Trouble Makers - Dana-Farber Cancer Institute

Transcription

Spring/Summer 2013
Research and Care at Dana-Farber Cancer Institute
Trouble
Makers
picking out
the mutations
that matter
Including the 2012
Annual Report
PLUS: multiple myeloma research • tech shortcuts • treating young adults
Dana-Farber Cancer Institute ...
“Dedicated to discovery ... committed to care” is the mission
of Dana-Farber Cancer Institute (DFCI), described as one of
the world’s premier cancer centers by the National Cancer
Institute. Founded in 1947 by Sidney Farber, MD, DanaFarber is renowned for its unique blend of basic and clinical
research and for using its discoveries to improve the treatment of adults and children with cancer and related diseases.
It is a founding member of the Dana-Farber/Harvard Cancer
Center – one of 41 nationally designated Comprehensive
Cancer Centers. A teaching affiliate of Harvard Medical
School, Dana-Farber is also one of 21 federal Centers for
AIDS Research in the United States, and is consistently
ranked one of the top cancer centers in the country by U.S.
News & World Report. In addition, it has earned “Magnet”
status for excellence in nursing.
Dana-Farber partners with Brigham and Women’s Hospital
to deliver care for adults with cancer through Dana-Farber/
Brigham and Women’s Cancer Center. It also has a long
standing alliance with Boston Children’s Hospital to care
for pediatric cancer patients through Dana-Farber/Children’s
Hospital Cancer Center. By bringing together the strengths of
three world-class institutions, these partnerships provide an
exceptional level of care for cancer patients and their families.
Spring/Summer 2013
Volume 22, Number 1
President and CEO, Dana-Farber Cancer Institute Edward J. Benz Jr., MD
Chief Financial Officer and Assistant Treasurer Karen Bird, MPH
Chair, Psychosocial Oncology and Palliative Care Susan D. Block, MD
Senior VP and General Counsel Richard S. Boskey, Esq.
Chief Medical Officer Craig Bunnell, MD, MPH, MBA
Senior VP for Experimental Therapeutics George Demetri, MD
Senior VP for Research Beverly Ginsburg Cooper, MBA
Chair, Medical Oncology James D. Griffin, MD
Chair, Radiation Oncology Jay R. Harris, MD
Senior VP for Human Resources Deborah Hicks, MA
Chief Quality Officer Joseph O. Jacobson, MD, MSc
Chief Clinical Research Officer Philip W. Kantoff, MD
Senior VP for Experimental Medicine Lee M. Nadler, MD
Chair, Pediatric Oncology Stuart H. Orkin, MD
Senior VP for Institute Operations Maria Papola, MHA
Senior VP for Development Susan S. Paresky, MBA
Executive VP and Chief Operating Officer Dorothy E. Puhy, MBA
Senior VP for Patient Care Services, Chief Nurse Patricia Reid Ponte, RN, DNSc, FAAN
Chief Scientific Officer Barrett J. Rollins, MD, PhD
Chief of Staff Emeritus Stephen E. Sallan, MD
Chief of Staff, Senior VP of Medical Affairs, Director of Regional Development,
and Director of Center for Global Cancer Medicine Lawrence N. Shulman, MD
... and the Jimmy Fund
Senior VP for Communications Steven R. Singer, MPA
The Jimmy Fund (www.JimmyFund.org) solely supports
Boston’s Dana-Farber Cancer Institute, raising funds for
adult and pediatric cancer care and research to improve the
chances of survival for cancer patients around the world.
This year celebrates the 60th anniversary of the Jimmy Fund
and Boston Red Sox relationship, and represents one of the
most remarkable partnerships between a team and a charity
in the history of professional sports. The Jimmy Fund is
also the official charity of the Massachusetts Chiefs of
Police Association, the Pan-Massachusetts Challenge, and
the Variety Children’s Charity of New England. Since 1948,
the generosity of millions of people has helped the Jimmy
Fund save countless lives and reduce the burden of cancer for
patients and families worldwide. Follow the Jimmy Fund on
Facebook (www.facebook.com/thejimmyfund) and on Twitter
(@TheJimmyFund).
10% of all designated gifts supports our Faculty Research
Fund to advance Dana-Farber’s research mission.
®
Chief Surgical Officer Scott J. Swanson, MD
Chief of Radiology Annick D. Van den Abbeele, MD
Editor Michael Buller
Design John DiGianni
Associate Editor Robert Levy
Managing Editor Eric Schuller
Production Jacqueline Czel, Jessica Walker
Photographer Sam Ogden
Writers Christine Cleary, Elizabeth Dougherty, Naomi Funkhouser, Richard Saltus,
Saul Wisnia
Additional Photography Getty Images, Manalis Lab MIT, NCI Visuals, Aarron Washington
Paths of Progress is published twice a year by Dana-Farber
Cancer Institute. If you have any comments or would like to
be removed from the mailing list, please contact:
Michael Buller, Editor, Paths of Progress
Dana-Farber Cancer Institute, Dept. of Communications
450 Brookline Ave., OS301
Boston, MA 02215
617-632-4090
[email protected]
Copyright © 2013 Dana-Farber Cancer Institute. All rights reserved.
CONTENTS
Features
Departments
10 Trouble Makers
3 Around the Institute
In tumor cells with hundreds of
gene mutations, investigators must
identify which ones are guilty of
driving cancer growth.
16 Man on a Mission
Ken Anderson, MD, has helped
transform multiple myeloma from
an often fatal disease to, in many
cases, a chronic, manageable illness.
20 Science Illustrated
Gene mutations or abnormalities can
spur cancer growth, but these same
mutations may leave cells vulnerable
to cleverly designed therapies.
A free nutrition app for your iPhone, 20 years of pediatric
survivorship, and more news from Dana-Farber.
7 Six Questions for ... Craig Bunnell, MD, MPH
Dana-Farber Chief Medical Officer Craig Bunnell explains
how a business background helps strengthen and inform
his work in cancer care.
8 Bench to Bedside
Massimo Loda, MD, PhD, and Mary Ellen Taplin, MD,
pursue new treatments for prostate cancer.
31 Tech Preview: Mass Spectrometry
Scientists use an advanced imaging system to aid
research into brain tumors and drug delivery.
32 Why I Work Here
Nutritionist Stacy Kennedy, MPH, RD, helps patients
learn how to follow a healthy diet during treatment.
33 What I Know
A father reflects on lessons learned from his young son’s
journey back from a rare cancer.
34 Legislative Update
22 Young Lives on Hold
Caring for young adults means
treating their unique clinical and
emotional needs.
26 Search for Shortcuts
New medical tools may speed drug
development and, in the process, offer
better treatments for brain tumors.
New oral chemo law benefits Massachusetts patients.
35 2012 Dana-Farber Annual Report
22
From the President
Dear Readers,
It has always been the hope of cancer patients that
if no drug or other treatment can cure their disease,
existing therapies can extend their lives long enough for
scientists to develop new and better treatments. For too
many patients, for too many years, that hope failed to
materialize. Improved therapies didn’t arrive quickly
enough to help patients in need of them.
In recent years, however, as we’ve learned more about
the basic biology of cancer and moved ever more agents
into clinical testing, that pattern has begun to change.
Increasingly, when a drug fails to work or loses its
effectiveness after a period of months or years, there
are new treatments available, often as part of a clinical
trial. It is in this regard that cancer is gradually changing
from an acute disease to a chronic one – one that can be
lived with, and carefully managed, for the long term.
There may be no one in medicine whose career better
exemplifies this trend than Dana-Farber’s Ken Anderson, MD, PhD, profiled in this issue of
Paths of Progress. Specializing in the bone marrow cancer multiple myeloma – and leader of
a lab with a prodigious scientific output – Ken has often told patients that if they aren’t helped
by a particular therapy, he’s working on new agents in the lab that may work better. His success has helped turn a disease that once was almost invariably fatal to one that is, for some
patients, a chronic condition.
Ken’s work is a model, and an inspiration, for researchers in many other types of cancer.
One example is glioblastoma, a form of brain cancer which, as you’ll read in this issue, is a
focus of intense effort at Dana-Farber to identify molecular targets for new therapies. The
search for new treatments also motivates scientists’ efforts to distinguish “driver” genetic
mutations, which propel the growth of cancer cells, from “passenger” mutations, which are
bystanders to the cancer process – the subject of another article.
Your interest in, and support of, our work at Dana-Farber is what makes these advances
possible. I hope you find this issue of Paths of Progress enlightening and intriguing.
Edward J. Benz Jr., MD
President and CEO, Dana-Farber Cancer Institute
2 P at h s
of
Progress
Spring/Summer 2013
www.dana-farber.org
Around the Institute
Red Sox and the Jimmy Fund
Celebrate 60 Years
Recipes and Photos
for Your iPhone
This year marks the 60th anniversary of the historic partnership between
the Boston Red Sox and the Jimmy Fund, which supports adult and pediatric
cancer care and research at Dana-Farber Cancer Institute. The milestone
anniversary will be highlighted during the 2013 baseball season with activities
and events, including the first
annual Jimmy Fund Chorus
and Jimmy Fund Month at
Fenway Park in August.
The Jimmy Fund Chorus
will sing at select Jimmy Fund
events throughout the year.
This ensemble will include
current and former patients
and their family members,
Dana-Farber staff, friends,
and those who have been
touched by cancer. This is a
special way to celebrate the
historic Red Sox-Jimmy Fund
partnership.
The celebration continues in August when Fenway
Park celebrates Jimmy Fund
Month. Events and activities
will include the WEEI/NESN
Jimmy Fund Radio-Telethon
Xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
held Aug. 27 and 28, featuring interviews with Dana-Farber patients, families,
care providers, and scientists, as well as Red Sox manager John Farrell.
Dana-Farber now offers two free
apps for iPhones and iPads, one
designed to help patients maintain
a healthy diet and another aimed at
showcasing photos that convey the
spirit of Dana-Farber patients, staff,
and volunteers.
Ask the Nutritionist: Recipes for
Fighting Cancer offers more than
100 healthy recipes, ranging from
snacks to entrees and desserts. It also
provides preparation directions, the
ability to create a shopping list, nutrition tips, and nutritional information
in a standard USDA label format.
A diet section provides recipes
with foods that
are gluten-free
or high-fiber, or
provide immune
support. Users can
search recipes by
symptoms commonly associated with
cancer treatment,
such as nausea or
mouth sores, helping
them customize a diet
while going through
treatment. The app also
has tips for cancer survivors or anyone looking
to make healthy food choices. New
recipes are added each month.
The photography app, Portraits of
Care, captures glimpses of the cancer
journey using images taken at DanaFarber designed to convey hope,
inspiration, discovery, care, compassion, and collaboration. New images
are added monthly.
To download either app, search
for “Dana-Farber” in the iTunes
App Store.
In the News
Stuart H. Orkin, MD, chairman of the Department of Pediatric
Oncology at Dana-Farber/Children’s Hospital Cancer Center, received
the Jessie Stevenson Kovalenko Medal at the National Academy of
Sciences’ 150th annual meeting in April.
Jane deLima Thomas, MD, a palliative care physician and associate director of the Harvard Palliative Medicine Fellowship Program at
Dana-Farber, was one of five U.S. physicians to receive the 2013 Hastings Center Cunniff-Dixon Physician Award.
Dana-Farber researcher Kornelia Polyak, MD, PhD, was presented
with the American Association for Cancer Research’s 2012 Outstanding Investigator Award for Breast Cancer Research at the San Antonio
Breast Cancer Symposium.
Spring/Summer 2013 P a t h s
of
Progress
3
A closer look at a few of the thousands of words associated with the
complex fields of cancer medicine
and research.
androgen: A hormone, such
as testosterone or androsterone,
that controls the development
and maintenance of masculine
sex characteristics.
atypical teratoid rhabdoid tumor
(AT/RT): A rare, aggressive cancer
that affects the kidney, liver, or
central nervous system. It usually
occurs in very young children.
Ewing sarcoma: A relatively rare
cancer that forms in bone or soft
tissue, affecting mainly children
and adolescents.
Judy Garber, MD, MPH
Garber Gets Nod from White House
Judy Garber, MD, MPH, director of the Center for Cancer Genetics and
Prevention at Dana-Farber/Brigham and Women’s Cancer Center, was
recently appointed to the National Cancer Advisory Board by President
Barack Obama. She will serve a six-year term on the 18-member committee,
which advises the Department of Health and Human Services secretary and
the National Cancer Institute (NCI). The committee reviews applications for
grants and recommends approval of applications for projects that demonstrate
potential for valuable contributions to cancer research and knowledge.
