proof

Comments

Transcription

proof
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
HISTOLOGICAL EVALUATION OF FRESH FROZEN AND CRYOPRESERVED HOMOLOGUE
ILIAC CREST GRAFTS USED IN SINUS LIFTING: A COMPARATIVE STUDY
S. FANALI1*, M. DANZA1*, P. TRISI1, A. VISCIONI2,
L. RIGO2, V. SOLLAZZO3, G. BRUNELLI4,5, F. CARINCI4
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
2
Department of Maxillofacial Surgery, Civil Hospital, Castelfranco Veneto, Italy
3
Orthopaedic Clinic, University of Ferrara, Ferrara, Italy
4
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
5
Don Orione Hospital, Bergamo, Italy
1
*These two authors equally contributed to this paper
O
R
In the last decade, several investigators have reported that autologous and homologous fresh frozen (FFB) and
cryopreserved homologue bones (CFFB) are effective materials to restore alveolar ridges previous to insert dental
implants. Here we reported a histological comparative study between FFB and CFFB. Patients were treated with a
split mouth scheme for sinus lifting and bone grafting with FFB and CFFB. Eleven patients were enrolled, 9 males
and 2 females, median age 51 years. They were treated at the Department of Maxillofacial Surgery, Civil Hospital,
Castelfranco Veneto, Italy in the period January 2008 – December 2008. The study was approved by the Local
Ethical Committee. Histological evaluation was performed on bone specimens at the time of grafting and after
4, 6, 10 and 18 months. Statistical test demonstrated that no difference exists between FFB and CFFB over time.
Vital Bone Volume increase during the follow-up demonstrating that both FFB and CFF are good scaffold for bone
regeneration. In conclusion, iliac crest FFB and CFFB are valuable materials for alveolar ridge augmentation:
they are cheap, available in programmed amounts, safe and avoid a second operation field.
P
Craniofacial “skeletal” defects should be ideally
corrected with autologous bone or cartilage by
replacement or augmentation. Although autografts are the
standard procedure for bone grafting, it is sometimes not
possible to harvest bone and collect an adequate amount
of bone from other donor sites of the same patient.
Moreover, autologous bone grafts have the drawback of
secondary surgery for autograft retrieval, with increased
operation time and anesthesia, and donor site morbidity.
On the other hand, biomaterials are good but expensive,
and may extrude at a later date. So, the use of allograft
bone provides a reasonable alternative to meet the need
for graft material (1).
Bone allograft transplantation has been performed in
humans for more than one hundred years and is being
used in increasing numbers by orthopedic surgeons also
for ligament reconstruction, meniscal transplantation, and
articular surface reconstruction (2).
In Europe, organ centers play an intermediary role
in the donation of tissue and organs and their allocation
and transplantation. They take responsibility for donor
medical/safety screening and organize procurement.
Allocation of tissues is performed according to rules set
by committees of renowned experts in the field. Bone
banking and the clinical use of banked tissue are the most
common forms of allopreservation and transplantation in
modern medicine (3, 4).
Many forms of banked bone allograft are available to
the surgeon. Among the grafts available are fresh-frozen
bone (FFB), freeze-dried bone (FDB), and demineralized
fresh dried bone (DFDB) Each one of these grafts carries
risks and has unique limitations and handling properties.
Key words: Bone, graft, pre-prosthetic surgery, allograft, homograft, histology
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C.
Section of Maxillofacial Surgery
University of Ferrara
Corso Giovecca 203 44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
1
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
2 (S)
S. FANALE ET AL.
In order to use these materials appropriately, the surgeon
must be familiar with the properties of each and must
feel confident that the bone bank providing the graft is
supplying a safe and sterile graft (5, 6).
Recently our group verified the stability of FFB bone
grafts over time (Franco et al. 2008a) and the effectiveness
of this material used for alveolar ridge reconstruction in
pre-prosthetic surgery (3-6).
Also cryopreserved homologous bone (CFFB) was
investigated from a clinical point of view (7). The study
demonstrated that autologous, FFB and CFB have similar
clinical outcome in term of implants’ survival and bone
resorption around fixture neck.
Here, a split mouth study is performed on FFB and
CFFB to evaluate the histological changes over time in a
period of 18 months to detect the osteogenic potential of
the two types of grafts.
mg Nimesulid twice daily for 3 days. Oral hygiene instructions
were provided. Grafts were en-block and inserted with sinus
lift elevation technique. Sutures were removed 14 days after
surgery. All patients were included in a strict hygiene recall.
Specimens were collected at time zero and after 4, 6, 10 and 18
months.
F
O
Histologic and Histomorphometric Procedure
The evaluated specimens were infiltrated in methacrylate
resin from a starting solution of 50% ethanol resin and
subsequently 100% resin. Each step in this process required
a 24-hour period. Photopolymerization was obtained using a
48-hour blue-light exposure. After polymerization, the blocks
were ground to remove excess resin and expose the tissue and
then glued on plastic slides using a methacrylate-based glue.
A Micromet high-speed rotating- blade microtome (Remet,
Bologna, Italy) was used to separate the section from the block
to obtain a 250-µm-thick section. The section was ground
down to about 40 µm using an LS-2 grinding machine (Remet,
Bologna, Italy) equipped with waterproof grinding paper. After
grinding, each section was polished with polishing paper and a
3-µm polishing cream. Two different staining procedures were
used for these sections. Toluidine blue was used to analyze the
different ages and remodeling patterns of the bone, and basic
fuchsin was used to distinguish the fibrous tissue and for better
contrast.
The histomorphometric analysis was performed by
digitizing the images from the microscope via a JVC TK-C1380
color video camera (JVC Victor, Yokohama, Japan) and a frame
grabber. Subsequently, the digitized images were analyzed
by image-analysis software (IAS 2000, Delta Sistemi, Rome,
Italy). The images were acquired with a 50 magnification. For
each samples the two most central sections were analyzed. The
parameters calculated using the IAS 2000 software were:
- Bone Volume % (BV/TV): Bone Volume (BV) is the
volume of the mineralized bone whereas the Total Volume (TB)
is the mineralized bone plus non mineralized matrix.
- Graft Volume % (GV/TV): is the amount of graft particles
still present in the specimens.
- Vital Bone % (VB/TV): is the amount of mineralized bone
after subtraction of the Graft Volume (GV/TV)
O
R
MATERIALS AND METHODS
Study design/sample
The study population was composed of patients split mouth
grafted with FFB and CFFB presenting to the Maxillofacial
Surgery, Castelfranco Veneto, Italy for evaluation and implant
treatment between January 2008 and December 2008.
Subjects were screened according to the following inclusion
criteria: controlled oral hygiene and absence of any lesions in the
oral cavity; in addition, the patients had to agree to participate in
a post-operative check-up program.
The exclusion criteria were as follows: bruxists, smoking
more than 20 cigarettes/day, consumption of alcohol higher than
2 glasses of wine per day, localized radiation therapy of the oral
cavity, antitumor chemotherapy, liver, blood and kidney diseases,
immunosupressed patients, patients taking corticosteroids,
pregnant women, inflammatory and autoimmune diseases of the
oral cavity.
P
Graft material
The FFB - obtained from the Veneto Tissue Bank in Treviso
(Italy) - is a mineralized, non-irradiated, only disinfected and
frozen homologous bone. The bone harvesting is obtained from
the anterior and posterior iliac crest, in the first 12 hours after
donor death and processed as previously described (3).
CFFB is selected and processed in the same way of FFB but
bone is frozen at a rate of - 1°C per minute and then stored in
liquid N2 vapor for a maximum period of 5 years and processed
as previously described (7).
Summary of operative methods
Before surgery, radiographic examinations were done with
the use of CT scans.
All patients underwent the same surgical protocol. An
antimicrobial prophylaxis was administered with 1g Amoxycillin
twice daily for 5 days starting 1 hour before surgery. Local
anesthesia was induced by infiltration with articaine/epinephrine
and post-surgical analgesic treatment was performed with 100
Data analysis
T-test (Test for equality of variance) was used to detect
statistical differences between median values.
RESULTS
Eleven patients (2 females and 9 males) with a median
age of 51 years have the inclusion criteria and were
enrolled in the present study. Informed written consent
approved by the local Ethics Committee was obtained
from patients to use their data for research purposes.
Two specimens per patients, one inserted in FFB
(Fig. 1) and one inserted in CFFB (Fig. 2), were sampled.
Samplings were performed at the time of grafting and after
4, 6, 10 and 18 months. Table I reports the histological
F
3 (S)
European Journal of Inflammation
results. Statistical test demonstrated that no difference
exists between FFB and CFFB over time.
DISCUSSION
The treatment of severe maxillary residual ridge
resorption involves various grafting materials such as
autogenous bone or bone substitutes. Autogenous bone is
the “gold standard” for grafting materials; however, the
necessity of a second operation field and a great amount
of bone needed to be harvested could be a limitation.
Homograft provides a reasonable alternative: it is cheap,
available in programmed amounts, safe (at least for known
pathologies) and avoids a second operation field (2).
In a previous study the effectiveness of FFB was
demonstrated (2): only 4 over 140 grafts failed with a
success rate of 97.2% and the surgical technique was the
variable related to the failures. No complications like high
amount of blood loss and higher duration of hospitalization
were detected. An average bone resorption of 22.8% was
reported and grafts become stable after functional bone
loading.
In following studies on a series of dental implants
inserted in the same FFB it was demonstrated that fixtures
inserted in FFB have a clinical outcome similar to those
inserted in native (i.e. not grafted) bone (3-6).
Subsequently we planned a retrospective study on
84 SPIs inserted into native, FFB and CFFB to estimate
implant survival and changes in crestal bone resorption:
FFB and CFFB have a limited number of lost implant and
a low degree of crestal bone resorption around implant’
neck (7).
Here we performed and histological evaluation of FFB
and CFFB used for maxillary sinus lifting. Statistical test
demonstrated that no difference exists between FFB and
CFFB over time. Noteworthy Vital Bone Volume increase
during the follow-up demonstrating that both FFB and
CFF are good scaffold for bone regeneration.
In conclusion, iliac crest FFB and CFFB are valuable
materials for alveolar ridge augmentation: they are cheap,
available in programmed amounts, safe and avoid a
second operation field.
F
O
O
R
Table I. Histological evaluation of FFB and CFFB grafts retrieved after different months
P
Months
Bone Volume %
-
0
4
6
10
FFB
39.0 ± 39.7
30.4 ± 19.7
14.2 ± 5.4
28.1 ± 7.6
CFFB
25.0 ± 7.7
19.4 ± 13.5
19.8 ± 13.1
23.7 ± 6.7
0.272
0.390
0.180
0.841
p values
Graft Volume %
FFB
31.3 ± 44.2
10.2 ± 9.9
3.7 ± 2.5
19.6 ± 21.1
CFFB
7.4 ± 4.7
4.4 ± 4.6
7.4 ± 8.1
8.6 ± 6.0
0.150
0.10
0.085
0.068
FFB
0.1 ± 0.1
9.1 ± 6.3
10.6 ± 6.2
18.6 ± 7.1
CFFB
0.1 ± 0.1
12.6 ± 14.6
17.2 ± 7.5
15.1 ± 9.7
1.15
0.126
0.762
0.621
p values
Vital Bone Volume %
p values
Fig.1. FFB graft sampled after 4 months: there are several
trabecule of grafted FFB and newly formed woven bone. There
are resorption process in the grafted bone.
Fig.2. CFFB graft sampled after 18 months: there are several
and thick bone trabecule. There is woven and lamellar bone.
4 (S)
S. FANALE ET AL.
ACKNOWLEDGEMENTS
This work was supported by FAR from the University
of Ferrara (FC), Ferrara, Italy, and from Regione Emilia
Romagna, Programma di Ricerca Regione Universita,
2007–2009, Area 1B: Patologia osteoarticolare: ricerca preclinica e applicazioni cliniche della medicina rigenerativa
Unita Operativa n. 14, and PRIN 2008 (F.C.).
4.
5.
REFERENCES
1.
2.
3.
Carinci F, Farina A, Zanetti U, Vinci R, Negrini S, Calura
G, Laino G, Piattelli A. Alveolar ridge augmentation: a
comparative longitudinal study between calvaria and iliac
crest bone grafrs. J Oral Implantol 2005; 31:39-45.
Franco M, Viscioni A, Rigo L, Guidi R, Brunelli G, Carinci
F. Iliac crest fresh frozen homografts used in pre-prosthetic
surgery: a retrospective study. Cell Tissue Bank 2009; 10:
227-33.
Carinci F, Brunelli G, Franco M, Viscioni A, Rigo L, Guidi
6.
R, Strohmenger L. A retrospective study on 287 implants
installed in resorbed maxillae grafted with fresh frozen
allogenous bone. Clin Implant Dent Relat Res; 12:91-8.
Franco M, Tropina E, De Santis B, Viscioni A, Rigo L,
Guidi R, Carinci F. A 2-year follow-up study on standard
length implants inserted into alveolar bone sites augmented
with homografts. Stomatologija 2008; 10:127-32.
Viscioni A, Franco M, Rigo L, Guidi R, Spinelli G, Carinci
F. Retrospective study of standard-diameter implants
inserted into allografts. J Oral Maxillofac Surg 2009; 67:
387-93.
Carinci F, Brunelli G, Zollino I, Franco M, Viscioni A,
Rigo L, Guidi R, Strohmenger L. Mandibles grafted with
fresh-frozen bone: an evaluation of implant outcome.
Implant Dent 2009; 18:86-95.
Viscioni A, Franco M, Paolin A, Cogliati E, Callegari M,
Zollino I, Sollazzo V, Carinci F. Effectiveness of fresh
frozen and cryopreserved homologue iliac crest grafts used
in sinus lifting: a comparative study. Cell Tissue Bank.
F
O
P
O
R
7.
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
COMPARISON BETWEEN IMPLANTS INSERTED IN FRESH FROZEN AND
CRYOPRESERVED GRAFTS: AN HISTOLOGICAL STUDY
M. DANZA1*, S. FANALI1*, P. TRISI1, A. VISCIONI2,
B. DE SANCTIS2, V. SOLLAZZO3, G. BRUNELLI4,5, F. CARINCI4
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
2
Department of Maxillofacial Surgery, Civil Hospital, Castelfranco Veneto, Italy
3
Orthopaedic Clinic, University of Ferrara, Ferrara, Italy
4
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
5
Don Orione Hospital, Bergamo, Italy
1
*These two authors equally contributed to this paper
O
R
In the last decade, several investigators have reported that autologous and homologous fresh frozen (FFB) and
cryopreserved homologue bones (CFFB) are effective materials to restore alveolar ridges previous to insert dental
implants. Here we reported a histological comparative study on implants inserted in FFB and CFFB to detect the
osteogenic potential of the two types of grafts. Patients were treated with a split mouth scheme for sinus lift with FFB
and CFFB bone grafting and immediate implant insertion to evaluate the bone implant contact after 6 months. Three
patients were enrolled, 2 males and 1 female, median age 52 years. They were treated at the Department of Maxillofacial
Surgery, Civil Hospital, Castelfranco Veneto, Italy in the period January 2008 – December 2008. The study was
approved by the Local Ethical Commetee. Histological evaluation was performed on bone speciments containing spiral
implants (Alpha Bio LTD, Petah-Tikva, Israel) after 6 months. Statistical test demonstrated that no difference exists
between dental implants inserted in FFB and CFFB. However, FFB has a higher values of Vital Bone Volume Percentage
suggesting it has higher potential in bone regeneration. In conclusion, iliac crest FFB and CFFB are valuable materials
for alveolar ridge augmentation and implant insertion. Spiral implants can be immediately inserted in grafted bone.
P
The anatomical limitations of residual alveolar bone
can cause problems for the insertion of dental implants
(1). Less-than-ideal sites can result in an esthetic and
functional compromise because implant placement
requires an adequate quantity and quality of bone. In
many cases, however, this anatomic problem can be
solved with autogenous bone grafts, which are the most
predictable and successful material available (1).
Although autografts are the standard procedure for
bone grafting, it is sometimes not possible to collect an
adequate amount of bone from other donor sites on the
same patient. Moreover, autologous bone grafts have
the drawback of a secondary surgery field for autograft
retrieval, with increased operation time and anesthesia,
and donor site morbidity. On the other hand, biomaterials
are good but expensive, and may extrude at a later date.
So, the use of homologue bone provides a reasonable
alternative to meet the need for graft material (2).
Recently our group verified the stability of FFB bone
grafts over time (2) and the effectiveness of this material
used for alveolar ridge reconstruction in pre-prosthetic
surgery (3-6).
Also cryopreserved homologous bone (CFFB) was
investigated from a clinical point of view (7). The study
demonstrated that autologous, FFB and CFB have similar
clinical outcome in term of implants’ survival and bone
resorption around fixture neck.
Here, a split mouth study is performed on implants
immediately inserted in FFB and CFFB used for sinus
lifting to evaluate the bone implant contact after 6 months
Key words: Bone, graft, pre-prosthetic surgery, allograft, homograft, histology
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C.,
Section of Maxillofacial Surgery
University of Ferrara
Corso Giovecca 203 44100 Ferrara
ItalyE-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
5
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
6 (S)
M. DANZA ET AL.
to detect the osteogenic potential of the two types of
grafts.
MATERIALS AND METHODS
Study design/sample
The study population was composed of patients who
underwent to split mouth grafting with FFB and CFFB
presenting to the Maxillofacial Surgery, Castelfranco Veneto,
Italy for evaluation and implant treatment between January 2008
and December 2008.
Subjects were screened according to the following inclusion
criteria: controlled oral hygiene and absence of any lesions in the
oral cavity; in addition, the patients had to agree to participate in
a post-operative check-up program.
The exclusion criteria were as follows: bruxists, smoking
more than 20 cigarettes/day, consumption of alcohol higher than
2 glasses of wine per day, localized radiation therapy of the oral
cavity, antitumor chemotherapy, liver, blood and kidney diseases,
immunosupressed patients, patients taking corticosteroids,
pregnant women, inflammatory and autoimmune diseases of the
oral cavity.
resin. Each step in this process required a 24-hour period.
Photopolymerization was obtained using a 48-hour blue-light
exposure, and implants oriented longitudinally to display the
opposing surfaces. After polymerization, the blocks were ground
to remove excess resin and expose the tissue and then glued on
plastic slides using a methacrylate-based glue. A Micromet
high-speed rotating- blade microtome (Remet, Bologna, Italy)
was used to separate the section from the block to obtain a
250-µm-thick section. The section was ground down to about
40 µm using an LS-2 grinding machine (Remet, Bologna, Italy)
equipped with waterproof grinding paper. After grinding, each
section was polished with polishing paper and a 3-µm polishing
cream. Two different staining procedures were used for these
sections. Toluidine blue was used to analyze the different ages
and remodeling patterns of the bone, and basic fuchsin was used
to distinguish the fibrous tissue and for better contrast.
The histomorphometric analysis was performed by
digitizing the images from the microscope via a JVC TK-C1380
color video camera (JVC Victor, Yokohama, Japan) and a frame
grabber. Subsequently, the digitized images were analyzed
by image-analysis software (IAS 2000, Delta Sistemi, Rome,
Italy). The images were acquired with a 50 magnification of the
implant and surrounding bone. For each samples the two most
central sections were analyzed. The parameters calculated using
the IAS 2000 software were:
- Bone Volume % (BV/TV): Bone Volume (BV) is the
volume of the mineralized bone whereas the Total Volume (TB)
is the mineralized bone plus non mineralized matrix.
- Graft Volume % (GV/TV): is the amount of graft particles
still present in the specimens.
- Vital Bone % (VB/TV): is the amount of mineralized bone
after subtraction of the Graft Volume (GV/TV)
- Bone-to-implant contact % (BIC) is the linear surface of
the implant directly contacted by the bone matrix and expressed
as a percentage of the total implant surface.
E) Data analysis
T-test (Test for equality of variance) was used to detect
statistical differences between median values.
F
O
O
R
Graft material
The FFB - obtained from the Veneto Tissue Bank in Treviso
(Italy) - is a mineralized, non-irradiated, only disinfected and
frozen homologous bone. The bone harvesting is obtained from
the anterior and posterior iliac crest, in the first 12 hours after
donor death and processed as previously described (3).
CFFB is selected and processed in the same way of FFB but
bone is frozen at a rate of - 1°C per minute and then stored in
liquid N2 vapor for a maximum period of 5 years and processed
as previously described (7).
P
Summary of operative methods
Before surgery, radiographic examinations were done with
the use of CT scans.
All patients underwent the same surgical protocol. An
antimicrobial prophylaxis was administered with 1g Amoxycillin
twice daily for 5 days starting 1 hour before surgery. Local
anesthesia was induced by infiltration with articaine/epinephrine
and post-surgical analgesic treatment was performed with 100
mg Nimesulid twice daily for 3 days. Oral hygiene instructions
were provided. Grafts were en-block and inserted with sinus lift
elevation technique.
Spiral implants (Alpha Bio LTD, Petah-Tikva, Israel) were
inserted in the same grafting surgical operation. The implant
platform was positioned at the alveolar crest level. Sutures
were removed 14 days after surgery. After 6 months from
implant insertion, a second surgery was performed to drill
bone containing an implant and the surrounding bone (native
and grafted). Two mini implant were removed per patients, one
placed in FFB and one in CFFB graft. All patients were included
in a strict hygiene recall.
Histologic and Histomorphometric Procedure
The specimens were infiltrated in methacrylate resin from a
starting solution of 50% ethanol resin and subsequently 100%
RESULTS
Three patients (one female and two males) with a
median age of 52 years have the inclusion criteria and
were enrolled in the present study. Informed written
consent approved by the local Ethics Committee was
obtained from patients to use their data for research
purposes. Two implants per patients were retrieved after
6 months, one inserted in FFB (Fig. 1) and one inserted
in CFFB (Fig. 2). Table I report the histological results.
Statistical test demonstrated that no difference exists
between dental implants inserted in FFB and CFFB.
DISCUSSION
The treatment of severe maxillary residual ridge
resorption involves various grafting materials such as
F
7 (S)
European Journal of Inflammation
autogenous bone or bone substitutes. Autogenous bone
is the “gold standard” for grafting materials; however the
necessity of a second operation field and a great amount
of bone needed to be harvested could be a limitation.
Homograft provides a reasonable alternative: it is cheap,
available in programmed amounts, safe (at least for known
pathologies) and avoids a second operation field (2).
In a previous study the effectiveness of FFB was
demonstrated (2): only 4 over 140 grafts failed with a
success rate of 97.2% and the surgical technique was
the variable related to the failures. No complications
like high amount of blood loss and higher duration
of hospitalization were detected. An average bone
resorption of 22.8% was reported and grafts become stable
after functional bone loading.
In following studies on a series of dental implants
inserted in the same FFB it was demonstrated that fixtures
inserted in FFB have a clinical outcome similar to those
inserted in native (i.e. not grafted) bone (2-5).
According to recent literature, we decided to use
the CFFB because it showed an improved angiogenesis
induction and enhanced immune tolerance compared with
unprotected frozen grafts (8); furthermore CFFB, thanks
to dimethyl sulfoxide (DMSO) treatment; preserves some
residual osteoblast cell viability (9, 10) which may be of
importance in the early revascularization improving graft
incorporation (11).
Subsequently we planned a retrospective study on
84 SPIs inserted into native, FFB and CFFB to estimate
implant survival and changes in crestal bone resorption:
FFB and CFB have a limited number of lost implant and
a low degree of crestal bone resorption around implant’
neck (7).
Here we performed and histological evaluation
of implant immediately inserted in FFB and CFFB.
Statistical test demonstrated that no difference exists
between dental implants inserted in FFB and CFFB
(Table I). However, FFB has a higher values of Vital Bone
Volume Percentage suggesting it has higher potential in
bone regeneration.
In this study spiral implants (Alpha Bio LTD, PetahTikva, Israel) were inserted. A spiral implant is a conical
internal helix implant with a variable thread design which
confer the characteristic of self drilling, self tapping
and self bone condensing. These proprieties offer better
control during insertion and high initial stabilization even
in poor quality bone. Small diameter drilling results in
reduced trauma and minimal bone loss. Location and
orientation of implant can be altered even after initial
insertion without trauma to the surrounding tissues. Its
advantages are particularly obvious in compromised
situations where there is minimal amount of bone and
Variable
FFB
CFFB
F
O
Bone Volume %
39.7 ± 32.9
19.1 ± 13.1
0.542
Graft Volume %
3.6 ± 1.6
10.1 ± 8.6
0.066
Vital Bone Volume %
36.2 ± 34.5
8.9 ± 11.2
0.448
Bone Implant Contact
0.1 ± 0.1
0.1 ± 0.1
1.150
O
R
P
Table 1. Histological evaluation of grafts and implants retrieved after 6 months.
Fig. 1. Fixture inserted in FFB. After 6 months there is a low
amount of newly formed bone and the BIC cover a small part of
the implant
p values
Fig. 2. Implant inserted in CFFB. The bone around implant is
mainly composed by CFFB, there are few island of newly formed
bone and it has low density. BIC is not well developed.
8 (S)
M. DANZA ET AL.
low bone density, achieving high stabilization in freshly
extracted sites and thin sinus floors without prior bone
augmentation. The self drilling capability of the implant
allows it to be inserted into sites that have been prepared
to a reduced depth. This ability becomes very useful in
situations of close proximity to anatomical structures
such as the mandibular nerve canal or the maxillary sinus
and nose cavity. The Spiral Family Implants (SFIs) is
composed by two types of implants, the Spiral Implant
(SPI) and the Spiral Flare Bevel (SFB). This last has a
reverse conical head that allows for an increased volume
of crestal bone around the implant neck. That accounts
for some additional benefits such as a closer placement
of adjacent implants without compromising health tissues
and aesthetic outcome. This last was always used in this
study.
In conclusion, iliac crest FFB and CFFB are valuable
materials for alveolar ridge augmentation and implant
insertion. Spiral implants can be immediately inserted
in grafted bone.
This work was supported by FAR from the University
of Ferrara (FC), Ferrara, Italy, and from Regione Emilia
Romagna, Programma di Ricerca Regione Universita,
2007–2009, Area 1B: Patologia osteoarticolare: ricerca preclinica e applicazioni cliniche della medicina rigenerativa
Unita Operativa n. 14, and PRIN 2008 (F.C.).
P
2.
F
O
O
R
ACKNOWLEDGEMENTS
1.
227-33.
3. Carinci F, Brunelli G, Franco M, Viscioni A, Rigo L, Guidi
R, Strohmenger L. A retrospective study on 287 implants
installed in resorbed maxillae grafted with fresh frozen
allogenous bone. Clin Implant Dent Relat Res; 12:91-8.
4. Viscioni A, Franco M, Rigo L, Guidi R, Spinelli G, Carinci
F. Retrospective study of standard-diameter implants
inserted into allografts. J Oral Maxillofac Surg 2009; 67:
387-93.
5. Carinci F, Brunelli G, Zollino I, Franco M, Viscioni A,
Rigo L, Guidi R, Strohmenger L. Mandibles grafted with
fresh-frozen bone: an evaluation of implant outcome.
Implant Dent 2009; 18:86-95.
6. Franco M, Tropina E, De Santis B, Viscioni A, Rigo L,
Guidi R, Carinci F. A 2-year follow-up study on standard
length implants inserted into alveolar bone sites augmented
with homografts. Stomatologija 2008; 10:127-32.
7. Viscioni A, Franco M, Paolin A, Cogliati E, Callegari M,
Zollino I, Sollazzo V, Carinci F. Effectiveness of fresh
frozen and cryopreserved homologue iliac crest grafts used
in sinus lifting: a comparative study. Cell Tissue Bank.
8. Wingenfeld C, Egli RJ, Hempfing A, Ganz R, Leunig M.
Cryopreservation of osteochondral allografts: dimethyl
sulfoxide promotes angiogenesis and immune tolerance in
mice. J Bone Joint Surg Am 2002; 84-A:1420-9.
9. Egli RJ, Sckell A, Fraitzl CR, Felix R, Ganz R, Hofstetter
W, Leunig M. Cryopreservation with dimethyl sulfoxide
sustains partially the biological function of osteochondral
tissue. Bone 2003; 33:352-61.
10. Reuther T, Rohmann D, Scheer M, Kubler AC. Osteoblast
viability and differentiation with Me2SO as cryoprotectant
compared to osteoblasts from fresh human iliac cancellous
bone. Cryobiology 2005; 51:311-21.
11. Egli RJ, Wingenfeld C, Holzle M, Hempfing A, Fraitzl CR,
Ganz R, Leunig M. Histopathology of cryopreserved bone
allo- and isografts: pretreatment with dimethyl sulfoxide. J
Invest Surg 2006; 19:87-96.
REFERENCES
Carinci F, Farina A, Zanetti U, Vinci R, Negrini S, Calura
G, Laino G, Piattelli A. Alveolar ridge augmentation: a
comparative longitudinal study between calvaria and iliac
crest bone grafrs. J Oral Implantol 2005; 31:39-45.
Franco M, Viscioni A, Rigo L, Guidi R, Brunelli G, Carinci
F. Iliac crest fresh frozen homografts used in pre-prosthetic
surgery: a retrospective study. Cell Tissue Bank 2009; 10:
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
COMPARISON BETWEEN IMPLANT RETRIEVED FROM HUMAN MANDIBLE AND
MAXILLA: AN HISTOMORPHIC-METRIC EVALUATION
T. TRAINI1*, M. DANZA2*, I. ZOLLINO3, L. MARINUCCI 4, F. CARINCI3
F
O
EIS-international educational society and private practice, San Benedetto del Tronto, Italy
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
3
Department of D.M.C.C.C., Maxillofacial Surgery Section, University of Ferrara, Ferrara, Italy
4
Department of Experimental Medicine and Biochemical Sciences, University of Perugia, Perugia, Italy
1
2
*
These two authors equally contributed to this paper
The aim of the present study was to compare the course of osseointegration speculating the bone-to-implant
contact (BIC) rate, the osteocytes density (OD) and the collagen fiber orientation (CFO) in one implant retrieved
from mandible and in one retrieved from maxilla. A SLA (Sand-blasted, Large grit, Acid-etched) surface implant of
3.3 mm x 15 mm was placed in a male 53 years old in the anterior region of the mandible bone (4.1) and an implant
Dental Implant Line (sand blasted surface) of 3.75 x 16 mm was placed in the anterior region of the maxillary bone
(2.1) in a female of 50 years old after a bone augmentation procedure. These implants were processed for histology.
The specimens were analyzed under the confocal scanning laser microscope (CSLM) and brightfield light microscope
(LM) equipped with circularly polarized light (CPL). The BIC rate of the implant retrieved after 23 months was 76.7±
4.9 (mean ±SD) while for the implant retrieved after 13 years it was 68.7 ± 3.7. The histomorphometric evaluation
showed a predominantly woven bone around the 23 months implant, while around the 13 years implant the bone
was manly lamellar. The transverse CFO (mean ±SD) under the lower flank of the thread near the tread tip was 55.2
± 4.8 x 104 pixel for the 23 months specimen and 20.4 ± 3.5 x 104 for the 13 years specimen (P<.05). The longitudinal
CFO (mean ±SD) in the inter-threads region was 65.6 ± 6.5 x 104 pixel for the 23 months specimen and 21.4 ± 3.0 x
104 for the 13 years specimen (P<.05). In the 23 months specimen much more longitudinal CFO were present in the
inter-threads area, while under the lower flank of the thread there were much more transverse CFO. In the 13 years
specimens the difference in transverse and longitudinal CFO appeared to be not statistically significant due to the
lamellar nature of the peri-implant bone which presents alternating CFO in adjacent bone lamellae. The OD (mean
±SD) was 205 ± 45 in the specimen after 23 months and 130 ± 34 in the specimen after 13 years (P<.001).
O
R
P
Osseointegration is widely accepted in clinical
dentistry as the basis for dental implant success.
Failure to achieve osseointegration at a high rate can be
attributed to one or more implant, local anatomic, local
biologic, systemic or functional factors (1). Moreover, the
performance and maintenance of osseointegrated dental
implants in function are dependent upon several factors:
1) load transmission at the bone-to-implant interface
(2); 2) the amount and quality of the bone (3); and 3) the
surface characteristics of the implant (4).
A major interest in implant design factors is evident
and clinical efforts to improve implant success have been
focused on increasing the amount of bone that forms at
the endosseous implant surface. Implant surface character
is one implant design factor affecting the rate and extent
of osseointegration .Following the osseointegration the
bone tissue is formed around an alloplastic material
(implant) in an hierarchical mode (following at the best
the implant macro-micro-nano-structures) satisfying
the environmental needs (unloading vs. loading) with
stiffness and adequate strength. Yet to maintain the
osseointegration bone must be adaptable and repairable.
Key Words: Circularly Polarized Light Microscopy; collagen fiber orientation; bone implant contact rat; implant fracture;
osseointegration.
Corresponding author: Prof. Francesco Carinci MD, DDS
Department of D.M.C.C.C.
Section of Maxillofacial Surgery
Corso Giovecca, 203 44100 (Italy)
Phone: +39.0532.455874
Fax: +39.0532.455582
e-mail: [email protected]
0393-974X (2011)
9
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
10 (S)
T. TRAINI ET AL.
So the peri-implant bone architecture is an answer to the
above requirements.
Until now, most of the histological analyses in implant
dentistry were based on the bone to- implant contact
(BIC) without also considering bone matrix organization.
However, the mechanical properties of the bone and its
spatial arrangement are considered to be very important
factors (5). Considerable amount of experimental and
numerical studies have been performed on understanding
the mechanism of load transfer from the implant to the
bone using the finite element analysis (FEA) methods.
Nevertheless, some limitation of FEA methods still remain
i.e. the anisotropic character of the bone tissue, the lack of
spatiotemporal dynamic response of the bone cells and
consequently bone matrix rearranging. The peri-implant
bone adjusts its architecture in relation to its functional load
bearing (6). The differences between implant surfaces and
morphologies are important for the stability of implants
under load and are also of major importance for the bone
forming osteoblasts to promote matrix mineralization
in the vicinity of the implant. Primary bone is easily
distinguished from secondary osteons of remodeled bone
since, secondary osteons are formed through a resorption
and replacement process and their outer margin will often
intersect lamellae of the surrounding bone. Additionally,
secondary osteons can usually be distinguished from
primary osteons by their reoriented collagen matrix,
as seen under Circularly Polarized Light Microscopy
(CPLM), and their circumferential margin known as the
cement line. By definition, primary osteons do not have
cement lines.
The principal factor in determining the mechanical
properties of bone is the collagen configuration in the matrix
and corresponding orientation of mineral crystallites that
also reflects the mechanical microenvironment at the time
of bone formation (7). So, the quantity and orientation of
the collagen fibers surrounding the implant can serve as a
reliable measure of osseointegration quality. Determining
the collagen fiber orientation (CFO) in peri-implant bone
matrix by a means of CPLM is an alternative avenue to
study the load transfer along the bone-dental implant
interface over the time. The different mechanical loading
environment affects the collagen orientation and it could
alter osteoblasts in a manner that causes a characteristic
orientation in the fibers they synthesize: bone under
compression shows transversely oriented collagen,
whereas bone under tension shows longitudinally
oriented collagen (8). Moreover, the CFO in bone could
help obtain information about the relation among implant
design, distribution of stress applied to the bone, and the
growth of bone (9).
Given recent findings implicating osteocytes as
regulators of bone remodeling, bone formation and bone
volume (10). Osteocytes are the most abundant cells in
the bone that form a cellular syncytium able to sense
the local environment and to influence bone remodeling
(11). Moreover, they play a crucial role in maintaining
the mechanical quality of bone: osteocyte density is
positively related to the proportion of osteoid surface
covered by osteoblasts and it could be considered as an
alternative index in assessing bone quality.
The aim of the present study was to compare the
course of osseointegration speculating the bone-toimplant contact (BIC) rate, the osteocytes density and the
collagen fiber organization in one implant retrieved from
mandible and one retrieved from maxilla .
F
O
MATERIALS AND METHODS
P
O
R
Implants
A SLA (Sand-blasted, Large grit, Acid-etched) surface
implant (Arrow Press fixture, Alpha Bio LTD, Petah-Tikva,
Israel) of 3.3 mm x 15 mm was placed in a male 53 years old
in the anterior region of the mandible bone (4.1) in June 2008.
The implant was immediately loaded with an acrylic resin
restoration. Final restoration in glass-ceramic fused to zirconia
was placed two months later. The implant-restoration undergo to
fracture in July 2010 (after 23 months).
In a female of 50 years old, an implant Dental Implant Line
(sand blasted surface) (Dental Implant Line, Casalpalocco,
Roma, Italy) of 3.75 x 16 mm placed in the anterior region of the
maxillary bone (2.1) after a bone augmentation procedure made
in January 1997 using either DFDBA autologous bone chips and
Gore Tex membrane was used. The implant, placed four months
later the augmentation procedure, remained in function until
to July 2010 (13 years) when it was removed due to implant
platform fracture.
Specimen’s processing
The retrieved specimens were fixed in 4% formalin pH 7.0
for 10 days, and then transferred to a solution of 70% ethanol
until processing. The specimens were dehydrated in increasing
concentrations of alcohol up to 100%, infiltrated and embedded
in LR White (London Resin Company, Berkshire, England)
resin. Undecalcified longitudinal cut sections of 50 µm were
prepared by using a cutting and grinding TT system (TMA2,
Grottammare, AP, Italy). The sections were double stained with
toluidine blue and fuchsine acid for some samples and toluidine
blue stains for others to be analyzed.
Transmitted Light Microscopy (LM)
The histomorphometry was used to evaluate the amount of
bone implant contact rate (BIC%). The investigation was carried
out in a transmitted brightfield Light Microscope Axiolab (Zeiss
Oberchen, Germany) connected to a high-resolution digital
camera (FinePix S2 Pro, Fuji Photo Film Co. LTD. MinatoKu, Japan). An Histometric software package with image
capturing capabilities (Image-Pro Plus 6.0, Media Cybernetics
Inc., Bethesda, MD, USA) was used. To ensure accuracy, the
software was calibrated for each experimental image using a
F
11 (S)
European Journal of Inflammation
software feature named “Calibration Wizard” which reports the
number of pixel between two selected points (diameter or length
of the implant ). The linear remapping of the pixel numbers was
used to calibrate the distance in millimeters
Circularly Polarized Light Microscopy (CPLM)
Birefringence was used to evaluate the collagen fiber
orientation (CFO) of the bone matrix around the implants. The
measurements using polarized light were concentrated mainly
under the thread tip along the lower flank of the thread and in
the inter-threads region. Unstained sections (before staining
procedure) were used. The CFO was evaluated by a means of a
light microscope (Axiolab, Carl Zeiss, Jena, Germany) equipped
with two linear polarizer and two quarter wave plates arranged to
have transmitted circularly polarized light, connected to a highresolution digital camera (FinePix S2 Pro, Fuji Photo Film Co.
LTD. Minato-Ku, Japan). The Collagen fibers aligned perfectly
transverse to the direction of the light propagation (parallel to the
plane of the section) appeared “white-blue” due to a change in
the refraction of exiting light whereas the collagen fibers aligned
along the axis of light propagation (perpendicular to the plane
of the section) appeared “red-yellow”, because no refraction
occurred.
not statistically significant (P= 0.632) (Fig. 2, Table I). The
histomorphometric evaluation showed a predominantly
woven bone around the 23 months implant, while around
the 13 years implant the bone was manly lamellar. The
transverse CFO (mean ±SD) under the lower flank of the
thread near the tread tip was 55.2 ± 4.8 x 104 pixel for the
23 months specimen and 20.4 ± 3.5 x 104 for the 13 years
specimen (P<.05) (Fig. 3, Table II) . The longitudinal
CFO (mean ±SD) in the inter-threads region was 65.6
± 6.5 x 104 pixel for the 23 months specimen and 21.4 ±
3.0 x 104 for the 13 years specimen (P<.05) (Fig. 3, Table
II). In the 23 months specimen much more longitudinal
CFO were present in the inter-threads area, while under
the lower flank of the thread there were much more
transverse CFO (Fig. 4). In the 13 years specimens the
difference in transverse and longitudinal CFO appeared
to be not statistically significant due to the lamellar nature
of the peri-implant bone which presents alternating CFO
in adjacent bone lamellae. The OD (mean ±SD) was 205
± 45 in the specimen after 23 months and 130 ± 34 in
the specimen after 13 years (P<.001) (Fig. 5 and 6, Table
III).
O
R
F
O
Confocal Scanning Laser microscopy
In order to evaluate the osteocytes/ lacunae density the
specimens were stained using basic fuchsin, than evaluated under
a confocal scanning laser microscope (CSLM), TCS-SP, Leica
Microsystems, Wetzlar, Germany) with a 20 x magnification
objective lens. A 568 nm wavelength excitation light was used
to view the fluorescent die. The digitized images were stored in
format JPEG with NxM = 3024 x 2016 grid of pixels for a 24
bit. The osteocytes density (OD) was evaluated as follow OD =
Ot.Lc/BAr where Ot.Lc was the number of osteocytes or lacunae
counted while BAr was the bone area investigated.
P
Statistical analysis
One person (TT) performed all the measurements.
Intra-examiner variability was controlled by carrying out 2
measurements for each index. When for the same index the
difference in the two performed readings exceeded 15 % the
measure was repeated. Statistical analysis was performed by
means of the computerized statistical package (Sigma Stat 3.5,
SPSS inc. Ekrath, Germany). To compare the BIC rate for a
significant difference Z-test was used between two implants.
Parametric tests were used to test the histomorphometric results
after evaluating both the normality test and the equal variance
test. Unpaired t-test was used in the inference of the OD between
two groups while, One-Way ANOVA test was used to evaluate
the CFO toward either implant type and implant site followed by
a multiple comparison procedure using Holm-Sidak method. A P
value of under 0.05 was considered statistically significant.
RESULTS
The BIC rate of the implant retrieved after 23 months
was 76.7± 4.9 (mean ±SD) while for the implant retrieved
after 13 years it was 68.7 ± 3.7 (Fig. 1). The difference was
DISCUSSION
The clinical use of available osseointegrated titanium
implants to substitute missing teeth is widespread
notwithstanding our knowledge of the processes which
take place on the interface during healing is limited.
Moreover, we do not know how several types of implants
become attached to the bone that is the processes involved
in the mechanical interconnections compared to the
chemical one. This lack of information is possibly due
to the lack of techniques for the specific study of these
problems.
However, the osseointegration is widely accepted in
clinical dentistry as the basis for dental implant success
and first this requires a peri-implant bone tissue of good
quality. Failure to achieve osseointegration at a high rate
can be attributed to one or more implant, local anatomic,
local biologic, systemic or functional factors (1).
Implant surface character, an important implant
design factor, represents a great importance for the
implant success because affecting the rate and extent of
osseointegration. For this reasons clinical efforts have
been focused on increasing the amount of bone that
forms at the endosseous implant. During the process
of the osseointegration, after dental implant placement,
the bone tissue is formed around an alloplastic material
(implant) in an hierarchical mode (following at the best
the implant macro-micro-nano-structures) satisfying the
environmental needs with stiffness and adequate strength.
One important factor that influences the formation of the
12 (S)
T. TRAINI ET AL.
F
O
O
R
Fig. 1. Light microscopic view of bone implant contact. In (A)
immediate loaded implant retrieved due to fracture (overloaded)
after 23 months. In (B) delay loaded implant retrieved after 13
years due to implant platform fracture. Toluidine blue staining;
original magnification x 12
P
Fig. 3. Polarized light microscopic images of the bone near the
implant retrieved after 23 months (A ; B) and after 13 years (C;D).
in (A) the bone facing the lower flank of the thread (near the tip),
where the load was transferred to bone by compressive vectors, the
CFO appeared mainly transverse (white-blue)than longitudinal
(white-red). In (A1) the computer separation of the two CFO
orientation. In (B) the bone facing the inter-threads, were the load
was transferred to bone mainly by shear vectors, the CFO was
mostly longitudinal (white-red). In (B1) the computer separation
of the two CFO orientation. In (C) the bone facing the lower flank
of the thread the CFO appeared mainly transverse (white-blue). In
(C1) the computer separation of the two CFO orientation. In (D)
the bone facing the inter-threads the CFO was mostly longitudinal
(white-yellow). In (D1) the computer separation of the two CFO
orientation. Unstained sections; original magnification x 100.
Fig. 2. BIC rate comparison by time. The difference in the
mean values of the two groups appeared to be not statistically
significant (P= 0.632).
bone-to-implant contact (BIC) is the mechanical loading
that sometimes is applied immediately after implant
placement. In fact, immediate loading has recently become
one of the most important research topics in restorative
dentistry and has as main objective, to achieve a high
mechanical stability to avoid micromovements during
the process of osseointegration (12). Yet to maintain the
osseointegration bone must be adaptable and repairable.
So, the knowledge of the peri-implant bone architecture is
an answer to the above requirements.
Implants in function among others, undergo to axial
load that exerts a considerable lateral forces which can
be estimated to F tan ( α) / (2πD) where F, vertical load;
D, is the diameter of the implant. All the occlusal forces
F
13 (S)
European Journal of Inflammation
F
O
O
R
Fig. 4. The CFO comparison for transverse and longitudinal
collagen fiber vs 23 months and 13 years by lower flank of the
thread or between threads. It was noted a statistical significant
association for both implants for transverse CFO to the lower
flank of the thread and for longitudinal CFO to the inter-threads
area. In general the implant retrieved after 23 months showed
much more difference in CFO due to the presence of woven bone
than the implants retrieved after 12 years in which the bone
appeared to be lamellar.
P
Fig. 5. Confocal laser micrographs of the bone around dental
implants after both 23 months (A) and 13 Years(B). The implant
appears in gray, the mineralized bone matrix appears in black
while the osteocytes appears in yellow. Basic fuchsine staining;
original magnification x 200.
are transmitted directly to the bone around the implant so,
the distribution at the implant-bone interface is influenced
by the implant design. The load has a profound effect
on the organization of the bone matrix composition and
organization.
Bone is a two-phase porous composite material
constituted primarily of collagen and minerals, which
together provide its mechanical properties (13). The
process of osseointegration culminates in calcium
phosphate crystal growth on matrix proteins like
osteopontin and bone sialoprotein and collagen production
Fig. 6. The osteocyte lacunar density ( Ot.Lc.N/ BAr) comparison
between peri-implant bone after either 23 months and 13 years.
The density is significantly higher after 23 months than that 13
years (P<.001).
with mineralization (14).
Furthermore, the important and complex interactions
of extracellular matrix macromolecules like collagen
fibers with mineral deposits under mechanical loads are
still poorly known. While the mineral phase primarily
imparts stiffness to bone, the spatial orientation of
collagen fibers contributes to bone toughness and strength
(mechanical properties) (15).
Classical histology classified bone tissue in relation
to the spatial orientation of collagen fibers. Two several
types of bone have been recognized: woven-fibered bone
and parallel-fibered bone (lamellar or non-lamellar).
Woven bone has a loosely organized matrix that is formed
rapidly in response to fracture healing or hypertrophic
adaptation. The slower parallel-fibered bone displays a
more highly organized matrix and greater strength. The
stiffness and strength of the bone is also related to the
degree of matrix mineralization (16).
The hypothesis that collagen fibers of preferred
orientation and distribution have biomechanical
significance was first set forth by Gebhardt (17) and later
tested by Ascenzi and Bonucci (18) and Simkin and Robin
(19). Numerous studies correlate strongly the collagen
fiber orientation to the mechanical loading (20). However
few studies have, until now, focused on the relationship
between collagen fiber orientation and loaded dental
implants although the orientation of the collagen fibers
enable evaluation of the quality of osseointegration and
bone remodeling (21) The orientation of collagen fibers
in bone could help obtain information about the relation
among implant design, distribution of stress applied to the
bone, and the growth of bone (9).
14 (S)
T. TRAINI ET AL.
Table I. BIC rate comparison.
Z-test
Group Name
N
13 Years
5
23 Months
5
Proportions
F
O
0.680
0.760
Yates correction applied to calculations
The difference of sample proportions
-0.0800
The pooled estimate for p= 0.716
Standard error of difference of sample proportions= 0.303
95 percent confidence interval for difference: -0.673 to 0.513
z= -0.479; P = 0.632
O
R
Table II. Longitudinal / transversal CFO vs implant site multicomparisons
One-Way ANOVA for CFO
Normality Test: Passed (P = 0.178)
Equal Variance Test: Passed (P = 0.927)
N
Mean
[pixel x104]
Transverse CFO Thread Tip 23months [A]
5
55.200
Longitudinal CFO Tread Tip 23months [B]
5
45.800
Transverse CFO Inter-Treads 23months [C]
5
36.400
Longitudinal CFO Inter-Threads 23months [D]
5
65.600
Transverse CFO Thread Tip 13years [E]
5
20.400
Longitudinal CFO Thread Tip 13years [F]
5
19.800
Transverse CFO Inter-Threads 13years [G]
5
Longitudinal CFO Inter-Threads 13years [H]
5
Group Name
P
Std Dev
SEM
4.817
2.154
2.387
1.068
2.408
1.077
6.542
2.926
3.578
1.600
2.864
1.281
15.000
4.000
1.789
21.400
3.050
1.364
Source of Variation
DF
SS
MS
F
P
Between Groups
7
12460.700
1780.100
115.031
<0.001
Residual
32
495.200
15.475
39
12955.900
Total
The differences in the mean values among the groups are statistically significant (P = <0.001).
Power of performed test with alpha = 0.050: 1.000
All Pairwise Multiple Comparison Procedures (Holm-Sidak method):
Overall significance level = 0.05
Comparison
Diff of Means
t
Unadjusted P
Critical Level
Significance
[A] vs. [E]
34.800
13.987
3.492E-015
0.002
yes
[B] vs. [F]
26.000
10.450
7.634E-012
0.003
yes
[C] vs. [G]
21.400
8.601
0.000000000789
0.003
yes
[D] vs. [H]
44.200
17.765
3.895E-018
0.002
yes
F
15 (S)
European Journal of Inflammation
Table III. OD comparison.
Unpaired t-test for OD
Normality Test: Passed (P = 0.075)
Equal Variance Test: Passed (P = 0.630)
Group Name
N
Mean
OD peri-imlant bone 23 mounths
12
130.000
OD peri-implant bone 13 years
12
205.417
Difference
F
O
-75.417
t = -4.609 with 22 degrees of freedom. (P = <0.001)
Std Dev
SEM
34.415
9.935
45.038
13.001
95 percent confidence interval for difference of means: -109.351 to -41.483
O
R
The difference in the mean values between the groups are statistically significant
(P = <0.001).
Power of performed test with alpha = 0.050: 0.995
In the present study the much more amount of either
transverse or longitudinal CFO in the 23 months specimen
are explained by both a higher BIC rate and the presence
of woven bone. Moreover for the 13 years specimen
the results showed mainly lamellar bone with several
secondary “hoop” alternating osteons with transverse and
longitudinal CFO. This aspect, heavily contributes to a
lack of a predominant CFO in the 13 years specimen. The
analysis for transverse and longitudinal CFO for different
implant sites point out the importance of the implant
shape factor. In fact, both implant specimens’ showed
differences for bone CFO when we comparing the thread
tip area vs inter-thread area demonstrating differences in
loading transfer. Moreover, under the lower flank of the
thread the prevalence of transverse CFO is an index of
compression stress while in the inter-threads region the
prevalence of longitudinal CFO indicates the presence of a
shear stress. The different thread profile for the two type of
implants here investigated appear to be of importance for
bone matrix composition around loaded dental implants.
This aspect will be further investigated.
Beside the spatial orientation of collagen fibers, also
bone cells play a determinant role in achieving a satisfying
implant success. After dental implant placement, the
healing process forms a soft fracture callus with a
conspicuous neoangiogenesis, supporting the precursor
bone cells. Frost (22) assumed the `basic multicellular
units’ (BMUs) of osteoblasts and osteoclasts come the
local strains to maintain local bone mass (mechanostat
theory). They are controlled by a `mechanical feedback
P
loop’ and a `set point’, which is the quantitative setting
for the balance between strain and bone mass. The
same Author pointed out that this control process is
purely biological in its components, but is governed by
mechanical loads. It is known that static loads have no
effects on bone mass; experimental information makes
it plausible that amplitude, rate, frequency and duration
of loading are all important for bone metabolism. These
theories have contributed greatly to the awareness of
mechanical factors in the regulation of bone modeling,
remodeling and repair in orthopedics, orthodontics and in
general in bone biology.
Initially, osteoblasts formed woven bone and when
they ended bone matrix synthesis, either dead by apoptosis
or differencing into osteocytes embedded in the matrix or
remaining on the surface becoming lining cells (23).
Osteocytes, the most abundant cells in the mature
bone, are the ideal location to form a cellular syncytium
able to sense the local mechanical environment and
to influence bone remodeling (11). Osteocyte density
is positively related to the quantity of osteoid surface
covered by osteoblasts and would be inversely related
to the proportion of osteoblasts that undergo apoptosis.
Moreover, some authors have been reported that
osteocytes might also be more numerous in bone with
higher turn-over (24).
The osteocyte syncytium within bone is responsible
for sensing load and regulating functional bone adaptation
via the canalicular network and intercellular gap junctions
working as the mechanosensors (11). Recently, Ma YL
16 (S)
T. TRAINI ET AL.
et al.(25) suggested that osteocytes plays a crucial role
in maintaining the biomechanical quality of bone, and
osteocyte density could be considered as an alternative
index in assessing bone quality.
In conclusion the bone around the implant retrieved
after 23 months appeared to be woven with a significantly
increase of osteocytes number while the bone around
the implant retrieved after 13 years was mainly lamellar
with several secondary osteons. For both implants the
transverse CFO were associated with the lower flank of
the implant threads, while the longitudinal collagen fibers
were more represented in the inter-threads area.
ACKNOWLEDGMENT
This work was supported by FAR from the University
of Ferrara (FC), Ferrara, Italy, and from Regione Emilia
Romagna, Programma di Ricerca Regione Universita,
2007–2009, Area 1B: Patologia osteoarticolare: ricerca
pre-clinica e applicazioni cliniche della medicina
rigenerativa Unita Operativa n. 14, and PRIN 2008
(F.C.).
8.
9.
10.
11.
P
2.
3.
4.
5.
6.
7.
F
O
O
R
12.
13.
REFERENCES
1.
long-term loading period: a case report. J Oral Implantol
2006; 32:177-81.
Riggs CM, Lanyon LE, Boyde A. Functional associations
between collagen fibre orientation and locomotor strain
direction in cortical bone of the equine radius. Anat
Embryol (Berl) 1993; 187:231-8.
Osaki S, Tohno S, Tohno Y, Ohuchi K, Takakura Y.
Determination of the orientation of collagen fibers in
human bone. Anat Rec 2002; 266:103-7.
Yi JM, Lee JK, Um HS, Chang BS, Lee MK. Marginal
bony changes in relation to different vertical positions of
dental implants. J Periodontal Implant Sci; 40:244-8.
Knothe Tate ML, Steck R, Forwood MR, Niederer P. In
vivo demonstration of load-induced fluid flow in the rat
tibia and its potential implications for processes associated
with functional adaptation. J Exp Biol 2000; 203:273745.
Brunski JB. Avoid pitfalls of overloading and micromotion
of intraosseous implants. Dent Implantol Update 1993; 4:
77-81.
Loveridge N, Power J, Reeve J, Boyde A. Bone
mineralization density and femoral neck fragility. Bone
2004; 35:929-41.
Davies JE. Mechanisms of endosseous integration. Int J
Prosthodont 1998; 11:391-401.
