revisión taxonómica y códigos de barras de dna para zamia

REVISIÓN TAXONÓMICA Y CÓDIGOS DE BARRAS DE DNA
PARA ZAMIA L. EN MEGAMÉXICO
TESIS QUE PRESENTA EL M. C. EDISON FERNANDO NICOLALDEMOREJÓN PARA OBTENER EL GRADO DE DOCTOR EN CIENCIAS
Xalapa, Veracruz, México 2009
Aprobación final del documento final de tesis de grado:
REVISIÓN TAXONÓMICA Y CÓDIGOS DE BARRAS DE DNA PARA ZAMIA
L. EN MEGAMÉXICO
Nombre
Firma
Director:
Dr. Andrew P. Vovides
________________________
Comité Tutorial:
Dr. Dennis Wm. Stevenson
________________________
Dra. Victoria Sosa Ortega
________________________
Dr. Jorge González Astorga
________________________
Jurado
Dr. Francisco Vergara Silva
________________________
2
RECONOCIMIENTOS
•
A la Red Latinoamericana de Botánica (RLB) por la beca otorgada para estudios de
doctorado (RLB-06-D2).
•
Al Instituto de Ecología, A. C., por el apoyo económico para desarrollar una
estancia académica en el Instituto de Biología de la Universidad Nacional
Autónoma de México.
•
A la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad
(CONABIO), que a través de proyecto GE004, financió parte de este trabajo de
tesis.
•
A los siguientes investigadores por su apoyo: Andrew P. Vovides, Dennis Wm.
Stevenson, Jorge González Astorga, Francisco Vergara Silva, Victoria Sosa,
Alejandro Espinosa de los Monteros, Octavio Rojas Soto, Mario Vázquez Torres,
Fernando Chiang, Gonzalo Castillo, Francisco Ornelas, Sergio Avendaño, Walter
Palacios, Calaway H. Dodson, Carlos Cerón, John Janovec y David Neill.
•
A toda mi familia: mi madre Olga Marina, mis hermanos: Patricia, Silvia, Diego y
Alexandra.
•
A Julia Hernández Villa técnico del Laboratorio de Genética de Poblaciones del
Instituto de Ecología, A. C.
•
A mis amigos: David Martínez, Alejandro Abundis, Nadia Rivera, Pablo Carrillo,
Dánae Cabrera, Lalo Ruiz, Deneb García, Xavier Barrientos, Carlos Durán,
Fernando Vaz de Mello, Jaime Pacheco, Julián Bueno, Claudia Hornung.
•
A todo del personal del Jardín Botánico Francisco Javier Clavijero: Carlos Iglesias,
Orlik Gómez, Víctor Luna, Philip J. Brewster, Julián Pérez, Daniel Hernández,
Javier Hernández, Joel López y Genaro Justo.
3
DEDICATORIA
A Zamia Fernanda, Elvia Rubí y Olga Marina
4
DECLARACIÓN
Excepto cuando es explícitamente indicado en el texto, el trabajo de
investigación contenido en esta tesis fue efectuado por el M. C. Edison Fernando
Nicolalde Morejón como estudiante de la carrera de Doctorado en Ciencias entre
septiembre del 2006 y septiembre del 2009, bajo la supervisión del Dr. Andrew P.
Vovides.
Las investigaciones reportadas en esta tesis no han sido utilizadas anteriormente
para obtener otros grados académicos, ni serán utilizadas para tales fines en el futuro.
Candidato:
________________________________________
M. C. Edison Fernando Nicolalde Morejón
Director de tesis:
________________________________________
Dr. Andrew P. Vovides
5
ÍNDICE
Resumen…………………………….…………………………………………...……...9
CAPITULO I—Introducción
El género Zamia L. en Megaméxico: de la taxonomía alfa a los códigos de barras
genéticos………………………………………………….…………………………....10
Resumen………………………………………………………………………...….12
Abstract……………………………………………………………………….....…12
Introducción………………………………………………………………….…..…14
Materiales y Métodos…………………………………………………………...….15
Resultados y Discusión……………………………………………………………..16
Morfología y grupos afines……………………………………………………..16
Megaméxico, diversidad y endemismo………………………...........................19
Intensidad de colectas botánicas………………..………………………………20
Taxonomía alfa y código de barras moleculares en Zamia…………………….21
Perspectivas del género Zamia en Megaméxico………………………………..24
Agradecimientos…………………………………………………………………....26
Literatura citada…………………………………………………………………….26
Figura 1……………………………………………………………………………..33
Tabla 1……………………………………………………………………………...34
Tabla 2………………………………………………………………………….…..35
Tabla 3……………………………………………………………………………...36
Tabla 4……………………………………………………………………………...38
CAPITULO II—Taxonomic revision of Zamia in Mega-Mexico……………….….39
Abstract………………………………………………………………………….….41
Resumen…………………………………………………………………………....41
Introduction…………………………………………………………………….......43
Materials and Methods...…….…………………………………………………......44
Results…………………………………………………………………………...…45
Habitat…………………………………………………………………………...…45
Morphology……………………………………………………………………...…46
Habit………………………………………………………………………...….46
6
Trichoms………………………………………………………………………..47
Reproductive structure…………………………………………………….……47
Chromosome numbers………………………………………………………….48
Distribution and endemism…………………………………………………………50
Taxonomic treatment……………………………………………………………….51
Species dubium…………………………………………………………………96
Acknowledgments………………………………………………………………….98
Literature cited……………………………………………………………..……….98
Figura 1……………………………………………………………………...….…105
Figura 2……………………………………………………………………...….…106
Figura 3……………………………………………………………………...….…107
Figura 4………………………………………………………………...……….…108
Figura 5……………………………………………………………...………….…109
Figura 6………………………………………………………………...………….110
Figura 7……………………………………………………………..….………….111
Figura 8……………………………………………………………...…………….112
Figura 9…………………………………………………………..….…………….113
Figura 10…………………………………………………………………………..114
Figura 11…………………………………………………………………………..115
Figura 12……………………………………………………………………..……116
Figura 13………………………………………………………………..…………117
CAPITULO III— DNA barcoding in the Mexican cycads: a character attribute
organization system (CAOS) approach…………………………………….………118
Abstract……………………………………………………………………………120
Introduction………………………………………………………………….……121
Materials and Methods……………………………………………....................…126
Sampling of biological materials……………………………………...………126
Leaf genomic DNA extraction and PCR amplification (including DNA
sequencing).…………………………………….……………..………………127
Sequence analysis.……………………………………………..……...………128
Character-based analysis/identification of ‘DNA diagnostics’ and determination
of DNA barcodes in Mexican cycad species……………………..………...…128
7
Results and discussion…….………………………………………………………129
A DNA barcode for land plants: difficult roads toward a consensus................129
DNA barcoding in the cycads redux I: surprising results under the assumptions
of a character-based method.............................................................................130
DNA barcoding in the cycads redux II: is the ‘Seberg-Petersen limit’ real?...136
Conclusions: gene quantity versus universality in plant DNA barcoding, and
‘the wisdom of the local’...................................................................................138
Acknowledgements……………………………………………………….………139
References……………………………………………………………...…………140
Tables………………………………………………………………….……..……148
Figures captions……………………………………………………….………..…149
Tabla 1………………………………………………………………….…………150
Tabla 2………………………………………………………………….…………151
Tabla 3……………………………………………………………………….……153
Tabla 4………………………………………………………………….…………154
Figure 1……………………………………………………………….…..……….155
Figure 2……………………………………………………………….…..……….156
CAPITULO IV—Discusión y conclusión general……………...………….…….…157
1. Implicaciones taxonómicas………………………………..................................158
2. Códigos de barras moleculares y la taxonomía del genero Zamia.………..…...159
3. Literatura citada…………………………………………………...…….…...…161
8
RESUMEN
Los objetivos de esta tesis son 1) determinar y describir las especies del género Zamia
L. en Megaméxico, área geográfica que abarca los países de México, Guatemala,
Belice, Honduras, El Salvador y el Norte de Nicaragua, y 2) determinar la combinación
optima de loci necesario para identificar molecularmente las especies del género, bajo la
aproximación de los Códigos de Barras Moleculares.
La tesis está dividida en cuatro capítulos que brevemente se describen a
continuación. En el primer capítulo, el cual funge como introductorio, se presenta una
síntesis de la variación morfológica y la formación de grupos afines, luego se describe
la distribución y las áreas de mayor concentración de riqueza que el género tiene en
Megaméxico; para finalmente presentar las perspectivas sistemáticas del género en el
contexto de los códigos de barras moleculares. El segundo capítulo, corresponde a la
revisión taxonómica del género Zamia, revisión que incluye una clave dicotómica,
descripciones botánicas para cada una de las especies, material de herbario revisado,
etimología y principales atributos morfológicos que representan caracteres diagnósticos
para estas especies. También se indican nuevas designaciones de tipos nomenclaturales.
En el tercer capítulo, es un estudio que aborda el análisis de sitios diagnósticos bajo la
perspectiva de los códigos de barras moleculares para las especies del género Zamia de
la revisión taxonómica, también se incluye en este análisis a todas la especies de
Cycadas Mexicanas y al menos a un representante de los géneros no Mexicanas del
orden Cycadales. En el cuarto capítulo se discuten los resultados más relevantes de esta
tesis, su importancia y contribución al conocimento de la biología del género Zamia en
Megaméxico.
9
CAPITULO I—Introducción
Perspectivas sistemáticas de Zamia (Zamiaceae) en Megaméxico: de la taxonomía
alfa a los códigos de barras genéticos
(Sometido a la Revista Mexicana de Biodiversidad)
10
Perspectivas sistemáticas de Zamia (Zamiaceae) en Megaméxico: de la taxonomía
alfa a los códigos de barras genéticos
Fernando Nicolalde-Morejón1, 2*, Jorge González-Astorga1, Francisco Vergara-Silva3 y
Andrew P. Vovides4
1
Laboratorio de Genética de Poblaciones, Departamento de Biología Evolutiva.
Instituto de Ecología, A. C., km 2.5 Antigua Carretera a Coatepec No. 351, Xalapa
91070, Veracruz, México
2
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Av. Luis Castelazo
Ayala s/n, Col. Industrial Ánimas, Xalapa 91190, Veracruz, México
3
Laboratorio de Sistemática Molecular (Jardín Botánico), Instituto de Biología,
Universidad Nacional Autónoma de México, 3er Circuito Exterior, Ciudad
Universitaria, Coyoacán 04510, México, D. F. México
4
Laboratorio de Biología Evolutiva de Cycadales, Departamento de Biología Evolutiva.
Instituto de Ecología, A. C., km 2.5 Antigua Carretera a Coatepec No. 351, Xalapa
91070, Veracruz, México
*Autor correspondiente: [email protected]
11
Resumen. El género Zamia en Megaméxico cuenta con 22 especies descritas y una
entidad bajo el estatus de species dubium (Z. verschaffeltii). En las últimas décadas, el
género Zamia ha recibido atención en tratamientos florísticos regionales y, de manera
sobresaliente, en una monografía especializada. Además, algunas especies del género
han sido objeto de varios estudios en citogenética, ecología y genética de poblaciones.
El objetivo de este trabajo es presentar información actualizada sobre las especies de
Zamia que se distribuyen en Megaméxico, con base en una revisión de ejemplares de
herbario y trabajo de campo. Adicionalmente se hace énfasis en los complejos de
especies que aún requieren investigación para esclarecer sus límites taxonómicos. La
discusión se plantea bajo la perspectiva de la necesidad de investigación a nivel
poblacional con datos moleculares, que se enmarca en la aproximación conocida como
‘códigos de barras de DNA’ (“DNA barcoding”). Se concluye que la creación de una
base de datos moleculares que funcione como una ‘biblioteca de referencia de códigos
de barras’ para todas las especies de Zamia en Megaméxico será de utilidad en varios
aspectos de la investigación básica y aplicada de las cycadas neotropicales.
Palabras clave: Diversidad, DNA Barcoding, Megaméxico, Taxonomía, Zamia
Abstract. The genus Zamia in Megamexico consists of 22 valid species and one
species dubium (Z. verschaffeltii) and over the last decades Zamia has undergone
regional floristic treatments, one specialized monograph and some species have been
object to a number of studies in cytotaxonomy, cytogenetics, ecology and population
genetics. The objective of this study is to present updated information on the genus in
Megamexico based herbarium voucher revisions and field studies. Emphasis is made
on species complexes that still require further studies to elucidate taxonomic limits and
12
the need for population level studies using molecular data to underpin a DNA barcoding
approach is discussed. We conclude that the creation of a molecular database that can
function as a ‘DNA-barcode reference library’ covering Zamia species in Megamexico
will be of utility to varying aspects of basic and applied research on neotropical cycads.
Key words: Diversity, DNA Barcoding, Megamexico, Taxonomy, Zamia.
13
Introducción
El orden Cycadales consta de tres familias: Cycadaceae, Stangeriaceae y
Zamiaceae (Stevenson, 1992). Zamiaceae incluye, con mucha diferencia, el mayor
número de géneros descritos para el orden, y en el Neotrópico se distribuyen cinco
géneros: Chigua D. W. Stev. y Microcycas (Miq.) A. DC. endémicos de Colombia y
Cuba, respectivamente; Ceratozamia Brongn. y Dioon Lindl. endémicos de México y
Zamia L. con una distribución neotropical.
La primera monografía de Zamia incluyó diez especies (Miquel, 1842).
Posteriormente, se registraron 23 especies (Miquel, 1851; 1861) de las cuales 14 se
consideran sinónimos hoy en día (Hill et al., 2007); más tarde, Schuster (1932) reportó
26 especies. Trabajos taxonómicos regionales (Sabato, 1990; Stevenson, 1987; 1991a,
b; 1993; 2001a, b; 2004; Norstog y Nicholls, 1997, Nicolalde-Morejón et al., 2008), así
como la tipificación de nombres válidos (Stevenson y Sabato, 1986), han detectado
errores nomenclaturales y taxonómicos en la revisión propuesta por Schuster (1932),
debido principalmente al insuficiente trabajo de campo y a la escasa revisión de las
colecciones botánicas. A la fecha, de acuerdo con las estimaciones taxonómicas más
recientes, Zamia consta de 61 especies válidas (Hill et al., 2007; Taylor et al., 2009),
distribuidas desde Georgia y Florida en Estados Unidos hasta Bolivia y el suroeste de
Brasil (Balduzzi et al., 1982; Sabato, 1990; Norstog y Nicholls, 1997; Stevenson,
2001a). Dentro de este último grupo de especies, 22 son endémicas a Megaméxico.
Zamia es uno de los géneros del orden Cycadales más difíciles de
caracterizar (Norstog y Nicholls, 1997), debido a que sus patrones de variación
morfológica, ecológica, citológica (Marchant, 1968; Vovides, 1983; Moretti y Sabato,
1984; Moretti, 1990; Moretti et al., 1991; Vovides y Olivares 1996; Norstog y Nicholls,
1997; Nicolalde-Morejón et al., 2009a), y genética (González-Astorga et al., 2006;
14
Limón, 2009) son muy complejos. Además, debido a los ciclos de vida largos y al
tamaño y volumen de las estructuras reproductivas de las especies del género, escasos
especímenes botánicos incluyendo estas estructuras son depositados en museos y
herbarios. De hecho, los caracteres diagnósticos para identificar las especies de Zamia
están basados principalmente en atributos foliares, los cuales son muy variables. Esta
circunstancia ha traído confusión en la delimitación y reconocimiento de especies del
género, lo cual se refleja directamente en un considerable número de sinonimias (58,
para ser exactos; Hill et al., 2007).
El presente artículo es parte inicial de un proyecto monográfico de largo
alcance del género Zamia, el cual además de incorporar los aspectos tradicionales de
una monografía incluirá evidencia molecular con la aproximación conocida como
‘DNA barcoding’ o ‘código de barras genético’ (Hebert et al., 2003). En línea con lo
anterior, este artículo tiene los siguientes objetivos: (a) determinar cuántas y cuáles
especies de Zamia se distribuyen en Megaméxico (sensu Rzedowski, 1991), (b)
presentar un panorama histórico-taxonómico del género haciendo énfasis en los
complejos de especies que se requieren estudiar a mayor profundidad o detalle, y
finalmente (c) discutir la utilidad de los códigos de barras para identificar, e incluso
delimitar especies en el grupo.
Materiales y Métodos
Para la realización de este trabajo se revisó el material botánico disponible
en los siguientes herbarios: B, BM, CIB, CHIP, CICY, ECOSUR, ENCB, F, FCME,
FLAS, FTG, HEM, IBUG, IEB, K, LE, MEXU, MO, NY, SERO, U, UADY, UAMIZ,
US, W, WIS, XAL, XALU y ZEA. La información se complementó con la consulta de
15
las descripciones originales así como de los tratamientos taxonómicos tanto regionales
como de todo el género.
Con el objeto de estudiar los endemismos con referencia geográfica natural y
usando criterios históricos y florísticos, Rzedowski (1991) delimitó áreas para su
definición y posterior análisis, áreas a las cuales llamó, precisamente, ‘Megaméxico’.
Siguiendo el trabajo de dicho autor, nosotros hacemos uso del concepto ‘Megaméxico
2’, región que abarca a México, Guatemala, Honduras, Belice, El Salvador, así como el
norte de Nicaragua, para la descripción y análisis de las especies del género Zamia que
resultan endémicas para esta región.
Resultados y Discusión
Morfología y grupos afines
Zamia incluye plantas dioicas al igual que los demás géneros del orden
Cycadales. Asimismo, se trata de un género entomófilo y de larga vida, con
distribución restringida a los trópicos. Zamia presenta además una amplia diversidad de
formas morfológicas y ecológicas: por ejemplo, mientras que la endémica colombiana
Z. wallisii A. Brau presenta folíolos fuertemente acanalados de hasta 15 cm de ancho,
con nervaduras conspicuas, Z. spartea A. DC. –endémica a Oaxaca, México– presenta
folíolos de hasta 1 cm de ancho, totalmente lisos. El género también incluye especies
con tallos arbóreos, como es el caso de Z. obliqua A. Braun (Colombia y Panamá), que
puede llegar a medir hasta 5 m de alto (Stevenson, 2004). En contraste, también
presenta especies como Z. paucijuga Wieland –otro endemismo de México– y Z.
amazonum D. W. Stev. –proveniente de la Amazonía de Colombia, Ecuador, Perú y
Brasil– que posee tallos subterráneos. Además, Z. pseudoparasitica Yates in Seem.,
especie endémica de Panamá, representa el único caso de especie epifita para el orden
16
Cycadales (Stevenson, 1993). En términos ecológicos, especies de Zamia se encuentran
en hábitats muy contrastantes, como es el caso de Z. gentryi Dodson, endémica de
Ecuador (Nicolalde-Morejón, 2007) que se distribuye en bosques húmedos premontanos
(sensu Holdridge, 1978), con lluvias de hasta 6500 mm en promedio al año. Por su
parte, Z. encephalartoides D. W. Stev. –endémica de Colombia– crece en hábitats secos
(Stevenson, 2004), mientras que Z. roezlii Linden, distribuida en el Chocó
Biogeográfico (Ecuador y Colombia), se conoce a partir de poblaciones creciendo en
manglares. Altitudinalmente, Zamia se distribuye desde el nivel del mar y sobre dunas
costeras (i. e. Z. furfuracea L. f., México) hasta los 2700 metros, como ocurre con Z.
montana A. Braun, especie endémica a bosques húmedos premontanos en Antioquia,
Colombia (Stevenson, 2001a).
Tomando en cuenta la morfología –especialmente, hábito, hojas y folíolos–
de múltiples especímenes dentro del género Zamia (F. Nicolalde-Morejón,
observaciones no publicadas; Vovides et al., 2007), nosotros consideramos que en
Megaméxico existen varios complejos de especies para el género, los cuales podrían ser
de difícil identificación. Por ejemplo, en el noreste de México (Tamaulipas, San Luís
Potosí, Querétaro, Hidalgo y Norte de Veracruz) ocurren dos especies en apariencia
similares: Z. fischeri Miq. y Z. vazquezii D. W. Stev., Sabato, A. Moretti y De Luca.
Este par de entidades, aquí denominado “complejo Zamia fischeri”, incluye plantas
generalmente pequeñas con folíolos papiráceos, dentaciones sobre los bordes de los
folíolos y tallos subterráneos; otros caracteres diagnósticos son principalmente atributos
asociados a estructuras reproductivas femeninas (Nicolalde-Morejón et al., 2009a). Por
otro lado, en el sureste de México (Veracruz, Oaxaca, Tabasco y Chiapas) se encuentra
el “complejo Zamia katzeriana” que incluye a Z. katzeriana (Regel) Retting, Z.
cremnophila Vovides, Schutzman & Dehgan, Z. lacandona Schutzman & Vovides y Z.
17
purpurea Vovides, J. D. Rees & Vázq. Torres. Estas especies se caracterizan por
presentar folíolos anchos (3-11 cm), coriáceos y tallos subterráneos (Nicolalde-Morejón
et al., 2008). Aunque Z. purpurea es incluida en este grupo, sus folíolos acanalados con
nervaduras conspicuas –atributo único entre las especies en Megaméxico– la asemejan
más al complejo basado en Z. skinneri Warsz. ex A. Dietrich, que se distribuye a lo
largo del Chocó Biogeográfico.
El complejo taxonómico que se construye alrededor de Zamia loddigesii (i.e.
Z. loddigesii Miq., Z. paucijuga Wieland y Z. polymorpha D. W. Stev., A. Moretti y
Vázq. Torres) incluye las especies con la más amplia distribución en Megaméxico (ver
Figura 1), los números cromosómicos más altos del género (Moretti, 1990) y, desde el
punto de vista morfológico, los taxa que presentan más dificultad en ser caracterizados.
Entre los atributos fenotípicos del complejo están los folíolos coriáceos, linearlanceolados a oblanceolados y los tallos subterráneos. Sin embargo, bajo la misma
perspectiva morfológico-vegetativa, consideramos que Z. spartea (endémica al Istmo de
Tehuantepec-México) y Z. prasina W. Bull (endémica de Belice) deberían ser incluidas
en este complejo, para posteriores estudios taxonómicos y evolutivos. Aunque no
necesariamente existen problemas para su identificación, entre especies del grupo
compuesto por Z. tuerckheimii Donn. Sm. (Guatemala), Z. soconuscensis Schutzman,
Vovides y Dehgan (Chiapas, México) y Z. inermis Vovides, J. D. Rees & Vázq. Torres
(Veracruz, México) se comparten caracteres como los tallos epigeos y los folíolos con
los bordes enteros. Sin embargo, debido a la presencia de folíolos linear-lanceolados,
coriáceos y bordes enteros, los ejemplares de herbario de Z. inermis (usualmente
carentes de estructuras reproductivas) podrían ser confundidos con ejemplares de Z.
encephalartoides D. W. Stevenson. Además es necesario considerar a Z. onanreyesii C.
Nelson & G. Sandoval, especie que también presenta tallos aéreos de hasta 2 m de alto,
18
pero que a diferencia de las anteriores posee folíolos subcoriaceos y márgenes
serrulados sobre el tercio distal.
Las especies Zamia oreillyi C. Nelson, Z. sandovallii C. Nelson y Z.
standleyi Schutzman, todas de reciente descripción, se caracterizan por tener folíolos
lisos, subcoriaceos, bordes serrulados a dentados y tallos subterráneos. Aparte, dichas
especies se distribuyen en una misma región (Honduras y Guatemala); como su
identificación y delimitación a través de caracteres morfológicos tanto vegetativos como
reproductivos esté bien definido, actualmente no existen problemas taxonómicos
asociados a este grupo. Finalmente, tanto Z. variegata Warsz. como Z. furfuracea son
especies fáciles de caracterizar e identificar. Z. variegata tiene folíolos variegados por
el haz, atributo único dentro del género Zamia; en tanto, Z. furfuracea presenta tallos
aéreos generalmente bifurcados, folíolos coriáceos, abovados a oblanceolados con
indumento amarillento. Esta última especie crece de manera particular sobre dunas
costeras en la región centro-sur del estado de Veracruz, México.
Megaméxico, diversidad y endemismo
Considerando las 22 especies de Zamia conocidas actualmente para
Megaméxico (Nicolalde-Morejón et al., 2009a; ver Tabla 3), México cuenta con doce
especies endémicas –la mayor diversidad para la región– seguido de Honduras, con tres,
Guatemala con dos, y Belice con una especie (Tabla 1). En Megaméxico encontramos
además dos centros de mayor diversidad (Figura 1). El primero está ubicado en el
sureste de México (sur de Veracruz, Tabasco, sureste de Oaxaca y norte de Chiapas),
donde se distribuyen siete especies, todas ellas simpátricas (i. e., Z. cremnophila, Z.
katzeriana, Z. lacandona, Z. loddigesii, Z. purpurea, Z. polymorpha y Z. spartea),
mientras que el segundo centro se ubica entre Guatemala (Alta Verapaz e Izabal) y
19
Honduras (Atlántida, Cortés y Santa Bárbara), en el cual ocurren siete especies (i. e. Z.
monticola, Z. onanreyesii, Z. oreillyi, Z. sandovallii, Z. standleyi, Z. tuerckheimii y Z.
variegata). Estos sitios tienen un clima cálido húmedo donde la temperatura promedio
anual es de 25°C y la precipitación son de 3 000 a 4 000 mm por año (Toledo, 1982).
Ambos sitios comparten tipos similares de vegetación, particularmente Bosque Tropical
Perennifolio (sensu Rzedowski, 1978).
Estos datos de acumulación de biodiversidad para Zamia son contrastantes
con áreas como la planicie costera del Pacífico, donde se registran únicamente tres
especies (i.e. Z. herrerae, Z. paucijuga y Z. soconuscensis) a lo largo de
aproximadamente 2000 km distribuidos entre México, Guatemala y El Salvador. Esta
amplia zona de distribución está asociada a diferentes tipos de vegetación, como Bosque
Tropical Perennifolio, Bosque Tropical Subcaducifolio, Bosque de Coníferas y de
Quercus (sensu Rzedowski, 1978); algo similar pasa en la península de Yucatán
(México), el Petén en Guatemala y parte de Belice, donde ocurre únicamente Z.
polymorpha (Figura 1).
Intensidad de colectas botánicas
En términos de las colectas botánicas realizadas hasta la fecha, los dos sitios
de alta concentración de riqueza de especies están muy poco representados. Por
ejemplo, para Zamia cremnophila –correspondiente a la primera región– sólo hay cuatro
colectas, caso que se repite en Z. tuerckheimii (segunda región). En contraste, las
especies más colectadas son Z. polymorpha (con 116 colectas), Z. paucijuga (con 114) y
Z. loddigesii (con 80), todos ellas taxa de amplia distribución. A su vez, debe notarse
que sólo una pequeña parte de la distribución de estas especies converge con las áreas
de alta riqueza, como sucede con Z. loddigesii y Z. polymorpha (ver Figura 1). Es
20
posible que este patrón se deba a dos razones: (i) al hecho de que las especies menos
colectadas tienen rangos de distribución muy restringido, y en muchos casos sólo se
conocen desde la localidad tipo; y (ii) a que las especies de amplia distribución, como Z.
loddigesii, Z. paucijuga y Z. polymorpha, ocurren en áreas de fácil acceso y que además
históricamente han sido colectadas ampliamente. Haciendo uso de los reportes actuales
de colectas botánicas para este grupo (ver Tabla 2), consideramos que son necesarias
más exploraciones botánicas, principalmente a regiones como Montes Azules (en
Chiapas, México), la región de Alta Verapaz e Izabal en Guatemala, la región sureste de
Honduras y el noreste de Nicaragua.
Taxonomía alfa y códigos de barras moleculares en Zamia
Como mencionamos arriba, Megaméxico es una región biogeográfica con
altos niveles de diversidad y endemismo para Zamiaceae, superada únicamente por
Australia (Hill et al., 2007; Vovides et al., 2008a, b; Nicolalde-Morejón et al., 2009b,
ver Tabla 4). En esta familia de cycadas, y en particular en el género Zamia, los
avances en citogenética, ecología y genética de poblaciones (para una revisión
actualizada sobre el tema, ver Vovides et al., 2007) están en vías de ser
complementados por el uso de caracteres moleculares, semejantes a los que ya han sido
usados para avanzar enormemente en la inferencia filogenética entre los géneros de
cycadas a nivel mundial (Treutlein y Wink 2002; Hill et al., 2003; Bogler y FranciscoOrtega 2004; Rai et al., 2004; Chaw et al., 2005; Zgurski et al., 2008). De hecho,
matrices de DNA para análisis filogenéticos ya han comenzado a ser empleadas en las
cycadas neotropicales (Ceratozamia Brongn.; González y Vovides, 2002; Dioon Lindl.;
Bogler y Francisco-Ortega 2004, González et al., 2008; Zamia, Caputo et al., 2004).
21
Entre las líneas de investigación actuales que abordan el estudio de la
diversidad biológica mediante el uso de datos genómicos, mediante el uso de
herramientas bioinformáticas, se encuentra la aproximación conocida como ‘DNA
barcoding’ o ‘códigos de barras genéticos’, formalmente inaugurada con la propuesta
hecha por Hebert et al. (2003a) usando parte de la secuencia que codifica para la enzima
citocromo oxidasa 1 (CO1) para identificar especies de manera automatizada, confiable
y rápida (para otros ejemplos de uso de los códigos de barras en el ámbito zoológico,
ver Hebert et al., 2003b; Barrett et al., 2005; Hajibabaei et al., 2006; Stoeckle y Hebert,
2008). Para nuestros propósitos, y a manera de síntesis de una intensa labor académica
en un espacio de apenas cinco años, podemos afirmar que los códigos de barras
moleculares se presentan como una herramienta con grandes posibilidades de
complementar el trabajo taxonómico tradicional. Esto es especialmente cierto en lo que
atañe a la identificación de especímenes ya asignados a un binominal latino válido –es
decir, a una hipótesis taxonómica robusta basada en análisis previos de caracteres
morfológicos. Además de su papel en el plano de la identificación, el DNA barcoding
podría ser un auxiliar en el descubrimiento de nuevas especies, aunque este tema no está
exento de controversia (cf. Tautz et al., 2003; Seberg et al., 2003; DeSalle, 2006, 2007).
La aplicación de los códigos de barras de DNA en plantas, particularmente
provenientes de regiones neotropicales, está atrayendo mucho interés, pues la diversidad
biológica en estas regiones del planeta está compuesta en gran medida por especies
vegetales. Sin embargo, dada la complejidad involucrada en la selección de las regiones
que podrían funcional mejor como fuentes de los códigos de barras en plantas, la
oficialización de dicha selección apenas tuvo lugar en el mes de agosto de 2009
(Hollingsworth et al., 2009). En este contexto, las especies del género Zamia con
distribución en Megaméxico mantienen su interés, debido a que constituyen un grupo de
22
especies relativamente pequeño (ver Tabla 4), con una clara relevancia evolutiva para el
resto de las plantas con semilla, y en virtud de que incluye especies bajo alguna
categoría de protección.
En principio, cabría esperar que la identificación de especies del género
Zamia en Megaméxico bajo la aproximación de los códigos de barras moleculares sea
exitosa; existe el antecedente de un estudio piloto de códigos de barras genéticos en las
cycadas del mundo que así lo sugieren (Sass et al., 2007). Dicho trabajo sería de gran
utilidad para la corroboración y/o reforzamiento de las hipótesis individuales
correspondientes a las 22 especies para esta región, propuesta en el último tratamiento
taxonómico (Nicolalde-Morejón et al., 2009a). Las identificaciones moleculares
alcanzadas con DNA barcoding en Zamia tendrían que ser, por supuesto, consideradas
de manera paralela con aquellos aspectos que la taxonomía tradicional aun no ha
logrado solventar, en especial al momento de identificar taxa que tengan una amplia
variación morfológica entre y dentro de especies y, que a su vez presentan una amplia
distribución geográfica (i. e. Z. paucijuga, Z. loddigesii y Z. polymorpha, ver Figura 1).
