Salicyloyl-aspartate synthesized by the acetyl

Transcription

Acta Biochimica et Biophysica Sinica Advance Access published July 10, 2013
Acta Biochim Biophys Sin 2013, xx: 1 – 10 | ª The Author 2013. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of
Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. DOI: 10.1093/abbs/gmt078.
Original Article
Salicyloyl-aspartate synthesized by the acetyl-amido synthetase GH3.5 is a potential
activator of plant immunity in Arabidopsis
Ying Chen†, Hui Shen†, Muyang Wang*, Qun Li*, and Zuhua He
Salicylic acid (SA) plays a critical role in plant immunity
responses against pathogen infection, especially in the establishment of systemic acquired resistance. Whether other
forms of salicylates also function in plant immunity has not
been explored. Our previous study has revealed that
salicyloyl-aspartate (SA-Asp), the only reported endogenous SA-amino acid conjugate in plants, was highly accumulated in the Arabidopsis activation-tagged mutant gh3.5-1D
after pathogen infection. In this study, we dissected SA-Asp
production in Arabidopsis. In vitro biochemical experiments showed that the GH3.5 protein could catalyze the
conjugation of SA with aspartic acid to form SA-Asp. SAAsp is not converted into free SA and likely acts as a
mobile molecule in plants. SA-Asp could induce pathogenesis-related (PR) gene expression and increase disease resistance to pathogenic Pseudomonas syringae. Our current
study also supports the notion that GH3.5 is a multifunction enzyme in plant hormone metabolism.
Keywords
salicyloyl-aspartate; GH3.5; plant immunity;
Arabidopsis
Received: February 24, 2013
Accepted: April 26, 2013
Introduction
Plants have developed a machinery of defense against pathogens during the long-term co-evolution with pathogens,
including activation of pathogenesis-related (PR) genes and
accumulation of phytoalexins in face of pathogen attack. In
the past decade, extensive studies have identified many key
components involved in defense signaling in Arabidopsis
[1–4]. In particular, systemic acquired resistance (SAR) is a
mechanism that can activate defense responses in distant
tissues uninfected and confer a long-lasting protection against
subsequent infections by a broad spectrum of microbes [4,5].
SAR requires the signal molecule salicylic acid (SA) and is
associated with the accumulation of PR proteins in intact
distant tissues. SA is essential for the establishment of not
only local resistance but also SAR during plant-pathogen
interactions. In particular, SA plays crucial role in defense response against biotrophic pathogens [5,6].
It has been shown that the majority (69%) of SA accumulated in systemic leaves was generated and transported from
the initial tobacco leaves inoculated with tobacco mosaic
virus [7]. However, the argument on whether SA is the
mobile signal lasted decades of years. Until to 2007, Park
et al. [8] discovered that an SA derivate methyl salicylate
(MeSA) is the mobile signal in tobacco SAR establishment,
accompanying the participation of the high SA affinity esterase SABP2 [9–12]. MeSA is synthesized from SA by an SA
methyl transferase [13], moved to the uninfected leaves
through the phloem, and then converted to SA by SABP2 to
establish SAR [8]. Similar SABP2 gene family AtMES was
also identified in Arabidopsis, which encoded potentially
active a/b fold hydrolases. Three members AtMES1, -7, or
-9 are SABP2 functional homologs, suggesting that MeSA is
a conserved SAR signal in Arabidopsis and tobacco [14].
However, a later study showed that most of MeSA is emitted
into the atmosphere, and only a small amount is retained in
plants [15]. Moreover, the abilities of MeSA generation and
SAR establishment do not coincide in several Arabidopsis
defense mutants, and mutants that are completely lack of
MeSA induction still increase systemic SA levels and develop
SAR upon pathogen inoculation. Therefore, MeSA is likely
dispensable for SAR at least in Arabidopsis [15].
Modifications of phytohormones play important roles in
hormone bioactivity and homeostasis whereby plants grow,
develop, and respond to diverse environments. Oxidation,
methylation, esterification, glucoslyation, and amino acid conjugation are major modification types of hormones [6,16–18].
Except MeSA as the methylated form of bioactive SA in
Acta Biochim Biophys Sin (2013) | Page 1
Downloaded from http://abbs.oxfordjournals.org/ at Shanghai Information Center for Life Sciences, CAS on July 22, 2013
National Key Laboratory of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences,
Chinese Academy of Sciences, Shanghai 200032, China
†
These authors contributed equally to this work.
*Correspondence address. Tel: þ86-21-54924122; Fax: þ86-21-54924123; E-mail: [email protected] (Q.L.); Tel: þ86-21-54924128;
Fax: þ86-21-54924123; E-mail: [email protected] (M.W.)
SA-Asp in plant immunity
Materials and Methods
Plant growth
The Arabidopsis seeds were germinated on plates with 0.5
Murashige and Skoog (MS) medium after being placed at
48C for 3 days. Then the plates were move to the green
house with a 9/15 h light/dark cycle at 19–218C with 70%