In her work at Dana-Farber, Garber has helped develop national guidelines
in genetics testing and medical oncology. Her research includes the study of
breast cancer risk assessment, cancer genetics, and the treatment of triplenegative breast cancer. She served on the NCI’s Board of Scientific Counselors from 2007-2012 and she is the immediate past president of the American
Association for Cancer Research.
4 P at h s
of
Progress
Spring/Summer 2013
Lupron: Also known as leuprolide
acetate, this drug is used primarily
to treat advanced prostate cancer.
The drug’s active ingredient (leuprolide) blocks the body’s production
of the male hormone testosterone
and the female hormone estradiol.
metabolite: A substance created by
or used for metabolism (when the
body breaks down food, drugs or
chemicals to create energy and the
materials needed for growth, development, and reproduction).
osteosarcoma: A bone cancer that
most often affects the large bones
of the arm or leg. It tends to occur
in young people and affect more
males than females.
www.dana-farber.org
CANCER DICTIONARY
Cancer Death Rates Keep Dropping
A recent report from the nation’s leading cancer organizations shows that
death rates from all cancers for American men and women continued to
decline between 2000 and 2009. The findings come from the latest Annual
Report to the Nation on the Status of Cancer.
Dana-Farber President and CEO
Edward J. Benz Jr., MD, says that while
improvements are needed, the results
are encouraging. “People are surviving
more and we are getting better at preventing some cancers,” said Benz. “But
we’re not taking advantage of all the
ways to detect cancers at an early stage
when they can be the most curable.”
The overall cancer incidence rate
decreased for men and remained stable
for women. While cancer incidence
rates among children age 14 or younger
increased slightly (0.6 percent each year
from 1992 through 2009), overall death
rates for cancer among children have
steadily declined since at least 1975.
Noting that there is plenty of work to be done to continue this trend, Benz
said that the good news is that prevention strategies such as vaccinations for
human papillomavirus (HPV) can have a big effect on incidence and death
rates. “Many of the things that are still a problem in these statistics can be
changed,” said Benz.
Paths of Progress
on
Download our free app to read the
latest cancer research and treatment
advances on your tablet device (iPad
or Android) or e-reader (such as a
Kindle or Nook).
The interactive edition of Paths
of Progress includes all of the content from the print issue, along with
digital-only extras, including photo
galleries, videos, and more.
An Immunology
‘Dream Team’
Dana-Farber researchers Glenn
Dranoff, MD, Stephen Hodi, MD, and
Kai Wucherpfennig, MD, PhD, were
recently named recipients of a scientific
“Dream Team” grant in cancer immunology from Stand Up to Cancer. The
team, which includes scientists at eight
cancer centers nationwide, will receive
$10 million over three years to explore
two therapies that harness the immune
system to combat cancer. One focuses
on a drug that may help heighten the
response at immune checkpoint blockades – areas that maintain tight control
over the body’s response to disease. The
other involves transfusing disease-fighting T cells into patients with cancer.
“The hope is to accelerate the development of new and more potent cancer
immunotherapies by bringing investigators together through this Dream
Team,” says Dranoff, leader of cancer
immunology at Dana-Farber/Harvard
Cancer Center.
Your Tablet
You can find the Paths of Progress
app on the iTunes app store or visit
the Android marketplace (search for
“cancer research”). You can also find
an e-reader version of the magazine
in the Kindle and Nook stores.
Links to the interactive versions,
along with a downloadable PDF, are
also available at www.dana-farber.org/
pathsofprogress.
of
Progress
5
A Milestone for Young Survivors
Twenty years ago, the idea of cancer survivorship was in its infancy. Only
a handful of programs offered expert follow-up care and wellness programs
for patients who had completed treatment. One of the first of these groundbreaking programs opened at Dana-Farber in 1993 in the form of the David B.
Perini Jr. Quality of Life Clinic, the pediatric survivorship program at DanaFarber/Children’s Hospital Cancer Center (DF/CHCC).
“Survivorship rates were starting to rise and we were just beginning to
understand the specific long-term issues that our young survivors faced,” says
Holcombe Grier, MD, professor of pediatrics at DF/CHCC, who served as
co-director of the Perini Clinic in 1993. “We saw that we needed a more controlled, unified way to address specific long-term issues.”
Today, an estimated 13.7 million Americans are cancer survivors, and the
demand for survivorship services is on the rise. Programs like those offered
through the Perini Clinic and Dana-Farber’s Adult Survivorship Program
give patients access to a range of experts, from psychologists to fertility and
cardiac care experts, who help address post-cancer challenges and concerns.
They provide childhood and adolescent cancer survivors access to the expertise, education, and support needed to manage key survivorship issues, including the long-term adverse effects of treatment, the risk of second cancers, and
social and psychological concerns. Such services are an integral part of care
at comprehensive cancer centers like Dana-Farber, and they have become an
expectation for most patients today.
“It’s remarkable to see how the conversation has changed,” Grier says.
“When I sit down with families and talk with them about a child’s new cancer
diagnosis, it’s no longer just about treatment. While much of the conversation
is ‘will my child survive?’, an almost equal amount is on ‘how will this affect
my child over the long term?’”
To learn more, visit www.dana-farber.org/perini-clinic.
Connect with Dana-Farber Online
Whether it’s through Facebook, YouTube, or Twitter, connecting with
Dana-Farber online has never been easier. You’ll find our “Insight” blog
at www.blog.dana-farber.org/insight, or keep in touch through your
favorite social networking sites, such as Google+, Pinterest, or YouTube.
Visit us online at www.dana-farber.org/socialmedia to find links to all
of our social media sites, then follow us to keep up with the Institute’s
latest news and research, while showing your support for vital research
and patient care.
6 P at h s
of
Progress
Spring/Summer 2013
BY THE
NUMBERS
19,614
Combined number of
hours donated last year by Dana-Farber
volunteers
721 Number of clinical trials open to
Dana-Farber patients in 2012
42 feet Length of new Blood Mobile
introduced in 2013 and made possible by
the Friends of Dana-Farber and Friends
of Brigham and Women’s Hospital
More than 3,000 Number of
tumor samples now classified in Profile,
an ambitious effort by Dana-Farber and
Brigham and Women’s Hospital to scan
tumor samples from all adult consenting
patients and identify the sets of DNA
mutations – or genotypes – that drive
tumor growth
$72,000 Amount donated by DanaFarber staff to patients and families
participating in the Institute’s Seasonal
Giving Program, a program to help ease
the financial burden of a cancer diagnosis
242 Registered nurses who staff
inpatient units at Dana-Farber/Brigham
and Women’s Cancer Center
5,234 Number of bicyclists who participated in the 2012 Pan-Massachusetts
Challenge (PMC), which raised more
than $37 million for the Jimmy Fund.
The event attracted cyclists from nine
countries and 36 states.
www.dana-farber.org
Six Questions For ...
Interview by Christine Cleary
Craig Bunnell, MD, MPH, MBA
“I love my job,” says Craig Bunnell, MD, MPH, MBA, Dana-Farber’s Chief
Medical Officer (CMO) since July 2012. Bunnell, a medical oncologist and
a former clinical director of the Breast Oncology Center, has been a faculty
member at Dana-Farber/Brigham and Women’s Cancer Center since 1997.
He is leading a major initiative aimed at making the experience of patients
smoother and more efficient. Bunnell explains how his background in medicine, public health, and business prepared him for this role.
Q: What does the CMO job entail?
A:
My charge is to make sure we
deliver high-quality, cost-effective,
efficient, and patient-centered care.
I engage physicians and collaborate
with other departments such as
Nursing, Human Resources, and
Finance – as well as our satellite
centers and partner institutions – to
see that we meet our research and
clinical care goals.
Q: How does your role support
Dana-Farber’s goals,
particularly those aimed
at quality improvement?
A: Quality improvement is a responsibility shared by all of us, and it
affects every aspect of the work
I do. Patients come here with the
belief that they will have a quality
experience. They expect their care
at Dana-Farber to be better than
what they would find elsewhere.
We have to deliver on this.
Q: Describe your vision for
effective patient care.
A:
This vision is for the best possible care to be given by the right
professional at the right time for the
patient. For example, if administrative work is handled by an administrative expert, then the program
nurse is freed up to do clinical
work, which in turn frees up the
physician assistants, nurse practitioners, and physicians. Each person is
doing what he or she does best, and
this way of working is standardized
across the Institute. In the end, the
patient has a better experience.
Q: How do you work with patients to
make improvements in care?
A: At Dana-Farber, patients are an inte-
gral part of the way we make changes. They are involved, as volunteers,
on every committee. We also receive
their feedback through surveys and
other means. Even complaints are a
way to learn. I write back to patients
all the time, and I thank them for
pointing out an opportunity for us
to improve.
Q: You have several degrees. How did
these areas of study prepare you
for your job?
A: I pursued an MPH [master’s degree
in public health] while in medical
school because I was interested in
health policy and clinical research
design. Later on, when I became
clinical director for breast oncology
here, I discovered how much I liked
organizational operations, so I went
to business school and it really energized me. Now I know how much we
can learn from other industries.
Xxxxxxxxxxxxxxxxxx
xxxxxxxxxxxxxxxxxx
xxxxx
Q: Do you still take care of patients?
A: Yes, I see breast cancer patients two
days a week. I love being a doctor,
and I consider patient care a critical
part of my role as CMO. This keeps
me close to the patient experience. I
only ask other clinicians to do what
I am willing to do myself.
of
Progress
7
Bench to Bedside
by ROBERT LEVY
R esearcher P rofile
A
thletes caught using performance-enhancing
drugs are betrayed by their own blood, which
carries chemical evidence of substances they’ve
ingested or injected. That evidence isn’t the drug itself,
but bits and pieces of it that have been split off and reassembled by the body in a process known as metabolism.
At Dana-Farber, Massimo “Max” Loda, MD, and his
colleagues are conducting equivalent exams on prostate
cancer cells, trying to discover how metabolism differs in
tumor cells and normal cells, and what those differences
Massimo Loda, MD, PhD
8 P at h s
of
Progress
can tell scientists about genes behind the disease.
“Metabolism is the process by which cells and tissues
break down nutrients and use them to grow, reproduce,
and perform their function within the body,” says Loda.
“My lab uses metabolism as a window into the genes that
cause and drive prostate cancer.”
His focus on metabolism was inspired by a discovery
about an enzyme, a protein that speeds chemical reactions in the cell. Half a dozen years ago, he and his
associates found that a long-overlooked enzyme known
as fatty acid synthase, or FAS, is essential for prostate
cancer cell survival. Blocking the enzyme in laboratory
cultures of prostate cancer cells caused the cells to die.
As an enzyme, FAS is deeply involved in cell metabolism. “The discovery of FAS’s role in prostate cancer
led us to the broader field of metabolic pathways – the
chain of events by which compounds are modified to
produce other products within the cell,” Loda says. His
team began making “metabolic
“We can see which
profiles” of normal and cancerous prostate cells, identifying the
metabolic pathways
molecules created as metabolism
are altered in prosproceeds and the levels at which
tate cancer cells
they’re produced.
and which are not.”
“We focus on the molecules –
or metabolites – that result from
enzymes’ action within cells,” Loda explains. He and
his associates found stark differences in the metabolic
profiles of normal prostate cells and prostate cancer cells
– differences that may hold clues to better treatments.
“We can see which metabolic pathways are altered in
prostate cancer cells and which are not,” Loda explains.
“We apply that information to what we’ve learned from
genomic research into the disease. We know, for example,
that prostate tumors driven by certain mutated genes
have distinct metabolic profiles. By combining the two
approaches, we hone in not only on cancer-causing genes,
but also on the metabolic pathways they change. Both the
genes and pathways can be targets for new therapies.”
Loda’s research has also shown that metabolic profiles can vary from one prostate tumor to another. Those
differences may serve as biomarkers, indicating which
prostate cancers are likely to respond to certain drugs,
and which are not.
Spring/Summer 2013
www.dana-farber.org
Bench to Bedside
by ROBERT LEVY
C linician P rofile
I
magine trying to extinguish a fire that burns even
after its oxygen supply has been cut off – a blaze with
the ability to produce its own oxygen. For doctors
and patients who battle aggressive prostate cancer, the
predicament is much the same.
