Report 2010 - Biocenter - Medizinische Universität Innsbruck

Transcription

REPORT
2010
TTATATATTTAGGTACTTCAATGTTGAGTGGATATATGTTTACTATTGTTTTATTCTTTTGATGAATTGA
CCCTGTTATCATTATATAATGACATTATCTCTTATGACAGATTTGATTCAAAGTCTATTTTTTCTGACAT
AAATATTGCTTACCCATTCTCTCTTTGTTTTCATTTGCATGGAATATTTTTTATTTCTCTTCACTTGCAG
TCAATATGTCTTCTTAAGGCTAAATTGAGTCCCCAGCAGGAATCATACTGTTTGATCTTGTTTTTTATTA
TCCATTCAGCCATGCTGTGTCCTTTGACTAGAGCATTTAATCCATTACATTTAAAGAAATTATTGATAGG
TAAGAATTTACTATTGATATTATTTTCAATTGTTTTCTAATTGTTTTGTAGTTCCTTATTTCCTCTCTTTCTGATTTGCTTTGTGATTGGTTGATTTTCTGTAGTGGTA
TGCTTTTTTTTTTTTTCTTTAAGTTCTGGGATACATGTGCAGAACACGCAGGTTTGTTACATAGGTACACATGTGCCATGGTGGTTTGCTCCACCTATCAACCCGTCAT
CTAGGTTTTAAGCCCCGCATGCATTAGGTATTTGATTTCTTTTTCGTCATGTTTTGTGCACTGACTAGAGGTTTTTTGTGGTTACCATGAATCTTATATAAAAATCTTA
TCATTATAACATTCTATTTTAAAGTGATAACTTCAATCACATACAAAAATTATACTTTACTTTTCTCAAACAATAATTTTATGTGATTGACATCACACTTTATATCCTT
TTATATTATGTCTACATTAACAAATTATTGTAGCTATAGTTATTTCTATTATATATGTCTTTTAAATTTAATAGTAGAGTTAAAAGAGATTAAATACAACCACTACTAT
ATTAGTGCATTCTGAATTTGACTATATATCTATCTTTACCTGTGTATATCTGTGTATATATACTTTCATACATTTTCATGTTGCTGGTTTTTGTCTTTTTGTTTCAACT
TGAAGAACCTCCTTTAGCATTTATTGTAAGGTAGGTCTTATGGTGATGAATTCCCACATTTTTTTTGTCTGGGAATGTCTTTATCCTTTCTTACTTCTGAAGGACAGTT
TTTCGTAATATTGTTTCATAGTTATTTTTTCTTTCAGCATTTTGAATATATAATCTCAGTGCCTCCTGGTCTATAAAATTTCCTCTGAGAAGTCCATTGATAGACTCAT
TGGGGTGCCCTCATATGTGAAGAGACTCTTTTACTAGTTTCAGGATTTCTCTTTGTCTTTAACTTTTGAGAATTTCATTATAATATGTCTTGGGATAATTTTGATTTTA
ACTTATTGTCATCCTTTGAGCTTCATAAGTCTGGATGTGCATATCTTTCACCTAATTTTGGAAGTTTTCAGTCATTTCTCTAAATAAGCTGCCTTTTTTTTTTTCTTTT
TTTTTTAAAGACATACGTAACTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCACATTGATAGTTCACTGCAACCTTGATCTCCTGGAGTCAAGAGATCATCCTACCTC
GCTTCCTGAATAGTGAGGACTACAGGTATGTATCATCACACCTGGCTGATTTTTTTTTTTTTTTTTTTTTTGGAAGATGGTGGTCTTAGTATGTTGCCCAGGCTGGTTT
TAAATTCCTATCCTCAAGCAAACCATCTGCTTTGCCTTCCCAAAGCACTGGGATGACAGACATGAGCCACTGAGCCCAGCCCTCTAAATAAGCTTTCTGTCTCATTTTC
CCTTTCTTCTCATTCTAGAAATCCTATAATTCATATATTTCTATGCTTGATGGTGTCCCATAGGTCCCTTATGCTTTCTTCAATCTTTTATTTTATTCCTCTAATTGGC
TAATTTCAAATGACTAATCTTTGAGTTCCCTAATTCTGTTTTATAATTGAGTCTATCAAATTTTGCAGTTCTATCATTATGTTCTTCGGCTCCAGGATTTTTGTTTGCT
TCCTTTTTATGGATTCCATTTCTTTGTTAAACTTCTCATTTTGTTCATGCATTGCTTTCCTAATTTTGTTTCGTTTTCAGTATGTGTTCTCTTGAATCTCATTGAGCTT
CAAGATGATTTTTTTGTCAGGCAATTTGTAGATCTCTATTTCTATAGGATTGATTACTGGAGCCTTTCTAGTTTCATTTGGTTGTTTTATTGTCCATAAAGCCTCACAT
TATTGCCTGTGCAACTAAAGGAGCAAACACCTCTTTCAGTTTTTATAAGCTGGTTTTAGCATATAAAGACTTTCTCTTTTGGAGTCCTTGCAAAGACATGACTACCTTC
AGGATCACAGATGAATGGGGTTGAAGCCAGGTCACCTAACTGCTGCCGGGTTTGCAGTGGAGCCTGTAGTTGGCAGATCTATTACCAAGTGCTTGAATGGGCATGGATT
CTATCTAGTCTCTTGGTGCACTTAACTGCCTCCACAGCCTTGGTCAGTAGGGGTTGCACCTGGACCAGCGTCTTATTCAGTGTCTGCCAACAGAAAGACTGTTACCAAA
TATACAGATGCTCAGATGGGTATCACTTCCTCTGGGTTTCGGGACGGCTTCCTGCTGTGTCACTGGTTAAATACCTGGGCAGGCAATACTGGCCCATGACTGCAACTGA
GCTAGAATGGAGTTCTAGCTGGGAAAGAACTGAGTTACAGGGTTCTGTCAATTTCCACAGCTGAGACTCATGTCTGTAGGGTTGCCCCTAGGGGCACAGATGGATGTCT
CTGTTTTCAGGCTCAACTCTTAATTAAAAGTTACTTCCAAAATTCAAAAAATCCATTAAAAACCAGGCTTTCTGGGCTGCTTTCAGACTGCAGCTGACAAGGACTGGAG
CCAGGTTCCATCTGAGGATCTGTTGTGAGACTGAGTTCAGCTGTTCTTCCAGTTGGGGGACAGATGTGTGTTTCTCTCCCTCAGTCCCTGGACAGGCACAACTGCTCTC
AGACCAGAACTGAGTGAGGTTAGAACTGAGTTACAAGGCTGTTTCAGGGTGCATAGCAGGTACCGAGGCCAGCAGGCCTGCTATCCAAGGCATGAGTAGGCATGAATGC
TGCTGGGTTCCTTGTCAGATGGTTCTGGCAATAGGACCCATGCCAAATGGAAATGAACTCAATCCACAAGGGAATGGAGATATTTCGGGGTTTAGAGGCGGGACCACGG
TTGGCAAGTCTGCAACCTGGGAATACTTCTGCCCTCTCAAATCAACCTTCCTAGGTCTTGGGTAGCAACAAGTTTTAGTAACTTCCTGCCTGAATCCCAAAGCTCCCAC
AAAGGCACTTTTGTTCGTGAATGGCTGCAAAACCAGTGTTTCTATGGAAAGAATATGAGCCAGAAGAACTCCTATTCTACCATCTTGCTGATGTCACTCTAGAAATAAT
CATTACTGTGCTCACTAACACTGTTCCCTTTTCAGTTTCTTGACCTCCATAAATTTTCTGTCTCTTTTGAACTCTGTAAATAAAATTATTAATTCATTATATATATATC
ACTATTCTGTATTTAATAGCCTCCCATTTTCTGAGATTAATTTCTCACATTATTTTTATTGACCTGGAGACTATGAATTAACAAAATGTTCAAAATAAAAGTTTAAAGA
AAATTAGCACGCATATTTTCTTTTTTTTCTTTATCTTTCTAGAGATGTGTAATTCCTACATTACACAAAGAGAATTTGTAGGAGAAACCAGGAAAGGAAAACAGGAAGG
AAAAGACTTTTCTGATAAATACATGGTTTCATTTTCCTCTCCCTTCTTTGATGCAGAAGAGACCTTGATGTGTCCAAGAGTATATGAGGAGGTTAGATGTGCAGTCTCA
TTGACTGGAGAAGTGTCAGGAAGGAGGGGTTTATTTTTGCTTAGCTTTGCCCTGTATTCATTTTTCTTGTTGCATAAGCTTCTTATCGACATTAATTTTAGACTCCCAA
GATGTTTTGCATAACATAGAATTATAATCTAGTGTCTAAAATAGTTGCAAACCATAGTTTCAAATACATTAGGAAGATGAATCATTTCCTTAACATGAACCACTGTGTT
ATTTGAAATGATTACTTACAAGGGAGAAGTGATACATAATTAAAGTATCATGTGACATACAAAAAAGAAATCAATGAAATTCAAACAATAAATGCTTCTTCTGTTTCTC
GTGAAAGATAGATGAAATATGCAGCTCCTTCTCATATCCATTTTGAAATGAATGGGTCTTGAATACCATAACTATGTTATTTCAGTAGTAAGTAGAAATATTTCAGTAT
CAGAAGGGAAGAAATGAAATGAAATCAATCTACATCACTTTGGATTTTTAACTCCTCTAAAAACGTCTTACTGGGTATACATTATTGTTGTCAAATCCATTTTAATTTG
AATTTTACTGTGTTTGTGTATGTGTATGCATGCACTTACTTTTGTTTTTAACTCTCTTAAATAGCTTCAAAATGAAAGTTTTGTAACCAAATTTGAGCAGCAAAGAAAA
AGGAGAAAGGGATCAAATATCTCTAACATATTCTACTTCATACAGTTCTTGGGTTTCTTTTTGCCAAGCTTTCACTCATAGCAGCTACACCAGTACCATCATGAATACT
AATGAAATGTAATAGAAGGCATCAGTCATGATCCATCCAGGCTAGGGACATAACCATATACAAAGTGATAGTTCTTCCAGCTTAATGAAGCCTTCTTAAAGAAAAACTG
TTTACATTCAAATTTGGATAAGCTATGAGAGCTTGTAAGCTATGAGAGCTAGACTGTACAGTTTTTAGGGGCAGGCATTGGTACAGGGAAACTCTATTATCTTCTTTAT
TTTCCTTCCAAAATTGTGCCTCATCAAAGTCCTGGGCATAAAATGTTTACTGAACAAAGTTTCAAAGAAATGCCATAGGAAATAAAGCTTAAAACTGTAGAAATCGAAA
GTAAAAGATTTTAAACAGATAGACAACAGTGTTTAGATAAGCAAATACTTTTTCTGCAATCCTTAAGGTTTGCTGCCAACCTATGGAGTTCAAATTAACATTTCTCTCA
GAAGTAAGCCTCATCTTTCTACTATCTTTTTAGACTATGTTTCTACATTCTATATATTCCTCCTTTCCAATAACAAGTCTCAGGAGTGGTTTTGGAACTCACTGATTTT
TGGATCAAGCTAATATAGGATGGCATTAATGTAAAGTAATGCTATTACTCAAATATCAGGGATACTATCGTGACAGCTATATCCCTGGAATCACTGAATAAGCTTACAA
AACTTACTCTGCAAGAAGCTCCTGCTGAAACTTGAAAAGCATGTCAACAGAGGCTCCAAATGACAGAAAATTGCAATTTGTTATAACATTAAAAGAGAACTTATAACTT
ATTCTGACATATAATACTTCCCATAACCTGGTCAGGCCTCTTTTATTATTCAAGGTTTTCTAAAACCTCACTCTCATTATGAAGCTTTTCCAGACTCACTGCAAATAAA
ATTATCAGAGAAGAGACACATTCATATCTTACATGGCAATGTACTTGGCCACGAGTGCAAAGGTGCTTTGGCCTTGTATAAATTTAGTTACTAAATTTGTTCCACATGC
ATGTAAGTTTTTGTTTAATTTTATTTTGTTTTCCTTACCATATATGATTTAAATTATGAACTTCTACAGTCAAAATAATTTTAACTAAATTTTTATATCTATCTTTGGG
GAGGGAGTACAAAGAAGTATACTAGTCAAATAATGTTGCAATATTGCTGCATGACAAATAGCCAGAAAATCTCAGTGGTACCCAACTATGAGGATCTTATCTCACTCAG
TCCAAATGTCAGCTAGCATGGTGCCACCTCAGCATATGCATCTTCAGAGTTGCTGAATTTTGTTTCTCCTGGTTCATGCTGGACCTAAGGCTGAAGAAACAGTAGCTAC
CTGGGGTACCTTCTTCTTATAGAGGAGATATGAAGGTCCCAGAGAGTGCAAGCCAAACTGTGTGATGTCTCTTAAGATCTATGCTTAATATTTGATCCCTACTGCATTC
CTTCTGCACGTCCTACTGTAAAATCATGTCCCTTGACCTAACACAATTTCTATGGATTAGAGACATGTACTATTGACATGGAATGGGAAGATCACAAGAGGTGAATATA
CCCTGATAAATATTCTAAATATACCATAGTGTACCCTCTTATTTAAAAATGTTCACATCTCTGGTCGGGTGAGGTGGCTCACATCTGTAATCCCAGCACTTTGGGAGGC
CGACGCAGGCAGATCACAAGGTCAGGGGATCGAGACCACCTTGGCCAACATGGTGAAACCCCATCTTTACTAAAATACAAAAAATTAACCGGGTGTGGTGGTGGGTGCT
TGTAATCCCAGCTACTTGGGAGGCTGAGGCAGGGGTATCACGTGAACCCAGGAGGGAGAGTTTGCAGTGAGCTGAGATCGCATCACTGCACTCCAGCCTAGCAACAGAG
CAAGACTCCATTATTAATAATAATTAATTTATTAATTCATGTAAAACATAGAAAATGTGCAGCCATATAGGCTTATTTGCCTTCTTTTCCAGTCTTCTATGCTATAATT
TTCCAGTCTTTTATGCTATAATTGTCATATGTATTACACATACATAAATTAAAATATATTATAATTTTTACATTAAAAAACTATATGTAAACACAATAAACAAAATAAT
CAAACAAAATAAAAAATTTGTCTTCTATGTTTACTCATATATCTTTCATTTCTAATCCTCCATATTTCTTCCTAAAATTCCATTTCTCCATCTGGTATCATTTTCCTTC
AACCTGCAAGACTTTCTTGGTTTTGGCTTACCTGAAAATGGCTTTATTTTGCCTATGTTATTAAACAATGTTTCTGAATTTTGAAATTAACCCTTTATTTCTTGAATAA
TTAGAGATGGGGAAGTCTTCTGGTAGGGTAGTTTTGAGGGAATAAATCAGGAGATTGATGTCGGGCATACTGAATTCAAGATACTAAAACCTCCAAGAAGATACATAAA
CCTGGTGTTTGAGAAAACAGTCAGAATTGGACATAAAGAATTATGGGTTGTCAACATATATTACAGATAGTATTTAGAGCTATGAGATGATAGGACTCACATCTAGGAC
TATCATCAAGGGAGTGAGTGTAGTTAATGAAGTGAAGGAGGCTCTGAACTGTGTCTTAGAGCACTCCAACAATGTGAAGCTAGAGAAGAGGAGGAAACAGCAACAGAAA
GTGAGGAGCAACTAATGAGTTAGGAGAAAACAAACCGTAGTGTATGGTTTTCTACAAGCTATATAAATAATGAAAATGAAGAAGGAAAAAACAATAATATCAAGGGCTA
CAGACTGGAAAGATTGGGACAGAAAATTAACCATTAGAATTAATTGAACGCAGGTCACCGGCAACCTTGAAGTTTTGGTGAACTGGTGGAAGTAAAAGTGTGATTGGAG
TGGGTCATTAATTTTTAATAATGACAGTAGTGAATAGGTAAACATCCTATAGTGGTCACAAGAACATAATTGTGAATATAAATAACATTACATTCTTATTTATAACATT
GTTTTATGATTTTCACATTATCCTGTTGGATTTATACCCAATAAGCAACCACTACTTTTTTGAGAACTGCCCTCTACCCTAGCCCCTGAAAATATATTATATGAAAATT
CTCTCCCAGCTCTAATTGGTTTAACAAAATATATGACCCAACCCA
w w w. i - m e d . a c . a t / b i o c e n t e r
Adele Loidl | Alexander Hüttenhofer | Alexander Pauck | Alexandra Lusser | Alexandra Pipal | Anna Moussavi | Andrea Casari |
Andrea Eigentler | Andreas Ploner | Andreas Villunger | Anette Zeilner | Angela Klein-Wondrak | Anita Kofler | Anna Chirkova |
Anna Moussavi | Anne Krogsdam Anto Nogalo | Arno Helmberg | Astrid Devich | Ayten Yigit | Barbara Gschirr | Barbara Meissner |
Barbara Stoiber | Barbara Wolf | Beate Abt | Beatrix Fürst | Beatriz Campo-Fernández | Benedicte Sohm | Benedikt Koller |
Bernhard Halfinger | Bastian Bäumer | Bernhard Redl | Bernhard Rieder | Bettina Sarg | Bettina Thauerer | Bettina Unterberger |
Birgit Faber | Brigitte Andrä | Cecilia Grundtmann | Christian Ploner | Christian Eller | Christina Mayerl | Christina Weinl | Christine
Bandtlow | Christine Mantinger | Christoph Dohmesen | Cicek Aydemir | Claudia Manzl | Claudia Ram | Claudia Soratroi | Claudia Wöss |
Constanze Nandy | Cornelia Thoeni | Cornelia Wandke | Daniel Bindreither | Denise Tischner | David Teis | Diana Hilber | Dietmar Fuchs
| Dietmar Rieder | Divyavaradhi Varadarajan | Domagoj Cikes | Dorata Garczarczyk | Doris Bratschun | Doris Hinger | Edith Hofer | Elena
Ledjeff | Ernst R. Werner | Evelyn Rabensteiner | Fabio Gsaller | Fatma Dikmen | Florentine Marx | Florian Baumgartner | Florian Bock |
Florian Kern | Florian Schwarze | Florian Überall | Francesca Grespi | Franziska Gobber | Friederike Finsterbusch | Gabriele BaierBitterlich | Gabriele Scheran | Gabriele Stöckl | Gabriele Werner-Felmayer | Georg Golderer | Georg Nikolaidis | Georg Wick | Gerald
Brosch | Gerhard Krumschnabel | Gernot Stocker | Gertrude Huber | Giridhar Shivalingaiah | Günther Böck | Giovanni Almanzar-Reiner |
Glory Ranchez | Hans Grunicke | Heidelinde Jäkel | Hans Grunicke | Heribert Talasz | Helene Heiss | Hermann Krabichler | Hildegard
Wörle | Hubert Hackl | Hubertus Haas | Igea Contarini | Ilenia Bertipaglia | Ilja Vietor | Ilona Lengenfelder | Ines Jaklitsch | Ines Peschel |
Ingo Bauer | Irene Gaggl | Irina Berger | Ivan Prokudin | Jan Mrazek | Jan Wiegers | Jennifer Gebetsberger | Johann Hofmann | Johanna
Gostner | Johanna Sebald | Johannes Rainer | Jonathan Vosper | Julia Scheffler | Julianna Leuenberger | Julien Lelong | Kalina Duszcka
| Kamilla Bakowska-Zywicka | Karin Ecker | Karin Lentsch | Karin Schluifer | Karl Maly | Karoline Hörtnagel | Katharina Fegerl | Katherin
Patsch | Kathrin Gotsch | Kathrin Rossi | Katja Jacob | Katrin Watschinger | Kire Trivodaliev | Konstantinia Skreka | Krista Trappl | Lára
Hannesdottir | Leopold Kremser | Levent Kaya | Linda Teufel | Lisa Kindler-Maly | Ludger Hengst | Lukas A. Huber | Lukas Peintner |
Lukas Sattler | Magan Ansbro | Manuel Kaufmann | Manuel Alonso Y Adell | Manuela Villunger-Gfreiner | Marek Zywicki | Maren Fischer |
Maria Fischer | Maria Goralik-Schramel | Maria-Laura Fluckinger | Mariana Eca Guimaraes de Araujo | Maria Saurer | Marietta Brunner |
Marin Barisic | Mario Gründlinger | Markus Keller | Markus Schrettl | Markus Unterwurzacher | Martin Eisendle | Martin Müller | Martin
Offterdinger | Martin Tribus | Martina Barisic | Martina Brunner | Mathieu Rederstorff | Matthias Erlacher | Mattias Carlsson | Melanie
Amort | Melanie Heymann | Melanie Hofer | Melanie Lukasser | Melanie Ramberger | Michael Blatzer | Michael Keith Kullmann | Michael
Rittinger | Michaela Pfister | Michela Carlet | Mihaela Angelova | Miriam Alber | Monika Hertscher | Muhammad Saeed | Nadine Plank |
Nadja Haas | Natalia Schiefermeier | Nikola Beckmann | Nicole Taub | Nikoletta Hegedüs | Nikos Yannoutsos | Nina Clementi | Nina
Daschil | Nina Madl | Nirmala Parajuli | Norbert Polacek | Oliver Wrulich | Paolo Piatt | Patrick Clemens | Patrizia Nössing | Paul Vögele |
Peter Gröbner | Peter Gruber | Peter Loidl | Petra Daum | Petra Loitzl | Petra Merschak | Petra Mikolcevic | Philipp Stefan Ascher | Pia
Müller | Piotr Tymoszuk | Pornpimol Charoentong | Przemyslaw Filipek | Reinhard Kofler | Reinhard Sigl | Renate Gamper | Rita
Holzknecht | Roland Hutzinger | Rosanna Nagele | Roswitha Sgonc | Rüdiger Schweigreiter | Rudolf Schicho | Ruth Pfeilschifter |
Sabiha Yasmin | Sabine Chwatal | Sabine Weys | Sabine Weiss | Sandra Trojer | Sarah Borrie | Sebak Datta | Sebastian Schröcksnadl |
Shadab Alipour | Siegfried Schwarz | Silvio Podmirseg | Simon Schnaiter | Simone Kreutmayer | Sonja Stenico | Stefan Grässle | Stefan
Steixner | Stefano Morettini | Stephan Geley | Stephan Pabinger | Stephan Sickinger | Susanne Lobenwein | Sylvia Maurer | Tanja
Hertscheg | Taras Stasyk | Ulrike Binder | Valerie Podhraski | Verena Labi | Vinca Ljesic | Wilhelm Sachsenmaier | Winfred Wunderlich |
Wolfgang Doppler | Wolfgang Piendl | Zlatko Trajanoski |
The People
R E P O R T 2008 - 9
www.i-med.ac.at/biocenter
The Biocenter
The way and the goal: The view of the director Why do we need a Biocenter at lnnsbruck Medical University? Why do we want central resources and why is it better to share
technology and supporting facilities? How does it relate to the ten individual institutes that founded the Biocenter? These are the kind
of questions that we have been asked since we started the Biocenter in January 2005 and these are some answers:
The Biocenter is a Department where Innsbruck Medical University has put together scientists with different expertises, working with
different genetic model organisms or biochemical systems but with the common goal to contribute as much as possible to a
molecular understanding of diseases. Innsbruck has a unique campus structure where the research institutes of both Universities are
centered around the University hospital. This fosters medically relevant research and provides the grounds for developing
personalized medicine in Innsbruck. The Biocenter is also the nucleation point and main contributor of such recently established
strategies such as the special research project SFB021 "Cell Proliferation and Cell Death in Tumors", the international graduate
program in "Molecular Cell Biology and Oncology" (MCBO) or the "k1*" Competence Center for Personalized Medicine, ONCOlYROL.
In the Iast seven years, the Biocenter has become a visible Iandmark within biomedical research in Austria and was also
internationally recognized, as can be seen by the successful participation in and the coordination of several large EU projects (e.g.
GROWTHSTOP) as well as nationally funded research consortia (e.g. Austrian Proteomics Platform, non-coding RNA Platform, GENAU). The Biocenter is proud of its talented young scientists. Besides many research prizes our scientists received, the Biocenter
harbors four winners of the START prize, i.e. Alexardra Lusser, Norbert PoIacek, Andreas Villunger, and David Teis, which is the most
prestigious distinction for young scientists in Austria. An important step towards achieving these goals was the transition into a center structure with sharing of facilities and resources.
Momentum was gained by common activities such as retreats, the Biocenter seminar series for postdocs and students and the
yearly Biocenter party. We have embarked on a stony but also rewarding way, however, we have not reached our goal yet. The next
major building block for a competitive research structure in Innsbruck will be the new life science building at the river site, which is
very close to the University of Innsbruck and the University hospital. Together with chemists and pharmacists of the University, the
Biocenter will contribute to this largest Iife science cluster in the western part of Austria. This is a historical chance for Innsbruck to
further foster our coIlaborations and to take the utmost advantage of the campus structure in order to make another important step
towards our goal, i.e. international visibility. The progress the Biocenter has made in the last 6 years is documented in this report and
is testament to the commitment of many peopIe connected with us. lt's the peopIe who make the dilference in science and therefore
I would like to express my sincere gratitude to all the enthusiastic and hard working scientists, technicians, administrative and
supporting staff, without them the Biocenter and I would not be here.
Finally, I would like to mention that we have succeeded to acquire a new Division in our Departement,
i.e. the Division of Bioinformatics. Zlatko Trajanoski, former professor of Bioinformatics at the Technical
University of Graz, was recently appointed to lead this Division. Welcome, Zlatko, in our team!
Lukas A. Huber
We all hope that you enjoy the reading!
Director [email protected]
07
Facts
The Biocenter
The BIOCENTER engages alltogether
215 collaborators 135 of which being scientific and 80 general collaborators
129 of which being financed by the regular university budget and 86 by
scientific grants (= 40% by external funding)
among the scientific collaborators are 7 full professors
25 associate professors
103 graduate students, post docs and technicians
External funding 2006
2007
2008
2009
FWF, EU, GEN-AU
Others
3,3
1,1
3,5
1,8
3,9
2,4
4,4
1,9
Mio Euro
Mio Euro
Total 4,4
5,3
6,3
6,3
Mio Euro
Since the founding of the BIOCENTER, several hundred diploma and doctoral theses by
students enrolled in the PhD and MD programmes of the University of Innsbruck and
the Innsbruck Medical University have been successfully elaborated.
Public & private support
BIOCENTER SEMINARS
Every Friday afternoon, one of our postdocs or Ph.D. students gives a lecture of her/his
recent scientific achievements.
Therafter, HAPPY HOUR is on, which is an important relaxation after a hard „working“
week as well as for the establishment of possible scientific cooperations.
Basic research
INNSBRUCK MEDICAL UNIVERSITY MENTORING PROGRAMME FOR WOMEN IN
SCIENCE
An „established“ person accompanies a young female scientist through her career in
academia until she reaches her specific goal. In case of obstacles and difficulities, the
mentor is trying to find solutions for her mentée. Christine Bandtlow, Roswitha GruberSgonc, Gabriele Werner-Felmayer of the Biocenter are appointed mentors.
http://www.imed.ac.at/gleichstellung/mentoring/mentorinnen.html
ETHICS & MISCONDUCT IN BIOMEDICINE, A seminar given by Gabriele WernerFelmayer of the Biocenter
Publications
Patents
Spin-offs
www.i-med.ac.at/imcbc/molecularcellbiologyfolder/aushaenge/Aushang_Bioethik_SS_08.pdf
08
GOOD SCIENTIFIC PRACTICE
Christine BANDTLOW of the Biocenter has recently been appointed to act as member
of the newly founded commission on the establishment and supervision of Good
Scientific Practice at the Medical University of Innsbruck
http://www.i-med.ac.at/qm/gsp
http://www.i-med.ac.at/mypoint/news/2008120901.xml
Publications 2002 - 06 Impact factors
Biocenter
2168
citations
8227
The Biocenter
Divisions & Groups
Division of Bioinformatics
Zlatko TRAJANOSKI
Division of Biological Chemistry
.
.
.
.
Christine BANDTLOW (interim)
Dietmar FUCHS
Ernst WERNER
Gabriele WERNER-FELMAYR
Georg GOLDERER
Division of Cell Biology
.
Signal Transduction & Proteomics
.
Cell Differentiation
.
Gene Regulation & Molecular Immunology
.
Membrane Traffic & Signalling Lukas A. HUBER
Lukas A. HUBER
Ilja VIETOR
Nikos YANNOUTSOS
David TEIS Division of Clinical Biochemistry
.
Protein Analysis
Ludger HENGST (interim)
Herbert LINDNER
Division of Developmental Immunology
.
Apoptosis & Tumor Biology
.
Immunoendocrinology
Andreas VILLUNGER
Andreas VILLUNGER
Jan WIEGERS
Division of Exper. Pathophysiology & Immunology
.
Experimental Rheumatology .
Biophysics/Biooptics
.
Molecular Endocrinology
Lukas A. HUBER (interim)
Roswitha SGONC
Günther BÖCK
Siegfried SCHWARZ
Division of Genomics and RNomics .
Experimental RNomics
.
Ribonucleoprotein complexes Alexander HÜTTENHOFER
Alexander HÜTTENHOFER
Norbert POLACEK
Division of Medical Biochemistry
.
Cell Cycle and Cell proliferation .
Signal Transduction in Mammary Gland
.
Biochemical Pharmacology
.
Ribosomal Proteins and RNA .
Nutritional Biochemistry
Ludger HENGST
Ludger HENGST
Wolfgang DOPPLER
Johann HOFMANN
Wolfgang PIENDL
Florian ÜBERALL Division of Molecular Biology
.
Chromatin and Epigenetics
.
Molecular Microbiology
.
Applied Mycology
.
Lipocalins Peter LOIDL
Peter LOIDL Gerald BROSCH
Stefan GRÄSSLE
Alexandra LUSSER
Hubertus HAAS
Florentine MARX
Bernhard REDL
Division of Molecular Pathophysiology
.
Leukemia – Apoptosis
.
Molecular Oncology
.
Cell Cycle Control
.
Applied Bioinformatics
Reinhard KOFLER
Reinhard KOFLER
Arno HELMBERG
Stephan GELEY
Johannes RAINER
Division of Neurobiochemistry
.
Neurobiochemistry
.
Neurotoxicity
.
Biooptics Christine BANDTLOW
Christine BANDTLOW
Gabriele BAIER-BITTERLICH
Martin OFFTERDINGER
09
The Biocenter
Support & Collaborations
10
Institute for Biomedical Aging Research
Austrian Academy of Sciences
The Biocenter
Spezialforschungsbereich SFB021
http://www.sfb021.at/
MEMBERS
Baccarini Manuela
Baier Gottfried
Bonn Günther
Fässler Reinhard
Geley Stephan
Greil Richard
Hengst Ludger
Huber Lukas A. (Coordinator)
Kofler Reinhard
Villunger Andreas
Associated Members
Gastl Guenther
Schneider Rainer
Young Investigator Program
Fiegl Heidelinde
Rainer Johannes
Teis David
Wolf Dominik
Former Members
Doppler Wolfgang
Jansen-Dürr Pidder
Klocker Helmut
Tinhofer Inge
Überall Florian
Members from the Biocenter
Geley Stephan, A.Univ.-Prof. Dr.:
Hengst Ludger, Univ.-Prof. Dr.:
Huber Lukas A., Univ.-Prof. Dr.:
Kofler Reinhard, Univ.-Prof. Dr.:
Villunger Andreas, Prof. Dr.:
Cell Biology, Cancer Research (Division of Pathophysiology)
Cell Biology, Cancer Research, Medical Biochemistry (Division of Medical Biochemistry)
Cell Biology (Division of Cell Biology)
Molecular Oncology (Division of Molecular Pathology)
Cellular Immunology, Tumor Biology, Apoptosis (Division of Developmental Immunology)
Associated Members
Gastl Guenther, Univ.-Prof. Dr.:
Tumor Profiling (Division of Haematology and Oncology, Department of Internal Medicine)
Schneider Rainer, A.Univ.-Prof. Dr.: Biochemistry (Department of Biochemistry, University of Innsbruck)
Young Investigator Program (supported by Tiroler Zukunftsstiftung and Medical University Innsbruck)
Rainer Johannes, Dr:
Teis David, Dr.: Bioinformatics, Cancer Research (Division Molecular Pathophyisiology)
Membrane traffic and signaling (Division of Cell Biology)
For a detailed description of the various research topics, see the respective individual pages of the SFB members later in this brochure! The major goals of the SFB021 are to understand molecular pathways that link signals leading either to cell death/survival or to cell proliferation/cell cycle arrest in tumors. The
SFB021 also aims to better understand, why the immune system apparently fails to eliminate tumor cells focusing on the established pathways regulating T cell activation
thresholds. In continuation of the work during the first funding period (2003-2007) SFB021 scientists propose the coordinated use of biochemical and genetic as well as
proteomic/transcriptomic approaches to delineate changes in cellular pathways that occur in several types of tumors, namely epithelial tumors (breast cancer, liver, skin), chronic
myeloic leukemia (CML) or tumors of lymphatic origin (acute lymphatic leukemia (ALL) and multiple myeloma). In addition, for the second funding period (2008-2010) they have
now extended their experimental approaches towards antigen receptor signal processing machinery in T cells during immunesurveillance in tumors, adhesion signaling in tumor
cells, as well as posttranslational modifications of the Cdk inhibitor p27Kip1. 11
The Biocenter
Dietmar Fuchs and Ernst Werner of the division of Biological Chemistry are founding
and steering members of the International Neopterin Network
They organize since many years the annual Winter Workshop on Clinical, Chemical and
Biochemical Aspects of Pteridines in St. Christoph/Arlberg/Austria
www.neopterin.net
Andreas Villunger of the Division of Developmental Immunology of the Biocenter is
integrated into ApopTrain
a Transeuropean Network of Apoptosis research laboratories
Lukas A. Huber of the Division of Cell Biology of the Biocenter is coordinator of the EUFP6 (Framework Program 6) research project entitled
GrowthStop Network
which started in October 2006. The topics and goals are: IDENTIFICATION,
DEVELOPMENT AND VALIDATION OF NOVEL THERAPEUTICS TARGETING
PROGRAMMED CELL DEATH IN TUMORS. A total of 12 international partners from different EU countries together with Israel are
participating in this four year project. CEMIT is supporting the project coordinator and
project partners in administrative aspects.
www.cemit.at
www.cemit.at/
Georg Wick, professor emeritus of the Division of Experimental Pathophysiology and
Immunology is – together with Mathias Mass of the Salzburg University Clinics coordinator of 12
ECIBUG – European Inititative to fight Chlamydial Infecbiased Genomics
tions with Unb
This rersearch network is also part of the Austrian GEN-AU program (see next page!).
www.gen-au.at
The Biocenter
www.proteomics.or.at/
Lukas A. Huber is also coordinator of the
Austrian Proteomics Platform.
