CARACTERIZAÇÃO FUNCIONAL DE UMA

UNIVERSIDADE FEDERAL DE VIÇOSA
CARACTERIZAÇÃO FUNCIONAL DE UMA XILOGLUCANO
GALACTOSILTRANSFERASE DE Eucalyptus grandis E UMA
RAMNOSE SINTASE DE Arabidopsis thaliana: EFEITOS SOBRE A
ESTRUTURA E COMPOSIÇÃO DA PAREDE CELULAR
PRIMÁRIA
Francis Julio Fagundes Lopes
Doctor Scientiae
VIÇOSA
MINAS GERAIS – BRASIL
2008
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
FRANCIS JULIO FAGUNDES LOPES
CARACTERIZAÇÃO FUNCIONAL DE UMA XILOGLUCANO
GALACTOSILTRANSFERASE DE Eucalyptus grandis E UMA RAMNOSE
SINTASE DE Arabidopsis thaliana: EFEITOS SOBRE A ESTRUTURA E
COMPOSIÇÃO DA PAREDE CELULAR PRIMÁRIA
Tese apresentada à Universidade Federal de
Viçosa, como parte das exigências do Programa
de Pós-Graduação em Fisiologia Vegetal, para a
obtenção do título de “Doctor Scientiae”
VIÇOSA
MINAS GERAIS – BRASIL
2008
Co-orientadora
Co-orientador
Ao grande tesouro da minha vida,
Minha Mãe,
Dedico!
ii
AGRADECIMENTOS
À Universidade Federal de Viçosa, pelas oportunidades e pela tradicional
excelência na formação de pessoas.
Ao CNPq, pelo incentivo à pesquisa no Brasil e, particularmente, pelo
financiamento das atividades que envolveram o desenvolvimento desta Tese.
Ao Professor Marcelo Ehlers Loureiro, pelo apoio e orientação durante o
desenvolvimento deste trabalho, bem como pelo incentivo à participação em outros
projetos.
Ao Professor Sérgio H. Brommonschenkel, pelo apoio com o seqüenciamento do
gene EgMUR3.
Ich danke insbesondere Dr. Prof. Markus Pauly, der mir mit seiner
hervorragenden Betreuung, die Durchführung der Transformations und zell-WandExperimenten in seiner Arbeitsgruppe in Max-Planck Institut unterstütz hat.
Auβerdem, möchte ich mich bei Norma, für die Hilfe mit molekularbiologischen
Methoden, und bei Lutz, Peter und Katrin für die Durchführung von zell-Wand
analytischen Methoden, bedanken. Meine Danksagung gilt auch der ganzer „grünner
Mannschaft“ für die hilfereiche Pflege meiner Pflanzen.
Ich möchte mich auch insbesondere bei Duha bedanken, für unsere
Freundschaft, die sehr, sehr, sehr...also, unermesslich, wichtig für mich war.
Bei dem DAAD (Deutscher Akademischer Austauschdienst) möchte ich mich
ganz besonders bedanken nicht nur für die Deutsch Kurs, sondern auch für die
ausgezeichnet Austauschdienst und kulturellen Veranstaltungen angebieten.
À amiga Camila Caldana, pela companhia diária e pelo carinho durante minha
estadia no MPI.
Aos amigos do curso de Alemão em Leipzig, pelo apoio e amizade durante o
período de adaptação na Alemanha.
À minha mãe e à minha irmã pelo carinho e apoio ao longo da realização deste
trabalho.
A Deus pelas oportunidades providenciadas, saúde e força para continuar.
A todos aqueles que de alguma forma contribuíram para a realização deste
trabalho.
iii
BIOGRAFIA
Francis Julio Fagundes Lopes, filho de Antônio Lopes Pinto e de Amélia de
Campos Lopes, nasceu em 28 de Setembro de 1977, em Ipatinga (Vale do Aço), Minas
Gerais.
Em Fevereiro de 1997, ingressou no curso de Ciências Biológicas da
Universidade Federal de Viçosa (UFV), graduando-se com Votos de Louvor por bom
desempenho acadêmico, como Bacharel e Licenciado, em Agosto de 2001.
Obteve o título de Mestre em Microbiologia Agrícola, na mesma Instituição, em
Agosto de 2003. Em Abril de 2004, iniciou o Doutoramento em Fisiologia Vegetal
(UFV), com Doutorado Sanduíche no Instituto Max-Planck para Fisiologia Molecular
de Plantas (Alemanha, 2006 a 2007), defendendo Tese em Fevereiro de 2008.
iv
RESUMO
LOPES, Francis Julio Fagundes, D.Sc., Universidade Federal de Viçosa, Fevereiro de
2008. Caracterização funcional de uma xiloglucano galactosiltransferase de
Eucalyptus grandis e uma ramnose sintase de Arabidopsis thaliana: Efeitos sobre a
estrutura e composição da parede celular primária. Orientador: Marcelo Ehlers
Loureiro. Co-orientadores: Andréa Miyasaka de Almeida, Sérgio Hermínio
Brommonschenkel e Nairam Félix de Barros.
A parede celular vegetal tem sido associada a várias funções biológicas
importantes. Ela delimita o corpo da planta, protegendo-o contra injúrias mecânicas,
estresses bióticos e abióticos. Além disso, a parede celular determina a forma e as taxas
de crescimento celular. Os principais constituintes da parede celular vegetal são:
celulose, hemicelulose, pectina, lignina e proteínas, os quais variam de acordo com o
tipo celular, idade e condições do ambiente.
Para avaliar o impacto de genes envolvidos no metabolismo da parede celular,
uma estratégia comum consiste em super-expressar ou silenciar genes candidatos em
plantas modelo ou na espécie de interesse. Em seguida, analisa-se a parede celular para
se determinar o impacto da manipulação gênica sobre os constituintes da parede celular.
O objetivo deste trabalho foi caracterizar funcionalmente genes de Eucalyptus
grandis e Arabidopsis thaliana envolvidos no metabolismo de parede celular. No
primeiro capítulo, a clonagem e a caracterização de um gene que codifica uma
xiloglucano galactosiltransferase de E. grandis (EgMUR3
ABSTRACT
LOPES, Francis Julio Fagundes, D.Sc., Universidade Federal de Viçosa, February 2008.
Functional characterization of a xyloglucan galactosyltransferase of Eucalyptus
grandis and a rhamnose synthase of Arabidopsis thaliana: Effects upon the
structure and composition of the primary cell wall. Adviser: Marcelo Ehlers
Loureiro. Co-advisers: Andréa Miyasaka de Almeida, Sérgio Hermínio
Brommonschenkel and Nairam Félix de Barros.
The plant cell wall has been associated with several important biological
functions. It surrounds the plant, protecting it against mechanical injuries, biotic and
abiotic stresses. In addition, plant cell walls determine cell shape and growth rates. The
main constituents of plant cell walls are: cellulose, hemicellulose, pectine, lignin and
proteins, which vary according to cell type, age and environmental conditions.
To evaluate the impact of genes involved in cell wall metabolism, a common
strategy consists in overexpressing or silencing candidate genes in plant models or in
the species of interest. Afterwards, a cell wall analysis is performed to determine the
impact of the gene manipulation in the cell wall constituents.
The aim of this work was to functionally characterize genes from Eucalyptus
grandis and Arabidopsis thaliana involved in cell wall metabolism. In the first chapter,
the cloning and characterization of a xyloglucan galactosyltransferase gene of E.
grandis (EgMUR3) is described. The gene successfully complemented the mur3
mutation in A. thaliana, restoring the missing galactosylation and fucosylation in the
xyloglucan component of mur3 mutant. In the second chapter, the gene UER1 encoding
a bifunctional enzyme (3, 5-epimerase and 4-keto reductase) was shown to be required
for the normal pollen grain development in A. thaliana. UER1 exhibits high degree of
homology with RHM (rhamnose synthase) genes, and therefore, the content of pectic
compounds was investigated in pollen grains from UER1/uer1 heterozygotes.
Cytochemical analysis showed a reduction of pectic compounds in uer1 pollen. Mutant
pollens also exhibited an altered morphology and were unviable, suggesting that UER1
plays an important role in pollen grain development in A. thaliana. Two models are
proposed to explain why uer1 mutant pollen grains become unviable during the pollen
grain development in A. thaliana.
vi
GENERAL INTRODUCTION
The plant cell wall
Cell wall is associated with many important biological processes including
control of plant development, cell shape determination and tolerance to biotic and
abiotic stresses (Pilling and Hofte, 2003). Since plants are sessile organisms, cell wall
provides, to a certain extent, a buffered microenvironment controlling porosity and
therefore, the transport of solutes into the cell, keeping the hydration and mineral
homeostasis, which are important for plant development.
Cell wall forms a continuum around the plant body. In every tissue it has to meet
the needs for a particular function. Therefore, cells must be under a very precise control
to synthesize cell wall with the right properties to match the exact tissues needs. The
cell wall properties are controlled by the cell by changing the abundance and type or
specific cell wall constituents. The plant, in a not completely understood mechanism,
“senses” the extracellular signals and control the activity of the genes involved in cell
wall biosynthesis, such as those encoding synthases, transferases, glucanases, extensins,
expansins, just to mention a few, which act upon macromolecular wall constituents
(cellulose, hemicellulose, pectin and lignin) or their building blocks (nucleotide-sugars
and monolignols). In Arabidopsis, about 15% of genome is dedicated to cell wall
biogenesis and remodeling (Carpita & McCann, 2002).
Growing plant cells deliver cell wall material first into the apoplast space, the
principal communication interface with the surrounding environment. The first cell wall
layer deposited is the middle lamella. The middle lamella is found between adjacent
cells where their primary walls come into contact (Figure 1). It is synthesized during
cell division in the cell plate. Its composition differs from the rest of the wall in a
manner that it is rich in pectin and contains proteins not found elsewhere.
Plant cell wall can be functionally and anatomically distinguished in primary and
secondary wall. Primary cell wall is built basically of a cellulose-xyloglucan network
embedded in a hemicellulosic/pectic matrix containing proteins (Figure 2), while
secondary wall shows highly organized crystalline-cellulose microfibrils embedded in a
lignin/hemicellulosic matrix network (Figure 3).
1
Figure 1 – Ultra-structure of primary cell wall. Middle lamella contacts recently deposited
primary cell walls. In young tissues, abundant pectin can be found filling corner spaces. In:
Buchanan, 2001.
Figure 2 – Scheme of pea primary cell wall (Talbot & Ray, 1992).
2
Figure 3 – Structure of secondary cell wall. In tissues undergoing secondary growth,
secondary cell wall (S1, S2 and S3 layers) is deposited between primary cell wall (cw1) and
plasma membrane. Cellulose microfibrils are deposited in different orientations, giving rise
to the pattern observed in layers S1, S2 and S3. In: Buchanan, 2001.
3
Only a little of protein and pectin is found in secondary walls. Primary walls are
extensible and surround growing cells in non-woody tissues. In contrast, the secondary
wall is stiff and constituted an important evolutionary step toward the land environment,
since it allowed the plants to withstand water deficit. Xylem cells, such as those found
in wood, have highly thickened cell walls that are strengthened and waterproofed by
lignin. Pectin (hydrophilic) is substituted by lignin (hydrophobic) in secondary walls of
woody plants.
In general, primary cell walls are constituted of five basic compounds: cellulose,
hemicellulose, pectins, lignin and proteins. Hemicelluloses and pectins are
polysaccharides composed of many different sugars like xylosyl-, glucosyl-, galactosyl-,
arabinosyl- or mannosyl-residues. Differences can be found in architecture and
composition of monocots and dicots primary cell walls, as well as within monocots. On
this basis, plant cell walls of dicots and noncommelinoid monocots are type I (Carpita
and Gibeaut, 1993) while commelinoid monocots have type II cell walls (Buckeridge et
al., 2004).
Eucalyptus wood shows in average, 46.6% cellulose and 21% hemicellulose.
Xylan is the most representative hemicellulosic fraction (10.8-13.2%). Uronic acids
such as galacturonic and glucuronic are common side-chains in xylan and account for 4
% of the total wood composition. These groups are particularly important in the
industrial pulping processes, since they consume alkali and affect the pulp yielding
(Gomide et al., 2005). In poplar wood, cellulose, xylan and lignin constitute about 4348, 18-28 and 19-21%, respectively, of total dry weight. In addition, glucomannan, a
hemicellulose component, corresponds to a small portion of about 5% of the wood
(Mellerowicz et al., 2001).
Cell wall constituents
Cellulose: confers stiffness to the wall, since the cellulose ribbons are closely
aligned and bound to each other (crystalline state). As a result, cellulose is a compound
that excludes water, and is relatively resistant to degradation.
Hemicelluloses: are flexible polysaccharides that interact with cellulose surface,
tethering the cellulose microfibrils and controlling cell wall expansion. It is a target of
many enzymes (expansins, endotransglycosylases and endoglucanases). Hemicellulose
is constituted of pentoses (arabinose and xylose) and hexoses (glucose, mannose,
4
galactose and a little of uronic acids). These sugar-constituents form the
macromolecular compounds: mannans, glucomannans, arabinans, xyloglucans and
xylans (arabinoxylan and o-acetyl-4-o- metylglucuronoxylan). The type and content of
hemicelluloses vary according to the specie, age, tissue and position in the plant.
Hemicellulose is a component that underwent remarkable modifications. In some plants,
cell wall has undergone structural adaptations to work as a storage tissue in the seeds,
giving support to the embryo development during germination (Buckeridge et al., 2000;
Buckeridge, 2006; Tine et al., 2006). In addition, primary wall hemicellulose is
considerably different of hemicellulose from woody tissues. Interestingly, few plant
fibrous materials existing in the nature that are not incrusted by lignin (cotton for
example) also do not have hemicellulose. Conversely, fibrous materials possessing
lignin also have hemicellulose (Gomide and Colodette, 2007). This suggests that
hemicellulose plays an important role in lignin incrustation.
Pectins: form a hydrated gel phase embedding the cellulose-hemicellulose
network. They help the cell wall to withstand high internal turgor pressure developed in
recently synthesized and actively expanding cells. Pectins in extracellular matrix
promote cell to cell adhesion and determine the porosity of cell wall to macromolecules.
Lignin: It is deposited in the cell wall after the other cell wall polysaccharides
were laid down. It provides rigidity, proof against water loss and resistance against
pathogen attacks. The lignin pathway is well understood (Boerjan et al., 2003) and
promising, concerning the potential for industrial applications, although details about
the control of its biosynthesis are still unknown.
Cell wall proteins: The roles of cell wall proteins are not completely understood.
They are thought to add mechanical strength to the wall and assist in the normal
assembly of other wall components. The most abundant proteins found in the cell wall
are those rich in hydroxyproline (Showalter, 1993). HRGPs (hydroxyproline-rich
glycoproteins) constitute a supergroup including PRPs/proline-rich proteins (Bernhardt
and Tierney, 2000), glycine-rich proteins (Sachetto-Martins et al., 2000) and
arabinogalactans/AGPs (Schultz et al., 2000). The content of hydroxyproline containing
proteins is increased short after attack of some plant pathogens, suggesting that HRGPs
(hydroxiproline rich glycoproteins, also called extensins) is involved in pathogen attack
responses (Esquerre-Tugaye et al., 1979). HRGPs act by strengthening the cell wall as it
has been demonstrated to agglutinate negatively charged cell wall surfaces and
molecules, including bacteria and fungi in incompatible plant-pathogen interactions
5
(Leach et al., 1982). Another class of proteins (wall-associated kinases or WAKs) is
composed by intrinsic membrane-bound proteins possessing an intracellular
serine/threonine kinase domain and an extracellular portion strongly associated with the
cell wall. The extracellular domain shows repetitive motifs homologous epidermic
growth factors of vertebrates, a class of proteins related to extracellular interactions
(Kohorn, 2001). The findings of cell wall-signaling proteins associations suggest that
plant cells might monitor environmental signals coming to cell wall.
Therefore, plant cell wall is to plants as the skin is to animals. Deciphering how
plant cell wall components interact, how they are synthesized and assembled and how
cell perceives stimuli leading to shifts in cell wall composition is a challenging field that
may prove to be important for manipulating plant characteristics.
6
REFERENCES
Bernhardt, C., and Tierney, M.L. (2000). Expression of AtPRP3, a proline-rich structural
cell wall protein from Arabidopsis, is regulated by cell-type-specific developmental
pathways involved in root hair formation. Plant Physiol 122, 705-714.
Boerjan, W., Ralph, J., and Baucher, M. (2003). Lignin biosynthesis. Annu Rev Plant Biol
54, 519-546.
Buckeridge, M.S. (2006). Implications of emergence, degeneracy and redundance for the
modeling of the plant cell wall. In The science and the lore of the plant cell wall, T.
Hayashi, ed, pp. 41-47.
Buckeridge, M.S., dos Santos, H.P., and Tine, M.A.S. (2000). Mobilisation of storage cell
wall polysaccharides in seeds. Plant Physiol Biochem 38, 141-156.
Buckeridge, M.S., Rayon, C., Urbanowicz, B., Tine, M.A.S., and Carpita, N.C. (2004).
Mixed linkage (1 -> 3),(1 -> 4)-beta-D-glucans of grasses. Cereal Chemistry 81,
115-127.
Carpita NC, Gibeaut DM (1993) Structural models of primary cell walls in flowering
plants: consistency of molecular structure with the physical properties of the walls
during growth. Plant J 3: 1-30
Carpita, N.C., and Mccann, M.C. (2002). The functions of cell wall polysaccharides in
composition and architecture revealed through mutations. Plant Soil 247: 71.
Esquerre-Tugaye, M.T., Lafitte, C., Mazau, D., Toppan, A., and Touze, A. (1979). Cell
Surfaces in Plant-Microorganism Interactions: II. Evidence for the Accumulation of
Hydroxyproline-rich Glycoproteins in the Cell Wall of Diseased Plants as a Defense
Mechanism. Plant Physiol 64, 320-326.
Gomide, J.L., Colodette, J.L., de Oliveira, R.C., and Silva, C.M. (2005). Caracterização
tecnológica, para produção de celulose, da nova geração de clones de Eucalyptus do
Brasil. Re. Árvore 29, 1-12.
Gomide, J.L., and Colodette, J.L. (2007). Qualidade da Madeira. In Biotecnologia Florestal,
A. Borém, ed (Viçosa: Gráfica UFV), pp. 25-54.
Kohorn, B.D. (2001). WAKs; cell wall associated kinases. Curr Opin Cell Biol 13, 529-533.
Leach, J.E., Cantrell, M.A., and Sequeira, L. (1982). Hydroxyproline-Rich Bacterial
Agglutinin from Potato : Extraction, Purification, and Characterization. Plant
Physiol 70, 1353-1358.
Mellerowicz, E.J., Baucher, M., Sundberg, B., and Boerjan, W. (2001). Unravelling cell
wall formation in the woody dicot stem. Plant Mol Biol 47, 239-274.
Pilling, E., and Hofte, H. (2003). Feedback from the wall. Curr Opin Plant Biol 6, 611-616.
Sachetto-Martins, G., Franco, L.O., and de Oliveira, D.E. (2000). Plant glycine-rich
proteins: a family or just proteins with a common motif? Biochim Biophys Acta
1492, 1-14.
Schultz, C.J., Johnson, K.L., Currie, G., and Bacic, A. (2000). The classical arabinogalactan
protein gene family of arabidopsis. Plant Cell 12, 1751-1768.
Showalter, A.M. (1993). Structure and function of plant cell wall proteins. Plant Cell 5, 923.
Talbott, L.D., and Ray, P.M. (1992). Changes in Molecular Size of Previously Deposited
and Newly Synthesized Pea Cell Wall Matrix Polysaccharides: Effects of Auxin and
Turgor. Plant Physiol 98, 369-379.
Tine, M.A.S., Silva, C.O., de Lima, D.U., Carpita, N.C., and Buckeridge, M.S. (2006). Fine
structure of a mixed-oligomer storage xyloglucan from seeds of Hymenaea
courbaril. Carbohydrate Polymers 66, 444-454.
