PDF FILE

Transcription

PDF FILE

THE THAI JOURNAL OF VETERINARY MEDICINE
Office :
Faculty of Veterinary Science
Chulalongkorn University
Bangkok 10330
Thailand
tel. 0 2218 9676
fax. 0 2218 9677
Advisory Committee :
Prof. Dr. Annop Kunavongkrit
Dr. Yukol Limleamthong
Dean
President of the Veterinary Council of Thailand
Assoc. Prof. Dr. Janenuj Wongtavatchai
Dr. Yukol Limleamthong
Associate Dean (Research and Academic Services)
Director General of the Department of Livestock
Development, Ministry of Agriculture and Cooperatives
Assoc. Prof. Dr. Boonrit Thongsong
Dr. Pratuang Sudsakorn
Assistant Dean (Research Affairs)
President of the Thai Veterinary Medical Association
under the Royal Patronage
Miss Pringsri Ingkaninun
Dr. Piboon Kitjanukit
Assistant Dean (Information and Public Relations)
President of Chulalongkorn University
Veterinary Alumni Association
Editorial Board :
Anudep Rungsipipat (Editor-in-Chief)
Takashi Aoki (Japan)
Piyarat Chansiripornchai (Thailand)
Stanley H. Done (UK)
Sarinee Kalandakanond-Thongsong (Thailand)
Andrzj Mcdej (Sweden)
Nalinee Tuntivanich (Thailand)
Elisabeth Persson (Sweden)
Taradol Luangtongkum (Thailand)
Stig Einarsson (Sweden)
Kriengyot Sajjarengpong (Thailand)
Han-Soo Joo (USA)
Roongroje Thanawongnuwech (Thailand)
Eileen L. Thacker (USA)
Teresa Y. Morishita (USA)
Karen L. Keller (USA)
Journal Management :
The Chulalongkorn University Veterinary Library and Information Centre
Faculty of Veterinary Science
Tel. 0 2218 9554-7
Fax. 0 2255 8853, 0 2252 0980
Email [email protected], [email protected]
With the financial support of the Commission on Higher Education
This publication will be indexed and abstracted in Science Citation Index Expanded (SciSearch®) and SCOPUS
Printing :
Point Graphic Partnership
129 Baromrajchachonnanee Rd., Saladhammasop Thaweewattana Bangkok 10170 Thailand
Tel. 0 2888 8163, 08 1807 1110 Fax. 0 2888 8163 Email Address [email protected]
Board of Reviewing Editors
TJVM would like to thank the followings for their expertise contribution to the Journal in 2008-2009
Animal husbandry: Boonrit Thongsong, Benjaporn Prapakdee, Duangsmorn Suwattana,
Hatairat Plaimast, Monchai Duangjinda, Thanathip Suwansopee, Orawan Satayalai,
Somchai Chanpongsang, Surasak Jittakote, Suwanna Kijparkorn, Uttra Jamikorn. Aquatic
Animal Medicine: Aranya Ponpornpisit, Kanit Chukanhom, Janenuj Wongtavatchai,
Jirasak Tangtongpiroj, Sumrarn Bunnajirakul. Physiology & Biochemistry: Chutamas
Benjanirat, Gunnaporn Suriyapol, Kris Angkanaporn, Meena Sarikaputi, Narisa Futrakul,
Nikom Chaisiri, Prapruddee Piyaviriyakul, Suthasinee Poonyachoti, Suwanakiet Sawangkoon,
Tamolwan Suanarunsawat, Tanong Ausawakarn. Livestock Animal Medicine:
Jiroj Sasipreyajan, Kittisak Ajariyakhajorn, Nalin Upragarin, Niwat Chansiripornchai,
Somsak Pakpinyo, Supol Luengyosleuchakul, Witaya Suriyastaporn. Medicine:
Lallida Pariyakanok, Pinnita Tanthuvanit, Pongsak Yuktanandana. Small Animal Medicine:
Fahnan Suksawat. Theriogenology: Kelwalee Chatdarong, Peerasak Chanprateep,
Rangsun Parnpai, Sudson Sirivaidyapong, Suneerat Aiumlamai, Sunpetch Sophon,
Theerawat Tarasanit. Veterinary Anatomy: Damri Darawiroj, Paisan Tienthai,
Prasarn Tangkawattana, Weerapong Koykul, Wuthichai Klomkleaw, Veterinary
Microbrology: Channarong Rodkhum, Veterinary Pharmacology: Kanchana Imb-silp,
Sirinthorn Yibchok-A-nan, Supatra Srichairat. Veterinary Parasitology: Arkom Sangvaranond,
Manop Muangyai, Nareerat Viseshakul, Sparagano Oliver Andre Ettore, Sonthaya Tiewsirisup.