relative humidity. Seven-day-old seedlings were transferred
to soil under the same condition. All genotypes were in the
Col-0 background. sid2 was sid2-2, and eds5 was eds5-1.
Expression of the GH3.5 protein
The full-length gh3.5 cDNA was amplified from gh3.5-1D
with the primers: GH3.5-F 50 -GGATCCAAGAAAGAATC
TTTAGAGG-30 and GH3.5-R 50 -ACTCGAGCACTGTT
TGTGACCAGGA-30 . Two restriction sites GGATCC
(HindIII) and CTCGAG (XhoI) were introduced, respectively. The cDNA was inserted into the HindIII and XhoI sites of
the expression vector pGEX 4T-3. The expression plasmid
was transformed into Escherichia coli strain BL21 (DE3) to
produce the glutathione S-transferase (GST)-GH3.5 fusion
protein induced by 0.2 mM of isopropyl-b-D-thiogalactoside
at 288C. The fusion protein (97 kDa) was purified with
the MicroSpin GST Purification Module 27-4570-03 (GE
Healthcare, Uppsala, Sweden) for enzymatic activity test.
Determination of SA levels
Rosette leaves of 5-week-old plants were treated with 1 mM
or 1 mM SA-ASP, then were harvested at each time point,
and frozen with liquid nitrogen for following analyses. SA
extraction and determination were performed as previously
described [30,35]. In brief, O-anisic acid (O-ANI) was added
to each sample as internal standard. The samples were
finally dissolved in 20% methyl alcohol. A 5 mm, 15 4.6 mm ID Supelcosil LC-ABZ Plus column (Supelco,
Bellefonte, USA) was maintained at 278C and equilibrated
in 15% acetonitrile with 25 mM KH2PO4 ( pH 2.6) at a flow
rate of 1.0 ml/min. Each sample (100 ml) was injected. The
elution process began with 15% acetonitrile with 25 mM
KH2PO4 ( pH 2.6) for 1 min, then with a linear increase to
20% acetonitrile for 5 min and maintained for 10 min, and
increase to 55% acetonitrile for 17.5 min, finally to 90%
acetonitrile within 5 min. SA and O-ANI were quantified
using the fluorescence detector with 305 nm excitation/
365 nm emission for o-ANI and 305/407 nm for SA.
In vitro analysis of SA-Asp synthesis by GH3.5
The enzymatic activity of the fusion GST-GH3.5 protein to
conjugate SA and Asp was assayed in the buffer containing
50 mM Tris-HCl, pH 8.6, 3 mM MgCl2, 3 mM ATP, 1 mM
dithiothreitol, 1 mM SA, and 1 mM Asp at 228C according
to the method described by Staswick et al. [21], with the
plants [8,10,19], the major modifications of SA in plants
are glycosylation by UDP-glucosyltransferase to form SA
2-O-b-D-glucoside, which is considered as the pool of free
bioactive SA [20]. Plant hormones conjugated with amino
acids also constitute a large part of hormone forms. One of
the early auxin-responsive gene family GH3 (Gretchen
Hagen 3) encodes amino acid conjugating enzyme, which
catalyzes the conjugations of hormones indole-3-acetic acid
(IAA), jasmonic acid (JA), and amino acids and regulates
plant growth, development, and stress responses by accommodating levels and activity of phytohormones [21–23].
The GH3 family consists of enzymes that catalyze a variety
of reactions with a common start step, transferring of AMP
from ATP to the carboxylic acid group of an acyl substrate to
form an activated acyl-adenylate intermediate [23–25]. In
particular, JAR1 (AtGH3.11) encodes an adenylation synthetase that can catalyze the conjugation of JA with several
amino acids, including the most bioactive JA form JA-Ile
[22,23]. Many other GH3 members, such as GH3.2, GH3.3,
GH3.4, GH3.5, GH3.6, and GH3.17, also have the activity
of IAA-amido synthetase. These GH3 proteins may be responsible for biosynthesis of IAA-amido conjugates discovered in plants, including IAA-Ala, IAA-Leu, IAA-Asp,
and IAA-Glu, which are important in IAA metabolism.
Particularly, some IAA-amido conjugates act as temporary
storage of free IAA. For example, IAA-Ala and IAA-Leu are
found to be converted to free IAA through the action of
IAA-amido hydrolases [26–28]. Most recently, IAA-Asp
was found to stimulate disease through regulating virulence
gene expression, highlighting a novel mechanism that
increases plant susceptibility to pathogens through auxin
conjugation [29].
The Arabidopsis GH3.5 protein is a multifunctional
acetyl-amido synthetase that shows adenylating activity on
both IAA and SA in vitro [21,23]. Our previous study has
shown that gh3.5 plays dual regulation role in both SA
and auxin signaling during pathogen infection [30].
Overexpression of the gh3.5 gene in the activation-tagged
mutant gh3.5-1D leads to elevated accumulation of both free
SA and IAA, and impairs several PR genes-mediated resistance [30,31]. Salicyloyl-aspartate (SA-Asp) is the only kind
of SA-amino acid conjugate found in plants [32,33].
Previously, GH3.12 was identified as a synthetase to conjugate amino acids with 4-substituted benzoates (SA precursors) and the conjugation was inhibited by SA [34].
However, no enzyme has been identified as the SA-Asp
synthetase, and nor its function in plant immunity. We
detected high levels of SA-Asp in gh3.5-1D after pathogen
infection [30], suggesting that GH3.5 might also have the
capacity of catalyzing the SA-Asp formation. In this study,
we reported that GH3.5 can adenylate SA with Asp to form