7
Chapter 1
The Eucalyptus grandis EgMUR3 gene encodes a xyloglucan
galactosyltransferase that complements the mur3 mutation in
Arabidopsis thaliana
Francis Julio Fagundes Lopes1, Sérgio Hermínio Brommonshenkel2, Markus Pauly3,
Marcelo Ehlers Loureiro1.
1
Departamento de Biologia Vegetal, Universidade Federal de Viçosa, Viçosa, Brasil
2
Departamento de Fitopatologia, Universidade Federal de Viçosa, Viçosa, Brasil
3
Michigan State University, Michigan, USA
8
RESUMO
O xiloglucano (XyG) é o principal componente hemicelulósico encontrado na
parede primária das plantas superiores e consiste de um esqueleto básico de DGlcρ (Dglicopiranoses) ligadas covalentemente na configuração ß-1,4 e com vários substituintes
α-D-Xylρ (α-D-xilopiranoses) na posição O6. Propõe-se que XyG “amarre” as fibras de
celulose umas às outras conferindo força e rigidez à parede. Além disso, acredita-se que
XyG participe dos processos de relaxamento e expansão durante a remodelagem da
parede primária. Apesar do papel fundamental das hemiceluloses para o crescimento e
desenvolvimento da célula, pouco se conhece a respeito dos genes envolvidos nas vias
de biossíntese de XyG, bem como sua contribuição para a bioquímica da parede celular,
especialmente em plantas de importância econômica como o eucalipto.
Neste estudo, um gene de E. grandis (EgMUR3) que codifica para uma
xiloglucano galactosiltransferase, foi identificado e caracterizado. EgMUR3 representa
um quadro de leitura aberta de 1854 pb e codifica uma proteína putativa de 617
aminoácidos. EgMUR3 apresenta uma alta homologia de seqüência com o gene MUR3
de A. thaliana. O alinhamento global revelou uma identidade de 73% e uma
similaridade de 82% entre as duas proteínas. O alinhamento dos motivos exostosina
(família CAZy GT47) das duas proteínas mostrou uma identidade de 90% e uma
similaridade de 96%.
Para determinar se essa seqüência codificaria uma enzima funcional, a possível
ORF foi clonada no vetor de expressão binário pBinAr sob o controle do promotor
CaMV-35S, a construção foi transformada no mutante mur3 de A. thaliana e o estado
transgênico dos transformantes foi confirmado por meio de RT-PCR. A caracterização
do perfil dos oligossacarídeos de material de parede celular digerido com uma endo-1,4β-glucanase
confirmou
a
restauração
dos
padrões
específicos
de
galactosilação/fucosilação ausentes na estrutura do xiloglucano de mur3.
Os resultados apresentados confirmam que EgMUR3 representa uma
xiloglucano galactosiltransferase de E. grandis bioquimicamente funcional, que
reconhece substrato(s) intermediário(s) específico(s) das etapas de biossíntese do
xiloglucano em A. thaliana, sugerindo que parte dos aspectos do metabolismo do
xiloglucano seja conservada nas duas espécies.
9
ABSTRACT
Xyloglucan (XyG) is the major hemicellulosic compound found in the primary
cell wall of higher plants and consists of a 1,4-linked ß-DGlcρ backbone with several αD-Xylρ substituents at O6 position. It is believed that XyG tethers the cellulose
microfibrils to each other conferring rigidity and strength for maintenance of cell shape.
In addition, XyG is thought to play a role in cell wall relaxation and remodelling during
plant growth. Despite the importance of hemicelluloses, little is known about genes
involved in XyG relevant pathways and their contributions to the cell wall biochemistry,
especially in economical important trees such as Eucalypts.
In this study we have identified and characterized an Eucalyptus grandis gene
(EgMUR3), which showed a high degree of sequence homology with the MUR3 gene
(xyloglucan-galactosyltransferase) of Arabidopsis thaliana. EgMUR3 is an intronless
sequence of 1854 bp predicted to encode a protein of 617 amino acid residues. It
exhibits 73% identity and 82% similarity to the A. thaliana MUR3 gene. Local
alignment within the exostosin motifs (GT47 family signature) of A. thaliana and E.
grandis genes revealed an even higher degree of homology, 90% identity and 96%
similarity.
To determine whether this sequence encoded a functional enzyme, the putative
ORF was cloned into the pBinAr vector under the control of the strong and constitutive
CaMV-35S promoter. The construction was then used to transform A. thaliana mur3
mutant line, kanamycin-resistant plants were selected and the expression of the
transgene confirmed by RT-PCR. Oligosaccharide fingerprinting of cell wall material
from transformed plants digested with a specific endo-1,4-β-glucanase confirmed the
full restoration of the missing galactosylation/fucosylation pattern in the structure of
mur3 xyloglucan.
The results here presented confirmed that EgMUR3 represents a biochemically
functional xyloglucan galactosyltransferase of E. grandis acting upon intermediate
substrate(s) in the xyloglucan biosynthesis pathway in A. thaliana, suggesting that
xyloglucan metabolism is in part, conserved in both species.
10
1. INTRODUCTION
1.1 Eucalypts
The genus Eucalyptus (Myrtaceae) contains more than 700 species and
constitutes an economically important tree (Brooker, 2000). They are known for their
fast growth rates, tolerance to different soil and climate conditions and outstanding
wood quality for different purposes, especially pulp and paper production.
Characteristics such as high annual biomass increments and short rotation management
place this species among the most planted woody species in the world. Moreover,
Eucalyptus wood shows valuable traits such as high quality fibers and high yields in
pulping processes.
FAO (Food and agriculture organization) estimates for 2030 a global increase of
wood consumption around 60% over current levels, including paper and its derivative
products. Part of this increase will be due to the expansion of emergent economies
(http://www.global21.com.br/informessetoriais/setor.asp?cod=9). Despite the great
economical importance of Eucalyptus spp for global economy, relatively little is known
about wood formation in Eucalyptus spp. and other tree species.
1.2 Tree genomics
Wood tree genomics has been boosted in the last decades due to the completion
of the genome sequence of A. thaliana, physical mappings and the increasing number of
ESTs from important species showing secondary growth such as Populus spp
(Hertzberg et al., 2001; Sterky et al., 2004; Kelleher et al., 2007) and Pinus taeda
(Allona et al., 1998; Pavy et al., 2005) available in public databases. Those data are
allowing comparisons and integration of genomes, speeding up the discovery of genes
controlling many aspects of metabolism, particularly those involved in plant cell wall
metabolism. However, for Eucalyptus spp, relatively few works on functional genomics
were published to date (Paux et al., 2005; Poke et al., 2005; Foucart et al., 2006).
In Brazil, two large-scale eucalypt genome projects were started in 2001 and
2002: the ForEST project and the Genolyptus project, respectively (Grattapaglia, 2004).
In the Genolyptus project, more than 20.000 unigenes were generated, including ESTs
from E. urophyla, E. grandis and E. globulus flowers, xylem and phloem. Few years
later (2006) it was announced that Genolyptus would integrate the International
initiative for the full sequencing of E. grandis genome to be performed by DOE JGI. In
11
2008, the genome sequencing has started and the data being generated are expected to
contribute significantly for exploration of green energy possibilities and unraveling the
role
of
genes
involved
in
wood
formation
(http://www.jgi.doe.gov/News/news_6_8_07.html).
1.3 The cellulose-xyloglucan network in primary cell wall
In the primary wall of dicots and non-graminaceous monocots, the most
abundant hemicellulose is xyloglucan (XyG). It may account for up to 20% of the dry
weight of the primary wall (Mcneil et al., 1984). Its backbone is composed of 1,4-linked
β-D-Glcρ residues. Up to 75% of these residues are substituted at O-6 position with
mono-, di-, or triglycosyl side chains containing xylose, galactose and often, fucose.
Primary wall xyloglucans are typically fucosylated, but those in storage walls are not.
A consistent nomenclature for describing XyG structures was developed (Fry et
al., 1993). According to this nomenclature, a single-letter code is assigned to the
terminal glucosyl residue attached to each xylosyl residue in the xyloglucan backbone
(Figure 4A and B).
There are some taxonomic variation concerning xyloglucan composition and
configurations, for instance, solanaceous show arabinose as substituent in the side
groups, but not galactose or fucose (Figure 4A). Hemicellulose fractions may also
contain other polysaccharides, for example, glucuronoarabinoxylans (Buckeridge et al.,
2004) and glucomannans, depending on the developmental state of tissue or plant
species.
The cellulose-xyloglucan network is believed to be the major load-bearing
structure in the primary wall. Xyloglucan coats the surface of the cellulose microfibrils,
limiting their aggregation and connecting them via tethers that directly or indirectly
regulate the mechanical properties of the wall. These properties have been studied by
chemical methods, which also have shown that three fractions of xyloglucan can be
found associated to cellulose microfibrils in the primary cell wall (Pauly et al., 1999a).
It has also been suggested that XyG is composed of different molecular domains
possessing distinct chemical identities affecting the local properties in XyG (an
interesting discussion can be found in Tine et al., 2006). As a consequence, the diversity
of structures found in different organs or cell wall domains allows XyG to accomplish
with certain functional roles. For instance, the distribution of galactosylation might
affect the solubility of XyG, and consequently, the loss of galactosyl residues decreases
12
the solubility of XyG in aqueous solution. The X-L motif is thought to contact the
cellulose microfibrils (de Lima and Buckeridge, 2001). These authors observed that
there might be certain XyG galactosyl substitutions that affect its affinity for cellulose.
Furthermore, fucose residues are thought to flatten the XyG backbone, allowing a better
interaction with cellulose microfibrils (Levy et al., 1997).
To date, only a few genes have been assigned to participate in xyloglucan
biosynthesis (Figure 5).
13
A
B
Figure 4 – General structure of XyG with its correspondent single-letter code (A and B).
Xyloglucan oligosaccharides (XyGOs) shown represent moieties released after digestion with
a xyloglucan specific endoglucanase (B). Single-letter code is given for each terminal sugar
residue below each substituted β-D-glucosyl residue in the XyG core (Fry et al., 1993).
14
Figure 5 – Genes participating in the biosynthesis of XyG. Except for MUR3, most of the genes
indicated had its biochemical activity shown in yeast or in in vitro assays.
15
1.4 Cell wall mutants
Cell wall mutants allow the comprehension of how cell wall components are
synthesized and how they influence cell wall properties. During the last years, the
analysis of the composition and structure of cell wall components identified a number of
mutations in cell wall architecture and composition (Table 1). The first and best-known
large screening for cell wall mutants was conducted by Reiter and colleagues (Reiter,
1998, Reiter et al., 1997). Among 5200 plants analyzed for monosaccharide
composition, 23 mutant lines were identified to carry mutations that altered their sugar
composition. Afterwards, 11 different loci were identified and designated as mur1 to
mur11. Three types of cell wall modifications were observed: (1) complete absence of
one monosaccharide, (2) reduction of content and (3) complex alterations in several
monosaccharide relative contents. Mutants exhibiting a decrease in fucose were
represented by mur2 and mur3, in arabinose by mur4, mur5, mur6 and mur7, in
rhamnose by mur8 and mutants showing complexes changes were represented by mur9,
mur10 and mur11.
To date, only a few of those genes were cloned and the enzymes were
biochemically characterized. For instance, mapping of mur1 mutation led to the
identification of a 4,6-dehydrase which converts GDP-manose to GDP-fucose (Bonin et
al., 1997).
1.5 The MUR3/KATAMARI 1 gene
The effects of mur3 mutation in A. thaliana were independently characterized
and reported by Madson et al. (2003) and Tamura et al. (2005). In the former, amino
acid
substitutions
within
the
exostosin
domain
abolished
the
xyloglucan
galactosyltransferase activity causing a loss of fucosylation and galactosylation in major
plant organs. In the later, a stop codon created after the transmembrane domain (TMD)
originated a truncated protein, which caused complete disorganization of the
endomembrane system, i.e., the collapse of vacuoles, ER, and Golgi stacks.
Cell wall analysis of mur3 lines revealed a drastic modification of the
xyloglucan (XyG) component, despite the fact that mur3 was not phenotypically
distinguishable from with wild type Col-0 (Reiter et al., 1997). Further, cell wall
analysis revealed a reduction of more than 90% in fucose content in 4M KOH fraction
of mur3 cell wall. Besides reduction of fucose, there was also a significant reduction of
galactose contents in both 1M KOH and 4M KOH fractions. More detailed analysis then
16
showed that MUR3 enzyme is a galactosyltransferase enzyme which adds galactose to
the third xylose residue in the XXXG core of XyG (Madson et al., 2003). A possible
effect of those alterations was the loss of tensile strength of dark grown hypocotyls
(Pena et al., 2004).
MUR3 is expressed throughout the plant (Figure 6), markedly in tissues where
reorganization of primary cell wall due to cell expansion might be intensively occurring,
such as apical part of inflorescence stem, developing siliques, expanding primary leaves
in seedlings and root apical meristem (Madson et al., 2003).
A
eFP database
B
Genevestigator database
Figure 6 - Expression pattern of MUR3 during the development of A. thaliana (A) and stress
responses (B). MUR3 is expressed throughout the plant, being considerably up-regulated in
actively expanding young tissues and under cold stress. Expression data obtained from
Genevestigator database.
17
Table 1 – Mutants and genes described for GTs.
Loci
NC
At2g03220
At2g20370
At1g30620
NC
NC
NC
NC
NC
AT5G17420
NC
AB128823
Mutants
mur1 - Absence of fucose. Plants show reduced
growth, inflorescence stems show brittleness
AtFUT1/MUR2 - Shows reduced fucose levels.
mur3 - Reduced fucose due to lack of
galactosylation on the third xylosyl residue from
the non reducing end and over galactosylation on
the second residue.
katamary – Disorganization of endomembrane
system. Dwarf growth due to cell failure in
elongating
mur4 – Reduced arabinose
hsr8 – High sugar response 8 mutant shows altered
sugar contents in response to light/dark stimuli
mur5 - Reduced arabinose.
mur6 - Reduced arabinose.
mur7 - Reduced arabinose.
mur8 - Reduced rhamnose.
mur9 - Reduced fucose and xylose
mur10/irx3 - Reduced fucose, increased arabinose,
reduced xylose
mur11 - Reduced rhamnose, reduced fucose,
reduced xylose, increased manose
NpGUT1 – mutant lost the ability to form tight
intercellular attachments
and adventitious shoots
At3g25140
qua1 – Decrease of 25% in galacturonic acid
content of cell wall but neutral sugars. Decrease on
homogalacturonan components as confirmed by
JIM5/JIM7 labeling.
At1g75120
rra1 – Reduction in residual insoluble arabinose
Functions
ND
CAZy family
ND
Galactoside 2-α-L-fucosyltransferase
Xyloglucan galactosyltransferase
GT37
GT47
References
(Reiter et al., 1997)
(Bonin et al., 1997)
(Reiter et al., 1997)
(Reiter et al., 1997)
(Madson et al., 2003)
Element for endomembrane system organization
(Tamura et al., 2005)
UDP-arabinose 4-epimerase activity
ND
(Reiter et al., 1997)
(Li et al., 2007)
ND
ND
ND
ND
ND
CELLULOSE SYNTHASE CATALYTIC
SUBUNIT
ND
ND
ND
ND
ND
(Reiter et al., 1997)
(Reiter et al., 1997)
(Reiter et al., 1997)
(Reiter et al., 1997)
(Reiter et al., 1997)
(Reiter et al., 1997)
(Bosca et al., 2006)
(Reiter et al., 1997)
Pectin-glucuronyltransferase gene of Nicotiana
plumbaginifolia
GT47
(Iwai et al., 2002)
alpha-1,4- D-galacturonosyltransferase and beta1,4- D-xylan synthase activities. It has a function
on development of vascular tissue, in rapidly
elongating inflorescence stems and
pectin/hemicellulose cell wall synthesis
Putative galactosyl/arabinosyltransferase.
GT8
(Bouton et al., 2002)
GT77
(Egelund et al., 2007)
18
At2g28110
ABI64067/
PoGT47
AF223643
content fraction that is strongly bound to primary
wall in meristematic region
fra8 – Fragile fiber 8 mutation causes reduction of
xylose content in primary and secondary xylem and
reduction of vessel thickness.
NM
PsFuT1
AJ245478
At3g62720
NM
AtXT1
At4g02500
AtXT2
Involved in synthesis of glucuronoxylan during
secondary wall synthesis
GT47
(Zhong et al., 2005)
The poplar gene that complements the fra8
mutation in A. thaliana
α-1,2-fucosyltransferase from Pisum sativum that
catalyzes the last step on cell wall xyloglucan
Fenugreek α-1,6-galactosyltransferase
Xyloglucan xylosyltransferase involved in the
formation of the core xyloglucan
Xyloglucan xylosyltransferase involved in the
formation of the core xyloglucan
GT47
(Zhou et al., 2006)
GT37
(Faik et al., 2000)
GT34
GT34
(Edwards et al., 1999)
(Faik et al., 2002)
GT34
(Cavalier and Keegstra, 2006)
NC – Not characterized at molecular level
ND – Not defined
NM – No mutants available
19
In addition to its biochemical activity as a xyloglucan galactosyltransferase,
MUR3/KATAMARI 1 was also shown to be important for the organization of
endomembranes in the plant cell (Tamura et al., 2005). Katamary1 mutants exhibited
collapsed Golgi and vacuoles, dwarf growth caused by abnormal shape of epidermic
cells and loss of elongating properties as well. In the same work, the authors colocalized MUR3 to Golgi compartment.
In another study, mur3, mur4/hsr8 and mur1 mutants showed altered responses
to light and high sugar concentration (Li et al., 2007). Dark-grown mur3 seedlings
showed increased response to low glucose concentration on media, as did hsr8 mutants
(High Sugar Response). This response is characterized by the ability of developing
vegetative organs and reduced hypocotyl elongation in low glucose concentrations not
withstood by WT plants. This type of control seems to allow the cell to properly funnel
the sugar metabolism in certain directions according to the current plant needs. This
study confirmed that cell wall sugar status is monitored by the cell, which responds
through not completely understood mechanisms at transcriptional level and at
modulation of cell wall enzymes.
1.6 OLIMP – Oligosaccharide mass profiling
Determination of structure and function of carbohydrates is particularly difficult
since carbohydrate biosynthesis is not a primer-driven process such DNA replication,
RNA transcription or protein translation. It is an enzyme driven process that takes place
in many cellular compartments. Only recently it has started to be unraveled thanks to
the advent of a wide variety of analytical and biochemical technologies (Raman et al.,
2005). Besides the difficulties faced with the interpretation of glycan structures, a single
method is never completely conclusive to make a statement about the structure of a
certain sugar compound.
Analytical methods for investigation of cell wall composition and structure must
be preferably sensitive, fast and informative. Such a method can be represented by
OLIMP (Oligosaccharide Mass Profiling, Figure 7). This method consists of enzymatic
solubilization of oligosaccharides from specific cell wall components followed by the
analysis of the mass profile generated by MALDI-TOF MS (Matrix Assisted Laser
Desorption Ionization Time of Fly). The outcoming spectrum refers to the signal
generated and detected for each oligosaccharide present in the sample (Wang et al.,
1999).
20
As this method does not involve strong alkali/acid treatment or sample
derivatization, some substituents such as acetyl groups are preserved and can be
successfully detected. This is also a very rapid and efficient method for screening of
mutants with altered cell wall composition (Lerouxel et al., 2002).
Like any other method, such approach has some limitations. Sugar
configuration, glycosidic linkage and structural isomers can not be predicted. On the
other hand, the method is very useful for the rapid fingerprinting of some cell wall
components and alterations due to mutations (Lerouxel et al., 2002) or natural variations
(Obel et al., 2006), provided that the enzyme cleaving the component is available and
the mass/charge signals produced by the released oligosaccharides are feasible to be
deduced.
Figure 7 – Scheme of OLIMP (Oligosaccharide Mass Profiling). XEG (xyloglucan-specific
endo- β-1,4- glucanase) acts upon the non-substituted glucose. Most of released xyloglucan
oligosaccharides consist of a cellotetraose backbone.
