title of the thesis - QSpace

THE NRF-1/GABP/BRCA1 TRANSCRIPTIONAL NETWORK IN
MAMMARY EPITHELIAL DIFFERENTIATION
by
Crista Lisbeth Thompson
A thesis submitted to the Department of Pathology & Molecular Medicine
In conformity with the requirements for
the degree of Doctor of Philosophy
Queen’s University
Kingston, Ontario, Canada
(September, 2012)
Copyright © Crista Lisbeth Thompson, 2012
Abstract
Evidence indicates that the mammary epithelium is arranged in a hierarchy in which
mature luminal and myoepithelial cells are derived from stem cells through a series of lineagerestricted intermediates. One of the more compelling hypotheses in breast cancer research is that
transformation of a particular cell within the hierarchy will initiate a tumour with a specific
molecular profile and clinical outcome. If this is true, valuable insight into tumourigenesis can be
gained by investigating normal and malignant pathways of differentiation. A well-known tumour
suppressor in breast cancer, BRCA1, plays a role in mammary epithelial differentiation. It has
been proposed that haploinsufficiency or loss of BRCA1, either by germline mutation or sporadic
downregulation, blocks differentiation producing a pool of genetically unstable mammary
stem/progenitor cells that are prime targets for transformation. Thus, investigation of BRCA1
regulation and its role in differentiation are important to our understanding of breast cancer
etiology. In this study, we determined that BRCA1 is at the end of a transcriptional network
comprised of NRF-1 and GABP, a transcription factor comprised of two distinct subunits
GABPα and GABPβ. Decreased BRCA1 transcription in SK-BR-3 cells was found to be caused
by aberrant activation of the GABPβ promoter by an NRF-1 binding protein complex. We
determined that the SWI/SNF family members BRG1, ARID1A and BAF155 may participate in
the complex that activates GABPβ transcription in conjunction with NRF-1. Examination of
NRF-1, GABP and BRCA1 in 3D culture models suggests that mammary epithelial
differentiation is biphasic with the transition between the phases being driven by changes in
BRCA1 expression and localization. In the first phase, BRCA1 promotes differentiation in the
nucleus, and in the second phase, BRCA1 is downregulated as a result of diminished GABP
expression and relocated to an apical position, presumably to facilitate cell polarization.
Following BRCA1 downregulation, NRF-1 and GABP levels increase indicating they are
ii
inducing oxidative phosphorylation in the second phase of differentiation. The involvement of
NRF-1 and GABP in cellular respiration as well as differentiation through targets such as BRCA1
suggests that these proteins may integrate the cellular functions and mitochondrial metabolism
required for mammary epithelial differentiation.
iii
Co-Authorship
Chapter 2 entitled “Decreased expression of BRCA1 in SK-BR-3 cells is the result of
aberrant activation of the GABP Beta promoter by an NRF-1-containing complex” has been
published – Thompson et al., Molecular Cancer 2011, 10:62. The authors are Crista Thompson,
Gwen MacDonald and Christopher R. Mueller. CT and GM participated in the study design and
carried out the experiments as specified in the figure legends. CT drafted the manuscript. CRM
conceived of the study and participated in its design and helped to draft the manuscript. All
authors read and approved the final manuscript.
Chapter 3 entitled “The role of the SWI/SNF nucleosome remodelling complex in the
NRF 1>GABP>BRCA1 transcriptional network” has been prepared for peer review. The authors
are Crista Thompson and Christopher R. Mueller. CT participated in the study design, carried out
the experiments and drafted the manuscript. CRM conceived of the study, participated in its
design and edited the manuscript. Both authors read and approved the final manuscript.
Chapter 4 entitled “Basal versus luminal progenitor cell differentiation: a comparison of
MCF-10A and 184hTERT cells in three-dimensional culture” has been prepared for peer review.
The authors are Crista Thompson, Rachael Klinoski, Sherri Nicol and Christopher R. Mueller.
CT, RK and SN carried out the experiments as specified in the figure legends. CT participated in
the study design and drafted the manuscript. CRM conceived of the study, participated in its
design and edited the manuscript. All authors read and approved the final manuscript.
All remaining sections of this thesis were written by Crista Thompson.
iv
Acknowledgements
First and foremost, I would like to thank my supervisor, Dr. Christopher Mueller for all
his guidance and support throughout my doctoral research. I would also like to acknowledge the
contributions of my supervisory committee members, Dr. David Lebrun and Dr. Christopher
Nicol, as well as Dr. Peter Greer and Dr. Bruce Elliott for their input and advice. I would like to
thank the members of the Mueller lab, past and present, for being the greatest bunch of lab sisters
anyone could hope for: Rachael Klinoski, Heather Ritter, Valerie Kelly-Turner, Sherri Nicol,
Alyssa Cull, Christina Lamparter, Kirsten Nesset, Marni Fellows, Gwen MacDonald and Lilia
Antonova. I’m going to miss you all very much. I gratefully acknowledge Jeff Mewburn and
Matt Gordon for their technical expertise in confocal microscopy and flow cytometry.
In
addition, I would like to acknowledge the generous financial support of the Canadian Breast
Cancer Foundation – Ontario Region. Finally, I’d like to thank my parents and my extended
family for thinking it’s cool that I’m still in school, and my “hubby” James for being such an avid
science enthusiast (for an IT guy).
v
Table of Contents
Abstract ............................................................................................................................................ ii
Co-Authorship ................................................................................................................................ iv
Acknowledgements .......................................................................................................................... v
List of Figures .................................................................................................................................. x
List of Tables ................................................................................................................................. xii
List of Abbreviations .................................................................................................................... xiii
Chapter 1 General introduction........................................................................................................ 1
1.1 Breast cancer at the molecular level ...................................................................................... 1
1.2 Differentiation of the human mammary epithelium............................................................... 2
1.3 BRCA1................................................................................................................................... 4
1.3.1 BRCA1 in breast cancer.................................................................................................. 4
1.3.2 BRCA1 in mammary epithelial cell differentiation ........................................................ 5
1.3.3 Transcriptional regulation of BRCA1 ............................................................................. 7
1.4 GABP ..................................................................................................................................... 9
1.4.1 GABP structure ............................................................................................................... 9
1.4.2 GABP in stem cell renewal and differentiation ............................................................ 11
1.4.3 GABP in cell cycle regulation ...................................................................................... 12
1.4.4 GABP as a nuclear respiratory factor ........................................................................... 14
1.5 NRF-1 .................................................................................................................................. 16
1.5.1 NRF-1 structure ............................................................................................................ 16
1.5.2 Regulation of mitochondrial function ........................................................................... 16
1.5.3 NRF-1 in cell cycle regulation ...................................................................................... 18
1.6 Rationale, hypothesis and objectives ................................................................................... 18
1.6.1 Rationale and hypothesis .............................................................................................. 18
1.6.2 Objectives ..................................................................................................................... 19
Chapter 2 Decreased expression of BRCA1 in SK-BR-3 cells is the result of aberrant activation
of the GABP Beta promoter by an NRF-1-containing complex .................................................... 21
2.1 Abstract ................................................................................................................................ 21
2.2 Background .......................................................................................................................... 22
2.3 Methods ............................................................................................................................... 24
2.3.1 Cell culture .................................................................................................................... 24
2.3.2 DNA constructs............................................................................................................. 24
vi
2.3.3 Recombinant NRF-1 ..................................................................................................... 27
2.3.4 Dual luciferase assay..................................................................................................... 27
2.3.5 Electrophoretic mobility shift assay (EMSA) ............................................................... 28
2.3.6 Chromatin immunoprecipitation (ChIP) ....................................................................... 28
2.3.7 siRNA Knockdown ....................................................................................................... 29
2.3.8 Semi-quantitative RT-PCR ........................................................................................... 30
2.3.9 Quantitative RT-PCR .................................................................................................... 30
2.3.10 Preparation of whole cell lysates ................................................................................ 32
2.3.11 Western blot ................................................................................................................ 32
2.3.12 Immunofluorescence ................................................................................................... 33
2.4 Results .................................................................................................................................. 33
2.4.1 Differential expression of BRCA1 in MCF-7 versus SK-BR-3 cell lines .................... 33
2.4.2 Endogenous GABPβ activity and levels are lower in SK-BR-3 cells........................... 36
2.4.3 Expression of exogenous GABPβ restores BRCA1 proximal promoter activity, and
GABPα levels and localization in SK-BR-3 cells ................................................................. 36
2.4.4 A critical activating factor(s) binds to the GABPβ promoter between -268 and -251 .. 41
2.4.5 NRF-1 binds to the GABPβ promoter between -268 to -251 ....................................... 44
2.4.6 Loss of NRF-1 decreases GABPβ and BRCA1 gene expression ................................. 44
2.4.7 NRF-1 levels and activity are similar between MCF-7 and SK-BR-3 cells ................. 47
2.4.8 NRF-1 is one member of a protein complex that activates GABPβ transcription ........ 47
2.5 Discussion ............................................................................................................................ 50
2.6 Conclusions .......................................................................................................................... 53
2.7 Acknowledgements .............................................................................................................. 54
Chapter 3 The role of the SWI/SNF nucleosome remodelling complex in the
NRF-1>GABP>BRCA1 transcriptional network .......................................................................... 55
3.1 Abstract ................................................................................................................................ 55
3.2 Background .......................................................................................................................... 56
3.3 Methods ............................................................................................................................... 58
3.3.1 Identification of NRF-1 binding proteins...................................................................... 58
3.3.2 Antibodies ..................................................................................................................... 59
3.3.3 DNA constructs and siRNA .......................................................................................... 59
3.3.4 Preparation of transfected whole cell lysates/ nuclear extracts and coimmunoprecipitation .............................................................................................................. 60
vii
3.4 Results .................................................................................................................................. 60
3.4.1 Isolation of proteins that form the NRF-1 binding complex on the GABPβ promoter. 60
3.4.2 Identification of SWI/SNF proteins as members of the NRF-1 binding complex on the
GABPβ promoter ................................................................................................................... 62
3.4.3 Binding of BRG1, ARID1A and BAF155 to the GABPβ promoter............................. 68
3.4.4 Effects of exogenous BRG1 and loss of BRG1, ARID1A and NRF-1 on GABPα,
GABPβ and BRCA1 protein levels ....................................................................................... 72
3.4.5 Effects of exogenous BRG1 and loss of BRG1, ARID1A and NRF-1 on GABPβ and
BRCA1 promoter activity ...................................................................................................... 75
3.4.6 Evaluation of BRG1, ARID1A and BAF155 binding to Gb-290 versus Gb-270 ......... 78
3.5 Discussion ............................................................................................................................ 80
3.6 Conclusions .......................................................................................................................... 87
3.7 Acknowledgements .............................................................................................................. 88
Chapter 4 Basal versus luminal progenitor cell differentiation: a comparison of MCF-10A and
184hTERT cells in three-dimensional culture ............................................................................... 89
4.1 Abstract ................................................................................................................................ 89
4.2 Background .......................................................................................................................... 90
4.3 Methods ............................................................................................................................... 92
4.3.1 Three-dimensional acini culture.................................................................................... 92
4.3.2 Preparation of whole cell lysates from acini ................................................................. 93
4.3.3 Antibodies ..................................................................................................................... 93
4.3.4 Quantitative RT-PCR .................................................................................................... 94
4.3.5 Immunofluorescence ..................................................................................................... 94
4.3.6 ALDEFLUOR assay ..................................................................................................... 95
4.3.7 Flow cytometry ............................................................................................................. 96
4.4 Results .................................................................................................................................. 96
4.4.1 MCF-10A and 184hTERT cells have different protein expression profiles during acini
formation and differentiation ................................................................................................. 96
4.4.2 BRCA1 and ERα localization differs in MCF-10A and 184hTERT acini throughout
differentiation......................................................................................................................... 99
4.4.3 Undifferentiated MCF-10A and 184hTERT cells are comprised of different mammary
epithelial cell subtypes ......................................................................................................... 106
4.5 Discussion .......................................................................................................................... 110
viii
4.6 Conclusions ........................................................................................................................ 118
4.7 Acknowledgements ............................................................................................................ 118
Chapter 5 General discussion....................................................................................................... 120
5.1 The NRF-1/GABP/BRCA1 transcriptional network ......................................................... 120
5.2 NRF-1, GABP and BRCA1 in mammary epithelial differentiation .................................. 123
5.3 Conclusion ......................................................................................................................... 126
References .................................................................................................................................... 128
Appendix A Supplemental figures ............................................................................................... 150
ix
List of Figures
Figure 1: Hierarchical model of mammary epithelial differentiation. ............................................. 3
Figure 2: Regulation of the BRCA1 promoter.................................................................................. 8
Figure 3: Structure of GABPα and β. ............................................................................................ 10
Figure 4: GABP in cell cycle regulation. ....................................................................................... 13
Figure 5: NRF-1 and GABP co-ordinate the expression of nuclear genes required for
mitochondrial functions. ................................................................................................ 15
Figure 6: BRCA1 expression and GABP alpha/beta activity is reduced in SK-BR-3 cells........... 35
Figure 7: GABPα and β subunit protein and mRNA levels are decreased in the SK-BR-3
cell line. ......................................................................................................................... 37
Figure 8: Exogenous GABPβ in SK-BR-3 cells restores BRCA1 proximal promoter
activity and stabilizes endogenous GABPα. .................................................................. 38
Figure 9: GABPα nuclear localization is rescued by GABPβ in SK-BR-3 cells........................... 40
Figure 10: GABPβ promoter activity in MCF-7 and SK-BR-3 cell lines. ..................................... 42
Figure 11: Binding complexes that form on the GABPβ promoter. .............................................. 43
Figure 12: NRF-1 binds to the GABPβ promoter. ......................................................................... 45
Figure 13: NRF-1 loss attenuates GABPβ promoter activity and GABPβ/BRCA1
expression; NRF-1 is consistent between cell lines....................................................... 46
Figure 14: NRF-1 is a component of a protein complex that binds to the GABPβ
promoter. ....................................................................................................................... 49
Figure 15: Isolation of the proteins that form the NRF-1 binding complex on the GABPβ
promoter. ....................................................................................................................... 63
Figure 16: Identification of BRG1, ARID1A and BAF155 as members of the NRF-1
binding complex on the GABPβ promoter .................................................................... 67
Figure 17: Binding of BRG1 and ARID1A to the GABPβ promoter. ........................................... 69
Figure 18: Binding of BRG1 and ARID1A to the GABPβ promoter (continued). ........................ 71
Figure 19: Binding of BRG1 and BAF155 to the GABPβ promoter. ............................................ 73
Figure 20: Effects of exogenous BRG1 and loss of BRG1, ARID1A and NRF-1 on
GABPα, GABPβ and BRCA1 protein levels. ............................................................... 74
Figure 21: Effects of exogenous BRG1 and loss of BRG1, ARID1A and NRF-1 on
GABPβ and BRCA1 promoter activity. ......................................................................... 77
x
Figure 22: Evaluation of BRG1 and NRF-1 column fraction binding to Gb-290 versus
Gb-270. .......................................................................................................................... 79
Figure 23: Protein expression profiles of MCF-10A and 184hTERT cells throughout acini
formation and differentiation. ........................................................................................ 97
Figure 24: BRCA1 localization in MCF-10A and 184hTERT acini throughout
differentiation. ............................................................................................................. 100
Figure 25: ERα localization in MCF-10A and 184hTERT acini at Day 15. ............................... 105
Figure 26: ALDH activity of MCF-10A, MCF-7 and 184hTERT cells. ..................................... 108
Figure 27: Quantification of mammary epithelial cell subtypes in undifferentiated MCF10A and 184hTERT populations. ................................................................................ 109
Figure 28: ALDH1A3 mRNA and protein levels in undifferentiated 184hTERT and
MCF-10A cell lines. .................................................................................................... 111
Figure 29: MCF-10A and 184hTERT acini model different stages in the mammary
epithelial differentiation hierarchy. ............................................................................. 114
Figure 30: Feedback regulation of the NRF-1/GABP/BRCA1 transcriptional network. ............ 121
xi
List of Tables
Table 1: Primers, templates and restriction enzymes used in the preparation of DNA
constructs ....................................................................................................................... 25
Table 2: Primers used for RT PCR ................................................................................................ 31
Table 3: Experimental details and results for co-immunoprecipitations performed to
confirm the interaction of NRF-1 with BRG1, ARID1A and BAF155 ......................... 61
Table 4: Identification by mass spectrometry of proteins eluted from the NRF-1 binding
column in the 300 mM KCl fraction ............................................................................. 64
xii
List of Abbreviations
3D, three-dimensional
ALDH, aldehyde dehydrogenase
AR, Ankyrin repeats
ARID1A, AT-rich interactive domain-containing protein 1A
ARID1B, AT-rich interactive domain-containing protein 1B
BAA, BODIPY® -aminoacetate
BAAA, BODIPY® -aminoacetaldehyde
BAF, BRG1/BRM-associated factor
BAF155, BRG1-associated factor 155
BARD1, BRCA1 associated RING domain 1
BRCA1, breast cancer 1 early onset
BRD7, bromodomain containing 7
BRG1, Brahma-related gene 1
BRM, Brahma
BSA, bovine serum albumin
CB, column buffer
CDK, cyclin-dependent kinase
CDX-2, caudal type homeobox 2
CHFR, checkpoint with forkhead and ring finger domains
ChIP, chromatin immunoprecipitation
ChIP-on-chip, chromatin immunoprecipitation (ChIP) coupled with promoter microarrays (chip)
ChIP-seq, chromatin immunoprecipitation-sequencing
CK, cytokeratin
CKI, cyclin-dependent kinase inhibitor
xiii
Co-IP, co-immunoprecipitation
COX, cytochrome C oxidase
COXIV, cytochrome oxidase subunit 4
DBD, DNA binding domain
DEAB, diethylaminobenzaldehyde
DNAPKcs, DNA-dependent protein kinase catalytic subunit
EDTA, ethylenediaminetetraacetic acid
EMSA, electrophoretic mobility shift assay
EpCAM, epithelial cell adhesion molecule
ERα, estrogen receptor α
ErbB2, v-erb-b2 erythroblastic leukemia viral oncogene homolog 2
ES, embryonic stem
ETS-2, v-ets erythroblastosis virus E26 oncogene homolog 2
EZH2, enhancer of zeste homolog 2
FITC, fluorescein isothiocyanate
GABP, GA binding protein
GAPDH, glyceraldehyde 3-phosphate dehydrogenase
GR, glucocorticoid receptor
HC, hydrocortisone
HCF-1, host cell factor C1
HDAC, histone deacetylase I
HEPES, 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid
HIF-1, hypoxia-inducible factor 1
ID4, inhibitor of DNA binding 4
IF, immunofluorescence
xiv
INK4, inhibitors of CDK4
KCl, potassium chloride
KH2PO4, potassium phosphate monobasic
KIS, kinase interacting with leukemia-associated gene stathmin
KLF4, kruppel-like factor 4
LC-MS/MS, liquid chromatography-mass spectrometry/mass spectrometry
LOH, loss of heterozygosity
M, monolayer
MAX, MYC associated factor X
MBP, maltose binding protein
mtDNA, mitochondrial DNA
MYC, v-myc myelocytomatosis viral oncogene homolog (avian)
NaCl, sodium chloride
NaH2PO4, sodium phosphate monobasic
Na2HPO4, sodium phosphate dibasic
NaN3, sodium azide
NBR2, neighbor of BRCA1 gene 2
NEB, New England Biolabs
NOD/SCID, non-obese diabetic/severe combined immune deficiency
NLS, nuclear localization signal
NR2F1, nuclear receptor subfamily 2, group F, member 1
NR6A1, nuclear receptor subfamily 6, group A, member 1
NRF-1, nuclear respiratory factor-1
NRF-2, nuclear respiratory factor-2
OCT-4, POU class 5 homeobox 1 (POU5F1)
xv
OST, on-sight domain
PARP-1, poly(ADP-ribose) polymerase-1
PBAF, Polybromo-associated BAF
PBS, phosphate buffered saline
PCR, polymerase chain reaction
PE, phycoerythrin
PGC1α, peroxisome proliferator-activated receptor gamma coactivator 1α
PGC1β, peroxisome proliferator-activated receptor gamma coactivator 1β
PMSF, phenylmethanesulphonylfluoride
PNT, pointed domain
POU2F1, POU class 2 homeobox 1
PR, progesterone receptor
PRC, PGC-1-related coactivator
qRT PCR, quantitative reverse transcriptase polymerase chain reaction
RA, retinoic acid
RB, retinoblastoma protein
RIBS, EcoRI bandshift
RIPA, radioimmunoprecipitation assay
RNA pol II, RNA polymerase II
RT, reverse transcribed/transcription
S, shift/binding complex
SDS, sodium dodecyl sulfate
SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis
shRNA, small hairpin RNA
siRNA, small interfering RNA
xvi
SKP2, S-phase kinase-associated protein 2
SMA, smooth muscle actin
SOX2, sex determining region Y-box 2
SS, supershift/binding complex
STAT3, signal transducer and activator of transcription 3
SWI/SNF, switching defective/sucrose nonfermenting
TAD, transcriptional activation domain
TBP, TATA binding protein
TIC, tumour initiating cell
TPO, thrombopoietin
UP, upstream
xvii
Chapter 1
General introduction
1.1 Breast cancer at the molecular level
With the exception of non-melanoma skin cancer, breast cancer is the most common
cancer among Canadian women. It is estimated that one in nine women will develop breast
cancer during her lifetime and one in 29 will die from it (Canadian Cancer Society's Steering
Committee on Cancer Statistics: Canadian Cancer Statistics 2012). Breast cancer mortality rates
have declined since the mid-1980’s due to improved early detection and more effective therapies,
however the fact remains that once the disease becomes metastatic, it is incurable. Although
breast cancer is a heterogeneous disease in terms of presentation, morphology, molecular profile
and response to therapy, gene expression erythroblastic leukemia profiling has identified six
clinically relevant subtypes – luminal A, luminal B, normal breast-like, ErbB2+ (v-erb-b2
erythroblastic leukemia viral oncogene homolog 2 +), basal-like and claudin-low [1-4]. While
luminal A and B subtypes are typically associated with a good prognosis, ErbB2+ tumours are
associated with poor overall survival [5]. The basal-like and claudin-low subgroups are among
the most clinically aggressive and tend to be hormone receptor and ErbB2 negative (triple
negative) [4,6] which makes them unresponsive to both endocrine therapy and trastuzumab, a
humanized monoclonal antibody that targets ErbB2 [7]. Because the gene expression profiles of
these six tumour subtypes segregate with cellular subpopulations found within the normal breast
[4], the current working hypothesis in the field is that the heterogeneity of breast cancer is due in
part to the differentiation hierarchy of the mammary epithelium.
More specifically, that
transformation of a cell within a distinct mammary epithelial subpopulation generates a particular
tumour subtype with an associated clinical outcome.
1
1.2 Differentiation of the human mammary epithelium
The mammary gland is a branched network of ducts that end in lobules of secretory acini
embedded in a matrix of stromal cells, blood vessels and lymphatics [8]. The ducts and lobules
are comprised of a stratified epithelium with luminal cells lining an inner lumen and contractile
myoepithelial cells residing at the basal surface of the epithelium between the luminal cells and
the basement membrane.
According to the hierarchical model of mammary epithelial
differentiation, mature luminal and myoepithelial cells are derived through a series of lineagerestricted intermediates from self-maintaining undifferentiated mammary stem cells (Figure 1).
The existence of a breast hierarchy is consistent with the profound expansion of the mammary
epithelium during puberty and pregnancy [6]. Moreover, it has been demonstrated that an entire
functional mouse mammary gland can be generated from a single (stem) cell [9], and epithelial
subsets representing different levels in the hierarchy have been identified in human mammary
tissue. Mammary stem/progenitor cells capable of generating mammary epithelial structures in
vivo have been isolated on the basis of high aldehyde dehydrogenase (ALDH) activity [10]. A
similar subset of human breast stem/progenitor cells characterized by high expression of CD49f
and low expression of Epithelial cell adhesion molecule (EpCAM) has been shown to have
mammary regenerative capacity in vivo [11,12].
Bipotent progenitors capable of forming
colonies containing a central core of luminal cells surrounded by myoepithelial-like cells have
been isolated, and myoepithelial-restricted progenitor cells have been shown to lie downstream
from bipotent progenitors through serial passaging [13]. Finally, luminal-restricted progenitors
have been identified as expressing both CD49f and EpCAM [11-13]. If the hierarchical position
of the transformed cell is reflected in the resulting tumour (Figure 1), a better understanding of
normal epithelial subtypes, their pathways of differentiation as well as their predisposition to
transformation will contribute to our understanding of tumour heterogeneity and provide insight
2
Figure 1: Hierarchical model of mammary epithelial differentiation.
Mature luminal and myoepithelial cells are derived from self-maintaining mammary stem cells through a
series of lineage-restricted intermediates. Mammary stem/early progenitor cells are characterized by high
expression of CD49f and low expression of EpCAM, as well as high ALDH activity. These cells are
negative for ER, PR and ErbB2. Luminal progenitors express both CD49f and EpCAM, whereas mature
luminal cells do not express CD49f but do express EpCAM. Both luminal progenitors and mature luminal
cells can be ER negative or positive. It has been proposed that transformation of a cell with a distinct
hierarchical position generates a particular tumour subtype with an associated clinical outcome. BRCA1
plays a role in the differentiation of the luminal lineage and its deficiency is associated with the formation
of basal-like tumours. The ErbB2+ subtype could originate in a target cell restricted to the luminal lineage
following ErbB2 overexpression or amplification. Figure adapted from [6].
3
into more effective therapies. Interestingly, a well-known factor in breast cancer, Breast cancer 1
early onset (BRCA1), has been shown to play a role in mammary epithelial cell differentiation.
1.3 BRCA1
1.3.1 BRCA1 in breast cancer
BRCA1 was the first gene identified to confer susceptibility to early onset breast and
ovarian cancer [14] with cumulative risks at age 70 of 57% (breast) and 40% (ovarian) [15].
Breast tumours from BRCA1-mutation carriers tend to have a distinctive phenotype associated
with a poor outcome, i.e. poorly differentiated, high grade carcinomas that exhibit pushing
margins [16], a high proliferative index [17] and do not express Estrogen receptor α (ERα),
Progesterone receptor (PR) or ErbB2 [18]. Although reported germ-line mutations are scattered
throughout the BRCA1 gene and consist of insertions, deletions, frameshifts and base
substitutions [19], BRCA1 mutations are rare in sporadic cancers [20-22]. However, evidence
suggests that downregulation of BRCA1 contributes to breast tumourigenesis.
Diminished
BRCA1 expression has been observed in sporadic carcinomas and correlates with high
histological grade [23-25], ER-negativity [23], acquisition of distant metastasis [26] and lymph
node involvement [25]. Moreover, loss of heterozygosity (LOH) at the BRCA1 locus is common
in sporadic breast cancers [27], and is associated with shorter disease-free survival and overall
survival [28]. Interestingly, loss of BRCA1, either by germ-line mutation or downregulation of
expression, is associated with basal-like breast cancer [2,29-33], and tumours with epigenetic
silencing of BRCA1 develop similar patterns of genomic alterations as tumours derived from
BRCA1-mutation carriers [34].
The consistent pathological and genetic profiles of breast
carcinomas from BRCA1-mutation carriers and spontaneous carcinomas showing BRCA1
downregulation suggest that BRCA1 dysfunction is instrumental in the development of one of the
most aggressive forms of breast cancer.
4
1.3.2 BRCA1 in mammary epithelial cell differentiation
BRCA1 has been implicated in a variety of cellular functions, most of which are required
to protect the integrity of the genome. For instance, BRCA1 plays a major role in double-strand
break repair by homologous recombination, is involved in checkpoint control which allows cells
time to repair DNA damage before progressing through the cell cycle, and is required for mitotic
spindle pole assembly which is essential for correct chromosomal segregation [35]. BRCA1 has
also been shown to act as a transcriptional regulator of targets such as ERα [36] as well as play a
role in chromatin modification through interactions with the SWI/SNF nucleosome remodeling
complex [37]. Interestingly, a novel role for BRCA1 in chromatin modification has recently been
described and is dependent on the ability of BRCA1 to act as an E3 ubiquitin ligase [38,39]. Zhu
et al. [40] have reported that BRCA1 maintains constitutive heterochromatin by
monoubiquitinating histone H2A, ensuring the interaction of the modified histone with pericentric
heterochromatin and the concomitant silencing of satellite DNA. In fact, the genomic instability
caused by BRCA1 deficiency has been attributed to the loss of heterochromatin and expression of
satellite transcripts [40]. Given the overarching function of BRCA1 as a guardian of the genome,
it is not surprising that loss of BRCA1 leads to tumour formation. However, it is not clear why a
deficiency in BRCA1 is predominantly tumourigenic in breast and ovarian cells. With respect to
breast cancer, it has been proposed that the role of BRCA1 in mammary epithelial cell
differentiation underlies its tumourigenic specificity [41].
There are multiple lines of evidence implicating BRCA1 in mammary cell fate
determination. Following its discovery in 1994, it was determined that BRCA1 is expressed in all
tissues of the developing mouse and its expression is particularly associated with differentiating
and proliferating tissues [42-45]. Moreover, tissue-specific conditional knockout of BRCA1 in
mice impairs normal development of the mammary gland [46]. This tissue-specificity has been
further supported by in vitro studies which demonstrated that downregulation of BRCA1
5
attenuates mammary epithelial cell differentiation, but not muscle or neuronal differentiation
[47]. Additional in vitro work has showed that knockdown of BRCA1 by RNA interference
prevents normal acini formation while enhancing proliferation of mammary epithelial cells [48].
This is consistent with observations by the same group that depletion of BRCA1 leads to
upregulation of genes associated with proliferation and the downregulation of genes associated
with differentiation [48]. Pivotal work by Max Wicha’s group employed in vitro systems and a
humanized NOD/SCID (non-obese diabetic/severe combined immune deficiency) mouse model
to demonstrate that BRCA1 expression is required for the differentiation of ER-negative
stem/progenitor cells to ER-positive luminal cells [49]. They observed that BRCA1 knockdown
in primary breast epithelial cells causes an increase in cells displaying the stem/progenitor cell
marker ALDH1 and a decrease in cells expressing luminal epithelial markers and ER.
In
addition, in breast tissues from germ-line BRCA1-mutation carriers, they detected entire ALDH1positive lobules with LOH for the normal BRCA1 allele indicating that blocked differentiation
with expansion of the stem/early progenitor cell population occurs in the absence of BRCA1
expression. Recent work has determined that BRCA1-mutation carriers harbor an increased
luminal progenitor population [12], and targeted deletion of BRCA1 in ER-negative luminal
progenitor cells in mice causes formation of mammary tumours which phenocopy human BRCA1
breast tumour pathology [50]. These studies emphasize a role for BRCA1 in the maturation of
the luminal lineage. While the exact role(s) and temporal/lineage requirements of BRCA1 have
yet to be conclusively determined, the accumulating evidence makes it clear that BRCA1 is
critical for normal mammary epithelial differentiation.
Because BRCA1 also functions in
maintaining genomic integrity, its loss generates a pool of genetically unstable stem and/or
progenitor cells that are prime targets for transformation. Given that several mechanisms can
account for the loss of BRCA1 expression observed in sporadic tumours, e.g. LOH,
hypermethylation of the BRCA1 promoter, or loss or mutation of a gene required for BRCA1
6
activation, investigation of BRCA1 regulation is imperative to our understanding of breast cancer
etiology.
1.3.3 Transcriptional regulation of BRCA1
BRCA1 transcriptional regulation is complex, being directed by a variety of hormones,
developmental regulators and other transcription factors [51]. The requirement for strict control
of BRCA1 transcription is emphasized by the fact that BRCA1 is autoregulated [52]. The BRCA1
gene is aligned in a head-to-head orientation with its neighbouring gene, NBR2 (neighbor of
BRCA1 gene 2) [53], and the two genes, which are divergently transcribed, are separated by only
218 bp and share a minimal 56 bp bidirectional promoter element [54]. We have determined that
the BRCA1 promoter sequence from –204 to +27 relative to the transcription start site has optimal
promoter activity in human breast cancer lines [55]. At the 5’ end of this region is a sequence
termed the EcoRI Bandshift (RIBS) element that is critical for BRCA1 expression in a cell-line
specific manner [55] (Figure 2).
The RIBS element, which is included in the minimal
bidirectional promoter [54], has been shown to bind the multisubunit ets transcription factor, GA
Binding Protein (GABP) [55]. This is consistent with reports that GABP regulates bidirectional
transcription [56]. Interestingly, in addition to activating BRCA1 transcription at the RIBS site,
GABP has been shown to bind to the repressor UP (UPstream) element found near the
transcription start site of the BRCA1 promoter [57]. The UP site appears to form a composite
repressor element with a previously identified E2F recognition site, and evidence suggests that
GABP has a repressive function in this context (Figure 2). We have also determined that GABP
mediates activation of the BRCA1 promoter by the unliganded Glucocorticoid receptor (GR) [58].
GR is a member of the steroid receptor superfamily of nuclear receptors that is activated in
response to stress signals [59].
We observed that in the absence of the stress hormone
hydrocortisone (HC), GR binds to GABP at the RIBS element and upregulates BRCA1
7
Figure 2: Regulation of the BRCA1 promoter.
GABP, which is comprised of two subunits α and β, binds as a heterotetramer to the RIBS element of the
BRCA1 promoter and activates transcription [55]. GABP also binds to the repressor UP element found near
the transcription start site of the BRCA1 promoter. The UP site appears to form a composite repressor
element with a previously identified E2F recognition site, and evidence suggests that GABP has a
repressive function in this context [57]. In addition, GABP mediates the activation of the BRCA1 promoter
by unliganded GR. In the presence of its ligand, the stress hormone HC, GR dissociates from the promoter
causing diminished BRCA1 expression [58]. Figure adapted from [57].
8
transcription [58]. However, in the presence of its ligand (i.e. HC), GR dissociates from the
promoter causing diminished BRCA1 expression (Figure 2). This is consistent with our previous
observations that HC is a negative regulator of BRCA1 expression [60] and provides a molecular
basis for the recognized link between psychological stress and increased breast cancer risk [61].
The cumulative evidence generated by our lab indicates that GABP is one of the key regulators of
BRCA1 transcription in the breast.
1.4 GABP
1.4.1 GABP structure
GABP is a member of the ets family of transcription factors and is comprised of two
distinct and unrelated subunits – GABPα and GABPβ [62,63]. GABPα binds to sequences rich
in guanine and adenine nucleotides via the characteristic ets “winged-helix-turn-helix” DNAbinding domain (DBD) located near its carboxy terminus [62,63] (Figure 3). GABPα is the only
protein capable of recruiting GABPβ to DNA, and although GABPβ does not contact the DNA
directly, it enhances the DNA-binding affinity of the alpha subunit [63-65]. GABPβ is a Notchrelated protein that possesses ankyrin repeats (AR) at its N-terminus as well as a nuclear
localization signal (NLS) and transcriptional activation domain (TAD) towards its C-terminus
[63,66,67] (Figure 3). Human GABPβ is expressed as four different isoforms as a result of
alternate mRNA splicing [66,68]. All forms have the NLS and TAD, as well as the AR motif
which mediates the interaction of GABPβ with GABPα [63,66,67,69]. However, two of the
isoforms lack an α-helical C-terminal domain that mediates coiled-coil dimerization between beta
proteins [63,66,70] (Figure 3). Therefore, heterodimers readily form between GABPα and all
isoforms of GABPβ, but the longer beta isoforms permit the formation of a tetramer (α2β2) on
tandem repeats of GGAA [63,68,69]. With the functional domains (DBD and TAD) in separate
proteins, GABP has the distinction of being the only obligate multimer among ets proteins [71].
9
GABPα
OST
PNT
ETS
Alternate names
GABPβ1
Isoform 1
AR
GABPβ1
Isoform 2
AR
GABPβ1
Isoform 3
AR
GABPβ1
Isoform 4
AR
TAD
*
TAD
TAD
*
TAD
CC
CC
β1-42, β1
β1-41, β2
β1-38, γ1
β1-37, γ2
Figure 3: Structure of GABPα and β.
