1*1

Universite de Sherbrooke
Effets du peroxyde d'hydrogene sur la fonction placentaire : implication dans
la physiopathologie de la preeclampsie
par
Samuel Leblanc
Departement d'Obstetrique et Gynecologie
Memoire presente a la Faculte de medecine
en vue de l'obtention du grade de
maitre es sciences (M.Sc.) en physiologie
Avril 2009
Evaluateurs :
Dr Aziz Aris, departement d'obstetrique gynecologie
Dr Jean-Patrice Baillargeon, departement de medecine (endocrinologie)
Dr Guilain Boissonneault, departement de biochimie
1*1
Library and Archives
Canada
Bibliotheque et
Archives Canada
Published Heritage
Branch
Direction du
Patrimoine de I'edition
395 Wellington Street
Ottawa ON K1A 0N4
Canada
395, rue Wellington
Ottawa ON K1A 0N4
Canada
Your file Votre reference
ISBN: 978-0-494-65630-3
Our file Notre reference
ISBN: 978-0-494-65630-3
NOTICE:
AVIS:
The author has granted a nonexclusive license allowing Library and
Archives Canada to reproduce,
publish, archive, preserve, conserve,
communicate to the public by
telecommunication or on the Internet,
loan, distribute and sell theses
worldwide, for commercial or noncommercial purposes, in microform,
paper, electronic and/or any other
formats.
L'auteur a accorde une licence non exclusive
permettant a la Bibliotheque et Archives
Canada de reproduce, publier, archiver,
sauvegarder, conserver, transmettre au public
par telecommunication ou par ('Internet, prefer,
distribuer et vendre des theses partout dans le
monde, a des fins commerciales ou autres, sur
support microforme, papier, electronique et/ou
autres formats.
The author retains copyright
ownership and moral rights in this
thesis. Neither the thesis nor
substantial extracts from it may be
printed or otherwise reproduced
without the author's permission.
L'auteur conserve la propriete du droit d'auteur
et des droits moraux qui protege cette these. Ni
la these ni des extraits substantiels de celle-ci
ne doivent etre imprimes ou autrement
reproduits sans son autorisation.
In compliance with the Canadian
Privacy Act some supporting forms
may have been removed from this
thesis.
Conformement a la loi canadienne sur la
protection de la vie privee, quelques
formulaires secondaires ont ete enleves de
cette these.
While these forms may be included
in the document page count, their
removal does not represent any loss
of content from the thesis.
Bien que ces formulaires aient inclus dans
la pagination, il n'y aura aucun contenu
manquant.
1+1
Canada
RESUME
Des travaux anterieurs effectues dans notre laboratoire ont demontre une
correlation entre les nivaux circulants de peroxyde d'hydrogene (H2O2) et
d'hormone gonadotrophine chorionique humaine (hCG) chez des femmes souffrant
de preeclampsie (Kharfi et al,. 2005). Le peroxyde d'hydrogene etant surtout connu
pour ses effets cytotoxiques, nous avons determine quels etaient ses effets sur des
cellules placentaires in vitro, en rapport aux conditions retrouvees in vivo chez des
femmes preeclamptiques. Pour ce faire, nous avons developpe un modele d'etude
de cellules trophoblastiques in vitro, avec lequel nous avons pu evaluer les effets du
peroxyde d'hydrogene sur la fonction placentaire via la production d'hCG, sur la
production de TNF-a comme marqueur inflammatoire et sur l'oxyde nitrique (NO)
comme facteur vasodilatateur.
Nos resultats nous ont permis de constater divers effets du peroxyde d'hydrogene
sur les cytotrophoblastes in vitro, effets qui peuvent etre correles avec les niveaux
constates chez la femme preeclamptique. Premierement, nous avons pu observer
une augmentation de la production d'hCG sous l'effet de faibles concentrations de
peroxyde d'hydrogene (<50 uM), alors que des concentrations plus elevees
diminuent Pactivite placentaire en diminuant la secretion d'hCG, demontrant son
action cytotoxique a plus forte dose. Ceci a egalement ete constate par une
augmentation de l'apoptose. Le peroxyde d'hydrogene a aussi demontre ses effets
sur la production par les cytotrophoblastes de facteurs pro-inflammatoires, tel le
TNF-a, ainsi que de son recepteur, le TNFR2, qui sont tous deux augmentes apres
traitement. Le peroxyde d'hydrogene semble aussi avoir une influence sur la
production de mediateurs vasodilatateurs tel l'oxyde nitrique, dont la diminution est
observee in vitro avec des concentrations croissantes d'FfcC^.
Le stress oxydatif dans la preeclampsie, represente dans notre modele in vitro par
le peroxyde d'hydrogene, semble done etre central dans la physiopathologie de
cette maladie, puisqu'on peut lui attribuer en partie la variation d'importants
facteurs. Toutefois, les moyens de la prise en charge de cette condition
pathologique doivent etre soigneusement determines, puisque le peroxyde
d'hydrogene parait avoir tout de meme un role physiologique important a jouer,
d'ou l'interet de parler d'equilibre oxydatif.
Mots cles: preeclampsie, placenta, stress oxydatif, peroxyde d'hydrogene et TNF-a.
TABLE DES MATIERES
Table des Matieres
Ill
Liste des Illustrations
VI
Liste des Abbreviations
VII
Resume
VIII
1 Introduction
1
1.1 Grossesse
1
1.1.1 Fecondation
1
1.1.2 Implantation
2
1.2 Placenta
3
1.2.1 Developpement Placentaire
5
1.2.1.1 Trophoblastes Villositaires
5
1.2.1.2 Trophoblastes Extra-Villositaires
6
1.2.2 Fonctions du Placenta
7
1.2.2.1 L'hCG
9
1.2.3 Structures du Placenta a Terme
10
1.2.3.1 Plaque Chorionique
11
1.2.3.2 Espace Intervilleux
13
1.2.3.3 Plaque Basale
13
1.2.3.4 Cordon Ombilical
14
1.3 Hypertension Gestationnelle et Preeclampsie
1.3.1 Preeclampsie
1.3.1.1 Definition
16
16
16
III
1.3.1.2 Historique
17
1.3.1.3 Etiologie
18
1.3.1.4 Physiopathologie
19
1.3.1.5 Facteurs de Risque
22
1.3.1.6 Prevention Prediction et Traitement de la Preeclampsie....24
1.4 Stress Oxydatif.
26
1.4.1 Facteurs Prooxydants
1.4.1.1 Derives Reactifs de l'Oxygene
1.4.1.1.1 Peroxyde d'Hydrogene
1.4.1.2 Derives Reactifs Azotes
1.4.2 Facteurs Antioxydants
26
27
27
30
31
1.4.2.1 Antioxydants Enzymatiques
31
1.4.2.2 Antioxydants Non-Enzymatiques
32
1.4.2.2.1 VitamineE
32
1.4.2.2.2 VitamineC
33
1.4.3 Stress Oxydatif et Preeclampsie
1.5 TNF-a et ses Recepteurs
l . S l Structure du TNF-a
34
35
35
1.5.2 Recepteurs du TNF-a
36
1.5.3 TNF-a et Preeclampsie
37
1.6 0bjectifs
38
2 Resultats
40
IV
2.1 Article 1 : Effect of H2O2 on placental regulation of TNF-a system:
considerations for preeclampsia
40
2.1.1 Auteurs
40
2.1.2 Role joue par le candidat dans cette etude
40
2.1.3 Resume
41
2.1.4 Article
42
2.2 Article 2: Dual action of H2O2 on placental hCG secretion: Implications for
oxidative stress in preeclampsia
66
2.2.1 Auteurs
66
2.2.2 Role joue par le candidat dans cette etude
66
2.2.3 Resume
67
2.2.4 Article
68
2.3 Article 3: Potential biomarkers of preeclampsia : inverse correlation between
hydrogen peroxide and nitric oxide early in maternal circulation and at term in
placenta of women with preeclampsia
85
2.3.1 Auteurs
85
2.3.2 Role joue par le candidat dans cette etude
85
2.3.3 Resume
86
2.3.4 Article
87
3 Discussion
116
4 Conclusions et Perspectives
124
5 Remerciements
126
6 References
127
V
LISTE DES ILLUSTRATIONS
Figures
Figure 1 : L'oeuf implante a la fin de la deuxieme semaine
4
Figure 2 : Placenta a terme
12
Figure 3 : Les principales structures du placenta a terme
15
Figure 4 : Exposition des cellules eucaryotiques au peroxyde d'hydrogene
29
Tableaux
Tableau I : Facteurs de risque de la preeclampsie
23
VI
SIGLES, ABREVIATIONS ET SYMBOLES
ADN:
Acide desoxyribonucleique
BCRP:
Proteine de resistance du cancer du sein
FSH:
Hormone folliculostimulante
GLUTs :
Transporters du glucose
GnRH:
Gonado-liberine
GPx:
Gluthation peroxidase
hCG:
Hormone gonadotrophine chorionique humaine
HLA-C :
Complexe majeur d'histocompatibilite C
KIRs:
Recepteurs inhibiteurs cytotoxiques
LH:
Hormone luteinisante
MDR1 :
Proteine multi-drogue resistante
NF-
Facteur nucleaire KB
KB
:
NO:
Oxyde nitrique
NOS:
Oxyde nitrique synthase
eNOS:
Oxyde nitrique synthase endotheliale
Nox:
NADPH oxydase
NADPH:
Nicotinamide adenine dinucleotide phosphate
PE:
Preeclampsie
RCIU:
Retard de croissance intra-uterin
ROS:
Derives reactifs de l'oxygene
SOD:
Superoxyde dismutase
Syk:
Proteine tyrosine kinase
TACE:
EnzymeTNF-alpha convertase
TNF-a :
Tumor necrosis factor alpha
TNFR1 :
Receptor du tumor necrosis factor 1
TNFR2:
Receptor du tumor necrosis factor 2
TRADD:
TNFR1 -associated death domain protein
TSH:
Hormone de stimulation thyroidienne
uNK:
Natural killer uterine
1 INTRODUCTION
1.1 Grossesse
La grossesse est le processus physiologique au cours duquel la progeniture
vivante d'une femme se developpe dans son corps depuis la conception jusqu'a ce
qu'elle puisse survivre hors du corps de la mere. La grossesse et la reproduction
sont done, par leur importance, l'objet d'investigation de tres nombreux chercheurs
et medecins partout au monde, car ces processus et les maladies qui y sont
rattachees sont encore loin d'etre expliques et parfaitement compris. La grossesse
implique de nombreuses etapes, allant de la fecondation a 1'accouchement, en
passant par l'implantation et la placentation, qui seront decrites dans ce memoire.
1.1.1 Fecondation
La fecondation proprement dite est 1'ensemble des phenomenes qui resultent de la
rencontre entre le gamete male (spermatozo'ide) et le gamete femelle (ovocyte).
Cette rencontre resulte en une fusion des deux gametes qui forment un noyau
diploi'de, le zygote, au niveau de la trompe uterine. Le zygote migre ensuite vers la
cavite uterine tout en debutant sa segmentation, une suite de divisions cellulaires.
D'abord, les deux premieres cellules, ou blastomeres, apparaissent
environ 24
heures apres la fusion, donnant ensuite chacune des cellules filles conduisant, avec
un certain asynchronisme, a la formation d'un oeuf de 8, 16, 32 cellules, de taille de
plus en plus petite, puis 64 cellules, ou le stade de morula est atteint environ 96
heures apres la fecondation. Entre le quatrieme et le cinquieme jour, les blastomeres
1
entrent dans la cavite uterine ou ils seront libres et s'appellent maintenant le
blastocyste. II est limite par une couche cellulaire peripherique continue, le
trophoblaste, qui deviendra le placenta. A un pole de la sphere, appele pole
embryonnaire, les cellules constituant le bouton embryonnaire forment une masse
cellulaire restant en contact avec le trophoblaste. A l'autre pole, les deux ensembles
cellulaires sont separes par une cavite remplie de liquide appelee le blastocele
(RABINEAU et al, 2003).
1.1.2 Implantation
La fixation du blastocyste a Pendometre se produit vers le septieme jour apres la
fecondation, et le phenomene d'implantation debute. Le blastocyste entre done en
contact par son pole embryonnaire avec Pepithelium de Pendometre et le
trophoblaste, la couche superficielle, prolifere activement au point de fixation. Les
divisions
nucleaires
(cytodierese).
II
en
successives
resulte
un
interviennent
syncytium
sans
derive
division
du
cytoplasmique
trophoblaste,
le
syncytiotrophoblaste qui commence a secreter Phormone chorionique gonadotrope
(hCG). Le reste du trophoblaste, qui separe le bouton embryonnaire du
syncytiotrophoblaste, reste constitue de cellules bien individualists et prend le
nom de cytotrophoblaste. Vers la fin de la deuxieme semaine, le blastocyste sera
completement enfonce dans Pendometre, ou la differentiation trophoblastique
s'etendra tout autour de Poeuf qui sera completement cerne par une couche de
syncytiotrophoblastes entourant les cytotrophoblastes. Des differentes structures
qu'on y retrouve, les cytotrophoblastes resulteront en membranes choriales et
2
placenta, l'endometre en differentes deciduales, le disque embryonnaire, provenant
du pole embryonnaire, sera a l'origine de Pembryon. On peut aussi y distinguer la
cavite amniotique (Figure 1) (RABINEAU et al, 2003).
1.2 Placenta
Lorsque la vie a commence a se developper a l'exterieur des oceans, de nouvelles
strategies de reproduction ont emerge pour compenser la perte des nutriments et de
l'oxygene normalement fournis par cet environnement. Malgre le fait que plusieurs
exemples de viviparite existent chez les invertebres, les poissons, les amphibiens et
les reptiles, la placentation
est relativement
nouvelle
dans
revolution.
L'etablissement du lien etroit trophique entre la mere et l'embryon est une
caracteristique des mammiferes. La placentation est done une nouvelle strategic
dans la reproduction, permettant le developpement d'un petit nombre de foetus a
l'interieur meme de l'organisme maternel protecteur. Comme les mammiferes ont
probablement evolue d'animaux semblables aux petits rongeurs ayant de courts
temps de gestation a des animaux plus gros avec des periodes gestationnelles
prolongees, le placenta a du s'adapter aux besoins croissants du foetus. Le placenta
est done devenu plus gros, augmentant considerablement la surface de contact entre
la circulation maternelle et foetale et a acquis toute une panoplie de fonctions
metaboliques, hormonales et immunologiques specialisees. C'est done un organe
indispensable pour le developpement de l'embryon, maintenant un systeme de
communication etroit entre la mere et le foetus, permettant le bon deroulement de la
grossesse (BISCHOF et IRMINGER-FINGER, 2005).
3
Endometre —
•
r
•'<•'
/• I / Af ; J ,
Figure 1 : L'oeuf implante a la fin de la deuxieme semaine. On y retrouve les
syncytiotrophoblastes entourant les cytotrophoblastes, 1'endometre et le disque
embryonnaire. On peut aussi y distinguer la cavite amniotique.
4
1.2.1 Developpement Placentaire
Une fois 1'implantation achevee, une differentiation et une proliferation des
cellules trophoblastiques en deux structures distinctes surviennent, chacune ayant
des fonctions differentes : les trophoblastes villositaires et extravillositaires.
1.2.1.1 Trophoblastes Villositaires
Au cours de la deuxieme semaine post-fecondation, le syncytiotrophoblaste
devient lacunaire et ces lacunes se remplissent de sang maternel par erosion des
capillaires de l'endometre. A partir du treizieme jour, le syncytiotrophoblaste emet
dans toutes les directions de l'espace des travees radiaires qui penetrent dans
l'endometre et entrainent avec elles des cordons de cellules cytotrophoblastiques
qui constituent l'axe des villosites primaires. Au cours de la troisieme semaine, les
villosites se developpent et leur axe est envahi par le mesenchyme extraembryonnaire de la lame choriale et deviennent des villosites secondaires. Entre le
18e et le 21 e jour, des llots vasculo-sanguins se constituent dans
l'axe
mesenchymateux des villosites, comme dans tout le reste du mesenchyme extraembryonnaire; les villosites deviennent alors des villosites tertiaires (Figure 2). Les
villosites tertiaires libres, dont Pextremite flotte dans la chambre intervilleuse,
s'arboriseront pour former une importante surface de contact avec le sang maternel
lorsque la circulation maternelle y sera etablie (RABINEAU et al, 2003). Les
cytotrophoblastes des autres villosites tertiaires continueront de proliferer a leur
5
extremite
pour
emprunter
la
voie
de
differentiation
des
trophoblastes
extravillositaires.
1.2.1.2 Trophobastes extravillositaires
Les cytotrophoblastes de ces dernieres villosites, appelees villosites crampon,
vont migrer et envahir l'endometre maternel. lis vont poursuivre leur migration
dans la decidue et le premier tiers du myometre, realisant 1'invasion interstitielle. lis
migrent notamment de facon specifique vers les parois des arteres uterines qu'ils
vont eroder dans leur tiers superieur. lis transforment ainsi la tunique elastique
arterielle en une paroi fibreuse atone, n'offrant que peu de resistance au flux
sanguin maternel, et remplacent les cellules endotheliales maternelles dans le
conduit arteriel (ALSAT et al, 1999). Des trophoblastes dits interstitiels vont
s'agreger autour des arteres spiralees ou ils preparent les vaisseaux pour faciliter
leur invasion par les trophoblastes endovasculaires (PIJNENBORG et al, 1981;
PIJNENBORG et al, 1983). Ces derniers entrent dans la lumiere des arteres
spiralees, formant un bouchon cellulaire qui empeche le sang maternel d'entrer dans
l'espace intervilleux du placenta. Les trophoblastes detruisent ensuite Pendothelium
vasculaire, en ne laissant qu'une mince couche de cellules endotheliales et aucune
couche de muscles lisses. La consequence de ce phenomene est d'inhiber la reponse
des vaisseaux maternels aux agents vasoactifs. Ce sont maintenant les vaisseaux
utero-placentaires.
6
Le developpement des vaisseaux utero-placentaires se fait en deux vagues. La
premiere se produit avant la 12e semaine post-fecondation et consiste en 1'invasion
et la modification des arteres spiralees de la decidue et de Pendometre. La
deuxieme vague a cours entre la 12e et la 16e semaine post-fecondation, resultant en
une invasion et une modification des arteres spiralees du myometre en des arteres
dilatees, et de faible resistance (RAMSEY et DONNER, 1980). Ce n'est qu'a partir
de la 12e semaine, ou, parfois, un peu plus tard, que le sang maternel entre dans
l'espace intervilleux (BURTON et al, 1999).
1.2.2 Fonctions placentaires
Les principales fonctions du placenta peuvent etre classees sous les categories
suivantes : transport et metabolisme, protection et fonctions endocriniennes. II
permet Papport de tout ce que le foetus a besoin : oxygene, eau, glucides, acides
amines, lipides, vitamines, mineraux et autre nutriments, tout en retirant le dioxyde
de carbone (CO2) et autres dechets de la circulation foetale. II metabolise un nombre
important de substances, pouvant etre liberees autant dans la circulation maternelle
que fcetale (GUDE et al, 2004). Par exemple, le foetus, dont la principale source
d'energie est le glucose, a une faible capacite de gluconeogenic Ce sucre doit
done provenir de la circulation maternelle. Son transport a travers le placenta y est
facilite par plusieurs transporteurs de glucose (GLUTs). Le recaptage du glucose
maternel se fait par les syncytiotrophoblastes, et peut etre transports via la
membrane basale, qui possede aussi des transporteurs de glucose, vers les
capillaires foetaux. Le glucose peut aussi y etre converti en glucose-6-phosphate ou
7
en glycogene placentaire pour un usage ulterieur (BAUMANN et al, 2002). Par des
processus semblables, des acides amines peuvent y etre convertis en proteines, et
les lipides en acides gras et autres precurseurs. Les molecules plus petites, l'eau, les
ions, les vitamines, peuvent y passer par transport passif, facilite, ou encore actif
(STULC, 1997).
Le placenta peut aussi proteger le foetus contre certaines substances ou bacteries
pouvant circuler dans le sang maternel. Plusieurs peuvent traverser le placenta par
diffusion simple, ou encore par les divers transporters qui ne sont pas
completement specifiques a leur molecule endogene habituellement transportee.
Toutefois, le placenta possede plusieurs systemes de protection pouvant aider a
reduire le transfer! placentaire de substances potentiellement toxiques, incluant la
proteine de resistance multidrogue 1 (MDR1) et la proteine de resistance au cancer
du sein (BCRP) (MARIN et al, 2003). Le placenta contient aussi des enzymes
cytochrome P450 qui peuvent metaboliser certaines drogues et autres xenobiotiques
(PASANEN, 1999). Des proteines maternelles, dont des immunoglobulines de type
G, y sont transportees a travers le placenta qui fournissent une immunite passive au
foetus (MOFFETT et LOKE, 2004).
Le placenta etant denue de nerfs, toute communication, tant avec la mere que le
foetus, passe par la diffusion de substances a travers le sang. Ces facteurs
endocrines, paracrines ou autocrines incluent les cestrogenes, la progesterone, la
gonadotrophine chorionique humaine (hCG), le lactogene placentaire, l'hormone de
8
croissance placentaire, plusieurs facteurs de croissance, des cytokines, chemokines,
agents vasoactifs, GnRH, ainsi que de nombreuses autres substances (GUDE et al,
2004). L'hCG, une hormone placentaire majeure dans nos recherches, est
maintenant decrite plus en detail.
1.2.2.1 L'hCG
Au debut du developpement embryonnaire, la presence de progesterone est
requise pour le maintien de l'endometre, et est produite par le corps jaune,
developpe a partir des cellules de la theque interne du follicule de De Graaf apres
Povulation. L'hormone responsable de Pintegrite du corps jaune est 1'hCG, deja
transcrite dans l'embryon a 8 cellules, et secretee par les trophoblastes, est
detectable des le 8e jour apres Povulation dans le serum maternel. Sa concentration
y augmentera exponentiellement jusqu'a la 10e semaine et decline progressivement
par la suite, le placenta etant capable de produire suffisamment de progesterone.
L'hCG est composee de deux sous-unites. La sous-unite a, commune a toutes les
hormones glycoproteines (FSH, LH, TSH), est un polypeptide de 92 acides amines
avec deux oligosaccharides lies en N-terminal. La sous-unite beta, specifique a
1'hCG, est un polypeptide de 145 acides amines, comprenant deux oligosaccharides
en N-terminal et quatre en C-terminal. En plus de son role majeur de maintenance
du corps jaune, 1'hCG est impliquee dans des mecanismes de regulation autocrines
et
paracrines
de
la
differentiation
trophoblastique
(EVAIN-BRION
et
MALASSINE, 2003).
9
Comme les anomalies trophoblastiques jouent un role central dans la
physiopathologie de maladies compliquant la grossesse dont la preeclampsie
(hypertension gestationnelle), et qu'elles precedent ses signes cliniques, il est
envisageable que le profil hormonal de 1'hCG y soit modifie dans la circulation
maternelle, demontrant la defectuosite de la fonction placentaire (HSU et al, 1994).
L'augmentation de la production d'hCG par les placentas preeclamptiques est done
observee (BARROS et al, 2002). II a ete suggere que 1'hCG joue un role important
dans la periode entourant Pimplantation en augmentant le flot sanguin uterin via la
vasodilatation, l'angiogenese (DANTZER et al, 2000) et l'invasion trophoblastique
(ZYGMUNT et al, 1998), resultant en de possibles effets therapeutiques benefiques
(TOTH etal, 2001).
1.2.3 Structures du placenta a terme
A terme, le placenta (Figure 2) est, dans plus de 90% des cas, un disque plat d'un
diametre d'environ 22 centimetres, ayant une epaisseur au centre de 2.5 centimetres
en moyenne, et ayant un poids d'environ 470 grammes. Bien entendu, ces
dimensions sont tres variables, selon, entre autres, le type de mesure. II est compose
a 85% d'eau, 12% de proteines, 0.11% de tissu adipeux et 1% de particules autres.
II peut contenir jusqu'a 250 millilitres de sang. Le placenta est divise en quatre
parties. D'abord, la surface foetale ou chorionique, qui comprend la plaque
chorionique et la membrane entourant le foetus et contenant le liquide amniotique.
La plaque basale, en contact direct avec le tissu uterin, est la surface maternelle du
placenta. Entre les deux se confine Pespace intervilleux, ou le sang maternel circule
10
en contact avec les villosites choriales. Le cordon complete le placenta et relie les
parties principales du placenta au foetus pour completer les echanges maternofoetaux. A la surface maternelle, 10 a 40 lobes sont presents et separes a l'interieur
par des septa qui sont a l'origine de la resistance mecanique du developpement
placentaire (BERNIRSCHKE et KAUFMANN, 2000).