21
1.7 Arabidopsis thaliana as a tool for studying gene function
A. thaliana is an useful tool for the study of genes from other plant species,
especially those whose genetic transformation is troublesome. Transformation protocols
for A. thaliana are well established, events can be recovered at high rates, the effects of
the transgene expression can be rapidly scored and full genome sequence is publicly
available. In poplar, a glycosyltransferase (PoGT47C) involved in xylan biosynthesis
could be successfully characterized by its transgenic expression in the fra8 mutant of A.
thaliana (Zhou et al., 2006). In another study, the constitutive expression of a poplar
cellulase (PaPopCel1) in A. thaliana resulted in enhanced growth of rosette leaves (Park
et al., 2003).
In this study we could show that the Eucalyptus grandis EgMUR3 gene is a
functional ortholog of the A. thaliana MUR3 gene. We expressed EgMUR3 in A. thaliana
mur3 mutant and analyzed the xyloglucan structure of cell wall material from EgMUR3
transgenic Arabidopsis plants by MALDI-TOF MS. The restoration of fucosylation and
galactosylation patterns missing in mur3 xyloglucan showed that EgMUR3 is an ortholog of
the A. thaliana MUR3 gene. This suggests an evolutionary conservation of some aspects of
the xyloglucan biosynthesis pathway in both plants.
Aim of this work
Investigate the function of a putative MUR3-ortholog gene of E. grandis by
functional complementation of the correspondent A. thaliana mutant (mur3) and cell
wall analysis of the transgene-expressing plants by oligosaccharide profiling through
MALDI-TOF MS.
22
2. MATERIAL AND METHODS
2.1 Plant lines and growth conditions
Arabidopsis thaliana Ecotype Columbia (Col-0) and mur3 mutant line were
obtained from Max-Planck Institute for Molecular Plant Physiology’s collection.
Plants were kept in greenhouse until seed harvesting. After setting the first
siliques, the inflorescences were bagged to avoid dispersion and loss of seeds. The
following temperature/humidity growth parameters were used: from 6h to 22 h,
20°C/80%, from 22h to 6h, 18°C/50%. Light intensity was 120 mmol.m-2.s-1.
In order to select for transgenic plants, a cold treatment for breaking seed
dormancy was applied by incubating the plates containing infiltrated seeds at 4°C in
darkness for 48 h. Plates were then taken to long-day phytotron chamber at 22°C under
16 h/8 h (light/dark) alternating cycles, 120 mmol.m-2.s-1 light intensity and 60%
humidity. Plates were kept in long day phytotron until transformants could be detected.
Afterwards, plants were transferred to pots containing soil and kept in “short-day”
chamber (8 h light/16 h dark at 22°C, under 120 mmol.m-2.s-1 light intensity and 60%
humidity). Plants were maintained for 3 weeks in short-day condition to produce leaf
material for RNA and cell wall analysis, and afterwards were transferred to greenhouse
for seed production.
2.2 Cloning of EgMUR3
The EUGR_SG_006 subclone library consisting of pSPORT plasmids carrying
~1.5-kb E. grandis genomic fragments represents an E. grandis genomic fragment of
~180-kb. The large-scale sequencing of the EUGR_SG_006 subclone library was
performed, since the BAC clone (87E04) carrying the respective genomic fragment was
previously shown through PCR-based screenings (primers were designed according to
information obtained from the E. grandis ESTs library of Genolyptus project) to contain
putative genes of interest (data not shown). The E. grandis BAC library and the
EUGR_SG_006
subclone
library
are
maintained
in
the
Genomics
Lab
(BIOAGRO/UFV, Brazil), under the supervision of Prof. Sergio H. Brommonshenkel.
The large scale sequencing of EUGR_SG_006 library was performed with the
primers T3 and T7, which border the pSPORT cloning site, where the E. grandis
genomic fragments were subcloned. Raw data was obtained by sequencing
minipreparations plates from the EUGR_SG_006 subclone library, in a MegaBACE
23
sequencer. The raw data was converted to FASTA query sequences and submitted in
batches to BLAST. Sequences of interest were filtered out for clones showing
homology with genes of interest. The sequences generated by the high-scale sequencing
revealed tags showing high sequence similarity to the A. thaliana MUR3 gene. Key
subclones showing homology of sequence with the A. thaliana MUR3 gene were
identified, isolated, fully sequenced and the contigs were mounted.
A final contig of 4.6 kb was analyzed by GENSCAN at the New GENSCAN
server (http://genes.mit.edu/GENSCAN.html) in order to determine the EgMUR3
genomic sequence. Sequences obtained were processed and edited for vector
contamination, quality (PHRED >20) and contigs assembled using CodonCode
Aligner®,
which
integrates
tools
such
as
(PHRED,
PHRAP,
CONSED,
CROSS_MATCH) for sequence processing.
Alignment
analysis
was
performed
with
ClustalW
(http://www.ebi.ac.uk/Tools/clustalw2/index.html) and box shading edition with
GeneDoc (Nicholas & Nicholas, 1997).
2.3 Plasmids and plant transformation
Specific
primers
GGTACCATGAGACGCCGTTCGTCGGCGA
(egmur3_kpn_for
and
egmur3_sal_rev
GTCGACTCATGACTGGTCTCTCTGCTCGTT) were used to amplify the full-length
genomic sequence of EgMUR3 from the BAC clone 87E04 (~180 Kb). A high fidelity
PCR with Pfu Turbo DNA polimerase (Invitrogen) was then conducted according to the
manufacture’s recommendations. For the PCR, about 20 ng of DNA from the BAC
87E04 were used as template. Cycling conditions was as follow: 1) 95°C /5 min; 2)
95°C /45 sec; 3) 65 °C (-1°C/cycle)/45 sec ; 4) 72 °C /4 min; 5) Go to step 2, 10x.; 6)
95°C /45 sec; 7) 56°C /45 sec; 8) 72°C /4 min; 9) Go to step 7, 25x; 10) 72°C /10 min.
After step 9, the termocycler was paused and 0.5 µl of Taq DNA polymerase were
added.
The PCR product was directly used in a pCR®II-TOPO® cloning reaction
(Invitrogen) according to manufacturer’s instructions. The ligation product was then
transformed into one-shot competent bacteria (Invitrogen). To confirm the cloning,
plasmid DNA was extracted from 5 clones by alkaline lysis method (Sambrock &
Russel, 2001) and analyzed by digestion with XbaI (cuts once in pCR®II-TOPO®EgMUR3). A positive clone with the expected band sizes was picked, the plasmid was
24
extracted and its insert fully sequenced with egmur3_kpn_for and egmur3_sal_rev
primers to confirm whether any mutation was introduced during the amplification of
EgMUR3 with the Pfu DNA polymerase.
The plasmid pCR®II-TOPO®-EgMUR3 was then cutted with KpnI and SalI
restriction enzymes. The 1.8-kb band corresponding to the EgMUR3 ORF was gelpurified using the Nucleospin Extract II kit (Machery-Nagel) and ligated into the KpnISalI restriction sites in pBinAr (Hofgen and Willmitzer, 1990). Plasmid pBinAr is a
pBIN19 derivative (Bevan, 1984) in which an expression cassete for plants containing
the 35S promoter from the cauli-flower mosaic virus (CAMV) was inserted.
The pBinAr-EgMUR3 construct (Figure 8) was transformed into E. coli
competent cells and resistant clones growing on selective LB kan media were picked for
plasmid DNA extractions. Afterwards, pBinAr-EgMUR3 construct was transformed
into A. tumefaciens strain GV 3101 (pMP90) by electroporation (Mersereau et al.,
1990), plasmid DNA was extracted from the transformed A. tumefaciens and amplified
with the primers egmur3_kpn_for and egmur3_sal_rev to confirm the pBinAr-EgMUR3
vector. Also, cutting the isolated vector with BamHI, which has three restriction sites in
the insert and none in the vector confirmed the transformation of pBinAr-EgMUR3 into
A. tumefaciens clones (Figure 9).
Transformation of pBinAr-EgMUR3 and empty vector (pBinAr) into A. thaliana
mur3 mutant was performed by Agrobacterium tumefasciens-mediated transformation
(Bechtold and Pelletier, 1998; Clough and Bent, 1998). In order to select for transgenic
plants, infiltrated seeds were sterilized and placed on AMOZ media [11.0 g.L-1 MS
medium, 2.5 g.L-1 MES (2-N-Morfolino-ethanosulfonic acid), 7 g.L-1 bacto-agar, pH
5.7] plus 1% (w/v) sucrose, 50 µg.mL-1 kanamycin, 250 µg.ml-1 β-bactyl. Growth
conditions were as described in topic 2.1.
25
HindIII
SalI
EcoRI
HindIII
KpnI
Figure 8 - The pBinAr-EgMUR3 transformation vector carrying the E grandis EgMUR3 gene is
based on pBinAr backbone. Enzymes cutting once are indicated.
Atum 2
13 kb__
203
336
1758
1,5 kb__
pBinAr-EgMUR3
Atum 3
Atum 4
2.4 Confirmation of transgenic state of transformant plants by RT-PCR
Total RNA was extracted from leaf material of 5-week-old plants. A whole leaf
was transferred to a 2 mL microtube and frozen in liquid nitrogen. Grinding was
performed in a MM 200 Retschmill equipment (Retsch®) in a frequency of 25 Hz for 1
minute. RNA was extracted with RNeasy Plant Mini Kit (Qiagen). For DNA digestion,
samples were treated with DNAse from Ambion® (DNA-free™ DNAse Treatment &
Removal Reagents) for removing of contaminant DNA. The cDNA synthesis was
performed with a kit from Bioline USA Inc. using the Bioscript reverse transcriptase.
All procedures were according to manufacturer’s recommendations.
The expression of EgMUR3 message was checked by PCR using the synthesized
cDNA library as template and the following specific primers amplifying the EgMUR3
gene:
egmur3RT_for
CCATTGCGGTTAGGACTGAG;
egmur3RT_rev
TGCTCTTAGTTCCCACCACTT. As internal control, the APT gene (adenine
phosphoribosyltransferase 1, At1g27450) was amplified, using the following primers:
APT_for TCCCAGAATCGCTAAGATTGCC; APT_rev CCTTTCCCTTAAGCTCTG.
A typical reaction consisted of: About 10 ng of cDNA library, 1X Taq DNA polymerase
buffer, 1.5 mM MgCl 2 , 0.5 ρmol.μL - 1 of each primer, 0.2 mM of each
dNTP (dATP, dCTP, dGTP, dTTP) and 2.5 U of recombinant Taq DNA
polymerase (Invitrogen ® ). Cycling conditions were as follow: 1) 95
°C/5min, 2) 95 °C/45 s, 3) 55 °C/45 s, 4) 72 °C/ 1.5 min, go to 3 23X, 5)
72 °C/10 min, 6) 4 °C/∞.
To confirm the specificity of primers used to amplify EgMUR3, an attempt to
amplify the MUR3 gene from A. thaliana was performed in a control PCR using
EgMUR3 primers and cDNA preparation from WT. Primers used to amplify the
endogenous MUR3 gene were: mur3RT_for GCACCAGTAGCCAATTCTAG and
mur3RT_rev GTCGCATACCAACCTTCATC. For all amplifications, 27 cycles were
performed.
27
2.5 Cell wall analysis
To determine whether EgMUR3 was a functional ortholog of the A. thaliana
MUR3 gene, the impact of EgMUR3 expression on XyG structure of transgenic plants in
comparison to mur3 and WT lines was investigated as described previously by Lerouxel
et al. (2002). Shortly, cell wall material was isolated from Col-0, mur3 mutant and mur3
mutant expressing EgMUR3 and digested with a xyloglucan-specific endo-β-1,4glucanase. The XGOs (xyloglucan oligosaccharides) produced by this digestion was
then assessed by MALDI-TOF MS.
2.6 Seed sterilization
About 40 mg of seeds in 2 mL microtubes were washed with 1 mL 70% ethanol
for 5 minute under agitation. Supernatant was discarded and seeds rinsed with sterile
distilled water. Afterwards, seeds were left for 10 minutes immersed in a 5%
hypoclorite solution + 50 µl Triton X-100. Supernatant was discarded and seeds were
rinsed 5 times with 1 mL distilled water. Seeds were then dried under sterile airflow in a
Petri dish covered with sterile filter paper. Seeds were stored at 4°C.
2.7 Isolation of cell wall material from leaves
Young expanded leaves from 4 to 5 weeks-old plants were harvested, weighed
(about 50 mg fresh Weight) and transferred to 2 mL microtubes before freezing in liquid
nitrogen. Grinding was performed in a MM200 Retsch® equipment using a frequency of
25 Hz for 1 minute. The powder was homogenized with 1 mL 70% ethanol to remove
cellular metabolites. The tubes were centrifuged at 11,600 x g for 10 minutes,
supernatant was discarded and pellet resuspended in 1 mL of 1:1 (v/v)
methanol:chloroform. Samples were centrifuged again as before for 5 minutes. The
cleaning step in methanol:chloroform was repeated twice. Steps for removing
chlorophyll were performed by washing the cell wall pellet with acetone until complete
bleaching of the material as performed for methanol:chloroform centrifugation steps.
The material was then freeze-dried for 30 minutes and kept at RT until use.
2.8 Isolation of cell wall material from hypocotyls
Sterilized seeds were sowed on Petri dishes containing 2 MS media (4.4 g.L-1
Murashige and Skoog powder, 0.5 g.L-1 MES, 20 g/L sucrose, 8g.L-1 agar, pH 5.8) and
500 µL of water were added to them. Plates were wrapped in aluminium foils and kept
28
at 22 °C incubation chamber. After 4 days, the etiolated hypocotyls were transferred to
microtubes with 70% ethanol and stored at RT. For cell wall material preparation, a
single hypocotyl was transferred to a 2 mL microtube before freezing in liquid nitrogen.
Grinding was performed as described for leaf material. Samples were then resuspended
in 1 mL 70% ethanol and tubes centrifuged at 11,600 x g for 10 minutes. The
supernatant was carefully discarded by vacuum suction and pellet was washed in
methanol:chloroform (1:1) to remove membrane and other lipids. The material was then
centrifuged as previously described and supernatant was discarded by suction with a
thin Pasteur pipette adapted to the vacuum suction system. Pellet was dried in a
desiccator coupled to a vacuum pump for 30 minutes.
2.9 Digestion of cell wall material with specific endoglucanase
Cell wall material from leaf or hypocotyl was digested with a specific
xyloglucan endo-β-1,4-glucanase (EC 3.2.1.151), or simply XEG, before the MALDITOF MS analysis. XEG does not cleave any other cell wall component, except
xyloglucan, and the outcomming products keep their original β- configuration (Pauly et
al., 1999b). The remaining cell wall pellet was solubilized in 46 µL of 54 mM
ammonium formate buffer pH 4.5 with 0.2U of XEG for 16 h at 37 °C. Afterwards,
samples were freeze-dried for 2 h and stored at 4°C until use. Before use, samples were
desalted in Biorex MSZ 501 (Biorad) equilibrated beads. Material was first resuspended
in 5 µL of water by pipeting up and down and then, 6 to 10 Biorex beads were added to
each tube. The desalinization process was performed at RT for 10 minutes.
2.10 MALDI-TOF MS analysis
MALDI-TOF MS analysis of solubilized xyloglucan oligosaccharides were
performed in a Voyager DE – Pro MALDI-TOF (Applied Biosystems, Langen,
Germany) equipment using an acceleration voltage of 20,000 V and a delay time of 350
ns. Mass spectra were obtained in the negative reflection mode. Matrix used in cocrystallization was DHB (10 mg.mL-1 2,5-dihydroxibenzoic acid) with the solubilized
sugars 1:1 (v:v).
29
3. RESULTS
3.1 Cloning and sequence analysis of EgMUR3 gene
Among the data generated by the sequencing of the EUGR_SG_006 library, tags
showing high similarity with the A. thaliana MUR3 gene were found. Key subclones
encompassing the entire MUR3-homolog gene were selected, fully sequenced and the
contigs were assembled. A final contig of 4.6-kb that contained a predicted 1854 bp
long intronless sequence (EgMUR3) was obtained (Figure 10). The gene sequence was
predicted to encode a protein with 617 amino acid residues. The putative protein had a
deduced molecular mass of 70870 Da and isoeletric point of 8.19, as determined by
ProtParam (http://www.expasy.org/cgi-bin/protparam).
Alignment analysis revealed a striking similarity of 82% and identity of 73%
over 617 amino acids between EgMUR3 and MUR3 proteins. Local alignment of their
predicted catalytic domains (GT47 signature motif for exostosins) revealed similarity
and identity of 96% and 90%, respectively (Figure 11). Searches of public databases
through tblastn analysis retrieved a Vitis vinifera sequence showing high homology
(78% identity and 86% similarity over 487 and 532 amino acids, respectively) to
EgMUR3.
Genolyptus database (http://www.lge.ibi.unicamp.br/eucalyptus) that contains a
large collection of Eucalyptus ESTs from different organs and species was searched for
EgMUR3 homologs but no nucleotide or amino acid sequence showing significant
homology could be retrieved. The most similar entry (EUGR-PU-003-072-D03-GO.F)
showed 36% identity and 53% similarity over 128 amino acids but no significant
similarity was found in nucleotide sequence (data not shown).
30
Figure 10 – Key subclones encompassing the genomic region containing the E. grandis
EgMUR3 gene.
Figure 11 - Global alignment of EgMUR3 and MUR3 amino acid sequences. Exostosin motif is
underlined.
31
3.2 EgMUR3 structure and classification
Searches
of
Conserved
Domains
Database
(http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) revealed a putative catalytic
domain corresponding to pfam03016 in EgMUR3 protein, which is typical from
exostosin proteins.
Exostosin motif is ubiquitous in glycosyltransferases from family GT47 and
many microorganisms, animal, fungi and plant GTs show some degree of similarity
inside this domain (Figure 12). GTs can be searched in CAZy database
(http://www.cazy.org/), which classifies them according to their topological fold,
domains and stereochemistry of the reaction they perform.
Figure 12 - Exostosin domain pfam03016 is ubiquitous across kingdoms. Additional domains
can be found depending on the protein and might be related to the acceptor substrate that these
GTs recognize.
32
Analysis of EgMUR3 amino acid sequence by TMHMM v. 2.0 at
http://www.cbs.dtu.dk/services/TMHMM-2.0 predicted a N-terminal cytoplasmic tail
followed by a stretch of hydrophobic residues in EgMUR3, which is consistent with a
putative TMD (transmembrane domain) typical of type II glycosyltransferases (Figure
13).
Analysis
of
EgMUR3
(http://bioweb.pasteur.fr/seqanal/interfaces/toppred.html)
by
shows
TopPred
that
the
charge
distribution along EgMUR3 is in agreement with typical type II GTs (Figure 14). The
most negative values for hydrophobicity observed after the TMD could correspond to
the stem.
Attempts to predict the subcellular localization of EgMUR3 by PSORT
(http://psort.ims.u-tokyo.ac.jp/) or TargetIP (http://www.cbs.dtu.dk/services/TargetP/)
did not succeed and returned ambiguous results (data not shown). However,
experimental data on MUR3 showed that it co-localizes to Golgi cisternae (Tamura et
al., 2005). It is reasonable to suggest, based on high sequence similarities between
EgMUR3 and MUR3 that EgMUR3 might be a Golgi resident protein.
Analysis
using
ProDom
server
at
http://prodom.prabi.fr/prodom/current/html/form.php (Servant et al., 2002) allowed
predicting the approximate localization of the exostosin motif. The output of the
analysis shows four regions highly conserved (p-value <10-5) to other exostosin-like
proteins used in the analysis (Figure 15A). The first region encompasses the TMD and
part of the exostosin motif, while the second, third and fourth regions comprehend the
exostosin domain and part of the C-terminal. By associating results from ProDom with
HCA (hydrophobic cluster analysis), it was possible to assign putative DxD motifs in
the exostosin domain of EgMUR3 (Figure 15B). HCA (hydrophobic cluster analysis)
for EgMUR3 revealed 4 candidate sites to represent DxD motifs. These sites could
therefore, potentially accept UDP-Gal, the putative donor nucleotide-sugar used by
EgMUR3.
