Feofanov Alexander S. Arseniev and Alexey V. Peter M. Kolosov

Transcription

Membrane Biology:
Point mutations in dimerization motifs of
transmembrane domain stabilize active or
inactive state of the EphA2 receptor
tyrosine kinase
George V. Sharonov, Eduard V. Bocharov,
Peter M. Kolosov, Maria V. Astapova,
Alexander S. Arseniev and Alexey V.
Feofanov
J. Biol. Chem. published online April 14, 2014
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 0 references, 0 of which can be accessed free at
http://www.jbc.org/content/early/2014/04/14/jbc.M114.558783.full.html#ref-list-1
Downloaded from http://www.jbc.org/ by guest on April 24, 2014
Access the most updated version of this article at doi: 10.1074/jbc.M114.558783
JBC Papers in Press. Published on April 14, 2014 as Manuscript M114.558783
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M114.558783
Switching of EphA2 by transmembrane helix-helix interaction
Point mutations in dimerization motifs of transmembrane domain stabilize active
or inactive state of the EphA2 receptor tyrosine kinase*
George V. Sharonov1,2, Eduard V. Bocharov1, Peter M. Kolosov3, Maria V. Astapova1, Alexander S.
Arseniev1, and Alexey V. Feofanov1,4
1
From the Department of Structural Biology, Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry
RAS, 117997 Moscow
2
From the Faculty of Medicine, Moscow State University
3
From the Department of Molecular Neurobiology, Institute of Higher Nervous Activity and
Neurophysiology of RAS
4
From the Biological Faculty, Moscow State University
*Running title: Switching of EphA2 by transmembrane helix-helix interaction
Keywords: Receptor tyrosine kinase; Eph receptors; protein domains; membrane proteins;
transmembrane domain; alternative dimerization; flow cytometry; cell surface receptor
Background: Isolated Eph transmembrane
domains (TMD) dimerize in membrane-mimetics
but functional significance of these interactions is
unclear.
Results: Mutations introduced into alternative
dimerization motifs of EphA2 TMD affect
oppositely receptor activity.
Conclusion: Alternative TMD interactions
promote either active or inactive EphA2
conformation.
Significance: Involvement of TMD
interactions in Eph receptor activity is discovered
for the first time.
TMD interactions for full-length EphA2 we
substituted key residues in the heptad repeat
motif (HR variant: G539I, A542I, G553I) or in
the glycine zipper motif (GZ variant: G540I,
G544I) and expressed YFP-tagged EphA2 (wild
type (WT), HR and GZ variants) in HEK293T
cells. Confocal microscopy revealed similar
distribution of all EphA2-YFP variants in cells.
Expression of EphA2-YFP variants, their
kinase activity (phosphorylation of Tyr588
and/or Tyr594) and ephrin-A3 binding were
analyzed with a flow cytometry on a single cell
basis. Activation of any EphA2 variant is found
to occur even without ephrin stimulation when
EphA2 content in cells is sufficiently high.
Ephrin-A3 binding is not affected for mutant
variants. Mutations in TMD have significant
effect on EphA2 activity. Both liganddependent and ligand-independent activities are
enhanced for HR variant and reduced for GZ
variant as compared to WT. These findings
allow us to suggest TMD dimerization switching
between the heptad repeat and glycine zipper
motifs, corresponding to inactive and active
receptor states, respectively, as a mechanism
underlying EphA2 signal transduction.
ABSTRACT
EphA2 receptor tyrosine kinase plays a
central role in regulation of cell adhesion and
guidance in many human tissues. Activation of
EphA2 befalls after proper dimerization/
oligomerization in the plasma membrane,
which occurs with participation of extracellular
and cytoplasmic domains. Our recent studies
revealed that isolated transmembrane domain
(TMD) of EphA2 embedded into lipid bicelle
dimerized
via
heptad
repeat
motif
L535X3G539X2A542X3V546X2L549,
rather
than
through alternative glycine zipper motif
A536X3G540X3G544 (typical for TMD dimerization
in many proteins). To evaluate significance of
1 Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
To whom correspondence should be addressed: Alexey V. Feofanov, Department of Structural Biology,
Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry RAS, ul. Miklukho-Maklaya 16/10, 117997
Moscow, Russia, Tel.:+7(495)3366455; E-mail: [email protected].
Receptor tyrosine kinases of the Eph family
and their ephrin ligands are key regulators of cellcell and cell-matrix adhesion, coordinating cell
migration and positioning in various adult and
embryonic tissues of human organism (1, 2).
EphA2 receptor, a representative of the human
fourteen-member Eph family, controls such
diverse processes as capillary stabilization by
pericytes (3), keratinocyte movement out of basal
layer (2), blastocyst entry into endometrial layer
(4), and cardiac stem cells mobilization from niche
(5). Activation of EphA2 leads to cell detachment
(mobilization), loss of intercellular contacts (an
increase in cell layer permeability) or cell
repulsion (guidance).
A classical model of EphA2 activation
assumes the binding of a ligand (ephrin) situated at
the membrane of a neighboring cell followed by
dimerization of ephrin-EphA2 complexes and
phosphorylation of Tyr residues in cytoplasmic
domain of EphA2 (6, 7). Accumulating evidences
suggest that even without ligands EphA2 can form
EphA2-EphA2 homo-dimers and oligomers
(clusters) (7, 8) that facilitate formation of
signaling (ephrin-EphA2)2 hetero-tetramers (9). At
high local concentration of EphA2 the receptor
oligomerization is accompanied with a ligandindependent receptor activation (7). Structural
studies revealed several sites that are involved in
ligand-dependent and ligand-independent EphA2
oligomerization. These sites were found along the
extended extracellular domain (ECD), consisting
of fibronectin III repeats (FN1 and FN2), ligand
binding and cysteine-rich domains (LBD and
CRD), as well as in a cytoplasmic SAM domain
situated after tyrosine kinase domain (TKD) (7, 9,
10).
Functional
importance
of
EphA2
oligomerization via ECD was confirmed by using
site-directed mutagenesis and cell-based signaling
assays (7, 10). At the same time, participation of a
single-span transmembrane domain (TMD) in the
EphA2 activation was not studied yet.
It should be mentioned that the view of TMD
as a mere membrane anchor of receptors has
changed dramatically over last decade. An
advanced concept considers TMD as regulators of
dynamic receptor assembly, conformational
switching and signal transduction (11–17). To a
large degree this concept is based on the findings
obtained for isolated TMD that were either
expressed in bacterial membrane or reconstituted
in membrane-like environment or simulated by
2 Downloaded from http://www.jbc.org/ by guest on April 24, 2014
computational modeling. Investigations of fulllength receptors confirm this concept, but a list of
studied proteins is rather limited: Neu/ErbB2
epidermal growth factor receptor 2 (18), fibroblast
growth factor receptors (19, 20), platelet derived
growth factor receptor A (21), erythropoietin
receptor (22), neuropilin-1 (23), p75 neurotrophin
receptor (24), T-cell receptor (25), class II major
histocompatibility complex (26), integrins (27),
syndecan-4 (28), E-cadherin (29), and amyloid
precursor protein (30).