1.2.3.1 Plaque chorionique
La plaque chorionique, qui fait face au foetus, est une structure de plusieurs
couches. Elle comprend l'amnios situe du cote fcetal, et le chorion. L'amnios
comprend 5 couches : Perithelium amniotique, en contact direct avec le liquide du
meme nom, la couche compacte, la couche fibroblastique, la couche spongieuse et
la couche intermediate, qui ne sont pas visibles a l'ceil nu. Le chorion est une
couche reticulee, et est la membrane basale et contient des cellules trophoblastiques,
qui contribuent a Pattachement de la membrane a la decidue maternelle. La plaque
chorionique joue un role de protection contre les infections provenant du tractus
genital, et participe aussi au developpement foetal et a la progression normale de la
grossesse. En effet, en plus de ses activites autocrines, cette membrane secrete des
substances tant dans le liquide amniotique, affectant son homeostasie, que vers
Puterus, ce qui peut influencer la physiologie cellulaire maternelle (GUDE et al,
2004).
11
Figure 2 : Placenta a terme. A : Cote foetal, comprenant la plaque chorionique, la
membrane et le cordon. B : Cote maternel, comprenant la plaque basale.
12
1.2.3.2 Espace intervilleux
L'espace intervilleux, situe entre la plaque basale et le chorion, contient le sang
maternel qui baignent les villosites choriales permettant les echanges foetomaternels (Figure 3). L'espace intervilleux sert done de lieu d'echange, et contient
enormement de villosites qui, sous leur forme arborescente, permettent un contact
maximum entre le sang maternel et les syncytiotrophoblastes recouvrant les
villosites (BERNIRSCHKE et KAUFMANN, 2000).
1.2.3.3 Plaque basale
La plaque basale est la portion placentaire qui est du cote maternel. Sa couche
interieure,
ou
deciduale
basale,
est
formee
de
residus
de
quelques
syncytiotrophoblastes, pratiquement inexistants a terme dans cette couche, et est
recouverte par la couche fibrino'ide de Rohr. Vient ensuite la couche principale de la
plaque basale. Elle est composee de cytotrophoblastes extravillositaires, de cellules
deciduales et de tissu conjonctif. La couche fibrinoi'de uteroplacental recouvre le
tout a la maniere d'un filet, et est constitute d'un melange de cellules maternelles et
foetales. Cette portion est le site de nombreux processus immunologiques. La zone
de separation vient ensuite delimiter le placenta et le tissu uterin. Elle est formee de
cellules deciduales, de cellules stromales endometrials et de trophoblastes
(BERNIRSCHKE et KAUFMANN, 2000).
13
1.2.3.4 Cordon ombilical
La derniere portion placentaire, reliant le placenta au foetus, est le cordon
ombilical. II est de longueur variable, allant de 24 a 146 cm avec une moyenne de
59 cm, et possede un diametre de 0.8 a 2 cm. II y a normalement 2 arteres et une
veine dans le cordon ombilical humain, et c'est cette derniere qui amene Poxygene
et les nutriments du placenta vers le foetus. Ces vaisseaux sont entoures de tissu
conjonctif appele gelee de Wharton, substance composee de polysaccharides et
contenant des fibroblastes. Le cordon est ensuite recouvert d'un epithelium
amniotique, d'une epaisseur decroissante du placenta au foetus (BERNIRSCHKE et
KAUFMANN, 2000).
14
Le placenta et les cotyledons.
Figure 3 : Les principales structures du placenta a terme. Du tissu uterin vers le
cordon on retrouve la plaque basale, ou deciduale basale, l'espace intervilleux
contenant les villosites, et la plaque chorionique, qui contient les vaisseaux
principaux qui se ramifient vers le cordon.
15
1.3 Hypertension gestationnelle et preeclampsie
Dans certaines pathologies de grossesse, le placenta peut avoir un role important.
Parmi celles-ci, l'hypertension est la plus commune des complications de grossesse.
Elle est definie par une pression systolique d'au moins 140 mm de Hg et ou d'une
pression diastolique d'au moins 90 mm de Hg, diagnostiquee apres 20 semaines de
grossesse chez des femmes prealablement normotensives. Cette categorie inclut
l'hypertension de grossesse legere et severe, et une autre forme avec une proteinuric
qu'on appelle « preeclampsie » et ses variantes plus severes : Peclampsie, et le
HELLP (Hemolytic anemia, Elevated Liver Enzymes and Low Platelet count), un
syndrome associant hemolyse, enzymes hepatiques elevees et une diminution des
plaquettes sanguines (Report of the national high blood pressure education program,
working group on high blood pressure in pregnancy, 2000). Entre 6 a 17% des
femmes nullipares et 2 a 4% des femmes multipares souffriront d'hypertension
gestationnelle. Parmi celles-ci, 70% peuvent developper des complications reliees a
la preeclampsie (SIBAI, 2003).
1.3.1 Preeclampsie
1.3.1.1 Definition
La preeclampsie est definie, de facon primaire, comme etant une hypertension de
grossesse (pression sanguine >140/90 mmHg) avec une proteinuric (300 mg ou plus
par 24h de collection des urines) apres 20 semaines d'amenorrhee. Cette maladie
affecte entre 2 et 7% des femmes nullipares prealablement en sante et est la cause
16
principale de morbidite et de mortalite perinatale (SIBAI, 2003, ROBERTS et
GAMMILL, 2005). La preeclampsie peut aussi etre associee a des femmes
souffrant d'hypertension chronique. Cette pathologie se divise en deux categories,
soit la preeclampsie legere et la preeclampsie severe. Cette derniere peut inclure des
criteres de severite tels qu'un oedeme pulmonaire, un gain de poids important, des
convulsions, une oligurie, une hyperuricemie, une thrombocytopenic, des enzymes
hepatiques eleves, une hypoalbuminemie, des douleurs epigastriques, de violentes
migraines, des troubles visuels et un statut mental altere. Certaines de ces
complications peuvent survenir apres le diagnostique de la preeclampsie, et plus
elles arriveront tot en grossesse, par exemple, avant la 33 e semaine de grossesse,
plus le pronostique est mauvais (SIBAI, 2003). La preeclampsie est aussi associee a
de nombreuses autres pathologies de grossesse touchant le foetus, comme
l'accouchement premature (30-44%), le retard de croissance intra-uterin (16-29%)
(TUFFNELL et al, 2005, YUCESOY et al, 2005, MAGEE et al, 2003, ALMULHIM et al, 2003).
1.3.1.2 Historique
II y a 2000 ans, Celse, l'Hippocrate latin, a decrit des convulsions chez les
femmes enceintes qui disparaissaient avec l'accouchement. Puisque cette condition
semblait survenir sans avertissement, elle fut nommee eclampsie, derive du mot
grec eclair. Pour les 1900 annees suivantes, l'eclampsie etait consideree comme un
desordre unique a la grossesse. Ce n'est qu'a la moitie du 19e siecle que des
similitudes entre la femme souffrant d'eclampsie avec les patients atteints de la
17
maladie de Bright (glomerulonephrite aigue) ont mene a la decouverte que ces
femmes avaient frequemment des proteines dans leur urine et que cette condition
precedait l'eclampsie. Cinquante ans plus tard, le developpement de techniques
non-invasives de mesure de la pression sanguine permit de faire le meme type
d'association avec 1'augmentation de la pression sanguine (CHESLEY, 1978).
Rapidement, il fut reconnu que ce syndrome, meme sans les convulsions, presentait
des risques autant pour la mere que pour le bebe. La preeclampsie fut alors
reconnue comme un syndrome maternel ou les convulsions n'etaient qu'une
manifestation de la maladie. Malheureusement, la reconnaissance que ce syndrome
n'etait pas qu'un probleme de convulsions a ete suivi par le concept que la
preeclampsie etait une maladie hypertensive. Les tentatives pour comprendre ce
desordre pour les 70 annees suivantes furent grandement concentrees sur l'etude de
la pression sanguine, ignorant toute une serie d'autres changements physiologiques.
Plus recemment, l'attention fut redirigee vers l'ensemble du syndrome, resultant en
une meilleure comprehension de la maladie (ROBERTS et REDMAN, 1993).
1.3.1.3 Etiologie
Bien que de nombreuses hypotheses aient ete enoncees sur l'etiologie de la
preeclampsie, les causes exactes de cette maladie sont toujours inconnues, lui valant
le surnom de la maladie des theories, dont la plupart n'ont pas traverse l'epreuve du
temps. Les
theories
potentielles
toujours
en
cours
incluent
1'invasion
trophoblastique deficiente des vaisseaux uterins, une intolerance immunologique
entre le placenta et les tissus maternels, une mesadaptation
aux changements
18
cardiovasculaires ou inflammatoires de la grossesse, une deficience par rapport a la
diete, ou encore des anomalies genetiques (SIBAI, 2003).
1.3.1.4 Physiopathologie
Un modele en deux etapes a ete propose pour conceptualiser la physiopathologie
de la preeclampsie. Le stade 1 consiste en une mauvaise placentation et une
irrigation placentaire reduite, pouvant, chez certaines femmes, conduire au stade 2 :
le syndrome maternel multi-systemique de la preeclampsie. Bien que beaucoup
d'incertitudes demeurent dans ces deux stades, les questions principales sont:
pourquoi la reduction de 1'irrigation placentaire resulte en preeclampsie chez
certaines femmes seulement, et qu'est-ce qui lie ces deux stades.
Stade 1 de la preeclampsie: Reduction de Pirrigation placentaire
II y a environ 70 ans, Ernest Page a formule le concept que la perfusion
placentaire etait reduite dans la preeclampsie (PAGE, 1939). Pour expliquer ce
phenomene, le remodelage des vaisseaux uterins au site d'implantation a ete cible.
Comme explique plus tot, il appert que le remodelage de ces vaisseaux est le
resultat de l'invasion trophoblastique, et en particulier, l'invasion endovasculaire.
Le controle cellulaire de l'invasion cytotrophoblastique depend des interactions
entre la deciduale maternelle et les trophoblastes. La tension en oxygene locale et
les interactions immunologiques sont particulierement determinantes dans ce
processus, dont l'apoptose serait aussi impliquee (HUNG et al, 2002).
19
La tension en oxygene dans l'espace intervilleux est faible jusqu'a environ 12
semaines post-conception, ou les vaisseaux maternels commencent a perfuser cet
espace. La tension en oxygene y augmente dramatiquement, tout comme les derives
reactifs de Poxygene. II est done propose que si la capacite maternelle en
antioxydants est insuffisante, cela nuit a l'invasion, resultant en une faible perfusion
placentaire et, possiblement, en preeclampsie (JAUNIAUX et al, 2000).
La regulation de la differentiation et de l'invasion des trophoblastes implique
aussi des mecanismes immunologiques. Les cellules immunitaires predominates
dans la deciduale sont les cellules uNK (natural killer uterines). Les recepteurs
KIRs (killer immunoglobulin receptors) presents sur ces cellules interagissent avec
des marqueurs trophoblastiques specifiques, influencant l'invasion. L'antigene
leucocytaire trophoblastique humain de classe C (HLA-C) est central dans ses
interactions avec la deciduale (KING et al, 2000). Des combinaisons genotypiques
specifiques de KIRS et HLA-C resultent en un risque accru de preeclampsie (HIBY
et al, 2004).
L'apoptose placentaire pourrait etre la derniere voie associant ces deux
mecanismes. Les placentas de patientes preeclamptiques ont une apoptose
generalisee plus elevee que les controles (ALLAIRE et al, 2000). L'apoptose mene
aussi au relachement de fragments syncytiotrophoblastiques dans la circulation
maternelle, accelerant la preeclampsie (KNIGHT et al, 1998).
20
Stade 2 : Syndrome maternel de la preeclampsie
Tous les changements physiologiques presents chez les femmes souffrant
d'eclampsie ont un point commun : une reduction de la perfusion dans pratiquement
tous les organes. Par exemple, les changements pathologiques dans les reins
consistent en une endofheliose glomerulaire caracterisee par une tumefaction des
cellules glomerulaires endotheliales suffisante pour bloquer la lumiere capillaire,
accompagnee de legers changements dans les podocytes renaux (MCCARTNEY,
1969). Ce changement est important, puisqu'il est absent dans les autres types
d'hypertension. La diminution de la perfusion est aussi reduite en raison de spasmes
vasculaires, de 1'activation de la coagulation intravasculaire, et de la perte de fluide
de
l'espace
intravasculaire
(ROBERTS
et
LAIN,
2002). Les
femmes
preeclamptiques sont aussi singulierement sensibles aux agents vasoactifs
(CHESLEY, 1966). Tous ces changements ont mene au concept de la dysfonction
endotheliale comme point central physiopathologique de la preeclampsie
(ROBERTS et LAIN, 2002), qui peut expliquer tous les changements observes chez
la mere.
La question centrale dans le modele impliquant deux stades de la preeclampsie est
le lien qui unit ces deux stades. Cette question demeure toutefois le saint graal de la
recherche sur la preeclampsie, puisque ce phenomene semble impliquer de
nombreux facteurs, soit genetiques, immunologiques et biochimiques.
De ces
facteurs, le stress oxydatif, via les ROS, semble jouer un role preponderant dans la
preeclampsie, et qui pourrait soit contribuer ou stimuler le lien entre les deux stades
(ROBERTS et GAMMILL, 2005). En effet, les cytokines provoquent le
21
relachement de radicaux libres (CONNER et GRISHAM, 1996), alors que les
monocytes et les neutrophiles actives en relachent aussi quand ils entrent en contact
avec de Pendothelium active. Le stress oxydatif entraine aussi l'apoptose
placentaire, provoquant le relachement possible de particules microvillositaires
contenant des lipides oxydes, qui peuvent agir sur tout le systeme (ROBERTS et
GAMMILL, 2005).
1.3.1.5 Facteurs de risque
De nombreux facteurs de risque presents dans la periode de preconception ont etes
associes avec une augmentation des risques de preeclampsie (Tableau I). Les
femmes ayant des problemes medicaux avant la grossesse auront plus de risques
d'avoir une preeclampsie que toute autre grossesse. Le niveau de risque depend
bien entendu de la condition medicale specifique de chaque femme, ainsi que de la
severite de sa condition. Par exemple, une femme souffrant d'hypertension
chronique, en melant tous les cas, a un risque de souffrir de preeclampsie de 25%
durant sa grossesse. Ce risque ne sera que de 15% pour les femmes souffrant
d'hypertension legere avant ou au debut de la grossesse, alors qu'il frise les 50%
dans les cas d'hypertension severe (BARTON et SIBAI, 2008). II en va de meme
pour la plupart des facteurs de risque, dont l'obesite, ou les risques augmentent avec
l'indice de masse corporelle, probleme lui-meme associe a la resistance a Pinsuline
qui est aussi un facteur de risque de la preeclampsie (CATALANO, 2007).
Etrangement, l'usage de la cigarette diminuerait
les risques de souffrir de
22
preeclampsie durant la grossesse de 33% (CONDE-AGULEDO et al, 1999). Les
mecanismes associes sont toutefois toujours a expliquer.
Tableau I : Facteurs de risque de la preeclampsie
Nulliparity
Grossesse multiple
Obesite
Historique familial de preeclampsie/eclampsie
Preeclampsie dans une grossesse precedente
Diabete pregestationnel de type 2
Thrombophilie
Infections urinaires durant la grossesse
Hypertension chronique ou gestationnelle, problemes renaux
Age maternel de plus de 40 ans
Exposition limitee au sperme paternel (nouveau partenaire,
insemination, fecondation in vitro)
Pere ayant engendre une grossesse preeclamptique chez une autre
femme
Femme ayant elle-meme souffert de retard de croissance intra-uterin
Complications dans une grossesse precedente (retard de croissance
intra-uterin, hematome retroplacentaire, mort fcetale)
(Adapte de SIBAI, 2003, BARTON et SIBAI, 2008)
23
1.3.1.6 Prevention, prediction et traitement de la preeclampsie
Comme mentionne precedemment, il y a plusieurs facteurs qui peuvent entrainer
une augmentation des risques de developper une preeclampsie. Ces risques,
identifies avant la grossesse, peuvent amener a une intervention qui constitue une
prevention primaire de la preeclampsie. Par exemple, des etudes epidemiologiques
ont demontre qu'un controle du poids pouvait affecter Tissue de la gestation
(VILLAMOR et CNATTINGIUS, 2006, BAETEN et al, 2001). Pour une femme
obese, l'obtention d'un poids ideal avant la conception pourrait done etre une bonne
tentative de reduire les risques de preeclampsie. Les femmes avec diabete seraient
aussi encouragees a avoir leurs enfants le plus tot possible, avant que leur situation
ne se deteriore, et a controler leur diabete et leur hypertension, si presente, de facon
appropriee, et ce, plusieurs mois avant la grossesse, et durant celle-ci (BARTON et
SIBAI, 2008).
Pour la prevention secondaire de la preeclampsie, il y a eu de nombreux essais
cliniques decrivant l'usage de nombreuses methodes pour prevenir ou reduire les
risques de preeclampsie (SIBAI et al, 2005). L'etiologie de cette maladie etant
inconnue, ces interventions ont ete effectuees pour corriger des anomalies
physiopathologiques theoriques de la preeclampsie durant la grossesse. L'usage de
drogues anti-hypertensives pour les femmes hypertendues, de supplementation en
huile de poisson, de calcium, de vitamines C et E et d'heparine se sont averees
inefficaces pour la prevention de la preeclampsie. En plus d'avoir des effets
secondaires nefastes potentiels, dans le cas des huiles de poisson, et des hautes
doses de vitamines C et E (BARTON et SIBAI, 2008). Par exemple, un essai
24
clinique realise en utilisant des fortes doses de vitamines C et E pour retablir
Pequilibre oxydatif chez des femmes a risque, n'a pas change 1'incidence de la
preeclampsie, mais il a resulte en une augmentation significative des bebes de petit
poids a la naissance (POSTON et ah, 2006). Toutefois, l'usage de faibles doses
d'aspirine pourrait, chez certaines femmes a risque, par exemple celles ayant deja
eu une preeclampsie resultant en un accouchement premature, aider a reduire
P incidence de la preeclampsie (ASKIE et al, 2007).
Pour ce qui est de la prediction de l'apparition de la preeclampsie, de nombreux
tests cliniques, biophysiques et biochimiques ont ete proposes pour la predire ou la
detecter de facon precoce. Toutefois, la plupart de ces tests souffrent d'un manque
de sensibilite ou d'un faible pourcentage de prediction, et la majorite d'entre eux ne
sont pas faits pour un usage de routine en clinique (SIBAI, 2003). Le diagnostic
repose done toujours sur la mesure de la pression arterielle et la mesure des
proteines dans une collecte urinaire de 24 heures, ainsi que sur le suivi des femmes
les plus a risque. Cette methode a aussi ses limites, par exemple pour les femmes
qui ne font qu'une legere hypertension.
Une fois la preeclampsie diagnostiquee, les traitements utilises sont nombreux,
mais peu efficaces, et souvent controverses. Ces traitements peuvent soulager
certains symptomes, mais aucun ne peut guerir la maladie, si ce n'est que
Paccouchement. Toutefois, les symptomes peuvent quand meme continuer a
s'aggraver apres Paccouchement. L'usage d'agents antihypertenseurs, un repos
complet ou partiel font partie des traitements recommandes, et peuvent aider a
reduire les risques d'hypertension severe. Dans les cas de preeclampsies severes, le
25
sulfate de magnesium est utilise pour eviter les convulsions et le risque
d'aggravation en eclampsie, mais la delivrance reste le seul traitement efficace
(SIBAI, 2003).
1.4 Stress oxydatif
Le stress oxydatif est decrit comme etant un debalancement entre la production de
derives reactifs de Poxygene (ROS) et la capacite des antioxydants de les
neutraliser. Ce desequilibre peut provenir soit d'une augmentation de la production
des ROS et/ou d'une diminution des antioxydants. Le plus souvent, ces ROS sont
des radicaux libres et provoquent des dommages cellulaires en reagissant avec des
proteines, lipides ou avec les acides nucleiques (MYATT et CUI, 2004).
1.4.1 Facteurs prooxydants
Les facteurs prooxydants sont surtout composes de radicaux libres, qui sont des
molecules instables et tres reactives. lis deviennent stables en faisant l'acquisition
d'un electron provenant d'acides nucleiques, de lipides, de proteines ou toute autre
molecule, provoquant une reaction en chaine resultant en un possible dommage
cellulaire et possiblement en une pathologie (PIERCE et ah, 2004, WARD et
CROFT, 2006). II y a deux categories majeures de radicaux libres : les derives
reactifs de l'oxygene (ROS) et les derives reactifs azotes.
26
1.4.1.1 Derives reactifs de l'oxygene
Les trois principaux types de ROS sont l'anion superoxyde (O2"), le peroxyde
d'hydrogene (H2O2) et le radical hydroxyle (OH). L'anion superoxyde est forme
lorsque des electrons s'echappent de la chaine de transport des electrons
(HALLIWELL et al, 1992). La dismutation de cet anion resulte en la formation de
peroxyde d'hydrogene. Le radical hydroxyle est aussi tres reactif et peut modifier
les purines et pyrimidines et causer des dommages a l'ADN (MELLO FILHO et al,
1984). Toutefois, bien qu'ils soient surtout connus pour leurs effets nefastes, les
ROS auraient aussi un role important dans le remodelage tissulaire, la signalisation,
le cycle cellulaire, l'apoptose, les fonctions des gametes et la reproduction (RILEY
et BEHRMAN, 1991, NOSE, 2000)
1.4.1.1.1 Peroxyde d'hydrogene
Depuis quelques annees, il ne fait maintenant aucun doute que le peroxyde
d'hydrogene (H2O2), bien connu pour ses effets cytotoxiques, joue un role
important dans de nombreux processus biologiques dans la plupart, si ce n'est pas
dans tous les organismes vivants. Chez les procaryotes et levures, des mecanismes
de detection et de reponse a l ' E L ^ dans l'environnement ont ete developpes, et de
nombreux organismes vivants produisent intentionnellement de l ' L L ^ dans divers
buts, comme lors de la defense immunitaire ou dans la chaine respiratoire
mitochondriale. De plus, il y a maintenant de fortes evidences suggerant que PH2O2
27
pourrait aussi avoir certaines fonctions dans des voies de signalisation cellulaire, en
particulier chez les vertebres (STONE et YANG, 2006).
La source majeure d'F^C^ implique la reaction spontanee ou catalytique de
l'anion superoxyde (O2-), produit par la reduction partielle de l'oxygene durant la
respiration aerobique et suivant l'exposition des cellules a de nombreux agents
physiques, chimiques et biologiques (Figure 4). Par exemple, il est etabli que les
cellules phagocytaires activent des complexes NADPH oxydase (Nox) pour generer
l'anion superoxyde, par consequent PH2O2, comme agent cytotoxique durant la
destruction des microbes. Toutefois, il est maintenant demontre que ces Nox ne sont
pas seulement presentes chez les cellules phagocytaires, mais aussi dans de
nombreux types de cellules et tissus. En fait, dans les cellules non-immunitaires, les
Nox sont associes a la generation de derives reactifs de l'oxygene (ROS) comme
molecules de signalisation (VEAL et al, 2007).
28
phagocytes
receplor/ligand
interaction
immunoqlobulin G
0
m
^
Si h
*•*!,
^
^
tnlegrins,,
cytoplasm
ss-if^i
o,
^
O2- • • * H 2 O z
ampn
growth factors
cytokines
integrifis
o.
O2"
iiOf
Cj'teCtlfWB*!
oxtdsM
Vi-"
mitochondria
Figure 4 : Exposition des cellules eucaryotiques au peroxyde d'hydrogene. Le
peroxyde d'hydrogene
peut etre produit l'oxydation
de l'eau par
les
immunoglobulines G, par des interactions recepteur-ligand, et par les cellules
phagocytaires. L'anion superoxyde est lui aussi rapidement converti en peroxyde
d'hydrogene par Taction des superoxyde dismutases. Des facteurs de croissance,
cytokines et integrines stimulant aussi l'activation de la NADPH oxydase ou 5'lipoxygenase. Le peroxyde d'hydrogene peut aussi diffuser a travers la membrane.
29
1.4.1.2 Derives reactifs azotes
La production d'oxyde nitrique (NO) implique la NO synthase (NOS) qui, en la
presence suffisante du cofacteur tetrahydrobiopterin, recoit des electrons du
NADPH pour convertir la L-arginine et Poxygene moleculaire en NO et L-citruline.
II y a trois isoformes de NOS : la NOS neuronale (nNOS), la NOS inductible
(iNOS) et la NOS endothelial (eNOS), qui sont respectivement exprimees dans les
neurones, dans les globules blancs, et dans les cellules endothelials et le placenta
(SCHIESSL et al, 2005). D'un autre cote, les arginases jouent un role important
dans le metabolisme du NO en catabolisant la L-arginine en uree et en L-ornithine.
II y a deux formes d'arginases. L'arginase I, une enzyme cytosolique, et l'arginase
II, qui est une enzyme mitochondriale (CEDERBAUM et al, 2004, MORRIS,
2002).
Ces deux arginases sont exprimees par les cytotrophoblastes dans le
placenta en debut de grossesse et a terme (ISHIKAWA et al, 2007).