Prostate tumors fuel their growth with the male hormone androgen, which is produced in the testes, the adrenal glands, and – most troublesomely – in the cancer cells
themselves. Drugs that shut down production of androgen
in the testes and adrenal glands can bring tumor growth
to a halt. But without a way to stop tumors from making
homegrown androgen, such remissions rarely last long.
Mary Ellen Taplin, MD, has spent more than 20 years
working to improve the options for men with prostate
cancer treated at Dana-Farber/Brigham and Women’s
Cancer Center. Last year, she and her colleagues scored
a major success with a clinical trial of a drug that ranges
far and wide to stifle androgen production in the body.
The trial involved 58 men
“This is the first trial with aggressive prostate
cancer tumors likely to
ever to show that
spread beyond the prostate
treating high-risk
gland. “Such tumors are
prostate cancer
rarely cured by surgical repatients ... can
moval of the prostate gland
alone,” Taplin says. “Therahave such a powerful
pies that combine surgery
clinical result.”
with older, androgen-blocking drugs haven’t had much of a positive impact on those
results. Research indicated a broader-acting anti-androgen agent might be more effective.”
Half of the trial participants received the standard hormone-blocking drug Lupron, and half received Lupron
and the study drug abiraterone acetate, which handcuffs
androgen production in the tumor as well as in the testes
and adrenal glands. After three months, all participants
began receiving the two-drug combination. Three months
later, all the men’s prostate glands were surgically removed. Pathology exams showed that 34 percent of the
participants had no or almost no tumor tissue left – a vast
improvement over conventional hormonal therapy.
“This is the first trial to show that treating high-risk
prostate cancer patients with neo-adjuvant therapy [in
which participants receive hormone or chemotherapy
prior to surgery] can have such a powerful clinical result,”
Taplin says. The next step will examine which dose and
combination of androgen-blockers has the best result.
The study results are, in a way, a vindication of the
promise that Taplin saw in prostate cancer research when
she entered the field in the early 1990s. “At the time,
much less was known about the role of the androgen
receptor [a protein on cells that switches their growth on
and off] in prostate cancer than about the role of estrogen
receptor in breast cancer,” she observes.
Mary Ellen Taplin, MD
of
Progress
9
Photo Illustration by Jessica Walker
10 P at h s
of
Progress
Spring/Summer 2013
www.dana-farber.org
Trouble Makers
by Robert Levy
picking out the genes that cause cancer
of
Progress
11
TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
CGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT
GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
ATCGTCGATCGATCGTCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
N
ot long ago, the task of linking a mutated gene to cancer could consume
the better part of a scientist’s career.
Today, it may take as long as a week.
Advanced DNA-sequencing technology can speedily deliver lists of
the mutations within a set of tumor
cells – the various misspellings, duplications, and garblings
of the genetic code
that can send cell
growth into overdrive. And impressive lists they can be.
If the cancer being
scanned is a
lymphoma
or leukemia, the
number
of muta-
12 tions may be less than a dozen. If
it’s a lung cancer or melanoma, the
figure is apt to be in the hundreds, if
not thousands.
The challenge for scientists, then,
has shifted from one of scarcity to
surplus. In tumor cells with, say,
1,000 mutations, the number of
mutations actually driving the cells’
growth and survival may be relatively small (though no one knows
how small). The remainder of the
mutations, regardless of where or
why they arose, have little influence
on the tumor’s behavior and are, essentially, along for the ride – hence
their name, “passenger” mutations.
When designing new cancer
drugs, investigators clearly want to
aim at the mutations responsible for
cancer cells’ chaotic growth. The
question then becomes how to distinguish drivers from passengers, the
legitimate targets from the decoys.
The mutations themselves offer few
clues: a typo in a single letter of
DNA can sometimes wreak havoc; a
gene copied multiple times over may
have no negative impact.
“For lung cancer and many other
cancers, we’re drinking from a firehose, trying to select out the few
gene mutations that matter amid the
torrent of mutations that are less
critical,” says Kwok-Kin Wong, MD,
PhD, scientific co-director of the
Belfer Institute for Applied Cancer
Science at Dana-Farber, which
seeks to discover new treatments
by understanding the mutations
that make cancer go.
The Likeliest Suspects
Getting a bead on driver mutations
wasn’t difficult initially. “There
are a number of mutated genes
that have been known for 20-25
years to be involved in cancer –
genes such as ras, BCR/ABL, and
Myc,” says William Hahn, MD, PhD,
Dana-Farber’s deputy scientific
director and director of the Institute’s
Center for Cancer Genome Discovery. “The problem was that, other
Of the many gene mutations within a cancer cell,
only a relatively small number may be driving
the cancer.
P at h s
of
Progress
Spring/Summer 2013
CTCA
GATC-
For Belfer Institute leaders (from left) Jesse English, PhD, Pasi Jänne, MD, PhD, and Kwok-Kin Wong, MD, PhD, studying
cancer’s environment within the body is key to understanding the disease.
than these, we knew very little about
which genes underlie different types
of cancer.”
Researchers began by focusing on
the mutations most clearly connected to cancer. Scientists knew that
enzymes known as kinases are often
abnormal in cancer cells. So it was
natural for kinase genes to be among
the first considered as drivers.
Another clue was how often a particular gene is found to be mutated
in cancer. “If it happens at a highenough frequency – if it occurs in,
say, 30 percent of cancers of a
certain type – we’ll be pretty suspi-
cious that it plays an important role,”
Hahn remarks.
“Researchers initially looked at
the genes that had been extensively
studied and described,” Wong says.
“From that base of knowledge,
you start building a picture of how
they contribute to cancer. If you’re
interested in a gene about which little
is known, you have to build that biological understanding yourself. That
is what the Belfer Institute and other
labs at Dana-Farber are doing.”
The challenge of identifying the
drivers goes beyond finding which
mutations are troublemakers in
Spring/Summer 2013
P at h s
laboratory specimens of cancer cells.
Tumors are best understood within
their natural surroundings, the layers
of normal and near-normal tissue
that enfold them within the body. A
group of gene mutations that causes
cell reproduction to go berserk in
petri dishes may have an entirely
different effect – or no effect – in
actual organs and tissues. Laboratory
techniques that simulate the living
environment of tumors are critical to
this research.
“When we look for driver mutations, we need to take into account
all the different types of cells that are
of
Progress
13
Genome Research ‘Goes Viral’
Investigators in Dana-Farber’s Center for Cancer
Systems Biology (CCSB) have taken a novel approach to
distinguish driver from passenger mutations. The key
to their technique: viruses, the primal perpetrators of
cellular havoc.
After a virus infects a cell, proteins made from the
virus’s genes begin interacting with the cell’s own
proteins. These interactions can interfere with the cell’s
normal functioning and the activity of its genes – so
recklessly, sometimes, that the cell becomes cancerous.
The disruptions produced by cancer-causing viruses
often mimic those triggered by gene mutations. “That led
us to ask, ‘What if we systematically examine the interactions between normal cell proteins and the proteins made
from cancer cell viruses?’” says Michael Cusick, PhD,
of the CCSB, who helped lead the research. “Because
viral proteins and gene mutations cause cancer by similar
mechanisms, could we use the viral proteins as stand-ins
for identifying proteins – and the underlying gene mutations – associated with cancer?”
To find out, researchers from the United States and
Canada collected 144 proteins from four viruses linked
to cancer and screened them one by one against 20,000
different proteins in human cells, recording which ones
interacted. The end tally was the identification of roughly
950 viral targets, cell proteins potentially associated
with cancer.
around the tumor, that feed the tumor
and promote its growth,” says Jesse
English, PhD, the Belfer Institute’s
head of research. “We’ve developed
several strategies for studying the
effect of mutations within the context
of a tumor’s normal environment.”
Diving In
Belfer Institute researchers use two
main approaches – or platforms – to
cull driver mutations from the throng
of passengers. The first is contextspecific screening (CSS). English
explains: “In any given tumor type,
there are often baseline mutations –
a small group of mutations that don’t
necessarily make a cell cancerous,
14 P at h s
of
“Viruses have spent millions of years perfecting the
art of interacting with cells – of taking advantage of
gene pathways that are essential for the cell and may
therefore be essential to cancer,” Cusick remarks. “We’re
now using them as a guide to the mutations that are most
important in cancer.” –RL
Electron micrograph of a negatively stained human papilloma
virus (HPV) that occurs in human warts. Warts on the hands and
feet have never been known to progress to cancer. However,
after many years, cervical warts can become cancerous.
but start it in that direction. The
question is, which additional mutations will push the cell over the
edge into cancer?”
Belfer Institute scientists have
created such almost-cancer cells for
a variety of tumor types. They slip
suspected driver mutations into the
cells’ DNA and implant the cells in
lab animals, in the same tissue where
such cells might naturally be found.
If the cells become cancerous, it’s an
indication that the added mutations
are indeed drivers.
The second strategy is a “depletion
screen” involving shRNA (the “sh”
stands for “short hairpin” but might
just as well stand for “Shhh!” as the
Progress
Spring/Summer 2013
technique involves silencing genes
one at a time). “We use viruses to
carry shRNA into laboratory samples
of tumor cells,” explains Belfer
Institute scientist Mark Bittinger.
“The RNA shuts down a specific
gene, and we track whether the cells
stop growing and die. It’s a systematic way of determining whether
a particular gene is necessary for
tumor cell survival and proliferation.
“This approach, known as RNA
interference, mimics the way a drug
against an individual gene would
work. It has become the workhorse
of efforts to discover cancer-related
genes that make good targets for
new therapies.”
www.dana-farber.org
Hahn and his colleagues have harnessed RNA interference in an effort
dubbed Project Achilles. Named after
the mythical Trojan War hero who
was killed by a wound to the weak
spot in his heel, the project is concerned with vulnerabilities, specifically the genes on which cancer cells
depend for their growth and survival.
“We’re screening at least 500 cancer cells lines in which we know all
of the genetic alterations and asking,
if we turn off those genes one by one,
can we identify which are critical?
It’s our hope that the project will
result in a global picture of how
to find those vulnerabilities,” Hahn
comments. “We’re about halfway
through the project [which began
in 2010], but it’s already enabled
us to begin exploring the links
between certain mutations and
cell survival.”
Hahn and other scientists emphasize that no single approach –
whether in laboratory cell cultures,
tumor tissue samples, or animal
studies – will be sufficient to
decisively label a particular gene
mutation as a driver. Rather, it will
require a combination of these
approaches to identify the most
likely offenders.
Also, driver mutations rarely
work solo. In the vast majority of
cancers, it isn’t one mutation but a
combination of them that are responsible for turning a cell cancerous
and keeping it that way. Researchers
are hard at work trying to determine
which combination of mutations
provides the formula for cancer, and
which combination of therapies can
undo the damage those mutations
have produced.
William Hahn, MD, PhD (right), with Rameen Beroukhim, MD, PhD, leads Project Achilles, named for the mythical warrior
with a single vulnerability.
Spring/Summer 2013
P at h s
of
Progress
15
Man
Mission
on a
16 P at h s
of
Progress
Spring/Summer 2013
www.dana-farber.org
Ken Anderson:
Changing the Natural History
of Multiple Myeloma
by Elizabeth Dougherty
A
mong the many photographs lining the shelves in his office, Ken Anderson, MD, is
quick to point out one. In it, he stands with Robert Kraft, owner of the New England Patriots and patron and co-founder, with Anderson, of the Kraft Family Blood
Donor Center at Dana-Farber Cancer Institute and Brigham and Women’s Hospital.
The two are smiling as Anderson holds up a 2004 Super Bowl ring.
Anderson, who is director of the Jerome Lipper Multiple Myeloma Center and
LeBow Institute for Myeloma Therapeutics at Dana-Farber/Brigham and Women’s
Cancer Center, says he counts Kraft as a “friend for life, both personally and professionally.” Anderson, the Kraft Family Professor of Medicine at Harvard Medical
School, and Kraft have been close friends for 30 years. Anderson says it’s relationships like these – with colleagues and collaborators, trainees, and, most important,
with patients and families he has cared for – that are the secret to his success.
In his four decades of practice and research, including 32 years at Dana-Farber, Anderson has played a central role in
transforming myeloma, a cancer of the bone marrow, from a near immediate death sentence to, in many cases, a chronic,
manageable illness. From the 1970s through the ‘90s, not a single new myeloma drug made it into clinical practice. But
during the last decade, Anderson, a slight man with kindly eyes and a ready smile, helped shepherd multiple new drugs
from laboratory bench through regulatory approval and to the patient bedside.