Kalmey JK, Lovejoy CO. Collagen fiber orientation in the
femoral necks of apes and humans: do their histological
structures reflect differences in locomotor loading? Bone
2002; 31:327-32.
Currey JD. The effect of porosity and mineral content
on the Young’s modulus of elasticity of compact bone. J
Biomech 1988; 21:131-9.
Gebhardt W. Uber funktionell wichtige Anordnungsweisen
der feineren und groberen Bauelemente des
Wirbeltierknochens. Arch Entwickl Org 1905; 20:187322.
Ascenzi A, Bonucci E. The compressive properties of
single osteons. Anat Rec 1968; 161:377-91.
Simkin A, Robin G. Fracture formation in differing
collagen fiber pattern of compact bone. J Biomech 1974;
7:183-8.
Kingsmill VJ, Boyde A. Collagen fiber orientation affects
osteoclastic resorption. J Dent Res 2001; 80:2085-8.
Traini T, Degidi M, Strocchi R, Caputi S, Piattelli A.
Collagen fiber orientation near dental implants in human
bone: do their organization reflect differences in loading? J
Biomed Mater Res B Appl Biomater 2005; 74:538-46.
Frost HM. Bone “mass” and the “mechanostat”: a proposal.
Anat Rec 1987; 219:1-9.
Zarb GA, Schmitt A. The longitudinal clinical effectiveness
of osseointegrated dental implants: the Toronto study. Part
III: Problems and complications encountered. J Prosthet
Dent 1990; 64:185-94.
Summers RB. The osteotome technique: Part 2--The ridge
expansion osteotomy (REO) procedure. Compendium
1994; 15:422, 24, 26, passim; quiz 36.
Rupp F, Scheideler L, Rehbein D, Axmann D, GeisGerstorfer J. Roughness induced dynamic changes of
wettability of acid etched titanium implant modifications.
Biomaterials 2004; 25:1429-38.
Sammons RL, Lumbikanonda N, Gross M, Cantzler P.
Comparison of osteoblast spreading on microstructured
dental implant surfaces and cell behaviour in an explant
model of osseointegration. A scanning electron microscopic
study. Clin Oral Implants Res 2005; 16:657-66.
Traini T, De Paoli S, Caputi S, Iezzi G, Piattelli A. Collagen
fiber orientation near a fractured dental implant after a 5year loading period: case report. Implant Dent 2006; 15:
70-6.
Neugebauer J, Weinlander M, Lekovic V, von Berg KH,
Zoeller JE. Mechanical stability of immediately loaded
implants with various surfaces and designs: a pilot study in
dogs. Int J Oral Maxillofac Implants 2009; 24:1083-92.
Traini T, Pecora G, Iezzi G, Piattelli A. Preferred collagen
fiber orientation human peri-implant bone after a short- and
14.
15.
16.
17.
18.
19.
20.
21.
22.
F
17 (S)
European Journal of Inflammation
23. Mackie EJ. Osteoblasts: novel roles in orchestration of
skeletal architecture. Int J Biochem Cell Biol 2003; 35:
1301-5.
24. Power J, Loveridge N, Rushton N, Parker M, Reeve J.
Osteocyte density in aging subjects is enhanced in bone
adjacent to remodeling haversian systems. Bone 2002; 30:
859-65.
25. Ma YL, Dai RC, Sheng ZF, Jin Y, Zhang YH, Fang LN, Fan
HJ, Liao EY. Quantitative associations between osteocyte
density and biomechanics, microcrack and microstructure
in OVX rats vertebral trabeculae. J Biomech 2008; 41:
1324-32.
P
O
R
F
O
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
DOES TMJ MORPHOLOGY DETERMINE DISK INCOORDINATION?
A. BUSATO1, V. VISMARA1, L. BERTELE’2, I. ZOLLINO3, S. FANALI4,
G. TRAPELLA3, A. AVANTAGGIATO3, F. CARINCI3
F
O
Private practice, Milano, Italy
Centro riabilitativo Rigamonti, Merate, Italy
3
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
4
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
1
2
The relation between disk incoordination and Temporo-Mandibular Joint morphology is incompletely known.
To address the research purpose, the investigators designed a cohort study on 200 (TMJ). A series of morphological
parameters of condyle, glenoid fossa and intra-articular space dimensions were investigated and related to disk
displacement. Differences exist between normal and pathologic cases as well as between mild and severe disk
incoordination. The high of condylar head, the distance between condyle from the vault of glenoid fossa as well
as from the posterior wall of glenoid fossa, the angulation of tuber and the angulation of condylar head (in an
horizontal plane) are the variables dividing normal from pathologic cases. The distance between condyle from
vault of glenoid fossa and the angulation of condylar head (in an horizontal plane) are the variables separating
mild from severe cases. Reported data shown that disk incoordination is related to condyle, glenoid fossa and
intra-articular space dimensions. The distance between condyle from the upper part of the glenoid fossa and the
angulation of the condylar head are the strongest variables predicting disk incoordination. Additional studies are
needed to detect which therapy gives better results in mild and severe subgroups.
O
R
P
Temporo Mandibular Disorders (TMD) is a generic
term including clinical problems involving the masticatory
musculature, the Temporo-Mandibular Joint (TMJ) or
both. Symptoms include pain in the masticatory muscles,
in the TMJ, and surrounding associated structures. Patients
with TMD most frequently present with pain, limitation or
deviation in the mandibular range of motion, TMJ sounds
(1, 2). Common associated symptoms include ear pain and
stuffiness, tinnitus, dizziness, neck pain, and headache.
The onset may be acute with mild and self limitating
symptoms. In other patients, a chronic TMD develops, with
persistent pain and physical, behavioral, psychological
symptoms similar to patients with chronic pain syndromes
in other area of the body (3, 4) (i.e. fybromalgia, arthrosis,
arthritis, chronic headache) that require a coordinated
interdisciplinary diagnostic and treatment approach.
Symptoms of TMD occur in approximately 6-12% of
the adult population. The prevalence among adults in the
United States of at least one sign of TMD varies from 40
to 75% and 33% among those with at least one symptom
(5, 6). TMD are most common in young to middle-age
adults (20 to 50 years of age ). The epidemiology shows
a predilection for female, between 18 and 45 years of age
with a female-to-male ratio ranging from 3:1 to 9:1 (7). The
reason of it is still unclear. Despite the high prevalence of
TMD only 5 to 10% require treatment suggesting that in
up to 40% of patients the symptoms resolve spontaneously
(8). About 80% of patients with TMD present signs and
symptoms of joint disease, including disc displacement,
arthralgia, osteoarthrosis and osteoarthritis. These
degenerative diseases are characterized by an imbalance
in the synthesis and degradation of extracellular matrix,
which are mediated by chondrocytes and fibrochondrocites
in cartilage and fibrocartilage of the TMJ. This leads to a
progressive loss of extracellular matrix components of the
articular cartilage and subchondral bone. TMD are also a
very important social problem due to the fact that only in
the United States about 17.800.000 workdays are lost each
Key words: Condyle; Disk; Glenoid fossa; TMJ;
Corresponding author: Prof. Francesco Carinci, M.D
Department of Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara ITALY
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
19
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
20 (S)
A. BUSATO ET AL.
year for every 100.000 full-time working adults (9).
Because the relation between disk incoordination and
TMJ morphology is incompletely known, a series of 100
patients were investigated in order to detect morphological
parameters of condyle, glenoid fossa and intra-articular
space statistically associated to disk displacement.
In Table II the mild cases (35 cases) are grouped
together with 131 normal cases and compared with totally
displaced disk (34 cases). The results show that CON-A
and DIS-V differentiate the most severe cases.
MATERIALS AND METHODS
TMD is a generic term including a wide range
of problems concerning the jaw joint. Injuries of the
jaw, TMJ, or head and neck muscles can cause TMD.
Other causes include grinding or clenching of the teeth,
malocclusion, dislocation of the disc, osteoarthritis or
rheumatoid arthritis, tumors or paraneoplastic diseases
like synovial chondromatosis.
For most patients, TMD improve over time with or
without treatment. About 50% of patients improve in one
year and 85% improve completely in three years (5, 10,
11).
Treatment varies from physical therapy and non
surgical treatment to different surgical procedures.
The majority of patients can be adequately treated by
a combination of conservative techniques including
rest, reassurance, behavioral interventions, counseling,
oral appliances, and medical interventions including
pharmacologic treatment (i.e. nonsteroidal antiinflammatory drugs, anxiolytics, benzodiazepines,
tricyclic antidepressants) or intra-articular corticosteroid
or anesthetic injection. Cochrane assessment shows no
evidence for the use of occlusal modification in TMD and
that no oral appliance is better than any other (12-14).
The majority of patients (about 90%) with TMD can
be treated with non-surgical, non-invasive and reversible
intervention (15).
Surgical procedures are reserved to those patients that
not benefit from conservative management for pain relief
and function severe enough to interfere with daily living
activities, or for those affected by alterations of condylar
growth, mandibular ankylosis or benign and malignant
tumors. Arthrocentesis, arthroscopy and open surgery,
including arthroplasty, high condylectomy, discectomy
and joint replacement are different surgical options (1618).
Our date demonstrated that TMJ morphology has an
impact on disk incoordination. Specifically, the high of
condylar head, the distance between condyle from the
vault of glenoid fossa as well as from the posterior wall of
glenoid fossa, the angulation of tuber and the angulation
of condylar head (in an horizontal plane) are the variables
dividing normal from pathologic cases (Table I). The
distance between condyle from vault of glenoid fossa and
the angulation of condylar head (in a horizontal plane) are
the variables separating mild from severe cases (Table II).
These differences are statistically relevant to distinguish
Study design/sample
To address the research purpose, the investigators designed
a cohort study. The study population was composed of 100
patients (77 females and 23 males, median age 44.5 ± 14
years, min 17, max 79 years) admitted for TMJ evaluation and
treatment between June 2002 and June 2005. Informed written
consent approved by the local Ethics Committee was obtained
from patients to use their data for research purpose.
Subjects were enrolled since a complex orthodontic or
prosthetic therapies were planned or patients had a TMD with
symptoms or signs such as pain, mouth opening limitation and/
or deviation, and clicking.
Exclusion criterion was a prior TMJ therapy.
CT and MRI were performed and both TMJs were
investigated in each patient.
Several variables were investigated: demographic (age and
gender), anatomic (condylar high, width, thick and angulation
of the condyle, distance of condyle from tuber, from posterior
wall, from vault, from medial wall, glenoid fossa width and
angulation of tuber) and functional (disk position when patient
have the teeth of upper and lower jaws in max inter-cuspidation)
variables.
DISCUSSION
O
R
F
O
P
Anatomical variables
A series of morphological parameters were investigated:
they are reported in Figs 1 to 6.
Functional variables
The disk position was evaluated with patient was with teeth
of upper and lower jaws in max inter-cuspidation: disk could be
in the physiological position, partially or displaced.
Data analysis
Pearson Chi Square was used to correlate dimension (i.e.
morphology) of several TMJ anatomical structures with disk
position.
RESULTS
One hundred patients (77 females with a median age
of 45 ± 14.5 years and 33 males with a median age of
43 ± 13.7 years) were enrolled in the present study. One
hundred and thirty one disks were in the correct anatomical
position, 35 were mild and 34 were totally displaced.
In Table I the mild cases (35 cases) are grouped
together with totally displaced disk (34 cases) and
compared with 131 normal cases. The results show that
CON-H, CON-A, DIS-P, DIS-V, and T-A are statistically
different between normal and pathological cases.
F
21 (S)
European Journal of Inflammation
Fig. 1. CON-H - high of the condylar head. X is the reference
point: it is the most anterior point of the condylar head. Here
vertical, horizontal and transversal lines are drawn to calculate
the distances.
F
O
Fig. 4. DIS-T – distance between the condyle from the tuber;
DIS-P - distance between the condyle from posterior wall of the
glenoid fossa; DIS-V - distance between the condyle from vault
of the glenoid fossa.
O
R
P
Fig. 2 left. CON-W - width of condylar head, from the lateral
to medial pole; right: CON-T - thick of condylar head, from the
anterior to the posterior edge.
Fig. 5 left. DIS-M - distance between the medial part of the
condyle and the medial part of the glenoid fossa; right: GF- W
– antero-posterior dimension of the glenoid fossa.
Fig. 3. CON-A - angle between a line passing on the anterior
pole of both condylar heads and a line passing on the mesiolateral axis of one condylar head.
Fig. 6. T-A - angle between a line of the tuber and the orbital
plane ( a line drawn from the sub-orbital point to the Porion).
22 (S)
A. BUSATO ET AL.
Table I. Comparison between TMJ morphology and disk position (correct or incorrect): the mild cases (35 cases) are grouped together
with totally displaced disk (34 cases) and compared with 131 normal cases.
Pos. Dis
N
Mean
Standard.
Deviation
p-value
CON-H
0
1
131
69
3.71
3.22
1.04
0.86
0.034
CON-W
0
1
131
69
17.85
16.44
2.65
3.06
CON-T
0
1
131
69
8.24
7.41
1.85
1.62
CON-A
0
1
131
69
15.84
26.15
6.00
8.75
DIS-T
0
1
131
69
3.30
2.70
1.27
1.38
DIS-P
0
1
131
69
2.34
2.75
1.09
1.64
DIS-V
0
1
131
69
2.69
2.38
1.11
1.42
DIS-M
0
1
131
69
4.27
4.30
1.89
2.15
GF-W
0
1
131
69
13.79
13.12
2.28
2.26
T-A
0
1
131
69
115.63
118.28
14.12
17.76
P
O
R
F
O
n.s.
n.s.
0.001
n.s.
0.030
0.039
n.s.
n.s.
0.004
Table II. Comparison between TMJ morphology and disk position (correct or incorrect): the mild cases (35 cases) are grouped
together with 131 normal cases and compared with totally displaced disk (34 cases).
Pos. Dis
N
Mean
Standard
Deviation
p-value
CON-H
0
1
166
34
3.67
2.89
0.99
0.84
n.s.
CON-W
0
1
166
34
17.84
15.07
2.58
3.13
n.s.
CON-T
0
1
166
34
8.11
7.19
1.80
1.71
n.s.
CON-A
0
1
166
34
17.28
29.71
6.65
9.61
0.006
DIS-T
0
1
166
34
3.14
2.89
1.29
1.57
n.s.
DIS-P
0
1
166
34
2.39
2.92
1.16
1.87
n.s.
DIS-V
0
1
166
34
2.67
2.13
1.14
1.55
0.006
DIS-M
0
1
166
34
4.27
4.33
1.86
2.51
n.s.
GF-W
0
1
166
34
13.64
13.17
2.26
2.43
n.s.
T-A
0
1
166
34
114.46
126.70
14.64
15.65
n.s.
F
23 (S)
European Journal of Inflammation
patients with different degree of disk incoordination and
might help to apply different treatment protocols.
9.
ACKNOWLEDGMENT
10.
This work was supported by grants from University of
Ferrara (F.C.) and Fondazione CARIFE
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
Okeson JP. Bell’s orofacial pains: the clinical management
of orofacial pain. 6th ed. Chicago: Quintessence Publishing;
2004.
Scrivani SJ, Keith DA, Kaban LB. Temporomandibular
disorders. N Engl J Med 2008; 359:2693-705.
Fordyce WE. Pain and suffering. A reappraisal. Am
Psychol 1988; 43:276-83.
Parker MW, Holmes EK, Terezhalmy GT. Personality
characteristics of patients with temporomandibular
disorders: diagnostic and therapeutic implications. J Orofac
Pain 1993; 7:337-44.
De Leeuw R, Bertoli E, Schmidt JE, Carlson CR.
Prevalence of post-traumatic stress disorder symptoms in
orofacial pain patients. Oral Surg Oral Med Oral Pathol
Oral Radiol Endod 2005; 99:558-68.
Schiffman E, Fricton JR. Epidemiology of TMJ and
craniofacial pains: an unrecognized social problem. In TMJ
and craniofacial pain: diagnosis and management. Fricton
J, Kroening RJ, Hathaway KM, ed. Ishiyaku EuroAmerica.
St. Louis, 1988; 1-10.
Wabeke K, Spruijt RJ On temporomandibular joint sounds:
dental and psychological studies. Amsterdam: University
of Amsterdam; 1994:91-103.
Levitt SR, McKinney MW. Validating the TMJ scale in
a national sample of 10,000 patients: demographic and
epidemiologic characteristics. J Orofac Pain 1994; 8:25-35.
11.
12.
Wadhwa S, Kapila S. TMJ disorders: future innovations in
diagnostics and therapeutics. J Dent Educ 2008; 72:93047.
Ferrando M, Andreu Y, Galdon MJ, Dura E, Poveda R,
Bagan JV. Psychological variables and temporomandibular
disorders: distress, coping, and personality. Oral Surg Oral
Med Oral Pathol Oral Radiol Endod 2004; 98:153-60.
Manfredini D, di Poggio AB, Romagnoli M, Dell’Osso L,
Bosco M. Mood spectrum in patients with different painful
temporomandibular disorders. Cranio 2004; 22:234-40.
Auerbach SM, Laskin DM, Frantsve LM, Orr T.
Depression, pain, exposure to stressful life events, and
long-term outcomes in temporomandibular disorder
patients. J Oral Maxillofac Surg 2001; 59:628-33;
discussion 34.
Turner JA, Dworkin SF, Mancl L, Huggins KH, Truelove
EL. The roles of beliefs, catastrophizing, and coping in the
functioning of patients with temporomandibular disorders.
Pain 2001; 92:41-51.
Campbell LC, Riley JL, 3rd, Kashikar-Zuck S,
Gremillion H, Robinson ME. Somatic, affective, and pain
characteristics of chronic TMD patients with sexual versus
physical abuse histories. J Orofac Pain 2000; 14:112-9.
Hashimoto Y, Kawashima M, Hatanaka R, Kusunoki M,
Nishikawa H, Hontsu S, Nakamura M. Cytocompatibility
of calcium phosphate coatings deposited by an ArF pulsed
laser. J Mater Sci Mater Med 2007; 18:1457-64.
Klasser GD, Greene CS. Oral appliances in the management
of temporomandibular disorders. Oral Surg Oral Med Oral
Pathol Oral Radiol Endod 2009; 107:212-23.
Sidebottom AJ. Current thinking in temporomandibular
joint management. 2009.
Ingawale S, Goswami T. Temporomandibular joint:
disorders, treatments, and biomechanics. Ann Biomed Eng
2009; 37:976-96.
F
O
P
O
R
13.
14.
15.
16.
17.
18.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
RELATION BETWEEN OCCLUSION, TMJ PAIN AND IDIOPATHIC SCOLIOSIS:
A RETROSPECTIVE STUDY ON 120 PATIENTS
A. BUSATO1, V. VISMARA1, L. BERTELE’2, I. ZOLLINO3,
S. FANALI4, G. TRAPELLA3, A. AVANTAGGIATO3, F. CARINCI3
F
O
Private practice, Milano, Italy; 2Centro riabilitativo Rigamonti, Merate, Italy
3
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
4
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
1
The present study was to establish a correlation between occlusion, Temporomandibular Joint (TMJ) pain
and idiopathic scoliosis. The study population was composed of 120 patients affected by idiopathic scoliosis and
admitted for orthodontic evaluation and treatment between January 2008 and December 2009. Several variables
were investigated: demographic (age and gender), TMJ symptoms (left and right pain) anatomic (left and right
cuspid and molar tooth classes, overbite and overjet, anterior and posterior left and right emanel surface lesions,
anterior and posterior left and right cross-bites) and functional (frontal and left and right lateral guides for
disclosure, left and right initial, intermediate, final and reciprocal clicks) variables. By matching TMJ pain and
all the other variables, only occlusal functional variables and most severe scoliosis have a significant correlation
with TMJ pain. Patients affected by idiopathic scoliosis have a high incidence of malocclusion. Occlusal functional
variables and degree of scoliosis have a clinical impact on TMJ symptoms.
O
R
P
The interaction between posture and occlusion constitute
a vast topic and has been a constant source of interest to
health care professionals. Etiologic hypotheses suggesting
an interdependence between the tonic postural system and
the stomatognathic system are based on considering the
complex relationships between the stomatognathic system
and the central nervous system – CNS - (1).
The physiological continuum tying occlusion to posture
does not appear to be a univocal and linear relationship
but instead a complex ensemble made up of numerous
contributing factors. The close relationship between the
spatial arrangement of the different skeletal parts of the
body and the continuous adjusting action exerted by the
CNS on the muscles, through processing the information
coming from the dental, muscles and joints proprioceptors,
produces continuous variations of the posture of the head,
of the position of the jaw and of the hyoid bone (2).
Therefore, head posture could be affected by skeletal (2)
and dental occlusion. During the mixed dentition, the dental
occlusion changes and the head posture could be affected
(3). In the primary teeth period, the arch dimensions seem
to be stable, so if there are changes in the head and cervical
column posture, these might be due to other factors besides
changes in occlusion, for example, the occurrence of oral
parafunctions, especially bruxism (4). Bruxism not only
affects the masticatory muscles, but also all the muscles
of the cranio-facial complex, shoulders and neck (5).
These structures share innervations through the trigeminocervical complex, which is conformed by the upper cervical
and trigeminal nerves (5). Also, anatomically, the axes for
the eccentric movements of the mandible and cervical
column concur in the occiput. These connections cause
the jaw position to influence the activity of the cervical
muscles and the neck inclination to influence the bilateral
sternocleidomastoid activity (6).
The diagnosis of bruxism, should be multifactorial
and include the associated peripherally factors, such as
the analysis of the dental wear digitally, evaluation of the
TMD (temporomandibular disorders) and alterations in
anxiety levels (4).
Due to the clinical impact that a correlation between
body posture could have on dental occlusion, and the still
controversial results from the available studies, further
investigations are warranted to better clarify whether
Key words: TMJ, scoliosis, occlusion, tooth, pain
Corresponding author: Prof. Francesco Carinci, M.D
Department of Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
25
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
26 (S)
A. BUSATO ET AL.
this correlation exists. Therefore, this study was designed
to determine the incidence of dental malocclusion a
group of patients affected by idiopathic scoliosis and a
investigation was performed on Temporomandibular Joint
(TMJ) symptoms.
MATERIALS AND METHODS
Study design/sample
To address the research purpose, the investigators designed a
cohort study. The study population was composed of 120 patients
(92 females and 28 males, median age 14 ± 3.5 years, min 6, max
27 years) affected by idiopathic scoliosis and admitted for dental
evaluation between January 2008 and December 2009. Informed
written consent approved by the local Ethics Committee was
obtained from patients to use their data for research purpose.
Scoliosis was evaluated by means of lateral and frontal x-rays,
usually. Scoliosis were classified as located in the cervical, dorsal,
dorso-lumbar and lumbar sites. Scoliosis were scored as moderate
(X<30°), mild (30°<X<50°) and severe (X>50°) (Fig-1 and 2)
Several variables were investigated: demographic (age and
gender), TMJ symptoms (left and right pain) anatomic (left
and right cuspid and molar tooth classes, overbite and overjet,
anterior and posterior left and right emanel surface lesions,
anterior and posterior left and right cross-bites) and functional
(frontal and left and right lateral guides for disclosure, left and
right initial, intermediate, final and reciprocal clicks) variables.
cuspids), respectively.
Table III reports number of different clicks detected in
each TMJ. Thirteen right and 10 left TMJs were painful,
respectively.
By matching TMJ pain and all the other variables, only
those reported in Table IV were statistically significant:
TMJ pain is associated with occlusal functional variables
and with most severe scoliosis.
F
O
DISCUSSION
The relationship between cervical posture and
dental occlusion alteration is due to anatomical and
biomechanical interactions. The forward head posture
is characterized by a dorso-extension of the head and
upper cervical spine (C1–C3), accompanied by a flexion
of the lower cervical spine (C4–C7) (7). This condition
causes the upward and backward displacement of the
mandible because of influence exercised by the muscular
activity as well as the tissue elasticity of the mandible
(visco-elasticity properties). As the mandibular position
is retruded and elevated, the physiological freeway space
(vertical dimension) between maxilla and mandible
decreases during the rest position. As a result, the dental
contacts will be located further posteriorly (8).
Some researchers have morphologically studied
the relationship between posture and malocclusion (9).
Documentation of associations between anterior crowding
and head posture seems convincing. Rocabado et al. (10)
found an association between Class II occlusion and
forward head posture. Solow and Sonnesen (9) advocated
the soft tissue stretching hypothesis, according to which
the sagittal development of the dentoalveolar arches is
impeded by the increased dorsally-directed soft tissue
pressure in subjects with extended cranio-cervical posture.
A specific interest in orthopedic conditions was presented
by Huggare (11) who reported plausible evidence for an
increased prevalence of Angle Class II malocclusions
associated with hyperlordosis of the cervical spine and
an increased risk of lateral crossbite in children affected
by scoliosis and torticollis. Lippold et al. (12) examined
preschool children and also found high incidences of
Angle Class II malocclusion in scoliotic children. Also in
our series class II patients were the vast majority.
Scoliosis is an orthopedic condition characterized by
faulty posture. Idiopathic scoliosis is the most common
type and most patients are female. In our series female
are 3⁄4 of all cases. The etiology is unknown, but genetic,
hormonal, neurological, biochemical, and possibly
biomechanical factors interact (13). It is a progressive,
lateral deviation of the spine, often discovered in
childhood. Treatment is usually conservative, including
orthopedic braces, but, in more progressive and severe
P
O
R
Data analysis
Pearson Chi Square was used to detect TMJ pain more
associated with type and severity of scoliosis and anatomic and
functional variables of occlusion.
RESULTS
One hundred and twenty patients (92 females and
28 males with a median age of 14 years) with idiopathic
scoliosis were enrolled in the present study. There were 11
cervical, 70 dorsal, 35 dorso-lumbar and 4 lumbar scoliosis.
Thirty eight, 63 and 19 were moderate, mild and severe,
respectively. Table I is a cross-tabulation reporting the series
matching severity and localization of the scoliosis. Twenty
one patients were treated by using an orthopedic brace.
Table II reports number of cases of cuspid and molar
tooth classes: some of them were not evaluable because
canines were missed or in wrong position (reported as
missing data). Twenty and 42 patients have pathological
overbite and overjet (i.e. lower of higher then 2±2 mm),
respectively. There were 2 cases of emanel surface lesions
per each quadrant (anterior and posterior left and right).
Cross-bites were as follows: 1 anterior right, 15 posterior
right, none anterior left and 11 posterior left.
Frontal disclosure guide was abnormal in 10 cases
(i.e. not incisors), whereas left and right lateral guides for
disclosure were uncorrected in 38 and 39 cases (i.e. not
F
27 (S)
European Journal of Inflammation
F
O
O
R
Fig. 1. RMN showing a thoracic scoliosis in the sagittal plane
Fig. 2. RMN showing a scoliosis in the cervical spine
cases, spine fusion is indicated.
Motoyoshi et al. (14) studied by three-dimensional
(3D) finite element analysis the results for spinal
displacement. They found that the alteration of head
posture directly influences head pitching during
mastication. Nevertheless, head posture is maintained by
the neuromuscular system with several afferent pathways
from propioceptors in muscles, tendons and joints,
vestibular and visual receptors and information from the
cortical and subcortical motor areas (15). When the head
and neck sway forward, the occipital cervical muscles
become tense; this tension would put pressure on the
cervical column and possibly modify the spine position
and eventually also the shape (14).
According to some studies (16), the occlusion
alterations can be associated with parafunctional habits
such as squeezing and clenching the teeth (bruxism),
leading to muscle spasm and hyperactivity. Gadotti et al.
(17) reported in their study a greater presence of subjects
with bruxism presenting occlusion alteration class II
than normal occlusion class. It may suggest a tendency
of subjects with class II to present bruxism, showing an
association between these alterations. In our studied group
only few patients have emanel surface lesions (8 teeth).
Oral parafunctions, especially bruxism, have a significant
association with temporomandibular disorders (TMD), even
Table I. Sites of scoliosis are reported in columns whereas the
severity is reported in rows
P
Spine site
Cervical
Dorsal
Dorso-lumbar
Lumbar
Moderate
1
12
25
-
Mild
8
44
7
4
Severe
2
14
3
-
Table II. Number of cases of cuspid and molar tooth classes are
reported.
Tooth
Side
Right
Left
Right
Left
Canine
Molar
1
45
48
73
75
2
39
35
40
38
3
4
4
Missing
36
37
3
3
Table III. Number of clicks per TMJ
Side
Right
Left
Initial
12
13
Intermediate
2
1
Final
2
4
Reciprocal
11
9
Table IV. Variables statistically associated with TMJ pain
Side
Overbite
Posterior left
cross bite
Frontal
disclosure
Right lateral
disclosure
Severity of
scoliosis
Right
0.02
-
-
0.02
0.01
Left
-
0.01
0.01
0.01
-
28 (S)
A. BUSATO ET AL.
in children (18). However, controversy does exist regarding
the relationship between TMD and head posture. Some
authors support it (19), but their methodology is not good
enough to establish the relationship between TMD and
anterior head posture in children (4). Some of them used a
stethoscope to detect only TMJ sounds (19), leaving aside
other TMD that are not audible. Others used the Helkimo’s
index (20), whose measurements of the muscle tenderness
and pain are not reliable in children (21). However, other
authors found a poor relationship between TMD and head
posture (22). In our series a significant relation between TMJ
pain and functional occlusal anomalies was detected, thus
demonstrating that functional and not anatomical variables
are the most relevant variables influencing TMJ symptoms.
Patients affected by idiopathic scoliosis have a high
incidence of malocclusion. Occlusal functional variables
and degree of scoliosis have a clinical impact on TMJ
symptoms.
8.
9.
10.
11.
12.
This work was supported by grants from University of
Ferrara (F.C.) and PRIN 2008 (F.C.)
P
13.
14.
15.
REFERENCES
2.
3.
4.
5.
6.
7.
F
O
O
R
ACKNOWLEDGEMENTS
1.
system, a conceptual study. Cranio 1996; 14:71-80.
Goldstein DF, Kraus SL, Williams WB, Glasheen-Wray
M. Influence of cervical posture on mandibular movement.
J Prosthet Dent 1984; 52:421-6.
Solow B, Sonnesen L. Head posture and malocclusions.
Eur J Orthod 1998; 20:685-93.
Rocabado M, Johnston BE, Jr., Blakney MG. Physical
therapy and dentistry: an overview. J Craniomandibular
Pract 1982; 1:46-9.
Huggare J. Postural disorders and dentofacial morphology.
Acta Odontol Scand 1998; 56:383-6.
Lippold C, van den Bos L, Hohoff A, Danesh G, Ehmer
U. Interdisciplinary study of orthopedic and orthodontic
findings in pre-school infants. J Orofac Orthop 2003; 64:
330-40.
Burwell RG. Aetiology of idiopathic scoliosis: current
concepts. Pediatr Rehabil 2003; 6:137-70.
Motoyoshi M, Shimazaki T, Sugai T, Namura S.
Biomechanical influences of head posture on occlusion:
an experimental study using finite element analysis. Eur J
Orthod 2002; 24:319-26.
Ferrario VF, Sforza C, Schmitz JH, Taroni A. Occlusion and
center of foot pressure variation: is there a relationship? J
Prosthet Dent 1996; 76:302-8.
Celic R, Jerolimov V, Panduric J. A study of the
influence of occlusal factors and parafunctional habits
on the prevalence of signs and symptoms of TMD. Int J
Prosthodont 2002; 15:43-8.
Gadotti IC, Berzin F, Biasotto-Gonzalez D. Preliminary
rapport on head posture and muscle activity in subjects
with class I and II. J Oral Rehabil 2005; 32:794-9.
Alamoudi N. Correlation between oral parafunction and
temporomandibular disorders and emotional status among
saudi children. The Journal of clinical pediatric dentistry
2001; 26:71-80.
Sonnesen L, Bakke M, Solow B. Temporomandibular
disorders in relation to craniofacial dimensions, head
posture and bite force in children selected for orthodontic
treatment. Eur J Orthod 2001; 23:179-92.
van der Weele LT, Dibbets JM. Helkimo’s index: a scale or
just a set of symptoms? . J Oral Rehabil 1987; 14:229-37.
Kritsineli M, Shim YS. Malocclusion, body posture, and
temporomandibular disorder in children with primary and
mixed dentition. J Clin Pediatr Dent 1992; 16:86-93.
Olivo SA, Bravo J, Magee DJ, Thie NM, Major PW,
Flores-Mir C. The association between head and cervical
posture and temporomandibular disorders: a systematic
review. J Orofac Pain 2006; 20:9-23.
Amat P. Occlusion, orthodontics and posture: are there
evidences? The example of scoliosis. International Journal
of Stomatology & Occlusion Medicine 2009; 2:2-10.
D’Attilio M, Caputi S, Epifania E, Festa F, Tecco S.
Evaluation of cervical posture of children in skeletal class
I, II, and III. Cranio 2005; 23:219-28.
Slaj M, Jezina MA, Lauc T, Rajic-Mestrovic S, Miksic M.
Longitudinal dental arch changes in the mixed dentition.
Angle Orthod 2003; 73:509-14.
Velez AL, Restrepo CC, Pelaez-Vargas A, Gallego GJ,
Alvarez E, Tamayo V, Tamayo M. Head posture and dental
wear evaluation of bruxist children with primary teeth. J
Oral Rehabil 2007; 34:663-70.
Friedman MH, Weisberg J. The craniocervical connection:
a retrospective analysis of 300 whiplash patients with
cervical and temporomandibular disorders. Cranio 2000;
18:163-7.
Santander H, Miralles R, Perez J, Valenzuela S, Ravera
MJ, Ormeno G, Villegas R. Effects of head and neck
inclination on bilateral sternocleidomastoid EMG activity
in healthy subjects and in patients with myogenic craniocervical-mandibular dysfunction. Cranio 2000; 18:181-91.
Gonzalez HE, Manns A. Forward head posture: its
structural and functional influence on the stomatognathic
16.
17.
18.
19.
20.
21.
22.
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
CRYOPRESERVED HOMOLOGUE ILIAC CREST GRAFTS USED IN SINUS LIFTING FOR
IMPLANT REHABILITATION: A CASE SERIES ANALYSIS
M. DANZA1, S. FANALI1, L. RIGO2, M. FRANCO2,
A. AVANTAGGIATO3, A. LUCCHESE3, I. ZOLLINO3, F. CARINCI3
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
2
Department of Maxillofacial Surgery, Civil Hospital, Castelfranco Veneto, Italy
3
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
In the last decade, several investigators have reported that autologous and homologous fresh frozen bones
(FFB) are effective materials to restore alveolar ridges previous to insert dental implants. Here we reported a
comparative study between implants inserted in cryopreserved fresh frozen bones (CFFB) and native bone to
evaluate their clinical outcome. Patients were grafted and spiral implants were inserted in the same surgical time.
Several variables (patient, grafts, anatomic site, implant, prosthetic restoration) were investigated. Implant’ failure
and peri-implant bone resorption were considered as predictor of clinical outcome. 53 implants were inserted in
12 patients. Implants were inserted to replace 8 incisors, 4 cuspids, 21 premolars and 20 molars. The mean followup was 14 months. Three out of 53 implants were lost (i.e. survival rate SVR = 94.3%) and no differences were
detected among the studied variables. Similar result was obtained by analyzing the crestal bone resorption around
implant’ neck (i.e. success rate). CFFB and native bone have high and comparable survival and success rate.
Spiral implants can be successfully inserted in native e grafted bone to perform an oral rehabilitation.
O
R
P
The anatomical limitations of residual alveolar bone
can cause problems for the insertion of dental implants
(1). Less-than-ideal sites can result in an esthetic and
functional compromise because implant placement
requires an adequate quantity and quality of bone. In
many cases, however, this anatomic problem can be
solved with autogenous bone grafts, which are the most
predictable and successful material available (1).
Although autografts are the standard procedure for
bone grafting, it is sometimes not possible to collect an
adequate amount of bone from other donor sites on the
same patient (2). Moreover, autologous bone grafts have
the drawback of a secondary surgery field for autograft
retrieval, with increased operation time and anesthesia,
and donor site morbidity. On the other hand, biomaterials
are good but expensive, and may extrude at a later date
(3). So, the use of homologue bone provides a reasonable
alternative to meet the need for graft material (2).
Bone homograft transplantation has been performed in
humans for more than one hundred years and is being used
in increasing numbers by orthopedic surgeons (4, 5).
Regarding the use of fresh-frozen bone (FFB) in oral
and maxillo-facial surgery, preliminary reports on a limited
number of cases are available (6, 7). More recently our
group verified the stability of FFB bone grafts over time (8)
and the effectiveness of this material used for alveolar ridge
reconstruction in pre-prosthetic surgery (9-12).
Here we reported data obtained by using cryopreserved
fresh frozen bones (CFFB) for sinus lifting and implant’
rehabilitation. The specific aims of this study were to
enroll a study cohort of subjects who have undergone
dento-alveolar reconstruction and immediate implant
placement, estimate the 14 months survival of the fixtures,
measure changes in crestal bone around implant’ neck,
and identify factors associated with crestal bone loss.
MATERIALS AND METHODS
Study design/sample
To address the research purpose, the investigators designed a
Key words: Iliac crest, bone, graft, pre-prosthetic surgery, allograft, homograft.
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C.,
Section of Maxillofacial Surgery
Corso Giovecca 203 44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
29
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
30 (S)
M. DANZA ET AL.
retrospective cohort study. The study population was composed
of patients grafted with CFFB presenting to the Maxillofacial
Surgery, Castelfranco Veneto, Italy for evaluation and implant
treatment between January 2007 and February 2008.
Subjects were screened according to the following inclusion
criteria: controlled oral hygiene and absence of any lesions in the
oral cavity; in addition, the patients had to agree to participate in
a post-operative check-up program.
The exclusion criteria were as follows: bruxists, smoking
more than 20 cigarettes/day, consumption of alcohol higher than
2 glasses of wine per day, localized radiation therapy of the oral
cavity, antitumor chemotherapy, liver, blood and kidney diseases,
immunosupressed patients, patients taking corticosteroids,
pregnant women, inflammatory and autoimmune diseases of the
oral cavity.
Graft material
The CFFB - obtained from the Veneto Tissue Bank in Treviso
(Italy) - is a mineralized, non-irradiated, only disinfected and
frozen homologous bone. The bone harvesting is obtained from
the anterior and posterior iliac crest, in the first 12 hours after
donor death and processed in a similar way of fresh frozen bone,
as previously described (9-12).
CFFB is selected and processed in the same way of FFB but
bone is frozen at a rate of - 1°C per minute and then stored in
liquid N2 vapor for a maximum period of 5 years.
TIFF format for classification. Each file was processed with the
Windows XP Professional operating system using Photoshop
7.0 (Adobe, San Jose, CA), and shown on a 17” SXGA TFT
LCD display with a NVIDIA GÈ Force FX GO 5600, 64 MB
video card (Acer Aspire 1703 SM-2.6). By knowing dimensions
of the implant, it was possible to establish the distance from the
medial and distal edges of the implant platform to the point of
bone-implant contact (expressed in tenths of a millimeter) by
doing a proportion.
The difference between the implant-abutment junction and
the bone crestal level was defined as the Implant Abutment
Junction (IAJ) and calculated at the time of operation and at the
end of the follow-up. The delta IAJ is the difference between
the IAJ at the last check-up and the IAJ recorded just after the
operation. Delta IAJ medians were stratified according to the
variables of interest.
Peri-implant probing was not performed because controversy
still exists regarding the correlation between probing depth and
implant success rates (14, 15).
All patients underwent the same surgical protocol. An
antimicrobial prophylaxis was administered with 1g Amoxycillin
twice daily for 5 days starting 1 hour before surgery. Local
anesthesia was induced by infiltration with articaine/epinephrine
and post-surgical analgesic treatment was performed with 100
mg Nimesulid twice daily for 3 days. Oral hygiene instructions
were provided. Grafts were en-block and inserted with sinus lift
elevation technique.
Spiral implants (Alpha Bio LTD, Petah-Tikva, Israel) were
inserted in the same grafting surgical operation. The implant
platform was positioned at the alveolar crest level. Sutures were
removed 14 days after surgery. After 24 weeks from implant
insertion, the provisional prosthesis was provided and the final
restoration was usually delivered within additional 8 weeks. The
number of prosthetic units (i.e. implant/crown ratio) was 0.74
on 50 survived implants (3 fixtures failed). All patients were
included in a strict hygiene recall (Fig. 1-7).
F
O
O
R
P
Variables
Several variables are investigated: demographic (age and
gender), anatomic (tooth site), graft (CFFB and native bone),
implant (length and diameter), and prosthetic (number of
prosthetic units- N.P.U.- , edentulness, temporary removable
prosthesis) variables. N.P.U. is the number of prosthetic units and
is the number of implants divider for the number of crowns.
Primary and secondary predictors of clinical outcome are
used. The primary predictor is the presence/absence of the
implant at the end of the observation period. It is defined as
survival rate (i.e. SVR) that is the total number of implants still
in place at the end of the follow-up period.
The second predictor of outcome is the peri-implant bone
resorption. It is defined as implant success rate (SCR) and it is
evaluated according to the absence of persisting peri-implant
bone resorption greater than 1.5 mm during the first year of
loading and 0.2 mm/years during the following years (13).
Data collection methods and summary of operative methods
Before surgery, radiographic examinations were done with
the use of orthopantomographs.
Peri-implant crestal bone levels were evaluated by the
calibrated examination of orthopantomograph x-rays after
surgery and at the end of the follow-up period. The measurements
were carried out medially and distally to each implant,
calculating the distance between the implant’ platform and the
most coronal point of contact between the bone and the implant.
The bone level recorded just after the surgical insertion of the
implant was the reference point for the following measurements.
The measurement was rounded off to the nearest 0.1 mm. The
radiographs were performed with a computer system (Gendex,
KaVo ITALIA srl, Genova, Italia) and saved in uncompressed
Data analysis
Disease-specific survival curves were calculated according
to the product-limit method (Kaplan-Meier algorithm) (16).
Time zero was defined as the date of the implant’s insertion.
Implants which are still in place (or have a crestal bone
resorption value lower then the cut-off value) were included
in the total number at risk of loss only up to the time of their
last follow-up. Therefore, the survival rate only changed when
implant loss (or crestal bone resorption higher than the cut-off
value) occurred. The calculated survival rate was the maximum
estimate of the true survival curve. Log rank testing was used to
compare survival/success curves, generated by stratifications for
a variable of interest.
RESULTS
Twelve patients (3 females and 9 males) with a median
age of 50.4 years (min-max 40-61) have the inclusion
criteria and were enrolled in the present study. Informed
written consent approved by the local Ethics Committee
was obtained from patients to use their data for research
F
31 (S)
European Journal of Inflammation
purposes. The mean follow-up was 14 months.
A total of 53 spiral implants (Alpha Bio LTD, PetahTikva, Israel) were inserted in the maxilla. Two measure
of length (13 - 16 mm) and diameter (3.75 - 4.2 mm)
were used. Implants were inserted to replace 8 incisors,
4 cuspids, 21 premolars and 20 molars. All implants were
inserted in the maxilla. Twenty and 33 implants were
inserted in native bone and CFFB, respectively.
Table I reports the median delta IAJ according to the
studied variables.
Three implants were lost in the post-operative
period (within 4 months) and Table II describes their
characteristics.
Kaplan Meier algorithm demonstrates that no variable
has a statistical significant impact on clinical outcome
(Table III).
One patient loose all 3 implants inserted in CFFB. This
was due to a dehiscence of the mucosa. Consequently all
this 3 fixtures were erase from the following SCR
statistical analysis since this last focus on bone resorption
around implants after graft healing (i.e. implant which
underwent to prosthetic restoration).
Then peri-implant bone resorption (i.e. delta IAJ) was
used to investigate SCR. Eight implants have a crestal
bone resorption greater than 1.5 mm and thus were used
fro statistical purpose. However Kaplan Meier algorithm
demonstrates that no variable has a statistical significant
impact on clinical outcome (Table IV). This is noteworthy
as regard bone type.
Fig. 1. Pre-surgical intra-oral frontal view.
Fig. 3. Pre-surgical CT showing the residual alveolar bone in
the floor of right and left sinus.
Fig. 2. Pre-surgical ortopantomography.
Fig. 4. CFFB is drilled to facilitate blood penetration and
subsequent osseointegration.
DISCUSSION
F
O
The treatment of severe maxillary residual ridge
resorption involves various grafting materials such as
autogenous bone or bone substitutes. Autogenous bone
is the “gold standard” for grafting materials; however the
necessity of a second operation field and a great amount
of bone needed to be harvested could be a limitation.
Homograft provides a reasonable alternative: it is cheap,
available in programmed amounts, safe (at least for known
pathologies) and avoids a second operation field (8).
In a previous study the effectiveness of fresh frozen
bone (FFB) was demonstrated (8): only 4 over 140 grafts
failed with a success rate of 97.2% and the surgical
technique was the variable related to the failures. No
complications like high amount of blood loss and higher
duration of hospitalization were detected. An average
bone resorption of 22.8% was reported and grafts become
stable after functional bone loading.
In following studies on a series of dental implants
O
R
P
32 (S)
M. DANZA ET AL.
unprotected frozen grafts (17); furthermore CFFB, thanks
to dimethyl sulfoxide (DMSO) treatment; preserves some
residual osteoblast cell viability (18, 19) which may be of
importance in the early revascularization improving graft
incorporation (20).
In the present study a new type of implant was used.
A spiral implant (Alpha Bio LTD, Petah-Tikva, Israel) is
a conical internal helix implant with a variable thread
design which confers the characteristic of self drilling, self
tapping and self bone condensing. These proprieties offer
better control during insertion and high initial stabilization
even in poor quality bone. Small diameter drilling results
in reduced trauma and minimal bone loss. Location and
orientation of implant can be altered even after initial
insertion without trauma to the surrounding tissues. Its
advantages are particularly obvious in compromised
situations where there is minimal amount of bone and
low bone density, achieving high stabilization in freshly
extracted sites and thin sinus floors without prior bone
augmentation. The self drilling capability of the implant
allows it to be inserted into sites that have been prepared
to a reduced depth. This ability becomes very useful in
situations of close proximity to anatomical structures such
as the mandibular nerve canal or the maxillary sinus and
nose cavity.
Thus we planned a retrospective study on 53 spiral
implants inserted into native and CFFB to estimate
implant survival and changes in crestal bone resorption.
The specific aims of this study were to enroll a study
cohort of subjects who have undergone dento-alveolar
reconstruction and simultaneous implant placement,
estimate the 14 months survival of the implants, measure
changes in crestal bone around implant’ neck, and identify
factors associated with implant and crestal bone loss.
Only 3 out of 53 implants was lost (i.e. survival rate
SVR = 94.3%) and no differences were detected among
the studied variables. To evaluate the SCR the remaining
50 implants were considered since 3 were dropped out
form the group of those still in place at the end of the
observation period. Among the 50 implants, 8 have a
bone resorption around implant neck higher than the
cut-off value (i.e. 1.5 mm). However, none of the studied
variables was the cause of crestal bone resorption.
In conclusion our data shown that CFFB is an effective
material to restore alveolar ridge volume. Spiral implants
can be successfully inserted in native e grafted bone to
perform an oral rehabilitation.
F
O
O
R
Fig. 5. Sinus lift and implant insertion.
P
Fig. 6. The post-operative ortopantomography.
Fig. 7. The 1 year follow-up intra-oral upper jaw view.
inserted in the same FFB it was demonstrated that fixtures
inserted in FFB have a clinical outcome similar to those
inserted in native (i.e. not grafted) bone (9-12).
According to recent literature, we decided to use
the CFFB because it showed an improved angiogenesis
induction and enhanced immune tolerance compared with
ACKNOWLEDGMENT
This work was supported by FAR from the University
of Ferrara (FC), Ferrara, Italy, and from Regione Emilia
Romagna, Programma di Ricerca Regione Universita,
F
33 (S)
European Journal of Inflammation
Table I. Distribution of series; the number of cases is out of parenthesis whereas millimeters of crestal bone resorption (i.e. median
delta IAJ) is in parenthesis (only 50 implants are considered since 3 were lost).
Temporary removable
prosthesis
Implant site
Bone
Implant length
Implant diameter
NPU
Edentulness
Incisors
8 (0.7)
Native
20 (0.7)
13 mm
23 (0.7)
3.75 mm
21 (0.6)
1
19 (0.7)
Total
22 (1.1)
None
15 (1.1)
Cuspids
4 (0.2)
CFFB
30 (1.1)
16 mm
27 (1.0)
4.2 mm
29 (1.1)
0.75
24 (0.8)
Partial
28 (0.7)
Removable dentures
35 (0.8)
Premolars
20 (1.1)
-
-
-
< 0.75
7 (1.5)
-
-
Molars
18 (0.9)
-
F
O
O
R
Table II. Failed implants
-
-
-
-
-
Implant diameter
Implant length
Site
Bone
N° of months
post implant insertion
3.75
16
26
CFFB
4
4.2
13
24
CFFB
4.2
13
27
CFFB
P
4
4
Table III. Output of Kaplan-Meyer analysis performed by using the SVR: no variable has a statistical significant value.
Variable
Bone type
Tooth site
Implant length
Implant diameter
Edentulness
1.89
1.43
0.48
0.09
3.49
Degree of freedom
1
3
1
1
1
Significance
0.169
0.698
0.490
0.7695
0.062
Log Rank
.Table IV. Output of Kaplan-Meyer analysis performed by using the SCR (3 lost implants were removed from the file, whereas 8
fixtures have a peri-implant bone resorption greater than 1.5 mm and were used for statistical evaluation): no variable has a statistical
significant value.
Variable
Bone type
Implant length
Implant diameter
Edentulness
NPU
Log Rank
0.21
0.01
1.55
0.01
2.13
Degree of freedom
1
1
1
1
2
Significance
0.645
0.953
0.214
0.909
0.345
34 (S)
M. DANZA ET AL.
2007–2009, Area 1B: Patologia osteoarticolare: ricerca
pre-clinica e applicazioni cliniche della medicina
rigenerativa Unita Operativa n. 14, and PRIN 2008
(F.C.).
REFERENCES
1.
2.
3.
4.
5.
Carinci F, Farina A, Zanetti U, Vinci R, Negrini S, Calura
G, Laino G, Piattelli A. Alveolar ridge augmentation: a
comparative longitudinal study between calvaria and iliac
crest bone grafrs. J Oral Implantol 2005; 31:39-45.
Vargel I, Tuncbilek G, Mavili E, Cila A, Ruacan S, Benli
K, Erk Y. Solvent-dehydrated calvarial allografts in
craniofacial surgery. Plast Reconstr Surg 2004; 114:298306.
Gajiwala K, Lobo Gajiwala A. Use of banked tissue in
plastic surgery. Cell Tissue Bank 2003; 4:141-6.
Tomford WW, Mankin HJ. Bone banking. Update on
methods and materials. Orthop Clin North Am 1999; 30:
565-70.
Vangsness CT, Jr., Garcia IA, Mills CR, Kainer MA,
Roberts MR, Moore TM. Allograft transplantation in the
knee: tissue regulation, procurement, processing, and
sterilization. Am J Sports Med 2003; 31:474-81.
Perrott DH, Smith RA, Kaban LB. The use of fresh
frozen allogeneic bone for maxillary and mandibular
reconstruction. Int J Oral Maxillofac Surg 1992; 21:260-5.
Rochanawutanon S, Suddhasthira T, Pairuchvej V,
Vajaradul Y. Long term follow-up of reconstruction with
allogeneic mandibular bone crib packed with autogenous
particulate cancellous bone marrow. Cell Tissue Bank
2002; 3:183-97.
Franco M, Viscioni A, Rigo L, Guidi R, Brunelli G, Carinci
F. Iliac crest fresh frozen homografts used in pre-prosthetic
surgery: a retrospective study. Cell Tissue Bank 2009; 10:
227-33.
Carinci F, Brunelli G, Franco M, Viscioni A, Rigo L, Guidi
R, Strohmenger L. A retrospective study on 287 implants
installed in resorbed maxillae grafted with fresh frozen
allogenous bone. Clin Implant Dent Relat Res; 12:91-8.
7.
8.
9.
F
O
O
R
P
6.
10. Viscioni A, Franco M, Rigo L, Guidi R, Spinelli G, Carinci
F. Retrospective study of standard-diameter implants
inserted into allografts. J Oral Maxillofac Surg 2009; 67:
387-93.
11. Carinci F, Brunelli G, Zollino I, Franco M, Viscioni A,
Rigo L, Guidi R, Strohmenger L. Mandibles grafted with
fresh-frozen bone: an evaluation of implant outcome.
Implant Dent 2009; 18:86-95.
12. Franco M, Tropina E, De Santis B, Viscioni A, Rigo L,
Guidi R, Carinci F. A 2-year follow-up study on standard
length implants inserted into alveolar bone sites augmented
with homografts. Stomatologija 2008; 10:127-32.
13. Albrektsson T, Zarb GA. Determinants of correct clinical
reporting. Int J Prosthodont 1998; 11:517-21.
14. Quirynen M, van Steenberghe D, Jacobs R, Schotte A,
Darius P. The reliability of pocket probing around screwtype implants. Clin Oral Implants Res 1991; 2:186-92.
15. Quirynen M, Naert I, van Steenberghe D, Teerlinck
J, Dekeyser C, Theuniers G. Periodontal aspects of
osseointegrated fixtures supporting an overdenture. A
4-year retrospective study. J Clin Periodontol 1991; 18:
719-28.
16. Dawson-Saunders B, Trapp RG. Basic & Clinical
Biostatistic. Norwalk: Appleton & Lange; 1994.
17. Wingenfeld C, Egli RJ, Hempfing A, Ganz R, Leunig M.
Cryopreservation of osteochondral allografts: dimethyl
sulfoxide promotes angiogenesis and immune tolerance in
mice. J Bone Joint Surg Am 2002; 84-A:1420-9.
18. Egli RJ, Sckell A, Fraitzl CR, Felix R, Ganz R, Hofstetter
W, Leunig M. Cryopreservation with dimethyl sulfoxide
sustains partially the biological function of osteochondral
tissue. Bone 2003; 33:352-61.
19. Reuther T, Rohmann D, Scheer M, Kubler AC. Osteoblast
viability and differentiation with Me2SO as cryoprotectant
compared to osteoblasts from fresh human iliac cancellous
bone. Cryobiology 2005; 51:311-21.
20. Egli RJ, Wingenfeld C, Holzle M, Hempfing A, Fraitzl CR,
Ganz R, Leunig M. Histopathology of cryopreserved bone
allo- and isografts: pretreatment with dimethyl sulfoxide. J
Invest Surg 2006; 19:87-96
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
IMPLANTS INSERTED IN MAXILLARY SINUS GRAFTED WITH FRESH FROZEN
HOMOLOGUE ILIAC BONE: A RETROSPECTIVE STUDY
M. DANZA1, S. FANALI1, A. VISCIONI2, M. FRANCO2,
A. AVANTAGGIATO3, A. LUCCHESE3, I. ZOLLINO3, F. CARINCI3
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
2
Department of Maxillofacial Surgery, Civil Hospital, Castelfranco Veneto, Italy
3
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
In the last decade, several investigators have reported that autologous and homologous fresh frozen bones (FFB)
are effective materials to restore alveolar ridges previous to insert dental implants. Here we reported a comparative
study between spiral implants inserted in FFB and native bone to evaluate their clinical outcome. Patients were
grafted and spiral implants were inserted in the same surgical time. Several variables (patient, grafts, anatomic
site, implant, prosthetic restoration) were investigated. Implant’ failure and peri-implant bone resorption were
considered as predictor of clinical outcome. 51 implants were inserted in 12 patients. Implants were inserted to
replace 8 incisors, 4 cuspids, 18 premolars and 21 molars. The mean follow-up was 14 months. No implant was
lost. Peri-implant bone resorption (i.e. success rate) was used as predictor of clinical outcome but Kaplan Meier
algorithm demonstrates that no studied variable has a statistical significant impact on clinical outcome. FFB and
native bone have high and comparable survival and success rate. Spiral implants can be successfully inserted in
native e grafted bone to perform an oral rehabilitation.