Recently we have shown that isolated TMD
helices of EphA2 dimerized in membranemimicking environment (31). Being embedded
into lipid bicelles they formed a left-handed dimer
via
heptad
repeat
motif
L535X3G539X2A542X3V54X2L549 (Fig. 1A). TMD of
EphA2 contains another recognized dimerization
sequence A536X3G540X3G544 (Fig. 1B), the socalled glycine zipper (32). Interactions via the
glycine zipper motif were not observed for EphA2
TMD in the bicelles. At the same time isolated
TMDs of EphA1 receptor formed two alternative
dimers via similar N-terminal glycine zipper and
presumably via C-terminal GG4-like dimerization
motif, which was in fact the part of a heptad repeat
sequence (33, 34). Appearance of an alternative
dimerization mode was induced by the
deprotonation of the E547 side chain, resulting in
local structure perturbations near the N-terminal
glycine zipper and a realignment of the helix-helix
packing in the EphA1 TMD dimer (33). Moderate
changes in lipid composition of the bicelles caused
an alteration in the observed conformational
exchange (33). Thus, depending on external and
local membrane environment as well as ligand
binding, EphA1 TMD can be involved in different
types of association. Accordingly we have
hypothesized about dimerization of TMD in fulllength EphA2 receptors which could occur with
participation of either heptad repeat or glycine
zipper motif (31).
Here we present experimental proof of a
functional importance of TMD interactions for the
EphA2
receptor.
To
characterize
TMD
participation in the EphA2 receptor activation we
substituted key residues in the heptad repeat motif
(HR variant) or in the glycine zipper motif (GZ
variant) and expressed wild type (WT), HR and
GZ variants of EphA2 tagged with yellow
fluorescent protein (YFP) in HEK293T human
embryonic kidney cells. We found significant
disturbance of ligand-dependent and ligand-
EXPERIMENTAL PROCEDURES
Cloning and mutagenesis of human EphA2–
The full-length cDNA encoding EphA2 was
cloned into pTagYFP-N (neo) vector (Evrogen)
under the control of CMV RNA polymerase II
promoter as described previously (35). The PCR
primers used for the generation of EphA2 mutants
are the following (5’ to 3’):
G553I: GAAGCCAACTATTGCCAGCAC
G544I: AGCAGGACCACAATGACAGCCAC
G540I: ACAGCCACGATGCCAATCAC
A536I: GCCAATCACTATCAAGTTGCCAG
G539I; A542I:
ACACCGACAATCACGCCGATAATCACCG
Mutagenesis procedure was carried out
according to the PCR-based “megaprimer” method
(36). Two rounds of PCR were performed with the
same PCR mixture. To get “megaprimer” in the
first PCR round a direct primer was always 5′GCACGAATTCCAGACGCTGTC -3′ (EcoRI site
is underlined), and a reverse primer was one of
mutant primers 1-5 listed above. In the second
PCR round the “megaprimer” served as a direct
primer, and a reverse primer was 5′TTTGTCGACATGGGGATCCCCACAGTGTTC
A-3′ (revpr_SalI, the SalI site underlined). The
first round was carried out in 25 µl reaction
mixture containing 20 ng of pTagYFP-EphA2
DNA, 0.48 µM direct primer and 0.6 µM reverse
mutant primer, 0.2 mM dNTP, Pfu DNA
polymerase reaction buffer (1×) and 0.75 U of
PfuTurbo DNA polymerase (Stratagene). The
denaturation was carried out at 95°C (3 min) in the
first cycle and at 94°C (30 s) in the next 20–25
cycles. The amplification included 30 s of the
primer annealing (60°C) and 40 s of elongation
(72°C). The second round was performed after
addition to the PCR mixture of 12 pmol of the
reverse primer (revpr_SalI) and 1.25 U of
PfuTurbo DNA polymerase. Amplification with
‘megaprimer’ was performed during 28 cycles (30
s at 94°C, 40 s at 65°C and 140 s at 72°C). The
resulting 1370 bp PCR product was purified in 1%
agarose) using DNA extraction kit (Promega),
hydrolyzed with EcoRI and SalI, and ligated with
pTagYFP-EphA2 plasmid, treated with the same
endonucleases. The resulting pTagYFP-EphA2
DNA having point mutation was further utilized to
introduce next mutation exactly as described
above. The final ligated mixtures were utilized for
the transformation of E. coli, strain T10. The
cloned DNAs were sequenced, and characterized
clones were used in experiments.
EphA2
expression,
stimulation
and
fluorescent staining–HEK293Т cells were cultured
in DMEM culture medium with low glucose and
sodium pyruvate (HyClone) supplemented with
10% fetal bovine serum (HyClone). Cells were
seeded in a 6-well plate, and in 24 h they were
transfected with 1 μg of EphA2-YFP plasmid
(WT, HR or GZ) mixed with 2.5 μl of
lipofectamine 2000 (Invitrogen) per well. Two
days after transfection the cells were washed,
placed in serum free medium for 5 h, harvested
using Versene solution (Paneco, Russia),
resuspended in PBS at a final concentration of
(3±1)×106 cells/ml and kept at 37°C. Cells were
activated either with 7 μg/ml of dimeric ephrin-A3
(R&D Systems) or with a mixture of 7 μg/ml
ephrin-A3 and 2 μg/ml anti-human Fc-specific
Cy5-labeled
antibodies
(Cy5-ab,
Jackson
Immunoresearch). In the last case 5:1 ephrinA3:Cy5-ab molar mixture was prepared 30 min
before application and resulted in the formation of
Cy5-labeled clusters of ephrin-A3 (ephrinA3/Cy5) (37). In 2, 5 and 10 min after activation
100 μl of cell suspension was picked out and fixed
in 200 μl of 2% paraformaldehyde (SigmaAldrich) or diluted to 12 ml with PBS and fixed
with 0.5% paraformaldehyde. Last protocol was
used for ephrin-A3/Cy5 stimulated cells in order to
reduce nonspecific ligand cross-linking. Cells were
fixed at 20°C for 10 minutes, washed twice and
stained with antibodies in Perm/Wash buffer (BD
Biosciences) supplemented with 1% fatty acid free
bovine serum albumin (PAA). Cells were
incubated with primary rabbit antibodies (Abcam,
cat. #ab62256) that recognize phosphorylated
tyrosines 588 and 594 in an intracellular
juxtamembrane domain (JMD) of activated EphA2
(pEphA2). After 45 min incubation the cells were
washed and stained with secondary anti-rabbit
DyLight-649- or TRITC-labeled (for staining of
ephrin-A3/Cy5 stimulated cells) antibodies having
minimized
cross-reactivity
(Jackson
Immunoresearch).
