Tyt-Spis-tre ci-2007-1 - Polish Journal of Microbiology

POLSKIE TOWARZYSTWO MIKROBIOLOGÓW
POLISH SOCIETY OF MICROBIOLOGISTS
Polish Journal of Microbiology
I am pleased to inform you that Polish Journal of Microbiology has been selected
for coverage in Thomson Scientific products and customers information services.
Beginning with No 1, Vol. 57, 2008 information on the contents of the PJM will be
included in: Science Citation Index Expanded (ISI) and Journal Citation Reports
(JCR)/Science Edition.
Miros³awa W³odarczyk
Editor in Chief
2008
Polish Journal of Microbiology
formerly Acta Microbiologica Polonica
2008, Vol. 57, No 4
CONTENTS
ORIGINAL PAPERS
Expression of Bombyx mori nucleopolyhedrovirus ORF76 in permissive and non-permissive cell lines by a novel
Bac-to-Bac/BmNPV baculovirus expression system
SU W.-J., WU Y., WU H.-L., ZHU S.-Y., WANG W.-B. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 271
Stable sulfur isotope fractionation by the green bacterium Chlorobaculum parvum during photolithoautotrophic growth
on sulfide
KELLY D.P. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275
Exopolysaccharide production by Bacillus strains colonizing packaging foils
SZUMIGAJ J., ¯AKOWSKA Z., KLIMEK L. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281
"-Amylase production by Streptomyces erumpens MTCC 7317 in solid state fermentation using response surface
methodology (RSM)
KAR S., RAY R.C., MOHAPATRA U.B. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
Screening for soil streptomycetes from North Jordan that can produce herbicidal compounds
BATAINEH S.M.B., SAADOUN I., HAMEED K.M., ABABNEH Q. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 297
Macrolide-lincosamide-streptogramin B resistant phenotypes and genotypes for methicillin-resistant Staphylococcus aureus
in Turkey, from 2003 to 2006
GUL H.C., KILIC A., GUCLU A.U., BEDIR O., ORHON M., BASUSTAOGLU A.C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307
Cell surface hydrophobicity of Bacillus spp. as a function of nutrient supply and lipopeptides biosynthesis and its role in
adhesion
CZACZYK K., BIA£AS W., MYSZKA K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 313
Scanning electron microscopy and energy-dispersive X-ray microanalysis of Penicillium brevicompactum treated
with cobalt
FARRAG R. M., MOHAMADEIN M. M., MEKAWY A.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 321
Isolation and characterization of a Cr(VI) reducing Bacillus firmus strain from industrial effluents
SAU G.B., CHATTERJEE S., SINHA S., MUKHERJEE S.K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 327
SHORT COMMUNICATION
Selective isolation of Bacillus thuringiensis from soil by use of L-serine as minimal media supplement
ANDRZEJCZYK S., LONC E. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 333
INSTRUCTION TO AUTHORS AVAILABLE AT www.microbiology.pl/pjm
Polish Journal of Microbiology
2008, Vol. 57, No 4, 271–274
ORIGINAL PAPER
Expression of Bombyx mori Nucleopolyhedrovirus ORF76
in Permissive and Non-permissive Cell Lines
by a Novel Bac-to-Bac/BmNPV Baculovirus Expression System
WU-JIE SU, YAN WU, HUI-LING WU, SHAN-YING ZHU and WEN-BING WANG*
Institute of Life Sciences, JiangSu University, Xuefu Road 301, Zhenjiang 212013, P.R.China
Received 1 July 2008, revised 3 September 2008, accepted 11 September 2008
Abstract
Open reading frame 76 of Bombyx mori nucleopolyhedrovirus (BmNPV), designated as Bm76, is a gene whose function is completely
unknown. With EGFP fused to the 3’ terminal of Bm76 as the reporter gene and BmNPV bacmid as the expression vector, a recombinant
bacmid was successfully constructed expressing Bm76-EGFP fusion protein under the control of polyhedrin promoter in Bombyx mori
cells (Bm cells), BmNPV’s permissive cell line, laying the foundation for rescue experiment of Bm76 deletion mutant. Moreover,
the supernatant from Bm cells transfected with the recombinant bacmid was used to infect Trichoplusia Ni cells (Tn cells), BmNPV’s
non-permissive cell line. Unexpectedly, the expression of Bm76-EGFP fusion protein in some Tn cells was detected, implying that viral
DNA was replicated in these cells. The causes are being studied for the inability of BmNPV to produce enough viable budded viruses
in Tn cells despite of viral DNA replication.
K e y w o r d s: Bac-to-Bac/BmNPV baculovirus expression system; EGFP; host range; ORF76; rescue experiment
Introduction
The baculovirus expression system has been employed widely as a powerful expression vector for the
production of recombinant proteins under the control
of powerful very late promoters, p10 or polyhedrin
promoter. Traditionally, recombinant baculoviruses
were generated by homologous recombination in insect cells which takes at least 40 days because of multiple rounds of purification of viruses. Luckow et al.
(1993) developed an AcNPV bacmid system. In this
system, recombinant baculoviruses were generated by
site specific transposition in Escherichia coli which
needs no more than 10 days due to the elimination of
multiple rounds of purification of viruses. However,
AcNPV bacmid is not infectious to Bm cells and silkworm, and thus AcNPV bacmid system can not be applied in Bm cells and silkworm. Recently, a BmNPV
bacmid system had been developed, and the BmNPV
bacmid is infectious to Bombyx mori cells (Bm cells)
and silkworm (Motohashi et al., 2005). Using this
novel system, some recombinant proteins have been
produced in Bm cell lines or silkworms, such as spi-
der flagelliform silk protein and Superoxide dismutase
(Miao et al., 2006; Yue et al., 2006).
Open reading frame 76 of BmNPV (Bm76, nt 7126371748 of GenBank accession number NC_001962) is
486-bp in size and its function is completely unknown
(Gomi et al., 1999). Using BLAST in NCBI, we
found that Bm76 has homologues in almost all the
sequenced baculoviurses. However, none of these
homologues has been characterized. Moreover, there
is no conserved motif in the predicted amino acid
sequence of Bm76 product. Therefore, in order to study
its role, a Bm76 deletion mutant should be generated
first. There are many steps in the construction of
a Bm76 deletion mutant, and mutations may arise in
other genes. Accordingly, we should confirm that the
observed phenotype resulted from the deletion, not
from second site mutations. To achieve this, we should
construct a repair virus in which a copy of Bm76 under
the control of its native promoter or a positive promoter
is inserted into the polyhedrin locus of the Bm76 deletion mutant (Lin and Blissard, 2002). However, Bm76
promoter has not been characterized yet, and a positive promoter should be used. According to Iwanaga
* Corresponding author: W. Wang, Institute of Life Sciences, Jiangsu University, Xuefu Road 301, Zhenjiang 212013, China;
phone: (86) 511 82927891; e-mail: [email protected]
272
Su W.-J. et al.
et al. (2004), Bm76 has a similar expression pattern
with polyhedrin gene. Therefore, polyhedrin promoter
can be used as a positive promoter in repair virus.
In this study, in order to lay the foundation for the
rescue experiment of Bm76 deletion mutant, we investigated the feasibility of expressing Bm76 under
the control of polyhdrin promoter in Bm cells by using
this novel system. Moreover, with Bm76-EGFP as reporter gene, we explored the infection of Trichoplusia
Ni cells (Tn cells) with the recombinant bacmid expressing Bm76-EGFP.
4
tamicin, and tetracycline were selected, streaked onto
fresh plates to verify the phenotype. Bacmid DNA
was isolated by using the FlexiPrep kit (Amersham
Pharmacia Biotech) and then analyzed by PCR with
the M13 forward and M13 reverse primers. The PCR
conditions were 1 cycle at 94°C for 5 min; 35 cycles
Experimental
Material and Methods
Plasmids and cell line. Plasmid pFastBac1 and
the E. coli DH10Bac/BmNPV were supplied by Prof.
E.Y. Park and Prof. K. Maenaka (Motohashi et al.,
2005). pBacPAK-EGFP was previously constructed
in our laboratory (unpublished). Bm cell line, originated from ovary, was preserved in our laboratory and
cultured at 27°C with GIBCO medium supplemented
with 10% fetal bovine serum.
Reagent and medium. FuGENE 6 transfection reagent was the product of Roche Applied Science, USA.
The Grace’s insect cell culture medium (GIBCO) was
purchased from Invitrogen.
Construction of recombinant donor plasmid
pFastBac-Bm76-EGFP. With BmNPV genomic DNA
as template, Bm76 was PCR amplified by using the
following primers: forward: 5’-ATAGGATCCATGGC
GACTAGCAAAAC-3’; reverse: 5’-GACGGTACCA
TTTACAATTTCAATTCCAAT-3’ (BamHI and KpnI
sites were underlined). The PCR product of Bm76 was
digested with BamHI and KpnI and then cloned into
BamHI-KpnI sites of PUC18 to generate PUC-Bm76.
PUC-Bm76 was sequenced, and then Bm76 was excised from PUC-Bm76 by digestion with BamHI and
KpnI. The excised Bm76 was cloned into BamHIKpnI sites of pBacPAK-EGFP to generate pBacPAKBm76-EGFP. Bm76-EGFP was excised from pBacPAKBm-EGFP by digestion with BamHI and EcoRI, and
then cloned into the BamHI-EcoRI sites of pFastBac1,
to generate pFastBac-Bm76-EGFP.
Construction and isolation of recombinant
bacmid. pFastBac-Bm76-EGFP was transformed into
E. coli DH10Bac/BmNPV where transposition occurred. After 6-h incubation at 37°C in SOC medium,
transformed cells were plated onto LB media containing 50 µg/ml of kanamycin, 7 µg/ml of gentamicin, 10 µg/ml of tetracycline, 100 µg/ml of X-Gal,
and 40 µg/ml of isopropyl-$-D-thiogalactopyranoside
(IPTG). Plates were incubated at 37°C for a minimum
of 24 h. White colonies resistant to kanamycin, gen-
Fig. 1. Electrophoresis identification of recombinant pFastBacBm76-EGFP and PCR product. Lane 1, molecular marker
(8/HindIII); Lane 2, pFastBac-Bm76-EGFP digested by BamHI
and KpnI; Lane 3, PCR product of Bm76; Lane 4, molecular
marker (DL-2000)
Fig. 2. Recombinant bacmid was analyzed by PCR with the M13
forward and M13 reverse primers. PCR products were electrophoresized on a 0.8% agarose gel. Lane 1, molecular marker
(8/HindIII); lane 2, PCR product of recombinant bacmid; lane 3,
PCR product of non-recombinant bacmid; lane 4, molecular
marker (DL-2000)
4
Expression of Bombyx mori nucleopolyhedrovirus ORF76
at 94°C for 45 s, 55°C for 45 s, and 72°C for 5 min;
and 1 cycle at 72°C for 10 min.
Recombinant bacmid comfirmed by PCR was transfected into Bm cells using FuGENE 6 transfection reagent according to manual.
Results
Generation of pFastBac-Bm4-EGFP. 483-bp
Bm76 was PCR amplified from BmNPV genomic
DNA (Fig. 1, lane 3). pFastBac-Bm76-EGFP digested
with BamHI and KpnI generated three fragments:
pFastBac (4.7 kp), Bm76(483 bp) and a KpnI-KpnI
fragment containing EGFP (800 bp) (Fig. 1, lane 2).
This is because EGFP is flanked by two KpnI sites
due to the cloing of Bm76-EGFP into BamHI-EcoRI
sites of pFastBac1, leaving the KpnI site of pFastBac1
intact. These results showed the successful construction of pFastBac-Bm76-EGFP.
273
Identification of recombinant bacmid. Recombinant bacmid DNA is greater than 128 kb in size, so
restriction analysis is difficult to perform with DNA
of this size. PCR analysis was used to identify recombinant bacmid. The bacmid contains M13 forward
(–40) and M13 reverse priming sites flanking the
mini-attTn7 site, facilitating PCR analysis. If bacmid
is not transposed with donor plasmid, PCR product
of the bacmid (non-recombinant bamcid) was about
300 bp (Fig. 2, lane 3). If the bacmid is transposed
with donor plamid, PCR product of the bacmid (recombinant bacmid) was about 2000 + 300 bp plus the
size of the insert. Therefore, PCR product of recombinant bacmid, the bacmid transposed with pFastBacBm76-EGFP, was about 3.5 kb (Fig. 2, lane 2).
Expression of Bm76-EGFP fusion protein in
Bm cells. At 72 h post transfection, Bm cells transfected with recombinant bacmid showed signs of infection such as detachment of cells from the disk and
rounding of cells (Fig. 3A). To detect the expression
Fig. 3. Bm cells transfected with the recombinant bacmid were observed under bright field illumination (A)
and under blue light illumination (B)
Fig. 4. Tn cells infected with the supernatant from Bm cells transfected with the recombinant bacmid
were observed under bright field illumination (A) and under blue light illumination (B)
274
4
Su W.-J. et al.
of Bm76-EGFP fusion protein, cells were examined
by fluorescent microscope. Fluorescent signal was
detected in most of the cells (Fig. 3B), showing the
successful expression of Bm76-EGFP fusion protein
under the control of polyhedrin promoter in Bm cells.
Expression of Bm76-EGFP fusion protein in Tn
cells. The supernatant from Bm cells transfected with
the recombinant bacmid was used to infect Tn cells.
At 72 h post infection, Tn cells showed no notable
sighs of infection (Fig. 4A). However, fluorescent signal was observed in some Tn cells when Tn cells were
examined by fluorescent microscope (Fig. 4B).
fact that the BmNPV-K1 Woo et al. used also caused
more pronounced cytopathic effects in Sf9 cells than
the strain used by Martin and Croizier (1997). To gain
more knowledge on host range, the causes are being
studied for the inability of BmNPV to produce enough
viable budded viruses in Tn cells.
Discussion
Literature
To quickly and easily detect the expression of Bm76,
we used EGFP fused to the 3’ terminal of Bm76 as the
reporter gene. The expression of Bm76-EGFP fusion
protein could be detected by using fluorescent microscope without complicated assays (Fig. 3B and 4B).
The strong fluorescent signal in Bm cells (Fig. 3B)
showed that the expression of Bm76-EGFP fusion
protein could be driven efficiently by polyhedrin promoter at the polyhedrin locus, laying the foundation
for the rescue experiment of Bm76 deletion mutant.
According to Iwanaga et al. (2004), apart from Bm76,
many BmNPV genes such as ORF47, ORF121 and
ORF122 have a similar expression pattern with
polyhedrin promoter. Therefore, polyhedrin promoter
can be also used as a positive promoter to drive the
expression of these genes in repair viruses.
Late and very late promoters are activated after
viral DNA replication (Durantel et al., 1998), and
polyhedrin promoter is very late promoter. Therefore,
the expression of Bm76-EGFP fusion protein under
the control of polyhedrin promoter in some Tn cells
(Fig.4B) showed that viral DNA replication was carried out in these cells. However, fluorescent signal
was observed in only a small number of Tn cells, indicating that few viable budded viruses, if any, were
produced despite of viral DNA replication. The result
is consistent with the lack of cytopathic effects observed (Fig.4A). However, our result is a little different from that of Woo et al. (2007) who observed pronounced cytopathic effects in Tn cells infected with
recombinant BmNPV strain (BmNPV-K1) harboring
the E. coli lacZ gene rather than the polyhedrin gene.
The difference may be caused by different BmNPV
strains we used. The possibility is supported by the
Durantel D., G. Croizier, M. Ravallec and M.L. Ferber. 1998.
Temporal expression of the AcMNPV lef-4 Gene and subcellular
localization of the protein. Virology 241: 276–284.
Gomi S., K. Majima and S. Maeda. 1999. Sequence analysis of
the genome of Bombyx mori nucleopolyhedrovirus. J. Gen. Virol.
80: 1323–1337.
Iwanaga M., K. Takaya, S. Katsuma, M. Ote, S. Tanaka,
S.G. Kamita, W.K. Kang, T. Shimada and M. Kobayashi.
2004. Expression profiling of baculovirus genes in permissive and
nonpermissive cell lines. Biochem. Biophys. Res. Commun. 323:
599–614.
Lin G. and G.W. Blissard. 2002. Analysis of an Autographa
californica multicapsid nucleopolyhedrovirus lef-6-Null virus:
LEF-6 is not essential for viral replication but appears to accelerate
late gene transcription. J. Virol. 76: 5503–5514.
Luckow V.A., S.C Lee, G.F. Barry, and P.O. Olins. 1993. Efficient generation of infectious recombinant baculoviruses by sitespecific transposon-mediated Insertion of foreign genes into
a baculovirus genome propagated in Escherichia coli. J.Virol. 67:
4566–4579.
Martin O. and G. Croizier. 1997. Infection of a Spodoptera
frugiperda cell line with Bombyx mori nucleopolyhedrovirus. Vir.
Res. 47: 179–185.
Miao Y.G., Y.S. Zhang, K. Nakagaki, T.F Zhao., A.C. Zhao,
Y. Meng, M. Nakagaki, E.Y. Park and K. Maenaka. 2006.
Expression of spider flagelliform silk protein in Bombyx mori cell
line by a novel Bac-to-Bac/BmNPV baculovirus
expression system. Appl. Microbiol. Biotechnol. 71: 192–199.
Motohashi T., T. Shimojima, T. Fukagawa, K. Maenaka and
E.Y. Park. 2005. Efficient large-scale protein production of larvae
and pupae of silkworm by Bombyx mori nuclear polyhedrosis virus
bacmid system. Biochem. Biophys. Res.Commun.326: 564–569.
Woo S.D., J.Y. Roh, J.Y. Choi and B.R. Jin. 2007. Propagation
of Bombyx mori nucleopolyhedrovirus in nonpermissive insect
cell lines. J. Microbiol. 45: 133–138.
Yue W.F., Y.G. Miao, X.H. Li, X.F. Wu, A.C. Zhao and
M. Nakagaki. 2006. Cloning and expression of manganese superoxide dismutase of the silkworm, Bombyx mori by Bac-to-Bac/
BmNPV Baculovirus expression system. Appl. Microbiol. Biotechnol. 73: 181–186.
Acknowledgements
This work was supported by the 973 National Basic Research
Program of China (2005CB121005); the Six-Field Top programs
of Jiangsu Province; National Natural Science Foundation of
Jiangsu Education Committee (06KJD180043); and Innovation
Foundation for Graduate Students of Jiangsu Province.
Polish Journal of Microbiology
2008, Vol. 57, No 4, 275–279
ORIGINAL PAPER
Stable Sulfur Isotope Fractionation by the Green Bacterium Chlorobaculum parvum
During Photolithoautotrophic Growth on Sulfide
DONOVAN P. KELLY*
Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK
Received 30 October 2008, accepted 10 November 2008
Abstract
Growing cultures of the green obligate photolithotroph, Chlorobaculum parvum DSM 263T (formerly Chlorobium vibrioforme forma specialis
thiosulfatophilum NCIB 8327), oxidized sulfide quantitatively to elemental sulfur, with no sulfate formation. In the early stages of growth
and sulfide oxidation, the sulfur product became significantly enriched with 34S, with a maximum *34S above +5‰, while the residual sulfide
was progressively depleted in 34S to *34S values greater than –4‰. As oxidation proceeded, the *34S of the sulfur declined to approach that
of the initial sulfide when most of the substrate sulfide had been converted to sulfur in this closed culture system. No significant formation
of sulfate occurred, and the substrate sulfide and elemental sulfur product accounted for all the sulfur provided throughout oxidation. The
mean isotope fractionation factors (g) for sulfide and sulfur were equivalent at g values of –2.4‰ and +2.4‰ respectively. The significance
of the experimentally-observed fractionation to the 34S/32S ratios seen in natural sulfur-containing minerals is considered.
K e y w o r d s: Chlorobaculum parvum, photolithotrophic sulfur bacteria, stable sulfur isotopes, sulfide oxidation
Introduction
There is a huge literature on sulfur isotope fractionation during bacterial sulfate reduction (e.g. McCready,
1975; Chambers and Trudinger, 1979; Canfield, 2001;
Detmers et al., 2001; Brunner and Bernasconi, 2005;
Hoek and Canfield, 2008), but microbially-assisted
fractionation occurring during the oxidation of inorganic sulfur compounds has received less and only
intermittent study over the past six decades (e.g. Jones
and Starkey, 1957; Kaplan and Rittenberg, 1964;
Ivanov et al., 1976; Fry et al., 1986; Kelly, 2008).
Photolithotrophic sulfur bacteria including Chromatium, Chlorobium and Ectothiorhodospira have been
shown to discriminate between 34S and 32S during the
oxidation of sulfide (Kaplan et al., 1960; Kaplan and
Rittenberg, 1964; Mekhtieva and Kondratieva, 1966,
Ivanov et al., 1976; Chambers and Trudinger, 1979;
Fry et al., 1984, 1986, 1988). The general observations
were that one or both of elemental sulfur or sulfate
produced from sulfide became enriched with 34S, while
residual sulfide became enriched in 32S (Kaplan et al.,
1960; Ivanov et al., 1976; Chambers and Trudinger,
1979). There is some inconsistency in the literature in
that some reports showed little or no enrichment of
34S
into elemental sulfur, while Kaplan et al. (1960)
claimed enrichment of sulfur with 32S rather than 34S,
and insignificant fractionation of sulfur isotopes in the
sulfate produced from sulfide. A partial explanation
for these inconsistencies could be the reported accumulation of polythionates (SnO62–) from sulfide oxidation, which become “sinks” for 34S, in those cases
where production of 32S-enriched sulfur has been
claimed (Kaplan and Rittenberg, 1964; Chambers and
Trudinger, 1979). This was shown markedly to be the
case during the accumulation of 34S-enriched polythionate during thiosulfate oxidation by the aerobic
chemolithotroph Halothiobacillus neapolitanus (Kelly,
2008). The most convincing study of isotope fractionation during sulfide oxidation by a phototroph is that
of Fry et al. (1988), who showed increase of the 32S
content of sulfide during its oxidation to 34S-enriched
sulfur by Chlorobium vibrioforme. The end-product
of sulfide oxidation by Chlorobium vibrioforme was,
however, 34S-depleted sulfate, for which elemental
sulfur was a precursor (Fry et al., 1988). Comparing
different phototrophs, the magnitude of the preferential fractionation of 34S into elemental sulfur observed
by Fry et al. (1984, 1988) ranged from zero (for Chromatium) to +2.0 to +2.4‰ (for Chlorobium). In the
* Corresponding author: D.P. Kelly, Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK; phone:
(44) 24 7657 2907; fax: (44) 24 7652 3701; e-mail: [email protected]
276
Kelly D.P.
case of Chlorobium vibrioforme any sulfate formation
(with sulfate becoming depleted in 34S) concurrent
with the accumulation of 34S-enriched elemental sulfur would have enhanced the observed 34S content of
the residual sulfur intermediate.
No previous study has been reported of the oxidation of sulfide exclusively to sulfur by a green phototrophic bacterium. Quantitative oxidation of sulfide to
sulfur is a property of a number of species of Chlorobiaceae (van Niel, 1931; Kelly, 1974; Cork et al., 1983;
Imhoff, 2003). Data from such sulfur-producers are
clearly needed to complement the observations on
Chlorobium vibrioforme, for which sulfur is only an
intermediate in sulfide oxidation. Chambers and
Trudinger (1979) briefly alluded to a study in which
a Chlorobium strain oxidized sulfide exclusively to
produce sulfur enriched in 34S by about 5‰ (citing
unpublished results of Kelly, Chambers and Rafter).
Those experiments with Chlorobaculum parvum were
conducted in the late 1960s, but never published. The
sulfur isotope fractionation data obtained for sulfide
oxidation have now been reassessed for publication,
as the only comparable work since then has been the
study by Fry et al. (1988). This assessment enabled
the progressive changes in the *34S of the sulfide and
sulfur to be determined, and the sulfur isotope fractionation factors for the stoichiometric oxidation of
sulfide to sulfur to be calculated (Mariotti et al., 1981),
and compared with results of Fry et al. (1988).
Experimental
Materials and Methods
Maintenance and growth of cultures. Chlorobaculum parvum DSM 263T (formerly Chlorobium
vibrioforme forma specialis thiosulfatophilum NCIB
8327; Kelly, 1974; Imhoff, 2003) was originally obtained from Dr June Lascelles in 1967 as “Chlorobium
thiosulfatophilum” NCIB 8327, and maintained in
continuously illuminated anaerobic culture on 4 mM
thiosulfate with 0.5 mM sulfide as described previously
(Kelly, 1974). For isotope discrimination experiments
with sulfide as sole substrate, cultures were grown
with 4 mM Na2S in a nominally sulfate-free medium,
containing (g/l in distilled water): Na2S× 9H2O (1.0),
KH2PO4 (1.0), NH4Cl (1.0), MgCl2 × 6H2O (0.5),
NaHCO3 (2.0), trace metal solution (Pfennig and
Lippert, 1966; 10 ml), 0.1 M HCl (7.5 ml). Traces of
sulfate were present in the initial medium as a result of
sulfate-salts in the trace metal solution, and as a possible trace contaminant in other reagents. Sterilization
was by autoclaving at 110°C for 10 min. Bicarbonate,
sulfide and HCl were sterilized separately and added
while hot to the rest of the medium. To provide as pure
4
and accurate a supply of sulfide as possible, large
sodium sulfide crystals were washed with distilled water and blotted dry before making up 10% (w/v) solutions for sterilization. Cultures were grown at 25°C in
completely filled flat bottles (capacity 570 ml), with
a 3–5% (v/v) inoculum of an actively growing culture.
A layer of sterile paraffin oil was placed on top of the
cultures before sealing the bottles. Illumination was
by two banks of four 40 watt (40 J s–1) fluorescent
tubes placed 30 cm away from both sides of a double
array of bottles. Dark control cultures were bottles
prepared as above, but were wrapped in black paper
and incubated together with the experimental bottles.
Sampling procedures and recovery of sulfide,
sulfur and sulfate for analysis. At intervals from zero
time until 270 h after inoculation, individual replicate
bottles were opened, the paraffin layer removed by
aspiration, and the bottle contents thoroughly mixed.
To recover the residual sulfide, an aliquot (200 ml)
was placed in a Quickfit Drechsel bottle, 10 ml of 1 M
HCl injected through a sealed port, mixed, and sulfide
expelled by bubbling with a flow of nitrogen for 2 h;
the effluent gases were passed into a series of two
traps containing 50 ml 0.2 M AgNO3 to precipitate
sulfide as Ag2S. All the sulfide was recovered in the
first trap. The Ag2S precipitates were recovered by
filtration through 0.45 µm pore-size Millipore filters
(45 mm diameter).
A second aliquot (220 ml) was filtered through
a 1.2 µm pore-size Millipore filter (45 mm diameter) to
recover precipitated sulfur. The filtrate (200 ml) was
assayed to determine any sulfate production, as described below.
Determination of sulfide, sulfur and sulfate, and
sample preparation for isotope ratio mass spectrometry. Sulfide recovered as Ag2S was washed on
the filters with distilled water and transferred to
weighed beakers and air-dried under an infrared lamp
before weighing to estimate sulfide recovery. Standard sulfide solutions treated exactly as for the culture samples showed the procedure to give 100–103%
recovery of the expected weights of Ag2S. Recoveries of sulfide using traps with CdCl2 or ZnCl2 gave
comparably high recoveries, but precipitation with silver was chosen as Ag2S could be used directly for
isotope ratio analyses.
Sulfur recovered on the filters was transferred into
beakers and oxidized by heating on a sand bath for
1–2 h with 50 ml bromine-saturated concentrated
nitric acid with 5 ml HCl and 5 ml 20% (w/v) NaCl.
After standing overnight at 20°C, the liquid was
evaporated to dryness and the residue taken up into
25 ml HCl and again evaporated. The residue was dissolved in 100 ml 0.4 M HCl and sulfate precipitated
by boiling with 30 ml 0.05 M BaCl2. The barium sulfate precipitate was recovered by filtration on to
4
Sulfur isotope fractionation
a 1.2 µm pore-size filter, washed, dried at 120°C, and
weighed. Replication of sulfur recovery among quadruplicate samples was ± 1.5% of the mean recovery.
Sulfate in the filtrates (200 ml) was precipitated
by heating the samples on a boiling water bath with
2 ml HCl and dropwise addition of 0.05 M BaCl2.
After heating for 1 h, sulfate was recovered by filtration, dried and weighed as above.
Samples of Ag2S and BaSO4 recovered as described
above were sent for sulfur isotope ratio analysis to
the Rafter Stable Isotope Laboratory, Institute for
Nuclear Studies, Lower Hutt, New Zealand. *34S values were determined from the 34S/32S ratios of sulfur
in the various samples relative to the Cañon Diablo
troilite standard (Krouse and Coplen, 1997), using the
equation: *34S (‰) = [34S/32S(sample)/ 34S/32S(standard) – 1] × 103. Methods for the analysis of the
34S/32S data are given in the legends to Fig. 1 and 2.
277
its *34S was +5.3‰, progressively declining to a *34S
close to that of the initial substrate-sulfide when
80–90% of the expected sulfur had accumulated
(Fig. 1). The residual sulfide became progressively enriched with 32S, with its *34S declining from about
–0.5‰ when only about 0.8 mM sulfide had been consumed to –4.3‰ when about more than 80% of the
initial sulfide had been oxidized. The data show that
proportional changes in the *34S of sulfide and sulfur
during sulfide oxidation exclusively to elemental sulfur, with no evidence for the formation of transient intermediate sulfur compounds or sulfate: apparent fractionation declined to approach the original sulfide *34S
value when sulfide conversion to sulfur neared 100%.
Estimation of sulfur isotope fractionation factors
(g) for sulfide oxidation and sulfur formation. The
*34S values of Fig. 1 were plotted against the natural
logarithms of the fractions (f) of sulfide consumed
and sulfur produced (where f = 1 and ln f = 0 for the
Results
34S
isotope discrimination during sulfide oxidation by growing cultures of Chlorobaculum parvum.
Illuminated cultures grown with 4 mM sulfide consumed all the substrate in 50–70 h, with the production of sulfur equal to 96 ± 4% (four experiments) of
the sulfide provided. There was no significant formation of sulfate from sulfide or sulfur (even in cultures
incubated in the light for 200 h following sulfide
exhaustion): the sulfate content of ten replicate illuminated cultures (24–270 h after inoculation) and of
a 270 h dark control was constant at about 0.3 mM,
all of which was due to sulfate introduced in the
inoculum cultures. No evidence was obtained for the
existence of any intermediate sulfur compound (e.g.
polythionates) during sulfide oxidation, as the sulfide
and sulfur recovered at each sampling time accounted
for all the inorganic sulfur in the samples. This strain
will also oxidize thiosulfate to sulfate as the photosynthetic electron donor, (Kelly, 1974), and thus has
the capacity to convert the sulfane-sulfur (S–) of thiosulfate to sulfate, but under the conditions of the experiments described here, when sulfide rather than
combined sulfane-sulfur was the substrate, it was converted quantitatively to elemental sulfur.
Marked enrichment of 34S in the sulfur produced
was paralleled by a decrease in the *34S of the residual
sulfide. Fig. 1 shows the *34S values of the sulfur
formed (relative to the *34S of the initial sulfide = 0),
as a percentage of the amount expected for complete
sulfide oxidation (4 mM), and the *34S of the residual
sulfide, as a percentage of the initial 4 mM sulfide.
Fractionation was greatest early in the growth, as expected when the sulfide concentration was highest.
Thus, when less than 0.4 mM sulfur had been formed
Fig. 1. Isotopic changes in sulfide (±) and sulfur (●) during sulfide
oxidation to sulfur by Chlorobaculum parvum.
Changes in *34S of sulfide (initially 100% of the total sulfur present)
and sulfur (initially 0% of total sulfur) are shown relative to the fraction
(%) of sulfur present as sulfide or sulfur. The *34S of the sulfide used
in all the experiments was +8.80 ± 0.26‰: in order to relate the experimental *34S values to that of the substrate-sulfide, the data were recalculated with respect to the 34S/32S of the initial sulfide to normalize the
substrate-sulfide value to *34S = 0‰.
278
4
Kelly D.P.
Discussion
Fig. 2. Isotopic values (*34S) of substrate-sulfide and productsulfur as functions of the natural logarithms of the fractions of the
initial sulfide remaining or of sulfur formed (ln f) during sulfide
oxidation by Chlorobaculum parvum (data of Fig. 1).
Isotope fractionation factors (g, ‰) were calculated from the slopes of
these plots. For irreversible reactions, the g values indicate the expected
difference between the product and its substrate (Mariotti et al., 1981).
A negative g value (for residual sulfide) indicated depletion of 34S in the
substrate, matched by a positive g value in the product (sulfur), in which
the 34S content was increased.
initial 4 mM sulfide and for the 4 mM sulfur expected
for complete oxidation of the added sulfide). The
best-fit lines of plots of *34S values against ln f gave
matching slopes for sulfur and sulfide. Simply combining the two plots showed the best fit line to run
through all the data (Fig. 2). This showed that the
mean decline in the 34S content of the sulfide was paralleled, with 95% confidence, by the increase in the
34S of the sulfur. The isotope discrimination factors
(e) given by the slope of this line were –2.4 for sulfide and + 2.4 for sulfur. The factors are the same
as those calculated for sulfide oxidation to sulfur by
Chlorobium vibrioforme (Fry et al., 1988). This treatment of the results effectively smoothes the data to
reveal the mean fractionation over the whole time period, and obscures the initial *34S increase to + 5–6‰
in the sulfur formed.
The results obtained allow a clear interpretation of
what appears to be a relatively simple physiological
system, in which sulfide and its oxidation product,
elemental sulfur, are the only detectable sulfur species
at all stages of the complete oxidation of the sulfide
provided. The culture method used, a batch culture
with a limited initial sulfide concentration, is a closed
system, so it was expected, and shown, that the greatest change in *34S would occur early in the oxidation,
with progressive decrease as oxidation neared completion. Thus, initially there was high discrimination in
favour of the formation of 34S-elemental sulfur, decreasing as less sulfide remained, but a progressive
increase in the 32S-content of the sulfide showed that
positive discrimination in favour of 34S-sulfide as
a substrate continued throughout oxidation (Fig. 1).
In an open system, such as a continuous flow system
with passage of some excess sulfide, the decreased
*34S of the residual sulfide would be sustained as the
sulfide flowed out of the system. The environmental
relevance of these results is that in habitats permanently rich in sulfide (e.g. from a continuous sulfide
input from bacterial sulfate reduction in an anoxic
sediment), with only a minor part of this being oxidized to sulfur by photolithotrophs, a significant
accumulation of 34S-enriched elemental sulfur would
result, with *34S values approaching + 6‰ (cf. Fig. 1).
In contrast, in habitats in which most of the input sulfide was oxidized to sulfur, the small residual “steadystate” pool of sulfide would show a large decrease in
*34S. The enrichment observed experimentally was to
a *34S-sulfide value of –4 to –5‰ (Fig. 1), which is
consistent with the value of about –5.3‰ estimated
from the data of Fry et al. (1988) for Chlorobium vibrioforme. Thus, in natural environments, where both
closed and open systems occur, oxidation of sulfide
to sulfur by phototrophs such as Chlorobaculum could
in part explain the large negative *34S values observed
in some mineral sulfides, deposited in habitats where
sulfide was in relatively abundant supply from sulfate
reduction, but where oxidation to sulfur would result
in 34S-depleted sulfide-minerals (Mekhtieva and Kondratieva, 1966; Nissenbaum and Rafter, 1967; Chambers
and Trudinger, 1979; Detmers et al., 2001; Habicht and
Canfield, 1996, 2001; Hoek and Canfield, 2008).