33
Figure 13 – Prediction of transmembrane domains in EgMUR3 by TMHMM 2.0. “Inside”
corresponds to N-terminal portion (amino acids 1 to 25), “transmembrane” corresponds to TMD
(encompassing amino acids 26 to 48) and “outside”, the C-terminal, probably facing the Golgi
lumen (amino acids 49 to 617).
Figure 14 – Hydropathic plot by TopPred. The stem region, as indicated, contains charged residues.
A stretch of highly hydrophobic amino acid residues before the stem corresponds to TMD.
34
A
Region I
Region II
B
Region III
Region IV
TMD
1
3
2
4
1
2
3
4
Figure 15 – Assignment of candidate DxD motifs in EgMUR3 exostosin domain. A) Alignment of
exostosin domains from proteins showing the same architecture as EgMUR3 using ProDom allows
determining 4 conserved regions in EgMUR3 related proteins. The numbers refer to amino acid
positions delimiting the different domains. Region II encompasses the exostosin domain, and conserved
amino acid residues which might be important for GT activity within region II are indicated in the
consensus row. B) Location of relevant elements along EgMUR3 amino acid sequence. B) Prediction of
key residues which might constitute TMD and DxD motifs (within region II). Green residues are
hydrophobic.
35
3.3 Phylogenetic analysis
Although there are nearly 150 entries in GT47 family of glycosyltransferases in
CAZy (carbohydrate active enzymes) database to date, few of them were confirmed to
have biological functions. An alignment of EgMUR3 with other GTs that were already
shown to participate in different aspects of cell wall metabolism (see Table 1, in
Introduction) was performed. They seem to have diverged very early from a common
ancestor, given their functional specialization. EgMUR3 and its equivalent in A.
thaliana however, show a high degree of conservation and probably both possesses
xyloglucan galactosyltransferase activity (Figure 16).
The Phylogenetic branch represented by FRA8, PoGT47C and NpGUT1 accept
UDP-GlcA (glucuronic acid) as donor substrate and belong to GT47 family. NpGUT1
participates in pectin biosynthesis, while FRA8 and PoGT47 are involved in xylan
(secondary wall hemicellulose) biosynthesis (Iwai et al., 2002; Zhong et al., 2005).
Since GlcA is an acidic sugar, the catalytic site of these enzymes might have
adaptations to accommodate this negatively charged sugar. Although QUA1 (GT8) is
also involved in pectin metabolism, it accepts UDP-GalA (galacturonic acid) as donor
substrate. Furthermore, NpGUT1 acts upon rhamnogalacturonan II, while there are
biochemical evidences that QUA1 participates in homogalacturonan metabolism
(Bouton et al., 2002). These differences could reflect why these genes are so distantly
related to each other.
The Phylogenetic branch represented by PsFUT1 (Pisum sativum) and AtFUT1
(A. thaliana) refers to GT37 enzymes that accept GDP-Fucose as donor substrate and
participate in xyloglucan fucosylation (Perrin et al., 1999; Faik et al., 2000). AtXT1 and
AtXT2 genes are also involved in xyloglucan biosynthesis. They encode
xylosyltransferases that substitutes (1,4)-β-D-glc within the xyloglucan core with
xylosyl residues (Faik et al., 2002; Cavalier and Keegstra, 2006).
RRA1 (GT77) is a putative A. thaliana arabinosyltransferase acting upon
unknown cell wall component(s), since knocked out plants showed up to 20% reduction
in arabinose content in cell wall fractions after removal of pectin and xyloglucan
(Egelund et al., 2007).
36
Figure 16 –Phylogenetic relationships among known genes encoding proteins possessing GT
activity.
37
3.4 EgMUR3 expression analysis
In order to investigate whether EgMUR3 exhibits biochemical activity related to
xyloglucan galactosyltransferase in vivo, the gene was transformed into A. thaliana
mur3 mutant and the expression of the transgene was checked by RT-PCR.
Considering that mur3 plants express a mutant version of MUR3 transcript
(carrying a miss-sense mutation) and that EgMUR3 shares a high homology of sequence
with MUR3, primers were designed based on the alignment of the genomic sequence
from both genes in order to find regions the most dissimilar as possible. To confirm the
specificity of the primers used in the analysis of EgMUR3 expression in transformant
plants, a PCR test was performed with a Col-0 cDNA preparation from young leaves.
MUR3 message was present in the RNA preparation from Col-0 young leaves,
but EgMUR3 primers did not amplify endogenous MUR3 message, confirming that
EgMUR3 primers were specific and suitable for the expression analysis of transgenic
plants. Furthermore, APT (-) represents the amplification (using the APT primers) test
of the cDNA preparation treated with DNAse, in which reverse transcriptase was not
added. The absence of amplified products showed that the cDNA preparation was free
of genomic DNA contamination (Figure 17).
In the transgene expression analysis of kanamycin resistant plants, multiple lines
identified by PCR showed different expression levels of the transgene (Figure 18).
Three of them (EgM4, EgM9 and EgM10) were selected for further cell wall analysis.
EgM4 represented the lower expressor, EgM10 expressed the transgene in intermediate
level and EgM9 was the higher expressor.
38
APT (-)
MUR3
EgMUR3
APT (+)
Figure 17 – Specificity test for EgMUR3 primers. A cDNA preparation from Col-0 was used as
template. MUR3 message is present (MUR3 band) but was not amplified by EgMUR3 primers
(EgMUR3 lane). APT (+) band shows the amplification of the constitutive adenine
phosphoribosyltransferase 1 gene. As shown, the cDNA preparation was free of contamination
by genomic DNA [APT (-) band].
EgM7
EgM8
EgM9
EgM10
EgM12
EgM11
EgM6
EgM5
EgM4
EgM3
EgM2
MUR3
Col-0
EgMUR3
APT
Figure 18 – RT-PCR analysis of transgenic plants. Total RNA was extracted from leaf material,
reverse transcribed in cDNA and PCR amplified. EgM2 to EgM12 represent pBinAr-EgMUR3
transformed plants selected on Kan media. EgM3, EgM4, EgM6 and EgM12 weakly expressed the
EgMUR3 message and EgM7, although showing Kan resistance, did not express the transgene. EgM9
was the higher expressor. The expression of the housekeeping APT gene was monitored as positive
control.
39
3.5 Cell wall analysis
Cell wall material was prepared from young leaves or etiolated hypocotyls from
WT, mur3, empty vector and pBinAr-EgMUR3 transformant lines and digested with
XEG. Oligosaccharides released from the digestion were then analyzed by MALDITOF MS.
MUR3 was previously shown to act upon the third xylosyl residue in the
xyloglucan core (Madson et al., 2003). Since fucosylation on this position depend on
previous galactosylation, all galactosylation (XXLG) and fucosylation (XXFG and
XLFG) peaks are missing in mur3 mutant, (Figure 19B; Table 2 for corresponding
masses).
In
the
EgM9
and
EgM10
transformant
plants,
all
missing
galactosylation/fucosylation peaks were restored, confirming that EgMUR3 possesses a
xyloglucan galactosyltransferase activity. In spite of EgM4 being selected in kanamycin
media, EgMUR3 message could neither be detected by RT-PCR nor galactosylation
peaks were restored (Figure 19F). Possibly, plasmid DNA has inserted in a genomic
region with low transcriptional activity. Also, EgMUR3-expressing plants exhibited an
increased acetylation in their XyG structure peaks (Figure 20).
40
B
A
1100
D
C
1100
1300
E
1500
1300
1500
1100
1100
1300
1300
1500
1500
F
Figure 19 – MALDI-TOF MS spectra of cell wall material digested with XEG. (A) Columbia-0
(hypocotyl), (B) mutant mur3 (hypocotyl), (C) empty vector control (leaf), (D) EgM9 transformant
(leaf), (E) EgM10 transformant (leaf), (F) EgM4 transformant (leaf). Stars above the peaks indicate
acetylation of the corresponding peak.
41
Figure 20 – Relative abundance of xyloglucan oligossacharides detected for each line by MALDI-TOF
MS analysis.
Table 2 – Nominal masses of XyGOs from Col-0, mur3, and EgMUR3 transformant lines (EgM)
generated by digestion of XyG with XEG and detected by MALDI-TOF MS.
Masses
Oligosaccharides
Col-0
MUR3
Empty
EgM9
EgM10
EgM4
vector
791,4
XXG
+
-
-
+
+
-
953,3
GXXG
+
-
-
+
+
-
1085,3
XXXG
+
+
+
+
+
+
1247,3
XXLG(?)/XLXG
+
+
+
+
+
+
+
-
-
+
+
-
1289,2
XXLG/XLXG+1 OAc
(a)
1393,2
XXFG
+
-
-
+
+
-
1435,2
XXFG+1OAc
+
-
-
+
+
-
1555,2
XLFG
+
-
-
+
+
-
1597,5
XLFG+1OAc
-
-
-
+
+
-
a
( ) OAc represents acetyl groups.
42
4. DISCUSSION
In A. thaliana genome, MUR3 is single-copy and its non-functional redundancy
is confirmed by the clear impact of mur3 mutation on specific biochemical traits of A.
thaliana cell wall. In E. grandis, there is no report about EgMUR3 copy number or
expression patterns, to date. Searches of Genolyptus expression database did not
retrieve sequences showing similarity to EgMUR3 gene. This database consists mainly
of xylem expressed genes from several species. When public databases (NCBI) was
searched for EgMUR3 homologs, more than 30 putative proteins showing high degree
of homology (e-value as low as 10-56) to EgMUR3 were recovered. In spite of not
seeming to be essential for normal plant development, at least in A. thaliana, MUR3like proteins remain well conserved across different taxa.
The structure analysis of EgMUR3 protein revealed that it might be a type II GT
due to the presence of a putative TMD (transmembrane domain). This domain anchors
type II GTs to Golgi membranes. This way, C-terminal portion probably faces the Golgi
lumen while N-terminal might be outward. Freshly isolated Golgi vesicles from rat liver
showed an increase of up to eight-fold in UDP-galactose: N-acetylglucosamine
galactosyltransferase (GT) and CMP-sialic:desialylated transferrin sialyltransferse (ST)
activities after treatment with Triton X-100, supporting the idea that the catalytic
domain of type II GT most likely is facing the Golgi lumen (Fleischer, 1981).
Analysis of charge distribution along the EgMUR3 amino acidic sequence
suggested that EgMUR3 might possess a “stem” segment. The stem corresponds to a
stretch of charged amino acids starting just after the TDM and before the catalytic
domain in GTs and has been associated with the correct positioning of the catalytic
domain in the lumen face. It is believed that the stem portion keeps the catalytic
domains away from the lipid bilayer preventing unspecific interactions which would
interfere with enzyme-substrate or enzyme-enzyme available interfaces (Breton et al.,
2001).
Bioinformatic analysis showed that EgMUR3 belongs to the GT47 CAZy family
represented by exostosin-like glycosyltransferases. Further analysis within the exostosin
domain of EgMUR3 revealed important putative motifs that might be involved in the
galactosyltransferase activity. Several GTs that utilize nucleotide-sugars as donor
substrate and sugar moieties as acceptor show conserved DxD motifs [aspartic acid (D),
any (X), aspartic acid (D)] (Breton and Imberty, 1999). Variants of these motifs are
EDD, EED or [DE] x [DE], where (E) represents glutamic acid. These residues are
43
negatively charged in the cellular environment and therefore, might contact divalent
cations, which are believed to coordinate the binding between substrates and enzyme.
Divalent cations probably contact the negatively charged phosphate group in nucleotidesugars. For those enzymes not showing the DxD motif, basic amino acids would assume
that function (Breton and Imberty, 1999; Breton et al., 2001). Nucleotide binding
domains (NBD) are common elements in the catalytic domain of many GTs, from
bacteria to animals, indicating that GTs might share a common ancestrallity.
The results obtained from MALDI-TOF MS analysis clearly confirmed that the
E. grandis EgMUR3 gene is a functional ortholog of the A. thaliana MUR3 gene.
Curiously, EgMUR3 transgenic plants exhibited a high degree of o-acetyl substitutions.
This could be due to a characteristic of the material used (leaves). Alternatively, the
over acetylation could be an unknown cell wall response to the overexpression of
EgMUR3. Overexpressing the fucosyltransferase AtFUT1 in A. thaliana also led to a
similarly high acetylation response (Perrin et al., 2003). These authors have shown that
the XyG fucosyltransferase encoded by the Arabidopsis gene AtFUT1 directed the
addition of fucose (Fuc) residues to terminal galactose residues on XyG side chains and
that the degree of fucosylation correlated to the degree of o-acetylation [(mutants
showing reduced or no fucose in XyG structure (mur1 and mur2) also exhibited
significant reduction of O-acetylation]. These authors suggested that the fucosyl
residues on XyG structure might be the potential targets for acetylation observed in
plants overexpressing AtFUT1 and the terminal galactose residues added to the 3rd
position on XXXG constitute the potential target for such fucosylation and
consequently, acetylation. Maybe this could explain, at least in part, the increased oacetylation shown by EgMUR3 over-expressing plants. The biological role of oacetylated residues in XyG is unknown, although it has been postulated to increase the
protection of the polymer against enzymatic fragmentation (Pauly and Scheller, 2000).
To a certain extent, confirmation of function of many plant cell wall genes is
hampered by the extreme plasticity exhibited by the cell wall. This way, a gene that is
thought to play a role may actually assume another. Also, the action of downstream
genes can mask the action of the upstream ones because the addition of sugar moieties
at enzymatic level probably involves pre-conceived serial reactions to give rise to a
specific sugar structure. An example is the decoration of XyG by the
glycosyltransferases, since fucosylation at a specific sugar residue seems to require a
previous galactosylation step.
44
In A. thaliana, the MUR3 gene seems to be dispensable for normal plant
development (Reiter et al., 1997; Madson et al., 2003). These authors reported that the
galactosylation and consequently, fucosylation at the third xylosyl residue (XXXG) was
completely abolished while the galactosylation at the second xylosyl (XLXG) was
enhanced in mur3 mutants without major consequences for normal plant development.
The authors also described that mur3 mutants (mur3-1 and mur3-2) still expressed a
mutant version of MUR3 protein (carrying amino acid substitutions in different
positions within the exostosin domain). In contrast, Tamura et al. (2005) reported
drastic effects due to the expression of a truncated form of KATAMARI1/MUR3. These
authors suggested a loss of physical integrity of cytoskeleton elements that could be
contacting KATAMARI1/MUR3 protein. Concerning the biochemical role performed
by MUR3, Madson et al. (2003) clearly demonstrated that galactosylation at first
xylosyl residue from the reducing end (XXXG) is defected. However, whether
galactosylation enhancement at the second xylosyl from the non-reducing end is such a
compensation for the loss of the original XyG configuration is not clear. Neither
katamari
1 nor
mur3
phenotypes
seem to
explain
the
lack
of
MUR3
galactosyltransferase activity. katamari 1 phenotypes relate to loss of cytoskeleton
physical integrity, and one not may discard that the lack of developmental mur3
phenotypes could be due to a shift of MUR3 biochemical activity. The amino acid shifts
described within the exostosin motif could have changed the specificity of the MUR3
enzyme, causing the enhancement of galactosylation at the second xylosyl unit (XXXG)
as observed in mur3 lines. Therefore, it is reasonable to suggest that such a biochemical
shift could also lead to a compensation effect allowing a normal plant development.
Another issue concerns the precise mechanism by which sugar moieties are
added to xyloglucan. Currently available analytical methods allow us to observe
fragments of the final xyloglucan structure, but not the intermediate forms or building
blocks that participated in the assembly of that structure. It has been shown that
nucleotide-sugar enzymes can be found as multienzymatic complexes (Nakayama et al.,
2003) favoring the idea of interlinked metabolic pathways that increase the efficiency of
channeling intermediate products (Srere, 1987; Seifert, 2004; Oka et al., 2007). Thus, an
intermediate structure or a donor/acceptor conformation may never be assumed in a
cellular context as we think.
Therefore, little seems to be known about the mechanisms and enzymes
underlying XyG biosynthesis. In E. grandis, for instance, basic XyG structure is
45
constituted of XXXG and XXXXG, and the following galactosylated XGOs can be
found in a typical E. grandis xyloglucan spectrum: XXLG/XLXG, XLLG, XLJG and
XLXXG (Dr. Marcos S. Buckeridge, personal communication). It gets complicated
when one thinks in terms of how many glycosyltransferases would be required to give
rise to all those mentioned structural patterns. For instance, how many
galactosyltransferases would be required to produce XXLG/XLXG, XLLG, XLJG and
XLXXG in E. grandis? Or, if a single galactosyltransferase can perform the
galactosylation in all those different positions, what drives glycosyltransferases activity
in specific substitutions? Therefore, many questions remain unanswered concerning
XyG metabolism.
5. CONCLUSION
Functional genomics in Eucalyptus is hampered by the lack of efficient
transformation and regeneration protocols. The approach described in this work allowed
the successful confirmation of the biochemical function of the EgMUR3 gene from E.
grandis. The fact that EgMUR3 successfully complemented the mur3 mutation suggests
that some aspects of XyG biosynthesis might be conserved between E. grandis and A.
thaliana. Future studies will be conducted to determine whether EgMUR3 gene is
functional in E. grandis through expression analysis in tissues and/or organs.
Despite that A. thaliana does not show an outstanding secondary growth, it
could be an useful system to study Eucalyptus genes controlling traits such as primary
cell wall composition, disease resistance, drought tolerance, flowering time, cell fate
determination, among many others, speeding up functional genomics for this
economically important species.
46
6. REFERENCES
Allona, I., Quinn, M., Shoop, E., Swope, K., St Cyr, S., Carlis, J., Riedl, J., Retzel, E.,
Campbell, M.M., Sederoff, R., and Whetten, R.W. (1998). Analysis of xylem
formation in pine by cDNA sequencing. Proc Natl Acad Sci U S A 95, 96939698.
Bechtold, N., and Pelletier, G. (1998). In planta Agrobacterium-mediated
transformation of adult Arabidopsis thaliana plants by vacuum infiltration.
Methods Mol Biol 82, 259-266.
Bevan, M. (1984). Binary Agrobacterium Vectors for Plant Transformation. Nucleic
Acids Research 12, 8711-8721.
Bonin, C.P., Potter, I., Vanzin, G.F., and Reiter, W.D. (1997). The MUR1 gene of
Arabidopsis thaliana encodes an isoform of GDP-D-mannose-4,6-dehydratase,
catalyzing the first step in the de novo synthesis of GDP-L-fucose. Proc Natl
Acad Sci USA 94, 2085-2090.
Bosca, S., Barton, C.J., Taylor, N.G., Ryden, P., Neumetzler, L., Pauly, M., Roberts, K.,
and Seifert, G.J. (2006). Interactions between MUR10/CesA7-dependent
secondary cellulose biosynthesis and primary cell wall structure. Plant Physiol
142, 1353-1363.
Bouton, S., Leboeuf, E., Mouille, G., Leydecker, M.T., Talbotec, J., Granier, F.,
Lahaye, M., Hofte, H., and Truong, H.N. (2002). Quasimodo1 encodes a
putative membrane-bound glycosyltransferase required for normal pectin
synthesis and cell adhesion in Arabidopsis. Plant Cell 14, 2577-2590.
Breton, C., and Imberty, A. (1999). Structure/function studies of glycosyltransferases.
Curr Opin Struc Biol 9, 563-571.
Breton, C., Mucha, J., and Jeanneau, C. (2001). Structural and functional features of
glycosyltransferases. Biochimie 83, 713-718.
Buckeridge, M.S. (2006). Implications of emergence, degeneracy and redundance for
the modeling of the plant cell wall. In The science and the lore of the plant cell
wall, T. Hayashi, ed, pp. 41-47.
Buckeridge, M.S., dos Santos, H.P., and Tine, M.A.S. (2000). Mobilisation of storage
cell wall polysaccharides in seeds. Plant Physiol Biochem 38, 141-156.
Buckeridge, M.S., Rayon, C., Urbanowicz, B., Tine, M.A.S., and Carpita, N.C. (2004).
Mixed linkage (1 -> 3),(1 -> 4)-beta-D-glucans of grasses. Cereal Chemistry 81,
115-127.