Resumiendo, la posibilidad de contar con atributos diagnósticos moleculares,
los cuales funcionarían de manera análoga a los caracteres morfológicos necesarios para
la descripción de las especies, contribuirá a establecer los límites entre especies y/o al
descubrimiento de ‘especies crípticas’. En última instancia, consideramos que el
acercamiento a la identificación y delimitación de especies usando DNA como una
nueva fuente de datos encuentra su marco conceptual de referencia óptimo de los
conceptos de ‘taxonomía integrativa’ y ‘círculo taxonómico’ propuestos por DeSalle et
al. (2005).
Es importante enfatizar también que un objetivo ulterior de la construcción
de una biblioteca molecular de referencia hecha de secuencias de nucleótidos para los
23
loci con mayor variabilidad –los códigos de barras de DNA, en sentido estricto- para el
género Zamia y los otros géneros de cycadas en Megaméxico es su aprovechamiento
por usuarios externos, en contextos de biología de la conservación. Esta utilización de
la base de referencia de DNA barcodes se ejemplificaría bien, por ejemplo, en
situaciones de recuperación de información de ejemplares de decomiso por instancias
nacionales o internacionales (como las que se indican de acuerdo con la Convención
sobre el Comercio Internacional de Fauna y Flora Silvestres en Peligro de Extinción, o
CITES, por sus siglas en inglés), a partir de saqueos ilegales.
Perspectivas del género Zamia en Megaméxico
Considerando la historia nomenclatural y la complejidad morfológica de las
especies aquí analizadas, el “complejo Zamia loddigesii” es claramente sobresaliente.
Consideramos que se trata de un ensamblaje taxonómico que aún requiere de
investigación detallada para aclarar su taxonomía y nomenclatura, como se detalla a
continuación.
Zamia loddigesii representa sin duda la especie más compleja desde el punto
de vista nomenclatural, con un total de 12 nombres afines publicados y que actualmente
representan sinonimias (Nicolalde-Morejón et al., 2009a). A pesar de ser una especie
ampliamente colectada a lo largo del Golfo de México desde el siglo XIX, hasta el año
2008 se desconocía de la existencia de un ejemplar de herbario que pudiera fungir como
tipo nomenclatural, por lo que Stevenson y Sabato (1986) habían lectotipificado el
protólogo. Sin embargo, investigaciones recientes muestran un espécimen [i.e. Van
Houtte 3374 (U)] que predata a la descripción de la especie, y que a su vez concuerda
con los atributos morfológicos descritos por Miquel (1843). Por esta razón, dicho
24
ejemplar ha sido considerado para su designación como lectotipo de esta especie
(Nicolalde-Morejón et al., 2009a, ver Tabla 3).
En contraste, aunque taxonómicamente Zamia paucijuga y Z. polymorpha no
han experimentado cambio alguno, son junto a Z. loddigesii las especies catalogadas
como de mayor dificultad para su identificación taxonómica. Esto se debe básicamente
a que estas tres especies muestran patrones de variación morfológicos muy similares, lo
cual complica su identificación desde ejemplares de herbario hasta colecciones vivas.
Esta situación se agudiza en ausencia de estructuras femeninas, razón por la que
convencionalmente su determinación siempre ha estado asociada a procedencias
geográficas. En este contexto, consideramos que este complejo de especies requiere
más investigación a nivel poblacional, donde se evalué a detalle la variación
morfológica y nucleotídica que pudieran presentar dichas poblaciones y con ello
clarificar su identificación tanto morfológica como molecular.
Es también predecible que los estudios de filogeografía con datos
moleculares (Avise, 2000) abran nuevas perspectivas acerca de los patrones y procesos
que, a nivel poblacional, pudieran explicar la distribución espacial de la diversidad
genética y fenotípica actual no sólo de los complejos, sino de las especies en general de
Zamia en Megaméxico. En realidad, dichos estudios ya están coexistiendo con la
aproximación de códigos de barras, para algunos taxa animales (e. g. Linares et al.
2009). Dicha convergencia analítica podría darse también en taxa vegetales como las
cycadas de México. En cualquier caso, consideramos que el tipo de investigaciones
basadas directamente en información molecular permitirán seguir estudiando la
variación biológica en general, entre y dentro de especies, para resolver interrogantes
biogeográficas, taxonómicas, sistemáticas y de biología evolutiva en las cycadas de
Megaméxico.
25
Agradecimientos
Este trabajo fue parcialmente financiado por el proyecto CONACYTSEMARNAT-2002. El primer autor expresa su agradecimiento a la Red
Latinoamericana de Botánica por la Beca de Doctorado RLB-06-D2, y en especial al
Dr. Javier Simonetti. Asimismo, agradecemos al Dr. Dennis Wm. Stevenson por
facilitarnos imágenes de varios tipos nomenclaturales, a la Dra. Victoria Sosa
(INECOL, Xalapa) por sus comentarios y edición al texto. A Miguel Ángel Pérez
Farrera y Carlos Iglesias por su ayuda con el trabajo de campo. Por último,
reconocemos a los curadores y personal de los herbarios mencionados por
proporcionarnos las colecciones botánicas para el desarrollo de este estudio.
Literatura citada
Avise, J. C. 2000. Phylogeography: The History and Formation of Species. Harvard
University Press. Cambridge. Estados Unidos. 464 pp.
Balduzzi, A. P., P. De Luca y S. Sabato. 1982. A phytogeographical approach to
the New World Cycads. Delpinoa, n.s., 23-24.
Barrett, R. D. H. y P. D. N. Hebert. 2005. Identifying spiders through DNA barcodes.
Canadian Journal of Zoology 83: 481-491.
Bogler, D. J. y J. Francisco-Ortega. 2004. Molecular systematic studies in cycads:
evidence from trnL intron and ITS2 rDNA sequences. Botanical Review 70: 260–
273.
Caputo, P., S. Cozzolino, P. De Luca, A. Moretti y D. W. Stevenson. 2004. Molecular
phylogeny of Zamia (Zamiaceae). En Walters, T. y R. Osborne (eds.), Cycad
26
Classification: Concepts and Recommendations. Pp. 149-157. CABI Publishing,
Wallingford, Inglaterra.
Chaw, S. M., T. W. Walters, C. C. Chang, S. H. Hu y S. H. Chen. 2005. A phylogeny of
cycadas (Cycadales) inferred from chloroplast matK gene, trnK intron, and
nuclear rDNA ITS region. Molecular Phylogenetics and Evolution 37: 214-234.
DeSalle, R., M. G. Egan y M. Siddall. 2005. The unholy trinity: taxonomy, species
delimitation and DNA barcoding. Philosophical Transactions of the Royal Society
B 360: 1905-1916.
DeSalle, R. 2006. Species discovery versus species identification in DNA barcoding
efforts: response to Rubinoff. Conservation Biology 20: 1545-1547.
DeSalle, R. 2007. Phenetic and DNA taxonomy; a comment on Waugh. Bioessays 29:
1289-1290.
González, D. y A. P. Vovides. 2002. Low intralineage divergence in Ceratozamia
(Zamiaceae) detected with nuclear ribosomal DNA ITS and chloroplast DNA
trnL-F non coding region. Systematic Botany 27: 654-661.
González, D., A. P. Vovides y C. Bárcenas. 2008. Phylogenetic relationships of the
neotropical genus Dioon (Cycadales, Zamiaceae) based on nuclear and chloroplast
DNA sequence data. Systematic Botany 33: 229-236.
González-Astorga, J., A. P. Vovides, P. Octavio-Aguilar, D. Aguirre-Fey, F. NicolaldeMorejón y C. Iglesias. 2006. Genetic diversity and structure of the cycad Zamia
loddigesii Miq. (Zamiaceae): implications for evolution and conservation.
Botanical Journal of the Linnean Society 152: 533-544.
Hajibabaei, M., D. H. Janzen, J. M. Burns, W. Hallwachs y P. D. N. Hebert. 2006. DNA
barcodes distinguish species of tropical Lepidoptera. Proceedings of the National
Academy of Sciences USA 103: 968-971.
27
Hebert, P. D. N., A. Cywinska, S. L. Ball y J. R. deWaard. 2003a. Biological
identifications through DNA barcodes. Proceedings of the Royal Society of
London B 270: 313-321.
Hebert, P. D. N., S. Ratnasingham y J. R. deWaard. 2003b. Barcoding animal life:
cytochrome c oxidase subunit 1 divergences among closely related species.
Proceedings of the Royal Society of London B (Supplement) 270: S96-S99.
Hill K. D., M. W. Chase, D. W. Stevenson, H. G. Hills y B. Schutzman. 2003. The
families and genera of cycads: a molecular phylogenetic analysis of Cycadophyta
based on nuclear and plastid DNA sequences. International Journal of Plant
Sciences 164: 933-948.
Hill, K. D., D. W. Stevenson y R. Osborne. 2007. The world list of cycads/La lista
mundial de Cícadas. Memoirs of the New York Botanical Garden 97: 454-483.
Holdridge, L. R. 1987. Ecología basada en zonas de vida. Instituto Interamericano de
Cooperación para la Agricultura. San José, Costa Rica. 216 p.
CBOL Plant Working Plant. Hollingsworth, P. M., L. L. Forrest, J. L. Spouge, M.
Hajibabaei, S. Ratnasingham, M. van der Bank, M. W. Chase, R. S. Cowan, D. L.
Erickson, A. J. Fazekas, S. W. Graham, K. E. James, Ki-Joong Kim, W. J. Kress,
H. Schneider, J. van AlphenStahl, S. C. H. Barrett, C. van den Berg, D. Bogarin,
K. S. Burgess, K. M. Cameron, M. Carine, J. Chacón, A. Clark, J. J. Clarkson, F.
Conrad, D. S. Devey, C. S. Ford, T. A. J. Hedderson, M. L. Hollingsworth, B. C.
Husband, L. J. Kelly, P. R. Kesanakurti, J. S. Kim, Y. D. Kim, R. Lahaye, H. L.
Lee, D. G. Long, S. Madriñán, O. Maurin, I. Meusnier, S. G. Newmaster, ChongWook Park, D. M. Percy, G. Petersen, J. E. Richardson, G. A. Salazar, V.
Savolainen, O. Seberg, M. J. Wilkinson, D. K. Yi, y D. P. Little. 2009. A DNA
28
barcode for land plants. Proceedings of the National Academy of Sciences USA
106: 12794-12797.
Limón, F. L. 2009. Genética de Poblaciones de Zamia furfuracea L. f. (Zamiaceae); una
cícada endémica al estado de Veracruz, México. Tesis de licenciatura,
Universidad Veracruzana, México.
Linares, M. C., I. D. Soto-Calderón, D. C. Lees y N. M. Anthony .2009. High
mitochondrial diversity in geographically widespread butterflies of Madagascar:
A test of the DNA barcoding approach. Molecular Phylogenetics and Evolution
50: 485-495.
Marchant, C. J. 1968. Chromosome patterns and nuclear phenomena in the cycad
families Stangeriaceae and Zamiaceae. Chromosoma 24: 100-134.
Miller, S. E. 2007. DNA barcoding and the renaissance of taxonomy. Proceedings of the
National Academy of Sciences USA 104: 4775-4776.
Miquel, F. A. W. 1842. Monographia Cycadearum. Trajecti ad Rhenum/Utrecht pp. 3248, t. 4-5.
______. 1851. Cycadeae quaedam americanae, Partim Novae. Nederl. Inst. Verh. Erste
Kl. (Series 3) 4: 181-189. Amsterdam.
______. 1861. Prodromus systematics cycadearum. C. v. d. Post Jr. Utrecht,
The Netherlands.
Moretti, A. y S. Sabato. 1984. Karyotype evolution by centromeric fission in Zamia
(Cycadales). Plant Systematics and Evolution 146: 215-223.
______. 1990. Karyotypic data on North and Central American Zamiaceae
(Cycadales) and their phylogenetic implications. American Journal of Botany
77: 1016-1029.
29
______, P. Caputo, L. Gaudio, & D.W. Stevenson. 1991. Intraspecific chromosome
variation in Zamia (Zamiaceae, Cycadales). Caryologia 44: 1-10.
Nicolalde-Morejón, F. 2007. Taxonomía, Distribución y Estado de Conservación de
Zamia en Ecuador. Memoirs of The New York Botanical Garden 97: 45-63.
Nicolalde-Morejón, F., A. P. Vovides, D. W. Stevenson y V. Sosa. 2008. The identity of
Zamia katzeriana and Zamia verschaffeltii (Zamiaceae). Brittonia 60: 38-48.
______, A. P. Vovides, D. W. Stevenson. 2009a. Taxonomic revision of Zamia in
Mega-Mexico. Brittonia. DOI 10.1007/s12228-009-9077-9.
______, F. Vergara-Silva, J. González-Astorga, A. P. Vovides y A. Espinosa de los
Monteros. 2009b. Reciprocal illumination of morphological characters upon a
molecular hypothesis supports the proposal of a new species of cycad from
Mexico. Systematics and Biodiversity 7: 73-79.
Norstog, K. y T. J. Nicholls. 1997. The Biology of the Cycads. Cornell University
Press, Ithaca, Nueva York.
Rai, H. S., H. E. O'Brien, P. A. Reeves, R. G. Olmstead y S. W. Graham. 2003.
Inference of higher-order relationships in the cycads from a large chloroplast
data set. Molecular Phylogenetics and Evolution 29: 350-359.
Rzedowski, J. 1978. Vegetación de México. Limusa, S. A. México, D.F.
———, 1991. El endemismo en la flora fanerogámica mexicana: una apreciación
analítica preliminar. Acta Botanica Mexicana 15: 47-64.
Sabato, S. 1990. West Indian and South American cycads. Memoirs of the New York
Botanical Garden 57: 173-185.
Schuster, J. 1932. Cycadaceae. Das Pflanzenreich 99:1-168. Wilhelm Engelmann,
Leipzig.
30
Seberg, O., J. Ch. Humphries, S. Knapp, D. W. Stevenson, G. Petersen, N. Scharff y N.
M. Andersen. 2003. Shortcuts in systematics? A commentary on DNA-based
taxonomy. 2003. Trends in Ecology and Evolution 18(2): 63-65.
Stevenson D. W. 1987. The West Indian Zamias. Fairchild Tropical Garden Bulletin.42:
23-27.
———. 1991a. Flora of the Guianas. Serie. A. Fascicule 9: 7-11.
———. 1991b. The Zamiaceae in the Southeastern United States. Journal of the Arnold
Arboretum, Supplemental Series 1: 367-383.
———. 1992. A formal classification of the extant cycads. Brittonia 44: 220-223
———. 1993. The Zamiaceae in Panama with comments on phytogeography and
species relationships. Brittonia 45: 1-16.
———. 2001a. Orden Cycadales. Flora de Colombia. Monografía No. 21. Editorial
Unibiblos. Bogotá D.C.
———. 2001b. Zamiaceae. Flora Nicaragua 1: 6-7.
———. 2004. Zamiaceae of Bolivia, Ecuador, and Perú. En Walters, T. y R. Osborne
(eds.), Cycad Classification: Concepts and Recommendations. Pp. 173-194.
CABI Publishing, Wallingford, Inglaterra.
——— y S. Sabato. 1986. Typification of names in Zamia L. and Aulacophyllum
Regel. (Zamiaceae). Taxon 35: 134-144.
Stoeckle, M. Y. y P. D. N. Hebert. 2008. Barcode of life. Scientific American 299: 8288.
Taylor, A. S., J. L. Haynes y G. Holzman. 2009. Taxonomical, nomenclatural and
biogeographical relevations in the Zamia skinneri complex of Central America
(Cycadales: Zamiaceae). Botanical Journal of the Linnean Society 158: 399-429.
31
Toledo, V. M. 1982. Pleistoceno changes of vegetation in tropical Mexico. Pp. 93-111.
En: Prance, G. T. (ed). Biological Diversification in the Tropics. Columbia
University Press, New York.
Treutlein, J. y M. Wink. 2002. Molecular phylogeny of cycads inferred from rbcL
sequences. Naturwissenschaften 89:221-225.
Tautz, D., P. Arctander, A. Minelli, R. H. Thomas y A. P. Vogler. 2003. A plea for
DNA taxonomy. Trends in Ecology and Evolution 18: 70-74.
Vovides, A. P. 1983. Systematics studies on the Mexican Zamiaceae I. Chromosome
numbers and karyotypes. American Journal of Botany 70: 1002-1006.
______ y M. Olivares. 1996. Karyotype polymorphism in the cycad Zamia loddigesii
(Zamiaceae) of the Yucatan peninsula, Mexico. Botanical Journal of the Linnean
Society 120: 77-83.
______, J. González-Astorga, M. A. Pérez-Farrera, D. González, C. Bárcenas y C.
Iglesias. 2007. The Cycads of Mexico: 25 years of research and conservation.
Memoirs of the New York Botanical Garden 97: 611-641.
______, S. Avendaño, M. A. Pérez-Farrera y J. González-Astorga. 2008a. A new
species of Ceratozamia (Cycadales, Zamiaceae) from Veracruz, Mexico. Novon
18: 109-114.
______, M. A. Pérez-Farrera, J. González-Astorga y C. Iglesias. 2008b. A new species
of Ceratozamia (Zamiaceae) from Oaxaca, Mexico with comments on habitat
and relationships. Botanical Journal of the Linnean Society 157: 169-175.
Zgurski, J. M., H. S. Rai, Q. M. Fai, D. J. Bogler, J. Francisco-Ortega J y S. W.
Graham. 2008. How well do we understand the overall backbone of cycad
phylogeny? New insights from a large, multigene plastid data set. Molecular
Phylogenetics and Evolution 47: 1232-1237.
32
Figura 1. Distribución de: A) Zamia cremnophila, Z. katzeriana, Z. lacandona, Z.
purpurea, Z. spartea; B) Z. monticola, Z. onareyesii, Z. oreillyi, Z. sandovallii, Z.
standleyi, Z. tuerckheimii, Z. variegata; C) Z. paucijuga; D) Z. loddigesii; E) Z.
polymorpha; F) Z. herrerae; G) Z. soconuscensis; H) Área inexplorada para Zamia.
33
Tabla 1. Especies, distribución y tipos de vegetación de Zamia en Megaméxico
No
Especie
País
Estado/Departamento
Tipo de
Vegetación
1
Z. cremnophila
México
Tabasco
BTP
2
Z. fischeri
México
Hidalgo, Querétaro, San Luís
BTsC,
Potosí
BMM, BQBC
3
Z. furfuracea
México
Veracruz
BTP
4
Z. herrerae
El Salvador, ES: Sonsonate, M: Chiapas
BTP, BTsC
Guatemala,
México
5
Z. inermis
México
Veracruz
BTC
6
Z. katzeriana
México
Chiapas, Tabasco, Veracruz
BTP
7
Z. lacandona
México
Chiapas
BTP
8
Z. loddigesii
México
Chiapas, Hidalgo, Oaxaca,
BTP
Puebla, Tabasco, Tamaulipas,
Veracruz
9
Z. monticola
Guatemala
Alta Verapaz
BTP
10 Z. onanreyesii
Honduras
Cortés
BTP
11 Z. oreillyi
Honduras
Atlántida
BTP
12 Z. paucijuga
México
Colima, Guerrero, Jalisco,
BTsC,
Michoacán, Nayarit, Oaxaca
BTC, BQ
13 Z. polymorpha
Belice,
B: Distrito Belice, Distrito Cayo; BTP, BTsC
Guatemala,
G: Peten; M: Campeche,
México
Chiapas, Quintana Roo, Tabasco,
Yucatán
14 Z. prasina
Belice
Distrito Toledo
BTP
15 Z. purpurea
México
Oaxaca, Veracruz
BTP
16 Z. sandovallii
Honduras
Atlántida
BTP
17 Z. soconuscensis México
Chiapas
BTsC
18 Z. spartea
México
Oaxaca
BTP, BTC
19 Z. standleyi
Guatemala,
G: Izabal; H: Atlántida, Santa
BTP
Honduras
Bárbara
20 Z. tuerckheimii
Guatemala
Alta Verapaz
BTP
21 Z. variegata
Guatemala,
G: Alta Verapaz, Izabal; M:
BTP
México
Chiapas
22 Z. vazquezii
México
Veracruz
BTP
Simbología aquí utilizada para los tipos de vegetación, según Rzedowski (1978). BTP
Bosque Tropical Perennifolio; BTsC Bosque Tropical Subcaducifolio; BMM Bosque
Mesófilo de Montaña, BQ Bosque de Quercus; BC Bosque de Coníferas.
34
Tabla 2. Especies, distribución y cantidad de colectas de Zamia en Megaméxico
No
Especie
País
Estado/Departamento
No. de
colectas
botánicas
1
Z. cremnophila
México
Tabasco
4
2
Z. fischeri
México
Hidalgo, Querétaro, San Luís
20
Potosí
3
Z. furfuracea
México
Veracruz
36
4
Z. herrerae
El Salvador, ES: Sonsonate, M: Chiapas
14
Guatemala,
México
5
Z. inermis
México
Veracruz
12
6
Z. katzeriana
México
Chiapas, Tabasco, Veracruz
25
7
Z. lacandona
México
Chiapas
22
8
Z. loddigesii
México
Chiapas, Hidalgo, Oaxaca,
80
Puebla, Tabasco, Tamaulipas,
Veracruz
9
Z. monticola
Guatemala
Alta Verapaz
2
10 Z. onanreyesii
Honduras
Cortés
3
11 Z. oreillyi
Honduras
Atlántida
2
12 Z. paucijuga
México
Colima, Guerrero, Jalisco,
114
Michoacán, Nayarit, Oaxaca
13 Z. polymorpha
Belice,
B: Distrito Belice, Distrito Cayo;
116
Guatemala,
G: Peten; M: Campeche,
México
Chiapas, Quintana Roo, Tabasco,
Yucatán
14 Z. prasina
Belice
Distrito Toledo
3
15 Z. purpurea
México
Oaxaca, Veracruz
15
16 Z. sandovallii
Honduras
Atlántida
4
17 Z. soconuscensis México
Chiapas
7
18 Z. spartea
México
Oaxaca
24
19 Z. standleyi
Guatemala,
G: Izabal; H: Atlántida, Santa
8
Honduras
Bárbara
20 Z. tuerckheimii
Guatemala
Alta Verapaz
5
21 Z. variegata
Guatemala,
G: Alta Verapaz, Izabal; M:
16
México
Chiapas
22 Z. vazquezii
México
Veracruz
4
35
Tabla 3. Especies, publicación y tipos nomenclaturales de Zamia en Megaméxico
Especie
Año
Publicación
Z. cremnophila Vovides, Schutzman &
1988 Bot. Gaz. 149: 351
Dehgan
Z. fischeri Miq.
1845 in Lem., Hort. Vanhoutt. 1: 20
Z. furfuracea L. f.
1789 in Aiton, Hortus Kew. 3: 477
Z. herrerae Calderón & Standl.
1924
Z. inermis Vovides, J.D. Rees & Vázq.
Torres
Z. katzeriana (Regel) Retting
Z. lacandona Schutzman & Vovides
Z. loddigesii Miq.
1983
1896
1998
1843
Z. monticola Chamb.
Z. onanreyesii C. Nelson & G. Sandoval
Z. oreillyi C. Nelson
Z. paucijuga Wieland
1926
2008
2005
1916
Z. polymorpha D.W. Stev., A. Moretti &
Vázq. Torres
Z. prasina W. Bull
Z. purpurea Vovides, J.D. Rees & Vázq.
Torres
Z. sandovallii C. Nelson
Z. soconuscensis Schutzman, Vovides &
Dehgan
Z. spartea A. DC.
Z. standleyi Schutzman
199596
1881
1983
2005
1988
1868
1989
Tipo
H-MEXU
N-U
L-pl. 210 in Herm. Parad.
Bat., 1698
Proc. Wash. Acad. Sci. 14(4): 93, H-US
fig. 1
Flora de Veracruz 26: 22-24, fig. H-XAL
3
Acta Horti Petrop. 4(4):298
L-LE
Novon 8(4): 441-446, figs. 1-3
H-FLAS
Tijdschr. Natuurl. Gesch.
L-U
Physiol. 10: 72-73
Bot. Gaz. 81: 219-223, figs. 1-3 H-MO
Ceiba 49(1): 135-136, figs. 1-6
H-TEFH
Ceiba 46(1-2): 56, figs. 1-3
H-TEFH
American Fossil Cycads 2: 212, LE—fig. 86
fig. 86
Delpinoa n.s. 37-38: 3-8 (issued H-NY
1998), fig. 1
Retail List: 20
H-K
Flora de Veracruz 26: 28-31, fig. H—XAL
5
Ceiba 46(1-2): 55, figs. 1-10
H-TEFH
Bot. Gaz. 149(3): 347-351, figs.
H—F
1-3
Prodr. 16(2): 539
H—G-DC
Syst. Bot. 14(2): 214-219, figs. 1- H—FLAS
36
Isotipos
CSAT, FCM, MO,
UAMIZ
F
XAL
NY
TEFH
BRH, FTG, MO, NY,
U
TEFH
CR, MEXU, MICH
ENA, FTG
Z. tuerckheimii Donn. Sm.
1903
Z. variegata Warsz.
Z. vazquezii D.W. Stev., Sabato, A. Moretti
& De Luca
1845
199596
2
Bot. Gaz. (Crawfordsville) 35(1): H—US
8, pl. 1
Allg. Gartenzeitung 32: 252-253 N—NY
Delpinoa n.s. 37-38: 9-17 (issued N—NY
1998), fig. 3
37
K
U, XAL
CIB, FTG, MO, NY,
U
Tabla 4. Diversidad y endemismos de Cycadas en Megaméxico
Géneros de
Especies descritas
Especies endémicas a
Cycadas
Megaméxico 2
Ceratozamia
25
25
Dioon
14
14
Zamia
61
22
Total
100
61
38
CAPITULO II
Taxonomic revision of Zamia in Mega-Mexico
(Brittonia: Aceptado DOI 10.1007/s12228-009-9077-9)
39
Taxonomic revision of Zamia in Mega-Mexico
Fernando Nicolalde-Morejón1, Andrew P. Vovides1 and Dennis W. Stevenson2*
1
Departamento de Biología Evolutiva. Instituto de Ecología, A. C. km 2.5 Antigua
Carretera a Coatepec No. 351, Xalapa 91070, Veracruz, Mexico.
2
The New York Botanical Garden, Bronx, New York, 10458-5120, USA.
*Corresponding author: [email protected]
40
ABSTRACT. The genus Zamia is revised for Mega-Mexico, with 22 species recognized
and described and one species dubium. The study presents a taxonomic clarification for
the genus in Mesoamerica, a contribution that provides the foundation for a future
monograph for Zamia in the Neotropics. The largest proportion of species richness and
endemism for the genus is concentrated in southeastern Mexico, among the states of
Chiapas, Oaxaca, Tabasco and Veracruz, an area that is considered highly diverse in
floristic terms. Distribution maps and a key to species are also provided, as well as
complete descriptions of the specimens examined, including information on
nomenclatural types, habitats, synonymies, and etymologies. Zamia spartea is
illustrated for the first time and chromosome numbers for Z. herrerae are reported and
illustrated. Finally, scanning electron micrographs of leaflet trichome character states
are presented, along with a discussion of their systematic implications within the group.
KEYWORDS: Endemism, Mexico, gymnosperms, cycads, floristic richness, Zamia.
RESUMEN. El género Zamia es revisado para Mega-México, con 22 especies descritas y
una species dubia. El estudio está orientado al esclarecimiento taxonómico del género
en Mega-México, una contribución que siente los fundamentos para una futura
monografía para Zamia en el Neotrópico. La mayor riqueza y endemismo para el género
se concentra en el sureste de México, entre los estados de Chiapas, Oaxaca, Tabasco y
Veracruz, área de alta biodiversidad florística. Mapas de distribución y una clave para
las especies son presentadas, como también descripciones completas, tipos, hábitat,
sinónimos, etimología y especimenes examinadas. Z. spartea es ilustrada por primera
vez y números cromosómicos para Z. herrerae son presentados. Finalmente, se
41
presentan fotografías de tricomas al microscopio electrónico y una discusión de sus
implicaciones en la sistemática del grupo.
42
Introduction
According to Stevenson (1992), Zamiaceae comprises eight genera distributed in
tropical and subtropical Africa, Australia, Greater Antilles, North, Central and South
America. Five genera with 94 species are known from the Neotropics (Hill et al., 2007).
The genera Ceratozamia Brongn. (21 spp.) and Dioon Lindl. (13 spp.) are both endemic
to Mexico and a neighboring biogeographic region of Central America that is
floristically similar to the southern part of Mexico (Mega-Mexico) while Microcycas A.
DC. (1 sp) and Chigua D.W. Stev. (2 spp.) are endemic to Cuba and Colombia,
respectively. The type genus for the family, Zamia L. (59 spp.), is distributed
throughout tropical and sub-tropical America as well as the Caribbean, with exception
to the Lesser Antilles.
Zamia is the widest distributed genus of the order Cycadales in the Neotropics. Its
northern range starts in Georgia and Florida (United States of America), reaching
Bolivia and the Mato Grosso of Brazil in South America (Balduzzi et al., 1982; Sabato,
1990; Norstog & Nicholls, 1997; Stevenson, 2001a, b). A remarkable morphological
and cytological variation has been documented (Vovides, 1983; Moretti & Sabato,
1984; Moretti, 1990a, b; Stevenson et al., 1995-96a; Vovides & Olivares, 1996; Norstog
& Nicholls, 1997), and also high levels of genetic variation (González-Astorga et al.,
2006). As a consequence of this complexity, Zamia´s taxonomy is controversial;
although the genus comprises 75 species, their circumscription and limits have yet to be
determined (see Hill et al., 2007).
The most recent exhaustive taxonomic treatment for Zamia was published by
Schuster (1932) and later work by Sabato (1990) and Stevenson (1987; 1991a, b; 1993;
2001a, b; 2004) underlined nomenclatural and taxonomic anomalies in Zamia,
principally owing to insufficient fieldwork and a scarcity of good quality botanical
43
collections. The taxonomic history for the genus in Mexico began with the publication
of Zamia fufuracea L. f. in 1789 from the central-south coastal region of Veracruz,
which also represents the first cycad species described from the American continent.
During the 19th century, six species were subsequently described for Mexico; Z.
fischeri Miq., Z. katzeriana (Regel) Rettig, Z. lawsoniana Dyer, Z. loddigesii Miq., Z.
spartea A. DC. and Z. verschaffeltii Miq., whereas the remaining known species were
documented and characterized during the 20th century, with a marked tendency for
taxonomic activity during the last thirty years (see: Vovides et al., 1983; Schutzman et
al., 1988; Stevenson et al., 1995-96a,b; Schutzman et al., 1998; Vovides, 1999).
The present taxonomic revision includes endemic species of the cycad genus Zamia
that occur in ‘Mega-Mexico 2’, a term coined by Rzedowski (1991) that associates the
Central American territories of Guatemala, Belize, Honduras and northern Nicaragua to
to the Mexican states of Nayarit on the Pacific to southern Tamaulipas on the Gulf of
Mexico. using biotic (mainly floristic) criteria. Rzedowski’s concept will be referred to
as simply ‘Mega-Mexico’ hereafter, given that the slight differences in the boundaries
of ‘Mega-Mexico 1’ with respect to ‘Mega-Mexico 2’ do not affect the biogeographic
aspects of our description of the species. This study is intened to provide a taxonomic
clarification of the genus in Mesoamerica and to provide the basis for a future
monograph of Zamia.
