Vol.70, Issue 2, April-June 2011 - About us | RAMI Editorial Board

Transcription

ROMANIAN ARCHIVES
OF
MICrOBIOLOgY
AND
IMMUNOLOgY
Founded by
PrOFessOr ION CANTACUZINO
VOLUMe 70 - No. 2
April - June 2011
Published quarterly
by
CANTACUZINO INsTITUTe BUChAresT
TOTAL PUBLIshINg hOUse
ROMANIAN ARCHIVes OF MICROBIOLOGY AND IMMUNOLOGY
ROMANIAN ARCHIVES
OF
MICrOBIOLOgY
AND
IMMUNOLOgY
IS S n 1 2 2 2 - 3 8 9 1
In d e x e d In M e d LIn e
C n C S IS C a t e gor y B +
Editor-in-Chief: Gabriel Ionescu
Deputy Editor: Aurora sãlãGeAnu
Editorial Board: Viorel AlexAndrescu, Antonis AntonIAdIs,
Jean-Marc cAVAIllon, Ana cãluGãru, cornelia ceIAnu,
carmen chIfIrIuc, Irina codIÞã, lidia creMer, Maria dAMIAn,
Angel GAlAboV, luminiþa smaranda IAncu, Anca IsrAIl,
emilia lupulescu, Adrian onu, roxana MoldoVAn, Geza MolnAr,
Marian neGuÞ, hervé pelloux, dorel lucian rAdu, Alexandru rAfIlA,
constantin spânu, demetrios spAndIdos, dan sterIu,
Galina tseneVA, codruþa romaniþa useIn, hans Wolf
Editorial Staff: felicia rApIlAt, Monica trãIstAru
totAl publIshInG house
Subscription orders:
Orders can be placed directly with the publisher:
„Cantacuzino“ National Institute of Research-Development for Microbiology and Immunology
C.P. 1-525, splaiul Independentei 103, 050096, Bucureºti, România
Fax: (40.21)306.93.07
e-mail: [email protected]
www.roami.ro
Copyright
46
©
2011 CANTACUZINO INsTITUTe Bucharest
CONTeNTs
MICROBIOLOGY
49
ANTIMICROBIAL AND ANTI-PATHOGeNIC ACTIVITY OF sOMe THIOUReIDes
DeRIVATIVes AGAINsT eRWINIA AMYLOVORA PHYTOPATHOGeNIC sTRAINs
Luminiþa Mãruþescu, Mihai-George Niþulescu, Marcela Bucur,
Lia-Mara Diþu, Grigore Mihãescu, Veronica Lazãr, Tatiana sesan
54
PROBIOTICs - AN ALTeRNATIVe TReATMeNT FOR VARIOUs DIseAses
Nicoleta Vasile, Raluca Ghindea, Tatiana Vassu
60
Helicobacter pylori CULTIVATION FROM GAsTRIC BIOPsIes
AND sUsCePTIBILITY TO ANTIBIOTICs UseD IN eMPIRICAL THeRAPY
Mãdãlina Ilie, Marcela Popa, Mariana Carmen Chifiriuc,
Alina Baltac, Gabriel Constantinescu, Coman Tãnãsescu
65
sCReeNING FOR GROUP B sTRePTOCOCCUs:
A PRIVATe LABORATORY exPeRIeNCe
Violeta-Corina Cristea, Maria Duþã, Gabriela Neacşu
69
OPTIMIZATION OF TRIPLex ReAL TIMe PCR FOR DeTeCTING
StapHylococcuS aureuS mecA, pvl AND nuc GeNes
Teodora Vremerã, Luminiþa smaranda Iancu, Cãtãlina Logigan,
eduard Nãstase, egidia Miftode, Cãtãlina Luncã, Olivia Dorneanu
74
A sTUDY ON APOPTOsIs INDUCING eFFeCTs
OF UVB IRRADIATION IN pSeuDoMoNaS aeruGiNoSa
Payam Behzadi and elham Behzadi
78
sURVIVAL OF H5N1 INFLUeNZA VIRUs IN WATeR AND ITs INACTIVATION BY CHeMICAL MeTHODs
Maria elena Mihai, Cristina þecu, Alina elena Ivanciuc, Gheorghe Necula, emilia Lupulescu, Adrian Onu
ReVIeW
85
NeW INTeRFeRONs IN THe TReATMeNT OF CHRONIC HePATITIs C
simona Ruþã and Costin Cernescu
VOLUMe 70
NO. 2
APRIL - JUNe 2011
47
INsTRUCTIONs TO AUTHORs
Aims and Scope
romanian archives of Microbiology and immunoloy, an international
journal dedicated to original research work, publishes papers focusing
on various aspects of microbiology and immunology. romanian archives of Microbiology and immunology is indexed in MeDLINe. The
frequency of the Journal is currently four issues per year.
Categories of manuscripts
Full-length articles are full-length descriptions of original research (up to
10 printed pages).
reviews are comprehensive appraisals of research in a field of current
interest. All reviews are subject to the normal review process (up to 15
printed pages).
rapid communications are brief, definitive reports of highly significant
and timely findings in the field (up to 5 printed pages).
Submission of manuscripts
Manuscripts and all attached files (tables and illustrations) should be
submitted in electronic form to the editorial Office, e-mail address:
[email protected] or by regular mail (address: Redactia Revistei
Romanian Archives of Microbiology and Immunology, spl. Independentei 103, sector 5, 050096, Bucuresti, Romania) on compact disk,
preferrably accompanied by three copies of the manuscript, including
tables and figures, printed on one side of A4 paper format, doublespaced, with 2.5 margins.
The preferred software is Microsoft Word.
In order to speed up the process of review, manuscripts should be prepared very carefully.
Cover letter
each manuscript submitted to the Romanian Archives of Microbiology
and Immunology must be accompanied by a Cover letter including an
explicit statement by the corresponding author that:
• the manuscript represents an original work, has not been previously
published, and has not been submitted simultaneously for publication
elsewhere.
• the manuscript, as submitted, has been reviewed and approved by all
named authors and that all authors concur with the submission and
are responsible for its content.
Editorial review and acceptance
All manuscripts are subject to editorial review by professional peer
reviewers (at least two). The acceptance criteria for all manuscripts are
based on quality and originality. The corresponding author of a manuscript is informed within 45 days after submission that the paper is
accepted for publication in the journal, needs revision or is rejected.
Revised manuscripts should be resubmitted as soon as possible but not
later than 14 days.
Ethical considerations
A paper describing any experimental work with humans should include
a statement that the ethics Committee of the institution in which the
work was done has approved it, and that the subjects gave informed
consent to the work.
experiments with animals should be done in accordance with the legal
requirements of the relevant local or national authority. Procedures
should be such that animals used in experiments do not suffer unnecessarily. Papers should include details of the procedures and anaesthetics
used. The editors will not accept papers where the ethical aspects are,
in their opinion, open to doubt.
Preparation of manuscripts
Manuscripts should be submitted in english. American or British spelling
can be used provided that only one spelling style is consistently used
throughout. Manuscripts must be typewritten on A4 format (210x297
mm), with double spacing, margins of 25 mm, on one side only, consecutively numbered. Times New Roman font, 12-point size, is required.
Text headings
All headings in the text should be set over to the left hand margin, and
text should begin on the next line. Type first level (sectional) headings
all in capitals. second level headings should be typed in small (lower
case) letters but with the first letter of each main word a capital. For third
level headings, only the first letter of the first word should be a capital.
Underline first and second level headings.
FIRsT LeVeL TexT HeADING
second Level Text Heading
Third level text heading
48
Manuscripts should be divided into the following sections and order:
Title page, Abstract and key words, Introduction, Materials and Methods, Results, Discussion, Acknowledgements, References, Tables,
Figure Legends and Figures.
1. Title page contains: title of the paper not longer than 80-100 characters, including spaces and punctuation; full name of the authors and
their affiliation; the author responsible for correspondence will be
marked by an asterisk, and his full address telephone/fax numbers,
and e-mail address will be indicated.
2. Abstract must not exceed 250 words and should reflect the content
of the study. Following the abstract, a list of 3-10 keywords is essential for indexing purposes.
3. Introduction containing a description of the problem under investigation and a brief survey of the existing literature on the subject.
4. Materials and Methods provide sufficient detail to allow the work to
be reproduced.
5. Results. Results should be clear and concise.
6. Discussion that enriches but does not repeat section 3 or 5.
7. Acknowledgements (if applicable) containing acknowledgement of
technical help and of financial material support.
8. References should be numbered consecutively in the order in which
they are first mentioned in the text. Identify references in text, tables,
and legends by Arabic numerals in square brackets (e.g. [1], [2-6],
etc.). Please note the following examples:
Journals:
Allain F, Vanpouille C, Carpentier M, Slomianny MC, Durieux S,
Spik G. Interaction with glycosaminoglycans is required for cyclophilin B to trigger integrin-mediated adhesion of peripheral blood
T lymphocytes to extracellular matrix. Proc Natl Acad sci U s A
2002. 99: 2714-2719.
Books:
Theofilopoulos AN. Immune complexes in autoimmunity. In: Bona
CA, siminovitch KA, Zanetti M, Theofilopoulos AN (eds.) The Molecular Pathology of Autoimmune Diseases. Harwood Academic Publishers, switzerland 1993, pp 229-244.
9. Tables with suitable captions at the top and numbered with Arabic
numerals should be collected at the end of the text on separate
sheets (one page per Table). Footnotes to tables should be marked
with a) b) c) etc and *, **, *** should be reserved for p values. each
table must be understood independently of the text. All tables must
be cited in the text.
10. Figures (illustrations) Figures should be submitted on separate
pages at the end of the article (new page for each complete figure).
They should be numbered in the order of their appearance with
Arabic numerals. Figures should be submitted as TIFF files at a proper
resolution as follows: Graphs at 800-1200 dpi; Photos at 400-800
DPI; Color 300-400 DPI. Text in figures should be 8-10 point in
size. each figure must have a separate legend. The legends should
not appear under the figures, but be gathered in a separate section
(Figure legends). Color figures can only be printed if the author is
prepared to pay the cost incurred.
11. Figure legends should be supplied at the end of the manuscript,
double spaced, with relevant figure numbers, labeling symbol and
explanation.
Units of measurement, Symbols and abbreviations
symbols for physical units should be those of the système Internationale
(sI) Units.
Alternative or non-sI units may be used, but these must be defined at
their first occurrence in the text.
Nomenclature of Microorganisms
Binary names, consisting of a generic name and a specific epithet (e.g.,
escherichia coli), must be used for all microorganisms.
Genetic Nomenclature
To facilitate accurate communication, it is important that standard genetic nomenclature be used whenever possible and that deviations or
proposals for new naming systems be endorsed by an appropriate authoritative body.
Proofs and reprints
Ten reprints of each article and one copy of the journal will be supplied
free of charge to the corresponding author.
romanian archives of Microbiology and immunology
ANTIMICROBIAL AND ANTI-PATHOGeNIC ACTIVITY
OF sOMe THIOUReIDes DeRIVATIVes
AGAINsT erwiNia aMylovora PHYTOPATHOGeNIC sTRAINs
Luminiþa Mãruþescu1*, Mihai-George Niþulescu2, Marcela Bucur1,
Lia-Mara Diþu1, Grigore Mihãescu1, Veronica Lazãr1, Tatiana Sesan1
1university
2carol
of bucharest, Faculty of biology, Microbiology immunology and Mycology Department;
Davila university of Medicine and pharmacy, Faculty of pharmacy, pharmaceutical chemistry Department
ABsTRACT
A series of N-(1-methyl-1Hpyrazole-4-carbonyl)-thiourea derivatives were assessed for their in vitro
antimicrobial and anti-pathogenic activity against twenty-two strains of erwinia amylovora isolated
from different regions in Romania. The compounds were solubilised in dimethylsulfoxide and
screened for their in vitro antimicrobial activity. The qualitative screening of the susceptibility spectra of various strains to the compounds was performed by adapted diffusion techniques (distribution
of the tested compound solution directly on the solid medium previously seeded with the bacterial
inoculums). The quantitative assay of the minimal inhibitory concentration (MIC, mg/mL) was based
on liquid medium two-fold microdilutions. The subinhibitory concentrations of the tested substances were investigated for their influence on biofilm development on inert substrata. The
present study showed that six new thiourea compounds exhibited a low antibacterial activity (MIC
values > 500 mg/ml), but the subinhibitory concentrations inhibited the biofilm development on
inert substrata. Thus, these results could suggest the usefulness of the tested compounds as control
agents for preventing the first stage (colonization) of the infection with the fire blight pathogen.
Keywords: erwinia amylovora, thiourea derivates, chemical control
INTRoDUCTIoN
Literature survey reveals many N-acylthiourea
derivatives with wide application as herbicides,
insecticides, parasiticidals, antimicrobials and antifungals [1-9]. Pyrazole containing compounds have
practical applications in the medicinal and agrochemical field and the biological activity of pyrazoles
and its derivatives are well documented. The pyrazole ring has proved to be the basic moiety for a
number of antibacterial substances [10]. Giving attention to the possible synergistic antimicrobial effects of
both thiourea and pyrazole moieties presence in an
organic compound, it appeared useful to synthesize a
series of N-(1-methyl-1Hpyrazole-4-carbonyl)-thiourea
derivatives.
Fire blight, caused by the enterobacterium
erwinia amylovora (Burrill) Winslow et al., is a
necrotrophic disease of members of the rosaceae
family, and it has economic importance in the cultivation of apples and pears [11]. Although a great
amount of research has been performed to overcome
the damage caused by this phytopathogen, a major
difficulty encountered is the lack of effective control
measures and tools [12]. The search for novel molecules with antimicrobial activity against phytopathogens is of challenging interest in plant pathology. In this context, the aim of the present study was
to evaluate the in vitro antibacterial effects of some
newly synthesized thiourea derivatives against different strains of e. amylovora isolated from various
regions in Romania.
* corresponding author: Luminiþa Mãruþescu, University of Bucharest, Faculty of Biology, Microbiology Immunology and Mycology
Department, Bucharest, Romania, e-mail: [email protected]
49
MãRUþESCU et al.
Fig. 1. Chemical formula of the seven thiourea derivates
with antimicrobial activity against E. amylovora strains
MATERIAL AND METHoDS
Bacterial strains and growth conditions
Twenty-two strains of e. amylovora were used
throughout the study; these strains were isolated from
plant material with fire blight symptoms (pyrus sp.,
cydonia sp., Malus sp.) in a surveillance program
which took place in 2005 in Romania (Braşov, Constanþa, Dâmboviþa, Gorj, Harghita, Iaşi, Mehedinþi,
Mureş, Ilfov, Neamþ, satu-Mare, sãlaj). The used maintenance media were represented by nutrient agar
(NA) and NA with 5% added sucrose (NsA).
Assessment of the antimicrobial and anti-pathogenic activity of newly synthesized compunds
in vitro antimicrobial tests were carried out by
an adapted agar-disc diffusion technique using bacterial suspensions of 0.5 McFarland density obtained
from 24 hours cultures. The compounds were solubilised in dimethylsulfoxide. 10 mL of each tested
compound solution was distributed directly on the
solid medium previously seeded with the bacterial
inocula. The inoculated plates were incubated for 48
50
hours at 28°C. Antimicrobial activity was assessed by
measuring the growth inhibition zones diameters.
The quantitative assay of the antimicrobial activity was performed by broth microdilution method in
96-well microplates in order to establish the minimal
inhibitory concentration (MIC, mg/mL). After 24 hrs incubation at 28°C the bactericidal activity was quantified by measuring the absorbance of the liquid culture at 620 nm. At the end of the experiment the wells
were emptied, washed three times with PBs, fixed
with cold methanol and stained with 1% violet crystal
solution for 30 minutes. The biofilm formed on plastic wells was resuspended in 30% acetic acid. The
intensity of the colored suspensions was assessed by
measuring the absorbance at 490 nm.
RESULTS AND DISCUSSIoN
In the present study we investigated the antimicrobial and anti-pathogenic effect of newly synthesized thiourea derivatives against e. amylovora strains
isolated from different counties in Romania. The qualitative screening of the susceptibility spectra of vari-
Antimicrobial and anti-pathogenic activity of some thioureides derivatives against Erwinia amylovora phytopathogenic strains
Fig. 2. Absorbance values at 620 nm of bacterial cultures developed
in presence of binary concentrations of newly synthesized compunds
ous strains of e. amylovora to new thiourea derivates
showed that out of the twenty tested compounds
seven produced an inhibition zone of the bacterial
growth area. The chemical formula of these active
thiourea derivatives is presented below (Fig. 1). The
antimicrobial activity of these newly synthesized
compounds was further quantified.
The results of the quantitative assay revealed
that the tested compounds exhibited a low inhibitory
activity on bacterial growth. Their MIC/MBC values
were in the range from 1000 - 500 mg/ml, values similar with those of the used organic solvent (DMsO)
(Fig. 2).
The subinhibitory concentrations of the tested
compounds inhibited the biofilm development on
inert substrata (Fig. 3). Blossoms are important sites of
infection for e. amylovora, the causal agent of fire
blight of rosaceous plants. Before entering the tissue,
the pathogen colonizes the stigmatic surface [13].
Thus, these results could suggest the usefulness of
these compounds as control agents for preventing the
first stage (colonization) of the infection with fire
blight pathogen, but a real assessment of the inhibitory effect of the tested compounds requires in vivo
testing methods.
CoNCLUSIoN
In conclusion, our study demonstrated that the
newly synthesized thiourea derivatives exhibited a
low inhibitory effect on the bacterial growth, but a
significant anti-biofilm effect that could suggest the
usefulness of these compounds as antimicrobial
agents in the prevention of fire blight disease.
51
MãRUþESCU et al.
Fig. 3. Absorbance values at 490 nm of the colored suspensions of bacterial biofilms developed on inert substrata in presence of binary concentrations of newly synthesized compounds
52
Antimicrobial and anti-pathogenic activity of some thioureides derivatives against Erwinia amylovora phytopathogenic strains
REFERENCES
1. Xue Sijia, Duan Liping, Ke Shaoyong, Jia Liangbin,
synthesis. Crystal structure and herbicidal activity of 1benzoyl-3-(4,6- disubstitute - pyrimidine-2-yl)- thiourea
derivatives, cJi 2003. 5 (8): 67.
2. J. Müller, C. Limban, B. Stadelmann, A. V. Missir, I. C.
Chiriþã, M. C. Chifiriuc, G. M. Niþulescu, A. Hemphill,
Thioureides of 2-(phenoxymethyl) benzoic acid 4-R substituted. A novel class of anti-parasitic compounds.
parasitology international. 2009. 58: 128-35.
3. Mariana Carmen Balotescu, Carmen Limban, Alexandru-Vasile Missir, Ileana Cornelia Chiriþã, George
Mihai Niþulescu, The synthesis and Biological Activities
Of some New 2-(4-Methoxy-phenoxymethyl)benzoic
Acid Thioureides. revista de chimie (bucuresti). 2007.
58: (11) 1064-1068
4. Carmen Limban, Mariana-Carmen Balotescu Chifiriuc,
Alexandru-Vasile Missir, Ileana Cornelia Chiriþã, Coralia Bleotu, Antimicrobial Activity of some New Thioureides Derived from 2-(4-Chlorophenoxymethyl)benzoic Acid. Molecules. 2008. 13:567- 580.
5. Carmen Limban, Alexandru-Vasile Missir, Ileana Cornelia Chiriþã, George Mihai Niþulescu, Laurenþiu Morusciag, Camelia Elena Stecoza, Diana Camelia Nuþã,
Carmellina Daniela Bãdiceanu, Miron Teodor Cãproiu,
Constantin Drãghici, synthesis Of New 2-(4-MethylPhenoxymethyl)Benzoic Acid Thioureides. Farmacia.
2008. 56 (6): 659-68.
6. Carmen Limban, Alexandru Missir, Ileana Chiriþã, Noi
tioureide ale acidului 2- (fenoximetil)-benzoic. Nota I.
Farmacia. 2000. 48 (6): 73-78.
7. Carmen Limban, Alexandru Missir, Ileana Chiriþã. Noi
tioureide ale acidului 2 fenoximetilbenzoic. Nota II.,
Farmacia. 2004. 52 (5): 7-12.
8. Zhimei Zhonga, Ronge Xinga, Song Liua, Lin Wanga,
Shengbao Caia, Pengcheng Lia, synthesis of acyl
thiourea derivatives of chitosan and their antimicrobial
activities in vitro, carbohydrate research. 2008. 343
(3): 566-70.