Le NO a plusieurs roles physiologiques importants, comme la maintenance de
l'equilibre vasculaire systemique, un mediateur de la reponse inflammatoire et la
promotion des proprietes antithrombiques de 1'endothelium. L'implication du NO
dans la preeclampsie est largement etudiee, en depit de la controverse entourant sa
cinetique et les doutes entourant sa regulation. Quelques etudes ont done constate
une augmentation du NO dans la circulation maternelle (BHATNAGAR et al,
2007, VURAL, 2002), et dans le placenta (SHAAMASH et al, 2000), alors que
d'autres ont constate une diminution dans le serum maternel (SANDRIM et al,
2008) et le placenta (SCHONFELDER et al, 2004), ou encore des niveaux
normaux (ORANGE et al, 2003). L'anion superoxyde peut aussi reagir avec le NO,
30
resultant en un puissant agent oxydant, l'anion peroxynitrite (ONOO) qui peut
interagir avec de nombreuses molecules (BECKMAN et al, 1990).
1.4.2 Antioxydants
Dans des conditions normales, les antioxydants convertissent les ROS en eau pour
prevenir la surproduction des ROS. II y a deux types d'antioxydants dans le corps
humain : les antioxydants enzymatiques et les antioxydants non-enzymatiques.
1.4.2.1 Antioxydants enzymatiques
Les antioxydants enzymatiques sont composes principalement des families des
superoxydes dismutases (SOD), des catalases et des gluthation peroxydases (GPx).
La dismutation de l'anion superoxyde en peroxyde d'hydrogene est souvent appelee
la premiere defense contre les ROS, pour prevenir la formation subsequente
d'autres radicaux libres. Les SOD sont classifies en trois classes, selon l'ion
metallique qu'elles contiennent, soit les Cu/Zn SOD, les Mn SOD et les Fe SOD.
Leur activite est surtout intracellulaire, et leur presence varie selon les tissus
(MILLER, 2004). Les catalases sont principalement responsables de l'acceleration
de la decomposition de PH2O2 en H2O. Les catalases sont distributes un peu partout
dans l'organisme, avec une presence variable selon les tissus. Les GPx, une famille
comportant 5 formes, chacune ayant des fonctions semblables, mais des modes et
des sites d'action differents (BRIGELIUS-FLOHE et al, 1994). Elles sont aussi
responsables de la catalyse de l ' L L ^ et des peroxydes organiques en H2O, et ce, a
31
des concentrations plus basses de peroxyde d'hydrogene que la catalase, cette
derniere etant plus active a des concentrations plus elevees (YU, 1994).
1.4.2.2 Antioxydants non-enzymatiques
Les antioxydants non-enzymatiques proviennent principalement de l'alimentation
et comprennent, entre autres, la vitamine C, la vitamine E, le selenium, le zinc, la
glutathione, le p-carotene et la taurine (AGARWAL et ah,2003). Leur mode
d'action
est
varie,
et
ils
sont
presents
tant
au
niveau
intracellulaire
qu'extracellulaire, dependamment de leurs proprietes, comme leur solubilite
aqueuse ou lipophile. Les vitamines C et E sont de tres puissants antioxydants, et
sont interessants, car ils peuvent etre facilement utilises comme supplements
alimentaires pour tenter de corriger un desequilibre oxydatif.
1.4.2.2.1 Vitamine E
La vitamine E est Pantioxydant le plus distribue dans la nature, tant chez les
plantes que dans le monde animal. La vitamine E est un terme generique qui refere
a au moins huit isomeres structuraux de tocopherol, dont Pa-tocopherol, le plus
connu, possede l'activite antioxydante la plus importante (BURTON et al., 1982).
Les
isomeres de tocopherol sont des molecules lipophiles, ce qui fait que la
vitamine E est le plus important antioxydant dans les environnements lipophiles,
comme dans les lipoproteines plasmatiques. Au niveau intracellulaire, la vitamine E
est associee aux membranes riches en lipides comme les mitochondries et le
32
reticulum endoplasmique. L'action antioxydante de cette vitamine est done
importante pour contrer la peroxydation des membranes lipidiques en reagissant
avec les lipides peroxydes et radicaux alkoxyl (YU, 1994).
1.4.2.2.2 Vitamine C
La vitamine C, ou acide ascorbique, est hydrophile et est plus efficace dans un
environnement aqueux que la vitamine E. C'est un agent reducteur et antioxydant,
qui reagit directement avec l'anion superoxyde ou le radical hydroxyle et divers
lipides peroxydes. II peut aussi restaurer les proprietes antioxydantes de la vitamine
E oxydee (WITTING et HORWITT, 1964), fournissant a cette vitamine une
fonction importante dans le recyclage de la vitamine E. La vitamine C est largement
distribute dans les tissus des mammiferes, mais moins presente dans certains
organes comme le foie et le cerveau.
Toutefois, la vitamine C peut aussi avoir des effets prooxydants. A de plus fortes
concentrations, soit environ 1 mM, et en presence de metaux de transition comme le
FE3+ ou le Cu2+, elle peut generer des cofacteurs de ROS et promouvoir la
peroxydation lipidique. La complexite de son role est mise en evidence en presence
de vitamine E, ou la peroxydation lipidique des microsomes chez des animaux
deficients en vitamine E est augmentee, mais diminuee par la vitamine C dans des
conditions normales. Son role semble done etre ambivalent, selon les conditions
environnantes (YU, 1994).
33
1.4.3 Stress oxydatif et preeclampsie
II y a de nombreuses evidences d'un debalancement oxydatif chez les femmes
souffrant
de preeclampsie, incluant une augmentation plasmatique de la
concentration des produits d'oxydation des radicaux libres (WICKENS et ah,
1981), de lipides peroxydes (HUBEL et ah, 1996) et une diminution de la
concentration d'antioxydants comme les vitamines C et E (MIKHAIL et ah, 1994).
Notre laboratoire a aussi demontre une augmentation d'H202 dans le serum de
femmes preeclamptiques par rapport aux femmes ayant une grossesse normale
(KHARFI et ah, 2005).
Les consequences de ce stress oxydatif sont nombreuses. Par exemple, la severite
d'un debalancement en faveur des facteurs prooxydants a ete correlee avec une
augmentation de la pression sanguine (MADAZLI et ah, 2002). Le TNF-a (tumor
necrosis factor- a), est anormalement eleve dans les placentas preeclamptiques
(CONRAD et ah, 1998), probablement en reponse au stress oxydatif. Le TNF-a luimeme peut aussi contribuer au stress oxydatif en induisant la production des ROS
(WANG et WALSH, 1996).
Les etudes de recherche sur le stress oxydatif dans la preeclampsie, bien qu'elles
identifient clairement la presence d'un debalancement entre prooxydants et
antioxydants, ne parviennent pas a elucider les causes.
34
1.5 TNF-a et ses recepteurs
Le TNF-a, une cytokine pleiotrope pro-inflammatoire, est surtout exprimee par
une variete de cellules inflammatoires activees telles que les monocytes, les
macrophages, les neutrophiles, les cellules NK, les lymphocytes T, mais aussi par
des cellules non-inflammatoires,
comme les astrocytes, les adipocytes, les
keratinocytes et les fibroblastes (TRACEY et CERAMI, 1993). Elle est connue
pour affecter
la croissance, la differentiation,
la survie et les
fonctions
physiologiques de nombreuses cellules (BEUTLER et CERAMI, 1988; BEUTLER
et CERAMI. 1989).
1.5.1 Structure du TNF-a
Le TNF-a
est
exprime
sous
la forme
d'une
proteine
homotrimerique
transmembranaire, qui est ensuite relachee sous sa forme homotrimerique soluble
par l'enzyme TNF-a convertase (TACE), une metalloproteinase liee a la membrane
(WAJANT et al, 2003). Les protomeres du TNF-a sont de 17 kDa chacun sous la
forme soluble, et sont composes de deux feuillets beta anti-paralleles (ECKS et
SPRANG, 1980). Chacune des formes solubles et membranaires (26 kDa) existe, et
se lie principalement au recepteur 1 du TNF (TNFR1) et au recepteur 2 du TNF
(TNFR2) (IDRISS et NAISMITH, 2000).
35
1.5.2 Recepteurs du TNF-a
Le TNF-a exerce ses effets via les recepteurs TNFR1 (p55) et TNFR2 (p75),
ayant des poids moleculaires de 55 et 75 kDa, respectivement (SHU et al, 1996).
Ces deux recepteurs ne partagent que peu d'homologie, ce qui indique qu'ils
peuvent induire differentes fonctions (BEYAERT et FIERS, 1994). Contrairement
au TNFR1 qui est communement exprime dans la plupart des cellules, le TNFR2
est plus regule et trouve principalement dans les cellules immunitaires et
hematopoietiques (WAJANT et al, 2003).
Les signaux medies par les recepteurs du TNF-a sont divers, et peuvent avoir des
effets similaires via des mecanismes distincts. L'activation d'un ou des deux
recepteurs depend de la voie de signalisation mise en jeu (THOMMESEN et
LAEGREID, 2005). Des differences fonctionnelles entre le TNFR1 et le TNFR2
concernant la cytotoxicite, les dommages a l'ADN, et la differentiation des
macrophages ont ete observes (HIGUCHI et AGGARWA1, 1994). Dans certains
cas, les deux recepteurs peuvent avoir des effets opposes. Tandis que le TNFR2
promeut la survie cellulaire, le TNFR1 favorise plutot la mort cellulaire
(FONTAINE et al, 2002). Des lignees cellulaires exprimant soit le TNFR1 ou le
TNFR2 ont ete utilisees pour confirmer que la cytotoxicite est principalement
mediee par le TNFR1 (HIGUCHI et AGGARWAL, 1994). L'absence d'un
domaine cytoplasmique de mort cellulaire chez le TNFR2, le domaine de liaison a
la proteine TRADD (TNFR1-associated death domain protein), est attribue a sa
signalisation de survie cellulaire.
36
Bien que ces recepteurs soient principalement lies a la membrane, ils peuvent
aussi etre retrouves dans une forme soluble active, mimant une action paracrine
(LOTZ et al, 1996). Les domaines extracellulaires des recepteurs peuvent aussi etre
clives par la TACE, et deviennent des fragments solubles qui ont la capacite de
neutraliser le TNF-a circulant (KEITH et al, 2000, WAJANT et al, 2003). Les
formes solubles des deux recepteurs ont la capacite de Her, mais aussi de relacher le
TNF-a (REDDY et al, 1994), ce qui peut entrainer deux effets. Ils peuvent agir
comme inhibiteurs en liant le TNF-a, le rendant non disponible, ou agir comme
reservoir, relachant lentement le TNF-a et prolongeant ses effets biologiques. La
premiere condition survient a de hautes concentrations de recepteurs solubles, alors
qu'a de plus faibles concentrations, les recepteurs solubles stabilisent la structure du
TNF-a et augmentent son activite (ADERKA et al, 1992). Le sTNFRl,
contrairement au sTNFR2, voit son expression etre indifferente aux niveaux de
TNF-a circulant (VANDENABEELE et al, 1995).
1.5.3 TNF-a et preeclampsie
Lors de la grossesse, le TNF-a joue un role tres important (HUNT et al, 1996).
Dans le deroulement normal de la grossesse, il semble etre benefique au
developpement foetal, puisqu'il est exprime dans de nombreux organes. Dans le
placenta humain, l'augmentation
de cette cytokine entraine l'apoptose
des
cytotrophoblastes isoles a partir de placenta a terme, suggerant un role important
dans le renouvellement des trophoblastes (YUI et al, 1994). II a ete demontre que le
TNF-a joue un role dans la regulation de la production de la progesterone, de
37
Pestradiol, et de 1'hCG sur des explants placentaires, des cellules JEG-3 (lignee
cancereuse trophoblastique) ou des cytotrophoblastes isoles (LI et al, 1992),
suggerant qu'il est aussi implique dans la differentiation et la fonction des
trophoblastes. L'alteration des niveaux de TNF-a a ete constatee dans le sang de
femmes souffrant de preeclampsie (BENYO et al, 2001), et il y a actuellement une
incertitude sur la provenance de ce TNF-a, soit de la mere, ou du placenta. La
theorie qui prevaut presentement veut que l'augmentation de l'expression du TNF-a
dans le placenta puisse mener a l'activation des leucocytes circulants, liant ainsi le
stress oxydatif du placenta a un stress oxydatif generalise et a une dysfonction
endothelial chez la mere (WALSH, 1998).
1.6 Objectifs
Une des conditions physiopathologiques majeures de la preeclampsie est un stress
oxydatif eleve. Des travaux anterieurs effectues dans notre laboratoire ont demontre
une correlation entre les nivaux circulants du peroxyde d'hydrogene (H2O2) et de
P hormone gonadotrophine chorionique humaine (hCG) chez les femmes souffrant
de preeclampsie (KHARFI et al,. 2005). II est done concevable que ce stress
oxydatif a des effets directs sur le placenta. Afin de determiner les effets du
peroxyde d'hydrogene sur les cellules placentaires in vitro, en rapport aux
conditions retrouvees in vivo chez des femmes preeclamptiques, nous avons
developpe un modele d'etude de cellules trophoblastiques primaires humaines in
vitro, avec lequel nous avons evalue les effets du peroxyde d'hydrogene suivants :
38
1
Effet du peroxyde d'hydrogene sur la production placentaire de 1'hCG,
explorant ainsi la reponse endocrinienne du placenta au stress oxydatif.
2
Effets du peroxyde d'hydrogene sur la production placentaire du TNF-a,
explorant ainsi la reponse inflammatoire du placenta au stress oxydatif.
3
Effet du peroxyde d'hydrogene sur la production placentaire du NO,
explorant ainsi la reponse vasoactive du placenta au stress oxydatif.
Ces investigations in vitro nous permettent de faire des liens entre le stress
oxydatif et certaines conditions rencontrees in vivo lors de la preeclampsie.
II est a noter que Pensemble de ces travaux nous ont permis de preparer 3 articles
dont deux sont publies aujourd'hui, il s'agit de l'effet sur 1'hCG et sur le NO.
L'effet de l'H202 sur le TNF-a constitue mon article principal dans ce memoire et
qui est soumis au journal « Free Radical Research ».
39
2 RESULTATS
2.1 Article 1 : Effect of H2O2 on placental regulation of TNF-a system: considerations
for preeclampsia
2.1.1 Auteurs :
Samuel Leblanc, Jean-Marie Moutquin, Regen Drouin, Yves Giguere, Jean-Claude Forest,
Aziz Aris
2.1.2 Role joue par le candidat dans cette etude :
Design experimental, realisation des experiences, compilation des donnees, analyse
statistique des donnees, interpretation des resultats et ecriture de l'article scientifique.
Soumis le 7 avril 2009 au journal « Free Radical Research ».
40
2.1.3 Resume
Nos recherches precedentes ont etabli le role du peroxyde d'hydrogene (H2O2) comme un
biomarqueur liable du stress oxydatif de la preeclampsie (PE). La PE est caracterisee par une
elevation de mediateurs oxydatifs et inflammatoires dans la circulation maternelle et le
placenta. Toutefois, les mecanismes de regulation reliant le placenta et le stress
inflammatoire ne sont pas encore bien compris. Le but de cette etude etait done d'etudier les
effets du H2O2 sur l'expression placentaire du TNF-a et de ses recepteurs. L'expression et la
synthese de novo du TNF-a et de ses recepteurs (TNFR1 et TNFR2) ont ete evaluees suivant
l'exposition de cytotrophoblastes humains provenant de grossesses normales a H2O2 in vitro.
Nos resultats demontrent que l'FfcCh induit simultanement l'activation du TNF-a et du
TNFR2. Etonnamment, le TNF-a soluble a ete davantage detecte dans le milieu de culture
apres neutralisation du TNFR2. Ceci est du a la liaison du sTNF-a aux formes solubles et
membranaires du TNFR2. Nos resultats impliquent done que les cytotrophoblastes repondent
au stress oxydatif en augmentant non seulement le TNF-a, mais aussi le TNFR2, qui peut
diminuer les exces de TNF-a et reduire ses effets autocrines et paracrines. Ce processus peut
representer une nouvelle cible de prevention des maladies associees au stress inflammatoire
comme la PE. De plus, nos resultats semblent aussi fournir une explication sur l'inconstance
de detection complete du TNF-a soluble dans les milieux biologiques.
41
Submitted April 7tn 2009
2.1.4 Article 1
Free Radical Research
Effect of H2O2 on placental regulation of TNF-ct system: considerations for
oxidative stress in preeclampsia
SAMUEL LEBLANC 12 , JEAN-MARIE MOUTQUIN 1 , REGEN DROUIN 3 , YVES
GIGUERE4, JEAN-CLAUDE FOREST4, & AZIZ ARIS 1 2
1
Departement d'Obstetrique-Gynecologie,
Service
Laboratory of Research in Reproductive and
Gestational
Health.
de Genetique,
Centre Hospitalier
Sherbrooke.
Unite de Perinatalogie et Centre de Recherche de I 'Hopital Saint-Francois
d'Assise, CHUQ, Universite Laval. Quebec, Canada
Universitaire
de
Abstract
Our previous studies have established the role of hydrogen peroxide (H2O2) as a reliable
biomarker of oxidative stress in preeclampsia (PE). PE is characterized by an elevation of
oxidative and inflammatory mediators in maternal circulation and placenta. However,
regulatory mechanisms involved in these processes are not fully understood. The aim of
this study was to investigate the effects of H2O2 on placental expression of TNF-a and its
receptors. The expression and the de novo synthesis of TNF-a and its receptors (TNFR1
and TNFR2) were assessed following the exposure of human cytotrophoblasts to H2O2.
H202 increases simultaneously the production of TNF-a and TNFR2. In conclusion,
cytotrophoblasts respond to oxidative stress by enhancing synthesis of not only TNF-a,
but also TNFR2 which may clear the excessive levels of TNF-a and reduce its autocrine
and paracrine effects.
Keywords: Oxidative stress, hydrogen peroxide (H2O2), TNF-a and its receptors,
placenta, cytotrophoblasts
43
Introduction
The trophoblast is the major component of human placenta and it is involved in all stages
of pregnancy, from the blastocyst implantation stage until delivery. Human trophoblast is
formed by two components which are functionally distinct: 1) the villous trophoblast,
bathing in maternal blood of intervillous spaces and involved in materno-fetal exchanges
and in placental endocrine functions; 2) the extra-villous trophoblast involved in uterine
spiral arteries remodelling and in the placental anchorage into the uterine wall. Human
villous trophoblasts are composed of two layers of cells: the inner mononuclear
cytotrophoblast
Cytotrophoblasts
cells
are
and
the
highly
outer
multinucleated
proliferative
which
syncytiotrophoblast
exert
invasive
[1].
actions.
Syncytiotrophoblasts are highly differentiated, which display many functions necessary
for the maintenance of pregnancy. Defective trophoblast development and/or function
lead to shallow placentation, and is a common characteristic involved in the
pathophysiology of preeclampsia (PE) [2-4].
Oxidative stress and inflammation have been shown associated with shallow placentation
and subsequent PE. Aetiology of these associations is still unclear, but it is now
postulated to result from a combination of immunologic, environmental and genetic
factors that leads to the failure of normal trophoblastic invasion and remodelling of the
uterine spiral arteries [2-4]. This disorder causes underperfusion, ischemia and hypoxia in
placenta [5, 6], which is then thought to release in maternal circulation a variety of
mediators including proinflammatory cytokines such as tumor necrosis-alpha (TNF-a),
interleukins (IL-1 and IL-6), interferon gamma (INF-y) and reactive oxygen species
(ROS) such as nitric oxide (NO), superoxide anion (02~) and hydrogen peroxide (H2O2)
44
[7, 8]. These mediators are thought to cause endothelial dysfunction and permanent
systemic vasoconstriction leading to preeclampsia [9-11].
Placental trophoblasts, similarly to all mammalian cells, possess an ever-expanding list of
cellular signalling molecules [12], including immune-mediated extracellular ligands and
receptors, such as TNF-a and its receptors [13]. In the human placenta, TNF-cc is
produced in villous of the placenta throughout pregnancy and has been implicated in the
regulation of placental apoptosis [14]. TNF-a exerts its biological effects via two cell
surface receptors, namely TNFR1 (p55, 55kD) and TNFR2 (p75, 75kD). These receptors
are encoded by two independent genes, and each receptor is capable of mediating distinct
intracellular signals [15, 16].
TNF-a is strongly associated with T helper 1 and its expression has been shown to
increase in maternal serum of preeclamptic pregnancies [17, 18]. Actually, there is
conflicting evidence whether high levels of TNF-a shown in maternal circulation are of
maternal or placental origin. Up to now, it is thought that increased expression of TNF-a
in the placental compartment could lead to the activation of the circulating leukocytes,
linking the oxidative stress of the placenta with a widespread increased oxidative stress
and endothelial dysfunction in the mother [19]. Hung et al.[20] showed that in vitro
hypoxia/reoxygenation leads to increased expression of TNF-a in placental cells,
suggesting that the organ is the main source of circulating cytokine in preeclampsia.
Parallel, we recently showed an increase of levels of H2O2 in both maternal circulation
and placenta of women with preeclampsia [8], suggesting a close link between H2O2 and
TNF-a.
Considering the above, the objective of this study was to investigate the effects of H2O2
on the regulation of placental synthesis of TNF-a and its receptors.
Materials and methods
Human subjects and collection of placental samples
Placentas were obtained from women with normal pregnancy and delivery, and neonates
were of appropriate size for gestational age. All gave their written and informed consent
to take part in the study, which was approved by the Ethics Committee of the CHUS
(Centre Hospitalier Universitaire de Sherbrooke). Immediately after delivery of the
placenta, samples were collected, and the total length of processing time was less than
15 min. As the placenta is a large heterogeneous organ and sampling bias is a potential
hazard [21], three biopsies (2 cm2) of the placenta were taken (centre, mid and edge of
placenta) avoiding areas of infarcts and thrombosis. Each sample was briefly rinsed 3
times in cold saline, blotted dry and flash-frozen in individual bags in liquid nitrogen.
Cytotrophoblasts isolation and culture
Human cytotrophoblasts were purified from five placentas of uncomplicated term
pregnancies immediately after delivery, with the method previously described by Kliman
et al.[22], with minor modifications. Approximately 35 to 40 g of placental villous tissue
from the maternal side was digested three times for 30 min with 0.15% trypsin (Sigma, St.
Louis, MO, USA) and 0.02% deoxyribonuclease I (Roche Diagnostics, Laval, QC,
Canada) in Hank s' balanced salt solution (HBSS; Invitrogen Canada Inc, Burlington, ON,
Canada) containing 25 raM HEPES (Sigma) in a water bath at 37°C. For the last two
digestions, tissue fragments were allowed to settle and the supernatant was filtered
through a 200 uM pore size nylon mesh and no more than 45 ml of cell suspension was
layered over 5 ml aliquots of fetal calf serum (Sigma) and centrifuged at 1000xg for
46
lOmin at room temperature. The pelleted cells were then resuspended in Dulbecco's
Modified Eagle's Medium (DMEM) (Sigma) at room temperature.
All of the resultant cell suspensions were pooled, centrifuged at lOOOxg, and resuspended
in 5 ml of DMEM. The cells were layered over a discontinuous Percoll (Amersham
Biosciences, Baie d'Urfe, QC, Canada) density gradient (5-70% in 5% steps of 3 ml each
in HBSS) and centrifuged at 400 x g at room temperature for 20 min. The band of cells
between 50 and 40% was collected, washed once, and cultured in DMEM containing 10%
fetal bovine serum (FBS; Wisent Inc, St-Bruno, QC, Canada), 1% PSN (penicillinstreptomycin-neomycin) antibiotic mixture (Invitrogen, Canada Inc.), 2 mM glutamine
(Wisent) and 44 mM sodium bicarbonate (Fisher Scientific Ltd, Nepean, ON, Canada),
pH 7.2, in a humidified 5% C02/95% air incubator at 37°C in a poly-1-lysine (Sigma)
treated six wells plate (Becton Dickinson Labware, Franklin Lakes, NJ, USA) at 1 x 10
cells per well with 2 ml of DMEM. For all experiments, the purity of isolated
cytotrophoblasts was 98% as assessed by cytokeratin (positive) and vementin (negative)
staining according to Guilbert et al.[23].
Exposure of cytotrophoblasts to H2O2
Cells were allowed to attach overnight and then washed with DMEM. To study the effects
of oxidative stress in these cells, they were thereafter exposed for 48 h to different
concentrations of H202: 0, 25, 50 and 100 uM of H2O2 (Fisher Scientific) in complete
medium, according to our previous study [24]. Following incubation, media were
collected and preserved at - 20°C until determination of TNF-a and its receptors.
Cytotrophoblasts were then detached with trypsin 0.125% 2 min, inhibited by complete
medium and preserved in lysis buffer for mRNA extraction (Stratagene, Cedar Creek, TX,
USA). To establish the specificity of H2O2 effect on TNFR2 synthesis, cells were pretreated with neutralizing monoclonal antibody against TNFR2 (5 ug/ml, R&D system,
Minneapolis, MN, USA) for 1 h at 37 °C, and then H2O2 was added and incubated for
48 h. Cell viability was determined by a Trypan Blue staining.
