Islet Neogenesis Associated Protein (INGAP) induces the

Differentiation 90 (2015) 77–90
Contents lists available at ScienceDirect
Differentiation
journal homepage: www.elsevier.com/locate/diff
Islet Neogenesis Associated Protein (INGAP) induces the differentiation
of an adult human pancreatic ductal cell line into insulin-expressing
cells through stepwise activation of key transcription factors for
embryonic beta cell development
Béatrice Assouline-Thomas a,b,n, Daniel Ellis a,b, Maria Petropavlovskaia a,b, Julia Makhlin a,b,
Jieping Ding a,b, Lawrence Rosenberg a,b
a
b
Department of Experimental Surgery, McGill University, Montréal, QC, Canada H3G1A4
Lady Davis Institute for Medical Research, Sir Mortimer B. Davis-Jewish General Hospital, Montréal, QC, Canada H3T 1E2
art ic l e i nf o
a b s t r a c t
Article history:
Received 3 June 2015
Received in revised form
13 October 2015
Accepted 22 October 2015
Available online 11 November 2015
Regeneration of β-cells in diabetic patients is an important goal of diabetes research. Islet Neogenesis
Associated Protein (INGAP) was discovered in the partially duct-obstructed hamster pancreas. Its
bioactive fragment, pentadecapeptide 104–118 (INGAP-P), has been shown to reverse diabetes in animal
models and to improve glucose homeostasis in patients with diabetes in clinical trials. Further development of INGAP as a therapy for diabetes requires identification of target cells in the pancreas and
characterization of the mechanisms of action. We hypothesized that adult human pancreatic ductal cells
retain morphogenetic plasticity and can be induced by INGAP to undergo endocrine differentiation. To
test this hypothesis, we treated the normal human pancreatic ductal cell line (HPDE) with either INGAP-P
or full-length recombinant protein (rINGAP) for short-term periods. Our data show that this single drug
treatment induces both proliferation and transdifferentiation of HPDE cells, the latter being characterized
by the rapid sequential activation of endocrine developmental transcription factors Pdx-1, Ngn3, NeuroD,
IA-1, and MafA and subsequently the expression of insulin at both the mRNA and the protein levels. After
7 days, C-peptide was detected in the supernatant of INGAP-treated cells, reflecting their ability to secrete insulin. The magnitude of differentiation was enhanced by embedding the cells in Matrigel, which
led to islet-like cluster formation. The islet-like clusters cells stained positive for nuclear Pdx-1 and Glut
2 proteins, and were expressing Insulin mRNA.
These new data suggest that human adult pancreatic ductal cells retain morphogenetic plasticity and
demonstrate that a short exposure to INGAP triggers their differentiation into insulin-expressing cells in
vitro. In the context of the urgent search for a regenerative and/or cellular therapy for diabetes, these
results make INGAP a promising therapeutic candidate.
& 2015 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.
Keywords:
INGAP
Pancreas
Endocrine differentiation
Ductal cells
Human
Beta cell
1. Introduction
Diabetes Mellitus (DM) is an epidemic, life-threatening disease
characterized by the destruction of insulin-producing beta cells in
the pancreas. In Type 1 DM beta cells are destroyed by autoimmune reactivity, whereas in Type 2 DM apoptosis is suspected
to be the cause of a 60% decrease in beta-cell volume (Matveyenko
et al., 2006). An attractive therapeutic approach for diabetes lies in
n
Correspondence to: Lady Davis Institute for Medical Research, Sir Mortimer B.
Davis-Jewish General Hospital, 3755 Côte Ste-Catherine Road, Montreal, QC, Canada
H3T 1E2. Fax: þ 1 514 340 7502.
E-mail address: [email protected] (B. Assouline-Thomas).
harnessing the innate regenerative potential of the native pancreas. Islet cell regeneration refers to the ability of cells in the adult
pancreas to undergo proliferation and differentiation toward an
endocrine cell phenotype, leading to islet neogenesis (Granger
and Kushner, 2009; Rosenberg, 1995). Accordingly, identification
of bioactive molecules with islet neogenic activity, as well as
knowledge of putative target pancreatic progenitor cells in human,
are critical for investigation.
Islet Neogenesis Associated Protein (INGAP) is the first therapeutic drug candidate that induces formation of new islets
(Fleming A, 2007). INGAP was discovered in a surgical model of
partial pancreatic duct obstruction in hamsters, in which the animals displayed an increased β-cell mass with new endocrine cells
http://dx.doi.org/10.1016/j.diff.2015.10.008
Join the International Society for Differentiation (www.isdifferentiation.org)
0301-4681/& 2015 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.
78
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
arising near the ducts (Rosenberg, 1998). INGAP's bioactive fragment, the pentadecapeptide 104–118 (INGAP-P), has been shown
to induce islet neogenesis in normoglycemic rodents, dogs (Pittenger et al., 2007; Rosenberg et al., 2004) and cynomolgus
monkeys (Lipsett et al., 2007). In diabetic mice, INGAP-P reversed
hyperglycemia and the pancreata displayed foci of duct-associated
islet neogenesis as well as an increase in Pdx-1 immunoreactive
duct cells (Rosenberg et al., 2004). Pdx-1 is the first molecular
marker that characterizes the early pancreatic epithelium and it is
critical for pancreatic development. Its expression later becomes
restricted to mature beta cells (Melloul, 2004). In Phase 2 clinical
trials (Dungan et al., 2009), INGAP-P was reported to improve
glucose homeostasis in diabetic patients, and in patients with Type
1 diabetes this was accomplished via an increased endogenous
insulin secretion. This suggests that patients with diabetes retain
the potential to regenerate functioning insulin-producing β cells,
thereby making INGAP a promising neogenic agent for the treatment of diabetes. Still to be resolved, however, is the nature of the
pancreatic target cell(s) of INGAP in these patients. Partial insight
into this question comes from previous studies of our group on the
morphogenetic plasticity of human isolated islets. We had reported on the development of an in vitro model of islet-to-duct
transformation in which cultured islets dedifferentiated into ductlike cystic structures composed of proliferative precursor-type
cells, very similar to ductal cells (Jamal et al., 2003; Yuan et al.,
1996). When treated with INGAP, human islet-derived duct-like
structures responded by redifferentiating into fully functional islet-like structures resembling freshly isolated islets (Fig. 1) (Jamal
et al., 2005). This work led to the question of whether normal
human adult ductal cells, i.e. not derived from islets, can give rise
to endocrine cells in response to INGAP.
The potential capacity of adult pancreatic ductal cells to give
rise to islet cells in rodents remains the subject of debate in the
literature. It is well accepted that during pancreatic organogenesis
islet cells originate from primitive duct-like structures (Pictet and
Rutter, 1972, reviewed in Pan et al., 2011), and it is believed that
under normal physiological conditions new β-cells are formed
exclusively from beta cell replication (Dor et al., 2004). However,
the origin of new beta cells after pancreatic injury and the existence of a progenitor cell remain controversial, as different
groups have obtained opposing data. Following partial duct ligation (PDL) or partial pancreatectomy, new endocrine cells were
observed arising near ducts (Rosenberg, 1995; Rosenberg et al.,
1982; Wang et al., 1995), providing indirect evidence that after
injury new islets may differentiate from the ducts. The first direct
evidence of a ductal origin of neoislets after PDL has been revealed
by an elegant in vivo labeling experiment conducted in hamsters
which demonstrated that after a single pulse of tritiated
thymidine, a transfer of the radiotracer occurred from ductal cells
to islet cells in the weeks following surgery (Rosenberg, 1998).
More definitive supportive evidence of this observation has come
from two lineage tracing studies in adult mice, using the PDL
model. The first demonstrated the existence of facultative precursor cells in the pancreatic ducts, which in response to PDL activate Ngn3 expression and can subsequently differentiate into
new islets in vitro (Xu et al., 2008). The second study showed that
carbonic anhydrase II þ cells (ductal cells) give rise to new islets in
adults after PDL (Inada et al., 2008). The latter study was criticized
however, as the results could not be reproduced by other groups
(Kopp et al., 2011b; Solar et al., 2009). Another study based on
conditional target cell lineage ablation added further support,
demonstrating that the adult mouse ductal compartment contributes to regeneration of new endocrine cells (Criscimanna et al.,
2011). Finally, several different groups have recently published
controversial studies showing that regeneration of beta cells from
ductal cells does or does not occur in adult animals (Al-Hasani
et al., 2013; Rankin et al., 2013; Van de Casteele et al., 2013; Xiao
et al., 2013; Baeyens et al., 2014). The different lineage-tracing
techniques used and different degrees of ligation applied might
account for the differences in the authors’ conclusions. To date,
only a few in vitro studies using human pancreatic tissue have
been reported in which ductal cells are successfully turned into an
endocrine phenotype (Bonner-Weir et al., 2000; Gao et al., 2003;
Hao et al., 2006), but the purity of the starting material has been
questioned or cancer-derived cell lines were used (Gao et al.,
2005; Hardikar et al., 2003; Zhang et al., 2010; Zhou et al., 2008).