“Partnership is absolutely key,” says Anderson, who received a 2012 Medal of Honor in Science from the American
Cancer Society for bringing his research into the clinic. “We practice team science. We work with industry, regulatory
authorities, and funding agencies. But most important, our patients are the heroes, inspiration, and reason for all we do.”
of
Progress
17
Anderson arrived at Johns Hopkins University in 1973 for medical school, inspired by his mother,
a nurse, to become a small-town
general practitioner. He also had a
keen interest in science. In his mind,
however, blending science and the
practice of medicine as he conceived
it – “on the front lines, taking care of
people in the community” – wasn’t in
the realm of possibility.
Then he met Richard Humphrey,
a multiple myeloma doctor who was
growing myeloma tumor cells in the
laboratory and testing them against
conventional drugs. Humphrey introduced Anderson to clinical research,
and also taught him the meaning of
success: Make science count for
patients, and treat patients as family.
So imbued is Anderson with these
two principles that he has, by word
and example, passed them on to those
he mentors. “He always told me, as
long as you keep the patient in mind,
bone marrow aspirations, they also
grow readily in the laboratory, making it possible to model the disease
and put science to work against it.
The stage was set. Anderson
began pursuing myeloma research
immediately.
Making Science Count
Anderson attributes many of his
subsequent discoveries to simply following science trends. “In the ‘80s, it
was a Golden Age of monoclonal antibodies,” he says, his eyes sparkling
as he recalls treatment advancements
that came from this work. Monoclonal antibodies grab onto invaders
such as viruses and cancer cells and
allow the immune system to attack.
Anderson used antibodies that target myeloma tumor cells to improve
the success of bone marrow transplants when patients self-donate marrow. Even after chemotherapy, such
marrow still contains some malignant
“I have been blessed to have colleagues here
and around the world passionately committed
to curing myeloma ...” – Kenneth Anderson, MD
you’ll never go wrong,” says Noopur
Raje, MD, who trained in Anderson’s
lab a decade ago and now leads her
own myeloma lab and practice.
In the early 1970s, there were very
few people working on myeloma and
survival was measured in months.
“There was a glaring and urgent need
to make things better for patients,”
says Anderson.
Research into myeloma was also
primed for improvement. Not only
are myeloma tumor cells relatively
easy to gather from patients, through
18 P at h s
of
cells. Anderson found that treating it
with antibodies helps clear the tumor
cells and delays relapse.
Later, Anderson worked to transform bone marrow transplants into
stem cell transplants. The method
involves harvesting and reintroducing a patient’s own blood stem cells
to regenerate the blood and immune
system after high-dose chemotherapy.
Again, this improved survival.
As science began to uncover the
importance of cytokines – proteins
that cue cells to grow and influence
Progress
Spring/Summer 2013
their behavior – Anderson’s research
expanded in that direction. This led
to a better understanding of the cellular circuitry that drives myeloma.
In the mid-1990s, Anderson discovered that a switch inside myeloma cells, NF-kB, was important to
myeloma cell growth and survival,
making it a promising drug target.
At about the same time, colleagues
at Harvard Medical School were
working on a new drug, an inhibitor that blocks the proteasome, the
cell’s garbage collector. That drug,
it turned out, worked by inhibiting
NF-kB, Anderson’s prime target.
Further research in Anderson’s
lab confirmed the effectiveness of
the drug against myeloma. Then, in
a phase 1 clinical trial, a myeloma
patient had a complete response. All
signs of the disease vanished.
Just three years later, in 2003,
the FDA approved the drug, called
Velcade, which today is standard
treatment for newly diagnosed
myeloma. “It went from the bench
to the bedside very quickly,” says
Anderson, who with his colleagues
won the prestigious Warren Alpert
Foundation Prize at Harvard Medical School for this work in 2012.
“The whole concept of benchto-bedside-and-back research was
really new,” says Faith Davies, MD,
who joined Anderson’s lab in 1999
for a three-year fellowship. She is
now a myeloma investigator at the
Institute of Cancer Research in London. “Others may have been doing
it, but Ken really drove it.”
Around the same time, Anderson
was investigating thalidomide, another promising myeloma drug. He
modeled not just patient tumor cells
but also, as he says, “the neighborhood” of the tumor, including non-
www.dana-farber.org
cancerous immune and other cells.
The tumor’s neighborhood – or
“microenvironment” – mattered
in myeloma treatment because
myeloma cells that adhere to the
microenvironment don’t respond to
conventional chemotherapy drugs.
These more life-like models
allowed Anderson to discover that
thalidomide and its close cousin
lenalidomide (brand name Revlimid) work as immunomodulators,
drugs that recruit immune cells to
fight cancer. Paul Richardson, MD,
his colleague and clinical director
of the Lipper Center, led the first
human trials, setting the stage for
the 2006 approval of lenalidomide
to treat myeloma.
Modeling the microenvironment
has since proven to be a valuable
tool in translational research. “Ken’s
work has shown that when drugs
work in laboratory models of the
tumor that include the context of
the microenvironment, they tend to
work better in patients,” says Raje,
who, along with Davies, collaborated on these findings.
Myeloma Mixology
Researchers now know that cancer
is heterogeneous (many genetic
mutations drive a single tumor) and
must be treated with combinations
of therapies that target different
drivers. In some forms, such as
testicular cancer and certain types of
leukemia and lymphoma, such drug
cocktails have led to cures.
So Anderson is looking for synergistic combinations of drugs and
therapies for myeloma. Synergy can
happen if, for example, one drug
undoes the mechanisms that cause
resistance to another drug.
He also hopes to personalize treat-
Kenneth Anderson, MD (right), has had a lifelong friendship with New England Patriots
owner Robert Kraft (left), a passionate supporter of the fight against cancer.
ment by categorizing patients based
on the molecular pathways that are
driving their cancer, as determined
by tumor genomics, and to prescribe combinations of drugs based
on those categories. “The more we
understand, the more we realize how
complicated this disease is,” says
Anderson, who, along with colleague
Nikhil Munshi, MD, is finding that
myeloma tumors have many mutations even at the very start of the disease. “Hardly ever will it be enough
to use just one targeted agent.”
One combination, Velcade, Revlimid and Dexamethasone, shows
promise in all patients, with all signs
of myeloma vanishing in half. Given
these unprecedented results, Munshi, Richardson, and Anderson have
launched a trial to test this combination in newly diagnosed myeloma
patients. Half of the participants will
receive stem cell transplants, testing
whether the combination increases
transplant success, and vice versa.
“My prediction is that science will
inform the design of four- or even
five-agent treatment combinations
that will markedly improve outcomes
and lead to potential cures,” he says.
Anderson’s influence is behind
much of the progress made in myeloma over the past four decades. Yet
Anderson deftly passes the credit. “I
have been blessed to have colleagues
here and around the world passionately committed to curing myeloma,
and courageous patients who are a
daily source of inspiration.”
“He’s so humble about his achievements,” says Raje, who still attends
Anderson’s weekly lab meetings and
calls him regularly for input.
When Anderson looks back on his
40-year journey, he shakes his head
in disbelief. “What a privilege it has
been for me to watch the natural history of myeloma change, see trainees
become leaders, and watch patients
share the joys of life with their families. It doesn’t get any better than
this!,” he says. Nevertheless, when
he looks ahead, he has the energy of
a man just about to begin.
See Dr. Anderson explain multiple
myeloma. Visit www.bit.ly/Z1WtwX.
of
Progress
19
SCIENCE ILLUSTRATED
Cancer Cell with BRCA1
or BRCA2 Mutation
by Robert Levy
Illustration by Jessica Walker and john digianni
PARP
T
he renegade behavior of cancer cells
results from mutations or abnormalities in key sets of genes. As scientists
have come to realize, these same
mutations can leave the cells vulnerable to cleverly-designed therapies.
One example involves a treatment for breast and
ovarian cancer patients who have inherited mutations
in the genes BRCA1 or BRCA2. As depicted here, the
approach turns these otherwise dangerous changes to
patients’ advantage.
1) Everyday wear and tear or environmental hazards
can damage cells, often producing a break in a single
strand of DNA. Normally, a protein known as PARP
helps fix such single-strand breaks.
2) Treating such patients with PARP-blocking
drugs can prevent such breaks from being repaired
in cancer cells.
DNA Break
1. Single Strand
DNA Break
3) With PARP sidelined, DNA damage accumulates,
eventually producing breaks in both strands of the molecule. In most people, the BRCA genes handle two-strand
repair jobs, but patients who inherit BRCA1 or 2 mutations have only one functioning copy of these genes,
rather than the usual two. In such patients’ tumor cells,
even that one good copy is lost. The result: mounting,
irreversible DNA damage to tumor cells.
4) Its DNA irreparably broken, the tumor cell can no
longer sustain itself and dies.
20 P at h s
of
Progress
Spring/Summer 2013
www.dana-farber.org
Outmaneuvering Cancer
3. Double Strand
DNA Break
PARP
2. Treatment with
PARP Inhibitor
PARP
BRCA
DNA Break
PARP Inhibitor
DNA Break
BRCA
PARP Inhibitor
4. Dead Cancer Cell
Spring/Summer 2013
P at h s
of
Progress
21
Young Lives
ON HOLD
Caring for young
adults means
treating their
unique clinical and
emotional needs
Rebecca Blumenfeld always planned on getting married and starting a family. She
just didn’t expect she would need to do both so suddenly.
In the fall of 2011, Blumenfeld was newly engaged and attending graduate school
just outside Boston. When a small bump on her leg rapidly grew in size, a succession
of doctor visits ended with surgery to remove a tumor and, then, a diagnosis of a rare
form of osteosarcoma – bone cancer.
Suddenly, at age 29, Blumenfeld felt like the life she’d mapped out was contracting
quickly. Instead of graduate school and wedding plans, she was faced with a second,
more invasive surgery and a year of chemotherapy. She and her fiancé, Jeff, immediately
obtained a marriage license, found a justice of the peace, and spent their first week as
husband and wife undergoing in vitro fertilization and harvesting embryos in case Blumenfeld’s treatment caused fertility problems.
Then, in the second week of married life, came chemo.
Young adult patients have long been cancer’s forgotten group. Children, despite making up just 2 percent of all cancer cases, get a disproportionate share of research funding, clinical focus, and media attention. Middle-aged and older patients are the primary
beneficiaries of clinical trials, research protocols, and support groups.
For those caught in between, things can be confusing. Too old for the pediatric clinic
and its playroom, too young to feel comfortable in an adult clinic alongside people their
parents’ age, young adults facing cancer often feel isolated.
Just about 10 percent of outpatients at Dana-Farber/Brigham and Women’s Cancer
by Saul Wisnia
22 P at h s
of
Progress
Spring/Summer 2013
www.dana-farber.org
Left to right: Divya Raju, Rebecca
Blumenfeld, and Ben O’Clair were all
forced to halt major life events during
cancer treatment at Dana-Farber.
Spring/Summer 2013
P at h s
of
Progress
23
Center (DF/BWCC) are between
ages 18 and 35. Peers don’t understand what they are going through,
and sometimes their own families
are not sure how to help. Major
milestones, such as going to college
or beginning a career or family, are
often disrupted.
DF/BWCC’s Young Adult Program is designed to help these
patients find their place and each
other. It offers individual and group
counseling, educational events, and
peer support through face-to-face
meetings and a secure website with
online forums and information.
“Young adults can be taken off
track by cancer, and it’s hard for
them to transition back into regular
life, for practical and existential reasons,” says Karen Fasciano, PsyD,
a clinical psychologist and director
of the Young Adult Program. “Their
peer group hasn’t experienced this,
and their perspective on life and
what they value may change.”
Blumenfeld says she suppressed
her emotions for the year she was in
active treatment, only to have them
come flooding back after her PortA-Cath device was removed last
December – exactly one year after
her first chemotherapy infusion.
“During treatment, I was concretely connected with the physical
– and my body and pain and nausea
and discomfort – that I didn’t have
time to feel anything,” says Blumenfeld, who was a “very part-time”
student during this period. “Since
treatment, I’ve been reflecting. I’m
angry and frustrated that this was
not the year it was supposed to be. I
had to put off finishing school, my
relationship was constantly challenged, and I don’t feel like my
body belongs to me anymore.”
Blumenfeld credits the Young
24 P at h s
of
Recent findings show that many young adult
patients may respond best to a chemotherapy
regimen designed for children.