Acknowledgements
I am indebted to the late Dr Athol Rafter (Rafter Stable Isotope
Laboratory, Institute for Nuclear Studies, Lower Hutt, New Zealand)
in whose laboratory all the stable isotope measurements were made.
Part of this work was carried out with the assistance of Lyn Chambers at the Baas Becking Geobiological Laboratory, Canberra, Australia, which has now been disbanded. Lyn Chambers (formerly of
that Laboratory) is now retired. I thank Dr Brian Fry (Louisiana
State University) for helpful comment, and Dr Ann Wood (King’s
College London) for critical reading of the manuscript.
4
Sulfur isotope fractionation
Literature
Brunner B. and S.M. Bernascini. 2005. A revised isotope fractionation model for dissimilatory sulfate reduction in sulfate reducing bacteria. Geochim. Cosmochim. Acta 69: 4759–4771.
Canfield D.E. 2001. Isotope fractionation by natural populations
of sulfate-reducing bacteria. Geochim. Cosmochim. Acta 65:
1117–1124.
Chambers L.A. and P.A. Trudinger. 1979. Microbiological fractionation of stable sulfur isotopes: a review and critique. Geomicrobiol. J. 1: 249–293.
Cork D.J., R. Garunas and A. Sajjad. 1983. Chlorobium
limicola forma thiosulfatophilum: biocatalyst in the production of
sulfur and organic carbon from a gas stream containing H2S and
CO2. Appl. Environ. Microbiol. 45: 913–918.
Detmers J., V. Bruchert, K.S. Habicht and J. Kuever. 2001.
Diversity of sulfur isotope fractionations by sulfate-reducing
prokaryotes. Appl. Environ. Microbiol. 67: 888–894.
Fry B., H. Gest and J.M. Hayes. 1984. Isotope effects associated with the anaerobic oxidation of sulfide by the purple photosynthetic bacterium, Chromatium vinosum. FEMS Microbiol. Lett.
22: 283–287.
Fry B., J. Cox, H. Gest and J.M. Hayes. 1986. Discrimination
between 34S and 32S during bacterial metabolism of inorganic sulfur compounds. J. Bacteriol. 165: 328–330.
Fry B, H. Gest and J.M. Hayes. 1988. 34S/32S fractionation in
sulfur cycles catalyzed by anaerobic bacteria. Appl. Environ.
Microbiol. 54: 250–256.
Habicht K.S. and D.E. Canfield. 1996. Sulphur isotope fractionation in modern microbial mats and the evolution of the sulphur
cycle. Nature 382: 342–343.
Habicht K.S. and D.E. Canfield. 2001. Isotope fractionation by
sulfate-reducing natural populations and the isotopic composition
of sulfide in marine sediments. Geology 29:555–558.
Hoek J. and D.E. Canfield. 2008. Controls on isotope fractionation during dissimilatory sulfate reduction, pp. 273–284. In:
Dahl C. and C.G. Friedrich (eds), Microbial Sulfur Metabolism.
Springer-Verlag, Berlin.
Imhoff J.I. 2003. Phylogenetic taxonomy of the family Chlorobiaceae on the basis of 16S rRNA and fmo (Fenna-Matthews-Olson
protein) gene sequences. Int. J. Syst. Evol. Microbiol. 53: 941–951.
279
Ivanov M.V., G.I. Gogotova, A.G. Matrosov and A.M. Zyakun.
1976. Fractionation of sulfur isotopes by phototrophic bacteria
Ectothiorhodospira shaposhnikovi (in Russian). Microbiology
(Moscow) 45: 655–659.
Jones G.E. and R.L. Starkey. 1957. Fractionation of stable isotopes of sulfur by microorganisms and their role in deposition of
native sulfur. Appl. Microbiol. 5: 111–118.
Kaplan I.R. and S.C. Rittenberg. 1964. Microbiological fractionation of sulphur isotopes. J. Gen. Microbiol. 34: 195–212.
Kaplan I.R., T.A. Rafter and J.R. Hulston. 1960. Sulphur isotopic variations in nature. Part 8 – application to some biogeochemical problems. New Zealand J. Sci. 3: 338–361.
Kelly D.P. 1974. Growth and metabolism of the obligate photolithotroph Chlorobium thiosulfatophilum in the presence of added
organic nutrients. Arch. Microbiol. 100: 163–178.
Kelly D.P. 2008. Stable sulfur isotope fractionation and discrimination between the sulfur atoms of thiosulfate during oxidation
by Halothiobacillus neapolitanus. FEMS Microbiol. Lett. 282:
299–306.
Krouse H.R. and T.B. Coplen. 1997. Reporting of relative sulfur
isotope-ratio data. Pure Appl. Chem. 69: 293–295.
McCready R.G.L. 1975. Sulphur isotope fractionation by Desulfovibrio and Desulfotomaculum species. Geochim. Cosmochim.
Acta 39: 1395–1401.
Mariotti A., J.C. Germon, P. Hubert, P. Kaiser, R. Letolle,
A. Tardieux and P. Tardieux. 1981. Experimental determination
of nitrogen kinetic isotopic fractionation: some principles; illustration for the denitrification and nitrification processes. Plant
Soil 62: 413–430.
Mekhtieva V.L. and E.N. Kondratieva. 1966. Fractionation of
stable sulfur isotopes by photosynthesizing purple sulphur bacteria, Rhodopseudomonas sp. (in Russian) Doklady Akademii Nauk
SSSR (Biological Sciences) 166: 80–83.
Nissenbaum A. and T.A. Rafter. 1967. Sulfur isotopes in altered
pyrite concretions from Israel. Israel J. Petrol. 37: 961–962.
Pfennig N. and K.D. Lippert. 1966. Über das Vitamin B12Bedürfnis phototropher Schwefelbakterien. Arch. Mikrobiol. 55:
245–256.
van Niel C.B. 1931. On the morphology and physiology of the
purple and green sulphur bacteria. Arch. Mikrobiol. 3: 1–112.
280
Kelly D.P.
4
Polish Journal of Microbiology
2008, Vol. 57, No 4, 281–287
ORIGINAL PAPER
Exopolysaccharide Production by Bacillus Strains Colonizing Packaging Foils
JOANNA SZUMIGAJ1,2*, ZOFIA ¯AKOWSKA 1 and LESZEK KLIMEK3
1 Institute
of Fermentation Technology and Microbiology, Technical University of £ódŸ, Poland
of Mushroom Cultivation, Research Institute of Vegetable Crops, Skierniewice, Poland
3 Institute of Materials Science and Technology, Technical University of £ódŸ, Poland
3 Department of Basic and Pre-Clinical Science, Medical University of £ódŸ, Poland
2 Laboratory
Received 3 June 2008, revised 25 August 2008, accepted 10 September 2008
Abstract
The influence of the chemical composition of medium, availability of glucose and pH on the production of exopolysaccharides (EPS) by
different Bacillus strains were investigated. Bacillus strains were isolated from the surface of polyethylene foils modified with mineral
compounds after their biodegradation in compost soil. Moreover, the effect of EPS production on bacterial adhesion onto the surface of the
materials was examined. The enhanced synthesis of exopolysaccharides in nutrient-starved conditions was revealed. The most effective
synthesis of polymers was observed during the logarithmic phase of culture growth. The increased amount of EPS facilitated bacterial
adhesion to material surfaces. It was determined that the biofilm on the material surface positively affects its biodegradation. Based on the
results, we conclude that the biodegradation of polymers may be accelerated in low-nutrient environment.
K e y w o r d s: biodegradation, biofilm, extracellular polymeric substances, polyethylene foils
Introduction
In recent years the ecological hazard resulting
from the large number of used plastic materials has
increased. The development of new biodegradable
materials that are resistant to biological disintegration
can be an interesting alternative for packaging. These
materials can resolve the problem of packaging waste.
Many authors indicate the relevance between the
biological disintegration of polymer materials and
microbial adhesion onto solid surface of various materials. Therefore, the biodegradation of packaging
materials is relevant with adhesion phenomena and
biofilm formation on the solid surface of materials
(Beech, 2006; Flemming, 1998; Ford and Mitchell,
1990; Tsuneda et al., 2003). This process results in
a complex microbial structure (microbial aggregate)
consisting of bacteria and fungi and their metabolic
products, as well as various inorganic substances
(Characklis and Cooksey, 1983; Costerton et al., 1987).
The attachment of bacteria to a solid surface is the
first and essential stage in the formation of a biofilm.
It seems that there is two-step process, reversible and
irreversible attachment (Allison and Sutherland, 1987;
Marshall et al., 1971). In the first step, the microorganisms come close to the material’s surface to be
weakly held by electrostatic forces. In the second, the
attached microorganisms are more difficult to remove
from the surface, as the bacteria produce extracellular
polymeric substances (EPS) that finally form the
biofilm matrix (Czaczyk, 2004; Hall-Stoodley and
Stoodley, 2002; Sutherland, 1982). It has been reported that EPS play a significant role in cell adhesion and biofilm formation onto the surface of a material (Olofsson et al., 2003; Rijnaarts et al., 1995;
Sutherland, 1980; Sutherland, 2001).
Extracellular polymeric substances, which are secreted by microorganisms during growth, consist of
various organic substances such as polysaccharides,
proteins, nucleic acids and lipids (Horan and Eccles,
1986). The exact functions of EPS are not completely
known because of their heterogeneous nature. They
protect cells from harsh external environments and
provide energy and carbon when nutrients are in short
supply (Sutherland, 1999; Wang et al., 2007). They
also play an important role in the flocculation of
bacterial cells (Morikawa, 2006; Pratt and Kolter,
1999). Many researchers have investigated the factors
* Corresponding author: J. Szumigaj, Laboratory of Mushroom Cultivation, Research Institute of Vegetable Crops, Skierniewice,
Rybickiego 15/17, 96-100 Skierniewice, Poland; e-mail: [email protected]
282
4
Szumigaj J. et al.
influencing the EPS production by microorganism and
the role of EPS in the bacterial adhesion onto various
surfaces (Allison and Sutherland, 1987; Gu et al.,
1998; Langille et al., 2000; Parkar et al., 2001).
Tsuneda et al. (2003) investigated bacterial adhesion onto glass in connection with the amounts and
composition of the EPS produced by bacterial strains.
It was shown that the enhanced synthesis of extracellular polymers has a significant effect on the adhesion
phenomena. Moreover, he indicated that proteins and
polysaccharides accounted for 75–80% of the EPS
composition. Sheng et al. (2006) showed that the
quantity and composition of exopolysaccharides is
influenced by cell growth phase, the C/N ratio and
the concentration of carbon and nitrogen sources as
well as of NaCl in the medium. It was documented
that degradation of metal surface, termed microbially
influenced corrosion or biocorrosion, occurs when
contact between microbial cells, products of their metabolism such as EPS, and the surface is established.
The microorganisms, which are involved in the polymers biodegradation, then produce exopolysaccharides
(EPS) (Beech, 2006).
The previous research on the biodegradation of
packaging foils indicated that polyethylene materials
modified by mineral compounds were not easily degraded. It was found that there were no changes on
the foil surface even after 8 months of composting
(Szumigaj et al., 2005). The aim of the current studies
was to determine the conditions that could positively
affect EPS production by Bacillus strains participating in the degradation of plastic. Information dealing
with the conditions influencing exopolysaccharide
production could prove useful for evolving strategies
for the regulation of polymer degradation.
The influence of the chemical composition of the
medium, availability of glucose and pH of the medium on the production of exopolysaccharides (EPS)
by Bacillus spp. strains was investigated. Strains of
Bacillus sp. were isolated from the surface of polyethylene foils modified with mineral compounds. Moreover, the influence of EPS synthesis on bacterial adhesion onto the surface of the materials was examined.
Experimental
Materials and Methods
Bacterial strains and cultivation. Five strains of
Bacillus species, i.e. Bacillus coagulans, Bacillus
firmus, Bacillus subtilis, Bacillus megaterium and Bacillus sp. were isolated from the surface of foil during
biodegradation in compost. Bacterial growth and EPS
production were monitored at 4, 8, 18, 24, 48 and
72 hour of cultivation. The process was carried out at
30oC on a rotary shaker at 85 rpm in broth medium
(pH 7.4) composed of the following: meat extract 2g;
yeast extract 2g; bactopeptone 5g; NaCl 4g; distilled
water 1l and mineral growth medium (pH 5.0) composed of the following: yeast extract 5g; MgSO4×
7H2O 5g; (NH4)2SO4 3g; KH2PO4 1g; distilled water
1 l. The media contained various concentrations of glucose (0%, 1% or 5%) and 0.1% polyethylene foil modified mineral compounds. The foils were sterilised by
immersing them for 1 minute in a 70% solution of ethyl
alcohol and then each side was exposed to UV rays for
a period of 15 minutes. The results given below are the
arithmetic mean of three series of experiments.
Extraction of EPS. The quantity of EPS produced
by bacteria was determined by a modified acid hydrolysis method using dextran (Mp. 50 000, Fluka) as
a standard (Parkar et al., 2001; Czaczyk and Myszka,
2004). The vegetative cells were suspended in distilled water to 1.0× 108 cfu/ml, sonicated and centrifuged at 10 000× g for 10 min. Then 1 ml supernatant
was precipitated with 8 ml 95% ethyl alcohol and kept
at 4°C for 24 hours. Next, the probes were centrifuged
at 10 000×g for 20 min and the pellet was suspended
in 1 ml water, then 7 ml 77% sulphuric acid and 1 ml
1% tryptophan was added. Afterwards, the probes
were kept in boiling water for 20 min and absorbance
was measured at wavelength P = 500 nm. A standard
curve using dextran (Mp. 50 000, Fluka) was prepared
to estimate the amount of EPS. The result are given in
µm EPS per 108 cells (Parkar et al., 2001; Czaczyk
and Myszka, 2004).
Evaluation of bacterial adhesion onto foil’s surface. The bacterial adhesion onto foil’s surface and
biofilm formation was monitored by using scanning
electron microscope (Hitachi 3000N) (SEM). The
material before analysis was covered with a thin
layer of gold.
Results
Lack of carbon source and EPS synthesis. The
production of extracellular polysaccharides in media
without carbon source was examined. The results
showed that the average proportion of EPS produced
by Bacillus spp., except for B. megaterium, was higher
in the mineral growth medium (pH 5.0) than in the
broth medium (pH 7.4) (Fig. 1A). The highest amount
of EPS was noticed for B. coagulans, B. firmus and
B. subtilis strains. These strains were characterised by
significantly enhanced exopolysaccharides synthesis
in starvation medium.
Availability of glucose and EPS synthesis. Addition of glucose to the mineral medium resulted
in decreased production by B. coagulans, B. subtilis
and Bacillus sp., while in case of B. firmus and
4
EPS production by Bacillus spp. colonizing polyethylene foils
283
Fig. 1. The average amount of EPS (µg EPS/108 cells) produced by Bacillus strains in mineral
and broth medium A – without glucose, B – with 1% glucose concentration, C – with 5% glucose concentration
B. megaterium strains the quantity of EPS increased
(Fig. 1B and C).
The increase of glucose concentration to 5%
(Fig. 1C) in broth medium affected the increase of
polysaccharides production by 3 strains, i.e. B. coagulans, B. firmus and B. megaterium strains as compared to the medium containing 1% of glucose, while
EPS synthesis was decreased in the case of B. subtilis
and did not change for Bacillus sp. (Fig. 1B). The
exopolysaccharides production by Bacillus spp. was
higher in the mineral medium than in the broth medium. Only the B. megaterium and B. coagulans
strains were characterised by increased EPS synthesis
in the broth medium, at 1% and 5% glucose concentration, respectively (Fig. 1B and C).
Dynamics of EPS production. Growth dynamics
and EPS production in the broth and the mineral medium at various glucose concentrations are presented
on the example of the B. firmus strain. Figure 2A
shows strain growth dynamics in the broth medium.
The stationary phase started latest and the biomass increase was the lowest in the glucose-free medium.
Until the 24th hour, an increase of the number of cells,
reaching 6.2× 107 cfu/ml, was observed. At 1% glucose concentration, the strain attained the stationary
phase faster, at the 18th hour, and the number of cells
Fig. 2. Growth dynamic of Bacillus firmus and exopolysaccharides production A – in broth medium, B – in mineral medium
284
Szumigaj J. et al.
was 6.6 × 107 cfu/ml, i.e. approx. 20% higher than in
the glucose-free medium.
The growth of the EPS production to the value of
6.6 µg/108 cells was in the first few hours of cultivation in the glucose-free medium. Following the
8th hour, a decrease of extracellular polymers synthesis
was noted. In the medium containing 1% of glucose,
in the first hours of cultivation, the strain produced
fewer EPS than in the glucose-free medium, but
an increase of these compounds was revealed at the
18th hour of cultivation (Fig. 2A).
The greatest biomass growth was observed in the
medium containing 5% of glucose, i.e. 8.2× 107 cfu/ml
at the 18th hour of cultivation. At that hour, the strain
also achieved the stationary phase of growth. Addition of 5% of glucose also effectively influenced
exopolysaccharides production. After 8 hours of cultivation, the amount of synthesised compounds was
the highest, i.e. 37.3 µg/108 cells. It was shown that
the fastest polymer growth was during the logarithmic growth phase. The stationary phase started at the
18th hour of cultivation and the quantity of EPS
started to decrease significantly. After the 48th hour,
inhibition of EPS synthesis was detected in all the
variants (Fig. 2A).
Analysing dynamics of cells growth in the mineral
medium without source of carbon, it was observed that
the strain reached the stationary phase at the 18th hour
of cultivation, and the number of cells amounted to
8.7× 107 cfu/ml. In the medium containing 1% of glucose, the stationary phase was also at the 18th hour,
but the number of cells was higher, i.e. 9.2×107 cfu/ml
(Fig. 2B).
In the carbon-free medium, a dynamic growth of
the extracellular polysaccharides synthesis started at
within the first hours of cultivation and at the 4th hour,
the EPS content achieved the value of 99.7 µg/108
cells. In the next hours of cultivation, synthesis of the
extracellular polymers started to decrease to an undetectable quantity after 48 hours. Addition of 1% of glu-
4
cose did not affect EPS synthesis effectiveness and was
lower than in the glucose-free medium. The content of
extracellular polysaccharides at the 18th hour reached
the value of 6.5 µg/108 cells, and within the next hours
of cultivation it decreased below 3.0 µg/10 8 cells.
Dynamics of cells growth in the medium with 5%
glucose concentration indicated that the strain reached
the stationary phase at the 8th hour of cultivation
already, and the number of cells was highest, i.e.
9.6× 107 cfu/ml. EPS synthesis in these conditions
remained high until the 24th hour of cultivation and
decrease of production of the compounds was noted
in the consecutive hours (Fig. 2B).
Bacterial adhesion to foil surface. Following incubation, the foil surface was analysed by the SEM
method for the B. firmus strain, which in all the variants was characterised by significantly enhanced EPS
synthesis in the mineral medium. In order to compare
the level of bacteria adhesion depending on the quantity of the extracellular polymers, an image of the foil
surface after cultivation was shown, in which the
strain was characterised by effective EPS production
and the synthesis was inhibited.
Figure 3 shows the foil surface following cultivation in glucose-free mineral medium, in which the
strain was characterised by effective exopolysaccharides production. After the 24th hour of incubation, only
single cells on the foil surface were observed, while
after 72 hours large bacteria concentrations were detected. Moreover, the bacterial morphology had changed,
cell dimensions were reduced compared to the cells
incubated in optimal growth conditions (Fig. 3).
After incubation in the glucose-free broth medium,
where B. firmus strain produced much fewer EPS than
in the case described above, single cells or insignificant concentrations of them on the material surface
were noted. In broth medium containing 5% of glucose, synthesis of the extracellular polysaccharides
produced by B. firmus significantly increased compared to the glucose-free broth medium. Furthermore,
Fig. 3. SEM microphotographs of foils surface after incubation with Bacillus firmus in mineral medium without
glucose A – after 24 h, B – after 72 h
4
EPS production by Bacillus spp. colonizing polyethylene foils
285
Fig. 4. SEM microphotographs of foils surface after incubation with Bacillus firmus in broth medium containing 5%
of glucose A – after 24 h, B – after 72 h
after 72 hours of incubation large concentrations of
bacteria on the foil surface were noticed. The morphology of the bacterial cells did not change (Fig. 4).
Discussion
The effect of the environmental conditions on the
production of extracellular polysaccharides as well as
the role of EPS in bacterial adhesion to plastic surfaces was investigated.
Data showed that EPS synthesis by indicated Bacillus genus representatives was more effective in carbon-free environment than in the environment optimal
for growth. The highest EPS values were recorded for
B. coagulans and B. subtilis strains, which produced
exopolysaccharides more efficiently in low nutrition
environment. Similar observations were described by
Czaczyk (2004) and Czaczyk et al. (2005). Liu et al.
(2004) also reported that EPS production is positively
affected by low-carbon conditions. Moreover, according to Christensen (1989) and Tsuneda et al. (2003)
exopolysaccharides biosynthesis is initiated by conditions unfavourable for growth.
The obtained results regarding EPS synthesis in
conditions unfavourable for growth suggest that exopolysaccharides may constitute an auxiliary source of
carbon and energy for microorganisms. The literature
data indicate that extracellular polysaccharides, in
carbon-free environmental conditions, may be biodegraded by the same strain and used as a source of carbon and energy (Frølund et al., 1996; Sutherland,
1999; Zhank and Bishop, 2003; Wang et al., 2007).
Moreover, according to Frølund et al. (1996), exopolymers constitute a film protecting cells against the
external environment.
The influence of glucose concentration on exopolysaccharides production was also examined. Addition
of carbon source to the mineral medium resulted in
a decrease of EPS production in the case of 3 strains;
B. coagulans, B. subtilis and Bacillus sp., whereas
in the case of other strains, it increased at the 5%
glucose concentration. In the case of most of the
strains increased polysaccharides production in the
broth medium with the addition of 5% glucose was
observed. Majumdar et al. (1999) also showed
favourable impact of carbon source availability on the
EPS synthesis. Along the growth of carbon source
concentration in the medium, increased polysaccharides production was stated.
The results demonstrated that EPS synthesis by
Bacillus spp. strains depends on the medium chemical
composition and nutrient availability. Significant impact of the environmental conditions on exopolysaccharides production was also described in studies by
Gandhi et al. (1997) and Sheng et al. (2006). According to Gandhi et al. (1997), the increase of the carbon
source concentration affects the increase of EPS production, whereas the increase of nitrogen concentration unfavourably affects the production of these substances. Similar conclusions may be drawn from these
findings, because EPS production in the broth medium rich in nitrogen compounds was reduced.
Moreover, synthesis of extracellular substances also
depends on the type of microorganisms (Czaczyk,
2004; Czaczyk et al., 2005). Studies proved that
certain strains produce greater EPS quantities in the
mineral medium, and others are characterised by an
increased synthesis in the nutritive medium (B. megaterium). In this case, EPS synthesis may also be affected by the pH of the medium. In the study by Gandhi
et al. (1997), it was discovered that pH close to the
neutral is favourable for the process. Similar results
were obtained in this work, because the EPS production by B. megaterium in the broth medium at pH 7.0
was the most effective.
Assessment of growth dynamics and EPS production suggested that the process depends on the
286
4
Szumigaj J. et al.
microorganism growth phase. Polysaccharides synthesis was the most effective within the first few hours
of cultivation, that is during the logarithmic growth
phase of the culture of the strain. Similar conclusions
were drawn by Sutherland (1982), who followed EPS
synthesis by P. aeuroginosa. He showed results which
indicated greater production of polysaccharides in the
first hours of incubation. In the study by Boza et al.
(2004), it was also noted that polysaccharides production by Beijerinckia increases until the 12th hour of
cultivation. The findings in this study confirmed the
observations of the authors cited. Exopolysaccharides
may be a source of carbon for microorganisms and
may be used by them in conditions of insufficient
glucose availability, as was mentioned and described
previously (Frølund et al., 1996; Sutherland, 1999;
Zhank and Bishop, 2003)
The studies were also aimed at indicating correlations between exopolysaccharides production and
bacterial adhesion to foil surface. Literature data imply that exopolysaccharides play a fundamental role
in biofilm formation (Allison, 1998; Majumdar et al.,
1999; Rijnaarts et al., 1995; Sivan et al., 2006). Similar conclusions may be drawn from these experiments.
SEM observations confirmed that B. firmus, which
produced large amounts of exopolysaccharides, effectively adhered to the foil surface, whereas in the event
in which EPS production was low, only insignificant
cell concentrations could be observed on the foil surface. The key role of EPS in cell aggregate and
biofilm formation was observed by Beech (2006),
Czaczyk et al. (2005), Liu et al. (2004) and Yeo et al.
(2007). Moreover, in the experiments conducted in
the mineral environment, a decrease of Bacillus sp.
cell dimensions was observed. Cell morphology
change may also be a form of adaptation to the conditions and, consequently, affect faster adhesion to the
surface of solids. Cell morphology change in lownutrient conditions was also observed by Humphrey
et al. (1983) and Stretton et al. (1997).
Literature data imply that the biofilm produced on
the foil surface may accelerate the process of their
biodegradation. Such favourable effect of biofilm on
the material surface was described, among others, by
Gilan et al. (2004) and Sivan et al. (2006). Increased
synthesis of extracellular polysaccharides constituting
the first biofilm production stage, in unfavourable
conditions, may affect faster degradation of the polymer materials. The current date and represented surveys quite unambiguously suggest the hypothesis that
the biodegradation of polymer foils in soil rich in
nutritive components does not always effectively influence the process of its degradation.
Acknowledgements
The work was supported by the Polish Ministry of Science
and Higher Education (MNiSW), grant number N N508 0880 33.
Literature
Allison D.G. 1998. Exopolysaccharides production in bacterial
biofilm. Biofilm 3: BF98002
Allison D.G. and I.W. Sutherland. 1987. The role of exopolysaccharides in adhesion of freshwater bacteria. J. Gen. Microbiol.
133: 1319–1327.
Beech I.B. 2006. Corrosion of technical materials in the presence
of biofilms. Inter. Biodeter. Biodegrad. 58: 89–93.
Boza Y., L.P. Neto, F.A.A. Costa and A.R.P. Scamparini. 2004.
Exopolysaccharides production by encapsulated Beijerinckia cultures. Process Biochem. 39: 1201–1209.
Characklis W.G. and K.E. Cooksey. 1983. Biofilms and microbial fouling. In Laskin A.I. (eds.) Applied Microbiology, vol. 29.
Academic Press, New York, p. 93–138.
Christensen B.E. 1989. The role of extracellular polysaccharides
in biofilms. J. Biotechnol. 10: 181–202.
Costerton J.W., K.J. Cheng, G.G. Geesey, T.I. Ladd, J.C.
Nickel, M. Dasgupta and T.J. Marrie. 1987. Bacterial biofilms
in nature and disease. Ann. Rev. Microbiol. 41: 435–464.
Czaczyk K. 2004. Factors affecting the adhesion of microorganisms to solid surface (in Polish). Post. Mikrobiol. 43: 267–283.
Czaczyk K. and K. Myszka. 2004. Biosynthesis of exopolysaccharides and their role in the adhesion of Bacillus megaterium
to a stainless steel surface. (in Polish). ¯ywn. Technol. Jakoœ. 3:
27–36.
Czaczyk K., K. Myszka and A. Mueller. 2005. The effect of
nutrient availability on biosynthesis of extracellular polysaccharides by Bacillus spp. and its role in adhesion. Folia Univ. Agric.
Stetin. 246: 33–46.
Ford T. and R. Mitchell. 1990. The ecology of microbial corrosion. Adv. Microb. Ecol. 11: 231–261.
Flemming H.C. 1998. Relevance of biofilms for the biodegradation of surfaces of polymeric materials. Polymer Degrad. Stabil.
59: 309–315.
Frølund, B., R. Palmgren, K. Keiding and P.H. Nielsen. 1996.
Extraction of extracellular polymers from activated sludge using
a cation exchange resin. Water Res. 30: 1749–1758.
Gandhi H.P., R.M. Ray and R.M. Patel. 1997. Exopolymer production by Bacillus species. Carbohydr. Polymer. 34: 323–327.
Gilan I., Y. Hadar and A. Sivan. 2004. Colonization, biofilm
formation and biodegradation of polyethylene by a strain of
Rhodococcus ruber. Appl. Microbiol. Biotechnol. 65: 97–104.
Gu J.D., M. Roman, T. Esselman and R. Mitchell. 1998. The
role of microbial biofilms in deterioration of space station candidate materials. Inter. Biodeter. Biodegrad. 41: 25–33.
Hall-Stoodley L. and P. Stoodley. 2002. Developmental regulation of microbial biofilms. Curr. Opin. Biotechnol. 13: 228–233.
Horan N.J. and C.R. Eccles. 1986. Purification and characterization of extracellular polysaccharide from activated sludge.
Water Res. 20: 1427–1432.
Humphrey B., Kjelleberg S., Marshall K.C. 1983. Responses
of marine bacteria under starvation conditions at a solid-water
interface. Appl. Environ. Microbiol. 45: 43–47.
Langille S.E., G.G. Geesey and R.M. Weiner. 2000. Polysaccharide-specific probes inhibit adhesion of Hyphomonas
rosenbergii strain VP-6 to hydrophilic surfaces. J. Ind. Microbiol.
Biotechnol. 25: 81–85
Liu Y.Q., Y. Liu and J.H. Tay. 2004. The effects of extracellular
polymeric substances on the formation and stability of biogranules.
Appl. Microbiol. 54: 46–62.
Majumdar I., F. D’Souza and N.B. Bhosle. 1999. Microbial
exopolysaccharides: Effects on corrosion and partial chemical
characterization. J. Indian Inst. Sci. 79: 539–550.
Marshall K.C., R. Stout and R. Mitchell. 1971. Mechanism
of the initial events in the sorption of marine bacteria to surfaces.
J. Gen. Microbiol. 68: 337–348.
4
EPS production by Bacillus spp. colonizing polyethylene foils
Morikawa M. 2006. Beneficial biofilm formation by industrial
bacteria Bacillus subtilis and related species. J. Biosci. Bioeng.
101: 1–8.
Olofsson A.C., M. Hermansson and H. Elwing. 2003. N-AcetylL-cysteine affects growth, extracellular polysaccharides production, and bacterial biofilm formation on solid surfaces. Appl.
Environ. Microbiol. 69: 4814–4822.
Parkar S.G., S.H. Flint, J.S. Palmer and J.D. Brooks. 2001.
Factors influencing attachment of thermophilic bacilli to stainless
steel. J. Appl. Microbiol. 90: 901–908.
Pratt L.A. and R. Kolter 1999. Genetic analyses of bacterial
biofilm formation. Curr. Opin. Microbiol. 2: 598–603.
Rijnaarts H.H.M., W. Norde, E.J. Bouwer, J. Lyklema and
A.J.B. Zehnder. 1995. Reversibility and mechanism of bacterial
adhesion. Colloid. Surface 4: 5–22.
Sivan A., M. Szanto and V. Pavlov. 2006. Biofilm development
of the polyethylene-degrading bacterium Rhodococcus ruber.
Appl. Microbiol. Biotechnol. 72: 346–352.
Sheng G.P., H.Q. Yu and Z. Yue. 2006. Factors influencing the
production of extracellular polymeric substances by Rhodopseudomonas acidophila. Inter. Biodeter. Biodegrad. 58: 89–93.
Stretton S., S.J. Danon, S.M. Kjelleberg, and A.E. Goodman.
1997. Changes in cell morphology and motility in the marine
Vibrio spp. Strain S14 during conditions of starvation and recovery.
FEMS Microbiol. Lett.146: 23–29.
287
Sutherland I.W. 1980. Polysaccharides in the adhesion of marine
and freshwater bacteria. In: Microbial Adhesion to Surfaces, Berkeley R. C. W., Lynch J. M., Melling J., Rutter P. R. and Vincent
B. (eds), Ellis Horwood Publ., Chichester, UK, p. 329–338.
Sutherland I.W. 1982. Biosynthesis of microbial exopolysaccharides. Adv. Microb. Physiol. 23: 79–100.
Sutherland I.W. 1999. Polysaccharases for microbial exopolysaccharides. Carbohydr. Polym. 38: 319–328.
Sutherland I.W. 2001. Biofilm exopolysaccharides: a strong and
sticky framework. Microbiology 147: 3–9.
Szumigaj J., Z. ¯akowska, L. Klimek and A. Bartkowiak. 2005.
Biodegradation of polymer packaging foils. Ann. Pol. Chem. Soc.
1: 520–524
Tsuneda S., H. Aikawa, H. Hayashi, A. Yuasa and A. Hirata.
2003. Extracellular polymeric substances responsible for bacterial
adhesion onto solid surface. FEMS Microbiol. Lett. 223: 287–292.
Wang Z.W., Y. Liu and J.H. Tay. 2007. Biodegradability of extracellular polymeric substances produced by aerobic granules. Appl.
Microbiol. Biotechnol. 74: 462–466.
Zhang X. and P.L. Bishop. 2003. Biodegradability of biofilm
extracellular polymeric substances. Chemosphere 50: 63–69.
Yeo Y., N. Jang, J. Cho, K.S. Kim and I.S. Kim. 2007. Identification of the effect of extracellular polymeric substances on bacterial adhesion to the membrane surface in a membrane bioreactor
using Pseudomonas fluorescens. Water Sci. Tech. 55: 35–42.
288
Szumigaj J. et al.
4
Polish Journal of Microbiology
2008, Vol. 57, No 4, 289–296
ORIGINAL PAPER
"-Amylase Production by Streptomyces erumpens MTCC 7317
in Solid State Fermentation Using Response Surface Methodology (RSM)
SHAKTIMAY KAR1, RAMESH C. RAY1* and UMA B. MOHAPATRA2
1Microbiology
Laboratory, Central Tuber Crops Research Institute (Regional Centre),
Orissa, India; 2Department of Botany, North Orissa University, Takatpur, Orissa, India
Received 17 June 2008, revised 18 September 2008, accepted 2 October 2008
Abstract
Production of á-amylase under solid state fermentation by Streptomyces erumpens MTCC 7317 has been investigated using different agroindustrial residues, i.e. cassava bagasse, sugarcane bagasse and wheat bran; wheat bran was found to be the best substrate. Among different
nitrogen source supplemented to wheat bran, beef extract or peptone (1%) showed maximum enzyme production. Response surface methodology was used to evaluate the effect of main process parameters as incubation period (48 h), moisture holding capacity (70%), pH (7.0) and
temperature (50°C) on enzyme production by applying a full factorial central composite design. The maximum hydrolysis of soluble starch
(90%) and cassava starch (75%) was obtained with the application of 4 ml (~12096 U) of S. erumpens crude enzyme after 5 h of incubation.
K e y w o r d s: "-amylase, process optimization, response surface methodology, solid state fermentation, wheat bran
Introduction
"-Amylases (E.C. 3.2.1.1) are extracellular enzymes that randomly cleave the "-1, 4 linkages between adjacent glucose units in the linear amylose
chain and generate glucose, maltose and maltotriose
units. Enzymatic hydrolysis of starch has now replaced acid hydrolysis in over 75% of starch hydrolyzing processes due to many advantages, not least its
highest yields (Tonkova, 2006). Spectrum of application of "-amylase has widened in many sectors such
as clinical, medicinal and analytical chemistry. Besides their use in starch saccharifaction, they also find
applications in baking, brewing, detergent, textile, paper and distillery industries (Kandra, 2003). Approximately 90% of all industrial enzymes are produced in
submerged fermentation (SmF) because of the ease of
handling and greater control of environmental factors
such as temperature and pH. However, solid state fermentation (SSF) constitutes an interesting alternative
since the metabolites so produced are concentrated and
purification procedures are less costly (Gangadharan
et al., 2006). SSF is preferred to SmF because of
simple technique, low capital investment, lower level
of end product inhibition and low waste water output.
