Randa Elfadil Ibrahim abdalla

The National Ribat University
Faculty of Graduate Studies
and Scientific Research
Assessment of the level and Phenotype of Haptoglobin and Association
between the Polymorphisms of A disintegrin & metalloprotease (ADAM) 33,
Interleukin-4 promoter (-590), Interleukin-4receptor promoter (-576) and
Glutathione S-transferase (GSTT1&GSTPi) genes in Sudanese with asthma
A thesis submitted in fulfillment of the requirement of the Ph.D degree in Human
Physiology
By:
Randa Elfadil Ibrahim abdalla
B.Sc.Veterinary Medicine -University of Khartoum
M.Sc. human physiology- The National Ribat University, 2010
Supervisor:
Prof. Omer Abdel Aziz Musa
MBBS, DTCD, PhD
Co supervisor:
Dr. Hanan Babiker Eltahir
B.Sc., MSc, Ph.D. Medical Biochemistry, U of K, 2007
2015
List of contents
Subjects
List of contents
Dedication
Acknowledgement
Abstract (English)
Abstract (Arabic)
List of tables
List of figures
Abbreviations
Declaration
Page
No.
I
VI
VII
VIII
X
XII
XIV
XVI
XVIII
Chapter one
Introduction and literature review
1.
1.1
1.1.1
1.1.2
1.1.3
1.1.4
1.1.4.1
1.1.4.2
1.1.4.2.1
1.1.5
1.1.6
1.2
1.2.1
1.2.2
1.2.2.1
1.2.2.2
1.2.3
1.2.3.1
1.2.3.2
1.2.3.3
1.2.3.4
1.2.3.5
1.2.3.6
Introduction
Asthma
Definition
Epidemiology and global prevalence of asthma
Prevalence of Asthma in Sudan
Causes
Environmental causes
Genetic causes
Genetic Analysis of Asthma Susceptibility
Inflammatory cells in asthma
Pathophysiology
Haptoglobin (Hp)
Haptoglobin (Hp) phenotype
Haptoglobin as a Diagnostic Marker
Conditions Associated With an Elevated Plasma Hp Level
Conditions Associated With Decreased plasma Hp Level
Physiology and Functions of Haptoglobin
Role of Hp in regulation of the immune system
Inhibition of Prostaglandins
Antibacterial Activity
Antioxidant Activity
Activation of neutrophils
Role of Hp in angiogenesis
1
1
1
2
2
3
3
4
5
7
7
9
9
10
10
10
11
11
12
12
12
13
13
1.2.3.7
1.2.4
1.3
1.3.1
1.3.1.1
1.3.2
1.3.3
1.3.4
1.4
1.4.1
1.4.1.1
1.4.1.2
1.4.2
1.4.2.1
1.4.2.2
1.4.3
1.4.3.1
1.4.3.1.1
1.4.3.1.2
1.4.3.1.3
1.4.3.2
1.4.3.3
1.5
1.5.1
1.5.3.1
1.5.3.2
1.5.3.3
1.5.4
1.5.5
1.5.6
1.6
1.7
1.8
1.9
1.10
Hp is required to induce mucosal tolerance
14
Hp and asthma
15
A disintegrin and metalloprotease (ADAM) 33
15
Physiological functions of ADAM33
16
ADAM 33 as a morphogenetic gene
16
ADAM 33 as a biomarker of severe asthma
16
ADAM 33 gene polymorphisms and asthma
17
Role of the gene-environment interaction and ADAM33 in 19
development of asthma
Interleukins and asthma
19
Interleukin-4 (IL-4)
19
Physiological functions of IL4
20
Interleukin-4 gene and asthma
20
IL4 Receptor
21
Physiological functions of IL4Rα
21
Interleukin 4 receptor (IL-4Rα) gene and asthma
22
Interleukin 13
23
Physiological functions of IL13
23
IL-13 role in mucus production
24
IL-13 in airway hyperresponsiveness
24
Interleukin-13 in pulmonary fibrosis
24
IL 13 and inflammatory pathways in asthma
24
Anti-interleukin-13 antibody therapy for asthma
25
Glutathione S-transferases (GSTs)
25
Functions of GSTs
26
The detoxication functions of GSTs
26
The metabolic function of GSTs
26
The regulatory function of GSTs
27
GSTs and asthma
27
Glutathione S-transferase Theta 1 (GSTT1)
28
Glutathione S-transferase Pi 1(GSTP1)
29
Diagnosis
29
Classification and severity
29
Prevention and management
31
Justification
32
Objectives
33
Chapter two
Materials and methods
2. 1
2.1.1
2.1.2
2.1.3
2.1.4
2.1.5
2.1.6
2.1.7
2.1.8
2.1.9
2.2
2.2.1
2.2.2
2.2.3
2.2.4
2.2.5
2.2.5.1
2.2.5.2
2.2.5.3
2.2.5.4
2.2.5.5
2.2.5.6
2.2.5.6.1
2.2.5.6.2
2.2.5.6.3
2.2.5.6.4
2.2.5.7
2.2.5.7.1
2.2.5.7.1.1
2.2.5.7.1.2
2.2.5.7.1.3
2.2.5.7.1.4
2.2.5.7.1.4
2.2.5.7.2
2.2.5.7.2.1
2.2.5.7.2.2
2.2.5.7.2.3
Materials
Electronic spirometer
Gel electrophoresis
PCR machine
Primers
Maxime PCR PreMix Kit ( i-Taq)
UV Transilluminator JY-02S analyzer
Microplate reader
ELIZA kits
Vertical electrophoresis cell
Methods
Study design
Study area
Study population
Ethical consideration
Procedures
Questionnaire
Clinical examination
Body Mass Index (BMI)
Lung functions test
Sampling technique
Molecular analysis
DNA extraction
Agarose gel electrophoresis requirements for DNA and
PCR product
Polymerase chain reaction (PCR)
Restriction Fragment Length Polymorphism Analysis
(RFLPs)
Laboratories Analysis
Polyacrylamide Gel Electrophoresis (PAGE)
Preparation of the reagents
Separating gel preparation
Stacking gel preparation
Sample preparation and loading
Protein staining
ELISA
Quantitative assay for total IgE antibodies
Quantitative assay for total Haptoglobin
Quantitative assay for total IL4
34
34
36
37
38
38
39
40
40
41
42
42
42
42
42
42
42
43
43
43
44
44
44
46
49
50
50
50
51
52
52
52
53
53
53
54
56
2.3
3.1
3.2
3.3
3.4
3.4.1
3.4.2
3.5
3.6
3.7
3.8
3.9
3.9.1
3.9.2
3.10
5.1
5.2
Method of data analysis
Chapter three
Results
Study group
Asthma Control Test (ACT)
lung function tests
Serum level of IgE and IL4 in asthmatic and control
Serum level of IgE in different classes of asthma
Serum level of IL4 in different classes of asthma
Haptoglobin phenotypes and Level
ADAM33 polymorphism in chromosome 20
IL4 (-590 C/T) polymorphism in chromosome 5
IL4Rα (- Q576R) polymorphism in chromosome 16
GSTs polymorphism
GSTT1 polymorphism in chromosome 22
GSTPi polymorphism in chromosome 11
Frequencies of mutant genotypes
Chapter four
Discussion
4. Discussion
Chapter five
Conclusion and Recommendations
Conclusion
Recommendations
Chapter six
58
59
62
62
63
64
65
65
69
72
74
76
76
77
80
81
87
88
References and Appendices
References
Questionnaire
Asthma control test
Maxime PCR PreMix kit
BsmF1 enzyme
BsmA1enzyme
Msp1 enzyme
The component of toatl IgE Eliza Kit
The components of the haptoglobin kit
Reagent Preparation (haptoglobin kit)
The components of the IL4 kit
Reagent Preparation (IL4 kit)
89
126
128
129
130
131
132
133
134
135
136
137
:
To my parents
To the soul of my brother Hafiz
I wish to express my thanks gratitude and indebtedness to my supervisor
Prof. Omer Abdel Aziz whose keen interest, supervision and assistance
led to the initiation and completion of thesis work.
I am greatly indebted to many individuals who helped with the
preparation of this work Dr. Hannan Babiker Ehtahir for her wisdom
and guidance throughout the years, I am forever grateful to her for
playing a significant part of my success and teaching me the necessary
skills to be a successful graduate student.
I also thank all the subjects who granted me their time. I would like to
express my especial thanks to Dr. Jehan Essa for her sustainable
presence and unlimited help. I am very grateful to Dr. Amel Osman, Mr.
Mohammed Elhadi, Mr. Ahmmed Brear and Ms. Nagat Ahmmed for
their great help. I wish to express my thanks to Dr. Nasr mohammed
Nasr, for taking the time to teach me about ELIZA technique. I especially
want to thank Mr. Kamal Eltayeb – department of biochemistry and
molecular
biology-faculty
of
Science
and
Technology-AlNeelain
University. I also thank all the staff of the research center at Sudan
University of science and technology and the research center at Garab
Elniel College.
Also I want to thank the Ministry of higher education and scientific
research for the financial support. To all those who encouraged me, I owe
and gladly acknowledge a considerable debt. Finally, I would like to
acknowledge and thank The National Ribat University.
Abstract
Introduction:
Asthma is an inflammatory disease that results from interactions between multiple
genetic and environmental factors that influence both its severity and its
responsiveness to treatment. Haptoglobin (Hp) is an acute phase protein and
functions as an immune system modulator. Recent studies have revealed evidence
for linkage of human chromosomes 5q23, 11q13, 16p12.1, 20p13 and 22q11.2 as
regions likely to contain genes related to asthma. Among the candidate genes in
these regions are the genes encoding for IL4, GSTPi, IL4Rα, ADAM33 and
GSTT1.
Objectives:
To assess the level and common phenotype of Hp among asthmatic and control
subjects. Also to assess the frequency of the mutant ADAM 33, IL4 (-590), IL4R α
(-576), GSTT1 and GSTPi genes in asthmatic patients in comparison with healthy
controls.
Methods:
A total of 63 patients with allergic asthma and 53 normal subjects were studied.
Serum levels of IgE, IL-4 and Hp were measured by ELISA method. Serum Hp
phenotypes were detected by using Polyacrylamide Gel Electrophoresis. DNA was
extracted from blood using salting out method. Polymorphisms were determined
by PCR method for GSTT1, PCR-RFLP method for ADAM33, IL4 and GSTPi,
and allele specific PCR for IL4Rα.
Results:
Our results indicate that total level of serum IgE and IL4 in patients were
considerably higher than controls. Serum electrophoresis showed that the
distribution of Hp phenotypes of Hp1-1, Hp2-1 and Hp2-2 among asthmatic
patients were17.5%, 50.8 % and 31.7%, respectively. Distributions of different Hp
phenotypes in healthy controls were 7.6%, 66% and 26.4%, respectively. Serum
Hp level was higher in asthmatics than controls (0.001).
The results showed that GSTT1 null genotype was higher (54%) than control
(24.5%) (P=0.001).The mutant ADAM33 allele was higher (81%) than control
(55%) (P= 0.000), IL4 (-590) allele was higher (69.8%) than control (42.9%)
(P=0.000), IL4R α (-576) allele was higher (57.1%) than control (48.1%) (P=
0.170) and no significant differences of GSTPi allele between asthmatics (34.8%)
and controls (29.2%) (p= 0.358).
Conclusion:
The level of serum IgE and IL4 in patients were higher in asthmatic patients.Hp
phenotypes have no role in activation of the disease, while Hp level was higher in
asthmatic patients and in all asthma classes.
Gene polymorphism of ADAM33, IL4 (-590) and GSTT1 may be associated with
the development of asthma in Sudan while IL4R α (-576) and GSTPi genes
appears to play no role in the occurrence of the disease.
‫الخـُـــــــــالصــــة‬
: ‫المقدمة‬
‫الربو الشعبً مرض التهابً ٌنتج من التفاعل بٌن العوامل الوراثٌة والبٌئٌة المتعددة التً تؤثر فً كل‬
ً‫) هو بروتٌن المرحلة الحادة واحدي وظائفه مغٌر ف‬HP( ‫ هابتوغلوبٌن‬.‫من حدته واستجابتها للعالج‬
‫ وقد كشفت الدراسات األخٌرة دلٌال على الربط بٌن الكروموسومات البشرٌة‬.‫نظام المناعة‬
‫ والمناطق المحتمل أن تحتوي على الجٌنات‬22q11.2 ‫ و‬20p13 ،16p12.1 ،11q13،5q23
ADAM33،IL4Rα ،GSTPi ،IL4 ً‫ بٌن الجٌنات المرشحة فً هذه المناطق ه‬.‫المرتبطة بالربو‬
GSTT1‫و‬
:‫األهــــداف‬
‫تهدف هذه الدراسه لتقييم مستتو والتمم الاتري‬
‫أيضتتر لتقيتتيم التوتي ة المتمولت للجيمتتر‬
‫للهترتتوللوتي تتي م ضت ال تتو ومجموعت التتم م‪.‬‬
‫‪ GSTT1 ،)-075( IL4R α ،)-095( IL4 ، ADAM33‬و‬
‫‪ GSTPi‬ف الم ضى المصرتي ترل تو مقر م مع االصمرء‪.‬‬
‫الطـــــرق ‪:‬‬
‫اجرٌت هذه الدراسه المقطعٌه التحلٌلٌة فً عدد ‪ 111‬شخص فً والٌة الخرطوم (‪ 13‬مجموعة‬
‫الدراسه) (‪33‬مجموعة التحكم)‪ .‬واجرٌت قٌاسات مستوي امٌنوقلوبٌولٌن ‪ (IgE) E‬وانترلٌوكٌن ‪4‬‬
‫(‪(IL4‬‬
‫و الهابتوغلوبٌن )‪(Hp‬‬
‫فً السٌرم بواسطه ‪ .ELIZA‬ونوع الهابتوقلوبٌن باستخدام جل‬
‫بولً أكرٌالمٌد الكهربائً ‪.PAGE‬‬
‫تم استخالص ‪ DNA‬من الدم وتحدٌد التغٌٌر الجٌنً بواسطه‬
‫‪PCR‬‬
‫لجٌن ‪ GSTT1‬و‬
‫‪ PCR-RFLP‬لجٌن ‪ ADAM33, IL4 , GSTPi‬و ‪ allele specific PCR‬لجٌن ‪.IL4Rα‬‬
‫تم استخدام برنامج ‪ SPSS‬للتحلٌل االحصائً‪.‬‬
‫النـتـائــج ‪:‬‬
‫عند مقارنة االشخاص المصابٌن بالربو الشعبً (مجموعة الدراسه ) مع االشخاص الطبٌعٌٌن (مجموعة‬
‫التحكم) نجد ان قٌاسات مستوي ‪ IgE‬و ‪ IL4‬و‪ Hp‬اعلً عند مرضً الربو الشعبً‪ .‬توزٌع الشكل‬
‫الظاهري للهابتوقلوبٌن ‪1-1‬و‪ 2-1‬و‪ 2-2‬عند مرضً الربو الشعبً هو ‪ 17.5%‬و ‪ 50.8 %‬و ‪31.7%‬‬
‫علً التوالً وعند مجموعة التحكم هو ‪ 7.6%‬و‪ 66%‬و‪26.4%‬علً التوالً‪.‬‬
‫وأظهرت النتائج أن النمط الجٌنً المتحول ‪ GSTT1‬أعلى عند مرضً الربو (‪ )٪05‬من مجموعة‬
‫التحكم (‪ .( P=0.001( )٪55.0‬كان االلٌل المتحول ‪ ADAM33‬أعلى (‪ )٪18‬من مجموعة التحكم‬
‫على (‪ .)P=5 .000( )٪00‬وكان االلٌل المتحول (‪ IL4 (-095‬أعلى (‪ )٪59.1‬من التحكم (‪)٪55.9‬‬
‫(‪(P=0.000‬‬
‫‪ ،‬كان االلٌل المتحول ‪ )-075( IL4R α‬أعلى (‪ )٪07.8‬من التحكم (‪)٪51.8‬‬
‫(‪ . (P=0.170‬ال وجود لفروق ذات داللة لاللٌل المتحول ‪ GSTPi‬بٌن الربو (‪ )٪35.1‬والتحكم‬
‫(‪.)P=0.358( )٪59.5‬‬
‫الخـاتــمه‪:‬‬
‫قٌاسات مستوي الهابتوغلوبٌن ‪ Hp‬و‪ IL4‬و‪ IgE‬اعلً عند مرضً الربو و لٌس هنالك اختالف فً‬
‫الشكل الظاهري للهابتوغلوبٌن‬
‫تعدد اش رل الجيمر ‪ )095( GSTT1‬و‪ ADAM33 ،IL4‬قد تت افق مع اإلصرت تم ض ال تو ف‬
‫السودا ‪ ،‬تيممر جيمر ‪ IL4R α)075-( GSTPi‬المتمول فيتدو امهر ليس لهر دو ف مدوث الم ض‬
List of tables
Tables
Page
No.
Table (1.1): Prevalence of asthma symptoms in adults & children (aged 3
13-14) in different areas in Sudan.
Table (1.2): Clinical classification (≥ 12 years old)
31
Table(2.1): Single-nucleotide polymorphisms genotyped in IL-4, IL-4rα, 48
ADAM33, GSTT1 and GSTP1 genes
Table (2.2): The Polymerase chain reaction protocol
49
Table(2.3): The restriction enzymes incubation protocol
50
Table(3.1): Distribution of anthropometric characteristics among female 60
subjects
Table(3.2): Distribution of anthropometric characteristics among
male 61
subjects
Table(3.3): The asthma control test score in asthma patients
62
Table(3.4): Distribution of lung functions test among the study group
62
Table(3.5): Distribution of serum level of IgE and IL4 among the study 63
group
Table(3.6): Serum IgE in different classes of Asthma
64
Table(3.7): Serum Il4 in different classes of Asthma
65
Table(3.8): Distribution of haptoglobin phenotype among the study group 66
Table(3.9): Distribution of serum level of Hp among the study group
67
Table(3.10):A comparison of serum Hp in Patients and control with 68
different Hp phenotype
Table(3.11): Serum Hp in different classes of Asthma
68
Table(3.12): Allele and genotype frequencies for ADAM33 SNPs
69
Table(3.13): A comparison of FEV1 in asthmatics and healthy control 71
with different ADAM33 genotype
Table(3.14): Allele and genotype frequencies for IL4 SNPs
72
Table(3.15): Allele and genotype frequencies for IL4Rα (-576) SNPs
74
Table(3.16): Genotype distribution of GSTT1 SNPs
76
Table(3.17): Allele and genotype frequencies for GSTPi SNPs
78
Table(3.18): Combination of various risk mutant genotypes
80
List of figures
figures
Page No.
Figure (1.1): Inflammatory cells in asthma
7
Figure (1.2): Inflammatory pathways in asthma
8
Figure (1.3): The structure of the different haptoglobin phenotype
10
Figure (1.4): Key cells influenced by ADAM33 in airway remodelling
18
in asthma
Figure (2.1): Electronic Spirometer and mouth pieces:
35
Figure (2.2): Gel electrophoresis cell
36
Figure (2.3): PCR machine
37
Figure (2.4): Forward and Reverse primers
38
Figure (2.5): Maxime PCR PreMix Kit ( i-Taq)
38
Figure (2.6):UV Transilluminator analyzer
39
Figure (2.7): Microplate reader
40
Figure (2.8): ELIZA kits for haptoglobin and IL4
40
Figure (2.9): Vertical electrophoresis
41
Figure(2.10): Precipitation of DNA
46
Figure (3.1): The percentage of females and males in the study group
59
Figure (3.2): The total number of females and males
60
Figure (3.3): The classification of asthmatic group
61
Figure (3.4): IgE level in asthmatic and control group
63
Figure (3.5): IL4 serum level in asthmatic and control
64
Figure (3.6): Determination of Haptoglobin phenotype electrophoresed 66
in polyacrylamid gel
Figure (3.7): Comparison of Hp level in serum of asthmatic and
67
Control
Figure (3.8): Mutant allelic frequencies of ADAM33 polymorphism
for asthmatic and control (%)
70
Figure (3.9):The ADAM33 PCR product on 3% agarose
70
Figure (3.10): Analysis of ADAM33 polymorphism on 3.8% agarose
71
Figure (3.11): Mutant Allelic frequencies of IL4 (-590) polymorphism
73
for asthmatic and control (%)
Figure (3.12):The IL4 (-590) PCR product on 3% agarose
73
Figure (3.13): Mutant allelic frequencies of IL4Rα polymorphism for
75
asthmatic and control (%)
Figure (3.14):The IL4Rα (-576) PCR product and analysis of
75
polymorphism on 3% agarose
Figure (3.15): GSTT1 null genotype frequencies for asthmatic and
76
control (%)
Figure (3.16):Analysis of GSTT1 polymorphism on 3% agarose
77
Figure (3.17): Allele and genotype frequencies for GSTPi SNPs
78
Figure (3.18):The GSTPi Ile105Val PCR product on 3% agarose
79
Figure (3.19): Analysis of Ile105Val polymorphism on 3% agarose
79
Figure (3.20):Combination of various risk mutant genotypes of 5 genes 80
Abbreviations
AHR
airway hyperresponsiveness
GSTM1
glutathione S-transferase mu 2 (muscle)
CTLA-4
Cytotoxic T-Lymphocyte associated protein 4
SPINK5
Serine protease inhibitor Kazal- type 5
IL-4Rα
Interleukin 4 receptor alpha
ADAM 33
A disintegrin and metalloprotease 33
ADRB2
adrenergic beta-2-receptor
BHR
bronchial hyperactivity
SPT
skin prick test
IgE
Immunoglobulin E
CC16
Clara cell 16
CCL
CC chemokine ligands
TLR
toll-like receptor
NOD1
nucleotide-binding oligomerization domain containing 1
HLA
Human leukocyte antigen cell
GSTP1
Glutathione S-transferase Pi 1
ALOX-5
arachidonate 5-lipoxygenase
NOS1
nitric oxide synthase 1
ECM
extracellular matrix
ASM
airway smooth muscle MCs: mast cells
Hp
haptoglobin.
FEV1
Forced expiratory volume in one second
HMC-1
human mast cell line HMC-1
TNF
tumour necrosis factor
ROS
reactive oxygen species
SNPs
single nucleotide polymorphisms
EMTU
epithelial mesenchymal tropic unit
EGF
epidermal growth factor
TGF
transforming growth factors
VCAM-1
vascular cell adhesion molecule 1
GM-CSF
Granulocyte macrophage colony-stimulating factor
MHC II
major histocompatibility class II
GSTPi
Glutathione S-transferase Pi
GSH
Glutathione
GST
glutathione transferase
NF-AT
nuclear factor of activated T cell
PEF
Peak expiratory flow
GINA
Global Initiative for Asthma
PAGE
polyacrylamide gel electrophoresis
SDS
Sodium dodecyl sulfate
TE
Tris EDTA
dH2O
distilled water
Declaration
I declare that this work has not been previously submitted in support of application
for another degree at this or any other university and has been done in the
department of physiology, Faculty of Medicine, The National Ribat University.
Part of this work has been submitted to the 9th Scientific Conference- Sudanese
chest Physicians society (5-6 April 2015) as a paper in abstract form:
1. RE Ibrahim, HB Eltahir, JE Abdelrahman, A O Gundi, O A Musa. Genetic
polymorphisms of ADAM33, IL4 (-590), IL4Rα (-576), GSTT1 and GSTPi
genes in Sudanese with asthma. Presented by Randa Ibrahim.
Table (2.1) Single-nucleotide polymorphisms genotyped in IL-4, IL-4rα, ADAM33, GSTT1
and GSTP1 genes:
Gene
location SNP &
Sequence of primer
Method
PCR
SNP
product
name
5q23
F: 5΄ACTAGGCCTCACCTGATACG-3΄
PCR+RE 254bp
IL4
-590C>T
R: 5΄GTTGTAATGCAGTCCTCCTG-3΄
IL4Rα
16p12.1
F:InnerGCTTACCGCAGCTTCAGCACCT
-Q576R
T >C
R:Inner GACACGGTGACTGGCTCAGTG
GSTT1
22q11.2
F+1
G>A
----------
PCR+RE
166bp
MspI
PCR
480 bp
--------
PCR+RE
440bp
BsmA1
F:5΄GTATCTATAGCCCTCCAAATCAGA
AGAGCC-3΄
R:5΄GGACCCTGAGTGGAAGCTG-3΄
null allele F: 5-TTCCTTACTGGTCCTCACATCTC-3
R:5 TCACCGGATCATGGCCAGCA-3
11q13
Introduction & Literature review
1.