9. Adnan A. Bekhit, Hayam M. A. Ashour, Alaa El-Din A.
Bekhit, Hamdy M. Abdel-Rahman, Salma A. Bekhit.
synthesis of some pyrazolyl benzenesulfonamide derivatives as dual anti-inflammatory antimicrobial agents. J.
enzym. inhib. Med. chem. 2009. 24 (1): 296-309.
10. V. A. Chornous, M. K. Bratenko, M. V. Vovk and I. I.
Sidorchuk. synthesis and antimicrobial activity of pyrazole-4-carboxylic acid hydrazides and N-(4- pyrazoyl)hydrazones of aromatic and heteroaromatic aldehydes. pharmaceut. chem. J. 2001. 35 (4): 203-5.
11. Eastgate, J. A. erwinia amylovora: the molecular basis
of fire blight disease. Mol. plant. pathol. 2000. 1:325329.
12. Psallidas P G, Tsiantos J. Chemical control of fire
blight. In Fire Blight: the Disease and its Causative
Agent, erwinia amylovora. ed. J L Vanneste. Wallingford, United Kingdom: CAB International. 2000. pp.
199-234.
13. Antje Burse, Helge Weingart, and Matthias S. Ullrich.
NorM, an erwinia amylovora multidrug efflux pump
involved in in vitro competition with other epiphytic
bacteria. appl environ Microbiol. 2004. 70(2): 693-703.
53
PROBIOTICs - AN ALTeRNATIVe TReATMeNT
FOR VARIOUs DIseAses
Nicoleta Vasile*, Raluca Ghindea, Tatiana Vassu
university of bucharest, Faculty of biology, Department of Genetics, bucharest, romania
ABsTRACT
Modulating the microbiota of the gastrointestinal tract through probiotics is an alternative to the
conventional treatment of various diseases, based on synthetic drugs. The lifestyle, nutrition and
stress of the present modern society could be among the factors responsible for modifications in
the intestinal microbiota, correlated with specific diseases. The present study describes the positive
effects of probiotics use, with special reference to the yeasts use in several frequently encountered diseases, such as hypercholesterolemia, the irritable bowel syndrome, gastritis and several uro-genital
disorders.
Keywords: probiotics, yeasts, human microbiota
INTRoDUCTIoN
Researchers in all fields have constantly paid a
special attention to the human health status and wellbeing, taking into account the social and economical
implications of these issues. Drug use, especially antibiotics, for treating different human infectious diseases, has significantly lowered the morbidity and mortality rates, particularly in the developed countries.
Nevertheless, these chemicals have certain disadvantages, especially in that they can disturb the normal
functioning of microorganisms colonizing the human
body.
MicroorGaNiSM
In the last years, a greater importance has been
given to the impact of the intestinal microbiota on the
human health and to the use of microorganisms to
improve the body’s health status or to prevent disease. several conclusions can be drawn: the human
body presents a normal microbiota in which the colonizing species are in balance [1]; the colonization of
the gastrointestinal tract at birth is subsequently influenced by the nutrition of the newborn, knowing the
fact that children fed with maternal milk are carrying
bifidobacterium bifidus in their intestines, while those
fed with powder milk predominantly show clostridium perfrigens [2]; the microbiota shows a permanent
dynamics in relation with the host during lifetime, its
modifications being induced by age, lifestyle, diet,
stress, exposure to other microorganisms or some
medical interventions in the gastrointestinal tract. The
disturbance of the ecological balance of the microbiota in the above-mentioned conditions is associated
with the decrease in the number of the microorganisms with known health benefits, and a numerical
increase of those potentially pathogenic, which can
lead to discomfort or cause certain diseases [3, 4].
yeaStS aS probioticS
since the late 1800s, eli Metchikoff hypothesized that the Bulgarian people, which intensively consumed fermented dairy products rich in lactobacillus
species, present a higher longevity and an improved
health status. The term probiotics, derived from the
Greek word ‹‹for life››, was first used in 1965 by Lilly
and stillwell [5] and, afterwards, by Parker in 1974 to
define the organisms or substances that contribute to
the microbial equilibrium of the intestine. subsequently, at the beginning of the ‘90s, Fuller reviewed this
definition, stating that the term probiotic is equivalent to viable microbial supplement that assures benefits to the hosting animal organism by improving the
intestinal microbial equilibrium [6].
In the last few years, the term probiotic was used
to define living microbial compositions that, when
* corresponding author: Vasile Nicoleta, Department of Genetics, Faculty of Biology, University of Bucharest,1-3 Aleea Portocalilor,
sector 6, 060101 - Bucharest, Romania, email: [email protected]
54
Probiotics - an alternative treatment for various diseases
consumed, improve or heal some diseases, on the
basis of the modification of the gastrointestinal equilibrium by changing the metabolism and the interaction with the microorganisms within the intestine [7].
To be used by humans, the probiotics should
meet the following conditions:
(1) resist to the gastric acid and to the bile and pancreatic secretions from the intestine, maintaining
their viability through the gastrointestinal tract;
(2) get fixed on the epithelial cells of the intestine in
order to resist to peristalsis and to colonize the
intestine, at least temporarily, for the exclusion of
the pathogens, or to stimulate the renewal of the
affected intestinal mucosa.
(3) be recognized as non-pathogenic and safe for the
host organism, after some clinical tests that would
prove their benefits for health.
(4) maintain their viability along the processes of
product manufacturing, thus ensuring their large
scale production [8, 9].
Most of the studies concern the probiotic capacity of the lactic bacteria strains, their beneficial effects
being presently well known. Nevertheless, in the last
20 years a greater attention was shown to the probiotic capacity of some yeast strains. Among these, the
importance of the Saccharomyces boulardii species
is recognized, but the identification of other strains
with probiotic potential is desirable, especially since
the yeasts have some advantages compared to the
probiotic bacteria, among which their resistance to
antibiotics is an important aspect.
Saccharomyces boulardii, initially isolated from
fruits in Indochina by the French microbiologist Henri
Boulard and used in the treatment of intestinal diseases
since 1950, is currently commercialized as probiotic
product in europe, Africa and south America [10].
Initially classified as a separate species, Saccharomyces boulardii has been shown in recent studies
to be in fact a Saccharomyces cerevisiae strain, with
specific differences. Ingram L. and his collaborators
have recently widened this perspective, proving that
Saccharomyces boulardii presents trisomia for the Ix
chromosome. The aneuploidia state is maintained in
the Saccharomyces boulardii strain, probably because
it provides some selective advantages to the yeast
cell through the presence of a large number of gene
copies, due to the duplicate chromosome. Among
these characteristics, the survival at very low pH values
(even at pH 2) is an important physiological characteristic that assures the viability of the microorganism
in the stomach and thus strengthens the probiotic
potential of the strain by increasing the number of
viable cells that reach the intestine [11].
Regarding the yeasts their action as probiotics
was explained by Fuller [12] taking into account four
hypotheses concerning Saccharomyces boulardii:
- The competition for nutrients. Yeasts prevent
the colonization of the host organism by pathogenic
microorganisms, inhibiting their excessive development through the competition for nutrients;
- The competition for cell receptors involved in
microbial adhesion. in vitro studies certify that the
presence of Saccharomyces boulardii inhibits the
adhesion of entamoeba histolytica trophozoites to
the erythrocytes.
- Antitoxins production. experiments prove that
Saccharomyces boulardii can produce a 54 kDa protease that inhibits the hydrolysis of the A and B toxins
produced by clostridium difficile in the gastrointestinal tract [13]. Also, during the intestinal transit, Saccharomyces boulardii secretes and releases polyamines in the intestinal lumen (especially spermines and
spermidines), all these having an antagonistic effect
on the pathogens development in the intestine. Additionally, recent in vitro studies show that Saccharomyces boulardii is efficient against the toxins generated by vibrio cholerae and escherichia coli [14].
- Immunity stimulation. studies on mice have
demonstrated that Saccharomyces boulardii stimulates the secretion of immunoglobulin A during infections with clostridium difficile [15], and that it also
modulates the immune response of the host organism, by stimulating the secretion of proinflammatory
cytokines [16].
each part of our organism that is colonized by
certain microorganisms can theoretically be a target
for different probiotics. By modulating these sites, an
improvement of the overall health status can be
obtained, and different diseases can be prevented [17].
tHerapeutical uSe oF probioticS
Hypercholesterolemia
One of the most well known risk factors for
coronary heart disease is the high cholesterol level in
the blood. It contributes to the formation of a plate
that can narrow the coronary arteries, and, corroborated with other factors (such as hypertension, high
glucose level in the blood, etc.) leads to heart disease. Considering only these few negative influences the high serum cholesterol level has on the
health status, the public interest in reducing the cholesterol level by means of various physical, chemical
and biological procedures has increased.
In the past years, probiotic products gained a
special attention from both the consumers and the
producers, given that the ingestion of probiotics is
55
VASILE et al.
considered a natural way of reducing the level of
cholesterol. The hypocholesterolemiant effect of the
probiotics can be due to the following mechanisms:
the inhibition of 3-hydroxy-3-methylglutaril CoA reductase; the precipitation of the cholesterol resulted
from the diet with bile salts in the intestine; the assimilation of cholesterol in the cells of the probiotic
microorganism.
Although there is less data from experiments
dealing with different yeast strains compared with
studies made on bacteria, it has been proved that
cholesterol consumption is lower for lactic bacteria
than in the case of yeasts. Consequently, the yeast
strains: issatchenkia orientalis, saccharomyces cerevisiae, Saccharomyces boulardii (the latter being isolated from the Ultra Levure probiotic product) present a significantly higher capacity of removing the
cholesterol from the growth medium, even in the presence of inhibiting factors specific to the gastrointestinal tract (gastric juice, Oxgall, low pH level, incubation at non permissive temperatures of 37 oC). In these
experiments, the cholesterol level measured subsequently in the cell lysate is identical to the level of
cholesterol removed from the environment. This
proves that cholesterol is not metabolized. The intracellular assimilation of the cholesterol remains, thus,
the only possible mechanism through which the
yeast strains remove the cholesterol from the growth
environment [18].
Genital Disorders
The vaginal infections with escherichia coli,
Gardnerella vaginalis and candida albicans are treated with antibiotics or antifungal (metronidazole,
nistatin) which could lead to a disbiosis of the local
microbiota. The local or oral administration of some
probiotics proved useful in treating these infections.
Probiotics have several advantages in comparison
with the usual treatment: they assure the recovery of
the normal protective microbiota and, at the same
time, the secondary gastrointestinal effects of antibiotics use are avoided.
The use of lactobacilli and Saccharomyces
boulardii inhibits the adhesion of fungi to the vaginal
wall cells, being usable in treating mycotic vaginitis
by local administration [19]. Probiotics added to the
antibiotic used in genital disease treatment can easily
prevent gastrointestinal problems. Recent studies
indicate that Saccharomyces boulardii can be used as
well as a probiotic in the treatment of genital tract
infections (especially the inflammation of the fallopian tubes), caused by chlamydia trachomatis or
Neisseria gonorrhoea that can generate infertility and
56
ectopic pregnancy. In these cases, an alternative treatment with ofloxacin, ornidazol along with bacillus
and Saccharomyces boulardii was used, in comparison with the usual treatment using doxycycline and
metronidazole. The results were considered similar,
the advantage of using probiotics consisting in the
lack of secondary gastrointestinal effects specific to
the current treatment [20].
Gastrointestinal Diseases
The irritable bowel syndrome is a frequent disease in the european and American countries. symptoms differ from one person to another, which makes
it difficult to diagnose. The causes may be the weak
contraction of the intestinal muscles, the disturbance
of the intestinal innervations, and the type of food
consumed, as well as endocrine disorders, stress, poor
absorption, and genetic predisposition [21]. Probiotic
use could have the following beneficial results: lactic
bacteria consumption as a supplement for food such
as dairy products conduct to abdominal bloating reduction, pain and constipation attenuation; the administration of Saccharomyces boulardii is associated
with the attenuation of all the symptoms and a significant improvement of the patients’ state [22].
Colorectal cancer is often encountered in people
over the age of 50, who, during their lives, have had
a diet rich in meat and fat and have neglected the
vegetal products that contain fibres. A study made on
the Japanese population concludes that the ingestion
of lactobacillus casei Shirota can reduce the incidence of colon cancer [23]. The triggering mechanisms are yet unknown, the studies performed on animals suggesting that they might consist in:
- inhibiting tumour growth due to the generation of
glycopeptides and cytotoxins by the lactobacilli;
- the reduction of the procarcinogen substances
because of the microbiota changes;
- the antimutagenic properties of the probiotics and
the dairy products that contain probiotics.
Diarrhea is a disease with multiple possible causes that affects adults and children in all the countries,
despite their development level. The treatment with
broad-spectrum antibiotics (ampicillin, amoxicillin,
clindamycin) determines major changes in the
composition of the microbiota, data showing that
administrating the combination amoxicillin-clavulanic acid has the most disruptive effects upon the
colonising species. The administration of probiotics
can reduce the period of medication in the case of
this disease. The administration of Saccharomyces
boulardii, with the exception of lactic acid bacteria, in
treating this disorder has produced very good results.
In what concerns the children affected by diarrhea, from the comparative administration of the recommended rehydration treatment and of the same
treatment supplemented with Saccharomyces bulardii,
it can be noticed that the group that received the probiotic had a 50% lower disease manifestation period.
Also, the group to which the probiotic was administrated had a 50% decrease of the risk of diarrheal
episodes occurrence on a 2 months period from the
cessation of the treatment with probiotics - this showing a preventive character [25].
The treatment with antibiotics like ampicillin,
lincomycin, and clyndomycin determines diarrhea
caused by the development of clostridium difficile.
In one clinical study [26], the administration of antibiotics and placebo versus antibiotics and probiotics
in the treatment of persons with different diseases
showed that 9% of the placebo patients manifested
diarrhea in comparison with only one patient from
the group with probiotics, the toxin produced by
clostridium difficile being present in the faeces of the
affected patients. Thus, the study showed that the administration of Saccharomyces boulardii has a preventive role in the case of diarrhea associated with
antibiotherapy and clostridium difficile. The outstanding results of the use of Saccharomyces boulardii for
the treatment of recurrent infections with clostridium
dificille are due to the presence of a protease that
splinters the A and B toxins of the bacteria and block
the access of these toxins to the membrane receptors
of the epithelial cells [27].
In certain diseases or after surgical procedures
the artificial nutrition of patients, by intubation, is required. The analysis of the faeces proved that the
ratio between aerobic and anaerobic micro-organisms
is modified for the intubated patients and the quantity of short-chain fatty acids is low, which predisposes these patients to the occurrence of diarrhoea.
The administration of Saccharomyces boulardii in
lyophilized state to the intubated persons revealed an
increase of fatty acids quantity and prevented diarrhoea. The lactic bacteria that are most commonly
used as probiotics cannot induce this modification.
The study also showed that the beneficial quantity of
short-chain fatty acids remained high even if the
yeast was not retrieved from the faeces, which denotes a prolonged protective effect (9-10 days) of the
probiotics, not necessarily associated with the daily
continuous administration [28].
At present, probiotic products for treating or preventing this disease are commercially available. Ultra
Levure, Florastor, enterol (Biocodex) contain Saccharomyces boulardii strains, Acidophilus with psyllium
(CaliVita International) contains lactobacillus acidophilus, Ultra Flora Plus (Metagenics) contains bifidobacterium lactis, lactobacillus acidophilus NCFM.
Helicobacter pylori is a bacterium whose presence in the stomach and the duodenum was associated with diseases like gastritis and gastric cancer. It
is assumed that an important percent of the human
population is a carrier of this bacterium. The classic
treatment consists in administration of antibiotics
(amoxicillin, clarythromycine). The use of probiotics
can have positive effects by directly competing with
the bacterium and inhibiting its adhesion.
The combination of the standard treatment for
Helicobacter pylori with probiotics administration
proved efficient. In the clinical studies for infections
with Helicobacter pylori eradication, lactic bacteria
were used in some cases, and Saccharomyces
boulardii in others.
Saccharomyces boulardii was used as a probiotic supplement along the standard treatment with antibiotics, assuring a reduction of the diarrhea associated with the antibiotic administration, the attenuation
of gastric discomfort and a good tolerance of the
treatment [29].
The consumption of some fermented dairy products that contain strains of the bifidobacterium and
lactobacillus sp. just few weeks before treatment with
antibiotics to eradicate Helicobacter pylori, as well
as during the treatment, had beneficial effects, preventing the occurrence of diarrhoea associated with
antibiotics use [29].
probioticS SaFety
The role of yeasts as probiotic biotherapeutics
agents in treating various diseases was proved, some
species, such as Saccharomyces cerevisiae and Kluyveromyces lactis, receiving the GRAs (Generally recognized as safe) status being used in medical practice [30]. There were situations in clinical practice
when patients suffered infections with microorganisms existing in probiotic structures. There are data
indicating the incidence of some yeast infections
associated with the use of catheters on patients to
whom this probiotic was administered [31]. since
these infections were almost exclusively observed in
immunocompromised patients moderation in use of
this probiotic is recommended in such cases.
specialists keep some reserves as well in what
concerns the administration of these products to
patients with AIDs and to the prematurely born children who present other complications. The yeast
infection cases are, nevertheless, reduced and should
not overcome the positive effects observed in the use
57
VASILE et al.
of probiotics [32]. The probiotics must be consumed
under the supervision of the medical specialist and
the patient should be well instructed about the role of
such strains in treating or preventing various illnesses
[32]. In what concerns the healthy people, different
studies emphasized the probiotics’ capacity to reduce
the risk of developing some diseases by maintaining
the balance of the intestinal microbiota [33].
perSpectiveS
Human Microbiom Project (HMP) - is an international project that aims to characterize in situ the
entire human microbiota, from the mouth to the skin
and the genital tract, in order to highlight the colonizing microbial strains that are currently difficult to
grow or collect. The identification and correlation of
different microorganisms that compose the microbiota with different diseases, the establishment of their
relationships as well as the knowledge of the particularities of the individual microbiota composition
could be useful in health state improvement. At the
same time, this would be extremely important for the
efficient use of probiotics in therapy, even more so
since they can be added to the patient’s diet.
The Human Variome Project intends to identify
gene mutations and their association with the phenotypical variability and with the various aspects of different diseases. The knowledge of each person’s genetic imprinting is necessary for preventing the onset
of certain diseases by the adopted lifestyle, diet or
even medication [34].
Nutrition influences the health condition from
birth during our entire life. Nowadays, nutridynamics,
nutrigenomics and nutrigenetics are trying to prove
that the benefits of food are not the same for everyone and that the future of medicine, based both on
medication and nutrition consists in the personalized
approach for every individual [36, 37].
The information offered by these new research
directions will certainly improve the way of probiotics
use as well as the identification of new strains showing this potential.
58
REFERENCES
1. Dore J, Corthier G. Le microbiote intestinal humain. The
human intestinal microbia. Gastroen clin biol 2010. 34:
7-16.
2. Tennyson CA, Friedman G. Microecology, obesity, and
probiotics. Current opinion in endocrinology, Diabets
obes 2008. 15: 422-427.
3. Buddington R. Using Probiotics and Prebiotics to manage the Gastrointestinal Tract ecosystem. In: Charalampopoulos D, Rastall RA. (eds.) Prebiotics and Probiotics
science and Technology. springer science+Business
Media, LLC 2009, pp. 1-33.
4. Quigley EMM. Prebiotics and probiotics; modifying and
mining the microbiota. pharmacol res 2010. 61: 213218.
5. Fuller R. Probiotics in man and animals. J Appl Bacteriol
1989. 66: 365-378.
6. Fuller R. Probiotics in human medicine. Gut 1991. 32:
439-442.
7. Playne MJ. ICCC-9 Ninth International Congress on Culture Collection - Book of abstracts 2000 pp 68.
8. ouwehand AC, Salmien S, Isolauri E. Probiotics: an
overview of beneficial effects. Antonie van Leeuwenhoek 2002. 82: 279-289.
9. Dumitru IF, Vamanu A. Aplicaþii terapeutice ale produselor biotehnologice probiotice In: Drojdiile Biotehnologii clasice şi moderne. Ars Docenti, 2002.
10. Goulet o. Un probiotique pas comme les autres: d’une
histoire tropicale à des propriétés biologiques et des
effets cliniques prouvés (A probiotic not like others:
From tropical history to biological properties and
proved clinical effects). Journal de pédiatrie et de puériculture 2009. 22: 269-272.
