Fulltext - ETH E

DISS. ETH. Nr. 20380
Structural and Functional Characterization of
Interactions of Myotubularin-Related Proteins
A dissertation submitted to
ETH ZURICH
for degree of
Doctor of Science
presented by
Katharina Gegenschatz-Schmid
Master of Science UZH in Biology
Born Mai 07, 1980 in Vienna, Austria
Citizen of Vilters-Wangs, Vilters SG and Germany
accepted on the recommendation of
Prof. Dr. Ueli Suter, examiner
Prof. Dr. Kurt Ballmer-Hofer, co-examiner
Dr. Philipp Berger, co-examiner
2012
Table of Content
1 Table of Content
1
2
3
4
5
5.1
5.1.1
5.1.1.1
5.1.1.2
5.1.2
5.1.3
5.1.3.1
5.1.4
5.1.5
5.1.6
5.2
5.2.1
5.2.2
5.2.2.1
5.2.2.2
5.2.3
5.2.3.1
5.2.3.2
5.2.4
5.2.5
5.2.5.1
5.2.5.2
5.2.6
5.3
6
6.1
6.1.1
6.1.1.1
6.1.1.2
6.1.1.3
6.1.2
6.1.2.1
6.1.2.2
6.1.2.3
6.1.3
Table of Content ................................................................................... 1
Summary ............................................................................................... 4
Zusammenfassung .............................................................................. 6
Abbreviations ....................................................................................... 8
Introduction ........................................................................................ 10
The Myotubularin family ................................................................... 10
Myotubularins in human diseases .................................................. 11
MTM1 and X-linked myotubular myopathy ................................. 11
MTMR2 and SBF2 in CMT4B1 and CMT4B2 ............................ 12
Structural aspects of MTMR domains and their function ............... 13
MTMR-protein interactions............................................................. 16
MTMR-PDZ protein interactions................................................. 16
MTMR-MTMR interactions ............................................................. 17
Other MTMR-protein interactions................................................... 18
Function and localization ............................................................... 20
Endosomes, trafficking and effector proteins including MTMRs ...... 21
Overview: Endosomes, Rab GTPases and trafficking pathways ... 21
Phosphoinositides .......................................................................... 25
Structure and turnover ............................................................... 25
Recruitment and binding of PIs by specific domains .................. 27
Conversion of PI-3-P to PI-5-P ...................................................... 28
PI interacting effectors and their role ......................................... 28
PI metabolizing proteins and their function in cell biology .......... 31
PI metabolizing enzymes and the relevance of their correct
function in vivo ............................................................................... 34
Rab GTPases and their influence on transport .............................. 36
Rab5 to Rab7 conversion/switch................................................ 37
Rab GTPases and their influence on receptor trafficking ........... 37
Influence of Rabs and PIs on EGFR signaling and trafficking........ 39
Aim of the thesis .............................................................................. 43
Experimental Procedures .................................................................. 44
Screen for novel binding partners of MTMRs ................................... 44
Cloning........................................................................................... 44
GST-MTMR constructs for screening of the PDZ domain array . 44
Constructs for PDZ domain mapping of Sap97 .......................... 45
Cloning of pcDNA3.1 RGS-His Mtm1-∆PDZ .............................. 46
Protein expression ......................................................................... 46
Protein expression of GST-tagged MTMR C-termini
and His-tagged PDZ domains in E. coli ..................................... 46
Protein expression of His-tagged Mtmr2 and HA-tagged
SAP97 PDZ domains in Sf21 insect cells .................................. 47
Protein expression of Mtmr2/Sbf2 complex in Sf21 insect cells . 47
Protein purification ......................................................................... 47
1
Table of Content
6.1.3.1
6.1.3.2
6.1.3.3
6.1.3.4
6.1.4
6.1.5
6.1.6
6.1.7
6.1.7.1
6.1.7.2
6.1.7.3
6.1.7.4
6.1.8
6.2
6.2.1
6.2.1.1
6.2.1.2
6.2.2
6.2.3
6.2.4
6.2.5
6.2.6
6.2.7
6.2.7.1
6.2.7.2
6.2.7.3
6.2.8
6.2.8.1
6.2.8.2
7
7.1
7.1.1
7.1.2
7.1.3
7.1.4
7.1.4.1
7.1.4.2
Protein purification of GST-tagged MTMR C-termini.................. 47
Protein purification of His-tagged PDZ-domain proteins ............ 48
Protein purification of His-Mtmr2/HA-Sap97-PDZ1-2 complex .. 48
Protein purification of His-Mtmr2/CBP-Sbf2 complexes ............. 49
Protein crystallization ..................................................................... 49
Mass spectrometry ........................................................................ 50
Proteomic PDZ-domain array overlay with GST-tagged MTMRs... 50
Pulldown experiments .................................................................... 52
GST pulldown experiments ........................................................ 52
Immunoprecipitation of His-Mtm1 and Myc-Pdzk2 in
HEK293 cells ............................................................................. 52
Immunoprecipitation of Mtm1 and Pdzk2 in mouse tissues ....... 53
Identification of Sap97 PDZ domains interacting with Mtmr2 ..... 54
Cell culture and immunofluorescence microscopy ......................... 55
Characterization of Mtmr2/3-Pap complex ....................................... 56
Plasmids and cloning ..................................................................... 56
Plasmids for transient and stable expression in HEK293 cells .. 56
Plasmids for baculovirus-based insect cell expression .............. 57
Generation of stable cell lines and cell culture ............................... 57
Coimmunoprecipitation of Mtmr2 and 3-Pap from transiently
and stably transfected HEK293 cells ............................................. 58
Protein expression of Mtmr2 and 3-Pap in Sf21 insect cells .......... 58
Analytical protein purification of His-Mtmr2, Strep-3-Pap and
His-Mtmr2/Strep-3-Pap complex .................................................... 59
Multi-angle light scattering (MALS) measurements and mass
spectrometry analysis .................................................................... 60
Small-Angle X-ray Scattering (SAXS) ............................................ 60
SAXS analysis ........................................................................... 60
SAXS data analysis and evaluation ........................................... 61
Protein crystallization of His-3-Pap, Strep-3-Pap and
His-Mtmr2/Strep-3-Pap complex ................................................ 61
Immunofluorescence miscroscopy ................................................. 62
Immunostainings of Mtmr2/3-Pap cotransfected HEK293 cells
under steady-state and hypo-osmotic conditions ....................... 62
Immunostainings of EGF stimulated COS and HEK293 cells .... 63
Results ................................................................................................ 64
Identification of new PDZ binding partners ...................................... 64
Expression and purification of recombinant GST-tagged
MTMR C-term proteins .................................................................. 64
PDZ-domain array - Overlay results .............................................. 66
Verification of the PDZ array results by GST pulldown
experiments ................................................................................... 69
Characterization of Pdzk2 as binding partner of Mtm1 .................. 71
Pdzk2 coimmunoprecipitates with Mtm1 in HEK293 cells and
mouse tissues ............................................................................ 72
Colocalization of Mtm1 and Pdzk2 in COS-7 and HEK293 cells 73
2
Table of Content
7.1.4.3
7.2
7.2.1
7.2.2
7.3
7.3.1
7.3.2
7.3.3
7.3.3.1
7.3.3.2
7.3.4
7.3.5
8
8.1
8.2
8.2.1
8.2.2
8.2.3
8.2.4
9
9.1
10
11
11.1
11.2
12
13
Localization studies of Mtm1, Pdzk2 and the sodium
phosphate co-transporter NaPi-IIa in opossum kidney cells ...... 78
Structural analysis of MTMRs and MTMR-complexes ..................... 80
Structural analysis of the Mtmr2/Sap97 complex ........................... 80
Purification and analysis of Mtmr2/Sbf2 complex .......................... 82
Structural and functional characterization of Mtmr2, 3-Pap and
Mtmr2/3-Pap complex ...................................................................... 86
Characterization of the Mtmr2/3-Pap interaction in HEK293 cells . 86
Characterization of the purified Mtmr2/3-Pap complex .................. 87
Protein purification and structural analysis using SAXS ................ 89
Mtmr2 homodimer ...................................................................... 90
3-Pap monomer ......................................................................... 94
Localization of Mtmr2 and 3-Pap in HEK293 cells ....................... 100
Influence of Mtmr2, 3-Pap and Mtmr2/3-Pap complex on EGFR
trafficking in HEK293 cells ........................................................... 102
Discussion and Outlook .................................................................. 117
MTMRs interact with PDZ domain containing scaffolds ................. 117
Interactions between active and inactive MTMR members ............ 128
The Mtmr2/Sbf2 protein complex ................................................. 129
Structural characterization of Mtmr2 homodimer, 3-Pap
monomer and Mtmr2/3-Pap heterodimer ..................................... 130
Subcellular localization of Mtmr2, 3-Pap and EGFR under
resting and growth factor stimulated conditions ........................... 134
Future pharmacological aspects in CMT disease ........................ 141
Appendix ........................................................................................... 143
Remaining PDZ-domain array results ............................................ 143
References ........................................................................................ 150
Publications ...................................................................................... 179
List of publications ......................................................................... 179
Poster presentations ...................................................................... 179
Curriculum Vitae .............................................................................. 180
Acknowledgements ......................................................................... 182
3
Summary
2 Summary
The Myotubularin-Related Proteins (MTMRs) represent one of the largest and
most conserved subfamily of protein tyrosine/dual specificity phosphatase-like
phosphatases (PTPs). Out of the 14 family members identified in the human
genome, six family members contain substitutions in the phosphatase domain
rendering them catalytically inactive. Mutations in the catalytically active
members Myotubularin (MTM1) and Myotubularin-Related-Protein-2 (MTMR2)
are associated with the physiological distinct human diseases X-linked
myotubular myopathy (XLMTM), a recessive congenital muscle disorder, and
Charcot-Marie-Tooth disease Type 4B1 (CMT4B1), a hereditary demyelinating
neuropathy, respectively. Mutations in the inactive member MTMR13/SetBinding-Factor-2 (SBF2) cause CMT Type 4B2. It is still unclear how mutations in
MTM1 and MTMR2 or SBF2 can lead to such distinct human diseases.
In this work I followed two different approaches to elucidate the specificity of
MTMRs: (1) the identification of novel PDZ-domain containing proteins that
interact with MTMRs and (2) the structural and functional characterization of
complexes between active and inactive MTMRs. I identified Pdzk2 as specific
interaction partner of Mtm1. Pdzk2 is a PDZ-domain containing scaffold protein
composed of four PDZ domains which has been shown to interact through its
PDZ domains with ion channels, receptors, transporters and signaling molecules.
Thereby it regulates the transport activity and subcellular localization of
transporters and channels especially in kidney and intestine. The interaction of
Pdzk2 with Mtm1 represents a possible mechanism to modulate cell surface
expression of receptor/Pdzk2/Mtm1 complexes. Mtmr12/3-Pap is an inactive
phosphatase and it interacts like Sbf2 with Mtmr2. The characterization of
Mtmr2/3-Pap complex revealed that it exists as heterodimer, which is distinct to
the tetrameric Mtmr2/Sbf2 complex. Furthermore, we could show that under
hypo-osmotic conditions 3-Pap, in contrast to Sbf2, does not influence the
subcellular localization of Mtmr2. Based on these structural and functional
findings we suggest that the dead MTMR phosphatases can be classified into
4
Summary
two groups. Thereby, the differential combinations of the different classes of
inactive MTMRs with one specific active MTMR might have opposite effects on
membrane identity and receptor sorting. In addition, we observed that Mtmr2 and
3-Pap localized along the recycling axis (Rab5-Rab4-Rab11) and promoted
sorting of the EGF receptor (EGFR) to Rab11 positive recycling endosomes. We
propose that Mtmr2 phosphatase activity influences the local composition of
phosphoinositides at these membranes. This has the consequence that EGFR is
redirected into the recycling pathway and is subsequently not degraded.
5
Zusammenfassung
3 Zusammenfassung
Die Myotubularin-Related Proteine (MTMRs) bilden eine der grössten und am
stärksten
konservierten
Phosphatasen
(PTPs).
Familienmitgliedern
Unterfamilie
der
Protein
Phosphatase-ähnlichen
Von 14 im menschlichen Genom
tragen
sechs
inaktivierende
identifizierten
Substitutionen
in
der
Phosphatase-kodierenden Domäne. Mutationen in den katalytisch aktiven
Mitgliedern Myotubularin (MTM1) und Myotubularin-Related-Protein-2 (MTMR2)
werden mit den physiologisch unterschiedlichen menschlichen Krankheiten XChromosom gebundene myotubuläre Myopathie (XLMTM), eine erblich bedingte
rezessive Muskelkrankheit, und der Charcot-Marie-Tooth Krankheit Typ 4B1
(CMT4B1), eine vererbare demyelinisierende Neuropathie in Verbinding
gebracht. Mutationen im inaktiven Mitglied MTMR13/Set-Binding-Factor-2
(SBF2) lösen die Krankheit CMT Typ 4B2 aus. Es ist noch immer unklar wie
Mutationen in MTM1 und MTMR2 oder SBF2 zu zwei so unterschiedlichen
menschlichen Krankheiten führen können.
In dieser Arbeit verfolgte ich zwei verschiedene Ansätze um eine Spezifität unter
den MTMRs aufzudecken: (1) die Identifizierung von neuen PDZ-Domänen
enthaltenden Proteinen die mit MTMRs interagieren und (2) die strukturelle und
funktionale Charakterisierung von Komplexen zwischen aktiven und inaktiven
MTMRs. Ich identifizierte Pdzk2 als spezifischen Interaktionspartner von Mtm1.
Pdzk2 is ein PDZ-Domänen enthaltendes Verbindungsprotein, das aus vier PDZDomänen besteht und durch seine PDZ Domänen mit Ionenkanälen,
Rezeptoren, Transportern und Signalmolekülen interagiert. Dadurch reguliert es
die Transportaktivität und die subzelluläre Lokalisation der Transporter und
Kanäle speziell in der Niere und im Darm. Die Interaktion zwischen Pdzk2 und
Mtm1
zeigt
einen
möglichen
Mechanismus
zur
Regulierung
der
Zelloberflächenexpression von Rezeptor/Pdzk2/Mtm1 Protein-Komplexen auf.
Mtmr12/3-Pap ist wie Sbf2 eine inaktive Phosphatase, die mit Mtmr2 interagiert.
Die Charakterisierung des Mtmr2/3-Pap Komplexes zeigte, dass er als
Heterodimer
existiert,
der
sich
vom
6
tetrameren
Mtmr2/Sbf2
Komplex
Zusammenfassung
unterscheidet. Darüber hinaus konnten wir zeigen, dass 3-Pap unter hypoosmotischen Bedingungen, im Gegensatz zu Sbf2, die subzelluläre Lokalisation
von Mtmr2 nicht beeinflussen konnte. Basierend auf diesen Erkenntnissen,
schlagen wir eine Einteilung der toten MTMR Phosphatasen in zwei Gruppen
vor.
Unterschiedliche
Kombinationen
von
inaktiven
MTMRs
mit
einem
spezifischen aktiven MTMR könnten gegensätzliche Auswirkungen auf die
Membran-Identität
und
die
Rezeptor-Entsorgung
haben.
Ausserdem
beobachteten wir, dass Mtmr2 und 3-Pap entlang der Rezyklierungsachse
(Rab5-Rab4-Rab11) lokalisierten, was die Entsorgung vom EGF Rezeptor
(EGFR) in die Rab11 positiven Rezyklierungs-Endosomen förderte. Wir schlagen
vor, dass die Phosphatase-Aktivität von Mtmr2 die lokale Zusammensetzung von
Phosphoinositiden an diesen Membranen beeinflusst. Dies hat zur Folge, dass
EGFR in den Rezyklierungsweg umgelenkt wird und deshalb nicht abgebaut
wird.
7
Abbreviations
4 Abbreviations
3-PAP
3-Phosphatase Adapter Protein
CMT
Charcot-Marie-Tooth disease
CNS
Central Nervous System
EEA1
Early Endosome Antigen 1
EE
Early Endosome
EGF
Epidermal Growth Factor
EGFR
Epidermal Growth Factor Receptor
ESCRT
Endosomal Sorting Complexes Required for Transport
GST
Gluthatione-S-Transferase
HEK293
Human Embryonic Kidney 293 cells
HMSN
Hereditary Motor and Sensory Neuropathies
IB
Immunoblot
ILV
Intralumenal Vesicle
IP
Immunoprecipitation
LE
Late Endosome
MS
Mass Spectrometry
MT
Microtubule
MTM1
Myotubularin 1
MTMR2
Myotubularin-Related-Protein-2
MTMRs
Myotubularin-Related-Proteins
MVB
Multi-Vesicular Body
MWCO
Molecular Weight Cut-Off
NaPi-IIa
Na+- dependent inorganic Phosphate cotransporter type IIa
8
Abbreviations
NHERF
Na+/H+ Exchanger Regulatory Factor
OK
Opossum Kidney cells
PDZ
PSD-95, DLG1, ZO-1
PDZ-BD
PDZ-Binding Domain
PH
Pleckstrin Homology domain
PI
Phosphoinositide
PI3K
PI-3 Kinase
PNS
Peripheral Nervous System
PtdIns
Phosphatidylinositol
PTH
Parathyroid Hormone
PTP
Phosphatase-like Phosphatases
RE
Recycling Endosome
RTK
Receptor Tyrosine Kinase
SAP97
Synapse-Associated Protein 97
SAXS
Small-Angle X-ray Scattering
SBF2
Set-Binding-Factor-2
SNXs
Sorting Nexins
TGN
Trans-Golgi Network
VEGF
Vascular Endothelial Growth Factor
VEGFR2
Vascular Endothelial Growth Factors receptor-2
VPS
Vacuolar Protein Sorting
XLMTM
X-linked Myotubular Myopathy
9
Introduction
5 Introduction
5.1 The Myotubularin family
The Myotubularin-Related Proteins (MTMRs) represent one of the largest and
most conserved family of protein tyrosine/dual specificity phosphatase-like
phosphatases (PTPs). They are conserved from yeast to human (Wishart et al,
2002; Laporte et al, 2001). A hallmark of PTP domains is the Cys-X5-Arg motif,
comprising the catalytically essential residues. Interestingly, out of the 14 family
members identified in the human genome, six family members contain
substitutions in the cysteine and arginine residues, rendering them catalytically
inactive (Laporte et al, 2003). Inactive PTPs were found in vertebrates and
invertebrates but not in yeast (Robinson et al, 2006). Several studies have shown
that MTMRs do not only homodimerize with themselves, but also heterodimerize
with their active or inactive homologues (Schaletzky et al, 2003; Berger et al,
2003; Dang et al, 2004; Kim et al, 2003; Mochizuki et al, 2003; Nandurkar et al,
2003; Lorenzo et al, 2005). Although inactive MTMRs by themselves are “dead
phosphatases”, they can influence the enzymatic activity and the subcellular
localization of their binding partner by associating with an active family member
(Kim et al, 2003; Mochizuki et al, 2003; Nandurkar et al, 2003; Berger et al,
2006a) (Nandurkar et al, 2003). It has also been speculated that these inactive
phosphatases act as substrate traps protecting the substrate. Substrate-trapping
mutants for MTM1 and MTMR2 have been described, and the putative catalytic
acids were identified as Asp278 and Asp320, respectively (Blondeau et al, 2000).
Structural information of Mtmr2 however, revealed that Asp320 is completely
buried in the hydrophobic core of the protein and that its mutation to alanine
would disrupt the protein core, which speaks against the substrate-trapping
hypothesis (Begley et al, 2003). In addition to the phosphatase domain, all
Myotubularin-Related Proteins contain a phosphoinositide-binding PH-GRAM
(pleckstrin homology glucosyltransferases, Rab-like GTPase activators and
myotubuarins) domain and all MTMRs also contain a C-terminal coiled-coil motif.
Furthermore, individual family members contain a DENN (differentially expressed
10
Introduction
in neoplastic versus normal cells), a PH, a FYVE zinc-finger or a C-terminal PDZbinding motif. The phosphoinositides phosphoinositol-3-phosphate (PI-3-P) and
PI-3,5-P2 are the major enzymatic substrates of MTMRs (Blondeau et al, 2000;
Berger et al, 2002; Schaletzky et al, 2003). Both, PI-3-P and PI-3,5-P2 are mainly
localized on early and late endosomes and are key players in mediating vesicular
trafficking and membrane transport (Corvera et al, 1999; Odorizzi et al, 2000).
Three members of the myotubularin family have been associated with human
diseases (see also 5.1.1). Myotubularin (MTM1) is the founding member of the
family and was originally identified as the disease-causing gene in X-linked
myotubular myopathy (XLMTM) (Laporte, 1996). Myotubularin-Related-Protein-2
(MTMR2) and MTMR13/Set-Binding-Factor-2 (SBF2) are the disease causing
genes of Charcot-Marie-Tooth disease Type (CMT) 4B1 and 4B2, respectively
(Bolino, 2000; Azzedine et al, 2003; Senderek et al, 2003).
5.1.1 Myotubularins in human diseases
5.1.1.1 MTM1 and X-linked myotubular myopathy
X-linked myotubular myopathy (also known as centronuclear myopathy, CNM) is
a recessive congenital muscle disorder, where skeletal muscle development
and/or regeneration is impaired, leading to severe hypotonia and generalized
muscle weakness in newborn patients (reviewed in (Romero, 2010)). The nuclei
are abnormally localized to the center of the small rounded myofibers, making
muscle biopsies initially a valuable tool for detection of XLMTM. Pathological
hallmark of mild forms of XLMTM with late onset are necklace-fibers. Additionally
to the recessive form caused by mutations in the MTM1 gene (Laporte, 1996),
CNMs can also be caused by mutations in dynamin2 (DNM2) gene (Bitoun et al,
2005) and amphyphisin2 (BIN1) gene (Nicot et al, 2007). Mutations in DNM2
cause the classical autosomal CNM with mild, moderate or severe phenotype,
whereas mutations in BIN1 cause an autosomal recessive form with moderate to
severe phenotype. Interestingly, DNM2 mutations result also in CMT neuropathy
with intermediate or normal nerve conduction velocities (Bitoun et al, 2005;
Claeys et al, 2009; Fabrizi et al, 2007). Furthermore, MTM1, BIN1 and DNM2 are
11
Introduction
all essential for clathrin-mediated endocytosis (Dowling et al, 2008). Mtm1
knockout mice recapitulate the skeletal muscle phenotype of XLMTM patients:
generalized and progressive myopathy, with amyotrophy and accumulation of
central nuclei in skeletal muscle fibers (Buj-Bello et al, 2002b). Since muscle
differentiation occurred normally in Mtm1-deficient mice, a failure to maintain
muscle cell structure was suggested. It was also shown that Myotubularin
overexpression in muscle of mice induced the accumulation of packed
membrane saccules and presence of vacuoles that contained markers of
sarcolemma and T-tubules, suggesting Mtm1 to be involved in plasma
membrane homeostasis of myofibers (Buj-Bello et al, 2008). Also in mammalian
cells MTM1 overexpression lead to altered cell shape including plasma
membrane projections and ruffles (Laporte et al, 2002a; Kim et al, 2002).
5.1.1.2 MTMR2 and SBF2 in CMT4B1 and CMT4B2
Charcot-Marie-Tooth (CMT) disease comprises hereditary motor and sensory
neuropathies (HMSN) affecting myelinated axons of the peripheral nervous
system (Niemann et al, 2006; Berger et al, 2006b). CMT is characterized by
progressive distally accentuated muscle weakness and atrophy and can be
grouped into axonal and demyelinating forms. Axonal forms, including CMT2, are
characterized by a loss of myelinated axons resulting in a reduction of the
compound muscle action potential (CMAP) amplitude (Zuchner et al, 2006).
CMT4 subtypes B1 and B2 belong together with CMT1 and CMT3 to the
demyelinating forms, characterized and diagnosed by reduced nerve conduction
velocity caused by demyelination of axons. CMT4B1 and CMT4B2 are severe
demyelinating peripheral neuropathies caused by recessive mutations in MTMR2
(Bolino, 2000) and SBF2 (Azzedine et al, 2003). Both types share the CMT
disease typical features including a demyelinating neuropathy associated with
slowed nerve conduction and focally folded myelin sheaths (Previtali et al, 2007;
Quattrone et al, 1996). Generally the disease onset is in early infancy and
severeness proceeds with aging, why wheelchair is needed from late childhood
on. In some families early onset of glaucomas was associated with CMT4B2
(Azzedine et al, 2003; Senderek et al, 2003; Hirano et al, 2004). Similar to
12
Introduction
CMT4B1 patients, Mtmr2-deficient mice showed complex myelin infoldings and
outfoldings. However, signs of demyelination like thinly myelinated large caliber
axons or onion bulb formation were not detected (Bonneick et al, 2005). Mtmr2
mutant mice were also reported to show impaired spermatogenesis (Bolino et al,
2004). Sbf2-deficient mice developed peripheral neuropathy similar to CMT4B2
patients (Tersar et al, 2007; Robinson et al, 2008), but showed minor signs of
reduced nerve conduction velocity and no obvious evidence for primary
demyelination and remyelination (Tersar et al, 2007). No significant differences
were observed between the double deficient Mtmr2/Sbf2 mice and the Sbf2deficient animals (Tersar et al, 2007).
5.1.2 Structural aspects of MTMR domains and their function
All MTMRs have a main core in common, which is composed of a GRAM-PH
domain, a phosphatase and a coiled-coil motif (Figure 5-1). MTM1, MTMR2,
MTMR3, and MTMR6 were shown to dephosphorylate both PI-3,5-P2 and PI-3-P
at position D3 suggesting that this substrate specificity is common to all active
family members (Walker et al, 2001; Berger et al, 2002; Schaletzky et al, 2003).
The phosphatase domain is N-terminally flanked by a RID (Rac-induced
recruitment domain) and C-terminally by a SID (SET-interacting domain) motif
(Cui et al, 1998; Begley et al, 2003; Robinson et al, 2006). The RID domain was
proposed to be necessary for the recruitment of myotubularins (MTMR2, MTMR3
and MTMR9) to the plasma membrane (Laporte et al, 2002b; Laporte et al,
2002a) and to mediate protein interaction with neurofilament light chain (NF-L) in
the case of MTMR2 (Previtali et al, 2003). SBF1 interacts through its SID domain
with the SET-domain containing protein HRX, thereby modulating growth control
(Cui et al, 1998). The SID domain of MTM1 was shown to be important for
interaction with MTMR12/3-PAP, pointing towards a role in protein-protein
interaction (Nandurkar et al, 2003). The PH-GRAM domain was reported to be
essential in mediating membrane association by binding to phosphoinositides,
mainly to PI-3-P and PI-3,5-P2, which are also the major substrates of MTMRs
(Schaletzky et al, 2003; Berger et al, 2003; Tsujita et al, 2004; Lorenzo et al,
2005). Several studies have shown that the coiled-coil motifs of MTMRs enable
13
Introduction
homodimerization
and
heterodimerization
with
their
active
or
inactive
homologues (Schaletzky et al, 2003; Berger et al, 2003; Dang et al, 2004; Kim et
al, 2003; Mochizuki et al, 2003; Nandurkar et al, 2003; Lorenzo et al, 2005). The
coiled-coil motif of MTMR2 mediates homodimerization, and promotes thereby
indirectly membrane association and localization (Berger et al, 2003). Mutations
in the GRAM domain of MTM1 lead to XLMTM, underscoring the significance of
the GRAM domain for cellular function (de Gouyon et al, 1997; Laporte et al,
1998). Localization studies of MTMR4 with endosomal markers EEA1 and Hrs,
both FYVE (Fab1, YGL023, Vps27 and EEA1) domain containing proteins that
localize to endosomes through interactions with PI-3-P (Gaullier et al, 1998; Urbe
et al, 2000) showed clear colocalization (Lorenzo et al, 2006), suggesting a
function
in
endosomal
membrane
localization.
MTMR13/SBF2
and
MTMR5/SBF1 contain an N-terminal DENN (differentially expressed in normal
and neoplastic cells) domain. Several DENN domain proteins have been shown
to interact with Rab GTPases (Levivier et al, 2001), which are important effectors
of membrane trafficking. The DENN domains of SBF1 and SBF2 were reported
to have GEF activity toward Rab28 (Yoshimura et al, 2010), which in fact
interacts with the retromer and the ESCRT complex in the endosomal pathway
(Lumb et al, 2011). This provides potential function of the DENN domains of
MTMRs for vesicular trafficking and signaling processes. Loss of the dDENN
domain (one of three subdomains of the DENN domain) due to a mutation in
MTMR13/SBF2 resulted in CMT4B2 disease (Senderek et al, 2003). Additionally,
MTMR13/SBF2 contains a classical PI-3,4,5-P3 binding PH-domain (Berger et al,
2006a). In the case of MTMR5/SBF1 it was shown to have regulatory function on
cell growth (Firestein et al, 2001). PDZ domain binding motif (PDZ-BD) and
coiled-coil motif mediate both protein-protein interactions and are discussed in
more detail in chapter 5.1.3. The PDZ-BD is usually a short stretch of 3-7 amino
acids at the C-terminus recognizing PDZ-domain containing proteins.
14
Introduction
Figure 5-1: The Myotubularin family
Depicted is the phylogenetic tree of the Myotubularin-Related-proteins (MTMRs) and their
structural composition. All share a main core consistent of a GRAM-PH (blue), a phosphatase
(yellow), and a coiled-coil (orange) motif. MTM1, MTMR1, MTMR2, MTMR5 and MTMR13
harbour a carboxy-terminal PDZ binding motif (grey). In addition, MTMR3 and MTMR4 contain a
FYVE domain (red). MTMR5 and MTMR13 contain a supplemental amino-terminal DENN domain
(green), an uncharacterized region with no homology to other proteins (purple) and a C-terminal
PH domain (light yellow). Inactive phosphatase domains are crossed out. Figure adapted from
(Clague et al, 2005).
A crystal structure of MTMRs has only been solved of human MTMR2, whereas
MTMR2 structures in complex with PI-3-P and PI-3,5-P2 were proposed based on
deuterium-exchange mass spectrometry (DXMS) results (Begley et al, 2003;
Begley et al, 2006). Although the crystal structure has provided valuable new
insight including the structural information of the PH-GRAM and the phosphatase
domain as well as the phosphoinositide binding active site, the last C-terminal 57
amino acids, including the coiled-coil motif and the PDZ binding domain are
missing (see Figure 7-18). To fully understand, how homodimeric or
heterodimeric MTMR complexes are build and how complex formation can
influence substrate affinity and membrane association, a crystal structure of the
full length protein in complex would be needed.
15
Introduction
5.1.3 MTMR-protein interactions
5.1.3.1 MTMR-PDZ protein interactions
The name PDZ derives from the founding members: the postsynaptic density-95
(PSD-95/SAP90), Drososophila tumor suppressor protein discs-large-1 (DLG1,
also known as SAP97) and the epithelial tight junction protein zona occludens-1
(ZO-1). PDZ-domain containing proteins are scaffolding proteins that mediate
protein-protein interactions. They play an important role in the regulation,
clustering and formation of multimeric protein complexes including membrane
transporters and ion channels at surfaces and specific subcellular sites. In
scaffolding proteins they can occur in one or multiple copies. In general, the PDZ
domain containing proteins are localized to specific subcellular sites, such as
synapses; intercellular contact sites; or the apical, basal, or lateral cell surface
(reviewed in (Fanning et al, 1999)). PDZ domains are recognized by short Cterminal ~5-7 residue long peptide motifs or rarely by internal sequences,
structurally mimicking a terminus. To date, four types of PDZ recognition motifs
have been classified: class I (S/T-x-Φ), class II (Φ-x-Φ), class III (Ψ-x-Φ) and
class IV (D-x-V), where x is any amino acid, Φ is a hydrophobic residue (V, I, L,
A, G, W, C, M, F) and Ψ is a basic, hydrophilic residue (H, R, K) (Songyang et al,
1997). The C-terminal PDZ-BD motifs of MTM1 (-VQTHF), MTMR1 (-VHTSV),
MTMR2 (-VQTVV), MTMR5/SBF1 (-CLSDA) and MTMR13/SBF2 (-CISDA)
belong therefore to the class I motifs. Yet, only few PDZ-interactions with
myotubularins have been reported: MTMR1 and TIP-15 (Fabre et al, 2000),
Mtmr2 and Sap97/Dlg1 (Bolino et al, 2004; Bolis et al, 2005), Mtmr2 and
Psd-95/Sap90 (Lee et al, 2010). An interaction of Mtmr2 with Sap97 has been
reported to be essential for membrane homeostasis and cell junction integrity in
Schwann cells (Bolis et al, 2009) and interaction with PSD95/Sap90 to be
important for maintenance of excitatory synapses by modulating endosomal
trafficking (Lee et al, 2010). Furthermore, SAP97 was shown to interact with
minus-end directed actin motor myosin IV, suggesting a scenario in which
myosin VI is involved in the trafficking of vesicle-associated SAP97 and AMPA
receptor (Wu et al, 2002). Both, MTMRs and PDZ-domain containing proteins are
16
Introduction
essential players in membrane homeostasis, endosomal trafficking and sorting of
membrane proteins. But little is known about their action as complex on these
actions. The identification of novel PDZ-interacting proteins with MTMRs are
therefore of high interest.
5.1.4 MTMR-MTMR interactions
Up to now, several interactions between MTMR family members have been
reported through identification of coimmunoprecipitation and/or yeast-two hybridscreens (see Table 1 in (Lorenzo et al, 2006); simplified and updated here in
Table 5-1). Self-associations were described for the following proteins: MTM1
(Caldwell et al, 1991; Schaletzky et al, 2003; Lorenzo et al, 2006); MTMR2
(Berger et al, 2003); MTMR3 and MTMR4 (Lorenzo et al, 2006); MTMR6 (Zou et
al, 2009); MTMR9 (Zou et al, 2009), MTMR12 (Lorenzo et al, 2006) and
MTMR13 (Berger et al, 2006a). The only heteromeric interaction between two
active MTMRs has been reported between MTMR3 and MTMR4, which was
coiled-coil dependent (Lorenzo et al, 2006). Several heteromeric interactions
between active and inactive myotubularins have been characterized as follows:
the inactive MTMR12/3-PAP with the active phosphatase MTM1 or MTMR2
(Nandurkar et al, 2003); the active MTMR2 additionally interacts with the inactive
proteins MTMR5/SBF1 (Kim et al, 2003) and a MTMR2 homodimer forms a
coiled-coil dependent complex with a MTMR13/SBF2 homodimer (Berger et al,
2006a); inactive MTMR9/STYX interacts with the active proteins MTMR6 (Zou et
al, 2009), MTMR7 (Mochizuki et al, 2003) or MTMR8 (Lorenzo et al, 2006);
inactive MTMR10 with the active members MTM1 or MTMR2 (Lorenzo et al,
2006). Interestingly, heteromerization between active and inactive MTMRs
resulted in several changes: increased catalytic activity of the active member
(Kim et al, 2003; Nandurkar et al, 2003; Mochizuki et al, 2003; Berger et al,
2006a; Zou et al, 2009), relocalization of the protein complex to specific
subcellular sites (Nandurkar et al, 2003; Kim et al, 2003; Lorenzo et al, 2006) and
modified substrate specificity (Nandurkar et al, 2001). These specific interactions
between active and inactive MTMR family members seem to follow a general rule
17
Introduction
with functional significance. Furthermore, they suggest differential regulated
function upon tissue specific complex formation.
Table 5-1: Protein interactions within the MTMR family
Catalytically active MTMRs are represented with light blue background, and inactive members
with grey background. Self-associations are labeled with an asterisk. For references, consult
discussion above. n.d. = no data
MTMRs
MTM1
MTMR1
MTMR2
MTMR3
MTMR4
MTMR5/SBF1
MTMR6
MTMR7
MTMR8
MTMR9/STYX
MTMR10
MTMR11
MTMR12/3-PAP
MTMR13/SBF2
Interacting MTMR
MTM1*, MTMR12/3-PAP, MTMR10
n.d
MTMR2*, MTMR5/SBF1, MTMR12/3-PAP, MTMR13/SBF2, MTMR10
MTMR3*, MTMR4
MTMR4*, MTMR3
MTMR2
MTMR6*, MTMR9/STYX
MTMR9
MTMR8*, MTMR9/STYX
MTMR9/STYX*, MTMR6, MTMR7, MTMR8
MTM1, MTMR2
n.d
MTMR12/3-PAP*, MTM1, MTMR2
MTMR13/SBF2*, MTMR2
5.1.5 Other MTMR-protein interactions
Myotubularin-related-proteins and MTMR-interacting proteins are involved in a
variety of CMT forms and myopathies. Yeast two-hybrid screenings revealed that
MTMR2 interacts with the class IV intermediate filament (IF) neurofilament light
chain (NF-L) in Schwann cells and neurons (Previtali et al, 2003). Neurofilaments
are formed by a trimeric complex composed of NF-L, NF medium chain (NF-M)
and NF heavy chain (NF-H), whereby NF-L functions as scaffolding protein
(Ching et al, 1993; Lee et al, 1993). Mice lacking either NF-L, NF-M, NF-H or
both NF-M and NF-H lost up to 20% of their motor axons and were subjected to
disturbances in axonal maturation (reviewed in (Lariviere et al, 2004)). These
findings were interesting as such, that mutations in NF-L gene are associated
with the dominant axonal CMT type 2E and dominant demyelinating CMT type
1F form (Perez-Olle et al, 2005), supporting the nerve-specific pathogenesis of
CMT4B1. Recently, also the class III intermediate filament proteins vimentin,
GFAP, desmin and peripherin as well as the class V IF lamin A were identified as
MTMR2 interactors (Tersar, 2008). Besides Mtmr2, MTM1 was also reported to
interact with desmin and was shown to regulate desmin cytoskeleton and
mitochondria homeostasis in skeletal muscle (Hnia et al, 2011). Mutations in
18
Introduction
Desmin cause myopathies in skeletal and cardiac muscle (Paulin et al, 2004;
Schroder et al, 2007). Cardiac involvement however, is not a common sign of
adult XLMTM patients (Herman et al, 1999). This is supported by the finding that
in cardiac muscles of mice no interaction between Mtm1 and desmin was
observed and colocalization was rather weak (Hnia et al, 2011). Nevertheless, it
is intriguing that alterations of MTM1 or desmin affect skeletal muscles, whereas
alterations of MTMR2 and NF-L specifically affect peripheral neurons and
Schwann cells. MTMR2 also functionally interacts with the phospholipid
phosphatase FIG4/SAC3 in both Schwann cells and neurons (Vaccari et al,
2011). Mutation of FIG4 in human and mice is involved in autosomal recessive
demyelinating CMT type 4J and a subset of patients present a late-onset
phenotype that resembles amyotrophic lateral sclerosis (ALS) (Chow et al, 2007;
Zhang et al, 2008). Furthermore, Fig4 deficiency in mice affects motor neurons
differently from sensory neurons by mechanisms involving excessive retention of
molecules in lysosomes or disruption of vacuolated organelles (Katona et al,
2011). MTMR4 was shown to interact with the ubiquitin ligase Nedd4, which was
associated with skeletal muscle atrophy (Koncarevic et al, 2007). It becomes
very clear that MTMRs and their interaction partners build a complex network of
proteins with cell relevant functions in intracellular trafficking and are key
regulators in the peripheral nervous system (Berger et al, 2006b; Suter, 2007).
Surprisingly, MTMR phosphatases were also found in complex with kinases. In
testis, MTMR2 interacts with the nonreceptor protein tyrosine kinase c-Src and
together they regulate Sertoli-germ cell adherens junction dynamics (Zhang et al,
2005). In mammalian cells, both MTM1 and MTMR2 were reported to interact
with the lipid kinase complex hVps15/hVps34 on endosomes, thereby modulating
Rab5-Rab7 dependent endosome maturation (Cao et al, 2007; Cao et al, 2008;
Poteryaev et al, 2010) (see also 5.2.5.1). Receptor mediated endocytosis 8
(RME-8), another protein interacting with MTMR2, was just recently identified as
a novel PI-3-P binding protein, whose localization is regulated by MTMR2
(Xhabija et al, 2011). Another interaction with MTMR4 was found for
phosphorylated R-Smads. MTMR4 dependent dephosphorylation of R-Smads,
19
Introduction
reduced R-Smad translocation to the nucleus and resulted in preventing
overactivation of TGFβ signaling (Yu et al, 2010).
5.1.6 Function and localization
One of the most intriguing questions in the field of disease relevant MTMRs is:
Although MTMRs share substrate specificity, high sequence homology and are
ubiquitously expressed, how does it come that MTMRs are not redundant and
have unique functions within cells? How comes that MTM1 and MTMR2
mutations lead to two human diseases affecting different cell types? One
possible mechanism for this could be the differential interaction with proteins like
PDZ-domain containing proteins, inactive MTMRs or other proteins. Dependent
on the interaction not only the place of action could be altered but also the
catalytical activity. Active MTMRs dephosphorylate both PI-3,5-P2 and PI-3-P at
position D3 of the inositol ring to PI-5-P and phosphatidylinositol (PtdIns),
respectively. Thereby, they regulate specific pools of PI-3-P and/or PI-3,5-P2,
which in turn are anchor sites on membranes for effector proteins of early and
late phases of the endocytic process. Besides the function of MTMRs in cell
shape and plasma membrane homeostasis (see 5.1.1.1), they have also been
shown to regulate receptor sorting. Overexpression of both MTMR2 and MTM1
resulted in blocked degradation of epidermal growth factor receptor (EGFR)
(Tsujita et al, 2004; Berger et al, 2009). Furthermore, Berger et al. could show
that the adaptor unit MTMR13/SBF2 could counteract this effect, without
affecting prolonged Akt activation. Since PI-3-P and/or PI-3,5-P2 levels interfere
with the maturation of endosomes, their reduction might explain the observed
block of EGFR degradation. PI-3-P is synthesized by the PI3 kinase Vps34 on
early endosomes and displays a recruitment site for FYVE-domain containing
Rab5 effectors such as EEA1 and Hrs (Simonsen et al, 1998; Christoforidis et al,
1999; Gaullier et al, 1998). PI-3,5-P2 is generated from PI-3-P by PIKfyve, which
was found to localize to late endosomes (Sbrissa et al, 2002). Effector proteins
binding PI-3,5-P2 were reported for sorting nexins (SNXs), Vps24 and Svp1p
(Whitley et al, 2003; Dove et al, 2004; Seet et al, 2006). Interestingly, by
inhibiting the PI3 kinase with wortmannin, endocytosed EGFR failed to reach late
20
Introduction
endosomes and was trapped in early/recycling endosomes (Petiot et al, 2003).
Additionally they suggested that PI-3-P signaling controls the sorting of receptor
in early endosomes presumably by Hrs. Also knockdown of Vps24 or
overexpression of dominant-negative forms of Vps24 blocked EGFR degradation
(Yan et al, 2005; Bache et al, 2006).
5.2 Endosomes, trafficking and effector proteins including
MTMRs
5.2.1 Overview: Endosomes, Rab GTPases and trafficking pathways
Endocytosis and membrane trafficking between organelles is essential for protein
and membrane homeostasis of the cell and is summarized in Figure 5-2. Here
we focus on the internalization of plasma membrane receptors and their
subsequent sorting. Dependent on signaling and effector molecules at the
endocytic compartments the fate of the internalized receptors can vary: (1) as
part of the signaling process; (2) recycling back to the plasma membrane for
continuous action; (3) propagation to the lysosome for degradation. Large
particles like cell debris and fluids usually enter the cell by phagocytosis and
macropinocytosis, respectively. Other material including membrane receptors are
taken up in clathrin- or caveolin-coated vesicles or tubular structures, which are
also known as clathrin- and dynamin-independent carriers (CLICs), which include
GEEC-, and ARF6-dependent pathways (Mayor et al, 2007). All internalized
protein first converges at the apical early endosomes (EEs), which are
characterized by several markers, such as PI-3-P, EEA1, PI-3 kinase Vps34 and
small Rab GTPase Rab5 (Christoforidis et al, 1999; Zerial et al, 2001; Behnia et
al, 2005). PI-3-P, Rab5 and their binding effector proteins play an important role
in endosome maturation, which includes Rab5 to Rab7 and PI-3-P to PI-3,5-P2
conversion (Rink et al, 2005; Poteryaev et al, 2010). The structure of individual
EEs with tubular and vacuolar domains is heterogeneous. Inward vesiculation to
form intralumenal vesicles (ILVs) happens already at the stage of EEs and is an
important process during late endosome (LE) and lysosome maturation.
21
Introduction
Activated, internalized membrane receptors are still able to signal, as long as
their C-terminal tail is facing the cytosolic phase. One essential step to inactivate
these signaling receptors is their ubiquitination and subsequent removement
from the endocytic membranes by inclusion into ILVs (Raiborg et al, 2002).
Recruitment of ubiquitinated cargo to EEs is regulated by the ubiquitin interacting
motifs on hepatocyte growth factor-regulated tyrosine kinase substrate (Hrs) and
components of the endosomal sorting complexes required for transport (ESCRT)
complex (Slagsvold et al, 2006). ILVs follow together with the cargo destined for
degradation the degradative pathway: from early endosomes (EEs) through late
endosomes (LEs) to endolysosomes/lysosomes, whereby the endosomes move
towards the perinuclear space along microtubules (MT). The fusion of LEs with
lysosomes is unidirectional, whereby endolysosomes are generated, in which the
actual degradation is taking place (Luzio et al, 2007). Retrograde transport
between endosomes and trans-Golgi network (TGN) occurs between all levels of
endocytic pathway and is essential for the supply of lysosomal and removal of
endosomal components. Thereby, the retromer, an oligomeric protein complex,
as well as the small GTPases Rab7 and Rab9 are important regulators (van
Weering et al, 2011). The retromer is composed of the trimeric vacuolar protein
sorting (Vps) subcomplex (Vps26,-29,-35) and heterodimeric phosphoinositide
and receptor binding sorting nexins (SNXs, SNX1 and SNX2 or SNX5 and SNX6)
(McGough et al, 2011). From the TGN cargo is sorted through Rab8 vesicles
either directly to the plasma membrane or indirectly through the recycling
endosome (RE) (De Matteis et al, 2008; Cramm-Behrens et al, 2008).