GABPα binds to DNA via the ets (ETS) domain at its C-terminus. In conjunction with an adjacent Cterminal region, GABPα binds to GABPβ via the ETS domain [63]. The pointed (PNT) and On-SighT
(OST) domains mediate GABPα interactions with co-regulatory proteins such as p300 [72,73]. Human
GABPβ is expressed as four different isoforms as a result of alternate mRNA splicing [66,68]. All forms
have the AR motif which mediates the interaction with GABPα, as well as the TAD; the nuclear
localization signal is contained within the TAD [63,66,67,69]. The isoforms differ in the first instance at
their C-terminus - two of the isoforms lack an α-helical region that mediates coiled-coil (CC) dimerization
between beta proteins [63,66,70]. Therefore, heterodimers readily form between GABPα and all isoforms
of GABPβ, but the longer beta isoforms permit the formation of a tetramer (α2β2) on tandem repeats of
GGAA [63,68,69]. The beta isoforms also differ in the inclusion of a 12 amino acid insert (*) in the middle
of the protein. The function of this insert is unknown [66].
10
1.4.2 GABP in stem cell renewal and differentiation
GABP is expressed in a wide variety of cell types, e.g. hematopoietic cells, liver, muscle
and brain, and its numerous targets include housekeeping as well as lineage-restricted genes [71].
The requirement for both alpha and beta subunits to produce a functional transcription factor
allows regulation of GABP activity at the level of either subunit, and may account for some of its
lineage-specific regulation. Homozygous knockout of GABPα or GABPβ in mice results in early
embryonic lethality highlighting the essential role of GABP in embryogenesis [74,75].
Interestingly, GABPα is broadly expressed throughout embryogenesis and in embryonic stem
cells, and the protein levels of GABPα observed in wild-type mice are maintained in the tissues
of GABPα heterozygous mice [74]. This demonstrates that the expression of GABPα is tightly
controlled and is consistent with observations that GABPα is autoregulated [76].
Consistent with roles in development and BRCA1 regulation, GABP has been shown to
function in tissue-specific differentiation. For example, GABP plays a role in T cell and B cell
development [77-79] and regulates the thrombopoietin (TPO) gene which controls the
differentiation and maturation of megakaryocytes [80]. In addition, studies in muscle cells have
demonstrated that the induction of Retinoblastoma protein (RB) gene expression by GABP and
Host cell factor C1 (HCF-1) coincides with (and is known to be a pre-requisite for) the
differentiation of muscle cells [81]. Conversely, evidence also implicates GABP in the renewal
of stem cells. Certain factors have been identified as critical to maintaining/inducing “stemness”,
e.g. Sex determining region Y-box 2 (SOX2), Kruppel-like factor 4 (KLF4), v-myc
myelocytomatosis viral oncogene homolog (avian) (MYC) and POU class 5 homeobox 1
(POU5F1, also referred to as OCT-4) [82,83]. OCT-4 is necessary for the self-renewal of
embryonic stem cells, and this function depends on the appropriate level of OCT-4 expression
[84,85]. GABP has been shown to regulate OCT-4 expression in mouse embryonic stem cells
through activation of OCT-4 transcription and down-regulation of OCT-4 transcriptional
11
repressors, i.e. Caudal type homeobox 2 (CDX-2), Nuclear receptor subfamily 2, group F,
member 1 (NR2F1) and Nuclear receptor subfamily 6, group A, member 1 (NR6A1) [86]. More
recently, Yu et al. revealed that GABP controls a gene regulatory module that is essential for the
maintenance and differentiation of hematopoietic stem/progenitor cells [87]. While seeming
contradictory, the involvement of GABP in renewal and differentiation emphasizes its importance
in stem cell function. This view is further supported by computer analysis of stem cell regulatory
modules which identifies GABP as a critical transcription factor in stem cell function, namely in
proliferation [88].
1.4.3 GABP in cell cycle regulation
The classic model of progression from cellular quiescence into the cell cycle is as
follows: (i) D-cyclin expression is increased in response to environmental mitogenic signals, (ii)
D-cyclins complex with their catalytic partners, the cyclin-dependent kinases (CDKs), (iii) Dcyclin/CDK complexes are phosphorylated (activated), (iv) activated D-cyclin/CDK complexes
phosphorylate RB and RB-related proteins, (v) phosphorylation of RB results in the unmasking of
E2F proteins, a family of transcription factors responsible for the activation of genes required for
DNA synthesis, and (vi) the cell enters the cell cycle [89-93] (Figure 4). Both the RB and E2F1
genes are targets of GABP transcriptional regulation [94-97]. In addition, GABP binds and
regulates the promoters of thymidylate synthase which generates dTTP and is required for DNA
replication, as well as the DNA polymerase α p180 catalytic subunit which initiates DNA
replication in S phase [98,99]. This suggests that GABP controls the expression of critical
components of the G1/S restriction point of the cell cycle. Interestingly, it has been demonstrated
that GABPα is required and sufficient to drive serum-induced proliferation by mouse embryonic
fibroblasts independently of the D-cyclin pathway [100]. GABP activates the gene expression of
SKP2 (S-phase kinase-associated protein 2) which mediates ubiquitination and subsequent
degradation of the cyclin-dependent kinase inhibitors (CKIs) p27 and p21 [101,102] (Figure 4).
12
Figure 4: GABP in cell cycle regulation.
In the classic model of progression from G1 (quiescence) to S-phase (DNA synthesis), D-type cyclin
expression is activated in response to environmental mitogenic signals. D-cyclins complex with their
catalytic partners, CDK4/6, and following activation by phosphorylation, the D-cyclin/CDK complexes
phosphorylate RB and RB-related proteins, p107 and p130. The hypophosphorylated form of RB is active
and prevents cell proliferation by binding to E2F proteins, a family of transcription factors responsible for
the activation of genes required for DNA synthesis. Conversely, phosphorylation of RB results in the
release of E2F and the initiation of the cell cycle. The activities of the CDKs are constrained by CKIs.
CKIs fall into two classes: Inhibitors of CDK4 (INK4 proteins) and Cip/Kip proteins (such as p27 and p21)
[89-93]. GABP regulates the transcription of the RB and E2F1 genes [94-97], and activates the gene
expression of SKP2 which mediates ubiquitination and degradation of p27 and p21 [100]. In addition,
GABP activates transcription of KIS, a kinase that phosphorylates p27 leading to its nuclear export [103].
By preventing CKI activity, GABP promotes CDK activity and entry into the cell cycle.
13
In addition, GABP activates transcription of KIS (Kinase interacting with leukemia-associated
gene stathmin), a kinase that phosphorylates p27 leading to its nuclear export [103]. As a result,
GABP indirectly promotes CDK activity which, in turn, results in RB phosphorylation, E2F
release and entry into the cell cycle.
1.4.4 GABP as a nuclear respiratory factor
One of the main functions of GABP is to regulate certain nuclear genes whose products
are required for the mitochondrial respiratory chain [104]. Although mitochondria have their own
chromosome, the entire protein coding capacity of the organelle is limited to 13 essential subunits
of the respiratory apparatus thus, the majority of proteins necessary for mitochondrial functions
are the products of nuclear genes [104]. Nuclear respiratory factor-1 (NRF-1) was the founding
member of a family of transcription factors that co-ordinately regulate the expression of nucleusencoded respiratory proteins [105,106]. NRF-1 was initially characterized as an activator of
cytochrome C expression [105], but has since been shown to regulate genes involved in oxidative
phosphorylation, mitochondrial DNA transcription and regulation, heme biosynthesis and protein
import [104] (Figure 5). Similarly, GABP was identified as an activator of Cytochrome oxidase
subunit 4 (COXIV) transcription and was named Nuclear respiratory factor-2 (NRF-2) in this
context [107]. In addition to COXIV, evidence indicates that GABP regulates the expression of
all 10 nucleus-encoded cytochrome oxidase subunits [108,109] as well as genes involved in the
same processes previously indicated for NRF-1 [104]. Furthermore, GABP regulates BRCA1,
which has been implicated in maintaining the integrity of mitochondrial as well as nuclear DNA
[110]. Thus, NRF-1 and GABP are two significant control points for the co-ordinate regulation
of genes required for the maintenance and function of the mitochondria (Figure 5).
14
Figure 5: NRF-1 and GABP co-ordinate the expression of nuclear genes required for mitochondrial
functions.
NRF-1 and GABP regulate the expression of nuclear genes involved in mtDNA transcription and
replication, heme biosynthesis, oxidative phosphorylation (respiratory subunits and cytochrome c),
mitochondrial translation and protein import and assembly. The pathways controlled by NRF-1 and GABP
are coupled to the demands of the cell by the PCG1 family of transcriptional co-activators. PGC1α, which
is induced by stimuli such as cold, fasting and exercise, can activate the transcription of NRF-1 and GABPα
in addition to serving as a co-activator of NRF-1 and GABP target genes. PGC1β acts as a NRF-1 coactivator, and PRC, which is induced upon serum stimulation, can trans-activate NRF-1 and GABP target
genes. Mitochondrial function is likely coupled to cellular differentiation via these pathways. Figure
adapted from [104].
15
1.5 NRF-1
1.5.1 NRF-1 structure
NRF-1 binds its recognition site as a homodimer through a unique DNA binding domain
that is related to developmental regulatory proteins in sea urchins and Drosophila [111]. The
highly conserved DNA binding domain is in the N-terminal half of the molecule and the
conservation is maintained into the nuclear localization signal [111,112]. A large C-terminal
transcriptional activation domain containing glutamine-rich clusters of hydrophobic amino acid
residues is not conserved in the lower eukaryotic proteins [112], and no other mammalian NRF-1
isoforms have been found [104].
1.5.2 Regulation of mitochondrial function
NRF-1 and GABP were the first vertebrate transcription factors implicated in the global
regulation of multiple mitochondrial functions [113]. The nuclear pathways controlled by NRF-1
and GABP are coupled to the demands of the cell by the PGC1 family of transcriptional
coactivators which consists of PPARγ coactivator 1α (PGC1α), PGC1β and PGC1α-related coactivator (PRC) [104] (Figure 5). When induced by environmental stimuli, PGC1 proteins transactivate the small number of transcription factors responsible for coordinating the expression of
genes required for mitochondrial functions such as oxidative phosphorylation, fatty acid
oxidation, the citric acid cycle, as well as mitochondrial DNA (mtDNA) replication and
maintenance [104]. By stimulating such a diverse array of activities, PGC1 proteins act as key
regulators of mitochondrial function and biogenesis. PGC1α, which is induced by stimuli such as
cold exposure and has a significant role in adaptive thermogenesis, has been shown to activate
transcription of NRF-1 and GABPα in addition to serving as a co-activator of NRF-1 and GABP
target genes [114-116]. Unlike PGC1α, PGC1β is not induced in brown fat upon cold exposure,
however it can act as a NRF-1 co-activator and induce mitochondrial biogenesis and respiration
16
in other contexts [117-119]. PRC is able to trans-activate NRF-1 and GABP target genes,
however, like PGC1β, PRC is not induced significantly during adaptive thermogenesis [120,121].
Because PRC mRNA and protein levels are rapidly induced upon serum stimulation of quiescent
cells, it has been proposed that PRC is a cell growth regulator [120,122] (Figure 5).
MYC, a well-known oncogene with roles in cell cycle, proliferation and differentiation,
has also been implicated in respiratory gene expression and mitochondrial function. Using
chromatin immunoprecipitation coupled with promoter microarrays (ChIP-on-chip), 107 nuclear
encoded genes involved in mitochondrial biogenesis, including NRF1, have been identified as
direct targets of MYC [123]. This is consistent with observations that ectopic MYC expression
results in increased oxygen consumption and mitochondrial mass/function, and MYC-null
fibroblasts have reduced mitochondrial content that can be partially rescued by MYC expression
[124]. In addition to regulating NRF-1 expression, MYC can induce the expression of NRF-1
targets by binding noncanonical MYC /MAX (MYC associated factor X) binding sites contained
within certain NRF-1 sites [125]. By deregulating NRF-1 target genes, MYC overexpression can
sensitize cells to apoptosis [125].
MYC also upregulates mitochondrial biogenesis and
respiration by activating transcription of PGC1β [126]. Notably, this effect is repressed by
Hypoxia-inducible factor 1 (HIF-1) in renal carcinoma cells lacking the von Hippel-Lindau tumor
suppressor suggesting that this pathway may contribute to the switch from oxidative
phosphorylation to aerobic glycolysis mediated by HIF-1 in certain cancers [126]. Evidence
suggests that GABPβ is also regulated by MYC, and that this regulation occurs in conjunction
with ERα [127]. Interestingly, NRF-1 has also been shown to be regulated by ERα. In response
to estradiol, transcription of NRF-1 is induced by the direct interaction of ERα with its
recognition site in the NRF-1 promoter in a breast adenocarcinoma cell line, MCF-7 [128].
Activation of NRF-1 by estrogen was followed by increased oxygen consumption and
17
mitochondrial DNA levels consistent with NRF-1 mediating ERα-induced increases in
mitochondrial activity in estrogen-responsive cells.
1.5.3 NRF-1 in cell cycle regulation
NRF-1 targets are not limited to genes involved in mitochondrial function. NRF-1 is one
of seven transcription factors whose binding sites are most frequently found in the proximal
promoters of ubiquitously expressed genes [129]. In addition, ChIP-on-chip has revealed that
NRF-1 is a coregulator of a large number of E2F target genes [130]. The E2F family of
transcription factors (E2F1-7) has a well-established role in regulating the onset of S phase and
DNA replication [131,132]. However, ChIP-on-chip revealed targets for E2F in other cellular
processes such as DNA repair, chromosome dynamics, centrosome function, mRNA processing
and mitochondrial function, and demonstrated that the NRF-1 binding sequence is enriched in a
subset of E2F target promoters [130]. This subset shows substantial enrichment for genes
involved in DNA replication, mitosis and cytokinesis emphasizing a previously unrecognized role
for NRF-1 in cell cycle regulation.
Notably, NRF-1 has also been implicated in the
transcriptional regulation of E2F1 [133] and E2F6 [134]. The broad spectrum of NRF-1 targets
as well as its involvement in cell cycle regulation and mitochondrial function explain the early
embryonic lethality observed in NRF-1 knockout mice [135] and suggest that NRF1 plays a
fundamental role in integrating mitochondrial functions with cellular events necessary for growth
and development.
1.6 Rationale, hypothesis and objectives
1.6.1 Rationale and hypothesis
Given that transformation of a particular cell within the mammary epithelial hierarchy
can initiate a tumour with a specific molecular profile and clinical outcome, valuable insight into
breast tumourigenesis can be gained by investigating normal and malignant pathways of
18
differentiation. Evidence suggests that BRCA1, a tumour suppressor linked to breast and ovarian
cancer, plays a role in mammary epithelial differentiation. Because BRCA1 also functions in
maintaining genomic integrity, it has been proposed that loss of BRCA1, either by germline
mutation or sporadic downregulation, generates a pool of genetically unstable stem and/or
progenitor cells that are more likely to progress to malignancy. Thus, investigation of BRCA1
regulation and its role in differentiation are important to our understanding of breast cancer
etiology. One mechanism that could account for the loss of BRCA1 expression in sporadic
tumours is the deregulation of transcription factors involved in BRCA1 activation. Work in our
lab has established that BRCA1 transcription is regulated by the multisubunit ets transcription
factor, GABP. I propose that deregulation of GABP, at the gene or protein level, prevents
adequate BRCA1 expression and leads to breast tumour formation. Moreover, transcriptional
networks leading to activation of BRCA1 by GABP may be critical to normal mammary epithelial
differentiation. My hypothesis for my doctoral research was that a transcriptional network
leading to upregulation of BRCA1 by GABP drives mammary epithelial cell differentiation.
1.6.2 Objectives
The overall objectives of this project were: (i) to identify upstream transcriptional
regulator(s) of GABP and, consequently BRCA1, and (ii) to evaluate the roles of GABP and
BRCA1, as well as any upstream regulators, in mammary epithelial differentiation. In the first
phase of the project (chapter 2), the initial objective was to determine the basis for the low
BRCA1 expression in the ErbB2-overexpressing cell line, SK-BR-3. Having determined that low
BRCA1 expression is the result of diminished GABPβ expression, the second objective was to
determine the basis for low GABPβ expression in SK-BR-3 cells. We established that NRF-1
regulates the expression of GABPβ, and consequently BRCA1. However, decreased GABPβ
expression is not the result of low levels of NRF-1, but rather aberrant activation of the GABPβ
19
promoter by an NRF-1 containing complex. Therefore, in the second phase of the project
(chapter 3), the specific objective was to identify the additional members of the protein complex
that regulates the GABPβ promoter in conjunction with NRF-1. Finally, in the third phase of the
project (chapter 4), the specific objectives were to characterize two immortalized but nontransformed mammary epithelial cell lines as models of differentiation, and use the models to
profile the expression of NRF-1, GABP and BRCA1 throughout differentiation.
20
Chapter 2
Decreased expression of BRCA1 in SK-BR-3 cells is the result of
aberrant activation of the GABP Beta promoter by an NRF-1containing complex
2.1 Abstract
Background: BRCA1 has recently been identified as a potential regulator of mammary
stem/progenitor cell differentiation, and this function may explain the high prevalence of breast
cancer in BRCA1 mutation carriers, as well as the downregulation of BRCA1 in a large
proportion of sporadic breast cancers. That is, loss of BRCA1 function results in blocked
differentiation with expansion of the mammary stem/progenitor cells. Because BRCA1 also
maintains genomic integrity, its loss could produce a pool of genetically unstable stem/progenitor
cells that are prime targets for further transforming events. Thus, elucidating the regulatory
mechanisms of BRCA1 expression is important to our understanding of normal and malignant
breast differentiation.
Results: Loss of BRCA1 expression in the ErbB2-amplified SK-BR-3 cell line was found
to be the result of loss of activity of the ets transcription factor GABP, a previously characterized
regulator of BRCA1 transcription. The expression of the non-DNA binding GABPβ subunit was
shown to be deficient, while the DNA binding subunit, GABPα, was rendered unstable by the
absence of GABPβ. Deletion analysis of the GABPβ proximal promoter identified a potential
NRF-1 binding site as being critical for expression.
Supershift analysis, the binding of
recombinant protein and chromatin immunoprecipitation confirmed the role of NRF-1 in
regulating the expression of GABPβ. The siRNA knockdown of NRF-1 resulted in decreased
GABPβ and BRCA1 expression in MCF-7 cells indicating that they form a transcriptional
21
network. NRF-1 levels and activity did not differ between SK-BR-3 and MCF-7 cells, however
the NRF-1 containing complex on the GABPβ promoter differed between the two lines and
appears to be the result of altered coactivator binding.
Conclusions: Both NRF-1 and GABP have been linked to the regulation of nuclearencoded mitochondrial proteins, and the results of this study suggest their expression is
coordinated by NRF-1’s activation of the GABPβ promoter. Their linkage to BRCA1, a potential
breast stem cell regulator, implies a connection between the induction of mitochondrial
metabolism and breast differentiation.
2.2 Background
BRCA1 has been implicated in functions such as DNA repair, cell-cycle checkpoint
control, protein ubiquitination, chromatin remodelling and transcriptional regulation (for reviews
see [136,137]). However, the discovery that BRCA1 is required for mammary stem/progenitor
cell differentiation [49] has cast BRCA1 in a different light. Mammary stem cells produce two
cell populations – the inner luminal epithelial cells which express low molecular weight
cytokeratins and estrogen receptor α (ERα), and the outer supporting basal myoepithelial cells
which express high molecular weight cytokeratins and smooth muscle markers [138]. Liu et al.
(2008) demonstrated that knockdown of BRCA1 in both in vitro and mouse model systems
causes an increase in the stem/progenitor and myoepithelial cell populations (ERα-negative), and
a decrease in the differentiated luminal epithelial cell population (ERα-positive). These results
are consistent with the fact that BRCA1 activates ERα gene expression [36], and indicate that
BRCA1 expression is required for the differentiation of mammary stem/progenitor cells into
luminal epithelial cells and its loss results in blocked differentiation with expansion of the
stem/progenitor cells [49]. Because BRCA1 also functions in maintaining genomic integrity
(reviewed in [35]), these cells are more likely to progress to malignancy. Characterization of
epithelial subpopulations in preneoplastic tissue from BRCA1 mutation carriers identified an
22
aberrantly expanded luminal progenitor cell population as the likely target of transformation [12].
This model is also consistent with clinical data, i.e. the vast majority of breast tumours in women
with germ-line mutations in BRCA1 display a basal-like (stem cell-like) phenotype characterized
by a lack of expression of ER, PR and ErbB2 and robust expression of markers of myoepithelial
differentiation [139]. Thus, there is strong evidence to suggest that loss of BRCA1 generates a
cancer stem cell capable of initiating and driving breast tumour formation.
While mutational inactivation of BRCA1 in some familial breast and ovarian cancer is seen
[140], a consistent pattern of BRCA1 gene mutation has not been identified in sporadic breast
tumours [20-22]. However, decreased BRCA1 expression is observed in sporadic breast tumours,
with decreasing expression correlating with increasing tumour grade [24,25,141]. This suggests
that BRCA1 downregulation in sporadic cancer may also lead to a block in stem cell
differentiation with the attendant increase in cancer risk.
The transcriptional regulation of the BRCA1 gene is complex with a variety of transcription
factor binding sites having been identified (reviewed in [51]). Our previous analysis of the
BRCA1 promoter had pointed to the ets transcription factor GA Binding Protein (GABP) and its
RIBS binding element as key regulators of BRCA1 expression, particularly as it relates to its
decrease in sporadic breast cancers [55]. The SK-BR-3 cell line, which overexpresses ErbB2, is
known to have particularly low levels of BRCA1 protein. In this study, the BRCA1 promoter
was shown to be less active in SK-BR-3 cells and the activity of the GABP protein was shown to
be compromised. GABP is comprised of two distinct and unrelated subunits – GABPα, which
contains the DNA-binding domain, and GABPβ, which contains the nuclear localization signal
and transcriptional activation domain [62,63,66,67]. The expression of the GABPβ gene was
shown to be decreased in SK-BR-3 cells and is in turn regulated by Nuclear Respiratory Factor-1
(NRF-1) [106]. While NRF-1 levels and activity are similar between MCF-7 and SK-BR-3 cells,
the NRF-1 specific complex was altered suggesting that a coactivator interacting with NRF-1
23
differs between the two lines. BRCA1 expression appears to be regulated by a transcriptional
network consisting of NRF-1 and GABP.
2.3 Methods
2.3.1 Cell culture
The human breast carcinoma cell lines MCF-7, T-47D, SK-BR-3, ZR75-1 and MCF-10A
were obtained from the ATCC (Manassas, VA, USA), while 184hTERT cells [142] were a
generous gift of Dr. Calvin Roskelley. MCF-7 and T-47D cells were maintained as previously
reported [57].
ZR75-1 cells were maintained as per MCF-7/T-47Ds. SK-BR-3 cells were
maintained in Dulbecco’s modified Eagle’s medium (Sigma, Oakville, Canada) supplemented
with 10% fetal bovine serum (HyClone, Logan, UT, USA), 100 µg/mL streptomycin (Sigma) and
100 units/mL penicillin (Sigma). MCF-10A cells were maintained in DMEM F12 with LGlutamine (HyClone) supplemented with 5% horse serum (Invitrogen, Burlington, Canada), 20
ng/mL epidermal growth factor (Invitrogen), 10 µg/mL insulin (Sigma), 0.5 µg/mL
hydrocortisone (Sigma), 100 ng/mL cholera toxin (Sigma), 100 units/mL penicillin and 100
µg/mL streptomycin.
184hTERT cells were maintained in Clonetics® MEBM medium
supplemented with Clonetics® SingleQuot, 400 µg/mL G418 (BioShop, Burlington, Canada), 1
µg/mL transferrin (BD, Mississauga, Canada) and 1.25 µg/mL isoproterenol (Sigma). Cells were
cultured in a humidified atmosphere at 37°C and 5% CO2.
2.3.2 DNA constructs
Creation of L6-pRL has been previously described [57]. To create the FLAG-GABPα
construct, the human GABPα gene was PCR amplified using pCAGGS-E4TF1-60 (obtained
from Hiroshi Handa, [143]) as the template with the primers specified in Table 1. The GABPα
PCR product was cloned into the pSCT-Gal vector using the restriction enzymes XbaI/HindIII.
The pSCT-Gal-GABPα construct was then digested with HindIII, filled-in by Klenow, and then
24
Table 1: Primers, templates and restriction enzymes used in the preparation of DNA constructs
Constructa
pSCT-Gal-GABPα
Primer sequenceb
PCR template
(+) 5'-GGGTCTAGAATGATCAAAAGAGAAGC /
pCAGGS-E4TF1-60
(-) 5'-GGGAAGCTTTCAATTATCCTTTTCCG
(+) 5'-GGGTCTAGAATGTCCCTGGTAGATTTGG /
pCAGGS-E4TF1-53
pMAL-c2-GABPβ
(-) 5'-GGGGTCGACGTTCATTTCAATTAAACAGC
pTRE-tight-NRF-1
(+) 5'- GGAGATCTGATGGAGGAACACGGAGTGACC
pSG5-NRF-1
(-) 5'-GGACGCGTTCACTGTTCCAATGTCACC
pMAL-c2-NRF-1
(+) 5'-GGGGATCCATGGAGGAACACGGAGTGACC
pSG5-NRF-1
(-) 5'-GGAAGCTTTCACTGTTCCAATGTCACC
-1023*
(+) 5’-GGGCTCGAGCATTTAAGCTTGTCAATTCTCC
MCF-7 genomic DNA
-715*
(+) 5’-GGGAGATCTCAAGCAGTTACTAGGATCTACG
MCF-7 genomic DNA
-594*
(+) 5’-GGGAGATCTGAACCTCACTCGTTCCTTCC
MCF-7 genomic DNA
-545*
(+) 5’-GGGAGATCTGTCTGCCTAGTTGAATCTAGG
-594 construct
-478*
(+) 5’-GGGAGATCTCAGGATTCTGCTAGGCCGC
-594 construct
-268*
(+) 5’-GGGAGATCTGCCGCGCAGGCGCCGGGCGAGC
SK-BR-3 genomic DNA
-251*
(+) 5’-GGGAGATCTCGAGCCGGGACTTGCGGTCG
-594 construct
-205*
(+) 5’-GGGAGATCTCTTTGTGTGGCTGAAGCGC
-594 construct
-118*
(+) 5’-GGGAGATCTACACAGCTAGGGAGTGGG
-594 construct
m4-6*
(+) 5’-GGGAGATCTGggcCGCAGGCGCCGGGCGAGC
-545 construct
mT4*
(+) 5’-GGGAGATCTGtCGCGCAGGCGCCGGGCGAGC
-545 construct
mT5*
(+) 5’-GGGAGATCTGCtGCGCAGGCGCCGGGCGAGC
-545 construct
mA6*
(+) 5’-GGGAGATCTGCCaCGCAGGGCCGGGCGAGC
-545 construct
a All GABPβ promoter constructs (marked with an asterisk) were prepared using the following primer (+194): (-) 5’GGGGAATTCGCGACGGGAAGGCAGCAGG (EcoRI site is underlined)
b Restriction enzyme sites are underlined. Mutations are in lowercase.
25
Restriction enzyme
(+) XbaI /
(-) HindIII
(+) XbaI /
(-) SalI
(+) BglII
(-) MluI
(+) BamHI /
(-) HindIII
XhoI
BglII
BglII
BglII
BglII
BglII
BglII
BglII
BglII
BglII
BglII
BglII
BglII
cut with XbaI. The p3×FLAG-CMV-10 vector (Sigma) was cut with BamHI, filled-in using
Klenow, and digested with XbaI. The complete FLAG-GABPα construct was obtained by
ligation of these two fragments. To generate the FLAG-GABPβ construct, the human GABPβ
gene was PCR amplified using pCAGGs-E4TF1-53 (obtained from Hiroshi Handa, [143]) as the
template with the primers specified in Table 1. The GABPβ PCR product was then cloned into
the pMAL-c2 vector (New England Biolabs (NEB), Pickering, Canada) using the restriction
enzymes XbaI/SalI. Isopropyl β-D-1-thiogalactopyranoside (IPTG)/Xgal colour screening was
used to select positive clones. The GABPβ fragment was then cut out of the pMAL-c2 vector
using SalI, filled in by Klenow, and subsequently digested using XbaI. The p3×FLAG-CMV-10
vector was prepared by first cutting with BamHI, followed by a Klenow fill-in reaction, and then
digestion using XbaI. The final FLAG-GABPβ construct was generated by the ligation of these
two fragments. pTRE-tight-GABPβ was prepared by digesting FLAG-GABPβ with SacI (partial)
and XmaI and cloning the FLAG-tagged GABPβ sequence into pTRE-tight (Clontech, Mountain
View, CA, USA).
To create the NRF-1 expression vector, pTRE-tight-GABPβ was digested with BglII and
MluI to remove the GABPβ sequence, but retain the FLAG sequence. The human NRF-1 coding
sequence was PCR amplified from pSG5-NRF-1 [111], a generous gift of RC Scarpulla, using the
primers specified in Table 1. The PCR product was digested with BglII and MluI and cloned into
pTRE-tight with the FLAG sequence to create pTRE-tight-NRF-1. The FLAG-tagged NRF-1
sequence was cut from pTRE-tight-NRF-1 using SacI and XbaI and cloned into p3×FLAG-CMV10 vector to create the NRF-1 expression vector, p3XFLAG-NRF-1.
The GABPβ proximal promoter sequences were PCR amplified using the primers and
templates specified in Table 1. The promoter regions were cloned into the pRL-null reporter
plasmid (Promega, Madison, WI, USA) using the restriction sites indicated in Table 1. Gb-270
26
multimer was prepared by cloning double-stranded oligonucleotides comprised of 3 repeats of
Gb-270 (sequence specified in Figure 11) with HindIII (5’) and KpnI (3’) overhangs into pRLnull containing a TATA box derived from the albumin gene and a G-free cassette.
2.3.3 Recombinant NRF-1
The human NRF-1 coding sequence was PCR amplified from pSG5-NRF-1 [111] using
the primers specified in Table 1. The PCR product was digested and cloned into the BamHI and
HindIII sites of pMAL-c2. The recombinant protein was expressed and purified according to the
manufacturer’s protocol. The purified protein was eluted with 10 mM maltose in nuclear dialysis
buffer (10 mM HEPES pH 7.6, 0.1 mM EDTA, 40 mM KCl, 10% glycerol, 1 mM dithiothreitol,
1 µg/mL leupeptin, 1 µg/mL pepstatin, 0.1 mM phenylmethanesulphonylfluoride (PMSF), 1%
aprotinin, 1 mM benzamidine).
2.3.4 Dual luciferase assay
Approximately 24 h prior to transfection, cells were plated in 12-well plates at 1 × 105
cells/well. Cells were transfected in triplicate using a total of 250 ng DNA per well with 0.75
µL/well FuGENE (Roche, Laval, Canada) according to the manufacturer’s protocol. The specific
amounts of material used per well were: 25 ng of the CMV-luc internal control, 25 ng of each
expression vector or empty vector control, 50 ng of shRNA plasmid and a Renilla luciferase
reporter vector up to a total of 250 ng. Approximately 48 h post-transfection, the cells were
washed with phosphate buffered saline (PBS), lysed in 150 µL passive lysis buffer (Promega),
and 20 µL of the cell lysates were assayed using the Dual-Luciferase® Reporter Assay System
according to the manufacturer's instructions (Promega) with a EG&G Berthold microplate
luminometer.
27
2.3.5 Electrophoretic mobility shift assay (EMSA)
Nuclear extracts were prepared as previously described [55] with the exception that
nuclear proteins were not concentrated by (NH3)2SO4 precipitation, but were dialyzed against 10
mM HEPES pH 7.6, 40 mM KCl, 0.1 mM EDTA, and 10% glycerol. Nuclear extracts or
recombinant protein (2-4 µg unless otherwise indicated) were combined with
32
P-labelled
oligonucleotides (1 ng) in binding buffer (25 mM HEPES pH 7.6, 5 mM MgCl2, 34 mM KCl, 50
µg/mL poly dI:dC (Sigma), 0.5 mg/mL bovine serum albumin (BSA)). Binding reactions (20 µL
final volume) were incubated on ice for 15 min prior to separation on a 6% acrylamide 0.25 ×
TBE non-denaturing gel. For competition assays, unlabelled oligonucleotide competitors were
mixed with
32
P-labelled oligonucleotides in binding buffer prior to the addition of nuclear
extracts. For the supershift assay, 2 µg anti-NRF-1 (ab34682, Abcam, Cambridge, MA, USA) or
PBS (negative control) was incubated with 4 µg of nuclear extracts for 30 min on ice prior to the
addition of 32P-labelled oligonucleotide in binding buffer. Oligonucleotide sequences are given in
Figures 11 and 14 (positive strand only). The sequence of RC4, an oligonucleotide containing the
NRF-1 binding sequence from the rat cytochrome C promoter (nucleotide -173 to -147), has been
previously reported [106].
2.3.6 Chromatin immunoprecipitation (ChIP)
ChIP assays were performed with the ChIP-IT™ Express kit according to the
manufacturer’s instructions (Active Motif, Carlsbad, CA, USA).
Each immunoprecipitation
reaction contained chromatin from 1.5 × 106 cells, and 2 µg of antibody (or water as a negative
control).
The following antibodies were used: acetylated histone H3K9 (06-599, Upstate
Biotechnology, Lake Placid, NY, USA), haemagglutinin (Y-11, Santa Cruz Biotechnology, Santa
Cruz, CA, USA), RNA polymerase II (Covance, Emeryville, CA, USA), histone deacetylase I
(ab7028, Abcam), NRF-1 (ab34682, Abcam), and Oct-4 (ab19857, Abcam).
amplified
the
BRCA1
promoter
from
28
position
-341
to
+116
PCR primers
((+)
5’-
GATTGGGACCTCTTCTTACG and (-) 5’-TACCCAGAGCAGAGGGTGAA)) and the GABPβ
promoter from position -358 to -178 ((+) 5’-CTCCTACCCACCGCAGAAC and (-) 5’CCATTTCTAGCGCTTCAGCC). A water blank (no template) and the initial chromatin were
also subjected to PCR amplification as controls.
2.3.7 siRNA Knockdown
For dual luciferase assays involving siRNA knockdown, MCF-7 cells were plated at 5 ×
104 cells/well in 24-well plates approximately 24 h prior to transfection. Cells were transfected in
triplicate with siRNA (100 ng/well), GABPβ promoter constructs (175 ng/well), and CMV-luc
(25 ng/well) for normalization of transfection efficiency, using TransMessenger™ Transfection
Reagent
(Qiagen,
Mississauga,
Canada)
according
to
the
manufacturer’s
protocol.
Approximately 48 h post-transfection, the cells were washed with PBS, lysed in 75 µL passive
lysis buffer and 20 µL of the cell lysates were assayed using the Dual-Luciferase® Reporter
Assay System according to the manufacturer's recommendations. For western blots, MCF-7 cells
were plated at 2.5 × 105 cells/well in 6-well plates approximately 24 h prior to transfection. Cells
were transfected with siRNA (1 µg per well) using Santa Cruz Transfection Reagent (Santa Cruz
Biotechnology) according to the manufacturer’s protocol. Approximately 72 h post-transfection,
cells were washed twice with PBS and lysed in 200 µL loading buffer (2.5% SDS, 25 mM TrisHCl pH 6.8, 10% glycerol, 1% apropotin, 1 mM dithiothreitol, 1 µg/mL leupeptin, 1 µg/mL
pepstatin, 0.1 mM PMSF, 1 mM NaF, 1 mM sodium orthovanadate, 20 mM β-glycerophosphate).
siRNA used: siGAPDH (siGENOME® GAPD Control siRNA, Thermo Scientific Dharmacon,
Lafayette, CO, USA) and siNRF-1 (5’-CGUUAGAUGAAUAUACUACtt, Ambion, Austin, TX,
USA) [144].
29
2.3.8 Semi-quantitative RT-PCR
RNA was isolated using the Genelute Mammalian Total RNA Miniprep Kit (Sigma).
cDNA was generated by reverse-transcribing 2.5 μg of RNA for 5 min at 70ºC and then 1 h at
42ºC in a reaction mix containing 1 × MMluV reaction buffer (Invitrogen), 1 μg pol(N)6 primer
(Pharmacia), 0.5 mM dNTPs, 1 μL RNAse OUT (Invitrogen), and 1 μL MMluV-RTase enzyme
(Invitrogen) made up to 50 μL with diethylpyrocarbonate (DEPC)-treated water. Primer pairs
specific to each of the GABP subunits and GAPDH were then used to amplify 2 µL of each
reverse transcribed (RT) product. In addition to the RT product and 500 ng of each primer, the
reactions contained 1 × Thermopol buffer (NEB), 0.25 mM dNTPs, 1 µL Vent (NEB) and DEPCtreated water up to a final volume of 50 µL. The PCR protocol consisted of 4 min at 98ºC, 29-33
cycles of (30 sec at 98ºC, 1 min at 55ºC, 1 min at 72ºC) followed by 4 min at 72ºC. Loading
buffer was added to each sample to a final concentration of 2.5% Ficoll, 0.025% bromophenol
blue and 0.1 mM EDTA, and 10 µL of each sample was resolved on a 1.5% agarose gel. Primers
are specified in Table 2.