SA-Asp, and that SA-Asp plays a role in activating plant
immunity with less growth harm than SA.
b-glucuronidase activity
Marked rosette leaves of 40-day-old PR1::GUS transgenic
plants (provided by Dr Philippe Reymond, Department of
Plant Molecular Biology, University of Lausanne, Switzerland)
were treated with 1 mM SA, 1 mM SA-Asp, or ddH2O (with
0.25% alcohol; v/v), respectively. b-glucuronidase (GUS)
staining was done as previously described [36].
For GUS fluorometric determination [36], soluble proteins
were extracted from the leaves grinded in 50 mM NaH2PO4,
pH 7.0, 10 mM ethylenediaminetetraacetic acid, 0.1% Triton
X-100, 0.1% sodium lauryl sarcosine, and 10 mM 13mercaptoethanol (extraction buffer) on ice. The fluorogenic
reaction was carried out in 1 mM 4-methylumbelliferylb-D-glucuronide extraction buffer with a reaction volume of
1 ml. Fluorescence was measured with a DyNA Quant 200
fluorimter (Hoefer Pharmacia Biotech, Holliston, USA).
Fluorescence of 1 mM 4-methylumbelliferone in reaction
buffer was used as standard. Protein concentrations were
determined by the dye-binding method of Bradford [37].
GUS activities were calculated from protein concentrations
and relative fluorogenic intensities.
Bacterial inoculation and disease assessment
Bacterial strains were grown on King’s B medium agar
plates at 288C containing proper antibiotics for 2 days.
Bacteria were collected and suspended in 10 mM MgCl2.
After 24 h sprayed with SA, SA-Asp, or ddH2O, three leaves
of each plant were syringe-infiltrated with a bacterial suspension of 105 cfu/ml. All controls were infiltrated with 10 mM
MgCl2 as mock inoculation. The whole treated leaves were
immediately harvested after infiltration and 3 days after
inoculation. Leaves were gently washed by ddH2O for
three times and dried with absorbent paper. Five or six
leaves were pooled as a sample. Three or four samples for
each time point were statistically analyzed. Bacterial growth
and colony forming units were measured as previously
described [38].
Analysis of gene expression
For real-time quantitative polymerase chain reaction (qPCR)
analysis, plants were harvested and frozen immediately
with liquid nitrogen. Total RNA was isolated using Trizol
(Invitrogen, Carlsbad, USA), 1 mg of total RNA was converted into cDNA using the SuperScriptw III First-Strand
Synthesis System according to the manufacture’s instruction
(Invitrogen). The cDNA was diluted with 60 ml ddH2O and
then stored at 2208C. About 2 ml of the resulting cDNA
was used for the qPCR analyses. qPCR was performed using
SYBRw Premix Ex Taq (TaKaRa, Dalian, China) and
Mastercycler Ep Realplex2 machine (Eppendorf, Hamburg,
Germany). In detail, 2 ml diluted cDNA, 0.4 ml (10 mM)
forward primer, 0.4 ml (10 mM) reverse primer, 10 ml 2
premix, and 7.2 ml ddH2O were mixed in the reaction
system. Amplicon dissociation curves were recorded after cycle
40 according to the manufacturer’s instructions (Eppendorf).
Ten-fold serial dilutions (1 : 4 diluted cDNA mentioned
above was used as the highest template concentration) of one
sample were performed and used in separate PCR reactions
to detect efficiencies for each primer pair. Actin2 was used
as internal control. The primer pairs used were: Actin2,
AGTGTCTGGATCGGTGGTTC and CCCCAGCTTTTTA
AGCCTTT; and PR1, TTCTTCCCTCGAAAGCTCAA
and CGCTACCCCAGGCTAAGTTT. The products are a
149-bp fragment of Actin2 (At3g18780) and a 201-bp fragment of PR1 (At2g14610), which were confirmed by sequencing. Relative expression levels were calculated by
normalizing with Actin2. All values were shown as the
mean + SD (n ¼ 3). Similar results were observed in three
independent experiments. *P , 0.05, **P , 0.01 were considered significant, based on Student’s t-test.
Detection on movement of 2H-labeled SA-ASP in plants
2
H-labeled SA was purchased from Sigma (Cat No. 616796;
St Louis, USA), and 2H-labeled SA-Asp was synthesized
according to the method described by Bourne et al. [33].
Three leaves of each 5-week-old Col-0 plants were smeared
with 1 mM 2H-labeled SA-Asp, followed SA-Asp by inoculating with Psm(avrRPM1) (OD600 ¼ 1) 3 h later. Mock inoculation was used as control. At 6, 24, 48 h after pathogen
inoculation, the smeared leaves, opposite leaves, upper
leaves, and systemic leaves were harvested and frozen in
liquid nitrogen for SA-Asp measurements.
About 0.1 g frozen leaves were ground in liquid nitrogen
to a fine powder using Retsch MM400 mixer mill (Retsch
GmbH, Haan, Germany). Then, 1 ml of 90% methanol was
added to each sample. Samples were sonicated for 20 min,
and centrifuged for 20 min at 15,000 g at 48C. The supernatant was transferred to a new tube, and the pellet was
re-extracted with 1 ml 90% methanol. The two supernatants
were combined and vacuum dried, and frozen at 2808C.
Each sample was re-suspended in 500 ml of 30% methanol.
GST protein as control. The reaction was stopped by adding
equal volume methyl alcohol and then the mixtures were
centrifuged at 20,000 g for 20 min. The supernatant was
diluted with equal volume H2O for quantification. The conjugated product (SA-Asp) was quantified with an Agilent