Assessment of soluble TNF-a and its receptors
Soluble concentrations of TNF-a, TNFR1 and TNFR2 were determined in the
supernatants using an Enzyme Linked Immunosorbent Assay (ELISA) method, based on
commercial kits and according to instructions of manufacturers (BD Biosciences,
Mississauga, ON. Canada). All samples were assayed in duplicates and read with the
spectrophotometer at 450 nm.
Assessment of TNF-a mRNA
RNA extraction
Forty milligrams of tissue from -80°C stored biopsies of placenta were used for RNA
extractions. Cultured cytotrophoblasts isolated from placenta were stored in lysis buffer at
- 80°C until extractions. Total RNA was extracted by using the Absolutely RNA
Miniprep Kit (Stratagene, La Jolla, CA, USA), following the standard manufacturer's
protocol including DNase step. Total RNA was eluted from the columns in 50 ul of
elution buffer 2 times. Total RNA concentration was determined by absorbance at 260 nm
(Ultrospec 2100pro UV/Visible Spectrophotometer, Biochrom, England). Protein
contamination was monitored by A260/A280 ratio.
48
Real-time RT-PCR
First strand cDNA was synthesized using the iScriptTM cDNA Synthesis Kit (Bio-Rad
Laboratories, Hercules, CA, USA) according to manufacturer's instructions. The
maximum amount of total RNA was run in 20 ul reactions. The reactions were performed
in a TGradient Thermoblock (Biometra, Germany). Human TNF-a and P-actin primers
were purchased from R&D Systems, Inc. (Minneapolis, MN, USA). For TNF-a, the
forward
and
reverse
sequences
were
GTGACAAGCCTGTAGCCCA
and
ACTCGGCAAAGTCGAGATAG, respectively. Using these primers, the RT-PCR
fragment was 414 bp, whereas amplification of genomic DNA would have yielded a 714
bp
fragment.
For
P-actin,
the
forward
and
reverse
sequences
were
CTACAATGAGCTGCGTGTGG and AAGGAAGGCTGGAAGAGTGC, respectively.
Using these primers, the RT-PCR fragment was 528 bp, whereas amplification of
genomic DNA would have yielded a 969 bp fragment. The iTaqTM SYBR Green
Supermix with ROX (Bio-Rad Laboratories, Hercules, CA, USA) was used for the PCR
reactions according to manufacturer's instructions.
PCR master mixes were prepared containing either the TNF-a or p-actin primer pairs at
225 nM (kept on ice). Uracil-N-glycosylase (Roche, Penzberg, Germany) was added to
the master mixes at 0.02 U/u.1 to prevent carry-over. Two microlitres of the RT reaction
was added to 48 ul of the PCR master mix. The mixtures were gently mixed, quickly
centrifuged and separated in 2 0.1 ml tubes (Corbett Research, Sydney, Australia) for 25
ul duplicate. For each assay, a no template control and 2 positive controls, one for each
primer pair, were done.
The PCR reaction was performed in a Rotor Gene RG-3000 (Corbett Research, Sydney,
Australia). The PCR program was setup as follow: a first hold at 50°C for 2 min, followed
by a second hold at 95°C for 2.5 min. Each cycle consisted of 30 sec at 95°C, 45 seconds
at 55°C and 45 seconds at 72°C and was repeated 60 times. Then a standard melt step was
performed to verify the specificity of the reactions. The analysis of the data was done
according to the mathematical model for relative quantification described by M. W. Pfaffl
[25]. For each primer, the efficiency (E) of the reactions was determined with realtime
PCR of serial dilutions of a reverse transcripted sample and the equation: E=101/slope.
The values of A Ct (A CP) determined by the Rotor Gene 6 software were used to
calculate the relative expression ratio of a sample (exposed cytotrophoblasts) versus a
control (nonexposed cytotrophoblasts).
Immunofluorescence and cytometric analysis
Expression
of
membranous
receptors
of
TNF-a
(mTNFRl
or
mTNFR2)
in
cytotrophoblasts was determined by indirect immunofluorescence and cytometry. Cover
slips were placed into a 6-well plate. A total of 1x10 cells were added into each well and
treated with different concentration of H2O2 as described above for 48 hours.
Cytotrophoblasts were fixed with 4% paraformaldehyde for 30 min, washed 3 times with
PBS, and permeabilized with triton X-100 ( 1 % in PBS) for 20 min. After a PBS rinse,
cytotrophoblasts were incubated with a monoclonal mouse anti-human TNFR1 or TNFR2
antibody ( R & D System, Minneapolis, MN, USA) in 1% BSA/PBS for 2 hours. After
washing with PBS, the cells were incubated with secondary antibody goat anti-mouse
Alexa Fluor 594 for 1 hour. Nuclei were identified by 4',6'-diamidino-2-phenyllindole
staining for 15 min at room temperature.
PBS was used to replace first antibody and served as a negative control. After being
washed 2 times with PBS, the cytotrophoblasts were mounted on slides and observed
under an Olympus microscope (Olympus BX60 microscope) and photomicrographs were
taken with corporate computer. Moreover, immuno- and Pi-stained cells were scanned
with iCys imaging cytometer (Compucyte, Cambridge, MA) using Argon ion excitation
laser (488 nm) with green (530nm/30nm, immunostaining detection of TNFR1 or
TNFR2), long red (650nm/LP, DNA staining detection of cytotrophoblasts) and scatter
detectors. Scanning was performed at 0.5 urn x 0.25 urn pixel size resolution. Sample
focusing was adjusted with scatter detector. Event selection was performed using a virtual
channel obtained by adding green and long red signals to insure detection of fused cells.
Cell types were identified based on DNA content one genomic copy for cytotrophoblasts.
An experimented scorer selected the scoring thresholds for immunostaining intensity. All
cytotrophoblasts selections were confirmed by visualizing a gallery of at least 25
representative cells.
Statistical analysis
A non-parametric statistical test such as the KrusKal Wallis test was used. All analyses
were carried out using the Statistical Analysis System (SAS Institute, Inc., Cary, NC). A
P value less than 0.05 was considered statistically significant.
51
Results
To test the effects of hydrogen peroxide on TNF-a mRNA expression in freshly isolated
cytotrophoblasts, these cells were treated with increasing concentrations of H2O2 (0, 25, 50
and 100 uM) for 48-h. Viability was estimated at > 95% by Trypan Blue exclusion in
unexposed cytotrophoblasts. This viability was decreased at 75% and 50% after the exposure
of cytotrophoblasts to 50 and 100 uM of H2O2, respectively.
As shown in Figure 1, our first observations were the dose-dependent increase of TNF-a
mRNA expression, which was statistically significant with concentrations of H2O2 > 50
|iM. Moreover, released TNF-a protein was also increased following treatment of
cytotrophoblasts with 50 uM H2O2 (see Figure 2). On the other hand, levels of soluble
TNFR2 (sTNFR2) were increased after exposure cytotrophoblasts to 50 uM H2O2,
whereas levels of soluble TNFR1 (sTNFRl) did not differ between treated and untreated
cytotrophoblasts (see Figure 2). Using an immunofluorescence analysis, our results
showed that membranous expression of TNFR2 (mTNFR2), but not membranous TNFR1
(mTNFRl), was increased after the exposure of cytotrophoblasts to 50 uM H2O2 (see
Figure 3). Interestingly, the amount of detected soluble TNF-a (sTNF-a) has exceeded
twice after pretreatment with neutralizing anti-TNFR2 antibody (see Figure 4).
52
0-"
1
0
1
1
1
1—
5
25
50
H202 exposure
100
Figure 1. Production of TNF-a mRNA by cytotrophoblasts exposed to H2O2.
Cytotrophoblasts were exposed to increased concentrations of H2O2 (0, 25, 50 and 100
uM) for 48h. TNF-a mRNA was assessed as relative expression ratio. Central bars
represent median values; boxes represent interquartile ranges; and whiskers represent the
90th and 10th percentiles. P < .005 and .001 for exposure to 50 and 100 uM H 2 0 2 ,
respectively, compared to unexposed controls (H2O2 = 0). P-values were determined by a
non-parametric statistical test (Kruskal Wallis test). Five placentas were studied.
53
I 8.
P<.001
Q.
EZI Unexposed
•
H202 (50 fjM/L)
C
« 4H
P<.001
© 2-
go-
CZI
en
s>
/
<?
«>
«>
#*
^
Figure 2. Effects of H202 on released soluble TNF-a and its receptors by
cytotrophoblasts.
Cells were exposed to 50 uM H2O2 for 48h. Then soluble proteins of TNF-a, TNFR1 and
TNFR2 were assessed in pg/mL. White and black bars represent unexposed and exposed
cells to 50 uM H2O2, respectively. A control column for each of the protein was used. P <
.001, for both TNF-a and TNFR2, but not TNFR1. Five placentas were studied.
54
IA
•
;
$
&
&
$
-
>_ .-, * r. , •"
,**
H i
3B
P«£,WH
U
FigiDir© 3. Effects of H2O2 on membranous receptors of TNF-a expression.
Cytotropfaoblasts exposed to 50 pM H202 and examined for expression of membranous
receptors of TNF-a. Figure 3 showed immunofluorescence of mTNFR2 (3 A), including
negative control in the absence of primary antibody (A), unexposed cells (B) and exposed
cells (C). A graphical illustration of mTNFR2 immunostainiog (3B) was also showed.
Data are presented as mean ± SEM. P < .001 for niTNFR2 after exposure to 50 |iM H2O2,
compared to unexposed controls. Five placentas were studied.
55
P<.0001
E
I
6P < .001
4_0)
A
O
CO
201
r
<>
#
Figure 4. Effects of anti-TNFR2 Ab on cytotrophoblasts exposed to H2O2.
Neutralizing monoclonal antibody against TNFR2 (5 ng/ml) was pretreated to cells for 1
h at 37°C, and then 50 uM of H 2 0 2 was added for 48h. soluble TNF-a (sTNF-a) was
assessed in pg/mL. Central bars represent median values; boxes represent interquartile
ranges; and whiskers represent the 90th and 10l percentiles. Detected levels of sTNF-a
were double after TNFR2 neutralizing, P < .001, compared to cytotrophoblasts exposed to
only H2O2 and unexposed controls. Five placentas were studied.
56
Discussion
Our results showed that cytotrophoblasts exposed to H2O2 express high levels of TNF-a at
levels of protein and mRNA, confirming the direct activation of TNF-a by H2O2 and
providing a convincing model of the induction of inflammation by oxidative stress, a
phenomenon now called inflammatory stress. TNF-a and H2O2 share common signalling
pathways that involve the activation of N F - K B (nuclear factor-KB), even if this is done
according to different mechanisms [26]. Indeed, the phosphorylation of p65 at serine 529
has been shown to be required for the TNF-induced transcriptional activity of N F - K B
[27], whereas H2O2 induces N F - K B activation, not through serine phosphorylation or
degradation of IicBa, but through Syk-mediated tyrosine phosphorylation of IicBa [26].
On the other hand, as the activation of N F - K B can lead to the activation of TNF-a [28,
29], it is conceivable that H2O2 can induce TNF-a by activating N F - K B . Additionally,
there are reports showing that H2O2 activates N F - K B [30-32].
The second evidence from our study is the common pattern in the response of TNF-a and
TNFR2. High synthesis of membranous TNFR2 (mTNFR2) and soluble TNFR2
(sTNFR2) was the response of cytotrophoblasts to increased levels of H202 and TNF-a
in surrounding environment. Both mTNFR2 and sTNFR2 could strongly bind to sTNF-a,
preventing its diffusion. This becomes evident after neutralizing TNFR2 by an antibody
treatment, resulting in more detectable sTNF-a. The consequences of this double binding
of TNF-a would be to limit its effects on two targets: 1) on the same cells (autocrine
effect) when TNF-a is bound to mTNFR2; and 2) on the surrounding cells (paracrine
effect) when TNF-a is bound to sTNFR2.
This is consistent with our previous study on the expression of TNF-a and its receptors in
situ in placental villi, showing that expression of TNF-a and TNFR2 are inter-adaptative
and follow the same pattern, whereas expression of TNFR1 is constitutive and
independent from TNF-a [35].
On the other hand, our results showed that TNFR1 was not affected by H2O2. H2O2exposed cytotrophoblasts express similar levels of TNFR1 compared to unexposed
cytotrophoblasts. This would suggest that TNFR1 is not influenced by the variation of
significant oxidative stress surrounding cytotrophoblasts. Furthermore, we previously
showed that the expression of TNFR1 was constitutive and present in all cells of normal
placental villi, independently of TNF-a expression. Thus, these results suggest distinctive
roles of TNF-a receptors against oxidative stress. Outside these cells, TNFR1 is expressed
rather constitutively on a broad spectrum of different cell types and has been shown to
mediate most of the commonly known biological effects of TNF-a [36, 37]. In contrast,
expression of the TNFR2 seems to be regulated and there are only a few cellular
responses which can be attributed exclusively to signalling via the TNFR2 (i.e.
proliferation of thymocytes and mature T cells, NK and B cells, and GM-CSF secretion of
T lymphocytes) [38, 39]. Recently a function for TNFR2 has also been proposed in
expansion and activation of regulatory T cells [40]. Moreover, TNFR2 has been shown to
be preferentially activated by membrane-bound TNF-a [41].
Excessive production of ROS and inflammatory factors may occur at certain windows in
placental development and in pathologic pregnancies, such as those complicated by
preeclampsia and/or IUGR, overpowering antioxidant defenses with deleterious outcome.
In the first trimester, establishment of blood flow into the intervillous space is associated
with a burst of oxidative stress. The inability to mount an effective antioxidant defense
against this results in early pregnancy loss [42]. In late gestation increased oxidative stress
is seen in pregnancies complicated by PE in association with increased trophoblast
apoptosis and deportation and altered placental vascular reactivity [42]. Thus, the
relevance of our findings is due to the fact that they mimic in vitro an oxidative
environment that we usually find in placenta-mediated diseases such as preeclampsia and
IUGR [7].
In conclusion, our findings emphasize that cytotrophoblasts respond to oxidative stress by
enhancing synthesis of TNF-a, which appear to play a relevant role in both oxidative
stress and preeclampsia, and secondly by enhancing TNFR2 which may attenuate the
excessive levels of TNF-a by reducing its autocrine and paracrine effects. These findings
also seem to provide an explanation of why we often fail to detect soluble TNF-a in
biological media. Also, our findings appear to pave the way for considering the use of
recombinant sTNFR2 in neutralizing the inflammatory effects of oxidative stress.
Additional studies must be undertaken to explore the potential protective effect of TNFR2
in animal and human placentas. Eventually, this could provide novel anti-inflammatory
prevention against several conditions and diseases which are characterized by high
placental inflammatory stress such as gestational hypertension-preeclampsia.
59
Acknowledgments
This study was supported by funding provided by the Fondation des etoiles (FE), the
Fonds de Recherche en Sante du Quebec (FRSQ), the Canadian Instituts of Health
Research (CIHR) and the Centre de Recherche Clinique (CRC)-Etienne-Lebel du CHUS.
The authors wish to thank Danielle Beaulieu for recruitment of patients, samples
collection and providing clinical data and Eric Bouchard for microscopy analysis.
Declaration of interest: The authors report no conflicts of interest. The authors alone are
responsible for the content and writing of the paper.
60
References
[1] Rejniak KA, Kliman HJ, Fauci LJ. A computational model of the mechanics of
growth of the villous trophoblast bilayer. Bull Math Biol 2004; 66: 199-232.
[2] Roberts JM, Cooper DW. Pathogenesis and genetics of pre-eclampsia. Lancet 2001;
357: 53-56.
[3] Roberts JM, Lain KY. Recent Insights into the pathogenesis of pre-eclampsia.
Placenta 2002; 23: 359-372.
[4] Kharfi A, Giguere Y, Sapin V, Masse J, Dastugue B, Forest JC. Trophoblastic
remodeling in normal and preeclamptic pregnancies: implication of cytokines. Clin
Biochem 2003; 36: 323-331.
[5] Lyall F, Myatt L. The role of the placenta in pre-eclampsia~a workshop report.
Placenta 2002; 23 Suppl A: S142-145.
[6] Granger JP, Alexander BT, Bennett WA, Khalil RA. Pathophysiology of pregnancyinduced hypertension. Am J Hypertens 2001; 14: 178S-185S.
[7] Kharfi A, Giguere Y, De Grandpre P, Moutquin JM, Forest JC. Human chorionic
gonadotropin (hCG) may be a marker of systemic oxidative stress in normotensive and
preeclamptic term pregnancies. Clin Biochem 2005; 38: 717-721.
[8] Aris A, Benali S, Ouellet A, Moutquin JM, Leblanc S. Potential Biomarkers of
Preeclampsia: Inverse Correlation between Hydrogen Peroxide and Nitric Oxide Early in
Maternal Circulation and at Term in Placenta of Women with Preeclampsia. Placenta
2009; 30: 342-347.
[9] Roberts JM, Hubel CA. Is oxidative stress the link in the two-stage model of preeclampsia? Lancet 1999; 354: 788-789.
61
[10] Hubel CA. Oxidative stress in the pathogenesis of preeclampsia. Proc Soc Exp Biol
Med 1999;222:222-235.
[11] Khalil RA, Granger JP. Vascular mechanisms of increased arterial pressure in
preeclampsia: lessons from animal models. Am J Physiol Regul Integr Comp Physiol
2002; 283: R29-45.
[12] Heazell AE, Crocker IP. Live and let die - regulation of villous trophoblast apoptosis
in normal and abnormal pregnancies. Placenta 2008; 29: 772-783.
[13] Allaire AD, Ballenger KA, Wells SR, McMahon MJ, Lessey BA. Placental apoptosis
in preeclampsia. Obstet Gynecol 2000; 96: 271-276.
[14] Levy R, Nelson DM. To be, or not to be, that is the question. Apoptosis in human
trophoblast. Placenta 2000; 21: 1-13.
[15] Chen HL, Yang YP, Hu XL, Yelavarthi KK, Fishback JL, Hunt JS. Tumor necrosis
factor alpha mRNA and protein are present in human placental and uterine cells at early
and late stages of gestation. Am J Pathol 1991; 139: 327-335.
[16] Shu HB, Takeuchi M, Goeddel DV. The tumor necrosis factor receptor 2 signal
transducers TRAF2 and c-IAPl are components of the tumor necrosis factor receptor 1
signaling complex. Proc Natl Acad Sci U S A 1996; 93: 13973-13978.
[17] Visser W, Beckmann I, Bremer HA, Lim HL, Wallenburg HC. Bioactive tumour
necrosis factor alpha in pre-eclamptic patients with and without the HELLP syndrome. Br
J Obstet Gynaecol 1994; 101: 1081-1082.
[18] Vince GS, Starkey PM, Austgulen R, Kwiatkowski D, Redman CW. Interleukin-6,
tumour necrosis factor and soluble tumour necrosis factor receptors in women with preeclampsia. Br J Obstet Gynaecol 1995; 102: 20-25.
62
[19] Walsh SW. Maternal-placental interactions of oxidative stress and antioxidants in
preeclampsia. Semin Reprod Endocrinol 1998; 16: 93-104.
[20] Hung TH, Charnock-Jones DS, Skepper JN, Burton GJ. Secretion of tumor necrosis
factor-alpha from human placental tissues induced by hypoxia-reoxygenation causes
endothelial cell activation in vitro: a potential mediator of the inflammatory response in
preeclampsia. Am J Pathol 2004; 164: 1049-1061.
[21] Mayhew TM, Burton GJ. Methodological problems in placental morphometry:
apologia for the use of stereology based on sound sampling practice. Placenta 1988; 9:
565-581.
[22] Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss JF, 3rd. Purification,
characterization, and in vitro differentiation of cytotrophoblasts from human term
placentae. Endocrinology 1986; 118: 1567-1582.
[23] Guilbert LJ, Winkler-Lowen B. Placental alkaline phosphatase (PLAP) staining and
human chorionic gonadotropin (hCG) production in cultures of fresh and cryopreserved
cytotrophob lasts isolated by CD9/MHC class I/MHC class II immunoelimination.
Placenta 2007; 28: 348-349.
[24] Kharfi Aris A, Leblanc S, Ouellet A, Moutquin JM. Dual action of H202 on
placental hCG secretion: implications for oxidative stress in preeclampsia. Clin Biochem
2007; 40: 94-97.
[25] Pfaffl MW. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res 2001; 29: e45.
[26] Takada Y, Mukhopadhyay A, Kundu GC, Mahabeleshwar GH, Singh S, Aggarwal
BB. Hydrogen peroxide activates NF-kappa B through tyrosine phosphorylation of I
63
kappa B alpha and serine phosphorylation of p65: evidence for the involvement of I kappa
B alpha kinase and Syk protein-tyrosine kinase. J Biol Chem 2003; 278: 24233-24241.
[27] Wang D, Baldwin AS, Jr. Activation of nuclear
factor-kappaB-dependent
transcription by tumor necrosis factor-alpha is mediated through phosphorylation of
RelA/p65 on serine 529. J Biol Chem 1998; 273: 29411-29416.
[28] Shakhov AN, Collart MA, Vassalli P, Nedospasov SA, Jongeneel CV. Kappa B-type
enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the
tumor necrosis factor alpha gene in primary macrophages. J Exp Med 1990; 171: 35-47.
[29] Collart MA, Baeuerle P, Vassalli P. Regulation of tumor necrosis factor alpha
transcription in macrophages: involvement of four kappa B-like motifs and of constitutive
and inducible forms of NF-kappa B. Mol Cell Biol 1990; 10: 1498-1506.
[30] Kretz-Remy C, Mehlen P, Mirault ME, Arrigo AP. Inhibition of I kappa B-alpha
phosphorylation and degradation and subsequent NF-kappa B activation by glutathione
peroxidase overexpression. J Cell Biol 1996; 133: 1083-1093.
[31] Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently
widely used messengers in the activation of the NF-kappa B transcription factor and HIVl.EmboJ 1991; 10:2247-2258.
[32] Meyer M, Schreck R, Baeuerle PA. H202 and antioxidants have opposite effects on
activation of NF-kappa B and AP-1 in intact cells: AP-1 as secondary antioxidantresponsive factor. Embo J 1993; 12: 2005-2015.
[33]
Kharfi A, Bureau M, Giguere Y, Moutquin JM, Forest JC. Dissociation
between increased apoptosis and expression of the tumor necrosis factor-alpha system in
term placental villi with preeclampsia. Clin Biochem 2006; 39: 646-651.
64
[34] Vercammen D, Vandenabeele P, Declercq W, Van de Craen M, Grooten J, Fiers W.
Cytotoxicity in L929 murine fibrosarcoma cells after triggering of transfected human p75
tumour necrosis factor (TNF) receptor is mediated by endogenous murine TNF. Cytokine
1995;7:463-470.
[35] Wajant H, Pfizenmaier K, Scheurich P. Tumor necrosis factor signaling. Cell Death
Differ 2003; 10:45-65.
[36] Vandenabeele P, Declercq W, Vercammen D, Van de Craen M, Grooten J, Loetscher
H, Brockhaus M, Lesslauer W, Fiers W. Functional characterization of the human tumor
necrosis factor receptor p75 in a transfected rat/mouse T cell hybridoma. J Exp Med
1992; 176:1015-1024.
[37] Grell M, Becke FM, Wajant H, Mannel DN, Scheurich P. TNF receptor type 2
mediates thymocyte proliferation independently of TNF receptor type 1. Eur J Immunol
1998; 28: 257-263.
[38] Scumpia PO, Delano MJ, Kelly KM, O'Malley KA, Efron PA, McAuliffe PF, Brusko
T, Ungaro R, Barker T, Wynn JL, Atkinson MA, Reeves WH, Salzler MJ, Moldawer LL.
Increased natural CD4+CD25+ regulatory T cells and their suppressor activity do not
contribute to mortality in murine polymicrobial sepsis. J Immunol 2006; 177: 7943-7949.
[39] Seitz C, Mannel DN, Hehlgans T. Isolation and functional characterization of the
mouse p75 TNF receptor promoter. Genomics 1998; 48: 111-116.
[40] Myatt L, Cui X. Oxidative stress in the placenta. Histochem Cell Biol 2004; 122:
369-382.
65
2.2 Article 2: Dual action of H2O2 on placental hCG secretion : Implications for
oxidative stress in preeclampsia
2.2.1Auteurs :
Aziz Kharfi Aris, Samuel Leblanc, Annie Ouellet, Jean-Marie Moutquin
2.2.2 Role joue par le candidat dans cette etude :
Design experimental, realisation des experiences, compilation des donnees, analyse
statistique des donnees.
Article publie dans CLINICAL BIOCHEMISTRY, 2007 JAN; 40(l-2):94-7.