Proteomics is one of the greatest challenges in basic science of our age, where the
human genome has already been sequenced. Besides DNA as cellular carrier of information, proteins are importan cellular tools that are involved in the generation of diseases. It is therefore a great challenge in lifes sciences to decipher
besides the genome also the proteome, i.e. the entirety of proteins (gene products) of a particular cell (type) or tissue in a particular state (of development, activity) = function. While the genome
is static, the proteome is dynamic, as it constantly changes in response to challenges impinging on the cell. The proteome includes expression profiles of gene products, but also the
posttranslational processing events of proteins. These, however, can only be investigated on the proteins themselves. The proteome reflects thus the state of a cell, tissue, organism, normal as
well as pathological.
The Austrian Proteomics Platform was founded as a network of 5 Austrian basic scientists, working at the Universities and Medical Universities of Vienna, Graz, Innsbruck, the Veterinary
University of Vienna and the Institute of Molecular Pathology (IMP) Vienna. These Partners have submitted individual projects, yet exchange among themselves ressources, technologies and
experience in order to establish a broad proteinomics platform. The individual researchers focus in particular on those biological as well as technological questions, where they have already
expertise and from which they can expect to achieve internationally a scientific advantage.
In the first phase, the following activities are undertaken:
° Establishing a state-of-tha-art infrastructure for proteomics work
° Technological development with view to funtional proteomics, i.e. for the elucidation of cellular functions of proteins, such as protein-ligand interaction, postttranslational modifications etc.
° Development of new protocols and new stationary phases for prottein and peptide separation work
° Development of Bioinformatics for more thorough data evaluation
° Education of highly qualified scientists
GEN-AU Meeting
in Seefeld, January
2009 Former Federal Minister of
Science Johannes
Hahn together with
Nobel
Laureate
Prof. Robert Huber
and the organizers,
Günther Bonn, Lukas Huber, Peter
Öfner, and Giulio
Superti-Furga
Two members of the Biocenter are also members of the
Austrian RNomics Platform
Andrea Barta, Vienna
Ivo Hofacker, Vienna
Alexander Hüttenhofer, Innsbruck
Javier Martinez, Vienna
Ronald Micura, Innsbruck
Norbert Polacek, Innsbruck
Renee Schroeder, Vienna
and are involved in a concerted research action on the study of noncoding (nc)RNAs in
several organisms. ncRNAs are newly discovered RNA species which exert a profound
regulatory role on gene expression and - in altered state - are thought to be responsible
for various human diseases.
http://www.cemit.at/folgeseite.cfm?id=187
http://www.gen-au.at/projekt.jsp?projektId=60&lang=de
www.gen-au.at
13
www.cemit.at/
http://www.oncotyrol.at/
In building Innrain 66, ONCOTYROL estab-lishes
research laboroatories copyright CEMIT GmbH
Oncotyrol – Center for Personalized Cancer Medicine – is an international partnership between academia and industry, set
up to accelerate the development and evaluation of individualized cancer therapies, together with diagnostic, prognostic
and preventive tools. Oncotyrol was established in 2008 as part of the structural program COMET which is an initiative of
several Austrian Federal Government Ministries and is funded by national and regional resources, approximately 50% each.
The main scientific contribution comes from the three Tyrolean universities – the Innsbruck Medical University, the Leopold
Franzens University Innsbruck as well as the Private University for Health and Life Sciences UMIT in Hall. They work
together with international universities such as the Harvard Medical School and the LMU (Ludwig Maximilian‘s University) in
Munich. In total, Oncotyrol comprises 21 academic workgroups. On the industrial side, 18 small- end medium sized
enterprises are involved as well as 10 internationally positioned companies, such as Roche, Novartis, Amgen, Fresenius,
Schering-Plough, and Janssen-Cilag. Oncotyrol is the product of a continuous strategic development to establish Innsbruck as a top location for cancer research.
The first step in this direction was the approval of the Special Research Program SFB021 „Cell Proliferation and Cell Death
in Tumors“ in 2003. It combined and strengthened the local resources in basic oncology research. In 2005, the international
graduate program for „Molecular Cell Biology and Oncology“ (M
MCBO) was established, also the industrial competence
center of Medicine (K
KMT) in Innsbruck was positively evaluated and so went into its second phase. Further important steps
in this build-up phase were the coordination of national and international cooperative research projects by members of the
SFB021. Among these were the Austrian Proteomics Platform, part of the Austrian Genome Program GEN-AU, which is
now in its third term, and the European Network GROWTHSTOP. 2005 was also the year in which the Biocenter was
founded and, one year later, the First Clinical Trial Center in Austria was established at the Medical University. Fueled by the
SFB and the basic research done in the Biocenter, Innsbruck had become a well recognized and internationally visible
cancer research center, which was accompanied by excellent clinical oncological experience and a close network of local
life science enterprises.
At this time, the oncology research community realized that many of their scientific projects had matured and left the realm
of basic research. However, they were not advanced enough to be brought to market or sold to industry. A gap had opened
up, i.e. the lack of funding for applied cancer research. At the same time it became clear that cancer medicine was heading
more and more towards personalized approaches. This was the birth of Oncotyrol as an incubator structure for applied and
personalized cancer research. Oncotyrol fills now the gap between basic research and commercial development and it
involves the collaboration of clinics, basic research groups, local enterprises and international companies. 14
| Contakt: ONCOTYROL | Center for Personalized Cancer Medicine GmbH | Karl-Kapferer-Straße 5 / 3rd floor | 6020 Innsbruck | Austria | | Tel. +43.512.576523- 0 | Fax. +43.512.576523- 303 | Email: [email protected] | www.oncotyrol.at | Lukas Huber (left) is the CSO of Oncotyrol, Bernhard Hofer (right) is CEO.
Area 1
Area 2
Area 3
Area 4
Area 5
Mechanisms controlling
tumor growth and antitumor immunity
Bioanalytics and
diagnostics
Biomarker-guided cancer
diagnosis, therapy and
prevention
Bioinformatics and
systems biology
Gottfried Baier, i-med
Helmut Klocker, i-med
Günther Gastl,
i-med
Decision-analytic
outcome modeling,
Health Technology
Assessment (HTA)
and health economics
Uwe Siebert, UMIT
Metabolite analysis
D. Sonntag, Biocrates Life
Sciences AG
New markers for prostate
cancer
H.Klocker, i-med
Methodological
framework for early HTA
U. Siebert, UMIT
Knowledge management
S. Losko, Biomax
Informatics AG
Biobanking
MAP kinase scaffold
inhibitors
L. Huber, Biocenter
Gas analysis of VOCs
S. Praun, V&F medical
development GmbH
Breast cancer –
metastasis risk
C. Marth, H. Fiegl, i-med
Austrian myeloma register
G. Gastl, i-med
Methods for analysis of
metabolomic data
B. Haas, Biocrates Life
Sciences AG
Sequencing & genotyping
F. Kronenberg, i-med
Cell therapy unit
N. Romani, i-med
M. Thurnher, i-med
Glucocorticoid-responsive
transcriptome I
R. Kofler, Biocenter
Androgen receptor
targeting for prostate
cancer I. Eder, i-med
Outcome & policy model
for prostate cancer
U. Siebert, UMIT
Glucocorticoid-responsive
transcriptome II
R. Kofler, Biocenter
General management
IAP antagonists
M. Außerlechner, i-med,
H. Stuppner, LFU
Prostate cancer
prevention
H. Klocker, i-med
Evaluation of EpCAM
expression
G. Spizzo, i-med
Outcome & policy model
for breast cancer
U. Siebert, UMIT
Targeting RAF/BAG-1
interaction
J. Troppmair, i-med
Breath gas analysis for
breast cancer diagnosis
I.Kohl, Ionimed Analytik
GmbH
Angiogenesis biomarkers
Outcome & Policy Model
for Rheumatoid Arthritis
U. Siebert, UMIT
Cbl-b targeting Concept G. Baier, i-med
E. Gunsilius, i-med
Integration of health
system data and
exchange
T. Schabetsberger, UMIT
Core Facilities
Zlatko Trajanoski,
Biocenter
G. Daxenbichler, i-med
CEMIT GmbH
This table shows the alltogether 24 research projects in
Oncotyrol, a fraction of which being led by Biocenter
scientist. Two examples are described in more detail on
the following page.
| Abbreviations: | Cbl: Cbl oncogene | MAP: mitogen activated protein kinase | IAP: inhibitor of apoptosis proteins | RAF: Raf oncogene | VOC: Volatile Organic Carbon |
| EpCAM: eptithelial cell adhesion molecule | HTA Health assessement technology | i-med: Medizinische Universität Innsbruck | LFU: Leopold Franzens Universität Innsbruck |
UMIT: Private Health and Life Sciences University, Hall | 15
Screening for scaffold-specific MAP-Kinase inhibitors/modulators
Mitogen-activated kinase (MAPK) signaling is a complex cascade/network of signals
induced by different extra- or intracellular factors. The response of cells upon activation
of MAPK signaling varies from cell proliferation, differentiation, cell migration to
apoptosis. Aberrant or overactivation of MAPK signaling is observed in 30% of all
human cancers and other diseases like aberrant inflammatory reactions. The different
members of the MAPK signaling pathway are therefore interesting targets for drug
development. Previous work on signal transduction inhibition, performed in SFB021 projects and in
the EU FP6 consortium GROWTHSTOP, has shown that the p14/MP1 scaffold is
essential for differentiation and cell cycle progression and therefore represents an
attractive target for kinase inhibition. The target has been validated by mouse knock-out
models and the crystal structure of the p14/MP1 complex has been solved (see
picture!). Targeting p14/MP1 opens up the possibility of selective modulation rather than
inhibition of total MAPK activity. In Oncotyrol, we are pursuing this innovative approach
by screening for scaffold-specific MAP kinase inhibitors/modulators. Our Partner in
Oncotyrol is Vichem Chemie Research Ltd., a Hungarian biotech research company
focusing on signal transduction therapy with kinase inhibitors (http://www.vichem.hu/). We have set up a powerful in-cell assay system to identify small molecular weight
compounds, which are able to specifically modulate the MAPK activation kinetics. With
this assay, two groups of compounds were screened. One group was selected by 3D
pharmacophore modeling into the putative MP1-MEK binding grooveidentified in the
p14/MP1 crystal. The other group consisted of a kinase inhibitor library established by
our partner ViChem. Thus far, 19 substances were selected, most of which displaying
an effect on proliferation (in MAPK-dependent cell lines), viability (in multiple myeloma
cell lines) and/or migration.
16
Collaborators: György Keri (Vichem),
Winfried Wunderlich,
Simon Schnaiter, Beatrix Fürst, Lukas A. Huber
Defining the glucocorticoid-responsive transcriptome by advanced
expression profiling
Glucococorticoids (GCs) belong to the most frequently prescribed drugs worldwide, and
understanding the molecular mechanism of their action has major medical implications.
Most of the GC effects are mediated through the GC receptor (GR, NR3C1), a member
of the nuclear transcription factor family that upon agonist binding translocates to the
nucleus and thus alters part of the cell‘s gene expression profile. With the advent of
microarray technology it has now become possible to systematically study the effects of
GCs on the transcriptome on a whole genome level in various clinical and experimental
systems. Our laboratory has been focussing on the molecular basis of anti-leukemic
effects (induction of apoptosis and cell cycle arrest) of GC in lymphoid malignancies for
the last 15 years. Most GC effects result from gene regulation via the GR. In order to
study this, we have built up a long standing experience in gene expression profiling. We
also operate the Affymetrix Gene Expression Profilinig Unit of the Medical University of
Innsbruck.
In our Oncotyrol project we have introduced recent developments in the gene expression field
including exon array technology for the detection of alternative transcripts, Promoter tiling arrays
(ChIP-on-CHIP) for transcription factor binding site detection and microRNA screening. Since up to
30% of transcriptional regulatory effects are not reflected in changes in the corresponding protein
levels, we have established wet lab procedures for isolation of polysome-bond mRNAs
(“translatome analyses”). Finally, we perform functional analysis (lentiviral mediated conditional gene
over-expression and gene knock-down by RNAi) to study the possible role of the identified GCregulated genes and alternative transcripts. Altogether, these technologies will help us to better
understand the transcriptional response triggered by GC in malignant and non-malignant lymphoid
cells. In the second part of the project we are working together with our partner company
Genomatix Software GmbH, Munich (http://www.genomatix.de/index.html), to develop the
necessary bioinformatics tools with which we can delineate the transcriptional response to GC in
the various biological systems investigated in the wet lab part of our project.
Collaborators: Reinhard Kofler, Alexander Trockenbacher,
Johannes Reiner, Anita Kofler, Klaus May (Genomatix)
The Biocenter
MCBO Science Day 2010
MCBO Science Day, Poster Discussion, Awards, Party, March 5, 2010
Doctoral College in Molecular Cell Biology and Oncology
PROGRAM
MCBO is a highly competitive PhD program, financed by the Austrian
Science Fund and run by leading scientists of the doctoral programs in
Molecular Cell Biology and Molecular Oncology at the Innsbruck Medical
University.
AIM
MCBO aims to attract promising young scientists from Austria and across
the world and provide them with a comprehensive and challenging
research training that will enable them to develop into tomorrow's leaders
in biological research.
SUBJECT
MCBO combines the use of state-of-the-art molecular and cellular
approaches to address important basic and clinical scientific problems.
Our research emphasis is in the cellular signaling mechanisms controlling
normal cellular functions and their aberrations in human diseases.
RESEARCH AREAS & PARTICIPANTS
• Ion channels and membrane receptors
• Cytoplasmic signal transduction and effectors
• Nuclear receptors and transcriptional regulation
Flucher, Gastl, Grabner , Striessnig, Baier, Geley, Hengst, Huber, Troppmair, Villunger, Culig, Doppler, Klocker, Kofler
http://www.mcbo.at/
17
The Biocenter
The new Biocenter
Site visit at the new Biocenter Builiding Innrain 80-82 on March 4, 2010
18
The Biocenter
The new Biocenter
Visitation of the building by the Austrian Federal Minister for Science and Research,
Dr.Beatrix Karl
May 27, 2010
First row: Rector Karlheinz Töchterle, Leopold Franzens-University, Rector Herbert
Lochs, Medical Univeristy of Innsburck, Herwig van Staa, President of the Country
Counsil of Tyrol, Minister Beatrix Karl
Second row: as above, Wolfgang Gleissner, Director of the BIG (Bundesimmobilien
Gesellschaft), Vice Rector for Infrastructure, Arnold Klotz
19
Third row: Minister Beatrix Karl + Rector Töchterle, Rector Lochs, Van Staa + Rector
Lochs
Director of the Biocenter Lukas A. Huber, people of the building company BODNER
praising the builder and owner of the building, Joerg Striessnig and the
photographer and designer of this brochure, Siegfried Schwarz
The Biocenter
Open to the Public
Members of the Biocenter show young pupils experiments and other aspects of their scientific work. This activity should attract more people to science and a scientific career
20
The Biocenter
Wachter Foundation
Professor Mag. Dr.DDr. H.c. Helmut Wachter, born 1929 in Landeck, studied pharmacy at the University of Innsbruck. After graduation, he
studied medicine and later joined as Assistant Professor the Institute of Medical Chemistry. There, he became Associate Professor and
installed a very productive research group. The focus of this group was the investigation of an until then barely recognized group of small
molecules, i.e. the pteridines. 1971 – 1972, Professor Wachter was appointed Visiting Professor at the Westminster Medical School,
University of London, in 1974, he became Full Professor of Medical Chemistry at the University of Innsbruck. In 1986, he founded the
Ludwig Boltzmann-Institute for AIDS Research at the University of Innsbruck. In 1987, he received a Honorary Degree (Dr. h.c.) in Natural
Sciences by the University of Aston in Birmingham, with more honorations to follow: Austrian First Class Honorary Cross for Science and
Arts (1988), the Fritz-Pregl-Medal of the Austrian Society of Analytical Chemistry (1992), Honorary membership of the Austrian Society for
Clinical Chemistry (1992), Honorary Decoration of Tyrol (1996), Honorary membership of the International Society for Pteridinology (1998),
whose elected president he was until 1992. In 1997, Professor Wachter retired as Professor Emeritus of Analytic Medical Chemistry. In 1994, Helmut Wachter together with his wife Ilse Wachter donated a foundation to the University of Innsbruck, the ILSE & HELMUT WACHTER-STIFTUNG
(http://www.wachterstiftung.org). It is devoted to further medical science for the welfare of mankind and to raise the reputation of the Medical University of
Innsbruck. This goal shall be accomplished by granting a scientific award. The prize is 15.000 Euro and will be given to international scientists of highest
reputation, being nominated by peers and colleagues (self-application not possible). Thus far, five awards have been given: Professors Avram Hershko and Aaron Ciechanover, Technion-Israel Institute of Technology, Haifa, for their discovery of
the ubiquitin system (1999) [who received in 2004 also the Nobel prize]; Professor Hanns Möhler, University of Zurich, for his elucidation of the anxiolytic
properties of benzodiazepine drugs (2001); Professor Wolfgang P. Baumeister, Max Planck-Institute of Biochemistry, Martinsried, for his elucidation of the
structure of the proteasome (2003); Professor Cynthia J. Kenyon, University of California, San Francisco, for her ground-breaking work on the regulation of
aging mechanisms in C. elegans (2005); Professor Irving L. Weissman, Stanford University, California, for his life-long work on the differentiation of lymphoid
cells as well as on stem cells and their medical use (2007). [portraits of the awardees on the bottom of this page, from left to right] Nine experts of the Medicial University of Innsbruck form a committee for selecting one of the nominated persons. The board of the foundation‘s directors then
bestows the prize to the awardee. The board of directors consists of 2 professors of the Medical University of Innsbruck, i.e. Professor Peter Fritsch and Prof.
Dietmar Fuchs, and Dr. Helmut Fröhlich, retired CEO of the Hypobank Tirol. Since 2009, Prof.. Lukas Huber followed Prof. Fritsch (lower left picture:to the right)
as chairman of this board.
21
Awards
The Biocenter
Andreas Villunger
Division of
Developmental
Immunology
2003 - 2009
Alexandra Lusser
Division of Molecular
Biology
2005 – 2011
Norbert Polacek
Division of Genomics
and RNomics
2006 – 2012
David Teis
Division of Cell Biology
2009 - 2015
22
David Teis with Johannes
Hahn, Federal Minister of
Science
Start Prize
The Biocenter
The START-Prize has been founded in 1996 by the then Federal Minister of Science Rudolf Scholten. It is announced every year. Applicants must be under 35 years and are
selected by an international jury of renowned scientists. Successful applicants are supported for up to 6 years. Therefore, the START prize represents that award of the FWF that
is of highest national reputation. Also, it is the highest amount of support (i.e. 1.200.000 Euro) in Austria that can be given to single awardee. The most important idea behind this
prize is to give young and highly qualified scientists the financial basis to persue a long-term research project independent from their university supervisors. It is mostly young
scientist who worked successfully as post-doctoral fellows abroad and who plan to return to their home universities. Often, the situation at home is difficult in terms of a secured
career perspective which may hinder their return and which would mean a brain drain to Austrian universities. Until now, the START Prize has been awarded 76 times (see some of
the portraits of awardees on the previous page). It is a great pleasure to mention that 11 of 76 awardees belong the Innsbruck Universities and 4 of these 11 to our institution.
Only 7 of 76 awardees were women, however 1 of these 4 Biocenter awardees is a women. A list of awardees can be found under http://www.start-portal.at/die-starter/liste.html.
Andreas Villunger, born 1967 in Innsbruck, studied Biology at the University of Salzburg, later Microbiology and Biochemistry in Innsbruck. He graduated in
1996 with a thesis on "Interleukin-6 regulated cell death and survival in multiple myeloma" at the local Department for Internal Medicine. Programmed cell
death, often also called apoptosis, started to receive major scientific attention in the late 1980ies, but „exploded“ shortly thereafter. This field of research was
also awarded the Nobel Prize in Physiology and Medicine in 2002. After a first Postdoc at the Institute of Medical Chemistry in Innsbruck, working on Protein
Kinase C family proteins, Andreas left for Melbourne, Australia, in 1998. There, he worked as a postdoctoral fellow in the laboratory of Professsor Andreas
Strasser at the prestigeous Walter & Eliza Hall Institute for Medical Research and investigated the role of death receptors and the Bcl2 family in lymphocyte
homeostasis. After four years he returned to Innsbruck and joined the Institute of Pathophysiology. His research proposal on "BH3-only protein function in
cell death and disease" was awarded the START-Prize in 2003 and allowed him to establish an independent research group. He was appointed Associate
Professor in Immunology in 2007 and became 2009 Full Professor of Developmental Immunology in 2009. Currently he is heading a research team of about
a dozen people, working in the apoptosis-related fields of lymphocytes development and lymphomagenesis, the DNA-damage response as well as certain
aspects of autoimmunity. Alexandra Lusser, born 1970 in Lienz, studied Microbiology at the University of Innsbruck. Results from her doctoral thesis under the supervision of Peter
Loidl were already published in Science! From 2001 till 2004, Alexandra worked as post-doc with James T. Kadonaga in the Section of Molecular Biology at
the University of California in San Diego. Returned to Innsbruck, she became Associate Professor. Alexandra is interested in elucidating the mechanisms that
govern chromatin dynamics, a field that gained great momentum 10 years ago. In San Diego, Alexandra discovered an ATP-dependent enzyme which is
required for a dsDNA to get wrapped around histone proteins. This process allows not only a shortening and compaction of DNA but also a dynamic
mechanism of regulating gene expression. Mutations in such chromatin-modifying enzymes and proteins can have serious clinical consequences such as
increased susceptibility to cancer and other diseases (e.g. ATRX syndrome, OMIM: 301040, 300032, CHARGE syndrome, 214800). Alexandra and her
research team found that the chromatin remodeling factor CHD1 is one of two proteins currently known, which are critically required for chromatin assembly
and disassembly. They have found that without this factor, fertilization is not possible, since CHD1 is necessary for the reorganization of the chromatin of the
sperm nucleus prior to the fusion with the oocyte nucleus. Currently, her group is investigating potential functions of CHD1 during transcription and DNA
replication.
23
Start Prize
The Biocenter
Norbert Polacek, born 1970 in Vienna, studied Biology and Genetics at the University of Vienna. He graduated in 2000 with a thesis under Andrea Barta
describing changes in structure of rRNA during translation. Later he went as post-doc to Knud Nierhaus at the Max-Planck Institute of Molecular
Genetics in Berlin, thereafter to Alexander S. Mankin at the Center for Pharmaceutical Biotechnology, University of Illinois at Chicago. There, Norbert
continued his work on the catalytic properties of rRNA. In 2003, he returned to Austria and joined Alexander Hüttenhofer, director of the Division of
Genomics & RNomics at the Biocenter. In 2005, Norbert became Associate Professor and in 2006, he received the START Prize. In recent years, noncoding RNAs (ncRNAs) gained enormous increase in scientific interest. NcRNAs are not to be translated into proteins. Instead, they realize their cellular
actions as RNAs. A special class of ncRNAs are ribozymes, i.e. catalytically active RNAs. The larges ribozyme resides in the ribosome and acts there
during translation. A number of antibiotic drugs interefere with ribosomes, thus inhibit translation and thereby hinder the survival of bacteria. The work of
Norbert and others clearly underlines that ribozymes were not only the earliest enzymes in evolution but still „at its end“ act as such during translation. In
particular, it is the 23S rRNA that is in Norbert’s focus. In its peptidyl transfer center, Norbert is trying to manipulate certain groups, even atoms of certain
nucleosides in order to understand the functioning of this center (kind of a systematic atomic mutagenesis). It is of particular interest to Norbert how the
elongated peptide chain is moved forward for one unit, out of the catalytic center, into which the next unit moves. It is logical that Norbert’s group
investigates also the details of the elongation factor EF-G (EFG1, 606639), which induces the translocation of the tRNAs. On an even larger scale,
Norbert tries to understand the architecture of a whole ribosome. Another topic of Norbert’s interest are so called vault-RNAs (612695), still quite
enigmatic components of a cell. Possibly, they are involved in drug resistance.
24
David Teis, born 1975 in Graz, studied Microbiology at the University of Graz. For his PhDthesis David joined the international PhD-Program at the
renowned Institute of Molecular Pathology (IMP) in Vienna. After graduating in 2002, Davidmoved with Lukas Huber to the Division of Cell Biology at the
University of Innsbruck, now Medical University of Innsbruck. In 2005, David – with an EMBO and a Human Frontier Science (HFSP) long-term
fellowship in his pocket - moved as a post-doc to Scott D. Emr, University of California, San Diego, later Cornell University, New York. In 2009 David
returned to the Biocenter andreceived the START prize. Here, as SFB021 Junior Investigator, he establishedan independent researchgroup in the
Division of Cell Biology. The main focus of his teamare the molecular mechansimsused by cellstoadapt to their environmental. In particular, he is
interested how membrane transport and signaling are coordinated. During adaptation,thedegradationof surface receptors represents a
majorregulatorymechanism.Receptor degradation requires ubiquitination of the receptor,endocytic internalization and subsequent sorting reactionsthat
will deliver the ubiquitinated receptors into the lumen of the lysosome. The key step during this process is catalyzed by the endosomal sorting complexes
required for transport (ESCRT). This machinery, whichs binds directly to the ubiquitined transmembrane proteins and packages them in so called MVB
vesicles for the delivery into lysosomes. Thus, theESCRT machinery contributes essentially to the development of multicellular organsims andmutations
cause cancer and neurodegneration.Moreover certain viruses (e.h. HIV) use ESCRT proteins for their own propagation. David’s major interest now is to
understandthemechanisms which regulate theESCRT machinery.
Awards
BRANDL-Award 20. 5. 2008 to Dr. Martin
Eisendle, Div. Molecular Biology, and Dipl.Ing. Nicole Taub, Div. Cell Biology, http://
www.i-med.ac.at/mypoint/news/
2008052101.xml The Biocenter
SANOFI-Award 4.12. 2008 to
Mag. Verena Labi, Div. Develop.
Immunology (Lukas A. Huber),
http://www.i-med.ac.at/mypoint/
news/2008120501.xml
MCBO (Molecular Cell Biology &
Oncology Program) Doctoral Awards
23.1.2008 to Francesa Grespi, Div.
Dev. Immunol., Marin Barisic, Michela
Carlet, both Div. Molecular Pathophysiol.,
http://www.i-med.ac.at/
mypoint/ news/2008 012301.xml
"A
Award of Excellence“ of the Ministry of
Science given on 20.11.2008 to Dr.
Nicole Taub. http://www.i-med.ac.at/
mypoint/news/ 2008121901.xml
Erwin-Schrödinger-Prize 2008 for his Life Contribution on autoimmunity research, the
highest award given by the Austrian Academy of Sciences, to Georg Wick
AESKU.AWARD for Life Contribution to Autoimmunity, given to Georg Wick at the 6th
International Congress on Autoimmu-nity, Porto, 2008. Former awardees were Donato
Alarcón-Segovia, Ian R. Mackay and Noel R. Rose (2004) and Joachim R. Kalden,
Graham R. V. Hughes, and Irun R. Cohen (2006). http://www.i-med.ac.at/mypoint/
news/2008092501.xml
25
The Biocenter
Awards, Meetings
MCBO Award 2009. (Molecular Cell Biology
& Oncology) 5.3.2009 Wolfgang Doppler of
the Biocenter (right) is coordinator of the
Oncology programme, which is part of the
MCBO programme (the former being
organzied by Bernhard Flucher (left). http://
www.i-med.ac.at/mypoint/news/
2009030501.xml
26
The 'Human Frontier
Science
Program'
carreer development
award was given to
David Teis, Div. Cell
Biologogy on March
30,
2010.
HFSP
sponsors
interdisciplinary research projects that aim to integrate different disciplines such as biology,
chemistry, mathematics and computer
sciences. Research Award of the Principality of Liechtenstein 2009, to
Norbert Polacek, Div. Genomics
& RNomics, 30.3.2009, Guido
Wolfinger (Liechtenstein), Norbert Polacek, Alexander Hüttenhofer (Laudator). http://www.i-med.ac.at/
mypoint/news/2009033001.xml
BINDER Innovation Award 27.4.2009 to
Ludger Hengst of the Biocenter for his
research on cell cycle control. F.l.t.r.:
Wolfgang Preter, Binder Gmbh, Ludger
Hengst, and DGZ-Reinhard Fässler, President
of the German Society for Cell Biology,
http://www.i-med.ac.at/mypoint/news/
2009042701.xml
The town of Innsbruck honors medical research 4.12.2009 f.l.t.r.: Rector Herbert
Lochs, Mayor Hilde Zach, Town Council member Christoph Kaufmann, Vice Rector
Günther Sperk. Awardees:
Natascha Veronika Hermann-Kleiter,
Alexander
Moschen, Alexandra Lusser, the latter being from the Biocenter
http://www.i-med.ac.at/public-relations/presse/2009/13.html
Award of the Society of Austrian
Chemists 2009 (GÖCH) 11.12.2009
to Markus Keller (left) of the Div.
Biological Chemistry. Peter Jaintner
(right, Laudator). Copyright: GÖCH http://www.i-med.ac.at/mypoint/
news/2009121101.xml
SANOFI-AVENTIS-Award
2009,
16.12.2009 to Markus Schrettl, Div.
Molecular Biology
http://www.i-med.ac.at/publicrelations/presse/2009/14.html
The Biocenter
Emeriti Professors
Wilhelm Sachsenmaier Hans Grunicke
Professor Sachsenmaier became in 1970 Full Professor of „Biochemistry“ and
Chairman of the newly founded “Institute of Biochemistry and Experimental Cancer
Research” at the Medical Faculty of the Leopold-Franzens-University of Innsbruck. From
1977-79, he was President of the Austrian Biochemical Society. In 1995, he retired as
Professor emeritus for Biochemistry. In his active time, Professor Sachsenmaier conducted research on molecular aspects of
cell proliferation and used hereto a model system, i.e. the synchronous multinuclear
plasmodium of the myxomycete Physarum polycephalum, which he introduced from his
former affiliations with the McArdle Institute of Cancer Research, Madison/Wisconsin
and the German Cancer Research Center, Heidelberg.
Current activities
Teaching: Seminar “Special problems of Biochemistry”.
Organization of international meetings and workshops on „Cell Cycle Control“ in cooperation with
local colleagues (L. Hengst, L. A. Huber, S. Geley, P. Loidl, J. Troppmair). Recent and future events:
Mayrhofen/AUT (2001) together with K. Nasmyth/Vienna/Oxford; Spetses/GR, (2007) together with
C. Sekeris/ Athens; Montpellier/F (2011) together with E. Schwob/France.
Professor Grunicke succeeded Prof. Sachsenmaier as Professor of Medical
Biochemistry. He is now focussing his work on reviewing, writing and consulting. He is
pleased that there is still some demand for his advice which he is happy to give to
anybody asking for it. Professor Grunickes is convinced that the Innsbruck Biocenter will continue its
successful development to an internationally reputable centre of basic medical research.
“My expertise is at the disposal of the department whenever it is desired”. Professor Grunicke is Vicepresident of the Alumni-i-med-Club (http://www.i-med.ac.at/
alumni/), a circle of former students, professors, supporters, sponsors and friends of the
Medical University of Innsbruck. This club was founded in 2007 and Hans Grunicke was
elected as its first president. Regular meetings are offered to the members at which a
variety of scientific, political, economic and cultural topics are presented and discussed
in an open-minded style. Austrian Cancer Society–Tyrol Section: Reactivation of the Society by Prof. S., as he became
President in 1970 and from thereon permanent member of its research advisory board. Present
number of active members: ~400. In 2009 financial support with fund-raising money (300.000
EUR) was granted by the society for ~50 selected research projects of predominantly young
scientists (< 35 yrs) including 30.000 EUR for the recipient of a „Molecular Cell Biology – Oncology
Award Fellowship“ (Dipl.-Ing. Marin Barisic, MCBO-graduate student programme) and for 5 PhDOncology-Seminars”, i.e.
theses with 1.000 EUR each. Since decades, Prof. S. organizes the “O
guest lectures of international cancer scientists. A recent top speaker was Nobel Laureate Sir Tim
Hunt/UK “Getting in and out of Mitosis”.
http://www.krebshilfe-tirol.at/service/onko_kolloquien.shtm, http://www.krebshilfe.net/home.shtm
Tel.: 0043 (512) 9003.70328
email: [email protected]
27
Tel.: 0043 (512) 9003.70112
The Biocenter
Emeriti Professors
Autoimmunity
www.autoimmunity.at
Tel.: 0043 (512) 9003.70960
Georg Wick
This group works on two major research projects, i.e. the immunology of
atherosclerosis and the immunology of fibrosis. Both areas of research are
supported by competitive grants, notably from the Austrian Science Fund
(FWF) and the Framework 7 (FR7) Program of the European Union. Additional
Support is obtained from private foundations. The Immunology of Atherosclerosis. This project has been in the center of Georg Wick’s
group for the last two decades and resulted in the formulation of a new “autoimmune”
hypothesis for the development of Atherosclerosis supported by solid data from in vitro
and animal experiments as well as from cross-sectional and prospective longitudinal
studies in human cohorts. In essence, this hypothesis states that classical
atherosclerosis risk factors, the well proven atherogenic role of which is not disputed,
first act as endothelial stressors inducing the expression of a stress protein (heat shock
protein 60 – Hsp60) that then acts as a “danger signal” and thus serves as a target for
preexisting innate and adaptive anti Hsp60 immunity. The present research of the group
is on one hand focused on the elucidation of the HSP60-inducing role of classical
atherosclerosis risk factors in endothelial cells and on the other hand on the
identification of the earliest immunologic effector mechanisms leading to the first
inflammatory stage of atherosclerosis
The Immunology of Fibrosis. Fibrosis is an important consequence of various
pathological conditions ranging from tissue damage, over inflammation, reactions
against foreign body implants to “spontaneous” fibrotic diseases. In spite of these
heterogenic causes, the final stage of fibrogenesis is very stereotypic and always
associated with inflammatory immunologic processes. 28
Group members: Giovanni Almanzar-Reina, Mattias
Carlsson, Cecilia Grundtmann, Simone Kreutmayer,
Julianna Leuen-berger, Christina Mayerl, Elisabeth
Onestingel, Nadine Plank, Evelyn Rabensteiner
The focus of research of the group in this area is put on the clarification of the imbalance
of pro- and antifibrotic cytokines produced by the mononuclear inflammatory cells in
tissues with incipient fibrotic changes. Most recently, an impaired function of regulatory
T cells (Teffs) within fibrotic tissues allowing for a hyperactivity of T effector cells (Teffs) has
been demonstrated that may underly the abundant production of pro-fibrotic cytokines
by the latter. International collaborators
Immunology of atherosclerosis
ECIBUG (9 partners – Austria, Finland, France, Germany); TOLERAGE (10 partners – Austria,
Switzerland, Sweden, Germany, France, Italy, Netherlands); Rudi Tanzi, Department of Neurology,
Massachusetts General Hospital, Harvard Medical School, Boston, USA); Marcus Textor, ETH,
Zürich; Ingrid Lundberg, Karolinska Institute, Stockholm; Ivana Hollan, Department of Cardiac
Surgery, Feiring Heart Clinic, Feiring, Norway
Immunology of Fibrosis Olov Ekwall and Palle Kämpe, Department of Medical Sciences, University Hospital, Uppsala;
Russell Wilson, Autoimmune Technologies, LLC, New Orleans, Louisiana, USA); Yehuda Shoenfeld,
Tel Hashomer, Israel
Awards
Georg Wick: Erwin-Schrödinger-Prize for his Life Contribution on autoimmunity research, the
highest award given by the Austrian Academy of Sciences, 2008
Georg Wick: AESKU.AWARD for Life Contribution to Autoimmunity, given at the 6th International
Congress on Autoimmunity, Porto, 2008. Former awardees were Donato Alarcón-Segovia, Ian R.