BsmFI
574 pb
Internal
control
324bp(T)
294pb(C)
F:OuterTGGACCTGCTCGGAGAGGAGA
Ile105Va F:5'-ACG CACATC CTC TTC CCC TC-3'
l
R:5'-TAC TTG GCT GGTTGA TGT CC-3
313A>G
PCR = polymerase chain reaction; RE = restriction enzyme
GSTPi
enzyme
PCRallele
specific
R:OuterTAACCAGCCTCTCCTGGGGGC
ADAM33 20p13
Intron6
Restrict
Introduction:
Asthma is one of the most common chronic diseases affecting an estimated 300
million people worldwide.
(1)
Currently, it is recognized that asthma is a complex
disease that results from interactions between multiple genetic and environmental
factors. (2, 3) During an asthma attack, the airways that carry air to the lungs are
constricted, and as a result, less air is able to flow in and out of the lungs.
(4)
Asthma attacks can cause a multitude of symptoms ranging in severity from mild
to life-threatening.
(4)
Asthma is not considered as a part of chronic obstructive
pulmonary disease as this term refers specifically to combinations of disease that
are
irreversible
such
as
bronchiectasis,
chronic
bronchitis,
and
emphysema.(5)Unlike these diseases, the airway obstruction in asthma is usually
reversible, if left untreated, the chronic inflammation accompanying asthma can
make the lungs to become irreversibly obstructed due to airway remodeling. (6) In
contrast to emphysema, asthma affects the bronchi, not the alveoli. (7)
1.1
Asthma:
1.1.1Definition:
Asthma is a common chronic inflammatory disease of the airways characterized
by variable and recurring symptoms, reversible airflow obstruction, and
bronchospasm.(8) Common symptoms include wheezing, coughing, chest
tightness, and shortness of breath.(9) The definition of asthma, according to
international guidelines
(10)
, includes the three domains of symptoms: (1) variable
airway obstruction, (2) airway hyperresponsiveness (AHR) (or bronchial
hyperreactivity), and (3) airway inflammation.
1.1.2Epidemiology and global prevalence of asthma:
The prevalence of asthma in different countries varies widely, but the disparity is
narrowing due to rising prevalence in low and middle income countries and
plateauing in high income countries.
(11)
Beginning in the 1960s, the prevalence,
morbidity, and mortality associated with asthma have been on the rise.
(12)
It is
estimated that the number of people with asthma will grow by more than 100
million by 2025. (13) The greatest rise in asthma rates in USA was among black
children (almost a 50% increase) from 2001 through 2009.(11) In Africa in 1990,
74.4 million asthma cases was reported, this increased to 119.3 million in 2010.(14)
About 70% of asthmatics also have Allergies.(13) Workplace conditions, such as
exposure to fumes, gases or dust, are responsible for 11% of asthma cases
worldwide(13). While asthma is twice as common in boys as girls, (10) severe asthma
occurs at equal rates.(15) In contrast adult women have a higher rate of asthma than
men. (10)
1.1.3 Prevalence of asthma in Sudan:
The prevalence among Sudanese children by using ISAAC questionnaire and
adults by using a modified ISAAC questionnaire is different in many areas of the
Sudan (Table 1.1).The average prevalence of asthma in adults in Sudan was found
to be 10.4%. (16)
Table (1.1):Prevalence of asthma symptoms in adults & children (aged 13-14)
in different areas in Sudan.
Areas
Children
Adults
Khartoum (17)
Atbara (18)
Gadarif (19)
Prevalence %
12.2
4.2
5
White Nile (20)
11.2
Khartoum (16)
10.7
Dongola (21)
9.6
Elobeid (16)
6.7
Kassala (16)
13
1.1.4 Causes:
Asthma is caused by a combination of complex and incompletely understood
environmental and genetic interactions.
(22, 23)
severity and its responsiveness to treatment.
These factors influence both its
(24)
It is believed that the recent
increased rates of asthma are due to changing epigenetics (heritable factors other
than those related to the DNA sequence) and a changing living environment. (25)
1.1.4.1 Environmental causes:
Many environmental factors have been associated with asthma development and
exacerbation including: allergens, air pollution, and other environmental
chemicals.
(26)
Asthma is associated with exposure to indoor allergens.
(27)
Common indoor allergens include: dust mites, cockroaches, animal dander, and
mold. (28, 29) Efforts to decrease dust mites have been found to be ineffective. (30)
Smoking during pregnancy and after delivery is associated with a greater risk of
asthma-like symptoms.(10) Exposure to indoor volatile organic compounds may be
a trigger for asthma; formaldehyde exposure, for example, has a positive
association.(31) Certain viral respiratory infections may increase the risk of
developing asthma when acquired in young children such as(8) respiratory
syncytial virus and rhinovirus.(15) Certain other infections however may decrease
the risk.(15) Asthmatics in the Sudan are found to be sensitive to cockroach
allergens, cat allergens, Betulaceae trees allergens and the house dust mite. (32)
1.1.4.2 Genetic causes:
Family history is a risk factor for asthma with many different genes being
implicated. (33) If one identical twin is affected, the probability of the other having
the disease is approximately 25 %.(33) Family studies indicated that the first degree
relatives of individuals with asthma are at about five to six times risk of asthma
than the individuals in the general population.
(34)
Heritability, the proportion of
phenotypic variances that are caused by genetic effects, varies from study to study
in asthma.
(35)
By the end of 2005, 25 genes had been associated with asthma in
six or more separate populations including the genes :GSTM1, IL10, CTLA-4,
SPINK5,LTC4S, IL4R and ADAM33 among others.(36) Many of these genes are
related to the immune system or modulating inflammation. Even among this list of
genes supported by highly replicated studies, results have not been consistent
among all populations tested.
(36)
In 2006 over 100 genes were associated with
asthma in one genetic association study alone
(37)
(36)
and more continue to be found.
Some genetic variants may only cause asthma when they are combined with
specific environmental exposures.(23)The most highly replicated regions with
obvious candidate genes are chromosome 5q31-33 including interleukins 5, 13, 4,
CD14, and adrenergic beta-2-receptor (ADRB2) and chromosome 6p21.
(36)
A
recent meta-analysis of genome-wide linkage studies of asthma, bronchial
hyperresponsiveness (BHR), positive allergen skin prick test (SPT), and total
immunoglobulin E (IgE) identified overlapping regions for multiple phenotypes
on chromosomes 5q and 6p as well as 3p and 7p.
(38)
Positional cloning studies
have identified six genes for asthma on chromosome 20p13. (39)
1.1.4.2.1 Genetic Analysis of Asthma Susceptibility:
The numerous genome-wide linkage, candidate gene, and genome-wide
association studies performed on asthma and asthma related phenotypes have
resulted in an increasing large list of genes implicated in asthma susceptibility and
pathogenesis. This list has been categorized into four broad functional groups by
several recent reviewers. (40, 41)
1. Epithelial barrier function:
Studies of asthma genetics have raised new interest in the body‘s first line of
immune defense, the epithelial barrier, in the pathogenesis of asthma. Filaggrin
(FLG), a protein involved in keratin aggregation, is not expressed in the bronchial
mucosa,
(42)
which has lead others to suggest that asthma susceptibility in patients
with loss-of-function FLG variants may be due to allergic sensitization that occurs
after breakdown of the epithelial barrier.
(43)
Several epithelial genes with
important roles in innate and acquired immune function have also been implicated
in asthma. These genes include defensin-beta1(an antimicrobial peptide), Clara cell
16-kD protein (CC16) (an inhibitor of dendritic cell-mediated Th2-cell
differentiation), and several chemokines (CCL-5, -11, -24, and -26) involved in
the recruitment of T-cells and eosinophils.(44, 45, 46)
2. Environmental sensing and immune detection:
A second class of associated genes is involved in detection of pathogens and
allergens. These genes include pattern recognition receptors and extracellular
receptors, such as CD14, toll-like receptor 2 (TLR2), TLR4, TLR6, TLR10,
and intracellular receptors, such
containing 1(NOD1/CARD4).
as nucleotide-binding oligomerization domain
(47,
48,
49)
Additional studies have strongly
associated variations in the HLA class II genes with asthma and allergen-specific
IgE responses. (50)
3. Th2-mediated cell response:
Th2 -cell mediated adaptive immune responses have been widely recognized as a
crucial component of allergic disease. Genes involved in Th2 -cell differentiation
and function have been extensively studied in asthma candidate-gene association
studies, and as one might expect, SNPs in many of these genes have been
associated with asthma and other allergic phenotypes. Genes important for Th1
versus Th2 T cell polarization, like IL4
(51)
, IL4RA
(52)
and STAT6,
(53)
have
been implicated with asthma and allergy. The genes encoding IL-13 and the betachain of the IgE receptor FcεR1 are well replicated contributors to asthma
susceptibility. (50, 54)
4. Tissue response:
A variety of genes involved in mediating the response to allergic inflammation
and oxidant stress at the tissue level appear to be important contributors to asthma
susceptibility. Genes important for tissue response include a disintegrin and
metalloprotease,(39) leukotriene C4 synthase (LTC4S)
(55)
glutathione-S-
transferase (GSTP1, GSTM1), (56) arachidonate 5-lipoxygenase (ALOX-5), and
nitric oxide synthase 1 (NOS1). (57)
1.1.5 Inflammatory cells in asthma:
It is evident that no single inflammatory cell is able to account for the complex
pathophysiology of allergic disease, but some cells predominate in asthmatic
inflammation. (58)
Figure (1.1): Inflammatory cells in asthma :( 58)
1.1.6Pathophysiology:
The pathophysiologic hallmark of asthma is a reduction in airway diameter
brought about by contraction of smooth muscles, vascular congestion, edema of
the bronchial wall and thick tenacious secretions.(59) Chronic asthma may lead to
irreversible airway structural changes characterized by subepithelial fibrosis
(60)
,
extracellular matrix (ECM) deposition, smooth muscle hypertrophy, and goblet
cell hyperplasia in the airways.
(61,62)
Inflammatory cells such as T cells,
eosinophils, and mast cell (MCs) are believed to cause irreversible airway
structural changes by releasing pro-inflammatory cytokines and growth factors.
(63)
Th2 cell-mediated immune response against ‗innocuous‘ environmental
allergens in the immune-pathogenesis of allergic asthma is an established fact.Th2
polarization is mainly because of the early production of IL-4 during the primary
response.(64)IL-4 could be produced by the naive T helper cell itself.(65) Cytokines
and chemokines produced by Th2 cells, including GM-colony stimulatory factors,
IL-4, IL-5, IL-9, IL-13, and those produced by other cell types in response to Th2
cytokines or as a reaction to Th2-related tissue damage (CCL11) account for most
pathophysiologic aspects of allergic disorders, such as production of IgE
antibodies, recruitment and activation of mast cells, basophils, and eosinophils
granulocytes, mucus hyper secretion, subepithelial fibrosis and tissue remodeling.
(66)
Figure (1.2): Inflammatory pathways in asthma :( 67)
1.2 Haptoglobin (Hp):
Haptoglobin (Hp) is an acute phase protein with a strong hemoglobin-binding
capacity which was first identified in serum in 1940.(68)Three major phenotypes
named Hp1-1, Hp2-1 and Hp2-2, have been identified so far.
(69,70)
The biological
role of Hp1-1 phenotype represents the most effective factor in binding free
hemoglobin and suppressing the inflammatory responses. Hp2-1 has a more
moderate role and Hp2-2 has the least.
(71)
The liver is the principal organ
responsible for synthesis of haptoglobin and secreted in response to IL-1, IL-6, IL8, and tumor necrosis factor (TNF)
(72)
and as one of the innate immune protection
markers, has different biological roles.
(73,74)
Hp is present in the serum of all
mammals, but polymorphism is found only in humans.(7) In addition to the liver,
Hp is produced in other tissues including lung, skin, spleen, brain, intestine, arterial
vessels and kidney, but to a lesser extent.(75, 76) Also Hp gene is expressed in lung,
skin, spleen, kidney, and adipose tissue in mice. (77, 78)
1.2.1 Haptoglobin (Hp) phenotypes:
The Hp polymorphism is related to 2 codominant allele variants (Hp1 and Hp2) on
chromosome 16q22, a common polymorphism of the haptoglobin gene,
characterized by alleles Hp 1 and Hp 2, give rise to structurally and functionally
distinct haptoglobin protein phenotypes, known as Hp 1-1, Hp 2-1, and Hp 2-2.(79)
The three major haptoglobin phenotypes have been identified by gel
electrophoresis. (80) Hp 1-1 is the smallest haptoglobin, and has a molecular weight
of about 86 kd. In contrast, Hp 2-2 is the largest haptoglobin, with a molecular
weight of 170 to 900 kd. The heterozygous Hp 2-1 has a molecular weight of 90 to
300 kd.(81) Haptoglobin phenotyping is used commonly in forensic medicine for
paternity determination. (82)
Figure (1.3): The structure of the different haptoglobin phenotype: (83)
1.2.2 Haptoglobin as a Diagnostic Marker:
1.2.2.1 Conditions Associated With an Elevated Plasma Hp Level:
An elevated plasma haptoglobin level is found in inflammation, trauma, burns and
with tumors.
(84,85)
The plasma level increases 4 to 6 days after the beginning of
inflammation and returns to normal 2 weeks after elimination of the causative
agent.(86) The plasma haptoglobin level in the initial phase of acute myocardial
infarction is high, but later, owing to hemolysis, the plasma level decreases
temporarily.(87)
1.2.2.2 Conditions Associated With Decreased plasma Hp Level:
The plasma haptoglobin level is decreased in hemolysis, malnutrition, ineffective
erythropoiesis, hepatocellular disorders, late pregnancy, and newborn infants. (86, 88)
In addition, the plasma haptoglobin level is lower in people with positive skin tests
for pollens, high levels of IgE and specific IgE for pollens and house dust mites,
rhinitis, and allergic asthma. (89)
1.2.3Physiology and Functions of Haptoglobin:
In healthy adults, the haptoglobin concentration in plasma is between 38 and 208
mg/dL (0.38 and 2.08 g/L).(80) People with Hp 1-1 have the highest plasma
concentrations, those with Hp 2-2 the lowest plasma concentrations, and those with
Hp 2-1 have concentrations in the middle.(80,84) The half-life of haptoglobin is 3.5
days, and the half-life of the haptoglobin- hemoglobin complex is approximately
10 minutes.(90) Haptoglobin (Hp) is a potent antioxidant and a positive acute-phase
reaction protein whose main function is to scavenge free hemoglobin that is toxic
to
cells.
Hp
also
exerts
direct
angiogenic,
anti-inflammatory,
and
immunomodulatory properties in extravascular tissues and body fluids. It is able to
migrate through vessel walls and is expressed in different tissues in response to
various stimuli. (91) Hp can also be released from neutrophil granulocytes
(92)
at sites
of injury or inflammation and dampens tissue damage locally.(93) Hp receptors
include CD163 expressed on the monocyte-macrophage system
(94)
and CD11b
(CR3) found on granulocytes, natural killer cells, and small subpopulations of
lymphocytes. Hp has also been shown to bind to the majority of CD4+ and CD8+
T lymphocytes
(80)
, directly inhibiting their proliferation and modifying the
Th1/Th2 balance. (95)
1.2.3.1The role of Hp in regulation of the immune system:
Haptoglobin functions as an immune system modulator. Th1-Th2 imbalance is
responsible for the development of various pathologic conditions such as in
parasitic and viral infections, allergies, and autoimmune disorders. By enhancing
the Th1 cellular response, haptoglobin establishes Th1-Th2 balance in vitro.
(95)
Haptoglobin inhibits cathepsin B and L and decreases neutrophil metabolism and
antibody production in response to inflammation. (96) Also it inhibits monocyte and
macrophage functions. (97, 98) Haptoglobin binds to different immunologic cells by
specific receptors. It binds to human B lymphocytes via the CD22 surface receptor
and is involved in immune and inflammatory responses. (99) Also, haptoglobin binds
to the human mast cell line HMC-1 through another specific receptor and inhibits
its spontaneous proliferation. (100) In populations with Hp 2-2, the B-cell and CD4+
T-lymphocyte counts in the peripheral blood are higher than in populations with
Hp 1-1. People with Hp 2-2 have more CD4+ in the bone marrow than do people
with Hp 1-1. (101)
1.2.3.2 Inhibition of Prostaglandins:
Some of the prostaglandins such as the leukotrienes have a proinflammatory role in
the body. (102) Haptoglobin by binding to hemoglobin and limiting its access to the
prostaglandin pathway enzymes such as prostaglandin synthase has an important
anti-inflammatory function in the body.(103, 104)
1.2.3.3 Antibacterial Activity:
Iron is one of the essential elements for bacterial growth. The combination of
hemorrhagic injury and infection can have a fatal outcome because the presence of
blood in injured tissue can provide the required iron to the invading
microorganisms. Once bound to haptoglobin, hemoglobin and iron are no longer
available to bacteria that require iron. (105)In the lungs, haptoglobin is synthesized
locally and is a major source of antimicrobial activity in the mucous layer and
alveolar fluid and also has an important role in protecting against infection. (91)
1.2.3.4 Antioxidant Activity:
In plasma, free Hb binds Hp with extremely high affinity but low dissociation
speed, in a ratio of 1Hp:1Hb, to form the Hp-Hb complexes. These complexes are
rapidly cleared and degraded by macrophages. Hb-Hp complexes once internalized
by tissue macrophages are degraded in lysosomes. The heme fraction is converted
by heme oxygenase into bilirubin, carbon monoxide and iron.(106) So Hp prevents
the oxidative damage caused by free Hb which is highly toxic.(107) Hp also plays a
role in cellular resistance to oxidative stress since its expression renders cells more
resistant to damage by oxidative stress induced by hydrogen peroxide.(108) The
capacity of Hp to prevent oxidative stress is directly related to its phenotype. Hp1-1
has been demonstrated to provide superior protection against Hb-iron driven
peroxidation than Hp2-2. The superior antioxidant capacity of Hp1-1 seems not to
be related with a dissimilar affinity with Hb but the functional differences may be
explained by the restricted distribution of Hp2-2 in extravascular fluids as a
consequence of its high molecular mass. (109)
1.2.3.5Activation of neutrophils:
During exercise, injury, trauma or infection, the target cells secrete the primary
pro-inflammatory cytokines IL-1β and TNF-α, which send signals to adjacent
vascular cells to initiate activation of endothelial cells and neutrophils. The
activated neutrophils, which are first in the line of defense, aid in the recruitment
of other inflammatory cells following extravasation.
(110)
Neutrophils engage in
generating reactive oxygen species (ROS) as well as recruiting other defense cells,
particularly monocytes and macrophages. Hp is synthesized during granulocyte
differentiation and stored for release when neutrophils are activated. (111)
1.2.3.6 The role of Hp in angiogenesis:
Haptoglobin is an important angiogenic factor in the serum that promotes
endothelial cell growth and differentiation of new vessels,
(112)
induced
accumulation of gelatin serves as a temporary matrix for cell migration and
migration of adventitial fibroblasts and medial smooth muscle cells (SMCs) which
is a fundamental aspect of arterial restructuring.(112,113) In chronic systemic
vasculitis and chronic inflammatory disorders, haptoglobin has an important role in
improving the development of collateral vessels and tissue repair. Among the
haptoglobin phenotypes, Hp 2-2 has more angiogenic ability than the others. (113)
1.2.3.7 Hp is required to induce mucosal tolerance:
Reduced or absent responsiveness of the immune system against self-antigens is
necessary to allow the immune system to mount an effective response to eliminate
infectious invaders while leaving host tissues intact. This condition is known as
immune tolerance.
(114)
Mucosal tolerance induction is a naturally occurring
immunological phenomenon that originates from mucosal contact with inhaled or
ingested proteins. Regular contact of antigens with mucosal surfaces prevents
harmful inflammatory responses to non-dangerous proteins, such as food
components,
harmless
environmental
inhaled
antigens
and
symbiotic
microorganisms. Oral and nasal tolerance has been used successfully to prevent a
number of experimental autoimmune diseases including, arthritis, diabetes, uveitis,
and experimental autoimmune encephalomyelitis.(115)The majority of inhaled
antigen detected in lymph nodes is associated with a variety of dendritic cells.(116)
The CD4+ T cell population that arises after harmless antigen administration in the
nose is able to transfer tolerance and to suppress specific immune responses in
naïve animals.(117) Importantly, Hp expression is increased in cervical lymph nodes
shortly after nasal protein antigen instillation without adjuvant.(118)
1.2.4 Hp and asthma:
Hp has been shown to decrease the reactivity of lymphocytes and neutrophils
toward a variety of stimuli, and may act as a natural antagonist for receptor-ligand
activation of the immune system.(119) A change in the concentration of Hp at the
site of inflammation can modulate the immune reactivity of the inflammatory cells.
Haptoglobin can be expressed by eosinophils, and variable serum levels have been
reported in asthma, where both elevated
(120)
and reduced
(121)
serum haptoglobin
levels were described. Increases in haptoglobin are seen in uncontrolled asthma (122)
and 24 hours after allergen challenge in late responders.(123) Mukadder et al
reported that Hp levels were found to be significantly decreased in patients with
asthma and/or rhinitis Consistent with its roles in modulating immune responses.
(124)
Haptoglobin has also been correlated with FEV1.
(120)
Wheezing was reported
to be significantly related to low levels of Hp, and bronchial hyper-responsiveness
related to high level.
(120)
As part of its tissue repair function, haptoglobin can
induce differentiation of fibroblast progenitor cells into lung fibroblasts
(125)
and
angiogenesis. (112) Bronchial asthma was correlated with Hp1-1. (80)
1.3 A disintegrin and metalloprotease (ADAM) 33:
A disintegrin and metalloprotease (ADAM) family consists of 34 members
(ADAM1-ADAM34). ADAM is synthesized as a latent proprotein with its signal
sequence in the endoplasmic reticulum. They have an active site in the
metalloprotease domain, containing a zinc-binding catalytic site. (126, 127)The active
site sequences of ADAM33 like the other protease-type ADAM members,
implying that ADAM33 can promote the process of growth factors, cytokines,
cytokine receptors, and various adhesion molecules.
(128)
ADAM33 mRNA is
preferentially expressed in smooth muscle, fibroblasts, and myofibroblasts, but not
in the bronchial epithelium or in inflammatory or immune cells. (39, 129) The ADAM
protein has been detected in lung tissue, smooth muscle cells and fibroblasts. (130) It
is an asthma susceptibility gene and plays a role in the pathophysiology of asthma.
(39)
1.3.1Physiological functions of ADAM33:
ADAM33 consists of 22 exons that encode a signal sequence, and different
domains structure. From a functional standpoint, these different domains translate
into different functions of ADAM33, which include activation, proteolysis,
adhesion, fusion, and intracellular signaling.(131) Metalloprotease and ADAM
proteins play an important role in branching morphogenesis of the lung by
influencing the balance of growth factors at specific stages during development.
(131)
Several ADAM33 protein isoforms occur in adult bronchial smooth muscle
and in human embryonic bronchi and surrounding mesenchyme. (132)
1.3.1.1 ADAM 33 as a morphogenetic gene:
Multiple forms of ADAM33 protein isoforms exist in human embryonic lung when
assessed at 8 to 12 weeks of development.
(133)
Although many of these variants
were similar in size to those identified in adult airways and airway smooth
muscles,
fetal
lung
also
expressed
a
unique,
small
25-kD
variant.
Immunohistochemistry applied to tissue sections of human fetal lung demonstrated
ADAM33 immunostaining not only in airway smooth muscles but also in primitive
mesenchymal cells that formed a cuff at the end of the growing lung bud.