66
2.2.3 Resume
Nos resultats prealablement publies ont demontre que les niveaux circulants d't^Ch
etaient augmentes et correles avec de hauts niveaux de 1'hCG chez les femmes
souffrant de preeclampsie, suggerant que le stress oxydatif pourrait moduler la synthese
de cette hormone placentaire. L'objectif de cette etude etait d'etudier in vitro les effets
de TH202 sur la secretion placentaire de 1'hCG. Des cytotrophoblastes in vitro on ete
traites avec des concentrations croissantes d'l^Ch et la secretion de 1'hCG de novo a
ete mesuree. Le traitement avec de faibles concentrations d't^C^ (1-50 uM)
augmentent la secretion de 1'hCG par les cytotrophoblastes, alors que des
concentrations superieures a 50 uM reduisent la secretion de 1'hCG d'une maniere dose
dependante. Nos resultats soulignent done que : (1) PH2O2 pourrait avoir une double
action sur l'activite placentaire et agir non seulement comme un agent cytotoxique,
mais aussi comme une molecule de signalisation pouvant induire la secretion de 1'hCG
; (2) 1'hCG pourrait etre un agent antioxydant protecteur relache par le placenta pour
contrer un stress oxydatif leger.
67
2.2.4 Article 2
Published in Clinical Biochemistry,
2007 Jan; 40(l-2):94-7
Dual action of H2O2 on placental hCG secretion: implications for oxidative stress
in preeclampsia
Short Title: effects of oxidative stress on trophoblastic hCG secretion
Aziz Kharfi Aris ab *, Samuel Leblanc, Annie Ouelleta, Jean-Marie Moutquina,b
a
Departement d'Obstetrique-Gynecologie, CHUS, FMSS, Universitaire de Sherbrooke.
b
Centre de Recherche Clinique Etienne Lebel, Axe Mere-Enfant, Faculte de Medecine,
Universite de Sherbrooke, Quebec, Canada.
Abstract
Objective: Our previous published findings showed that circulating levels of H2O2
were increased and correlated with high levels of hCG in women with preeclampsia,
suggesting that oxidative stress modulates placental hormone synthesis. The aim of this
study was to investigate in vitro the effects of H2O2 on placental secretion of hCG.
Design and Methods: in vitro trophoblasts were stimulated with increasing
concentrations of t^Chand the de novo hCG secretion was assayed.
Results: Stimulation with low concentrations of H2O2 (1-50 uM) enhance
cytotrophoblastic hCG secretion, whereas concentrations of H2O2 > 50 uM reduce hCG
secretion in a dose-dependent manner.
Conclusions: our findings emphasize that: 1) H2O2 may have dual action on
placental activity and acts not only as a cytotoxic mediator, but also as a signaling
molecule able to induce hCG secretion; 2) hCG may be a protective antioxidant
released by the placenta to counter low oxidative stress challenge.
Key-words: hCG, H2O2, placenta, trophoblasts, oxidative stress, preeclampsia
69
Introduction
Preeclampsia is a vasoconstrictive disorder, characterized by blood pressure >
140/90 mmHg in a previously normotensive women after the 20th week of pregnancy in
the presence of significant proteinuria (> 300 mg/24 h urine collection)[l, 2]. The
etiology of preeclampsia is still open to debate; it is now believed to result from a
combination of immunologic, environmental and genetic factors that leads to the failure
of normal trophoblastic invasion and remodeling of the uterine spiral arteries [3, 4].
This disorder causes underperfusion, ischemia and hypoxia in placenta [5, 6], which is
then thought to release in maternal circulation a variety of mediators including
hormones such as human chorionic gonadotropin (hCG), cytokines such as tumor
necrosis-alpha (TNF-a), interleukins (IL-1 and IL-6), interferon gamma (INF-y), and
reactive oxygen species (ROS) such as nitric oxide (NO), superoxide anion (O2-) and
hydrogen peroxide (H2O2). These mediators thought to cause endothelial dysfunction
and permanent systemic vasoconstriction leading to preeclampsia [7, 8].
Since trophoblastic abnormalities play a central role in the pathophysiology of
preeclampsia and precede its clinical manifestations [9], it is conceivable that some
placental hormone profiles such as an increased secretion of human chorionic
gonadotropin (hCG) are modified in the maternal circulation, pointing out to the defect
of placental function [9] and [10]. Increased production of hCG by preeclamptic
placentas has been shown to be associated with strong hCG immunostaining of the
syncytiotrophoblast [11]. Recently, we showed a correlation between the increased
secretion of hCG and oxidative stress as measured by circulating hydrogen peroxide
70
(H2O2) in vivo in preeclampsia, suggesting that increased level of H2O2 in pregnant
women can interfere with placental hormone synthesis [12].
H2O2 is a member of the ROS family, a product of produced by many enzymecatalyzed redox reactions and its determination is of fundamental importance in
biological fields, particularly in the assessment of the oxidative state. Under normal
conditions, the cells use their antioxidant defenses, which convert H2O2 to oxygen and
water, thereby keeping the production of the ROS system under control. Although
H2O2 is more known for its toxicological effects such as its ability to harm
microorganisms and to damage cells, its association with a high placental secretion of
hCG in vivo in preeclampsia allows us to think that H2O2 can act as a signaling
molecule. Some believe that hCG secretion may be increased as a consequence of
abnormal placental invasion, placental immaturity [13] or placental hypoxia with the
development of a hypersecretory state [10]. However, the exact mechanisms interacting
between H2O2 and placental hCG secretion are not clear. Their understanding would
help in best preventing and treating pathologies implying oxidative stress and placenta
such as preeclampsia.
71
Material and Methods
Human subjects
All placentas were obtained from women with normal pregnancy and delivery, and
all neonates were of appropriate size for gestational age. All gave their written and
informed consent to take part in the study, which was approved by the Ethic Committee
of the CHUS.
Collection of placental samples
Immediately after delivery of the placenta, samples were collected, and the total
length of processing time was less than 15 min. As the placenta is a large
heterogeneous organ, and sampling bias is a potential hazard [14], a square grid of 16
holes in a 4 x 4 design within a circular template was constructed to overlay the
placenta. Templates of various sizes were prepared to best fit placentas of different
diameters. After blotting the maternal surface of blood, a sterile nickel cork borer was
inserted into each of the 16 holes (~1 cm) to obtain a full thickness biopsy (~0.5 g
tissue, which excluded the chorionic plate). Each sample was briefly rinsed 3 times in
cold saline, blotted dry, and flash-frozen in individual bags in liquid nitrogen.
Cytotrophoblast isolation and culture
Human cytotrophoblasts were purified from five placentas of uncomplicated term
pregnancies immediately after delivery, with the method previously described by
Kliman et al.[15], with minor modifications. 35 to 40 grams of placental villous tissue
from the maternal side were digested 3 times for 30 minutes with 0.15 % trypsin
(Sigma, St Louis, MO, USA) and 0.02 % desoxyribonuclease I (Roche Diagnostics,
72
Laval, Qc, Can) in Hanks' balanced salt solution (HBSS) (Invitrogen Canada Inc,
Burlington, ON, Can) containing 25 mM HEPES (Sigma) in a water bath at 37°C. For
the two last digestions, tissue fragments were allowed to settle and the supernatant was
filtered through a 200 uM pore size nylon mesh and no more than 45 ml of cell
suspension was layered over 5 ml aliquots of fetal calf serum (Sigma) and centrifuged
at 1000 x g for 10 min at room temperature. The pelleted cells were then resuspended
in Dulbecco's Modified Eagle's Medium (DMEM) (Sigma) at room temperature. All of
the resultant cell suspensions were pooled, centrifuged at 1000 x g, and resuspended in
5 ml of DMEM. The cells were layered over a discontinuous Percoll (Amersham
Bioscinces, Baie d'Urfe, QC, Can) density gradient (5-70% in 5% steps of 3 ml each in
HBSS) and centrifuged at 400 g at room temperature for 20 minutes. The band of cells
between 50 an 40 % were collected, washed once, and cultured in DMEM containing
10 per cent fetal bovine serum (FBS) (Wisent Inc, St-Bruno, QC, Can), 1 per cent PSN
(Invitrogen Canada Inc.), 2 mM glutamine (Wisent) and 44 mM sodium bicarbonate
(Fisher Scientific Ltd, Nepean, ON, Can) (pH 7.2) in a humidified 5% C0 2 /95% air
incubator at 37°C in a poly-L-lysine (Sigma) treated six well plate (Becton Dickinson
Labware, Franklin Lakes, NJ, USA) at 1 x 106 cells per well with 2 mL of DMEM.
hCG-cytotrophoblasts stimulation
Cells were allowed to attach overnight and then washed with DMEM. To study the
effects of oxidative stress in these cells, they were thereafter exposed for 48 h to (0, 1,
5, 10, 50, 60, 70, 200 and 500 uM H 2 0 2 (Fisher Scientific) in complete medium.
Following incubation, the media were collected and preserved at -20°C until
73
determination of hCG. Cytotrophoblasts were then detach with trypsin 0.125 % 2
minutes, inhibited by complete medium and preserved in lysis buffer for mRNA
extraction (Stratagene, Cedar Creek, TX, USA).
Determination of hCG production
hCG was measured using a standard automated immunoassay which has a detection
limit of 0.1 IU/L (Elecsys HCG+P; Roche Diagnostics Corporation, Indianapolis, IN).
Statistical analysis
Data are presented as the mean concentration and mean percent change from
baseline, as determined from control cultures in unconditioned media, ± SD. Statistical
analysis was performed by analysis of variance (ANOVA) and post hoc analysis
(Dunnet test) for comparison to control. All analyses were carried out using the
Statistical Analysis System (SAS Institue, Inc., Cary, NC). A P value less than 0.05
was considered statistically significant.
74
Results
To test the effects of hydrogen peroxide on hCG secretion by trophoblast cells in
vitro, these cells were stimulated with increasing concentrations of H2O2 (0, 1, 5, 10,
50, 60, 70, 200 and 500 uM). Using an hCG standard automated immunoassay, the
hCG content of spent medium from control (unstimulated cells) and stimulated
trophoblasts was measured following 48-h hydrogen peroxide exposure. Our first
observations were the high individual variation of hCG secretion and the second
observations were the existence of two distinctive responses of hCG secretion
depending of the concentrations of H2O2. Thus, cultures stimulated with concentrations
under 50 uM showed high secretion of hCG relative to unstimulated controls, reaching
a maximal secretion with 5 uM H2O2 (Fig.lA). Ten, cultures stimulated with
concentrations of H2O2 above 50 uM (i.e. 60, 70, 200 and 500 uM) exhibited a marked
dose-dependent decrease in hCG secretion relative to their unstimulated controls (Fig.
IB). We recapitulated these tendencies in Fig. 2, showing the essential points of these
two windows of hydrogen peroxide effects on human trophoblast hCG secretion.
75
120
.0 e-110
*5 • 4i—- »
u 8 100
w «4—
O o
o
90H
80- 1
5
10
50
i
i
H 2 0 2 (uM)
120-.
§ 3
90
g 8 60
CO
O
O
M-
o
30H
i
50
60
70
200 500
H 2 0 2 (uM)
Fig. 1. Representative illustration of dual action of H2O2 on hCG production by
trophoblast cells in vitro. Concentrations of H2O2 from 1 to 50 uM produce more
secretion of hCG than unstimulated controls (0 uM), a maximal secretion was reached
with 5 uM H2O2 (A). In (B), cultures stimulated with concentrations of H2O2 > 50 uM
exhibited a marked dose-dependent decrease in hCG secretion.
76
150-.
P < 0.01
c ^r 125-
.2 2
0 c 100-
b o
75-
o
o
50-
°
250
p < 0.001
J
Control
5 uM
50 uM
500 uM
Peroxide concentration (uM)
Fig. 2. Effects of hydrogen peroxide on the hCG production of trophoblast cells in
vitro (n =5). For 48 h, the trophoblasts were stimulated by increasing concentrations of
H2O2 (5, 50 and 500 uM), unstimulated controls (0 uM H2O2). Secretion of hCG was
assessed by a standard automated immunoassay. Note the statistically significant
increase of hCG secretion following exposure to 5 uM H2O2. Because hCG secretion of
individual preparations varied, controls were arbitrarily set at 100 % in each
experiment.
*P < 0.01 or **P < 0.001 compared to unstimulated controls. P values were
determinate by ANOVA and post hoc analysis (Dunnet test).
77
Discussion
It is well established that oxidative stress is involved in human placental pathologies
such as preeclampsia and fetal growth restriction (FGR) [16]. Our previous study
showed that women with preeclampsia exhibit higher serum hCG and H2O2 than
normotensive pregnant women at term [12]. Thus, the main objective of the present
study was to examine in vitro the hCG production/secretion as response of
trophoblastic cells to an oxidative stress, in occurrence hydrogen peroxide. As already
highlight in our in vivo findings showing a positive correlation between increased
circulating hCG and H2O2 in preeclampsia, our present in vitro study on placental
function have revealed interactions between trophoblastic cells and oxidative stress
generated by H2O2. Both in vivo and in vitro observations suggest that H2O2 triggers
the placental hormone synthesis. Our results showed that the basal secretion of hCG
was higher after 48 h culture than 24h. This is may be explained by the high
differentiation of cytotrophoblasts to syncytiotrophoblasts, placental cells producing
pregnancy
hormones
(i.e. hCG). Incubation
of trophoblasts
with
increasing
concentrations of H 2 0 2 (0, 1, 5, 10, 50, 60, 70, 200 and 500 uM) for 24 h as well as 48
h result in a dual action of hydrogen peroxide. Low concentrations of H2O2 (1-50 uM)
enhance secretion of hCG, with a maximal production around 5 uM and moderate with
about 50 uM and below. Theses findings outline that hydrogen peroxide may act not
only as cytotoxic mediator, but also as a signaling molecule able to active cellular
synthesis. Although, the exact mechanisms of activation of H2O2 are not yet clear it is
possible that the secretion of hCG is a consequence of the increase in the differentiation
of cytotrophoblasts into syncytiotrophoblasts.
78
Many agents producing intracellular oxidative stress, including hydrogen peroxide
and steroid hormones, have also been found to induce the production of antioxidant
factors [17]. This action may be essential for the survival of terminally differentiated
cells subjected to oxidative stress, such as syncytiotrophoblasts, placental cells
producing hCG and forming the maternal-fetal barrier. Changes in the localization of
antioxidant factor expression were apparent after a low oxidative stress challenge [17].
In general, to counteract stress caused by H2O2, organisms have evolved a wide variety
of defence mechanisms. For instance, the reactions leading to H2O2 are minimized by
sequestering the metal ions that would otherwise act as catalysts into proteins. Ferritin,
transferrin, hemosiderin and heme are examples of proteins that enclose iron and thus
play a role in protecting the cell against oxidative damage [18]. Other tools in the
combat against oxidative stress are enzymes that are employed to rapidly dismutate
H2O2 to water. Superoxide dismutases (SOD), catalases, peroxidases (especially
glutathione peroxidases), and thioredoxin-linked systems are examples of such
enzymes [19], [20]. Many other molecules serve as antioxidants including vitamins
(e.g. vitamin E, vitamin C, provitamin A, also called beta-carotine), hormones (e.g.
melatonin) and cofactors such as coenzyme Q [21]. Thus, it is probable that hCG may
have an antioxidant role against low oxidative stress allowing the survival of placental
cells. Future investigations must aim to better eluciding these aspects.
On the other hand, the fall of hCG production after incubation with concentration of
H2O2 above 50 JJM could be explained by the toxological effect of hydrogen peroxide
on trophoblasts. Just as H2O2 has the ability to harm microorganisms, it also has the
ability to destroy our body's cells. H2O2 per se causes only mild damage. The
damaging power comes from the transition to highly reactive hydroxyl radicals that
79
indiscriminately react with a wide variety of organic substrates causing peroxidation of
lipids, cross-linking and inactivation of proteins, and mutations in DNA [22, 23].
Hydroxyl radicals form when H2O2 is exposed to ultraviolet light or when it comes in
contact with a range of transition metal ions, of which the most important is probably
iron. It is widely accepted that H2O2 is a toxin in vivo at concentrations of about 50 uM
and above.
In conclusion, our present in vitro findings confirm our previous in vivo study
suggesting that there are interactions between oxidative stress and placental function.
Hydrogen peroxide acts not only as a cytotoxic mediator, but also as a signaling
molecule able to induce secretion of hCG by trophoblasts. This dual action of H2O2
depends on its concentrations. Its low concentrations (1-50 uM) result in increase of
placental hCG secretion, whereas concentrations above 50 uM decrease this secretion.
On the other hand, our findings also suggest that hCG may be an antioxidant factor
produced by the placenta in order to counter low oxidative stress. Other investigation in
this direction will help to better understand these phenomena.
80
Acknowledgments
This work was supported by the Fonds de la Recherche en Sante du Quebec (FRSQ)
and La Fondation de la Recherche sur les Maladies Infantiles (FRMI). We thank
Helene Marceau, Jennifer Saint-Laurent, Christine Brown and Cynthia Rodrigue for
technical assistance.
81
References
[1] Roberts JM, Lain KY. Recent Insights into the pathogenesis of pre-eclampsia.
Placenta 002; 23: 359-372.
[2] Sibai
BM. Diagnosis
and
management
of gestational
hypertension
and
preeclampsia. Obstet Gynecol 2003; 102: 181-192.
[3] Roberts JM, Cooper DW. Pathogenesis and genetics of pre-eclampsia. Lancet
2001; 357: 3-56.
[4] Aris Kharfi A, Giguere Y, Sapin V, Masse J, Dastugue B, Forest JC. Trophoblastic
remodeling in normal and preeclamptic pregnancies: implication of cytokines. Clin
Biochem 2003; 36: 323-331.
[5] Lyall F, Myatt L. The role of the placenta in pre-eclampsia~a workshop report.
Placenta 2002; 23 Suppl A: SI42-145.
[6] Granger JP, Alexander BT, Llinas MT, Bennett WA, Khalil RA. Pathophysiology
of
reeclampsia: linking placental ischemia/hypoxia with microvascular dysfunction.
Microcirculation 2002; 9: 147-160.
[7] Hubel CA. Oxidative stress in the pathogenesis of preeclampsia. Proc Soc Exp
Biol Med
1999;222:222-235.
[8] Khalil RA, Granger JP. Vascular mechanisms of increased arterial pressure in
preeclampsia: lessons from animal models. Am J Physiol Regul Integr Comp Physiol
2002; 283: R29-45.
[9] Vaitukaitis JL, Ebersole ER. Evidence for altered synthesis of human chorionic
gonadotropin in gestational trophoblastic tumors. J Clin Endocrinol Metab 1976; 42:
1048-1055.
82
[10] Hsu CD, Chan DW, Iriye B, Johnson TR, Hong SF, Repke JT. Elevated serum
human
chorionic gonadotropin
as evidence of secretory
response
in
severe
preeclampsia. Am J Obstet Gynecol 1994; 170: 1135-1138.
[ll]Barros JS, Baptista MG, Bairos VA. Human chorionic gonadotropin in human
placentas
from normal and preeclamptic pregnancies. Arch Gynecol Obstet 2002;
266:67-71.
[12] Aris Kharfi A, Giguere Y, De grandpre P, Moutquin JM, Forest JC. Human
chorionic gonadotropin (hCG) may be a marker of systemiv oxidative stress in
nomotensive and preeclamptic. Clin Biochem 2005 Aug;38(8):717-21.
[13] Lieppman RE, Williams MA, Cheng EY, Resta R, Zingheim R, Hickok DE, Luthy
DA. An association between elevated levels of human chorionic gonadotropin in the
midtrimester and adverse pregnancy outcome. Am J Obstet Gynecol 1993; 168: 18521856; discussion 1856-1857.
[14] Mayhew TM, Burton GJ. Methodological problems in placental morphometry:
apologia for the use of stereology based on sound sampling practice. Placenta 1988; 9:
565-581.
[15]Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss JF, 3rd. Purification,
characterization, and in vitro differentiation of cytotrophoblasts from human term
placentae. Endocrinology 1986; 118: 1567-1582.
[16] Myatt L, Cui X. Oxidative stress in the placenta. Histochem Cell Biol 2004; 122:
369-382.
[17] McAleer MF, Tuan RS. Metallothionein protects against severe oxidative stressinduced apoptosis of human trophoblastic cells. In Vitr Mol Toxicol 2001; 14: 219-231.
83
[18]Nappi AJ, Vass E. Iron, metalloenzymes and cytotoxic reactions. Cell Mol Biol
(Noisy-le-grand) 2000; 46: 637-647.
[19] Droge W. Free radicals in the physiological control of cell function. Physiol Rev
2002; 82: 47-95.
[20] Arner ES, Holmgren A. Physiological functions of thioredoxin and thioredoxin
reductase. Eur J Biochem 2000; 267: 6102-6109.
[21] Reiter RJ, Melchiorri D, Sewerynek E, Poeggeler B, Barlow-Walden L, Chuang J,
Ortiz GG, Acuna-Castroviejo D. A review of the evidence supporting melatonin's role
as an antioxidant. J Pineal Res 1995; 18: 1-11.
[22] Liu D, Wen J, Liu J, Li L. The roles of free radicals in amyotrophic lateral
sclerosis: reactive oxygen species and elevated oxidation of protein, DNA, and
membrane phospholipids. Faseb J 1999; 13: 2318-2328.
[23] Abe T, Konishi T, Hirano T, Kasai H, Shimizu K, Kashimura M, Higashi K.
Possible correlation between DNA damage induced by hydrogen peroxide and
translocation of heat shock 70 protein into the nucleus. Biochem Biophys Res Commun
1995;206:548-555.
84
2.3 Article 3: Potential biomarkers of preeclampsia : inverse correlation
between hydrogen peroxide and nitric oxide early in maternal circulation
and at term in placenta of women with preeclampsia
2.3.1 Auteurs :
Aziz Aris, Sebastien Benali, Annie Ouellet, Jean-Marie Moutquin, Samuel
Leblanc
2.3.2R61e joue par le candidat dans cette etude :
Design experimental, realisation des experiences, compilation des donnees,
analyse statistique des donnees.
Article publie dans PLACENTA, 2009 APR;30(4):342-7.
85
2.3.3 Resume
La preeclampsie (PE) est un desordre specifique a la grossesse qui a ete
associe a des maladies cardiovasculaires ulterieures, aussi bien chez la mere
que chez l'enfant. L'etiologie de la PE est inconnue, mais le stress oxydatif
semble y jouer un role preponderant dans la dysfonction endothelial et la
vasoconstriction systemique permanente qui la caracterise. Le peroxyde
d'hydrogene (H2O2), un metabolite terminal dans la cascade du stress oxydatif
cellulaire,
est
aussi
un
composant
du
stress
oxydatif
lors
de
Pischemie/reperfusion du placenta. Nous avons ete les premiers a demontrer
Pelevation des niveaux d'EL^ dans le serum de femmes preeclamptiques a
terme. L'H202 est deja connu pour son role dans la reduction de la production
d'oxyde nitrique (NO) en augmentant le metabolisme des arginases. L'objectif
de cette etude etait d'etudier une possible correlation entre le NO, un
vasodilatateur puissant, et PH2O2 au cours de la grossesse normale et
preeclamptique. Nous avons done simultanement dose les niveaux du NO et de
P H2O2 dans le serum de femmes normales et preeclamptiques de 10 a 15 et de
37 a 40 semaines de grossesse, et dans leurs placentas a terme. Nos resultats
revelent une correlation inverse entre les niveaux de PH2O2 et du NO, aussi
bien au niveau sanguin qu'au niveau placentaire. Cette correlation est
confirmee par nos experiences in vitro, demontrant que PH2O2 inhibe la
synthese de NO par les cytotrophoblastes. Pour conclure, la correlation inverse
entre PH2O2 et le NO observee en debut de grossesse dans la circulation
maternelle et dans le placenta des femmes preeclamptiques ouvre la voie pour
86
de futures etudes sur l'usage potentiel du NO et de PH2O2 comme
biomarqueurs de prediction de la preeclampsie.
87
2.3.4 Article 3
Published in Placenta
Apr;30(4):342-7
Potential Biomarkers of Preeclampsia: Inverse Correlation Between Hydrogen
Peroxide and Nitric Oxide Early in Maternal Circulation and at Term in
Placenta of Women with Preeclampsia
A. Arisa'b'*, S. Benalib, A. Ouelleta, J.M. Moutquin3, S. Leblancb
department of Obstetrics-Gynecology, bLaboratory of Research in
Reproductive and Gestational Health.
Short Title: Potential use of hydrogen peroxide and nitric oxide as predictive
biomarkers of preeclampsia
Abstract
Preeclampsia (PE) is a pregnancy-specific disease that has been associated with
future cardiovascular disease for the mother and her child. The etiology of PE
is unclear but oxidative stress seems to play a major role in endothelial
dysfunction and permanent systemic vasoconstriction shown in PE. Hydrogen
peroxide (H2O2), a terminal metabolite of the cellular oxidative stress cascade,
is also revealed as a component of oxidative ischemia/reperfusion stress in
placenta. We were the first to show an increase in the levels of H2O2 in the
serum of preeclamptic women at term. H2O2 is already known to reduce the
production of NO by increasing the metabolism of arginases. The objective of
this study was to investigate a possible correlation between nitric oxide (NO), a
potent vasodilator, and H2O2 throughout pregnancy. Thus, we simultaneously
assessed the levels of NO and H2O2 in the serum of normal and preeclamptic
women at 10-15 and 37-40 weeks of pregnancy, and in placentas at delivery.