Mackay and Noel R. Rose (2004) and Joachim R. Kalden, Graham R. V. Hughes, and Irun R.
Cohen (2006).
Future goals
Immunology of Atherosclerosis
1.Elucidation of the role of Chlamydiae as potent inducers of HSP60 expression by infected
endothelial cells. 2.Microarray analysis of altered gene expression by endothelial cells after treatment with cigarette
smoke extract. 3.Phenotypic and functional characterization of T-cells obtained from early, clinically inapparent
atherosclerotic lesions. 4.Development of a vaccine against atherosclerosis (http://www.cemit.at/folgeseite.cfm?id=227)
Immunology of fibrosis
1. Functional analysis of proteins and cells adhering to silicone surfaces
2.Phenotypic and functional analysis of T-cells derived from fibrotic capsules around silicone
implants
The Biocenter
Seminars & Happy Hour
29
The Biocenter
Publications 2008
Case Reports
Wolfram, D.; Backovic, A.; Kaindl, R.; Hussl, H.; Wick, G.: Spontaneous unilateral autoinflation of a
saline-filled mammary implant. JOURNAL OF PLASTIC RECONSTRUCTIVE AND AESTHETIC
SURGERY. 2008; 61(3); 342-345. IF: 1.235
Original Publications
Abdulle, Sahra; Hagberg, Lars; Svennerholm, Bo; Fuchs, Dietmar; Gisslén, Magnus: Cerebrospinal
fluid viral load and intrathecal immune activation in individuals infected with different HIV-1 genetic
subtypes. PLOS ONE. 2008; 3(4); e1971. Baydar, T.; Girgin, G.; Fuchs, D.; Inanici, F.; Sipahi, H.; Erol, O.; Sahin, G.: Pteridine Pathway in
Patients with Degenerative Diseases During Short Time Treatment with Low Dose of Meloxicam, as
a Non-steroidal Anti-inflammatory Drug. PTERIDINES. 2008; 19(4); 107. IF: 0.706
Bellmann-Weiler, R.; Schroecksnadel, K.; Holzer, C.; Larcher, C.; Fuchs, D.; Weiss, G.: IFN-gamma
mediated pathways in patients with fatigue and chronic active Epstein Barr virus-infection.
JOURNAL OF AFFECTIVE DISORDERS. 2008; 108(1-2); 171-176. IF: 3.271
Blum, G.; Perkhofer, S.; Haas, H.; Schrettl, M.; Wurzner, R.; Dierich, MP.; Lass-Florl, C.: Potential
basis for amphotericin B resistance in Aspergillus terreus. ANTIMICROBIAL AGENTS AND
CHEMOTHERAPY. 2008; 52(4); 1553-1555. IF: 4.716 Brandacher, G.; Golderer, G.; Kienzl, K.; Werner, ER.; Margreiter, R.; Weiss, HG.: Potential
applications of global protein expression analysis (proteomics) in morbid obesity and bariatric
surgery. OBESITY SURGERY. 2008; 18(7); 905-910. IF: 2.913 Brunner, A.; Verdorfer, I.; Prelog, M.; Mayerl, C.; Mikuz, G.; Tzankov, A.: Large-scale analysis of cell
cycle regulators in urothelial bladder cancer identifies p16 and p27 as potentially useful prognostic
markers. PATHOBIOLOGY. 2008; 75(1); 25-33. IF: 1.818 Cano, OD.; Neurauter, G.; Fuchs, D.; Shearer, GM.; Boasso, A.: Differential effect of type I and type
II interferons on neopterin production and amino acid metabolism in human astrocyte-derived cells.
NEUROSCIENCE LETTERS. 2008; 438(1); 22-25. IF: 2.200 30
Carrico, AW.; Johnson, MO.; Morin, SF.; Remien, RH.; Riley, ED.; Hecht, FM.; Fuchs, D.: Stimulant
use is associated with immune activation and depleted tryptophan among HIV-positive persons on
anti-retroviral therapy. BRAIN BEHAVIOR AND IMMUNITY. 2008; 22(8); 1257-1262. IF: 4.909 Casella, I.; Lindner, H.; Zenzmaier, C.; Riitano, D.; Berger, P.; Costa, T.: Non-gonadotropinreleasing hormone-mediated transcription and secretion of large human glycoprotein hormone
alpha-subunit in human embryonic kidney-293 cells. ENDOCRINOLOGY. 2008; 149(3);
1144-1154. IF: 4.945
Cecchinato, V.; Tryniszewska, E.; Ma, ZM.; Vaccari, M.; Boasso, A.; Tsai, WP.; Petrovas, C.; Fuchs,
D.; Heraud, JM.; Venzon, D.; Shearer, GM.; Koup, RA.; Lowy, I.; Miller, CJ.; Franchini, G.: Immune
activation driven by CTLA-4 blockade augments viral replication at mucosal sites in simian
immunodeficiency virus infection. JOURNAL OF IMMUNOLOGY. 2008; 180(8); 5439-5447. IF:
6.000
Efimov, A.; Schiefermeier, N.; Grigoriev, I.; Brown, MC.; Turner, CE.; Small, JV.; Kaverina, I.: Paxillindependent stimulation of microtubule catastrophes at focal adhesion sites. JOURNAL OF CELL
SCIENCE. 2008; 121(2); 196-204. IF: 6.247
Espelt, MV.; Alleva, K.; Amodeo, G.; Krumschnabel, G.; Rossi, RC.; Schwarzbaum, PJ.: Volumetric
response of vertebrate hepatocytes challenged by osmotic gradients: A theoretical approach.
COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY B-BIOCHEMISTRY & MOLECULAR
BIOLOGY. 2008; 150(1); 103-111. IF: 1.468 Fluckinger, M.; Merschak, P.; Hermann, M.; Haertle, T.; Redl, B.: Lipocalin-interacting-membranereceptor (LIMR) mediates cellular internalization of beta-lactoglobulin. BIOCHIMICA ET
BIOPHYSICA ACTA-BIOMEMBRANES. 2008; 1778(1); 342-347
Fritsche, G.; Nairz, M.; Werner, ER.; Barton, HC.; Weiss, G.: Nramp1-functionality increases iNOS
expression via repression of IL-10 formation. EUROPEAN JOURNAL OF IMMUNOLOGY. 2008; 38
(11); 3060-3067. IF: 4.865
Glockner, G.; Golderer, G.; Werner-Felmayer, G.; Meyer, S.; Marwan, W.: A first glimpse at the
transcriptome of Physarum polycephalum. BMC GENOMICS. 2008; 9(2). IF: 3.926
Green, A.; Sarg, B.; Koutzamani, E.; Genheden, U.; Lindner, HH.; Rundquist, I.: Histone H1
dephosphorylation is not a general feature in early apoptosis. BIOCHEMISTRY. 2008; 47(28);
7539-7547. IF: 3.379 Greilberger, J.; Koidl, C.; Greilberger, M.; Lamprecht, M.; Schroecksnadel, K.; Leblhuber, F.; Fuchs,
D.; Oettl, K.: Malondialdehyde, carbonyl proteins and albumin-disulphide as useful oxidative
markers in mild cognitive impairment and Alzheimer's disease. FREE RADICAL RESEARCH. 2008;
42(7); 633-638. IF: 2.826
The Biocenter
Publications 2008
Gruber, T.; Fresser, F.; Jenny, M.; Uberall, F.; Leitges, M.; Baier, GB.: PKC theta cooperates with
atypical PKC zeta and PKC iota in NF-kappa B transactivation of T lymphocytes. MOLECULAR
IMMUNOLOGY. 2008; 45(1); 117-126. IF: 3.555
Haffner, MC.; Jurgeit, A.; Berlato, C.; Geley, S.; Parajuli, N.; Yoshimura, A.; Doppler, W.: Interaction
and functional interference of glucocorticoid receptor and SOCS1. JOURNAL OF BIOLOGICAL
CHEMISTRY. 2008; 283(32); 22089-22096. IF: 5.520 Hammerer-Lercher, A.; Halfinger, B.; Sarg, B.; Mair, J.; Puschendorf, B.; Griesmacher, A.; Guzman,
NA.; Lindner, HH.: Analysis of circulating forms of proBNP and NT-proBNP in patients with severe
heart failure. CLINICAL CHEMISTRY. 2008; 54(5); 858-865. IF: 5.579 Henderson, B.; Csordas, A.; Backovic, A.; Kind, M.; Bernhard, D.; Wick, G.: Cigarette smoke is an
endothelial stressor and leads to cell cycle arrest. ATHEROSCLEROSIS. 2008; 201(2); 298-305. IF:
4.601
Hermann-Kleiter, N.; Gruber, T.; Lutz-Nicoladoni, C.; Thuille, N.; Fresser, F.; Labi, V.; Schiefermeier,
N.; Warnecke, M.; Huber, L.; Villunger, A.; Eichele, G.; Kaminski, S.; Baier, G.: The nuclear orphan
receptor NR2176 suppresses lymphocyte activation and T helper 17-dependent autoimmunity.
IMMUNITY. 2008; 29(2); 205-216. IF: 20.579
Imeri, F.; Herklotz, R.; Risch, L.; Arbetsleitner, C.; Zerlauth, M.; Risch, GM.; Huber, AR.: Stability of
hematological analytes depends on the hematology analyser used: A stability study with Bayer
Advia 120, Beckman Coulter LH 750 and Sysmex XE 2100. CLINICA CHIMICA ACTA. 2008; 397
(1-2); 68-71. IF: 2.960
Jenny, M.; Winkler, C.; Spetea, M.; Schennach, H.; Schmidhammer, H.; Fuchs, D.: Non-peptidic
delta-Opioid receptor antagonists suppress mitogen-induced tryptophan degradation in peripheral
blood mononuclear cells in vitro. IMMUNOLOGY LETTERS. 2008; 118(1); 82-87. IF: 2.858 Jochl, C.; Rederstorff, M.; Hertel, J.; Stadler, PF.; Hofacker, IL.; Schrettl, M.; Haas, H.; Huttenhofer,
A.: Small ncRNA transcriptome analysis from Aspergillus fumigatus suggests a novel mechanism
for regulation of protein synthesis. NUCLEIC ACIDS RESEARCH. 2008; 36(8); 2677-2689. IF:
6.878 Kitchen, Maria; Quigley, Maria A.; Mwinga, Alwyn M.; Fuchs, Dietmar; Lisse, Ida M.; Porter, John D
H.; McAdam, Keith P W J.; Godfrey-Faussett, Peter: HIV Progression and Predictors of Mortality in
a Community-Based Cohort of Zambian Adults. JOURNAL OF THE INTERNATIONAL
ASSOCIATION OF PHYSICIANS IN AIDS CARE. 2008; 7(1); 17-26.
Kositz, C.; Schroecksnadel, K.; Grander, G.; Schennach, H.; Kofler, H.; Fuchs, D.: High serum
tryptophan concentration in pollinosis patients is associated with unresponsiveness to pollen
extract therapy. INTERNATIONAL ARCHIVES OF ALLERGY AND IMMUNOLOGY. 2008; 147(1);
35-40. IF: 2.131 (2008) / ZIT: 0Labi, V.; Erlacher, M.; Kiessling, S.; Manzl, C.; Frenzel, A.; O'Reilly, L.; Strasser, A.; Villunger, A.: Loss of the
BH3-only protein Bmf impairs B cell homeostasis and accelerates gamma irradiation-induced
thymic lymphoma development. JOURNAL OF EXPERIMENTAL MEDICINE. 2008; 205(3);
641-655. IF: 15.219 (2008) / ZIT: 7
Lang, K.; Erlacher, M.; Wilson, DN.; Micura, R.; Polacek, N.: The role of 23S ribosomal RNA
residue A2451 in peptide bond synthesis revealed by atomic mutagenesis. CHEMISTRY &
BIOLOGY. 2008; 15(5); 485-492. IF: 5.603 (2008) / ZIT: 5
Lirk, P.; Haller, I.; Colvin, HP.; Lang, L.; Tomaselli, B.; Klimaschewski, L.; Gerner, P.: In vitro,
inhibition of mitogen-activated protein kinase pathways protects against bupivacaine- and
ropivacaine-induced neurotoxicity. ANESTHESIA AND ANALGESIA. 2008; 106(5); 1456-1464. IF:
2.590 (2008) / ZIT: 0
Madej, MJ.; Niemann, M.; Huttenhofer, A.; Goringer, HU.: Identification of novel guide RNAs from
the mitochondria of Trypanosome brucei. RNA BIOLOGY. 2008; 5(2); 84-91. IF: / ZIT: 1
Mai, A.; Cheng, D.; Bedford, MT.; Valente, S.; Nebbioso, A.; Perrone, A.; Brosch, G.; Sbardella, G.;
De Bellis, F.; Miceli, M.; Altucci, L.: Epigenetic multiple ligands: Mixed Histone/Protein
methyltransferase, acetyltransferase, and class III deacetylase (Sirtuin) inhibitors. JOURNAL OF
MEDICINAL CHEMISTRY. 2008; 51(7); 2279-2290. IF: 4.898 (2008) / ZIT: 16
Mair, J.; Hammerer-Lercher, A.; Mittermayr, M.; Klingler, A.; Humpeler, E.; Pachinger, O.;
Schobersberger, W.: 3-week hiking holidays at moderate altitude do not impair cardiac function in
individuals with metabolic syndrome. INTERNATIONAL JOURNAL OF CARDIOLOGY. 2008; 123(2);
186-188. IF: 3.121 (2008) / ZIT: 0
Massoner, P.; Haag, P.; Seifarth, C.; Jurgeit, A.; Rogatsch, H.; Doppler, W.; Bartsch, G.; Klocker,
H.: Insulin-like growth factor binding protein-3 (IGFBP-3) in the prostate and in prostate cancer:
Local production, distribution and secretion pattern indicate a role in stromal-epithelial interaction.
PROSTATE. 2008; 68(11); 1165-1178. IF: 3.069 (2008) / ZIT: 3
31
The Biocenter
Publications 2008
McDonagh, A.; Fedorova, ND.; Crabtree, J.; Yu, Y.; Kim, S.; Chen, D.; Loss, O.; Cairns, T.;
Goldman, G.; Armstrong-James, D.; Haynes, K.; Haas, H.; Schrettl, M.; May, G.; Nierman, WC.;
Bignell, E.: Sub-telomere directed gene expression during initiation of invasive aspergillosis. PLOS
PATHOGENS. 2008; 4(9); e1000154. IF: 9.125 (2008) / ZIT: 7
Neurauter, G.; Grahmann, AV.; Klieber, M.; Zeimet, A.; Ledochowski, M.; Sperner-Unterweger, B.;
Fuchs, D.: Serum phenylalanine concentrations in patients with ovarian carcinoma correlate with
concentrations of immune activation markers and of isoprostane-8. CANCER LETTERS. 2008; 272
(1); 141-147. IF: 3.504 (2008) / ZIT: 0
Meraner, J.; Lechner, M.; Schwarze, F.; Gander, R.; Jesacher, F.; Loidl, P.: Cell cycle dependent role
of HDAC1 for proliferation control through modulating ribosomal DNA transcription. CELL
BIOLOGY INTERNATIONAL. 2008; 32(9); 1073-1080. IF: 1.619 (2008) / ZIT: 0
Offterdinger, M.; Bastiaens, PI.: Prolonged EGFR signaling by ERBB2-mediated sequestration at
the plasma membrane. TRAFFIC. 2008; 9(1); 147-155. IF: 5.709 (2008) / ZIT: 4
Michalak, EM.; Villunger, A.; Adams, JM.; Strasser, A.: In several cell types tumour suppressor p53
induces apoptosis largely via Puma but Noxa can contribute. CELL DEATH AND
DIFFERENTIATION. 2008; 15(6); 1019-1029. IF: 7.548 (2008) / ZIT: 16
Moheno, P.; Pfleiderer, W.; DiPasquale, AG.; Rheingold, AL.; Fuchs, D.: Cytokine and IDO
metabolite changes effected by calcium pterin during inhibition of MDA-MB-231 xenograph tumors
in nude mice. INTERNATIONAL JOURNAL OF PHARMACEUTICS. 2008; 355(1-2); 238-248. IF:
3.061 (2008) / ZIT: 1
Moser, B.; Schroecksnadel, K.; Hortnagl, H.; Rieder, J.; Fuchs, D.; Gottardis, M.: Influence of
Extreme Long Endurance Sports Activity on Neopterin Excretion. PTERIDINES. 2008; 19(4); 114.
IF: 0.706 (2008) / ZIT: 0
Muller, T.; Hess, MW.; Schiefermeier, N.; Pfaller, K.; Ebner, HL.; Heinz-Erian, P.; Ponstingl, H.;
Partsch, J.; Rollinghoff, B.; Kohler, H.; Berger, T.; Lenhartz, H.; Schlenck, B.; Houwen, RJ.; Taylor,
CJ.; Zoller, H.; Lechner, S.; Goulet, O.; Utermann, G.; Ruemmele, FM.; Huber, LA.; Janecke, AR.:
MYO5B mutations cause microvillus inclusion disease and disrupt epithelial cell polarity. NATURE
GENETICS. 2008; 40(10); 1163-1165. IF: 30.259 (2008) / ZIT: 5
Nairz, M.; Fritsche, G.; Brunner, P.; Talasz, H.; Hantke, K.; Weiss, G.: Interferon-gamma limits the
availability of iron for intramacrophage Salmonella typhimurium. EUROPEAN JOURNAL OF
IMMUNOLOGY. 2008; 38(7); 1923-1936. IF: 4.865 (2008) / ZIT: 10
Neher, A.; Schobersberger, W.; Augustijns, P.; Fuchs, D.; Wolf-Magele, A.; Hoffmann, G.: Influence
of Neopterin on Ciliary Beat Frequency of Human Nasal Epithelial Cells in vitro. PTERIDINES. 2008;
19(3); 79. IF: 0.706 (2008) / ZIT: 0
32
Paddison, JS.; Booth, RJ.; Fuchs, D.; Hill, AG.: Peritoneal inflammation and fatigue experiences
following colorectal surgery: A pilot study. PSYCHONEUROENDOCRINOLOGY. 2008; 33(4);
446-454. IF: 3.788 (2008) / ZIT: 2
Pafundo, DE.; Chara, O.; Faillace, MP.; Krumschnabel, G.; Schwarzbaum, PJ.: Kinetics of ATP
release and cell volume regulation of hyposmotically challenged goldfish hepatocytes. AMERICAN
JOURNAL OF PHYSIOLOGY-REGULATORY INTEGRATIVE AND COMPARATIVE PHYSIOLOGY.
2008; 294(1); R220-R233. IF: 3.272 (2008) / ZIT: 3
Perkhofer, S.; Kehrel, BE.; Dierich, MP.; Donnelly, JP.; Nussbaumer, W.; Hofmann, J.; von Eiff, C.;
Lass-Florl, C.: Human platelets attenuate Aspergillus species via granule-dependent mechanisms.
JOURNAL OF INFECTIOUS DISEASES. 2008; 198(8); 1243-1246. IF: 5.682 (2008) / ZIT: 3
Pfister, D.; De Mulder, K.; Hartenstein, V.; Kuales, G.; Borgonie, G.; Marx, F.; Morris, J.; Ladurner,
P.: Flatworm stem cells and the germ line: Developmental and evolutionary implications of macvasa
expression in Macrostomum lignano. DEVELOPMENTAL BIOLOGY. 2008; 319(1); 146-159. IF:
4.416 (2008) / ZIT: 6
Ploder, M.; Neurauter, G.; Spittler, A.; Schroecksnadel, K.; Roth, E.; Fuchs, D.: Serum
phenylalanine in patients post trauma and with sepsis correlate to neopterin concentrations.
AMINO ACIDS. 2008; 35(2); 303-307. IF: 4.132 (2008) / ZIT: 1
Ploner, C.; Rainer, J.; Niederegger, H.; Eduardoff, M.; Villunger, A.; Geley, S.; Kofler, R.: The BCL2
rheostat in glucocorticoid-induced apoptosis of acute lymphoblastic leukemia. LEUKEMIA. 2008;
22(2); 370-377. IF: 8.634 (2008) / ZIT: 10
Purschwitz, J.; Mueller, S.; Kastner, C.; Schoser, M.; Haas, H.; Espeso, EA.; Atoui, A.; Calvo, AM.;
Fischer, R.: Functional and physical interaction of blue- and red-light sensors in Aspergillus
nidulans. CURRENT BIOLOGY. 2008; 18(4); 255-259. IF: 10.777 (2008) / ZIT: 17
Ragno, R.; Simeoni, S.; Rotili, D.; Caroli, A.; Botta, G.; Brosch, G.; Massa, S.; Mai, A.: Class IIselective histone deacetylase inhibitors. Part 2: Alignment-independent GRIND 3-D QSAR,
homology and docking studies. EUROPEAN JOURNAL OF MEDICINAL CHEMISTRY. 2008; 43(3);
621-632. IF: 2.882 (2008) / ZIT: 6
The Biocenter
Publications 2008
Rainer, M.; Sonderegger, H.; Bakry, R.; Huck, CW.; Morandell, S.; Huber, LA.; Gjerde, DT.; Bonn,
GK.: Analysis of protein phosphorylation by monolithic extraction columns based on poly
(divinylbenzene) containing embedded titanium dioxide and zirconium dioxide nano-powders.
PROTEOMICS. 2008; 8(21); 4593-4602. IF: 4.586 (2008) / ZIT: 2
Reitinger, S.; Boroviak, T.; Laschober, GT.; Fehrer, C.; Muellegger, J.; Lindner, H.; Lepperdinger, G.:
High-yield recombinant expression of the extremophile enzyme, bee hyaluronidase in Pichia
pastoris. PROTEIN EXPRESSION AND PURIFICATION. 2008; 57(2); 226-233. IF: 1.621 (2008) /
ZIT: 2
Rossmann, A.; Henderson, B.; Heidecker, B.; Seiler, R.; Fraedrich, G.; Singh, M.; Parson, W.;
Keller, M.; Grubeck-Loebenstein, B.; Wick, G.: T-cells from advanced atherosclerotic lesions
recognize hHSP60 and have a restricted T-cell receptor repertoire. EXPERIMENTAL
GERONTOLOGY. 2008; 43(3); 229-237. IF: 3.283 (2008) / ZIT: 7
Schmidt-Glenewinkel, H.; Vacheva, I.; Hoeller, D.; Dikic, I.; Eils, R.: An ultrasensitive sorting
mechanism for EGF Receptor Endocytosis. BMC SYSTEMS BIOLOGY. 2008; 2(4); IF: / ZIT: 2
Schneeberger, S.; Hautz, T.; Wahl, SM.; Brandacher, G.; Sucher, R.; Steinmassl, O.; Steinmassl, P.;
Wright, CD.; Obrist, P.; Werner, ER.; Mark, W.; Troppmair, J.; Margreiter, R.; Amberger, A.: The
effect of secretory leukocyte protease inhibitor (SLPI) on ischemia/reperfusion injury in cardiac
transplantation. AMERICAN JOURNAL OF TRANSPLANTATION. 2008; 8(4); 773-782. IF: 6.559
(2008) / ZIT: 1
Schrettl, M.; Kim, HS.; Eisendle, M.; Kragl, C.; Nierman, WC.; Heinekamp, T.; Werner, ER.;
Jacobsen, I.; Illmer, P.; Yi, H.; Brakhage, AA.; Haas, H.: SreA-mediated iron regulation in Aspergillus
fumigatus. MOLECULAR MICROBIOLOGY. 2008; 70(1); 27-43. IF: 5.213 (2008) / ZIT: 5
Schroecksnadel, K.; Sarcletti, M.; Winkler, C.; Mumelter, B.; Weiss, G.; Fuchs, D.; Kemmler, G.;
Zangerle, R.: Quality of life and immune activation in patients with HIV-infection. BRAIN BEHAVIOR
AND IMMUNITY. 2008; 22(6); 881-889. IF: 4.909 (2008) / ZIT: 3
Schroecksnadel, K.; Walter, RB.; Weiss, G.; Mark, M.; Reinhart, WH.; Fuchs, D.: Association
between plasma thiols and immune activation marker neopterin in stable coronary heart disease.
CLINICAL CHEMISTRY AND LABORATORY MEDICINE. 2008; 46(5); 648-654. IF: 1.888 (2008) /
ZIT: 0
Schweigreiter, R.: The natural history of the myelin-derived nerve growth inhibitor Nogo-A.
NEURON GLIA BIOLOGY. 2008; 4(4); 83-89. IF: 0.937 (2008) / ZIT: 0
Scrandis, Debra A.; Langenberg, Patricia; Tonelli, Leonardo H.; Sheikh, Tehmina M.; Manogura,
Anita C.; Alberico, Laura A.; Hermanstyne, Tracey; Fuchs, Dietmar; Mighty, Hugh; Hasday, Jeffrey
D.; Boteva, Kalina; Postolache, Teodor T.: Prepartum Depressive Symptoms Correlate Positively
with C-Reactive Protein Levels and Negatively with Tryptophan Levels: A Preliminary Report.
INTERNATIONAL JOURNAL OF CHILD HEALTH AND HUMAN DEVELOPMENT. 2008; 1(2);
167-174. Seifert, M.; Nairz, M.; Schroll, A.; Schrettl, M.; Haas, H.; Weiss, G.: Effects of the Aspergillus
fumigatus siderophore systems on the regulation of macrophage immune effector pathways and
iron homeostasis. IMMUNOBIOLOGY. 2008; 213(9-10); 767-778. IF: 3.461
Skvortsov, S.; Sarg, B.; Lindner, H.; Lukas, P.; Hilbe, W.; Zwierzina, H.; Skvortsova, I.: Cetuximab
inhibits thymidylate synthase in colorectal cells expressing epidermal growth factor receptor.
PROTEOMICS CLINICAL APPLICATIONS. 2008; 2(6); 908-914. IF: 1.514 Skvortsova, I.; Skvortsov, S.; Stasyk, T.; Raju, U.; Popper, BA.; Schiestl, B.; von Guggenberg, E.;
Neher, A.; Bonn, GK.; Huber, LA.; Lukas, P.: Intracellular signaling pathways regulating
radioresistance of human prostate carcinoma cells. PROTEOMICS. 2008; 8(21); 4521-4533. IF:
4.586 Sonnleitner, E.; Sorger-Domenigg, T.; Madej, MJ.; Findeiss, S.; Hackermuller, J.; Huettenhofer, A.;
Stadler, PF.; Blasi, U.; Moll, I.: Detection of small RNAs in Pseudomonas aeruginosa by RNomics
and structure-based bioinformatic tools. MICROBIOLOGY-SGM. 2008; 154(8); 3175-3187. IF:
2.841 Teufel, L.; Schuster, KC.; Merschak, P.; Bechtold, T.; Redl, B.: Development of a fast and reliable
method for the assessment of microbial colonization and growth on textiles by DNA quantification.
JOURNAL OF MOLECULAR MICROBIOLOGY AND BIOTECHNOLOGY. 2008; 14(4); 193-200. IF:
2.286
Theurl, I.; Theurl, M.; Seifert, M.; Mair, S.; Nairz, M.; Rumpold, H.; Zoller, H.; Bellmann-Weiler, R.;
Niederegger, H.; Talasz, H.; Weiss, G.: Autocrine formation of hepcidin induces iron retention in
human monocytes. BLOOD. 2008; 111(4); 2392-2399. IF: 10.432 Tishchenko, S.; Kljashtorny, V.; Kostareva, O.; Nevskaya, N.; Nikulin, A.; Gulak, P.; Piendl, W.;
Garber, M.; Nikonov, S.: Domain II of Thermus thermophilus Ribosomal Protein L1 Hinders
Recognition of Its mRNA. JOURNAL OF MOLECULAR BIOLOGY. 2008; 383(2); 301-305. IF: 4.146
33
The Biocenter
Publications 2008
Tomaselli, B.; zur Nedden, S.; Podhraski, V.; Baier-Bitterlich, G.: p42/44 MAPK is an essential
effector for purine nucleoside-mediated neuroprotection of hypoxic PC12 cells and primary
cerebellar granule neurons. MOLECULAR AND CELLULAR NEUROSCIENCE. 2008; 38(4);
559-568. IF: 3.934 Vaccari, M.; Boasso, A.; Ma, ZM.; Cecchinato, V.; Venzon, D.; Doster, MN.; Tsai, WP.; Shearer,
GM.; Fuchs, D.; Felber, BK.; Pavlakis, GN.; Miller, CJ.; Franchini, G.: CD4(+) T-cell loss and delayed
expression of modulators of immune responses at mucosal sites of vaccinated macaques following
SIVmac251 infection. MUCOSAL IMMUNOLOGY. 2008; 1(6); 497-507. Volgger, B.; Aspisirengil, C.; Genser-Krimbacher, E.; Ciresa-Koenig, A.; Daxenbichler, G.; Fuchs, D.;
Windbichler, G.; Marth, C.: Prognostic significance of TPA versus SCC-Ag, CEA and neopterin in
carcinoma of the uterine cervix. CANCER LETTERS. 2008; 262(2); 183-189. IF: 3.504 (
Watschinger, K.; Horak, SB.; Schulze, K.; Obermair, GJ.; Wild, C.; Koschak, A.; Sinnegger-Brauns,
MJ.; Tampe, R.; Striessnig, J.: Functional properties and modulation of extracellular epitope-tagged
Ca(V)2.1 voltage-gated calcium channels. CHANNELS (AUSTIN, TEX.). 2008; 2(6); 461-473. IF:
1.513 Weinmeister, P.; Lukowski, R.; Linder, S.; Traidl-Hoffmann, C.; Hengst, L.; Hofmann, F.; Feil, R.:
Cyclic Guanosine Monophosphate-dependent Protein Kinase I Promotes Adhesion of Primary
Vascular Smooth Muscle Cells. MOLECULAR BIOLOGY OF THE CELL. 2008; 19(10); 4434-4441.
IF: 5.558
Wesierska-Gadek, J.; Hajek, SB.; Sarg, B.; Wandl, S.; Walzi, E.; Lindner, H.: Pleiotropic effects of
selective CDK inhibitors on human normal and cancer cells. BIOCHEMICAL PHARMACOLOGY.
2008; 76(11); 1503-1514. IF: 4.838 Wick, MC.; Mayerl, C.; Backovic, A.; van der Zee, R.; Jaschke, W.; Dietrich, H.; Wick, G.: In vivo
imaging of the effect of LPS on arterial endothelial cells: molecular imaging of heat shock protein
60 expression. CELL STRESS & CHAPERONES. 2008; 13(3); 275-285. IF: 2.238
Winkler, C.; Schroecksnadel, K.; Ledochowski, M.; Schennach, H.; Houcher, B.; Fuchs, D.: In vitro
Effects of Nigella sativa Seeds Extracts on Stimulated Peripheral Blood Mononuclear Cells.
PTERIDINES. 2008; 19(4); 101. IF: 0.706
34
Wolfram, D.; Oberreiter, B.; Mayerl, C.; Soelder, E.; Ulmer, H.; Piza-Katzer, H.; Wick, G.; Backovic,
A.: Altered systemic serologic parameters in patients with silicone mammary implants.
IMMUNOLOGY LETTERS. 2008; 118(1); 96-100. IF: 2.858 Wollensak, G.; Redl, B.: Gel electrophoretic analysis of corneal collagen after photodynamic crosslinking treatment. CORNEA. 2008; 27(3); 353-356. IF: 1.853 Yegnasubramanian, S.; Haffner, MC.; Zhang, YG.; Gurel, B.; Cornish, TC.; Wu, ZJ.; Irizarry, RA.;
Morgan, J.; Hicks, J.; DeWeese, TL.; Isaacs, WB.; Bova, GS.; De Marzo, AM.; Nelson, WG.: DNA
Hypomethylation Arises Later in Prostate Cancer Progression than CpG Island Hypermethylation
and Contributes to Metastatic Tumor Heterogeneity. CANCER RESEARCH. 2008; 68(21);
8954-8967. IF: 7.514 (
Yilmaz, A.; Price, RW.; Spudich, S.; Fuchs, D.; Hagberg, L.; Gisslen, M.: Persistent intrathecal
immune activation in HIV-1-infected individuals on antiretroviral therapy. JAIDS-JOURNAL OF
ACQUIRED IMMUNE DEFICIENCY SYNDROMES. 2008; 47(2); 168-173. IF: 4.570 zur Nedden, S.; Tomaselli, B.; Baier-Bitterlich, G.: HIF-1 alpha is an essential effector for purine
nucleoside-mediated neuroprotection against hypoxia in PC12 cells and primary cerebellar granule
neurons. JOURNAL OF NEUROCHEMISTRY. 2008; 105(5); 1901-1914. IF: 4.500 Proceedings Papers
Neurauter, G.; Sperner-Unterweger, B.; Ledochowski, M.; Fuchs, D.: Tryptophan and phenylalanine
in systemic and CNS inflammatory disorders. ACTA NEUROPSYCHIATRICA. 2008; 20(7); 5-6. IF:
1.380 Reviews
Brandacher, G.; Margreiter, R.; Fuchs, D.: Clinical relevance of indoleamine 2,3-dioxygenase for
alloimmunity and transplantation. CURRENT OPINION IN ORGAN TRANSPLANTATION. 2008; 13
(1); 10-15. IF: 0.435 Brosch, G.; Loidl, P.; Graessle, S.: Histone modifications and chromatin dynamics: a focus on
filamentous fungi. FEMS MICROBIOLOGY REVIEWS. 2008; 32(3); 409-439. IF: 7.963 Chu, IM.; Hengst, L.; Slingerland, JM.: The Cdk inhibitor p27 in human cancer: prognostic potential
and relevance to anticancer therapy. NATURE REVIEWS CANCER. 2008; 8(4); 253-267. IF: 30.762
Gu, YS.; Kong, J.; Cheema, GS.; Keen, CL.; Wick, G.; Gershwin, ME.: The immunobiology of
systemic sclerosis. SEMINARS IN ARTHRITIS AND RHEUMATISM. 2008; 38(2); 132-160. IF:
4.379 Haas, H.; Eisendle, M.; Turgeon, BG.: Siderophores in fungal physiology and virulence. ANNUAL
REVIEW OF PHYTOPATHOLOGY. 2008; 46(1); 149-187.