O
R
P
The anatomical limitations of residual alveolar bone
can cause problems for the insertion of dental implants
(1). Less-than-ideal sites can result in an esthetic and
functional compromise because implant placement
requires an adequate quantity and quality of bone. In
many cases, however, this anatomic problem can be
solved with autogenous bone grafts, which are the most
predictable and successful material available (1).
Although autografts are the standard procedure for
bone grafting, it is sometimes not possible to collect an
adequate amount of bone from other donor sites on the
same patient (2). Moreover, autologous bone grafts have
the drawback of a secondary surgery field for autograft
retrieval, with increased operation time and anesthesia,
and donor site morbidity. On the other hand, biomaterials
are good but expensive, and may extrude at a later date
(3). So, the use of homologue bone provides a reasonable
alternative to meet the need for graft material (2).
Bone homograft transplantation has been performed in
humans for more than one hundred years and is being used
in increasing numbers by orthopedic surgeons (4, 5).
Regarding the use of fresh-frozen bone (FFB) in
oral and maxillo-facial surgery, preliminary reports on a
limited number of cases are available (6, 7). More recently
our group verified the stability of FFB bone grafts over
time (8) and the effectiveness of this material used for
alveolar ridge reconstruction in pre-prosthetic surgery
(9-12).
Here we reported data obtained by using FFB for
sinus lifting and implant’ rehabilitation. The specific aims
of this study were to enroll a study cohort of subjects
who have undergone dento-alveolar reconstruction and
immediate implant placement, estimate the 14 months
survival of the fixtures, measure changes in crestal bone
around implant’ neck, and identify factors associated with
crestal bone loss.
MATERIALS AND METHODS
A)
Study design/sample
To address the research purpose, the investigators designed a
retrospective cohort study. The study population was composed
Key words: Iliac crest, bone, graft, pre-prosthetic surgery, allograft, homograft.
Corresponding author:
Prof. Francesco Carinci, M.D
Department of D.M.C.C.C.,
Section of Maxillofacial Surgery
Corso Giovecca 203 44100 Ferrara Italy
E-mail: [email protected] Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
35
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
36 (S)
M. DANZA ET AL.
of patients grafted with CFFB presenting to the Maxillofacial
Surgery, Castelfranco Veneto, Italy for evaluation and implant
treatment between January 2007 and February 2008.
Subjects were screened according to the following inclusion
criteria: controlled oral hygiene and absence of any lesions in the
oral cavity; in addition, the patients had to agree to participate in
a post-operative check-up program.
The exclusion criteria were as follows: bruxists, smoking
more than 20 cigarettes/day, consumption of alcohol higher than
2 glasses of wine per day, localized radiation therapy of the oral
cavity, antitumor chemotherapy, liver, blood and kidney diseases,
immunosupressed patients, patients taking corticosteroids,
pregnant women, inflammatory and autoimmune diseases of the
oral cavity.
B)
Graft material
The FFB - obtained from the Veneto Tissue Bank in Treviso
(Italy) - is a mineralized, non-irradiated, only disinfected and
frozen homologous bone. The bone harvesting is obtained from
the anterior and posterior iliac crest, in the first 12 hours after
donor death and processed as previously described (9-12).
card (Acer Aspire 1703 SM-2.6). By knowing dimensions of the
implant, it was possible to establish the distance from the medial
and distal edges of the implant platform to the point of boneimplant contact (expressed in tenths of a millimeter) by doing
a proportion.
The difference between the implant-abutment junction and
the bone crestal level was defined as the Implant Abutment
Junction (IAJ) and calculated at the time of operation and at the
end of the follow-up. The delta IAJ is the difference between
the IAJ at the last check-up and the IAJ recorded just after the
operation. Delta IAJ medians were stratified according to the
variables of interest.
Peri-implant probing was not performed because controversy
still exists regarding the correlation between probing depth and
implant success rates (14, 15).
All patients underwent the same surgical protocol. An
antimicrobial prophylaxis was administered with 1g Amoxycillin
twice daily for 5 days starting 1 hour before surgery. Local
anesthesia was induced by infiltration with articaine/epinephrine
and post-surgical analgesic treatment was performed with 100
mg Nimesulid twice daily for 3 days. Oral hygiene instructions
were provided. Grafts were en-block and inserted with sinus lift
elevation technique.
Spiral implants (Alpha Bio LTD, Petah-Tikva, Israel) were
inserted in the same grafting surgical operation. The implant
platform was positioned at the alveolar crest level. Sutures were
removed 14 days after surgery. After 24 weeks from implant
insertion, the provisional prosthesis was provided and the final
restoration was usually delivered within additional 8 weeks.
The number of prosthetic units (i.e. implant/crown ratio) was
0.77. No implant was lost. All patients were included in a strict
hygiene recall (Fig. 1-6).
E) Data analysis
Disease-specific survival curves were calculated according
to the product-limit method (Kaplan-Meier algorithm) (16).
Time zero was defined as the date of the implant’s insertion.
Implants which are still in place (or have a crestal bone
resorption value lower then the cut-off value) were included
in the total number at risk of loss only up to the time of their
last follow-up. Therefore, the survival rate only changed when
implant loss (or crestal bone resorption higher than the cut-off
value) occurred. The calculated survival rate was the maximum
estimate of the true survival curve. Log rank testing was used to
compare survival/success curves, generated by stratifications for
a variable of interest.
F
O
O
R
C) Variables
Several variables are investigated: demographic (age and
gender), anatomic (tooth site), graft (FFB and native bone),
implant (length and diameter), and prosthetic (number of
prosthetic units- N.P.U.- , edentulness, temporary removable
prosthesis) variables. N.P.U. is the number of prosthetic units and
is the number of implants divider for the number of crowns.
Primary and secondary predictors of clinical outcome are
used. The primary predictor is the presence/absence of the
implant at the end of the observation period. It is defined as
survival rate (i.e. SVR) that is the total number of implants still
in place at the end of the follow-up period.
The second predictor of outcome is the peri-implant bone
resorption. It is defined as implant success rate (SCR) and it is
evaluated according to the absence of persisting peri-implant
bone resorption greater than 1.5 mm during the first year of
loading and 0.2 mm/years during the following years (13).
P
D) Data collection methods and summary of operative
methods
Before surgery, radiographic examinations were done with
the use of orthopantomographs.
Peri-implant crestal bone levels were evaluated by the
calibrated examination of orthopantomograph x-rays after
surgery and at the end of the follow-up period. The measurements
were carried out medially and distally to each implant,
calculating the distance between the implant’ platform and the
most coronal point of contact between the bone and the implant.
The bone level recorded just after the surgical insertion of the
implant was the reference point for the following measurements.
The measurement was rounded off to the nearest 0.1 mm. The
radiographs were performed with a computer system (Gendex,
KaVo ITALIA srl, Genova, Italia) and saved in uncompressed
TIFF format for classification. Each file was processed with the
Windows XP Professional operating system using Photoshop 7.0
(Adobe, San Jose, CA), and shown on a 17” SXGA TFT LCD
display with a NVIDIA GÈ Force FX GO 5600, 64 MB video
RESULTS
Twelve patients (3 females and 9 males) with a median
age of 50.4 years (min-max 40-61) have the inclusion
criteria and were enrolled in the present study. Informed
written consent approved by the local Ethics Committee
was obtained from patients to use their data for research
purposes. The mean follow-up was 14 months.
A total of 51 spiral implants (Alpha Bio LTD, PetahTikva, Israel) were inserted in the maxilla. Two measure
of length (13 - 16 mm) and diameter (3.75 - 4.2 mm)
were used. Implants were inserted to replace 8 incisors,
F
37 (S)
European Journal of Inflammation
4 cuspids, 18 premolars and 21 molars. All implants were
inserted in the maxilla. Twenty and 31 implants were
inserted in native bone and FFB, respectively.
Table I reports the median delta IAJ according to
the studied variables. No implants was lost and thus
peri-implant bone resorption (i.e. delta IAJ) was used as
predictor of clinical outcome. Seven implants have a periimplant bone resorption higher than 1.5 mm and they were
considered as failures. However, Kaplan Meier algorithm
demonstrates that no variable has a statistical significant
impact on clinical outcome (i.e. in determining the 7
implant failures, Table II). This is noteworthy as regard
bone type.
DISCUSSION
demonstrated (8): only 4 over 140 grafts failed with a
success rate of 97.2% and the surgical technique was
the variable related to the failures. No complications
like high amount of blood loss and higher duration
of hospitalization were detected. An average bone
resorption of 22.8% was reported and grafts become
stable after functional bone loading.
In following studies on a series of dental implants
inserted in the same FFB it was demonstrated that fixtures
inserted in FFB have a clinical outcome similar to those
inserted in native (i.e. not grafted) bone (9-12).
In the present study a new type of implant was used.
A spiral implant (Alpha Bio LTD, Petah-Tikva, Israel) is
a conical internal helix implant with a variable thread
design which confer the characteristic of self drilling, self
tapping and self bone condensing. These proprieties offer
better control during insertion and high initial stabilization
even in poor quality bone. Small diameter drilling results
in reduced trauma and minimal bone loss. Location and
orientation of implant can be altered even after initial
insertion without trauma to the surrounding tissues. Its
advantages are particularly obvious in compromised
situations where there is minimal amount of bone and
low bone density, achieving high stabilization in freshly
extracted sites and thin sinus floors without prior bone
augmentation. The self drilling capability of the implant
F
O
O
R
The treatment of severe maxillary residual ridge
resorption involves various grafting materials such as
autogenous bone or bone substitutes. Autogenous bone
is the “gold standard” for grafting materials; however the
necessity of a second operation field and a great amount
of bone needed to be harvested could be a limitation.
Homograft provides a reasonable alternative: it is cheap,
available in programmed amounts, safe (at least for known
pathologies) and avoids a second operation field (8).
In a previous study the effectiveness of FFB was
P
Fig. 1. Pre-surgical ortopantomography.
Fig. 2. Pre-surgical intra-oral lateral view.
Fig. 3. FFB is tailored to be inserted in the maxillary sinus.
Fig. 4. Sinus lift and implant insertion.
38 (S)
M. DANZA ET AL.
F
O
Fig. 6. The 1 year follow-up intra-oral lateral view.
Fig. 5. The post-operative ortopantomography.
Table I. Distribution of series; the number of cases is out of parenthesis whereas the median delta IAJ is in parenthesis.
O
R
Bone
Implant
length
Implant
diameter
NPU
Edentulness
Temporary removable
prosthesis
Incisors
8 (0.7)
Native
20 (0.7)
13 mm
24 (0.9)
3.75 mm
19 (0.6)
1
19 (1.2)
Total
22 (0.9)
None
16 (0.9)
Cuspids
4 (0.2)
FFB
31 (0.9)
16 mm
27 (0.8)
4.2 mm
32 (1.0)
0.75
20 (0.7)
Partial
29 (0.8)
Removable dentures
35 (0.8)
Premolars
18 (1.0)
-
-
-
< 0.75
12 (0.7)
-
-
-
-
-
-
-
Implant site
P
Molars
21 (0.9)
-
Table II. Output of Kaplan-Meyer analysis performed by using the SCR (7 fixtures have a peri-implant bone resorption greater than
1.5 mm and were used for statistical evaluation): no variable has a statistical significant value.
Variable
Bone
type
Implant length
Implant
diameter
Edentulness
NPU
Log Rank
0.80
3.42
0.22
0.13
2.81
Degree of freedom
1
1
1
1
2
Significance
0.372
0.064
0.638
0.722
0.246
allows it to be inserted into sites that have been prepared
to a reduced depth. This ability becomes very useful in
situations of close proximity to anatomical structures such
as the mandibular nerve canal or the maxillary sinus and
nose cavity.
Thus we planned a retrospective study on 51 spiral
implants (Alpha Bio LTD, Petah-Tikva, Israel) inserted
into native and FFB to estimate implant survival and
changes in crestal bone resorption. The specific aims
of this study were to enroll a study cohort of subjects
who have undergone dento-alveolar reconstruction and
simultaneous implant placement, estimate the 14 months
survival of the implants, measure changes in crestal bone
around implant’ neck, and identify factors associated with
implant and crestal bone loss.
No implant was lost (i.e. survival rate SVR = 100%).
SCR was used to detect differences among the studied
variables. Kaplan-Meyer did not revealed any statistical
F
39 (S)
European Journal of Inflammation
difference (Table II).
In conclusion our data shown that FFB is an effective
material to restore alveolar ridge volume. Spiral implants
can be successfully inserted in native e grafted bone to
perform an oral rehabilitation.
ACKNOWLEDGMENT
This work was supported by FAR from the University
of Ferrara (FC), Ferrara, Italy, and from Regione Emilia
Romagna, Programma di Ricerca Regione Universita,
2007–2009, Area 1B: Patologia osteoarticolare: ricerca
pre-clinica e applicazioni cliniche della medicina
rigenerativa Unita Operativa n. 14, and PRIN 2008
(F.C.).
7.
8.
9.
10.
2.
3.
4.
5.
6.
F
O
O
R
REFERENCES
1.
Rochanawutanon S, Suddhasthira T, Pairuchvej V,
Vajaradul Y. Long term follow-up of reconstruction with
allogeneic mandibular bone crib packed with autogenous
particulate cancellous bone marrow. Cell Tissue Bank
2002; 3:183-97.
Franco M, Viscioni A, Rigo L, Guidi R, Brunelli G, Carinci
F. Iliac crest fresh frozen homografts used in pre-prosthetic
surgery: a retrospective study. Cell Tissue Bank 2009; 10:
227-33.
Carinci F, Brunelli G, Franco M, Viscioni A, Rigo L, Guidi
R, Strohmenger L. A retrospective study on 287 implants
installed in resorbed maxillae grafted with fresh frozen
allogenous bone. Clin Implant Dent Relat Res; 12:91-8.
Viscioni A, Franco M, Rigo L, Guidi R, Spinelli G, Carinci
F. Retrospective study of standard-diameter implants
inserted into allografts. J Oral Maxillofac Surg 2009; 67:
387-93.
Carinci F, Brunelli G, Zollino I, Franco M, Viscioni A,
Rigo L, Guidi R, Strohmenger L. Mandibles grafted with
fresh-frozen bone: an evaluation of implant outcome.
Implant Dent 2009; 18:86-95.
Franco M, Tropina E, De Santis B, Viscioni A, Rigo L,
Guidi R, Carinci F. A 2-year follow-up study on standard
length implants inserted into alveolar bone sites augmented
with homografts. Stomatologija 2008; 10:127-32.
Albrektsson T, Zarb GA. Determinants of correct clinical
reporting. Int J Prosthodont 1998; 11:517-21.
Quirynen M, Naert I, van Steenberghe D, Teerlinck
J, Dekeyser C, Theuniers G. Periodontal aspects of
osseointegrated fixtures supporting an overdenture. A
4-year retrospective study. J Clin Periodontol 1991; 18:
719-28.
Quirynen M, van Steenberghe D, Jacobs R, Schotte A,
Darius P. The reliability of pocket probing around screwtype implants. Clin Oral Implants Res 1991; 2:186-92.
Dawson-Saunders B, Trapp RG. Basic & Clinical
Biostatistic. Norwalk: Appleton & Lange; 1994.
Carinci F, Farina A, Zanetti U, Vinci R, Negrini S, Calura
G, Laino G, Piattelli A. Alveolar ridge augmentation: a
comparative longitudinal study between calvaria and iliac
crest bone grafrs. J Oral Implantol 2005; 31:39-45.
Vargel I, Tuncbilek G, Mavili E, Cila A, Ruacan S, Benli
K, Erk Y. Solvent-dehydrated calvarial allografts in
craniofacial surgery. Plast Reconstr Surg 2004; 114:298306.
Gajiwala K, Lobo Gajiwala A. Use of banked tissue in
plastic surgery. Cell Tissue Bank 2003; 4:141-6.
Tomford WW, Mankin HJ. Bone banking. Update on
methods and materials. Orthop Clin North Am 1999; 30:
565-70.
Vangsness CT, Jr., Garcia IA, Mills CR, Kainer MA,
Roberts MR, Moore TM. Allograft transplantation in the
knee: tissue regulation, procurement, processing, and
sterilization. Am J Sports Med 2003; 31:474-81.
Perrott DH, Smith RA, Kaban LB. The use of fresh
frozen allogeneic bone for maxillary and mandibular
reconstruction. Int J Oral Maxillofac Surg 1992; 21:260-5.
P
11.
12.
13.
14.
15.
16.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
CUSTOM-MADE CRANIAL VALUT RECONSTRUCTION: A RETROSPECTIVE STUDY
M. LAPPARELLI1, M. A. LORENZIN1, G. TRAPELLA2,
I. ZOLLINO2, G. CARNEVALI2, F. CARINCI2
F
O
Neurosurgery, University of Ferrara, Ferrara, Italy
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
2
None of several materials used to reconstruct skull defects is fully satisfactory, due to biological and physical
properties. In large defects or in defects with more complex geometries, the preoperative prefabrication of a custom
polymethylmethacrylate (PMMA) implant based on a three dimensional model could be the best choice. From
January 2007 to December 2010 PMMA custom made cranioplasty have been implanted in 44 patients (22M/22F;
age range 17-82) at the Neurosurgery Unit of the Arcispedale S. Anna of the University Hospital of Ferrara, Italy.
The causes of primary operation were 25 (56.8%) cerebral hemorrhages, 15 (34.1%) traumas, 3 (6.8%) tumors
and 1 (2.3%) infection, respectively. Hypertension was a co-morbidity factor in 13 (29.5%) patients. Cranial vault
reconstruction was performed after a mean period of 9 months. The variables analyzed were causes of craniotomy
(hemorrhages, traumas, tumors and infections), co-morbidity factor (i.e. hypertension), sites (1 frontal, 8 frontotemporal, 32 fronto-temporo-parietal, 2 temporo-parietal and 1 temporo-occipito-parietal) and dimension of the
defect (maximum diameter smaller than 9 cm, 9 ≤ x < 12 cm, equal or greater than 12 cm). Each patient obtained
an good aesthetic result. In two cases the reconstruction was removed in the follow-up period: one case of infected
reconstruction and case of mobility of the prosthesis. PMMA custom-made devices from processing of CT images
can be used for produce cranial prostheses which have a low rate of infection and mobility.
O
R
P
Decompressive craniectomy is a commonly used
procedure in the treatment of severe craniocerebral
injuries. It is often necessary to repair skull defect
following acute phase of craniocerebral injuries in an
attempt not only to meet cosmetic needs and provide
mechanical protection but also to meliorate local blood
flow and metabolism of the brain tissues and facilitate
neurofunctional recovery (1).
The cranial defect resulting from decompressive
craniectomy is one of the indications for cranioplasty. It is
believed that the cranioplasty should be performed 3 to 6
months after the craniectomy, and if the patient has a risk
of infection, this procedure should be delayed at least 6
months after the first operation (2).
An enormous range of materials have been applied to the
repair of cranial defects, and neurosurgeons have witnessed
the remarkable evolution in these kinds of surgeries (3). To
be ideal for cranioplasty, the material must be viable (i.e.,
capable of growth and resistant to infection), radiolucent,
thermally nonconductive (with an expansion coefficient
identical to that of the surrounding cranium), not-ionizing
and not-corrosive, stable, inert, aesthetically pleasing,
protective (with biomechanical properties equal to those of
the cranium), malleable and easily contoured, inexpensive,
readily available, and can be sterilized (4).
Autologous bone grafts have traditionally been
accepted and used as an ideal material since it does not
cause any immune response. However, it is quite difficult
to collect enough bone for large cranial defects and there
is donor-site morbidity (5).
Allografts including cartilage and cadaver skull have
also been used but are less favored than autografts or bone
substitutes (6, 7).
Metals such as tantalum and titanium have been
favored by neurosurgeons due to their biocompatibility
and strength. However, they need to be prepared and are
prone to shatter (8).
Another
commonly
implanted
material
is
hydroxyapatite having better biocompatibility and good
osteoconductivity. It is easily handled but it is too brittle
Key Words: Skull defect; polymethylmethacrylate; custom made; cranioplasty; decompressive craniectomy.
Corresponding author: Prof. Francesco Carinci, M.D
Department of Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara ITALY
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
41
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
42 (S)
M. LAPPARELLI ET AL.
to bear a load (9).
Although each biomaterial has its own advantages
and disadvantages, most alloplastic cranioplasties are
performed by using polymethylmethacrylate (PMMA). It
has been used for decades as an intraoperatively mixed and
cured material that sets rapidly with a very stable construct
(6). PMMA is widely used for cranioplasty but some
characteristics have to be taken into account. These are
fumes and exothermic reaction during mixing and setting
and rarely exudative reactions, which may be associated
with allergic reactions (9, 10). On the other hand, among
the moldable currently available materials, PMMA has a
very high biomechanical resistance (6). In large defects or
in defects with more complex geometries, the preoperative
prefabrication of a custom PMMA implant based on a three
dimensional model has been popular more recently (6).
The computed assisted 3D design and manufacturing the
cranioplasty has improved the cosmetic result and reduced
the operative time for implantation (9).
In this retrospective study a series of 44 custom made
cranioplasties were reviewed in order to detect those
variables potentially associated with failures.
F
O
O
R
MATERIALS AND METHODS
P
Case series
Forty-four patients operated on at the Neurosurgery Unit of
the Arcispedale S. Anna /Ferrara, Italy) between January 2007
and December 2010 were eligible for this retrospective study.
Patients
The patients included 22 males (50%) and 22 females. They
ranged in age from 17 to 82 years (median age 49 ys, SD = 19 ys)
at the time of admission. The causes of primary operation were
25 (56.8%) cerebral hemorrhages, 15 (34.1%) traumas, 3 (6.8%)
tumors and 1 (2.3%) infection, respectively. Hypertension was a
co-morbidity factor in 13 (29.5%) patients.
Fig. 1. 3D CT showing a large cranial defect.
Fig. 2. Intra-operative photograph showing the flap, the cranial
defect and the dura mater.
Cranial vault reconstruction
Cranial vault reconstruction was performed after a mean
period of 9 months (min-max 0 –i.e. intra-operatively - to 24
months, SD 5 months). The hole maximum diameter was 11 cm
(min-max 4 to 16 cm, SD 3 cm). By using the geometric center
of the defect there were 1 (2.3%) frontal (F), 8 (18.2%) frontotemporal (FT), 32 (72.7%) fronto-temporo-parietal (FTP), 2
(4.5%) temporo-parietal (TP) and 1 (2.3%) temporo-occipitoparietal (TPO) defects, respectively. All cranioplasties were
performed with a custom-made acrylic prosthesis.
Treatment
All patients underwent to an open reconstruction via coronal
access, pericranial flap and subsequent internal fixation by
means of vicryl sutures.
Outcome
There were one case of reconstruction infection and one case
of mobility of the prosthesis in the follow-up period.
Fig. 3. The custom made prosthesis covers the cranial defect.
F
43 (S)
European Journal of Inflammation
reconstruction and mobility of the prosthesis). However,
a multivariate analysis performed by using the significant
variables obtained with univariate test and adjusted by age
and gender did not demonstrated any statistical difference
(Table II).
F
O
DISCUSSION
Fig. 4. 3D CT showing the vault reconstruction by means custom
made prosthesis.
Reconstruction of calvarial defects secondary to
trauma would require a two-stage approach, with
primary surgery for cranial decompression followed by
secondary reconstruction (13). However, large defects
of the cranial vault may result not only from trauma (14,
15), but also from congenital deformities, decompressive
craniectomies, or bone flap infections (16). Skull
restoration is still a challenge for craniofacial surgeons
and neurosurgeons. There has been a continuous search
for materials to fill calvarial defects not only for esthetic
reasons but for protection against trauma and prevention
of the low-pressure syndrome (17).
The ideal material for cranioplasty prostheses
construction must be resistant, biocompatible, to eliminate
the risk of inflammation, rejection and infection, and
integrable with the living bone structure to the point of
becoming a part of it, promoting osteoblast migration
(18). However, resistance to impact would be the most
relevant biomechanical feature of a cranioplasty material
given the frequent trauma that is known to occur to the
head region (6).
Although autologous bone remains the preferred
option because of its potential growth and replacement of
host cells (5), it has the drawback of donor-site morbidity
and an insufficient amount to be collected for large cranial
defects (5). On the other hand, allografts have the risk of
immunological reactions and contamination (6).
Alloplastic implants have become more popular and
are now used almost as frequently as autologous bone
(5, 6). PMMA - the most widely used material for the
reconstruction of skull defects (7)- is a viscous chemical
polymer that can easily be shaped for approximately 5-7
minutes. PMMA turns into a very hard material however,
the polymerisation phase is highly exothermic generating
temperatures up to 110°C (6). Any tissues in contact with
the cement would be susceptible to thermal necrosis. As
a serious disadvantage, PMMA can cause a significant
inflammatory response resulting in foreign-body giantcell formation, fibrous encapsulation of the implant and
late perennial infection (19).
Surgical protocol related to use of PMMA involved
manual prosthesis modeling directly in the operating
theatre, with substantial implant size and shape problems
and the release of bio-incompatible compounds,
related to the cement’s polymerization (7). However,
O
R
Statistic analysis
Disease-specific survival curves were calculated according
to the product-limit method (Kaplan-Meier algorithm) (11).
Time zero was defined as the date of the prosthesis’ insertion.
Prostheses which are still in place were included in the total
number at risk of loss only up to the time of their last follow-up.
Therefore, the survival rate (SVR) only changed when implant
loss occurred. The calculated SVR was the maximum estimate
of the true survival curve. Log rank testing was used to compare
survival curves, generated by stratifications for a variable of
interest.
Cox regression analysis was then applied to determine the
single contribution of covariates on survival rate. Cox regression
analysis compares survival data while taking into account the
statistical value of independent variables, such as age and sex, on
whether or not an event (i.e. implant loss) is likely occur. If the
associated probability was less than 5% (p<.05), the difference
was considered statistically significant. In the process of doing
the regression analysis, odds ratio and 95% confidence bounds
were calculated. Confidence bounds did not have to include the
value «1» (12).
P
RESULTS
In two cases the reconstruction was removed in the
follow-up period: one case of infected reconstruction and
case of mobility of the prosthesis. The overall survival rate
was 95.5%. in the post-operative period and thus it was
demonstrated that this is a safe surgical technique.
The variables analyzed were causes of craniotomy
(hemorrhages, traumas, tumors and infections), comorbidity factor (i.e. hypertension), sites (i.e. F, FT, FTP,
TP and TPO) and dimension of the defect (maximum
diameter smaller than 9 cm, 9 ≤ x < 12 cm, equal or greater
than 12 cm). Kaplan-Meier output (Table I) showed
that causes of craniotomy were potentially associated
with an higher risk to have complications (i.e. infected
44 (S)
M. LAPPARELLI ET AL.
Table I. Output of Kaplan–Meyer analysis: NS = p > 0.05.
Variable
Log Rank
df
Significance
Causes of craniotomy
8.16
3
0.042
Co-morbidity
0.27
1
Maximum diameter of defect
2.08
2
F
O
NS
NS
Table II. Output of Cox analysis by considering statistical significant variables obtained with Kaplan–Meyer test.
Variable
Β
df
Age
-0.047
1
Gender
-1.019
1
Causes of craniotomy
0.858
1
Significance
NS
NS
O
R
the development of customized and pre-fabricated
implants for repairing defects in the cranium has today
revolutionized the neurosurgical procedures (20). The
advent of computed tomography (CT) and magnetic
resonance imaging (MRI) has changed the definition and
evaluation of human anatomy. Data acquired from CT
and MRI could be used as a guide for the manufacture of
prosthetic cranioplastic implants. A computer numerically
controlled milling or rapid prototyping processes like
stereolithography could then be used to fabricate the
biomodels and the master cranioplastic implants (21).
The provision of preoperatively customized implants
and the plastic replicas (biomodels) allows the surgeons
to assess implant fit preoperatively, evaluate fixation
sites, and obtain a valuable overview of the procedure.
The patients, on the other hand, are also benefiting since
they get an opportunity to see the biomodel and implant
preoperatively, and thus improve their understanding of
the operation procedure (22).
Customization and prefabrication have reported to
reduce operating time and improve cosmesis. In our
series two cases the reconstruction was removed in the
follow-up period: one case of infected reconstruction and
case of mobility of the prosthesis. Overall, the failure
rate due to complications such as rejection, prosthesis
movement, infection, and aesthetic inefficacy is from 2
to 20%, according to this study and to international case
studies (7). The overall survival rate was 95.5% in the
post-operative period and thus it was demonstrated that
this is a reliable safe surgical technique.
Several variables were investigated to detect those
potentially associated with failures. The variables
analyzed were causes of craniotomy (hemorrhages,
traumas, tumors and infections), co-morbidity factor
(i.e. hypertension), sites (i.e. F, FT, FTP, TP and TPO)
and dimension of the defect (maximum diameter smaller
P
NS
than 9 cm, 9 ≤ x < 12 cm , equal or greater than 12 cm).
No variables pass the two step statistical analysis (i.e.
univariate Table I and multivariate, Table II) and thus was
demonstrated that dimension is not a limiting factor in
custom made cranial reconstruction. According to Eppley
(6), we say that in large defects or in defects with more
complex geometries, the preoperative prefabrication of
a custom PMMA implant based on a three dimensional
model is the best choice.
In conclusion PMMA custom-made devices from
processing of CT images can be used for produce
cranial prostheses which have a low rate of infection and
mobility.
ACKNOWLEDGMENT
This work was supported by FAR from the University
of Ferrara (FC), Ferrara, Italy, and from PRIN 2008
(F.C.), and from Regione Emilia Romagna, Programma
di Ricerca Regione Università, 2007–2009, Area
1B: Patologia osteoarticolare: ricerca pre-clinica e
applicazioni cliniche della medicina rigenerativa, Unità
Operativa n. 14.
REFERENCES
1.
2.
3.
Liu MY. Practical craniocerebral injuries. Beijing: People’s
Military Medical Press; 2003.
Chen TM, Wang HJ. Cranioplasty using allogeneic
perforated demineralized bone matrix with autogenous bone
paste. Ann Plast Surg 2002; 49:272-7; discussion 77-9.
Sanus GZ, Tanriverdi T, Ulu MO, Kafadar AM, Tanriover
N, Ozlen F. Use of Cortoss as an alternative material in
calvarial defects: the first clinical results in cranioplasty. J
Craniofac Surg 2008; 19:88-95.
F
45 (S)
European Journal of Inflammation
4.
5.
6.
7.
8.
9.
10.
Iwama T, Yamada J, Imai S, Shinoda J, Funakoshi T, Sakai
N. The use of frozen autogenous bone flaps in delayed
cranioplasty revisited. Neurosurgery 2003; 52:591-6;
discussion 95-6.
Artico M, Ferrante L, Pastore FS, Ramundo EO, Cantarelli
D, Scopelliti D, Iannetti G. Bone autografting of the
calvaria and craniofacial skeleton: historical background,
surgical results in a series of 15 patients, and review of the
literature. Surg Neurol 2003; 60:71-9.
Eppley BL. Biomechanical testing of alloplastic PMMA
cranioplasty materials. J Craniofac Surg 2005; 16:140-3.
Moreira-Gonzalez A, Jackson IT, Miyawaki T, Barakat K,
DiNick V. Clinical outcome in cranioplasty: critical review
in long-term follow-up. J Craniofac Surg 2003; 14:144-53.
Gosain AK. Biomaterials for reconstruction of the cranial
vault. Plast Reconstr Surg 2005; 116:663-6.
Eppley BL, Hollier L, Stal S. Hydroxyapatite cranioplasty:
2. Clinical experience with a new quick-setting material. J
Craniofac Surg 2003; 14:209-14.
Hobar PC, Hunt JA, Antrobus S. Assessment of the effects
on growth of porous hydroxyapatite granule cranioplasty
in the immature guinea pig craniofacial skeleton. Plast
Reconstr Surg 2003; 111:1667-75; discussion 76-9.
Dawson-Saunders B, Trapp RG. Basic & Clinical
Biostatistic. Norwalk: Appleton & Lange; 1994.
Cox DR, Oakes D. Analysis of survival data. New York:
Chapman & Hall; 1984.
Schantz JT, Hutmacher DW, Chou N, Teoh SH, Lim TC.
Clinical application of tissue engineering for craniofacial
reconstruction. In Proceedings of the 47th Plastic Surgery
Research Council. Boston; 2002.
Carinci F, Arduin L, Pagliaro F, Zollino I, Brunelli G,
Cenzi R. Scoring mandibular fractures: a tool for staging
12.
13.
14.
16.
17.
18.
F
O
O
R
P
11.
15.
diagnosis, planning treatment, and predicting prognosis. J
Trauma 2009; 66:215-9.
Carinci F, Zollino I, Arduin L, Lapparelli M, Cavallo M,
Cenzi R. Fronto-ethmoidal fractures: A staging system and
case series analysis. Asian JOMS 2010; 22 74-79.
Goiato MC, Anchieta RB, Pita MS, dos Santos DM.
Reconstruction of skull defects: currently available
materials. J Craniofac Surg 2009; 20:1512-8.
Winkler PA, Stummer W, Linke R, Krishnan KG, Tatsch
K. Influence of cranioplasty on postural blood flow
regulation, cerebrovascular reserve capacity, and cerebral
glucose metabolism. J Neurosurg 2000; 93:53-61.
Mastrogiacomo M, Muraglia A, Komlev V, Peyrin F,
Rustichelli F, Crovace A, Cancedda R. Tissue engineering
of bone: search for a better scaffold. Orthod Craniofac Res
2005; 8:277-84.
Verheggen R, Merten HA. Correction of skull defects
using hydroxyapatite cement (HAC)--evidence derived
from animal experiments and clinical experience. Acta
Neurochir (Wien) 2001; 143:919-26.
Staffa G, Nataloni A, Compagnone C, Servadei F. Custom
made cranioplasty prostheses in porous hydroxy-apatite
using 3D design techniques: 7 years experience in 25
patients. Acta Neurochir (Wien) 2007; 149:161-70;
discussion 70.
Chim H, Schantz JT. New frontiers in calvarial
reconstruction: integrating computer-assisted design and
tissue engineering in cranioplasty. Plast Reconstr Surg
2005; 116:1726-41.
D’Urso PS, Earwaker WJ, Barker TM, Redmond MJ,
Thompson RG, Effeney DJ, Tomlinson FH. Custom
cranioplasty using stereolithography and acrylic. Br J Plast
Surg 2000; 53:200-4.
19.
20.
21.
22.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
TEMPORO-MANDIBULAR JOINT DISORDERS TREATMENT:
REVIEW OF A CASE SERIES AND EVALUATION
OF CLINICAL FACTORS ACTING ON OUTCOME
L. CLAUSER1, S. MANDRIOLI1, S. FANALI2, A. AVANTAGGIATTO3,
A. LUCCHESE3, I. ZOLLINO3, F. CARINCI3
F
O
Cranio-Maxillofacial Surgery Unit, Arcispedale S. Anna, Ferrara, Italy
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
3
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
2
Temporo-Mandibular Disorders (TMD) is a constellation of diseases characterized by pain of TMJ or its
surrounding tissues, functional limitation of the mandible, or clicking the TMJ during motion. TMD etiology and
pathogenesis are not completely understood and therefore a precise diagnoses and management is difficult. There
is a wide range of medical or/and surgical treatment options. The majority of TMD can be greatly advantaged
by the treatment with gnathologic and physiokinesic techniques. Because of no general agreement is reached on
treatment protocols, data from 35 patients with TMD are reported. Our data demonstrated that oral appliance and
physiotherapy are associated with a better clinical outcome. However, both oral appliance and physiotherapy are
not strong enough to determine the effectiveness of the clinical outcome by themselves. Surgery must be reserved
only to severe cases when conservative methods failed.
O
R
P
Temporo Mandibular Disorders (TMD) is a
generic term including clinical problems involving the
masticatory musculature, the Temporo-Mandibular Joint
(TMJ) or both. Symptoms include pain in the masticatory
muscles, in the TMJ, and surrounding associated
structures. Patients with TMD most frequently present
with pain, limitation or deviation in the mandibular
range of motion, TMJ sounds (1, 2). Common associated
symptoms include ear pain and stuffiness, tinnitus,
dizziness, neck pain, and headache. The onset may be
acute with mild and self limitating symptoms. In other
patients, a chronic TMD develops, with persistent pain
and physical, behavioral, psychological symptoms similar
to patients with chronic pain syndromes in other area of
the body (3) (i.e. fybromalgia, arthrosis, arthritis, chronic
headache) that require a coordinated interdisciplinary
diagnostic and treatment approach. Symptoms of TMD
occur in approximately 6-12% of the adult population.
The prevalence among adults in the United States of at
least one sign of TMD varies from 40 to 75% and 33%
among those with at least one symptom (4). TMD are
most common in young to middle-age adults (20 to 50
years of age ). The epidemiology shows a predilection for
female, between 18 and 45 years of age with a female-tomale ratio ranging from 3:1 to 9:1 (5). The reason of it is
still unclear. Despite the high prevalence of TMD only 5
to 10% require treatment suggesting that in up to 40% of
patients the symptoms resolve spontaneously (6). About
80% of patients with TMD present signs and symptoms
of joint disease, including disc displacement, arthralgia,
osteoarthrosis and osteoarthritis. These degenerative
diseases are characterized by an imbalance in the
synthesis and degradation of extracellular matrix, which
are mediated by chondrocytes and fibrochondrocites in
cartilage and fibrocartilage of the TMJ. This leads to a
progressive loss of extracellular matrix components of the
articular cartilage and subchondral bone. TMD are also a
very important social problem due to the fact that only in
the United States about 17.800.000 workdays are lost each
year for every 100.000 full-time working adults (7).
Because of no general agreement is reached on
treatment protocols, a series of 35 patients affected by
Key words: Temporo-mandibular disorders; temporo-mandibular joint therapy; arthroscopy; arthrocentesis; pain.
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C.
Section of Maxillofacial Surgery
Corso Giovecca 203 44100 Ferrara Italy
e-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
47
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
48 (S)
L. CLAUSER ET AL.
TMD were analyzed with special attention to treatments
modalities and the pertinent literature discussed.
the single contribution of covariates on the success rate (9).
Stepwise Cox analysis allowed us to detect the variables most
associated with clinical success.
MATERIALS AND METHODS
Study design/sample
To address the research purpose, the investigators designed
a retrospective cases series analysis. The study population was
made up of 35 patients (30 females and 5 males, median age 46
years, min 16 - max 77) who had undergone TMJ evaluation
and treatment between April 2005 and August 2009. Informed
written consent approved by the local Ethics Committee was
obtained from patients to use their data for research purpose.
Variables
Fifty eight TMJs were evaluated. Several variables were
investigated: demographic (age and gender), symptoms (i.e.
headache, stuffiness, masticatory muscles pain, articular pain),
signs (i.e. range of opening, deviation, click, rumors, loss of
teeth, prosthesis), and types of treatments (oral appliances,
physiokinesitherapy, arthrocentesis, arthroscopy and open
surgery) were evaluated.
Differential diagnosis included odontogenic and non
odontogenic causes of facial pain, primary and secondary
headache syndromes, trigeminal neuropatic pain, primary
or metastatic jaw tumors and of the skull base, disorders of
the salivary glands, systemic diseases (i.e. temporal arthritis,
autoimmune, cardiac and viral disease) .
Variables were as follow: headache, stuffiness, articular
pain, masticatory muscles pain, click, rumors. Improvement
of symptoms at the end of the observation period was used as
parameters of clinical outcome. The defined success rate (i.e.
SCR) was the total number of TMJs which had an improvement
of symptoms at the end of the follow-up period.
RESULTS
F
O
There were 5 male and 30 female median age 46
years, min 16 - max 77.
A total of 58 TMJs were analyzed. The mean followup was 13.25 months (min 12 - max 53).
The Kaplan Meier algorithm demonstrated that oral
appliance and physiokinesic therapy are potentially
associated with a better clinical outcome (Table I).
However, no variable has an impact on clinical
outcome if investigated with multivariate analysis (Table
II).
O
R
P
Data collection methods and summary of operative methods
Before surgery, clinical examinations were done including
observation and measurements of mandibular motion (maximal
interincisal opening, lateral movements, and protrusion),
palpation of masticatory muscles (temporalis, masseter, medial
and lateral pterygoid muscles, sternocleidomastoideus muscle)
and cervical musculature, palpation of the TMJ, examination of
the oral cavity, dentition, occlusion, examination of the cranial
nerves with special attention of the trigeminal nerve.
Imaging of the TMJ was performed with panoramic
radiograph, CT and MRI scan.
Treatment consisted of a combination of conservative
methods (i.e. oral appliances, bite, physiotherapy) and surgery
like arthrocentesis, arthroscopy and arthroplasty.
In the follow-up period, clinical examinations were
done using VAS (Visual Analog Scale) for pain evaluation,
examination of mandibular motion range and function.
Data analysis
Disease-specific success curves were calculated according
to the product-limit method (Kaplan-Meier algorithm) (8). Log
rank testing was used to compare success curves, generated by
stratifications for a variable of interest.
Cox regression analysis was then applied to determine
DISCUSSION
TMD is a generic term including a wide range
of problems concerning the jaw joint. Injuries of the
jaw, TMJ, or head and neck muscles can cause TMD.
Other causes include grinding or clenching of the teeth,
malocclusion, dislocation of the disc, osteoarthritis or
rheumatoid arthritis, tumors or paraneoplastic diseases
like synovial chondromatosis.
For most patients, TMD improve over time with or
without treatment. About 50% of patients improve in one
year and 85% improve completely in three years (4, 1012).
Treatment varies from physical therapy and non
surgical treatment to different surgical procedures.
The majority of patients can be adequately treated by
a combination of conservative techniques including
rest, reassurance, behavioral interventions, counseling,
oral appliances, and medical interventions including
pharmacologic treatment (i.e. nonsteroidal antiinflammatory drugs, anxiolytics, benzodiazepines,
tricyclic antidepressants) or intra-articular corticosteroid
or anesthetic injection. Cochrane assessment shows no
evidence for the use of occlusal modification in TMD and
that no oral appliance is better than any other (13-15).
The majority of patients (about 90%) with TMD can
be treated with non-surgical, non-invasive and reversible
intervention (16).
Surgical procedures are reserved to those patients that
not benefit from conservative management for pain relief
and function severe enough to interfere with daily living
activities, or for those affected by alterations of condylar
growth, mandibular ankylosis or benign and malignant
tumors. Arthrocentesis, arthroscopy and open surgery,
including arthroplasty, high condylectomy, discectomy and
joint replacement are different surgical options (17-19).
Our date demonstrated that oral appliance and
F
49 (S)
European Journal of Inflammation
Table I. Output of Kaplan-Meier analysis: bite and physiotherapy a have a statistical significant value (see last column).
Variable
Log Rank
Degree of freedom
Level of significance p
Edentulness
1.75
1
.1853
Prosthesis
1.34
1
.2466
Bite
7.17
1
.0074
Physiotherapy
6.24
1
.0125
Arthrocentesis
.00
1
.9639
Arthroscopy
.54
1
.4609
Arthroplasty
1.32
1
.2497
Variable
Age
Gender
P
Bite
Physiotherapy
F
O
O
R
Table II. Cox analysis: no variable reach a statistical significance
Degree of freedom
Level of significance p
Exp (B)
1
.1544
.5596
1
.9871
3.762E-05
1
.1231
7.130
1
.1268
7.7320
physiotherapy are associated with a better clinical
outcome (Table I)
In addition we demonstrated that oral appliance
and physiotherapy are not strong enough to determine
the effectiveness of clinical outcome by themselves if
investigated with multivariate analysis (Table II). That
happen because analyzed patients needed an association
of therapies and it was not possible to separate less
complicated patients from the others due to the small size
of the sample.
Surgical procedures such as arthrocentesis and
arthroplastic are helpful in the treatment of internal
derangements, especially acute closed lock and for quick
relief of pain and function. The effect of lysis and washing
may facilitate the release of adherences and the movement
of articular disc.
TMD are difficult to diagnose and manage because
of their poorly understood etiology and pathogenesis
and remain a frequent cause of visits to primary care
physicians, internists, dentist and maxillofacial surgeon.
Important improvements have been made in diagnostic
and imaging capabilities as in the understanding of the
95% CI for Exp(B)
Lower
Upper
.9744
1.1780
.0001
0.01
.5870
86.6064
.5596
106.8275
mechanisms inducing inflammatory changes in the TMJ.
Efforts in the field of genetics, pain research may offer
the possibility of better defining the TMD providing more
specific and effective treatments.
Our data demonstrated that oral appliance and
physiotherapy are associated with a better clinical
outcome.
In addition we demonstrated that oral appliance and
physiotherapy are not strong enough to determine the
effectiveness of the clinical outcome by themselves.
Surgery must be reserved only to severe cases when
conservative methods failed.
ACKNOWLEDGMENT
This work was supported by grants from University of
Ferrara (F.C.) and Fondazione CARIFE
REFERENCES
1.
Okeson JP. Bell’s orofacial pains: the clinical management
of orofacial pain. 6th ed. Chicago: Quintessence
50 (S)
L. CLAUSER ET AL.
Publishing; 2004.
2. Scrivani SJ, Keith DA, Kaban LB. Temporomandibular
disorders. N Engl J Med 2008; 359:2693-705.
3. Parker MW, Holmes EK, Terezhalmy GT. Personality
characteristics of patients with temporomandibular
disorders: diagnostic and therapeutic implications. J
Orofac Pain 1993; 7:337-44.
4. De Leeuw R, Bertoli E, Schmidt JE, Carlson CR. Prevalence
of post-traumatic stress disorder symptoms in orofacial pain
patients. Oral Surg Oral Med Oral Pathol Oral Radiol Endod
2005; 99:558-68.
5. Wabeke K, Spruijt RJ On temporomandibular joint sounds:
dental and psychological studies. Amsterdam: University
of Amsterdam; 1994:91-103.
6. Levitt SR, McKinney MW. Validating the TMJ scale in
a national sample of 10,000 patients: demographic and
epidemiologic characteristics. J Orofac Pain 1994; 8:2535.
7. Wadhwa S, Kapila S. TMJ disorders: future innovations in
diagnostics and therapeutics. J Dent Educ 2008; 72:93047.
8. Dawson-Saunders B, Trapp RG. Basic & Clinical
Biostatistic. Norwalk: Appleton & Lange; 1994.
9. Cox D, Oakes D. Analysis of survival data. New York:
Chapman & Hall; 1984.
10. Ferrando M, Andreu Y, Galdon MJ, Dura E, Poveda R,
Bagan JV. Psychological variables and temporomandibular
disorders: distress, coping, and personality. Oral Surg Oral
Med Oral Pathol Oral Radiol Endod 2004; 98:153-60.
11. Manfredini D, di Poggio AB, Romagnoli M, Dell’Osso L,
Bosco M. Mood spectrum in patients with different painful
temporomandibular disorders. Cranio 2004; 22:234-40.
12. Dworkin SF, Sherman J, Mancl L, Ohrbach R, LeResche
L, Truelove E. Reliability, validity, and clinical utility of
the research diagnostic criteria for Temporomandibular
Disorders Axis II Scales: depression, non-specific physical
symptoms, and graded chronic pain. J Orofac Pain 2002;
16:207-20.
13. Auerbach SM, Laskin DM, Frantsve LM, Orr T.
Depression, pain, exposure to stressful life events, and
long-term outcomes in temporomandibular disorder
patients. J Oral Maxillofac Surg 2001; 59:628-33;
discussion 34.
14. Turner JA, Dworkin SF, Mancl L, Huggins KH, Truelove
EL. The roles of beliefs, catastrophizing, and coping in the
functioning of patients with temporomandibular disorders.
Pain 2001; 92:41-51.
15. Campbell LC, Riley JL, 3rd, Kashikar-Zuck S,
Gremillion H, Robinson ME. Somatic, affective, and pain
characteristics of chronic TMD patients with sexual versus
physical abuse histories. J Orofac Pain 2000; 14:112-9.
16. Hashimoto Y, Kawashima M, Hatanaka R, Kusunoki M,
Nishikawa H, Hontsu S, Nakamura M. Cytocompatibility
of calcium phosphate coatings deposited by an ArF pulsed
laser. J Mater Sci Mater Med 2007; 18:1457-64.
17. Klasser GD, Greene CS. Oral appliances in the
management of temporomandibular disorders. Oral Surg
Oral Med Oral Pathol Oral Radiol Endod 2009; 107:21223.
18. Sidebottom AJ. Current thinking in temporomandibular
joint management. 2009.
19. Ingawale S, Goswami T. Temporomandibular joint:
disorders, treatments, and biomechanics. Ann Biomed Eng
2009; 37:976-96.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
TRICALCIUM PHOSPHATE STIMULATES ADIPOSE TISSUE-DERIVED
STEM CELLS TOWARDS OSTEOBLASTS DIFFERENTIATION
V. SOLLAZZO1, S. FANALI2, E. MASIERO3, A. GIRARDI3, F. FARINELLA4,
E. MELLONI5, F. PEZZETTI3, C. IACCARINO6, G. ZAULI7, F. CARINCI3
F
O
Orthopedic Clinic, University of Ferrara, Ferrara, Italy
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
3
Department of Histology, Embryology and Applied Biology, Centre of Molecular Genetics, CARISBO
Foundation, University of Bologna, Bologna, Italy
4
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
5
Department of Morphology and Embryology, University of Ferrara, Ferrara, Italy
6
”Hub & Spoke” Neurosurgery Unit-Emergency Department, University Hospital of Parma, Parma, Italy
7
Institute for Maternal and Child Health, IRCCS “Burlo Garofolo”, Trieste, Italy
1
2
O
R
Tricalcium Phosphate (TCP) is used successfully as bone substitutes and scaffolds for tissue engineering
and implantology to its capacity to enhance bone formation in vivo. To study how TCP can induce osteoblast
differentiation and proliferation in mesenchymal stem cells, the expression levels of bone related genes were
measured in adipose derived stem cells (ADSCs) and normal osteoblast (NO) cultivated on TCP scaffolds after
15 and 30 days of treatment using real time Reverse Transcription-Polymerase Chain Reaction. Significantly,
differentially expressed genes among ADSCs and NO were RUNX, COL1A1, ALPL and SPP1 in the first 15 days
of treatment and SP7, FOSL1, RUNX2, COL3A1 COL1A1, SPP1 and ALPL after 30 days. The present study
demonstrated that TCP influences the behavior of ADSCs in vitro by enhancing proliferation, differentiation and
deposition of matrix.
P
Various bone grafting materials have been used as
alternatives or supplements to autogenous bone. Many
synthetic and allograft materials are available at present.
Among the resorbable ceramics, have gained much
attention tricalcium phosphate (TCP) for its usefulness
as bone substitutes and scaffolds in tissue engineering
(1). The pure phase of TCP has good biodegradability
and osteoconductivity (2), and it is used successfully in
hand surgery, osteology, maxillofacial and implantology
surgery, where it has demonstrated its capacity to form
bone on reabsorption by the organism (3).
Because few reports analyze the genetic effects of
TCP on stem cells, the expression of genes related to the
osteoblast differentiation were analyzed using cultures of
Adipose Derived Stem Cell (ADSC) cultivated on TCP
scaffolds.
Adipose tissue is the most abundant and accessible
source of adult stem cells (4), as the frequency of stem
cells within adipose tissue range from 1:100 to 1:1500
cells, which far exceeds the frequency of marrow stromal
cells (MSCs) in bone marrow (5).
Growing evidence suggests that these cells may retain
multilineage potential and are capable of giving rise to
cell lineages other than those of the resident tissue (6).
Adipose tissue is an ideal source of autologous stem
cells, particularly in comparison with the traditional
bone marrow cells procurement procedure, as it is easily
obtainable by lipoaspiration under local anesthesia with
minimal discomfort for the patient, and its MSC content
is adequate for clinical-grade cell manipulation in
regenerative medicine.
Current methods for isolating ADSCs from adipose
tissue vary slightly among investigators but generally
rely on a collagenase digestion followed by centrifugal
Key words: Tricalcium Phosphate, adipose tissue, stem cells, gene expression, PCR real time
Corresponding author: Prof. Francesco Carinci, M.D
Department of Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
51
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
52 (S)
V. SOLLAZZO ET AL.
separation to isolate the stromal/vascular cells from
primary adipocytes. Differential centrifugation separates
floating mature adipocytes from the pellet of stromal/
vascular cells. This pellet contains blood cells, fibroblasts,
pericytes, and endothelial cells in addition to ADSCs
(4, 7). This stromal/vascular fraction is plated on plastic
tissue culture dishes. Stromal cells adhere to plastic, and
during further culture nonadherent hematopoietic and
other contaminating cells can be depleted. To this end,
we isolated a stem cell population with mesenchymal
features from adipose tissue samples of volunteers
patients undergoing for lipoaspiration, and explored its
characteristics and multilineage potential.
To study how TCP can induce osteoblast differentiation
and proliferation in mesenchymal stem cells, the expression
levels of bone related genes (RUNX2, SP7, ALPL, SPP1,
COL1A1, COL3A1 and FOSL1) and mesenchymal stem
cells marker (ENG) were measured in ADSCs and normal
osteoblast (NO) cultivated on TCP scaffolds using real time
Reverse Transcription-Polymerase Chain Reaction.
volunteers were sampled during operation and transferred in
75 cm2 culture flasks containing DMEM medium supplemented
with 20% fetal calf serum, antibiotics (Penicillin 100 U/ml
and Streptomycin 100 micrograms/ml - Sigma Aldrich, Inc.,
St Louis, Mo, USA) and amminoacids (L-Glutamine - Sigma
Aldrich, Inc., St Louis, Mo, USA). Cells were grown in a
humidified atmosphere of 5% CO2 at 37°C. The medium was
changed the next day and every 3 days thereafter. After 15 days,
the pieces of bone tissue were removed from the culture flask.
Cells were harvested after 30 days of incubation.
F
O
Cell culture
For the assay, ADSCs and NO at second passage were
trypsinized upon subconfluence and seeded on TCP scaffolds
(Fin-Ceramica Faenza S.p.A., Faenza, Italy).
Another set of wells containing untreated cells were used
as control.
The medium was changed every 3 days. The cells were
maintained in a humidified atmosphere of 5% CO2 at 37°C.
Cells were harvested at two time points, 15 and 30 days,
for RNA extraction. Quantitative real-time reverse-transcriptase
polymerase chain reaction was performed to measure mRNA
expression of several osteogenic marker genes.
RNA processing
Reverse transcription to cDNA was performed directly
from cultured cell lysate using the TaqMAN Gene Expression
Cells-to-Ct Kit (Ambion Inc., Austin, TX, USA), following
manufacturer’s instructions. Briefly, cultured cells were lysed
with lysis buffer and RNA released in this solution. Cell lysate
were reverse transcribed to cDNA using the RT Enzyme Mix
and appropriate RT buffer (Ambion Inc., Austin, TX, USA).