Carpita, N.C., and Gibeaut, D.M. (1993). Structural models of primary cell walls in
flowering plants: consistency of molecular structure with the physical properties
of the walls during growth. Plant J 3, 1-30.
Cavalier, D.M., and Keegstra, K. (2006). Two xyloglucan xylosyltransferases catalyze
the addition of multiple xylosyl residues to cellohexaose. J Biol Chem 281,
34197-34207.
Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant J 16, 735-743.
de Lima, D.U., and Buckeridge, M.S. (2001). Interaction between cellulose and storage
xyloglucans: the influence of the degree of galactosylation. Carbohydrate
Polymers 46, 157-163.
Edwards, M.E., Dickson, C.A., Chengappa, S., Sidebottom, C., Gidley, M.J., and Reid,
J.S.G. (1999). Molecular characterisation of a membrane-bound
galactosyltransferase of plant cell wall matrix polysaccharide biosynthesis. Plant
J 19, 691-697.
47
Egelund, J., Obel, N., Ulvskov, P., Geshi, N., Pauly, M., Bacic, A., and Petersen, B.L.
(2007). Molecular characterization of two Arabidopsis thaliana
glycosyltransferase mutants, rra1 and rra2, which have a reduced residual
arabinose content in a polymer tightly associated with the cellulosic wall
residue. Plant Mol Biol 64, 439-451.
Faik, A., Price, N.J., Raikhel, N.V., and Keegstra, K. (2002). An Arabidopsis gene
encoding an alpha-xylosyltransferase involved in xyloglucan biosynthesis. Proc
Natl Acad Sci U S A 99, 7797-7802.
Faik, A., Bar-Peled, M., DeRocher, A.E., Zeng, W.Q., Perrin, R.M., Wilkerson, C.,
Raikhel, N.V., and Keegstra, K. (2000). Biochemical characterization and
molecular cloning of an alpha-1,2-fucosyltransferase that catalyzes the last step
of cell wall xyloglucan biosynthesis in pea. J Biol Chem 275, 15082-15089.
Fleischer, B. (1981). Orientation of glycoprotein galactosyltransferase and
sialyltransferase enzymes in vesicles derived from rat liver Golgi apparatus. J
Cell Biol 89, 246-255.
Foucart, C., Paux, E., Ladouce, N., San-Clemente, H., Grima-Pettenati, J., and Sivadon,
P. (2006). Transcript profiling of a xylem vs phloem cDNA subtractive library
identifies new genes expressed during xylogenesis in Eucalyptus. New Phytol
170, 739-752.
Fry, S.C., York, W.S., Albersheim, P., Darvill, A., Hayashi, T., Joseleau, J.P., Kato, Y.,
Lorences, E.P., Maclachlan, G.A., Mcneil, M., Mort, A.J., Reid, J.S.G., Seitz,
H.U., Selvendran, R.R., Voragen, A.G.J., and White, A.R. (1993). An
Unambiguous Nomenclature for Xyloglucan-Derived Oligosaccharides. Physiol
Plant 89, 1-3.
Li, Y.H., Smith, C., Corke, F., Zheng, L.Y., Merali, Z., Ryden, P., Derbyshire, P.,
Waldron, K., and Bevan, M.W. (2007). Signaling from an altered cell wall to the
nucleus mediates sugar-responsive growth and development in Arabidopsis
thaliana. Plant Cell 19, 2500-2515.
Madson, M., Dunand, C., Li, X.M., Verma, R., Vanzin, G.F., Calplan, J., Shoue, D.A.,
Carpita, N.C., and Reiter, W.D. (2003). The MUR3 gene of Arabidopsis encodes
a xyloglucan galactosyltransferase that is evolutionarily related to animal
exostosins. Plant Cell 15, 1662-1670.
Mcneil, M., Darvill, A.G., Fry, S.C., and Albersheim, P. (1984). Structure and Function
of the Primary-Cell Walls of Plants. Annu Rev Biochem 53, 625-663.
Mersereau, M., Pazour, G.J., and Das, A. (1990). Efficient Transformation of
Agrobacterium-Tumefaciens by Electroporation. Gene 90, 149-151.
Nakayama, K., Maeda, Y., and Jigami, Y. (2003). Interaction of GDP-4-keto-6deoxymannose-3,5-epimerase-4-reductase with GDP-mannose-4,6-dehydratase
stabilizes the enzyme activity for formation of GDP-fucose from GDP-mannose.
Glycobiology 13, 673-680.
Obel, N., Erben, V., and Pauly, M. (2006). Functional wall glycomics through
oligosaccharide mass profiling. In The science and lore of the plant cell wall, T.
Hayashi, ed (Brown Walker Press), pp. 258-266.
Oka, T., Nemoto, T., and Jigami, Y. (2007). Functional analysis of Arabidopsis thaliana
RHM2/MUM4, a multidomain protein involved in UDP-D-glucose to UDP-Lrhamnose conversion. J Biol Chem 282, 5389-5403.
Park, Y.W., Tominaga, R., Sugiyama, J., Furuta, Y., Tanimoto, E., Samejima, M.,
Sakai, F., and Hayashi, T. (2003). Enhancement of growth by expression of
poplar cellulase in Arabidopsis thaliana. Plant J 33, 1099-1106.
Pauly, M., and Scheller, H.V. (2000). O-Acetylation of plant cell wall polysaccharides:
identification and partial characterization of a rhamnogalacturonan O-acetyltransferase from potato suspension-cultured cells. Planta 210, 659-667.
Pauly, M., Albersheim, P., Darvill, A., and York, W.S. (1999a). Molecular domains of
the cellulose/xyloglucan network in the cell walls of higher plants. Plant J 20,
629-639.
Pauly, M., Andersen, L.N., Kauppinen, S., Kofod, L.V., York, W.S., Albersheim, P.,
and Darvill, A. (1999b). A xyloglucan-specific endo-beta-1,4-glucanase from
Aspergillus aculeatus: expression cloning in yeast, purification and
characterization of the recombinant enzyme. Glycobiology 9, 93-100.
Paux, E., Carocha, V., Marques, C., Mendes de Sousa, A., Borralho, N., Sivadon, P.,
and Grima-Pettenati, J. (2005). Transcript profiling of Eucalyptus xylem genes
during tension wood formation. New Phytol 167, 89-100.
Pavy, N., Paule, C., Parsons, L., Crow, J.A., Morency, M.J., Cooke, J., Johnson, J.E.,
Noumen, E., Guillet-Claude, C., Butterfield, Y., Barber, S., Yang, G., Liu, J.,
Stott, J., Kirkpatrick, R., Siddiqui, A., Holt, R., Marra, M., Seguin, A., Retzel,
E., Bousquet, J., and MacKay, J. (2005). Generation, annotation, analysis and
database integration of 16,500 white spruce EST clusters. Bmc Genomics 6, -.
Pena, M.J., Ryden, P., Madson, M., Smith, A.C., and Carpita, N.C. (2004). The
galactose residues of xyloglucan are essential to maintain mechanical strength of
the primary cell walls in Arabidopsis during growth. Plant Physiol 134, 443-451.
Perrin, R.M., DeRocher, A.E., Bar-Peled, M., Zeng, W., Norambuena, L., Orellana, A.,
Raikhel, N.V., and Keegstra, K. (1999). Xyloglucan fucosyltransferase, an
enzyme involved in plant cell wall biosynthesis. Science 284, 1976-1979.
49
Perrin, R.M., Jia, Z.H., Wagner, T.A., O'Neill, M.A., Sarria, R., York, W.S., Raikhel,
N.V., and Keegstra, K. (2003). Analysis of xyloglucan fucosylation in
Arabidopsis. Plant Physiol 132, 768-778.
Poke, F.S., Vaillancourt, R.E., Potts, B.M., and Reid, J.B. (2005). Genomic research in
Eucalyptus. Genetica 125, 79-101.
Raman, R., Raguram, S., Venkataraman, G., Paulson, J.C., and Sasisekharan, R. (2005).
Glycomics: an integrated systems approach to structure-function relationships of
glycans. Nat Methods 2, 817-824.
Reiter, W.D., Chapple, C., and Somerville, C.R. (1997). Mutants of Arabidopsis
thaliana with altered cell wall polysaccharide composition. Plant J 12, 335-345.
Seifert, G.J. (2004). Nucleotide sugar interconversions and cell wall biosynthesis: how
to bring the inside to the outside. Curr Opin Plant Biol 7, 277-284.
Servant, F., Bru, C., Carrere, S., Courcelle, E., Gouzy, J., Peyruc, D., and Kahn, D.
(2002). ProDom: automated clustering of homologous domains. Brief Bioinform
3, 246-251.
Srere, P.A. (1987). Complexes of sequential metabolic enzymes. Annu Rev Biochem
56, 89-124.
Sterky, F., Bhalerao, R.R., Unneberg, P., Segerman, B., Nilsson, P., Brunner, A.M.,
Charbonnel-Campaa, L., Lindvall, J.J., Tandre, K., Strauss, S.H., Sundberg, B.,
Gustafsson, P., Uhlen, M., Bhalerao, R.P., Nilsson, O., Sandberg, G., Karlsson,
J., Lundeberg, J., and Jansson, S. (2004). A Populus EST resource for plant
functional genomics. Proc Natl Acad Sci U S A 101, 13951-13956.
Tamura, K., Shimada, T., Kondo, M., Nishimura, M., and Hara-Nishimura, I. (2005).
KATAMARI1/MURUS3 is a novel Golgi membrane protein that is required for
endomembrane organization in Arabidopsis. Plant Cell 17, 1764-1776.
Tine, M.A.S., Silva, C.O., de Lima, D.U., Carpita, N.C., and Buckeridge, M.S. (2006).
Fine structure of a mixed-oligomer storage xyloglucan from seeds of Hymenaea
courbaril. Carbohydrate Polymers 66, 444-454.
Wang, J., Sporns, P., and Low, N.H. (1999). Analysis of food oligosaccharides using
MALDI-MS: quantification of fructooligosaccharides. J Agric Food Chem 47,
1549-1557.
Zhong, R.Q., Pena, M.J., Zhou, G.K., Nairn, C.J., Wood-Jones, A., Richardson, E.A.,
Morrison, W.H., Darvill, A.G., York, W.S., and Ye, Z.H. (2005). Arabidopsis
fragile fiber8, which encodes a putative glucuronyltransferase, is essential for
normal secondary wall synthesis. Plant Cell 17, 3390-3408.
Zhou, G.K., Zhong, R.Q., Richardson, E.A., Morrison, W.H., Nairn, C.J., Wood-Jones,
A., and Ye, Z.H. (2006). The poplar glycosyltransferase GT47C is functionally
conserved with Arabidopsis Fragile fiber8. Plant Cell Physiol 47, 1229-1240.
Internet sites
DOE Joint Genome Institute Announces 2008 Genome Sequencing Targets. DOE JGI
Office of Science, Press release: June 8, 2007. Disponível em : <
http://www.jgi.doe.gov/News/news_6_8_07.html>. Acesso em: 06 de Janeiro de
2008.
Global21,
Informes
setoriais:
Papel
e
celulose.
Disponível
em:
<http://www.global21.com.br/informessetoriais/setor.asp?cod=9>. Acesso em
05 de Janeiro de 2008.
Bracelpa divulga números do setor em 2007. Bracelpa, Bracelpa news, Ano XIII, n.
666,
19
de
Dezembro
de
2007.
Disponível
em:
<
50
http://www.bracelpa.org.br/bra/news/pdf/666.pdf>. Acesso em 06 de Janeiro de
2008.
Softwares
GeneDoc: A tool for editing and annotating multiple sequence alignments. V. 2.6.002
Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor
and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:9598.
51
Chapter 2
The UER1 gene related to the rhamnose synthase (RHM) genes is
essential for normal pollen grain development in Arabidopsis thaliana
Francis Julio Fagundes Lopes1, Marcelo E. Loureiro1, Markus Pauly2
1
Departamento de Biologia Vegetal, Universidade Federal de Viçosa, Viçosa, Brasil
2
Michigan State University, Michigan, USA.
52
RESUMO
Vários processos celulares estão envolvidos na germinação do tubo polínico,
elongação, direcionamento ao longo do tecido germinativo feminino e fertilização.
Contudo, pouco se sabe a respeito dos aspectos bioquímicos destes processos. Neste
trabalho são apresentadas evidências de que UER1, um gene homólogo aos genes que
codificam para ramnose sintases em plantas (genes RHM), é essencial para a formação
de grãos de pólen. Também é discutido o papel dos compostos pécticos na biologia do
desenvolvimento do pólen e são apresentadas hipóteses para os fenótipos mutantes
observados.
L-ramnose é um desoxi-açúcar constituinte dos componentes pécticos RGI
(ramnogalacturonano I) e RGII (ramnogalacturonano II). Algumas funções atribuídas às
pectinas são: promoção da adesão celular, controle da porosidade apoplástica e
plasticidade e resistência em tecidos jovens em atividade de multiplicação celular e
expansão.
Em um trabalho anterior, um cDNA de Arabidopsis thaliana (UER1) foi clonado
e heterologamente expresso. A enzima purificada exibiu atividades de 3,5-epimerase e
4-ceto redutase, convertendo dTDP-4-ceto-6-desoxi-glicose a dTDP-β-L-ramnose, em
uma reação dependente de NADPH. Para se investigar os efeitos da mutação uer1 na
composição da parede celular de A. thaliana, uma linhagem contendo inserção T-DNA
no gene em questão foi autofecundada e os descendentes analisados por PCR. Apenas
plantas selvagens e heterozigotas foram detectadas, em uma proporção aproximada de
1:1. As síliquas dos heterozigotos mostraram-se menores que as do tipo selvagem e a
sua dissecção revelou que essas continham cerca de 50% de sementes abortadas. A
investigação da morfologia dos grãos de pólen produzidos pelos heterozigotos mostrou
uma mistura de grãos de pólen normais e grãos de pólen de tamanho reduzido e com
morfologia anormal. Estes grãos de pólen mutantes foram incapazes de germinar em
testes de germinação in vitro e in vivo, ao contrário dos grãos de pólen normais, que
emitiram tubo polínico. Verificou-se também que os grãos de pólen mutantes são
desprovidos de núcleo e apresentam níveis reduzidos de pectina.
Os resultados experimentais sugerem que o gene UER1 é essencial para o
desenvolvimento normal dos grãos de pólen.
53
ABSTRACT
Several cellular processes are involved in pollen tube germination: growth,
guidance and fertilization, but little is known about the biochemistry of these processes.
In this work we present evidences that UER1, a gene homologous to the rhamnose
synthase genes (RHM genes), is essential for normal pollen grain development. We also
discuss the role of pectic compounds in pollen biology and present hypothesis to explain
the observed mutant phenotypes.
L-rhamnose is a deoxysugar present in RGI (rhamnogalacturonan I) and RGII
(rhamnogalacturonan II) pectic components. In plants, pectic components promote cell
adhesion, control of apoplastic porosity and plasticity/ resistance of primary cell walls
in actively dividing and elongating cells in young tissues.
In a previous work, an Arabidopsis thaliana cDNA (At1g63000/UER1) has been
cloned and heterologously expressed. The purified enzyme exhibited both 3,5epimerase and 4-keto reductase activities, converting dTDP-4-keto-6-deoxy-glucose to
dTDP-β-L-rhamnose in a NADPH dependent reaction. In order to investigate the effects
of the uer1 mutation on the cell wall of Arabidopsis thaliana plants, we have screened
three generations of progenies from self-crossed heterozygous T-DNA insertion lines
for uer1 homozygous plants. Only heterozygous or WT plants in an approximate ratio
of 1:1 could be recovered. Siliques produced by heterozygous plants were smaller and
contained about 50% of the seeds aborted. Investigations of pollen grains morphology
revealed a mixture of normal and defective pollen grains, the latter being unable to
germinate in vitro or in vivo. Cytochemical methods showed that mutant pollens were
devoided of nuclei and presented reduced levels of pectic compounds.
Together, the experimental results suggest that UER1 is essential for normal
pollen grain development.
54
1. INTRODUCTION
1.1 Pectin
Pectic polysaccharides constitute an important class of cell wall compounds
which account for approximately 30% of the primary walls of dicotyledonous and nongraminaceous monocotyledonous plants, and 5 to 10% of the walls of grasses (Smith
and Harris, 1999). The great diversity of pectic polysaccharides structures, and the
many genes that might be required to synthesize pectin exemplifies how important are
the pectin for plant growth and development (Ridley et al., 2001). They are involved in
many important biological processes such as: cell wall hydration (Suarez-Cervera et al.,
2002), intercellular adhesion (Lord, 2000; Iwai et al., 2002), cell wall plasticity during
growth (Bosch and Hepler, 2005), signaling in plant-pathogen interactions (Ridley et
al., 2001) and water storage in underground xylopodium of Ocimum nudicaule (Braga
et al., 2006).
Arabidopsis thaliana genome might contain more than 700 genes involved in
cell wall metabolism (Henrissat et al., 2001) with one fourth of them being estimated to
participate in the biosynthesis of pectic compounds (Somerville et al., 2004). Despite
the importance of this class of compounds, only a few genes involved in their
metabolism were characterized at functional level (Iwai et al., 2002; Usadel et al., 2004;
Jiang et al., 2005; Bosch and Hepler, 2006; Iwai et al., 2006; Oka et al., 2007). Also,
studies on pectin have been hampered by the fact that some nucleotide-sugar donors and
acceptor substrates for the pectin biosynthetic enzymes are unknown and many are not
commercially available. Only recently, mutants for pectic compounds have been
characterized (Iwai et al., 2002; Usadel et al., 2004) and genes involved in UDP-LRhamnose
(Rha)
biosynthesis
in
plants
heterologously
expressed,
allowing
demonstrating the biochemical conversion of UDP-Glc to UDP-Rha (Oka et al., 2007).
L-Rha is an essential sugar in plant metabolism. It is a naturally occurring
deoxy-sugar and can be classified either as a methyl-pentose or a 6-deoxy-hexose
(Figure 1A). Rhamnose occurs in nature in its L-form as L-rhamnose (6-deoxy-Lrhamnose). This is unusual since most of the naturally occurring sugars are in D-form.
Exceptions are the methyl pentoses L-fucose and L-rhamnose and the pentose Larabinose. In cell wall metabolism, it is required for synthesis of compounds like RGI
(rhamnogalacturonan I) and RGII (rhamnogalacturonan II). In RGI, Rha alternates with
GalA (galacturonic acid) in the constitution of the polysaccharide core (Figure 1B). In
addition, there are several compounds, which are rhamnosylated by the cell, for
55
instance, the secondary metabolites (Reiter and Vanzin, 2001; Ridley et al., 2001;
Yonekura-Sakakibara et al., 2007).
Figure 1A - Rhamnose is a deoxy-sugar that can be classified either as a methyl-pentose or a
6-deoxy-hexose.
Figure 1B – Structure of the main pectic compounds and their constituent sugars (adapted
from (Scheller et al., 2007). Description for antibodies recognizing each pectic epitope can be
accessed through: http://www.bmb.leeds.ac.uk/staff/jpk/pp/#pp5.
56
1.2 Pectin biosynthesis
Given the importance of pectic compounds in plant metabolism, efforts have
been done in order to characterize the steps of pectin biosynthesis and the genes
involved. In bacteria, the synthesis of dTDP-Rha occurs from dTDP-glucose by a
cluster of biosynthetic genes, consisting of rmlB (or rfbB), rmlC (or rfbC), and rmlD (or
rfbD) genes (Dong et al., 2003). In Arabidopsis, a class of genes (RHM1,
RHM2/MUM4, RHM3 and UER1) showed significant sequence similarity to the
bacterial orthologs Rha biosynthetic genes (Reiter and Vanzin, 2001) (Figure 2).
RHM1, RHM2/MUM4 and RHM3 proteins exhibit 85.6 to 91.6% of similarity to
each other. UER1 (also called NRS/ER) is a bifunctional enzyme that converts dTDP-4keto-6-deoxy-Glc to dTDP-β-L-rhamnose in the presence of NADPH and exhibits about
78.6 – 82.9% similarity degree to the C-terminal portion of RHM proteins (Figure 3).