IF: 10.237 The Biocenter
2009
Publications 2008
Original Publications
Labi, V.; Grespi, F.; Baumgartner, F.; Villunger, A.: Targeting the Bcl-2-regulated apoptosis pathway
by BH3 mimetics: a breakthrough in anticancer therapy? CELL DEATH AND DIFFERENTIATION.
2008; 15(6); 977-987. IF: 7.548
Lindner, HH.: Analysis of histones, histone variants, and their post-translationally modified forms.
ELECTROPHORESIS. 2008; 29(12); 2516-2532. IF: 3.509 Marx, F.; Binder, U.; Leiter, E.; Pocsi, I.: The Penicillium chrysogenum antifungal protein PAF, a
promising tool for the development of new antifungal therapies and fungal cell biology studies.
CELLULAR AND MOLECULAR LIFE SCIENCES. 2008; 65(3); 445-454. IF: 5.511
Morandell, S.; Stasyk, T.; Skvortsov, S.; Ascher, S.; Huber, LA.: Quantitative proteomics and
phosphoproteomics reveal novel insights into complexity and dynamics of the EGFR signaling
network. PROTEOMICS. 2008; 8(21); 4383-4401. IF: 4.586
Barrientos, G.; Fuchs, D.; Schrocksnadel, K.; Ruecke, M.; Garcia, MG.; Klapp, BF.; Raghupathy,
R.; Miranda, S.; Arck, PC.; Blois, SM.: Low levels of serum asymmetric antibodies as a marker of
threatened pregnancy. JOURNAL OF REPRODUCTIVE IMMUNOLOGY. 2009; 79(2); 201-210. IF:
2.778
Batta, G.; Barna, T.; Gaspari, Z.; Sandor, S.; Kover, KE.; Binder, U.; Sarg, B.; Kaiserer, L.; Chhillar,
AK.; Eigentler, A.; Leiter, E.; Hegedus, N.; Pocsi, I.; Lindner, H.; Marx, F.: Functional aspects of the
solution structure and dynamics of PAF - a highly-stable antifungal protein from Penicillium
chrysogenum. FEBS JOURNAL. 2009; 276(10); 2875-2890. IF: 3.139
Berlato, C.; Doppler, W.: Selective Response to Insulin Versus Insulin-Like Growth Factor-I and -II
and Up-Regulation of Insulin Receptor Splice Variant B in the Differentiated Mouse Mammary
Epithelium. ENDOCRINOLOGY. 2009; 150(6); 2924-2933. IF: 4.945 Morettini, S.; Podhraski, V.; Lusser, A.: ATP-dependent chromatin remodeling enzymes and their
various roles in cell cycle control. FRONTIERS IN BIOSCIENCE. 2008; 13(3); 5522-5532. IF: 3.308 Boasso, A.; Vaccari, M.; Fuchs, D.; Hardy, AW.; Tsai, WP.; Tryniszewska, E.; Shearer, GM.;
Franchini, G.: Combined Effect of Antiretroviral Therapy and Blockade of IDO in SIV-Infected
Rhesus Macaques. JOURNAL OF IMMUNOLOGY. 2009; 182(7); 4313-4320. IF: 6.000
Neurauter, G.; Schrocksnadel, K.; Scholl-Burgi, S.; Sperner-Unterweger, B.; Schubert, C.;
Ledochowski, M.; Fuchs, D.: Chronic immune stimulation correlates with reduced phenylalanine
turnover. CURRENT DRUG METABOLISM. 2008; 9(7); 622-627. IF: 4.350 Capuron, L.; Moranis, A.; Combe, N.; Cousson-Gelie, F.; Fuchs, D.; De Smedt-Peyrusse, V.;
Barberger-Gateau, P.; Laye, S.: Vitamin E status and quality of life in the elderly: influence of
inflammatory processes. BRITISH JOURNAL OF NUTRITION. 2009; 102(10); 1390-1394. IF: 2.764
Pinon, JD.; Labi, V.; Egle, A.; Villunger, A.: Bmf and Bmf in tissue homeostasis and malignant
disease. ONCOGENE. 2008; 27(9); S41-S52. IF: 7.216 Castets, P.; Maugenre, S.; Gartioux, C.; Rederstorff, M.; Krol, A.; Lescure, A.; Tajbakhsh, S.;
Allamand, V.; Guicheney, P.: Selenoprotein N is dynamically expressed during mouse development
and detected early in muscle precursors. BMC DEVELOPMENTAL BIOLOGY. 2009; 9(3); IF: 3.079
Ploner, C.; Kofler, R.; Villunger, A.: Noxa: at the tip of the balance between life and death.
ONCOGENE. 2008; 27(9); S84-S92. IF: 7.216 Rymarquis, LA.; Kastenmayer, JP.; Huttenhofer, AG.; Green, PJ.: Diamonds in the rough: mRNAlike non-coding RNAs. TRENDS IN PLANT SCIENCE. 2008; 13(7); 329-334. IF: 9.210 Sgonc, R.; Wick, G.: Pro- and anti-fibrotic effects of TGF-beta in scleroderma. RHEUMATOLOGY.
2008; 47(2); V5-V7. IF: 4.136 Wick, MC.; Kremser, C.; Frischauf, S.; Wick, G.: In vivo molecular imaging of vascular stress. CELL
STRESS & CHAPERONES. 2008; 13(3); 263-273. IF: 2.238
100 Publications in 2008
Dohnal, AM.; Luger, R.; Paul, P.; Fuchs, D.; Felzmann, T.: CD40 ligation restores type 1 polarizing
capacity in TLR4-activated dendritic cells that have ceased interleukin-12 expression. JOURNAL
OF CELLULAR AND MOLECULAR MEDICINE. 2009; 13(8B); 1741-1750. IF: 5.114 Ecker, K.; Lorenz, A.; Wolf, F.; Ploner, C.; Bock, G.; Duncan, T.; Geley, S.; Helmberg, A.: A RAS
recruitment screen identifies ZKSCAN4 as a glucocorticoid receptor-interacting protein. JOURNAL
OF MOLECULAR ENDOCRINOLOGY. 2009; 42(1-2); 105-117. IF: 3.225
Eisenmann, A.; Murr, C.; Fuchs, D.; Ledochowski, M.: Gliadin IgG antibodies and circulating
immune complexes. SCANDINAVIAN JOURNAL OF GASTROENTEROLOGY. 2009; 44(2);
168-171. IF: 1.980
35
The Biocenter
Publications 2009
Garczarczyk, D.; Toton, E.; Biedermann, V.; Rosivatz, E.; Rechfeld, F.; Rybczynska, M.; Hofmann,
J.: Signal transduction of constitutively active protein kinase C epsilon. CELLULAR SIGNALLING.
2009; 21(5); 745-752. IF: 4.305 Heinke, R.; Spannhoff, A.; Meier, R.; Trojer, P.; Bauer, I.; Jung, M.; Sippl, W.: Virtual Screening and
Biological Characterization of Novel Histone Arginine Methyltransferase PRMT1 Inhibitors.
CHEMMEDCHEM. 2009; 4(1); 69-77. IF: 3.150 Girgin, G.; Baydar, T.; Ledochowski, M.; Schennach, H.; Bolukbasi, DN.; Sorkun, K.; Salih, B.;
Sahin, G.; Fuchs, D.: Immunomodulatory effects of Turkish propolis: Changes in neopterin release
and tryptophan degradation. IMMUNOBIOLOGY. 2009; 214(2); 129-134. IF: 3.461
Heiss, EH.; Schachner, D.; Werner, ER.; Dirsch, VM.: Active NF-E2-related Factor (Nrf2)
Contributes to Keep Endothelial NO Synthase (eNOS) in the Coupled State ROLE OF REACTIVE
OXYGEN SPECIES (ROS), eNOS, AND HEME OXYGENASE (HO-1) LEVELS. JOURNAL OF
BIOLOGICAL CHEMISTRY. 2009; 284(46); 31579-31586. IF: 5.520
Girgin, Gozde; Tolga Sahin, Tevfik; Fuchs, Dietmar; Kasuya, Hideki; Yuksel, Osman; Tekin,
Ercument; Baydar, Terken: Immune system modulation in patients with malignant and benign
breast disorders: tryptophan degradation and serum neopterin. INTERNATIONAL JOURNAL OF
BIOLOGICAL MARKERS. 2009; 24(4); 265-270. IF: 1.265
Grammer, TB.; Fuchs, D.; Boehm, BO.; Winkelmann, BR.; Maerz, W.: Neopterin as a Predictor of
Total and Cardiovascular Mortality in Individuals Undergoing Angiography in the Ludwigshafen Risk
and Cardiovascular Health Study. CLINICAL CHEMISTRY. 2009; 55(6); 1135-1146. IF: 5.579
Greksova, K.; Parrak, V.; Chovancova, D.; Stencl, P.; Oravec, J.; Marsik, L.; Sysak, R.; Fuchs, D.;
Peskova, Z.; Borovsky, M.: Procalcitonin, neopterin and C-reactive protein in diagnostics of
intrauterine infection and preterm delivery. BRATISLAVSKE LEKARSKE LISTY. 2009; 110(10);
623-626.
Grundtman, C.; Lundberg, IE.: Vascular involvement in the pathogenesis of idiopathic inflammatory
myopathies. AUTOIMMUNITY. 2009; 42(7); 615-626. IF: 2.525
Gu, YY.; Harley, IT. W.; Henderson, LB.; Aronow, BJ.; Vietor, I.; Huber, LA.; Harley, JB.; Kilpatrick,
JR.; Langefeld, CD.; Williams, AH.; Jegga, AG.; Chen, J.; Wills-Karp, M.; Arshad, SH.; Ewart, SL.;
Thio, CL.; Flick, LM.; Filippi, MD.; Grimes, HL.; Drumm, ML.; Cutting, GR.; Knowles, MR.; Karp,
CL.: Identification of IFRD1 as a modifier gene for cystic fibrosis lung disease. NATURE. 2009; 458
(7241); 1039-U119. IF: 31.434
Haffner, MC.; Kronberger, IE.; Ross, JS.; Sheehan, CE.; Zitt, M.; Muhlmann, G.; Ofner, D.; Zelger,
B.; Ensinger, C.; Yang, XM. J.; Geley, S.; Margreiter, R.; Bander, NH.: Prostate-specific membrane
antigen expression in the neovasculature of gastric and colorectal cancers. HUMAN PATHOLOGY.
2009; 40(12); 1754-1761. IF: 3.322
36
Hautz, T.; Brandacher, G.; Zelger, B.; Muller, HG.; Lee, AW. P.; Fuchs, D.; Margreiter, R.;
Schneeberger, S.: Indoleamine 2,3-Dioxygenase and Foxp3 Expression in Skin Rejection of Human
Hand Allografts. TRANSPLANTATION PROCEEDINGS. 2009; 41(2); 509-512. IF: 1.055
Hofmann, J.; Easmon, J.; Puerstinger, G.; Heinisch, G.; Jenny, M.; Shtil, AA.; Hermann, M.;
Condorelli, DF.; Scire, S.; Musumarra, G.: N-benzoxazol-2-yl-N'-1-(isoquinolin-3-yl-ethylidene)hydrazine, a novel compound with antitumor activity, induces radicals and dissipation of
mitochondrial membrane potential. INVESTIGATIONAL NEW DRUGS. 2009; 27(3); 189-202. IF:
3.396
Huntington, ND.; Labi, V.; Cumano, A.; Vieira, P.; Strasser, A.; Villunger, A.; Di Santo, JP.; Alves,
NL.: Loss of the pro-apoptotic BH3-only Bcl-2 family member Bim sustains B lymphopoiesis in the
absence of IL-7. INTERNATIONAL IMMUNOLOGY. 2009; 21(6); 715-725. IF: 3.181 Hutzinger, R.; Feederle, R.; Mrazek, J.; Schiefermeier, N.; Balwierz, PJ.; Zavolan, M.; Polacek, N.;
Delecluse, HJ.; Huttenhofer, A.: Expression and Processing of a Small Nucleolar RNA from the
Epstein-Barr Virus Genome. PLOS PATHOGENS. 2009; 5(8); IF: 9.125
Jenny, M.; Santer, E.; Klein, A.; Ledochowski, M.; Schennach, H.; Ueberall, F.; Fuchs, D.: Cacao
extracts suppress tryptophan degradation of mitogen-stimulated peripheral blood mononuclear
cells. JOURNAL OF ETHNOPHARMACOLOGY. 2009; 122(2); 261-267. IF: 2.260
Jenny, M.; Santer, E.; Pirich, E.; Schennach, H.; Fuchs, D.: Delta 9-Tetrahydrocannabinol and
cannabidiol modulate mitogen-induced tryptophan degradation and neopterin formation in
peripheral blood mononuclear cells in vitro. JOURNAL OF NEUROIMMUNOLOGY. 2009; 207(1-2);
75-82. IF: 3.159 Jochl, C.; Loh, E.; Ploner, A.; Haas, H.; Huettenhofer, A.: Development-dependent scavenging of
nucleic acids in the filamentous fungus Aspergillus fumigatus. RNA BIOLOGY. 2009; 6(2); 179-186.
Jurgens, B.; Hainz, U.; Fuchs, D.; Felzmann, T.; Heitger, A.: Interferon-gamma-triggered
indoleamine 2,3-dioxygenase competence in human monocyte-derived dendritic cells induces
regulatory activity in allogeneic T cells. BLOOD. 2009; 114(15); 3235-3243. IF: 10.432
The Biocenter
Publications 2009
Kauer, Maximilian; Ban, Jozef; Kofler, Reinhard; Walker, Bob; Davis, Sean; Meltzer, Paul; Kovar,
Heinrich: A molecular function map of Ewing's sarcoma. PLOS ONE. 2009; 4(4); e5415.
Kern, J.; Untergasser, G.; Zenzmaier, C.; Sarg, B.; Gastl, G.; Gunsilius, E.; Steurer, M.: GRP-78
secreted by tumor cells blocks the antiangiogenic activity of bortezomib. BLOOD. 2009; 114(18);
3960-3967. IF: 10.432 4
Kienzl, K.; Sarg, B.; Golderer, G.; Obrist, P.; Werner, ER.; Werner-Felmayer, G.; Lindner, H.;
Maglione, M.; Schneeberger, S.; Margreiter, R.; Brandacher, G.: Proteomic Profiling of Acute
Cardiac Allograft Rejection. TRANSPLANTATION. 2009; 88(4); 553-560. IF: 1.417 Knoflach, M.; Kiechl, S.; Penz, D.; Zangerle, A.; Schmidauer, C.; Rossmann, A.; Shingh, M.;
Spallek, R.; Griesmacher, A.; Bernhard, D.; Robatscher, P.; Buchberger, W.; Draxl, W.; Willeit, J.;
Wick, G.: Cardiovascular Risk Factors and Atherosclerosis in Young Women Atherosclerosis Risk
Factors in Female Youngsters (ARFY Study). STROKE. 2009; 40(4); 1063-1069. IF: 6.499
Kurz, K.; Teerlink, T.; Sarcletti, M.; Weis, G.; Zangerle, R.; Fuchs, D.: Plasma concentrations of the
cardiovascular risk factor asymmetric dimethylarginine (ADMA) are increased in patients with HIV-1
infection and correlate with immune activation markers. PHARMACOLOGICAL RESEARCH. 2009;
60(6); 508-514. IF: 3.287
Loeffler-Ragg, J.; Mueller, D.; Gamerith, G.; Auer, T.; Skvortsov, S.; Sarg, B.; Skvortsova, I.;
Schmitz, KJ.; Martin, HJ.; Krugmann, J.; Alakus, H.; Maser, E.; Menzel, J.; Hilbe, W.; Lindner, H.;
Schmid, KW.; Zwierzina, H.: Proteomic identification of aldo-keto reductase AKR1B10 induction
after treatment of colorectal cancer cells with the proteasome inhibitor bortezomib. MOLECULAR
CANCER THERAPEUTICS. 2009; 8(7); 1995-2006. IF: 5.003 Malinowska, K.; Cavarretta, IT.; Susani, M.; Wrulich, OA.; Uberall, F.; Kenner, L.; Culig, Z.:
Identification of mu-Crystallin as an Androgen-Regulated Gene in Human Prostate Cancer.
PROSTATE. 2009; 69(10); 1109-1118. IF: 3.069 Malinowska, K.; Neuwirt, H.; Cavarretta, IT.; Bektic, J.; Steiner, H.; Dietrich, H.; Moser, PL.; Fuchs,
D.; Hobisch, A.; Culig, Z.: Interleukin-6 stimulation of growth of prostate cancer in vitro and in vivo
through activation of the androgen receptor. ENDOCRINE-RELATED CANCER. 2009; 16(1);
155-169. IF: 5.236
Manzl, C.; Krumschnabel, G.; Bock, F.; Sohm, B.; Labi, V.; Baumgartner, F.; Logette, E.; Tschopp,
J.; Villunger, A.: Caspase-2 activation in the absence of PIDDosome formation. JOURNAL OF
CELL BIOLOGY. 2009; 185(2); 291-303. IF: 9.120 Massoner, P.; Colleselli, D.; Matscheski, A.; Pircher, H.; Geley, S.; Durr, PJ.; Klocker, H.: Novel
mechanism of IGF-binding protein-3 action on prostate cancer cells: inhibition of proliferation,
adhesion, and motility. ENDOCRINE-RELATED CANCER. 2009; 16(3); 795-808. IF: 5.236
Messner, S.; Leitner, S.; Bommassar, C.; Golderer, G.; Grobner, P.; Werner, ER.; Werner-Felmayer,
G.: Physarum nitric oxide synthases: genomic structures and enzymology of recombinant proteins.
BIOCHEMICAL JOURNAL. 2009; 418(1); 691-700. IF: 4.371 Moheno, P.; Pfleiderer, W.; Fuchs, D.: Plasma cytokine concentration changes induced by the
antitumor agents dipterinyl calcium pentahydrate (DCP) and related calcium pterins.
IMMUNOBIOLOGY. 2009; 214(2); 135-141. IF: 3.461
Moroder, H.; Steger, J.; Graber, D.; Fauster, K.; Trappl, K.; Marquez, V.; Polacek, N.; Wilson, DN.;
Micura, R.: Non-Hydrolyzable RNA-Peptide Conjugates: A Powerful Advance in the Synthesis of
Mimics for 3 '-Peptidyl tRNA Termini. ANGEWANDTE CHEMIE-INTERNATIONAL EDITION. 2009;
48(22); 4056-4060. IF: 10.879
Murr, C.; Meinitzer, A.; Grammer, T.; Schroecksnadel, K.; Bohm, BO.; Marz, W.; Fuchs, D.:
Association between Asymmetric Dimethylarginine and Neopterin in Patients with and without
Angiographic Coronary Artery Disease. SCANDINAVIAN JOURNAL OF IMMUNOLOGY. 2009; 70
(1); 63-67. IF: 2.186
Murr, C.; Winklhofer-Roob, BM.; Schroecksnadel, K.; Maritschnegg, M.; Mangge, H.; Bohm, BO.;
Winkelmann, BR.; Marz, W.; Fuchs, D.: Inverse association between serum concentrations of
neopterin and antioxidants in patients with and without angiographic coronary artery disease.
ATHEROSCLEROSIS. 2009; 202(2); 543-549. IF: 4.601
Nandy, C.; Mrazek, J.; Stoiber, H.; Grasser, FA.; Huttenhofer, A.; Polacek, N.: Epstein-Barr VirusInduced Expression of a Novel Human Vault RNA. JOURNAL OF MOLECULAR BIOLOGY. 2009;
388(4); 776-784. IF: 4.146 Neuwirt, H.; Puhr, M.; Santer, FR.; Susani, M.; Doppler, W.; Marcias, G.; Rauch, V.; Brugger, M.;
Hobisch, A.; Kenner, L.; Culig, Z.: Suppressor of Cytokine Signaling (SOCS)-1 Is Expressed in
Human Prostate Cancer and Exerts Growth-Inhibitory Function through Down-Regulation of
Cyclins and Cyclin-Dependent Kinases. AMERICAN JOURNAL OF PATHOLOGY. 2009; 174(5);
1921-1930. IF: 5.697 Nordigarden, A.; Kraft, M.; Eliasson, P.; Labi, V.; Lam, EW. F.; Villunger, A.; Jonsson, JI.: BH3-only
protein Bim more critical than Puma in tyrosine kinase inhibitor-induced apoptosis of human
leukemic cells and transduced hematopoietic progenitors carrying oncogenic FLT3. BLOOD. 2009;
113(10); 2302-2311. IF: 10.432 37
The Biocenter
Publications 2009
Obexer, P.; Hagenbuchner, J.; Rupp, M.; Salvador, C.; Holzner, M.; Deutsch, M.; Porto, V.; Kofler,
R.; Unterkircher, T.; Ausserlechner, MJ.: p16(INK4A) Sensitizes Human Leukemia Cells to FAS- and
Glucocorticoid-induced Apoptosis via Induction of BBC3/Puma and Repression of MCL1 and
BCL2. JOURNAL OF BIOLOGICAL CHEMISTRY. 2009; 284(45); 30933-30940. IF: 5.520
Obexer, P.; Hagenbuchner, J.; Unterkircher, T.; Sachsenmaier, N.; Seifarth, C.; Bock, G.; Porto, V.;
Geiger, K.; Ausserlechner, M.: Repression of BIRC5/Survivin by FOXO3/FKHRL1 Sensitizes Human
Neuroblastoma Cells to DNA Damage-induced Apoptosis. MOLECULAR BIOLOGY OF THE CELL.
2009; 20(7); 2041-2048. IF: 5.558 Parajuli, N.; Doppler, W.: Precision-cut slice cultures of tumors from MMTV-neu mice for the study
of the ex vivo response to cytokines and cytotoxic drugs. IN VITRO CELLULAR &
DEVELOPMENTAL BIOLOGY-ANIMAL. 2009; 45(8); 442-450. IF: 0.576
Pedersen, AW.; Holmstrom, K.; Jensen, SS.; Fuchs, D.; Rasmussen, S.; Kvistborg, P.; Claesson,
MH.; Zocca, MB.: Phenotypic and functional markers for 1 alpha,25-dihydroxyvitamin D-3-modified
regulatory dendritic cells. CLINICAL AND EXPERIMENTAL IMMUNOLOGY. 2009; 157(1); 48-59. IF:
2.853
Ploder, M.; Spittler, A.; Schroecksnadel, K.; Neurauter, G.; Pelinka, LE.; Roth, E.; Fuchs, D.:
Tryptophan degradation in multiple trauma patients: survivors compared with non-survivors.
CLINICAL SCIENCE. 2009; 116(7-8); 593-598. IF: 4.187 Ploder, M.; Spittler, A.; Schroecksnadel, K.; Neurauter, G.; Pelinka, LE.; Roth, E.; Fuchs, D.:
Accelerated Tryptophan Degradation in Trauma and Sepsis Patients is Related to Pro-inflammatory
Response and to the Diminished in vitro Response of Monocytes. PTERIDINES. 2009; 20(2);
54-61. IF: 0.706
38
Rainer, TH.; Chan, CP. Y.; Leung, MF.; Leung, W.; Ip, M.; Lee, N.; Cautherley, GW. H.; Graham,
CA.; Fuchs, D.; Renneberg, R.: Diagnostic utility of CRP to neopterin ratio in patients with acute
respiratory tract infections. JOURNAL OF INFECTION. 2009; 58(2); 123-130. IF: 3.089
Rieder, U.; Lang, K.; Kreutz, C.; Polacek, N.; Micura, R.: Evidence for Pseudoknot Formation of
Class I preQ(1) Riboswitch Aptamers. CHEMBIOCHEM. 2009; 10(7); 1141-1144. IF: 3.322 Rothmeier, AS.; Ischenko, I.; Joore, J.; Garczarczyk, D.; Furst, R.; Bruns, CJ.; Vollmar, AM.; Zahler,
S.: Investigation of the marine compound spongistatin 1 links the inhibition of PKC alpha
translocation to nonmitotic effects of tubulin antagonism in angiogenesis. FASEB JOURNAL. 2009;
23(4); 1127-1137. IF: HOLOGY. 2009; 42(1); 67-68. IF: 1.417 Sabiha, Y.; Abt, B.; Schrettl, M.; Moussa, TA. A.; Werner, ER.; Haas, H.: The interplay between iron
and zinc metabolism in Aspergillus fumigatus. FUNGAL GENETICS AND BIOLOGY. 2009; 46(9);
707-713. IF: 3.005 Samaee, SM.; Lahnsteiner, F.; Gimenez, G.; Estevez, A.; Sarg, B.; Lindner, H.: Quantitative
Composition of Vitellogenin-Derived Yolk Proteins and Their Effects on Viability of Embryos and
Larvae of Common Dentex (Dentex dentex), a Marine Pelagophil Teleost. JOURNAL OF
EXPERIMENTAL ZOOLOGY. PART A, ECOLOGICAL GENETICS AND PHYSIOLOGY. 2009; 311A
(7); 504-520.
Sarg, B.; Chwatal, S.; Talasz, H.; Lindner, HH.: Testis-specific Linker Histone H1t Is Multiply
Phosphorylated during Spermatogenesis IDENTIFICATION OF PHOSPHORYLATION SITES.
JOURNAL OF BIOLOGICAL CHEMISTRY. 2009; 284(6); 3610-3618. IF: 5.52´0
Ploner, A.; Ploner, C.; Lukasser, M.; Niederegger, H.; Huttenhofer, A.: Methodological obstacles in
knocking down small noncoding RNAs. RNA-A PUBLICATION OF THE RNA SOCIETY. 2009; 15
(10); 1797-1804. IF: 5.018 Schroecksnadel, K.; Winkler, C.; Sarcletti, M.; Romani, N.; Banki, Z.; Ebner, S.; Fuchs, D.;
Zangerle, R.: Parameters of Soluble Immune Activation In Vivo Correlate Negatively With the
Proliferative Capacity of Peripheral Blood Mononuclear Cells In Vitro in HIV-Infected Patients.
JAIDS-JOURNAL OF ACQUIRED IMMUNE DEFICIENCY SYNDROMES. 2009; 50(4); 354-359. IF:
4.570
Ploner, C.; Rainer, J.; Lobenwein, S.; Geley, S.; Kofler, R.: Repression of the BH3-only molecule
PMAIP1/Noxa impairs glucocorticoid sensitivity of acute lymphoblastic leukemia cells.
APOPTOSIS. 2009; 14(6); 821-828. IF: 3.971 Schroecksnadel, K.; Winkler, C.; Werner, ER.; Sarcletti, M.; Romani, N.; Ebner, S.; Schennach, H.;
Fuchs, D.; Zangerle, R.: Interferon-gamma-mediated pathways and in vitro PBMC proliferation in
HIV-infected patients. BIOLOGICAL CHEMISTRY. 2009; 390(2); 115-123. IF: 3.035
Rainer, J.; Ploner, C.; Jesacher, S.; Ploner, A.; Eduardoff, M.; Mansha, M.; Wasim, M.; PanzerGrumayer, R.; Trajanoski, Z.; Niederegger, H.; Kofler, R.: Glucocorticoid-regulated microRNAs and
mirtrons in acute lymphoblastic leukemia. LEUKEMIA. 2009; 23(4); 746-752. IF: 8.634
Schubert, C.; Lampe, A.; Geser, W.; Merk, M.; Jenny, M.; Fuchs, D.: Temporal Association
Between Daily Alcohol Consumption, Emotional States and Urinary Neopterin Levels in a Patient
with Systemic Lupus Erythematosus. PTERIDINES. 2009; 20(2); 62-72. IF: 0.706 Sehranz, M.; Talasz, H.; Graziadei, I.; Winder, T.; Sergi, C.; Bogner, K.; Vogel, W.; Zoller, H.:
Diagnosis of Hepatic Iron Overload A Family Study Illustrating Pitfalls in Diagnosing
Hemochromatosis. DIAGNOSTIC MOLECULAR PATHOLOGY. 2009; 18(1); 53-60. IF: 1.770 The Biocenter
Publications 2009
Proceedings Papers
Shi, MG.; Vivian, CJ.; Lee, KJ.; Ge, CM.; Morotomi-Yano, K.; Manzl, C.; Bock, F.; Sato, S.;
Tomomori-Sato, C.; Zhu, RH.; Haug, JS.; Swanson, SK.; Washburn, MP.; Chen, DJ.; Chen, BP. C.;
Villunger, A.; Florens, L.; Du, CY.: DNA-PKcs-PIDDosome: A Nuclear Caspase-2-Activating
Complex with Role in G2/M Checkpoint Maintenance. CELL. 2009; 136(3); 508-520. IF:
31.253417 Hautz, T.; Brandacher, G.; Zelger, B.; Muller, HG.; Lee, AW. P.; Fuchs, D.; Margreiter, R.;
Schneeberger, S.: Indoleamine 2,3-Dioxygenase and Foxp3 Expression in Skin Rejection of Human
Hand Allografts. TRANSPLANTATION PROCEEDINGS. 2009; 41(2); 509-512. Sigl, R.; Wandke, C.; Rauch, V.; Kirk, J.; Hunt, T.; Geley, S.: Loss of the mammalian APC/C
activator FZR1 shortens G1 and lengthens S phase but has little effect on exit from mitosis.
JOURNAL OF CELL SCIENCE. 2009; 122(22); 4208-4217. IF: 6.247
Pulkki, K.; Suvisaari, J.; Collinson, P.; Ravkilde, J.; Stavljenic-Rukavina, A.; Hammerer-Lercher, A.;
Baum, H.; van Dieijen-Visser, MP.; Laitinen, P.: A pilot survey of the use and implementation of
cardiac markers in acute coronary syndrome and heart failure across Europe The CARdiac MArker
Guideline Uptake in Europe (CARMAGUE) study.
CLINICAL CHEMISTRY AND LABORATORY MEDICINE. 2009; 47(2); 227-234. IF: 1.888 Subramanyam, P.; Obermair, GJ.; Baumgartner, S.; Gebhart, M.; Striessnig, J.; Kaufmann, WA.;
Geley, S.; Flucher, BE.: Activity and calcium regulate nuclear targeting of the calcium channel beta
(4b) subunit in nerve and muscle cells. CHANNELS (AUSTIN, TEX.). 2009; 3(5); 42-54. IF: 1.513 Unterluggauer, H.; Micutkova, L.; Lindner, H.; Sarg, B.; Hernebring, M.; Nystrom, T.; Jansen-Durr,
P.: Identification of Hsc70 as target for AGE modification in senescent human fibroblasts.
BIOGERONTOLOGY. 2009; 10(3); 299-309. IF: 3.000
Talasz, H.; Sarg, B.; Lindner, HH.: Site-specifically phosphorylated forms of H1.5 and H1.2
localized at distinct regions of the nucleus are related to different processes during the cell cycle.
CHROMOSOMA. 2009; 118(6); 693-709. IF: 5.111 Reviews
Wallner, A.; Blatzer, M.; Schrettl, M.; Sarg, B.; Lindner, H.; Haas, H.: Ferricrocin, a Siderophore
Involved in Intra- and Transcellular Iron Distribution in Aspergillus fumigatus. APPLIED AND
ENVIRONMENTAL MICROBIOLOGY. 2009; 75(12); 4194-4196. IF: 3.801 Frenzel, A.; Grespi, F.; Chmelewskij, W.; Villunger, A.: Bcl2 family proteins in carcinogenesis and the
treatment of cancer. APOPTOSIS. 2009; 14(4); 584-596. IF: 3.971 Watschinger, K.; Keller, MA.; Hermetter, A.; Golderer, G.; Werner-Felmayer, G.; Werner, ER.:
Glyceryl ether monooxygenase resembles aromatic amino acid hydroxylases in metal ion and
tetrahydrobiopterin dependence. BIOLOGICAL CHEMISTRY. 2009; 390(1); 3-10. IF: 3.035 Weber, Arnim; Kirejczyk, Zofia; Potthoff, Stephanie; Ploner, Christian; Häcker, Georg: Endogenous
Noxa Determines the Strong Proapoptotic Synergism of the BH3-Mimetic ABT-737 with
Chemotherapeutic Agents in Human Melanoma Cells. TRANSLATIONAL ONCOLOGY. 2009; 2(2);
73-83. Worter, V.; Schweigreiter, R.; Kinzel, B.; Mueller, M.; Barske, C.; Bock, G.; Frentzel, S.; Bandtlow,
CE.: Inhibitory Activity of Myelin-Associated Glycoprotein on Sensory Neurons Is Largely
Independent of NgR1 and NgR2 and Resides within Ig-Like Domains 4 and 5. PLOS ONE. 2009; 4
(4); Yamada, T.; Place, N.; Kosterina, N.; Ostberg, T.; Zhang, SJ.; Grundtman, C.; Erlandsson-Harris,
H.; Lundberg, IE.; Glenmark, B.; Bruton, JD.; Westerblad, H.: Impaired Myofibrillar Function in the
Soleus Muscle of Mice With Collagen-Induced Arthritis. ARTHRITIS AND RHEUMATISM. 2009; 60
(11); 3280-3289. IF: 6.787
Ecker, K.; Hengst, L.: Skp2: caught in the Akt. NATURE CELL BIOLOGY. 2009; 11(4); 377-379. IF:
17.774 Fuchs, D.; Avanzas, P.; Arroyo-Espliguero, R.; Jenny, M.; Consuegra-Sanchez, L.; Kaski, JC.: The
Role of Neopterin in Atherogenesis and Cardiovascular Risk Assessment. CURRENT MEDICINAL
CHEMISTRY. 2009; 16(35); 4644-4653. IF: 4.823 Grunicke, HH.: Coordinated Regulation of Ras-, Rac-, and Ca2+-Dependent Signaling Pathways.
CRITICAL REVIEWS IN EUKARYOTIC GENE EXPRESSION. 2009; 19(2); 139-169. IF: 1.947
(2008) / ZIT: 0
Hoeller, D.; Dikic, I.: Targeting the ubiquitin system in cancer therapy. NATURE. 2009; 458(7237);
438-444. IF: 31.434 Kremser, L.; Blaas, D.; Kenndler, E.: Virus analysis using electromigration techniques.