Finally the cDNA was amplified by real-time PCR using the
included TaqMan Gene Expression Master Mix and the specific
assay designed for the investigated genes.
O
R
MATERIALS AND METHODS
Stem isolation
Human adipose tissue was obtained by liposuction of adult
volunteers patients. Fat was finely minced with a sterile scissors
and transferred in a tube containing digestive solution (DMEM
containing 1 mg/mL of collagenase type II). The tube was placed
in 37˚C water bath for 60 min, swirling occasionally.
The sample was centrifugated at 3000 rpm for 5 minutes.
Then was removed from centrifuge, shaked vigorously (to
complete separation of stromal cells from primary adipocytes),
and centrifugated again for 5 minutes. The oil on the top of the
tube (which includes primary adipocytes) was aspirated and
discarded, while the stromal fraction at the bottom was washed
for three times with 10 ml of PBSA 1X and centrifugated again
for 5 minutes. After last wash the pellet was resuspended in 10
ml of Alphamem medium (Sigma Aldrich, Inc., St Louis, Mo,
USA) supplemented with 10% fetal calf serum, antibiotics
(Penicillin 100 U/ml and Streptomycin 100 micrograms/ml
- Sigma, Chemical Co., St Louis, Mo, USA) and amminoacids
(L-Glutamine - Sigma, Chemical Co., St Louis, Mo, USA). The
medium was changed after 2-3 days. Cells were characterized
for staminality by flow cytometric analyses.
P
Flow cytometric analyses
The purity of cell cultures was determined by analysis of
different antigens after staining with fluorochrome (FITC- or
PE-) conjugated mAbs anti-human CD14-FITC, CD14-PE,
CD34-FITC, CD45-FITC, CD90-PE, CD105-PE (Immunotech,
Marseille, France) and analyzed by FACScan. The nonspecific
mouse IgG was used as isotype control (Immunotech). To avoid
nonspecific fluorescence from dead cells, live cells were gated
tightly using forward and side scatter.
Primary osteoblasts cell culture
Fragments of bone derived from skull of an healthy
Real time PCR
Expression was quantified using real time RT-PCR. The
gene expression levels were normalized to the expression
of the housekeeping gene RPL13A and were expressed as
fold changes relative to the expression of the untreated cells.
Quantification was done with the delta/ delta calculation
method (8).
Forward and reverse primers and probes for the selected
genes were designed using primer express software (Applied
Biosystems, Foster City, CA, USA) and are listed in Table I.
All PCR reactions were performed in a 20 µl volume using
the ABI PRISM 7500 (Applied Biosystems, Foster City, CA,
USA). Each reaction contained 10 µl 2X TaqMan universal
PCR master mix (Applied Biosystems, Foster City, CA, USA),
400 nM concentration of each primer and 200 nM of the probe,
and cDNA. The amplification profile was initiated by 10-minute
incubation at 95°C, followed by two-step amplification of 15
seconds at 95°C and 60 seconds at 60°C for 40 cycles. All
experiments were performed including non-template controls to
exclude reagents contamination.
Statistical analyses
Comparison of gene expression between ADSCs and NO
was performed with “Two tails ANOVA “statistic analyses using
F
53 (S)
European Journal of Inflammation
Excel spreadsheets (Microsoft Office 2003).
RESULTS
Cell cultures were phenotipically characterized by
flow cytometric analyses. Cell preparations derived from
dental pulp were homogenously CD105+, CD90+, CD34-,
CD45-, CD14-, which is a typical mesenchymal stem cells
surface antigen profile (Fig. 1)
To further investigate if TCP stimulates osteoblasts
differentiation and proliferation in ADSCs, several
osteoblast genes (SP7, RUNX, COL3A1, COL1A1,
ALPL, SPP1 and FOSL1) and mesenchymal stem cells
marker, were analyzed by quantitative real-time PCR.
ADSCs and NO were cultured on TCP scaffolds at two
time point, 15 and 30 days.
In ADSCs, after 15 days of treatment with TCP, the
genes SP7, ENG, ALPL and SPP1 were up-regulated.
Instead FOSL1, RUNX2 and COL1A1 were downregulated. COL3A1 expression was the same in treated
and untreated ADSCs (Fig. 2).
After 30 days of treatment, in ADSCs, the bone related
genes SP7 and SPP1 were up-regulated, while ENG,
COL3A1, COL1A1, FOSL1, RUNX2 and ALPL were
decreased (Fig. 3).
Different results were obtained for NO. After 15 days
of treatment only SPP1 was over-expressed. The other
bone related genes SP7, ENG, FOSL1, RUNX2, COL3A1,
COL1A1 and ALPL were down-regulated (Fig. 4).
After 30 days the bone related genes SP7, ENG,
FOSL1, RUNX2, COL3A1 ALPL and SPP1 were upregulated, while COL1A1 was decreased (Fig. 5).
Comparing, by “Two tails ANOVA”, the relative
expression of the analyzed genes between ADSCs
and NO we observed that significantly differentially
expressed genes at 15 days of treatment were RUNX,
COL1A1, ALPL and SPP1 (Table II). After 30 days of
treatment, the differentially expressed genes were SP7,
FOSL1, RUNX2, COL3A1, COL1A1, ALPL and SPP1
(Table III).
F
O
DISCUSSION
Bioactive calcium phosphates, such as tricalcium
phosphate (TCP), has been intensively investigated as the
cell scaffold for bone tissue engineering(9) because it is
well recognized that it is compatible to natural bone tissue
and osteoconductive.
To study how TCP can induce osteoblast differentiation
in mesenchymal stem cells, ADSCs were cultivated for 15
and 30 days on TCP scaffolds. The expression levels of
bone related genes and mesenchymal stem cells marker
were analyzed, using real time Reverse TranscriptionPolymerase Chain Reaction.
Mesenchymal stem cells are an adherent, fibroblast-like
cell population found in bone marrow as well as blood,
muscle dermis and adipose tissue. In this regard, fat is a
source of uncommitted mesenchymal stem cells that can
O
R
P
Table I. Primer and probes used in real time PCR.
Gene symbol
Gene name
Primer sequence (5’>3’)
Probe sequence (5’>3’)
SPP1
osteopontin
F-GCCAGTTGCAGCCTTCTCA
R-AAAAGCAAATCACTGCAATTCTCA
CCAAACGCCGACCAAGGAAAACTCAC
COL1A1
collagen type I alpha1
F-TAGGGTCTAGACATGTTCAGCTTTGT
R-GTGATTGGTGGGATGTCTTCGT
CCTCTTAGCGGCCACCGCCCT
RUNX2
runt-related transcription
factor 2
F-TCTACCACCCCGCTGTCTTC
R-TGGCAGTGTCATCATCTGAAATG
ACTGGGCTTCCTGCCATCACCGA
ALPL
alkaline phospatasi
F-CCGTGGCAACTCTATCTTTGG
R-CAGGCCCATTGCCATACAG
CCATGCTGAGTGACACAGACAAGAAGCC
COL3A1
collagen, type III, alpha 1
F-CCCACTATTATTTTGGCACAACAG
R-AACGGATCCTGAGTCACAGACA
ATGTTCCCATCTTGGTCAGTCCTATGCG
ENG
endoglin
F-TCATCACCACAGCGGAAAAA
R-GGTAGAGGCCCAGCTGGAA
TGCACTGCCTCAACATGGACAGCCT
FOSL1
FOS-like antigen 1
F-CGCGAGCGGAACAAGCT
R-GCAGCCCAGATTTCTCATCTTC
ACTTCCTGCAGGCGGAGACTGACAAAC
SP7
osterix
F-ACTCACACCCGGGAGAAGAA
R-GGTGGTCGCTTCGGGTAAA
TCACCTGCCTGCTCTTGCTCCAAGC
RPL13A
ribosomal protein L13
F-AAAGCGGATGGTGGTTCCT
R-GCCCCAGATAGGCAAACTTTC
CTGCCCTCAAGGTCGTGCGTCTG
54 (S)
V. SOLLAZZO ET AL.
Table II. Differentially expressed genes between ADSCs and
NO after 15 days of treatment
Genes
ADSCs
NO
Differentially
expressed genes
SP7
ENG
FOSL1
RUNX2
COL3A1
COL1A1
ALPL
SPP1
Log10 RQ
0,93
0,09
-0,10
-0,05
0,00
-0,78
0,11
0,93
Log10 RQ
-0,44
-0,21
-0,29
-0,61
-0,63
-0,70
-0,57
1,07
p<0,005
0,067
0,152
0,172
0,001
0,138
0,004
0,006
0,001
F
O
O
R
Table III. Differentially expressed genes between ADSCs
and NO after 30 days of treatment.
Genes
ADSCs
SP7
ENG
FOSL1
RUNX2
COL3A1
COL1A1
ALPL
SPP1
Log10 RQ
0,43
-0,08
-0,11
-0,28
-0,29
-0,40
-0,96
0,04
P
NO
Log10 RQ
1,46
0,49
1,40
1,27
1,04
-1,86
0,91
1,36
Differentially
expressed genes
p<0,005
0,001
0,199
0,001
0,001
0,004
0,023
0,001
0,001
be easily expanded and, over the last few-years, autologous
fat has been used in some clinical applications for novel
cell-based (4).
The study was first conducted on ADSCs, to evaluate
the genes that are activated during the stem cells
differentiation inducted by TCP. Then was extended to
NO to compare the genetic profiling of differentiated stem
cells with osteoblast after TCP treatment.
“Two tails ANOVA” showed that the significantly
differentially expressed genes among the two group
were RUNX2, COL1A1, ALPL and SPP1 after first 15
days of treatment, and SP7, FOSL1, RUNX2, COL3A1,
COL1A1, SPP1 and ALPL after 30 days.
TCP cause the down-regulation of RUNX2 both in
ADSCs than in NO in the first 15 day of treatment. After
30 days of treatment, RUNX2 was down-regulated in
ADSCs and up-regulated in NO.
RUNX2 is the most specific osteoblast transcription
factor, activated in the first stage of differentiation.
It is a prerequisite for osteoblast differentiation and
consequently mineralization
Fig. 1. Surface antigene profile of ADSCs. Phenotipic
characterization by flow cytometry of cell cultures derived
from adipose tissue, by staining with the indicated mAb.
Representative dot plots documenting the purity of cell
preparations and the homogenously CD105+, CD90+, CD34, CD45-, CD14- surface antigen profile, are shown. Irr.,
irrelevant, isotype control Ab.
Another transcriptional factor, SP7, that regulates
bone formation and osteoblast differentiation and that is
downstream of RUNX2 (10) was differentially expressed
between ADSCs and NO.
SP7 was down-regulated during the first 15 days of
treatment and increased at 30 days of culture on TCP
scaffold in ADSCs and NO.
TCP also modulate the expression of genes encoding
for collagenic extracellular matrix proteins like collagen
type 1α1 (COL1A1) and collagen type 3α1 (COL3A1),
but this effect was observed only in the late stage of
treatment.
In treated ADSCs was observed the down-regulation
of COL1A1 during all the period of treatment both in
ADSCs than in NO. COL3A1 instead was up-regulated
only in NO after 30 days of treatment.
In this study, ALPL was up-regulated in the first 15
days of treatment, in ADSCs and in the next 30 days of
treatment in NO.
Increasing in ALPL expression is associated with
osteoblast differentiation (11). For this reason, its
expression is more evident in osteoblast than in stem
cells.
Another gene involved in osteoblast differentiation
and modulated by TCP was FOSL1. This gene was down
regulated in cells in ADSCs during all the 30 days of
treatment.
F
55 (S)
European Journal of Inflammation
Fig. 2. Gene expression in ADSCs cultivated with TCP for 15
days.
F
O
Fig. 5. Gene expression in NO cultivated with TCP for 30 days.
O
R
P
Fig. 3. Gene expression in ADSCs cultivated with TCP for 30
days.
Fig. 4. Gene expression in NO cultivated with TCP for 15 days.
In NO, its expression increased at the end of the 30
days probably because it is important in the late stage of
mineralization. FOSL1 encodes for Fra-1, a component
of the dimeric transcription factor activator protein1 (AP-1). AP-1 sites are present in the promoters of
many osteoblast genes, including alkaline phosphatase,
collagen I, osteocalcin. The differential expression of Fos
family members could play a role in the regulation of
bone-specific gene expression significant for osteoblast
differentiation (12).
TCP induce up-regulation of osteopontine (SPP1) for
all the period of the treatment both in ADSCs than NO.
Osteopontin is actively involved in bone resorbitive
processes directly by ostoclasts (13). Osteopontin
produced by osteoblasts, show high affinity to the
molecules of hydroxylapatite in extracellular matrix and
it is chemo-attractant to osteoclasts (14). In our study
osteopontin is significantly down expressed in both cells
type, ADSCs and NO.
The present study demonstrated that TCP influences
the behavior of ADSCs in vitro by enhancing proliferation,
differentiation and deposition of matrix as demonstrated by
the activation of osteoblast related genes SP7, ALPL and
SPP1.
The obtained results can be relevant to better
understand the molecular mechanism of bone regeneration
and as a model for comparing other materials with similar
clinical effects.
REFERENCES
1.
2.
3.
Flautre B, Descamps M, Delecourt C, Blary MC, Hardouin
P. Porous HA ceramic for bone replacement: role of the
pores and interconnections - experimental study in the
rabbit. J Mater Sci Mater Med 2001; 12:679-82.
Matsuno T, Nakamura T, Kuremoto K, Notazawa
S, Nakahara T, Hashimoto Y, Satoh T, Shimizu Y.
Development of beta-tricalcium phosphate/collagen
sponge composite for bone regeneration. Dent Mater J
2006; 25:138-44.
Mangano C, Bartolucci EG, Mazzocco C. A new porous
hydroxyapatite for promotion of bone regeneration in
56 (S)
4.
5.
6.
7.
8.
V. SOLLAZZO ET AL.
maxillary sinus augmentation: clinical and histologic study
in humans. Int J Oral Maxillofac Implants 2003; 18:23-30.
Gimble JM, Guilak F. Differentiation potential of adipose
derived adult stem (ADAS) cells. Current Topics in
Developmental Biology, Vol 58 2003; 58:137-60.
De Ugarte DA, Morizono K, Elbarbary A, Alfonso Z, Zuk
PA, Zhu M, Dragoo JL, Ashjian P, Thomas B, Benhaim
P, Chen I, Fraser J, Hedrick MH. Comparison of multilineage cells from human adipose tissue and bone marrow.
Cells Tissues Organs 2003; 174:101-09.
Weissman IL, Anderson DJ, Gage F. Stem and progenitor
cells: Origins, phenotypes, lineage commitments,
and transdifferentiations. Annual Review of Cell and
Developmental Biology 2001; 17:387-403.
Hauner H, Entenmann G, Wabitsch M, Gaillard D,
Ailhaud G, Negrel R, Pfeiffer EF. Promoting effect of
glucocorticoids on the differentiation of human adipocyte
precursor cells cultured in a chemically defined medium. J
Clin Invest 1989; 84:1663-70.
Livak KJ, Schmittgen TD. Analysis of relative gene
expression data using real-time quantitative PCR and the
2(-Delta Delta C(T)) Method. Methods 2001; 25:402-8.
Livingston T, Ducheyne P, Garino J. In vivo evaluation of
11.
12.
F
O
O
R
P
9.
10.
a bioactive scaffold for bone tissue engineering. J Biomed
Mater Res 2002; 62:1-13.
Nishio Y, Dong Y, Paris M, O’Keefe RJ, Schwarz EM,
Drissi H. Runx2-mediated regulation of the zinc finger
Osterix/Sp7 gene. Gene 2006; 372:62-70.
Turksen K, Bhargava U, Moe HK, Aubin JE. Isolation of
monoclonal antibodies recognizing rat bone-associated
molecules in vitro and in vivo. J Histochem Cytochem
1992; 40:1339-52.
McCabe LR, Banerjee C, Kundu R, Harrison RJ,
Dobner PR, Stein JL, Lian JB, Stein GS. Developmental
expression and activities of specific fos and jun proteins
are functionally related to osteoblast maturation: role of
Fra-2 and Jun D during differentiation. Endocrinology
1996; 137:4398-408.
Dodds RA, Connor JR, James IE, Rykaczewski EL,
Appelbaum E, Dul E, Gowen M. Human osteoclasts, not
osteoblasts, deposit osteopontin onto resorption surfaces:
an in vitro and ex vivo study of remodeling bone. J Bone
Miner Res 1995; 10:1666-80.
Ohtsuki C, Kamitakahara M, Miyazaki T. Bioactive ceramicbased materials with designed reactivity for bone tissue
regeneration. J R Soc Interface 2009; 6 Suppl 3:S349-60.
13.
14.
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
COMPARISON BETWEEN IMPLANTS INSERTED INTO
NATIVE AND GRAFTED BONE: A RETROSPECTIVE
COHORT STUDY ON 2,131 IMPLANTS
S. FANALI1, I. ZOLLINO2, A. AVANTAGGIATO2, G. BRUNELLI2, B. DE ROSSI2 and F. CARINCI2
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
2
In the last decade, several studies have been performed to evaluate the clinical outcome of implants inserted into
grafted maxillae. A retrospective cohort study on 2,131 implants was planned to verify the impact on the clinical
outcome. A total of 2,131 fixtures were inserted into native and grafted bones. Multiple implant systems were used.
Five surgeons were enrolled. Kaplan Meyer and Cox analyses were used to detect those variables associated with
the clinical outcome. Thirty one implants were lost (survival = 98.55%). Among the studied variables, only jaw and
implant length were statistically associated with different implant survival rates. Of the remaining 2,100 implants,
304 had a peri-implant bone resorption rate that was higher than the cut-off value (success = 85.5%). The mean
follow-up was 33 months. Implant site, type, length and bone type were associated to success. Bone grafts do not
increase the number of lost implants in comparison with those inserted into native bone although higher bone
resorption around the implant neck must be expected.
O
R
Prosthetic rehabilitation of the edentulous jaw using
endosseous implants to restore oral function is often a difficult
surgical and prosthetic challenge because of the minimal
amount of residual bone quality and quantity support and the
progressive nature of the resorptive process (1).
Vastly different surgical techniques have been advocated
for osseous reconstruction of severely atrophic jaws.
Materials which were previously used for grafting include
autogenous bone, allogenic bone and alloplastic materials
(2).Autogenous bone grafting is the “gold standard” in
materials since it is the most predictable and successful bone
available. It can be harvested in multiple forms (particles,
strips and blocks) and is available from the calvaria, the
iliac crest and the mandible. It has no adverse antigenicity
because it originates from the patient, and it is extremely
reliable (3). However, it has the drawback of requiring
secondary surgery for autograft retrieval, with increased
operation time, anesthesia and donor site morbidity (4).
Consequently, other materials have been studied to avoid
the above mentioned side-effects. Among them are banked
allografts (1). Bone allograft transplantation has been
performed in humans for more than one hundred years
and is also being used increasingly by orthopedic surgeons
for ligament reconstruction, meniscal transplantation and
articular surface reconstruction (5).
Many forms of banked bone allograft are available to
the surgeon. Among the grafts available are fresh-frozen
bone (FFB), freeze-dried bone (FDB), and demineralized
fresh dried bone (DFDB). Each one of these grafts carries
risks and has unique limitations and handling properties.
In order to use these materials appropriately, the surgeon
must be familiar with the properties of each and must
feel confident that the bone bank providing the graft is
supplying a safe and sterile graft (1).
Since there are few reports available regarding
the clinical outcome of grafts used for alveolar ridge
reconstruction we planned a retrospective cohort study to
evaluate the factors influencing the outcome of implants
inserted into native and grafted bone. Five surgeons
working in different centers were involved and multiple
dental implant systems were used for placement.
P
MATERIALS AND METHODS
A) Graft materials
The FFB was obtained from the Veneto Tissue Bank in
Key words: iliac crest, graft, calvaria, transplant, implant, jaw
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C. Section of Maxillofacial Surgery
University of Ferrara
Corso Giovecca 203 44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.45558
0393-974X (2011)
57
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
58 (S)
S. FANALI ET AL.
Treviso (Italy) (1). – It is mineralized, non-irradiated, disinfected,
frozen homologous bone. The bone harvesting is obtained from
the anterior and posterior iliac crest in the first 12 hours after
donor death. The bone is then disinfected, for at least 72 hours
at -4°C, in a polychemotherapeutic solution of vancomycine,
polymyxine, glazidine and lincomycine, following that the
sample is irrigated with a sterile saline solution. The sample is
then subdivided into cortico-medullary blocks, packed in double
sterile casing and frozen at -80°C.
Specific tests were performed to guarantee the safety of the
transplanted material.
Bone from living donors was obtained from the Gaetano Pini
Institute in Milano (Italy) (6). It derives from hip substitutions in
the elderly. It was treated in a similar way to the FFB.
Calvaria, iliac crest and symphyseal bone from autografts
were collected as usual (2).
1.5 mm during the first year of loading and 0.2 mm/years during
forthcoming years (8).
C) Statistical Analysis
Both the number of implants still in place at the end of the
follow-up period (i.e. survival rate- SVR) and the implants with
reduced bone resorption around the fixture neck (i.e. success rate
– SCR) were statistically evaluated to detect the variables that
were significantly associated with the clinical outcome. In order
to detect the success rate, the differences between the implant
abutment junction and the bone crestal level was defined as the
Implant Abutment Junction (IAJ) and calculated at the time of the
operation and during follow-up. The delta IAJ is the difference
between the IAJ at the last check-up and the IAJ recorded just
after the operation. Delta IAJ medians were stratified according
to the variables of interest. Kaplan Meier and Cox analyses were
performed to investigate SVR and SCR (9).
F
O
O
R
B) Data collection
Before surgery, radiographic examinations were done with
the use of orthopantomograph and CT scans.
In each patient, peri-implant crestal bone levels were
evaluated by the calibrated examination of ortopantomograph xrays. Measurements were recorded before surgery, after surgery
and at the end of the follow-up period. The measurements were
carried out mesially and distally to each implant, calculating the
distance between the edge of the implant and the most coronal
point of contact between the bone and the implant. The bone
level recorded just after the surgical insertion of the implant
was the reference point for the following measurements. The
measurement was rounded off to the nearest 0.1 mm. A periapical radiograph was impresed by means of a customized Rinn
holder device. This device was necessary to maintain the X-ray
cone perpendicular to a film which was pieced parallel to the
long axis of the implant. The endoral radiographs were taken
using a long x-ray tube at 70 Kw of power, and performed with
a computer system (Gendex, KaVo ITALIA srl, Genoa, Italy)
and saved in uncompressed TIFF format for classification. Each
file was processed with the Window XP Professional operating
system using Photoshop 7.0 (Adobe, San Jose, CA), and shown
on a 17” SXGA TFT LCD display with a NVIDIA GÈ Force
FX GO 5600, 64 MB video card (Acer Aspire 1703 SM-2.6).
With the known dimensions of the implant, it was possible to
establish the distance from the mesial and distal edges of the
implant platform to the point of bone-implant contact (expressed
in tenths of a millimeter).
The difference between the implant-abutment junction and
the bone crestal level was defined as the Implant Abutment
Junction (IAJ) and was calculated at the time of the operation
and during follow-up. The delta IAJ is the difference between
the IAJ at the last check-up and the IAJ recorded just after the
operation. Delta IAJ medians were stratified according to the
variables of interest.
Peri-implant probing was not performed since controversy
still exists regarding the correlation between probing depth
and implant success rates (7). The implant success rate (SCR)
was evaluated according to the following criteria: (a) absence
of persisting pain or dysesthesia; (b) absence of peri-implant
infection with suppuration; (c) absence of mobility; and (d)
absence of persisting peri-implant bone resorption greater than
P
RESULTS
In the period between January 2000 and December
2008, 2,131 dental implants were inserted by 5 different
surgeons to restore partial or complete edentulism. The
median age of the patients was 53 ± 11 (min 15, max 89),
and their gender was as follows: 1,274 (59.8%) fixtures
inserted in females and 857 (40.2%) in males.
The investigated variables were: jaw (upper and
lower), replaced teeth, implant type, length and diameter,
surgeon, bone type.
Implants were inserted into both jaws, 1,263 (59.3%)
in the maxilla and 868 (40.7%) in the mandible; 523
(24.5%) incisors, 297 (13.95%) cuspids, 702 (32%)
pre-molars and 609 (28.6%) molars were rehabilitated,
respectively. 355 Alpha Bio (3D alpha Bio, Pescara,
Italy), 107 3i (Osseotite, Biomet Inc., Parsippany, NJ,
USA), 386 Frialit (Friadent, Dentsply Inc., York, PA,
USA), 76 Branemark (Nobel Biocare, Gothenburg,
Sweden), 150 Maestro (Dentsply-Friadent,Mannheim,
Germany), 91 Nobel Biocare (Nobel Biocare, Gothenburg,
Sweden), 79 P1H (3i implants, Biomet Inc, US), 76
RBM (Lifecore Biomedical Inc., Chaska, MN, USA),
76 Restore (Lifecore Biomedical), 60 Samo (Samo,
Bologna, Italy), 68 TiUnite (Nobel Biocare, Gothenburg,
Sweden), 278 Xive (Dentsply-Friadent,Mannheim,
Germany), 39 Neoss (Neoss SRL, Milan, Italy) and 41
IMZ (Dentsply-Friadent,Mannheim, Germany) were
inserted. An additional 16 different implant types were
used for the remaining 249 fixtures. There were 294
(13.8%) narrow (i.e. diameter smaller than 3.75 mm), 376
(34.5%) standard (i.e. 3.75mm ≤ diameter ≤ 3.8 mm), and
1,101 (51.7%) wide (i.e. diameter larger than 3.8 mm)
implants; implant length was as follow: 637 (29.9 %)
short (i.e. length < 13 mm), 728 (34.2 %) standard (i.e.
length = 13 mm ) and 766 (35.9 %) longer (i.e. length
> 13 mm) fixtures. The five surgeons inserted 261 (12.2
F
59 (S)
European Journal of Inflammation
%), 310 (14.5%), 1074 (50,4%), 350 (16.4 %), and 136
(6.4 %) implants, respectively. Fixtures were inserted into
different bone types: 1,435 (67.3 %) into native bone, 350
(16.4 %) into FFB, 175 (8.2 %) into calvaria, 96 (4.5 %)
into autologous iliac crest, 17 (0.8 %) into symphyseal
grafts and 58 (2.7 %) into bone from living donors. Table I
report the mean bone resorption around implants clattered
using the above mentioned variables.
Thirty one implants were lost (SVR = 98.55%, Fig 1).
Analyzing the studied variables by means of an univariate
analysis, only upper/lower jaw (p=0.01), implant site
(p=0.01), fixture type (p=0.01), length (p=0.01) and
surgeon (p=0.001) had a statistical value. Subsequently,
by performing a multivariate analysis only upper/lower
jaw (p=0.01) and length (p=0.01) were statistically
associated with different implant SVR (Table II). Implants
inserted into the maxilla had a statistically higher risk (26
over 31) of being lost in the follow-up period compared
F
O
Table I. Distribution of series; the number of cases is out of parenthesis whereas the median delta IAJ is in parenthesis. Differences in
n. are due to lost implants.
Jaw
Tooth
Implant
length
Implant diameter
Implant type
Surgeon
Bone
Maxilla
1237 (1.1)
Incisors
520 (0.8)
Length < 13
mm
621 (1.1)
Diameter < 3.75
mm
288 (1.2)
Alpha Bio
343 (1.4)
1
260 (1.5)
Calvaria
174 (1.4)
Mandible
863 (1.0)
Cuspids
295 (0.8)
Diameter = 3.75
mm
727 (1.1)
3i
103 (1.8)
2
298 (1.6)
FFB
343 (1.9)
-
Premolars
692 (1.1)
Length > 13
mm
762 (0.8)
Diameter > 3.75
mm
1085 (1.0)
Frialit
380 (0.6)
3
1066 (0.6)
Bone from living
donours
57 (0.5)
-
Molars
593 (1.3)
-
-
Branemark
76 (1.2)
4
343 (1.9)
Native
1415 (0.8)
-
-
-
-
Maestro
150 (0.7)
5
133 (0.8)
Symphiseal bone
17 (1.0)
-
-
-
-
Nobel biocare
89 (1.8)
-
Iliac crest
94 (1.5)
-
-
-
-
P1H
78 (1.5)
-
-
-
-
-
-
RBM
75 (1.7)
-
-
-
-
-
-
Restore
76 (0.7)
-
-
-
-
-
-
Samo
58 (1.2)
-
-
-
-
-
-
TiUnite
68 (0.5)
-
-
-
-
-
-
Xive
276 (0.4)
-
-
-
-
-
-
Neoss
39 (0.6)
-
-
-
-
-
-
IMZ
41 (1.2)
-
-
P
O
R
Length = 13
mm
717 (1.3)
60 (S)
S. FANALI ET AL.
Table II. A multivariate analysis (Cox) is performed by using only those variables reaching statistical significant value with the
univariate analysis (Kaplan Meyer). The table shows p-value (significance) and the confidence interval (CI) for both survival (SVR
– i.e. implant still in place at the end of the follow-up) and success rate (SCR – i.e. bone resorption around implant neck).
SVR
Variable
Age
Gender
Jaw
Tooth site
Implant length
Surgeon
Significance
.0347
.3198
.0014
.0558
.0048
.3149
Age
Gender
Jaw
Tooth site
Diameter
Length
Surgeon
Bone type
.3640
.8302
.3321
.0001
.1751
.0032
.5398
.0001
Exp(B)
1.0379
.6870
.2038
1.4684
.4522
1.1975
SCR
.9948
.9748
.8770
1.4185
.8941
.7888
1.0344
.7152
95% CI for Exp(B)
Lower
Upper
1.0027
1.0743
.3279
1.4394
.0767
.5413
.9906
2.1767
.2604
.7854
.8426
1.7017
F
O
.9837
.7719
.6727
1.2645
.7605
.6735
.9283
.6554
O
R
P
Fig. 1. The overall implant survival is reported; follow is the
number of months (observation period), cumulative survival
is the percentage of implant still in place, censored are those
implants dropped out from the observation
to those inserted into the mandible; a similar result was
obtained for short fixtures (15 over 31) compared to
standard and long ones.
Of the remaining 2,100 implants, 304 had peri-implant
bone resorption that is higher than the cut-off value (SCR
= 85.5% at 120 months, Fig 2). The mean follow-up
was 33 months. By analyzing the studied variables by
means of the Log Rank test, all of them (i.e. upper/lower
1.0060
1.2310
1.1433
1.5913
1.0511
.9238
1.1527
.7805
Fig. 2. The overall implant success rate (calculated by using
peri-implant bone resorption) is reported; follow is the number
of months (observation period), cumulative survival is the
percentage of implant with a peri-implant bone resorption lower
then the cut of value (absence of persisting peri-implant bone
resorption greater than 1,5 mm during the first year of loading
and 0,2 mm/years during the following years), censored are
those implants dropped out from the observation
jaw, implant sites, fixture types, diameter, length, bone
types and surgeon) had a statistically significant value.
Subsequently, by performing Cox analysis only the
implant site (p=0.001), implant type (p= 0.001), length
(p= 0.01) and bone type (p=0.01) were statistically
F
61 (S)
European Journal of Inflammation
associated with a different implant SCR (Table II). As
reported in Table I, Xive, longer implants and bone from
living donors had the lowest peri-implant bone resorption,
which means a better clinical outcome (SCR).
DISCUSSION
The concept of osseointegration, i.e., directly
anchoring endosseous implants, made of commercially
pure or titanium alloy, to the bone caused a breakthrough
in oral rehabilitation (10). In many cases, the insertion of
endosseous implants is difficult because of the lack of
supporting bone. In the case of severe atrophy of the jaws,
a large volume of bone can be harvested and grafted into
both jaws.
The identification of factors for long term survival
rates (SVR i.e. total implants still in place at the end of
the follow-up) and success rates (SCR i.e. good clinical,
radiological and aesthetic outcome) are the main goals of
the recent literature. Several variables can influence the
final result, but in general they are grouped as 1-surgery, 2-host-, 3-implant-, and 4-occlusion-related factors
(1). The surgery-related factors are made up of several
variables such as an excess of surgical trauma like thermal
injury bone preparation, drill sharpness and design (11).
Bone quality and quantity are the most important hostrelated factors, while design, surface coatingdiameter
and length are the most important implant-related factors
(2, 12). Finally, force quality and quantityand prosthetic
design are the variables of interest among the occlusionrelated factors. All these variables are a matter of scientific
investigation since they may affect the clinical outcome
(13).
As regards SVR, Woo and coll. (14) analyzed
dentoalveolar reconstructive procedures (DRPs) such as
external or internal sinus lifts, onlay bone grafting, or
guided-tissue regeneration with autogenous bone grafts
or autogenous bone graft substitutes commonly used to
enhance deficient implant recipient sites to assess the use
of DRPs as a risk factor in implant failure. A retrospective
cohort study was designed, a sample of 677 implants were
investigated and implant failure was the major outcome
variable. Four factors were close to being statistically
associated with implant failure: current tobacco use,
implant length, implants staging, and prosthesis type but
in the multivariate model, patients with DRPs did not have
a statistically significant increased risk of implant failure.
As regards SCR, Yoo and coll. (15) performed a
retrospective cohort study by measuring crestal bone level
changes in subjects with immediately loaded implants in
order to identify risk factors associated with changes in
bone level. The sample was made up of 174 subjects who
received 347 immediately loaded implants with a mean
duration of radiographic follow-up of 6.9 +/- 4.0 months,
respectively. The multivariate model revealed that
radiolucency at or adjacent to implant sites was associated
with an increased risk of crestal bone loss.
The present study reports a series of 2,131 implants
with only 31 implants having been lost during a mean
follow-up of 33 months (SVR = 98.55%).
In general, implant type, length and diameter are
considered relevant implant-related factors (16-18). In
our series, implant length had an impact on both SVR and
SCR, whereas implant type had an effect on peri-implant
bone resorption (SCR).
The surface of an implant has been found to interact
with bone by remodeling in several ways, leading to
various effects (19). Superior osseointegration that is
appreciated in terms of higher bone-implant interface and
greater resistance to torque removal have been repeatedly
reported in studies that compared the shear strength of
smooth and rough implants. Surface roughness increases
the wettability of a material and influences spontaneous
protein deposit, specifically fibronectin, an adherent
molecule recognized by osteoblasts (20). It also affects
proliferation, differentiation, local factor release and
response to osteoblast-like cells (20).
In our series, different fixtures have different periimplant bone resorption and this datum is not surprising
due the above mentioned reasons.
Bone quality, a host-related factor, is believed to be
one of the strongest predictors of outcome. Our data
demonstrated that jaws have an impact on SVR whereas
site (i.e. incisor, cuspid, premolar and molar) and bone
type have an effect on SCR. Studies have shown that
implant therapy in the maxilla has a higher clinical failure
rate than in the mandible, and regional differences in
maxillary bone mineral density (BMD) may be partly
responsabile (2). In the molar region, peri-implant bone
resorption is significantly higher than in other sites. This
can be explained by the fact that implants in the molar
area have a higher loading force in comparison to those
inserted in the frontal area.
Among the surgical related factors we investigated
those performing the operations. There were 5 surgeons
but no statistically significant difference was detected
both in SVR and in SCR.
In conclusion, bone grafts do not increase the number
of lost implants in comparison with those inserted into
native bone although higher bone resorption around the
implant neck must be expected.
F
O
P
O
R
ACKNOWLEDGEMENTS
This work was supported by FAR from the University
of Ferrara (F.C.), and PRIN 2008.
62 (S)
S. FANALI ET AL.
REFERENCES
1.
Franco M, Viscioni A, Rigo L, Guidi R, Brunelli G, Carinci
F. Iliac crest fresh frozen homografts used in pre-prosthetic
surgery: a retrospective study. Cell Tissue Bank 2009; 10:
227-33.
2. Cenzi R, Arduin L, Zollino I, Casadio C, Scarano A,
Carinci F. Alveolar ridge augmentation with calvaria,
iliac crest and mandibular autologous bone grafts: a
retrospective study on 261 implants. J Stomat Occ Med
2010; 3:1-6.
3. Carinci F, Farina A, Zanetti U, Vinci R, Negrini S, Calura
G, Laino G, Piattelli A. Alveolar ridge augmentation: a
comparative longitudinal study between calvaria and iliac
crest bone grafrs. J Oral Implantol 2005; 31:39-45.
4. Vargel I, Tuncbilek G, Mavili E, Cila A, Ruacan S, Benli K,
Erk Y. Solvent-dehydrated calvarial allografts in craniofacial
surgery. Plast Reconstr Surg 2004; 114:298-306.
5. Vangsness CT, Jr., Garcia IA, Mills CR, Kainer MA,
Roberts MR, Moore TM. Allograft transplantation in the
knee: tissue regulation, procurement, processing, and
sterilization. Am J Sports Med 2003; 31:474-81.
6. Grecchi F, Zollino I, Parafioriti A, Mineo G, Pricolo
A, Carinci F. One-step oral rehabilitation by means of
implants’ insertion, Le Fort I, grafts, and immediate
loading. J Craniofac Surg 2009; 20:2205-10.
7. Quirynen M, van Steenberghe D, Jacobs R, Schotte A,
Darius P. The reliability of pocket probing around screwtype implants. Clin Oral Implants Res 1991; 2:186-92.
8. Albrektsson T, Zarb GA. Determinants of correct clinical
reporting. Int J Prosthodont 1998; 11:517-21.
9. Dawson-Saunders B, Trapp RG. Basic & Clinical
Biostatistic. Norwalk: Appleton & Lange; 1994.
10. Adell R, Lekholm U, Rockler B, Branemark PI. A 15-year
study of osseointegrated implants in the treatment of the
edentulous jaw. Int J Oral Surg 1981; 10:387-416.
11. Scarano A, Piattelli A, Assenza B, Carinci F, Donato LD,
Romani GL, Merla A. Infrared Thermographic Evaluation
12.
13.
14.
of Temperature Modifications Induced during Implant Site
Preparation with Cylindrical versus Conical Drills. Clin
Implant Dent Relat Res 2009.
Viscioni A, Franco M, Rigo L, Guidi R, Spinelli G, Carinci
F. Retrospective study of standard-diameter implants
inserted into allografts. J Oral Maxillofac Surg 2009; 67:
387-93.
Scarano A, Carinci F, Quaranta A, Iezzi G, Piattelli M,
Piattelli A. Correlation between implant stability quotient
(ISQ) with clinical and histological aspects of dental
implants removed for mobility. Int J Immunopathol
Pharmacol 2007; 20:33-6.
Woo VV, Chuang SK, Daher S, Muftu A, Dodson TB.
Dentoalveolar reconstructive procedures as a risk factor
for implant failure. J Oral Maxillofac Surg 2004; 62:77380.
Yoo RH, Chuang SK, Erakat MS, Weed M, Dodson TB.
Changes in crestal bone levels for immediately loaded
implants. Int J Oral Maxillofac Implants 2006; 21:253-61.
Degidi M, Piattelli A, Carinci F. Immediate loaded
dental implants: comparison between fixtures inserted
in postextractive and healed bone sites. J Craniofac Surg
2007; 18:965-71.
Degidi M, Piattelli A, Gehrke P, Carinci F. Clinical
outcome of 802 immediately loaded 2-stage submerged
implants with a new grit-blasted and acid-etched surface:
12-month follow-up. Int J Oral Maxillofac Implants 2006;
21:763-8.
Degidi M, Piattelli A, Carinci F. Clinical outcome of
narrow diameter implants: a retrospective study of 510
implants. J Periodontol 2008; 79:49-54.
Carinci F, Brunelli G, Danza M. Platform switching and
bone platform switching. J Oral Implantol 2009; 35:24550.
Palmieri A, Pezzetti F, Avantaggiato A, Lo Muzio L,
Scarano A, Rubini C, Guerzoni L, Arlotti M, Ventorre
D, Carinci F. Titanium acts on osteoblast translational
process. J Oral Implantol 2008; 34:190-5.
F
O
P
O
R
15.
16.
17.
18.
19.
20.
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
OPTIMIZATION OF IMPLANT-ABUTMENT CONNECTION
IN ELECTRO-WELDED IMPLANTOLOGY:
STUDY AND MECHANICAL CHARACTERIZATION
S. FANALI1, T. VILLA2, D. FANALI3, F. CARINCI4
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
Department of Structural, IRCCS Istituto Ortopedico Galeazzi, Milan, Italy 3Private Practice, Rome, Italy
4
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
2
The aim of this study is to compare in vitro the mechanical resistance of 7 different implant-abutment
connections and determine which of them has the best mechanical performances (both statically and when
subjected to dynamic loads) and which of them can guarantee the best level of tenacity during the clinical use of
the intraoral electro-welded implantology with the bi-phase implants. All the implants were machined by Falappa
Medical Devices – Rome. Two types of tests have been performed: static tests and fatigue tests. The static tests
were performed on four specimens for each typology of connection, the fatigue tests on three specimens for each
typology of connection. Configuration followed ISO 14801 standard.. The static tests were performed until rupture
while the fatigue tests were performed applying a 108-1080 N load until either break was detected or 5 Mcycles
were reached. Results showed that good static behavior does not involve automatically that the connection has
also good long-term performances. Statistically significant differences were noted among the configurations: in
particular internal connectors showed better results in comparison to external ones and among internal connectors
the hexagonal one turned out to be the best one even if almost all the connectors had sufficient resistance to
withstand normal masticatory loads.
O
R
P
Over the last years several studies have been
conducted with a view to compare the various types of
implant-abutment connections and finally determine the
best biomechanical features.
In the implantology field, failures tend to be blamed on
wrong surgical procedures but this is not always the case,
as mechanical collapse in the implant-abutment interface
may just as easily occur and doom the whole implant to
failure.
During the clinical use of the electro-welded
implantology with the bi-phase implants these mechanical
problems assume a huge importance for many reasons;
for didactic purpose, we will pass through every single
feature that limits the bi-phase/solder combination:
1) Firm implant-abutment connection. This is the very
first issue: firmness. Indeed, the main advantage of an
electro-welded bar is in its firmness. By applying the bar
to monolithic implants we obtain one whole monolithic
structure;
2) Parallelism. It is impossibile to insert perfectly
parallel implants even for the most trained implantologist
without use of parallelometer, neither would it be advisible.
It is well-known that a slight mutual disparallelism
improves implant stability as eccentric stress vectors are
deflected and dropped into the base polygon. A disparallel
join is only allowed by the taper shape, which guarantees
stability in the connection and eliminates loosening risk,
as the through screw does not participate in the static
system. This consideration contributes in restricting the
choice range;
3) A critical point concerns the fact that industry has
not yet complied with a regular use of electric solders. A
good solder is only achieved by use of a good bar support.
In comparison with full abutments, through-screw
abutments suffer for their thin titanium paries to such an
extent that in case of application of forces slightly over the
Key words: abutment design; yield point; fatigue failure; mechanical complications; maximum load;
one-pice abutment; two-piece abutment.
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C. Section of Maxillofacial Surgery
University of Ferrara
Corso Giovecca 203 44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
63
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
64 (S)
S. FANALI ET AL.
limit, there may happen deformation hindering throughscrew removal. The production of a specific device for
such case is still awaited.
The present research was conducted to conceive a
type of implant-abutment connection that may meet the
requirements set by the needs of electro-welding in biphase implantology.
For such reasons research has focused on the way to
find the best connection for both static and dynamic load
resistance.
Strong connections do not always turn out to be
the best ones: some scholars (Branemark’s team) have
shown in their studies - with whom we do not agree at
all - that connections with lower mechanical resistance
do not always bring negative effects, as they may work
as a sort of shock absorber in case of occlusal overloads,
thus protecting the perimplant bone from the action of
excessive forces which might lead to failure (1); on the
contrary, stronger connections transferring the whole
occlusal load onto the supporting tissues may hinder the
correct implant osseointegration.
No doubt, proper implant osseointegration is an
indispensable condition for a successful treatment.
Implant-post junctions are the most critical points of the
biomechanical system. Rangert et al. (2), conducted a
study on 39 cases of fracture with screw retained implants
(Branemark) and noticed osseus absorption over an area
stretched up to the third thread, which led to implant
failure. Further studies considered 107 rehabilitations
on single teeth (Branemark implant with through
screw): one screw broke down three years later, 13 were
replaced between the third and the fifth year (2, 3). Such
studies have certainly brought innovation in the field of
implantology: nowadays the rates of mechanical failure
have lowered but the issue still remains.
Notwithstanding the efforts made by various
companies to improve the implants, the implantologist
at the moment has to face some problems occurring in
clinical practice regularly, still decreasingly, like the
instability of the clamp screw which tends to unscrew
and, in many neglected cases, to break.
This work focuses on the research for an improved
physical and mechanical design of implant, with special
care for implant-abutment connection, aiming at the
definitive solution of the matter and providing new
implants able to reduce as much as possible any risk of
implant failures due to mechanical causes.
Many studies have been lead on several types of
implants in vitro (4-6), directing the research towards
a precise direction. One of these (7) showed how major
tension stresses occurred in an implant with a screwed
internal connector rather than on one with a screwed
conic connector; Norton (8) verified a major resistance to
tension stresses of the latter kind of connector (although
produced by a different company) with respect to the
former. Another study (9) proved a major resistance to
torsion of an implant with an inside conic connector with
respect to one with a hexagonal connector. The purpose
of a subsequent study (10) was to evaluate the effect of
eccentric cyclic loading on abutment screw loosening
in internal and external hexagon implants with either
of these two screw materials, titanium (Ti) alloy versus
gold alloy. Similar results have come out from another
study on 97 single implants (11) which showed how
golden screws offer a major resistance than titanium ones.
Another study aims to determine the relationship between
fracture surface morphology and applied stress level for
dental abutment screws loaded in cyclic fatigue (12).
Levine (13), moreover, observed that, in an experiment
on 157 conic screwed implants, the only fractures on
the screws had occurred on the implants of a diameter
of 3.5 mm. Such evidence demonstrates why companies
have, during the last years, tended to reduce the risk of
mechanical problems by enlarging the implant diameter,
and modifying the design of connectors and the type of
material used.
Steinebrunner (14) evaluated the influence of longterm dynamic loading on the fracture strength of different
implant-abutment connections; six implant systems
were tested: two systems with external connections
(Brånemark, Compress) and four systems with internal
connections (Frialit-2, Replace-Select, Camlog, ScrewVent). Another study evaluates the influence of two
commercially available dental implant systems on stress
distribution in the prosthesis, abutment, implant (15).
Many other studies made a prospective and retrospective
analysis on different types of implants (13, 16-18).
All this considered, we have performed a study in
which 7 types of connectors were tested.
They were chosen among a wide range of connectors
used by several companies indexed on the internet (Table
I):
Among these 7 different connectors have been chosen
using the following exclusion criteria:
- manufacturing costs
- circulation and knowledge by professionals
- user friendliness
- relatively limited components.
Peculiarities of each connection are reported in
Material and Methods section.
F
O
P
O
R
MATERIALS AND METHODS
The aim of this study was to determine in an experimental
way (through mechanical tests) the static and fatigue resistance
of seven types of implant/pillar connectors.
F
65 (S)
European Journal of Inflammation
In order to avoid any influence on the mechanical
performances of the material and of the manufacturing technique,
all the implants were machined by the same manufacturer
(Falappa Medical Devices – Rome), using the same raw material
Titanium grade 4 (ASTM F67). Tests have been conducted on
cylindrical implants of 3.60 mm diameter and 14 mm length,
with different connectors to the abutment. Abutments were
25° inclined and totally 9 mm high, clamped on the implants
using AISI 316L stainless steel connection screws of 1,60 mm
diameter, using a torque of 32Ncm.
The implant has been screwed into an aluminum support,
leaving a distance of 3,0 mm ± 0,5 mm apically from the nominal
bone level, thus replicating a worst case condition due to an
important bone resorption phenomenon: this configuration has
been derived from ISO 14801 standard “Dentistry — Implants
— Dynamic fatigue test for endosseous dental implants”.
Finally, previously to test, the implants have been treated
with ultrasound washings, using a solution of distilled water for
three hours at 80°C, and subsequently dry sterilized for an hour
at 175°.
Different typologies of fixture/abutment connectors have
been associated to different abbreviations: IB, IC, IC2, IC3, ID,
ID2, IF.
1) The first kind of connector, IB, is made of an hexagonal
anti-rotation system, 2,40 mm wide, 0,80 mm height. The
abutment supporting base is 3,46 mm; adherence to the
connector is granted by a linking screw of 1.60 mm at the height
of the threads, and 6.20 mm long starting from the threads;
2) The second typology we have tested, IC, presents a
pairing configuration inside the fixture: the first component is
a cone of 3,00 mm height and a variable diameter ranging from
2,80 mm to 1,85 (9° conicity), meant to stabilize the connector.
The second component is an anti-rotational, screwing octagon,
2,35 mm wide and 1,20 mm height (being a conic pairing, there
is no supporting base). Adherence to the connector is granted by
a linking screw of 1.60 mm at the height of the threads, and 3,00
mm long starting from the threads;
3) IC2 type presents the octagon inserted in 2.30 mm depth
in the crown margin of the implant, with respect to the IC’s 2,00
mm; the cervical bevel as well was modified and taken to an
angle of 15°;
4) The IC3 connection, presents the octagon inserted at 2,10
mm with respect to the crown margin, and the cervical bevel
was brought to an angle of 30°. The apical pairing cone of the
abutment was lengthened in order to gain more contact to the
implant;
5) The ID implant features an internal pairing, its stabilizing
and antirotational component is hexagonal, 2,20 mm wide, 1,50
high. The abutment leans on a crown shaft of 2.60 mm diameter
and 0.50 mm high. Adherence to the connector is granted by
linking screw of 1.60 mm at the height of the threads, and 3,00
mm long starting from the threads;
6) The ID2 connection presents an intermediate additional
component, able to overlap un-parallelisms between implants,
and able to permit the pairing between a conic connector
abutment and an internal hexagon implant;
7) The last morphology considered, IF, has a double
configuration of internal pairing on the fixture. It presents a
conic stabilizing component of 1.50 mm height, with a superior
diameter of 2.80 mm diminishing to 2,20 mm (conicity of 9°).
The anti-rotational component is represented by a 2,20 wide
and 1,50 mm high hexagon (being a conic pairing, there is no
supporting base). Adherence to the connector is granted by a
linking screw of 1.60 mm at the height of the threads, and 3,00
mm long starting from the threads.
F
O
Loading machine and loading approach
Static test
In order to reproduce the bending that rises when masticatory
loads act, the fixture-abutment specimen was mounted on the
testing machine with the long axis of the fixture parallel to the
direction of application of load, as reproduced in Figure 1.
Such a configuration, due to the inclination of the abutment,
implies a bending on both the fixture-abutment connection and
the connecting screw that causes the failure of the weakest part
of the implant.
In order to reduce horizontal forces due to friction rising
between the load applicator and the abutment, a purposely
design lubricated sliding plate has been interposed between the
two above mentioned elements, as sketched in Figure 1.
For the static test a MTS MiniBionix 858 testing machine
(MTS Systems, Minneapolis, MN, USA) equipped with a 1.515 kN scales load cell was used; a 10 mm LVDT transducer is
connected to the actuator of the testing machine, permitting the
measure of the vertical displacement of the loading applicator;
the data of the applied load and of the vertical displacement were
recorded at 10Hz frequency.
The tests have been carried out in monotonic compression
under displacement control mode at a rate of 2 mm/min and the
static tests were stopped after the implant specimen failure.
Static tests were performed on four specimens for each
described typology, for a total number of 28 tests. For each
specimen the maximum load and the yielding load have been
considered as explained in Figure 2 where the plot of a single
test is reported, as an example: the maximum load is the highest
load registered during the test while the yielding load has been
considered as the first point where the linearity of the curve
(representative of the elastic behaviour of the implant) is lost.
For the four specimens of each typology of connection mean
and standard deviation of both maximum and yield values were
calculated.
Statistical comparisons of the maximum load and of the
yielding load among the different connections were performed
by using Student’s t-test: differences were considered statistically
significant at p < 0.05.
P
O
R
Fatigue tests
In order to evaluate the fatigue endurance of the different
connections fatigue tests have been performed on three
specimens of each typology.
The set-up for the fatigue tests was the same illustrated
in Figure 2 for the static test. In order to allow for a direct
comparison of the results of the dynamic tests, the applied load
was chosen to be the same for all the tested connections: in
particular, the choice was performed on the basis of the static
results obtained on the same implants. The loading value chosen
for the fatigue tests was equal to the 80% of the mean of the
yielding loads obtained for the most resistant connection (type
66 (S)
S. FANALI ET AL.
ID): the resulting applied load was hence 1080 N.
Load followed a wavesine shape between 108 and 1080 N
at a maximum 5 Hz frequency: the test was stopped either after
the specimen failure or after 5.000.000 cycles were reached, in
accordance with ISO 14801-2007 standard.
Also for fatigue tests mean value and standard deviation
of the number of cycles to rupture of the three samples for
each typology were calculated: for the data analysis Student’s
t-test was adopted and differences were considered statistically
significant at p < 0.05.
RESULTS
Static test
Figures 3 and 4 report the results of the static tests,
as regarding maximum load, yield load and statistical
analyses.
From the analysis of the results it can be argued
that the ID and ID2 connections are those with the best
performance both at yielding and at the maximum load;
at yielding also IB and IC3 connections have the same
performance of ID and ID2 while their mechanical
resistance at the maximum load are significantly lower
than ID and ID2: it must be underlined that the yield
load is the most representative of the actual mechanical
performance of the device, as it corresponds to a point at
which the exemplar begins to deform permanently and
irreversibly. which means that, the connector is already
compromised.
P
Table I. Connection typologies
Internal six receptor sockets
Scalloped
Internal dodecagon
External hex
Internal octagon
External octagon
External spline
External morse taper
Internal morse taper
Internal six lobe
Internal tri lobe
Internal six spline
Internal pentagon
Internal thread
External thread
Internal square
External square
Internal five lobe
Internal four lobe
Internal three spline
External triangle
Internal eight spline
F
O
DISCUSSION
The obtained results are summarized in Figure 6 that
tries to compare the whole mechanical resistance in terms
of maximum static resistance, static resistance at yielding
and fatigue resistance.
As stated before, the result that must be deeper
analyzed is the one regarding the yielding load: as a
matter of fact, after the yielding point, the implant has
already gone beyond its elastic limit and thus must be
considered as mechanically failed. In this light ID, ID2,
IB and IC3 connections must be considered having an
equivalent static resistance.
However, all the typologies of connections seem to be
able to withstand normal biting loads: according to Craig
(19) the average load on a single tooth of the molar region
can reach approximately 800 N and the mean values of the
yielding loads of all the tested connections are above this
limit. Moreover the 3mm simulation of bone resorption
prescribed by the ISO standard is representative of a very
severe condition: in this light, results obtained in the static
tests imply a good static mechanical reliability of all the
connections.
As regards the choice of the load at which long-term
tests have been conducted (1080 N), it should be noted
that this value is far above normal masticatory loads, even
in subjects with a well developed musculature: results
of such tests (namely number of cycles at rupture) must
hence be considered as not representative of a possible
life endurance of the implant during clinical use. The
choice of overstressing the specimen during the fatigue
test is due only to time-saving necessities: nevertheless,
being all the connections subjected to the same load,
results can be correctly considered as representative of
the long-term performances of the connection, allowing a
relative comparison among the different designs.