(134)
Polymorphic variation in ADAM33 could influence lung function in infancy. (135)
1.3.2 ADAM 33 as a biomarker of severe asthma:
Lee and colleagues (136) recently described the presence of a soluble form of
ADAM33 of approximately 55 kD (sADAM33). The soluble form was reported to
be over expressed in airway smooth muscles and basement membrane in subjects
with asthma but not in normal control subjects. Applying an immunoassay for
sADAM33 in bronchoalveolar lavage fluid, levels increased significantly in
proportion to asthma severity, with ADAM33 protein levels correlating inversely
with the predicted FEV1%. These exciting observations raise the possibility that
sADAM33 is a biomarker of asthma severity and chronicity and in its soluble form
could play an important role in asthma pathogenesis. (134)
1.3.3 ADAM 33 gene polymorphisms and asthma:
Disintegrin and metalloproteinase domain-containing protein 33 is an enzyme that
in humans is encoded by the ADAM33 gene
(134)
(128)
located on chromosome 20p13.
It was the first identified as an asthma susceptibility gene by positional cloning
approach in the year 2002 in a genome wide scan of a Caucasian population. (39) A
survey of 135 polymorphisms in 23 genes identified the ADAM33 gene as being
significantly
associated
with
asthma
using
case-control,
transmission
disequilibrium and haplotype analyses. (39)
A study on the Genetics of Asthma, demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma and BHR in
African-American, Hispanic, and white populations.(137) Simpson et al
(135)
supported the hypothesis that ADAM33 polymorphisms influence lung function in
early life and epithelial-mesenchymal dysfunction in the airways may predispose
individuals toward asthma, being present in early childhood before asthma
becomes clinically expressed. The ADAM33 gene was associated with a
significant excess decline in baseline forced expiratory volume in first second
(FEV1) of 23.7–30 ml/year.(138) These data imply a role for ADAM33 in airway
wall remodelling which is known to contribute to chronic airflow obstruction in
moderate to severe asthma (figure1.4).(139)Another study conducted on infants born
of allergic/asthmatic parents has revealed positive associations between SNPs of
ADAM33 and increased airway resistance, with the strongest effect seen in the
homozygotes.(140)These data support that the alterations in the expression or
function of ADAM33 is in some way involved in impairing lung function in early
life and as a consequence, increasing the risk of asthma development. The
substitution of thymine for cytosine in the T1 SNP which is located in exon 20,
results in the substitution of methionine for threonine in the cytoplasmic domain of
the protein and this may alter intracellular signaling, resulting in increased
fibroblast and smooth muscle cells proliferation.(141) Some of the significant SNPs
were located in noncoding regions within introns and the 3'untranslated region
(UTR) and may affect alternative splicing, splicing efficiency or messenger RNA
turnover as reported for other disease-causing genes.(142)
Figure (1.4): Key cells influenced by ADAM33 in airway remodelling in
asthma: (143)
1.3.4 Role of the gene-environment interaction and ADAM33 in development
of asthma:
The activation of tissue-specific susceptibility genes provides a basis for
explaining environmental factors that may be more closely associated with
asthma.(144) Selective expression of the ADAM33 gene in mesenchymal cells
suggests its potential to affect the epithelial mesenchymal tropic unit (EMTU)
along with Th2 cytokines.(145,146) Possible exposure to environmental factors such
as pollutants, microbes, allergens, and oxidant stimuli reactivates the EMTU,
which is involved in morphogenesis during fetal lung development.
(145,147)
It has
been shown that epithelium of patients with asthma is structurally and functionally
abnormal and more susceptible to oxidant-induced apoptosis.
(148)
Apoptotic cell
loss is accompanied by increased expression of epidermal growth factor (EGF)
receptors and transforming growth factors (TGF) β1 and β2.
(149)
These growth
factors play an important role in promoting differentiation of fibroblasts into
myofibroblasts that secrete other growth factors such as edothelin1, which act as
mitogens for smooth muscles and endothelial cells. (149, 150)
1.4 Interleukins and asthma:
1.4.1 Interleukin-4 (IL 4):
It is a potent lymphoid cell growth factor which can stimulate the growth,
differentiation and survivability of and regulate the function of various cell types
of hematopoietic (including B and T lymphocytes, mast cells, monocytes and
macrophages) and non-hematopoietic (e.g., vascular endothelial cells and certain
tumor cells) origin. (151) Its effects depend upon binding to and signaling through a
receptor complex consisting of the IL-4 receptor alpha chain (IL-4Rα) and the
common gamma chain (γc). (152)
1.4.1.1 Physiological functions of IL4:
IL-4, a pleiotropic cytokine produced by Th2 cells and mast cells, is a central
mediator of allergic inflammation. Its plays an essential role in IgE regulation and
plays a critical role in the induction and maintenance of allergy.
Th0 cells to promote their differentiation into Th2 cells.
(154)
(153)
IL-4 acts on
It decreases the
production of Th1 cells, macrophages, IFN-gamma, and dendritic cell IL-12.
Overproduction of IL-4 is associated with allergies. (155) IL-4 also induces vascular
cell adhesion molecule 1(VCAM-1) on vascular endothelium and thus directs the
migration of T lymphocytes, monocytes, basophils, and eosinophils to the
inflammation site.
(156)
In asthma, IL-4 contributes both to inflammation and to
airway obstruction through the induction of mucin gene expression and the
hypersecretion of mucus.
(157)
It also inhibits eosinophil apoptosis and promotes
eosinophilic inflammation by inducing chemotaxis and activation through the
increased expression of eotaxin.(158)Some of these effects may be mediated by
bronchial fibroblasts that respond to IL-4 with increased expression of eotaxin and
other inflammatory cytokines. (159)
1.4.1.2 Interleukin-4 gene and asthma:
IL4 gene has been mapped to chromosome 5q31 where asthma and atopy have also
been linked.
(160)
The human IL-4 promoter exists in multiple allelic forms, one of
which confers high transcriptional activity; causing over-expression of the IL-4
gene
(161)
Basehore et al
(162)
reported that nine SNPs in the IL-4 gene were
significantly associated with asthma or total serum IgE in whites and other allergy
related phenotypes, although ethnical differences have been reported. The IL4 (590
C/T) single nucleotide polymorphism (SNP) presents on the promoter region of the
gene (chromosome 5q23.3- 31.2).
(163)
Phylogenetic studies indicate that this
polymorphism belongs to a conserved region in all primates except for humans.
The derivative allele T has been related to elevated serum levels of IgE and
asthma, High frequencies of this allele may be the result of positive selection.
(164)
Walley et al
(165)
reported that allelic variant T-590 is associated with higher
promoter activity and increased production of IL-4 as compared to C-590 allele.
The –590C/T polymorphism is located in one of the unique binding sites for the
nuclear factor of activated T cell (NF-AT) which plays an important role in the
transcription of several cytokine genes.(166)
1.4.2 IL4 Receptor:
This receptor exists in different complexes throughout the body. IL-4Rα pairs with
the common γ chain to form a type I IL-4R complex that is found predominantly in
hematopoietic cells and is exclusive for IL-4. IL-4Rα also pairs with the IL-13Rα1
subunit to form a type II IL-4R. The type II receptor is expressed on both
hematopoietic and nonhematopoietic cells such as airway epithelium.
(167)
These
type II receptors have the ability to bind both IL-4 and IL-13, two cytokines with
closely related biological functions.(168, 169) The sequential binding sequence for this
receptor complex where IL-13 first binds to IL-13Rα1 and then this complex
recruits IL-4Rα to form a high affinity binding site.
(170)
In the case of IL-4, this
sequence of events is reversed, where IL-4 first binds to IL-4Rα with high affinity
before associating with the second subunit. (156)
1.4.2.1 Physiological functions of IL4Rα:
Receptors for both interleukin 4 and interleukin 13 couple to the JAK1/2/3-STAT6
pathway.(168,169) The IL4 response is involved in promoting Th2 differentiation.
(156)
The IL4/IL13 responses are involved in regulating IgE production, chemokine
and mucus production at sites of allergic inflammation.(156) In certain cell types,
IL4Rα can signal through activation of insulin receptor substrates, IRS1/IRS2.
(171)
The binding of IL-4 or IL-13 to the IL-4 receptor on the surface of
macrophages results in the alternative activation of those macrophages. Alternative
activated macrophages downregulate inflammatory mediators such as IFNγ during
immune responses, particularly with regards to helminth infections. (172)
Soluble IL-4Rs (sIL-4Rs) are present in biological fluids and contain only the
extracellular portion of IL-4R and lack the transmembrane and intracellular
domains. In vitro, sIL-4R blocks B cell binding of IL-4, B cell proliferation, and
IgE and IgG1 secretion. (173) In vivo, sIL-4R inhibits IgE production by up to 85%
in anti-IgD-treated mice (174) and reduces airway inflammation, suggesting that sIL-
4R may be useful in the treatment of IgE-mediated inflammatory diseases such as
asthma. (175, 176) One potential disadvantage of sIL-4R as a treatment is that it does
not block the effects of IL-13, because, in asthma, the effects of allergic
inflammation are mediated by both IL-4 and IL-13.(156)
1.4.3 Interleukin 4 receptor (IL-4Rα) gene and asthma:
The IL-4 receptor alpha (IL-4Rα, also called CD124) gene encodes a single-pass
transmembrane subunit protein. This gene is located on chromosome 16p
(16p12.1).
(177)
There is evidence that interleukin-4 (IL-4) and its receptor (IL-4R)
are involved in the pathogenesis of asthma.
(178, 179)
A recent meta-analysis
indicated a modest risk associated with IL4R single nucleotide polymorphisms
(SNPs) on occurrence of asthma, but other investigators found conflicting results.
(179)
Analysis of asthma candidate genes in a genome-wide association study
population showed that SNPs in IL4R were significantly related to asthma.(180)
African Americans experience higher rates of asthma prevalence and mortality
than whites
(181)
, few genetic association studies for asthma have focused
specifically on the roles of the IL-4 and IL-4Rα genes in this population.(162, 182)
Gene–gene interaction between IL-4 and IL-4Rαand asthma has been demonstrated
in several populations.
(183, 184)
The Q576R polymorphism that is associated with
asthma susceptibility in outbred populations, especially severe asthma, this allele is
overrepresented in the African-American population (70% allele frequency in
African Americans vs. 20% in Caucasians. (185,186,187)The Q576R (A/G) is gain-offunction mutation also enhancing signal transduction, which results in glutamine
being substituted by arginine.(188)
1.4.3 Interleukin 13:
IL-13 is a cytokine closely related to IL4 that binds to IL-4Rα. IL-13 and IL-4
exhibit a 30% of sequence similarity and have a similar structure.
(189)
produced by
CD4+ T cells, NK T cells, mast cells, basophils, eosinophils.(190) It is implicated as a
central
regulator
in
IgE
synthesis,
mucus
hypersecretion,
airway
hyperresponsiveness (AHR), and fibrosis.(191)
1.4.3.1 Physiological functions of IL13:
In vitro studies have demonstrated that IL-13 has a broad range of activities,
including switching of immunoglobulin isotype from IgM to IgE,
adhesion of eosinophils to the vascular endothelium
(193)
(192)
increase
and augmentation of cell
survival.(194) Proliferation and activation and of mast cells.(195) Increased epithelial
permeability.(196)
(197)
Induction
of
goblet
cell
differentiation
and
growth.
Transformation of fibroblasts into myofibroblasts and production of
collagen.(198)Diminished relaxation in response to B-agonists (199) and augmentation
of contractility in response to acetylcholine in smooth muscles. (200)
1.4.3.1.1 IL-13 role in mucus production:
Goblet cell hyperplasia and mucus overproduction are features of asthma and
chronic obstructive pulmonary disease and can lead to airway plugging, a
pathologic feature of fatal asthma.
(201)
Animal models demonstrate that IL-13
induces goblet cell hyperplasia and mucus hypersecretion
(202)
and human in vitro
studies demonstrate that IL-13 induces goblet cell hyperplasia. Experiments
suggest that these effects are mediated by IL-13 signaling through IL-13Rα1.(203,204)
Human bronchial epithelial cells (HBEs), stimulated by IL-4 and IL-13, can also
undergo changes from a fluid absorptive state to a hypersecretory state independent
of goblet cell density changes. (205, 206)
1.4.3.1.2 IL-13 in airway hyperresponsiveness:
Inflammation, remodeling and AHR in asthma, are induced by IL-13 over
expression.
(207)
Also IL-13 modulates Ca2+ responses in vitro in human airway
smooth muscles.(208) Saha SK et al(209) reported that Sputum IL-13 concentration
and the number of IL-13+cells in the bronchial submucosa and airway smooth
muscles bundle are increased in severe asthmatics.(209)
1.4.3.1.3 Interleukin-13 in pulmonary fibrosis:
Experimental models identify IL-13 to be an important profibrotic mediator. (210,211)
Both IL-4 and IL-13 have redundant signaling pathways with implications in
pulmonary fibrosis. IL-4 and IL-13 are important in alternatively activated
macrophage induction, which is believed to regulate fibrosis. (211)
1.4.3.2 IL 13 and inflammatory pathways in asthma:
Munitz et al (191) demonstrated that key pathogenic molecules associated with
asthma severity, such as chitinase, are entirely dependent on IL-13 signaling
through IL-13Rα1, a component of the type II receptor. Rhinovirus (RV), the virus
responsible for the common cold, in children is a distinct risk factor for asthma
exacerbations. (212)Among the cytokines studied, IL-13 was the most increased in
the RV group versus the respiratory syncytial virus (RSV) group. (213)
1.4.3.3 Anti-interleukin-13 antibody therapy for asthma:
Piper et al. (214) reported that patients with poorly controlled asthma who
received a humanized monoclonal antibody directed against IL-13 (tralokinumab)
showed improvement. Analysis of patients with elevated sputum IL-13 (>10
pg/mL-1) at study entry had numerically higher improvements in FEV1 compared
with subjects whose values were lower than these thresholds, suggesting that the
presence of residual IL-13 was associated with a larger FEV1 response. These data
bear much in common with recently published findings from a trial of
lebrikizumab, another anti-IL-13 monoclonal antibody, in patients with asthma.
(215)
The treatment group who received lebrikizumab had a significant improvement
in FEV1, 5.5% higher than that in patients receiving placebo. (215)
1.5 Glutathione S-transferases (GSTs):
Glutathione S-transferases (GSTs) belong to a super family of phase II
detoxification enzymes, which play an important role in protecting cells from
damage caused by endogenous and exogenous compounds by conjugating reactive
intermediates with glutathione to produce less reactive water-soluble compounds.
(216)
GSTs are a multi-gene family of enzymes involved in drug biotransformation
and xenobiotic metabolism and, in a few instances, activation of a wide variety of
chemicals.
(217)
Conklin et al
(218)
reported that GSTs represent a major group of
detoxification enzymes and redox regulators important in host defense to numerous
environmental toxins and reactive oxygen species (ROS) including those found in
cigarette smoke and air pollution. (219)
1.5.1 Functions of GSTs:
GSTs neutralize the electrophilic sites of compounds by conjugating them to
the tripeptide thiol, glutathione (GSH). (220)The compounds targeted in this manner
by GSTs encompass a diverse range of environmental or exogenous toxins,
including chemotherapeutic agents and other drugs, pesticides, herbicides,
carcinogens, and variably-derived epoxides.(216)GSTs are responsible for a reactive
intermediate formed from aflatoxin B1, which is a crucial means of protection
against the toxin in rodents. (216)
1.5.3.1 The detoxication functions of GSTs:
As enzymes GSTs are involved in many different detoxication reactions. The
substrates mentioned below are some of the physiologically interesting substrates.
GST P1-1, GST M1-1 and GST A1-1 have been shown to catalyze the inactivation
process of α, β unsaturated carbonyls. One example of α, β unsaturated carbonyls
is acrolein, a cytotoxic compound present in tobacco smoke. Exposure of cells to
acrolein produce single strand DNA breaks.
(221)
Another class of α, β unsaturated
carbonyls are propenals, which are generated by oxidative damage to DNA. (222)
1.5.3.2 The metabolic function of GSTs:
GSTs are involved in the biosynthesis of prostaglandins (PGs). Human GST M2-2
has been isolated as a prostaglandin E synthase in the brain cortex.
(223)
Human
GST M3-3 also displays the same activity while GST M4-4 does not.(224) The
Sigma class of GST was shown to catalyze the isomerization reaction of PGF2 to
PGD2. PGD2, PGE2 and PGF2 act as hormones that bind to G-protein coupled
receptors. These receptors in turn regulate other hormones and neurotransmittors.
(224)
1.5.3.3 The regulatory function of GSTs:
The most recent studies on GSTs have demonstrated that GST P1-1 interacts with
c-Jun N-terminal kinase 1 (JNK1) suppressing the basal kinase activity.
(225)
Introduction of GST P1-1 elicits protection and increased cell survival when the
cells are exposed to hydrogen peroxide (H2O2).
(226)
same protection against UV-induced apoptosis.
GST P1-1 does not elicit the
(225)
In contrast to GST P1-1,
mouse GST M1-1 seems to protect cells against both UV-and H2O2-induced cell
death. (227)
1.5.4 GSTs and asthma:
Several studies have highlighted that oxidative stress damages pulmonary function
and might act as a key player in the worsening of asthma symptoms.
(228)
The
damage caused by oxidative injury leads to an increase in airway reactivity and/or
secretions, and influences the production of chemoattractants and increases
vascular permeability.(229) All these factors exacerbate inflammation, which is the
hallmark of asthma. Phase II detoxification enzymes, particularly classes of
glutathione S-transferases (GSTs), play an important role in inflammatory
responses triggered by xenobiotic or reactive oxygen compounds. (230) Studies have
shown that individuals with lowered antioxidant capacity are at an increased risk of
asthma. (231) In particular, GSTM1 and GSTT1 null polymorphisms and a single
nucleotide polymorphism of GSTP1 (Ile105Val) may influence the pathogenesis of
respiratory diseases.
(230)
There are several explanations for the role of GSTs in
disease pathogenesis, the first being that xenobiotics are not discharged from the
organism in the absence of these enzymes, and may trigger mast cell
degranulation.
(216)
Secondly, it is known that leukotrienes released by mast cells
and eosinophils, important compounds in bronchial constriction, are inactivated by
GSTs.
(232)
The absence of these enzymes may contribute to asthma by
abnormalities in the transport of inflammatory inhibitors to bronchioles. (233)
1.5.5 Glutathione S-transferase Theta 1 (GSTT1):
The GSTT1 is an important phase II enzymes that protect the airways from
oxidative stress. (216) It has lower glutathione binding activity, along with increased
catalytic efficiency. They utilize as substrates a wide variety of products of
oxidative stress.
(234)
The GSTT1 gene is located on chromosome 22q11 and it is
one of the members of GST‘s enzymes family. Human GST genes are
polymorphic, either due to presence of single nucleotide polymorphisms (SNPs) or
due to deletions.(235) Total gene deletion or null polymorphism leads to no
functional enzymatic activity.
(236)
Enzymes of this group have a wide range of
substrates including carcinogens in food, air or medications, tobacco smoke,
combustion products.
(237)
Frequency of GSTT1 null polymorphism differs largely
among different populations. It has highest frequency in Asians (50%) followed by
African Americans (25%) and Caucasians (20%).
(238)
Deletion polymorphism of
GSTT1 gene has been associated with asthma in children and adults.
(229, 239, 240)
The
GSTT null gene leads to non-transcription of messenger RNA and non-translation
of the protein, resulting in complete loss of functionality.
(241)
It is postulated that
GSTT1 null gene may lead to a reduction in anti-inflammatory and anti-oxidative
systems, possibly potentiating the pathogenesis of asthma. (242)
1.5.6Glutathione S-transferase Pi 1(GSTP1):
In human, GST-Pi was first detected in placenta.
cytosolic GST expressed in lung epithelium.
(244)
(243)
GSTP1 is the predominant
GSTP1 enzyme plays a key role
in biotransformation and bioactivation of certain environmental pollutants such as
benzo[a]pyrene-7, 8-diol-9, 10-epoxide (BPDE) and other diol epoxides of
polycyclic aromatic hydrocarbons.
(245)
GSTP1 is a gene located on chromosome
11q13, a known ―hot spot‖ for asthma-related genes.(246) A single nucleotide
polymorphism at position 313 in GSTP1 results from conversion of an adenine to a
guanine (A>G). (247) The resulting isoleucine to valine substitution in codon 105 of
exon 5 (Ile105_Val105) significantly lowers GST enzyme activity. (248)This GSTP1
variant has been associated with asthma in some studies.
(249,250, 251)
studies.( 252,253) This variant has been reported to be both protective
but not all
(254, 255, 256)
and a
risk factor(250, 257, 258) for asthma. The inconsistency may have several explanations,
including differences in asthma pathogenesis in young children and adults, as well
as the effects of other common variants in GSTP1 coding and promoter regions.
(250, 257)
1.6 Diagnosis:
A diagnosis of asthma should be suspected if there is a history of recurrent
wheezing, coughing or difficulty of breathing and these symptoms occur or
worsen due to exercise, viral infections, allergens or air pollution. (8) Spirometry is
then used to confirm the diagnosis.(8) In children under the age of six the diagnosis
is more difficult as they are too young for spirometry. (10)
1.7 Classification and severity:
According to guidelines, evaluation of severity is necessary for appropriate and
adequate treatment, especially the selection and dosing of medications.(259,
260)
Based on symptoms and signs of severity, asthma can be classified into four
clinical stages: intermittent, mild persistent, moderate persistent and severe
persistent.(259,260) Certain medications are indicated for each clinical stage.(261) It is
clinically classified according to the frequency of symptoms, forced expiratory
volume in one second (FEV1), and peak expiratory flow rate.(262) Peak flow meter
is necessary to be able to assess the severity of asthma at different times, measure
the peak expiratory flow (PEF which is a good indication of the degree of
obstruction to air flow (GINA).
(259)
The international union against tuberculosis
and lung disease (263) estimates the severity of the symptoms as follows:
Intermittent: symptoms disappear for long periods. When they return, they occur
less than once a week (< weekly). The periods of attacks last only a few hours or a
few days. When there are nocturnal symptoms, they occur less than twice a
month.
*Persistent: symptoms never disappear for more than one week. When symptoms
occur more than once a week, they are called persistent.
Mild persistent: symptoms occur less than once a day (weekly) and nocturnal
symptoms occur more than twice a month.
Moderate persistent: symptoms are daily and attacks affect activity and sleep
patterns more than once a week.
Severe persistent: symptoms are continuous with frequent attacks, limiting
physical activity and often occurring at night.
Table (1.2) Clinical classification (≥ 12 years old): (262)
Severity
Symptom
frequency
Night time
symptoms
%FEV1 of
predicted
FEV1
Variability
SABA use
Intermittent
≤ 2/week
≤ 2month
≥ 80%
<20%
≤
2days/week
Mild
persistent
>2/week
3–4/month
≥ 80%
20–30%
>
2days/week
Moderate
persistent
Daily
> 1/week
60–80%
> 30%
daily
Severe
persistent
Continuously
Frequent
(7×/week)
< 60%
> 30%
≥ twice/day
1.8 Prevention and management:
Early pet exposure may be useful.(264) Reducing or eliminating compounds (trigger
factors) known to the sensitive people from the work place may be effective.(265)
Plan for proactively monitoring and managing symptoms should be created. This
plan should include the reduction of exposure to allergens, testing to assess the
severity of symptoms, and the usage of medications. The treatment plan and the
advised adjustments to treatment according to changes in symptoms should be
written down.(10)The most effective treatment for asthma is identifying triggers,
such as cigarette smoke, pets and aspirin and eliminating exposure to them. If
trigger avoidance is insufficient, the use of medication is recommended.
Pharmaceutical drugs are selected based on, among other things, the severity of
illness and the frequency of symptoms. Specific medications for asthma are
broadly classified into fast-acting and long-acting categories. (8)
1.9 Justification:
Currently, there is no cure for asthma; however, people who have asthma can still
lead productive lives if they control their asthma. Physician evaluations of asthma
severity and medication requirements often rely on subjective indices reported by
patients, including daily symptom scores and use of inhaled asthma medication.
These measures are prone to inconsistencies due to variations in investigator and
patient assessments. They can also be difficult to obtain, especially in young
children, and most of them imperfectly reflect physiologic alterations involved
with asthma. Patient symptoms may subside despite the presence of residual
disease in the form of reduced lung capacity and bronchial hyperreactivity. Patients
with decreased pulmonary function who remain asymptomatic may later
experience shortness of breath caused by severely restricted lung capacity. Studies
point to IL4 /IL4RA, ADAM33 and GSTs and clinical utility as an indicator of
asthma severity and as a monitor for asthma therapy, and to investigate
haptoglobin phenotype in asthmatic patients.