Materials and Methods
The present taxonomic revision is based on more than 450 specimens from the
following herbaria: B, BM, CIB, CHIP, CICY, ECOSUR, ENCB, F, FCME, FLAS,
FTG, HEM, IBUG, IEB, K, LE, MEXU, MO, NY, SERO, U, UADY, UAMIZ, US, W,
44
WIS, XAL, XALU, ZEA. Unfortunately, we were not able to obtain vouchers on loan
from NAP; therefore, material from this herbarium is not cited.
Chromosome counts for Zamia herrerae Calderón & Standley were performed on
five individuals held at the Jardín Botánico Fco. Javier Clavijero, Instituto de Ecología,
A.C (JBC). These plants has been previously collected at the Acacoyagua and Tonalá
regions, located in the state of Chiapas and represent the species range in southern
Mexico. Plants from its full biogeographic range, which would include El Salvador and
Guatemala, were not available for this study. A modified root-tip squash method was
used for examining somatic metaphase cells described by Vovides (1983) with a 12 to
15 hour ice-water (0°C) follow-up soak after the 0.2% colchicine pretreatment at
ambient temperature (Schutzman et al., 1988). Counts were made from the best 10-15
metaphase cells and karyotype noted according to the classification of Schlarbaum and
Tsuchiya (1984). Photomicrographs were produced using a Zeiss Fomi III
photomicroscope fitted with planapochromatic objectives and Kodak Plus-X pan ASA
125 film.
Scanning electron micrographs (SEM) were taken on young leaflet material from
living plants cultivated in the JBC. Samples were placed on sample stubs with double
sided adhesive tape and then introduced into a dessicator for 24 hours. All samples were
sputter coated with gold-palladium at 1.5 kv at 5 mA for 8 minutes with a Jeol Fine
Coat JFC 1100 sputter coater. Observations were made with a Jeol JSM-5600LV SEM.
In all cases, the types have been examined by one or more of the authors.
Results
HABITAT
45
Of the 22 species included in this revision, 18 occur in specific habitats, accounting
for the restricted distribution of the majority of the taxa. The species with the widest
distribution are associated with two or more vegetation types, namely (a) Zamia
paucijuga Wieland, found in pine-oak, oak and tropical dry forests; (b) Z. polymorpha
D.W. Stev., A. Moretti & Vázq. Torres, located in evergreen tropical rainforest, subdeciduous tropical forest and their secondary succession stages; (c) Z. herrerae, which
occurs in evergreen tropical rainforest, sub-deciduous tropical forest and tropical dry
forest and their secondary succession stages and finally, to a lesser extent, (d) Z.
loddigesii, present in evergreen tropical rainforest, but more commonly in subdeciduous tropical forest and its secondary succession stages.
MORPHOLOGY
HABIT. — All adult cycad stems are pachycaulous and may be columnar and arborescent
or subterranean and tuber-like. The genera Dioon, Microcycas, Ceratozamia and
Lepidozamia Regel are usually columnar arborescent in habit, while the subterranean
forms are characteristic of Bowenia Hook. ex Hook. f., Chigua and Stangeria T. Moore.
Cycas L., Encephalartos Lehm., Macrozamia Miq. and Zamia have both stem
morphologies, either subterranean tuber-like or columnar arborescent (Stevenson,
1980). In this context, the species of Zamia in Mesoamerica represent both growth
forms, with the subterranean tuber-like habitat predominant. Only four species, Z.
inermis, Z. onanreyesii, Z. soconuscensis and Z. tuerckheimii, have arborescent stems
reaching up to 100 cm or more in height. Some species branch dichotomously with age
(namely, Z. fischeri Miq., Z. furfuracea, Z. inermis Vovides, Rees & Vázq. Torres, Z.
soconuscensis Schutzman, Vovides & Dehgan, Z. loddigesii and Z. herrerae), with the
46
coastal dune species Z. furfuracea being the most notable, with branches reaching up to
80 cm long in adult plants.
TRICHOMES.— Trichomes of cycads leaves are bi-celled, consisting of a small basal cell
and a longer free apical portion (Stevenson, 1981). All the trichomes analyzed here
show the same bifurcate pattern, with one arm proportionally longer than the other (Fig
1a). Each trichome presents a rounded basal cell and a more extensive cylindrical
bifurcate free portion, which in most cases observed had evidence of collapse and
twisting (Fig. 1b-f). The pubescence was significantly denser in emerging than in older
adult leaves with the latter becoming completely glabrous. An exception to this
condition is found in Zamia furfuracea, which maintains a great part of its original
indument on the abaxial surface of each leaflet.
According to Stevenson (1981), four types of trichomes occur in Zamia; of these,
the transparent ramified and the colored ramified are the types found in the present
work. In contrast to what was found in the aforementioned study by Stevenson, no trend
or correlation was found between aerial stems (i.e. Z. soconuscensis or Z. inermis) and
bifurcate trichomes with equal length branches. Trichomes with unequal sized prevail
among taxa with both aerial and subterranean stems. In this context, we consider that a
more extensive and detailed sampling of the genus Zamia across the Neotropics would
be necessary to corroborate any correlation between trichome morphology and stem
habit.
REPRODUCTIVE STRUCTURES — Although the characters employed for the identification
of species of Zamia have been obtained from leaf morphology (see Miquel, 1861, 1869;
Regel, 1857, 1876; De Candolle, 1868; Schuster, 1932; Eckenwalder 1980; Vovides et
al., 1983; Newell,1986; Schutzman & Vovides, 1998, Schutzman et al., 1988;
47
Stevenson, 1993, 2001a, b, 2004, Nicolalde-Morejón et al., 2008), the evaluation of
reproductive characters, especially those corresponding to ovulate strobili, is essential to
discriminate among closely related taxa. Outstanding attributes that should be
considered in this case are (i) the form and shape of the cone apex (Stevenson, 1987) ;
(ii) the peduncle position with respect to the vertical axis of the cone, when mature
(Schutzman et al., 1988); and (iii) the overall color of the cone (see descriptions and
Figs. 2 & 3). In contrast to the ovulate strobili, pollen strobili show scarce variation at
the species level, and their utility to discriminate among species that might possess high
degrees of genealogical affinity is relatively low. For the description of the pollen
reproductive axes, the terminology introduced by Mundry and Stützel (2003) has been
followed.
CHROMOSOME NUMBERS —Zamia shows the highest chromosome numbers and
karyotype variation throughout the Order Cycadales, with 2n counts of 16, 17, 18, 22,
23, 24, 25, 26, 27 and 28 (see Marchant, 1968; Norstog, 1980, 1981; Vovides, 1983;
Moretti & Sabato, 1984; Moretti, 1990a, b; Vovides & Olivares, 1996). In contrast, all
Ceratozamia species studied so far have stable diploid chromosome numbers (2n = 16)
and karyotypes, as do all the Dioon species analyzed to date with stable diploid
chromosome numbers (2n = 18) and karyotypes (Marchant, 1968; Vovides, 1983, 1985;
Moretti, 1990a, b).
Chromosome counts are presented and illustrated (Fig. 4) here for the first time for
Zamia herrerae. This species has, but to a lesser extent, cytotype polymorphisms
similar to those found for Z. paucijuga (Moretti and Sabato, 1984) and Z. polymorpha
(Vovides and Olivares, 1996; Stevenson et al., 1995-96b). Zamia herrerae has 2n = 23,
24 from two populations along its Mexican range in Chiapas (Fig. 4). Both the m
48
(median region of the chromosomes) and T (telocentric) chromosomes vary in number
(6-11 T, 4-6 m) and are large (6-11 µm for T and 8-12 µm for m) and their arms can be
longer than half the spindle axis, which can cause mitotic instability during telophase
(Schubert, 2007). Karyotype differences are probably due to centric fissions occurring
on some of the larger m chromosomes, giving rise to telocentrics with part of the
centromere still present. In this context, there are two general hypotheses to explain
karyotypic evolution in Zamia: first, Norstog’s hypothesis (Norstog 1980, 1981)
relating karyotype simplification and symmetry with progressive fusion of telocentric
chromosomes, which predicts low diploid number in taxa with a high number of
metacentric chromosomes, and secondly that of more recent research on Zamia, which
postulates centric fission rather than fusion producing a progressively higher diploid
number and asymmetric karyotypes with a high number of telocentric chromosomes
(Moretti and Sabato, 1984; Vovides & Olivares, 1996; Caputo et al., 2004). For a more
in-depth discussion of mechanisms of chromosome evolution in seed plants, see Jones
(1998).
The highly asymmetric karyotypes and somatic chromosome numbers in both Z.
paucijuga and Z. polymorpha, which also appear to be the pattern for Z. herrerae, seem
to be correlated with the highest morphological variation and widest geographic
distribution of the genus in Mesoamerica. Zamia herrerae has a range of about 1,000
km, spanning El Salvador, Guatemala and Chiapas (Mexico); therefore, we suggest
investigating the distribution of chromosome character states in this species throughout
its range. This karyotype asymmetry contrasts with their congeners of a more restricted
distribution, which often have less morphological variation and a tendency towards
constant chromosome number and karyotype, e. g. Z. cremnophila Vovides, Schutzman
& Dehgan, Z. fischeri, Z. inermis, Z. katzeriana, Z. purpurea and Z. soconuscensis (all
49
2n = 16), as well as Z. furfuracea, Z. spartea and Z. vazquezii (all 2n = 18). Vovides and
Olivares (1996) and Jones (1998) comment that atypical chromosome number increase
attributed to fission is probably a result of stressful influences.
DISTRIBUTION AND ENDEMISM
Seventy-five percent of the species in this revision are endemic to the type locality
and nearby areas. They are limited to two or three close populations with low
population densities. These attributes are consistent with Rabinowitz’s (1981)
evaluation criteria for species rarity, which mainly considers information related to
geographic range, habitat specificity and local population size. In congruence with these
criteria, the endemic Zamia species of Mesoamerica are considered rare, threatened or
endangered and are listed under the IUCN Red List (2005, Hill et al., 2007).
With 21 endemic cycad species in three genera, Mexico has the highest cycad
diversity and number of endemics of the region. Six species of Zamia are known in
Guatemala, two of which are endemic (Z. monticola Chamberlain and Z. tuerckheimii J.
Donnell Smith); in Honduras, three species are known of which three recently described
species are endemic (Z. oreillyi C. Nelson , Z. sandovalii C. Nelson, and Z. onanreyesii
C. Nelson & G. Sandoval). Two further species are known for Belize, of which one is
endemic (Z. prasina W. Bull) and finally, El Salvador is represented by one broadly
distributed species, Z. herrerae, with a range that runs along the Pacific seaboard
through Guatemala and the Sierra Madre de Chiapas in Mexico. Other species of the
genus in Mexico with broad distributions are (a) Z. paucijuga, distributed along the
Pacific seaboard of Mexico ranging from Nayarit (northwest Mexico) to Oaxaca
(southwest); (b) Z. polymorpha, distributed widely throughout the Yucatán penninsula
in Mexico, Belize and the Petén region of Guatemala; (c) Z. loddigesii, ranging along
50
the Gulf of Mexico seaboard from Tamaulipas (northeast Mexico) to Tabasco
(southeast); and finally (d) Z. variegata Warsz., distributed between Guatemala and
southern Mexico.
The southern and southeastern regions of Mexico, comprising the states of
Veracruz, Oaxaca, Chiapas and Tabasco, are the most diverse area of Mexico for the
genus Zamia, with seven endemic species (Z. cremnophila, Z. lacandona, Z. loddigesii,
Z. katzeriana, Z. purpurea, Z. polymorpha and Z. spartea). The Gulf of Mexico region
has three micro-endemics Z. furfuracea, Z. inermis and Z. vazquezii, whereas two
micro-endemic species, Z. fischeri and Z. soconuscensis, are known respectively from
the Sierra Madre Oriental and the Sierra Madre de Chiapas.
Finally, in spite of the status of Z. paucijuga as a Mexican endemic, its distribution
is extremely wide within Mega-Mexico, covering a range of about 1,000 km between
the states of Oaxaca and Nayarit. The northern limit of Z. paucijuga in the latter state
represents the northernmost distribution for the genus along the Pacific seaboard of the
Neotropics.
Taxonomic Treatment
Zamia L., Sp. Pl. ed. 2: 1659. 1763. nom. cons.
Type species: Zamia pumila L.
Palma-Felix Adanson, Fam. Pl. 2: 21, 587. 1763
Aulacophyllum Regel, Gartenflora 25: 140. 1876
Stems hypogeous and epigeous, erect to decumbent, sometimes dichotomously
branched in mature plants. Cataphylls chartaceous to membranaceous, stipulate,
persistent or deciduous, base triangular, apex long acuminate to aristate, tomentose,
generally reddish-brown to yellowish. Ptyxis erect to inflexed. Leaves stipulate,
51
ascending to descending to spreading, reddish-brown or green when emerging; petiole
sometimes blackish in young leaves, terete or subterete, without prickles or heavily to
lightly armed with straight or bifurcate prickles; rachis subterete generally with few
prickles along the proximal third or without prickles, with up to 60 pairs of leaflets.
Leaflets articulate, sessile, papyraceous to coriaceous, linear, linear-lanceolate,
lanceolate, ovate, obovate obpyriform to elliptic, opposite to subopposite, falcate or
non-falcate, imbricate to non-imbricate, generally acute at apex and symmetric,
attenuate at base, margins entire to dentate along upper third, subrevolute, articulations
green, yellowish or dark brown in young leaflets. Pollen strobili usually 1-2(4), with
sterile tip, erect, cylindrical to conical, light brown to purple, tomentulose, apex acute to
apiculate, generally with densely tomentose peduncles; pollen sporangiophores
cuneiform, distal face truncate hexagonal, 0.3-0.55 cm long, fertile abaxial surface 2
lobed with 2-14 bisporangiate synangia per lobe, sporangia dehiscent by longitudinal
slit. Ovulate strobili usually solitary, erect to decumbent, cylindrical to ellipsoid, purple
to yellowish, generally tomentulose, apex acute to apiculate; peduncle densely
tomentose; ovulate sporangiophores cuneiform-peltate to scutiform, distal end truncatehexagonal when not scutiform. Seeds ovoid, sarcotesta white to pink when immature,
red at maturity, sclerotesta smooth but sometimes with several furrows running
longitudinally from micropylar end.
Key to the species of Zamia in Mega-Mexico
1. Leaflets chartaceous to papyraceous
2. Leaflet margin dentate
3. Leaflets elliptic, adaxial surface with yellow to cream variegation
52
Z. variegata
3. Leaflets long-lanceolate, without variegation
4. Leaflets imbricate, peduncle of pollen strobili decumbent, up to
16 cm long
Z. oreillyi
4. Leaflets not imbricate, peduncle of pollen strobili erect, up to 8 cm long
Z. herrerae
2. Leaflet margin serrulate to entire,
5. Leaflet margin entire, chartaceous
6. Leaflets oblong-lanceolate, glossy, 4-6 cm wide; ovulate strobili iridescent
blue-green at maturity
Z. tuerckheimii
6. Leaflets linear-lanceolate, not glossy, 0.6-1.5 cm wide, ovulate strobili darkbrown at maturity
Z. soconuscensis
5. Leaflet margin serrulate, papyraceous
7. Leaflets sub-falcate basally, long-acuminate, strongly apically
curved
Z. monticola
7. Leaflets straight, acuminate, not curved at apex
8. Leaflets elliptic to lanceolate, ovulate strobili cylindrical to ovoid, darkgreen and glabrous when mature, from San Luís Potosí and Querétaro,
Mexico
Z. fischeri
8. Leaflets ovate to obpyriform, ovulate strobili ovoid-cylindrical, gray to
brown tomentulose when mature. Endemic to Veracruz, Mexico
Z. vazquezii
1. Leaflets coriaceous
9. Leaflet margin entire to serrulate
10. Leaflet margin entire, petiole unarmed
53
Z. inermis
10. Leaflet margin serrulate, petiole prickly
11. Leaflets long acuminate apically; stems arborescent
Z. onanreyesii
11. Leaflets rounded to acute apically; stems subterranean
12. Leaflets obovate to oblanceolate, keeled adaxially, apex rounded
Z. furfuracea
12. Leaflets linear to oblanceolate, flat adaxially, apex acute
13. Leaflets linear, 0.4-0.6 cm wide
Z. spartea
13. Leaflets lanceolate, ≥0.7 cm wide
14. Leaflets falcate
Z. sandovallii
14. Leaflets not falcate
15. Leaflets lanceolate-oblanceolate, ovulate strobili dark-brown
tomentulose
Z. polymorpha
15. Leaflets linear-lanceolate, ovulate strobili brown to yellowish
16. Ovulate strobili ellipsoid to cylindrical, apex acute to apiculate,
yellowish-brown. From the Pacific seaboard of Mexico
Z. paucijuga
16. Ovulate strobili ellipsoid to conical, apex acute, yellowish. From
the Gulf of Mexico seaboard
Z. loddigesii
9. Leaflet margin distinctly dentate
17. Leaflets channeled adaxially between veins, appearing plicate
Z. purpurea
17. Leaflets smooth, not channeled adaxially between veins, not
appearing plicate
18. Leaflets linear-lanceolate, imbricate, petiole strongly armed
with straight or bifurcate prickles up to 6 mm long
54
Z. cremnophila
18. Leaflets lanceolate to oblanceolate, not imbricate, petiole
armed with small straight prickles, generally between 2-4 mm
19. Leaflets with brilliantly shining cuticle on adaxial surface;
ovulate strobili decumbent when mature
Z. katzeriana
19. Leaflets without brilliantly shining cuticle on adaxial
surface; ovulate strobili erect when mature
20. Distal leaflets sub-falcate, petiole with bulbous base,
blackish in young leaves
Z. lacandona
20. All leaflets straight, petiole with no bulbous base, greenish
in young leaves
21. Leaflets oblong to lanceolate, bright grass-green, without
conspicuously denticulate along margins; ovulate strobili
green
glabrous when mature, apex acuminate
Z. prasina
21. Leaflets long-lanceolate, conspicuous dentate,
up to 4 mm long; ovulate strobili brown
tomentulose when mature, apex long-apiculate
Z. standleyi
Zamia cremnophila Vovides, Schutzman & Dehgan. Bot. Gaz. 149(3): 351. 1988.
Type: Mexico. Tabasco: 18 Aug 1981, M. A. Magaña & S. Zamudio 343 (holotype:
MEXU; isotypes: CSAT, FCME, MO, UAMIZ).
55
Stem hypogeous, generally unbranched, 5-34 cm long, 4-11.3 cm in diam.
Cataphylls chartaceous, persistent, base triangular, apex aristate, 5.4 cm long, 2.9 cm at
base, reddish-brown tomentose. Ptyxis inflexed. Leaves 2-3(4), 57.5-179 x 40.2-76.1
cm, descending, reddish-brown when emerging; petiole 10.2-95.3 cm long, blackish in
young leaves, subterete, heavily armed with straight or bifurcate prickles up to 6 mm
long; rachis subterete, up to 84 cm long, with few prickles along the proximal third.
Leaflets 5-28 pairs, sessile, coriaceous, lanceolate, opposite to subopposite, imbricate,
apex acute, base attenuate, margins dentate along distal third, subrevolute; articulations
dark brown in young leaflets, 0.8-1.2 cm; the median leaflets 22.7-38 x 3.1-4.4 cm
wide. Pollen strobili usually 1-2, erect, cylindrical, up to 8 cm long and 1.4 cm in diam,
light brown, apex acute; peduncle densely light brown tomentose, 4.5 cm long, 1.2 cm
in diam; pollen sporangiophores cuneiform, distal face truncate-hexagonal, 0.35 cm
long, fertile abaxial surface with 3 bisporangiate synangia per lobe. Ovulate strobili
usually solitary, erect, ellipsoid, 13.2 cm long, 4.9 cm in diam, brown to reddish,
tomentulose, apex acuminate; peduncle densely brown tomentose, 2.9 cm long, 1.6 cm
in diam; distal face hexagonal-truncate with a horizontal longitudinal depression, 1-1.2
cm high, 1.1-1.4 cm wide. Seeds ovoid, sarcotesta white when immature, red at
maturity, 2-2.8 cm long, 1.4-2 cm in diam, sclerotesta smooth.
Chromosome number.— 2n = 16 (Schutzman et al., 1988).
Diversity and genetic structure.— The average of alleles per locus is A = 1.98, the
percentage of polymorphic loci is P = 94.3, the expected heterozygosity is HE = 0.347
and the genetic differentiation between the two populations currently under study is Fst
= 0.093 (González-Astorga et al. unpubl. data).
Distribution and habitat.— Endemic to Tabasco-Mexico (Fig. 5), on karstic rocks
and cliffs of the Sierra El Madrigal, between 50-150 m. The vegetation type where this
56
species grows is evergreen tropical rain forest or bosque tropical perennifolio of
Rzedowski (1978).
Etymology.— The specific epithet is derived from the Greek word for cliff-friend
(κρεµνóσ = cremnos = cliff, and φιλοσ = filos = friend/lover) (Schutzman et al., 1988),
because of its unusual habitat.
Distinguishing features.— The species is characterized by its exclusive habit on the
rocky walls of limestone cliffs, in addition to descendent leaves. Petioles are densely
armed with prickles that are sometimes branched, and also lanceolate, imbricate leaflets
that are visibly dentate along the distal third.
Additional specimens examined.— MEXICO. TABASCO: Teapa, F. NicolaldeMorejón et al. 1497 (XAL), M. A. Pérez-Farrera 293 (HEM), M. A. Pérez-Farrera 900
(HEM, MEXU).
Zamia fischeri Miq., in Lem., Hort. Vanhoutt. 1: 20. 1845. Type: ex Horto
Petropolitano in H. Houtte. vecta, Miquel s.n. (neotype: designated by Stevenson &
Sabato, 1986a: U). (Fig. 7).
Stem subterranean, dichotomously branching in older plants, up to 30 cm long, 4-8
cm in diam. Cataphylls membranaceous, persistent, base triangular, apex aristate, 4.5
cm long, 1.2 cm at base, yellowish tomentose. Ptyxis inflexed. Leaves 1-5(8), 15-45 x 820 cm, ascending to spreading, dark-brown when emerging; petiole 9-14 cm long,
blackish in young leaves, unarmed, terete; rachis subterete, up to 31 cm long, unarmed.
Leaflets 20-35 pairs, sessile, papyraceous, elliptic to oblanceolate, alternate to
subopposite, apex acute symmetric, base cuneate, margins serrulate along distal third,
subrevolute; articulations light-brown in young leaflets, 0.3-0.4 cm wide, median
57
leaflets 5-9 x 1.5-4.5 cm. Pollen strobili usually 1-3, erect, conical, 4-6 cm long, 1.5-2.2
cm in diam, gray tomentose, apex acute; peduncle yellowish tomentose, 2.8 cm long,
0.9-1.1 cm in diam; pollen sporangiophores cuneiform, distal face hexagonal-truncate,
0.3 cm long, fertile abaxial surface with 3-4 bisporangiate synangia per lobe. Ovulate
strobili usually 1-2, erect, cylindrical to ovoid, up to 9 cm long, 4.5 cm in diam, brown
to reddish tomentulose when young, dark-green and glabrous when mature, apex acute;
peduncle brown tomentose, 3 cm long, 1.1 cm in diam; megasporangiophores peltate,
distal face hexagonal-truncate when immature, scutiform when mature 0.8-1.2 cm high,
1.3-1.9 cm wide. Seed ovoid, 1.6 cm long, 1.3 cm in diam, sarcotesta pink when young
and orange at maturity.
Chromosome number.— 2n = 16 (Marchant, 1968; Moretti et al., 1991; Stevenson et
al., 1995-96a).
Distribution and habitat.—Zamia fischeri is endemic to Mexico (Tamaulipas, San
Luis Potosí, Querétaro and Hidalgo) (Fig. 5), between 140-900 m elevation. The
vegetation type of its habitat is pine-oak forest, tropical deciduous forest and mountain
tropical forest (sensu Rzedowski, 1978).
Etymology.— The specific epithet is in honor of Friedrich Fischer, a German cycad
horticulturist of the 19th century.
Distinguishing features.— Zamia fischeri are small fern-like plants (up to 100 cm
tall), with papyraceous but serrulate leaflets and unarmed petiole and rachis. Ovulate
strobili greenish upon maturity.
Additional specimens examined.— MEXICO. QUERÉTARO: Jalopan, López 438
(XAL), Servín 1471 (XAL), Vovides 330 (XAL). SAN LUIS POTOSÍ: O. M. Clark 6839
(MO), J. Rees 1686 (XAL), Stevenson et al. 566 (MEXU, NY), Vovides 753 (XAL); El
Naranjo, F. Nicolalde-Morejón & J. González Astorga 1614 (XAL), 1615 (XAL), 1616
58
(XAL), 1617 (XAL), 1618 (MEXU, XAL), 1619 (XAL); Ciudad Valles, F. NicolaldeMorejón & J. González-Astorga 1620 (XAL), 1621 (XAL), 1622 (XAL), 1623 (MEXU,
XAL), 1624 (MEXU, XAL), 1625 (MEXU, XAL), 1626 (MEXU, XAL). HIDALGO:
Pisaflores, O. Alcántara-Ayala & R. Mayorga-Saucedo 3325 (FCME).
Zamia furfuracea L. fil. in Aiton, Hortus Kew. 3: 477. 1789. Type: Palma americana
crassis rigidisque foliis, pl. 210, in Herm. Paradisus Batavus. 1698 (lectotype:
designated by Stevenson & Sabato, 1986a).
Zamia furfuracea var. trewii A. DC., Prodr. 16(2): 541. 1868. Type: Palmifolia
fructu clavato polypireno[polyspermo]. C. J. Trew, PI. Select. Tab. 26. 1752
(holotype: G; typotype: designated by Stevenson & Sabato, 1986a: BM).
Zamia murieata var. obtusifolia Miquel, Tijdschr. nat. Gesch. Physiol. 10(1): 71-72.
1843. Type: Tab. VII, fig. a in Linnaea 19(4): 1847. (neotype: by Stevenson &
Sabato, 1986a).
Zamia latifolia Loddiges ex Miquel, Tijdschr. wis-en natuurk. Wet. 2(4): 298. 1849.
Basionym: Z. muricata var. obtusifolia Miq.
Stem hypogeous, becoming epigeous with age, often dichotomously branched, up to
60 cm long, 20 cm in diam. Cataphylls coriaceous, persistent, base triangular, apex long
aristate, up to 10 x 3-4.5 cm at base, yellowish tomentose. Ptyxis inflexed. Leaves 3 to
many, 45-190 x 10-30 cm, diffuse, brown-yellowish when emerging; petiole 17-50 cm
long, brown-yellowish when young, subterete, armed with small prickles up to 3 mm
long; rachis terete, up to 120 cm long, with few prickles along the proximal third.
Leaflets 8-18 pairs, sessile, coriaceous, obovate to oblanceolate, opposite to
subopposite, imbricate, keeled, apex rounded to sub-acute, base attenuate, margins
59
slightly serrulate along the ½ distal portion, subrevolute; articulations yellow in young
and juvenile leaflets, 0.4-0.7 cm wide; median leaflets 14-20 x 4-7.5 cm. Pollen strobili
usually 2-4, erect, cylindrical, up to 17 cm long, 1.8 cm in diam, yellowish to brown,
apex acute; peduncle densely light-brown tomentose, 12 cm long, 1.1 cm in diam;
pollen sporangiophores cuneiform, distal face hexagonal-truncate, 0.45-0.55 cm long,
fertile abaxial surface with 8-9 bisporangiate synangia per lobe. Ovulate strobili usually
1 per crown, erect, cylindrical, up to 25 cm long, up to 10.5 cm in diam, yellowishgreen tomentulose when immature, light brown upon maturity, apex apiculate; peduncle
yellowish tomentose, up to 8 cm long, up to 1.3 cm in diam; megasporangiophores
peltate, distal end hexagonal-truncate, 0.9 cm high, 1.3 cm wide. Seeds ovoid, sarcotesta
yellowish-green when immature turning red at maturity, 1.6 cm long, 1.2 cm in diam,
sclerotesta smooth.
Chromosome number.— 2n = 18 (Moretti, 1990a ,b).
Diversity and genetic structure.— The average of alleles per locus is A = 2.05, the
percentage of polymorphic loci is P = 90.7, the expected heterozygosity is HE = 0.356
and the genetic differentiation between the two populations currently under study is Fst
= 0.161 (González-Astorga et al. unpubl. data).
Distribution and habitat.— Endemic to Mexico in central-south coastal Veracruz,
along a coastal stretch of approximately150 km in stable dunes and basalt cliffs (Fig. 5).
Etymology.— The specific epithet alludes to the persistent brown-yellowish
trichomes of the leaves throughout the developmental stages of the plant.
Distinguishing features.— Leaves strongly keeled with highly imbricate and
coriaceous obovate to oblanceolate leaflets with brown-yellowish indumentum
persisting with age.
60
Additional specimens examined.— MEXICO. VERACRUZ: Ibarra-Mariquez 316
(MEXU, MO), Ibarra-Mariquez 1952, 1959 (MEXU); Alvarado, Rees 1650, 1651,
1652 (XAL), M. Vázquez-Torres et al. 4871 (CIB); Catemaco, Calzada 1475 (MEXU),
Calzada 2451 (XAL), Cedillo 2610 (MEXU, XAL), González-Quintero 1520 (ENCB),
Ibarra 316 (MEXU), Lot 1277-14 (F, XAL), Menendez 115 (MEXU, MO, XAL), F.
Nicolalde-Morejón et al. 1484 (XAL), 1485 (XAL), 1486 (XAL), J. Rees 1651 (IBUG,
MEXU, XAL), J. Rees 1652 (XAL), Schatz & Nee 207 (XAL), Vovides 567 (MEXU,
XAL); Mecayapan, Calzada et al. 11325 (XAL), Castillo-Campos 12732 (XAL); Lerdo
De Tejada, Vovides 828 (XAL), 829 (XAL), 830 (XAL), 831 (XAL), 832 (XAL), 833
(XAL), 839 (XAL); San Andrés Tuxtla, Castillo-Campos et al. 13881 (XAL), Chazaro
B. 512 (XAL), Hammel & Merello 15499 (MO), Hernández-M 1216A (F, MEXU),
Lorence 4978 (MEXU), Sousa 3099 (F, MEXU, MO), Vovides & Iglesias 1148 (XAL).
Zamia herrerae Calderón & Standl., Proc. Wash. Acad. Sci. 14(4): 93. 1924. Type:
Salvador. Vicinity of Sonsonate: 17 Jul 1923, S. Calderón 1682 (holotype: US).
Stem hypogeous, bifurcate in adult plants, 6-26 x 4.5-13.5 cm in diam. Cataphylls
chartaceous, persistent, base triangular, apex aristate, 4.6 x 1.2 cm wide at base,
yellowish tomentose. Ptyxis inflexed. Leaves 2-4, erect, green to light-brown when
emerging, 61-96 x 24.5-29.5 cm; petiole 19-34 cm long, brownish in young leaves,
terete, armed with prickles up to 3 mm long; rachis subterete, up to 63 cm long, with
few prickles along the proximal third. Leaflets 15-32 pairs, sessile, papyraceous,
lanceolate, alternate to subopposite, apex acute, base symmetric attenuate; margins
dentate along distal 2/3, subrevolute; articulations dark brown when young, 0.3-0.5 cm
wide; median leaflets 22-38 x 3.1-4.4 cm. Pollen strobili usually 2-3, erect, cylindrical
61
to conical, 4.3-7.5 cm long, 1.3-2.1 cm in diam, light brown tomentulose, apex
mucronate; peduncle densely light-brown tomentose, 6.2-7.8 cm long, 1.1-1.4 cm in
diam; pollen sporangiophores cuneiform, distal face hexagonal, 0.35 cm long, fertile
abaxial surface with 3-4 bisporangiate synangia per lobe. Ovulate strobili usually
solitary, erect, cylindrical to ovoid, 7.1-11.6 cm long, 4.1-4.9 cm in diam, brown,
tomentulose, apex acute; peduncle densely brown tomentose, 3.5-4.2 cm long, 1.1-1.3
cm in diam; megasporangiophores peltate, distal face hexagonal-truncate, 1.3-1.6 cm
high, 2.2-2.8 cm wide. Seeds ovoid, sarcotesta pink when immature, red at maturity,
1.6-1.9 cm long, 1.2-1.5 cm in diam, sclerotesta smooth.