From the analysis of results of the fatigue test, it can
be noticed that the above described good static behaviour
of all the connections does not involve also a good longterm mechanical resistance: in fact, some connections
(IB, IC and IF) seem to withstand a number of cycles
O
R
Fatigue tests
Figures 5 reports the results of the fatigue tests, as
regards cycles to failure and statistical analyses: all the
Internal hex
specimens have failed within the limit of 5.000.000
cycles, with great differences among the tested typologies.
Also in this case ID typology has turned out to be the best
performing connection, significantly better than any other
connection; on the other hand, ID2 connection, that had
very good static performances, shows a poor long-term
resistance, lower than IC3 connection but not enough
to be considered as statistically different. The other
three connections (namely IB, IC and IF) shows fatigue
performances significantly lower than those of ID, ID2
and IC3 typologies.
F
67 (S)
European Journal of Inflammation
F
O
Fig. 4. Extrapolation of yielding point and maximum load point
on a typical load-displacement curve of a static test.
O
R
Fig. 1. The experimental set-up used for the compressionbending tests.
P
Fig. 2. Results of static tests as regards maximum load, mean
and standard deviation are reported. Identified groups are
statistically NOT different.
Fig. 5. Results of fatigue tests as regards cycles at break, mean
and standard deviation are reported.
Fig. 3. Results of static tests as regards yield load, mean
and standard deviation are reported. Identified groups are
statistically NOT different.
Fig. 6. Comparison of the mechanical performances of the
different connections
68 (S)
S. FANALI ET AL.
significantly lower than other connections (ID, IC3),
while ID2, that had good static properties, does not repeat
such a good result in the long-term tests. The reason must
be searched in the different ways the specimens fail when
subjected either to a static load or to a dynamic load:
in the static case the failure is mostly due to the crosssection dimensions while in the fatigue failure a good
manufacturing capability is fundamental to prevent the
arising of cracks that finally lead to the failure of the
whole structure. In this light, ID2 connection has probably
a correctly dimensioned cross-section to resist static load
but its particular design introduces some manufacturing
difficulties that, in turn, lead to defects from which fatigue
cracks can originate.
Being the nature of masticatory loads typically cyclic,
the long-term performance has to be considered as the
key factor on which the choice of the best performing
connection should be made: in this light, as regards the
whole mechanical resistance performances, ID and IC3
connections turn out to be the first choice.
Implantology has achieved great advancements in
research and in technological evolution during the last
few years. This has caused technical complications
on implant-prosthesis to diminish greatly. Continuous
improvements, though, do not resolve any problem as
far as clinical practice is concerned, since anomalous
overload, parafunctioning of the implant, occlusive
disequilibrium still represent the most common
mechanical complications of the implants (20, 21). We
have centered our study on the latter, analyzing seven
different morphologies. Macroscopically different
results have thus depended on the morphology of the
connectors. In conclusion, we may assert that our study
confirms other authors’ thesis, according to which internal
connectors are less exposed to technical problems such
as fractures and unscrewing, all this is evident from the
fatigue tests in which ID, ID2 and IC3 connectors have
obtained better results than IB connector (external). As for
the so called internal connectors (ID, ID2, IC, IC2, IC3,
IF), the hexagonal one (ID) has obtained the best results
during both static and dynamic tests. However, the results
obtained with IC3 connector must be analyzed, as during
the fatigue test its resistance was lower than ID but higher
than ID2. Such result was obtained because the octagon
was brought into a more apical position creating a deeper
clutch. The ID2 connector, which presents an intermediate
element able to solve dis-parallelisms and to permit the
pairing between a conic connection abutment and a
hexagon internal implant, did not present any relevant
difference in static tests with respect to the connection
without the intermediate element (ID), but it came out
as the less lasting during the fatigue resistance test. Not
by chance, the last considered is the IF (conic with apical
hexagon), since it proved excellent results for maximum
load resistance, but it turned out to be the worst during the
cyclic resistance test.
REFERENCES
1.
2.
3.
F
O
Basten CH, Nicholls JI, Daly CH, Taggart R. Load fatigue
performance of two implant-abutment combinations. Int J
Oral Maxillofac Implants 1996; 11:522-8.
Rangert B, Krogh PH, Langer B, Van Roekel N. Bending
overload and implant fracture: a retrospective clinical
analysis. Int J Oral Maxillofac Implants 1995; 10:326-34.
Jemt T, Laney WR, Harris D, Henry PJ, Krogh PH,
Jr., Polizzi G, Zarb GA, Herrmann I. Osseointegrated
implants for single tooth replacement: a 1-year report
from a multicenter prospective study. Int J Oral Maxillofac
Implants 1991; 6:29-36.
Mollersten L, Lockowandt P, Linden LA. Comparison of
strength and failure mode of seven implant systems: an in
vitro test. J Prosthet Dent 1997; 78:582-91.
Assenza B, Scarano A, Petrone G, Iezzi G, Thams U, San
Roman F, Piattelli A. Crestal bone remodeling in loaded
and unloaded implants and the microgap: a histologic
study. Implant Dent 2003; 12:235-41.
Khraisat A, Stegaroiu R, Nomura S, Miyakawa O. Fatigue
resistance of two implant/abutment joint designs. J
Prosthet Dent 2002; 88:604-10.
Piattelli A, Scarano A, Paolantonio M, Assenza B,
Leghissa GC, Di Bonaventura G, Catamo G, Piccolomini
R. Fluids and microbial penetration in the internal part of
cement-retained versus screw-retained implant-abutment
connections. J Periodontol 2001; 72:1146-50.
Norton MR. An in vitro evaluation of the strength of an
internal conical interface compared to a butt joint interface
in implant design. Clin Oral Implants Res 1997; 8:290-8.
Balfour A, O’Brien GR. Comparative study of
antirotational single tooth abutments. J Prosthet Dent
1995; 73:36-43.
Tsuge T, Hagiwara Y. Influence of lateral-oblique cyclic
loading on abutment screw loosening of internal and
external hexagon implants. Dent Mater J 2009; 28:37381.
Binon PP. Implants and components: entering the new
millennium. Int J Oral Maxillofac Implants 2000; 15:7694.
Huang HM, Tsai CM, Chang CC, Lin CT, Lee SY.
Evaluation of loading conditions on fatigue-failed implants
by fracture surface analysis. Int J Oral Maxillofac Implants
2005; 20:854-9.
Levine RA, Clem DS, 3rd, Wilson TG, Jr., Higginbottom
P
O
R
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
F
69 (S)
European Journal of Inflammation
F, Saunders SL. A multicenter retrospective analysis of the
ITI implant system used for single-tooth replacements:
preliminary results at 6 or more months of loading. Int J
Oral Maxillofac Implants 1997; 12:237-42.
14. Steinebrunner L, Wolfart S, Ludwig K, Kern M. Implantabutment interface design affects fatigue and fracture
strength of implants. Clin Oral Implants Res 2008; 19:
1276-84.
15. Quaresma SE, Cury PR, Sendyk WR, Sendyk C. A finite
element analysis of two different dental implants: stress
distribution in the prosthesis, abutment, implant, and
supporting bone. J Oral Implantol 2008; 34:1-6.
16. Henry PJ, Laney WR, Jemt T, Harris D, Krogh PH, Polizzi
G, Zarb GA, Herrmann I. Osseointegrated implants for
single-tooth replacement: a prospective 5-year multicenter
study. Int J Oral Maxillofac Implants 1996; 11:450-5.
17. Scheller H, Urgell JP, Kultje C, Klineberg I, Goldberg PV,
Stevenson-Moore P, Alonso JM, Schaller M, Corria RM,
Engquist B, Toreskog S, Kastenbaum F, Smith CR. A 5year multicenter study on implant-supported single crown
restorations. Int J Oral Maxillofac Implants 1998; 13:212-8.
18. Mangano C, Bartolucci EG. Single tooth replacement by
Morse taper connection implants: a retrospective study of
80 implants. Int J Oral Maxillofac Implants 2001; 16:67580.
19. Craig RG. Restorative Dental Materials. St. Louis, MO:
Mosby, C.V.; 1980.
20. Jemt T, Pettersson P. A 3-year follow-up study on single
implant treatment. J Dent 1993; 21:203-8.
21. Walton JN, MacEntee MI. A prospective study on the
maintenance of implant prostheses in private practice. Int J
P
O
R
F
O
Prosthodont 1997; 10:453-8.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
RECONSTRUCTION OF SEVERELY ATROPHIC JAWS USING HOMOGRAFTS: BONE
DENSITY EVALUATION OVER TIME
F. CARINCI1, I. ZOLLINO1, S. FANALI2, A. MOTRONI3,
G. MORETTI3, A. VISCIONI4, M. FRANCO4, V. SOLLAZZO5
F
O
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
3
AMIRG (Applied Medical Imaging Research Group), Milan, Italy
4
Department of Maxillofacial Surgery, Civil Hospital, Castelfranco Veneto, Italy
5
Orthopedic Clinic, University of Ferrara, Ferrara, Italy
1
2
Bone augmentation to reconstruct atrophic jaws provides the base for sufficient functional and aesthetic
implant-supported oral rehabilitation. Although autografts are the standard procedure for bone grafting, the use
of homologue bone provides a reasonable alternative. Here bone density of native and grafted bone was evaluated
over time by using Computed Tomography (CT) output and a specific computer program. Five patients were
grafted with Fresh Frozen Bone (i.e. FFB) and 41 implants were inserted in the same operation. Pearson’s chisquare test was used to investigate difference in bone density (i.e. BD) between native and grafted immediately over
time. BD of both native bone and FFB located far away from implants do not change over time. Native bone has
about a double BD than FFB. Peri-implants FFB BD is growing over time: it became about 3⁄4 of native BD after
12 months follow-up (and after 8 months of loading).CT scan represents a valuable and accurate pre-operative
method to obtain information about bone quality and quantity (i.e. volume of available bone).
O
R
P
The treatment of choice for edentulousness, which
cannot be adequately compensated for by a denture
which causes considerable oral dysfunction, is a bridge
construction on osseointegrated titanium fixtures. In
those cases, where the quantity or quality of the alveolar
ridge does not provide enough bone tissue for implant
anchorage, jaw bone restoration is required (1).
In an attempt to evaluate the best material and method
for bone reconstruction, clinical studies on various
grafting procedures were performed and some are on
homologue Fresh Frozen Bone (i.e. FFB) (2). Although
autografts are the standard procedure for bone grafting, it
is sometimes not possible to collect an adequate amount
of bone from other donor sites on the same patient (2).
Moreover, autologous bone grafts have the drawback of
requiring secondary surgery for autograft retrieval, with
increased operation time and anesthesia, and donor site
morbidity. On the other hand, biomaterials are good but
expensive, and may extrude at a later date (3). So, the
use of homologue bone provides a reasonable alternative
to meet the need for graft material (4). Many forms of
banked bone homograft are available to the surgeon.
Among the grafts available are fresh-frozen bone (FFB),
freeze-dried bone (FDB), and demineralized fresh dried
bone (DFDB). Each one of these grafts carries risks and
has unique limitations and handling properties (5).
After jaw restoration, the planning of dental implant
position and its transfer to the operation site represents
another of the most important factors for the long-term
success of implant supported prosthetic and epithetic
restorations (6). It is now possible to pre-surgically
determine with a high degree of accuracy the implant
position and inclination based on the final prosthetic
outcome using 3D visuals (7). The use of radiographic
images is necessary to evaluate the surgical site underneath
the soft tissue and Computed Tomography (CT) images
provide an accurate 3D picture of the surgical field (8).
Cone beam computed tomography (CBCT) greatly
Key words: Alveolar crest, reconstruction, iliac crest, allograft, homograft, atrophic jaw
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C. Section of maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
71
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
72 (S)
F. CARNICI ET AL.
reduces patients’ exposure to radiation, thus changing the
way dental practitioners view the oral and maxillofacial
complex (9). CBCT uses radiation in a similar manner,
as does conventional diagnostic imaging, and reformats
the raw data into DICOM data (Digital Imaging and
Communications in Medicine). DICOM data are imported
into simulation software that enables the manipulation of
multiplanar reconstructed slices and three-dimensional
volume renderings. DICOM data may also be used in
third-party software to aid in dental implant placement,
orthognatic surgery and orthodontic assessment.
Recently, there are systems which combine computerplanned data to a working cast has been reported (10).
These procedures allow the clinician to obtain, to a
master cast, the correct implant positions to through the
correction of previously planned expected positions. This
cast is used to build an individual surgical stent that perfectly
matches the teeth and soft tissues as well as a provisional
or definitive implant-supported prosthesis for partially or
completely edentulous patients. Almost in one case, it has
the additional advantage to evaluate bone density by using
the output DICOM file obtained from CT evaluation (11).
Since there are non specific study that evaluate bone
density over time we therefore decide to perform a
retrospective study on 5 patients to evaluate FFB clinical
outcome over time by using DICOM files derived from
CT evaluation and elaborated with a specific computer
program (11).
(Italy) - is a mineralized, non-irradiated, only disinfected and
frozen homologous bone. The bone harvesting is obtained
from the anterior and posterior iliac crest. The sample is then
subdivided into cortico-medullary blocks, packed in double
sterile casing and frozen at -80°C. Several tests are performed in
order to detect infectious agents, as previously reported (2, 12).
F
O
Data collection
Before, immediately after surgery and after 4 and 12
months radiographic examinations were done with the use of
a conventional CT scans (Scanner: GE MEDICAL SYSTEMS/
LightSpeed VCT, Voltage 120 KV, Dose 228.00 mAs, Slice
Information: Width 512 pxl, Height 512 pxl, Pixel size 0.313
mm, Field of View 16.00 cm, Orientation RAB, Gantry Tilt
0.0°, Slice thickness 0.625 mm, Reconstruction algorithm
BONEPLUS).
The DICOM data were processed with a medical imaging
software (3Diagnosys 3.0 - 3DIEMME, Italy) which gives the
possibility to use a virtual probe to extract the bone density
values in the desired regions and export them in Excel tables for
statistical analysis (Fig. 1 and 2). The virtual probes were set in
the following regions in the “after surgery” CT scans:
1. Native bone (premaxilla)
2. Bone graft (far from implants)
3. Around implants to analyze both the graft and native bone
around implants
4. Airways (used as an indication of noise Measurements)
An area of 1 mm thickness was extracted with this probe
and exported to Excel for further analysis. In order to place
the probes in the same position in the 4 months and 12 months
CT scans, the bone volumes extracted from these exams were
exported in STL file format and superimposed according to a
“best-fit” algorithm (Geomagic Studio 11 - Geomagic Corp.,
USA) based on the bone regions not affected by the surgery.
After the repositioning of every DICOM stack in the same
reference system, the data collected by the probes were extracted
and analyzed for statistical processing. The data extracted
is expressed in Hounsfield Units, being the processed CT
scans calibrated according to water based phantoms. Phantom
measurements have not been provided at different positions in
the FOV because the values in the study are not analyzed as
absolute values but were compared each other.
O
R
P
MATERIALS AND METHODS
Patients
In the period between June 2007 and December 2007, 5
patients (3 females and 2 males) with a median age of 41 years
were operated on at the Civil Hospital, Castelfranco Veneto,
Italy. Forty one implants were inserted in FFB allograft during
the same operation. Informed written consent approved by the
local Ethics Committee was obtained from patients to use their
data for research purpose. CT check-up was performed after 4
(all cases) and 12 months (3 cases) with a mean follow-up of
about 9 months. Usually, the mean post-grafting period was 4
months before prosthetic restoration was delivered.
Subjects were screened according to the following inclusion
criteria: controlled oral hygiene and the absence of any lesions
in the oral cavity; in addition, the patients had to agree to
participate in a post-operative check-up program.
The exclusion criteria were as follows: bruxism, smoking
more than 20 cigarettes/day and excessive consumption of
alcohol (two glasses of wine per day), localized radiation
therapy of the oral cavity, antitumor chemotherapy, liver, blood
and kidney diseases, immunosupressed patients, patients taking
corticosteroids, pregnant women, inflammatory and autoimmune
diseases of the oral cavity, poor oral hygiene.
Graft material
The FFB - obtained from the Veneto Tissue Bank in Treviso
Implants
A total of 41 implants were inserted in 5 patients, all in the
maxilla. Implants were inserted to replace 2 incisors, 5 cuspids,
17 premolars and 17 molars.
Surgical and prosthetic technique
All patients underwent the same surgical protocol. An
antimicrobial prophylaxis was administered with 2000 mg
Amoxicillin before surgery and 1000 mg twice daily for 7 days
starting 1 hour before surgery.
The implants were inserted simultaneously with the bone
grafts. The implant platform was positioned at the natural
alveolar crest level. All cases were sinus lift augmentation
by using en-block FFB. Sutures were removed 10 days after
surgery. Then 16 weeks after implant insertion, the provisional
prosthesis was provided and the final restoration was usually
delivered within an additional 8 weeks. All patients were
F
73 (S)
European Journal of Inflammation
Table I. Bone density evaluated by CT and computer programm
COMPUTER TOMOGRAPHY HOUNSFIELD (HU)
PATIENTS
1
2
3
PROBE
POST SURGICAL
BD
4 MONTHS
FOLLOW-UP
428 ± 224
432,96 ± 230,37
451 ± 561
611 ± 580
Native bone
818 ± 417
724 ± 333
Calibration
-1021 ± 14
-1024 ± 1
290 ± 158
321 ±174
453 ± 566
473 ± 593
Native bone
900 ± 540
789 ± 494
Calibration
-1020 ± 18
-1023 ± 10
269 ± 146
301 ± 167
187 ± 379
233 ± 496
251 ± 491
422 ± 498
Native bone
533 ± 365
536 ± 339
497 ± 403
Calibration
-1023 ± 6
-1018 ± 22
-1019 ± 42
269 ± 200
319 ± 203
314 ± 240
394 ± 739
451 ± 715
483 ± 705
Native bone
635 ± 386
563 ± 326
677 ± 309
Calibration
-1021 ± 21
-1019 ± 24
-1023 ± 7
275 ± 110
295 ± 122
318 ± 337
303± 577
353 ± 551
409 ± 597
Native bone
927 ± 279
932 ± 298
949 ± 303
Calibration
-1023 ± 9
-1020 ± 18
-1016 ± 26
Bone grafted far from
implant
Bone grafted around
implant
Bone grafted far from
implant
Bone grafted around
implant
5
F
O
O
R
Bone grafted far from
implant
Bone grafted around
implant
P
4
1 YEAR
FOLLOW-UP
Bone grafted far from
implant
Bone grafted around
implant
Bone grafted far from
implant
Bone grafted around
implant
included in a strict hygiene recall. Statistical Analysis
Pearson’s chi-square test was used to investigate difference
in bone density between native and grafted bone as well as
immediately after operation and after 4 and 12 months.
RESULTS
Table I reports the median bone density (BD) in 5
patients: in columns are reported the BD over time (i.e.
immediately after operation and after 4 and 12 months)
whereas in rows are reported the type of bone (native,
grafted around implants and grafted far from implants).
BD of both native bone and FFB located far away from
implants do not change over time. Native bone has about
a double BD than FFB. Peri-implants FFB BD is growing
over time: it became about 3⁄4 of native BD after 12
months follow up (and after 8 months of loading). Bone
density values around implants were collected excluding
area affected by artifacts such as photon beam hardening.
DISCUSSION
Bone augmentation to reconstruct atrophic jaws
provides the base for sufficient functional and aesthetic
implant-supported oral rehabilitation. The choice of
onlay graft and simultaneous implantation rather than
74 (S)
F. CARNICI ET AL.
F
O
O
R
Fig. 1. The virtual probe extracts the bone density around implants and in unloaded bone
P
Fig. 2. Upper jaw with grafted sinuses and inserted implants.
secondary, delayed, implantation 4–6 months after
onlay grafting remains controversial (13). To establish
the most favorable time for implantation after bone
grafting, preoperative analysis of bone structure and of
the available bone in the augmented parts of the jaw are
important. To obtain information about available bone and
bone structure/density, both conventional radiographic
procedures and computed topographic methods are
used (14). The value of these procedures for providing
information about the completion of osseous structures
after avascular iliac crest bone grafting and the reliability
of measurements of bone density for assessing bone
structure have not yet been established.
The amount of bone resorption can be measured
as height reduction in plane radiographs (15), but this
measurement only represents the bone resorption of
one axis of the three-dimensional graft. The absolute
amount of bone volume reduction can be determined
by volumetric measurements using CT scans (16). An
additional advantage of measurement by CT scan is that
bone density can also be calculated using CT data. Norton
(17) and Gamble and Shahlaie et al. (18) examined
implant sites with quantitative CT in Hounsfield units and
compared them with subjective quality scores defined by
Lekholm and Zarb (19). They concluded that quantitative
CT was a valuable supplement to subjective bone density
in the region of implant placement. They hypothesized
that CT scanning is a viable and accurate method to
measure bone density. Misch (20) classified bones into
5 categories according to density: D1 bone had density
> 1250 HU; D2, 850-1250 HU; D3, 350-850 HU; D4,
150-350; and D5, < 150 HU. Decrease of bone density
results from decalcification and reduction of trabecular
bone. Therefore, bone density (density of mineralization)
directly correlates to bone quality (17).
For onlay grafting and simultaneous implantation
in atrophic maxillas, the success rate varies between
51% and 83% after five years of masticatory functional
loading (21). In contrast, Schliephake et al. (22) reported
a 20% higher success rate for secondary implantation
after five years of masticatory loading. The reason is
thought to be the more favorable bone structure that
follows remodeling of the avascular bone graft before
implantation (23). Schultze-Mosgau et al. (14) studied
the available transverse and vertical bone and the bone
density of natural and augmented bone by using CT
data. They found that secondary implantation following
4-6 months of autogenous iliac crest bone grafting is the
more favorable option in the maxilla because of increased
cancellous bone and reduced resorption.
F
75 (S)
European Journal of Inflammation
Our results demonstrated that BD of grafted bone
changes over time: it increases in the loaded region. Native
bone density does not change. This data support the idea to
perform an early implant loading whenever possible. Bone
graft density changes over time and CT scan represents a
valuable method to obtain information about bone quality
in addition to bone quantity (i.e. volume). It potentially
allows detecting the most favorable time for implantation
after bone grafting and comparing grafted bone quality to
natural bone. CT scanning suggests the choice of graft and
early masticatory loading.
10.
11.
ACKNOWLEDGEMENTS
12.
This work was supported by FAR from the University
of Ferrara (FC), Ferrara, Italy, and from PRIN 2008
(F.C.).
13.
2.
3.
4.
5.
6.
7.
8.
9.
F
O
O
R
REFERENCES
1.
2007; 18:965-71.
Danza M, Zollino I, Carinci F. Comparison between
implants inserted with and without computer planning and
custom model coordination. J Craniofac Surg 2009; 20:
1086-92.
Tarnow DP, Wallace SS, Testori T, Froum SJ, Motroni
A, Prasad HS. Maxillary sinus augmentation using
recombinant bone morphogenetic protein-2/acellular
collagen sponge in combination with a mineralized bone
replacement graft: a report of three cases. Int J Periodontics
Restorative Dent; 30:139-49.
Carinci F, Brunelli G, Zollino I, Franco M, Viscioni A,
Rigo L, Guidi R, Strohmenger L. Mandibles grafted with
fresh-frozen bone: an evaluation of implant outcome.
Implant Dent 2009; 18:86-95.
Lundgren S, Rasmusson L, Sjostrom M, Sennerby L.
Simultaneous or delayed placement of titanium implants
in free autogenous iliac bone grafts. Histological analysis
of the bone graft-titanium interface in 10 consecutive
patients. Int J Oral Maxillofac Surg 1999; 28:31-7.
Schultze-Mosgau S, Keweloh M, Wiltfang J, Kessler
P, Neukam FW. Histomorphometric and densitometric
changes in bone volume and structure after avascular
bone grafting in the extremely atrophic maxilla. Br J Oral
Maxillofac Surg 2001; 39:439-47.
Verhoeven JW, Ruijter J, Cune MS, Terlou M, Zoon M.
Onlay grafts in combination with endosseous implants
in severe mandibular atrophy: one year results of a
prospective, quantitative radiological study. Clin Oral
Implants Res 2000; 11:583-94.
Johansson B, Grepe A, Wannfors K, Hirsch JM. A clinical
study of changes in the volume of bone grafts in the
atrophic maxilla. Dentomaxillofac Radiol 2001; 30:15761.
Norton MR, Gamble C. Bone classification: an objective
scale of bone density using the computerized tomography
scan. Clin Oral Implants Res 2001; 12:79-84.
Shahlaie M, Gantes B, Schulz E, Riggs M, Crigger M.
Bone density assessments of dental implant sites: 1.
Quantitative computed tomography. Int J Oral Maxillofac
Implants 2003; 18:224-31.
Lekholm U, Zarb GA. Patient selection and preparation.
In Tissue integrated protheses: osseointegration in clinical
densitstry. Branemark PI, Zarb GA, Albrektsson T, eds.
Quintessence. Chicago, 1985; 199-209.
Misch CE. Density of bone: effect in treatment planning,
surgical approach, and healing. In Contemporary implant
dentistry. Misch CE, ed. Mosby. St Louis, 1993; 469-85.
Isaksson S, Alberius P. Maxillary alveolar ridge augmentation
Peleg M, Garg AK, Mazor Z. Predictability of simultaneous
implant placement in the severely atrophic posterior
maxilla: A 9-year longitudinal experience study of 2132
implants placed into 731 human sinus grafts. Int J Oral
Maxillofac Implants 2006; 21:94-102.
Franco M, Viscioni A, Rigo L, Guidi R, Brunelli G, Carinci
F. Iliac crest fresh frozen homografts used in pre-prosthetic
surgery: a retrospective study. Cell Tissue Bank 2009; 10:
227-33.
Gajiwala K, Lobo Gajiwala A. Use of banked tissue in
plastic surgery. Cell Tissue Bank 2003; 4:141-6.
Vargel I, Tuncbilek G, Mavili E, Cila A, Ruacan S, Benli
K, Erk Y. Solvent-dehydrated calvarial allografts in
craniofacial surgery. Plast Reconstr Surg 2004; 114:298306.
Hardin CK. Banked bone. Otolaryngol Clin North Am
1994; 27:911-25.
Mischkowski RA, Zinser MJ, Neugebauer J, Kubler AC,
Zoller JE. Comparison of static and dynamic computerassisted guidance methods in implantology. Int J Comput
Dent 2006; 9:23-35.
Azari A, Nikzad S, Kabiri A. Using computer-guided
implantology in flapless implant surgery of a maxilla: a
clinical report. J Oral Rehabil 2008; 35:690-4.
Casap N, Tarazi E, Wexler A, Sonnenfeld U, Lustmann J.
Intraoperative computerized navigation for flapless implant
surgery and immediate loading in the edentulous mandible.
Int J Oral Maxillofac Implants 2005; 20:92-8.
Degidi M, Piattelli A, Carinci F. Immediate loaded
dental implants: comparison between fixtures inserted
in postextractive and healed bone sites. J Craniofac Surg
P
14.
15.
16.
17.
18.
19.
20.
21.
76 (S)
F. CARNICI ET AL.
with onlay bone-grafts and immediate endosseous implants.
J Craniomaxillofac Surg 1992; 20:2-7.
22. Schliephake H, Berding G, Neukam FW, Bothe KJ, Gratz
KF, Hundeshagen H. Use of sequential bone scintigraphy
for monitoring onlay grafts to grossly atrophic jaws.
Dentomaxillofac Radiol 1997; 26:117-24.
23. Hangartner TN, Gilsanz V. Evaluation of cortical bone by
computed tomography. J Bone Miner Res 1996; 11:1518-25.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
HUMAN CORD STROMA CELLS AFTER CO-CULTURE WITH HUMAN DENTAL PULP CELLS
UNDERGO TO OSTEOGENIC DIFFERENTIATION THROUGH A BMP 2-MEDIATED PATHWAY
A. GRAZIANO1,2*, R. D’AQUINO2*, L. VISAI3, V. MALIARDI3,
L. BENEDETTI3, M.G. CUSELLA DE ANGELIS3, M. AIMETTI1, F. CARINCI2
F
O
Dental School, University of Torino, Torino, Italy
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
3
Department of Sperimental Medicine, Section of Human Anatomy, University of Pavia, Pavia, Italy
1
2
*These authors equally contributed to the study.
In the human embryonic development, the umbilical cord comes from trofoblast, the embryo part that will not
originate differentiated tissues but is committed to organize the trophic system for the developing embryo. The
easy collecting procedure of the cord stroma and the plasticity of the cells isolated make it a suitable source for the
collection of human mesenchymal cells. At the present moment, the bone needing for clinical therapies is increasing
and identification of an alternative human cellular resource, easy to collect and able to produce a well-differentiated
extracellular bone matrix, acts in this way. In this paper we demonstrate that the cord stroma mesenchymal
progenitors are easy to commit into osteogenic lineages after exposition to conditionated medium of Runx2+/OC+
positive cells, obtained from the differentiation of human dental pulp stem cell, cells that are bone committed cells
and can be used to study the bone regeneration mechanisms. The chance to obtain the osteogenic differentiation
and the production of a well-differentiated bone matrix just culturing the cells with the conditionated medium of
OC+/RUNX2+ cells is very important in the perspective of clinical application of these MSC.
O
R
P
In the human embryonic development the umbilical
cord comes from trofoblast, the embryo part that will
not originate differentiated tissues but is committed to
organize the trophic system for the developing embryo.
At the end of pregnancy the human cord is build up by two
main tissue: the cord blood and the stromal fraction: the
second is a high vascularized mucous connective tissue,
called Wharton gelly.
The easy collecting procedure of the cord stroma and
the plasticity of the cells isolated makes it a suitable source
for the collection of human mesenchymal cells. Although
it is possible to isolate multipotent mesenchymal stem
cells from cord blood too (1), mainly with hematopiesis
supportive function (2), the Wharton Gelly is the most
important source for this cytotype in the human cord
(3). The approach for their collection follows two main
approach: isolating the cells surrounding the umbilical
veins, called HUVECs, (Human Vascular Endothelial
Cells) or culturing the stromal cells under appropriate
conditions as for bone marrow-derived mesenchymal
cells (4).
Despite the demonstration that CD117+ stromal cells
were able to differentiate into neurons and glia (5) or
can be used for cardiovascular tissue engineering (6,
7), mesenchymal tissue engineering seems to be the
most promiseful field (8). At the present moment, the
bone needing for clinical therapies is increasing and
identification of an alternative human cellular resource,
easy to collect and able to produce a well-differentiated
extracellular bone matrix, acts in this way. In the future,
the bone marrow, today the gold cave for stromal cells
collection, can hardly answer to all the clinical needs and
the umbilical cord stroma looks very promiseful (9).
In this paper we demonstrate that the cord stroma
mesenchymal progenitors are easy to commit into
osteogenic lineages after exposition to conditionated
medium of Runx2+/OC+ positive cells, obtained from the
differentiation of human dental pulp stem cells. Dental
Key words: stem cells; cord stroma cells; bone tissue engineering.
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C.,
Section of Maxillofacial Surgery
Corso Giovecca 203 44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
77
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
78 (S)
A. GRAZIANO ET AL.
pulp stem cells are bone committed cells and can be used
to study the bone regeneration mechanisms (10, 11). These
cells can be frozen and stored for months before their use
(12). The chance to obtain the osteogenic differentiation
and the production of a well-differentiated bone matrix
just culturing the cells with the conditionated medium of
OC+/RUNX2+ cells is very important in the perspective of
clinical application of these MSC.
MATERIALS AND METHODS
Dental pulp extraction, digestion and culture
Human dental pulp has been extracted from adult teeth of
healthy subjects aged 21 to 45 years according to Laino protocol
(10). Briefly, the pulp was gently removed and immersed in a
digestive solution: penicillin 100U/ml/streptomycin 100 μg/ml,
0.6 ml claritromycin 500μg/ml in 4 ml PBS 1M, added of 3 mg/ml
type I collagenase, 4mg/ml dispase for 1 h at 37°C. Once digested,
cells were filtered through a 70-micron strainer and immersed
in α-MEM culture medium, added with 20% FCS, 100μM 2Pascorbic acid, 2mM L-glutamine, 100U/ml penicillin, 100μg/ml
streptomycin (all purchased from Invitrogen, San Giuliano
Milanese, Milan, Italy).
After centrifugation at 140g, the cells were cultured in 75
ml flasks with a standard medium made up of α-MEM culture
medium, added with 20% FCS, 100μM 2P-ascorbic acid, 2mM
L-glutamine, 100U/ml penicillin, 100μg/ml streptomycin (all
purchased from Invitrogen, San Giuliano Milanese, Milan, Italy).
The medium was changed twice a week. Samples of 1,000,000
HCSCs were analyzed at 15 days of culture at FACScanning.
F
O
FAC Scanning of HCSCs
For the cord stroma, at least 1,000,000 cells per sample were
detached using 0.02% EDTA solution in PBS and pelleted (10 min
at 1,000 rpm), washed in 0.1% BSA in 0.1M PBS at 4°C, then
incubated in a solution of 1μl antibody/9 µl 0.1% BSA in 0.1M
PBS. Cells were then washed in the same solution (see above) and
were ready for observation. The antibodies were the following:
CD34, CD90, CD117, CD44, CD303 (flk-1), CD 54, CD31
(Pecam 1), BMPr I/II., Runx2, OC. Experiments were performed
at day 15 of culture before stimulation and at day 45 after 30 days
of stimulation with conditionated medium.
O
R
Osteogenic differentiation of dental pulp stem cells
Dental pulp stem cells were cultured in standard medium
for 30 days without passages of the culture. When cells showed
signs of differentiation, by day 30, as reported by Laino et al.
(10), cells were challenged to test their osteogenic differentiation
using the following mouse anti-human antibodies: Osteocalcin,
CD44 and for the transcription factor RUNX-2 (all from Santa
Cruz, CA, USA). For RUNX-2 analysis cells were fixed in 4%
paraformaldehyde in 1 M PBS, with 0.2% Triton X100 for 30 min
at 4°C, washed twice in 0.1% BSA in 1M PBS and then incubated
with RUNX-2 antibody.
P
RT- PCR of osteocalcin (OC),TGF1-Beta, BMP-2 and BMP7 by
DPSCs
Analysis of genetic expression has been executed with cells in
culture with nutrients factors for 15 days and standard culture for
22days. The analysis have been executed to 0,15 and 38days. Total
RNA has been extracted from cells used RNeasy Mini Kit and
digested with RNAse-free DNase for remove any contaminations
of DNA. The synthesis of cDNA from total RNA with iScript
cDNA synthesis Kit(bio-Rad).
PCR amplification has been executed in 25microl that
contain 2microl of cDNA, 2mM of MgCl2,0,2 mM of
dNTP’s,0,025U7microlitre of Taq DNA polymerase.
Human Cord Stroma cell digestion and culture
After human cord blood collecting for banking, Human Cord
Stroma Cells (HCSCs) were collected as follow: cord stroma
fibrous surface has been opened using a surgical blade; highvascularized tissue within has been removed using a surgical
curette and immersed in a digestive solution protocol: penicillin
100U/ml/streptomycin 100 μg/ml, 0.6 ml claritromycin 500μg/ml
in 4 ml PBS 1M, added of 3 mg/ml type I collagenase, 4mg/ml
dispase for 3 h at 37°C.
Co-culture of HCSCs and dental pulp derived osteoblasts
At day 15 of culture, after FACScanning, HUVEC samples of
100,000 cells were plated in 16 mm wells and co-cultured with
OC/Runx-2 positive cells from dental pulp using cell culture insert
0.4 µm (Falcon-BD, Le Point de Clex, France ). HUVECs control
samples have been cultured with standard medium.
RT-PCR expression of osteocalcin, osterix, Runx2, BSP and
osteonectin
by DPSCs derived osteoblasts, HCSCs and
stimulated HCSCs
Analysis of genetic expression has been executed with cells
in culture with nutrients factors after 15 days of co-culture of
HCSC and DPSCs derived osteoblasts. Total RNA has been
extracted from cells used RNeasy Mini Kit and digested with
RNAse-free DNase for remove any contaminations of DNA. The
synthesis of cDNA from total RNA with iScript cDNA synthesis
Kit(bio-Rad).PCR amplification has been executed in 25microl
that contain 2microl of cDNA, 2mM of MgCl2,0,2 mM of
dNTP’s,0,025U7microlitre of Taq DNA polymerase.
ALP assay
For alkaline phosphatase (ALP), HCSCs samples after 30
days of stimulation were washed in 0.1 M PBS and fixed in
4% paraformaldehyde in PBS, with 0.2% Triton X100 for 30
min at 4°C, then washed twice in 0.1% BSA in PBSat room
temperature for 10 min each. Cells were covered using ALP
standard solution, incubated in dark for 8 h.
ALP activity was measured every 5 days from day 15 till
day 45 using 1,00,000 cell samples, detached by means of PBS/
EDTA 0.02% and centrifuged for 10 min at 140g. The pellet was
incubated with 1 ml of BMPurple solution (Roche, Segrate) for
8 h in dark.Supernatant was read in a spectrophotometer at 615
nm. As control, not stimulated HUVECs were used. The values
were expressed as ratio between sample and BMPurple stock
solution. BMPurple solvent was used as blank
ELISA on stimulated HCSCs
After 30 days of co-culture of HCSC and DPSCs derived
osteoblasts, culture were stopped and analyzed with ELISA for
F
79 (S)
European Journal of Inflammation
bone ECM proteins secretion.
1. Protein Extraction procedures
A procedure adapted from Nagata et al. was used to extract
proteins from the cell culture layers. All procedures were carried
out at + 4°C, and all buffers contained proteinase inhibitors
(100mM hexanoic acid, 5mM benzamidine hydrochloride and
1mM phenylmethanesulphonyl fluoride (PMSF). Briefly, cells
layers of both samples (the control cells and the cells incubated
with stem cell media) were first washed three times with sterile
PBS followed by one extraction with a solution of 4 M Guanidine
Hydrochloride (GuHCl), containing 0.5 M EDTA in 50 mM TrisHCl buffer pH 7.4 for 24 hrs. After the extraction the two samples
were pooled and dialysed against PBS extensively and then kept at
-20°C until used. The concentration of each sample was evaluated
with a BCA Protein Assay Kit, using a Spectrophotometer
(UltroSpecR 2100 Pro, GE HealthCare). Set of purified proteins
2. Set of purified proteins
Decorin and type I collagen were purified as previously
described; osteocalcin was from Biomedical Technologies,
Inc.(Stoughton, MA, USA), osteopontin and osteonectin were
obtained from Assay Designs, Inc.(Ann Arbor, MI, USA); type
III collagen and alkaline phosphatase were purchased by SigmaAldrich, Inc.
3. Set of rabbit polyclonal antisera
L.W. Fisher (http://csdb.nidcr.nih.gov/csdb/antisera.htm,
National Institutes of Health, National Institute of Dental and
Craniofacial Research, Craniofacial and Skeletal Diseases
Branch, Matrix Biochemistry Unit, Bethesda, MD) provided us,
generously, with the following rabbit polyclonal antibodies which
were used in the solid-phase binding assay: anti-type-I and typeIII-collagen, anti-decorin, anti-osteonectin, anti-osteopontin, antiosteocalcin, anti-alkaline phosphatase.
4. Solid-phase binding assay
Calibration curves to measure decorin, osteocalcin, osteopontin,
osteonectin, type I and type III collagen were performed. Microtitre
wells were coated with increasing concentrations of each purified
protein, from 1 ng to 2 μg, in coating buffer (50 mM sodium
carbonate, pH 9.5) overnight at 4°C. Wells coated with bovine
serum albumin (BSA) were used as negative control.
Microtite wells were coated overnight at 4°C with 100 μl of
20 μg/ml protein extract from control cells and cells incubated
with stem cell media in coating buffer. After washing with PBST
(PBS containing 0.1% (v/v) Tween 20), the wells were blocked
for 1 h at 22 °C with 200 μl of PBS containing 2% (w/v) BSA.
The plates were then incubated with 100 μl of Larry Fisher rabbit
polyclonal antibodies (dilution 1:500) for 90’ at 22°C. Binding of
each antibody to the wells was detected incubating the plates with
100 μl of HRP-conjugated goat anti-rabbit IgG (DakoCytomation,
Glostrup, Denmark, 1:1000 dilution) respectively, for 1 h at 22°C.
The binding of secondary antibody was detected by addition to the
wells of the substrate o-phenylenediamine dihydrochloride (OPD)
and measuring the absorbance at 490 nm in a microplate reader
(Bio-Rad Laboratories, Inc. Hercules, CA).
(not shown) and mRNA transcripts for bone ECM proteins.
After their differentiation into osteogenic lineage, DPSC
express RUNX-2 and OC membrane antigens. Within
these cultures is detectable mRNA transcripts for TGF1Beta, BMP2 but not for BMP7 (Fig. 1).
HCSCs, challenged at the FAC scanning at 15 days of
culture expressed CD34, CD90, CD117, CD303 and both
BMPrI and BMPrII. At day 15, when started stimulation,
HUVECs expressed CD90, CD31, CD303, CD44, CD54
and BMPrI/II but not CD34 CD117 and STRO1. The
positivity of percentage was the same for all the markers
and was about 40%. This antigenic pattern confirm the
presence of undifferentiated cells within human cord
stroma. Negativity for STRO-1 showed that wasn’t an
osteogenic fraction within cell population (Table I).
Both the receptors for BMP2, BMPrI and II, were
expressed on HCSCs, both at day 15 and 45, before and
after the co-culture.
Already 10 days after co-cultures, HCSCs cells started
to change their morphology, building pseudo-nodular
structures; at day 45, after 30 days of stimulation nodules
were clearly observable within HUCPV cultured with CM.
These nodules were dark at light microscopy for matrix
density and were 1-2 mm diameter. No nodular structures
were observable in the control cultures and HCSCs in coculture with DPSCs (data not shown).
At RT-PCR HCSCs after co-culture expressed,
transcripts for RUNX-2, not expressed by standard
HCSCs and an increasing of transcripts for osterix gene.
DPSCs derived osteoblasts, as expected, expressed high
levels of BSP and ostecalcin, not expressed by HCSCs
neither stimulated nor standard. On the contrary, by
DPSCs osteoblasts, osterix was expressed but a lower
level with respect to HCSCs; osteonectin was expressed
at the same level (Fig. 2).
ALP expression increased after day 15 till day 45 in
stimulated HCSCs (data not shown). At day 45, at the
end of stimulation, ELISA tests confirmed the production
of OC, ON and OP by HCSCs co-cultured with DPSCs
samples (Table II).
F
O
O
R
P
RESULTS
After 30 days of culture with SM sorted cells express
CD44, RUNX2 and OC, showing osteoblast morphology
DISCUSSION
During human embryonal development the umbilical
cord comes from trofoblast, the embryo part that doesn’t
give origin to differentiated tissues but it is committed
to the trophic system for the developing embryo. At the
end of pregnancy the human cord is constituted by two
main tissue: the cord blood and the stromal fraction. The
second is a high vascularized mucous connective tissue,
called Wharton gelly. The human umbilical stromal
cells are good candidates for tissue regeneration of
mesenchyme-derived tissues. The cells from Wharton’s
80 (S)
A. GRAZIANO ET AL.
Table I. Antigen table.
Markers
CD 34
CD 90
CD 117
CD 303
CD 44
CD 31
CD 54
BPMr I/II
OC
ON
OP
Expression
7 days
++
++
+
++
++
-
15 days
++
++
+
+
+
+
-
Differentiated
+
+
++
+
+
+
++
+
+
TABLE II
Proteins
Alkaline phospatase
Collagen type I
Collagen type III
Decorin
Fibronectin
Osteocalcin
Osteonectin
Osteopontin
F
O
O
R
++: ≥ 50% of positive cells; +: ≥ 20% < 50% of positive cells;
-: negative cells.
P
Control
Micrograms/ml
0,191
0,187
0,208
0,187
0,183
0,177
0,173
0,176
Treated
Micrograms/ml
5
90
25
75
19
4
8
2
Fig. 1. Gene expressed by DPSCs after they differentiation
towards osteoblastic lineage. BMP2 but not BMP7 is
expressed.
Fig. 2. Differential gene expression by HCSC (C), dental pulp
derived osteoblasts (O) and HCSC co-cultured with osteoblasts
(T). After 15 days of co-culture HCSC start to acquire preosteoblastic lineage as demonstrated by Runx-2 expression and
increasing of osterix, but the terminal differentiation has not yet
been reached as showed by the deficient expression of BSP and
ostocalcin.
Jelly have properties of MSCs: their isolation is
extremely easy, doesn’t affect the collection of the cord
blood, but provides a great amount of stromal stem cells
suitable for autologous and omologous transplantation
procedures. Unfortunately researchers attention has been
more focused on blood than on stromal part of umbilical
cord as collection source for human stem cells, although
the antigens expressed on cellular surface and the results
obtained from differentiation experiments confirmed the
undifferentiated nature of these stromal cells (13).
From the cord blood it is possible to isolate
multipotent mesenchymal stem cells, mainly with
hematopiesis supportive function (1) but the collection of
these mesenchymal progenitors (2) must follow different
procedures respect to those used for the same progenitors
in the bone marrow (14).
Actually in the Wharton Gelly, the most important
source for this cytotype in the human cord (3), the
approach for collection of stromal stem cells follows
two main approach: isolating the cells surrounding the
umbilical veins, called HUVECs, (Human Vascular
Endothelial Cells) or culturing the matrix cells under
appropriate conditions for bone marrow-derived
mesenchymal cells (4). In 2005 the group of Davis (15),
isolated stem cells called HUCPV(Human Umbilical
PeriVascular Cells) from the peri-vascular compartment
of the cord stroma, using a similar protocol to that used
for HUVECs isolation. Actually the amount of cells that
can be collected from the cord stroma is significantly
higher with respect to the bone marrow stroma, due to the
F
81 (S)
European Journal of Inflammation
tissue volume avalaible for each cell selection procedure,
almost 50 ml. The technique we used to collect the cells
from the inner gelly surrounding the umbilical veins
makes our cells very similar to HUVEC and confirms
that the mesenchymal subpopulation resides in the
perivascular pool; on the other hand the conditions we
used for culture the cells showed the analogies with bone
marrow mesenchymal progenitors.
This study has been conducted to explore the chance
of inducing human umbilical cord -derived MSCs to
differentiate into osteogenic cells after exposing to the
supernatant of osteoblastic cells. This environment has
been reproduced co-culturing cord stroma cells with
OC+/RUNX2+ cells obtained from dental pulp stem cells.
The dental pulp stem cells are a good model of osteogenic
differentiation (16). Although they are pluripotent stem
cells, the self-commitment they display toward an
osteogenic cytotype mimics the bone regeneration after
injuries and the model they reproduce in vitro can be
helpful to study bone development processes (16). In this
paper we preferred to use OC+/RUNX2+ differentiated
stem cells instead than bone cell lineages, in order to
better mimic bone differentiation environment, in terms of
soluble factors released in the differentiation process.
The chance to obtain bone differentiation just after
exposing the cord stroma cells to the conditionated
medium of bone differentiated cells shows the plasticity of
these cells to acquire a connective phenotype in a fast and
efficient way. It makes them extremely suitable for clinical
application for connective tissue diseases therapies.
Osteoblast differentiated cells from dental pulp stem
cells show RT-PCR transcripts for TGF beta1, BMP2 but
not for BMP7, suggesting a different role of this TGF-beta
family proteins on osteogenic processes. BMP2 expression
was confirmed by ELISA.
Bone Morphogenetic Protein 2 (BMP-2) and
Osteogenic Protein 1 (OP-1, also termed BMP-7)
are members of the transforming growth factor beta
superfamily BMPs were originally identified as protein
regulators of cartilage and bone formation. Analysis of the
skeletal phenotypes caused by the genetic inactivation of
individual Bmps, along with the study of their expression
patterns, suggest possible functional redundancy of these
molecules.
BMP-2 exerts pleiotropic functions, including
organogenesis, bone formation and regeneration.
Recombinant human BMP-2 has been shown to possess
potent ectopic bone-forming activity in a variety of
experimental systems (17, 18).
BMP-2 is expressed in the growth plate and regulates
growth plate chondrogenesis by inducing chondrocyte
proliferation and hypertrophy (19). In addition to promoting
bone formation during embryonic development, BMP-2 is
also involved in dorsal-ventral pattern formation. BMP7
is expressed at diverse sites in the developing mouse
embryo, including visceral endoderm, notochord, heart,
eye, kidney, and bone (20).
In the ribs, Bmp4 and Bmp7 seem to act in the same
pathway to assure proper guidance of mesenchymal
condensations of the ribs extending toward the sternum.
In the limbs, these molecules appear to play a similar role
in controlling digit number, possibly through induction
of apoptosis in the interdigital and anterior mesenchyme
(21).
Interestingly, the effects of these two BMPs on
joint formation were found to be different. While the
predominant effect of BMP-2 is alteration in joint shape,
OP-1 is a potent inhibitory factor for joint formation (22).
BMPs signal via different hetero-oligomeric
complexes of type I and type II serine/threonine kinase
receptors (for reviews, see references 12 and 13). BMP-2
receptors include the type I receptors, ALK-6/BMPR-IB,
ALK-2/Act RI and ALK-3/BMPR-IA, and the type II
receptors, BMP RII and Act RIIB.
The expression of both the receptors, BMPrI and II, on
HUCPV before the co-culture, shows the plasticity of this
cells to be addressed toward an osteogenic lineage.
The expression of osterix, despite al low levels,
in non-stimulated cells too, shows the mesenchymal
committement of HUVECs and confirm that osx itself is
not able to determine osteogenic fate of cells; interestingly
osx shows the same levels in differentiated osteoblasts
and in undifferentiated cells; on the contrary runx-2
expression is detectable only in stimulated HUVECs,
coming with an up-regulation of osx, determining an
osteogenic differentiation of the cells, showed by ALP
expression and calcein-positive nodules, suggesting a
different roles of the master genes in the key regulation of
bone differentiation.
Both these genes are activated through a BMP2
pathway, producted by DPSCs derived osteoblasts as
demonstrated.
F
O
P
O
R
REFERENCES
1.
2.
3.
Lee OK, Kuo TK, Chen WM, Lee KD, Hsieh SL, Chen
TH. Isolation of multipotent mesenchymal stem cells from
umbilical cord blood. Blood 2004; 103:1669-75.
Lu LL, Liu YJ, Yang SG, Zhao QJ, Wang X, Gong W, Han
ZB, Xu ZS, Lu YX, Liu D, Chen ZZ, Han ZC. Isolation and
characterization of human umbilical cord mesenchymal
stem cells with hematopoiesis-supportive function and
other potentials. Haematologica 2006; 91:1017-26.
McElreavey KD, Irvine AI, Ennis KT, McLean WH.
Isolation, culture and characterisation of fibroblast-like
82 (S)
A. GRAZIANO ET AL.
cells derived from the Wharton’s jelly portion of human
umbilical cord. Biochem Soc Trans 1991; 19:29S.
4. Romanov YA, Svintsitskaya VA, Smirnov VN. Searching
for alternative sources of postnatal human mesenchymal
stem cells: candidate MSC-like cells from umbilical cord.
Stem Cells 2003; 21:105-10.
5. Mitchell KE, Weiss ML, Mitchell BM, Martin P, Davis
D, Morales L, Helwig B, Beerenstrauch M, Abou-Easa
K, Hildreth T, Troyer D, Medicetty S. Matrix cells from
Wharton’s jelly form neurons and glia. Stem Cells 2003;
21:50-60.
6. Kadner A, Hoerstrup SP, Tracy J, Breymann C, Maurus
CF, Melnitchouk S, Kadner G, Zund G, Turina M. Human
umbilical cord cells: a new cell source for cardiovascular
tissue engineering. Ann Thorac Surg 2002; 74:S1422-8.
7. Hoerstrup SP, Kadner A, Breymann C, Maurus CF, Guenter
CI, Sodian R, Visjager JF, Zund G, Turina MI. Living,
autologous pulmonary artery conduits tissue engineered
from human umbilical cord cells. Ann Thorac Surg 2002;
74:46-52; discussion 52.
8. Griffith LG, Naughton G. Tissue engineering--current
challenges and expanding opportunities. Science 2002;
295:1009-14.
9. Hofmeister CC, Zhang J, Knight KL, Le P, Stiff PJ. Ex
vivo expansion of umbilical cord blood stem cells for
transplantation: growing knowledge from the hematopoietic
niche. Bone Marrow Transplant 2007; 39:11-23.
10. Laino G, d’Aquino R, Graziano A, Lanza V, Carinci F,
Naro F, Pirozzi G, Papaccio G. A new population of human
adult dental pulp stem cells: a useful source of living
autologous fibrous bone tissue (LAB). J Bone Miner Res
2005; 20:1394-402.
11. Laino G, Graziano A, d’Aquino R, Pirozzi G, Lanza V,
Valiante S, De Rosa A, Naro F, Vivarelli E, Papaccio G. An
approachable human adult stem cell source for hard-tissue
engineering. J Cell Physiol 2006; 206:693-701.
12. Papaccio G, Graziano A, d’Aquino R, Graziano MF,
Pirozzi G, Menditti D, De Rosa A, Carinci F, Laino G.
Long-term cryopreservation of dental pulp stem cells
13.
14.
15.
(SBP-DPSCs) and their differentiated osteoblasts: a cell
source for tissue repair. J Cell Physiol 2006; 208:319-25.
Ma L, Feng XY, Cui BL, Law F, Jiang XW, Yang LY, Xie
QD, Huang TH. Human umbilical cord Wharton’s Jellyderived mesenchymal stem cells differentiation into nervelike cells. Chin Med J (Engl) 2005; 118:1987-93.
Mareschi K, Biasin E, Piacibello W, Aglietta M, Madon
E, Fagioli F. Isolation of human mesenchymal stem cells:
bone marrow versus umbilical cord blood. Haematologica
2001; 86:1099-100.
Sarugaser R, Lickorish D, Baksh D, Hosseini MM, Davies
JE. Human umbilical cord perivascular (HUCPV) cells: a
source of mesenchymal progenitors. Stem Cells 2005; 23:
220-9.
Graziano A, d’Aquino R, Cusella-De Angelis MG, Laino
G, Piattelli A, Pacifici M, De Rosa A, Papaccio G. Concave
pit-containing scaffold surfaces improve stem cell-derived
osteoblast performance and lead to significant bone tissue
formation. PLoS One 2007; 2:e496.
Wozney JM. Bone morphogenetic proteins. Prog Growth
Factor Res 1989; 1:267-80.
Riley EH, Lane JM, Urist MR, Lyons KM, Lieberman JR.
Bone morphogenetic protein-2: biology and applications.
Clin Orthop Relat Res 1996:39-46.
De Luca F, Barnes KM, Uyeda JA, De-Levi S, Abad
V, Palese T, Mericq V, Baron J. Regulation of growth
plate chondrogenesis by bone morphogenetic protein-2.
Endocrinology 2001; 142:430-6.
Dudley AT, Robertson EJ. Overlapping expression
domains of bone morphogenetic protein family members
potentially account for limited tissue defects in BMP7
deficient embryos. Dev Dyn 1997; 208:349-62.
Katagiri T, Boorla S, Frendo JL, Hogan BL, Karsenty G.
Skeletal abnormalities in doubly heterozygous Bmp4 and
Bmp7 mice. Dev Genet 1998; 22:340-8.
Macias D, Ganan Y, Sampath TK, Piedra ME, Ros
MA, Hurle JM. Role of BMP-2 and OP-1 (BMP-7) in
programmed cell death and skeletogenesis during chick
limb development. Development 1997; 124:1109-17.
F
O
P
O
R
16.
