docBreeds and their DNA
download 
Report Transcription
Breeds and their DNA
How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 1. Breeds and their DNA 2. What does the DNA tell us? 3. What does DNA not tell us? 4. Two theses for the Discussion Breeds and their DNA Different phenotypes « variation in DNA: adaptive variation But we do not always know where! Somewhere in genome 3.000.000.000 bp, 25.000 genes Genetic diversity studies via neutral variation - microsatellites, polymorphic -CACACACACA - - CACA- loci » forensic DNA profiling » most genetic diversity studies - SNPs, single nucleotide polymorphisms ACGATGGCATAGGAAAAATA ACGATGGCATGGGAAAAATA - mitochondrial DNA: maternal history - Y-chromosomal DNA: paternal history Breeds and their DNA Species DNA variants of a gene Breeds and their DNA Species DNA variants of a gene: variation within a species < differences between species DNA variants are shared by breeds Breeds Mutations much older than breeds A breed carries ~80% of total diversity Breeds and their DNA Species DNA variants are specific for the species DNA variants are shared by breeds Breeds Mutations much older than breeds A breed carries ~80% of total diversity Differences in allele frequencies by genetic drift Breed-specific variants are rare (where is the uniqueness?) Breeds and their DNA new wisdom in human genetics DNA variants are shared by breeds Races Mutations much older than breeds Races carry ~90% of total diversity Differences in allele frequencies by genetic drift Breed-specific variants are rare. “concept of race - - social prejudice” Breeds and their DNA Current consensus in conservation genetics (FAO MoDAD report 1994, EU projects) Neutral variation is a substitute of adaptive variation for assessing the conservation value DNA variants are shared by breeds Breeds Mutations much older than breeds A breed carries ~80% of total diversity Differences in allele frequencies by genetic drift Breed-specific variants are rare ☺ Genetic drift informative for breed relationships and history How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 1. Breeds and their DNA 2. What does the DNA tell us? cattle sheep horse 3. What does DNA not tell us? 4. Two theses for the Discussion Cattle breeds Data: 110 breeds, 20-50 animals/breed, 30 microsatellites Highest DNA diversity in South-East Europe Geographic distribution of 3 types of cattle Fewer DNA variants Many DNA variants Cattle breeds Data: 110 breeds, 20-50 animals/breed, 30 microsatellites Highest DNA diversity in South-East Europe Geographic distribution of 3 types of cattle « Neolithic migration routes « influence of European aurochs? « 2 separate developments of dairy cattle Further subdivision » more recent spreading of popular breed types North Central South Cattle breeds Data: 110 breeds, 20-50 animals/breed, 30 microsatellites Highest DNA diversity in South-East Europe Geographic distribution of 3 types of cattle « Neolithic migration routes « influence of European aurochs? « 2 separate developments of dairy cattle Further subdivision » more recent spreading of popular breed types black-pied, red, Shorthorn, Ayrshire, alpine-brown, alpine spotted » regional types British, Iberian, Nordic, Balkan Cattle breeds ☺ Molecular classification follows geography ☺ Historic information Conservation values? + Diversity in southeast + Some breeds: separate history - Several (near) duplicates Sheep breeds Mitochondrial DNA » Southwest Asian origin Data 2005: 31 microsatellites, 1748 sheep, 57 breeds » SW Asian/SE European/SW-European/NW-central clusters » West-Europe: weak geographic differentiation » Clear loss of diversity from southeast to northwest Sheep breeds Breed representation Microsatellites for sheep not informative ☺ Data 2010: 50.000 single-nucleotide polymorphisms (SNPs), 2819 sheep, 74 breeds from 5 continents + 55 wild or feral sheep Sheep breeds on the origin of wool SMF0018 SMF0003 SMF0019 SMF0027 SMF0004 SMF0012 SMF0020 SMF0005 SMF0013 