Moreover, SSF has of late, emerged as an appropriate
technology for the management of agro-industrial
residues and their value addition (Pandey et al., 2001).
Among the agro-industrial residues wheat bran, cassava bagasse and sugarcane bagasse are considered
as good substrates for enzyme production in SSF
(Pandey et al., 2000a; Anto et al., 2006; Swain and
Ray, 2007).
The optimization of fermentation parameters is an
important problem in the development of economically
feasible bioprocesses. Response surface methodology
(RSM) consists of a group of empirical techniques
devoted to the evaluation of relations existing between
a cluster of controlled experimental parameters (factors) and the measured responses, according to one or
more selected criteria (Kunamneni and Singh, 2005).
A prior knowledge and understanding of the process
and the process parameters under investigation are
necessary for achieving a more realistic model. RSM
has already been successfully applied for optimization
of the media and culture conditions in many cultivation processes for production of primary and secondary metabolites (Boyaci, 2005), amino acid (Xiong
et al., 2005), ethanol (Carvalho et al., 2003) and enzymes (Rao and Satyanarayana, 2003).
* Corresponding author: R.C. Ray, Central Tuber Crops Research Institute, (Regional Centre) Bhubaneswar 751019, Orissa, India;
fax: (91) 674-2470528; e-mail: [email protected]
290
4
Kar S. et al.
In our earlier study an actinomycetes, Streptomyces
erumpens MTCC 7317 isolated from brick kiln soil,
produced thermostable "-amylase at pH 6.0, temperature 50°C and had a molecular mass of 54.5 kDa (Kar
and Ray, 2008). The present study was carried out
to identify an effective agro-residue as the substrate
as well as carbon source for production of "-amylase
by SSF. Four physico-chemical fermentation parameters (incubation period, moisture holding capacity
– MHC, pH and temperature) have been optimized by
applying RSM.
Experimental
Materials and Methods
Microorganism. S. erumpens, isolated from a brick
kiln soil (Kar and Ray, 2008) was used as the biological material and maintained at 4°C in soluble starchbeef extract (SB) (soluble starch, 1%; beef extract, 1%;
yeast extract, 0.2%; MgSO4, 0.02%; glycerol, 0.02%;
agar, 2%; pH was adjusted to 7.0) agar slants. The
inoculum preparation was carried out in SB liquid medium by transferring a loop full of organism from
stock culture and incubating at 50°C and 120 rpm for
24 h in an orbital incubator shaker (Remi Pvt. Ltd,
Bombay, India).
Preparation of substrate for SSF. Wheat bran
was obtained commercially from a local flour mill
and oven-dried. The dry material was composed of
(g/100 g: crude fibre, 9.2; starch, 34.0; reducing
sugar, 1.9; protein, 1.4 and ash, 3.5). Cassava bagasse
was collected during starch extraction from cassava
and oven-dried. The residue contains (g/100g: crude
fibre, 10.8; starch, 63.0; reducing sugar, 1.45; protein,
0.88 and ash, 1.2). Sugarcane bagasse was obtained
from sugarcane mill. The dry material was composed
of (g/100 g: crude fibre, 75.0; reducing sugar, 3.53;
protein, 0.8 and ash, 3.4).
Twenty gram substrate taken in Roux bottles
(132 mm×275 mm) were moistened with distilled
water containing 1% beef extract and 0.02% glycerol
to provide 70% MHC and mixed thoroughly. The initial pH of the substrate was adjusted to 7.0 by using
0.1 N NaOH. The bottles were autoclaved at 15 lb
pressure for 30 min and then cooled at room temperature, 30± 2°C and were inoculated with 15% (w/v)
inoculum (determined by pre-experiments). The inoculated substrates were incubated at 50°C for 72 h in an
incubator. The contents in the bottle were periodically
mixed by gentle tapping.
Beef extract (1%) present in the basal medium was
substituted with equal amount of different organic and
inorganic nitrogen source for enzyme production using
wheat bran as the substrate (pH adjusted to 7.0) and
incubated at 50°C for 48 h.
Optimization of fermentation parameters using
wheat bran. RSM was a collection of statistical
techniques for designing experiments, building models, evaluating the effect of factors and searching
for the optimum conditions of factors for desirable
responses (Liew et al., 2005). In order to maximize
amylase production the role of interacting factors under SSF were optimized by employing RSM using
wheat bran as substrate.
RSM was carried out using statistical software
package Design Export 7.1 (Stat-Ease, Inc, Minneapolis, USA). The levels of independent factors (incubation period, MHC, pH and temperature) were optimized by studying each factor in the design at five
different levels (–", – 1, 0, + 1 and +") (Table I). The
optimum value of each factor was taken at a central
coded value considered as zero. The minimum [coded
as (–1)] and maximum [coded as (+1)] range of
experimental values of each factor used and the full
experimental plan for RSM performed with 30 experiments were listed in Table II.
Table I
Range of the values for the response surface methodology
Independent factors
Incubation period (h)
Moisture holding capacity (%)
pH
Temperature (°C)
Coded Factor Levels
–"
–1
0
+1
+"
0
30
3
10
24
50
5
30
48
70
7
50
72
90
9
70
96
110
11
90
Statistical analysis and modeling. The data obtained from RSM on "-amylase production was subjected to the analysis of variance (ANOVA). The quadratic models for predicting the optimal points were
expressed according to the quadratic equation;
Y= $0 + $1A + $2 B + $3 C + $4 D+ $11 A2 + $22 B2
+ $33C2 + $44 D2 + $12 AB + $13 AC + $14 AD
+ $23 BC+ $24 BD + $34 CD
(1)
Where Y was response variable, $0 was intercept, $1,
$2, $3 and $4 were linear coefficients, $11, $22, $33 and
$44 were squared coefficient, $12, $13, $14, $23, $24 and
$34 were interaction coefficient and A, B, C, D, A2,
B2, C2, D2, AB, AC, AD, BC, BD and CD were level
of independent factors. The significance of the quadratic model equation was expressed by the coefficient
of determination (R2) and its statistical significance
was checked by Fischer’s test value (F-value).
Effect of MHC and initial medium pH. The influence of MHC on enzyme titre was evaluated by
varying the moisture content of the substrate from 50
to 90% MHC and initial medium pHs were adjusted
to 5.0–9.0 by using 0.1 N HCl or NaOH. The samples
(n = 3) were incubated for 48 h at 50°C. The moisture
content of the substrate was analyzed by a Mettler
LP16 Infra-Red analyzer.
4
291
"-amylase production by S. erumpens MTCC 7317
Table II
Experimental design and result of CCD of response surface methodology
Observation
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
A: Incubation
period (h)
–1
1
–1
1
–1
1
–1
1
–1
1
–1
1
–1
1
–1
1
–"
+"
0
0
0
0
0
0
0
0
0
0
0
0
B: Moisture
holding capacity (%)
–1
–1
1
1
–1
–1
1
1
–1
–1
1
1
–1
–1
1
1
0
0
–"
+"
0
0
0
0
0
0
0
0
0
0
C: pH
–1
–1
–1
–1
1
1
1
1
–1
–1
–1
–1
1
1
1
1
0
0
0
0
–"
+"
0
0
0
0
0
0
0
0
Effect of temperature on enzyme production.
The effect of temperature was studied by evaluating
the solid substrate at different incubation temperatures
(30–70°C) maintained in an incubator and the samples
were incubated for 48 h.
Enzyme extraction and assay. After 24 h of incubation (determined by pre-treatments), samples
(n = 3) from each treatment were taken out at 12 h
intervals up to 72 h and enzyme was extracted by
mixing the substrate with 40 ml of distilled water [1:2
(substrate:water) ratio] and squeezed through a wet
cheese cloth. The pooled enzyme extract was centrifuged at 8000× g for 20 min in refrigerated centrifuge
(Remi Pvt. Ltd, Bombay, India) and the clear supernatant was used for enzyme assay.
The amylase assay was based on the reduction in
blue colour intensity resulting from enzymatic hydrolysis of starch and formation of starch-iodine complex
(Swain et al., 2006). The reaction mixture consisted
of 0.2 ml enzyme (cell free supernatant), 0.25 ml of
D:
Temperature (°C)
–1
–1
–1
–1
–1
–1
–1
–1
1
1
1
1
1
1
1
1
0
0
0
0
0
0
–"
+"
0
0
0
0
0
0
Enzyme production (U/gds)
Predicted
Experimental
2987
3198
2802
3013
2318
2529
2133
2344
2921
3132
2736
2947
2252
2463
2067
2278
3157
3580
2906
2536
3003
1664
2172
2040
3747
3747
3747
3747
3747
3747
3117
3308
2937
3128
2422
2613
2242
2432
2923
3114
2743
2934
2228
2419
2048
2239
3025
3530
2825
2435
2860
1625
1825
2205
3831
3731
3775
3650
3685
3815
0.1% starch solution and 0.5 ml of phosphate buffer
(0.1 M, pH 7.0) incubated at 50°C for 10 min. The
reaction was stopped by adding 0.25 ml of 0.1 N HCl
and the colour was developed by adding 0.25 ml of
I/KI solution (2% KI in 0.2% I). The optical density
(OD) of the blue colour solution was determined using
a UV-Vis Spectrophotometer (Model no CE 7250,
Cecil Instrument, UK) at 690 nm. One unit of enzyme
activity was defined as the quantity of enzyme that
causes 0.01% reduction of blue colour intensity of
starch iodine solution at 50°C in one minute per ml
(Swain et al., 2006). In SSF, units of enzyme activity
were calculated as units (U) per gram of dry substrate
(gds) (i.e. U/gds).
Application. A 2% (w/v) of soluble starch and
cassava starch were incubated with 2 ml (~6048 U),
3 ml (~9072 U), 4 ml (~12096 U) and 5 ml (~15120 U)
of S. erumpens crude enzyme obtained through SSF
(50°C) using wheat bran. The degradation of starch
was evaluated at 1 h interval up to 5 h.
292
4
Kar S. et al.
Results
In this study, all the substrates supplemented with
1% beef extract and 0.02% glycerol supported thermostable (50°C) "-amylase production by S. erumpens;
however, using wheat bran gave the highest enzyme
production (3781 U/gds) at 48 h followed by cassava
bagasse (3437 U/gds) at 60 h (Table III). Maximum
"-amylase production was obtained when either beef extract or peptone was supplemented as the nitrogen source
in comparison to other nitrogen sources (Table IV).
Further studies were carried out, therefore, using wheat
bran as the substrate and carbon source, supplemented
with beef extract (1%) as the nitrogen source.
Table III
Screening of agro-residues (pH adjusted to 7.0) incubated
at 50°Cfor the production of "-amylase using S. erumpens
"-amylase production (U/gds)
Incubation time (h)
Wheat bran
Cassava bagasse
Sugarcane bagasse
24
2562
2300
1781
36
3356
3168
2419
48
3781
3306
2821
60
3562
3437
2531
72
3325
3215
2280
Table IV
Effect of nitrogen source on "-amylase production in SSF using
wheat bran as the substrate (pH adjusted to 7.0) and incubated
at 50°C for 48 h
Nitrogen sources
Ammonium acetate
Ammonium chloride
Ammonium nitrate
Ammonium sulphate
Potassium nitrate
Urea
Beef extract (control)
Casein
Peptone
Yeast extract
Enzyme production (U/gds)
1512 ± 105.0
1120 ± 95.0
1980 ± 110.0
1435± 110.0
1850 ± 120.0
937 ± 115.0
3775± 105.0
2985 ± 121.0
3850 ± 101.0
3437 ± 105.0
Where Y was enzyme production, A was incubation period (h), B was MHC (%), C was pH and D
was temperature (°C).
The regression equation obtained indicated R2 (coefficient of determination) values of 0.9643 for "-amylase production and thus the model could explain
more than 96.43% of the variability in the response
(Table V). Moreover, the predicted R2 value (0.8017)
was in reasonable agreement with adjusted R2 value
of 0.9310. Further, a high similarity was observed between the predicted and experimental result (Fig. 1).
An adequate precision of 18.112 for "-amylase production was recorded. The model F-value of 28.95
and Value of “prob> F” (< 0.05) indicated that model
terms were significant. For "-amylase production, the
coefficients of A, B, C, A2, B2, C2 and D2 were significant at 1% level.
Table V
ANOVA for "-amylase production in solid state fermentation
Source
Sum
Degree
Mean
F-Value p-value
of squares of freedom Square
Model
984.92
Pure Error
1.74
Total
1021.38
14
5
29
70.35
0.35
28.95
0.0001
R2 = 0.9643; adjusted R2 = 0.9310;
predicted R2 = 0.8017; adequate precision = 18.112
Response surface estimation for maximum enzyme production. To investigate the interactive effect
of factors on the amylase production, the response
surface graphs were employed by plotting the effect
of independent factors (incubation period, MHC, pH
and temperature). Out of four factors, two were fixed
at zero level while other two were varied.
±: Standard deviation
Optimization of fermentation parameters. The
effect of four independent factors (incubation period,
MHC, pH and temperature) for "-amylase production
by S. erumpens in wheat bran were presented along
with predicted and observed responses in Table II. Regression analysis was performed to fit the response
function with the experimental data. The results obtained after CCD were then analyzed by standard
analysis of variance (ANOVA), which gave the second order polynomial regression equation.
Y= 61.22 + 0.99 A – 0.90 B – 3.34 C – 0.28 D
– 0.74 A2 – 2.23 B2 – 3.32 C2 – 3.83 D2 + 0.015 AB
+ 0.060 AC + 0.018 AD – 0.058 BC – 0.016 BD
– 0.061 CD
Fig. 1. Plot of predicted versus actual amylase production
4
293
"-amylase production by S. erumpens MTCC 7317
B
A
B:
Mo
lst
ure
ho
ldi
ng
ca
pa
cit
y(
In
A:
%)
cu
b
on
ati
p
o
eri
d(
Te
m
B:
Mo
l
re
stu
C:
pe
D
pH
C
pH
A:
D:
C:
h)
ho
l
g
din
ca
c
pa
rat
ity
ure
(%
(°C
)
A:
u
Inc
ba
tio
n
ri
pe
od
Te
m
pe
rat
ure
(°C
tio
n
(h)
E
)
D:
F
)
ba
od
(h)
Te
m
pe
rat
ure
(°C
)
B:
D:
u
Inc
ri
pe
pH
C:
Mo
ur
lst
eh
o
ng
ldi
ca
p
it
ac
y(
%)
Fig. 2. Statistical optimization of enzyme
production using RSM, (A) incubation
period and MHC; (B) incubation period
and pH; (C) incubation period and temperature; (D) MHC and pH; (E) MHC and
temperature and (F) pH and temperature
294
4
Kar S. et al.
Figure 2A depicts three dimensional diagram and
contour plot of calculated response surface from the
interaction between incubation period and MHC
while keeping the other factors (pH and temperature)
at zero level. The result demonstrated that with increase
in incubation period and MHC up to 48 h and 70%,
respectively, the enzyme production had increased up
to 3745.55 U/gds and thereafter it declined.
Figure 2B shows the effect of incubation period
and pH on enzyme production, keeping temperature
and MHC at zero level. The graph shows that the
maximum amylase production (3764 U/gds) occurred
at pH of 7.0 and incubation period of 48 h, which was
in conformity with the model. At ‘0’ level of MHC
and pH the response between incubation period and
temperature indicated that a higher temperature
(50°C) was optimum with 48 h incubation period for
"-amylase production (3750 U/gds) (Fig. 2C). The
response between MHC and pH (keeping incubation
period and temperature at 0 level) indicated that pH
7.0 with 70% MHC showed the optimum enzyme production (3757 U/gds) (Fig. 2D). Fig. 2E represented
interaction between MHC and temperature while
keeping incubation period and pH at 0 level. An interaction between the remaining two factors (pH and
temperature) (Fig. 2F) suggested a little difference
with the earlier responses.
Optimization. To find out optimum level of process parameters for maximizing the response, the criteria were set, as given in Table VI. The optimization
criteria were used to get maximum yield of amylase
by minimizing incubation period (48 h) and maximizing pH (7.0), temperature (50°C) and MHC (70%).
Table VI
Optimization criteria used in this study
Parameter
or Response
Incubation period
MHC
pH
Temperature
Enzyme production
Limits
Lower
Upper
24
50
5.0
30
1625
72
90
9.0
70
3831
Importance
Criterion
3
5
3
3
5
Minimize
Maximize
Maximize
Maximize
Maximize
Testing of model adequacy. Usually it was necessary to check the fitted model to ensure that it provides
an adequate approximation to the real system. Unless
the model shows an adequate fit, processing with investigation and optimization of the fitted response
surface likely give poor or misleading results. By
constructing a normal probability plot of the residuals, a check was made for the normality assumption,
as given in Fig. 3. The normality assumption was
satisfied as the residuals were approximated along
a straight line.
Fig. 3. Normal probability plot of studentized residuals
Practical verification of theoretical results. Further to support the optimized data as given by statistical modeling under optimized condition, the confirmatory experiments were conducted with the parameters
as suggested by the model (incubation period, 48 h;
MHC, 70%; pH, 7.0 and temperature, 50°C). The optimized process condition yielded amylase production
(3830 U/gds) which was closer to the predicted amylase production (3755 U/gds) at same optimal point.
Application. The rate of hydrolysis of 2% (w/v)
soluble starch and cassava starch by S. erumpens
"-amylase is shown in Fig. 4. There was a gradual
hydrolysis of starches with increase in incubation
period from 1 to 5 h and the rate of hydrolysis also
increased with the increase in enzyme concentration.
With application of 4 ml (~12096 U) crude enzyme
there was 90 and 75% hydrolysis of soluble starch
and cassava starch, respectively.
Discussion
In recent years, the application of the agro-industrial residues (i.e. wheat bran, cassava bagasse, sugarcane bagasse, sugar beet pulp, apple pomace, etc.)
provide an alternative way to replace the refined and
costly raw materials and the use of such materials will
help to solve many environmental hazards (John et al.,
2006). Several processes have been developed that
utilize these as raw materials for the production of
value added products such as ethanol, enzymes, organic acids and others (Pandey et al., 2000a). Wheat
bran has been widely reported to be the ideal substrate
for production of several enzymes in SSF: "-amylase
(Anto et al., 2006), pectinase (Kashyap et al., 2003),
4
"-amylase production by S. erumpens MTCC 7317
A
295
B
Fig. 4. Hydrolysis of (A) soluble starch and (B) cassava starch by application of crude "-amylase (6048- 15120 U) from S. erumpens
glucoamylase (Bhatti et al., 2007), protease (Aikat
and Bhattacharyya, 2000) and xylanase (Poorna and
Prema, 2007). Following the evaluation of nitrogen
sources, it was observed that organic nitrogen supported higher amylase production than inorganic nitrogen sources. Similar results were obtained for SSF
in case of Bacillus spp., i.e. Bacillus amyloliquefaciens (Gangadharan et al., 2006), Bacillus coagulans (Babu and Satyanarayana, 1995) and for Aspergillus niger in wheat bran containing solid substrate
medium (Ellaiah et al., 2002).
The characterization of different factors for "-amylase production was optimized by applying RSM.
A high similarity was observed between the predicted
and experimental results (Fig. 1), which reflected the
accuracy and applicability of RSM to optimize the
process for enzyme production. In this study, an incubation period (48 h), MHC (70%), pH (7.0) and temperature (50°C) were major factors that influenced the
enzyme titre. The production of "-amylase reached
a peak at 48 h (3781 U/gds) using wheat bran and
there after, it declined. This could be due to loss of
moisture with prolonged incubation at 50°C and denaturation or decomposition of a-amylase due to interaction with other components in the culture medium
(Gangadharan et al., 2006). Moreover, the incubation
time is governed by characteristics of the culture and
is based on enzyme production (Baysal et al., 2003).
In most cases, the optimum incubation period for
"-amylase production in SSF using Bacillus sp. culture varied from 24 to 74 h, depending on environmental conditions (Baysal et al., 2003; Sivaramakrishnan
et al., 2006). In contrast, "-amylase production from
Streptomyces rimosus was reported at 180 h incubation using sweet potato residue as the substrate (Yang
and Wang, 1999).
Moisture is one of the most important parameter
in SSF that influences the growth of the organism and
thereby enzyme production (Baysal et al., 2003). In the
present study, 70% moisture content gave maximum
enzyme production when compared to 50, 60, 80 and
90% MHC. A reduction in enzyme production at high
initial moisture content might be due to porosity, lower
oxygen transfer (Pandey et al., 2000a), pore aeration
and adsorption of enzyme to the substrate particle
(Swain and Ray, 2007). The optimum amylase production for S. rimosus on a mixture of sweet potato and
peanut meal residue was found to be at 65% MHC in
SSF (Yang and Wang, 1999). In case of Bacillus spp,
optimal moisture content was found to be at 60–85%
(Pandey et al., 2000b; Gangadharan et al., 2006).
Among physicochemical parameters, the pH of the
medium plays an important role including morphological changes in the organism and in enzyme production. It is evident from the study that "-amylase
yield was significant over a range of pH 6.0–7.0 with
an optimum at pH 7.0 (3837 U/gds). Further increase
in pH resulted in a drastic reduction in enzyme production. "-Amylase of S. rimosus was reported to have pH
optimum at 6.0 in SSF (Yang and Wang, 1999). Anto
et al. (2006) reported pH 5.0 to be the best for the
production of "-amylase by Bacillus cereus in SSF.
The influence of temperature on amylase production is related to the growth of the organism. However, the optimum temperature depends on whether
the culture is mesophilic or thermophilic. The isolate,
S. erumpens showed maximum "-amylase production
at 50°C. Further increase the temperature led to decrease in enzyme production. The optimum "-amylase
production for other actinomycetes, i.e. Thermoactonomyces vulgaris and S. rimosus were found to be 62.5
and 45°C, respectively (Heese et al., 1991; Yang and
Wang, 1999).
In conclusion, the parametric optimization of "-amylase production by S. erumpens in SSF using wheat
bran differed to some extent from SmF (Kar and Ray,
296
Kar S. et al.
2008). The optimum incubation period, pH and temperature in SmF were 36 h, 6.0 and 50°C, where as in
the present study, these parameters were 48 h, 7.0 and
50°C, respectively. The variations in pH and incubation period optima between two forms of fermentation
were because of cultural conditions. Further, the enzyme yield was somewhat similar in SmF (3500 U/ml)
and SSF (3781 U/gds). Nevertheless, utilization of
agro-waste such as wheat bran has multitude of advantages as discussed in the earlier section.
Acknowledgement
Authors thank Director, CTCRI, Thiruvanathapuram for providing facilities.
Literature
Aikat K. and B.C. Bhattacharyya. 2000. Optimization of some
parameters of solid state fermentation of wheat bran for protease
production by a local strain of Rhizopus oryzae. Acta Biotechnol.
20: 149–159.
Anto H., U. Trivedi and K. Patel. 2006. "-Amylase production
by Bacillus cereus MTCC 1305 using solid state fermentation.
Food Technol. Biotechnol. 44: 241–245.
Babu K.R. and T. Satyanarayana. 1995. "-Amylase production
by thermophilic Bacillus coagulans in solid state fermentation.
Process Biochem. 30: 305–309.
Baysal Z., F. Uyar and C. Aytekin. 2003. Solid-state fermentation for production of "-amylase by a thermotolorant Bacillus
subtilis from hot spring water. Process Biochem. 38: 1665–1668.
Bhatti H.N., M.H. Rashid, R. Nawaz, M. Asgher, R. Perveer
and A. Jabbar. 2007. Optimization of media for enhanced
glucoamylase production in solid state fermentation by Fusarium
solani. Food Technol. Biotechnol. 45: 51–56.
Boyaci I.H. 2005. A new approach of determination of enzyme
kinetic constants using response surface methodology. Biochem.
Eng. J. 25: 55–62.
Carvalho J.C.M., M. Vitolo, S. Sato and E. Aquarone. 2003.
Ethanol production by Saccharomyces cerevisiae grown in sugarcane blackstrap molasses through a feed batch process: optimization by response surface methodology. Appl. Biochem. Biotechnol.
110: 151–164.
Ellaiah P., A. Kunamneni, Y. Bhavani, P. Padmaja and B. Srinivasulu. 2002. Optimization of process parameters for glucoamylase
production under solid state fermentation by a newly isolated
Aspergillus species. Process Biochem. 38: 615–620.
Gangadharan D., S. Sivaramakrishnan, K.M. Nampoothiri and
A. Pandey. 2006. Solid culturing of Bacillus amyloliquefaciens
for "-amylase production. Food Technol. Biotechnol. 44: 269–274.
Heese O., G. Hansen, W.E. Hohne and D. Korner. 1991. A thermostable "-amylase from Thermoactinomyces vulgaris: purification and characterization. Biomed. Biochem. Acta 5: 225–232.
John R.P., K.M. Nampoothiri and A. Pandey. 2006. Solid state
fermentation for L-lactic acid production from agro wastes using
Lactobacillus delbrueckii. Process Biochem. 41: 759–763.
4
Kandra L. 2003. "-Amylases of medical and industrial importance. J. Mol. Struct. (Theochem) 666–667: 487–498.
Kar S. and R.C. Ray. 2008. Partial characterization and optimization of extracellular thermostable Ca2+ inhibited "-amylase production by Streptomyces erumpens MTCC 7317. J. Sci. Ind. Res.
66: 252–255.
Kashyap D.R., S.K. Soni and R. Tewari. 2003. Enhanced production of pectinase by Bacillus sp. DT7 using solid state fermentation. Biores. Technol. 88: 251–254.
Kunamneni A. and S. Singh. 2005. Response surface optimization of enzymatic hydrolysis of maize starch for higher glucose
production. Biochem. Eng. J. 27: 179–190.
Liew S.L., A.B. Ariff, A.R. Raha and Y.W. Ho. 2005. Optimization of medium composition for the production of a probiotic
microorganism, Lactobacillus rhamnosus, using response surface
methodology. Int. J. Food Microbiol. 102: 137–142.
Pandey A., C.R. Soccol and W. Mitchell. 2000b. New development in solid state fermentation: I. – bioprocess and products.
Process Biochem. 35: 1153–1169.
Pandey A., C.R. Soccol, J.A. Rodriguez-Leon and P. Nigam.
2001. Solid-State Fermentation in Biotechnology: Fundamentals and applications, Asiatech Publishers Inc., New Delhi, India,
pp. 221.
Pandey A., C.R. Soccol, P. Nigam, V.T. Soccol, L.P.S. Vandenberghe and R. Mohan. 2000a. Biotechnological potential of
agro-industrial residues, II: cassava bagasse. Biores. Technol. 74:
81–87.
Poorna C.A. and P. Prema. 2007. Production of cellulose-free
xylanase from novel alkalophilic thermotolerent Bacillus pumilus
by solid state fermentation and its application in waste paper
recycling. Biores. Technol. 98: 485–490.
Rao J.L.M. and T. Satyanarayana. 2003. Statistical optimization of a high maltose-forming, hyperthermostable and Ca2+-independent "-amylase production by an extreme thermophile
Geobacillus thermoleovorans using response surface methodology. J. Appl. Microbiol. 95: 712–718.
Sivaramakrishnan S., D. Gangadharan, K.M. Nampoothiri,
C.R. Soccol and A. Pandey. 2006. "-Amylase from microbial
sources – an overview on recent developments. Food Technol.
Biotechnol. 44: 173–184.
Swain M.R. and R.C. Ray. 2007. "-Amylase production by Bacillus subtilis CM3 in solid state fermentation using cassava fibrous
residues. J. Basic Microbiol. 47: 417–425.
Swain M.R., S. Kar, G. Padmaja and R.C. Ray. 2006. Partial
characterization and optimization of extra-cellular "-amylase
from Bacillus subtilis isolated from culturable cow dung microflora. Polish J. Microbiol. 55: 289–296.
Tonkova A. 2006. Microbial starch converting enzymes of the
"-amylase family. pp. 421–472. In: Ray R.C. and O.P. Wards
(eds.). Microbial Biotechnology in Horticulture Vol. I. Science
Publishers, Enfield, New Hampshire, USA.
Xiong C., C. Shouwen, S. Ming and Y. Ziniu. 2005. Medium
optimization by response surface methodology for poly-Y-glutamic
acid production using dairy manure as the basis of a solid substrate. Appl. Microbiol. Biotechnol. 69: 390–396.
Yang S.S. and J.Y. Wang. 1999. Protease and amylase production of Streptomyces rimosus in submerged and solid state cultivations. Bot. Bull. Acad. Sin. 40: 259–265.
Polish Journal of Microbiology
2008, Vol. 57, No 4, 297–305
ORIGINAL PAPER
Screening for Soil Streptomycetes
from North Jordan that Can Produce Herbicidal Compounds
SEREEN M.B. BATAINEH1; ISMAIL SAADOUN1*; KHALID M. HAMEED2 and QOTAIBA ABABNEH1
2 Department
1 Department
of Applied Biological Sciences, Faculty of Science and Arts
of Plant Production, Faculty of Agriculture, Jordan University of Science and Technology.
Received 23 March 2008, revised 15 June 2008, accepted 29 July 2008
Abstract
A total of 231 different soil Streptomyces isolates were recovered from 16 different locations in North Jordan. They were assessed for
their phytotoxic activity on seeds of cucumber (Cucumis sativus L.) and ryegrass (Lolium perenne L.) placed adjacent to a 2 cm wide
Streptomyces culture strips grown at 28C° for 3 weeks on starch casein nitrate (SCN) agar. Phytotoxicity was ascertained on the basis
of suppressed seed germination, discoloration of the root tip, reduced root and the shoot growth and eventual death of the root. Twenty
one of the isolates exhibited adverse effect against growth of germinated cucumber seeds, germination and growth of ryegrass seeds.
Using filter paper bioassay method, culture filtrate from the SCN broth of the isolate R9; identified as Streptomyces aburaviensis, significantly inhibited seed germination, radicle and shoot growth of ryegrass, reduced radicle and shoot growth of cucumber and suppressed the
shoot growth of milk thistle (Silybum marianum L.). Also, culture filtrate from the glucose-peptone-molasses (GPM) broth diluted (1:1)
with sterilized distilled water caused complete inhibition of seed germination of redroot pigweed (Amaranthus retroflexus L.).
Dichloromethane extracted fraction of S. aburaviensis (strain R9) culture filtrate from GPM broth completely inhibited seed germination of ryegrass when applied at doses of 3 and 5 mg of dry weight, and the seedling growth of cucumber and milk thistle was severely
reduced by the same doses.
K e y w o r d s: Streptomyces, phytotoxin, seeds, weeds
Introduction
Many isolation and screening attempts have been
done on streptomycetes to find microbial metabolites with bioherbicidal potentials (Arai et al., 1976;
Defrank and Putnam, 1985; Li et al., 2003; Mallik,
1997; Mishra et al., 1987; Murao and Hayashi, 1983;
Sekizawa and Takematsu, 1983, Takahashi et al., 1995).
Anisomycin, which is produced by Streptomyces
toyocaensis was the first commercially used phytotoxin (Yamada et al., 1972). Bialaphos, which is produced by Streptomyces hygroscopicus (Mallik, 2001)
and Streptomyces viridochromogenes (Charudattan
et al., 1996), represents the first patented microbial
bioherbicide. Arai et al. (1976) reported the production of two bioherbicides, herbicidans A and B, by
Streptomyces saganonesis that are selective against
many dicotyledonous plants. Gougerotin is another
plant growth inhibitor produced by Streptomyces sp.
No 179 (Murao and Hayashi, 1983). Babaczinski
et al. (1991) reported vulgamycin as phytotoxin
against dicotyledonous weeds and grasses if applied
post-emergence. Phosphenothrixin that is produced
by Saccharothrix sp. ST-888 inhibits the germination
of gramineous and broadleaved weeds (Takahashi
et al., 1995). Herbimycin represents a potent herbicidal activity when used pre-emergence, against
flat-sedge (Cyperus microiria Steud.) (Sekizawa and
Takematsu, 1983).
All these discovered phytotoxins from streptomycetes represent a wide range of plant inhibitory
compounds that are naturally degraded in the environment, which may restrict the regular undesirable
consequences of using agrochemicals such as, accumulation, biomagnifications, and excessive persistence
(Heisey and Putnam, 1990). The intensive and the arbitrary usage of herbicides lead to the development of
resistant weed species to some of those herbicides
(Mallik, 2001). Moreover, biotechnological techniques
were utilized for testing the possibility of transferring
* Corresponding author: I. Saadoun, Department of Applied Biological Sciences, Jordan University of Science and Technology,
P.O. Box 3030, Irbid-22110, Jordan;. e-mail: [email protected]
298
Bataineh S.M.B. et al.
the genes of phytotoxin production to a plant pathogen
in an attempt to become sufficiently acceptable for
control a weed target (Charudattan et al., 1996).
There are about 300 common weed species that
cause crop losses world wide (Hoagland, 1990). Weed
control depends mainly on conventional hand weeding
and tillage (Abu-Irmaileh, 2000; Salim and Mokhtar,
2000) and the strategies at this stage are more logical
in taking early precautions and avoiding future negative consequences on the environment. Therefore,
biological control of weeds represents a logical alternative to the agrochemicals.
In Jordan, weed control is not well managed and
implemented. Several studies have already been conducted on soil streptomycetes of Jordan for their potential to produce antibiotics (Saadoun et al., 1999;
2008; Saadoun and Gharaibeh, 2002). However, the
herbicidal activity of streptomycetes is not studied
yet. Therefore, the present investigation was conducted to isolate soil streptomycetes from different
locations in North Jordan and screening them for their
phytotoxic potential against common broad leaf and
grass weeds. The optimal medium suitable for better
phytotoxic activity in the culture filtrate and extraction of phytotoxin was, also investigated.
Experimental
Materials and Methods
Location, sampling, treatment of soil samples
and isolation technique. Soil samples were collected
from 9 different locations in North Jordan representing the most humid and vegetative part of Jordan. One
or more soil sample was collected from each location.
Enrichment of streptomycetes in the soil samples and
isolation of Streptomyces spp. were performed as described by Saadoun et al. (2008). Dilutions that gave
20–200 colonies were chosen for repeated streaking
and selection of pure bacterial colonies showing
Streptomyces-like characteristics.
Phytotoxic activity assay. Bioassays of the isolated
streptomycetes for their phytotoxicity were performed
using two indicator plant seeds namely: cucumber
(Cucumis sativus L.) (UPC, 0-21496-28630-3, Lowes,
Texas) and ryegrass seeds (Lolium perenne L.) (Local
cultivar Beit Alpha) (Mallik, 2001).
Surface sterilization of the indicator plant seeds.
Cucumber and ryegrass seeds were surface sterilized
by immersing each one of them for 5 min in 2% and
25% solutions of sodium hypochlorite (Clorox commercial containing 6.5% of NaClO), respectively. In
both cases, 20 µl of Tween 20 was added to break the
water surface tension. Vacuum was applied using
vacuum pump to facilitate thorough surface steriliza-
4
tion. Seeds were washed 3 times with sterilized distilled water for 1.5 min at each wash in order to get rid
of the residual hypochlorite and Tween 20. Surface
sterilized seeds were blotted between double layers of
sterilized cheesecloth and transferred to sterilized glass
Petri dishes to be used in the bioassay experiments.