17.
18.
19.
20.
21.
22.
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
EFFECTIVENESS OF SURGICAL AND ORTHODONTIC TREATMENT IN ORTHOGANTIC
SURGERY: A RETROSPECTIVE STUDY
U. BACILIERO1, I. ZOLLINO2, S.FANALI3, A. BUSATO4,
V. VISMARA4, A. AVANTAGGIATO2, F. CARINCI2
F
O
Maxillofacial Surgery, Civil Hospital, Vicenza, Italy
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
3
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
4
Private practice, Milano, Itly
1
2
Orthognathic surgery is the surgical correction of skeletal anomalies or malformations involving the mandible
or the maxilla. Therefore, an accurate objective prediction analysis of the final treatment outcome has become an
important part of the consultation for any patient seeking orthognathic surgery. In the present study a case series
of patients planned on tracing of cephalometric radiographs is reported in order to assess the effectiveness of
planning and treatment and pertinent literature discussed. The study population was composed of 44 patients (28
females and 16 males, median age 28 years) affected by class II and III skeletal malocclusion or long face. Patients
were evaluated by means of 4 teleradiograpies: one at the admission, one before surgery, one after surgery and one
at the end the follow-up. Slavicek cephalometric analysis was performed. A logistic analysis was performed in order
to dected those variables associated to the clinical outcome. Among the skeletal variables, the mandibular trend
is the only variable that has an impact on clinical outcome. None of the teeth variables has statistical significance.
Orthognathic surgery involving mobilization, repositioning, and fixation of the maxilla and mandible. The jaw is
corrected to improve functional difficulties in the musculoskeletal system involving the mouth, including difficulties
with mastication and pronunciation, and to treat facial appearance due to abnormal growth. It not only results
in functional and cosmetic recovery, but the improved appearance also benefits the patient psychologically and
socially. Our data demonstrated that patients planned on tracing of cephalometric radiographs have good clinical
outcome. However, mandibular correction is the most difficult challenge to be perfectly corrected.
O
R
P
Orthognathic surgery is the surgical correction of
skeletal anomalies or malformations involving the
mandible or the maxilla. These malformations and
anomalies can cause chewing and eating difficulties,
abnormal speech patterns, early loss of teeth, and
disfigurement and dysfunction of the temporomandibular
joint. They may be present at birth, or they may become
evident as the patient grows and develops. Also traumatic
events in the developing facial skeleton can displace the
normal elements and they can disturb normal subsequent
growth (1).
Indications for orthognathic surgery include facial
dysmorphism with and without functional implications,
for restoring the facial form and or for functional
occlusion. Airway and speech are other indications when
considering the functional need for orthognathic surgery.
Therefore, restoration of the normal anatomic relationship
between the maxilla and mandible relative to the cranial
base reestablishes the functional components of the facial
skeleton (2).
Current methods of orthognathic surgical planning
involve clinical evaluation, photographs, skeletal
evaluation with standardized radiographs, dental
evaluation, freehand surgical simulation based on
cephalometric tracing and then transferred to study model
surgery, and computerized prediction software (3, 4).
Clinical assessment should be directed specifically at
evaluating the relative position and size of each of the facial
skeletal elements, the degree of zygomatic projection, and
the maxillary and mandibular positions in space relative
Key words: Orthognathic surgery, relapse, orthodontic treatment, osteotomy, face.
Corresponding author: Prof. Francesco Carinci, M.D
Department of Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
83
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
84 (S)
U. BACILIERO ET AL.
to each other and to the cranial-orbital region. The
nasolabial angle, upper lip length, lip competency and
labial-mental sulcus should be documented. Any facial
asymmetry should be noted along with the relationship of
the maxillary dental mid line. The intraoral examination
should focus on the dental alignment within each arch
and relationship of the dental arches to each other. The
degree of dental display on repose and smile also should
be recorded with the amount of gingival display (5).
Therefore, an accurate objective prediction
analysis of the final treatment outcome has become
an important part of the consultation for any patient
seeking orthognathic surgery (6). A number of
methods have been used in the past to achieve this
goal including manual surgical simulation based on
tracing of cephalometric radiographs, acetate overlays,
and cut-and-paste profile tracings followed by manual
repositioning of the patient photograph (7, 8). Lately,
computer software programs have been developed and
used to analyze and predict the outcome of orthognathic
surgery (9, 10). Recent advances in 3-dimensional (3D)
medical image computing for orthognathic surgery have
enabled and allowed a major virtual diagnosis, treatment
planning, and evaluation of treatment outcomes of
maxillofacial deformities (11). The importance of 3D
virtual surgical planning increases with the complexity
of the deformity and reconstruction needed to correct it
(Fig. 1 and 2). Computer-based virtual reality surgical
simulation permits a broader experience, repetitive skills
acquisition, and objective evaluation without risk to real
outcomes, especially when compared with the traditional
model of surgical teaching (12).
In the present study a case series of patients planned
on tracing of cephalometric radiographs is reported in
order to assess the effectiveness of planning and treatment
and pertinent literature discussed.
at the admission, one before surgery, one after surgery and one
at the end the follow-up (12 months).
Slavicek cephalometric analysis(13) was performed. It
evaluates the following parameters composed by several
measures:
1 – Cranial trend that is the sum of the following variables:
Facial axis (normal value = 90.0°), Facial depth (n.v. = 91.5°),
Facial convexity (n.v. = 68.0°), Mandibular plane (n.v. = 21.5°),
Bjork sum (n.v. = 396.0°), Facial length ratio (n.v. = 63.5%), Yaxis/SN angle (n.v. = 67.0°), Y axis (n.v. = 61.8°), SN/GoniomGnation angle (n.v. = 31.6°); cranial trend can be long, normal
or short;
2 – Mandibular trend: Mandibular arch (n.v. = 31.2°),
Goniac angle (n.v. = 130.0°), Ramus high (n.v. = 54.9 mm),
Body length (n.v. = 82.4 mm), Mandibular body to anterior base
(1.1 ratio); mandibular trend can be long, normal or short;
3 – Skeletal class: Maxillary position (n.v. = 65.0°), SNA
angle (n.v. = 80.5°), Maxillary depth (n.v. = 90.0°), Facial depth
(n.v. = 91,5°), SNB angle (79.2°), SND angle (n.v. = 76.0°),
Skeletal difference maxilla/mandible (n.v. = 0.0%), Maxillary
skeletal position (n.v. = 0.0%), Mandibular skeletal position
(n.v. = 0.0%), ANB angle (n.v. = 1.3°), Wits (n.v. = 0.0 mm),
Facial convexity (n.v. = 1.5°), AB to Facial plane (n.v. = - 6.0 °);
there are 3 skeletal class;
4 – Maxilla: Maxillary position (n.v. = 65.0°), SNA angle
(n.v. = 80.5°), Maxillary depth (n.v. = 90.0°), Maxillary high
(n.v. = 56.6 °), Palatine point/Francofort angle (n.v. = 1.0°);
maxilla can be prognatic, normal or retrognatic;
5 – Mandible: Facial depth (n.v. = 91.5°), SND angle (n.v. =
76.0°), SNB angle (n.v. = 79.2 °), Mandibular body to Anterior
Base (1.1 ratio), Body length (n.v. = 79.4 mm), Anterior cranial
base length (n.v. = 62.2 mm), Ramus position (n.v. = 76.0°),
SNP angle (n.v. = 81.0°); mandible can be prognatic, normal or
retrognatic;
6 – Lower facial high: Lower facial high (n.v. = 46.2°),
Lower facial high to D point (n.v. = 52.7°), Mandibular plane
(n.v. = 21.5°), Palatine point to Francfort (n.v. = 1.0°), Maxillary
high (n.v. = 56.6 °), Maxillary relation (n.v. = 23.3°), N index
(n.v. = 79.0%); lower facial high can be increased, normal or
decreased;
7 – Protrusion of upper incisor: Protrusion of the upper
incisor (n.v. = 5.6 mm), Upper incisor to NA distance (n.v. = 4.0
mm), Upper incisor to Facial plane (n.v. = 8.0 mm), Inclination
of upper incisor (n.v. = 26.4 °); protrusion of upper incisor can
be increased, normal or decreased; worsend (0). The sum of
skeletal and teeth variables ranged from 0 to 14 and from 0 to
10, respectively. A skeletal and a teeth score ≥ 7 and ≥ 6 were
considered as clinical success, respectively. Lower values were
considered failures.
F
O
O
R
P
MATERIALS AND METHODS
Study design/sample
To address the research purpose, the investigators designed a
retrospective cohort study. The study population was composed
of 44 patients (28 females and 16 males, median age 28 years)
affected by class II and III skeletal malocclusion or long face,
consecutively admitted to for evaluation and treatment at the
Department of Maxillofacial Surgery, Civil Hospital, Vicenza,
Italy between January 2004 and December 2005. Informed
written consent approved by the local Ethics Committee was
obtained from patients to use their data for research purpose.
The exclusion criteria were as follows: previous facial
operation, localized radiation therapy, antitumor chemotherapy
and presence of any syndromic malformation.
Slavicek cephalometric analysis
Patients were evaluated by means of 4 teleradiograpies: one
Data collections
Patients were evaluated by means of 4 teleradiograpies:
one at the admission (Fig. 3), one before surgery (Fig. 4), one
after surgery (Fig. 5) and one at the end of the follow-up (Fig.
6). The measurement was rounded off to the nearest 0.1 mm.
The radiographs were scannerized by means a scanner Epson
Expression 1680pro. Each file was processed with the Gamma
Dental Software for Windows (Gamma GMBH, Austria). The
dimensions were detected by a lateral meter.
F
85 (S)
European Journal of Inflammation
Data analysis
A logistic analysis was performed in order to dected those
variables associated to the clinical outcome (14).
RESULTS
Forty-four patients (28 females and 16 males, median
age 28 years) were enrolled in the present study. There
were 24 skeletal class III, 14 skeletal class II and 6 skeletal
class I but with long face.
As regard skeletal variables there were the following
distribution at the admission: 24 long, 15 normal and
5 short cranial trend; 5 long, 22 normal and 17short
mandibular trend; 6, 14 and 24 skeletal class I, II and
III; 9 prognatic, 12 normal and 23 retrognatic maxilla;
18 prognatic, 5 normal and 21 retrognatic mandible; 11
increased, 31 normal and 2 decreased lower facial high.
As regard teeth variables there were the following
distribution: 16 increased, 19 normal and 9 decreased
protrusion of upper incisors; 12 increased, 19 normal and
O
R
Table I. Output of logistic analysis obtained by comparing
skeletal variables registered from pre-and post-surgical
teleradiographies; df = degree of freedom.
P
VARIABLE
Cranial trend
Mmandibular trend
Skeletal class
Maxilla
Mandible
Lower facial high
Bimaxillary ostrotomy
F
O
Fig. 1. 3D CT reconstraction of facial skeleton
df
Sig.
1
0.7050
1
0.0316
1
0.7880
1
0.5549
1
0.1219
1
0.2785
1
0.1495
Fig. 2. The surgyplanner, an instrument to transform the 3D
image in a model where osteotomies can be planned.
Table II. Output of logistic analysis obtained by comparing
teeth variables registered from post-surgical and final
teleradiographies.
VARIABLE
Protrusion upper
incisor
Inclination upper
incisor
Protrusion lower
incisor
Inclination lower
incisor
Incisors angle
df
Sig.
1
0.3936
1
0.3824
1
0.6764
1
0.0823
1
0.1225
Fig. 3. Teleradiography (TRG) performed at the admission.
13 decreased inclination of upper incisors; 16 increased,
25 normal and 3decreased protrusion of lower incisors; 7
increased, 36 normal and 1decreased inclination of lower
incisors; 8 increased, 29 normal and 7 decreased incisors
angle).
Finally, as regard surgical variables there were
the following distributions: 36 Le Fort I osteotomies,
43sagittal split osteotomies and 24 genioplasty.
86 (S)
U. BACILIERO ET AL.
Table II reports the output of logistic analysis
obtained by comparing teeth variables registered from
post-surgical and final teleradiographies: no variable has
statistical significance.
DISCUSSION
Fig. 4. TRG recorded just before the operation.
F
O
Correction of severe skeletal malocclusions usually
involves an interdisciplinary team for planning and
monitoring of co-ordinated orthodontic and surgical
treatment. This elective treatment is demanding to
the patient, substantial resources are being spent, and
treatment represents risks for unwanted side-effects, such
as nerve injuries, resulting in sensory disturbances in the
face (15).
The facial appearance may play a larger role today,
and a rise in awareness of the treatment possibilities
among the patients may have increased the demand for
orthognathic surgery (16).
Orthognathic surgery involving mobilization,
repositioning, and fixation of the maxilla and mandible.
The jaw is corrected to improve functional difficulties
in the musculoskeletal system involving the mouth,
including difficulties with mastication and pronunciation,
and to treat facial appearance due to abnormal growth.
It not only results in functional and cosmetic recovery,
but the improved appearance also benefits the patient
psychologically and socially (17). Multiple segmental
osteotomies are required in complex cases, but bone
healing after orthognathic surgery is associated with
relatively few complications (18). However, the
complications that arose as a consequence of jaw surgery
were divided into the during and after surgery categories.
The complications during surgery included inappropriate
bone fragmentation (19), vascular damage (20), nerve
exposure (21), tooth damage, and soft tissue damage. The
complications after surgery included sensory numbness,
respiratory difficulty, neck pain, and gastrointestinal
disease (17). Careful planning, with treatment simulation
and model surgery, minimize potential intraoperative
complications related to segment positioning. However,
variability in bone architecture and density can result in
unanticipated fractures that make fixation and stabilization
difficult. This is most common in the mandibular ramus
with the bilateral sagittal split osteotomy and in the
pterygoid plates with Le Fort I osteotomy (17).
Our data demonstrated that patients planned on
tracing of cephalometric radiographs have good clinical
outcome. However, mandibular correction is the most
difficult challenge to be perfectly corrected.
Similar results were obtained by Hong-Po Chang
et coll. (22). Skeletal Class III patients with midface
deficiency are often less difficult to treat than patients
O
R
P
Fig. 5. TRG performed after the bimaxillary surgery.
Fig. 6. TRG recorded at the end of the treatment.
Table I reports the output of logistic analysis obtained
by comparing skeletal variables registered from pre-and
post-surgical teleradiographies: the mandibular trend is
the only variable that has an impact on clinical outcome.
F
87 (S)
European Journal of Inflammation
with mandibular prognathism alone, since some
improvement may be obtained in the midface by maxillary
protraction, and some in the mandible by chincup therapy.
In addition, an orthodontic preparation with dentoalveolar
decompensation will allow an increase in the quantity of
surgical correction and a stable occlusion immediately
after surgery, making better functional and aesthetic
results possible (22).
In conclusion, patients planned on tracing of
cephalometric radiographs have good clinical outcome.
Additional studies on new technologies (such as 3D
virtual surgical planning of orthognathic surgery) may be
helpful in treating most difficult cases.
9.
10.
11.
12.
ACKNOWLEDGMENTS
REFERENCES
2.
3.
4.
5.
6.
7.
8.
F
O
O
R
This work was supported by grant from the University
of Ferrara (F.C.).
1.
orthognathic surgery. Am J Orthod Dentofacial Orthop
1995; 107:177-85.
Laney TJ, Kuhn BS. Computer imaging in orthognathic
and facial cosmetic surgery. Oral Maxillofac Surg Clin
North Am 1990; 2:659.
Turpin DL. Computers coming on-line for diagnosis and
treatment planning. Angle Orthod 1990; 60:163.
Swennen GR, Mollemans W, Schutyser F. Threedimensional treatment planning of orthognathic surgery
in the era of virtual imaging. J Oral Maxillofac Surg 2009;
67:2080-92.
Schendel SA, Jacobson R. Three-dimensional imaging
and computer simulation for office-based surgery. J Oral
Maxillofac Surg 2009; 67:2107-14.
Slavicek R. The masticatory organ. Michigan.: Needhan
Press, Ann Arbor; 2002.
Hosmer D, Lemeshow S. Applied logistic regression NJ
state, USA: Wiley, Hoboken; 2000.
Espeland L, Hogevold HE, Stenvik A. A 3-year
patient-centred follow-up of 516 consecutively treated
orthognathic surgery patients. Eur J Orthod 2008; 30:2430.
Papadopoulos MA, Lazaridou-Terzoudi T, Oland J,
Athanasiou AE, Melsen B. Comparison of soft and hard
tissue profiles of orthognathic surgery patients treated
recently and 20 years earlier. Oral Surg Oral Med Oral
Pathol Oral Radiol Endod 2009; 108:e8-13.
Kim SG, Park SS. Incidence of complications and problems
related to orthognathic surgery. J Oral Maxillofac Surg
2007; 65:2438-44.
Bell WH, You ZH, Finn RA, Fields RT. Wound healing
after multisegmental Le Fort I osteotomy and transection
of the descending palatine vessels. J Oral Maxillofac Surg
1995; 53:1425-33; discussion 33-4.
Lanigan DT, West RA. Aseptic necrosis of the mandible:
report of two cases. J Oral Maxillofac Surg 1990; 48:296300.
Mehra P, Cottrell DA, Caiazzo A, Lincoln R. Lifethreatening, delayed epistaxis after surgically assisted
rapid palatal expansion: a case report. J Oral Maxillofac
Surg 1999; 57:201-4.
Jones JK, Van Sickels JE. Facial nerve injuries associated
with orthognathic surgery: a review of incidence and
management. J Oral Maxillofac Surg 1991; 49:740-4.
Chang HP, Tseng YC, Chang HF. Treatment of mandibular
prognathism. J Formos Med Assoc 2006; 105:781-90.
Moles DR, Cunningham SJ. A national review of
mandibular orthognathic surgery activity in the National
Health Service in England over a nine year period: part
1--service factors. Br J Oral Maxillofac Surg 2009; 47:26873.
Cunningham SJ, Moles DR. A national review of
mandibular orthognathic surgery activity in the National
Health Service in England over a nine year period: part 2-patient factors. Br J Oral Maxillofac Surg 2009; 47:274-8.
Donatsky O, Hillerup S, Bjorn-Jorgensen J, Jacobsen
PU. Computerized cephalometric orthognathic surgical
simulation, prediction and postoperative evaluation of
precision. Int J Oral Maxillofac Surg 1992; 21:199-203.
Loh S, Yow M. Computer prediction of hard tissue profiles
in orthognathic surgery. Int J Adult Orthodon Orthognath
Surg 2002; 17:342-7.
Proffit WR, White Jr RP, Sarver DM. Contemporary
Treatment of Dentofacial Deformities. St. Louis: CV
Mosby; 2002.
Kaipatur NR, Flores-Mir C. Accuracy of computer
programs in predicting orthognathic surgery soft tissue
response. J Oral Maxillofac Surg 2009; 67:751-9.
Burstone CJ, James RB, Legan H, Murphy GA, Norton
LA. Cephalometrics for orthognathic surgery. J Oral Surg
1978; 36:269-77.
Sinclair PM, Kilpelainen P, Phillips C, White RP, Jr.,
Rogers L, Sarver DM. The accuracy of video imaging in
P
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
SINUS LIFT AUGMENTATION USING PULP STEM CELLS:
A CASE REPORT AND HISTOLOGICAL EVALUATION
A. GRAZIANO1, R. D’AQUINO1, G. BRUNELLI2, S. FANALI3, F. CARINCI1
F
O
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
2
Don Orione Hospital, Bergamo, Italy
3
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
1
Bone augmentation to reconstruct atrophic jaws provides the base for sufficient functional and aesthetic
implant-supported oral rehabilitation. Although autografts are the standard procedure for bone grafting, the
use of bone regeneration by using dental pulp stem cell is an alternative that open a new era in this field. One
patient undergoes to sinus lift elevation by means pulp stem cells gentle poured onto collagen sponge. Histological
sampling was performed after 6 months. Results clearly demonstrated new bone formation after dental pulp
stem cells grafting after sinus lift. This report demonstrated that stem cells derived from dental pulp poured onto
collagen sponge is a useful method for bone regeneration in atrophic maxilla.
O
R
Human adult stem cells are the natural and direct
physiological source from which stable differentiated
cells are generated, leading to tissue formation (1). Stem
cells are a promising tool for tissue repair (2), thanks to
their extensive proliferation, differentiation plasticity and
their multipotent activity, characteristics that make them
able, theoretically, to regenerate the structure of injured
tissues and that lead to several tissue-based therapies. One
of the main problems of the therapeutic use of stem cells
remains the identification of accessible sites within the
human body where collecting an adequate amount of stem
cells. Although their number is higher before the birth,
it has been suggested that also within the adult human
body there are several “loci” or “niches” inhabited by a
significant number of stem cells (3).
Dental pulp is a niche housing neural-crest-derived
stem cells that display plasticity and multipotential
capability (4). This niche is easily accessible and there is
limited morbidity of the anatomical site after collection
of the pulp (5). Dental pulp is made of both ectodermic
and mesenchymal components and is divided into four
layers, from the outer to the inner part: 1) the external
layer made up of odontoblast producing dentin; 2) the
second layer, called “cell free zone”, poor in cells and rich
in extracellular matrix; 3) the third layer, called “cell rich
zone”, containing progenitor cells that display plasticity
and pluripotential capabilities (6); 4) the inner layer, that
comprise the vascular area and nervous plexus.
Several studied have been performed on dental pulp
stem cells (DPSCs) and they mainly found that these
cells are multipotent stromal cells that can be safety
cryopreserved, used with several scaffolds, that can
extensively proliferate, have a long lifespan and build
in vivo an adult bone with Havers channels and an
appropriate vascularisation (1).
To determinate the proliferation and clonogenic
potential of cells, culturing of DPSCs is the first step
that establish a stem cell line, which is a propagating
collection of genetically identical cells that can be used
for research and therapy development. DPSCs can be
cultured by two methods; the first is the enzyme-digestion
method (7) in which the pulp tissue is collected under
sterile conditions, digested with appropriate enzymes, and
then the resulting cell suspensions are seeded in culture
dishes containing a special medium supplemented with
necessary additives and incubated. Finally, the resulting
colonies are subcultured before confluence and the cells
are stimulated to differentiate. The second method for
isolating dental pulp stem cells is the explant outgrowth
method (8) in which the extruded pulp tissues are cut,
anchored via microcarriers onto a suitable substrate,
and directly incubated in culture dishes containing the
P
Key words: Jaw, reconstruction, stem cell, bone, homograft, resorption
Corresponding author: Prof. Francesco Carinci, M.D
Department of Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
89
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
90 (S)
A. GRAZIANO ET AL.
essential medium with supplements. Up to 2 weeks is
needed to allow a sufficient number of cells to migrate out
of the tissue.
In the current study we performed a sinus lift
augmentation using stem cells derived from dental pulp.
Patient was evaluated after 6 months by bone sampling
and subsequent histological evaluation.
MATERIALS AND METHODS
Patient
A male M.B., 42 years old, was selected in the Department
of Oral Surgery, Don Orione Hospital, Bergamo, Italy. Informed
written consent approved by the local Ethics Committee was
obtained from patients to use their data for research purpose.
The patient had an unremarkable medical history, no
other oral diseases and he wanted to rehabilitate the upper left
maxilla with dental implant-prosthetic therapy. He was taking
no medications and denied any allergies. Before the surgery he
underwent sexant scaling with ultrasonic and hand instruments.
The same patient presented a third molar with advanced bone
resorption but healthy for caries. We decided to extract the third
molar and extract the pulp to select stem cells for bone tissue
regeneration of the upper left maxilla (Fig 1 and 2).
The post-surgical course was uneventful.
After 6 months follow-up a re-entry was performed in
order to collect a sample bone and place a dental implant at the
same time. The surgical protocol was similar to that previously
described. Before the surgical re-entry a Computed Tomography
(CT) was scheduled to analyze the calcification within the
grafting area. The Computed Tomography (CT) showed a
high rate of mineralization within the site where sinus lift was
performed (Fig. 5).
The tissue sample was processed for hematoxillin-eosin
to challenge lamellar bone tissue organization. IF staining for
osteocalcin (OC) and osteonectin (ON) was performed in order
to evidence differentiated osteoblasts and bone ECM production
by dental pulp stem cells within the bone sample after 6 months.
The slides with H&E staining showed lamellar bone formation
both at low (Fig. 6) and high magnification (Fig.7). The IF
confirmed the expression of OC (Fig. 8) and ON (Fig.9).
F
O
P
O
R
Surgical procedure and dental pulp stem cells collection
After the extraction of the third molar the crown was
separated from the roots following the enamel-cementum line in
order to open the pulp chamber and expose the soft connective
pulpar tissue (Fig.3). The pulp was gently collected using a
Gracey curette and dissociated using Medimachine System
(Consul TS, Orbassano, Italy) in 2ml of physiologic solution.
After 60 seconds of agitation the cellular suspension is collected
from the system and gentle poured onto collagen sponge
(Gingistat, GABA, Italy). The sponge was placed in the sinus
lift space (Fig 4) and then the wound sutured.
The pharmacological profylaxis was prescribed as follows:
dexamethason (Decadron, Visufarma spa, Italy) 4.5 mg 6h
before the surgery, Nimesulide (DOC Generici srl, Italy) 100mg
2h before the surgery, amoxicillin 875 mg and 125 clavulanic
acid (Augmentin, Glaxosmithkline spa, Italy) 12 h and 1h before
the surgery. Before the surgery the oral decontamination was
obtained using 60 seconds of mouth rinsing with 0,2 Clorexidine
washing (Forhans, Italy). The local anesthetic used was articain
2% 1:100000 epinephrin (UBISTEIN – ESPE, Italy).
The incisions were performed and a full thickness flap
elevated according the lateral approach technique; a bony
window of square shape with 25 mm side was obtained to access
the sinus using a 1.5 mm bur.
Then, the sinus cavity was filled with a mix of Gingistat and
dental pulp stem cells. The sinus access was closed and sutured.
Postsurgical medication were prescribed as follows:
antibiotic therapy (875 amoxicillin + 125 clavulanic acid) twice
a day for 7 days; dexamethason 3mg for the first day and 1,5 mg
for the second day after the surgery; Nimesulide 100 mg twice
a day for 5 days; 0.12 Clorexidine rinse twice a day for 15 days.
The patient was advised against blowing her nose and was asked
to return in one week for suture removal.
Statistical Analysis
Pearson’s chi-square test was used to investigate difference
in bone density between native and FB as well as in peri-implant
and far from fixture areas.
DISCUSSION
The possibility of using stem cells, biological
molecules and tissue engineering opens new ways for
clinical dentistry. The use of adult stem/progenitor cells
can be extensive, since stem/progenitor cells can be
harvested from various tissues such as adipose tissue,
bone marrow, dental pulp and periodontal ligament (9).
Dental and periodontal tissues represent a possible source
of stem cells because approachable niches containing a
high number of stem cells compared to equal volumes
with the bone marrow. Dental pulp stem cells (DPSCs)
display different antigenic patterns and noticeable
plasticity that is explained by their neural-crest origin
(10). This is of great importance to understanding the
extraordinary plasticity displayed by these cells, which
differentiate not only toward osteoblasts and adipocytes
Fig. 1. Intra-oral photo showing the upper left first molar
missed
F
91 (S)
European Journal of Inflammation
Fig. 2. CT scan showing the wisdom tooth
F
O
Fig. 5. Three dimensional CT showing the bone produced in the
sinus area
O
R
P
Fig. 3. The third molar is extracted and the pulp collected
Fig. 6. Lamellar bone formation (H&E magnification 10x)
Fig. 4. Maxillary sinus lifting.
Fig. 7. Lamellar bone formation (H&E magnification 200x)
(10) but also toward neurons or myocytes. Moreover, the
use of these cells is of great interest because dental pulp
can be collected easily and pulpectomy itself is a therapy
in some cases (11).
Firstly Gronthos and colleagues (11), in 2000,
isolated stem cells from human dental pulp based on the
striking ability to regenerate a dentin-pulp-like complex
composed of a mineralized matrix of tubules lined with
odontoblasts, and fibrous tissue containing blood vessels
in an arrangement similar to the dentin-pulp complex
found in normal human teeth. These cells exhibited
differentiation potential into odontoblastic, adipogenic
and neural citotype. When compared with bone marrow
stromal cells, the DPSCs showed superimposable
ability in terms of calcified tissues formation, although
in different lineages (12). After Gronthos (11) studies
92 (S)
A. GRAZIANO ET AL.
with concave surfaces differentiated quicker and showed
nuclear polarity, an index of secretion, cellular activity and
matrix formation. Moreover, bone-specific proteins were
significantly expressed and the obtained bone tissue was of
significant thickness. Thus, cells cultured on the concave
textured surface had better cell-scaffold interactions and
were induced to secrete factors that, due to their autocrine
effects, quickly lead to osteodifferentiation, bone tissue
formation, and vascularisation.
The quality and quantity of regenerated bone formed by
DPSCs was demonstrated in vitro and in vivo experiments
using stem cells and biomaterials (16, 18). Thus, dental
pulp could be considered as an interesting and potentially
important source of autologous stem/progenitor cells that
are ready for use for therapeutic purposes, such as the
repair/regeneration of craniofacial bones.
Our results demonstrated that the dental pulp stem
cells grafting after the sinus lift procedure is an affordable
procedure for bone regeneration. The loading on collagen
sponge of the cellular suspension is important to fix the
cells grafting in a specified site and to support stem cells
along the first two weeks of their differentiation towards
a fibrous bone tissue at first. After the fourth week this
fibrous bone will be remodeled into a lamellar bone as
clearly demonstrated by data provided.
This report demonstrated that stem cells derived
from dental pulp poured onto collagen sponge is a useful
method for bone regeneration in atrophic maxilla.
F
O
O
R
Fig. 8. Immunofluorescence showing osteocalcin (magnification
10x).
P
Fig. 9. Immunofluorescence showing osteonectin (magnification
200x).
other researchers confirmed how these stem cells, under
specific stimuli (13), differentiated into several cell
types, including neurons, adipocytes and chondrocytes
(5) although the main commitment remains to form bone
(14, 15).
The use of appropriate biomaterial scaffolds combined
with selected growth factors can significantly improve
the survival and differentiation of the transplanted
stem/progenitor cells (9). Dental stem/progenitor cells
collected from dental pulp can be differentiated in vitro
and then transplanted with biomaterial scaffolds into
the host without immunologic rejection (16). Graziano
et al. (17) observed DPSCs performances on different
scaffolds, such as PLGA 85:15, hydroxyapatite chips
(HA) and titanium. Results showed that stem cells
exerted a different response, depending on the different
type of textured surface. Actually, stem cells challenged
ACKNOWLEDGMENT
This work was supported by FAR from the University
of Ferrara (FC), Ferrara, Italy, and from PRIN 2008 (F.C.).
1.
2.
3.
4.
REFERENCES
Papaccio G, Graziano A, d’Aquino R, Graziano MF,
Pirozzi G, Menditti D, De Rosa A, Carinci F, Laino G.
Long-term cryopreservation of dental pulp stem cells
(SBP-DPSCs) and their differentiated osteoblasts: a cell
source for tissue repair. J Cell Physiol 2006; 208:319-25.
Bianco P, Robey PG. Stem cells in tissue engineering.
Nature 2001; 414:118-21.
Laino G, d’Aquino R, Graziano A, Lanza V, Carinci
F, Naro F, Pirozzi G, Papaccio G. A new population of
human adult dental pulp stem cells: a useful source of
living autologous fibrous bone tissue (LAB). J Bone Miner
Res 2005; 20:1394-402.
Kerkis I, Kerkis A, Dozortsev D, Stukart-Parsons GC,
Gomes Massironi SM, Pereira LV, Caplan AI, Cerruti HF.
Isolation and characterization of a population of immature
dental pulp stem cells expressing OCT-4 and other
F
93 (S)
European Journal of Inflammation
embryonic stem cell markers. Cells Tissues Organs 2006;
184:105-16.
5. Jo YY, Lee HJ, Kook SY, Choung HW, Park JY, Chung JH,
Choung YH, Kim ES, Yang HC, Choung PH. Isolation and
characterization of postnatal stem cells from human dental
tissues. Tissue Eng 2007; 13:767-73.
6. Sinanan AC, Hunt NP, Lewis MP. Human adult craniofacial
muscle-derived cells: neural-cell adhesion-molecule
(NCAM; CD56)-expressing cells appear to contain
multipotential stem cells. Biotechnol Appl Biochem 2004;
40:25-34.
7. Sonoyama W, Liu Y, Yamaza T, Tuan RS, Wang S, Shi S,
Huang GT. Characterization of the apical papilla and its
residing stem cells from human immature permanent teeth:
a pilot study. J Endod 2008; 34:166-71.
8. Saito T, Ogawa M, Hata Y, Bessho K. Acceleration effect
of human recombinant bone morphogenetic protein-2 on
differentiation of human pulp cells into odontoblasts. J
Endod 2004; 30:205-8.
9. d’Aquino R, De Rosa A, Lanza V, Tirino V, Laino L,
Graziano A, Desiderio V, Laino G, Papaccio G. Human
mandible bone defect repair by the grafting of dental pulp
stem/progenitor cells and collagen sponge biocomplexes.
Eur Cell Mater 2009; 18:75-83.
10. Laino G, Graziano A, d’Aquino R, Pirozzi G, Lanza V,
Valiante S, De Rosa A, Naro F, Vivarelli E, Papaccio G. An
approachable human adult stem cell source for hard-tissue
engineering. J Cell Physiol 2006; 206:693-701.
11. Gronthos S, Mankani M, Brahim J, Robey PG, Shi S.
Postnatal human dental pulp stem cells (DPSCs) in vitro
and in vivo. Proc Natl Acad Sci U S A 2000; 97:13625-30.
12. Graziano A, d’Aquino R, Laino G, Papaccio G. Dental
pulp stem cells: a promising tool for bone regeneration.
Stem Cell Rev 2008; 4:21-6.
13. Srisawasdi S, Pavasant P. Different roles of dexamethasone
on transforming growth factor-beta1-induced fibronectin
and nerve growth factor expression in dental pulp cells. J
Endod 2007; 33:1057-60.
14. Hosoya A, Nakamura H, Ninomiya T, Hoshi K, Yoshiba
K, Yoshiba N, Takahashi M, Okabe T, Sahara N, Yamada
H, Kasahara E, Ozawa H. Hard tissue formation in
subcutaneously transplanted rat dental pulp. J Dent Res
2007; 86:469-74.
15. Otaki S, Ueshima S, Shiraishi K, Sugiyama K, Hamada
S, Yorimoto M, Matsuo O. Mesenchymal progenitor cells
in adult human dental pulp and their ability to form bone
when transplanted into immunocompromised mice. Cell
Biol Int 2007; 31:1191-7.
16. Graziano A, d’Aquino R, Laino G, Proto A, Giuliano MT,
Pirozzi G, De Rosa A, Di Napoli D, Papaccio G. Human
CD34+ stem cells produce bone nodules in vivo. Cell
Prolif 2008; 41:1-11.
17. Graziano A, d’Aquino R, Cusella-De Angelis MG, De
Francesco F, Giordano A, Laino G, Piattelli A, Traini
T, De Rosa A, Papaccio G. Scaffold’s surface geometry
significantly affects human stem cell bone tissue
engineering. J Cell Physiol 2008; 214:166-72.
18. d’Aquino R, De Rosa A, Laino G, Caruso F, Guida L,
Rullo R, Checchi V, Laino L, Tirino V, Papaccio G.
Human dental pulp stem cells: from biology to clinical
applications. J Exp Zool B Mol Dev Evol 2009; 312B:40815.
P
O
R
F
O
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
EARLY EFFECTS OF PULSED ELECTROMAGNETIC FIELDS ON HUMAN
OSTEOBLASTS AND MESENCHYMAL STEM CELLS
V. SOLLAZZO1, L. SCAPOLI2, A. PALMIERI3, S. FANALI4,
A. GIRARDI2, F. FARINELLA3, F. PEZZETTI2, F. CARINCI3
F
O
Orthopedic Clinic, University of Ferrara, Ferrara, Italy
Department of Histology, Embryology and Applied Biology, University of Bologna, Bologna, Italy
3
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
4
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
1
2
Pulsed Electromagnetic Fields (PEMFs) are commonly used in the clinical practice to treat several pathologies
like osteotomies, avascular necrosis of the femoral head and bone grafts. The sequences of events by which
electromagnetic stimulation can lead its effects on bone healing are not completely understood. In order to get
more information on the mechanism of action of PEMFs, we asked whether a) PEMFs are able to induce changes
in the production of growth factors in human osteoblasts and in human mesenchymal stem cells b) the production
of growth factors induced by PEMFs vary at different time points (12 and 24 hrs) c) PEMFs induce a different
production of growth factors in cells at different stages of differentiation like human Mesenchymal Stem cells
and human osteoblasts. Twenty seven genes out of the 84 studied were significantly over and down expressed and
fourteen of those genes up or down regulated are related to bone formation or inflammation. Our data demonstrate
that PEMFs exert their effects by activating or suppressing a large number of growth factors simultaneously with
different functions and that this variation of expression varies depending on time and depending on the different
stage of differentiation of the cell.
O
R
P
The positive effects of Pulsed Electromagnetic Fields
(PEMFs) on fracture healing are well known and PEMFs
are commonly used in the clinical practice since over
30 years. PEMFs are used to treat several pathologies
in which enhancement of bone healing is needed such
as non union, delayed union, osteotomies, avascular
necrosis of the femoral head, bone grafts and spinal fusion
(1). PEMFs are also demonstrated to be effective in the
relief of he postoperative pain and to favor the recovery
in patients who have undergone arthroscopic surgery and
arthroscopic anterior cruciate ligament reconstruction
due to their chondro-protective and anti-inflammatory
effects (2). Although the therapeutic properties of
PEMFs are well known, the sequence of events by
which electromagnetic stimulation can lead its desirable
effects on bone healing and cartilage are not completely
understood. PEMFs are known to modify some important
physiological parameters of cells cultured in vitro such as
proliferation, transduction, transcription, synthesis and
secretion of growth factors (3). PEMF are able to induce
cell proliferation in mitogen stimulated lymphocytes and
to improve IL-2 receptor expression and IL-2 utilization
in lymphocytes from aged donors, which are characterized
by defective production and utilization of this growth
factor (4). PEMF exposure induces cell proliferation in
human osteoblasts and chondrocytes cultured in vitro (5).
Moreover, normal human osteoblasts require minimal
exposure times to PEMF in order to increase their cell
proliferation, like the time needed to stimulate bone
formation in vivo. Electromagnetic fields determine
signal transduction by means of intracellular release of
Ca2+ leading to an increase in cytosolic Ca2+ and an
increase in activated cytoskeletal calmodulin (6). PEMFs
induce a dose-dependent increase in bone and cartilage
differentiation and the up-regulation of mRNA expression
of extracellular matrix molecules, proteoglycan, and
Key words: Pulsed electromagnetic fields, gene expression, stem cells
Corresponding author: Prof. Francesco Carinci, MD,
Department. of D.M.C.C.C.
Section of Maxillofacial Surgery
University of Ferrara Corso Giovecca, 203
44100 Ferrara Italy
Phone: +39.0532.455874 Fax: +39.0532.455582
E-mail:[email protected] Web:www.carinci.org
0393-974X (2011)
95
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
96 (S)
V. SOLLAZZO ET AL.
type II collagen. The acceleration of chondrogenic
differentiation is associated with increased expression
of transforming growth factor b1 (TGFb1) mRNA and
protein suggesting that the stimulation of TGFb1 may be
a mechanism through which PEMF affect complex tissue
behavior such as cell differentiation and through which
the effects of PEMF may be amplified (7). PEMFs are
also postulated to act at a membrane level influencing
signal transduction of several hormones or growth factors
like PTH, IGFII and Adenosine A2a producing the
amplification of their transmembrane receptors. PEMF
enhances osteogenic effects of BMP-2 on MSCs cultured
on calcium phosphate substrates, suggesting that PEMF
will improve MSC response to BMP-2 in vivo in a bone
environment (8).
In one of our previous study, we demonstrated
that PEMF are able to induce changes in gene
expression in human osteoblast-like cells (MG-63) (9).
Particularly, PEMFs appear to induce cell proliferation
and differentiation. Furthermore and they promote
extracellular matrix production and mineralization while
decreasing matrix degradation and absorption. In order
to get more information on the mechanism of action of
PEMFs, in the present work we asked whether a) PEMFs
are able to induce changes in the production of growth
factors in human osteoblasts and in bone marrow derived
human mesenchymal stem cells (BM-hMSCs) b) the
production of growth factors induced by PEMFs varies at
different time points (12 and 24 hrs) c) PEMFs induce a
different production of growth factors in cells at different
stages of differentiation like BM-hMSCs and human
osteoblasts.
Mo, USA), for immunofluorescence and PEMFs stimulation.
Immunofluorescence
Cells were washed with PBS for three times and fixed
with cold methanol for 5 min at room temperature. After
washing with PBS, cells were blocked with bovine albumin 3%
(Sigma Aldrich, Inc., St Louis, Mo, USA) for 30 min at room
temperature. The cells were incubated overnight sequentially
at 4 °C with primary antibodies raised against CD105 1:200,
mouse (BD Biosciences, San Jose, CA, USA), CD73 1:200,
mouse (Santa Cruz Biotecnology, Inc., Santa Cruz, CA, USA),
CD90 1:200, mouse (Santa Cruz Biotecnology, Inc., Santa Cruz,
CA, USA), CD34 1:200, mouse (Santa Cruz Biotecnology,
Inc., Santa Cruz, CA, USA). They were washed with PBS and
incubated for 1 h at room temperature with secondary antibody
conjugated-Rodamine goat anti-mouse 1:200 (Santa Cruz
Biotecnology, Inc., Santa Cruz, CA, USA). Subsequently, cells
were mounted with the Vectashield Mounting Medium with
DAPI (Vector Laboratories, Inc., Burlingame, CA, USA) and
observed under a fluorescence microscope (Eclipse TE 2000-E,
Nikon Instruments S.p.a., Florence, Italy).
F
O
P
O
R
MATERIALS AND METHODS
Mesenchymal stem cells preparation
Bone marrow derived human mesenchymal stem cells (BMhMSCs) were obtained from healthy adult volunteers (mean age
45 years).
Bone Marrow were collected in heparinized tubes, was
diluted 1:3 with phosphate buffered saline (PBS) (Lonza,
Basel, Switzerland) and layered over a Ficoll-Histopaque
gradient (1.077g/ml; Sigma, St. Louis, MO). The low-density
mononuclear cells were washed twice in PBS, counted and
plated at 106/cm2 in cell culture flasks (Falcon BD, Bedford,
MA, USA) in Dulbecco’s Modified Eagle’s Medium (DMEM)
(Lonza, Basel, Switzerland) supplemented with 20% heat
inactivated fetal bovine serum (FBS) (Lonza, Basel, Switzerland)
and antibiotics (100 U/ml penicillin, 100 μg/ml streptomicin)
(Sigma Aldrich, Inc., St Louis, Mo, USA), and then incubated
at 37°C in a humidified atmosphere with 5% CO2. After 1 week,
the non-adherent cells were removed by replacing the medium
supplemented with 10% FBS. When the cultures were near
confluence (after 2 weeks) the cells were recovered, by treatment
with 1X trypsin/EDTA solution (Sigma Aldrich, Inc., St Louis,
Osteoblast culture
Fragments of bone derived from healthy volunteers
patients were sampled during operation of hip substitution
and transferred in 75 cm2 culture flasks containing DMEM
medium supplemented with 20% fetal calf serum, antibiotics
(Penicillin 100 U/ml and Streptomycin 100 micrograms/ml
- Sigma Aldrich, Inc., St Louis, Mo, USA) and amminoacids
(L-Glutamine - Sigma Aldrich, Inc., St Louis, Mo, USA). Cells
were grown in a humidified atmosphere of 5% CO2 at 37°C. The
medium was changed the next day and every 3 days thereafter.
After 15 days, the pieces of bone tissue were removed from the
culture flask. Cells were harvested after 30 days of incubation.
PEMFs stimulation
BM-hMSCs and human osteoblasts were exposed to PEMFs
(pulsed electromagnetic fields) for 12 and 24 hours using
PEMFs generator system (Igea, Carpi, Italy). The solenoids
were powered using a Biostim pulse generator (Igea, Carpi,
Italy), a pulsed electromagnetic field (PEMF) generator. The
electromagnetic bioreactor applied a PEMF to the cells on the
scaffold surface with the following characteristics: intensity of
the magnetic field 2±0.2 mT, amplitude of the induced electric
tension 5±1 mV, signal frequency 75±2 Hz, and pulse duration
1.3 ms.
Control cultures were maintained in another incubator in the
same culture conditions.
After 12 and 24 hours, when cultures were sub-confluent,
cells were processed for RNA extraction.
Superarray
RNA obtained from treated cells and controls was extracted
using Nucleospin RNA II (Machery-Nagel, Düren, Germany).
RNA amount was estimated by using the Quant-iT™ RNA
Assay Kit (Invitrogen Corp., Carlsbad, CA) and the Qubit™
fluorometer (Invitrogen Corp., Carlsbad, CA).
1 µg of each sample was treated with the “Genomic
DNA elimination mixture” included in the RT2 First Strand
Kit (SABiosciences, MD, USA), to eliminate the genomic
F
97 (S)
European Journal of Inflammation
contamination.
RNA was then converted to cDNA using the RT2 First Strand
Kit (SABiosciences, MD, USA). The template was then added
to a ready to use RT2 SYBR Green/ROX qPCR Master Mix
(SABiosciences, MD, USA), containing dNTP, Hot start Taq
Polymerase and its appropriate buffer, SYBR® Green detector.
The mixture was then aliquotated in each well of the same plate
containing pre-dispensed gene-specific primer set. Each array,
RT Prpfiler PCR Array Human Growth Factor (SABiosciences,
MD, USA) contains a panel of 96 primer sets belonging o the
Human Growth Factor pathway.
The PCR was performed in the ABI PRISM 7500 (Applied
Biosystems, Foster City, CA, USA). The amplification profile
was initiated with 10-minute incubation at 95°C, followed by
two-step amplification of 15 seconds at 95°C and 60 seconds at
60°C for 40 cycles. Quantification was done with the delta/ delta
calculation method (10).
of hematopoietic origin, CD34 (Figure 1).
Superarray
Twenty seven genes out of the 84 studied were
significantly over and down expressed (Table I). We
considered those genes up or down regulated that are
related to bone formation or inflammation.
a) BM-hMSCs
MIF, BMP3A, BMP7 (respectively -2.08, -26.39, 36.56) were down expressed after 12 hrs of stimulation
with PEMFs while after 24 hrs their values were similar
in stimulated and control.
IGF1 was down expressed both after 12 and after 24
hrs of stimulation.
BMP4 and VEGF-D were significantly over expressed
by PEMF only after 24 hrs of stimulation, while GMCSF
was down regulated by PEMFs both after 12 and after 24
hrs.
IL-11 and IL-4 were significantly up regulated after
12 hrs, while IL-10 was up-regulated after 24 hrs of
stimulation.
PEMFs induced the over expression of IL-2 both at 12
F
O
O
R
RESULTS
Immunofluorescence
BM-hMSCs were characterized by immunofluorescence.
The cell surfaces were positive for mesenchymal stem cell
marker, CD105, CD90 and CD73 and negative for markers
P
Table I. Up- and down-regulated genes.
Gene
CITOCHINE
MIF/MIS
BMP1
BMP3A
BMP4
OP1(BMP7)
MCSF (CSF1)
GMCSF (CSF2)
GCSF (CSF3)
NGF
FSP/GRO1
FGF1/AEGF/ECGF
FGF11/FHF 3
FGF2/BFGF/FGFB
FIGF/VEGF-D
BMP3B
BMP11
IGF1A
IGF2 (11 O FG3)
IL-11
IL-10
IL-1A/IL-1
IL-1B/IL-1
IL-2/TCGF
IL-4/BCGF1
PDGFC
TGFB1
TNNT1
MSC midollo
12h
24h
-2,08
-1,19
1,25
-1,06
-26,39
1,06
2,16
1,57
-36,56
1,06
1,81
1,99
93,57
-59,3
-2,87
1,06
-1,41
1,87
1,79
1,85
1,32
1,05
3,41
2,33
-1,4
-1,06
2,33
-1,06
-1,36
-1,42
1,3
1,49
-8,59
-3,27
1,05
-1,05
17,73
1,06
2,48
1,8
1,31
1,46
1,01
-1,56
49,45
55,33
255,65
1,14
-1,31
1,11
1,09
1,32
1,27
1,06
Osteoblasti
12h
24h
-2,9
2,02
2,84
1,4
-31,47
1,58
2,88
14,97
-37,95
1,51
2,05
1,2
-6,69
-2,09
24,83
1,26
2,84
1,21
2,69
1,06
2,27
1,16
2,69
-3,11
2,09
-1,35
7,75
-1,82
-11,41
1,26
2,86
1,26
3,2
-3,99
3,11
-2,76
-2,52
-46,4
-23,2
1,67
5,26
-1,98
-2,36
-1,09
-315,61
1,88
-84,8
-1,11
2,45
1,35
2,24
1,61
-33,87
-20,48
98 (S)
V. SOLLAZZO ET AL.
O
R
F
O
Fig. 1. BM-hMSCs by indirect immunofluorescence (Rodamine). Cultured cells were positive for the mesenchymal stem cell marker
CD73 (b), CD90 (c), CD105 (d) and negative for the hematopoietic markers CD34 (a). Nucleuses were stained with DAPI. Original
magnification x40
P
and 24 hrs, while TGFb1, PDGFC, and IGF2 expression
was not significantly altered by PEMFs.
b) Human osteoblasts
While MIF was down regulated after 12 hrs of
stimulation at 24 hrs it was over expressed if compared
to control. On the contrary, IGF1 and IGF2 were over
expressed after 12 hrs of stimulation while decreased after
24 hrs.
BMP3A and BMP7 were significantly over expressed
after 24 hrs of stimulation.
GMCSF was down regulated both after 12 and after 24
hrs being less down regulated at 24 hrs.
IL-11 was down expressed more after 24 hrs than after
12 hrs of stimulation.
IL1-10 and IL-4 were down expressed after 24 hrs of
stimulation.
IL-2 was overexpressed after 12 hrs of stimulation
while after 24 hrs was similar to the control.
BMP4 was over expressed by PEMFs stimulation
both after 12 and after 24 hrs, while VEGF-D was over
expressed after 24 hrs.
PDGFC and TGFb1 were over expressed after 24 hrs
of stimulation.
DISCUSSION
The idea of electrical stimulation with the purpose of
eliciting fracture healing is based on the seminal study
of Fukada and Yasuda in which they gave a description
of electrical fields generated by mechanical stress on
bone (11). They suggested that stress on the crystalline
components of bone produced a current flow that triggers
healing processes. Yasuda demonstrated that electrical
signals similar to those generated by mechanical stress
could enhance fracture healing. PEMFs are an inductive
system for the electrical stimulation of osteogenesis. They
are commonly used in clinical practice to treat delayed
union, non union, avascular necrosis of the femoral head
because they are able to promote osteogenesis when it
has stopped. The application of PEMFs is now accepted
also in the therapy of the pathologies of the cartilage,
because they are demonstrated to have an Adenosine
A2A Receptor Agonist Activity, to favor chondrocyte
proliferation and to reverse the catabolic effect of IL-1β
on the cartilage matrix.(7). Although considerable basic
and clinical research on PEMFs has been reported, their
mechanism of action is not completely clear.
In the our previous study we demonstrated that PEMFs
can affect the expression of important genes related to
bone formation in MG-63 osteoblastic cell lines in vitro.
Although the effects of PEMF on Human Mesenchymal
Stem Cells (hMSC) (8) and on human osteoblasts were
already studied (12), in the present literature there are
no studies comparing the effect of PEMFs in human
osteoblasts and hMSC on the expression of a wide range
of growth factors.
F
99 (S)
European Journal of Inflammation
Given the fact that growth factors are known to be
crucial to start biomolecular mechanisms that regulate cell
replication and differentiation (13, 14) we wanted to verify
if PEMFs are able a) to induce changes in the production
of growth factors in HO and in BM-hMSCs b) if PEMFs
induce a different production of growth factors in cells at
different stages of differentiation c) if the production of
growth factors induced by PEMFs varies at different time
points (12 hrs and 24 hrs).
We acknowledge the following limitation: in order to
see the early effect of PEMFs we have studied cell cultures
only after 12 and 24 hrs of stimulation. Although in our
previous study we have seen a peak of DNA synthesis in
human osteoblasts after 18 hrs of stimulation, perhaps it
would be useful to investigate the effects of PEMFs also
after prolonged stimulation time.
Our data demonstrate that PEMFs are able to induce
significative changes in the production of cytokines both
in human osteoblasts and in BM-hMSCs. Moreover,
the production of growth factors varies both in the two
different cell types and depending on the time. PEMFs
seem to elicit bone formation by promoting or reducing
the expression or different growth factors both in human
osteoblast and BM-hMSCs.
PEMFs induced a different expression of cytokines
in human osteoblasts and in BM-hMSCs. In human
osteoblasts, PEMFs exposure induced the over expression
of bone forming growth factors (BMP4, VEGF-D, IGF1,
IGF2, PDGFC, TGFB1). BMP4 shows an osteogenic
effect (15) and VEGF act synergistically with BMP4
playing an important role in bone formation elicited by
BMP4. IGF1 is essential for coupling matrix biosynthesis
to sustained mineralization and IGF1 and IGF2 are
potent anabolic regulators of bone metabolism and
induce osteogenic differentiation and bone formation
(16). Platelet-derived growth factor (PDGF) stimulates
chemotaxis and proliferation of osteoblasts, and induces
bone formation in vivo. However, prolonged exposure to
PDGF, which is likely to occur in chronic inflammation,
would inhibit differentiated osteoblast function and limit
bone regeneration. Transforming growth factor-beta (TGF
beta) stimulates the expression of extracellular matrix
proteins and is a local regulator of bone growth (17).
On the other hand, PEMFs in osteoblasts determined the
down regulation of cytokines that contrast bone formation
(MIF, BMP3A). MIF is an important regulator of innate
and adaptive immunity and is known that MIF inhibit
osteoclast activity in vitro and trabecular bone formation
in vivo. BMP3 is an inhibitor of osteogenic BMPs and can
signal through a TGF-beta/activin pathway and it shows a
negative effect on osteogenesis (18). PEMFs in osteoblasts
also determined the down regulation of cytokines that
promote inflammation processes (GMCSF, IL11, IL10,
IL2, IL4). GM-CSF induces osteoclastogenesis (19). IL11 is important for osteoclastognesis through the direct
activation of osteoclast precursors. IL-11 is required
for normal bone turnover and normal trabecular bone
mass. The deficiency of IL-11 results in the increasing
of trabecular bone mass (20). Interleukin-10 (IL-10), an
anti-inflammatory cytokine, has been shown to inhibit
osteoclast formation and bone resorption reducing
RANKL-mediated osteoclastogenesis. IL-2 supports
osteoclast formation (21). Interleukin (IL)-4 is closely
related cytokine known to inhibit osteoclast formation
by targeting osteoblasts to produce an inhibitor,
osteoprotegerin (OPG), as well as by directly targeting
osteoclast precursors (22). hMSC showed a different
response to PEMFs as compared to human osteoblasts.
In hMSV PEMFs induced the expression of cytokines
that promotes inflammation processes (GMCFS, IL11,
IL10, IL2, IL4). In BM-hMSCs ostoinductive cytokines
sometimes were up regulated (BMP4 and VEGFD) or
down regulated (IGF1), In BM-hMSCs PEMFs reduced
significantly the expression of cytokines that contrast
bone formation (MIF, BMP3A).