SMF0021 SMF0006 SMF0014 SMF0022 SMF0016 SMF0026 SMF0028 SMF0007 SMF0023 AMF0001 AMF0003 AMF0004 SOA5147 SOA0904 SOA2143 SOA1952 SOA2623 SOA2624 SOA2631 SOA4103 SOA2536 GG AG GG AA AG AG GG GG GG GG AA AG GG GG AA GG GG GG AA AA AA GG AG GG GG GG GG GG GG GG GG GG GG GG GG GG GG AA GG AG AG AG GG GG GG GG AG GG GG GG GG GG GG GG GG GG GG GG GG GG AG GG AG GG GG AA AG AG GG AG GG AG AG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG AG GG GG GG GG GG AG GG AG GG GG GG GG GG GG AA GG GG GG GG GG GG GG GG GG GG AA AA AA AG AA AA AA AG AG AG AA AG AA AA AG AG AG AG AA AG AG 00 00 00 00 00 00 00 00 00 GG GG AG AG GG AG GG AG GG AG GG GG AG GG GG GG AG GG GG GG GG AG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG GG AG GG GG GG GG AG AG GG 00 AG GG GG GG GG GG GG AG GG GG GG AG GG AA AG GG AG AG AG AA AA GG AG GG AG GG GG AG GG AA GG AA GG AG AG GG AG AG AG AA GG GG GG GG AG GG GG GG AG AG GG GG AG GG GG GG GG AG AG 00 AA GG GG GG GG GG GG GG GG GG GG AA AG GG AG AG AG AG AA AG AA GG AG AG GG AG AG GG AG GG GG AG AG GG GG GG AG GG GG AG AG AG GG GG GG GG AG AG GG AG AG AG AG AG GG GG AG AG GG GG GG AA AG AA GG AA AA AG AA AA GG GG GG GG GG GG AG GG GG GG GG GG GG AG GG GG GG GG AG GG GG GG GG GG GG GG GG GG GG GG GG GG AG AG AG GG AG GG AA GG GG AG GG AG AG GG GG AA AA GG AA AG AG AG AA AA AG AG AG AG GG GG GG GG GG GG GG GG AG GG AG GG GG GG GG AG GG GG GG GG AG AG AG GG GG AG AG GG GG GG AG AG AG AA GG AG AA AA AG AG AG AG AG AG AA AG AG GG AG AA AG 00 00 00 00 00 00 00 00 00 GG AG AA AA AA AA AA AA AG AA AG AA AA AA AA AA AA AA GG AA GG GG GG GG GG GG GG GG GG GG AA AG AA AG AG AG AA AG AA AG AG GG AA AG AG AA GG GG 00 AA AA GG GG AG AG GG AA AG AG GG AG AA AG AG AA AA GG AG AG AA AG AG AG AG AG AA AG AA GG GG GG AG GG GG AG AG AG GG AG AG AA AA AA AA AA AA AG AA AG AA AG AA AA AA AA AA AA AA GG AA AG 00 00 00 00 00 00 00 00 00 AG GG AG GG AG AG GG GG GG GG GG GG AA GG GG GG GG AG GG GG GG AG AA AA AG AG AG AA AG AA AG AG AG AG GG AG AG AG AA AG AG GG GG AG AA AA GG AG AG GG AG 00 00 00 00 00 00 00 00 00 GG AG GG GG GG GG GG GG GG GG AG AG GG GG GG GG AA AG GG GG AG 00 00 00 00 00 00 00 00 00 AA AA AA GG AA AA AG AG AA AA AA AG AG AA AG AA AG AG AG AA AA GG GG GG GG GG GG AG GG GG AG AA AG AG AG AG AG GG AA AG AG AA AG AA AG AA AA GG GG AA AG GG AG GG GG GG GG GG GG AG AG AG AG AG GG GG AA AG AG AG AG GG AG AG GG GG AG AG GG GG GG 00 00 00 00 00 00 00 00 00 AA AG AA AG AG AA AG AA AG AG AG GG AG AG AG AG GG AG 00 AA AG 00 00 00 00 00 00 00 00 00 GG AG GG AG GG 00 AG AG GG AG AA GG GG GG GG AA GG AG AA GG AG AG GG AG GG GG AG GG AG AG GG AG GG GG GG AG AG AG AG GG AA GG GG GG GG AG GG AG AA AA AA 00 00 00 00 00 00 00 00 00 Sheep breeds on the origin of wool Cluster analysis » geographic groups of related breeds Scottish isles Dorset British Friesian » geographic gene pools Asian African American Hybrid Dorper Supervised clustering with feral mouflons, descending from Sardinian Black early domestic sheep European mouflon Sardinian mouflon » remnants of most primitive sheep mainly in northern Europe Sheep breeds on the origin of wool Phylogenetic networks representing genetic distances » geographic clusters » lines of descent Branch lengths » genetic drift = divergence + inbreeding Root at position of wild ancestor: Asian mouflon Asian mouflon Sheep breeds on the origin of wool Primitive hair sheep were later replaced by wool sheep, but when and where? Columella (4-70): during Roman era still many hair sheep Plinius the Elder (25-79), Naturalis Historia 8, 190: The most praised wool is that of Apulia, which in Italy is named the Greek sheep wool, but in other countries is named Italian - - The wool of Apulia is of a short staple, and specially in request for cloaks and mantles, and nothing else. About Tarentum and Canusium, the richest of this kind are found Exactly where SNPs place the origin of sheep! Tarentine sheep exported to Syria, Black Sea, Spain, Britain Sheep breeds on the origin of wool Wool trading was a vital component of the Roman economy Hypothesis: demand of high-quality wool drove export and expansion of Southern Italian wool sheep. These became the ancestors of most sheep around the world. Sheep breeds on the origin of wool Successive expansions of profitable types of sheep. 