2.3.9 Quantitative RT-PCR
RNA and RT products were prepared as described above.
Quantitative RT-PCR
reactions for BRCA1 (with TBP as an internal control) were performed using the SuperScript®
III Platinum® One-Step Quantitative RT-PCR system (Invitrogen) with 500 ng RNA per reaction
and LUXTM primers specified in Table 2 according to the manufacturer’s instructions. The PCR
protocol consisted of 1 cycle of (900 sec at 55°C and 120 sec at 95°C), followed by 40 cycles of
(30 sec at 95°C, 30 sec at 55°C, 30 sec at 72°C). BRCA1 expression for each cell line was
calculated relative to the results for the MCF-7 cell line using the Pfaffl method [145].
Quantitative RT-PCR reactions for GABPβ were performed using the QuantiTect SyBr
Green PCR kit (Qiagen) with 2.5 µL of RT product as per the manufacturer’s instructions.
Primer pairs and annealing temperatures (Tm) are specified in Table 2. The PCR protocol
30
Table 2: Primers used for RT PCR
Type of RT-PCR
Target
Quantitative
BRCA1
Primersa
(+) 5'-AGATGTGTGAGGCACCTGTGG
Primer conc
(nM)
250
Tm
200
-
100
55°C
100
50°C
-
-
-
-
-
(-) 5'-CACTCTAAGCTCCTGGCACTGGTAGAG(FAM)G
Quantitative
TBP
(+) 5'-CGTAAGACAACAGCCTGCCACCTTA(JOE)G
(-) 5'-TAGGGATTCCGGGAGTCATGG
Quantitative and
GAPDH
Semi-quantitative
Quantitative
(+) 5'-GAAGGTGAAGGTCGGAGTC
(-) 5'-GAAGATGGTGATGGGATTTC
GABPβ
(+) 5'-CAGCTAAGAGACAATGTATCG
(-) 5'-GCCTCTGCTTCCTGTTCTTTC
Semi-quantitative
GABPα
(+) 5'-CCAGCATCAGTGCAATCTG
(-) 5'-GCTCAATTATCCTTTTCCGTTTGC
Semi-quantitative
GABPβ
(+) 5'-GCACTCTATTCCAACCAGTGG
(-) 5'-TACATGTTCATTTCAATTAAACAGC
a FAM and JOE are fluorescent dyes used to label the primers
31
consisted of 1 cycle of 900 sec at 95ºC followed by 45 cycles of (15 sec at 95ºC, 30 sec at TmºC,
30 sec at 72ºC). GABPβ expression for each cell line was calculated relative to the results for the
184hTERT cell line using the delta-delta Ct method presented by PE Applied Biosystems (Perkin
Elmer, Forster City, CA, USA).
2.3.10 Preparation of whole cell lysates
For GABP subunit complementation assays, cells were plated as described for dual
luciferase assays. Transfections were performed using 3 μL FuGENE transfection reagent and 1
μg of each expression plasmid per well (total of 2 μg DNA per well), as per the manufacturer’s
instructions. Forty-eight hours post-transfection, the cells were scraped using a rubber policeman
and lysed using 50 μL/well modified RIPA buffer (50 mM Tris-HCl pH 7.4, 1% Igepal C630,
0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 μg/mL each of aprotinin,
leupeptin and pepstatin, 1 mM sodium orthovanadate, 1 mM NaF) for 15 min at 4ºC. An equal
amount of 2× SDS-PAGE loading buffer was added to each lysate. To determine the endogenous
BRCA1, GABPα and GABPβ protein levels, cells were grow to 60% confluence, scraped using a
rubber policeman and lysed using modified RIPA buffer for 15 min at 4ºC. An equal amount of
2× SDS-PAGE loading buffer was added to each lysate.
2.3.11 Western blot
Whole cell lysates were resolved on a SDS-polyacrylamide gel, transferred to a
nitrocellulose or PVDF membrane, and probed with the appropriate antibody. Primary antibodies
included: anti-BRCA1 (0P92, 1:500, Calbiochem, San Diego, CA, USA), anti-GABPα (H-180,
1:500, Santa Cruz Biotechnology), anti-GABPβ (H-265, 10x, 1:5000, Santa Cruz Biotechnology),
anti-FLAG (M2, 1:1000, Sigma), anti-NRF-1 (M01, 1:500, Abnova, Taipei, Taiwan), anti-γtubulin (GTU-88, 1:5000, Sigma), and anti-TBP (1TBP18, 1:2000, Abcam). Secondary antibody
detection was performed by chemiluminescence (Thermo Scientific/Fisher, Nepean, Canada).
32
2.3.12 Immunofluorescence
For immunofluorescence analysis of proteins, cells were plated on coverslips 24 h prior
to transfection, in 12-well plates at a density of 1 × 105 cells/mL. Transfections were performed
using 0.75 μL of FuGENE transfection reagent and 125 ng of each expression plasmid per well
(total of 250 ng DNA per well), as per the manufacturer’s instructions. Cells were incubated at
37˚C for 48 h at which time the media was aspirated and the wells washed with PBS. The cells
were fixed at room temperature using 4% paraformaldehyde in PBS, aspirated, washed with PBS,
and then permeabilized at room temperature using 0.5% TritonX-100 in PBS. The cells were
incubated in blocking buffer (3% BSA, 10% Normal Goat Serum, 0.1% Triton X-100, 0.1%
Tween 20 in PBS) at room temperature for one hour, followed by primary antibody solution
(1:200 dilution of antibody in PBS, 3% BSA) at room temperature for one hour in a humidified
chamber, and then washed with PBS. All steps were performed in the dark from this point
onward.
The coverslips were incubated in secondary antibody solution (1:100 dilution of
antibody in PBS, 3% BSA) for one hour in the humidified chamber, washed with PBS, and then
the nuclei were stained for 10 minutes with Hoechst in PBS. The coverslips were given a final
wash with PBS and then mounted onto slides using Permount Anti-fade mounting medium.
Images were visualized on a Leica TCS SP2 Multi Photon confocal microscope. FITC was
excited using a 488 nm laser and detected at 525 nm ± 20, and Hoescht was excited using a 2photon laser at 780 nm and detected at 450 nm ± 20. The imaging software used was Image Pro
Plus.
2.4 Results
2.4.1 Differential expression of BRCA1 in MCF-7 versus SK-BR-3 cell lines
Cell lines and tumours overexpressing ErbB2 have been reported to have particularly low
BRCA1 levels [146,147]. This phenomenon was confirmed by comparison of the breast cancer
33
cell lines MCF-7, which has low ErbB2 levels, and SK-BR-3, which highly overexpresses the
receptor. Western blot analysis of whole cell lysates confirmed the low level of BRCA1 protein
in SK-BR-3 cells (Figure 6a) and quantitative RT-PCR analysis of BRCA1 mRNA levels in
multiple breast lines suggests this decrease may be due to limited transcription in SK-BR-3 cells
(Figure 6b).
To investigate the molecular basis of low BRCA1 expression in the SK-BR-3 line, the
activity of the BRCA1 proximal promoter (i.e. L6-pRL) [57] was examined in the two lines.
When the activities of the constructs were normalized using a dual luciferase assay, expression
was approximately 6-fold lower in the SK-BR-3 line compared to MCF-7 cells (Figure 6c).
Consistent with this observation, chromatin immunoprecipitation (ChIP) revealed that the BRCA1
promoter is occupied by RNA polymerase II (RNA pol II) in MCF-7 but not SK-BR-3 cells,
suggesting that the promoter is transcribed at a low level in the SK-BR-3 cell line (Figure 6d).
The lack of histone deacetylase I (HDAC) binding suggests this protein is not involved in BRCA1
downregulation (Figure 6d).
Having previously demonstrated that the multi-subunit ets transcription factor GABP is a
critical regulator of the BRCA1 proximal promoter [55], the effects of modulation of GABP levels
on BRCA1 promoter activity were evaluated. Co-transfection of a shRNA construct directed
against the alpha subunit of GABP resulted in a dramatic decrease in BRCA1 promoter activity in
MCF-7s, but had no effect on its activity in the SK-BR-3 line (Figure 6e). Overexpression of the
GABP alpha and beta subunits however, had no effect on promoter activity in MCF-7s (Figure
6f), presumably due to the presence of saturating endogenous levels of these proteins. In contrast,
cotransfection of these expression vectors resulted in a dramatic increase in the transcriptional
activity of the L6-pRL promoter in SK-BR-3 cells (Figure 6f). These results suggest that
endogenous GABP is either absent or non-functional in the SK-BR-3 cell line and that this loss is
responsible for the low level of BRCA1 expression in this line.
34
Figure 6: BRCA1 expression and GABP alpha/beta activity is reduced in SK-BR-3 cells.
(a) Western blot analysis of BRCA1 protein levels in MCF-7 and SK-BR-3 cells. Equal quantities of
proteins were loaded and levels of TATA Binding Protein (TBP) are shown as an internal control. (b)
Quantitative RT-PCR for BRCA1 was carried out for a variety of breast cell lines using TBP as an internal
control. Levels are shown relative to MCF-7 cells with the mean and standard deviation of three replicates
shown. (c) The relative activities of the BRCA1 proximal promoter construct (L6-pRL) in MCF-7 and SKBR-3 cells were compared using normalization with an internal control plasmid. For all transfection
experiments reported here, the mean and standard deviation of 3 replicates are indicated. Independent
experiments were performed a minimum of three times. (d) A ChIP assay was performed using MCF-7 and
SK-BR-3 chromatin and antibodies against acetylated histone H3K9 (acH3), haemagglutinin (HA, negative
control), RNA polymerase II (RNA pol II) and histone deacetylase I (HDAC). PCR products obtained
using primers specific to the BRCA1 promoter (refer to Methods) are shown. (e) The BRCA1 L6-pRL
construct was co-transfected with a small hairpin RNA expression construct directed against GABP alpha
(shGABP alpha), or the empty H1-2 vector (Empty vector). Results are expressed in relation to the vector
transfected cells, for each cell line. (f) Expression vectors for both GABP alpha and beta (GABP
alpha/beta) were cotransfected with the L6-pRL promoter construct in both cell lines. Results are expressed
in relation to the empty vector controls for each cell line. Experiments performed by Valerie Kelly-Turner
(a), Gwen MacDonald (c, e, f) and Crista Thompson (b, d).
35
2.4.2 Endogenous GABPβ activity and levels are lower in SK-BR-3 cells
To determine if GABP protein levels were altered in SK-BR-3 cells, cell lysates from
three breast cell lines, MCF-7, T-47D and SK-BR-3, were evaluated by western blot. Equal
quantities of total protein from both nuclear (data not shown) and whole cell extracts (Figure 7a)
were analyzed. Levels of both GABPα and GABPβ were dramatically reduced in SK-BR-3 cells
compared to MCF-7 cells and T-47D cells, though some reduction in the levels of these proteins
in T-47D cells was noted (Figure 7a). Semi-quantitative RT-PCR was then carried out on all
three cell lines using PCR primers directed against the alpha and beta subunits, as well as
GAPDH as an internal control. The alpha subunit mRNA appears to be expressed at similar
levels in all three cell lines while the beta form is significantly reduced in SK-BR-3 cells (Figure
7b). The reduced levels of GABPβ mRNA in SK-BR-3 cells were confirmed by quantitative RTPCR (Figure 7c). These results suggest that the low levels of GABPβ protein in the SK-BR-3 cell
line are the result of a lack of expression of the beta gene. While the GABPα mRNA levels are
similar, the low levels of GABPα protein may be attributable to the lack of its binding partner.
2.4.3 Expression of exogenous GABPβ restores BRCA1 proximal promoter activity, and GABPα
levels and localization in SK-BR-3 cells
These results suggest that GABPβ expression is compromised and was confirmed when
cotransfection of the beta subunit alone, but not the alpha subunit, was able to transactivate the
BRCA1 promoter in SK-BR-3 cells (Figure 8a). To confirm these results, whole cell lysates from
SK-BR-3 cells transfected with FLAG-tagged expression vectors for GABPα and GABPβ were
evaluated by western blot to determine the relative levels of GABP subunit expression (Figure
8b). The FLAG-GABPα levels were also increased by the presence of FLAG-GABPβ confirming
that alpha protein is stabilized by the presence of its partner. Endogenous GABPα levels were
36
Figure 7: GABPα and β subunit protein and mRNA levels are decreased in the SK-BR-3 cell line.
(a) Western blot analysis of whole cell lysates from MCF-7, T-47D and SK-BR-3 cells was carried out
using antibodies to GABPα, GABPβ and the blots were then reprobed with anti-γ-tubulin as an internal
control. Apparent molecular weight markers (kDa) are indicated to the right of the panels. (b) The relative
transcript levels of the GABP subunits in MCF-7 (M), T-47D (T) and SK-BR-3 (S) cells were examined by
semi-quantitative RT-PCR. Specific products were amplified from equal amounts of RT product from the
cell lines indicated using primer sets for GABPα, GABPβ and GAPDH as an internal control. Products
were separated on a 1.5% agarose gel with 100 bp ladder in leftmost lane. (c) Quantitative RT-PCR
analysis of GABPβ mRNA was carried out on the indicated cell lines. Levels are expressed in relation to
the 184hTERT cell line. Experiments performed by Gwen MacDonald (a, c) and Crista Thompson (b).
37
Figure 8: Exogenous GABPβ in SK-BR-3 cells restores BRCA1 proximal promoter activity and
stabilizes endogenous GABPα.
(a) Expression vectors for the individual GABP subunits, or both together, were cotransfected with the
BRCA1 L6-pRL promoter construct in SK-BR-3 cells. (b) SK-BR-3 cells were co-transfected with the
indicated FLAG-tagged GABP expression vectors. Whole cell lysates from these cells were analyzed by
western blots probed with antibodies against GABPα, GABPβ or the FLAG moiety and then reprobed with
anti-γ-tubulin to control for sample loading. The arrow indicates the band corresponding to endogenous
GABPα protein. Apparent molecular weight markers (kDa) are presented to the right of the panels.
Experiments performed by Gwen MacDonald.
38
almost undetectable in the lysates from cells transfected with the empty FLAG vector (Figure 8b,
FLAG vector, anti-GABPα), the arrow indicates endogenous GABPα. Cells transfected with the
FLAG-GABPβ expression vector however, produced detectable amounts of endogenous GABPα
protein, confirming that exogenous GABPβ protein is able to stabilize endogenous GABPα
expression (Figure 8b, FLAG-GABPβ, anti-GABPα), while endogenous GABPβ remains
undetectable in all cases. No effect on endogenous BRCA1 levels was detected following
exogenous GABPα and/or GABPβ expression (data not shown) likely due to the initial regulation
defect leading to permanent downregulation of BRCA1 in this cell line consistent with the low
level of RNA pol II detected by ChIP (Figure 6d).
Translocation of GABPα into the nucleus is dependent on a nuclear localization signal
present in GABPβ [67]. The effect of beta levels on alpha translocation was determined by
transfection of the FLAG-tagged GABPα construct into MCF-7 and SK-BR-3 cells and
visualization of the proteins using confocal microscopy with antibodies against the FLAG moiety.
In MCF-7 cells, the alpha protein is present in the nucleus and addition of an expression vector
for GABPβ does not alter its location (Figure 9, FLAG-GABP alpha, FLAG-GABP alpha +
GABP beta). In contrast, the alpha subunit is present in the cytoplasm in SK-BR-3 cells (Figure 9,
FLAG-GABP alpha), presumably due to the lack of GABPβ. Addition of a GABPβ expression
vector causes the alpha protein to translocate into the nucleus (Figure 9, FLAG-GABP alpha +
GABP beta). This confirms the absence of beta in SK-BR-3 cells and indicates that nuclear
localization of the alpha protein can be rescued by the addition of exogenous GABPβ.
Thus, the decreased expression of BRCA1 in SK-BR-3 cells appears to be the result of a
loss of GABPβ expression, destabilizing the α/β heterodimer and in turn leading to decreased
BRCA1 expression due to the absence of GABP-mediated activation of the BRCA1 promoter.
39
Figure 9: GABPα nuclear localization is rescued by GABPβ in SK-BR-3 cells.
MCF-7 and SK-BR-3 cells were transfected with the indicated expression vectors. Cells were stained with
anti-FLAG FITC-labeled antibodies (green) and Hoechst dye (blue). Confocal imaging of the overlay of the
two stains is shown. Experiment performed by Gwen MacDonald.
40
2.4.4 A critical activating factor(s) binds to the GABPβ promoter between -268 and -251
In order to characterize the basis for the downregulation of GABPβ in SK-BR-3 cells, the
proximal promoter from -1023 to +194 was cloned and a series of deletion constructs were
prepared using a Renilla luciferase reporter plasmid. These constructs identified a decrease in
activity when the sequence between positions -268 and -251 was deleted in both MCF-7 and SKBR-3 cells (Figure 10a). This suggested that a critical activating factor(s) binds to this site.
Adjusting the Renilla light units to compensate for differences in transfection efficiency to permit
a comparison of the absolute promoter activity between the two cell lines, revealed a reduction
(approximately 2 to 3.5-fold) in GABPβ promoter activity in SK-BR-3 cells compared to MCF-7
cells (Figure 10b), although both cell lines showed similar deletion profiles. This indicates that
the promoter is less active in SK-BR-3 cells, but the principal transcription factor(s) required for
promoter activity is functional in both cell lines.
To confirm binding of a critical activating factor(s) to this region of the promoter, six
overlapping 20-mer oligonucleotides representing the GABPβ promoter from position -290 to 221 were synthesized (Figure 11a) and assessed in an electrophoretic mobility shift assay
(EMSA) with MCF-7 nuclear extracts (Figure 11b). Different binding complexes for each
oligonucleotide were observed including a non-specific binding complex (NS) on each
oligonucleotide, a weak doublet on Gb-240 (S), and a large binding complex on Gb-270 (S),
which encompasses the
critical sequence identified by deletion analysis (-268 to -251).
Interestingly, the complex that forms on Gb-270 differs between MCF-7 and SK-BR-3 cells
(Figure 11c). While a robust single band representing a large binding complex was formed with
MCF-7 nuclear extracts, a weaker doublet was formed with the same amount of SK-BR-3 nuclear
extracts by weight (with normalization verified via the non-specific binding complex, NS). It is
possible that this difference in the levels of binding proteins is responsible for the lower GABPβ
promoter activity observed in SK-BR-3 cells (Figure 10b).
41
Figure 10: GABPβ promoter activity in MCF-7 and SK-BR-3 cell lines.
A series of 5’ deletion mutants of the GABPβ proximal promoter were prepared in the pRL-null reporter
plasmid. Promoter constructs are named according to the 5’ nucleotide position relative to the transcription
start site with all constructs extending to nucleotide +194. The transcriptional activity of the GABPβ
promoter constructs was assessed via dual luciferase assay using the pCMV-luc plasmid as an internal
control. (a) Promoter activity is expressed relative to the activity of the longest construct, -1023. (b) SKBR-3 raw Renilla light units were multiplied by a correction factor to compensate for differences in
transfection efficiency and permit a comparison of the absolute promoter activity between the two cell lines
(Relative Renilla light units). The correction factor was based upon the luciferase light units (LLU) of the
internal control, pCMV-luc, and was calculated by dividing the mean MCF-7 LLU by the mean SK-BR-3
LLU for the longest GABPβ promoter construct, -1023. Experiments performed by Crista Thompson.
42
Figure 11: Binding complexes that form on the GABPβ promoter.
(a) A series of overlapping 20-mer oligonucleotides (sequences specified by square brackets) spanning the
GABPβ promoter from nucleotide -290 to -221 were prepared to examine the binding complexes that form
on the promoter. The deletion constructs that border the sequence critical for promoter activity (Figure 10)
are indicated (arrows, bold). (b) The 20-mer oligonucleotides were used as probes in an EMSA with
nuclear extracts from MCF-7 cells. Binding complexes are indicated (Shift = S), as are non-specific
binding complexes (NS) and free probe (F). (c) Gb-270 was used as a probe in an EMSA with increasing
amounts of nuclear extracts (NE) from MCF-7 and SK-BR-3 cells. Binding complexes are as indicated
above. Experiments performed by Crista Thompson.
43
2.4.5 NRF-1 binds to the GABPβ promoter between -268 to -251
Analysis of the GABPβ promoter sequence between -268 and -251 revealed its similarity
to the consensus binding sequence of NRF-1 [106]. Given that GABP and NRF-1 are key
regulators of mitochondrial respiration [104], this suggested a potential linkage in their
regulation. Binding of NRF-1 to the GABPβ promoter was initially demonstrated in an EMSA in
which Gb-270 was able to compete in a dose-dependent fashion for NRF-1 binding with RC4, an
oligonucleotide containing the NRF-1 binding site from the rat cytochrome C promoter [106]
(Figure 12a). This result was verified by an EMSA in which recombinant NRF-1, prepared and
purified as a fusion with maltose binding protein, bound in a concentration-dependent manner to
both Gb-270 and RC4 (Figure 12b). Finally, binding of NRF-1 to the GABPβ promoter in vivo
was verified by ChIP (Figure 12c). MCF-7 chromatin was immunoprecipitated with a variety of
antibodies and after PCR amplification of the proximal promoter, the antibody against NRF-1
gave a positive signal, while negative controls did not. Together, the EMSA and ChIP results
confirm that NRF-1 binds to the GABPβ promoter between -268 and -251 in vitro and in vivo.
2.4.6 Loss of NRF-1 decreases GABPβ and BRCA1 gene expression
To investigate the role of NRF-1 on the GABPβ promoter, MCF-7 cells were transfected
with siRNA against NRF-1 or GAPDH (as a negative control), and one of two GABPβ promoter
constructs, -268 which contains the NRF-1 binding site, and -251 which does not (Figure 13a).
Knockdown of NRF-1 attenuated the promoter activity of -268, but not -251, indicating that loss
of NRF-1 binding decreases GABPβ transcription and depends on this promoter region. The
effects of NRF-1 knockdown were confirmed in a western blot on whole cell lysates from MCF-7
cells transfected with siGAPDH or siNRF-1 (Figure 13b). NRF-1 was reduced to undetectable
levels, while GABPβ was decreased to approximately 40% (normalized with the loading control,
TBP). Interestingly, the levels of GABPα were unaffected by NRF-1 knockdown, although
44
Figure 12: NRF-1 binds to the GABPβ promoter.
(a) An oligonucleotide with a known NRF-1 binding site (RC4) [106] was used as a probe in an EMSA
with MCF-7 nuclear extracts and Gb-270 as a cold competitor. NRF-1 binding (NRF-1), non-specific (NS)
binding and free probe (F) are indicated. (b) Recombinant NRF-1 (rNRF-1) was prepared as a fusion with
the maltose binding protein. Decreasing amounts of recombinant protein (5, 2.6, 1.3, 0.26, 0.13 and 0.03
µg) were used in an EMSA with RC4 and Gb-270 probes. Binding complexes as indicated above. (c) A
ChIP assay was performed using MCF-7 chromatin and antibodies against acetylated histone H3K9 (acH3),
haemagglutinin (HA, negative control), NRF-1 and Oct-4 (transcription factor, negative control). PCR
products obtained using primers specific to the GABPβ promoter (refer to Methods) are shown.
Experiments performed by Crista Thompson (a, c) and Rachael Klinoski (b).
45
Figure 13: NRF-1 loss attenuates GABPβ promoter activity and GABPβ/BRCA1 expression; NRF-1
is consistent between cell lines.
(a) The transcriptional activity of the GABPβ promoter constructs -268, which contains the NRF-1 binding
site, and -251 which does not, was assessed in MCF-7 cells via dual luciferase assay in the presence of
siRNA against GAPDH (siGAPDH, negative control) and NRF-1 (siNRF-1). Promoter activity is
expressed as relative light units. (b) The protein levels of NRF-1, GABPβ, GABPα, BRCA1 and TBP
(internal control) were assessed by western blot in whole cell lysates prepared from MCF-7 cells treated
with siGAPDH or siNRF-1. (c) NRF-1 levels were determined by western blot in MCF-7 and SK-BR-3
whole cell lysates. TBP was used as an internal control. Apparent molecular weight markers (kDa) are
indicated to the right of the panels. (d) The activity of two GABPβ promoter constructs, Gb-270 multimer
(which contains a triple repeat of the Gb-270 sequence specified in Figure 11) and -268 (see part a), was
examined via dual luciferase assay in MCF-7 and SK-BR-3 cells following exogenous NRF-1 expression.
Promoter activation by NRF-1 is expressed as a fold relative to empty vector controls in each cell line. (e)
A ChIP assay was performed using MCF-7 and SK-BR-3 chromatin and antibodies against acetylated
histone H3K9 (acH3), haemagglutinin (HA, negative control), RNA polymerase II (RNA pol II), histone
deacetylase I (HDAC), NRF-1 and Oct-4 (transcription factor, negative control). PCR products obtained
using primers specific to the GABPβ promoter (refer to Methods) are shown. Experiments performed by
Crista Thompson.
46
the change in band appearance (i.e. single band to a doublet) could indicate an alteration in posttranslational modification (Figure 13b). BRCA1 protein levels were also decreased by the NRF-1
siRNA indicating that it lies downstream of both GABP and NRF-1, forming a transcriptionally
regulated network.
2.4.7 NRF-1 levels and activity are similar between MCF-7 and SK-BR-3 cells
Given that NRF-1 binds to and regulates the GABPβ promoter (Figure 12, 13a, 13b), it
was important to determine if low GABPβ expression in SK-BR-3 cells could be the result of
decreased NRF-1 levels. Western blot analysis demonstrated that the levels of NRF-1 between
MCF-7 and SK-BR-3 cells are similar (Figure 13c), and thus, are unlikely to be responsible for
low GABPβ expression in SK-BR-3 cells. It was also important to ascertain whether NRF-1
activity was compromised in SK-BR-3 cells. MCF-7 and SK-BR-3 cells transfected with an
NRF-1 expression vector (p3XFLAG-NRF-1) and one of two GABPβ promoter constructs, Gb270 multimer (which contains a triple repeat of the Gb-270 sequence specified in Figure 11) and 268 (as referenced above), were assessed in a dual luciferase assay. Activation of the promoter
constructs by exogenous NRF-1 was similar in the MCF-7 and SK-BR-3 lines confirming that
NRF-1 function was not defective in SK-BR-3 cells (Figure 13d). In addition, ChIP analysis
revealed that the GABPβ promoter is active (as evidenced by the presence of acetylated histone
H3K9 (acH3) and RNA pol II, and the lack of HDAC) and occupied by NRF-1 in both cell lines
(Figure 13e). Thus, altered NRF-1 activity does not appear to account for the discrepancy in
GABPβ expression between MCF-7 and SK-BR-3 cells.
2.4.8 NRF-1 is one member of a protein complex that activates GABPβ transcription
Binding of NRF-1 to the GABPβ promoter was further characterized by evaluating a
series of mutant oligonucleotides in an EMSA with MCF-7 nuclear extracts. The consensus
binding sequence for NRF-1 [106] indicated that the NRF-1 binding site in Gb-270 began at
47
nucleotide 5 (Figure 14a).
Therefore, mutant versions of Gb-270 were prepared with
conservative nucleotide replacements (i.e. C to G and G to C) at positions 4-6 (m4-6), and nonconservative single nucleotide replacements (i.e. C to T and G to A) at positions 4, 5 and 6 (mT4,
mT5, mA6) (Figure 14a). Mutation of nucleotides 4-6 disrupted the large protein complex that
normally forms on Gb-270 (Figure 14b, m4-6), whereas single nucleotide replacements at
positions 4, 5 and 6 diminished the formation of the large protein complex and, in the case of
positions 4 and 5, yielded faster migrating complexes as well (Figure 14b, mT4, mT5, mA6). A
supershift EMSA with oligonucleotides mT4 and mT5 were used to probe MCF-7 nuclear
extracts in the absence and presence of an antibody against NRF-1 (Figure 14c). Addition of the
anti-NRF-1 antibody shifted the faster migrating complex (S) to a slower migrating complex (SS)
for both oligonucleotides confirming that the faster migrating complex contained NRF-1. The
fact that NRF-1 binding produces a faster migrating complex than what is normally observed on
Gb-270 strongly suggests that the complex that forms on Gb-270 is actually a larger protein
complex containing NRF-1. This is further supported by the faster migration of recombinant
NRF-1 bound to Gb-270 (Figure 12b). The banding pattern observed (Figure 14b) suggests that
NRF-1 binds to the GABPβ promoter in complex with at least two other proteins (Figure 14e).
To verify the role of NRF-1 on the GABPβ promoter, the mutants described were
incorporated into the -268 promoter construct and these plasmids tested in co-transfection
experiments in MCF-7 cells.
As previously observed (Figure 13a), knockdown of NRF-1
attenuated the promoter activity of -268, which contains the NRF-1 binding site, but had no effect
on the minimal activity of -251, which does not contain the NRF-1 site (Figure 14d). Mutation of
nucleotides 4-6 decreased the GABPβ promoter activity to levels similar to -251 (m4-6)
consistent with the disruption of the large protein complex previously observed by EMSA (Figure
48
Figure 14: NRF-1 is a component of a protein complex that binds to the GABPβ promoter.
(a) The NRF-1 consensus sequence [106], and the sequences of Gb-270 and mutant oligos are shown.
Mutations are in lowercase and bold. (b) Gb-270 and the mutant oligos were used as probes in an EMSA
with MCF-7 nuclear extracts. Binding complexes (S), non-specific binding complexes (NS) and free probe
(F) are indicated. Bands corresponding to NRF-1, and predicted NRF-1 + X and NRF-1 + X +Y complexes
(see part e) are also indicated. (c) Mutant oligos mT4 and mT5 were used as probes in an EMSA with
MCF-7 nuclear extracts. An NRF-1 antibody was added to the binding reactions as indicated (+), or PBS
was added as a negative control (-). Binding complexes (S) were supershifted (SS) in the presence of the
NRF-1 antibody. (d) The transcriptional activities of the GABPβ promoter constructs -268 (contains the
NRF-1 binding site) and -251 as well as promoter constructs with the mutations specified in part (a) were
assessed in MCF-7 cells via dual luciferase assay in the presence of siRNA against GAPDH (siGAPDH,
negative control) and NRF-1 (siNRF-1). Promoter activity expressed as relative light units. (e) Model of
the NRF-1 complex that activates GABPβ gene expression. Banding patterns observed by EMSA suggest
that NRF-1 binds to the GABPβ promoter in complex with at least two other proteins (refer to part b). We
propose that NRF-1 binds as a homodimer to the GABPβ promoter from nucleotide –266 to –255
(underlined). Protein X binds NRF-1 and makes limited contact with the promoter upstream of the NRF-1
binding site stabilizing its interactions with NRF-1. A third protein (Y) binds to the NRF-1 + X complex.
Mutations to the promoter (mT4, mT5 and mA6) disrupt formation of the complex (refer to part b), but
oligonucleotides with mT4 and mT5 mutations retain NRF-1 binding capability (refer to part c).
Experiments performed by Crista Thompson.
49
14b, m4-6). Furthermore, knockdown of NRF-1 using a siRNA had no effect on the activity of
this construct indicating that NRF-1 no longer binds and activates the GABPβpromoter. Mutation
of nucleotides 4 and 5 did not decrease GABPβ promoter activity (Figure 14d, mT4, mT5) despite
the diminished full protein complex formation observed by EMSA (Figure 14b). The promoter
activities of mT4 and mT5 were attenuated by NRF-1 knockdown (Figure 14d) consistent with
their ability to bind NRF-1 (Figure 14c). Interestingly, mA6, which showed diminished full
complex formation but no uncomplexed NRF-1 binding (Figure 14b), exhibited reduced promoter
activity that was also attenuated by NRF-1 knockdown (Figure 14d). This suggests that mutation
of nucleotide 6 allowed binding of the full NRF-1-containing complex but with a reduced
affinity. In summary, nucleotides 4-6 are required for assembly of the multi-protein complex,
while binding of NRF-1 is required and sufficient for full promoter activity in vitro. The ability
of the multi-protein complex to form in the presence of a point mutant in the NRF-1 site, though
with lower affinity (as exemplified by mA6), as well as the decreased binding to Gb-270
observed in SK-BR-3 cells (Figure 11c) suggests the NRF-1 may bind co-operatively with other
proteins (Figure 14e).
2.5 Discussion
Like many ErbB2-overexpressing tumours [146,147], the SK-BR-3 cell line has low
levels of BRCA1 protein and mRNA.
In searching for the basic cause of this defect, we
determined that the beta subunit of GABP, a key transcriptional regulator of the BRCA1
promoter [55], is itself downregulated. Decreased GABPβ activity is in turn linked to defects in
an NRF-1/coactivator complex present on the GABPβ promoter. Knockdown of NRF-1 in MCF7 cells confirms that this represents a NRF-1>GABP>BRCA1 regulatory pathway. Given the
inverse correlation between BRCA1 and ErbB2 levels in tumours, it was expected that some
component of the NRF-1>GABP>BRCA1 pathway would be sensitive to ErbB2-overexpression.
50
However, cotransfection and siRNA knockdown experiments with both ErbB2 and all of the
other Erb family members failed to affect the expression of any of these genes in both MCF-7 and
SK-BR-3 lines (data not shown). This suggests that inactivation of this pathway is not a direct
consequence of ErbB2 overexpression.
Both NRF-1 and GABP are known to control the expression of a wide variety of nuclear
encoded mitochondrial proteins (reviewed in [104]). These include proteins involved in electron
transport, such as cytochrome C and the cytochrome oxidases, as well as proteins involved in
mitochondrial replication and maintenance. The expression of NRF-1 and GABP appear to be
coordinated during mitochondrial biogenesis [104], but the basis for this has not previously been
investigated. Our discovery of the presence of a functional and key NRF-1 regulatory element
within the GABPβ promoter provides a molecular mechanism to explain this linkage. Because
GABP is an obligate heterodimer [65], the GABPα protein levels must be coordinated with
GABPβ levels. The GABPα promoter has previously been shown to be autoregulated [76], and
GABPα levels in heterozygous knockout mice are the same as the wildtype indicating that
protein levels are under tight control [74]. We have demonstrated that in the absence of GABPβ,
GABPα protein is made but is unstable due to the lack of its partner, possibly as a result of
changes in post-translational modification as seen with the siNRF-1 experiment (Figure 13b).
This suggests that levels of GABPβ may be limiting and regulated, with GABPα being both
stabilized and transcriptionally upregulated as GABPβ levels increase.
This arrangement
suggests that a positive feedback switch may exist, with GABP either lying downstream of NRF1, or with NRF-1 also being regulated by GABP. Consistent with this, ChIP on CHIP analysis
has located a GABP site in the proximal promoter of the NRF-1 gene [148]. The observation that
BRCA1 may also be involved in negative autoregulation of its own promoter means that it could
also participate in this feedback loop [52]. The formation of the NRF-1 complex on the GABPβ
51
promoter, which differs between cell lines (Figure 11), was also shown to be dependent on the
interaction of a coactivator complex with DNA sequences adjacent to the NRF-1 site (Figure 14).
Because the induction of mitochondrial activity is controlled by the co-activator PGC1α which
acts in conjunction with NRF-1 and GABP in muscle and fat tissue (reviewed in [149]), PGC1α
was a candidate for the complex observed on the GABPβ promoter. We have been unable to
observe any role for this coactivator in the induction of GABP function (data not shown). This
has included cotransfection, siRNA and western blot analysis which indicate that neither PGC1α,
PGC1β nor PRC are active or present in a variety of breast cell lines (data not shown). Indeed we
have identified a different class of coactivators which are associated with NRF-1, and which
could control mitochondrial biogenesis in these cells.
The identification of BRCA1 as a stem cell regulator in mammary cells [49] has
expanded its already extensive list of possible functions.
Based on this role, the frequent
downregulation of BRCA1 expression seen in sporadic breast cancers could reflect the disruption
of a stem cell differentiation program. Our findings suggest that BRCA1 is at the end of a
transcriptional regulatory network consisting of NRF-1 and GABP. GABPα has been shown to
be necessary for early embryonic growth with the homozygous knockout leading to death of the
pre-implantation embryo [74]. The complete GABPβ knockout also exhibits early embryonic
lethality [75], so that any defect in the GABP complex inhibits embryonic development.