Our findings showed an inverse correlation between increased levels of H202
and decreased levels of NO early in maternal circulation and at term in
placenta. This relationship is confirmed by our in vitro experiments which
demonstrate that H2O2 inhibits NO synthesis of cytotrophoblasts. In conclusion,
our findings highlight an inverse correlation between H2O2 and NO early in
maternal circulation and placenta of women with preeclampsia, paving the way
for further studies examining the potential use of NO and H2O2 as biomarkers
in the prediction of preeclampsia.
Keywords: preeclampsia; placenta; oxidative stress; hydrogen peroxide
(H202); nitric oxide (NO); biomarkers
89
1.
Introduction
Preeclampsia is a vasoconstrictive disorder, characterized by blood
pressure = 140/90 mm Hg in previously normotensive women after the 20th
week of pregnancy in the presence of significant proteinuria (>300 mg/24 h
urine collection) [1] and [2]. The etiology of preeclampsia is still open to
debate; it is now believed to result from a combination of immunologic,
environmental and genetic factors that leads to the failure of normal
trophoblastic invasion and remodeling of the uterine spiral arteries [3] and [4].
This disorder causes underperfusion, ischemia and hypoxia in the placenta [5]
and [6], which is then thought to release in maternal circulation a variety of
mediators including hormones such as human chorionic gonadotropin (hCG),
cytokines such as tumor necrosis-alpha (TNF-a), interleukins (IL-1 and IL-6),
interferon gamma (INF-y) and reactive oxygen species (ROS) such as nitric
oxide (NO), superoxide anion (O2 ) and hydrogen peroxide (H2O2). These
mediators are thought to cause endothelial dysfunction and permanent systemic
vasoconstriction leading to preeclampsia [7] and [8].
H2O2 is a member of the ROS family and a metabolite produced by many
enzyme-catalyzed redox reactions. Its determination is of fundamental
importance in many biological fields, particularly in the assessment of the
oxidative state. In a previous study, we demonstrated that its circulating levels
are increased in preeclampsia [9] as well as its correlation with human
chorionic gonadotropin (hCG) [9], suggesting a direct effect of oxidative stress
on placental function. This hypothesis was confirmed by our in vitro study
90
showing that H2O2 modulates directly the endocrine activity of placenta [10].
Thus, the vasoconstriction seen in preeclampsia may be the result of the
combination of increased actions of many vasoconstrictor factors [11] including
oxidants such as H2O2 [12] and of the reduction in levels of vasodilators such
as nitric oxide (NO) [13].
NO production involves NO synthase (NOS) which, in the presence of
sufficient cofactor tetrahydrobiopterin (BH4), receives electron from NAD(P)H
to breakdown the cosubstrates 1-arginine and molecular oxygen into NO and 1citruline. There are three isoforms of NO synthase, neuronal NOS (nNOS),
inducible NOS (iNOS) and endothelial NOS (eNOS), which are expressed in
neurons, white cells, endothelium and placenta On the other hand, arginase
plays a key role in NO metabolism by catabolising 1-arginine to urea and 1ornithine. There are two isoforms of arginase both of which reduce NO
synthesis: arginase I, a cytosolic enzyme, and arginase II, a mitochondrial
enzyme [15] and [16]. These two arginases have been shown to be expressed in
cytotrophoblasts in the first trimester and at term in the human placenta [17].
NO has many key physiological effects such as maintaining systemic
vascular
health,
mediating
inflammatory
response
and
promoting
antithrombotic properties of the endothelium. The implication of NO in
preeclampsia is widely referred despite the controversy surrounding its kinetics
and the mystery around its regulation. Indeed, some studies found increased
levels of NO in maternal circulation [18] and [19] and placenta [20] while
91
others found decreased levels in the maternal serum [21] and placenta [22] or
even normal levels [23].
It is possible that H2O2 interacts with NO, providing two interdependent
mediators. Indeed, H2O2 has been shown to reduce the production of NO by
increasing arginases metabolism [15]. Thus, the purpose of this study is to
investigate a possible correlation between H2O2 and NO production in maternal
circulation and placenta throughout pregnancy with and without preeclampsia.
92
2. Materials and methods
2.1. Participants and blood sampling
The data for this study were derived from a prospective assessment of risk
for preeclampsia by a combination of maternal serum biomarkers. Among a
cohort of healthy nulliparous pregnant women recruited at Centre Hospitalier
Universitaire de Sherbrooke (CHUS), we examined twenty women with
preeclampsia (preeclamptic group) which were matched for age, gestational
age, and parity with twenty normotensive pregnant women (control group)
(Table 1). Preeclampsia was diagnosed when the systolic blood pressure was
greater than 140 mm Hg and/or diastolic blood pressure greater than or equal to
90 mm Hg and proteinuria greater than 0.3 g/24 h on a 24-h urine collection.
Eligible participants had 25.3 ± 5.1 for age and were not known for cigarette or
illicit drug use nor suffering from any medical conditions (i.e. diabetes,
hypertension or metabolic disease). All of the examined patients had Cesarean
delivery and did not have any adverse perinatal outcomes. The common
indications for Cesarean section among the control group included labor
dystocia, nonreassuring fetal heart testing, and malpresentation such as breech.
All subjects in our study reported taking standard prenatal multivitamins
with anti-oxidants such as vitamin C and E during pregnancy (typically 100 mg
of vitamin C and 30 IU of vitamin E). Blood sampling was serially performed
from each participant at 10-15 weeks of gestation and at delivery where routine
blood sampling was performed as part of the preoperative assessment before
93
Table 1
Characteristics of the normotensive and preeclamptic nulliparous pregnant
subjects and their serum and placental H2O2 and NO concentrations
Controls (n = 20)
Preeclampsia (n = 20)
3
P value
Age
- Mean ± SD
26.5 ± 5.8
25.3 ±5.4
NS
Gestational age
- Mean ± SD
38.5 ± 2.3
38.3 ±1.2
NS
Birth weight
-MeaniSD
NS
H 2 0 2 (mean ± SD, uM)
- Serum
• 10-15 weeks of gestation
P<0.01
• 37-40 weeks of gestation
P<0.01
- Placenta
• Homogenates
P<0.01
NO (mean ± SD, uM)
- Serum
• 10-15 weeks of gestation
P<0.01
•37-40 weeks of gestation
P < 0.001
- Placenta
• Homogenates
P < 0.001
3357 ± 345 g
3165 ± 4 3 8
30.45 ±6.31
41.75 ±13.36
33.15 ±8.09
46.20 ±14.63
7.88 ±1.94
10.99 ±3.48
25.81 ± 10.62
16.95 ± 6.23
29.49 ±6.86
19.82 ±6.51
4.54 ± 1.06
3.05 ± 1.00
H202 = hydrogen peroxide, NO = nitric oxide. Data are expressed as mean ±
SD. NS = not significant. a P values were determined by Mann-Whitney test
94
Cesarean section. We did not recruit pregnant women before the 10 week of
gestation; since they usually consult after this date.
The study was approved by the CHUS Ethics Human Research Committee
on Clinical Research. All participants gave written consent. Blood samples
were centrifuged at 2000 rpm for 15 minutes within 1 h of collection. Serum
was stored at -20°C until assayed for H202 and NO levels.
2.2. Placental samples collection
Immediately after delivery of the placenta, samples for PE and or a
selected following normotensive control were collected. The total length of
processing time was less than 15 min. As the placenta is a large heterogeneous
organ, and sampling bias is a potential hazard [24], three biopsies (2cm2) of
the placenta were taken (centre, mid and edge of placenta) avoiding areas of
infarcts and thrombosis. Almost all cases of proteinuric or severe PE deliver
early in the day which allowed us to use the fresh specimens we needed for
our lab processing. Collected placentas were homogenized according to a
previous protocol [25] and assessed for spontaneous production of H202 and
NO. For our in vitro study, a part of placental from normal pregnancy was
immediately processed to isolate cytotrophoblasts. These cells were obtained
by enzymatic dispersion and density gradient centrifugation as described
previously by Kliman et al. [26], and placed in culture for 24h.
95
2.3. In vitro exposure of cytotrophoblasts to H2O2
Isolated cytotrophoblasts were allowed to attach overnight and then
washed with DMEM, as we previously described [10]. To study the effects of
oxidative stress in these cells, they were exposed thereafter for 48 h to 0, 1, 5,
10, 25, 50, 100, 200 and 500 uM H 2 0 2 (Fisher Scientific) in complete
medium. The viability of trophoblasts was assessed for all experiments (n=5)
and was not affected by a concentration of 500 uM H202. Indeed,
trophoblasts have been shown to resist to a concentration of 1000 uM H2O2
[27]. Following incubation, the media were collected and preserved at — 20°C
until determination of NO.
2.4. H202 determination
Levels of H2O2 from serum and/or supernatant were measured using an
electrochemical technique adapted in our laboratory [9]. Briefly, H202 is
measured with a three-electrode system which consists of a platinum working
electrode, an Ag/AgCI reference electrode, and a Pt auxiliary electrode. The
potential at the working electrode is held at 650 mV vs the reference
electrode. H202 is oxidized on the microelectrode at this potential and the
current generated is recorded with an electrochemical detector. All
measurements are performed at ambient temperature (20-25°C). H202 stock
solutions (10 mM or 100 uM) are prepared by diluting the H2O2 (30%) in
double-distilled water. Phosphate buffer (50 mM, pH 7.4) is made from
K2HPO4 (0.84 g/1) and NaH2P04 (7.5 g/l). For the calibration curve, the
96
potential at the working electrode is highly linear from 0 to at least 200 \xM
concentration. These levels are about 34 uM (33.57 uM)9 and these
measurements are consistent with other studies claiming levels up to ^35 uM
in human blood plasma [28-31]. Levels of H202 at or below about 20-50 uM
seem to have limited cytotoxicity to many cell types [28]. Among the ROS
family members, H202 is the more stable and easy to measure under assay
conditions in which its removal is prevented.
2.5. NO determination
Because NO is stoichiometrically converted to nitrate and nitrite [32], the
stable metabolites of NO, levels of NO were determined by assaying for
nitrate and nitrite. The nitrate is first converted to nitrite by enzymatic
reduction catalyzed by nitrate reductase, and the nitrite is quantitated by a
colorimetric assay using the Griess Reagent [31]. NO production was
assessed by measuring levels of total nitrite and nitrate (NOx), the stable
metabolites of NO, in deproteinized serum. Nitrate was reduced to nitrite by
using the Griess method [33].
97
3.
Statistical analysis
Statistical analyses were carried out by the Mann-Whitney test for group
differences and by analysis of variance (ANOVA) and post hoc analysis
(Dunnett test) for comparison to control. For correlations, the Pearson and
Spearman rank correlation test were used. Data are presented as the mean
concentration ± SD All analyses were carried out using the Statistical
Analysis System (SAS Institute, Inc., Cary, NC). A P value less than 0.05 was
considered statistically significant.
98
4.
Results
As expected, there were no significant differences in age, parity, gestational
age and birth weight among the two matched groups (Table 1). Maternal serum
concentrations of H2O2 were significantly greater in preeclamptic women in
comparison to normotensive pregnant women at 10-15 weeks (41.75 ± 13.36 vs
30.45 ± 6.31, P < 0.01) and delivery (46.20 ± 14.63 vs 33.15 ± 8.09, P < 0.01)
(Table 1, Figs. 1A,B). Levels of H2O2 were also higher in preeclamptic
placentas than normotensive placentas (10.99 ± 3.48 vs 7.88 ± 1.94, P < 0.01)
(Table 1, Fig. 2A).
The concentration of serum NO was significantly lower in preeclamptic
women compared to the controls at 10-15 gestational weeks (16.95 ± 6.23 vs
25.81 ± 10.62, P < 0.01) and at term (19.82 ± 6.51 vs 29.49 ± 6.86, P < 0.001)
(Table 1, Figs. 1C,D). Also, concentrations of NO were low in placental
homogenates from preeclamptic group in comparison to normotensive women
(3.05 ± 1.00 vs 4.54 ± 1.06, P < 0.001) (Table 1, Fig. 2B).
Finally, there was an inverse correlation between NO and H202 in maternal
serum and placentas among all studied subjects (n = 40). Spearman correlation
coefficients were r = -0.58, P = 0.0001 for serum at 10-15 gestational weeks, r
= -0.60, P < 0.0001 for serum at 37-40 gestational weeks and r = -0.59, P <
0.0001 for placental homogenates (Figs. 3A,B and C).
For the in vitro study, viability of freshly isolated cytotrophoblasts was
estimated at > 95% by Tryptan Blue exclusion. To study the effects of H202
on NO production of trophoblasts cells in vitro, the number of of experiments
99
was 5 (n=5) (Fig. 4). Because NO production in individual preparations varied,
controls were arbitrary set at 100% in each experiment. Thus, 50 uM of H202
reduced levels of NO by 30%, P < 0.01 and 100 uM of H202 reduced levels of
NO by 40%, P < 0.01. P values were determinate by ANOVA and post hoc
analysis (Dunnett test).
100
I
A
B
100-.
100n
40-1
Control
?
80-
f
60-
•£
40-
oo
0(P n OO
Preeclampsia
Preeclampsia
Groups
Groups
C
D
100-i
2-
1
3
50-i
80
3-40-
60-
3
30-
tn
I 40
o
Z
20-
A
A
S 20-
A
* >
AA
Isle*-
iio0-
0-
Control
Preeclampsia
Groups
Control
Preeclampsia
Groups
Fig.l. Serum levels of hydrogen peroxide (H202) (A and B) and nitric oxide
(NO) (C and D) in pregnant women with (n = 20) or without preeclampsia (n =
20), at 10-15 gestational weeks (A and C) and at delivery (B and C). Maternal
serum H202 and NO were measured by an electrochemical method and a
colorimetric assay, respectively. The horizontal line refers to median
concentration. Note the significant differences in the levels of H202 and NO
among the studied groups (P < 0.01 for panel A, P < 0.01 for panel B, P = 0.01
for panel C and P < 0.001 for panel D).
101
A
_l
i
20-i
Z2
*—^
CM
O
CM
P < 0.01
15-
X
X—
O
CO
10-
5
0)
S
c
5-
0
o
0-
m
1
Controls
Preeclamptic
Groups
B
8-i
3
o
6P < 0.001
o
4-
$c
CD
2-
o
JO
Q.
0Controls
Preeclamptic
Groups
Fig.2. Placenta] levels of hydrogen peroxide (H202) (A) and nitric oxide (NO)
(B) in pregnant women with (n = 20) or without preeclampsia (n = 20), at
delivery (17-40 gestational weeks). Placental homogenates H202 and NO were
measured by an electrochemical method and a colorimetric assay, respectively.
Note the significant differences in the levels of H202 and NO between controls
and preeclamptic subjects (A: P < 0.01 for and B: P < 0.001 for panel D).
102
A
5040g 303
O 20Z
1000
20
40
60
H202 (uM/L)
0
25
50
75
H202 (uM/L)
100
0
6
12
18
H202 (ulWL)
24
B
5040§ 303
O 20-
z
100-
c
10-1
8-
IO
420-
Fig.3. Relationship between levels of H202 and NO in serum at 10-15
gestational weeks (A), at term (37-40 weeks) (B) and in placentas at delivery
(C) from normotensive and preeclamptic pregnant women. There are
significant negative correlations between H202 and NO production among all
studied subjects (n = 40) in serum at 10-15 gestational weeks (o) and 37-40
weeks (•) , and in placentas at delivery (*). Sepearman correlation coefficients
r = -0.58, P = 0.0001, r = -0.60, P < 0.0001 and r = -0.59, P < 0.0001,
respectively.
103
100Z ~
P < 0.001
1
80-|
-1-
^
e g 60.2 o
|
P< 0.001
—
—I—
\
I
o 40H
2 ~ 20H
o-"
£
<P*
*J» X
5$>
#
^
H202 exposure
Fig.4. Effects of hydrogen peroxide on the production of NO by trophoblast
cells (n=5). For 48 h, isolated primary cytotrophoblasts were treated by
increasing concentrations of H202 (25, 50 and 100 uM), unstimulated controls
(0 uM H202). Production of NO was assessed by a colorimetric assay. Note
the significant decrease of NO production after exposure to 50 and 100 uM of
H202.
Because NO production of individual preparations varied, controls
were arbitrarily set at 100% in each experiment. P < 0.001 for 50 uM H202
exposure and P < 0.01 for 100 uM H202 exposure compared to unstimulated
controls. P values were determinate by ANOVA and post hoc analysis (Dunnett
test).
104
Discussion
It is well established that oxidative stress plays an important role in
preeclampsia [34]. Thus, our findings highlight an increase of H202 levels in
maternal circulation early at 10-15 weeks of gestation. Moreover, we noted
that placentas from preeclamptic women exhibit more H202 than normotensive
women. This suggests that oxidative stress seen in preeclampsia affects both
maternal circulation and placenta. Under normal conditions, cells use their
antioxidant defenses, which convert H202 to oxygen and water, thereby
keeping the production of the ROS system under control. Increased H202 can
result from overproduction of ROS and/or decreased antioxidant capacity.
Although the origin of increased levels of H202 in preeclampsia remains
unclear, our findings suggest that preeclampsia may be triggered by an
oxidative stress state.
On the other hand, multiple studies were interested in assessing levels of
NO in preeclampsia. However, these studies were contradictory since some
have shown increased levels of NO in maternal circulation [18,19] and
placenta [20] while others found decreased levels in maternal serum [21] and
placenta [22] or even normal levels [23]. The present work is the first study
that simultaneously determines levels of circulating NO early and at term of
pregnancy and at term in the placenta. Thus, our findings demonstrate that
levels of NO are decreased at 10-15 weeks of gestation and at delivery in
maternal serum, and at term in placenta. With regards to the process of
vasoconstriction which characterizes preeclampsia, the reduction of a
105
powerful vasodilator such as nitric oxide in the first trimester may precede the
generalised hypertension found in preeclamptic women which appears around
the 20 th week of gestation.
Our results also demonstrate a significant inverse correlation between serum
H2O2 levels and NO production among all studied groups in serum at both 1015 gestational weeks and at term, and in placentas at delivery. This suggests
that in maternal circulation as well as in placenta, the increase in H202
coincides with a decline in the production of NO, which may trigger the
vasoconstriction.
The majority of pregnant women take moderate vitamin supplements in
Canada and this appeared not influence the incidence of preeclampsia. On
potential interference of this vitamins supplementation on NO and H202
production,
our analyses showed
that multivitamins taken
at normal
concentrations did not affect production of NO, nor those of H202 in both
normal and preeclamptic pregnancies.
On the other hand, our in vitro experiments showed that H202 induces
decreased production of NO by cytotrophoblasts and confirm our hypothesis
that H202 is an inhibitor of NO synthesis. Moreover, Noris et al. showed
increased levels of arginase II in preeclampsia [35]. Arginases may compete
with eNOS for L-Arginine and metabolise the latter into urea and L-ornithine
resulting in a decreased production of NO. In the presence of reduced levels
of L-arginine, the activation of eNOS leads to overproduction of a large
amount of superoxide anion (O ") via the uncoupling of eNOS on L-Arginine
106
[36]. O2" reacts with NO to form peroxynitrite (ONOO) [37], thereby
decreasing the availability of NO. The hypothesis that levels of NO are
decreased via inactivation of L-arginine is supported by the study of Altun et
al [38], which demonstrated that L-Arginine supplementation in preeclamptic
rats decreased clinical manifestations of preeclampsia. Thus, it is possible that
H202 mediates decreased NO via increasing arginase I and II as their
functions may overlap [15]. Indeed, Thengchaisri et al. [39], showed that
upregulation of arginase by H202 impairs the NO-mediated endothelium
dilatation.
It is important to mention that our in vitro studies on isolated
cytotrophoblasts-exposed H202 were performed using normal placentas and
further studies using preeclamptic placentas are needed to observe a potential
difference in responses.
On the other hand, levels of both H2O2 and NO tend to increase, but are not
statistically significant, from the beginning of pregnancy to its end, in control
and preeclamptic groups. This may be explained by the increase of metabolic
interactions due to the increase of fetal growth and advancement of
pregnancy. Moreover, to our knowledge, there is no study that assessed levels
of H2O2 and NO at 10-15 and 37-40 weeks of pregnancy, allowing
comparison.
In conclusion, our study highlights an increase in H202 levels in maternal
serum early at 10-15 weeks, at term and in placenta of women with
preeclampsia.
The high circulating H202 has been shown to be inversely
correlated with a lowered NO production. These findings provide a rationale
107
for considering these mediators as potential biomarkers in predicting
preeclampsia.
108
5.
Acknowledgments
This study was supported by funding provided by the Fonds de Recherche
en Sante du Quebec (FRSQ), the Fondation de Recherche sur les Maladies
Infantiles (FRMI), the Canadian Institutes of Health Research (CIHR) and the
Centre de Recherche Clinique (CRC)-Etienne-Lebel du CHUS. The authors
wish to thank Christine Brown and Danielle Beaulieu for recruitment of
patients, sample collection and providing clinical data; and Christine Lebel for
laboratory and technical assistance.
109
6. References
[1]
Roberts JM, Lain KY. Recent insights into the pathogenesis of pre-eclampsia.
Placenta. 2002;23:359-72.
[2]
Sibai BM, Diagnosis and management of gestational hypertension and
preeclampsia. Obstet Gynecol. 2003;102:181-92.
[3]
Roberts JM, Cooper DW, Pathogenesis and genetics of pre-eclampsia. Lancet.
2001;357:53-6.
[4]
Kharfi A, Giguere Y, Sapin V, Masse J, Dastugue B, Forest JC, Trophoblastic
remodeling in normal and preeclamptic pregnancies: implication of cytokines.
Clin Biochem. 2003;36:323-31.
[5]
Lyall F, Myatt L. The role of the placenta in pre-eclampsia—A workshop
report. Placenta. 2002;23:S 142-5.
[6]
Granger
JP, Alexander
BT,
Llinas
MT,
Bennett
WA,
Khalil
RA,
Pathophysiology of preeclampsia: linking placental ischemia/hypoxia with
microvascular dysfunction. Microcirculation. 2002;9:147-60.
[7]
Hubel CA, Oxidative stress in the pathogenesis of preeclampsia, Proc Soc Exp
Biol Med. 1999;222:222-35.
[8]
Khalil RA, Granger JP, Vascular mechanisms of increased arterial pressure in
preeclampsia: lessons from animal models. Am J Physiol Regul Integr Comp
Physiol. 2002;283:R29-45.
[9]
Kharfi A, Giguere Y, De Grandpre P, Moutquin JM, Forest JC.
Human
chorionic gonadotropin (hCG) may be a marker of systemic oxidative stress in
110
normotensive
and
preeclamptic
term
pregnancies.
Clin
Biochem.
2005;38(8):717-21.
[10] Kharfi Aris A, Leblanc S, Ouellet A, Moutquin JM. Dual action of H2O2 on
placental hCG secretion: implications for oxidative stress in preeclampsia. Clin
Biochem. 2007; 40: 94-7.
[11] Ariza AC, Bobadilla NA, Halhali A. Endothelin 1 and angiotensin II in
preeclampsia. Rev Invest Clin. 2007;59(l):48-56.
[12] Agarwal A, Gupta S, Sharma RK. Role of oxidative stress in female
reproduction. Reprod Biol Endocrinol. 2005;3:28.
[13] Tsukimori K, Komatsu H, Fukushima K, Kaku T,Nakano H, Wake N.
Inhibition of nitric oxide synthetase at mid-gestation in rats is associated with
increases in arterial pressure, serum tumor necrosis factor-alpha, and placental
apoptosis. Am J Hypertens. 2008;21(4):477-81.
[14] Schiessl B, Mylonas I, Hantschmann P, Kuhn C, Schulze S, Kunze S, Friese K,
Jeschke U. Expression of endothelial NO synthase, inducible NO synthase, and
estrogen receptors alpha and beta in placental tissue of normal, preeclamptic,
and intrauterine growth-restricted pregnancies. J Histochem Cytochem. 2005;
53(12):1441-9.
[15] Cederbaum SD, Yu H, Grody WW, Kern RM, Yoo P, Iyer RK. Arginases I and
II: do their functions overlap? Mol Genet Metab. 2004;81 :S38-44.
[16] Morris SM Jr. Regulation of enzymes of the urea cycle and arginine
metabolism. Annu Rev Nutr. 2002;22:87-105.
Ill
[17] Ishakawa T, Harada T, Koi H, Kubota T, Azuma H, Aso T. Identification of
arginase in human placental villi. Placenta. 2007;28(2-3): 133-8.
[18] Bhatnagar S, Bhattacharjee J, Vaid M, Madan T, Trivedi SS, Sarma PU.
Inducible nitric oxide synthase (iNOS) gene polymorphism in pre-eclampsia: a
pilot study in North India. Aust N Z J Obstet Gynaecol. 2007;47(6):477-82.