Thus the goal of the present study was to assess if adult human
pancreatic ductal cells (1) retain morphogenetic plasticity and
(2) can be induced by INGAP peptide or full-length recombinant
protein (rINGAP) (Assouline-Thomas et al., 2010) to undergo endocrine transdifferentiation. We used the immortalized normal
pancreatic ductal cell line HPDE, originally derived from a biopsy
of a normal human adult pancreatic duct and immortalized by
transduction with the E6/E7 genes of human papillomavirus
(Furukawa et al., 1996). HPDE cells have extensively been used as a
model of normal pancreatic duct epithelial cells as they exhibit the
expected genotype and phenotype (Liu et al., 1998; Ouyang et al.,
2000) and express CK19, CA II and MUC1 as normal ductal cells do
(Ming Sound Tsao and Dan Strumpf, unpublished). We report in
the present study that a short exposure of the HPDE cells to INGAP
triggers their differentiation into insulin-expressing cells by inducing the sequential expression of transcription factors that are
key for embryonic beta cell development.
Fig. 1. Morphogenetic plasticity of human pancreatic islets. (a) Inverted microscopy and (b) schemes, depicting the transition from adult human islet to duct-like structure
(DLS), followed by regeneration of an islet-like structure (ILS) in the presence of INGAP-P (adapted from Jamal et al., 2005).
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
2. Materials and methods
2.1. Cells
HPDE cells (kindly provided by Dr. Ming-Sound Tsao, Ontario
Cancer Institute, Toronto, Canada) were seeded at 8 104 cells/cm2
either in 10 or 6 cm culture-treated dishes or in chamber slides, in
Keratinocyte Serum Free Medium (KSFM) supplemented with BPE
and EGF (Invitrogen, Burlington, Canada). When 70% confluency
was obtained, cells were treated with PBS (control), 167 nM INGAP-P (1 ) or 5 nM rINGAP for different intervals. When cultured
for more than 24 h, the medium was changed and factors were
added every other day. INGAP-P was synthesized at the Sheldon
Biotechnology Center (McGill University, Montreal, Canada). INGAP recombinant protein (rINGAP) was produced in our laboratory
as described elsewhere (Assouline-Thomas et al., 2010).
2.2. Induction of cluster formation
HPDE cell clusters were formed following the 3D overlay
method developed by Debnath et al. (2003). Briefly, a thin layer of
Matrigel (BD Biosciences, Mississauga, Canada) was laid at the
bottom of the chamber slides or the tissue culture dishes. When
the Matrigel coating was dry, the cell suspension was added on top
at a concentration of 15,000 cells/ml in 2% Matrigel–KSFM solution. Clusters formation was observed after 5 days. After another
5 days, the clusters became cystic. HPDE cysts were then treated
with PBS (control), 167 nM INGAP peptide (1 ) or 5 nM rINGAP
for 7 days. To harvest the cells for RNA or immunofluorescence, the
Matrigel was dissolved using Dispase (BD Biosciences, Mississauga,
Canada) for 45 min to 1 h at 37 °C. After 3 washes with PBS, the
cell pellet was lysed for RNA extraction or fixed in 2% PFA and
processed for immunofluorescence.
2.3. RT-qPCR
Cell pellet was lysed in RLT buffer (RNeasy Mini, Qiagen, Germany) and RNA was isolated as per the manufacturer's protocol.
RNA concentration was measured by spectrophotometer. Omniscript kit from Qiagen (Germany) was used as per manufacturer's
protocol to reverse transcribe 2 mg RNA per reaction. Quantitative
RT-PCRs were performed using SYBR Green ready-to-use mix
(Qiagen, Germany). 2 ml of RT reaction were used per qRT-PCR
reaction. See Table 1 for primers description. Reactions were performed on an Opticon 2 DNA Engine Cycler (Biorad, Mississauga,
Canada). Relative gene expression was calculated using the ΔΔCT
method with beta-actin as a reference gene.
2.4. Protein extraction
Cells were lysed in 100 mL 1X-Protein Lysis Buffer (Cell Signaling Technology, Danvers, MA) containing proteases inhibitors
79
(Complete TM minitablets, Roche Applied Science, Laval, Canada)
and 10 mg/ml PMSF in isopropanol. Cell lysates were then sonicated and centrifuged. Protein-containing supernatants were frozen at 80 °C or further processed for quantification using BioRad Dc protein assay (Biorad, Mississauga, Canada).
2.5. Intracellular C-peptide
Since KSFM medium contains insulin, the insulin synthesis in
HPDE cells was evaluated by C-peptide ELISA (Alpco, Salem, NH).
25 ml of total cell lysate was used per reaction. The actual concentration of C-peptide was calculated according to C-peptide elisa
standard curve and normalized to total cellular protein measured
by the Bio-Rad protein-assay kit.
2.6. Western blots
100 mg of total protein were resolved on a 12.5% SDS-Polyacrylamide gel. Proteins were then transferred to a nitrocellulose
membrane and probed with primary antibodies, anti-Pdx-1 (Abcam, Cambridge, MA) or anti-beta actin (Invitrogen, Burlington,
Canada). Following incubation with the secondary antibody, antirabbit HRP-conjugated antibody, blots were treated with the ECL
reagent (GE healthcare, Baie d’Urfe, Canada) and exposed to a
Kodak XOMat autoradiographic film (Sigma Aldrich, Oakville, Canada). Relative intensities of Pdx-1 bands (to beta actin) were
quantified using ImageJ.
2.7. Insulin secretion
HPDE cells were treated with 167 nM or 835 nM INGAP-P for
7 days. The insulin secretory function of the cells was then evaluated as follows: after a 1 h preincubation period at 37 °C in KSFM
medium (5.8 mM glucose), they were then incubated for 1 h in
KSFM medium with 25 mM glucose. At the end of the incubation
time, C-peptide immunoassay measurements were performed on
the concentrated supernatants (Mercodia ultrasensitive C-peptide
ELISA), values obtained were normalized to total cellular protein
measured by the Bio-Rad protein-assay kit.
2.8. Immunofluorescence
HPDE cells grown in monolayers or as clusters in Matrigel were
treated for 7 days with 167 nM INGAP-P. Cells grown in monolayer
were trypsinised, rinsed in PBS and then pelleted, whereas clusters
were harvested after Matrigel dispersion (see above). Cell pellets or
clusters were fixed with 2% PFA, and then embedded in 2% low
melting temperature agarose (Sigma Aldrich, Oakville, Canada). The
samples were then processed following a standard protocol of dehydration and paraffin embedding. 5 mm sections were deparaffinized and probed with one of the following primary antibodies:
Rabbit anti-hCK19 (ProteinTech), Rabbit anti-hPdx-1 (Millipore),
Table 1
List of the primers used for real-time qPCR.
Gene
Sense
Antisense
Amplicon size (bp)
hbACTIN
hPDX1
hINSULIN
hNEUROGENIN-3
hNEURO-D1
hIA-1
hGLUCOKINASE
hGLUCAGON
hPPY
CATCCTCACCCTGAAGTACC
CCTTTCCCATGGATGAAGTC
GCTGGTAGAGGGAGCAGATG
TTCAACATGACAGCCAGCTC
ATCCCAACCCACCACCAACC
GAACTGTGCCTTCGCTTGGA
GCTGAGATGCTCTTCGACTAC
ACAAGGCAGCTGGCAACGTTCCCT
CCACCTGCGTGGCTCTGTTA
GTCATCTTCTCGCGGTTGG
TTCAACATGACAGCCAGCTC
AGCCTTTGTGAACCAACACC
TGCTTGCTCAGTGCCAACTC
CAGCGGTGCCTGAGAAGATT
AAGAGACTGACTCCTGTTGCG
CTTGGTCCAGTTGAGAAGGATG
CCTTCCTCCGCCTTTCACCAGCCA
AGAAGGCCAGCGTGTCCTC
170
199
243
249
439
231
152
343
189
80
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
Mouse anti-hC-peptide (Biodesign), Rabbit anti-hGlut-2 (Millipore)
and corresponding secondary antibodies: Rhodamine-anti-Rabbit
(Abcam), AlexaFluor 488 anti-Mouse (Invitrogen) or AlexaFluor 488
anti-Rabbit (Invitrogen). Slides were then mounted in DAPI-containing Vectashield mounting medium (Vector, Burlingame, Canada). Images were captured using a Zeiss Axioskop 40 microscope
and Northern Eclipse v6.0 (Empix Imaging, Mississauga, ON, Canada). To assess proliferation variations, cells or clusters were stained
for the proliferation marker PCNA (Proliferating Cell Nuclear Antigen) (Mouse anti-hPCNA, Dako) and the percentage of PCNAþ/total
number of nuclei was then calculated.
2.9. Kinetworks phosphoprotein profiling
In the phosphoprotein Kinetworks profiling studies (Kinexus
Bioinformatics Corp., Vancouver, Canada), HPDE cells were treated
with PBS (control), 835 nM INGAP-P (5 ) or 1 nM rINGAP for 20 min.