Our data showed a down regulation of BMP7 both
in osteoblast and in BM-hMSCs. BMP7 is known to
stimulate osteogenetic processes in human osteoblast
while it is known that BMP7 expression is reduced in the
early stages of osteoblastic differentiation of BM-hMSCs
(23). Probably PEMFs do not act through a pathway
involving BMP7 in human osteoblasts.
In conclusion, PEMFs seem to act through the
activation of a series of growth factors which is not
necessarily simultaneously but may vary depending on
time. For example, while after 12 hrs of stimulation in
human osteoblasts IGF1 and IGF2 were over expressed,
after 24 hrs of stimulation the same growth factors were
down expressed. Likewise, after 12 hrs of stimulation
BMP4 was slightly over expressed by PEMF while after
24 hrs a seven fold expression of the same growth factor
was seen. It is difficult to recognize a strong relationship
between the behavior of expression of a single growth
factor- Our data demonstrate that PEMFs exert their
effects by activating or suppressing a large number of
growth factors simultaneously with different functions,
rather than a single or a few growth factors with the same
function, and that this variation of expression varies in the
time. PEMFs act in a different way in human osteoblasts
and on BM-hMSCs depending on the different kind of
nature of the cells tested. The target of PEMFs does not
seem to be a single growth factor but a large number of
growth factors. PEMFs seem to act on the biological
system by balancing the expression of growth factors with
the global effect of an improvement of the metabolism of
an already committed cell.
P
O
R
F
O
100 (S)
V. SOLLAZZO ET AL.
ACKNOWLEDGEMENTS
The authors thank PRIN 2008 (F.C.) and Regione
Emilia Romagna, Programma di Ricerca Regione
Università, 2007–2009, Area 1B: Patologia osteoarticolare:
ricerca pre-clinica e applicazioni cliniche della medicina
rigenerativa, Unità Operativa n. 14.
REFERENCES
1.
Benazzo F, Zanon G, Pederzini L, Modonesi F, Cardile C,
Falez F, Ciolli L, La Cava F, Giannini S, Buda R, Setti S,
Caruso G, Massari L. Effects of biophysical stimulation in
patients undergoing arthroscopic reconstruction of anterior
cruciate ligament: prospective, randomized and double
blind study. Knee Surg Sports Traumatol Arthrosc 2008;
16:595-601.
2. Zorzi C, Dall’Oca C, Cadossi R, Setti S. Effects of
pulsed electromagnetic fields on patients’ recovery after
arthroscopic surgery: prospective, randomized and doubleblind study. Knee Surg Sports Traumatol Arthrosc 2007;
15:830-4.
3. Goodman EM, Greenebaum B, Marron MT. Effects of
electromagnetic fields on molecules and cells. Int Rev
Cytol 1995; 158:279-338.
4. Cadossi R, Bersani F, Cossarizza A, Zucchini P, Emilia G,
Torelli G, Franceschi C. Lymphocytes and low-frequency
electromagnetic fields. Faseb J 1992; 6:2667-74.
5. Sollazzo V, Traina GC, DeMattei M, Pellati A, Pezzetti F,
Caruso A. Responses of human MG-63 osteosarcoma cell
line and human osteoblast-like cells to pulsed electromagnetic
fields. Bioelectromagnetics 1997; 18:541-7.
6. Brighton CT, Wang W, Seldes R, Zhang G, Pollack SR.
Signal transduction in electrically stimulated bone cells. J
Bone Joint Surg Am 2001; 83-A:1514-23.
7. Aaron RK, Ciombor DM, Keeping H, Wang S, Capuano A,
Polk C. Power frequency fields promote cell differentiation
coincident with an increase in transforming growth factorbeta(1) expression. Bioelectromagnetics 1999; 20:453-8.
8. Schwartz Z, Simon BJ, Duran MA, Barabino G, Chaudhri
R, Boyan BD. Pulsed electromagnetic fields enhance
BMP-2 dependent osteoblastic differentiation of human
mesenchymal stem cells. J Orthop Res 2008; 26:1250-5.
9. Sollazzo V, Palmieri A, Pezzetti F, Massari L, Carinci
F. Effects of pulsed electromagnetic fields on human
osteoblastlike cells (MG-63): a pilot study. Clin Orthop
Relat Res; 468:2260-77.
10. Livak KJ, Schmittgen TD. Analysis of relative gene
expression data using real-time quantitative PCR and the
2(-Delta Delta C(T)) Method. Methods 2001; 25:402-8.
11. Fukada E, Yasuda I. On the piezoelectric effect of bone J
Phisiol Soc Jpn 1957; 12:1158-62.
12. Aaron RK, Boyan BD, Ciombor DM, Schwartz Z, Simon
BJ. Stimulation of growth factor synthesis by electric and
electromagnetic fields. Clin Orthop Relat Res 2004:30-7.
13. Frost HM. The biology of fracture healing. An overview
for clinicians. Part I. Clin Orthop Relat Res 1989:283-93.
14. Frost HM. The biology of fracture healing. An overview
for clinicians. Part II. Clin Orthop Relat Res 1989:294309.
15. Wright V, Peng H, Usas A, Young B, Gearhart B, Cummins
J, Huard J. BMP4-expressing muscle-derived stem cells
differentiate into osteogenic lineage and improve bone
healing in immunocompetent mice. Mol Ther 2002; 6:
169-78.
16. Kalajzic I, Staal A, Yang WP, Wu Y, Johnson SE, Feyen
JH, Krueger W, Maye P, Yu F, Zhao Y, Kuo L, Gupta
RR, Achenie LE, Wang HW, Shin DG, Rowe DW.
Expression profile of osteoblast lineage at defined stages
of differentiation. J Biol Chem 2005; 280:24618-26.
17. Shur I, Lokiec F, Bleiberg I, Benayahu D. Differential gene
expression of cultured human osteoblasts. J Cell Biochem
2001; 83:547-53.
18. Bahamonde ME, Lyons KM. BMP3: to be or not to be a
BMP. J Bone Joint Surg Am 2001; 83-A Suppl 1:S56-62.
19. Park BK, Zhang H, Zeng Q, Dai J, Keller ET, Giordano T,
Gu K, Shah V, Pei L, Zarbo RJ, McCauley L, Shi S, Chen
S, Wang CY. NF-kappaB in breast cancer cells promotes
osteolytic bone metastasis by inducing osteoclastogenesis
via GM-CSF. Nat Med 2007; 13:62-9.
20. Sims NA, Jenkins BJ, Nakamura A, Quinn JM, Li R,
Gillespie MT, Ernst M, Robb L, Martin TJ. Interleukin-11
receptor signaling is required for normal bone remodeling.
J Bone Miner Res 2005; 20:1093-102.
21. Horwood NJ, Kartsogiannis V, Quinn JM, Romas E,
Martin TJ, Gillespie MT. Activated T lymphocytes support
osteoclast formation in vitro. Biochem Biophys Res
Commun 1999; 265:144-50.
22. Yamada A, Takami M, Kawawa T, Yasuhara R, Zhao B,
Mochizuki A, Miyamoto Y, Eto T, Yasuda H, Nakamichi
Y, Kim N, Katagiri T, Suda T, Kamijo R. Interleukin-4
inhibition of osteoclast differentiation is stronger than that
of interleukin-13 and they are equivalent for induction of
osteoprotegerin production from osteoblasts. Immunology
2007; 120:573-9.
23. Lavery K, Hawley S, Swain P, Rooney R, Falb
D, Alaoui-Ismaili MH. New insights into BMP-7
mediated osteoblastic differentiation of primary human
mesenchymal stem cells. Bone 2009; 45:27-41.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
MANDIBLE BROWN TUMOR CAUSED BY PRIMARY HYPERPARATHYROIDISM
A. SCARANO1, B SINJARI 1, L. ARTESE1, S. FANALI1, F. CARINCI2
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
F
O
2
Brown tumor is a uni or multi-focal bone lesion, which represents the terminal stage of the hyperparathyroidismdependent bone pathology. It often appears as an expansive osteolytic lesion of the bone, commonly in the mandible, ribs,
pelvis and femur. A 56 year-old male patient presented with an asymptomatic unilocular radiolucent lesion of the right
mandible without teeth. The lesion had a diameter of about 3 cm, had sharply delimited margins and was surrounded
by an osteosclerotic rim. Under local anesthesia, the lesion was extracted surgically. The microscopic diagnosis was
brown tumor of the mandible. The following report describes a patient with secondary hyperparathyroidism who
developed a brown tumor of the mandible, discuss the differential diagnosis, and review the literature.
O
R
Brown tumor is a uni or multi-focal bone lesion, which
represents the terminal stage of the hyperparathyroidismdependent bone pathology (1-3).
These bone lesions are classic skeletal manifestations
of hyperparathyroidism usually seen in severe forms with
subperiosteal bone resorption.
This pathological condition shows a bone catabolism
enhancement, due to increased level of PTH (4).
Brown tumor is a localized form of fibrouscystic osteitis associated with primary or secondary
hyperparathyroidism. Hyperfunction of the thyroid
gland, or hyperthyroidism, is characterized by excessive
amounts of thyroid hormones T3 (tiiodothyronine) and T4
(thyroxine) or by increased levels of thyroid-stimulation
hormones (TSH) (5).
Hyperparathyroidism is classified in primary and
secondary one.
Primary hyperparathyroidism usually results from a
benign tumor (adenoma) of one of the four parathyroid
gland, which have hyperplastic parathyroid gland
that secrete excess PTH, serum calcium and alkaline
phosphatase.
The combination of hypercalcemia and elevated
serum level of PTH is diagnostic of primary
hyperparathyroidism.
Secondary hyperparathyroidism is a condition that
results when the parathyroid glands are stimulated to
procedure increased amounts of parathyroid hormone to
correct abnormally low serum calcium levels. Chronic
renal disease and osteomalacia are the most common
condition in which the hypocalciemic state is a feature
(5).
The bone lesion secondary to a hyperparathyroidism
comprise two types of cystic lesions: true bone cysts and
“Brown tumors”.
Despite the fact that secondary hyperparathyroidism
occurs in vitamin D deficiency rickets, no cases of rickets
with brown tumor have so far been described.
The two lesions have the same radiologic appearance,
but bone cysts remain indefinitely after successful surgery,
whereas brown tumors resolve and re-mineralized. The
subperiosteal resorption and bony demineralization are
reversible (1).
In other cases, there is a complete absence of clinical
symptoms and diagnosis may be totally coincidental
during the radiological examinations.
Brown tumor is a lesion that often shows an area of
exaggerated bone resorption. Symptoms are caused by
the considerable dimensions of the brown tumor and its
localization: in the jawbones it may present sometimes
painful, hard and clearly palpable swellings; if large,
the tumor may deform the appearance of the bone
segments affected or alter the function of the masticatory
apparatus.
Because of the increased longevity of patients with
chronic renal failure, it is now more commonly observed
P
Key Words: Brown tumor, bone lesion, hyperparathyroidism
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C. Section Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
101
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
102 (S)
A. SCARANO ET AL.
(6).
Although the oral manifestations of this condition are
not specific, they are consistent. In children, premature
or accelerated exfoliation of deciduous teeth and
concomitants rapid eruption of permanent teeth are often
noted. In adults, osteoporosis of the mandible and maxilla
may be found. Burning tongue as well as other nonspecific
symptoms and increase of dental erosion (1).
We
describe
a
patient
with
secondary
hyperparathyroidism who developed a brown tumour
of the mandible, discuss the differential diagnosis, and
review the literature.
CASE REPORT
44,0 (normal range, 38,0 to 52,0); hemoglobin, 15 g/dl
(normal range, 14,0 to 18,0); and white blood cell count,
4,3x109/L (normal range, 4,0x109/L to 10x109/L)
Electrolyte analisis showed sodium level of 155 mEq/l
(normal range, 135 mEq/l to 150 mEq/l); potassium, 6,3
mEq/l (normal range, 3,5 mEq/l to 5 mEq/l); calcium
10,4 mg%, (normal range, 8 mg%l to 11 mg % l);
phosphorum, 2,2 mg% (normal range, 2,5 mg%l to 4,5
mg%l); creatine, 1,1 mg% (normal range, 0,6 mg%l to
1,3 mg%l); magnesium, 2,1 mg/dl (normal range, 1,5
mg/dl to 2,5 mg/dl); and alkaline phosphatase, 1,5 mg/dl
(normal range, 0 mg/dll to 3 mg/dl).
The patient’s serum protein level was 7,4 gr/dl
(normal range, 6,4 gr/dl to 8,2 gr/dl); albumin (normal
range, 8 mg%l to 11 mg%l) ; uric acid (normal range, 8
mg%l to 11 mg%l);
The serum of creatinine, urea, alkaline phosphatase,
total protein and albumin excludes chronic renal failure.
Blood pressure was 120/60 mm Hg; pulse, 60 beats
per minute and regular; respiratory rate, 18 breaths per
minute; and temperature, 37 ° C. The results of the
examination were normal.
F
O
O
R
A 56 year-old male patient presented with an
asymptomatic unilocular radiolucent lesion of the right
mandible without teeth.
The lesion had a diameter of about 3 cm, had
sharply delimited margins and was surrounded by an
osteosclerotic rim (Fig. 1). Under local anesthesia, the
lesion was extracted surgically.
Histological examination of biopsy taken from the mass
revealed by a cell population of rounded or spindle-like
mononucleate elements, mixed with a certain number
of plurinucleate giant cells, resembling osteoclastic
cells, among which recent haemorrhagic infiltrates and
hemosiderin deposits (hence the brown color) were often
found (fig. 2-3). The microscopic diagnosis was brown
tumor of the mandible. The lesion was completely removed.
No recurrences were present at a 1 year follow-up.
Clinical history of lesions were suggestive for the
presence of a systemic disease, laboratory data allowed a
secondary hyperparathyroidism diagnosis.
Laboratory investigation was remarkable for elevated
serum levels of creatinine, urea, alkaline phosphatase and
parathyroid hormone (PTH).
Pertinent laboratory findings as follow: hematocrit,
P
Fig. 1. Panoramic radiograph showing osteolytic lesions in the
right sides of the mandible.
Fig. 2. Multinucleated giant cell into the fibrous stroma
(hematoxylineosin, original magnification X400).
Fig. 3. A lesion of HPT showing resorption of bone and a
fibrous stroma with multinucleated giant cells and hemorrhage
throughout the lesion (hematoxylin-eosin, original magnification
X100).
F
103 (S)
European Journal of Inflammation
DISCUSSION
Classic skeletal lesions, which are bone resorption,
bone cysts, brown tumors and generalized osteopenia,
now occur in fewer than 5% of cases (7). The ribs,
clavicles, pelvic griddle, and the mandible are the most
often involved bones (8, 9). Maxillofacial brown tumors
are rare; when they occur in this region, they usually
involve the mandible, whereas the maxilla is only rarely
affected (10-17).
Brown tumors (osteoclastomas) are histologically
benign lesions that are caused by primary or secondary
hyperparathyroidism. However, theses tumors can behave aggressively and can be destructive (18). Secondary
hyperparathyroidism is a frequent complication of chronic
renal failure. The disease is characterized by bone pain
and pathologic fracture. Facial deformation tends to be the
first clinical manifestation, and typically occurs when the
lesion reaches 30 mm in diameter (19).
It is well known that chronic renal failure can cause
renal osteodystrophy due to secondary HP. (20, 21).
The incidence of hyperparathyroidism in patients with
chronic renal failure are 18% after 1 years on dialysis to
92% after more than 2 years (1).
Skeletal brown tumors are relatively uncommon, and
brown tumors that involve the ribs, clavicle, pelvic girdle,
while occurs maxillary or mandibular are considered very
rare (2).
Brown tumor is a focal lesion found within areas
where osteoclastic and osteoblastic activity causes
bone resorption with fibrous replacement of the marrow
and thinning the cortex (8). It should be considered in
differential diagnosis with many lesions that occur in the
mandible and have a cyst-like radiographic appearance.
Most radicular cysts appear as round or pear-shaped,
unilocular, lucent lesions in the periapical region.
The case treated from us presented an edentulous
lucent lesion not in relationships with the teeth, which
appearance was easily mistakable with a residual cyst.
Non-odontogenic lesions that mimic odontogenic
lesions include benign fibro-osseous lesions (conventional
or juvenile ossifying fibroma, focal or periapical
cemento-osseous dysplasia, florid osseous dysplasia),
traumatic bone cyst, lingual salivary gland inclusion
defect, central giant cell granuloma, brown tumor of
hyperparathyroidism, arteriovenous malformation, and
mucoepidermoid carcinoma.
Differential diagnosis is possible only by comparative
evaluation of clinical, radiological, biochemical and
histological evidences. Computerized tomography is
helpful in identifying extend of the lesion. Bone and
parathyroid scans can also aid in the diagnosis. However,
the diagnosis is suggested by clinical history and
confirmed by laboratory investigations including calcium,
phosphorus, alkaline phosphatase and parathormone
assays (18). Brown tumor regression after successful
parathyroid tumor resection has been frequently
reported (14, 16, 22). However, diverse authors have
recommended tumor resection because they consider that
the lesion would require a long time period to regression
(15). Corticosteroids have also been utilized to reduce
tumor size (13).
F
O
ACKNOWLEDGMENTS
This work was partially supported by the National
Research Council (C.N.R.), Rome, Italy, and by the
Ministry of University, Research, Science and Technology
(M.U.R.S.T.), Rome, Italy.
P
O
R
REFERENCES
1.
Mirra JM. Bone Tumor: Clinical, radiologic, and
Pathologic Correlations. Philadelphia, PA: Lea & Febiger;
1989.
2. Shafer WG, Hine MK, Levy BL. Textbook of oral
pathology Philadelphia, PA,: Saunders; 1983.
3. Murray RO, Stocker DJ. A textbook of radiology and
imaging. Edimburgh: Scotland, Churchill Livingstone;
1987.
4. Okada H, Davies JE, Yamamoto H. Brown tumor of the
maxilla in a patient with secondary hyperparathyroidism:
a case study involving immunohistochemistry and electron
microscopy. J Oral Maxillofac Surg 2000; 58:233-8.
5. Scully C, Cawson RA. Medical problems in dentistry.
Butterworth-Heineman, UK; 1998.
6. Chaouat Y, Chaouat D. [Primary hyperparathyroidism.
History]. Rev Rhum Mal Osteoartic 1988; 55:475-8.
7. Horowitz M, Wishart JM, Need AG, Morris HA, Nordin
BE. Primary hyperparathyroidism. Clin Geriatr Med 1994;
10:757-75.
8. Keyser JS, Postma GN. Brown tumor of the mandible. Am
J Otolaryngol 1996; 17:407-10.
9. Rosenberg EH, Guralnick WC. Hyperparathyroidism.
A review of 220 proved cases with spcial emphasis on
findings in the jaws. Oral Surg 1962; 157:82-93.
10. Rubin MR, Livolsi VA, Bandeira F, Caldas G, Bilezikian
JP. Tc99m-sestamibi uptake in osteitis fibrosa cystica
simulating metastatic bone disease. J Clin Endocrinol
Metab 2001; 86:5138-41.
11. Mishra SK, Agarwal G, Kar DK, Gupta SK, Mithal
A, Rastad J. Unique clinical characteristics of primary
hyperparathyroidism in India. Br J Surg 2001; 88:708-14.
104 (S)
A. SCARANO ET AL.
12. Lessa MM, Sakae FA, Tsuji RK, Filho BC, Voegels RL,
Butugan O. Brown tumor of the facial bones: case report
and literature review. Ear Nose Throat J 2005; 84:432-4.
13. Martinez-Gavidia EM, Bagan JV, Milian-Masanet MA,
Lloria de Miguel E, Perez-Valles A. Highly aggressive
brown tumour of the maxilla as first manifestation of
primary hyperparathyroidism. Int J Oral Maxillofac Surg
2000; 29:447-9.
14. Kar DK, Gupta SK, Agarwal A, Mishra SK. Brown tumor
of the palate and mandible in association with primary
hyperparathyroidism. J Oral Maxillofac Surg 2001; 59:
1352-4.
15. Yamazaki H, Ota Y, Aoki T, Karakida K. Brown tumor
of the maxilla and mandible: progressive mandibular
brown tumor after removal of parathyroid adenoma. J Oral
Maxillofac Surg 2003; 61:719-22.
16. Corbetta S, Rossi D, D’Orto O, Vicentini L, Beck-Peccoz P,
Spada A. Brown jaw tumors: today’s unusual presentation
of primary hyperparathyroidism. J Endocrinol Invest 2003;
26:675-8.
17. Daniels JS. Primary hyperparathyroidism presenting as a
palatal brown tumor. Oral Surg Oral Med Oral Pathol Oral
Radiol Endod 2004; 98:409-13.
18. Guney E, Yigitbasi OG, Bayram F, Ozer V, Canoz O.
Brown tumor of the maxilla associated with primary
hyperparathyroidism. Auris Nasus Larynx 2001; 28:36972.
19. Potter BJ, Tiner BD. Central giant cell granuloma. Report
of a case. Oral Surg Oral Med Oral Pathol 1993; 75:2869.
20. Bricker NS, Bourgoignie J, Weber H, Schmidt RW,
Slatopolsky E. Pathogenesis of the uremic state: a new
perspective. Adv Nephrol Necker Hosp 1972; 2:263-76.
21. Massry SG, Ritz E. The pathogenesis of secondary
hyperparathyroidism of renal failure. Is there a
controversy? Arch Intern Med 1978; 138 Spec No:853-6.
22. Suarez-Cunqueiro MM, Schoen R, Kersten A, Klisch J,
Schmelzeisen R. Brown tumor of the mandible as first
manifestation of atypical parathyroid adenoma. J Oral
Maxillofac Surg 2004; 62:1024-8.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
POSTURE-STABILOMETRIC VALUATION IN RUGBY PLAYERS
AFTER MANDIBULAR REPOSITIONING
M. D’ATTILIO1, D. RODOLFINO1, C. CHIMENTI2,
A. SCARANO1, F. FESTA1, S. FANALI1, F. CARINCI3
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
2
Department of Surgical Sciences, Università degli Studi di L’Aquila, Italy
3
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
The aim of the present study was to investigate the effect of the mandibular repositioning on the sport
performance of rugby players, after posture-stabilometric screening. Twenty healthy rugby players (25 years on the
average), with Temporomandibular Disorders (TMD), were included in the study. Posture–stabilometric valuation
was performed with a combination of different visual conditions (eyes open/closed) and mandibular positions (Rest
Position (RP) /Maximum Intercuspidation /mandibular repositioning with a wax non centric, centric and with
an increase of the vertical dimension). Twelve players, which improved their posture-stabilometric arrangement
after mandibular repositioning, were treated with Positioner, and underwent strength and speed testing before
(T0) and after (T1) the use of the Positioner. For all tests there was a statistically significant improvement of the
performance (P<0.05). The mandibular repositioning can produce an increase of the levels of strength, postural
stability, resistance to fatigue, and a reduction of the muscular trauma.
O
R
P
The interest toward the relationship between occlusion
and body posture has been increasing over the last years
(1-10). Many authors supported such a relationship on
the basis of anatomical and neuromuscular connections
between the cervical-cranium-mandibular system and
the rest of the body (2-5, 7). The connection role of the
hyoid bone has been extensively assessed (11). About the
neuro-functional correlations, the interactions between
the descending nucleus of trigeminal nerve and the
spinal tract have been attested (6, 8, 12, 13). Moreover,
evidences exist to support the role of the visual, vestibular
and somatosensorial inputs, integrated in a complex
regulation system, in the maintenance of the posture
of the whole body. Some authors have suggested the
opportunity to improve the postural arrangement of the
body by operating on the stomatognathic system, through
the mandibular repositioning. This possibility has been
widely evaluated in the sport medicine, but the conclusions
are discordant (14-18). The current study was performed
to evaluate the effect of the mandibular repositioning on
the sport performance in the rugby players, after posturestabilometric screening.
MATERIALS AND METHODS
Twenty male rugby players (25 years on the average),
athletes of the Unione Rugby Capitolina (Unione Rugby
Capitolina S. p. A., Roma), were included, faculty, in this study.
Inclusionary criteria were: 1) good healthy condition; 2) no
history of vertigo due to pathologies of CNS (Central Nervous
System); 3) no previous orthodontic or gnatologic treatment;
4) asymptomatic for stress conditions; 5) asymptomatic for
vestibular pathologies; 6) symptomatic for Temporomandibular
Disorders (TMD). Each subject put his signature in an informed
consent.
The posture-stabilometric evaluation was performed by a 10
Hz sampling frequency vertical force platform (Lizard; Lemax
s.r.l., Como, Italy) and elaborated by specific software (Lizard
v 3.0; Lemax s.r.l., Como, Italy). The platform, that provides
a static evaluation of the posture, allows evaluating: 1) the
position of the centre of mass; 2) the distribution of the weight
on the area of the feet; 3) the position of the centre of mass of
each half-body. 4) the bar torsion angle.
The subjects involved in the study were asked to avoid
physical stress, alcohol, coffee and exiting substances during 24
hours before testing. The same expert operator made all records
in a quiet room.
Key words: Mandibular repositioning; Posture;
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C. Section Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
105
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
106 (S)
M. D’ATTILIO ET AL.
Each subject was guided to bite slowly and gently into a
wax registration, made by three internal sheets of red soft wax
and two external sheets of pink hard wax. The wax registration
was inserted between the maxillary and the mandibular arches,
distally to the canines. The wax registration was fitted for each
subject, guiding to bite in:
•
an advanced jaw position with the maxillary and
mandibular labial frena aligned;
•
a jaw position obtained with an increase of vertical
dimension;
•
an advanced jaw position with the maxillary and
mandibular frena not aligned (just for subjects presenting a
mandibular deviation).
For repeatability, mandibular advancement was performed in
a position that reproduced an ideal overjet (2 mm) and overbite
(2 mm) (19). The vertical dimension was increased up to place
the jaw just before the first tooth contact. On the basis of each
of the two (or three) wax registrations, acrylic resin incisor Jigs
were made to guide the subject in the desired position. This was
done to avoid any interference between the waxes and the tongue
during the following procedures.
The subjects, placed on the platform, were asked to remain
as stable as possible, relaxed, with the arms along the body, and
to gaze a point in the wall corresponding with the central axis of
the platform (90 cm away) (20). To eliminate, or highly reduce,
subjectivity in the patient positioning, a custom-made tool was
realized, which gives an exact projection of the lateral malleolus
centre on the platform (Fig. 1). Each recording lasted 51.2 sec.
The posture-stabilometric evaluation was performed in basal
conditions, i.e.:
1. Rest position/open eyes: Teeth slightly apart and
masticatory muscle in a relaxed non-contractile condition,
with open eyes.
2. Rest position/closed eyes: Teeth slightly apart and
masticatory muscle in a relaxed non-contractile condition,
with closed eyes.
3. Maximum Intercuspidation/open eyes: The patient was
invited to close the teeth in maximum intercuspidation,
with open eyes.
4. Maximum Intercuspidation/closed eyes: The patient was
invited to close the teeth in maximum intercuspidation,
with closed eyes.
Subsequently, the exam was recorded while the subject
put on the Jigs. The subjects, who showed an improvement
of the postural arrangement after mandibular repositioning,
were treated with a custom Positioner. The enhancement of the
postural arrangement was evaluated considering the variations
of the position of the centre of mass, the distribution of the
weight on the area of the feet, and the torsion angles of the
body axis regard the Cartesian axes. These parameters allow
evaluating the quality of the articular and muscular work of the
body. The custom Positioner was realized in the best mandibular
position for each subject like shown by the results of the posture
stabilometric screening. The athletes treated with Positioner
underwent, before (T0) and after 6 months (T1) the use of the
Positioner, strength and speed tests:
•
running (30 m);
•
squat ( a maximal series);
•
turn (a maximal series);
•
bench (a maximal series).
RESULTS
The results of the tests of speed and strength of the
twelve athletes treated with Positioner are shown in Table
I.
For each variable, the parameters of the descriptive
statistic are shown in Table II.
Because of the limited number of the subjects, the
Wilcoxon Signed-Ranks Test, a non-parametric test, was
applied (Table III).
All calculates were performed with a Software
SigmaStat 3.0.
For each variable was observed an improvement
statistically significant from T0 to T1 (P<0, 05).
P
O
R
F
O
DISCUSSION
The current study shows the possibility to use a
posture-stabilometric platform to point out the relationship
between the stomatognathic system and the body posture.
The anatomical and neuromuscular structures of the body
don’t behave like single elements but like chains, always
under the control of the specialized structures of brain
and cerebellum. In the interaction between stomatognatic
system and body posture, the role of the hyoid bone is
underlying (11). Moreover, the interaction between the
descending nucleus of trigeminal nerve and the spinal
tract is wildly attested (6, 8, 12, 13) like the role of the
proprioceptive, vestibular, and visual receptors in the
postural control (21). The biomechanical complexity
of body posture derives from the integration of the
several body segments: when there is a change in any
biomechanical subunit, a refinement of the postural
control systems will necessarily occur. Stockweel (20)
sustains that the axes of the Temporomandibular, Shoulder,
Hip, and Ankle joint have to be perfectly parallel, on the
vertical axis, to guarantee a correct equilibrium of the
body (20). Sakaguchi et al. have proved that to change
the mandibular position effects the body posture and viceversa (10). Nobili et al. (22) showed that subjects with
a Class II malocclusion exhibit an anteriorly displaced
posture, whereas subjects with a Class III malocclusion
exhibit a posteriorly displaced posture. Monzani et al.
(2) observed a significantly different increase in average
body sway in patients with craniomandibular disorders as
opposed to controls. Milani seems to confirm that altering
dental occlusion by wearing an oral appliance could
induce some fluctuations in dynamic postural attitude
(6). Conversely, Hanke sustains that most publications in
literature fail to provide the hard facts and solid evidence
characteristic of high-quality research (1). The current
F
107 (S)
European Journal of Inflammation
Table I. The results of the tests of speed and strength of the twelve athletes before and after the use of the Positioner
test without Positioner (TO)
test with Positioner (T1)
30 m
(sec)
squat
(kg)
turn
(kg)
bench
(kg)
30 m
(sec)
squat
(kg)
player 1
4,17
190
100
150
4,17
195
105
155
player 2
4,08
205
110
145
4,05
210
115
150
player 3
3,99
210
120
150
3,90
210
130
150
player 4
4,11
200
115
135
4,05
205
220
135
player 5
4,21
190
115
115
4,17
210
125
120
player 6
4,01
175
110
110
4,00
185
120
120
player 7
3,90
160
85
100
3,85
165
95
110
player 9
player 10
player 11
player 12
P
Bench
(kg)
F
O
O
R
player 8
turn
(kg)
3,92
150
90
95
3,85
160
100
100
3,95
140
90
90
3,89
155
95
90
3,86
150
100
100
3,80
155
105
100
3,75
160
110
110
3,70
165
115
120
3,70
145
100
105
3,65
150
110
115
Table II. The descriptive statistic (Mean, Standard Deviation, Median, 25th Percentile, 75th Percentile, Maximum and Minimum) of the
results of the tests of speed and strength
N
30 m (T0)
12
squat (T0)
12
turn (T0)
12
bench (T0)
12
30 m (T1)
12
squat (T1)
Mean
Minimum
Maximum
Percentiles
25th
50th
75th
3,9950
,1640
3,74
4,21
3,9000
3,9700
4,1700
175,0000
24,6798
140,00
210,00
160,0000
115,00000
190,0000
103,3333
13,3712
85,00
120,00
90,00000
105,0000
115,0000
120,8333
23,8207
90,00
150,00
100,0000
117,5000
150,0000
3,9467
1785
5,70
4,17
3,8500
3,8950
4,1700
12
183,3333
23,4844
155,00
210,00
165,0000
180,0000
210,0000
turn (T1)
12
110,8333
14,2754
95,00
130,00
95,0000
110,0000
125,0000
bench (T1)
12
124,1667
23,4359
90,00
155,00
110,0000
120,0000
150,0000
study shows that changing the mandibular position affects
the postural assessment of the subjects. The variation is
evident if we consider the distribution of the weight on the
area of the feet, the position of the center of mass of the
body and the angle of torsion between the axis of the body
and the X-axis. These results highlight the possibility
to realize, on the basis of the posture-stabilometric
valuation, a device for the mandibular repositioning in
the best condition for the muscular equilibrium of the
subject. Subsequently, the study evaluated the effect of
the mandibular repositioning on the sport performance.
Many authors have discussed the applications of the
mandibular repositioning in the sport medicine, but
the conclusions are discordant. Gelb observed that jaw
108 (S)
M. D’ATTILIO ET AL.
Table III. Wilcoxon Signed-Ranks Test
30 m (T1)
30 m (T0)
squat (T1)
squat (T0)
turn (T1)
turn (T0)
bench (T1)
bench (T0)
Z
-2,812
-2,873
-3,145
-2,271
Asymp. Sig. (2tailed)
,005
,004
,002
,023
F
O
orthopedic repositioning appliance, Welch determined the
ideal vertical dimension of occlusion through the manual
resistance of the deltoid. Because this protocol is not
objective and repeatable, in our study we have preferred
to determine the vertical dimension placing the jaw just
before the first tooth contact. The current study performed
tests of speed and strength to evaluate the improvement of
the performance of the athletes. The results evidenced an
increase of the speed during the running and an increase
of the maximal weight lifted during the exercises. That is
in agreement with a better consequent muscular-articular
strategy that can get to an increase of power and elasticity
during the athletic performance.
The current study supports the possibility that the
mandible position can influence the muscular work of the
other body’s muscles. The effect of such a relationship
is the chance to improve, through the mandibular
repositioning, the postural arrangement and the muscular
and articular strategy of the body, with a consequent
increment of the body’s elasticity and dynamism. That
is particularly true in the athletes. We can suggest that
the mandibular repositioning, achieved by an individual
Positioner, can produce an increase of the levels of the
muscular strength and of the postural stability, with a
reduction of the movements of compensation. Moreover,
it is possible to observe an improvement of the forces,
the resistance to the fatigue and of the muscular elasticity,
with a consequent decrease of muscular trauma. These
results suggest more attention to the occlusion and the
postural involvements in the sport’s medicine.
P
O
R
Fig. 1. The custom tool for the patient positioning.
repositioning can enhance appendage muscular strength
and athletic performance (15). Yates performed, on 14
football players, tests with no mouthpiece, with a placebo
mouthpiece, and with a MORA mouthpiece. The bite
relation used to realize the appliance was obtained with
the subjects biting forward with the incisors separated
approximately 2 to 3 mm. The results suggest that
the MORA has no effect on muscular strength. (23).
Regarding to Yates, we have preferred to achieve, by the
mandibular advancement, not only an ideal overjet but
also an ideal overbite. The limit of the protocol used by
Yates is that the mouthpieces, without a previous posturestabilometric evaluation, are not able to guide each subject
in the most favorable mandibular position for his postural
arrangement. Sforza sustains that a functionally more
symmetric maxillo-mandibular position resulted in a more
symmetric sternocleidomastoid muscle contraction pattern
and less body sway. Modifications in the contraction of
the masticatory muscles may therefore affect the whole
body (18). Welch, conversely, observed that changing
the position of the temporal mandibular joint, with a
mandibular orthopedic repositioning appliance, does not
increase muscular strength (24). To realize the mandibular
REFERENCES
1.
2.
3.
Hanke BA, Motschall E, Turp JC. Association between
orthopedic and dental findings: what level of evidence is
available? J Orofac Orthop 2007; 68:91-107.
Monzani D, Guidetti G, Chiarini L, Setti G. Combined effect
of vestibular and craniomandibular disorders on postural
behaviour. Acta Otorhinolaryngol Ital 2003; 23:4-9.
Tardieu C, Dumitrescu M, Giraudeau A, Blanc JL, Cheynet
F, Borel L. Dental occlusion and postural control in adults.
F
109 (S)
European Journal of Inflammation
4.
5.
6.
7.
8.
9.
10.
Neurosci Lett 2009; 450:221-4.
Chessa G, Capobianco S, Lai V. [Stabilimetry and craniocervico-mandibular disorders]. Minerva Stomatol 2002;
51:167-71.
Chessa G, Marino A, Dolci A, Lai V. [Baropodometric
examination for complete diagnosis of patients with
cranio-cervico-mandibular disorders]. Minerva Stomatol
2001; 50:271-8.
Milani RS, De Periere DD, Lapeyre L, Pourreyron L.
Relationship between dental occlusion and posture. Cranio
2000; 18:127-34.
Tecco S, Colucci C, Calvisi V, Orso CA, Salini V, Festa F.
Influence of knee pathology on body posture and muscle
activity of head, neck and trunk muscles. Minerva Stomatol
2005; 54:611-33.
Bracco P, Deregibus A, Piscetta R, Ferrario G. Observations
on the correlation between posture and jaw position: a pilot
study. Cranio 1998; 16:252-8.
Bracco P, Deregibus A, Piscetta R. Effects of different jaw
relations on postural stability in human subjects. Neurosci
Lett 2004; 356:228-30.
Sakaguchi K, Mehta NR, Abdallah EF, Forgione AG,
Hirayama H, Kawasaki T, Yokoyama A. Examination of
the relationship between mandibular position and body
posture. Cranio 2007; 25:237-49.
Gale A, Kilpelainen PV, Laine-Alava MT. Hyoid bone
position after surgical mandibular advancement. Eur J
Orthod 2001; 23:695-701.
Gangloff P, Louis JP, Perrin PP. Dental occlusion modifies
gaze and posture stabilization in human subjects. Neurosci
Lett 2000; 293:203-6.
Gangloff P, Perrin PP. Unilateral trigeminal anaesthesia
modifies postural control in human subjects. Neurosci Lett
2002; 330:179-82.
Egret C, Leroy D, Loret A, Chollet D, Weber J. Effect
12.
13.
14.
16.
17.
18.
F
O
O
R
P
11.
15.
of mandibular orthopedic repositioning appliance on
kinematic pattern in golf swing. Int J Sports Med 2002; 23:
148-52.
Gelb H, Mehta NR, Forgione AG. The relationship
between jaw posture and muscular strength in sports
dentistry: a reappraisal. Cranio 1996; 14:320-5.
Wang K, Ueno T, Taniguchi H, Ohyama T. Influence on
isometric muscle contraction during shoulder abduction by
changing occlusal situation. Bull Tokyo Med Dent Univ
1996; 43:1-12.
Cronin J, Sleivert G. Challenges in understanding the
influence of maximal power training on improving athletic
performance. Sports Med 2005; 35:213-34.
Sforza C, Tartaglia GM, Solimene U, Morgun
V, Kaspranskiy RR, Ferrario VF. Occlusion,
sternocleidomastoid muscle activity, and body sway: a
pilot study in male astronauts. Cranio 2006; 24:43-9.
Björk A. Variability and age changes in overjet and
overbite. Am J Orthod 1953; 39:779-801.
Stockwell CW, Koozekanani SH, Barin K. A physical
model of human postural dynamics. Ann N Y Acad Sci
1981; 374:722-30.
Ries LG, Berzin F. Analysis of the postural stability
in individuals with or without signs and symptoms of
temporomandibular disorder. Braz Oral Res 2008; 22:37883.
Nobili A, Adversi R. Relationship between posture and
occlusion: a clinical and experimental investigation.
Cranio 1996; 14:274-85.
Yates JW, Koen TJ, Semenick DM, Kuftinec MM. Effect
of a mandibular orthopedic repositioning appliance on
muscular strength. J Am Dent Assoc 1984; 108:331-3.
Welch MJ, Edington DM, Ritter RC. Muscular strength
and temporomandibular joint repositioning. J Orthop
Sports Phys Ther 1986; 7:236-9.
19.
20.
21.
22.
23.
24.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
POSTUROSTABILOMETRIC EVALUATION OF PLANTAR VARIATIONS
IN PATIENTS WITH TEMPORO-MANDIBULAR DYSFUNCTION:
A CASE-CONTROL STUDY
M. D’ATTILIO1, D. RODOLFINO1, B. SINJARI1, S. CAPUTI1,
R. GERXHANI1, A. SCARANO1, F. FESTA1, S. FANALI1, F. CARINCI2
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
2
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
1
The aim of this experimental study was to find out if temporo-mandibular dysfunctions (TMD) can influence
two of the parameters defining body posture, intersolar distance and plantar lay. Test group (TG) was made of
52 subjects (14 males and 38 females aging from 12 to 64 years, average 34.25 ± 12.96. ) all affected by temporomandibular dysfunctions. Control Group (CG) was made of 52 subjects (21 males and 31 females aging from 16
to 56 years average 34.19 ± 13.40 ) completely negative for temporo-mandibular or occlusal dysfunctions. The
posturo-stabilometric measurements were made using a stabilometric platform and the following conditions were
investigated: mandibular rest position (rest) and intercuspidal position (icp) with both eyes open/closed. For both
conditions the following parameters were recorded: sway area, sway velocity, sway length, sway velocity variation,
weight distribution, right foot angle, left foot angle, the sum of feet angles, bar torsion angle and intersolar
distance. The results of our study show that there is a detectable difference between Test and Control group in
intercuspal position.
O
R
P
Human posture is the resulting of the position and
orientation of body and limbs in order to maintain
equilibrium against the force of gravity.
Postural adjustments, consisting of slight swaying
movements, comprehend visual, vestibular and
somatosensorial inputs integrated by a complex regulation
system (1).
Many studies have underlined that respiration, head
and neck position, mood and in a particular anxiety, can
influence body posture (2, 3).
Dentistry literature, yet, reports many observations
respect the influence of body and head posture on the
mandibular rest position, on the range of its movements
and on the final intercuspidal position (4). The masticatory
muscles activity seems to be correlated with the trunk
and neck ones, in fact, alterations of muscular body
equilibrium can influence mandibular position (5, 6) and
facial morphology.
Human body can compensate postural alterations,
in healthy subjects better than in patients with occlusal
dysfunctions (5).
Recent studies evidence a potential role of dental
occlusion(7-10) and trigeminal afferences in the
determination of postural control, as the afferences from
the periodontal system, from the masticatory muscles and
from the Temporo-mandibular Joint (TMJ) converge in
the trigeminal nuclei. Recent neuroanatomical studies
has evidenced a projection of the trigeminal neurons
to the vestibular nuclei(11) and trigeminocerebellar
links, although the functions of these remain to be
defined (12). However, they are of interest since these
anatomical areas are involved in body posture (12).
Moreover, several studies seem to indicate that different
mandibular positions induce variations in body posture
(10, 13, 14). Other studies suggest that dental occlusion
may influence head posture (15), spine curvatures (e.g.,
scoliosis and lordosis) (8, 16, 17) and even leg length
(18). According to these findings, previous investigations
using posturography described correlations between
body posture and dental occlusion (10), postural sways
Key words: posture, DTM, posture-stabilometric recordings
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C. Section Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
111
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
112 (S)
M. D’ATTILIO ET AL.
stabilisation (7) and diminishing of trigeminal afferences
through unilateral anaesthesia (12). In contrast, an earlier
study published about 12 years ago did not support a
similar correlation (19).
The results of an experimental study published in 2005
do not support the correlation between dental occlusion
and body posture. Actually, the findings of this study are
considered not valid because the test group examined
were totally healthy patients and did not present any
dental occlusion alteration (20). Also other studies asses
that there is no detectable correlation between posture and
temporo-mandibular dysfunctions or occlusal alteration
(21, 22).
A huge literature review published some years ago,
settled that there is no scientific evidence that justifies
occlusal therapy for the treatment of postural disorders
and vice versa (23).
In accord with the hypothesis that dental occlusion
may influence body posture (10, 19) dysfunctions, such as
chewing and swallowing of the masticatory muscles can
be transmitted to distal musculature along the so-called
“muscle chains” (18).
Only one article in literature, based on an experimental
study on rats, settles that vertebral spine alignment seems
to be influenced by an alteration of occlusion caused by a
monolateral molar pad (16).
In spite all, the influence of occlusal factors in body
posture is yet to be established.
For these reasons we designed a study aiming to find
out if patients showing Temporo-mandibular Dysfunction
(TMDs) present also a variation of the distance
between the two foot centres (intersolar distance) and,
consequently, of the foot lay.
psychosocial and psychological stress profile in the last year; (v)
no vestibular apparatus alteration; (vi) completely negative for
temporo-mandibular dysfunctions.
Posturography recordings were performed by using a
10 Hz sampling frequency vertical force platform (Lizard,
Lemax s.r.l.Como, Italy) and elaborated by using the Lizard v
3.0 software (Lizard, Lemax s.r.l.Como, Italy). The platform
transforms signals received by its load cells into outputs
elaborated by the software and transformed in repeatable
parameters like sway area, sway velocity, sway length, sway
velocity variation and weight distribution. Besides, there are
other parameters not directly provided by the software but that
are easily detectable and in a repeatable way by making simple
arithmetical operations based on data that the software provides.
These parameters include: right foot angle, left foot angle, bar
torsion angle and intersolar distance. For example, by making
a simple addition/subtraction operation between the distance of
each foot pressure centre from the central axis (data provided
by the software) we obtained the distance between the two feet
pressure centres and its’ variation. (data detected indirectly).
All records were taken in a quiet room by the same expert
operator. Patients were asked to remain as stable as possible, but
relaxed, with their arms hanging free beside their body, facing
the wall and gazing a point in the wall placed in correspondence
with the central axis of the platfrom (80 cm away). Moreover
they were asked to avoid physical stress, alcohol, coffee and
exiting substances during the 24 hours before the recording.
The position of the patient on the platform is matter of
argument in literature because of the hardly repeatable position
of lateral malleulus in the oblique line of the platform. In order
to avoid this error we created a tool which gives an exact
projection of the centre of the lateral malleulus on the platform
so we eliminated, or highly reduced, subjectivity in positioning
the patient on the platform.
Two conditions, mandibular rest position (rest) and
intercuspidal position without clenching (icp), were investigated
with both open and closed eyes. The recording lasted 51.2 sec.
For both conditions the following parameters were recorded:
sway area (sa), sway velocity (sv), sway length (sl), sway
velocity variation (Δv), weight distribution (wd), right foot
angle (rfa), left foot angle (lfa), the sum of feet angles (suman),
bar torsion angle (bta) and intersolar distance (isd).
F
O
P
O
R
MATERIALS AND METHODS
Test group (TG) included 52 subjects,14 males and 38
females (ages 12 to 64 years mean age 34,25 ± 12.96) signing
an informed consent form and satisfying the following inclusion
criteria:
(i) good general health according to medical history and
clinical judgement; (ii) negative history of vertigo through
central nervous disease; (iii) no previous orthodontic or
gnathologic treatement; (iv) absence of any particular episode of
psychosocial and psychological stress profile in the last year; (v)
no vestibular apparatus alteration; (vi) positive to gnathologic
examination for Temporo-Mandibular Dysfunctions.
Control Group was made of 52 subjects, 21 males and 31
females (ages 16 to 56 years, mean age 34.19 ± 13.40) signing
an informed consent form and satisfying following inclusion
criteria:
(i) good general health according to medical history and
clinical judgement; (ii) negative history of vertigo through
central nervous disease; (iii) no previous orthodontic or
gnathologic treatement; (iv) absence of any particular episode of
Data treatment
A non parametric results test (Wilcoxon Signed Rank Test)
was used for the statistic treatment. Parametric results statistic
tests were not considered valid because the sample did not
satisfy the normality and homogeneity criteria.
Longitudinal statistic analysis rest vs. icp were made for Test
and Control group.
Moreover was made a transversal test with the following
criteria:
1.
rest position, test group vs control group.
2.
icp position, test group vs control group.
DISCUSSION
Recent Studies assess that does not exist any
F
113 (S)
European Journal of Inflammation
Table I. REST vs ICP IN TEST GROUP.
REST VS ICP IN TEST GROUP
p value
significative
SA REST TEST vs. SA ICP TEST
p = 0,518
NO
SV REST TEST vs. SV ICP TEST
p = 0,925
NO
SL REST TEST vs. SL ICP TEST
p = 0,899
DELTA V REST TEST vs. DELTA V ICP TEST
p = 0,764
WD REST TEST vs. WD ICP TEST
p = 0,764
RFA REST TEST vs. RFA ICP TEST
p = 0,005
LFA REST TEST vs. LFA ICP TEST
p = 0,497
SUMAN REST TEST vs. SUMAN ICP TEST
p = 0,001
BTA REST TEST vs. BTA ICP TEST
p = 0,935
SR REST TEST vs. SR ICP TEST
p= 0,444
ISD REST TEST vs. ISD ICP TEST
p = 0,629
F
O
O
R
Table II. TEST GROUP vs. CONTROL GROUP IN REST POSITION.
NO
NO
NO
YES
NO
YES
NO
NO
NO
TEST GROUP vs. CONTROL GROUP IN REST POSITION
p value
significative
SA REST TEST vs. SA REST CONT
p = 0,078
NO
SV REST TEST vs. SV REST CONT
p = 0,087
NO
SL REST TEST vs. SL REST CONT
p = 0,129
NO
DELTA V REST TEST vs. DELTA V REST CONT
p = 0,135
NO
WD REST TEST vs.WD REST CONT
p = 0,588
NO
RFA REST TEST vs. RFA REST CONT
p = 0,845
NO
LFA REST TEST vs. LFA REST CONT
p = 0,616
NO
SUMAN REST TEST vs. SUMAN REST CONT
p = 0,760
NO
BTA REST TEST vs. BTA REST CONT
p = 0,873
NO
SR REST TEST vs. SR REST CONT
p = 0,426
NO
ISD REST TEST vs. ISD REST CONT
p = 0,054
NO
P
detectable correlation between occlusion and posture
(20-23). Three of these studies (20, 22, 23) investigated
parameters such as sway area (sa), sway velocity
(sv), sway length (sl), sway velocity variation (Δv),
weight distribution (wd) or sway shape variation in
different conditions (rest, icp, open/closed eyes). All
these parameters evaluate sway, which is indisputably
influenced by visual inputs. So, in our opinion, all of
these parameters are to be considered unspecific, as they
do not investigate all other postural variations but sway.
Moreover, in one of the two studies, examined patients do
not show any orthodontic or gnathologic dysfunction, thus
the study is to be considered unfounded. In the third study
(21) a visual measurement method is used, which does
not consider possible compensation mechanisms involved
during different conditions (icp or rest). Moreover, there
is no normalisation of all other parameters involved in
human body posture.
For these reasons we considered other, more specific,
parameters such as plantar lay (feet angles) and intersolar
distance and investigated their variations in icp and rest
position.
In Table I is evidenced that no significant differences
occur between the two conditions in Control group, that
is to say that in healthy patients there are no significant
changes in rest or intercuspidal position. So their
114 (S)
M. D’ATTILIO ET AL.
Table III. TEST GROUP vs. CONTROL GROUP IN ICP POSITION
TEST GROUP vs. CONTROL GROUP IN ICP POSITION
p value
significative
SA ICP TEST vs. SA ICP CONT
p = 0,100
NO
F
O
SV ICP TEST vs. SV ICP CONT
p = 0,161
NO
p = 0,099
NO
p = 0,090
NO
p = 0,261
NO
p = 0,740
NO
p = 0,594
NO
p = 0,781
NO
p = 0,636
NO
p = 0,888
NO
p = 0,027
YES
P value
significative
P = 0,100
NO
P = 0,161
NO
P = 0,099
NO
DELTA V ICP TEST vs. DELTA V ICP CONT
P = 0,090
NO
WD ICP TEST vs. WD ICP CONT
P = 0,261
NO
RFA ICP TEST vs. RFA ICP CONT
P = 0,740
NO
LFA ICP TEST vs. LFA ICP CONT
P = 0,594
NO
SUMAN ICP TEST V vs. S SUMAN ICP CONT
P = 0,781
NO
BTA ICP TEST vs. BTA ICP CONT
P = 0,636
NO
SR ICP TEST vs. BTA ICP CONT
P = 0,888
NO
ISD ICP TEST vs. ISD ICP CONT
P = 0,027
YES
SL ICP TEST vs. SL ICP CONT
DELTA V ICP TEST vs. DELTA V ICP CONT
WD ICP TEST vs. WD ICP CONT
RFA ICP TEST vs. RFA ICP CONT
LFA ICP TEST vs. LFA ICP CONT
SUMAN ICP TEST vs. SUMAN ICP CONT
O
R
BTA ICP TEST vs. BTA ICP CONT
SR ICP TEST vs. BTA ICP CONT
ISD ICP TEST vs. ISD ICP CONT
Table IV. TEST GROUP vs. CONTROL GROUP IN ICP POSITION
P
TEST GROUP vs. CONTROL GROUP IN ICP POSITION
SA ICP TEST vs. SA ICP CONT
SV ICP TEST vs. SV ICP CONT
SL ICP TEST vs. SL ICP CONT
occlusion does not influence the posture of the rest of
their body. Besides, differences are evidenced between
the two conditions in Test group (suman and rfa) (Table
II). This means that, in patients with TMJ dysfunctions,
occlusion influences the whole body posture. Moreover,
there are no differences between the two samples in
rest position, condition in which occlusal influences are
eliminated (Table III). Besides the intersolar distance
changes between TG and CG in intercuspidal position, in
which occlusion and TMJ dysfunctions play an important
role (Table IV).
Physiatric studies assess that TMJ axis, scapolo-omeral
joint axis, coxo-femoral joint axis and tibial-astragalus
joint axis have to be perfectly parallel in order to guarantee
a correct equilibrium of the body. Compensations are
possible in order to maintain parallelism of the axis as
F
115 (S)
European Journal of Inflammation
these junctions have 6 degrees of range.
TMJ
dysfunctions,
especially
condylo-diskal
displacements, or even pre-contacts like cross-bites can
modify TMJ bicondylar axis. According to physiatric
studies we can suppose that a modification of TMJ axis
leads to a compensation of the other joints which induces a
modification of the plantar lay and intersolar distance.
12.
13.
REFERENCES
1.
Guez G, Kandel ER, Schwartz JH, Jessel TM. Principles of
Neural Science. Amsterdam: Elsevier; 1991.
2. Bolmont B, Gangloff P, Vouriot A, Perrin PP. Mood states
and anxiety influence abilities to maintain balance control
in healthy human subjects. Neurosci Lett 2002; 329:96100.
3. Kantor E, Poupard L, Le Bozec S, Bouisset S. Does body
stability depend on postural chain mobility or stability
area? Neurosci Lett 2001; 308:128-32.
4. Celic R, Jerolimov V, Panduric J. A study of the influence of
occlusal factors and parafunctional habits on the prevalence
of signs and symptoms of TMD. Int J Prosthodont 2002;
15:43-8.
5. Marzooq AA, Yatabe M, Ai M. What types of occlusal
factors play a role in temporomandibular disorders...? A
literature review. J Med Dent Sci 1999; 46:111-6.
6. Stohler CS, Wang JS, Veersarn P. Motor unit behaviour to
response to experimental muscle pain. J Dent Res 1990;
609:273.
7. Gangloff P, Louis JP, Perrin PP. Dental occlusion modifies
gaze and posture stabilization in human subjects. Neurosci
Lett 2000; 293:203-6.
8. Huggare J, Pirttiniemi P, Serlo W. Head posture and
dentofacial morphology in subjects treated for scoliosis.
Proc Finn Dent Soc 1991; 87:151-8.
9. Huggare JA, Raustia AM. Head posture and
cervicovertebral and craniofacial morphology in patients
with craniomandibular dysfunction. Cranio 1992; 10:1737; discussion 78-9.