Veterinary Pathology: Boonmee Sunyasootcharee, Chaleow Salakij, Komkrich Teankum,
Nopadon Pirarat, Roongroje Thanawongnuwech, Taweesak Songserm, Wijit Banlunara.
Veterinary Public Health: Rungtip Chuanchuen, Suthep Ruangwises. Veterinary Surgery:
Atichat Bramasa, Marissak Kalpravidh, Naris Tengchaisri, Naruepon Kampa,
Niyada Suwankong, Voraphan Na Songkhala, Wanna Suriyastaporn. Veterinary Virology:
Kanisak Oraveerakul, Pravina Kitikoon.
The Thai Journal of Veterinary Medicine
Vol. 39 No. 3 September 2009
Contents
Editor's Not
Successful Transcervical Insemination in Giant Panda at Chiangmai Zoo, Thailand
199
Boripat Siriaroonrat Ampika Thongphakdee Wanlaya Tipkantha Kannikar Nimtragul
Kornchai Kornkeawrat Ratchaneewan Khejornwong Prasertsak Buntragulpoontawee Sumate Kamolnorranath
Review Article
Penaeid Shrimp Immune System
Gabriel Aguirre-Guzman
Antonio Luna-Gonzalez
205
Jesus Genaro Sanchez-Martinez
Felipe Ascencio
Angel Isidro Campa-Cordova
Original Article
Proliferation and Apoptosis of the Bitch Ovary during the Different Stages of the Oestrous Cycle.
Sayamon Srisuwatanasagul
Sukanya Manee-in
Promporn Raksaseri
217
Kongkiat Srisuwatanasagul
In vitro Antibiotic Susceptibility of Aeromonas hydrophila Isolated From Disease Ornamental Fish
225
Malinee Jongjareanjai Nongnut Assawawongkasem Nantarika Chansue
Comparative Efficacy of Enrofloxacin and Oxytetracycline by Different Administration Methods in
Broilers after Experimental Infection with Avian Pathogenic Escherichia coli
231
Niwat Chansiripornchai
The Indicative Influence of Oxidative Stress on Low Milk Yields in Dairy Cattle
Witaya Suriyasathaporn Usanee Vinitketkumnuen
Vena Chupia
Tanu Pinyopummintr
237
Teera Chewonarin
Effects of Medium Chain Fatty Acids, Organic Acids and Fructo-oligosaccharide on
Cecal Salmonella Enteritidis Colonization and Intestinal Parameters of Broilers
245
Sucheera Chotikatum Indhira Kramomthong Kris Angkanaporn
Efficacy of Microsatellite Markers in Parentage Control in Swine
259
Wanwisa Yaemmeeklin Jutarat Jirasupphachok Weerapon Koykul Duangsmorn Suwattana
Surveillance of Mycoplasma synoviae Infection in Mixed Thai Native Chickens
in the Area of Nakornpathom Province
Somsak Pakpinyo
Somkid Khanda
267
Supanat Boonyapisitsopa
Short Communication
Prevalence of Mycoplasma bovis and Other Contagious Bovine Mastitis Pathogens in Bulk Tank Milk
of Dairy Cattle Herds in Khon Kaen Province, Thailand
275
Jaruwan Kampa Varaporn Sukolapong Arunee Buttasri Apirom Charoenchai
Growth Characteristics of the H5N1 Avian Influenza Virus in Chicken Embryonic Eggs and MDCK Cells
Wisanu Wanasawaeng
Napawan Bunpapong
Wichet Leelamanit
Diagnostic Forum
ECG Quiz
Chollada Buranakarl
281
Roongroje Thanawongnuwech
287
Kris Angkanaporn
Ophthalmology Snapshot
Winai Chansaisakorn
289
Nalinee Tuntivanich
Ultrasound Diagnosis
291
Phiwipha Kamonrat
What is your Diagnosis
Pranee Tuntivanich
295
Suwicha Chuthatep
196
INSTRUCTIONS TO AUTHORS
The Thai Journal of Veterinary Medicine publishes
articles reporting interdisciplinary investigations
concerning veterinary and animal sciences, at all levels of
resolution, from basic to clinical, molecular to behavioral,
and opinions that are of general interest to the broad
community of veterinarians and biological scientists.