Confocal microscopy–In 48 h after
transfection cells were seeded in the wells of Lab-
independent activity (phosphorylation) of HR and
GZ variants as compared to WT receptor. It is the
first time involvement of TMD in the activation of
the receptor tyrosine kinase of the Eph family is
discovered supplementing available biophysical
and biochemical data with useful insights into Eph
functioning at the molecular level.
RESULTS
A role of TMD interactions was studied using
YFP-tagged EphA2 and two variants of EphA2YFP with point mutations introduced into either
the heptad repeat motif of TMD (HR variant) or
the glycine zipper motif of TMD (GZ variant)
(Fig. 1B). In the HR variant, three key weakly
polar residues (G539, A542 and G553) situated at
the helix-helix packing interface (Fig. 1B) of the
EphA2 TMD dimer (31) were substituted with
bulky hydrophobic isoleucine residues. GZ variant
containing two mutations, G540I and G544I, was
created to verify our hypothesis (31) that two
dimerization motifs are involved in stabilization of
alternative structures of EphA2 dimers upon a
signal transduction. Similar amino acid
substitutions strongly diminished dimerization of
isolated EphA1 TMD occurring via homologous
glycine zipper motif (34). In either case the
introduced mutation should disturb the EphA2
dimerization via the mutated motif and affect
receptor functioning, if the corresponding
dimerization mode is realized for a full-length
receptor.
Earlier we have demonstrated that the EphA2
receptors tagged with YFP or cyan fluorescent
protein on C-terminus and expressed in HEK293T
cells bind ephrins, form dimers (oligomers) and
pEphA2 increase of 500 fluorescence units over
background level. Ability to activation AA is
inversely proportional to AEL and calculated as
104/AEL. Integrated activity is an area under the
fitted sigmoidal curve within the range of the
observed EphA2-YFP intensity values. Six
independent experiments were carried out, and
their results were averaged. Statistical analysis was
performed with paired t-test in Prism software
(GraphPad). Each time point for each experiment
gave a total of n=24 data point pairs for statistical
analysis.
Molecular modeling of TMD dimer-Molecular
modeling of the self-association of EphA2 TMD
(residues 532-562) was performed with the
PREDDIMER program (38). The set of five dimer
structures was predicted with the FSCOR values
varied from 1.593 to 2.426. The right-handed
dimer formed via glycine zipper motif (Fig. 1C)
received the best rank (FSCOR =2.426). The second
rank (FSCOR =2.197) was given to the left-handed
dimer formed via the heptad repeat motif. Its helix
packing interface was similar to the NMR-derived
structure (Fig. 1A) (31).
Tek chambered covergalss (Nunc) and analyzed on
a next day with TCS SP5 confocal microscope
(Leica) with 63× oil-immersion objective and 514nm excitation line of argon laser.
Flow cytometry and data analysis–Cells were
analyzed with either FACSCanto II or
LSRFortessa (both from BD Biosciences).
Fluorescence of EphA2-YFP, pEphA2-TRITC and
pEphA2-DyLight649 (or ephrin-A3/Cy5) were
measured with 488, 562 and 633 nm excitation
wavelengths and 530/30, 585/15 and 660/20
emission bandpass filters, respectively. No
fluorescence spillover was observed between these
channels, and therefore compensation was not
applied.
Two-dimensional
(2D)
cytograms
of
pEphA2-DyLight649 vs. EphA2-YFP (Fig. 2)
were recalculated into dependences of EphA2YFP activity on receptor amount in cells in the
following way. Data were processed with FloJo
software (Treestar) where cells were gated on
forward and side scatter and then with a specially
written script. Briefly, the measured cells were
subdivided into 15 segments in accordance with
EphA2-YFP content (EphA2-YFP fluorescence
intensity). For each segment an average EphA2YFP activity (average pEphA2 fluorescence
intensity) was calculated after correction for
unresponsive cells. Note, JMD phosphorylation of
EphA2-YFP was inhomogeneous over cells within
a sample. Most cells responded to ephrin-A3
stimulation by increasing pEphA2, but some cells
retained background level of EphA2 activity
because of unknown reasons (Fig. 2). To discern
such unresponsive cells we performed the fitting
of frequency distribution of pEphA2 in cells
(within each of 15 segments) with two Gaussian
curves. The curve with a higher average pEphA2
value corresponded to responsive cells, and this
average value was taken as a measure of EphA2
activation at a particular amount of EphA2-YFP in
cells. Calculated dependences of EphA2-YFP
activity on receptor amount in cells were fitted
with sigmoidal curve with variable slope (Fig. 2),
and simultaneously background levels of EphA2YFP activity were defined.
To compare abilities of WT, HR and GZ
variants of EphA2 to activation we have analyzed
the dependences of pEphA2-DyLight649 on
EphA2-YFP and introduced parameters called
activating expression level (AEL), ability to
activation (AA) and integrated activity (IA). AEL
is amount of EphA2-YFP in cells that provides the
in cells (Fig. 2, 4B). AA values averaged over six
independent experiments are as follows:
1.27±0.08, 0.93±0.08 and 0.84±0.1 (Mean±SEM)
for HR, WT and GZ receptors, respectively (Fig.
4B).
Ephrin-A3
induces
enhancement
of
phosphorylation for all variants of EphA2-YFP
(Fig. 2, 4). This enhancement is observed for most
of cells including those with high receptor content,
i.e. with increased level of ligand independent
phosphorylation (Fig. 2). As shown by us earlier
(35), activation of WT EphA2-YFP with ephrin
A3 occurs in a transient (pulse-like) manner in
cells. It achieves a maximum in ca. 2 min after
ligand addition and decays to the initial level in ca.
20 min. Similar behavior is observed for ligandinduced activation of HR, and GZ variants of
EphA2-YFP (Fig. 4). The intensity of ligandinduced activation was found to decrease in the
row of receptor variants HR > WT > GZ. This
behavior remains unchanged for cells with various
contents of receptors in different periods after
ligand addition (Fig. 2) and is reproduced in
independent experiments (Fig. 4). Paired t-test of
all time points for six independent experiments
gave a significant 1.15±0.01-fold increase
(p=0.0015) of AA for the HR variant and a
1.54±0.22-fold decrease (p=0.04) for the GZ
mutant as compared to WT receptor. Similar
differences were observed for IA values that were
1.34±0.02-fold higher (p=0.008) for the HR
variant and 1.30±0.17-fold lower (p=0.013) for the
GZ variant as compared to WT EphA2-YFP.