Endocytosed protein, which has arrived in EEs has been initially proposed to
escape the degradative pathway by recycling back to the plasma membrane in
two different ways (Maxfield et al, 2004): via the Rab11 dependent trafficking
through the RE (also known as slow recycling); or by leaving the EE directly in
Rab4 vesicles (fast recycling). Thereby, membrane proteins such as the
transferrin receptor (TfR) are sorted away from soluble proteins via the formation
and fission of Rab11 positive narrow tubules from the EE to the RE. This is
regulated by a subset of proteins including SNX4, which has been reported to
22
Introduction
coordinate the long-range translocation by binding to the minus end-directed
microtubule motor dynein (Shinozaki-Narikawa et al, 2006; Traer et al, 2007;
Cullen, 2008).
23
Introduction
24
Introduction
Figure 5-2: Overview of vesicle transport - from recycling to degradation
Material is transported to EEs in clathrin- or caveolin-coated vesicles or in clathrin- and dynaminindependent carriers (CLICs), including GEEC- and ARF6-dependent pathways. Rab5 vesicles
fuse with the early endosomes (EEs), where the endocytosed cargo accumulates before sorting.
The structure of EEs is characterized by tubular and vacuolar domains with few intralumenal
vesicles (ILVs). Hallmarks of EEs on the protein level are the small GTPases Rab5 and Rab4, the
PI3 kinase Vps34, its product PI-3-P and PI-3-P effector proteins like EEA1. From the EE the
internalized cargo, including membrane proteins, is either sorted for degradation to lysosomes or
recycled back to the plasma membrane. By entering the degradative pathway, the endosomes
are converted from EEs to late endosomes (LEs) and fuse with lysosomes to form endolysosmes.
Thereby, the vesicles are moving towards the perinuclear space along microtubules (MT) and
undergo structural changes ranging from growing in size by continuous inward vesiculation to
changes in protein components. Typical hallmarks for LE maturation is the Rab5-Rab7 switch, as
well as the conversion of PI-3-P to PI-3,5-P2 with the subsequent effector proteins such as the
ESCRT machinery. During LE maturation membrane proteins still can escape the degradative
pathway by retrograde transport through the trans-Golgi network (TGN). PI-4-P is localized at the
TGN. The retrograde transport to the TGN is regulated by the SNX-Bar retromer, typically
composed of SNX1/2, SNX5/6 and Vps26, Vps29 and Vps35. Through Rab8 vesicles cargo is
sorted from the TGN to the recycling endosome (RE), which is characterized by Rab11. Via
Rab11/FIP2/myosinVb protein complex, Rab11 vesicles can move along the actin skeleton back
to the plasma membrane. Recycling from EEs can be divided into “slow” and “fast” and proceeds
in a sequence-dependent manner. The slow recycling involves formation and fission of Rab11
positive narrow tubules from the EE to the RE. Sequence-dependent recycling involves
membrane proteins with a PDZ-binding motif, PDZ domain containing proteins such as GIPC or
ERM proteins, and the transition along actin-stabilized recycling tubules positive for Rab4 and
Rab11.
5.2.2 Phosphoinositides
5.2.2.1 Structure and turnover
Phosphoinositides (PIs) are essential components of eukaryotic cell membranes
and regulate fundamental biological processes including cell growth, survival,
membrane trafficking and cytoskeletal dynamics (Roth, 2004; Lemmon, 2008).
Phosphatidylinositol (PtdIns) belongs to the glycerophospholipids and is
composed of two fatty acid tails, which anchor the molecule into cellular
membranes and are linked through a glycerol backbone and an inorganic
phosphate to the polar inositol head group (Figure 5-3, A). PtdIns is the most
abundant PI in mammalian cells (~15% of total phospholipids found in eukaryotic
cells) (Di et al, 2006). Phosphorylated products of phosphatidylinositol are called
phosphoinositides and are less abundant (by one order of magnitude).
Reversible phosphorylation of the inositol ring at position D3, D4 or D5 generates
seven
possible
phosphoinositides,
which
are
enriched
on
subcellular
compartments and serve as docking sites for signaling effectors (Roth, 2004; Di
et al, 2006). PI-4,5-P2 (often called PIP2) and PI-3,4,5-P3 (also known as PIP3)
25
Introduction
are both formed and localized to the plasma membrane (see Figure 5-2).
PI-4,5-P2 is the principal substrate of receptor-stimulated phospholipase C and
comprises only about 1% of total phospholipids in the whole cell (Falkenburger et
al, 2010). PI-4-P was mainly found at the TGN. Because of continuous sequential
phosphorylation/dephosphorylation
reactions
by
specific
kinases
and
phosphatases, PtdIns, PI-4,5-P2 and PI-4-P are kept in a steady-state level in the
cell membrane. PI-3-P and PI-3,5-P2 are concentrated on early and late
endosomes, respectively. PI-3-P is constitutively present at low but rather stable
levels,
whereas
PI-3,5-P2
and
PI-5-P
levels
can
increase
upon
cell
stress/activation (Dove, 1997; Zonia et al, 2004; Sbrissa et al, 2005).
Interconversions between different PIs are regulated by PI kinases and
phosphatases, leading to temporal and spatial regulation of membrane budding,
motility and fusion. The importance of the different PI levels and their catalyzing
enzymes is supported by the occurrence of various human diseases generated
by mutations in these metabolizing enzymes (Vicinanza et al, 2008; Nicot et al,
2008; Liu et al, 2010) (see Figure 5-3, B; modified from (Vicinanza et al, 2008)).
26
Introduction
Figure 5-3: Phosphoinositide metabolism and their relevance in human health
(A) Phosphatidylinositol backbone with the possible phosphorylation sites D3, D4 and D5 at the
inositol ring. (B) Interconversion scheme with phosphatidylinositol and the seven possible
phosphoinositides, catalyzed by phosphatases and kinases. Enzymes associated with human
diseases are highlighted in red and labeled from 1-13. Affected genes (in italic) and
corresponding diseases are listed in the legend below. For references see Vicinanza et al., 2008,
from which this graph was modified.
5.2.2.2 Recruitment and binding of PIs by specific domains
Phosphoinositides are bound to effector proteins, whereby individual effector
proteins can interact with several PIs (Kutateladze, 2010). Up to date 12 PIbinding modules have been identified: (1) pleckstrin homology (PH) domain, (2)
AP180 N-terminal homology (ANTH) domain, (3) conserved region-2 of protein
kinase C (C2) domain, (4) epsin N-terminal homology (ENTH), (5) 4.1, ezrin,
radixin, moiesin (FERM) domain, (6) Fab1, YOTB, Vac1 and EEA1 (FYVE)
domain, (7) Golgi phosphoprotein 3 (GOLPH3) domain, (8) PDZ domains,
(9) β-propellers that bind PIs (PROPPINs) domain, (10) phosphotyrosine binding
(PTB) domain, (11) Phox homology (PX) domain and (12) Tubby modules
(Figure 5-4, adapted from Kutateladze, 2010). FYVE domain-containing proteins
recognize PI-3-P with high specificity and affinity and are characterized by a zincbinding finger (Gaullier et al, 1998). They are involved in the regulation of
endocytic trafficking, fusion of endosomal membranes and maturation of late
endosomes including formation of MVBs (Gillooly et al, 2001). PX domains were
initially found to bind PI-3-P. Thereby, SNXs represent the largest group of PX
domain-containing proteins (Seet et al, 2006). They are involved in endosomal
sorting and recycling, in internalization and in membrane tubulation (see 5.2.1).
Less than 10% of all identified PH domains bind PIs with high affinity, such as
PI-4,5-P2, PI-3,4-P2 and PI-3,4,5-P3 (Lemmon, 2007). PH-domain containing
proteins were associated not only with membrane budding and trafficking, but
also with essential processes such as cell growth, proliferation, migration and
metabolism. PH, PTB and PDZ domain structures are markedly similar and share
a structural core consisting of several antiparallel β strands and an α-helix (Doyle
et al, 1996; Balla, 2005).
27
Introduction
Figure 5-4: Phosphoinositide recognizing effectors
Signaling domains and their predominant target PIs. Adapted from (Kutateladze, 2010).
5.2.3 Conversion of PI-3-P to PI-5-P
5.2.3.1 PI interacting effectors and their role
PI-3-P and PI-3,5-P2, as well as their catalyzing enzymes, play an important role
in endosome identity, maturation and trafficking between plasma membrane,
Golgi and lysosome (Odorizzi et al, 2000). PI-3 kinase complex Vps34/p150 is
recruited to EEs by binding to Rab5 and generates PI-3-P from PtdIns (Schu,
1993; Christoforidis et al, 1999). As soon as PI-3-P is synthesized, it attracts
various effector proteins. Recruitment of early endosome antigen 1 (EEA1) in
concert with SNARE proteins promotes vesicle fusion and endocytosis
(Simonsen et al, 1998; Lawe et al, 2000). The ESCRT complexes I and II bind
PI-3-P through Vps27 and Vps36, respectively (Katzmann et al, 2003; Teo et al,
2006). Thereby, the ESCRT machinery regulates MVB formation and sorting of
ubiquitinated cargo. Hrs of the ESCRT-0 complex is recruited to EEs and MVBs
by Rab5 and PI-3-P, where it controls receptor sorting and internalization within
the MVBs (Lloyd et al, 2002; Raiborg et al, 2002; Raiborg et al, 2001). PIKfyve is
a PI 5 kinase which converts PI-3-P into PI-3,5-P2 and is implicated in
membrane homeostasis, MVB/ILV formation and endosome maturation (Nicot et
al, 2006). The PX-domain containing SNXs, which have been shown to modulate
endosome-to-TGN trafficking, interact with PI-3-P, PI-3,5-P2 and/or PI-5-P. These
include SNX3 or the SNX-Bar retromer components SNX1/2 and SNX5/6 (Cozier
et al, 2002; Carlton et al, 2005; Wassmer et al, 2007; Wassmer et al, 2009;
28
Introduction
Harterink et al, 2011). Besides MVB formation, Hrs is involved in Smad signaling
through cooperation with Smad anchor for receptor activation (SARA), another
FYVE-domain containing PI-3-P binding protein (Miura et al, 2000). Furthermore,
SARA has been shown to regulate TGF-β/Smad signaling (Itoh et al, 2002),
whereas MTMR4 was reported to act as a negative regulator of TGF-β/Smad
signaling (Yu et al, 2010). Autophagy-linked FYVE protein (Alfy), another PI-3-P
binding FYVE domain-containing protein, was found to colocalize with
autophagic membranes and was suggested to target cytosolic protein
aggregates for autophagic degradation (Simonsen et al, 2004). Interestingly, also
the PI-3-P producing kinase Vps34 and the phosphatase MTMR3 were both
associated with autophagy (Matsunaga et al, 2009; Taguchi-Atarashi et al, 2010).
Overall, PI-3-P level and its effectors regulate cellular functions covering
endocytic membrane traffic, autophagy, degradative pathway, recycling through
retrograde endosome-to-TGN transport and receptor signaling (Figure 5-5).
PI-3,5-P2 is substrate for FIG4 and MTMRs (MTM1, MTMR2), which generate
PI-3-P and PI-5-P, respectively. Effectors of PI-3,5-P2 were mostly identified and
characterized in yeast. Atg18p/Svp18p, a member of the PROPPIN family (for
β-propeller(s) that bind(s) PPIn), binds PI-3,5-P2 with high affinity and
participates in retrograde membrane traffic from the vacuole in yeast (Dove et al,
2004). The epsin-like proteins Ent3p and Ent5p as well as the ESCRT-III
component Vps24 and the ESCRT-II component Vps36 bind to PI-3,5-P2 and
were associated with MVB sorting (Whitley et al, 2003; Friant et al, 2003; Eugster
et al, 2004; Teo et al, 2006). Functional MVB formation has been reported to be
required for successful envelopment/egress of the following virus infections:
herpes simplex virus (HSV), non-enveloped picornavirus echovirus 1 (EV1), old
world arenavirus Lassa virus (LASV) (Calistri et al, 2007; Karjalainen et al, 2011;
Pasqual et al, 2011). Furthermore, the entry of LASV into the cell was reported to
be dependent on PI-3-P and PI3K activity. Given that MVB membranes serve as
platforms for viral envelopment/egress, thereby representing a critical step in viral
infection, MVB involved factors like Vps24 may represent putative drug targets to
treat viral infections. A recent publication showed that PI-3,5-P2 activates the
29
Introduction
endolysosomal calcium channel TRPML1 by directly interacting with the latter
(Dong et al, 2010). Furthermore, they proposed that TRPMLs regulate
membrane trafficking by transducing information regarding PI-3,5-P2 levels into
changes in juxtaorganellar Ca2+, thereby triggering membrane fusion/fission
events. In summary, PI-3,5-P2 as well as its binding effectors are mainly involved
MVB/ILV formation including subsequent cargo degradation and LE maturation.
In mammals, PI-5-P is produced from PI-3,5-P2 by active MTMRs (Tronchere et
al, 2004). In Shigella flexneri infected mammalian cells the phosphatase IpgD
takes over this part, whereby it uses PI-4,5-P2 as substrate (Rameh et al, 1997).
Injection of IpgD by S. flexneri into the host cell leads to reorganization of the
host cell membrane morphology and promotes the uptake of the bacterium into
the host (Niebuhr, 2002). Interestingly, IpgD infection leads to EGFR activation
which is required for PI-5-P induced Akt activation (Ramel et al, 2009; Ramel et
al, 2011). Furthermore, they analyzed the impact of PI-5-P on endosome
formation and EGFR trafficking in HeLa cells. Thereby they revealed that PI-5-P
increased the numbers of EEs with activated EGFR, prolonged EGFR signaling
and blocked general vesicular transport from early to late endosomes (Ramel et
al, 2011). These findings are interesting as such that overexpression of MTMR2
also resulted in sustained Akt activation and blocked EGFR degradation.
Furthermore, overexpression of Sbf2 could counteract the blocked EGFR
degradation (Berger et al, 2009). The PX domain of SNX5 specifically binds to
PI-3,5-P2, PI-4-P and PI-5-P, but not PI-3-P as SNX1 does (Liu et al, 2006). Few
effectors of PI-5-P have been lately identified: the plant homeodomain (PHD)
finger of inhibitor of growth protein-2 (ING2), a candidate tumor suppressor
protein (Gozani et al, 2003); the PH-domain containing downstream of tyrosine
kinase (Dok) proteins Dok-1 and Dok-2, which are involved in T-cell homeostasis
maintenance (Guittard et al, 2009); PX domain of phospholipase D1 (PLD1),
which is also an effector of PI-3-P and is involved in macroautophagy and amino
acid sensing (Du et al, 2003; Dall'Armi et al, 2010; Yoon et al, 2011); Nox
organizing protein 1 (NOXO1), which is involved in NADPH oxidase regulation
30
Introduction
(Cheng et al, 2004). All together, the collected data point to a function of PI-5-P
in recycling and signaling.
Figure 5-5: Conversion of PI-3-P to PI-5-P and PI effectors
Phosphoinositide binding effectors are encircled and colored corresponding to their cellular
function in endocytosis (brown), retrograde transport (petrol), MVB formation and trafficking
(green), autophagy (orange) and signaling (yellow). PLD1 binds PI-3-P and PI-5-P, the function in
autophagy however has been shown in relation to PI-3-P. The unknown function of PLD1 with
respect to PI-5-P is depicted in grey. PI metabolizing enzymes are represented in red.
5.2.3.2 PI metabolizing proteins and their function in cell biology
In mammalian cells three classes of PI-3 kinases (PI3Ks) exist. They
phosphorylate phosphatidylinositol or phosphoinositides at the D3 position of the
inositol ring, thereby generating PI-3-P, PI-3,4-P2, PI-3,4,5-P3 or PI-3,5-P2.
Class I PI3K subtype IA is activated by receptor tyrosine kinases (RTKs) and
subtype IB by G-protein coupled receptors (GPCRs). Especially kinases of the
subtype IA were associated with oncogenesis. The generation of PI-3,4,5-P3
from PI-4,5-P2 leads to the activation of downstream pathways that involve AKT
and PTEN. The oncogene AKT encodes a serine/threonine kinase that triggers a
cascade of responses including cell growth, proliferation, survival and motility, all
driving tumour progression (Vivanco et al, 2002). In contrast, PTEN encodes a
phosphatase which converts PI-3,4,5-P3 back to PI-4,5-P2 and therefore acquires
31
Introduction
tumour-suppressor function. PI-3 kinase/AKT pathway is dysregulated in a
variety of human cancers, including breast, colon, ovarian, pancreatic, lymphoid
and prostate cancers. Class II PI3K enzymes include PI3K-C2α, PI3K-C2β, and
PI3K-C2γ, which use PtdIns as substrate to produce PI-3-P and PI-3,4-P2 and
are characterized by a PX and C2 domain. In COS-1 cells the PX and the C2
domain of PI3K-C2α were shown to mediate binding to lipid membranes of the
TGN and clathrin-coated vesicles (Domin et al, 2000). Although some reports
point to a activation by external stimuli similarly to class I PI3Ks, there is still
relatively little understanding of their role in cellular function (Falasca et al, 2007).
The first PI3K coding gene Vps34 was found in Saccharomyces cerevisiae and
was characterized to be required for vacuolar protein sorting and vacuole
segregation (Herman et al, 1990; Schu, 1993). Vps34 is the sole PI3K that
produces only PI-3-P from PtdIns in vivo and was therefore classified as PI3K
class III. The human homologue hVps34/PIK3C3 is regulated by Vps15/p150 and
localizes to EEs by binding to Rab5 (Schu, 1993; Stack et al, 1995; Christoforidis
et al, 1999). Together, they are part of two distinct multimeric protein complexes:
complex I (hVps34/PIK3C3, Vps15/p150, Beclin1, and Atg14L) which activates
autophagy
and
complex II
(hVps34/PIK3C3,
Vps15/p150,
Beclin1,
and
UVRAG/Vps38) which regulates trafficking at late endosomes (Simonsen et al,
2001; Lindmo et al, 2006; Backer, 2008; Itakura et al, 2008). PI-3-P is also
recognized by the FYVE domain of PIKfyve, a kinase that phosphorylates PI-3-P
at position D5 to form PI-3,5-P2 (Sbrissa et al, 1999). Overexpression of a
dominant-negative form which is unable to synthesize PI-3,5-P2 (PIKfyveK1999E) induces endomembrane swelling and vacuolation (Ikonomov et al,
2001). Swollen vacuoles were also observed in yeast, when fab1, the yeast
orthologue of PIKfyve was deleted (Yamamoto et al, 1995). PI-3,5-P2 contributes
less than 0.1% of the total phosphoinositide pool but it is transiently upregulated
under hypo-osmotic conditions in COS cells, in T-lymphocytes upon stimulation
with interleukin-2, or in COS cells upon stimulation with EGF (Dove, 1997; Jones
et al, 1999; Tsujita et al, 2004). Initially, it has been shown that mouse PIKfyve
associates with late endosomes in mammalian cells (Shisheva et al, 2001).
32
Introduction
Human PIKfyve localizes to vesicles which are positive for early endosomal
markers like EEA1 and Hrs. PIKfyve localizes on these vesicles to microdomains
which contain little EEA1, Hrs, and PI-3-P (Cabezas et al, 2006). This indicates
that recruitment of PIKfyve to PI-3-P rich microdomains of early endosomes
leads to the local conversion of PI-3-P to PI-3,5-P2 which is then probably
followed by the recruitment of PI-3,5-P2 effector proteins. The antagonistic
enzyme of PIKfyve is the phosphatase FIG4/Sac3, which converts PI-3,5-P2 to
PI-3-P. Both enzymes are regulated by binding to Vac14/ArPIKfyve (Sbrissa et
al, 2007). FIG4/Sac3 plays a dual role in this complex. FIG4 not only catalyzes
PI-3,5-P2 turnover but also promotes PI-3,5-P2 synthesis, by facilitating the
association of PIKfyve and ArPIKfyve (Sbrissa et al, 2007; Sbrissa et al, 2008).
Deletion of Fig4 in yeast lead to elevated PI-3,5-P2 levels, enlarged vacuoles and
impaired retrograde traffic to the late endosomes, similar to knockdown of
mammalian Fab1/PIKfyve kinase knockdown phenotype (Gary et al, 1998;
Bonangelino et al, 2002; Michell et al, 2005). SiRNA-mediated knockdown of
endogenous FIG4 in 3T3L1 adipocytes resulted also in a slight but significant
elevation of PI-3,5-P2 level (Ikonomov et al, 2009). Furthermore, it was shown
that FIG4 activity towards PI-3,5-P2 was markedly reduced upon acute insulin
stimulation
and
its
down-regulation
subsequently
increased
insulin
responsiveness. In yeast, Vac14 promotes the localization of Fig4 to the site of
PI-3,5-P2 synthesis (Dove et al, 2002; Rudge et al, 2004). Deletion of Vac14
resulted in enlarged vacuoles and reduced PI-3,5-P2 levels (Bonangelino et al,
2002).
PI-3,5-P2 binding Vps24 protein of the ESCRT-III complex controls recycling to
the Golgi and degradation pathway (Raiborg et al, 2008). In yeast, Vps24 was
additionally identified to be involved in pH-responsive Rim101 pathway (Hayashi
et al, 2005). Especially to mention here, is the influence of Vps24 on stimulated
degradation of membrane proteins. Depletion of Vps24 resulted in accumulation
of EGF/EGFR complex in acidified EEs and was not further degraded (Bache et
al, 2006). Also the degradation of monoubiquitinated potassium channel, which is
encoded by the human ether-a-go-go-related gene (hERG) was blocked in
33
Introduction
depleted Vps24 HEK cells (Sun et al, 2011). Vps24 dependent MVB formation,
which is a component of the degradative pathway, plays an important role in viral
host cell infection and will be discussed in the proximate chapter. Function of PI
binding MTMR phosphatases in cellbiological processes was extensively
discussed in chapter 5.1.
5.2.4 PI metabolizing enzymes and the relevance of their correct
function in vivo
PIK3C3 gene encodes the PI3 kinase VPS34. Pik3c3flox/flox mice with sensory
neuron-specific
deletion
of
Pik3c3
developed
increasing
difficulties
in
coordinating movement and maintaining body postures from postnatal day 5–6
(P5–P6) and died within 2 weeks of age. This pathological feature was the result
of neurodegeneration, which was based on drastic defects in the endo-lysosomal
pathways but not autophagy (Zhou et al, 2010). Substrate trap experiment in
Schizosaccharomyces pombe suggest that human MTM1 regulates VPS34
activity by dephosphorylation of VPS34 and by decreasing the PI-3-P pool
(Blondeau et al, 2000). Such dual activity, comprising protein phosphatase and
lipid phosphatase function, has also been suggested for the tumor suppressor
and PI-3 phosphatase PTEN (Di et al, 2000). Pik3c3 null mice embryos are
poorly developed with no evidence of mesoderm formation, suffer from severe
reduced cell proliferations and are embryonic lethal (Zhou et al, 2011).
Furthermore, it was shown that amino acid activated mTOR signaling is indeed
drastically reduced in Pik3c3 mutant embryos. PIK3C3/VPS34 is therefore not
only important in autophagy or trafficking at late endosomes, but also absolutely
required for signaling during developmental processes.
Heterozygous mutations in PIKfyve cause François-Neetens fleck corneal
dystrophy (CFD), an autosomal dominant syndrome clinically manifested by the
presence of enlarged/swollen vesicles (speckles) within keratocytes (Li et al,
2005). Deletion of PIKfyve (Fab1) in yeast was not lethal and caused aberrant
nuclear division and growth defects, characterized by aberrant vacuolation
(Yamamoto et al, 1995). Pikfyve null mutants of C. elegans or Drosophila had
developmental defects and were embryonic/pupae lethal, respectively (Nicot et
34
Introduction
al, 2006; Rusten et al, 2006). Recently, the first mouse model was published with
global deletion of the Pikfyve gene using the Cre-loxP approach (Ikonomov et al,
2011). PIKfyveKO/KO mutant embryos died before the 32–64-cell stage, a result of
defective cell division. Heterozygous PIKfyveWT/KO mice however, developed
normally even though their PIKfyve levels were lower than those of wild-type
mice.
PI-3,5-P2 is substrate for the phosphatase FIG4. Missense mutation FIG4 I41T
combined with a FIG4 null allele in humans causes Charcot-Marie-Tooth 4J
disease, a recessive neurodegenerative disorder that accounts for ∼0.2% of
CMT (Chow et al, 2007). CMT4J is characterized by slow nerve conduction
velocities, axonal loss, thinly myelinated nerve fibres and evidence of de- and remyelination. Fig4-/- mice (designated as “pale tremor” mice) displayed similar
features including defects in PNS myelination. Additionally, the pale tremor mice
exhibited a dramatic reduction of myelin in the brain and spinal cord, which
however could be rescued by neuronal expression of the human FIG4 I41T
mutant protein (Winters et al, 2011). In contrast to the Fig4/Sac3 knockdown
mutants in yeast and adipocytes, the PI-3,5-P2 levels in the Fig4 null mice were
reduced (Chow et al, 2007). Fig4 and Vac14 mutant mice are blocked in
autophagy, supporting the evidence that PI-3,5-P2 pool in the CNS plays an
essential role in autophagy pathway (Ferguson et al, 2009). Vac14−/− knockout
mice displayed enlarged endolysosomes and suffered from neurodegeneration
(Zhang et al, 2007). Cultured fibroblasts from missense mutant Vac14 mouse
showed reduced level of PI-3,5-P2 and similar pathological features as observed
from Fig4-/- fibroblasts (Ferguson et al, 2010): severe neurodegeneration,
reduced number of myelinated axons in sciatic nerve, loss of neurons from
sensory and autonomic ganglia and lethality by 6 weeks of age. Mutations in
MTM1, MTMR2 and SBF2 and their causing diseases XLMTM, CMT4B1 and
CMT4B2, respectively, were described earlier (5.1.1).
35
Introduction
5.2.5 Rab GTPases and their influence on transport
The role of Rab GTPases in membrane traffic, vesicle transport and endosome
maturation has been extensively reviewed (see small selection for review (Zerial
et al, 2001; Schwartz et al, 2007; Lee et al, 2009; Stenmark, 2009; Hutagalung et
al, 2011; Huotari et al, 2011). Some Rab GTPases have been introduced in
chapter 5.2.1 and are depicted in Figure 5-2. More than 60 members of Rab
GTPases were identified in humans, which localize to distinct subcellular
membranes or distinct microdomains of the same vesicles (Zerial et al, 2001;
Schwartz et al, 2007). They exist in an inactive GDP bound stage and an active
GTP bound form, whereby the interconversion is catalyzed by guanine nucleotide
exchange factor (GEF) and GTPase-activating protein (GAP). Cytosolic inactive
Rab is associated with GDP dissociation inhibitor (GDI), stabilizing the GDP
bound Rab (Matsui et al, 1990). Assisted by GDI dissociation factor (GDF) Rab
GTPase is inserted into the appropriate membrane (Sivars et al, 2003). Active
Rabs recruit specific effectors to restricted membrane microdomains, thereby
specifying membrane identity. The most cited example is the recruitment of
class III PI3K by Rab5 and subsequent production of PI-3-P, the hallmark of early
endosomal membranes (Christoforidis et al, 1999). Through interaction with
miscellaneous effectors, Rabs regulate multiple processes of vesicular traffic.
These are listed here by means of few examples (reviewed in (Stenmark, 2009;
Hutagalung et al, 2011)): (1) Rab5 in complex with GDI is essential for assembly
of clathrin-coated pits and clathrin-mediated endocytosis/vesicle budding at the
plasma membrane (McLauchlan et al, 1998); (2) Rab5 together with rab5
exchange factor RME-6 coordinate regulation of AP2 uncoating from CCVs
(Semerdjieva et al, 2008); (3) Rab5 recruits EEA1, which interacts with the
endosomal SNAREs syntaxin 6 and syntaxin 13 to drive vesicle fusion
(Simonsen et al, 1999; McBride et al, 1999); (4) Rab11a in complex with FIP2
binds to the motor protein myosin Vb, thereby connecting Rab11a positive
vesicles with the actin filaments and facilitating recycling along the cytoskeleton
back to the plasma membrane (Hales et al, 2001; Hales et al, 2002).
36
Introduction
5.2.5.1 Rab5 to Rab7 conversion/switch
Like the PI conversion of PI-3-P to PI-3,5-P2 plays an important role in membrane
identity of EEs, LEs and their maturation, so does the Rab conversion of Rab5 to
Rab7 (reviewed in (Huotari et al, 2011)). The degradative pathway of cargo
destined to LEs and lysosomes starts in Rab5 positive microdomains of EEs,
which can undergo conversion to Rab7 and subsequent maturation (Rink et al,
2005; Hutagalung et al, 2011). Rab5 gets activated by the GEF Rabex-5
(Horiuchi et al, 1997). Activated, GTP-bound Rab5 promotes then binding of
further Rab5 through interaction with Rabex-5 and Rabaptin-5 (Lippe et al, 2001).
Inhibition of this positive feedback loop is the first step in Rab5/Rab7 switch and
needs the dissociation of Rabex-5 from the membrane (Huotari et al, 2011). This
is initiated by Mon1/SAND-1 complexed with Ccz1, which bind to Rab5, PI-3-P
and Rabex-5. Increasing PI-3-P level was suggested to localize on “elderly”
maturing microdomains of the EEs, and thereby driving SAND-1 binding
specifically to these sites (Poteryaev et al, 2010). Inactivation of GTP-Rab5 by
GAP, which hydrolyses GTP to GDP, is followed by removement of Rab5 from
the membrane. Mon1/SAND-1 complexed with Ccz1 plays not only a critical role
in recruitment and activation of Rab7, but also in mediating membrane tethering
by binding to the homotypic fusion and protein sorting complex (HOPS: Vps11,
Vps16, Vps18, Vps33, Vps39, and Vps41) (Wurmser et al, 2000; Nickerson et al,
2009). As soon as Rab7 is activated, it recruits its own effectors, such as
RILP/ORP1L which regulates endo-lysosomal morphogenesis and enables
transport of the maturing endosome along the minus-end directed microtubule
(Cantalupo et al, 2001; Johansson et al, 2005; Johansson et al, 2007; Wang et
al, 2011).
5.2.5.2 Rab GTPases and their influence on receptor trafficking
Ligand-induced activation of many hormone and growth factor receptors leads to
intracellular signaling, internalization and trafficking to lysosomes for degradation.
Receptor signaling is regulated through endocytosis, recycling, ubiquitination,
inclusion into ILVs and degradation, whereby Rab GTPases play a significant
role (Raiborg et al, 2002; von et al, 2007; Stenmark, 2009). The influence of
37
Introduction
Rab4 and Rab11 on recycling and therefore also signaling of β2AR, TfR and
VEGFR-2 is discussed in detail in the chapter 8.1. Rab5 controls intracellular
trafficking through receptor endocytosis and through endosomal dynamics (Zerial
et al, 2001). Based on the findings that activation of RTKs lead to the formation
of actin-based membrane ruffles through the activation of the small GTPases
Ras and Rac (Bar-Sagi et al, 2000), Lanzetti et al. (2004) showed that Rab5 is
the critical regulator in this pathway. Platelet derived growth factor (PDGF)
induces the formation of circular ruffles, which however was inhibited by
expression of a dominant negative Rab5 mutant. Rab5 activity was therefore
required in this PDGF originated signaling pathway leading to circular ruffles.
Rab7 regulates transport of receptors from early to late endosomes. Nerve
growth factor (NGF) activated TrkA receptors are important for the mediation of
neurite outgrowth. Rab7 was reported to control endosomal trafficking and
neuritogenic signaling by directly interacting with TrkA. Inhibition of Rab7 activity
resulted in accumulation of TrkA in endosomes, augmented TrkA signaling,
potentiated phosphorylation of Erk1/2 and enhanced neurite outgrowth (Saxena
et al, 2005). Missense mutations in Rab7 cause the autosomal dominant
peripheral
neuropathy
Charcot-Marie-Tooth
disease
type
2B
(CMT2B).
Interestingly, Rab7 mutant causing CMT2B was shown to interact with TrkA
similarly as Rab7 WT, but enhanced TrkA phosphorylation significantly in
response to NGF stimulation and increased Erk1/2 phosphorylation, which was
triggered on signaling endosomes (BasuRay et al, 2010). These observations let
suggest a mechanistic link between Rab7 CMT2B mutants and altered TrkA and
Erk1/2 signaling from endosomes. Mutations in Rab23 were associated with the
neurological disease Carpenter syndrome in humans and the embryonically
lethal open brain (opb) mutant phenotype in mice (Gunther et al, 1994; Jenkins et
al, 2007). Rab23 acts as a negative regulator of sonic hedgehog (shh) signaling
during dorsoventral development of the mouse spinal cord (Eggenschwiler et al,
2001). Rab40 was also reported to act in a signaling pathway by recruiting
components of the ubiquitination machinery to regulate Wnt signaling and normal
gastrulation in Xenopus (Lee et al, 2007).
38
Introduction
5.2.6 Influence of Rabs and PIs on EGFR signaling and trafficking
The epidermal growth factor receptor (EGFR, also known as HER1 or ErbB1) is
a member of the human epidermal growth factor receptor (HER)-erbB family of
receptor tyrosine kinases (RTKs) and plays an important role in cell growth,
proliferation and development. Ligand-binding triggers EGFR homo- or
heterodimerization with its family members HER2 (ErbB2), HER3 (ErbB3) and/or
HER4 (ErbB4). This induces autophosphorylation of the intracellular domain
through intrinsic tyrosine kinase activity and activates downstream signaling
pathways like Ras/Raf mitogen activated protein kinase (MAPK), the PI3K/AKT,
the signal transducer and activator of transcription (STAT) and the phospholipase
Cγ/protein kinase C (PKC) pathways. Overexpression or constitutive activation of
EGFR is characteristic for many tumors with increased cell growth, proliferation
and survival, making EGFR an attractive target for anticancer therapy (Hynes et
al, 2009). Frequently used EGFR inhibitors in clinics are the monoclonal
antibodies (1) Cetuximab and (2) Panitumumab and the less selective smallmolecules (3) Erlotinib and (4) Gefitinib, all of which inhibit EGFR activation
(reviewed in (Ciardiello et al, 2008)). The length of signaling is highly dependent
on ligand-stimulated endocytosis, receptor ubiquitination and subsequent
lysosomal degradation as well as on the rate of recycling (Roepstorff et al, 2009;
Sorkin et al, 2009; Sorkin et al, 2009). A good overview, summarizing the
regulation of Rab proteins on EGFR endocytoc trafficking, was published by
Ceresa et al. (2006).
Rab5: Barbieri et al. (2000) reported that EGF stimulation of NR6 cells induced
Rab5a activation and enhanced Rab5 effector EEA1 translocation from cytosol to
early endosomes, which concomitantly activated endocytosis and internalization
of EGFR. EGF stimulation was also shown to regulate cell proliferation. By
inducing release of Rab5 effector APPL1 from the membrane, APPL1
translocated to the nucleus, where in complex with APPL2 interacted with the
nucleosome
remodeling
and
histone
NuRD/MeCP1 (Miaczynska et al, 2004).
39
deacetylase
multiprotein
complex
Introduction
Rab4: Not much is known about the role of Rab4 in EGFR trafficking and
signaling. McCaffrey et al. (2001) reported that expression of a dominant
negative mutant Rab4 (Rab4AS22N) in HeLa cells lead to a significant reduction
in both recycling and degradation of EGF.
Rab11: Rab11-family interacting proteins (FIPs) include FIP1, FIP2, FIP3/Efrin,
FIP4, FIP5/Rip11 and RCP, all of which have been identified to potentially
mediate Rab11 effects in recycling endosomes. Rab11-FIP2 associates with the
α-adaptin subunit of AP-2 complexes, which are known to recruit receptors into
clathrin-coated vesicles (Cullis et al, 2002). Rab11a-FIP2 has been reported to
form a ternary complex with the myosin Vb, representing a possible sorting
mechanism back to the plasma membrane (Hales et al, 2001; Hales et al, 2002).
However, overexpression of FIP2 suppresses the internalization of EGFR,
favoring Rab11-FIP2 function in endocytosis and subsequent sorting of receptorcontaining vesicles in endosomes (Cullis et al, 2002). In vitro studies of immortal,
nontumorigenic MCF10A breast cells transfected with Rab11a or dominant
negative Rab11a resulted in accelerated or postponed EGFR recycling,
respectively (Palmieri et al, 2006). In contrast to FIP2, these results clearly
support a function of Rab11a in recycling. Furthermore, they could show that
Rab11a modulates EGFR recycling, promotes the proliferation but inhibits the
motility of immortal MCF10A breast cells.
Rab7: Similar to the effect of Rab7 on TrkA trafficking (see 5.2.5.2), expression
of inactivated Rab7 mutant in HeLa cells lead to the accumulation of the
EGFR/EGF complex in LEs. Furthermore, expression of dominant negative Rab7
slowed the rate of EGFR degradation, suggesting that functional Rab7 is
required for the degradation EGFR/EGF complex by the lysosome (Ceresa et al,
2006).
Rab22B: The small GTPase Rab22B was found to be highly enriched in astroglia
lineage and likely has a role in TGN-endosome transport (Rodriguez-Gabin et al,
2001). Ng et al. (2009) showed that Rab22B interacts with EGFR in a GTPdependent manner. Furthermore, they reported that Rab22B silencing prevented
40
Introduction
or delayed EGFR trafficking to late endosomal compartments and reduced EGF
degradation.
PI-3-P: By inhibition of PI3 kinase with wortmannin, EGFR was trapped in
early/recycling endosomes, showing that PI-3-P controls the sorting of EGFR in
early endosomes (Petiot et al, 2003). Hrs and SNX1 both bind to PI-3-P and in
HeLa colocalize to early endosomes, but not cytosol (Chin et al, 2001).
Furthermore, overexpression of Hrs, SNX1, Hrs/SNX1 complex or the SNX1binding domain of Hrs inhibited ligand-induced degradation of EGFR (Kurten et
al, 1996; Chin et al, 2001).
PI-3,5-P2: PIKfyve is a PI 5 kinase and converts PI-3-P to of PI-3,5-P2. In
transitional carcinoma cells (TCCSUP) PIKfyve was shown to interact with
cytoplasmic EGFR and to mediate EGFR translocation to the nucleus.
Transfection of wild-type PIKfyve increased the level of nuclear-resident EGFR,
whereas silencing of PIKfyve by siRNA inhibited nuclear accumulation of EGFR
significantly (Kim et al, 2007). In HeLa cells siRNA knockdown of PIKfyve alone
produced no defect in EGFR degradation, however a combined knockdown with
Vac14 revealed a modest inhibition of EGFR degradation. This suggested that a
low threshold of PI-3,5-P2 is necessary and sufficient for this pathway (de et al,
2009). Additionally, pharmacological inhibition of PIKfyve resulted in a profound
block to the lysosomal degradation and accumulation of EGFR in the interior of a
swollen, EEA1 positive endosomes. Additionlly to PI-3-P, MTM1 and MTMRs
bind to PI-3,5-P2 and hydrolyzes it to PI-5-P. Overexpression of MTM1 has been
shown to inhibit EGFR degradation and to induce large endosomal vacuoles
(Tsujita et al, 2004). Furthermore, overexpression of MTMR2 was shown to
inhibit EGFR degradation, whereas coexpression of SBF2 counteracted this
effect (Berger et al, 2009). Additionally, Berger at al. observed sustained Akt
activation upon MTMR2 overexpression, which was not affected by coexpression
of SBF2. The PX domain of SNX5 specifically binds to PI-3,5-P2, PI-4-P and
PI-5-P, but not PI-3-P as SNX1 does (Liu et al, 2006). Overexpression of SNX5
was shown to inhibit the degradation of EGFR, whereas overexpression of SNX1
was able to attenuate this effect. SNX5 and SNX1 were therefore suggested to
41
Introduction
play antagonistic roles in regulating endosomal trafficking of the receptor, similar
to MTMR2 and Sbf2. It should also be mentioned, that no direct interaction
between SNX5 and EGFR was detected. However, direct interactions were
reported for SNX1 and EGFR, as well as for SNX1 and SNX5, pointing to a
regulatory function of SNX1 (Chin et al, 2001; Liu et al, 2006).
PI-4,5-P2 (PIP2): EGFR activation starts a signaling cascade that includes direct
tyrosine phosphorylation of phospholipase Cγ. Subsequent PI-4,5-P2 hydrolysis
to inositol-1,4,5-P3 and diacylglycerol leads to Ca2+ mobilization and PKC
activation, respectively (Rhee, 2001). Recently Michaelidis et al. (2011) reported,
that in oocytes PI-4,5-P2 down-regulation by PI kinase inhibitor Wortmannin
severely impaired EGFR activation, whereas up-regulation of PI-4,5-P2 by
overexpression of PIP5KIα potentiated EGF-mediated activation of the receptor.
42
Introduction
5.3 Aim of the thesis
Although MTM1 and MTMR2 are expressed in the same tissues and although
they share the same substrate specificity and a high sequence similarity (~64%),
it is still unclear how mutations in these enzymes can lead to such distinct human
diseases. Interaction of MTM1 and MTMR2 with different adaptor proteins
including scaffolding proteins and other MTMR family members, could lead to
differential localization and action as well as differential sorting and signaling of
membrane proteins. The first part of this study is dedicated to the screening,
verification and characterization of novel PDZ-domain containing proteins
interacting with MTMRs. The identification of new PDZ-domain containing
proteins gives the opportunity to study the influence of MTMRs on the trafficking
and sorting of yet unidentified PDZ-dependent protein and membrane receptor
complexes. The second part of this thesis focuses on the structural analysis of
the protein complexes Mtmr2/Sbf2, Mtmr2/Sap97 and Mtmr2/3-Pap using
analytical methods such as immunoprecipitation, size exclusion chromatography,
multi-angle light scattering and small-angle X-ray scattering. For detailed analysis
of the Mtmr2/3-Pap protein complex, the subcellular localization of these proteins
in cultured cells will be specified by help of coexpression with endosomal
markers. To elucidate the functional aspects of 3-Pap and Mtmr2/3-Pap complex
on endocytic EGFR trafficking, the localization of the individual proteins will be
monitored
after
different
timepoints
microspcopy.
43
after
EGF
stimulation
using
light
Experimental Procedures
6 Experimental Procedures
6.1 Screen for novel binding partners of MTMRs
6.1.1 Cloning
6.1.1.1 GST-MTMR constructs for screening of the PDZ domain array
The PDZ domain proteomic array is an excellent tool to screen for 96 different
PDZ domains of PDZ-domain containing proteins (Fam et al, 2005). All PDZ
domains spotted on the membrane are His- and S-tagged fusion proteins (see
also chapter 6.1.6). The PDZ array is overlaid with GST fused to the carboxyterminus of the bait protein. To assess the binding of myotubularins (MTMRs),
the carboxy-terminal 25 amino acids of each MTMR (named C-term), had to be
expressed as GST-fusion proteins. From human or mouse genomic DNA or
appropriate cDNA the C-termini were amplified by PCR using Phusion HighFidelity DNA polymerase (Finnzymes) and forward primers containing an NcoI
restriction site and reverse primers containing a XhoI restriction site (listed in
Table 6-1). PCR products were digested with NcoI and XhoI and ligated using
T4-ligase (Fermentas) into NcoI/XhoI cut pET42a-TEV vector (modified vector
with an N-terminal TEV cleavage site downstream of the GST coding sequence).
The ligation mixture was transformed into electro-competent Escherichia coli
(E. coli) DH10β-cells for amplification and selection. All constructs were verified
by restriction digest and DNA sequencing.
Table 6-1: Primers used for cloning of MTMRs into the expression vector pET42a-TEV.
Restriction sites NcoI in forward primers (For) and XhoI in reverse primers (Rev) are underlined.