1260 HPLC system (Santa Clara, USA) and detected using
the diode-array detector (DAD) with 300 nm. A 5 mm,
4.6 150 mm Zorbax eclipse XDB-C18 column (Agilent
Tech-nologies, Santa Clara, USA) was maintained at 258C
and equilibrated in 75% H2O with 0.1% formic acid and
25% acetonitrile at a flow rate of 1.0 ml/min and 20 ml of
each sample was injected. The retention time of SA-Asp was
2.92 min. The SA-Asp standard was synthesized according
to the method described by Bourne et al. [33].
2
Results
GH3.5 catalyzes SA-Asp formation in vitro
GH3.5 has adenylation activity on SA in vitro [23]. We first
determined the catalytic activity of GH3.5 in SA-Asp biosynthesis in vitro using the GH3.5-GST fusion protein produced in E. coli. As shown in Fig. 1(A), the GH3.5-GST
fusion protein but not the GST protein control could conjugate SA and Asp to form SA-Asp, as revealed by highperformance liquid chromatography (HPLC). The capacity
of GH3.5 catalyzing IAA and Asp to form IAA-Asp was
used as the positive control (Supplementary Fig. S1). With
ultraviolet spectral scanning [Fig. 1(B)], SA-Asp has a characteristic absorption peak at 300 nm. The yield of SA-Asp
increased linearly along with the reaction time [Fig. 1(C),
inset]. The standard curve of SA-Asp was constructed by
Agilent 1260 HPLC spectroscopy [Fig. 1(D)]. These results
confirmed that the GH3.5 protein could catalyze the biosynthesis of SA-Asp, and also supported the notion that GH3.5
is a multifunctional acetyl-amido synthetase [23,30,39].
SA-Asp is a weaker inducer of PR gene expression with
less growth harm than SA
SA plays a critical role in plant defense, especially in the establishment of SAR. However, direct spray-application of high
concentration SA causes injury in plants. Therefore, 1 mM is
the widely used concentration for SA application in defense
studies. Even with this concentration, some visible damage
lesions were also caused on Arabidopsis leaves, and 5 mM SA
Figure 1 SA-Asp conjugation by GH3.5 in vitro (A) HPLC profile for analysis of GH3.5 activity on the conjugation reaction of SA and Asp. The
reaction time was 3 h. (B) The ultraviolet absorbent spectrum of SA-Asp detected by Agilent 1260 HPLC spectroscopy analysis. (C) HPLC profiles with
DAD detection on 300 nm to analyze SA-Asp biosynthesis with different reaction time. (D) The standard curve of SA-Asp constructed by Agilent 1260
HPLC spectroscopy.
H-labeled SA-Asp was identified by reverse-phase ultraperformance liquid chromatography-coupled electrospray
ionization quadrupole time-of-flight mass spectrometry
(UPLC/ESI-QTOF-MS) (Agilent Technologies). A 2.7 mm,
4.6 50 mm poroshell 120E C18 (Agilent Technologies)
column was maintained at 258C and equilibrated in 0.1%
formic acid with 40% methanol at a flow rate of 0.2 ml/min.
The injection volume of each sample was 6 ml. Eluted
compounds were detected from m/z 100–1000 using a
MicrOTOF-Q hybrid QTOF-MS equipped with an Apollo II
electrospray ion source in positive ion modes using the
following instrument settings: tune 1700 low 2 GHZ,
Nebulizer pressure 40 psig, drying gas N2 350 C 9 l/min,
ESI Vcap 4000 V, fragmentor 160 V, skimmer 65 V, and
Oct RF Vpp750 V.
could kill plants completely [Fig. 2(A)]. Whereas with the
same concentrations, SA-Asp caused less damage than SA
did. The damage caused by 3 mM SA-Asp was similar to that
by 1 mM SA, and even 10 mM SA-Asp did not kill plants
[Fig. 2(A), Supplementary Fig. S2]. Therefore, SA-Asp is
less harmful than SA.
Since SA-Asp is largely accumulated in plants after pathogen infection [30], we suspected that it is not subjected to
Figure 2 Tissue damage and PR1 induction by SA-Asp and SA in Arabidopsis (A) Leaf damage caused by different concentrations of SA and SA-Asp
at 24 h after SA and SA-Asp treatment. (B) Relative expression levels of PR1 in Col-0 at 24 h after SA and SA-Asp treatment with different concentrations.
Values are shown as the mean + SD (n ¼ 3). (C) Relative expression levels of PR1 in Col-0 after 1 mM SA and SA-Asp treatment in a time course. Values
are shown as the mean + SD (n ¼ 3).
degradation and might have biological activity in immunity
activation. We first determined the capacity of SA-Asp
induction of the PR1 gene that has been widely used as the
SA-mediated immunity marker [5]. Results showed that
SA-Asp is not converted into free SA and likely acts as a
mobile molecule
GH3.12 (PBS3) can conjugate amino acids to 4-substituted
benzoates, and the new compounds might trigger SA biosynthesis [34]. We first determined whether SA-Asp could be
converted into free SA. We found that the levels of total and
Figure 4 Measurement of SA and SA-Asp distribution in SA-Asp treated plants (A) Free SA levels in the SA-Asp treated plants. Values are shown as
the mean + SD (n ¼ 3). (B) Total SA levels in the SA-Asp treated plants. Values are shown as the mean + SD (n ¼ 3). (C) SA-Asp levels in systemic and
upper leaves of SA-Asp treated plants. L, local leaves; S, systemic leaves.
Figure 3 The induction of the PR1::GUS reporter in transgenic plants
(A) Expression of the GUS reporter in the PR1::GUS plants. (B) GUS
activity in the PR1::GUS plants. Values are shown as the mean + SD