10. Bracco P, Deregibus A, Piscetta R. Effects of different jaw
relations on postural stability in human subjects. Neurosci
Lett 2004; 356:228-30.
11. Buisseret-Delmas C, Compoint C, Delfini C, Buisseret P.
Organisation of reciprocal connections between trigeminal
14.
and vestibular nuclei in the rat. J Comp Neurol 1999; 409:
153-68.
Gangloff P, Perrin PP. Unilateral trigeminal anaesthesia
modifies postural control in human subjects. Neurosci Lett
2002; 330:179-82.
Palano D, Molinari G, Cappelletto M, Guidetti G, Vernole
B. [The role of stabilometry in assessing the correlations
between craniomandibular disorders and equilibrium
disorders]. Bull Group Int Rech Sci Stomatol Odontol
1994; 37:23-6.
Palano D, Molinari G, Cappelletto M, Guidetti G, Vernole
B. [The use of computer-assisted stabilometry in the
diagnosis of craniomandibular disorders]. Bull Group Int
Rech Sci Stomatol Odontol 1994; 37:19-22.
Solow B, Sonnesen L. Head posture and malocclusions.
Eur J Orthod 1998; 20:685-93.
D’Attilio M, Filippi MR, Femminella B, Festa F, Tecco S.
The influence of an experimentally-induced malocclusion
on vertebral alignment in rats: a controlled pilot study.
Cranio 2005; 23:119-29.
D’Attilio M, Caputi S, Epifania E, Festa F, Tecco S.
Evaluation of cervical posture of children in skeletal class
I, II, and III. Cranio 2005; 23:219-28.
Valentino B, Fabozzo A, Melito F. The functional
relationship between the occlusal plane and the plantar
arches. An EMG study. Surg Radiol Anat 1991; 13:171-4.
Ferrario VF, Sforza C, Schmitz JH, Taroni A. Occlusion and
center of foot pressure variation: is there a relationship? J
Prosthet Dent 1996; 76:302-8.
Perinetti G. Dental occlusion and body posture: no
detectable correlation. Gait Posture 2006; 24:165-8.
Munhoz WC, Marques AP, de Siqueira JT. Evaluation
of body posture in individuals with internal
temporomandibular joint derangement. Cranio 2005; 23:
269-77.
Michelotti A, Farella M, Buonocore G, Pellegrino G,
Piergentili C, Martina R. Is unilateral posterior crossbite
associated with leg length inequality? Eur J Orthod 2007;
29:622-6.
Michelotti A, Buonocore G, Farella M, Pellegrino G,
Piergentili C, Altobelli S, Martina R. Postural stability
and unilateral posterior crossbite: is there a relationship?
Neurosci Lett 2006; 392:140-4.
F
O
P
O
R
15.
16.
17.
18.
19.
20.
21.
22.
23.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
MAXILLARY SINUS MEMBRANE PERFORATION FROM NASAL
SUCTION TECHNIQUE AND ULTRASONIC APPROACH
vs. CONVENTIONAL ROTATIVE INSTRUMENTS
A. SCARANO1, C. MANCINO1, G. MURMURA1, S. FRISONE1, S. FANALI1, F. CARINCI2
F
O
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy;
1
2
To compare the efficacy of two different techniques for sinus membrane elevation for maxillary lining lifted
using a lateral window approach: nasal suction technique and ultrasonic surgery approach vs. traditional
approach. Twelve partially edentulous patients having bilaterally 1 to 5 mm of residual bone height and at least 5
mm bone width below the maxillary sinuses as measured on Computed Tomography (CT) scans were randomized
to receive two 2-stage sinus lift procedures using the lateral window approach. In one side the sinus lining the
membrane was elevation with nasal suction technique and ultrasonic surgery approach whereas the contralateral
side the membrane was elevation after osteotomy prepared using a round oral surgery bur. No patient dropped
out. In the group 1 (control), a four small peroration of membrane (< 5 mm) was observed. In the group 2 (test) no
perforation of membranes was observed. A statistically significant difference was present between the incidence
of sinus membrane perforation in group I vs. II (control vs. test) p-value = 0.08. In conclusion the sinus lift with
ultrasonic surgery and nasal suction technique is useful to prevent a perforation of sinus membrane.
O
R
P
The sinus lift procedure was introduced in the early
1980s to overcome anatomical limitation and gain
adequate vertical bone height in atrophic areas of the
posterior maxilla prior to the placement of dental implants
(1).
A common problem facing dentists is the rehabilitation
of oral function in patients with edentulous atrophic
posterior jaws. A common clinical problem encountered
in the rehabilitation of edentulous posterior maxilla is
the presence of large pneumatisated maxillary sinuses
preventing the placement of implants due to the lack of
sufficient bone volume. To overcome this problem various
sinus lifting techniques have been proposed ranging
from using autogenous bone grafts (particulated or in
blocks) or combinations of various types of allografts or
biomaterials (1). Sinus lift techniques are among of the
most commonly performed augmentation procedure and
are considered very reliable particularly when autogenous
bone is used (2-5). The original technique was described
during the late seventies (5). A lateral window is opened
into the maxillary sinus, the sinus membrane is carefully
lifted up, and autogenous bone or bone substitutes are
placed into the sinus, and are allowed to heal for about
6 months or more before placing the implants. This
technique, with some minor modifications, is still widely
used nowadays.
Though the sinus lift procedure is relatively safe, there
are some potential problems related to this procedure
(2, 3). The most prevalent intraoperative complication
is perforation of sinus membrane. Perforation of sinus
membrane may cause loss of graft materials and early
failure of dental implant, as well as disruption of normal
sinus physiologic function (4). Various techniques and
materials have been proposed for the management of
perforation of sinus membrane (5, 6).
The aim of this randomized controlled clinical trial
was to compare the efficacy of two different techniques
for sinus membranes elevation using nasal suction
technique and ultrasonic surgery approach vs. elevation
after osteotomy prepared using a round oral surgery bur.
MATERIALS AND METHODS
A preoperative computer tomography scan was used to
Key words: Ultrasonic surgery, sinus membrane perforation, sinus membrane elevation, sinus lift, complication
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C.
Section of Maxillofacial Surgery University of Ferrara
Corso Giovecca 203 44100 Ferrara
Italy E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
117
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
118 (S)
A. SCARANO ET AL.
quantify the amount of available bone under the maxillary
sinus to decide whether the patient could be included in the
study (OPT/CT scan). Patients were not admitted in the study
if any of the following exclusion criteria were present: 1)
general contraindications to implant surgery; 2) subjected to
irradiation in the head and neck area; 3) immunosuppressed
or immunocompromised; 4) treated or under treatment with
intravenous amino-bisphosphonates; 5) active periodontitis,
poor oral hygiene and motivation; 6) uncontrolled diabetes;
7) pregnant or nursing; 8) substance abusers; 9) psychiatric
problems or unrealistic expectations; 10) lack of opposite
occluding dentition/prosthesis in the area intended for implant
placement; 11) acute chronic infection/inflammation (sinusitis)
in the area intended for implant placement.
The principles outlined in the Declaration of Helsinki on
clinical research involving human subjects were adhered to.
All patients received through explanations and signed a written
informed consent form prior to being enrolled in the trial.
All patients received prophylactic antibiotic therapy: 2 g of
amoxicillin (or clyndamicin 600 mg if allergic to penicillin) one
hour before the intervention and continued the take the antibiotics
postoperatively, 1 g amoxicillin or 300 mg clyndamicin twice a
day, for 7 days. Prior to the intervention patients rinsed with
chlorhexidine mouthwash 0.2% for 1 minute. All patients were
treated under local anesthesia using Articaine with adrenaline
1:100.000. A crestal incision was performed starting from site
number 1 and a flap was elevated. After internal displacement of
a lateral bony window prepared with a ultrasonic surgery device
(Surgysonic, Esacrom, Imola Italy), the maxillary membrane
was carefully elevated and its integrity was assessed visually
and with a blunt instrument.
Twelve partially edentulous patients having bilaterally 1
to 5 mm of residual bone height and at least 5 mm bone width
below the maxillary sinuses as measured on CT scans were
randomized to receive two 2-stage sinus lift procedures using
the lateral window approach. In one side the sinus lining the
membrane was elevation with nasal suction technique and
ultrasonic surgery approach whereas the contralateral side the
membrane was elevation after osteotomy prepared using a round
oral surgery bur. Standard sinus membrane elevation procedures
were performed in 12 sinus (group 1) and 12 sinus membranes
elevation (group 2) procedure were performed with application
of nasal suction and ultrasonic surgery device (Fig. 1 and 2).
In the group 1 (control) an osteotomy was prepared using a
round oral surgery bur with saline irrigation.
Elevation of the sinus lining was completed by using
standard sinus lift instruments.
In the group 2 (test) an osteotomy was prepared using a
ultrasonic surgery with nasal suction technique and elevation
of the sinus lining was completed by using standard sinus lift
instruments.
After lateral bony window with a ultrasonic surgery device
a nasopharyngeal airway inserted into the ipsilateral nostril. The
suction line was attached to a standard surgical suction device.
The effect of the negative air pressure within the sinus was
manifested by inversion and inward displacement of the sinus
lining. Elevation of the sinus lining was completed by using
standard sinus lift instruments.
The incidence of sinus membranes perforation was
evaluated.
Statistical analysis
The statistical analysis of the percentages of sinus membrane
perforation was carried out using the Chi-square test according
to the Statistical Package for Social Science (SPSS 8.0). p <0.05
is to be considered as significant (7).
F
O
RESULTS
No intraoperative or postoperative complications were
observed in any patients
In the group 1 (control), a four small perforation of
membrane (< 5 mm) was observed. In the group 2 (test)
no perforation of membranes was observed.
The application of nasal suction through the ipsilateral
nostril resulted in the inversion of the sinus membrane
around the edges of the lateral access window. This made
the sinus lifting easier and less prone to perforations, as
P
O
R
Fig. 1. Application of nasal suction through the nostril on
ipsilateral side as the sinus elevation being carried out. The
suction device is attached to a standard surgical suction
equipment.
Fig. 2. Instantaneous and complete membrane elevation on
applying nasal suction without instrumentation.
F
119 (S)
European Journal of Inflammation
the need for extensive instrumentation was significantly
eliminated.
Statistical analysis
A statistically significant difference was present
between the incidence of sinus membrane perforation in
group I vs. II (control vs. test) p-value = 0.08.
2.
3.
DISCUSSION
Since 1980, when Boyne and James first published
about sinus lift procedure, a number of studies have been
carried out (8). The most commonly reported complication
of sinus augmentation is membrane perforation (9).
Preferred management of membrane perforations is not
clearly defined in the literature. Small perforations usually
do not need treatment because the membrane folds itself
during the elevation (10). Large perforations are usually
managed by use of a membrane, use of a block graft instead
of a cancellous graft, or abandonment of the procedure
(11). The clinical significance of sinus perforation is
controversial. The success of sinus grafting is dependent
primarily on the neovascularization of the graft mass,
which is reported to derive mainly from the sinus floor.
Consequently, it is assumed that the regenerative result
of the bone grafting procedure is inferior following sinus
membrane perforations (12). The results presented in the
present study illustrate a simple technique through which it
was possible to control perforation of sinus membrane. No
sinus membrane perforation was observed, during sinus
lift in the group 2. Moreover, there is evidence to show
that the success of implantation correlates inversely with
the size of the tear that occurs within the sinus membrane.
Suggesting that either prevention or satisfactory repair of
perforations of sinus membrane is a prerequisite for the
predictability of this procedure. Consequently, is very
important to prevent perforations of sinus membrane.
In the present study was conducted to evaluate the
feasibility and efficacy of sinus membrane elevation with
nasal suction technique and ultrasonic surgery approach.
The present study confirm the results of precedent
search results (13). The main limitation of the present
investigation was the small sample size. In conclusion
the sinus lift with ultrasonic surgery and nasal suction
technique to prevent a perforation of sinus membrane.
4.
with autogenous marrow and bone. J Oral Surg 1980; 38:
613-6.
Jensen J, Simonsen EK, Sindet-Pedersen S. Reconstruction
of the severely resorbed maxilla with bone grafting and
osseointegrated implants: a preliminary report. J Oral
Maxillofac Surg 1990; 48:27-32; discussion 33.
Tidwell JK, Blijdorp PA, Stoelinga PJ, Brouns JB,
Hinderks F. Composite grafting of the maxillary sinus for
placement of endosteal implants. A preliminary report of
48 patients. Int J Oral Maxillofac Surg 1992; 21:204-9.
Proussaefs P, Lozada J, Kim J. Effects of sealing the
perforated sinus membrane with a resorbable collagen
membrane: a pilot study in humans. J Oral Implantol 2003;
29:235-41.
Proussaefs P, Lozada J, Kleinman A. The “Loma Linda
stent”: a screw-retained resin stent. J Oral Implantol 2003;
29:19-23.
Oh E, Kraut RA. Effect of sinus membrane perforation on
dental implant integration: a retrospective study on 128
patients. Implant Dent; 20:13-9.
Colton T. Statistics in Medicine. Boston: Little, Brown and
Company; 1974.
Scarano A, Degidi M, Iezzi G, Pecora G, Piattelli M,
Orsini G, Caputi S, Perrotti V, Mangano C, Piattelli A.
Maxillary sinus augmentation with different biomaterials:
a comparative histologic and histomorphometric study in
man. Implant Dent 2006; 15:197-207.
Karabuda C, Arisan V, Hakan O. Effects of sinus membrane
perforations on the success of dental implants placed in the
augmented sinus. J Periodontol 2006; 77:1991-7.
Aimetti M, Romagnoli R, Ricci G, Massei G. Maxillary
sinus elevation: the effect of macrolacerations and
microlacerations of the sinus membrane as determined by
endoscopy. Int J Periodontics Restorative Dent 2001; 21:
581-9.
Sailer HF. A new method of inserting endosseous implants
in totally atrophic maxillae. J Craniomaxillofac Surg 1989;
17:299-305.
Ardekian L, Oved-Peleg E, Mactei EE, Peled M. The
clinical significance of sinus membrane perforation during
augmentation of the maxillary sinus. J Oral Maxillofac
Surg 2006; 64:277-82.
Ucer C. Nasal suction technique for maxillary sinus floor
elevation: a report of 24 consecutive patients. Int J Oral
Maxillofac Implants 2009; 24:1138-43.
F
O
O
R
P
REFERENCES
1.
Boyne PJ, James RA. Grafting of the maxillary sinus floor
5.
6.
7.
8.
9.
10.
11.
12.
13.
P
O
R
F
O
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
EVALUATION OF A MIR-146A POLYMORPHISM IN ORAL SQUAMOUS
CELL CARCINOMA ORIGIN AND PROGRESSION
A. PALMIERI1, F. CARINCI1, M. MARTINELLI2, F. PEZZETTI2,
A. GIRARDI2, F. FARINELLA1, C. RUBINI3, P. BONELLI4 and L. SCAPOLI2
F
O
Department of D.M.C.C.C, Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
Department of Histology, Embryology and applied Biology University of Bologna, Bologna, Italy
3
Anatomical Pathology Unit, Polytechnic University of the Marche Region, Ancona, Italy
4
Experimental Pharmacology, Department of Research, National Cancer Institute G Pascale, Naples, Italy
1
2
Recent evidence indicates that microRNAs affect cell growth, differentiation, apoptosis, and play a role
in tumorigenesis. Large scale screening suggested that mir-146a was related to oral squamous cell carcinoma
development and progression. The common polymorphism rs2910164, able to modulate mir-146a expression
appeared related to the onset of different cancers, including carcinoma. A sample set of 360 oral squamous
cell carcinoma was genotyped to test association between rs2910164 and cancer occurrence as well as cancer
progression. No significant levels of association with any allele or genotype was found, however a slight increase
of the variant allele was observed in stage II tumors. Further studies could help to understand if rs2910164 may
considered a risk factor for oral carcinoma.
O
R
Oral cavity cancers are among the most common
cancer, with estimated worldwide annual age-standardized
incidence of 3.8/100,000 and mortality of 1.9/100,000 (1).
The vast majority of these cancers are oral squamous cell
carcinoma (OSCC). Recognized risk factors for OSCC,
such as tobacco and alcohol consumption, are suspected
to promote tumor progression by increasing the DNA
damage rate (2).
OSCCs generally exhibit poor prognosis. The
occurrence of metastasis, that are the main cause of death,
significantly correlates with clinical stage, localization
of the primary tumor, degree of deep infiltration and cell
differentiation. However, prognosis of primary OSCC is
difficult to predict basing on histopathological parameters
alone. Reliable molecular markers with a predictive value
could represent important tools for clinicians who intend
to plan personalized treatments for OSCC patients.
The identification of tumor progression markers
- useful to improve diagnoses, plane treatment and
implement prognosis - represents a major goal of scientific
community. In spite of the intense research effort, no
striking results for OSCC have been obtained till now.
Large scale approaches helped to dissect frequent genetic
changes involved in tumor development and progression,
such as chromosome aberration or variations in gene
expression profiles.
Recently, a new class of molecules able to modulate
gene expression levels was considered appealing
biomarkers of tumor progression (3). MicroRNAs
(miRNAs), small (18-22 nt) non-coding RNAs, cleaved
from 60- to 110-nt hairpin precursors, are able to trigger
degradation of specific mRNAs (4, 5). MiRNAs are
involved in various biological processes, including cell
proliferation and cell death during development, stress
resistance and metabolism (6) and because of their
extraordinary tissue-specificity have been proposed as a
tool to diagnosing and classifying primary cancers and
their metastases (7, 8). Our research group has recently
investigated miRNA expression profile of OSCC by
oligonucleotide microarray hybridization (9). A number
of aberrant expressed miRNAs potentially implicated in
OSCC origin and progression were identified. The subject
of the present investigation was the mir-146a, a member
of a small group of miRNA that was found useful in
discriminating OSCC with lymphnode metastasis. Indeed
mir-146a was found significantly underexpressed among
P
Key words: Oral squamous cell carcinoma, micro RNA, single nucleotide polymorphism, metastasis.
Corresponding author: Prof. Francesco Carinci, M.D
Department of D.M.C.C.C., Section of Maxillofacial Surgery
University of Ferrara Corso Giovecca 203
44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
121
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
122 (S)
A. PALMIERI ET AL.
OSCC with lymphnode metastasis. Interestingly, it was
described a common polymorphism in mir-146a gene
having a significant functional impact. Indeed the G>C
substitution produces a mismatch in the predicted pre-mir146a hairpin structure that results in a reduced amount of
mature miR-146a. This SNP, named rs2910164, has been
related to papillary thyroid carcinoma (10), breast cancer
(11), prostate cancer (12) and hepatocellular carcinoma
(13) susceptibility. Altogether, these evidences prompted
us to investigate rs2910164 in OSCC in order to verify
association with tumor susceptibility and progression.
MATERIALS AND METHODS
The sample included 360 OSCC patients diagnosed at the
Anatomical Pathology Unit, Polytechnic University of the
Marche Region, Ancona, Italy. Tumors sites were limited to
the oral cavity in its strictest definition as defined by the Union
Internationale Contre le Cancer (UICC) code ICD-O C02–C06,
which includes tongue and excludes tonsil and laryngeal cancer
(14). Age, sex and tumor stage distribution of the bulk of cases
was previously described, as well as procedures for genomic
DNA isolation (15). Control population genotypes were obtained
from published data, i.e. the “Toscani in Italia” (TSI) population
from HapMap project and a German sample from a paper by
Catucci and colleagues (16).
Genotypes of rs2910164 were obtained with a specific
Applied Biosystems assay using the TaqMan chemistry and the
ABI PRISM 7500 Real-Time PCR System. Hardy–Weinberg
equilibrium was tested by comparing the observed and expected
genotype frequencies using the Pearson’s χ2 test. Allelic
association was investigated by 2x2 contingency tables and MidP exact test. Data were further investigated with 2x2 contingency
tables by combining heterozygous genotype with either one of
the homozygous genotype in a dominant or recessive mode of
inheritance. Odds ratios were obtained by conditional maximum
likelihood estimation. To account for multiple comparisons the
Bonferroni correction was adopted; the threshold was 0.05/6 =
0.008.
F
O
RESULTS
A case control association study was performed to
verify whether the inherited polymorphisms rs2910164
at mir-146a gene could influence the risk to develop
OSCC or whether it could be related to metastasis
production or cancer stage. Genotypes obtained from
347 OSCC specimens were distributed accordingly to
Hardy-Weinberg equilibrium. The allelic association
test indicated that patient allele frequency at each locus
did not significantly differ with respect to controls from
Germany or Toscana (Table 1). No deviation from the null
was observed with the genotypic association tests.
In order to test association between rs2910164 and
tumor progression genotypes were stratified basing on
metastasis or UICC stage. Tests of association were
performed to compare non-metastatic tumors versus
metastatic tumor and stage groups separated by a single
step, i.e. control vs. stage I, stage I vs. stage II, stage
II vs. stage III, and stage III vs. stage IV. Among these
evaluation, significant association was observed only in
the comparison stage I vs. stage II; indeed the rare allele C
was more frequent in stage II (P value = 0.02). The variant
allele carriers shown higher probability to progress at
stage II, odds ratio 1.75 (95% C.I. 0.99-3.10), while the
O
R
P
Table 1. Genotypes distribution at rs2910164 and test for allele frequency difference.
GG
200
GC
126
CC
21
MAFa
0.24
P value
ref.
536
50
318
31
50
7
0.23
0.26
0.57
0.71
252
87
146
51
91
32
15
4
0.24
0.23
ref
0.79
139
85
48
6
0.22
0.57b
II
74
35
31
8
0.32
0.02c
III
46
26
17
3
0.25
0.26c
IV
79
51
26
2
0.19
0.26c
OSCC
Controls
Germany
Tuscany
lymph node metastasis
N0
N1
tumor grade
I
n
347
Minor allele frequency
a
Test for difference respect TSI controls
b
Test for difference respect previous grade
c
F
123 (S)
European Journal of Inflammation
odds ratio for homozygotes was 3.23 (95% C.I. 1.0510.02). However, no test produced a significant deviation
from the null when the threshold level was lowered to
account of the multiple comparison.
DISCUSSION
An increasing body of evidence relating mir-146a
expression levels and cancer has been recently published.
Overexpression of mir-146a was observed in OSCC and
cervical cancer, a feature that was associate with worse
survival for squamous cell lung cancer (17-19). On the
other hand, low level of mir-146a expression was found in
cervical cancer cell lines and hormone-refractory prostate
cancer (18) (20). Ectopic expression of miR-146a was
able to inhibit migration, invasion, and occurrence of
metastasis in different experimental models (21, 22). Our
previous observation in OSCC suggest that mir-146 could
play a critical role in cancer development and progression,
being overexpressed in lymph node metastasis negative
OSCC and downregulated in lymph node metastasis
positive OSCC (9). The evidence that a SNP in mir-146a
gene can influence the expression of the active form of
mir-146a (10) prompted us to investigate whether it could
influence OSCC development and progression.
Data obtained from 347 OSCC indicate that genotype
of rs2910164 in mir-146a gene is not associated to cancer
development, indeed allele and genotype frequency
in case and controls were similar. Although mir-146a
expression drop was found related to lymph node
metastasis occurrence, this important step in tumor
progression did not appeared associated with rs2910164
alleles or genotypes. On the other hand a slight increase
of variant allele frequency was observed among tumors
of grade II. This difference was significant at nominal
level but not at the more stringent level corrected for
multiple comparisons. Additional investigation could
verify if this trend was due to chance or to biological
basis. If true, a possible interpretation is that the lower
mir-146a expressivity due to the rare allele of rs2910164
may confer a tumor advantage to pass to the stage II; this
little advantage become not relevant compared with the
more dramatically events necessary for stages III and IV
progression.
The effect of rs2910164 appeared more relevant in
other tumors. Indeed it predisposed to papillary thyroid
carcinoma (10), prostate cancer (23), breast cancer (12),
and cervical squamous cell carcinoma (24); however
conflicting data were reported (16).
Toscana O.N.L.U.S., by Fondazione Cassa di Risparmio
di Ferrara, and by FAR from the University of Ferrara
(FC), Ferrara, Italy
REFERENCES
F
O
1.
Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin
DM. Estimates of worldwide burden of cancer in 2008:
GLOBOCAN 2008. Int J Cancer; 127:2893-917.
2. Scully C, Bagan J. Oral squamous cell carcinoma overview.
Oral Oncol 2009; 45:301-8.
3. Croce CM. Causes and consequences of microRNA
dysregulation in cancer. Nat Rev Genet 2009; 10:704-14.
4. Ambros V. The functions of animal microRNAs. Nature
2004; 431:350-5.
5. Tsuchiya S, Okuno Y, Tsujimoto G. MicroRNA: biogenetic
and functional mechanisms and involvements in cell
differentiation and cancer. J Pharmacol Sci 2006; 101:26770.
6. Bentwich I. Prediction and validation of microRNAs and
their targets. FEBS Lett 2005; 579:5904-10.
7. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J,
Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando
AA, Downing JR, Jacks T, Horvitz HR, Golub TR.
MicroRNA expression profiles classify human cancers.
Nature 2005; 435:834-8.
8. Rosenfeld N, Aharonov R, Meiri E, Rosenwald S, Spector
Y, Zepeniuk M, Benjamin H, Shabes N, Tabak S, Levy A,
Lebanony D, Goren Y, Silberschein E, Targan N, BenAri A, Gilad S, Sion-Vardy N, Tobar A, Feinmesser M,
Kharenko O, Nativ O, Nass D, Perelman M, Yosepovich
A, Shalmon B, Polak-Charcon S, Fridman E, Avniel A,
Bentwich I, Bentwich Z, Cohen D, Chajut A, Barshack I.
MicroRNAs accurately identify cancer tissue origin. Nat
Biotechnol 2008; 26:462-9.
9. Scapoli L, Palmieri A, Lo Muzio L, Pezzetti F, Rubini C,
Girardi A, Farinella F, Mazzotta M, Carinci F. MicroRNA
expression profiling of oral carcinoma identifies new
markers of tumor progression. Int J Immunopathol
Pharmacol; 23:1229-34.
10. Jazdzewski K, Murray EL, Franssila K, Jarzab B,
Schoenberg DR, de la Chapelle A. Common SNP in
pre-miR-146a decreases mature miR expression and
predisposes to papillary thyroid carcinoma. Proc Natl Acad
Sci U S A 2008; 105:7269-74.
11. Pastrello C, Polesel J, Della Puppa L, Viel A, Maestro R.
Association between hsa-mir-146a genotype and tumor
age-of-onset in BRCA1/BRCA2-negative familial breast
and ovarian cancer patients. Carcinogenesis; 31:2124-6.
12. Hu Z, Liang J, Wang Z, Tian T, Zhou X, Chen J, Miao
O
R
P
ACKNOWLEDGMENTS
This work was supported by: Associazione Tumori
124 (S)
13.
14.
15.
16.
A. PALMIERI ET AL.
R, Wang Y, Wang X, Shen H. Common genetic variants
in pre-microRNAs were associated with increased risk of
breast cancer in Chinese women. Hum Mutat 2009; 30:7984.
Hishida A, Matsuo K, Goto Y, Naito M, Wakai K, Tajima
K, Hamajima N. Combined Effect of miR-146a rs2910164
G/C Polymorphism and Toll-like Receptor 4 +3725 G/C
Polymorphism on the Risk of Severe Gastric Atrophy in
Japanese. Dig Dis Sci.
International Union Against Cancer U. TNM classification
of malignant tumors. New York: Wiley-Liss; 2002.
Scapoli L, Palmieri A, Rubini C, Martinelli M, Spinelli
G, Ionna F, Carinci F. Low prevalence of human
papillomavirus in squamous-cell carcinoma limited to oral
cavity proper. Mod Pathol 2009; 22:366-72.
Catucci I, Yang R, Verderio P, Pizzamiglio S, Heesen
L, Hemminki K, Sutter C, Wappenschmidt B, Dick M,
Arnold N, Bugert P, Niederacher D, Meindl A, Schmutzler
RK, Bartram CC, Ficarazzi F, Tizzoni L, Zaffaroni
D, Manoukian S, Barile M, Pierotti MA, Radice P,
Burwinkel B, Peterlongo P. Evaluation of SNPs in miR146a, miR196a2 and miR-499 as low-penetrance alleles
in German and Italian familial breast cancer cases. Hum
Mutat; 31:E1052-7.
Chang SS, Jiang WW, Smith I, Poeta LM, Begum S,
Glazer C, Shan S, Westra W, Sidransky D, Califano JA.
MicroRNA alterations in head and neck squamous cell
carcinoma. Int J Cancer 2008; 123:2791-7.
F
O
O
R
P
17.
18. Wang X, Tang S, Le SY, Lu R, Rader JS, Meyers C,
Zheng ZM. Aberrant expression of oncogenic and tumorsuppressive microRNAs in cervical cancer is required for
cancer cell growth. PLoS One 2008; 3:e2557.
19. Raponi M, Dossey L, Jatkoe T, Wu X, Chen G, Fan H,
Beer DG. MicroRNA classifiers for predicting prognosis
of squamous cell lung cancer. Cancer Res 2009; 69:577683.
20. Lin SL, Chiang A, Chang D, Ying SY. Loss of mir-146a
function in hormone-refractory prostate cancer. Rna 2008;
14:417-24.
21. Bhaumik D, Scott GK, Schokrpur S, Patil CK, Campisi J,
Benz CC. Expression of microRNA-146 suppresses NFkappaB activity with reduction of metastatic potential in
breast cancer cells. Oncogene 2008.
22. Hurst DR, Edmonds MD, Scott GK, Benz CC, Vaidya
KS, Welch DR. Breast cancer metastasis suppressor 1
up-regulates miR-146, which suppresses breast cancer
metastasis. Cancer Res 2009; 69:1279-83.
23. Xu B, Feng NH, Li PC, Tao J, Wu D, Zhang ZD, Tong
N, Wang JF, Song NH, Zhang W, Hua LX, Wu HF.
A functional polymorphism in Pre-miR-146a gene is
associated with prostate cancer risk and mature miR-146a
expression in vivo. Prostate; 70:467-72.
24. Zhou B, Wang K, Wang Y, Xi M, Zhang Z, Song Y, Zhang
L. Common genetic polymorphisms in pre-microRNAs
and risk of cervical squamous cell carcinoma. Mol
Carcinog.
F
EUROPEAN JOURNAL OF INFLAMMATION
Vol. 9, no. 1 (S), 0-0 (2011)
PEPTIDE-15 STIMULATES PULP STEM CELLS TOWARDS
OSTEOBLASTS DIFFERENTIATION
V. SOLLAZZO1, S. FANALI2, E. MASIERO3, A. GIRARDI3, F. FARINELLA4,
E. MELLONI5, F. PEZZETTI3, C. IACCARINO6, G. ZAULI7, F. CARINCI3
F
O
Orthopedic Clinic, University of Ferrara, Ferrara, Italy
Department of Oral Science, Nano and Biotechnology, University “G. D’Annunzio”, Chieti, Italy
3
Department of Histology, Embryology and Applied Biology, Centre of Molecular Genetics, CARISBO
Foundation, University of Bologna, Bologna, Italy
4
Department of D.M.C.C.C., Section of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy
5
Department of Morphology and Embryology, University of Ferrara, Ferrara, Italy
6
”Hub & Spoke” Neurosurgery Unit-Emergency Department, University Hospital of Parma, Parma, Italy
7
Institute for Maternal and Child Health, IRCCS “Burlo Garofolo”, Trieste, Italy
1
2
O
R
Peptide-15 (P-15) is a bone augmentation material analog to the cell binding domain of collagen. P-15 competes
for cell surface sites for attachment of collagen and, when immobilized on surfaces, it promotes adhesion of cells
and facilitates physiological process like binding, migration and differentiation of cells. To study how P15 can
induce osteoblast differentiation and proliferation in mesenchymal stem cells, the expression levels of bone related
genes (RUNX2, SP7, ALPL, SPP1, COL1A1, COL3A1 and FOSL1) and mesenchymal stem cells marker (ENG)
were measured in Dental Pulp Stem Cells (DPSCs) and Normal Osteoblast (NO), after 15 and 30 days of treatment.
Significantly, differentially expressed genes among DPSCs and NO were SP7, ENG, RUNX2, COL3A1, COL1A1,
ALPL and SPP1 in the first 15 days of treatment and ENG, RUNX2, COL31A, COL1A1, SPP1 and ALPL after
30 days. The present study demonstrated that P15 influences the behavior of DPSCs in vitro by enhancing
proliferation, differentiation and deposition of matrix.
P
Large bone defects still represent a major problem in
orthopedics and maxillofacial surgery. Several researches
have been involved in the identification of factors that
could help in the regeneration of lost tissue (1). One
avenue of research has been the identification of the
specific cell-binding domain of type I collagen (2). Type I
collagen represents approximatively one third of the body
proteins. Collagen, moreover, is a major determinant of
the architecture and tensile strength of the tissues, and it
modulates cell proliferation, migration, differentiation, and
specific gene expression (3). P-15 (Ceramed, Lakewood,
CO) is an analog of the cell-binding domain of collagen
(3). P-15 competes for cell surface sites for attachment of
collagen and, when immobilized on surfaces, it promotes
adhesion of cells (4). P-15 has been shown to facilitate
physiological processes in a way similar to collagen,
to facilitate the exchange of mechanical signals, and
to promote cell differentiation (5, 6). Like other bone
augmentation materials, P-15 associated with anorganicderived bone matrix (ABM), has been shown to be helpful
in the treatment of periodontal defects, and sinus-lifting
procedures (7, 8)
Because few reports analyze the effects of P-15 on
stem cells (9) and none focus on the genetic effects, the
expression of genes related to the osteoblast differentiation
were analyzed using cultures of dental pulp stem cells
(DPSCs) treated with P-15.
Stem cells are a promising tool for tissue repair (10),
thanks to their extensive proliferation, differentiation
plasticity and their multipotent activity.
Dental pulp is a niche housing neural-crest-derived
stem cells easily accessible with a limited morbidity
Key words: P15; stem cells; biomaterial; gene expression; differentiation
Corresponding author: Prof. Francesco Carinci, M.D
Department of Maxillofacial Surgery
University of Ferrara
Corso Giovecca 203 44100 Ferrara Italy
E-mail: [email protected]
Web: www.carinci.org
Phone: +39.0532.455874 Fax: +39.0532.455582
0393-974X (2011)
125
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in financial and other penalties
126 (S)
V. SOLLAZZO ET AL.
of the anatomical site after collection of the pulp (11).
Several studied have been performed on dental pulp stem
cells (DPSCs) and they mainly found that these cells are
multipotent stromal cells that can be safety cryopreserved,
used with several scaffolds, that can extensively
proliferate, have a long lifespan and build in vivo an
adult bone with Havers channels and an appropriate
vascularisation (12).
To investigate the osteogenic differentiation of
DPSCs, after P15 treatment, the quantitative expression
of the mRNA of specific genes, like transcriptional factors
(RUNX2 and SP7), bone related genes (SPP1, COL1A1,
COL3A1, ALPL, and FOSL1) and mesenchymal stem
cells marker (ENG) were examined by means of real time
Reverse Transcription-Polymerase Chain Reaction (real
time RT-PCR).
CO2 at 37°C. The medium was changed the next day and every
3 days thereafter. After 15 days, the pieces of bone tissue were
removed from the culture flask. Cells were harvested after 30
days of incubation.
Cell culture
For the assay, DPSCs and NO at second passage were
trypsinized upon subconfluence and cultivated with 10 μl/ml of
P15 (Ceramed, Lakewood, CO).
Another set of wells containing cells seeded without P15
was used as control. The medium was changed every 3 days.
The cells were maintained in a humidified atmosphere of 5%
CO2 at 37°C.
Cells were harvested at two time points, 15 and 30 days,
for RNA extraction. Quantitative real-time reverse-transcriptase
polymerase chain reaction was performed to measure mRNA
expression of several osteogenic marker genes.
F
O
O
R
MATERIALS AND METHODS
Stem cells isolation from dental pulp
Human dental germ pulp from third molars was extracted
from healthy subjects aged 20-25 years, following informed
consent. Dental pulp, extracted with a Gracey curette, was
immersed in a digestion solution (3 mg/ml type I collagenase,
4 mg/ml dispase, in 4 ml phosphate-buffered saline (PBS)
supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin,
and 500 µg/ml claritromycin) for 1 h at 37 °C. Once digested,
the solution was filtered with 70 µm Falcon strainers (Sigma
Aldrich, Inc., St Louis, Mo, USA).
After filtration, cells were immersed in α-MEM culture
medium (Sigma Aldrich, Inc., St Louis, Mo, USA) supplemented
with 20% FCS, 100 µM 2P-ascorbic acid, 2 mM L-glutamine,
100 U/ml penicillin, 100 µg/ml streptomycin and placed in
75 ml flasks. Flasks were incubated at 37°C and 5% CO2 and
the medium changed twice a week. Just before cells become
confluent, they were subdivided into new flasks.
DPSCs were characterized for staminality by flow
cytometric analyses.
P
Flow cytometric analyses
The purity of cell cultures was determined by analysis of
different antigens after staining with fluorochrome (FITC- or
PE-) conjugated mAbs anti-human CD14-FITC, CD14-PE,
CD34-FITC, CD45-FITC, CD90-PE, CD105-PE (Immunotech,
Marseille, France) and analyzed by FACScan. The nonspecific
mouse IgG was used as isotype control (Immunotech). To avoid
nonspecific fluorescence from dead cells, live cells were gated
tightly using forward and side scatter.
Primary osteoblasts cell culture
Fragments of bone derived from skull of an healthy volunteers
were sampled during operation and transferred in 75 cm2 culture
flasks containing DMEM medium supplemented with 20% fetal
calf serum, antibiotics (Penicillin 100 U/ml and Streptomycin
100 micrograms/ml - Sigma Aldrich, Inc., St Louis, Mo, USA)
and amminoacids (L-Glutamine - Sigma Aldrich, Inc., St Louis,
Mo, USA). Cells were grown in a humidified atmosphere of 5%
RNA processing
Reverse transcription to cDNA was performed directly
from cultured cell lysate using the TaqMAN Gene Expression
Cells-to-Ct Kit (Ambion Inc., Austin, TX, USA), following
manufacturer’s instructions. Briefly, cultured cells were lysed
with lysis buffer and RNA released in this solution. Cell lysate
were reverse transcribed to cDNA using the RT Enzyme Mix
and appropriate RT buffer (Ambion Inc., Austin, TX, USA).
Finally the cDNA was amplified by real-time PCR using the
included TaqMan Gene Expression Master Mix and the specific
assay designed for the investigated genes.
Real time PCR
Expression was quantified using real time RT-PCR. The
gene expression levels were normalized to the expression of the
housekeeping gene RPL13A and were expressed as fold changes
relative to the expression of the untreated cells. Quantification
was done with the delta/ delta calculation method (13).
Forward and reverse primers and probes for the selected
genes were designed using primer express software (Applied
Biosystems, Foster City, CA, USA) and are listed in Table I.
All PCR reactions were performed in a 20 µl volume using
the ABI PRISM 7500 (Applied Biosystems, Foster City, CA,
USA). Each reaction contained 10 µl 2X TaqMan universal
PCR master mix (Applied Biosystems, Foster City, CA, USA),
400 nM concentration of each primer and 200 nM of the probe,
and cDNA. The amplification profile was initiated by 10-minute
incubation at 95°C, followed by two-step amplification of 15
seconds at 95°C and 60 seconds at 60°C for 40 cycles. All
experiments were performed including non-template controls to
exclude reagents contamination.
Statistical analyses
Comparison of the gene expression between DPSCs and NO
was performed with “Two tails ANOVA “statistic analyses using
Excel spreadsheets (Microsoft Office 2003).
RESULTS
Cell cultures were phenotipically characterized by
F
127 (S)
European Journal of Inflammation
Table I. Primer and probes used in real time PCR
Gene
symbol
Gene name
Primer sequence (5’>3’)
Probe sequence (5’>3’)
SPP1
osteopontin
F-GCCAGTTGCAGCCTTCTCA
R-AAAAGCAAATCACTGCAATTCTCA
CCAAACGCCGACCAAGGAAAACTCAC
COL1A1
collagen type I alpha1
F-TAGGGTCTAGACATGTTCAGCTTTGT
R-GTGATTGGTGGGATGTCTTCGT
CCTCTTAGCGGCCACCGCCCT
RUNX2
runt-related transcription
factor 2
F-TCTACCACCCCGCTGTCTTC
R-TGGCAGTGTCATCATCTGAAATG
ACTGGGCTTCCTGCCATCACCGA
ALPL
alkaline phospatasi
F-CCGTGGCAACTCTATCTTTGG
R-CAGGCCCATTGCCATACAG
CCATGCTGAGTGACACAGACAAGAAGCC
COL3A1
collagen, type III,
alpha 1
F-CCCACTATTATTTTGGCACAACAG
R-AACGGATCCTGAGTCACAGACA
ATGTTCCCATCTTGGTCAGTCCTATGCG
ENG
endoglin
F-TCATCACCACAGCGGAAAAA
R-GGTAGAGGCCCAGCTGGAA
TGCACTGCCTCAACATGGACAGCCT
FOSL1
FOS-like antigen 1
F-CGCGAGCGGAACAAGCT
R-GCAGCCCAGATTTCTCATCTTC
ACTTCCTGCAGGCGGAGACTGACAAAC
SP7
osterix
F-ACTCACACCCGGGAGAAGAA
R-GGTGGTCGCTTCGGGTAAA
TCACCTGCCTGCTCTTGCTCCAAGC
F-AAAGCGGATGGTGGTTCCT
R-GCCCCAGATAGGCAAACTTTC
CTGCCCTCAAGGTCGTGCGTCTG
O
R
P
RPL13A
ribosomal protein L13
Table II. Differentially expressed genes between DPSCs and NO
after 15 days of treatment
Genes
SP7
ENG
FOSL1
RUNX2
COL3A1
COL1A1
ALPL
SPP1
DPSCs
F
O
NO
Log10 RQ Log10 RQ
-0,38
-0,93
0,14
-0,26
-0,18
-0,30
-0,05
-0,61
0,19
-0,38
0,34
-0,08
0,35
-1,18
0,66
-0,08
Differentially
expressed genes
p<0,005
0,013
0,001
0,125
0,001
0,001
0,001
0,001
0,030
flow cytometric analyses. Cell preparations derived from
dental pulp were homogenously CD105+, CD90+, CD34-,
CD45-, CD14-, which is a typical mesenchymal stem cells
surface antigen profile (Fig. 1)
To further investigate if P15 stimulates osteoblasts
differentiation and proliferation in DPSCs, several
osteoblast genes (SP7, RUNX2, COL3A1, COL1A1,
ALPL, SPP1 and FOSL1) and mesenchymal stem cells
marker, were analyzed by quantitative real-time PCR.
Table III. Differentially expressed genes between DPSCs and
NO after 30 days of treatment.
Genes
SP7
ENG
FOSL1
RUNX2
COL3A1
COL1A1
ALPL
SPP1
DPSCs
NO
Log10 RQ Log10 RQ
-0,95
0,37
0,49
-0,45
0,91
-0,47
0,05
0,06
-0,38
0,04
-1,19
-0,28
-0,53
-0,15
1,74
-0,25
Differentially
expressed genes
p<0,005
0,569
0,018
0,213
0,001
0,019
0,001
0,001
0,016
DPSCs and NO were cultured with 10 μl/ml of P15 for
15 days and for 30 days.
After 15 days, the genes ENG, COL3A1, COL1A1,
ALPL and SPP1 genes were up-regulated in treated
DPSCs. The other genes SP7, FOSL1 and RUNX2 were
down-regulated (Fig. 2).
After 30 days of treatment, compared to the control
cells, the bone related genes ENG, FOSL1, SPP1 and
RUNX2 were up-regulated, while SP7, COL3A1,
128 (S)
V. SOLLAZZO ET AL.
F
O
Fig. 4. Gene expression in NO treated for 15 days with 10 μl/ml
of P15.
O
R
Fig. 1. Surface antigene profile of dental pulp stem cells.
Phenotypic characterization by flow cytometry of cell cultures
derived from dental pulp, by staining with the indicated
mAb. Representative dot plots documenting the purity of cell
preparations and the homogenously CD105+, CD90+, CD34-,
CD45-, CD14- surface antigen profile, are shown. Irr., irrelevant,
isotype control Ab.
P
Fig. 2. Gene expression in DPSCs treated for 15 days with 10
μl/ml of P15.
Fig. 5. Gene expression in NO treated for 30 days with 10 μl/ml
of P15.
COL1A1 and ALPL were decreased (Fig. 3).
Treated NO shows different results. After 15 days all
osteoblast related genes were down-regulated (Fig. 4).
After 30 days the bone related genes SP7, RUNX2,
and COL3A1 were up-regulated, while ENG, FOSL1,
COL1A1, ALPL and SPP1 were decreased (Fig. 5).
Comparing, by “Two tails ANOVA”, the relative
expression of the analyzed genes between DPSCs and NO
we observed that significantly differentially expressed genes
at 15 days of treatment were SP7, ENG, RUNX2, COL3A1,
COL1A1, ALPL and SPP1 (Table II). After 30 days of
treatment, the differentially expressed genes were ENG,
RUNX2, COL31A, COL1A1, SPP1 and ALPL (Table III).
DISCUSSION
Fig. 3. Gene expression in DPSCs treated for 30 days with 10
μl/ml of P15.
P-15 is a highly conserved linear peptide with a 15amino acid sequence identical to the sequence contained
in the residues 766-780 of the alpha chain of type I
collagen (1).
Dental pulp stem cells (DPSCs) display different
antigenic patterns and noticeable plasticity that is
F
129 (S)
European Journal of Inflammation
explained by their neural-crest origin (14, 15). In addition,
they can be collected easily and pulpectomy itself is a
therapy in some cases (16).
To study the mechanism by which P15 induce
differentiation and proliferation in DPSCs the expression
levels of bone related genes were analyzed using real time
Reverse Transcription-Polymerase Chain Reaction.
The study was first conducted on DPSCs, to evaluate
the genes that are activated during the stem cells
differentiation inducted by P15. Then was extended to
NO to compare the genetic profiling of differentiated stem
cells with osteoblast after P15 treatment.
Two tails ANOVA analyses showed that the
significantly differentially expressed genes among the
two group were SP7, ENG, RUNX2, ALPL, COL3A1,
COL1A1 and SPP1 in the first 15 days of treatment and
ENG, COL3A1, COL1A1, SPP1, RUNX2 and ALPL after
30 days.
P15 cause down-regulation of RUNX2 both in DPSCs
than in NO in the first 15 day of treatment. It expression
increased in the next 30 days.
RUNX2 a transcriptional factor, activated in the first
stage of differentiation, is fundamental for osteoblast
differentiation and mineralization
SP7, another transcriptional factor involved in
bone formation and osteoblast differentiation (17), was
differentially expressed in DPSCs and NO.
SP7 was down-regulated during the first 15 days of
treatment both in DPSCs than in NO.
P15 also modulate the expression of collagenic
extracellular matrix genes, collagen type 1α1 (COL1A1)
and collagen type 3α1 (COL3A1).
After 15 days, in treated DPSCs was observed the
up-regulation of COL1A1 and COL3A1. Instead in NO,
the two collagens type were down-regulated. Collagen
expression, at 30 days of treatment, decrease in DPSCs. In
NO, COL3A1 was up-regulated and COL1A1 was downregulated probably because P15 induce differentiation
and matrix synthesis in the early stages of osteoblasts
differentiation and proliferation.
Type I collagen synthesis is associated with osteoblast
differentiation in the early stage, followed by the synthesis
of ALP (18) .
In this study, ALPL was up-regulated in the first 15
days of treatment, only in DPSCs. Increasing in ALPL
expression is associated with osteoblast differentiation
(19).
P15 induce up-regulation of SPP1 for all the period
of the treatment in DPSCs. In NO this gene was downregulated.
SPP1
encodes
osteopontin,
which
is
a
phosphoglycoprotein of bone matrix and it is the most
representative non collagenic component of extracellular
bone matrix. It is actively involved in bone resorbitive
processes directly by ostoclasts (20,21).
ENG, a surface markers used to define a bone
marrow stromal cell population capable of multilineage
differentiation (22) was up-regulated in DPSCs and
down-regulated in NO for the entire treatment. The
disappearance of the ENG antigen during osteogenesis
suggests that this protein, is involved in the regulation of
osteogenesis (26).
The present study demonstrated that P15 influences
the behavior of DPSCs in vitro by enhancing proliferation,
differentiation and deposition of matrix as demonstrated
by the activation of osteoblast related genes RUNX2,
COL1A1 and SPP1.
The obtained results can be relevant to better
understand the molecular mechanism by which P15
induces bone regeneration in the lost tissue.
P
O
R
F
O
REFERENCES
1.
2.
3.
4.
5.
6.
7.
Yukna RA, Callan DP, Krauser JT, Evans GH, AichelmannReidy ME, Moore K, Cruz R, Scott JB. Multi-center
clinical evaluation of combination anorganic bovinederived hydroxyapatite matrix (ABM)/cell binding peptide
(P-15) as a bone replacement graft material in human
periodontal osseous defects. 6-month results. J Periodontol
1998; 69:655-63.
Yukna RA, Krauser JT, Callan DP, Evans GH, Cruz R,
Martin M. Multi-center clinical comparison of combination
anorganic bovine-derived hydroxyapatite matrix (ABM)/
cell binding peptide (P-15) and ABM in human periodontal
osseous defects. 6-month results. J Periodontol 2000; 71:
1671-9.
Bhatnagar RS, Qian JJ, Gough CA. The role in cell binding
of a beta-bend within the triple helical region in collagen
alpha 1 (I) chain: structural and biological evidence for
conformational tautomerism on fiber surface. J Biomol
Struct Dyn 1997; 14:547-60.
Qian JJ, Bhatnagar RS. Enhanced cell attachment to
anorganic bone mineral in the presence of a synthetic
peptide related to collagen. J Biomed Mater Res 1996; 31:
545-54.
Yang XB, Bhatnagar RS, Li S, Oreffo RO. Biomimetic
collagen scaffolds for human bone cell growth and
differentiation. Tissue Eng 2004; 10:1148-59.
Lallier TE, Yukna R, St Marie S, Moses R. The putative
collagen binding peptide hastens periodontal ligament
cell attachment to bone replacement graft materials. J
Periodontol 2001; 72:990-7.
Yukna RA, Krauser JT, Callan DP, Evans GH, Cruz R,
130 (S)
8.
9.
10.
11.
12.
V. SOLLAZZO ET AL.
Martin M. Thirty-six month follow-up of 25 patients
treated with combination anorganic bovine-derived
hydroxyapatite matrix (ABM)/cell-binding peptide (P-15)
bone replacement grafts in human infrabony defects. I.
Clinical findings. J Periodontol 2002; 73:123-8.
Schilephake H. Bone growth factors in maxillofacial
skeletal reconstruction. Int J Oral Maxillofac Surg 2002;
31:469-84.
Smiler D, Soltan M, Lee JW. A histomorphogenic analysis
of bone grafts augmented with adult stem cells. Implant
Dent 2007; 16:42-53.
Bianco P, Robey PG. Stem cells in tissue engineering.
Nature 2001; 414:118-21.
Jo YY, Lee HJ, Kook SY, Choung HW, Park JY, Chung JH,
Choung YH, Kim ES, Yang HC, Choung PH. Isolation and
characterization of postnatal stem cells from human dental
tissues. Tissue Eng 2007; 13:767-73.
Papaccio G, Graziano A, d’Aquino R, Graziano MF,
Pirozzi G, Menditti D, De Rosa A, Carinci F, Laino G.
Long-term cryopreservation of dental pulp stem cells
(SBP-DPSCs) and their differentiated osteoblasts: a cell
source for tissue repair. J Cell Physiol 2006; 208:319-25.
Livak KJ, Schmittgen TD. Analysis of relative gene
expression data using real-time quantitative PCR and the
2(-Delta Delta C(T)) Method. Methods 2001; 25:402-8.
Laino G, d’Aquino R, Graziano A, Lanza V, Carinci F,
Naro F, Pirozzi G, Papaccio G. A new population of human
adult dental pulp stem cells: a useful source of living
autologous fibrous bone tissue (LAB). J Bone Miner Res
2005; 20:1394-402.
Laino G, Graziano A, d’Aquino R, Pirozzi G, Lanza V,
Valiante S, De Rosa A, Naro F, Vivarelli E, Papaccio G. An
approachable human adult stem cell source for hard-tissue
engineering. J Cell Physiol 2006; 206:693-701.
Gronthos S, Mankani M, Brahim J, Robey PG, Shi S.
Postnatal human dental pulp stem cells (DPSCs) in vitro
and in vivo. Proc Natl Acad Sci U S A 2000; 97:1362530.
Nishio Y, Dong Y, Paris M, O’Keefe RJ, Schwarz EM,
Drissi H. Runx2-mediated regulation of the zinc finger
Osterix/Sp7 gene. Gene 2006; 372:62-70.
Harris SE, Bonewald LF, Harris MA, Sabatini M, Dallas
14.
15.
16.
17.
18.
20.
F
O
O
R
P
13.
19.
S, Feng JQ, Ghosh-Choudhury N, Wozney J, Mundy GR.
Effects of transforming growth factor beta on bone nodule
formation and expression of bone morphogenetic protein
2, osteocalcin, osteopontin, alkaline phosphatase, and
type I collagen mRNA in long-term cultures of fetal rat
calvarial osteoblasts. J Bone Miner Res 1994; 9:855-63.
Turksen K, Bhargava U, Moe HK, Aubin JE. Isolation of
monoclonal antibodies recognizing rat bone-associated
molecules in vitro and in vivo. J Histochem Cytochem
1992; 40:1339-52.
Dodds RA, Connor JR, James IE, Rykaczewski EL,
Appelbaum E, Dul E, Gowen M. Human osteoclasts, not
osteoblasts, deposit osteopontin onto resorption surfaces:
an in vitro and ex vivo study of remodeling bone. J Bone
Miner Res 1995; 10:1666-80.
Ohtsuki C, Kamitakahara M, Miyazaki T. Bioactive
ceramic-based materials with designed reactivity for bone
tissue regeneration. J R Soc Interface 2009; 6 Suppl 3:
S349-60.
Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas
R, Mosca JD, Moorman MA, Simonetti DW, Craig S,
Marshak DR. Multilineage potential of adult human
mesenchymal stem cells. Science 1999; 284:143-7.
Jin HJ, Park SK, Oh W, Yang YS, Kim SW, Choi SJ.
Down-regulation of CD105 is associated with multilineage differentiation in human umbilical cord bloodderived mesenchymal stem cells. Biochem Biophys Res
Commun 2009; 381:676-81.
Barry FP, Boynton RE, Haynesworth S, Murphy JM,
Zaia J. The monoclonal antibody SH-2, raised against
human mesenchymal stem cells, recognizes an epitope on
endoglin (CD105). Biochem Biophys Res Commun 1999;
265:134-9.
Jakob M, Demarteau O, Schafer D, Hintermann B, Dick
W, Heberer M, Martin I. Specific growth factors during the
expansion and redifferentiation of adult human articular
chondrocytes enhance chondrogenesis and cartilaginous
tissue formation in vitro. J Cell Biochem 2001; 81:36877.
Haynesworth SE, Baber MA, Caplan AI. Cell surface
antigens on human marrow-derived mesenchymal cells are
detected by monoclonal antibodies. Bone 1992; 13:69-80.
21.
22.
23.
24.
25.
26.

Similar documents