Screening of streptomycete isolates for their
bioherbicidal activity. The growth of each streptomycete isolate from SCNA plates (28C° for 10 days)
was scraped and aseptically transferred into 5 ml vials
containing 2 ml of sterilized distilled water and
vortexed. Aliquot of 0.4 ml from each isolate cell suspension was placed in the center of SCNA plates, in
3 replicate, and spread using L-shape glass rod over
a 2 cm wide strip along the diameter of those plates.
Non-inoculated SCNA plates served as controls. After
3 weeks of incubation at 28C° for 3 weeks, 6 sterilized
cucumber seeds were placed on one side of the culture strip and 6 sterilized ryegrass seeds were placed
on the opposite side of the same culture strip within
the same plate. Plates were incubated in dark at 28C°
for 4 days. Seed germination was observed and germination percentages were calculated. Average length
of radicles and shoots was measured, using Vernier
caliper. The experiment was repeated 3 times for the
isolates that expressed the phytotoxic activity to confirm observation.
Detecting Phytotoxin(s) in the submerged culture. Primary inoculum of each of the seven most active isolates was prepared by transferring a loop full
of inoculum of each isolate into 100 ml Erlenmeyer
flask containing 25 ml of SCN broth and incubated
for 5 days in orbital shaker incubator (28C° with
shaking at 140 rpm). These cultures were used in the
inoculation process of larger volumes of SCN broth
in a ratio of 1:20 inoculum to broth. In the later process three 250 ml Erlenmeyer flasks containing 60 ml
broth for each isolate were inoculated with 3 ml of
the primary inoculum and incubated for 7 days in orbital shaker incubator. Culture filtrates were aseptically obtained by vacuum filtration through Whatman
No 4 filter paper and stored at 4C° for further phytotoxic bioassay. The experiment was repeated 3 times
for each one of the active isolates.
Seed collection of common weeds. Seeds of milk
thistle (Silybum marianum L.) and wild oat (Avena
fatua L.) were collected from the site of Jordan University of Science and Technology during the period
from April-May 2003. Redroot pigweed (Amaranthus
retroflexus L.) seeds were kindly provided by Dr. Jamal
Qasim, Faculty of Agriculture, University of Jordan,
Amman-Jordan.
Phytotoxic activity in the culture filtrates. Seeds
of two monocotyledonous (ryegrass and wild oat) and
two dicotyledonous (cucumber, milk thistle) species
were used in the phytotoxicity bioassay in the culture
4
Streptomycetes producing herbicidal compounds
filtrates. Sterilized Whatman No 4 filter papers were
placed inside 9 cm Petri dish and moistened with
2.5 ml of the culture filtrate of each isolate that was
prepared as described before. Two controls were prepared in the same way in which uninoculated SCN
broth and sterilized distilled water were used separately instead of culture filtrate. Four seeds from each
plant species were placed inside each Petri dish, and
replicated three times. The plates for each treatment
were placed inside plastic bags in order to conserve
moisture, and they were incubated in a cooled incubator at 28C° in darkness for 4 days. After that, the
length of the radicles and shoots was measured and
germination percentages were calculated. The experiment was repeated 3 times for the isolates that expressed phytotoxic activity in submerged culture. In
order to determine the appropriate medium composition that support better phytotoxin(s) production and
extraction (Halleck et al., 1955), an additional broth
media of glucose-peptone-molasses (GPM) and peptone-molasses-corn steep (PMC) were used. Furthermore, sterilized Whatman No 4 filter papers were
placed inside 9 cm Petri dish and moistened with
2.5 ml of R9 culture filtrate from the GPM submerged
culture diluted 1:1 with sterilized distilled water and
applied against Amaranthus retroflexus seeds (4 seeds
per plate).
Extraction of the phytotoxin(s) containing fraction. Extraction of the phytotoxin(s) containing fraction from the most active isolate R9 was performed as
described by Mallik (1997). After seven days of R9
incubation in GPM broth (500 ml broth/2 l Erlenmeyer flask) in shaker incubator at 28C° with shaking
at 140 rpm, culture filtrate was extracted with
dichloromethane (1:3 v/v) and repeated twice with the
same solvent. The solvent was evaporated close to
dryness using rotary evaporator at 29C°. The residue
was reconstituted into 4 ml dichloromethane and
transferred into a test tube. The solvent was evaporated using a jet stream of N2 gas and the weight of
the residue was determined by subtraction of the
known weight of the test tube. The residue was reconstituted in 10 ml dichloromethane and used as
stock concentration that was used to prepare 1.5, 3
and 5 mg crude extract in the bioassay for the phytotoxic activity. These amounts of crude extract were
used to be loaded on Whatman No 4 filter papers inside 9 cm glass Petri dishes. Filter papers were airdried for 15 min to allow solvent evaporation. Three
seeds of cucumber, ryegrass and milk thistle were
placed over a filter papers moistened with 2.5 ml sterilized distilled water, in three replicate plates. Prepared dishes were placed inside plastic bags to conserve on moisture and incubated inside cooled
incubator for 4 days at 28C°. Percent germination,
radicle and shoot growth of the germinants were re-
299
corded. Uninoculated GPM broth was extracted in the
same manner applied with the culture filtrate of the
active isolate to serve as a control along with another
control of sterilized distilled water.
Characterization of the most active Streptomyces isolates. Streptomyces isolates that maximally inhibited seed germination, radicle and shoot length
were characterized morphologically and physiologically according to the International Streptomyces
project (ISP) (Shirling and Gottlieb, 1966) and as described by Saadoun et al. (2008). The spore surface
of five of the active streptomycetes isolates was examined under scanning electron microscope at a magnification of 15000 to 25000 x. The stub that is covered
with conductive carbon disk was placed over a 21-day
old culture of each isolate grown on oatmeal and glucose asparagin agar. The stubs were placed in a sputter coater (Biorad, Polaron Equipment Ltd. E 6100)
for 2–3 min (approximately 150 A° of gold deposited). The gold sputterer was set at 1.2 kv, 40 mA and
10–3 mbar. After coating, the specimens were viewed
with a FAI Quanta 200 scanning electron microscope
with an accelerating voltage of 20 kv. Secondary electron images were recorded with black and white film.
The spore surface structures were classified to: smooth
(sm), spiny (sp), warty (wa) and hairy (ha) (Nonomura,
1974). Carbon utilization test was performed according to the ISP (Shirling and Gottlieb, 1966) for the most
active isolate to be identified to the species level.
Statistical analysis. All experiments were laid out
on the basis of completely randomized design (CRD)
and generated data was subjected to statistical analysis system (SAS). Means were separated by the least
significant differences (LSD) at " = 0.05.
Results and Discussion
The present investigation revealed that soils from
cultivated fields, forests and barns in North Jordan are
rich reservoirs for streptomycetes with phytotoxic activity. The phytotoxicity of these isolates was demonstrated by strip culture as well as the bacterial culture
filtrate treatment.
Isolation of Streptomyces isolates. By employing
enrichment methods, a total of 231 different Streptomyces isolates were recovered from 16 most humid
and vegetative habitats in Jordan. All of these isolates
matched the genus description reported by Shirling
and Gottlieb (1966), Nonomura (1974) and Williams
et al. (1983).
Screening for isolates with bioherbicidal activity. All of the 231 isolates were tested for their phytotoxicity ability towards two indicator plant seeds; cucumber (Cucumis sativus L.) (UPC, 0-21496-28630-3,
Lowes, Texas) and ryegrass seeds (Lolium perenne L.)
300
4
Bataineh S.M.B. et al.
Table I
Effect of the most active Streptomyces isolates on seed germination, radicle and shoot growth of cucumber and ryegrass
assessed by the agar plate screening method
Cucumber
Isolate
Cont.
R9
MB13
MS5
MS18
Is11
R2
MS3
J214
LSDe
a Ger:
Ger %
%) G
100
100
100
100
100
100
100
100
100
0
0
0
0
0
0
0
0
0
a
Germination;
b %):
b
Ryegrass
R.L mm %) R.L S.L mm %) S.L
c
59.3
8.9
20.4
18.5
22.7
20.0
26.8
18.7
22.1
7.5
d
85.0
65.6
68.8
61.7
66.3
54.8
68.5
62.7
27.7
2.7
4.3
4.2
5.5
3.7
5.1
4.2
3.7
9.7
Percent decrease over the control;
90.3
84.5
84.8
80.1
86.6
81.6
84.8
86.6
c R.L:
(Local cultivar Beit Alpha) (Mallik, 2001). As shown
in Table I, a considerable proportion of the tested isolates (9.1%) exhibited phytotoxic activity towards the
above plant seeds which was indicated as the percentage of seed germination. Other studies (Defrank and
Putnam, 1985; Heisey et al., 1985) reported a range
of 6.7% and 10–12% using same indicator plants of
cucumber and barnyard grass, respectively. The isolates MB13, MS5, Is11, R9, and J214 (Table I) inflicted significant phytotoxic effect on cucumber and
ryegrass seeds under culture strips treatment. The isolate R9 caused 85.2% inhibition of ryegrass seed germination and germinated seeds showed 98.1% and
97.1% reduction in their radicle and shoot growth, respectively. However, R9 did not affect cucumber seed
germination, although it caused 85% and 90.3% reduction in their radicle and shoot growth, respectively.
The isolate J214 caused 41.9% inhibition in seed germination of ryegrass in contrast with the control. The
germinated seeds showed 81.7% reduction in growth
of their radicle and 96.1% reduction in their shoot
growth. J214 caused reduction in the cucumber
radicle and shoot growth by 62.7% and 86.6%, respectively. The isolates MB13 and MS5 had almost
similar phytotoxic activity against both cucumber and
ryegrass seeds. Those isolates caused 33.3% inhibition in seed germination of ryegrass compared with
the control. The germinated seeds of both plant species showed more than 76% reduction in growth of
their radicle and more than 88% reduction in growth
of their shoot. Though MB13 and MS5 had no adverse effect on cucumber seed germination, but they
caused more than 65% reduction in growth of the
radicle and about 84% reduction in growth of shoot
in both plant species. The isolate Is 11 had no adverse
effect on ryegrass and cucumber seed germination in
contrast with the control, but it caused more than 40%
Ger. %
100
14.8
66.7
66.7
83.0
100
66.7
77.7
58.1
22.6
Radicle length;
%) G.L R.L Mm %) R.L S.L mm %) S.L
85.2
33.3
33.3
17.0
0
33.3
22.3
41.9
d S.L:
10.4
0.2
2.5
1.7
3.0
6.0
5.2
4.0
1.9
1.4
Shoot length;
98.1
76.0
83.7
71.2
42.3
50.0
61.5
81.7
e LSD:
10.3
0.3
1.2
0.9
2.0
0.3
4.2
3.0
0.4
2.2
97.1
88.3
91.3
80.6
97.1
59.2
70.8
96.1
Least significant difference
reduction in both plant species radicle growth and
more than 86% reduction in the growth of their shoot.
The phytotoxicity symptoms observed in this investigation were represented by discoloration and
death of the root tips, suggesting that the phytotoxic
effect is a cytotoxic one working on the meristematic
cells. This confirms that the mechanism of action of
such bacteria is by the production of some extra cellular agent (s) or toxin (s) that affects the meristematic cells. Such activity was more profoundly inflicted
by the isolates; R9, MB13, MS5 and J214.
Streptomyces culture filtrates from SCN broth.
The culture filtrate of R9 caused 33.3% inhibition in
the seed germination of ryegrass compared to the
SCN broth control (Fig. 1). R9 caused more than 67%
reduction in the growth of the radicle for cucumber
and ryegrass and significantly reduced the growth of
the shoot for cucumber, ryegrass and milk thistle. The
culture filtrate of MB13 caused more than 16% inhibition of seed germination for cucumber and ryegrass
in contrast with the control. However, germinated cucumber and ryegrass seeds showed reduced radicle
growth, whereas germinated milk thistle seeds
showed reduced shoot. The culture filtrate of MS5 inhibited the germination of ryegrass and wild oat seeds
by 33.3% and 88.9% respectively, compared to the
control. Germinated cucumber, ryegrass and milk
thistle seeds showed reduced radicle growth. Germinated ryegrass and milk thistle showed reduced shoot
growth, while a complete inhibition for wild oat shoot
growth was observed. The culture filtrate of MS18
inhibited seed germination of ryegrass and wild oat.
Whereas germinated cucumber and ryegrass seeds
showed reduced radicle growth, but germinated
ryegrass and wild oat seeds showed reduced shoot
growth. The culture filtrate of Is11 inhibited 33.3%
seed germination of ryegrass. Germinated cucumber
4
Streptomycetes producing herbicidal compounds
301
Fig. 1. Effect of culture filtrates of the isolates R9, R2, MB13, MS5, MS18, MS3 and Is11 from their SCN broth cultures compared to
the controls (SD H2O and uninoculated SCN broth) on germination, radicle and shoot growth of cucumber, ryegrass and milk thistle.
Bars represent the standard errors for means of a plant species at " = 0.05.
and ryegrass seeds showed reduced radicle growth
while germinated ryegrass and milk thistle showed reduced shoot growth compared to the control. R2 culture filtrate caused 91% inhibition for seed germination of cucumber and inhibited more than 33% seed
germination of ryegrass and milk thistle compared to
the control. Germinated cucumber, ryegrass and milk
thistle seeds showed about 90% reduction in the growth
of the radicle. Germinated ryegrass and milk thistle
showed about 80% reduction in the growth of the shoot
with complete inhibition of the growth of the shoot.
The culture filtrate of MS3 caused inhibition in the
seed germination of cucumber and ryegrass by 27.8%
and 66.7%, respectively compared to the control.
Most of the active isolates were active in the agar
plate screening method and the activity was evident
in their culture filtrates as well, a criterion that indicates the feasibility of gross fermentation, and extraction of significant amounts of the active component.
The extracellular metabolite activity of the actinomycetes was demonstrated in number of ways such as
the strip culture technique on agar, broth extraction
(Mallik, 1997), and the possible volatile constituent
of this product (El-Trabily et al., 1997).
Streptomyces culture filtrates from GPM broth.
The GPM broth composition was found to support
profuse phytotoxin production. The phytotoxic activity of R9 culture filtrate from its GPM broth culture presents a broad spectrum phytotoxin activity.
This activity affects both dicotyledonous and monocotyledonous plant seeds such as cucumber, ryegrass,
milk thistle, and redroot pigweed in pre-emergence
302
Bataineh S.M.B. et al.
4
Fig. 2. Effect of culture filtrates of the isolates R9, R2, MB13 and MS5 from their GPM broth cultures compared to the controls
(SD H2O and uninoculated GPM broth) on germination, radicle and shoot growth of cucumber, ryegrass and milk thistle.
Bars represent the standard errors for means of a plant species at " = 0.05.
applications. R9 culture filtrate caused complete inhibition in seed germination of ryegrass (Fig. 2). Germinated cucumber showed more than 87% reduction
in the growth of the radicle and shoot while germinated milk thistle showed 89.1% reduction in the
growth of the radicle compared to the GPM broth control. The culture filtrate of R9 caused significant phytotoxic effect against Amaranthus retroflexus seeds
indicated by complete inhibition for seed germination
when applied in 1:1 dilution with sterilized distilled
water (Fig. 3). The effect of the R9 culture filtrate
on ryegrass substantiates the finding reported by
Mallik (1997). A complete inhibition of the redroot
pigweed germination caused by R9 culture filtrate
was more pronounced than what was previously reported by Heisey and Putnam (1990). Through their
study they reported the inhibition for radicle elongation of redroot pigweed caused by geldanamycin and
nigericin rather than the complete inhibition of the
germination.
The culture filtrate of MB13 showed reduction in
growth of the radicle and shoot of milk thistle by
75.3% and 54.5%, respectively in contrast with the
control. The culture filtrate of MS5 showed reduction
in the growth of the radicle and shoot of milk thistle
by 82.6% and 42.4%, respectively compared to the
control. R2 culture filtrate reduced 42% growth of the
radicle in milk thistle compared with the control.
Streptomyces culture filtrates from peptone-molasses-corn steep (PMC) broth. R9 culture filtrate
showed more than 74% reduction in growth of the
radicle and shoot of cucumber whereas, the culture
filtrates of the isolates MB13, MS5 and R2 showed
no adverse effect on the seed germination or the growth
of the radicle and shoot of the tested plant species
compared to the PMC broth control.
Extraction of the phytotoxin(s). The R9 culture
filtrate was the only one to be extracted with dichloromethane. Dichloromethane extracted fraction of the
R9 culture filtrate (50 mg) from GPM broth caused
4
Streptomycetes producing herbicidal compounds
303
Fig. 3. Effect of culture filtrates of the isolates R9, R2, MB13 and MS5 from their PMC broth cultures compared to the controls
(SD H2O and uninoculated PMC broth) on germination, radicle and shoot growth of cucumber, ryegrass and milk thistle.
Bars represent the standard errors for means of a plant species at " = 0.05.
complete inhibition of ryegrass seed germination at 3
and 5 mg crude extract (Table II). However, at 1.5 mg,
there was no inhibition of seed germination, but the
growth of the radicle and shoot were reduced by
97.5% and 90.4%, respectively, compared to water
control. In case of cucumber, there was no inhibition
of seed germination, but the growth of the radicle was
reduced by 95.6%, 98.1% and 99.4% at 1.5, 3 and
5 mg, respectively, compared with its growth under
sterilized distilled water control. The growth of the
cucumber shoot was completely suppressed at 3 and
5 mg and reduced by 97.7% at 1.5 mg, compared with
the sterilized distilled water control. The seed germination of milk thistle was inhibited by 55.7% at 5 mg
compared to the sterilized distilled water control with
no significant inhibition at 1.5 and 3 mg. Radicle
growth of milk thistle was reduced by 66.5%, 93.2%
and 96.6% at 1.5, 3 and 5 mg respectively compared
to the sterilized distilled water control. Whereas the
growth of milk thistle shoots was completely suppressed at 5 mg, and reduced by 73% at 3 mg, but
there was no significant reduction at 1.5 mg compared
with the sterilized distilled water control.
Further testing revealed that other isolates are
important to be handled in similar manner such as
J214, MB13 and MS5, which was kept for future
investigation. The phytotoxic potential of R9 crude
extract against the growth of cucumber, ryegrass, and
304
4
Bataineh S.M.B. et al.
Table II
Responses of cucumber, ryegrass and milk thistle on filter paper moistened
with solvent extract of fresh R9 culture filtrate (CF) and uninoculated broth (UB)
Concentration
of extract (mg/ml)
Radicle length (mm)
Cucumber
1.5
3.0
5.0
control (S.D.H2O) a
LSD b
Ryegrass
1.5
3.0
5.0
control (S.D.H2O)
LSD
Milk thistle
1.5
3.0
5.0
control (S.D.H2O)
LSD
Shoot length (mm)
Germination (%)
UB
CF
UB
CF
UB
CF
75.0
73.0
55.8
85.0
3.7*
1.6*
0.5*
28.8
21.4
11.6
30.4
0.7*
0.0*
0.0*
100.0
100.0
100.0
100.0
100.0
89.0
89.0
2.7
17.7
14.8
7.0
16.3
6.0
0.4*
0.0*
0.0*
17.7
10.5
2.4
12.5
1.2*
0.0*
0.0*
1.9
31.5
21.5
20.0
23.6
25.4
100.0
100.0
100.0
100.0
55.7
0.0*
0.0*
4.9
7.9*
1.6*
0.8*
9.7
7.1
5.7
8.9
48.0
7.5
2.4
0.0*
4.7
100.0
100.0
100.0
100.0
100.0
66.7
44.3*
3.5
36.6
* Significantly different from corresponding uninoculated broth at " = 0.05
a S.D.H O: Sterile distilled water; b LSD: Least significant difference
2
Table III
Morphological and physiological characterization of streptomycetes active isolates
Characterization
Morphological
a
D-Fructose
Sucrose
I-inositol
Rhamnose
Raffinose
D-mannitol
Sm
Sm
Sm
Sm
Sm
Sm
Sm
D-xylose
RF
RF
RF
RA
RF
RF
RF
L-Arabinose
–
–
–
–
–
–
–
D-Glucose
0
1
0
0
0
0
0
Spore
Surfacec
Diffusible
pigmenta
Reverse side
color
Distinctive
Distinctive
Distinctive
Distinctive
Distinctive
Distinctive
Distinctive
Spore chain
morphologyb
Gray
White
White
White
White
Gray
White
Sugar utilizationd*
Microscopic
Melanin
Production
R9
R2
MS5
MB13
MS18
MS3
Is11
Aerial mass
color
Isolate
Physiological
Macroscopic
+
–
+
+
–
–
–
–
–
Diffusible pigment: 1 – Black, 0 – none; b RF: Rectiflexibiles, RA: Retinaculiaperti;
Sugar utilization test was done only for R9
d*
milk thistle at the higher two concentrations suggests
a promising broad spectrum phytotoxin. This activity on cucumber seeds coincide with the phytotoxic
activity on cucumber apical growth done by Mishra
et al. (1987).
The phytotoxic activity observed here indicates
that it may be a function of concentration coupled
with the degree of susceptibility of each crop to the
active ingredient produced. The phytotoxic effect of
R9 crude extract suggested a potential phytotoxin that
c
sm: smooth,
may adversely affect the embryos and hinder the seed
germination of weeds. The extracted compound(s)
would be a promising phytotoxin that may be mass
produced, purified, formulated and commercialized.
Characterization of the most active isolates.
Macroscopic and microscopic characterization of five
of the most active isolates was shown in Table III.
Based on spore surface, carbon utilization test and the
other cultural properties, stain R9 was identified as
Streptomyces aburaviensis.
4
Streptomycetes producing herbicidal compounds
Acknowledgements
Deanship of Scientific Research at Jordan University of
Science and Technology funded this research (Grant No. 135/03).
The authors are grateful to Prof. M.A.B. Mallik (Emeritus
Research Professor, Langston University, Oklahoma) for his guidance and valuable suggestions through out the present work.
Literature
Abu-Irmaileh B. E. 2000. Weed management in the Near East
– general view. pp. 19–25. In: P.G. Americanos, B.E. AbuIrmaileh and A.R. Saghir (eds), Improved Weed Management in
the Near East. Arab Organization of Agricultural Development.
Khartoum-Sudan.
Arai M., T. Haneishi, N. Kitahara, R. Enokita, K. Kawakubo
and Y. Kondo. 1976. Herbicidans A and B, two new antibiotics
with herbicidal activity, I. Producing organism and biological
activities. J. Antibiotics 29: 863–869.
Babaczinski P., M. Dorgerloh, A. Löbberding, H.J. Santel,
R.R. Schmidt and C. Wünsche. 1991. Herbicidal activity and
mode of action of vulgamycin. Pestic. Sci. 33: 439–446.
Charudattan R., V.J. Prange and J.T. DeValerio. 1996. Exploration of the use of the “Bialaphos Genes” for improving bioherbicidal efficacy. Weed Technol. 2: 625–636.
Defrank J. and A.R. Putnam. 1985. Screening procedures to
identify soil borne actinomycetes that can produce herbicidal
compounds. Weed Sci. 33: 271–274.
El-Trabily K.A., St. G.E. Hardy, K. Sivasithamparam,
A.M. Hussein and J.D. Kurtboke. 1997. The potential for the
biological control of cavity-spot disease of carrots, caused by
Pythium coloratum, by streptomycete and non-streptomycete
actinomycetes. New Phytol. 137: 495–507.
Halleck B., J. Warren, R. Josfph, F. Prokop and E.G. Walton.
1955. Nonsynthetic media for antibiotic producing actinomycetes.
Antibiot. Chemother. 5: 6–12.
Heisey R. M., J. Defrank and A.R. Putnam. 1985. A survey of
soil microorganisms for herbicidal activity, pp. 337–349. In: A.C.
Thompson (ed.), The Chemistry of Allelopathy. ACS Symposium
series No. 268. American Chemical Society. Washington, D.C.
Heisey R. M. and Putnam A. R. 1990. Herbicidal activity of
the antibiotics geldanamycin and nigericin. J. Plant Growth Reg.
9: 19–25.
Hoagland R.E. 1990. Microbes and microbial products as herbicides, an overview, pp. 2–52. In: R.E. Hoagland (ed.) Microbes
and Microbial Product as Herbicides. ACS Symposium No 439.
American Chemical Society, Washington, DC.
Li Y., Z. Sun, X. Zhuang, L. Xu, S. Chen and M. Li. 2003.
Research progress on microbial herbicides. Crop Protec. 22:
247–252.
305
Mallik M.A.B. 1997. Isolates of soil actinomycetes with potential for phytotoxin production. J. Chem. Ecol. 23: 2683–2693.
Mallik M.A.B. 2001. Selective isolation and screening of soil
microorganisms for metabolites withherbicidal potential. J. Crop
Allelo. Agroeco. 4: 219–236.
Mishra S. K., W.H. Taft, A.R. Putnam and S.K. Ries. 1987.
Plant growth regulatory metabolites from novel actinomycetes.
J. Plant Growth Reg. 6: 75–84.
Murao S. and H. Hayashi. 1983. Gourgerotin, as a plant growth
inhibitor, from Strptomyces sp. No. 179. Agric. Biol. Chem.
47: 1134–1136.
Nonomura H. 1974. Key for classification and identification of
458 species of the streptomycetes included in ISP. J. Ferm.
Technol. 52: 78–92.
Saadoun I., L. Wahiby, Q. Ababneh, Z. Jaradat, M. Massadeh
and F. AL-Momani. 2008. Recovery of soil streptomycetes from
arid habitats in Jordan and their potential to inhibit multi-drug
resistant Pseudomonas aeruginosa pathogens. World. J. Microbiol. Biotechnol. 24: 157–162
Saadoun I., F. Al-Momani, H. Malkawi and M.J. Mohammad.
1999. Isolation, identification and analysis of antibacterial activity of soil streptomycetes isolates from North Jordan. Microbios
100: 41–46.
Saadoun I. and R. Gharaibeh. 2002. The Streptomyces flora of
Jordan and its’ potential as a source of antibiotics active against
antibiotic-resistant Gram-negative bacteria. World J. Microbiol.
Biotech. 18: 465–470.
Salim A. A. and M. Mokhtar. 2000. A comparison study of weed
control methods in plum orchards, pp. 115–119. In: P.G.
Americanos, B.E. Abu-Irmaileh and A.R. Saghir (eds), Improved
Weed Management in the Near East. Arab Organization of Agricultural Development. Khartoum-Sudan.
Sekizawa Y. and T. Takematsu. 1983. How to discover new
antibiotics for herbicidal use, pp. 261–268. In: N. Takahashi,
H. Yoshioka, T. Misato and S. Matsunaka (eds.), Pesticide Chemistry: Human Welfare and the Environment, Vol. 2. Natural
Producer, Pergamon Press. Oxford, U.K.
Shirling E.B. and D. Gottlieb. 1966. Methods for characterization of Streptomyces species. Int. J. Syst. Bacteriol. 16: 313–340.
Takahashi E., T. Kimura, K. Nakamura, M. Arahira and
M. Iida. 1995. Phosphonothrixin, a novel herbicidal antibiotic
produced by Saccharathrix sp. ST 888, I. Taxonomy, fermentation
isolation and biological properties. J. Antibiot. 48: 1124–1129.
Williams S.T., M. Goodfellow, G. Alderson, E.M. Wellington,
P.H. Sneath and M.J. Sackin. 1983. Numerical classification of
Streptomyces and related genera. J. Gen. Microbiol. 129: 1743–1813.
Yamada O., Y. Kaise, F. Futatsuya, S. Ishida, K. Ito,
H. Yamamoto and K. Munakata. 1972. Studies on plant growth
regulating activities of anisomycin and toycamycin. Agric. Biol.
Chem. 36: 2013–2015.
306
Bataineh S.M.B. et al.
4
Polish Journal of Microbiology
2008, Vol. 57, No 4, 307–312
ORIGINAL PAPER
Macrolide-lincosamide-streptogramin B Resistant Phenotypes and Genotypes
for Methicillin-resistant Staphylococcus aureus in Turkey, from 2003 to 2006
H. CEM GUL1, ABDULLAH KILIC2*, AYLIN USKUDAR GUCLU2, ORHAN BEDIR2, MUSTAFA ORHON2
and A. CELAL BASUSTAOGLU2
Department of Infectious Diseases1 and Department of Microbiology 2,
Gulhane Military Medical Academy and School of Medicine 06018, Etlik, Ankara, Turkey
Received 20 September 2008, revised 1 November 2008, accepted 4 November 2008
Abstract
Methicillin-resistant Staphylococcus aureus (MRSA) strains with inducible macrolide-lincosamide-streptogramin B (iMLSB) resistance
phenotype may lead to clinical failure during clindamycin (CLI) therapy. The aim of this study was to determine the incidence of MLSB
phenotypes by using D-test method and genotypes by using multiplex real-time PCR method in MRSA strains. A total of 265 MRSA
strains were obtained from clinical samples from hospitalized and outpatients. Of the MRSA isolates, 225 (84.9%) were resistant
to erythromycin (ERT), and 170 (64.1%) to CLI. Among the 225 ERT-resistant MRSA strains, the constitutive MLSB (cMLSB) rate was
found in 49.3%, iMLSB in 39.1% and the M phenotype in 11.5%. Overall, ermA, ermC, ermA+ermC, msrA, ermC+msrA, and
ermA+ermC+msrA genes were detected in 85 (37.7%), 60 (26.6%), 42 (18.6%), 26 (11.5%), 11 (4.8%), and 1 (0.4%) isolates, respectively.
Most prevalent resistance determinant in MRSA strains was ermA, which was detected in 37.7% of the isolates. The 26 MRSA strains with
M phenotype harboured only msrA gene. In conclusion, due to aware of the potential of CLI treatment failure, D-test should be performed
and reported in MRSA strains in clinical laboratories. The multiplex real-time PCR method is easy to perform, fast and reliable method for
the detection of MLSB resistance genotypes.
K e y w o r d s: Staphylococcus aureus, MLSB, MRSA, multiplex real-time PCR
Introduction
Methicillin-resistant Staphylococcus aureus (MRSA)
is one of the most important pathogens as a worldwide health problem now (Deresinski, 2005). MRSA
became increasingly prevalent in the hospital and community settings in the United States, Asia, and some
parts of European countries (Robinson and Enright,
2003). MRSA has also been increasingly found in the
Turkish hospitals as an important problem (Oztop
et al., 2004).
Although macrolide, lincosamide and streptogramin B antimicrobial agents (MLSB) are chemically
distinct, they have similar mode of action (Leclercq
and Courvalin, 1991). Erythromycin (ERT) and clindamycin (CLI) inhibit protein synthesis in a wide
range of bacteria by binding to a single site the large
ribosomal subunit located near the entrance to the
growth of the polypeptide chain in bacterial ribosome.
They can also prevent the formation of the 50S riboso-
mal subunit in growing bacteria (Garza-Ramos et al.,
2001). Streptogramin B affects the 50S large subunit
in a similar way as the ERT and competes for the same
binding site (Harms et al., 2004).
Since MLSB antimicrobial agents are widely used
in the treatment of S. aureus and other Gram-positive
organism infections, resistance rate of this strain has
been rapidly increased (Khan et al., 1999). Mainly,
two different mechanisms are liable for most of the
acquired bacterial resistance to MLSB antibiotics in
staphylococci: through efflux of the antibiotic and
through target-site modification by methylation. In the
first mechanism, antibiotic efflux is typically mediated by ATP-dependent efflux pump encoded the
msrA gene (Lerlercq, 2002). The efflux mechanism
yields resistance to macrolides and type B streptogramins but not to lincosamides, the so-called M phenotype. In the second mechanisms, modification of the
drug-binding site is mediated by controlling the methylation of the 23S rRNA binding site of adenosine
* Corresponding author: A. Kilic, Department of Microbiology and Clinical Microbiology, Gulhane Military Medical Academy,
School of Medicine, 06018, Ankara, Turkey; phone: (90) 312 3043412; e-mail: [email protected]
308
4
Gul H.C. et al.
2058 (A2058) encoded by ERT ribosomal methylase
(erm) genes. The ermA and ermC are most frequently
found in staphylococci. This mechanism confers crossresistance to MLSB antibiotics, the so-called MLSB
phenotype. Expression of MLSB resistance can be
either constitutive (cMLSB) or inducible (iMLSB)
(Volokhov et al., 2003). Although strains with iMLS B
resistance display in vitro susceptiblity to lincosamides
and type B streptogramin which are not inducer, they
show in vitro resistance to macrolides which are inducer. Since iMLSB resistance can not be determined
by using standard susceptibility test methods such as
broth-based or agar dilution test, the double-disk diffusion agar inhibitory assay or D-test methods are
used for demonstration of this phenotype in isolates
that are susceptible to CLI and resistant to ERT
(Chavez-Bueno et al., 2005).
The objective of this study was to determine the
existence of iMLSB phenotype among MRSA strains
by using D-test and occurrence of the ERT-resistant
genes by using a new multiplex real-time PCR in
MRSA strains collected from Gulhane Military Medical Academy Hospital (GMMAH) Clinical Microbiology Laboratory during a four year study period. To
our knowledge, this is the first multiplex real-time PCR
study to detect ERT-resistant genes in MRSA strains.
Experimental
Materials and Methods
Bacterial strains. GMMAH is a teaching hospital
with more than 1500 beds in Ankara, the capital of
Turkey. A total of 265 MRSA strains were obtained
from clinical samples from hospitalized and outpatients
at the GMMAH from 2003 through 2006. These strains
were isolated from skin, soft tissue, abscess (114;
43.1%), blood stream (89; 33.5%), respiratory (25;
9.4%), and other clinical samples (37; 13.9%). Of the
patients included, 89.88% were adults, 10.2% were
child, 71.5% were male, and 28.5% were female. Only
the first isolate from each patient during the study period was included to avoid overrepresentation. Colony
morphology, Gram-staining, catalase, tube-coagulase,
DNase, and mannitol tests were used for identification
of all S. aureus isolates. Final identification was performed with the Phoenix, an automated bacteriology
system that performs bacterial identification (Becton
Dickinson Diagnostic Systems, Sparks, MD, USA)
(Layer et al., 2006). The isolates were kept at –70°C
in trypticase soy broth (Merck, Darmstadt, Germany)
supplemented with 15% glycerol before being tested.
Antimicrobial susceptibility testing. The susceptibility of the isolates was determined by a disk diffusion method in accordance with Clinical and Laboratory Standards Institute standards (CLSI, 2006) against
thirteen antimicrobial agents (Oxoid, Hampshire, England). The antibiotics tested were amoxicillin-clavulanate, cefazolin, CLI, ERT, gentamicin, levofloxacin,
minocycline, penicillin, rifampin, trimethoprim/sulfamethoxazole (SXT), quinupristin-dalfopristin, linezolid, and vancomycin. Inducible CLI resistance was
identified as a D-shaped inhibition zone by the CLIERT double-disk test. This test was performed by
placing a 2 µg CLI disk from 15 mm to 26 mm away
from the edge of a 15 µg ERT disk as part of the normal disk diffusion procedure on Mueller-Hinton Agar.
After 16–18 h incubation, organisms that do not show
flattening of the CLI zone recorded as CLI susceptible. Organisms that show flattening of the CLI zone
adjacent to the ERT disk indicated iMLSB phonotype
(Seybold et al., 2006). Penicillin Binding Protein 2’
Latex Agglutination Test (PBP2’) (Oxoid Limited,
Basingstoke, England) also was also performed for
the confirmation of mecA-positive S. aureus as recommended by the manufacturers. S. aureus ATCC 29213
and ATCC 25923 were used as control strains.