(n ¼ 3). *P , 0.05, **P , 0.01, based on Student’s t-test.
the PR1 gene could be induced by SA-Asp [Fig. 2(B)].
Time-course induction of PR1 showed that the expression
level of PR1 is significantly induced by SA (1 mM) at 3 h
and gets the peak induction at 12 h [Fig. 2(C)]. SA-Asp
treatment induced similar pattern of PR1 expression;
however, the induction of PR1 expression was much weaker
than by SA, with the induction peak at 24 h [Fig. 2(C)].
Treatment with 3 mM SA-Asp caused similar tissue damage
as 1 mM SA (Supplementary Fig. S2), and similar induction peak also occurred at 12 h by 3 mM SA-Asp
(Supplementary Fig. S3). Similar induction pattern was
also observed for the PR1 promoter-GUS reporter that is inducible in the presence of the SAR inducers SA and
2,6-dichloroisonicotinic acid [40], with more and faster induction by SA than SA-Asp in both local and systemic
leaves (Fig. 3). Taken together, we concluded that SA-Asp
is a weak inducer of plant immunity.
disease resistance in Arabidopsis. To test this hypothesis,
the ability of SA-Asp in resistance induction against Pst
DC3000 was determined. After treatment with SA-Asp
(1 mM) for 24 h, Pst DC3000 was inoculated, using SA
(1 mM) as a control. As usually, SA treatment could significantly enhance disease resistance with 0.64–0.9 log decrease in bacterial growth in Col-0, and the SA deficient
mutants sid2 and eds5 [Fig. 5(A–C)]. SA-Asp (1 mM) treatment also slightly enhanced disease resistance with 0.2–
0.41 log decrease in bacterial growth in Col-0, sid2, and
eds5 [Fig. 5(A–C)]. These results were consistent with PR1
induction [Fig. 2(B,C)]. Since 3 mM SA-Asp caused similar
tissue damage as 1 mM SA (Supplementary Fig. S2) and
induced higher PR1 expression compared with 1 mM SAAsp (Supplementary Fig. S3), we also measured disease resistance induced by 3 mM SA-Asp. As shown in Fig. 5(D),
treatment with 3 mM SA-Asp could significantly enhance
disease resistance to Pst DC3000.
Discussion
SA-Asp enhances disease resistance to Pseudomonas
syringae
We have shown that PR1 could be induced by SA-Asp, indicating that SA-Asp might play a role in the induction of
Amido modification of hormones plays an important role in
hormone homeostasis, thereby is essential in plant growth
and development. For example, the vast majority (90%) of
Figure 5 P. syringae growth in Col-0, sid2, and eds5 plants treated with SA and SA-Asp Leaves were pretreated with SA, SA-Asp, or buffer (mock)
24 h prior to infection with Pst DC3000 (105 cfu/ml). Bacterial titers were measured at 0 and 3 dpi. Values are shown as the mean + SD (n 3). Similar
results were observed in three independent experiments. *P , 0.05, **P , 0.01, based on Student’s t-test. (A) Growth of Pst DC3000 in Col-0 plants treated
with 1 mM SA and 1 mM SA-Asp. (B) Growth of s Pst DC3000 in sid2 plants treated with 1 mM SA and 1 mM SA-Asp. (C) Growth of Pst DC3000 in eds5
plants treated with, 1 mM SA and 1 mM SA-Asp. (D) Growth of Pst DC3000 in Col-0 plants treated with 1 mM SA and 3 mM SA-Asp.
free SA were not significantly changed in the local and systemic leaves treated with SA-Asp (1 mM and 1 mM)
[Fig. 4(A,B)]. Results suggested that SA-Asp is not converted into free SA nor primes SA biosynthesis.
MeSA can move to systemic leaves, and is converted into
free SA by the SA binding esterase SABP2, thereby acts as a
mobile signal in SAR establishment in tobacco [8] but not in
Arabidopsis [15]. This encouraged us to investigate whether
SA-Asp is a mobile molecule in Arabidopsis. We synthesized 2H-labeled SA-Asp and treated Col-0 leaves with
1 mM 2H-labeled SA-Asp together with or without inoculation with Psm(avrRpm1). We measured the levels of
2
H-labeled SA-Asp in untreated leaves at 0, 6, 24, and 48 h
after treatment (Supplementary Table S1). Results showed
that a small part of 2H-labeled SA-Asp could be detected in
untreated leaves with both Psm(avrRpm1) inoculation and
non-inoculation [Fig. 4(C)]. Therefore, we suggested that
SA-Asp is likely a mobile molecule in plants, and its mobilization is not stimulated by pathogen infection.
Supplementary Data
Supplementary data are available at ABBS online.
Acknowledgements
We would like to thank Prof. Fred Ausubel (Harvard
Medical School, Boston, USA) for providing the sid2-2
mutant and Dr Philippe Reymond (University of Lausanne,
Lausanne, Switzerland) for providing PR1::GUS plants.
Funding
This work was supported by the grants from the Ministry of
Science and Technology of China (2011CB100700 and
2007AA10Z107).
References
1 Glazebrook J. Genes controlling expression of defense responses in
Arabidopsis. Curr Opin Plant Biol 2001, 4: 301– 308.
2 Hammond-Kosack KE and Parker JE. Deciphering plant– pathogen communication: fresh perspectives for molecular resistance breeding. Curr Opin
Biotechnol 2003, 14: 177 –193.
3 Jones JD and Dangl JL. The plant immune system. Nature 2006, 444:
323– 329.
4 Spoel SH and Dong X. How do plants achieve immunity? Defence without
specialized immune cells. Nat Rev Immunol 2012, 12: 89 – 100.
5 Durrant WE and Dong X. Systemic acquired resistance. Annu Rev