11. Edwards-Ingram L, Gittsham P. Genotypic and physiological characterisation of Saccharomyces boulardii,
the probiotic stain of Saccharomyces cerevisiae. appl
environ Microb 2007. 73(8): 2458-2467.
12. Buzzini P, Vaughan-Martini A. Yeast Biodiversity and
Biotechnology. In: Rosa CA, Peter GB, springer Verlag
(eds.) Biodiversity and echophysiology of Yeasts - The
Yeast Handbook 2006, pp 533-561.
13. Castagliuolo I, Riegler MF, Valenick L, Lamont JT,
Pothoulakis C. Saccharomyces boulardii Protease Inhibits the effects of clostridium difficile Toxin A and B in
Human Colonic Mucosa, infect immun 1999. 69(1):
302-307.
14. Buts JP, De Keyser N. effects of Saccharomyces boulardii on Intestinal Mucosa. Digest Dis Sci 2006. 51:
1485-1492.
15. Qamar A, Aboudola S, Warny M, Michetti P, Pothoulakis C, Lamont CJ, Kelly C. Saccharomyces boulardii
stimulates Intestinal Immunoglobulin A Immune Response to clostridium difficile Toxin A in Mice. infect
immun 2001. 69(4): 2762-2765.
16. Rodrigues ACP, Cara DC, Fretez SHGG, Cuhna FQ,
Vieira EC, Nicoli JR, Vieira LQ. Saccharomyces boulardii stimulates sIgA production and the phagocytic
system of gnotobiotic mice. J appl Micobiol 2000. 89:
404-414.
17. Pagliaro G, Battino M. The use of probiotics in gastrointestinal diseases. Mediterr J Nutr Metab 2010. 3:
105-113. DOI 10.1007/s12349-010-0008-9.
18. Psomas EI, Fletouris DJ. Assimilation of Cholesterol by
Yeast strain Isolated from Infant Feces and Feta Cheese.
J Dairy Sci UsA 2003. 86: 3416-3422.
19. Isolauri E. Probiotics. best pract res cl Ga 2004. 18(2):
299-313.
20. Sharma JB, Chanana C. Comparison of ofloxacin &
ornidazole with probiotic versus doxycycline & metronidazole for the outpatient treatment of pelvic inflammatory disease. JK Science 2007. 9(2): 66-69.
21. Verna C, Lucak S. Use of probiotics in gastrointestinal
disorders: what to recommend? ther adv G 2010.
3(5): 307-319.
22. Iannitti T, Palmieri B. Therapeutical use of probiotic
formulation in clinical practice. clinical Nutrition
2010: 1-25.
23. Takeda K, okumura K. effects of a fermented milk
drink containing lactobacillus casei shirota on the
human NK-Cell activity, J. Nutr 2007. 137(3): 791-793
24. Hibberd PL. Probiotics for Infectious Diarrhea and
Traveler’s Diarrhea-What Do We Really Know? In:
Charalampopoulos D, Rastall RA. (eds.) Prebiotics and
Probiotics science and Technology. springer
science+Business Media, LLC 2009 pp. 874-901
25. Biloo AG, Memon MA, Murtaza G, Shekhani Saeed M,
Siddiqi A. Role of a probiotic (Saccharomyces boulardii) in management and prevention of diarrhoea.
world J Gastroentero 2006. 12 (28): 4557-4560.
26. Bauer MP, Van Dissel JT. Alternative strategies for
clostridium difficile infection. int J antimicrob ag
2009. 33: 51-56.
27. Chen X, Kokkotou EG, Kamakrishnan Bhaskar K,
Sougioultzis S, o’ Brien M, Pothoulakis C, Kelly CP.
Saccharomyces boulardii Inhibits eRK1/2 Mitogenactivated Protein Kinase Activation Both in Vitro and in
Vivo and Prottects against clostridium difficile toxin Ainduced enteritis. J biol chem UsA 2006. 281(34):
24449-24454.
28. Schneider SM, Girard-Pipau F, Fillipi J, Hebuterne X,
Moyse D, Hinojosa CG, Pompei A, Rampal P. effects
of Saccharomyces boulardii on fecal short-chain fatty
acids and microflora in patients on long-term total
enteral nutrition. world J Gastroenterol 2005. 11(39):
6165-6169.
29. Cindoruk M, Erkan G, Karakan T, Dursun A, Unal S.
efficacy and safety of Saccharomyces boulardii in the
14 day triple anti-Helicobacter pylori therapy: a
prospective randomized placebo-controlled doubleblind study. Helicobacter 2007. 12: 309-316.
30. Leuschner RGK, Robinson TP, Hugas M, Cocconcelli
PS, Richard-Forget F, Klein G, Licht TR, Nguyen-The
C, Querol A, Richardson M, Suarez JE, Thrane U, Vlak
JM, Von Wright. Qualified presumption of safety (QPs):
a generic risk assessment approach for biological
agents notified to the european Food safety Authority
(eFsA). trends Food Sci tech 2010. 21: 425-435.
31. Cassone M, Serra P, Mondello F, Girolamo A, Scafetti
S. Pistella E, Venditti M. Outbreak of Saccharomyces
cerevisiae subtype boulardii Fungemia in Patients
Neighboring Those Treated with a Probiotic Preparation of the Organism. J clin Microbiol 2003. 41(11):
5340-5343.
32. Jacques N, Casaregola. safety assessment of dairy microorganisms: The hemiascomycetous yeasts. int J
Food Microbio 2008. 126: 321-326.
33. Vanhoutte T, De Preter V, De Brandt E, Verbeke K,
Swings J, Huys G. Molecular Monitoring of the Fecal
Microbiota of Healthy Human subjects during Administration of Lactulose and Saccharomyces boulardii.
appl environl Microb 2006. 72( 9) : 5990-5997.
34. Boyle RJ, Robins-Browne RM, Tang LKM. Probiotic use
in clinical practice: what are the risks? am J clin Nutr
2006. 83: 1256-1264.
35. Fleet GH. Yeasts in food and beverages: impact on
product quality and safety. curr opin biotech 2007.
18:170-175.
36. Kaput J, Rodriguez RL. Nutritional genomics: the next
frontier in the postgenomic era. physiol Genomics
2004. 16: 166-177.
37. Vos WM, Castenmiller JJM, Harner RJ, Brummer RJ.
Nutridynamics- studying the dynamics of food components in products and in the consumer. curr opin
biotech 2010. 17: 217-225.
59
Helicobacter pylori CULTIVATION FROM GAsTRIC BIOPsIes
AND sUsCePTIBILITY TO ANTIBIOTICs UseD IN eMPIRICAL THeRAPY
Mãdãlina Ilie1*, Marcela Popa2, Mariana Carmen Chifiriuc2,
Alina Baltac3, Gabriel Constantinescu1, Coman Tãnãsescu4
1emergency
Hospital, Gastroenterology, bucharest, romania;
of bucharest, Faculty of biology, Microbiology immunology Department;
3carol Davila university of Medicine and pharmacy, bucharest, Faculty of Medicine; 4clinical Hospital colentina
2university
ABsTRACT
Helicobacter pylori is one of the most common among the numerous bacterial species of the stomach. It is classified as a class 1 carcinogen because of its causal relationship to gastric adenocarcinoma. The epidemiology of H. pylori infection is characterized by a marked difference between
developing and developed countries. Treatment of H. pylori still remains a challenge due to the
high rate of antibiotic resistance. The aim of this study was to investigate the susceptibility of
H. pylori strains isolated from gastric biopsies to different antibiotics currently used in the H. pylori
infection treatment schemes. Materials and methods. Upper gastrointestinal GI endoscopy was
performed, followed by the rapid urease test on gastric biopsies. The positive samples were cultivated on specific media under microaerophilic conditions and the antibiotic susceptibility assay
was performed on the isolated strains. Results. A positivity rate of 70% was obtained for cultures
performed from the biopsy samples positive for the urease test. The resistance rates for the antibiotics used in the classic triple therapy proved to be high, i.e. 92.8% for metronidazole, 50% for
amoxicillin and 32% for clarithromycin. The isolated strains proved to be sensitive to ciprofloxacin
and levofloxacin. Conclusions. The role of gastric microbiota and its contribution to the H. pylori
associated pathology need to be established. The problem of antibiotic treatment failure in case of
resistant H. pylori strains can be surpassed by routine culture and antibiotic susceptibility testings.
Keywords: Helicobacter pylori, gastrointestinal endoscopy, culture, resistance
INTRoDUCTIoN
A number of problems are associated with defining the indigenous microbiota of the stomach. First
of all, each day approximately 1010 bacteria from the
oral cavity and from the upper respiratory tract are
transferred to the stomach by swallowing. In addition, the stomach receives microbes that are present
in the food and beverages consumed by the host [1].
Gastric pH not only varies between individuals, but
also fluctuates widely in an individual throughout the
day as a result of food and beverage intake. Consequently, for short periods of time, the pH of the
stomach may lead to the survival and growth of a
range of bacterial species originating from the oral
cavity and/or the diet. Microbes frequently isolated
from the gastric juice (i.e. from the gastric lumen) are
mainly acid-tolerant species of streptococci and lactobacilli, although these are considered to be transient from the oral and/or nasal cavity. Organisms
that have been cultivated from stomach contents
include viridans streptococci (Streptococcus sanguinis
and Str. salivarius), lactobacilli (lactobacillus plantarum, l. salivarius, l. fermentum, and l. gasseri), Staphylococcus aureus, S. epidermidis, Neisseria spp.,
Haemophilus spp., bacteroides spp., Micrococcus
spp., bifidobacterium spp., coryneforms, and veillonella spp. The range of the organisms associated with
the gastric mucosa is similar to that present in the gastric lumen except that an additional organism, Helicobacter pylori, may be present in large proportions
of the population. Helicobacter pylori is one of the
most common among the numerous bacteria of the
* corresponding author: Ilie Mãdãlina, emergency Hospital, Gastroenterology, Bucharest, Romania, email: [email protected]
60
Helicobacter pylori cultivation from gastric biopsies and susceptibility to antibiotics used in empirical therapy
stomach. It is classified as a class 1 carcinogen because
of its causal relationship to gastric adenocarcinoma.
The epidemiology of H. pylori infection is characterized by a marked difference between developing
and developed countries. It has been suggested that,
prior to the 20th century, all humans were colonized
by H. pylori, but improved living conditions have
resulted in a decrease in the prevalence of the organism, this trend being particularly evident in developed countries in which prevalence rates continue to
fall. However, currently, approximately half of the
world’s population is colonized by H. pylori, but
there are marked regional variations in colonization
rates, which also vary with age, ethnicity, and socioeconomic status. In general, colonization rates are
higher in developing countries than in developed
countries and are declining in the latter. The frequency
of colonization increases with age among children
and adolescents, levels off during middle aged, and
then often decreases in the elderly. Other organisms
detected on the gastric mucosa include streptococci,
micrococci, peptostreptococcus spp., Gram-negative
anaerobic rods, veillonella spp., Neisseria spp., and
lactobacilli [2]. After antibiotic treatment the amount
of bacteria decreases significantly. Alteration of this
microbiota may have a role for functional dyspepsia
but the exact implication needs to be further studied
[1]. Treatment of H. pylori still remains a challenge due
to the high rate of antibiotic resistance. The eradication schemes used empirically include the standard
triple therapy consisting in: i) PPI (20 mg bid/dose),
combined with two antibiotics, the most frequently
used being clarithromycin (500 mg at 12h) and amoxicillin (1g at 12h), given for 7 days; ii) metronidazole
(500 mg at 12h) + amoxicillin (1g at 12h) + PPI (20
mg at 12h) for 7 days or iii) metronidazole (500 mg
at 12h) + clarithromycin (500 mg at 12h) + PPI (20
mg at 12h) for 7 days [3-5]. Although in the first years
since its discovery in 1982, H. pylori was sensitive to
most of the antibiotics, nowadays antibiotic resistance
is increasing. A major cause is the overuse of antibiotics for other infections, in many cases, of viral etiology. The aim of this study was to investigate the
susceptibility of H. pylori strains isolated from gastric
biopsies to different antibiotics currently used in the
H. pylori infection treatment schemes.
MATERIALS AND METHoDS
We investigated 100 patients using upper GI endoscopy admitted at the endoscopic unit of Clinical
emergency Hospital Bucharest, by a specialized gas-
troenterologist. All came with symptoms of persistent
epigastric pain or heartburn. endoscopic features were
normal in 30 patients (diagnosis was dyspepsia with
negative endoscopy), 39 with gastritis, 21 with gastroduodenal peptic ulcers, 9 with esophagitis and
one with gastric cancer. There were 33 males and 67
females. The ages of the patients ranged from 19 years
to 80 years. The gastric samples were tested for the
urease production by incubation in a test tube containing urea and phenol red as pH indicator. The
positive test was the color change (from yellow negative to red positive) due to urea’s hydrolysis to ammonium by H. pylori urease. Both commercial and in
house test tubes with similar sensitivities were used.
For bacterial culture detection, antral biopsy specimens positive for the urease test were transported
to the microbiology department within 1 hour in 5
mL tryptic soy broth as a transport medium. In the laboratory, specimens were cultivated on classic Columbia agar supplemented with 10% sheep blood
and incubated in CO2 atmosphere at 37oC (anaerobic
bags). After 3-7 days, small, circular, s-type colonies
typical for H. pylori were obtained. The isolated H.
pylori colonies were then subcultured on plates of
Columbia blood agar for purification, identification,
and performing antibiotic susceptibility tests. Identification of isolated H. pylori was confirmed by a negative reaction to Gram staining and by positive results of each of the following biochemical tests: oxidase test, catalase test and urease test [6].
The identified strains were tested for their antibiotic resistance to several antibiotics used in the H.
pylori infection treatment schemes, i.e.: amoxicillin,
tetracycline, furazolidone, metronidazole, clarithromycin, ciprofloxacin, levofloxacin, bismuth subcitrate [7].
The antibiotics were dissolved in sterile distilled
water in order to obtain a final concentration of
40 mg/ml, further used in a disk diffusion adapted method (by spotting 10 ml of each antibiotic solution on
the solid medium surface).
RESULTS
The gold standard for the presence of most infectious diseases is successful culture of the microorganism [8]. At present, culture of H. pylori from gastric antral biopsy specimens is a reference technique
in bacteriology and is essential for drug susceptibility
testing and analysis of putative virulence factors [8].
Primary isolation of H. pylori from a biopsy specimen
is a difficult process and the typical success rates in
61
ILIE et al.
culturing the organism are reported to be in the range
of 70% to 80% with 90% to 95% sensitivity and
100% specificity [8]. In our study, out of the total of
100 investigated patients, 40 patients proved to be
positive for the rapid test of H. pylori and in 70% of
them H. pylori was revealed using bacterial culture.
In the remaining patients (30%), H. pylori was not
detected. The recovery rate of H. pylori in culture
proved to be higher than that reported in other studies by using Columbia blood agar medium for isolation, i.e. 44% [8]. H. pylori was positive in 9 patients
from the 30 with normal endoscopy (diagnosed with
dyspepsia negative endoscopy), in 17 patients from
39 with gastritis, in 13 from 21 with gastro-duodenal
peptic ulcers and in one from 9 in esophagitis. so,
among H. pylori positive patients, the highest detection rates of the bacterium was recorded in patients
with gastroduodenal ulcers and gastritis; the age
group of 20-30 years was the one with highest rate of
H. pylori presence (70 % positive).
Gram stained smears obtained from the microbial cultures recovered on blood agar revealed very
diverse morphological types, from coco-bacillary to
filamentous forms, these results being in accordance
with similar data reported in the literature [9] (Fig. 1).
The Gram-negative spiral shaped rods were confirmed as H. pylori by three additional biochemical
tests (oxidase, catalase and urease).
The strains identified as H. pylori were further
tested for their antibiotic susceptibility. It must be noticed that there are no standards for antibiotic susceptibility testing in H. pylori, excepting for clarithromycin, using broth dilution method (CLsI, 2010). so, we
considered as sensitive those antibiotics exhibiting
growth inhibition zones >20 mm in diameter. The
analyzed strains exhibited resistance to at least one to
seven antibiotics (Fig. 2).
Fig. 1. Different morphotypes of bacterial strains isolated from the gastric biopsy samples (Gram staining, x1000)
62
Helicobacter pylori cultivation from gastric biopsies and susceptibility to antibiotics used in empirical therapy
Fig. 2. Antibiotic resistance patters of the strains isolated from the gastric biopsy samples (AMX-amoxicillin,
TE-tetracycline, FURAZ-furazolidone, METRo-metronidazole, CLR-clarithromycin, CIP- ciprofloxacin,
LEV-levofloxacin, BIS-bismuth)
The resistance rates for the antibiotics used in the
classic triple therapy proved to be high, i.e. 92.8%
for metronidazole, 50% for amoxicillin and 32% for
clarithromycin. The isolated strains proved to be sensitive to ciprofloxacin and levofloxacin (Fig. 3).
Fig. 3. Number of strains susceptible /resistant to different antibiotics (AMX-amoxicillin, TE-tetracycline,
FURAZ-furazolidone, METRo-metronidazole, CLR-clarithromycin, CIP- ciprofloxacin, LEV-levofloxacin,
BIS-bismuth)
63
ILIE et al.
CoNCLUSIoNS
The high resistance rate registered for the isolated H. pylori strains to the antibiotics used empirically in the triple therapy, such as clarithromycin, metronidazole and amoxicillin are proving the necessity
to take a careful patient history before prescribing
antibiotics and the ones that have been used before
for treating different infections should be avoided.
even if culture is time demanding and costly, it
should be performed especially for cases with previously multiple antibiotic administration or for treatment failure to triple therapy, and ideally, it would be
necessary for all cases.
64
REFERENCES
1. Bik, E., Eckburg, P., Gill, R. Molecular analysis of the
bacterial microbiota in the human stomach. pNaS.
2006. 103(3): 732-737.
2. Wilson, M., 2008, Bacteriology of Humans: An ecological perspective (1st ed.) Wiley-Blackwell.
3. Chey, W., Wong, B., Guidelines for Helicobacter pylori
treatment, American college of Gastroenterology guidelines. 2007.
4. Fuccio, L., Laterza, L., Zagari, R.M., Cennamo, V., Grilli,
D., Bazzoli, F., Treatment of Helicobacter pylori infection, clinical review. 2008. 5:321-331.
5. Gisbert, J.P., Pajares. J.M. Helicobacter pylori therapy:
first-line options and rescue regimen. Dig. Dis. 2001.
19: 134-143.
6. Makristathis, A, Hirschl, M., Lehours, P., Megraud, F.,
Diagnosis of Helicobacter pylori infection. Helicobacter. 2004. 1:7-14.
7. Megraud, F., Lehours, P. Helicobacter pylori Detection
and Antimicrobial susceptibility Testing. clinical
Microbiology reviews. 2007, p. 280-322.
8. Monstein, H., Tiveljung, A., Kraft, C., Borch, C., Profiling of bacterial flora in gastric biopsies from patients
with Helicobacter pylori-associated gastritis and histologically normal control individuals by temperature gradient gel electrophoresis and 16s rDNA sequence
analysis. Journal of Medical Microbiology. 2000. 49:
817-822.
9. Al-Sulami A., Al-Kiat H.S., Bakker L.K., Hunoon H.,
Primary isolation and detection of Helicobacter pylori
from dyspeptic patients: a simple, rapid method. la
revue de Santé de la Méditerranée orientale. 2008. 14
(2):268-276.
sCReeNING FOR GROUP B sTRePTOCOCCUs:
A PRIVATe LABORATORY exPeRIeNCe
Violeta-Corina Cristea*, Maria Duþã, Gabriela Neacşu
Synevo laboratory, bucharest, romania
ABsTRACT
We examined group B streptococcus (GBs) isolates colonizing women at the 35-37 weeks of pregnancy. A total of 257 group B streptococcus (GBs) isolates for serotyped using direct agglutination
with a set of commercially available antisera (Ia, Ib, II, III, IV, and V) and tested for susceptibility to
antimicrobials (penicillin, macrolides, lincosamides, fluoroquinolones and tetracyclines). Fourteen
isolates could not be serotyped with the antisera set used in the study. serotype III was the predominant serotype (33%), followed by serotypes V (23%), and Ia (20%). Whereas all isolates were
susceptible to penicillin, the rates of susceptibility to the other antimicrobials tested were the following: 91% for ofloxacin, 80% for clindamycin, 77% for erythromycin, and 4% for tetracycline.
More than half (67%) of the macrolide resistant isolates belonged to serotypes V and III.