1.10 Objectives:
General objectives:
The overall aim of this study is to investigate the possible immunological and
genetic markers that may correlate with the occurrence and the severity of asthma
among Sudanese asthmatics.
Specific objectives:
The specific objectives of the study are to:
1. Assess the level and the common phenotype of haptoglobin among
Sudanese asthmatic and healthy controls.
2. Measure the level of IL4 and IgE in normal and different classes of
asthma in Sudan using ELISA technique.
3. Determine the frequency of the known alleles of IL4, IL4Rα, ADAM33
and GSTs in Sudanese asthmatic patients and healthy controls using PCR
based methods.
4. Correlate between genetic polymorphisms of IL4 (-590)/IL4Rα (- 576),
ADAM33 and GSTs (GSTT1, GSTPi) and the severity of asthma among
Sudanese population.
Materials and Methods
2.1 Materials:
The following materials were used in this study.
2.1.1 Electronic Spirometer:
- Micro/Micro Plus Spirometers. CE120. was purchased from Micro Medical
Limited 1998
– P.O Box 6 Rochester Kent ME 1 2AZ. England.
It measures magnitude and velocity of air movement out of lungs.
The indices measured are:1. Forced vital capacity (FVC): the volume of gas that can be forcefully
expelled from the lung after maximal inspiration.
2. The forced expiratory volume in the first second (FEV1): the
volume of gas expelled in the first second of the FVC maneuver.
3. Peak expiratory flow rate (PEFR): the maximum air flow rate
achieved in the FVC maneuver.
4. Maximum voluntary ventilation (MVV): the maximum volumes of
gas that can be breathed in and out during 1minute.
5. Slow vital capacity (SVC): the volume of gas that can be slowly
exhaled after maximal inspiration.
6. FEV1/FVC: values of FEV1 and FVC that are over 80% of predicted are
defined as within the normal range. Normally the FEV1 is about 80%
of the FVC.
Specification of micro and micro-plus spirometers:
- Transducer: digital volume transducer
- Resolution: 10ml
- Accuracy: +/- 3% (To ATS recommendations standardization of spirometry
1994 update for flows and volumes)
- Flow range: 30L/min – 1000L/min
-Volume range: 0.1 - 9.99 liters.
-Display: custom 3digit liquid crystal
- power supply: 9v PP3
O
- Storage Temperature: 20 to + 70 C - Storage Humidity:10% - 90% RH
Mouth pieces:
Disposable mouth pieces. Micro Medical CE 120.
- Spiro safe pulmonary filters.
- cat No SPF 6050.
- Made in England.
Figure (2.1) Electronic Spirometer and mouth pieces:
Digital volume transducer
Display screen
Switch unit
Microcomputer unit
2.1.2 Gel electrophoresis cell:
- Horizontal gels within a single tank.
- Designed for rapid screening of DNA and PCR samples.
- CS Cleaver Scientific
- www. Cleaverscientific.com
Figure (2.2) Gel electrophoresis cell:
(1)
(2)
(3)
(4)
1. Power supply: - Model: MP -250V
- Serial number: 091202016
- 120~ 240V ~ 47/60 Hz
2. Casting dams: allow gels to be rapidly cast externally.
3. Combs (The number of samples can be maximized using high tooth
number combs).
4. Tank:
- Stock code: MSMINI
-Max volts 250 VDC.
-Made in the UK
- Max current 250 m A.
2.1.3 PCR machine:
Alpha Laboratories Ltd
40 Parham Drive, Eastleigh
Hampshire, 5050 4NU – United Kingdom
Figure (2.3) PCR machine:
Tel: 023 80 483000
PCR running program
2.1.4 Primers:
Made in Korea www.mocrogene.com
Macrogen Inc – dong Geumchun – gu Seoul Korea 153-781.
Tel: 82-2-2113-7037
Fax: 82-2-2113-7919
Figure (2.4): Forward and Reverse primers:
2.1.5 Maxime PCR PreMix Kit ( i-Taq):
- Product Catalog No.25025 (for 20µL rxn, 96tubes)
- iNtRON biotechnology, Inc. www.intronbio.com/ [email protected]
- Korea T. (0505)550-5600/ F. (0505)550- 5660
Figure (2.5) Maxime PCR PreMix Kit ( i-Taq):
2.1.6 UV Transilluminator JY-02S analyzer:
- Made in china
- Model number: JY- 02S
- Serial number: 0903002D
- Input voltage: 220 ± 10 - Input frequency: 50 Hz - Fuse: Φ5× 20 3A×2
- It is used to take and analyze the picture after the electrophoresis.
Figure (2.6) UV Transilluminator analyzer:
2.1.7 Microplate reader:
Model: RT-2100C
a.c. 110 V- 220V
- 451403041 FSEP
50/60Hz
120 WATTS
T3.15 AL 250V
Rayto life and Analytical sciences Co., Ltd
C&D/4F,7th Xinghua industrial Bldg, Nanhai Rd.
Shanghai International Holding Corp.GmbH (Europe)
Eiffestrasse 80, D- 20537, Hamburg, Germany.
- RT-2100C is a microprocessor –controlled, general purpose photometer system
designed to read and calculate the result of assays, including contagion, tumorous
mark, hemopathy, dyshormonism, which are read in microtiter plate.
Figure (2.7): Microplate reader:
(1)
(2)
(3)
1- Touch panel: display program
2- Plastic cover
3- Plate carrier: Microplate in plate carrier
2.1.8 ELIZA kits:
Made in: MINNEAPOLIS, MN USA
- www.RnDSystems.com
R&D Systems,Inc. USA & Canada R&D systems, Inc (800)343-7475
Figure (2.8): ELIZA kits for haptoglobin and IL4.
2.1.9 Vertical electrophoresis cell:
- For routine mini protein electrophoresis.
- Model: DYC2 – 24 DN
- Serial number: 028 – 01
- Umax 600 V - Imax 200mA
- Bei jing Liuyi Instrument Factory.
- Add: No. 128, Zaojia Street, Fengtai District, Beijing china
Tel: +86- 10- 63718710
Fax: +86- 10- 63719049
Figure (2.9): Vertical electrophoresis:
Power supply
Electrophoresis cell (Tank)
2.2 Methods:
2.2.1 Study design: It is a cross sectional analytic and descriptive study.
2.2.2 Study area: the study was conducted during (2013-2014) in Khartoum
state.
2.2.3 Study population:
Asthmatic patients if only they have documented physician-diagnosed
asthma and healthy subjects with no symptoms of present illness of both
sexes and aged between 16 to 60 years were included. Subjects with any
chronic disease or chest deformity or smoking habits were excluded.
Sample size:
- One hundred and sixteen Sudanese subjects were selected. Sixty three were
asthmatic patients and Fifty three were healthy volunteers.
2.2.4 Ethical considerations:
Ethical clearance has been obtained from the ethical committee of the
National Ribat University and consent from participants.
2.2.5 Procedures:
The study was conducted through the following phases: Questionnaire, Clinical
examination, Body Mass Index (BMI), Lung function tests, collection of blood
sample, Molecular analysis and Laboratory Analysis.
2.2.5.1 Questionnaire:
All selected subjects were interviewed to fill a questionnaire (appendix 1) form
including information about personal data, smoking habits, Family history, age of
onset, past medical history, drug history, triggering factors, Major asthma
symptoms such as wheeze, cough, chest tightness and shortness of breathing. The
severity of asthma was assessed in accordance with the international UNION
classification. Also the asthmatics patients were assessed by using Asthma control
questionnaire (appendix 2).
Asthma Control Test:
There were five questions in total. The patient was requested to circle the
appropriate score for each question. By adding up the numbers of the
patient’s responses, the total asthma control score was calculated.
2.2.5.2 Clinical examination:
The respiratory rate, pulse rate, blood pressure and any chest signs were recorded.
2.2.5.3Body Mass Index (BMI):
Weight and height were measured with participants standing without shoes
and wearing light clothing by using digital Weight scale and height scales
(mobile digital stadiometer). BMI was calculated by weight in kilograms over
height in meters squared.
2.2.5.4 Lung function tests:
Pulmonary function tests were performed by using electronic spirometer.
The switch unit was moved to its first position (BLOW).the display unit was
indicated (Blow) and three zeros. Measurements started with asking a
subject to stand up, take a deep breath, put a mouthpiece connected to the
spirometer in his mouth with the lips tightly around it, and then blow air out
as hard and as fast as possible for at least 5 seconds. When the subject has
completed this maneuver both the FEV1and FVC measurements were
displayed by pushing the switch upward to the (VIEW) position.
This procedure was performed until three acceptable measurements are
obtained from each subject according to standard criteria. The best was
taken
(266)
according to the guidelines of the American Thoracic Society and
European Respiratory Society.
2.2.5.5 Sampling technique:
Five mL of venous blood was collected from each subject. 2.5ml of collected
blood immediately transferred into EDTA tubes (EDTA as anticoagulant) and
stored at 40C for DNA extraction, and 2.5 ml transferred into plain tube for
serum. Serum was separated from the sample of blood after clotting and after
centrifugation and stored in eppendorf tube at -200C.
2.2.5.6 Molecular analysis:
2.2.5.6.1 DNA extraction:
DNA extraction from human blood:
DNA was extracted from the peripheral blood leucocytes using salting out
method.
Salting out method for DNA extraction from human blood: (267)
I. Solutions and buffers:
1. PBS (1 mM KH2P04, 154mM NaCl, 5.6 mM Na2HP04; pH7.4)- 1 liter
2. Sucrose Triton X-lysing Buffer
3. T20E5, pH8
4. Proteinase K (stock of 10 mg/mL)
5. Saturated NaCl (100 mL of sterile water was taken and 40g NaCl was added to
it slowly until absolutely saturated. It was agitated before use and NaCl was left
to precipitate out).
Purification of DNA from blood (2.5mL sample):
2.5 mL blood was brought to room temperature before use and then transferred to
a sterile polypropylene tube. It was diluted with 2 volumes of PBS, mixed by
inverting the tubes and centrifuged at 3000 g for 10 min. The supernatant was
poured off. The pellet (reddish) is resuspend in 12,5ml of Sucrose Triton X-100
Lysing Buffer. The mixture was vortexed and then placed on ice for 5 minutes.
The mixture was spun for 5 minutes at 3000 rpm in TH.4 rotor and the
supernatant was poured off. The pellet (pinkish or white) was resuspend in 1.5
mL of T20E5 (0.6X volume of original blood). 10% SDS was added to a final
concentration of 1% (100 L) then Protienase K was added (10 mg/mL) (20 L).
The mixture was mixed by inversion after adding each solution then the samples
were incubated at 45C overnight. 1 mL of saturated NaCl was added to each
sample and mixed vigorously for 15 seconds then it was spun for 30 minutes at
3000rpm. A white pellet was formed which consisted of protein precipitated by
salt, the supernatant that contained the DNA was transferred to a new tube.
Precipitation of DNA was achieved by adding two volumes of absolute alcohol
kept at room temperature. The solution was agitated gently and the DNA was
spooled off and transfered to eppendorf tube. The DNA was washed in 70% icecold alcohol (1 mL), air dried and dissolved in the appropriate volume of TE (100
L) and stored at 4 degrees overnight to dissolve. DNA was detected by
electrophoresis on gel.
Figure (2.10) Precipitation of DNA:
DNA clump
together
White
Layer
containing
DNA
visible air
bubbles “lift”
the DNA out
of solution
2.2.5.6.2 Agarose gel electrophoresis requirements for DNA and PCR
product:
- Agarose: forms an inert matrix utilized in separation.
- Ethidium bromide: for fluorescence under ultraviolet light
- TBE: stands for Tris Borate EDTA.
- Loading buffer: 1x TBE buffer is the loading buffer which gives color and
density to the sample to make it easy to load into the wells.
-Agarose gel electrophoresis procedure:
-
Making the gel (for a 2% gel, 100mL volume):
The mixture was heated until the agarose completely dissolved and then cooled
to about 60°C and 4µL of ethidium bromide (10mg/mL) added and swirled to
mix. The gel slowly poured into the tank. Any bubbles were pushed away to the
side using a disposable tip. The combs were inserted, double check for being
correctly positioned and left to solidify. 5µL DNA or PCR product was loaded
on the gel (inside the well). 1X TBE buffer (running buffer) poured into the gel
tank to submerge the gel. The gel was run at 100V for 20 minutes. After that it
was viewed on the ultra- violet radiation system.
-Five SNPs were selected for screening (table 2.1).
2.2.5.6.3 Polymerase chain reaction (PCR):
Standard PCR reaction:
All components necessary to make new DNA in the PCR process were placed in
20µl total volume. The experiment consists of DNA in 0.5 ml maxime PCR
Premix tube.
Primers preparation:
10 µL of primer added to 90 µL of sterile water. Forward and reverse primers were
prepared in separate eppendorf tube.
Preparation of PCR mixture:
The mixture prepared by adding 1 µL of forward primer, 1 µL of reverse primer
and 16 µL sterile water to PCR Premix tube and finally 2 µL of DNA.(appendix
3)
Table (2.2) The Polymerase chain reaction protocol:
PCR cycle
Temperature
Time
Number of cycles
Initial denaturation
94оC
5 min
-
Denaturation
94оC
30sec
30
Annealing
57оC
30sec
30
Extension
72оC
30sec
30
Final extension
72оC
5min
-
Checking of PCR products:
To confirm the presence of amplifiable DNA in the samples, by evaluating the
production of the target fragment by gel electrophoresis of 5µL PCR products on
2% agarose gel stained with ethidium bromide.
2.2.5.6.4Restriction Fragment Length Polymorphism Analysis (RFLPs):
For restriction enzyme analysis: the mixture contains 10 μL of the PCR product ,
0.5 μL (10 U) of restriction enzyme, 2.5 μL of 10X buffer and 12 μL of H2O
(total volume 25 μL) . This mixture was incubated according to the enzyme. After
the
incubation was complete, the restriction analysis was carried out in an
agarose gel electrophoresis with 1X TBE buffer.
Table (2.3) the restriction enzymes incubation protocol:
Enzyme
Incubation
Inactivation
BsmFI (appendix 4)
1 hour at 65оC
20 minutes at 80оC
BsmAI (appendix 5)
2 hours at 55оC
20 minutes at 80оC
MspI (appendix 6)
20 minute at 37оC
-----
2.2.5.7 Laboratory Analysis:
2.2.5.7.1 Polyacrylamide Gel Electrophoresis (PAGE): (268)
Principle of the test:
Different samples will be loaded in wells or depressions at the top of the
polyacrylamide gel. The proteins move into the gel when an electric field is
applied. The gel minimizes convection currents caused by small temperature
gradients, and it minimizes protein movements other than those induced by the
electric field. Proteins can be visualized after electrophoresis by treating the gel
with a stain, which binds to the proteins but not to the gel itself. Each band on the
gel represents a different protein (or a protein subunit); smaller proteins are found
near the bottom of the gel.
2.2.5.7.1.1 Preparation of the reagents:
- 30% acryl/bisacrylamide:
30g of acrylamide and 0.8g of bis-acrylamide were dissolved in 100ml distilled
water (dH2O).
- 8X Tris⋅Cl, pH 8.8 (1.5 M Tris⋅Cl):
182g Tris base was dissolved in 300 ml H2O and Adjusted to pH 8.8 with 1 N HCl.
H2O was added to 500 ml total volume.
- 10% of ammonium persulphate:
1g of ammouniumpersulphate was dissolved in 100ml dH2O.
- 4X Tris⋅Cl, pH 6.8 (0.5 M Tris⋅Cl):
6.05 g Tris base was dissolved in 40 ml H2O and adjusted to pH 6.8 with 1 N
HCl. H2O was added to 100 ml total volume.
- Sample buffer:
1ml glycerol, 1ml distilled H2O and 0.001g bromophenol blue were mixed.
- 5XElectrophoresis buffer:
15.1g Tris base and 72.0g glycine were dissolved in 1000 ml H2O.
 Dilute to 1X for working solution.
- Benzidine stain:
14.6 ml acetic acid and 1 gram benzidinedihydrochloride were dissolved in
485.4 ml distilled H2O
 1 drop H2O2 (2% = 5 µl/200 µl) was added just before use.
- Hemoglobin (Hb) solution:
1ml of whole blood was washed by 5ml PBS five times .1ml of washed RBCs
added to 9 ml distilled water, left at room temperature for 30 minute .Then
centrifuged at 15000 for 1hour .The supernatant is the standard Hb solution.
2.2.5.7.1.2 Separating gel preparation:
The phenotypes of Hp was determined using 7% acrylamide gel, which was
prepared by mixing 3.5ml of 30% acrylamide/bis-acrylamide , 3.75ml of 1.5 M
Tris-Cl
(pH
8.8)
,
70µl
of
10%
ammonium
persulphate
and
20µl
Tetramethylethylenediamine (TEMED) and then the volume was completed by
addition of 7.75ml deionized water, mixed well and 4ml of this mixture was
immediately poured with a Pasteur pipette into the tray of the instrument. One ml
of butanol was added just after the addition of the gel to prevent bubbles formation.
The gel was left to solidify for 20 min before the addition of the stacking gel.
2.2.5.7.1.3 Stacking gel preparation:
After the solidification of the separating gel, stacking gel was prepared by mixing
0.65 ml of 30% acrylamide/bisacrylamide, 1.25 ml of 0.5 M Tris-Cl, 30µl of 10%
ammonium persulphate and 15µl Tetramethylethylenediamine (TEMED) and then
the volume was completed by addition of 3.05 ml deionized water, mixed well and
2ml of this mixture was immediately poured with a Pasteur pipette above the
separating gel, and immediately a 1.5mm thick comb was inserted, the gel was left
to solidify for 20 min after that the combs were removed.
2.2.5.7.1.4 Sample preparation and loading:
From the serum, 10µl was mixed with 3µl of Hb solution and incubated for 5 min
at room temperature then 10µl of the sample buffer was added and mixed. 10 µl of
the sample were loaded into the gel. Running has been done with 1X
electrophoresis buffer at 200V for 2 hrs.
2.2.5.7.1.4 Protein staining:
After the protein has been separated, the protein was stained by Benzidin stain.
After the gel was removed from the casting glasses it was immersed in 30ml of the
stain solution, the bands started to appear immediately and Hp phenotypes was
determined according to the pattern of each band in the gel.
2.2.5.7.2 ELISA (enzyme-linked immuno assay):
2.2.5.7.2.1 Quantitative assay for total IgE antibodies:
The components of the kit are: (appendix 7)




Microplate: 96 wells, pre-coated with anti-IgE.
Reagent 1: buffered protein solution with antimicrobial agent.
Reagent 2: wash buffer concentrate.
Reagent 3: (conjugate) mouse anti human IgE conjugate (horseradish
peroxidase).
 Reagent 4: TMB substrate (Tetramethylbenzidine).
 Reagent 5: stop solution.
 Standards: 0, 50, 150, 375, 1250IU/ml of 10mM tris-buffered saline
containing human serum IgE ready to use.
 Positive control 1mL of 10mM tris-buffered saline containing human serum
IgE ready to use.
Principle of the test:
Diluted serum samples incubated with monoclonal anti human IgE immobilized
on microtitre wells. After washing away unbound serum components, monoclonal
mouse anti-human conjugated to horseradish peroxidase is added to the wells, and
this binds to surface- bound IgE during the second incubation. Unbound
conjugate is removed by washing, and a solution containing 3, 3, 5, 5, tetramethylbenzidine (TMB) and enzyme substrate is added to trace specific
antibody binding. Addition to stop solution terminates the reaction and provides
the appropriate pH color development. The optical densities of the standards,
positive control and samples are measured using microplate reader at 450 nm.
Procedure:
-100µl of each standard and positive control were dispensed.
20µl of each sample and 80µl of sample diluent were dispensed into each sample
well (to make a 1/5 dilution). The plate was tapped rapidly to mix the well
contents. It was then incubated for 60 minutes at room temperature. During all
incubations direct sunlight and close proximity of any heat sources were avoided.
After 60 minutes, the well contents were decanted and washed 3 times using
manual procedure.
Manual wash procedure:
The wells were emptied by inversion and blotted on absorbent paper. The wells
were filled with wash buffer by wash bottle and then emptied again. This wash
process was repeated 3 times.
After that100µl of conjugate was dispensed to each well then it was incubated for
30 minutes at room temperature. After incubation the well contents were
discarded and carefully the wells were washed 4 times with wash buffer. 100µl of
TMB substrate was rapidly dispensed into each well by a repeating dispenser. The
plate was incubated for 15 minutes.100µl of stop solution was added to each well.
To allow equal reaction times, the stop solution should be added to the wells in
the same order as the TMB substrate. The optical density of each well was read at
450nm by a microplate reader within 10 minutes.
2.2.5.7.2.2 Quantitative assay for total Haptoglobin:
The components of the kit are: (appendix 8)
 Microplate: 96 well coated with antibody against human Hp.
 Hp Conjugate: antibody against human Hp (horseradish peroxidase)
 Standard: human Hp in a buffered protein base.
 Assay diluent RD1-109: buffered protein base.
 Calibrator diluent RD5-67: buffered protein base.
 Wash buffer concentrate: concentrated solution of buffered surfactant.
 Color reagent A: stabilized hydrogen peroxide.
 Color reagent B: stabilized chomogen (tertramethylbenzidine).
 Stop solution: 2N sulfuric acid.
Principle of the assay:
This assay employs the quantitative sandwich enzyme immunoassay technique.
Amonoclonal antibody specific for human haptoglobin has been pre-coated onto a
microplate. Standards and samples are pipette into the wells and any haptoglobin
present is bound by the immobilized antibody. After washing away any unbound
substances, an enzyme-linked polyclonal antibody specific for human haptoglobin
is added to the wells. Following a wash to remove any unbound antibody- enzyme
reagent, a substrate solution is added to the wells and color develops in proportion
to the amount of haptoglobin bound in the initial step. The color development is
stopped and the intensity of the color is measured.
Reagent preparation:
All reagents and samples were brought to room temperature before use. Wash
buffer was mixed gently. Color reagent A and B were mixed together in equal
volumes within 15 minutes of use. Calibrator diluent was prepared by adding 20µL
of it to 80 20µL distilled water. (Appendix 9)
Assay procedure:
The excess microplate strips were removed from the plate frame and returned to
the foil pouch containing the desicant pack and reseal.200µL of assay diluents
RD1-109 was added to each well. 20 µL of standard, control and samples were
added per well and covered with adhesive strip provided and incubated for 2 hours
at room temperature. After that aspirated and washed and repeated the process
three times for a total four washes. Complete removal of liquid at each step is
essential to good performance. After the last wash, removed any remaining wash
buffer by aspirating or decanting. The plate was inverted and plotted against clean
paper towels.
After washing 200 µL of Hp conjugate was added to each well and covered with
anew adhesive strip and incubated for 2 hours at room temperature. The
aspiration/wash as in step 5 was repeated. 200 µL of substrate solution was added
to each well and incubated for 30 minute at room temperature on the penchtop and
protected from light. 50 µL of stop solution was added to each well. The optical
density of each well was determined within 30 minutes, by a microplate reader set
to 450nm.
2.2.5.7.2.3
Quantitative assay for IL4:
The components of the kit are: (appendix 10)
 Microplate: 96 well coated with antibody specific for human IL4.
 Human IL4 standard: recombinant human IL4 in a buffered protein base.

IL4 Conjugate: antibody specific for IL4 (horseradish peroxidase)
 Assay diluent RD1- 32: buffered protein base.
 Calibrator diluent RD6-9: animal serum.
 Wash buffer concentrate: concentrated solution of buffered surfactant.
 Color reagent A: stabilized hydrogen peroxide.
 Color reagent B: stabilized chomogen (tertramethylbenzidine).
 Stop solution: 2N sulfuric acid.
Principle of the assay: it is the same principle as for haptoglobin.
Reagent preparation:
All reagents and samples were brought to room temperature before use.
Concentrated wash buffer was mixed gently and 20mL of it was added to 480 mL
distilled water. Substrate solution was prepared by mixing color reagent A and B
together in equal volumes within 15 minutes of use. Calibrator diluent RD5Lwas
diluted (1-5) by adding 20µL of it to 80µL distilled water. (Appendix 11)
Assay procedure:
The excess microplate strips were removed from the plate frame and returned them
to the foil pouch containing the desicant pack and reseal. 100µL of assay diluents
RD1-32 was added to each well and 50 µL of standard, control, samples were
added per well within 15 minutes and covered with adhesive strip provided and
incubated for 2 hours at room temperature.