Adult Program with helping her
through. After attending DF/BWCC’s
annual young adult conference, she
was “amazed” to meet so many patients her age. She also met regularly
with Fasciano, with whom she discussed her relationship with both her
husband and her parents – on whom
this fiercely independent woman had
to become largely dependent.
Ben O’Clair faced several similar
obstacles. He was a 21-year-old college senior taking final exams when
he learned he had Ewing sarcoma –
another form of bone cancer – and
had to leave school immediately.
“I had just gotten to the point
where I was preparing for graduation
and interviewing for jobs and internships,” recalls O’Clair, now 24. “I
had to stop and put it all on hold.”
Today O’Clair serves on the Young
Adult Program advisory committee.
“We’re giving people a chance to get
the support they need and connect
with others are out there,” he explains. “I’m working on the website;
my favorite feature is a chat room
where people can arrange to meet up
with fellow patients.”
‘Awakening’ Research
Changes in how young adults are
treated at DF/BWCC are not limited
to their unique emotional concerns.
There is an increased focus on the
clinical and scientific differences that
can arise in tumors found in this age
population, and on tailoring treatments to best address them.
Stephen E. Sallan, MD, chief
of staff emeritus and a pediatric
Progress
Spring/Summer 2013
oncologist at Dana-Farber/Children’s
Hospital Cancer Center, says there
are several key obstacles in identifying and treating young adults.
“These are among the most uninsured and unemployed individuals
in the country, so they are often not
being seen regularly by a physician,”
says Sallan. “They feel they are
immortal and can’t get sick, so they
may initially ignore their symptoms.
Many times we don’t get to them
until they show up in an emergency
room, with or without their parents.”
Sallan says that it has long been
known that some cancers – sarcomas,
lymphomas, leukemias, some brain
tumors, and some germ cell cancers
– appear more often in young adults.
Researchers recently found that a
significant portion of these patients
may respond best if given a chemo
regimen designed for children.
Acute lymphoblastic leukemia
(ALL), the most common childhood cancer, has a survival rate of
85 percent or higher when treated in
patients age 15 and under. This rate
was always worse in young adults
until a pair of oncologists at the University of Chicago – Wendy Stock,
MD, and Jim Nachman, MD – found
that putting patients ages 18-30 on a
pediatric chemotherapy protocol led
to much better outcomes.
“When I first heard their talk, it
awakened me,” says Sallan. In 2000,
along with three other cancer centers,
Dana-Farber began treating young
adult ALL patients with pediatric
protocols. Survival rates went from
40 percent to 70 percent.
www.dana-farber.org
Researcher Katherine Helming (left) has seen cancer from both sides; Stephen
Sallan, MD, has sought cures for her and others for 40 years.
Back to Life
The key now, Sallan and others
agree, is to increase the number of
young adults on clinical trials for all
cancers so that physician-scientists
can learn more about what makes
their tumors respond differently.
“We want to develop clinical
trials geared to the physiological
and biological needs of this group,”
says Suzanne George, MD, clinical
director of the Center for Sarcoma
and Bone Oncology at DF/BWCC.
“If you look at sarcoma outcomes
by age subtypes, which typically
occur in the young adult population,
patients over 18 typically do worse
than younger patients, and yet are
treated on the same protocol. There
is an opportunity to better understand the disease biology.”
Adds Sallan: “Diseases are
sometimes identical regardless of
age, and sometimes are not. We are
learning the importance of recognizing these similarities and differences. Some of the difficult therapies and their side effects that can
be tolerated by children occasionally
prove to be too toxic for those in
their 20s and 30s.”
Katherine Helming has an innate
understanding of this situation. At
age 23, while a Harvard Medical
School doctoral student training in
a cancer biology lab at Dana-Farber,
she was diagnosed with leukemia.
Like O’Clair, she had to take a
full year off from her studies and,
due to intensive chemotherapy
treatments, spent many weeks of
2011 as an inpatient at Brigham and
Women’s Hospital or in isolation to
prevent infection.
Nurses told Helming she had to
“stop being a scientist worrying
about what was going on with my
cells, and start being a patient.”
Easier said than done, until she
joined the Young Adult Program.
“The most important thing the
program did was connect me with
other young adults in my situation,”
Helming says. “If we didn’t have
the same type of cancer or weren’t
in the same treatment stage, we
still had a lot in common – relating
to our peers, becoming dependent
again on our parents, and navigating
the return to school or work.”
Helming had a difficult time
Spring/Summer 2013
P at h s
returning to her doctoral program
during her second year of treatment.
From the windows in Dana-Farber’s
Louis B. Mayer Research Laboratories, she could look across the street
into the Yawkey Center for Cancer
Care, where she was still receiving
once-weekly chemotherapy.
“Sometimes that was too overwhelming to get my head around,”
Helming admits. “I got tired very
easily and I didn’t want to push
myself too hard in the lab, but I still
wanted to contribute.”
Even after treatment, young adult
patients like Helming face emotional
challenges. They’re often expected to
bounce right back to their old lives.
“People will say to them, ‘Aren’t
you lucky your cancer is gone?’ at
the same time they might really be
struggling,” says Ann LaCasce, MD,
a hematologic oncologist and director of Dana-Farber/Partners CancerCare Hematology-Medical Oncology
Fellowship Program. “They don’t
have the support they need, and every time something happens to them
medically, they’ll be certain their
disease is back – even if it isn’t.”
Now these patients have that support. Whether or not their cancer
returns, they are better equipped to
deal with it from an emotional
and physical standpoint. For Rebecca
Blumenfeld, that means joking about
her “real first year of marriage” as
she prepares for a larger ceremony
at a botanical garden in June.
Watch a video about young adult
patients. Visit www.bit.ly/12Tq0S2.
of
Progress
25
26 P at h s
of
Progress
Spring/Summer 2013
www.dana-farber.org
The search
for shortcuts
New medical tools may offer better predictions and
drug treatments for brain tumors
by richard saltus
C
linicians and researchers in neuro-oncology
at Dana-Farber are
excited. Experts have
spent decades trying to find ways of
controlling or killing glioblastomas,
the most highly malignant of brain
tumors, but progress has been slow.
Now, scientists are discovering a
growing list of molecular targets for
“smart” drugs that might dent the
tumors’ resistance that has stymied
conventional therapies, and could
potentially lengthen survival and
improve quality of life.
Until glioblastomas yield to
some future breakthrough, the best
near-term bet for helping patients
is to develop and test these targeted
drugs – first one-at-a-time, then in
combinations – say the researchers.
Rather than aiming to destroy tumor
cells by blasting them with radiation
and DNA-damaging chemotherapy,
the new agents are designed to block
runaway growth signals that drive
the tumors’ aggressive spread.
“There is hope that over the next
few years, new cocktails of drugs
will be available to target the key
molecular pathways involved in
these tumors,” says Patrick Wen,
MD, director of the Center for
Neuro-Oncology at Dana-Farber/
Brigham and Women’s Cancer
Center (DF/BWCC).
However, the road from promising candidate to effective treatment
is often fraught with detours and
delays. Each new compound from
pharmaceutical laboratories comes
with a list of necessary questions:
Can it reach its target within the
brain? Will it be effective in disrupting tumor growth? Does it have
acceptable risks of side effects?
Every new agent must pass these
tests on its own, then again when
combined with other drugs.
The urgency of getting these
Spring/Summer 2013
P at h s
answers runs up against the slow
and deliberate pace of clinical trials,
which require enrolling hundreds
of patients – whose tumors have
various genetic characteristics – and
testing drugs for months or years to
see if they are effective.
“If patients in clinical trials don’t
live longer, we say the drug failed
but we don’t know why it failed,”
notes Keith Ligon, MD, PhD, of
DF/BWCC’s Center for Molecular
Oncologic Pathology (CMOP).
“Maybe the drug killed off only half
the cells, but in fact we did make
some progress with the other part
of the tumor. But we have no way to
tell, other than crude measures that
take months to demonstrate results.”
Determined to do better, investigators are working on ways to
shortcut the testing process, evaluate
more quickly whether experimental
drugs are reaching targets in the
brain, and personalize treatments
of
Progress
27
grows as new patients come to DF/
BWCC for treatment.
“We take out samples and try to
establish a living model of that patient’s actual tumor, so that instead
of trying to guess from its genetic
profile how the tumor will behave,
we try to have a model so we can
go after it in a more direct fashion,”
explains Ligon.
“These tumor lines are an invaluable resource for preclinical testing,
to make sure the drugs do what
they are supposed to do,” notes
David Reardon, MD, medical
director of the Center for NeuroOncology. Reardon, Wen, and Ligon
are currently designing clinical
trials based on evidence from such
studies to help pick drugs with the
most promise.
Developing Patient ‘Avatars’
With brain tumor cells from the
Living Tissue Bank, Ligon has begun
work on another type of personalized cancer medicine known as
patient “avatars.” In online gaming,
an avatar is an image that represents
a person. In medicine, an avatar is
an exact animal model of a single
individual’s disease – such as a brain
tumor – created to enable personalized drug research for that patient.
Scientists create avatars by injecting
mice with tumor cells from the living
tissue bank or even tissue fresh from
the operating room. If all goes well,
an exact copy of the patient’s tumor
will develop in the mouse.
Additional mouse models can be
created from the initial avatar, so that
a variety of drugs can be tested on
Using a Living Tissue Bank
One of the newest and most
advanced resources is on the second
floor of Dana-Farber’s Jimmy Fund
Building, where incubators and
freezers contain cells taken from almost every DF/BWCC patient who
undergoes surgery for high-grade
brain tumors, such as glioblastoma.
Five years ago, Ligon, with the
support of his colleagues in NeuroOncology, started this collection
of brain tumor cells that survive
indefinitely as a resource for the DF/
BWCC Brain Tumor Program. He
calls it the “Living Tissue Bank”
in contrast to conventional tissue
banking, which has focused on
freezing or storing tissue in a form
where the cells are no longer alive.
Not all brain tumors can be grown
in laboratory dishes, but the bank
currently has 50 or 60 permanently
established cell cultures, or cell
lines, they can mine for valuable
information. The bank continually
28 P at h s
of
MIT researchers designed this tiny microfluidic chip that can measure the mass and
density of single cells, and how they respond to drugs.
Progress
/
Spring/Summer 2013
www.dana-farber.org
Photo courtesy of the Manalis Lab at MIT
for patients who are racing against
the clock.
What if different drugs could
quickly be tried in an exact animal
model of a patient’s brain tumor,
with results guiding the treatment
of that patient? Could physicians
remove a small number of cells
from the tumor during surgery and
rapidly screen a panel of drugs for
their effectiveness? Are there better
ways to predict whether a drug will
cross the barrier that protects the
brain, so that it can reach the tumor?
Though none of these are ready
for prime time, Center for NeuroOncology scientists and colleagues
are hopeful that these strategies will
prove valuable in the fight against
stubborn glioblastomas.
the tumors growing in the avatars.
Ligon notes that this strategy is
well-established in microbiology,
where doctors take a sample of bacteria from a patient with an infection
and grow them in a petri dish, trying
different antibiotics to find one that
kills the bacteria that is causing
disease in the patient.
“The ideal situation would be if
we could do this fast enough – if
we could test not just the drug the
patient was prescribed, but all the
drugs he or she could possibly be
given” to weed out those that would
be ineffective, Ligon says. The
model could evaluate new drugs
fresh from pharmaceutical company
laboratories.
Many scientists are skeptical that
mouse avatars will prove valuable
and cost-effective; Ligon agrees
that the method is a long way from
being proven.
One hurdle is that not all tumor
samples grow well in mice. Also,
the process in its current form may
take too long to help patients with
rapidly growing brain tumors during their lifetime. In addition, the
expense of creating and maintaining
the mouse models is high. Ligon
notes, however, that patients are
increasingly interested in having
avatars made of their disease.
He is optimistic that this concept,
originally tried in the 1960s, has
a future. “Our models are more
sophisticated and we have a lot
more drugs to test than were available back then,” he says.
A Cell-by-Cell Approach
Ligon, who is also affiliated with
the Neuro-Oncology Program of the
Dana-Farber/Harvard Cancer Center, has begun exploring a futuristic
scenario: subjecting one or a few
cells isolated from a patient’s tumor
to precise tests that might predict
the tumor’s behavior and how it will
respond to different drugs. Because
tumors often have more than one
type of cancer cell – tumor heterogeneity – the ability to test cells
from different parts of the cancer
could be extremely valuable.