Interestingly, the NRF-1 knockout exhibits a similar phenotype [135], as would be expected if it
was part of a common pathway with GABP. This pre-implantation phase of development is
associated with a burst of mitochondrial synthesis [150]. BRCA1 knockouts are also embryonic
lethal, but at a slightly later stage [151] suggesting that BRCA1 may lie downstream of both
NRF-1 and GABP during embryogenesis.
GABP has previously been implicated in the
regulation of stem cells as a downstream target of STAT3, and ectopic expression of GABPα in
52
embryonic stem cells activates Oct3/4 transcription by downregulating repressors of Oct3/4
expression [86]. In addition, bioinformatic analysis of stemness genes had previously implicated
GABP in the regulation of stem cell proliferation [88]. This strongly suggests that GABP is
linked to the regulation of stemness, in both the embryo and adult. At the same time, the linkage
of NRF-1 and GABP to mitochondrial metabolism implies that BRCA1 expression, and thus the
regulation of stemness, may also be linked to the activation of oxidative phosphorylation in these
cells. The Warburg effect suggests that most cancers have a defect in oxidative phosphorylation
which results in tumours primarily consuming glucose and producing lactic acid as the endpoint
of metabolism [152]. Stem cells, and cancer stem cells, have also been suggested to be dependent
on glycolysis [153]. If differentiation in the breast is linked by BRCA1 to the induction of
mitochondrial metabolism, then blockade of this pathway will lead to both the persistence of
stem-like properties and the lack of oxidative phosphorylation. The Warburg effect can then be
viewed as the persistence of a metabolic program present in stem cells into the tumour state.
Explanations of the Warburg effect have focused on alterations in proteins involved in
mitochondrial function and uncoupling [154]. These changes must be underlaid by alterations in
transcriptional regulation, presumably in networks such as NRF-1 and GABP involved in
upregulating oxidative phosphorylation. Many of the pathways previously shown to be affected
may represent compensatory activation of alternative metabolic pathways used by the cell to
overcome defective induction of oxidative phosphorylation.
2.6 Conclusions
In summary, recent evidence suggests that loss of BRCA1 function impairs normal breast
differentiation thereby facilitating tumour initiation. Investigation of low BRCA1 expression in
the human breast cancer cell line SK-BR-3 revealed a transcriptional network consisting of NRF1>GABPβ>BRCA1. Given the common role of NRF-1 and GABP in regulating mitochondrial
53
function, the NRF-1>GABPβ>BRCA1 pathway suggests a link between tumour initiation via
disruption of stem cell maturation and the abnormal mitochondrial metabolism (Warburg effect)
that has long been observed in tumours.
2.7 Acknowledgements
We gratefully acknowledge RC Scarpulla for providing pSG5-NRF-1, and Rachael
Klinoski for assistance in the preparation of recombinant NRF-1. We thank Xenia Schmidt for
contributions to the GABPβ promoter constructs, and Sherri Nicol and Valerie Kelly-Turner for
their excellent technical assistance. We would also like to thank Matt Gordon for his technical
expertise in confocal microscopy. This work was funded by a grant from the Canadian Breast
Cancer Foundation – Ontario Region, as well as a Fellowship to CT from the Canadian Breast
Cancer Foundation – Ontario Region.
54
Chapter 3
The role of the SWI/SNF nucleosome remodelling complex in the
NRF-1>GABP>BRCA1 transcriptional network
3.1 Abstract
Background: Loss of BRCA1, either by germline mutation or decreased expression, is a
driving force in breast cancer. Typically the tumours are classified as basal-like, and as such, are
characterized by high histological grade and poor prognosis. Investigation of BRCA1 regulation
is vital to our understanding of one of the most deadly forms of this disease. We had previously
determined that diminished BRCA1 expression in the ErbB2-overexpressing cell line, SK-BR-3,
is the result of aberrant activation of the GABPβ promoter by a protein complex containing NRF1. To determine the basis for the downregulation of GABPβ and BRCA1, we wanted to identify
the additional members of the NRF-1 binding protein complex.
Results: Proteins isolated from an NRF-1 affinity column and able to bind to the GABPβ
promoter in vitro were identified by mass spectrometry. Members of the SWI/SNF family of
ATP-dependent chromatin remodelers were identified and shown to bind to the GABPβ promoter
via chromatin immunoprecipitation.
EMSA, siRNA knockdown and dual luciferase assays
suggested that BRG1, ARID1A and BAF155 regulate the transcription of GABPβ in conjunction
with NRF-1. However, conflicting results prohibit definite conclusions about the role of the
SWI/SNF complex in GABPβ regulation. The lack of conclusive evidence may be a consequence
of the functional redundancy of SWI/SNF subunits, or insufficient methodology, i.e. not
employing complex chromatin templates typically required for nucleosome remodeling.
Conclusions: While a role for a SWI/SNF complex in the regulation of GABPβ as an
upstream regulator of BRCA1 would be consistent with known gene and protein interactions
55
between BRCA1 and SWI/SNF proteins, as well as the loss of SWI/SNF subunits in
tumourigenesis, additional experiments are required to conclusively demonstrate the function of
SWI/SNF proteins in the NRF-1 > GABP > BRCA1 transcriptional network.
3.2 Background
Germline mutations in the tumour suppressor BRCA1 (breast cancer 1, early onset) render
carriers highly susceptible to breast and ovarian cancer, with cumulative risks at age 70 of 57%
(breast) and 40% (ovarian) [15].
Although breast cancer is a multifarious disease, gene
expression profiling has identified six clinically relevant subtypes – luminal A, luminal B, normal
breast-like, ErbB2+ (v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 +), basal-like
and claudin-low [1-4]. The vast majority of BRCA1 mutation carriers develop breast tumours
with a basal-like phenotype [2,29,30]. These tumours are characterized by high histological
grade, high proliferative indices and poor prognosis [1,155-157]. In addition, basal-like tumours
tend to be hormone receptor and ErbB2 negative (triple negative) [1,155,157,158] which makes
them unresponsive to both endocrine therapy and trastuzumab, a humanized monoclonal antibody
that targets ErbB2 [7]. While BRCA1 mutations are rare in sporadic cancers [20-22], there is
evidence that loss of BRCA1 expression/function contributes to breast tumourigenesis [51].
Moreover, consistent with germline BRCA1 mutation, loss of BRCA1 is associated with basallike breast cancer. Low BRCA1 mRNA levels [31], hypermethylation of the BRCA1 promoter
[32], and increased expression of negative regulators of BRCA1 such as Inhibitor of DNA
binding 4 (ID4) [31] and miR-146a and miR-146b-5p [33], are all associated with basal-like
(triple negative) breast cancer. Interestingly, basal-like carcinomas exhibit a high degree of
genomic instability [159] which is consistent with the role of BRCA1 in DNA repair [160], and
tumours with epigenetic silencing of BRCA1 develop similar patterns of genomic alterations as
tumours derived from BRCA1 mutation carriers [34]. The consistent pathological and genetic
56
profiles of breast carcinomas from BRCA1 mutation carriers and spontaneous carcinomas
showing BRCA1 downregulation suggest that BRCA1 dysfunction has a causal role in the
development of one of the most deadly forms of the disease. Thus, investigation of BRCA1
regulation is imperative to our understanding of breast cancer etiology.
We previously established that BRCA1 is part of a transcriptional network comprised of
Nuclear respiratory factor-1 (NRF-1) > GA Binding Protein (GABP) [161]. GABP is comprised
of two subunits – GABPα, which contains the DNA-binding domain, and GABPβ, which
contains the nuclear localization signal and transcriptional activation domain [62,63,66,67]. The
low BRCA1 expression observed in the ErbB2-overexpressing cell line SK-BR-3 was attributed to
decreased GABPβ expression [161]. However, diminished GABPβ expression was not the result
of low levels of NRF-1, but rather aberrant activation of the GABPβ promoter by an NRF-1
containing complex. To determine the basis for the downregulation of GABPβ and BRCA1 in
SK-BR-3 cells, we wanted to identify the additional members of the protein complex that
regulates the GABPβ promoter in conjunction with NRF-1.
In this study, novel NRF-1 binding proteins, namely the SWI/SNF (Switching
defective/Sucrose nonfermenting) family members Brahma-related gene 1 (BRG1), AT-rich
interactive domain-containing protein 1A (ARID1A) and BRG1-associated factor 155 (BAF155),
were identified as potential co-regulators of GABPβ expression. SWI/SNF proteins form large
multi-subunit complexes that mediate ATP-dependent chromatin remodeling [162].
These
complexes have been implicated in a variety of cellular processes including proliferation, DNA
repair and differentiation, thus it is not surprising that disruption of SWI/SNF function has been
associated with cancer. Inactivating mutations of BRG1, which functions as a central ATPase
catalytic subunit [163], have been identified in pancreatic, prostate, breast and lung cancer cell
lines [164,165] and in primary lung tumours [166-168]. In addition, BRG1 heterozygous mice
57
are susceptible to mammary tumours suggesting that haploinsufficiency is sufficient for
tumourigenesis [169]. ARID1A has non-sequence-specific DNA binding activity [170] and is
reported to be mutated in 30% of endometrioid carcinomas [171], approximately 50% of ovarian
clear cell carcinomas [171,172], and 13% of transitional cell carcinoma of the bladder [173]. It
has also been implicated as a candidate tumour suppressor gene in breast cancer [174].
Confirming its tumour suppressor function, exogenous ARID1A in deficient ovarian cancer cells
suppresses cell proliferation and tumour growth in mice, and shRNA knockdown of ARID1A
enhances proliferation and tumourigenicity of non-transformed epithelial cells [175]. BAF155 is
a core member of the SWI/SNF complex that has been shown to stabilize additional SWI/SNF
components by blocking CHFR (Checkpoint with forkhead and ring finger domains)-mediated
ubiquitination and degradation [176]. Because of its loss in two cancer cell lines and its ability to
cause replicative senescence in deficient cancer cell lines upon re-expression, BAF155 has
recently been identified as another member of the SWI/SNF family that functions as a tumour
suppressor [177]. Thus, in contrast to traditional genetic views of cancer initiation via mutations
to oncogenes and tumour suppressors, it is becoming clear that epigenetic modulators play a
significant role in tumourigenesis. This paper investigates the previously unreported role of the
SWI/SNF chromatin-remodelling complex in the transcriptional regulation of GABPβ as an
upstream regulator of the tumour suppressor, BRCA1.
3.3 Methods
Methods are outlined in Thompson et al. [161] with the following additions.
3.3.1 Identification of NRF-1 binding proteins
Recombinant NRF-1 prepared as a fusion with Maltose binding protein (MBP) [161] was
bound to an amylose resin column (New England Biolabs (NEB), Pickering, Canada). Nonspecific protein binding was blocked with bovine serum albumin (BSA) in column buffer (CB; 10
58
mM
4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) pH 7.6, 0.1 mM
ethylenediaminetetraacetic acid (EDTA), 40 mM potassium chloride (KCl), 10% glycerol, 1 mM
dithiothreitol, 1 µg/mL leupeptin, 1 µg/mL pepstatin) before MCF-7 nuclear extracts were
applied to the column. The column was washed with CB and bound proteins were eluted with
300 mM and 500 mM KCl in CB. The recombinant NRF-1 was eluted from the amylose resin
with 10 mM maltose in CB. Fractions were analyzed by SDS-PAGE (7% acrylamide) and
visualized by silver (Pierce SilverSNAP® stain, Fisher, Nepean, Canada) or Coomassie (Bio-Rad
Laboratories, Mississauga, Canada) staining. Coomassie-stained bands from the 300 mM KCl
fraction were excised from the polyacrylamide gel, destained and sent to the Stanford University
Mass Spectrometry laboratory. Proteins were identified by subjecting proteolytic digests to
nanoflow LC-MS/MS (Thermo LTQ-Orbitrap Velos nanoUPLC-MS) and comparing peptide
fragments to available databases using software packages such as Mascot, Sequest, and Scaffold.
3.3.2 Antibodies
The
following
primary
antibodies
were
used
for
western
blot,
chromatin
immunoprecipitation (ChIP), electrophoretic mobility shift assay (EMSA) and/or coimmunoprecipitation (co-IP): anti-ARID1A (ab50878, Abcam, Cambridge, MA, USA), antiBAF155 (DXD7, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-BRG1 (for western
blot, ab70558, Abcam), anti-BRG1 (for ChIP and co-IP, H-88, Santa Cruz Biotechnology), antiFLAG (D-8, Santa Cruz Biotechnology), anti-cJUN (H-79, Santa Cruz Biotechnology) and antiNRF-1 (M01, Abnova, Taipei, Taiwan).
3.3.3 DNA constructs and siRNA
pCMV5 BRG1-Flag [178] was purchased from Addgene (Cambridge, MA, USA). Small
interfering RNA (siRNA) used for dual luciferase assay and western blot: siBRG1 (sc-29827,
59
Santa Cruz Biotechnology) and siARID1A (5’-GGACAAGGGAUUAAUAGUAtt, Ambion,
Austin, TX, USA).
3.3.4 Preparation of transfected whole cell lysates/ nuclear extracts and co-immunoprecipitation
Cells were plated at 1 × 106 cells/plate in 100-mm dishes. Transfections were performed
using 11 μL FuGENE transfection reagent (Roche, Laval, Canada) and 3.8 μg expression
plasmid(s) per plate, as per the manufacturer’s instructions. Forty-eight hours post-transfection,
the cells were scraped using a rubber policeman and lysed with 750 μL/plate modified
radioimmunoprecipitation assay (RIPA) buffer [161] for 15 min at 4ºC (whole cell lysates used
for co-IP), or lysed using 750 μL/plate 1 × SDS-PAGE loading buffer (MCF-7 pCMV5 BRG1Flag whole cell lysates used for western blot). Nuclear extracts were prepared 48 h posttransfection as previously described [161]. Co-immunoprecipitations were performed as outlined
in Table 3 following the method of Ritter et al. [58].
3.4 Results
3.4.1 Isolation of proteins that form the NRF-1 binding complex on the GABPβ promoter
Having previously demonstrated using MCF-7 and SK-BR-3 cells that NRF-1 is one
component of a protein complex that binds to the GABPβ promoter [161], we wanted to identify
the additional members of this binding complex. In order to isolate NRF-1 binding proteins,
recombinant NRF-1 fused with MBP was applied to amylose resin. Because of the high affinity
of MBP for amylose, this created an NRF-1 affinity column. Nuclear extracts from MCF-7 cells
were applied to the NRF-1 column, and the flow through and two wash fractions were collected.
NRF-1 binding proteins were eluted with 300 mM and 500 mM KCl before the recombinant
MBP-NRF-1 fusion was eluted with 10 mM maltose. To ascertain if any of the fractions
contained GABPβ promoter binding proteins, the fractions were assessed in an EMSA with Gb270, a 20-mer oligonucleotide containing the NRF-1 protein complex binding site [161], as the
60
Table 3: Experimental details and results for co-immunoprecipitations performed to confirm the interaction of NRF-1 with BRG1, ARID1A and
BAF155
Cell line
Transfected with
Lysates
Protein per
Antibody for Co-
Co-IP (µg)
IP
MCF-7
̶
Nuclear extracts
50
Anti-NRF-1
MCF-7
p3XFLAG-NRF-1
(FLAG-NRF-1)
p3XFLAG-NRF-1
(FLAG-NRF-1)
pCMV5 BRG1-Flag
(FLAG-BRG1) and
pSG5-NRF-1 (no
FLAG-tag)
̶
Whole cell lysates
50
Anti-FLAG
Nuclear extracts
60
Anti-FLAG
Whole cell lysates
50
Anti-FLAG
Whole cell lysates
100
Anti-BRG1
p3XFLAG-NRF-1
(FLAG-NRF-1) and
pCMV5 BRG1-Flag
(FLAG-BRG1)
Whole cell lysates
100
Anti-NRF-1 and
anti-BRG1
MCF-7
MCF-7
184hTERT
184hTERT
61
Results
NRF-1 recovered, but no evidence of BRG1,
ARID1A or BAF155 IP
FLAG-NRF-1 recovered, but no evidence of
BRG1, ARID1A or BAF155 IP
FLAG-NRF-1 recovered, but no evidence of
BRG1, ARID1A or BAF155 IP
No evidence of FLAG-BRG1 recovery
BRG1 recovered but degraded during IP, no
evidence of NRF-1, ARID1A or BAF155 IP
No evidence of NRF-1 or BRG1 recovery
probe (Figure 15a). Only the 300 mM KCl fraction was able to reconstitute the binding complex
previously observed on Gb-270 [161], while recombinant NRF-1 was also able to bind to Gb-270
as expected. When the NRF-1 affinity column fractions were assessed by SDS-PAGE, unique
high molecular weight bands (> approximately 100 kDa) were observed in the 300 mM KCl
fraction (Figure 15b). These unique bands were sent for identification via mass spectrometry
(Figure 15c).
3.4.2 Identification of SWI/SNF proteins as members of the NRF-1 binding complex on the
GABPβ promoter
Following in-gel digestion, tryptic peptides from each band (Figure 15c) were analyzed
by mass spectrometry. The proteins identified by ≥ 5 unique peptide hits are listed in Table 4.
As expected, NRF-1 and MBP were among the proteins identified.
However, contrary to
expectations that the proteins identified by mass spectrometry would include members of the
Peroxisome proliferator-activated receptor gamma coactivator 1 (PGC1) family of proteins which
are well-characterized regulators of NRF-1 and GABP expression [104], two proteins from the
SWI/SNF family of transcription regulators were identified – BRG1 and ARID1A.
After
confirming the presence of these proteins in the 300 mM KCl fraction by western blot (Figure
16a), binding of BRG1 and ARID1A to the GABPβ promoter was confirmed via ChIP assay
using MCF-7 chromatin (Figure 16b). In addition to BRG1 and ARID1A, another SWI/SNF
complex member, BAF155, also demonstrated GABPβ promoter binding in the ChIP assay
(Figure 16b). Unfortunately, decreased protein levels of BRG1, ARID1A or BAF155 cannot
account for the low GABPβ expression observed in SK-BR-3 cells [161] as western blot analysis
demonstrated similar protein levels between MCF-7 and SK-BR-3 cells (Figure 16c). This is not
entirely surprising - given the large number of proteins that form a SWI/SNF remodeling complex
[162], low levels of one or more alternate SWI/SNF proteins may be responsible for diminished
62
Figure 15: Isolation of the proteins that form the NRF-1 binding complex on the GABPβ promoter.
(a) MCF-7 nuclear extracts were applied to an NRF-1 affinity column and the fractions collected (refer to
Results) were assessed in an EMSA with Gb-270, a 20-mer oligonucleotide containing the NRF-1 protein
complex binding site [161], as the probe. Binding complexes are indicated (Shift = S), as are recombinant
NRF-1 binding complex (rNRF-1) and free probe (F). (b) Fractions from (a) were concentrated 10-fold,
analyzed by SDS-PAGE (7% acrylamide) and visualized by silver staining. Apparent molecular weight
markers (kDa) are indicated on the left. (c) Following large-scale preparation of NRF-1 binding proteins
from the NRF-1 affinity column, six bands observed in the 300 mM KCl fraction were excised from an
SDS-PAGE gel (7% acrylamide) for analysis by mass spectrometry.
63
Table 4: Identification by mass spectrometry of proteins eluted from the NRF-1 binding column in the 300 mM KCl fraction
Peptides identified per
gel bandb
GI Accession
no.
MW
(kDa)
Functiona
N
5
4
3
2
1
126695
43
Recombinant MBP-NRF-1
38
10
8
9
6
14
12643732
54
Recombinant MBP-NRF-1
13
2
4
1
1
7
Possible global transcription activator SNF2L4 (SNF2-beta) (BRG1 protein) (Brahma protein homolog 1)
1711407
185
SWI/SNF
0
0
0
39
0
0
SWI/SNF-related, matrix-associated, actin-dependent regulator of
chromatin subfamily F member 1 (B120) (ARID1A)
12643538
206
SWI/SNF
0
0
0
0
22
6
Possible global transcription activator SNF2L2 (SNF2-alpha)
(BRM)
1711406
181
SWI/SNF
0
0
0
10
0
0
Possible global transcription activator SNF2L1
134584
115
SWI/SNF
7
0
0
0
0
0
Chromodomain helicase-DNA-binding protein 4 (CHD-4) (Mi-2
autoantigen 218 kDa protein) (Mi2-beta)
5921744
218
NuRD complex
0
0
0
0
9
11
Paired amphipathic helix protein Sin3a
37999759
145
HDAC complex
0
11
0
0
0
0
Transcription intermediary factor 1-beta (TIF1-beta) (Tripartite
motif protein 28) (Nuclear corepressor KAP-1)
3183179
89
NCoR complex
7
0
0
0
0
0
Poly [ADP-ribose] polymerase-1 (PARP-1) (ADPRT) (NAD(+)
ADP-ribosyltransferase-1) (Poly[ADP-ribose] synthetase-1)
130781
113
DNA damage repair
Regulation of chromatin
5
0
0
0
0
0
38258929
469
Double-strand break repair
Interacts with PARP-1
0
1
0
0
0
41
113001
281
Actin binding protein
0
0
0
0
49
39
Protein
Maltose-binding protein
Nuclear respiratory factor-1 (NRF-1)
SWI/SNF subunits and interacting proteins
DNA-dependent protein kinase catalytic subunit (DNA-PKcs)
(DNPK1)
Filamin A (Alpha-filamin) (Filamin 1) (Endothelial actin-binding
protein) (ABP-280) (Nonmuscle filamin)
64
Table 4 continued
Peptides identified per
gel bandb
GI Accession
no.
MW
(kDa)
Functiona
N
5
4
3
2
1
12231019
183
DNA methyltransferase
0
1
11
49
0
0
2498434
141
Binds RNA and can induce
heterochromatin formation
0
29
0
0
0
0
2493433
284
Cytoskeleton
0
0
0
0
14
4
8928568
214
Double-strand break repair
0
0
0
0
0
7
20981698
101
Helicase
5
0
0
0
0
0
38605529
438
Histone acetyltransferase
0
0
0
0
0
12
12644130
332
Intercellular junctions
0
0
0
0
13
0
1730009
266
Nuclear pore complex
0
0
0
0
0
10
12643730 (+1)
127
Nucleotide excision repair
10
0
0
0
0
0
6226894
90
Pre-mRNA processing
7
0
0
0
0
0
Microtubule-associated protein 4 (MAP 4)
20455500
121
Promotes microtubule
assembly
0
0
2
13
0
0
Splicing factor 3 subunit 1 (Spliceosome associated protein 114)
(SAP 114) (SF3a120)
2498882
89
Splicing factor
7
0
0
0
0
0
Protein
Non-SWI/SNF proteins
DNA (cytosine-5)-methyltransferase 1 (Dnmt1) (DNA
methyltransferase HsaI) (DNA MTase HsaI) (MCMT) (M.HsaI)
Vigilin (High density lipoprotein-binding protein) (HDL-binding
protein)
Spectrin alpha chain, brain (Spectrin, non-erythroid alpha chain)
(Alpha-II spectrin) (Fodrin alpha chain)
Tumor suppressor p53-binding protein 1 (p53-binding protein 1)
(53BP1)
DNA replication licensing factor MCM2 (Nuclear protein BM28)
Transformation/transcription domain-associated protein (350/400
kDa PCAF-associated factor) (PAF350/400) (STAF40)
Desmoplakin (DP) (250/210 kDa paraneoplastic pemphigus
antigen)
Nucleoprotein TPR
DNA damage binding protein 1 (Damage-specific DNA binding
protein 1) (DDB p127 subunit) (DDBa) (XAP-1)
Heterogenous nuclear ribonucleoprotein U (hnRNP U) (Scaffold
attachment factor A) (SAF-A)
65
Table 4 continued
Peptides identified per
gel bandb
Protein
GI Accession
no.
MW
(kDa)
Functiona
N
5
4
3
2
1
729094
164
Transcription factor
0
0
0
16
0
0
20140909
142
Transcription factor
0
4
11
0
0
0
113576
69
Unknown
0
0
0
0
11
0
39932549
133
Unknown
0
0
0
0
0
13
12643409
95
Unknown
8
0
0
0
0
0
Non-SWI/SNF proteins continued
CCAAT displacement protein (CDP) (Cut-like 1)
Zinc finger transcription factor Trps1 (Zinc finger protein GC79)
(Tricho-rhino-phalangeal syndrome type I protein)
Serum albumin precursor
[Segment 2 of 2] Neuroblast differentiation associated protein
AHNAK (Desmoyokin)
Matrin 3
a Functions as per RefSeq and [179-181]
b Gel bands as per Figure 15c, N = MBP-NRF-1
66
Figure 16: Identification of BRG1, ARID1A and BAF155 as members of the NRF-1 binding complex
on the GABPβ promoter
(a) Fractions collected from the NRF-1 affinity column (refer to Figure 15) were assessed by western blot
to confirm the presence of BRG1 and ARID1A in the 300 mM KCl fraction. Apparent molecular weight
markers (kDa) are indicated to the right of the panels. (b) A ChIP assay was performed using MCF-7
chromatin and antibodies against acetylated histone H3K9 (acH3), haemagglutinin (HA, negative control),
NRF-1, ARID1A, BRG1, BAF155 and OCT-4 (also known as POU5F1, POU class 5 homeobox 1,
transcription factor, negative control). PCR products obtained using primers specific to the GABPβ
promoter [161] are shown. (c) The protein levels of BRG1 and ARID1A were assessed by western blot in
whole cell lysates prepared from the indicated cell lines. BAF155 levels were assessed in nuclear extracts
from the indicated cell lines. TATA binding protein (TBP) was assessed as an internal control. Apparent
molecular weight markers (kDa) are indicated to the right of the panels.
67
GABPβ expression in SK-BR-3 cells. The protein levels of BRG1, ARID1A and BAF155 were
also assessed in other breast cell lines for comparison. Similar to MCF-7 cells, T-47D and ZR751 are breast cancer cell lines that are positive for Estrogen receptor α (ERα) and Progesterone
receptor (PR) [182], however it has been reported that T-47D cells do not express ARID1A
[183,184]. 184hTERT and MCF-10A are immortalized but non-transformed mammary epithelial
cell lines that were included in our survey to represent “normal” mammary epithelium [142,185].
Interestingly, compared to MCF-7 and SK-BR-3 cells, BRG1, ARID1A and BAF155 protein
levels were shown to be much lower in all other cell lines assessed (Figure 16c). Previous
evaluations of SWI/SNF family members in human breast cancer cell lines reported that BRG1
and ARID1A levels are similar among MCF-7, SK-BR-3 and ZR75-1 cells, but BAF155 levels
are diminished in SK-BR-3 and ZR75-1 cells [186]. Thus, our results are similar to previous
reports, and discrepancies may be attributed to cell culture drift.
3.4.3 Binding of BRG1, ARID1A and BAF155 to the GABPβ promoter
To verify binding of BRG1, ARID1A and BAF155 to the GABPβ promoter at the NRF-1
binding site, a series of EMSAs were performed. Initially, Gb-270 and two mutant versions of
Gb-270, mT4 and mT5, were selected as probes (Figure 17a) [161]. The mutant oligonucleotides
were employed as they have non-conservative single nucleotide replacements (i.e. C to T) at
positions 4 and 5 in Gb-270 which have been shown to disrupt the formation of the full protein
complex yielding smaller binding complexes that retain NRF-1. Without all the members of the
large protein complex, these smaller complexes presumably expose additional epitopes that
facilitate antibody binding and supershift detection in EMSAs. Gb-270, mT4 and mT5 probes
were used to form binding complexes with 184hTERT nuclear extracts in the absence and
presence of antibodies to BRG1 and ARID1A. The presence of a BRG1 antibody supershifted
(SS) a faster migrating binding complex (S) observed with mT4 (Figure 17b) confirming binding
68
Figure 17: Binding of BRG1 and ARID1A to the GABPβ promoter.
A series of EMSAs were performed with a variety of nuclear extracts, and Gb-270, as well as mutant
versions of Gb-270, as probes. Binding complexes (Shifts = S), binding complexes super-shifted by
antibodies (SS), non-specific binding complexes (NS) and free probe (F) are indicated. (a) The NRF-1
consensus sequence [106], and the sequences of Gb-270 and mutant oligos are shown [161]. Gb-270
mutants were prepared with non-conservative single nucleotide replacements (i.e. C to T and G to A) at
positions 4, 5 and 6 (mT4, mT5, mA6). Mutations are in lowercase and bold. (b) EMSA performed in the
presence of no antibody (0), BRG1 antibody from Santa Cruz (B1), BRG1 antibody from Abcam (B2) and
ARID1A antibody (A). (c) Binding complexes formed in the presence of cJUN (J) or ARID1A (A)
antibodies or no antibody (0) as a negative control. (d) EMSA performed with MCF-7 (M), SK-BR-3 (SK)
and T-47D (T) nuclear extracts. The large binding complex is denoted S1, with a faster migrating complex
denoted S2.
69
of BRG1 to the GABPβ promoter. In addition, the same complex observed with mT4 (S)
appeared diminished and supershifted (albeit to a lesser degree) in the presence of the ARID1A
antibody indicating that ARID1A also binds to the GABPβ promoter (Figure 17b).
ARID1A binding was further supported by another EMSA in which Gb-270 was used to
probe MCF-7 and SK-BR-3 nuclear extracts in the absence and presence of antibodies to cJUN
(as a negative antibody control) and ARID1A.
In this instance, the ARID1A antibody
supershifted (SS) a binding complex (S) observed with MCF-7 nuclear extracts in the absence of
antibody or in the presence of cJUN, and modified the pattern and degree of binding observed
with SK-BR-3 nuclear extracts (S, Figure 17c). Because T-47D cells do not express ARID1A
(Figure 16c) [183,184], Gb-270 was used to probe T-47D nuclear extracts as well as MCF-7 and
SK-BR-3 nuclear extracts.
This assay revealed a modified binding pattern in T-47D cells
compared with MCF-7 cells, i.e. a disruption of the large binding complex (S1) to yield a doublet
(S1 and S2) similar to the bands observed in SK-BR-3 cells (Figure 17d), again suggesting that
ARID1A binds to the GABPβ promoter.
While these initial experiments indicated that SWI/SNF family members could be part of
the protein complex that forms on the GABPβ promoter, additional results seemed contradictory.
The original supershift observed using mT4 and 184hTERT nuclear extracts in the presence of
BRG1 and ARID1A antibodies (Figure 17b) could not be duplicated despite increasing the
amount of protein, combining the antibodies with anti-NRF-1, and using poly dG:dC in lieu of
dI:dC (Appendix A1, A2 and A3). Furthermore, a BRG1 antibody was unable to supershift any
binding complexes in an EMSA performed with Gb-270, mT4 and mT5 probes and MCF-7 and
SK-BR-3 nuclear extracts (Figure 18a). The supershift observed using Gb-270 to probe MCF-7
nuclear extracts in the presence of anti-ARID1A (Figure 17c) could not be duplicated, nor was
there any supershift with mT4 or mT5 probes (Figure 18b) or with SK-BR-3 nuclear extracts
70
Figure 18: Binding of BRG1 and ARID1A to the GABPβ promoter (continued).
A series of EMSAs were performed as outlined in Figure 17. (a) Binding complexes were formed with
MCF-7 (M) or SK-BR-3 (SK) nuclear extracts in the absence (-) or presence (+) of the BRG1 antibody
from Abcam. (b) EMSA performed in the absence (-) or presence (+) of the ARID1A antibody.
71
(Appendix A4 and A5). Neither anti-BRG1 nor anti-BAF155 was able to supershift complexes
formed between T-47D nuclear extracts and Gb-270, mT4, mT5 and another mutant
oligonucleotide mA6 (Figures 17a and 19) [161], and no supershift was observed using MCF-7 or
SK-BR-3 nuclear extracts and Gb-270, mT4, mT5 and mA6 probes in the presence of antiBAF155 (Appendix A5). Anti-BAF155 was also unable to supershift complexes formed between
184hTERT nuclear extracts and mT4 (Appendix A2). Thus, given the conflicting data, additional
experiments were undertaken to verify the role of the SWI/SNF proteins in GABPβ regulation.
3.4.4 Effects of exogenous BRG1 and loss of BRG1, ARID1A and NRF-1 on GABPα, GABPβ and
BRCA1 protein levels
Previous work had established a NRF-1 > GABPβ > BRCA1 transcriptional network,
whereby loss of NRF-1 via siRNA caused decreased GABPβ and BRCA1 protein levels [161].
To examine the effects of BRG1 on this regulatory pathway, MCF-7 cells were transfected with
an expression vector as well as a siRNA for BRG1. Western blot analysis on the transfected
whole cell lysates confirmed overexpression and knockdown of BRG1, respectively (Figure 20a).
While overexpression of BRG1 had no effect on GABPα or GABPβ levels, likely as a result of
saturating levels of BRG1 already present in MCF-7 cells, loss of BRG1 coincided with
decreased GABPβ levels, where each protein was reduced to approximately 50% (normalized
with the TBP loading control, Figure 20a). Loss of BRG1 had no effect on GABPα levels
consistent with BRG1 being a specific co-activator of GABPβ expression.
In a follow-up experiment where MCF-7 cells were again transfected with a siRNA
against BRG1 as well as one against ARID1A, western blot analysis confirmed knockdown of
BRG1 and ARID1A, as well as decreased BRG1 expression following loss of ARID1A (Figure
20b). Surprisingly, BRG1 knockdown did not affect GABPβ levels as previously observed, and
no decrease in BRCA1 levels was detected. ARID1A knockdown coincided with decreased
72
Figure 19: Binding of BRG1 and BAF155 to the GABPβ promoter.
An EMSA was performed as outlined in Figure 17. Binding complexes were formed in the presence of
antibodies to BRG1 (B, from Santa Cruz) or BAF155 (155) or no antibody (0) as a negative control.
73
Figure 20: Effects of exogenous BRG1 and loss of BRG1, ARID1A and NRF-1 on GABPα, GABPβ
and BRCA1 protein levels.
Protein levels in whole cell lysates from transfected cells were analyzed by western blot. TBP was
assessed as an internal control. Apparent molecular weight markers (kDa) are indicated to the right of the
panels. (a) BRG1, GABPα and GABPβ levels were analyzed in MCF-7 cells transfected with p3XFlag
(EV, negative control) and pCMV5 BRG1-Flag (hBRG1), as well as siRNA against GAPDH (siGAPDH,
negative control) and BRG1 (siBRG1). (b) Western blot analysis of MCF-7 cells transfected with
siGAPDH, siBRG1 and a siRNA against ARID1A (siARID1A). (c) Western blot performed on lysates
from T-47D cells transfected with siGAPDH, siBRG1 and a siRNA against NRF-1 (siNRF-1). (d) Western
blot analysis of 184hTERT cells transfected with siGAPDH, siBRG1 and siARID1A.
74
BRCA1 levels, although no effect on GABPα or GABPβ was observed.
To clarify these
conflicting results, additional experiments were performed in T-47D cells. The fact that T-47D
cells do not express ARID1A (Figure 16c) [183,184] implied that loss of NRF-1 or BRG1 in
these cells would have greater effects on GABPβ and BRCA1 protein levels than observed in
MCF-7 cells. However, while loss of NRF-1 in T-47D cells decreased BRCA1 protein levels,
GABPβ levels remained unchanged, and loss of BRG1 decreased the protein levels of both
GABPβ and BRCA1 but only by 50% and 30%, respectively (Figure 20c). Because positive
EMSA results were initially obtained using 184hTERT nuclear extracts (Figure 17b), loss of
BRG1 and ARID1A were evaluated in this cell line as an alternative to MCF-7 and T-47D cells.
Transfection of 184hTERT cells with siBRG1 decreased ARID1A protein levels, and moderately
affected GABPβ levels but did not diminish GABPα or BRCA1 levels (Figure 20d). In fact, loss
of BRG1 coincided with increased BRCA1 levels. Loss of ARID1A in 184hTERT cells did not
decrease GABPα, GABPβ or BRCA1 protein levels (Figure 20d). Thus, there is some indication
of BRG1 and ARID1A regulating GABPβ and BRCA1 expression, but variation between cell
lines and experiments could imply that the regulation is temporal, sensitive to protein
levels/modifications and/or cell line-specific.
3.4.5
Effects of exogenous BRG1 and loss of BRG1, ARID1A and NRF-1 on GABPβ and
BRCA1 promoter activity
Because evidence suggested that BRG1 and ARID1A were members of the NRF-1
binding protein complex that regulates GABPβ expression, a series of dual luciferase assays were
performed to examine the effects of these proteins on GABPβ promoter activity.