Construct
pET42a-TEV C-term
mSbf1
pET42a-TEV C-term
mSbf2
pET42a-TEV C-term
mMtm1
pET42a-TEV C-term
hMTMR1
pET42a-TEV C-term
mMtmr1
pET42a-TEV C-term
mMtmr2
Primer sequence 5’-3’
For: 5’-GATCCCATGGGATACAACTTCTGTGCCCAG-3’
Rev: 5’-GATCCTCGAGTCAGGCATCCGACAGGCA-3’
For: 5’-GATCCCATGGATATAACTTCTGTGCCCAG-3’
Rev: 5’-GATCCTCGAGTCAGGCATCAGAGATGCA-3’
For: 5’-GATCCCATGGGATCCGCCAAGCTTGCTGAT-3’
Rev: 5’-GATCCTCGAGTCAGAAGTGCGTCTGCAC-3’
For: 5’-GATCCCATGGGAACGCGCGCCGTCTCATCC-3’
Rev: 5’-GATCCTCGAGTCAGACCGAGGTGTGGAC-3’
For: 5’-GATCCCATGGGAACGCGCGCCGTCTCATCC-3’
Rev: 5’-GATCCTCGAGTCAGACCGAGGTGTGGAC-3’
For: 5’-GATCCCATGGGATCCAACCGCTCAACCTCC-3’
Rev: 5’-GATCCTCGAGTCATACAACAGTTTGGAC-3’
44
Primer Name
mSbf1GSTfor
mSbf1GSTback
mSbf2GSTfor
mSbf2GSTback
mMtm1GSTfor
mMtm1GSTback
hMTMR1GSTfor
hMTMR1GSTback
mMtmr1GSTfor
mMtmr1GSTback
mMtmr2GSTfor
mMtmr2GSTback
Experimental Procedures
pET42a-TEV C-term
mMtmr2 ∆PDZ
pET42a-TEV C-term
hNpn1
pET42a-TEV C-term
hNpn2
pET42a-TEV C-term
mPten
For: 5’-GATCCCATGGGATCCAACCGCTCAACCTCC-3’
Rev: 5’-GATCCTCGAGTCAAGGAGTCACACACTG-3’
For: 5’-GATCCCATGGGATATAACTTTGAACTTGTG-3’
Rev: 5’-GATCCTCGAGTCATGCCTCCGAATAAGT-3’
For: 5’-GATCCCATGGGAAACTACAACTTCGAGCTC-3’
Rev: 5’-GATCCTCGAGTCATGCCTCGGAGCAGCA-3’
For: 5’-GATCCCATGGGATATTCTGACACCACTGAC-3’
Rev: 5’-GATCCTCGAGTCAGACTTTTGTAATTTGTGA-3’
mMtmr2GSTfor
mMtmr2GSTs-back
hNpn1GSTfor
hNpn1GSTback
hNpn2GSTfor
hNpn2GSTback
mPtenGSTfor
mPtenGSTback
6.1.1.2 Constructs for PDZ domain mapping of Sap97
The coding regions of Sap97-PDZ1, Sap97-PDZ2, Sap97-PDZ3, Sap97-PDZ1-2,
and Sap97-PDZ1-3 were amplified from mouse cDNA pCMV-Sport6-Sap97
(accession number: NM_007862.2) by a two-step PCR using the primers listed in
Table 6-2. All Sap97 PDZ fragments were generated without the L27, SH3 and
MAGUK domains. Restriction sites SalI and NotI were introduced for insertion
into the MCS1 of pFBDM His-Mtmr2 vector (Berger et al, 2006a), resulting in
dual expression vectors pFBDM His-Mtmr2_HA-Sap97-PDZ. PCR products and
target backbone plasmid pFBDM His-Mtmr2 were digested with SalI and NotI
and
ligated
using
T4-ligase
(Fermentas).
Recombined
plasmids
were
transformed into electro-competent E. coli DH10β-cells for amplification and
selection. All constructs were verified by restriction digest and DNA sequencing.
Table 6-2: Primers used for amplification of Sap97 PDZ domains
Coding regions were amplified from pCMV-Sport6-Sap97 using the listed primers. Restriction
sites SalI (in SAP97 univ for) and NotI (in all reverse primers) are underlined.
Coding Region/
Primer Name
SAP97 PDZ1
SAP97 univ for
SAP97 PDZ1 for
SAP97 PDZ1 rev
SAP97 PDZ2
SAP97 univ for
SAP97 PDZ2 for
SAP97 PDZ2 rev
SAP97 PDZ3
SAP97 univ for
SAP97 PDZ3 for
SAP97 PDZ3 rev
SAP97 PDZ1-2
SAP97 univ for
SAP97 PDZ1 for
SAP97 PDZ2 rev
SAP97 PDZ1-3
SAP97 univ for
Primer sequence 5’-3’
5’-GATCGTCGACATGTACCCATACGATGTTCCAGATTACGCTGATTACGATATCC
CAACGACCGAGAACCTCTACTTCCAGGGCGCC-3’
5’-GATCGAGAACCTCTACTTCCAGGGCGCCGATGCAGATTATGAATATG-3’
5’-GATCGCGGCCGCTCACATGATTTTTTCTGATGCTGG-3’
5’-GATCGTCGACATGTACCCATACGATGTTCCAGATTACGCTGATTACGATATCC
CAACGACCGAGAACCTCTACTTCCAGGGCGCC-3’
5’-GATCGAGAACCTCTACTTCCAGGGCGCCCCAGCATCAGAAAAAATCATG-3’
5’-GATCGCGGCCGCTCAGCCATCATTTATATACATACTTGTTGG-3’
5’-GATCGTCGACATGTACCCATACGATGTTCCAGATTACGCTGATTACGATATCC
CAACGACCGAGAACCTCTACTTCCAGGGCGCC-3’
5’-GATCGAGAACCTCTACTTCCAGGGCGCCGAGATCACTAGGGAACC-3’
5’-GATCGCGGCCGCTCATTCAAAACGACTGTACTCTTCG-3’
5’-GATCGTCGACATGTACCCATACGATGTTCCAGATTACGCTGATTACGATATCC
CAACGACCGAGAACCTCTACTTCCAGGGCGCC-3’
5’-GATCGAGAACCTCTACTTCCAGGGCGCCGATGCAGATTATGAATATG-3’
5’-GATCGCGGCCGCTCAGCCATCATTTATATACATACTTGTTGG-3’
5’-GATCGTCGACATGTACCCATACGATGTTCCAGATTACGCTGATTACGATATCC
45
Experimental Procedures
SAP97 PDZ1 for
SAP97 PDZ3 rev
CAACGACCGAGAACCTCTACTTCCAGGGCGCC-3’
5’-GATCGAGAACCTCTACTTCCAGGGCGCCGATGCAGATTATGAATATG-3’
5’-GATCGCGGCCGCTCATTCAAAACGACTGTACTCTTCG-3’
6.1.1.3 Cloning of pcDNA3.1 RGS-His Mtm1-∆PDZ
RGS-His-tagged Mtm1-∆PDZ construct, devoid of the last five amino acids, was
generated by PCR-subcloning. (Geiser et al, 2001) By using pcDNA3.1 zeo(+)
RGS-His-Mtm1 (obtained from Philipp Berger) as template, RGS-His-Mtm1 was
amplified and simultaneously the PDZ-BD was looped out by using the following
primers: oligo408 (5’-GCCCCATTGACGCAAATGG-‘3) and mMtm1 c-del2 rev
(5’-GGCCCTCTAGACTCGACGCGGCCGCTCAATGGGGCACCATCTGTGACG3’). The first PCR product was purified and subsequently served as primer for a
second PCR step to amplify the plasmid backbone linked to the insert. pcDNA3.1
zeo(+) RGS-His-Mtm1-∆PDZ was verified by restriction digest and sequencing.
6.1.2 Protein expression
6.1.2.1 Protein expression of GST-tagged MTMR C-termini and His-tagged
PDZ domains in E. coli
For the expression of GST-tagged MTMR C-termini (listed in Table 6-1) and
His- and S-tagged PDZ domains (listed in Table 6-3, generous gift from Randy
Hall, Emory University, Atlanta) electro-competent E. coli Acella cells (EdgeBio,
#42649) were transformed and grown in LB medium at 37°C, containing 50 µg/ml
kanamycin, to an OD600 of 0.6. Protein expression was induced by addition of
isopropyl beta-D-thiogalactoside (IPTG) to a final concentration of 1 mM. Cells
were harvested by centrifugation (10’000 x g, 10 min, 4°C) 4 hours after IPTG
induction and the pellet was stored at -80°C.
Table 6-3: pET30a PDZ domain plasmids used for expression in E.coli
List of plasmids for the expression of His- and S-tagged PDZ-domain containing proteins.
Plasmids were obtained from Randy Hall (Emory University, Atlanta).
Plasmid
pET-30a MAGI-3 PDZ1
pET-30a NHERF-1 PDZ2
pET-30a NHERF-2 PDZ2
pET-30a PSD-95 PDZ3
pET-30a nNOS PDZ
pET-30a SAP97 PDZ1+2
pET-30a SAP97 PDZ3
pET-30a ERBIN PDZ
Protein
His-S-tag-MAGI-3 PDZ1
His-S-tag-NHERF-1 PDZ2
His-S-tag-NHERF-2 PDZ2
His-S-tag-PSD-95 PDZ3
His-S-tag-nNOS PDZ
His-S-tag-SAP97 PDZ1+2
His-S-tag-SAP97 PDZ3
His-S-tag-ERBIN PDZ
46
Experimental Procedures
pET-30a C2PA PDZ
pET-30a GIPC
pET-30a DENSIN-180
pET-30a MUPP PDZ8
pET-30a PTPN13 PDZ4+5
pET-30a PDZK1 PDZ3
pET-30a PDZK2 PDZ1
pET-30a PDZK2 PDZ3
pET-30a LNX PDZ3
His-S-tag-C2PA PDZ
His-S-tag-GIPC
His-S-tag-DENSIN-180
His-S-tag-MUPP PDZ8
His-S-tag-PTPN13 PDZ4+5
His-S-tag-PDZK1 PDZ3
His-S-tag-PDZK2 PDZ1
His-S-tag-PDZK2 PDZ3
His-S-tag-LNX PDZ3
6.1.2.2 Protein expression of His-tagged Mtmr2 and HA-tagged SAP97 PDZ
domains in Sf21 insect cells
The generation of baculovirus DNA, virus production, Sf21 insect cell transfection
and protein expression was performed as described (Fitzgerald et al, 2006). Sf21
insect cells were infected with baculovirus encoding His-Mtmr2 together with
HA-Sap97-PDZ1, Sap97-PDZ2, Sap97-PDZ3, Sap97-PDZ1-2 or Sap97-PDZ1-3.
The cells were grown in Lonza serum-free Insect-XPRESS™ medium with
L-glutamine (Lonza, #BE12-730Q) at 27°C, kept at a cell density of 0.5 x 106
cells/ml and harvested 5 days after infection. After centrifugation (900 x g,
10 min, RT) the cell pellets were stored at -80°C.
6.1.2.3 Protein expression of Mtmr2/Sbf2 complex in Sf21 insect cells
Sf21 insect cells were infected with baculovirus, which was earlier produced by
Philipp Berger (Berger et al, 2006a). The plasmids pFBDM His-Mtmr2/CBP-Sbf2,
pFBDM His-Mtmr2/CBP-Sbf2-MT+PH and pFBDM His-Mtmr2/CBP-Sbf2-MT
were used for the generation of baculovirus DNA and virus production. The cells
were grown in Lonza serum-free Insect-XPRESS™ medium with L-glutamine
(Lonza, #BE12-730Q) at 27°C, kept at a cell density of 0.5 x 106 cells/ml and
harvested 5 days after infection. After centrifugation (900 x g, 10 min, RT) the cell
pellets were stored at -80°C.
6.1.3 Protein purification
6.1.3.1 Protein purification of GST-tagged MTMR C-termini
Harvested cell pellets were thawed on ice and resuspended in resuspension
buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 0.1% Triton X-100, 2 mM PMSF,
3mM DTT, Roche protease inhibitor cocktail). The suspension was sonicated
with 50 pulses on ice and the soluble protein fraction was isolated by
47
Experimental Procedures
centrifugation (20’000 x g, 10 min, 4°C). The cleared lysate was then passed
through a 0.22 µm filter unit. The GST-tagged proteins were bound on a GST
Trap™ FF column (GE Healthcare), washed with washing buffer with increasing
sodium chloride concentrations (50 mM Tris-HCl pH 7.5, 100-600 mM NaCl,
0.1% Triton X-100), and eluted in elution buffer (50 mM Tris-HCl pH 7.5, 100 mM
NaCl, 0.1% Triton X-100, 10 mM reduced glutathione). Purified proteins were
stored at -20°C.
6.1.3.2 Protein purification of His-tagged PDZ-domain proteins
Harvested cell pellets were thawed on ice and resuspended in resuspension
buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 0.1% Triton X-100, 2 mM PMSF,
3 mM DTT, 10 mM imidazole, Roche protease inhibitor cocktail). The suspension
was sonicated with 50 pulses on ice and the soluble protein fraction was isolated
by centrifugation (20’000 x g, 10 min, 4°C). Cleared lysate was then passed
through a 0.22 µm filter unit. The His-tagged proteins were bound on a nickel
charged HiTrap™ Chelating HP column (GE Healthcare), washed with binding
buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 10 mM imidazole, 0.01%
Tween-20), and eluted in elution buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl,
0.01% Tween-20, 0.5 M imidazole). Purified proteins were stored at -20°C.
6.1.3.3 Protein purification of His-Mtmr2/HA-Sap97-PDZ1-2 complex
Harvested cell pellets were thawed on ice and resuspended in resuspension
buffer (100 mM Tris-HCl pH 8.6, 200 mM NaCl, 0.01% Tween-20, 2 mM PMSF,
3mM DTT, 10 mM imidazole, Roche protease inhibitor cocktail). The complex
was purified with a nickel charged HiTrap™ Chelating HP column (GE
Healthcare). The column was equilibrated and washed with washing buffer
(100 mM Tris-HCl pH 8.6, 200 mM NaCl, 10 mM imidazole, 0.01% Tween-20)
and the complex was eluted in elution buffer (100 mM Tris-HCl pH 8.6, 200 mM
NaCl, 0.01% Tween-20, 0.5 M imidazole). The eluate of the NiNTA column was
loaded on a Superdex 200 16/60 gelfiltration column for size exclusion
chromatography (SEC) and eluted in 100 mM Tris-HCl pH 8.6, 200 mM NaCl and
48
Experimental Procedures
1 mM DTT. NiNTA and SEC eluted samples were analyzed by Coomassie
stained SDS-PAGE.
6.1.3.4 Protein purification of His-Mtmr2/CBP-Sbf2 complexes
Harvested cell pellets were thawed on ice and resuspended in buffer (previously
tested in a solubility screen) as follows: His-Mtmr2/CBP-Sbf2 (100 mM Tris-HCl
pH 8.0, 150 mM NaCl, 10 mM imidazole, Roche protease inhibitor cocktail);
His-Mtmr2/Sbf2-MT and His-Mtmr2/Sbf2-MT+PH (100 mM Bis-Tris pH 6.5,
200 mM NaCl, 10 mM imidazole, Roche protease inhibitor cocktail). The complex
was purified with a nickel charged HiTrap™ Chelating HP column (GE
Healthcare). The column was equilibrated and washed with washing buffer
(same as the according resuspension buffer, but without protease inhibitors) and
the complex was eluted in elution buffer (same as the according washing buffer,
but with 0.5 M imidazole instead). The eluate of the NiNTA column was purified
with a Superdex 200 16/60 column (GE Healthcare) equilibrated in gelfiltration
buffer (same as the according washing buffer, but without imidazole). NiNTA and
SEC eluted samples were analyzed by Coomassie stained SDS-PAGE.
6.1.4 Protein crystallization
All protein samples were concentrated with Vivaspin (Sartorius) centrifugal
protein concentrators with a molecular weight cut-off (MWCO) of 50 Kilo Dalton
(KDa) and filtered with a 0.22 µm centrifugal filter device (Millipore) to the final
protein concentrations listed in Table 6-4. Protein crystallization screens were set
up in InnovaplateTM SD-2 (Innovadyne Technologies, Inc.) using the Crystal
PHOENIX dispenser (Art Robbins Instruments). Crystallization drops were
dispensed in protein:precipitant ratios of 1:1 and the screens were incubated at
20°C. His-Mtmr2/CBP-Sbf2 was manually screened in a 24-well plate (Greiner)
with buffer conditions ranging from pH 6.0-8.6 and polyethyleneglycole with a
size of 35 KDa (PEG 35’000) of 2%, 2.5%, 2.75% and 3%. The reservoir
contained 500 µl screening solution and the protein was pipetted in a
protein:precipitant ratio of 1:1.
49
Experimental Procedures
Table 6-4: Applied crystallization screens for His-Mtmr2/CBP-Sbf2 complexes
The protein complex analyzed for crystal growth is represented with the used protein
concentration, the applied crystal screen and additives treatment.
Protein
His-Mtmr2/
CBP-Sbf2-MT
Conc.
[mg/ml]
2.4; 10.0
2.4; 10.0
2.4; 10.0
2.4; 10.0
7.5; 10.3
7.5; 10.3
7.5; 10.3
5.4
5.2
His-Mtmr2/
CBP-Sbf2-MT+ PH
His-Mtmr2/
CBP-Sbf2
3.7; 7.4
5.6
Screen
Additives
Nextal- The Classics Lite Suite
Nextal- The Classics Suite
Nextal - The JCSG+ Suite
Nextal - The PEGs Suite
Nextal - The pHClear Suite
Nextal - The pHClear II Suite
Qiagen - The JCSG Core Suite I-IV
Qiagen - The JCSG Core Suite I-IV
0.3 mM PI-3-P
0.3 mM PI-3,5-P2
Nextal - The pHClear Suite
Qiagen - The JCSG Core Suite I-IV
24-well manual screen:
100 mM MES pH 6.0 and 6.5
100 mM HEPES pH 7.0 and 7.5
100mM Tris-HCl pH 8 and 8.6
PEG35’000 2%-3%
0.3 mM PI-3-P
0.3 mM PI-3,5-P2
6.1.5 Mass spectrometry
To analyze the amino acid composition of the purified GST-tagged proteins, the
peptides were analyzed by mass spectrometry (MS) at PSI (Alain Blanc, Center
for Radiopharmaceutical Sciences). The identification was performed using a
high-pressure liquid chromatography (HPLC, Waters 2796 Separations module)
coupled to an electrospray ionization mass spectrometer (ESI-MS, Waters
Micromass LCT-Premier, ESI-TOF, Waters Corporation, Milford, MA). The
algorithm software Maxent I Electrospray was used for deconvolution of the data.
6.1.6 Proteomic PDZ-domain array overlay with GST-tagged MTMRs
To identify novel PDZ-domain containing proteins interacting with the C-terminal
PDZ-binding domain (PDZ-BD) motif of the GST-tagged MTMRs, we made use
of a PDZ array based screen (Fam et al, 2005). Our collaborator (Randy Hall,
Emory
University,
Atlanta)
kindly
provided
us
10
nylon
membranes
(SuperCharge 96-grid, Schleicher & Schuell BioScience, #10416257) spotted
with 96 different His- and S-tagged class I PDZ domain fusion proteins (~1µg/bin)
(Table 6-5). Class I PDZ domains are preferentially bound by carboxyl-terminal
PDZ-BD motifs consisting of S/T-x-§ (where § represents a hydrophobic residue).
50
Experimental Procedures
Table 6-5: List of the His- and S-tagged PDZ fusion proteins spotted on the PDZ array,
delivered by Randy Hall
Bin PDZ Domain
Bin PDZ Domain
Bin PDZ Domain
A1
C9
F5
MAGI-1 PDZ1
ERBIN PDZ
MUPP1 PDZ12
A2
C10 ZO-1 PDZ1
F6
MAGI-1 PDZ2
MUPP1 PDZ13
A3
C11 ZO-1 PDZ2
F7
MAGI-1 PDZ3
PTPN13 PDZ1
A4
C12 ZO-1 PDZ3
F8
MAGI-1 PDZ4+5
PTPN13 PDZ3
A5
D1
F9
MAGI-2 PDZ1
ZO-2 PDZ1
PTPN13 PDZ4+5
A6
D2
F10 PDZK1 PDZ1
MAGI-2 PDZ2
ZO-2 PDZ2
A7
D3
F11 PDZK1 PDZ2
MAGI-2 PDZ3
ZO-2 PDZ3
A8
D4
F12 PDZK1 PDZ3
MAGI-2 PDZ4
ZO-3 PDZ1
A9
D5
G1
MAGI-2 PDZ5
ZO-3 PDZ2
PDZK1 PDZ4
A10 MAGI-3 PDZ1
D6
G2
ZO-3 PDZ3
PDZK2 PDZ1
A11 MAGI-3 PDZ2
D7
G3
C2PA PDZ
PDZK2 PDZ2
A12 MAGI-3 PDZ3
D8
G4
GIPC PDZ
PDZK2 PDZ3
B1
D9
G5
MAGI-3 PDZ4
MALS-1 PDZ
PDZK2 PDZ4
B2
D10 MALS-3 PDZ
G6
MAGI-3 PDZ5
LNX1 PDZ1
B3
D11
G7
NHERF-1 PDZ1
DENSIN-180
LNX1 PDZ2
B4
D12 RHOPHILIN-1
G8
NHERF-1 PDZ2
LNX1 PDZ3
B5
E1
G9
NHERF-2 PDZ1
RHOPHILIN-2
LNX1 PDZ4
B6
E2
G10 LNX2 PDZ1
NHERF-2 PDZ2
HARMONIN PDZ1
B7
E3
G11 LNX2 PDZ2
PSD95 PDZ1+2
HARMONIN PDZ2
B8
E4
G12 LNX2 PDZ4
PSD95 PDZ3
NEURABIN PDZ
B9
E5
H1
PDZ-GEF1 PDZ
SPINOPHILIN PDZ
PTPN4 PDZ
B10 CAL PDZ
E6
H2
α1-SYNTROPHIN
RHO-GEF PDZ
B11 nNOS PDZ
E7
H3
β1-SYNTROPHIN
RA-GEF PDZ
B12 INADL PDZ5
E8
H4
β2-SYNTROPHIN
ENIGMA PDZ
C1
E9
H5
INADL PDZ6
γ1-SYNTROPHIN
LARG PDZ
C2
E10 γ2-SYNTROPHIN
H6
SAP97 PDZ1+2
MAST205 PDZ
C3
E11 PAPIN 1
H7
SAP97 PDZ3
PTPN3 PDZ
C4
E12
H8
SAP102 PDZ1+2
MUPP1 PDZ1
SHANK1 PDZ
C5
F1
H9
SAP102 PDZ3
MUPP1 PDZ6
TAMALIN PDZ
C6
F2
H10 PAR-3 PDZ1
CHAP110 PDZ1+2
MUPP1 PDZ7
C7
F3
H11 PAR-3 PDZ2
CHAP110 PDZ3
MUPP1 PDZ8
C8
F4
H12 PAR-3 PDZ3
E6TP1 PDZ
MUPP1 PDZ10
The
membranes
were
blocked
in
blocking
buffer
(2%
milk
powder,
0.1% Tween-20, PBS) for 1 hour at room temperature (RT). The PDZ arrays
were overlaid with the purified GST-tagged MTMR fusion proteins and incubated
on a shaker for 1 hour with (25 nM GST-MTMR in blocking buffer). After
incubation with GST fusion proteins, the membranes were washed three times
for 5 min with blocking buffer. For detection the PDZ arrays were incubated with
blocking buffer containing the following antibody dilutions: goat anti-GST
(Amersham, #27-4577-01, 1:5000) and horse radish peroxidase (HRP) coupled
51
Experimental Procedures
secondary rabbit anti-goat antibody (Southern Biotech, #4010-05, 1:10’000).
Prior incubation with secondary antibodies the membranes were washed in
blocking buffer and after incubation washed in 0.1% Tween-20/PBS. Binding of
GST-MTMRs was visualized with ECL Plus western blotting detection kit
(Amersham, #RPN2132).
The PDZ-array results were visually evaluated by Philip Berger and Katharina
Schmid and summarized in a 96-grid scheme, reflecting the PDZ array. The
signal strength was related to the overall signals and rated from no signal (=0) to
strongest signal (=4) (Figure 7-3).
6.1.7 Pulldown experiments
6.1.7.1 GST pulldown experiments
Five microgramm purified GST-tagged MTMR protein and 0.5 µg purified Histagged PDZ-domain protein was subjected with 20 µl glutathione beads slurry
(50% in PBS) and the final volume was adjusted to 0.5 ml with lysis buffer
(50 mM Tris-HCl pH 8.0, 100 mM NaCl, 0.1% Triton X-100, 2 mM PMSF,
3 mM DTT, Roche protease inhibitor cocktail). The protein/beads suspension
rotated overnight at 4°C. After incubation, the bea ds were washed 2 times with
lysis buffer and bound protein was eluted with 30 µl elution buffer (50 mM TrisHCl pH 8.0, 100 mM NaCl, 0.01% Tween-20, 10 mM gluthathione). Eluted
supernatant was mixed with SDS PAGE Laemmli buffer and boiled for 5 min at
95°C. The protein samples were separated on a 12% S DS-PAGE and identified
by immunoblotting using mouse anti-penta-His (Qiagen, #34660, 1:1000) and
mouse anti-S-tag (Novagen, #71549-3, 1:5000) as primary antibodies and
alkaline phosphatase (AP) coupled secondary antibodies goat anti-mouse
(Southern Biotech, #1031-04, 1:10’000). Lumi-Phos™ WB (Thermo Scientific)
was used as AP substrate.
6.1.7.2 Immunoprecipitation of His-Mtm1 and Myc-Pdzk2 in HEK293 cells
The plasmid pcDNA3.1 hygro Myc-Pdzk2 for mammalian expression of Pdzk2
was kindly provided by our collaborator Jürg Biber (Institute of Physiology,
University of Zürich). The plasmids pcDNA3.1 zeo(+) RGS-His-Mtm1 and
52
Experimental Procedures
pcDNA3.1 zeo(+) RGS-His-Mtmr2 were cloned by Philipp Berger and pcDNA3.1
zeo(+) RGS-His-Mtm1-∆PDZ was cloned using pcDNA3.1 zeo(+) RGS-His-Mtm1
as template (see 6.1.1.3). HEK293 cells with a confluency of 80% were
transiently transfected by the calcium phosphate transfection method. For 10 cm
dishes, 600 µl solution A (250 mM CaCl2) containing 30 µg DNA were mixed with
600 µl solution B (140 mM NaCl, 50 mM HEPES, 1.5 mM Na2HPO4, adjusted to
pH 7.05). The mixture was incubated for 1 minute and then added to the cells.
The cells were maintained at 37°C in 5% CO 2 and grown in DMEM medium
(BioConcept, #1-26F03-I) containing 10% fetal bovine serum, 100 units/ml
penicillin and 100 µg/ml streptomycin. The medium was changed after 16 hours
and 40 hours after transfection the cells were washed with PBS and removed
from the plates with 4 ml lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl,
0.1% Triton X-100, 2 mM PMSF, Roche protease inhibitor cocktail). The cell
suspension was sonicated with 6 pulses and cell debris was removed by
centrifugation (10’000 x g, 10 min, 4°C). Two milliliter of the supernatant w as
incubated for 16 h with 60 µl protein A Sepharose CL-4B beads slurry (50% in
PBS, GE Healthcare) and mouse anti-penta-His antibodies (Qiagen, #34660,
1:1000). After incubation the mixture was centrifuged (500 x g, 5 min, 4°C) and
the beads were washed two times with lysis buffer. Bound protein was eluted by
boiling the beads in 30 µl Laemmli SDS-PAGE sample buffer for 5 min at 95°C.
The protein samples were separated on a 12% SDS-PAGE gel and identified by
immunoblotting using the following primary antibodies: mouse anti-Myc 9E10
(selfmade, 1:100) and mouse anti-penta-His (Qiagen, #34660, 1:2000). As
secondary antibodies alkaline phosphatase coupled goat anti-mouse AP
(Southern Biotech, #1031-04, 1:10’000) was used. Lumi-Phos™ WB (Thermo
Scientific) was used as AP substrate.
6.1.7.3 Immunoprecipitation of Mtm1 and Pdzk2 in mouse tissues
Tissue of wildtype mice were obtained from Dr. Michaela Miehe (Lab of Prof. Ueli
Suter, Institute of Cell Biology, ETH Zurich) and weighted (Table 6-6).
53
Experimental Procedures
Table 6-6: List of analyzed mouse tissues and total
immunoprecipitation experiment
Tissue
Weight
Liver
0.20 g
Kidney
0.14 g
Heart
0.15 g
Spleen
0.18 g
Lung
0.25 g
Intestine
0.20 g
Stomach
0.25 g
Cerebellum
0.15 g
Cortex
0.25 g
Thalamus
0.17 g
Muscle (hind leg)
0.24 g
amount
used
for
the
Tissue samples with a weight of 0.14-0.25 g were homogenized in 4 ml lysis
buffer (50mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% Triton X-100, 2 mM PMSF,
Roche protease inhibitor cocktail) using a polytron. Cell debris was separated
from soluble protein by centrifugation (4500 x g, 20 min, 4°C). The supernatant
was then incubated with 30 µl protein A Sepharose CL-4B (GE Healthcare)
beads for 1 h at 4°C, to clear the supernatant from endogenous mouse IgGs. The
pre-cleared lysate was then incubated with 30 µl protein A Sepharose and 0.5 µg
mouse anti-Mtm1 (Abnova, #H00004534-M01) antibody for 16 h at 4°C. Beads
were centrifuged (500 x g, 5 min, 4°C) and washed two times with lysis buffe r
and bound protein was eluted by boiling the beads in 30 µl Laemmli SDS-PAGE
sample buffer for 5 min at 95°C. The protein-sample s were separated on an 8%
SDS-PAGE gel and identified by immunoblotting as follows: rabbit anti-Pdzk2
(Thermo Scientific, #PA3-16819, 1:2000) and mouse anti-Mtm1 (Abnova,
#H00004534-M01, 1:2000). Alkaline phosphatase coupled goat anti-rabbit AP
(Southern Biotech, #4030-04, 1:10’000) and goat anti mouse AP (Southern
Biotech,
#1031-04,
1:10’000)
were used as
secondary antibodies
for
chemiluminescence detection. Lumi-Phos™ WB (Thermo Scientific) was used as
AP substrate.
6.1.7.4 Identification of Sap97 PDZ domains interacting with Mtmr2
Sf21 insect cells were distributed in a 6-well plate with a final density of
1.5 x 106 cells/well and infected with 1 µl of baculovirus V1 each. Five days after
54
Experimental Procedures
infection Sf21 insect cells expressing His-Mtmr2 and HA-Sap97 PDZ domains
(PDZ1, PDZ2 PDZ3, PDZ1-2 or PDZ1-3) were harvested and resuspended in
lysis buffer (100 mM Tris-HCl pH 8.6, 200 mM NaCl, 0.01% Tween-20, Roche
protease inhibitor cocktail). The suspension was sonicated and cell debris was
removed by centrifugation (10’000 x g, 10’, 4°C). The cleared lysate was
incubated for 16 h with 60 µl 50% protein A Sepharose CL-4B bead slurry (GE
Healthcare) and mouse anti-penta-His antibody (Qiagen, #34660, 1:100) at 4°C.
The beads were centrifuged (500 x g, 5 min, 4°C) and washed two times with
lysis buffer and boiled in Laemmli SDS-PAGE sample buffer for 5 min at 95°C.
Eluted proteins were separated on a 12% SDS-PAGE and identified by
immunoblotting as follows: rat anti-HA (3F10, Roche, #11867423001, 1:1000)
and mouse anti-penta-His (Qiagen, #34660, 1:1000). Alkaline phosphatasecoupled goat anti-mouse (Southern Biotech, #1031-04, 1:10’000) or rabbit antirat (Southern Biotech, #6180-01, 1:10’000) were used as secondary antibodies,
followed by chemiluminescence detection. Lumi-Phos™ WB (Thermo Scientific)
was used as AP substrate.
6.1.8 Cell culture and immunofluorescence microscopy
HEK293, COS and OK cells were maintained at 37°C in 5% CO2. HEK293 and
COS-7 cells were cultured in DMEM (BioConcept, #1-26F03-I) containing 10%
fetal bovine serum (FBS), 100 units/ml penicillin and 100 µg/ml streptomycin. OK
cells were cultured in 43.5% DMEM (BioConcept, #1-26F03-I), 43.5% HAM’s
F-12 (BioConcept, #1-14F03-I), 10% FBS, 2% HEPES pH 7.4, 100 units/ml
penicillin and 100 µg/ml streptomycin. For transient transfection the cells were
transfected in 3.5 cm dishes with FugeneHD (Roche) according manufacturer’s
recommendations. For Mtm1 and Pdzk2 colocalization studies, HEK293 and
COS-7 cells were transiently transfected with the following expression constructs:
pcDNA3.1 Myc-Pdzk2 with pcDNA3.1 RGS-His-Mtm1, pcDNA3.1 RGS-His-Mtm1
C375S, pcDNA3.1 RGS-His-Mtm1-∆PDZ or pcDNA3.1 RGS-His-Mtmr2. For the
localization studies of Mtm1 and Pdzk2 with endosomal markers, HEK293 cells
were transiently transfected with expression constructs for: RGS-His-Mtm1,
Myc-Pdzk2 and YFP-Rab4-Q67L, GFP-Rab5A-Q79L, EGFP-Rab7-Q67L or
55
Experimental Procedures
YFP-Rab11-Q70L. For the localization studies in OK NaPi-IIa cells, the
expression constructs pcDNA3.1 Myc-Pdzk2 and pcDNA3.1 RGS-His-Mtm1
were transfected into polarized OK cells. The cells were fixed with 2%
paraformaldehyde in PBS 48-72 hours after transfection. After permeabilization
in buffer (1% NP-40/PBS) for 10 min the cells were incubated with primary
antibodies for 3 hours and with secondary antibodies for 1.5 hours. Primary
antibodies were diluted in PBS as follows: mouse anti-RGS-His (Qiagen, #34610,
1:200), mouse anti-Mtm1 (Abnova, #H00004534-M01, 1:200), rabbit anti-Pdzk2
(Thermo Scientific, #PA3-16819, 1:500). Secondary antibodies were labeled with
Cy3, Cy5 or Alexa-488 (Invitrogen, Jackson ImmunoResearch Laboratories).
Samples were mounted in Citifluor AF1 (Citifluor). For the analysis a confocal
laser scanning microscope (Leica SP5) was used and single sections with a
thickness of 0.5 µm were obtained.
6.2 Characterization of Mtmr2/3-Pap complex
6.2.1 Plasmids and cloning
6.2.1.1 Plasmids for transient and stable expression in HEK293 cells
The pcDNA3.1 plasmids encoding RGS-His-tagged Mtmr2, RGS-His-tagged
Mtmr2 P589X and HA-tagged Sbf2 were previously described (Berger et al,
2006a; Berger et al, 2003). The construct for the expression of 3-Pap/Mtmr12
was kindly provided by H. Nandurkar (Nandurkar et al, 2001). His-tagged and
V5-tagged 3-Pap cDNAs were amplified by PCR from pCMV-Sport6 3-Pap
(mouse, Geneservice, IMAGE: 3661020) and cloned into the pcDNA3.1 zeo(+)
expression vector using ligase independent cloning as described previously
(Geiser et al, 2001). His-tagged and V5-tagged 3-Pap G654X missing the
C-terminal predicted coiled-coil motif were generated by mutating glycine 654
into a stop codon. Using the templates pcDNA3.1 His-3-Pap and pcDNA3.1
V5-3-Pap
and
by
using
the
oligonucleotides
(5’-ccagaagcccaaatcctgtgagtcgagtctagaggg-3’)
and
3-Pap-G654X-for
3-Pap-G654X-rev
(5’-ccctctagactcgactcacaggatttgggcttctgg-3’) the respective DNAs were amplified
56
Experimental Procedures
by PCR. All PCR-generated constructs were verified by restriction digest and
DNA sequencing.
6.2.1.2 Plasmids for baculovirus-based insect cell expression
The construct pFBDM His-Mtmr2 for expression in Sf21 cells was previously
described (Berger et al, 2006a). His- and Strep-tagII (named from now on
“Strep”) – tagged 3-Pap constructs were generated by two-step PCR from
pCMV-Sport6 3-Pap. Thereby an N-terminal TEV cleavage site and the
restriction sites EcoRI and SalI (Table 6-7) were introduced. EcoRI/SalI digested
PCR-fragments were ligated into EcoRI/SalI cut pFL vector (Fitzgerald et al,
2006) resulting in pFL His-3-Pap and pFL Strep-3-Pap. The constructs were
verified by restriction digest and DNA sequencing.
Table 6-7: Primers used for amplification of His-3-Pap and Strep-3-Pap from
pCMV-Sport6-3-Pap
Restriction sites EcoRI (in His_3PAP_for and Strep_3PAP_for) and SalI (in 3PAP_rev) are
underlined.
Fragment /
Primer Name
His-3-Pap
His_3PAP_for
TEV_for
3PAP_rev
Strep-3-Pap
Strep_3PAP_for
TEV_for
3PAP_rev
Primer sequence 5’-3’
5’-GATCGAATTCATGTCTGCACACCATCACCATCACCATGAGAATCTTTATTTT
CAGGGC-3’
5’-GATCGAGAATCTTTATTTTCAGGGCGCAGGACTGGGGAAAGGGGG-3’
5’-GATCGTCGACTCACACGTCCCCTAGG -3’
5’-GATCGAATTCATGTCTGCATGGTCACACCCACAATTCGAGAAAGAGAAT
CTTTATTTTCAGGGC-3’
5’-GATCGAGAATCTTTATTTTCAGGGCGCAGGACTGGGGAAAGGGGG-3’
5’-GATCGTCGACTCACACGTCCCCTAGG -3’
6.2.2 Generation of stable cell lines and cell culture
Stable HEK293 FlpIn cell lines expressing His-tagged Mtmr2, HA-tagged Sbf2 or
His-tagged Mtmr2 together with HA-tagged Sbf2 were previously described
(Berger et al, 2006a; Berger et al, 2009). The HEK293 FlpIn cell line
coexpressing His-tagged Mtmr2 and His-tagged 3-Pap was obtained by
integrating pcDNA3.1 zeo(+) His-3-Pap into the stable HEK293 His-Mtmr2 using
FugeneHD
(Roche)
as
transfection
reagent
according
manufacturer’s
recommendations followed by selection with hygromycin (Roche, 50 µg/ml) and
zeocin (Invitrogen, 100 µg/ml). HEK293wt cells were transfected with pcDNA3.1
zeo(+) His-3-Pap and selected with zeocin (Invitrogen, 100 µg/ml) to generate
57
Experimental Procedures
HEK293 cells expressing His-3-Pap. HEK293 and COS cells were maintained at
37°C in 5% CO 2. Both cell lines were cultured in DMEM (BioConcept,
#1-26F03-I) containing 10% fetal bovine serum, 100 units/ml penicillin and
100 µg/ml streptomycin.
6.2.3 Coimmunoprecipitation of Mtmr2 and 3-Pap from transiently
and stably transfected HEK293 cells
HEK293 wildtype cells were transiently transfected by the calcium phosphate
transfection method as previously described in 6.1.7.2. The medium was
changed after 16 hours and 40 hours after transfection the cells were washed
with PBS and removed from the plates with lysis buffer (0.5% Triton X-100/
100 mM NaCl/ 50 mM Tris-HCl pH 7.5/ 10 mM β-mercaptoethanol/ Roche
protease inhibitor cocktail). HEK293 cells stably expressing Mtmr2 and 3-Pap
were removed from the plate and lysed as described above. Cells were
sonicated and cell debris was removed by centrifugation. The supernatant was
incubated for 2 hours or overnight with 30 µl protein A Sepharose CL-4B
(GE Healthcare) and with the corresponding antibodies: 1 µg rabbit anti-3-Pap
(Sigma, #SAB2104232); 1 µg mouse anti-Mtmr2 (Tersar, 2008); 1 µg mouse
anti-penta-His (Qiagen, #34660); 1 µg mouse anti-V5 (Invitrogen, #R960-25).
The beads were washed three times with lysis buffer and boiled in Laemmli SDSPAGE sample buffer for 5 min at 95°C. Eluted protei ns were separated on an 8%
SDS-PAGE gel and identified by western blotting with mouse anti-Mtmr2 (Tersar,
2008;1:5), rabbit anti-3-Pap (Sigma, #SAB2104232, 1:5000), mouse anti-pentaHis (Qiagen, #34660, 1:1000) or mouse anti-V5 (Invitrogen, #R960-25, 1:5000).
Alkaline phosphatase-coupled goat anti-mouse (Southern Biotech, #1031-04,
1:10’000) or goat anti-rabbit (Southern Biotech, #4030-04, 1:10’000) were used
as secondary antibodies, followed by chemiluminescence detection.
6.2.4 Protein expression of Mtmr2 and 3-Pap in Sf21 insect cells
The construct pFBDM His-Mtmr2 for expression in Sf21 cells was previously
described (Berger et al, 2006a). The plasmids for the expression of His-tagged or
Strep-tagged 3-Pap were cloned into a EcoRI/SalI cut pFL vector (Fitzgerald et
al, 2006) resulting in pFL His-3-Pap and pFL Strep-3-Pap (6.2.1.2). The
58
Experimental Procedures
generation of baculovirus DNA, virus production, Sf21 insect cell transfection and
protein expression was performed as described (Fitzgerald et al, 2006). Sf21
insect cells were infected with baculovirus coding for His-Mtmr2 together with
Strep-3-Pap or with His-3-Pap and His-Mtmr2 alone. The cells were grown in
Lonza
serum-free
Insect-XPRESS™
medium
with
L-glutamine
(Lonza,
#BE12-730Q) at 27°C and harvested by centrifugation 3-5 days after infection.
6.2.5 Analytical protein purification of His-Mtmr2, Strep-3-Pap and
His-Mtmr2/Strep-3-Pap complex
Sf21 insect cell pellets were sonicated in lysis buffer as follows: His-Mtmr2 alone
or together with Strep-3-Pap (100 mM Tris-HCl pH 8.6, 200 mM NaCl, 0.01%
Tween-20, 10 mM imidazole, Roche protease inhibitor cocktail); His-3-Pap
(50 mM Tris-HCl pH 8.6, 350 mM NaCl, 10 mM imidazole, Roche protease
inhibitor cocktail). His-Mtmr2 and His-3-Pap lysates were purified independently
from each other with a NiNTA column, washed with lysis buffer and eluted with
increasing concentrations of imidazole. The eluate of the NiNTA column was
loaded on a Superdex 200 16/60 gelfiltration column and eluted in 100 mM TrisHCl pH 8.6 and 200 mM NaCl. His-Mtmr2/Strep-3-Pap lysate was first purified
with a StrepTrap column, washed in lysis buffer and eluted with lysis buffer
containing 2.5 mM D-desthiobiotin. The eluate of the StrepTrap column was
loaded for size exclusion chromatography on a Superdex200 16/60. The
molecular weight (MW) was estimated by comparing the elution spectra with the
BioRad gelfiltration standard. Fractions containing His-Mtmr2 and Strep-3-Pap
were pooled and additionally purified with a NiNTA column. The eluted proteins
and complexes of all performed purification runs were either analyzed with
Coomassie stained 8% SDS-PAGE or immunoblotting. The proteins were
detected with mouse anti-penta-His (Qiagen, #34660, 1:1000) and mouse antiStrep-tagII (IBA, #2-1507-001, 1:1000). As secondary antibody alkaline
phosphatase coupled goat anti-mouse (Southern Biotech, #1031-04, 1:10’000)
was used.
59
Experimental Procedures
6.2.6 Multi-angle light scattering (MALS) measurements and mass
spectrometry analysis
The multi-angle light scattering (MALS) experiments were performed at 20°C on
an Agilent 1100 HPLC-system (Agilent Technologies) coupled to an analyticalgrade Superdex 200HR 10/30 column (GE Healthcare) and connected to the
Wyatt miniDAWN Tristar (Wyatt Technologies) system. The column was
equilibrated in buffer as follows: for His-Mtmr2 in 100 mM Tris-HCl pH 8.6 and
200 mM NaCl; for His-3-Pap in 50 mM Tris-HCl pH 8.6 and 350 mM NaCl. For
each MALS measurement, 100 µg of concentrated His-Mtmr2 or His-3-Pap
protein was loaded onto the SEC column. The elution profiles were recorded as
UV-absorbance at a wavelength of 280 nm and as the intensity of Rayleigh
scattering at three different angles. To calculate the average molecular mass the
ASTRA™ software (Wyatt Technologies) was used.
To analyze the amino acid composition of the purified His-tagged Mtmr2 and
His-tagged 3-PAP proteins, the peptides were analyzed by mass spectrometry as
previously described (see 6.1.5).
6.2.7 Small-Angle X-ray Scattering (SAXS)
6.2.7.1 SAXS analysis
Small-angle X-ray scattering (SAXS) experiments were performed at the cSAXS
beamline X12SA at the Swiss Light Source (SLS) in Villigen, Switzerland. A
wavelength of λ=1 Å was used and the scattered intensities were collected with a
Pilatus 2M detector. The scattering vector range was 0.008 [1/Å] – 0.400 [1/Å].
The length of the scattering vector is defined as q = 4πsinθ/λ, where 2θ is the
scattering angle. A standard Silver Behenate sample was used to calibrate the qrange (Huang et al, 1993). The purified protein samples and the corresponding
buffer solutions were measured in quartz capillaries of 1 mm diameter
(Hilgenberg GmbH, Germany). Two series of measurements were necessary to
subtract background scattering from the actual protein scattering. First each
capillary filled with buffer was measured. After data collection the capillaries were
emptied and the second measurement series was performed on the
corresponding protein sample. The data was recorded at several positions along
60
Experimental Procedures
the capillary with an exposure time of 0.5 s per position. For each protein sample
three different concentrations were measured.
6.2.7.2 SAXS data analysis and evaluation
Each data set is composed of a subset of frames. Individual frames were
checked for radiation damage and radiation damage-free frames were integrated
and averaged using the in-house MATLAB macros programmed by Dr. John
Missimer and Dr. Kaisa Kisko. The buffer backgrounds were subtracted from the
protein using the program PRIMUS from the ATSAS package (Konarev et al,
2006; Konarev et al, 2003). Kratky-plots were calculated to analyze the proper
folding of the measured protein. The radius of gyration (Rg) was calculated from
the data in the Guinier region. The distance distribution function P(r) was
calculated using the program AUTOGNOM and was used as input for the
ab-initio shape reconstruction program DAMMIN (Konarev et al, 2006). For each
protein concentration 20 independent DAMMIN reconstructions were calculated,
checked for consistency and averaged with DAMAVER (Konarev et al, 2006).