There were no significant deviations from these
values for particular time points immediately
following the ligand addition. Thus, mutations in
the heptad repeat motif of TMD enhance ligandinduced receptor activation as opposed to the
mutations in the glycine zipper motif that reduce
it.
DISCUSSION
Using quantitative flow cytometry-based
approach in order to measure EphA2-YFP
phosphorylation in single cells a set of data was
obtained that clarified the role of TMD in the
receptor functioning. Applying the original
algorithm of data analysis we were able to monitor
and compare activation of the WT, HR and GZ
variants of EphA2-YFP in cells with various
receptor content. It should be noted that high
expression level of EphA2 was reported to realize
in malignant states (41, 42), whereas most normal
participate in ligand-induced phosphorylation (35,
39). Accordingly, WT, HR and GZ variants of
EphA2-YFP were transiently expressed in the
HEK293T cells. Confocal microscopy analysis
revealed similar cellular localization and
distribution of EphA2-YFP variants and absence
of novel features associated with the introduced
mutations (Fig. 3A). Ligand-binding properties of
EphA2-YFP variants were compared with the aid
of preclustered fluorescent ephrin-A3/Cy5 and
flow cytometry. A linear relationship between
ephrin-A3/Cy5
binding
and
EphA2-YFP
expression was observed in 2D cytograms (Fig.
3B) for most of cells except for a fraction of cells
with high EphA2-YFP expression level. A partial
decrease in ligand binding with such cells can
point to an overexpression-related increase in the
intracellular receptor pool that is inaccessible for
ephrin-A3. A slope of the linear part of the ephrinA3/Cy5 binding dependence on EphA2-YFP
content in cells (characterizing the amount of
bound ligand per receptor) is identical for all
EphA2-YFP variants (Fig. 3B). Therefore, the
introduced mutations affect neither externalization
nor ephrin-binding properties of HR and GZ
variants as compared to WT receptor.
Receptor activity was analyzed for each
individual cell by flow cytometry (Fig. 2) using
specific antibodies that recognize phosphorylated
tyrosines 588 and 594 in JMD. Phosphorylation of
these tyrosines in EphA2 was shown to be critical
for signal transduction (40). In accordance with
previously published data (7) receptors were found
to be partially activated even without a ligand
addition (Fig. 2). As shown earlier, such type of
activation is induced by ligand-independent
dimerization (oligomerization) of receptors (7). In
our
experiments
ligand-independent
phosphorylation grows as a function of the
receptor content in cells. It occurs for all variants
of EphA2-YFP, being greater for HR variant and
smaller for GZ variant as compared to WT
receptor (Fig. 2). The corresponding IA values are
(10±1)×104, (7.2±0.5)×104, and (5.0±0.9)×104 a.u.
(Mean±SEM) for HR, WT and GZ receptors,
respectively (Fig. 4A). It seems that mutations in
the heptad repeat motif of the TMD enhance
receptor activation, whereas mutations in the
glycine zipper motif reduce it. This conclusion is
consistent with the analysis of ligand-independent
activation ability (AA) which shows that an equal
level of activation is achieved at a less content of
HR receptors and higher content of GZ receptors
configuration. According to this model, ligand
binding induces both formation of dimers with
pro-active TMD configuration and transition of
preformed dimers from contra-active to pro-active
configuration.
These findings allowed us to suggest that
TMD dimerization switching is an essential
mechanism underlying EphA2 signal transduction
at the ligand-induced and spontaneous activation
of the receptor. The TMD dimerization switching
of unligated receptors can be modulated by local
membrane properties (i.e. charge, thickness,
curvature, lipid composition and ordering). Thus it
was demonstrated that cholesterol-rich membrane
microdomains
promote
ligand-independent
clusterization of Eph receptors and formation of
low-affinity homodimers (43).
EphA2 TMD interactions via the extended
heptad repeat motif leads to left-handed
dimerization of the TMD helixes with a small (ca.
15º) angle between helix axes (Fig. 1A). Molecular
modeling shows that dimerization via the glycine
zipper motif provides formation of the righthanded dimer, which has a scissor-like
configuration with a large (ca. 45º) angle between
the helix axes and increased distance (~20 Ǻ)
between the TMD helix ends on the cytoplasmic
side of membrane (Fig. 1C). This model structure
looks reliable since similar structure was revealed
with the NMR analysis for isolated EphA1 TMD,
which formed dimers via the N-terminus glycine
zipper motif (33). Moreover, right-handed
dimerization is one of the conventional variants for
packing of interacting TMD helices of integral
proteins, and the -45º helix crossing angle is close
to the frequently occurring angle for
transmembrane helix-helix interactions (44).
Taking into account the dimer structures of
EphA2 TMD described above (Fig. 1) the
transition from a contra-active configuration to a
pro-active one should be accompanied by mutual
rotation of TMDs around helix axes (ca. 160°) and
considerable separation of their ends at the
cytoplasmic side of membrane (from ca. 10 to 20
Ǻ). We surmise that such TMD realignments are a
driving force for the conformational transition of
TKD into the active state. By analogy to other
receptor tyrosine kinases (45-47) one can assume
that TKDs of adjacent EphA2 molecules form the
dimer, which is transformed from a symmetric
autoinhibited configuration to an active
asymmetric configuration.
cells have low to moderate receptor content. In
accordance with our suppositions, the mutations
introduced in TMD of EphA2 disturb receptor
dimerization
and
thus
affect
receptor
phosphorylation. The mutations to bulky non-polar
side chain residues used in our study do not
completely undermine functional bases of the
receptor signaling. Accordingly, mutation effects
are found to be moderate but reproducible and
statistically significant. Apparently, TMD of
EphA2 simultaneously acts as a membrane anchor
and a structural element that participates in the
receptor functioning in a complex manner. Our
findings indicate that both dimerization motifs in
TMD are involved in regulation of EphA2 activity.
They influence both ligand-dependent and ligandindependent EphA2 phosphorylation. According to
the data of NMR spectroscopy and molecular
modeling (Fig. 1), the heptad repeat and the
glycine zipper motifs cannot participate in TMD
dimerization simultaneously, and therefore they
should promote formation of two structurally
different receptor dimers. This conclusion is
strikingly supported by the fact that the heptad
repeat and glycine zipper motifs have opposite
effects on the receptor activity. Disturbance of
TMD interactions through the heptad repeat motif
increases activation ability of EphA2, and hence
the dimer formed via this motif corresponds to a
configuration making activation unfavorable
(contra-active configuration). The decrease in
phosphorylation of EphA2 caused by the glycine
zipper motif disruption indicates that this motif is
involved in the formation of a configuration
favoring activation of the receptor dimer (proactive configuration).
