Differentiation of Begomoviruses and Bemisia tabaci biotypes using

Comments

Transcription

Differentiation of Begomoviruses and Bemisia tabaci biotypes using
Differentiation of Begomoviruses infecting
tomato crops and Bemisia tabaci biotypes
using real time PCR
Lambros C. Papayiannis1 and Nicolaos I. Katis2
Agricultural Research Institute, Nicosia, Cyprus
2 Aristotle University of Thessaloniki, Greece
1
Tomato yellow leaf curl disease (TYLCD)
TYLCD is one of the most devastating viral diseases of tomato,
causing severe damage and heavy losses in many tropical and
subtropical regions of the world
EPPO 2005
Symptomatology on tomato plants
Young plants
9 Severe stunting
9 Bushy appearance
9 Small, puckered and distorted leaves
9 Downwards leaf curling
9 Interveinal chlorosis
9 Usually produce unmarketable fruits
Symptomatology on tomato plants
Older plants
9 Abnormal growth above
point of infection
9 Some flowers may fall
or fail to set fruits
TYLCD Host Range
Cultivated plants
Phaseolous vulgaris
>100 Weed plants
Capsicum annuum
Causal agents of TYLCD
9 Several virus species have been shown to be the causal agents of the
disease worldwide, all assigned in the genus Begomovirus of the family
Geminiviridae
9 EPPO region: two main species and two recombinants
Tomato yellow leaf curl virus
(TYLCV)- also known as Israel type
Tomato yellow leaf curl Sardinia
virus (TYLCSV)- Sardinia type
Tomato yellow leaf curl Malaga virus (TYLCMaV)
Tomato yellow leaf curl Axarquia virus (TYLCAxV)
Bemisia tabaci Genadius
9 The whitefly vector Bemisia tabaci transmits Begomovirus species in
a persistent, circulative manner
9 First reported in 1889 by Gennadios infesting tobacco (Aleurodes
tabaci)
1980 – today Has spread around the globe, infesting vegetable,
ornamental, fiber crops and many other arable and weed plants
1160 different species of whiteflies have been identified so far
and B. tabaci is considered to be among the most important ones
9
9
9
9
9
Polyphagous – colonizes > 600 Eudicots
High reproductive capacity (11-15 generations per year)
Adapts and spreads very easy
High genetic polymorphism - Biotypes
Insectiside resistance
¾ Direct damages – feeding
activity
¾ Indirect damages –Transmission >100 plant viruses
Detection methods of Begomoviruses involved in TYLCD
• Serology
• Molecular Hybridization
• Loop Mediated Isothermal Amplification
• Polymerase chain reaction (specific primers, RFLP, SSCP)
• qPCR assay for quantitation of TYLCSV
Detection methods currently used for identification of
Bemisia tabaci biotypes
• Polymerase chain reaction – RFLP, RAPD
• Sequencing analysis of mtCOI gene
• Microsatellite analysis
AIM OF THIS STUDY
¾ Development and validation of primers and probes for the
detection and differentiation of viruses and vectors involved in
Tomato yellow leaf curl disease epidemics using Real-Time
TaqMan PCR technology
¾ Identify the incidence and prevalence of Begomoviruses and
Bemisia tabaci biotypes in Greece and Cyprus
Materials and Methods
Probe TYLCV TAQ
PRIMER TYLCV R
PRIMER TYLCV F
PRIMER TYLCSV F
Probe TYLCSV TAQ
PRIMER TYLCSV R
Materials and Methods
9 Begomovirus Isolates
9 DNA extraction
9 Polymerase chain reaction (PCR): TY(+)/TY(-) primers followed by RFLP
analysis – AvaII (Accotto et al. 2001) – EPPO Protocol