DNA extraction and multiplex real-time PCR.
DNA was prepared as described previously by Kilic
et al. (2004). A real-time TaqMan PCR method was
performed on the 7500 ABI Prism Sequence Detector
(Applied Biosystems, Foster City, Calif., USA). The
primers and fluorophore TaqMan probes for ermA,
Table I
Oligonucleotide sequences of the primers and probes used in this study
Target
genes
ermA
ermC
msrA
Oligonucleotide sequence (5'–3')
Forward
Reverse
Probe
Forward
Reverse
Probe
Forward
Reverse
Probe
ggatcaggaaaaggacattttac
ttatatccatctccaccattaatagtaa
fam-tagtcaaaatgagtcgatcagttactgcta-bhq-1
gctcaggaaaagggcatttta
gctaatattgtttaaatcgtcaattc
vic-attagtacaaaggtgtaatttcgtaactgctat-bhq-1
gcacaataagagtgtttaaaggta
atgattggataattattatggatatcata
texas red-acagtatcaaaatcaatatgaacaagaacag-bhq-2
GenBank
accession no
AF466413.1
Y09003.1
EF0922840.1
4
309
MLSB resistant phenotypes and genotypes of S. aureus
ermC and msrA genes were designed with reference to
the sequences deposited in GenBank under accession
numbers AF466413.1, Y09003.1, and EF0922840.1,
respectively (Table I). In brief, 1 µl of the extracted
nucleic acid was added to 24 µl of reaction mixture
containing 0.8 µM of each primer and 0.4 µM
fluorophore probe (final concentration), and mixed
with 25 µl of TaqMan Universal PCR Master Mix
(Applied Biosystems). The TaqMan cycling conditions were a 2 min degradation of the pre-amplified
templates at 95°C and then 40 cycles of denaturation
at 95°C for 15 s and annealing and extension at 58°C
for 60 s (Kilic et al., 2006). S. aureus strains containing ermA (S. aureus RN1551), ermC (S. aureus
FPR3757) and msrA (S. aureus 15114) genes were
kindly provided from Fred C. Tenover at Centers for
Disease Control and Prevention, Atlanta, GA, USA.
Statistical analysis. Statistical comparisons were
performed using SPSS 15.0 for Windows (SPSS Inc.,
Chicago, Illinois, USA). Associations between
cMLSB phenotype and iMLSB phenotype for antibiotic susceptibilities were analyzed using the P2 test
or the Student t test. P values of ≤ 0.05 were considered statistically significant.
Results
A total of 265 MRSA isolates collected during a
four year period between 2003 and 2006 from the
Clinical Microbiology Laboratory at GMMAH were
tested. Of the MRSA isolates, 225 (84.9%) were
resistant to ERT, and 170 (64.1%) to CLI. Among 225
ERT-resistant MRSA strain, ermA, ermC, ermA+ermC,
msrA, ermC+msrA, and ermA+ermC+msrA genes were
detected in 85 (37.7%), 60 (26.6%), 42 (18.6%),
26 (11.5%), 11 (4.8%), and 1 (0.4%) isolates, respectively (Table II). The ermA gene was predominant in
these ERT-resistant MRSA strains. The 88 (39.1%)
isolates had iMLSB phenotype which showed a blunted
edge but an otherwise clear zone of inhibition around
the CLI disk. In these isolates, ermA (55; 62.5%),
ermC (23; 26.1%), and ermA+ermC (10; 11.3%)
genes were detected. In the 111 (49.3%) strains,
growth was observed around both disks, the so-called
cMLSB phenotype. They had ermC (37; 33.3%),
ermA+ermC (32; 28.8%), ermA (30; 27.1%), ermC+
msrA (11; 9.9%), ermA+ermC+msrA (1; 0,9%) genes.
The 26 (11.5%) isolates showed CLI susceptible zone
diameter with no blunting of the zone, the so-called
M phenotype. In these 26 strains, only msrA gene was
found. Antibiotic susceptibility for amoxicillin-clavulanate, cefazolin, gentamicin, levofloxacin, minocycline, penicillin, rifampin, trimethoprim/sulfamethoxazole (SXT), quinupristin-dalfopristin, linezolid, and
vancomycin was also determined and their resistance
rates between the cMLSB phenotype and iMLSB
phenotype were compared in Table III. The strains
with cMLSB phenotype were more resistant than the
strains with iMLSB phenotype to SXT (P2=11.903,
p = 0.001). No isolates were resistant to linezolid or
vancomycin in both groups.
Discussion
Since its first isolation by Barber in 1961, MRSA
is an increasingly important nosocomial pathogen in
the worldwide (Manian et al., 2003). In Turkey,
MRSA prevalence rates vary from 9% to 40% in studies (Karadenizli, 2002). Since MRSA strains are resistant to a variety of antimicrobial agents, therapy of
Table II
Distribution of macrolide-lincosamide-streptogramin B resistant genotypes and
phenotypes according to year among methicillin-resistant Staphylococcus aureus
No (%) of strains (n = 225)
Variable
Year
2003
2004
2005
2006
Genes ermA
ermC
ermA+ermC
msrA
ermC+msrA
ermA+ermC+msrA
Inducible
Constitutive
MLSB phenotype MLSB phenotype
(n = 111)
(n = 88)
40 (54.1)
16 (37.2)
31 (56.3)
24 (45.2)
30 (27.1)
37 (33.3)
32 (28.8)
0
11 (9.9)
1 (0.9)
MLSB: Macrolide-lincosamide-streptogramin B
27 (36.4)
23 (53.4)
17 (30.9)
21 (39.6)
55 (62.5)
23 (26.1)
10 (11.3)
0
0
0
M phenotype
(n = 26)
7 (9.4)
4 (9.3)
7 (12.7)
8 (15.1)
0
0
0
26 (11.5)
0
0
310
4
Gul H.C. et al.
Table III
Antibiotic resistance profiles between constitutive MLSB phenotype and inducible MLSB phenotype
in MRSA strains recovered from patients at Gulhane Military Medical Academy Hospital between 2003 and 2006
No (%) of strains
Antibiotics
Constitutive MLSB phenotype Inducible MLSB phenotype
(n = 111)
(n = 88)
Amoxicillin Clavulanate
Penicillin
Cefazolin
Gentamicin
Levofloxacin
Minocycline
Rifampin
Trimethoprim/sulfamethoxazole
Quinupristin-Dalfopristin
Linezolid
Vancomycin
102 (91.8)
111 (100.0)
101 (90.9)
102 (91.8)
88 (79.2)
4 (3.6)
99 (89.1)
39 (35.1)
3 (2.7)
0 (0.0)
0 (0.0)
83 (94.3)
87 (98.8)
81 (92.1)
79 (89.7)
67 (76.1)
0 (0.0)
81 (92.2)
12 (9.2)
0 (0.0)
0 (0.0)
0 (0.0)
chi square
0.442
1.268
0.070
0.268
0.282
3.236
0.464
11.903
2.415
NA
NA
p
0.506
0.260
0.792
0.605
0.596
0.072
0.496
0.001
0.120
MLSB: Macrolide-lincosamide-streptogramin B
infections caused by these strains is difficult and leads
to a high mortality rate (Ardic et al., 2005). Because
of the good oral absorption and remarkable distribution into skin and skin structures, CLI is considered
an alternative drug of the treatment of MRSA infection in outpatient and inpatient. However, reliable antibiotic susceptibility results are required for appropriate therapy decision (Angel et al., 2008). Gadepalli
et al. (2006) reported ERT and CLI resistance in 63%
and 79% of MRSA strains, respectively. In Taiwan,
ERT resistance rate was more than 90% and CLI resistance was between 70% and 90% in MRSA strains
were reported (Janapatla et al., 2007). Otsuka et al.
(2007) found 97% resistance to ERT and 59.5% to
CLI in MRSA strains. Schmitz et al. (1999) detected
94% resistance to ERT and 89.1% to CLI in 342
MRSA strains collected from 20 European university
hospitals. Azap et al. (2005) reported that in Turkey
ERT and CLI resistance rates were 69.6% and 63.8%
in MRSA strains. In our study, ERT and CLI resistance were found in 225 (73.7%) and 170 (55.7%)
MRSA strains, respectively as less than other studies.
CLI resistance can develop in staphylococcal isolates either constitutively or inducible. If the strains
have iMLSB, they may appear susceptible to CLI by
the microdilution and disk diffusion method as a false
in vitro result. The iMLSB, however, can be expressed
during a double disk diffusion test (D-test). Therefore,
2005 CLSI guideline has recommended to routine test
detecting staphylococci strains with iMLSB (Park
et al., 2007). In our study, the cMLSB, iMLSB and M
resistance phenotype were examined. Eighty-eight
(39.1%) isolates were found to be the iMLSB phenotype, 111 (49.3%) the cMLSB phenotype and 26
(11.5%) the M phenotype among ERT-resistant
MRSA. In Turkey, the cMLSb, iMLSB and M pheno-
type resistance rates were found to vary from 43.7%,
5.4% and 0% to 64%, 24.4%, 18%, respectively in
MRSA strains (Azap et al., 2007; Delialioglu et al.,
2005; Yilmaz et al., 2007; Aktas et al., 2007). The results of this study demonstrated that MLSB resistance
phenotype rate was consistent with previous studies
reported from Turkey. In the other countries such as
France, Greece, Taiwan, India, The United States, Japan, these rates were reported vary from 38%, 4%,
and 0% to 83%, 38.7%, 12%, respectively (Lina et al.
1999; Schreckenberger et al., 2004; Fokas et al. 2005;
Gadepalli et al. 2006; Janapatla et al. 2007; Otsuka
et al. 2007). The cMLSB phenotype was found predominant over the iMLSB phenotype in MRSA strains
in previously published studies consistent with our
study. This high rate of iMLSB resistance phenotype
among our hospital suggests that CLI should be used
cautiously. If CLI is used for treatment of infection
caused by MRSA strains with iMLSB phenotype, the
patients should be closely monitored during infection
progress for failure of treatment. CLI only may be used
safely treating of infection caused by MRSA strains
with M phenotype if appropriate.
The use of PCR and multiplex PCR for the detection of antibiotic resistance genes has been described
in many studies for MRSA strains previously (Lina
et al., 1999; Martineau et al., 2000; Lim et al., 2002;
Strommenger et al., 2003; Sekiguchi et al., 2003). To
our knowledge, this is the first investigation of ERTresistant genes in MRSA isolates by using multiplex
real-time PCR. When MLSB genotypes were examined
by using real-time PCR in this study, the ermA gene
was detected 85 (37.7%) of these isolates, ermC in 60
(26.6%), ermA+ermC in 42 (18.6%), msrA in 26
(11.5%), ermC+msrA in 11 (4.8%), and ermA+ermC+
msrA in 1 (0.4%). The ermA gene was more prevalent
4
MLSB resistant phenotypes and genotypes of S. aureus
in MRSA strains with iMLSB phenotype, while the
ermC gene was more common in cMLSB phenotype
strains. Fourty-two isolates contained both ermA and
ermC gene, while one (0.4%) isolate had all three
genes (ermA+ermC+msrA). In two studies from Turkey, Aktas et al. (2007) found the ermC gene was
more prevalent in MRSA strains as 63.6%, while Ardic
et al. (2005) reported the ermA gene is more common
in their MRSA strains as 71.4%. Schmitz et al. (2000)
reported from 24 countries in an European study,
the ermA gene was more common in MRSA strains
expressing a cMLSB phenotype. Janapatla et al.
(2007) detected the ermA gene in 93% and the ermC
gene in 7% of MRSA strains from Taiwan. Distinctly,
Spiliopoulou et al. (2004) from Greece in MRSA
strains reported most of MRSA strains in their study
carried the ermC gene (96.5%), mainly in strains with
cMLSB phenotype. Lina et al. (1999) reported the
ermA gene was more common in MRSA strains
(57.6%), mainly in strains with cMLSB phenotype
from France. To our knowledge, this is the first investigation of ERT-resistant genes in MRSA isolates by
using multiplex real-time PCR. The multiplex real-time
PCR described in this study detects three relevant resistance genes in a reaction.
In conclusion, the D-test should be performed
to avoid treatment failure in ERT-resistant, CLI susceptible MRSA strains. The multiplex real-time PCR
method should be used to determine the MLSB genotypes in MRSA strains. Our study has revealed that
the ermA gene and cMLSB phenotype were predominant in MRSA strains in Ankara, capital of Turkey.
This study suggested that MLSB resistance phenotypes and genotypes in MRSA strains should be monitored in every region and country.
Literature
Aktas Z., A. Aridogan, C.B. Kayacan and D. Aydin. 2007.
Resistance to macrolide, lincosamide and streptogramin antibiotics in staphylococci isolated in Istanbul, Turkey. J. Microbiol.
45: 286–290.
Angel M.R., V. Balaji, J. Prakash, K.N. Brahmadathan and
M.S. Mathews. 2008. Prevalence of inducible clindamycin resistance in gram positive organisms in a tertiary care centre. Indian
J. Med. Microbiol. 26: 262–264.
Ardic N., M. Ozyurt, B. Sareyyupoglu and T. Haznedaroglu.
2005. Investigation of erythromycin and tetracycline resistance
genes in methicillin-resistant staphylococci. Int. J. Antimicrob.
Agents. 26: 213–218.
Azap O.K., H. Arslan, F. Timurkaynak, G. Yapar, E. Oruc and
U. Gagir. 2005. Incidence of inducible clindamycin resistance in
staphylococci: first results from Turkey. Clin. Microbiol. Infect.
11: 582–584.
Chavez-Bueno S., B. Bozdogan, K. Katz, K.L. Bowlware,
N. Cushion, D. Cavuoti, N. Ahmad,G.H. Jr McCracken and
P.C. Appelbaum. 2005. Inducible clindamycin resistance and
molecular epidemiologic trends of pediatric community-acquired
311
methicillin-resistant Staphylococcus aureus in Dallas, Texas. Antimicrob. Agents. Chemother. 49: 2283–2288.
CLSI. 2006. Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standards, 9th ed. Clinical and Laboratory Standards Institute, Wayne, PA.
Delialioglu N., G. Aslan, C. Ozturk, V. Baki, S. Sen and
G. Emekdas. 2005. Inducible clindamycin resistance in staphylococci isolated from clinical samples. Jpn. J. Infect. Dis. 58:
104–106.
Deresinski S. 2005. Methicillin-resistant Staphylococcus aureus:
an evolutionary, epidemiologic, and therapeutic odyssey. Clin. Infect. Dis. 40: 562–573.
Fokas S., S. Fokas, M. Tsironi, M. Kalkani and M. Dionysopouloy. 2005. Prevalence of inducible clindamycin resistance in
macrolide-resistant Staphylococcus spp. Clin. Microbiol. Infect.
11: 337–340.
Gadepalli R., B. Dhawan, S. Mohanty, A. Kapil, B.K. Das and
R. Chaudhry. 2006. Inducible clindamycin resistance in clinical isolates of Staphylococcus aureus. Indian J. Med. Res. 123:
571–573.
Garza-Ramos G., L. Xiong, P. Zhong and A. Mankin. 2001.
Binding site of macrolide antibiotics on the ribosome: new resistance mutation identifies a specific interaction of ketolides with
rRNA. J. Bacteriol.183: 6898–6907.
Harms J.M., F. Schlünzen, P. Fucini, H. Bartels and A. Yonath.
2004. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins
dalfopristin and quinupristin. B.M.C. Biol. 2: 4.
Janapatla R.P., J.J. Yan, A.H. Huang, H.M. Chen, H.M. Wu
and J.J. Wu. 2007. Inducible clindamycin resistance in Staphylococcus aureus isolates causing bacteremia at a university hospital
in southern Taiwan. Diagn. Microbiol. Infect. Dis. 58: 203–209.
Karadenizli A. 2002. Hastanelerde metisilin dirençli Staphylococcus aureus (MRSA) control politikalarý ve MRSA. (in Turkish).
Hastane Ýnfeksiyonlarý Dergisi 6: 12–18
Khan S.A., M.S. Nawaz, A.A. Khan and C.E. Cerniglia. 1999.
Simultaneous detection of erythromycin-resistant methylase genes
ermA and ermC from Staphylococcus spp. By multiplex-PCR.
Mol. Cell. Probes 13: 381–387.
Kilic A., H. Li, C.W. Stratton and Y.W. Tang. 2006. Antimicrobial susceptibility patterns and staphylococcal cassette chromosome mec types of, as well as Panton-Valentine leukocidin occurrence among, methicillin-resistant Staphylococcus aureus isolates
from children and adults in middle Tennessee. J. Clin. Microbiol.
44: 4436–4440.
Kilic A., T. Demiray, M.A. Saracli, G. Bahar, H. Aydogan,
M. Baysallar and L Doganci. 2004. Bacteriological characterization of vancomycin-resistant enterococci in a pediatric hospital in Turkey. Ann. Microbiol. 54: 543–551.
Layer F., B. Ghebremedhin, W. König and B. König. 2006.
Heterogeneity of methicillin susceptible Staphylococcus aureus
strains at a German University Hospital implicates the circulating-strain pool as a potential source of emerging methicillinresistant S. aureus clones. J. Clin. Microbiol. 44: 2179–2185.
Leclercq R. 2002. Mechanisms of resistance to macrolides and
lincosamides: nature of the resistance elements and their clinical
implications. Clin. Infect. Dis. 34: 482–492.
Leclercq R. and P. Courvalin. 1991. Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target
modification. Antimicrob. Agents Chemother. 35: 1267–72.
Lim J.A., A.R. Kwon, S.K. Kim, Y. Chong, K. Lee and
E.C. Choi. 2002. Prevalence of resistance to macrolide, lincosamide and streptogramin antibiotics in Gram-positive cocci isolated in a Korean hospital. J. Antimicrob. Chemother. 49: 489–495.
Lina G., A. Quaglia, M.E. Reverdy, R. Leclercq, F. Vandenesch
and J. Etienne. 1999. Distribution of genes encoding resistance
to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrob. Agents Chemother. 43: 1062–1066.
312
Gul H.C. et al.
Manian F.A., P.L.Meyer, J. Setzer and D. Senke. 2003. Surgical
site infections associated with methicillin-resistant Staphylococcus aureus: do postoperative factors play a role? Clin. Infect. Dis.
36: 863–868.
Martineau F., F.J. Picard, N. Lansac, C. Ménard, P.H. Roy,
M. Ouellette and M.G. Bergeronl. 2000. Correlation between
the resistance genotype determined by multiplex PCR assays and
the antibiotic susceptibility patterns of Staphylococcus aureus and
Staphylococcus epidermidis. Antimicrob. Agents Chemother. 44:
231–238.
Otsuka T., H. Zaraket, T. Takano, K. Saito, S. Dohmae,
W. Higuchi and T. Yamamoto. 2007. Macrolide-lincosamidestreptogramin B resistance phenotypes and genotypes among Staphylococcus aureus clinical isolates in Japan. Clin. Microbiol.
Infect. 13: 325–327.
Oztop A.Y., H. Pinarbasi, S. Kocagoz, M.Z. Bakici and
M. Bakir. 2004. Molecular genotyping of methicillin-resistant
Staphylococcus aureus strains in a teaching hospital in Turkey.
Microb. Drug Resist. 10: 154–159.
Park J.Y., J.S. Jin, H.Y. Kang, E.H. Jeong, J.C. Lee, Y.C. Lee,
S.Y. Seol, D.T. Cho and J. Kim. 2007. A comparison of adult
and pediatric methicillin-resistant Staphylococcus aureus isolates
collected from patients at a University Hospital in Korea.
J. Microbiol. 45: 447–452.
Robinson D.A. and M.C. Enright. 2003. Evolutionary models
of the emergence of methicillin-resistant Staphylococcus aureus.
Antimicrob. Agents Chemother. 47: 3926–3934.
Schmitz F.J., J. Verhoef and A.C. Fluit. 1999. Prevalence of
resistance to MLS antibiotics in 20 European university hospitals
participating in the European SENTRY surveillance programme.
Sentry Participants Group. J. Antimicrob. Chemother. 43: 783–792.
Schmitz F.J., R. Sadurski, A. Kray, M. Boos, R. Geisel,
K. Köhrer, J. Verhoef and A.C. Fluit. 2000. Prevalence of ma-
4
crolide-resistance genes in Staphylococcus aureus and Enterococcus faecium isolates from 24 European university hospitals.
J. Antimicrob. Chemother. 45: 891–894.
Schreckenberger P.C., E. Ilendo and K.L. Ristow. 2004.
Incidence of constitutive and inducible clindamycin resistance in
Staphylococcus aureus and coagulase-negative staphylococci in
a community and a tertiary care hospital. J. Clin. Microbiol. 42:
2777–2779.
Sekiguchi J., T. Fujino, K. Saruta, F. Kawano, J. Takami,
H. Miyazaki, T Kuratsuji, H. Yoshikura and T. Kirikae. 2003.
Spread of erythromycin-, tetracycline- and aminoglycoside-resistant genes in methicillin-resistant Staphylococcus aureus clinical
isolates in a Kumamoto Hospital. Jpn. J. Infect. Dis. 56: 133–137.
Seybold U., E.V. Kourbatova, J.G. Johnson, S.J. Halvosa,
Y.F. Wang, M.D. King, S.M. Ray and H.M. Blumberg. 2006.
Emergence of community-associated methicillin-resistant Staphylococcus aureus USA300 genotype as a major cause of health careassociated blood stream infections. Clin. Infect. Dis. 42: 647–656.
Spiliopoulou I., E. Petinaki, P. Papandreou and G. Dimitracopoulos. 2004. erm(C) is the predominant genetic determinant
for the expression of resistance to macrolides among methicillinresistant Staphylococcus aureus clinical isolates in Greece. J. Antimicrob. Chemother. 53: 814–817.
Strommenger B., C. Kettlitz, G. Werner and W. Witte. 2003.
Multiplex PCR assay for simultaneous detection of nine clinically
relevant antibiotic resistance genes in Staphylococcus aureus.
J. Clin. Microbiol. 41: 4089–4094.
Volokhov D., V. Chizhikov, K. Chumakov and A. Rasooly.
2003. Microarray analysis of erythromycin resistance determinants. J. Appl. Microbiol. 95: 787–798.
Yilmaz G., K. Aydin, S. Iskender, R. Caylan and I. Koksal.
2007. Detection and prevalence of inducible clindamycin resistance in staphylococci. J. Med. Microbiol. 56: 342–345.
Polish Journal of Microbiology
2008, Vol. 57, No 4, 313–319
ORIGINAL PAPER
Cell Surface Hydrophobicity of Bacillus spp. as a Function of Nutrient Supply
and Lipopeptides Biosynthesis and its Role in Adhesion
KATARZYNA CZACZYK, WOJCIECH BIA£AS and KAMILA MYSZKA
Department of Biotechnology and Food Microbiology, Poznañ University of Life Sciences, Poznañ, Poland
Received 9 June, 2008, revised 2 October 2008, accepted 18 October 2008
Abstract
Cell surface hydrophobicity (CSH) is recognised as a important factor in microbial adhesion to solid surfaces. Growth conditions have
been found to determine the synthesis of extracellular molecules by microorganisms. It has major consequences in modification of bacterial
surface properties and consequently, in bacterial adhesion to solid surfaces. In this paper, CSH properties of Bacillus spp. depending on the
nutrient supply and lipopeptide biosynthesis and its role in bacterial adhesion to solid surfaces were investigated. The obtained results
indicate that the examined factors (nitrogen and carbon availability) influence the CSH of Bacillus spp. cells. In most variants of the
experiments the role of nutrient supply in adhesion process was characteristic for species. The strongest effect was observed for peptone
concentration (P< 0.001). A decrease of CSH was noticed in optimal nitrogen availability (10 g/l) and it was connected with maximum
yield of surfactin biosynthesis. The highest values of CSH of examined Bacillus spp. strains were observed under nitrogen starvation and
in excess of carbon source. In these conditions the adhesion to stainless steel surface was more extensive.
K e y w o r d s: Bacillus spp., adhesion, hydrophobicity, lipopeptides, nutrient availability
Introduction
Hydrophobic interactions have frequently been
pointed out as an important factor in the control of
interactions between microorganisms and interfaces.
Microbial CSH is one of the surfaces properties influencing nutrient transport in heterogeneous media
(Valcarce et al., 2002; Cunningham et al., 2007). It
plays a major role in many biological systems such as
assembly of phospholipids layers, micelle formation,
phagocytosis and protein adsorption (Doyle, 2000).
Bacterial CSH is recognised as one of the determinants in microbial adhesion to abiotic and biological
surfaces (McNamara et al., 1997; Ahimou et al., 2001;
Ly et al., 2006). CSH participation in adhesion has
been explained based on the Derjaguin, Landau,
Verwey, Overbeek (DLVO) theory of colloidal stability (Norde and Lyklema, 1989; Azeredo et al., 1999).
This theory summarises the van der Waals and electrostatic contributions to the interfacial interaction energy
between two interacting surfaces. It has been demonstrated to be useful in explaining most bacterial adhesion results (Vadillo-Rodriguez et al., 2005). Deviations from the DLVO theory have been reported in
some cases, being mainly related to the occurrence of
specific interactions at very short separation distance
(Busalmen and Sanchez, 2001; Jacobs et al., 2007).
One of main aspects of interactions between microorganisms and surfaces is bacterial hydrophobicity.
The accumulation of surfactants in the culture medium induces changes in the CSH of producing strains
(Ahimou et al., 2000; Mukherjee and Das, 2005). Surfactants are amphipathic molecules consisting of both
hydrophobic and hydrophilic moieties that partition
preferentially at the interface between fluid phases
having different degrees of polarity and hydrogen
bonding. Surfactants of biological origin, referred to
as biosurfactants, are produced by a wide variety of
microorganisms. Some species of Bacillus genus (Bacillus subtilis, Bacillus megaterium, Bacillus circulans,
Bacillus cereus, Bacillus licheniformis and Bacillus
pumilus) synthesize lipopeptides, which exhibit antibiotic and surface active properties (Razafindralambo
et al., 1998; Ahimou et al., 2000; Ahimou et al., 2001;
Youssef et al., 2004; Mulligan, 2005; Nitschke and
Costa, 2007).
Biosurfactants produced by microorganisms are
able to modify bacterial surface hydrophobicity and
* Corresponding author: K. Czaczyk, Department of Biotechnology and Food Microbiology, Poznañ University of Life Sciences,
Wojska Polskiego 48, 60-637 Poznañ, Poland; e-mail: [email protected]
314
Czaczyk K. et al.
consequently, bacterial adhesion to solid surfaces. Adhesion of bacteria to solid surfaces is a general phenomenon which is recognised as the first step in the
development of biofilms. Microbial colonization and
biofilm formation have important detrimental consequences in medicine (contamination of prostheses,
catheters, artificial organs, lenses) and in many economic fields (biofouling of marine materials, contamination of food product lines) (Jones et al., 1997; Peng
et al., 2001; Planchon et al., 2007). The contamination of abiotic surfaces by spoilage and pathogenic
microorganisms is a serious problem in the food industry. In this way studies on the attachment of microorganisms to abiotic surfaces represent important aspects
in the establishment of decontamination procedures
directed at minimalizing health hazards.
The aim of our experiments was to investigate the
CSH properties of Bacillus spp. depending on nutrient supply and lipopeptide biosynthesis and significance of CSH in bacterial adhesion to solid surfaces.
Experimental
Materials and Methods
Bacterial strains and growth conditions. Four
bacterial strains, Bacillus coagulans (B6), Bacillus
megaterium (B4), Bacillus circulans (B7) and Bacillus
brevis (B1), were isolated from an industrial plant
processing a variety of wastes from the food industry
(Cibis et al., 2004). They were identified using standard methods, based on Bergey’s key (Claus and Berkeley, 1986) and API 50 CHB tests (Logan and Berkeley, 1984). Microorganisms were grown for 48 h at
37°C with shaking (100 rpm). Basic nutrient media
for Bacillus spp. growth was the following composition: glucose 5 g/l; peptone K 10 g/l (Merck, Germany). The pH of the media was 7.0. Composition of
the nutrient solution was changed according to model
of experiments.
Test for cell surface hydrophobicity. The cell
surface hydrophobicity of the examined strains of
bacteria was determined using the bacterial adhesion
to hydrocarbons (BATH) test. Cultures were centrifuged (3000×g for 10 min) and the cells were resuspended in PBS solution (pH 7.2) to the OD of 1.2–1.6.
Cell suspensions (3 ml) were added to octane, xylene
or hexadecane (1 ml) and mixed briefly on a vortex
mixer (30 s). The absorbance of the aqueous phase
was measured at 540 nm after standing for 30 min at
ambient temperature to allow phase separation. The
percentage hydrophobicity was determined from the
initial OD of the bacterial suspension (Ai) and the OD
of the aqueous phase after separation (As) using the
formula (Ai – As) / Ai × 100 (%) (Jordan et al., 1994;
4
Flint et al., 1997). Experiments were repeated at twice
for every strain and determination of CSH was done
in triplicate for every hydrocarbon.
Extraction and analysis of lipopeptides. The culture medium (50 ml) was centrifuged at 10 000×g for
25 min at 4°C to remove the cells. The supernatant
was applied to Bond Elut C18 (Agilent Technologies,
USA). The cartridge, which retained lipopeptides, was
rinsed successively with 20 ml water and 40 ml 50%
aqueous methanol, and finally lipopeptides were eluted
from the cartridge with 20 ml of methanol. The eluate
was evaporated and the crude extract was dissolved
in 1 ml of methanol (Razafindralambo et al., 1998).
Determinations of surfactin and iturin A were carried out on MERCK-HITACHI system consisting of
autosampler (model L-7250), pump (model L-7100)
and DAD (model L-7455) set at 205 nm. Analyses
were performed isocratically at flow rate 1 ml/min, at
30oC, on column ODS-Hypersil (200×4.6 mm; 5 mm),
Hewlett-Packard. Acetonitryle and 3.8 mM trifluoroacetic acid (80:20) or acetonitryle and 10 mM ammonium acetate as mobile phases were used (for surfactin
and iturin, respectively). Samples were filtered (0.22 m,
Millex-GS, Millipore), the volume injected was 50 l.
Standards were used to identify peaks in chromatograms, and the peak area was used to determine the
samples’ concentrations. The identity of each peak
was confirmed by comparing the spectrum of the standard with that of the presumptive positive peak in the
sample after normalization. This was done by computer integration (Chromatography Data Station Software, MERCK-HITACHI) operated in the mode of
external standard (Wei and Chu, 1998).
Bacterial adhesion analysis. Stainless 1 cm×6.5 cm
×1 mm steel plates (type 304L) were treated with 50%
solution of HNO3 for 10 min at 70°C. After soaking
under distilled water the plates were put into glass
containers and sterilized at 121°C for 15 min (Parkar
et al., 2001).
The stainless steel plates were put into Bacillus
spp. cultures (48 h) and after 1, 2 and 4 hours the
plates were removed and washed with PBS solution
(pH 7.2) in order to remove unattached cells from
their surfaces. The plates were stained with 0.01% solution of acridine orange (2 min at room temperature).
For observation of bacteria adhering to the stainless
steel surface a fluorescence microscope was used
(CARL-ZEISS, Axiovert 200, Germany). To determine
the level of Bacillus spp. adhesion to the surface of
stainless steel the method described by Le Thi et al.
(2001) was used. This technique is based on the estimation of 50 visual fields according to a 9-degree scale:
1st degree: from 0 to 5 bacteria cells in visual
field;
2nd degree: from 5 to 50 bacteria cells in visual
field;
4
315
Cell surface hydrophobicity of Bacillus spp.
3rd degree: only single bacteria cells (above 50 bacteria cells in visual field), no microcolonies;
4th degree: single bacteria cells + microcolonies;
5th degree: large but not confluent microcolonies
+ single bacteria cells;
6th degree: confluent microcolonies + single bacteria cells;
7th degree: ¼ visual field covered by the biofilm;
8th degree: ½ visual field covered by the biofilm;
9th degree: visual field totally covered by the
biofilm.
Each experimental variant was repeated three times.
Design of experiments. To estimate the effects of
nutrient supply on the cell surface hydrophobicity of
Bacillus spp., the experiments were designed as a factorial search with three levels for each variable – BoxBehnken scheme (using computer program Design of
Experiments version 6.02, Stat-Easy, Minneapolis,
USA) and response surface method was used. The
crucial factors involved in the study and their concentration are given in Table I. A total of 17 runs were
carried out simultaneously, with runs 13–17 as three
replications. The following empirical model was used
for the determination of linear, interaction and curvature effects of the tested variables.
Z = bo + b1x1 + ... + bixi + b11x12 + ... + biixi2 (1)
where Z is the desired response; b0 the regression coefficient at center point; b1, bi the linear coefficients,
x1, x2 independent variables; and b11, bii quadratic coefficients.
Table I
Process variables and level in the three-factor, three-level
response surface design of cell surface hydrophobicity
Factors
Peptone (g/l)
Glucose (g/l)
pH
–1
0
0
5
Coded values
0
Actual values
10
5
7
1
20
10
9
All chemicals used were of the highest purity and,
unless otherwise stated, were purchased from SigmaAldrich or Fluka
Results
Cell surface hydrophobicirty (CSH) of Bacillus
spp. In the first step of these examinations CSH was
measured with the BATH method, and octane, xylene
and hexadecane, as hydrocarbons, were used. For further investigations octane was selected, with regard
to repeatability of research results. Some solvents are
usually toxic towards cells and octane was used to
evaluate their adhesion to this solvent. The adhesions
to octane of four examined Bacillus strains depending
on nutrient availability (pH 7.0) are presented in Fig. 1.
The obtained results indicate that the examined factors (nitrogen and carbon supply) have an influence
on CSH of Bacillus spp. cells, but its role is characteristic for species.
In the case of B. coagulans peptone and glucose
supply the strongest effect on CSH (p = 0.0004). Detailed analysis indicated that carbon source availability
in culture medium stimulated the increase of CSH in
the entire range of examined pH values. On the other
hand, the presence of peptone caused decrease of CSH.
CSH of B. megaterium cells depends mostly on glucose supply in medium. The lowest effect was noticed
for peptone concentration. Statistical analysis of results
(Design of experiments) indicated strong interactions
between peptone supply – pH (p = 0.0004) and glucose supply – pH (p = 0.0002).
The obtained results for B. circulans CSH showed
that all examined factors (pH, peptone and glucose concentrations) have an influence on this feature. Strong
interactions between peptone supply – pH (p = 0.0003)
and glucose – peptone supply – pH (p = 0.002) were
also observed.
CSH of B. brevis depends on peptone supply
(p< 0.0001) and pH (p = 0.0004). An increase of CSH
was observed together with increase of carbon source
in the culture medium. It was indicated complex interaction between the examined factors.
In general, exploration of the interdependence of
these factors and high values of determination coefficients (P ≤ 0.003) indicate complex interactions between the variables. In all experiments, the strongest
effect was observed for peptone concentration
(P< 0.001). The lowest CSH values were observed
with optimal nitrogen supply (10 g/l).
Similar results were observed in Bacillus spp.
growing in pH 5 and pH 9 (data not presented). The
highest values of CSH of Bacillus spp. were observed
under low concentration of peptone and in excess of
glucose as carbon source.
Lipopeptides biosynthesis. Production of lipopeptides (surfactin and iturin A) by examined Bacillus spp. strain under optimal culture conditions (peptone 10 g/l, glucose 5 g/l, pH 7) is shown in Table II.
Table II
Surfactin and iturin A biosynthesis by examined species
of Bacillus spp.