A systematic surveillance of the autochthonous GBs serotypes, performed at the level of laboratories
processing a high number of human specimens, is mandatory for strengthening the national epidemiological GBs surveillance. While penicillin remains the drug of choice for intrapartum prophylaxis, the resistance of autochthonous GBs isolates to other antibiotics should be actively monitored.
Keywords: group B streptococcus, serotyping, macrolide resistance
INTRoDUCTIoN
Streptococcus agalactiae or group B streptococcus (GBs) is a significant cause of morbidity and mortality among newborns, which are usually infected at
birth by transmission of the microorganisms from the
GBs colonized mothers [1]. The burden of perinatal
GBs infections, mainly the early-onset neonatal
infections, were significantly reduced in those
regions were maternal prenatal screening for GBs followed by offering of intrapartum chemoprophylaxis
to carriers was implemented [2]. This strategy was initially developed by the Federal Centers for Disease
Control and Prevention, the American College of
Obstetricians and Gynecologists, and the American
Academy of Pediatrics in 1996. since then, based on
the gathered experience, improved GBs guideline
recommendations were released to prevent GBs disease [3], which were also adopted by the healthcare
system of many european countries, including
Romania.
In our country, the private sector medicine is
becoming a stronger partner of the public health system, and private laboratories are among the most frequently addressed operators. This study was conducted in the Microbiology Department of the largest
private laboratory in Romania, in order to enrich the
local laboratory data on GBs isolates colonizing
pregnant women. We focused on the serotype distribution and antimicrobial resistance of vaginal GBs
isolates collected during routine practice, considering that a continuous monitoring of the circulating
human strains is mandatory for guiding the prophylactic approaches.
GBS isolates
The 257 GBs isolates studied were collected by
the Microbiology Unit from synevo Laboratories, Bucharest, between October 2008 - April 2010. All iso-
* corresponding author: Violeta-Corina Cristea, Laboratorul Central synevo, str. Industriilor nr. 25, Chiajna, Ilfov;
Tel.: 0727.712.932, 0752.144.940; e-mail: [email protected]
65
CRISTEA et al.
lates originated from vaginal swab specimens of pregnant (35-37 weeks of gestation) women, between ages
19 and 46 years (median age 30 years), who had no
symptoms of infection at the moment of sampling.
Isolates were identified to the species level based on
colony morphology on Columbia agar supplemented
with 5% sheep blood, catalase reaction, and appropriate reaction with a commercial latex agglutination
group-specific streptococcal typing system (sTRePTOCOCCAL GROUPING KIT, OxOID). Only one
colony confirmed as GBs was kept from each vaginal
sample culture.
GBS serotyping
Capsular serotyping of GBs isolates was performed by slide agglutination using sera for types Ia,
Ib, and II to V (strep-B-latex kit, ssI Diagnostica), according to manufacturer’s instructions.
Antimicrobial susceptibility testing
All GBs isolates were tested for penicillin G (10
U), tetracycline (30 mg), ofloxacin (5 mg), erythromycin (15 mg) and clindamycin (2 mg) susceptibility by
disk diffusion method, as recommended by Clinical
and Laboratory standards Institute (CLsI) guidelines
[4]. Macrolide-lincosamide-streptogramin B (MLsB) resistance phenotypes were determined by the doubledisk test with erythromycin and clindamycin disks, as
also indicated by CLsI [4].
RESULTS AND DISCUSSIoN
The screening of the GBs colonization of pregnant women recruited for this study was performed
between 35-37 weeks of pregnancy by using a single
vaginal swab culture. In our laboratory, the diagnostic
is limited to species identification and testing of bacterial susceptibility to a set of antibiotics by disk diffusion method. However, knowing that serotyping of
GBs is of great importance in epidemiological studies of GBs disease we added this task to our work.
At present, GBs strains can be classified, based
on their capsular polysaccharides, in ten serotypes: Ia,
Ib, II-Ix [5, 6]. We restricted our serological testing to
serotypes Ia, Ib, II-V, reported as the most frequently
isolated serotypes in most parts of the world. Of the
total of 257 GBs isolates serotyped, 243 isolates
(95.5%) were typeable, the rest being considered as
nontypeable (NT) (Table 1). The major serotypes found
were serotype III (84 isolates; 33%), V (60 isolates;
23%), and Ia (51 isolates; 20%). significantly less isolates of serotypes II (29 isolates; 11%), Ib (12 isolates;
5%), and IV (7 isolates, 3%) were identified. In a previous Romanian study on 100 GBs vaginal isolates,
collected during 2008, predominantly from non-pregnant women, the most frequently detected serotypes
were III and II (26% each), followed by serotype Ia
(19%). These data suggest that serotype III might be
the most frequent GBs serotype residing in the vaginal flora of fertile healthy women population from
our local community. Other GBs serotypes such as II,
V, and Ia could be also important for the epidemiology of GBs disease in our country, but extensive
studies are needed in order to obtain additional conclusive information. However, growing evidence
suggests that certain serotypes might be more frequently involved in GBs disease. Among these, serotype III was reported as causing invasive infections in
infants [7, 8]. The results of a very recent study showed that GBs serotypes III and V induce apoptosis of
Table 1. Serotype distribution and antibiotic susceptibility
of GBS isolates collected from vaginal flora of pregnant women
66
Screening for group B streptococcus: a private laboratory experience
epithelial cells in the early stages of GBs infection,
resulting in tissue destruction, bacterial spreading and,
in consequence, invasive disease or systemic infection [9].
The assessment of in vitro antimicrobial susceptibility of GBs strains (Table 1) revealed that the GBs
isolates were uniformly susceptible to penicillin but
expressed a high rate of resistance to tetracycline (246
resistant isolates; 96%). Most of the isolates were susceptible to ofloxacin (233 susceptible isolates; 91%).
Resistance to fluoroquinolones in GBs has already
been reported in Japan, the United states, and also in
europe [10-12]. Among our collection, there were
only 7 (3%) isolates fully resistant to ofloxacin, whereas 17 isolates displayed an intermediate susceptibility profile. since resistance to fluoroquinolones can
develop during therapy and cross-resistance to other
fluoroquinolones is likely to occur, when prescribing
fluoroquinolones for GBs infections, susceptibility
testing and monitoring during therapy should be
done to avoid treatment failure [13].
In view of the other studies indicating an increasing macrolide and lincosamide resistance of GBs in
recent years, we also noticed that 199 isolates (77%)
were fully susceptible to erythromycin and 206 isolates (80%) to clindamycin, respectively. One isolate
expressed an intermediate susceptibility to erythromycin, and one isolate was erythromycin susceptible
but resistant to clindamycin. These two antibiotics have
been traditionally considered the treatment and prophylaxis of choice against GBs in individuals allergic
to beta-lactams. Therefore, because of the increasing
rate of resistance laboratories have to take into consideration the susceptibility in each individual strain
before using any of these antibiotics. In our study, the
majority of the erythromycin resistant isolates (45/57
isolates; 79%) displayed a constitutive MLsB phenotype, whereas 6 isolates expressed the M phenotype
(erythromycin resistance and clindamycin susceptibility), and 6 isolates showed an inducible MLsB profile. Overall, if also considering as resistant the isolates displaying intermediate susceptibility, we obtained a 22.5% level of erythromycin resistance for our
collection of vaginal isolates, which is slightly higher
than the 19% level reported by Usein et al [14]. A
French study performed in 2008 on erythromycin
resistant isolates reported that 16% of the vaginal GBs
isolates collected from pregnant women were resistant to this antibiotic, which is also a lower frequency than our findings [15].
Previous studies reported that serotype V is more
frequently associated with macrolide resistance [16,
17]. Almost half (24/57 isolates; 42%) of the isolates
expressing erythromycin resistance studied by us belonged to serotype V. The second serotype in prevalence was serotype III, represented by 14 isolates
(25%). The association of antibiotic resistance with an
increased pathogenic potential in strains belonging to
these serotypes is a major concern, which requires
identification of alternative strategies to prevention of
GBs disease. The administration of prophylactic vaccines is the most promising approach to this prevention [18]. Nevertheless, in order to size the problem
dimension in our population, we need to elaborate
and adopt the most appropriate strategies for laboratory-based surveillance of this pathogen, which could
involve public and private medical institutions.
ACKNoWLEDGEMENTS
All opinions, findings, and conclusions expressed
in this material are those of the authors. We would
like to thank Virgil Ivan, the manager of synevo
Laboratories Romania, for his encouragement and
support.
REFERENCES
1. Schuchat A, Wenger JD. epidemiology of group B streptococcal disease. Risk factors, prevention strategies, and
vaccine development. epidemiol rev 1994. 16: 374402.
2. Schuchat A. Group B streptococcal disease: from trials
and tribulations to triumph and trepidation. clin infect
Dis, 2001. 33: 751-756.
3. Center for Disease Control and Prevention: Prevention
of perinatal group B streptococcal disease. MMwr
2002. 51(RR-11): 1-22.
4. Clinical and Laboratory Standards Institute. Performance
standards for antimicrobial disk susceptibility tests; approved standard, 10th ed. CLsI document M2-A10. Clinical and Laboratory standards Institute, Wayne PA, 2009.
5. Slotved H-C, Kong F, Lotte Lambertsen L, Sauer S,
Gilbert GL. serotype Ix, a proposed new Streptococcus
agalactiae serotype. J clin Microbiol 2007. 45: 29292936.
6. Schuchat A. epidemiology of group B streptococcal
disease in the United states: shifting paradigms. clin
Microbiol rev 1998. 11: 497-513.
7. Fluegge K, Supper S, Siedler A, Berner R. serotype distribution of invasive group B streptococcal isolates in
infants: results from a nationwide active laboratory surveillance study over 2 years in Germany. clin infect Dis
2005. 40: 760-763.
67
CRISTEA et al.
8. Madzivhandila M, Adrian PV, Cutland CL, Kuwanda L,
Schrag SJ, Madhi SA. serotype distribution and invasive
potential of group B streptococcus isolates causing disease in infants and colonizing maternal-newborn dyads.
ploS one 2011. 6: e17861.
9. Da Costa AF, Pereira CS, Da Silva Santos G, Carvalho
TM, Hirata R Jr, De Mattos-Guaraldi AL, De Paula Rosa
AC, Nagao PE Group B streptococcus serotypes III and
V induce apoptosis and necrosis of human epithelial
A549 cells. int J Mol Med 2011. 27: 739-744.
10. Kawamura Y, Fujiwara H, Mishima N, Tanaka Y,
Tanimoto A, Ikawa S, Itoh Y, Ezaki T. First Streptococcus agalactiae isolates highly resistant to quinolones, with point mutations in gyra and parc. antimicrob
agents chemother 2003. 47: 3605-3609.
11. Wehbeh W, Rojas-Diaz R, Li X, Mariano N, Grenner L,
Segal-Maurer S, Tommasulo B, Drlica K, Urban C,
Rahal JJ. Fluoroquinolone-resistant Streptococcus agalactiae: epidemiology and mechanism of resistance.
antimicrob agents chemother 2005. 49: 2495–2497.
12. Tazi A, Gueudet T, Varon E, Gilly L, Trieu-Cuot P, Poyart C. Fluoroquinolone-resistant group B streptococci
in acute exacerbation of chronic bronchitis. emerg
infect Dis 2008. 14: 349-350.
13. Wu HM, Janapatla RP, Ho YR, Hung KH, Wu CW, Yan
JJ, Wu JJ. emergence of fluoroquinolone resistance in
group B streptococcal isolates in Taiwan. antimicrob
agents chemother 2008. 52:1888-1890.
14. Usein CR, Petrini A, Georgescu R, Grigore L, Strãuþ M,
Ungureanu V. Group B streptococcus colonization of
Romanian women: phenotypic traits of isolates from
vaginal swabs. roum arch Microbiol immunol 2009.
68: 235-239.
15. Domelier A-S, van der Mee-Marquet N, Arnault L,
Mereghetti L, Lanotte P, Rosenau A, Lartigue MF,
Quentin R. Molecular characterization of erythromycin-resistant Streptococcus agalactiae strains. J antimicrob chemother 2008. 62: 1227-1233.
16. von Both U, Ruess M, Mueller U, Fluegge K, Sander A,
Berner R. A serotype V clone is predominant among
erythromycin-resistant Streptococcus agalactiae isolates in a southwestern region of Germany. J clin Microbiol 2003. 41: 2166–2169.
17. Gherardi G, Imperi M, Baldassarri L, Pataracchia M,
Alfarone G, Recchia S, orefici G, Dicuonzo G, Creti R.
Molecular epidemiology and distribution of serotypes,
surface proteins, and antibiotic resistance among
group B streptococci in Italy. J clin Microbiol 2007.
45: 2909-2916.
18. Johri AK, Paoletti LC, Glaser P, Dua M, Sharma PK,
Grandi G, Rappuoli R. Group B streptococcus: global
incidence and vaccine development. Nat rev Microbiol. 2006. 4: 932–942.
68
OPTIMIZATION OF TRIPLex ReAL TIMe PCR FOR DeTeCTING
StapHylococcuS aureuS mecA, pvl AND nuc GeNes
Teodora Vremerã1, Luminiþa Smaranda Iancu1, Cãtãlina Logigan2,
Eduard Nãstase2, Egidia Miftode2, Cãtãlina Luncã1, olivia Dorneanu1*
1Gr. t. popa university of Medicine and pharmacy, iaşi, Microbiology Department
2Gr. t. popa university of Medicine and pharmacy, iaşi, infectious Diseases Department
ABsTRACT
Multiplex polymerase chain reaction (PCR) allows simultaneous detection of two or more genes,
using the same reaction conditions, and so it is possible the rapid detection of methicillin resistant
Staphylococcus aureus strains (MRsA) in clinical specimens. This study aimed to implement, for
the first time in our laboratory, a triplex real time PCR (RT-PCR) technique for detection of genes
encoding resistance to oxacillin and synthesis of Panton Valentine leukocidin (pvl), a pathogenicity
factor characteristic for community acquired strains (CA-MRsA). The application of this method
will permit the epidemiological surveillance of circulating strains and early application of prevention measures.
Keywords: Staphylococcus aureus, pvl, mecA, multiplex PCR.
INTRoDUCTIoN
The ability of S. aureus to rapidly develop resistance to antibiotics and to spread in both community
and hospital environment imposes a strict monitoring
of circulating strains for identification of isolates carrying resistance genes and virulence factors. The
appearance of MRsA strains, due to the acquisition of
mecA gene, led to an increase in mortality, length of
hospital stay and costs. In our country, studies performed between 2004-2008 revealed a rate of MRsA
invasive infections varying between 38-50%, the
highest rate for europe [1,2,3]. While initially associated with hospital infections (hospital aquired
MrSa: HA-MRsA), MRsA is now increasingly involved in community infections, in patients without
healthcare associated risk factors [4,5]. These strains
seem to be more virulent than HA-MRsA [6].
expression of PVL, a cytolytic exotoxin, was strongly
associated with CA-MRsA [7]. The toxin, encoded by
phagic genes lukF-pv and lukS-pv, targets polymorphonuclear leukocytes, leading to cell lysis [6]. An
important risk factor for MRsA infection is the carriage of MRsA strains, almost 30% of carriers developping infections later [3]. Keeping MRsA prevalence at
a low level requires screening on admission of
patients at high risk of being colonized [8]. effective
monitoring of MRsA spread depends on the rapidity
of carriage detection. The use of molecular techniques (e.g. multiplex RT-PCR) allows for rapid detection of MRsA in clinical specimens, combined with
detection of genes encoding the synthesis of pathogenicity factors [9].
Our objective in this study was the application
of RT-PCR for detection of nuc (thermostable endonuclease gene, specific for S. aureus), mecA and pvl
genes in cultures of S. aureus reference strains in order
to optimize this technique, as a preliminary stage of
studies conducted on isolates from patients with community or hospital acquired infections.
In order to implement the detection of meca, pvl
and nuc genes in the Microbiology Laboratory of the
Faculty of Medicine, UMP „Gr T Popa” Iaşi, we used
the following reference strains: S. aureus ATCC 25923
and 49775 (nuc and pvl present, meca absent), S.
aureus ATCC 33592 (nuc and meca present, pvl
absent). For staphylococcal DNA extraction we used
GenelutetM bacterial Genomic DNA Kit, lysostaphin and lysozyme (sigma Aldrich, Germany). For amplification and detection of target genes with hydrolysis probes we used stratagene Mx3005P instrument. Amplification reactions were prepared using
* corresponding author: Olivia Dorneanu, [email protected], 16, Universitãþii street, Iaşi 700115, Romania, phone +40747413919
69
VREMERã et al.
Table 1. The sequences of primers and hydrolysis probes used for detection of mecA,
pvl and nuc genes (adapted from McDonald et al., 2005 [10])
5•Reporter dye /
3•Quencer
Primers and
hydrolysis probes
mecA Fwda)
mecA Revb)
GGCAATATTACCGCACCTCA
GTCTGCCACTTTCTCCTTGT
mecA probe
AGATCTTATGCAAACTTAATTGGCAAATCC
pvl Fwd
pvl Rev
ACACACTATGGCAATAGTTATTT
AAAGCAATGCAATTGATGTA
pvl probe
ATTTGTAAACAGAAATTACACAGTTAAATATGA
nuc Fwd
nuc Rev
CAAAGCATCAAAAAGGTGTAGAGA
TTCAATTTTCTTTGCATTTTCTACCA
nuc probe
TTTTCGTAAATGCACTTGCTTCAGGACCA
a)forward
primers;
b)reverse
Sequence (5•-3•)
primers;
c)melting
Tmc)
58oC
58oC
5•FAM
3•TAMRA
65oC
50oC
56oC
5•Quasar670
3•BHQ3
63oC
52oC
50 oC
5•CAL Fluor
Orange560
3•TAMRA
59 oC
temperature
2 mL of template DNA and the reagents indicated
below, with a total volume of 20 mL:
1. brilliant Multiplex Qpcr Master Mix for multiplex RT-PCR and brilliant ii Qpcr Master Mix for
singleplex RT-PCR, used in 1x concentration (Agilent
Technologies, UsA).
2. meca, nuc and pvl primers and hydrolysis
probes (Table 1) (Biosearch Technologies, Inc., UsA)
supplied in lyophilised form, purification HPLC (high
performance liquid chromatography).
The protocol used for triplex RT-PCR is shown in
Table 2 and 3. The strains were tested in triplicate by
both triplex and singleplex RT-PCR. Reagents and
thermal profiles used for singleplex RT-PCR detection
of each gene are presented in Table 4. The presence
of amplified genes was indicated by increasing fluorescence of the fluorochrome used to label the detection probe. Fluorescence channels used to detect amplification are shown in Table 5.
RESULTS
The results of triplex RT-PCR amplification are
shown in Figs. 1-3. The mecA gene was detected in
reference strain S. aureus ATCC 33592 and was
absent in S. aureus ATCC 25923 and S. aureus ATCC
49775. pvl genes were detected in reference strain S.
aureus ATCC 49775 and S. aureus ATCC 25923 and
were absent in S. aureus ATCC 33592. All three reference strains were positive for nuc gene. We compared pvl gene amplification curves obtained in singleplex with those obtained in multiplex and found that
they were similar (Fig. 2).
DISCUSSIoN
The use of RT-PCR led to a significant improvement in MRsA surveillance, by enabling direct detection of methicillin-resistant strains in clinical samples
and rapid establishment of preventive measures
Table 2. Triplex RT-PCR for detection of mecA, pvl and nuc genes:
Concentrations of primers and hydrolysis probes in the reaction mixture
Amplified gene
mecA
pvl
nuc
Primers
0,30
0,40
0,05
Final concentration (µM)
Hydrolysis probes
0,1
0,1
0,05
Table 3. The thermal profile used for triplex RT-PCR detection of mecA, pvl and nuc genes
Number of cycles
1
40
70
Step
pre-denaturation
denaturation
primers annealing/ elongation
Temperature
95ºC
95ºC
55ºC
Time
10 minutes
15 seconds
60 seconds
optimization of triplex Real Time PCR for detecting Staphylococcus aureus mecA, pvl and nuc genes
Table 4. Protocol used for singleplex RT-PCR detection of mecA, pvl and nuc genes
Amplified
gene
Primer concentration
(µM)
Hydrolysis probe
concentration (µM)
mecA
0,30
0,1
pvl
0,40
0,1
nuc
0,30
0,1
Thermal profile
1 cycle: 7 minutes at 95°C
40 cycles: 15 seconds at 95°C
60 seconds at 60°C
60 seconds at 55°C
60 seconds at 60°C
Table 5. Fluorescence channels used to detect amplification
Hydrolysis probe
5!Reporter dye
Excitation
Emission
mecA
pvl
nuc
FAM
Quasar 670
CAL Fluor Orange560
495 nm
647 nm
538 nm
520 nm
670 nm
559 nm
against their spread [10, 11]. These techniques are
based on simultaneous detection of mecA and nuc
genes. Moreover, multiplex RT-PCR allows simultaneous detection of genes encoding virulence factors,
such as PVL, a genetic marker for CA-MRsA infections [12,13]. PVL is associated with higher severity
Fluorescence channel used
for fluorochrome detection
FAM
Cy5
HEX/JOE/VIC
of localized lesions and increased systemic inflammatory response [14]. Rapid spread of CA-MRsA
strains not only in the community, but also in hospitals, requires their fast and accurate detection.