“Potentially we could take tumor
cells right out of patients and analyze them almost immediately to
determine what kind of drug to give
them,” Ligon says. Such a shortcut
may seem far-fetched, but Ligon is
pursuing this vision in collaboration
In neuro-oncology,
many drugs fail
because they can’t
breach the “bloodbrain barrier” – tiny
blood vessels that
protect the brain.
with Scott Manalis, PhD, a bioengineer at Massachusetts Institute of
Technology (MIT) and a member
of the David H. Koch Institute for
Integrative Cancer Research.
Manalis has created a microfluidic system so sensitive that it can
measure the mass of a single cell.
Within a few minutes, the device
can tell, from changes in the mass
and density of the cell, whether the
cell is dormant, growing, or shrinking. And it can even tell scientists
how the cell’s growth varies at different times – its “growth profile.”
“If the mass goes up, the cell is
Spring/Summer 2013
P at h s
happy and growing,” says Ligon,
“so if you apply the drug to a tumor
cell and its growth profile doesn’t
change, you know the drug had no
effect.” If, however, the cancer cell’s
growth stalls or shrinks, the drug is
likely to be working.
In a 2011 experiment at MIT, the
system was tested on leukemia cells
that were treated with an antibiotic
drug. Less than an hour later, the
weighing device detected a change
in the cancer cells’ density, signaling that they were beginning to die.
To the scientists, this suggested
the potential value of the system in
screening cancer drugs.
Ligon’s collaboration with
Manalis has been under way only
a few months, but he is excited
about the possibilities of measuring
drug effects in real-time. “If we get
the technology working, it would
go into clinical trials to validate it;
eventually it could be a diagnostic
test.” Funds for the research come
from a special National Institutes
of Health program to support scientists who are asking “provocative
questions” rather than continuing
incremental, “safe” research.
In another slant on analyzing the
genome of single brain tumor cells,
Dana-Farber’s Matthew Meyerson,
MD, PhD, and Ligon are collaborating with chemical engineer
Christopher Love, PhD, of MIT in
a “Bridge Project” supported by the
Koch Institute and Dana-Farber/
Harvard Cancer Center.
“We now are using technologies
which can take a single cell from a
patient’s tumor, amplify it to make
more DNA, and sequence its entire
genome,” Ligon explains. With such
precise information, scientists might
be able to determine the genetic
of
Progress
29
Shown here is a
“patient avatar”
brain tumor (dark
blue areas) within
a mouse brain,
created by implanting tumor tissue
from a patient.
makeup of the exact cells within a
brain tumor found, in devices like
those Manalis has developed, to use
a specific mechanism for resisting
drugs. And if the tumor is made up
of several kinds of tumor cells, this
technique could guide physicians in
selecting multiple drugs – combination therapy – for the attack.
Crossing the Barrier
The most potent anticancer drug is
worthless if it can’t reach its target.
In neuro-oncology, many potentially
effective drugs fail because they
can’t penetrate the “blood-brain
barrier” – tight-fitting blood vessel
cells evolved to protect the brain
against bacteria and poisons. A new
tool being developed by DF/BWCC
researcher Nathalie Agar, PhD, can
track a drug as it enters the body and
flows through the brain’s circulation,
revealing whether molecules of the
drug are getting through the barrier.
With the power of mass spectrometry, which detects molecules by
their mass, Agar has created a platform that creates images of a drug’s
distribution in the body and the brain
after the compound has been infused
into a research animal. What’s new
about Agar’s method is that there is
no need for the drug molecules to be
tagged with fluorescent chemicals,
which can change the drugs’ structure, she says. (See “Tech Preview”
on page 31 for details.)
Agar and Dana-Farber colleague
Charles Stiles, PhD, are using her
mass spectrometry technique to
determine if experimental drugs
are able to breach the blood-brain
barrier and reach tumor targets
within the brain.
Stiles, who is co-leader of the
Dana-Farber/Harvard Cancer Center
30 P at h s
of
Neuro-Oncology Program, remembers the first time he saw Agar
demonstrate her technique. “She
showed me what she was doing with
the mass spec technology, allowing
us to visualize the inside of a blood
capillary and drugs getting into the
interstitial space [of the brain], and I
was just blown away,” he says.
“An especially powerful feature
of Nathalie’s technology is that it
does not require any radioactive or
fluorescent labeling of the drugs
being tested,” Stiles explains. “She
can image the exact forms of drugs
that are intended for use in patients.”
Stiles and Agar discovered, in one
experiment, that a drug did penetrate the barrier and could be seen
on the computer display to have
accumulated in the tumor. But the
image also showed that the drug
was confined mainly to the network
of blood vessels that the tumor
had created. “So the drug was just
sitting there,” she says, “rather than
reaching the tumor tissue itself.”
Another interesting finding:
The mass spectrometry system
took 25 cross-section images of
a mouse brain and created a 3-D
representation. “We found that
there was one region of the brain
where the drug crossed the bloodbrain barrier more efficiently,”
says Agar, which might lead to a
strategy for delivering the drug
Progress
Spring/Summer 2013
where it is most likely to reach
a tumor.
One way of using the method clinically, Agar says, would be to give a
drug to a brain tumor patient prior
to surgery. The mass spectrometry
image could then be used to study the
tumor tissue that’s been removed “to
see if the drug actually made it to the
tumor.” If so, it would be a good sign
for further treatment with the drug.
Agar says she and Stiles, together
with Dana-Farber chemist Nathanael
Gray, PhD, plan to use the system to
test more drugs from pharmaceutical
companies.
If they can demonstrate that certain
drugs do reach the brain, she says,
it “might be a very effective way to
convince companies of the value of
developing trials that could help us
re-purpose existing drugs to treat
brain cancer.”
Only time will tell what impact
these innovations – mouse avatars,
single-cell testing, mass spec studies of drug penetration, and others
– will have on the treatment of brain
tumors. But one thing is certain:
They reflect the power of collaboration among DF/BWCC investigators,
both basic and clinical, to mount an
intense effort against this stubborn
form of cancer.
See how the microfluidic chip works.
Visit www.bit.ly/15OVxST.
www.dana-farber.org
Tech Preview
Seeing with Mass Spectrometry
New tools aid brain tumor studies
B
by richard saltus
y measuring the mass of molecules, Nathalie
Agar, PhD, makes images.
With a mass spectrometry platform, Agar can
trace the flow of cancer drugs given to research
animals, noting whether they slip through the
“blood-brain barrier,” tight-fitting blood vessels
that keep chemicals from reaching the brain.
For her studies of drug penetration in tumors
and in classifying tumor types, the mass spectrometry platform measures the distribution of proteins,
lipids, and other specific tissue components. From these
measurements, computers can construct vivid images,
including 3-D views of the blood-brain barrier. In a
clinical trial, mass spectrometry technology is enabling
Agar, in collaboration with Dana-Farber researchers, to
examine brain tumors removed from patients to determine whether drugs given before surgery hit their tumor
targets. She’s developing a GPS-aided mass spectrometry
instrument that would guide neurosurgeons during an
operation so that a brain tumor could be removed more
extensively with ultimate preservation of healthy tissue.
Agar directs the Surgical Molecular Imaging Laboratory at Brigham and Women’s Hospital, and also has an
appointment in Cancer Biology at Dana-Farber. A major
goal of her research is to provide more and better data to
personalize treatments for brain tumors and other cancers.
Agar, who holds a PhD in chemistry, and Charles Stiles,
PhD, a Dana-Farber cancer biologist, are testing potential
brain tumor drugs for their ability to cross the blood-brain
barrier. Agar’s technique allows researchers to track a
drug’s location after it is administered, without the need
for costly, cumbersome fluorescent or radioactive dyes.
Agar is also collaborating in a study of brain tumors
caused by the spread of malignant cells from breast cancers. “We’ll use the mass spectrometer to examine tissue
samples removed during surgery to see if the drug is getting into the tumor and how it’s distributed,” explains Agar.
Much of her research, she says, is aimed at designing
better treatments by analyzing different tumor cells and
matching them to the most effective drugs. “But the first
thing we need to determine is whether the drug makes it
into the tumor – this is a fundamental question.”
By Robert Levy
Nathalie Agar, PhD, uses an advanced mass spectrometry platform to create images of cancer drugs flowing in the brain.
Spring/Summer
Spring/Summer 2013
2013
P at h s
of
Progress
31
Why I Work Here
STACY KENNEDY, mph, rd
by Richard Saltus
S
he is a fountain of nutritional advice, a fitness
instructor and personal trainer, a self-proclaimed
science nerd, and an advocate of healthful eating
who walks the walk.
“I’m about 90-percent vegetarian,” says Stacy Kennedy,
MPH, RD, senior clinical nutritionist at Dana-Farber/
Brigham and Women’s Cancer Center (DF/BWCC). “My
diet is basically plant-based, but
sometimes I’ll make a big salad
with a little bit of grass-fed
beef, wild fish, or organic
chicken.” She’s long been
a “juicer,” augmenting her
fruit and vegetable intake
with home-pressed juices.
Despite this, Kennedy is
not a fanatic: “You still
have to have balance
and be a normal
person and enjoy a
piece of cake
once in awhile,”
she says.
Kennedy, who
holds a master’s
degree in public health and
is a registered
dietitian and a
certified specialist in oncology
nutrition, came
to DF/BWCC
12 years ago.
She is one of six
nutritionists in
the department
of Nutrition Services, where she
helps cancer patients and survivors who want to manage
their weight, design a more healthful diet, and learn
how to “fight cancer with a fork” – nutritional strategies for cancer prevention, to promote survivorship and
symptom management.
“I spend a lot of time with patients trying to put it all
into perspective,” she notes. “Nutrition can have a big
impact on people with cancer, and it’s never really one
thing – you need to find a system that works for you.”
DF/BWCC is a great fit for Kennedy, who helped take
care of her grandmother as she was dying from lung
cancer, and who has long been interested in the field.
”There is a lot of interesting science and research about
nutrition and oncology, and I love that,” she says.
That’s an asset for Kennedy: When evaluating the
ever-changing research
“Nutrition can have
findings on nutrition and
cancer, as well as the
a big impact on people
claims put forth for all
with cancer, and
kinds of diets and herbs
and supplements, she
it’s never really one
looks first and foremost
thing – you need to
to the scientific evidence.
“We’re so inundated with find a system that
these things, and everyworks for you.”
one is interested in the
most exciting, latest promise of a quick fix,” she
says. “I tell my patients they don’t need to be afraid
to talk about these unproven diets – I want to be supportive and informative, but it’s got to be safety first,
efficacy second.”
A project that Kennedy initiated several years ago
– creating a nutrition information section on DanaFarber’s website – has evolved and, in early 2013,
spawned a new iPhone app called Ask the Nutritionist:
Recipes for Fighting Cancer. The app offers searchable
questions about diet and cancer, as well as hundreds of
recipes for use by cancer patients, people on specialized
diets, and anyone interested in healthy eating.
Stacy Kennedy, MPH, RD
32 P at h s
of
Progress
Spring/Summer 2013
www.
What I Know
TIMOTHY ROURKE
As Told to NAOMI FUNKHOUSER
A
sound on the baby monitor awoke Timothy
Rourke and Mel Pepin at 6 a.m. on Father’s
Day in 2006. The parents of then-15-month-old
Declan Rourke rushed to find their child having a seizure.
They sped their unconscious son to the hospital. Hours
later, Declan was diagnosed with atypical teratoid rhabdoid tumor (AT/RT), a rare cancer that affects the brain
and central nervous system. Just 32 American children
under age 3 are diagnosed annually with AT/RT. Prior to
1997, mortality from such tumors was 100 percent within
six months of diagnosis.
Declan’s rigorous treatment at Dana-Farber/Children’s
Hospital Cancer Center (DF/CHCC) included 52 weeks
of cytotoxic chemotherapy agents delivered in adult
doses, and six weeks of cranial radiation. He completed
treatment in late 2007.
“he is a normal,
Today, Declan is almost 8,
with no evidence of disease.
happy kid, in the
“He is a normal, happy kid,
face of something in the face of something
extraordinary,” says his father.
extraordinary.”
One of a handful of pediatric
patients worldwide without a relapse or secondary cancer,
Declan is one of the world’s only longtime survivors of
AT/RT – a gift of life Rourke credits to “his friends and
partners” at DF/CHCC.