The N-terminal of RHM2/MUM4 was clearly shown to possess the UDP-Glc 4,6dehydratase activity which is missing in UER1 and therefore, RHM proteins are
trifunctional enzymes (Oka et al., 2007).
57
Figure 2 - Biosynthesis of L-Rhamnose from UDP/dTDP-glucose in plant and bacteria. In
bacteria, dTDP-Rha is produced from dTDP-Glc by dTDP-Glc 4,6-dehydratase (RmlB),
dTDP-4K6DG 3,5-epimerase (RmlC), and dTDP-4KR 4-keto-reductase (RmlD) activities
via dTDP-4K6DG and dTDP-4KR. In plants, UDP-Rha is produced from UDP-Glc by
UDP-Glc 4,6-dehydratase, UDP-4K6DG 3,5-epimerase, and UDP-4KR 4-keto-reductase
activities via UDP-4K6DG and UDP-4KR. Watt el al. (2001) reported that UER1 encodes
both dTDP/UDP-4K6DG 3,5-epimerase and dTDP/UDP-4KR 4-keto-reductase. UDP-Rha
is further utilized to synthesize cell wall polysaccharides and L-rhamnose-containing natural
compounds (Oka et al., 2007).
58
A
T-DNA insertion in uer1 gene
B
Figure 3 - RHM and UER1 genes. A) BLAST and sequence analysis of RHM and UER1 genes.
B) Comparison of gene structures showing exons (thick lines) and introns (thin lines). Analysis
++
performed with Flagdb v3.8.
59
1.3 Pollen grain development
The differentiation of sporogenic cells into mature pollen grains is a very well
coordinated event (Figure 4).
Sporogenic cells undergo several mitotic divisions to differentiate into pollen
mother cells. The latter ones originate a tetrad of haploid microspores completing a
round of DNA replication and two rounds of reductional meiosis. In this stage,
microspores are released from tapetum sporophytic tissue, which suffers a programmed
cell death process (Vizcay-Barrena and Wilson, 2006) in which callase digests callose
deposited around the tetrads and contribute to sculpt the most external cell wall of the
spores, the exine (McCormick, 2004). In the next stage, each uninucleate free
microspore undergoes an asymmetric mitotic division to form a large vegetative cell and
a small generative cell (bicellular pollen stage). In A. thaliana, the generative cell
undergoes another mitotic division giving rise to two sperm nuclei (tricellular pollen
stage). After pollination, the vegetative cell controls the further development of pollen
grain and the growth of the pollen tube toward the embryo sac (Owen and Makaroff,
1995; McCormick, 2004).
A proteomic study on pollen grain showed that most of proteins (42%) produced
by a pollen grain relate to metabolism, while 51% to energy generation and 9% to
biogenesis of cell structures (Noir et al., 2005). Therefore, most of the proteins that the
pollen grain accumulates might be synthesized and stored for latter use, when they are
immediately required to support the rapid changes that the pollen must undergo upon
hydration.
60
Figure 4 - Pollen grain development in Arabidopsis thaliana. 1) Division of a diploid
sporophytic cell giving rise to the anther wall of the stamen and the sporogenic cells. 2)
Sporogenic cells undergo mitotic divisions to differentiate into pollen mother cells. 3) Diploid
mother pollen cell forms a tetrad of haploid microspores via a round of DNA replication and
two consecutive meiotic divisions. 4) Uninucleate microspore undergoes an asymmetric
mitotic division forming a large vegetative cell and a small generative cell. 5) The generative
cell undergoes another mitotic division to give rise to two sperm nuclei (tricellular pollen
stage). 6) Following pollination, the vegetative cell controls the further development of the
mature pollen grain and growth of the pollen tube into the style. Each sperm nuclei will
fertilize an ovule (McCormick, 2004).
61
1.4 Mutations affecting pollen grain development
The pollen grains constitute an excellent miniature model for studies of cell
dynamics. The pollen tube growth is an example of intense cell wall biosynthesis and
modifications followed by massive membrane synthesis. The expanding apex of a
pollen tube must reach a balance point to allow extreme plasticity and withstand the
high turgor pressure that develops inside expanding cells. The pectic network in the
apical tube wall accomplishes for these functions, with the help of pectin
methylesterases, which act controlling its stiffness and plasticity (Bosch and Hepler,
2005).
Pollen is a useful tool for the identification and characterization of recessive
mutations that would be difficult to identify in a diploid background. Because all
expression changes happening after microspore formation result from the gametophytic
gene set, pollen grains represent an opportunity to score the effects of mutations in
particular single-copy represented alleles from the gametophyte genome. The isolation
of mutants for pollen grain development is helping to answer questions addressed to
many important biological processes such as cell fate determination, cellular
differentiation, intracellular and intercellular signaling and polar growth.
Unfortunately, from experiences reported in literature, gametophytic mutations
are not easy to score, and in majority of cases, plants does not exhibit a clear phenotype
(Procissi et al., 2001; Schnurr et al., 2006). For instance, a mutation in AtUSP, a gene
involved in the synthesis of nucleotide-sugars, the donor substrates for the synthesis of
pectin, hemicellulose, glycolipids and glycoproteins in A. thaliana, was linked to
distortions of segregation ratio in selective media and absence of homozygous plants for
the mutant allele in progenies of reciprocal crosses of heterozygous plants.
Heterozygotes were undistinguishable from WT, but investigation of pollen grain
structure revealed that mutant pollens were collapsed and the intine, the innermost cell
wall layer built mainly from pecto-cellulosic material, was almost absent (Schnurr et al.,
2006). Other examples of pollen mutations affecting plant reproduction described by
literature include: mature anthers devoided of pollens (Vizcay-Barrena and Wilson,
2006), failure of transmission of markers by both male and female gametophytes
(Feldmann et al., 1997), and distortions of the typical Mendelian segregation ratios for
T-DNA in tagged plant genes (Howden et al., 1998; Schnurr et al., 2006).
Mutations affecting pectin metabolism genes severely affect pollen grain fitness
and viability due to the great importance of these compounds in pollen development and
62
pollen tube dynamics. Boron, an important mineral for proper dimerization of RGII was
shown to directly influence the pollen germination and pollen tube development in
Picea meyeri (Wang et al., 2003). Furthermore, pectin methylesterases are key enzymes
controlling penetration and growth of pollen tubes through maternal tissues on style, by
controlling stiffness and plasticity of the cell wall at the tube apex (Bosch et al., 2005;
Bosch and Hepler, 2005; Jiang et al., 2005; Parre and Geitmann, 2005; Tian et al., 2006;
Pelloux et al., 2007).
1.5 The pollen cell wall organization
The pollen cell wall consists basically of two different layers: the exine and the
intine (Figure 5).
Tryphine
Transfered from Tapetum
Exine
Sporophytic domain
Intine
Gametophytic domain
Figure 5 – Development of pollen wall domains. Pollenkit is synthesized by cells from tapetum e
transferred to the exine layer. Exine is synthesized in the sporophytic phase and therefore, it is of
sporophytic origin. Intine is synthesized in the gametophytic phase.
63
Exine is composed mainly of sporollenin, a very resistant substance present in
fungi, algae, moss and fern spore walls. Exine contains long-chain fatty acids, phenolics
and a protein-rich matrix covering its outer surface known as tryphine or pollenkit. It
helps the male gametophyte to withstand dehydration and microorganism attacks
(Bedinger, 1992). In pollination, this substance helps to promote pollen grain adhesion
to the pellicle of stigma papillae cells in a very selective way (Bih et al., 1999). The
adhesion might be mediated by lipophilic interaction of pollen grains to stigma and
occurs within few seconds after pollination, preceding the hydration (Zinkl et al., 1999).
Arabidopsis regulate pollen development at the stigma surface. First, adhesion of
pollen grain to the dry stigma surface must occur, mediated by exine and tryphine, and
if reaction is compatible, hydration occurs afterwards (Zinkl et al., 1999). Some plants
like Arabidopsis have developed this “early discrimination” mechanism to avoid
inappropriate pollen to stick to stigma, germinate and deplete female tissue resources.
Plants employing the early discrimination typically show dry stigma, precisely
controlling pollen adhesion and hydration (Zinkl et al., 1999).
Intine is the innermost layer that directly contacts the pollen plasma membrane.
It is synthesized in the haploid microspore stage (gametophytic origin) and consists of
pecto-cellulosic material and proteins (Owen and Makaroff, 1995). This layer is
implicated in important changes during pollen germination. To germinate, pollen grain
must first hydrate. The absorption of water from environment is attributed to the pectic
components of intine, which upon hydration expand into a soft and almost-liquid gel,
becoming very mobile (Ha et al., 1997). This behavior of poral intine (seen in the pollen
aperture), seems to facilitate the emergence of the pollen tube because at the point of
emergence, the cellulosic microfibrillar texture is relaxed and abundant accumulation of
unesterified pectins occurs within the paired thickenings of the apertural intine of
Euphorbia peplus, forming an elastic gel material (Suarez-Cervera et al., 2002). In
addition, poral intine holds several lysing enzymes, such as pectin esterase (Albani et
al., 1991), pectate lyase (Wing et al., 1990), polygalacturonase (Niogret et al., 1991),
cutinases (Hiscock et al., 1994) and hydrolases (Knox and Heslopha.J, 1970), which
might be important to start the active penetration of pollen tube tip into the stigma
papillae. The intine enzymes are encoded by gametophyte genes, and are, most likely,
delivered into intine layer in the stage of intine secretion during microsporogenesis,
forming thin vesicles-like cavities (Knox and Heslopha.J, 1970). The enzymes in intine
64
cavities might be delivered onto stigma papillae, after hydration, pectin mobilization
and microfibrillar components reorganization (Heslop-Harrison, 1974).
Immunocytochemistry has been useful to locate specific epitopes in subcellular
compartments and cell wall, allowing getting a better picture of how cell wall
components are distributed and how their structure is affected in cell wall mutants,
besides allowing us to track polysaccharide synthesis in the cell compartments (Willats
et al., 2000). It has been suggested that the synthesis of pectic epitopes begins in cis
Golgi and continues into the medial Golgi cistern. The esterification of HG appears to
occur in the medial and trans Golgi network, while more extensive branching of pectin
occurs in the trans Golgi cisternae (Moore et al., 1991; Knox, 1992; Zhang and
Staehelin, 1992; Staehelin and Moore, 1995). Final pectin assembly might occur as the
Golgi vesicles are transported to the plasma membrane and pectin is inserted into the
wall, often as a highly methyl esterified polymer (Carpita and Gibeaut, 1993; Dolan et
al., 1997). Immunolabelling of pollen grain structures in Nicotiana tabacum with JIM5
(against unesterified pectin) and JIM7 (against methylesterified pectin) antibodies have
shown that in pollen grain, pectin is localized in intine, with unesterified being more
abundant than esterified one. Conversely, in the wall of pollen tube tip, esterified pectin
was more abundant (Li et al., 1995). In Oenothera hookeri.velans, intine stains with
ruthenium red, demonstrating pectins at the interapertural region and in the oncus. The
thickened intine in the endo-aperture of Oenothera showed an homogenous
impregnation with a relatively high methylesterified pectin (binding to JIM7) only in
mature pollen (de Halac et al., 2003).
65
In this work, attempts to produce uer1 homozygous T-DNA insertion lines from
selfed UER1/uer1 plants failed and no uer1 homozygous could be detected in progenies
of 3 consecutive generations. We noticed that the typical Mendelian segregation ratio
expected to a single gene was shifted to 1:1, as shown by PCR screening approach. In
addition, heterozygous plants produced approximately 50% less seeds that WT.
Observation of pollen grains from heterozygous plants showed a mixture of normal and
atrophied pollen grains. Moreover, the mutant pollens showed reduced affinity for
substances binding to pectin in staining tests and were devoided of nuclei.
Although UER1 have already been shown to encode a bifunctional enzyme with
3,5-epimerase and 4-keto reductase activities in vitro (Watt et al., 2004), no biological
function has been assigned to it, to date. Here we present the first evidences that UER1
is essential for normal pollen grain biology.
Aim of the work
Unravel the role of UER1 gene in plant development
66
2. MATERIAL AND METHODS
2.1 Plant lines
In this study, A. thaliana Columbia-0 ecotype (Col-0) and UER1/uer1
heterozygous plants were used. The later was isolated by Genoplante-INRA
(http://www.cng.fr/fr/teams/genoinra/home.html) and was shown to contain a T-DNA
insertion in the second exon of the UER1 gene (locus At1g63000) encoding a putative
3,5-epimerase/4-keto reductase enzyme.
2.2 Growth of plants in greenhouse for seed production
Before being taken to greenhouse, a dormancy breaking treatment was applied to
seeds. Plants were kept in greenhouse until the seed harvesting. After setting the first
siliques, inflorescences were bagged to avoid dispersion and loss of seeds. The
following temperature/humidity parameters were used: from 6h to 22 h, 20°C/80%,
from 22h to 6h, 18°C/50%.
2.3 Growth of plants in solid media for PCR screenings
In order to analyze the segregation ratio of UER1 allele, seeds from WT (control
for a seed viability experiment) and UER1 lines were grown in acclimated growth
chamber for production of seedlings to be used in PCR screening on solid media. Before
being taken to media, a treatment for breaking seed dormancy was applied to seeds by
leaving them for 48 h at 4 °C. Sterilized seeds were then sowed on 2 MS media, plates
were sealed with porous chirurgic tape and incubated at long-day growth chambers.
Diurnal phytotron conditions were 20°C/75% humidity, and nocturnal, 18°C/75%
humidity. Plates were kept in long-day phytotron until seedlings reached approximately
1 cm. Afterwards, plants were harvested for extraction of genomic DNA and PCR
analysis.
2.4 Genomic DNA extraction
Genomic DNA was extracted from young and fully expanded leaves in 2 mL
microtubes. Samples were frozen in liquid nitrogen, ground in a MM200 Retsch®
equipment using a frequency of 25 Hz for 1 min. Four hundred microliters of extraction
buffer (200 mM Tris-Cl pH 7.5; 250 mM NaCl, 25 mM EDTA and 0.5% SDS) were
added and samples were resuspended. A centrifugation step was performed at 11,600 x
g for 10 min, and the supernatant was transferred to another tube. The genomic DNA
67
was then precipitated with absolute ethanol by inversion, and incubated at room
temperature (RT) during 10 min. Another centrifugation step was performed,
supernatant was discarded and pellet was rinsed with 70% (v/v) ethanol. Samples were
centrifuged and allowed to dry. One hundred microliters of distilled and autoclaved
water were added to the samples, before storing them at –20 °C.
2.5 Molecular characterization of plant lines
To evaluate the presence of homozygous plants for the mutation in progenies
resulting from self-crossed uer1 heterozygous, PCR screenings with specific primers for
the UER1 gene and the T-DNA insertion were performed. About 100 ng of genomic
DNA from each plant were mixed with 1X Taq buffer, 1.5 mM MgCl2, 0.5 ρmol.μL-1 of
each
primer
(FL09_CTCGTGTATTGACTGTTGGAATCTGG;
FL10_GGAAACTGAAGTTTGAGGAAGTGAGTAG;
LB1_GACCATCATACTCATTGCTGATCC), 0.2 mM of each dNTP (dATP, dCTP,
dGTP, dTTP) and 2.5 U of recombinant taq DNA polymerase from Invitrogen® in a
PCR microtube. Cycling conditions used were: 1) 95 °C/45 s, 2) 65 °C/45 s (-1
°C/cycle), 3) 72 °C/ 1 min, go to step 1 10X, 4) 95 °C/45 s, 5) 56 °C/45 s, 6) 72 °C/1
min, go to step 4 25X, 7) 72 °C/10 min.
Primer combination FL09 and FL10 should result in a 1000 bp long product,
while FL09 and LB (left border) primer combination should result in a PCR product of
approximately 400 bp long (Figure 6). Since UER1 is very similar to RHM genes,
primer FL09 was designed to anneal in the single intron sequence.
FL09
3
2
1000 pb
FL10
1
T-DNA
400 pb LB
RB
Figure 6 – Position of T-DNA insertion in UER1 gene and regions corresponding to designed
primers. 1) pfam04321, substrate binding domain; 2) predicted CDS; 3) full mRNA sequence.
Analysis performed with Flagdb++ v3.8.
68
2.6 Seed set assay
Green and green-yellowish expanded and not dehiscent siliques were harvested
from selfed heterozygous and WT plants for examination of number of seeds produced
per silique. Siliques were carefully dissected under stereomicroscopy and seeds were
counted. The average number of seeds per silique of each line was calculated out of 9
siliques per plant line.
2.7 Spore germination assay
Fully open flowers with freshly dehiscent anthers were collected and dusted on
glass slides or mini culture plates covered with non autoclaved freshly prepared media
[18% sucrose, 0.01% boric acid, 1mM CaCl2, 1mM Ca(NO3)2, 1 mM MgSO4, 0.5%
agar, pH adjusted to 7.0 (modified from Zhengbio Yang laboratory, University of
California, Riverside)]. After 2-4 hours, the germinating pollen grains were observed
under bright light stereomicroscopy against dark field. Germination and pollen tube
growth were estimated from several hundreds of pollens.
2.8 Analysis of UER1 expression by RT-PCR
Total RNA was extracted from leaf material of 5 week old plants. A whole leaf
was transferred to a 2 mL microtube and frozen in liquid nitrogen. Grinding was
performed in a MM200 Retschmill equipment from Retsch® in a frequency of 25 Hz for
1 min. RNA was extracted with RNeasy Plant Mini Kit (Qiagen) according to the
manufacturer’s instruction. Total RNA was quantified spectrophotometrically at 260
nm, samples were treated with DNAse from Ambion® (DNA-free™ DNase Treatment
& Removal Reagents), according to manufacturer’s recommendations and cDNA
synthesis was performed with the Bioscript reverse transcriptase (Bioline USA Inc),
following the instructions of the manufacturer.
UER1 message was checked in buds and flowers by PCR amplification from the
synthesized
cDNA
with
the
following
ATGGTTGCAGACGCAAACGGTTCATCAT
specific
and
primers:
uer_for
uer_rev
TCAAGCTTTAACTTCAGTCTTCTTGTTGGG. As internal control, the APT gene
encoding an adenine phosphoribosyltransferase 1 (At1g27450) was amplified, using the
following primers: APT_for TCCCAGAATCGCTAAGATTGCC and APT_rev
CCTTTCCCTTAAGCTCTG.
69
The following conditions were used for amplification: 10 ng of cDNA library,
1X taq DNA polymerase buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP (dATP, dCTP,
dGTP, dTTP), 2.5 U of recombinant taq DNA polymerase (Invitrogen®) and 0.5
ρmol.μL-1 of each primer. Cycling conditions used were: 1) 95 °C/45 s, 2) 55 °C/45 s,
3) 72 °C/1.5 min, go to step 1 23X, 5) 72 °C/10 min.
2.9 Fluorescein diacetate (FDA) staining of pollen grains
FDA is a non-fluorescent, non-polar molecule which is passively taken up into
the cell. Living cells possess esterase activity and when FDA is de-esterified to polar
fluorescein, the last one accumulates in the cell and its fluorescence can be detected
under fluorescence microscope with blue excitation filters.
A 1 mg/mL (in acetone) FDA (Molecular Probes, Sigma) stock solution was
prepared and stored at 0 °C in the dark. The stock solution was diluted to a final
concentration of 0.1 mg/mL with distilled water and stored at 4° C in the dark for 1 to 2
weeks. Pollen viability was checked by dropping FDA working solution upon the slide
containing WT and mutant pollen grains, which were incubated for 5 min in dark and
afterwards, observed in an Olympus BX-51 microscope coupled with a ColorView III
camera, Cell-P Soft Imaging System under excitation filter of 489 nm and emission
filter of 514 nm.
2.10 Nuclear staining with DAPI (4,6-diamino-2-phenylindole)
VECTASHIELD® mounting medium with DAPI (Vector Labs Inc, CA) was
used according to the manufacturer’s instructions. Pollen grains from WT and uer1
heterozygous plants were incubated overnight at 4 °C in the dark before the
visualization in an Olympus microscope BX-51 under excitation and emission filters of
359 nm and 461 nm, respectively.