Two
GABPβ promoter constructs, -268 which contains the NRF-1 binding site and -251 which does
not [161], were assayed in MCF-7 cells in the presence of siRNAs against BRG1 and GAPDH
75
(Glyceraldehyde 3-phosphate dehydrogenase) as a negative control. The activity of -268 was
significantly decreased to approximately 50% in the presence of siBRG1, while the activity of 251 decreased by approximately 10% indicating that BRG1 regulated GABPβ promoter activity
at the NRF-1 binding site (Figure 21a). However, contradictory results were obtained when
MCF-7 cells were transfected a second time with siRNAs against GAPDH, BRG1 and NRF-1. In
this instance, the activities of both -268 and -251 were decreased by siBRG1 and siNRF-1, but
only siNRF-1 significantly decreased -268 activity (Figure 21b).
Subsequent attempts to
recapitulate the decrease in -268 activity following BRG1 knockdown were unsuccessful. Loss
of BRG1, both alone and in conjunction with loss of NRF-1, did not significantly decrease -268
promoter activity in MCF-7, SK-BR-3 or 184hTERT cells (Appendix A6 and A7).
Exogenous expression of BRG1 produced a small to moderate increase in -268 activity in
MCF-7 and SK-BR-3 cells, and in the case of MCF-7, a statistically significant increase in -251
activity (Figure 21c). The lack of substantial activation of -268 by exogenous BRG1 was
observed in an additional experiment with SK-BR-3 cells (Appendix A8) and can likely be
explained by saturating levels of endogenous BRG1 in both of these cell lines. Knockdown of
ARID1A did not affect the promoter activities of -268 or -251 in MCF-7 (Figure 21d) or
184hTERT cells (Appendix A7). Finally, knockdown of BRG1 did significantly decrease the
activity of the BRCA1 promoter construct L6-pRL in 184hTERT cells, and although loss of
BRG1 did diminish the L6-pRL activity in MCF-7 and T-47D cells, it was not statistically
significant (Figure 21e). Unfortunately, siBRG1 did not decrease the BRCA1 promoter activity in
MCF-7 cells in a repeat experiment, and an observed decrease in T-47D cells was not statistically
significant (Appendix A9). Thus, there is support for BRG1 regulating GABPβ and BRCA1
promoter activity, but similar to the western blot analyses (Figure 20), variation between
experiments and cell lines prohibit definitive conclusions.
76
Figure 21: Effects of exogenous BRG1 and loss of BRG1, ARID1A and NRF-1 on GABPβ and
BRCA1 promoter activity.
The transcriptional activity of the GABPβ or BRCA1 proximal promoter was assessed via dual luciferase
assay. Two GABPβ promoter constructs were employed, -268 which contains the NRF-1 binding site and 251 which does not [161]. The BRCA1 promoter construct L6-pRL [57] encompasses the minimal
promoter element [54] including the critical EcoRI Bandshift (RIBS) site which interacts with GABP [55].
Promoter activity is expressed as relative light units except where indicated with the mean and standard
deviation of three replicates shown. (a) MCF-7 cells were transfected with siRNA against GAPDH
(siGAPDH, negative control) and BRG1 (siBRG1). (b) MCF-7 cells were transfected with siGAPDH,
siBRG1 and a siRNA against NRF-1 (siNRF-1). (c) MCF-7 and SK-BR-3 cells were transfected with
p3XFlag (EV, negative control) and pCMV5 BRG1-Flag (hBRG1). (d) MCF-7 cells were transfected with
siGAPDH and a siRNA against ARID1A (siARID1A). (e) The cell lines indicated were transfected with
siGAPDH and siBRG1. L6-pRL activity is presented in relation to negative controls (siGAPDH) for each
cell line. P-values from paired one-sided t-tests are shown. * statistically significant, p < 0.05.
77
3.4.6 Evaluation of BRG1, ARID1A and BAF155 binding to Gb-290 versus Gb-270
Given the conflicting results regarding the regulation of GABPβ by the SWI/SNF
proteins, additional experiments were performed to verify the specificity of BRG1, ARID1A and
BAF155 binding on the GABPβ promoter, i.e. to demonstrate that these proteins actually interact
with NRF-1 and regulate GABPβ transcription. A series of co-immunoprecipitation experiments
were unable to demonstrate an interaction between NRF-1, BRG1, ARID1A and BAF155
(summarized in Table 3), therefore a “Bandshift Western” was performed to assess whether
BRG1 was present in the NRF-1-containing bandshift complex that we observed with the Gb-270
binding site. This technique uses a standard EMSA procedure to create DNA-protein complexes
which are then analyzed by western blotting of the proteins from the EMSA non-denaturing gel.
In principle, if the protein-oligonucleotide interaction influences the ability of the protein to
migrate into the gel, the protein will only be detected by immunoblot in the presence of the
oligonucleotide. This confirms the presence of specific protein components in these complexes.
In our Bandshift Western, another oligonucleotide representing the GABPβ promoter from
position -290 to -271 (Gb-290) [161] was employed in an EMSA alongside Gb-270 to act as a
negative (non-specific) control. Increasing amounts of the two oligonucleotides were used to
probe MCF-7 nuclear extracts and, as expected, the degree of protein binding increased as the
amount of probe increased (Figure 22a).
unlabeled oligonucleotides.
A duplicate EMSA gel was then prepared with
The proteins were transferred from this gel to a nitrocellulose
membrane and the levels of NRF-1 (as a positive control) and BRG1 were assayed by western
blot. Ideally, neither NRF-1 nor BRG1 would be detected by western blot in the absence of
probe, nor in the presence of Gb-290, instead the levels of both proteins would increase with
increasing amounts of Gb-270. This would indicate that both NRF-1 and BRG1 could bind Gb270 specifically, and would support their interaction on the GABPβ promoter at the NRF-1
binding site. Although the levels of BRG1 increased with increasing amounts of Gb-270, the
78
Figure 22: Evaluation of BRG1 and NRF-1 column fraction binding to Gb-290 versus Gb-270.
Gb-290 represents position -290 to -271 in the GABPβ promoter, i.e. upstream of the NRF-1 binding site
[161]. (a) An EMSA was performed using MCF-7 nuclear extracts and increasing amounts of Gb-270 and
Gb-290 as probes. Binding complexes (Shifts = S), non-specific binding complexes (NS) and free probe
(F) are indicated. (b) An additional EMSA was performed as per (a) with the exception that the
oligonucleotides were not radiolabelled. The proteins from this duplicate gel were transferred to a
nitrocellulose membrane which was then used to evaluate the levels of NRF-1 and BRG1 by western blot.
(c) Fractions collected from the NRF-1 affinity column (refer to Figure 15) were analyzed by EMSA with
Gb-270 and Gb-290 probes. Binding complexes are indicated as in (a).
79
same effect was noted with Gb-290, and BRG1 was detected in the absence of both probes,
implying the binding was non-specific (Figure 22b). However, because the positive control,
NRF-1, demonstrated no specific binding to Gb-270, i.e. NRF-1 was detected in the absence of
Gb-270 and Gb-290, and the protein levels remained unchanged in the presence of increasing
amounts of both Gb-270 and Gb-290, this experiment was inconclusive.
Finally, the NRF-1 affinity column fractions were probed in an EMSA with Gb-270 and
Gb-290 to evaluate the specificity of binding of the 300 mM KCl fraction. While a large binding
complex was observed for the 300 mM KCl fraction in the presence of both Gb-270 and Gb-290
(Figure 22c), this fraction contains many known and unknown proteins, and thus, it cannot be
unequivocally stated that the SWI/SNF proteins identified by mass spectrometry bind nonspecifically to the GABPβ promoter.
3.5 Discussion
Interrogating the basis of GABPβ and BRCA1 downregulation in the ErbB2overexpressing cell line, SK-BR-3, required identification of the NRF-1 binding proteins
responsible for co-regulation of the GABPβ promoter. A mixture of NRF-1 binding proteins
isolated using an NRF-1 affinity column and capable of GABPβ promoter binding in vitro were
subjected to mass spectrometric peptide sequencing. Among the proteins identified by >20
unique peptide sequences were BRG1 and ARID1A. These two proteins belong to the SWI/SNF
family which are known to form large multi-subunit complexes that use the energy from ATP
hydrolysis to modify nucleosome structure [179]. Either BRG1 or Brahma (BRM) functions as
the central ATPase of these complexes, and although these two enzymes have similar sequences
and activities in vitro [163,187,188], they have been shown to have different roles in various
cellular processes such as proliferation and differentiation [189-191]. In addition to BRG1 or
BRM, SWI/SNF complexes contain a core of requisite BRG1/BRM-associated factors (BAFs) as
80
well as variant protein subunits. The core subunits are BAF170, BAF155, BAF60, BAF57,
BAF53, BAF47, BAF45 and actin [192], and the variant subunits categorize SWI/SNF into BAF
or Polybromo-associated BAF (PBAF) complexes. BAF complexes can contain either ARID1A
or ARID1B [183,193], and PBAF complexes contain BRG1, BAF200, BAF180 and
Bromodomain containing 7 (BRD7) [194-196]. It is also noteworthy that in mammals many of
the BAF subunits are encoded by gene families [197] and in some cases, BAF- and PBAFspecific subunits have been found in the same complex [198].
Thus, not surprisingly,
accumulating evidence indicates that the composition of the SWI/SNF complex is important for
tissue-, cell- and promoter-specific regulation.
Although other proteins were identified by mass spectrometry, our chromatin
immunoprecipitation experiment verified that BRG1, ARID1A and BAF155 bind to the GABPβ
promoter. Notably, our results were consistent with genome-wide transcription factor ChIPsequencing
(ChIP-seq)
data
accessed
via
the
UCSC
Genome
Browser
website
(http://genome.ucsc.edu/, human genome assembly NCBI36/hg18) [199] which demonstrated
BRG1, BAF155, BAF170 and BAF47 binding to the GABPβ proximal promoter in the same
region as NRF-1.
An interaction between NRF-1 and the SWI/SNF complex is novel but
consistent with the evidence that these nucleosome remodelling complexes are recruited to
activate or repress specific gene targets via association with DNA-binding transcription factors
[179]. Moreover, a link between SWI/SNF activity and mitochondrial function has already been
established. NRF-1 and GABP, which regulate the expression of many nuclear genes required for
the maintenance and function of the mitochondrial respiratory apparatus, can be co-activated by
PGC1α [104]. PGC1α belongs to a family of coactivators that transmit environmental signals to
the transcriptional machinery governing mitochondrial biogenesis [200] and it has been shown
that PGC1α can interact with the SWI/SNF complex via BAF60a to regulate genes involved in
81
hepatic lipid homeostasis [201]. Interestingly, BAF60a can induce the expression of several
nuclear-encoded mitochondrial genes, such as subunits of the electron transport chain [201],
which would support a direct or indirect interaction with NRF-1 and/or GABP although this has
yet to be demonstrated.
A direct interaction with the SWI/SNF complex has already been demonstrated for
BRCA1. Two members of the PBAF complex, BRG1 and BRD7, directly and independently
bind BRCA1 to co-regulate its transcriptional targets [37,202]. Microarray-based expression
profiling indicates that BRD7 may be involved in the regulation of up to 30% of BRCA1 targets
[202]. For example, BRD7 recruits BRCA1 and POU class 2 homeobox 1 (POU2F1) to the
ERα promoter to activate transcription [202]. It has been proposed that BRD7 anchors BRCA1
to the DNA and this allows BRCA1 to recruit the SWI/SNF complex via BRG1 [202]. It has also
been shown by co-IP that BRCA1 can bind exogenous BRM, however the functional implications
of this interaction in vivo have not been evaluated [203]. Given that SWI/SNF proteins may be
recruited by NRF-1 to co-regulate GABPβ and consequently BRCA1, the interaction of BRCA1
with the SWI/SNF complex is intriguing as it provides a plausible feedback mechanism. In fact,
consistent with feedback regulation, previous work has revealed that the SWI/SNF complex
negatively regulates the BRCA1 promoter. Baker et al. demonstrated that unphosphorylated ETS2 (v-ets erythroblastosis virus E26 oncogene homolog 2) binds BRG1 via its pointed domain, and
recruits the SWI/SNF complex to the BRCA1 promoter to repress transcription [204]. This is
particularly interesting as ETS-2 and GABP are both members of the ets family of transcription
factors and as such, GABPα and ETS-2 share a highly conserved DNA binding domain, as well
as a “pointed” domain which mediates protein-protein interactions [71]. While we had previously
demonstrated that GABPα binds to the RIBS element of the BRCA1 promoter and activates
transcription in MCF7 cells [55], Baker et al. showed that overexpression of exogenous ETS-2 in
82
MCF7 cells could repress BRCA1 transcription [204]. Because GABPα and ETS-2 recognize the
same sequence in the BRCA1 promoter, it appears they compete for binding. If GABPα binds
BRG1 via its pointed domain as has been shown for ETS-2 [204], GABP and ETS-2 may activate
or repress BRCA1 transcription, respectively, by recruiting the SWI/SNF complex to the RIBS
element.
Because BRCA1 is a tumour suppressor, SWI/SNF activation of BRCA1 transcription is
consistent with observations that loss of SWI/SNF subunits promotes tumour formation and
progression.
For example, approximately 10% of mice heterozygous for BRG1 develop
predominantly mammary carcinomas [169], BAF180 mutations have been identified in breast
cancer cell lines and tumours [205], and decreased expression of BRD7 has been reported in
human breast tumours [206]. In addition, ARID1A is mutated in approximately 50% of ovarian
clear cell carcinomas, one of the most lethal subtypes of ovarian cancer [171,172].
Since
mutation and decreased expression of ARID1A has been detected in preneoplastic lesions, it has
been proposed that this is an early event in the transformation of endometriosis into cancer [171].
Recently, a comprehensive examination of somatic mutations in breast tumour genomes
identified driver mutations in the genes for ARID1A, ARID1B and ARID2, among others [207].
Consistent with this report, low levels of ARID1A mRNA have been detected in breast cancer
tissue [184], and decreased ARID1A expression has been demonstrated in 55% of invasive ductal
breast carcinomas [208]. Interestingly, diminished ARID1A levels correlates with the ERα-,
PR-, ErbB2- (triple negative) molecular subtype [208] which is consistent with the fact that
BRCA1 regulates ERα transcription [36,202] and decreased BRCA1 expression is also associated
with triple negative tumours [31-33].
BRCA1 has many cellular roles consistent with its tumour suppressor function [136,137],
but it is still unclear why a deficiency in BRCA1 is predominantly tumourigenic in breast and
83
ovarian cells. With respect to the mammary epithelium, it has been proposed that the role of
BRCA1 in stem/progenitor cell differentiation underlies its tumourigenic specificity [41]. Loss of
BRCA1 has been shown to result in an increase in the mammary stem/progenitor and
myoepithelial cell populations and a decrease in the luminal epithelial cell population [49], and
BRCA1 mutation carriers have an increased luminal progenitor population [50]. Given that
BRCA1 plays a role in genomic stability, the expanded stem/progenitor populations are likely to
undergo further transforming events. Consistent with this role for BRCA1 in differentiation, the
SWI/SNF complexes are also implicated in the regulation of stem and progenitor proliferation
and differentiation.
Highlighting their importance during embryogenesis, BRG1, ARID1A,
BAF155 or BAF47 homozygous knockouts exhibit embryonic lethality [189,209-213] as do
GABPα, GABPβ, NRF-1 or BRCA1 knockouts [74,75,135,151]. A SWI/SNF complex specific to
embryonic stem (ES) cells has been characterized and named “esBAF” [214]. In addition to
standard core subunits such as BRG1, BAF60A, BAF57, BAF53A, BAF47, BAF45 and actin,
this complex has some unique features [196,214,215]. Unlike other SWI/SNF complexes that
contain the homologues BAF155 and BAF170 in stoichiometric amounts, esBAF contains only
BAF155. Because decreased proliferation and increased apoptosis induced by BAF155 depletion
in ES cells cannot be rescued by exogenous BAF170, it is clear that BAF155 is critical for esBAF
function [214].
Evidence also suggests that the complex contains BAF180, BAF200, and
predominantly ARID1A, although ARID1B may also be present [196,214,215]. The esBAF
complex is required for ES cell self-renewal and pluripotency as knockout or knockdown of
BRG1, ARID1A, ARID1B or BAF155 results in reduced proliferation and an inability to maintain
an undifferentiated state [213-216]. The consequences of esBAF disruption has been attributed to
the fact that it regulates self-renewal and pluripotency genes such as OCT-4, Sex determining
region Y-box 2 (SOX2) and NANOG, as well as functionally interacting with these transcription
factors to coregulate their target genes [213-217]. Interestingly, GABP has also been shown to
84
regulate OCT-4 expression in ES cells through activation of OCT-4 transcription and
downregulation of OCT-4 transcriptional repressors, i.e. Caudal type homeobox 2 (CDX-2),
Nuclear receptor subfamily 2, group F, member 1 (NR2F1) and Nuclear receptor subfamily 6,
group A, member 1 (NR6A1) [86].
Upon differentiation of ES cells, BRM and BAF170 expression increases while ARID1A,
BAF200 and BAF155 expression decreases implying that SWI/SNF subunit switching may drive
differentiation [196,214,215]. Similar changes in subunit composition have also been implicated
in tissue-specific differentiation programs such as neural differentiation, heart and muscle
development, immune system development and hematopoiesis [197].
With respect to the
ATPases, BRG1- and BRM-containing complexes have been shown to antagonistically regulate
osteogenesis, i.e. BRG1 promotes differentiation whereas BRM restrains differentiation [218].
BRG1 has also been implicated in promoting the differentiation of lung cells [219], and BRG1
knockdown in MCF-10A cells results in a failure to form acini supporting a role in mammary
epithelial cell differentiation [220].
Thus, the diverse functions of SWI/SNF nucleosome
remodellers are achieved through combinatorial variety, and the oncogenic drive caused by
SWI/SNF deficiencies may be derived from the involvement of these complexes in regulating the
balance of self-renewal and differentiation.
Despite promising initial results consistent with genome-wide ChIP-seq data, as well as
theoretical validity for SWI/SNF involvement in the NRF-1 > GABP > BRCA1 transcriptional
network, confirmation of GABPβ regulation by SWI/SNF proteins proved elusive. However, this
does not preclude a role for a SWI/SNF complex in activating GABPβ transcription in
conjunction with NRF-1. Closer examination of the NRF-1 binding proteins identified by mass
spectrometry reveals that approximately 37% are SWI/SNF subunits or proteins known to interact
with SWI/SNF subunits (Table 4). This strongly supports the ability of SWI/SNF proteins to
bind directly to NRF-1. While co-IP experiments could not demonstrate an interaction between
85
NRF-1, BRG1, ARID1A or BAF155 (Table 3), it is possible that appropriate epitopes were
masked and thus unavailable for antibody pull-down. It is also possible that NRF-1 binding is
mediated by another subunit of the SWI/SNF complex that we did not identify because proteins
less than 100 kDa were excluded from mass spectrometric analysis.
The contradictory results obtained using ChIP, EMSA, western blot and dual luciferase
assays do not conclusively demonstrate the inability of BRG1, ARID1A and BAF155 to bind and
regulate the GABPβ promoter. SWI/SNF complexes regulate a large number of target genes in a
highly context dependent fashion [197], and some targets only require SWI/SNF binding for
maximal induction and thus, may not be present on the promoter at all times [221]. In addition, it
is likely that multiple BAF subunits coordinately mediate gene-specific interactions [179]. We
and others have shown that SWI/SNF subunits vary between breast cancer cell lines
[183,184,186] and this could cause cell line-specific discrepancies in gene regulation by
SWI/SNF complexes.
Given the parallel roles of many of the SWI/SNF family members,
functional redundancy may have produced false negative results in our siRNA knockdown
experiments. For example, BRM can compensate for BRG1 loss in Retinoblastoma protein (RB)
signaling pathways suggesting a redundancy between the two ATPases [222,223]. Moreover,
SWI/SNF complexes function as chromatin remodelers but transient DNA templates, such as
those used in short-term transfection assays, may not always be organized as chromatin
[224,225]. In fact, promoters may have already adopted an “open” conformation and would not
require SWI/SNF binding [217]. The lack of a clear functional assay employing chromatin
templates with all of the histone modifications and complexity of the actual genomic sites
required for nucleosome remodelling may have prohibited conclusive demonstration of GABPβ
transcription regulation by a SWI/SNF complex.
Nevertheless, given the inconclusive results of this study, it is plausible that NRF-1 binds
to SWI/SNF complex(es) but not in the context of GABPβ regulation. The positive results
86
obtained in ChIP and EMSA experiments may have been artifacts of the DNA-binding capability
of SWI/SNF complexes [179]. Finally, it cannot be ruled out that SWI/SNF proteins do not bind
to NRF-1 or regulate the GABPβ promoter. Two of the proteins identified by mass spectrometry,
Poly(ADP-ribose) polymerase-1 (PARP-1) and DNA-dependent protein kinase catalytic subunit
(DNAPKcs), have been shown to form a complex with Ku80, Ku70 and Topoisomerase IIβ that
binds NRF-1 via PARP-1 and regulates transcription of NRF-1 targets [226].
Additional
experiments will be required to ascertain if the PARP-1 complex can activate GABPβ
transcription. Alternatively, PARP-1 may have mediated SWI/SNF subunit isolation from the
NRF-1 column through its ability to bind both NRF-1 and BRG1 [180]. Ultimately, the true
regulators of the GABPβ promoter may lie undiscovered within the 300 mM KCl fraction, and
analyzing the entire fraction rather than select SDS-PAGE bands by mass spectrometry might
finally reveal their identity.
3.6 Conclusions
Similar to BRCA1, the involvement of SWI/SNF complexes in tissue-specific
differentiation may underlie the tumourigenic capacity of SWI/SNF subunit deficiency. Evidence
in this report implicated SWI/SNF proteins BRG1, ARID1A and BAF155 in the co-regulation of
GABPβ, a regulator of BRCA1, though the NRF-1 binding site. The ability of SWI/SNF proteins
to interact with PCG1α, a known coactivator of NRF-1 and GABP, as well as documented
interactions between BRCA1 and SWI/SNF family members at the gene and protein levels,
support the validity of these proteins as coregulators of the GABPβ promoter. However, due to
conflicting results, additional experiments are required to clarify the role of the SWI/SNF proteins
in the NRF-1 > GABP > BRCA1 transcriptional network.
87
3.7 Acknowledgements
We are indebted to Dr. Chris Adams at the Vincent Coates Foundation Mass
Spectrometry Laboratory, Stanford University Mass Spectrometry (http://mass-spec.stanford.edu)
for identification of NRF-1 binding proteins. We would also like to thank Sherri Nicol, Valerie
Kelly-Turner, Rachael Klinoski and Christina Lamparter for their excellent technical assistance.
This work was funded by a grant from the Canadian Breast Cancer Foundation – Ontario Region,
as well as a Fellowship to CT from the Canadian Breast Cancer Foundation – Ontario Region.
88
Chapter 4
Basal versus luminal progenitor cell differentiation: a comparison of
MCF-10A and 184hTERT cells in three-dimensional culture
4.1 Abstract
Background: Evidence suggests that the human mammary epithelium exists as a
hierarchy in which both mature luminal and myoepithelial cells are generated by mammary stem
cells via a series of lineage-restricted intermediates. The prevailing concept in breast cancer
etiology is that transformation of a distinct cell within the hierarchy leads to the formation of a
“cell-of-origin” with an associated tumour subtype and clinical outcome. Therefore, elucidating
the pathways of differentiation will contribute to our understanding of transformation and provide
insight into more effective diagnosis and therapy. Three-dimensional (3D) culture systems are
one of the tools used by cancer biologists to evaluate normal and aberrant differentiation. In this
study, we profiled and compared a well-characterized cell line, MCF-10A, to another
immortalized but non-transformed mammary epithelial cell line, 184hTERT, as an in vitro 3D
model of mammary epithelial differentiation.
Results: Cell surface expression of EpCAM and CD49f, as well as intracellular ALDH
activity and ALDH1A3 expression indicate that MCF-10A cells are predominantly stem/bipotent
progenitors that differentiate into a mixed population of luminal progenitors and mature luminal
epithelial cells.
Conversely, undifferentiated 184hTERT cells contain a high proportion of
luminal progenitors that differentiate into mature luminal cells. Evaluation of BRCA1 expression
and location revealed that BRCA1 is found in the nucleus in the early stages of acini
differentiation before being downregulated and relocated to an apical position.
89
Conclusions: Evidence suggests a role for BRCA1 in the nucleus in the early stages of
differentiation. Given that the cell of origin in BRCA1-deficient tumours may be a luminal
progenitor, the 184hTERT cell line may be a more appropriate model to investigate the role of
BRCA1 in mammary epithelial differentiation and transformation.
The fact that only
undifferentiated 184hTERT cells, which are predominantly luminal progenitors, are positive for
ALDH1, calls the specificity of this stem cell specific-antibody into question.
4.2 Background
The adult human mammary gland is a specialized structure with a complex organization.
The gland is comprised of a branching network of ducts that radiate away from the nipple to end
in clusters of small ductules (the terminal ductal lobular units) [6,227]. The ductal network,
which is nestled in a collagenous and fatty stroma, is characterized by an inner layer of polarized
luminal epithelial cells surrounded by a basal layer of contractile myoepithelial cells that lie
adjacent to the basement membrane. According to the hierarchical model of differentiation in the
breast epithelium, both mature luminal and myoepithelial cells are generated by mammary stem
cells, which reside in the basal layer and are hormone-receptor negative [12,228], via a series of
lineage-restricted intermediates. The luminal lineage is further divided into ductal cells which
line the ducts, and alveolar cells that arise during pregnancy [6]. Mature luminal cells express
hormone receptors and cytokeratins (CK) 8, 18 and 19, whereas mature myoepithelial cells
express smooth muscle actin (SMA), CK5 and CK14 [229,230].
Given the expansion and renewal of the breast epithelium that occurs during puberty and
pregnancy, the biology of the mammary gland is consistent with a hierarchical arrangement of
cells. However, recent evidence has revealed that the hierarchy is more complex than originally
believed. A multipotent stem cell that is substantially expanded during pregnancy, presumably to
drive the requisite increase in alveolar cells, has been identified and proposed to exist as a short90
term repopulating cell [231].
Moreover, genetic lineage-tracing experiments in the mouse
mammary gland under physiological conditions have revealed that the post-natal luminal and
myoepithelial lineages are maintained by unipotent stem cells [232]. These results suggest that
there is a complex hierarchy of stem cells in the mammary gland.
It is possible that the
multipotent mammary stem cell believed to reside at the apex of the hierarchy is only required
during embryonic development and does not normally contribute to the homeostasis of the adult
mammary gland [233].
In addition to these revelations about the stem cell population, the unidirectional nature of
the hierarchy has also been challenged.
Myoepithelial cells have been shown to adopt a
multipotent fate and generate a new mammary gland upon transplantation into the mammary fat
pad of non-obese diabetic/severe combined immune deficiency (NOD/SCID) mice [232].
Furthermore, differentiated mammary epithelial cells have been shown to convert to a stem-like
state in vitro in an apparently stochastic manner without genetic manipulation [234]. Thus it
seems that at least some of the cells in the mammary epithelium have an intrinsic phenotypic
plasticity giving the hierarchy a bidirectional nature. Despite these alterations to the classical
hierarchical model of differentiation, the prevailing concept in breast cancer etiology is that
transformation of a distinct cell within the hierarchy leads to the formation of a “cell-of-origin”
with an associated tumour subtype and clinical outcome [6]. Therefore, elucidating the pathways
of differentiation that are disrupted in tumours will contribute to our understanding of
transformation and provide insight into more effective diagnosis and therapy.
Three-dimensional (3D) culture systems are one of the tools used by cancer biologists to
evaluate normal and aberrant differentiation. Certain protocols for 3D culture of immortalized
non-transformed mammary epithelial cell lines involve culturing the cells on reconstituted
basement membrane [235,236]. This provides the appropriate environment for the cells to
differentiate into growth-arrested acini-like spheroids, each one with a hollow lumen and
91
apicobasal polarization, thereby recapitulating characteristics of the breast epithelium. Disruption
of normal differentiation caused by manipulation of gene expression is easily detected as gross
phenotypic alterations reminiscent of tumour pathology, i.e. disorganized, proliferative and nonpolar epithelial cell clusters [235,236]. Thus, 3D culture assays offer a flexible, physiologically
relevant ex vivo alternative to mouse models or human tissue for analysis of gene function in
tumourigenesis.
In this study, a well characterized cell line, MCF-10A, was profiled and compared to
another immortalized but non-transformed mammary epithelial cell line, 184hTERT [142], as an
in vitro 3D model of mammary epithelial differentiation. We demonstrated that undifferentiated
184hTERT cells consist of a large population of luminal progenitor cells and show higher
aldehyde dehydrogenase (ALDH) activity than MCF-10A cells which are predominantly basal.
In addition, only undifferentiated 184hTERT cells are positive for the stem cell marker, ALDH1,
and expression of ALDH1 is lost when the cells are grown as acini on reconstituted basement
membrane. In both MCF-10A and 184hTERT cell lines, expression of Breast cancer 1 early
onset (BRCA1) decreases as the acini differentiate. Interestingly, downregulation of BRCA1
expression corresponds with the formation of the lumen and the movement of BRCA1 from a
nuclear to an apical position. This novel observation strongly implies a nuclear role for BRCA1
in the early stages of mammary epithelial cell differentiation.
4.3 Methods
Methods are outlined in Thompson et al. [161] with the following additions.
4.3.1 Three-dimensional acini culture
MCF-10A and 184hTERT cells were cultured as 3D acini on reconstituted basement
membrane as previously described [235,236]. Following the “overlay method”, Growth Factor
Reduced MatrigelTM (Matrigel, catalogue no. 354230, BD Biosciences, Mississauga, Canada) was
92
spread evenly in each well (40 µL/well for 8-well glass chamber slides, and 50 µL/well for 12well plates). Cells were resuspended at 1.25 × 105 cells/mL in assay medium (DMEM F12 with
L-glutamine, 2% horse serum, 0.5 µg/mL hydrocortisone, 100 ng/mL cholera toxin, 10 µg/mL
insulin, 100 units/mL penicillin, 100 µg/mL streptomycin and 5 ng/mL epidermal growth factor)
containing 2% Matrigel, then plated on the solidified Matrigel layer already in the well. Assay
medium containing 2% Matrigel was replaced every 4 days. Following the “embedded method”,
Matrigel was spread in each well as described above. Cells were resuspended at 3.3 × 104
cells/mL in assay medium containing 33% Matrigel and plated on the solid Matrigel layer in each
well. Assay medium was layered over the embedded cells and changed every 4 days.
4.3.2 Preparation of whole cell lysates from acini
Whole cell lysates were prepared based on previously reported methods [236]. Acini
were washed twice with ice cold phosphate buffered saline (PBS; 137 mM sodium chloride
(NaCl), 2.7 mM potassium chloride (KCl), 10 mM sodium phosphate dibasic (Na2HPO4) and 2
mM potassium phosphate monobasic (KH2PO4)), then incubated on ice with shaking in PBS
containing 10 mM ethylenediaminetetraacetic acid (EDTA) and protease/phosphatase inhibitors
(1% apropotin, 1 mM dithiothreitol, 1 µg/mL leupeptin, 1 µg/mL pepstatin, 0.1 mM
phenylmethanesulphonylfluoride (PMSF), 1 mM sodium fluoride, 1 mM sodium orthovanadate
and 20 mM β-glycerophosphate). The acini were flushed from the Matrigel bottom layer by
pipetting and transferred to a centrifuge tube. Cells were pelleted at 150g for 5 min at 4°C, then
lysed in SDS loading buffer (2.5% SDS, 25 mM Tris-HCl pH 6.8, 10% glycerol and
protease/phosphatase inhibitors).
4.3.3 Antibodies
The following primary antibodies were employed for western blot: anti-ALDH1-BD
(clone 44/ALDH, 1:250, BD Transduction LaboratoriesTM, BD Biosciences), anti-ALDH1A3 (C93
13, 1:200, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti-Estrogen receptor α (ERα;
H-184, 1:500, Santa Cruz Biotechnology).
The following antibodies were used for
immunofluorescence: anti-BRCA1 (0P92, 1:50, Calbiochem, San Diego, CA, USA), anti-CD49f
(ab75737, 1:50, Abcam, Cambridge, MA, USA), anti-ERα (H-184, 1:100, Santa Cruz
Biotechnology), Alexa Fluor® 488 Goat Anti-Rabbit IgG (H+L) (A-11034, 1:500, Molecular
Probes®, Life Technologies Inc., Burlington, Canada) and Alexa Fluor® 594 Goat Anti-Mouse
IgG (H+L) (A-11032, 1:500, Molecular Probes®, Life Technologies Inc.).
The following
antibodies were used for flow cytometry: Phycoerythrin (PE)-conjugated anti-CD49f (clone
GoH3, BioLegend Inc., San Diego, CA, USA) and Fluorescein isothiocyanate (FITC)-conjugated
anti-Epithelial cell adhesion molecule (EpCAM; clone VU-1D9, STEMCELL Technologies Inc.,
Vancouver, Canada).
4.3.4 Quantitative RT-PCR
Quantitative RT-PCR reactions were performed using the TaqMan® assay (Life
Technologies Inc.) with 25 ng RNA per reaction according to the manufacturer’s instructions.
Probe/primer pairs were used for human ALDH1A3 (HS00167476-m1, FAM) and human TATA
binding protein (TBP; 4326322E, VIC) as an internal control. The PCR protocol consisted of 1
cycle of (15 min at 50°C and 2 min at 95°C), followed by 40 cycles of (15 sec at 95°C, 30 sec at
60°C). ALDH1A3 expression was calculated relative to the results for the 184hTERT cell line
using the delta-delta Ct method presented by PE Applied Biosystems (Perkin Elmer, Forster City,
CA, USA).
4.3.5 Immunofluorescence
Immunofluorescence (IF) procedures were based on previous reports [235,236]. Acini in
8-well chamber slides were washed with IF-PBS (130 mM NaCl, 7 mM Na2HPO4 and 3.5 mM
sodium phosphate monobasic (NaH2PO4)), then fixed with 2% paraformaldehyde (Fisher,
94
Nepean, Canada) for 20 min at room temperature. Following fixation, the acini were washed
once with IF-PBS containing 100 mM glycine for 15 min at room temperature, then washed twice
with IF-PBS. The acini could be stored at this step in IF-PBS at 4°C for up to one week. Cells
were permeabilized in Triton X-100 (0.5% for MCF-10A and 4% for 184hTERT) for 15 min at
room temperature, and rinsed 3 × 15 min in IF-PBS containing glycine. Cells were blocked for
1.5 h at room temperature in IF Buffer (IF-PBS, 7.7 mM sodium azide (NaN3), 0.1% bovine
serum albumin (BSA), 0.2% Triton X-100 and 0.05% Tween-20) containing 10% normal goat
serum (Sigma, Oakville, Canada), then incubated overnight at 4°C with primary antibodies
diluted in blocking solution. The acini were washed 3 × 20 min in IF Buffer. All of the
remaining steps were performed in the dark. Cells were incubated with Alexa Fluor® secondary
antibodies for 1 h at room temperature and washed 3 × 20 min in IF Buffer. Acini were stained
with Hoechst 33258 (1:5000, Molecular Probes®, Life Technologies Inc.) for 15 min, rinsed with
IF-PBS for 5 min and stored in IF-PBS at 4°C in the dark. Images were acquired using a Quorum
Wave FX spinning disk confocal microscope (Quorum Technologies, Inc.). Alexa Fluor® 488
and 594 were excited at 488 and 594 nm, and detected at 525 and 610 nm (± 20 nm), respectively.
Hoechst was excited at 405 nm and detected at 450 ± 20 nm. The imaging software was
MetaMorph® Microscopy Automation & Image Analysis Software (Molecular Devices, Inc.,
Sunnyvale, CA).
4.3.6 ALDEFLUOR assay
The ALDEFLUOR® assay was performed according to manufacturer’s instructions
(STEMCELL Technologies Inc.). Cells were analyzed using a Beckman Coulter Epics Altra
HSS flow cytometer.