He gives this advice to those who face the prospect of
being a parent of a cancer patient.
Help your child guide the conversation. As a result of
treatment, Declan suffers from hearing loss. He brought
hearing aides to class for “show-and-tell.” We will equip
Declan as his peer group dynamics change, to discuss his
cancer, or not – his choice.
Support and recognize the experience of being
a caregiver. Mel quit
her job to become
Declan’s caregiver
during treatment. We
focused on patience,
listening, and good
communication.
You’re a click away
from a mom or
dad who went
through this.
Log on and
connect
with other
parents who
also faced
complicated
choices.
Never regret any decision you make. You are doing
the best you can for your kid. It’s amazing what humans
are capable of when you don’t have a choice. For parents,
you discover within you this drive that you will do anything for your child.
With a cancer diagnosis, the
whole world rallies
around you. It can
be uncomfortable to
ask for help. Accept it
with gratitude. People
feel helpless. Be directive in what you need.
Decide to not live with cancer. Once we were on the
survivorship journey, we decided not to live with the
“what-ifs.” We reclaimed a goal in our life [adopting a
child] that we had been ready to walk away from. We got
through. For a long time, we thought we’d never get there.
Celebrate. I feel lucky
for every single day. Anything he does, I celebrate,
because I almost didn’t
have it.
Timothy Rourke and his son, Declan
of
Progress
Legislative
Update
What I Know
New Law Reflects the Changing Face of Cancer Treatment
Oral chemotherapy law brings parity to Massachusetts patients
by Eric Schuller
Massachusetts Gov. Deval Patrick signed an oral chemotherapy parity bill into law earlier this year,
joining more than 20 states requiring health plans to cover oral cancer pills “at a rate no less favorable”
than standard intravenous (IV) chemotherapy. The legislation ensures that patients who receive oral
chemotherapy treatment will get the same insurance coverage as those who take it intravenously.
Insurers generally cover IV chemotherapy as a medical benefit – with a modest patient copay and a limit on
annual out-of-pocket costs – while oral chemotherapy is
treated as a prescription drug benefit, requiring some
patients to pay a significant portion of the drug’s cost,
with no annual out-of-pocket limit. The new law has the
potential to trim thousands of dollars in out-of-pocket
costs for cancer patients receiving their chemo as a pill.
“The parity provided by this bill is a recognition that
cancer treatment is changing,” says Dana-Farber President Edward J. Benz Jr., MD. “Increasingly, pills are replacing IV chemotherapy in the clinical setting, and some
newer cancer drugs are only available in pill form. In fact,
New Massachusetts legislation makes it easier and cheaper
for cancer patients to recieve oral chemotherapy and related
anticancer medications.
34 P at h s
of
Progress
since 2012, eight of the 11 oncology drugs approved by
the FDA are oral treatments with no IV equivalent.”
While chemotherapy pills and capsules have been
around for years, they have become more common in the
past decade, and experts see them as a critical part of cancer treatment in the future. For example, the drug imatinib
(brand name Gleevec), which is the most effective treatment for chronic myelogenous leukemia, is only available in pill form, as is a newer medication, lenalidomide,
which is used to treat multiple myeloma and myelodysplastic syndromes.
Oral medications account for around 25 percent of 400
cancer medicines currently in development, according to
a 2008 report from the National Comprehensive Cancer
Network. And researchers are continuing to uncover new
potential benefits that may be gained through the use of
targeted medications available only in pill form.
Passage of the Massachusetts legislation represents a
victory for Dana-Farber’s Legislative Action Network,
whose members have actively lobbied legislators to enact
the bill since it was first introduced in 2009.
“It’s a real victory for those who support patient
access and equity,” says Anne Levine, Dana-Farber’s
vice president of External Affairs. “In a state that rightly
prides itself as leader in ensuring health care access to
all, this is a positive step forward, and I’m hopeful that
our members helped sway legislators to make the right
decision in passing this bill.”
To learn more about the Legislative Action Network
or to join its ongoing advocacy efforts for legislation
and policies that improve the lives of cancer patients,
sign up for email action alerts at www.dana-farber.org/
legislative-action-network.
Spring/Summer 2013
www.dana-farber.org
2012 A n n ua l R e p o rt /T r e a s u r e r ’ s R e p o rt
and
D a na -F a r b e r G ov e r na n c e
A message from Chief Financial Officer Karen Bird
Fiscal year 2012 was a very positive one for Dana-Farber, with the
completion of the first full year of operations for our Yawkey Center for
Cancer Care. We achieved an operating margin target of $15.3 million,
or roughly 1.5 percent, compared to a budgeted gain of $5.9 million.
This strong performance in 2012 continues our historic operating margin performance after a one year deficit in 2011. Total cash and investments grew by $93.9 million thanks to several factors: strong operating
performance, strong fundraising activity, and a 12 percent return on
our portfolio for the 12-month period ended Sept. 30, 2012. One other
highlight: Our net assets grew to just over $1 billion this year.
Strong growth in our patient care activities resulted in growth in
patient care revenues of 11.5 percent. Thanks to the continued support
of our donors, it was also a strong year for fundraising, which saw a
2.9 percent increase in unrestricted giving. Research revenues declined
8.4 percent, largely as a result of the expiration of government stimulus
funds initiated in 2008. These stimulus funds created additional revenue that we expected to decline in 2012. This decrease brings research
revenues back to our 2010 levels.
Management this year entered into a lease for approximately 100,000
square feet of critically needed research space in the Longwood
Center (near Dana-Farber, on the corner of Brookline and Longwood
Avenues). The Longwood Center will open in 2015 and will give us
the continued ability to recruit and retain world-class research faculty
members. It also provides us with the unprecedented opportunity to
reorganize the entire campus to accelerate the application of basic
discovery and translational science to treatments that advance the basic
and clinical science of cancer.
Another exciting research advancement is Profile, our comprehensive
personalized cancer medicine initiative launched in 2011 and operated
in partnership with Brigham and Women’s Hospital and Boston Children’s Hospital. A key component of our broad personalized medicine
initiative, Profile analyzes patients’ tumor tissue for nearly 500 genetic
mutations in 41 cancer genes. This strategic initiative will provide one
of the most complete profiles of known cancer genetic abnormalities
available anywhere in the world. In 2012, we consented well over 70
percent of our new patients for this study and, during fiscal year 2012,
we invested just over $2.4 million in this important initiative.
Management, faculty, and staff throughout Dana-Farber – guided by
the oversight of several committees of the Board of Trustees – worked
diligently to achieve these results. We are grateful to them, and also to
the many donors and friends of Dana-Farber who continue to demonstrate their commitment to the organization with their valuable knowledge and generous contributions, even in these challenging times.
We are proud of all of these efforts and grateful for your strong and
ongoing support.
Annual Report 2012
P at h s
of
Progress
35
D a na -F a r b e r C a n c e r I n s t i t u t e I n c .
and
Subsidiaries*
Condensed Consolidated Balance Sheets
For the Fiscal Year Ended Sept. 30
2012
2011
(Dollars in thousands)
Assets
Current Assets
248,483
Investments
621,266549,397
Debt Service Reserve and Construction Fund
Property, Plant, and Equipment, net
Contributions Receivable, less current portion
Other Assets
Total Assets
201,452
13,209
9,173
644,775
656,888
55,786
61,365
21,529
9,347
$1,605,048$1,487,622
Liabilities and Net Assets
Current Liabilities
174,255
166,734
Long-Term Debt and Other Liabilities
394,630
379,805
Net Assets
Unrestricted
477,225
445,625
Temporarily Restricted
406,939
351,538
Permanently Restricted
151,999
143,920
Subtotal Net Assets1,036,163
941,083
Total Liabilities and Net Assets
$1,605,048$1,487,622
Summary Statistical Information
(unless otherwise noted, includes adult and pediatric patients)
Infusion Treatments
123,440
117,974
Outpatient MD Visits
225,479
212,908
Number of Licensed Beds (as of year-end)
Adult Inpatient Discharges
Clinical Trials (open to patients at Dana-Farber,
30
30
1,134
1,060
721
694
including therapeutic and nontherapeutic trials)
* Subsidiaries include Dana-FarberInc. and Dana-Farber Trust.
36 P at h s
of
Progress
/
Annual Report 2012
www.dana-farber.org
and
Subsidiaries
Condensed Consolidated Statements of Operations and Changes in Net Assets
Fiscal Year 2012 Income
For the Fiscal Year Ended Sept. 30
2012
2011
(Dollars in thousands)
Revenues
Research
316,347
345,529 Patient Service, net
602,928
540,815
57,067
55,441
Unrestricted Contributions and Bequests
Other Operating
16,709
16,504
Total Revenues
Expenses
$993,051
$958,289
Direct Research
271,767
292,839
Unrestricted Contributions and Bequests: 6%
Direct Patient Care
394,297
368,871
Other Revenue: 1%
Research: 32%
Patient Service: 61%
Indirect
Total Operating Expenses
Operating Income
311,676299,075
$977,740
$960,785
15,311 (2,496)
Investment Return, net
18,928
Fiscal Year 2012 Expenses
8,279
Interest Rate Swap Agreement
Net interest received/(paid)
(5,518) Change in fair value
Other
(4,965)
(5,536)
(8,699)
(349)
(Deficit)/Excess of Revenues Over Expenses23,407 (8,452)
Other
8,193
42,517
(Decrease)/Increase in Temporarily Restricted Net Assets
55,401
5,043
(Decrease)/Increase in Permanently Restricted Net Assets
8,079
8,347
(Decrease)/Increase in Net Assets
Net Assets at Beginning of Year
Net Assets at End of Year
Research: 34%
Patient Service: 49%
Management and General: 17%
95,08047,455
941,083
893,628
$1,036,163
$941,083
5% of patient-care expenses
is directed to Community Benefits
Comparison of
Private Support
200
150
The preceding selected consolidated financial data as of Sept. 30, 2012, and 2011 (except for
the summary statistical data) have been derived from the consolidated financial statements
of Dana-Farber Cancer Institute Inc., Dana-Farber Inc., and Dana-Farber Trust. These have
been audited by Ernst & Young, LLP, independent auditors.
100
50
{
($ in millions) 0
In FY 2012, the Institute raised $168 million in new gifts and new pledges through its
Division of Development and the Jimmy Fund, and through the Friends of Dana-Farber
Cancer Institute. For accounting purposes, the financial charts reflect new gifts and
new pledges calculated at present value, excluding commitments the Institute could not
record due to conditionality.
Annual Report 2012
P at h s
of
2011
2012
Foundation Grants
Permanently Restricted
Temporarily Restricted
Gifts for Current Use
Unrestricted Contributions and Bequests
Progress
37
Corporate
Officers
Board Committees
and C hairpersons
Board Development
Committees and Chairpersons
Joshua Bekenstein
Chairman
Audit Committee
John J. O’Connor
President and
Chief Executive Officer
Committee on Facility Planning
and Construction
John L. Marshall III
Gary L. Countryman
Vice Chairman
Communications Committee
Harvey Rosenthal
Marjorie B. Salmon
Development Committee
Charles A. Dana III
Richard P. Morse
James W. Rappaport
(Co-Chair, Trustee Annual Fund)
Jean S. Sharf
(Co-Chair, Trustee Annual Fund)
Richard P. Morse
Vice Chairman
Community Programs Committee
Amy Z. Reiner
Jerry M. Socol
Vincent M. O’Reilly
Vice Chairman
Gift Planning Committee
Barbara L. Sadowsky
James P. Sadowsky
Compensation Committee
Gary L. Countryman
Richard A. Smith
Vice Chairman
Executive Committee
Joshua Bekenstein
Brian J. Knez
Treasurer
Finance Committee
Brian J. Knez
Karen S. Bird, MPH
Assistant Treasurer
Governance Committee
Neal J. Curtin, Esq.
Secretary
Investment Committee
Robert Stansky
Richard S. Boskey, Esq.
Assistant Secretary
Joint Committee on
Quality Improvement
and Risk Management
Vincent M. O’Reilly
Robert J. Sachs
Kathleen Harkey
Assistant Secretary
Medical Staff Appointments Committee
Gary L. Countryman
Trustee Science Committee
Malcolm S. Salter
The governance listings in this annual report are current as of Jan. 1, 2013.