Aspirate and wash each well, and repeated the process twice for a total three
washes. Wash by filling each well with wash buffer (400 µL) using a squirt bottle.
Any remaining wash buffer was removed by aspirating or decanting after the last
wash. The plate was inverted and plotted against clean paper towels.
200 µL of human IL4 conjugate was added to each well and covered with anew
adhesive strip and incubated for 2 hours at room temperature. The aspiration/wash
was repeated and 200 µL of substrate solution was added to each well and incubate
for 30 minute at room temperature on the penchtop and protected from light.50 µL
of stop solution was added to each well and the color in the well was changed
from blue to yellow. The optical density of each well was determined within 30
minutes, by using a microplate reader set to 450nm.
2.3 Method of data analysis:
Results obtained were analyzed using the Statistical Package for the Social
Sciences (SPSS). Data were expressed as means with the standard deviation
(sd).The correlations were analyzed by Pearson correlations. Numerical data were
compared using one way ANOVA for multiple groups. Categorical data were
compared using chi-square testing and cases Cross tabulation for multiple groups.
When three groups (two homozygote groups and one heterozygote group) were
compared, only the overall p value was generated to determine whether an overall
difference in the three groups existed. And a P value equal to or lower than 0.05
was considered statistically significant.
Results
A total of one hundred and sixteen Sudanese subjects participated in the study of
different ages and sexes.
Figure (3.1): The percentage of females and males in the study group:
48%
52%
Male 65
Female 61
3.1 Study group:
The participants were distributed as:
Test group:
63 subjects were selected and classified as Asthmatic.
-
35 subjects were females.
-
28 subjects were males.
Control group:
53 subjects were selected and classified as normal.
-
16 subjects were females.
-
37 subjects were males.
Figure (3.2): The total number of females and males:
Table (3.1) Distribution of anthropometric characteristics among female
subjects:
Means ± sd
P values
Normal (16)
Asthmatic (35)
29.4 ± 6
34.77 ±13
0.126
Height (cm)
163.5 ± 6.5
158.9 ± 5.9
0.058
Weight (Kg)
69.75 ± 8.38
68.5 ± 15.8
0.836
Body mass index (Kg/m2)
26.3 ± 4.17
27.08 ± 6.4
0.751
n of anthropometric characteristics among male subjects:
Means ± sd
P values
Number
Age (years)
Tab
le
(3.2
)
Dist
rib
utio
------------
30.05 ± 7.8
40.58 ± 16
0.002*
Height (cm)
179 ± 7.9
169.9 ± 8.9
0.751
studi
Weight (Kg)
76 ± 11
69.1 ± 16
0.181
es do
24.1 ± 3.6
23.5 ± 4.6
0.717
Age (years)
Body mass index (Kg/m2)
Normal (37)
*
Asthmatic (28)
Number
Gen
etic
not
influ
enced by age.
The asthmatic group was divided according to International UNION classification.
(237)
We have included 63 cases of asthma of which 10 (16%) had intermittent, 10
(16%) had mild persistent, 27(43%) had moderate persistent and 16(25%) had
severe persistent subgroup of asthma.
Figure (3.3): The classification of asthmatic group:
Series1;
Intermittent
10; 10; 16%
Series1;
Severe 16;
16; 25%
Series1;
Moderate 27;
27; 43%
Intermittent 10
Series1; Mild
Mild
10 ;10
10; 16%
Moderate 27
Severe 16
3.2 Asthma Control Test (ACT):
The ACT test showed decline in asthmatic patients score (table 3.3).
Table (3.3): The asthma control test score in asthma patients:
Test
Means ± Sd
Asthmatic score
Total score
15.8
ACT
P values
25
0.000
ACT score < 20- off target indicates that asthma was not controlled.
3.3 lung function tests:
All parameters (FEV1, FVC, PEFR,) were better in normal compared to asthmatic
subjects. The difference between normal and asthmatic was highly significant
(table 3.4).
Table (3.4) Distribution of lung functions test among the study group:
Means ± Sd
Test
Normal (53)
P values
Asthmatic (63)
FEV1
3.16 ± 0.77
2.01 ± 0.73
0.000
FVC
3.66 ± 0.83
2.63 ± 0.88
0.000
PEFR
484 ± 147
312.8 ± 112.5
0.000
FVC: forced vital capacity FEV1: forced expiratory volume in 1second
PEFR: peak expiratory flow rate.
3.4 Serum level of IgE and IL4 in asthmatic and control:
Serum level of IgE and IL4 were significantly higher in asthmatics (table 3.5).
Table (3.5) Distribution of serum level of IgE and IL4 among the study group:
Test
IgE (IU/ml)
Means ± sd
Normal
334 ± 250.71
Asthmatic
769 ± 377.6
P values
0.000
IL4 (pg/mL )
10.27 ±1.1
12.5 ± 2.1
0.000
Figure (3.4) IgE level in asthmatic and control group:
Asthmati
c;
Asthmati
c; 769
IgE IU/mL
Asthmati
c;
Control;
334
Control;
Asthmatic; 0
Asthmatic
Control;
Control; 0
Control
Figure (3.5): IL4 level in asthmatic and control:
; IL4 pg/mL
Asthmati
c ; 12.5
Asthmatic
; Control;
10.27
Control
3.4.1 Serum level of IgE in different classes of asthma:
Comparing serum IgE levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed (P= 0.867)(table3.6).
Table (3.6) Serum IgE in different classes of Asthma:
Asthma class
Mean (±Sd)
Intermittent
743.3 ± 405.3
Mild
855 ± 387.3
Moderate
767.9 ± 362.8
Severe
722 ± 412.3
3.4.2 Serum level of IL4 in different classes of asthma:
P Value
0.867
Comparing serum IL4 levels between each asthmatic group by using one way
ANOVA showed that statistically there was no significant difference between the
groups observed ( P= 0.536)(table3.7).
Table (3.7) Serum IL4 in different classes of Asthma:
Asthma class
Mean ±Sd
Intermittent
11.9 ± 2.3
Mild
13.3 ± 1.8
Moderate
12.6 ± 2.4
Severe
12.3 ± 1.6
P Value
0.536
3.5
Haptoglobin phenotypes and Level:
The high haptoglobin phenotypes frequency of asthmatics was observed in 50.8%
patients with Hp2-1. The Hp2-2 phenotype frequencies were found in 31.7% and
Hp1-1 in 17.5%. In healthy control group, the high haptoglobin phenotype
frequencies were seen in 66% with Hp2-1, whereas 26.4% for Hp2-2 and 7.6% for
Hp1-1 were found (table3.8). Figure (3.6) shows determination of serum
haptogloblin phenotypes electrophoresis in polyacrylamid gel using benzidin stain.
Comparison of each haptoglobin phenotype together by using Chi-Square Tests
and cases Cross tabulation, the frequency difference of each phenotype in the two
groups were analyzed and statistically there was no significant difference between
the two groups observed (P=0.163).
Table (3.8) Distribution of Hp phenotype among the study group:
Phenotype
% of Normal
% of Asthmatic
1-1
7.6
17.5
2-1
66
50.8
2-2
26.4
31.7
P values
0.163
Figure (3.6) Determination of Haptoglobin phenotype electrophoresed in
polyacrylamid gel:
1
2
3
4
5
6
7
8
9
10
1-1
2-2
2-1
2-1
2-1
2-1
2-2
2-1
2-1
1-1
Lanes 1,10:1-1 Hp phenotype(smallest molecular weight);lanes 2,7: 2-2
Hp phenotype(largest molecular weight) ;Lanes 3, 4, 5, 6, 8, 9:2-1 Hp
phenotype.
Serum Hp level showed significant difference between asthmatic and control
(table3.9)(figure3.7).Comparing serum Hp levels between patients and controls in
each phenotypic group showed that mean of Hp serum level was significantly
higher in patients than controls in 1-1 and 2-1 phenotypes and no significant
differences in 2-2 phenotype (table 3.10).
Table (3.9) Distribution of serum level of Hp among the study group:
Means ± sd
Test
Normal
Asthmatic
2.72 ±1.4
Hp (g/L )
P values
4.17 ± 1.7
0.001
Figure (3.7): comparison of Hp level in serum of asthmatic and control:
Asthmati
c;
Asthmati
c; 4.17
Hp g/L
Asthmati
c;
Control;
2.72
Control;
Asthmatic; 0
Asthmatic
Control;
Control; 0
Control
Table (3.10) A comparison of serum Hp in Patients and healthy control with
different haptoglobin phenotype:
Phenotype
Group
Mean(g/L) ±Sd
P. Value
Patients
3.9 ± 1.4
Control
1.9 ± 0.26
Patients
4.06 ± 1.7
Control
2.75 ±1.01
Patients
4.48 ±1.8
Control
3.38 ± 3.24
0.035
1-1
0.008
2-1
0.391
2-2
Comparing serum Hp levels between each asthmatic group by using one way
ANOVA showed that mean of Hp serum level was significantly different between
all groups (table3.11).
Table (3.11) Serum Hp in different classes of Asthma:
Asthma class
Mean (g/L) ± sd
Intermittent
5.23 ± 1.5
Mild
3.59 ± 2.2
Moderate
3.68 ± 1.3
Severe
4.79 ±1.4
P. Value
0.034
3.6 polymorphisms of ADAM33 in chromosome 20:
Analysis of both allele and genotype frequencies for ADAM33 polymorphism by
using Chi-square calculations tests showed that ADAM33 polymorphism was
significantly associated with asthma. The minor allele, A, of ADAM33 SNPs was
significantly more frequent in asthmatics than in the control group. The major
allele, G, was significantly more frequent in the control group than in asthmatics
(P-value = 0.000) (table 3.12) (figure 3.8).Concerning genotype frequencies, Cases
Cross tabulation and Chi-square tests demonstrated significant differences between
asthmatics and control subjects: The minor A/A genotype was more frequent in the
asthmatics (71.4%) than in the control group (P-value = 0.000) (table 3.12). Figure
(3.9) showed ADAM33 PCR product on 3% agarose and Figure (3.10) showed
analysis of ADAM33 polymorphism on 3.8% agarose.
Table (3.12) Allele and genotype frequencies for ADAM33 SNPs:
SNPs
F+1 G>A
Allele or
% of
genotype
Asthmatics
% of
Normal
G
19
44.3
A
81
55.7
GG
9.5
24.5
GA
19.1
41.5
AA
71.4
34
P. value
0.000
0.000
Figure (3.8): Mutant allelic frequencies of ADAM33 polymorphism for
asthmatic and control (%):
Figure (3.9): The ADAM33 PCR product on 3% agarose:
The ADAM33 F+1 PCR product on 3% agarose. M: DNA Ladder
(100pb); Lane‘s 1-7 ADAM33 PCR products
Figure (3.10): Analysis of ADAM33 polymorphism on 3.8% agarose:
Analysis of the ADAM33 F+1 polymorphism on 3.8 % agarose. M: DNA
Ladder (100pb); Lanes 1, 2, 3: Allele (GA) heterozygous; Lanes 4,5 :Allele
(GG) homozygous; Lane 7: Allele (AA) homozygous
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects by using one way ANOVA showed that mean of FEV1 was significantly
different between heterozygous (GA) and homozygous (GG) mutant genotypes
(table3.11). While no significant difference with Homozygous (AA) genotype
(P=0.074) (table 3.13).
Table (3.13): A comparison of FEV1 in asthmatics and healthy control with
different ADAM33 genotype:
FEV1 mean ± Sd
ADAM33
genotype
P. value
Asthmatics
Control
GG
203 ± 86.6
300 ± 72
0.074
GA
167.9 ± 83
291 ± 57.8
0.005
AA
209.6 ±67.9
341.9 ±90
0.000
3.7 Polymorphisms of IL4 (-590 C/T) in chromosome 5:
Analysis of both allele and genotype frequencies for IL4 promoter (-590C/T)
polymorphism by using Chi-square calculations tests showed that IL4 promoter (590C/T) polymorphism was significantly associated with asthma (table 3.14). The
minor allele, T, of IL4 promoter (-590C/T) SNPs was significantly more frequent
in asthmatics than in the control group (figure 3.11). The major allele, C, was
significantly more frequent in the control group than in asthmatics (P.value =
0.000) (table 3.14).Concerning genotype frequencies, Cases Cross tabulation and
Chi-square tests demonstrated significant differences between asthmatics and
control subjects: The minor T/T genotype was more frequent in the asthmatics
(65.1%) than in the control group (P.value = 0.022) (table 3.14). Figure (3.12)
showed IL4 (-590C/T) PCR product on 3% agarose.
Table (3.14): Allele and genotype frequencies for IL4 (-590C/T) SNPs:
of %
P. value
Allele or
% of
SNPs
genotype
Asthmatics Normal
-590C>T
57.1
C
30.2
T
69.8
CC
25.4
54.3
CT
9.5
5.7
TT
65.1
40
42.9
0.00
0.022
Figure (3.11): Mutant Allelic frequencies of IL4 (-590C/T) polymorphism for
asthmatic and control (%):
Allelic frequencies of IL4 polymorphism for
asthmatic and control (%)
Figure (3.12): The IL4 (-590 C/T) PCR product on 3% agarose:
The IL4 (-590) C>T PCR product on 3% agarose. M: DNA Ladder
(100pb); Lane‘s 2-7 IL4 PCR products.
3.8 Polymorphisms of IL4Rα (- Q576R) in chromosome 16:
Analysis of both allele and genotype frequencies for IL4Rα (-576) polymorphism
by using Chi-square calculations tests showed that statistically no significant
difference between the minor allele, C, and the major allele, T in asthmatics and
control group (P.value = 0.170) (table 3.15) (figure 3.13).Concerning genotype
frequencies, Cases Cross tabulation and Chi-square tests demonstrated no
significant differences between asthmatics and control subjects: The minor C/C
genotype was (33.33%)in the asthmatics and (24.5%) in the control group (P-value
= 0.402) (table 3.15). Figure (3.14) showed IL4Rα (-576) PCR product and
analysis of polymorphism on 3% agarose.
Table (3.15) Allele and genotype frequencies for IL4Rα (-576) SNPs:
% of
P. value
Allele or
% of
SNPs
genotype
Asthmatics Normal
-Q576R
T >C
T
42.9
51.9
C
57.1
48.1
TT
19.05
28.3
TC
47.62
47.2
CC
33.33
24.5
0.170
0.402
Figure
(3.13):
Mutant allelic frequencies of IL4Rα polymorphism for asthmatic and control
(%):
Figure (3.14): The IL4Rα (-576) PCR product and analysis of polymorphism
on 3% agarose.
Analysis of the IL4Rα T >C (Q576R) polymorphism on 3% agarose.
M: DNA Ladder (100pb); Lanes 1, 5: Allele (CC) homozygous; Lanes 6,
3.9 7:
GSTs
polymorphisms:
Allele
(TT) homozygous; Lanes 2, 3, 4: Allele (TC) heterozygous.
3.9.1 Polymorphisms of GSTT1 in chromosome 22:
Analysis of null genotype frequencies for GSTT1 polymorphism by using Chisquare calculations tests showed that higher frequency of GSTT1 deletion
polymorphism was found in asthmatic (P= 0.001)(table 3.16) (figure 3.15) .Figure
(3.16) showed analysis of GSTT1 polymorphism on 3% agarose.
Table (3.16): Genotype distribution of GSTT1 SNPs:
SNPs
Allele
% of Asthmatics % of Normal
P. value
Figu
Null
54
24.5
Present
46
75.5
Null allele
re
0.001
(3.15
):
GSTT1 null genotype frequencies for asthmatic and control (%):
Figure (3.16): Analysis of GSTT1 polymorphism on 3% agarose:
Analysis of the GSTT1 Genotype on 3% agarose. A350 bp fragment from
the β-globin was coamplified for internal control purposes.
3.9.2 Polymorphisms of GSTPi in chromosome 11:
Analysis of both allele and genotype frequencies for GSTPi Ile105Val
polymorphism by using Chi-square calculations tests showed that statistically no
significant difference between The minor allele, G, and major allele, A in
asthmatics
and
control
group
(P.value = 0.358)
(table 3.17)
(figure
3.17).Concerning genotype frequencies, Cases Cross tabulation and Chi-square
tests demonstrated no significant differences between asthmatics and control
subjects: The minor G/G genotype was (19%) in the asthmatics and (16.98%) in
the control group (P-value = 0.669) (table 3.17). Figure (3.18) showed GSTPi
Ile105Val PCR product on 3% agarose and Figure (3.19) showed
analysis of
GSTPi Ile105Val polymorphism on 3% agarose.
Table (3.17) Allele and genotype frequencies for GSTPi SNPs:
% of
Allele or
% of
SNPs
P. value
genotype
Asthmatics Normal
Ile105Val
313A>G
A
65.1
70.8
G
34.9
29.2
AA
50.8
58.49
AG
30.2
24.53
GG
19
16.98
0.358
0.669
Figure (3.17): Mutant allelic frequencies of GSTPi polymorphism for
asthmatic and control (%):
Figure (3.18): The GSTPi Ile105Val PCR product on 3% agarose:
The GSTPi A>G (Ile_Val105) PCR product on 3% agarose
M: DNA Ladder (100pb); Lanes 2-7GSTPi PCR product
Figure (3.19): Analysis of Ile105Val polymorphism on 3% agarose:
Analysis of the GSTPi A>G (Ile_Val105) polymorphism on 3% agarose.
M: DNA Ladder (100pb); Lanes 1, 3: Allele (AA) homozygous; Lane2:
Allele (GG) homozygous; Lanes 4, 5: Allele (AG) heterozygous.
3.10: Frequencies of mutant genotypes:
A combination of the double and triple genetic polymorphisms more frequent in
asthmatic than control subjects (table 3.18) (figure 3.20).
Table (3.18): Combination of various risk mutant genotypes:
Number of
mutant genotype
% of Normal
% of Asthmatic
0
32.1
7.9
1
34
7.9
2
18.9
38.1
3
13.2
33.3
4
1.8
11.1
5
0
1.6
Figure (3.20): Combination of various risk mutant genotypes of 5 genes:
Control; 0 Control;
Asthmatic;Asthmatic;
Control
mutation;1mutation; 2 mutation;3 mutaion;
Asthmatic
32.1
34
38.1
33.3
Control; 2
mutation; Control; 3
Asthmatic;
18.9
mutaion;
4 mutaion;
Asthmatic;Asthmatic;
13.2
11.1
0 mutation;1mutation;
Control; 4Asthmatic;
7.5
7.5
mutaion; 5 mutaion;
Control;
1.8
1.6 5
mutaion; 0
Discussion
Asthma is an inflammatory disease influenced by genetic and environmental
factors and associated with alterations in the normal architecture of the airway
walls, termed airways remodeling. The principal finding in this study is that IgE
and IL4 were significantly higher in asthmatic subjects compared to control
(P=0.000 and P=0.000 respectively) and no significant difference between asthma
classes. A linkage between total serum IgE and IL4 gene has been shown. IL4 is a
pleiotropic cytokine contributing to the maintenance of the Th2 lymphocyte profile
that leads to the elevation of baseline IgE levels.(162,164) The expression of IL-4 gene
was significantly more in asthmatic patients compared to controls (table3.13) and
the IL4 T-590 allele causes hyperproduction of IL-4.(165)
The association of Hp phenotypes with a variety of pathological conditions has
been interested by many investigators. Comparison of Hp phenotype frequency
between study groups showed that Hp1-1 and Hp 2-2 were higher in asthmatics
than controls, whereas Hp2-1 was higher in control group. Langlois MR et al
reported that Bronchial asthma has been seen with Hp1-1.(80)
In this study serum Hp level was found significantly higher in asthmatic patients
compared to healthy controls (table 3.9) and significantly higher in all asthma
classes (table 3.11).This is not unexpected, since other studies
(120,120)
showed that
asthma is associated with a higher Hp level. Association between specific protein
expression in bronchoalveolar lavage during differentiation of circulating
fibroblast progenitor cells in mild asthma has been reported by Larsen K et al.
(125)
They described elevated levels of Hp in patients with mild asthma compared to the
other subjects and issued a novel role for expression of Hp in airway remodeling in
patients with asthma. Krasteva et al (269) reported that salivary Hp level in children
with allergic asthma was elevated when compared to the healthy subjects. This
result is in disagreement with Piessens MF et al (89) who reported that the Hp level
was decreased in asthmatic subjects. Increase in Hp was seen in uncontrolled
asthma. (122)The increased Hp level in this study might be due to the poor control of
asthma. The possible explanation for the high level is the especial functions of Hp
as an immune system modulator.
(95)
Also, Hp binds to the human mast cell line
HMC-1 and inhibits its spontaneous proliferation. (100) Although IgE is measured as
an investigation for some asthmatics, Hp has not been used and it could be a useful
marker for asthma control.
Comparison of Hp level in Patients and healthy controls with different Hp
phenotypes showed that Hp level in asthmatics with 1-1 and 2-1 phenotypes was
significantly higher than control with same phenotype, while Hp level in
asthmatics with 2-2 phenotype was slightly increased but with no significant value
(table 3.10). The possible explanation of the slight increase that the B-cells and
CD4+ T-lymphocyte counts in the peripheral blood were higher in 2-2 Hp
phenotype (101) and Hp bind to the majority of CD4+ and CD8+ T lymphocytes (80),
directly inhibiting their proliferation and modifying the Th1/Th2 balance. (95)
A study on the Genetics of Asthma demonstrated positive association between
single nucleotide polymorphisms (SNPs) of ADAM33 and asthma in AfricanAmerican, Hispanic, and white populations.(137) In this study, we genotyped
ADAM33 variants in asthmatic and control subjects to evaluate the potential
influences of ADAM33 gene polymorphisms on asthma risk. As expected,
significant associations were observed in asthmatic patients. We found that the
homozygous mutant genotypes and allele frequencies of SNP F+1 was
significantly associated with asthma (table 3.12).In previous studies, F+1 SNP
polymorphism was reported in Indian adult populations
(270)
and UK
German populations.(271) and these associations were also found in the
(39)
and
study
samples. In contrast, lack of association for ADAM33 gene in asthma have also
been reported in populations from Korea (272) and Australia.(273)
Comparing FEV1 between each ADAM33 genotype in asthmatics and control
subjects showed that FEV1 was significantly decreased in heterozygous (GA) and
homozygous (GG) mutant genotypes (table3.13) while no significant difference
with Homozygous (AA) genotype (table 3.13). These results are supported by
previous studies. Jongepier H et al (138) reported that ADAM33 gene was associated
with a significant excess decline in baseline forced expiratory volume in first
second (FEV1). These data imply a role for ADAM33 in airway wall remodelling
which is known to contribute to chronic airflow obstruction in moderate to severe
asthma.(139)
Another study conducted in infants of allergic/asthmatic parents has revealed
positive associations between SNPs of ADAM33 and increased airway resistance,
with the strongest effect seen in the homozygotes.(140)
Thus, the present study adds to the growing list of population studies where the
ADAM33 SNPs seems to play a role in the susceptibility to asthma.
Polymorphism in promoter region of the cytokine gene was analyzed (C-590T
IL4). The derivative allele T has been related to elevated serum levels of IgE and
asthma. (165)Walley et al
(165)
reported that allelic variant T-590 is associated with
higher promoter activity and increased production of IL-4 as compared to C-590
allele. The analysis of cytokine level revealed a statistically significant increase of
IL-4 in asthmatic as compared to the control (table3.5).Hyper production of IL-4
leads to overproduction of IgE in asthmatic groups as compared with controls
(table 3.5). In this study -590C/T IL4 polymorphism showed the high incidence of
the TT homozygote mutant genotypes (65.1% in asthmatic and 40% in control) (P=
0.022) (table 3.13). Also it was found that the T allele frequencies was
significantly associated with asthma (table 3.13) (P= 0.000). The results of this
study are more in agreement with work reported in different population. (51,162,274)
The IL-4 receptor alpha mediates in B lymphocytes the class-switch recombination
mechanism and generation of IgE and IgG, which happens in response to IL4/IL13 and allergens/antigens. In this study, it was found that the minor allele C was
more frequently in asthmatics than in control subjects; likewise, the major allele T
was found more frequently in the control subjects than in asthmatics (table 3.14)
but statistically not significant (P= 0.170). The CC genotype was more frequent in
asthmatics and TT genotype was more frequent in control subjects (table 3.14) but
statistically not significant (P= 0.402). Association studies between IL4Rα
polymorphisms
and
asthma
have
been
reported
in
several
ethnic
groups.(180,184,185)One study showed that the IL-4Rα Q576R mutant was not
associated with serum IgE levels in Chinese asthmatic children.(275) IL-4R α
polymorphisms alone may not always influence the susceptibility to disease.(274)
The combined effect of IL-4Rα Q576R SNP with mutant alleles in other genes
could contribute significantly to disease susceptibility. The consequence of these
findings is that common variants alone cannot account for a given disease.