Clinical or pathological investigations, protocols and
reviews will also be considered for publication if they
provide significant insight into the structure or function,
the pathophysiology of a disease, or its treatment.
In the Journal’s Table of Contents, published
articles will be shown under one of the appropriate
Section titles listed below
SECTIONS
Editorials A limited amount of space will be
available for comments about important scientific points
or subjects of topical interest, and will be by invitation only.
Reviews and Minireviews will be either by
invitation, or submission. The latter will be reviewed by
experts in the same manner as other submitted manuscripts.
Original Articles should be novel research findings
and provide strong evidence for the conclusions. The
manuscripts suitable for publication in TJVM should be of
extreme importance to scientists in the field as well as
interesting to researchers in other disciplines.
Rapid or Short Communications These are short
communications that describe outstanding new
discoveries. This decision will be based on whether the
paper reports particularly important findings that are
likely to have a high impact in the field of work.
Clinical or Pathological Reports These are short
reports of original clinical or pathological findings
whose importance mean that they will be of interest to
veterinarians.
Diagnostic Forum is a regular feature of TJVM.
This includes Ultrasound Diagnosis, ECG Quiz,
Ophthalmology Snapshot and What Is Your Diagnosis,
all of which will be by invitation only.
SUBMISSION POLICY
Submission of a paper to TJVM is understood to
imply that it deals with original material not previously
published, and that it is not being considered for
publication elsewhere. Please write your text in good
English (American or British usage is accepted, but not a
mixture of these). The layout and style should adhere
strictly to the instructions given under “Organisation of
the Article”. Four copies of the manuscripts should
be submitted to the Editorial Board, The Thai Journal of
Veterinary Medicine, Chulalongkorn University, Bangkok
10330, Thailand. Fax: 02 218 9677. The final version of
the manuscript including all figures and tables should be
submitted in both hard copy and digital form. No revisions
or updates will be incorporated after the article has been
accepted and sent to the Publisher (unless approved by the
Editorial Board). The Editorial Board reserves the right to
reject any manuscript deemed unsuitable for publication
in TJVM.
Upon acceptance, a letter will be sent to the
corresponding Author confirming receipt of the manuscript.
Accepted manuscripts become the property of TJVM.
The Journal reserves the copyright, and no published
material may be reproduced or published elsewhere
without written consent from the Journal. If excerpts from
other copyrighted works are included, the Author(s) must
obtain written permission from the copyright owners and
credit the source(s) in the manuscript. The Journal will not
be responsible for the loss of manuscripts at any time.
All statements in, or omissions from, published manuscripts
are the responsibility of the Authors, who will assist the
editors by reviewing proofs before publication.
SUBMISSION PROCEDURE
Authors are requested to submit their manuscripts
in English, with abstracts in both Thai and English, in
a concise and understandable style. Technical jargon or “
laboratory slang” should not be used. Please note that
the electronic files supplied will always be used to produce
the illustrations, including those for the print version of the
article; it is the Authors’ responsibility to ensure that the
manuscript is written in a style that is grammatically
correct and free of spelling or other typographical errors,
and that these files are of suitable quality.