ELECTROPHORESIS. 2009; 30(1); 133-140. IF: 3.509 Krumschnabel, G.; Manzl, C.; Villunger, A.: Caspase-2: killer, savior and safeguard-emerging
versatile roles for an ill-defined caspase. ONCOGENE. 2009; 28(35); 3093-3096. IF: 7.216 Krumschnabel, G.; Podrabsky, JE.: Fish as model systems for the study of vertebrate apoptosis.
APOPTOSIS. 2009; 14(1); 1-21. IF: 3.971 39
The Biocenter
Publications 2009
Krumschnabel, G.; Sohm, B.; Bock, F.; Manzl, C.; Villunger, A.: The enigma of caspase-2: the
laymen's view. CELL DEATH AND DIFFERENTIATION. 2009; 16(2); 195-207. IF: 7.548 Hildgartner, A.; Wilflingseder, D.; Gassner, C.; Dierich, MP.; Stoiber, H.; Banki, Z.: Induction of
complement-mediated lysis of HIV-1 by a combination of HIV-specific and HLA allotype-specific
antibodies. IMMUNOLOGY LETTERS. 2009; 126(1-2); 85-90. IF: 2.858
Kurz, K.; Teerlink, T.; Sarcletti, M.; Weis, G.; Zangerle, R.; Fuchs, D.: Plasma concentrations of the
cardiovascular risk factor asymmetric dimethylarginine (ADMA) are increased in patients with HIV-1
infection and correlate with immune activation markers. PHARMACOLOGICAL RESEARCH. 2009;
60(6); 508-514. IF: 3.287 Scholl-Buergi, S.; Neurauter, G.; Karall, D.; Fuchs, D.: Serum phenylalanine concentrations in
patients post trauma and burn correlate to neopterin concentrations. JOURNAL OF INHERITED
METABOLIC DISEASE. 2009; 32(4); 587-588. IF: 2.691 Mai, A.; Valente, S.; Nebbioso, A.; Simeoni, S.; Ragno, R.; Massa, S.; Brosch, G.; De Bellis, F.;
Manzo, F.; Altucci, L.: New pyrrole-based histone deacetylase inhibitors: Binding mode, enzymeand cell-based investigations. INTERNATIONAL JOURNAL OF BIOCHEMISTRY & CELL BIOLOGY.
2009; 41(1); 235-247. IF: 4.178 Schubert, C.; Neises, M.; Fritzsche, K.; Burbaum, C.; Geser, W.; Ocana-Peinado, FM.; Fuchs, D.;
Hass, R.; Schmid-Ott, G.: Mood and Fatigue in Everyday Life Are Temporally Related to Cellular
Immune Activity Preliminary Evidence from an Extensive Observation of a Patient with Prior Breast
Cancer. PSYCHOPATHOLOGY. 2009; 42(1); 67-68. IF: 1.417
Pictures in a journal
Teis, D.; Saksena, S.; Emr, SD.: SnapShot: The ESCRT Machinery. CELL. 2009; 137(1); IF: 31.253 Biographical Items
Fuchs, D.; Hausen, A.; Murr, C.; Werner-Felmayer, G.; Werner, ER.; Reibnegger, G.: Helmut
Wachter-80 Years - Happy Birthday! PTERIDINES. 2009; 20(3); 113-114. IF: 0.706
Wick, G.: Self and non-self Professor Emeritus. CELLULAR AND MOLECULAR LIFE SCIENCES.
2009; 66(6); 949-961. IF: 5.511
Letters
Eberhart, K.; Renner, K.; Ritter, I.; Kastenberger, M.; Singer, K.; Hellerbrand, C.; Kreutz, M.; Kofler,
R.; Oefner, PJ.: Low doses of 2-deoxy-glucose sensitize acute lymphoblastic leukemia cells to
glucocorticoid-induced apoptosis. LEUKEMIA. 2009; 23(11); 2167-2170. IF: 8.634
Ecker, K.; Hengst, L.: Skp2: caught in the Akt. NATURE CELL BIOLOGY. 2009; 11(4); 377-379. IF:
17.774 (2008) 40
Selected publications of the 2010 formed Division of Bioinformatics
Mlecnik, B., Tosolini, M., Charoentong, P., Kirilovsky, A., Bindea, G., Berger, A., Camus, M., Gillard,
M., Bruneval, P., Fridman, W.H., Pages, F., Trajanoski, Z., Galon, J.: Biomolecular network
reconstruction identifies T cell homing factors associated with survival in colorectal cancer.
GASTROENTEROLOGY. 2010; 138(4):1429-1440.
Galon, J., Costes, A., Sanchez-Cabo, F., Kirilovsky, A., Mlecnik, B., Lagorce, C., Tosolini, M.,
Camus, M., Berger, A., Wind, P., Zinzindohoué, F., Bruneval, P., Cugnenc, P.-H., Trajanoski, Z.,
Fridman, W.-H., Pagès, F.: Type, density, and location of immune cells within human colorectal
tumors predicts clinical outcome. SCIENCE. 2006; 313: 1960-1964.
Hackl, H., Burkard, T., Sturn, A., Fiedler, R., Gaspard, R., Schleiffer, A., Tian, S., Quackenbush, J.,
Eisenhaber, F., Trajanoski, Z.: Molecular processes during fat cell development revealed by gene
expression profiling and functional annotation. GENOME BIOLOGY. 2005; 6: R108
Gruber, G.; Carlet, M.; Turtscher, E.; Meister, B.; Irving, JA. E.; Ploner, C.; Kofler, R.: Levels of
glucocorticoid receptor and its ligand determine sensitivity and kinetics of glucocorticoid-induced
leukemia apoptosis. LEUKEMIA. 2009; 23(4); 820-823. IF: 8.634 Pagès, F., Camus, M., Berger, A., Sanchez-Cabo, F., Costes, A., Molidor, R., Kirilovsky, A., Nilsson,
M., Damotte, D., Bruneval, P., Cugnenc, P.-H., Trajanoski, Z., Fridman W.-F., Galon, J.: Control of
early-metastatic invasion by effector-memory T-cells predicts increased survival of colorectal
cancer. NEW ENGLAND JOURNAL OF MEDICINE. 2005; 353; 2654-2666
Hammerer-Lercher, A.; Griesmacher, A.; Polzl, G.; Brinskelle-Schmal, N.; Mair, J.; Frick, M.; Hawa,
G.: Clinical value of a competitive NT-proBNP enzyme immunoassay compared to the Roche NTproBNP platform. CLINICAL CHEMISTRY AND LABORATORY MEDICINE. 2009; 47(10);
1305-1308. IF: 1.888
Mlecnik, B., Scheideler, M., Hackl, H., Hartler, J., Trajanoski, Z.: PathwayExplorer: web service for
visualizing high-throughput expression data on biological pathways. NUCLEIC ACIDS RESEARCH.
2005; 33; W633-W637
102 Publications in 2009
Grants
The Biocenter
41
Grants
42
The Biocenter
Grants
The Biocenter
43
Grants
44
The Biocenter
Our Staff
The Biocenter
Administration
(1st row)
Martina Barisic
Irina Berger Petra Daum
Melanie Hofer
Gertrude Huber Ines Jaklitsch
Ilona Lengenfelder
Rosanna Nagele
Patrizia Nössing
Angelika Posch Claudia Ram
(2nd row)
Maria Saurer Manuela Villunger-
Gfreiner
Michaela Wildauer
Glassware cleaning (3rd row) Brigitte Andrä
Cicek Aydemir Renate Gamper
Doris Haara
Monika Hertscher Karoline Hörtnagel
Vinca Ljesic Bettina Unterberger
Ayten Yigit
Laboratory assistants (4th row )
Christian Eller Maria Gleinser
Karin Lentsch Lukas Sattler
Stefan Steixner
45
Cooperations & Synergies
Since 2009, the BIOCENTER and the CENTER FOR MOLECULAR
BIOSCIENCES INNSBRUCK organize a yearly LIFESCIENCEMeeting in Igls
near Innsbruck. This 2 days-meeting in a peaceful and quiet rural area should
mutually deepen the knowledge of the scientific activities and interests of these
two institutions, should bring their members together and thus lay the
groundwork for already existing or future interinstitutional/interuniversity collaborations, respectively.
46
Bioinformatics
Zlatko Trajanoski
www.i-med.ac.at/biocenter/bioinformatics.html
Tel.: 0043 (512) 9003.71400
Director
Bioinformatics
Zlatko Trajanoski
The research activities at the Division of Bioinformatics are directed towards
two major thrusts:
1. The development of bioinformatics methods and software tools for largescale biomolecular data. Using state-of-the-art computer science methods and
software engineering, bioinformatics services for genomics, transcriptomics,
and proteomics data are developed, deployed, and maintained.
2. Data integration and modeling biomolecular networks. Specifically, the
research includes the development of methods for the integrative analyses of
heterogenous data sets, and modeling biomolecular networks in cell
differentiation and in cancer. Bioinformatics methods and tools
The flood of data arising from genomic-scale studies using established and
upcoming technologies poses significant challenges for biomedical
researchers. Hence, a computational infrastructure and software tools for the
management and analyses of large-scale biomolecular data are of utmost
importance. We have developed databases and analytical tools for
transcriptomic and proteomic data and applied these methods to address a
number of biological questions raised in our lab and in the labs of our
collaborators.
International cooperations
INSERM 255, Paris, France; Bioinformatics Institute, Singapore; National Cancer
Institute, NIH, Bethesda, MD/USA
Grants
-GEN-AU Bioinformatics Integration Network -FWF SFB Lipotoxocity
Group members: Mihaela Angelova, Pornpimol Charoentong, Andreas Dander, Kalina Duszcka, Maria Fischer, Ralph Galasch, Hubert Hackl, Edith Hofer,
Krogsdam, Stephan Pabinger, Dietmar Rieder, Gernot Stocker
Anne
47
Bioinformatics
Data integration and modeling biomolecular networks For biomedical research and future clinical practice it is an
imperative to integrate disparate data sources including
genomic sequences, gene expression data, proteomics data,
clinical data, and patient-related information, and enable
queries and analyses across the disparate data sources. The
major focus of our research activities is directed towards the
development of computational methods for the integrative data
analyses, and modeling biomolecular networks. A unique feature of our approach is the bidirectional flow of
information between the experimentalists and the
theoreticians. Whilst collaboration was previously successfully
achieved with the experimental partners, the information flow,
by contrast, was always directed from the biologists to the
bioinformaticians, i.e. data were generated for a given
biological question and analyzed using bioinformatics tools.
We are now adding an additional direction of information flow –
from the theoreticians to the experimentalists - and so
strengthen the interaction between these scientific
communities. In particular we are asking biological questions
using computational methods and then testing the resultant
hypotheses using experimental techniques. In this way we
hope to gradually blur the borders between the two scientific
communities and eventually obtain an integrated experimental/
theoretical environment in which challenging biological
problems can be addressed using novel approaches. In this
spirit, we have established collaborations with experimental
partners and identified two scientific questions which are
addressed using combined computational/experimental
methods: a) tumor-immune cell interaction in colorectal cancer
and b) information processing in transcriptional networks. 48
Figure (adapted from Mlecnik et al, Gastroenterology 2010). Biomolecular network reconstruction using gene expression data
in a cohort of patients with colorectal cancer and predicted gene–gene interactions based on available knowledge. The
network shows experimental data (colored nodes) and in silico prediction (white nodes surrounded by a red border). The
network shows the top genes predicted in silico plus the genes analyzed by reverse-transcription PCR. CX3CL1, CXCL9 and
CXCl10 are the top predicted genes and these were subseqently experimentally confirmed.
Biological Chemistry
www.i-med.ac.at/imcbc/molecularcellbiologyfolder/molcellbiol.html
Christine Bandtlow
Tel.: 0043 (512) 9003.70281
email :[email protected]
Interim Director
Peter Gröbner
former director (until 2008)
Fuchs
Golderer
Werner-Felmayer This Division is currently organized in four independent working groups, led by
senior investigators/professors, who attempt to pursue an overlapping,
interdependent, common and sustainable scientific goal, as outlined below. In
the near future, a professor for structural biology will be appointed.
Tel.:
Tel.:
Tel.:
Tel.:
Biochemistry and Biological Significance of CytokineInduced Metabolic Pathways
A major achievement was also our contribution to clarify the molecular mechanism by which H4biopterin catalyses NO formation from L-arginine, which is essentially different from that found in
aromatic amino acid hydroxylases since only one electron is donated and a pterin-radical is
formed. In the following, the relationship of endogenous H4-biopterin levels and its interplay with
NO synthases, peroxynitrite and superoxide was investigated showing that suboptimal cofactor
levels lead to formation of radicals involved in tissue damage.
Identification of neopterin as a marker for T-cell activation dates back to the 1980s. This
was the starting point to further investigate the mechanisms that lead to increased
neopterin formation and to establish its nowadays well-accepted clinical relevance.
Neopterin concentrations are among the best predictors of the future disease course in
patients with cardiovascular disorders, after multiple trauma and with several types of
cancer. In patients with HIV infection neopterin concentrations are even more closely
related with survival than virus load. Monitoring neopterin concentrations also allows
early detection of immunological complications in allograft recipients. Because of its
high sensitivity for early detection of acute virus infections, neopterin screening is
nationwide in use to improve virus safety in blood donation in Austria. Neopterin
concentrations are useful for monitoring therapy and support differentiation between
viral and bacterial lower respiratory tract infections. In addition, a cell-culture test for
pyrogenic contamination based on neopterin detection could be developed and the
monitoring of neopterin concentrations in stimulated peripheral blood mononuclear cells
sensitively allows the detection of pro- and anti-inflammatory effects of drugs, plant
components and chemicals.
Earlier work of our group characterized various cell types and immune stimuli for
increased H4-biopterin formation and we showed for the first time that intracellular H4biopterin levels control cytokine-induced and constitutive NO formation. 0043 (512) 9003.70350
0043 (512) 9003.70332
0043 (512) 9003.70340
0043 (512) 9003.70341
Werner
Radical formation is reduced by ascorbic acid or by trolox, a tocopherol derivative, due to
stabilizing H4-biopterin and thus preventing superoxide formation by impaired NO synthase
function. On the other hand, neopterin is able to amplify deleterious effects of radicals in various
cellular systems and seems to be part of the pro-inflammatory and cytocidal armature of the
activated human macrophage.
Small molecules with central functions
Neopterin is a product of human monocyte-derived macrophages and dendritic cells
formed preferentially in response to interferon-gamma but also to some other proinflammatory stimuli. It stems from 7,8-dihydroneopterin-triphosphate, a metabolite in
the formation of 5,6,7,8-tetrahydrobiopterin (H4-biopterin) from GTP. H4-biopterin is a
cofactor for hydroxylating aromatic amino acids and is hence of crucial importance
for neurotransmitter formation, for nitric oxide (NO) formation from L-arginine, a key
molecule for neurotransmission, blood pressure regulation and immune function, and for
ether lipid monooxygenase (Figure 1, 2 pages later). 49
Pharmacological effects of H4-biopterin In analogy to folates and antifolates, we designed the H4-biopterin-analogue 4-amino-H4-biopterin
and showed that it is an effective inhibitor of all three NO synthase isoenzymes with a preference
for the cytokine-induced enzyme. In vivo, 4-amino-H4-biopterin prolonged allograft survival in a
mouse heart transplantation model with an efficacy comparable to cyclosporine A and rescued rats
from septic shock. However, the immunosuppressive effect of 4-amino-H4-biopterin can not be
entirely explained by its capacity to inhibit NO synthase because in different expe-rimental settings,
the cofactor of NO synthase, i.e. H4-biopterin, and the inhibitor of NO synthase, i.e. 4-amino-H4biopterin, have similar effects. In mouse macrophages, we showed that H4-biopterin and its aminoanalogue added to culture media suppressed NO synthase gene expression via hydrogen peroxide
formation and induced apoptosis. In a mouse model, cardiac allograft survival was prolonged by
both H4-pteridines independently from their effect on NO synthase expression or activity, whereas
on dendritic cells only the amino analogon selectively suppressed MHC class II protein content and
antigen response. Pharmacological effects of H4-biopterin H4-biopterin is formed by three biosynthetic enzymes from guanosine triphosphate (GTP), i.e GTP
cyclohydrolase I, 6-pyruvoyl tetrahydropterin synthase and sepiapterin reductase. We have shown
that cytokines regulate the first step of this biosynthesis, by inducing GTP cyclohydrolase I and
repressing its feedback regulatory protein. Neopterin derivatives accumulate in human cells and in
particular in human macrophages due to a low activity of the second enzyme of the pathway, 6pyruvyol tetrahydropterin synthase. The mechanistic basis of this is selective skipping of exon 3 of
this enzyme in the splicing process which is particularly effective in human macrophages in which
H4-biopterin is undetectable. GTP cyclohydrolase I is induced by cytokines in alternatively spliced
RNAs, and coexpression of the spliced truncated forms of this enzyme cause decrease in activity
and protein, presumably by accelerated decay.
Related pathways and clinical relevance
In conditions leading to increased neopterin formation, i.e. activation of NK and T-cells and hence
of macrophages as well, a number of further cytokines and metabolic pathways are induced
(Figure 2, next page). 50
We were among the first to clone and characterize the novel small T-cell attracting CXC chemokine
CXCL11 and to show its cross-reactivity with other CXC chemokines reacting with the CXCR3
receptor, and its involvement in allograft rejection. A metabolic pathway induced in response to Tcell activation is degradation of the essential amino acid tryptophan by indoleamine 2,3dioxygenase (IDO). Patients with a negative prognosis have increased IDO activities in addition to
increased neopterin levels in a number of conditions. Group members Tanja Hertscheg, Markus Keller, Elena Ledjeff (no picture), Petra
Loitzl, Rita Holzknecht (statt Nina Madl, karnz.), Birgit Schraberger (on maternity
leave, no picture), Sebastian Schröcksnadl, Katrin Watschinger
Like other pathways induced by interferon-gamma, this strategy of the immune system serves to
restrict growth of pathogens or malignant cells but, when getting beyond control, can also lead to
immune deficiency, impairment of erythropoiesis and increased probability to develop depression
because of affecting the serotonin/tryptophan metabolism. Finally there exists a potential
association of subnormal tryptophan degradation and the course of allergy and asthma, as has
been investigated in patients suffering from pollinosis under specific immunotherapy. Physarum nitric oxide synthetase
Physarum polycephalum is a single-cell multinuclear model organism used in cell biology because
of its naturally synchronous cell cycle and its ability to undergo differentiation. Remarkably, this
organism expresses the only thus far known fully functional NO synthase outside the animal
kingdom, an enzyme required by this organism to gain sporulation competence thus establishing a
novel role for the H4-biopterin/NO/cGMP axis in cell differentiation. Moreover, we were involved in
initiating the Physarum genome project which was started in August 2004 by the National Human
Genome Research Institute (NHGRI) following an initiative of an international Physarum Genome
Consortium headed by J. Gott, Cleveland. Together with W. Marwan, Magdeburg, and G.
Gloeckner, Jena, a transcriptome project of the plasmodial stage analysed about half of the protein
coding genes of Physarum, yielding an important resource for the ongoing genome project. In the
near future, these projects will allow to study signalling networks and protein expression related to
cell differentiation in a systematic large-scale approach.
Current focus
Tryptophan degradation is still in focus of our experimental and clinical studies. In an intense
collaboration with the NCI/Bethesda, the role of IDO and its relationship to regulatory T-cells and
dendritic cells in the development of immunodeficiency is investigated in HIV infection and in
experimental SIV infection of rhesus macaques. The influence of tryptophan degradation on the
course of neuropsychiatric symptoms is investigated in patients with HIV infection (e.g. in
collaboration with UCSF) and with cancer. To further characterize the role of immune activation and
inflammation in cardiovascular diseases, the relationship between the metabolism of homocysteine
and asymmetric dimethylarginine (ADMA) is investigated in vitro and in vivo. For investigating a potential influence of immune activation and oxidative stress on the metabolism
of phenylalanine, a new HPLC method is to be developed and clinical collaboration studies are
under way. The relationship between tryptophan metabolism and allergy development will be
further investigated in patients and in vitro. Special attention is given to antioxidant compounds like
vitamins supplements and preservatives. Further experimental studies are devoted to the influence
of plant compounds such as cannabinoids on activated peripheral blood mononuclear cells in vitro.
In the animal models investigated in collaboration with the General and Transplantation Surgery
group, we intend to optimize treatment conditions of H4-biopterin in attenuating ischemia
reperfusion injury with the aim to develop a novel therapeutic strategy also applicable in humans. In our biochemical work, we currently aim to overexpress recombinant Physarum NO synthases in
sufficient quality and quantity to allow crystallization by our cooperation partners at the Scripps
Research Institute, La Jolla, USA. So far, only the oxygenase or reductase domains of NO synthase
were crystallized but not yet the full-length protein. Physarum NO synthases may be sufficiently
different from animal NO synthases and therefore it might be possible to crystallize the full-length
enzyme for the first time. Figure 1: Biosynthesis and known cofactor roles of tetrahydrobiopterin
Another focus of our research is the molecular characterization of glyceryl ether monooxygenase,
an enzyme that may contribute to the metabolic actions of H4-biopterin, the sequence of which is
not yet known. We have developed a 5 orders of magnitude more sensitive assay for this enzyme,
and aim to purify, sequence and characterize the physiological significance of this protein. Related
with this project, we study the metabolic fate of long chain fatty aldehydes using a novel,
fluorescence-labelled compound.
National Cancer Inst, NIH, Bethesda, MD, USA; The Scripps Research Institute, Dept. of Mol. Biol.,
La Jolla, CA, USA; Skaggs Institute for Chemical Biology Deparment.of Surgery, Yale University
School of Medicine, New Haven, CT, USA; NIMH Healthy Living Project, UCSF, San Francisco,
California, USA; Department. of Psychiatry, Oregon Health & Science University, Portland, Oregon,
USA; UKSanRx Pharmaceuticals, San Diego, California, USA; Department of Chemistry, University
of Science and Technology, Hong Kong, HK; Institute for Molecular and Cellular Biology, University
of Jena, D; Leibniz Institute for Age Research – Fritz Lipmann Institute, Jena; Max-Planck Institut
für Dynamik komplexer technischer Systeme; RNA Center, Case Western Reserve Institute,
Cleveland; Institute Francois Magendie, University of Bordeaux II, Bordeaux, F; Department of
Infectious Diseases, Östra Hospital, University of Goeteborg, S; Department of Immunology,
Imperial College London, London, UK; Chirurgische Klinik und Poliklinik, Universität München, D;
Synlab Medizinisches Versorgungszentrum für Labordiagnostik, Heidelberg, D; Department.of
Toxicology, Faculty of Pharmacy, Hacettepe University, Ankara, TR
Additional activities The meeting series “International Winterworkshop on Clinical, Chemical and
Biochemical Aspects of Pteridines” is organized annually. The International Society of Pteridinology
(current president: Dietmar Fuchs) is publishing the peer-reviewed international Journal Pteridines
(current executive editor: Dietmar Fuchs). Figure 2: TH1-type immune response and some of its metabolic effects
In 2007, Gabriele Werner-Felmayer initiated Ethucation at the MUI, a nation-wide network for
introducing bioethics and research ethics in the medical syllabus and for developing an
interdisciplinary dialogue on science, technology & society (more information on the activities of the
network on www.i-med.ac.at/ethucation). This network is the Austrian unit of NIMED (http://
www.unesco-chair-bioethics.org/UI/A01.aspx), an international network of the UNESCO Chair in
Bioethics (IL).
51
Cell Biology
Lukas A. Huber
www.i-med.ac.at/cellbio/
Tel.: 0043 (512) 9003.70171
Director
Signal Transduction & Proteomics
Lukas A. Huber
Mutations in MYO5b cause microvillus inclusion disease
Autosomal recessive microvillus inclusion disease (MVID) is characterized by an
intractable diarrhea starting within the first few weeks of life. The hallmarks of
MVID are a lack of microvilli on the surface of villous enterocytes, occurrence of
intracellular vacuoles lined by microvilli (microvillus inclusions), and the
cytoplasmic accumulation of periodic acid-Schiff (PAS)-positive vesicles in
enterocytes. Recently, we together with our collaborators from the Department
of Pediatrics II, MUI and the Division of Histology and Embryology, MUI, were
the first to identify mutations in MYO5B, encoding the unconventional type Vb
myosin motor protein, in a first cohort of nine MVID patients (Mueller et al.,
Nature Genetics 2008). In a follow up study, we identified 15 novel nonsense
and missense mutations in MYO5B in 11 unrelated MVID patients.
Fluorescence microscopy, Western blotting, and electron microscopy were
applied to analyze the effects of MYO5B siRNA knock-down in polarized,
brush border possessing CaCo-2 cells. Loss of surface microvilli, increased formation of microvillus inclusions, and subapical
enrichment of PAS-positive endomembrane compartments were induced in polarized,
filter-grown CaCo-2 cells, following MYO5B knock-down (see Figure 1). Our data indicate that MYO5B mutations are a major cause of microvillus inclusion
disease and that MYO5B knock-down recapitulates most of the cellular phenotype in
vitro, thus independently showing loss of MYO5B function as the cause of microvillus
inclusion disease (Ruemmele et al., Human Mutation 2010). Meanwhile we have
embarked on generation a MYO5b knockout mouse model. 52
Groups within the Division of Cell Biology
• Signal Transduction & Proteomics
• Cell Differentiation
• Gene Regulation and Molecular Immunology
• Membrane Traffic & Signaling
Lukas A. Huber
Ilja Vietor
Nikos Yannoutsos
David Teis
Cooperations
Division of Histology & Embryology, Medical University of Innsbruck (Michael Hess,
Kristian Pfaller); Pediatric Clinic MUI (Thomas Mueller)
Figure 1: Cell surface phenotype of
CaCo2 cells following MYO5B-siRNA knock-down treatment
© Kristian Pfaller
Group members Mariana Eca Guimaraes de Araujo, Beatrix Fürst, Diana Hilber, Ivan Prokudin, Julia Scheffler, Natalia Schiefermeier, Simon Schnaiter, Taras Stasyk, Nicole Taub, Cornelia Thoeni,
Winfried Wunderlich Cell Biology
www.i-med.ac.at/cellbio/labore/sigtranslab/index.html
Regulation of focal adhesions dynamics and cell migration through p14/MP1/MAP
kinase signaling endosomes Focal adhesions govern cell motility. Asymmetric distribution and dynamics of focal
adhesions rely on a variety of signaling cascades and require polarized cellular
distribution of molecular components. Within the SFB021 and in close collaboration
with the Fässler group (MPI, Munich) we could recently show that late endosomes,
carrying the p14/MP1 MAPK scaffold complex, can move to the cell periphery where
they specifically target focal adhesions. This was the first presentation of MAP kinase
signaling complexes that move along on late endosomes in order to target specific
structures in the cell periphery for signal propagation. In the absence of the p14/MP1
signaling complexes on late endosomes we observed strongly impaired cell migration
and a defect in focal adhesion remodeling. Our data showed further that binding of the
signaling complex through MP1 to the IQ domain of IQGAP1 is required for IQGAP1
localization to the plasma membrane, activation of Rac1 at the leading edge and proper
focal adhesion remodeling. We propose a novel role for late endosomes carrying the
p14/MP1 MAPK scaffold complex in signaling compartmentalization and cell migration;
see Figure 2.
Max Planck Institute of Biochemistry, Department of Molecular Medicine (Reinhard
Fässler), Harvard Medical School Brigham and Women`s Hospita, Boston, Mass. (David
B. Sacks)
Figure 2: A novel role for late endosomes carrying the p14/MP1 MAPK scaffold complex in
signaling compartmentalization and cell migration. In control cells, IQGAP1 is localized to the
plasma membrane and to focal complexes (FC) and supports Rac1 activation and formation of
new FC. Upon maturation of FC into focal adhesions (FA), IQGAP1 dissociates from FA and
recycles back to the plasma membrane. The process of IQGAP1 dissociation from the FA requires
endosomal MEK/ERK signaling and the binding of IQGAP1 to the p14/MP1 complex. When p14/
MP1 is absent from the late endosome, disassociation of IQGAP1 does not take place efficiently
and IQGAP1 accumulates at FA. As a result, Rac1 is no longer activated at the plasma membrane
and new FC are not formed. The absence of endosomal MEK/ERK activation on the other hand
results in impaired FA dynamics. Disbalance between FC and subpopulations of FA in cells where
p14/MP1 is no longer present on late endosomes, results in a phenotype where new FC are not
efficiently formed (due to impaired Rac1) 53
Cell Biology
Cell Differentiation
www.i-med.ac.at/cellbio/labore/celldifflab/index.html
Tel.: 0043 (512) 9003.70175
Ilja Vietor
The interplay between cell proliferation and differentiation controls not only development
but also regeneration. Therefore its regulatory mechanisms are of interest, also as
possible therapeutic targets. Based on our studies, we predict that the transcriptional
co-repressor TPA-inducible sequence 7 (TIS7) is one of the players affecting cellular
regeneration events. TIS7, induced by the mitogen TPA or growth factors, is differentially
expressed in various polarized cell types. We have shown that TIS7 interacts with the
SIN3 complex and represses transcription in an HDAC-dependent manner. In the TIS7regulated downstream target genes we have identified a common regulatory motif C/
EBPalpha-Sp1 transcription factor "module". Furthermore, TIS7 has the ability to inhibit
the Wnt signaling in an HDAC-dependent manner. TIS7 expression increases during the
process of tissue regeneration following a challenge like muscle crush damage or
intestinal resection. Our previous studies have shown that in TIS7 knockout mice the
expression of myogenic regulatory proteins is deregulated and the differentiation and
fusion potential of muscle satellite cells is impaired.
A second member of a novel gene family, SKMc15, is a protein which shares with TIS7
high homology at the amino acid level. Therefore, our laboratory generated SKMc15
single as well as TIS7 SKMc15 double knockout mice and now concentrates on the
identification of the functional role of both genes and their protein products. Interestingly,
the TIS7 SKMc15 double knockout mice have a prominent phenotype: they are
significantly smaller and leaner and, most importantly, they are resistant against weight
gain upon feeding with the high fat-diet. We are currently searching for the mechanism
responsible for this phenotype on the molecular level.
TIS7 wt
Major achievements
54
Last year the group of our collaborators around Prof. Chris Karp at the Cincinnati
College of Medicine, USA, using our TIS7 knockout mice as a specific experimental
animal model, identified TIS7 to be the major modifier of the severity of the lung disease
in cystic fibrosis. This lung disease is the major cause of morbidity and mortality in cystic
fibrosis, an autosomal recessive disease caused by mutations in CFTR. In cystic
fibrosis, chronic infection and dysregulated neutrophilic inflammation lead to progressive
airway destruction. Neutrophils, but not macrophages, from TIS7-deficient mice showed
blunted effector function. In vivo, TIS7 deficiency caused delayed bacterial clearance
from the airway, but also less inflammation and disease. In humans, TIS7
polymorphisms were significantly associated with variation in neutrophil effector
function. These data indicated that TIS7 modulates the pathogenesis of cystic fibrosis
lung disease through the regulation of neutrophil effector function. These findings were
published as a mutual collaboration in the journal Nature.
Gu Y, et al.: Identification of IFRD1 as a modifier gene for cystic fibrosis lung disease. Nature. 2009 Apr
23;458(7241):1039-42. Epub 2009 Feb 25.
See also:
TIS7 SKMc15 dKO
Figure 1: Muscle satellite cells grown under differentiation conditions. Immunofluorescence
microscopy images depict: MF20 - differentiated myoblasts marker protein (red), pICln - TIS7interacting methylosome subunit protein (green), and DAPI (blue) © Natalia Schiefermeier
Group members Katherin Patsch, Domagoj Cikes, Karin Schluifer
Cell Biology
Future goals
1) Identification of the molecular mechanism responsible for the smaller body size and
the lack of body fat deposits in TIS7 SKMc15 double knock out-mice. The long term
goal of this project is to be able to design strategies for intervention with possible
signaling pathways.
60
*** p<0,001
wt
dKO
50
40
30
20
10
***
0
TIS7 SKMc15 double knockout mice are
significantly leaner. 6 months old male mice;
n= 6. Chow diet.
40
Body weight gain (%)
Fused TIS7 wt skeletal muscle cells
grown under differentiation conditions in culture. Raster electron
scanning micrograph
© Kristian Pfaller Body fat tissue content (%)
Department of Medicine, Washington University School of Medicine, St Louis, Missouri,
USA; Division of Molecular Immunology at Cincinnati Children's Hospital Medical Center,
Cincinnati, Ohio, USA; Department of Immunology, Lerner Research Institute,
Cleveland, Ohio, USA; Institute of Physiology, University of Bonn, Germany
10000 *** p<0,001
wt
dKO
30
20
10
***
0
TIS7 SKMc15 double knockout mice gain
significantly less weight upon feeding with high
fat diet. 11 weeks male mice; n= 11; 3 weeks
high fat diet.
2) Identification of TIS7-interacting proteins and analysis of their biological role. In this
project we will concentrate on further characterization of interactions between TIS7
protein complex components, mainly on their in vivo interactions within the living cell.
The main focus will be on the regulatory mechanism by which TIS7 modulates gene
expression of muscle-specific genes during myogenesis.
3) For possible clinical application of the knowledge gained in cell culture experiments
and knockout mice we will analyze the expression of both proteins, TIS7 and SKMc15
in human patients’ samples. The expression of both proteins will be detected in muscle
samples freshly obtained after contusion and also following the wound healing, in order
to compare their expression in intact and injured tissues. The final goal of this project is
improvement of differentiation and thereby regeneration of tissues following an injury.
55
Lack of fat vacuoles in the jejunum of TIS7 SKMc15 double knockout mice (right). Oil red oil
staining; magnification 40x.
Cell Biology
www.i-med.ac.at/cellbio/labore/labore.html
Tel.: 0043 (512) 9003.70187
ASE
ASE
Gene Regulation & Molecular Immunology
Nikos Yannoutsos
Regulation of gene expression depends on DNA sequences such as promoters,
enhancers and locus control regions (LCRs) which surround the genes in the nontranscribed and non-translated areas of the genome. However, gene expression is also
regulated by "epigenetic" information, i.e. by inherited states of gene regulation that lie
outside of the DNA of a gene and that dictate its specific macromolecular structure.
Such epigenetic mechanisms include DNA methylation, histone modifications and RNA
interference (RNAi). The mechanisms are interrelated and affect the packaging of the
genes into chromatin. The dynamic change of the three-dimensional architecture of
chromatin is a modulator of the accessibility of the genes to the transcriptional
apparatus and to specific regulatory mechanisms in different tissues and developmental
stages and is, itself, modulated by them.