Our study aimed to implement a triplex RT-PCR
technique for simultaneous detection of mecA, nuc
Fig. 1. Amplification curves for S. aureus ATCC 25923 (mecA negative, pvl and nuc positive)
71
VREMERã et al.
Fig. 2. Amplification curves for S. aureus ATCC 49775 (mecA negative, pvl and nuc positive)
and comparison of pvl amplification by singleplex and by multiplex RT-PCR
and pvl genes, a method that can be then applied for
detection of virulence and resistance genes in clinical
isolates of S. aureus. Optimization of multiplex PCR
requires time-consuming procedures. One of the pro-
blems posed by multiplex RT-PCR is the „cross-talk”
of signal detection between channels (the capture of
fluorescent signal by another channel). This can be
avoided by choosing appropriate fluorochromes with
Fig. 3. Amplification curves for S.aureus ATCC 33592 (mecA and nuc positive, pvl negative)
72
optimization of triplex Real Time PCR for detecting Staphylococcus aureus mecA, pvl and nuc genes
narrow band emission, so that different bandwidths
do not overlap. Thus, we used hydrolysis probes labeled with FAM, Quasar 670 and CAL Fluor Orange
560. Another difficulty encountered is the preferential
amplification of one target sequence over another, by
competition for reagents (dNTP and polymerase) and
the interaction of primers, probes, targets or amplicons [15]. This can be avoided by optimization of the
concentrations of primers and probes. Thus, we
varied the concentrations of primers and probes from
0,05 mM to 0,4 mM, and from 0,05 mM to 0,1 mM, respectively. The use of primers in concentrations of
0,30 mM for mecA, 0,40 mM for pvl and 0,05 mM for
nuc, allowed the simultaneous amplification of the
targets, with reproduction of amplification curves
obtained by singleplex. Changing the thermal profile,
by increasing the duration of the pre-denaturation
cycle, from 7 to 10 minutes and the decrease of primer annealing/extension temperature from 60°C to
55°C improved the detection of pvl and nuc genes.
Also, the amplification of non-target sequences was
avoided by using Hot-start polymerase, which is inactive at room temperature. In addition, the use of
hydrolysis probes specific for the amplified genes,
increases the specificity of the reaction. each reaction
was performed in triplicate, thus verifying the reproducibility of the method.
CoNCLUSIoNS
Real Time PCR technique for detection of mecA,
nuc and pvl genes was implemented for the first time
in our laboratory. This technique makes possible the
validation of test results for phenotypic resistance to
oxacillin.
Detection of PVL-producing strains can be used
in combination with typing techniques for identification of CA-MRsA strains and epidemiological surveillance of these strains’ circulation.
The development of multiplex Real Time PCR
will allow in the future the detection of MRsA, possibly PVL-producing, directly in clinical specimens and
early implementation of preventive measures against
the spread of such strains in the hospital.
ACKNoWLEDGEMENTS
The research described in this study was supported by CNCsIs-UeFIsCsU, project number PNII-IDeI
code ID_1586/2008 and was possible by using facilities of the Laboratory of Microbiology of Gr T Popa
University of Medicine and Pharmacy, Iaşi.
REFERENCES
1. Ionescu R, Mediavilla J R., Chen L, Grigorescu D o,
Idomir M,. Kreiswirth B N, Roberts R B. Molecular Characterization and Antibiotic susceptibility of Staphylococcus aureus from a Multidisciplinary Hospital in
Romania, Microbial Drug resistance 2010. 16: 263-272.
2. Dorneanu o, Miftode E, Vremerã T, et al. Prevalence
and characteristics of S. aureus isolated from infections
in Northeast Romania, J prev Med 2006.14 (3-4): 66-70.
3. Köck R, Becker K, Cookson B, van Gemert-Pijnen JE,
Harbarth S, Kluytmans J, et al. Methicillin-resistant Staphylococcus aureus (MRsA): burden of disease and control challenges in europe. euro Surveill 2010. 15:
pii=19688.
4. Davis SL, Perri MB, Donabedian SM, et al. epidemiology and outcomes of community-associated methicillin-resistant Staphylococcus aureus infection. J clin Microbiol 2007. 45: 1705-1711.
5. Eveillard M, Lescure FX, Eb F, Schmit JL. Portage, acquisition et transmission de Staphylococcus aureus résistant
à la méticilline en milieu communautaire. Conséquences en terme de politique de prévention et d’antibiothérapie. Med Mal infect 2002. 32: 717-724.
6. Boyle-Vavra S, Daum RS. Community-acquired methicillin-resistant Staphylococcus aureus: the role of Panton-Valentine leukocidin. lab investig 2007. 87: 3-9.
7. Tristan A, Ferry T, Durand G, et al. Virulence determinants in community and hospital meticillin-resistant Staphylococcus aureus. J Hosp infect 2007. 65:105-9.
8. Stürenburg E. Rapid detection of methicillin-resistant
Staphylococcus aureus directly from clinical samples:
methods, effectiveness and cost considerations. Ger Med
Sci 2009. 7: Doc06
9. Al-Talib H, Yean CY, Al-Khateeb A, et al. A pentaplex
PCR assay for the rapid detection of methicillin-resistant
Staphylococcus aureus and Panton-Valentine Leucocidin. bMc Microbiol 2009. 9:113
10. McDonald RR, Antonishyn NA, Hansen T, et al. Development of a triplex real-time PCR assay for detection
of Panton-Valentine Leukocidin toxin genes in clinical
isolates of methicillin-resistant Staphylococcus aureus.
J clin Microbiol 2005. 43: 6147-6149.
11. ornskov D, Kolmos B, Bendix Horn P, et al. screening
for methicillin-resistant Staphylococcus aureus in clinical swabs using a high-throughput real-time PCR-based
method. clin Microbiol infect 2008. 14: 22–28.
12. Vandenesch F, Naimi T, Enright M, et al. Communityacquired methicillin-resistant Staphylococcus aureus
carrying Panton-Valentine leukocidin genes: worldwide emergence. emerg infect Dis 2003. 9: 978-984.
13. Hedin G, Fang H. The epidemiology of methicillinresistant Staphylococcus aureus (MRsA) in southern
stockholm 2000-2003. Microb Drug resist 2007. 13:
241-250.
14. Bocchini CE, Hulten KG, Mason Eo Jr, et al. PantonValentine leukocidin genes are associated with enhanced inflammatory response and local disease in acute
hematogenous Staphylococcus aureus osteomyelitis in
children. pediatrics 2006. 117: 433-40.
15. Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE, Multiplex PCR: Optimization and Application in Diagnostic
Virology. clin Microbiol rev 2000. 13: 559-570.
73
A sTUDY ON APOPTOsIs INDUCING eFFeCTs
OF UVB IRRADIATION IN pSeuDoMoNaS aeruGiNoSa
Payam Behzadi and Elham Behzadi*
affiliation: Microbiology Department, Faculty of basic Sciences,
islamic azad university, Shahr-e-Qods branch, tehran - iran
ABsTRACT
Background: pseudomonas aeruginosa is an important bacterial pathogen which causes different
infectious diseases such as wound and skin lesion infections. The main goal of this study was to
induce eventual apoptotic reactions in ultraviolet-exposed colonies of pseudomonas aeruginosa.
Materials and Methods: The colonies of pseudomonas aeruginosa were irradiated by UVB light; then,
the DNA molecules of control and UVB-exposed colonies were extracted. eventually, the extracted
DNA molecules mixed in loading dye were run in 1% agarose gel containing ethidium bromide.
Results: No unusual pattern like DNA laddering bands or smear, were detected upon the 1%
agarose gel.
Discussion: Through the applied protocol in this survey, the UVB radiation is not able to trigger
apoptosis pathway in UV light exposed colonies of pseudomonas aeruginosa. It seems that the
cytoprotective property of Heat shock proteins inhibit the inducing effect of UVB light in irradiated
colonies of pseudomonas aeruginosa.
Keywords: in vitro, pseudomonas aeruginosa, Apoptosis, electrophoresis, Agar gel
INTRoDUCTIoN
pseudomonas aeruginosa is a famous opportunistic pathogen, which often causes infections in
physical barriers including skin of immune defective
patients. so, pseudomonas aeruginosa is an important bacterial etiology of burn wound and lesions of
human skin. The infections caused by gram-negative
bacterium of pseudomonas aeruginosa are usually
treatable, but the mortality rate of acute fulminant
infections like burn wound infections is high [1-3]. As
we know, there are different antimicrobial agents for
treating Pseudomonas infections [1,2]; however, a
successful Ultraviolet (UV) therapy may be useful as
a cheap and sharp means for shortening the treatment
phase and more effective therapy of skin infections
caused by pseudomonas aeruginosa. Therefore, in this
study we tried to perform a determined Ultraviolet
radiation (UVR) protocol as an apoptosis inducing
stimulator in the irradiated colonies of pseudomonas
aeruginosa and compairing them with control
colonies.
pseudomonas aeruginosa was provided from the
microbial collections of Islamic Azad University,
shahr-e-Qods branch, Microbiology Laboratory. The
confirmation of bacterial samples was performed by
microscopic observations, Gram staining and biochemical tests as standard traditional diagnostic methods [4]. The bacterial samples were inoculated into
four plates containing Nutrient Agar (Merck KGaA,
Darmstadt, Germany) and then, incubated for 72
hours at 37oC. After suitable growth, a plate was
picked up as control one and the others were irradiated by UV-transilluminator (Upland, CA, U.s.A.).
The plates were exposed to UVB source with the
wavelength of 302 nm at a distance of 8 centimeters
for 10 minutes. The UV lamp with the maximum
quantity of light and the minimum quantity of heat
was fixed and placed above the colonies. The three
irradiated plates were incubated within a dark chamber respectively for 1, 24 and 72 hours [4-6].
A DNP kit (50T, CinnaGen Inc.) was used for
DNA extraction and the kit protocol was run for suc-
*corresponding author: elham Behzadi - Microbiology Department, Faculty of Basic sciences, Islamic Azad University,
shahr-e-Qods Branch, Tehran, Iran; Mobile: +98-912-4389442; e-mail: [email protected]
74
A study on apoptosis inducing effects of UVB irradiation in Pseudomonas aeruginosa
cessful harvesting of total genomic DNA belonging to
UV-exposed and control colonies of pseudomonas
aeruginosa.
According to the protocol, 5 ml of protease were
added to 100 ml of pseudomonas aeruginosa suspension and the incubation was run in 55oC for 30 minutes. Then, 100 ml of each suspension were mixed
into 400 ml Lysis solution. Next, 300 ml of Precipitation solution was added and the shaking of microtubes was carried out. Then, the samples were placed
at -20oC for 20 minutes. soon after that, the centrifugation of samples were achieved at 12,000 g for 10
minutes [4].
The obtained supernatant was slowly poured out
and then, 1 ml Wash Buffer was added to the pellet.
A shake was run and the samples were microfuged at
12,000 g for 5 minutes and the supernatant was decanted again. The obtained pellet was incubated at
65oC for 5 minutes. Then, 50 ml solvent Buffer were
added to the tube containing dried pellet and after
running a shake, it was incubated at 65oC for 5 minutes. At the end, the insoluble compounds were precipitated through microfugation at 12,000 g for 30
seconds and the total genomic DNA was isolated
from the supernatant phase of each sample. For visualizing the DNA bands, 10 ml of purified DNA of
each group (UV-exposed and control colonies) were
loaded into 1% agarose gel containing ethidium bromide. Also, DNA weight marker III of CinnaGen
Company, was used as the molecular weight size
marker (Fig. 1). The density of RNA molecules was
not considerable and no disadvantage was observed
during DNA extraction [4,7] (Fig. 1). The DNA lanes
were constructed by purified DNA molecules extracted from control and irradiated colonies to show the
eventual apoptotic patterns [4-6].
10]. The safe ray therapy can be a favorite alternative
approach for treating infected superficial wounds and
skin lesions, when the chemical therapy has low
effectiveness. Obviously, the long-term exposure of
UVB ray (280-320 nm) on humans has inducible
health hazards like skin cancer and adaptive immune
system suppression [8, 11-13]. so, finding a logic UVR
protocol with short-term irradiation to apply for UV
therapy by triggering apoptosis in pathogenic microbial cells like pseudomonas aeruginosa may affect
deeply on the chemotherapeuthic medication.
Heat shock proteins which have different cytoprotective effects are present in prokaryotes as well as
eukaryotes [14, 15]. Inducing downregulation of
Hsp90b caused by UVB is the key of cell apoptosis in
UV radiated organisms [15]. In this study, a shorttime UVB exposure -10 minutes with the wavelength
RESULTS
After 24 hours, all of the irradiated colonies had
lost the green-blue phenazine of pyocyanin (Fig. 2).
The extracted total genomic DNA of control and 10minute-UVB exposed colonies which were run
through 1% agarose gel showed neither smear (necrosis) nor DNA laddering (apoptosis) bands.
According to Fig. 1, no unusual and unknown pattern
was detected in DNA bands. The procedure was
repeated thrice.
DISCUSSIoN
UVR and, in particular, UVB light induces apoptosis in different organisms, from prokaryotic cells
like bacteria to eukaryotic cells like human cells [8-
Fig. 1 - The bands of DNA molecules extracted from
control and UVB- irradiated colonies of Pseudomonas
aeruginosa, which have been run in 1% agarose gel
Lane M: DNA weight marker III of CinnaGen Company
(size Marker). The size marker indicating the DNA bands
around 19 kbp.
Lane 1: DNA bands of control colonies of pseudomonas
aeruginosa.
Lane 2: DNA bands of 10-minute-irradiated pseudomonas
aeruginosa colonies, kept for 1 hour in a dark chamber
after UVR.
aeruginosa colonies, kept for 24 hours in a dark chamber
after UVR.
aeruginosa colonies, kept for 72 hours in a dark chamber
after UVR.
75
BEHZADI and BEHZADI
Fig. 2 - The presence of the phenazine of pyocyanin in control colonies of Pseudomonas aeruginosa (left) and the absence of the phenazine of pyocyanin in 10-minute-irradiated of Pseudomonas
aeruginosa (right)
of 302 nm from the distance of 8 centimeters - was
used to induce apoptosis in pseudomonas aeruginosa
[4-6]. several strains of pseudomonas aeruginosa as
opportunistic bacterial pathogens are able to produce
colorful, redox-active antibiotics which are named as
phenazines. One of the most known and studied phenazines is pyocyanin [16]. However, in this investigation, the production of the phenazine of pyocyanin
was inhibited in 10-minute-UVB-exposed colonies of
pseudomonas aeruginosa.
UV light causes DNA damages via formation of
cyclobutane pyrimidine dimers and photoproducts
which are both apoptosis inducing agents. As it is
known, bacteria have the repair systems like dark
repair and photo reactivation; thus, the UVB-irradiated colonies were put in a dark chamber respectively
1, 24 and 72 hours [4-6, 9, 17, 18].
The results of this investigation reveal that no
smear (necrosis) or laddering band (apoptosis) was
detected in extracted DNA molecules belonging to
control and 10-minute-UVB irradiated colonies of
pseudomonas aeruginosa, which were run in 1%
agarose gel electrophoresis. so, it seems that the
cytoprotective effects of Heat shock proteins inhibit
the expression of genes related to apoptosis machinery in the irradiated colonies of pseudomonas aeruginosa. Hence, furthur studies are needed for providing an acceptable UVR protocol used for a suitable
UV therapeuthic medication.
76
ACKNoWLEDGEMENTS
We appreciate Persian science & Research
Publisher (Persian s&RP) as the financial supporter of
this scientific project. We are also obliged to Mr.
Bahman Qadami (expert of Microbiology Laboratory
of Islamic Azad University, shahr-e-Qods Branch,
Tehran, IRAN) and Mr. Cyrus CHeGINI (expert of Biochemistry and Genetics Laboratory of Islamic Azad
University, shahr-e-Qods Branch, Tehran, IRAN) for
their help in this study.
A study on apoptosis inducing effects of UVB irradiation in Pseudomonas aeruginosa
REFERENCES
1. Qarah S, Cunha BA, Dua P, Lessnau KD. pseudomonas
aeruginosa Infections. emedicine from WebMD 2009.
http://emedicine.medscape.com/article/226748-overview.
2. Japoni A, Farshad S, Alborzi A. pseudomonas aeruginosa: burn infection, treatment and antibacterial resistance. iran red crescent Med J 2009. 11: 244-253.
3. Bodey GP, Bolivar R, Fainstein V, Jadeja L. Infections
caused by Pseudomonas aeruginosa. Clin Infect
Dis 1983. 5: 279-313.
4. Behzadi P, Behzadi E. An in vitro survey on the apoptotic effects of UVB ray in bacillus anthracis. Mædica J
clin Med 2011. 6: 28-31.
5. Behzadi P, Behzadi E, Geramishoar M. Apoptosis feature in dermatophyte fungi of epidermophyton floccosum, Microsporum canis and trichophyton mentagrophytes. iJciD 2010. 14:7-11.
6. Behzadi P, Behzadi E. Detection of Apoptosis Feature In
Ultraviolet Light-exposed trichophyton rubrum. turkiye
Klinikleri J Med Sci 2006. 26:607-610.
7. Simona ES, Diana P, Robertina I, Ionela A, Ileana S,
Tatiana VD. Molecular identification of some yeast
strains involved in oral candidosis. rom biotechnol lett
2009. 14:4180-4186.
8. Cai BX, Luo D, Lin XF, Gao J. Compound K suppresses
ultraviolet radiation-induced apoptosis by inducing
DNA repair in human keratinocytes. arch pharm res
2008. 31:1483-1488.
9. Kulms D, Schwartz T. Molecular mechanisms of UVinduced apoptosis. photodermatol photoimmunol
photomed 2000. 16:195-201.
10. Rastogi RP, Sinha R, Sinha RP. Apoptosis: molecular
mechanisms and pathogenicity. eXcli Journal 2009.
8:155-181.
11. Schwartz T, Schwartz A. DNA repair and cytokine
responses. J invest Dermatol 2009. 14:63-66.
12. Gläser R, Navid F, Schuller W, Jantschilsch C, Harder
J, Schröder JM, Schwartz A, Schwartz T. UV-B radiation induces the expression of antimicrobial peptides
in human keratinocytes in vitro and in vivo. J allergy
clin immunol 2009. 123:1117-1123.
13. Lewis W, Simanyi E, Li H, Thompson CA, Nasti TH,
Jaleel T, Xu H, Yusuf N. Regulation of ultraviolet radiation induced cutaneous photoimmunosuppression by
Toll-like receptor-4. arch biochem biophys 2011.
508:171-177.
14. Behzadi E, Behzadi P, Sirmatel F. Identification of 30kDa heat shock protein gene in trichophyton rubrum.
Mycoses 2009. 52:234-238.
15. Chen H, Xia Y, Fang D, Hawke D, Lu Z. Caspase-10
mediated Heat shock Protein 90b cleavage promotes
UVB irradiation-induced cell apoptosis. Mol cell biol
2009. 29:3657-3664.
16. Price-Whelan A, Dietrich LEP, Newman DK.
Pyocyanin Alters Redox Homeostasis and Carbon Flux
through Central Metabolic Pathways in pseudomonas
aeruginosa PA14. J bacteriol 2007. 189: 6372-6381.
17. Fernández Zenoff V, Siñeriz F, Farías ME. Diverse
Responses to UV-B Radiation and Repair Mechanisms
of Bacteria Isolated from High-Altitude Aquatic environments. appl environ Microb 2006. 72:7857-7863.
18. Batista LF, Kaina B, Meneghini R, Menck CF. How
DNA lesions are turned into powerful killing structures: Insights from UV-induced apoptosis. Mutat res
2009; 681:197-208.