Generated models were illustrated in PyMol (www.pymol.org). Analysis of the
macromolecular interfaces and assemblies of the PDB files of Mtmr2 (1LW3 and
1M7R) was performed with the interactive online tool PISA (Krissinel et al, 2007).
The Mtmr2 and 3-Pap ab-initio shape reconstruction models were manually
superimposed with the crystal structure of Mtmr2 monomer (PDB: 1LW3) or with
the PISA evaluated Mtmr2 dimer (PISA-dimer) using PyMol.
6.2.7.3 Protein crystallization of His-3-Pap, Strep-3-Pap and
His-Mtmr2/Strep-3-Pap complex
All protein samples were treated as previously described in chapter 6.1.4.
His-3-Pap, as indicated in Table 6-8, was incubated 30 min on ice with 1:100 or
1:1000 (w/w) α-chymotrypsin prior distribution into the crystallization plate.
61
Experimental Procedures
Table 6-8: Applied crystallization screens for 3-Pap and Mtmr2/3-Pap complex
Represented are protein concentrations and applied crystal screens used for screening crystal
growth. His-3-Pap was additionally treated with α-chymotrypsin, as indicated in the column
“additives”.
Protein
His-3-Pap
Strep-3-Pap
His-Mtmr2
Strep-3-Pap
Conc. [mg/ml]
3.1; 4.94; 10.63
2.53; 4.94
Screen
Nextal - The pHClear Suite
Qiagen - The JCSG Core Suite I-IV
4.4
Qiagen - The JCSG Core Suite I-IV
4.4
Qiagen - The JCSG Core Suite I-IV
2.97
Qiagen - The JCSG Core Suite I-IV
1.49
Qiagen - The JCSG Core Suite I-IV
Additives
1:100 (w/w)
α-chymotrypsin
1:1000 (w/w)
α-chymotrypsin
6.2.8 Immunofluorescence miscroscopy
6.2.8.1 Immunostainings of Mtmr2/3-Pap cotransfected HEK293 cells under
steady-state and hypo-osmotic conditions
HEK293 cells were transfected in 3.5 cm dishes with FugeneHD (Roche)
according manufacturer’s recommendations. Equal amounts of pcDNA3.1
RGS-His-Mtmr2 and pcDNA3.1 V5-3-Pap were used for the transfection reaction.
One day after transfection, the cells were starved overnight in 1% BSA/DMEM
and fixed 48 hours after transfection with 2% paraformaldehyde in PBS (steadystate condition). Hypo-osmotic conditions were applied as previously described
(Berger et al, 2003; Berger et al, 2006a). Cells were permeabilized in buffer
(1% NP-40/PBS) for 10 min. Permeabilized cells were incubated with primary
antibodies for 3 hours and with secondary antibodies for 1.5 hours. Primary
antibodies were diluted in PBS as follows: mouse anti-RGS-His (Qiagen, #34610,
1:200), mouse anti-V5 (Invitrogen, #R960-25, 1:200), rabbit anti-3-Pap (Sigma,
#SAB2104232, 1:200). Secondary antibodies were labeled with Cy3 and Alexa488 (Invitrogen, Jackson ImmunoResearch Laboratories). Samples were
mounted in Citifluor AF1 (Citifluor) or gelvatol. A confocal laser scanning
microscope (Leica SP5) was used for the analysis and to obtain single sections
with a thickness of 0.5 µm.
62
Experimental Procedures
6.2.8.2 Immunostainings of EGF stimulated COS and HEK293 cells
Cells were transfected in 3.5 cm dishes with FugeneHD (Roche) according
manufacturer’s recommendations. COS cells were cotransfected with 0.7 µg
pcDNA3.1 RGS-His-Mtmr2, 0.7 µg pcDNA3.1 V5-3-Pap and 0.6 µg flurorescently
tagged
YFP-Rab4-Q67L,
GFP-Rab5A-Q79L,
EGFP-Rab7-Q67L
or
YFP-Rab11-Q70L. One day after transfection the cells were starved overnight in
1% BSA/DMEM and stimulated with 200 ng Alexa647 conjugated EGF
(Invitrogen, #E35351). HEK293 cells were cotransfected with pRC-hEGFR,
pcDNA3.1 RGS-His-Mtmr2 and/or pcDNA3.1 V5-3-Pap and/or constructs for the
expression of fluorescently tagged endosomal markers (same as above). One
day after transfection the cells were starved overnight in 1% BSA/DMEM and
stimulated with 200 ng Alexa647 conjugated EGF (Invitrogen, #E35351).
Quadruple transfected cells
were stimulated
with 30 ng/ml
unlabeled
recombinant human EGF (rhEGF, Lonza, #CC-4107). The cells were fixed and
permeabilized as described above (6.2.8.1). Antibodies were diluted in PBS as
follows:
mouse
anti-RGS-His
(Qiagen,
#34610,
1:200),
mouse anti-V5
(Invitrogen, #R960-25, 1:200), rabbit anti-3-Pap (Sigma, #SAB2104232, 1:200).
Secondary antibodies were labeled with Cy3, Cy5 and Alexa-488 (Invitrogen,
Jackson ImmunoResearch Laboratories). Samples were mounted in Citifluor AF1
(Citifluor) and analyzed by using the confocal laser scanning microscope (Leica
SP5) as described above.
63
Results
7 Results
7.1 Identification of new PDZ binding partners
To identify novel putative PDZ-domain containing proteins interacting with the
C-terminus of the proteins Mtm1, Mtmr1, MTMR1, Mtmr2, Sbf1, Sbf2, NRP1,
NRP2 and Pten, we decided to made use of the well-established proteomic PDZ
array based screen (Fam et al, 2005). All PDZ domain proteins spotted on the
membrane are His- and S-tagged fusion proteins (see also chapter 6.1.6). To
assess the binding of the above mentioned MTMRs and proteins, the carboxyterminal 25 amino acids of each MTMR (named C-term), were fused C-terminally
to a GST-tag by cloning into the pET42a expression vector.
7.1.1 Expression and purification of recombinant GST-tagged MTMR
C-term proteins
Small scale expression tests showed that all recombinant GST-fusion proteins
could be expressed upon induction with 1 mM IPTG in E. coli Acella cells
(EdgeBio, #42649). The expression maximum was reached after 4 hours of
induction (data not shown). GST-tagged MTMRs that were expressed and
purified are listed in Table 7-1.
Table 7-1: List of expressed and purified GST-tagged proteins
Construct
Species
Expected MW [Da]
MW based on MS [Da]
GST-Mtm1 C-term
mouse
30908
30909
GST-Mtmr1 C-term
mouse
30894
31810
GST-MTMR1 C-term
human
30826
32048
GST-Mtmr2 C-term
mouse
30903
32430
GST-Sbf1 C-term
mouse
31278
n.d.
GST-Sbf2 C-term
mouse
31190
32105
GST-NRP1 C-term
human
31215
32132
GST-NRP2 C-term
human
31324
31324
GST-Pten C-term
mouse
31331
n.d.
64
Results
Pelleted cells were lysed, sonicated and centrifuged. The soluble protein fraction
was loaded on a GST Trap™ column. Bound protein was eluted with reduced
glutathione after column washing. Figure 7-1 (A) shows the purification of GSTMtm1 C-term and is representative for all GST purifications. The GST-tagged
proteins were analyzed for their amino acid integrity by mass spectrometry. The
corresponding MS-chromatogram is represented in Figure 7-1 (B). Expected
molecular mass of GST-Mtm1 C-term is 30909 Da, which could be confirmed by
MS. Part of the protein missed the C-terminal methionine or was glutathionylated
at one cysteine, leading to a decrease of 131 Da or increase of 305 Da in
molecular mass, respectively. However, concluding from the MS chromatogram
no further amino acid substitutions could be observed at the N-terminus or the Cterminus. Therefore, purified GST-Mtm1 C-term protein was expected to harbour
the PDZ-binding motif. MS chromatograms of the remaining purified GST-tagged
proteins can be found in the appendix chapter 9.1.
Figure 7-1: Purification and MS analysis of GST-Mtm1 C-term
(A) Recombinant GST-tagged Mtm1 C-term was expressed in E. coli Acella cells and purified with
a GST Trap column. Eluted fractions were analyzed with Coomassie stained SDS-PAGE. (B)
Mass spectrometry result of purified GST-Mtm1 C-term shows a main signal at 30908 Da,
corresponding to the full length protein (expected MW: 30909 Da). Some protein fraction misses
the methionine (orange), leading to a final mass of 30770 Da or got glutathionylated at one
cysteine, leading to an increase of the molecular weight of 305 Da (red) to 31214 Da.
65
Results
7.1.2 PDZ-domain array - Overlay results
Our collaborator Randy Hall provided ten PDZ-array membranes. We were
therefore restricted to test in maximum ten different GST-tagged C-termini. By
following the protocol and using for the overlay experiment 500 nM purified
protein, resulted in a strong unspecific background signal (data not shown). After
having adjusted the overlaying protein concentrations to 25 nM the signal output
was qualitatively acceptable, showing reduced background signals. The finetuning of the experimental procedure wasted 2 membranes, why were left with
8 PDZ array membranes for the actual analysis. To be able to test most of the
generated GST-fusion proteins, we decided to omit performing the experiments
in triplicates and to leave the negative control, the GST protein itself, out. The
PDZ array membranes were individually overlaid with 25 nM of the following
purified
GST
fusion
proteins:
GST-Mtm1 C-term,
GST-MTMR1 C-term,
GST-Mtmr1 C-term, GST-Mtmr2 C-term, GST-Sbf1 C-term, GST-Sbf2 C-term,
GST-NRP1 C-term, GST-NRP2 C-term and GST-Pten C-term. The overlay with
GST-NRP1 C-term and GST-NRP2 C-term resulted in no detectable signals
(data not shown). The result of the overlay with GST-Mtm1 C-term is represented
in Figure 7-2 (A) and positive signals are listed and highlighted in black (B). The
overlay results of GST-MTMR1 C-term, GST-Mtmr1 C-term, GST-Mtmr2 C-term,
GST-Sbf1 C-term, GST-Sbf2 C-term and GST-Pten C-term can be found in the
appendix (9.1).
66
Results
Figure 7-2: PDZ array overlaid with GST-Mtm1 C-term
(A) The PDZ array spotted with 96 class I PDZ domains (listed in B) was overlaid with 25 nM
purified GST-Mtm1 C-term. Positive interactions appear as dark spots. (B) List with the 96 class I
PDZ domains spotted on the membrane. Positive interactions are highlighted in black, negative
results are kept in grey.
67
Results
The strength of the interactions was rated independently by me and by Philipp
Berger in an arbitrary manner, by considering the darkness of the spots. Figure
7-3 represents the summary of my own rating. The rating of Philipp Berger can
be found in the appendix (Supplementary Figure 9-7). Comparing both ratings,
they were congruent with respect to the categorization into Mtm1 specific, MTMR
specific and unspecific signals. However, both ratings differed in the strength of
the rating of the indivual signals, which especially affected the categorization of
signals which are MTMR1 but not Mtmr1 specific (and vice versa). To summarize
the overlay results of myotubularins only, the evaluation of the overlay of
GST-Pten C-term was ignored in this scheme. For simplification, the following
discussion refers to the rating represented below, in Figure 7-3. Interestingly the
bins B4, B11, D11 and F3 (depicted with a yellow background) were strongly
positive for all conducted overlays, and a general unspecific binding for these
particular PDZ domains cannot be excluded. For GST-Mtm1 C-term, strong
interactions (dark spots) appeared for MAGI-3 PDZ1, NHERF1, NHERF2,
MUPP1 PDZ8, PTPN13 PDZ4+5 and PDZK2 PDZ3. Especially to mention is the
strong
interaction
for
PDZK2
PDZ3
(G4),
which
was
unique
for
GST-Mtm1 C-term (depicted with blue background). As expected, Mtmr2 C-term
interacted
with
SAP97
and
PSD95.
Interestingly
the
interaction
with
SAP97 PDZ 1-2 (C2) and SAP97 PDZ3 (C3) seemed to be specific for
Mtmr1/MTMR1 and Mtmr2, but not for Mtm1 (colored with brown background).
The C-terminal amino acid sequence composition between human MTMR1
(-ATSVHTSV) and mouse Mtmr1 (-ATPVHTSV) is similar for the last 5 residues,
but deviates at the sixth last position. The PDZ overlay revealed that Mtmr1 and
MTMR1 binding differed in at least 8 cases including MAGI3-PDZ1, PSD95
PDZ3, PDZ-GEF1 PDZ, CAL PDZ, ZO2-PDZ1, ZO3-PDZ2, HARMONIN PDZ2,
PAPIN1, MUPP1 PDZ1 and PTPN13 PDZ1 (colored with grew background).
Whether the sixth last amino acid proline in the carboxy-terminus of Mtmr1 might
have an effect on the overall structure of the PDZ-BD motif and therefore on the
binding would have to be investigated.
68
Results
Figure 7-3: Arbitrary rating of the PDZ array results
Depicted is a scheme representing the PDZ array with the 96 different spotted PDZ domains
listed in Table 6-5 and Figure 7-2, B. Positive signals for GST-Mtm1 C-term,
GST-MTMR1 C-term, GST-Mtmr1 C-term, GST-Mtmr2 C-term, GST-Sbf1 C-term and GST-Sbf2
C-term were weighted in an arbitrary manner considering the darkness of the spot and are
illustrated as green dots: weak signal (one green dot) to strong signal (four green dots). Mtm1
and MTMR specific interactions are colored with blue or brown background, respectively. Signals
which differed between human MTMR1 and mouse Mtmr1 are colored with a grey background.
7.1.3 Verification of the PDZ array results by GST pulldown
experiments
Our collaborator Randy Hall kindly provided a subset of plasmids for the
expression of S-tag and His-tagged PDZ domains in E. coli (see Table 6-3).
Sequencing of the plasmids (data not shown) with T7 primer (Microsynth)
revealed that a point mutation in the sequence coding for GIPC lead to an early
stop codon and the plasmid pET30a ERBIN PDZ was indeed pET30a Rho GEF
PDZ. Sequence alignment with nNOS was negative. All other plasmid sequences
were correct. The positive plasmids were transformed into E. coli Acella cells for
protein expression. NHERF-1 PDZ2 and PDZK2 PDZ1 were not expressable. All
other PDZ domains were purified with a NiNTA column. The GST pulldown
experiments were performed with purified GST-tagged protein together with
crude lysate of transformed E. coli expressing the PDZ domains or NiNTA
purified PDZ domain protein. GST alone was used as negative control. GST
pulldown results are summarized in Figure 7-4. The Mtm1 specific signal for
PDZK2 PDZ3 found in the PDZ array overlay was confirmed by GST pulldown
(Figure 7-4, A). Protein interactions specific for Mtmr1/MTMR1 and Mtmr2, but
69
Results
not for Mtm1, were found for the PDZ domains SAP97 PDZ1+2, PTPN13
PDZ4+5 and PSD95 PDZ3 (Figure 7-4, B). Furthermore, in the case of
PTPN13 PDZ4+5 mouse Mtmr1 and mouse Mtmr2 seem to interact stronger with
PTPN13 PDZ4+5 compared to human MTMR1, consistent with the rating of the
PDZ-array. In the case of SAP97 PDZ3, Mtm1 was not observed to interact in the
PDZ-array overlay. However, in the corresponding GST pulldown Mtm1
coprecipitated SAP97 PDZ3 (Figure 7-4, C). Comparing the precipitated amount
of SAP97 PDZ3 between GST-Mtmr1 and GST-MTMR1, the SAP97 PDZ3
coprecipitated with higher amount in the GST-MTMR1 pulldown. Additionally, the
two negative controls, Mtmr2-∆PDZ and GST, were able to precipitate SAP97
PDZ3. Due to these findings this pulldown was classified as “unspecific or no
interaction” (Figure 7-4, C). MAGI-3 PDZ1 signal was negative for MTMR1 in the
PDZ-array overlay. Examining the GST-pulldown, MAGI-3 PDZ1 coprecipitated
strongly with all, including the negative control GST, except for Mtmr2-∆PDZ,
Sbf1 and Sbf2. Since these interactions could be MTMR specific as well as
unspecific, they were also classified as “unspecific or no interaction”. Considering
the PDZ-overlay results, MUPP1 PDZ8 was rated as unspecific. In the GSTpulldown experiments, MUPP1 PDZ8 coprecipitated with all GST fusion protein,
confirming this observation. Nonetheless, it should be mentioned that MUPP1
PDZ8 coprecipitated in higher amounts with MTMR1, Mtmr2-∆PDZ, Sbf2 and
NRP1 (Figure 7-4, D). PDZK1 PDZ3 was expected to coprecipitate only with
Mtm1, but precipitated with all GST fusion proteins. DENSIN-180 and NHERF2
PDZ2 were expected to coprecipitate with some GST proteins, but did not
coprecipitate at all.
70
Results
Figure 7-4: Overview of GST pulldowns
Indicated purified GST-tagged MTMRs were bound to glutathione sepharose and incubated with
indicated purified PDZ domain proteins or the corresponding crude lysates. Precipitated protein
was analyzed with SDS-PAGE and visualized with immunoblotting (IB) using anti S-tag antibody.
(A) S-tag-PDZK2 PDZ3 coprecipitated only with GST-Mtm1 C-term. (B) S-tagged
SAP97 PDZ1+2, PTPN13 PDZ4+5 and PSD95 PDZ3 coprecipitated with GST-Mtmr1 C-term,
GST-MTMR1 C-term and GST-Mtmr2 C-term. (C) SAP97 PDZ3, MAGI-3 PDZ1, MUPP1 PDZ8
and PDZK1 PDZ3 coprecipitated with all GST fusion proteins including the GST control,
rendering the interactions unspecific. DENSIN-180 and NHERF2 PDZ2 did not coprecipitate with
any GST fusion proteins.
7.1.4 Characterization of Pdzk2 as binding partner of Mtm1
The PDZ array and the GST pulldown results showed that the last 25 amino
acids of Mtm1 fused to GST are able to interact with the third PDZ domain of
Pdzk2. This interaction was specific for Mtm1. Next we wanted to verify, whether
this protein-protein interaction indeed takes place through the last 5 C-terminal
amino acids of Mtm1 and whether this interaction also occurs with full length
proteins expressed in vivo. Therefore we performed immunoprecipitation
experiments from transiently transfected HEK293 cells and mouse tissues.
71
Results
7.1.4.1 Pdzk2 coimmunoprecipitates with Mtm1 in HEK293 cells and mouse
tissues
Human embryonic kidney 293 cells (HEK293) were transiently cotransfected with
expression vectors for full length Myc-Pdzk2 and His-Mtm1, His-Mtm1-∆PDZ or
His-Mtmr2. Cells were harvested and cell extracts were subjected to
immunoprecipitation with anti-penta-His antibodies. Precipitated protein was
analyzed by immunoblotting using anti-Myc and anti-penta-His antibodies. Pdzk2
coprecipitated with Mtm1, but not with Mtm1-∆PDZ, lacking the last 5 amino
acids consisting the PDZ-BD motif (Figure 7-5, A). Therefore, full length Pdzk2
and Mtm1 interact in HEK293 cells and protein-protein interaction is clearly
dependent on the last 5 carboxy-terminal amino acids.
To test, whether Mtm1 and Pdzk2 also interact in vivo, a set of mouse tissues
was obtained from wildtype mice and homogenized in lysis buffer. Crude cell
extract was subjected to immunoprecipitation with anti-Mtm1 antibody and the
associated Pdzk2 was analyzed with Western blot using anti-Pdzk2 antibody.
Here we show for the first time, that Mtm1 interacts with Pdzk2 in mouse tissues
(Figure 7-5, B). Mtm1 and Pdzk2 were not detectable in crude lysates by
immunoblotting, therefore the loading control was missing. We suggested that
the expression of Mtm1 and Pdzk2 in the analyzed tissues was very low. Pdzk2
was also named intestinal and kidney-enriched PDZ protein (IKEPP) based on its
mRNA distribution in human cells (Scott et al, 2002). Our pulldown results
showed that Pdzk2 protein is additionally present in other tissues. Interestingly,
Pdzk2 seemed to coprecipitate in higher amounts from cerebellum, muscle,
stomach, heart, spleen and liver compared to kidney and intestine.
72
Results
Figure 7-5: Mtm1 interacts with Pdzk2 in HEK293 cells and in mouse tissues
(A) HEK293 cells were transiently transfected with Myc-tagged Pdzk2 and His-tagged Mtm1, Histagged Mtm1-∆PDZ or His-tagged Mtmr2. As negative controls the cells were transfected with
Myc-Pdzk2, His-Mtm1, His-Mtm1-∆PDZ or His-Mtmr2 alone. His-tagged proteins were
immunoprecipitated from crude lysates with anti-penta-His antibody. Immunoblots were probed
with anti-Myc and anti-penta-His antibodies. Myc-Pdzk2 associated specifically with His-Mtm1 but
not with the PDZ-BD deletion mutant His-Mtm1-∆PDZ. (B) Crude mouse lysates of obtained
tissues were incubated with sepharose beads and anti-Mtm1 antibody. Immunoblots were probed
with Mtm1 and Pdzk2 specific antibodies. The interaction Mtm1 with Pdzk2 can be observed in all
tested mouse tissues, especially in cerebellum, muscle, stomach, heart, spleen and liver.
7.1.4.2 Colocalization of Mtm1 and Pdzk2 in COS-7 and HEK293 cells
Previous reports have shown that Mtm1 transfected cells displayed staining in
the nucleus, the cytosol and at the plasma membrane (Nandurkar et al, 2003;
Kim et al, 2002; Laporte et al, 2002a). Overexpression of Mtm1 resulted in
membrane projections, extensive filopodia and localization in membrane ruffles
(Laporte et al, 2002a; Kim et al, 2002). This phenotype however, was disrupted
in cells coexpressing Mtm1 with the inactive adaptor unit 3-Pap (Nandurkar et al,
2003). In vivo immunostainings of Pdzk2 predominantly showed staining in the
subapical compartment in mouse renal proximal tubules (Gisler et al, 2001). To
analyze, whether Mtm1 and Pdzk2 colocalize in human cells, we transiently
transfected COS-7 (African green monkey kidney) cells and HEK293 cells with
73
Results
the expression vectors for His-Mtm1, His-Mtm1 C375S, His-Mtm1-∆PDZ and
Myc-Pdzk2.
In COS-7 cells, Mtm1 staining was observed in the cytosol as vesicular
structures and at the plasma membrane (Figure 7-6, A). Pdzk2 showed similar
staining, and colocalized with Mtm1 (Figure 7-6, A: indicated by arrows and
visible in yellow in Merge). Myotubularin mutants Mtm1 C375S (Figure 7-6, B)
and Mtm1-∆PDZ (Figure 7-6, C) showed similar staining compared to their
wildtype (Figure 7-6, A) and colocalization with Pdzk2 was not disturbed. The
mutations did therefore not affect the localization of Mtm1. Interestingly, while
using Mtmr2 as control, we observed that Pdzk2 also colocalized with Mtmr2
vesicles (Figure 7-6, D). Since Mtm1 and Mtmr2 were reported to localize at
endosomal compartments, localization of Pdzk2 at these vesicles suggests a
scaffolding function at these membranes.
74
Results
Figure 7-6: Pdzk2 colocalizes with Mtm1 in transiently transfected COS-7 cells.
COS-7 cells were transiently cotransfected with Pdzk2 and RGS-His-tagged Mtm1, Mtm1 C375S,
Mtm1-∆PDZ or Mtmr2 (A-D). Cells were probed with Mtm1, Pdzk2 or RGS-His specific primary
antibodies. Merged images are shown on the right panels, where yellow staining indicated by
arrows show colocalization of Pdzk2 (red) with MTMR protein (green). White boxes indicate
regions which are represented as magnified views on the right. Scale bar = 10 µm.
To verify these results, we additionally transfected HEK293 cells and repeated
the immunostainings. All MTMRs localized to the cytosol in vesicular structures,
as previously seen in COS-7 cells. Immunostaining of Pdzk2 resulted in staining
of vesicular, punctuate structures in the cytosol and structures below the plasma
membrane. These results agree with the COS-7 immunostainings of Pdzk2.
Pdzk2 colocalization was observed with Mtm1 and Mtmr2 (Figure 7-7, A and D)
but not with Mtm1 C375S or Mtm1-∆PDZ (Figure 7-7, B and C).
75
Results
Figure 7-7: Pdzk2 colocalizes with Mtm1 in transiently transfected HEK293 cells
HEK293 cells were transiently cotransfected with Pdzk2 and RGS-His-tagged Mtm1,
Mtm1 C375S, Mtm1-∆PDZ or Mtmr2 (A-D). Cells were probed with Mtm1, Pdzk2 or RGS-His
specific primary antibodies. Merged images are shown on the right panels, where yellow staining
indicated by arrows show colocalization of Pdzk2 (red) with MTMR protein (green). White boxes
indicate regions, represented as magnified views on the right. Scale bar = 10 µm.
The substrate specificity of Mtm1 for PI-3,5-P2 and PI-3-P suggest a function in
endocytosis, sorting and degradation. PI-3,5-P2 is generated from PIKfyve, which
localizes to endosomes (Gaullier et al, 1998; Simonsen et al, 1998). Localization
studies of endogenously expressed Mtm1 as well as of overexpressed Mtm1 and
its phosphatase inactivated mutant Mtm1 C375S, showed colocalization with
Rab5 and Rab7 positive vesicles in BHK cells (Cao et al, 2007). For a more
detailed localization study of Mtm1 and Pdzk2, HEK293 cells were transiently
76
Results
cotransfected with the constitutively active endosomal markers Rab4-Q67L,
Rab5A-Q79L, Rab7-Q67L and Rab11-Q70L. Mtm1 clearly colocalized with
Pdzk2 along the plasma membrane and on vesicles, depicted in the merged
figures as magenta (Figure 7-8). However, no colocalization of Mtm1 or Pdzk2
with any of the four tested endosomal markers could be observed.
Figure 7-8: Intracellular localization of Mtm1 and Pdzk2
HEK293 cells were transiently cotransfected with Pdzk2, RGS-His-tagged Mtm1 and constitutive
active endosomal markers YFP-Rab4-Q67L, GFP-Rab5A-Q79L, EGFP-Rab7-Q67L and
YFP-Rab11-Q70L. Cells were probed with Mtm1, Pdzk2 or RGS-His specific primary antibodies.
Merged images are shown on the right panels. Colocalization of Pdzk2 (blue) with Mtm1 (red) is
visible in magenta. White boxes indicate regions, represented as magnified views on the right.
Scale bar = 10 µm.
77
Results
7.1.4.3 Localization studies of Mtm1, Pdzk2 and the sodium phosphate cotransporter NaPi-IIa in opossum kidney cells
Yeast two-hybrid screen against the C-terminal, cytosolic tail of the type II Na+dependent inorganic phosphate (NaPi-IIa) cotransporter revealed the interaction
with the NHERF protein family members NHERF1, NHERF2, PDZK1 and PDZK2
(Gisler et al, 2001). NaPi-IIa cotransporter plays an important role in renal
phosphate reabsorption and homeostasis at the brush border membrane.
Parathyroid hormone (PTH) regulates phosphate homeostasis and was shown to
induce internalization and mediate increased lysosomal degradation of NaPi-IIa
(Pfister et al, 1998; Pfister et al, 1997). Opossum kidney cells (OK) are a wellestablished model system to study PTH dependent regulation of NaPi-IIa
cotransporter (Malmstrom et al, 1986). Since Mtm1 has a regulatory effect on the
trafficking and degradation of EGF receptor, we were wondering whether binding
of Mtm1 to Pdzk2 might have a similar influence on the PTH induced degradation
of NaPi-IIa. To analyze that, we first had to test, whether OK cells stably
transfected with NaPi-IIa (kind gift of H. Murer and N. Hernando, University of
Zurich) were suitable for transient transfections and subsequent monitoring of
PTH induced NaPi-IIa trafficking.
Immunostaining of polarized OK cells stably expressing V5-tagged NaPi-IIa cells
transiently transfected with His-Mtm1 and Myc-Pdzk2 are depicted in Figure 7-9.
Consistent with previous localization studies (Blaine et al, 2009; Pfister et al,
1997; Pfister et al, 1998) NaPi-IIa clustered at the apical plasma membrane
(Figure 7-9, A) and could be observed in microvilli (Figure 7-9, B and C). Pdzk2
localized subapically of the plasma membrane in the cytoplasm (Figure 7-9, C
transsections). Mtm1 localized in vesicular structures distributed in the cytosol
(Figure 7-9, B and C). No colocalization of Mtm1 and Pdzk2 was observed.
78
Results
Figure 7-9: Immunostaining of NaPi-IIa, Mtm1 and Pdzk2 in OK cells
Opossum kidney cells stably expressing V5-tagged NaPi-IIa were transiently transfected with
His-Mtm1 and Myc-Pdzk2. His-Mtm1 was stained with anti-RGS-His. V5-NaPi-IIa was detected
with anti-V5 antibodies. Pdzk2 was stained with anti-Myc antibodies. (A) V5-NaPi-IIa, false
colored in red, clustered at the apical plasma membrane and (B) in microvilli (arrow). (C) Pdzk2
(blue) localized to the subapical cytoplasm and Mtm1 (green) in vesicular structures. Single
sections with a thickness of 0.5 µm were obtained by using a confocal laser scanning microscope
(Leica SP5). Scale bar = 30µm
We subsequently stimulated the transiently transfected OK V5-NaPi-IIa cells with
0.1 µM PTH and fixed the cells 0, 120 and 270 min after stimulation prior to
immunostaining (data not shown). Unfortunately we had to face the following
problems: 1st only approximately 5% of the OK cells polarized at all. 2nd of the
polarized cells, only few cells showed expression of NaPi-IIa, rendering the
NaPi-IIa expresssion highly inhomogeneous. It was therefore impossible to
differentiate between stimulated and non-expressing cells. Additionally, this
reduced the probability of polarized cells positive for transient transfection of
Mtm1 and Pdzk2. Western blot analysis of PTH stimulated OK V5-NaPi-IIa cells
confirmed these observations. V5-NaPi-IIa was not detectable and degradation
of NaPi-IIa upon PTH stimulation could not be observed (data not shown). We
79
Results
therefore concluded that the OK V5-NaPi-IIa cells were inappropriate for our
purposes and stopped the experiments at this point.
7.2 Structural analysis of MTMRs and MTMR-complexes
Up to date no crystal complexes of MTMR proteins with PDZ domain containing
proteins or with other MTMR family members have been reported. The
knowledge of the structure on the atomic level, the position and conformation of
the individual proteins to each other as well as the detailed information about the
macromolecular interfaces would help to understand e.g. differences in
localization and binding affinities towards phosphoinositides. To study the binding
domain characteristics of Mtmr2 with the PDZ-domain containing protein Sap97
and the inactive phosphatase Sbf2, we expressed the protein complexes in
insect cells for further analytical purification as well as crystallization.
7.2.1 Structural analysis of the Mtmr2/Sap97 complex
Synapse-associated protein 97 (Sap97), also known as Disc large 1 (Dlg1), is a
PDZ-domain containing scaffolding molecule of the membrane-associated
guanylate kinase-like (MAGUK) protein family. The structure of Sap97 is
composed of a L27 domain important in the formation of large protein
assemblies, 3 PDZ modules, a Src-homology 3 (SH3) domain and a guanylate
kinase-like domain (GK). Previous work has shown that Mtmr2 associates with
Sap97 in Schwann cells and its localization in Mtmr2-null mice was altered
(Bolino et al, 2004). It was also shown that the C-terminal amino acids of Mtmr2
are essential for this interaction (Bolis et al, 2009). Interestingly, loss of Sbf2 did
not affect the levels of its binding partner Mtmr2 and the Mtmr2-binding
Dlg1/Sap97 in peripheral nerves (Tersar et al, 2007).
Our PDZ-array (Figure 7-3) and GST pulldown results (Figure 7-4) confirmed the
interaction of Mtmr2 with Sap97. Here we further analyzed the binding specificity
of Mtmr2 to the different PDZ modules of Sap97 and performed a domain
mapping experiment. Therefore, we cloned the HA-tagged Sap97 PDZ domains
PDZ1, PDZ2, PDZ3, PDZ1-2 or PDZ1-3, all lacking the L27, SH3 and GK
80
Results
domains, into the pre-existing pFBDMc His-Mtmr2 vector. His-Mtmr2 and
HA-Sap97 PDZ proteins were produced in baculovirus infected Sf21 cells. Cell
lysates were used for immunoprecipitation and analytical protein purification. All
Sap97 PDZ motifs coprecipitated with His-Mtmr2. A particular strong interaction
could be observed for the second PDZ domain (Figure 7-10, A), suggesting a
higher affinity of Mtmr2 towards Sap97-PDZ2.
Figure 7-10: Analysis of Mtmr2/Sap97-PDZ1-2 complex
(A) Coimmunoprecipitation of His-Mtmr2 (75 KDa) and HA-Sap97-PDZ1 (14.0 KDa), -PDZ2 (13.7
KDa), -PDZ3 (13.2 KDa), -PDZ1-2 (24.0 KDa) or -PDZ1-3 (38.9 KDa) using anti-penta-His
antibody. Immunoblot detection was performed with anti-HA antibody. Sap97-PDZ2, -PDZ1-2 and
-PDZ1-3 clearly interacted stronger with Mtmr2 compared to Sap97-PDZ1 or -PDZ3.
(B) His-Mtmr2/Sap97-PDZ1-2 complex was purified via NiNTA (data not shown) followed by size
exclusion chromatography using a Superdex 200 16/60. Eluate (highlighted in green and orange)
was analyzed by Coomassie stained SDS-PAGE. Mtmr2 and Sap97 eluted with an elution
volume maximum of 67 ml. Compared with the BioRad gelfiltration standard this peak maximum
corresponds to a molecular weight of 208 KDa.
Since Mtmr2 forms a homodimer in solution, we expected Mtmr2/Sap97-PDZ1-2
complex to appear as Mtmr2 dimer with one or two SAP97-PDZ1-2 attached on
each Mtmr2, forming a tetramer (198 KDa). To reveal the complex structure of
His-Mtmr2/HA-Sap97-PDZ1-2 we purified the proteins on a NiNTA column and
analyzed the purified complex by size exclusion chromatography (Figure 7-10,
B). Sap97-PDZ1-2 eluted together with Mtmr2 with an elution volume maximum
81
Results
of 67 ml, corresponding to a molecular mass of 208 KDa. Considering the
expected size of a tetramer of 198 KDa, the tetrameric appearance of
Mtmr2/Sap97-PDZ1-2 has to be suggested. In a further step we also pooled the
fractions including the complex (Figure 7-10, B, highlighted in orange) and
subjected the concentrated protein sample to SAXS analysis. However, the
protein sample was damaged by X-ray radiation resulting in unfolded,
aggregated protein and quality loss of the obtained scattering data, which could
not be further processed (data not shown).
7.2.2 Purification and analysis of Mtmr2/Sbf2 complex
It has been shown that a homodimeric active Mtmr2 interacts with a homodimeric
inactive Sbf2, thereby forming a tetrameric complex (Berger et al, 2006a). Of all
myotubularin family members, only the crystal structure of Mtmr2 monomer has
been solved (Begley et al, 2003; Begley et al, 2006). To get further insights into
the structural aspects of active/inactive MTMR-complexes, we expressed and
purified the full length His-Mtmr2/CBP-Sbf2 complex (Figure 7-11) using the
baculovirus-based expression system. Since the flexible N- and C-terminal
linkers of Sbf2 reduce the solubility of the protein, we also expressed two
truncated versions of Sbf2: one lacking the N-terminus (DENN domain and a
large undefined region) but composed of the PH-GRAM, phosphatase domain
and C-terminal PH-domain (named MinTetra+PH or MT+PH) (Figure 7-12, A),
the other lacking the N-terminus and the C-terminus (PH domain) and composed
of the minimal part, the PH-GRAM and phosphatase domain (named MinTetra or
MT) (Figure 7-13, A). All protein samples were initially purified with an IMAC
followed by biochemical analysis using SEC. Purification and analysis of
His-Mtmr2/CBP-Sbf2 is represented in Figure 7-11. Purification with IMAC clearly
resulted in coelution of Sbf2 (B), supporting that Mtmr2 and Sbf2 form a complex.
Excess of His-tagged Mtmr2 in the eluted fractions was observed after IMAC
purification. Eluted fractions were pooled and subjected to SEC analysis (C). By
experience purification of Mtmr2 alone using the same SEC 200 16/60 column
(see Figure 7-16) usually resulted in the elution of Mtmr2 in the range of 64-75 ml
with an elution maximum of ~69 ml (~175 KDa). Here, Mtmr2 eluted with an
82
Results
apparent molecular weight of 183 KDa, agreeing with the previous results and
suggesting that Mtmr2 eluted as homodimer (expected: 150 KDa). Mtmr2 and
Sbf2 eluted between 46-62 ml. The void peak seemed to overlap with a second
UV-absorption detected peak visible as a shoulder. The eluted fractions ranging
from 56 ml to 62 ml correlated to molecular masses of 616 KDa to 455 KDa,
compared with a standard. Coomassie stained SDS-PAGE of these particular
samples let us assume a composition of Sbf2 to Mtmr2 of 1:1. The expected size
of a His-Mtmr2/CBP-Sbf2 tetramer is 570 KDa and would fit in this range quite
well. Nonetheless, the purification quality as reported in (Berger et al, 2006a)
could not be reproduced. Crystallization screens with SEC purified Mtmr2/Sbf2
complex did not yield any crystals.
Figure 7-11: Purification of His-Mtmr2/CBP-Sbf2 complex
(A) Scheme of the Mtmr2/Sbf2 tetramer. Mtmr2 and Sbf2 each form a homodimer and together a
tetramer. (B) IMAC purification of harvested Mtmr2/Sbf2. Eluted fractions were analyzed with
Coomassie stained SDS-PAGE. CBP-Sbf2 eluted together with His-Mtmr2. (C) SEC using a
Superdex200 16/60 of the IMAC purified fractions (red box in B). Fractionates were analyzed with
Coomassie stained SDS-PAGE. Mtmr2 homodimer eluted with an elution volume maximum of
68.2ml (~183 KDa). Sbf2 was found in the void and eluted together with Mtmr2 from 56 ml to
62 ml, covering the range of molecular masses from 616 KDa to 455 KDa, respectively.
Purification and analysis of His-Mtmr2/CBP-Sbf2-MT+PH is represented in
Figure 7-12. His-Mtmr2/Sbf2-MT+PH clearly eluted as complex after a single
83
Results
IMAC purification step (Figure 7-12, B). Analyzing the SEC fractions by
Coomassie stained SDS-PAGE, Mtmr2/Sbf2-MT+PH complex eluted with a peak
maximum of 65.4 ml (~243 KDa). The expected size of a tetramer however, is
376 KDa. Revising the Coomassie stained SDS-PAGE the elution maximum of
Mtmr2 seemed to be slightly shifted to smaller mass. We therefore have to
consider that the 243 KDa peak most probably reflected the composition of two
overlapping peaks: the Mtmr2 homodimer (~150 KDa) and the Sbf2-MT+PH
homodimer (~226 KDa). Although the formation of a heterodimeric complex of
Mtmr2/Sbf2-MT+PH with an expected molecular weight of 188 KDa could explain
the 243 KDa peak, the shifted protein maxima of Mtmr2 and Sbf2-MT+PH in the
Coomassie stained gel do not support this possibility. Therefore, it has to be
suggested that the complex was not stable during gelfiltration. SAXS analysis of
a concentrated sample (Figure 7-12, C, bordered in red) was unsuccessful. The
sample was damaged by radiation and aggregation, reflecting the instability of
the complex. Crystallization screens also did not yield any crystals, underscoring
these negative results.
Figure 7-12: Purification of His-Mtmr2/CBP-Sbf2-MT+PH complex
(A) Scheme of the Mtmr2/Sbf2-MT+PH tetramer. Sbf2-MT+PH domain misses the N-terminal
undefined region with the DENN domain. (B) IMAC of harvested His-Mtmr2/CBP-Sbf2-MT+PH.
Eluted fractions were analyzed with Coomassie stained SDS-PAGE. CBP-Sbf2-MT+PH eluted
84
Results
together with His-Mtmr2. (C) SEC using a Superdex200 16/60 of the IMAC purified fractions (red
box in B). Mtmr2 and Sbf2-MT+PH elute with an elution volume maximum of 65.4 ml (~243 KDa).
SEC fraction bordered in red was used for SAXS analysis.
Figure
7-13
summarizes
His-Mtmr2/CBP-Sbf2-MT.
the
purification
IMAC
purification
and
analysis
of
of
harvested
His-Mtmr2/CBP-Sbf2-MT lysate resulted in the elution of both His-Mtmr2 and
CBP-Sbf2-MT protein (Figure 7-13, B), suggesting that both proteins interacted.
Analyzing the SEC fractions by Coomassie stained SDS-PAGE, Mtmr2/Sbf2-MT
complex eluted with a peak maximum of 65.5 ml (~240 KDa). The expected size
of a tetramer however was 352 KDa. Also here it seemed that we have the
situation of two overlapping elution maxima, the Mtmr2 homodimer (~150 KDa)
and the Sbf2-MT homodimer (~226 KDa). Revising the Coomassie stained SDSPAGE, the elution maxima of Mtmr2 and Sbf2-MT seemed to be slightly shifted,
consistent with the SEC purification of Mtmr2/Sbf2-MT+PH. SAXS analysis of a
concentrated sample was unsuccessful (Figure 7-13, C, bordered in red). The
sample was damaged by radiation and scattering data was not further analyzed
(data not shown). Crystallization screens, which have been set up did also not
yield any hits.
Figure 7-13: Purification of His-Mtmr2/CBP-Sbf2-MT complex
(A) Scheme of the Mtmr2/Sbf2-MT tetramer. Sbf2-MT domain misses the N-terminal DENN
domain with undefined region and the C-terminal PH domain. (B) IMAC of harvested
85
Results
His-Mtmr2/CBP-Sbf2-MT. Eluted fractions were analyzed with Coomassie stained SDS-PAGE.
CBP-Sbf2-MT co-eluted together with His-Mtmr2. (C) SEC using a Superdex200 16/60 of the
IMAC purified fractions (bordered in red in B). Mtmr2 and Sbf2-MT eluted with an elution volume
maximum of 65.5 ml (~240 KDa). Expected MW of a tetramer was 352 KDa.
Summarizing our findings, the N-terminal DENN domain and the C-terminus
including the PH domain of Sbf2 seemed to contribute to the stability of a
heterotetrameric
complex
with
Mtmr2.
The
truncated
versions
Mtmr2/Sbf2-MT+PH and Mtmr2/Sbf2-MT were not stable during a gelfiltration
step. However, to achieve a pure sample for structural analysis such as
crystallization and SAXS, a gelfiltration step would be absolutely required.
7.3 Structural and functional characterization of Mtmr2, 3-Pap
and Mtmr2/3-Pap complex
7.3.1 Characterization of the Mtmr2/3-Pap interaction in HEK293 cells
3-Pap/Mtmr12 was identified as adaptor unit of Mtm1 and Mtmr2 in reciprocal
coimmunoprecipitation studies of both endogenous and recombinant proteins
expressed in K562 cells (Nandurkar et al, 2003). The Mtmr2/3-Pap interaction
was additionally confirmed in mouse Schwann cells by immunoprecipitation and
MS-based screening procedure (Tersar, 2008). Whether the interaction occurs
also in HEK293 cells and whether it takes place over the coiled-coil motifs of one
or both binding partners, has not yet been analyzed. To address this question,
we transiently transfected HEK293 cells with plasmids coding for the full length
proteins His-tagged Mtmr2 and V5-tagged 3-Pap as well as for the truncated
versions His-Mtmr2 P589X and V5-3-Pap G654X lacking the C-terminal coiledcoil motif. Two days after transfection the cells were lysed and incubated for
immunoprecipitation with anti-penta-His antibody or anti-V5 antibody. The protein
expression was too low to detect the protein input in the crude cell lysate.
Therefore, the immunoprecipitated protein was taken as loading control. The
experiment has been repeated more than three times with the same outcome
(data not shown). The results displayed in Figure 7-14 represent the merge of
two independent experiments. As expected, full length proteins V5-3-Pap and
His-Mtmr2 both coprecipitated each other. However, V5-3-Pap G654X could not
86
Results
precipitate His-Mtmr2 and vice versa His-Mtmr2 P589X did not coprecipitate
V5-3-Pap. Thus, the coiled-coil domain of both Mtmr2 and 3-Pap is therefore
essential for complex formation.
Figure 7-14: Mtmr2 and 3-Pap interact through the C-terminal tail including the coiled-coil
Immunoprecipitation of V5-3-Pap, V5-3-Pap G654X, His-Mtmr2 and His-Mtmr2 P589X using
mouse anti-penta-His (upper panel) and mouse anti-V5 antibody (lower panel) in HEK293 cells.
Precipitate and protein input was analyzed by immunoblotting using anti-penta-His and anti-V5
antibody. 3-Pap coprecipitated only with His-Mtmr2, but not with His-Mtmr2 P589X. His-Mtmr2
coprecipitated only with V5-3-Pap, but not with V5-3-Pap G654X. His-Mtmr2 P589X and
V5-3-Pap G654X did also not coprecipitate each other. As control single V5-3-Pap G654X,
His-Mtmr2 P589X and untransfected cells were used.