Effects of the mutations in the TMD of
EphA2 are clearly observed for cells with low and
high receptor content, and their characteristic
patterns remain unchanged (Fig. 2). It seems that
both configurations of dimers coexist in cells with
various EphA2 content. Enhancement of the
receptor expression level does not lead to
domination of a pro-active configuration since
disruption of the heptad repeat motif (responsible
for contra-active configuration) still increases
considerably the ligand-independent EphA2
activation in cells with high EphA2 content (Fig.
2). Growth of ligand-independent activation of
WT EphA2 with increasing receptor content is
likely to occur due to an increase in the number of
EphA2 involved in dimer formation, but only a
part of newly formed dimers has a pro-active TMD
place of ligand binding (Fig. 5B, C) as it is
observed in cells (43) and predicted by the socalled “seeding” mechanism (10). It seems that
EphA2 clusters behave like a continuous excitable
media rather than a set of isolated
dimers/oligomers.
Another question to be discussed is the
stoichiometry of a minimal ephrin-EphA2 active
complex in the context of the proposed model. The
hypothetic structure of signaling (ephrin-EphA2)2
hetero-tetramers is shown in Figure 5B. The
distance between C-terminals of FN2 domains in
such hetero-tetramer is ca. 12-17 nm considering
the possible rotation of FN2 domain. It is larger
than the length of two extracellular juxtamembrane
segments (ca. 5-6 nm) connecting the FN2
domains with the corresponding N-termini of the
TMD helixes. Obviously, these geometrical
constraints cannot be resolved for the depicted
signaling hetero-tetramers (Fig.5B). At the same
time, the available structures of ECD and TMD
dimers can be united in signaling ephrin2-EphA24
hetero-hexamers, for example, as shown in Fig.
5C. In this case, the distance between C-terminal
ends of FN2 domains, which are linked to the
TMD dimer, is 5-10 nm. So far, formation of
signaling ephrin2-EphA24 hetero-hexamers was
neither supported by experimental data nor
discussed as a hypothesis. To maintain the
classical concept of signaling (ephrin-EphA2)2
hetero-tetramers the structure of some EphA2
domains should be re-examined.
In conclusion, involvement of TMD
interactions in the Eph receptor activity is
discovered for the first time. As discussed earlier
(31), at least one dimerization motif can be found
in the TMD sequence of any Eph receptor. For
EphA1, dimerization of isolated TMD in lipid
environment was confirmed tentatively, and two
dimerization modes were recognized (33, 34, 48).
It seems that TMD participation in receptor
activation via TMD dimerization can be a general
property of Eph receptor tyrosine kinases.
Discovery of pro-active and contra-active
configurations of TMD dimers of EphA2 extends a
list of receptor tyrosine kinases such as ErbB (45,
49) and FGFR3 (50, 51), in which the alternative
dimerization of TMD is supposed to control
receptor activation.
Recent crystal structure studies of EphA2
ECD (7, 10) enable us to consider the tentative
models of functional coordination between ECD
and TMD of EphA2 receptors. Experimental data
indicate that EphA2 can participate in both dimeric
and oligomeric interactions via ECD (7, 10), but
only in dimeric interactions via TMD (31).
Oligomeric interactions between well-ordered
ECDs can stabilize linear arrays of EphA2 (10), in
which LBD binds to CRD of a neighboring
molecule forming the staggered parallel packing of
rigid rod-like ECDs (Fig. 5A). In such arrays
TMDs are supposed to form contra-active dimers,
and TKDs adopt a symmetric autoinhibited
configuration (Fig. 5A).
According to the crystal structure analysis
(10) the ligand-bound ECDs form “in-register”
arrays stabilized by LBD-LBD oligomeric and
CRD-CRD dimeric interactions (Fig. 5 B, C). Pairs
of ECDs cross in the region of FN1 domains. The
FN1-FN2 linker has a hinge-like character, and the
relative rotation of FN2 domain (~70º in crystal)
occurs as compared to unliganded ECD
conformation (10). Within “in-register” arrays of
receptors TMDs are supposed to form pro-active
dimers, and TKDs have an active asymmetric
configuration (Fig. 5B, C).
Transition from staggered packing to the
ligand-bound (“in-register”) structure should be
accompanied with the scaled reorientation of each
second ECD in the array and inevitable
reorganization of TMD dimers.
A crystal structure study revealed that arrays
of EphA2 ECDs can have the ligand-bound-like
(“in-register”) conformation even without ligand
(7). Such structures in EphA2 clusters should
promote the ligand-independent formation of the
pro-active TMD dimer configuration and receptor
activation. It is reasonable to suppose that
probability of the spontaneous formation of
unliganded “in-register” conformation in receptor
clusters increases at high receptor content in
membrane.
Since both ligand-bound and unliganded
EphA2 can adopt “in-register” conformation, the
local ligand-induced reorganization of receptors
from the staggered packing to “in register”
conformation can provoke propagation of this
reorganization and TMD-mediated receptor
activation along the EphA2 cluster far from the
REFERENCES
1.
Miao, H., and Wang, B. (2012) EphA receptor signaling- complexity and emerging themes. Semin.
Cell Dev. Biol. 23, 16–25
2.
Lin, S., Wang, B., and Getsios, S. (2012) Eph/ephrin signaling in epidermal differentiation and
disease. Semin. Cell Dev. Biol. 23, 92–101
3.
Okazaki, T., Ni, A., Baluk, P., Ayeni, O. A., Kearley, J., Coyle, A. J., Humbles, A., and McDonald,
D. M. (2009) Capillary defects and exaggerated inflammatory response in the airways of EphA2deficient mice. Am. J. Pathol. 174, 2388–2399
4.
Fujii, H., Fujiwara, H., Horie, A., Suginami, K., Sato, Y., and Konishi, I. (2011) EphrinA1
stimulates cell attachment and inhibits cell aggregation through the EphA receptor pathway in
human endometrial carcinoma-derived Ishikawa cells. Hum. Reprod. 26, 1163–1170
5.
Goichberg, P., Bai, Y., D’Amario, D., Ferreira-Martins, J., Fiorini, C., Zheng, H., Signore, S., del
Monte, F., Ottolenghi, S., D’Alessandro, D. A., Michler, R. E., Hosoda, T., Anversa, P., Kajstura,
J., Rota, M., and Leri, A. (2011) The ephrin A1-EphA2 system promotes cardiac stem cell
migration after infarction. Circ. Res. 108, 1071–1083
6.