77
sURVIVAL OF H5N1 INFLUeNZA VIRUs
IN WATeR AND ITs INACTIVATION BY CHeMICAL MeTHODs
Maria Elena Mihai, Cristina þecu, Alina Elena Ivanciuc, Gheorghe Necula, Emilia Lupulescu, Adrian onu*
cantacuzino NirDMi, National influenza center
ABsTRACT
The ability of H5N1 Avian Influenza Virus (AIV) to survive in surface water has been assessed in
experimental laboratory conditions, based on non-pathogenic avian reassortant model, by titration
of infectivity (TCID50) at different time intervals, in three different types of water.
The effect of different chemicals on AIV’s survival was assessed using the same type of experimental model. After exposure to the chemical, followed by growth on a suitable substrate, the AIV
was quantified by a real-time quantitative reverse transcriptase PCR (qRT-PCR).
The reassortant virus persisted, and remained infective in aquatic environments, for 12 days at 2235°C and up to 20 days at 4°C, irrespective of the type of water, supporting the hypothesis of a
potential risk for transmitting the virus among birds and contaminating the household water via
common sources of water. A significant decrease for AIV persistence models was recorded for sea
water, after 12 days, at 35°C.
An effective inactivation has been shown when using commercially available products based on
glutaraldehyde and penta potassium bis (peroxy mono sulphate) bis(sulphate), respectively. This
rapid and safe method for decontamination, developed in this study, might be helpful in implementation of biosafety measures in laboratory and farms against AIV.
Keywords: avian influenza, H5N1 reassortant, disinfectants, persistence, water
INTRoDUCTIoN
since 1997, the highly pathogenic avian influenza (HPAI) has spread infecting populations of wild
and domestic birds in several countries in Asia, as
well as causing the first human case of avian influenza with H5N1 in Hong Kong [1]. Bird flu has spread
to europe, Africa and Middle east since 2005.
Romania was confronted with two waves of HPAI:
the first wave in October 2005, originated in the
Danube Delta in small backyard premises [2] and the
second wave, in May 2006, started from a commercial farm of chickens in Brasov County [3]. An outbreak in backyard poultry was recorded in November
2007 in the Danube Delta, where the source consisted of the residues of an infected hunted coot. The
Danube Delta is an important station on the way of
migratory wild birds, which might become an endemic area for the avian influenza viruses and a potential source for outbreaks in poultry and even for
transmission to humans. The last presence of AIV in
*corresponding author: Adrian Onu - [email protected]
78
the Danube Delta was detected in March 2010 when,
viruses of high pathogenicity, clade 2.3.2 of the contemporary eurasian H5N1 lineage were identified [4].
At present H5N1 influenza virus still represents a real
threat for Romania.
Aquatic birds belonging to the orders Anseriformes and Charadriiformes are the natural reservoir
for avian influenza viruses. Infections in these avian
hosts are normally asymptomatic and characterized
by preferential replication in the intestinal tract with
high concentrations of virus shed in the feces. Viral
transmission in aquatic bird populations is thought to
occur through an indirect fecal-oral route involving
contaminated water [5, 6]. The maintenance of AIV
in these populations may also be dependent on or
enhanced by environmental persistence. It is possible
that virus shed by birds in autumn, prior to migration,
could be preserved in the water over winter, and provide a source of infection to birds returning during the
following spring. Despite the well-recognized role
Survival of H5N1 influenza virus in water and its inactivation by chemical methods
that contaminated water plays in the transmission
cycle of AIVs in wild waterfowl populations, little is
known about the viral persistence in this medium.
experimental data suggest that AIVs have evolved and are able to persist for extended periods in
aquatic habitats. A validated model system using distilled water was developed to evaluate the effects of
different environmental parameters on the persistence of AIVs [7, 8]. experimental studies using this
system indicate the following: 1) wild-type AIVs can
remain infective in water for an extended period,
with an estimated persistence >190 days for some
viruses with a starting viral mean concentration of
106 tissue-culture infective doses (TCID50/ml); 2) the
ability to persist in water differs between individual
AIVs; and 3) viral persistence is markedly influenced
by differences in temperature, salinity, and pH (within
limits encountered in natural field conditions) [8].
As many of AIVs subtypes (H5, H7, H9 et al.) are
able to infect humans, research on the inactivation of
these viruses by typical disinfection processes represents a high priority of the World Health Organization (WHO).
In our study we report the results of an analysis
of the stability of H5N1 non-pathogenic avian reassortant virus in surface water and its inactivation by
chemical methods in experimental laboratory conditions.
Viral strain. AIV vaccine strain, H5N1 - NIBRG
- 14 (originating from NIBsC, UK), with haemagglutinin - HA and neuraminidase - NA genes derived
from A/Viet Nam/1194/2004 - clade 1 was propagated in sPF embryonated eggs in order to obtain the
stock virus, which was aliquoted and stored in liquid
nitrogen. Virus concentrations used in the experiments were calculated by TCID50[9]. Virus titer was
105.25TCID50/0.1 ml. High, medium or low concentrations of H5N1 were obtained by dilution in phosphate buffer saline (PBs), standing water (lake - brackish water), running water (river - fresh water) and sea
water.
Water samples collected from the typical waterfowl habitats such as rivers (fresh water) - two different locations, two lakes (standing water) and Black
sea (sea water) were characterized in terms of chemical parameters using a commercial kit (AquaMerck,
Merck, Germany). Protein content [10] and pH were
also determined. Aliquots were stored at -80oC.
Infectivity of NIBRG-14 in experimental water
sample was quantified using a microtiter endpoint
titration and results were expressed in units of
TCID50/0.1 ml water. serial 10-fold dilutions from
sample were prepared in cold, serum-free DMeM
(sigma, Germany) and then transferred in microtitration plates on MDCK monolayer cells (ATCC-CCL34, Manassas VA, UsA), four wells/dilution. After 2472 h of incubation, the cytopathic effect upon the
monolayer cells was inspected in optical microscopy
and cells were fixed with 80% cold solution of acetone in PBs. endpoints were recorded by eLIsA test
using 1:4000 dilution of influenza A virus specific
monoclonal antibody (Chemicon) in dilution buffer
(PBs, 1:1000 Tween 20, 1% Bovine serum Albumine). The second antibody - anti-mouse IgG HRP conjugate (Promega) was a 1:2500 dilution in the same
buffer. substrate used was a mixture of 30% hydrogen peroxide and 3,3’5,5’-tetramethylbenzidine
(Merck, Germany). After adding stop solution (2M
sulphuric acid), the optical densities (OD) have been
automatically read at 450nm. The virus titer was considered the highest dilution where the value of OD
≥ average of OD of 4 wells uninfected cellular culture + 3 standard deviation. The titer of infectivity
has been calculated according to Reed and Muench
method [9].
Disinfectants. Two disinfectant groups were
included in the study: oxidizing agents - Virkon
(Antec Int. Ltd., UK); 0.5%, 1 %, 2% (w/v) concentrations and aldehydes - glutaraldehyde (Merck, Germany); 0.73 %, 1.1 %, 2% concentrations. They were
tested using different times of chemical interaction.
sodium bisulphite (0.28 M final concentration) was
used for neutralization of the disinfectant.
substrates to monitor the retention infectivity of
the influenza virus after each different treatment were
conventional embryonated chicken eggs or MDCK
cell line, according with WHO Manual [11].
each viral suspension exposed to chemical treatment, positive control (untreated virus in PBs) and
control of toxicity of chemicals on substrate were
gradually filtered up to 0.22 mm filter. Four embryonated eggs (11 days old) were inoculated with each
sample, 0.2 ml amniotic route each, two or three passages. The virus inactivation was indicated by lack of
HA activity of amniotic/allantoic fluids using a 0.5%
suspension of turkey erythrocytes.
Viral suspensions, after chemical treatment, were
inoculated in double on MDCK monolayer, in a
maintaining medium - DMeM containing a final concentration of 1 mg/ml trypsin TPCK (Fluka), 2.5 mg/ml
79
MIHAI et al.
Table 1. Main characteristics of waters included in the study of influenza virus survival
Test
pH
Protein content
Salinity (g/L)
Dourness
Nitrate
Nitrite
Oxygen
Fresh water
7.4
12.92 g prot/ml
0.23
14 0d
0
0.15 mg/L NO25,5 mg/L O2
Brackish water
8.02
12.29 g prot/ml
0.62
32 0d
10 mg/L NO30.025 mg/L NO27,7 mg/L O2
Sea water
7.6
106.33 g prot/ml*
16.19
>80 0d
2 mg/L NO30.075 mg/L NO26 mg/L O2
PBS
7.4
0 g prot/ml
8.5
0 0d
2 mg/L NO30.02 mg/L NO28,8 mg/L O2
* influenced by high salt content
amphotericin B (sigma, Germany), 100 mg/ml gentamicin (sigma, Germany). The virus was incubated
at 35°C in a 5% CO2 incubator for 40 hours.
Molecular detection. Viral RNA was purified
using commercial kit (QIAamp viral RNA kit Qiagen,
Hilden, Germany). qRT-PCR was performed using
the superscript Platinum III One step qRT-PCR kit
(Invitrogen, UsA) with the Mx3005P thermocycler
(stratagene), in a 25 mL volume containing 10 mL of
extracted RNA, 2x Reaction Mix (11.5 mL),
superscript III RT/Platinum Taq Mix (0.5 ml), forward
and reverse primer (5 mM each) (H5Viet For 5’-GGA
TGG CAG GGA ATG GTA GA -3’ respectively,
H5Viet Rev 5’-TCT ATT GCC TTT TGA GTG GAT
TCT T -3’), FAM-TAMRA probe (5 mM) (H5VietProbe
5’FAM- TGG GTA CCA CCA TAG CAA YGA GCA
GG-TAMRA 3’) described in [12] and ROx reference
dye (10 mM). Reverse transcription was initiated at
50oC for 30’, followed by PCR activation at 95oC for
2’ and 40 cycles of two step incubation at 95oC for
15” and 60oC for 30”. The standard curve was done
by using RNA purified from 10-fold dilution series of
the stock virus (105.25TCID50/0.1 ml). The lowest concentration of NIBRG - 14 reassortant reproducibly
detected was 17.7 TCID50 /0.1 ml.
RESULTS
Persistence of the infective viral particles of
NIBRG 14 was evaluated in three types of water: running water (river - fresh water), standing water (lake brackish water), and sea water, PBs was used as a
control. The main characteristics of waters are presented in Table 1.
NIBRG-14 virus survival (104 TCID50/0.1 ml
final concentration) has been evaluated at three temperatures: 4-8oC; 22oC and 35oC (Figs. 1, 2, 3).
The infectivity of AIV in water samples was quantified and we have obtained the following results: at
80
the 4oC, the viability of the approximate 104
TCID50/0.1 ml of NIBRG-14 virus in river, lake and
sea water was detected till 20 days p.i. and only 12
days at 22oC and 35oC; the persistence of 104
TCID50/0.1 ml of NIBRG-14 virus was highest at 4oC
in sterile PBs, finding 103 TCID50 at 12 days p.i.,
102.5 TCID50 at 20 and 34 days p.i., 101.5 TCID50 at
57 days p.i., 100.8 TCID50 at 77 days.
In a series of preliminary experiments we have
tested the impact of a larger group of disinfectants on
AIV survival in laboratory condition, using PBs: chlorine and chlorine compounds containing 2.5 g sodium dichloroisocyanurate (NaDCC); oxidizing agents:
pentapotassium bis(peroxymonosulphate) bis(sulphate); alcohols: ethanol and different concentrations
of isopropanol; aldehydes: glutaraldehyde. The efficacy of chlorine compounds and alcohol disinfectants tested was influenced by virus titers and temperature, the virus being recovered after 2 or 3 passages on embryonated hen eggs. Only two groups of
disinfectants (oxidizing agents and aldehydes) proved
to be effective in inactivation of NIBRG 14 reasortant, in PBs.
The impact of the disinfectants on the AIV, loss
or maintaining virus infectivity of the vaccine strain
in PBs is presented in the Table 2. The results revealed that NIBRG - 14 can be inactivated by disinfectant 0.5- 2% concentration. An effective inactivation
has been shown by glutaraldehyde and pentapotassium bis(peroxy mono sulphate), even at 4oC if the
time was prolonged at 20’ to 30’.
Action of 2% glutaraldehyde. The final concentration of 2% glutaraldehyde was chosen to test its
effectiveness on inactivation of virus reassortant, in
two surface water samples: river and lake water, having 3.58 mg/ml protein content and 25.5 mg/ml,
respectively. The first one had a neutral pH (7.2) and
the second had a basic pH (9.6). The action of 2%
glutaraldehyde on virus reassortant inactivation was
influenced by the environmental temperature, the
4
TCID 50
3.5
3
2.5
2
1.5
1
0.5
0
0
3
12
20
34
57
77
days post infection
fresh water
brackish water
sea water
PBS
Fig. 1. Survival of NIBRG -14 in natural water
and PBS, at 4 - 8oC temperature
5
4.5
4
3.5
TCID 50
DISCUSSIoN
Our results confirmed that the viability of the
virus in river, lake and sea water, varies with temperature: the virus survived 12 days at 22oC and 35oC,
and 20 days at 4°C. A significant decrease was recorded for sea water, between 3 and 12 days at 35oC. A
virus survival of at least 77 days in PBs was recorded
at 4oC. The time survival was much shorter comparative with a long persistence of wild-type AIV infectivity - ranging from 126 to 207 days at 17oC and from
30 to 102 days at 28oC - [7]. Another study showed
that an avian H5N1 virus isolated in Pakistan (2006)
could survive more than 100 days at 4oC, but was
inactivated after 24 h at 28oC [13].
In our study, disinfectants selection was based
on several factors, such as: virus characteristics, method of action, cost and toxicity. According to Noll
and Youngner (1959) viruses can be grouped into
three categories (A, B, C) on the basis of their resistance to chemical agents. Viruses including AIV, of
intermediate to large size, that possess lipoprotein
envelopes and are highly susceptible to many disinfectants belong to group A. Nonenveloped viruses that
are capable of adsorbing some lipids but are intermediate in their pattern of susceptibility to disinfectants belong to group B. small nonenveloped viruses
that are resistant to lipophilic disinfectants belong to
group C. Many authors have reached the same conclusion regarding the susceptibility of viruses to chemical agents, i.e. the presence of lipids is associated
with a high susceptibility to all disinfectants (Klein and
Deforest, 1965, 1983; evans et al., 1977; scott, 1979;
Maris, 1986, 1990). Disinfectants active against AIVs
can be grouped into soaps and detergents, alkalis,
acids, chlorine and chlorine compounds, oxidizing
5
4.5
3
2.5
2
1.5
1
0.5
0
0
3
12
20
days post infection
fresh water
brackish water
sea water
PBS
and PBS, at 22oC temperature
5
4.5
4
3.5
TCID 50
concentration of infectious virus and the characteristics of water. The efficacy of 2% glutaraldehyde estimated after 10 min contact time with disinfectants
on natural water infected with NIBRG-14 reassontant
virus is presented in Table 3
efficiency of glutaraldehyde is maximum at
35°C, except for the highest virus concentration (1.4
x 106 TCID50) in lake water; the live virus was detected by qRT-PCR on MDCK cells after 40 h p.i. At the
same viral concentration, the reassortant virus has
survived at 22°C, irrespective of the water type.
Instead, at 4°C, efficiency of glutaraldehyde was low:
only the lowest viral load (1.4 x 101 TCID50) was
completely destroyed, in 10 min., while reassortant
virus at an average concentration (1.4 x 104 TCID50)
has survived in lake water and PBs.
3
2.5
2
1.5
1
0.5
0
0
3
12
20
days post infection
fresh water
brackish water
sea water
PBS
and PBS, at 35oC temperature
81
MIHAI et al.
Table 2. The efficacy of disinfectants used in the study on different titers
of NIBRG 14 (H5N1) at different temperatures (in PBS)
Disinfectant
concentration/temperature/
time exposure
Group
Oxidizing agents
(Virkon® )
0.5%, 1%, 2% (w/v)
4 oC; 22 oC; 35 oC
10!; 20!, 30!; 60!
Aldehydes
(glutaraldehyde)
0.73 %, 1.1 %
4 oC; 22 oC; 35 oC
10!; 20!; 30!
Virus titer
to be
inactivated
5.5
5 x10
Outcomes
Loss of virus infectivity*,
except 40C, 10! time
of contact with disinfectant
EID50/ml
Loss of virus infectivity,
except 40C, 10! time
of contact with disinfectant
at 0.73 % concetration
5 x104 EID50/ml
* Loss of virus infectivity: after 2 or 3 passages in embryonnated hen eggs, the allantoic/amniotic fluids shown a lack of
HA activity of 0.5% suspension of turkey erytrocytes.
agents, aldehydes, phenol compounds, quaternary
ammonium compounds and alcohols (Maris, 1995;
Ausvetplan, 2005). Most disinfectants have the optimum of efficacy at temperatures above 20oC (Meroz
and samberg, 1995), indicating that environmental
temperature is an extremely important factor in influencing the efficacy of disinfection procedures in the
field [14]. Disinfectants based on chlorine compounds
and alcohol were proved to reduce viral load, but did
not completely destroy the virus. An effective inacti-
vation has been shown by glutaraldehyde and pentapotassium bis(peroxymonosulphate) bis(sulphate).
We infected river water and standing water, the first
type of water having a low protein content (3.58 mg/ml)
and a neutral pH (7.2), the other one a high protein
content (25.5 mg/ml) and a basic pH (9.6). In our hands
the virus was recovered only from the lake water at
35oC, suggesting the decrease of glutaraldehyde efficacy by organic materials, as previously reported by
other authors [14].
Table 3. Action of 2% glutaraldehyde on natural water infected
with different concentrations of reasortant
Type
of the water
Concentration
of the virus
6
1.4x10 TCID
River water
4
o
o
o
4-8 C
22 C
35 C
Negative
Negative
Positive
Positive
Positive
Positive
Positive
Positive
Positive
Negative
Negative
Negative
Negative
Positive
Positive
Positive
Positive
Positive
Negative
Negative
Positive
Negative
Positive
Positive
Positive
Positive
Positive
50
1.4x10 TCID
1
40 h p.i.
50
1.4x10 TCID
50
6
1.4x10 TCID
Lake water
4
50
1.4x10 TCID
1
50
1.4x10 TCID
50
6
1.4x10 TCID
PBS
4
50
1.4x10 TCID
1
50
1.4x10 TCID
50
Positive - lack of viral propagation
Negative - presence of viral propagation
82
The efficacy of glutaraldehyde in destroying
virus infectivity is related to environmental temperature. In this experiment, at 4oC, glutaraldehyde 2%
final concentration and 10 min time of contact, was
not efficient for inactivation of 1.4 x 106 TCID50/ml
virus in different types of water.
Other disinfectants evaluated, including Virkon-s,
CID-20 (disinfectant based on 5.8% glutaraldehyde,
quaternary ammonium, formaldehyde, alcohol) were
effective in completely destroying H5N1 virus at 1%
disinfectant dilutions after 15 min at 28oC [13]. Disinfectant induced inactivation of AIV has been reported
by various researchers all over the world [15, 16].
The effectiveness of disinfectant has been
assessed by estimation of RNA quantity (copies/ml) in
supernatants of cell culture harvested postinfection
(p.i.). These results were compared with the initial
number of copies detected in treated sample, before
inoculation on MDCK cell culture. Because quantitative RT-PCR (qRT-PCR) does not distinguish between
infectious and noninfectious particles, we tested supernatants harvested at 40 hours p.i. knowing that
after approximately 5 h p.i. newly produced virus particles are released into the extracellular medium [17].
estimation of surviving particles of influenza
virus in tissue culture by qRT-PCR method at 40 hours
p.i. presented an advantage vs. classical methods in
terms of time. This study was based on the multiplication of viable particles on MDCK cells and their
quantification by nucleic acid amplification reactions
(RT-PCR), other methods quantify the virus present in
water by RT-PCR after its concentration on the erythrocytes [18].
In this experiment one limitation was that all
data were collected under experimental condition,
on non-pathogenic reassortant of H5N1.
CoNCLUSIoNS
The influenza virus persistence in natural waters
is closely related to temperature, and is inversely proportional. Long persistence of AIV, at low temperatures, may be a source of infection and domestic
poultry should not be allowed to share a common
water source with free-wild aquatic birds.
Based on non-pathogenic avian reassortant
model, our results suggest that the avian influenza
virus in experimental condition might be sensitive to
glutaraldehyde and oxiding agents (Virkon® ), being
in agreement with other studies. Glutaraldehyde efficiency was proved to be less at low temperature but
increases at higher temperature.