The immune system is as complex as the nervous system. It is characterized by
communication among its component cells as well as between them and the
environment. This communication is based on the biochemical specificity of the
molecules carried by individual cells, the B or T cell receptors (BCR and TCR). V(D)J
recombination creates BCRs and TCRs by looping out and eliminating large
chromosomal segments that separate the regions which encode the Variable (V), the
Diversity (D) and the Joining (J) domains of these receptors. The process occurs in four
subpopulations of lymphocyte precursors, namely in pro- and pre-B cells in the bone
marrow and in double negative (DN) and double positive (DP) T cells in the thymus, and
is dependent on the expression of the Recombination Activating Genes 1 and 2 (Rag1
and Rag2).
56
Silencer
Rag2
ASE
Rag1
The two genes are closely linked and conserved in evolution. Transcription of the genes
is coordinately upregulated in pro-B and DN T cells, downregulated as the cells
proliferate and upregulated again as the cells become pre-B and DP T. Finally, the genes
are down regulated again as the cells mature into the B and T cells of the immune
system. Several elements in cis, in the areas of the DNA surrounding the genes, act in concert to
effect this regulation by silencing and antisilencing mechanisms that are still not well
understood. Our current research indicates that these mechanisms include secondary,
epigenetic, regulation of the Rag locus over at least 100 kilobases.
Major achievements/current progress
Major discovery in this area is the interplay between a silencer between the two genes
and an antisilencer (ASE), located 70 kb 5‘ to the Rag2 gene, which counteracts the
action of the silencer on the two promoters. Both elements seem to be the link of the
chromatin regulation of the locus to epigenetic mechanisms.
Group members Przemyslaw Filipek, Georgia Vogl
Cell Biology
Ongoing work in our laboratory includes the following findings
•Northern blot analysis shows an 80 bp RNA species that lights up with probes from the
Rag2 intron near the 5‘ untranslated exon. Database search finds three microRNA
sequences located in tandem within this area. This array is also found at about 3 kb 5‘
to Rag2 with one of the microRNAs also within the ASE area. The possible silencing
potential of these microRNA sequences will be further examined by monitoring Rag
expression after transfecting them into DP T cells in culture.
•FISH experiments with oligonucleotide sequences from the introns of Rag1 and Rag2
labeled with Alexa 560 (red) and Alexa 488 (green), respectively, which light up the
nascent primary transcripts in the nucleus, have shown that both genes are expressed
from the same chromosome at the same time
•Chromosome Conformation Capture (3C) experiments provide evidence for a complex
looping structure of the locus that explains its coordinated regulation by the ASE. One
loop brings the promoter of the Rag1 gene 5‘ to the promoter of the Rag2 gene and a
second loop brings the distant ASE to an area right behind the two touching promoters,
presumably mediated by factors that bind in these areas (see picture above!). •DNA methylation studies around the promoters of the genes and histone methylation/
acetylation studies across the locus are in progress.
Aberrant translocations and lymphomas
Another focus of our laboratory is on follicular lymphoma generated by the aberrant
Rag-dependent translocation that brings together the IgH enhancer with the antiapoptotic BCL2 gene. This occurs during the DJ rearrangement in pro-B cells in the
bone marrow. Disease, however, develops in the spleen in the adult cell. The project has
two directions. On the one hand, in collaboration with Dr. Gunsilius of the Hematolog/
Oncology Clinic of the MUI, we are analyzing patient material to see what BCRs the
actual follicular lymphomas carry, in an effort to clarify what antigens might be involved
in their activation. On the other hand, we aim to build a mouse model for the disease by
making a transgenic mouse that carries both a selected BCR as a transgene and a
transgene that mimics the translocation by driving expression of the BCL2 gene from
the IgH enhancer. We are also pursuing alternative mouse models that may potentially provide a shortcut
to these ideas. We have obtained a mouse from Dr. Villunger at the MUI, which drives
expression of the bcl2 gene from a vav promoter and enhancer regulatory elements.
In collaboration with Dr. Villunger, we have also generated a transgenic mouse that
expresses a green fluorescent protein (Venus) under the same vav regulation.
Combination of the vav-bcl2 mouse with the vav-venus mouse will facilitate these
studies as the tumors that may eventually form from the transplanted pro-B cells into
wild-type mice will be fluorescent.
Another very useful mouse has been obtained from Dr. Hendriks (Erasmus University,
Rotterdam). The mouse contains a transgene that overexpresses Bruton‘s tyrosine
kinase (btk). Btk is at the center of an important intracellular signaling pathway
downstream of BCR signaling after antigen stimulation and normal expression of Btk
has been recently shown to be necessary for the development of follicular lymphoma. It
is possible that when this mouse is combined with a mouse that overexpresses BCL2, it
will give follicular lymphomas, independent of antigen stimulation by a particular antigen,
providing a direct model for the dependence of follicular lymphoma on Btk. Future goals
We intend to develop projects related to stem cell technology in three major directions: -development of mouse models with reporters for genes that are upregulated in tumor
cells and combine them with mouse models of selected cancers, in order to study
tumor stem cells
- using Oct4 to reprogram differentiated cells to pluripotent state and drive them forward
with the aim to clarify development of cells, e.g. islets of Langerhans versus other
pancreatic cells, via differential gene expression programs
- extend such studies to material from patients by trying to reprogram tumor cells to
pluripotent or progenitor state and thereafter to drive them forward in order to see
where and how the disease-causing alteration occurs.
The transgenic/knock-out unit
www.i-med.ac.at/iftz/zentrale_gruppen/mouseunit/
Research in our laboratory depends on the generation of transgenic and knock-out
mouse models. Since the establishement of this laboratory in November 2005, a
major effort has been to create a laboratory for the generation of such mice by
pronuclear and blastocyst microinjection. At the end of 2007 the transgenic mouse
laboratory gained support by the former IFTZ (Integrated Research & Therapy
Center) and is used for collaborations with all laboratories in MUI interested to
generate such mouse models. It has also been used to establish rederivation of
mouse lines to Specific-Pathogen-Free (SPF) status. 57
Cell Biology
www.i-med.ac.at/cellbio/labore/Membrane_Traffic_and_Signaling/David_Teis.html
Tel.: 0043 (512) 9003.70187
Membrane Traffic and Signaling
David Teis
We are interested in the molecular mechanism that coordinate cell signaling
and membrane traffic, in particular during cell surface remodelling. Cell surface
remodelling requires the selective degradation of transmembrane proteins in
the lysosome. Defects in this essential degradation pathway contribute to
hallmarks of cancer such as loss of cell polarity, defects in cell migration and
enhanced proliferation and hence can be considered a tumor supressor
pathway.
A key step in the lysosomal degradation pathway is the formation of
multivesicular bodies (MVBs). This process is catalyzed by the endosomal
sorting complexes required for transport, (ESCRT). ESCRT dysfunction
contributes to many diseases ranging from cancer to neurodegeneration.
Moreover retroviruses such as HIV hijack the ESCRT machinery to escape from
the host cells. We would like to understand:
1.How does the ESCRT machinery form MVB vesicles ?
2.How is the activity of the ESCRT machinery regulated ?
3.How do cells monitor the activity of the ESCRT machinery?
International collaborations
Hans-Georg Krausslich, (Virology, University of Heidelberg) Reinhard Fässler (MPI, München, GE)
Prof. Scott D. Emr (Cornell University, Ithaca, NY)
58
Group members Manuel Alonso Y Adell, Marietta Brunner, Franziska Gobber, Martin
Müller, Sabine Weys
email:[email protected]
Figure 1: Endo-membrane system of eukaryotic cells. The research of D.T. focuses on endocytic
and recycling pathways of signaling cell surface receptors
Recent achievements
D.T received the 'Human Frontier Science Program' carreer development award. HFSP
sponsors interdisciplinary research projects that aim to integrate different disciplines
such as biology, chemistry, mathematics and computer sciences Regulation of ESCRT mediated cell surface remodeling
Adaptation is a central concept of biology. Cells use an array of different receptors at
their surface to sense their natural surrounding. Hence, the specific removal and
downregulation of receptors from the surface essentially determines how cells adapt to
their environment. A key step of receptor downregulation occurs on endosomes, where
the endosomal complexes required for transport (ESCRTs) sort ubiquitinated cell surface
receptors via the multivesicular body (MVB) pathway to the lumen of lysosomes for
degradation. This essential, ESCRT-dependent, degradation pathway controls the
repertoire of cell surface receptors and all other transmembrane proteins. Consequently,
the ESCRT machinery is involved in diverse developmental processes and its
dysfunction contributes to many diseases including cancer and neuro-degeneration.
Moreover, the same ESCRT machinery is hijacked by viruses such as HIV to promote
their release from host cells. While probably all components of the core ESCRT
machinery have been identified, the molecular mechanism underlying the regulation of
ESCRT activity and the consequences of its dysfunction, raise several questions.
Among the most important are: 1. How is the activity of the ESCRT machinery
regulated? 2. How do cell react/adapt to the loss of ESCRT function and the
subsequent accumulation of membrane proteins? Due to the universal function of the
ESCRT machinery during evolution, yeast functions as best suited model system to
address these questions. Our goal is to gain insight into the molecular mechanisms that
regulate and survey the ESCRT machinery and hence control the downregulation of cell
surface receptors. These findings will be of general importance for the regulation of
membrane protein degradation, such as cell surface receptors, and might help to
explain the molecular mechanism underlying the wide variety of ESCRT-associated
diseases ranging from cancer to neuro-degeneration and AIDS. Figure 3: Endo-membrane system of eukaryotic cells. The
research of D.T. focuses on endocytic and recycling
pathways of signaling cell surface receptors
merged
Figure 2: This picture shows downregulation of cell
surface proteins. Yeast cells expressing a GFP-tagged
cell surface receptor (Mup1). In non-stimulated cells (methionine), the receptors are at the cell surface,
whereas upon stimulation they are transported and
sorted to the vacuole by the ESCRT. MUP1-GFP
(methionine transporter) green, FM4-64 red
Mup1- GFP Cell Biology
59
Clinical Biochemistry
http://www.i-med.ac.at/imcbc/clinbiochemfolder/clinbiochem.html
Ludger Hengst
Tel.: 0043 (512) 9003.70310
Interim Director
Main technologies
Protein Analysis Group
Herbert Lindner Development of high-resolution methods for the separation and
identification of post-translationally modified proteins and for investigating
their biological significance.
Our group concentrates on the development of rapid and efficient methods for the
separation and characterization of proteins and their posttranslational modifications with
closest attention to the family of histone and HMG proteins. Histone analysis was
always a driving force behind the biological research in this field, because it consistently
provided a better insight into the complexity of this protein family. It is this complexity of
histones that, because of their varied modifications and their interplay, gives us new
information for such important biochemical processes like the activation as well as the
repression of genes. Because of the intricacy of histones it is not too surprising that an
entire repertoire of analytical methods is used for their separation. For this purpose, a
set of separation methods based on capillary electrophoresis (CE), reversed-phase
chromatography, hydrophilic interaction liquid chromatography (HILIC) and mass
spectrometry (MS) was introduced in our lab.
60
At present, our main research interest focuses on modifications of linker histones. One
of the most important modification is the phosphorylation of certain serine and threonine
residues located in the C- and N-terminal domains. Phosphorylation is cell cycledependent, and individual H1 subtypes differ in their degree of phosphorylation, which
is usually lowest in G1 phase, rises continuously during S and G2 reaching a maximum
during mitosis. Using HILIC and MS, various phosphorylated H1 forms were separated
and their phosphorylation sites and patterns identified.
.
Group members
Sabine Chwatal, Astrid
Devich, Fatma Dikmen, Klaus Faserl, Bernhard
Halfinger, Leopold Kremser, Michael Rittinger,
Bettina Sarg, Heribert Talasz
- ESI- and MALDI-TOF mass spectrometry
- HPLC, e.g. RPC, HILIC, IEC, GPC
- Capillary electrophoresis
- Phosphoproteomics
- Chromatin immunoprecipitation
- Coimmunoprecipitation
- Generation of site-specific phospho-antibodies
From these data, particular site-specific phospho-antibodies were generated as tools
for analyzing the involvement of particular site-specific phosphorylated H1 subtypes in
processes like cell cycle progression, gene expression, DNA replication or repair. HILIC
S17p
of
H1.5
(p1g)
H1.5p0 p1g
p1m
p2
S172p
of H1.5
(p1m)
p3
0
20
Time (min)
40
60
Left: HILIC separation of non-, mono- di-, and triphosphorylated forms of H1.5 from interphase
cells. HILIC even enables the separation of distinctly site-specifically phosphorylated proteins, e.g.
the two mono-phosphorylated forms p1g from p1m. Right: Immunofluorescence images of interphase cells. Red = alpha tubulin; green = specific
phospho-sites of histone H1.5. Clinical Biochemistry
Protein Micro-Analysis Facility
The Protein Facility is dedicated to provide investigators with equipment, expertise and
custom services for the detection, characterization and quantification of proteins and
peptides on a recharge basis. The facility maintains a suite of state of the art
instrumentation including a MALDI TOF/TOF 4800 plus analyzer (Applied Biosystems), a
hybrid FT mass spectrometer LTQ Orbitrap XL (Thermo-Scientific), an LTQ VELOS mass
spectrometer (Thermo-Scientific), a Procise 492 protein sequencer (Applied
Biosystems), Nano-LC gradient systems UltiMate 3000 (Dionex), a Probot microfraction
collector (LC-Packings) for on-line MALDI target preparations. Various capillary
electrophoresis and HPLC Systems and, in addition, a solar M6 dual Zeeman
spectrometer (ThermoScientific) for trace element analysis are operated in the facility.
Major achievements
- Development of affinity based enrichment methods for MS-based structural
investigation of bioactive peptides
- Generation of polyclonal peptide antibodies against phosphorylated Ser17, Ser172,
Thr10 of H1.5 - Identification of phosphorylation pattern and sites of linker histones y+1
9
1006.5
MS/MS
International Cooperations
I. Rundquist (Linkoping University, Sweden); N. Guzman (Johnson&Johnson, New York);
J. Thomas (Dep. of Biochemistry, Cambridge); R. Schneider (MPI Freiburg); F. Azorin
(Institute for Research in Biomedicine, Barcelona); Roche Diagnostics, Penzberg,
Germany; Beckman Coulter Inc., Brea, CA
y+1
10
1103.4
Relative Abundance
Main Aims and Projects
- Development of multidimensional LC/CE-MS-based methods
- Generation of further site-specific phospho-antibodies
- PTM identification of various nuclear proteins
- Identification of novel phospho-histone binding proteins
- Identification of histone modification patterns at the nucleosomal level
100
95
90
85
80
75
70
65
60
55
50
45
40
35
30
25
20
15
10
5
0
0
b+1
8
829.4
+2
y15
828.6
+2
y14
793.1
y+2
7
419.8
b+1
3
359.9
y+1
3
315.3
200
b+1
4
430.8
y+1
4
482.4
400
b+2
17
935.4
y+2
16
877.8
y+1
13
1456.4
+1
y11
1284.4
y+1
b+1
5
7
610.3 728.1
600
+1
b12
1249.9
800
1000
m/z
1200
+1
y12
1355.5
1400
y+1
15
1656.5
b+1
17
1870.1
1600
61
y+1
16
1753.5
1800
Left: Identification of phosphorylated T10 (fragment 1-20) of H1.5 by nanoLC-MS/MS. Right: Immunofluorescence image of cell in mitosis: red = a-tubulin; green = T10p
Developmental Immunology
www.apoptosis.at/
Andreas Villunger
Tel.: 0043 (512) 9003.70380
Director
Apoptosis & Tumor Biology
Andreas Villunger
Research Focus 1 - BH3-only proteins in cell death and disease
Whether a cell continues to live in response to diverse forms of stress or undergoes
apoptosis along the intrinsic cell death signaling pathway is largely determined by the
complex interplay between individual members of the Bcl-2 protein family that can either
promote or prevent apoptosis.
Survival-promoting Bcl-2 family members, i.e. Bcl-2, Bcl-xL, Bcl-w, Mcl-1 and A1 share
up to four Bcl-2 homology domains (BH1-BH4) amongst each other. All these proteins
are critical for cell survival, since loss of any of them causes premature cell death of
certain cell types. Consistently, overexpression of Bcl-2 pro-survival molecules is
associated with prolonged cell survival and resistance to cytottoxic drugs in a number of
model systems, but more importantly, also in tumor patients.
The pro-apoptotic Bcl-2 family members can be divided into two classes: the Bax-like
proteins, i.e. Bax, Bak, Bok that contain three BH-domains (BH123 or multi-domain
pro-apoptotic Bcl-2 proteins) and the BH3-only proteins. The latter include Bim, Bid,
Puma, Noxa, Bmf, Bad, Hrk and Bik that are unrelated in their sequence to each other
or other Bcl-2 family members (except for the BH3-domain).
We study the role of BH3-only proteins using genetically modified model systems,
currently ocusing on the role of Bim, Bmf and Puma in tumor and lymphocyte
development
62
Groups within the Division of Developmental Immunology
• Apoptosis & Tumor Biology
• Glucocorticoids & Immunology Andreas Villunger Jan Wiegers
Figure 1: Two major signalling pathways trigger cell death in mammals. The Bcl-2 regulated
apoptosis signaling pathway, conserved in C. elegans, and the 'death receptor' pathway. Both
converge at the level of effector caspase activation that causes cellular demolition. In certain cell
types, members of the TNF-family have been reported to link the death receptor pathway with the
Bcl-2-regulated pathway via caspase cleavage-mediated activation of the BH3-only protein Bid.
Group Members Florian Baumgartner, Florian Bock, Irene Gaggl, Francesca Grespi, Gerhard Krumschnabel, Verena Labi, Claudia Manzl, Eleonora Ottina, Ruth Pfeilschifter, Lukas Peintner, Kathrin
Rossi, Benedicte Sohm, Claudia Soratroi, Denise Tischner, Claudia Wöss Developmental Immunology
DNA-damage
ATM/ATR
The p53-induced protein with a death domain (PIDD) has been identified as a gene
activated in response to p53 upon DNA-damage. Together with the adapter molecule
RAIDD, PIDD is involved in the activation of caspase-2, in a complex called the
“PIDDosome”. Interestingly, PIDD has recently also been implicated in DNA damageinduced NF-kB activation, promoting the transcription of cell survival genes and DNArepair by forming a complex with the kinase RIP-1 and with Nemo. Caspase-2 is an illdefined protease that has been implicated in multiple cellular responses including the
one triggered by deprivation of metabolites, heat shock or DNA damage. However, the
contribution of caspase-2 to these responses is in many cases still unclear (Fig.2). We are currently investigating the role of the known PIDDosome components in tumor
suppression and aim to identify caspase 2-specific substrates to gain further insight into
the functions of this multi-protein complex.
Recent achievements
Gordon Research Conference poster prize to Verena Labi, 2009
ECDO poster prize to Francesca Grespi, 2009
Swarovski Research Prize to Claudia Manzl; 2009
Krebshilfe support to: Gerhard Krumschnabel, Claudia Manzl, Florian Bock & Florian Baumgartner
DR
Nucleus
Chk1
Heat-shock
p53
Caspase-2
PIDDosome
Golgi
Amplification Loop?
Research Focus 2 - The PIDDosome in the cellular response to DNA damage Cells that have been exposed to UV, ionizing radiation or DNA-damaging drugs aim to
repair the inflicted damage. However, when this attempt fails, cells usually activate an
apoptotic program to avoid the spread of cells with compromized genomes. The
molecular basis of these life/death decisions is still not entirely clear. Ongoing projects
•Bim and Bmf in the regulation of B cell survival downstream of BAFF
•Redundancies and specificities of the BH3-only proteins Bim & Bmf
•Bim & Bmf in ErbB2-dirven breast cancer development
•Regulation of Bmf protein expression and function
•Lymphocyte development in the absence of A1
•PUMA-mediated tumor suppression in response to DNA-damage
•PIDD in caspase-2 and NF-kB activation
•PIDDosome mediated tumor suppression
•Identification of Caspase-2 substrates
International collaborators
Georg Häcker, TU-Munich, GER; Andreas Strasser, WEHI, Melbourne, AUS; Jürg Tschopp, Lausanne, CH; Eric Eldering, AMC, Amsterdam; Alexandar Tzankov, Basel, CH
BID
tBID
Mitochondrium
Caspase-9
ER
Caspase-3
Apoptosis
Figure 2. Schematic model summarizing the most important apoptotic pathways with a
suggested involvement of caspase-2 activity, i.e. cell death in response to DNA-damage, ERstress, heat shock, and death receptor (DR) ligation. ATM, Ataxia telangiectasia mutated; ATR,
Ataxia telangiectasia and Rad3 related; PIDDosome, protein complex consisting of PIDD, RAIDD
and caspase-2;
necrosis factor related apoptosis inducing ligand; FADD, FasGM-130TRAIL, tumor overlay
associated death domain (modified according to G. Krumschnabel et al., Cell Death Diff 16:
195-207, 2009)
63
Developmental Immunology
Tel.: 0043 (512) 9003.70390
64
Research Focus 2 – Glucocorticoids and T cell development Selection processes in the thymus ensure that mature peripheral T cells fulfill two
essential prerequisites: activation by foreign peptides bound to (host) MHC molecules,
but tolerance to self-derived peptides presented in the same context. To that end,
thymocytes that express T cell receptors (TCRs) with high avidity for self antigen:MHC
and therefore are potentially autoreactive, undergo apoptosis (negative selection). In
contrast, thymocytes expressing TCR with moderate avidity for self antigen:MHC are
rescued and differentiate into mature T cells that migrate to the periphery (positive
selection). Glucocorticoid hormones (GC) have been suggested to influence these
processes, e.g. induce apoptosis in developing T cells, the thymus itself producing GCs!
In addition, GC resistance of thymocytes against GC-induced apoptosis is associated
with autoimmune diseases. We focus therefore on the following questions: i) what is the
molecular background of thymocyte resistance to GC-induced apoptosis in animal
models of autoimmune diseases, and ii) what factors determine sensitivity to GCinduced apoptosis in immature vs. mature thymocytes (Fig. 2). Group members Irene Gaggl, Manuel Kaufmann
GFP
Research Focus 1 – Impact of life span on regulatory T cell maturation and function
Regulatory T cells (Treg) expressing the transcription factor Foxp3 play an essential role
in keeping immune homeostasis and preventing autoimmunity. A spontaneous loss of
function-mutation in foxp3 in ‘scurfy’ mice leads to fulminant lymphoproliferation and
multiorgan autoimmunity. For a better and more efficient therapy of autoimmune
diseases, a more profound knowledge is essential on factors that affect (i) Treg
maturation and number in the thymus and (ii) Treg homeostasis under either normal
conditions or during the course of an immune response. It is currently also unclear how
(iii) life span influences the capacity of Treg to suppress immunity. To study maturation
and function of Treg cells, we use foxp3GFP knock-in mice that coexpress GFP under
control of the endogenous foxp3 promoter. This allows convenient detection and
purification of Treg cells by flow cytometry and the possibility to isolate nearly 100% pure
Treg cells (Fig. 1). before sort
GFP
Jan Wiegers
after sort
Falus A Department of Genetics, Celland Immunobiology (earlier Department
of Biology) at Semmelweis University,
Budapest; Reul JM Laboratories of
Integrative
Neuroscience
and
Endocrinology (LINE), University of
Bristol, UK; Boyd RL Department of
Immunology, Monash University, Clayton,
Victoria, Australia
CD4
Regulation of Immunity
FSC
CD4
CD4+ CD8+
Isotype FITC
CD4+ CD8+
GR-FITC
CD8-CY
CD4-PE
CD8+
Isotype FITC
Fig. 1.: Purification of Foxp3GFP+ Treg
cells. Isolated splenocytes were stained
for CD4 (left panel) and Foxp3GFP+ Treg
cells (upper right panel) and Foxp3GFP–
Tcon cells (lower right panel) isolated by
cell sorting with a flow cytometer. Fig. 2: Glucocorticoid receptor (GR)
expression in thymocyte subsets.
Thymocytes were stained for CD4, CD8
and GR, washed and mounted with
Mowiol. Isotype control and GR stained
thymocytes were mixed 1:1.
GR-FITC
Major achievements: Glucocorticoids enhance thymocyte development at the double-negative
level. Ongoing projects: Regulatory T cells in bim-/- and vav-bcl2 transgenic mice, Glucocorticoids and T
cell development
Exp. Pathophysiology- & Immunology
erimental
www2.i-med.ac.at/expatho/sgonc.html
Lukas A. Huber
Tel.: 0043 (512) 9003.70970
Future goals
Interim Director
1. Further elucidation of early pathomechanisms in SSc.; 2. development of new, highly specific
diagnostic tests for an earlier diagnosis of SSc; 3. development of efficient therapies based on our
research results
Experimental Rheumatology
Roswitha Sgonc
Jeremy Saklatvala and Robin Wait, Kennedy Institute of Rheumatology, Imperial College London;
Oliver Distler, Center of Exp. Rheumatology, University Hospital Zurich; Andreas Zisch†,
Department of Obstetrics, University Hospital Zurich; Olov Ekwall, Department of Rheumatology,
Göteborg; Susanne Kerje, Department of Medical Sciences, Uppsala University
Our group is interested primarily in the pathogenesis of systemic sclerosis
(SSc), which we study in human patients as well as in the spontaneous
UCD-200/206 model. UCD-200/206 chickens are the only animal model, that
manifests the whole clinical, histopathological and serological spectrum of
human SSc. This makes it the ideal tool to investigate the initial pathomechanisms, and to test new evidence-based therapies. Thus, only the comparative study of UCD-200/206 and human SSc made it
possible to identify microvascular endothelial cells as the primary target of the
autoimmune attack, which subsequently undergo apoptosis. In the follow-up
study, we could show that endothelial cell apoptosis in SSc is induced by
AECA (anti-endothelial cell antibody)-dependent cellular cytotoxicity (ADCC) via
the Fas/Fas ligand pathway. Currently, we focus on two main projects:
1. the identification of (auto)antigens expressed by microvascular endothelial cells, using a proteomic approach, and
2. the therapy of ischemic lesions in SSc
Major achievements
1. Identification of two autoantigens expressed by microvascular endothelial cells and recognized by chicken and human SSc sera
2. Effective therapy of ischemic skin lesions of UCD-206 chickens with VEGF121-Fibrin (pilot study)
Group members Gabriele Stöckl, Melanie Ramberger
EC-apoptosis
UCD-200
Human SSc
EC-apoptosis
65
Exp. Pathophysiology & Immunology
erimental
www2.i-med.ac.at/expatho/boeck.html
Tel.: 0043 (512) 9003.70385
Biophysics & Biooptics
Günther Böck The aim of our biophysics-biooptics group is to provide a service for the
various cell biology groups within as well as outside the Biocenter,
together with instructions and training.
The service includes mainly flow cytometry and flow sorting. Some examples of
these developments are given below:
b)
c)
d)
the use of a fluorescence-activated cell sorter (FACS) for single cell
level receptor demonstration and biochemical characterization
Sorting cells being transfected with expression plasmids for GFP
fusion proteins for further analysis
Sorting of stem cells for further analysis
DNA/cell cycle analysis (an example being shown below)
OFFERS SUPPORT FOR
FACSVantage SE
-Calcium flux measurement
-Side-population isolation
-Two-way cell sorting -7 colours
66
FACSCalibur/Scan
-Protein expression analysis
-Cell death analysis
-Cell cycle analysis
Fluorescence = DNA content
a)
S/G2/mitotic cells
Nuclei of G0 cells
Coming soon in 2011
-4 way cell-sorting, 15 parameters
-Protein analysis, 10 colours
Apoptotic bodies
Side scatter width
CURRENT EQUIPMENT
FACSVantage SE
Equipped with
Blue/Red/UV Lasers
(488/633/365 nm)
9 Parameters
FACSCalibur
Blue/Red Lasers
(488/633 nm)
6 Parameters
FACSScan
Blue Laser
(488 nm)
5 Parameters
Exp. Pathophysiology & Immunology
erimental
www2.i-med.ac.at/expatho/schwarz.html
Tel.: 0043 (512) 9003.70975
Molecular Endocrinology
Siegfried Schwarz
Research
This laboratory's work has focussed on the study of various hormone/neurotransmitter
binding proteins and receptors as well as their ligands. Key papers describe: - Discovery of Sex Hormone Binding Globulin (SHBG) in cerebrospinal fluid (CSF) and interaction of SHBG with Danazol (non-genomic actions of steroids?)
- 1st Demonstration of homocysteate as an NMDA-selective excitatory agonist
- 1st Description of an epitope map of the glycoprotein hormone hCG
- Construction of epitope-selective immunoassays for glycoprotein hormones
-Demonstration of different orientations of receptor-bound agonistic vs. antagonistic hCG
- Prediction of the 3D structure of the extracellular domain of the hCG receptor
- Characterizartion of an apoptotic activity within urinary hCG preparations towards
Kaposi‘s sarcoma cells
-Demonstration of the importance of vasopressin in critical ill patients
Teaching Pathophysiology
The University law 2002 mandated the implementation of the NEW CURRICULUM
HUMAN MEDICINE at the Innsbruck Medical University. The latter required a full-time
teaching devotion for the subject PATHOPHYSIOLOGY. In accordance with these
duties, Professor Schwarz published two textbooks, one in 2002, the other in 2007, on
molecular aspects of pathophysiology. In contrast to previous and „classical“ curricula, Pathophysiology is not any more taught
within 2 semesters as a separate and isolated subject, rather it is incorporated into an
integrative teaching style of organ and disease modules. A module is covered by
lecturers from diverse preclinical and clinical disciplines. The modules are the following:
diagnostics and laboratory medicine, endocrinology, hematology, cardiovascular
diseases, nephrology, pulmonology, neurology & psychiatry, infectious diseases +
immunology,
cancer,
dermatology,
gastroenterology,
osteology,
teratology,
environmental medicine. Since 2008, Professor Schwarz is appointed Guest Professor for Pathophysiology at
the Suranaree University of Technology (Korath/Nakhon Ratchasima, Thailand).
In the newly formed CLINICAL SKILLS LAB-project implemented by the MUI, the
Venipuncture practicum-proposal of S.S. was ranked 2nd out of 12.
In 2009, Prof. Schwarz was invited to display 10
pictures of this book (format 50x50) in the newly built
Pediatric University Hospital Innsbruck, 1st floor West.
This exhibition serves an aesthetic as well as an
educative purpose: ARS IN_STRUCTA (a term coined
by Stephan Geley). http://www2.i-med.ac.at/expatho/
molecules_of_life_anncmt.html
Book Award 2003 by the British Medical Association
Therefore, teaching of Pathophysiology is stratified over
five semesters instead of the previously two. Except for
infectious diseases and cancer, the entire teaching of
Patho-physiology in main lectures is covered by Prof.
Schwarz. In addition, he is appointed coordinator of the
module „Endocrinology“, coordinator of the 4th semester, organizer of the SIP3 (summative integrative examination at the end of the 6th semester). Also, he acts
as a deputy chief examiner at the EMS (Eingangstest
Medizin-Studium) mandatory for the enrollement in the
study of medicine, and is member of the examination
board of SIP3.
http://www.maudrich.com/list?
back=1f74a3719cde4316d61ae4a1952981f6&isbn=9783851
758603
67
Genomics & RNomics
genomics.i-med.ac.at/
Alexander Hüttenhofer
Tel.: 0043 (512) 9003.70250
Director
Experimental RNomics
Groups within the Division of Genomics & Rnomics
Norbert Polacek
Non-coding RNAs in model organisms: identification and function
• Experimental RNomics
• Molecular Biology of Ribonucleoprotein Complexes
Such RNPs, present in cellular compartments as diverse as the nucleolus or
dendritic processes of nerve cells, exhibit a surprisingly diverse range of
functions. However, the biological role of some of them remains elusive.
Moreover, most systematic genomic searches are biased against their
detection and comprehensive identification by computational analysis of the
genomic sequence of any organism remains an unsolved problem. Hundreds of genes and their RNA products may thus remain undetected. Their
functions, interactions in cellular circuits and roles in disease would remain
unknown and our understanding of the functioning of a cell would be
incomplete. Therefore, our goal is to directly identify ncRNAs and their genes in
the human genome and those of various model organisms as well as to
elucidate their functions in cellular processes and/or human diseases.
In cells from all organisms studied to date two different types of RNAs are
found: messenger RNAs (mRNAs), which are translated into proteins, and socalled nonprotein-coding RNAs (ncRNAs), which are not translated into
proteins but function at the level of the RNA itself. Many known ncRNAs, such
as microRNAs, are involved in the regulation of gene expression and thus act
as molecular switches. While the proteome of most model organisms is rather
well defined, e.g. the total number of protein-coding genes, we are only at the
very beginning of describing the ncRNA transcriptome. Thus, the predictions
on the number of ncRNA genes in the human genome range from about 1.000
up to 400.000 (estimated from tiling-array experiments); in comparison, about
20.000 protein-coding genes are being estimated. NcRNAs are often found in
complex with proteins that are bound to the RNA and thus form
ribonucleoprotein complexes (RNPs).
68
Group members Roland Hutzinger, Hubert
Muckenhuber, Matthias Heiss, Melanie Lukasser,
Ronald Gstir, Andreas Ploner, Mathieu Rederstorff,
Konstantinia Skreka, Katrin Perfler
Genomics & RNomics
http://genomics.i-med.ac.at/wg/func_genomics1.html
Research
Our group works on the identification of small non-coding RNAs (ncRNAs) in various
model organisms for which we have coined the term “experimental RNomics". By this
approach we want to complement the human and other genome projects in identifying
all non-protein-coding RNAs in addition to protein-coding mRNAs. We therefore have
generated cDNA libraries from various model organisms encoding ncRNA species.
From these studies, we have identified so far more than 700 novel small, ncRNAs in
model organisms like the mouse Mus musculus, the plant Arabidopsis thaliana, the
Nematode C. elegans or bacterial and archaeal species like Escherichia coli and
Archaeoglobus fulgidus. Up to now, most ncRNAs have been shown to be ubiquitously expressed. This is not
unusual since these RNAs - like tRNAs or small nuclear RNAs - are involved in
housekeeping functions like protein synthesis or splicing. In mouse for the first time, we
have identified brain-specific ncRNAs, which implies a novel function of these RNA
species other than housekeeping functions. Accordingly, our goal is to identify the
biological functions of tissue-specifc ncRNAs in mammalian cells. The genes of three of
the brain-specific non-messenger RNAs are located on chromsome 15q11-13 in human
(two of them in multy-copy repeats). This region is involved in the etiology of the PraderWilli-Syndrome (PWS), a neurogenetic disease. We could show that the brain-specific
RNAs are not expressed in PWS patients pointing to a role of these RNAs in disease.