Species
B. coagulans
B. megaterium
B. circulans
B. brevis
± – standard deviation
Surfactin (mg/l)
Iturin A (mg/l)
21.231 ± 1.811
7.795 ± 1.212
34.216 ± 2.112
12.601 ± 1.010
0.138 ± 0.009
0.351 ± 0.020
0.128 ± 0.008
0.222 ± 0.019
316
4
Czaczyk K. et al.
Fig. 1. Relationship between CSH of Bacillus spp., glucose and peptone concentration in culture medium for:
A – Bacillus coagulans, B – Bacillus megaterium, C – Bacillus circulans, D – Bacillus brevis
(glucose and peptone concentration, respectively, were expressed by coded values)
All strains synthetized both lipopeptide types, but biosynthesis of surfactin was on higher than iturin A.
Under these conditions the highest production of
surfactin was observed for B. circulans (34.216 mg/l).
Peptone supplied as a source of nitrogen in culture
medium influenced essentially surfactin production
in all examined Bacillus species. Figure 2 shows the
influence of nitrogen source availability in culture
medium on surfactin biosynthesis. Maximum biosurfactant production was observed when the peptone
concentration was between 10 and 12 g/l. These
strains were able to produce surfactants (at a similar
level) in the entire tested pH range (data not shown).
The influence of carbon source on surfactin biosynthesis by examined Bacillus spp. strains was statistically insignificant.
Bacterial adhesion. The results of the influence
of nitrogen source availability on the attachment of
Bacillus spp. cells to stainless steel (type 304L) are
presented in Table III. Approximately 106–107 cfu/ml
bacterial cells were present in the culture medium dur-
Table III
Bacillus spp. adhesion to the stainless steel (304L) surface
in dependence on nitrogen source availability in medium
(glucose concentration 5 g/l, pH = 7)
Peptone concentration (g/l)
Species
0
D
B. coagulans
1 h 4; 2
2 h 4; 5
4 h 4; 5; 2
B. megaterium 1 h 4; 3
2 h 5; 4
4 h 4; 2
B. circulans
1h
2; 4
2 h 4; 2
4 h 1; 2
B. brevis
1.h 4; 1
2 h 4; 5
4 h 5; 4; 2
10
20
H
D
H
D
H
5
5; 6
5; 6
5
5; 6
5; 6
5; 6
5; 6; 7
–
5
5; 6
5; 6; 7
1; 2
2; 1
2; 4
1; 2
2; 1
4; 2
2; 1
2; 1
4; 2
1; 2
1; 2
4; 1
–
–
5
–
–
6; 5
–
–
5, 6
–
–
5
4; 2
4; 2
1; 2
2; 4
4; 2
2; 1
4; 1
2; 4
4; 2
2; 1
4; 2
1; 2
–
5
–
–
5; 6
–
–
5
5
–
5; 6
–
D – Dominant adhesion degrees
H – Appearance of Higher adhesion degrees
4
317
Cell surface hydrophobicity of Bacillus spp.
Fig. 2. Effect of peptone concentration in growth medium on surfactin biosynthesis by Bacillus spp.
ing experiments. When a particular degree of adhesion occurred with a minimum amount of 20% that
degree was described as dominant. Appearance of
higher adhesion degrees was also noticed.
The most advanced stages of biofilm formation
were observed during nitrogen starvation. In these
conditions the 4th degree of adhesion was dominant,
and higher levels of adhesion (6th to 9th degrees) were
also observed. Bacillus spp. cells grown in optimal
conditions colonized the studied abiotic surface at the
1st, 2nd and 4th degree of adhesion and higher degrees
appeared only after 4 hours.
The effect of carbon source on the adhesion of Bacillus spp. cells to stainless steel surface is presented
in Table IV. Stainless steel (type 304L) was efficiently
colonized by Bacillus spp. cells in excess of carbon
source in growth medium. In these conditions the
4th degree of adhesion was dominant, and higher levels of adhesion were also observed (with the exception of B. circulans). The lowest stages of adhesion
was observed in optimal growth conditions and higher
degrees were appeared only after 4 hours. In the case
of B. brevis the most advantages stages of adhesion
were observed both in excess of carbon source and
during carbon starvation.
Table IV
Bacillus spp. adhesion to the stainless steel (304L) surface
in dependence on carbon source availability in medium
(peptone concentration 10 g/l, pH = 7)
Microbial adhesion to surfaces is a phenomenon
commonly observed in natural and engineering systems. Although extensive work has been performed
on microbial adhesion, many aspects of this process
are still unclear, especially the forces that determine
the interactions of microorganisms and support surfaces. Bacterial CSH is the most studied property of
the cell surface with regard to adhesion to abiotic surfaces (Jones et al., 1997; Faille et al., 2002; Jullien
et al., 2003). Microorganisms are able to biosynthesize
certain enzymes responsible for selective intake of
nutrients and synthesis of cell surface components.
The production of exopolymers (extracellular proteins
and extracellular polysaccharides) plays a important
role in hydrophobic interactions between an organism and substratum (Uberos et al., 2001).
Extracellular polymeric substances (EPS) production is known to be affected by nutrient status of the
growth medium. The general explanation is in such
that the hydrophobicity increases slightly in the presence of nitrogen source in the culture medium (Sanin
et al., 2003). Excess nitrogen channeled into protein
ends up in the extracellular polymer matrix. It is known
that proteins and amino acids are the hydrophobic
components of EPS. Therefore the increase of these
Glucose concentration (g/l)
Species
0
D
5
H
B. coagulans
1h
1; 2
–
2h
2; 1
–
4h
1; 2
–
B. megaterium
1h
2; 1
–
2h
2; 3
–
4h
2; 4
5; 6
B. circulans
1h
2; 1
2h
2; 1
–
4h
4; 3; 2 5; 6
B. brevis
1.h
2; 1
5
2h
2; 3
6
4h
4; 2; 5 5; 6; 7
10
D
H
D
H
1; 2
2; 1
2; 4
–
–
5
4; 2
4; 3
2; 4
6; 7
5; 6
5
1; 2
2; 1
4; 2
–
–
6; 5
4; 2
4; 3
4; 1; 6
5; 6
5; 6
5; 7
–
2; 1
4; 2
2; 1
–
5; 6
–
2; 3; 1
2; 1
2; 1
–
–
1; 2
1; 2
4; 1
–
–
5
4; 3
4; 5
4; 5
6; 7
6; 7
6; 7; 8
D – Dominant adhesion degrees
H – Appearance of Higher adhesion degrees
Discussion
318
4
Czaczyk K. et al.
compounds in cell surface causes increase of hydrophobicity (Doyle, 2000). On the other hand, when excess carbon is present in the medium, it is used for
production of extracellular carbohydrates (more hydrophilic components). A different situation was observed
in these experiments. In these investigations the highest values of CSH of examined Bacillus spp. strains,
were observed upon nitrogen limitation and carbon
excess. Increase of peptone concentration (near the
optimal) caused change of the CSH of Bacillus spp.
to more hydrophilic. There may be two reasons for
these results. First, connected with hydrophobic or
hydrophilic properties of EPS, and second – the ability
of Bacillus spp. to synthesize surface active compounds
and modify CSH.
EPS is highly hydrated because it can incorporate
large amounts of water into its structure by hydrogen
bonding. EPS may be hydrophobic, although most
types of EPS are both hydrophilic and hydrophobic
(Sutherland, 2001a). Excess available carbon and limitation of nitrogen promote EPS synthesis. Sutherland
(2001b) noted that the composition and structure of the
EPS determine its primary conformation. For example
many bacterial EPS possess a backbone structure that
contains 1,3- or 1,4-$-linked hexose residues and tend
to be more rigid, less deformable, and in certain cases
poorly soluble or insoluble in water (hydrophobic)
(Doyle, 2000; Sutherland, 2001a). The biosynthesis of
EPS in biofilms is not generally uniform and may vary
during cultivation. It is possible that under limited nitrogen conditions the configuration of cell surface
proteins stay more hydrophobic and protects the cell
from the loss of surface cell proteins (Doyle, 2000).
Cyclic lipopeptides including surfactin, iturin, fengycin and lichenisin, are the major classes of biosurfactants produced by Bacillus spp. Among the many
classes of biosurfactants, lipopeptides are particularly
interesting because of their high surface activities and
antibiotic potential (Ahimou et al., 2000). The ability
of microorganisms to produce lipopeptides is not dependent on bacterial hydrophobicity. However, after
their excretion and accumulation in the culture medium
changes in the CSH of the producing strain are induced
(Ahimou et al., 2000). Our results showed that nutrient
availability has an influence on surfactin biosynthesis
by Bacillus spp. Availability of nitrogen source in culture medium influenced the surfactin production in all
the species used. A decrease of cell surface hydrophobicity was noticed when surface-active compounds
were produced. Of the two examined lipopeptides, the
surfactin effect is more marked than that of iturin A,
because the surfactin is able to cover more space than
iturin A (larger molecular area) (Maget-Dana et al.,
1992). Surfactin contains seven residues of "-amino
acids and one residue of $-hydroxy fatty acid. When
the bacterial cell surface is hydrophilic, lipopeptide
molecules are probably oriented in such a way that
the peptide cycles, as polar heads, are adsorbed onto
surface and the hydrocarbon chains are exposed to the
surrounding medium. Hence, the bacterial surface becomes more hydrophobic. The orientation is inverted
for the hydrophobic bacterial surface (Ahimou et al.,
2000). The hydrophobicity alternations suggested the
important role of lipopeptide molecules to perform
in Bacillus spp. adhesion mechanisms onto various
surfaces by hydrophobic interaction (Ahimou et al.,
2000; Ron and Rosenberg, 2001).
Studies of bacterial adhesion to solid surfaces
showed that process was affected by environment (eg
nutrient availability), harvesting time, topography and
roughness of the substrata and by the morphology and
surface properties of bacterial cells (Flint et al., 1997;
Peng et al., 2001; Jefferson, 2004). Microbial surface
properties are considered to play a major role in interactions between bacteria and their environment, especially in adhesion (Liu et al., 2004; Ly et al., 2006;
Zikmanis et al., 2007). Little is known about the effect of substances produced by these microorganisms
on their surface properties. In this work the relationships between CSH of Bacillus spp. (as a function of
nutrient availability and lipopeptide biosynthesis) and
its adhesion to stainless steel were investigated. The
highest biosurfactants biosynthesis was noticed when
the peptone concentration was between 10 and 12 g/l
(optimal nitrogen availability) and consequently resulting in decrease of CSH value. The highest values
of CSH of examined Bacillus spp. strains were observed upon nitrogen limitation and carbon excess. In
these conditions the most advanced stages of biofilm
formation were observed. The weak adhesion was observed in optimal growth conditions.
In summary, our investigations show that nutrient
availability and lipopeptide biosynthesis are able to
modify bacterial surface hydrophobicity, which is involved in adhesion to stainless steel surface. A better
understanding of the factors involved in the adhesion
process will help in designing methods to control
biofilms through the prevention of adhesion or by enhancing the removal of attached bacteria.
Acknowledgements
This project was supported by the State Committee for Scientific Research (grant No 3 P06T 010 24).
Literature
Ahimou F., P. Jacques and M. Deleu. 2000. Surfactin and iturin
A effects on Bacillus subtilis surface hydrophobity. Enzym.
Microb. Technol. 27: 749–754.
Ahimou F., M. Paquot, P. Jacques, P. Thonart and
P.G. Rouxhet. 2001. Influence of electrical properties on the
evaluation of the surface hydrophobicity of Bacillus subtilis.
J. Microbiol. Meth. 45: 119–126.
4
Cell surface hydrophobicity of Bacillus spp.
Azeredo J., J. Visser and R. Oliviera. 1999. Exopolymers in
bacterial adhesion: interpretation in terms of DLVO and XDLVO.
Coll. Surf. 14: 141–148.
Busalmen J.P. and S.R. de Sanchez. 2001. Adhesion of Pseudomonas fluorescens (ATCC 17552) to nonpolarized and polarized
thin films of gold. Appl. Environ. Microbiol. 67: 3188–3194.
Cibis E., M. Krzywonos, K. Trojanowska, T. Miœkiewicz and
A. Ryzan. 2004. Biodegradation of potato slops with a mixed
population of bacteria of the genus Bacillus – determination of
the process conditions. Electr. J. Pol. Agr. Univ. Ser. Food Sci.
Technol. 7: 1–5.
Claus D. and R.C.W. Berkeley. 1986. Endospore-forming Grampositive rods and cocci: Bacillus. pp. 1105–1138. In: P.H.A. Sneath,
N.S. Mair, M.E. Shape and J.G. Holt (eds), Bergey’s Manual of
Systematic Bacteriology. Vol. 2., 2nd ed., Williams and Wilkins Co.,
Baltimore.
Cunningham A.B., R.R. Sharp, F. Caccavo Jr and R. Gerlach.
2007. Effects of starvation on bacterial transport through porous
media. Adv. Wat. Resour. 30: 1583–1592.
Doyle R.J. 2000. Contribution of the hydrophobic effect to microbial infection. Microb. Infect. 2: 391–400.
Faille C., C. Jullien, F. Fontaine, M.N. Bellon-Fontaine,
C. Slomianny and T. Benezech. 2002. Adhesion of Bacillus
spores and Escherichia coli cells to inert surface: role of surface
hydrophobicity. Can. J. Microbiol. 48: 728–738.
Flint S.H., J.D. Brooks and P.J. Bremer. 1997. The influence of
cell surface properties of thermophilic streptococci on attachment
to stainless steel. J. Appl. Microbiol. 83: 508–511.
Jacobs A., F. Lafolie, J.M. Herry and M. Debroux. 2007.
Kinetic adhesion of bacterial cells to sand: Cell surface properties
and adhesion rate. Colloids Surf., B: Biointerf. 59: 35–45.
Jefferson K.K. 2004. What drives bacteria to produce a biofilm?
FEMS Microbiol. Lett. 236: 163–173.
Jones D.S., J.G. McGovern, A.D. Woolfson and S.P. Gorman.
1997. Role of physiological conditions in the oropharynx on the
adherence of respiratory bacterial isolates to endotracheal tube
poly(vinyl chloride). Biomaterials. 18: 503–510.
Jordan F., P. Guicherd, V. Urbain and J.C. Manem. 1994. Hydrophobicity of activated sludge flocs and laboratory growth bacteria. Wat. Sci. Technol. 30: 211–218.
Jullien C., T. Bénézech, B. Carpentier, V. Lebret and C. Faille.
2003. Identification of surface characteristics relevant to the hygienic status of stainless steel for the food industry. J. Food. Eng.
56: 77–87.
Le Thi T.T., C. Prigent-Combaret, C. Dorel and P. Lejeune.
2001. First stages of biofilm formation: characterization and quantification of bacterial functions involved in colonization process.
Meth. Enzymol. 336: 152–159.
Liu Y., S.F. Yang, Y. Li, H. Xu, L. Qin and J.H. Tay. 2004. The
influence of cell and substratum surface hydrophobicities on microbial attachment. J. Biotechnol. 110: 251–256.
Logan N.A. and R.C. Berkeley. 1984. Identification of Bacillus
strains using the API system. J. Gen. Microbiol. 130:1871–1882.
Ly M.H., N.H. Vo, T.M. Le, J.M. Belin and Y. Waché. 2006.
Diversity of the surface properties of lactococci and consequences
on adhesion to food components. Colloids Surf., B: Biointerf. 52:
149–153.
Maget-Dana R., L. Thimon, F. Peypoux and M. Ptak. 1992.
Surfactin/iturin A interactions may explain the synergistic effect
of surfactin on the biological properties of iturin A. Biochemie 74:
1047–1051.
319
McNamara C.J., M.J. Lemke and L.G. Feff. 1997. Characterisation of hydrophobic stream bacteria based on adhesion to n-octane.
Ohio J. Sci. 97: 59–61.
Mukherjee A.K. and K. Das. 2005. Correlation between diverse
cyclic lipopeptides production and regulation of growth and substrate utilization by Bacillus subtilis strains in a particular habitat.
FEMS Microbiol. Ecol. 54: 479–489.
Mulligan C.N. 2005. Environmental applications for biosurfactants. Environ. Poll. 133: 183–198
Nitschke M. and S.G.V.A.O. Costa. 2007. Biosurfactants in food
industry. Trend. Food Sci. Technol. 18: 252–259.
Norde W. and J. Lyklema. 1989. Protein adsorption and bacterial adhesion to solid surfaces: A colloid-chemical approach. Coll.
Surf. 38: 1–13.
Parkar S.G., S.H. Flint, J.S. Palmer and J.D. Brooks. 2001.
Factors influencing attachment of thermophilic bacilli to stainless
steel. J. Appl. Microbiol. 90: 901–908.
Peng J.S., W.C. Tsai and C.C. Chou. 2001. Surface characteristics of Bacillus cereus and its adhesion to stainless steel. Int. J.
Food Microbiol. 65:105–111.
Planchon S., B. Gaillard-Martinie, S. Leroy, M.N. BellonFontaine, S. Fadda and R. Talon. 2007. Surface properties and
behaviour on abiotic surfaces of Staphylococcus carnosus, a genetically homogeneous species. Food Microbiol. 24: 44–51.
Razafindralambo H., Y. Popineau, M. Deleu, C. Hibid,
P. Jacques, P. Thonart and M. Paquot. 1998. Foaming properties
of lipopeptides produced by Bacillus subtilis: effect of lipid and
peptide structural attributes. J. Agric. Food Chem. 46: 911–916.
Ron E.Z. and E. Rosenberg. 2001. Natural roles of biosurfactants. Environ. Microbiol. 3: 229–236.
Sanin S.L., F.D. Sanin and J.D. Bryers. 2003. Effect of starvation
on the adhesive properties of xenobiotic degrading bacteria. Proc.
Biochem. 38: 909–914.
Sutherland I.W. 2001a. Biofilm exopolysaccharides: a strong
and sticky framework. Microbiology 147: 3–9.
Sutherland I.W. 2001b. The biofilm matrix – an immobilized but
dynamic microbial environment. Trends Microbiol. 9: 222–227.
Uberos J., C. Augustin, J. Liébana, A. Molina and A. MuñozHoyos. 2001. Comparative study of the influence of melatonin
and vitamin E on the surface characteristics of E. coli. Lett. Appl.
Microbiol. 32: 303–306.
Vadillo-Rodríguez V., H.J. Bussher, H.C. van der Mei, J. de
Vries and W. Norde. 2005. Role of Lactobacillus cell surface
hydrophobisity as probed by AFM in adhesion to surfaces at low
and high ionic strange. Colloids Surf., B: Biointerf. 41: 33–41.
Valcarce M.B., J.P. Busalmen and S.R. de Sánchez. 2002. The
influence of the surface condition on the adhesion of Pseudomonas fluorescens (ATCC 17552) to copper and aluminium brass.
Int. Biodeterior. Biodegrad. 50: 61–66.
Wei Y.H. and I.M. Chu. 1998. Enhancement of surfactin production in iron-enriched media by Bacillus subtilis ATCC 21332.
Enzym. Mcrob. Technol. 22: 724–728.
Wiliams O.B. 1936. Tryptone medium for the detection of flat
sour spores. Food Res. 3: 217–221.
Youssef N.H., K.E. Duncan, D.P. Nagle, K.N. Savage, R.M.
Knapp and M.J. McInerney. 2004. Comparison of methods
to detect biosurfactant production by diverse microorganisms. J.
Microbiol. Meth. 56: 339–347.
Zikmanis P., L. Shakirova, L. Auzina and I. Andersone. 2007.
Hydrophobicity of bacteria Zymomonas mobilis under varied
environmental conditions. Proc. Biochem. 42: 745–750.
320
Czaczyk K. et al.
4
Polish Journal of Microbiology
2008, Vol. 57, No 4, 321–326
ORIGINAL PAPER
Scanning Electron Microscopy and Energy-Dispersive X-Ray Microanalysis
of Penicillium brevicompactum Treated with Cobalt
RASHA M. FARRAG*, MOHAMED M. MOHAMADEIN and AMAL A. MEKAWY
The Regional Center for Mycology and Biotechnology, Al-Azhar University, Cairo, Egypt
Received 17 June 2008, revised 17 August 2008, accepted 28 August 2008
Abstract
Scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX) were used to study the morphology and elemental
composition of the conidia, phialids and hyphae of Penicillium brevicompactum grown in the presence of cobalt concentrations of 0, 50,
200, 500, 800 and 1000 ppm (mg/l). Cobalt uptake was through the hyphae, phialids and the conidia with maximum uptake being by the
conidia at a concentration of 1000 ppm. EDX revealed the increase in the percentage of calcium and magnesium in the hyphae, conidia and
phialids, compared to corresponding controls, accompanying the increase in cobalt uptake. Alternatively a decrease in sulfur percentage
was observed. This study might reflect the possibility of using SEM-EDX as a new technique in understanding the mechanism of tolerance.
K e y w o r d s: Penicillium brevicompactum, cobalt, elemental analysis, morphology, tolerance mechanism
Introduction
Cobalt belongs to Group VIII of the periodic classification of elements and shares properties with nickel
and iron. Cobalt is a relatively rare element in the
earth’s crust (0.0023%) and is usually found in association with other metals such as copper, nickel, manganese, and arsenic. Release of cobalt to the environment occurs via soil and natural dust, seawater spray,
volcanic eruptions, forest fires, and other continental
and marine biogenic emissions
Anthropogenic sources include fossil fuel burning,
processing of cobalt-containing alloys, copper and
nickel smelting and refining, sewage sludge, and agricultural use of phosphate fertilizers (Eco-SSL, 2005).
Although cobalt is an essential nutrient, excessive
oral doses result in a variety of adverse responses. The
best characterized toxic responses are increases in red
blood cell counts (polycythemia), cardiomyopathy, and
effects on the male reproductive system (Paternain
et al., 1988; Haga et al., 1996). In addition, reduced
food and water intake and growth inhibition are commonly observed (Diaz et al., 1994a; 1994b).
Some heavy metals are essential for the fungal metabolism, whereas others have no known biological
role. Both essential and nonessential heavy metals are
toxic for fungi, when present in excess. Whereas fungi
have metabolic requirements for trace metals, the
same metals are often toxic at concentrations only
a few times greater than those required (Hughes and
Poole, 1991). The metals necessary for fungal growth
include copper, iron, manganese, molybdenum, zinc,
cobalt and nickel. Nonessential metals commonly encountered include chromium, cadmium, lead, mercury
and silver (Gadd, 1993).
The contents of heavy metals in fungal mycelia reflect the metal concentrations in their environment
and in several cases, metal-tolerant strains of fungi
were isolated from contaminated sites (Gabriel et al.,
1997; Colpaert et al., 2000). It should also be noted
that it is possible to adapt fungi to higher heavy metal
concentrations (Baldrian, 2000).
Fungal species and strains differ in their sensitivity
towards metals and in the protection mechanisms involved (Baldrian, 2003). Baldrian and Gabriel (2002)
reported the high variability of growth response in the
case of Cd with the brown-rot fungus Piptoporus
betulinus; Cd-tolerant as well as sensitive strains were
found among 14 isolates from sites with different levels of air pollution by cadmium.
The interaction of fungi with heavy metals causes
severe changes in the physiological processes and
* Corresponding author: R.M. Farrag, The Regional Center for Mycology and Biotechnology, Al-Azhar University, Cairo, Egypt;
phone: (002) 02 26380271; e-mail: [email protected]
322
4
Farrag R.M. et al.
under certain circumstances it can even kill the mycelium. Therefore, fungi evolved active defense mechanisms that alleviate the toxicity of metals. The defense
is usually based on immobilization of heavy metals
using extracellular and intracellular chelating compounds. In many different taxonomic groups of fungi,
heavy metals are intracellularly chelated by peptidic
low molecular weight compounds-phytochelatins or
metallothioneins (Tomsett, 1993; Baldrian, 2003).
The binding properties of the cell wall could not be
refrained together with its role as a mechanism of
metal tolerance (Hall, 2002).
The wild type Neurospora crassa was found to
remove cobalt from solutions having a cobalt content
of 10 mg/l. The cobalt resistant mutant of N. crassa
was shown to remove more than 90% of cobalt even
from solution having Co concentrations as high as
500 mg/l (Karna et al., 1996).
Fungi belonging to the genera Rhizopus and Penicillium have already been studied as a potential biomass for the removal of heavy metals from aqueous
solution (Siegel et al., 1990; Srivastava and Thakur,
2006a). Uptake of heavy metal ions by fungi may offer an alternative method for their removal from
wastewater. The mechanisms of metal binding are not
well understood due to the complex nature of the
microbial biomass, which is not readily amenable to
instrumental analysis. However, localization of metals has been carried out using electron microscopic
and X-ray energy dispersive analysis studies (EDX)
(Srivastava and Thakur, 2006b).
The current work aims at investigating the effect of
different cobalt concentrations (0, 50, 200, 500, 800
and 1000 ppm) on the morphology and elemental composition of P. brevicompactum using scanning electron
microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX) as well as the possible use of these
advanced techniques in elucidating fungal tolerance.
Experimental
Materials and Methods
Fungal isolate. Penicillium brevicompactum was
obtained from the culture collection unit of the Regional Center for Mycology and Biotechnology
(RCMB) at Al-Azhar University.
Media and growth conditions. Czapek’s Dox
medium was supplemented with different cobalt concentrations of 0, 50, 200, 500, 800 and 1000 ppm
(mg Co/l). Except for the control, cobalt replaced ferrous sulfate. Cobalt chloride was the salt used to prepare the different cobalt concentrations. Media were
autoclaved and poured into sterile petri dishes (two
petri dishes for each cobalt concentration). The plates
were inoculated with a 7-day old P. brevicompactum
and incubated at 25°C for seven to fourteen days.
P. brevicompactum was grown on media supplemented with different cobalt concentrations (50, 200,
500, 800 and 1000 ppm). Morphological investigations
were carried out using scanning electron microscopy.
Energy-dispersive X-ray spectroscopy (EDX) was used
to identify the elements associated with P. brevicompactum together with their percentage with respect to
one another at the different investigated cobalt concentrations. The distribution of the elements in conidia,
phialids and hyphae was also investigated.
Scanning electron microscopy (SEM). Blocks of
the investigated fungal isolate were prepared for SEM
at The Regional Center for Mycology and Biotechnology, Al-Azhar Univ. according to Zain, 1998).
Fixation and dehydration procedures were performed
using the programmable LEICA EM TP tissue processor model (A-1170), where six to eight millimeter
squares of agar with fungal growth were cut from the
cultures. The squares were then fixed by immersion
in 2% (w/v) aqueous osmium tetroxide (OsO4) at 4°C
for 12 h. Fixed material was allowed to attain room
temperature and then washed in distilled water
(3 times, 10 min each) to remove excess of OsO4.
Fixed and washed materials were submerged and dehydrated through a graded, 10% steps, ethanol series
from 10% to 90% and finally absolute ethanol. Dehydrated specimens were critical point-dried using
the Critical Point Dryer EMS (Electron Microscopy
Sciences) model EMS 850. The critical point-dried
specimens were then attached to 0.9 mm diameter
copper stubs using a carbon adhesive. Specimens
were gold-coated (nearly 50 nm thickness) using an
SPI ModuleTM Sputter Coater and then examined
using the high-vacuum mode of a JEOL JSM-5500LV
Scanning Electron Microscope.
Energy-dispersive X-ray spectroscopy (EDX).
Elemental analysis (the percentage of the detected
elements with respect to one another) of the samples
was carried out using the X-ray detector (INCAxsight, Oxford Instruments) of the scanning electron
microscope (Jeol JSM-5500LV). Window Integral
was the mode of analysis. The given percentages represent the average of ten measurements for each of
the conidia, hyphae and phialids.
Results
Scanning electron micrographs reveal the high tolerance of P. brevicompactum against cobalt (Fig. 1).
The fungus was able to keep its penicillate form and
conidial chain production even at the highest investigated cobalt concentration (1000 ppm) (Fig. 1i). A cobalt concentration of 50 ppm enhanced the growth of
4
SEM-EDX of P. brevicompactum treated with cobalt
Fig. 1. Scanning electron micrographs of P. brevicompactum grown on Dox medium amended with cobalt concentrations
of 0 (a), 50 (b), 200 (c, d), 500 (e, f), 800 (g, h) and 1000 ppm (i, j, k).
323
324
4
Farrag R.M. et al.
Table I
The percentage of elements detected by SEM-EDX in the conidia, phialids and hyphae of Penicillium brevicompactum
grown under cobalt concentrations of 0, 50, 200, 500, 800 and 1000 ppm (mg/l)
Cobalt conc.
(ppm)
0
(control)
50
element
C
Na
Mg
S
K
Ca
Co
1.8
4 1.6
3.8
2 4.5
67 65.7 68.6
4.8 10.8 5.1
22 17.5 20.2
0
0
0
P
H
C
0.7
4.5
57
5.5
23
9.1
P
200
H
C
P
500
H
0.2 4.9 6.2 12.7 7.9
3.7 5.7 5.5 5.9 9.8
64.9 18.7 71.9 12.4 34.7
3.8
5 2.7 7.2 1.3
19.9 59.5 6.5 49.1
37
7.5 6.3 7.2 12.7 9.2
C
P
800
H
C
P
1000
H
C
P
H
2 1.9 2.7
1 2.5
1
0.5 1.1
1
6.3 13 10.7 6.5 6.8 5.7 15.5 13.4 12.6
32.9 31.3 42.2 42.9 38.9
40
0.2
23
30
2
5 3.4 1.7 5.2 1.8
5.2 7.3 4.3
39.8 29.6
27 23.6 22.3 26.5 40.6 32.4 27.3
17 19.2 13.8 24.3 24.3
25
38 22.8 24.8
C, conidia; P, phialids; H, hyphae
the fungus and the fungus grew without obvious morphological changes (Fig. 1b).
However, more divergent ramulli, metullae and
phialids were observed at cobalt concentrations of
200 ppm (Fig. 1c and d), 500 ppm (Fig.1e and f), 800
(Fig. 1e and f) and 1000 ppm (Fig. 1j and k). Distortions in branching were also observed.
At 200, 500, 800 and 1000 ppm, different distorted
phialid shapes were observed; enlarged, slender as
well as diminished.
Table I shows the results of the elemental analysis
(SEM-EDX) of conidia, phialids and hyphae of P. brevicompactum grown in the presence of different cobalt
concentrations (0, 50, 200, 500, 800 and 1000 ppm).
At a cobalt concentration of 50 ppm, the percentage (%) of sulfur (S) remained elevated in both the
conidia and phialids while the hyphae (possessing the
highest S% at the control) experienced a great decrease
in the percentage of S compensated for by an elevation in the percentage of calcium (Ca) which was also
elevated in the conidia and phialids when compared
to the control. The percentage of cobalt (Co) was
highest in the conidia followed by phialids and then
the hyphae. Regarding magnesium (Mg), there was
an increase in its percentage with a value higher than
the corresponding control.
At a cobalt concentration of 200 ppm, the percentage of S was greatly reduced in the phialids (12.4%)
followed by the hyphae (34.7%) while was elevated
in the conidia (53.9%) when compared to the corresponding controls (65.7%, 68.6% and 67.6% respectively). Ca % was the highest in the phialids followed
by the hyphae and then the conidia in which the Ca %
reached 6.5 compared to a control % of 22. Maximum cobalt uptake at such concentration was by the
phialids followed by the hyphae and then the conidia.
At a cobalt concentration of 500 ppm, the percentage of S in the three investigated parameters was decreased with values less than their corresponding controls. Alternatively, the Ca and the Mg percentages
were increased with values greater than their corre-
sponding controls. The same pattern was followed at
a concentration of 800 ppm regarding S, Ca and Mg.
However for Co uptake, no marked differences were
observed; 24.3, 24.3 and 25 represented the percentage
of Co in conidia, phialids and hyphae respectively.
Again at a concentration of 1000 ppm, the percentages of S were reduced when compared to their corresponding controls with the conidia being the structures
possessing the least sulfur content as detected by SEMEDX (0.2% compared to a control value of 67.6%).
Also, the % of Ca and Mg were increased over their
corresponding controls. Maximum Co uptake was by
the conidia followed by hyphae and then the phialids.
It could be concluded that maximum Co percentage
(38%) which was detected in the conidia of P. brevicompactum was accompanied by elevated Ca as well
as Mg levels. Alternatively, extremely reduced percent
of S was detected.
It was observed that increasing the concentration
of cobalt in the growth medium resulted in increasing
its uptake by the fungus. No clear cut could be concluded regarding the best structure uptaking cobalt;
conidia was the best at 50 ppm, phialids at 200 and
500 ppm, hyphae at 800 ppm and again conidia at
1000 ppm. However, it is clearly observed that the
best uptake was by conidia at 1000 ppm followed by
hyphae, phialids and conidia at 800 ppm.
Discussion
Fungi frequently display a higher affinity for metal
ions compared to other microbial groups and can accumulate metals from their external environment by
means of physicochemical and biological mechanisms
(Khoo and Ting, 2000; Cabuk et al., 2004; Preetha
and Viruthagiri, 2005).
Razak et al. (1990a, b, c and d; 1993) directed the
attention towards heavy metal uptake and metabolism
in microorganisms and the microbial role mobilizing and immobilizing them as: Se, Te, Cd, Ni, Pb,
4
SEM-EDX of P. brevicompactum treated with cobalt
Co, Cu and Hg. Recently, the ability of microorganisms to take up metals has been demonstrated
(Filipovic-Kovacevic et al., 2000; Costa and Duta,
2001; Yalcinkaya et al., 2002; Hussein et al., 2004;
Preetha and Viruthagiri, 2005).
In the current study, the growth of P. brevicompactum was not greatly affected by the investigated cobalt concentrations. Cobalt was distributed among the
hyphae, phialids and conidia with little morphological distortions where the penicillate form together
with long conidial chains of the fungus were maintained even at the highest investigated concentration
(1000 ppm). A number of Penicillium spp. were also
reported to show high tolerance against different heavy
metals, e.g., Razak et al. (1993) reported that P. chrysogenum was able to keep its penicillate form even at the
highest investigated tellurium concentration (0.5%).
In this study, long chains of conidia which were
still produced even at 1000 ppm might reflect their
role in metal uptake which was confirmed by SEMEDX where maximum cobalt uptake (38%) was by
conidia at a concentration of 1000 ppm.
SEM-EDX has been used to identify elements associated with microorganisms and wetland plants
(Srivastava and Thakur, 2006b).
In the current work, SEM-EDX was used to study
the distribution of cobalt in P. brevicompactum and
its effect on the percentage of the other detected elements (Ca, Mg, S, Na and K). The most obvious result was the increase in the percentage of Ca and Mg
accompanying the increase in cobalt uptake, where Ca
and Mg were always higher than their values in the
corresponding controls. This agrees with the results
of Latha et al. (2005) who reported that cobalt taken
up by Neurospora crassa was largely surface bound
(> 90%), resulting in a release of calcium and magnesium. Also, formerly (Karamushka and Gadd, 1994),
Ca and Mg were reported to have a protective effect
on proton efflux from Saccharomyces cerevisiae influenced by the heavy metal copper. It was concluded
that the protective effect of Ca and Mg is mediated by
competitive and stabilizing interactions at the cell surface as well as physiological functions of Ca and Mg.
Another noticeable result was the decrease in the
percentage of sulfur with increasing the cobalt concentration in the culture medium. This might be attributed to the synthesis of sulfhydryl-rich peptides.