Our results would be helpful in implementation
of biosafety measures against AIV in laboratory and
farms.
ACKNoWLEDGEMENTS
Funding for this work was provided by the
RIVeRs project: ssPe-CT-2006-44405.10.1016/j.jviromet.2006.11.037
REFERENCES
1. Centre for Disease Control and Prevention. Update. Isolation of avian influenza A(H5N1) viruses from humans
- Hong Kong, 1997-1998. Morb.Mortal wkly rep.
1998; 46(52): 1245-1247.
2. oprişan, G., Coste, H., Lupulescu, E., oprişoreanu,
A.M., Szmal, C., onita, I., Popovici, N., Ionescu, L.E.,
Bicheru, S., Enache, N., Ceianu, C., Czobor, F., olaru,
E., Alexandrescu, V., Radu, D.L., onu, A., Popa, M.I.
Molecular analysis of the first avian influenza H5N1 isolates from fowl in Romania. Roum. Arch. Microbiol.
Immunol, 2006, 65 (3-4): 79-82.
3. Avian influenza H5N1 outbreaks in Romania and Danish poultry, a large H5N1 cluster in Indonesian family.
eurosurveillance, Vol.11, Issue 21, 25 May 2006.
4. Reid S.M., Shell W.M., Barboi G., Ionita I., Turcitu M.,
Cioranu R., Marinova-Petkova A., Goujgoulova G.,
Webby R.J., Webster R.G., Russell C., Slomka M.J.,
Hanna A., Banks J., Alton B., Barrass L., Irvine R.M. and
Brown I.H. First reported incursion of high pathogenic
notifiable avian influenza A H5N1 viruses clade 2.3.2
into european poultry. 2010; transboundary and
emearging
Doseases.
Doi:
10.111/j.
18951682.2010.01175.x.
5. T.Ito, K. okazaki, Y. Kawaoka, A. Takada, R.G. Webster
and H.Kida. Perpetuation of influenza A viruses in
Alaskan waterfowl reservoirs. arch virol (1995) 140:
1163-1172.
6. Brown, J.D., Swayne, D.E., Cooper, R.J., Burns, R.E.,
Stallknecht, D. E. Persistence of H5 and H7 Avian
Influenza Viruses in Water.avian Diseases, 2007,
51:285-289.
7. Stallknecht, D.E., Shane, S.M., Kearney, M.T., Zwank,
P.J. Persistence of Avian Influenza Viruses In Water.
avian Diseases, 1990, 34: 406-411.
8. Stallknecht, D.E., Kearney, M.T., Shane, S.M., Zwank,
P.J. effects of pH, Temperature, and salinity on
Persistence of Avian Influenza Viruses In Water. avian
Diseases, 1990, 34: 412-418.
9. Reed, L.J., & Muench, H. A simple method of estimating
fifty percent endpoints. am. J. Hygiene, 1938, 27, 493497.
10. Lowry, o. H., Rosebrough, N. J., Farr, A. L., and
Randall, R. J. Protein measurement with the Folin phenol reagent. J. biol. chem., 1951, 193: 265-275.
83
MIHAI et al.
11. WHO Manual on Animal Influenza Diagnosis and
surveillance. WHO/CDs/CsR/NCs/2002.5.
12. standards Unit. evaluations and standards Laboratory,
UK, european real-time RT-PCR for influenza A H5
viruses, 2006, Issue no:1.1. Ref: VsOP 46i 1.1.
13. Akbar Shahid, M., Abubakar, M., Hameed, S., Hassan,
S. Avian influenza virus (H5N1): effects of physic-chemical factors on its survival. virology Journal, 2009,
6:38 doi: 10.1186/1743-422x-6-38.
14. De Benedictis, P., Beato, M.S., Capua, I. Inactivation
of Avian Influenza Viruses by Chemical Agents and
Physical Conditions: A Review. Zoonoses public
Health, 2007, 54(2007) 51-68.
15. Lucio-Forster, A.,Bowman, D.D., Lucio-Martinez, B.,
Labare, M.P., Butkus, M.A. Inactivation of the Avian
Influenza Virus (H5N2) in Typical Domestic Wastewater and Treatment systems. short Communication.
environmental engineering Science, 2006, 23 (6) 897903.
16. Muhmmad, K., Das, P., Yaqoob, T., Riaz, A., Manzoor,
R. effect of Physico-chemical Factors on survival of
Avian Influenza Virus (H7N3 Type). international
Journal of agriculture & biology. 2001,4: 416-418.
17. Sidorenko Y, Reichl U. structured model of influenza
virus replication in MDCK cells. biotechnology and
bioengineering, 2004, vol. 88, 1.
18. Dovas, C.I., Papanastassopoulou, M., Georgiadis, M.P.,
Chatzinasiou, E., Maliogka, V.I., Georgiades, G.K.,
2010. Detection and Quantification of Infectious Avian
Influenza A (H5N1) Virus in environmental Water by
Using Real-Time Reverse Transcription-PCR. applied
and environmental Microbiology, 2010, 76(7), p.
2165-2174.
84
NeW INTeRFeRONs IN THe TReATMeNT
OF CHRONIC HePATITIs C
Simona Ruþã1,2* and Costin Cernescu2
1carol
Davila university of Medicine and pharmacy, bucharest, romania
S Nicolau institute of virology, bucharest, romania
2Ştefan
ABsTRACT
The current standard therapy for chronic HCV infection is a combination of pegylated–interferon
(PeG–IFN) and weight-based ribavirin, administered for 24-48 weeks, according to the viral genotype. Although the weekly administration of pegylated interferons provides superior antiviral efficacy over standard interferon alpha, the rate of sustained virological response rarely overpasses
50% in patients infected with HCV genotypes 1 and 4. Consequently, multiple clinical trials with
congeners of interferon (consensus interferon, interferon lambda, albinterferon, and controlledrelease interferons) are ongoing. Their main advantages consist in maintenance of viral suppression
across a longer dosing interval, avoidance of interdose trough and reduced dosing frequencies
(twice or even once per month compared to once per week for the actual PeG-IFNs). Along with
these superior pharmacokinetic properties, new interferons are expected to have improved sideeffect profiles and better tolerability compared with the currently available formulations, providing
an option for otherwise difficult to treat, challenging populations. New interferon formulation can
be incorporated into future combination with direct acting antivirals, in order to maintain viral suppression over longer periods and minimize the development of viral resistance.
Keywords: hepatitis C treatment, pegylated interferons, albumin interferon, consensus interferon, lambda IFN,
controlled - release interferons
BACKGRoUND
The Evolution of Chronic Hepatitis C Treatment
The goal of chronic hepatitis C treatment is to
achieve viral eradication, reflected by a sustained
virological response (sVR)- defined as undetectable
HCV RNA at 6 months after treatment completion.
Long-term follow-up studies have shown that a sVR
is associated with durable suppression of viral replication and improvements in liver histology [1]. The
first attempts to treat hepatitis C were made almost 25
years ago with a small trial of recombinant human
interferon alpha [2]. Despite the overall poor response
rate, the multiple adverse effects and the high cost,
interferon (IFN) was approved for use in hepatitis C
treatment in 1992 in both United states and europe.
The addition of Ribavirin (RBV), a guanosine analogue that increases the viral mutagenesis rate [3],
conducted to an increased rate of therapeutical success in terms of virological, histological and bioche-
mical parameters [4]. A third advance in the therapy
of hepatitis C came with the introduction of pegylated
forms of interferon (PeG-IFN)-approved in United
states in 2001 - with longer half-life, that allowed for
a more convenient once-weekly administration, compared to the usual 3 times per week scheme used for
IFN alpha [5]. The current standard of care for the
treatment of HCV infection is a combination of
PeG-IFN and weight based RBV, administered for a
standard duration of 24-48 weeks, which improved
the overall rate of sVR to 54-63%, significantly higher
compared with the modest rates of 6-12% with IFN
monotherapy or 38-42% with conventional IFN and
RBV [6]. Further refinement of this therapy conducted
to tailored therapies, based on the baseline viral and
histological characteristics and the speed of the virological responses after treatment initiation. HCV
genotypes 2 and 3 (considered as “easy to treat”), low
pretreatment HCV viral load and absence of fibrosis
are important baseline predictors of treatment suc-
*corresponding author: simona Ruþã - Address: Ştefan s Nicolau Institute of Virology, 285, Şos. Mihai Bravu, 030304, Bucharest, Romania;
Tel./fax: 40213242590; e-mail: [email protected]
85
RUþã and CERNESCU
cess. The on-treatment viral kinetics, assessed at week
4 (rapid virological response), 12 (early virological
response) and 24/48 (end of treatment) allowed for a
response-guided therapy. Basically, the more rapidly
HCV RNA becomes negative during treatment, the
higher is the rate of sustained viral suppression.
Obtaining a rapid virological response (RVR)-defined
as undetectable HCV RNA at week 4 of treatmentaccurately predicts a sVR. Conversely, treatment failure is predicted by the absence of an early virological response (complete eVR: undetectable HCV RNA
at week 12; partial eVR: decrease of HCV RNA by
more than 2 log10 from baseline values at week 12).
Consequently, treatment duration can be reduced
from 24 to 12 weeks for genotypes 2/3 infected
patients who obtain an RVR, or from 48 to 24 weeks
for genotype 1 infected patients, with low pretreatment viral load, who attain a RVR. On the contrary,
treatment may be extended to 72 weeks for genotype
1 infected patients who show a slow virological
response-with partial eVR and HCV RNA negative by
Week 24 [7, 8]. Recently, another step towards an
Figure 1. The interferon signaling cascade.
schematic illustration of the Jak-sTAT-dependent pathways
activated by IFNs. IFN binding to its specific receptors
(IFN-R 1 and 2) is followed by recruitment of Janus kinases
(Jak) and subsequent phosphorylation of the signal transducer and activator of transcription (sTATs), that form the
IsGF3 complex (consisting of sTAT1, sTAT2, and IRF-9interferon responsive factor 9). This is translocated to the
nucleus to bind to specific sequences in the promoter of
target genes, inducing transcription of IFN-stimulated genes
(IsGs), that mediate the biological effects of IFNs.
86
individualized therapy in hepatitis C has been made,
as a host related parameter- IL28B genotype- has
been identified as a strong predictor of sVR with PeG
IFN/RBV [9]. Moreover, a huge effort is dedicated to
the introduction of specifically targeted antiviral therapies for HCV (sTAT - C drugs). A number of novel
compounds, especially those directed against the
Ns3 -Ns4A serin-protease and against the Ns5B
polymerase of HCV are in advanced clinical trials.
Two protease inhibitors, Telaprevir (INCIVeKTM,
developed by Vertex Pharmaceuticals) and Boceprevir
(VICTReLIsTM, developed by schering Plough/Merck)
have been approved by the FDA for clinical use in
May 2011. Triple therapy with a protease inhibitor
associated with PeG IFN and RBV was shown to
increase significantly the success rate in treatmentnaive and experienced patients infected with HCV
genotype 1 [10, 11, 12].
INTERFERoN’S MECHANISM oF ACTIoN
Interferon alpha (IFN-a) is a cytokine with antiviral, immunomodulatory and anticellular activities
(table 1), mediated by the transcriptional regulation
of interferon stimulated genes (IsGs). IFNs are naturally produced during infection by HCV and other viruses. Recognition of a virus’ molecular patterns, by
Toll-like receptors or cytoplasmic receptors such as
retinoic acid-inducible gene 1 protein (RIG-I) triggers
a signaling cascade, leading to activation of a transcription factor - namely interferon regulatory factor3 (IRF-3), that in turns induces expression of a/b IFNs
[13]. Upon binding to its specific receptor, the IFN
alpha triggers the activation of the canonical Janus
kinase (Jak) - signal transducer and activator of transcription (sTAT) pathway [14]. This conducts to the
formation of the IsGF3 complex (consisting of sTAT1,
sTAT2, and IRF-9-interferon responsive factor 9), that
bind to the interferon stimulated response element
(IsRe) (figure 1), within the promoter region of IsGs
[15]. Induction of IsGs expression (such as 2’-5’ oligoadenylate synthetase, RNase L, double-stranded
RNA dependent protein kinase), generates an antiviral resistance state within the neighboring cells, by inhibiting the translation of viral proteins and decreasing the stability of HCV RNA, thus limiting viral replication and spreading, and indirectly modulating the
maturation of the adaptive immune response [16]. Recombinant IFN-a, used with RBV in the treatment of
chronic hepatitis C has identical mechanisms of action
with that of endogenous IFNs, but attains higher in vivo
concentration and therefore, has higher antiviral efficacy [17].
New interferons in the treatment of chronic hepatitis C
Table 1. Interferon - HCV interaction
Multiple additional signals generated by IFNs
have been characterized, showing that members of
the p38 mitogen-activated protein kinase and protein
kinase C families of proteins, together with various
small GTPases are also needed for transcription of
IsGs, via distinct mechanisms [18]. Further complicating the overall picture, several subtypes of IFN-a (12
proteins encoded by 14 genes) and many allelic variants have been described [19]. Using subgenomic
replicons it has been demonstrated that each IFN subtype displays a unique activity profile, with IFN-a8
being the most effective inhibitor of intracellular HCV
replication; an effect exerted mainly through JAKsTAT-independent pathways [20]. In the recently developed HCV cell culture system that uses a JFH-1 genotype 2a strain of HCV, IFN-a17 displayed the highest anti-HCV activity [21]. The emerging evidence
from all these discoveries suggests that cooperation
among multiple pathways is essential for the induction of IFN responses.
HCV developed a series of mechanism to evade
the innate antiviral responses (table 1). These include
blocking of the activation of both PKR and IRF-1/IRF1-mediated transcriptional activation by the HCV
Ns5A protein [22], as well as disruption of IRF-3 activation by the Ns3/4A protease, which targets and
cleaves IPs-1 and antagonize RIG-I signaling [23]. It
is hoped that the use of HCV protease inhibitors will
also lead to a restoration of the cellular antiviral responses mediated by IRF-3 and a sustained IsG
expression, providing increased antiviral potency
against HCV.
The Additive Role of Ribavirin
During IFN-a-based therapy, HCV RNA levels
generally fall in a biphasic manner. The first phase of
viral suppression, that starts a few hours after IFN
alpha administration, is related to the direct inhibition of viral replication; its slope is dependent on the
viral particles’ clearance rate [24]. The second, slower
phase of viral suppression begins on day 2 after treatment initiation and is an excellent predictor of treatment response [25]. It is related to the gradual destruction of the infected cells by the patient’s immune
system, as shown by the marked increase in HCVspecific T-cell reactivity during antiviral therapy. Ribavirin exerts its additive effect on this phase, augmenting or amplifying the effect of IFN (table 2).
There is increasing evidence (mostly derived from the
recent clinical trials with protease inhibitors) of RBV
acting as a true antiviral agent and thus having a critical role in the suppression of viral replication and
prevention of virological relapse [4, 10, 11].
CURRENTLY AVAILABLE RECoMBINANT INTERFERoNS IN THE TREATMENT oF HCV INFECTIoN
Pegylated Interferons
There are two FDA and eMeA approved formulas of pegylated interferons (PeG-IFN): PeG-IFN alfa-
Table 2. Ribavirin’s mechanisms of action in HCV infection
87
RUþã and CERNESCU
2a (PeGAsYs, manufactured by Hofmann La-Roche)
and PeG-IFN alfa-2b (PeG-Intron, manufactured by
schering–Plough/Merck), that diverge in size, in the
type of polyethylene glycol (PeG) molecule and in
the type of attachment. standard interferon alfa-2a is
covalently linked to a 40-kDa branched PeG molecule in the PeG-IFN alfa-2a and to a 12-kDa linear
PeG molecule in PeG-IFN alfa-2b. These structural
differences are responsible for the differences in the
pharmacokinetic and pharmacodynamic parameters
of the two formulas [26], summarized in table 3. Due
to the distinct volume of distribution, PeG-IFN alpha2a is administered in a fixed dose (180 mg one
weekly), while PeG-IFN alpha-2b is given according
to body weight (1.5 mg/kg once weekly, with possible
adjustments at 1.0 mg/kg once patients became negative for HCV RNA) [27]. There is a significant sideeffect profile associated with PeG-IFNs. Main adverse
effects are influenza-like (fatigue, headache, fever
and rigor), psychiatric (depression, irritability, and insomnia), hematologic (anemia in around 30% of cases,
neutropenia in 18-20% of cases and trombopenia),
dermatologic (alopecia, dermatitis), neurologic (cognitive dysfunction), immunologic (hypo/hyperthyroidism), gastrointestinal (nausea, diarrhea), pulmonary
(cough, dyspnea), cardiovascular (cardiomyopaty) and
ocular (retinal abnormalities) [28]. Current evidence
does not allow for a definitive recommendation of
one of the two forms of pegylated interferons. The results of a large randomized clinical trial - IDeAL (Individual Dosing efficacy versus Flat Dosing to Assess
Optimal Pegylated Interferon Therapy) suggested that
that the two available products are comparable in
both benefits and harms [29], however, the existence
of important differences between the study arms (in
terms of starting doses of ribavirin and the protocols
for dose reductions in case of side effects) preclude a
final conclusion. On the other hand, a systematic review of head-to-head randomized trials designed to
assess the benefits and harms of the two forms of
treatment, suggests that PeG-IFN alpha-2a may be
associated with an incresed benefit in terms of sustained virological response compared to PeG-IFN
alpha-2b, nevertheless, the two products seem to be
comparable in terms of adverse effects leading to
treatment discontinuation [30]. As long as early and
sustained virological response are only surrogate markers of clinical outcomes (liver failure, hepatocellular
carcinoma and mortality) and the data on the long
term adverse effects are limited, both regimens seems
to be equally effective in clinical practice.
Consensus Interferon
Interferon Alfacon or consensus interferon (CIFN)
(INFeRGeN®, Three Rivers Pharmaceuticals, LLC) is a
recombinant, bioengineered interferon, consisting of
the most frequently observed amino acid in each corresponding position in the natural alpha interferons.
It shares an 89%, 30% and 60% homology with IFN
alpha, IFN beta and IFN omega, respectively. The CIFN
molecule binds to the interferon-alpha receptor with
the highest affinity of all known interferon-alpha molecules (including the natural subtypes, the variants or
recombinants). in vitro it appears to be approximately
5 to 20-fold more active than any other interferon
including PeG-IFN alfa-2a and alfa-2b [31]. While it
still requires dosing either once daily or 3 times
weekly, consensus interferon has stronger ability to
induce the expression of IsGs compared to PeG-IFN
and may provide a therapeutic benefit by restoring
the function of the RIG-I pathway and amplifying
endogenous IFN production. Data derived from clinical trials support the use of CIFN for treatment-naïve
patients, particularly those with high viral loads or genotype 1 infection [32], as well as in the retreatment
of relapsers and nonresponders [33, 34]. Clinical trials
suggested a dose-dependent rate of viral clearance,
however the maximum tolerated dose of daily CIFN
in difficult-to-treat patients is up to 15 mg/day. Administration of an induction dose (up to 18 mg/day) or of
Table 3. Different characteristics of the two available PEG IFNs (reference 26)
88
a higher dose (24 mg/day), did not translate to better
rates of sVRs and was limited by dose reductions and
discontinuations due to adverse events, especially
higher grades of leucopenia [35]. Consensus interferon is approved as monotherapy for chronic HCV in
adults with compensated liver disease, and, from
2010, for retreatment of chronic hepatitis C, in combination with ribavirin, being especially effective for
interferon-sensitive patients with lower baseline
fibrosis scores.
NEW INTERFERoNS FoRMULATIoNS
strategies for the development of new interferons (table 4) include IFN preparations with either improved pharmacokinetic profiles (albinterferon and
interferon controlled - release systems) or improved
side - effect profiles (interferon lambda).
IFN Formulations With Improved Pharmacokinetic Profiles
Albinterferon alpha 2b (ZALBIN®, Human Genome sciences/ known in europe as JOULFeRON®,
Novartis) is a long-acting IFN, that can be administered once or twice monthly. It consists of interferon
alfa-2b genetically fused to recombinant human albumin in a 85.7-kilodalton molecule, with an estimated
half-life of 150 hours. While standard IFN reaches
peak levels shortly after administration, followed by a
rapid decline to undetectable levels at the end of
each dosing interval, albinterferon provides sustained
exposure to interferon, by ensuring a low peak-to-
trough concentration ratio [36]. In phase 3 trials, in
patients with either genotype 1 or genotypes 2/3
chronic HCV infection, albinterferon (900 mg every 2
weeks) achieved noninferiority compared with
pegIFN alfa-2a, indicating that the two drugs are
equivalent [37, 38]. However, licensure of this dosing
regimen is unlikely, due to the unfavorable risk- benefit profile, mainly caused by slightly increased rates
of serious pulmonary adverse effects, coughing and
alopecia compared to PeG-IFN. Development of a 4
weeks dosage is undergoing.