We are currently investigating the role of brain-specific non-messenger RNAs in the
etiology of PWS in a mouse model. Sequencing facility
The Division of Genomics and RNomics owns a 16-capillary sequenator from Applied
Biosystems (ABI 3100). We offer to the scientific community in Innsbruck (institutes,
clinics, companies, etc.) the possibility to run their own sequencing reactions on the
ABI 3100. For this purpose, sequencing reactions, employing the BigDye sequencing
kit from ABI, should be carried out at the respective lab or institute (for sequencing
instructions and purifications of sequencing reactions see: http://genomics.imed.ac.at/service/seq_prot.html). Subsequently, reactions are run on our capillary
sequenator machine in the building Peter-Mayr-Str. 4b, 3. floor. Sequencing data can
be retrieved online via the internet without any delay of time. Contact: [email protected]
Major achievements
• Coordination GEN-AU Programme: ncRNAs: from identification to functional characterization
• Member of the 7th framework EU: SysKid
• PhD programme participant: SPIN: signal processing in neurons
Future goals
• Identification of the biological functions of novel ncRNAs
• Analysis and investigation of regulatory ncRNA networks by bioinformatical methods
Joerg Vogel, MPI, Berlin, Germany; Ralph Bock, MPI Potsdam, Germany; Jürgen Brosius,
University of Münster, Germany; Yuuchi Soeno, Nippon University, Tokyo, Japan
69
Genomics & RNomics
http://genomics.i-med.ac.at/wg/func_genomics2.html
Tel.: 0043 (512) 9003.70251
Ribonucleoprotein Complexes
Norbert Polacek Probing ribosome functions by nucleotide analogue interference
Ribosomes are multifunctional ribonucleoprotein (RNP) complexes that
translate the genome's message into proteins needed for life in every living cell.
Decades of biochemical and recent crystallographic studies revealed the
ribosome as an RNA-enzyme (ribozyme) with roots in the 'RNA world'. The aim
of this project is to gain molecular insight into fundamental ribosomal reactions
by employing a newly developed reconstitution assay of ribosomal particles.
This allows the site-specific incorporation of a single non-natural nucleotide
analog into 23S rRNA and to study the functional effects on the performance of
the ribosome as a whole. With this procedure, it is possible to identify crucial
functional groups with better precision and with a greater a chemical variety of
nucleosides than with regular mutagenesis. • The main focus of our group lies in the elucidation of molecular aspects of
peptide bond formation and peptide release, respectively, the two main
reactions promoted by the peptidyl transferase center. • In addition, we are studying the molecular requirements of elongation factor G
(EF-G)-driven tRNA translocation. • Recently we have started to screen the genomes of single-cell eukaryotes as
well as archaea for small non-protein-coding RNAs that regulate the ribosome’s
translation efficiency during gene expression.
70
Group members Melanie Amort, Kamilla Bakowska-Zywicka, Nina Clementi,
Matthias Erlacher, Jennifer Gebetsberger, Krista Trappl, Marek Zywicki
Figure 1: Following peptide bond formation, the reaction products (peptidyl-tRNA and deacylatedtRNA) need to be translocated from the A- and P-sites to the P- and E-sites, respectively. This
process is facilitated by the GTPase elongation factor G (EF-G). By employing an ‘atomic
mutagenesis’ approach, we disclosed the adenine exocyclic N6 amino group at A2660 of the 23S
rRNA sarcin-ricin-loop as key determinant to trigger GTP hydrolysis on EF-G. We showed the
purine -system expanding characteristics of the exocyclic functional group at A2660 to be
essential. We proposed that stacking interactions of A2660 to EF-G may act as molecular trigger
to induce repositioning of suspected functional amino acids in EF-G that in turn promote GTP
hydrolysis.
Clementi et al., Nature Chemical Biology, 2010
Genomics & RNomics
The elusive molecular biology of the vault RNA and the vault RNP
In a recent genomic non-coding RNA (ncRNA) screen we have identified the
vault RNP associated RNAs to be significantly upregulated in human B cells
upon Epstein Barr virus (EBV) infection. Very little is known about the function
of this ncRNA class, mainly because the vault complex has been overlooked
for many years. Here we address the question whether vault RNA upregulation
is indeed causally linked to the virus infection and which function the vault
RNAs might exert during virus propagation. Furthermore we will assess the
structure-function relationship of vault RNAs which will eventually reveal the so
far enigmatic molecular biology of this interesting ncRNA species. Major achievements
START Prize of the Austrian Research Fonds 2006
Figure 2: Vault RNAs (vtRNAs) are ncRNAs that are integral to the caps of the vault complex, a
gigantic hollow ribo-nucleoprotein particle of 13 MDa. Very little is known about the function of this
ncRNA class and the entire vault complex. The vault complex has been implicated in various tasks
such as multi-drug resistance, transport, signalling, apoptosis resistance, or innate immunity.
However its biological function has yet to be identified. We could show that the expression of
vtRNAs is specifically up-regulated in human lymphocytes upon infection by -herpesviruses,
such as the Epstein-Barr and the Kaposi’s Sarcoma viruses. Stimulation of vtRNA expression by
EBV was evident for all three so far known human vtRNAs and also for a newly identified fourth
vtRNA (vtRNA2). EF-G that in turn promote GTP hydrolysis.
2008 Research Award of the Principality of Liechtenstein
Novartis-Award 2007 to Norbert Polacek http://www.i-med.ac.at/mypoint/news/2007012901.xml
Future goals
Understanding non-coding RNA structure and function
relationships in molecular detail
71
Alexander Mankin, University of Illinois at Chicago, USA; Knud Nierhaus, Max-Planck
Institute, Berlin, Germany; Daniel Wilson, Gene Center, Munich, Germany; Aloys
Schepers, Helmholtz Zentrum München, Germany Medical Biochemistry
www.i-med.ac.at/ imcbc/medclinchemfolder/medclinchem.html
Ludger Hengst
Tel.: 0043 (512) 9003.70111
Director
Cell Cycle and Proliferation
Ludger Hengst Groups within the Division of Medical Biochemistry
• Cell Cycle & Proliferation
Precisely balanced cell divisions are essential for growth, development and
maintenance of multicellular organisms. Before cells commit to divide, they are
exposed to a flood of signals aimed to regulate growth, differentiation, proliferation
and cell fate. These external and internal signals impinge on the central cell cycle
control machinery in order to either permit or prohibit cell proliferation. Mistakes in
interpretation, processing or integration of these signals can lead to diseases
including cancer.
• Signal Transduction & Proliferation • Biochemical Pharmacology
• Ribosomal Proteins
• Bioinformatics
Ludger Hengst
Karl Maly
Wolfgang Doppler
Johann Hofmann
Wolfgang Piendl
Florian Überall
Our group investigates molecular mechanisms that link diverse signalling networks to
the central cell cycle control machinery. At the core of this machinery is a conserved
family of protein kinases, called cyclin-dependent kinases (Cdks). Cdks need to be
activated by binding of a positive regulatory subunit, the cyclin. Activation and
inactivation of specific Cdk complexes is required for cell cycle progression. Cdkinteracting protein (p21 - Cip1) and kinase inhibitory proteins (p27 - Kip1 and p57 Kip2) constitute a family of Cdk inhibitors that bind to and regulate Cdk kinase
activity. Their concentration, localisation and modifications plays a key role in
regulating Cdk kinase activity and cell proliferation.
Among others, we identified one of these Cdk inhibitor proteins, p27-Kip1. This
protein is regulated by mitogen signalling. Besides its ability to inactivate Cdks and
induce cell cycle arrest, p27 has also a Cdk-independent function in regulating cell
migration. We investigate pathways and mechanisms that control p27 localization,
modification, abundance and activity and study their physiological and
pathophysiological consequences.
72
Figure 1: Overview of the cell cycle. Central CDK/
cyclin complexes are indicated next to the cell
cycle position when they are active
Group members Andrea Casari, Christoph Dohmesen, Karin Ecker, Heidelinde Jäkel, Michael Keith Kullmann, Lisa Kindler-Maly, Karl Maly, Georg Nikolaidis, Alexander Pauck, Silvio Podmirseg, Glory Ranches,
Jonathan Vosper, Christina Weinl, Barbara Wolf
Medical Biochemistry
The eukaryotic cell division cycle is divided into four phases. DNA replication during
S-phase is separated by so-called gap phases, G1 and G2, from the segregation of
the duplicated DNA and other cellular components in mitosis. At the end of M phase,
two daugher cells are generated by cytokinesis. Cells decide to withdraw from
proliferation or to commit to another round of cell division during a specific window of
their cell cycle in G1 phase, until they reach the restriction point (Figure 1).
p27 regulates cell cycle progression over the restriction point. Abundant p27 binds
and inactivates Cdks and prevents cell proliferation. The Cdk inhibitor protein
becomes unstable as cells progress towards S-phase, as a positive feedback loop
couples p27 ubiquitin-dependnet stability to Cdk activation (Fig. 2). The mechanism
which triggers this feedback loop has long remained a puzzle.
Tyrosine-88 phosphorylation ejects this inhibitory helix from the catalytic cleft and
permits the p27-bound Cdk to bind ATP and to phosphorylate substrates. Among
these substrates is p27 itself. Phosphorylation of p27 by the bound Cdk generates a
phosphodegron which mediates the ubiquitin-proteasomal degradation of the Cdk
inhibitor (Figure 3).
Our discovery provides a model on how p27 can be inactivated and degraded in
response to mitogen signals and how it can function as assembly factor of active Cdk
complexes.
Figure 2
Figure 3
Ongoing research
Current research projects
Regulation of cell cycle progression through G1 phase by tyrosine kinases, translational control
in and of the cell cycle; temporal and spatial regulation of Cdk-inhibitory proteins during cell
cycle progression.
in the lab focus on two main areas:
- Function and regulation of Cdk-inhibitory proteins.
- Role of translational control for the decision between cell proliferation and withdra-wal from the
cell cycle.
Major achievements
Cooperations
We now discovere a mechanism which can trigger p27 degradation, Cdk activation and cell
cycle progression in G1 phase. Different tyrosine kinases can phosphorylate p27. Among these
kinases are known oncogenes like Src family kinases or BCR-Abl, whose activation leads to
increased and deregulated p27 tyrosine phosphorylation. In addition, cytokines can activate
kinases which phosphorylate p27.
Phosphorylation on tyrosine-88 leads to a conformational of p27 on bound Cdk/cyclin
complexes. In its unphosphorylated state, tyrosine 88 of p27 is part of an inhibitory helix that
occupies the purin binding pocket of the kinase and thereby prevents access of ATP to the
catalytic cleft.
Joyce M Slingerland, University of Miami, U.S.A.; Richard W. Kriwacki, St. Jude Hospital of
Sick Childreen, Memphis, U.S.A.; Markus Gerhard, Klinikum Rechts der Isar, München,
Germany; Hartmut Halfter, Universität Münster, Germany, Pierre Roger, Bruxelles, Belgium;
Stephen J. Elledge, Harvard, Boston, USA
73
www.i-med.ac.at/imcbc/staff_doc/doppler_wolfgang.html
Tel.: 0043 (512) 9003.70150
Signal Transduction
Wolfgang Doppler
Pregnancy
Signal transduction in mammary gland development and cancer
Our group is investigating the intracellular signaling pathways induced by the action of
hormones (steroid hormones, prolactin, insulin, insulin-like growth factors) and how they
influence proliferation, differentiation and survival of mammary epithelial cells. We
compare the operation of these pathways during normal mammary gland development
with the signaling in mammary carcinoma. Special emphasis is put on members of the family of signal transducers and activators
of transcription (STAT factors). Our aim is to understand the role of STAT factors on the
balance between cell proliferation and cell death in the normal mammary gland as well
as in mammary carcinomas. International colloboratior: Akihiko Yoshimura, Keio University, JAPAN
Group members Lára Hannesdottir, Sebak Datta, Benedikt Koller, Piotr
Tymoszuk, Nina Daschil, Anto Nogalo, Sonja Philipp
Involution STAT1 DNA binding & Tyr Phosphorylation
Relapse-free survival (%)
• Negative cross-talk between glucocorticoid receptor and STAT1 signaling: A novel interaction
between the STAT1 target gene SOCS1 and the glucocorticoid receptor was found, with general
implications for the inhibition of inflammatory processes, where both proteins play a key role.
• Insulin receptor splice variant B and insulin signaling in the differentiated mammary gland: A
selective requirement for insulin receptor signaling in the response to lactogenic hormones and a
strong up-regulation of insulin receptor splice variant B in the differentiated mammary gland were
observed. Contrary to the previous assumptions, our studies imply insulin receptor but not IGF-1
receptor signaling to be important for the differentiated gland.
• Novel technique to study the response of tumors and cytotoxic drugs ex-vivo. A protocol was
developed to produce precision-cut slice cultures of tumors, which can be incubated ex-vivo under
maintenance of the 3-D structure of the tumor.
Lactation
STAT proteins are activated during mammary gland development and in a variety of
tumors. Whereas STAT5 and STAT3 have been implicated in tumor formation and
progression, STAT1 activation is mainly considered as an anti-oncogene and linked to
cell cycle arrest and apoptosis. STAT1 is also considered to be a key factor in tumor
immunosurveillance and in the response to chemotherapeutics. In accordance with this
function, we have observed a link between STAT1 activation and good prognosis in
primary human breast cancer. Major achievements in 2008 and 2009
74
100
80
60
40
20
0
0 1 2
0
3
4
5 6 7 8
9 10 11 12 years Medical Biochemistry
www.i-med.ac.at/imcbc/staff_doc/hoffman_johann.html
Tel.: 0043 (512) 9003.70130
Biochemical Pharmacology
Johann Hofmann
Research Areas
•Investigations into the function of the C6orf69, RhoBTB3 and BTBD10 genes
•Development of antagonists of PKCepsilon by interference between
PKCepsilon and RACK2
•Investigations into the mechanism of action of novel bicyclic hydrazones as
antitumor compounds
Major achievements
• Progress in the development of peptidomimetics as PKCepsilon antagonists
• Progress in exploration of the function of C6orf69 and RhoBTB3
• Progress in elucidation of the mechanism of action of heterocyclic hydrazones
• Patents No. 1286987, No. 1361224 deposited at the European Patent Office
Future goals
• Exploration of the function of BTBD10
• Development of a PKCepsilon antagonist
• Investigations into the mechanism of action of heterocyclic hydrazones
Flavio Meggio, University of Padova; Maria Rybczynska, Medical University of Poznan;
Maria Preobazhenskaya, Academy of Sciences, Moscow; Peter Galfi, Veterinary
University, Budapest; Janet Lord, University of Birmingham; Peter Goekjian, University of
Lyon; Jouni Jokela, University of Helsinki
Group members Peter Gruber, Dorata Garczarczyk, Doris Hinger
Figure 1: RACK2 (green) with inhibitory octapeptide
EAVSLKPT (blue). RACK2 represents a protein that by
binding to PKCepsilon defines its final sorting in the cell,
e.g. for anchoring PKCepsilon onto cardiac
myofilaments/myofibrils. (RACK = receptor for activated
C kinases). The octapeptide shown here is part of the
RACK2-binding domain on PKCepsilon. By using such
peptides or similarily structured other small molecules,
the translocation and thus the function of PKCepsilon
can be inhibited.
Figure 2: Colocalization of RACK2
and PKC-epsilon in the Golgi
75
http://www.i-med.ac.at/imcbc/staff_doc/piendl_wolfgang.html
Tel.: 0043 (512) 9003.70331
Ribosomal Proteins
Wolfgang Piendl Interaction of ribosomal proteins with rRNA and mRNA
We are investigating ribosomal proteins L1, L4 and L10 (as part of the L10/L12
stalk complex) from different (hyper)thermophilic archaea and bacteria. They
exhibit a 10 to 100 fold higher affinity to their specific binding sites on rRNA
and mRNA compared to that of their mesophilic counterparts. This stronger
protein-RNA interaction might substantially contribute to the thermal tolerance
of ribosomes in thermophilic organisms. Our investigations are focusing on the
identification and characterization of those structural features of RNA-binding
proteins that modulate the affinity for their specific RNA binding site. In this
context we try to determine the crystal structures of the protein-RNA
complexes at high resolution (in collaboration with our Russian partners).
Control of ribosomal protein synthesis in mesophilic and thermophilic archaea
As bacteria and eukarya, archaea have to coordinate the synthesis of about 60 ribosomal proteins
with each other and with three rRNAs. Research is focusing on the MvaL1 operon (encoding
ribosomal proteins L1, L10 and L12) from mesophilic and thermophilic Methanococcus species. As
in bacteria, regulation of this operon takes place at the level of translation. The regulator protein
MvaL1 binds preferentially to its binding site on the 23S rRNA, and, when in excess, binds with a
20-fold lower affinity to its regulatory binding site on its mRNA (a structural mimic of the 23S rRNA
binding site) and thus inhibits translation of all three cistrons of the operon. MvaL1 inhibits its own
translation before or at the formation of the first peptide bond, but Mval1 does not inhibit the
formation of the functional ternary initiation complex. Our data suggest a novel mechanism of
translational inhibition that is different from the displacement or entrapment mechanism described
for the regulation of ribosomal proteins in bacteria. Our next aim is to pinpoint exactly the translation step at which MvaL1 inhibits its own synthesis.
Function of ribosomal protein L1
L1 is a two-domain protein with N and C termini located in domain I. In close
collaboration with a Russian group we succeeded in constructing a truncation mutant of
L1 representing domain I by deletion of the central part of L1 (= domain II). We could
demonstrate that domain I alone is sufficient for specific RNA binding, whereas domain
II stabilizes the L1-23S rRNA complex. In the ribosome L1 is located in the stalk region proximal to the E-site where the
deacylated tRNA is ejected. We plan to study the exact function of L1, especially of its
domain II in the process of protein synthesis.
Figure 1: ibosomal protein
L1 from the archaeon
Sulfolobus acidocaldarius in
complex with 23S rRNA
Major achievements
76
• Solution of the structure of the L1 protuberance in the ribosome (with the Russian collaborator);
see figure
• Construction of a truncated mutant of ribosomal protein L1 and elucidation of its role in RNA
binding
Future goals
• To study the role of ribosomal protein L1 and its individual domains within the ribosome
• To define the translational step at which archaeal L1 inhibits its own synthesis
• To determine the stoichiometry of the ribosomalL10/L12 complex in archaea
International collaborators, institutions
Prof. Dr. M. Garber, Institute of Protein Research, Russian Academy of Sciences, Pushchino,
Moscow Region, Russia
www.i-med.ac.at/imcbc/staff_doc/ueberall_florian.html
Tel.: 0043 (512) 9003.70120
Future goals
• Whole blood nutrient sensing
• Volatile organic compound (VOC)-mediated gene expression analysis
Nutritional Biochemistry
Florian Überall
The proper functioning of the pathways that are involved in the sensing and
management of nutrients is central to metabolic homeostatsis and is therefore among
the most fundamental requirements for survival. To identify multifactorial nonlinear
molecular signatures of cells after exposure to dietary components or herbal extracts,
we apply molecular and biochemical methods as well as functional genomics. In more
detail, we are working on cell-based assays combined with transcriptome analysis in
order to establish new risk-benefit assessement strategies for herbal preparations and
phytochemicals
As far as cytoprotective nutrient sensing is concerned, we investigate the role of PKC
family members on Keap1/Nrf2 transactivation in response to food additives, herbal
extracts or phytochemicals, which may initiate electrophilic attack of selective sulfhydrylgroups or direct or indirect phosphorylation events.
In the course of our long standing experience in characterizing PKCs as anticancer
targets, we were successful in identifying a chaperone subunit as a direct interaction
partner of atypical PKC isotypes. A detailed study of this molecular interaction and the
underlying biological functions in prostate cancer progression is currently in progress.
In addition, we participate in a collaboration with Bioenergy 2020plus (K-plus project
partner TU-Graz) to establish a WoodChemDB database in order to identify natural
compounds recovered after wood refinement production processes applying
headspace- as well as direct GC/MS-analysis
Major achievements
•Combination of cell-based assays and transcriptome analysis for the improvement of
an individual risk-benefit assessment for herbal preparations and phytochemicals. •Identification of a chaperone subunit as a direct interaction partner of atypical PKC
isotypes.
•Establishment of a WoodChemDB database for risk assessment of volatile organic
compounds of wood products.
Group members Miriam Alber, Johanna Gostner,Angela Klein-Wondrak, Marcel Jenny, Oliver Wrulich
Ulrich-Merzenich G, New perspectives for synergy research with the „omics“technologies in phytomedicine, Bonn, Germany
Moscat J, Protein kinase C signalling, Genome Research Institut Cincinnati, USA
Schwabl H, Institute for Nonlinear Studies, Zürich Switzerland
77
Molecular Biology
Peter Loidl
Director Research of the division is devoted to various topics of molecular biology,
including molecular microbiology, epigenetics, applied microbiology and
lipocalin structure and function. Research is mainly focused on the regulation of
gene expression in lower eukaryotes, plants and cultured mammalian cells.
Several independent research teams try to hold an internationally recognized
position within their research field. The division of Molecular Biology is
responsible for teaching and training students of the Innsbruck Medical
University and the Faculty of Biology of the University of Innsbruck in molecular
biology. Moreover, the division has teaching responsibilities for medical
students in microbiology and infectious disease control. Chromatin & Epigenetics Group
78
Nuclear DNA is compacted into chromatin which represents a structure built with
repeating units, the nucleosomes. These consist of DNA wrapped around a protein
octamer composed of 2 molecules each of the core histones H2A, H2B, H3, and H4.At
least 2 domains can be distinguished in histones, a globular domain involved in histonehistone interactions (the histone fold motif) and the flexible N-terminal tails (H3, H4) or
N-terminal and C-terminal tails (H2A, H2B). A series of consecutive nucleosomes forms
a beads-on-a-string structure. A further level of compaction is the 30 nm fiber. In the
past years our traditional picture of chromatin as a static and largely repressive
functional state has changed to a more complex view of chromatin as a dynamic state
that is essential for cellular regulation. The dynamic properties of chromatin are
mediated by multiprotein complexes with different functions that set marks overlying the
stable information of DNA. Factors that affect chromatin are enzymes that modify
histones and chromatin remodeling machines. Histones are substrates of
posttranslational modifications, like acetylation, methylation, phosphorylation and others
which all can cause structural and functional rearrangements in chromatin and therefore
represent essential elements of the complex epigenetic histone code. Groups within the Division of Molecular Biology
Chromatin and Epigenetics
-Structure and Function of Chromatin: Maize and Mouse Peter Loidl
-Structure and Function of Chromatin: Filamentous Fungi Gerald Brosch Stefan Grässle
-Chromatin Assembly and Remodeling
Alexandra
Lusser
Hubertus
Haas
Applied Mycology
Florentine
Marx
Lipocalins
Bernhard
Redl
To decipher this code which is recognized and interpreted by transcriptional regulators
and chromatin remodeling machines is one of the central challenges of chromatin
research. Moreover, numerous regulatory, non-histone proteins are modified by histone
acetyltransferases (HATs) and histone deacetylases (HDACs). This is an important point,
in that the same enzyme activities that are responsible for the acetylation/deacetylation
of nucleosomal histones also modify those regulatory proteins that bind to chromatin
and probably recognize the complex modification pattern established on nucleosomes.
One therefore faces a currently elusive correlation between pattern formation on
nucleosomes and signal establishment on histone-binding proteins.
Tasks
•
identification and functional analysis of HDACs, histone methyltransferases and demethylases in filamentous fungi •
role of HDACs in host-microbe interactions
•
mechanism of action of HDAC- and protein methyltransferase-inhibitors •
histone acetylation/ methylation in murine cells with a focus on nucleolar chromatin
•
functional significance of histone and non-histone protein modifications for cell cycle regulation (p130)
•
chromatin assembly and remodeling
Molecular Biology
mol-biol.i-med.ac.at/wg/chromatin_lab_mm.html
mol-biol.i-med.ac.at/
Tel.: 0043 (512) 9003.70200
Major achievements
We have identified the nucleolar protein PAF53 and the pocket protein 130 as proteins that are
acetylated by HATs and we could at least partially unravel the functional significance of the
modification. p130 is acetylated in a cell cycle dependent manner; lysine_1079 is the most
prominent acetylation site and the acetylation at this site interfers with p130 phosphorylation. Structure and Function of Chromatin: Maize and Mouse
Peter Loidl
Research Topics
• Acetylation of nonhistone, nuclear proteins (Acetoproteomics)
• Acetylation of nucleolar proteins (UBF, PAF53)
• Acetylation of cell cycle regulatory pocket proteins
• HDACs and protein methyltransferases during maize embryo germination
Future goals
We would like to understand the complex interrelation between regulatory non-histone proteins
that are acetylated/deacetylated by HATs/HDACs and chromatin.
Ingrid Grummt (Heidelberg), Manfred Jung (Freiburg), Bernd Lüscher (Aachen), Jonathan Walton
(East Lansing)
My laboratory was formerly engaged in the investigation of core histone acetylation. We
have intensively studied histone acetylation in the acellular slime mold Physarum
polycephalum and in plants. In particular, we have purified, characterized and identified
histone acetyltransferases and histone deacetylases in Zea mays and Arabidopsis
thaliana. In the course of these studies we identified a novel, plant specific type of
histone deacetylase (HD2) and a yet unknown level of regulation of an HD-A type
deacetylase by limited proteolytic cleavage. Currently we investigate this type of
regulation in more detail and we extended our investigations in maize for the purification
and characterization of histone/protein methyltransferases.
During the last years it became more and more clear that a huge number of non-histone
proteins are substrates for enzymes that were initially identified as histone-modifying
enzymes; this holds true, in particular, for HATs and HDACs and histone
methyltransferases. Just recently, we focussed our research on the analysis of the
functional consequences of acetylation of UBF and PAF53 (nucleolar transcription
regulators/adaptors) and p130 (a cell cycle regulatory pocket protein).
79
Group members:
Adele Loidl,
Schwarze
Maria Goralik-Schramel,
Muhammad Saeed, Florian
Molecular Biology
mol-biol.i-med.ac.at/wg/chromatin_lab_ff.html
Chromatin
Tel.: 0043 (512) 9003.70211
&
Epigenetics
Tel.: 0043 (512) 9003.70218
Structure and Function of Chromatin: Filamentous fungi
Histone methylation in filamentous fungi
80
Gerald Brosch
Protein methylation involves the transfer of a methyl group from S-adenosylmethionine
to acceptor groups on substrate proteins. Arginine residues of proteins are modified by
members of the protein arginine methyltransferase (PRMT) family. Arginine methylation
has been observed on a variety of proteins associated with gene regulation, including
DNA-binding transcriptional activators, transcriptional coactivators, and many RNAbinding proteins involved in RNA processing, transport, and stability. The long-term
objective of our research is to investigate the functional role of protein methylation in
filamentous fungi. We have identified three distinct PRMTs which all exhibit histone
methyltransferase activity in vitro and in vivo. One of these proteins, termed RmtB, has
an exceptional position because it displays both enzymatic and structural properties
that are different from other known PRMTs. To study the functional role of PRMTs in A.
nidulans we are currently deleting the corresponding PRMT genes by targeted gene
replacement and are analysing putative growth defects of rmtA, rmtB, and rmtC
deletion mutants under various growth conditions. These studies will be completed by
the generation of double and triple mutant strains and the concomitant investigation of
physiological and developmental effects. Finally, the analysis of global gene expression
patterns, the study of effects of rmtA, rmtB, and rmtC deletion on the regulation of
genes involved in secondary metabolism pathways, and the identification of novel
substrate proteins of PRMTs will help to clarify the role of arginine methylation in
Aspergillus.
Besides the functional analysis of histone modifying enzymes, our group is also involved
in the biological evaluation of small molecule inhibitors in cooperation with different
pharmaceutical laboratories. Such inhibitors are potent inducers of differentiation and
bear considerable potential as drugs for chemoprevention and treatment of cancer. Group members
Shadab Allipour, Ingo
Bauer, Birgit Faber, Hermann Krabichler,
Divyavaradhi Varadarajan
Functional roles of distinct histone deacetylases in the filamentous fungi
Stefan Grässle
Histone acetylation plays a crucial role in the processes of gene regulation in
eukaryotes. In particular, histones can be acetylated by histone acetyltransferases
(HATs) and can be deacetylated by a second group of enzymes, the histone
deacetylases (HDACs). In contrast to HATs, for which to date no potent inhibitors are
known, there is a panel of structurally unrelated agents available that affect HDACs in a
very selective way. Today these inhibitors are important tools for the study of histone
acetylation processes. Our working group studies histone acetylation/deacetylation
processes and attempts to purify HATs and HDACs of multiple organisms. Recently, we
have identified and partially characterized HDACs of different classes in the filamentous
fungus Aspergillus nidulans. The further characterization and clarification of the function
of these enzymes within our model organism is the goal of this project. Since
filamentous fungi are more complex than yeast in many important aspects, yet genetic
manipulation is relatively simple and easy to perform, they have widely been regarded as
model systems to study the basis of eukaryotic gene regulation. Moreover, many of
these organisms contribute to the decay of organic material and thereby play an
important role in the spoilage of food. But there are also filamentous fungi which
represent dangerous pathogenic agents for people such as the closely related species
to A. nidulans, A. fumigatus, which can cause life-threatening infections in patients that
have a compromized immune system. For these reasons the study of these group of
organisms is also of economic and medical interest. Molecular Biology
Major achievements
• Histone methylation: We could demonstrate that deletion of Aspergillus PRMTs
positively or negatively affect penicillin biosynthesis, indicating that PRMT activity is
involved in the regulation of secondary metabolism. By a proteomic approach we could
isolate and identify several putative target proteins of Aspergillus PRMTs. Compound
screening and chemical manipulations of lead compounds identified potent and specific
inhibitors of PRMTs; inhibition assays and biological evaluation experiments revealed in
vivo activity and selectivity of isolated drugs. • Histone acetylation: We show that deletion of hdaA, encoding an Aspergillus nidulans
HDAC, causes transcriptional activation of two telomere-proximal gene clusters of
secondary metabolites and consequently leads to increased levels of the corresponding
molecules (toxin and antibiotic). Introduction of two additional HDAC mutant alleles in a
delta HdaA background, however, showed minimal effects on expression of the two
HdaA-regulated clusters. Treatment of other fungal genera with HDAC inhibitors resulted
in overproduction of several metabolites, suggesting a conserved mechanism of HDAC
repression of defined secondary metabolite gene clusters. Depletion of RpdA, another
fungal HDAC, leads to a drastic reduction of growth and sporulation of Aspergillus
nidulans (Figure A) and to a hyperbranching of the hyphae (B). Functional studies
revealed that a short C terminal motif unique for RpdA-type proteins of filamentous fungi
is required for the catalytic activity of the enzyme and hence, cannot be deleted without
affecting the viability of A. nidulans. Moreover, evidence is provided that this motif is also
essential for other, if not all, filamentous fungi. Thus, the RpdA motif represents a
promising target for HDAC-inhibitors with impact on the vitality of these organisms. Future goals
• To clarify the functional role of protein methylation in Aspergillus nidulans
• To verify identified methylated proteins as in vivo targets.
• To investigate the impact of histone modifications on the regulation of secondary metabolism in
A. nidulans
• To clarify the molecular mechanism of the C-terminal motif of RpdA and its putative role as new
target for antifungal drugs
• Since several euascomycetes are not only well known for infection of food and crop plants, but
also represent causative agents of infections in humans, the development of novel antimycotic substances is highly desirable
Nancy Keller, Department of Plant Pathology, University of Wisconsin-Madison, USA; Manfred
Jung, Department of Pharmaceutical Sciences, Albert-Ludwigs-Universität Freiburg, Germany;
Antonello Mai, Dipartimento Studi Farmaceutici Università degli Studi di Roma "La Sapienza“, Italy;
Jonathan Walton, Department of Energy Plant Research Laboratory, Michigan State University,
East Lansing; Gianluca Sbardella, Dipartimento di Scienze Farmaceutiche, Università di Salerno,
Fisciano, Italy
Figure: Growth of RpdA knock-down strains A18 and X79 under rpdA inductive or repressive
conditions. Prototrophic strains with random integrated markergenes served as wild type control
(wt). (A) Radial growth of the strains on agar plates with 10 mM l-threonine (thr) or 1% xylose (xyl)
for induction of rpdA in A18 or X79. Repression of both promoters was achieved by 1% glucose
(glc). (B) Microscopic examination of hyphae grown under rpdA repressive (glc) or inductive (thr, xyl)
conditions. Mol.. Biol. Cell, 2010, 21: 345 -53.
wt
A
A18
X79
glc
thr
xyl
B
glc
glc
glc
thr
thr
xyl
81
Molecular Biology
mol-biol.i-med.ac.at/wg/chromatin_assembly.html
Tel.: 0043 (512) 9003.70210
Major achievements
Chromatin & Epigenetics
Chromatin Assembly & Remodelling
82
Alexandra Lusser The way in which eukaryotic DNA is organized in chromatin has profound effects on all
processes that direct DNA metabolism (such as transcription, replication, repair and
recombination). We are interested to learn how the establishment and maintenance of
eukaryotic chromatin affects those processes. We are approaching this question by
studying the molecular mechanism and biological context of the chromatin assembly
process. Chromatin assembly is a fundamentally important process that is tightly linked to DNA
replication and enables the cell to faithfully duplicate the chromosomes. In addition,
chromatin assembly occurs independently of replication to turn-over histones, for
instance during transcription or DNA damage repair. We have recently identified
Drosophila CHD1 as an ATP-dependent chromatin assembly factor that belongs to the
SNF2 superfamily of ATPases. Many members of this large group of molecular motor
proteins are involved in the modification of chromatin structure. Only members of two
SNF2-subfamilies, namely CHD1, and the previously identified ISWI are known to
catalyze the ATP-dependent assembly of chromatin. ISWI and its human homolog
hSNFH function as part of the Drosophila ACF and CHRAC chromatin assembly
complexes and the human RSF complex, whereas Drosophila CHD1 appears to
predominantly operate as a monomer. CHD1 and ACF enzymes catalyze the ATPdependent assembly of periodic arrays of nucleosomes. Interestingly, these enzymes
generate different types of chromatin in terms of internucleosomal spacing distance and
linker histone H1 content. We are particularly interested in the biological functions of CHD1 which has been
implicated in the regulation of transcriptional elongation and termination processes. To
study the implications of chromatin assembly in processes of DNA metabolism, we use
a biochemical approach employing in vitro chromatin reconstitution and transcription
systems. In addition, chromatin assembly defects are investigated in tissue culture as
well as in mutant Drosophila lines. Group members Megan Ansbro, Stefano Morettini,
Paolo Piatti, Valerie Podhraski, Gabriele Scheran,
Johanna Sebald, Hildegard Wörle, Anette Zeilner
In our studies of the biological roles of the ATP-dependent chromatin remodeling factor we found
that CHD1 has a crucial role in vivo in the remodeling of sperm chromatin during fertilization. CHD1
is essential for the incorporation of the variant histone H3.3 into paternal DNA during early
Drosophila development. Thus, CHD1 is the first ATP-dependent remodeling factor that is linked to
an H3.3-specific nucleosome assembly pathway.