All manuscripts must be typewritten using TIMES
font at 12 point, with double-spacing throughout and
with margins at least 2.5 cm wide. Pages should be
numbered in succession, the title page being no. 1. Text
files should be supplied in Windows Microsoft Word or
Word Perfect formats.
197
Each manuscript should be accompanied by a
signed cover letter in which the corresponding Author
states: “The work described has not been submitted
elsewhere for publication, in whole or in part”. All
submissions to TJVM must contain experiments that
conform to the ethical standards issued by the National
Research Council. If the studies deal with animal
experiments, the authors certify in the Materials and
Methods section, that the procedures have been
approved by the Authors’ Institution’s Ethic
Committee, and care was taken to minimize the
number of animals used. If the ethical standard
governing the reported research is different from those
guidelines indicated above, the authors must provide
information in the submission cover letter about which
guidelines and oversight procedures were followed.
Authors should only use abbreviations sparingly
and should always define the abbreviation when first used
in the text by placing it in parentheses after the full term.
The abbreviations should then be used consistently
thereafter and appear at least twice in the text. Drug
names should be the official or approved names; trade
names or common names may be given where the drug is
first mentioned. Trade names should be capitalised and
the manufacturer’s name and country given in parenthesis
thereafter. The doses of the drugs should be given as unit
weight/unit body weight, e.g. mmol/kg or mg/kg. Symbols
for physical units should be restricted to the Systems
Internationale (S.I.) Units.
Where possible, Authors should also include
a list of three or more potential reviewers for their
manuscript, with contact information.
ORGANISATION OF THE ARTICLE
The manuscript should have a uniform style and be
submitted exactly as the author wishes it to appear in print.
It should consist of subdivisions in the following sequence.
1) Title page
2) Abstract
3) Text
4) Acknowledgments
5) References
6) Tables
7) Figures legends
8) Figures
Start each subdivision on a new page.
Title Page. The first page of the manuscript should
include:
● Title of paper
● Full name of author(s)
● Institutional affiliations and complete mailing
address
● The exact number of pages, figures and tables in
the article
● Individual, address, and telephone number to
whom correspondence concerning manuscript
should be sent.
Abstract. Submit an abstract of around 250
words that will serve in lieu of a concluding summary.
The abstract must be written in complete sentences and
succinctly state the objectives, experimental design of the
paper, principal observations, and conclusions; it should
be intelligible without reference to the rest of the paper.
Key Words. Four to six key words should be
included.
Text.
- Original articles: The text should be presented
in the following order: INTRODUCTION; MATERIALS
AND METHODS; RESULTS; DISCUSSION.
(i) Introduction. This should provide the scientific
rationale for the research that is reported. No results
should be presented.
(ii) Materials and Methods. Procedures used in the
research should be described in sufficient detail to permit
the replication of the work by others. Previously published
procedures should be referenced and briefly summarised.
The source of all materials, including animals and human
tissue, must be provided.
(iii) Results. This section presents findings
without discussion of their significance. Subsections
should be used in order to present results in an organised
fashion. The findings may be assisted by high quality
illustrations, as necessary, to adequately document the work.
Figures should be referred to in the text as Fig.1, Figs. 1, 34, etc., and tables as Table 1, Table 1, 3-4, etc.
(iv) Discussion. This section presents the Authors’
interpretations of their findings and an assessment of
their significance in relation to previous work. Repetition
of material presented in the Results section should be
avoided.
- Short Communication and Clinical or
Pathological Reports: These should not exceed 4 pages
(approximately 2,000 words in total, including spaces)
Follow the instructions for Original Articles with the
198
exception that results and discussion are combined.
- Reviews: Reviews should have an introductory
section, followed by several information presentation
sections and end with a conclusion section. Section
headings should be used to organise the presentation
of information.
Acknowledgements. It is the corresponding
Author’s responsibility to ensure that individuals who are
acknowledged for assistance or for providing comments
on the manuscript are agreeable to being acknowledged
in this way.
References
(a) In the text, references should be quoted as the
name of the first author and year in chronological order.