Glutathione ((-L-glutamyl-L-cysteinylglycine) is responsible for the synthesis of these sulfhydryl-rich
peptides in plants and fungi. These peptides are produced in response to metal stress where metals are
chelated through coordination with the sulfhydryl
groups in cysteine. An intracellular complex formed
by these thiol peptides is thought to detoxify the metal
by sequestration in the vacuole (Prasad, 2004). The
sulfur in such intracellular complexes formed inside
325
the vacuole could not be detected by SEM-EDX as
the penetration power of the electron beam cannot
reach that depth into the cytoplasm and vacuoles
(Oxford Operation Manual, 2000), and thus cannot
detect the sulfur in such compartments resulting in
a decreased sulfur percentage. It should be noted that
the penetration power of the electron beam cannot
also allow the detection of the cobalt sequestered
in the vacuole by the thiol peptides, however the
percentage of cobalt was still high accompanying
the treatments with low S%. This could lead to the
conclusion that cell wall might play the major role in
cobalt uptake by P. brevicompactum, this agrees with
the results of Latha et al. (2005).
The increase in the percentage of Ca and Mg, with
values greater than the corresponding controls, by
increasing the percentage of cobalt in the medium
in the current study might also reflect the ability of
the highly tolerant P. brevicompactum to sequester
cobalt through the formation of thiol peptides where
Mariano-da-Silva et al. (2007) reported that accumulation of heavy metals in the vacuole may cause calcium displacement from the vacuole, increasing free
Ca+2 ions in the cytosol. Mg+2 ions are also displaced
from the vacuole, passing to the cytoplasm.
Also, Tsekova et al. (2006) reported that biosorption of copper and cobalt ions displaced K+, Mg2+
and Ca2+ present on Penicillium cyclopium indicating
that biosorption took place as a result of an ion-exchange process.
The presence of two techniques for heavy metal
sequestering has been reported; e.g., detoxification of
Cd in Paxillus involutus involved binding of Cd to
the cell wall and accumulation of Cd in the vacuole
(Blaudez et al., 2000).
Conclusively, SEM-EDX might reflect the possible presence of two mechanisms conferring tolerance to P. brevicompactum against cobalt; cell wall
and thiol peptides. Further confirming studies will
be conducted using transmission electron microscope
and biochemical studies.
Acknowledgements
The authors would like to thank Prof. Dr. Magda El-Meleigy,
Head of The Department of Botany and Microbiology, Faculty
of Science for Girls, Al-Azhar Univ., for her scientific guidance
and support.
Also would like to thank Dalia Mosbah, scientific assistant
at The Regional Center for Mycology and Biotechnology, as well
as Nesreen Safout, Assisstant researcher at The Center, for their
honest kind help in the laboratory work.
Literature
Baldrian P. 2000. Effect of heavy metals on the growth and
biodegradative abilities of wood-rotting fungi. PhD thesis, Charles
University, Prague. Czech Republic.
326
Farrag R.M. et al.
Baldrian P. 2003. Interactions of heavy metals with white-rot
fungi. Enzyme Microb. Technol. 32: 78–91
Baldrian P. and J. Gabriel. 2002. Intraspecific variability in
growth response to cadmium of the wood-rotting fungus Piptoporus
betulinus. Mycologia 94: 428–36.
Blaudez D., B. Botton, and M. Chalot. 2000. Cadmium uptake
and subcellular compartmentation in the ectomycorrhizal fungus
Paxillus involutus. Microbiology 146: 1109–1117.
Cabuk A., S. Ilhan, C. Filik and F. Caliskan. 2004. Pb2+
biosorption by pretreated fungal biomass. Turk. J. Biol. 29: 23–28.
Colpaert J.V., P. van den Koornhuyse, K. Adriaensenand and
J. van Gronsveld. 2000. Genetic variation and heavy metal tolerance in the ectomycorrhizal basidiomycete Suillus luteus. New
Phytol. 147: 367–79.
Costa A.C. and F.P. Duta. 2001. Bioaccumulation of copper,
zinc, cadmium and lead by Bacillus sp.; Bacillus cereus, Bacillus
sphaericus and Bacillus subtilis. Brazilian J. Microbiol. 32: 1–5.
Diaz G.J., R.J. Julian and E.J. Squires. 1994a. Cobalt-induced
polycythaemia causing right ventricular hypertrophy and ascites
in meat-type chickens. Avian Pathol. 91–104.
Diaz G.J., R.J. Julian and E.J. Squires. 1994b. Lesions in
broiler chickens following experimental intoxication with cobalt.
Avian Dis. 38: 308–16.
Eco-SSL. 2005. Ecological soil screening levels for cobalt. Interim final, OSWER Directive 9285.7–67. U.S. Environmental
Protection Agency, Office of Solid Waste and Emergency Response. Washington, DC.
Filipovic-Kovacevic Z., L. Sipos, and F. Briski. 2000. Biosorption
of chromium, copper, nickel and zinc ions onto fungal pellets of
Aspergillus niger 405 from aqueous solutions. Food Technol.
Biotechnol. 38: 211–216.
Gabriel J., P. Baldrian, P. Rychlovský and M. Krenzelok. 1997.
Heavy metal content in wood-decaying fungi collected in Prague
and in the National Park Šumava in the Czech Republic. Bull.
Environ. Contam. Toxicol. 59: 595–602.
Gadd G.M. 1993. Interactions of fungi with toxic metals. New
Phytol. 124: 25–60.
Haga Y., N. Clyne, N. Hatroi, C. Hoffman-Bang, S.K. Pehrsson
and L. Ryden. 1996. Impaired myocardial function following
chronic cobalt exposure in an isolated rat heart model. J. Trace
Elem. Electrolytes Health Dis. 13: 69–74.
Hall J.L. 2002. Cellular mechanisms for heavy metal detoxification and tolerance. J. Exp. Bot. 53: 1–11.
Hughes M.N. and R.K. Poole. 1991. Metal speciation and microbial growth – the hard (and soft) facts. J Gen Microbiol. 137:
725–34.
Hussein H., S.F. Ibrahim, K. Kandeel and H. Moawad. 2004.
Biosorption of heavy metals from wastewater using Pseudomonas sp. Electron. J. Biotechnol. 7: 38–42.
Karamushka V.I. and G.M. Gadd. 1994. Influence of copper
on proton efflux from Saccharomyces cerevisiae and the protective effect of calcium and magnesium. FEMS Microbiol. Letters
122: 33–38.
Karna R.R., L.S. Sajaniand and P.M. Mohan. 1996. Bioaccumulation and biosorption of Co+2 by Neurospora crassa. Biotechnol. Lett. 18: 205–208.
Khoo K.M. and Y.P. Ting. 2000. Biosorption of gold by immobilized fungal biomass. Biochem. Engineering J. 8: 51–59.
4
Latha J.N.L., K. Rashmiand and P.M. Mohan. 2005. Cell-wallbound metal ions are not taken up in Neurospora crassa. Can.
J. Microbiol. 51: 1021–1026. Mariano-da-Silva S., J.D. Brait, L.H.P. Angeloni, F.M. MarianoDa-Silva, C.A.O. Leite and P. Braga. 2007. Effects of nickel on
the mineral composition of Fleischmanns yeast (Saccharomyces
cerevisiae). Ciênc. Tecnol. Aliment. 27: 503–510.
Oxford Operation Manual. 2000. Oxford Operation Manual for
Oxford Energy Dispersive X-ray Spectroscopy (EDX). London,
United Kingdom.
Paternain J.L., J.L. Domingo and J. Corbella. 1988. Developmental toxicity of cobalt in the rat. .J. Toxicol. Environm. Health
24: 193–200.
Prasad M.N.V. 2004. Heavy Metal Stress in Plants from Biomolecules to Ecosystems. 2nd edition. Springer. Narosa Publishing
House, New Delhi, India.
Preetha B. and T. Viruthagiri. 2005. Biosorption of zinc (II) by
Rhizopus arrhizus: equilibrium and kinetic modeling. Afr. J. Biotechnol. 4: 506–508.
Razak A.A., M.A. El-Meleigy and E.A. Ghonamy 1990a. Tellurium chelatins in A. fumigatus and P. chrysogenum. Al-Azhar
J. Microbiol. 8: 255.
Razak A.A., E.A. Ghonamy and M.A. El-Meleigy 1990b. Selenium chelatins in A. fumigatus and P. chrysogenum. Al-Azhar
J. Microbiol. 8: 249.
Razak A.A., E.H. Ghanem, I.F. Lashin and E.A. Mohamed.
1993. Fungal responses towards tellurium. African J. Mycol. Biotechnol. 1: 33–47.
Razak A.A., S.E. Ramadan, A.M. Ragab and M.A. El-Meleigy.
1990c. Influence of tellurium on certain biological activities in
A. fumigatus, A. terreus and P. chrysogenum. The Fourth International Mycological Congress, 28 August 3rd Sept., Regensburg,
W. Germany.
Razak A.A., S.E. Ramadan, A.M. Ragab and M.A. El-Meleigy.
1990d. Tellurium volatilization by A. fumigatus, A. terreus and
P. chrysogenum. The Fourth International Mycological Congress,
28 August- 3rd Sept., Regensburg, W. Germany.
Siegel S.M., M. Galun and B.Z. Siegel. 1990. Filamentous
fungi as metal biosorbents; a review. Wat Air Soil Pollut. 53:
335–344.
Srivastava S. and I.S. Thakur. 2006a. Isolation and process parameter optimization of Aspergillus sp. for removal of chromium
from tannery effluent. Biores. Technol. 97: 1167–1173.
Srivastava S. and I.S. Thakur. 2006b. Biosorption Potency of
Aspergillus niger for Removal of Chromium (VI). Current Microbiol. 53: 232–237.
Tomsett A.B. 1993. Genetics and molecular biology of metal tolerance in fungi. In: Jennings DH, editor. Stress Tolerance in Fungi.
Marcel Dekker: New York; p. 69–95.
Tsekova K., D. Christova and M. Ianis. 2006. Heavy metal biosorption sites in Penicillium cyclopium. J. Appl. Sci. Environ. Mgt.
10: 117–121.
Yalcinkaya Y., M.Y. Arica, L. Soyal, A. Denizli, O. Genc, and
S. Bektas. 2002. Cadmium and mercury uptake by immobilized
Pleurotus sapidus. Turkish J. Chem. 26: 441–452.
Zain M.E. 1998. Modern approaches to the taxonomy of fungi.
Ph.D. Thesis, Botany and Microbiology Department, Faculty of
Science for Boys, Al-Azhar Univ., Cairo, Egypt.
Polish Journal of Microbiology
2008, Vol. 57, No 4, 327–332
ORIGINAL PAPER
Isolation and Characterization of a Cr(VI) Reducing Bacillus firmus Strain
from Industrial Effluents
GOPI BALLAV SAU, SWAGATA CHATTERJEE, SANGRAM SINHA and SAMIR KUMAR MUKHERJEE*
Department of Microbiology, University of Kalyani, Kalyani 741235, India
Received 12 August 2008, revised 16 October 2008, accepted 22 October 2008
Abstract
A chromium resistant bacterial strain KUCr1 exhibiting potential Cr(VI) reducing ability under in vitro aerobic condition is reported. The
bacterial strain showed varied degree of resistance to different heavy metals. The MIC of chromium to this strain was found to be 950 mM
under aerobic culture condition in complex medium. The factors affecting Cr(VI) reduction by this strain under culture condition were
evaluated. Maximal Cr(VI) reduction was observed at the pH 8 to 10 and at a temperature of 35°C. Higher concentration of Cr(VI) slowed
down the reduction, eventually all the metal could be reduced with longer incubation time. Different toxic metals showed differential
effect on reduction. Cadmium and zinc were found to inhibit reduction. Cr(VI) reduction and bioremediation were found to be related to
the growth supportive condition in terms of carbon, phosphorous and nitrogen supply in wastewater fed with tannery effluent indicating
cell mass dependency of Cr(VI) reduction. Through biochemical characterization and 16S rDNA sequence analysis, the strain KUCr1, as
the name given to it, was identified as a strain of Bacillus firmus.
K e y w o r d s: ambient factors, bioremediation, hexavalent chromium reduction
Introduction
Chromium (Cr) has been identified by US Environmental Protection Agency (US EPA, 1998) as one of
the 17 toxic metals/metalloids posing the major hazard
in environment. This transition metal is widely found
in nature in different valence states as Cr(VI) to
Cr(III) forms. Among these Cr(VI) is highly soluble,
thus mobile and biologically available in the ecosystems and thus exerts toxicity; whereas Cr(III) forms
complexes that precipitate as amorphous hydroxide
(Palmer and Wittebrodt, 1991; Sawyer et al., 1994).
The toxic form of Cr is released in environment
with effluents from different industries (Bailar, 1997;
US EPA, 1998; Abdel-Sabour, 2007). The technologies
for Cr clean-up from the contaminated sites consist
mostly of, (i) removing the maximum Cr(VI)-contaminated parts from the site; (ii) immobilizing the chromium to prevent further leaching; or (iii) reducing the
Cr(VI) to its non-toxic species, i.e. Cr(III) state. Microbial reduction of toxic Cr(VI) has practical importance
in this respect, because biological strategies provide costeffective and ecofriendly technology (Eccles, 1995).
Bacteria detoxify chromium mainly by reducing
Cr(VI) to Cr(III) via Cr(V) and Cr(IV) intermediates
(Camargo et al., 2003; Xu et al., 2004, 2005; Pal et al.,
2005; Cheung et al., 2006), therefore it is a potentially
useful process for remediation of Cr(VI)-affected environments (Michel et al., 2001). Many aerobic and
anaerobic microbes were reported to reduce Cr(VI) to
Cr(III) while utilizing a wide range of electron donors (Bopp and Ehrlich, 1988; Ishibashi et al., 1990;
Francis et al., 2000; Fredrickson et al., 2000; McLean
and Beveridge, 2001).
The vision of our work was to isolate and characterize a chromium resistant bacterial strain that could
be exploited for its ability to reduce Cr(VI) to nontoxic Cr(III). Biochemical and molecular characterization (16S rDNA sequence analysis) were carried
out to identify the strain KUCr1.
Experimental
Materials and Methods
Isolation of chromate resistant bacterial strain.
Chromate-resistant bacteria were isolated from soil
samples fed with Cr containing effluents of electroplating industries nearby Kolkata, India. The sample was
serially diluted and inoculated on PYG agar (peptone,
* Corresponding author: S.K. Mukherjee, Department of Microbiology, University of Kalyani, Kalyani 741 235, India; phone:
(91)33 25827315; Fax (91) 33 25828282; e-mail: [email protected]
328
Sau G.B. et al.
10 g/l; yeast extract, 5 g/l; glucose, 3 g/l; agar, 20 g/l;
pH 7.2) plates having different concentration of Cr (0.5,
1, 1.5, and 2 mM) as K2CrO4. The colonies that could
tolerate the highest concentration of Cr (2 mM) were
selected randomly and assessed for its Cr(VI) reductive ability. The isolate that showed highest Cr(VI) reductive ability was selected for further experiment in
this study and the strain was designated as KUCr1. The
isolate was then purified by cycles of single colony isolation and liquid culture transfers on minimal medium
(K2HPO4, 3 g/l; Na2HPO4, 6 g/l; NaCl, 5 g/l; NH4Cl,
2 g/l; MgSO4, 0.1 g/l; glucose, 8 g/l; pH 7.2) supplemented with 2 mM Cr. A single culture was eventually
chosen for further experiment on the basis of their Cr
reductive ability and is being maintained.
Characterization of the Cr-resistant bacterial
isolate. The isolate was identified based on the morphological and standard biochemical tests according to
Bergey’s Manual of Systematic Bacteriology (Sneath,
1986). The strain was also tested for its resistance to
different toxic metals in PYG medium. Furthermore,
the genomic DNA was isolated from the pure culture
pellet and ~1.4 kb rDNA fragment was amplified using
high-fidelity PCR polymerase. The PCR product was
sequenced bi-directionally using the forward, reverse
and internal primer. The sequencing of the PCR product was done at Chromous Biotech Pvt. Ltd., Bangalore, India. The sequence data were aligned and analyzed to identify the bacterium and its closest neighbors
using BLAST function (Altschul et al., 1990) at
NCBI database and the Ribosomal Database Project
(Maidack et al., 1997).
Growth and Cr(VI) reduction in PYG and
minimal media under chromium stress. To assess
the effect of Cr (VI) on cell growth under aerobic condition, KUCr1 were inoculated with same volume of
young cell suspension (finally to have ~6.2 log CFU/
ml) into both undefined PYG and minimal media
supplemented with 2 mM Cr (VI) as K2CrO4 and incubated on a rotary shaker at 37°C, and compared
with respective control set without Cr. The growth responses were determined by counting the colony
forming units (CFU) on PYG agar plate. The chromate reduction was measured at different time intervals by measuring the residual Cr(VI) in the cell-free
supernatant following centrifugation.
Chromium(VI) reduction and its analysis. Chromate reduction was assayed as the decrease of chromate with time using Cr(VI) specific colorimetric reagent S-diphenylcarbazide (DPCZ). One ml of 0.05%
DPCZ (w/v in acetone) and 3 ml of 0.16 M sulfuric
acid were added for minimizing the deterioration
(Urone, 1955) to 1 ml sample of known dilution of
Cr(VI). DPCZ reacts with chromate and forms a purple
complex that absorbs light at 540 nm. The absorbance
of the reaction mixture was taken immediately at
4
540 nm in a spectrophotometer (Cecil CE7200, England). Quantity of Cr(VI) was measured obtaining the
standard curve using solutions of K 2CrO4 as standard.
Effect of pH and ambient temperature on chromium reduction. The influence of pH on chromate reduction under aerobic culture condition was assessed
in PYG broth having different pH values, inoculated
with same volume of young cell suspension and incubated at 37°C. The influence of incubation temperature
on chromate reduction under aerobic culture condition
was assessed in PYG broth (pH 7.2), inoculated with
same volume of young cell suspension and incubated
on a rotary shaker at different temperature. Chromate
reduction at different time intervals was measured.
Effect of different metals/metalloid on Cr(VI)
reduction. Normally the Cr-contaminated sites show
simultaneous presence of toxic metals/metalloids
which effect the survival of the inoculant. In order to
assess the exact effect of such metals/metalloid (Cd,
Co, Ni, As and Zn) on its Cr(VI) reductive ability, the
isolate was grown on PYG broth having 2 mM Cr
with different test metals (0.1 mM in the media) separately. Different treatment regimes were inoculated
with same volume of young cell suspension (finally
to have ~5.7 log CFU/ml), incubated on a rotary
shaker at 37°C and chromate reduction was measured.
Biosorption of chromium. In order to assess
whether the bacterial strain has Cr biosorbing ability
apart from its Cr(VI) reductive activity, the dead cell
mass (both dry and wet) were put into K2Cr04 solution
in saline buffer finally having 2 mM Cr(VI). Bacterial
cell mass of 72 h old was harvested by centrifugation
at 7000× g for 10 min and the cell pellet was dried at
60°C for 24 h to have dry dead cell or the cell pellet
was autoclaved to have wet dead cell. The removal of
Cr by the dead cell was measured at different time intervals by measuring the residual Cr(VI) in the supernatant following centrifugation at 7000× g for 10 min.
Survival of KUCr1 and Cr(VI) reduction in tannery effluent. Wastewater having 0.272 mM Cr(VI)
collected from an effluent fed canal nearby a tannery
industry, pH was adjusted to 7.5. 100 ml of 12 h grown
cell suspension culture grown in PYG medium was
added to the experimental sets containing sterilized
20 ml wastewater supplemented with 2 mM Cr(VI),
and to a control set without added Cr. The ambient temperature (35°C) was adjusted as per respective optimal
value for Cr(VI) reduction obtained in PYG medium.
Anticipating the poor nutritional support in tannery
wastewater, in another experiment it was assessed
whether addition of extra nutrient has any positive
role on Cr reduction or not. For this study wastewater
was supplemented with equal amount (0.8% w/v) of
NH4Cl, glucose and KH2PO4 as N, C and P sources
respectively. 100 ml of 12 h grown cell suspension
was added to 20 ml of extra nutrient added wastewater
4
Bacillus firmus reducing Cr(VI)
329
with or without additional Cr (2 mM) and the cultures
were kept at 35°C on shaking incubator. The viable
cell numbers were determined for each set by dilution
plate technique on PYG plates having 2 mM Cr. Chromate reduction was compared between the sets having extra nutrient and sets without extra nutrient.
Results and Discussion
The selected KUCr1 strain showed varied degree
of resistance to different heavy metals/metalloid and
the order of toxicity of the test elements to the bacterium in PYG broth was Cd> As = Co = Ni> Zn> Cr.
The minimum inhibitory concentration (MIC) of the
test metals for the bacterium are 3 mM, 10 mM,
22 mM and 950 mM, respectively. Based on the biochemical tests and analysis of the 16S rDNA sequence
(1196 bp) using BLAST function at NCBI database
and Ribosomal Database Project, the isolate KUCr1
was identified as a strain of Bacillus firmus (NCBI
GenBank Accession No. EU784699).
The growth of the isolate and course of the Cr(VI)
reduction in PYG and minimal media (MM) supplemented with 2 mM Cr were compared (Fig. 1 and 2).
Because of less cell mass yield by the strain at the
maximum tolerance level of Cr as per MIC data, in
this experiment 2 mM, which is even much higher
than that in the industrial effluents, was used to have
a substantial bacterial cell mass. The bacterial strain
showed steady growth in the complex medium (PYG)
accompanied with maximum Cr reduction capacity.
However, when the strain was grown in minimal medium the growth rate as well as Cr reduction ability
was declined considerably. The differences in growth
and Cr removal in those media may be explained by
the fact that bioavailable metal content was reduced
due to complexation with undefined components in
the PYG medium. Almost 100% removal of Cr(VI)
occurs in PYG medium whereas about 80% removal
occurs in MM after 6 days. The level of Cr tolerance
of this strain under aerobic conditions is significant in
comparison to that of the earlier reported bacilli
strains (Shakoori et al., 2000; Camargo et al., 2003).
There are many available other reports on Cr reduction in Bacillus (Campos et al., 1995; Garbisu et al.,
1998; Nurbap Nourbakhsh et al., 2002; Cheung and
Gu, 2005, 2007; Pal et al., 2005), however, reports on
B. firmus are scanty in particular, and this article reports a highly Cr resistant and Cr(VI) reducing
B. firmus strain. Removal of metal ions (Pb, Cu and
Zn) from aqueous solution by extracellular polysaccharide produced by B. firmus was only reported earlier (Salehizadeh and Shojaosadati, 2003).
The effect of Cr(VI) concentration in the medium
on the overall rate of reduction was studied at varied
Fig. 1. Growth response of the test strain grown in PYG and minimal media (MM) supplemented with 2 mM Cr as K 2CrO4 (+ Cr) or
without chromium (– Cr). Data are the mean of three replications
with error bars.
Fig. 2. Cr (VI) reduction by the test strain in PYG and minimal
media (MM) supplemented with 2 mM Cr as K2CrO4. Data are
the mean of three replications with error bars.
concentrations (0.5 mM to 2 mM). Cr(VI) was almost
completely reduced at all concentrations after 120 h
(Fig. 3). At lower concentrations (0.5 mM and 1 mM)
reduction rate increased sharply by 24 h and the metal
was completely reduced after 48 h. The reaction rate
was slowed in the first 24 h at concentrations of
1.5 mM and 2 mM, then it took 72 h to reduce Cr(VI)
completely at 1.5 mM and 120 h at 2 mM concentration. It seems higher concentration posed a selection
pressure due to Cr toxicity and thus lengthened the
growth phase, and for having substantial cell mass it
took longer period for complete reduction. Similar observation was also reported earlier by McLean et al.
(2000). Cr(VI) concentration dependence on reduction kinetics in Bacillus was also reported (Wang and
Xiao, 1995; Camargo et al., 2003).
Bacterial Cr(VI) reduction was found to be dependent on ambient pH and temperature which affect enzymatic reactions necessary for Cr(VI) reduction. For
most of the isolates so far reported, the optimal pH
330
Sau G.B. et al.
4
Fig. 3. Cr(VI) reductive ability of KUCr1 grown in PYG broth
(pH 7.2) having different concentration of chromium. Data are
the mean of three replications with error bars.
Fig. 5. Effect of different temperature on Cr (VI) reduction by the
test strain under aerobic culture condition grown in PYG medium
supplemented with 2 mM Cr as K2CrO4. Data are the mean of
three replications with error bars.
Fig. 4. Effect of different pH on Cr (VI) reduction by the test
strain under aerobic culture condition grown in PYG medium
supplemented with 2 mM Cr as K2CrO4. Data are the mean of three
replications with error bars.
Fig. 6. Chromium removal (%) by the dead cellmass (wet and dry)
from chromate solution having 2 mM Cr(VI). Data are the mean
of three replications with error bars.
and temperature for growth correlated with highest
rate of Cr(VI) reduction (Wang et al., 1990; Wang and
Xiao, 1995; Shakoori et al., 2000; Camargo et al.,
2003). The KUCr1 showed significant growth at wide
range of pH, however, pH 7 to 10 was found to be
growth yield supportive for significant Cr(VI) reduction (data not shown). Accordingly, Cr(VI) reduction
increased with elevated ambient pH value above 7 to
pH 10 (Fig. 4). However, the optimal pH for the
growth of KUCr1 ranges from 7.5 to 9. The relationship between pH and Cr(VI) reduction was not surprising because chromate (CrO42–) offers the dominant Cr(VI) species in an aqueous environment at pH
6.5 to 9 (Mc Lean and Beveridge, 2001).
The optimum temperature for better growth yield
in KUCr1 was found to range from 35°C to 40°C, and
Cr(VI) reduction achieved its highest value at 35°C
(Fig. 5). Earlier Losi et al. (1994) reported an optimum temperature of 30 to 37°C required for Cr(VI)
reduction under culture condition. Wang et al. (1990)
also reported interference of temperature on chromate
reduction. Requirement of an ambient temperature
of 30°C for highest Cr(VI) reduction in Bacillus sp.
was also reported (Wang and Xiao, 1995; Camargo
et al., 2003).
Cr(VI) reduction was variedly affected by the addition of different heavy metals (0.1 mM) under culture
condition. Cadmium and zinc significantly inhibited
Cr(VI) reduction whereas arsenic, cobalt and nickel
salt did not show any notable effect on Cr(VI) reduction (Table I) by the bacterial isolate, even though all
treatment regimes showed similar cell mass yield (data
4
331
Bacillus firmus reducing Cr(VI)
Table I
Effect of different metals/metalloids on Cr (VI) reduction (%)a by the test strainb
Metal/Metalloid used
Control
c
99.00 (±0.577)
Zn
Cd
As
Ni
Co
44.37 (±0.595)
26.23 (±0.606)
87.93 (±0.520)
85.65 (±0.693)
80.27 (±0.589)
a Data
are the mean of 3 replications with standard error and were obtained after 120 h of incubation.
For metal effect study PYG medium supplemented with 2 mM Cr additionally with different test metals (0.1 mM) separately.
c Bacteria were inoculated to PYG without any test metal except Cr (2 mM).
b
not shown), as the strain has inherent resistance to that
metals/metalloid. It seems Cd and Zn have some interference on the biochemistry of Cr(VI) reduction. Faisal
and Hasnain (2004) reported both Cr(VI) reduction
enhancement and inhibition by Zn (as 200 ppm ZnSO4)
and Co (as 50 ppm CoCl2) respectively in one strain
of Brevibacterium under culture condition. McLean
and Beveridge (2001) observed concentration dependent inhibition in Cr(VI) reduction by a pseudomonad
strain. Desjardin et al. (2003) reported Ni and Cd
induced Cr(VI) reduction during first 72 h and thereafter did not affect the reduction in Streptomyces
thermocarboxydus. The mechanism of Cr(VI) reduction inhibition by Cd and Zn in this strain needs further investigation.
Among bacteria, Bacillus sp. has been identified
as having a high potential for metal sequestration and
has been used in commercial biosorbent preparation.
In order to assess whether this Bacillus strain has Cr
biosorbing ability apart from its Cr(VI) reduction, dead
cell mass (wet and dried) was exposed to K2CrO4 solution. To avoid the artifacts might arise due to the presence of insoluble Cr(III) in the precipitate coming from
reduction by active cells, we could not perform the
experiment of bioaccumulation by viable cells. A significant cellular accumulation of chromium in Brevibacterium (Faisal and Hasnain, 2004) and in Bacillus
(Nurbap Nourbakhsh et al., 2002) was reported earlier.
The amount of chromium adsorbed by the dry and wet
dead cell mass of KUCr1 increased with increasing
contact time with metal solution (Fig. 6). Dried cell
mass adsorbed a bit higher amount of chromium than
the dead wet cell mass did, which contradicts the earlier observation (Faisal and Hasnain, 2004). Overall
chromium removal by dead cell mass in this study was
found to be very insignificant in comparison to the
Cr(VI) reduction by the active cell mass of this strain
under culture condition.
An experiment was conducted to determine Cr-reducing activity of the isolate with a number of different carbon and energy sources. The purpose was to
enrich for potential Cr(VI)-reducing strain by carbon
amendment and its possible optimization (Smith et al.,
2002). The results showed that the isolate grew significantly better in glucose containing medium, thus
the Cr(VI) reduction was also enhanced (result not
shown). From this finding the wastewater was supplemented with glucose and other nutrients (N and P).
The bacteria grew significantly better when additional
nutrients were provided and Cr(VI) reduction was
found to be doubled (Fig. 7A and 7B). It was observed
that under nutrient supportive condition the bacterial
strain reduced 64.4% of the Cr from the wastewater
after 6 days. But when the strain was grown in nutrient
deficient condition it reduced 32.5%. This finding signifies the cell mass dependency of Cr(VI) reduction.
Fig. 7. Growth response (A) and Cr(VI) reduction ability (B) of KUCr1 in wastewater from tannery industry
after 6 days initially having 5.7 log CFU/ml. WW = wastewater; – Cr/ + Cr = without/with added Cr;
– EN/ + EN = without/with extra nutrients as carbon, phosphorous and nitrogen source (vide Experimental part).
Data are the mean of three replications with error bars.
332
Sau G.B. et al.
However, potentiality of using cost effective natural
or non-conventional carbon or other mineral sources
to support in situ bioremediation of Cr(VI) by this
bacterial candidate warrants further investigation.
The studied ambient parameters that affect chromate reduction are important physico-chemical factors regulating bioremediation strategies for sites contaminated with toxic species of chromium. This strain
shows promise for Cr(VI) reduction and its features
would be useful for successful microbiological detoxification of chromate for both in situ or ex situ bioremediation of Cr-contaminated sites with appropriate
growth and reduction supportive conditions.
Acknowledgement
The work was supported by the grant received from the University of Kalyani, India.
Literature
Abdel-Sabour M.F. 2007. Chromium in receving environment
in Egypt (An Overview). E.J. Environ. Agri. Food Chem. 6:
2178–2198.
Altschul S.F., W. Gish, W. Mille, E.W. Myer and D.J. Lipman.
1990. Basic local alignment search tool. J. Mol. Biol. 219: 403–410.
Bailar J.C. 1997. Chromium. In: Parker S.P. (ed). McGraw-Hill
Encyclopedia of Science and Technology, VIIIth ed. Vol. 3.
McGraw-Hill, New York.
Bopp L.H. and H.L. Ehrlich. 1988. Chromate resistance and reduction in Pseudomonas fluorescens strain LB300. Arch. Microbiol.
150: 426–431.
Camargo F.A.O., F.M. Bento, B.C. Okeke and W.T. Frankenberger. 2003. Chromate reduction by chromium-resistant bacteria
isolated from soils contaminated with dichromate. J. Environ. Qual.
32:1228–1233.
Campos J., M. Martinez-Pacheco and C. Cervantes. 1995.
Hexavalent-chromate reduction by a chromate resistant Bacillus sp.
Antonie Van Leeuwenhoek 68: 203–208.
Cheung K.H. and J.D. Gu. 2005. Chromate reduction by Bacillus
megaterium TKW3 isolated from marine sediments. W.J. Microbiol. Biotechnol. 21: 213–219.
Cheung K.H. and J.D. Gu. 2007. Mechanism of hexavalent
chromium detoxification by microorganisms and bioremediation
application potential: A review. Int. Biodet. Biodegrad. 59: 8–15.
Cheung K.H., H.Y. Lai and J.D. Gu. 2006. Membrane-associated
hexavalent chromium reductase of Bacillus megaterium TKW3
with induced expression. J. Microbiol. Biotechnol. 16: 855–862.
Desjardin V., R. Bayard, P. Lejeune and R. Gourdon. 2003.
Utilisation of supernatants of pure cultures of Streptomyces
thermocarboxydus NH50 to reduce chromium toxicity and mobility in contaminated soils. Water Air Soil Pollut. 3: 153–160.
Eccles H. 1995. Removal heavy metals from effluents streams
– why select a biological process? Int. Biodet. Biodegrad. 35: 5–16.
Faisal M. and S. Hasnain. 2004. Microbial conversion of Cr (VI)
in to Cr (III) in industrial effluent. African J. Biotechnol. 3: 610–617.
Francis C.A., A.Y. Obraztsova and B.M. Tebo. 2000. Dissimilatory metal reduction by the facultative anaerobe Pantoea agglomerans SP1. Appl. Environ. Microbiol. 66: 543–548.
Fredrickson J.K., H.M. Kostandarithes, S.W. Li, A.E. Plymale
and M.J. Daly. 2000. Reduction of Fe(III), Cr(VI), U(VI), and
Tc(VII) by Deinococcus radiodurans R1. Appl. Environ. Microbiol.
66: 2006–2011.
4
Garbisu C., I. Alkorta, M.J. Llama and J.L. Serra. 1998. Aerobic chromate reduction by Bacillus subtilis. Biodegraation 9:
133–141.
Ishibashi Y., C. Cervantes and S. Silver. 1990. Chromium reduction in Pseudomonas putida. Appl. Environ. Microbiol. 56:
2268–2270.
Losi M.E., C. Amrhein and W.T. Frankenberger. 1994. Environmental biochemistry of chromium. Rev. Environ. Contam.
Toxicol. 36: 91–121.
Maidack B.L., G.J. Olsen, N. Larson, R. Overbeek, M.J.
McCaughey and C.R. Woese. 1997. The RDP (Ribosomal Database Project). Nucleic Acids Res. 205: 109–111.
McLean J. and T.J. Beveridge. 2001. Chromate reduction by
a pseudomonad isolated from a site contaminated with chromated
copper arsenate. Appl. Environ. Microbiol. 67: 1076–1084.
McLean J.S., T.J. Beveridge and D. Phipps. 2000. Isolation
and characterization of a chromium-reducing bacterium from
a chromated copper arsenate-contaminated site. Environ. Microbiol.
2: 611–619.
Michel C., M. Brugna, C. Aubert, A. Bernadac and M. Bruschi.
2001. Enzymatic reduction of chromate: comparative studies
using sulfate-reducing bacteria. Appl. Microbiol. Biotechnol. 55:
95–100.
Nurbap Nourbakhsh M., S. Kilicarslan, S. Ilhan and H. Ozdag.
2002. Biosorption of Cr6+, Pb 2+ and Cu2+ ions in industrial waste
water on Bacillus sp. Chem. Eng. J. 85: 351–355.
Pal A., S. Dutta and A.K. Paul. 2005. Reduction of hexavalent
chromium by cell-free extract of Bacillus sphaericus AND 303
isolated from serpentine soil. Curr. Microbiol. 51: 327–330.
Palmer C.D. and P.R. Wittbrodt. 1991. Processes affecting the
remediation of chromium-contaminated sites. Environ. Health
Pers. 92: 25–40.