Himanen, J. P. (2012) Ectodomain structures of Eph receptors. Semin. Cell Dev. Biol. 23, 35–42
7.
Himanen, J. P., Yermekbayeva, L., Janes, P. W., Walker, J. R., Xu, K., Atapattu, L., Rajashankar,
K. R., Mensinga, A., Lackmann, M., Nikolov, D. B., and Dhe-Paganon, S. (2010) Architecture of
Eph receptor clusters. Proc. Natl. Acad. Sci. U. S. A. 107, 10860–10865
8.
Himanen, J. P., Goldgur, Y., Miao, H., Myshkin, E., Guo, H., Buck, M., Nguyen, M., Rajashankar,
K. R., Wang, B., and Nikolov, D. B. (2009) Ligand recognition by A-class Eph receptors: crystal
structures of the EphA2 ligand-binding domain and the EphA2/ephrin-A1 complex. EMBO Rep.
10, 722–728
9.
Janes, P. W., Nievergall, E., and Lackmann, M. (2012) Concepts and consequences of Eph receptor
clustering. Semin. Cell Dev. Biol. 23, 43–50
10. Seiradake, E., Harlos, K., Sutton, G., Aricescu, A. R., and Jones, E. Y. (2010) An extracellular
steric seeding mechanism for Eph-ephrin signaling platform assembly. Nat. Struct. Mol. Biol. 17,
398–402
11. Bocharov, E. V., Volynsky, P. E., Pavlov, K. V., Efremov, R. G., and Arseniev, A. S. (2010)
Structure elucidation of dimeric transmembrane domains of bitopic proteins. Cell Adhes. Migr. 4,
284–298
12. Li, E., Wimley, W. C., and Hristova, K. (2012) Transmembrane helix dimerization: beyond the
search for sequence motifs. Biochim. Biophys. Acta 1818, 183–193
13. Cymer, F., Veerappan, A., and Schneider, D. (2012) Transmembrane helix-helix interactions are
modulated by the sequence context and by lipid bilayer properties. Biochim. Biophys. Acta 1818,
963–973
14. Hubert, P., Sawma, P., Duneau, J.-P., Khao, J., Hénin, J., Bagnard, D., and Sturgis, J. (2010)
Single-spanning transmembrane domains in cell growth and cell-cell interactions: More than meets
the eye? Cell Adhes. Migr. 4, 313–324
15. Moore, D. T., Berger, B. W., and DeGrado, W. F. (2008) Protein-protein interactions in the
membrane: sequence, structural, and biological motifs. Structure 16, 991–1001
16.
Reddy, T., Manrique, S., Buyan, A., Hall, B.A., Chetwynd, A., and Sansom, M.S. (2014) Primary
and secondary dimer interfaces of the fibroblast growth factor receptor 3 transmembrane domain:
characterization via multiscale molecular dynamics simulations. Biochemistry 53, 323-332
17. Zhang, L., Sodt, A.J., Venable, R.M., Pastor, R.W., and Buck, M. (2013) Prediction, refinement,
and persistency of transmembrane helix dimers in lipid bilayers using implicit and explicit
solvent/lipid representations: microsecond molecular dynamics simulations of ErbB1/B2 and
EphA1. Proteins 81, 365-376.
18. Cao, H., Bangalore, L., Bormann, B. J., and Stern, D. F. (1992) A subdomain in the transmembrane
domain is necessary for p185neu* activation. EMBO J. 11, 923–932
19. Li, Y., Mangasarian, K., Mansukhani, A., and Basilico, C. (1997) Activation of FGF receptors by
mutations in the transmembrane domain. Oncogene 14, 1397–1406
20. Ronchetti, D., Greco, A., Compasso, S., Colombo, G., Dell’Era, P., Otsuki, T., Lombardi, L., and
21.
22.
23.
24.
25.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
26.
Neri, A. (2001) Deregulated FGFR3 mutants in multiple myeloma cell lines with t(4;14):
comparative analysis of Y373C, K650E and the novel G384D mutations. Oncogene 20, 3553–3562
Velghe, A. I., Van Cauwenberghe, S., Polyansky, A. A., Chand, D., Montano-Almendras, C. P.,
Charni, S., Hallberg, B., Essaghir, A., and Demoulin, J.-B. (2013) PDGFRA alterations in cancer:
characterization of a gain-of-function V536E transmembrane mutant as well as loss-of-function and
passenger mutations. Oncogene, doi: 10.1038/onc.2013.218
Becker, V., Sengupta, D., Ketteler, R., Ullmann, G. M., Smith, J. C., and Klingmüller, U. (2008)
Packing density of the erythropoietin receptor transmembrane domain correlates with amplification
of biological responses. Biochemistry 47, 11771–11782
Roth, L., Nasarre, C., Dirrig-Grosch, S., Aunis, D., Crémel, G., Hubert, P., and Bagnard, D. (2008)
Transmembrane domain interactions control biological functions of neuropilin-1. Mol. Biol. Cell
19, 646–654
Sykes, A. M., Palstra, N., Abankwa, D., Hill, J. M., Skeldal, S., Matusica, D., Venkatraman, P.,
Hancock, J. F., and Coulson, E. J. (2012) The effects of transmembrane sequence and dimerization
on cleavage of the p75 neurotrophin receptor by γ-secretase. J. Biol. Chem. 287, 43810–43824
Fuller-Espie, S., Hoffman Towler, P., Wiest, D. L., Tietjen, I., and Spain, L. M. (1998)
Transmembrane polar residues of TCR beta chain are required for signal transduction. Int.
Immunol. 10, 923–933
Cosson, P., and Bonifacino, J. S. (1992) Role of transmembrane domain interactions in the
assembly of class II MHC molecules. Science 258, 659–662
Li, W., Metcalf, D. G., Gorelik, R., Li, R., Mitra, N., Nanda, V., Law, P. B., Lear, J. D., Degrado,
W. F., and Bennett, J. S. (2005) A push-pull mechanism for regulating integrin function. Proc.
Natl. Acad. Sci. U.S.A. 102, 1424–1429
Choi, Y., Kang, D., Han, I.-O., and Oh, E.-S. (2012) Hierarchy between the transmembrane and
cytoplasmic domains in the regulation of syndecan-4 functions. Cell. Signal. 24, 1522–1530
Huber, O., Kemler, R., and Langosch, D. (1999) Mutations affecting transmembrane segment
interactions impair adhesiveness of E-cadherin. J. Cell Sci. 112 ( Pt 23), 4415–4423
Kienlen-Campard, P., Tasiaux, B., Van Hees, J., Li, M., Huysseune, S., Sato, T., Fei, J. Z., Aimoto,
S., Courtoy, P. J., Smith, S. O., Constantinescu, S. N., and Octave, J.-N. (2008) Amyloidogenic
processing but not amyloid precursor protein (APP) intracellular C-terminal domain production
requires a precisely oriented APP dimer assembled by transmembrane GXXXG motifs. J. Biol.