95
4.3.7 Flow cytometry
Cells grown on 100 mm plates were incubated in PBS containing 5 mM EDTA at 37°C
until they rounded. The cells were lifted from the plate via gentle scraping and pipetting,
transferred to a conical tube containing regular medium and centrifuged at 150g for 5 min. All
remaining steps were performed on ice. The cells were washed and resuspended at 0.1-1 × 107
cells/mL in ice cold PBA (PBS, 5% BSA and 0.1% NaN3), then aliquotted into 12 × 75 mm
polystyrene round-bottom Falcon® tubes (100 µL per tube) (VWR, Mississauga, Canada). All
remaining steps were performed in the dark. The cells were incubated with 20 µL of each
antibody for 30 min, washed and resuspended in 0.5 mL PBA. Cells were analyzed using a
Beckman Coulter Epics Altra HSS flow cytometer. FITC was excited at 488 nm and detected at
525 ± 20 nm, and PE was excited at 488 nm and detected at 575 ± 20 nm.
4.4 Results
4.4.1 MCF-10A and 184hTERT cells have different protein expression profiles during acini
formation and differentiation
To profile and compare MCF-10A and 184hTERT cell lines as models of mammary
epithelial cell differentiation, the cells were cultured as 3D acini on a basement membrane matrix,
Matrigel. Whole cell lysates were prepared from the acini throughout differentiation, and protein
expression was assessed via western blot alongside lysates prepared from MCF-10A and
184hTERT cells grown on plastic as undifferentiated monolayer (M) (Figure 23).
The
monoclonal anti-ALDH1 antibody produced by BD Transduction LaboratoriesTM (anti-ALDH1BD) is widely employed as a marker of normal and cancer stem cells and is believed to recognize
aldehyde dehydrogenase 1A1 (ALDH1A1) [237]. Interestingly, undifferentiated 184hTERT cells
expressed ALDH1-BD and this expression was lost when the cells formed acini, consistent with
an expected loss of “stemness” as cells differentiate. In contrast, neither undifferentiated nor
96
Figure 23: Protein expression profiles of MCF-10A and 184hTERT cells throughout acini formation
and differentiation.
MCF-10A and 184hTERT cells were harvested after growth on plastic as a monolayer (M) or after the
indicated number of days of acini formation and growth (e.g. Day 2 = D2) on Matrigel. Lysates were
assayed via western blot for expression of ALDH1-BD, ALDH1A3, BRCA1, ERα, GABPα, GABPβ,
NRF-1, EZH2 and TBP (as an internal control). P and β represent phosphorylated and unphosphorylated
GABPβ, respectively. ND, not done. Apparent molecular weight markers (kDa) are indicated to the right
of the panels. Independent experiments were performed three times with one representative replicate
shown. Lysates prepared by Crista Thompson and Sherri Nicol. Western blots performed by Rachael
Klinoski.
97
differentiated MCF-10A cells expressed ALDH1-BD suggesting these cells are more mature than
184hTERT cells in the undifferentiated state. MCF-10A and 184hTERT cells also differ in the
expression pattern of the most prominently expressed aldehyde dehydrogenase in the normal
human breast, ALDH1A3 [238]. The ALDH1A3 expression observed in MCF-10A monolayer
culture was substantially reduced on Day 2 (Figure 23, D2) and lost on Day 4 (D4) before
returning throughout the remaining days of acini differentiation, albeit at much lower levels than
observed in the monolayer, while ALDH1A3 expression was lost in 184hTERT acini by Day 8
(D8).
Because upregulation of ALDH1A3 expression has recently been associated with
commitment of mammary stem cells to the luminal lineage [238], this would suggest that in
opposition to the ALDH1-BD results, MCF-10A acini begin as a basal (more stem-like)
population and differentiate into a mixed population of luminal progenitors and mature luminal
cells, whereas 184hTERT cells are luminal progenitors that differentiate into mature luminal
cells. However, both cell lines differentiate into ERα-positive cells (Figure 23).
Loss of the tumour suppressor BRCA1, either by germ-line mutation or decreased
expression, is associated with breast and ovarian tumourigenesis [51]. In addition to its many
cellular functions, evidence suggests that BRCA1 acts as a regulator of mammary
stem/progenitor cell differentiation [12,48-50]. Consistent with such a role, BRCA1 was detected
in the monolayer and early timepoints of acini differentiation (Figure 23). In fact, there was a
specific increase in BRCA1 expression on Day 2 (D2) of 184hTERT acini formation. However
as differentiation progressed, BRCA1 expression decreased to undetectable levels in both MCF10A and 184hTERT cell lines (Figure 23). BRCA1 is at the end of transcriptional network
comprised of Nuclear respiratory factor-1 (NRF-1) > GA Binding Protein (GABP) [161]. GABP
is comprised of two subunits – GABPα, which contains the DNA-binding domain, and GABPβ,
which contains the nuclear localization signal and transcriptional activation domain
[62,63,66,67].
In MCF-10A cells, GABPα levels remained constant throughout acini
98
differentiation, whereas GABPβ levels dropped at Day 2 (D2) before increasing up to Day 12
(D12). NRF-1 levels also increased up to Day 12 (D12). In 184hTERT cells, GABPα, GABPβ
and NRF-1 increased up to Day 15 (D15), with the notable exception of Day 4 (D4) where
GABPα expression was lost (Figure 23).
Interestingly, decreased GABPα (184hTERT) or
GABPβ (MCF-10A) expression preceded loss of BRCA1 suggesting that diminished GABP
expression results in the downregulation of BRCA1 in the early stages of differentiation. Because
changes in ALDH1A3, GABP and NRF-1 protein levels were detected following the decrease in
BRCA1, downregulation of BRCA1 expression appears to mark a transition event in
differentiation, e.g. the onset of polarization or survival signalling in the outer cells of the acini
[235]. The increase in GABP and NRF-1 suggests they are performing other roles in the later
stages of differentiation such as regulating the switch from glycolysis to oxidative
phosphorylation [104].
4.4.2 BRCA1 and ERα localization differs in MCF-10A and 184hTERT acini throughout
differentiation
To further characterize and compare the MCF-10A and 184hTERT cell lines as models
of differentiation, acini morphology and the localization of BRCA1 and ERα were examined
throughout differentiation via immunofluorescence. Acini were formed in 8-well chamber slides
and fixed at various timepoints throughout differentiation. Fixed acini were immunostained for
BRCA1, ERα and/or the basal marker CD49f (also referred to as Integrin α6), and nuclei were
counterstained with Hoechst dye. A consecutive series of cross-sectional images of the acini
were acquired using a confocal microscope, but only the equatorial cross sections are shown to
demonstrate hollowing of the lumen and apicobasal positioning of proteins of interest (Figures 24
99
Figure 24: BRCA1 localization in MCF-10A and 184hTERT acini throughout differentiation.
MCF-10A and 184hTERT acini were fixed at various timepoints throughout growth/differentiation and
immunostained for BRCA1 (red) or CD49f (green). Nuclei were counterstained with Hoechst dye (blue).
Confocal microscopy images of the equatorial plane of the acini are shown. Experiment was performed
once by Crista Thompson.
100
Figure 24 continued
101
Figure 24 continued
102
Figure 24 continued
103
and 25). Similar to previous reports [235], Hoechst staining revealed that the MCF-10A cells
clustered in the early stages of differentiation before the inner cells died by apoptosis leaving a
ring of outer cells surrounding a hollow lumen. The lumen was clearly visible by Day 4 and the
acini increased in size incrementally up to Day 8. In contrast, 184hTERT cells remained as
clusters until Day 6 when the lumen became visible. The 184hTERT acini increased in size up to
Day 15, at which point they were twice as large as MCF-10A acini. Both MCF-10A and
184hTERT acini exhibited apicobasal polarity at Day 6 as indicated by the position of CD49f, a
known basal marker [235] (Figure 24, Day 6).
Interestingly, lumen formation coincided with changes in BRCA1 localization, as well as
decreased BRCA1 expression, particularly in 184hTERT acini. Before the lumen became clearly
visible as indicated by Hoechst staining, BRCA1 was predominantly in the nucleus (Figure 24,
184hTERT Days 2 and 4) and its expression was detectable by western blot (Figure 23,
184hTERT D2 and D4). However, when the lumen formed, BRCA1 moved to an apical position
(Figure 24, 184hTERT Day 6) and was no longer detected by western blot (Figure 23, 184hTERT
D8). Although BRCA1 expression was downregulated by approximately 7-fold between Day 4
and Day 8 in 184hTERT acini (Appendix A10), the confocal microscope was calibrated for
optimal signal detection which permitted BRCA1 visualization throughout differentiation. The
apical position and decreased expression of BRCA1, which were observed in both 184hTERT
and MCF-10A lines, were maintained throughout the remaining days of acini maturation. While
observing BRCA1 in the nucleus is consistent with a recent report that BRCA1 plays a role in the
maintenance of constitutive heterochromatin [40], an apical position is consistent with evidence
that BRCA1 disrupts microtubule assembly at the centrosomes which reposition to apical
locations during MCF-10A differentiation [239]. It has been postulated that BRCA1 facilitates
the reorganization of microtubules from centrosomes to adherens junctions which, in turn,
regulates epithelial cell-to-cell contacts that polarize the cells and promote differentiation [239].
104
Figure 25: ERα localization in MCF-10A and 184hTERT acini at Day 15.
MCF-10A and 184hTERT acini were fixed at Day 15 and immunostained for ERα (green). Nuclei were
counterstained with Hoechst dye (blue). Confocal microscopy images of the equatorial plane of the acini
are shown. Experiment was performed once by Crista Thompson.
105
Our results suggest that differentiation is biphasic where the transition between the phases is
driven by changes in BRCA1 expression and localization, e.g. BRCA1 is initially highly
expressed in the nucleus to stimulate differentiation by promoting heterochromatinization before
being downregulated and relocated to an apical position to promote polarization concomitant with
lumen formation.
The localization of ERα also differed between MCF-10A and 184hTERT cell lines
(Figure 25). In MCF-10A acini, ERα was more prominent and predominantly cytoplasmic in
certain cells within the structure. The cell-to-cell variation in the expression levels of ERα in
MCF-10A acini reflects the heterogeneity observed in the luminal cells of the breast [240],
however its cytoplasmic location indicates it is not bound to estrogen or regulating gene
expression. In contrast, ERα was predominantly nuclear and evenly distributed throughout the
cells of the 184hTERT acini suggesting hormone engagement and gene regulation by the
receptor. Because ERα expression and signaling are associated with more differentiated/mature
luminal epithelial cells [241], the increased expression and ability of ERα to be stimulated by
estrogen in 184hTERT but not MCF-10A acini may reflect their relative positions in the
mammary epithelial hierarchy after differentiation, i.e. 184hTERT are mature luminal cells
whereas MCF-10A are a mixed population of luminal progenitors and mature luminal cells.
4.4.3 Undifferentiated MCF-10A and 184hTERT cells are comprised of different mammary
epithelial cell subtypes
Despite the fact that both cell lines are capable of acini formation, differences in
morphology and protein expression throughout differentiation implied that MCF-10A and
184hTERT cells might represent different mammary epithelial subtypes.
As previously
mentioned, the anti-ALDH1-BD antibody has been widely adopted to identify stem and cancer
stem cells, i.e. cells within the basal population. Similarly, increased ALDH activity has also
106
been associated with the stem cell population [237]. Thus, to corroborate the presence of
ALDH1-BD in undifferentiated 184hTERT but not MCF-10A cells (Figure 23), the ALDH
activity of the cell lines was measured using a non-immunological fluorescence-based method,
the ALDEFLUOR® assay.
In this assay, cells are incubated with BAAA (BODIPY® -
aminoacetaldehyde) which is converted to BAA (BODIPY® -aminoacetate) by intracellular
ALDH. BAA is a highly fluorescent compound that is retained intracellularly and thus can be
used to identify cells with ALDH activity by flow cytometry. As a gating control, the assay is
performed in the presence of the ALDH inhibitor diethylaminobenzaldehyde (DEAB).
Consistent with the ALDH1-BD results, 184hTERT cells had the highest ALDH activity (17.9%
ALDH-positive cells) compared with MCF-10A and MCF-7 cells (11.2% and 11.9% ALDHpositive cells, respectively) (Figure 26) suggesting that 184hTERT cells would be characterized
as basal (stem) epithelial cells.
Surprisingly, identification of the mammary epithelial cell subtypes present in
undifferentiated MCF-10A and 184hTERT cells revealed that both cell lines were a mixed
population of basal and luminal progenitor cells (Figure 27). There are three subsets of epithelial
cells found in normal human breast tissue that can be identified and isolated based on differential
expression of CD49f and EpCAM [11,242]. The basal fraction (CD49f+EpCAM¯) contains all
of the mammary stem cells, the bi-lineage progenitors and myoepithelial cells, the primitive
luminal fraction (CD49+EpCAM+) contains all of the luminal-restricted progenitors and some
more differentiated luminal cells, and the mature luminal fraction (CD49f¯EpCAM+) contains
fully differentiated luminal cells [238].
Contrary to expectations, MCF-10A cells were
predominantly basal (91.2%) while 184hTERT cells were almost evenly distributed between
basal and primitive luminal subtypes (45% and 54.8%, respectively). Thus, it appeared that the
primitive luminal fraction, not the basal fraction, correlated with the presence of ALDH1-BD and
107
Figure 26: ALDH activity of MCF-10A, MCF-7 and 184hTERT cells.
The ALDH activity of MCF-10A, MCF-7 and 184hTERT cells was evaluated using the ALDEFLUOR®
assay. Cells were incubated with the ALDH-substrate BAAA which is converted to BAA, a highly
fluorescent compound that is retained intracellularly. The BAA fluorescence profiles are shown for each
cell line in the presence and absence of the ALDH-inhibitor, DEAB as a negative control. Independent
experiments were performed twice with one representative replicate shown. Experiment performed by
Sherri Nicol.
108
Figure 27: Quantification of mammary epithelial cell subtypes in undifferentiated MCF-10A and
184hTERT populations.
Expression of cell surface markers, EpCAM and CD49f, was assessed in MCF-10A and 184hTERT
populations via flow cytometry as a measure of the mammary epithelial cell subtypes present. The basal
fraction (CD49f+EpCAM¯) contains the mammary stem cells and bi-lineage progenitors, the primitive
luminal (Prim.) fraction (CD49+EpCAM+) contains the luminal-restricted progenitors and some of the
more differentiated luminal cells, and the mature luminal (Mat.) fraction (CD49f¯EpCAM+) contains fully
differentiated luminal cells [238]. Experiment was performed once by Crista Thompson.
109
higher ALDH activity. While in opposition to traditional views, these findings are consistent
with recent work by Eirew et al. [238] who determined that mammary stem cells (i.e. the basal
subtype) are characterized by low ALDH activity, but this activity is dramatically increased upon
commitment to the luminal lineage (i.e. the primitive luminal subtype). Eirew et al. attributed the
ALDH activity of the primitive luminal population primarily to ALDH1A3 [238]. Quantitative
RT-PCR and western blot confirmed that undifferentiated 184hTERT cells have significantly
higher ALDH1A3 expression than MCF-10A cells (Figure 28).
4.5 Discussion
Increasing evidence suggests that breast tumours contain a subpopulation of cells capable
of initiating and driving tumour formation [243]. These “tumour-initiating cells” (TICs) have
stem cell properties such as self-renewal and the ability to differentiate, but it is unclear whether
they are derived from the transformation of normal stem cells or if they are the result of dedifferentiation of malignant progeny. Identification of TICs has been of great interest because of
the prognostic and therapeutic implications. While breast TICs were initially isolated on the basis
of cell surface markers, i.e. CD24¯CD44+ [244], Ginestier et al. demonstrated that intracellular
ALDH expression as well as activity determined via the ALDEFLUOR® assay could identify
breast TICs [10]. Moreover, they showed that ALDH expression in breast cancer is a prognostic
marker of poor outcome, and normal human mammary stem cells could be isolated via their
ALDH expression/activity suggesting that TICs are derived from normal stem cells in accordance
with the cancer stem cell theory [10]. At the time, it was presumed that the ALDH activity was
provided by one isoform, ALDH1A1. ALDH1A1 is a member of the human ALDH superfamily
which consists of 19 enzymes that catalyze the NAD(P)+-dependent oxidation of endogenous and
exogenous aldehydes [245]. The ALDH1A family, which is comprised of three highly conserved
cytosolic isozymes (ALDH1A1, ALDH1A2 and ALDH1A3), catalyzes the oxidation of retinal to
110
Figure 28: ALDH1A3 mRNA and protein levels in undifferentiated 184hTERT and MCF-10A cell
lines.
(a) Quantitative RT-PCR for ALDH1A3 expression was performed for undifferentiated 184hTERT and
MCF-10A cells using TBP as an internal control. mRNA levels are shown relative to 184hTERT cells with
the mean and standard deviation of three replicates shown. The p-value from a paired one-sided t-test is
shown. * statistically significant, p < 0.05. (b) Western blot analysis of ALDH1A3 protein levels in
184hTERT and MCF-10A cells grown on plastic as a monolayer. TBP was detected as a loading control.
Apparent molecular weight markers (kDa) are indicated to the right of the panels. Independent
experiments were performed twice with one representative replicate shown. qRT-PCR performed by
Rachael Klinoski and western blot performed by Crista Thompson.
111
retinoic acid (RA), a critical ligand in the breast for processes such as differentiation. In a
subsequent study, Marcato et al. determined that the ALDH activity of breast TICs is primarily
due to ALDH1A3, not ALDH1A1 [246]. This is consistent with evidence that ALDH1A3 is the
retinaldehyde dehydrogenase present in normal human breast epithelium [247], and the fact that
the ALDH1A1 protein cannot be detected in normal breast epithelium [238] or in breast cancer
cell lines (Appendix A11).
Interestingly, separation of normal breast epithelium into three
subpopulations based on the expression of the cell surface markers EpCAM and CD49f revealed
that ALDH1A3 expression is highest in the primitive luminal population, which contains luminal
progenitor cells, whereas the basal fraction, which contains the stem cells, does not express
ALDH1A3 protein [238]. While these findings contradict the concept that TICs are derived from
mammary stem cells with high ALDH activity, the results are consistent with recent work on
BRCA1-related breast cancer. The increased luminal progenitor population observed in BRCA1
mutation carriers [12], and the ability of targeted deletion of BRCA1 in ER-negative luminal
progenitor cells in mice to cause mammary tumours which phenocopy human BRCA1 breast
tumour pathology [50] implicate luminal progenitors as the precursors to TICs.
From a
functional standpoint, the high ALDH activity associated with the luminal progenitors would be
consistent with a role for ALDH1A3 in the production of RA or some other substrate required for
luminal cell differentiation.
In this study, evidence indicates that MCF-10A and 184hTERT cell lines represent
different mammary epithelial subtypes and their respective differentiation lineages when grown
on reconstituted basement membrane. Consistent with previous reports that MCF-10A cells
express markers commonly associated with a basal epithelial phenotype [235], we determined
that undifferentiated MCF-10A are predominantly basal (91.2% CD49f+EpCAM¯, Figure 27).
Because expression of ALDH1A3, which is associated with the luminal progenitor population
[238], increased as the MCF10A acini differentiated (Figure 23), we propose that the basal cells
112
form acini and differentiate into a mixed population of luminal progenitors and mature luminal
cells (Figure 29). The ALDH1A3 protein levels (Figure 23) and ALDH activity measured by the
ALDEFLUOR® assay (Figure 26) in undifferentiated MCF-10A cells can be attributed to the
small primitive luminal fraction detected by flow cytometry (8.5% CD49+EpCAM+, Figure 27).
In contrast, undifferentiated 184hTERT cells are predominantly luminal progenitors (54.8%
CD49+EpCAM+, Figure 27), although there is a high proportion of basal cells (45%). This is
suggestive of a bistable population that likely exhibits a high degree of plasticity, i.e. cells switch
between the basal and luminal progenitor state. Based on the expression of ALDH1A3 which
decreased as the 184hTERT acini differentiated (Figure 23), we propose that the luminal
progenitors form acini that differentiate into mature luminal cells (Figure 29). The higher ALDH
activity measured by the ALDEFLUOR® assay in undifferentiated 184hTERT versus MCF-10A
cells (Figure 26) can be attributed to higher ALDH1A3 expression correlating with a larger
primitive luminal population (Figure 28). Given that the cell of origin in BRCA1-deficient
tumours may be a luminal progenitor [12,50], the 184hTERT cell line may be a more relevant
model to investigate the role of BRCA1 in mammary epithelial differentiation and
tumourigenesis.
Our observation that only undifferentiated 184hTERT cells express ALDH1-BD raises
questions about the specificity of this antibody, routinely used as the “gold standard” for stem cell
identification. Although the antibody was generated against human ALDH1A1, Eirew et al.
[238] were unable to detect ALDH1A1 in normal breast epithelium, and we have not been able to
detect ALDH1A1 expression in any of the breast cancer cell lines routinely employed in our lab
including 184hTERT cells (Appendix A11). Given their high degree of homology at the amino
acid level [248], it is possible that both ALDH1A3 and ALDH1A1 are recognized by antiALDH1-BD.
However, because the expression of ALDH1A3 and ALDH1-BD are not
synchronous throughout 184hTERT differentiation (Figure 23), ALDH1A3 expression alone does
113
Figure 29: MCF-10A and 184hTERT acini model different stages in the mammary epithelial
differentiation hierarchy.
The human mammary epithelium exists as a hierarchy in which both mature luminal and myoepithelial
cells are generated by mammary stem cells via a series of lineage-restricted intermediates. Certain
subpopulations within this hierarchy can be identified based on the expression of the cell surface markers
EpCAM and CD49f. ALDH1A3 expression has been found to be the highest in the primitive luminal
population [238]. Our characterization of 184hTERT and MCF-10A acini throughout differentiation
suggests that undifferentiated (monolayer = M) 184hTERT cells exist as a bistable population of
stem/bipotent progenitors and luminal progenitors. The luminal progenitors seem to initiate acini
formation and by Day 15 (D15), 184hTERT acini are comprised of mature luminal cells. In contrast,
undifferentiated MCF-10A cells are predominantly stem/bipotent progenitors (or a luminal precursor) that
differentiate into a mixed population of luminal progenitors and mature luminal cells by D15. It is likely
that there is some degree of plasticity between stem/bipotent progenitors and luminal progenitors, as well
as between mature luminal cells and luminal progenitors. The fact that only undifferentiated 184hTERTs
are positive for the stem cell marker, ALDH1, suggests that this antibody may actually detect luminal
progenitors but confirmatory experiments are still required.
114
not explain ALDH1-BD detection. Thus, we propose that anti-ALDH1-BD is recognizing an
isoform variant or post-translationally modified ALDH1A3. Multiple isoforms of ALDH1A3
have been identified [249,250], and although post-translational modifications to ALDH1A3 have
not been studied, other ALDH family members have been shown to be S-nitrosylated,
phosphorylated, nitrated and acetylated (reviewed in [251]). We are currently investigating antiALDH1-BD specificity with respect to ALDH1A3.
The possibility that anti-ALDH1-BD
recognizes modified ALDH1A3 raises interesting questions about mammary stem cell identity.
Have normal and malignant committed luminal progenitors been misclassified as multipotent
stem cells? Is anti-ALDH1-BD specific to the recently identified unipotent luminal stem cell
[232]? Why would ALDH1A3 be modified in stem or luminal progenitor cells? Interestingly,
the cells identified by anti-ALDH1-BD reside in the inner luminal layer [10,252], and increased
ALDH1-BD expression has been detected in pre-neoplastic and tumour tissue from BRCA1
mutation carriers [49,253]. Thus, the ALDH activity previously attributed to the mammary stem
cell may actually be a hallmark of the luminal progenitor.
Evidence presented here suggests that mammary luminal epithelial differentiation can be
considered biphasic with the transition between the two phases being driven by changes in
BRCA1 expression and localization. In the first phase of differentiation, BRCA1 is highly
expressed in the nucleus, whereas in the second phase, BRCA1 is downregulated and relocated to
an apical position. A decrease in either of the subunits of GABP, i.e. GABPα in 184hTERTs or
GABPβ in MCF-10As, precedes the decrease in BRCA1 (Figure 23). This implicates diminished
GABP expression in the downregulation of BRCA1. In addition, it exemplifies the control of
GABP function by regulation of either the alpha or beta subunit. However, it is unknown
whether the observed GABP subunit specificity reflects differences in basal versus luminal
progenitor cells or merely differences between 184hTERT and MCF-10A cell lines. Following
BRCA1 downregulation, GABP and NRF-1 protein levels increase in the second phase of acini
115
differentiation. Because GABP and NRF-1 are nuclear respiratory factors [104], this increase in
expression would be consistent with the theory that differentiation is accompanied by a metabolic
shift from glycolysis to oxidative phosphorylation [254]. Although the expression patterns of
BRCA1 and ERα throughout differentiation are incongruous with previous reports that BRCA1
activates transcription of ERα [36], they are consistent with a role for BRCA1 in the degradation
of ERα [255] (Figure 23). It has been shown that the BRCA1-BARD1 (BRCA1 associated
RING domain 1) heterodimer ubiquitinates ERα resulting in its degradation, and as such, ERα is
stabilized by depletion of BARD1 or BRCA1 [255].
Our observation that BRCA1 levels
decrease prior to ERα detection suggests that downregulation of BRCA1 is required for the
stabilization of ERα in the final stages of differentiation.
Recent groundbreaking work has determined that, in conjunction with its binding partner
BARD1, BRCA1 maintains constitutive heterochromatin by monoubiquitinating histone H2A
(H2A-Ub), ensuring the interaction of the modified histone with pericentric heterochromatin and
the concomitant silencing of satellite DNA [40]. The absence of H2A-Ub resulting from BRCA1
deficiency de-represses the chromatin and results in the transcription of pericentric satellite
repeats. Notably, ectopic expression of these satellite transcripts induces the cellular defects
attributed to BRCA1 loss such as centrosome amplification, cell-cycle checkpoint defects, DNA
damage and a deficiency in homologous recombination.
These results implicate satellite
transcripts as the root cause of the genomic instability that follows loss of BRCA1. Moreover,
satellite DNA de-repression has been detected in breast tumours from BRCA1 mutation carriers
emphasizing the clinical relevance of this work [40]. This novel role for BRCA1 may underlie its
ability to regulate mammary luminal epithelial cell differentiation. Global changes in nuclear
architecture occur throughout differentiation, notably with respect to heterochromatin distribution
[256]. Several studies have employed the non-neoplastic human mammary epithelial cell line
HMT-3522 in 3D acini assays and determined that acini formation and differentiation is
116
accompanied by an increase in heterochromatinization and an overall reduction in gene
expression [257-259]. Preventing the formation of heterochromatin via DNA hypomethylation or
histone acetylation disrupts the establishment of acini polarity, induces proliferation and causes
dedifferentiation [257,258]. This suggests that condensation of the chromatin drives normal
differentiation, likely by restricting gene expression to lineage-specific proteins, and is consistent
with a role for BRCA1 in promoting mammary epithelial cell differentiation via
heterochromatinization.
Interestingly, BRCA1 has been shown to have a reciprocal relationship in breast cancer
with another protein involved in heterochromatin formation, Enhancer of zeste homolog 2
(EZH2). EZH2 is a Polycomb group protein that participates in gene repression by specifically
trimethylating lysine 27 of histone H3 [260]. EZH2 overexpression occurs mainly in basal-type
breast tumours [261,262], and is an independent marker of recurrence and metastasis [263]. In
addition, EZH2 expression is elevated in the normal breast epithelium of BRCA1 mutation
carriers [264] and identifies benign breast lesions with increased risk of progression to breast
cancer [265]. Consistent with observations that ER-negative invasive breast carcinomas exhibit
high EZH2 and low BRCA1 expression, overexpression of EZH2 has been shown to cause
nuclear export of BRCA1 [266,267] and BRCA1-deficient mouse and human mammary tumours
show elevated EZH2 expression [268].
When we examined EZH2 expression throughout
184hTERT differentiation, we determined that it is essentially co-regulated with BRCA1,
showing a similar decrease in expression from Day 4 to Day 8 (Figure 23). Because EZH2 has
been associated with stem cell maintenance [269], it is possible that in the normal mammary
epithelium, EZH2 and BRCA1 control the balance of stemness versus differentiation by
regulating heterochromatin formation. Disruption of this balance by EZH2 overexpression or
BRCA1 deficiency is tumourigenic. Although BRCA1 is downregulated and moves from a
nuclear to an apical position during differentiation (Figures 23 and 24), this could reflect the
117
stability of the heterochromatin after a certain point in acini maturation such that BRCA1
function is no longer required. The ability of BRCA1 to drive differentiation by promoting
heterochromatinization is a compelling model as it provides a single function for BRCA1 that can
account for its tumour suppressor role in the breast, including the myriad of cellular defects
associated with BRCA1 loss, as well as the pathology of BRCA1-related tumours. Specifically,
BRCA1 deficiency disrupts heterochromatin formation, causing both a block in normal luminal
cell differentiation and an increase in genomic instability via expression of satellite transcripts,
ultimately promoting generation of the TIC from aberrant luminal progenitors.
4.6 Conclusions
The fact that MCF-10A and 184hTERT cell lines appear to model different stages in the
mammary epithelial differentiation hierarchy may prove useful in evaluating the pathways that
lead to a cell of origin and a particular tumour subtype. The ability of the stem cell marker,
ALDH1, to recognize 184hTERT cells which are predominantly luminal progenitors, may be
significant to the field of mammary stem cell research. If this antibody is recognizing ALDH1A3
in luminal progenitors, this raises questions about stem cell identity and the origins of tumour
initiating cells. While a role for BRCA1 in the nucleus in the early stages of differentiation is
consistent with its known nuclear functions, it will be interesting to see if future studies can
reconcile maintenance of heterochromatin by BRCA1 with its specificity for breast and ovarian
tumours.
4.7 Acknowledgements
We gratefully acknowledge Colleen Schick for guidance in immunofluorescence, and
Jeff Mewburn and Matt Gordon for their technical expertise in confocal microscopy and flow
cytometry. This work was funded by a grant from the Canadian Breast Cancer Foundation –
118
Ontario Region, as well as a Fellowship to CT from the Canadian Breast Cancer Foundation –
Ontario Region.
119
Chapter 5
General discussion
5.1 The NRF-1/GABP/BRCA1 transcriptional network
In the first phase of this project, we established that Breast cancer 1 early onset (BRCA1)
is part of a transcriptional network comprised of Nuclear respiratory factor-1 (NRF-1) and GA
Binding Protein (GABP). Investigation into low BRCA1 expression in the ErbB2 (v-erb-b2
erythroblastic leukemia viral oncogene homolog 2)-overexpressing cell line, SK-BR-3, revealed
that impaired BRCA1 transcription is the result of deficient transcription of one of its established
regulators, GABP [55]. Specifically, low GABPβ transcription destabilizes the GABPα subunit
preventing formation of the GABPα/β heterodimer and activation of the BRCA1 promoter [161].
Both BRCA1 promoter activity and GABPα protein levels and nuclear localization can be rescued
by exogenous GABPβ exemplifying control of GABP functionality at the level of the non-DNA
binding GABPβ subunit (Figure 30). This highlights the versatility of the unique structure of
GABP, i.e. by requiring two distinct proteins to form a functional transcription factor, GABP
activity can be modified by regulating the expression of the alpha or beta subunit. This flexibility
in control may partially account for the ability of this ubiquitous transcription factor to regulate
tissue- and lineage-specific targets.
Having established the cause of diminished BRCA1 expression in SK-BR-3 cells, we
wanted to investigate the molecular basis of GABPβ downregulation.
We determined that
GABPβ transcription is activated by NRF-1 [161] (Figure 30). Furthermore, NRF-1 knockdown
via small interfering RNA (siRNA) decreases both GABPβ and BRCA1 expression indicating
that NRF-1, GABP and BRCA1 form a transcriptionally regulated network. Activation of this
pathway appears to be under strict control as GABPα, GABPβ and BRCA1 are reportedly
120
Figure 30: Feedback regulation of the NRF-1/GABP/BRCA1 transcriptional network.
BRCA1 transcription is regulated by GABP, a transcription factor comprised of two distinct subunits,
GABPα and GABPβ [55]. GABPα stability and nuclear localization are controlled by GABPβ expression
(blue arrow). GABPβ transcription is regulated by NRF-1 [161]. Activation of this pathway appears to be
under strict control as GABPα, GABPβ and BRCA1 are reportedly autoregulated [52,76,87], and genomewide transcription factor ChIP-seq data accessed via the UCSC Genome Browser website
(http://genome.ucsc.edu/, human genome assembly NCBI36/hg18) [199] indicates that NRF-1 is also
autoregulated. Moreover, an NRF-1 site in the GABPα proximal promoter as well as a GABP site in the
NRF-1 promoter suggest additional feedback controls exist [148] (UCSC Chip-seq data).
121
autoregulated [52,76,87], and genome-wide transcription factor chromatin immunoprecipitationsequencing
(ChIP-seq)
data
accessed
via
the
UCSC
Genome
Browser
website
(http://genome.ucsc.edu/, human genome assembly NCBI36/hg18) [199] indicates that NRF-1
may also autoregulate. Moreover, an NRF-1 site in the GABPα proximal promoter as well as a
GABP site in the NRF-1 promoter suggest additional feedback controls exist [148] (UCSC Chipseq data as indicated above) (Figure 30). Interestingly, we determined that NRF-1 protein levels
and activity are not compromised in SK-BR-3 cells. However, experiments employing mutant
versions of the GABPβ promoter suggested that NRF-1 is one member of a protein complex that
activates GABPβ transcription, and that one or more members of this protein complex are
compromised in SK-BR-3 cells causing reduced GABPβ expression.
To investigate the basis for GABPβ and BRCA1 downregulation, we wanted to identify
the additional members of the protein complex that activates the GABPβ promoter in conjunction
with NRF-1. Using an NRF-1 affinity column and mass spectrometry, two proteins from the
Switching defective/Sucrose nonfermenting (SWI/SNF) family of transcriptional regulators were
identified as co-regulators of the GABPβ promoter – Brahma-related gene 1 (BRG1) and AT-rich
interactive domain-containing protein 1A (ARID1A). SWI/SNF proteins regulate transcription
by forming large multi-subunit complexes that are recruited to DNA by transcription factors to
mediate ATP-dependent chromatin remodeling [162]. Experimental evidence suggested that
along with another SWI/SNF family member, BRG1-associated factor 155 (BAF155), BRG1 and
ARID1A participate in the NRF-1 binding protein complex that activates GABPβ. Notably, these
results are consistent with UCSC ChIP-seq data (http://genome.ucsc.edu/, human genome
assembly NCBI36/hg18) [199] which show SWI/SNF family members BRG1, BAF155, BAF170
and BAF47 binding to the GABPβ proximal promoter in the same region as NRF-1. However,
the functional redundancy provided by SWI/SNF subunits and/or the transient/cell-specific nature
122
of the SWI/SNF complexes generated conflicting and inconclusive experimental results which
prohibit definitive conclusions to be made about the ability of the SWI/SNF complex to regulate
GABPβ transcription.
Thus, additional experiments are required to clarify the role of the
SWI/SNF proteins in the NRF-1/GABP/BRCA1 transcriptional network.
5.2 NRF-1, GABP and BRCA1 in mammary epithelial differentiation
In the second phase of this project, we investigated the roles of NRF-1, GABP and
BRCA1 in mammary epithelial differentiation. Because BRCA1 is implicated in mammary cell
fate determination, we proposed that upregulation of the NRF-1/GABP/BRCA1 transcriptional
network would drive mammary epithelial differentiation.
We profiled and compared two
immortalized but non-transformed mammary epithelial cell lines, MCF-10A and 184hTERT, as
in vitro three-dimensional (3D) models of mammary epithelial differentiation.
The results
suggested that MCF-10A cells are predominantly stem/bipotent progenitors that differentiate into
a mixed population of luminal progenitors and mature luminal epithelial cells, whereas
undifferentiated 184hTERT cells contain a high proportion of luminal progenitors that
differentiate into mature luminal cells. The unexpected finding that MCF-10A and 184hTERT
cell lines appear to model different stages in the mammary epithelial differentiation hierarchy
may provide unique opportunities in the future to compare and contrast the pathways that lead to
a particular cell of origin and its associated tumour subtype.
Evaluation of BRCA1 expression and location throughout differentiation revealed that
BRCA1 plays a role in the nucleus in the early stages of acini differentiation before being
downregulated and relocated to an apical position in both MCF-10A and 184hTERT cells.