Phytopathol 2004, 42: 185– 209.
6 Vlot AC, Dempsey DMA and Klessig DF. Salicylic acid, a multifaceted
hormone to combat disease. Annu Rev Phytopathol 2003, 47: 177– 206.
7 Shulaev V, Leon J and Raskin I. Is salicylic acid a translocated signal of systemic acquired resistance in tobacco? Plant cell 1995, 7: 1691– 1701.
8 Park SW, Kaimoyo E, Kumar D, Mosher S and Klessig DF. Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science
2007, 318: 113– 116.
9 Kumar D and Klessig DF. High-affinity salicylic acid-binding protein 2 is
required for plant innate immunity and has salicylic acid-stimulated lipase
activity. Proc Natl Acad Sci USA 2003, 100: 16101– 16106.
10 Forouhar F, Yang Y, Kumar D, Chen Y, Fridman E, Park SW and Chiang Y,
et al. Structural and biochemical studies identify tobacco SABP2 as a
methyl salicylate esterase and implicate it in plant innate immunity. Proc
Natl Acad Sci USA 2005, 102: 1773– 1778.
11 Kumar D, Gustafsson C and Klessig DF. Validation of RNAi silencing specificity using synthetic genes: salicylic acid-binding protein 2 is required for
innate immunity in plants. Plant J 2006, 45: 863 –868.
12 Kumar D and Klessig DF. The search for the salicylic acid receptor led to
discovery of the SAR signal receptor. Plant Signal Behav 2008, 3: 691 –692.
13 Dudareva N, Raguso RA, Wang J, Ross JR and Pichersky E. Floral scent
production in Clarkia breweri. III. Enzymatic synthesis and emission of benzenoid esters. Plant Physiol 1998, 116: 599– 604.
14 Vlot AC, Liu PP, Cameron RK, Park W, Yang Y, Kumar D and Zhou F,
et al. Identification of likely orthologs of tobacco salicylic acid-binding
protein 2 and their role in systemic acquired resistance in Arabidopsis
thaliana. Plant J 2008, 56: 445 – 456.
15 Attaran E, Zeier TE, Griebel T and Zeier J. Methyl salicylate production and
jasmonate signaling are not essential for systemic acquired resistance in
Arabidopsis. Plant Cell 2009, 21: 954– 971.
16 Woodward AW and Bartel B. Auxin: regulation, action, and interaction. Ann
Bot 2005, 95: 707– 735.
17 Erb M and Glauser G. Family business: multiple members of major phytohormone classes orchestrate plant stress responses. Chemistry 2010, 16:
10280– 10289.
18 Dempsey DA, Vlot AC, Wildermuth MC and Klessig DF. Salicylic acid biosynthesis and metabolism. In: Somerville CR and Meyerowitz EM eds. The
Arabidopsis Book 9. Rockville, MD: American Society of Plant Biologists,
2011, e0156. doi: 10.1199/tab.0156, www.aspb.org/publications/arabidopsis/.
IAA exists as IAA-amino acid conjugates, and only ,1%
exists as bioactive free IAA in Arabidopsis [41,42]. It has
been reported that many of the gh3 gene family members
have the capacity to adenylate IAA with different amino
acids to form IAA-amido conjugates, and then play important roles in IAA homeostasis that control plant growth and
development [21,23,30]. As a defense hormone, the biosynthesis of SA has been extensively studied, and several key
enzyme genes have been identified including PAL, ICS1,
ICS2, EDS1, and PAD4 [43–52]. However, the turnover of
SA in plants has been less studied. SA-Asp is the only
SA-amido conjugate found in plants [30,32,33]. However,
the biosynthesis and function of SA-Asp are elusive. We
now confirmed that the acetyl-amido synthetase GH3.5
catalyzes the conjugation of SA and aspartic acid in
Arabidopsis. We postulated that SA-Asp found in other
plant species is also generated by GH3.5 homologs [32,33].
Our previous study has shown that GH3.5 is involved in
the biosynthesis of the phytoalexin camalexin likely through
directly catalyzing the formation of a novel intermediate
indole-3-acyl-cysteinate [ICA(Cys)] [39]. Our current finding
further supported the notion that GH3.5 is a multifunctional
acetyl-amino synthetase. It will be worth investigating the
crystal structure, substrate binding feature, and catalytic core
of the GH3.5 protein towards different substrates.
Plants have evolved a complex defense network against
different biotic invasion. SAR is an efficient inducible
defense mechanism conferring a long-lasting resistance to a
broad-spectrum of pathogens. The controversy about the systemic signal(s) in SAR has lasted for decades. There are
several candidate signals that contribute to the SAR establishment, including MeSA [8,53], jasmonates [54–56],
azalaic acid [57], glycerol-3-phosphate [58,59], lipid-based
molecules [60–62], and a group of peptides [63–65].
Different signals may take part in specific systemic resistance dependent on plant species and invading pathogens.
SA-Asp indeed induced the activation of PR genes and
defense, albeit at weaker degree than SA (Figs. 2, 3, and 5).
We have shown that SA-Asp can move from treated leaves
to untreated leaves [Fig. 4(B)]. The potential role of SA-Asp
as a mobile molecule in SAR establishment is worthy of
being further explored. Moreover, less toxicity raises the
possibility of its application as a novel fungicide.
38 Katagiri F, Thilmony R and He SY. The Arabidopsis thaliana-Pseudomonas
syringae interaction. In: Somerville CR and Meyerowitz EM eds. The
Arabidopsis Book 1. Rockville, MD: American Society of Plant Biologists,