Chem. 283, 7733–7744
Bocharov, E. V., Mayzel, M. L., Volynsky, P. E., Mineev, K. S., Tkach, E. N., Ermolyuk, Y. S.,
Schulga, A. A., Efremov, R. G., and Arseniev, A. S. (2010) Left-handed dimer of EphA2
transmembrane domain: Helix packing diversity among receptor tyrosine kinases. Biophys. J. 98,
881–889
Kim, S., Jeon, T.J., Oberai, A., Yang, D., Schmidt, J.J., and Bowie, J.U. (2005) Transmembrane
glycine zippers: physiological and pathological roles in membrane proteins. Proc. Natl. Acad. Sci.
USA. 102, 14279-14283.
Bocharov, E. V., Mayzel, M. L., Volynsky, P. E., Goncharuk, M. V., Ermolyuk, Y. S., Schulga, A.
A., Artemenko, E. O., Efremov, R. G., and Arseniev, A. S. (2008) Spatial structure and pHdependent conformational diversity of dimeric transmembrane domain of the receptor tyrosine
kinase EphA1. J. Biol. Chem. 283, 29385–29395
Volynsky, P.E., Mineeva, E.A., Goncharuk, M.V., Ermolyuk, Y.S., Arseniev, A.S., and Efremov,
R.G. (2010) Computer simulations and modeling-assisted ToxR screening in deciphering 3D
structures of transmembrane alpha-helical dimers: ephrin receptor A1. Phys. Biol. 7, 16014-16028
Sharonov, G. V., Mozgovaja, M. N., Astapova, M. V., Kolosov, P. M., Arseniev, A. S., and
Feofanov, A. V. (2012) in Current microscopy contributions to advances in science and technology
(Mendez-Vilas, A. ed.) Formatex Research Center, Badajoz, Spain, pp. 140–147
Sarkar, G., and Sommer, S. S. (1990) The “megaprimer” method of site-directed mutagenesis.
Biotechniques 8, 404–407
Kaneko, M., and Nighorn, A. (2003) Interaxonal Eph-ephrin signaling may mediate sorting of
olfactory sensory axons in Manduca sexta. J. Neurosci. 23, 11523–11538
38.
39.
40.
41.
42.
43.
44.
46.
47.
48.
49.
50.
51.
45.
Polyansky, A. A., Chugunov, A. O., Volynsky, P. E., Krylov, N. A., Nolde, D. E., and Efremov, R.
G. (2013) PREDDIMER: a web server for prediction of transmembrane helical dimers.
Bioinformatics, doi: 10.1093/bioinformatics/btt645
Nekrasova, O. V., Sharonov, G. V., Tikhonov, R. V., Kolosov, P. M., Astapova, M. V., Yakimov,
S. A., Tagvey, A. I., Korchagina, A. A., Bocharova, O. V., Wulfson, A. N., Feofanov, A. V., and
Kirpichnikov, M. P. (2012) Receptor-binding domain of ephrin-A1: production in bacterial
expression system and activity. Biochemistry (Mosc.) 77, 1387–1394
Fang, W. B., Brantley-Sieders, D. M., Hwang, Y., Ham, A.-J. L., and Chen, J. (2008) Identification
and functional analysis of phosphorylated tyrosine residues within EphA2 receptor tyrosine kinase.
J. Biol. Chem. 283, 16017–16026
Udayakumar, D., Zhang, G., Ji, Z., Njauw, C.-N., Mroz, P., and Tsao, H. (2011) EphA2 is a critical
oncogene in melanoma. Oncogene 30, 4921–4929
Tandon, M., Vemula, S. V., and Mittal, S. K. (2011) Emerging strategies for EphA2 receptor
targeting for cancer therapeutics. Expert Opin. Ther. Targets 15, 31–51
Wimmer-Kleikamp, S. H., Janes, P. W., Squire, A., Bastiaens, P. I. H., and Lackmann, M. (2004)
Recruitment of Eph receptors into signaling clusters does not require ephrin contact. J. Cell Biol.
164, 661–666
Walters, R. F. S., and DeGrado, W. F. (2006) Helix-packing motifs in membrane proteins. Proc.
Natl. Acad. Sci. USA. 103, 13658–13663
Tao, R.-H., and Maruyama, I. N. (2008) All EGF(ErbB) receptors have preformed homo- and
heterodimeric structures in living cells. J. Cell Sci. 121, 3207–3217
Lemmon, M. A., and Schlessinger, J. (2010) Cell signaling by receptor tyrosine kinases. Cell 141,
1117–1134
Bae, J. H., and Schlessinger, J. (2010) Asymmetric tyrosine kinase arrangements in activation or
autophosphorylation of receptor tyrosine kinases. Mol. Cells 29, 443–448
Artemenko, E. O., Egorova, N. S., Arseniev, A. S., and Feofanov, A. V. (2008) Transmembrane
domain of EphA1 receptor forms dimers in membrane-like environment. Biochim. Biophys. Acta
1778, 2361–2367
Fleishman, S. J., Schlessinger, J., and Ben-Tal, N. (2002) A putative molecular-activation switch in
the transmembrane domain of erbB2. Proc. Natl. Acad. Sci. U.S.A. 99, 15937–15940
Bocharov, E. V., Lesovoy, D. M., Goncharuk, S. A., Goncharuk, M. V., Hristova, K., and
Arseniev, A. S. (2013) Structure of FGFR3 transmembrane domain dimer: implications for
signaling and human pathologies. Structure 21, 2087–2093
Volynsky, P. E., Polyansky, A. A., Fakhrutdinova, G. N., Bocharov, E. V., and Efremov, R. G.
(2013) Role of dimerization efficiency of transmembrane domains in activation of fibroblast
growth factor receptor 3. J. Am. Chem. Soc. 135, 8105–8108
FOOTNOTES
*This work was supported by Russian foundation for basic research (grants 13-04-40105-Н and 12-0401816-a). G.V.S. is supported by Grants of the President of Russian Federation (MK-5003.2013.4).
1
To whom correspondence may be addressed: Alexey A. Feofanov, Department of Structural Biology,
Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry RAS, ul. Miklukho-Maklaya 16/10, 117997
Moscow, Russia, Tel.:+7(495)3366455; E-mail: [email protected].