1. 8.000-10.000 BCE Primitive hair sheep 2. Roman period: Tarentine wool sheep 3. From early Middle Ages: English wool sheep 4. From late Middle Ages: Spanish Merino wool sheep esi Ha an flin Du ger tch She Dra ft t She land2 tla -N Mi nd1- L nia Eu t u Ap re r pal Po Fal oosa ny abe Ice lla lan Fjo dic rd Ko n Me iks re Ha ns ckn Fel ey l Iris Tinh Co Shi ker b re We l We sh1 Da lsh2 r Co tmor n e Ca nema m Ten poli ra Ka ness na s Ne pianee w Lip For e i Grozane st r n An inge da r Lus lusia ita n Ara no bia n Th oro Tro ugh tte bre d Wa r r FW mblo arm od Wa blo 2-NL rm od1 blo od NL -Eu r Fri Horse breeds Van de Goor et al., VHL, in press Data: 17 microsatellites, 35 breeds Clustering » Differentiation of Cold blood/Pony/N-European/Full, warm-blood Horse breeds Van de Goor et al., in press Phylogenetic networks ☺ Differentiation of Cold blood/Pony/N-European/Full, warm-blood Separate position of Friesian horse by inbreeding ny Po sa ni Mi loo pa Ap Shetland NL Falabella Eur Icelandic Hackney Tenessee Connemara Fjord Koniks Dutch Draft Andalusian Lusitano Wa Haflinger Merens Fell od blo rm ob C sh Iri Sh i Tin re ker We We lsh1 lsh2 Friesian Kaspian New Forest Lipizaner Groninger Campolina Arabian ThoroughDartmore Trotterbred How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 1. Breeds and their DNA 2. What does the DNA tell us? cattle sheep horse 3. What does DNA not tell us? 4. Two theses for the Discussion What does DNA tell us? ☺ About history of livestock ☺ About high diversity » valuable for conservation primitive breeds near domestication site ☺ About a separate history » valuable uniqueness Italian Chianina cattle, Scottish Soay sheep, etc. About a recent origin » conservation less urgent many synthetic or upgraded breeds Genetic distances based on neutral variation just indicate genetic drift by inbreeding many breeds! Instant diversity by genetic isolation ☺ New consensus in conservation genetics Neutral variation is NOT a substitute of adaptive variation Go for the adaptive variation! Genomic sequencing! How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 1. Breeds and their DNA 2. What does the DNA tell us? Mainly the history! 3. What does DNA NOT tell us? 4. Two theses for the Discussion What does DNA not tell us? Other reasons for conservation (Not yet) Valuable traits ☺ Morphology, productivity, local adaptation A unique trait does not imply a large contribution to the diversity DNA diversity and uniqueness are separate criteria for conservation Cultural heritage, tradition, social function Most breeds are only few 100 years old Dutch belted Most breeds are of mixed origin e.g., Dutch Belted influenced by Galloway Conserve the phenotype, but not ‘genetic purity’, consider outcrossing, even crossbreeding Guelder Avoid inbreeding defects Encourage molecular analysis of traditional trait: mutation, geographic range, history Friesian Deep red How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 1. Breeds and their DNA 2. What does the DNA tell us? Mainly the history! 3. What does DNA NOT tell us? 4. Two theses for the Discussion How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 Genetisch zuiverheid zit tussen je oren How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 Genetisch zuiverheid zit tussen je oren Met een genetisch zuiver dier zit je in de problemen How differ breeds in their DNA J.A. Lenstra Themadag SZH/ WUR, December 3. 2010 Genetisch zuiverheid zit tussen je oren Met een genetisch zuiver dier zit je in de problemen Neutrale DNA variatie zegt meer over de geschiedenis dan over de waarde van een ras Een ras kan uniek een waardevol zijn zonder veel bij te dragen aan de genetische diversiteit