Chromosome number.— 2n = 23, 24 (Fig. 4).
Distribution and habitat.— The species range is El Salvador, Guatemala and
southern Mexico in Chiapas, between 100-600 m elevations (Fig.6). It generally grows
in tropical deciduous forest (sensu Rzedowski, 1978) on deep clay soils. Also, this
cycad may be found in secondary growth forests and pastures.
Etymology.— The specific epithet honors Hector Herrera, a scientist from El
Salvador.
Distinguishing features.— Zamia herrerae is distinguished by its long-lanceolate
papyraceous leaflets with dentate margins along the distal 2/3.
Additional specimens examined.— MEXICO. CHIAPAS: Escuintla, Matuda
16368 (MEXU), 16871 (MEXU), 17332 (MEXU), 18332 (MEXU), M. A. PérezFarrera 143 (HEM), Schutzman 526 (XAL), 527 (XAL), 528 (XAL); Tonalá, Farrera
2489 (CHIP), F. Nicolalde-Morejón & J. González-Astorga 1579 (XAL), 1580 (XAL),
1581 (XAL), M. A. Pérez-Farrera 744 (CIB).
GUATEMALA. P. C. Standley 67306 (F).
NICARAGUA. MANAGUA: Cultivated, A. Grijalva 3658 (MO).
62
Zamia inermis Vovides, J.D. Rees & Vázq. Torres, Flora de Veracruz 26: 22. 1983.
Type: Mexico. Veracruz: 6 Jun 1981, Vovides 666 (holotype: XAL; isotype: F).
(Fig. 8).
Stem epigeal, erect, dichotomously branching in mature plants, 15-43 cm long, 8.626.4 cm in diam. Cataphylls chartaceous, persistent, base triangular, apex aristate, 2.12.6 x 4.1-5.6 cm wide at base, yellowish tomentose. Ptyxis inflexed to erect. Leaves 1035, erect, light to yellowish-green when emerging, 30-95 x 43.5-60 cm; petiole 18-41
cm long, greenish in young leaves, subterete, without prickles; rachis subterete, 15-19
cm long, unarmed. Leaflets 27-32 pairs, sessile, coriaceous, linear-lanceolate, opposite
to subopposite, apex acute, base attenuate; margins entire, subrevolute; articulations
0.4-0.6 cm wide; median leaflets 20-30.5 x 0.9-1.2 cm. Pollen strobili cylindrical,
usually 1-2 per crown, erect, up to 9.1 cm long, up to 2.8 cm in diam, beige-yellowish,
apex acute; peduncle densely light-yellowish tomentose, up to 4.5 cm long, 1.1 cm in
diam; pollen sporangiophores cuneiform, distal face hexagonal-truncate, 0.35 cm long,
fertile abaxial surface with 5-6 bisporangiate synangia per lobe. Ovulate strobili usually
1-2 per crown, erect, cylindrical, 13-23 cm long, 8-9.8 cm in diam, light-brown to beige
tomentulose, apex apiculate; peduncle brown tomentose, 6-8 cm long, 1.2-1.4 cm in
diam; megasporangiophores peltate, distal face hexagonal-truncate, 0.7-0.9 cm high,
1.1-1.3 cm wide. Seeds ovoid, sarcotesta pink when immature, red at maturity, 1.7-2.5
cm long, 1.4-2.1 cm in diam, sclerotesta smooth.
Chromosome number.— 2n = 16 (Vovides, 1983).
63
Distribution and habitat.— Endemic to Mexico in a small mountain range in central
Veracruz (Fig. 5) at 150-300 elevation on basaltic soils. The vegetation type of the
habitat is tropical deciduous forest (sensu Rzedowski, 1978).
Etymology.— The specific epithet alludes to the absence of prickles on the petiole
and rachis and the entire leaflet margins.
Distinguishing features.— Zamia inermis differs from its congeners in Mexico by a
total absence of prickles along the petiole and rachis, as well as having totally entire
leaflets and light-yellowish to clear-beige tomentulum on the pollen and ovulate strobili.
Additional specimens examined.— MEXICO. VERACRUZ: Actopan, Acosta &
Acosta 234 (XAL), F. Nicolalde-Morejón & Vovides 1415 (XAL), 1416 (XAL), 1417
(XAL), Schutzman 570 (XAL), 571 (XAL), 572 (XAL), 575 (XAL), 576 (XAL), 577
(XAL), J. Rees et al. 681 (XAL).
Zamia katzeriana (Regel) Rettig, Gartenflora 45: 148. 1896. Type: ex Horto Katzer.,
Regel s.n. (lectotype: designated by Stevenson & Sabato 1986a : LE).
Ceratozamia katzeriana Regel, Acta Horti Petrop. 4(4): 298. 1876. Type: ex
Horto Katzer., Regel s.n. (lectotype: designated by Stevenson & Sabato,
1986b: LE).
Zamia splendens Schutzman, Phytologia 55(5): 299. 1984. Type: Cultivated in
Fairchild Tropical Garden, Miami, accession no. FTG 76-1046, 11 Apr 1984, J.
Watson s.n. (holotype: NY; isotypes: FLAS, FTG, MEXU).
Stem hypogeous, unbranched, up to 25 cm long, up to 7 cm in diam. Cataphylls
chartaceous, semidecidious, base triangular, apex aristate, 5.3 x 1.4 cm at base,
yellowish tomentose. Ptyxis inflexed. Leaves 1-2 (3), 49-220 x 35-58 cm, ascending to
64
descending, bright reddish-pink with lustrous cuticle when emerging, dark green when
mature; petiole 20-130 cm long, terete, armed with few simple prickles; rachis
subterete, up to 84 cm long, unarmed. Leaflets 3-7 pairs sessile, coriaceous, oblonglanceolate, opposite to subopposite, adaxial surface with brilliantly shining cuticle
throughout life of leaflet, apex acute, base attenuate; margins dentate along distal third,
subrevolute; articulations brown in young leaflets turning green with age 0.6-1.6 cm
wide; median leaflets 18-35 x 3.5-12 cm. Pollen strobili 1-5, conical, light-brown
tomentulose, erect upon emergence becoming prostrate to decumbent upon maturity, up
to 3.9 cm long, 1.1 cm in diam, apex acute; peduncle light-brown tomentose, up to 5.8
cm long, 1.2 cm in diam; pollen sporangiophores cuneiform, distal face hexagonal
scutiform, 0.35 cm long, fertile abaxial surface with 5-6 bisporangiate synangia per
lobe. Ovulate strobili usually solitary, decumbent to erect, elliptic, 8-12 cm long, 4.5-6
cm in diam, brown to yellowish tomentose, apex aristate; peduncle brown tomentose,
2.1-4.3 cm long, 1.1-1.3 cm in diam; megasporangiophores peltate, distal face
hexagonal-truncate to scutiform, 1-1.2 cm high, 1.1-1.3 cm wide. Seeds ovoid,
sarcotesta pink when immature, red at maturity, 1.1-1.4 cm long, 1.6-1.8 cm in diam,
sclerotesta smooth.
Chromosome number.— 2n = 16 (Schutzman, 1984; Moretti, 1990a).
Diversity and genetic structure.— The average of alleles per locus is A = 1.95, the
percentage of polymorphic loci is P = 84.4, the expected heterozygosity is HE = 0.280
and the genetic differentiation between the two populations currently under study is Fst
= 0.194 (González-Astorga et al. unpubl. data).
65
Distribution and habitat.— Endemic to Mexico and known from the states of
Chiapas, Tabasco and Veracruz (Fig. 5) at 200-700 m in evergreen tropical forest (sensu
Rzedowski, 1978).
Etymology.— Specific epithet in honor of Katzer, inspector of the gardens in
Paullowsk (Stevenson and Sabato, 1986a).
Distinguishing features.— Zamia katzeriana is easily distinguished from its
congeners by having leaves with highly lustrous or shiny cuticles. Emerging leaves are
a bright reddish-pink. Both pollen and ovulate strobili are borne on long peduncles that
become descendent to prostrate.
Additional specimens examined.— MEXICO. VERACRUZ: Las Choapas,
Martínez & Martínez-M. 825 (HEM), F. Nicolalde-Morejón et al.1436 (XAL), 1437
(XAL). Tabasco, Teapa, Hdez-Najarro 622 (CHIP), M. A. Magaña 1905 (MEXU), M.
A. Pérez-Farrera s.n. (XAL), M. A. Pérez-Farrera 899 (HEM, MEXU), Walters s.n.
(FTG accession 12-2, XAL). CHIAPAS: San Fernando, Vovides et al. 1266 (XAL),
Palacios 383 (CHIP), F. Nicolalde-Morejón & Pérez-Farrera 1420 (XAL), M. A.
Pérez-Farrera s.n. (XAL), Walters s.n. (FTG accession 23-2, XAL); Ocozocoautla,
Gómez-Pompa 705 (FCME, MEXU), F. Nicolalde-Morejón et al. 1453 (XAL), 1454
(XAL), 1455 (XAL), 1456 (XAL), 1457 (XAL), 1458 (XAL), 1459 (XAL), 1460
(XAL), M. A. Pérez-Farrera 29 (CHIP, CIB, MEXU); Tila, Vovides et al. 1340 (XAL),
1343 (XAL), 1341 (XAL).
Zamia lacandona Schutzman & Vovides. Novon 8(4): 441. 1998. Type: Mexico.
Chiapas: Selva Lacandona, July 1984, Schutzman 517 (holotype: FLAS; isotype:
XAL).
66
Stem hypogeous, unbranching, 6-14 cm long, 5-9 cm in diam. Cataphylls
coriaceous, persistent, base triangular, apex long-aristate, 8.3 x 3.6 cm at base, reddishbrown tomentose. Ptyxis inflexed, reddish-brown. Leaves usually solitary, up to 3 under
cultivation, 46-171 x 32-75 cm, ascending, reddish-brown when emerging; petiole 1495.3 cm long with bulbous base, blackish in young leaves, subterete, proximal section
strongly channeled, armed with prickles up to 5 mm long; rachis subterete, 31-76 cm
long, with few prickles along proximal third. Leaflets 4-17 pairs, sessile, coriaceous,
lanceolate, opposite to subopposite, subfalcate, apex acute, base attenuate, margins
dentate along distal third, subrevolute; articulations dark-brown when young, 0.4-1.1
cm wide; median leaflets 15.6-37 x 2.9-6 cm. Pollen strobili usually 2-3, erect, conical,
5.4-6.6 cm long, 1.5-1.7 cm in diam, light-brown, apex acute; peduncle light-brown
tomentose, 5.8-6.9 cm long, 1.2 cm in diam; pollen sporangiophores cuneiform, distal
face hexagonal truncate, 0.35 cm long, fertile abaxial surface with 4-5 bisporangiate
synangia per lobe. Ovulate strobili usually solitary, erect, ellipsoid, 13.2 cm long, 4.9
cm in diam, dark-brown, tomentulose, apex acute to slightly apiculate; peduncle densely
brown tomentose, 6.5 cm long, 1.2 cm in diam; megasporangiophores peltate, distal
face hexagonal-truncate, 1-1.2 cm high, 1-1.5 cm wide. Seeds irregularly ovoid,
sarcotesta pink when immature, red at maturity, 2-2.4 cm long, 1.3-1.9 cm in diam,
sclerotesta smooth.
Chromosome number.— 2n = 16, 17, 18 (Schutzman & Vovides, 1998).
Diversity and genetic structure.— The average of alleles per locus is A = 1.78, the
percentage of polymorphic loci is P = 67.9, the expected heterozygosity is HE = 0.191
and the genetic differentiation between the two populations currently under study is Fst
= 0.108 (González-Astorga et al. unpubl. data).
67
Distribution and habitat.— Endemic to Chiapas (Fig. 5) in the vicinity of the
Lacandon forest at 80-200 m elevation, in evergreen tropical forest (sensu Rzedowski,
1978). It is also found in secondary succession stages of the tropical forest.
Etymology.— The epithet is derived from the name of the 1.8 million hectare Selva
Lacandona (Lacandona Jungle) in southeastern Chiapas, which itself bears the name of
the Lacandona Maya Indians who inhabit the forest.
Distinguishing features.— This species is distinguished by having a solitary large
leaf (up to three leaves may be maintained on plants under cultivation) with a stout erect
petiole and a strongly bulbous base. The leaf is reddish-brown at emergence and petiole
dark purplish-brown turning dark-brown with age. Ovulate cone generally solitary, with
acute apex.
Additional specimens examined.— MEXICO. CHIAPAS: Palenque, Schutzman
510 (XAL), 511 (XAL), 512 (XAL), 513 (XAL), 514 (XAL), 515 (XAL), 516 (XAL),
517 (XAL), 518 (XAL), 519 (XAL), 520 (XAL), F. Nicolalde-Morejón & N. Martínez
1418 (XAL), M. A. Pérez-Farrera 890 (HEM, MEXU), Walters s.n. (FTG accession
14-2, XAL), M. Vázquez-Torres et al. 3925 (CIB); San Jerónimo Tulija, Chavelas et al.
ES=315 (ENCB, MEXU), Schutzman 521 (XAL), 522 (XAL), 524 (XAL), 523 (XAL),
525 (XAL).
Zamia loddigesii Miq., Tijdschr. Natuurl. Gesch. Physiol. 10: 72. 1843. Type:
cultivated by Van Houtte 3374 (lectotype, here designated: U)
Zamia galeotti De Vriese, in Hoven & De Vries. Tijdschr. Natuurl. Gesch.
Physiol. 12: 24. 1845. Type: Mexico, Veracruz. 5 July 1983. D. W.
Stevenson 538 (neotype, here designated: NY, isoneotype: XAL).
Zamia leiboldii Miq. Linnaea 19: 425. 1847. Type: E. Mexico in Hortum
68
Loehrianum Lipsiae attulit Liebold, 1845, Miquel s.n. (holotype: U).
Zamia loddigesii var. angustifolia Regel, Bull. Soc. Nat. Moscou 30(1): 190.
1857. Type: ex horto Petropolitano, 1856, Regel s.n. (holotype: LE)
Zamia loddigesii var. obtusifolia Regel, Bull. Soc. Nat. Moscou 30(1): 190.
1857. Type : t. 186, figs 27-28 in Gartenflora 6: 1857. (lectotype, designated
by Stevenson & Sabato, 1986a: LE).
Zamia mexicana Miquel, Prodr. syst. Cycad. 13. 1861. Type: Eriozamia
mexicana H. Belg., 1847, Miquel s.n. (holotype:U).
Zamia loddigesii var. leiboldii (Miquel) A. DC., Prodr. 16(2): 541. 1868.
Basionym: Zamia leiboldii Miquel.
Zamia leiboldii var. angustifolia Regel Trudy Imp. S.-Petersburgsk. Bot. Sada
4(4): 307. 1876. Type: Mexico. Oaxaca: 15 July 1983. D. W. Stevenson 559
(neotype, here designated: NY; isoneotype, XAL).
Zamia leiboldii var. latifolia Regel, Trudy Imp. S. Petersburgsk. Bot. Sada 4(4):
307. 1876. Type: ex Horto Petropolitano, 1875, Regel s.n. (holotype: LE).
Zamia lawsoniana Dyer in Hemsley, Biol. Centr.-Amer., Bot. 3(16): 195. 1884.
Type: Mexico. Oaxaca: Fielding 209 (holotype: OX; isotype: K).
Zamia cycadifolia Dyer in Hemsley, BioI. Cent.-Amer., Bot. 3(16): 195. 1884,
non Jacquin 1809. Type: México. Bourgeau s.n. (holotype : K; isotype : C).
nomen illegit.
Zamia sylvatica Chamberlain, Bot. Gaz. 81: 223. 1926. Type: Mexico, Oaxaca,
Tuxtepec, Sep 1910, C. J. Chamberlain s.n. (lectotype, designated by
Stevenson & Sabato, 1986a: NY; isolectotype, F-3 sheets).
69
Zamia loddigesii var. cycadifolia Schuster, Pflanzenreich 99: 148. 1932.
Basionym: Zamia cycadifolia Dyer in Hemsley, Biol. Cent.-Amer., Bot.
3(16): 195. 1884, non Jacquin 1809.
Zamia loddigesii var. angustifolia (Regel) J. Schust., in Engl., Pflanzenr. 4(1):
148. 1932. Type: México. Veracruz: savanne bei Mundo nuevo, Karwinski
1028b (lectotype, designated by Stevenson & Sabato, 1986a: LE;
isolectotype, LE).
Zamia loddigesii var. longifolia J. Schust., in Engl., Pflanzenr. 4(1): 147. 1932.
Type: Mexico: Veracruz, Colipa, Karwinski 1029 (lectotype, designated by
Stevenson & Sabato, 1986a : LE ; isolectotype: LE).
Stem hypogeous, branching dichotomously with age, 10-45 cm long, 8-15 cm in
diam. Cataphylls chartaceous, persistent, base triangular, apex aristate, 8.4 x 3.7 cm at
base, yellowish tomentose. Ptyxis inflexed. Leaves 2-3 (4) ascending to spreading, 4596 x 30-41 cm, light-green when emerging, green to dark-green when mature; petiole
15-25 cm long, green in young leaves, subterete, armed with prickles up to 4 mm long;
rachis subterete, up to 57 cm long, with few prickles on the proximal third. Leaflets 1223 pairs, sessile, coriaceous, linear-lanceolate, opposite to subopposite, apex acute, base
attenuate, margins serrulate along distal third, subrevolute; articulations 0.4-0.7 cm
wide; median leaflets 16-26 x 1.8-3.1 cm. Pollen strobili 1-2 per crown, up to 6 (7)
when multiple crowned, erect, cylindrical, 8-14 cm long, 1.8-3.5 cm in diam, light
brown tomentulose, apex acute; peduncle light-brown tomentose, 6 cm long, 1.2 cm in
diam; pollen sporangiophores cuneiform, distal face hexagonal-truncate, 0.3 cm long,
fertile abaxial surface with 6-8 bisporangiate synangia per lobe. Ovulate strobili usually
1-2 per crown, erect, ellipsoid to conical, up to 16 cm long, up to 6 cm in diam, beige-
70
tomentulose, apex acute; peduncle brown-tomentose, up to 6 cm long, 1.6 cm in diam;
megasporangiophores peltate, distal face hexagonal-truncate, 0.7-1 cm high, 1.9-2.6 cm
wide. Seeds ovoid, sarcotesta pink when immature, red at maturity, 1.4-1.8 cm long,
0.8-1 cm in diam, sclerotesta smooth.
Chromosome number.— 2n = 18 (Norstog, 1980; Moretti, 1990a, b).
Diversity and genetic structure.— The average of alleles per locus is A = 1.8, the
percentage of polymorphic loci is P = 66.6, the expected heterozygosity is HE = 0.266
and the genetic differentiation between the two populations currently under study is Fst
= 0.179 (González-Astorga et al. unpubl. data).
Distribution and habitat.— Endemic to Mexico and distributed widely within the
states of Tamaulipas, Hidalgo, Veracruz, Tabasco and parts of Oaxaca with a single
known locality in Chiapas (Fig. 6). The vegetation types are evergreen tropical forest,
tropical deciduous and sub-deciduous forests (sensu Rzedowski, 1978), as well as a
variety of secondary succession and disturbed habitats such as pastures and cornfields,
as well as road-side vegetation.
Etymology.— The specific epithet honors Conrad Loddiges (1738-1826), a German
horticulturist who lived in London and cultivated American cycads.
Nomenclatural notes.— The description of Zamia loddigesii was lectotypified by
Stevenson & Sabato, (1986). However, it is no longer permissible to designate a
description to serve as a type. Moreover, since then a specimen, Van Houtte 3374 at U,
was found that was sent to Miquel by Van Houtte. This specimen predates the
publication of Z. loddigesii Miq. and matches the description. Thus, we are designating
it the lectotype.
Distinguishing features.— Zamia loddigesii in contrast to Z. paucijuga, has been
widely collected along the Gulf of Mexico seaboard and on the Yucatan peninsula since
71
the 19th century, largely by British and Russian botanists, and recently by Mexican and
North American researchers. The high morphological variation presented by this
species has resulted in the publication of 10 affine names (see Hill et al., 2007) that at
times, has been a basis for the separation of natural populations, i.e. that of the Yucatan
peninsula (formerly Z. loddigesii sensu Vovides & Olivares, 1996) that is now a
separate entity Z. polymorpha (see Stevenson et al., 1995-96b), a decision based on both
vegetative and reproductive characters that differ from Z. loddigesii mainly on pollen
and ovulate strobilus shape and indument color.
Zamia loddigesii is similar to Z. polymorpha in leaf morphology; however, there are
differences in the reproductive structures. Pollen cones of Z. loddigesii are beige in
color with a blunt apex whereas those of Z. polymorpha are dark reddish-brown or
maroon with an acute apex. Ovulate cones of Z. loddigesii are cylindrical and beige in
color and those of Z. polymorpha are ovoid and dark maroon in color.
Additional specimens examined.— MEXICO. CHIAPAS: Ocozocoautla, M. A.
Pérez-Farrera 81 (CHIP, HEM). HIDALGO: Atlapexco, San Juan 15 (XAL), 16 (XAL),
17 (XAL), 18 (XAL), 19 (XAL), 20 (XAL), 21 (XAL). PUEBLA: Sarukán et al. 4632
(FCME, MEXU). Oaxaca, Tuxtepec, J. Chamberlain s.n. (MO). TAMAULIPAS: R. L.
Dressler 1858 (MO), Mayfiel et al. 791 (MEXU); Aldama, F. Nicolalde-Morejón & J.
González-Astorga 1585 (XAL), 1586 (XAL), 1587 (XAL), 1588 (XAL). VERACRUZ:
Chavelas et al. ES-4231 (MEXU), Dorantes et al. 964 (MEXU, MO), Dorantes et al.
1112 (MEXU), Lot 733 (MEXU), Medrano et al. 2725 (MEXU), Nevling & GómezPompa 140 (MEXU), Santos 353 (XAL, XALU); Acayucan, Vovides et al. 1376
(XAL), 1377 (XAL); Actopan, J. I. Calzada et al. 6369 (MEXU, XAL), Lot 1027
(XAL), A. Vovides 754 (XAL), 755 (XAL), 817 (XAL), 818 (XAL), 819 (XAL), 820
(XAL), 821 (XAL), 822 (XAL), 823 (XAL), 824 (XAL); Alto Lucero, J. Rees 1627
72
(XAL), 1629 (XAL), 1630 (XAL), 1631 (XAL), 1632 (XAL), 1637 (XAL), Vovides
846 (XAL); Atoyac, Acevedo & Castillo-Campos 240 (XAL); Cotaxtla, González 82
(MEXU); Chicontepec, J. Rees 1615 (MEXU, XAL); Choapas, Vovides et al. 1373,
1374, 1735 (XAL); Coatepec, J. Rees & Vovides 1670 (XAL); Coatzacoalcos, Castillo
& Acosta 16220 (XAL); Colipa, J. Rees 1634, 1635 (XAL); Cosautlan, Vovides 35
(XAL); Emiliano Zapata, J. Rees 1763 (XAL), Stevenson et al. 538 (MEXU, NY), M.
Vázquez-Torres 8071 (CIB); Huejultla, Stresser 291 (MEXU); Hueyapan de Ocampo,
Gómez-Pompa 4424 (XAL), Vovides et al. 1378 (XAL), 1379 (XAL), 1380 (XAL);
Jalcomulco, Castillo & Zamora C. 7542 (XAL), Castillo & Gómez-Pompa 2588 (XAL),
Castillo-Campos 2727 (XAL); Mecayapan, Castillo et al. 13681 (XAL), 13792 (XAL),
13843 (XAL), 13861 (XAL), 13865 (XAL), 13866 (XAL), A. Calatayud & J. MartínezGándara 124 (CIB); Moloacan, J. Rees 1656 (XAL); Puente Nacional, Castillo &
Medina 4261 (XAL); Papantla, R. Cuevas et al. 4652 (ZEA); Soteapan, Leonati 42
(MEXU); Soteapan, A. Calatayud & J. Benítez R 285 (CIB), M. A. Santos R. 352 (CIB);
Tampico Alto, Ortega & Ortega O. 2437 (XAL); Tezonapa, Robles 370 (XAL);
Totutla, J. Rees 1661 (XAL); Yecuatla, J. Rees 1633 (XAL).
Zamia monticola Chamb., Bot. Gaz. 81: 219. 1926. Type: cultivated from a single seed
collecting opposite the crater of Naolinco, near Xalapa, Veracruz, Oct 1925, C. J.
Chamberlain s.n. (holotype: MO; isotype: NY).
Stem epigeal, up to 30 cm tall, 18-20 cm in diam. Cataphylls base triangular, apex
linear-lanceolate, 3-6 x 1-2 cm wide at base. Leaves 5-20, 100-200 cm long, erect to
slightly curved; petiole 50-75 cm long, terete, armed with stout prickles in lower half;
rachis terete, up to 100 cm long, with few prickles along the lower half. Leaflets 30-40
73
pairs, sessile, chartaceous to papyraceous, linear-lanceolate, opposite to subopposite,
subfalcate near the base, apex long-acuminate and often strongly curved, base attenuate,
margins serrulate only near the base, subrevolute; articulations 0.4-0.7 cm wide; the
median leaflets 25-30 x 4-6 cm. Pollen strobili usually 2-6, erect, cylindrical to oblong,
12-20 cm long and 2-4 cm in diam, cream to light brown, apex acute; peduncle light
brown tomentose, 10-20 cm long; pollen sporangiophores cuneiform, distal face
hexagonal, 0.4 cm long, fertile abaxial surface 2-lobed with 10-16 bisporangiate
synangia per lobe. Ovulate strobili unknown.
Chromosome number.— Unknown.
Etymology.— The specific epithet alludes to its mountainous habitat type, originally
thought to be near Naolinco near the city of Xalapa, Veracruz in Mexico. It is now
known that this species is not known from Mexico and is endemic to Guatemala.
Distribution and habitat.— Endemic to Guatemala on rocky outcrops in primary and
secondary evergreen tropical rainforest (Fig. 6).
Distinguishing features.— Characterized by its consistently chartaceous to
papyraceous long acuminate leaflets that are strongly curved near the apex with light
serrulations.
Additional specimens examined.— GUATEMALA. ALTA VERAPAZ: H. Förther
2621/592 (NY).
Zamia onanreyesii C. Nelson & G. Sandoval. Ceiba 49(1): 135. 2008. Type:
Honduras. Cortés, 7 Jan 2008, O. Reyes 406 (holotype: TEFH).
Zamia bussellii Schutzman, R. S. Adams, J. L. Haynes & Whitelock. The Cycad
Newsletter 31(2/3), 22. 2008. TYPE: Honduras. Cortés, June 2003, Whittington
2003/01 (holotype: FLAS).
74
Stem up to 2 m tall, up to 16 cm in diam. Ptyxis inflexed. Leaves 3-15(44), 60-180 x
15-50 cm, erect to slightly curved, tomentulose when emerging; petiole 15-40 cm long,
terete, sparsely to moderately armed with prickles; rachis terete, up to 40-120 cm long,
with few prickles along proximal third. Leaflets up to 30 pairs, sessile, subcoriaceous,
oblong-lanceolate, opposite to subopposite, long acuminate apically, base attenuate,
margins serrulate along distal third, subrevolute; articulations yellowish; median leaflets
to 36 x 4 cm. Pollen strobili usually 1-3, erect, cylindrical, up to 27.5 cm long, up to 4
cm in diam, light brown to tan, apex acute; peduncle brown to tan, tomentose, up to 8.5
cm long, up to 1.6 cm in diam; pollen sporangiophore cuneiform, distal face hexagonal
truncate, fertile abaxial surface with up to 9 bisporangiate sori per lobe. Ovulate strobili
usually solitary, erect, cylindrical, up to 43 cm long, 12 cm in diam, brown to greenish,
tomentulose, apex conical; peduncle densely brown tomentose, up to 5 cm long, up to
2.5 cm in diam, distal face hexagonal-truncate, 2.9 cm high, 4.7 cm wide. Seeds ovoid,
sarcotesta red at maturity, up to 3 cm long, up to 2 cm in diam, sclerotesta smooth.
Chromosome number.— Unknown.
Distribution and habitat.— The species range is Honduras (Fig. 6), between 0-1300
m elevations in evergreen tropical forest.
Etymology.— The specific epithet is in honor of Onán Reyes, a Honduran biologist.
Distinguishing features.— Stems arborescent up to 2 m tall, leaflets coriaceous,
long acuminate apically, with margin serrulate.
Nomenclatural note. — Both Z. onanreyesii and Z. busselllii were published in
2008. The dates of issue are however different. The date of issue for Z. onanreyesii is 6
September 2008 and the date of issue for Z. bussellii is 16 October 2008. Thus, under
75
Article 29.1 of the Interantional Code of Botanical Nomenclature (McNeill et al., 2007),
Z. onanreyesii has priority and is used here.
Additional specimens examined.— HONDURAS. Departamento Cortés: J.
Haynes et al. 044A, 044B (TEFH).
Zamia oreillyi C. Nelson, Ceiba 46(1-2): 56. 2005. Type: Honduras. Atlántida: 8 Apr
2006, G. Sandoval et al. 1157 (holotype: TEFH). (Fig. 9).
Stem hypogeous, non-branching, up to 25 cm long, up to 7.5 cm in diam. Leaves
usually 1(2), up to 78.2 cm long, 31-35 cm wide, ascending to descending; petiole up to
47 cm long, subterete, armed with small prickles; rachis subterete, up to 35-40 cm long,
with few prickles along the proximal third. Leaflets 29-31 pairs, sessile, papyraceous to
sub-coriaceous, linear-lanceolate, opposite to subopposite, imbricate, apex acuminate,
base attenuate, margins dentate to rarely entire along distal third, up to 0.3 cm,
subrevolute; articulations brown in young leaflets, 0.3-0.5 cm wide; the median leaflets
up to 16 cm long, 1 cm wide. Pollen strobili usually solitary, decumbent, cylindrical, up
to 2.5 cm long and 1 cm in diam, light brown, apex acuminate; peduncle light brown
tomentose, up to 15.9 cm long, 0.2 cm in diam; pollen sporangiophores cuneiform,
distal face truncate-hexagonal, 0.4 cm long, fertile abaxial surface, with 2-3
bisporangiate synangia per lobe. Ovulate strobili unknown.
Chromosome number.— Unknown.
Etymology.— The specific epithet is in honor of Carlos Manuel O´Reilly, a
Honduran biologist.
Distribution and habitat.— Endemic to Honduras, between 0-200 m in evergreen
tropical rainforest (Fig. 6).
76
Distinguishing features.— Characterized by strongly imbricate linear-lanceolate to
oblong leaflets with dentate margins along distal third; Pollen strobili usually solitary,
decumbent, with fertile section up to 2.9 cm long and decumbent peduncle up to 15.9
cm long.