Phase II detoxification enzymes, particularly classes of glutathione S-transferases
(GSTs), play an important role in inflammatory responses triggered by xenobiotic
or reactive oxygen compounds.(203) Studies have shown that individuals with
lowered antioxidant capacity are at an increased risk of asthma. (204) In particular,
GSTT1 null polymorphisms and a single nucleotide polymorphism of GSTP1
(Ile105Val) may influence the pathogenesis of respiratory diseases. (203)This study
showed that the GSTT1 null genotype was more frequent in asthmatic patients
compared with control subjects (table 3.15). Frequency of GSTT1 null
polymorphism differs largely among different populations. It has highest frequency
in Asians (50%) followed by African Americans (25%) and Caucasians (20%).
(211)
Total gene deletion or null polymorphism leads to no functional enzymatic
activity. (209)
On the other hand, genotyped GSTP1 Ile105Val SNP showed no significant
difference between asthmatic and control subjects (table 3.16). The mutant G/G
genotype was (19%) in the asthmatics and (16.98%) in the control group (P=
0.669) in agreement with work reporting that in different populations.( 225,226) Some
studies reported association between GSTP1 variant and asthma. (222,223, 224)
Asthma is a complex disease where many genes are involved and contain different
phenotypes such as bronchoconstriction, airway remodeling, hyperactivity, mucus
hypersecretion, and persistent inflammation.(276)Given the complexity of asthma, it
could be speculated that in an individual, multiple SNPs in several genes could act
in concert or synergy to produce a significant effect. The current study confirmed
that polymorphism of the ADAM33 gene is associated with asthma. Therefore, it is
suggested that the ADAM33 gene may be an important gene for asthma
development and remodeling processes. The results showed a significant
association between the IL-4 promoter polymorphism -589C/T and asthma.
Furthermore, this study indicated a possible involvement of a single nucleotide
polymorphism in the IL-4 gene in the development of asthma. Moreover the results
showed that The GSTT1 null genotype was more frequent in asthmatic patient
compared with control subjects. The CC genotype of IL4Rα gene was more
frequent in asthmatics compared with control subjects. Table (3.17) showed that
double and triple
Mutant genotypes are more frequent in asthmatics compared with control subjects.
This finding supports the view that asthma is a complex polygenic disease and that
more combined genes are needed to predict the risk of asthma. Based on study
findings, each candidate gene might modulate an association with asthma.
But a combination of more the one gene modulate the different role of
pathogenesis, such as IL4 for persistent inflammation, ADAM33 for airway
remodeling and hyperactivity.
Conclusion &Recommendations
5.1Conclusion:
The level of IgE and IL4 were higher in asthmatic subjects with no significant
difference between asthma classes. Hp phenotypes have no role in activation of the
disease, while Hp level was higher in asthmatic patients and in all asthma classes.
Gene polymorphism of ADAM33, IL4 (-590) and GSTT1 may be associated with
the development of asthma. While GSTPi gene appears to play no role in the
occurrence of the disease. The present data suggests that IL4Rα polymorphisms
exert only a minor effect and do not contribute significantly to the development of
asthma. It cannot be excluded that IL4Rα polymorphisms interact with
polymorphisms in other genes that may have effects on development of asthma.
A combination of more than one gene may play an important role in the
susceptibility and development of asthma.
Chromosome 20p13, chromosome 16p12.1 and chromosome 22q11.2 may be
associated with the development of asthma in Sudan.
5.2 Recommendations:
 Cytokines play a key role in airway inflammation and structural changes of
the respiratory tract in asthma, and thus become an important target for the
development of therapeutic. Therefore, the discovery of new cytokine can
afford other opportunity to control the disease.
 Investigation of haptoglobin polymorphism in asthmatic patients and its
possible association to the presenting symptoms.
 The Haptoglobin level can be used as a biomarker for asthma control.
 Further studies on the complete genetic pathway including specific IgE
receptor gene.
 Functional studies on the IL4, ADAM33 and IL4Rα single nucleotide
polymorphisms are probably needed.
References
1. Masoli M, Fabian D, Holt S, Beasley R (2004). Global Initiative for Asthma
(GINA) program: the global burden of asthma: executive summary of the GINA
Dissemination Committee report.Allergy; 59: 469-478.
2. Mukherjee AB, Zhang ZA (2011). Allergic Asthma: Influence of Genetic and
Environmental Factors. J Biol Chem.286: 32883–32889.
3. Wenzel S E (2006). Asthma: defining of the persistent adult phenotypes. Lancet
368, 804–813.
4. NHLBI (National Heart, Lung, and Blood Institute) (2004). Diseases and
conditionsindex.http://www.nhlbi.nih.gov/health/dci/Diseases/Asthma/Asthma_
WhatIs.html
5. Self, Timothy; Chrisman, Cary; Finch, Christopher (2009). 22. Asthma. In
Mary Anne Koda-Kimble, Brian K Alldredge, et al. Applied therapeutics: the
clinical use of drugs (9th ed.). Philadelphia: Lippincott Williams & Wilkins.
6. Delacourt, C (2004). Bronchial changes in untreated asthma. Pediatr J; 11 71s–
73s.
7. Schiffman,
George
(2009).
Chronic
obstructive
MedicineNet.http://www.medicinenet.com/chronic
pulmonary
obstructive
disease.
pulmonary
disease copd.
8. NHLBI Guideline (National Heart, Lung, and Blood Institute) (2007). National
asthma education and prevention program-Pathophysiology and Pathogenesis of
Asthma, and Natural History of Asthma.pp.11-42.
9. Patient Information Series (2013):
Society-
Am
J
Respir
Crit
What Is Asthma?. American Thoracic
Care
Med
Vol
188,
P7-8.
http://patients.thoracic.org/information- series/en/resources/vcd.pdf.
10.GINA (Global Initiative for Asthma). Global strategy for asthma management
and prevention (2011).P.1-56.Available from: www.ginasthma.com.
11.Centers for Disease Control and Prevention, Vital Signs (2011). Asthma in the
US growing every year. http://www.cdc.gov/asthma/actionplan.html.
12.Stephen T Holgate, Giorgio Walter Canonica, Carlos E Baena-Cagnani,
Thomas B. Casale, Myron Zitt, Harold Nelson, Pakit Vichyanond (2011).
Asthma.
WAO white book on allergy. World Allergy Organization.
www.worldallergy.org.
13.World Health Organization (2007). Global surveillance, prevention and control
of chronic respiratory diseases: a comprehensive approach.
14.Adeloye D, Chan K y, Igor Rudan I, Campbell H (2013). An estimate of
asthma prevalence in Africa: a systematic analysis. Croat Med J. 54(6): 519–
531.
15.Bush A, Menzies-Gow A (2009). Phenotypic differences between pediatric and
adult asthma. Proc Am Thorac Soc 6 (8): 712–9
16.Magzoub AA. Validation of ISSAC questionnaire for asthma diagnosis by
pulmonary function test and skin prick tests in Sudanese adults. (2012) (Thesis
submitted for PhD requirement in Human Physiology). National Ribat
University.
17.Ait-Khalid N, Odihambo J, Pearce N, Adjoh KS, Maesano IA, Benhabyles B,
Camara L, Catteau C, Asma ES, Hypolite IE, Musa OA, Jerray M, Khaldi F,
Sow O, Tijani O, Zar HJ, Melaku K, Kuaban C, Voyi K (2007). International
Study of Asthma and Allergy (ISAAC) in Childhood Phase III: Prevalence of
symptoms of asthma, rhinitis and eczema in 13 to 14 year old children in
Africa. Allergy 2007: 10.1111/j.1398-9995.
18.Ahmed A, Magzoub A, Musa O (2009) .Prevalence of asthma symptoms in
children in Atbara, Sudan. The international journal of tuberculosis and lung
disease, volume 13, p s 141.
19.Bashir A, A (2003). Childhood asthma in Gadarif. The international journal of
tuberculosis and lung disease, volume7, p s154.
20. Bashir A, Abdalla A, Musa O (2009). Childhood asthma in White Nile state,
Sudan. The international journal of TB and lung diseases, volume 13,
supplements 1, p s 144.
21.Magzoub A, Elsoni A, Musa OA (2010). Prevalence of asthma symptoms in
adult university students and workers in Dongola, North Sudan. The
international journal of tuberculosis and lung disease, volume 14, p s 69.
22.Martinez FD (2007). Genes, environments, development and asthma: a
reappraisal. Eur Respir J 29 (1): 179–84.
23.Miller, RL; Ho SM (2008). Environmental epigenetics and asthma: current
concepts and call for studies. American Journal of Respiratory and Critical Care
Medicine 177 (6): 567–573.
24.Choudhry S, Seibold M A, Luisa N. Borrell L N, Tang H, Serebrisky D,
Chapela R, Rodriguez-Santana J R, Avila P C, Elad Ziv , Rodriguez-Cintron W
, Risch N J, Burchard E G (2007). Dissecting complex diseases in complex
populations: asthma in latino americans. Proc Am Thorac Soc 4 (3): 226–33.
25.Dietert, RR (2011). Maternal and childhood asthma: risk factors, interactions,
and ramifications.Reproductive toxicology (Elmsford, N.Y.) 32 (2): 198–204.
26.Kelly FJ, Fussell JC (2011). Air pollution and airway disease. Clinical and
experimental allergy: journal of the British Society for Allergy and Clinical
Immunology 41 (8): 1059–71.
27.Ahluwalia SK, Matsui EC (2011).The indoor environment and its effects on
childhood asthma. Current opinion in allergy and clinical immunology 11
(2):137–43.
28.Arshad SH (2010). Does exposure to indoor allergens contribute to the
development of asthma and allergy? Current allergy and asthma reports 10
(1):49–55.
29.Custovic A, Simpson A (2012). The role of inhalant allergens in allergic
airways disease. Journal of investigational allergology & clinical immunology:
official organ of the International Association of Asthmology (INTERASMA)
and Sociedad Latinoamericana de Alergia e Inmunologia 22 (6): 393–401.
30.Johansen HK (2008). Gotzsche, Peter C. ed. House dust mite control measures
for asthma. Cochrane Database Syst Rev (2).
31.McGwin G, Lienert J, Kennedy JI (2010). Formaldehyde exposure and asthma
in children: a systematic review. Environmental health perspectives 118 (3):
313–7.
32.Abdel Razag AE, Musa OA (2004). Validation of the score for allergic rhinitis
diagnosis (SFAR) and correlation of allergic rhinitis and asthma. MSc thesis
(2004), Dept. of Physiology, University of Gezira.
33.Elward, Graham Douglas, Kurtis S. (2010). Asthma. London: Manson Pub.
pp.27–29.
34.Sandford A, Weir T, Pare P (1996). The genetics of asthma. Am J Respir Crit
Care Med; 153:1749-65.
35.Pinto LA, Stein RT, Kabesch M (2008). Impact of genetics in childhood
asthma. J Pediatr (Rio J); 84:S68-75.
36.Ober C, Hoffjan S (2006). Asthma genetics: the long and winding road to gene
discovery. Genes Immun 7 (2): 95–100.
37.Halapi E, Bjornsdottir US (2009). Overview on the current status of asthma
genetics. The clinical respiratory journal 3 (1): 2–7.
38.Denham S, Koppelman GH, Blakey J, Wjst M, Ferreira MA, Hall IP, Sayers I
(2008). Meta-analysis of genome-wide linkage studies of asthma and related
traits. Respir Res 9:38.
39.Van Eerdewegh P, Little RD, Dupuis J, Del Mastro RG, Falls K, Simon J,
Torrey D, Pandit S, McKenny J, Braunschweiger K, Walsh A, Liu Z, Hayward
B, Folz C, Manning SP, Bawa A, Saracino L, Thackston M, Benchekroun Y,
Capparell N, Wang M, Adair R, Feng Y, Dubois J, FitzGerald MG, Huang H,
Gibson R, Allen KM, Pedan A, Danzig MR, Umland SP, Egan RW, Cuss FM,
Rorke S, Clough JB, Holloway JW, Holgate ST, Keith TP. (2002). Association
of the ADAM33 gene with asthma and bronchial hyperresponsiveness. Nature;
418:426–430.
40.Holloway JW, Yang IA, Holgate ST (2010). Genetics of allergic disease. J
Allergy Clin Immunol 125(2):S81-94.
41.Swarr DT, Hakonarson H (2010). Unraveling the complex genetic
underpinnings of asthma and allergic disorders. Curr Opin Allergy Clin
Immunol 10(5):434-442.
42.Ying S, Meng Q, Corrigan CJ, Lee TH (2006). Lack of filaggrin expression in
the human bronchial mucosa. J Allgery Clin Immunol 118(6):1386-1388.
43.Hudson TJ (2006). Skin barrier function and allergic risk. Nat Genet
38(4):399-400.
44.Laing IA, de Klerk NH, Turner SW, Judge PK, Hayden CM, Landau LI,
Goldblatt J, Le Souëf PN (2009). Perth Infant Asthma Follow-up Cohort.
Cross-sectional and longitudinal association of the secretoglobin 1A1 gene
A38G polymorphism with asthma phenotype in the Perth Infant Asthma
Follow-up cohort. Clin Exp Allergy 39(1):62-71.
45.Lee JH, Moore JH, Park SW, Jang AS, Uh ST, Kim YH, Park CS, Park BL,
Shin HD (2008). Genetic interactions model among Eotaxin gene
polymorphisms in asthma. J Hum Genet 53(10):867-875.
46.Zhang YG, Huang J, Zhang J, Li XB, He C, Xiao YL, Tian C, Wan H, Zhao
YL, Tsewang YG, Fan H (2010). RANTES gene polymorphisms and asthma
risk: A meta-analysis. Arch Med Res 41(1):50-58.
47.Eder W, Klimecki W, Yu L, von Mutius E, Riedler J, Braun-Fahrländer C,
Nowak D, Holst O, Martinez FD; ALEX Team (2006). Association between
exposure to farming, allergies and genetic variation in CARD4/NOD1. Allergy
61(9):1117-1124.
48.Kormann MS, Depner M, Hartl D, Klopp N, Illig T, Adamski J, Vogelberg C,
Weiland SK, von Mutius E, Kabesch M (2008). Toll-like receptor heterodimer
variants protect from childhood asthma. J Allergy Clin Immunol 122(1):8692.
49.Smit LA, Siroux V, Bouzigon E, Oryszczyn MP, Lathrop M, Demenais F,
Kauffmann F,(2009). Epidemiological Study on the Genetics and Environment
of Asthma, Bronchial Hyperresponsiveness, and Atopy (EGEA) Cooperative
Group. CD14 and toll-like receptor gene polymorphisms, country living, and
asthma in adults. Am J Respir Crit Care Med 179(5):363-368.
50.Li X, Howard TD, Zheng SL, Haselkorn T, Peters SP, Meyers DA, Bleecker
ER (2010). Genome-wide association study of asthma identifies RAD50-IL13
and HLA DR/DQ regions. J Allergy Clin Immunol 125(2):328-335.e11.
51.Haller G, Torgerson DG, Ober C, Thompson EE (2009). Sequencing the IL4
locus in African Americans implicates rare noncoding variants in asthma
susceptibility. J Allergy Clin Immunol 124(6):1204-1209.e9.
52.Howard TD, Koppelman GH, Xu J, Zheng SL, Postma DS, Meyers DA,
Bleecker ER (2002). Gene-gene interaction in asthma: IL4RA and IL13 in a
Dutch population with asthma. Am J Hum Genet 70(1):230-236.
53.Pykäläinen M, Kinos R, Valkonen S, Rydman P, Kilpeläinen M, Laitinen LA,
Karjalainen J, Nieminen M, Hurme M, Kere J, Laitinen T, Lahesmaa R (2005).
Association analysis of common variants of STAT6, GATA3, and STAT4 to
asthma and high serum IgE phenotypes. J Allergy Clin Immunol 115(1):8087.
54.Genuneit J, Cantelmo JL, Weinmayr G, Wong GW, Cooper PJ, Riikjärv MA,
Gotua M, Kabesch M, von Mutius E (2009). A multi-centre study of candidate
genes for wheeze and allergy: the International Study of Asthma and Allergies
in Childhood Phase 2. Clin Exp Allergy 39(12):1875-1888.
55.Duroudier NP, Tulah AS, Sayers I (2009). Leukotriene pathway genetics and
pharmacogenetics in allergy. Allergy 64(6):823-839.
56.Minelli C, Granell R, Newson R, Rose-Zerilli MJ, Torrent M, Ring SM,
Holloway JW, Shaheen SO, Henderson JA (2010). Glutathione-S-transferase
genes and asthma phenotypes: a Human Genome Epidemiology (HuGE)
systematic review and meta-analysis including unpublished data. Iny J
Epidemiol 39(2):539-562.
57.Hollá LI, Bucková D, Kuhrová V, Stejskalová A, Francová H, Znojil V, Vácha
J (2002). Prevalence of endothelial nitric oxide synthase gene polymorphisms in
patients with atopic asthma. Clin Exp Allergy 32(8):1193-1198.
58.Barnes PJ (2003). Pathophysiology of asthma. Eur Respir Mon 23, 84–113.
59.National asthma Education and Prevention Program (1997). Expert Panel
Report 2. Guidelines for the Diagnosis and Management of Asthma. NIH
publication No. 97-4051. Bethesda, MD: US Dept of Health and Human
Services.
60.Roche WR, Williams JH, Beasly R, Holgate ST (1989). Subepithelial fibrosis in
the bronchi of asthmatics. Lancet 1:520–524.
61. Aikawa T, Shimura S, Sasaki H, Ebina M, Takashima T (1992). Marked goblet
cell hyperplasia with mucus accumulation in the airways of patients who died
of severe acute asthma attack. Chest 101:916–921,
62.Ebina M, Takahashi T, Chiba T, Motomiya M (1973). Cellular hypertrophy and
hyperplasia of airway smooth muscles underlying bronchial asthma: a 3-D
morphometric study. Am Rev Respir Dis 48:720–726
63.Busse W, Elias J, Sheppard D, Banks-Schlegel S (1999). Airway remodeling
and repair. Am J Respir Crit Care Med 160:1035–1042.
64.Parronchi P, De Carli M, Manetti R, Simonelli C, Sampognaro S, Piccinni MP
(1992). IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on
the development of cytolytic potential by Th1 or Th2 human T cell clones. J
Immunol; 149:2977–2983.
65.Liotta F, Frosali F, Querci V, Mantei A, Filì L, Maggi L, Mazzinghi B, Angeli
R, Ronconi E, Santarlasci V, Biagioli T, Lasagni L, Ballerini C, Parronchi P,
Scheffold A, Cosmi L, Maggi E, Romagnani S, Annunziato F (2008). Human
immature myeloid dendritic cells trigger a Th2- polarizing program via Jagged1/Notch interaction. J Allergy Clin Immunol; 121: 1000–1005.
66.Romagnani S (2000). The role of lymphocytes in allergic diseases. J Allergy
Clin Immunol105:399–408.
67.Spahn J, Covar R, Stempel DA (2002). Asthma: Addressing consistency in
results from basic science, clinical trials, and observational experience. J
Allergy Clin Immunol; 109:S492.
68.Carter K, Worwood M (2007). Haptoglobolin: a review of the major allele
frequencies worldwide and their association with diseases. Int J Lab Hematol.;
29:92-110.
69.Wobeto VPA, Zaccariotto TR, Sonati MF (2008). Polymorphism of human
haptoglobin and its clinical importance. Genet Mol Biol.; 31:602-20.
70.Langlois MR, Delanghe JR (1996). Biological and clinical significance of
haptoglobin polymorphism in humans. Clin Chem.; 42:1589-600.
71.Sadrzadeh SM, Bozorgmehr J (2004). Haptoglobin phenotypes in health and
disorders. Am J Clin Pathol. 121:S97-104.
72.Raynes JG, Eagling S, McAdam KP (1991). Acute-phase protein synthesis in
human hepatoma cells: Differential regulation of serum amyloid A(SAA) and
haptoglobin by interleukin-1 and interleukin-6. Clin Exp Immunol.83:488-91.
73. Tseng CF, Huang HY, Yang YT, Mao SJ (2004). Purification of human
haptoglobin
1-1,
2-1,
and
2-2
using
monoclonal
antibody
affinity
chromatography. Protein Expr Purif. 33:265-73.
74.Quaye IK (2008). Haptoglobin, inflammation and disease. Trans R Soc Trop
Med Hyg. 102:735-42.
75.Pelletier N, Boudreau F, Yu S J, Zannoni S, Boulanger V, Asselin C (1998).
Activation
of
haptoglobin
gene
expression
by
cAMP
involves
CCAAT/enhancerbinding protein isoforms in intestinal epithelial cells. FEBS
Lett. 439:275-280
76.Yang F, Ghio A J, Herbert D C, Weaker FJ, Walter C A, Coalson J J (2000).
Pulmonary expression of the human haptoglobin gene. Am.J.Respir.Cell
Mol.Biol.23:277- 282
77.Friedrichs WE,
Navarijo-Ashbaugh AL,
Bowman BH,
Yang F
(1995).
Expression and inflammatory regulation of haptoglobin gene in adipocytes.
Biochem Biophys Res Commun. 209:250-256.
78.Smithies O, Connell GE, Dixon GH (1962). Chromosomal rearrangements and
the evolution of haptoglobin genes. Nature. 4851:232-236.
79.Maeda N, Yang F, Barnett DR, Bowman BH, Smithies O (1984). Duplication
within the haptoglobin Hp2 gene. Nature; 309: 131–5.
80. Langlois MR, Delanghe JR (1996). Biological and clinical significance of
haptoglobin polymorphism in humans. Clin Chem.; 42:1589-600.
81.Black JA, Dixon GH (1968). Amino-acid sequence of alpha chains of human
haptoglobins. Nature.218:738-741.
82.Bias WB, Zachary AA (1986). Basic principles of paternity determination. In:
Rose NR, Friedman H, Fahey JL, eds. Manual of Clinical Laboratory
Immunology. 3rd ed. Washington, DC: American Society for Microbiology;
902-911.
83.Georgina Galicia and Jan L. Ceuppens (2011). Haptoglobin Function and
Regulation in Autoimmune Diseases, Acute Phase Proteins - Regulation and
Functions of Acute Phase Proteins, Prof. Francisco Veas (Ed.), ISBN: 978-953307-252-4, InTech.
84.Javid J (1978). Human haptoglobins. Curr Top Hematol. 1:151-192.
85.Wang F, Huang W, Li A (1996). Serum haptoglobin suppresses T lymphocyte
functions following burns. Chin Med Sci J.11:180-183.
86.Silverman LN, Christenson RH (1999). Protein. In: Burtis CA, Ashwood ER,
eds. In: Tietz Textbook of Clinical Chemistry. Philadelphia, PA: Saunders; 494497.
87. Bernard D R, Langlois M R, Delanghe J R, de Buyzere M L (1997). Evolution
of haptoglobin concentration in serum during the early phase of acute
myocardial infarction. Eur J Clin Chem Clin Biochem.; 35:85-88.
88.Berkova N, Lemay A, Dresser DW, Fontaine JY, Kerizit J, Goupil S (2001). Haptoglobin
is present in human endometrium and shows elevated levels in the decidua
during pregnancy. Mol Hum Reprod.7: 747- 754.
89.Piessens MF, Marien G, Stevens E (1984). Decreased haptoglobin levels in
respiratory allergy. Clin Allergy.; 14:287-293.
90.Bowman BH (1993). Haptoglobin. In: Bowman BH, ed. Hepatic Plasma
Proteins. San Diego, CA: Academic Press; 159-167.
91.Yang F, Friedrichs WE, Navarijo-Ashbaugh AL, deGraffenried LA, Bowman
BH, Coalson JJ (1995). Cell type-specific and inflammatory-induced expression
of haptoglobin gene in lung. Lab Invest; 73:433– 40.