9 Multiplex PCR primers AC1048/AV632/AC950 (Martinez-Culebras et al. 2001)
9 Results were compared to the Real Time PCR assay
Materials and Methods
¾ B. tabaci samples were collected from Greece, Cyprus,
Israel, Spain, Italy, Mexico, USA
DNA was extracted from females
Charge Switch® magnetic bead technology
Partial amplification and sequencing analysis
cytochrome oxidase I gene (Frohlich et al., 1999)
of
mitochondrial
Partial amplification and RFLP analysis of mitochondrial cytochrome
oxidase I gene (Bosco et al., 2003)
Materials and Methods
Primers and Probes were designed for
Real Time TaqMan PCR tests
BIOTYPE Q
BTQ-F: AATGCCTCGCCGATATTCAG
BTQ-R: AATCCTTCCCGCAGAAGAAATT
BTQ-T: TexasRed-TTATGCTGATTGTTATCTAGTATGGAACA-BHQ
BIOTYPE B
BTB-F: GGTATTTGGAAGGTTGGGTATAATTTAT
BTB-R: ACTGTGAATATATGATGACCTCAAACAA
BTB-T: FAM-CTATATTGACTATTGGTATTCTAGGGTTT-BHQ
Results
Identification of TYLCV and TYLCSV using reported protocols
TYLCV
II)
Multiplex PCR
TYLCV/TYLCSV
TYLCV-Sar
Λακωνία
TYLCV-Isr
Κύπρος
RFLP (Ava
302 ζβ
360 ζβ
TYLCSV-Sardinia
150 ζβ
TYLCV-Isr
277 ζβ
TYLCSV
68 ζβ
1
2
3
4
5
6
7
1
2 3 4 5
6 7 8 9 10 11 12
Multiplex detection of TYLCV/TYLCSV
with Real-Time TaqMan PCR
TYLCSV
TYLCV
PCR-RFLP results from B. tabaci
samples
Bemisia tabaci
Biotype Β
Bemisia tabaci
Biotype Q
Multiplex detection of B and Q biotypes
B. tabaci with Real-Time TaqMan PCR
Q-like biotypes
Cyprus
Greece
Israel
Spain
USA
B biotypes
Α-Biotype
T.vaporariorum
Papayiannis et al., 2009 Bulletin of Entomological Research
Summary
¾ A real time PCR assay was developed for multiplex detection
and differentiation of Begomoviruses involved in TYLCD
¾ The assay is extremely sensitive (>100 times from
conventional PCR), specific and suitable for typing large numbers
of field crops and weeds
¾ A TaqMan PCR assay for rapid discrimination of Bemisia tabaci
biotypes B and Q was also developed and evaluated for several
whitefly individuals from different geographical regions
¾ Both assays were successfully used in a large scale survey for
identification of the virus species and vectors involved in TYLCD
in Greece and Cyprus
Summary
¾ In Greece both TYLCV and TYLCSV coexist
¾ In Cyprus TYLCV is the only Begomovirus related to TYLCD
¾ In Cyprus B. tabaci biotype B and possibly Q are involved to
TYLCD
¾ In Greece biotype Q is the predominant type. B biotype is
reported for the first time in Rhodes island
¾Other B. tabaci -transmitted viruses are found in countries
neighboring EU and new strategies for managing the whiteflyvirus complex should be developed and adopted
Acknowledgements
9 Prof. J.K.Brown, University of Arizona
9 All those who have supplied Begomovirus-infected
material and whitefly samples for our studies
Dr L. Tomassoli (Istituto Sperimentale per la Patologia Vegetale, Rome, Italy),
Dr. J. Morris (Central Science laboratory, York, UK), Prof. Gutierrez and A.
Alvaro-Fernandez (Instituto Agrofestal DelMediterraneao, Valencia, Spain),
Prof. A. M. Idris (University of Arizona), Dr G. Anfoka (Faculty of Agricultural
Technology, Al-Balqa’ Applied University, Jordan), Mr. A. Paraskevopoulos
(Directorate of Agriculture, Kyparissia, Greece), Dr. Horowitz, Israel
9 Cyprus Research Promotion Foundation for funding
this study
Thank you!

Similar documents