7.3.2 Characterization of the purified Mtmr2/3-Pap complex
The expression vector pFBDM His-Mtmr2/CBP-Sbf2 was successfully used for
expression in Sf21 insect cells (Berger et al, 2006a). We therefore replaced
CBP-Sbf2 in pFBDM His-Mtmr2/CBP-Sbf2 by Strep-tagged 3-Pap by PCR based
subcloning. The protein yield of Strep-3-Pap however was extremely low (data
not shown). We therefore cloned the expression vector pFL Strep-3-Pap for
baculovirus-based expression and co-infected Sf21 cells with pFBDM His-Mtmr2
and pFL Strep-3-Pap baculovirus. The protein complex was purified in a first step
87
Results
using a StrepTactin column and analysis of the eluate by Coomassie stained
SDS-PAGE showed that His-Mtmr2 clearly co-eluted with Strep-3-Pap (Figure
7-15, A). His-Mtmr2/Strep-3-Pap complex can be produced and purified from
Sf21 cells. To further characterize the complex formation between His-Mtmr2 and
Strep-3-Pap, the StrepTactin eluate was separated by size exclusion
chromatography (Figure 7-15, B). Strep-3-Pap eluted in excess with an elution
maximum of 74.30 ml (~100 KDa). An excess of Strep-tagged protein was
expected after StrepTactin purification. The expected molecular mass of
Strep-3-Pap based on the amino acid sequence is 89 KDa. The elution peak of
Strep-3-Pap with a molecular mass of 100 KDa points to a monomer in solution.
His-Mtmr2 and Strep-3-Pap were found within a peak with a maximum of
67.62 ml (~195 KDa). This molecular mass could be explained by the formation
of a His-Mtmr2/Strep-3-Pap heterodimer. In contrast, the Mtmr2 dimer eluted with
a molecular mass of ~175 KDa (see Figure 7-16, B). To verify and confirm the
heteromeric complex in a last purification step, the Mtmr2/3-Pap complex
fractions of the SEC (bordered in red) were pooled and purified with a NiNTA
column (Figure 7-15, C). The NiNTA eluate was separated by SDS-PAGE and
analyzed by immunoblotting. Strep-3-Pap was detected with Strep-tagII antibody
and His-Mtmr2 with penta-His antibody. Strep-3-Pap clearly coeluted with
His-Mtmr2. The Mtmr2/3-Pap complex purification by StrepTactin and SEC was
repeated three times, and in all three experiments Mtmr2 and 3-Pap coeluted
with a corresponding mass of a heterodimer.
88
Results
Figure 7-15: Purification and analysis of His-Mtmr2/Strep-3-Pap complex
Sf21 cells were coinfected with baculovirus for the expression of His-Mtmr2 and Strep-3-Pap.
Three to five days after infection the cells were harvested and proteins were purified from the
lysate. (A) StrepTactin purification and Coomassie stained SDS-PAGE of eluted fractions. Mtmr2
eluted together with 3-Pap. (B) Size exclusion chromatography of pooled StrepTactin fractions
using a gelfiltration column 200 16/60. Strep-3-Pap eluted alone with an elution maximum of
74.3 ml (~100 KDa) and together with Mtmr2 at 67.62 ml (~194 KDa). (C) SEC eluted fractions
(framed in red, B) were purified in a third step by IMAC. Eluted samples were analyzed by SDSPAGE and immunoblotting using anti-penta-His and anti-Strep-tagII antibodies. His-Mtmr2 coeluted with Strep-3-Pap.
7.3.3 Protein purification and structural analysis using SAXS
Small-angle X-ray scattering (SAXS) is a powerful tool to study molecular
structures in solutions such as proteins and protein complexes, to investigate
conformational changes upon activation such as ligand binding and it enables the
modeling of flexible structures like linkers, which are impossible to crystallize
(Bernado et al, 2007; Svergun et al, 2003). Compared to crystallography, SAXS
gives only access to low resolution structures ranging from 20-30 Å upwards.
Prerequisites for successful data collection are highly pure protein in the range of
1-5 mg/ml and monodispersity. From the initial collected data, the scattered
89
Results
intensity (I) as a function of the scattering vector (q/[1/ Å]), the following
parameters can be easily extracted: the molecular weight (MW), radius of
gyration (Rg), hydrated particle volume (Vp) and maximum particle diameter
(Dmax) (Mertens et al, 2010). The Rg is calculated by the Guinier approximation
from the initial collected data. Rg is the square root of the average squared
distance of each scatterer from the particle center and can also be calculated
from the distance distribution function (P(r)). P(r) function results from the
Fourier-transformation of the scattering data and illustrates the distributions of
intramolecular distances. The maximal intramolecular distance is described as
Dmax. Ab-initio modeling programs as DAMMIN from the ATSAS package use
Rg and P(r) to reconstruct the averaged shape.
7.3.3.1 Mtmr2 homodimer
Baculovirus derived from pFBDM His-Mtmr2 was already available in our lab.
Sf21 insect cells were infected with the virus and the cells were harvested five
days after infection. In a first step His-Mtmr2 protein was purified from the lysate
with an IMAC column (Figure 7-16, A). In a further purification step, the IMAC
fractions (framed in red, A) were pooled and purified by size exclusion
chromatography. His-Mtmr2 eluted as dimer with an elution maximum of 68.7 ml,
corresponding to a molecular mass of 176 KDa (Figure 7-16, B). Analysis of SEC
purified His-Mtmr2 confirmed the homodimeric form of Mtmr2, which eluted with
a MW of 160 KDa (Figure 7-16, C).
90
Results
Figure 7-16: Purification and analysis of His-Mtmr2 homodimer by SEC and MALS
Recombinant His-tagged Mtmr2 was expressed in Sf21 insect cells. Five days after infection the
cells were harvested and purified. (A) Purification of His-Mtmr2 by IMAC and analysis of eluted
fractions by Coomassie stained SDS-PAGE. (B) SEC using a Superdex200 16/60 gelfiltration
column of the IMAC purified fractions. Mtmr2 protein eluted with an elution volume maximum of
68.7 ml (~176 KDa). Eluted fractions were analyzed by Coomassie stained SDS-PAGE. (C) Multiangle light scattering of SEC purified Mtmr2 (bordered in red, B). Mtmr2 eluted with a molecular
weight of 160 KDa.
The published crystal structure of Mtmr2 (PDB: 1LW3) lacks the first N-terminal
73 amino acids and the last C-terminal 57 amino acids, including the coiled-coil
motif and the PDZ binding domain (Begley et al, 2003). A possible dimer found in
the crystal packing has also been proposed (PDB: 1M7R) (summarized in Figure
7-18, A). Analysis of the macromolecular interfaces and assemblies of both
mentioned PDB files with the interactive tool PISA (Krissinel et al, 2007) revealed
that the interface of the Mtmr2 dimer (1M7R) with a Complexation Significance
Score (CSS) of 0.000 had no biological significance and was unstable. A CSS
ranges from 0 to 1, with 1 achieving the highest relevance of interfaces for
complexation. In contrast, PISA uncovered in the crystal packing of 1LW3 a
91
Results
stable Mtmr2 dimer interface with a CSS of 0.201, rendering the newly
discovered dimer interface as biologically relevant. This structure is from now on
called PISA-dimer. Despite the biological relevance, the Mtmr2 structure lacks
the coiled-coil motif, which was shown to be absolutely essential for
homodimerization (Berger et al, 2003). Although the PISA-dimer model could be
still an artefact of crystal packing, the biological relevance of the interface lets
suggest a function in supporting the dimerization. To shed light on this issue, we
decided to analyze the structure of Mtmr2 full length in solution using SAXS and
to compare it with the calculated, biologically relevant crystal structure from
PISA. After having successfully produced and purified His-Mtmr2 homodimer
with high purity, the sample was subjected for SAXS analysis. We measured
three different concentrations: 1.48 mg/ml, 3.03 mg/ml and 4.64 mg/ml. The initial
collected data were plotted as intensity as a function of the scattering vector q
(Figure 7-17, A) and were consistent for all three measured concentrations. The
Kratky-plot confirmed that the protein was folded (Figure 7-17, B). The linear
Guinier-region showed that no higher order aggregates were formed (Figure
7-17, C). The average Rg was 44 Å. The P(r) function showed an average
maximum distance (Dmax) of 150 Å. The bell shaped curve indicated a spherical
shape and the elongated tail to longer distances an appendix.
92
Results
Figure 7-17: SAXS data analysis of purified His-Mtmr2 in solution
(A) Scattered intensity plotted against the scattering vector q, after background substraction.
(B) Kratky plot of the measured Mtmr2 concentrations. (C) By fitting the Guinier equation with the
program PRIMUS (Konarev, 2003), the value of Rg was determined for the Mtmr2 concentrations
1.48 mg/ml, 3.03 mg/ml and 4.64 mg/ml to be 43.55 Å, 44.17 Å and 43.65 Å, respectively. The
average Rg is 44 Å. (D) The P(r) function was calculated by the program AUTOGNOM (Svergun,
1992). Dmax ranges from 145 Å to 153 Å and is in average 150 Å.
The evaluated distance distribution functions were used as an input for the
ab-initio
shape
reconstruction
program
DAMMIN.
Twenty
independent
reconstructions were run for each concentration and resulted in globular shapes
with a tail. Consistency between these individual runs allowed averaging with the
program DAMAVER (Konarev et al, 2006). Superimposition of the PISA-dimer
with the averaged SAXS model is depicted in (Figure 7-18, B). Howsoever the
PISA-dimer was positioned and rotated it never fitted perfectly into the SAXS
model. Normally, the positioning of the two monomers in a parallel manner into
the SAXS shape resulted in a better fit (Figure 7-18, C).
93
Results
Figure 7-18: Ab-initio shape reconstruction of Mtmr2 homodimer
(A) Mtmr2 protein consist of a GRAM-PH domain (green), a phosphatase domain (blue), a coiledcoil (orange) and at the C-terminus a PDZ binding domain (grey). A crystal structure of the
monomer has been published by Begley et al. (2003; 2006) and a complex of two monomers has
been stored in the PDB database. The crystal structure lacks the first N-terminal 73 amino acids
and the last C-terminal 57 amino acids, including the coiled-coil motif. (B) Ab-initio shape
reconstruction of full length His-Mtmr2 homodimer (grey) with DAMMIN and averaged with
DAMAVER (ATSAS 2.4), manually superimposed with the antiparallel Mtmr2 PISA-dimer
structure. (C) Two Mtmr2 monomer structures manually fitted into the SAXS model, showing a
parallel alignment.
7.3.3.2 3-Pap monomer
3-Pap belongs to the catalytically inactive members of the MTMR family and
consists only of the characteristic domains: GRAM-PH, phosphatase domain and
a coiled-coil motif (Figure 7-22, A). Based on the amino acid sequence retrieved
from the UniProt database 3-Pap is 104 amino acids longer compared to Mtmr2
(73.4 KDa), resulting in a 12.7 KDa heavier protein (86.1 KDa in total). Based on
the sequence alignment with Mtmr2 and its PDB file (PDB: 1LW3) a surface
model of 3-Pap has been proposed (Begley et al, 2006) (Figure 7-22, B). Begley
94
Results
et al. reported electrostatic polarization of the PH-GRAM and phosphatase
domains to be likely for active myotubularins, as shown in Figure 7-22 (B) for
Mtmr2 and Mtm1, but not the inactive myotubularins such as 3-Pap/Mtmr12.
They propose that the two subgroups may have different affinities for PIcontaining membranes. Since structural information of 3-Pap was missing, we
performed structural analysis of 3-Pap by analytical purification, crystallization
and SAXS.
Analysis of Mtmr2/3-Pap complex by size exclusion chromatography (see Figure
7-15, B) has shown that in addition to the Mtmr/3-Pap heterodimer, 3-Pap eluted
as a monomer. To verify these findings, pFL His-3-Pap baculovirus was
produced for infection of Sf21 insect cells and protein production. In a first step
His-3-Pap was purified by its His-tag with an IMAC column (Figure 7-19, A). In a
second purification step the protein was separated from impurities by size
exclusion chromatography (Figure 7-19, B). Three peaks were observed, of
which the first consisted of impurities with a high molecular weight. 3-Pap eluted
within the last two peak maxima corresponding to 162 KDa and 91 KDa
(compared with the gelfiltration BioRad standard). The second peak might reflect
small amounts of homodimers (expected MW based on the amino acid
sequence: 173 KDa). However, under the analyzed conditions most of the 3-Pap
protein eluted with a peak maximum of 91 KDa (expected MW is 87.5 KDa),
confirming the monomeric state. Peptide mass analysis of His-3-Pap by mass
spectrometry (LC/ESI/MS) resulted in a molecular weight of 87.372 KDa, which
was 104.9 Da smaller than expected. This discrepancy could neither be
explained by an N-terminal methionine substitution (-131 Da) nor by a C-terminal
valine substitution (-99 Da). (Figure 7-19, C). Also SEC coupled multi-angle light
scattering confirmed the monomeric condition of His-3-Pap. Summarizing these
results, we propose that under the measured conditions in vitro 3-Pap is a
monomer.
95
Results
Figure 7-19: Protein purification and analysis of 3-Pap by SEC, MS and MALS
Recombinant His-tagged 3-Pap was expressed in Sf21 insect cells. Three days after baculovirus
infection the cells were harvested and purified. (A) Purification of His-3-Pap by IMAC and analysis
of eluted fractions by Coomassie stained SDS-PAGE. (B) SEC using a Superdex200 16/60
column of the IMAC purified fractions. His-3-Pap eluted with elution maxima of 72.07 ml
(~162 KDa) and 79.97 ml (~91 KDa). Eluted fractions were analyzed by Coomassie stained SDSPAGE. (C) MS analysis of gelfiltration purified 3-Pap resulted in a MW of 87.371 KDa. The
expected MW, based on the amino acid sequence, was 104.9 Da bigger. (D) Multi-angle light
scattering (MALS) analysis of SEC purified 3-Pap protein. 3-Pap eluted with a molecular weight of
89 KDa, confirming the monomeric state.
Crystallization screens have been set up with purified His-3-Pap (see Table 6-8).
These however, did not yield any positive hits. A common technique to improve
crystallization is the removal of flexible linkers and domains of the protein. This
can either be achieved on the transcriptional level, by expressing truncated
versions of the protein or on the protein level by in situ proteolysis prior
crystallization (Wernimont et al, 2009). The latter is technically the fastest to test.
I therefore screened the two standard proteolytic enzymes trypsin and
α-chymotrypsin in weight to weight (w:w) ratios of 1:10, 1:100, 1:1’000 and
96
Results
1:10’000. Evaluating the Coomassie stained SDS-PAGE gel, a dilution of 1:100
for both tested enzymes resulted in one stable fragment of ~55 KDa (Figure
7-20). His-3-Pap was therefore incubated with a 1:100 α-chymotrypsin dilution
prior to crystallization (see Table 6-8). However, also the proteolytically treated
protein samples did not yield any crystals and further refinement would be
needed.
Figure 7-20: In situ proteolysis series of purified His-3-Pap for crystallization
4 µg purified His-3-Pap was incubated with trypsin or α-chymotrypsin for 30 min in w:w ratios of
1:10, 1:100, 1:1000 and 1:10000 trypsin or α-chymotrypsin. Reactions were stopped by addition
of SDS sample buffer and boiling for 5 min at 95°C. Samples were analyzed by Coomassie
stained SDS-PAGE. The first lane represents untreated purified His-3-Pap protein.
Since crystallization was unsuccesfull, structural analysis of 3-Pap was continued
by small-angle X-ray scattering analysis. Purified His-3-Pap originating from a
SEC purification, as shown in the representative Figure 7-19 (framed in red), was
used for SAXS analysis. Eluates corresponding to the molecular weight of a
monomer were pooled and concentrated. Samples were measured in the
presence of EDTA alone or together with DTT at three different concentrations:
1.50 mg/ml, 2.75 mg/ml and 4.38 mg/ml. The highest concentrated protein
sample was damaged by radiation, which is why it was not further processed.
Initial collected intensities after background subtraction are plotted in Figure 7-21
(A). The Kratky-plot confirmed that the protein was folded (Figure 7-21, B).
Compared with the Kratky-plot of Mtmr2 (see Figure 7-17, B) 3-Pap lacked the
typical features of two maxima, suggesting a monomeric structure. The linear
Guinier-approximation was consistent for both measured samples and resulted in
97
Results
an average Rg of 41 Å (Figure 7-21, C). The P(r) function is characterized by an
average maximum distance (Dmax) of 145 Å. Comparing the P(r) functions of
3-Pap and Mtmr2, 3-Pap is only 5 Å shorter in maximum distance and the
distribution lets assume a thinner corpus (Figure 7-21, D).
Figure 7-21: SAXS data analysis of His-3-Pap monomer
(A) Scattered intensity plotted against the scattering vector q, after background substraction.
(B) Kratky plot of the measured 3-Pap concentrations. (C) By fitting the Guinier equation with the
program PRIMUS (Konarev, 2003), the value of Rg was determined for the 3-Pap concentrations
1.5 mg/ml and 2.75 mg/ml to be 41.96 Å and 40.79 Å, respectively. The average Rg is 41 Å.
(D) Comparison of the calculated P(r) functions of 3-Pap (continuous line) and Mtmr2 (dashed
line). The P(r) function was generated by the program AUTOGNOM (Svergun, 1992). The
maximum diameter (Dmax) for 3-Pap ranges from 143 Å to 147 Å and is in average 145 Å.
The evaluated distance distribution functions were used as an input for the abinitio shape reconstruction program DAMMIN. Twenty independent structures
were generated and averaged with DAMAVER. Here we propose the first ab-inito
SAXS model of a full length 3-Pap monomer (Figure 7-22, C). Superimposition
98
Results
with the Mtmr2 crystal structure was possible with two different orientations, with
either the phosphatase domain or the GRAM-PH domain facing the head.
Consistent with the interpretation of the P(r) function, 3-Pap shape reconstruction
had similar maximum dimensions as Mtmr2. Furthermore, superimposition of
both Mtmr2 and 3-Pap SAXS shape reconstructions clearly showed that the
corpus of 3-Pap (blue) was thinner (Figure 7-22).
Figure 7-22: Ab-initio shape reconstruction of 3-Pap monomer
(A) 3-Pap consists of a GRAM-PH domain (green), an inactive phosphatase domain (blue) and a
coiled-coil motif (CC, orange). (B) Surface electrostatic potentials of human MTMR2, MTM1 and
3-PAP/MTMR12 (adapted from Begley et al., 2006). The surface is colored by its electrostatic
potential showing saturating potential in blue and red, 10 and –10 kT/e, respectively. (C) Ab-initio
shape reconstruction of full length His-3-Pap monomer (blue) with DAMMIN and averaged with
DAMAVER (ATSAS 2.4). MTMR2 structure (PDB: 1LW3) was manually superimposed. Two
99
Results
orientations of MTMR2 are possible: phosphatase-to-head or GRAM-PH-to-head (in box).
(D) Superimposition of the Mtmr2 (grey) and 3-Pap (blue) SAXS models.
7.3.4 Localization of Mtmr2 and 3-Pap in HEK293 cells
Previous localization studies of Mtmr2 in COS cells showed that Mtmr2 is
diffusely distributed in the cytosol with stronger staining in the perinuclear region
(Berger et al, 2003; Kim et al, 2003; Berger et al, 2006a). 3-Pap was reported to
localize to punctuate structures in the cytosol of COS-7 cells (Nandurkar et al,
2003). To analyze whether Mtmr2 and 3-Pap colocalize, HEK293 cells were
transiently transfected with expression vectors for RGS-His-tagged Mtmr2 and
V5-tagged 3-Pap. Mtmr2 staining was observed in punctuate structures in the
cytosol and in membrane ruffles at the surface of the cell. 3-Pap colocalized with
Mtmr2 in membrane ruffles, however no colocalization was observed in the
cytosol (Figure 7-23).
Figure 7-23: Colocalization of Mtmr2 and 3-Pap at membrane ruffles
HEK293 cells were transiently cotransfected with RGS-His-tagged Mtmr2 and V5-tagged 3-Pap.
Cells were probed with RGS-His and V5 specific primary antibodies. Two confocal sections of the
same cell are shown. Merged images are shown on the panels on the left and right.
Colocalization of Mtmr2 (red) with 3-Pap (green) is visible in the merged image as yellow in
membrane ruffles (arrow) at the plasma membrane (upper row). No colocalization was observed
in the same cell imaged in the center (lower row). White boxes indicate regions, represented as
magnified views on the right. Scale bar = 10 µm.
Hypo-osmotic stress has been reported to activate PI-3,5-P2 synthesis and to
lead to a transient increase of PI-3,5-P2 levels (Dove, 1997). Berger et al. (2003)
reported that upon hypo-osmotic stress of transiently transfected COS cells
100
Results
Mtmr2 or Sbf2 localized at membranes of stress-induced vesicles. Furthermore,
it was shown that in cotransfected cells expressing high levels of Sbf2, Mtmr2
staining was absent at these membranes (Figure 7-24, A). They therefore
concluded that Sbf2 bound with higher affinity than Mtmr2 to membranes of
these vacuoles, thereby competing for Mtmr2-binding sites. To analyze whether
3-Pap has a similar effect on Mtmr2 as Sbf2, HEK293 cells were transiently
transfected with Mtmr2 and/or 3-Pap and incubated under hypo-osmotic
conditions. HEK293 cells expressing 3-Pap or Mtmr2 alone showed staining at
the plasma membrane and at membranes of the stress induced vesicles (Figure
7-24, B and C). Interestingly, in cells coexpressing Mtmr2 and high levels of
3-Pap (Figure 7-24, D), Mtmr2 still localized to the lipids of the vacuoles. Thus,
3-Pap did not compete for Mtmr2-binding sites as it was proposed for Sbf2.
These findings let us assume that Mtmr2 and 3-Pap either have similar binding
affinities or that they bind as a heterodimer to these membranes.
101
Results
Figure 7-24: Colocalization of Mtmr2 and 3-Pap in HEK293 cells under hypo-osmotic
conditions
(A) COS cells were transiently cotransfected with Sbf2 and Mtmr2 expression constructs and
stained after hypo-osmotic shock. Sbf2 preferentially associated with the stress-induced vesicles,
but not Mtmr2 (adapted from Berger et al., 2006). (B-D) HEK293 cells were transiently
transfected with V5-tagged 3-Pap, RGS-His-tagged Mtmr2 or both expression constructs
simultaneously. (B) V5-3-Pap staining was localized at the membranes of the stress induced
vesicles, at the plasma membrane and partially in the cytosol. (C) RGS-His-Mtmr2 showed
staining at the vesicles, at the plasma membrane and partially in the cytosol. (D) In Mtmr2/3-Pap
cotransfected cells V5-3-Pap and RGS-His-Mtmr2 colocalized to membranes of stress induced
vesicles and to the plasma membrane. Scale bar = 10 µm.
7.3.5 Influence of Mtmr2, 3-Pap and Mtmr2/3-Pap complex on EGFR
trafficking in HEK293 cells
Based on the finding, that Mtmr2 overexpression in HEK293 cells blocks EGF
stimulated EGFR degradation and that coexpression of Sbf2 abolished this effect
(Berger et al, 2009), we wanted to study the localization of Mtmr2, 3-Pap,
Mtmr2/3-Pap complex and EGF receptor in the context of EGF stimulated
internalization and trafficking through endosomal compartments. Rab GTPases
102
Results
were used before as subcellular markers for the localization of MTMRs (Cao et
al, 2007; Cao et al, 2008; Franklin et al, 2011). The data are sometimes
conflicting. This might be explained by the fact that these vesicles are often
positive for several Rab GTPases (Ballmer-Hofer et al, 2011). We therefore
analyzed colocalization with four different Rab GTPases to study trafficking
through the endocytic compartment. Rab5-Rab4-Rab11 define the recycling axis,
whereas Rab5-Rab4-Rab7 define the degradation axis. To monitor the
localization throughout the different steps of internalization, HEK293 cells were
transiently cotransfected with the expression constructs for the constitutive active
endosomal markers YFP-Rab4 Q67L, GFP-Rab5A Q79L, EGFP-Rab7 Q67L or
YFP-Rab11 Q70L. Prior to fixation, the Mtmr2 and 3-Pap transfected cells were
stimulated with Alexa647 coupled EGF. By using the confocal microscope SP5,
we were restricted to the use of three lasers covering the spectra of three
different fluorescence markers. These were already occupied by Mtmr2 (Cy3),
3-Pap (Cy5) and the endosomal markers (yellow and green). HEK293 cells
transiently cotransfected with MTMR, RabX and EGFR and positive for MTMR
and RabX were in general also positive for EGFR (data not shown). We therefore
stimulated
Mtmr2/3-Pap
cotransfected
cells
only
with
unstained
EGF.
Immunostainings of HEK293 cells transiently transfected with RGS-His-tagged
Mtmr2, EGFR and GFP-tagged Rab GTPases and stimulated with Alexa647EGF are represented in Figure 7-25. Based on the binding specificities of Mtmr2
for the phosphoinositides PI-3,5-P2 and PI-5-P, localization of Mtmr2 would be
expected at membranes harboring these lipids. Under steady state conditions
(T=0) Mtmr2 localized on Rab4, Rab5, Rab7 and Rab11 vesicles, visible as
yellow dots and marked with asterisks in the merged Figure 7-25 (A-D). Thirty
minutes after EGF stimulation (T=30), Mtmr2 was still visible on Rab4, Rab5 and
Rab7 vesicles, joined by internalized EGF (Figure 7-25, A-C, marked with
arrows). After 180 min EGF stimulation (T=180), Mtmr2 was no longer found on
Rab4 or Rab7 vesicles, but on Rab5 and colocalized with Rab11 vesicles.
Interestingly, under steady state conditions and 30 min after EGF stimulation we
found Mtmr2 not only at the lipid membranes of the Rab vesicles, but also inside
103
Results
Rab4, Rab5 and Rab7 vesicles (Figure 7-25, A-C, marked with an asterisk). One
possible explanation could be the formation of multivesicular bodies inside these
vesicles. In Rab11 transfected cells however, we could not make such
observations. EGF staining was found in all four positive Rab endosomes.
Considering the finding that after 180 min stimulation Mtmr2 colocalized strongly
with Rab11, suggests that Mtmr2 got relocalized to Rab11 vesicles. Additionally,
EGF was still observed in Rab11 vesicles, also after 180 min. Recently published
localization study of EGFR with Rab GTPases in COS cells has shown that after
180 min EGF stimulation, phosphorylated EGFR was mainly found in Rab5,
Rab4 and Rab7 positive vesicles but barely in Rab11 vesicles (Ballmer-Hofer et
al, 2011). As mentioned above, it was also reported that Mtmr2 overexpression
blocks EGFR degradation and leads to sustained Akt activation (Berger et al,
2009).
We
can
thus
hypothesize
that
Mtmr2
overexpression
blocks
phosphorylated EGF receptor in Rab11 vesicles, where it further activates
downstream signaling leading to sustained Akt activaton.
104
Results
105
Results
Figure 7-25: Localization of Mtmr2 with endosomal markers in EGF stimulated HEK293
cells
HEK293 cells transiently transfected with the expression plasmids coding for RGS-His-tagged
Mtmr2, human EGFR and the endosomal markers YFP-Rab4 Q67L (A), GFP-Rab5A Q79L (B),
EGFP-Rab7 Q67L (C) or YFP-Rab11 Q70L (D). Prior fixation and immunostaining, the cells were
starved overnight and then stimulated for 30 min and 180 min with Alexa647 conjugated EGF
(blue). RGS-His-Mtmr2 (red) was detected and stained with RGS-His specific primary antibody.
106
Results
Vesicles with Mtmr2 inside are marked with an asterisk. EGF loaded vesicles positive for Mtmr2
inside or outside are labeled with an arrow. Rab vesicles only positive for EGF are marked with a
filled arrow head and EGF vesicles only positive for Mtmr2 are marked with an empty arrow head.
Mtmr2 localized inside Rab4 (A), Rab5 (B) and Rab7 (C) vesicles after 0 min and 30 min
stimulation, but not after 180 min. Mtmr2 colocalized with Rab11 after all three time points (D).
EGF was found on all four Rab positive endosomes. Scale bar = 10 µm.
Transiently transfected HEK293 cells with V5-tagged 3-Pap, EGFR and
GFP-tagged Rab GTPases expression constructs, stimulated with Alexa647-EGF
and immunostained are represented in Figure 7-26. At steady state conditions
3-Pap did not colocalize with any of the four expressed endosomal markers, nor
was it observed inside the endosomes. Thirty minutes and 180 min after EGF
stimulation, 3-Pap was observed at Rab4, Rab5 and Rab11 positive vesicles,
pointing to the localization at vesicles important in the recycling pathway. EGF
was observed in all four endosomal compartments after stimulation.
107
Results
108
Results
Figure 7-26: Localization of 3-Pap with endosomal markers in EGF stimulated HEK293
cells
HEK293 cells transiently transfected with the expression plasmids coding for V5-tagged 3-Pap,
human EGFR and the endosomal markers YFP-Rab4 Q67L (A), GFP-Rab5A Q79L (B),
EGFP-Rab7 Q67L (C) or YFP-Rab11 Q70L (D). Prior fixation and immunostaining, the cells were
starved and stimulated for 30 min and 180 min with Alexa647 conjugated EGF (blue). V5-3-Pap
(red) was detected and stained with V5 specific primary antibody. 30 min and 180 min after
109
Results
stimulation 3-Pap localized to Rab4, Rab5 and Rab11 vesicles, which were positive for EGF
(arrow). Rab vesicles only positive for EGF are marked with an arrow head. EGF was found on all
four Rab positive endosomes. Scale bar = 10 µm.
The first immunostaining experiments were performed in COS-7 cells, which
have the advantage to express endogenous EGF receptor in higher amounts
compared to HEK293 cells. Therefore, transient transfection of COS-7 with
EGFR is unnecessary. We observed that in transiently cotransfected cells with
3-Pap and Mtmr2 expression contructs, the 3-Pap transfection efficiency was
constantly higher compared to Mtmr2 (data not shown). Less than 5% of 3-Pap
transfected cells were cotransfected with Mtmr2, making localization studies
quantitatively difficult. However, we could collect a dataset of transiently
transfected COS-7 cells with V5-tagged 3-Pap and GFP-tagged Rab GTPases
expression constructs, stimulated with Alexa647-EGF (Figure 7-27), representing
a valuable verification of the HEK293 results. In COS-7 cells, 3-Pap already
colocalized at steady state conditions with all four endosomal markers. Thirty
minutes after EGF stimulation, 3-Pap colocalized with EGF positive Rab4 and
Rab5 vesicles (arrow in A and B), however not with Rab7 or Rab11 vesicles.
After 180 min EGF stimulation, 3-Pap was still found at Rab4 and Rab5, but also
at Rab11 vesicles. Internalized Alexa647-EGF was found in all four Rab positive
vesicles (arrow head). Comparing and summarizing these results with the
HEK293 immunostaining results (Table 7-2): in COS cells, at steady state
conditions, 3-Pap could already be found at Rab4, Rab5 and Rab11 vesicles; in
HEK293 cells however, this was not the case until 30 min and 180 min after EGF
stimulation; in both tested cell lines, 3-Pap clearly did not localize to Rab7
vesicles. These findings all point to a localization of 3-Pap at early endosomes of
the recycling axis.
110
Results
111
Results
Figure 7-27: Localization of 3-Pap with endosomal markers in EGF stimulated COS-7 cells
COS-7 cells transiently transfected with the expression plasmids coding for V5-tagged 3-Pap and
the endosomal markers YFP-Rab4 Q67L (A), GFP-Rab5A Q79L (B), EGFP-Rab7 Q67L (C) or
YFP-Rab11 Q70L (D). Prior fixation and immunostaining, the cells were starved and stimulated
for 30 min and 180 min with Alexa647 conjugated EGF (blue). V5-3-Pap (red) was V5 specific
primary antibody. At steady state conditions (T=0min) 3-Pap colocalized with all four endosomal
markers (arrows). After 30 min and 180 min stimulation 3-Pap localized on Rab4, Rab5 and
112
Results
Rab11 vesicles, which were positive (arrow) or negative (asterisk) for EGF. Rab vesicles only
positive for EGF are marked with an arrow head. EGF was located in all four Rab positive
endosomes. Scale bar = 10 µm.
The immunostaining results of EGF stimulated HEK293 cells transiently
transfected with RGS-His-tagged Mtmr2, V5-tagged 3-Pap, human EGFR and
GFP-tagged Rab GTPases are represented In Figure 7-28. Prior to stimulation
(T=0), Mtmr2 was found on Rab4, Rab7 and Rab11 vesicles (asterisk), but not
on Rab5 vesicles. Triple positive vesicles were only found on Rab4 vesicles
(marked with an arrow, A). Thirty minutes after EGF stimulation, Mtmr2 was
found on all four Rab positive endosomes, after 180 min however, only on Rab4
and on Rab11 vesicles. A weak colocalization of 3-Pap with Rab5 was observed
and marked with an arrow head (B). It is interesting that the only clear
colocalization between Mtmr2, 3-Pap and endosomes 180 min after EGF
stimulation occurred in Rab4 and Rab11 vesicles (A and D, marked with an
arrow), which belong to the recycling axis.
113
Results
114
Results
Figure 7-28: Localization of Mtmr2 and 3-Pap with endosomal markers in EGF stimulated
HEK293 cells
HEK293 cells transiently transfected with the expression plasmids coding for RGS-His-tagged
Mtmr2, V5-tagged 3-Pap and the endosomal markers YFP-Rab4 Q67L (A), GFP-Rab5A Q79L
(B), EGFP-Rab7 Q67L (C) or YFP-Rab11 Q70L (D). Prior fixation and immunostaining, the cells
were starved and stimulated for 30 min and 180 min with unconjugated EGF. Vesicles with Mtmr2
inside are marked with an asterisk. Vesicles positive for Mtmr2 inside or outside and 3-Pap are
115
Results
labeled with an arrow. Colocalization between 3-Pap and Rab vesicles are marked with an arrow
head and colocalizations between Mtmr2 and 3-Pap are marked with a V. Mtmr2 localized inside
Rab4 (A), Rab7 (C) and Rab11 (D) vesicles after 30 min stimulation and after 180 min only in
Rab4 and Rab11. Mtmr2 colocalized with Rab11 after all three timepoints (D). Scale bar = 10 µm.
The immunostainings are summarized in Table 7-2. Comparing the localization of
Mtmr2 with 3-Pap alone, Mtmr2 did localize inside Rab7 vesicles, but 3-Pap did
not localize at the membrane of these vesicles. The differences get even more
clear 180 min after EGF stimulation. Mtmr2 was no longer present in Rab4 or
Rab7 vesicles, however at Rab11 vesicles. 3-Pap in contrast, was found at Rab4
vesicles. Both, Mtmr2 and 3-Pap were found in or at Rab5 and Rab11 vesicles.
In Mtmr2/3-Pap double transfected cells, Mtmr2 did not relocalize 3-Pap to Rab7
vesicles. Furthermore, Mtmr2 was no longer found in Rab5 vesicles, but in Rab4
vesicles. Considering the findings that in COS cells 3-Pap localized already at
steady state conditions at Rab4 and Rab5 vesicles and remained there also after
EGF stimulation (in HEK293 cells and COS cells), might support the hypothesis
that the affinity of 3-Pap for Rab5 vesicles is stronger than of Mtmr2. Whether the
presence of 3-Pap at Rab4 vesicles might retain Mtmr2 in these vesicles would
have to be investigated. All together it can be concluded, that after stimulation
the myotubularins Mtmr2 and 3-Pap localized independently or in complex along
the recycling axis at Rab4 and Rab11 vesicles.
Table 7-2: Summary of Mtmr2 and 3-Pap localizations with Rab positive vesicles before
and after EGF stimulation
Presence or absence in or at the respective Rab vesicles 0 min (0), 30 min (30) and 180 min
(180) after EGF stimulation is symbolized with a tickmark (√) or a minus (-), respectively. In the
case of Mtmr2/3-Pap cotransfected cells, the evaluated results refer to the underlined protein.
HEK293
Rab4
Rab5
Rab7
Rab11
0
30
180
0
30
180
0
30
180
0
30
180
T=
Mtmr2
√
√
√
√
√
√
√
√
√
√
Mtmr2/3-Pap
√
√
√
√
√
√
√
√
√
3-Pap
√
√
√
√
√
√
Mtmr2/3-Pap
√
√
√
√
COS-7
3-Pap
√
√
√
√
√
√
√
√
116
Discussion and Outlook
8 Discussion and Outlook
8.1 MTMRs interact with PDZ domain containing scaffolds
MTMRs are phosphatases which regulate the phosphoinositide pool at cellular
membranes and influence trafficking and sorting of internalized membrane
proteins. Loss of function of MTM1, MTMR2 and SBF2 has been linked to the
human diseases XLMTM, CMT4B1, and CMT4B2, respectively, highlighting their
essential role in human health. MTM1 and MTMR2 share high sequence
similarity, same substrate specificity and are both expressed in the same tissues.
However, the molecular mechanism leading to the distinct diseases XLMTM and
CMT4B1 is poorly understood. One possibility to explain this differential outcome
could be that the C-terminal PDZ-binding motif of MTM1 (-VQTHF) and
MTMR2 (-VQTVV) interact with different PDZ domains of scaffolding proteins.
The goal of the first part of this thesis was to identify and characterize novel or
known PDZ-interactors of MTMRs. First of all we screened GST-tagged C-termini
of MTMRs against 96 different PDZ domains spotted on a membrane (Fam et al,
2005). Thereby we identified the first two PDZ domains of Sap97 to bind
specifically to the GST-tagged C-termini of MTMR1 (-VHTSV), Mtmr1 (-VHTSV)
and MTMR2, but not Mtm1. The finding that Mtmr2 interacts with Sap97 as such
was nothing new. Initially, the Sap97-Mtmr2 interaction was identified in
Schwann cells of mice, where Sap97 is enriched in the paranodal cytoplasm.
Interestingly, Sap97 localization was altered in Schwann cells of conditional
Mtmr2-null mice. Loss of the interaction between Sap97 and Mtmr2 results in
myelin outfoldings at the paranodes, suggesting that this interaction regulates
cellular junctions or membrane remodelling in Schwann cells (Bolino et al, 2004).
To specifically localize and characterize the Mtmr2-binding domain of Sap97
more precisely, we coexpressed and purified full length His-tagged Mtmr2 and
HA-tagged PDZ domains of Sap97 (Sap97-PDZ1, Sap97-PDZ2, Sap97-PDZ3,
Sap97-PDZ1-2
or
Sap97-PDZ1-3)
from
Sf21
insect
cells.
Our
coimmunoprecipitation experiments revealed that Mtmr2 preferentially binds to
the second PDZ domain of Sap97 (Figure 7-10). Meanwhile, Bolis et al. (2009)
117
Discussion and Outlook
showed by GST-pulldown experiments from COS-7 cells expressing Myc-tagged
Mtmr2 and GST-tagged Sap97 PDZ domains (PDZ1, PDZ1+2 or PDZ2+3) that
Mtmr2 preferentially interacted with Sap97-PDZ1+2 and Sap97-PDZ2+3. Their
results clearly support our findings, whereas we additionally could show a
specific affinity of Mtmr2 towards the second PDZ domain of Sap97. Rescue
experiments in Mtmr2-null explants with Mtmr2 and Mtmr2 devoid of the PDZbinding motif (Mtmr2∆PDZ) showed that Mtmr2∆PDZ rescued myelin outfoldings
significantly less effectively than Mtmr2 (Bolis et al, 2009). Additionally, Bolis et
al. identified in Schwann cells the plus-end directed motor protein kinesin 13B
(kif13B) and the exocyst component Sec8 to interact with Sap97. They proposed
a model in which Sap97-Sec8 interaction promotes membrane addition to sites of
membrane remodelling and Mtmr2 negatively regulates membrane formation
(Figure 8-1, A). Cotter et al. (2010) silenced Sap97 by injection of lentiviral
vectors expressing shRNA in myelinating Schwann cells in mouse sciatic nerves
at early stages of myelination (3 to 4 days postnatal). Two months after injection
the thickness of myelinating Schwann cells was strikingly increased, whereby
internodal length remained unaffected. Furthermore, they observed that some
Sap97-silenced cells displayed myelin outfoldings, typical characteristics of
CMT4B. Sap97 overexpression prevented Schwann cell myelination, indicating
an inhibitory function. At last, they observed that axonal neuregulin-1 type III
stimulated myelination
was
negatively regulated by Sap97 and Pten.
Furthermore, Pten and PI3K regulate the turnover of PI-4,5-P2 and PI-3,4,5-P3,
whereby loss of Pten was shown to result in increased levels of PI-3,4,5-P3 which
have been shown to trigger myelination in PNS and CNS (Goebbels et al, 2010).
Summerizing the above mentioned observations: Mtmr2, Pten and Sap97
influence membrane remodeling and myelination either alone or in complex with
each other. Regarding our results and taking the above mentioned observations
together, it would be interesting to see which effect a deletion of the second PDZ
domain of Sap97 would have on myelin formation and on downstream signaling
of Pten. Furthermore, it would be interesting to analyze whether weaker binding
of Mtmr2 to the first or third PDZ domain of Sap97 would be enough for myelin
118
Discussion and Outlook
formation. Sap97 has been reported to bind via its PDZ domains to various
C-termini of receptors and ion channels, thereby regulating function and
localization of these membrane proteins (see Table 8-1). Additional potential
PDZ-domain binding interactors of Sap97 predicted from the primary PDZ
binding motif sequence were summerized in the Table S6 by Tonikian et al.
(2008). In addition to the PDZ dependent interaction of Sap97 to the plus-end
directed microtubule motor protein KIF1Bα, Sap97 has also been reported to
interact through its N-terminus to the minus-end directed actin motor protein
myosin VI and through its MAGUK domain with the plus-end directed microtubule
motor protein Kif13B (Hanada et al, 2000; Wu et al, 2002; Mok et al, 2002). In
Schwann cells KIF13B could transport Sap97 at sites of membrane remodeling,
where interaction with Sec8 and Mtmr2 could regulate the rate of membrane
addition (Bolis et al, 2009). The exact molecular mechanism of Mtmr2 on
membrane remodeling during Schwann cell myelination is still unclear. The
interaction of a PDZ scaffold with motor proteins has recently been shown to be
important for the sequence-dependent recycling of receptors. Analysis of
endosomal sorting of beta-2 adrenergic receptor (β2AR) revealed concentrated
localization of β2AR in actin-stabilized recycling tubules positive for Rab4 and
Rab11. Furthermore, they could show that the linkage of the receptor to the local
actin cytoskeleton was mediated through PDZ-domain interactions (Puthenveedu
et al, 2010). Similar results were found for the intracellular trafficking of
internalized Vascular Endothelial Growth Factor Receptor-2 (VEGFR-2).
Stimulation with Neuropilin-1 (NRP1)-binding isoform VEGF-A165a led to receptor
recycling to the plasma membrane through Rab11, while an isoform unable to
bind NRP-1, VEGF-A165b, failed to do so (Ballmer-Hofer et al, 2011; Berger et al,
2011).
They
could
show
that
the
transition
of
internalized
VEGFR-2/NRP-1/VEGF-A165a complex from Rab4 to Rab11 vesicles was
mediated by the PDZ binding of NRP-1 to GIPC. These results suggested a
GIPC-mediated recycling of VEGFR-2/NRP-1/VEGF-A165a complex. Since GIPC
was previously reported to associate with myosin VI (Aschenbrenner et al, 2003;
Naccache
et
al,
2006),
they
proposed
119
that
the
attachment
of
a
Discussion and Outlook
NRP-1/GIPC/myosin VI complex to VEGFR-2 by VEGF A165a lead to association
with the actin cytoskeleton early after internalization. Myosin VI can therefore be
seen as mediator for trafficking of internalized cargo to early and recycling
endosomes. Recycling back to the plasma membrane however, would need a
plus-end-directed myosin motor as for example myosin Vb. Interestingly, Rab11a
has been reported to form a ternary complex with the myosin Vb and Rab11family interacting protein 2 (FIP2), representing a possible sorting mechanism
back to the plasma membrane along the actin cytoskeleton and/or by tubulation
(Hales et al, 2001; Hales et al, 2002).
Up to now, the role of MTMR1 is poorly understood. During differentiation and
development of skeletal muscle cells the MTMR1 gene is subject to alternative
splicing and a muscle-specific transcript was reported. In patients with congenital
myotonic dystrophy (cDM1) mRNA splicing of various genes is disturbed,
including the muscle-specific isoform of MTMR1 (Buj-Bello et al, 2002a). The
only so far known interaction of the PDZ binding motif of MTMR1 with a PDZdomain containing protein has been identified in a yeast-two-hybrid screen using
TIP-15 as bait (splice variant of PSD95/DLG4/SAP90 harboring the first two PDZ
domains) (Fabre et al, 2000). The C-terminal PDZ-binding motif of MTMR1 with
the sequence –VHTSV belongs to the class I PDZ-BD consensus sequence
X-S/T-X-V/L. By the PDZ-domain array, as well as by GST pulldowns, this
interaction was confirmed (Figure 7-4). In addition, I could show that the C-term
of Mtmr1 interacted with the third PDZ domain of PSD95. Thereby we monitored
a stronger signal for mouse Mtmr1 compared to human MTMR1. Interestingly,
also the PDZ domains SAP97 PDZ1+2, SAP97 PDZ3 and PTPN13 PDZ4+5
precipitated stronger with Mtmr1 compared to MTMR1 (Figure 7-4). Although the
C-termini of both Mtmr1 (-TSVHTSV) and MTMR1 (-TPVHTPV) are homologous
in the last five amino acids, they differ at the sixth last position. The proline of
MTMR1 might have introduced sterical changes into the peptide chain explaining
the differential binding properties between MTMR1 and Mtmr1. PSD95 is an
abundant excitatory postsynaptic scaffolding protein which has been implicated
together with the MAGUK family members in the regulation of excitatory synapse
120
Discussion and Outlook
formation, maturation and plasticity (reviewed in (Zheng et al, 2011)). PSD95
interacts and scaffolds a subset of membrane receptors which are listed in Table
8-1. Recently, Mtmr2 was localized in excitatory synapses of rat central neurons
and was identified to interact with the first two PDZ domains of PSD95 (Lee et al,
2010). The C-terminal PDZ-BD sequence –VQTVV of Mtmr2 is highly similar to
Mtmr1 (-VHTSV). Furthermore they observed that knockdown of Mtmr2 in
cultured neurons reduced excitatory synapse density and function and shifted the
intensity of EEA1-positive signal on EEs from dendrites to the cell body region.