2002, e0039. doi: 10.1199/tab.0039, www.aspb.org/publications/arabidopsis/.
39 Wang M, Liu X, Chen Y, Xu X, Yu B, Zhang S and Li Q, et al. Arabidopsis
acetyl-amido synthetase GH3.5 involvement in camalexin biosynthesis
through conjugation of indole-3-carboxylic acid and cysteine and upregulation of camalexin biosynthesis genes. J Integr Plant Biol 2012, 54:
471– 485.
40 Cao H, Bowling SA, Gordon AS and Dong X. Characterization of an
Arabidopsis mutant that is nonresponsive to inducers of systemic acquired
resistance. Plant Cell 1994, 6: 1583– 1592.
41 Normanly J, Cohen JD and Fink GR. Arabidopsis thaliana auxotrophs reveal
a tryptophan-independent biosynthetic pathway for indole-3-acetic acid.
Proc Natl Acad Sci USA 1993, 90: 10355 –10359.
42 Tam YY, Epstein E and Normanly J. Characterization of auxin conjugates in
Arabidopsis. Low steady-state levels of indole-3-acetyl-aspartate,
indole-3-acetyl-glutamate, and indole-3-acetyl-glucose. Plant Physiol 2000,
123: 589 –596.
43 Wanner LA, Li G, Ware D, Somssich IE and Davis KR. The phenylalanine
ammonia-lyase gene family in Arabidopsis thaliana. Plant Mol Biol 1995,
27: 327 – 338.
44 Zhou N, Tootle TL, Tsui F, Klessig DF and Glazebrook J. PAD4 functions
upstream from salicylic acid to control defense responses in Arabidopsis.
Plant Cell 1998, 10: 1021– 1030.
45 Falk A, Feys BJ, Frost LN, Jones JD, Daniels MJ and Parker JE. EDS1, an
essential component of R gene-mediated disease resistance in Arabidopsis
has homology to eukaryotic lipases. Proc Natl Acad Sci USA 1999, 96:
3292– 3297.
46 Nawrath C and Métraux JP. Salicylic acid induction-deficient mutants of
Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 1999, 11: 1393 – 1404.
47 Feys BJ, Moisan LJ, Newman MA and Parker JE. Direct interaction between
the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4.
EMBO J 2001, 20: 5400 – 5411.
48 Wildermuth MC, Dewdney J, Wu G and Ausubel FM. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 2001,
414: 562 –565.
49 Cochrane FC, Davin LB and Lewis NG. The Arabidopsis phenylalanine
ammonia lyase gene family: kinetic characterization of the four PAL isoforms. Phytochemistry 2004, 65: 1557 –1164.
50 Rohde A, Morreel K, Ralph J, Goeminne G, Hostyn V, De Rycke R and
Kushnir S, et al. Molecular phenotyping of the pal1 and pal2 mutants of
Arabidopsis thaliana reveals far-reaching consequences on phenylpropanoid, amino acid, and carbohydrate metabolism. Plant Cell 2004, 16:
2749– 2771.
51 Garcion C, Lohmann A, Lamodière E, Catinot J, Buchala A, Doermann P
and Métraux JP. Characterization and biological function of the
ISOCHORISMATE SYNTHASE2 gene of Arabidopsis. Plant Physiol
2008, 147: 1279– 1287.
52 Huang J, Gu M, Lai Z, Fan B, Shi K, Zhou YH and Yu JQ, et al. Functional
analysis of the Arabidopsis PAL gene family in plant growth, development,
and response to environmental stress. Plant Physiol 2010, 153: 1526 –1538.
53 Koo YJ, Kim MA, Kim EH, Song JT, Jung C, Moon JK and Kim JH, et al.
Overexpression of salicylic acidcarboxyl methyltransferase reduces salicylic
acid-mediated pathogen resistance in Arabidopsis thaliana. Plant Mol Biol
2007, 64: 1– 15.
54 Lee GI and Howe GA. The tomato mutant spr1 is defective in systemin perception and the production of a systemic wound signal for defense gene expression. Plant J 2003, 33: 567– 576.
55 Thorpe MR, Ferrieri AP, Herth MH and Ferrieri RA. 11C-imaging: methyl
jasmonate moves in both phloem and xylem promotes transport of
19 Park SW, Liu PP, Forouhar F, Vlot AC, Tong L, Tietjen K and Klessig DF.
Use of a synthetic salicylic acid analog to investigate the roles of methyl salicylate and its esterases in plant disease resistance. J Biol Chem 2009,
284: 7307– 7317.
20 Dean JV, Mohammed LA and Fitzpatrick T. The formation, vacuolar localization, and tonoplast transport of salicylic acid glucose conjugates in
tobacco cell suspension cultures. Planta 2005, 221: 287 –296.
21 Staswick PE, Serban B, Rowe M, Tiryaki I, Maldonado MT, Maldonado MC
and Suza W. Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3-acetic acid. Plant Cell 2005, 17: 616–627.
22 Staswick PE and Tiryaki I. The oxylipin signal jasmonic acid is activated by
an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 2004,
16: 2117 –2127.
23 Staswick PE, Tiryaki I and Rowe ML. Jasmonate response locus JAR1 and
several related Arabidopsis genes encode enzymes of the firefly luciferase
superfamily that show activity on jasmonic, salicylic, and indole-3-acetic
acids in an assay for adenylation. Plant Cell 2002, 14: 1405– 1415.
24 Kleinkauf H and Von Dohren H. A nonribosomal system of peptide biosynthesis. Eur J Biochem 1996, 236: 335 –351.
25 Chang KH, Xiang H and Dunaway-Mariano D. Acyladenylate motif of the
acyl-adenylate/thioester-forming enzyme superfamily: a site-directed mutagenesis study with the Pseudomonas sp. strain CBS3 4-chlorobenzoate: coenzyme A ligase. Biochemistry 1997, 36: 15650– 15659.
26 Bandurski RS, Cohen JD, Slovin JP and Reinecke DM. Hormone biosynthesis and metabolism B1: auxin biosynthesis and metabolism. In: Davies
PJ ed. Plant Hormones: Physiology, Biochemistry and Molecular Biology.