2.11 Staining of pectin in pollen with ruthenium red
The pollen grains were dusted on a Poly-PrepTM slide surface (Sigma-Aldrich,
Germany) and one drop of a 0.01% (w/v) ruthenium red (Sigma-Aldrich) solution was
applied. Pollens were observed under light microscopy in an Olympus BX-51
microscope coupled with a ColorView III camera with a Cell-P Soft Imaging System.
70
2.12 Specific staining of pectin in pollen grains with Hydroxylamine-Ferric chloride
(HFCl staining)
The reaction of the carbometoxy- groups of pectins with hydroxylamine in
alkaline solution produces hydroxynamic pectic acids (Gee et., al 1959). Hydroxynamic
pectic acids react with iron to form an insoluble redwish-brown complex. Based on
these principles, a protocol was adapted to detect pectic compounds in WT and uer1
pollen grains from Arabidopsis, in addition to the ruthenium red staining.
Anthers were cutted from flowers under a MZ FZ III Leica stereomicroscopy (510 anthers/eppendorf tubes were used). The samples were immersed in a 5%
formaldehyde solution for 2 h at room temperature. Afterwards, samples were
centrifuged (11,600 x g for 3 min) and the supernatant was discarded. A 20% (v/v)
ethanol solution was added in a suitable volume to keep the anthers immersed in this
solution for 30 min. Then, the solution was discarded and 60% (v/v) ethanol was added,
allowing the anthers to stand in this solution for 30 min.
The hydroxylamine-Ferric chloride reaction was performed by transferring the
anthers to a freshly prepared alkaline hydroxylamine solution [1:1 v/v solution A (0.14
g.mL-1 crystalline hydroxylamine hydrochloride in 60% (v/v) ethanol) + solution B
(0.14 g.mL-1 NaOH in 60% (v/v) ethanol)]. Infiltration of this solution in the samples
was carried out for 30 min in an implosion-proof vacuum desiccator coupled to a
vacuum pump. Tubes were centrifuged (11,600 x g for 5min) and supernatant was
discarded. The anthers were then carefully washed once in 60% (v/v) ethanol and
centrifugation steps were repeated in order to pellet down the pollen grains after each
wash step. Equal volume of acidified ethanol solution C [(1:2) HCl : 95% (v/v) ethanol]
was added to the same total volume of solutions A and B. Pollen grains were mixed by
pipeting up and down, centrifuged and the supernatant was discarded.
Ferric-chloride in acidified alcohol (0.025 g.mL-1 ferric chloride lumps in 0.1N
HCl [in 60% (v/v) ethanol] was added to the tubes and after 10 min, pollen grains were
centrifuged and supernatant discard.
Uncoupled iron was washed away twice with 60% (v/v) ethanol by gentle
shaking for 15 min. Then, pollen grains were transferred to a slide with a cover slide
and visualized under light microscopy.
71
2.13 Analysis of callose production during pollen germination
This method was used to reveal callose production by germinating pollen grains
on self pollinated stigma. Flowers from uer1 heterozygous plants were harvested, the
anthers were dusted on their self stigma and the flowers were laid down on a glass plate
covered with a moisturized filter paper, and the emergence of pollen tubes was followed
at RT over. After the germination of pollens on the stigma, flowers were fixed in 10%
(v/v) acetic acid solution for 1.5 h, distained overnight in absolute ethanol, and in the
next day, incubated in 0.07 M sodium phosphate (Na2HPO4.2H2O) buffer, pH 9.0, for
30 min. The buffer solution was discarded and aniline blue staining solution was added.
The samples were allowed to impregnate for 60 min in aniline blue solution in the dark.
Subsequently, the material was visualized under 370 nm and 509 nm excitation and
emission filters, respectively, using an Olympus BX-51 microscope coupled with a
ColorView III camera, Cell-P Soft Imaging System.
72
3 RESULTS
3.1 Genetic analysis of UER1 segregation
Initially, we intended to isolate homozygous T-DNA insertion lines to determine
the impact of uer1 mutation on cell wall and other tissues of A. thaliana. However, PCR
analysis of 3 generations of progenies from self-crossed uer1 heterozygous lines did not
detected homozygous for T-DNA insertion in UER1 gene (Figure 7).
FL09+FL10
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
wt1wt2 wt3 H20
1000 bp
1000 bp
FL09+LB
400 bp
Figure 7 – Typical screening for uer1 homozygous plants. Plant lines descending from selfed
heterozygous are represented by numbers from 1 to 23. Genomic DNA was substituted by water
in the negative control (H2O). The 1000 bp band corresponds to the amplification product using
FL09 and FL10 primer combination while the 400 bp band was amplified with FL09 and LB
primers. The amplification products from FL09+FL10 and FL09+LB primer combinations were
sequenced, confirming that the UER1 gene is amplified instead of RHM genes. The gel (1%
agarose) was stained with ethidium bromide.
To estimate the segregation ratio of uer1 allele in the progeny from self-crossed
heterozygous, an experiment was performed by sowing seeds from 3 heterozygous
plants in 2 MS media, allowing them to germinate and reach a seedling stage of 10
days. Afterwards, genomic DNA was extracted from the whole seedling and a PCR
screening was conducted. In this test, forty nine plants out of 93 screened in solid media
were heterozygous, an approximate ratio of 1:1 (χ2= 0.26; P>0.6). Therefore, the uer1
allele is not normally transmitted through one of the gametophytes, causing distortion in
the normal Mendelian segregation ratio. In order to further address this question,
reproductive organs from uer1 heterozygous plants were examined.
73
3.2 Phenotypes exhibited by the heterozygous plants
Siliques produced by the heterozygous were significantly smaller than those
produced by WT (Figure 8). To investigate the number of seeds produced by WT and
heterozygous plants, three siliques from three distinct WT and three from distinct
heterozygotes (9 siliques for each line) in the same stage of development were
dissected. The dissection revealed that heterozygous siliques had approximately 50% of
aborted seeds in siliques from uer1 heterozygous plants (Figure 8 and 9).
To determine whether heterozygous lines produced homozygous seeds, seeds
from heterozygote lines were sowed on 2 MS media and 10-days old seedlings were
then characterized at molecular level by PCR. No difference in germination efficiency
was observed for seeds produced by WT and heterozygous plants (data not shown).
Once again, we could not detect homozygous plants from the seeds produced by
heterozygous plants. Therefore, the impossibility to detect homozygous plants in
progeny of selfed heterozygous could neither be attributed to differences in germination
efficiency nor to problems concerning seedling development. The failure in detecting
homozygous seedlings was actually due to the lack of homozygous seeds. We then
assumed that problems concerning seed formation could have arisen during
gametophytic stage. To address this issue, pollen grains from heterozygous lines were
assayed for morphology, germination efficiency, viability and content of pectic
compounds.
The examination of pollen grains produced by uer1 heterozygous lines revealed
that uer1 heterozygous plants produced a significant amount of abnormal pollen grains
mixed with normal ones (Figure 10). Abnormal pollens were significantly smaller than
the normal ones and also, altered in shape. On the other hand, WT lines produced only
pollen grains with a very regular size and morphology. By scoring the number of
normal and abnormal pollen grains produced by flowers from heterozygous lines, 37%
of abnormal pollen grains were detected, in average (Figure 11).
Differences in flowering time, flower morphology or amount of flowers in each
line were not observed.
74
A
B
WT
Aborted seed development
UER1/uer1
Figure 8 – Siliques from heterozygous and WT plants grown in green house, in the same stage
of development. A) UER1/uer1 and WT dissected siliques. B) In detail (arrowhead), aspect of
aborted seeds produced by heterozygous plants.
60
Number od seeds/silique
50
40
Atrophied seeds
30
Normal seeds
20
10
0
WT1
WT2
WT3
uer1-1 uer1-2 uer1-3
Figure 9 – Number of seeds produced by WT and uer1 heterozygous lines. Each bar represents
the standard deviation of the average of 3 siliques scored per plant.
75
Number of pollen grains
of normal
and atrophied
pollen
grainsheterozygous
in heterozygotes
Ratio Ratio
of normal
and mutant
pollen grains
in three
plants
900
800
700
600
500
400
300
WT pollens
pollens
Small pollens
200
100
0
1
2
3
3.3 Analysis of UER1 expression
Since pollen development appears to be impaired by the uer1 mutation, the
CSBDB co-expression database was searched for the UER1 expression profile.
According to expression data in CSBDB database (http://csbdb.mpimp-golm.mpg.de/),
RHM2/MUM4 (AT1G53500), RHM3 (AT3G14790) and UER1 (AT1G63000) show the
highest expression level in mature pollen grains, with UER1 being remarkably upregulated (Figure 12). UER1 is also significantly expressed in roots, and responds,
although slightly, to methyl-jasmonate application treatment. In roots, UER1 expression
is significantly up regulated (Figure 13).
RHM1 (AT1G78570) is not significantly expressed in mature pollen grains, but
its expression increases during shoot apex and flowers (petals) development, as well as
during seedling development. RHM2 RNA is abundant in mature pollen and siliques
with seeds (stages 4 and 5). Expression levels of RHM3 RNA remain almost unchanged
during all developmental stages, but show a slight increase in mature pollen (Figures 12
and 13).
Since UER1 is highly expressed in mature pollen grains, the UER1 expression in
buds and flowers was investigated by RT-PCR. UER1 message was detected in flowers
and buds from both WT and heterozygous organs. Slightly less UER1 message was
detected in flower and buds of heterozygous plants (Figure 14). Thus, one may assume
that UER1 may be required for normal pollen grain development.
77
Figure 12– Expression data of RHM1 (AT1G78570), RHM2/MUM4 (AT1G53500), RHM3 (AT3G14790) and UER1 (AT1G63000) during developmental
stages of A. thaliana, retrieved from CSBDB database.
Figure 13– Expression data of UER1 in different tissues and developmental stages of A. thaliana,
retrieved from Genevestigator database. UER1 is mainly expressed in endodermis and pollen
grains.
UER1/uer1
F
B
UER1/UER1
F
B
UER1
APT
Figure 14 – RT-PCR analysis with RNA from buds (B) and flowers (F) of uer1 heterozygous
and WT Arabidopsis plants. The APT housekeeping gene was amplified in the same
conditions as UER1. The number of cycles (23) was optimized to not reach the saturation
plateau.
79
3.4 Viability and germination assays
In order to determine whether the mutant pollen grains are able to germinate, we
sowed pollens from heterozygous and WT flowers on pollen germination media.
Germination efficiency could not be calculated due to inconsistent germination
frequencies observed. Nonetheless, in all germination assays, only WT pollens
germinated. It was not possible to detect in any of the germination assays conducted,
germination of mutant pollen grains (Figure 15).
A
B
È
È
È
Figure 15 – Pollen grains germinating on the surface of the growth media. A) WT pollen grains.
B) Pollen grains from uer1 heterozygous plant. Arrows indicate abnormal pollen grains. Dark
field stereomicroscopy.
80
3.5 In vivo germination and viability assays
To further investigate the viability of mutant pollen grains, pollen germination
on self-pollinated pistil was followed. Callose production is an indicative of pollen
germination and can be easily detected by aniline blue staining (Ferguson et al., 1998;
Lord, 2000).
Most of the WT pollen grains were able to germinate, what could be evidenced
by emission of pollen tube and callose production on the growth basis of pollen tube tip,
as well as in the place of pollen tube emergence in pollen grains (Figure 16). In contrast,
mutant pollens did not emit pollen tube and also do not emit fluorescence after aniline
blue staining, indicating that they were recalcitrant to stimuli leading to germination or
were dead. Even non-germinating WT pollen grains showed a slight affinity for the
staining, in contrast to mutant pollens, which appeared completely dark.
To investigate the reasons for such impaired germination ability, a viability test
was performed by staining the pollen grains from heterozygous plants with FDA. This
test exploits the ability that living tissues have to convert FDA in a fluorescent
compound by the action of esterases. The results showed that some mutant pollen grains
retained the esterase activity, particularly in the pollen grain aperture (Figure 17).
In order to determine whether mutant pollen grains contained genomic DNA,
DAPI staining was performed with pollens from heterozygous plants. In WT pollen,
DNA could be clearly detect, while in mutant pollens no DNA staining could be seen.
In addition, mutant pollen appeared to be devoided of cellular content (Figure 18).
81
+
*
*
+
*
Figure 16 – Aniline blue staining of germinating pollen grains in stigma papillae. (+) indicates
site of callose production in WT pollens. (*) indicates UER1 pollen grains.
#
+
+
*
#
*
Figure 17 – FDA staining of pollen grains produced by uer1 heterozygous lines. WT pollen
grains shows esterase activity (*) while uer1 pollen were apparently dead (+) or showed
esterase activity confined to the poral aperture (#). Overlay: bright field + fluorescence.
82
*
*
+
+
+
*
+
*
+
*
Figure 18 – DAPI staining of A. thaliana pollen grains produced by uer1 heterozygous lines.
WT pollen grains show nuclei (*), while uer1 are devoided of nuclei (+). Arrows indicate the
three nuclei in WT pollen. Overlay: bright field + fluorescence images.
83
3.6 Mutant pollen grains show decreased content of pectic compounds
Since UER1 was previously shown to convert dTDP-4-keto-6-deoxy-glucose to
dTDP-β-L-rhamnose, the content of pectin in mutant and WT pollen grains was
investigated by two cytochemical methods for detection of pectin. First, pollens from
WT and heterozygous were stained with ruthenium red, which preferably stains pectin.
After the washes, the sample was observed under light microscopy.
WT pollen grains retained the staining with ruthenium red throughout the whole
grain, while in mutant pollens the staining almost completely disappeared, except for a
narrow site corresponding to the pollen aperture (Figure 19).
In addition, the hydroxylamine ferric-chloride reaction (HFCl) for detecting
pectin was performed in order to validate the results obtained with ruthenium red
staining. In higher magnification, one may see that exine clearly shows low affinity for
this type of staining. On the other hand, the pollen grain aperture was strongly stained
confirming the presence of pectin in this site, in agreement with the results from the
ruthenium red staining (Figure 20).
84
Æ
Æ
Figure 19 – Ruthenium red staining of pollen grains from uer1 heterozygous plants. In WT, the
whole grain shows affinity for ruthenium red staining, in contrast to uer1 pollens, which show
affinity solely in the pollen aperture as indicate by arrows.
WT
E
uer1
Figure 20 –HFCl staining reaction occurred only in the narrow pollen aperture (Æ), while in
normal pollen, it has occurred probably at the level of intine. Exine (E) does not exhibit affinity
for this method. Bright field light microscopy.
85
4. DISCUSSION
4.1 Characterization of uer1 mutation
The PCR screening analysis of plants grown in greenhouse and 2MS solid media
failed in detecting homozygous T-DNA insertion lines for the UER1 gene. In addition,
the PCR screening revealed that the genotypic frequencies were shifted to 1:1 instead of
the expected 1:2:1 ratio in progenies of selfed heterozygotes, suggesting a complete
failure of uer1 transmission through one of the gametophytes. However, the possibility
that uer1 affects to some extent the viability of embryo sac cannot be ruled out.
In vitro germination assays showed that uer1 pollen grains do not germinate
while WT pollens successfully germinated in the media used. Also, in the stigma of
pollinated uer1 heterozygous flowers, mutant pollen grains were recalcitrant to the
stimuli leading to pollen germination, which in A. thaliana is marked by callose
production during the pollen tube emergence. In plant cells, callose is well known to
work like a sealant in cases of pathogen attack and mechanical tissue injuries. In pollen
grains, some studies have shown that it might work as a load-bearing-structure to
support the invasive growth of the fast elongating pollen tubes (Parre and Geitmann,
2005). In general, callose occurs in large amounts in pollen, particularly at the site of
pollen tube emergence and at the base of the expanding tube apex. However, the
deposition of callose seems not to be essential for the start of germination, since in N.
tabacum germinating pollen grains callose labeling starts only after 4 hours of
mutations show sporophytic requirements, an increasing number of mutations affecting
male or female gametophyte development have been reported (Bonhomme et al., 1998).
Sporophytic mutations, which disrupt pollen grain and embryo sac development, are
normally associated with decreased fertility. In contrast, lethal gametophytic mutations
are fully penetrant to one sex and can only be recovered as heterozygotes. Plants that are
heterozygous for a lethal mutation in female gametophyte are semi-sterile because half
of the ovules carry the mutation and do not develop into seeds. In contrast, plants that
are heterozygous for a lethal mutation in male gametophyte might be fully fertile due to
the large number of WT pollens remaining which can potentially fertilize the ovules
(Howden et al., 1998).
The examination of the reproductive organs of uer1 heterozygous lines revealed
that the siliques, seeds and pollen grains are abnormally developed in comparison to
WT ones. Seed production by heterozygotes is the half of WT, while mutant pollen
grains (about 37% of the total produced by uer1 heterozygotes) are smaller and
devoided of nuclei. Since uer1 pollens are not viable, most likely the mutation does not
affect the female gametophyte, or if it does, it does not impair the female gametophyte
completely in transmitting the uer1 allele, otherwise the heterozygote class would also
not be detected.
UER1 gene was shown to be highly expressed in mature pollen grains by
expression profile analysis through the CSBDB and Genevestigator databases. In
addition, UER1 is also significantly up-regulated in the root endodermis.
Endodermis is known to control the radial flux of water and solutes to the xylem
stream. At the endodermis, water flux through the apoplast pathway is obstructed by the
Casparian strip, which consists of a band of cell wall impregnated with suberin. This
barrier forces de flux of water and solutes to cross the endodermis and plasma
membrane. At the level of cell wall thus, a flux control by the pectic network in
endodermis is likely to occur. For instance, accumulation of Al in the root apex depends
on the pectin content of the cell walls and degree of pectin methylation. Genotypic Al
resistance is related to less accumulation of Al due to a lower negativity of the cell walls
(lower pectic content, thus) and plasma membrane (Horst et al., 2007). Zea mays cells
with higher pectin contents were more Al-sensitive, suggesting that binding of Al in the
pectin matrix modulates Al toxicity (Schmohl and Horst, 2000). In the same work, the
authors observed that as the pectin content of cell wall decreases, Al tolerance increases
in the culture grown cell suspensions.
87
The mutation also impacts the content of pectic compounds, as qualitatively
shown by pectin staining methods. The loss of affinity by ruthenium red and HFCl
reaction staining suggests that the pectic network was somehow altered by the uer1
mutation or a significant decrease of pectin content occurred. In uer1, the staining was
confined to a narrow region around and in the middle of the pollen aperture. On the
other hand, WT pollens were completely stained by ruthenium red and HFCl, except
that the latter method allowed distinguishing the non-stained exine layer from intine that
was strongly stained. Since intine shows a pecto-cellulosic nature, most likely intine is
collapsed and confined to the pollen aperture, as the FDA, ruthenium red and HFCl
approaches point out.
Therefore, UER1 a gene responsible for the synthesis of UDP-Rha in vitro (as
shown so far) exhibits an expression profile overlaping with the locations where pectin
accumulates and may exert important biological roles, such as in endodermis and
mature pollen grain.
4.2 Models proposed to explain the effects of uer1 mutation upon the development of
A. thaliana pollen grains
In this work we showed that the inactivation of a gene related to L-rhamnose
metabolism in A. thaliana dramatically affected the pollen grain development and
consequently, viability.
Two hypotheses are proposed to explain the negative effects of the uer1
mutation upon the development of A. thaliana pollen grains.
According to the first hypotheses, a missing UER1 activity could have caused
the collapse of the endomembrane system to the poral aperture. Yeast cells expressing
only the N-terminal portion of RHM2/MUM4 (which carries the dehydratase domain,
but not the reductase and epimerase ones) showed slower growth and formed
aggregates. In contrast, when the C-terminal portion of RHM2/MUM4 or the full UER1
cDNA was co-expressed with the RHM2/MUM4 N-terminal, a normal cell growth was
observed and no aggregate was formed (Oka et al., 2007). These authors suggested that
the accumulation of the intermediate product of UDP-Glc to UDP-Rha (UDP-4-keto-6deoxy-glucose) by the activity of the N-terminal portion of RHM2/MUM4 could have
been toxic to the cells. L-Rha is a deoxysugar that exhibits a methyl group at C5
position as does its precursor (nucleotide-4-keto-6-deoxy-glucose). The –4-keto- group
significantly enhances the hydrophobicity of nucleotide-sugars (Nakano et al., 2000).