Protein lysates (500 mg) were used for Kinetworks Phospho-Site
Screen (KPSS-1.3). The KPSS-1.3 screen allows simultaneous detection/
semiquantitative analysis of the levels of 38 different phosphorylation
sites in phospho-protein kinases and signaling proteins. Briefly, the
KPSS 1.3 phospho-site broad coverage pathway screen detects the
targets in two steps. First, molecules are separated by gel electrophoresis based on their molecular weight, and then the phosphorylation sites are detected by their immunoreactivity with highly validated phospho-specific antibodies. The resulting images were visualized using ECL followed by quantitation using proprietary software.
2.10. Statistics
In all experiments control and treatment groups were compared. All experiments were performed at least three times, and
results are expressed as mean 7SEM. Statistical significance was
determined by Student's t test. Statistical significance was defined
as *pr 0.05.
3. Results
3.1. INGAP induces endocrine differentiation in HPDE cells
3.1.1. Rapid induction of Pdx-1 expression in HPDE cells by INGAP
Pancreatic and duodenal homeobox 1 (Pdx-1) is expressed in
the pancreatic duct epithelium cells during development, and
seems to be a prerequisite for their differentiation into acini, ducts,
and endocrine cells in the mature pancreas (Ahlgren et al., 1996;
Gu et al., 2002; Melloul, 2004; Offield et al., 1996). We investigated
Pdx-1 gene expression in INGAP-treated HPDE cells. A time-course
study revealed a transient increase in Pdx-1 mRNA expression
after 15 min of treatment with 167 nM INGAP-P (Fig. 2A), a concentration previously shown to be effective in the conversion of
islet-derived duct-like structures to neoislets (Jamal et al., 2005).
An increase in Pdx-1 expression was also observed after a 15 min
treatment with 1, 5 or 25 nM rINGAP, with the greatest stimulation
being achieved with 5 nM (Fig. 2B). This indicates that INGAP recombinant protein is more potent on a molar basis, compared to
the peptide, which is consistent with our earlier data (AssoulineThomas et al., 2010; Petropavlovskaia et al., 2012). Western blot
analysis further established that the upregulation of Pdx-1 gene
expression was followed by an 8-fold increase in Pdx-1 protein
after 24 h (Fig. 2C and D). At the same time point, the level of Pdx1 transcripts in 24 h INGAP-treated HPDE cells was 2.24 ( 70.098)fold higher than the untreated cells, but still 160-fold lower than
in adult human islets (data not shown). Altogether, these data
show that HPDE cells are responsive to INGAP and that the exposure induces an increase in Pdx-1 mRNA and protein levels.
Fig. 2. INGAP induces Pdx-1 expression in human adult ductal cells. (A) Pdx-1
mRNA expression variation over time in HPDE cells treated with 167 nM INGAP-P,
expressed as a fold-change of the time-matched untreated control. (B) Pdx-1 mRNA
expression variations in HPDE cells treated for 15 min with different doses of
rINGAP, expressed as a fold change of the time-matched untreated control.
(C) Representative Western blot of Pdx-1 expression after 24 h in HPDE untreated
cells (CTL) and cells treated with 167 nM INGAP-P (INGAP-P). Equal amounts of
total proteins were loaded onto each lane (as shown with b-Actin). (D) Graphical
representation of % increase in Pdx-1 protein, after quantification with ImageJ
software. Data is presented as mean 7 SEM, *p o 0.05, n¼ 3 independent
measurements.
3.1.2. Induction of the cascade of endocrine transcription factors by
INGAP
Pancreatic endocrine differentiation during development is
associated with the sequential expression of several specific
transcription factors (Habener et al., 2005; Pan and Wright, 2011).
We therefore chose to examine the expression of some of them in
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
81
Fig. 3. INGAP induces the coordinated expression of developmental transcription factors implicated in endocrine differentiation during pancreatic development.
(A) Representative gel of Neurogenin 3 amplicons after qRTPCR performed on HPDE not treated (Ctl) or treated with 167 nM INGAP-P (PP) or 5 nM rINGAP (rING) for 15 min,
30 min and 1 h. (B–D) NeuroD, IA-1 and MafA mRNA expression variations overtime, expressed as a fold-change of the time-matched untreated control (*p r 0.05). Left
panel, cells were treated with 167 nM INGAP-P, right panel 5 nM rINGAP.
HPDE cells during the time course of treatment (15 min–2 h) with
INGAP: neurogenin 3 (Ngn3) – a basic helix–loop–helix transcription factor controlling endocrine cell fate decisions in multipotent pancreatic endodermal progenitors cells (Gradwohl et al.,
2000; Schwitzgebel et al., 2000); NeuroD1, an insulin transactivator, that is critical for development of the endocrine pancreas
(Naya et al., 1997); Insulinoma-A1-1(IA-1/Insm1), a zinc finger islet
transcription factor (Mellitzer et al., 2006) and v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (MafA), beta
cell specific transcriptional activator, crucial for functional maturation of β cells (Hang and Stein, 2011).
Agarose gel of qRT-PCR products show that Ngn3 is absent in
untreated cells, but present in INGAP-P-treated cells at 15 min and
30 min and in rINGAP treated cells at 15 min, 30 min and 1 h
(Fig. 3B). We were able to observe quantifiable changes in the
transcription factors NeuroD1 and IA1 expression, which are
downstream of Ngn3 (Habener et al., 2005; Mellitzer et al., 2006),
as well as in MafA expression (Fig. 3C). The sequential biphasic
regulation of NeuroD1, followed by IA-1 and lastly MafA, was reminiscent of the sequence of transcriptional events observed in
the embryonic pancreatic development (Fig. 3A), although the
timeframe of these events (minutes to hours) was much shorter
than during development, or compared to other in-vitro models of
ductal to endocrine differentiation (Heremans et al., 2002; Zhou
et al., 2002). Similar results were obtained with 5 nM rINGAP
(Fig. 3C), suggesting the same or similar mechanisms of action for
82
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
both the protein and peptide.
3.1.3. Insulin expression in HPDE cells treated with INGAP for 24 h
To establish whether the onset of INGAP-induced expression of
developmental transcription factors was followed by beta-cell
differentiation, we assessed insulin transcripts presence in INGAPtreated HPDE cells. Insulin expression, as determined by qRT-PCR
was increased 8 times after 24 h of treatment with INGAP-P
(Fig. 4A). Interestingly, this was associated with the onset of expression of the mature beta cell marker glucokinase, which was
not detectable before the addition of INGAP (Fig. 4B). To verify
whether the increase in insulin mRNA was accompanied by the
synthesis of insulin protein, we performed a C-peptide ELISA on
total cell lysates. As shown in Fig. 4C, both INGAP-P and rINGAP
significantly increase levels of C-peptide after 24 h of treatment.
Although these ductal cells in monolayers undergo to a certain
extend a beta-like cell differentiation after only 24 h of exposure to
INGAP, the C-peptide intracellular average content of 0.3 pg/ug
total protein is not at all comparable with the one of freshly isolated adult human islets (65 ng/ug protein, based on Aly et al.,
2013). It is nevertheless very comparable with the C-peptide
contents obtained in various multi-compounds-based multi-stages
long-term protocols in which insulin-producing cells are differentiated in vitro from various human cell type sources as reported
in Table 2 (Hori et al., 2005; Jiang et al., 2007; Tsai et al., 2012). Of
particular interest, the induction of human ES cells differentiated
insulin-producing cells, in which the intracellular c-peptide content of the induced cells varied between 0.2 and 0.6 ng/mg (Jiang
et al., 2007).
Fig. 4. INGAP induces Insulin expression in human adult ductal cells. (A) Insulin
expression in HPDE cells after 24 h in culture in absence (Ctrl) or presence (INGAPP) of 167 nM INGAP-P. (B) Detection of glucokinase expression by qRT PCR in HPDE
cells after 24 h in culture in absence (Ctrl) or presence of 5 nM rINGAP (rINGAP)
(representative gel). (C) Graphical representation of C-peptide protein detected in
HPDE cells lysates after 24 h in culture in absence (Ctrl) or presence of 167 nM
INGAP-P (INGAP-P) or 5 nM rINGAP (rINGAP) by ELISA (*po 0.05, normalized to
total protein).
3.1.4. Expression of beta cell specific proteins in HPDE cells treated
with INGAP-P for 7 days
We next sought to determine whether the observed insulin
mRNA expression of the HPDE cells would remain and/or be enhanced after a longer exposure to INGAP. Our qRT-PCR data show
that insulin mRNA expression was increased 2 and 3.1 times upon
a 7-day treatment with INGAP-P or rINGAP respectively (Fig. 5A).
At the same time point, the presence of the ductal marker CK19,
Pdx-1, C-peptide and Glut-2 proteins was analyzed by immunofluorescence (Fig. 6). Our data showed a decreased detection of the
CK19 protein in treated cells (Fig. 6) as well as the translocation of
the Pdx-1 protein signal from the cytoplasm (Fig. 6, arrowheads)
into the nucleus (Fig. 6, arrows), concomitant with the appearance
of a weak signal for C-peptide (not shown). These data confirm the
onset of differentiation towards a beta cell phenotype. However,
the weakness of the signals for Pdx1 and C-peptide, as well as the
absence of the marker of mature beta cell GLUT2 (not shown)
indicate that although HPDE cells in monolayer are capable of
some degree of differentiation into β-like cells when treated with
INGAP, the process remains incomplete under the present
conditions.