Controlled-release recombinant interferon systems were designed to improve the pharmacokinetics
of recombinant IFNalfa-2b, in order to maintain continuous drug levels and consequently minimize the
side effects.
Locteron®, (Biolex Therapeutics/OctoPlus) is a
recombinant nonglycosylate IFN alpha-2b produced
in polyether-ester microspheres. This steady controlled-release formulation avoids fluctuation in IFN levels. A pilot study reported that after injection of
320 mg Locteron, the concentration of serum IFN
remained elevated through 14 days [39]. Locteron
can be administered twice monthly, with its trough
concentration between doses maintaining adequate
antiviral activity. Preliminary results of Phase 2b studies, showed that in treatment-naive patients, Locteron, in combination with ribavirin, produced similar
viral suppression to that of PeG-IFN/RBV [40], with
fewer flu-like side effects and substantially lower
rates of depression.
Table 4. New interferons in the treatment of Chronic Hepatitis C (see reference1)
89
RUþã and CERNESCU
IFN XL (Flamel Technologies) is an extra long
controlled-release formulation of recombinant IFN
alpha-2b, based on the nanoparticles Medusa delivery system. It has a slow, sustained release, with
increasing antiviral efficacy [41]. In a phase 1 study,
IFN-alpha 2b xL induced greater reduction in viral
load after two weeks and fewer adverse events compared to PeG IFN [42]. A Phase 2a study designed to
evaluate IFN-alpha-2b xL in combination with ribavirin in naïve and previous HCV non-responders to
standard interferon therapy is ongoing.
omega interferon is a type 1 interferon delivered with an osmotic minipump - Omega DUROs®
(Intarcia Therapeutics, Inc.) - implanted subcutaneously. This device is designed to release a continuous dose of omega interferon at a constant rate for
3 months [43].
Other tentative approaches include the evaluation of low-dose human interferon-alpha administered by oral mucosal route, as lozenges (Amarillo
Biosciences, Inc.) for prevention of relapse in hepatitis C; as well as the design of enteric coated tablets
containing variants of IFN-alpha, with a single point
mutation that confers lower sensitivity to proteasemediated degradation (Belferon, Nautilus Biotech).
IFN Preparations With Improved Side - Effect
Profiles
IFN lambda (IFN-a) is a type III interferon, comprising of IL28A, Il28B and IL29. These 3 interleukines
are part of a recently discovered class II cytokine family that display similar properties to type I IFNs,
signaling through the JAK-sTAT pathway and upregulating the expression of genes involved in controlling
viral replication and cellular proliferation [44].
However, IFN-a has a complex binding, mainly
through the IL28 receptor, which is present only on
plasmacytoid dendritic cells, peripheral B cell epithelial cells and hepatocytes. This restricted receptor distribution, compared to that of IFN alpha receptors’,
offers interferon lambda a better tolerability and
safety profile, especially in terms of bone marrow
suppression [45]. Recombinant IFN lambda has previously demonstrated strong antiviral activity and
good tolerability, enhancing the sub-saturating levels
of IFN-a and providing additive therapeutical effects
[46]. Interferon lambda has been pegylated (Zymogenetics/Bristol-Myers squibb); its administration in treatment-naive patients chronically infected with HCV
genotypes 1/2/3/4 resulted in significantly higher
rates of rapid and early virological responses [47]. IFN
lambda might prove to be increasingly important for
the treatment of chronic hepatitis C, due to the recent
90
findings regarding the impact of host genetics in the
response to therapy. several genome-wide association
studies have shown that variations in the IL28B gene
(part of the gene-complex encoding for IFN lambda)
are major predictors of both treatment response [9,
48, 49] and natural viral clearance in HCV infection
[50]. The favourable CC polymorphism is most frequently encountered in Asians and least frequently in
African-Americans, a fact that can explain the differences in the treatment response between races [9,
51]. Together with other information on virus genotype, viral load, the degree of fibrosis and the presence of comorbidities, host genetic variations may
become critical in establishing the individual appropriate treatment doses and duration.
CoNCLUSIoNS
New therapeutical approches are developed for
chronic hepatitis C, due to the increasing number of
non responders and relapsers to the current standard
of care, as well as to the important side-effects associated with both PeG- IFN and ribavirin. The direct
acting antivirals targeting HCV protease and polymerase will still require a backbone of interferons
and ribavirin in order to avoid emergence of resistant
viral strains and subsequent virologic breakthrough.
New interferons are currently being developed to offer
enhanced activity, continuous controlled drug-release
through IFN-delivery systems and better safety profiles. Although to-date the new interferon formulation
have not shown superior efficacy compared to PeG
IFN in naïve patients, they may still be helpful for the
management of nonresponders and relapsers to current therapies, as well as for challenging population
(HIV-HCV coinfected or transplanted patients).
REFERENCES
1. Dieterich DT, Rizzetto M, Manns MP. Management of
chronic hepatitis C patients who have relapsed or not
responded to pegylated interferon alfa plus ribavirin. J
viral Hepat 2009. 16:833–843.
2. Hoofnagle JH, Mullen KD, Jones DB, Rustgi V, Di
Bisceglie A, Peters M, Waggoner JG, Park Y, Jones EA.
Treatment of chronic non-A,non-B hepatitis with recombinant human alpha interferon. A preliminary report. N
engl J Med. 1986. 15(25):1575-1578.
3. Crotty S, Maag D, Arnold JJ, Zhong W, Lau JY, Hong Z,
Andino R, Cameron CE. The broad-spectrum antiviral
ribonucleoside ribavirin is an RNA virus mutagen. Nat
Med. 2000. 6(12):1375-1379.
4. Feld JJ, Hoofnagle JH. Mechanism of action of interferon
and ribavirin in treatment of hepatitis C. Nature. 2005.
436(7053):967–972
5. Manns MP, McHutchison JG, Gordon SC, Rustgi VK,
Shiffman M, Reindollar R, Goodman ZD, Koury K, Ling
M, Albrecht JK. Peginterferon alfa-2b plus ribavirin
compared with interferon alfa-2b plus ribavirin for the
treatment of chronic hepatitis C: a randomised trial.
lancet. 2001.358:958-965.
6. Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos
G, Gonçales FL Jr, Häussinger D, Diago M, Carosi G,
Dhumeaux D, Craxi A, Lin A, Hoffman J, Yu J. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C
virus infection. N engl J Med. 2002.347:975-982.
7. Thomson BJ, Kwong G, Ratib S, Sweeting M, Ryder SD,
De Angelis D, Grieve R, Irving WL; Trent HCV Study
Group. Response rates to combination therapy for
chronic HCV infection in a clinical setting and derivation of probability tables for individual patient management. J viral Hepat. 2008.15:271-8.
8. Ghany MG, Strader DB, Thomas DL, Seeff LB; American Association for the Study of Liver Diseases. Diagnosis, management, and treatment of hepatitis C. Hepatology 2009. 49:1335-74.
9. Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV,
Urban TJ, Heinzen EL, Qiu P, Bertelsen AH, Muir AJ,
Sulkowski M, McHutchison JG, Goldstein DB. Genetic
variation in IL28B predicts hepatitis C treatment-induced
viral clearance. Nature 2009; 461:399-401
10. McHutchison JG, Manns MP, Muir AJ, Terrault NA,
Jacobson IM, Afdhal NH, Heathcote EJ, Zeuzem S,
Reesink HW, Garg J, Bsharat M, George S, Kauffman
RS, Adda N, Di Bisceglie AM; PRoVE3 Study Team.
Telaprevir for previously treated chronic HCV infection. N engl J Med. 2010. 362:1292–1303.
11. Poordad F, McCone J Jr, Bacon BR, Bruno S, Manns
MP, Sulkowski MS, Jacobson IM, Reddy KR, Goodman
ZD, Boparai N, DiNubile MJ, Sniukiene V, Brass CA,
Albrecht JK,Bronowicki JP; SPRINT-2 Investigators.
Boceprevir for untreated chronic HCV genotype 1 infection. N engl J Med. 2011. 364:1195-1206.
12. Bacon BR, Gordon SC, Lawitz E, Marcellin P, Vierling
JM, Zeuzem S, Poordad F, Goodman ZD, Sings HL,
Boparai N, Burroughs M, Brass CA, Albrecht JK, Esteban R; HCV RESPoND-2 Investigators. Boceprevir
for previously treated chronic HCV genotype 1 infection. N engl J Med. 2011. 364:1207-1217.
13. Pestka S, Krause CD, Walter MR. Interferons, interferon-like cytokines, and their receptors. immunol rev.
2004. 202:8-32.
14. Rawlings JS, Rosler KM, Harrison DA. The JAK/sTAT
signaling pathway. J. cell Sci. 2004. 117, 1281-1283
15. Horvath CM., Stark GR, Kerr IM, Darnell JE Jr. Interactions between sTAT and non-sTAT proteins in the
interferon-stimulated gene factor 3 transcription complex. Mol cell biol. 1996. 16: 6957-64
16. Thomas H, Foster G, Platis D. Mechanisms of action of
interferon and nucleoside analogues. J Hepatol. 2003.
39:s93–98.
17. Feld JJ, Hoofnagle JH. Mechanism of action of interferon and ribavirin in treatment of hepatitis C. Nature.
2005. 436:967-972
18. Samuel CE. Antiviral actions of interferons. clin
Microbiol rev. 2001.14:778–809.
19. Koyama T, Sakamoto N, Tanabe Y, Nakagawa M, Itsui
Y, Takeda Y, Kakinuma S, Sekine Y, Maekawa S, Yanai
Y, et al. Divergent activities of interferon-alpha subtypes against intracellular hepatitis C virus replication.
Hepatol res. 2006; 34:41–49.
20. Lohmann V, Korner F, Koch J, Herian U, Theilmann L,
Bartenschlager R. Replication of subgenomic hepatitis
C virus RNAs in a hepatoma cell line. Science. 1999;
285:110-113.
21. Dubois A, François C, Descamps V, et al. enhanced
anti-HCV activity of interferon alpha 17 subtype. virol
J. 2009; 6: 70-80.
22. Pflugheber J, Fredericksen B, Sumpter Jr R, Wang C,
Ware F, Sodora DL, Gale Jr. M, Regulation of PKR
and IRF-1 during hepatitis C virus RNA replication,
proc. Natl. acad. Sci. UsA. 2002. 99: 4650–4655
23. Foy E., Li K., Wang C, Sumpter Jr. R., Ikeda M, Lemon
SM, Gale Jr. M. Regulation of interferon regulatory
factor-3 by hepatitis C virus serine protease, Science
2003. 300: 1145-1148.
24. Neumann AU, Lam NP, Dahari H, Gretch DR, Wiley
TE, Layden TJ, Perelson AS. Hepatitis C viral dynamics
in vivo and the antiviral efficacy of interferon-alpha
therapy. Science 1998. 282: 103-107.
25. Zeuzem S, Herrmann E, Lee JH, Fricke J, Neumann
AU, Modi M, Colucci G, Roth WK. Viral kinetics in
patients with chronic hepatitis C treated with standard
or peginterferon a2a. Gastroenterology. 2001.120(6):
1438-1447.
26. Foster GR. Pegylated interferons for the treatment of
chronic hepatitis C: pharmacological and clinical differences between peginterferon-alpha-2a and peginterferon-alpha-2b.Drugs. 2010. 70(2):147-165.
27. Hoofnagle JH, Seeff LB. Peginterferon and ribavirin for
chronic hepatitis C. N engl J Med. 2006. 355:24442451.
28. Ferenci P. safety and efficacy of treatment for chronic
hepatitis C with a focus on pegylated interferons: the
backbone of therapy today and in the future.expert
Opin Drug saf. 2011 [epub ahead of print] PMID:
21345149
29. McHutchison JG, Lawitz EJ, Shiffman ML, Muir AJ,
Galler GW, McCone J, Nyberg LM, Lee WM, Ghalib
RH, Schiff ER, Galati JS, Bacon BR, Davis MN,
Mukhopadhyay P, Koury K, Noviello S, Pedicone LD,
Brass CA, Albrecht JK, Sulkowski MS; IDEAL Study
Team. Peginterferon alfa-2b or alfa-2a with ribavirin
for treatment of hepatitis C infection. N engl J Med.
2009. 361:580-593.
30. Awad T, Thorlund K, Hauser G, Stimac D, Mabrouk
M, Gluud C. Peginterferon alpha-2a is associated with
higher sustained virological response than peginterferon alfa-2b in chronic hepatitis C: systematic review of
randomized trials. Hepatology. 2010. 51:1176-84.
31. Blatt LM, Davis JM, Klein SB, Taylor MW. The biologic
activity and molecular characterization of a novel synthetic interferon-alpha species, consensus interferon. J
interferon cytokine res. 1996;16:489-499.
32. Sjogren MH, Sjogren R, Holtzmuller K, Winston B,
Butterfield B, Drake S, Watts A, Howard R, Smith M.
91
RUþã and CERNESCU
Interferon alfacon-1 and ribavirin versus interferon
alpha-2b and ribavirin in the treatment of chronic hepatitis C. Dig Dis Sci. 2005. 50:727-32.
33. Leevy CB. Consensus interferon and ribavirin in patients with chronic hepatitis C who were nonresponders to pegylated interferon alfa-2b and ribavirin. Digestive Diseases and Sciences. 2008. 53:1961-1966.
34. Gonzalez SA, Keeffe EB. Management of chronic hepatitis C treatment failures: role of consensus interferon.
biologics. 2009. 3:141-50.
35. Meyer DF, Tobias H, Min AD, Rajendra A, Zic I, Brettholz E, Clain DJ, Klion F, Bernstein D, Bodenheimer
HC. Retreatment of patients nonresponsive to pegylated interferon and ribavirin with daily high-dose consensus interferon. Hepat res treat. 2010. 537:827
36. Subramanian GM, Fiscella M, Lamousé-Smith A, Zeuzem S, McHutchison JG. Albinterferon alpha-2b: a genetic fusion protein for the treatment of chronic hepatitis c. Nat biotechnol. 2007.25(12):1411-1419.
37. Bain VG, Kaita KD, Marotta P, Yoshida EM, Swain MG,
Bailey RJ, Patel K, Cronin PW, Pulkstenis E, McHutchison JG, Subramanian GM. safety and antiviral activity of albinterferon alfa-2b dosed every four weeks
in genotype 2/3 chronic hepatitis C patients. clin Gastroenterol Hepatol 2008.6:701-706.
38. Nelson DR, Benhamou Y, Chuang WL, Lawitz EJ,
Rodriguez-Torres M, Flisiak R, Rasenack JW, Kryczka
W, Lee CM, Bain VG, Pianko S, Patel K, Cronin PW,
Pulkstenis E, Subramanian GM, McHutchison JG;
ACHIEVE-2/3 Study Team. Albinterferon Alfa-2b was
not inferior to pegylated interferon-a in a randomized
trial of patients with chronic hepatitis C virus genotype
2 or 3. Gastroenterology. 2010.139(4):1267-1276.
39. De Leede LG, Humphries JE, Bechet AC, Van Hoogdalem EJ, Verrijk R, Spencer DG. Novel controlled-release Lemna-derived IFN-alpha2b (Locteron): pharmacokinetics, pharmacodynamics, and tolerability in a
phase I clinical J interferon cytokine res. 2008.
28:113-22.
40. Lawitz E, Younossi Z, Mehra P, Rigney A, Krastev Z,
Tchernev K, Takov D, Long WA. sVR for Controlledrelease Interferon Alpha-2B (CR2b) +Ribavirin Compared to Pegylated Interferon Alpha-2B (PeG2b) +Ribavirin in Treatment-naïve Genotype-1 46th Annual
Meeting of the european Association for the study of
the Liver. Berlin, Germany. March 30-April 3, 2011,
Poster 444.
41. Soriano V, Peters MG, Zeuzem S. New therapies for
hepatitis C virus infection. clin infect Dis. 2009; 48.
313-320.
42. Modi AA., Hoofnagle JH. New therapies for hepatitis
C. Hepatology 2007. 46: 615–617
43. Melnikova I. Hepatitis C therapies. Nature reviews Drug
Discovery 2008. 7: 799-800.
44. Sheppard P, Kindsvogel W, Xu W, Henderson K,
Schlutsmeyer S, Whitmore TE, Kuestner R, Garrigues
U, Birks C, Roraback J, ostrander C, Dong D, Shin J,
Presnell S, Fox B, Haldeman B, Cooper E, Taft D,
Gilbert T, Grant FJ, Tackett M, Krivan W, McKnight
G, Clegg C, Foster D, Klucher KM. IL-28, IL-29 and
their class II cytokine receptor IL-28R. Nat immunol.
2003.4(1):63-68.
92
45. Witte K, Gruetz G, Volk HD, Looman AC, Asadullah
K, Sterry W, Sabat R, Wolk K. Despite IFN-lambda
receptor expression, blood immune cells, but not keratinocytes or melanocytes, have an impaired response
to type III interferons: implications for therapeutic
applications of these cytokines. Genes immun.
2009.10(8):702-714.
46. Pagliaccetti NE, Eduardo R, Kleinstein SH, Mu JX, i
Bandi P, Robek MD Mechanisms of signal Transduction: Interleukin-29 Functions Cooperatively with Interferon to Induce Antiviral Gene expression and Inhibit
Hepatitis C Virus Replication. J. biol. chem. 2008.
283: 30079-30089
47. Muir AJ, Shiffman ML, Zaman A, Yoffe B, de la Torre A,
Flamm S, Gordon SC, Marotta P, Vierling JM, LopezTalavera JC, Byrnes-Blake K, Fontana D, Freeman J,
Gray T, Hausman D, Hunder NN, Lawitz E. Phase 1b
study of pegylated interferon lambda 1 with or without
ribavirin in patients with chronic genotype 1 hepatitis C
virus infection. Hepatology. 2010. 52(3):822-832.
48. Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, Nakagawa M, Korenaga M, Hino
K, Hige S, Ito Y, Mita E, Tanaka E, Mochida S, Murawaki Y, Honda M, Sakai A, Hiasa Y, Nishiguchi S,
Koike A, Sakaida I, Imamura M, Ito K, Yano K, Masaki
N, Sugauchi F, Izumi N, Tokunaga K, Mizokami M. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic
hepatitis c. Nat Genet. 2009.41(10):1105-1109.
49. Suppiah V, Moldovan M, Ahlenstiel G, Berg T, Weltman M, Abate ML, Bassendine M,Spengler U, Dore
GJ, Powell E, Riordan S, Sheridan D, Smedile A,
Fragomeli V,Müller T, Bahlo M, Stewart GJ, Booth
DR, George J.IL28B is associated with response to
chronic hepatitis C interferon-alpha and ribavirin
therapy. Nat Genet. 2009.41(10):1100-1104.
50. Thomas DL, Thio CL, Martin MP, Qi Y, Ge D,
o’Huigin C, Kidd J, Kidd K, Khakoo SI, Alexander G,
Goedert JJ, Kirk GD, Donfield SM, Rosen HR, Tobler
LH, Busch MP, McHutchison JG, Goldstein DB,
Carrington M. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature.
2009.461(7265):798-801.
51. Rauch A, Kutalik Z, Descombes P, Cai T, Di Iulio J,
Mueller T, Bochud M, Battegay M, Bernasconi E, Borovicka J, Colombo S, Cerny A, Dufour JF, Furrer H,
Günthard HF, Heim M, Hirschel B, Malinverni R,
Moradpour D, Müllhaupt B, Witteck A, Beckmann JS,
Berg T, Bergmann S, Negro F, Telenti A, Bochud PY;
Swiss Hepatitis C Cohort Study; Swiss HIV Cohort Study.
Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology. 2010.138(4):1338-1345.

Vol.70, Issue 2, April-June 2011 - About us | RAMI Editorial Board

Transcription

Similar documents

Germs Bio-terrain?

poster ECFGversie2 gecorrigeerd.pub

The Hammerling Experiment The Hammerling Experiment

Probiotic applications: Focus on Saccharomyces boulardii

Fruity Loops.indd

View content - Nestlé Nutrition Institute

September 2014 - Guillain Barré Syndrome Support Group NZ Trust

December 8, 2015 - Rock Island Rotary

Five Steps To a Healthier PC A guide to simple preventive