92.Theilgaard-Monch K, Jacobsen LC, Nielsen MJ, Rasmussen T, Udby L, Gharib
M, Arkwright PD (2006). Haptoglobin is synthesized during granulocyte
differentiation, stored in specific granules, and released by neutrophils in
response to activation. Blood; 108:353– 61.
93.Yerbury JJ, Rybchyn MS, Easterbrook-Smith SB, Henriques C, Wilson MR
(2005). The acute phase protein haptoglobin is a mammalian extracellular
chaperone with an action similar to clusterin. Biochemistry; 44:10914 –25.
94.Kristiansen M, Graversen JH, Jacobsen C,Hoffman HJ, Law SK, Moestrup SK
(2001). Identification of the haemoglobin scavenger receptor. Nature (Lond);
409:198 –201.
95.Arredouani M, Matthijs P, Van H E, Kasran A, Baumann H, Ceuppens J L,
Stevens E (2003). Haptoglobin directly affects T cells and suppresses T helper
cell type 2 cytokine releases. Immunology. 108:144-151.
96.Oh S-K, Pavlotsky N, Tauber AI (1990). Specific binding of haptoglobin to
human neutrophils and its functional consequences. J Leukocyte Biol. 47:142148.
97.Oh S-K, Kim S-H, Walker JE (1990). Interference with immune response at the
level of generating effector cells by tumor associated haptoglobin. J Natl Cancer
Inst. 82:934-940.
98.Oh SK, Leung MF, Knee T, Williams JM (1987). Biological properties of
suppressive E-receptor factor on lymphokine function. Eur J Immunol. 17:14031409.
99.Hanasaki K, Powell LD, Varki A (1995). Binding of human plasma
sialoglycoproteins by the B cell–specific lectin CD22. J Biol Chem. 270:75437550.
100.
El-Ghmati, S.M., Arredouani, M, Van Hoeyveld, E.M, Ceuppens, J.L,
Stevens, E.A (2002). Haptoglobin interacts with the human mast cell line HMC1 and inhibits its spontaneous proliferation. Scand J Immunol. 55:352-358.
101. Langlois M, Delanghe J, Philippe J, Ouyang J, Bernard D, De Buyzere M,
Van Nooten G, Leroux-Roels G (1997). Distribution of lymphocyte subsets in
bone marrow and peripheral blood is associated with haptoglobin type: binding
of haptoglobin to the B-cell lectin CD22. Eur J Clin Chem Clin Biochem.;
35:199-205.
102. Funk CD (1996). The molecular biology of mammalian lipoxygenases and
the quest for eicosanoid functions using lipoxygenasedeficient mice. Biochim
Biophys Acta. 1304:65-84.
103. Jue DM, Shim BS, Kang YS (1983). Inhibition of prostaglandin synthase
activity of sheep seminal vesicular gland by human serum haptoglobin. Mol
Cell Biochem. 51:141-147.
104. Komoriya K, Hoshina K, Ohtsu A (1980). Inhibition of prostaglandin
synthesizing enzymes by haptoglobin and plasma of rats with inflammation. Jpn
J Pharmacol. 30:899-904.
105. Eaton JW, Brandt P, Mahoney JR, Lee JT (1982). Haptoglobin: a natural
bacteriostat. Science. 215:691-693.
106. Buehler P W, Abraham B, Vallelian F, Linnemayr C, Pereira C P , Cipollo J
F, Jia Y, Mikolajczyk M, Boretti F S , Schoedon G, Alayash A I, Schaer D J
(2009). Haptoglobin preserves the CD163 hemoglobin scavenger pathway by
shielding hemoglobin from peroxidative modification. Blood. 113:2578-2586
107. Lim S K, Ferraro B, Moore K , Halliwell B (2001). Role of haptoglobin in
free hemoglobin metabolism. Redox.Rep. 6:219-227.
108. Tseng C F, Lin C C, Huang H Y, Liu H C, Mao S J (2004). Antioxidant role
of human haptoglobin. Proteomics. 4:2221-2228.
109. Melamed-Frank M, Lache O, Enav B I, Szafranek T, Levy N S, Ricklis R
M, Levy A P (2001). Structure-function analysis of the antioxidant properties of
haptoglobin. Blood. 98:3693-3698.
110. Kushner I (1993). Regulation of the acute phase response by cytokines.
Perspect. Biol. Med. 36, 611—622.
111. Theilgaard-Monch K, Jacobsen L C, Nielsen M J, Rasmussen T, Udby L,
Gharib M, Arkwright P D, Gombart A F, Calafat J, Moestrup S K, Porse B T,
Borregaard N (2006). Haptoglobin is synthesized during granulocyte
differentiation, stored in specific granules, and released by neutrophils in
response to activation. Blood 108, 353—361.
112. De Kleijn DP, Smeets MB, Kemmeren PP, Lim SK, Van Middelaar BJ,
Velema E, Schoneveld A, Pasterkamp G and Borst C (2002). Acute-phase
protein haptoglobin is a cell migration factor involved in arterial restructuring.
FASEB J. 16:1123-1125.
113. Cid MC, Grant DS, Hoffman GS, Auerbach R, Fauci AS ,Kleinman HK
(1993). Identification of haptoglobin as an angiogenic factor in sera from
patients with systemic vasculitis. J Clin Invest. 91:977-985.
114. Kyewski B, Klein L (2006). A central role for central tolerance. Annu. Rev.
Immunol.24:571-606
115. Faria A M, Weiner H L (2006). Oral tolerance: therapeutic implications for
autoimmune diseases. Clin.Dev.Immunol. 13:143-157
116. Wikstrom M E, Stumbles PA (2007). Mouse respiratory tract dendritic cell
subsets and the immunological fate of inhaled antigens. Immunol.Cell Biol.
85:182-188
117. Unger W W, Hauet-Broere F, Jansen W, van Berkel L A, Kraal G, Samsom
J N (2003). Early events in peripheral regulatory T cell induction via the nasal
mucosa. J.Immunol. 171:4592-4603
118. Boots A M, Verhaert P D, tePoele R J, Evers S, Coenen-deRoo C J, Cleven
J, Bos E S (2004). Antigens up the nose: identification of putative biomarkers
for nasal tolerance induction functional studies combined with proteomics.
J.Proteome Res.3:1056- 1062.1535-3893
119. Piessens M F, Marien G, Stevens E (1984). Decreased haptoglobin levels in
respiratory allergy. Clin. Allergy 14:287–293.
120. Kauffmann FC, Frette I, Annesi M-F, Dore, Neukirch F (1991).
Relationships of haptoglobin level to FEV1, wheezing, bronchial hyperresponsiveness and allergy. Clin. Exp. Allergy 21: 669-674.
121. Piessens MF, Marien G, Stevens E (1984). Decreased haptoglobin levels in
respiratory allergy. Clin. Allergy 14: 287-293.
122. Koh YY, Kim YW, Park JD, Oh JW (1996). A comparison of serum
haptoglobin levels between acute exacerbation and clinical remission in asthma.
Clin Exp Allergy 10:1202-9.
123. Kim CK, Chung CY, Koh YY (1998) .Changes in serum haptoglobin level
after allergen challenge test in asthmatic children. Allergy 53(2):184-9.
124. Mukadder CALIKO_LU, MD,a Ali ÜNLÜ, MD,b Lülüfer TAMER, MD,b
_lker ÇALIKO_LU, MD,c Gürbüz POLAT, MD (2004). Levels of Serum
Acute-Phase Proteins in Patients with Asthma. Turkiye Klinikleri J Med Sci,
24:440-444
125. Larsen K, Macleod D, Nihlberg K, Gurcan E, Bjermer L, Marko-Varga G,
Westergren-Thorsson
G
(2006).
Specific
haptoglobin
expression
in
bronchoalveolar lavage during differentiation of circulating fibroblast
progenitor cells in mild asthma. J Proteome Res 5:1479-1483.
126. Black R A, White J M (1998). ADAMs: focus on the protease domain. Curr.
Opin. Cell Biol. 10: 654–659.
127. Becherer J D, Blobel C P (2003). Biochemical properties and functions of
membrane-anchored metalloprotease-disintegrin proteins (ADAMs). Curr. Top
Dev. Biol. 54: 101–123.
128. Yoshinaka T,Nishii k, Yamada K, Sawada H, Nishiwaki E, Smith K,
Yoshino K, Ishiguro H, Higashiyama S. (2002). Identification and
characterization of novel mouse and human ADAM33s with potential
metalloprotease activity. Gene 282: 227–236.
129. Howard TD, Postma DS, Jongepier H, Moore WC, Koppelman GH, Zheng
SL, Xu J, Bleecker ER, Meyers DE (2003). Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations. J Allergy Clin Immunol 112:717–722.
130. Garlisi CG, Zou J, Devito KE, Tian F, Zhu FX, Liu J, Shah H, Wan Y,
Motasim Billah M, Egan RW, Umland SP (2003).Human ADAM33: protein
maturation and localization. Biochem Biophys Res Commun 301: 35– 43.
131. Holgate ST, Davies DE, Powell RM, Holloway JW (2005). ADAM33: a
newly identified gene in the pathogenesis of asthma. Immunol Allergy Clin
North Am; 25:655–668.
132. Haitchi H M, Powell R M, Shaw T J, Howarth P H, Wilson S J , Wilson D I,
Holgate S T, Davies DE (2005).ADAM33 expression in asthmatic airways and
human embryonic lungs.. Am. J. Respir. Crit. Care Med.
133. Powell RM, Wicks J, Holloway JW, Holgate ST, Davies DE (2004). The
splicing and fate of ADAM33 transcripts in primary human airways fibroblasts.
Am J Respir Cell Mol Biol 31:13–21.
134. Holgate ST, Yang Y, Haitchi HM, Powell RM, Holloway JW, Yoshisue H,
Pang YY, Cakebread J, Davies DE (2006). The genetics of asthma: ADAM33
as an example of a susceptibility gene. Proc Am Thora c Soc; 3:440–443.
135. Simpson A, Maniatis N, Jury F, Cakebread JA, Lowe LA, Holgate ST,
Woodcock A, Ollier WE, Collins A, Custovic A, Holloway J W, John S J
(2005). Polymorphisms in a disintegrin and metalloprotease 33 (ADAM33)
predict impaired early-life lung function. Am J Respir Crit Care Med 172:55–
60.
136. Lee JY, Park SW, Chang HK, Kim HY, Rhim T, Lee JH, Jang AS, Koh ES,
Park CS (2006). A disintegrin and metalloproteinase 33 protein in asthmatics:
relevance to airflow limitation. Am J Respir Crit Care Med 173:729–765.
137. Howard TD, Postma DS, Jongepier H, Moore WC, Koppelman GH, Zheng
SL, Xu J, Bleecker ER, Meyers DA (2003). Association of a disintegrin and
metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse
populations. J Allergy Clin Immunol; 112:717–722.
138. Jongepier H, Boezen HM, Dijkstra A, Howard TD, Vonk JM, Koppelman
GH, Zheng SL, Meyers DA, Bleecker ER, Postma DS(2004). Polymorphisms
of the ADAM33 gene are associated with accelerated lung function decline in
asthma. Clin Exp Allergy; 34:757–60.
139. Bel EH (2004). Clinical phenotypes of asthma. Curr Opin Pulm Med;
10:44–50.
140. Simpson A, Maniatis N, Jury F, Cakebread JA, Lowe LA, Holgate ST,
Woodcock A, Ollier WE, Collins A, Custovic A, Holloway J W, John S
J(2004) . Manchester Asthma and Allergy Study: polymorphisms in ADAM 33
predict lung function at age 5 years. J Allergy Clin Immunol 2004; 113:S340.
141. JING WANG, JIN WEN, MI-HE-RE-GU-LI SI-MA-YI, YUAN-BING HE,
KE-LI-BIE-NA
MAN-GU-LI
TU-ER-XUN,
YU
XIA,
JIAN-LONG
ZHANG,QI-
WU-SHOU-ER (2013). Association of ADAM33 gene
polymorphisms with asthma in the Uygur population of China. Biomedical
reports 1: 447-453.
142. Maquat L E (2001). The power of point mutations. Nature Genet. 27, 5–6.
143. Mahesh PA (2013). Unravelling the role of ADAM33 in asthma. Indian J
Med Res 137, pp 447-450.
144. Cleo CD, Postma DS, Vonk JM, Bruinenberg M, Schouten JP, Boezen HM
(2005). A disintegrin and metalloprotease 33 polymorphisms and lung function
decline in the general population. Am J Respir Crit Care Med. 172:329–33.
145. Holgate ST (1999). Genetic and environmental interaction in allergy and
asthma. J Allergy Clin Immunol 104:1139 –1146.
146. Davies DE, Holgate ST (2002). Asthma: The importance of epithelial
mesenchymal communication in pathogenesis. Inflammation and the airway
epithelium in asthma. Int J Biochem Cell Biol 34:1520 –1526.
147. Cakebread JA, Haitchi HM, Holloway JW, Powell RM, Keith T, Davies DE,
Holgate ST (2004). The role of ADAM33 in the pathogenesis of asthma. Semin
Immunol 25:361–375.
148. Chou KT, Huang CC, Chen YM, Perng DW, Chao HS, Chan WL, Leu HB.
(2011). Asthma and risk of erectile dysfunction—A nationwide populationbased study. J Sex Med 8:1754 –1760.
149. Bucchieri F, Puddicombe SM, Lordan JL, Richter A, Buchanan D, Wilson
SJ, Ward J, Zummo G, Howarth PH, Djukanović R, Holgate ST, Davies DE.
(2002). Asthmatic bronchial epithelium is more susceptible to oxidant-induced
apoptosis. Am J Respir Cell Mol Biol 27:179 –185.
150.
Redington AE, Roche WR, Holgate ST, Howarth PH (1998). Co-
localization of immunoreactive transforming growth factor-beta 1 and decorin
in bronchial biopsies from asthmatic and normal subjects. J Pathol 186:410–
415.
151. Paul WE (1991). Interleukin-4: a prototypic immunoregulatory lymphokine.
The Journal of the American Society of Hematology. 77(9):1859-1870.
152. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE (1999) . The IL-4
receptor:
signaling
mechanisms
and
biologic
functions.
Annu
Rev
Immunol.17:701-38.
153. María IG, Ignacio D, Elena L, Esther M, Félix L, Rogelio G S (2005).
Interleukin4 (IL4) and interleukin receptor (IL4RA) polymorphisms in asthma:
a case control study. Clinical and Molecular Allergy, 3:15.
154. Le Gros G, Ben-Sasson S Z, Seder R, Finkelman F D, Paul W
E(1990).Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro:
IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells. J.
Exp. Med.172:921.
155. Hershey GK, Friedrich MF, Esswein LA, Thomas ML, Chatila TA
(1997).The association of atopy with a gain-of-function mutation in the alpha
subunit of the interleukin-4 receptor. N. Engl. J. Med. 337 (24): 1720–5.
156. Allison-Lynn Andrews, John W. Holloway, Stephen T. Holgate, and Donna
E. Davies (2006). IL-4 Receptor α Is an Important Modulator of IL-4 and IL-13
Receptor Binding: Implications for the Development of Therapeutic Targets1. J
Immunol 176:7456-7461
157. Dabbagh K, Takeyama K, Lee H M, Ueki I F, Lausier J A, Nadel J A
(1999). IL-4 induces mucin gene expression and goblet cell metaplasia in vitro
and in vivo. J. Immunol. 162: 6233–6237.
158. Fukuda T, Fukushima Y, Numao T, Ando N, Arima M, Nakajima H, Sagara
H, Adachi T, Motojima S, Makino S(1996). Role of interleukin-4 and vascular
cell adhesion molecule-1 in selective eosinophil migration into the airways in
allergic asthma. Am. J. Respir. Cell Mol. Biol. 14: 84–92.
159. Doucet C, Brouty-Boye D, Pottin-Clemenceau C, Jasmin C, Canonica G W,
Azzarone B (1998). IL-4 and IL-13 specifically increase adhesion molecule and
inflammatory cytokine expression in human lung fibroblasts. Int. Immunol. 10:
1421–1433.
160. Palmer LJ, Daniels SE, Rye PJ, Gibson NA, Tay GK, Cookson WO,
Goldblatt J, Burton PR, LeSöuef PN (1999). Linkage of chromosome 5q and
11gene markers to asthma –associated quantitative traits in australian children.
Am j Respir Crit care Med 158:1825 – 1830.
161. Song Z, Casolaro V, chen r, georas SN, Monos d, Ono SJ (1996).
Polymorphic nucleotides within the human IL4 promoter that mediate
overexpression of the gene .J Immunol 156:424-9.
162. Basehore MJ, Howard TD, Lange LA, Moore WC, Hawkins GA, Marshik
PL, Harkins MS, Meyers DA, Bleecker ER (2004). A comprehensive
evaluation of IL4 variants in ethnically diverse populations: association of total
serum IgE levels and asthma in white subjects. J Allergy Clin Immunol 114:8087.
163. Mout R, Willenze R, Landegent JE (1991). Repeat polymorphism in the
interleukin-4 gene (IL-4). Nucleic Acids Res; 19: 3763.
164. Rockman MV, Hahn MW, Soranzo N, Goldstein DB, Wray GA (2003).
Positive selection on a humanspecific transcription factor binding site
regulating IL4 expression. Current Biology; 13: 2118-2123.
165. Walley AJ, Cookson WO (1996). Investigation of an interleukin-4 promoter
polymorphism for association with asthma and atopy. J Med Genet. 33:689_92.
166. Hoey T, Sun Y L, Williamson K, Xu X (1995). Isolation of two new
members of the NF-AT gene family and functional characterization of the NFAT proteins. Immunity; 2:461-472.
167. Raffi Tachdjian, Clinton Mathias, Shadi Al Khatib, Paul J. Bryce, Hong S.
Kim, Frank Blaeser, Brian D. O'Connor, Danuta Rzymkiewicz, Andrew Chen,
Michael J. Holtzman, Gurjit K. Hershey, Holger Garn, Hani Harb, Harald Renz,
Hans C. Oettgen, Talal A. Chatila (2009). Pathogenicity of a disease-associated
human IL-4 receptor allele in experimental asthma. J. Exp. Med. Vol. 206 No.
10 2191-2204
168. Maes T, Joos GF, Brusselle GG (2012). Targeting interleukin-4 in asthma:
lost in translation?. Am. J. Respir. Cell Mol. Biol. 47 (3): 261–70.
169.
Chatila TA (2004). Interleukin-4 receptor signaling pathways in asthma
pathogenesis. Trends Mol Med 10 (10): 493–9.
170. Andrews A L, Holloway J W, Puddicombe S M, Holgate S T, Davies D E
(2002). Kinetic analysis of the interleukin-13 receptor complex. J. Biol. Chem.
277: 46073–46078.
171. Keegan AD, Nelms K, White M, Wang L.-M., Pierce J H, Paul W E (1994) .
An IL-4 receptor region containing an insulin receptor motif is important for
IL-4-mediated IRS-1 phosphorylation and cell growth. Europe PMC, Cell
76:811-820.
172. Tundup S, Srivastava L, Harn DA (2012). Polarization of host immune
responses by helminth-expressed glycans. Ann. N. Y. Acad. Sci. 1253: E1–E13
173. Maliszewski C R, Sato T A, Vanden Bos T, Waugh S, Dower S K, Slack J,
Beckmann M P, Grabstein K H(1990). Cytokine receptors and B cell functions.
I. Recombinant soluble receptors specifically inhibit IL-1- and IL-4- induced B
cell activities in vitro. J. Immunol. 144: 3028–3035.
174. Sato T A, Widmer M B, Finkelman F D, Madani H, Jacobs C A, Grabstein
K H, Maliszewski C R(1993). Recombinant soluble murine IL-4 receptor can
inhibit or enhance IgE responses in vivo. J. Immunol. 150:2717–2725.
175. Borish, L C, Nelson H S, Corren J, Bensch G, Busse W W, Whitmore J B,
Agosti J M (2001). Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma. J. Allergy Clin. Immunol. 107: 963–970.
176. Borish L C, Nelson H S, Lanz M J, Claussen L, Whitmore J B, Agosti J M,
Garrison L(1999). Interleukin-4 receptor in moderate atopic asthma: a phase
I/II randomized, placebo-controlled trial. Am. J. Respir. Crit. Care Med. 160:
1816–1823.
177. Pritchard MA, Baker E, Whitmore SA, Sutherland GR, Idzerda RL, Park LS,
Cosman D, Jenkins NA, Gilbert DJ, Copeland NG (1991). The interleukin4receptor gene (IL4R) maps to 16p11.2 – 16p12.1 in human and to the distal
region of mouse chromosome 7.genomics, 10:801 – 806.
178. Perkins C, Yanase N, Smulian G, Gildea L, Orekov T, Potter C, Brombacher
F, Aronow B, Wills-Karp M, Finkelman FD (2011). Selective stimulation of IL4 receptor on smooth muscle induces airway hyperresponsiveness in mice. J
Exp Med, 208:853–867.
179. Loza MJ, Chang BL (2007). Association between Q551R IL4R genetic
variants and atopic asthma risk demonstrated by meta-analysis. J Allergy Clin
Immunol, 120:578–585.
180. Michel S, Liang L, Depner M, Klopp N, Ruether A, Kumar A, Schedel M,
Vogelberg C, von Mutius E, , Frischer T, Genuneit J, Gut IG, Schreiber S,
Lathrop M, Illig T, Kabesch M (2010). Unifying candidate gene and GWAS
approaches in asthma. PLoS One, 5:e13894.
181. Akinbami LJ, Schoendorf KC (2002). Trends in childhood asthma:
prevalence,health care utilization, and mortality. Pediatrics;110(2 Pt 1):315–
322.
182. Donfack J, Schneider DH, Tan Z, Kurz T, Dubchak I, Frazer A, Ober C
(2005). Variation in conserved non-coding sequences on chromosome 5q and
susceptibility to asthma and atopy. Respir Res; 6:145.
183. Chan A, Newman DL, Shon AM, Schneider DH, Kuldanek S, Ober C
(2006).Variation in the type I interferon gene cluster on 9p21 influences
susceptibility to asthma and atopy. Genes Immun; 7:169–178.
184. Lee SG, Kim BS, Kim JH, Lee SY, Choi SO, Shim JY, Hong TJ, Hong SJ
(2004). Gene-gene interaction between interleukin-4 and interleukin-4 receptor
alpha in Korean children with asthma. Clin Exp Allergy; 34:1202–1208.
185. Ober C, Leavitt SA, Tsalenko A, Howard TD, Hoki DM, Daniel R, Newman
DL, Wu X, Parry R, Lester LA, Solway J, Blumenthal M, King RA, Xu J,
Meyers DA, Bleecker ER, Cox NJ (2000). Variation in the interleukin 4-
receptor alpha gene confers susceptibility to asthma and atopy in ethnically
diverse populations. Am. J. Hum. Genet. 66:517–526.
186. Ober C, Leavitt SA, Tsalenko A, Howard TD, Hoki DM, Daniel R, Newman
DL, Wu X, Parry R, Lester LA, Solway J, Blumenthal M, King RA, Xu J,
Meyers DA, Bleecker ER, Cox NJ (2007). IL4R alpha mutations are associated
with asthma exacerbations and mast cell/IgE expression. Am. J. Respir. Crit.
Care Med. 175:570–576.
187. Mannino D M, Homa D M, Akinbami L J, Moorman J E, Gwynn C, Redd S
C (2002). Surveillance for asthma–United States, 1980- 1999. MMWR Surveill.
Summ. 51:1–13.
188. Kruse S, Japha T, Tedner M, Sparholt SH, Forster J, Kuehr J, Deichmann
KA (1999).The polymorphisms S503P and Q576R in the interleukin-4 receptor
alpha gene are associated with atopy and influence the signal transduction.
Immunology; 96:365-71.
189. Zurawski SM, Vega F, Juyghe B, Zurawski G (1993). Receptors for
interleukin-13 and interleukin-4 are complex and share a novel component that
functions in signal transduction. EMBO. 12:2663–2670.
190. Fahy JV (2002). Goblet cell and mucin gene abnormalities in asthma. Chest;
122:320S–326S.