Table 2
Comparison of C-peptide content obtained in various protocols of insulin-producing cell differentiation.
Cell type
Protocole length/
number of stages
Drugs/number of drugs
C-peptide content
Reference
Human Pancreatic Ductal
Cells (HPDE)
24 h/1
INGAP/1
0.3 pg/ug prot
#0.3 ng/mg prot
#0.08pmol/mg prot
0.3 ng/mg prot at low glucose in suspension. 0.6ng/mg prot at high glucose in
suspension.
0.2 ng/mg prot low or high glucose in
adhesion
0.6 pmoles/mg prot
Present
manuscript
Human embryonic stem cells 20 days/4
Activin A, RA, bFGF, Nicotinamide/4
Human Neural Progenitor
Cells
Umbilical cord mesenchymal
stem cells
5 weeks/4
RA, Nicotinamide, IGF-1/3
10 days/3
Activin A, sodium butyrate, b-mercaptoethanol, 2 pg/ug prot
taurine, GLP-1, Nicotinamide, NEAA/7
Jiang et al. (2007)
Hori et al. (2005)
Tsai et al. (2012)
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
83
Fig. 5. 7-day treatment with INGAP triggers endocrine differentiation of human adult ductal cells. Insulin (A), Glucagon (B), PPY (C) and Somatostatin and (D) mRNA
expression variations in HPDE cells treated for 7 days with 167 nM INGAP-P (INGAP-P) or 5 nM rINGAP (rINGAP), expressed as a fold-change of the time-matched untreated
control (*p r 0.05). (E) C-peptide release in the medium of HPDE cells cultured 7 days in absence (control) or in the presence of 167 nM or 835 nM INGAP-P (#pr 0.05 vs.
control 5.8 mM, *p o 0.05 vs. control 25 mM Glucose).
3.1.5. Expression of glucagon, somatostatin and PPY in HPDE cells
treated with INGAP-P for 7 days
Interestingly, upon a 7 day treatment with INGAP-P or rINGAP,
we also observed an increased mRNA expression in HPDE cells of
glucagon, PPY and somatostatin (Fig. 5B–D), suggesting that these
other endocrine cell types could be induced by INGAP.
3.1.6. Insulin secretion by HPDE cells treated with INGAP-P for 7 days
We then sought to address whether these 1-week INGAPtreated cells have the capacity to secrete insulin in response to
glucose. The data show (Fig. 5E) that in basal glucose condition
(5.8 mM) 167 nM INGAP-treated cells do have the capacity to secrete insulin, and that this capacity is 2.6-times higher than in
control cells cultured without INGAP: 25.66 76.07 pg c-peptide/
mg total protein in treated cells versus 9.91 72.88 pg c-peptide/
mg total protein. When the cells were treated with 835 nM INGAP-
P, the increase was close to 4 fold-change of the control, the
c-peptide release for these cells was 37 75.33 pg c-peptide/mg
total protein (Fig. 5E). When the cells were exposed to high glucose (25 mM), the treated cells were also secreting more insulin
that the control cells, the 167 nM INGAP-P and 835 nM INGAP-Ptreated cells secreted 3.4 and 4.5 more c-peptide than the control,
respectively. Although these results show a trend to secrete more
insulin in high glucose conditions, the differences between low
and high glucose secretion were not statistically significant. Of
note, the control cells did not display any difference between low
and high glucose. The amounts of C-peptide secreted by INGAP-Ptreated cells vary from 25.6 to 46.3 pg/mg total protein, which are
in the range of the amounts secreted by human ES cells or human
liver cells genetically modified to express Pdx-1 (Bernardo et al.,
2009, Berneman-Zeitouni et al., 2014). As a comparison, adult islets were reported to secrete 15 to 40 ng/mg total protein in
84
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
Fig. 6. 7-day treatment with INGAP-P triggers beta cell differentiation of human adult ductal cells. Immunofluorescence analysis of HPDE cells in monolayer cultured 7 days
without (CONTROL) or with 167 nM INGAP-P (INGAP): immunodetection of Cytokeratin19, and Pdx1 (representative pictures).
similar conditions (Zhang et al., 2009). Interestingly, the relationship between the C-peptide secretion for a 167 nM dose compared
with a 835 nM (5-times higher) of INGAP-P remains the same in
both glucose conditions, suggesting a dose-dependant effect of the
peptide on the insulin secretion.
Taken together, the data produced using HPDE monolayers
demonstrate that INGAP is able to initiate endocrine differentiation in ductal cells, although the degree of differentiation is limited. Given that INGAP-induced islet neogenesis in vivo occurs in a
3D microenvironment, and that our model of duct-like structures
to islet-like structures transdifferentiation showed robust endocrine differentiation in response to INGAP in a 3D culture environment (Jamal et al., 2005), we sought to investigate the effect
of such a culture system on INGAP-induced differentiation of HPDE
cells.
This morphological change was accompanied by 2- and 4-fold
increase in insulin mRNA level in HPDE islet-like clusters when
treated with 167 nM INGAP peptide or 5 nM protein respectively
(Fig. 7B). In addition to insulin, we observed an upregulation of
glucagon (2.5 and 1.5-fold respectively), and PPY (1.4 and 2.5-fold
respectively) mRNAs (Fig. 7B). This data suggests that a 3D microenvironment potentiates the effect of INGAP on endocrine
differentiation of HPDE cells.
3.2.1. HPDE form cell clusters and cystic structures when embedded
in Matrigel
The 3D overlay method for the Matrigel embedding of cells
(Debnath et al., 2003), was used to plate a single cell suspension of
HPDE cells. These formed small cell clusters by 5 days (Fig. 7A, left
panel). After a further 5 to 10 days, these clusters spontaneously
transformed into cystic structures (Fig. 7A, middle panel) hat appeared very similar to the islet-derived duct-like structures previously described in detail elsewhere (Fig. 1 and Jamal et al., 2003;
Yuan et al., 1996).
3.2.3. Expression of beta cell specific proteins in INGAP-treated HPDE
islet-like clusters
The phenotypic conversion from cystic to solid structures was
further examined by immunostaining for CK-19, Pdx-1, C-peptide
and GLUT2. As shown in Fig. 8, after 1 week of exposure to 167 nM
INGAP-P, most of the cystic structures appear solid. This was
concomitant with the loss of CK19, a marker of duct cell phenotype, when compared to time-matched untreated cystic structures. This loss of CK19 is accompanied by the appearance of
C-peptide signal in virtually all the cells of the solid structures,
although the detected signal remains too weak to draw conclusions at the protein level (not shown). The most significant
changes were those observed for Pdx-1, which showed a switch
from faint cytoplasmic protein expression typical of human ductal
cells (Heimberg et al., 2000) to strong nuclear staining, indicative
of Pdx-1 activation that is characteristic for β-cells. This change in
expression was accompanied by the appearance of the mature
beta-cell marker GLUT2, which further confirmed the more mature beta cell phenotype of INGAP-treated structures in a 3D environment, as compared to those cells grown in monolayers.
3.2.2. INGAP up-regulates expression of islet-related genes in HPDE
clusters
When treated for 7 days with INGAP-P, HPDE cystic structures
reverted into solid islet-like clusters (Fig. 7A, right panel), what is
very similar to our report of the conversion of islet-derived ductlike structures to islet-like structures (Fig. 1) (Jamal et al., 2005).
3.2.4. INGAP-P increases proliferation in HPDE cell monolayers and
clusters
The proliferation index of INGAP-P-treated cells versus untreated cells was assessed by immunofluorescence for PCNA. The
data indicate that INGAP-P stimulates proliferation of HPDE cells
grown for 7 days either in monolayers or in 3D Matrigel cultures
3.2. INGAP-induced differentiation of HPDE cells is enhanced by a 3D
culture system
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
85
Fig. 7. Clustering HPDE cells mimics the islet-DLS-ILS model and enhances endocrine differentiation triggered by INGAP. (A) HPDE cells embedded in Matrigel form clusters
after 5 days in culture. After 10 days, the clusters become cystic. When treated for 7 days with 167 nM INGAP-P, HPDE cystic structures revert into solid islet-like clusters
(phase-contrast microscopy, representative pictures). (B) Insulin, Glucagon and PPY mRNA expression variations in HPDE clusters treated for 7 days with 167 nM INGAP-P
(INGAP-P) or 5 nM rINGAP (rINGAP), expressed as a fold-change of the time-matched untreated control (*pr 0.05).
(Fig. 9). Interestingly, there was a 4.3-fold increase in PCNA-positive cells in HPDE islet-like clusters cultured in Matrigel compared
to time-matched untreated cells (60.65% 70.52 vs 14.25% 70.56,
p o0.05). This difference was smaller for cells grown in monolayers (54%7 0.61 vs 33%70.94 po 0.05), but still significant. Thus
it appears that INGAP-P induces proliferation of HPDE cells in both
types of culture systems.