Additional specimens examined.— HONDURAS. ATLÁNTIDA. Balick 1711 (NY,
TEFH).
Zamia paucijuga Wieland, American Fossil Cycads 2: 212 . 1916. Type: Fig. 86 in
American Fossil Cycads 2: 212 .1916.. (lectotype, designated by Stevenson &
Sabato, 1986a).
Stem hypogeous, branching dichotomously with age, 15-27 cm long, 8-13 cm in
diam. Cataphylls coriaceous, persistent, base triangular, apex aristate, 4.5 x 3.4 cm at
base, brown tomentose. Ptyxis inflexed. Leaves 2-3, ascending to descending 41-95 x
29-36 cm wide, brownish when emerging; petiole 10.2-32 cm long, green in young
leaves, subterete, armed with prickles up to 4 mm long; rachis subterete, up to 56 cm
long, with few prickles along the proximal third. Leaflets 5-28 pairs sessile, coriaceous,
lanceolate, opposite to subopposite, apex acute, base attenuate, margins serrulate to
slightly dentate along distal third, subrevolute; articulations brownish in young leaflets,
0.4-0.6 cm wide; the median leaflets 14-19 x 2.3-3.4 cm. Pollen strobili usually 1-2,
erect, cylindrical, 6.3-11 cm long, 2.1-2.6 cm in diam, light brown tomentulose, apex
acute; peduncle light-brown tomentose, 6.3 cm long, 1.2 cm in diam; pollen
sporangiophores cuneiform, distal face hexagonal-truncate, 0.3 cm long, fertile abaxial
surface with 6-8 bisporangiate synangia per lobe. Ovulate strobili usually solitary, erect,
ellipsoid to cylindrical, 8.1 cm long, 5.2 cm in diam, brown-yellowish, tomentulose,
77
apex apiculate; peduncle densely brown tomentose, 3.9 cm long, 1.3 cm in diam;
megasporangiophores peltate, distal face hexagonal-truncate, 0.6-0.8 cm high, 1.1-1.5
cm wide. Seeds ovoid, sarcotesta pink when immature, orange at maturity, 2-2.8 cm
long, 1.5-1.7 cm in diam, sclerotesta smooth.
Chromosome number.— 2n = 23, 34, 25, 26, 27, 28 (Moretti & Sabato, 1984).
Distribution and habitat.— Endemic to Mexico. Known from the states of Nayarit,
Jalisco, Colima, Michoacan, Guerrero and Oaxaca (Fig. 6). Found in varied habitats
from dry open woodlands to understory evergreen tropical forest.
Etymology.— The specific epithet alludes to few leaflet pairs per leaf.
Distinguishing features.— Zamia paucijuga is highly variable morphologically and
in chromosome number and karyotype (Moretti, 1990a, b). This may represent more
than one entity under the concept of Z. paucijuga sensu stricto Wieland (1916). This
species shares a number of characteristics with Z. loddigesii, being small plants with
underground contractile stems and having coriaceous leaflets with marginal teeth.
Nevertheless, it differs from Z. loddigesii in having highly coriaceous leaflets with
longer marginal teeth, and seeds with an orange sarcotesta at maturity as contrasted to
the red sarcotesta of Z. paucijuga. Zamia paucijuga occurs along the Pacific seaboard of
Mexico whereas Z. loddigesii is known generally from the Gulf of Mexico seaboard.
Additional specimens examined.— MEXICO. COLIMA: McVaugh 15768
(FCME, MEXU). GUERRERO: Acapulco, N. Noriega-Acosta 463, 546 (FCME), W.
Thomas & J. L. Contreras 3744 (FCME); Chilpancingo, Kruse 902 (FCME, MEXU), R.
M. Fonseca 1210 (FCME), F. Nicolalde-Morejón et al. 1566, 1567, 1568, 1569 (XAL),
José Azueta, Vovides et al. 1426 (XAL); Petatlán, Vovides et al. 1427, 1428, 1429,
1430, 1431, 1432, 1433, 1434 (XAL); Unión de Isidro Montes De Oca, Vovides et al.
1416, 1417, 1418, 1420, 1421 (XAL); La Unión, G. Lozano-Valdez 331 (FCME), J.
78
Jiménez 331 (FCME). JALISCO: Gómez-Pompa 4876 (MEXU); El Arenal, Castillo et
al. 9822 (XAL); Cabo Corrientes, Castillo et al. 10147, 11733, 10280, 10466 (XAL), J.
Ceja et al 1437 (UAMIZ), J. Ceja et al. 1470 (UAMIZ), F. Nicolalde-Morejón et al.
1524, 1525 (XAL); Cihuatlán, J. Borocio R. s.n. (ZEA); Cuautitlán, Cochrane et al.
10886 (IBUG, WIS, ZEA), R. Cuevas et al 7025 (ZEA), L. Guzmán & J. Santana M.
745, 947 (ZEA), F. Nicolalde-Morejón et al. 1528, 1529 (XAL), Pérez de la Rosa 1039
(FCME, IBUG, MEXU), 1040 (FCME, IBUG, XAL), 1041 (CIB), 1518 (IBUG),
Ramírez 425 (IBUG), M. Rosales & L. Cruz 75 (ZEA), J. Santana M. et al. 5296
(ZEA); La Huerta, Cuevas et al. 4861 (IBUG, ZEA); San Sebastián, F. NicolaldeMorejón et al. 1422 (XAL), 1423 (XAL), 1424 (XAL), 1425 (XAL), 1426 (XAL),
1427 (XAL), Pérez de la Rosa 1084 (IBUG, FCME, MEXU) 1097, 1098 (IBUG);
Tuito, A. Flores et al. 614 (UAMIZ), F. Nicolalde-Morejón et al. 1429 (XAL), Pérez de
la Rosa 1438, 1439 (IBUG); Vallarta, Pérez de la Rosa 1413, 1415 (IBUG); Villa
Purificación, Pérez de la Rosa 1885. (IBUG). NAYARIT: Gentry & Gilly 10496
(MEXU), McVaugh 19211 (FCME, MEXU), Vovides et al. 1487 (XAL), 1488 (XAL),
1489 (XAL), 1490 (XAL), 1491 (XAL), 1493 (XAL); Compostela, F. NicolaldeMorejón et al. 1521 (XAL), 1522 (XAL), 1523 (XAL); Tepic, R. Dressler 1026 (MO),
H. S. Gentry & C. I. Gilly 10498 (FCME). Oaxaca: Miranda 4205 (MEXU), F.
Nicolalde-Morejón et al. 1465 (XAL), 1466 (XAL), 1467 (XAL), 1468 (XAL), 1469
(XAL), 1470 (XAL), 1471 (XAL), 1472 (XAL), 1473 (XAL); Pochutla, Schutzman
543 (XAL), 544 (XAL), 545 (XAL), 546 (XAL), 547 (XAL), 548 (XAL), 550
(XAL), 551 (XAL), 552 (XAL), 553 (XAL), 554 (XAL), 555 (XAL), 556 (XAL),
557 (XAL), 558 (XAL), 560 (XAL), 561 (XAL), 562 (XAL), 563 (XAL), 565
(XAL), A. Nava-Zafra & J. Pascual 35 (SERO, FCME); Puerto Escondido, J. Rees
1603 (MO, XAL), Walters sn (FTG accession 7-14, XAL); San Gabriel Mixtepec, F.
79
Nicolalde-Morejón et al. 1474 (XAL); San Pedro Pochulta, J. Lomelí et al. 2967
(MEXU).
Zamia polymorpha D.W. Stev., A. Moretti & Vázq. Torres. Delpinoa n.s. 37-38: 4.
1995-96 (issued 1998). Type: Belize. Cayo: 22 Jan 1989, D. W. Stevenson et al.
1119 (holotype: NY; isotypes: BRH, FTG, MO, NY, U). (Fig. 10).
Stem hypogeous, branching dichotomously with age, up to 32 cm long, up to 14 cm
in diam. Cataphylls chartaceous, persistent, base triangular, apex aristate, 3-6.4 x 1.32.6 cm at base, brown tomentose. Ptyxis inflexed. Leaves 2-3(4), ascending, 30-105 x
29-45 cm, brown when emerging, green when mature; petiole 10.2-95.3 cm long,
greenish in young leaves, subterete, armed with prickles up to 4 mm long; rachis
subterete, up to 67 cm long, with few prickles along the proximal third. Leaflets 3-12
pairs, sessile, coriaceous, lanceolate to oblanceolate, opposite to subopposite, apex
acute, base attenuate, margins serrulate along upper third, subrevolute; articulations
brown when young, green when mature, 0.4-0.8 cm wide; the median leaflets 17-35 x 23.5 cm. Pollen strobili usually 1-2, erect, conical, 6.5-7.3 cm long, 1.1-1.4 cm in diam,
light to dark-brown tomentulose, apex acute; peduncle light brown tomentose, 6.8 cm
long, 1.2 cm in diam; pollen sporangiophores cuneiform, distal face hexagonal-truncate,
0.4 cm long, fertile abaxial surface with 4-5 bisporangiate synangia per lobe. Ovulate
strobili usually solitary, erect, cylindrical to ovoid, 8.7-16.3 cm long, 5-8.3 cm in diam,
dark-brown tomentulose, apex acute; peduncle brown tomentose, 4-7.5 cm long, 1.1 cm
in diam; megasporangiophores peltate, distal face hexagonal-truncate, 0.8 cm high, 1.82.1 cm wide. Seeds ovoid, sarcotesta pink when immature, red at maturity, 1.4-2.1 cm
long, 0.5-0.9 cm in diam, sclerotesta smooth.
80
Chromosome number.— 2n = 17, 22, 23, 24, 25, 26, 27, 28 (Stevenson et al., 199596; Vovides & Olivares, 1996).
Distribution and habitat.— This species is known from Belize, Guatemala and
Mexico from 0-200 m elevation. In Mexico, its range includes the states of Quintana
Roo, Yucatán, Campeche, Tabasco and Chiapas (Fig. 6).
Etymology.— The specific epithet alludes to the extreme variation in leaf and leaflet
morphology presented by this species (Stevenson et al., 1995-96b).
Distinguishing features.— Zamia polymorpha shares many morphological attributes
with Z. loddigesii of the Gulf of Mexico drainage. However, there are clear differences
in the pollen and ovulate reproductive structures. In Z. loddigesii, the pollen strobili are
beige in color with an acute apex and the ovulate strobili are beige and cylindrical
whereas in Z. polymorpha the pollen strobili are maroon with an acuminate apex and the
ovulate strobili are dark-maroon and ovoid.
Additional specimens examined.— MEXICO. CAMPECHE: Hernández et al. ES184 (MEXU), Schutzman 502 (XAL), 503 (XAL), 504 (XAL), 505 (XAL), 506 (XAL),
507 (XAL), 508 (XAL), 509 (XAL); Benito Juárez, Vovides et al. 1312 (XAL), 1313
(XAL), 1314 (XAL), 1315 (XAL), 1316 (XAL), 1317 (XAL); Calakmul, Madrid et al.
736 (MEXU), Martínez 30420-A (MEXU); Ciudad del Carmen, Flores et al. 9586
(XAL); Champoton, Chan 3719 (CICY, XAL), Vovides 853 (XAL), 854 (XAL), 855
(XAL), 1326 (XAL), 1328 (XAL), 1329 (XAL), 1330 (XAL), 1331 (XAL), 1332
(XAL), 1333 (XAL), 1334 (XAL), 1335 (XAL), 1336 (XAL), 1337 (XAL), 1338
(XAL), 1339 (XAL), 1527 (XAL); Hopelchen, Ortega & Ucán 1562 (UADY, XAL),
Ucán et al. 7293 (UADY, XAL), 7307 (UADY, XAL), 7398 (UADY, XAL). CHIAPAS:
Palenque, Aguilar & Aguilar 1355 (MEXU), F. Nicolalde-Morejón & N. Martínez 1419
(XAL), Schutzman 508 (XAL), Walters s.n. (FTG accession 13-2, XAL); Ocosingo,
81
Walters s.n. (FTG accession 17-2, XAL). QUINTANA ROO: Cabrera et al. 2574
(MEXU), Davidse et al. 20075 (MEXU, MO), Téllez 1415 (MEXU), Trejo 225 (CICY,
MEXU); Adolfo Huerta, Álvarez et al. 9495 (MEXU); Chetumal, Vovides 852 (XAL),
Flores & Burgos 9635 (XAL), 9643 (XAL), Othon P. Blanco, Vovides et al. 1318
(XAL), 1319 (XAL), 1320 (XAL), 1321 (XAL), 1322 (XAL), 1323 (XAL), 1324
(XAL), 1325 (XAL). TABASCO: Balancan, Matuda 3117 (MEXU), Méndez 214 (XAL),
Novelo 169 (MEXU, XAL), Puig 788 (MEXU). Macuspana, Vovides et al. 1344, 1345
(XAL). Yucatán, G. F. Gaumer 2430 (MO), Lundell & Gentle 827 (MEXU), May 743
(CICY, MEXU); Tekon, Enríquez 94 (MEXU); Tzucacab, Vovides et al. 1303 (XAL),
1306 (XAL), 1307 (XAL), 1308 (XAL), Flores & Burgos 9642 (XAL); Valladolid,
Vovides 856, 857 (XAL), Vovides et al. 867 (XAL), 868 (XAL), 869 (XAL) 871
(XAL), 872 (XAL), 873 (XAL), 874 (XAL), 875 (XAL), 881 (XAL), 877 (XAL), 870
(MEXU, XAL), 876 (MEXU, XAL), 877 (MEXU, XAL), 878 (MEXU, XAL), 880
(MEXU, XAL); Yaxcaba, Vovides et al. 1309 (XAL), 1310 (XAL), Vovides 1311
(XAL).
GUATEMALA. PETEN: W. E. Harmon & J. A. Fuentes 5735 (MO).
BELIZE. BELIZE DISTRICT: Estrada 234 (CICY), D. L. Spellman 1548 (MO), C.
Whitefoord 2603 (MO). CAYO DISTRICT: D. W. Stevenson et al. 1121 (FTG, MO, NY,
U), 1122 (FTG, MO, NY, U), M. J. Balick et al. 1803 (MO, NY), M. J. Balick et al.
2058 (NY), T. B. Croat 23732 (MO), D. R. Hotel & L. Thomas 1130 (NY), J. S. Huston
s.n. (MO), R. W. Long 3238 (MO), J. A. Ratter 5195 (MO), D. L. Spellman 1974 (MO),
D. L. Spellman & W. W. Newey 1962 (K), J. R. Wiley 333 (MO). Orange Walk, G.
Davidse & A. E. Brant 32768 (MO). Stann Creek, R. L. Walter 1099 (MO). Sin datos
(K).
82
Zamia prasina W. Bull, Retail List: 20. 1881. Type: cultivated from Br. Honduras, W.
Bull s.n. (holotype: K).
Stem hypogeous to epigeous, rarely branching. Cataphylls chartaceous, persistent,
base triangular, apex aristate, 3-4.5 x 1.2-2.7 cm at base, brown tomentose. Ptyxis
inflexed. Leaves 2-4(6), 57-100 x 25-35 cm, ascending to spreading, brown when
emerging; petiole 12-30 cm long, brown-greenish young leaves, subterete, sparsely to
densely armed with prickles up to 4 mm long; rachis subterete, up to 70 cm long, with
few prickles along the proximal third. Leaflets 12-18 pairs, sessile, coriaceous, oblong
to oblanceolate, opposite to subopposite, apex acute to acuminate, base cuneate,
margins serrate to denticulate in the upper two third, subrevolute; articulations brownyellowish in young leaflets, 0.3-0.6 cm wide; the median leaflets 15-20 x 4-6 cm. Pollen
strobili usually 1-2, erect, cylindrical to ovoid, up to 6-10 cm long and 2-4 cm in diam,
light brown, apex acute; peduncle densely light brown tomentose, 2-4 cm long, 1.5 cm
in diam. Ovulate strobili usually solitary, erect, cylindrical, 10-15 cm long, 5-7 cm in
diam, green, glabrous when mature, apex acute; peduncle brown-greenish tomentose,
3.5 cm long, 1.5 cm in diam; megasporangiophores distal face hexagonal-truncate, 1-1.4
cm high, 1.1-1.8 cm wide. Seeds ovoid, sarcotesta light red when immature, red at
maturity, 1.5-2 cm long, 0.5-0.8 cm in diam, sclerotesta smooth.
Chromosome number.— Not known.
Distribution and habitat.— Endemic to Belize (Fig. 6) on rocky outcrops between
100-200 m elevation in evergreen tropical rainforest.
Etymology.— The specific epithet alludes to the bright grass-green leaflets.
83
Distinguishing features.— Plants with subterranean or epigeal stems, distinctly
serrulate leaflet margins and bright-green leaflets; ovulate strobili ovate, green and
glabrous when mature.
Additional specimens examined.— BELIZE. TOLEDO: G. Davidse & A. E. Brant
32179 (MO), 32232 (MO).
Zamia purpurea Vovides, J.D. Rees & Vázq.Torres. Flora de Veracruz 26: 28. 1983.
Type: Mexico. Veracruz: 30 January 1982, Vovides 734 (holotype: XAL). (Fig. 11).
Stem hypogeous, dichotomously branching with age, up to 30 cm long, 4-6 cm in
diam. Cataphylls membranaceous, deciduous, base triangular, apex acuminate, 5.x 1.8
cm at base, reddish-brown tomentose. Ptyxis inflexed. Leaves 1-6, ascending to
spreading, 34-90 x 32-38 cm, reddish-brown when emerging, turning green to darkgreen at maturity; petiole 16-29 cm long, blackish in young leaves, subterete, armed
with simple prickles up to 4 mm long; rachis subterete, 17-45 cm long, with few
prickles along the proximal third. Leaflets 3-4(6) pairs, sessile, coriaceous, elliptic to
lanceolate, opposite to subopposite, veins highly prominent on adaxial surface, though
relatively inconspicuous veins have been reported on some individuals, apex acute, base
attenuate, margins dentate along upper third, subrevolute; articulations brown in young
leaflets, 0.4-0.8 cm wide; the median leaflets 6-27 x 2-8.1 cm. Pollen strobili usually 12, erect, conical, 2-4.3 cm long, 0.5-1.1 cm in diam, light-brown tomentulose, apex
acute; peduncle light-brown tomentose, 2-3.5 cm long, 0.7-0.9 cm in diam; pollen
sporangiophores cuneiform peltate, distal hexagonal face and truncate to scutiform, 0.25
cm long, fertile abaxial surface with 2 bisporangiate synangia per lobe. Ovulate strobili
usually solitary, erect, conical, 6-9 cm long, 3-4.5 cm in diam, purplish-brown
84
tomentulose when immature turning dark-purple glabrescent when mature, apex acute;
peduncle densely dark-brown tomentose, 2.9 cm long, 1.6 cm in diam, distal face
hexagonal-scutiform, 0.9-1.2 cm high, 1.6-2.1 cm wide. Seeds ovoid, sarcotesta pink
when immature, red at maturity, 0.8-1.1 cm long, 0.6-0.8 cm in diam, sclerotesta
smooth.
Chromosome number.— 2n = 16 (Vovides, 1983).
Diversity and genetic structure.— The average of alleles per locus is A = 2.10, the
percentage of polymorphic loci is P = 100, the expected heterozygosity is HE = 0.481
and the genetic differentiation between the two populations currently under study is Fst
= 0.037 (González-Astorga et al. unpubl. data).
Distribution and habitat.— Zamia purpurea is endemic to Mexico from the Río
Uxpanapa drainage system within the states of Veracruz and Oaxaca (Fig. 5) between
50-200 m in evergreen tropical forest (sensu Rzedowski, 1978) classification.
Etymology.— The specific epithet alludes to the dark purple color of the ovulate
strobili.
Distinguishing features.— Characterized by the prominent leaflet veins giving the
coriaceous leaflets a channeled appearance in contrast to the rest of its congeners in
Mesoamerica, and the dark purple color of the ripe ovulate strobili.
Additional specimens examined.—MEXICO. Oaxaca: Santa María Chimalapa,
S. H. Salas M. 982 (SERO), Sánchez et al. 40 (B, MEXU); Santa María Lachixio,
Cerón et al. 266 (XAL); San Juan Guichicovi, F. Nicolalde-Morejón & J. Torres 1503
(XAL), 1404 (XAL), M. Vázquez-Torres et al. 1470 (MO, XAL), Walters s.n. (FTG
accession 10-1, XAL). Veracruz: M. Vázquez-Torres 4038 (CIB); Hidalgotitlán,
Calzada 8374 (XAL), M. Vázquez-Torres et al. 224 (MO); Jesús Carranza, A. González-
85
Christen s.n. (CIB), F. Nicolalde-Morejón & J. Torres 1502 (XAL), M. Vázquez-Torres
et al. 2373 (CIB), M. Vázquez-Torres et al. V-2532 (CHAPA, CIB, XAL).
Zamia sandovallii C. Nelson, Ceiba 46(1-2): 55.. 2005. Type: Honduras. Atlántida:
Jan 2006, G. Sandoval et al. 1154 (holotype: TEFH).
Stem hypogeous, non-branching, 15.7 cm long, 10.1 cm in diam. Cataphylls
persistent, base triangular. Leaves 1-3, ascending to descending up to 210 x 0.55 cm;
petiole 68 cm long, subterete, armed with small prickles; rachis subterete, up to 140 cm
long, unarmed. Leaflets 68 pairs sessile, sub-coriaceous, lanceolate, opposite to
subopposite, falcate, apex acuminate, base attenuate, margins serrulate along distal
third, subrevolute; the median leaflets 16-31 x 2-3 cm. Pollen strobili usually 2, erect,
cylindrical, 11.2 cm long, 2.6 cm in diam, brown-reddish tomentulose, apex apiculate;
peduncle light-brown tomentose, 16.7 cm long, 1.2 cm in diam; pollen sporangiophores
cuneiform, distal face hexagonal truncate, 0.8 cm long, fertile abaxial surface with 2-3
bisporangiate synangia per lobe. Ovulate strobili usually solitary, erect, ellipsoid to
cylindrical, 12 cm long, 4.5 cm in diam, brown-yellowish, tomentulose, apex longacuminate; peduncle densely brown tomentose, 1.5 cm long; megasporangiophores
peltate, distal face hexagonal-truncate, 2-2.5 cm high, 1.8-2 cm wide. Seeds ovoid,
sarcotesta white when immature, 1.2-1.8 cm long, 0.5-0.7 cm in diam, sclerotesta
smooth.
Chromosome number.— Unknown.
Distribution and habitat.— Endemic to Honduras (Fig. 6), between 200-350 m in
evergreen tropical forest.
86
Etymology.— The specific epithet honors Germán Sandoval, biologist of the
Universidad Nacional Autonoma de Honduras (Nelson, 2005).
Distinguishing features.— This species is characterized by glabrous, subcoriaceous, lanceolate, falcate leaflets; cylindric, ovulate strobili with a strongly
acuminate apex; and seeds with a white sclerotesta.
Additional specimens examined.— HONDURAS. ATLÁNTIDA: J. Haynes et al.
37 (TEFH), G. Sandoval et al. 1155 (TEFH), 1156 (TEFH).
Zamia soconuscensis Schutzman, Vovides & Dehgan, Bot. Gaz. 149(3): 347. 1998.
Type: Mexico. Chiapas: Feb 1939, Matuda 2659 (holotype: F; isotypes: CR,
MEXU, MICH).
Stem epigeal, erect to decumbent in adult plants, branching dichotomously with age,
30-65 cm long, 10-31.5 cm in diam. Cataphylls chartaceous, persistent, base triangular,
apex aristate, 7.1 x 2.6 cm at base, reddish-brown tomentose. Ptyxis inflexed to erect.
Leaves 3-15 or more per apex, 120-190 x 45-62 cm, ascending, distal portion
descending to spreading, brown when emerging turning green at maturity; petiole 38-72
cm long, green-yellowish in young leaves, terete, armed with prickles up to 5 mm long;
rachis subterete, up to 84 cm long, with few prickles along the proximal third. Leaflets
41-52 pairs, sessile, coriaceous, linear-lanceolate, alternate to subopposite, subfalcate,
apex acute, base attenuate; margins entire, subrevolute; articulations brown in young
leaflets, 0.4-0.8 cm wide; the median leaflets 12-35 x 0.6-1.5 cm. Pollen strobili usually
1-3 per apex, erect, cylindrical to conical, 9-15 cm long, 1.2-2.4 cm in diam, darkbrown tomentulose, apex apiculate; peduncle light-brown tomentose, up 7.2 cm long,
1.2 cm in diam; pollen sporangiophores cuneiform, distal face hexagonal-truncate, 0.45
87
cm long, fertile abaxial surface with 5 bisporangiate synangia per lobe. Ovulate strobili
usually solitary, erect, cylindrical, 12-15 cm long, 6.1-7.3 cm in diam, dark-brown to
reddish, tomentulose, apex aristate; peduncle brown puberulent, 2.1 cm long, 1.2 cm in
diam; megasporangiophores peltate, distal face hexagonal-truncate, 0.7-0.9 cm high,
1.6-1.8 cm wide. Seeds ovoid to angular, sarcotesta white when immature turning
salmon-pink when mature, sclerotesta light-beige, smooth with 6-8 light furrows
running longitudinally and sometimes dichotomizing, 2.1-2.6 cm long, 1.4-1.9 cm diam.
Chromosome number.— 2n = 16 (Schutzman et al., 1988).
Distribution and habitat.— Endemic to Chiapas-Mexico, between 900-1,400 m in
the Soconusco mountain range of southern Chiapas. It inhabits the understory
herbaceous layer of the transition zone between evergreen tropical forest and cloud
forest (Fig. 5).
Etymology.— The specific epithet alludes to the Sierra del Soconusco mountain
range also known as the Sierra Madre de Chiapas, being the region where this species is
native (Schutzman et al., 1998).
Distinguishing features.— Zamia soconuscensis is the only species of the genus in
Mexico that approaches an arborescent habit with leaves that can reach almost two
meters long that gracefully arch toward the terminal portion. The linear-lanceolate
leaflets have totally entire margins; the only other Mexican congener with entire
margins is Z. inermis. Ovulate strobili are short-pedunculate and solitary with a darkbrown velvety tomentulum.
Additional specimens examined.— MEXICO. CHIAPAS: Matuda 2087 (MEXU),
2535 (MEXU), 2590 (MEXU), 2656 (MEXU); Acacoyagua, García 149 (CHIP,
MEXU), M. A. Pérez-Farrera 141 (CIB, HEM, MEXU).
88
Zamia spartea A. DC., Prodr. 16 (2): 539. 1868. Type: Mexico. Oaxaca: prope
Acayucam, Verapa, Chimalapi, 1832, Alaman s.n. (holotype: G-DC). (Fig. 12).
Zamia loddigesii var. spartea (A. DC.) Schuster, Pflanzenr. 99: 148. 1932.
Basionym: Zamia spartea A. DC.
Stem hypogeous, branching dichotomously with age, 5-40 cm long, 5-8 cm in diam.
Cataphylls chartaceous, persistent, base triangular, apex aristate, 6 x 1.4 cm at base,
yellowish tomentose. Ptyxis inflexed. Leaves 2-5(8) per crown, 35-60 x 38-52 cm,
ascending to gracile, reddish-brown when emerging, turning green at maturity; petiole
12-21 cm long, green-yellowish in young leaves, subterete, heavily armed with straight
to sometimes bifurcate prickles up to 4 mm long; rachis subterete, up to 42 cm long,
with few prickles along the proximal third. Leaflets 15-27 pairs sessile, coriaceous,
linear, alternate to subopposite, apex acute, base attenuate; margins serrulate along
extreme distal portion, subrevolute; articulations light-orange when young, turning
yellowish with age, 0.3-0.4 cm wide; the median leaflets 20-35 x 0.3-0.6 cm. Pollen
strobili usually 2-3, erect, cylindrical, 6.5-8.5 cm long, 1.4-1.9 cm in diam, yellowishbeige tomentulose, apex acute; peduncle densely light-brown tomentose, 6-8 cm long,
0.9-1.1 cm in diam; pollen sporangiophores cuneiform, distal face hexagonal-truncate,
0.3 cm long, fertile abaxial surface with 10-14 bisporangiate synangia per lobe. Ovulate
strobili usually solitary, erect, cylindrical to oval-cylindrical, 9-12 cm long, 4.2-4.8 cm
in diam, brown tomentulose, apex acute; peduncle densely brown tomentose, 3.4-3.8 cm
long, 0.8-1.1 cm in diam; megasporangiophores peltate, distal face hexagonal-truncate,
0.8-1.1 cm high, 1-1.3 cm wide. Seeds ovoid, sarcotesta pink when immature, red at
maturity, 1.2-1.6 cm long, 0.7-0.9 cm in diam, sclerotesta smooth.
89
Chromosome number.— 2n = 18 (Vovides, 1983; Moretti, 1990a).
Distribution and habitat.— Endemic to Oaxaca-Mexico. Known in southern areas
of the Isthmus of Tehuantepec (Fig. 5), between 200-400 m elevation, associated with
tropical deciduous forests (sensu Rzedowski, 1978).
Etymology.— The epithet is from the broom genus Spartium (Fabaceae), in
reference to the narrow and tapered leaflets of the cycad.
Distinguishing features.— Small gracile plants reaching up to 80 cm tall with very
narrow-linear leaflets with an almost entire margin with a few very small serrulations
only on the extreme distal portion.
Additional specimens examined.— MEXICO. OAXACA: Meave del Castillo &
García 2388 (MEXU); Matías Romero, F. Nicolalde-Morejón & J. Torres 1505 (XAL),
1506 (XAL), Schutzman 529 (XAL), 530 (XAL), 531 (XAL), 532 (XAL), 533 (XAL),
534 (XAL), 535 (XAL), 536 (XAL), 537 (XAL), 538 (XAL), 539 (XAL), 540 (XAL),
541 (XAL), 542 (XAL), Vovides & Perales 600 (XAL), Walters s.n. (FTG accession 93, XAL); San Juan Guichicovi, N. Antonio-Barrera 83b (CIB), Santa María Chimalapa,
A. Espejo et al 6485 (UAMIZ), R. García S. 341 (XAL, SERO), Torres 653 (XAL); San
Miguel Chimalapa, M. Vázquez-Torres 4039 (CIB).
Zamia standleyi Schutzman, Syst. Bot. 14(2): 214. 1989. Type: Honduras. Atlantida:
Lanatilla Valley near Tela, Aug 1984, B. Schutzman 449 (holotype: FLAS; isotypes:
ENA, FTG).
Stem hypogeous and tuberous, 6-14 cm long, 5-9 cm in diam. Cataphylls
chartaceous, persistent, base triangular, apex long-aristate, to 12 cm x 1.5 cm at base,
reddish-brown tomentose. Ptyxis inflexed. Leaves 1-5, 20-100 x to 55 cm, slightly to
90
slightly recurved, tomentulose when emerging; petiole 35-60 cm long, terete, sparsely
to heavily armed with prickles; rachis terete, up to 70 cm long, with few prickles along
proximal third. Leaflets 10-15 pairs, sessile, subcoriaceous-coriaceous, long-lanceolate,
opposite to subopposite, recurved, apex acute, base attenuate, margins dentate along
distal third, subrevolute; articulations dark brown when young, 0.3-0.5 cm wide; median
leaflets 20-45 x 1-4 cm. Pollen strobili usually 1-3, decumbent, cylindrical, 6-10 cm
long, 1-2 cm in diam, light-brown tomentulose, apex acute; peduncle light-brown
tomentose, 2-4 cm long, 1.1 cm in diam; pollen sporangiophores cuneiform, distal face
hexagonal truncate, fertile abaxial surface with 4 bisporangiate sori per lobe; Ovulate
strobili usually solitary, erect, cylindrical to slightly ovoid, 8-12 cm long, 3-8 cm in
diam, brown, tomentulose, apex long-apiculate; peduncle densely brown tomentose,
2.5-4 cm long, 1.3 cm in diam, distal face hexagonal-truncate, 0.7-1.2 cm high, 1.5-2.1
cm wide. Seeds ovoid, sarcotesta pink when immature, red at maturity, up to 3 cm long,
up to 2 cm in diam, sclerotesta smooth.