This effect was rescued by wild-type Mtmr2 but not by Mtmr2∆PDZ or Mtmr2
lacking the phosphatase activity. Suppression of Mtmr2 promoted endocytosis of
the
AMPA
receptor
subunit
GluR2,
which
mainly
localized
to
late
endosomes/lysosomes in the cell body. Lee and coworkers therefore suggested
that PSD95 promotes the synaptic localization of Mtmr2, and that synaptically
targeted Mtmr2 maintains excitatory synapses by inhibiting excessive endosomal
production and destructive trafficking to lysosomes. Based on the findings of
Mtmr2 function on EGFR trafficking I would suggest, that Mtmr2 phosphatase
activity alters the local phosphoinositide pool and thereby redirects the receptor
complex back to the plasma membrane (Figure 8-1, B). The question which
arises is, whether PSD95 knockdown or mutant lacking the first two PDZ
domains would recapitulate the Mtmr2 knockdown phenotype in the excitatory
synapses. Moreover, does Mtmr1 also play a role in excitatory synapses or does
PSD95-Mtmr1 interaction have another cell specific area of action? As a next
step Mtmr1-Sap97 interaction should be confirmed in vitro and in vivo with full
length proteins. Assuming that Mtmr1 and Mtmr2 have overlapping PDZ-domain
binding specificities, it would be interesting to analyze, whether Mtmr1 is able to
compete with Mtmr2 for binding to the PDZ domain or whether Mtmr1 might even
compensate Mtmr2 knockdown phenotype.
The PDZ array revealed that the third PDZ domain of PDZK2 specifically and
only interacted with the C-term of Mtm1. We confirmed the Pdzk2-Mtm1
interaction in vitro and in vivo and could show that the interaction was dependent
on the last 5 carboxy-terminal amino acids. mRNA based expression patterns of
121
Discussion and Outlook
Pdzk2 identified Pdzk2 mainly in intestine and kidney (Gisler et al, 2001; Scott et
al, 2002). Interestingly, immunoprecipitation of Mtm1 from mouse tissue
coprecipitated Pdzk2 not only from intestine and kidney tissue lysates, but also
from cerebellum, muscle, stomach, heart, spleen and liver tissue lysates. To our
best knowledge, Pdzk2 has yet not been correlated to XLMTM. Considering that
mutations in Mtm1 gene cause the muscle specific phenotype CNM and
regarding our finding that Pdzk2 is expressed in mouse muscle and does interact
with Mtm1, strongly suggest to analyze the role of Mtm1-Pdzk2 interaction in
muscle cell function more intensively. Assuming Pdzk2 has a scaffolding function
in muscle cells at the plasma membrane or at endosomes strongly points to
follow up with an analysis of Pdzk2-interacting proteins via pulldowns from
muscle tissue. PDZK2 (also named NHERF4 or IKEPP) belongs to the Na+/H+
exchanger regulatory factor (NHERF) family of epithelial-enriched PDZ domain
scaffolding proteins. Out of four family members NHERF1 and NHERF2 are
characterized by two PDZ domains and a C-terminal MERM (Moesin, Ezrin,
Radixin, Merlin) binding domain. PDZK1/NHERF3 and PDZK2/NHERF4 lack the
MERM domain but consist of two additional PDZ domains. NHERFs play
important roles for the regulation of intestinal ion transport and have been shown
to bind through their PDZ domains to ion channels, receptors, transporters and
signaling molecules, thereby regulating transport activity, subcellular localization
and ion homeostasis (Gisler et al, 2001; Gisler et al, 2003; Shenolikar et al, 2004;
Thelin et al, 2005; Lamprecht et al, 2006). Proteins interacting with the PDZ
domains of Pdzk2 are listed in Table 8-1. OCTN2 is a sodium-dependent uptake
transporter for L-carnitine, expressed in kidney, heart, skeletal muscle and
placenta (Tamai et al, 1998). Interestingly, in HEK293 cells coexpressing PDZK2
and OCTN2, cell surface expression level and L-carnitine transport capacity of
OCTN2 was increased (Watanabe et al, 2006). Whether this was due to a
stabilizing effect of PDZK2 at the plasma membrane was not analyzed. It could
also be suggested that internalized OCTN2 localized at EEs bound PDZK2 and
then recycled back to the plasma membrane. Furthermore, it could be
hypothesized that PDZK2 interacted with phosphatases e.g. Mtm1, which
122
Discussion and Outlook
promoted recycling of OCTN2/PDZK2 complexes from EEs. The recycling
hypothesis is supported by the finding that the C-terminal PDZ-BD of CFTR is
required for the recycling of CFTR from EEs/REs back to the plasma membrane
(Moyer et al, 1999; Swiatecka-Urban et al, 2002; Lamprecht et al, 2006).
Thereby, binding to members of the NHERF family has been suggested to
promote the recycling of CFTR (Lamprecht et al, 2006). The calcium transporters
transient receptor potential vanilloid member 5 (TRPV5) and TRPV6 tightly
control transcellular Ca2+ (re)absorption in epithelial cells of intestine and kidney
and thereby regulate calcium homeostasis (reviewed in (Renkema et al, 2011)).
Gene ablation of TRPV5 and TRPV6 in mice leads to hypercalciuria, which forms
the main risk factor for renal stone formation (Hoenderop et al, 2003; Coe et al,
2005). Long term survivors with XLMTM have been reported with clinical
complications including gall stones, kidney stones, nephrocalcinosis and
biochemical evidence of liver dysfunction (Herman et al, 1999). Considering the
hypothesis that Mtm1 might influence ion homeostasis and absorption e.g. in the
kidney via binding of Pdzk2 to TRPV5 and/or TRPV6 might explain the observed
formation of kidney stones and nephrocalcinosis in long term XLMTM patients,
as well as other accompanied complications. NaPi-IIa cotransporter plays an
important role in renal phosphate reabsorption and homeostasis at the brush
border
membrane.
Parathyroid
hormone
(PTH)
regulates
phosphate
homeostasis by inducing internalization and degradation of NaPi-IIa (Pfister et al,
1998; Pfister et al, 1997). In transfected OK cells the transporter NaPi-IIa was
reported to localize predominantly at the apical plasma membrane. Deletion of
the last three C-terminal amino acids partially prevented apical expression of
NaPi-IIa and increased its localization in intracellular compartments (KarimJimenez et al, 2001). NaPi-IIa was shown to bind with its C-terminal PDZ-BD to
the third PDZ domain of both Pdzk1 and Pdzk2 and to the first PDZ domain of
NEHRF1 (Gisler et al, 2001). Similar to CFTR, localization of NaPi-IIa has been
suggested to be regulated by NHERF scaffolding proteins (reviewed in (Bacic et
al, 2004)). Immunostaining of mouse proximal tubules showed that, Nherf1,
Nherf2 and Pdzk1/Nherf3 colocalized with NaPi-IIa within the brush border
123
Discussion and Outlook
membrane (BBM) and Pdzk2 localized subapically (Gisler et al, 2001).
Furthermore, it should be mentioned that overexpression of the third PDZ domain
of Pdzk1, which is highly homologous to the third PDZ domain of Pdzk2, had a
dominant negative effect on the apical expression of NaPi-IIa (Hernando et al,
2002; Thelin et al, 2005). Nherf1 and Pdzk1 could therefore stabilize NaPi-IIa at
the apical plasma membrane or support recycling as described above for
OCTN2. We therefore need functional assays which analyze the influence of
Mtm1 and Pdzk2 on the trafficking and activity of Pdzk2-bound receptors such as
TRPV5, TRPV6, NaPi-IIa or OCTN2. By immunostainings of transiently
transfected COS-7 cells and HEK293 cells we observed that Mtm1 and Pdzk2
colocalized in vesicles, suggesting Mtm1 and Pdzk2 to form a complex at these
structures (Figure 7-6 and Figure 7-7). Immunostainings of OK cells stably
expressing NaPi-IIa and transiently transfected with Mtm1 and Pdzk2, NaPi-IIa
clustered at the apical plasma membrane and in microvilli, consistent with
previous localization studies (Blaine et al, 2009; Pfister et al, 1997; Pfister et al,
1998). As expected, Pdzk2 localized subapically of the plasma membrane in the
cytoplasm, however we could not observe colocalization of Pdzk2 with Mtm1 in
vesicles (Figure 7-9). Thus we hypothesized, that upon PTH stimulation Pdzk2
and/or Mtm1 might relocate e.g. to NaPi-IIa positive endosomal compartments.
However, due to the highly inhomogeneous NaPi-IIa expression and the low rate
of transiently transfected polarized cells positive for Mtm1 and Pdzk2, we were
not able to assess NaPi-IIa, Pdzk2 and Mtm1 localization under PTH stimulated
conditions in OK cells. The question whether Mtm1 overexpression influences
NaPi-IIa localization and trafficking remains therefore still unanswered. The
following experimental changes, improvements or alternatives should be
considered: (1) Establish OK cell line stably expressing NaPi-IIa, Pdzk2 and
Mtm1 simultaneously and repeat PTH-directed internalization and localization
studies; analyze alternatively the influence of Mtm1 and Pdzk2 on (2) OCTN2
localization, transport activity and carnitine-uptake in HEK293 (Watanabe et al,
2006) or on (3) TRPV5/TRPV6 localization, transport activity and Ca+-uptake in
HEK293 or HeLa cells (van de Graaf et al, 2006; van de Graaf et al, 2008).
124
Discussion and Outlook
Table 8-1: List of interaction partners of SAP97, PSD95/SAP90/DLG4 and PDZK2/IKEPP
and their PDZ domain binding interactors
PDZ Protein
PDZ
Domain
1
SAP97/DLG1
2
3
1-3
1
PSD95/SAP90/DLG4
2
3
1-2
Interactor
Reference
NrCAM
(Dirks et al, 2006)
NR2B
(Wang et al, 2005)
GluR6
(Mehta et al, 2001)
KIFIBα
(Mok et al, 2002)
SEC8
(Bolis et al, 2009)
Kir2.2
(Leonoudakis et al, 2001)
KIFIBα
(Mok et al, 2002)
MTMR2
Figure 7-10 and (Bolis et al, 2009)
PTEN
(Valiente et al, 2005)
SEC8
(Bolis et al, 2009)
NR2A-D
(Cui et al, 2007)
NR2B
(Wang et al, 2005)
GluRA
(Cai et al, 2002)
SST1
(Cai et al, 2008)
9ORF1
(Lee et al, 1997)
APC
(Lee et al, 1997)
PKCα
(O'Neill et al, 2011)
β1AR
(He et al, 2006)
GluR1
(Leonard et al, 1998)
Kir2.1
(Nehring et al, 2000)
KIFIBα
(Mok et al, 2002)
KCNA4/Kv1.4
(Piserchio et al, 2002)
GluR6
(Piserchio et al, 2002)
CRIPT
(Piserchio et al, 2002)
Kir2.1
(Nehring et al, 2000)
KIFIBα
(Mok et al, 2002)
SEMA4F
(Schultze et al, 2001)
NLGN1
(Irie et al, 1997)
ERBIN
(Huang et al, 2001)
KCNA1-4
(Kim et al, 1995)
ERBB4
(Garcia et al, 2000)
MTMR1
(Fabre et al, 2000)
SEC8
(Fabre et al, 2000)
125
Discussion and Outlook
1-3
MTMR2
(Lee et al, 2010)
NrCAM
(Irie et al, 1997)
NR2A
(Bassand et al, 1999)
SEMA4B
(Burkhardt et al, 2005)
SEMA4C
(Inagaki et al, 2001)
MAP17
(Lanaspa et al, 2007)
NaPi-IIa
(Gisler et al, 2001)
MRP2
(Hegedus et al, 2003)
GCC
(Scott et al, 2002)
MTM1
See chapter 7.1.4.1
MAP17
(Lanaspa et al, 2007)
TRPV5
(van de Graaf et al, 2006)
TRPV6
van de Graaf et al, 2006a)
DRA
(Lamprecht et al, 2006)
CFTR
(Lamprecht et al, 2006)
NHE3
(Lamprecht et al, 2006)
OCTN1
(Kato et al, 2004)
OCTN2
(Kato et al, 2004)
OCT3
(Kato et al, 2004)
1
3
PDZK2/IKEPP/
NHERF4
4
1-4
In
summary,
the function
of
MTMRs
in
trafficking
and
recycling
of
transmembrane receptors and their influence on endosome maturation through
their phosphatase activity has been reported many times. The identification and
characterization of the interaction of MTMRs with PDZ-domain containing
scaffolding proteins however, is still scarce and only few MTMR-PDZ protein
interactions have been analyzed in detail. Although I have not discussed all
single positive PDZ-array results here, the abundance of potential PDZinteractors for each tested MTMR points to a significant role. Differential
interaction of MTMRs with PDZ domain containing proteins, which themselves
also interact with different membrane receptors can therefore result in differential
function and specificity of MTMRs. Whether the different PDZ-dependent specific
interactions between Mtm1 and Mtmr2 are the answer to the differential clinical
features of XLMTM and CMT4B diseases, respectively, remains open.
126
Discussion and Outlook
Nevertheless, we have shown that Pdzk2 is bound by Mtm1 and not by Mtmr2
pointing to such a selectivity. Based on the findings (1) that overexpression of
MTMRs can block the degradation of membrane receptors and can promote their
recycling, (2) that overexpression of certain PDZ scaffolds enhances receptor
activity and abundance at the plasma membrane and (3) MTMRs as well as
receptors and channels bind to PDZ scaffolding proteins prompted us to merge
these findings and propose an updated model. Figure 8-1 (A) represents a
modified model proposed by Bolis et al. (2009). Mtmr2 interacts through its PDZBD with the second PDZ domain of Sap97. Sap97 interacts via its MAGUK
domain with the plus-end directed microtubule motor protein Kif13B, which
directs the whole protein complex in Schwann cells towards the plasma
membrane and the site of membrane remodeling. In the modified and
generalized model (Figure 8-1, B) a receptor binds via its PDZ-BD to a PDZ
scaffold protein at EEs. The PDZ protein also interacts with an active member of
the MTMR family. Thereby, the phosphatase activity of the MTMR alters the local
pool of phosphoinositides. The reduction of PI-3-P and PI-3,5-P2 pool leads to a
reduced recruitment of adaptors for degradation such as the ESCRT machinery
including Vps24 or Hrs. The local increase of PI-5-P triggers the recruitment of
recycling adaptors such as SNX5. The binding of MTMRs to receptor-PDZscaffold complexes therefore promotes and directs recycling of the whole
complex to the plasma membrane. Dependent on the domain structure of the
PDZ scaffold, the protein complex can be transported along the cytoskeleton by
association with actin or microtubule binding motor proteins.
127
Discussion and Outlook
Figure 8-1: Model of MTMR-PDZ scaffold interaction in membrane and receptor recycling
(A) To regulate membrane homeostasis, Sec8 (not depicted in this graph) and Mtmr2 (blue) are
transported via Sap97 (green) and by the motor protein Kif13B (violet) to the Schwann cell
membrane (modified from (Bolis et al, 2009)). (B) Postulated model of MTMR (blue), PDZ
scaffold (green), receptor (orange) and a putative interacting motor protein (violet) at the early
endosome. Phosphatase activity of MTMRs leads to local reduction of PI-3-P and PI-3,5-P2 pools
and/or increase of PI-5-P pool, which promote recycling to plasma membrane. Interaction of PDZ
scaffold with motor protein connects the whole protein complex to the cytoskeleton.
8.2 Interactions between active and inactive MTMR members
Specificity among the MTMRs can not only be gained by differential interaction
with PDZ scaffolds, but also by differential interaction with other MTMR family
members. The majority of MTMRs have been shown to homodimerize and/or
heteromerize (see Table 5-1). Heteromerization between active and inactive
MTMRs resulted in several changes including increased catalytic activity of the
active member (Kim et al, 2003; Nandurkar et al, 2003; Mochizuki et al, 2003;
Berger et al, 2006a; Zou et al, 2009), relocalization of the protein complex to
specific subcellular sites (Nandurkar et al, 2003; Kim et al, 2003; Lorenzo et al,
2006) and modified substrate specificity, as shown for the Mtm1/3-Pap
heterodimer purified from platelets which can dephosphorylate PI-3,4-P2
(Nandurkar et al, 2001). Both Mtm1 and Mtmr2 interact with the inactive
3-Pap/Mtmr12 (Nandurkar et al, 2003), but only Mtmr2 was shown to
heteromerize with Sbf1/Mtmr5 and Sbf2/Mtmr13 (Kim et al, 2003; Berger et al,
2006a).
128
Discussion and Outlook
8.2.1 The Mtmr2/Sbf2 protein complex
Previously, Mtmr2 and Sbf2 were both shown to homodimerize each through
their coiled-coil domain and to form a heterotetramer (Berger et al, 2006a). To
understand how Sbf2 increases the catalytic activity of Mtmr2 from the structural
point of view we aimed to express and purify the Mtmr2/Sbf2 complex for
structural analysis by crystallization and SAXS. We successfully expressed Histagged Mtmr2 simultaneously with the full length CBP-tagged Sbf2 or with the
Sbf2 truncated versions CBP-Sbf2-MT+PH and CBP-Sbf2-MT. Complex
formation
of
His-Mtmr2/CBP-Sbf2,
His-Mtmr2/CBP-Sbf2-MT+PH
and
His-Mtmr2/CBP-Sbf2-MT was confirmed after a single IMAC purification (Figure
7-11, Figure 7-12 and Figure 7-13). Separation of the His-Mtmr2/CBP-Sbf2
complex however was not optimal. Although Mtmr2 mainly eluted as homodimer
and Sbf2 in an aggregated state, low amounts of Mtmr2/Sbf2 complex eluted
with an apparent molecular size consistent with a tetrameric state. Against
expectations,
SEC
purification
of
His-Mtmr2/CBP-Sbf2-MT+PH
and
His-Mtmr2/CBP-Sbf2-MT resulted not in the elution of a tetramer, but rather in
the elution of a His-Mtmr2 dimer together with a CBP-Sbf2-MT dimer or a
CBP-Sbf2-MT+PH dimer. This let suggest that the N-terminal region including the
DENN domain and a large unidentified domain (~451 amino acids) might
contribute to the stability of a heterotetrameric complex formation with Mtmr2.
This hypothesis could be verified by coexpression and analytical purification of
Mtmr2 together with a truncated Sbf2 version possessing the N-terminal domain
but missing the C-terminal PH domain. This however, was not tested in this work.
Furthermore, it was observed that CBP-Sbf2-MT and CBP-Sbf2-MT+PH
expressed in similar amounts compared to His-Mtmr2, whereas CBP-Sbf2
expression was lower and during gelfiltration mainly eluted together with
aggregates. Although the large N-terminal domain upstream of the PH-GRAM
domain of Sbf2 seemed to contribute to the stability of a heterotetramer formation
with Mtmr2, it also decreased together with the C-terminal domain the solubility
of Sbf2. Since purification of a stable Mtmr2/Sbf2 tetramer devoid of any flexible
domains for crystallization was unsuccessful this project was stopped at this
129
Discussion and Outlook
point. Alternatively we analyzed the characterized Mtmr2 interaction with the
inactive phosphatase 3-Pap/Mtmr12.
8.2.2 Structural characterization of Mtmr2 homodimer, 3-Pap
monomer and Mtmr2/3-Pap heterodimer
Originally, 3-phosphatase adapter protein (3-Pap) was purified from rat brain in
form of a heterodimer with an associated unidentified 65 KDa PI-3-P
3-phosphatase (Caldwell et al, 1991). Size exclusion chromatography revealed
that this 65 KDa protein existed as homodimer and as heterodimer with 3-Pap,
whereby the heterodimeric complex exhibited increased specificity and
phosphatase activity towards its substrate PI-3-P. Ten years later, the cDNA of
human 3-PAP was cloned and its coding protein characterized as catalytically
inactive phosphatase of the MTMR family (Nandurkar et al, 2001). In 2003,
MTM1 was identified as catalytic subunit associated with 3-PAP. Interaction of
3-PAP with MTM1 caused relocation of MTM1 from the plasma membrane to the
cytosol and to punctuate vesicles and attenuated the MTM1-overexpressing cell
phenotype in COS-7 cells. In addition, also MTMR2 was found to interact with 3PAP (Nandurkar et al, 2003). The Mtmr2/3-Pap interaction was later confirmed in
mouse Schwann cells (Tersar, 2008). In the second part of this thesis I described
the successful expression, purification and characterization of the proteins Mtmr2
and 3-Pap and their protein complex Mtmr2/3-Pap. Furthermore I identified the
relevant domains for Mtmr2/3-Pap complex formation and I determined the
subcellular localization of Mtmr2, 3-Pap and EGFR in cells under steady state
and EGF stimulated conditions.
As previously described, purification by gelfiltration of His-Mtmr2 clearly resulted
in an apparent molecular size consistent with a homodimeric state (Berger et al,
2003) (Figure 7-16). Crystal structures of Mtmr2 monomer (PDB: 1LW3) was
previously described, but lack the first N-terminal 73 amino acids and the last Cterminal 57 amino acids, including the coiled-coil motif and the PDZ binding
domain (Begley et al, 2003; Begley et al, 2006). SAXS analysis of Mtmr2
homodimer enabled us to confirm the dimeric state of Mtmr2 and led us to
propose a 3D shape reconstruction of the full length Mtmr2 homodimer. The
130
Discussion and Outlook
SAXS envelope of Mtmr2 exhibited an elongated tail and a major globular
domain, which we proposed to be formed by the two Mtmr2 monomers.
Furthermore, manual superimposition of two individual Mtmr2 monomers (PDB:
1LW3) with the SAXS shape matched if oriented in parallel (Figure 7-18). We
therefore propose that the two Mtmr2 monomers orient in parallel to form a
homodimer. This is supported by the finding that the coiled-coil domains of
Mtmr2 form a parallel dimer (Berger et al, 2003).
In contrast to Mtmr2, no structural information on 3-Pap has been reported. We
therefore analyzed the protein by analytical gelfiltration. To my best knowledge,
this is the first report of recombinant 3-Pap protein expression and purification.
Gelfiltration of His-3-Pap suggested an apparent molecular size consistent with a
monomeric state (Figure 7-19). To a smaller extent, 3-Pap also eluted as
homodimer. 3-Pap homodimers were previously described in yeast-two-hybrid
screenings (Lorenzo et al, 2006) and we could confirm their existence by
immunoprecipitation experiments from transiently transfected HEK293 lysates
(data not shown). It remains to be investigated, whether the presence and
stability of 3-Pap homodimers is increased in vivo under physiological conditions.
To obtain structural information at the molecular level crystallization screens
were performed, which did not yield any crystals. Thus, to obtain the overall
structure of the full length His-3-Pap monomer in solution we performed SAXS
analysis. The distance distribution functions of 3-Pap monomer compared to
Mtmr2 dimer clearly deviated from each other, suggesting a thinner corpus for
3-Pap (Figure 7-21). The SAXS derived shape of 3-Pap compared to Mtmr2 was
clearly thinner, supporting the monomeric state of 3-Pap and the dimeric state of
Mtmr2 (Figure 7-22). Higher resolution data of the 3-Pap structure in future is
absolutely required since the low resolution of the 3-Pap SAXS shape did not
allow detailed conclusions regarding to structure and orientation of monomers.
The characteristics of Mtmr2/3-Pap complex formation were solved by analytical
two step purification of differentially tagged His-Mtmr2 and Strep-3-Pap proteins
(Figure 7-15). We could show that Mtmr2 formed a heterodimer with 3-Pap. It
would be interesting to know, whether the conformation of an Mtmr2/3-Pap
131
Discussion and Outlook
heterodimer is similar to the Mtmr2 homodimer or not. The Mtmr2/3-Pap complex
formation was shown to be dependent on the C-terminus including the coiled-coil
motif (Figure 7-14). If the C-termini of Mtmr2 and 3-Pap would dimerize by their
coiled-coil, it would be interesting to know whether the coiled-coil domain forms a
parallel or an antiparallel dimer. In future experiments a SAXS analysis of the
Mtmr2/3-Pap heterodimer should be envisaged. Similar to the complex formation
with Mtm1 (Caldwell et al, 1991), 3-Pap heterodimerized with Mtmr2, assuming
that 3-Pap generally occurs as a heterodimer with active MTMRs. Interestingly,
gelfiltration analysis of Mtm1 in the absence of substrate resulted in a molecular
weight representing a monomeric state (Schaletzky, 2002). Titration of Mtm1 with
the catalytically dead mutant Mtm1 C375S in the presence of PI-3-P not only
increased catalytic activity of the active Mtm1, but also promoted oligomerization
givin rise to heptameric ring structures (Schaletzky et al, 2003). Interaction
interfaces or domains of Mtm1 oligomers have not been analyzed. Furthermore,
it is also unknown, whether Mtm1/3-Pap complexes interact through their Cterminus, as we observed for the Mtmr2/3-Pap complex. Considering the high
sequence similarity among the MTMRs and the multiple reports of coiled-coil
dependent MTMR-MTMR complex formations (see 5.1.4 for references), one
could suggest that 3-Pap also heterodimerizes with Mtm1 in a coiled-coil
dependent manner. In contrast to the other dead phosphatase Sbf2 or the
binding partner Mtmr2, 3-Pap preferentially is a monomer. It would be interesting
to investigate, whether the dead phosphatase Mtmr10, which is the closest
relative of 3-Pap in the MTMR family, is also monomeric. Interestingly, yeast-twohybrid screenings revealed that Mtmr10 interacts with Mtm1 and Mtmr2, similar
to 3-Pap. Hence, it would also be interesting to characterize Mtmr10/Mtm1 or
Mtmr10/Mtmr2 complex formation more closely. Since both Mtm1 and Mtmr2
were found in a heterodimeric complex with 3-Pap, this lets us to suggest that
monomeric 3-Pap triggers heteromeric complex formation. Although the exact
mechanism of heterodimer formation is not known yet, one possible scenario
could be that monomeric 3-Pap interacts through its coil domain with the coiledcoil of Mtmr2 homodimer, thereby 3-Pap attacks and destroys the coiled-coil
132
Discussion and Outlook
dependent
heterodimer.
Mtmr2-Mtmr2
The
dead
interaction
and
phosphatases
establishes
Sbf1/Mtmr5,
an
Mtmr2/3-Pap
Sbf2/Mtmr13
and
3-Pap/Mtmr12 have in common that complexing with an active MTMR resulted in
increased catalytic activity of the active partner and relocalized the latter to other
specific subcellular sites (Kim et al, 2003; Nandurkar et al, 2003; Berger et al,
2006a; Lorenzo et al, 2006). However, dependent on the proteins involved, this
resulted in completely distinct subcellular localization. In the case of Mtmr2/Sbf2
complexes additional domains like the PI-3,4,5-P3 binding PH domain of Sbf2
have been proposed to play a role in relocalization and function (Berger et al,
2006a). Furthermore, in contrast to 3-Pap, Sbf2 homodimerizes and has been
shown to form heterotetramers with Mtmr2 dimers (Berger et al, 2006a). It has to
be considered that not only binding of structurally different dead phosphatases,
but also the resulting altered stoichiometry of the complex formation (heterodimer
vs tetramer) might influence Mtmr2 function and localization. I therefore strongly
suggest making a distinction of at least two different classes of dead
phosphatases interacting with Mtmr2. A phylogenetic survey of myotubularin
genes revealed that dead phosphatases appeared early in evolution and
independently on three separate occasions in eukaryotic evolution: Giardia
lamblia, Dictyostelium discoideum and Entamoeba histolytica (Laporte et al,
2003; Kerk et al, 2010). Based on the genome sequences, MTMRs were
classified into six subgroups, three of which are represented by the dead
phosphatases. From these the first subgroup comprises MTMR9, the second
MTMR10, MTMR11 and MTMR12 and the third subgroup includes MTMR5/SBF1
and MTMR13/SBF2. Inactive MTMR9 has been shown to homodimerize and to
heteromerize with active members of the subgroup comprising MTMR6, MTMR7
and MTMR8 (Mochizuki et al, 2003; Lorenzo et al, 2006; Zou et al, 2009). The
stoichiometry of these complexes however, has not been solved yet. Up to date,
MTMR2 is the only active MTMR reported to interact with two different
types/subgroups of dead phosphatases, accentuating the specificity and
importance of these interactions.
133
Discussion and Outlook
8.2.3 Subcellular localization of Mtmr2, 3-Pap and EGFR under
resting and growth factor stimulated conditions
Finally, we determined the subcellular localization of Mtmr2 and 3-Pap by
immunostaining of
transiently transfected HEK293 cells. Under resting
conditions, Mtmr2 staining was found in punctuate structures whereas 3-Pap
staining was diffusely distributed in the cytosol. Mtmr2 and 3-Pap colocalized at
the surface in membrane ruffles but not in the cytosol (Figure 7-23). Membrane
ruffles are regions of increased PI-4,5-P2 levels, where processes like
endocytosis and macropinocytosis take place (McLaughlin et al, 2002; Doherty et
al, 2009). Under resting conditions the level of PI-3-P is high within cells,
whereas the level of PI-3,5-P2 is low. Hypo-osmotic shock, UV radiation or EGF
stimulation however, has been shown to lead to a transient increase of PI-3,5-P2
levels (Dove, 1997; Jones et al, 1999; Tsujita et al, 2004; Cao et al, 2008). In
COS cells expressing Mtmr2 or Sbf2, both Mtmr2 and Sbf2 were confined to
membranes of stress induced vesicles under hypo-osmotic conditions (Berger et
al, 2003; Berger et al, 2006a). In COS cells coexpressing Mtmr2 and Sbf2,
Mtmr2 was no longer observed at these membranes, suggesting Sbf2 to
compete for Mtmr2-binding sites due to binding with higher affinity (Berger et al,
2006a). Beside its function as adaptor for the correct localization of Mtmr2 and as
regulator of Mtmr2 phosphatase activity, Sbf2 was also proposed to protect
PI-3,5-P2 from degradation (Cui et al, 1998). Here we report that under hypoosmotic condition of transiently transfected HEK293 cells, both Mtmr2 and 3-Pap
localized to membranes of stress induced vesicles (Figure 7-24). In HEK293 cells
coexpressing Mtmr2 and 3-Pap, both proteins were clearly colocalized at these
vesicles. In contrast to Sbf2, 3-Pap did therefore either not compete for Mtmr2
binding sites or had similar binding affinity compared to Mtmr2. In addition,
colocalization of Mtmr2 and 3-Pap suggested a specific function of the
Mtmr2/3-Pap complex at these membranes, supported by our finding that these
proteins heterodimerize. Differential function, regulation and localization for
Mtmr2/3-Pap homodimers and Mtmr2/Sbf2 tetramers, respectively, are therefore
likely. Mtm1 and Mtmr2 were both reported to relocalize under conditions with
elevated PI-3,5-P2, e.g. under hypo-osmotic conditions or EGFR stimulation
134
Discussion and Outlook
(Berger et al, 2003; Tsujita et al, 2004). In COS-7 cells PI-3,5-P2 peaks 40 min
after EGF stimulation and Mtm1 was shown to translocate to EGFR-positive late
endosomal compartments. Furthermore, it was reported that Mtm1 negatively
regulated EGFR trafficking from the late endosomes to lysosomes for
degradation (Tsujita et al, 2004). Mtmr2 was also reported to negatively regulate
EGFR degradation, however coexpression of Sbf2 counteracted this effect
(Berger et al, 2009). How and where Sbf2 fulfills the counteracting effect, alone
or in complex with Mtmr2, is not clear yet. Next, it would be highly interesting to
study localization of Mtmr2, Sbf2 and 3-Pap in cotransfected cells under hypoosmotic conditions. This experiment could address whether Sbf2 (or 3-Pap)
compete for Mtmr2/3-Pap (or Mtmr2/Sbf2) complex formation as well as for
localization at stress induced vesicles. Since in cells coexpressing Mtmr2/3-Pap
under hypo-osmotic conditions both Mtmr2 and 3-Pap were found at these
membranes, one could argue that 3-Pap or the Mtmr2/3-Pap complex do not
fulfill a protecting function but rather induce PI-3,5-P2 degradation at these
membranes and therefore stimulate recycling. Thus, we were interested whether
3-Pap or Mtmr2/3-Pap complex affect Mtmr2 in blocking EGFR degradation. As
mentioned above, Mtm1 was shown to block EGFR trafficking from the late
endosomes to the lysosomes for degradation (Tsujita et al, 2004). Whether
Mtmr2 also blocks EGFR trafficking for degradation in specific endosomal
compartments was not analyzed till now. Rab GTPases were used many times
as subcellular markers for the localization of MTMRs as well as to track transport
routes of membrane proteins such as RTKs (Cao et al, 2007; Cao et al, 2008;
Zwang et al, 2009; Stenmark, 2009; Franklin et al, 2011). Recent published data
showed that EGFR recycled through Rab11 vesicles under resting conditions.
However 180 min after EGF stimulation, EGFR was routed along the degradation
axis to Rab5, Rab4 and Rab7 vesicles but barely to Rab11 vesicles (BallmerHofer et al, 2011). Thus, we used the endosomal markers Rab4, Rab5, Rab7
and Rab11 to monitor EGFR localization along the recycling (Rab5-Rab4-Rab11)
and the degradation axis (Rab5-Rab4-Rab7). Mtmr2, 3-Pap and Mtmr2/3-Pap
complex localization was analyzed before and after EGF stimulation in transiently
135
Discussion and Outlook
transfected cells. Prior to EGF stimulation, Mtmr2 was found throughout the
whole cell in or at vesicles which are part of the recycling axis (Rab5-Rab4Rab11) as well as the degradation axis (Rab5-Rab4-Rab7) (Figure 8-2, A). Thirty
minutes after EGF stimulation, when the PI-3,5-P2 level should nearly have
reached its maximum (Tsujita et al, 2004), no relocalization of Mtmr2 was
observed. However, 180 min after EGF stimulation, Mtmr2 was mostly observed
in Rab5 and Rab11 recycling vesicles but no longer in Rab7 vesicles (Figure 8-2,
B). Cao et al. (2008) reported that Mtmr2 colocalized with Rab7, but not with
Rab5 or EEA1, in baby hamster kidney (BHK) and human epithelial carcinoma
A431 cells. Whether colocalization of Mtmr2 with Rab5 vesicles is dependent on
the cell type remains to be investigated. Subcellular localization of Mtmr2 after
EGF stimulation was not reported. In HEK293 cells overexpressing Mtmr2 and
stimulated 180 min, EGF was still detected in Rab5, Rab4 and Rab11 vesicles.
Cao et al. analyzed EGFR trafficking in Mtm1 or Mtmr2 siRNA silenced A431
cells. In mock transfected cells, EGFR was mainly degraded and occasionally
observed in Rab7 vesicles, consistent with other data (Ballmer-Hofer et al, 2011).
In A431 cells transiently transfected with Mtm1 siRNA, EGFR accumulated in
EEA1 positive vesicles 180 min after EGF stimulation. In Mtmr2 siRNA silenced
cells however, EGFR was detected in Rab7 vesicles. Based on these findings, it
was proposed that Mtm1 and Mtmr2 regulate distinct subcellular pools of PI-3-P
and PI-3,5-P2 through their specific membrane recruitment to early and/or late
endosomes. Our results confirm Mtmr2 localization at Rab7 vesicles before and
30 min after stimulation, but in addition we observed loss of Mtmr2 from Rab7
vesicles 180 min after EGF stimulation. Furthermore, we could show that in
Mtmr2 overexpressing cells, EGFR was still observed in Rab11 vesicles 180 min
after EGF stimulation. This let us suggest that Mtmr2 keeps EGFR in the
recycling axis, where it probably further activated downstream signaling. This
coincides with the findings that Mtmr2 dependent blocking of EGFR degradation
lead to sustained Akt activation (Berger et al, 2009). Localization of 3-Pap was
determined in transiently transfected COS-7 and HEK293 cells. At steady state
conditions 3-Pap localization clearly differed between these cell lines. In HEK293
136
Discussion and Outlook
cells, 3-Pap staining was more diffuse and no colocalization with any of the four
tested endosomal markers was observed. In COS-7 cells however, 3-Pap
colocalized with Rab4, Rab5 and Rab11. Differential protein content, protein
expression level and/or signaling might explain these differences. Interestingly, in
HEK293 cells 30 min after an EGF pulse, 3-Pap concentrated along the recycling
axis of Rab5-Rab4-Rab11 vesicles. Consistent with the COS-7 cell stainings,
3-Pap was still present 180 min after stimulation. Although relocalization of 3-Pap
was delayed, EGF stimulation resulted in the concentration of both Mtmr2 and 3Pap along membranes of the recycling pathway. EGF was observed in all four
Rab endosomes, especially in Rab5 vesicles, 180 min after stimulation. Whether
3-Pap overexpression also leads to blocking of EGFR degradation and sustained
Akt activation has to be verified by immunoblotting and these experiments are
under way. A clear difference we observed between Mtmr2 and 3-Pap
localization was the presence of Mtmr2 and absence of 3-Pap in Rab7 positive
late endosomes at steady state conditions and 30min after EGF stimulation. The
question is what exactly regulates Mtmr2 to leave Rab7 positive LEs? I suggest
investigating the role of Sbf2 in this context, especially because localization of
Sbf2 under hypo-osmotic conditions pointed to a high affinity of Sbf2 towards
membranes of stress induced vesicles (Berger et al, 2006a). In HEK293 cells
coexpressing Mtmr2 and 3-Pap, Mtmr2 was not able to attract 3-Pap to Rab7
vesicles nor did 3-Pap relocalize Mtmr2. We can therefore conclude that no
Mtmr2/3-Pap complex is formed at membranes of late endosomes, but that it
forms along the recycling axis under resting conditions and EGF stimulated
conditions. The observation that 180 min after EGF stimulation, Mtmr2 and 3-Pap
clearly colocalized with Rab4 and Rab11 vesicles, but not with Rab5 or Rab7
vesicles, further support a function along the recycling axis (Figure 8-2, B). As
mentioned above, 3-Pap coexpression in COS cells altered MTM1 localization
(Nandurkar et al, 2003). Coexpression of 3-Pap in HEK293 cells, however, did
not alter Mtmr2 localization. We can therefore conclude that by heterodimerizing
with both Mtm1 and Mtmr2, 3-Pap had a differential impact on the localization of
its binding partners.
137
Discussion and Outlook
Figure 8-2: Subcellular localization of Mtmr2, 3-Pap and Mtmr2/3-Pap complex before and
180 min after EGF stimulation
Depicted are simplified graphs of Figure 5-2 showing the localization of Mtmr2 (red star), 3-Pap
(blue cross) and Mtmr2/3-Pap complex (red star in yellow circle) as observed in the
immunostainings (A) at resting conditions and (B) 180 min after EGF stimulation (see original
data in Figure 7-27,7-28 and 7-30). Membranes of early endosomes (EE), recycling endosomes
138
Discussion and Outlook
(RE) and late endosomes (LE) are colored dependent on their Rab GTPase content in orange
(Rab4), green (Rab5), light blue (Rab11) and violet (Rab7).
Another important difference we recognized between Mtmr2 and 3-Pap was that
at resting conditions and 30 min after EGF stimulation Mtmr2 localized inside
Rab4, Rab5 and Rab7 vesicles resembling “MVBs”. 3-Pap however, was never
observed inside these vesicles, but on the outside of the membranes. Whether
localization of Mtmr2 in MVBs reflects its degradative fate to the lysosomes is not
known, but might represent a possible scenario.
The concentration of Mtmr2 and the Mtmr2/3-Pap complex along membranes of
the recycling axis (Rab5-Rab4-Rab11) 180 min after EGF stimulation strongly
suggests a function in the regulation of the local PI content at these membranes.
As described above (see chapter 8.1) increased levels of Mtmr2 could decrease
the local PI-3-P and PI-3,5-P2 content and increase PI-5-P pool at these
membranes. Reduction of PI-3,5-P2 pool would result in less binding of effectors
such as the ESCRT-II subunit Vps36 or ESCRT-III subunit Vps24, which have
been shown to regulate sorting of ubiquitinated cargo and/or MVB formation,
respectively (Whitley et al, 2003; Slagsvold et al, 2006). MVB formation at EEs
and their maturation is highly dependent on the PI-3-P pool and on the
production of PI-3,5-P2 (Roth, 2004). Internalized EGFR destined for degradation
is sorted to intraluminal vesicles (ILVs) of endosomes, which mature to LEs
(Piper et al, 2007; Williams et al, 2007). Consequently, the reduction of PI-3-P
and PI-3,5-P2 at EEs by Mtmr2 might influence not only MVB formation but also
explain the influence on EGFR trafficking at this level. Furthermore, EGFR was
reported to directly interact with the BAR retromer component SNX1 (Kurten et
al, 1996; Chin et al, 2001). SNX1 binds to PI-3-P, PI-3,5-P2 and PI-3,4,5-P3 and
was shown to directly interact with SNX5 (Cozier et al, 2002; Zhong et al, 2002).
SNX5 also binds to PI-4-P and PI-5-P, but not to PI-3-P (Liu et al, 2006). SNX1
and SNX5 are both BAR retromer components and are involved in retrograde
transport of EGFR (Chin et al, 2001; Liu et al, 2006; van Weering et al, 2010; van
Weering et al, 2011). SNX1 has also been shown to interact with the ESCRT-0
subunit Hrs, which controls receptor sorting and internalization within the MVBs
139
Discussion and Outlook
(Lloyd et al, 2002; Raiborg et al, 2002; Raiborg et al, 2001). Interestingly,
independent overexpression of Hrs and SNX5 was shown to inhibit stimulated
degradation of EGFR, whereas overexpression of SNX1 attenuated this effect
(Kurten et al, 1996; Chin et al, 2001; Liu et al, 2006). The influence of MTMRs on
the local PI pool, like the increase of PI-5-P, could therefore influence local
binding of SNXs and subsequently regulate vesicle tubulation and promote
recycling. Localization studies of Mtmr2 and Sbf2 in COS cells have shown that
20 min after EGF stimulation Mtmr2 and Sbf2 colocalized with SNX1, SNX2 and
SNX5, supporting a function of MTMRs in SNX-BAR tubulation and retrograde
transport (Berger et al, 2009). Recently, the DENN domains of SBF1 and SBF2
were reported to have GEF activity towards Rab28 (Yoshimura et al, 2010).
Using RNA interference Rab28 was depleted in trypanosomes and was thereby
found to mediate maintenance of the Golgi complex and to maintain expression
levels and locations of the retromer subunit Vps26 and the ESCRT-I subunit
Vps23. Based on localization studies Rab28 was suggested to localize to late
endosomes and pre-lysosomes (Lumb et al, 2011). Binding of Sbf2 to PI-3,5-P2
might regulate the function and localization of Rab28 to LEs. In the case that
Mtmr2/Sbf2 complex would also bind to Rab28, Mtmr2 could influence the local
PI-3,5-P2 pool and thereby alter Rab28 function in retromer and ESCRT-I
regulation. In summary, different combinations of active and inactive MTMR
complexes might influence the PI pool in different endosomal membranes and
thereby affect membrane and receptor trafficking from EEs to LEs.
To draw further conclusion, we first need do investigate whether 3-Pap
overexpression has an impact on EGFR degradation and whether it blocks te
effect of Mtmr2 on EGFR degradation (1). These experiments are of highest
priority and already in preparation. (2) It would also be interesting to investigate
EGFR degradation in an Mtmr2/Sbf2/3-Pap overexpressing cell system. (2a) One
possible approach could be to stably transfect the existing stable HEK293 FlpIn
His-Mtmr2/HA-Sbf2 cells with V5-3-Pap or (2b) to establish a new stable HEK293
cell line stably expressing Mtmr2, Sbf2 and 3-Pap by using a single MultiLabel
plasmid for transfection. To complete the picture of localization and trafficking of
140
Discussion and Outlook
EGFR in an Mtmr2/3-Pap overexpressing background, the following experiments
are also in preparation: (3) The cDNAs for Mtmr2, 3-Pap, one of the four
endosomal markers (Rab4, Rab5, Rab7 or Rab11) and EGFR will be cloned into
one single plasmid using MultiLabel technology (Kriz et al, 2010). The generated
MultiLabel plasmids enable us: (3a) to monitor EGFR trafficking throughout the
different Rab positive endosomes making sure that
Mtmr2/3-Pap are
overexpressed and (3b) to investigate EGFR degradation in Mtmr2/3-Pap
expressing cells. The influence of Sbf2 on EGFR degradation in Mtmr2
overexpressing cells is known, however its localization in cells under resting
versus EGF stimulated conditions at different timepoints was not investigated yet.