3.2.5. Signaling pathways implicated in early endocrine
differentiation
To pinpoint signaling events activated by INGAP we screened for
phospho-proteins using a western blot based signaling pathway
screening assay. While our dose response experiments indicated
equal induction of Pdx1 by 165 nM (1 ) or 835 nM INGAP-P (5 ), it
was unclear if pathway activation was similar. In order to screen for
pathway activity, we opted to use the higher dose to assure robust
phosphorylation in these assays. Fig. 10(A–C), shows representative
western blot analysis in control (A), INGAP-P-treated (B), and rINGAPtreated (C) HPDE cells after 20 min of treatment. The intensity of the
ECL signals for the target protein bands on the Kinetworks immunoblots were quantified and significant changes in OD (425%)
were reported on the statistical bar diagrams (Fig. 10D) and
table (Fig. 10E). As shown in Fig. 10D and E, proteins activated after
20 min by INGAP-P and rINGAP are associated with the PI3K/Akt and
MAPK pathways, which is consistent with the observed induction of
differentiation in HPDE cells. However, activation of Erk, MEK1/2, Rb1
and Raf1 also suggests an increase in proliferation, which was also
observed, as described earlier (Fig. 9).
4. Discussion
The present work aimed at determining if human adult pancreatic ductal cells are INGAP-responsive and if INGAP could
86
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
Fig. 8. Matrigel-embedding of human adult ductal cells intensifies endocrine differentiation upon INGAP treatment. Immunofluorescence analysis of HPDE clusters cultured
7 days without (CONTROL) or with 167 nM INGAP-P (INGAP): immunodetection of Cytokeratin19, Pdx1 and Glut2 (representative pictures). Upon INGAP treatment, CK19 is
abolished, Pdx-1 is translocated to the nucleus and Glut 2 appears.
promote their differentiation into beta cells. Our results show that
INGAP induces very quickly (15 min) the expression of 2 transcription factors which are crucial for the differentiation of pancreatic endocrine cells during development: Pdx-1 and Ngn-3.
According to current understanding, Ngn3 functions as a master
switch for pancreatic cell differentiation into all endocrine cell
lineages (Rukstalis and Habener, 2009). More precisely, during the
mouse pancreas development, it is believed that Ngn3 up-regulation results in separation of endocrine cells from the duct
lineage (Stanger and Hebrok, 2013). We observed here for the first
time the induction of Ngn3 expression in human adult ductal cells
upon INGAP treatment. In the course of 2 hours, INGAP subsequently induces a rapid change in gene expression of the proendocrine transcription factors NeuroD1, IA-1 and MafA one after
another. This seemingly well-orchestrated sequence of transcriptional events resembles to a recapitulation of what occurs during
pancreatic development (Habener et al., 2005; Mellitzer et al.,
2006) (Fig. 3A). These events are followed after 24 h of treatment
by the increase of insulin mRNA and protein levels (c-peptide
ELISA), and by the appearance of glucokinase mRNA. These findings demonstrate that HPDE cells are INGAP-responsive and that
INGAP could trigger the onset of the beta cell differentiation
program in the ductal cells. This conclusion is supported by studies
in animals showing (1) the selective targeting of a tagged INGAP to
pancreatic ductal cells (Borelli et al., 2007; Pittenger et al., 2007),
and (2) INGAP immunoreactivity in the developing pancreas in the
course of the endocrine differentiation (Hamblet et al., 2008).
Moreover, a correlation between the increase of the INGAP-positive cell mass and the increase in the number of beta-cells and
Pdx-1-positive cells in the course of rat pancreas development has
been recently reported (Madrid et al., 2013), suggesting that INGAP
may have a role in the developmental transcription factors cascade
of endocrine pancreatic cells differentiation. This hypothetic role
of INGAP could also be suggested in human pancreas development
as small clusters of INGAP-immunoreactive cells were detected in
fetal human pancreas (Taylor-Fishwick et al., 2008). Altogether,
our results and the literature therefore suggest that INGAP induces
ductal cells to recapitulate the early steps of the cascade of transcription factors that leads to beta cell differentiation during development, a process in which an INGAP-related molecule may
initially have a role.
Our results show that the rapid change seen in the transcription factors gene expression appears to correlate with activation of
PI3K and MAPK. The role of PI3K-Akt pathway in the islet
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
Fig. 9. INGAP increases HPDE cell proliferation. HPDE cells in monolayers or cultured in Matrigel as clusters were treated with 167 nM INGAP peptide for 7 days.
Cells were then stained for the indicator of proliferation PCNA and the percentage
of PCNA þ/total number of nuclei calculated (*p r 0.05).
development and in regulation of PDX1 and other key islet transcription factors has been documented (Furuya et al., 2013; Jamal
et al., 2005; Uzan et al., 2009). We have previously shown that this
87
pathway is necessary for INGAP-P-induced differentiation of neoislets from DLS (Jamal et al., 2005) and so we believe that activation of PI3K/Akt is likely in play in the observed upregulation of
transcription factors in HPDE cells. Activation of Erk1/2 pathway is
also known to upregulate the expression levels of PDX1, MafA1,
NeuroD1 and insulin in the islets (Lawrence et al., 2008) and so it
is possible that Erk1/2 is partially responsible for upregulation of
PDX1 in HPDE cells. Besides, activation of the Erk cascade is associated with cell proliferation and has been implicated in the
proliferative effects of INGAP on beta cell lines and rat islets
(Barbosa et al., 2008; Petropavlovskaia et al., 2012). Accordingly, it
was likely involved in the proliferative effects of INGAP-P and
rINGAP on HPDE cells. Since islet neogenesis involves both proliferation and differentiation, this observation is not surprising.
Both processes are coordinated during pancreatic organogenesis
and regeneration, likely via the fine regulation of Notch signaling,
to maintain the appropriate numbers of progenitor and mature
cells (Dhawan et al., 2007).
A 7 day treatment improves the extent of the INGAP-induced
transdifferentiation, as suggested by the decrease of the ductal
marker CK-19 protein signal, the translocation of Pdx-1 protein
signal from the cytosol to the nucleus, the presence of the mature
beta-cell marker Glut-2 and most importantly, the detection of
C-peptide protein release (reflecting insulin protein). The amount
of C-peptide secreted by INGAP-P-treated cells is 600–800 times
lower than human adult isolated islets (Zhang et al., 2009), but
this was expected as the starting material for this study is a human
adult ductal cell line and these were treated with a peptidic drug
for only seven days. The INGAP-treated cells show a trend to
Fig. 10. Effect of INGAP on protein kinase activation in HPDE cells. (A–C) Kinetworks Western blot results of various phosphoprotein kinases from HPDE cells treated for
20 min with PBS (control), 835 nM INGAP-P, and 1 nM rINGAP, respectively; (D) statistical bar diagram of the OD for various protein kinase activation after 20 min from
control (empty bars), INGAP-P-treated (gray bars), and rINGAP-treated (black bars) cells; (E) abbreviated names of protein kinases as depicted by numbers in (A–D),
respectively and the corresponding fold-changes. Only the significant changes are represented. A change in OD of at least 25% was considered significant.
88
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
secrete more insulin in high glucose conditions, but the differences
were not statistically significant. We therefore conclude that these
cells after this short exposure to one single peptidic drug start to
show beta cell features, but that they are not mature beta cells.
Interestingly the mRNA levels of glucagon, somatostatin and
pancreatic polypeptide were also slightly increased at the 7 day
time point, suggesting that INGAP may also induce the differentiation pathways of the other endocrine cell types. This hypothesis is reinforced by the fact that in our in vitro model of
human adult islets dedifferentiation into duct-like structures, INGAP induced the redifferentiation of the duct-like structures into
fully functional islets, composed of the 4 islet hormones (Jamal
et al., 2005).
The magnitude of differentiation was enhanced by embedding
the cells in Matrigel, which led to islet-like cluster formation. After
a 7 day treatment, the solid structures exhibited a higher fold
change in the mRNA levels of endocrine markers (insulin, glucagon
and PPY) as well as stronger signals for Pdx-1, glut-2 and c-peptide
compared to treated cells in monolayer culture. The mechanisms
underlying the observed effect of Matrigel remain to be fully elaborated, but based on available studies (Bonner-Weir et al., 2000;
Boretti and Gooch, 2008; Gao et al., 2003), these may include:
(1) morphogenetic changes in 3D resulting in the restoration of
cell polarity; and (2) signaling events induced by ECM proteins
and/or by a variety of growth factors contained in Matrigel, which
might act in concert with INGAP to enhance its effect. The degree
of differentiation attained after a 7 day INGAP treatment in Matrigel remains nevertheless limited in terms of insulin expression.
Indeed, at the doses tested, we only detect a weak signal of
C-peptide protein (reflecting insulin), not sufficient to qualify our
differentiated cells true beta cells. Still, the translocation of Pdx-1
to the nucleus and the expression of Glut -2, two features of mature beta-cells associated with a low insulin-expression strongly
suggest that the INGAP-treated ductal cells are capable of transdifferentiation into insulin-expressing cells.