[19] Vural P. Nitric oxide/endothelin-1
in preeclampsia. Clin Chim
Acta.
2002;317(l-2):65-70.
[20] Shaamash AH, Elsnosy ED, Makhlouf AM, Zakhari MM, Ibrahim OA, El Dien
HM. Maternal and fetal serum nitric oxide (NO) concentrations in normal
pregnancy, pre-eclampsia and eclampsia. Int J Gynaecol Obstet. 2000;68:20714.
[21] Sandrim VC, Palei AC, Metzger IF, Gomes VA, Cavalli RC, Tanus-Santos JE.
Nitric oxide formation is inversely related to serum levels of antiangiogenic
factors
soluble
fms-like
tyrosine
kinase-1
and
soluble
endogline
in
preeclampsia. Hypertension. 2008;52(2):402-7.
[22] Schonfelder G, Fuhr N, Hadzidiakos D, John M, Hopp H, Paul M.
Preeclampsia is associated with loss of neuronal nitric oxide synthase
expression in vascular smooth muscle cells of the human umbilical cord.
Histopathology. 2004;44:116-28.
[23] Orange SJ, Painter D, Horvath J, Yu B, Trent R, Hennessy A. Placental
endothelial nitric oxide synthase localization and expression in normal human
pregnancy and pre-eclampsia. Clin Exp Pharmacol Physiol. 2003;30(5-6):37681.
112
[24] Mayhew TM, Burton GJ. Methodological problems in placental morphometry:
apologia for the use of stereology based on sound sampling practice. Placenta.
1988;9:565-81.
[25] Huang X, Huang H, Dong M, Yao Q, Wang H. Serum and placental
interleukin-18 are elevated in preeclampsia. J Reprod Immunol. 2005;65(1):7787.
[26] Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss JF, 3rd. Purification,
characterization, and in vitro differentiation of cytotrophoblasts from human
term placentae. Endocrinology. 1986;118:1567-82.
[27] Hallmann A, Klimek J, Masaoka M, Kaminski M, Kedzior J, Majczak A,
Niemczyk
E,
Wozniak
M,
Trzonkowski
P,
Wakabayashi
T.
Partial
characterization of human choriocarcinoma cell line JAR cells in regard to
oxidative stress. Acta Biochim Pol. 2004;51:1023-38.
[28] Halliwell B, Clement MV, Long LH. Hydrogen peroxide in the human body.
FEBS Lett. 2000;486(1):10-13.
[29] Varma SD, Devamanoharan PS. Hydrogen peroxide in human blood. Free
Radic Res Commun. 1991;14:125-31.
[30] Lacy F, O'Connor DT, Schmid-Schonbein GW. Plasma hydrogen peroxide
production in hypertensives and normotensive subjects at genetic risk of
hypertension. J Hypertens. 1998;16:291-303.
[31] Deskur E, Przywarska I, Dylewicz P, Szczesniak L, Rychlewski T, Wilk M,
Wysocki H. Exercise-induced increase in hydrogen peroxide plasma levels is
113
diminished by endurance training after myocardial infarction. Int J Cardiol.
1998;67:219-24.
[32] Baylis C, Vallance P. Measurement of nitrite and nitrate levels in plasma and
urine—what does this measure tell us about the activity of the endogenous nitric
oxide system? Curr Opin Nephrol Hypertens. 1998;7:59-62.
[33] Kleinbongard P, Rassaf T, Dejam A, Kerber S, Kelm M. Griess method for
nitrite measurement of aqueous and protein-containing samples. Methods
Enzymol. 2002;359:158-68.
[34] Myatt L, Cui X. Oxidative stress in the placenta. Histochem cell biol
2004;122:369-382.
[35] Noris M, Todeschini M, Cassis P, Pasta F, Cappellini A, Bonazzola S, Macconi
D, Maucci R, Porrati F, Benigni A, Picciolo C, Remuzzi G.L-Arginine
Depletion in Preeclampsia Orients Nitric Oxide Synthase Toward Oxidant
Species. Hypertension. 2004;43(3):614-22.
[36] Culcasi, M, Lafon-Cazal M, Pietri, S, Bockaert J. Glutamate receptors induce a
burst of superoxide via activation of nitric oxide synthase in arginine-depleted
neurons. J Biol Chem. 1994; 269(17):12589-93.
[37] Beckman JS, Koppenol WH(1996). Nitric oxide, superoxide, and peroxynitrite
: The good, the bad, and ugly. Am J Physiol. 1996; 271(5, Part 1):C 1424-37.
[38] Altun ZS, Uysal S, Guner G, Yilmaz O, Posaci C. Effects of oral L-arginine
supplementation on blood pressure and asymmetric dimethylarginine in stressinduced preeclamptic rats. Cell Biochem Funct. 2008;26(5):648-53.
114
[39] Thengchaisri N, Hein TW, Wang W, Xu X, Li Z, Fossum TW, Kuo L.
Upregulation of arginase by H2O2 impairs endothelium-dependent nitric oxidemediated dilation of coronary arterioles. Arterioscler Thromb Vase Biol.
2006;26(9):2035-42.
3 DISCUSSION
II est d'ores et deja etabli que le stress oxydatif est implique dans les pathologies
de grossesse humaines comme la preeclampsie (MYATT et CUI, 2004). Comme
nous avions constate dans des etudes precedentes une concentration serique plus
elevee d't^C^ et d'hCG chez des femmes atteintes de preeclampsie, par rapport a
des femmes normotensives (KHARFI et al, 2005), nous voulions verifier ses effets
sur le placenta, plus precisement sur les cytotrophoblastes in vitro.
D'abord, comme nous l'avions souligne dans nos resultats in vivo, une correlation
positive de l'augmentation des niveaux circulants d't^C^ et d'hCG presente chez
les femmes preeclamptiques, nos resultats in vitro sur la fonction placentaire
revelent des interactions entre les cellules trophoblastiques et le stress oxydatif
represente par PH2O2. Nos observations in vivo et in vitro suggerent que PH2O2
entraine la synthese d'hCG. En effet, l'exposition a des concentrations croissantes
d't^C^ durant 24 et 48 heures resultent en une double action du peroxyde
d'hydrogene. De plus faibles concentrations (1-50 uM) entrainent une augmentation
de la secretion d'hCG, avec une production maximale a 5 uM, et plus moderee
jusqu'a 50 uM. Ceci suggere done que le peroxyde d'hydrogene n'agit pas
seulement comme un mediateur cytotoxique, mais aussi comme une molecule de
signalisation pouvant activer la production d'autres molecules. Comme les
mecanismes d'activation par PH2O2 sont encore mal connus, il est possible que la
secretion de 1'hCG soit la consequence de l'augmentation de la differentiation des
cytotrophoblastes en syncytiotrophoblastes, ces derniers constituent la veritable
glande endocrine du placenta.
116
Plusieurs agents produisant un stress oxydatif intracellulaire, incluant le peroxyde
d'hydrogene et les hormones stero'idiennes, induisent la production de facteurs
antioxydants (MCALEER et TUAN, 2001). Cette action peut etre essentielle aussi
bien aux cytotrophoblastes qu'aux syncytiotrophoblastes exposes au stress oxydatif.
Des changements dans la localisation de facteurs antioxydants sont apparents, et
ce, meme apres une exposition a un leger stress oxydatif (MCALEER et TUAN,
2001). Generalement, pour contrer ce stress entraine par PH2O2, de nombreux
mecanismes de defense existent. Par exemple, les reactions menant a la formation
d'l-bCh sont attenuees par la sequestration par des proteines d'ions metalliques,
dont la ferritine, la transferrine et Theme, qui pourraient agir comme catalyseurs
(NAPPI et VASS.,2000).
D'autres facteurs de defense comme les superoxyde dismutases, les catalases,
peroxydases et la thioredoxine sont des enzymes qui permettent de combattre le
stress oxydatif en reagissant avec PH2O2 pour le transformer en eau (DROGE,
2002, ARNER et HOLMREN, 2000). D'autres molecules comme les vitamines C,
E et A, des hormones comme la melatonine et des cofacteurs comme le coenzyme
Q peuvent aussi servir d'antioxydants (REITER et a/., 1995). II est done probable
que 1'hCG puisse avoir un certain role antioxydant pour contrer un stress oxydatif
permettant la survie des cellules placentaires.
D'un autre cote, la chute de la secretion de 1'hCG apres un traitement de plus de
50 uM d'H202 peut etre expliquee par les effets cytotoxiques du peroxyde
d'hydrogene sur les cytotrophoblastes. Comme PH2O2 a la capacite de detruire des
microorganismes, il est aussi habilite a endommager les cytotrophoblastes. Les
117
dommages causes par PH2O2 sont toutefois moderes, en comparaison avec des
especes plus actives comme le radical hydroxyle qui peut reagir avec une grande
variete de substrats organiques, causant la peroxydation des lipides, Pinactivation
de proteines et des dommages a l'ADN (LIU et al, 1999, ABE et al., 1995). Le
radical hydroxyle peut etre forme quand PH2O2 est expose aux rayons ultraviolets
ou lorsqu'il entre en contact avec certains ions de metaux comme le fer. II est aussi
largement accepte que PH2O2 agit comme molecules cytotoxique in vivo a une
concentration superieure a 50 ^M.
Nos resultats aussi ont demontre que les cytotrophoblastes exposes a FH2O2
expriment plus de TNF-a, tant au niveau de la proteine que de l'ARNm, confirmant
l'activation directe du TNF-a par PH2O2 et fournissant un modele de Pinduction de
Pinflammation par le stress oxydatif, appele stress inflammatoire. Le TNF-a et
PH2O2 partagent une voie de signalisation qui implique l'activation de N F - K B
(facteur nucleaire KB), et ce, meme si cela se produit par des mecanismes differents
(TAKADA et al, 2003). II a ete demontre que la phosphorylation de la p65 a la
serine 529 est requise pour induire Pactivite transcriptionnelle du TNF-a (WANG
et BALDWIN, 1998), alors que PH 2 0 2 induit l'activation de N F - K B par la
phosphorylation de la tyrosine via Syk de bcBa (TAKADA et al, 2003). II est done
possible que, comme l'activation de N F - K B peut mener a la transcription du TNF-a
( SHAKHOV et al, 1990, COLLART et al,
1990), PH 2 0 2 puisse induire la
transcription de TNF-a en activant N F - K B . Cette possibility est renforcee par
d'autres etudes demontrant que PH 2 0 2 active N F - K B (KRETZ-REMY et al, 1996,
SCHRECK et al, 1991, MEYER et al, 1993).
118
Cette etude a aussi permis d'entrevoir une reduction de la detection du TNF-a
soluble dans le surnageant quand une forte secretion du TNFR2 se produit. Comme
nous l'avons constate, une forte synthese de TNFR2 membranaire et de sa forme
soluble augmenterait la liaison du TNF-a a ce recepteur et entraverait sa detection
complete. Ceci a done ete confirme par la neutralisation du recepteur par un
anticorps, rendant le TNF-a davantage detectable. En consequence, 1'augmentation
de l'expression de ce recepteur pourrait limiter les effets du TNF-a, d'abord sur la
cellule elle-meme (effet autocrine), quand cette cytokine se lie au recepteur
membranaire, puis en liant le recepteur soluble, limitant ses effets sur les cellules
environnantes (effet paracrine). L'F^Ch n'induit done pas seulement l'activation du
TNF-a, mais aussi celle de son recepteur TNFR2. Cela concorde avec nos travaux
anterieurs portant sur l'expression du TNF-a et de ses recepteurs in situ dans les
cytotrophoblastes, demontrant que l'expression du TNFR2 parait etre adaptative
avec celle du TNF-a et suit le meme profil (KHARFI et ah, 2006). Les
cytotrophoblastes exposes a FH2O2 produisent done simultanement du TNF-a et le
TNFR2 et relachent leur forme soluble dans le surnageant, et ce dernier peut Her le
TNF-a, prevenant sa detection.
D'un autre cote, nos resultats ont demontre que le TNFR1 ne parait pas etre
influence par la variation des concentrations d'FfcC^, les cytotrophoblastes
n'exprimant pas plus ou moins de recepteur selon diverses concentrations. Ceci
suggererait que le TNFR1 n'est pas influence par la variation des metabolites
oxydants environnants. De plus, nous avions precedemment demontre que
l'expression du TNFR1 etait constitutive et presente dans toutes les cellules
119
placentaires, independamment de l'expression du TNF-a (KHARFI et al, 2006).
Inversement au TNFR2, comme le TNFR1 apparait etre plus stable contre le stress
oxydatif, cela suggere qu'ils ont un role different chez les cytotrophoblastes. En
dehors de ces cellules, le TNFR1 est en effet exprime de maniere plutot constitutive
sur un large eventail de cellules et est connu pour medier les effets les plus connus
du TNF-a. (VERCAMMEN et al, 1995, WAJANT et al, 2003). L'expression du
TNFR2 semble etre regulee et quelques reponses cellulaires peuvent etre attributes
exclusivement par la signalisation via ce recepteur, comme la proliferation des
thymocytes et des cellules T matures, des cellules NK et B, ainsi que la secretion de
GM-CSF par les lymphocytes T (VANDENABEELE et al, 1992, GRELL et al,
1998). Recemment, il a ete demontre que le TNFR2
est aussi implique dans
l'expansion et l'activation des cellules T regulatrices (SCUMPIA et al, 2006).
De nombreuses etudes ont aussi portees sur les niveaux du NO dans la
preeclampsie. Toutefois, ces etudes sont souvent contradictoires puisque quelques
unes ont constate une augmentation du NO dans la circulation maternelle
(BHATNAGAR et al, 2007, VURAL, 2002), et dans le placenta (SHAAMASH et
al., 2000), alors que d'autres ont constate une diminution dans le serum maternel
(SANDRIM et al, 2008) et le placenta (SCHONFELDER et al, 2004), ou encore
des niveaux normaux (ORANGE et al, 2003). Nous avons done ete les premiers a
determiner simultanement les niveaux circulants de NO en debut et en fin de
grossesse et placentaires en fin de grossesse. Nous avons done demontre que les
niveaux de NO sont diminues entre 10 et 15 semaines de grossesse dans le serum, a
terme dans le serum, et a terme dans le placenta des femmes preeclamptiques. Tout
120
en tenant compte de l'etat de vasoconstriction qui caracterise la preeclampsie, la
reduction d'un vasodilatateur important comme le NO dans le premier trimestre
peut etre un precedent dans l'hypertension generalised presente chez les femmes
preeclamptiques diagnostiquees apres la 20 e semaine de grossesse.
Nos resultats demontrent aussi une correlation inverse significative entre les
niveaux seriques d ' L L ^ et de NO, et ce, dans toutes les conditions etudiees. Ceci
suggere done que dans la circulation maternelle, aussi bien que dans le placenta,
l'augmentation de PH2O2 coincide avec le declin de la production de NO, qui
pourrait entrainer la vasoconstriction.
La majorite des femmes enceintes prennent moderement des supplements de
vitamines au Canada, et ceci ne semble pas avoir d'influence sur 1'incidence de
preeclampsie. L'interference de cette supplementation sur le NO et sur PH2O2,
selon nos analyses, ne semble pas etre importante et n'affecte pas la production de
NO, pas plus que celle de TH202, tant chez les femmes normales que
preeclamptiques (ARIS et al, 2009).
D'un autre cote, nos experiences in vitro demontrent que PH2O2 diminue la
production de NO par les cytotrophoblastes et confirment notre hypothese que
PH2O2 agit comme inhibiteur de la synthese de NO. De plus, Noris et al ont
constate une augmentation des niveaux d'arginase II dans la preeclampsie (NORIS
et al, 2004). Les arginases peuvent agir en competition avec eNOS pour la Larginine et la metaboliser en uree et en L-ornithine, resultant en une diminution de
la production de NO. En la presence diminuee de L-arginine, l'activation de la
eNOS mene a une surproduction
de l'anion superoxyde (O2) via la non liaison
121
entre la eNOS et la L-arginine (CULCASI et al, 1994). L'anion superoxyde reagit
aussi avec le NO pour former le peroxynitrite (ONOO) (BECKMAN et
KOPPENOL, 1996), diminuant la disponibilite du NO. L'hypothese que les niveaux
de NO sont diminues par la diminution de la biodisponibilite de la L-arginase est
supportee par une etude de Altun et al qui demontre qu'une supplementation en Larginine chez des rats preeclamptiques diminue les manifestations cliniques de la
preeclampsie (ALTUN et al, 2008). II est aussi possible que PH2O2 entraine une
diminution du NO via 1'augmentation
de l'activite des arginases I et II
(CEDERBAUM et al, 2004). II a aussi ete demontre que l'augmentation de la
regulation des arginases par PH202 interfere avec la vasodilatation de l'endothelium
entralnee par le NO (THENGCHAISRJ et al.,2006). De plus, nous avons constate
une augmentation de l'activite des arginases dans les milieux de culture de
cytotrophoblastes stimules par PH2O2 (resultats non publies), proposant que la
diminution de NO pourrait bel et bien etre due a la diminution de l'arginine
disponible plutot qu'a une apoptose des cytotrophoblastes. Comme nos experiences
in vitro ont ete effectuees sur des cytotrophoblastes provenant de placentas
normaux, une difference pourrait etre observee si l'on repetait les traitements avec
PH2O2 sur des cytotrophoblastes provenant de patientes preeclamptiques.
Les niveaux de NO et d ' P L ^ semblent aussi tous deux augmenter durant la
grossesse, mais de maniere non significative, tant chez les femmes preeclamptiques
que chez les femmes normales. Ceci peut etre explique par l'augmentation des
interactions metaboliques entrainees par la croissance foetale et l'avancement de la
grossesse. De plus, selon nos connaissances, aucune autre etude n'a mesure les
122
niveaux d'HiCh et de NO en debut et en fin de grossesse, nous limitant dans nos
comparaisons.
123
4 CONCLUSION ET PERSPECTIVES
Pour conclure, les differents travaux effectues nous ont permis de confirmer le
role important qu'occupe le stress oxydatif, et plus precisement PH2O2 dans la
preeclampsie. D'abord, nos resultats nous ont permis de confirmer nos observations
anterieures indiquant une correlation in vivo entre le stress oxydatif et la fonction
placentaire. I/H2O2 n'agit done pas seulement comme un mediateur cytotoxique,
mais aussi comme une molecule capable d'induire la secretion de 1'hCG par les
cytotrophoblastes, et ce, selon sa concentration. Nos resultats suggerent aussi un
role possible de 1'hCG comme facteur antioxydant produit par le placenta pour
contrer un stress oxydatif leger, ouvrant la voie a d'autres etudes dans ce sens.
Le stress oxydatif a aussi eu des effets sur la secretion du TNF-a et du recepteur
TNFR2 par les cytotrophoblastes, ayant comme consequence possible de reduire les
effets de cette cytokine, autant autocrines que paracrines. Nos resultats ont aussi
permis d'expliquer pourquoi le TNF-a est parfois difficile a detecter dans des
milieux biologiques. De plus, l'usage du TNFR2 soluble recombinant semble etre
envisageable pour reduire les effets inflammatoires du stress oxydatif. D'autres
etudes pourraient etre entreprises pour explorer l'effet protecteur potentiel du
TNFR2 chez l'humain ou l'animal, tant pour des maladies de grossesse
caracterisees par un stress inflammation comme la preeclampsie que pour d'autres
maladies inflammatoires.
De plus, nos travaux ont permis de constater une augmentation du peroxyde
d'hydrogene, tant entre la 10e et la 15e semaine de grossesse qu'a terme, chez les
femmes preeclamptiques par rapport aux femmes normales. Cette augmentation a
124
ete inversement correlee avec les niveaux de NO, qui se trouvent diminues avec
1'augmentation d'tfeC^, ce qui rend ces deux mediateurs comme etant de possibles
biomarqueurs de prediction la preeclampsie. D'autres travaux sont aussi en cours
pour
determiner
l'effet
du
peroxyde
d'hydrogene
sur
les
arginases
cytotrophoblastiques in vitro.
125
5 REMERCIEMENTS
Je tiens tout d'abord a remercier mon directeur de maitrise, Dr Aziz Aris, qui m'a
accueilli dans son laboratoire. En effet, c'est grace a ses conseils, ses connaissances
scientifiques, sa disponibilite et sa patience que ce travail a pu etre effectue. Merci
infiniment Dr Aris.
Merci aussi a tous ceux que j ' a i cotoye de pres ou de loin durant mon sejour, tant
au gens du laboratoire meme, ou aux membres du departement de Genetique, pour
leur aide, que ce soit au point de vue de mes nombreuses questions techniques ou
autre.
J'aimerais
aussi remercier
les infirmieres
du departement
d'Obstetrique-
Gynecologie du CHUS pour leur disponibilite et leur gentillesse, sans lesquelles
mon recrutement aurait ete beaucoup plus ardu.
Finalement, merci a mes parents, Philippe et Madeleine, mes freres et sceurs et
amis, pour leur support constant, leurs encouragements dans les moments les plus
difficiles comme les plus faciles.
126
6 REFERENCES
Abe T, Konishi T, Hirano T, Kasai H, Shimizu K, Kashimura M, Higashi K.
Possible correlation between DNA damage induced by hydrogen peroxide and
translocation of heat shock 70 protein into the nucleus. Biochem Biophys Res
Commun. 1995 Jan 17;206(2):548-55.
Aderka D, Engelmann H, Maor Y, Brakebusch C, Wallach D. Stabilization of the
bioactivity of tumor necrosis factor by its soluble receptors. J Exp Med. 1992
Febl;175(2):323-9.
Agarwal A, Saleh RA, Bedaiwy MA. Role of reactive oxygen species in the
pathophysiology of human reproduction. Fertil Steril. 2003 Apr;79(4):829-43.
Allaire AD, Ballenger KA, Wells SR, McMahon MJ, Lessey BA. Placental
apoptosis in preeclampsia. Obstet Gynecol. 2000 Aug;96(2):271-6.
Al-Mulhim AA, Abu-Heija A, Al-Jamma F, El-Harith eA. Pre-eclampsia: Maternal
risk factors and perinatal outcome. Fetal Diagn Ther. 2003 Jul-Aug;18(4):27580.
Alsat E, Tarrade A, Merviel P, Evain-Brion D. Le cytotrophoblaste humain, un
casse-tete pour le biologiste. M/S. Novembre 1999;11(15):1236-43.
Aris A, Benali S, Ouellet A, Moutquin JM, Leblanc S. Potential biomarkers of
preeclampsia : inverse correlation between oxygen peroxide and nitric oxide
early in maternal circulation and at term in placenta of women with
preecclampsia. Placenta. 2009 Apr;30(4):342-7.
Arner ES, Holmgren A. Physiological functions of thioredoxin and thioredoxin
reductase. Eur J Biochem. 2000 Oct;267(20):6102-9.
127
Askie LM, Duley L, Henderson-Smart DJ, Stewart LA, PARIS Collaborative
Group. Antiplatelet agents for prevention of pre-eclampsia: A meta-analysis of
individual patient data. Lancet. 2007 May 26;369(9575):1791-8.
Baeten JM, Bukusi EA, Lambe M. Pregnancy complications and outcomes among
overweight and obese nulliparous women. Am J Public Health. 2001
Mar;91(3):436-40.
Barros JS, Baptista MG, Bairos VA. Human chorionic gonadotropin in human
placentas from normal and preeclamptic pregnancies. Arch Gynecol Obstet.
2002Apr;266(2):67-71.
Barton JR, Sibai BM. Prediction and prevention of recurrent preeclampsia. Obstet
Gynecol. 2008 Aug;l 12(2 Pt l):359-72.
Baumann MU, Deborde S, Illsley NP. Placental glucose transfer and fetal growth.
Endocrine. 2002 Oct; 19(1): 13-22.
Beckman JS, Beckman TW, Chen J, Marshall PA, Freeman BA. Apparent hydroxyl
radical production by peroxynitrite: Implications for endothelial injury from
nitric oxide and superoxide. Proc Natl Acad Sci U S A . 1990 Feb;87(4): 1620-4.
Beckman JS, Koppenol WH. Nitric oxide, superoxide, and peroxynitrite: The good,
the bad, and ugly. Am J Physiol. 1996 Nov;271(5 Pt l):C1424-37.
Benirschke, K, Kaufmann, P. Pathology of the human placenta. Fourth edition ed.
New York: Springer-Verlag; 2000. 947 p.
Benyo DF, Smarason A, Redman CW, Sims C, Conrad KP. Expression of
inflammatory cytokines in placentas from women with preeclampsia. J Clin
Endocrinol Metab. 2001 Jun;86(6):2505-12.
128
Beutler B, Cerami A. The biology of cachectin/TNF--a primary mediator of the host
response. Annu Rev Immunol. 1989;7:625-55.
Beutler B, Cerami A. The history, properties, and biological effects of cachectin.
Biochemistry. 1988 Oct 4;27(20):7575-82.
Beyaert R, Fiers W. Molecular mechanisms of tumor necrosis factor-induced
cytotoxicity, what we do understand and what we do not. FEBS Lett. 1994 Feb
28;340(l-2):9-16.