(4) To understand this effect in more detail, we need to study the site of action
more precisely, as shown in this work for Mtmr2 and 3-Pap. Our results strongly
point to a differential effect in the regulation and localization of the two dead
phosphatases Sbf2 and 3-Pap while binding the active phosphatase Mtmr2.
Therefore,
the
spatiotemporal
accumulation
of
both
Mtmr2/Sbf2
and
Mtmr2/3-Pap protein complexes needs to be investigated in more detail. Mtmr2,
Sbf2, 3-Pap, and one of the endosomal Rab markers and/or EGFR should be
inserted into MultiLabel plasmids to study their localization at steady state and
after EGF stimulation.
8.2.4 Future pharmacological aspects in CMT disease
What are the future aspects and potential implications with regard to the
peripheral neuropathy CMT? Currently there is no effective drug therapy for CMT
patients. CMT4B is a severe demyelinating peripheral neuropathy with myelin
outfoldings probably caused by increased synthesis or impaired membrane
degradation in regions of active myelin turnover (Quattrone et al, 1996). By
influencing the pool of PI-3-P and PI-3,5-P2, MTMRs have been shown to alter
the turnover of membrane receptors and subsequently cell signaling (Cao et al,
2008; Berger et al, 2009). In mammals, PIKfyve synthesizes PI-3,5-P2 from
PI-3-P and PI-5-P from PtdIns (Sbrissa et al, 1999; Sbrissa et al, 2002).
Curcumin is a polyphenol derived from the curry spice turmeric and has been
traditionally used for centuries for treating numerous diseases (Visioli et al,
141
Discussion and Outlook
2011). Although curcumin was shown to inhibit a variety of kinases, in live cells at
a very low concentration (ID50 = 6 µM), PIKfyve was reported to be a major target
(Ikonomov et al, 2002). The Trembler-J mouse carrys a missense mutation in the
peripheral myelin protein 22 gene (PMP22) and is a validated CMT1 mouse
model (Suter et al, 1992b; Suter et al, 1992a). Inhibition of PIKfyve by oral
curcumin administration could mitigate the severe neuropathy phenotype of the
Trembler-J mouse, supporting the hypothesis that PI-3-P and PI-3,5-P2 pools
play a general role in peripheral neuropathies (Khajavi et al, 2007). PMP22,
P0/MPZ, Cx32/GJB1 and periaxin, are all associated with CMT diseases, are
structural components of compact myelin, and play a major role in membrane
homeostasis (see also Figure 3 of (Niemann et al, 2006) and Figure 1 of (Berger
et al, 2006b)). In transiently transfected COS-7 and Schwann cells, mutant
PMP22 was shown to be retained in the ER or in the intermediate compartment
(Naef et al, 1999). Curcumin treatment of HeLa cells expressing mutant PMP22
could partially release mutant PMP22 from the ER (Khajavi et al, 2007).
Enzymes involved in the turnover of PI-3-P and PI-3,5-P2, which include the
kinase PIKfyve and the phosphatases MTM1, MTMR2, SBF2, 3-PAP and FIG4,
represent therefore potential and promising pharmacological targets.
142
Appendix
9 Appendix
9.1 Remaining PDZ-domain array results
Supplementary Figure 9-1: MS analysis and PDZ-array overlay result of GST-Mtmr1 C-term
Recombinant GST-tagged Mtmr1 C-term was expressed in E. coli Acella cells and purified with a
GST Trap column. (A) Mass spectrometry result of purified GST-Mtmr1 C-term shows a main
signal for 31810 Da, corresponding to the full length protein (expected MW: 30894 Da) which was
glutathionylated at three cysteines. Glutathionylation at one cysteine leads to an increase of
305 Da. Some glutathionylated protein fraction misses the methionine (orange), leading to a final
mass of 31678 Da. (B) The PDZ array spotted with 96 class I PDZ domains (listed in C) was
overlaid with 25 nM purified GST-Mtmr1 C-term. Positive interactions appear as dark spots. (C)
List with the 96 class I PDZ domains spotted on the membrane. Positive interactions are
highlighted in black, negative results are kept in grey.
143
Appendix
Supplementary Figure 9-2: MS analysis and PDZ-array overlay result of GST-MTMR1
C-term
Recombinant GST-tagged MTMR1 C-term was expressed in E. coli Acella cells and purified with
a GST Trap column. (A) Mass spectrometry result of purified GST-MTMR1 C-term shows a main
signal for 32048 Da, corresponding to the full length protein (expected MW: 30826 Da) which was
glutathionylated at four cysteines. Glutathionylation at one cysteine leads to an increase of
305 Da. (B) The PDZ array spotted with 96 class I PDZ domains (listed in C) was overlaid with
25 nM purified GST-MTMR1 C-term. Positive interactions appear as dark spots. (C) List with the
96 class I PDZ domains spotted on the membrane. Positive interactions are highlighted in black,
negative results are kept in grey.
144
Appendix
Supplementary Figure 9-3: MS analysis and PDZ-array overlay result of GST-Mtmr2 C-term
Recombinant GST-tagged Mtmr2 C-term was expressed in E. coli Acella cells and purified with a
GST Trap column. (A) Mass spectrometry result of purified GST-Mtmr2 C-term shows a main
signal for 32430 Da, corresponding to the full length protein (expected MW: 30903 Da) which was
glutathionylated at five cysteines. Glutathionylation at one cysteine leads to an increase of
305 Da. (B) The PDZ array spotted with 96 class I PDZ domains (listed in C) was overlaid with
25 nM purified GST-Mtmr2 C-term. Positive interactions appear as dark spots. (C) List with the 96
class I PDZ domains spotted on the membrane. Positive interactions are highlighted in black,
negative results are kept in grey.
145
Appendix
Supplementary Figure 9-4: MS analysis and PDZ-array overlay result of GST-Sbf2 C-term
Recombinant GST-tagged Sbf2 C-term was expressed in E. coli Acella cells and purified with a
GST Trap column. (A) Mass spectrometry result of purified GST-Sbf2 C-term shows a signal for
32105 Da, corresponding to the full length protein (expected MW: 31190 Da) which was
glutathionylated at three cysteines. Glutathionylation at one cysteine leads to an increase of
305 Da. (B) The PDZ array spotted with 96 class I PDZ domains (listed in C) was overlaid with
25 nM purified GST-Sbf2 C-term. Positive interactions appear as dark spots. (C) List with the 96
class I PDZ domains spotted on the membrane. Positive interactions are highlighted in black,
negative results are kept in grey.
146
Appendix
Supplementary Figure 9-5: PDZ-array overlay result of GST-Sbf1 C-term
Recombinant GST-tagged Sbf1 C-term was expressed in E. coli Acella cells and purified with a
GST Trap column. (A) The PDZ array spotted with 96 class I PDZ domains (listed in B) was
overlaid with 25 nM purified GST-Sbf2 C-term. Positive interactions appear as dark spots. (B) List
with the 96 class I PDZ domains spotted on the membrane. Positive interactions are highlighted
in black, negative results are kept in grey.
147
Appendix
Supplementary Figure 9-6: PDZ-array overlay result of GST-Pten C-term
Recombinant GST-tagged Pten C-term was expressed in E. coli Acella cells and purified with a
GST Trap column. (A) The PDZ array spotted with 96 class I PDZ domains (listed in B) was
overlaid with 25 nM purified GST-Pten C-term. Positive interactions appear as dark spots. (B) List
with the 96 class I PDZ domains spotted on the membrane. Positive interactions are highlighted
in black, negative results are kept in grey.
148
Appendix
Supplementary Figure 9-7: Arbitrary rating of the PDZ array results by Philipp Berger
Depicted is a scheme representing the PDZ array with the 96 different spotted PDZ domains
listed in Table 6-5. Positive signals for GST-Mtm1 C-term, GST-MTMR1 C-term,
GST-Mtmr1 C-term, GST-Mtmr2 C-term and GST-Sbf2 C-term were weighted in an arbitrary
manner considering the darkness of the spot and are illustrated as green dots: weak signal (one
green dot) to strong signal (four green dots). Mtm1 and MTMR specific interactions are colored
with blue or brown background, respectively. Signals which differed between human MTMR1 and
mouse Mtmr1 are colored with a grey background.
149
References
10 References
Aschenbrenner L, Lee T, Hasson T (2003) Myo6 facilitates the translocation of
endocytic vesicles from cell peripheries. Mol Biol Cell 14: 2728-2743
Azzedine H, Bolino A, Taieb T, Birouk N, Di DM, Bouhouche A, Benamou S,
Mrabet A, Hammadouche T, Chkili T, Gouider R, Ravazzolo R, Brice A, Laporte
J, LeGuern E (2003) Mutations in MTMR13, a new pseudophosphatase
homologue of MTMR2 and Sbf1, in two families with an autosomal recessive
demyelinating form of Charcot-Marie-Tooth disease associated with early-onset
glaucoma. Am J Hum Genet 72: 1141-1153
Bache KG, Stuffers S, Malerod L, Slagsvold T, Raiborg C, Lechardeur D, Walchli
S, Lukacs GL, Brech A, Stenmark H (2006) The ESCRT-III subunit hVps24 is
required for degradation but not silencing of the epidermal growth factor receptor.
Mol Biol Cell 17: 2513-2523
Bacic D, Wagner CA, Hernando N, Kaissling B, Biber J, Murer H (2004) Novel
aspects in regulated expression of the renal type IIa Na/Pi-cotransporter. Kidney
Int Suppl: S5-S12
Backer JM (2008) The regulation and function of Class III PI3Ks: novel roles for
Vps34. Biochem J 410: 1-17
Balla T (2005) Inositol-lipid binding motifs: signal integrators through protein-lipid
and protein-protein interactions. J Cell Sci 118: 2093-2104
Ballmer-Hofer K, Andersson AE, Ratcliffe LE, Berger P (2011) Neuropilin-1
promotes VEGFR-2 trafficking through Rab11 vesicles thereby specifying signal
output. Blood 118: 816-826
Bar-Sagi D and Hall A (2000) Ras and Rho GTPases: a family reunion. Cell 103:
227-238
Barbieri MA, Roberts RL, Gumusboga A, Highfield H, Alvarez-Dominguez C,
Wells A, Stahl PD (2000) Epidermal growth factor and membrane trafficking.
EGF receptor activation of endocytosis requires Rab5a. J Cell Biol 151: 539-550
Bassand P, Bernard A, Rafiki A, Gayet D, Khrestchatisky M (1999) Differential
interaction of the tSXV motifs of the NR1 and NR2A NMDA receptor subunits
with PSD-95 and SAP97. Eur J Neurosci 11: 2031-2043
BasuRay S, Mukherjee S, Romero E, Wilson MC, Wandinger-Ness A (2010)
Rab7 mutants associated with Charcot-Marie-Tooth disease exhibit enhanced
NGF-stimulated signaling. PLoS One 5: e15351
150
References
Begley MJ, Taylor GS, Brock MA, Ghosh P, Woods VL, Dixon JE (2006)
Molecular basis for substrate recognition by MTMR2, a myotubularin family
phosphoinositide phosphatase. Proc Natl Acad Sci U S A 103: 927-932
Begley MJ, Taylor GS, Kim SA, Veine DM, Dixon JE, Stuckey JA (2003) Crystal
structure of a phosphoinositide phosphatase, MTMR2: insights into myotubular
myopathy and Charcot-Marie-Tooth syndrome. Mol Cell 12: 1391-1402
Behnia R and Munro S (2005) Organelle identity and the signposts for membrane
traffic. Nature 438: 597-604
Berger P and Ballmer-Hofer K (2011) The reception and the party after: how
vascular endothelial growth factor receptor 2 explores cytoplasmic space. Swiss
Med Wkly 141: w13318
Berger P, Berger I, Schaffitzel C, Tersar K, Volkmer B, Suter U (2006a) Multilevel regulation of myotubularin-related protein-2 phosphatase activity by
myotubularin-related protein-13/set-binding factor-2. Hum Mol Genet 15: 569-579
Berger P, Bonneick S, Willi S, Wymann M, Suter U (2002) Loss of phosphatase
activity in myotubularin-related protein 2 is associated with Charcot-Marie-Tooth
disease type 4B1. Hum Mol Genet 11: 1569-1579
Berger P, Niemann A, Suter U (2006b) Schwann cells and the pathogenesis of
inherited motor and sensory neuropathies (Charcot-Marie-Tooth disease). Glia
54: 243-257
Berger P, Schaffitzel C, Berger I, Ban N, Suter U (2003) Membrane association
of myotubularin-related protein 2 is mediated by a pleckstrin homology-GRAM
domain and a coiled-coil dimerization module. Proc Natl Acad Sci U S A 100:
12177-12182
Berger P, Tersar K, Ballmer-Hofer K, Suter U (2009) The CMT4B diseasecausing proteins MTMR2 and MTMR13/SBF2 regulate AKT signaling. J Cell Mol
Med
Bernado P, Mylonas E, Petoukhov MV, Blackledge M, Svergun DI (2007)
Structural characterization of flexible proteins using small-angle X-ray scattering.
J Am Chem Soc 129: 5656-5664
Bitoun M, Maugenre S, Jeannet PY, Lacene E, Ferrer X, Laforet P, Martin JJ,
Laporte J, Lochmuller H, Beggs AH, Fardeau M, Eymard B, Romero NB,
Guicheney P (2005) Mutations in dynamin 2 cause dominant centronuclear
myopathy. Nat Genet 37: 1207-1209
151
References
Blaine J, Okamura K, Giral H, Breusegem S, Caldas Y, Millard A, Barry N, Levi M
(2009) PTH-induced internalization of apical membrane NaPi2a: role of actin and
myosin VI. Am J Physiol Cell Physiol 297: C1339-C1346
Blondeau F, Laporte J, Bodin S, Superti-Furga G, Payrastre B, Mandel JL (2000)
Myotubularin, a phosphatase deficient in myotubular myopathy, acts on
phosphatidylinositol 3-kinase and phosphatidylinositol 3-phosphate pathway.
Hum Mol Genet 9: 2223-2229
Bolino A (2000) Charcot-Marie-Tooth type 4B is caused by mutations in the gene
encoding myotubularin-related protein-2. Nature Genet 25: 17-19
Bolino A, Bolis A, Previtali SC, Dina G, Bussini S, Dati G, Amadio S, Del CU,
Mruk DD, Feltri ML, Cheng CY, Quattrini A, Wrabetz L (2004) Disruption of
Mtmr2 produces CMT4B1-like neuropathy with myelin outfolding and impaired
spermatogenesis. J Cell Biol 167: 711-721
Bolis A, Coviello S, Bussini S, Dina G, Pardini C, Previtali SC, Malaguti M,
Morana P, Del CU, Feltri ML, Quattrini A, Wrabetz L, Bolino A (2005) Loss of
Mtmr2 phosphatase in Schwann cells but not in motor neurons causes CharcotMarie-Tooth type 4B1 neuropathy with myelin outfoldings. J Neurosci 25: 85678577
Bolis A, Coviello S, Visigalli I, Taveggia C, Bachi A, Chishti AH, Hanada T,
Quattrini A, Previtali SC, Biffi A, Bolino A (2009) Dlg1, Sec8, and Mtmr2 regulate
membrane homeostasis in Schwann cell myelination. J Neurosci 29: 8858-8870
Bonangelino CJ, Nau JJ, Duex JE, Brinkman M, Wurmser AE, Gary JD, Emr SD,
Weisman LS (2002) Osmotic stress-induced increase of phosphatidylinositol 3,5bisphosphate requires Vac14p, an activator of the lipid kinase Fab1p. J Cell Biol
156: 1015-1028
Bonneick S, Boentert M, Berger P, Atanasoski S, Mantei N, Wessig C, Toyka KV,
Young P, Suter U (2005) An animal model for Charcot-Marie-Tooth disease type
4B1. Hum Mol Genet 14: 3685-3695
Buj-Bello A, Fougerousse F, Schwab Y, Messaddeq N, Spehner D, Pierson CR,
Durand M, Kretz C, Danos O, Douar AM, Beggs AH, Schultz P, Montus M,
Denefle P, Mandel JL (2008) AAV-mediated intramuscular delivery of
myotubularin corrects the myotubular myopathy phenotype in targeted murine
muscle and suggests a function in plasma membrane homeostasis. Hum Mol
Genet 17: 2132-2143
Buj-Bello A, Furling D, Tronchere H, Laporte J, Lerouge T, Butler-Browne GS,
Mandel JL (2002a) Muscle-specific alternative splicing of myotubularin-related 1
gene is impaired in DM1 muscle cells. Hum Mol Genet 11: 2297-2307
152
References
Buj-Bello A, Laugel V, Messaddeq N, Zahreddine H, Laporte J, Pellissier JF,
Mandel JL (2002b) The lipid phosphatase myotubularin is essential for skeletal
muscle maintenance but not for myogenesis in mice. Proc Natl Acad Sci U S A
99: 15060-15065
Burkhardt C, Muller M, Badde A, Garner CC, Gundelfinger ED, Puschel AW
(2005) Semaphorin 4B interacts with the post-synaptic density protein PSD95/SAP90 and is recruited to synapses through a C-terminal PDZ-binding motif.
FEBS Lett 579: 3821-3828
Cabezas A, Pattni K, Stenmark H (2006) Cloning and subcellular localization of a
human phosphatidylinositol 3-phosphate 5-kinase, PIKfyve/Fab1. Gene 371: 3441
Cai C, Coleman SK, Niemi K, Keinanen K (2002) Selective binding of synapseassociated protein 97 to GluR-A alpha-amino-5-hydroxy-3-methyl-4-isoxazole
propionate receptor subunit is determined by a novel sequence motif. J Biol
Chem 277: 31484-31490
Cai C, Li H, Kangasniemi A, Pihlajamaa T, Von OL, Kerkela K, Schulz S, Rivera
C, Keinanen K (2008) Somatostatin receptor subtype 1 is a PDZ ligand for
synapse-associated protein 97 and a potential regulator of growth cone
dynamics. Neuroscience 157: 833-843
Caldwell KK, Lips DL, Bansal VS, Majerus PW (1991) Isolation and
characterization of two 3-phosphatases that hydrolyze both phosphatidylinositol
3-phosphate and inositol 1,3-bisphosphate. J Biol Chem 266: 18378-18386
Calistri A, Sette P, Salata C, Cancellotti E, Forghieri C, Comin A, Gottlinger H,
Campadelli-Fiume G, Palu G, Parolin C (2007) Intracellular trafficking and
maturation of herpes simplex virus type 1 gB and virus egress require functional
biogenesis of multivesicular bodies. J Virol 81: 11468-11478
Cantalupo G, Alifano P, Roberti V, Bruni CB, Bucci C (2001) Rab-interacting
lysosomal protein (RILP): the Rab7 effector required for transport to lysosomes.
EMBO J 20: 683-693
Cao C, Laporte J, Backer JM, Wandinger-Ness A, Stein MP (2007) Myotubularin
lipid phosphatase binds the hVPS15/hVPS34 lipid kinase complex on
endosomes
1. Traffic 8: 1052-1067
Cao CH, Backer JM, Laporte J, Bedrick EJ, Wandinger-Ness A (2008)
Sequential actions of myotubularin lipid phosphatases regulate endosomal
PI(3)P and growth factor receptor trafficking. Molecular Biology of the Cell 19:
3334-3346
153
References
Carlton JG, Bujny MV, Peter BJ, Oorschot VM, Rutherford A, Arkell RS,
Klumperman J, McMahon HT, Cullen PJ (2005) Sorting nexin-2 is associated
with tubular elements of the early endosome, but is not essential for retromermediated endosome-to-TGN transport. J Cell Sci 118: 4527-4539
Ceresa BP (2006) Regulation of EGFR endocytic trafficking by rab proteins.
Histol Histopathol 21: 987-993
Ceresa BP and Bahr SJ (2006) rab7 activity affects epidermal growth
factor:epidermal growth factor receptor degradation by regulating endocytic
trafficking from the late endosome. J Biol Chem 281: 1099-1106
Cheng G and Lambeth JD (2004) NOXO1, regulation of lipid binding, localization,
and activation of Nox1 by the Phox homology (PX) domain. J Biol Chem 279:
4737-4742
Chin LS, Raynor MC, Wei X, Chen HQ, Li L (2001) Hrs interacts with sorting
nexin 1 and regulates degradation of epidermal growth factor receptor. J Biol
Chem 276: 7069-7078
Ching GY and Liem RK (1993) Assembly of type IV neuronal intermediate
filaments in nonneuronal cells in the absence of preexisting cytoplasmic
intermediate filaments. J Cell Biol 122: 1323-1335
Chow CY, Zhang Y, Dowling JJ, Jin N, Adamska M, Shiga K, Szigeti K, Shy ME,
Li J, Zhang X, Lupski JR, Weisman LS, Meisler MH (2007) Mutation of FIG4
causes neurodegeneration in the pale tremor mouse and patients with CMT4J.
Nature 448: 68-72
Christoforidis S, Miaczynska M, Ashman K, Wilm M, Zhao L, Yip SC, Waterfield
MD, Backer JM, Zerial M (1999) Phosphatidylinositol-3-OH kinases are Rab5
effectors. Nat Cell Biol 1: 249-252
Ciardiello F and Tortora G (2008) EGFR antagonists in cancer treatment. N Engl
J Med 358: 1160-1174
Claeys KG, Zuchner S, Kennerson M, Berciano J, Garcia A, Verhoeven K, Storey
E, Merory JR, Bienfait HM, Lammens M, Nelis E, Baets J, De VE, Berneman ZN,
De V, I, Vance JM, Nicholson G, Timmerman V, De JP (2009) Phenotypic
spectrum of dynamin 2 mutations in Charcot-Marie-Tooth neuropathy. Brain 132:
1741-1752
Clague MJ and Lorenzo O (2005) The myotubularin family of lipid phosphatases.
Traffic 6: 1063-1069
Coe FL, Evan A, Worcester E (2005) Kidney stone disease. J Clin Invest 115:
2598-2608
154
References
Corvera S, D'Arrigo A, Stenmark H (1999) Phosphoinositides in membrane
traffic. Curr Opin Cell Biol 11: 460-465
Cotter L, Ozcelik M, Jacob C, Pereira JA, Locher V, Baumann R, Relvas JB,
Suter U, Tricaud N (2010) Dlg1-PTEN interaction regulates myelin thickness to
prevent damaging peripheral nerve overmyelination. Science 328: 1415-1418
Cozier GE, Carlton J, McGregor AH, Gleeson PA, Teasdale RD, Mellor H, Cullen
PJ (2002) The phox homology (PX) domain-dependent, 3-phosphoinositidemediated association of sorting nexin-1 with an early sorting endosomal
compartment is required for its ability to regulate epidermal growth factor
receptor degradation. J Biol Chem 277: 48730-48736
Cramm-Behrens CI, Dienst M, Jacob R (2008) Apical cargo traverses endosomal
compartments on the passage to the cell surface. Traffic 9: 2206-2220
Cui H, Hayashi A, Sun HS, Belmares MP, Cobey C, Phan T, Schweizer J, Salter
MW, Wang YT, Tasker RA, Garman D, Rabinowitz J, Lu PS, Tymianski M (2007)
PDZ protein interactions underlying NMDA receptor-mediated excitotoxicity and
neuroprotection by PSD-95 inhibitors. J Neurosci 27: 9901-9915
Cui X, De V, I, Slany R, Miyamoto A, Firestein R, Cleary ML (1998) Association
of SET domain and myotubularin-related proteins modulates growth control. Nat
Genet 18: 331-337
Cullen PJ (2008) Endosomal sorting and signalling: an emerging role for sorting
nexins. Nat Rev Mol Cell Biol 9: 574-582
Cullis DN, Philip B, Baleja JD, Feig LA (2002) Rab11-FIP2, an adaptor protein
connecting cellular components involved in internalization and recycling of
epidermal growth factor receptors. J Biol Chem 277: 49158-49166
Dall'Armi C, Hurtado-Lorenzo A, Tian H, Morel E, Nezu A, Chan RB, Yu WH,
Robinson KS, Yeku O, Small SA, Duff K, Frohman MA, Wenk MR, Yamamoto A,
Di PG (2010) The phospholipase D1 pathway modulates macroautophagy. Nat
Commun 1: 142
Dang H, Li Z, Skolnik EY, Fares H (2004) Disease-related myotubularins function
in endocytic traffic in Caenorhabditis elegans. Mol Biol Cell 15: 189-196
de Gouyon BM, Zhao W, Laporte J, Mandel JL, Metzenberg A, Herman GE
(1997) Characterization of mutations in the myotubularin gene in twenty six
patients with X-linked myotubular myopathy. Hum Mol Genet 6: 1499-1504
De Matteis MA and Luini A (2008) Exiting the Golgi complex. Nat Rev Mol Cell
Biol 9: 273-284
155
References
de LJ, Polson H, Feldman M, Shokat K, Tooze SA, Urbe S, Clague MJ (2009)
PIKfyve regulation of endosome-linked pathways. Traffic 10: 883-893
Di CA and Pandolfi PP (2000) The multiple roles of PTEN in tumor suppression.
Cell 100: 387-390
Di PG and De CP (2006) Phosphoinositides in cell regulation and membrane
dynamics. Nature 443: 651-657
Dirks P, Thomas U, Montag D (2006) The cytoplasmic domain of NrCAM binds to
PDZ domains of synapse-associated proteins SAP90/PSD95 and SAP97. Eur J
Neurosci 24: 25-31
Doherty GJ and McMahon HT (2009) Mechanisms of endocytosis. Annu Rev
Biochem 78: 857-902
Domin J, Gaidarov I, Smith ME, Keen JH, Waterfield MD (2000) The class II
phosphoinositide 3-kinase PI3K-C2alpha is concentrated in the trans-Golgi
network and present in clathrin-coated vesicles. J Biol Chem 275: 11943-11950
Dong XP, Shen D, Wang X, Dawson T, Li X, Zhang Q, Cheng X, Zhang Y,
Weisman LS, Delling M, Xu H (2010) PI(3,5)P(2) controls membrane trafficking
by direct activation of mucolipin Ca(2+) release channels in the endolysosome.
Nat Commun 1: 38
Dove SK (1997) Osmotic stress activates phosphatidylinositol-3,5-bisphosphate
synthesis. Nature 390: 187-192
Dove SK, McEwen RK, Mayes A, Hughes DC, Beggs JD, Michell RH (2002)
Vac14 controls PtdIns(3,5)P(2) synthesis and Fab1-dependent protein trafficking
to the multivesicular body. Curr Biol 12: 885-893
Dove SK, Piper RC, McEwen RK, Yu JW, King MC, Hughes DC, Thuring J,
Holmes AB, Cooke FT, Michell RH, Parker PJ, Lemmon MA (2004) Svp1p
defines a family of phosphatidylinositol 3,5-bisphosphate effectors. EMBO J 23:
1922-1933
Dowling JJ, Gibbs EM, Feldman EL (2008) Membrane traffic and muscle:
lessons from human disease. Traffic 9: 1035-1043
Doyle DA, Lee A, Lewis J, Kim E, Sheng M, MacKinnon R (1996) Crystal
structures of a complexed and peptide-free membrane protein-binding domain:
molecular basis of peptide recognition by PDZ. Cell 85: 1067-1076
Du G, Altshuller YM, Vitale N, Huang P, Chasserot-Golaz S, Morris AJ, Bader
MF, Frohman MA (2003) Regulation of phospholipase D1 subcellular cycling
through coordination of multiple membrane association motifs. J Cell Biol 162:
305-315
156
References
Eggenschwiler JT, Espinoza E, Anderson KV (2001) Rab23 is an essential
negative regulator of the mouse Sonic hedgehog signalling pathway. Nature 412:
194-198
Eugster A, Pecheur EI, Michel F, Winsor B, Letourneur F, Friant S (2004) Ent5p
is required with Ent3p and Vps27p for ubiquitin-dependent protein sorting into the
multivesicular body. Mol Biol Cell 15: 3031-3041
Fabre S, Reynaud C, Jalinot P (2000) Identification of functional PDZ domain
binding sites in several human proteins. Mol Biol Rep 27: 217-224
Fabrizi GM, Ferrarini M, Cavallaro T, Cabrini I, Cerini R, Bertolasi L, Rizzuto N
(2007) Two novel mutations in dynamin-2 cause axonal Charcot-Marie-Tooth
disease. Neurology 69: 291-295
Falasca M and Maffucci T (2007) Role of class II phosphoinositide 3-kinase in
cell signalling. Biochem Soc Trans 35: 211-214
Falkenburger BH, Jensen JB, Dickson EJ, Suh BC, Hille B (2010)
Phosphoinositides: lipid regulators of membrane proteins. J Physiol 588: 31793185
Fam SR, Paquet M, Castleberry AM, Oller H, Lee CJ, Traynelis SF, Smith Y, Yun
CC, Hall RA (2005) P2Y1 receptor signaling is controlled by interaction with the
PDZ scaffold NHERF-2. Proc Natl Acad Sci U S A 102: 8042-8047
Fanning AS and Anderson JM (1999) PDZ domains: fundamental building blocks
in the organization of protein complexes at the plasma membrane. J Clin Invest
103: 767-772
Ferguson CJ, Lenk GM, Meisler MH (2009) Defective autophagy in neurons and
astrocytes from mice deficient in PI(3,5)P2. Hum Mol Genet 18: 4868-4878
Ferguson CJ, Lenk GM, Meisler MH (2010) PtdIns(3,5)P2 and autophagy in
mouse models of neurodegeneration. Autophagy 6: 170-171
Firestein R and Cleary ML (2001) Pseudo-phosphatase Sbf1 contains an Nterminal GEF homology domain that modulates its growth regulatory properties. J
Cell Sci 114: 2921-2927
Fitzgerald DJ, Berger P, Schaffitzel C, Yamada K, Richmond TJ, Berger I (2006)
Protein complex expression by using multigene baculoviral vectors. Nat Methods
3: 1021-1032
Franklin NE, Taylor GS, Vacratsis PO (2011) Endosomal targeting of the
phosphoinositide 3-phosphatase MTMR2 is regulated by an N-terminal
phosphorylation site. J Biol Chem 286: 15841-15853
157
References
Friant S, Pecheur EI, Eugster A, Michel F, Lefkir Y, Nourrisson D, Letourneur F
(2003) Ent3p Is a PtdIns(3,5)P2 effector required for protein sorting to the
multivesicular body. Dev Cell 5: 499-511
Garcia RA, Vasudevan K, Buonanno A (2000) The neuregulin receptor ErbB-4
interacts with PDZ-containing proteins at neuronal synapses. Proc Natl Acad Sci
U S A 97: 3596-3601
Gary JD, Wurmser AE, Bonangelino CJ, Weisman LS, Emr SD (1998) Fab1p is
essential for PtdIns(3)P 5-kinase activity and the maintenance of vacuolar size
and membrane homeostasis. J Cell Biol 143: 65-79
Gaullier JM, Simonsen A, D'Arrigo A, Bremnes B, Stenmark H, Aasland R (1998)
FYVE fingers bind PtdIns(3)P. Nature 394: 432-433
Geiser M, Cebe R, Drewello D, Schmitz R (2001) Integration of PCR fragments
at any specific site within cloning vectors without the use of restriction enzymes
and DNA ligase. Biotechniques 31: 88-90, 92
Gillooly DJ, Simonsen A, Stenmark H (2001) Cellular functions of
phosphatidylinositol 3-phosphate and FYVE domain proteins. Biochem J 355:
249-258
Gisler SM, Pribanic S, Bacic D, Forrer P, Gantenbein A, Sabourin LA, Tsuji A,
Zhao ZS, Manser E, Biber J, Murer H (2003) PDZK1: I. a major scaffolder in
brush borders of proximal tubular cells. Kidney Int 64: 1733-1745
Gisler SM, Stagljar I, Traebert M, Bacic D, Biber J, Murer H (2001) Interaction of
the type IIa Na/Pi cotransporter with PDZ proteins. J Biol Chem 276: 9206-9213
Goebbels S, Oltrogge JH, Kemper R, Heilmann I, Bormuth I, Wolfer S, Wichert
SP, Mobius W, Liu X, Lappe-Siefke C, Rossner MJ, Groszer M, Suter U, Frahm
J, Boretius S, Nave KA (2010) Elevated phosphatidylinositol 3,4,5-trisphosphate
in glia triggers cell-autonomous membrane wrapping and myelination. J Neurosci
30: 8953-8964
Gozani O et al (2003) The PHD finger of the chromatin-associated protein ING2
functions as a nuclear phosphoinositide receptor. Cell 114: 99-111
Guittard G, Gerard A, Dupuis-Coronas S, Tronchere H, Mortier E, Favre C, Olive
D, Zimmermann P, Payrastre B, Nunes JA (2009) Cutting edge: Dok-1 and Dok2 adaptor molecules are regulated by phosphatidylinositol 5-phosphate
production in T cells. J Immunol 182: 3974-3978
Gunther T, Struwe M, Aguzzi A, Schughart K (1994) Open brain, a new mouse
mutant with severe neural tube defects, shows altered gene expression patterns
in the developing spinal cord. Development 120: 3119-3130
158
References
Hales CM, Griner R, Hobdy-Henderson KC, Dorn MC, Hardy D, Kumar R,
Navarre J, Chan EK, Lapierre LA, Goldenring JR (2001) Identification and
characterization of a family of Rab11-interacting proteins. J Biol Chem 276:
39067-39075
Hales CM, Vaerman JP, Goldenring JR (2002) Rab11 family interacting protein 2
associates with Myosin Vb and regulates plasma membrane recycling. J Biol
Chem 277: 50415-50421
Hanada T, Lin L, Tibaldi EV, Reinherz EL, Chishti AH (2000) GAKIN, a novel
kinesin-like protein associates with the human homologue of the Drosophila discs
large tumor suppressor in T lymphocytes. J Biol Chem 275: 28774-28784
Harterink M, Port F, Lorenowicz MJ, McGough IJ, Silhankova M, Betist MC, van
Weering JR, van Heesbeen RG, Middelkoop TC, Basler K, Cullen PJ,
Korswagen HC (2011) A SNX3-dependent retromer pathway mediates
retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt
secretion. Nat Cell Biol 13: 914-923
Hayashi M, Fukuzawa T, Sorimachi H, Maeda T (2005) Constitutive activation of
the pH-responsive Rim101 pathway in yeast mutants defective in late steps of
the MVB/ESCRT pathway. Mol Cell Biol 25: 9478-9490
He J, Bellini M, Inuzuka H, Xu J, Xiong Y, Yang X, Castleberry AM, Hall RA
(2006) Proteomic analysis of beta1-adrenergic receptor interactions with PDZ
scaffold proteins. J Biol Chem 281: 2820-2827
Hegedus T, Sessler T, Scott R, Thelin W, Bakos E, Varadi A, Szabo K, Homolya
L, Milgram SL, Sarkadi B (2003) C-terminal phosphorylation of MRP2 modulates
its interaction with PDZ proteins. Biochem Biophys Res Commun 302: 454-461
Herman GE, Finegold M, Zhao W, de GB, Metzenberg A (1999) Medical
complications in long-term survivors with X-linked myotubular myopathy. J
Pediatr 134: 206-214
Herman PK and Emr SD (1990) Characterization of VPS34, a gene required for
vacuolar protein sorting and vacuole segregation in Saccharomyces cerevisiae.
Mol Cell Biol 10: 6742-6754
Hernando N, Deliot N, Gisler SM, Lederer E, Weinman EJ, Biber J, Murer H
(2002) PDZ-domain interactions and apical expression of type IIa Na/P(i)
cotransporters. Proc Natl Acad Sci U S A 99: 11957-11962
Hirano R, Takashima H, Umehara F, Arimura H, Michizono K, Okamoto Y,
Nakagawa M, Boerkoel CF, Lupski JR, Osame M, Arimura K (2004) SET binding
factor 2 (SBF2) mutation causes CMT4B with juvenile onset glaucoma.
Neurology 63: 577-580
159
References
Hnia K, Tronchere H, Tomczak KK, Amoasii L, Schultz P, Beggs AH, Payrastre
B, Mandel JL, Laporte J (2011) Myotubularin controls desmin intermediate
filament architecture and mitochondrial dynamics in human and mouse skeletal
muscle. J Clin Invest 121: 70-85
Hoenderop JG, van Leeuwen JP, van der Eerden BC, Kersten FF, van der Kemp
AW, Merillat AM, Waarsing JH, Rossier BC, Vallon V, Hummler E, Bindels RJ
(2003) Renal Ca2+ wasting, hyperabsorption, and reduced bone thickness in
mice lacking TRPV5. J Clin Invest 112: 1906-1914
Horiuchi H, Lippe R, McBride HM, Rubino M, Woodman P, Stenmark H, Rybin V,
Wilm M, Ashman K, Mann M, Zerial M (1997) A novel Rab5 GDP/GTP exchange
factor complexed to Rabaptin-5 links nucleotide exchange to effector recruitment
and function. Cell 90: 1149-1159
Huang TC, Toraya H, Blanton TN, Wu Y (1993) X-Ray-Powder Diffraction
Analysis of Silver Behenate, A Possible Low-Angle Diffraction Standard
1. Journal of Applied Crystallography 26: 180-184
Huang YZ, Wang Q, Xiong WC, Mei L (2001) Erbin is a protein concentrated at
postsynaptic membranes that interacts with PSD-95. J Biol Chem 276: 1931819326
Huotari J and Helenius A (2011) Endosome maturation. EMBO J 30: 3481-3500
Hutagalung AH and Novick PJ (2011) Role of Rab GTPases in membrane traffic
and cell physiology. Physiol Rev 91: 119-149
Hynes NE and MacDonald G (2009) ErbB receptors and signaling pathways in
cancer. Curr Opin Cell Biol 21: 177-184
Ikonomov OC, Sbrissa D, Delvecchio K, Xie Y, Jin JP, Rappolee D, Shisheva A
(2011) The phosphoinositide kinase PIKfyve is vital in early embryonic
development: preimplantation lethality of PIKfyve-/- embryos but normality of
PIKfyve+/- mice. J Biol Chem 286: 13404-13413
Ikonomov OC, Sbrissa D, Ijuin T, Takenawa T, Shisheva A (2009) Sac3 is an
insulin-regulated phosphatidylinositol 3,5-bisphosphate phosphatase: gain in
insulin responsiveness through Sac3 down-regulation in adipocytes. J Biol Chem
284: 23961-23971
Ikonomov OC, Sbrissa D, Mlak K, Shisheva A (2002) Requirement for PIKfyve
enzymatic activity in acute and long-term insulin cellular effects. Endocrinology
143: 4742-4754
Ikonomov OC, Sbrissa D, Shisheva A (2001) Mammalian cell morphology and
endocytic membrane homeostasis require enzymatically active phosphoinositide
5-kinase PIKfyve. J Biol Chem 276: 26141-26147
160
References
Inagaki S, Ohoka Y, Sugimoto H, Fujioka S, Amazaki M, Kurinami H, Miyazaki N,
Tohyama M, Furuyama T (2001) Sema4c, a transmembrane semaphorin,
interacts with a post-synaptic density protein, PSD-95. J Biol Chem 276: 91749181
Irie M, Hata Y, Takeuchi M, Ichtchenko K, Toyoda A, Hirao K, Takai Y, Rosahl
TW, Sudhof TC (1997) Binding of neuroligins to PSD-95. Science 277: 15111515
Itakura E, Kishi C, Inoue K, Mizushima N (2008) Beclin 1 forms two distinct
phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG.
Mol Biol Cell 19: 5360-5372
Itoh F, Divecha N, Brocks L, Oomen L, Janssen H, Calafat J, Itoh S, Dijke PP
(2002) The FYVE domain in Smad anchor for receptor activation (SARA) is
sufficient for localization of SARA in early endosomes and regulates TGFbeta/Smad signalling. Genes Cells 7: 321-331
Jenkins D, Seelow D, Jehee FS, Perlyn CA, Alonso LG, Bueno DF, Donnai D,
Josifova D, Mathijssen IM, Morton JE, Orstavik KH, Sweeney E, Wall SA, Marsh
JL, Nurnberg P, Passos-Bueno MR, Wilkie AO (2007) RAB23 mutations in
Carpenter syndrome imply an unexpected role for hedgehog signaling in cranialsuture development and obesity. Am J Hum Genet 80: 1162-1170
Johansson M, Lehto M, Tanhuanpaa K, Cover TL, Olkkonen VM (2005) The
oxysterol-binding protein homologue ORP1L interacts with Rab7 and alters
functional properties of late endocytic compartments. Mol Biol Cell 16: 54805492
Johansson M, Rocha N, Zwart W, Jordens I, Janssen L, Kuijl C, Olkkonen VM,
Neefjes J (2007) Activation of endosomal dynein motors by stepwise assembly of
Rab7-RILP-p150Glued, ORP1L, and the receptor betalll spectrin. J Cell Biol 176:
459-471
Jones DR, Gonzalez-Garcia A, Diez E, Martinez A, Carrera AC, Merida I (1999)
The identification of phosphatidylinositol 3,5-bisphosphate in T-lymphocytes and
its regulation by interleukin-2. J Biol Chem 274: 18407-18413
Karim-Jimenez Z, Hernando N, Biber J, Murer H (2001) Molecular determinants
for apical expression of the renal type IIa Na+/Pi-cotransporter. Pflugers Arch
442: 782-790
Karjalainen M, Rintanen N, Lehkonen M, Kallio K, Maki A, Hellstrom K, Siljamaki
V, Upla P, Marjomaki V (2011) Echovirus 1 infection depends on biogenesis of
novel multivesicular bodies. Cell Microbiol 13: 1975-1995
161
References
Kato Y, Yoshida K, Watanabe C, Sai Y, Tsuji A (2004) Screening of the
interaction between xenobiotic transporters and PDZ proteins. Pharm Res 21:
1886-1894
Katona I, Zhang X, Bai Y, Shy ME, Guo J, Yan Q, Hatfield J, Kupsky WJ, Li J
(2011) Distinct pathogenic processes between Fig4-deficient motor and sensory
neurons. Eur J Neurosci 33: 1401-1410
Katzmann DJ, Stefan CJ, Babst M, Emr SD (2003) Vps27 recruits ESCRT
machinery to endosomes during MVB sorting. J Cell Biol 162: 413-423
Kerk D and Moorhead GB (2010) A phylogenetic survey of myotubularin genes of
eukaryotes: distribution, protein structure, evolution, and gene expression. BMC
Evol Biol 10: 196
Khajavi M, Shiga K, Wiszniewski W, He F, Shaw CA, Yan J, Wensel TG, Snipes
GJ, Lupski JR (2007) Oral curcumin mitigates the clinical and neuropathologic
phenotype of the Trembler-J mouse: a potential therapy for inherited neuropathy.
Am J Hum Genet 81: 438-453
Kim E, Niethammer M, Rothschild A, Jan YN, Sheng M (1995) Clustering of
Shaker-type K+ channels by interaction with a family of membrane-associated
guanylate kinases. Nature 378: 85-88
Kim J, Jahng WJ, Di VD, Lee JS, Jhaveri R, Rubin MA, Shisheva A, Freeman
MR (2007) The phosphoinositide kinase PIKfyve mediates epidermal growth
factor receptor trafficking to the nucleus. Cancer Res 67: 9229-9237
Kim SA, Taylor GS, Torgersen KM, Dixon JE (2002) Myotubularin and MTMR2,
phosphatidylinositol 3-phosphatases mutated in myotubular myopathy and type
4B Charcot-Marie-Tooth disease. J Biol Chem 277: 4526-4531
Kim SA, Vacratsis PO, Firestein R, Cleary ML, Dixon JE (2003) Regulation of
myotubularin-related (MTMR)2 phosphatidylinositol phosphatase by MTMR5, a
catalytically inactive phosphatase. Proc Natl Acad Sci U S A 100: 4492-4497
Konarev PV, Petoukhov MV, Volkov VV, Svergun DI (2006) ATSAS 2.1, a
program package for small-angle scattering data analysis. Journal of Applied
Crystallography 39: 277-286
Konarev PV, Volkov VV, Sokolova AV, Koch MHJ, Svergun DI (2003) PRIMUS: a
Windows PC-based system for small-angle scattering data analysis. Journal of
Applied Crystallography 36: 1277-1282
Koncarevic A, Jackman RW, Kandarian SC (2007) The ubiquitin-protein ligase
Nedd4 targets Notch1 in skeletal muscle and distinguishes the subset of
atrophies caused by reduced muscle tension. FASEB J 21: 427-437
162
References
Krissinel E and Henrick K (2007) Inference of Macromolecular Assemblies from
Crystalline State. Journal of Molecular Biology 372: 774-797
Kriz A, Schmid K, Baumgartner N, Ziegler U, Berger I, Ballmer-Hofer K, Berger P
(2010) A plasmid-based multigene expression system for mammalian cells. Nat
Commun 1: 120
Kurten RC, Cadena DL, Gill GN (1996) Enhanced degradation of EGF receptors
by a sorting nexin, SNX1. Science 272: 1008-1010
Kutateladze TG (2010) Translation of the phosphoinositide code by PI effectors.
Nat Chem Biol 6: 507-513
Lamprecht G and Seidler U (2006) The emerging role of PDZ adapter proteins
for regulation of intestinal ion transport. Am J Physiol Gastrointest Liver Physiol
291: G766-G777
Lanaspa MA, Giral H, Breusegem SY, Halaihel N, Baile G, Catalan J,
Carrodeguas JA, Barry NP, Levi M, Sorribas V (2007) Interaction of MAP17 with
NHERF3/4 induces translocation of the renal Na/Pi IIa transporter to the transGolgi. Am J Physiol Renal Physiol 292: F230-F242
Lanzetti L, Palamidessi A, Areces L, Scita G, Di Fiore PP (2004) Rab5 is a
signalling GTPase involved in actin remodelling by receptor tyrosine kinases.