In a broader angle, these observations on human ductal cells
lend further support to the studies on the mechanism of action of
INGAP as a potential islet-neogenic agent in diabetic patients. In
Phase 2 clinical trials of patients with Diabetes Mellitus, treatment
with INGAP-peptide increased arginine-stimulated C-peptide in
type 1 patients, reflecting an increased endogenous insulin secretion in these diabetic patients (Dungan et al., 2009). At the light
of the data that we report here, the results of these clinical studies
may suggest that in INGAP-treated patients, the induced insulin
secretion could be the result of islet neogenesis from ductal cells
via a reactivation of the beta cell differentiation developmental
program. Several recent studies conducted in human support that
hypothesis; it has indeed been shown that patients with Type
1 diabetes attempt to spontaneously regenerate islets from their
existing population of ductal cells (Martin-Pagola et al., 2008;
Meier et al., 2006), and a recent study of chronic pancreatitis
strongly supports a ductal origin of islet neogenesis in human
patients (Soltani et al., 2011). Finally, evidence directly implicating
INGAP in human islet neogenesis has surfaced in a case report of
hyperinsulinemia associated with a pancreatic transplant in which
the tissue demonstrated florid nesidioblastosis (foci of islet cells
budding off ducts accompanied by an increase in the number of
islets): the neogenic tissue was heavily stained by an α-INGAP
antibody (Semakula et al., 2002). Data collected over the years in
animal and in vitro studies also corroborate the concept that INGAP may induce endocrine differentiation – and consequently islet
neogenesis – from pancreatic ductal cells.
Some questions remain, however unanswered. In vivo, are all
the ductal cells responsive to INGAP? Is there a subpopulation of
such cells that are more susceptible to be triggered by INGAP to
undergo endocrine differentiation because they are specialized
progenitors, as some suggest (Yanger and Stanger, 2011) and
would have all the transcriptional equipment ready for an immediate response as concluded by Kopp et al. (2011a)? Would this
progenitor cell be Ngn3-negative, as predicted by Van de Casteele
et al. (2013)? The duct-ligation model, main proof of the existence
of beta cell neogenesis and the original source of INGAP identification, tends to indicate that at least in rodents, there is an
“emergency program” that allows the reactivation of the developmental beta cell differentiation program to increase (and restore) the beta cell mass after injury. This “save mode” is failing in
humans, supposedly because of autoimmunity in T1D patients
(Martin-Pagola et al., 2008; Meier et al., 2006), and for yet unknown reasons in T2D patients. Can the administration of INGAP
sufficiently restore the endogenous regeneration capacity to
overcome such failures? Would longer treatments, higher doses, or
co-administration of other factors increase INGAP's effect and lead
to higher levels of insulin expression? Undergoing research is
addressing these questions. There is nevertheless increasing evidence for the adult ductal cells plasticity. The successful reprogramming of adult ductal cells into beta cells has been reported,
either through inactivation of the SCF-type E3 ubiquitin ligase
substrate recognition component Fbw7 (Sancho et al., 2014) or
through expression of the cardinal islet developmental regulators
Neurog3, MafA, Pdx1 and Pax6 using an adenovirus-mediated
transgenic system (Lee et al., 2013). In contrast to these studies
using genetic manipulation or viral delivery of exogenous transcription factors, our approach triggers duct-to-beta cell transdifferentiation through a transient exposure to a peptide drug rather
than genetic modification.
In conclusion, we report here that both full-length recombinant
protein rINGAP, and the peptide INGAP-P, induce stepwise activation
of key proteins for embryonic beta cell development in the human
adult pancreatic ductal HPDE cells leading to the expression and
secretion of insulin. After only a 7 day treatment, INGAP treated-cells
are not to fully functional beta cells, but they show beta cell hallmarks demonstrating the plasticity of human adult ductal cells. Although on their own, the inductions reported here are modest, together with previous compelling data, they provide new insights on
INGAP. This model of duct-to-islet cell transdifferentiation therefore
sets the stage for further studies that will elucidate the mechanism of
action of INGAP and related molecules. More importantly, this study
raises the possibility that the treatment of diabetes could become
based on the pharmacological induction of islet regeneration to restore a functioning beta cell mass without resorting to transplantation, genetic manipulations or stem cell therapy as currently conceived. Today's challenge for INGAP research lies in identifying the
right doses, timing and probably the right combination of factors to
reach true beta cell neogenesis and make regenerative medicine a
reality for patients with diabetes.
Conflict of interest
The authors have nothing to disclose.
Acknowledgments
The authors are grateful to Dr. Ming-Sound Tsao, Dr. Dan
Strumpf and Nikolina Radulovich (University of Toronto) for providing the HPDE cell line and for kindly sharing the microarray
data. The authors also wish to thank Dr. Reid Aikin, Tiffany
Assouline, Alexei Gorelik, Dr. Jing Hu, Jason Patapas, and Stephane
Thomas for their assistance. This work was supported by the
Canadian Institutes of Health Research.
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
References
Ahlgren, U., Jonsson, J., Edlund, H., 1996. The morphogenesis of the pancreatic
mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/
PDX1-deficient mice. Development 122, 1409–1416.
Al-Hasani, K., Pfeifer, A., Courtney, M., Ben-Othman, N., Gjernes, E., Vieira, A.,
Druelle, N., Avolio, F., Ravassard, P., Leuckx, G., Lacas-Gervais, S., Ambrosetti, D.,
Benizri, E., Hecksher-Sorensen, J., Gounon, P., Ferrer, J., Gradwohl, G., Heimberg,
H., Mansouri, A., Collombat, P., 2013. Adult Duct-lining cells can reprogram into
beta-like cells able to counter repeated cycles of toxin-induced diabetes. Dev.
Cell 26, 86–100.
Aly, H., Rohatgi, N., Marshall, C.A., Grossenheider, T.C., Miyoshi, H., Stappenbeck, T.
S., Matkovich, S.J., McDaniel, M.L., 2013. A novel strategy to increase the proliferative potential of adult human beta-cells while maintaining their differentiated phenotype. PLoS ONE 8, e66131.
Assouline-Thomas, B., Pilotte, A., Petropavlovskaia, M., Makhlin, J., Ding, J., McLeod,
D., Hanley, S., Massie, B., Rosenberg, L., 2010. Production and characterization of
the recombinant islet neogenesis associated protein (rINGAP). Protein Expr.
Purif. 69, 1–8.
Baeyens, L., Lemper, M., Leuckx, G., De Groef, S., Bonfanti, P., Stange, G., Shemer, R.,
Nord, C., Scheel, D.W., Pan, F.C., Ahlgren, U., Gu, G., Stoffers, D.A., Dor, Y., Ferrer,
J., Gradwohl, G., Wright, C.V., Van de Casteele, M., German, M.S., Bouwens, L.,
Heimberg, H., 2014. Transient cytokine treatment induces acinar cell reprogramming and regenerates functional beta cell mass in diabetic mice. Nat.
Biotechnol. 32, 76–83.
Barbosa, H.C., Bordin, S., Anhe, G., Persaud, S.J., Bowe, J., Borelli, M.I., Gagliardino, J.J.,
Boschero, A.C., 2008. Islet neogenesis-associated protein signaling in neonatal
pancreatic rat islets: involvement of the cholinergic pathway. J. Endocrinol. 199,
299–306.
Bernardo, A.S., Cho, C.H., Mason, S., Docherty, H.M., Pedersen, R.A., Vallier, L.,
Docherty, K., 2009. Biphasic induction of Pdx1 in mouse and human embryonic
stem cells can mimic development of pancreatic beta-cells. Stem Cells 27,
341–351.
Berneman-Zeitouni, D., Molakandov, K., Elgart, M., Mor, E., Fornoni, A., Dominguez,
M.R., Kerr-Conte, J., Ott, M., Meivar-Levy, I., Ferber, S., 2014. The temporal and
hierarchical control of transcription factors-induced liver to pancreas transdifferentiation. PLoS ONE 9, e87812.
Bonner-Weir, S., Taneja, M., Weir, G.C., Tatarkiewicz, K., Song, K.H., Sharma, A.,
O’Neil, J.J., 2000. In vitro cultivation of human islets from expanded ductal
tissue. Proc. Natl. Acad. Sci. 97, 7999–8004.
Borelli, M.I., Del Zotto, H., Flores, L.E., Garcia, M.E., Boschero, A.C., Gagliardino, J.J.,
2007. Transcription, expression and tissue binding in vivo of INGAP and INGAPrelated peptide in normal hamsters. Regul. Pept. 140, 192–197.
Boretti, M.I., Gooch, K.J., 2008. Effect of extracellular matrix and 3D morphogenesis
on islet hormone gene expression by Ngn3-infected mouse pancreatic ductal
epithelial cells. Tissue Eng. Part A 14, 1927–1937.
Criscimanna, A., Speicher, J.A., Houshmand, G., Shiota, C., Prasadan, K., Ji, B., Logsdon, C.D., Gittes, G.K., Esni, F., 2011. Duct cells contribute to regeneration of
endocrine and acinar cells following pancreatic damage in adult mice. Gastroenterology 141, 1451–1462.
Debnath, J., Muthuswamy, S.K., Brugge, J.S., 2003. Morphogenesis and oncogenesis
of MCF-10A mammary epithelial acini grown in three-dimensional basement
membrane cultures. Methods 30, 256–268.