Chromosome number.— 2n = 16 (Schutzman, 1989).
Distribution and habitat.— The species range is Honduras and Guatemala (Fig. 6),
between 0-200 m in evergreen tropical forest.
Etymology.— The specific epithet honors Paul C. Standley a prominent botanist of
the flora of Mexico and Central America (Schutzman, 1989).
Distinguishing features.— Its falcate leaflets and conspicuous marginal teeth up to 4
mm long, and long-apiculate ovulate strobili as well as its cylindrical characterize this
species.
Additional specimens examined.— GUATEMALA. PROVINCIA IZABAL: H.
Förther 10234/252 (MSB, W).
91
HONDURAS. DEPARTAMENTO ATLÁNTIDA: Tela, V. Severen 1450 (NA),
Standley 53721 (F, US); Puerto Sierra, Wilson 537 (NY). DEPARTAMENTO SANTA
BARBARA: San Pedro Sula, Thieme 144 (US). Departamento Yoro, Coyoles, T. G.
Yuneker et al. 8186 (F, G, GH, MO, NY). DEPARTAMENTO CORTES: Montaña Santa
Ana, Molina R. 3628 (F, GH).
Zamia tuerckheimii Donn. Sm., Bot. Gaz. (Crawfordsville) 35(1): 8. 1903. Type:
Guatemala. Dept. Alta Verapaz: Cubilquitz, Jul 1900, von Tuerckheim 7786
(holotype: US; isotype: K).
Stem epigeal, rarely branched with age, up to 100 cm long, 10-12 cm in diam.
Cataphylls chartaceous, persistent, base triangular, apex aristate, 8.3 x 2.7 cm at base,
light brown-greenish tomentose. Ptyxis inflexed to erect. Leaves 8-15, 100-200 x 20-45
cm, ascending, distal portion descending to spreading, green when emerging; petiole
30-50 cm long, green in young leaves, terete, armed with minute prickles to unarmed;
rachis subterete, up to 150 cm long, unarmed. Leaflets 8-15 pairs, sessile, papyraceous,
oblong-lanceolate, glossy, iridescent blue-green, alternate to subopposite, apex abruptly
acuminate, base attenuate; margins entire, subrevolute; articulations green, 0.4-0.6 cm
wide; the median leaflets 14-18 x 4-6 cm x. Pollen strobili usually solitary, erect,
cylindrical, 12-15 cm long, 2-4 cm in diam, gray-brown at maturity, apex acute;
peduncle light-brown tomentose, up 6.5 cm long, 1.4 cm in diam. Ovulate strobili
usually solitary, erect, cylindrical, 12-18 cm long, 4-8 cm in diam, brownish when
young, iridescent blue-green at maturity, apex aristate; peduncle light brown puberulent,
3.4 cm long, 1.5 cm in diam; megasporangiophores peltate, distal face hexagonal-
92
truncate, 1.4-2 cm high, 3-3.6 cm wide. Seeds elongate-ovoid, sarcotesta light red when
immature, red at maturity, smooth, 2.1-2.6 cm long, 1.3-1.6 cm diam.
Chromosome number.— 2n = 16 (Moretti, 1990b).
Distribution and habitat.— Endemic to Guatemala, between 250-1000 m in the Alta
Verapaz department mountain range. It inhabits the understory herbaceous layer of
tropical forest (Fig. 6).
Etymology.— The specific epithet honors Hans von Tüerkheim, who collected this
species for the first time in Guatemala.
Distinguishing features.— The principal distinguishing features of this species are
arborescent stems up to one meter tall, papyraceous leaflets with entire margins and
ovulate cylindrical strobilus with abruptly acuminate apex and aristate apex, the cone
becoming blue-green iridescent when mature.
Additional specimens examined.— GUATEMALA. ALTA VERAPAZ: T. B. Croat
41647 (MO), H. Förther 11034 (MSB, W), J. A. Steyermark 44484 (MO); Rubeltem, H.
Förther 10918 (MSB, W).
Zamia variegata Warsz., Allg. Gartenzeitung 32: 253. 1845. Type: Mexico. Chiapas,
Lacandona, on border with Guatemala, 12 January 1987 D. W. Stevenson 685
(neotype, here designated: NY; isoneotypes: U, XAL).
Zamia picta Dyer in Hemsley, Biol. Cent.-Amer., Bot. 3(16): 194. 1884.
Basionym: Zamia muricta var. picta Miquel, Tijdschr. Wis-en natuurk.
Wet.1(4): 198-199. 1848, non Von Houtte 1846. Type: ex Horto Amsterdam (Z.
picta H. Belg.), Miquel s.n. (holotype, U).
93
Stem hypogeous, 9-16 cm long, 4-10.5 cm in diam. Cataphylls chartaceous, base
triangular, apex aristate, 4.6-7.1 x 2.1-2.4 at base, yellowish tomentose. Ptyxis inflexed.
Leaves 1-2(3), 40-291 x 24-44 cm, ascending; petiole 35-177 cm long, dark-green with
characteristic yellow variegation; petiole subterete, heavily armed with prickles up to 5
mm long; rachis subterete, up to 105 cm long, with few prickles along the proximal
third. Leaflets 3-10 pairs, sessile, papyraceous, elliptic, opposite to subopposite, darkgreen with yellow or cream variegation, apex acute, base attenuate; margins dentate
along distal third, subrevolute; articulations brown in young leaflets turning green at
maturity, 0.4-0.8 cm wide; the median leaflets 12-22 x 3.1-8.8 cm. Pollen strobili up to
6, erect, long-cylindrical, 7-11 cm long, 1.9-2.5 cm in diam, yellowish-beige, apex
acute; peduncle densely light-brown tomentose, 3-6 cm long, 0.7-0.9 cm in diam.
Ovulate strobili 1-2 ovoid to cylindrical, 12 cm long, 4.5 cm in diam, gray-greenish
tomentulose; megasporangiophores peltate, distal face hexagonal-truncate, 0.8-1.3 cm
high, 1.7-2.1 cm wide. Seeds ovoid, red at maturity, 1.1-1.5 cm long, 0.7-1 cm in diam,
sclerotesta smooth.
Chromosome number.— 2n = 21, 22 (Moretti et al., 1991).
Diversity and genetic structure.— The average of alleles per locus is A = 2.02, the
percentage of polymorphic loci is P = 97.3, the expected heterozygosity is HE = 0.355
and the genetic differentiation between the two populations currently under study is Fst
= 0.085 (González-Astorga et al. unpubl. data).
Distribution and habitat.— Zamia variegata was described from plants collected in
Guatemala by Warszewicz (Stevenson & Sabato, 1986a). In Mexico, this plant is known
only from Chiapas, in lowland areas near the Montes Azules Biosphere Reserve (Fig.
5). Its habitat is evergreen tropical rainforest (sensu Rzedowski, 1978).
94
Etymology.— The specific epithet alludes to the variegated nature of the leaflets, an
attribute unique to this species of Zamia.
Distinguishing features.— Its yellow-cream variegated papyraceous leaflets easily
distinguish Zamia variegata. The variegations are in the form of irregular yellow
blotches that are most apparent on the adaxial side of the lamina.
Additional specimens examined.— MEXICO. Chiapas: Ocosingo, CastilloCampos et al. 3848 (XAL), 3855 (XAL), 3885 (XAL), M. Vázquez-Torres et al. 3924
(CIB); Margaritas, F. Nicolalde-Morejón et al. 1443 (XAL), 1444 (XAL), 1445 (XAL),
1446 (XAL), 1447 (XAL), 1448 (XAL), 1449 (XAL), 1450 (XAL), 1451 (XAL), 1452
(XAL); Lacandona, Stevenson 692 (NY, XAL).
GUATEMALA. Alta Verapaz: J. A. Steyermark 45048 (F, NY). Izabal: J. J.
Castillo & D. R. Hodel 2138 (MO), M Véliz 6893 (BIGUA, MEXU).
Zamia vazquezii D.W. Stev., Sabato, A. Moretti & De Luca, Delpinoa n.s. 37-38: 14.
1995-1996 (issued 1998). Type: Mexico. Veracruz: 22 Jan 1989, M. Vázquez-Torres
et al. 3990 (holotype: NY; isotypes: FTG, MO, NY, U, CIB). (Fig. 13).
Stem hypogeous, dichotomously branching with age, 35 cm long, 12 cm in diam.
Cataphylls chartaceous, persistent, base triangular, apex aristate, 5.9 x 3.8 cm at base,
brown tomentose. Ptyxis inflexed. Leaves 4-6 to many, 35-100 x 16-29 cm, ascending,
brownish when emerging, turning green at maturity; petiole 21-45 cm long, terete,
unarmed or rarely with prickles, rachis terete, up to 65 cm long. Leaflets 14-26 pairs,
sessile, papyraceous, ovate to obpyriform, opposite to subopposite, apex acuminate,
base cuneate; margins with numerous serrations along distal third, subrevolute,
articulations brown in young leaflets, 0.5-0.7 cm wide; the median leaflets 7.1-14.6 x
95
2.8-4.1 cm. Pollen strobili usually 1-2 per apex, erect, ovoid to ovoid-cylindrical, up to
10.6 cm long and 2.6 cm in diam, light-brown tomentulose, apex acute; peduncle
densely light-brown tomentose, 4.5 cm long, 1.2 cm in diam; pollen sporangiophore
distal face hexagonal-truncate. Ovulate strobili usually solitary, erect, cylindrical to
ovoid-cylindrical, up to 15 cm long, 7.3 cm in diam, gray to brown tomentulose, apex
apiculate; peduncle densely brown tomentose, 5.3 cm long, 1.4 cm in diam;
megasporangiophores peltate, distal face hexagonal-truncate to scutiform, 1.2 cm high,
2.9 cm wide. Seeds ovoid, sarcotesta pink when immature, orange-red to red at
maturity, 1.6 cm long, 1.2 cm in diam, sclerotesta smooth.
Chromosome number.— 2n = 18 (Stevenson et al., 1995-1996a).
Distribution and habitat.— Endemic to Veracruz, Mexico (Fig. 5), found between
50-350 m in evergreen tropical forest sensu Rzedowski (1978) classification, on
predominantly deep clayey soils.
Etymology.— The specific epithet honors Mario Vázquez-Torres, a Mexican
biologist and cycad specialist.
Distinguishing features.— Zamia vazquezii has more leaves (up to six), longer with
each up to 100 cm long, and wider leaflets than Z. fischeri. The two species are disjunct
in distribution and have different chromosome numbers, Z. vazquezii 2n = 18 and Z.
fischeri 2n = 16 (Stevenson et al., 1995-1996a).
Additional specimens examined.— MEXICO. VERACRUZ: Papantla, M. VázquezTorres 4568 (CIB), Allen 1970-2141 (XAL); Tiguatlán, J. Rees 1617 (XAL).
Species dubium
Socorro is the locality mentioned by Schuster (1932) for Miquel’s (1870) source of
96
Zamia verschaffeltii, although no locality information is given on the type specimen,
which is the only specimen at U where Miquel’s herbarium resides (Stafleu, 1966). The
original description by Miquel gives the source of material as “Ex imperio Mexicano
introduxit A. Verschaffelt, qui in Catalogis Z. fuscam latifoliam dixit” and makes no
mention of a specific locality. However, following the information given by Schuster
(1932), we have conducted exhaustive searches over the years at two possible localities
with the name of El Socorro, one in Tabasco and the other at Ruta del Socorro in
Veracruz, It is important to note that the whole area and surrounding regions have been
converted into vast sugar cane plantations so that historically Zamia could have been
present but would now be extirpated. We can confidently say that no species of Zamia
were found in or near the two localities of the name Socorro, and no other locality of
this name was located within the distribution range of this species complex in the study.
Also, no individuals or populations of Zamia studied here conform to the original
description of Z. verschaffeltii; because we were unable to find another record of Z.
verschaffeltii since its publication in 1870, we believe that this species is probably
extinct (Nicolalde-Morejón et al., 2008). It is interesting that Schuster actually
described a form latifolia Schuster does not cite any specimens of this form, but only
that it is cultivated in "Garten Verschaffelt." We have been unable to locate any
specimens of this form that were seen by Schuster, and if one did exist at B it was
destroyed. Therefore, all source material remains enigmatic.
Zamia verschaffeltii Miq., Verh. Kon. Ned. Akad. Wetensch., Afd. Natuurk. 2(4): 31.
1870. Type: Mexico. "Zamia fusca latifolia Versch.", Miquel s.n. (holotype, U).
Zamia verschaffeltii forma latifolia Schuster, Pflanzenr. 99: 138. 1932. TYPE:
description (lectotype, designated by Stevenson & Sabato, 1986a).
97
Acknowledgments
The first author thanks the Red Latinoamericana de Botánica for the award of a Ph.
D. fellowship (RLB-06-D2; Systematics Program, Instituto de Ecología, A.C., Xalapa,
Mexico) and the Mellon Foundation for a stipend for a six months residence at the New
York Botanical Garden during 2002. This research was supported partially by
CONACyT-SEMARNAT grant No. 2002-CO1-0183 to AV and NSF Grants BSR8607049 and EF-0629817 to DWS. The authors thank to Francisco Vergara Silva, Jorge
González Astorga, and Victoria Sosa for their comments on a previous version of this
manuscript, and Pablo Carrillo-Reyes, Eduardo Ruiz for their comments on the
diagnostic key to species of Zamia, Carlos Iglesias for assistance and guidance in the
field, and Edmundo Saavedra for the illustrations of Zamia spartea. We thank the
Curators and staff of the herbaria mentioned for making their collections available for
study, as well as the staff of the Jardín Botánico Fco. J. Clavjiero of the Instituto de
Ecología, A.C. for access to the living specimens of the Mexican National Cycad
Collection. Finally, the authors would like to tahnk Roy Osborene for his salient
discussions and diligence in reviewing this manuscript throughout the preparation of
this work.
Literature Cited
Balduzzi, A. P., P. De Luca & S. Sabato. 1982. A phytogeographical approach to
the New World Cycads. Delpinoa, n.s., 23-24.
98
de Candolle, A. 1868. Cycadaceae. Prodromus systematis naturalis regni vegetabilis 16
(2): 522-548.
Caputo, P., S. Cozzolino, P. De Luca, A. Moretti & D. Stevenson. 2004. Molecular
phylogeny of Zamia. In: T. Walters & R. Osborne, eds. Cycad Classification:
Concepts and Recommendations, Pp. 149-158. CABI Publishing, Oxford.
Eckenwalder, J. 1980. Taxonomy of the West Indian cycads. Journal of the Arnold
Arboretum. 61(4): 701-722.
González-Astorga, J., A. P. Vovides, P. Octavio-Aguilar, D. Aguirre-Fey, F.
Nicolalde-Morejón & C. Iglesias. 2006. Genetic diversity and structure of the
cycad Zamia loddigesii Miq. (Zamiaceae): implications for evolution and
conservation. Botanical Journal of the Linnean Society 152: 533-544.
Hill, K. D., D. W. Stevenson & R. Osborne. 2007. The world list of cycads/La lista
mundial de Cícadas. Memoirs of the New York Botanical Garden 97: 454-483.
Hill, K. 1998-present.The cycad pages. http://plantnet.rbgsyd.nsw.gov.au/
PlantNet/cycad
IUCN. 2005. IUCN Red List Categories and Criteria: Version 3.1. IUCN
Species Survival Commission. IUCN, Gland, Switzerland and Cambridge,
UK. ii + 30 pp.
Jones, K. 1998. Robertsonian fusion and centric fission in karyotype evolution of
higher plants. The Botanical Review 64: 273-289.
Marchant, C. J. 1968. Chromosome patterns and nuclear phenomena in the cycad
families Stangeriaceae and Zamiaceae. Chromosoma 24: 100-134.
McNeill, J., F.R. Barrie, H.M. Burdet, V. Demoulin, D.L. Hawksworth, K.
Marhold, D.H. Nicolson, J. Prado, P.C. Silva, J.E. Skog, J.H. Wiersema, &
N.J. Turland. 2007. International Code of Botanical Nomenclature (Vienna
99
Code),adopted by the Seventeenth International Botanical Congress. Vienna,
Austria. July 2005. Gantner, Ruggell, Liechtenstein.
Miquel, F. A. W. 1861. Prodromus systematics cycadearum. C. v. d. Post Jr. Utrecht,
The Netherlands.
. 1869. Neiuwe bijdragen tot der kennis der Cycadeen. Vijfde gedeelte.
Verslagen en medeelingen van de afdeeling natuurkunde: koninkljkie
akademie van wetenschappen. Amsterdam. ser. 2, 3(2): 196-206.
. 1870. Neiuwe bijdragen tot der kennis der Cycadeen. Zesde gedeelte.Verslagen
en medeelingen van de afdeeling natuurkunde: koninkljkie akademie van
wetenschappen. Amsterdam.. 2(4): 31. 1870.
Moretti, A. 1990a. Karyotypic data on North and Central American Zamiaceae
(Cycadales) and their phylogenetic implications. American Journal of Botany
77: 1016-1029.
______. 1990b. Cytotaxonomy of cycads. Memoirs of the New York Botanical Garden
57: 114-122.
______, P. Caputo, L. Gaudio, & D.W. Stevenson. 1991. Intraspecific chromosome
variation in Zamia (Zamiaceae, Cycadales). Caryologia 44: 1-10.
——— & Sabato, S. 1984. Karyotype evolution by centromeric fission in Zamia
(Cycadales). Plant Systematics and Evolution 146: 215-223.
Mundry, M. & T. Stützel. 2003. Morphogenesis of male sporangiophores of Zamia
amblyphyllidia D. W. Stev. Plant Biology 5: 297-310
Nelson, C. H. 2005. Dos plantas nuevas del género Zamia (Zamiaceae,
Gymnospermae) en Honduras. Ceiba 46: 55-58.
Newell, S. J. 1986. Variations in leaflet morphology among three populations of
Zamia L. in Puerto Rico. Taxon 35: 234-242.
100
Nicolalde-Morejón, F., A. P. Vovides, D. W. Stevenson & V. Sosa. 2008. The
indentity of Zamia katzeriana and Zamia verschaffeltii (Zamiaceae). Brittonia 60:
38-48.
Norstog, K. J. 1980. Chromosome number in Zamia (Cycadales). Caryologia 33: 419428.
______. 1981. Karyotypes of Zamia chigua (Cycadales). Caryologia 34: 255-260.
______. & T. J. Nicholls. 1997. The Biology of the Cycads. Cornell University Press,
Ithaca.
Rabinowitz, D. 1981. Seven forms of rarity. In: Synge H, (ed). Biological Aspect of
Rare Plant Conservation. Pp. 205-217, John Wiley & Sons Ltd.
Regel, E. 1857. Die Cycadeen des Botanischen Gartens in Petersburg. Gartenfora 6: 516.
———, 1876. Cycadearum generum specierumque revisio. Acta Horti Petropoltani
4(4): 273-320.
Rzedowski, J. 1978. Vegetación de México. Limusa, S. A. México, D.F.
———, 1991. Diversidad y orígenes de la flora fanerogámica de México. Acta
Botánica de México 14: 3-21.
Sabato, S. 1990. West Indian and South American cycads. Memoirs of the New York
Botanical Garden 57: 173-185.
Schlarbaum, S. E. & T. Tsuchiya. 1984. The chromosomes of Cunninghamia
konishii, C. lanceolata and Taiwania cryptomeroides (Taxodiaceae). Plant
Systematics and Evolution 145: 169-181.
Schubert, I. 2007. Chromosome evolution. Current Topics in Plant Biology 10: 109115.
101
Schuster, J. 1932. Cycadaceae. Das Pflanzenreich 99:1-168. Wilhelm Engelmann,
Leipzig.
Schutzman, B. 1984. A new species of Zamia L. (Zamiaceae, Cycadales)
from Chiapas, Mexico. Phytologia 55: 299–304.
______. 1989. A new species of Zamia from Honduras. Systematic Botany 14:
214-219.
______, A. P. Vovides & B. Dehgan. 1988. Two new species of Zamia
(Zamiaceae, Cycadales) from southern Mexico. Botanical Gazette. 149: 347360.
______ & A. P. Vovides. 1998. A new Zamia (Zamiaceae-Cycadales) from
eastern Chiapas, Mexico. Novon 8: 441-446.
Stevenson, D. W. 1980. Radial growth in the Cycadales. American Journal of Botany
67: 465-475.
______. 1981. Observations on ptyxis, phenology, and trichomes in the
Cycadales and their systematics implications. American Journal of Botany 68:
1104-1114.
______. 1987. The West Indian Zamias. Fairchild Tropical Garden Bulletin.42: 23-27.
———. 1991a. Flora of the Guianas. Serie. A. Fascicule 9: 7-11.
———. 1991b. The Zamiaceae in the Southeastern United States. Journal of the Arnold
Arboretum, Supplemental Series 1: 367-383.
———. 1992. A formal classification of the extant cycads. Brittonia. 44: 220-223
———. 1993. The Zamiaceae in Panama with comments on phytogeography and
species relationships. Brittonia 45: 1-16.
———. 2001a. Orden Cycadales. Flora de Colombia. Monografía No. 21. Editorial
Unibiblos. Bogotá D.C.
102
———. 2001b. Zamiaceae. Flora Nicaragua 1: 6-7.
———. 2004. Zamiaceae of Bolivia, Ecuador, and Peru. In: T. Walters &
R. Osborne (eds.), Cycad classification: Concepts and Recommendations. Pp.
173-194. CABI Publishing, Wallingford, England.
——— & S. Sabato. 1986a. Typification of names in Zamia L. and Aulacophyllum
Regel. (Zamiaceae). Taxon 35: 134-144.
——— & ———.1986b. Typification of names in Ceratozamia Brongn., Dion Lindl.,
and Microcycas A.DC. (Zamiaceae). Taxon 35: 578-584.
———,. ———, A. Moretti & P. De Luca. 1995-1996a. What is Zamia fischeri?
Delpinoa ns. 37-38: 9-17 (issued 1998).
______, A. Moretti & L. Gaudio. 1995-96b. A new species of Zamia
(Zamiaceae) from Belize and the Yucatan Peninsula of Mexico. Delpinoa, sn.
37-38: 3-8 (issued 1998).
Vovides, A. P. 1983. Systematic studies on the Mexican Zamiaceae I. Chromosome
numbers and karyotypes. American Journal of Botany 70: 1002-1006.
______. 1985. Systematic studies on Mexican Zamiaceae II. Additional notes on
Ceratozamia kuesteriana from Tamaulipas, Mexico. Brittonia 37: 226-361.
______. 1999. Zamiaceae. Flora del Bajío y de Regiones Adyacentes. Fascículo 71.
______, J. D. Rees & M. Vázquez-Torres. 1983. Zamiaceae. Flora de
Veracruz, fasiculo 26. In: A. Gómez-Pompa, ed., Flora de Veracruz, Instituto
Nacional de Investigaciones sobre Recursos Bióticos, Xalapa, Veracruz,
México.
______ & M. Olivares. 1996. Karyotype polymorphism in the cycad Zamia loddigesii
(Zamiaceae) of the Yucatan peninsula, Mexico. Botanical Journal of the Linnean
Society 120: 77-83.
103
Wieland, G. R. 1916. American Fossil Cycads. Vol 2. Carnegie Institute, Washington,
D.C.
104
FIG. 1. Trichomes. A-B. Zamia furfuracea. C-D. Z. katzeriana. E-F. Z. polymorpha.
105
FIG. 2. Illustrations of ovulate strobili. A. Zamia inermis. B. Z. vazquezii. C. Z.
paucijuga. D. Z. lacandona. E. Z. spartea.
106
FIG. 3. Illustrations of ovulate strobili. A. Z. fischeri. B. Z. furfuracea. C. Z.
cremnophila. D. Z. katzeriana. E. Z. polymorpha
107
FIG. 4. Chromosomes of Zamia herrerae. A. 2n = 23. B. 2n = 24.
108
FIG. 5. Distribution of Zamia cremnophila ( ), Z. furfuracea ( ), Z. inermis ( ), Z.
katzeriana ( ), Z. lacandona (■), Z. monticola ( ), Z.onanreyesii ( ), Z.
prasina ( ), Z. sandovallii (▲), Z. soconuscensis ( ), Z. vazquezii ( ).
109
FIG. 6. Distribution of Zamia fischeri ( ), Z. herrerae ( ), Z. loddigesii ( ), Z.
oreillyi ( ), Z. paucijuga ( ), Z. polymorpha (■), Z. purpurea (▲), Z. spartea ( ),
Z.standleyi ( ), Z. tuerckheimii ( ), Z. variegata ( ).
110
FIG. 7. Zamia fischeri A. Habit. B. Leaflets.
111
FIG. 8. Zamia inermis. A-B. Habit. C. Cataphyll. D. Pollen strobilus. E.
Microsporophyll, abaxial and adaxial view. F-H. Ovulate strobilus. I. Ovulate
sporangiophores. J. Seed.
112
FIG. 9. Zamia oreillyi. A. Habit. B. Cataphyll. C-E. Leaflet variability. C. Broad and
imbricate with dentate margins. D. Narrow and imbricate with dentate margins. E.
Narrow and slighly imbricate with entire margins. F. Ovulate strobilus. G. Pollen
strobilus. H. microsporophyll, abaxial view.
113
FIG. 10. Zamia polymorpha. A. Habit. B. Leaflets. C. Ovulate strobilus. D. Pollen
strobilus. E. Cataphyll.
114
FIG. 11. Zamia purpurea. A. Habit. B. Pollen strobilus. C. Microsporophyll, abaxial
view. D. Ovulate strobilus. E. Ovulate sporangiophores. F. Seed.
115
Fig. 12. Zamia spartea. A. Habit. B. Leaflet. C. Pollen strobilus. D-E. Microsporophyll,
abaxial and adaxial view. F-G. Petiole and cataphyll. H. Ovulate strobilus and
peduncle. I. Ovulate sporangiophore. J. Ovulate sporangiophores, distal end
truncate hexagonal. K. Seed with sarcotesta. L-M-N. Seeds.
116
Fig. 13. Zamia vazquezii. A. Habit. B. Leaflet. C. Ovulate strobilus. D. Pollen strobilus.
E. Cataphyll.
117
CAPITULO III
DNA barcoding in the Mexican cycads: a character attribute organization system
(CAOS) approach
(Sometido a Cladistics)
118
DNA barcoding in the Mexican cycads: a character attribute organization system
(CAOS) approach
Running title: DNA barcoding in the Mexican cycads using CAOS
Fernando Nicolalde-Morejón1, 2*, Francisco Vergara-Silva3, Jorge González-Astorga1,
Dennis W. Stevenson4, Andrew P. Vovides5 & Victoria Sosa6
1
Laboratorio de Genética de Poblaciones, Biología Evolutiva. Instituto de Ecología, A.
C., km 2.5 Antigua Carretera a Coatepec No. 351, Xalapa 91070, Veracruz, México
2
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Av. Luis Castelazo
Ayala s/n, Col. Industrial Ánimas, Xalapa 91190, Veracruz, México
3
Laboratorio de Sistemática Molecular (Jardín Botánico), Instituto de Biología,
Universidad Nacional Autónoma de México, 3er Circuito Exterior, Ciudad
Universitaria, Coyoacán 04510, México, D. F. México
4
The New York Botanical Garden, Bronx, New York, 10458-5120, USA
5
Laboratorio de Biología Evolutiva de Cycadales, Biología Evolutiva. Instituto de
Ecología, A. C., km 2.5 Antigua Carretera a Coatepec No. 351, Xalapa 91070,
Veracruz, México
6
Laboratorio Molecular, Biología Evolutiva. Instituto de Ecología, A. C., km 2.5
Antigua Carretera a Coatepec No. 351, Xalapa 91070, Veracruz, México
*Corresponding author: [email protected]
119
Abstract
A DNA barcoding study was conducted to determine the optimal combination of loci
needed for successful species-level molecular identification in three extant cycad
genera, Ceratozamia, Dioon and Zamia that occur in Mexico. Based on conclusions of
a previous study in representative species of all genera in the Cycadales, we tested the
DNA barcoding performance of seven chloroplast coding (matK, rpoB, rpoC1 and
rbcL) and non-coding regions (atpF/H, psbK/I and trnH-psbA), plus sequences of the
nuclear ITS. We analyzed data under the assumptions of the “Character Attributes
Organization System” (CAOS), a character-based approach whereby species are
identified through the presence or ‘DNA diagnostics’. In Ceratozamia, five chloroplast
regions were needed to achieve >70% of unique species identification, whereas the twogene atpF/H+psbK/I and the four-gene combination atpF/H+psbK/I+rpoC1+ITS2 were
needed to reach 79% and 75% of unique species identification in Dioon and Zamia,
respectively. The combinations atpF/H+psbK/I and atpF/H+psbK/I+rpoC1+ITS2
include loci previously considered by the international DNA barcoding community.
However, our results suggest that the optimal combination for DNA barcoding in
cycads does not coincide with the ‘core barcode’ of chloroplast markers (matK +rbcL)
recently proposed for universal use in the plant kingdom.
Keywords: Plant DNA barcoding, Ceratozamia, Dioon, Zamia, Mexican cycads, taxonspecific DNA barcode combinations, character attribute organization system (CAOS)
120
Holding approximately one sixth of the total species number for the order in the
Neotropics, Mexico is one of the three main centers of biological diversity in Cycadales,
one of four groups of extant gymnosperms (Norstog and Nicholls, 1997; Vovides et al.,
2007). As in other important seed plant groups, e. g. angiosperms (Mathews, 2009 and
references therein), the systematics of cycads has advanced greatly during the present
decade, especially through the use of a large number of DNA sequences with proven
value for the reconstruction of phylogenetic relationships (Treutlein and Wink, 2002;
Hill et al., 2003; Bogler and Francisco-Ortega, 2004; Caputo et al., 2004; Rai et al.,
2004; Chaw et al., 2005; Zgurski et al., 2008). These molecular data sets have added to
a relatively limited number of morphological characters, traditionally established as the
basis of intergeneric and/or intraspecific classification (Stevenson, 1990, 1992). The
description of new species of cycads from Mexico has also experienced notable
progress recently (Schutzman and Vovides, 1998; Vovides et al., 2008a, b), but aside
from a few exceptional cases (e. g. Nicolalde-Morejón et al., 2009a); the use of
molecular information has not played a prominent role in the proposal of such
taxonomic hypotheses.
In parallel to developments in the molecular systematics of cycads and seed plants in
general (Mathews, 2009 and references therein), the use of DNA as a source of
evidence in comparative biology has been recently extended outside the realm of
phylogenetic inference per se, bringing important changes in the disciplinary
relationship between molecular biology/genomics, bioinformatics, and alpha-taxonomy.
Central to these changes has been the explicit suggestion of the direct use of selected
genomic regions as ‘DNA barcodes’, in close analogy to the way in which unique
combinations of variable width vertical marks work for the identification of
industrialized goods in commerce, etc. (Hebert et al. 2003a; Stoeckle and Hebert, 2008).