Interestingly, decreased GABPα (184hTERT) or GABPβ (MCF-10A) expression precedes the
reduction in BRCA1 expression suggesting that diminished GABP expression results in the
downregulation of BRCA1 in the early stages of differentiation. Following the downregulation of
123
BRCA1, GABP and NRF-1 protein levels increase throughout the remaining days of
differentiation indicating they are performing other functions in the later stages of acini
maturation. The observed changes in protein expression suggest that mammary luminal epithelial
differentiation can be considered biphasic with the transition between the two phases being driven
by changes in BRCA1 expression and localization. In the first phase, BRCA1 is highly expressed
in the nucleus to stimulate differentiation by promoting heterochromatinization and/or activating
transcription of its target genes [40,137], and in the second phase, BRCA1 is downregulated and
relocated to an apical position to promote polarization concomitant with lumen formation [239].
The downregulation of BRCA1 appears to be induced by transiently diminished GABP
expression, however the fact that GABP levels increase throughout the remaining days of
differentiation suggests that another mechanism is responsible for maintaining low BRCA1
levels, e.g. methylation of the BRCA1 promoter.
The increase in NRF-1 and GABP expression in the second phase of differentiation
would stimulate expression of their respiratory target genes thereby inducing oxidative
phosphorylation [104]. Oxidative phosphorylation and glycolysis are the two metabolic pathways
employed by the cell to generate ATP.
In the presence of sufficient oxygen, most
nonproliferating, differentiated cells metabolize glucose to pyruvate through glycolysis in the
cytoplasm, and then completely oxidize most of this pyruvate to CO2 through the mitochondrial
tricarboxylic acid cycle where oxygen is the final acceptor in an electron transport chain that
generates an electrochemical gradient facilitating ATP production (oxidative phosphorylation)
[270]. However, when oxygen levels are low, cells redirect the pyruvate produced by glycolysis
away from mitochondrial oxidative phosphorylation by generating lactate (anaerobic glycolysis)
[271].
This permits continued glycolysis although it produces minimal ATP compared to
oxidative phosphorylation.
It has been proposed that differentiation is accompanied by a
metabolic shift from glycolysis to oxidative phosphorylation [254] and this would be consistent
124
with increased expression of NRF-1 and GABP in the second phase of differentiation. The
stabilization of Estrogen receptor α (ERα) resulting from decreased BRCA1 expression in the
second phase of differentiation [255] would also promote NRF-1 and GABP expression and the
onset of oxidative phosphorylation as NRF-1 and GABPβ are transcriptional targets of ERα
[127,128].
It is clear that the process of differentiation requires step-wise adjustments in gene
expression in order to control characteristics such as cell-cell contacts, polarization and
metabolism and generate the specialized structure of the mammary epithelium. No single factor
or pathway drives differentiation, instead the process is a tightly choreographed interplay of
epigenetic and genetic regulators coordinating the cellular functions required for differentiation.
Given their large number of target genes and their roles in diverse functions such as cell cycle
progression and oxidative metabolism, NRF-1 and GABP likely serve as control points for the
coordinated regulation of multiple aspects of mammary epithelial differentiation. In fact, GABP
has already been shown to regulate a variety of genes involved in survival, quiescence, selfrenewal, DNA damage repair, telomere maintenance and differentiation of hematopoietic stem
cells [87] and may have an analogous role in the mammary epithelium. With targets such as
BRCA1, disruption of gene regulation by NRF-1 and/or GABP could play a role in breast
tumourigenesis. Moreover, their well-characterized roles in mitochondrial function imply that
aberrant NRF-1 and/or GABP activity may be instrumental in the abnormal mitochondrial
metabolism that has long been observed in tumours. One of the most extensively studied
metabolic phenotypes of tumours is aerobic glycolysis or the “Warburg effect”. The Warburg
effect is commonly defined as the propensity of tumours to undergo glycolysis and produce
lactate even in the presence of oxygen [272].
This implies that defective oxidative
phosphorylation is a feature of transformation, and as such, could be achieved through the
downregulation of NRF-1 and/or GABP as we have observed in SK-BR-3 cells [161]. In addition
125
to blocking mammary epithelial differentiation by downregulating BRCA1, decreased NRF-1
and/or GABP expression would prevent the switch from glycolysis to oxidative phosphorylation
that accompanies normal differentiation. In this instance, the reliance of the cancer cells on
glycolysis despite the presence of oxygen is a consequence of the aberrant differentiation that
triggered tumour formation, and thus the pathological and metabolic phenotype of the tumour are
molecularly linked via the transcriptional networks that control differentiation.
5.3 Conclusion
One compelling theory in breast cancer research is that the tumour phenotype is dictated
by the hierarchical position of the cell of origin and the pattern of mutations acquired during
transformation. Loss of BRCA1 is associated with a basal-like phenotype consistent with its
proposed role in mammary epithelial differentiation. Our results support an early requirement for
BRCA1 in the nucleus during differentiation and it will be interesting to see if this role is related
to its recently discovered ability to maintain constitutive heterochromatin. Intuitively, control of
cellular metabolism is intrinsically linked with the process of differentiation, thus the metabolic
profile of the cell of origin may also be reflected in the resulting tumour. For example, NRF-1
upregulation is associated with poor outcome in more differentiated luminal A breast tumours
[273] suggesting that the tumours originated in mature luminal cells with high NRF-1 expression
driving oxidative phosphorylation and that this feature has been exploited to promote tumour
growth. Alternatively (and perhaps more likely), transforming mutations re-engineer
mitochondrial activity to promote enhanced survival and growth. Because NRF-1 and GABP are
prime candidates to mediate the integration of differentiation and metabolism, these two proteins
are probable targets of deregulation in tumour initiation and progression.
Future studies
investigating the metabolic profile and the genome-wide gene regulation by GABP and NRF-1 in
normal and malignant mammary epithelial cells will clarify their involvement in differentiation,
126
metabolism and breast tumourigenesis. We hope that elucidating the pathways of differentiation
and metabolism will reveal novel targets for therapeutic intervention and improve the clinical
outcome and quality of life for breast cancer patients.
127
References
1. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H et al.: Gene expression
patterns of breast carcinomas distinguish tumor subclasses with clinical
implications. Proc Natl Acad Sci U S A 2001, 98: 10869-10874.
2. Sorlie T, Tibshirani R, Parker J, Hastie T, Marron JS, Nobel A et al.: Repeated
observation of breast tumor subtypes in independent gene expression data sets. Proc
Natl Acad Sci U S A 2003, 100: 8418-8423.
3. Herschkowitz JI, Simin K, Weigman VJ, Mikaelian I, Usary J, Hu Z et al.: Identification
of conserved gene expression features between murine mammary carcinoma models
and human breast tumors. Genome Biol 2007, 8: R76.
4. Prat A, Parker JS, Karginova O, Fan C, Livasy C, Herschkowitz JI et al.: Phenotypic
and molecular characterization of the claudin-low intrinsic subtype of breast
cancer. Breast Cancer Res 2010, 12: R68.
5. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire WL: Human breast
cancer: correlation of relapse and survival with amplification of the HER-2/neu
oncogene. Science 1987, 235: 177-182.
6. Visvader JE: Keeping abreast of the mammary epithelial hierarchy and breast
tumorigenesis. Genes Dev 2009, 23: 2563-2577.
7. Pegram MD, Konecny G, Slamon DJ: The molecular and cellular biology of
HER2/neu gene amplification/overexpression and the clinical development of
herceptin (trastuzumab) therapy for breast cancer. Cancer Treat Res 2000, 103: 5775.
8. Buckley NE, Mullan PB: BRCA1 - Conductor of the breast stem cell orchestra: the
role of BRCA1 in mammary gland development and identification of cell of origin of
BRCA1 mutant breast cancer. Stem Cell Rev 2012, 8: 982-993.
9. Shackleton M, Vaillant F, Simpson KJ, Stingl J, Smyth GK, Asselin-Labat ML et al.:
Generation of a functional mammary gland from a single stem cell. Nature 2006,
439: 84-88.
10. Ginestier C, Hur MH, Charafe-Jauffret E, Monville F, Dutcher J, Brown M et al.:
ALDH1 is a marker of normal and malignant human mammary stem cells and a
predictor of poor clinical outcome. Cell Stem Cell 2007, 1: 555-567.
11. Eirew P, Stingl J, Raouf A, Turashvili G, Aparicio S, Emerman JT et al.: A method for
quantifying normal human mammary epithelial stem cells with in vivo regenerative
ability. Nat Med 2008, 14: 1384-1389.
128
12. Lim E, Vaillant F, Wu D, Forrest NC, Pal B, Hart AH et al.: Aberrant luminal
progenitors as the candidate target population for basal tumor development in
BRCA1 mutation carriers. Nat Med 2009, 15: 907-913.
13. Stingl J, Eaves CJ, Zandieh I, Emerman JT: Characterization of bipotent mammary
epithelial progenitor cells in normal adult human breast tissue. Breast Cancer Res
Treat 2001, 67: 93-109.
14. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S et al.: A
strong candidate for the breast and ovarian cancer susceptibility gene BRCA1.
Science 1994, 266: 66-71.
15. Chen S, Parmigiani G: Meta-analysis of BRCA1 and BRCA2 penetrance. J Clin Oncol
2007, 25: 1329-1333.
16. Lakhani SR, Jacquemier J, Sloane JP, Gusterson BA, Anderson TJ, Van De Vijver MJ et
al.: Multifactorial analysis of differences between sporadic breast cancers and
cancers involving BRCA1 and BRCA2 mutations. J Natl Cancer Inst 1998, 90: 11381145.
17. Palacios J, Honrado E, Osorio A, Cazorla A, Sarrio D, Barroso A et al.:
Immunohistochemical characteristics defined by tissue microarray of hereditary
breast cancer not attributable to BRCA1 or BRCA2 mutations: differences from
breast carcinomas arising in BRCA1 and BRCA2 mutation carriers. Clin Cancer Res
2003, 9: 3606-3614.
18. Palacios J, Robles-Frias MJ, Castilla MA, Lopez-Garcia MA, Benitez J: The molecular
pathology of hereditary breast cancer. Pathobiology 2008, 75: 85-94.
19. Wooster R, Weber BL: Breast and ovarian cancer. N Engl J Med 2003, 348: 23392347.
20. Futreal PA, Liu Q, Shattuck-Eidens D, Cochran C, Harshman K, Tavtigian S et al.:
BRCA1 mutations in primary breast and ovarian carcinomas. Science 1994, 266:
120-122.
21. Papa S, Seripa D, Merla G, Gravina C, Giai M, Sismondi P et al.: Identification of a
possible somatic BRCA1 mutation affecting translation efficiency in an early-onset
sporadic breast cancer patient. J Natl Cancer Inst 1998, 90: 1011-1012.
22. van der Looij M, Cleton-Jansen AM, van Eijk R, Morreau H, van Vliet M, KuipersDijkshoorn N et al.: A sporadic breast tumor with a somatically acquired complex
genomic rearrangement in BRCA1. Genes Chromosomes Cancer 2000, 27: 295-302.
23. Lee WY, Jin YT, Chang TW, Lin PW, Su IJ: Immunolocalization of BRCA1 protein in
normal breast tissue and sporadic invasive ductal carcinomas: a correlation with
other biological parameters. Histopathology 1999, 34: 106-112.
129
24. Wilson CA, Ramos L, Villasenor MR, Anders KH, Press MF, Clarke K et al.:
Localization of human BRCA1 and its loss in high-grade, non-inherited breast
carcinomas. Nat Genet 1999, 21: 236-240.
25. Taylor J, Lymboura M, Pace PE, A'hern RP, Desai AJ, Shousha S et al.: An important
role for BRCA1 in breast cancer progression is indicated by its loss in a large
proportion of non-familial breast cancers. Int J Cancer 1998, 79: 334-342.
26. Seery LT, Knowlden JM, Gee JM, Robertson JF, Kenny FS, Ellis IO et al.: BRCA1
expression levels predict distant metastasis of sporadic breast cancers. Int J Cancer
1999, 84: 258-262.
27. Turner N, Tutt A, Ashworth A: Hallmarks of 'BRCAness' in sporadic cancers. Nat Rev
Cancer 2004, 4: 814-819.
28. Okada S, Tokunaga E, Kitao H, Akiyoshi S, Yamashita N, Saeki H et al.: Loss of
heterozygosity at BRCA1 locus is significantly associated with aggressiveness and
poor prognosis in breast cancer. Ann Surg Oncol 2012, 19: 1499-1507.
29. Foulkes WD, Stefansson IM, Chappuis PO, Begin LR, Goffin JR, Wong N et al.:
Germline BRCA1 mutations and a basal epithelial phenotype in breast cancer. J
Natl Cancer Inst 2003, 95: 1482-1485.
30. Lakhani SR, Reis-Filho JS, Fulford L, Penault-Llorca F, van d, V, Parry S et al.:
Prediction of BRCA1 status in patients with breast cancer using estrogen receptor
and basal phenotype. Clin Cancer Res 2005, 11: 5175-5180.
31. Turner NC, Reis-Filho JS, Russell AM, Springall RJ, Ryder K, Steele D et al.: BRCA1
dysfunction in sporadic basal-like breast cancer. Oncogene 2007, 26: 2126-2132.
32. Stefansson OA, Jonasson JG, Olafsdottir K, Hilmarsdottir H, Olafsdottir G, Esteller M et
al.: CpG island hypermethylation of BRCA1 and loss of pRb as co-occurring events
in basal/triple-negative breast cancer. Epigenetics 2011, 6: 638-649.
33. Garcia AI, Buisson M, Bertrand P, Rimokh R, Rouleau E, Lopez BS et al.: Downregulation of BRCA1 expression by miR-146a and miR-146b-5p in triple negative
sporadic breast cancers. EMBO Mol Med 2011, 3: 279-290.
34. Stefansson OA, Jonasson JG, Johannsson OT, Olafsdottir K, Steinarsdottir M,
Valgeirsdottir S et al.: Genomic profiling of breast tumours in relation to BRCA
abnormalities and phenotypes. Breast Cancer Res 2009, 11: R47.
35. O'Donovan PJ, Livingston DM: BRCA1 and BRCA2: breast/ovarian cancer
susceptibility gene products and participants in DNA double-strand break repair.
Carcinogenesis 2010, 31: 961-967.
36. Hosey AM, Gorski JJ, Murray MM, Quinn JE, Chung WY, Stewart GE et al.: Molecular
basis for estrogen receptor alpha deficiency in BRCA1-linked breast cancer. J Natl
Cancer Inst 2007, 99: 1683-1694.
130
37. Bochar DA, Wang L, Beniya H, Kinev A, Xue Y, Lane WS et al.: BRCA1 is associated
with a human SWI/SNF-related complex: linking chromatin remodeling to breast
cancer. Cell 2000, 102: 257-265.
38. Wu LC, Wang ZW, Tsan JT, Spillman MA, Phung A, Xu XL et al.: Identification of a
RING protein that can interact in vivo with the BRCA1 gene product. Nat Genet
1996, 14: 430-440.
39. Hashizume R, Fukuda M, Maeda I, Nishikawa H, Oyake D, Yabuki Y et al.: The RING
heterodimer BRCA1-BARD1 is a ubiquitin ligase inactivated by a breast cancerderived mutation. J Biol Chem 2001, 276: 14537-14540.
40. Zhu Q, Pao GM, Huynh AM, Suh H, Tonnu N, Nederlof PM et al.: BRCA1 tumour
suppression occurs via heterochromatin-mediated silencing. Nature 2011, 477: 179184.
41. Foulkes WD: BRCA1 functions as a breast stem cell regulator. J Med Genet 2004, 41:
1-5.
42. Marquis ST, Rajan JV, Wynshaw-Boris A, Xu J, Yin GY, Abel KJ et al.: The
developmental pattern of Brca1 expression implies a role in differentiation of the
breast and other tissues. Nat Genet 1995, 11: 17-26.
43. Rajan JV, Wang M, Marquis ST, Chodosh LA: Brca2 is coordinately regulated with
Brca1 during proliferation and differentiation in mammary epithelial cells. Proc
Natl Acad Sci U S A 1996, 93: 13078-13083.
44. Rajan JV, Marquis ST, Gardner HP, Chodosh LA: Developmental expression of Brca2
colocalizes with Brca1 and is associated with proliferation and differentiation in
multiple tissues. Dev Biol 1997, 184: 385-401.
45. Bernard-Gallon DJ, De Latour MP, Sylvain V, Vissac C, Aunoble B, Chassagne J et al.:
Brca1 and Brca2 protein expression patterns in different tissues of murine origin.
Int J Oncol 2001, 18: 271-280.
46. Xu X, Wagner KU, Larson D, Weaver Z, Li C, Ried T et al.: Conditional mutation of
Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and
tumour formation. Nat Genet 1999, 22: 37-43.
47. Kubista M, Rosner M, Kubista E, Bernaschek G, Hengstschlager M: Brca1 regulates in
vitro differentiation of mammary epithelial cells. Oncogene 2002, 21: 4747-4756.
48. Furuta S, Jiang X, Gu B, Cheng E, Chen PL, Lee WH: Depletion of BRCA1 impairs
differentiation but enhances proliferation of mammary epithelial cells. Proc Natl
Acad Sci U S A 2005, 102: 9176-9181.
49. Liu S, Ginestier C, Charafe-Jauffret E, Foco H, Kleer CG, Merajver SD et al.: BRCA1
regulates human mammary stem/progenitor cell fate. Proc Natl Acad Sci U S A 2008,
105: 1680-1685.
131
50. Molyneux G, Geyer FC, Magnay FA, McCarthy A, Kendrick H, Natrajan R et al.:
BRCA1 basal-like breast cancers originate from luminal epithelial progenitors and
not from basal stem cells. Cell Stem Cell 2010, 7: 403-417.
51. Mueller CR, Roskelley CD: Regulation of BRCA1 expression and its relationship to
sporadic breast cancer. Breast Cancer Res 2003, 5: 45-52.
52. De Siervi A, De Luca P, Byun JS, Di LJ, Fufa T, Haggerty CM et al.: Transcriptional
autoregulation by BRCA1. Cancer Res 2010, 70: 532-542.
53. Xu CF, Brown MA, Nicolai H, Chambers JA, Griffiths BL, Solomon E: Isolation and
characterisation of the NBR2 gene which lies head to head with the human BRCA1
gene. Hum Mol Genet 1997, 6: 1057-1062.
54. Suen TC, Goss PE: Transcription of BRCA1 is dependent on the formation of a
specific protein-DNA complex on the minimal BRCA1 Bi-directional promoter. J
Biol Chem 1999, 274: 31297-31304.
55. Atlas E, Stramwasser M, Whiskin K, Mueller CR: GA-binding protein alpha/beta is a
critical regulator of the BRCA1 promoter. Oncogene 2000, 19: 1933-1940.
56. Collins PJ, Kobayashi Y, Nguyen L, Trinklein ND, Myers RM: The ets-related
transcription factor GABP directs bidirectional transcription. PLoS Genet 2007, 3:
e208.
57. MacDonald G, Stramwasser M, Mueller CR: Characterization of a negative
transcriptional element in the BRCA1 promoter. Breast Cancer Res 2007, 9: R49.
58. Ritter HD, Antonova L, Mueller CR: The Unliganded Glucocorticoid Receptor
Positively Regulates the Tumor Suppressor Gene BRCA1 through GABP Beta. Mol
Cancer Res 2012, 10: 558-569.
59. Vilasco M, Communal L, Mourra N, Courtin A, Forgez P, Gompel A: Glucocorticoid
receptor and breast cancer. Breast Cancer Res Treat 2011, 130: 1-10.
60. Antonova L, Mueller CR: Hydrocortisone down-regulates the tumor suppressor gene
BRCA1 in mammary cells: a possible molecular link between stress and breast
cancer. Genes Chromosomes Cancer 2008, 47: 341-352.
61. Antonova L, Aronson K, Mueller CR: Stress and breast cancer: from epidemiology to
molecular biology. Breast Cancer Res 2011, 13: 208.
62. LaMarco K, Thompson CC, Byers BP, Walton EM, McKnight SL: Identification of Etsand notch-related subunits in GA binding protein. Science 1991, 253: 789-792.
63. Thompson CC, Brown TA, McKnight SL: Convergence of Ets- and notch-related
structural motifs in a heteromeric DNA binding complex. Science 1991, 253: 762768.
132
64. Brown TA, McKnight SL: Specificities of protein-protein and protein-DNA
interaction of GABP alpha and two newly defined ets-related proteins. Genes Dev
1992, 6: 2502-2512.
65. Batchelor AH, Piper DE, de la Brousse FC, McKnight SL, Wolberger C: The structure
of GABPalpha/beta: an ETS domain- ankyrin repeat heterodimer bound to DNA.
Science 1998, 279: 1037-1041.
66. Gugneja S, Virbasius JV, Scarpulla RC: Four structurally distinct, non-DNA-binding
subunits of human nuclear respiratory factor 2 share a conserved transcriptional
activation domain. Mol Cell Biol 1995, 15: 102-111.
67. Sawa C, Goto M, Suzuki F, Watanabe H, Sawada J, Handa H: Functional domains of
transcription factor hGABP beta1/E4TF1-53 required for nuclear localization and
transcription activation. Nucleic Acids Res 1996, 24: 4954-4961.
68. Virbasius JV, Virbasius CA, Scarpulla RC: Identity of GABP with NRF-2, a
multisubunit activator of cytochrome oxidase expression, reveals a cellular role for
an ETS domain activator of viral promoters. Genes Dev 1993, 7: 380-392.
69. Sawada J, Goto M, Sawa C, Watanabe H, Handa H: Transcriptional activation through
the tetrameric complex formation of E4TF1 subunits. EMBO J 1994, 13: 1396-1402.
70. de la Brousse FC, Birkenmeier EH, King DS, Rowe LB, McKnight SL: Molecular and
genetic characterization of GABP beta. Genes Dev 1994, 8: 1853-1865.
71. Rosmarin AG, Resendes KK, Yang Z, McMillan JN, Fleming SL: GA-binding protein
transcription factor: a review of GABP as an integrator of intracellular signaling
and protein-protein interactions. Blood Cells Mol Dis 2004, 32: 143-154.
72. Resendes KK, Rosmarin AG: GA-binding protein and p300 are essential components
of a retinoic acid-induced enhanceosome in myeloid cells. Mol Cell Biol 2006, 26:
3060-3070.
73. Kang HS, Nelson ML, Mackereth CD, Scharpf M, Graves BJ, McIntosh LP:
Identification and structural characterization of a CBP/p300-binding domain from
the ETS family transcription factor GABP alpha. J Mol Biol 2008, 377: 636-646.
74. Ristevski S, O'Leary DA, Thornell AP, Owen MJ, Kola I, Hertzog PJ: The ETS
transcription factor GABPalpha is essential for early embryogenesis. Mol Cell Biol
2004, 24: 5844-5849.
75. Xue HH, Jing X, Bollenbacher-Reilley J, Zhao DM, Haring JS, Yang B et al.: Targeting
the GA binding protein beta1L isoform does not perturb lymphocyte development
and function. Mol Cell Biol 2008, 28: 4300-4309.
76. Patton J, Block S, Coombs C, Martin ME: Identification of functional elements in the
murine Gabp alpha/ATP synthase coupling factor 6 bi-directional promoter. Gene
2006, 369: 35-44.
133
77. Xue HH, Bollenbacher J, Rovella V, Tripuraneni R, Du YB, Liu CY et al.: GA binding
protein regulates interleukin 7 receptor alpha-chain gene expression in T cells. Nat
Immunol 2004, 5: 1036-1044.
78. Xue HH, Bollenbacher-Reilley J, Wu Z, Spolski R, Jing X, Zhang YC et al.: The
transcription factor GABP is a critical regulator of B lymphocyte development.
Immunity 2007, 26: 421-431.
79. Yu S, Zhao DM, Jothi R, Xue HH: Critical requirement of GABPalpha for normal T
cell development. J Biol Chem 2010, 285: 10179-10188.
80. Kamura T, Handa H, Hamasaki N, Kitajima S: Characterization of the human
thrombopoietin gene promoter. A possible role of an Ets transcription factor,
E4TF1/GABP. J Biol Chem 1997, 272: 11361-11368.
81. Delehouzee S, Yoshikawa T, Sawa C, Sawada J, Ito T, Omori M et al.: GABP, HCF-1
and YY1 are involved in Rb gene expression during myogenesis. Genes Cells 2005,
10: 717-731.
82. Takahashi K, Yamanaka S: Induction of pluripotent stem cells from mouse embryonic
and adult fibroblast cultures by defined factors. Cell 2006, 126: 663-676.
83. Park IH, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA et al.: Reprogramming of
human somatic cells to pluripotency with defined factors. Nature 2008, 451: 141-146.
84. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I et al.:
Formation of pluripotent stem cells in the mammalian embryo depends on the POU
transcription factor Oct4. Cell 1998, 95: 379-391.
85. Niwa H, Miyazaki J, Smith AG: Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000, 24: 372376.
86. Kinoshita K, Ura H, Akagi T, Usuda M, Koide H, Yokota T: GABPalpha regulates
Oct-3/4 expression in mouse embryonic stem cells. Biochem Biophys Res Commun
2007, 353: 686-691.
87. Yu S, Cui K, Jothi R, Zhao DM, Jing X, Zhao K et al.: GABP controls a critical
transcription regulatory module that is essential for maintenance and
differentiation of hematopoietic stem/progenitor cells. Blood 2011, 117: 2166-2178.
88. Joung JG, Shin D, Seong RH, Zhang BT: Identification of regulatory modules by coclustering latent variable models: stem cell differentiation. Bioinformatics 2006, 22:
2005-2011.
89. Sherr CJ, Roberts JM: Inhibitors of mammalian G1 cyclin-dependent kinases. Genes
Dev 1995, 9: 1149-1163.
90. Sherr CJ: Cancer cell cycles. Science 1996, 274: 1672-1677.
134
91. Dyson N: The regulation of E2F by pRB-family proteins. Genes Dev 1998, 12: 22452262.
92. Helin K: Regulation of cell proliferation by the E2F transcription factors. Curr Opin
Genet Dev 1998, 8: 28-35.
93. Sherr CJ, Roberts JM: CDK inhibitors: positive and negative regulators of G1-phase
progression. Genes Dev 1999, 13: 1501-1512.
94. Savoysky E, Mizuno T, Sowa Y, Watanabe H, Sawada J, Nomura H et al.: The
retinoblastoma binding factor 1 (RBF-1) site in RB gene promoter binds
preferentially E4TF1, a member of the Ets transcription factors family. Oncogene
1994, 9: 1839-1846.
95. Shiio Y, Sawada J, Handa H, Yamamoto T, Inoue J: Activation of the retinoblastoma
gene expression by Bcl-3: implication for muscle cell differentiation. Oncogene 1996,
12: 1837-1845.
96. Sowa Y, Shiio Y, Fujita T, Matsumoto T, Okuyama Y, Kato D et al.: Retinoblastoma
binding factor 1 site in the core promoter region of the human RB gene is activated
by hGABP/E4TF1. Cancer Res 1997, 57: 3145-3148.
97. Hauck L, Kaba RG, Lipp M, Dietz R, von HR: Regulation of E2F1-dependent gene
transcription and apoptosis by the ETS-related transcription factor GABPgamma1.
Mol Cell Biol 2002, 22: 2147-2158.
98. Izumi M, Yokoi M, Nishikawa NS, Miyazawa H, Sugino A, Yamagishi M et al.:
Transcription of the catalytic 180-kDa subunit gene of mouse DNA polymerase
alpha is controlled by E2F, an Ets-related transcription factor, and Sp1. Biochim
Biophys Acta 2000, 1492: 341-352.
99. Rudge TL, Johnson LF: Synergistic activation of the TATA-less mouse thymidylate
synthase promoter by the Ets transcription factor GABP and Sp1. Exp Cell Res
2002, 274: 45-55.
100. Yang ZF, Mott S, Rosmarin AG: The Ets transcription factor GABP is required for
cell-cycle progression. Nat Cell Biol 2007, 9: 339-346.
101. Yu ZK, Gervais JL, Zhang H: Human CUL-1 associates with the SKP1/SKP2 complex
and regulates p21(CIP1/WAF1) and cyclin D proteins. Proc Natl Acad Sci U S A
1998, 95: 11324-11329.
102. Carrano AC, Eytan E, Hershko A, Pagano M: SKP2 is required for ubiquitin-mediated
degradation of the CDK inhibitor p27. Nat Cell Biol 1999, 1: 193-199.
103. Crook MF, Olive M, Xue HH, Langenickel TH, Boehm M, Leonard WJ et al.: GAbinding protein regulates KIS gene expression, cell migration, and cell cycle
progression. FASEB J 2008, 22: 225-235.
135
104. Scarpulla RC: Transcriptional paradigms in mammalian mitochondrial biogenesis
and function. Physiol Rev 2008, 88: 611-638.
105. Evans MJ, Scarpulla RC: Interaction of nuclear factors with multiple sites in the
somatic cytochrome c promoter. Characterization of upstream NRF-1, ATF, and
intron Sp1 recognition sequences. J Biol Chem 1989, 264: 14361-14368.
106. Evans MJ, Scarpulla RC: NRF-1: a trans-activator of nuclear-encoded respiratory
genes in animal cells. Genes Dev 1990, 4: 1023-1034.
107. Virbasius JV, Scarpulla RC: Transcriptional activation through ETS domain binding
sites in the cytochrome c oxidase subunit IV gene. Mol Cell Biol 1991, 11: 5631-5638.
108. Ongwijitwat S, Wong-Riley MT: Is nuclear respiratory factor 2 a master
transcriptional coordinator for all ten nuclear-encoded cytochrome c oxidase
subunits in neurons? Gene 2005, 360: 65-77.
109. Ongwijitwat S, Liang HL, Graboyes EM, Wong-Riley MT: Nuclear respiratory factor
2 senses changing cellular energy demands and its silencing down-regulates
cytochrome oxidase and other target gene mRNAs. Gene 2006, 374: 39-49.
110. Coene ED, Hollinshead MS, Waeytens AA, Schelfhout VR, Eechaute WP, Shaw MK et
al.: Phosphorylated BRCA1 is predominantly located in the nucleus and
mitochondria. Mol Biol Cell 2005, 16: 997-1010.
111. Virbasius CA, Virbasius JV, Scarpulla RC: NRF-1, an activator involved in nuclearmitochondrial interactions, utilizes a new DNA-binding domain conserved in a
family of developmental regulators. Genes Dev 1993, 7: 2431-2445.
112. Gugneja S, Virbasius CM, Scarpulla RC: Nuclear respiratory factors 1 and 2 utilize
similar glutamine-containing clusters of hydrophobic residues to activate
transcription. Mol Cell Biol 1996, 16: 5708-5716.
113. Scarpulla RC: Metabolic control of mitochondrial biogenesis through the PGC-1
family regulatory network. Biochim Biophys Acta 2011, 1813: 1269-1278.
114. Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM: A cold-inducible
coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 1998, 92:
829-839.
115. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V et al.: Mechanisms
controlling mitochondrial biogenesis and respiration through the thermogenic
coactivator PGC-1. Cell 1999, 98: 115-124.
116. Mootha VK, Handschin C, Arlow D, Xie X, St PJ, Sihag S et al.: Erralpha and
Gabpa/b specify PGC-1alpha-dependent oxidative phosphorylation gene expression
that is altered in diabetic muscle. Proc Natl Acad Sci U S A 2004, 101: 6570-6575.
136
117. Meirhaeghe A, Crowley V, Lenaghan C, Lelliott C, Green K, Stewart A et al.:
Characterization of the human, mouse and rat PGC1 beta (peroxisome-proliferatoractivated receptor-gamma co-activator 1 beta) gene in vitro and in vivo. Biochem J
2003, 373: 155-165.
118. Lin J, Puigserver P, Donovan J, Tarr P, Spiegelman BM: Peroxisome proliferatoractivated receptor gamma coactivator 1beta (PGC-1beta ), a novel PGC-1-related
transcription coactivator associated with host cell factor. J Biol Chem 2002, 277:
1645-1648.
119. St-Pierre J, Lin J, Krauss S, Tarr PT, Yang R, Newgard CB et al.: Bioenergetic analysis
of peroxisome proliferator-activated receptor gamma coactivators 1alpha and 1beta
(PGC-1alpha and PGC-1beta) in muscle cells. J Biol Chem 2003, 278: 26597-26603.
120. Andersson U, Scarpulla RC: Pgc-1-related coactivator, a novel, serum-inducible
coactivator of nuclear respiratory factor 1-dependent transcription in mammalian
cells. Mol Cell Biol 2001, 21: 3738-3749.
121. Gleyzer N, Vercauteren K, Scarpulla RC: Control of mitochondrial transcription
specificity factors (TFB1M and TFB2M) by nuclear respiratory factors (NRF-1 and
NRF-2) and PGC-1 family coactivators. Mol Cell Biol 2005, 25: 1354-1366.
122. Vercauteren K, Pasko RA, Gleyzer N, Marino VM, Scarpulla RC: PGC-1-related
coactivator: immediate early expression and characterization of a CREB/NRF-1
binding domain associated with cytochrome c promoter occupancy and respiratory
growth. Mol Cell Biol 2006, 26: 7409-7419.
123. Kim J, Lee JH, Iyer VR: Global identification of Myc target genes reveals its direct
role in mitochondrial biogenesis and its E-box usage in vivo. PLoS ONE 2008, 3:
e1798.
124. Li F, Wang Y, Zeller KI, Potter JJ, Wonsey DR, O'Donnell KA et al.: Myc stimulates
nuclearly encoded mitochondrial genes and mitochondrial biogenesis. Mol Cell Biol
2005, 25: 6225-6234.
125. Morrish F, Giedt C, Hockenbery D: c-MYC apoptotic function is mediated by NRF-1
target genes. Genes Dev 2003, 17: 240-255.
126. Zhang H, Gao P, Fukuda R, Kumar G, Krishnamachary B, Zeller KI et al.: HIF-1
inhibits mitochondrial biogenesis and cellular respiration in VHL-deficient renal
cell carcinoma by repression of C-MYC activity. Cancer Cell 2007, 11: 407-420.
127. Cheng AS, Jin VX, Fan M, Smith LT, Liyanarachchi S, Yan PS et al.: Combinatorial
analysis of transcription factor partners reveals recruitment of c-MYC to estrogen
receptor-alpha responsive promoters. Mol Cell 2006, 21: 393-404.
128. Mattingly KA, Ivanova MM, Riggs KA, Wickramasinghe NS, Barch MJ, Klinge CM:
Estradiol stimulates transcription of nuclear respiratory factor-1 and increases
mitochondrial biogenesis. Mol Endocrinol 2008, 22: 609-622.
137
129. FitzGerald PC, Shlyakhtenko A, Mir AA, Vinson C: Clustering of DNA sequences in
human promoters. Genome Res 2004, 14: 1562-1574.
130. Cam H, Balciunaite E, Blais A, Spektor A, Scarpulla RC, Young R et al.: A common set
of gene regulatory networks links metabolism and growth inhibition. Mol Cell 2004,
16: 399-411.
131. Trimarchi JM, Lees JA: Sibling rivalry in the E2F family. Nat Rev Mol Cell Biol 2002,
3: 11-20.
132. Cam H, Dynlacht BD: Emerging roles for E2F: beyond the G1/S transition and DNA
replication. Cancer Cell 2003, 3: 311-316.
133. Efiok BJ, Safer B: Transcriptional regulation of E2F-1 and eIF-2 genes by alpha-pal:
a potential mechanism for coordinated regulation of protein synthesis, growth, and
the cell cycle. Biochim Biophys Acta 2000, 1495: 51-68.
134. Kherrouche Z, De LY, Monte D: The NRF-1/alpha-PAL transcription factor
regulates human E2F6 promoter activity. Biochem J 2004, 383: 529-536.
135. Huo L, Scarpulla RC: Mitochondrial DNA instability and peri-implantation lethality
associated with targeted disruption of nuclear respiratory factor 1 in mice. Mol Cell
Biol 2001, 21: 644-654.
136. Boulton SJ: Cellular functions of the BRCA tumour-suppressor proteins. Biochem
Soc Trans 2006, 34: 633-645.
137. Narod SA, Foulkes WD: BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer
2004, 4: 665-676.
138. Smalley MJ, Reis-Filho JS, Ashworth A: BRCA1 and stem cells: tumour typecasting.
Nat Cell Biol 2008, 10: 377-379.
139. Turner NC, Reis-Filho JS: Basal-like breast cancer and the BRCA1 phenotype.
Oncogene 2006, 25: 5846-5853.
140. Lux MP, Fasching PA, Beckmann MW: Hereditary breast and ovarian cancer: review
and future perspectives. J Mol Med 2006, 84: 16-28.
141. Thompson ME, Jensen RA, Obermiller PS, Page DL, Holt JT: Decreased expression of
BRCA1 accelerates growth and is often present during sporadic breast cancer
progression. Nat Genet 1995, 9: 444-450.