Dhawan, S., Georgia, S., Bhushan, A., 2007. Formation and regeneration of the endocrine pancreas. Curr. Opin. Cell Biol. 19, 634–645.
Dor, Y., Brown, J., Martinez, O.I., Melton, D.A., 2004. Adult pancreatic beta-cells are
formed by self-duplication rather than stem-cell differentiation. Nature 429,
41–46.
Dungan, K.M., Buse, J.B., Ratner, R.E., 2009. Effects of therapy in type 1 and type
2 diabetes mellitus with a peptide derived from islet neogenesis associated
protein (INGAP). Diabetes Metab. Res. Rev. 25, 558–565.
Fleming A, R.L., 2007. The prospects and challenges for islet regeneration as a
treatment for diabetes: a review of islet neogenesis associated protein (INGAP).
Diabetes Sci. Technol. 1, 231–244.
Furukawa, T., Duguid, W.P., Rosenberg, L., Viallet, J., Galloway, D.A., Tsao, M.S., 1996.
Long-term culture and immortalization of epithelial cells from normal adult
human pancreatic ducts transfected by the E6E7 gene of human papilloma
virus 16. Am. J. Pathol. 148, 1763–1770.
Furuya, F., Shimura, H., Asami, K., Ichijo, S., Takahashi, K., Kaneshige, M., Oikawa, Y.,
Aida, K., Endo, T., Kobayashi, T., 2013. Ligand-bound thyroid hormone receptor
contributes to reprogramming of pancreatic acinar cells into insulin-producing
cells. J. Biol. Chem. 288, 16155–16166.
Gao, R., Ustinov, J., Korsgren, O., Otonkoski, T., 2005. In vitro neogenesis of human
islets reflects the plasticity of differentiated human pancreatic cells. Diabetologia 48, 2296–2304.
Gao, R., Ustinov, J., Pulkkinen, M.A., Lundin, K., Korsgren, O., Otonkoski, T., 2003.
Characterization of endocrine progenitor cells and critical factors for their
differentiation in human adult pancreatic cell culture. Diabetes 52, 2007–2015.
Gradwohl, G., Dierich, A., LeMeur, M., Guillemot, F., 2000. neurogenin3 is required
for the development of the four endocrine cell lineages of the pancreas. Proc.
Natl. Acad. Sci. 97, 1607–1611.
Granger, A., Kushner, J.A., 2009. Cellular origins of beta-cell regeneration: a legacy
view of historical controversies. J. Intern. Med. 266, 325–338.
Gu, G., Dubauskaite, J., Melton, D.A., 2002. Direct evidence for the pancreatic
lineage: NGN3þ cells are islet progenitors and are distinct from duct
89
progenitors. Development 129, 2447–2457.
Habener, J.F., Kemp, D.M., Thomas, M.K., 2005. Minireview: transcriptional regulation in pancreatic development. Endocrinology 146, 1025–1034.
Hamblet, N.S., Shi, W., Vinik, A.I., Taylor-Fishwick, D.A., 2008. The Reg family
member INGAP is a marker of endocrine patterning in the embryonic pancreas.
Pancreas 36, 1–9.
Hang, Y., Stein, R., 2011. MafA and MafB activity in pancreatic beta cells. Trends
Endocrinol. Metab. 22, 364–373.
Hao, E., Tyrberg, B., Itkin-Ansari, P., Lakey, J.R., Geron, I., Monosov, E.Z., Barcova, M.,
Mercola, M., Levine, F., 2006. Beta-cell differentiation from nonendocrine epithelial cells of the adult human pancreas. Nat. Med. 12, 310–316.
Hardikar, A.A., Marcus-Samuels, B., Geras-Raaka, E., Raaka, B.M., Gershengorn, M.C.,
2003. Human pancreatic precursor cells secrete FGF2 to stimulate clustering
into hormone-expressing islet-like cell aggregates. Proc. Natl. Acad. Sci. 100,
7117–7122.
Heimberg, H., Bouwens, L., Heremans, Y., Van De Casteele, M., Lefebvre, V., Pipeleers, D., 2000. Adult human pancreatic duct and islet cells exhibit similarities in expression and differences in phosphorylation and complex formation
of the homeodomain protein Ipf-1. Diabetes 49, 571–579.
Heremans, Y., Van De Casteele, M., in’t, Veld, P., Gradwohl, G., Serup, P., Madsen, O.,
Pipeleers, D., Heimberg, H., 2002. Recapitulation of embryonic neuroendocrine
differentiation in adult human pancreatic duct cells expressing neurogenin 3. J.
Cell Biol. 159, 303–312.
Hori, Y., Gu, X., Xie, X., Kim, S.K., 2005. Differentiation of insulin-producing cells
from human neural progenitor cells. PLoS Med 2, e103.
Inada, A., Nienaber, C., Katsuta, H., Fujitani, Y., Levine, J., Morita, R., Sharma, A.,
Bonner-Weir, S., 2008. Carbonic anhydrase II-positive pancreatic cells are progenitors for both endocrine and exocrine pancreas after birth. Proc. Natl. Acad.
Sci. USA 105, 19915–19919.
Jamal, A.M., Lipsett, M., Hazrati, A., Paraskevas, S., Agapitos, D., Maysinger, D., Rosenberg, L., 2003. Signals for death and differentiation: a two-step mechanism
for in vitro transformation of adult islets of Langerhans to duct epithelial
structures. Cell. Death Differ. 10, 987–996.
Jamal, A.M., Lipsett, M., Sladek, R., Laganiere, S., Hanley, S., Rosenberg, L., 2005.
Morphogenetic plasticity of adult human pancreatic islets of Langerhans. Cell
Death Differ. 12, 702–712.
Jiang, W., Shi, Y., Zhao, D., Chen, S., Yong, J., Zhang, J., Qing, T., Sun, X., Zhang, P.,
Ding, M., Li, D., Deng, H., 2007. In vitro derivation of functional insulin-producing cells from human embryonic stem cells. Cell Res. 17, 333–344.
Kopp, J.L., Dubois, C.L., Hao, E., Thorel, F., Herrera, P.L., Sander, M., 2011a. Progenitor
cell domains in the developing and adult pancreas. Cell Cycle 10, 1921–1927.
Kopp, J.L., Dubois, C.L., Schaffer, A.E., Hao, E., Shih, H.P., Seymour, P.A., Ma, J., Sander,
M., 2011b. Sox9þ ductal cells are multipotent progenitors throughout development but do not produce new endocrine cells in the normal or injured adult
pancreas. Development 138, 653–665.
Lawrence, M., Shao, C., Duan, L., McGlynn, K., Cobb, M.H., 2008. The protein kinases
ERK1/2 and their roles in pancreatic beta cells. Acta Physiol. (Oxf.) 192, 11–17.
Lee, J., Sugiyama, T., Liu, Y., Wang, J., Gu, X., Lei, J., Markmann, J.F., Miyazaki, S.,
Miyazaki, J., Szot, G.L., Bottino, R., Kim, S.K., 2013. Expansion and conversion of
human pancreatic ductal cells into insulin-secreting endocrine cells. Elife 2,
e00940.
Lipsett, M., Hanley, S., Castellarin, M., Austin, E., Suarez-Pinzon, W.L., Rabinovitch,
A., Rosenberg, L., 2007. The role of islet neogenesis-associated protein (INGAP)
in islet neogenesis. Cell. Biochem. Biophys. 48, 127–137.
Liu, N., Furukawa, T., Kobari, M., Tsao, M.S., 1998. Comparative phenotypic studies of
duct epithelial cell lines derived from normal human pancreas and pancreatic
carcinoma. Am. J. Pathol. 153, 263–269.
Madrid, V., Borelli, M.I., Maiztegui, B., Flores, L.E., Gagliardino, J.J., Zotto, H.D., 2013.
Islet neogenesis-associated protein (INGAP)-positive cell mass, beta-cell mass,
and insulin secretion: their relationship during the fetal and neonatal periods.
Pancreas 42, 422–428.
Martin-Pagola, A., Sisino, G., Allende, G., Dominguez-Bendala, J., Gianani, R., Reijonen, H., Nepom, G.T., Ricordi, C., Ruiz, P., Sageshima, J., Ciancio, G., Burke, G.
W., Pugliese, A., 2008. Insulin protein and proliferation in ductal cells in the
transplanted pancreas of patients with type 1 diabetes and recurrence of autoimmunity. Diabetologia 51, 1803–1813.
Matveyenko, A.V., Butler, P.C., 2006. Beta-cell deficit due to increased apoptosis in
the human islet amyloid polypeptide transgenic (HIP) rat recapitulates the
metabolic defects present in type 2 diabetes. Diabetes 55, 2106–2114.
Meier, J.J., Lin, J.C., Butler, A.E., Galasso, R., Martinez, D.S., Butler, P.C., 2006. Direct
evidence of attempted beta cell regeneration in an 89-year-old patient with
recent-onset type 1 diabetes. Diabetologia 49, 1838–1844.