121
The proposal to employ molecular barcodes for large-scale, species-level identification
in varied contexts, ranging from basic taxonomic research to clinical, agricultural, or
even recreative applications (Stoeckle and Hebert, 2008), straightforwardly rests on the
claim that certain regions in animal genomes behave in a practically invariant manner
within members (i. e. individuals) belonging to the same species, and simultaneously
vary to a clearly detectable level between species (Hebert et al., 2003a, b; for a survey
of molecular systematic antecedents of this idea, see Meier, 2008). Animal DNA
barcoding quickly stabilized around phenetic analysis of orthologs of a ‘single-locus
barcode’, constituted by approximately 650 bp of the mitochondrial cytochrome oxidase
I (COI) coding region, for which primers were designed with high PCR amplification
success in a large number of animal species. In a brief period of time, several cases of
reliable indication of taxonomic pertinence at the species level using this short sequence
fragment accumulated in selected vertebrate and invertebrate taxa (Hebert et al., 2004;
Monaghan et al., 2005; Ward et al., 2005, Hajibabaei et al., 2006; Smith et al., 2007,
2008). Nevertheless, COI-based animal DNA barcoding has not passed unquestioned
by some molecular systematists (see, for instance, Brower, 2006; Cognato and Sun,
2007), a few of which have stated that the whole DNA barcoding enterprise is
conceptually flawed (e. g. Ebach and Holdrege, 2005; Wheeler, 2004, 2005; Will and
Rubinoff, 2004; for some of the responses made to these statements, see Gregory, 2005;
Packer et al., 2009).
Although harsh criticisms of DNA barcoding as a research program in plant
taxonomy have been raised (e. g. Seberg et al., 2003; Spooner, 2009), a sector of the
botanical community has embraced the DNA barcoding initiative with more sympathy
(e. g. Chase et al., 2005; Cowan et al., 2006). As a result of a few preliminary studies
and associated discussions, some of them held at international conferences (see Pennisi,
122
2007); molecular biology-oriented plant systematists decided collectively that the
chloroplast genome should provide a major proportion of plant DNA barcoding data.
However, botanists heavily involved in selecting the ‘definitive set’ of plant DNA
barcoding regions have had a difficult time agreeing upon which single locus, or
combination of loci, might perform best in the largest number of groups. Their mutual
disagreements have been, in fact, evident in a number of proposals to settle the issue
(Kress et al., 2005; Cowan et al., 2006; Chase et al., 2007; Kress and Erickson, 2007;
Fazekas et al., 2008; Lahaye et al., 2008; Ford et al., 2009). In keeping with their
largely positive attitude towards DNA barcoding, though, the central point of discussion
in these papers has been how much sequence data –and from how many chloroplast (or
nuclear, in some special cases such as non-green mycoheterotrophs) genome regions–
should be collected in order to successfully carry out rapid, cheap and reliable
molecular identification of plant species in the widest possible plant diversity. As a
result of an evaluation of the accumulated evidence so far, a consensus has been reached
this year by a multinational assemblage of plant DNA barcoding researchers, who
settled for a two-locus ‘standard’ or ‘core’ barcode composed of two fragments of easy
PCR amplification within the maturase K (matK) and the large subunit of the ribulose
1,5-bisphosphate carboxylase oxygenase (rbcL) loci, both of them chloroplast coding
regions with a long history of success in plant molecular systematics (CBOL Plant
Working Group, 2009). According to the proposal of this group of botanists, the core
plant DNA barcode could be supplemented by a group of three non-coding regions, also
from the chloroplast genome –atpF-atpH, psbK-psbI and trnH-psbA– all of which had
been considered (either separately or jointly) in several of the DNA barcoding studies
preceding the consensus on the standard barcode.
123
While fully recognizing that the matK+rbcL pair will now be recognized as the
standard, universal barcode in land plants, in the present plant DNA barcoding study we
have decided to address the discussion topic that was at the base of the consensus
decision taken by the CBOL Plant Working Group. In the language chosen by the
CBOL Plant Working Group, this topic amounts to the definition of three
straightforward criteria: (i) universality; (ii) sequence quality and coverage; and (iii)
discrimination. Our study focused on the three genera of cycads that occur in Mexico,
Ceratozamia Brongn., Dioon Lindl., and Zamia L., and involved comparison of the
performance of several different genome regions, all of them potentially useful for
unique species identification in plants by CBOL standards. In a manner similar to the
multinational group, we have explicitly considered the proposals resulting from the
Second International Barcode of Life Conference (held in Taipei, 2007; see Pennisi,
2007) as well as relevant previous work on plant DNA barcoding, including
taxonomically restricted studies in selected plant genera and/or familes (Kress et al.,
2005; Cowan et al., 2006; Chase et al., 2007; Little and Stevenson, 2007; Kress and
Erickson, 2007; Fazekas et al., 2008; Lahaye et al., 2008; Ford et al., 2009; Seberg and
Petersen, 2009). In contrast to the CBOL Plant Working Group, though, we have also
followed the pioneer DNA barcoding study conducted by Sass et al. (2007) on a set of
selected cycad species representative from all biogeographic centers of diversity. As a
result of all of the above considerations, the definitive group of regions assayed here
includes four chloroplast coding loci (the genes matK, rpoC1, rpoB and rbcL), three
non-coding intergenic spacer regions from the same plastid genomic compartment
(atpF/H, psbK/I and trnH-psbA) and, finally, a non-plastid genome region, the nuclear
ribosomal internal transcribed spacer (ITS).
124
Initial processing of the resulting data sets included standard phenetic tests (e. g.
neighbor-joining phenogram construction), following previously published DNA
barcoding work (e. g. Hebert et al., 2003). However, for advanced data analysis, we
have employed the recently proposed “Character Attributes Organization System”
approach (CAOS; Sarkar et al., 2008), a character-based approximation to DNA
barcoding implemented in the software package of the same name. To our knowledge,
this is the first report in which a plant DNA barcoding data set has been analyzed under
these methodological assumptions (for examples of CAOS analyses with animal DNA
barcoding data, see Kelly et al., 2007; Rach et al. 2008; and Naro-Maciel et al., 2009).
Under the CAOS analytical regime, which basically looks for diagnostic characters
instead of relying on phenetic distance measurements, we have calculated that psbK/I,
one of the non-coding chloroplast intergenic segments, provide the highest number of
‘DNA diagnostic’ sites overall. We have also found that a three-gene combination with
100% amplification success, involving two non-coding and one coding regions –
namely, atpF/H+psbK/I+rpoC1– from our selected chloroplast working set, allows 79
and 67 percent unique species identification in the genera Dioon and Zamia,
respectively. For Ceratozamia, however, >70 percent (78%) identification could only
be achieved through the addition of two regions (matK and ITS) to the two-gene group
that worked adequately in Dioon, whereas for Zamia, addition of a fourth genomic
element (the nuclear ITS) was needed to increase the identification percentage above 70
percent (up to 75%). We discuss our findings in the light of recent observations, also
made in a botanical, taxonomically restricted context, which point out to a potential
‘intrinsic limit to resolution’ for low-number combinations of candidate DNA barcoding
regions in plants (Seberg and Petersen, 2009). However, we additionally observe that
even considering this explicit acknowledgment of potential boundaries of reliable
125
identification in plant DNA barcoding, the optimal gene set of DNA barcodes in two of
the three Mexican cycad genera studied here does not coincide at all with the
matK+rbcL core barcode, nor does it match any of the three-gene combinations
entertained for implementing DNA barcoding in plant species in the relevant
publications previous to the CBOL Plant Working Group consensus. We therefore
suggest that ‘taxonomically local’ combinations of plant genome loci for molecular
species identification, which work best for relatively restricted phylogenetic
assemblages, should be seriously considered besides the ‘2+3’ standard chloroplast set
of barcoding regions. In our opinion, this alternative needs to be entertained if
molecular reference databases for species identification are to be successfully applied in
either floristic, conservation biology, or strictly taxonomic-nomenclatural research
contexts, particularly in certain Neotropical plant groups.
Materials and Methods
Sampling of biological materials
We collected leaf samples from all Mexican cycad species known to date from the
three genera that occur in Mexico –Ceratozamia, Dioon y Zamia– as published in the
World Cycad List by Hill et al. (2007), plus three new species recently published (see
Vovides et al., 2008a, b; Nicolalde-Morejón et al., 2009a). We also collected leaf
material from at least one individual from each non-Mexican cycad genus (Table 2).
All materials were obtained from living plants included in the National Cycad
Collection at the Jardín Botánico ‘Francisco Javier Clavijero’ (JBC), which houses
materials from the Mexican species as well specimens in cultivation from several
126
countries, covering the entire order Cycadales. We also performed ex profeso field
collections to complement the set of sampled materials for the present study. Leaf tissue
from Chigua restrepoi D. W. Strev., Zamia standleyi Schutzman, Z. tuerchkeimii Donn.
Sm. and Z. prasina W. Bull was kindly donated by the Montgomery Botanical Center
(MBC).
Leaf genomic DNA extraction and PCR amplification (including DNA sequencing)
With the exception of the leaf samples transported from the field to the lab, fresh
materials were always used for the total leaf genomic DNA extractions of material
collected at the greenhouses of the JBC. For the extractions, we used either the
DNAeasy Plant Mini kit (QIAGEN) or a user-tailored protocol based on a widely
known CTAB DNA extraction procedure (Doyle & Doyle, 1987). PCR amplification
and automated sequencing includes all loci proposed at the Second International
Barcode of Life conference (Taipei, 2007; see Pennisi, 2007; Fazekas et al., 2008; Ford
et al., 2009 and CBOL, 2009). Nucleotidic variability in four chloroplast coding
regions (the genes matK, rpoC1, rpoB and rbcL), three non-coding intergenic spacer
regions from the same plastid genomic compartment (atpF-atpH, psbK-psbI and trnHpsbA) and the nuclear ribosomal internal transcribed spacer (ITS) as a complement nonchloroplast locus (see Table 1 for primers used in each type of PCR reaction) was
evaluated here (see Table 2 for an overview of amplification success for each gene
assayed for each species).
Polymerase chain reaction (PCR) amplification experiments were performed as
reported in recent plant DNA barcoding publications (e. g. Sass et al., 2007).
Amplification products were visualized through gel electrophoresis in 1% agarose gels
127
stained with ethidium bromide. In all cases where single bands were clearly detected,
PCR products were directly purified using QIAquick® PCR Purification Kit
(QIAGEN). Automated sequencing was carried out in Macrogen (South Korea;
http://dna.macrogen.com).
Sequence analysis
Electropherograms were edited and contigs were assembled using the software
program Sequencher 4.8 (Gene Codes Corp., Ann Arbor, Michigan, USA). Sequences
were aligned in BioEdit 7.0.9 (Hall, 1999), through its implementation of the Clustal X
(Thompson et al., 1997) multiple alignment mode. Alignments were imported into
MacClade (Sinauer Associates, Sunderland, Massachusetts, USA), further edited by
eye, and saved in Nexus format for ulterior character analysis.
Character-based analysis/identification of ‘DNA diagnostics’ and determination of
DNA barcodes in Mexican cycad species
Neighbour-joining (NJ) guide trees were estimated for each matrix/amplified locus,
using a Kimura-2-parameter distances model in PAUPv4.0b10 (Swofford, 2002). These
trees were stored in Nexus format and edited in MacClade. The tree topology that was
ultimately selected and used in the “character attributes organization system” analyses
corresponds to Stevenson’s 1992 previously published phylogenetic hypothesis for the
cycads. Program P-GNOME from the CAOS software package (Sarkar et al., 2008) was
executed according to the authors’ instructions (http://sarkarlab.mbl.edu/CAOS).
Actual determination of DNA diagnostics involved the manual revision of the “CAOS-
128
attribute file” and “CAOS-group file” archives generated by P-GNOME. Only characters
(‘attributes’) with confidence value of 1.00 were selected. Corroboration of these
attributes was performed by eye, observing and comparing the information of the
“CAOS-group file” archives with the original, MacClade-edited matrices.
Results and discussion
A DNA barcode for land plants: difficult roads toward a consensus
Although still unexplored in its full extent for a wide array of taxa, analyses of
molecular evolutionary processes taking place in certain plant mitochondrial genomes
indicate that the cytochrome oxidase I (COI) coding region, which has been adopted by
consensus as the ‘universal animal DNA barcode’ in animals (Hebert et al., 2003a, b;
Stoeckle and Hebert, 2008), is not suitable for analogous use in plants (Adams and
Palmer, 2003; Spooner, 2009). A central interest in the international effort to develop
DNA barcoding in plants has therefore been directed to find a different individual locus,
or a combination of loci, that could fulfill the set of pragmatic criteria that during the
early stages of this international research initiative have been recognized to constitute
the mark of an adequate DNA barcode (for a concise description of these criteria, see
Sass et al., 2007; Ford et al., 2009; for a description of their mature version, see CBOL
Plant Working Group, 2009).
The comparative performance of several different combinations of loci in plant
genomes –particularly, from the chloroplast– has correspondingly received special
attention, and the selection of the best combination among these has been discussed in
recent meetings specifically devoted to plant DNA barcoding initiatives, as well as in
129
recent publications derived from these meetings (see, for instance, Pennisi, 2007;
Fazekas et al., 2008; Ford et al., 2009). Only recently, an international consensus on a
standard botanical DNA barcode has been reached (CBOL Plant Working Group,
2009). It is worth noting, though, that some prominent plant DNA barcoding studies
initially promoted the idea that empirical evidence was enough to support either psbAtrnH, a non-coding chloroplast region of about 400 base pairs (Kress et al., 2005; Kress
and Erickson, 2007) or an N-terminal approximately 800 base pairs-long segment of the
coding region for the maturase K gene (matK), also from the plastid genome (the latter
claim was made as recently as last year; Lahaye et al., 2008), as sufficiently good
candidates to achieve the status of individual, standard plant DNA barcodes. The fact
that the final decision on a ‘core’ and a supplementary set of DNA barcodes ultimately
involved a total of five (two coding and three non-coding) regions from the chloroplast
genome, clearly shows that the early hopes to reach a botanical analog of the ‘singlelocus DNA barcode’ scheme that is accepted in the zoological community were
unwarranted.
DNA barcoding in the cycads redux I: surprising results under the assumptions of a
character-based method
Within the context of exploratory work in different plant groups carried out in order
to select a universal set of plant DNA barcodes, the order Cycadales has occupied a
visible place (Sass et al., 2007; Little & Stevenson, 2007). This situation is not
surprising; in taxonomic terms, cycads are particularly well suited for exhaustive DNA
barcoding due to the relatively small number of genera and species that constitute the
group (Norstog and Nicholls, 1997; Hill et al., 2007). At the same time, cycad
130
specialists have already realized that DNA barcoding data collected for all genera might
potentially contribute to molecular systematic studies at that taxonomic level. At
present, a reliable phylogenetic classification of cycad genera is not available, despite
the growing number of works devoted to the subject in recent years (Treutlein and
Wink, 2002; Hill et al., 2003; Rai et al., 2004; Chaw et al., 2005; Zgurski et al., 2008).
The genus Dioon, arguably the most difficult taxon to place in a phylogenetic context
within the order as a whole (Hill et al., 2003), is a peculiar case in this respect within
the context of the Mexican cycads not only because it is basically endemic to the
Mexico, but also because of the potential that molecular matrices of chloroplast DNA
barcode candidates might have as sources of informative characters in cladistic analyses
(Nicolalde-Morejón et al., unpublished observations).
Given that the trnH-psbA region was the first chloroplast locus to be suggested as a
universal DNA barcode in plants (Kress et al., 2005; Kress and Eriksson, 2008), during
the development of this study we were particularly interested in the degree of
nucleotidic variability at the species level that this chloroplast intergenic spacer could
show in the three cycad genera that occur in Mexico. Previously, Sass et al. (2007) had
already found that, with the exception of Cycas, all amplifications of cycad genomic
DNA with the primers suggested by Kress et al. (2005) for this region yielded two
distinct bands, even when the annealing temperature is raised to 62°C. We replicated
this result for all the leaf genomic DNA samples tested. Working with the smallest of
these bands in all cases where amplification was successful (all but one Dioon species,
several Ceratozamia and Zamia species, and all outgroups; see Table 2), which
corresponds to the amplification that was not sequenced by Sass et al. (2007), we have
unequivocally observed that trnH-psbA is not variable between species in either
Ceratozamia, Dioon, or Zamia. This result is compatible with the conclusion reached
131
by Sass et al. (2007) on the basis of the species-level variability of the larger band in at
least one species per genus in the Cycadales. However, we noticed that the distribution
of four indels varies consistently between genera (data not shown), and therefore might
be useful for systematic purposes at the genus level. We specifically suggest that
characters corresponding to indels in the trnH-psbA region sequenced in this paper
might contribute with information to clarify the phylogenetic position of Dioon,
possibly the most contentious subject in current cycad molecular systematics (Hill et al.,
2003; Bogler and Francisco-Ortega, 2004; Rai et al., 2004; Chaw et al., 2005; Zgurski
et al., 2008). However, our results do not lend support to the status of ‘potential’ core
DNA barcode that this non-coding chloroplast region still had just prior to the selection
of the two-locus standard plant DNA barcode (CBOL Plant Working Group, 2009:
12795).
The chloroplast coding region for the matK and rbcL genes, both of them wellestablished as important sources of characters for molecular systematics in angiosperms,
are two loci whose variability we also decided to explore in detail. Our decision was
evidently taken in the face of recent claims of the relative superiority of the former as a
DNA barcode in plants (Lahaye et al., 2008), and the ultimate selection of both loci as
the two core DNA barcoding regions (CBOL Plant Working Group). It is important to
notice, though, that rbcL had already been discarded as a DNA barcoding region by
Sass et al. (2007) for not complying with basic reproducibility criteria. With an interest
in checking if that negative result could be reverted, a random sample of five
Ceratozamia, six Dioon and five Zamia species was selected, for which we obtained
complete amplification success. This result was, however, again linked to an absolute
lack of variability at the nucleotide level within genera (data not shown), leading us to
confirm the judgement of unsuitability for rbcL as a DNA barcoding region in cycads.
132
In contrast to rbcL, Sass et al. (2007) had not ignored matK in their cycad DNA
barcoding study, but the region was not considered beyond Step 2 (i. e. testing of
selected primer pairs) of their optimized flowchart. The elimination of matK for further
testing in that study was due to failure of amplification in selected species of eight
cycad genera (Ceratozamia, Chigua D. W. Stev., Dioon, Encephalartos Lehm.,
Lepidozamia Regel, Macrozamia Miq., Microcycas (Miq.) A. DC. and Stangeria T.
Moore) and to the fact that in the remaining two genera, Cycas L. and Zamia,
amplification was only partially successful (products were not obtained in Cycas
platyphylla K. D. Hill and Zamia variegata Warsz., one out of three species tested for
each genus). In our hands, it was also impossible to obtain good quality amplifications
of matK in the genus Dioon, and only a few Zamia samples behaved successfully as
templates in the PCR reactions (Table 2). In contrast, leaf genomic DNA from all the
species of Ceratozamia, tested with the set of primers that were not tested by Sass et al.
(2007), supported sufficient product amplification with high associated quality of
sequences.
Despite the partial amplification success, matK data from Zamia species was not
variable enough to be further considered useful for DNA barcoding purposes (data not
shown). On the other hand, analysis of this Ceratozamia matrix with our preferred
analytical regime, the “characteristic attributes organization system” (CAOS) algorithm,
implemented in the software of the same name (Sarkar et al., 2008), retrieved ‘DNA
diagnostics’ for only five out of 24 species. Our results do not necessarily rule out the
use of matK in DNA barcoding, though. It remains to be seen if the use of different
universal primers for this locus, which amplify larger segments of the gene (the primers
that were successful in the present study yield an approximately 800 base pairs-long, Nterminal fragment of this coding region) is more suitable due to a higher concentration
133
of CAOS informative sites/DNA diagnostics in other regions of matK. However, since
this caveat could hardly apply to rbcL data, we explicitly consider inadequate to use the
CBOL Plant Working Group core DNA barcode as the main source of information for
DNA barcoding in cycads.
The locus psbK/I is a chloroplast region that has only been included recently as part
of two of the sets of candidate loci for DNA barcoding (Kim et al., 2007 (abstract at the
Taipei conference); Pennisi, 2007). We selected this locus as the third region of interest
in the present DNA barcoding study mainly because no information was previously
available for it, neither in gymnosperms nor in cycads in particular, and also due to the
fact that this locus was included in the set of non-coding regions supplementary to the
core DNA barcode of the CBOL Plant Working Group. Pragmatic criteria for the
selection of a good DNA barcoding region in the flowchart in Sass et al. (2007) were
easily fulfilled starting with the fact that amplification success was 100% (Table 2). In
view of its levels of variability for species in the three genera tested here under the
assumptions of our preferred character-based analytical approach (see Figure 1, and
Table 3), we propose that –contra Fazekas et al. (2009, p. e2802), who argued against
its use due to “its higher failure rate in amplification and sequencing”– the psbK/I locus
should be seriously considered as a candidate for inclusion in any final DNA barcoding
gene combination used in cycads. Presumably, performance of this chloroplast genome
region for DNA barcoding in other gymnosperms also might be acceptable.
By itself, psbK/I allows variable, and not very high (i. e. <50%), levels of unique
species identification in the three Mexican cycad genera (Table 3). However, in Dioon
and Zamia, these levels are clearly the highest for any single gene (Figure 2), reaching
57 percent (8/14 species) in the former and 50 percent (12/24 species) in the latter
genus. Only in Ceratozamia the single-gene percentage of species identification has a
134
really low value for this region (17%, or 4 out of 23 species). On the basis of the CAOS
results for psbK/I, the remaining of our character-based DNA barcoding analysis was
performed in order to quantify the increase of unique species identification percentages
for loci added to this chloroplast non-coding region. Given the perfect record (i. e.
100% success) of amplification that they showed for our study taxa (Table 2), the
obvious choices were atpF-H and rpoC1, another intergenic spacer and a coding
chloroplast locus, respectively. Interestingly, atpF-H and rpoC1 had not been jointly
considered before as candidates for low loci number plant DNA barcoding (Pennisi,
2007), and only the former was included in the set of supplementary DNA barcoding
loci (CBOL Plant Working Group, 2009).
In Ceratozamia, Dioon and Zamia, the addition of atpF-H to psbK/I increased the
percentage of unique species identification to 39, 79 and 63 percent, respectively, under
CAOS assumptions (Figure 1). However, in the first two genera, CAOS analysis upon
matrices where rpoC1 was further added did not increase the percentage of molecular
identification, indicating that although the rpoC1 primers used here are highly efficient
for amplification with cycad genomic DNA, nucleotidic variability is close to zero for
cycad homologs of this gene (data not shown). Additional differences in the additive
performance of a fourth region were observed for each genus: in Ceratozamia, the
addition of matK improved species-level identification by 13% (reaching a global
percentage of 52), while in Zamia the addition of the ITS2 increased the percentage to
75 (given a 67% of correct species identification using the three-gene combination
atpF/H+psbK/I+rpoC1). For Dioon, in contrast, addition of a fourth gene rpoB did not
contribute with any DNA diagnostics to further discriminate unique species in this
genus (Figure 1).
135
DNA barcoding in the cycads redux II: is the ‘Seberg-Petersen limit’ real?
As stated in the Introduction, in the present study we have not ignored the
international consensus on plant DNA barcoding recently arrived at by a group of
highly renowned botanical experts (CBOL Plant Working Group, 2009). However,
guided mainly by the results of a previous study which dealt specifically with our taxon
of interest (Sass et al., 2007), we decided to take a step back from that compromise.
This decision allowed us to consider a whole range of reasonable possibilities for
selecting DNA barcoding regions in the Mexican cycads, employing in addition what
we deem to be the best analytical approach for theoretical reasons that we consider
sufficiently established (see DeSalle 2007 and references therein). Such stance further
enabled us to re-analyze the balances intrinsic to the criteria that the CBOL Plant
Working Group itself considered central in their selection of the standard DNA barcode
for the land plants –namely universality, sequence quality and coverage, and
discrimination (CBOL Plant Working Group, 2009: 12794).
In this discussion context, it is relevant to retrieve a portion of one of the recently
published, pre-CBOL Plant Working Group consensus plant DNA barcoding papers,
where equality of performance was supported for multiple multilocus combinations.
The authors of that work stated that “from the perspective of species resolution, the
identity of the regions used is less important than the number” (Fazekas et al. 2008, p.
e2802). We agree completely with this statement; in fact, we further suggest that for
each of the three cycad genera studied in detail here a different combination of
chloroplast regions clearly works ‘best’ as a DNA barcoding set. However, the issue of
‘goodness’ is of major concern for us here. Judging from the distribution of nucleotidic
variation we observed in the present study, we estimate that if our research team were to
136
gather more sequence data from several additional chloroplast and nuclear regions in
the Mexican cycads, the percentages of unique (i. e. correct) species identification
would approach a high value. Presumably, this would be the case particularly in Dioon
and Zamia, the two genera for which basic systematics is better understood (NicolaldeMorejón et al., 2009b). Moreover, we consider that after such effort the construction of
a very good DNA barcoding reference library would be feasible for the Mexican
cycads, given the relatively low number of species in each of the three genera versus the
excellent sampling that we have of their diversity, down to the population level.
Aiming for high amounts of genomic information in order to obtain good levels of
unique species recognition was, then, already validated in some of the last publications
previous to the consensus (see, for instance, Ford et al., 2009), but the fact that
surpassing a certain threshold of ‘sequencing volume’ would render the approach too
expensive and, ultimately, unmanageable was simultaneously acknowledged. This
important point was actually reflected in the CBOL Plant Working Group decision to
choose a two-locus and not a three-locus ‘core’ barcode (CBOL Plant Working Group,
2009: 12795). "Having identified the tension between the need to sequence multiple
loci and the convenience of not exceeding a certain threshold of sequencing, on the
other hand we recall that Fazekas et al. (2008) also mentioned that “fundamental upper
limits” exist to “what is possible for any current plant DNA barcoding approach”.
Interestingly, in their taxonomically restricted study of DNA barcoding in the genus
Crocus, Seberg and Petersen (2009, p. e4598) took a step forward in the direction
indicated by Fazekas et al., when they affirmed that “in a taxonomic setting and with a
reasonable effort it is unlikely that barcoding will enable us to identify more than
around 70-75% of the known species –in some instances less, in some instances more”
(italics ours). Again, this boundary of resolution was acknowledged in the international
137
consensus (“the unique identification to species level of 72% of cases and to ‘species
groups’ in the remainder will be useful for many applications of DNA barcoding (…)”;
CBOL Plant Working Group, 2009: 12796). Using low-number combinations of
chloroplast genes in our study of the Mexican cycads, we might have reached the
Seberg and Petersen limit, the key point being that, in each case, we arrived at this limit
using a different combination of loci.
Conclusions: gene quantity versus universality in plant DNA barcoding, and ‘ the
wisdom of the local’
Considering the clear-cut unsuitability of both matK and rbcL as the main DNA
barcoding loci in cycads, we think that an unavoidable conclusion from the cycad work
presented here in fact echoes the idea expressed by Fazekas et al. (2008), adopted
implicitly by the CBOL Plant Working Group as one of their directives: in DNA
barcoding, what should matter is not too much gene identity, but gene (i. e. low)
quantity. Although we seem to have reached the 70-75% ‘limit of resolution’ alluded to
by Seberg and Petersen (2009), at the same time we suggest that the substitution of
rpoC1 (a gene region which had 100% amplification success, but zero DNA
diagnostics) with another locus with suboptimal amplification success but higher
variability could improve the percentages of unique species identification in some of the
Mexican cycad genera. This still unknown coding or non-coding region might lie in the
chloroplast, but it might well have been overlooked since the initial plant DNA
barcoding pilot studies, which did not include a thorough sampling of cycads. In this
regard, future projects oriented towards the sequencing of complete chloroplast
138
genomes in selected species from all cycad genera will be extremely useful in the search
for those alternative regions.
On the basis of the present DNA barcoding project in the Mexican cycads, we
suggest that the future of plant DNA barcoding might lie in being flexible with respect
to the seemingly unattainable ideal of a unique set of universal DNA barcodes, despite
the fact that the international community has now achieved a consensus around a
standard barcode for the land plants (CBOL Plant Working Group, 2009). Without
questioning the merits that this consensus entails, and the utility that the chosen loci
might have in several plant taxa, we think that a serious consideration of the use of
‘local’ combinations of plant DNA barcodes, that work best for relatively restricted
taxonomic-phylogenetic assemblages, should not be discarded yet. This relaxation of
constraints in the international plant DNA barcoding initiative will ultimately facilitate
the construction of optimal reference libraries for DNA barcoding, with applications in
either floristic, conservation biology, or strictly taxonomic-nomenclatural research
contexts for important and charismatic, but rare plant groups that inhabit the
Neotropical region of the planet.
Acknowledgements
This research was supported by CONABIO grant No. GE004 and NSF Grants BSR8607049 and EF-0629817 to DWS. The first author thanks the Red Latinoamericana de
Botánica for the award of a Ph. D. fellowship (RLB-06-D2; Systematics Program,
Instituto de Ecología, A.C., Xalapa, Mexico), and especially Javier Simonetti for
additional support during the final phase of this project. Special thanks also to Raúl
Jiménez-Rosenberg and Martha Gual for their encouragement at the planning stages.
139
Finally, we are grateful to the staff of the Jardín Botánico Fco. J. Clavijero at the
Instituto de Ecología, A. C. (Xalapa) for access to the living specimens of the Mexican
national cycad collection (Colección de Cycadas Mexicanas).
References
Adams, K.L., Palmer, P.D.N. 2003. Evolution of mitochondrial gene content: genes loss
and transfers to the nucleus. Mol. Phylogenet Evol. 29, 380-95
Barrett, R.D.H., Hebert, P.D.N., 2005. Identifying spiders through DNA barcodes. Can.
J. Zool. 83, 481-491.
Bogler, D.J., Francisco-Ortega, J., 2004. Molecular systematic studies in cycads:
evidence from trnL intron and ITS2 rDNA sequences. Bot. Rev. 70, 260–273.
Caputo, P., Cozzolino, S., De Luca, P., Moretti A., Stevenson, D.W., 2004. Molecular
phylogeny of Zamia (Zamiaceae). In: Walters, T., Osborne, R.,
(Eds.), Cycad Classification: Concepts and Recommendations. CABI Publishing,
Wallingford, Inglaterra, pp. 149-157.
CBOL Plant Working Group. Hollingsworth, P.M., Forrest, L.L., Spouge, J.L.,
Hajibabaei, M., Ratnasingham, S., van der Bank, M., Chase, M.W., Cowan, R.S.,
Erickson, D.L., Fazekas, A.J., Graham, S.W., James, K.E., Kim, K.J., Kress, W.J.,
Schneider, H., van AlphenStahl, J., Barrett, S.C.H., van den Berg, C., Bogarin, D.,
Burgess, K.S., Cameron, K.M., Carine, M., Chacón, J., Clark, A., Clarkson, J.J.,
Conrad, F., Devey, D.S., Ford, C.S., Hedderson, T.A.J., Hollingsworth, M.L.,
Husband, B.C., Kelly, L.J., Kesanakurti, P.R., Kim, J.S., Kim, Y.D., Lahaye, R.,
Lee, H.L., Long, D.G., Madriñán, S., Maurin, O., Meusnier, I., Newmaster, S.G.,
Park, Ch.W., Percy, D.M., Petersen, G., Richardson, J.E., Salazar, G.A.,
140
Savolainen, V., Seberg, O., Wilkinson, M.J., Yi, D.K., Little, D.P., 2009. A DNA
barcode for land plants. Proc. Natl Acad. Sci. USA 106, 12794-12797.
Cognato, A.I., Sun, J.H., 2007. DNA based cladograms augment the discovery of a new
Ips species from China (Coleoptera: Curculionidae: Scolytinae). Cladistics 23, 539551.