191. Munitz A, Brandt EB, Mingler M, Finkelman FD, Rothenberg (2008).
Distinct roles for IL-13 and IL-4 via IL-13 receptorα1 and the type II IL-4
receptor in asthma pathogenesis. Proceedings of the National Academy of
Sciences; 105:7240 –7245.
192. Punnonen J, Aversa G, Cocks BG (1993). Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by human B cells.
Proc Natl Acad Sci USA 90: 3730–3734.
193. Horie S, Okubo Y, Hossain M, Sato E, Nomura H, Koyama S, Suzuki J,
Isobe M, Sekiguchi M (1997). Interleukin-13 but not interleukin-4 prolongs
eosinophil survival and induces eosinophil chemotaxis. Intern Med; 36: 179–
185.
194. Luttmann W, Knoechel B, Foerster M, Matthys H,Virchow Jr, Kroegel C
(1996). Activation of human eosinophils by IL-13. Induction of CD69 surface
antigen, its relationship to messenger RNA expression, and promotion of
cellular viability. J Immunol; 157: 1678–1683.
195. Kaur D, Hollins F, Woodman L, Yang W, Monk P, May R, Bradding P,
Brightling CE (2006). Mast cells express IL-13R alpha 1: IL-13 promotes
human lung mast cell proliferation and Fc epsilon RI expression. Allergy; 61:
1047–1053.
196. Ahdieh M, Vandenbos T, Youakim A (2001). Lung epithelial barrier
function and wound healing are decreased by IL-4 and IL-13 and enhanced by
IFN-c. Am J Physiol Cell Physiol; 281: C2029–C2038.
197. Kondo M, Tamaoki J, Takeyama K, Isono K, Kawatani K, Izumo T, Nagai
A (2006). Elimination of IL-13 reverses established goblet cell metaplasia into
ciliated epithelia in airway epithelial cell culture. Allergol Int 55: 329–336.
198. Richter A, Puddicombe SM, Lordan JL, Bucchieri F, Wilson SJ, Djukanovic
R, Dent G, Holgate ST, Davies DE (2001).The contribution of interleukin (IL)4 and IL-13 to the epithelial–mesenchymal trophic unit in asthma. Am J Respir
Cell Mol Biol ; 25: 385–391.
199. Laporte JC , Moore PE, Baraldo S, Jouvin MH, Church TL, Schwartzman
IN, Panettieri RA Jr, Kinet JP, Shore SA (2001).Direct effects of interleukin-13
on signaling pathways for physiological responses in cultured human airway
smooth muscle cells. Am J Respir Crit Care Med; 164: 141–148.
200. Grunstein M M, Hakonarson H, Leiter J, Chen M, Whelan R, Grunstein J
S, Chuang S (2002). IL-13-dependent autocrine signaling mediates altered
responsiveness of IgE sensitized airway smooth muscle. Am J Physiol Lung
Cell Mol Physiol; 282: 520– 528.
201. Fahy JV (2002). Goblet cell and mucin gene abnormalities in asthma. Chest.
122320S–326S.
202. Zhu Z, Homer R J. Homer, Wang Z, Chen Q, g P, Wang J, Zhang Y, Elias
J A (1999). Pulmonary expression of interleukin-13 causes inflammation,
mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and
eotaxin production.J Clin Invest.103:779 –788.
203. Yasuo M, Fujimoto K, Tanabe T, Yaegashi H, Tsushima K, Takasuna K,
Koike T, Yamaya M, Nikaido T (2006).The relationship between calciumactivated chloride-channel 1 and MUC5AC in goblet cell hyperplasia induced
by interleukin-13 in human bronchial epithelial cells. Respiration. 73:347–359.
204. Tanabe T, Fujimoto K, Yasuo M, Tsushima K, Yoshida K, Ise H, Yamaya
M (2007). Modulation of mucus production by interleukin-13 receptor a2 in the
human airway epithelium. Clin Exp Allergy. 38:122–134.
205. Danahay H, Atherton H, Jones G, Bridges RJ, Poll CT (2002). Interleukin13 induces a hypersecretory ion transport phenotype in human bronchial
epithelial cells. Am J Physiol Lung Cell Mol Physiol. 282:L226–L236.
206. Galietta L J, Pagesy P, Folli C, Caci E, Romio L, Costes B, Nicolis E,
Cabrini G, Goossens M, Ravazzolo R, Zegarra-Moran O(2002). IL-4 is a potent
modulator of ion transport in the human bronchial epithelium in vitro.J
Immunol. 168:839–845.
207. Zhao J, Maskrey B, Balzar S, Chibana K, Mustovich A, Hu H, . Trudeau J
B, O'Donnell V,
Wenze S E (2009). Interleukin-13-induced MUC5AC is
regulated by 15-lipoxygenase 1 pathway in human bronchial epithelial cells.
Am J Respir Crit Care Med. 179:782–790.
208. Moynihan B, Tolloczko, Michoud MC, Tamaoka M, Ferraro P, Martin JG
(2008). MAP kinases mediate interleukin-13 effects on calcium signaling in
human airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol.
295:L171–L177.
209. Saha SK, Berry MA, Parker D, Siddiqui S, Morgan A, May R, Monk P,
Bradding P, Wardlaw AJ, Pavord ID, Brightling CE (2008).Increased sputum
and bronchial biopsy IL-13 expression in severe asthma. J Allergy Clin
Immunol.121:685– 691.
210. Ramalingam TR, Pesce JT, Sheikh F, Cheever AW, Mentink-Kane MM,
Wilson MS, Stevens S, Valenzuela DM, Murphy AJ, Yancopoulos GD, Urban
JF Jr, Donnelly RP, Wynn TA (2008). Unique functions of the type II
interleukin 4 receptor identified in mice lacking the interleukin 13 receptor _1
chain. Nature Immunol. 9(1):25–33.
211. Wynn TA (2004). Fibrotic disease and the Th1/Th2 paradigm. Nat Rev
Immunol. 4:583–594.
212. Khetsuriani N, Kazerouni NN, Erdman DD, Lu X, Redd SC, Anderson LJ,
Teague WG (2007). Prevalence of viral respiratory tract infections in children
with asthma. J Allergy Clin Immunol. 119:314 –321.
213. Jartti T, Paul-Anttila M, Lehtinen P, Parikka V, Vuorinen T, Simell O,
Ruuskanen O (2009). Systemic T-helper and T-regulatory cell type cytokine
responses in rhinovirus vs. respiratory syncytial virus induced early wheezing:
an observational study. Respir Res. 10(1):85–95.
214. Piper E, Brightling C, Niven R, Oh C, Faggioni R, Poon K, She D, Kell C,
May RD, Geba GP, Molfino NA (2013).A phase II placebo-controlled study of
tralokinumab in moderate-to- severe asthma. Eur Respir J; 41: 330–338.
215. Corren J, Lemanske R F, Nicola A. Hanania N A, Korenblat P E, Parsey M
V, Arron J R, Harris J M, Scheerens H, Wu L C, Su Z, Mosesova S, Eisner M
D, M.D., Bohen S P, Matthews J G (2011). Lebrikizumab treatment in adults
with asthma. N Engl J Med; 365: 1088–1098.
216. Hayes J, Flanagan J, Jowsey I, Hayes J, Flanagan J, Jowsey I (2005). Glutathione
transferases. Pharmacol. Toxicol. 45:51–88.
217. Jakoby WB (1978). The glutathione S-transferases: a group of
multifunctional detoxification proteins. Adv Enzymnol 46:383-413.
218. Conklin D J, Haberzettl P, Prough R A, Bhatnagar, A (2009). Glutathione-Stransferase P protects against endothelial dysfunction induced by exposure to
tobacco smoke. Am JPhysiol Heart Circ Physiol. 296, H1586-97.
219. Diaz-Sanchez D, Riedl M (2005). Diesel effects on human health: a question
of stress? Am J Physiol Lung Cell Mol Physiol. 289, L722-3.
220. Hayes J D, Pulford D J (1995). The glutathione S-transferase supergene
family: regulation of GST and the contribution of the isoenzymes to cancer
chemoprotection and drug resistance. Crit Rev Biochem Mol Biol. 30, 445-600.
221. Tim R. Crook, Robert L. Souhami, Andrà E. M. McLean (1986).
Cytotoxicity, DNA cross-Linking, and single strand breaks induced by activated
cyclophosphamide and acrolein in human Leukemia cells. Cancer research 46,
5029-5034.
222. Berhane K, Widersten M, Engström Å, Kozarich J W, Mannervik B (1994).
Detoxication of base propenals and other alpha, beta-unsaturated aldehyde
products of radical reactions and lipid peroxidation by human glutathione
transferases. Proc. Natl. Acad. Sci. U. S. A. 91, 1480–1484
223. Beuckmann CT, Fujimori K, Urade Y, Hayaishi O (2000).Identification of
mu-class glutathione transferases M2-2 and M3-3 as cytosolic prostaglandin E
synthases in the human brain. Neurochem Res. 25(5):733-8.
224. Ujihara M, Tsuchida S, Satoh K, Sato K, Y. Urade Y (1988). Biochemical
and immunological demonstration of prostaglandin D2, E2 and F2α formation
from prostaglandin H2 by various rat glutathione S-transferase isoenzymes.
Arch. Biochem. Biophys. 264:428-437.
225. Mannervik B (1985). The isoenzymes of glutathione transferase. Adv.
Enzymol. Relat. Areas Mol. Biol. 57:357-417.
226. Adler V, Yin Z, Fuchs S Y, Benezra M, Rosario L, Tew K D, Pincus M R,
Sardana M , Henderson C J , Wolf C R, Davis R J, Ronai Z (1999). Regulation
of JNK signaling by GSTp. EMBO J. 18(5):1321-34.
227. Yin Z, Ivanov VN, Habelhah H, Tew K, Ronai Z(2000). Glutathione Stransferase p elicits protection against H2O2-induced cell death via coordinated
regulation of stress kinases. Cancer Res.1; 60:4053-7.
228. Barnes PJ (1990). Reactive oxygen species and airway inflammation. Free
Radic Biol Med; 9:235–-43.
229. Hanene C, Jihene L, Jamel A, Kamel H, Agnès H (2007). Association of
GST genes polymorphisms with asthma in Tunisian children. Mediators
Inflamm;19564.
230. Goodrich GG, Goodman PH, Budhecha SK, Pritsos CA (2009). Functional
polymorphism of detoxification gene NQO1 predicts intensity of empirical
treatment of childhood asthma. Mutat Research; 674:55-61.
231. Greene LS (1995). Asthma and oxidant stress: nutritional, environmental,
and genetic risk factors. J Am Coll Nutr; 14:317–324.
232. Scoggan KA, Jacobson PJ and Ford-Hutchinson AW (1997) .Production of
leukotriene C4 in different human tissues is attributable to distinct membrane
bound biosynthetic enzymes. J Biol Chem 272:10182-10187.
233. Carmen Silvia Passos Lima, Iramaia Angélica Néri1, Gustavo Jacob
Lourenço,Isabel Cristina Jacinto Faria, José Dirceu Ribeiro,Carmen Silvia
Bertuzzo (2010) .Glutathione S-transferase mu 1 (GSTM1) and theta 1
(GSTT1) genetic polymorphisms and atopic asthma in children from
Southeastern Brazil. Genetics and Molecular Biology, 33, 3, 438-441.
234. Hayes JD, Strange RC (1995). Potential contribution of the glutathione Stransferase supergene family to resistance to oxidative stress. Free Radic Res,
22:193–197.
235. Ekhart C, Rodenhuis S, Smits PHM, Beijnen JH, Huitema ADR (2009). An
overview of the relations between polymorphisms in drug metabolizing
enzymes and drug transporters and survival after cancer drug treatment. Cancer
Treat Rev, 35, 18-31.
236. Arundhati Bag, Saloni Upadhyay, Lalit M Jeena, Princi Pundir, Narayan S
Jyala (2013). GSTT1 Null Genotype Distribution in the Kumaun Region of
Northern India Asian Pacific Journal of Cancer Prevention, 14(8):4739-4742.
237. Meyer DJ, Coles B, Pemble SE, Gilmore KS, Fraser GM, Ketterer B (1991).
Theta, a new class of glutathione transferases purified from rat and man.
Biochem J, 274, 409-14.
238. Landi S (2000). Mammalian class theta GST and differential susceptibility
to carcinogens: a review. Mutat Res, 463, 247-83.
239. Brasch-Andersen C, Christiansen L, Tan Q, Haagerup A, Vestbo J, Kruse
TA (2004). Possible gene dosage effect of glutathione- S-transferases on atopic
asthma: using real-time PCR for quantification of GSTM1 and GSTT1 gene
copy numbers. Hum Mutat; 24:208–14.
240. Saadat M, Saadat I, Saboori Z, Emad A (2004). Combination of CC16,
GSTM1, and GSTT1 genetic polymorphisms is associated with asthma. J
Allergy Clin Immun; 113:996–98.
241. London SJ (2007). Gene-air pollution interactions in asthma. Proc. Am.
Thorac. Soc.; 4: 217–20.
242. Siqiao liang, xuan wei, chen gong, jinmei wei, zhangrong chen, Xiaoli chen,
zhibo wang and jingmin deng (2013).Significant association between asthma
risk and the GSTM1 andGSTT1 deletion polymorphisms: An updated metaanalysis of Case–control studies. Respirology ;18, 774–783.
243. Satoh K, Kitahara A, SomaY, Inaba Y, Hatayama C, Sato K (1985).
Purificaion,induction and distribution of placental glutathione transferase a new
marker enzyme for pre neoplastic cells in rat chemical hepatocarcinogenesis.
Proc Natl Acad Sci. 82:3964-3968.
244. Fryer A A, Hume R, Strange R C (1986). The development of glutathione S
transferase and glutathione peroxidase activities in human lung. Biochim
Biophys Acta. 883, 448-53.
245. Hengstler J G, Arand M , Herrero M E, Oesch F (1998). Polymorphism of
N-acetyltransferases, glutathione S-transferases, microsomal epoxide hydrolase
and sulfotransferases: influence on cancer susceptibility. Recent Results Cancer
Res. 154, 47–85.
246. Doull I J, Lawrence S, Watson M, Begishvili T, Beasley R W, Lampe F,
Holgate T , Morton N E (1996). Allelic association of gene markers on
chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness. Am J
Respir Crit Care Med. 153, 1280-4.
247. Hoskins A, Wu P, Reiss S, Dworski R (2013).Glutathione S-transferase P1
Ile105Val polymorphism modulates allergen-induced airway inflammation in
human atopic asthmatics in vivo. Clin Exp Allergy. 43(5): 527–534.
248. Watson M A, Stewart R K, Smith G B, Massey T E, Bell D A (1998).
Human glutathione S-transferase P1 polymorphisms: relationship to lung tissue
enzyme activityand population frequency distribution. Carcinogenesis. 19, 27580.
249.
Tamer L, Calikoglu M, Ates N A , Yildirim H, Ercan B, Saritas E , Unlu A , Atik
U(2004).Glutathione-s-transferase
gene polymorphisms (gstt1, gstm1, gstp1) as
increased risk factors for asthma. Respirology; 9:493–8.
250.
Lee Y L, Hsiue TR, Lee YC, Lin YC, Guo YL
(2005). The association between
glutathione s-transferase p1, m1 polymorphisms and asthma in taiwanese
schoolchildren. Chest; 128:1156–62.
251. Nickel R, Haider A, Sengler C, Lau S, Niggemann B, Deichmann KA,
Wahn U, Heinzmann A (2005). Association study of glutathione s-transferase
p1 (gstp1) with asthma and bronchial hyper-responsiveness in two german
pediatric populations. Pediatr Allergy Immunol; 16:539–41.
252.
Brasch-Andersen C, Christiansen L, Tan Q, Haagerup A, Vestbo J, Kruse
TA (2004). Possible gene dosage effect of glutathione-s-transferases on atopic
asthma: Using real-time pcr for quantification of gstm1 and gstt1 gene copy
numbers. Hum Mutat; 24:208–14.
253. Mak JC, Ho SP, Leung HC, Cheung AH, Law BK, So LK, Chan JW, Chau
CH, Lam WK, Ip MS, Chan-Yeung M. (2007). Relationship between
glutathione s-transferase gene polymorphisms and enzyme activity in hong
kong chinese asthmatics. Clin Exp Allergy; 37:1150–7.
254. Lee YL, Lin YC, Lee YC, Wang JY, Hsiue TR, Guo YL. (2004).
Glutathione s-transferase p1 gene polymorphism and air pollution as interactive
risk factors for childhood asthma. Clin Exp Allergy; 34:1707–13.
255. Mapp CE, Fryer AA, De Marzo N, Pozzato V, Padoan M, Boschetto P,
Strange RC, Hemmingsen A, Spiteri MA. (2002). Glutathione s-transferase
gstp1 is a susceptibility gene for occupational asthma induced by isocyanates. J
Allergy Clin Immunol; 109:867–72.
256. Aynacioglu AS, Nacak M, Filiz A, Ekinci E, Roots I (2004). Protective role
of glutathione s-transferase p1 (gstp1) val105val genotype in patients with
bronchial asthma. Br J Clin Pharmacol; 57:213–17.
257. Kamada F, Mashimo Y, Inoue H, Shao C, Hirota T, Doi S, Kameda M,
Fujiwara H, Fujita K, Enomoto T, Sasaki S, Endo H, Takayanagi R, Nakazawa
C, Morikawa T, Morikawa M, Miyabayashi S, Chiba Y, Tamura G, Shirakawa
T, Matsubara Y, Hata A, Tamari M, Suzuki Y (2007). The gstp1 gene is a
susceptibility gene for childhood asthma and the gstm1 gene is a modifier of the
gstp1 gene. Int Arch Allergy Immunol; 144:275–86.
258. Li YF, Gauderman WJ, Conti DV, Lin PC, Avol E, Gilliland FD (2008).
Glutathione s-transferase p1, maternal smoking, and asthma in children: A
haplotype-based analysis. Environ Health Perspect; 116:409–15.
259. GINA (Global Initiative for Asthma) (2007). Global strategy for asthma
management and prevention.
260. British Thoracic Society/Scottish Intercollegiate Guidelines Network (2008).
Guidelines on Asthma Management. Available on the BTS web site (www.britthoracic.org.uk) and the SIGN web site.
261. Pauwels RA, Pedersen S, Busse WW, Tan WC, Chen YZ, Ohlsson SV,
Ullman A, Lamm CJ, O'Byrne PM (2003).Early intervention with budesonide
in mild persistent asthma: a randomized, double-blind trial. Lancet; 361: 1071–
6.
262. Yawn BP (2008). Factors accounting for asthma variability: achieving
optimal symptom control for individual patients. Primary Care Respiratory
Journal 17 (3): 138–147.
263. The
international
union
against
tuberculosis
and
lung
disease
(2008).Management of asthma. A guide to the essentials of good clinical
practice.
264. Lodge CJ, Allen KJ, Lowe AJ, Hill DJ, Hosking CS, Abramson MJ,
Dharmage SC (2012). Perinatal cat and dog exposure and the risk of asthma and
allergy in the urban environment: a systematic review of longitudinal studies.
Clinical & developmental immunology: 176484.
265. Baur X, Aasen TB, Burge PS, Heederik D, Henneberger PK, MaestrelliP,
Schlünssen V, Vandenplas O, Wilken D (2012). ERS Task Force on the
Management of Work-related, Asthma. The management of work-related
asthma guidelines: a broader perspective. European respiratory review: an
official journal of the European Respiratory Society 21 (124): 125–39.
266. Nathan SP, Lebowitz MD and Kunson RJ (1979). Spirometric testing.
Number of tests required and selection of data. Chest 76:384-88.
267. Miller S A, Dykes D D, Polesky HF (1988). A simple salting out procedure
for extracting DNA from human nucleated cells. Nucleic Acids Research; V16
Number 3:1215.
268. Hames BD (1981). Gel electrophoresis of proteins: A practical approach,
Hames BD and Rickwood D, Eds, IRL Press Washington, D,C., PP 1-91.
269. Krasteva A, Perenovska P, Ivanova A, Altankova I, BochevaT,Kisselova A
(2010).Alteration in Salivary Components of Children with Allergic Asthma.
Biotechnology & Biotechnological Equipment, 24(2);1866-1869.
270. Tripathi P, Awasthi S, Prasad R, Husain N, Ganesh S (2011).Association of
ADAM33 gene polymorphisms with adult-onset asthma and its severity in an
Indian adult population. J. Genet. 90, 265–273.
271. Werner M, Herbon N, Gohlke H, Altmüller J, Knapp M, Heinrich J, Wjst M
(2004). Asthma is associated with single nucleotide polymorphisms in
ADAM33. Clin. Exp. Allergy 34, 26–31.
272. Lee JH, Park HS, Park SW, Jang AS, Uh ST, Rhim T, Park CS, Hong SJ,
Holgate ST, Holloway JW, Shin HD (2004). ADAM33 polymorphism:
association with bronchial hyper-responsiveness in Korean asthmatics. Clin.
Exp. Allergy 34, 860–865.
273. Kedda M A, Duffy D L, Bradley B, O‘Hehir R E, Thompson P J(2006).
ADAM33 haplotypes are associated with asthma in a large Australian
population. Eur. J. Hum. Genet. 14, 1027–1036.
274. Magdy Zedan, Ashraf Bakr, Basma Shouman, Hosam Zaghloul, Mohammad
Al-Haggar, Mohamed Zedan, Amal Osman (2014).Single Nucleotide
Polymorphism of IL4C-590T and IL4RA 175V and Immunological Parameters
in Egyptian Asthmatics with Different Clinical Phenotypes. J Allergy Ther.
5,189.
275. Zhang AM, Li HL, Hao P, Chen YH, Li JH, Mo YX (2006).Association of
Q576R polymorphism in the interleukin-4 receptor gene with serum IgE levels
in children with asthma. Zhongguo Dang Dai Er Ke Za Zhi;8:109-12.
276. Chi-Huei Chiang, Ming-Wei Lin,Ming-Yi Chung, Ueng-Cheng Yang(2012).
The association between the IL-4, ADRb2 and ADAM 33 gene polymorphisms
and asthma in the Taiwanese population. Journal of the Chinese Medical
Association: 75; 635-643.
Appendix (1):
Questionnaire:
Assessment of the level and Phenotype of Haptoglobin and
Association between the Polymorphisms of (ADAM) 33gene, IL4
& IL-4R α in Sudanese with asthma
Candidate No: ……………………
Date: ………………………………………..
Name: (optional): ………………………………………. Age: ……………………
Tel No-: …………………………… Relative Phone No……………………………
Gender: Male
Female
Tribe: …………………………..
Residence: ………………………………
Occupation: ……………………………
Marital status: …………………………
1. Family history of Asthma(chest allergy):
1st degree relative
2nd degree relatives
2. Duration of asthma (chest allergy): ………………………………...
3. Type of treatment: Inhalers
Specify…………………..
Oral
Specify…………………..
4. History of allergic rhinitis:
Yes
No
5. History of drug allergy :
Yes
No
6. Asthma symptoms trigger factors:
Outdoor:
Specify…………………..
Indoor:
Specify…………………..
7. Past medical history of:
Diabetes: Yes
No
Hypertension: Yes
No
8. History of smoking:
Non-smoker
Current smoker
ex-smoker
9. Asthma symptoms:
10.Wheezing (whistling)
Chest tightness
Shortness of breath
Cough
11.Asthma symptoms are more:
At night (nocturnal)
at day time
12.Asthma symptoms frequency (classification of Persistent Asthma):
- < Weekly
= intermittent
- Weekly but not daily
= mild
- Daily but not all day
- Continuous
= moderate
= severe
13. Number of unplanned visits:
Emergency room visits
Weight: ----------
Hospital admissions
Height: ---------------
BMI: ----------------
function test:
Test
FEV1
FVC
PEFR
FEV1/FVC
1
2
3
Best
Lung
Appendix(2):Asthma control test:
Appendix (3):
Appendix (4):
Appendix (5):
Appendix (6):
Appendix (7):
Appendix (8):
Appendix (9):
Appendix (10):
Appendix (11):
CHAPTER ONE
INTRODUCTION
&
LITERATURE REVIEW
CHAPTER TWO
MATERIALS & METHODS
CHAPTER THREE
RESULTS
CHAPTER FOUR
DISCUSSION
CHAPTER FIVE
CONCLUSION &
RECOMMENDATIONS
CHAPTER SIX
REFRENCES & APPENDICES