Nature 429: 309-314
Laporte J (1996) A gene mutated in X-linked myotubular myopathy defines a new
putative tyrosine phosphatase family conserved in yeast. Nature Genet 13: 175182
Laporte J, Bedez F, Bolino A, Mandel JL (2003) Myotubularins, a large diseaseassociated family of cooperating catalytically active and inactive
phosphoinositides phosphatases. Hum Mol Genet 12 Spec No 2: R285-R292
Laporte J, Blondeau F, Buj-Bello A, Mandel JL (2001) The myotubularin family:
from genetic disease to phosphoinositide metabolism. Trends Genet 17: 221-228
Laporte J, Blondeau F, Buj-Bello A, Tentler D, Kretz C, Dahl N, Mandel JL (1998)
Characterization of the myotubularin dual specificity phosphatase gene family
from yeast to human. Hum Mol Genet 7: 1703-1712
Laporte J, Blondeau F, Gansmuller A, Lutz Y, Vonesch JL, Mandel JL (2002a)
The PtdIns3P phosphatase myotubularin is a cytoplasmic protein that also
localizes to Rac1-inducible plasma membrane ruffles. J Cell Sci 115: 3105-3117
Laporte J, Liaubet L, Blondeau F, Tronchere H, Mandel JL, Payrastre B (2002b)
Functional redundancy in the myotubularin family. Biochem Biophys Res
Commun 291: 305-312
163
References
Lariviere RC and Julien JP (2004) Functions of intermediate filaments in
neuronal development and disease. J Neurobiol 58: 131-148
Lawe DC, Patki V, Heller-Harrison R, Lambright D, Corvera S (2000) The FYVE
domain of early endosome antigen 1 is required for both phosphatidylinositol 3phosphate and Rab5 binding. Critical role of this dual interaction for endosomal
localization. J Biol Chem 275: 3699-3705
Lee HW, Kim Y, Han K, Kim H, Kim E (2010) The phosphoinositide 3phosphatase MTMR2 interacts with PSD-95 and maintains excitatory synapses
by modulating endosomal traffic
1. J Neurosci 30: 5508-5518
Lee MK, Xu Z, Wong PC, Cleveland DW (1993) Neurofilaments are obligate
heteropolymers in vivo. J Cell Biol 122: 1337-1350
Lee MT, Mishra A, Lambright DG (2009) Structural mechanisms for regulation of
membrane traffic by rab GTPases. Traffic 10: 1377-1389
Lee RH, Iioka H, Ohashi M, Iemura S, Natsume T, Kinoshita N (2007) XRab40
and XCullin5 form a ubiquitin ligase complex essential for the noncanonical Wnt
pathway. EMBO J 26: 3592-3606
Lee SS, Weiss RS, Javier RT (1997) Binding of human virus oncoproteins to
hDlg/SAP97, a mammalian homolog of the Drosophila discs large tumor
suppressor protein. Proc Natl Acad Sci U S A 94: 6670-6675
Lemmon MA (2007) Pleckstrin homology (PH) domains and phosphoinositides.
Biochem Soc Symp: 81-93
Lemmon MA (2008) Membrane recognition by phospholipid-binding domains.
Nat Rev Mol Cell Biol 9: 99-111
Leonard AS, Davare MA, Horne MC, Garner CC, Hell JW (1998) SAP97 is
associated with the alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid
receptor GluR1 subunit. J Biol Chem 273: 19518-19524
Leonoudakis D, Mailliard W, Wingerd K, Clegg D, Vandenberg C (2001) Inward
rectifier potassium channel Kir2.2 is associated with synapse-associated protein
SAP97. J Cell Sci 114: 987-998
Levivier E, Goud B, Souchet M, Calmels TP, Mornon JP, Callebaut I (2001)
uDENN, DENN, and dDENN: indissociable domains in Rab and MAP kinases
signaling pathways. Biochem Biophys Res Commun 287: 688-695
Li S, Tiab L, Jiao X, Munier FL, Zografos L, Frueh BE, Sergeev Y, Smith J, Rubin
B, Meallet MA, Forster RK, Hejtmancik JF, Schorderet DF (2005) Mutations in
164
References
PIP5K3 are associated with Francois-Neetens mouchetee fleck corneal
dystrophy. Am J Hum Genet 77: 54-63
Lindmo K and Stenmark H (2006) Regulation of membrane traffic by
phosphoinositide 3-kinases. J Cell Sci 119: 605-614
Lippe R, Miaczynska M, Rybin V, Runge A, Zerial M (2001) Functional synergy
between Rab5 effector Rabaptin-5 and exchange factor Rabex-5 when physically
associated in a complex. Mol Biol Cell 12: 2219-2228
Liu H, Liu ZQ, Chen CX, Magill S, Jiang Y, Liu YJ (2006) Inhibitory regulation of
EGF receptor degradation by sorting nexin 5. Biochem Biophys Res Commun
342: 537-546
Liu Y and Bankaitis VA (2010) Phosphoinositide phosphatases in cell biology and
disease. Prog Lipid Res 49: 201-217
Lloyd TE, Atkinson R, Wu MN, Zhou Y, Pennetta G, Bellen HJ (2002) Hrs
regulates endosome membrane invagination and tyrosine kinase receptor
signaling in Drosophila. Cell 108: 261-269
Lorenzo O, Urbe S, Clague MJ (2005) Analysis of phosphoinositide binding
domain properties within the myotubularin-related protein MTMR3. J Cell Sci
118: 2005-2012
Lorenzo O, Urbe S, Clague MJ (2006) Systematic analysis of myotubularins:
heteromeric interactions, subcellular localisation and endosome related
functions. J Cell Sci 119: 2953-2959
Lumb JH, Leung KF, Dubois KN, Field MC (2011) Rab28 function in
trypanosomes: interactions with retromer and ESCRT pathways. J Cell Sci 124:
3771-3783
Luzio JP, Pryor PR, Bright NA (2007) Lysosomes: fusion and function. Nat Rev
Mol Cell Biol 8: 622-632
Malmstrom K and Murer H (1986) Parathyroid hormone inhibits phosphate
transport in OK cells but not in LLC-PK1 and JTC-12.P3 cells. Am J Physiol 251:
C23-C31
Matsui Y, Kikuchi A, Araki S, Hata Y, Kondo J, Teranishi Y, Takai Y (1990)
Molecular cloning and characterization of a novel type of regulatory protein (GDI)
for smg p25A, a ras p21-like GTP-binding protein. Mol Cell Biol 10: 4116-4122
Matsunaga K, Saitoh T, Tabata K, Omori H, Satoh T, Kurotori N, Maejima I,
Shirahama-Noda K, Ichimura T, Isobe T, Akira S, Noda T, Yoshimori T (2009)
Two Beclin 1-binding proteins, Atg14L and Rubicon, reciprocally regulate
autophagy at different stages. Nat Cell Biol 11: 385-396
165
References
Maxfield FR and McGraw TE (2004) Endocytic recycling. Nat Rev Mol Cell Biol
5: 121-132
Mayor S and Pagano RE (2007) Pathways of clathrin-independent endocytosis.
Nat Rev Mol Cell Biol 8: 603-612
McBride HM, Rybin V, Murphy C, Giner A, Teasdale R, Zerial M (1999)
Oligomeric complexes link Rab5 effectors with NSF and drive membrane fusion
via interactions between EEA1 and syntaxin 13. Cell 98: 377-386
McCaffrey MW, Bielli A, Cantalupo G, Mora S, Roberti V, Santillo M, Drummond
F, Bucci C (2001) Rab4 affects both recycling and degradative endosomal
trafficking. FEBS Lett 495: 21-30
McGough IJ and Cullen PJ (2011) Recent advances in retromer biology. Traffic
12: 963-971
McLauchlan H, Newell J, Morrice N, Osborne A, West M, Smythe E (1998) A
novel role for Rab5-GDI in ligand sequestration into clathrin-coated pits. Curr Biol
8: 34-45
McLaughlin S, Wang J, Gambhir A, Murray D (2002) PIP(2) and proteins:
interactions, organization, and information flow. Annu Rev Biophys Biomol Struct
31: 151-175
Mehta S, Wu H, Garner CC, Marshall J (2001) Molecular mechanisms regulating
the differential association of kainate receptor subunits with SAP90/PSD-95 and
SAP97. J Biol Chem 276: 16092-16099
Mertens HDT and Svergun DI (2010) Structural characterization of proteins and
complexes using small-angle X-ray solution scattering. Journal of Structural
Biology 172: 128-141
Miaczynska M, Christoforidis S, Giner A, Shevchenko A, Uttenweiler-Joseph S,
Habermann B, Wilm M, Parton RG, Zerial M (2004) APPL proteins link Rab5 to
nuclear signal transduction via an endosomal compartment. Cell 116: 445-456
Michailidis IE, Rusinova R, Georgakopoulos A, Chen Y, Iyengar R, Robakis NK,
Logothetis DE, Baki L (2011) Phosphatidylinositol-4,5-bisphosphate regulates
epidermal growth factor receptor activation. Pflugers Arch 461: 387-397
Michell RH, Heath VL, Lemmon MA, Dove SK (2005) Phosphatidylinositol 3,5bisphosphate: metabolism and cellular functions. Trends Biochem Sci: 52-63
Miura S, Takeshita T, Asao H, Kimura Y, Murata K, Sasaki Y, Hanai JI, Beppu H,
Tsukazaki T, Wrana JL, Miyazono K, Sugamura K (2000) Hgs (Hrs), a FYVE
domain protein, is involved in Smad signaling through cooperation with SARA.
Mol Cell Biol 20: 9346-9355
166
References
Mochizuki Y and Majerus PW (2003) Characterization of myotubularin-related
protein 7 and its binding partner, myotubularin-related protein 9
1. Proc Natl Acad Sci U S A 100: 9768-9773
Mok H, Shin H, Kim S, Lee JR, Yoon J, Kim E (2002) Association of the kinesin
superfamily motor protein KIF1Balpha with postsynaptic density-95 (PSD-95),
synapse-associated protein-97, and synaptic scaffolding molecule PSD-95/discs
large/zona occludens-1 proteins. J Neurosci 22: 5253-5258
Moyer BD, Denton J, Karlson KH, Reynolds D, Wang S, Mickle JE, Milewski M,
Cutting GR, Guggino WB, Li M, Stanton BA (1999) A PDZ-interacting domain in
CFTR is an apical membrane polarization signal. J Clin Invest 104: 1353-1361
Naccache SN, Hasson T, Horowitz A (2006) Binding of internalized receptors to
the PDZ domain of GIPC/synectin recruits myosin VI to endocytic vesicles. Proc
Natl Acad Sci U S A 103: 12735-12740
Naef R and Suter U (1999) Impaired intracellular trafficking is a common disease
mechanism of PMP22 point mutations in peripheral neuropathies. Neurobiol Dis
6: 1-14
Nandurkar HH, Caldwell KK, Whisstock JC, Layton MJ, Gaudet EA, Norris FA,
Majerus PW, Mitchell CA (2001) Characterization of an adapter subunit to a
phosphatidylinositol (3)P 3-phosphatase: identification of a myotubularin-related
protein lacking catalytic activity. Proc Natl Acad Sci U S A 98: 9499-9504
Nandurkar HH, Layton M, Laporte J, Selan C, Corcoran L, Caldwell KK,
Mochizuki Y, Majerus PW, Mitchell CA (2003) Identification of myotubularin as
the lipid phosphatase catalytic subunit associated with the 3-phosphatase
adapter protein, 3-PAP. Proc Natl Acad Sci U S A 100: 8660-8665
Nehring RB, Wischmeyer E, Doring F, Veh RW, Sheng M, Karschin A (2000)
Neuronal inwardly rectifying K(+) channels differentially couple to PDZ proteins of
the PSD-95/SAP90 family. J Neurosci 20: 156-162
Ng EL, Ng JJ, Liang F, Tang BL (2009) Rab22B is expressed in the CNS
astroglia lineage and plays a role in epidermal growth factor receptor trafficking in
A431 cells. J Cell Physiol 221: 716-728
Nickerson DP, Brett CL, Merz AJ (2009) Vps-C complexes: gatekeepers of
endolysosomal traffic. Curr Opin Cell Biol 21: 543-551
Nicot AS, Fares H, Payrastre B, Chisholm AD, Labouesse M, Laporte J (2006)
The phosphoinositide kinase PIKfyve/Fab1p regulates terminal lysosome
maturation in Caenorhabditis elegans. Mol Biol Cell 17: 3062-3074
Nicot AS and Laporte J (2008) Endosomal phosphoinositides and human
diseases. Traffic 9: 1240-1249
167
References
Nicot AS, Toussaint A, Tosch V, Kretz C, Wallgren-Pettersson C, Iwarsson E,
Kingston H, Garnier JM, Biancalana V, Oldfors A, Mandel JL, Laporte J (2007)
Mutations in amphiphysin 2 (BIN1) disrupt interaction with dynamin 2 and cause
autosomal recessive centronuclear myopathy. Nat Genet 39: 1134-1139
Niebuhr K (2002) Conversion of PtdIns(4,5)P2 into PtdIns(5)P by the S. flexneri
effector IpgD reorganizes host cell morphology. EMBO J 21: 5069-5078
Niemann A, Berger P, Suter U (2006) Pathomechanisms of mutant proteins in
Charcot-Marie-Tooth disease. Neuromolecular Med 8: 217-242
O'Neill AK, Gallegos LL, Justilien V, Garcia EL, Leitges M, Fields AP, Hall RA,
Newton AC (2011) Protein kinase Calpha promotes cell migration through a
PDZ-dependent interaction with its novel substrate discs large homolog 1
(DLG1). J Biol Chem 286: 43559-43568
Odorizzi G, Babst M, Emr SD (2000) Phosphoinositide signaling and the
regulation of membrane trafficking in yeast. Trends Biochem Sci 25: 229-235
Palmieri D, Bouadis A, Ronchetti R, Merino MJ, Steeg PS (2006) Rab11a
differentially modulates epidermal growth factor-induced proliferation and motility
in immortal breast cells. Breast Cancer Res Treat 100: 127-137
Pasqual G, Rojek JM, Masin M, Chatton JY, Kunz S (2011) Old world
arenaviruses enter the host cell via the multivesicular body and depend on the
endosomal sorting complex required for transport. PLoS Pathog 7: e1002232
Paulin D, Huet A, Khanamyrian L, Xue Z (2004) Desminopathies in muscle
disease. J Pathol 204: 418-427
Perez-Olle R, Lopez-Toledano MA, Goryunov D, Cabrera-Poch N, Stefanis L,
Brown K, Liem RK (2005) Mutations in the neurofilament light gene linked to
Charcot-Marie-Tooth disease cause defects in transport. J Neurochem 93: 861874
Petiot A, Faure J, Stenmark H, Gruenberg J (2003) PI3P signaling regulates
receptor sorting but not transport in the endosomal pathway. J Cell Biol 162: 971979
Pfister MF, Lederer E, Forgo J, Ziegler U, Lotscher M, Quabius ES, Biber J,
Murer H (1997) Parathyroid hormone-dependent degradation of type II Na+/Pi
cotransporters. J Biol Chem 272: 20125-20130
Pfister MF, Ruf I, Stange G, Ziegler U, Lederer E, Biber J, Murer H (1998)
Parathyroid hormone leads to the lysosomal degradation of the renal type II
Na/Pi cotransporter. Proc Natl Acad Sci U S A 95: 1909-1914
168
References
Piper RC and Katzmann DJ (2007) Biogenesis and function of multivesicular
bodies. Annu Rev Cell Dev Biol 23: 519-547
Piserchio A, Pellegrini M, Mehta S, Blackman SM, Garcia EP, Marshall J, Mierke
DF (2002) The PDZ1 domain of SAP90. Characterization of structure and
binding. J Biol Chem 277: 6967-6973
Poteryaev D, Datta S, Ackema K, Zerial M, Spang A (2010) Identification of the
switch in early-to-late endosome transition. Cell 141: 497-508
Previtali SC, Quattrini A, Bolino A (2007) Charcot-Marie-Tooth type 4B
demyelinating neuropathy: deciphering the role of MTMR phosphatases. Expert
Rev Mol Med 9: 1-16
Previtali SC, Zerega B, Sherman DL, Brophy PJ, Dina G, King RH, Salih MM,
Feltri L, Quattrini A, Ravazzolo R, Wrabetz L, Monaco AP, Bolino A (2003)
Myotubularin-related 2 protein phosphatase and neurofilament light chain protein,
both mutated in CMT neuropathies, interact in peripheral nerve. Hum Mol Genet
12: 1713-1723
Puthenveedu MA, Lauffer B, Temkin P, Vistein R, Carlton P, Thorn K, Taunton J,
Weiner OD, Parton RG, von ZM (2010) Sequence-dependent sorting of recycling
proteins by actin-stabilized endosomal microdomains. Cell 143: 761-773
Quattrone A, Gambardella A, Bono F, Aguglia U, Bolino A, Bruni AC, Montesi
MP, Oliveri RL, Sabatelli M, Tamburrini O, Valentino P, Van BC, Zappia M (1996)
Autosomal recessive hereditary motor and sensory neuropathy with focally folded
myelin sheaths: clinical, electrophysiologic, and genetic aspects of a large family.
Neurology 46: 1318-1324
Raiborg C, Bache KG, Gillooly DJ, Madshus IH, Stang E, Stenmark H (2002) Hrs
sorts ubiquitinated proteins into clathrin-coated microdomains of early
endosomes. Nat Cell Biol 4: 394-398
Raiborg C, Bremnes B, Mehlum A, Gillooly DJ, D'Arrigo A, Stang E, Stenmark H
(2001) FYVE and coiled-coil domains determine the specific localisation of Hrs to
early endosomes. J Cell Sci 114: 2255-2263
Raiborg C, Malerod L, Pedersen NM, Stenmark H (2008) Differential functions of
Hrs and ESCRT proteins in endocytic membrane trafficking. Exp Cell Res 314:
801-813
Rameh LE, Tolias KF, Duckworth BC, Cantley LC (1997) A new pathway for
synthesis of phosphatidylinositol-4,5-bisphosphate. Nature 390: 192-196
Ramel D, Lagarrigue F, Dupuis-Coronas S, Chicanne G, Leslie N, Gaits-Iacovoni
F, Payrastre B, Tronchere H (2009) PtdIns5P protects Akt from
169
References
dephosphorylation through PP2A inhibition. Biochem Biophys Res Commun 387:
127-131
Ramel D, Lagarrigue F, Pons V, Mounier J, Dupuis-Coronas S, Chicanne G,
Sansonetti PJ, Gaits-Iacovoni F, Tronchere H, Payrastre B (2011) Shigella
flexneri infection generates the lipid PI5P to alter endocytosis and prevent
termination of EGFR signaling. Sci Signal 4: ra61
Renkema KY, Bindels RJ, Hoenderop JG (2011) Role of the calcium-sensing
receptor in reducing the risk for calcium stones. Clin J Am Soc Nephrol 6: 20762082
Rhee SG (2001) Regulation of phosphoinositide-specific phospholipase C. Annu
Rev Biochem 70: 281-312
Rink J, Ghigo E, Kalaidzidis Y, Zerial M (2005) Rab conversion as a mechanism
of progression from early to late endosomes. Cell 122: 735-749
Robinson FL and Dixon JE (2006) Myotubularin phosphatases: policing 3phosphoinositides. Trends Cell Biol 16: 403-412
Robinson FL, Niesman IR, Beiswenger KK, Dixon JE (2008) Loss of the inactive
myotubularin-related phosphatase Mtmr13 leads to a Charcot-Marie-Tooth 4B2like peripheral neuropathy in mice. Proc Natl Acad Sci U S A 105: 4916-4921
Rodriguez-Gabin AG, Cammer M, Almazan G, Charron M, Larocca JN (2001)
Role of rRAB22b, an oligodendrocyte protein, in regulation of transport of
vesicles from trans Golgi to endocytic compartments. J Neurosci Res 66: 11491160
Roepstorff K, Grandal MV, Henriksen L, Knudsen SL, Lerdrup M, Grovdal L,
Willumsen BM, van DB (2009) Differential effects of EGFR ligands on endocytic
sorting of the receptor. Traffic 10: 1115-1127
Romero NB (2010) Centronuclear myopathies: a widening concept. Neuromuscul
Disord 20: 223-228
Roth MG (2004) Phosphoinositides in constitutive membrane traffic. Physiol Rev
84: 699-730
Rudge SA, Anderson DM, Emr SD (2004) Vacuole size control: regulation of
PtdIns(3,5)P2 levels by the vacuole-associated Vac14-Fig4 complex, a
PtdIns(3,5)P2-specific phosphatase. Mol Biol Cell 15: 24-36
Rusten TE, Rodahl LM, Pattni K, Englund C, Samakovlis C, Dove S, Brech A,
Stenmark H (2006) Fab1 phosphatidylinositol 3-phosphate 5-kinase controls
trafficking but not silencing of endocytosed receptors. Mol Biol Cell 17: 39894001
170
References
Saxena S, Bucci C, Weis J, Kruttgen A (2005) The small GTPase Rab7 controls
the endosomal trafficking and neuritogenic signaling of the nerve growth factor
receptor TrkA. J Neurosci 25: 10930-10940
Sbrissa D, Ikonomov OC, Fenner H, Shisheva A (2008) ArPIKfyve homomeric
and heteromeric interactions scaffold PIKfyve and Sac3 in a complex to promote
PIKfyve activity and functionality. J Mol Biol 384: 766-779
Sbrissa D, Ikonomov OC, Fu Z, Ijuin T, Gruenberg J, Takenawa T, Shisheva A
(2007) Core protein machinery for mammalian phosphatidylinositol 3,5bisphosphate synthesis and turnover that regulates the progression of
endosomal transport. Novel Sac phosphatase joins the ArPIKfyve-PIKfyve
complex. J Biol Chem 282: 23878-23891
Sbrissa D, Ikonomov OC, Shisheva A (1999) PIKfyve, a mammalian ortholog of
yeast Fab1p lipid kinase, synthesizes 5-phosphoinositides. Effect of insulin. J
Biol Chem 274: 21589-21597
Sbrissa D, Ikonomov OC, Shisheva A (2002) Phosphatidylinositol 3-phosphateinteracting domains in PIKfyve. Binding specificity and role in PIKfyve.
Endomenbrane localization. J Biol Chem 277: 6073-6079
Sbrissa D and Shisheva A (2005) Acquisition of unprecedented
phosphatidylinositol 3,5-bisphosphate rise in hyperosmotically stressed 3T3-L1
adipocytes, mediated by ArPIKfyve-PIKfyve pathway. J Biol Chem 280: 78837889
Schaletzky J (2002) Charakterisierung des Myotubularin-verwandten Proteins
MTMR6. Diploma thesis, University of Bayreuth, Bayreuth, Germany.
Schaletzky J, Dove SK, Short B, Lorenzo O, Clague MJ, Barr FA (2003)
Phosphatidylinositol-5-phosphate activation and conserved substrate specificity
of the myotubularin phosphatidylinositol 3-phosphatases. Curr Biol 13: 504-509
Schroder R, Vrabie A, Goebel HH (2007) Primary desminopathies. J Cell Mol
Med 11: 416-426
Schu PV (1993) Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene
essential for protein sorting. Science 260: 88-91
Schultze W, Eulenburg V, Lessmann V, Herrmann L, Dittmar T, Gundelfinger ED,
Heumann R, Erdmann KS (2001) Semaphorin4F interacts with the synapseassociated protein SAP90/PSD-95. J Neurochem 78: 482-489
Schwartz SL, Cao C, Pylypenko O, Rak A, Wandinger-Ness A (2007) Rab
GTPases at a glance. J Cell Sci 120: 3905-3910
171
References
Scott RO, Thelin WR, Milgram SL (2002) A novel PDZ protein regulates the
activity of guanylyl cyclase C, the heat-stable enterotoxin receptor
1. J Biol Chem 277: 22934-22941
Seet LF and Hong W (2006) The Phox (PX) domain proteins and membrane
traffic. Biochim Biophys Acta 1761: 878-896
Semerdjieva S, Shortt B, Maxwell E, Singh S, Fonarev P, Hansen J, Schiavo G,
Grant BD, Smythe E (2008) Coordinated regulation of AP2 uncoating from
clathrin-coated vesicles by rab5 and hRME-6. J Cell Biol 183: 499-511
Senderek J, Bergmann C, Weber S, Ketelsen UP, Schorle H, RudnikSchoneborn S, Buttner R, Buchheim E, Zerres K (2003) Mutation of the SBF2
gene, encoding a novel member of the myotubularin family, in Charcot-MarieTooth neuropathy type 4B2/11p15. Hum Mol Genet 12: 349-356
Shenolikar S, Voltz JW, Cunningham R, Weinman EJ (2004) Regulation of ion
transport by the NHERF family of PDZ proteins. Physiology (Bethesda ) 19: 362369
Shinozaki-Narikawa N, Kodama T, Shibasaki Y (2006) Cooperation of
phosphoinositides and BAR domain proteins in endosomal tubulation. Traffic 7:
1539-1550
Shisheva A, Rusin B, Ikonomov OC, DeMarco C, Sbrissa D (2001) Localization
and insulin-regulated relocation of phosphoinositide 5-kinase PIKfyve in 3T3-L1
adipocytes. J Biol Chem 276: 11859-11869
Simonsen A, Birkeland HC, Gillooly DJ, Mizushima N, Kuma A, Yoshimori T,
Slagsvold T, Brech A, Stenmark H (2004) Alfy, a novel FYVE-domain-containing
protein associated with protein granules and autophagic membranes. J Cell Sci
117: 4239-4251
Simonsen A, Gaullier JM, D'Arrigo A, Stenmark H (1999) The Rab5 effector
EEA1 interacts directly with syntaxin-6. J Biol Chem 274: 28857-28860
Simonsen A, Lippe R, Christoforidis S, Gaullier JM, Brech A, Callaghan J, Toh
BH, Murphy C, Zerial M, Stenmark H (1998) EEA1 links PI(3)K function to Rab5
regulation of endosome fusion. Nature 394: 494-498
Simonsen A, Wurmser AE, Emr SD, Stenmark H (2001) The role of
phosphoinositides in membrane transport. Curr Opin Cell Biol 13: 485-492
Sivars U, Aivazian D, Pfeffer SR (2003) Yip3 catalyses the dissociation of
endosomal Rab-GDI complexes. Nature 425: 856-859
Slagsvold T, Pattni K, Malerod L, Stenmark H (2006) Endosomal and nonendosomal functions of ESCRT proteins. Trends Cell Biol 16: 317-326
172
References
Songyang Z, Fanning AS, Fu C, Xu J, Marfatia SM, Chishti AH, Crompton A,
Chan AC, Anderson JM, Cantley LC (1997) Recognition of unique carboxylterminal motifs by distinct PDZ domains. Science 275: 73-77
Sorkin A and Goh LK (2009) Endocytosis and intracellular trafficking of ErbBs.
Exp Cell Res 315: 683-696
Stack JH, DeWald DB, Takegawa K, Emr SD (1995) Vesicle-mediated protein
transport: regulatory interactions between the Vps15 protein kinase and the
Vps34 PtdIns 3-kinase essential for protein sorting to the vacuole in yeast. J Cell
Biol 129: 321-334
Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol
Cell Biol 10: 513-525
Sun T, Guo J, Shallow H, Yang T, Xu J, Li W, Hanson C, Wu JG, Li X, Massaeli
H, Zhang S (2011) The role of monoubiquitination in endocytic degradation of
human ether-a-go-go-related gene (hERG) channels under low K+ conditions. J
Biol Chem 286: 6751-6759
Suter U (2007) Phosphoinositides and Charcot-Marie-tooth disease: new keys to
old questions. Cell Mol Life Sci 64: 3261-3265
Suter U, Moskow JJ, Welcher AA, Snipes GJ, Kosaras B, Sidman RL, Buchberg
AM, Shooter EM (1992a) A leucine-to-proline mutation in the putative first
transmembrane domain of the 22-kDa peripheral myelin protein in the trembler-J
mouse. Proc Natl Acad Sci U S A 89: 4382-4386
Suter U, Welcher AA, Ozcelik T, Snipes GJ, Kosaras B, Francke U, BillingsGagliardi S, Sidman RL, Shooter EM (1992b) Trembler mouse carries a point
mutation in a myelin gene. Nature 356: 241-244
Svergun DI and Koch MHJ (2003) Small-angle scattering studies of biological
macromolecules in solution. Reports on Progress in Physics 66: 1735-1782
Swiatecka-Urban A, Duhaime M, Coutermarsh B, Karlson KH, Collawn J,
Milewski M, Cutting GR, Guggino WB, Langford G, Stanton BA (2002) PDZ
domain interaction controls the endocytic recycling of the cystic fibrosis
transmembrane conductance regulator. J Biol Chem 277: 40099-40105
Taguchi-Atarashi N, Hamasaki M, Matsunaga K, Omori H, Ktistakis NT,
Yoshimori T, Noda T (2010) Modulation of local PtdIns3P levels by the PI
phosphatase MTMR3 regulates constitutive autophagy. Traffic 11: 468-478
Tamai I, Ohashi R, Nezu J, Yabuuchi H, Oku A, Shimane M, Sai Y, Tsuji A
(1998) Molecular and functional identification of sodium ion-dependent, high
affinity human carnitine transporter OCTN2. J Biol Chem 273: 20378-20382
173
References
Teo H, Gill DJ, Sun J, Perisic O, Veprintsev DB, Vallis Y, Emr SD, Williams RL
(2006) ESCRT-I core and ESCRT-II GLUE domain structures reveal role for
GLUE in linking to ESCRT-I and membranes. Cell 125: 99-111
Tersar K (2008) Function, Regulation and Involvement of Mtmr2 and
Mtmr13/Sbf2 in the Hereditary Human Diseases CMT4B1 and CMT4B2. Doctoral
Thesis, ETH Zurich, Switzerland
Tersar K, Boentert M, Berger P, Bonneick S, Wessig C, Toyka KV, Young P,
Suter U (2007) Mtmr13/Sbf2-deficient mice: an animal model for CMT4B2
1. Hum Mol Genet 16: 2991-3001
Thelin WR, Hodson CA, Milgram SL (2005) Beyond the brush border: NHERF4
blazes new NHERF turf. J Physiol 567: 13-19
Tonikian R, Zhang Y, Sazinsky SL, Currell B, Yeh JH, Reva B, Held HA,
Appleton BA, Evangelista M, Wu Y, Xin X, Chan AC, Seshagiri S, Lasky LA,
Sander C, Boone C, Bader GD, Sidhu SS (2008) A specificity map for the PDZ
domain family. PLoS Biol 6: e239
Traer CJ, Rutherford AC, Palmer KJ, Wassmer T, Oakley J, Attar N, Carlton JG,
Kremerskothen J, Stephens DJ, Cullen PJ (2007) SNX4 coordinates endosomal
sorting of TfnR with dynein-mediated transport into the endocytic recycling
compartment. Nat Cell Biol 9: 1370-1380
Tronchere H, Laporte J, Pendaries C, Chaussade C, Liaubet L, Pirola L, Mandel
JL, Payrastre B (2004) Production of phosphatidylinositol 5-phosphate by the
phosphoinositide 3-phosphatase myotubularin in mammalian cells. J Biol Chem
279: 7304-7312
Tsujita K, Itoh T, Ijuin T, Yamamoto A, Shisheva A, Laporte J, Takenawa T
(2004) Myotubularin regulates the function of the late endosome through the
gram domain-phosphatidylinositol 3,5-bisphosphate interaction. J Biol Chem 279:
13817-13824
Urbe S, Mills IG, Stenmark H, Kitamura N, Clague MJ (2000) Endosomal
localization and receptor dynamics determine tyrosine phosphorylation of
hepatocyte growth factor-regulated tyrosine kinase substrate. Mol Cell Biol 20:
7685-7692
Vaccari I, Dina G, Tronchere H, Kaufman E, Chicanne G, Cerri F, Wrabetz L,
Payrastre B, Quattrini A, Weisman LS, Meisler MH, Bolino A (2011) Genetic
Interaction between MTMR2 and FIG4 Phospholipid Phosphatases Involved in
Charcot-Marie-Tooth Neuropathies. PLoS Genet 7: e1002319
Valiente M, Andres-Pons A, Gomar B, Torres J, Gil A, Tapparel C, Antonarakis
SE, Pulido R (2005) Binding of PTEN to specific PDZ domains contributes to
174
References
PTEN protein stability and phosphorylation by microtubule-associated
serine/threonine kinases. J Biol Chem 280: 28936-28943
van de Graaf SF, Chang Q, Mensenkamp AR, Hoenderop JG, Bindels RJ (2006)
Direct interaction with Rab11a targets the epithelial Ca2+ channels TRPV5 and
TRPV6 to the plasma membrane. Mol Cell Biol 26: 303-312
van de Graaf SF, Rescher U, Hoenderop JG, Verkaart S, Bindels RJ, Gerke V
(2008) TRPV5 is internalized via clathrin-dependent endocytosis to enter a Ca2+controlled recycling pathway. J Biol Chem 283: 4077-4086
van Weering JR, Verkade P, Cullen PJ (2010) SNX-BAR proteins in
phosphoinositide-mediated, tubular-based endosomal sorting. Semin Cell Dev
Biol 21: 371-380
van Weering JR, Verkade P, Cullen PJ (2011) SNX-BAR-Mediated Endosome
Tubulation is Co-ordinated with Endosome Maturation. Traffic
Vicinanza M, D'Angelo G, Di CA, De Matteis MA (2008) Phosphoinositides as
regulators of membrane trafficking in health and disease. Cell Mol Life Sci 65:
2833-2841
Visioli F, De La Lastra CA, Andres-Lacueva C, Aviram M, Calhau C, Cassano A,
D'Archivio M, Faria A, Fave G, Fogliano V, Llorach R, Vitaglione P, Zoratti M,
Edeas M (2011) Polyphenols and human health: a prospectus. Crit Rev Food Sci
Nutr 51: 524-546
Vivanco I and Sawyers CL (2002) The phosphatidylinositol 3-Kinase AKT
pathway in human cancer. Nat Rev Cancer 2: 489-501
von ZM and Sorkin A (2007) Signaling on the endocytic pathway. Curr Opin Cell
Biol 19: 436-445
Walker DM, Urbe S, Dove SK, Tenza D, Raposo G, Clague MJ (2001)
Characterization of MTMR3. an inositol lipid 3-phosphatase with novel substrate
specificity. Curr Biol 11: 1600-1605
Wang L, Piserchio A, Mierke DF (2005) Structural characterization of the
intermolecular interactions of synapse-associated protein-97 with the NR2B
subunit of N-methyl-D-aspartate receptors. J Biol Chem 280: 26992-26996
Wang T, Ming Z, Xiaochun W, Hong W (2011) Rab7: role of its protein interaction
cascades in endo-lysosomal traffic. Cell Signal 23: 516-521
Wassmer T, Attar N, Bujny MV, Oakley J, Traer CJ, Cullen PJ (2007) A loss-offunction screen reveals SNX5 and SNX6 as potential components of the
mammalian retromer. J Cell Sci 120: 45-54
175
References
Wassmer T, Attar N, Harterink M, van Weering JR, Traer CJ, Oakley J, Goud B,
Stephens DJ, Verkade P, Korswagen HC, Cullen PJ (2009) The retromer coat
complex coordinates endosomal sorting and dynein-mediated transport, with
carrier recognition by the trans-Golgi network. Dev Cell 17: 110-122
Watanabe C, Kato Y, Sugiura T, Kubo Y, Wakayama T, Iseki S, Tsuji A (2006)
PDZ adaptor protein PDZK2 stimulates transport activity of organic
cation/carnitine transporter OCTN2 by modulating cell surface expression. Drug
Metab Dispos 34: 1927-1934
Wernimont A and Edwards A (2009) In situ proteolysis to generate crystals for
structure determination: an update. PLoS One 4: e5094
Whitley P, Reaves BJ, Hashimoto M, Riley AM, Potter BV, Holman GD (2003)
Identification of mammalian Vps24p as an effector of phosphatidylinositol 3,5bisphosphate-dependent endosome compartmentalization. J Biol Chem 278:
38786-38795
Williams RL and Urbe S (2007) The emerging shape of the ESCRT machinery.
Nat Rev Mol Cell Biol 8: 355-368
Winters JJ, Ferguson CJ, Lenk GM, Giger-Mateeva VI, Shrager P, Meisler MH,
Giger RJ (2011) Congenital CNS Hypomyelination in the Fig4 Null Mouse Is
Rescued by Neuronal Expression of the PI(3,5)P2 Phosphatase Fig4. J Neurosci
31: 17736-17751
Wishart MJ and Dixon JE (2002) PTEN and myotubularin phosphatases: from 3phosphoinositide dephosphorylation to disease. Trends Cell Biol 12: 579-585
Wu H, Nash JE, Zamorano P, Garner CC (2002) Interaction of SAP97 with
minus-end-directed actin motor myosin VI. Implications for AMPA receptor
trafficking. J Biol Chem 277: 30928-30934
Wurmser AE, Sato TK, Emr SD (2000) New component of the vacuolar class CVps complex couples nucleotide exchange on the Ypt7 GTPase to SNAREdependent docking and fusion. J Cell Biol 151: 551-562
Xhabija B, Taylor GS, Fujibayashi A, Sekiguchi K, Vacratsis PO (2011) Receptor
mediated endocytosis 8 is a novel PI(3)P binding protein regulated by
myotubularin-related. FEBS Lett 585: 1722-1728
Yamamoto A, DeWald DB, Boronenkov IV, Anderson RA, Emr SD, Koshland D
(1995) Novel PI(4)P 5-kinase homologue, Fab1p, essential for normal vacuole
function and morphology in yeast. Mol Biol Cell 6: 525-539
Yan Q, Hunt PR, Frelin L, Vida TA, Pevsner J, Bean AJ (2005) mVps24p
functions in EGF receptor sorting/trafficking from the early endosome. Exp Cell
Res 304: 265-273
176
References
Yoon MS, Du G, Backer JM, Frohman MA, Chen J (2011) Class III PI-3-kinase
activates phospholipase D in an amino acid-sensing mTORC1 pathway. J Cell
Biol 195: 435-447
Yoshimura S, Gerondopoulos A, Linford A, Rigden DJ, Barr FA (2010) Familywide characterization of the DENN domain Rab GDP-GTP exchange factors. J
Cell Biol 191: 367-381
Yu J, Pan L, Qin X, Chen H, Xu Y, Chen Y, Tang H (2010) MTMR4 attenuates
transforming growth factor beta (TGFbeta) signaling by dephosphorylating RSmads in endosomes. J Biol Chem 285: 8454-8462
Zerial M and McBride H (2001) Rab proteins as membrane organizers. Nature
Rev Mol Cell Biol 2: 107-117
Zhang J, Wong CH, Xia W, Mruk DD, Lee NP, Lee WM, Cheng CY (2005)
Regulation of Sertoli-germ cell adherens junction dynamics via changes in
protein-protein interactions of the N-cadherin-beta-catenin protein complex which
are possibly mediated by c-Src and myotubularin-related protein 2: an in vivo
study using an androgen suppression model. Endocrinology 146: 1268-1284
Zhang X, Chow CY, Sahenk Z, Shy ME, Meisler MH, Li J (2008) Mutation of
FIG4 causes a rapidly progressive, asymmetric neuronal degeneration. Brain
131: 1990-2001
Zhang Y, Zolov SN, Chow CY, Slutsky SG, Richardson SC, Piper RC, Yang B,
Nau JJ, Westrick RJ, Morrison SJ, Meisler MH, Weisman LS (2007) Loss of
Vac14, a regulator of the signaling lipid phosphatidylinositol 3,5-bisphosphate,
results in neurodegeneration in mice. Proc Natl Acad Sci U S A 104: 1751817523
Zheng CY, Seabold GK, Horak M, Petralia RS (2011) MAGUKs, synaptic
development, and synaptic plasticity. Neuroscientist 17: 493-512
Zhong Q, Lazar CS, Tronchere H, Sato T, Meerloo T, Yeo M, Songyang Z, Emr
SD, Gill GN (2002) Endosomal localization and function of sorting nexin 1. Proc
Natl Acad Sci U S A 99: 6767-6772
Zhou X, Takatoh J, Wang F (2011) The mammalian class 3 PI3K (PIK3C3) is
required for early embryogenesis and cell proliferation. PLoS One 6: e16358
Zhou X, Wang L, Hasegawa H, Amin P, Han BX, Kaneko S, He Y, Wang F
(2010) Deletion of PIK3C3/Vps34 in sensory neurons causes rapid
neurodegeneration by disrupting the endosomal but not the autophagic pathway.
Proc Natl Acad Sci U S A 107: 9424-9429
177
References
Zonia L and Munnik T (2004) Osmotically induced cell swelling versus cell
shrinking elicits specific changes in phospholipid signals in tobacco pollen tubes.
Plant Physiol 134: 813-823
Zou J, Chang SC, Marjanovic J, Majerus PW (2009) MTMR9 increases MTMR6
enzyme activity, stability, and role in apoptosis. J Biol Chem 284: 2064-2071
Zuchner S and Vance JM (2006) Mechanisms of disease: a molecular genetic
update on hereditary axonal neuropathies. Nat Clin Pract Neurol 2: 45-53
Zwang Y and Yarden Y (2009) Systems biology of growth factor-induced
receptor endocytosis. Traffic 10: 349-363
178
Publications
11 Publications
11.1 List of publications
Kriz A., Schmid K., Baumgartner N., Ziegler U., Berger I., Ballmer-Hofer K.,
Berger P. A Plasmid based multigene expression system for mammalian cells.
Nat Commun. (2010)Nov;1(8):110.
Kriz, A., Schmid, K., Ballmer-Hofer, K., and Berger, P.: Integration of multiple
expression cassettes into mammalian genomes in a single step. Nature protocol
exchange (2011)
Kriz, A., Schmid, K., Ballmer-Hofer, K., and Berger, P.: Multilabel:
Multigenexpression in Säugerzellen. GIT Labor-Fachzeitschrift (2011) 11, 776780.
Kriz, A., Schmid, K., Ballmer-Hofer, K., and Berger, P.: MultiLabel: Multigene
Expression in Mammalian Cells. GIT Laboratory Journal (2011) 3-4, 12-13.
11.2 Poster presentations
Annual Symposium of the Neuroscience Center Zurich (ZNZ), 12th September
2008, ETH Zurich, Switzerland
Annual meeting of the Union of the Swiss Societies for Experimental Biology
(USGEB): 29th - 30th January 2009, Interlaken, Switzerland
11th - 12th February 2010, Lugano, Switzerland
179
Curriculum Vitae
12 Curriculum Vitae
Katharina Gegenschatz-Schmid
Rathausplatz 1
CH-5200 Brugg, Switzerland
Date of Birth: 07. May 1980
Nationality:
Swiss and German
Education
11/2007 – 03/2012
PhD student at the Paul Scherrer Institut (PSI, Villigen)
and participant of the international PhD program in
Neuroscience (ZNZ) of the ETH Zurich, Switzerland
Supervision by:
Dr. Philipp Berger
Prof. Kurt Ballmer-Hofer
Prof. Ueli Suter
Doctoral Thesis:
„Structural and Functional Characterization of Interactions
of Myotubularin-Related Proteins“
08/2005 – 04/2007
Master of Science in Biology, Plant Sciences, University
of Zurich, Switzerland (Total Mark: 5.6)
Master Thesis:
„Molecular Characterization of the MATE transporter TT12
using Site-directed Mutagenesis“ (Mark: 6)
08/2001 – 08/2005
08/2000 – 07/2001
08/1996 – 07/2000
Bachelor of Science in Biology, University of Zurich,
Switzerland
Forensic Sciences, University of Lausanne, Switzerland
Kantonsschule Sargans (Matura Type E, Economy)
180
Curriculum Vitae
Employment History
2007
Private Lesson Teacher in Zurich, Switzerland
By giving lessons in Biology and designing specific
excercises I prepared an autistic biology student for his
intermediate degree in Biology (at the University of Zurich),
which he passed successfully.
2003 – 2006
Temporary Laboratory Assistant at the ETH Zurich,
Switzerland
In the laboratory of the research group of Prof. Dr. E. Hafen
in the Institute of Molecular Systems Biology ETH Zurich, I
supervised and maintained mutant Drosophila
melanogaster strains.
2003 – 2004
Freelance Garden Teacher at the Botanical Garden of the
University of Zurich, Switzerland
This activity included the organization, preparation and
guidance of school classes of different ages through the
botanical garden.
181
Acknowledgements
13 Acknowledgements
First of all I would like to thank Dr. Philipp Berger for giving me the opportunity to
work on this interesting project. I am grateful for his constant support and his
valuable advices. I appreciated his encouraging words with a pinch of black
humor.
I would like to thank Prof. Kurt Ballmer-Hofer for the opportunity to work in his
group under excellent scientific conditions and for his personal support also as
member of my PhD committee.
Special thanks go to Prof. Ueli Suter, who supported me at our annual committee
meetings with helpful inputs and who agreed to examine this thesis.
I would like to thank the whole BMR for providing a nice atmosphere. Special
thanks go to all my present and former colleagues of the MCB lab: Eddi, Anja,
Thomas, Alex, Sandro, Kaisa, Sandra, Maurice, Nadia, Yosuke, Nathalie,
Mayanka, Aline and Caroline. It was a great time with you all. Special thanks go
to Kaisa who introduced me to SAXS and who made the beam time nights to
chocolate-sweet experiences. I would also like to thank the good soul of the lab,
Ulla, for keeping the lab running.
Many thanks go to my family who supported me my whole life and to Marc for
everything.
182