Chase, M.W., Salamin, N., Wilkinson, M., Dunwell, J.M., Kesanakurth, R.P., Haidar,
N., Savolainen, V., 2005. Land plants and DNA barcodes: short-term and long-term
goals. Phil. Trans. R. Soc. B 360, 1889-1895.
Chase, M.W., Cowan, R.S., Hollingsworth, P.M., van der Berg, C., Madriñán, S.,
Petersen, G., Seberg, O., Jørgsensen, T., Cameron, K.M., Carine, M., Pedersen, N.,
Hedderson, T.A.J., Conrad, F., Salazar, G.A., Richardson, J.E., Hollingsworth,
M.L., Barraclough, T.G., Kelly L., Wilkinson, M., 2007. A proposal for a
standardized protocol to barcode all land plants. Taxon 56, 295-299.
Chaw, S.M., Walters, T.W., Chang, C.C., Hu, S.H., Chen, S.H., 2005. A phylogeny of
cycads (Cycadales) inferred from chloroplast matK gene, trnK intron, and nuclear
rDNA ITS region. Mol. Phylogenet. Evol. 37, 214-234.
Cowan, R.S., Chase, M.W., Kress, W.J., Savolainen, V., 2006. 300,000 species to
identity: problems, progress, and prospects in DNA barcoding of land plants. Taxon
55, 611-616.
DeSalle, R., 2006. Species discovery versus species identification in DNA barcoding
efforts: response to Rubinoff. Conserv. Biol. 20, 1545-1547.
DeSalle, R. 2007. Phenetic and DNA taxonomy; a comment on Waugh. BioEssays 29,
1289-1290.
Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochem. Bull. 19, 11-15.
141
Ebach, M., Holdrege, C., 2005. DNA barcoding is no substitute for taxonomy. Nature
434, 697.
Fazekas, A.J., Burgess, K.S., Kesanakurti, P.R., Graham, S.W., Newmaster, S.G.,
Husband, B.C., Percy, D.M., Hahibabaei, M., Barrett, S.C.H., 2008. Multiple
multilocus DNA barcodes from the plastid genome discriminate plant species
equally well. PLoS ONE 3, 7-e2802.
Ford, C.S., Ayres, K.L., Toomey, N., Haider, N., van Alphen Stahl, J., Kelly, L.J.,
Wikström, N., Hollingsworth, P.M., Duff, R.J., Hoot, S.B., Cowan, R.S., Chase,
M.W., Wilkinson, M.J., 2009. Selection of candidate coding DNA barcoding
regions for use on land plants. Bot. J. Linn. Soc. 159, 1-11.
Gregory, T.R. 2005. Sunergy between sequence and size in large-scale genomics. Nat.
Rev. Genet. 6, 699-708.
Hajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W., Hebert, P.D.N., 2006. DNA
barcodes distinguish species of tropical Lepidoptera. Proc. Natl Acad. Sci. USA
103, 968-971.
Hebert, P.D.N., Cywinska, A., Ball, S.L., deWaard, J.R., 2003a. Biological
identifications through DNA barcodes. Proc. R. Soc. Lond. B. 270, 313-321.
Hebert, P. D. N., S. Ratnasingham y J. R. deWaard. 2003b. Barcoding animal life:
cytochrome c oxidase subunit 1 divergences among closely related species.
Proceedings of the Royal Society of London B (Supplement) 270: S96-S99
Hebert, P.D.N., Penton, E.H., Burns, J.M., Janzen, D.H., Hallwachs, W., 2004. Ten
species in one: DNA barcoding reveals cryptic species in the neotropical skipper
butterfly Astraptes fulgerator. Proc. Natl. Acad. Sci. USA 101, 14812-14817.
Hebert, P.D.N., Gregory, T.R., 2005. The promise of DNA barcoding for taxonomy.
Syst. Biol. 54, 852-859.
142
Hill, K.D., Chase, M.W., Stevenson, D.W., Hills, H.G., Schutzman, B., 2003. The
families and genera of cycads: a molecular phylogenetic analysis of Cycadophyta
based on nuclear and plastid DNA sequences. Int. J. Plant. Sci. 164, 933-948.
Hill, K.D., Stevenson, D.W., Osborne, R., 2007. The world list of cycads/La lista
mundial de cícadas. Memoirs of the New York Botanical Garden 97, 454-483.
Hillis, D.M., Moritz, C., Mable, B.K., (Eds.). 1996. Molecular Systematics, 2nd edition.
Sunderland Mass, USA, Sinauer Associates, Inc.
Kelly, R.P., Sarkar, I.N., Eernisse, D.J., DeSalle, R., 2007. DNA barcoding using
chitons (genus Mopalia). Mol. Ecol. Notes 7, 177-183.
Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weigt, L.A., Janzen, D.H., 2005. Use of
DNA barcodes to identify flowering plants. Proc. Natl Acad. Sci. USA 102, 83698374.
Kress, W.J., Erickson, D.L., 2008. A two-locus global DNA barcode for land plants: the
coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS
ONE 2, e508.
Lahaye, R., van der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin,
O., Duthoit, S., Barraclough, T.G., Savolainen, V., 2008. DNA barcoding the floras
of biodiversity hotspost. Proc. Natl Acad. Sci. USA 105, 2923-2928.
Little, D.P., Stevenson, D.W., 2007. A comparison of algorithms for the identification
of species using DNA barcodes: examples for gymnosperms. Cladistics 23, 1-21.
Mathews, S. 2009. Phylogenetic relationships among seed plants: Persistent questions
and the limits of molecular data. Am. J. Botany 2009 96, 228-236.
Meier, R,. 2008. DNA sequences in taxonomy: opportunities and challenges. In:
Wheeler, Q. D. (Ed.), The New Taxonomy. CRC Press, Boca Ratón, Florida
143
Miller, S.E., 2007. DNA barcoding and the renaissance of taxonomy. Proc. Natl Acad.
Sci. USA 104, 4775-4776.
Min, X.J., Hickey, D.A., 2007. Assessing the effect of varying sequence length DNA
barcoding of fungi. Mol. Ecol. Notes 7, 365-373.
Monoghan, M.T., Balke, M., Pons, J., Vogler, A.P., 2006. Beyond barcodes: complex
DNA taxonomy of a South Pacific Island radiation. Proc. R. Soc. Lond. B 273,
887-893.
Mullis, K., Faloona, F.A., 1987. Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction. Meth. Enzymol. 155, 35-40.
Naro-Maciel, E., Reid, B., Fitsimmons, N.N., Lee, M., DeSalle, R., Amato, G., 2009.
DNA barcodes for globally threatened marine turtles: a registry approach to
documenting biodiversity. Mol. Ecol. Resour. doi, 10.1111/j.17550998.2009.02747.x.
Nicolalde-Morejón, F., Vergara-Silva, F., González-Astorga, J., Vovides, A.P.,
Espinosa de los Monteros, A., 2009a. Reciprocal illumination of morphological
characters upon a molecular hypothesis supports the proposal of a new species of
cycad from Mexico. Syst. Biodivers. 7, 73-79.
Nicolalde-Morejón, F., Vovides, A.P., Stevenson, D.W., 2009b. Taxonomic revision of
Zamia in Mega-Mexico. Brittonia. DOI 10.1007/s12228-009-9077-9.
Norstog, K., Nicholls, T.J., 1997. The Biology of the Cycads. Cornell University Press,
Ithaca, Nueva York.
Packer, L., Gibbs, J., Sheffield, C., Hanner, R., 2009. DNA barcoding and the
mediocrity of morphology. Mol. Ecol. Resour. 9, 42-50.
Pennisi, E. 2007. Wanted: a barcode for plants. Science 318, 190-191.
144
Rai, H.S., O'Brien, H.E., Reeves, P.A., Olmstead, R.G., Graham, S.W., 2003. Inference
of higher-order relationships in the cycads from a large chloroplast data set. Mol.
Phylogenet. Evol. 29, 350-359.
Rach, J., DeSalle, R., Sarkar, I.N., Schierwater, B., Hadrys, H., 2008. Character-based
DNA barcoding allows discrimination of genera, species and populations in
Odonata. Proc. R. Soc. B 275, 237-247.
Ratnasingham, S., Hebert, P.D.N., 2007. BOLD: The barcode of life data system
(www.barcodinglife.org). Mol. Ecol. Notes 7, 355-364.
Rubinoff, D., 2006. DNA barcoding evolves into the familiar. Conserv. Biol. 20, 15481549.
Sambrook, J., Russell, D.W., 2001. Molecular cloning: a laboratory manual, 3rd edition.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Sarkar, I.N., Planet, P.J., DeSalle, R., 2008. CAOS software for use in character-based
DNA barcoding. Mol. Ecol. Resour. 8, 1256-1259.
Sass, Ch., Little, D.P., Stevesnon, D.W., Specht, Ch.D., 2007. DNA barcoding in the
Cycadales: testing the potential of proposed barcoding markers for species
Identification of cycads. PLoS ONE. 11, e1154.
Schutzman, B., Vovides, A.P., 1998. A new Zamia (Zamiaceae-Cycadales) from Easter
Chiapas, Mexico. Novon 8, 441-446.
Seberg, O., Humphries, J.Ch., Knapp, S., Stevenson, D.W., Petersen, G., Scharff, N.,
Andersen, N.M., 2003. Shortcuts in systematics? A commentary on DNA-based
taxonomy. 2003. Trends Ecol. Evol. 18, 63-65.
Seberg, O., Petersen, G., 2009. How many loci does it take to DNA barcode a Crocus?
PLoS ONE 42, e4598.
145
Shaw, J., Lickey, E.B., Beck, J.T., Farmer, S.B., Liu, W., Miller, J., Siripun, K.C.,
Winder, C.T., Schilling, E.E., Small, R.L., 2005. The tortoise and the hare II:
relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic
analysis. Amer. J. Bot. 92, 142-166.
Smith, M.A., Wood, D.M., Janzen, D.L., Hallwachs, W., Hebert, P.D.N., 2007. DNA
barcodes affirm that 16 species of apparently generalist tropical parasitoid flies
(Diptera, Tachinidae) are not all generalists. Proc. Natl Acad. Sci. USA 104, 49674972.
Smith, M.A., Poyarkov, N.A., Hebert, P.D.N., 2008. CO1 DNA barcoding amphibians:
take the chance, meet the challenge. Mol. Ecol. Resources 8, 235-246.
Spooner, D.M., 2009. DNA barcoding will frecuently fail in complicated groups: an
example in wild potatoes. Amer. J. Bot. 96, 1177-1189.
Stevenson, D.W., 1990. Morphology and systematics of the Cycadales. Memoirs of The
New York Botanical Garden 57: 8-55.
Stevenson, D.W., 1992. A formal classification of the extant cycads. Brittonia 44, 220-223
Stoeckle, M.Y., Hebert, P.D.N., 2008. Barcode of life. Sci. Am. 299, 82-88.
Swofford, D.L., 2002. PAUP*. Phylogenetic analysis using parsimony. Sinauer
Associates, Sunderland.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997.
The ClustalX windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tool. Nucl. Acids Res. 24, 5875-5882.
Treutlein, J., Wink, M., 2002. Molecular phylogeny of cycads inferred from rbcL
sequences. Naturwissenschaften 89:221-225.
146
Vovides, A.P., González-Astorga, J., Pérez-Farrera, M.A., González, D., Bárcenas, C.,
Iglesias, C., 2007. The cycads of Mexico: 25 years of research and conservation.
Memoirs of The New York Botanical Garden 97, 611-641.
Vovides, A.P., Avendaño, S., Pérez-Farrera, M.A., González-Astorga, J., 2008a. A new
species of Ceratozamia (Cycadales, Zamiaceae) from Veracruz, Mexico. Novon 18,
109-114.
Vovides, A.P., Pérez-Farrera, M.A., González-Astorga, J., Iglesias, C., 2008b. A new
species of Ceratozamia (Zamiaceae) from Oaxaca, Mexico with comments on
habitat and relationships. Bot. J. Linn. Soc.157, 169-175.
Ward, R.D., Zemlak, T.S., Innes, B.H., 2005. DNA barcoding Australia’s fish species.
Phil. T. R. Soc. B 360, 1847–1857.
Wheeler, Q., 2004. Taxonomic triage and the poverty of phylogeny. Phil. T. R. Soc. B
359, 571-583.
Wheeler, Q., 2005. Losing the plot: DNA “barcodes” and taxonomy. Cladistics 21, 405407.
Will, K.W., Rubinoff, D., 2004. Myth of the molecule: DNA barcodes cannot replace
morphology for identification and classification. Cladistics 20, 47-55.
Zgurski, J.M., Rai, H.S., Fai, Q.M., Bogler, D.J., Francisco-Ortega, J., Graham, S.W.,
2008. How well do we understand the overall backbone of cycad phylogeny? New
insights from a large, multigene plastid data set. Mol. Phylogenet. Evol. 47, 12321237.
147
Tables
Table 1. Genes, primers and protocols used in the present DNA barcoding project.
Table 2. Comparative performance –in terms of amplification success– of the six coding
(matK, rpoB and rpoC1) and non-coding (atpF/H, psbK/I and trnH-psbA) chloroplast
regions, plus the two versions of the nuclear internal transcribed spacer region (ITS and
ITS2), used in the present study. The order of columns additionally reflects the
information content (under CAOS assumptions) in each locus. For the chloroplast
regions, notice the following peculiarities: (a) trnH-psbA was in general successfully
amplified in this study, but primers failed in a few species in each Mexican genus; (b)
matK was successfully amplified in all species of Ceratozamia; (c) despite working for
all species of Dioon, rpoB could not be amplified in either Ceratozamia or Zamia; and
(d) matK was not successfully amplified in any species of Dioon, and only in a few
Zamia species.
Table 3. Comparative performance –in terms of number of species uniquely identified–
of the various combinations of loci used in the present study, after character-based DNA
barcoding analyses with the CAOS software (Sarkar et al., 2008).
Table 4. Number of DNA diagnostic sites per species exemplar for each genera in the
Cycadales, including the three target genera in the study –i. e. Ceratozamia, Dioon and
Zamia– after character-based analyses with the CAOS software (Sarkar et al., 2008) for
the three chloroplast regions with 100% amplification success. The non-coding region
148
psbK-psbI provided the highest number of sites, only failing to provide information in
Chigua, Lepidozamia and Microcycas, genera which were considered as reference taxa
in this work.
Figure captions
Figure 1. Percentages of unique species identification using diverse combinations of
candidate loci for DNA barcoding in Ceratozamia, Dioon and Zamia, the three cycad
genera occurring in Mexico. Each individual combination is identified with a letter,
according to the following key: A = psbK-psbI; B = psbK-psbI + atpF-atpH; C = psbKpsbI + atpF-atpH + rpoC1; D1 = psbK-psbI + atpF-atpH + rpoC1+ matK; D2 = psbKpsbI + atpF-atpH + rpoC1+ rpoB; D3 = psbK-psbI + atpF-atpH + rpoC1+ITS2; E =
psbK-psbI + atpF-atpH + rpoC1+ matK+ITS.
Figure 2. DNA diagnostic sites under CAOS assumptions (Sarkar et al. 2008), obtained
after the analyses performed in the software package of the same name, for one species
in each valid cycad genus. The species set is ordered alphabetically. Species
corresponding to the three Mexican genera –Ceratozamia latifolia, Dioon caputoi and
Zamia soconuscensis- were chosen at random.
149
Table 1
Gene
Primer
Sequence 5´- 3´
Source of reaction
conditions
rpoB
rpoC1
matK
matK
2
ATGCAACGTCAAGCAGTTCC
3
CCGTATGTGAAAAGAAGTATA
1
GTGGATACACTTCTTGATAATGG
4
CCATAAGCATATCTTGAGTTGG
f
ATACCCCATTTTATTCATCC
r
GTACTTTTATGTTTACGAGC
2.1
CCTATCCATCTGGAAATCTTAG
2.1a
ATCCATCTGGAAATCTTAGTTC
5
3.2
rbcL
trnH/psbA
atpF/H
psbK/I
nrITS
GTTCTAGCACAAGAAAGTCG
www.kew.org/barcoding
www.kew.org/barcoding
www.kew.org/barcoding
www.kew.org/barcoding
www.kew.org/barcoding
CTTCCTCTGTAAAGAATTC
f
ATGTCACCACAAACAGAGACTAAAGC www.kew.org/barcoding
R
GAAACGGTCTCTCCAACGCAT
H
CGCGCATGGTGGATTCACAATCC
A
GTTATGCATGAACGTAATGCTC
F
ACTCGCACACACTCCCTTTCC
H
GCTTTTTATGGAAGCTTTAACAAT
K
TTAGCCTTTGTTTGGCAA G
I
AGA GTTTGAGAGTAAGCAT
5a
4 rev
CCTTATCATTTAGAGGAAGGAG
TCCTCCGCTTATTGATATGC
150
Shaw et al. 2005
Lahaye et al. 2008
Lahaye et al. 2008
Sass et al. 2007
Table 2
Genes
Taxa
psbI/K
Cycas couttisiana
Bowenia serrulata
Chigua restrepoi
Encephalartos natalensis
Lepidozamia peroffskyana
Macrozamia fawcetii
Microcycas calocoma
Stangeria eriopus
Dioon angustifolium
Dioon argenteum
Dioon califanoi
Dioon caputoi
Dioon edule
Dioon holmgrenii
Dioon mejiae
Dioon merolae
Dioon purpusii
Dioon rzedowskii
Dioon sonorense
Dioon spinulosum
Dioon tomasellii
Dioon stevensonii
Ceratozamia alvaresii
Ceratozamia becerrae
Ceratozamia chimalapensis
Ceratozamia decumbens
Ceratozamia euryphyllidia
Ceratozamia hildae
Ceratozamia huastecorum
Ceratozamia kuesteriana
Ceratozamia latifolia
Ceratozamia matuade
Ceratozamia mexicana
Ceratozamia microstrobila
Ceratozamia miqueliana
Ceratozamia mirandae
Ceratozamia mixeorum
Ceratozamia morettii
Ceratozamia norstogii
atpF/H
151
rpoC1
trnH-psbA
matK
rpoB
ITS
ITS2
Ceratozamia robusta
Ceratozamia sabatoi
Ceratozamia vovidesii
Ceratozamia whitelockiana
Ceratozamia zaragozae
Ceratozamia zoquorum
Zamia cremnophila
Zamia cunaria
Zamia elegantissima
Zamia fischeri
Zamia furfuracea
Zamia herrerae
Zamia inermes
Zamia integrifolia
Zamia katzeriana
Zamia lacandona
Zamia loddigesii
Zamia manicata
Zamia paucijuga
Zamia polymorpha
Zamia prasina
Zamia pseudoparasitica
Zamia purpurea
Zamia pygmea
Zamia soconuscensis
Zamia spartea
Zamia standleyi
Zamia tuerckheimii
Zamia variegata
Zamia vazquezii
152
Table 3
Combination of loci
psbK-psbI
psbK-psbI + atpF-atpH
psbK-psbI + atpF-atpH + rpoC1
psbK-psbI + atpF-atpH + rpoC1+ rpoB
psbK-psbI + atpF-atpH + rpoC1+ matK
psbK-psbI + atpF-atpH + rpoC1+ matK+ITS
psbK-psbI + atpF-atpH + rpoC1+ITS2
Ceratozamia Brongn.
4/23
9/23
9/23

12/23
18/23

153
Dioon Lindl.
8/14
11/14
11/14
11/14



Zamia L.
12/24
15/24
16/24



18/24
Table 4
No.
1
2
3
4
5
6
7
8
9
10
11
Species exemplar for each genera in the order
Cycadales
Bowenia serrulata (W. Bull) Chamb.
Ceratozamia latifolia Miq.
Chigua restrepoi D. W. Stev.
Cycas couttisiana K. D. Hill
Dioon caputoi De Luca, Sabato & Vázq. Torres
Encephalartos natalensis R.A. Dyer & I. Verd.
Lepidozamia peroffskyana Regel
Macrozamia fawcetii C. Moore
Microcycas calocoma (Miq.) A. DC.
Stangeria eriopus (Kunze) Baill
Zamia soconuscensis Schutzman, Vovides & Deghan
psbK-psbI
19
7
0
46
7
16
0
28
0
54
1
atpF-atpH rpoC1
0
0
0
43
0
3
0
12
19
—
3
154
1
0
0
9
1
1
0
1
0
10
1
Figure 1
155
Figure 2
156
CAPITULO IV
Discusión y conclusiones
157
DISCUSIÓN Y CONCLUSIONES
1. Implicaciones taxonómicas
Históricamente Zamia ha sido considerado como uno de los géneros más complejos de
caracterizar, morfológica y ecológicamente, dentro del orden Cycadales (Norstog y
Nicholls, 1997); y a su vez, el último trabajo taxonómico para el género presentado por
Schuster (1932), fué muy criticado por el escaso material revisado (de herbario y trabajo
de campo) y por errores nomenclaturales adoptados en su monografía (ver Sabato,
1990; Stevenson, 1987; 1991a, b; 1993; 2001a, b; 2004; Stevenson y Sabato, 1986;
Norstog y Nicholls, 1997, Nicolalde-Morejón et al., 2009a). Bajo este contexto, en la
presente tesis doctoral se abordó la tarea de caracterizar morfológica y molecularmente
a las especies del género Zamia en Megaméxico, abriendo la discusión sobre dos
tópicos estrechamente relacionados como son el proceso de identificación y
determinación y el esclarecimiento de la taxonomía y nomenclatura del género.
Los problemas nomenclaturales y la intrincada taxonomía del género, han sido
analizados en función de la escasa disponibilidad de caracteres vegetativos diagnóstico
para identificar especies y sus implicaciones nomenclaturales. Sin embargo, los
resultados aquí alcanzados, nos muestran que todas las especies de Zamia endémicas a
Megaméxico, pueden ser caracterizadas mediante la combinación de atributos
morfológicos vegetativos y reproductivos, los cuales funcionan como diagnósticos (ver
clave dicotómica y descripciones de las especies en el capítulo II). No obstante, el
problema con las especies (complejo Z. loddigesii Miq., ver Capítulo I) de amplia
distribución geografíca y que a su vez presentan alta variación morfológica entre
poblaciones, necesita ser más estudiado, por lo que considero necesario evaluar la
158
variación morfológica a nivel poblacional y la inclusión de datos moleculares
(secuencias de DNA), como una nueva fuente de evidencia que corrobore o refute la
hipótesis de la presencia de 22 especies de Zamia para Megaméxico.
2. Códigos de barras moleculares y la taxonomía del genero Zamia
En el ámbito de la taxonomía alfa, la biblioteca de referencia de códigos de barras
moleculares para las cycadas mexicanas y particularmente el género Zamia, abre la
puerta para identificaciones rápidas y revisiones críticas de la circunscripción de
especies, circunscripción que está fuertemente sustentada por análisis morfológicos
publicados recientemente (Nicolalde-Morejón et al., 2009a). Acorde con DeSalle
(2006), la inclusión de un nuevo set de datos (secuencias de DNA) para la identificación
de especies, no viola ningún contenido intelectual de la taxonomía, por el contrario, esta
fuente de evidencia (DNA Barcoding) ofrece una nueva hipótesis sobre la taxonomía de
un grupo. Además, posteriormente estos datos serían incluidos como parte de la
diagnosis de las especies en estudio.
Los datos aquí presentados (ver capítulo III) indican que las sugerencias recientes
acerca de un ‘límite intrínseco’ de que con poco más del 70% de discriminación exitosa
de especies con códigos de barras moleculares (ver, por ejemplo, Seberg y Petersen,
2009) deben ser consideradas como un éxito en la identificación de las mismas. El
análisis crítico de nuestros datos, nos permite afirmar que las regiones del genoma que
hasta el momento parecen estar ubicándose como los candidatos más fuertes para ser
‘códigos de barras universales’ en las plantas vasculares (ver, por ejemplo, Lahaye et
al., 2008; Ford et al., 2009) no necesariamente funcionan de manera óptima para un
importante subgrupo de gimnospermas neotropicales, y que su vez tampoco podrían
159
coincidir exactamente con la última recomendación de considerar a los genes matK y
rbcL como potenciales barcodes universales en plantas (CBOL Plant Working Group,
2009). Por el contrario, considero que combinaciones de DNA barcodes locales, como
los aquí expuestos (ver Capítulo III) deberían ser considerados, siendo este uno de los
aportes más importantes de esta tesis.
También considero que con un muestreo igualmente diverso, debe evaluarse la
posible sobre-estimación de la diversidad de especies en aquellos grupos donde
claramente no se alcance un 100% de identificación inequívoca, como es el caso de las
cycadas mexicanas. Para este efecto, recomiendo el uso de la estrategia recientemente
puesta en práctica para la descripción de Dioon stevensonii (Nicolalde-Morejón et al.,
2009b), en la cual se evalúan diferentes fuentes de evidencia siguiendo el concepto de
‘Iluminación recíproca’. En última instancia, estrategias de ‘taxonomía integrativa’
(sensu DeSalle et al., 2005) como la ejemplificada en la propuesta de dicha nueva
especie de Dioon serán útiles para contribuir a la discusión sobre las diferencias entre
‘DNA barcoding’ y ‘DNA taxonomy’, recientemente discutidas en la literatura sobre
aspectos conceptuales del ‘renacimiento taxonómico’ (ver, por ejemplo, DeSalle, 2005)
que la iniciativa internacional de códigos de barras de DNA promete hacer realidad en
el siglo XXI.
Finalmente, considerando que esta tesis ha dado lugar a nuevas preguntas y con el
objetivo de continuar con estos avances, considero pertinente reconocer que son
necesarios más estudios de campo, exploraciones dirigidas a incrementar el
conocimiento de la historia natural de muchas especies, en especial de aquellas
conocidas únicamente desde las localidades tipo. Al mismo tiempo queda pendiente un
estudio detallado para el género a nivel poblacional con una orientación molecular,
donde se evalué a detalle la variación nucleotídica. Estos resultados servirán de soporte
160
para el establecimiento definitivo de la biblioteca molecular de referencia taxonómica,
la cual constituye la base para el objetivo primario de los códigos de barras de DNA: la
identificación automatizada, confiable, de cualquier ejemplar del género en
Megaméxico que se presente, aún sin información taxonómica asociada, y su
ampliación hacia actividades aplicadas útiles para diagnosticar la identidad taxonómica
de plantas decomisadas a saqueadores y/o traficantes.
Desde mi perspectiva, los esfuerzos internacionales por construir bibliotecas de
referencia moleculares para todas las especies de plantas bajo la óptica del los ‘códigos
de barras de DNA’ (“DNA barcoding”), debería considerar en primera instancia, el
incentivo necesario para desarrollar mas estudios monográficos, estudios que
representan la base para el buen funcionamiento de esta nueva iniciativa de
identificación de especies. En definitiva, la perspectiva aquí planteada del ‘DNA
Barcoding’ es coherente con lo expuesto por varios autores sobre aspectos filosóficos
del ‘renacimiento taxonómico’, y que en un futuro cercano este acercamiento se
convertirá en una herramienta robusta de apoyo para futuras investigaciones y proyectos
de taxonomía alfa y de conservación de las especies de cycadas del neotropico.
3. Literatura citada
CBOL Plant Working Group. Hollingsworth, P. M., L. L. Forrest, J. L. Spouge, M.
Hajibabaei, S. Ratnasingham, M. van der Bank, M. W. Chase, R. S. Cowan, D. L.
Erickson, A. J. Fazekas, S. W. Graham, K. E. James, Ki-Joong Kim, W. J. Kress,
H. Schneider, J. van AlphenStahl, S. C. H. Barrett, C. van den Berg, D. Bogarin,
K. S. Burgess, K. M. Cameron, M. Carine, J. Chacón, A. Clark, J. J. Clarkson, F.
Conrad, D. S. Devey, C. S. Ford, T. A. J. Hedderson, M. L. Hollingsworth, B. C.
Husband, L. J. Kelly, P. R. Kesanakurti, J. S. Kim, Y. D. Kim, R. Lahaye, H. L.
161
Lee, D. G. Long, S. Madriñán, O. Maurin, I. Meusnier, S. G. Newmaster, ChongWook Park, D. M. Percy, G. Petersen, J. E. Richardson, G. A. Salazar, V.
Savolainen, O. Seberg, M. J. Wilkinson, D. K. Yi, y D. P. Little. 2009. A DNA
barcode for land plants. Proceedings of the National Academy of Sciences USA
106: 12794-12797.
DeSalle, R., M. G. Egan, y M. Siddall. 2005. The unholy trinity: taxonomy, species
delimitation and DNA barcoding. Philosophical Transaction of the Royal Society
B 360: 1905-1916.
DeSalle, R. 2006. Species discovery versus species identification in DNA barcoding
efforts: response to Rubinoff. Conservation Biology 20: 1545-1547.
Ford, C. S., K. L. Ayres, N. Toomey, N. Haider, J. van Alphen Stahl, L. J. Kelly, N.
Wikström, P. M. Hollingsworth, R. J. Duff, S. B. Hoot, R. S. Cowan, M. W.
Chase, y M. J. Wilkinson. 2009. Selection of candidate coding DNA barcoding
regions for use on land plants. Botanical Journal of the Linnean Society 159: 1-11.
Lahaye, R., M. van der Bank, D. Bogarin, J. Warner, F. Pupulin, G. Gigot, O. Maurin,
S. Duthoit, T. G. Barraclough, y V. Savolainen. 2008. DNA barcoding the floras
of biodiversity hotspost. Proceedings of the National Academy of Sciences (USA)
105: 2923-2928.
Nicolalde-Morejón, F., A. P. Vovides, y D. W. Stevenson. 2009a. Taxonomic revision
of Zamia in Mega-Mexico. Brittonia. DOI 10.1007/s12228-009-9077-9.
Nicolalde-Morejón, F., F. Vergara-Silva, J. González-Astorga, A. P. Vovides, y A.
Espinosa de los Monteros. 2009b. Reciprocal illumination of morphological
characters upon a molecular hypothesis supports the proposal of a new species of
cycad from Mexico. Systematics and Biodiversity 7: 73-79.
162
Norstog, K. y T. J. Nicholls. 1997. The Biology of the Cycads. Cornell University
Press, Ithaca, Nueva York.
Sabato, S. 1990. West Indian and South American cycads. Memoirs of the New York
Botanical Garden 57: 173-185.
Schuster, J. 1932. Cycadaceae. Das Pflanzenreich 99:1-168. Wilhelm Engelmann,
Leipzig.
Seberg, O., y G. Petersen. 2009. How many loci does it take to DNA barcode a Crocus?
PLoS ONE 42: e4598.
Stevenson, D. W. 1987. The West Indian Zamias. Fairchild Tropical Garden
Bulletin.42: 23-27.
———. 1991a. Flora of the Guianas. Serie. A. Fascicule 9: 7-11.
———. 1991b. The Zamiaceae in the Southeastern United States. Journal of the Arnold
Arboretum, Supplemental Series 1: 367-383.
———. 1993. The Zamiaceae in Panama with comments on phytogeography and
species relationships. Brittonia 45: 1-16.
———. 2001a. Orden Cycadales. Flora de Colombia. Monografía No. 21. Editorial
Unibiblos. Bogotá D.C.
———. 2001b. Zamiaceae. Flora Nicaragua 1: 6-7.
———. 2004. Zamiaceae of Bolivia, Ecuador, and Perú. En Walters, T. y R. Osborne
(eds.), Cycad Classification: Concepts and Recommendations. Pp. 173-194.
CABI Publishing, Wallingford, Inglaterra.
——— y S. Sabato. 1986. Typification of names in Zamia L. and Aulacophyllum
Regel. (Zamiaceae). Taxon 35: 134-144.
163