Future goals
We are currently investigating functions of CHD1 in vivo that are distinct from its role in early fly
development. We wish to elucidate the molecular mechanisms by which CHD1 operates to
remodel chromatin in transcription-dependent and transcription-independent processes. International collaborators
Dmitry Fyodorov, Albert Einstein College of Medicine, Bronx, USA; Jim Kadonaga, University of
California, San Diego, USA; Cees Dekker, Delft University of Technology, Delft, NL; Karolin Luger,
Colorado State University, Fort Collins, USA; Alexander Konev, Russian Academy of Sciences, St.
Petersburg, Russia. Figure 1: A working model for Chromatin Assembly. Schematic repreRepressive
Active
sentation of our recent
experimental findings: the
Chromatin
Chromatin
ATP-dependent chromatin remodeling factors
CHD1 and ACF can
assemble distinct types
of chromatin in vitro, i.e.
ACF incorporates the
linker histone H1, while
CHD1 cannot. These
data together with in vivo
findings suggest that
ACF might play a role in
the assembly of repressive chromatin, whereas
CHD1 might be important for the assembly of
chromatin in transcriptionally active genomic regions.
Molecular Biology
mol-biol.i-med.ac.at/wg/molec_microbiol.html
Tel.: 0043 (512) 9003.70205
Major achievements
Hubertus Haas
Fungi affect the life of mankind positively and negatively. On the one hand, fungi are
major players in saprobic decomposition, mutually interact with plants (mycorrhiza),
serve directly as food (mushrooms) or in food production (e.g., bread, cheese, alcohol),
and produce widely used primary (e.g. citric acid) and secondary metabolites (e.g.
penicillin). On the other hand, some fungi are pathogens of plants (e.g. Fusarium spp.)
and animals (e.g. Aspergillus fumigatus), or spoil food by contamination or toxin
production (e.g. aflatoxin). Therefore, fungi impact ecology, biotechnology, medicine,
agriculture and food industry. The best studied fungal organism is Saccharomyces
cerevisiae. In several respects, however, the physiology of this yeast is not comparable
with that of filamentous fungi (e.g. iron metabolism, light regulation, secondary
metabolism). We are mainly interested in the molecular elucidation of the peculiarities of
filamemtous fungi´s physiology. Our current research focus is the iron/siderophore metabolism of Aspergilli. A. fumigatus
is a typical saprobic filamentous ascomycete but also the most common airborne fungal
pathogen of humans. It causes allergic and invasive disease depending on the immune
system. Unsatisfying diagnostic and therapeutic possibilities are reflected in a high
mortality rate. The low-pathogenic relative Aspergillus nidulans represents an
established genetic model system.
Both Aspergillus species produce extracellular siderophores (triacetylfusarinine C) for iron
acquisition and intracellular siderophores (ferricrocin) for storage and distribution of iron.
Siderophore biosynthesis is regulated by two transcription factors, SreA and HapX. Siderophores
are central components of the fungal metabolism as they affect germination, sexual and asexual
reproduction, oxidative stress resistance and virulence. Lack of siderophore biosynthesis renders
A. fumigatus apathogenic. Consequently, the siderophore system represents a novel target for
antifungal therapy. Additional research topics include light regulation, nitrogen metabolism, noncoding RNAs,
chromatin modification, improvement of molecular tools for the manipulation of fungi. Our central research goal is to characterize the fungal metabolism and to exploit this knowledge for
both improvement of antifungal therapy, diagnosis of fungal infections, and improvement of the
biotechnological potential of fungi.
Group members Beate Abt, Nicola Beckmann, Michael Blatzer,
Martin Eisendlle, Mario Gründlinger, Fabio Gsaller, Christoph Jöchl,
Sabiha Yasmin, Markus Schrettl
• Identification of a novel fungal iron-regulatory mechanism • Characterization of fungal mechanisms for iron uptake and storage (including the siderophore
system)
• Dissection of the role of extracellular and intracellular siderophores in fungal physiology and
virulence
Future goals
Detailed characterization of the iron homeostasis-maintaining mechanisms of filamentous fungi (in
particular of Aspergilli) and applied medical and biotechnological exploitation of the gained
knowledge
Elaine Bignell, Dep. Molec. Microbiol. & Infec., Imperial Coll. London; Axel A. Brakhage, LeibnizInst. for Natural Product Res. & Infection Biol., F. Schiller Univ. Jena; R. Fischer, Dep. Applied
Microbiol., Univ. Karlsruhe; William C. Nierman, J. Craig Venter Institute, The George Washington
Univ. Sch. Med., Rockville, MD, USA; Gillian Turgeon, Dep. Plant Pathol., Cornell Univ., Ithaca, NY,
USA; GüntherWinkelmann, Dep. Microbiol. & Biotechnol., Univ. Tuebingen
Aspergillus fumigatus: A, on plates; B, scanning electron-microscopy of hyphae and conidia
(courtesy of K. Pfaller); C, siderophore metabolism.
83
Molecular Biology
mol-biol.i-med.ac.at/wg/applied_mycol.html
Tel.: 0043 (512) 9003.70207
Gyula Batta, University of Debrecen, HU; Mojca Bencina, National Institute of Chemistry, Ljublijana,
Slovenia; Mogens Trier Hansen, Novozyme, Bagsvaert, DK; Vera Meyer, Technical University Berlin;
István Pócsi, University of Debrecen, HU; Nick Read, University of Edinburgh, UK
Applied Mycology
Florentine Marx
Filamentous fungi secrete a wide array of different proteins into the external medium
where they accomplish most diverse functions, e.g. assimilation of complex nutrients,
communication between other fungal cells, interaction between pathogenic fungi and
their host and others. Apart from some secreted enzymes which have been developed
for a variety of commercial uses (mainly for the fermentation industry), only few
extracellular proteins are well characterized with respect to their function as pathogenic
factors or as cell signalling factors. Our main scientific interest is to identify, isolate and further characterize on the molecular
and functional level novel extracellular proteins with antimicrobial activity from
Penicillium chrysogenum, Aspergillus nidulans and Aspergillus fumigatus. Antimicrobial
proteins are promising candidates for the development of novel therapies applicable in
medicine as well as in agriculture and in the food industry to prevent and treat microbial
infections. Therefore, the detailed characterization of the mode of action of these
proteins is of crucial importance and a prerequisite for the development of new
therapeutic approaches and their successful application in the future.
Figure 1: Tentative model of the
mode of action of the Penicillium
chrysogenum antifungal protein
PAF in Aspergillus nidulans
1
2
Major research interests
• Characterization of the mode of action of antimicrobial proteins secreted by filamentous fungi on
the molecular and cellular level
• Identification and characterization of molecular targets in sensitive fungi
• Localization studies and characterization of endocytotic pathways in fungi
• Structural biology
• Determination of the relevance and function of antimicrobial proteins for the producing organisms
Major achievements
First steps towards biotechnological utilization of antimicrobial proteins
84
3
Co
+ PAF
Figure 2: Fluorescence micrographs showing chitin distribution and hyperbranching in A.
nidulans hyphae in response to
PAF treatement (+PAF) compared with the untreated control
(Co)
Figure 3:. TEM images of the
cellular ultrastructure of A. nidulans in response to PAF treatment compared with the untreated control
Future goals
Identification of molecular targets for the development of new therapeutic drugs
Group members Ulrike Binder, Doris
Bratschun, Andrea Eigentler, Nikoletta
Hegedüs Molecular Biology
mol-biol.i-med.ac.at/wg/lipocalin_lab.html
Tel.: 0043 (512) 9003.70203
Major achievements
Identification of a cellular receptor for beta-lactoglobulin
Lipocalins
Bernhard Redl
Structure and Function of Lipocalins and their Cellular Receptors Our group investigates structural and functional features of human lipocalins.
The protein superfamily of „lipocalins“ consists of small, mainly secretory
proteins defined on the basis of conserved amino acid sequence motifs and
their common structure. Functionally, they were found to be important
extracellular carriers of lipophilic compounds in vertebrates, invertebrates,
plants, and bacteria. There is increasing evidence that this group of proteins is
involved in a variety of physiological processes including retinoid, fatty acid,
and pheromone signaling, immunomodulation, inflammation, detoxification,
modulation of growth and metabolism, tissue development, apoptosis, and
even behavioral processes. Whereas the structural basis of lipocalin-ligand
binding is now well understood, there is a major lack of knowledge regarding
the mechanisms by which lipocalins exert their biological effects. This is mainly
due to the fact that only limited data are available on lipocalin receptors and
lipocalin-receptor interactions, although it is well accepted that many, if not all,
of these proteins are able to bind to specific cell receptors.
Current research projects of our lab focus on the following subjects:
• Identification of cellular lipocalin receptors, characterization of the molecular
mechanism of the receptor-ligand interaction and the biological processes
beyond receptor binding
• Evaluation of novel functions of lipocalins in innate immunity and allergy Group members Hermann Krabichler, Petra Merschak, Anna Mouossavi, Alexandra Pipal
Arne Skerra, TU Munich, Freising-Weihenstephan; Ben J. Glasgow, UCLA School of
Medicine, Los Angeles, CA, USA
A
Figure:
A Structure of Lipocalins B Lipocalin receptors
C Cellular targeting of Lipocalins
B
R
E
Q
L
F
H
E
R
I
R
E
C
V
S
E Y D P
L V
M
E
A
Y I Q
R G M Q G
W
N Y
P
L
R
T
M
N
P
S
A
G
S L Y
L
D
E
S
L
A
S
R
L
F
G
E
N
L
I
W
Q
D
E
A
H
L
V
I
Y
K
G
S
V
L
F
Y
N
L
E
L
S
L
N
K
W
E
P
S
D
K
N
I I S T
I I SF
L G S F
Y
V
I H I L
L F V L
G
C S Y L
A S A I
P
A
F
L L
V I L
S N L
A
I S F L
V W V M
A F
GA V L L L
V
V V Q I V
S
G
G
T L
L
F I L
V
L A I A L
L I F Y L
T G L S
L L V
L L L
L
L V L L C
M
L I Y
L V C T
M P F A
T L L M
L CT F T
V S S V
C
P
L
E L A
H I F L
V G
A I
L A
F Y
L A M L
A L G L
T F F Y
T V V M
K
T
R
S
E
E
P
N
R
S
M
S
Y
Y
F
V
V
E
F
P
G
R
K
T
G
L
S
L
G
F
A
F
K
V
N
A
L
D
P
R
R
T
G S R K G V
A
E
S
Q
G
E F
D
L
T T
W
K
L
A
L
S
V
K
P
A
L R
K
L
E
R
D
R
L
K
E
E
E
L
Q
L
L
V
Y
C
R
S
Q
A
T
F
Q
E
L
E
A
L
A
A
Q V
L
H R
T R
R I C
L L
N P T
M E
S C W L P L D
C
F D L L
R
G
T
D
L
F
G
G
L
R
T
F
R
N
S F V P
W L G N
F
L
A
I Y
S S
L F V
L V L
Y N A A F
L
A
C V C
T T L G
N G I I
L C
L A
L V
Q
K
T
T
Cytosol
M
F
A
T
A
T
A
D
V
H
R
R P R W
A
E
L
I
R
A
F
Q Q
G
Q H
T
L
R K
D
S
A
R
Q
L
P
F
P
L P
G
V S
85
Molecular Pathophysiology
www.tkfi.at/dmp
Reinhard Kofler
Director
Leukemia Apoptosis
Tel.: 0043 (512) 9003.70360
within the Division of Molecular Pathophysiology
Reinhard Kofler •Groups
Leukemia Apoptosis
Reinhard Kofler
The Division of Molecular Pathophysiology (DMP) aims at a better molecular
understanding of fundamental biological processes with the ultimate goal to
apply this knowledge to improve therapy and diagnosis of human diseases.
Specifically, we investigate apoptosis (Kofler), cell cycle control (Geley) and
proteins interacting with the glucocorticoid receptor (Helmberg). A recent
addition to our lab is the Applied Bioinformatics Group (Rainer) that supports
our high throuput analyses and the MUI-Expression Prolifing Facility which also
attached to the DMP. Our Division participates in several excellence programs
such as a local Research Program Project (SFB, "Spezialforschungsbereich“
Oncotyrol“.
021), the MCBO graduate college and “O
86
Resistance to anticancer therapy represents a major clinical problem.
Glucocorticoids (GC), trigger a suicide program - called apoptosis - in certain
benign and malignant lymphoid cells and are therefore used for the therapy of
hematological malignancies, most importantly childhood acute lymphoblastic
leukemia (ALL). In the Berlin-Frankfurt-Münster (BFM) protocol, children
suffering from ALL receive GC for 1 week before being assigned to a
polychemotherapy regimen of a risk-dependent intensity.
In most cases, GC treatment results in a remarkable reduction of tumor cells.
However, if the patients fail to respond to this therapy they require an intensified
chemotherapy. We aim to understand the effects of GC on leukemia cells on a
molecular level as well as to identify the various resistance mechanisms. This
knowledge should allow us to develop concepts for new therapies. Five major
research strategies are persued in our division.
Group members Martina Brunner, Michela Carlet, Kathrin Götsch, Daniela
Grazio, Barbara Gschirr, Anita Kofler, Martina Redziz (kein Bild), Bastian Oppl,
Alexander Trockenbacher
• Cell Cycle Control
• Molecular Oncology
• Applied Bioinformatics
Stephan Geley
Arno Helmberg
Johannes Rainer
Glucocorticoid-induced apoptosis
www.tkfi.at/dmp/en/research/detail.php?id=2
Identification of candidate genes for the anti-leukemic effects of GC, i.e. determination
of the gene expression profile of such cells in the absence or presence of GC, in a
clinical setting, i.e. in patients with acute lymphoblastic leukemia (ALL) using whole
genome microarray-based expression profiling (performed in our "Expression Profiling
Unit“). By inclusion of peripheral blood lymphocytes from GC-exposed healthy donors,
GC-sensitive and resistant ALL cell lines and mouse thymocytes, an essentially
complete list of GC-regulated candidate genes in clinical settings and experimental
systems was generated, allowing immediate analysis of any gene for its potential
significance to GC-induced apoptosis.
Advanced microarray technology and deep sequencing. More recently we have
embarked in analysing alternative transcripts (via Exon-Array technology), GC receptor
binding site definition in the human genome (ChIP-on-CHIP, ChIP-seq), translatome
analyses, and microRNA profiling. Verification of regulation and functional analysis of the candidate genes and novel
transcripts on the RNA and protein level is currently under way by real time RT-PCR and
Western blotting technologies and lentiviral, conditional systems for gene overexpression and RNA interference-based systems for gene knock-down, respectively.
Analyses of model systems of GC resistance. To understand how leukemia cells escape
cell death induced by GC, we have generated a large number of GC-resistant leukemia
cell lines which we investigate with respect to the mechanism(s) of resistance
development. Analyses include determination of GC-receptor structure and expression,
DNA finger printing, expression profiling, and FACS-based analyses.
Novel therapeutic combinations in preclinical models. From the knowledge obtained in
the above studies we try to develop concepts for novel therapeutic combinations, e.g.
GC combined with 2-deoxyglucose (an inhibitor of glucolysis), which yielded a
remarkable effect on an ALL model system.
Current results
Defining GC-regulated genes and transcripts in a variety of experimental and clinical
systems revealed an unexpected heterogeneity of this response questioning the model
system derived conclusions from previous studies. The transcriptional GC response is
highly complex including pro- and anti-apoptotic signals that encompass both proteinand microRNA-encoding genes. Apart from its most apical component, the GC
receptor (GR, NR3C1), no key regulator downstream of the GR has thus far been
identified in our functional analyses. At least in some systems, GC-induction of BH3only molecules (like BMF, BCL2L11/Bim and a potentially new transcript from the Bim
locus, called BimBam) appears to be critical for cell death induction. Additional cell
death pathways including metabolic alterations exaggerated by the lack of a negative
GR feedback may, however, contribute to this response.
Major achievements
•Defining the GC-regulated transcriptome in children during systemic GC mono-therapy
and numerous other biologically relevant lymphoid systems
• functional analyses of numerous GC response genes
• first identification of GC-regulated microRNAs
Future goals
A better delineation of the transcriptional response to glucocorticoids in normal and
malignant cells of the lymphoid lineage as it relates to the anti-leukemic and other
effects of glucocorticoids and resistance to this substance
.
• J.A. Irving, Northern Institute for Cancer Research, Newcastle Upon Tyne
• H. Kovar, R. Panzer, S. Strehl, St.Anna Kinderspital, Vienna; The Expression Profiling Unit (EPU) of
the Innsbruck Medical University
(head: Reinhard Kofler) provides a
number of services and bioinformatic support related to microarraybased technologies including expression profiling on various Affymetrix
arrays and microRNA screening, genome-wide detection of DNA-binding
proteins (ChIP-on-CHIP technology),
etc. The EPU is currently located
both at the Division of Molecular
PathOphysiology and the Tyrolean
Cancer Research Institute. For
further details, please visit the EPU
home
page
(http://www.gdcfepu.info/). 87
Tel.: 0043 (512) 9003.70366
Molecular Oncology
Arno Helmberg Research
Having our roots in Reinhard Kofler's lab, we have been searching for proteins
interacting with the glucocorticoid receptor (GR). The classical tool to detect low to
intermediate affinity protein-protein interactions is the yeast two-hybrid system. In its
commonly used form, it makes use of protein–protein interactions to reconstitute a
transcription factor necessary for the expression of reporter or selection genes.
Although powerful, this system has inherent limitations. Proteins like the GR, containing
transactivating domains, cannot be used as bait, as they would directly activate
expression of reporter genes independently of an interaction partner. To overcome these
limitations, we have modified a specialized, cytoplasmic form of the two-hybrid system
developed by A. Aronheim. By tethering the GR to the plasma membrane of the yeast
cell, we have been screening a HeLa library for proteins interacting with the receptor.
Isolated candidate proteins are then assayed in human cell lines for interaction with the
receptor. By doing so, we have isolated ZKSCAN4, a KRAB-containing zinc finger
protein that can be coprecipitated with the receptor at normal expression levels of the
two proteins. ZKSCAN4 seems to exert a chromatin-dependent inhibitory effect on
glucocorticoid receptor-mediated transactivation. For details, please see Ecker et al., J
Mol Endocrinol. 42: 105-117 (2009).
88
Teaching
A large part of my time is devoted to teaching mecidal students in the areas of
• immunology
• carcinogenesis
• pathophysiology of the liver & gastrointestinal system
• recombinant protein drugs
For these areas, I am providing extensive lecture notes in German and in English to help
students keep track of the essential information of the lectures series. These lecture
notes are kept up to date and may be freely accessed at my homepage
www.helmberg.at
Figure 1: Looking for glucocorticoid receptor-interacting proteins. Scanning electron micrograph of
a lymphocyte, courtesy of Kristian Pfaller
Major achievements
Identification of ZKSCAN4, a KRAB-containing zinc finger protein, as an interaction
partner of the glucocorticoid receptor
In 2010, Professor Helmberg was elected as „Professor of the term“ by the medical
students of the 7th semester.
Tel.: 0043 (512) 9003.703665
Figure 1: A normal metaphase in a human cervix carcinoma cell line (left panel). Structures of the
mitotic spindles are identified by indirect immunofluorescence. Microtubules are labelled in green,
spindle poles in yellow, chromosomes in blue and kinetochores in red. In the absence of Spindly
and NDC80 (right panel), the spindle forms independently of chromosomes and therefore becomes
displaced from them. This causes mitotic arrest and cell death.
Cell Cycle Control
Stephan Geley Function and regulation of cyclin dependent kinases CDKs are proline-directed serine/threonine kinases of the CMGC subgroup of
eukaryotic protein kinases. CDKs are activated by cyclins and are involved in
the control of cellular division, transcription, cell growth as well as additional
functions in differentiated cells such as neurons. Since deregulated cell cycle
control is a hallmark of tumorigenesis, a detailed understanding of cell cycle
control in normal and malignant cells is mandatory for a better understanding
of tumor development. Our work focuses on the function and regulation of the
mitotic cyclins A and B as well as their targets in order to understand how
these molecules control entry into, progression through and exit from mitosis,
respectively. In addition, we are interested in the function of ‘orphan CDKs‘, i.e.
members of the CDK family whose mode of activation and function is still
unknown.
Main aims and projects
• Function and regulation of mitotic cyclins
• Indentification of mitotic phosphoproteins (Sohm)
• Functional analysis of mitotic phosphoproteins (Barisic, Wandke)
• Functional analysis of microtuble-based motor proteins (Barisic, Wandke, Finsterbusch)
• Functional analysis of the APC/C activator Fzr1 (Sigl, Wandke, Shivalingaiah)
• Functional analysis of CDK16/Pctk1 (Mikolcevic, Sigl)
• Identification of germline mutations in PCTK1 in human infertile males (Stoiber, Fegerl) Cooperations
T. Hunt (Cancer Research UK,
London); R. Fässler (MPI Martinsried,
Munich)
Figure 2:
Conditional deletion of CDK16 causes male infertility due to a spermatogenesis defect. Arrows
indicate malformation of the sperm head, an annulus defect with a displaced septin ring (labeled in
red by immunofluorescence).
Major achievements
Strategies and main technologies
• Fzr1 function in G1-phase
• In vitro expression cloning
• Identification of an activator for CDk16/Pctk1• Phosphoproteomics
• Pin1 interactome
• Recombineering and GATEWAY technology
• Function of human Spindly in mitosis
• Lenti- adenoviral gene transduction
• KIF4A deficient cells
• Lentiviral conditional RNAi
• Gene targeting in mouse and human cell lines
Future goals
• Mouse genetics
• Fzr1 function in vivo
• AAV-mediated gene targeting
• Regulation of Spindly
• Live cell imaging, microinjection
• Function and regulation of chromokinesins • Cell cycle analysis
• Biochemistry
89
Group members Marin Barisic, Katharina Fegerl, Friederike Finsterbusch, Sylvia Maurer, Petra Mikolcevic, Cornelia Wandke, Benedicte Sohm, Veronika Rauch, Giridhar Shivalingaiah, Reinhard Sigl, Barbara Stoiber
Barbara Stoiber
bioinfo.i-med.ac.at/
Tel.: 0043 (512) 570485 13
Current projects
Applied Bioinformatics
Johannes Rainer
Modern high throughput technologies and the combination of different biological data
sets demand sophisticated computational and statistical solutions as well as analysis
documentation systems.
The Applied Bioinformatics Group was thus funded as a Junior Group to assist
scientists at the Medical University of Innsbruck with particular emphasis on groups
within the special research project SFB021 (“Cell Proliferation and Cell Death in
Tumors”) in bioinformatic and biostatistical analyses. The bioinformatic support of the
group for collaboration partners, including users of the Expression Profiling Unit of the
Medical University of Innsbruck, comprises support during the experimental design and
the analysis of high-throughput gene expression data including identification of
differentially expressed genes and further high-level analysis to aid in the biological
interpretation of the results. Analysis methods and algorithms are refined and adapted,
based on the specific properties of the investigated biological systems and design of the
experiments.
The main scientific focus of the group is centered at the analysis of the transcriptional
response of leukemia cells to glucocorticoid (GC) drug treatment with the aim to 1.
identify DNA binding sites of the GC receptor (GR) transcription factor, 2. to identify GCregulated protein coding and non-coding RNA species, 3. to identify specific, and
potentially novel isoforms of such GC-dependent genes. In this context we are
developing and refining methods for the analysis of current high-throughput platforms
for the identification of potentially new transcript variants and alternative splicing events
(Affymetrix Exon microarrays) and for the identification of in vivo transcription factor
binding sites on DNA entailing microarray based ChIP-chip and High Throughput
Sequencing based ChIP-seq data. Algorithms and methods are provided as opensource R software packages to be used in an R/Bioconductor analysis framework.
90
.Major collaborators
J.A. Irving, Northern Institute for Cancer Research, Newcastle Upon Tyne; H. Kovar, R. Panzer, S.
Strehl, St.Anna Kinderspital, Vienna; Group members Daniel Bindreither, Julien Lelong, Markus Unterwurzacher •Analysis of ChIP-chip and ChIP-seq data including bioinformatic approaches for the prediction of
potential transcription factor binding sites on DNA sequences
•Analysis of Affymetrix Exon microarrays for the identification of specific regulated gene isoforms
and differential splice events
•Comprehensive analysis of microarray data from acute lymphatic leukemia (ALL) patients
undergoing in vivo GC treatment including comparisons of transcriptional responses in the various
ALL subtypes relative to the response in normal lymphoid cells
• Comparisons and analysis of the in-vivo and in-vitro response of leukemia cells to GC treatment
•Development of a web application for the storage and analysis of FACS data (in collaboration with
the UMIT, Department of Bioinformatics and Translational Research)
Figure 1: Transcriptional regulation of the
gene TSC22D3 by glucocorticoids (GC). a) in vivo binding of the GR transcription
factor to the DNA. Orange rectangle and
red peaks represent binding sites identified
by ChIP-chip and ChIP-seq analysis
respectively. b) TSC22D3 transcript variants. c) Expression of the individual exons of
TSC22D3 in the presence (red) and
absence (blue) of GC determined by
Affymetrix Exon microarray analysis.
Major achievements
1. CARMAweb, web application for the analysis of microarray data. 2. Identification of GC regulated microRNAs/analysis workflow using conventional gene expression
microarrays for the prediction of microRNA expression/regulation. 3. Various software packages for the analysis of biological data (including Bioconductor packages
maDB and pgUtils).
Future goals
A better delineation of the transcriptional response to glucocorticoids in normal and malignant cells
of the lymphoid lineage as it relates to the anti-leukemic and other effects of glucocorticoids and
resistance to this substance.
Neurobiochemistry
www.i-med.ac.at/ imcbc/neurobiochemistry/
Christine Bandtlow
Tel.: 0043 (512) 9003.70281
Director
Neurobiochemistry
Christine Bandtlow Groups within the Division of Neurobiochemistry
The lab is primarily interested in delineating the physiological functions of reticulon
proteins (RTN) and their signaling molecules in the nervous system. Related to their
association with the ER, RTN proteins have been suggested to play a role in the
regulation of intracellular trafficking of proteins involved in exo- and endocytosis, but
their precise cellular functions remain unknown. Although many RTN isoforms show
distinct expression patterns in the CNS and PNS - both in the developing and mature
nervous system – RTN4-A/Nogo, is the only RTN member with a defined function in the
adult brain. Nogo-A was originally identified as a myelin-derived inhibitor of neurite
outgrowth and has been implicated as a major factor preventing neuronal regeneration
and compensatory sprouting in the adult CNS. Over the past few years, considerable
progress has been made in our understanding of the structure-function relationship of
Nogo-A, its axonal receptors, and the intracellular signaling cascades mediating
inhibition of axon outgrowth. However its physiological significance as an intracellular
protein of neurons is unknown. Recent studies in our lab highlight novel functions of RTN-4A/Nogo-A and other RTN isoforms as
important intracellular regulators of axonal and dendritic morphogenesis in vitro and in vivo. Present
aims are to unravel the molecular mechanisms that mediate these effects and to analyse proteins
that specifically interact with neuronally expressed RTN proteins. In addition, we use several knockout mouse model systems to explore and define the role of the Nogo receptor components
p75NTR and NgR in normal and diseased brains.
Major achievements
Identification of a noncanonical caspase recognition site in Nogo-B
Future goals
Characterization of the physiological function of RTN proteins in neurons
Neurobiochemistry
Neurotoxicity
Christine Bandtlow
Gabriele Baier-Bitterlich
Stefan Frentzel, Novartis Pharma, Basel, Switzerland; Mathias
Klugmann, Physiological Chemistry, Mainz, Germany; Martin
Korte, Marta Zagrebelsky, TU
Braunschweig, Germany; Roland Martin, ZMNH, Hamburg,
Germany
Group members Bastian Bäumler, Sarah Borrie, Igea Contarini, Helene Heiss, Katja Jacob, Levent Kaya, Florian Kern, Barbara Meissner, Rüdiger Schweigreiter, Stephan Sickinger, Sandra Trojer
91
Neurobiochemistry
http://www.i-med.ac.at/neurobiochemistry/neurobiochemistry/Biooptics/Main.html
Tel.: 0043 (512) 9003.70284
Biooptics Martin Offterdinger
The MUI Biooptics facility, implemented in 2009 at the Division of Neurobiochemistry,aims at providing university-wide access to advanced equipment, training,
education and expertise in light microscopy to all scientists on the campus. We
currently offer assisted access to research microscopes and image processing
software. Moreover, a number of courses is offered within the different PhD training
programmes at the MUI.
Presently, we are harbouring one high-end confocal microscope (Leica SP5) equipped
with 4 independent lasers, a live cell incubation chamber and several software modules
facilitating advanced imaging methods such as fluorescence recovery after
photobleaching (FRAP), fluorescence resonance energy transfer (FRET), UV-induced
photoactivation and multi-position time-lapse imaging.
92
Figure 1: Isosurface reconstruction (cyan) of a U2OS
cell nucleus (green) in close
contact with IGFBP3 positive vesicles (red). Software support is offered at various levels, from basic user manuals to complex
interactive and collaborative calculations. We have currently licensed a deconvolution
software package (Huygens Professional), which enables us to improve the resolution
of light microscopic images, especially in the axial direction. Due to the high
computational power required for deconvolution algorithms, we have installed this
software on a server located within the MUI IT department. All users can get access to
the server via their local PCs using auxiliary software. Moreover, we have purchased a
commercial software package (Imaris) allowing the performance of advanced and
challenging interactive 3D image analyses and installed it on a high-performance image
processing workstation (WinXP 64 bit, 17 Gb RAM, 1Gb graphics card, several
harddisks) located at the Division of Neurobiochemistry. In general, the software is
mainly employed for 3D analysis of confocal images, isosurface renderings and
advanced movies. Additional software options allow us to analyze colocalization and to
perform tracking, e.g. of vesicles but also whole cells, or to measure the properties of
neurons. For both the confocal microscope and the Imaris workstation, an on-line
booking system has been established in order to ensure fair access for all users.
Figure 2: Orthoslice of a
plant‘s cells with cell wall
(red)
and
chloroplasts
(green). Future goals
We plan to integrate a number of existing microscopes into the biooptics facility and to a new Total
Internal Reflection Fluorescence (TIRF) microscope
Neurobiochemistry
Tel.: 0043 (512) 9003.70289
Neurotoxicity
Gabriele Baier-Bitterlich
To reduce apoptosis in the brain is central to functional recovery after stroke. Present
research is focused on the development of drugs that block the apoptotic process,
hoping to improve clinical outcome. The purine nucleoside adenosine is produced and
released in the central nervous system in response to ischemia and hypoxia. It acts as a
powerful endogenous neuroprotectant during ischemia-induced energy failure, by
decreasing neuronal metabolism and increasing cerebral blood flow. Purine nucleosides
interact specifically with several different purinoceptors (A1, A2, A3, A2B) in the figure to
the right) and thereby induce several distinct intercellular signaling pathways. This is
particularly the case in the brain, which expresses high concentrations of purinoceptors.
Activation of adenosine receptors and stimulation of their downstream signaling
functions were hypothesized to result in an effective treatment of stroke. Previous results in this laboratory demonstrated the positive impact of the purine
nucleosides adenosine, inosine and guanosine on viability and neurite outgrowth of
neuronal PC12 cells and on primary rat cerebellar granule neurons. Our data on the
activation and potential causal roles of p42/p44 mitogen-activated kinases (alias
ERK1/2) and hypoxia-inducible transcription factor-1 (HIF1-alpha) in these pathways
supported the investigation of the molecular effector pathways of MAPK/HIF1-alpha in
purine nucleoside-mediated signaling leading to regeneration and/or survival of neurons.
Major achievements
Figure 1: Scheme of the currently proposed mode of action of purin agonists via different
adenosine receptors (purinoceptors A1, A2, etc.) and their associated signaling pathways.
These can lead to either inhibition of neuronal activity or survival of neurons or both. Hoechst/PI
• Establishment of positive effect of purine nucleosides on viability and neurite outgrowth and of the
special role of p42/44 MAPK and HIF-1alpha.
• FWF project 19578-B05, Hertha-Firnberg fellowship (B.Thauerer)
Future goals
Analysis of p42/44 MAPK activation and substrates in purine-mediated protection
Figure 2.: Hypoxic cell death of cerebellar granule
neurons
Michail Sitkovsky, Dana-Farber Cancer Institute, Boston, USA
Group member: Bettina Thauerer (former Tomaselli)
93
project
din
94
a4
architects innsbruck
between
the
University
of
Innsbruck
and
the
Innsbruck
Medical
University
2011
joint
The New Biocenter
A
the future
2011
The New Biocenter
On September 19, 2008, the foundation ceremony of the new research
building was held by federal minister Johannes Hahn, rector Karlheinz
Töchterle (University of Innsbruck), vice rector Manfred Dierich (Innsbruck
Medical University) and Lukas A. Huber (director, Biocenter). The facility, into which also the Biocenter will be incorporated, will
comprise 35.000 sqm of laboratories, offices and lecture rooms,
its building costs amounting to 75 million Euros. By 2011, the
new Biocenter is expected to start full operation. As the minister
said, this facility will be a landmark for the life sciences in western
Austria.
There is one person to mention here:
Mag. Pia Müller. Since years she has
devoted all her working energy into
the fine planning of this builiding.
Hours of discussions with technical
providers, furniture companies etc.
All details are in her mind.
Thank you, Pia!
architects innsbruck
din
a4 95
This report has been designed and edited by Siegfried Schwarz, by order of the department conference of THE BIOCENTER and with the help of Peter Loidl and Lukas A. Huber.
The contents are based on informations provided by the directors and group leaders of the BIOCENTER. Gregor Retti is thanked for elaborating data on publications and funds.
The logo of the BIOCENTER (to the left) was created by Siegfried Schwarz in 2007 and is by acceptance by the Department Conference officially used by the BIOCENTER.
Printed by Egger-Druck Imst/Tyrol, 2010

Report 2010 - Biocenter - Medizinische Universität Innsbruck

Transcription

Similar documents

Report 2008

Tätigkeitsbericht zum 6. EU-Rahmenprogramm

Marlow Floral Products

3. - Universitätsklinik für FRAUENHEILKUNDE Innsbruck