2
The abbreviations used are: AA, ability of receptor to activation; AEL, activating expression level of
receptor; ECD, extracellular domain; GZ, EphA2 mutant (G540I, G544I); HR, EphA2 mutant (G539I,
A542I, G553I); JMD, intracellular juxtamembrane domain; JMR, juxtamembrane region; TKD,
cytoplasmic tyrosine kinase domain; TMD, transmembrane domain; WT, wild type EphA2; YFP, yellow
fluorescent protein.
FIGURE LEGENDS
FIGURE 2. Flow cytometry analysis of activity for WT, HR and GZ variants of EphA2-YFP.
Dot plots show EphA2 phosphorylation (pEphA2-DyLight649) vs. EphA2-YFP content (expression level)
for each analyzed cell in single representative experiment. Columns represent HEK293T cells before and
2, 5 and 10 min after stimulation with ephrin-A3. Rows correspond to WT, HR and GZ variants of
EphA2-YFP. Dot plots were fitted with sigmoidal dose-response curves (red). Horizontal lines on dot
plots show background fluorescence level of pEphA2-DyLight649 (BG, green) and intensity level of
BG+500 fluorescence units (magenta) that was introduced to define lg(AEL) (vertical blue line) and
calculate the AA parameter (see Experimental section). Overlaid fitted curves for each EphA2-YFP
variant at different time points are presented to the right. Overlaid curves for EphA2-YFP variants for
each time point are shown at the bottom.
FIGURE 3. Cellular distribution and ligand binding for WT, HR and GZ variants of EphA2-YFP.
A. Typical distribution of WT, HR and GZ variants of EphA2-YFP in live HEK293 cells recorded with
laser scanning confocal microscopy. Representative individual cells are shown. B. Comparison of ephrinA3/Cy5 binding to WT, HR and GZ variants of EphA2-YFP in live HEK293 cells. Dot plots show
ephrin-A3/Cy5 binding vs. EphA2-YFP content for each analyzed cell. Data within first half of EphA2YFP expression range were fitted with linear dependency (red). A slope of the fitted line is indicated on
each dot plot.
FIGURE 4. Activity comparison for WT, HR and GZ variants of EphA2-YFP.
Comparative statistical analysis of data obtained for EphA2-YFP variants in six independent experiments.
A. Comparison of integrated activities (AI) of EphA2-YFP variants. B. Comparison of ability to
activation (AA) of EphA2-YFP variants. Abscissa is time after addition of ephrinA3 to HEK293T cells. p
values calculated with paired t-test were less than 0.05 (*) or 0.01 (**).
FIGURE 1. Alternative dimer configurations of EphA2 TMD.
A. A ribbon diagram of the left-handed TMD dimer of EphA2 formed via the heptad repeat motif
according to the NMR data (29). The heavy atom bonds are shown. The membrane is shown
schematically by yellow balls representing phosphorus atoms of the lipid heads. B. A hydrophobicity map
for the surface of a TMD helix (left blue helix from the panel A) constructed as described previously (29).
Contour isolines encircle regions with the high values of molecular hydrophobicity potential. Spatial
locations of two dimerization motifs, the heptad repeat motif L535X3G539X2A542X3V546X2L549 and the
glycine zipper motif A536X3G540X3G544, are marked by red and green dashed ovals. The helix packing
interface found in the NMR structure of the EphA2 TMD dimer is indicated by magenta-point area. The
amino acid substitutions in HR (G539I, A542I, G553I) and GZ (G540I, G544I) variants of EphA2 are
highlighted with red and green letters, respectively. C. A ribbon diagram of the right-handed TMD dimer
of EphA2 formed via glycine zipper motif according to the molecular modeling performed with the
PREDDIMER program (36).
FIGURE 5. A mechanism of EphA2 activation implying two alternative configurations of TMD
dimer. The presented model combines findings on ECD crystal structures (7, 10), TMD dimer
configurations and the general scheme of TKD activation in receptor tyrosine kinases (42-44).
A. Unliganded EphA2 receptors are pre-clustered and inactive. Oligomeric interactions of rigid rod-like
ECDs stabilize their staggered parallel packing (10). TMDs dimerize via the heptad repeat motif in a
contra-active configuration, which promotes the auto-inhibiting symmetric configuration of cytoplasmic
TKD dimer.
Domain composition of EphA2 receptor: extended extracellular domain (ECD: LBD, ligand-binding
domain; CRD, cysteine rich domain; FN1, FN2, fibronectin domains; JMR, juxtamembrane region),
transmembrane domain (TMD) and tyrosine kinase domain (TKD: JMD, juxtamembrane domain; N and
C, N- and C-terminal lobes that acts as an enzyme and substrate (43, 44); SAM, sterile α motif; PDZ, Psd95, Dlg and ZO1 domain). The autophosphorylation sites are pictured by open (dephosphorylated) and
filled (phosphorylated) orange circles.
B, C. Ligand-binding induces activation of EphA2 in the cluster. The ligand-bound ECDs form “inregister” arrays (7, 10) inducing reorganization of even unliganded neighboring EphA2 molecules. ECD
reorientation switches TMD dimers into pro-active configuration stabilized via N-terminal glycine zipper
motif. The separation of TMD dimer C-termini is a driving force for TKD transition into active
asymmetric state. Ensemble of Eph receptors behaves like a continuous excitable media rather than a set
of isolated dimers/oligomers.
In panel B, EphA2 are pictured to form “classical” signaling (ephrin-EphA2)2 hetero-tetramers
(highlighted), but in fact the distance between C-terminals of FN2 domains (ca. 12-17 nm considering the
possible rotation of FN2 domain) is inconsistent with the maximal length of two JMR (ca. 5-6 nm)
between FN2 and TMD of the pro-active TMD dimer. To overcome this inconsistence the structure of
some EphA2 domains should be re-examined.
In panel C, EphA2 are united in signaling ephrin2-EphA24 hetero-hexamers (highlighted). Here a distance
between the C-terminal ends of FN2 domains linked to a TMD dimer (5-10 nm) is consistent with the
length of two JMR.
Figure 1.
13 Switching of EphA2 by transmembrane helix-helix interaction
Figure 2
Figure 3
Figure 4
Figure 5
17

Feofanov Alexander S. Arseniev and Alexey V. Peter M. Kolosov

Transcription

Similar documents

AlAhliToken

Chronic orofacial pain and headache and the use of NTI-tss

6. Endocrinology 2010

INMUNOLOGIA MOLECULAR

The Molecular Basis of Oligomeric Organization of the Human M3

NPS Misuse clinical and pharmacological issues

Go to https://ipay.adp.com/iPay/login.jsf – select Register Now Enter

Functional genomics as a tool to define a molecular signature of

Piracicaba Dental School - UNICAMP