88
Also, Watt et al. (2004) observed that the intermediate of dTDP- -D-Glc to dTDP- -LRha conversion was a compound that eluted from a reverse-phase HPLC column as a
very broad peak. This is in agreement with the results from Nakano et al. (2000). UER1,
which performs the conversion step toward UDP-Rha, would prevent the accumulation
of UDP-4-keto-6-deoxy-glucose, acting such as a UDP-4-keto-6-deoxy-glucose
“scavenger” enzyme. The missing UER1 activities (epimerase and reductase) in uer1
mutant pollens would be required during the pollen development, otherwise the
accumulation of the toxic intermediate would lead to the death of uer1 pollen grains
(Figure 21). Since uer1 pollen grains are considerable smaller than WT ones, this might
occur in the microspore stage, when intine must be synthesized with the contribution of
solely the pollen grain haploid genome. If the hydrophobicity of the intermediate
actually has something to do with the toxicity and death of pollen grains it is not clear,
but if it has, a possible toxicity mechanism would be that the nucleotide-4-ketodeoxysugar would insert itself in lipidic bilayer, causing the aggregation and shrinking
of the endomembrane systems governed by hydrophobic interactions between the
dTDP-4-keto-6-deoxy-glucose molecules with themselves and ultimately with the
endomembranes.
The second hypotheses to explain the negative effects of uer1 mutation upon
pollen grain development would takes in consideration that the pectic network of the
pollen grain, particularly intine, might play an important role in keeping the proper and
functional pollen wall architecture. Intine is mainly composed of pecto-cellulosic
material (homogalacturonan and non-methylated pectin). Its biosynthesis and deposition
takes place in the gametophytic stage and remarkably alterations in the pectic network
was demonstrated by specific staining methods in this stage (Vizcay-Barrena and
Wilson, 2006). It is therefore highly likely that intine was directly affected by uer1
mutation. Intine is known to be the source of many enzymes involved in pollen
penetration through the stigma papillae (Knox and Heslopha.J, 1970). Intine inclusions
represent the angiosperms analogue of acrossome in spermatozoids. The inclusions are
lysosome-like and just like acrossome, as it releases enzymes at the time of pollination,
the penetration of pollen tube into stigma papillae occurs. In Arabidopsis thaliana, the
pollen grain exposes an aperture by which it can hydrate and release the enzymes stored
in intine to outside the pollen. The assembly of intine layer occurs when the pollen
grains are in an immature stage of development and have not reached the full size, yet.
If the assembly of any important structural domain in the intine pectic network goes
89
CH2OH
O
HO
UDP-glucose
HO
HO
NAD+
RHM1, 2 e 3
O
UDP
NADH
UDP-glucose-4,6dehydratase
hydrophobicity
H3C
O
H3C
O
O
HO
OH
UDP-4-keto-6-deoxyglucose
O
HO
OH
UER1
O
UDP
UDP
Toxicity
UDP-glucose-4-keto-6-deoxiglucose 3,5 epimerase
H3C
O
O
UDP
O
OH
UDP-4-keto-rhamnose
OH
NADPH
uer1 pollen grain
UDP-4-keto-rhamnose-4keto-reductase
NADP+
H3C
O
O
UDP
H3C
O
O
HO
OH
O
UDP
OH
UDP-L-rhamnose
HO
OH
OH
RGI, RGII and other
pectic compounds
WT pollen grain
Figure 21 – First model to explain the effects of the uer1 mutation upon pollen grain
development. The intermediate UDP-4K6DG is highly hydrophobic and become less
hydrophobic after reduction to UDP/dTDP-Rha in the last conversion step. If UER1 activity is
missing, the UDP-4K6DG intermediate would accumulate and promote cell death by toxicity.
91
A
UER1
Vesicles containing
enzymes are properly
stored in intine
B
uer1
Release of intine-stored
enzymes in cytoplasm
Cell death is triggered
Figure 22 – Second model to explain the effects of the uer1 mutation upon pollen grain
development. In uer1 pollen grains, Rha demand would be greater than the UDP-Rha supplies
required for the intine pectic network biosynthesis in the microspore stage. As a consequence,
the intine pectic network would not be properly assembled and intine enzymes would be
released in the cytoplasm, leading to the cell death.
92
The reduced number of seeds in siliques of uer1 heterozygous plants could be
due to a competition between the mutant pollens with the normal ones for attachment
sites on stigma papillae. Tests of foreign pollen adhesion on stigma of A. thaliana have
shown that the interaction is very specific, with stigma showing preference for its selfpollen. Binding of pollen to stigma happened within few seconds after they come in
contact and was independent of tryphine (Zinkl et al., 1999). Additionally, pollens from
cer6-2 mutants (Fiebig et al., 2000), which exhibit an extreme defect that eliminates all
detectable lipid droplets and most of the proteins in the coat do not show binding
defects. Concluding, it is most likely that exine has not been affected by the uer1
mutation, since its formation receives contribution from sporophytic tissues, with
sporollenin being its major component. Furthermore, in the pollen cell wall, the sole
pectic domain is represented by intine, which is the most likely structure to be directly
impacted by the uer1 mutation, as its formation receives contribution of the
gametophytic haploid genome and therefore, nothing has to do with exine origin.
Provided that the mutant pollens retained the ability to bind to the stigma papillae, they
could be potential competitors for the available binding surface on the papillae stigma,
and this could have led to the reduction of seeds in heterozygous siliques.
In spite of RHM2/MUM4 and RHM3 showing increased expression in mature
pollen grain, the role played by the UER1 gene seems to be unique. Assuming that
UER1 works like a dTDP-4-keto-6-deoxy-glucose “scavenger”, it would make sense the
lack of the UDP-glucose-4,6-dehydratase domain in UER1, if it is committed to channel
nucleotide-4-keto-6-deoxy-Glc (the putatively toxic intermediate) toward dTDP/UDPL-Rha instead of producing more. Perhaps it could explain why three enzyme activities
have been fused in one single protein, as exemplified by RHM1, RHM2 and RHM3.
This evolutionary step would increase the efficiency of UDP-glucose to UDP-rhamnose
conversion.
93
5. CONCLUSION
In conclusion, how exactly the lack of UER1 activity influences on pollen grain
development remains elusive. The absence of nuclei, cytoplasm content and the reduced
pectin contents of uer1 pollen grains shown by cytochemical methods suggest that
UER1 might contribute to intine formation by providing UDP-Rha necessary for pectin
biosynthesis in pollen grains during microsporogenesis. Optionally, one may not discard
the possibility that the intermediate used by UER1 could accumulate in the absence of
the latter and cause the death of uer1 pollens by a toxicity effect.
It is a matter of future studies to investigate in detail what is the nature of the
events leading to the lethality of the uer1 mutation in pollen development.
94
6. REFERENCES
Albani D, Altosaar I, Arnison PG, Fabijanski SF (1991) A Gene Showing Sequence
Similarity to Pectin Esterase Is Specifically Expressed in Developing Pollen of
Brassica-Napus - Sequences in Its 5' Flanking Region Are Conserved in Other
Pollen-Specific Promoters. Plant Molecular Biology 16: 501-513
Bedinger P (1992) The Remarkable Biology of Pollen. Plant Cell 4: 879-887
Bih FY, Wu SS, Ratnayake C, Walling LL, Nothnagel EA, Huang AH (1999) The
predominant protein on the surface of maize pollen is an endoxylanase
synthesized by a tapetum mRNA with a long 5' leader. J Biol Chem 274: 2288422894
Bonhomme S, Horlow C, Vezon D, de Laissardiere S, Guyon A, Ferault M, Marchand
M, Bechtold N, Pelletier G (1998) T-DNA mediated disruption of essential
gametophytic genes in Arabidopsis unexpectedly rare and cannot be inferred
from segregation distortion alone. Molecular and General Genetics 260: 444-452
Bosch M, Cheung AY, Hepler PK (2005) Pectin methylesterase, a regulator of pollen
tube growth. Plant Physiol 138: 1334-1346
Bosch M, Hepler PK (2005) Pectin methylesterases and pectin dynamics in pollen
tubes. Plant Cell 17: 3219-3226
Bosch M, Hepler PK (2006) Silencing of the tobacco pollen pectin methylesterase
NtPPME1 results in retarded in vivo pollen tube growth. Planta 223: 736-745
Braga MR, Carpita NC, Dietrich SM, Figueiredo-Ribeiro RdC (2006) Changes in
pectins of the Xylopodium of Ocimum nudicaule from dormancy to sprouting.
Braz. J. Plant Physiol. 18: 325-331
Carpita NC, Gibeaut DM (1993) Structural models of primary cell walls in flowering
plants: consistency of molecular structure with the physical properties of the
walls during growth. Plant J 3: 1-30
de Halac IN, Cismondi IA, Rodriguez-Garcia MI, Fama G (2003) Distribution of
pectins in the pollen apertures of Oenothera hookeri.velans ster/+ster. Biocell
27: 11-18
Dolan L, Linstead P, Roberts K (1997) Developmental regulation of pectic
polysaccharides in the root meristem of Arabidopsis. Journal of Experimental
Botany 48: 713-720
Feldmann KA, Coury DA, Christianson ML (1997) Exceptional segregation of a
selectable marker (Kan(R)) in Arabidopsis identifies genes important for
gametophytic growth and development. Genetics 147: 1411-1422
Ferguson C, Teeri TT, Siika-aho M, Read SM, Bacic A (1998) Location of cellulose
and callose in pollen tubes and grains of Nicotiana tabacum. Planta 206: 452460
Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D (2000) Alterations in
CER6, a gene identical to CUT1, differentially affect long-chain lipid content on
the surface of pollen and stems. Plant Cell 12: 2001-2008
Ha MA, Apperley DC, Jarvis MC (1997) Molecular rigidity in dry and hydrated onion
cell walls. Plant Physiology 115: 593-598
Henrissat B, Coutinho PM, Davies GJ (2001) A census of carbohydrate-active enzymes
in the genome of Arabidopsis thaliana. Plant Molecular Biology 47: 55-72
Hiscock SJ, Dewey FM, Coleman JOD, Dickinson HG (1994) Identification and
Localization of an Active Cutinase in the Pollen of Brassica-Napus L. Planta
193: 377-384
95
Horst WJ, Kollmeier M, Schmohl N, Sivaguru M, Wang Y, Felle HH, Hedrich R,
Schröder W, Staß A (2007) Significance of the Root Apoplast for Aluminium
Toxicity and Resistance of Maize. Springer Netherlands
Howden R, Park SK, Moore JM, Orme J, Grossniklaus U, Twell D (1998) Selection of
T-DNA-tagged male and female gametophytic mutants by segregation distortion
in Arabidopsis. Genetics 149: 621-631
Iwai H, Hokura A, Oishi M, Chida H, Ishii T, Sakai S, Satoh S (2006) The gene
responsible for borate cross-linking of pectin Rhamnogalacturonan-II is required
for plant reproductive tissue development and fertilization. Proc Natl Acad Sci U
S A 103: 16592-16597
Iwai H, Masaoka N, Ishii T, Satoh S (2002) A pectin glucuronyltransferase gene is
essential for intercellular attachment in the plant meristem. Proceedings of the
National Academy of Sciences of the United States of America 99: 16319-16324
Jiang L, Yang SL, Xie LF, Puah CS, Zhang XQ, Yang WC, Sundaresan V, Ye D (2005)
VANGUARD1 encodes a pectin methylesterase that enhances pollen tube
growth in the Arabidopsis style and transmitting tract. Plant Cell 17: 584-596
Knox JP (1992) Molecular Probes for the Plant-Cell Surface. Protoplasma 167: 1-9
Knox RB, Heslopha.J (1970) Pollen-Wall Proteins . Localization and Enzymic Activity.
Journal of Cell Science 6: 1-&
Li YQ, Faleri C, Geitmann A, Zhang HQ, Cresti M (1995) Immunogold Localization of
Arabinogalactan Proteins, Unesterified and Esterified Pectins in Pollen Grains
and Pollen Tubes of Nicotiana-Tabacum-L. Protoplasma 189: 26-36
Lord E (2000) Adhesion and cell movement during pollination: cherchez la femme.
Trends Plant Sci 5: 368-373
McCormick S (2004) Control of male gametophyte development. Plant Cell 16: S142S153
Moore PJ, Swords KM, Lynch MA, Staehelin LA (1991) Spatial organization of the
assembly pathways of glycoproteins and complex polysaccharides in the Golgi
apparatus of plants. J Cell Biol 112: 589-602
Nakano Y, Suzuki N, Yoshida Y, Nezu T, Yamashita Y, Koga T (2000) Thymidine
diphosphate-6-deoxy-L-lyxo-4-hexulose reductase synthesizing dTDP-6-deoxyL-talose from Actinobacillus actinomycetemcomitans. Journal of Biological
Chemistry 275: 6806-6812
Niogret MF, Dubald M, Mandaron P, Mache R (1991) Characterization of pollen
polygalacturonase encoded by several cDNA clones in maize. Plant Mol Biol
17: 1155-1164
Noir S, Brautigam A, Colby T, Schmidt J, Panstruga R (2005) A reference map of the
Arabidopsis thaliana mature pollen proteome. Biochem Biophys Res Commun
337: 1257-1266
Oka T, Nemoto T, Jigami Y (2007) Functional analysis of Arabidopsis thaliana
RHM2/MUM4, a multidomain protein involved in UDP-D-glucose to UDP-Lrhamnose conversion. Journal of Biological Chemistry 282: 5389-5403
Owen HA, Makaroff CA (1995) Ultrastructure of Microsporogenesis and
Microgametogenesis in Arabidopsis-Thaliana (L) Heynh Ecotype Wassilewskija
(Brassicaceae). Protoplasma 185: 7-21
Parre E, Geitmann A (2005) More than a leak sealant. The mechanical properties of
callose in pollen tubes. Plant Physiol 137: 274-286
Parre E, Geitmann A (2005) Pectin and the role of the physical properties of the cell
wall in pollen tube growth of Solanum chacoense. Planta 220: 582-592
Pelloux J, Rusterucci C, Mellerowicz EJ (2007) New insights into pectin methylesterase
structure and function. Trends Plant Sci 12: 267-277
96
Procissi A, de Laissardiere S, Ferault M, Vezon D, Pelletier G, Bonhomme S (2001)
Five gametophytic mutations affecting pollen development and pollen tube
growth in Arabidopsis thaliana. Genetics 158: 1773-1783
Reiter WD, Vanzin GF (2001) Molecular genetics of nucleotide sugar interconversion
pathways in plants. Plant Mol Biol 47: 95-113
Ridley BL, O'Neill MA, Mohnen DA (2001) Pectins: structure, biosynthesis, and
oligogalacturonide-related signaling. Phytochemistry 57: 929-967
Scheller HV, Jensen JK, Sorensen SO, Harholt J, Geshi N (2007) Biosynthesis of
pectin. Physiologia Plantarum 129: 283-295
Schmohl N, Horst WJ (2000) Cell wall pectin content modulates aluminium sensitivity
of Zea mays (L.) cells grown in suspension culture. Plant Cell and Environment
23: 735-742
Schnurr JA, Storey KK, Jung HJ, Somers DA, Gronwald JW (2006) UDP-sugar
pyrophosphorylase is essential for pollen development in Arabidopsis. Planta
224: 520-532
Smith BG, Harris PJ (1999) The polysaccharide composition of Poales cell walls:
Poaceae cell walls are not unique. Biochemical Systematics and Ecology 27: 3353
Somerville C, Bauer S, Brininstool G, Facette M, Hamann T, Milne J, Osborne E,
Paredez A, Persson S, Raab T, Vorwerk S, Youngs H (2004) Toward a systems
app 4-7toot d Pets actinn plalt
Wing RA, Yamaguchi J, Larabell SK, Ursin VM, McCormick S (1990) Molecular and
genetic characterization of two pollen-expressed genes that have sequence
similarity to pectate lyases of the plant pathogen Erwinia. Plant Mol Biol 14: 1728
Yonekura-Sakakibara K, Tohge T, Niida R, Saito K (2007) Identification of a flavonol
7-O-rhamnosyltransferase gene determining flavonoid pattern in Arabidopsis by
transcriptome coexpression analysis and reverse genetics. J Biol Chem 282:
14932-14941
Zhang GF, Staehelin LA (1992) Functional Compartmentation of the Golgi-Apparatus
of Plant-Cells - Immunocytochemical Analysis of High-Pressure FrozenSubstituted and Freeze-Substituted Sycamore Maple Suspension-Culture Cells.
Plant Physiology 99: 1070-1083
Zinkl GM, Zwiebel BI, Grier DG, Preuss D (1999) Pollen-stigma adhesion in
Arabidopsis: a species-specific interaction mediated by lipophilic molecules in
the pollen exine. Development 126: 5431-5440
Internet sites
FLAGdb++: a database for the functional analysis of the Arabidopsis genome.
Samson F, Brunaud V, Duchene S, De Oliveira Y, Caboche M, Lecharny A,
Aubourg
S.
Nucleic Acids Res. 2004 Jan 1;32 Database issue:D347-50
http://193.51.165.9/projects/FLAGdb++/HTML/index.shtml
98
GENERAL CONCLUSIONS
The functional complementation of A. thaliana mur3 mutants with the EgMUR3
gene from E. grandis, as shown by MALDI-TOF MS, confirm that EgMUR3
corresponds to a xyloglucan galactosyltransferase. The E. grandis xyloglucan
galactosyltransferase recognized and biochemically modified the xyloglucan from A.
thaliana, suggesting that at least in part, the xyloglucan metabolism in both species
might share some degree of evolutionary conservation.
Concerning UER1, the results presented point out to an important role of this
gene in the metabolism of pectic compounds in A. thaliana pollen grains. The
participation of this gene in the synthesis of UDP-Rha in plants, the significant up
regulation during the maturation stage of A. thaliana pollen grains, the absence of
homozygous plants for the T-DNA insertion in this gene, the production of pollen
grains with altered morphology by heterozygotes and the detection of reduction of
pectic compounds in the altered pollen grains support the hypothesis for the
fundamental role of UER1 in pectin metabolism in A. thaliana pollen grains and
possibly, in other species.
99
Livros Grátis
( http://www.livrosgratis.com.br )
Milhares de Livros para Download:
Baixar livros de Administração
Baixar livros de Agronomia
Baixar livros de Arquitetura
Baixar livros de Artes
Baixar livros de Astronomia
Baixar livros de Biologia Geral
Baixar livros de Ciência da Computação
Baixar livros de Ciência da Informação
Baixar livros de Ciência Política
Baixar livros de Ciências da Saúde
Baixar livros de Comunicação
Baixar livros do Conselho Nacional de Educação - CNE
Baixar livros de Defesa civil
Baixar livros de Direito
Baixar livros de Direitos humanos
Baixar livros de Economia
Baixar livros de Economia Doméstica
Baixar livros de Educação
Baixar livros de Educação - Trânsito
Baixar livros de Educação Física
Baixar livros de Engenharia Aeroespacial
Baixar livros de Farmácia
Baixar livros de Filosofia
Baixar livros de Física
Baixar livros de Geociências
Baixar livros de Geografia
Baixar livros de História
Baixar livros de Línguas
Baixar livros de Literatura
Baixar livros de Literatura de Cordel
Baixar livros de Literatura Infantil
Baixar livros de Matemática
Baixar livros de Medicina
Baixar livros de Medicina Veterinária
Baixar livros de Meio Ambiente
Baixar livros de Meteorologia
Baixar Monografias e TCC
Baixar livros Multidisciplinar
Baixar livros de Música
Baixar livros de Psicologia
Baixar livros de Química
Baixar livros de Saúde Coletiva
Baixar livros de Serviço Social
Baixar livros de Sociologia
Baixar livros de Teologia
Baixar livros de Trabalho
Baixar livros de Turismo