Salehizadeh H. and S.A. Shojaosadati. 2003. Removal of metal
ions from aqueous solution by polysaccharide produced form Bacillus firmus. Water Res. 37: 4231–4235.
Sawyer C.N., P.L. McCarty and G.F. Parkin. 1994. Chemistry
for Environmental Engineering, IVth ed. McGraw-Hill, New York.
Shakoori A.R., M. Makhdoom and R.U. Haq. 2000. Hexavalent
chromium reduction by a dichromate-resistant gram-positive bacterium isolated from effluents of tanneries. Appl. Microbiol.
Biotechnol. 53: 348–351.
Smith W.A., W.A. Apel, J.N. Petersen and B.M. Peyton. 2002.
Effect of carbon and energy source on bacterial chromate reduction. Bioremed. J. 6: 205–215.
Sneath P. 1986. Endospore-forming Gram-positive rods and occi.
pp. 1104–1138. In: Sneath P.H.A., N.S. Mair, M.E. Sharpe and
J.G. Holt (eds). Bergeys Manual of Systematic Bacteriology.
Williams and Wilkins, Baltimore, USA.
United States Environmental Protection Agency. 1998. Toxicological review of hexavalent chromium (CAS No. 18540-29-9),
US EPA, Washington D.C.
Urone P.F. 1955. Stability of colorimetric reagent for chromium. S-diphenylcarbazides in various solvents. Anal. Chem. 27:
1354–1355.
Wang Y.T. and C. Xiao. 1995. Factors affecting hexavalent
chromium reduction in pure cultures of bacteria. Water Res. 29:
2467–2474.
Wang P., T. Mori, K. Toda and H. Ohtake. 1990. Membraneassociated chromate reductase activity from Enterobacter cloacae.
J. Bacteriol. 172: 1670–1672.
Xu X.R., H.B. Li and J.D. Gu. 2004. Reduction of hexavalent
chromium by ascorbic acid in aqueous solutions. Chemosphere
57: 609–613.
Xu X.R., H.B. Li, J.D. Gu and X.Y. Li. 2005. Kinetics of the
reduction of chromium (VI) by vitamin C. Environ. Toxicol.
Chem. 24: 1310–1314.
Polish Journal of Microbiology
2008, Vol. 57, No 4, 333–335
SHORT COMMUNICATION
Selective Isolation of Bacillus thuringiensis from Soil by Use of L-Serine
as Minimal Medium Supplement
SYLWIA ANDRZEJCZAK* and EL¯BIETA LONC
Department of Microorganisms Ecology and Environmental Protection, Institute of Genetics
and Microbiology, University of Wroc³aw, Wroc³aw, Poland
Received 20 June 2008, revised 4 August 2008, accepted 20 August 2008
Abstract
The influence of L-serine on the growth of different strains of the genus Bacillus was investigated. It has been observed that the addition
of L-serine to minimal synthetic media results in an inhibition in the growth of certain strains of Bacillus spp. but not B. thuringiensis.
Then L-serine-resistance phenomenon was used in isolation of B. thuringiensis strains from soil. An isolation method with media supplied
with L-serine was compared to the previously applied procedure (isolation on nutrient agar). L-serine-selective medium appeared to be
more effective in isolation of Bt strains.
K e y w o r d: Bacillus thuringiensis, L-serine resistance, B. thuringiensis selective isolation
Some amino acids i.e. valine (Leavitt and Umbarger,
1962), tyrosine (Beerstecher and Shive, 1947) or leucine (Washburn and Niven, 1948), preclude the growth
of bacterial cells. L-serine has long been known to
cause growth inhibition of Escherichia coli (Amos
and Cohen, 1954), Bacillus anthracis (Gladstone,
1939), Bacillus subtilis, Bacills megaterium, Bacillus
pantothenticus, Bacillus mycoides (Lachowicz et al.,
1996; Saito et al., 2001) cultured in minimal medium.
However data concerning one species – Bacillus thuringiensis are contradictory. In opposite to Lachowicz
et al. (1996), where three tested B. thuringiensis strains
were completely resistant to the inhibitory action of
L-serine, Singer and Rogoff (1986) provided evidence
that this amino acid inhibits B. thuringiensis growth.
The aim of this study was to confirm L-serine-resistance phenomenon and utilization of L-serine in selective isolation of B. thuringiensis from environment.
Twenty-eight reference strains as well as environmental isolates of Bacillus spp. (Table I) were tested in
this study. To examine the influence of L-serine on bacterial growth, the strains were cultured on synthetic
medium (M9) composed of (g/l): Na2HPO4 × 7H2O 6;
KH2PO4 3; NaCl 0.5; NH4Cl 0.5; MgSO 4 × 7H2O
0.024; CaCl2 0.0001; glucose 10; Bacto-agar 2 and
supplemented with L-serine at the concentration of 0.1
or 0.2 mM. The minimal medium of the same composition but without L-serine was used as a control.
M9 medium supplemented with L-serine was also
used for isolation of B. thuringiensis strains from soil
samples collected from woodland area near Zielona
Góra (Poland). About 1 g (dry weight) of environmental sample was placed in test tubes containing 10 ml
of 0.9% NaCl solution. The tubes were heat-shocked
at 80°C for 15 min in a water bath. Next, 1 ml of tube
content was poured into 50 ml of nutrient broth. The
flasks were incubated at 37°C until germination was
complete. The cells were sedimented by centrifugation and resuspended in 5 ml of 0.9% NaCl solution.
The suspensions were serially diluted and spread on
M9 medium and M9 medium supplemented with
serine (0.2 mM). Plates were incubated at 37°C for
48 h. The same samples were simultaneously analysed
using previously described nutrient agar method of
Doroszkiewicz and Lonc (1999). The heated suspensions of soil were diluted and then plated on nutrient
agar. Counts and B. thuringiensis colonies identification were made after incubation for 24 h at 37°C. All
isolates with typical B. thuringiensis colony morphology (i.e. flat, cream, rough surface, irregular edges)
* Corresponding author: S. Andrzejczak, Department of Microorganisms Ecology and Environmental Protection, Institute of
Genetics and Microbiology, University of Wroc³aw, Przybyszewskiego 63, 51-148 Wroc³aw, Poland; phone: (48) 71 3756366; e-mail:
[email protected]
334
4
Andrzejczyk S. and Lonc E.
Table I
List of tested Bacillus strains
Strain
B. circulans PCM 2229
B. firmus PCM 1844
B. sphaericus PCM 485
B. pumilus 1852 PCM
B. megaterium PCM 1855
B. megaterium MEG 001
B. thuringiensis finitimus KsAc1
B. thuringiensis finitimus KsS1
B. thuringiensis finitimus OpF3
B. thuringiensis finitimus OpS1
B. thuringiensis japonensis KpC1
B. thuringiensis japonensis KpF3
B. thuringiensis japonensis KsF1
B. thuringiensis japonensis OpAc1
B. thuringiensis japonensis OpPa1
B. thuringiensis japonensis OpPs1
B. thuringiensis kurstaki PO14
B. thuringiensis tochigiensis OpQ1
B. thuringiensis aizawai BTNT0423
B. thuringiensis kurstaki CFTRI20
B. thuringiensis thuringiensis CFTRI18
B. thuringiensis finitimus XBIT-1966
B. thuringiensis kurstaki IwonaI
B. thuringiensis fukuokaensis LBIT-499
B. thuringiensis sumiyoshiensis KNG6
B. thuringiensis morrisoni UNI101
B. thuringiensis israelensis LBE155
B. thuringiensis alesti LNG4-03
were determined to have the B. thuringiensis biochemical profile (Sneath, 1986) and were examined
for the presence of parasporal bodies by phase-contrast microscopy.
All 28 tested strains grew in presence of 0.1 mM
L-serine. However B. circulans PCM 2229, B. firmus
PCM 1844, B. sphaericus PCM 485, B. pumilus 1852
PCM, B. megaterium PCM 1855, B. megaterium
MEG 001 failed to grow in the presence of higher
(0.2 mM) concentrations of L-serine. All B. thuringiensis strains appeared totally resistant to both L-serine
concentrations applied.
Using different media to isolate B. thuringiensis
strains, 524 colonies were obtained on M9 medium
supplemented with L-serine and about 1000 on nutrient agar (approximate number because of specific
B. mycoides growth). Basing on biochemical tests
results and phase-contrast microscopy observations,
81 strains were identified as B. thuringiensis. Percentage of B. thuringiensis isolates on L-serinemedium was about 2.5 times higher than on nutrient
agar (Fig. 1).
Amino acids are essential for bacterial life, although
their lack as well as surplus makes the growth of some
species impossible. Our results show that some strains
of the genus Bacillus are sensitive to action of L-serine,
while all B. thuringiensis subspecies are resistant to
growth inhibition caused by this amino acid. Our re-
Origin
Polish Collection of Microorganisms,
Institute of Immunology
and Experimental Therapy
of the Polish Academy of Sciences, Wroc³aw
Collection of Institute of Genetics
and Microbiology,
University of Wroc³aw, Wroc³aw
Kindly supplied by Dr. J.F. Charles,
Pasteur Institute, Paris.
sults do not correspond with previously published
data of Singer and Rogoff (1986). The different results
are probably consequence of application in our tests
of minimal medium with different composition.
In our tests conditions L-serine-resistance seems to
be a general phenomenon for all B. thuringiensis sub-
%
5
4,5
4
3,5
3
2,5
2
1,5
1
0,5
0
1
2
Fig. 1. Comparison of the rate of isolation of B. thuringiensis
colonies using different media: 1 – nutrient agar,
2 – M9 medium supplemented with L-serine (0.2 mM)
4
Short communication
species. However, L-serine-sensitive Bacillus strains
are not able to grow in the presence of this amino acid,
probably because of inhibition of homoserine dehydrogenase I (HDH I) activity, i.e. enzyme involved in
L-threonine synthesis (S. Andrzejczak, unpublished
data). On the other hand, it suggests that B. thuringiensis strains have L-serine-resistant HDH I and its
activity is not inhibited even when serine concentration is relatively high. However the mechanism of this
phenomenon still needs to be solved.
Application of L-serine as growth inhibitor increases effectiveness of B. thuringiensis strains isolation. It is clearly apparent that amino acid inhibits the
growth of some species i.e. B. mycoides. Nevertheless, in natural environment L-serine-resistance seems
to be a more frequent characteristic in genus Bacillus
and other strains can be also isolated on minimal medium supplemented with serine.
Literature
Amos H. and G.N. Cohen. 1954. Amino acid utilization in bacterial growth. 2. A study of threonine-isoleucine relationships in
mutants of Escherichia coli. Biochem. J. 57: 338–343.
335
Beerstecher Jr. E. and W. Shive. 1947. Prevention of phenylalanine synthesis by tyrosine. J. Biol. Chem. 167: 527–534.
Doroszkiewicz W. and E. Lonc. 1999. Biodiversity of Bacillus
thuringiensis strains in the phylloplane and soil of Lower Silesia
Region (Poland). Acta Mirobiol. Pol. 48: 355–361.
Gladstone G.P. 1939. Interrelationship between amino acids
in the nutrition of Bacillus anthracis. Br. J. Exp. Pathol. 20:
189–200.
Lachowicz T.M., E. Morzejko, E. Panek and J. Pi¹tkowski.
1996. Inhibitory action of serine on growth of bacteria of the
genus Bacillus on mineral synthetic media. Folia Microbiol. 41:
21–25.
Leavitt R.I. and H.E. Umbarger. 1962. Isoleucine and valine
metabolism in Escherichia coli. XI. Valine inhibition of the
growth of Escherichia coli strain K-12. J. Bacteriol. 83: 624–630.
Saito K., K. Tanaka and K. Yamada. 2001. Growth inhibition
by L-serine in Bacillus subtilis MF920. Jpn. J. Food Chem. 8:
117–120.
Singer S. and M.H. Rogoff. 1986. Inhibition of growth of Bacillus thuringiensis by amino acids in defined media. J. Invertebr.
Pathol. 12: 98–104.
Sneath P.H.A. 1986. Endospore-forming Gram-positive rods and
cocci, pp. 55–75. In: P.H.A. Sneath, N.S. Mair, M.E. Sharpe, and
J.G. Holt (eds.), Bergey’s Manual of Systematic Bacteriology,
Williams & Wilkins, Baltimore.
Washburn M.R. and C. F. Niven. 1948. Amino acid interrelationships in the nutrition of Streptococcus bovis. J Bacteriol. 55:
769–76.
336
Andrzejczyk S. and Lonc E.
4
Polish Journal of Microbiology
formerly Acta Microbiologica Polonica
2008, Vol. 57, No 1–4
CONTENTS
Vol. 57, 1–4, 2008
No 1
MINIREVIEW
New approaches for Helicobacter vaccine development – difficulties and progress
JAGUSZTYN-KRYNICKA E.K., GODLEWSKA R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3
NOWAK-ZALESKA A., KRAWCZYK B., KOT£OWSKI R., MIKUCKA. A., GOSPODAREK E. . . . . . . . . . . . . . . . . . . . . . . .
11
RACZKOWSKA A., BRZÓSTKOWSKA M., BRZOSTEK K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
19
NAWROT. U., SKA£A J., W£ODARCZYK K., FONTEYNE P.A., NOLARD N., NOWICKA J. . . . . . . . . . . . . . . . . . . . . . . . . .
27
NARAYANA K.J.P., PRABHAKAR P., VIJAYALAKSHMI M., VENKATESWARLU Y., KRISHNA P.S.J. . . . . . . . . . . . . . . . . .
35
KÊDZIERSKA J., PI¥TKOWSKA-JAKUBAS B., KÊDZIERSKA A., BIESIADA G., BRZYCHCZY A.,
PARNICKA A., MIÊKINIA B., KUBISZ A., SU£OWICZ W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
41
KAR S., RAY R.C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
49
CHIPASA K.B., MÊDRZYCKA K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
59
SOOD A., SHARMA S., KUMAR V., THAKUR R.L. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
71
BAKRI Y., JAWHAR M., ARABI M.I.E. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
77
SAADOUN I., GHARAIBEH R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
INSTRUCTION TO AUTHORS
81
ORIGINAL PAPERS
Amplification of a single-locus variable-number direct-repeats with restriction fragment length polymorphism
(DR-PCR/RFLP) for genetic typing of Acinetobacter baumannii strains
Regulation of Yersinia enterocolitica mal genes by MalT and Mlc proteins
Proteolytic activity of clinical Candida albicans isolates in relation to genotype and strain source
Study on bioactive compounds from Streptomyces sp. ANU 6277
Clinical presentation of extraintestinal infections caused by non-typhoid salmonella serotypes among patients
at the University Hospital in Cracow during an 7-year period
Statistical optimization of "-amylase production by Streptomyces erumpens MTCC 7317 cells in calcium alginate beads
using response surface methodology
The influence of soluble microbial products on microbial community composition: hypothesis of microbial community
succession
Established and abandoned tea (Camillia sinensis L.) rhizosphere: dominant bacteria and their antagonism
SHORT COMMUNICATIONS
Polymorphism in the ITS region of ribosomal DNA of Cochliobolus sativus isolates differing in xylanase production
Usefulness of strb1 and 16S rDNA-targeted PCR for detection of Streptomyces spp. in environmental samples
No 2
MINIREVIEW
The decline of antibiotic era - new approaches for antibacterial drug discovery
JAGUSZTYN-KRYNICKA E.K., WYSZYÑSKA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
91
RUMIJOWSKA-GALEWICZ A, KORYCKA-MACHA£A M., LISOWSKA K., DZIADEK J. . . . . . . . . . . . . . . . . . . . . . . . . . . .
99
ORIGINAL PAPERS
The composition of cell wall skeleton and outermost lipids of Mycobacterium vaccae is modified to ethambutol treatment
Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats
in Poland
STEFAÑSKA I., RZEWUSKA M., BINEK M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
The delayed early gene G23 of temperate mycobacteriophage L1 regulates the expression of deoxyribonuclease,
the product of another delayed early gene of the phage
MANDAL P., DATTA H.J., SAU S., MANDAL N.C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113
Novel gyrase mutations and characterization of ciprofloxacin-resistant clinical strains of Enterococcus faecalis isolated
in Poland
PIEKARSKA K., GIERCZYÑSKI R., £AWRYNOWICZ-PACIOREK M., KOCHMAN M., JAGIELSKI M. . . . . . . . . . . . . . . . . 121
Gene expression profiling of lipoarabinomannan-treated mouse macrophage cultures infected with Mycobacterium
bovis BCG
KRZY¯OWSKA M., MALEWSKI T., HAMASUR B., AUGUSTYNOWICZ-KOPEÆ E., SCHOLLENBERGER A.,
PAW£OWSKI A., NIEMIA£TOWSKI M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125
Influence of microencapsulation and spray drying on the viability of Lactobacillus and Bifidobacterium strains
GODERSKA K., CZARNECKI Z. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135
Isoglucose production from raw starchy materials based on a two-stage enzymatic system
GROMADA A., FIEDUREK J., SZCZODRAK J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141
Statistical optimization of "-amylase production by probiotic Lactobacillus plantarum MTCC 1407 in submerged
fermentation
PANDA S.H., SWAIN M.R., KAR S., RAY R.C., MONTET D. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149
A comparative evaluation of PCR ribotyping and ERIC PCR for determining the diversity of clinical Pseudomonas
aeruginosa isolates
WOLSKA K., SZWEDA P. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
Studies on the survival of enterohemorrhagic and environmental Escherichia coli strains in wastewater and in activated
sludges from dairy sewage treatment plant
CZAJKOWSKA D., BOSZCZYK-MALESZAK H., SIKORSKA I., SOCHAJ A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165
Characterization of glycopeptides, aminoglycosides and macrolide resistance among Enterococcus faecalis and
Enterococcus faecium isolates from hospitals in Tehran
EMANEINI M., ALIGHOLI M., AMINSHAHI M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173
SHORT COMMUNICATION
Antimicrobial activity of 2,4-dihydro-[1,2,4]triazol-3-one derivatives
STEFAÑSKA J., STRUGA M., TYSKI S., KOSSAKOWSKI J., DOBOSZ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
No 3
ORIGINAL PAPERS
Anti-phagocytic activity of Helicobacter pylori lipopolysaccharide (LPS) – possible modulation of the innate immune
response to these bacteria
GRÊBOWSKA A., MORAN A.P., MATUSIAK A., B¥K-ROMANISZYN L., CZKWIANIANC E., RECHCIÑSKI T.,
WALENCKA M., P£ANETA-MA£ECKA I., RUDNICKA W., CHMIELA M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185
Low distribution of integrons among multidrug resistant E. coli strains isolated from children with community-acquired
urinary tract infections in Shiraz, Iran
FARSHAD S., JAPONI A., HOSSEINI M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193
Susceptibility pattern of some clinical bacterial isolates to selected antibiotics and disinfectants
OGBULIE J.N., ADIEZE I.E., NWANKWO N.C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
Effects of Propionibacterium on the growth and mycotoxin production by some species of Fusarium and Alternaria
GWIAZDOWSKA D., CZACZYK K., FILIPIAK M., GWIAZDOWSKI R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205
Characterisation of actinomycetes isolated from ancient stone and their potential for deterioration
ABDULLA H., MAY E., BAHGAT M., DEWEDAR A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
Biodegradation of carbendazim by epiphytic and neustonic bacteria of eutrophic Che³m¿yñskie lake
KALWASIÑSKA, A., KÊSY J., DONDERSKI W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 221
Isolation and characterization of extracellular bioflocculants produceed by bacteria isolated from Quatari ecosystems
ABD-EL-HALEEM D.A.M., AL-THANI R.F., AL-MOKEMY T., AL-MARII S., HASSAN F. . . . . . . . . . . . . . . . . . . . . . . . . . . . 231
The impact of organic carbon and ammonia load in wastewater on ammonia-oxidizing bacteria community
in activated sludge
CYDZIK-KWIATKOWSKA A., WOJNOWSKA-BARY£A I. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241
SHORT COMMUNICATION
Xylanase production by a newly isolated Aspergillus niger SS7 in submerged culture
BAKRI Y., AL-JAZAIRI M., AL-KAYAT G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
Slime production by Staphylococcus aureus strains isolated from cases of bovine mastitis
KRUKOWSKI H., SZYMANKIEWICZ M., LISOWSKI A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 253
Survival of rhizobia in two soils as influenced by storage conditions
MARTYNIUK S., OROÑ J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257
Evaluation of antibacterial activity of synthetic aliphatic and aromatic monoacylglycerols
BATOVSKA D., TODOROVA I., PARUSHEV S., TSVETKOVA I., NAJDENSKI H., UBUKATA M. . . . . . . . . . . . . . . . . . . . . . 261
First isolation of Clostridium difficile PCR-ribotype 027/toxinotype III in Poland
PITUCH H., BAKKER D., KUIJPER E. OBUCH-WOSZCZATYÑSKI P., WULTAÑSKA D., NURZYÑSKA G., BIELEC A.,
BAR-ANDZIAK E., £UCZAK M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 267
No 4
ORIGINAL PAPERS
Expression of Bombyx mori nucleopolyhedrovirus ORF76 in permissive and non-permissive cell lines by a novel
Bac-to-Bac/BmNPV baculovirus expression system
SU W.-J., WU Y., WU H.-L., ZHU S.-Y., WANG W.-B. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 271
Stable sulfur isotope fractionation by the green bacterium Chlorobaculum parvum during photolithoautotrophic growth
on sulfide
KELLY D.P. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275
Exopolysaccharide production by Bacillus strains colonizing packaging foils
SZUMIGAJ J., ¯AKOWSKA Z., KLIMEK L. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281
"-Amylase production by Streptomyces erumpens MTCC 7317 in solid state fermentation using response surface
methodology (RSM)
KAR S., RAY R.C., MOHAPATRA U.B. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
Screening for soil streptomycetes from North Jordan that can produce herbicidal compounds
BATAINEH S.M.B., SAADOUN I., HAMEED K.M., ABABNEH Q. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 297
Macrolide-lincosamide-streptogramin B resistant phenotypes and genotypes for methicillin-resistant Staphylococcus aureus
in Turkey, from 2003 to 2006
GUL H.C., KILIC A., GUCLU A.U., BEDIR O., ORHON M., BASUSTAOGLU C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307
Cell surface hydrophobicity of Bacillus spp. as a function of nutrient supply and lipopeptides biosynthesis and its role in
adhesion
CZACZYK K., BIA£AS W., MYSZKA K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 313
Scanning electron microscopy and energy-dispersive X-ray microanalysis of Penicillium brevicompactum treated
with cobalt
FARRAG R. M., MOHAMADEIN M. M., MEKAWY A.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 321
Isolation and characterization of a Cr(VI) reducing Bacillus firmus strain from industrial effluents
SAU G.B., CHATTERJEE S., SINHA S., MUKHERJEE S.K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 327
SHORT COMMUNICATION
Selective isolation of Bacillus thuringiensis from soil by use of L-serine as minimal media supplement
ANDRZEJCZYK S., LONC E. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 333
Polish Journal of Microbiology
formerly Acta Microbiologica Polonica
2008, Vol. 57, No 1–4
Polish Journal of Microbiology
2008, Vol. 57, 1–4
Author Index
Ababneh Q. 297
Abd-El-Haleem D.A.M. 231
Abdulla H. 213
Adieze I.E. 199
Al.-Jazairi M. 249
Al.-Kayat G. 249
Aligholi M. 173
Al-Marii S. 231
Al-Mokeny T. 231
Al-Thani R.F. 231
Aminshahi M. 173
Andrzejczyk S. 333
Arabi M.I.E. 77
Augustynowicz-Kopeæ E. 125
Bahgat M. 213
Bakker D. 267
Bakri Y. 77, 249
Bar-Andziak E. 267
Basustaoglu C. 307
Bataineh S.M.B. 297
Batovska D. 261
B¹k-Romaniszyn L. 185
Bedir O. 307
Bia³as W. 313
Bielec A. 267
Biesiada G. 41
Binek M. 105
Boszczyk-Maleszak H. 165
Brzostek K. 19
Brzóstkowska M. 19
Brzychczy A. 41
Chatterjee S. 327
Chipasa K.B. 59
Chmiela M. 185
Cydzik-Kwiatkowska A. 241
Czaczyk K. 205, 313
Czajkowska D. 165
Czarnecki Z. 135
Czkwianianc E. 185
Datta H.J. 113
Dewedar A. 213
Dobosz M. 179
Donderski W. 221
Dziadek J. 99
Emaneini M. 173
Farrag R.M. 321
Farshad S. 193
Fiedurek J. 141
Filipiak M. 205
Fonteyne P.A. 27
Gharaibeh R. 81
Gierzyñski R. 121
Goderska K. 135
Godlewska R. 3
Gospodarek E. 11
Grêbowska A. 185
Gromada A. 141
Guclu A.U. 307
Gul H.C. 307
Gwiazdowska D. 205
Gwiazdowski R. 205
Hamasur B. 125
Hameed K.M. 297
Hassan F. 231
Hosseini M. 193
Jagielski M. 121
Jagusztyn-Krynicka E.K. 3, 91
Japoni A. 193
Jawhar M. 77
Kalwasiñska A. 221
Kar S. 49, 149, 289
Kelly D.P. 275
Kêdzierska A. 41
Kêdzierska J. 41
Kêsy J. 221
Kilic A. 307
Klimek L. 281
Kochman M. 121
Korycka-Macha³a M. 99
Kossakowski J. 179
Kot³owski R. 11
Krawczyk B. 11
Krishna P.S.J. 35
Krukowski H. 253
Krzy¿owska M. 125
Kubisz A. 41
Kuijper E. 267
Kumar V. 71
Lisowska K. 99
Lisowski A. 253
Lonc E. 333
£awrynowicz-Paciorek M. 121
£uczak M. 267
Malewski T. 125
Mandal N.C. 113
Mandal P. 113
Martyniuk S. 257
Matusiak A. 185
May E. 213
Mekawy A.A. 321
Mêdrzycka K. 59
Miêkinia B. 41
Mikucka A. 11
Mohamadein M.M. 321
Mohapatra U.B. 289
Montet D. 149
Moran A.P. 185
Mukherjee S.K. 327
Myszka K. 313
Najdenski H. 261
Narayana K.J.P. 35
Nawrot U. 27
Niemia³towski M. 125
Nolard N. 27
Nowak-Zaleska A. 11
Nowicka J. 27
Nurzyñska G. 267
Nwankwo N.C. 199
Obuch-Woszczatyñski P. 267
Ogbulie J.N. 199
Orhon M. 307
Oroñ J. 257
Panda S.H. 149
Parnicka A. 41
Parushev S. 261
Paw³owski A. 125
Pi¹tkowska-Jakubas B. 41
Piekarska K. 121
Pituch H. 267
P³aneta-Ma³ecka I. 185
Prabhakar P. 35
Raczkowska A. 19
Ray R.C. 49, 149, 289
Rechciñski T. 185
Rudnicka W. 185
Rumijowska-Galewicz A. 99
Rzewuska M. 05
Saadoun I. 81, 297
Sau G.B. 327
Sau S. 113
Schollenberger A. 125
Sharma S. 71
Sikorska I. 165
Sinha S. 327
Ska³a J. 27
Sochaj A. 165
Sood A. 71
Stefañska I. 105
Stefañska J. 179
Struga M. 179
Su W.-J. 271
Su³owicz W. 41
Swain M.R. 149
Szczodrak J. 141
Szumigaj J. 281
Szweda P. 157
Szymankiewicz M. 253
Thakur R.L. 71
Todorova I. 261
Tsvetkova I. 261
Tyski S. 179
Ubukata M. 261
Venkateswarlu Y. 35
Vijayalakshmi M. 35
Walencka M. 185
Wang W.-B. 271
W³odarczyk K. 27
Wojnowska-Bary³a I. 241
Wolska K. 157
Wu H.-L. 271
Wu Y. 271
Wultañska D. 267
Wyszyñska A. 91
Zhu S.-Y. 271
¯akowska Z. 281
Polish Journal of Microbiology
formerly Acta Microbiologica Polonica
2008, Vol. 57, No 1–4
Acknowledgements
The Editors of Polish Journal of Microbiology wish to express their gratitude to the
following colleagues from the various fields of microbiology, who have reviewed the manuscripts submitted to our Journal in 2008:
El¿bieta Anuszewska, Jadwiga Baj, Jacek Bardowski, Dariusz Bartosik, Anna Belcarz,
Jacek Bielecki, Krystyna Bieñkowska-Szewczyk, Marian Binek, Hanka Boszczyk-Maleszak,
Katarzyna Brzostek, Jerzy Che³kowski, Aleksander Chmiel, Adam Choma, Ryszard Chróst,
S³awomir Ciesielski, Katarzyna Czaczyk, Danuta Czajkowska, Hanna Dahm, Andrzej Denys,
Estera Dey, Wojciech Donderski, Nadzieja Drela, Adam Dubin, Grzegorz Dubin, Jaros³aw
Dziadek, Danuta Dzier¿anowska, Katarzyna Dzier¿anowska-Fangrat, Bart³omiej Dziuba,
Jan Fiedurek, Stefania Giedrys-Kalemba, Gra¿yna Ginalska, Marek Gniatkowski, Marcin
Go³êbiewski, Eugenia Gospodarek, Anna Grabiñska-£oniewska, W³odzimierz Grajek, Stoyan
Groudev, Waleria Hryniewicz, Jolanta Jaroszuk-Œcise³, Adam Jaworski, Wies³aw Kaca, Halina
Kalinowska, Jacek Kozdrój, Józek Kur, Ewa Kurek, Wies³aw Kurz¹tkowski, Teresa Lagergård,
Maria £ebkowska, Tomasz Mach, Wanda Ma³ek, Zdzis³aw Markiewicz, Gayane Martirosjan,
Eugenusz Matafiej, Ma³gorzata Miko³ajczyk-Chmiela, Korneliusz Miksch, Ilona Motyl,
Krystyna Olañczuk-Nejman, Marek Niemia³towski, Tzi Bun Ng, Andrzej Orzeszko, Katarzyna
Pancer, Seraphim Papanikolaou, Barbara Pawlik-Skowroñska, Andrzej Piekarowicz,
Ma³gorzata Pleszczyñska, Magdalena Popowska, Anna Przondo-Mordarska, Irena
Romanowska, Barbara Ró¿alska, Wies³awa Rudnicka, Mojmir Rychtera, Katarzyna Rydzanicz,
Waldemar Rymowicz, Izabela Sinkiewicz, Krzysztof Siwicki, Aleksandra Sk³odowska,
Anna Skorupska, Tomasz S³omczyñski, Piotr Sobiczewski, Marta Stroczyñska-Sikorska,
Marta Struga, Hanna Stypu³kowska-Misiurewicz, Miros³awa Szczêsna-Antczak, Janusz
Szczodrak, Andrzej Szkaradkiewicz, Krzysztof Szulowski, Aleksander Œwi¹tecki, Izabela
Œwiêcicka, Krystyna Trojanowska, Stefan Tyski, Stanis³awa Tylewska-Wierzbanowska,
Teresa Urbanik-Sypniewska, Iwona Warmiñska-Radyko, Adam Waœko, Grzegorz Wêgrzyn,
Jadwiga Wild, Miros³awa W³odarczyk, Maria Wojtatowicz, Krystyna I. Wolska, Barbara
Wolska-Mitaszko, Borys Wróbel
POLISH JOURNAL OF MICROBIOLOGY
(founded in 1953 as Acta Microbiologica Polonica)
www.microbiology.pl/pjm
EDITORIAL OFFICE
EDITOR IN CHIEF:
Miros³awa W³odarczyk
EDITORS:
Ryszard Chróst
Hanna Dahm
Jaros³aw Dziadek
Anna Skorupska
EDITORIAL SECRETARY: Anna Kraczkiewicz-Dowjat
POSTAL ADDRESS:
Polish Journal of Microbiology
Miecznikowa 1
02-096 Warsaw, POLAND
CONTACT:
Phone: (48) 22 5541318
Fax: (48) 22 5541402
E-mail: Editorial Office ([email protected])
Editor in Chief ([email protected])
EDITORIAL BOARD
President: Andrzej Piekarowicz (Warsaw, Poland)
Estera Dey (Lund, Sweden)
Waleria Hryniewicz (Warsaw, Poland)
El¿bieta K. Jagusztyn-Krynicka (Warsaw, Poland)
Donovan P. Kelly (Coventry, UK)
Józef Kur (Gdañsk, Poland)
Tadeusz Lachowicz (Wroc³aw, Poland)
Teresa Lagergård (Göteborg, Sweden)
Wanda Ma³ek (Lublin, Poland)
Zdzis³aw Markiewicz (Warsaw, Poland)
Gerhardt Pulverer (Cologne, Germany)
Geoffrey Schild (Potters, Bar, UK)
Wac³aw Szybalski (Madison, USA)
Torkel Wadstrom (Lund, Sweden)
Jadwiga Wild (Madison, USA)
PUBLISHER: POLISH SOCIETY OF MICROBIOLOGISTS
Published quarterly with the financial support of the Ministry of Science and Higher Education
SUBSCRIPTION:
For information for Polish subscribers contact Secretary of Polish Society of Microbiologists, Che³mska 30/34,
02-725 Warsaw, Poland; phone: (48) 22 8413367, fax: (48) 22 8412949, e-mail: [email protected]
For information for foreign subscribes contact “Ars Polona” – e-mail: [email protected];
phone: + 48 (22) 5098661-5 also www.arspolona.com.pl
Cover illustration: Activated sludge microorganisms (for details see K.B. Chipasa and K. Mêdrzycka, 2008,
Vol. 57, No 1, 59–70
Typesetting and print: Publishing House Letter Quality, 01-216 Warsaw, Brylowska 35/38
Circulation: 300
Polish Journal of Microbiology, founded in 1953 as Acta Microbiologica Polonica, is a broad-based international microbiological journal covering: general microbiology, bacterial physiology, molecular biology and
genetics, virology, clinical bacteriology, environmental microbiology and biotechnology.
Polish Journal of Microbiology publishes mainly original research articles including short communications, but also minireviews, book reviews and press releases. All the papers should be prepared according
to “Instruction to Authors” which is included in the first issue of every volume and also available at
www.microbiology.pl/pjm. The papers appear usually within 3 months after final acceptance.
Abstracts and full texts of the papers (as pdf-s) are available under www.microbiology.pl/pjm directly after the
printed version appears.
Polish Journal of Microbiology is currently covered by Science Citation Index Expanded (ISI) and
Journal Citation Reports (JCR)/Science Edition, Thomson Master Journals List, Biological Abstracts,
BIOSIS Previews, EMBASE/Excerpta Medica, Index Medicus/MEDLINE, Cambridge Scientific
Abstracts, SCOPUS, Index Copernicus.
Submissions of manuscripts in various areas of microbiology are very welcome.
After acceptance of the paper the copyrights are reserved to the Publisher. No part of the publication may be
reproduced in any form without prior written permission of the Publisher, Polish Society of Microbiologists.
Subscription information for Polish subscribers under [email protected], for foreign subscribers under
www.arspolona.com.pl or [email protected]
Advertising offer
The Editorial Office of the Polish Journal of Microbiology encourages our Readers to place advertisements in
our quarterly. Our journal reaches scientists working in various research and educational institutions and involved in different fields of microbiology.
We ensure rapid appearance of the ad.
Price of black and white ad on inside cover: half of page = 150 PLN, full page = 300 PLN
Price of ad inside an issue: half page = 75 PLN, full page 150 PLN.
Please send file with graphical layout directly to the editorial office
of the journal or contact us at [email protected].
The Editorial Office and Publisher do not take any responsibility for the contents of advertisement
and announcements.
ISSN - 1733-1331
Index - 35119