Mellitzer, G., Bonne, S., Luco, R.F., Van De Casteele, M., Lenne-Samuel, N., Collombat,
P., Mansouri, A., Lee, J., Lan, M., Pipeleers, D., Nielsen, F.C., Ferrer, J., Gradwohl,
G., Heimberg, H., 2006. IA1 is NGN3-dependent and essential for differentiation
of the endocrine pancreas. Embo J. 25, 1344–1352.
Melloul, D., 2004. Transcription factors in islet development and physiology: role of
PDX-1 in beta-cell function. Ann. N. Y. Acad. Sci. 1014, 28–37.
Naya, F.J., Huang, H.P., Qiu, Y., Mutoh, H., DeMayo, F.J., Leiter, A.B., Tsai, M.J., 1997.
Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine
differentiation in BETA2/neuroD-deficient mice. Genes Dev. 11, 2323–2334.
Offield, M.F., Jetton, T.L., Labosky, P.A., Ray, M., Stein, R.W., Magnuson, M.A., Hogan,
B.L., Wright, C.V., 1996. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122, 983–995.
Ouyang, H., Mou, L., Luk, C., Liu, N., Karaskova, J., Squire, J., Tsao, M.S., 2000. Immortal human pancreatic duct epithelial cell lines with near normal genotype
90
B. Assouline-Thomas et al. / Differentiation 90 (2015) 77–90
and phenotype. Am. J. Pathol. 157, 1623–1631.
Pan, F.C., Wright, C., 2011. Pancreas organogenesis: from bud to plexus to gland.
Dev. Dyn. 240, 530–565.
Petropavlovskaia, M., Daoud, J., Zhu, J., Moosavi, M., Ding, J., Makhlin, J., AssoulineThomas, B., Rosenberg, L., 2012. Mechanisms of action of islet neogenesis-associated protein: comparison of the full-length recombinant protein and a
bioactive peptide. Am. J. Physiol. Endocrinol. Metab. 303, E917–E927.
Pictet, R., Rutter, W.J., 1972. Development of the embryonic endocrine pancreas. In:
Steiner, D.F., Frenkel, M. (Eds.), Handbook of Physiology. Williams & Wilkins,
Washington, DC, pp. 25–66.
Pittenger, G.L., Taylor-Fishwick, D.A., Johns, R.H., Burcus, N., Kosuri, S., Vinik, A.I.,
2007. Intramuscular injection of islet neogenesis-associated protein peptide
stimulates pancreatic islet neogenesis in healthy dogs. Pancreas 34, 103–111.
Rankin, M.M., Wilbur, C.J., Rak, K., Shields, E.J., Granger, A., Kushner, J.A., 2013. betaCells are not generated in pancreatic duct ligation-induced injury in adult mice.
Diabetes 62, 1634–1645.
Rosenberg, L., 1995. In vivo cell transformation: neogenesis of beta cells from
pancreatic ductal cells. Cell Transpl. 4, 371–383.
Rosenberg, L., 1998. Induction of islet cell neogenesis in the adult pancreas: the
partial duct obstruction model. Microsc. Res. Tech. 43, 337–346.
Rosenberg, L., Brown, R.A., Duguid, W.P., 1982. Induction of experimental nesidioblastosis-A model to study pancreatic-islet cell-differentiation and function.
Surgical. Forum 33, 227–230.
Rosenberg, L., Lipsett, M., Yoon, J.W., Prentki, M., Wang, R., Jun, H.S., Pittenger, G.L.,
Taylor-Fishwick, D., Vinik, A.I., 2004. A pentadecapeptide fragment of islet
neogenesis-associated protein increases beta-cell mass and reverses diabetes in
C57BL/6J mice. Ann. Surg. 240, 875–884.
Rukstalis, J.M., Habener, J.F., 2009. Neurogenin3: a master regulator of pancreatic
islet differentiation and regeneration. Islets 1, 177–184.
Sancho, R., Gruber, R., Gu, G., Behrens, A., 2014. Loss of Fbw7 reprograms adult
pancreatic ductal cells into alpha, delta, and beta cells. Cell Stem Cell 15,
139–153.
Schwitzgebel, V.M., Scheel, D.W., Conners, J.R., Kalamaras, J., Lee, J.E., Anderson, D.J.,
Sussel, L., Johnson, J.D., German, M.S., 2000. Expression of neurogenin3 reveals
an islet cell precursor population in the pancreas. Development 127,
3533–3542.
Semakula, C., Pambuccian, S., Gruessner, R., Kendall, D., Pittenger, G., Vinik, A.,
Seaquist, E.R., 2002. Clinical case seminar: hypoglycemia after pancreas transplantation: association with allograft nesidiodysplasia and expression of islet
neogenesis-associated peptide. J. Clin. Endocrinol. Metab. 87, 3548–3554.
Solar, M., Cardalda, C., Houbracken, I., Martin, M., Maestro, M.A., De Medts, N., Xu,
X., Grau, V., Heimberg, H., Bouwens, L., Ferrer, J., 2009. Pancreatic exocrine duct
cells give rise to insulin-producing beta cells during embryogenesis but not
after birth. Dev. Cell 17, 849–860.
Soltani, S.M., O’Brien, T.D., Loganathan, G., Bellin, M.D., Anazawa, T., Tiwari, M.,
Papas, A.N., Vickers, S.M., Kumaravel, V., Hering, B.J., Sutherland, D.E.,
Balamurugan, A.N., 2011. Severely fibrotic pancreases from young patients with
chronic pancreatitis: evidence for a ductal origin of islet neogenesis. Acta
Diabetol.
Stanger, B.Z., Hebrok, M., 2013. Control of cell identity in pancreas development and
regeneration. Gastroenterology 144, 1170–1179.
Taylor-Fishwick, D.A., Bowman, A., Korngiebel-Rosique, M., Vinik, A.I., 2008. Pancreatic islet immunoreactivity to the Reg protein INGAP. J. Histochem. Cytochem. 56, 183–191.
Tsai, P.J., Wang, H.S., Shyr, Y.M., Weng, Z.C., Tai, L.C., Shyu, J.F., Chen, T.H., 2012.
Transplantation of insulin-producing cells from umbilical cord mesenchymal
stem cells for the treatment of streptozotocin-induced diabetic rats. J. Biomed.
Sci. 19, 47.
Uzan, B., Figeac, F., Portha, B., Movassat, J., 2009. Mechanisms of KGF mediated
signaling in pancreatic duct cell proliferation and differentiation. PLoS ONE 4,
e4734.
Van de Casteele, M., Leuckx, G., Baeyens, L., Cai, Y., Yuchi, Y., Coppens, V., De Groef,
S., Eriksson, M., Svensson, C., Ahlgren, U., Ahnfelt-Ronne, J., Madsen, O.D.,
Waisman, A., Dor, Y., Jensen, J.N., Heimberg, H., 2013. Neurogenin 3 þ cells
contribute to beta-cell neogenesis and proliferation in injured adult mouse
pancreas. Cell. Death Dis., e523 (2013/03/09 Ed.).
Wang, R.N., Kloppel, G., Bouwens, L., 1995. Duct- to islet-cell differentiation and
islet growth in the pancreas of duct-ligated adult rats. Diabetologia 38,
1405–1411.
Xiao, X., Chen, Z., Shiota, C., Prasadan, K., Guo, P., El-Gohary, Y., Paredes, J., Welsh, C.,
Wiersch, J., Gittes, G.K., 2013. No evidence for beta cell neogenesis in murine
adult pancreas. J. Clin. Investig. 123, 2207–2217.
Xu, X., D’Hoker, J., Stange, G., Bonne, S., De Leu, N., Xiao, X., Van de Casteele, M.,
Mellitzer, G., Ling, Z., Pipeleers, D., Bouwens, L., Scharfmann, R., Gradwohl, G.,
Heimberg, H., 2008. Beta cells can be generated from endogenous progenitors
in injured adult mouse pancreas. Cell 132, 197–207.
Yanger, K., Stanger, B.Z., 2011. Facultative stem cells in liver and pancreas: fact and
fancy. Dev. Dyn.: Off. Publ. Am. Assoc. Anat. 240, 521–529.
Yuan, S., Rosenberg, L., Paraskevas, S., Agapitos, D., Duguid, W.P., 1996. Transdifferentiation of human islets to pancreatic ductal cells in collagen matrix culture. Differentiation 61, 67–75.
Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H., 2009. Highly
efficient differentiation of human ES cells and iPS cells into mature pancreatic
insulin-producing cells. Cell Res. 19, 429–438.
Zhang, T., Wang, H., Saunee, N.A., Breslin, M.B., Lan, M.S., 2010. Insulinoma-associated antigen-1 zinc-finger transcription factor promotes pancreatic duct cell
trans-differentiation. Endocrinology 151, 2030–2039.
Zhou, J., Pineyro, M.A., Wang, X., Doyle, M.E., Egan, J.M., 2002. Exendin-4 differentiation of a human pancreatic duct cell line into endocrine cells: involvement
of PDX-1 and HNF3beta transcription factors. J. Cell Physiol. 192, 304–314.
Zhou, Q., Brown, J., Kanarek, A., Rajagopal, J., Melton, D.A., 2008. In vivo reprogramming of adult pancreatic exocrine cells to beta-cells. Nature 455, 627–632.