38 P at h s
of
Progress
/
Annual Report 2012
www.dana-farber.org
Trustees
Andrea R. Abraham
Gerhard R. Andlinger
David Auerbach
David E. Barrett
Joshua Bekenstein 2*
Robert Belfer
Edward J. Benz Jr., MD 2*
Roger Berkowitz *
Amy S. Berylson *
Armin G. Biller
John F. Blais
Betty Ann Blum
Justice Stephen G. Breyer 1
Hon. Frederick L. Brown *
Craig A. Bunnell, MD
J. Gary Burkhead
Kennett F. Burnes, Esq.
Stephen J. Burton
Richard A. Cantor
Michael A. Champa *
George Cloutier
Marc A. Cohen *
Joseph F. Cotter 1
Gary L. Countryman 2*
Howard Cox*
Neal J. Curtin, Esq. 2*
Alice Cutler
Charles A. Dana III *
Lee S. Daniels
Nader F. Darehshori *
Laura Weissman Davis
David A. Dechman
Peter I. deRoetth
Emily F. DiMaggio
James H. Donovan
James Dow
John P. Dunfey
Donald Dwares
Michael R. Eisenson, Esq.
Edward Eskandarian
John S. Farber
Stephen B. Farber
Thomas A. Farrington *
James L. Fine *
Stephen A. Fine *
Deborah S. First
Robert C. First *
Charles Forman
Emil Frei III, MD
Michael Frieze
M. Dozier Gardner
Arthur Gelb, ScD 2*
Nancy Q. Gibson *
William M. Gillen
Michael S. Gordon
Abraham D. Gosman *
James D. Griffin, MD
Richard Grubman *
Judith Hale
David V. Harkins 2*
Marian L. Heard
Francis Heller *
Alan J. Hirschfield
Thomas F. Holt Jr., Esq.
Barbara H. Hugus, PhD 1
Alison Poorvu Jaffe
Jane P. Jamieson *
Glenn M. Johnson
Hon. Scott L. Kafker *
William S. Karol
Stephen B. Kay
Phyllis Swerling Kellem 1
Patricia D. Kelsey 1
Michele Kessler
Michael J. Kittredge
Brian J. Knez 2*
Ruth Kopelman 1
Steven P. Koppel *
Paul B. Kopperl *
Stephen P. Koster, Esq. *
Daniel A. Kraft
Robert K. Kraft 2*
Sandra G. Krakoff 2*
Phyllis Krock
Althea Lank
Jonathan Lavine
Kenneth H. M. Leet
John J. Legere *
Kenneth Levine
Roger A. Lockwood *
Richard K. Lubin 2*
Bradley A. Lucas *
Lawrence Lucchino
Hildegarde E. Mahoney
Peter A. Maich
Roger M. Marino
John L. Marshall III 2*
Thomas J. May
William F. McCall Jr.
Joseph C. McNay *
William F. Meagher *
David S. Moross
Richard P. Morse 2*
David G. Nathan, MD *
George Neale
Charles Nirenberg
Marci Noller
Joseph E. Norberg *
Brian O’Connor
John J. O’Connor *
Vincent M. O’Reilly 2*
Stuart H. Orkin, MD
Edward O. Owens *
Peter Palandjian *
Arthur M. Pappas, MD 1
Theodore Pasquarello *
Jean F. Pearlstein 2*
David B. Perini *
Eileen Perini *
Jennifer Perini *
Steven P. Perlmutter, Esq. *
Susan M. Poduska *
Elizabeth Pohl *
William J. Poutsiaka
John M. Randolph 1
Kathleen M. Randolph, PhD 1
James W. Rappaport *
John P. Reardon Jr.
Shari E. Redstone
Sumner M. Redstone 1
Amy Z. Reiner *
Robert L. Reynolds *
Barrett J. Rollins, MD, PhD
Ann M. Rosenberg *
Harvey Rosenthal 2*
Edward F. Rover *
Robert J. Sachs, Esq. *
Barbara L. Sadowsky
James P. Sadowsky
Marjorie B. Salmon *
Malcolm S. Salter *
H. Terrence Samway
Rebecca Sanders *
Judith P. Schlager
Richard N. Seaman
Thomas Sellers
Laura Sen *
Paul J. Severino
Jean S. Sharf
Lawrence N. Shulman, MD
Paula L. Sidman
Richard A. Smith 2*
Mrs. Susan F. Smith *
Ruth F. Snider
Jerry M. Socol *
Gloria H. Spivak 2*
Robert Stansky
William Starr
James M. Stoneman 1
Patrick J. Sullivan
Ronald S. Sullivan Jr. *
Jean C. Tempel *
Beth F. Terrana *
David T. Ting *
Delores Barr Weaver
J. Wayne Weaver
Karen L. Webster
T. Conrad Wetterau
Gregory A. White
Frederica M. Williams *
Winnie W. Wong, Phd
Carl Yastrzemski 1
George J. Yost III, Esq. *
Mortimer B. Zuckerman 1
1
2
*
+
Honorary Trustee
Member, Executive Committee
Governing Trustee
Deceased
The governance listings in this annual report are current as of Jan. 1, 2013.
Annual Report 2012
P at h s
of
Progress
39
Executive Leadership
President and Chief Executive Officer
Karen S. Bird, MPH
Chief Financial Officer and
Assistant Treasurer
Dorothy E. Puhy, MBA
Executive Vice President and
Chief Operating Officer
Chief Scientific Officer
Susan D. Block, MD
Chair, Psychosocial Oncology and
Palliative Care
Stephen E. Sallan, MD
Chief of Staff Emeritus
Senior Vice President; General Counsel;
and Chief Governance Officer
Craig Bunnell, MD, MPH, MBA
Chief Medical Officer
Lawrence N. Shulman, MD
Chief of Staff; Senior Vice President,
Medical Affairs; Director of Regional
Development; and Director of Center for
Global Cancer Medicine
Steven R. Singer, MPA
Senior Vice President, Communications
Beverly R. Ginsburg Cooper, MBA
Senior Vice President, Research
Scott J. Swanson, MD
Chief Surgical Officer
George D. Demetri, MD
Senior Vice President,
Experimental Therapeutics
Annick D. Van den Abbeele, MD
Chief of Imaging
Pasi A. Jänne, MD, PhD
Philip W. Kantoff, MD
Xiaole (Shirley) Liu, PhD
Dennis C. Lynch, MD, PhD*
Lee M. Nadler, MD
Stuart H. Orkin, MD
Giovanni Parmigiani, PhD
Thomas M. Roberts, PhD
Barrett J. Rollins, MD, PhD*
Rosalind A. Segal, MD, PhD
Jane C. Weeks, MD, MSc
Department of Medical Oncology
James D. Griffin, MD, Chair
Department of Biostatistics
and Computational Biology
Giovanni Parmigiani, PhD, Chair
Paul J. Catalano, ScD, Associate Chair
Department of Cancer Biology
Chair, Medical Oncology
The governance listings in this annual report
are current as of Jan. 1, 2013.
Jay R. Harris, MD
Chair, Radiation Oncology
Research Leadership
Department of Cancer
Immunology and AIDS
Deborah Hicks, MA
Senior Vice President, Human Resources
Professional Administration
Harvey Cantor, MD, Chair
Kai Wucherpfennig, PhD, Co-Chair
President, DFCI; Director, DF/HCC
Joseph O. Jacobson, MD, MSc
Chief Quality Officer
Beverly Ginsburg Cooper, MBA
Senior Vice President, Research, DFCI;
Associate Director, Administration,
DF/HCC
Chief Clinical Research Officer
Lee M. Nadler, MD
Senior Vice President,
Experimental Medicine
Chief Clinical Research Officer
Stuart H. Orkin, MD
Chair, Pediatric Oncology
Chief Scientific Officer
Maria Papola, MHA
Senior Vice President, Institute Operations
Susan S. Paresky, MBA
Senior Vice President, Development
Patricia Reid Ponte, RN, DNSc, FAAN
Senior Vice President, Patient Care
Services; Chief Nursing Officer
40 P at h s
of
Progress
Thomas M. Roberts, PhD, Co-Chair
Charles D. Stiles, PhD, Co-Chair
Department of Pediatric Oncology
Stuart H. Orkin, MD, Chair
Department of Psychosocial Oncology
and Palliative Care
Susan D. Block, MD, Chair
Department of Radiation Oncology
Jay R. Harris, MD, Chair
*
Ex-officio
Executive Committee for Research
William G. Kaelin Jr., MD, Chair
Harvey Cantor, MD
Alan D. D’Andrea, MD
Levi A. Garraway, MD, PhD
Beverly R. Ginsburg Cooper, MBA*
Nathanael Gray, PhD
/
Annual Report 2012
www.dana-farber.org
Friends of Dana-Farber Cancer Institute
Co-Presidents
Lauren Frei*
Marci Noller
Vice Presidents
Rebecca Latimore*
JoAnne Marshall
Cristina S. Peters*
Dana Gerson Unger
Treasurer
Debbie Maltzman
Recording Secretary
Amye Kurson
Governing Directors
Suzanne Fisher Bloomberg
Jen Cunningham Butler
Blake Chanowski
Kim Chisholm
Alice Cutler*
Sarah Duggan
Jayne Bennett Friedberg*
Susan Mendoza Friedman
Micki Hirsch
Nicole Hirsch
Jane M. Holt*
Marci Katz
Audra Lank
Maxene Lieberman
Jane B. Mayer
Jane R. Moss
Jean F. Pearlstein*
Rachel Police
Lesley Prowda
Nancy L. Socol*
Members at Large
Suzanne Chapman
Tobi Marram
Courtney Tatelman
Susan Wilk
Honorary Directors
Jean Speare Canellos*
Barbara Lapp
Louise S. Shivek
Susan F. Smith
Marilyn N. Wolman
Founding President
Sheila Driscoll Cunningham**
D a na -F a r b e r I n c .
Program Manager
Sarah M. Duggan
Program Assistant
Joniece Leonard
Corporate Officers
Art Program Coordinator
Elaine L. Tinetti
Joshua Bekenstein
Chairman
* Past President
** Deceased
President and Chief Executive Officer
Brian J. Knez
Treasurer and Vice Chairman
Trustee Chairs
President’s Visiting
Committees
Karen S. Bird, MPH
Assistant Treasurer
Secretary
Basic Science
William Karol, Co-Chair
Edward F. Rover, Co-Chair
Gastrointestinal Cancer Center
Michele Kessler, Co-Chair
Peter Palandjian, Co-Chair
Assistant Secretary
Kathleen Harkey
Assistant Secretary
Trustees
Hematologic Oncology
Marc A. Cohen, Co-Chair
Alan Hirschfield, Co-Chair
Joshua Bekenstein
Brian J. Knez
Robert Stansky
The Jimmy Fund
Nancy Gibson, Co-Chair
Patrick J. Sullivan, Co-Chair
The Lank Center for
Genitourinary Oncology
Thomas A. Farrington, Chair
Althea and Bertram Lank, Honorary
Co-Chairs
Dana-Farber Inc. manages the investments
of Dana-Farber Cancer Institute Inc.
The governance listings in this annual
report are current as of Jan. 1, 2013.
The Lowe Center for
Thoracic Oncology
William M. Gillen, Co-Chair
Susan M. Poduska, Co-Chair
Pediatric Oncology
Alison Poorvu Jaffe, Co-Chair
T. Conrad Wetterau, Co-Chair
Susan F. Smith Center for
Women’s Cancers
Mrs. Susan F. Smith, Chair
Jane P. Jamieson, Co-Chair
Annual Report 2012
P at h s
of
Progress
41
Non-profit Org.
U.S. Postage
P A I D
Dana-Farber
Dana-Farber Cancer Institute
450 Brookline Ave.
Boston, MA 02215-5450
617-632-4090
www.dana-farber.org
A teaching affiliate of
Harvard Medical School
Young dancers visited Dana-Farber in December as part of a performance to benefit breast and ovarian cancer research. The visit was
the result of the Friends of Dana-Farber’s partnership with the nonprofit Dancing for a Cure, which raises funds for cancer research.

Trouble Makers - Dana-Farber Cancer Institute

Transcription

Similar documents

we removed a tumor from her heart. her kids filled it

Exsanguination - Northern Health

A Kids` Brain Tumor Cure Foundation: driving forward research for

AMPULLA OF VATER STAGING FORM

Be the one to save a life. - Dana

Cervix Uteri Cancer Staging - American Joint Committee on Cancer

angionesesis emt metastasis

/ Print JoH_Poster_2016 - Fox Valley Brain Tumor Coalition

Impact - Dana-Farber Cancer Institute