2nd edn. Boston: Kluwer Academic Publishers, 1995.
27 Ljung K, Hull AK, Kowalczyk M, Marchant A, Celenza J, Cohen JD and
Sandberg G. Biosynthesis, conjugation, catabolism and homeostasis of
indole-3-acetic acid in Arabidopsis thaliana. Plant Mol Biol 2002, 50:
309– 332.
28 Rampey RA, LeClere S, Kowalczyk M, Ljung K, Sandberg G and Bartel B.
A family of auxin-conjugate hydrolases that contributes to free indole-3acetic acid levels during Arabidopsis germination. Plant Physiol 2004, 135:
978– 988.
29 González-Lamothe R, El Oirdi M, Brisson N and Bouarab K. The conjugated auxin indole-3-acetic acid-aspartic acid promotes plant disease development. Plant Cell 2012, 24: 762– 777.
30 Zhang Z, Li Q, Li Z, Staswick PE, Wang M, Zhu Y and He Z. Dual regulation role of GH3.5 in salicylic acid and auxin signaling during ArabidopsisPseudomonas syringae interaction. Plant Physiol 2007, 145: 450– 464.
31 Zhang Z, Wang M, Li Z, Li Q and He Z. Arabidopsis GH3.5 regulates salicylic acid-dependent and both NPR1-dependent and independent defense
responses. Plant Signal Behav 2008, 3: 537 – 542.
32 Steffan H, Ziegler A and Rapp A. N-Salicyloyl-aspartic acid: a new phenolic
compound in grapevines. Vitis 1988, 27: 79– 86.
33 Bourne DJ, Barrow KD and Milborrow BV. Salicyloylaspartate as an endogenous component in the leaves of Phaseolus vulgaris. Phytochemistry
1991, 30: 4041– 4044.
34 Okrent RA, Brooks MD and Wildermuth MC. Arabidopsis GH3.12 (PBS3)
conjugates amino acids to 4-substituted benzoates and is inhibited by salicylate. J Biol Chem 2009, 284: 9742 – 9754.
35 Dewdney J, Reuber TL, Wildermuth MC, Devoto A, Cui J, Stutius LM and
Drummond EP, et al. Three unique mutants of Arabidopsis identify eds loci
required for limiting growth of a biotrophic fungal pathogen. Plant J 2000,
24: 205 – 218.
36 Jefferson RA, Kavanagh TA and Bevan MW. GUS fusions: b-glucuronidase
as a sensitive and versatile gene marker in higher plants. EMBO J 1987,
6: 3901 – 3907.
37 Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem 1976, 72: 248– 254.
56
57
58
59
61 Buhot N, Gomès E, Milat ML, Ponchet M, Marion D, Lequeu J and Delrot S,
et al. Modulation of the biological activity of a tobacco LTP1 by lipid
complexation. Mol Biol Cell 2004, 15: 5047–5052.
62 Lascombe MB, Bakan B, Buhot N, Marion D, Blein JP, Larue V and Lamb
C, et al. The structure of ‘defective in induced resistance’ protein of
Arabidopsis thaliana, DIR1, reveals a new type of lipid transfer protein.
Protein Sci 2008, 17: 1522– 1530.
63 Huffaker A, Pearce G and Ryan CA. An endogenous peptide signal in
Arabidopsis activates components of the innate immune response. Proc Natl
Acad Sci USA 2006, 103: 10098 –10103.
64 Huffaker A and Ryan CA. Endogenous peptide defense signals in
Arabidopsis differentially amplify signaling for the innate immune response.
Proc Natl Acad Sci USA 2007, 104: 10732– 10736.
65 Yamaguchi Y, Pearce G and Ryan CA. The cell surface leucine-rich repeat
receptor for AtPep1, an endogenous peptide elicitor in Arabidopsis, is functional in transgenic tobacco cells. Proc Natl Acad Sci USA 2006, 103:
10104– 10109.
60
jasmonate, and of photoassimilate even after proton transport is decoupled.
Planta 2007, 226: 541– 551.
Truman W, Bennett MH, Kubigsteltig I, Turnbull C and Grant M.
Arabidopsis systemic immunity uses conserved defense signaling pathways
and is mediated by jasmonates. Proc Natl Acad Sci USA 2007, 104:
1075– 1080.
Jung HW, Tschaplinski TJ, Wang L, Glazebrook J and Greenberg JT.
Priming in systemic plant immunity. Science 2009, 324: 89 –91.
Chanda B, Xia Y, Mandal MK, Yu K, Sekine KT, Gao QM and Selote D,
et al. Glycerol-3-phosphate is a critical mobile inducer of systemic immunity
in plants. Nat Genet 2011, 43: 421– 427.
Mandal MK, Chanda B, Xia Y, Yu K, Sekine KT, Gao QM and Selote D,
et al. Glycerol-3-phosphate and systemic immunity. Plant Signal Behav
2011, 6: 1871– 1874.
Maldonado AM, Doerner P, Dixon RA, Lamb CJ and Cameron RK. A putative lipid transfer protein involved in systemic resistance signaling in
Arabidopsis. Nature 2002, 419: 399 – 403.

Salicyloyl-aspartate synthesized by the acetyl

Transcription

Similar documents

What Is GH3 And Where Did

Conference Book - Epsilon Open Archive

3. Results - publish.UP

Herbivore-induced, indirect plant defences

RIKEN Plant Science Center

here - Webpage Thomas Pradeu

Optimal immune defence in the light of variation in lifespan

Journal of Cell Science Accepted manuscript

The evolution of costly acquired immune memory

Influence of Soil Chemistry and Plant Physiology in the

studies on peroxisome associated proteolytic

PDF - Multinational Arabidopsis Steering Committee

Here - 21st International Conference on Arabidopsis Research

1 - Monash University Research Repository

CARACTERIZAÇÃO FUNCIONAL DE UMA

Mast cell activation disorders: chronic urticaria

The Role of Arabidopsis thaliana P80 in Inositol Signaling

Cellulose Biosynthesis Inhibitors - buleria

The Law as King and the King as Law: Is a President Immune from

Another One Bites the Dust: Missouri Puts to Rest Uncertainty about

Hilscher_Diss MTH_titelblaetter

Juliana Cabral Oliveira