Bhatnagar S, Bhattacharjee J, Vaid M, Madan T, Trivedi SS, Sarma PU. Inducible
nitric oxide synthase (iNOS) gene polymorphism in pre-eclampsia: A pilot
study in north india. Aust N Z J Obstet Gynaecol. 2007 Dec;47(6):477-82.
Bischof P, Irminger-Finger I. The human cytotrophoblastic cell, a mononuclear
chameleon. Int J Biochem Cell Biol. 2005 Jan;37(l):l-16.
Brigelius-Flohe R, Aumann KD, Blocker H, Gross G, Kiess M, Kloppel KD,
Maiorino M, Roveri A, Schuckelt R, Usani F. Phospholipid-hydroperoxide
glutathione peroxidase, genomic DNA, cDNA, and deduced amino acid
sequence. J Biol Chem. 1994 Mar ll;269(10):7342-8.
Burton GJ, Jauniaux E, Watson AL. Maternal arterial connections to the placental
intervillous space during the first trimester of human pregnancy: The boyd
collection revisited. Am J Obstet Gynecol. 1999 Sep;l81 (3):718-24.
Burton GW, Joyce A, Ingold KU. First proof that vitamin E is major lipid-soluble,
chain-breaking antioxidant in human blood plasma. Lancet. 1982 Aug
7;2(8293):327.
129
Catalano PM. Management of obesity in pregnancy. Obstet Gynecol. 2007
Feb;109(2Pt l):419-33.
Cederbaum SD, Yu H, Grody WW, Kern RM, Yoo P, Iyer RK. Arginases I and II:
Do their functions overlap? Mol Genet Metab. 2004 Apr;81 Suppl l:S38-44.
Chesley LC. Eclampsia: The remote prognosis. Semin Perinatol. 1978 Jan;2(l):99111.
Chesley LC. Vascular reactivity in normal and toxemic pregnancy. Clin Obstet
Gynecol. 1966 Dec;9(4):871-81.
Collart MA, Baeuerle P, Vassalli P. Regulation of tumor necrosis factor alpha
transcription in macrophages: Involvement of four kappa B-like motifs and of
constitutive and inducible forms of NF-kappa B. Mol Cell Biol. 1990
Apr; 10(4): 1498-506.
Conde-Agudelo A, Althabe F, Belizan JM, Kafury-Goeta AC. Cigarette smoking
during pregnancy and risk of preeclampsia: A systematic review. Am J Obstet
Gynecol. 1999 Oct;181(4):1026-35.
Conner EM, Grisham MB. Inflammation, free radicals, and antioxidants. Nutrition.
1996 Apr; 12(4):274-7.
Conrad KP, Miles TM, Benyo DF. Circulating levels of immunoreactive cytokines
in women with preeclampsia. Am J Reprod Immunol. 1998 Aug;40(2): 102-11.
Culcasi M, Lafon-Cazal M, Pietri S, Bockaert J. Glutamate receptors induce a burst
of superoxide via activation of nitric oxide synthase in arginine-depleted
neurons. J Biol Chem. 1994 Apr 29;269(17):12589-93.
130
Dantzer V, Leach L, Leiser R. Angiogenesis and placental vasculature-^ workshop
report. Placenta. 2000 Mar-Apr;21 Suppl A:S69-70.
Droge W. Free radicals in the physiological control of cell function. Physiol Rev.
2002 Jan;82(l):47-95.
Evain-Brion D, Malassine A. Human placenta as an endocrine organ. Growth Horm
IGF Res. 2003 Aug;13 Suppl A:S34-7.
Fontaine V, Mohand-Said S, Hanoteau N, Fuchs C, Pfizenmaier K, Eisel U.
Neurodegenerative and neuroprotective effects of tumor necrosis factor (TNF)
in retinal ischemia: Opposite roles of TNF receptor 1 and TNF receptor 2. J
Neurosci. 2002 Apr 1;22(7):RC216.
Grell M, Becke FM, Wajant H, Mannel DN, Scheurich P. TNF receptor type 2
mediates thymocyte proliferation independently of TNF receptor type 1. Eur J
Immunol. 1998 Jan;28(l):257-63.
Gude NM, Roberts CT, Kalionis B, King RG. Growth and function of the normal
human placenta. Thromb Res. 2004; 114(5-6):397-407.
Halliwell B, Gutteridge JM, Cross CE. Free radicals, antioxidants, and human
disease: Where are we now? J Lab Clin Med. 1992 Jun;l 19(6):598-620.
Hiby SE, Walker JJ, O'shaughnessy KM, Redman CW, Carrington M, Trowsdale J,
Moffett A. Combinations of maternal KIR and fetal HLA-C genes influence the
risk of preeclampsia and reproductive success. J Exp Med. 2004 Oct
18;200(8):957-65.
131
Higuchi M, Aggarwal BB. Differential roles of two types of the TNF receptor in
TNF-induced cytotoxicity, DNA fragmentation, and differentiation. J Immunol.
1994 Apr 15;152(8):4017-25.
Higuchi M, Aggarwal BB. TNF induces internalization of the p60 receptor and
shedding of the p80 receptor. J Immunol. 1994 Apr l;152(7):3550-8.
Hsu CD, Lucas RB, Johnson TR, Hong SF, Chan DW. Elevated urine
thrombomodulin/creatinine ratio in severely preeclamptic pregnancies. Am J
Obstet Gynecol. 1994 Sep;171(3):854-6.
Hubel CA, Kozlov AV, Kagan VE, Evans RW, Davidge ST, McLaughlin MK,
Roberts JM. Decreased transferrin and increased transferrin saturation in sera of
women with preeclampsia: Implications for oxidative stress. Am J Obstet
Gynecol. 1996 Sep;175(3 Pt l):692-700.
Hung TH, Skepper JN, Charnock-Jones DS, Burton GJ. Hypoxia-reoxygenation: A
potent inducer of apoptotic changes in the human placenta and possible
etiological factor in preeclampsia. Circ Res. 2002 Jun 28;90(12):1274-81.
Hunt JS, Chen HL, Miller L. Tumor necrosis factors: Pivotal components of
pregnancy? Biol Reprod. 1996 Mar;54(3):554-62.
Idriss HT, Naismith JH. TNF alpha and the TNF receptor superfamily: Structurefunction relationship(s). Microsc Res Tech. 2000 Aug 1;50(3): 184-95.
Ishikawa T, Harada T, Koi H, Kubota T, Azuma H, Aso T. Identification of
arginase in human placental villi. Placenta. 2007 Feb-Mar;28(2-3): 133-8.
132
Jauniaux E, Watson AL, Hempstock J, Bao YP, Skepper JN, Burton GJ. Onset of
maternal arterial blood flow and placental oxidative stress. A possible factor in
human early pregnancy failure. Am J Pathol. 2000 Dec;157(6):2111-22.
Keith M, Norwich KH, Wong W, Jeejeebhoy KN. The tissue distribution of tumor
necrosis factor-alpha in rats: A compartmental model. Metabolism. 2000
Oct;49(10):1309-17.
Kharfi A, Bureau M, Giguere Y, Moutquin JM, Forest JC. Dissociation between
increased apoptosis and expression of the tumor necrosis factor-alpha system in
term placental villi with preeclampsia. Clin Biochem. 2006 Jun;39(6):646-51.
Kharfi A, Giguere Y, De Grandpre P, Moutquin JM, Forest JC. Human chorionic
gonadotropin (hCG) may be a marker of systemic oxidative stress in
normotensive and preeclamptic term pregnancies. Clin Biochem. 2005
Aug;38(8):717-21.
King A, Burrows TD, Hiby SE, Bowen JM, Joseph S, Verma S, Lim PB, Gardner
L, Le Bouteiller P, Ziegler A, Uchanska-Ziegler B, Loke YW. Surface
expression of HLA-C antigen by human extravillous trophoblast. Placenta. 2000
May;21(4):376-87.
Knight M, Redman CW, Linton EA, Sargent IL. Shedding of syncytiotrophoblast
microvilli into the maternal circulation in pre-eclamptic pregnancies. Br J
Obstet Gynaecol. 1998 Jun;105(6):632-40.
Kretz-Remy C, Mehlen P, Mirault ME, Arrigo AP. Inhibition of I kappa B-alpha
phosphorylation and degradation and subsequent NF-kappa B activation by
glutathione peroxidase overexpression. J Cell Biol. 1996 Jun;133(5):1083-93.
133
Li Y, Matsuzaki N, Masuhiro K, Kameda T, Taniguchi T, Saji F, Yone K,
Tanizawa O. Trophoblast-derived tumor necrosis factor-alpha induces release of
human chorionic gonadotropin using interleukin-6 (IL-6) and IL-6-receptordependent system in the normal human trophoblasts. J Clin Endocrinol Metab.
1992 Jan;74(l): 184-91.
Liu D, Wen J, Liu J, Li L. The roles of free radicals in amyotrophic lateral sclerosis:
Reactive oxygen species and elevated oxidation of protein, DNA, and
membrane phospholipids. FASEB J. 1999 Dec; 13(15):2318-28.
Lotz M, Setareh M, von Kempis J, Schwarz H. The nerve growth factor/tumor
necrosis factor receptor family. J Leukoc Biol. 1996 Jul;60(l):l-7.
Madazli R, Benian A, Aydin S, Uzun H, Tolun N. The plasma and placental levels
of malondialdehyde, glutathione and superoxide dismutase in pre-eclampsia. J
Obstet Gynaecol. 2002 Sep;22(5):477-80.
Magee LA, von Dadelszen P, Bohun CM, Rey E, El-Zibdeh M, Stalker S, Ross S,
Hewson S, Logan AG, Ohlsson A, Naeem T, Thornton JG, Abdalla M,
Walkinshaw
S, Brown
M, Davis
G, Hannah
ME.
Serious
perinatal
complications of non-proteinuric hypertension: An international, multicentre,
retrospective cohort study. J Obstet Gynaecol Can. 2003 May;25(5):372-82.
Marin JJ, Macias RI, Serrano MA. The hepatobiliary-like excretory function of the
placenta. A review. Placenta. 2003 May;24(5):431-8.
McAleer MF, Tuan RS. Metallothionein protects against severe oxidative stressinduced apoptosis of human trophoblastic cells. In Vitr Mol Toxicol. 2001
Fall; 14(3):219-31.
134
McCartney CH. The acute hypertensive disorders of pregnancy, classified by renal
histology. Gynaecologia. 1969; 167(4):214-20.
McWhirter SM, Fitzgerald KA, Rosains J, Rowe DC, Golenbock DT, Maniatis T.
IFN-regulatory factor 3-dependent gene expression is defective in Tbkldeficient mouse embryonic fibroblasts. Proc Natl Acad Sci U S A . 2004 Jan
6;101(l):233-8.
Mello Filho AC, Hoffmann ME, Meneghini R. Cell killing and DNA damage by
hydrogen peroxide are mediated by intracellular iron. Biochem J. 1984 Feb
15;218(l):273-5.
Meyer M, Schreck R, Baeuerle PA. H202 and antioxidants have opposite effects on
activation of NF-kappa B and AP-1 in intact cells: AP-1 as secondary
antioxidant-responsive factor. EMBO J. 1993 May;12(5):2005-15.
Mikhail MS, Anyaegbunam A, Garfinkel D, Palan PR, Basu J, Romney SL.
Preeclampsia and antioxidant nutrients: Decreased plasma levels of reduced
ascorbic acid, alpha-tocopherol, and beta-carotene in women with preeclampsia.
Am J Obstet Gynecol. 1994 Jul; 171(1): 150-7.
Miller AF. Superoxide dismutases: Active sites that save, but a protein that kills.
Curr Opin Chem Biol. 2004 Apr;8(2): 162-8.
Moffett A, Loke YW. The immunological paradox of pregnancy: A reappraisal.
Placenta. 2004 Jan;25(l):l-8.
Morris SM,Jr. Regulation of enzymes of the urea cycle and arginine metabolism.
Annu Rev Nutr. 2002;22:87-105.
135
Myatt L, Cui X. Oxidative stress in the placenta. Histochem Cell Biol. 2004
Oct;122(4):369-82.
Nappi AJ, Vass E. Iron, metalloenzymes and cytotoxic reactions. Cell Mol Biol
(Noisy-le-grand). 2000 May;46(3):637-47.
Noris M, Todeschini M, Cassis P, Pasta F, Cappellini A, Bonazzola S, Macconi D,
Maucci R, Porrati F, Benigni A, Picciolo C, Remuzzi G. L-arginine depletion in
preeclampsia
orients
nitric
oxide
synthase
toward
oxidant
species.
Hypertension. 2004 Mar;43(3):614-22.
Nose K. Role of reactive oxygen species in the regulation of physiological
functions. Biol Pharm Bull. 2000 Aug;23(8):897-903.
Orange SJ, Painter D, Horvath J, Yu B, Trent R, Hennessy A. Placental endothelial
nitric oxide synthase localization and expression in normal human pregnancy
and pre-eclampsia. Clin Exp Pharmacol Physiol. 2003 May-Jun;30(5-6):376-81.
Page IH. A method for producing persistent hypertension by cellophane. Science.
1939 Mar 24;89(2308):273-4.
Pasanen M. The expression and regulation of drug metabolism in human placenta.
Adv Drug Deliv Rev. 1999 Jun 14;38(l):81-97.
Perler L, Pfister H, Schweizer M, Peterhans E, Jungi TW. A bioassay for interferon
type I based on inhibition of sendai virus growth. J Immunol Methods. 1999 Jan
l;222(l-2):189-96.
Pierce JD, Cackler AB, Arnett MG. Why should you care about free radicals? RN.
2004 Jan;67(l):38,42; quiz 43.
136
Pijnenborg R, Bland JM, Robertson WB, Brosens I. Uteroplacental arterial changes
related to interstitial trophoblast migration in early human pregnancy. Placenta.
1983 0ct-Dec;4(4):397-413.
Pijnenborg R, Bland JM, Robertson WB, Dixon G, Brosens I. The pattern of
interstitial trophoblastic invasion of the myometrium in early human pregnancy.
Placenta. 1981 Oct-Dec;2(4):303-16.
Poston L, Briley AL, Seed PT, Kelly FJ, Shennan AH, Vitamins in Pre-eclampsia
(VIP) Trial Consortium. Vitamin C and vitamin E in pregnant women at risk for
pre-eclampsia (VIP trial): Randomised placebo-controlled trial. Lancet. 2006
Apr 8;367(9517): 1145-54.
Rabineau, D, Dupont, J, Plateaux, P. Embryologie humaine. [Internet]. France:
SFRS
Service
du
Film
de
Recherche
Scientifique;
2003.
http://cvirtuel.cochin.univ-paris5.fr/Embryologie/AnimEntre/AnimEntrel.html
Ramsey, EM, Donner, MW. Placental Vasculature and Circulation. Anatomy,
Physiology, Radiology, Clinical Aspects. Atlas and Textbook. Philadelphie:
W.B.Saunders Company; 1980. 101 p.
Reddy SA, Chaturvedi MM, Darnay BG, Chan H, Higuchi M, Aggarwal BB.
Reconstitution of nuclear factor kappa B activation induced by tumor necrosis
factor requires membrane-associated components, comparison with pathway
activated by ceramide. J Biol Chem. 1994 Oct 14;269(41):25369-72.
Reiter RJ, Melchiorri D, Sewerynek E, Poeggeler B, Barlow-Walden L, Chuang J,
Ortiz GG, Acuna-Castroviejo D. A review of the evidence supporting
melatonin's role as an antioxidant. J Pineal Res. 1995 Jan; 18(1): 1-11.
137
Report of the national high blood pressure education program, working group on
high blood pressure in pregnancy. Am J Obstet Gynecol. 2000; 183 :S 1-22.
Riley JC, Behrman HR. Oxygen radicals and reactive oxygen species in
reproduction. Proc Soc Exp Biol Med. 1991 Dec; 198(3):781-91.
Roberts JM, Gammill HS. Preeclampsia: Recent insights. Hypertension. 2005
Dec;46(6):1243-9.
Roberts JM, Lain KY. Recent insights into the pathogenesis of pre-eclampsia.
Placenta. 2002 May;23(5):359-72.
Roberts
JM,
Redman
CW.
Pre-eclampsia:
More
than
pregnancy-induced
hypertension. Lancet. 1993 Jun 5;341(8858):1447-51.
Sandrim VC, Palei AC, Metzger IF, Gomes VA, Cavalli RC, Tanus-Santos JE.
Nitric oxide formation is inversely related to serum levels of antiangiogenic
factors
soluble
fms-like
tyrosine
kinase-1
and
soluble
endogline
in
preeclampsia. Hypertension. 2008 Aug;52(2):402-7.
Schiessl B, Mylonas I, Hantschmann P, Kuhn C, Schulze S, Kunze S, Friese K,
Jeschke U. Expression of endothelial NO synthase, inducible NO synthase, and
estrogen receptors alpha and beta in placental tissue of normal, preeclamptic,
and intrauterine growth-restricted pregnancies. J Histochem Cytochem. 2005
Dec;53(12):1441-9.
Schonfelder G, Fuhr N, Hadzidiakos D, John M, Hopp H, Paul M. Preeclampsia is
associated with loss of neuronal nitric oxide synthase expression in vascular
smooth muscle cells of the human umbilical cord. Histopathology. 2004
Feb;44(2): 116-28.
138
Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently
widely used messengers in the activation of the NF-kappa B transcription factor
and HIV-1. EMBO J. 1991 Aug;10(8):2247-58.
Scumpia PO, Delano MJ, Kelly KM, O'Malley KA, Efron PA, McAuliffe PF,
Brusko T, Ungaro R, Barker T, Wynn JL, Atkinson MA, Reeves WH, Salzler
MJ, Moldawer LL. Increased natural CD4+CD25+ regulatory T cells and their
suppressor activity do not contribute to mortality in murine polymicrobial
sepsis. J Immunol. 2006 Dec 1;177(11):7943-9.
Shaamash AH, Elsnosy ED, Makhlouf AM, Zakhari MM, Ibrahim OA, EL-dien
HM. Maternal and fetal serum nitric oxide (NO) concentrations in normal
pregnancy, pre-eclampsia and eclampsia. Int J Gynaecol Obstet. 2000
Mar;68(3):207-14.
Shakhov AN, Collart MA, Vassalli P, Nedospasov SA, Jongeneel CV. Kappa Btype enhancers are involved in lipopolysaccharide-mediated transcriptional
activation of the tumor necrosis factor alpha gene in primary macrophages. J
Exp Med. 1990 Jan l;171(l):35-47.
Shu HB, Takeuchi M, Goeddel DV. The tumor necrosis factor receptor 2 signal
transducers TRAF2 and c-IAPl are components of the tumor necrosis factor
receptor 1 signaling complex. Proc Natl Acad Sci U S A .
1996 Nov
26;93(24):13973-8.
Sibai B, Dekker G, Kupferminc M. Pre-eclampsia. Lancet. 2005 Feb 26-Mar
4;365(9461):785-99.
139
Sibai
BM.
Diagnosis
and
management
of
gestational
hypertension
and
preeclampsia. Obstet Gynecol. 2003 Jul; 102(1): 181-92.
Stone JR, Yang S. Hydrogen peroxide: A signaling messenger. Antioxid Redox
Signal. 2006 Mar-Apr;8(3-4):243-70.
Stone JR, Yang S. Hydrogen peroxide: A signaling messenger. Antioxid Redox
Signal. 2006 Mar-Apr;8(3-4):243-70.
Stulc J. Placental transfer of inorganic ions and water. Physiol Rev. 1997
Jul;77(3):805-36.
Takada Y, Mukhopadhyay A, Kundu GC, Mahabeleshwar GH, Singh S, Aggarwal
BB. Hydrogen peroxide activates NF-kappa B through tyrosine phosphorylation
of I kappa B alpha and serine phosphorylation of p65: Evidence for the
involvement of I kappa B alpha kinase and syk protein-tyrosine kinase. J Biol
Chem. 2003 Jun 27;278(26):24233-41.
Thengchaisri N, Hein TW, Wang W, Xu X, Li Z, Fossum TW, Kuo L. Upregulation
of arginase by H202 impairs endothelium-dependent nitric oxide-mediated
dilation
of coronary arterioles. Arterioscler Thromb
Vase Biol. 2006
Sep;26(9):2035-42.
Thommesen L, Laegreid A. Distinct differences between TNF receptor 1- and TNF
receptor 2-mediated activation of NFkappaB. J Biochem Mol Biol. 2005 May
31;38(3):281-9.
Toth P, Lukacs H, Gimes G, Sebestyen A, Pasztor N, Paulin F, Rao CV. Clinical
importance of vascular LH/hCG receptors—a review. Reprod Biol. 2001
Nov;l(2):5-ll.
140
Tracey KJ, Cerami A. Tumor necrosis factor: An updated review of its biology. Crit
Care Med. 1993 Oct;21(10 Suppl):S415-22.
Tracey KJ, Cerami A. Tumor necrosis factor: An updated review of its biology. Crit
Care Med. 1993 Oct;21(10 Suppl):S415-22.
Tuffnell DJ, Jankowicz D, Lindow SW, Lyons G, Mason GC, Russell IF, Walker
JJ, Yorkshire Obstetric Critical Care Group. Outcomes of severe preeclampsia/eclampsia in yorkshire 1999/2003. BJOG. 2005 Jul;112(7):875-80.
Vandenabeele P, Declercq W, Beyaert R, Fiers W. Two tumour necrosis factor
receptors: Structure and function. Trends Cell Biol. 1995 Oct;5(10):392-9.
Vandenabeele P, Declercq W, Vercammen D, Van de Craen M, Grooten J,
Loetscher H, Brockhaus M, Lesslauer W, Fiers W. Functional characterization
of the human tumor necrosis factor receptor p75 in a transfected rat/mouse T
cell hybridoma. J Exp Med. 1992 Oct 1;176(4):1015-24.
Veal EA, Day AM, Morgan BA. Hydrogen peroxide sensing and signaling. Mol
Cell. 2007 Apr 13;26(1):1-14.
Vercammen D, Vandenabeele P, Declercq W, Van de Craen M, Grooten J, Fiers W.
Cytotoxicity in L929 murine fibrosarcoma cells after triggering of transfected
human p75 tumour necrosis factor (TNF) receptor is mediated by endogenous
murine TNF. Cytokine. 1995 Jul;7(5):463-70.
Villamor E, Cnattingius S. Interpregnancy weight change and risk of adverse
pregnancy
outcomes:
A
population-based
study.
Lancet.
2006
Sep
30;368(9542): 1164-70.
141
Vural P. Nitric oxide/endothelin-1 in preeclampsia. Clin Chim Acta. 2002
Mar;317(l-2):65-70.
Wajant H, Pfizenmaier K, Scheurich P. Tumor necrosis factor signaling. Cell Death
Differ. 2003 Jan;10(l):45-65.
Walsh SW. Maternal-placental interactions of oxidative stress and antioxidants in
preeclampsia. Semin Reprod Endocrinol. 1998;16(1):93-104.
Wang
D,
Baldwin
transcription
by
AS,Jr.
Activation
of nuclear
factor-kappaB-dependent
necrosis
factor-alpha
is
tumor
mediated
through
phosphorylation of RelA/p65 on serine 529. J Biol Chem. 1998 Nov
6;273(45):29411-6.
Wang Y, Walsh SW. Antioxidant activities and mRNA expression of superoxide
dismutase, catalase, and glutathione peroxidase in normal and preeclamptic
placentas. J Soc Gynecol Investig. 1996 Jul-Aug;3(4): 179-84.
Ward NC, Croft KD. Hypertension and oxidative stress. Clin Exp Pharmacol
Physiol. 2006 Sep;33(9):872-6.
Wickens D, Wilkins MH, Lunec J, Ball G, Dormandy TL. Free radical oxidation
(peroxidation) products in plasma in normal and abnormal pregnancy. Ann Clin
Biochem. 1981 May; 18(Pt 3): 158-62.
Witting LA, Horwitt MK. Effect of degree of fatty acid unsaturation in tocopherol
deficiency-induced creatinuria. J Nutr. 1964 Jan;82:19-33.
Yu BP. Cellular defenses against damage from reactive oxygen species. Physiol
Rev. 1994Jan;74(l):139-62.
142
Yucesoy G, Ozkan S, Bodur H, Tan T, Caliskan E, Vural B, Corakci A. Maternal
and perinatal outcome in pregnancies complicated with hypertensive disorder of
pregnancy: A seven year experience of a tertiary care center. Arch Gynecol
Obstet. 2005 Nov;273(l):43-9.
Yui J, Garcia-Lloret M, Wegmann TG, Guilbert LJ. Cytotoxicity of tumour necrosis
factor-alpha
and
gamma-interferon
against
primary
human
placental
trophoblasts. Placenta. 1994 Dec;15(8):819-35.
Zygmunt
M,
Hahn
D, Munstedt
K,
Bischof
P, Lang
U.
Invasion
of
cytotrophoblastic JEG-3 cells is stimulated by hCG in vitro. Placenta. 1998
Nov;19(8):587-93.
143