142. Stampfer MR, Garbe J, Levine G, Lichtsteiner S, Vasserot AP, Yaswen P: Expression of
the telomerase catalytic subunit, hTERT, induces resistance to transforming growth
factor beta growth inhibition in p16INK4A(-) human mammary epithelial cells.
Proc Natl Acad Sci U S A 2001, 98: 4498-4503.
138
143. Watanabe H, Sawada J, Yano K, Yamaguchi K, Goto M, Handa H: cDNA cloning of
transcription factor E4TF1 subunits with Ets and notch motifs. Mol Cell Biol 1993,
13: 1385-1391.
144. Asangani IA, Rasheed SA, Leupold JH, Post S, Allgayer H: NRF-1, and AP-1 regulate
the promoter of the human calpain small subunit 1 (CAPNS1) gene. Gene 2008, 410:
197-206.
145. Pfaffl MW: A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res 2001, 29: e45.
146. Yoshikawa K, Honda K, Inamoto T, Shinohara H, Yamauchi A, Suga K et al.:
Reduction of BRCA1 protein expression in Japanese sporadic breast carcinomas
and its frequent loss in BRCA1-associated cases. Clin Cancer Res 1999, 5: 1249-1261.
147. Amirrad M, Al-Mulla F, Varadharaj G, John B, Saji T, Anim JT: BRCA1 gene
expression in breast cancer in Kuwait: correlation with prognostic parameters. Med
Princ Pract 2005, 14: 67-72.
148. Valouev A, Johnson DS, Sundquist A, Medina C, Anton E, Batzoglou S et al.: Genomewide analysis of transcription factor binding sites based on ChIP-Seq data. Nat
Methods 2008, 5: 829-834.
149. Puigserver P: Tissue-specific regulation of metabolic pathways through the
transcriptional coactivator PGC1-alpha. Int J Obes (Lond) 2005, 29 Suppl 1: S5-S9.
150. Larsson NG, Wang J, Wilhelmsson H, Oldfors A, Rustin P, Lewandoski M et al.:
Mitochondrial transcription factor A is necessary for mtDNA maintenance and
embryogenesis in mice. Nat Genet 1998, 18: 231-236.
151. Liu CY, Flesken-Nikitin A, Li S, Zeng Y, Lee WH: Inactivation of the mouse Brca1
gene leads to failure in the morphogenesis of the egg cylinder in early
postimplantation development. Genes Dev 1996, 10: 1835-1843.
152. Kroemer G, Pouyssegur J: Tumor cell metabolism: cancer's Achilles' heel. Cancer
Cell 2008, 13: 472-482.
153. Jang YY, Sharkis SJ: A low level of reactive oxygen species selects for primitive
hematopoietic stem cells that may reside in the low-oxygenic niche. Blood 2007, 110:
3056-3063.
154. Gogvadze V, Orrenius S, Zhivotovsky B: Mitochondria in cancer cells: what is so
special about them? Trends Cell Biol 2008, 18: 165-173.
155. Hu Z, Fan C, Oh DS, Marron JS, He X, Qaqish BF et al.: The molecular portraits of
breast tumors are conserved across microarray platforms. BMC Genomics 2006, 7:
96.
139
156. Fulford LG, Easton DF, Reis-Filho JS, Sofronis A, Gillett CE, Lakhani SR et al.:
Specific morphological features predictive for the basal phenotype in grade 3
invasive ductal carcinoma of breast. Histopathology 2006, 49: 22-34.
157. Livasy CA, Karaca G, Nanda R, Tretiakova MS, Olopade OI, Moore DT et al.:
Phenotypic evaluation of the basal-like subtype of invasive breast carcinoma. Mod
Pathol 2006, 19: 264-271.
158. Nielsen TO, Hsu FD, Jensen K, Cheang M, Karaca G, Hu Z et al.:
Immunohistochemical and clinical characterization of the basal-like subtype of
invasive breast carcinoma. Clin Cancer Res 2004, 10: 5367-5374.
159. Bergamaschi A, Kim YH, Wang P, Sorlie T, Hernandez-Boussard T, Lonning PE et al.:
Distinct patterns of DNA copy number alteration are associated with different
clinicopathological features and gene-expression subtypes of breast cancer. Genes
Chromosomes Cancer 2006, 45: 1033-1040.
160. Roy R, Chun J, Powell SN: BRCA1 and BRCA2: different roles in a common
pathway of genome protection. Nat Rev Cancer 2012, 12: 68-78.
161. Thompson C, MacDonald G, Mueller CR: Decreased expression of BRCA1 in SK-BR3 cells is the result of aberrant activation of the GABP Beta promoter by an NRF-1containing complex. Mol Cancer 2011, 10: 62.
162. Reisman D, Glaros S, Thompson EA: The SWI/SNF complex and cancer. Oncogene
2009, 28: 1653-1668.
163. Khavari PA, Peterson CL, Tamkun JW, Mendel DB, Crabtree GR: BRG1 contains a
conserved domain of the SWI2/SNF2 family necessary for normal mitotic growth
and transcription. Nature 1993, 366: 170-174.
164. Wong AK, Shanahan F, Chen Y, Lian L, Ha P, Hendricks K et al.: BRG1, a component
of the SWI-SNF complex, is mutated in multiple human tumor cell lines. Cancer Res
2000, 60: 6171-6177.
165. Medina PP, Romero OA, Kohno T, Montuenga LM, Pio R, Yokota J et al.: Frequent
BRG1/SMARCA4-inactivating mutations in human lung cancer cell lines. Hum
Mutat 2008, 29: 617-622.
166. Reisman DN, Sciarrotta J, Wang W, Funkhouser WK, Weissman BE: Loss of
BRG1/BRM in human lung cancer cell lines and primary lung cancers: correlation
with poor prognosis. Cancer Res 2003, 63: 560-566.
167. Medina PP, Carretero J, Fraga MF, Esteller M, Sidransky D, Sanchez-Cespedes M:
Genetic and epigenetic screening for gene alterations of the chromatin-remodeling
factor, SMARCA4/BRG1, in lung tumors. Genes Chromosomes Cancer 2004, 41: 170177.
140
168. Rodriguez-Nieto S, Canada A, Pros E, Pinto AI, Torres-Lanzas J, Lopez-Rios F et al.:
Massive parallel DNA pyrosequencing analysis of the tumor suppressor
BRG1/SMARCA4 in lung primary tumors. Hum Mutat 2011, 32: E1999-E2017.
169. Bultman SJ, Herschkowitz JI, Godfrey V, Gebuhr TC, Yaniv M, Perou CM et al.:
Characterization of mammary tumors from Brg1 heterozygous mice. Oncogene
2008, 27: 460-468.
170. Dallas PB, Pacchione S, Wilsker D, Bowrin V, Kobayashi R, Moran E: The human
SWI-SNF complex protein p270 is an ARID family member with non-sequencespecific DNA binding activity. Mol Cell Biol 2000, 20: 3137-3146.
171. Wiegand KC, Shah SP, Al-Agha OM, Zhao Y, Tse K, Zeng T et al.: ARID1A mutations
in endometriosis-associated ovarian carcinomas. N Engl J Med 2010, 363: 1532-1543.
172. Jones S, Wang TL, Shih I, Mao TL, Nakayama K, Roden R et al.: Frequent mutations
of chromatin remodeling gene ARID1A in ovarian clear cell carcinoma. Science
2010, 330: 228-231.
173. Gui Y, Guo G, Huang Y, Hu X, Tang A, Gao S et al.: Frequent mutations of
chromatin remodeling genes in transitional cell carcinoma of the bladder. Nat Genet
2011, 43: 875-878.
174. Mamo A, Cavallone L, Tuzmen S, Chabot C, Ferrario C, Hassan S et al.: An integrated
genomic approach identifies ARID1A as a candidate tumor-suppressor gene in
breast cancer. Oncogene 2012, 31: 2090-2100.
175. Guan B, Wang TL, Shih I: ARID1A, a factor that promotes formation of SWI/SNFmediated chromatin remodeling, is a tumor suppressor in gynecologic cancers.
Cancer Res 2011, 71: 6718-6727.
176. Jung I, Sohn DH, Choi J, Kim JM, Jeon S, Seol JH et al.: SRG3/mBAF155 stabilizes
the SWI/SNF-like BAF complex by blocking CHFR mediated ubiquitination and
degradation of its major components. Biochem Biophys Res Commun 2012, 418: 512517.
177. DelBove J, Rosson G, Strobeck M, Chen J, Archer TK, Wang W et al.: Identification of
a core member of the SWI/SNF complex, BAF155/SMARCC1, as a human tumor
suppressor gene. Epigenetics 2011, 6: 1444-1453.
178. Xi Q, He W, Zhang XH, Le HV, Massague J: Genome-wide impact of the BRG1
SWI/SNF chromatin remodeler on the transforming growth factor beta
transcriptional program. J Biol Chem 2008, 283: 1146-1155.
179. Trotter KW, Archer TK: The BRG1 transcriptional coregulator. Nucl Recept Signal
2008, 6: e004.
180. Hang CT, Yang J, Han P, Cheng HL, Shang C, Ashley E et al.: Chromatin regulation
by Brg1 underlies heart muscle development and disease. Nature 2010, 466: 62-67.
141
181. Schreiber V, Dantzer F, Ame JC, de MG: Poly(ADP-ribose): novel functions for an old
molecule. Nat Rev Mol Cell Biol 2006, 7: 517-528.
182. Lacroix M, Leclercq G: Relevance of breast cancer cell lines as models for breast
tumours: an update. Breast Cancer Res Treat 2004, 83: 249-289.
183. Nie Z, Xue Y, Yang D, Zhou S, Deroo BJ, Archer TK et al.: A specificity and targeting
subunit of a human SWI/SNF family-related chromatin-remodeling complex. Mol
Cell Biol 2000, 20: 8879-8888.
184. Wang X, Nagl NG, Jr., Flowers S, Zweitzig D, Dallas PB, Moran E: Expression of p270
(ARID1A), a component of human SWI/SNF complexes, in human tumors. Int J
Cancer 2004, 112: 636.
185. Soule HD, Maloney TM, Wolman SR, Peterson WD, Jr., Brenz R, McGrath CM et al.:
Isolation and characterization of a spontaneously immortalized human breast
epithelial cell line, MCF-10. Cancer Res 1990, 50: 6075-6086.
186. Decristofaro MF, Betz BL, Rorie CJ, Reisman DN, Wang W, Weissman BE:
Characterization of SWI/SNF protein expression in human breast cancer cell lines
and other malignancies. J Cell Physiol 2001, 186: 136-145.
187. Phelan ML, Sif S, Narlikar GJ, Kingston RE: Reconstitution of a core chromatin
remodeling complex from SWI/SNF subunits. Mol Cell 1999, 3: 247-253.
188. Randazzo FM, Khavari P, Crabtree G, Tamkun J, Rossant J: brg1: a putative murine
homologue of the Drosophila brahma gene, a homeotic gene regulator. Dev Biol
1994, 161: 229-242.
189. Bultman S, Gebuhr T, Yee D, La MC, Nicholson J, Gilliam A et al.: A Brg1 null
mutation in the mouse reveals functional differences among mammalian SWI/SNF
complexes. Mol Cell 2000, 6: 1287-1295.
190. Kadam S, Emerson BM: Transcriptional specificity of human SWI/SNF BRG1 and
BRM chromatin remodeling complexes. Mol Cell 2003, 11: 377-389.
191. Reyes JC, Barra J, Muchardt C, Camus A, Babinet C, Yaniv M: Altered control of
cellular proliferation in the absence of mammalian brahma (SNF2alpha). EMBO J
1998, 17: 6979-6991.
192. Wang W, Cote J, Xue Y, Zhou S, Khavari PA, Biggar SR et al.: Purification and
biochemical heterogeneity of the mammalian SWI-SNF complex. EMBO J 1996, 15:
5370-5382.
193. Wang X, Nagl NG, Wilsker D, Van SM, Pacchione S, Yaciuk P et al.: Two related
ARID family proteins are alternative subunits of human SWI/SNF complexes.
Biochem J 2004, 383: 319-325.
194. Lemon B, Inouye C, King DS, Tjian R: Selectivity of chromatin-remodelling cofactors
for ligand-activated transcription. Nature 2001, 414: 924-928.
142
195. Yan Z, Cui K, Murray DM, Ling C, Xue Y, Gerstein A et al.: PBAF chromatinremodeling complex requires a novel specificity subunit, BAF200, to regulate
expression of selective interferon-responsive genes. Genes Dev 2005, 19: 1662-1667.
196. Kaeser MD, Aslanian A, Dong MQ, Yates JR, III, Emerson BM: BRD7, a novel PBAFspecific SWI/SNF subunit, is required for target gene activation and repression in
embryonic stem cells. J Biol Chem 2008, 283: 32254-32263.
197. Wu JI: Diverse functions of ATP-dependent chromatin remodeling complexes in
development and cancer. Acta Biochim Biophys Sin (Shanghai) 2012, 44: 54-69.
198. Ryme J, Asp P, Bohm S, Cavellan E, Farrants AK: Variations in the composition of
mammalian SWI/SNF chromatin remodelling complexes. J Cell Biochem 2009, 108:
565-576.
199. Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM et al.: The human
genome browser at UCSC. Genome Res 2002, 12: 996-1006.
200. Scarpulla RC: Nuclear control of respiratory chain expression by nuclear respiratory
factors and PGC-1-related coactivator. Ann N Y Acad Sci 2008, 1147: 321-334.
201. Li S, Liu C, Li N, Hao T, Han T, Hill DE et al.: Genome-wide coactivation analysis of
PGC-1alpha identifies BAF60a as a regulator of hepatic lipid metabolism. Cell
Metab 2008, 8: 105-117.
202. Harte MT, O'Brien GJ, Ryan NM, Gorski JJ, Savage KI, Crawford NT et al.: BRD7, a
subunit of SWI/SNF complexes, binds directly to BRCA1 and regulates BRCA1dependent transcription. Cancer Res 2010, 70: 2538-2547.
203. Hill DA, de la Serna IL, Veal TM, Imbalzano AN: BRCA1 interacts with dominant
negative SWI/SNF enzymes without affecting homologous recombination or
radiation-induced gene activation of p21 or Mdm2. J Cell Biochem 2004, 91: 987998.
204. Baker KM, Wei G, Schaffner AE, Ostrowski MC: Ets-2 and components of
mammalian SWI/SNF form a repressor complex that negatively regulates the
BRCA1 promoter. J Biol Chem 2003, 278: 17876-17884.
205. Xia W, Nagase S, Montia AG, Kalachikov SM, Keniry M, Su T et al.: BAF180 is a
critical regulator of p21 induction and a tumor suppressor mutated in breast
cancer. Cancer Res 2008, 68: 1667-1674.
206. Drost J, Mantovani F, Tocco F, Elkon R, Comel A, Holstege H et al.: BRD7 is a
candidate tumour suppressor gene required for p53 function. Nat Cell Biol 2010, 12:
380-389.
207. Stephens PJ, Tarpey PS, Davies H, Van LP, Greenman C, Wedge DC et al.: The
landscape of cancer genes and mutational processes in breast cancer. Nature 2012,
486: 400-404.
143
208. Zhang X, Zhang Y, Yang Y, Niu M, Sun S, Ji H et al.: Frequent low expression of
chromatin remodeling gene ARID1A in breast cancer and its clinical significance.
Cancer Epidemiol 2012, 36: 288-293.
209. Kim JK, Huh SO, Choi H, Lee KS, Shin D, Lee C et al.: Srg3, a mouse homolog of
yeast SWI3, is essential for early embryogenesis and involved in brain development.
Mol Cell Biol 2001, 21: 7787-7795.
210. Roberts CW, Galusha SA, McMenamin ME, Fletcher CD, Orkin SH: Haploinsufficiency
of Snf5 (integrase interactor 1) predisposes to malignant rhabdoid tumors in mice.
Proc Natl Acad Sci U S A 2000, 97: 13796-13800.
211. Klochendler-Yeivin A, Fiette L, Barra J, Muchardt C, Babinet C, Yaniv M: The murine
SNF5/INI1 chromatin remodeling factor is essential for embryonic development and
tumor suppression. EMBO Rep 2000, 1: 500-506.
212. Guidi CJ, Sands AT, Zambrowicz BP, Turner TK, Demers DA, Webster W et al.:
Disruption of Ini1 leads to peri-implantation lethality and tumorigenesis in mice.
Mol Cell Biol 2001, 21: 3598-3603.
213. Gao X, Tate P, Hu P, Tjian R, Skarnes WC, Wang Z: ES cell pluripotency and germlayer formation require the SWI/SNF chromatin remodeling component BAF250a.
Proc Natl Acad Sci U S A 2008, 105: 6656-6661.
214. Ho L, Ronan JL, Wu J, Staahl BT, Chen L, Kuo A et al.: An embryonic stem cell
chromatin remodeling complex, esBAF, is essential for embryonic stem cell selfrenewal and pluripotency. Proc Natl Acad Sci U S A 2009, 106: 5181-5186.
215. Yan Z, Wang Z, Sharova L, Sharov AA, Ling C, Piao Y et al.: BAF250B-associated
SWI/SNF chromatin-remodeling complex is required to maintain undifferentiated
mouse embryonic stem cells. Stem Cells 2008, 26: 1155-1165.
216. Kidder BL, Palmer S, Knott JG: SWI/SNF-Brg1 regulates self-renewal and occupies
core pluripotency-related genes in embryonic stem cells. Stem Cells 2009, 27: 317328.
217. Ho L, Jothi R, Ronan JL, Cui K, Zhao K, Crabtree GR: An embryonic stem cell
chromatin remodeling complex, esBAF, is an essential component of the core
pluripotency transcriptional network. Proc Natl Acad Sci U S A 2009, 106: 51875191.
218. Flowers S, Nagl NG, Jr., Beck GR, Jr., Moran E: Antagonistic roles for BRM and
BRG1 SWI/SNF complexes in differentiation. J Biol Chem 2009, 284: 10067-10075.
219. Romero OA, Setien F, John S, Gimenez-Xavier P, Gomez-Lopez G, Pisano D et al.: The
tumour suppressor and chromatin-remodelling factor BRG1 antagonizes Myc
activity and promotes cell differentiation in human cancer. EMBO Mol Med 2012, 4:
603-616.
144
220. Cohet N, Stewart KM, Mudhasani R, Asirvatham AJ, Mallappa C, Imbalzano KM et al.:
SWI/SNF chromatin remodeling enzyme ATPases promote cell proliferation in
normal mammary epithelial cells. J Cell Physiol 2010, 223: 667-678.
221. Liu R, Liu H, Chen X, Kirby M, Brown PO, Zhao K: Regulation of CSF1 promoter by
the SWI/SNF-like BAF complex. Cell 2001, 106: 309-318.
222. Reisman DN, Strobeck MW, Betz BL, Sciariotta J, Funkhouser W, Jr., Murchardt C et
al.: Concomitant down-regulation of BRM and BRG1 in human tumor cell lines:
differential effects on RB-mediated growth arrest vs CD44 expression. Oncogene
2002, 21: 1196-1207.
223. Strobeck MW, Reisman DN, Gunawardena RW, Betz BL, Angus SP, Knudsen KE et al.:
Compensation of BRG-1 function by Brm: insight into the role of the core SWI-SNF
subunits in retinoblastoma tumor suppressor signaling. J Biol Chem 2002, 277: 47824789.
224. Fryer CJ, Archer TK: Chromatin remodelling by the glucocorticoid receptor requires
the BRG1 complex. Nature 1998, 393: 88-91.
225. Hager GL: Understanding nuclear receptor function: from DNA to chromatin to the
interphase nucleus. Prog Nucleic Acid Res Mol Biol 2001, 66: 279-305.
226. Hossain MB, Ji P, Anish R, Jacobson RH, Takada S: Poly(ADP-ribose) Polymerase 1
Interacts with Nuclear Respiratory Factor 1 (NRF-1) and Plays a Role in NRF-1
Transcriptional Regulation. J Biol Chem 2009, 284: 8621-8632.
227. Clayton H, Titley I, Vivanco M: Growth and differentiation of progenitor/stem cells
derived from the human mammary gland. Exp Cell Res 2004, 297: 444-460.
228. Asselin-Labat ML, Shackleton M, Stingl J, Vaillant F, Forrest NC, Eaves CJ et al.:
Steroid hormone receptor status of mouse mammary stem cells. J Natl Cancer Inst
2006, 98: 1011-1014.
229. Gudjonsson T, Adriance MC, Sternlicht MD, Petersen OW, Bissell MJ: Myoepithelial
cells: their origin and function in breast morphogenesis and neoplasia. J Mammary
Gland Biol Neoplasia 2005, 10: 261-272.
230. Stingl J, Raouf A, Emerman JT, Eaves CJ: Epithelial progenitors in the normal human
mammary gland. J Mammary Gland Biol Neoplasia 2005, 10: 49-59.
231. Asselin-Labat ML, Vaillant F, Sheridan JM, Pal B, Wu D, Simpson ER et al.: Control of
mammary stem cell function by steroid hormone signalling. Nature 2010, 465: 798802.
232. Van Keymeulen A, Rocha AS, Ousset M, Beck B, Bouvencourt G, Rock J et al.: Distinct
stem cells contribute to mammary gland development and maintenance. Nature
2011, 479: 189-193.
145
233. Visvader JE, Lindeman GJ: The unmasking of novel unipotent stem cells in the
mammary gland. EMBO J 2011, 30: 4858-4859.
234. Chaffer CL, Brueckmann I, Scheel C, Kaestli AJ, Wiggins PA, Rodrigues LO et al.:
Normal and neoplastic nonstem cells can spontaneously convert to a stem-like state.
Proc Natl Acad Sci U S A 2011, 108: 7950-7955.
235. Debnath J, Muthuswamy SK, Brugge JS: Morphogenesis and oncogenesis of MCF-10A
mammary epithelial acini grown in three-dimensional basement membrane
cultures. Methods 2003, 30: 256-268.
236. Lee GY, Kenny PA, Lee EH, Bissell MJ: Three-dimensional culture models of normal
and malignant breast epithelial cells. Nat Methods 2007, 4: 359-365.
237. Ma I, Allan AL: The role of human aldehyde dehydrogenase in normal and cancer
stem cells. Stem Cell Rev 2011, 7: 292-306.
238. Eirew P, Kannan N, Knapp DJ, Vaillant F, Emerman JT, Lindeman GJ et al.: Aldehyde
dehydrogenase activity is a biomarker of primitive normal human mammary
luminal cells. Stem Cells 2012, 30: 344-348.
239. Maxwell CA, Benitez J, Gomez-Baldo L, Osorio A, Bonifaci N, Fernandez-Ramires R et
al.: Interplay between BRCA1 and RHAMM regulates epithelial apicobasal
polarization and may influence risk of breast cancer. PLoS Biol 2011, 9: e1001199.
240. Petersen OW, Hoyer PE, van DB: Frequency and distribution of estrogen receptorpositive cells in normal, nonlactating human breast tissue. Cancer Res 1987, 47:
5748-5751.
241. Stingl J: Estrogen and progesterone in normal mammary gland development and in
cancer. Horm Cancer 2011, 2: 85-90.
242. Stingl J, Raouf A, Eirew P, Eaves CJ: Deciphering the mammary epithelial cell
hierarchy. Cell Cycle 2006, 5: 1519-1522.
243. Alison MR, Guppy NJ, Lim SM, Nicholson LJ: Finding cancer stem cells: are
aldehyde dehydrogenases fit for purpose? J Pathol 2010, 222: 335-344.
244. Al-Hajj M, Wicha MS, ito-Hernandez A, Morrison SJ, Clarke MF: Prospective
identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003, 100:
3983-3988.
245. Marchitti SA, Brocker C, Stagos D, Vasiliou V: Non-P450 aldehyde oxidizing
enzymes: the aldehyde dehydrogenase superfamily. Expert Opin Drug Metab Toxicol
2008, 4: 697-720.
246. Marcato P, Dean CA, Pan D, Araslanova R, Gillis M, Joshi M et al.: Aldehyde
dehydrogenase activity of breast cancer stem cells is primarily due to isoform
ALDH1A3 and its expression is predictive of metastasis. Stem Cells 2011, 29: 32-45.
146
247. Rexer BN, Zheng WL, Ong DE: Retinoic acid biosynthesis by normal human breast
epithelium is via aldehyde dehydrogenase 6, absent in MCF-7 cells. Cancer Res 2001,
61: 7065-7070.
248. Yoshida A, Rzhetsky A, Hsu LC, Chang C: Human aldehyde dehydrogenase gene
family. Eur J Biochem 1998, 251: 549-557.
249. Hsu LC, Chang WC, Hiraoka L, Hsieh CL: Molecular cloning, genomic organization,
and chromosomal localization of an additional human aldehyde dehydrogenase
gene, ALDH6. Genomics 1994, 24: 333-341.
250. Koenig U, Amatschek S, Mildner M, Eckhart L, Tschachler E: Aldehyde
dehydrogenase 1A3 is transcriptionally activated by all-trans-retinoic acid in human
epidermal keratinocytes. Biochem Biophys Res Commun 2010, 400: 207-211.
251. Song BJ, Abdelmegeed MA, Yoo SH, Kim BJ, Jo SA, Jo I et al.: Post-translational
modifications of mitochondrial aldehyde dehydrogenase and biomedical
implications. J Proteomics 2011, 74: 2691-2702.
252. Deng S, Yang X, Lassus H, Liang S, Kaur S, Ye Q et al.: Distinct expression levels and
patterns of stem cell marker, aldehyde dehydrogenase isoform 1 (ALDH1), in
human epithelial cancers. PLoS ONE 2010, 5: e10277.
253. Heerma van Voss MR, van der Groep P, Bart J, van der Wall E, van Diest PJ:
Expression of the stem cell marker ALDH1 in BRCA1 related breast cancer. Cell
Oncol (Dordr ) 2011, 34: 3-10.
254. Lonergan T, Bavister B, Brenner C: Mitochondria in stem cells. Mitochondrion 2007, 7:
289-296.
255. Dizin E, Irminger-Finger I: Negative feedback loop of BRCA1-BARD1 ubiquitin
ligase on estrogen receptor alpha stability and activity antagonized by cancerassociated isoform of BARD1. Int J Biochem Cell Biol 2010, 42: 693-700.
256. Kress C, Ballester M, Devinoy E, Rijnkels M: Epigenetic modifications in 3D: nuclear
organization of the differentiating mammary epithelial cell. J Mammary Gland Biol
Neoplasia 2010, 15: 73-83.
257. Plachot C, Lelievre SA: DNA methylation control of tissue polarity and cellular
differentiation in the mammary epithelium. Exp Cell Res 2004, 298: 122-132.
258. Lelievre SA, Weaver VM, Nickerson JA, Larabell CA, Bhaumik A, Petersen OW et al.:
Tissue phenotype depends on reciprocal interactions between the extracellular
matrix and the structural organization of the nucleus. Proc Natl Acad Sci U S A 1998,
95: 14711-14716.
259. Le Beyec J, Xu R, Lee SY, Nelson CM, Rizki A, Alcaraz J et al.: Cell shape regulates
global histone acetylation in human mammary epithelial cells. Exp Cell Res 2007,
313: 3066-3075.
147
260. Yoo KH, Hennighausen L: EZH2 methyltransferase and H3K27 methylation in
breast cancer. Int J Biol Sci 2012, 8: 59-65.
261. Bachmann IM, Halvorsen OJ, Collett K, Stefansson IM, Straume O, Haukaas SA et al.:
EZH2 expression is associated with high proliferation rate and aggressive tumor
subgroups in cutaneous melanoma and cancers of the endometrium, prostate, and
breast. J Clin Oncol 2006, 24: 268-273.
262. Collett K, Eide GE, Arnes J, Stefansson IM, Eide J, Braaten A et al.: Expression of
enhancer of zeste homologue 2 is significantly associated with increased tumor cell
proliferation and is a marker of aggressive breast cancer. Clin Cancer Res 2006, 12:
1168-1174.
263. Kleer CG, Cao Q, Varambally S, Shen R, Ota I, Tomlins SA et al.: EZH2 is a marker of
aggressive breast cancer and promotes neoplastic transformation of breast epithelial
cells. Proc Natl Acad Sci U S A 2003, 100: 11606-11611.
264. Ding L, Erdmann C, Chinnaiyan AM, Merajver SD, Kleer CG: Identification of EZH2
as a molecular marker for a precancerous state in morphologically normal breast
tissues. Cancer Res 2006, 66: 4095-4099.
265. Kunju LP, Cookingham C, Toy KA, Chen W, Sabel MS, Kleer CG: EZH2 and ALDH-1
mark breast epithelium at risk for breast cancer development. Mod Pathol 2011, 24:
786-793.
266. Gonzalez ME, Li X, Toy K, DuPrie M, Ventura AC, Banerjee M et al.: Downregulation
of EZH2 decreases growth of estrogen receptor-negative invasive breast carcinoma
and requires BRCA1. Oncogene 2009, 28: 843-853.
267. Gonzalez ME, DuPrie ML, Krueger H, Merajver SD, Ventura AC, Toy KA et al.:
Histone methyltransferase EZH2 induces Akt-dependent genomic instability and
BRCA1 inhibition in breast cancer. Cancer Res 2011, 71: 2360-2370.
268. Puppe J, Drost R, Liu X, Joosse SA, Evers B, Cornelissen-Steijger P et al.: BRCA1deficient mammary tumor cells are dependent on EZH2 expression and sensitive to
Polycomb Repressive Complex 2-inhibitor 3-deazaneplanocin A. Breast Cancer Res
2009, 11: R63.
269. Ezhkova E, Pasolli HA, Parker JS, Stokes N, Su IH, Hannon G et al.: Ezh2 orchestrates
gene expression for the stepwise differentiation of tissue-specific stem cells. Cell
2009, 136: 1122-1135.
270. Ward PS, Thompson CB: Metabolic reprogramming: a cancer hallmark even
warburg did not anticipate. Cancer Cell 2012, 21: 297-308.
271. Vander Heiden MG, Cantley LC, Thompson CB: Understanding the Warburg effect:
the metabolic requirements of cell proliferation. Science 2009, 324: 1029-1033.
148
272. Sotgia F, Martinez-Outschoorn UE, Pavlides S, Howell A, Pestell RG, Lisanti MP:
Understanding the Warburg effect and the prognostic value of stromal caveolin-1 as
a marker of a lethal tumor microenvironment. Breast Cancer Res 2011, 13: 213.
273. Ertel A, Tsirigos A, Whitaker-Menezes D, Birbe RC, Pavlides S, Martinez-Outschoorn
UE et al.: Is cancer a metabolic rebellion against host aging? In the quest for
immortality, tumor cells try to save themselves by boosting mitochondrial
metabolism. Cell Cycle 2012, 11: 253-263.
149
Appendix A
Supplemental figures
Appendix A1: EMSA performed with increased amounts of 184hTERT nuclear extracts and Gb-270, mT4
and mT5 as probes (refer to Figure 17). Binding complexes (Shifts = S), non-specific binding complexes
(NS) and free probe (F) are indicated. Binding complexes were formed in the presence of no antibody (0),
BRG1 antibody from Santa Cruz (B1), BRG1 antibody from Abcam (B2) and ARID1A antibody (A).
Experiment performed by Crista Thompson.
150
Appendix A2: EMSA performed with 184hTERT and MCF-7 nuclear extracts and mT4 as the probe (refer
to Figure 17). Binding complexes (Shifts = S), non-specific binding complexes (NS) and free probe (F) are
indicated. Binding complexes were formed in the presence of no antibody (0), NRF-1 antibody (N), BRG1
antibody from Santa Cruz (B), ARID1A antibody (A), BAF180 antibody from Bethyl Laboratories,
catalogue number A301-591A (180) and BAF155 antibody (155) as well as antibody combinations as
indicated. Experiment performed by Crista Thompson.
151
Appendix A3: EMSA performed with poly dG:dC in lieu of dI:dC with 184hTERT nuclear extracts and
mT4 as the probe (refer to Figure 17). Binding complexes (Shifts = S), non-specific binding complexes
(NS) and free probe (F) are indicated. Binding complexes were formed in the presence of no antibody (0),
NRF-1 antibody (N) and BRG1 antibody from Santa Cruz (B). Experiment performed by Crista
Thompson.
152
Appendix A4: EMSA performed with MCF-7 nuclear extracts and Gb-270, mT4 and mT5 as probes (refer
to Figure 17). Binding complexes (Shifts = S), non-specific binding complexes (NS) and free probe (F) are
indicated. Binding complexes were formed in the presence of no antibody (0) and ARID1A antibody (A).
Experiment performed by Crista Thompson.
153
Appendix A5: EMSA performed with MCF-7 and SK-BR-3 nuclear extracts and Gb-270, mT4, mT5 and
mA6 as probes (refer to Figure 17). Binding complexes (Shifts = S), non-specific binding complexes (NS)
and free probe (F) are indicated. Binding complexes were formed in the presence of no antibody (0),
BAF155 antibody (155), BAF180 antibody from Bethyl Laboratories, catalogue number A301-591A (180)
and ARID1A antibody (A). Experiment performed by Crista Thompson.
154
Appendix A6: The transcriptional activity of the GABPβ proximal promoter was assessed via dual
luciferase assay. Two GABPβ promoter constructs were employed, -268/+194 which contains the NRF-1
binding site and -251/+194 which does not [161]. Promoter activity is expressed as relative light units with
the mean and standard deviation of three replicates shown. MCF-7 and SK-BR-3 cells were transfected
with siRNA against GAPDH (siGAPDH, negative control), NRF-1 (siNRF-1), BRG1 (siBRG1) and a
combination of siNRF-1 and siBRG1. P-values from paired one-sided t-tests are shown. No statistical
analysis was performed if the siRNA did not cause a reduction in promoter activity. Experiment performed
by Crista Thompson.
155
Appendix A7: The transcriptional activity of the GABPβ proximal promoter was assessed via dual
luciferase assay. Two GABPβ promoter constructs were employed, -268/+194 which contains the NRF-1
binding site and -251/+194 which does not [161]. Promoter activity is expressed as relative light units with
the mean and standard deviation of three replicates shown. 184hTERT cells were transfected with siRNA
against GAPDH (siGAPDH, negative control), NRF-1 (siNRF-1), BRG1 (siBRG1) and ARID1A
(siARID1A). No statistical analysis was performed as the siRNA did not cause a reduction in promoter
activity compared to the negative control. Experiment performed by Crista Thompson.
156
\
Appendix A8: The transcriptional activity of the GABPβ proximal promoter was assessed via dual
luciferase assay. Two GABPβ promoter constructs were employed, -268/+194 which contains the NRF-1
binding site and -251/+194 which does not [161]. Promoter activity is expressed as relative light units with
the mean and standard deviation of three replicates shown. SK-BR-3 cells were transfected with p3XFlag
(EV, negative control) and pCMV5 BRG1-Flag (BRG1). No statistical analysis was performed as the
exogenous BRG1 did not cause an increase in promoter activity compared to the negative control.
Experiment performed by Crista Thompson.
157
Appendix A9: The transcriptional activity of the BRCA1 proximal promoter was assessed via dual
luciferase assay. The BRCA1 promoter construct L6-pRL [57] encompasses the minimal promoter element
[54] including the critical RIBS site which interacts with GABP [55]. The cell lines indicated were
transfected with a non-targeting negative control siRNA, siControl-A (Santa Cruz, sc-37007), and a siRNA
against BRG1 (siBRG1). L6-pRL activity is presented in relation to negative controls for each cell line
with the mean and standard deviation of three replicates shown. The p-value from a paired one-sided t-test
is shown. No statistical analysis was performed if the siRNA did not cause a reduction in promoter
activity. Experiment performed by Crista Thompson.
158
Appendix A10: Quantitative RT-PCR for BRCA1 expression was performed on RNA harvested from
184hTERT cells grown on plastic as a monolayer (M) or after the indicated number of days of acini
formation and growth (e.g. Day 2 = D2) on Matrigel. TBP was used as the internal control. BRCA1
expression is expressed relative to the monolayer with the mean and standard deviation of three replicates
shown. Actual values are indicated above the bars. Experiment performed by Rachael Klinoski.
159
Appendix A11: Western blot analysis of ALDH1A1 and ALDH1A3 levels in breast cancer cell lines and
Hela cells. HepG2 lysates were included as a positive control for ALDH1A1. Anti-ALDH1A1 antibody
was provided by Abcam (EP1933Y). Apparent molecular weight markers (kDa) are indicated to the right
of the panel. Independent experiments were performed three times with one representative replicate
shown. Experiment performed by Crista Thompson.
160