Multiple authors are indicated by “et al.”, except when there
are only two authors, in which case both names are
written.
Examples:
..... (Garthwaite and Garthwaite, 1995;
Morris, 2000).
....... by Nagy et al. (1999a,b).
Clarkson et al. (2004) stated.......
(b) The reference list should be on a separate
page at the end of the manuscript, in alphabetical order
and arranged as follows: authors’ names and initials, year,
title of the article, abbreviated title of the journal, volume,
first and last page numbers.
Examples:
Article in a periodical:
Nagy, Z.A., Esiri, M.M. and Cato, A.-M. 1999a.
Cell cycle markers in the hippocampus in Alzheimer’s
disease. Acta Neuropath. 94 (2):6-15.
Chapter in a book:
Mize, R.R. 1994. Conservation of Basic Synaptic
Circuits That Mediate GABA Inhibition in the Subcortical
Visual System. In: Neuroscience. From the Molecular to
the Cognitive. Progress in Brain Research. 3rded. F.E.
Bloom (ed.). Amsterdam: Elsevier. 123-132.
An entire book:
Sodikoff, C.H. 1995. Laboratory Profiles of Small
Animal Diseases. A Guide to Laboratory Diagnosis. 2nd
ed. St. Louis: Mosby. 178pp.
Electronic information:
Dumble, L.J. 1996. “The third world and infertile
women.” [Online]. Available: http://www.maff.gov.uk.
(c) A paper which has been accepted for
publication but has not yet appeared may be cited in the
reference list with the abbreviated name of the journal
followed by the words “in press”. Avoid using abstracts,
theses or dissertations as references. Unpublished
observations and personal communication may not be
used as references.
(d) Unpublished or submitted experiments by one
of the authors may be mentioned only in the text, not in the
References. Initials, as well as surnames, must be given
for authors whose unpublished experiments are quoted:
(M.L. King, unpublished observations)
Tables or figures. These should be included on
separate pages placed at the end of the manuscript. Their
desired approximate locations should be indicated in the
text. Each figure must be accompanied by an explanatory
legend in a separate section entitled Figure Legends. In
general, tables and figures should be constructed so that
they, together with their captions and legends, will be
intelligible with minimal reference to the main text. Table
and figure legends should be written as in the following
examples.
Figure 1 Typical lesions of...
Table 1 Statistical analysis showing....
All graphic files must be submitted, as JPEG,
in sufficiently high resolution (300 dpi for grayscale or
colour images and 600-1000 dpi for line art) to allow
for printing. Keep text and graphics (and any other items)
as separate files - do not import the figures into the text
file. Name your files using the correct extension, e.g.
text.doc, fig1a.eps, fig1.tif, Fig1.jpg, tbl1-6.xls, etc.
Authors will be required to pay a fee towards the extra
costs incurred in colour printing.
199
Editor Note
Successful Transcervical Insemination in Giant Panda
at Chiangmai Zoo, Thailand
Boripat Siriaroonrat1* Ampika Thongphakdee1 Wanlaya Tipkantha1
Kannikar Nimtragul1 Kornchai Kornkeawrat2 Ratchaneewan Khejornwong1
Prasertsak Buntragulpoontawee1 Sumate Kamolnorranath1
Giant panda (Ailuropoda melanoleuca), a bamboo-
2006-2009. Moreover, unclear understandings of giant
eating bear from China, has been globally recognized as
panda reproductive physiology and anatomy, as well as a
a symbol of endangered species conservation due to
short window of sexually receptive (2 to 3 days per year),
the loss of bamboo forest habitat and poaching. In
are the challenges that veterinarians and scientists were
wildlife education, giant panda has become worldwide
facing. Attempts have been made to investigate issues
ambassador to promote the need to conserve threatened
related to female fertility to prepare for natural or assisted
wildlife, habitats and biodiversity. In China, the Giant
breeding. Female reproductive cycle has been monitored
Panda Conservation Center has been established to
from the changing patterns of estrus behavior, vaginal
ensure sustainability of the valuable animals as well as
cytology and reproductive hormonal profiles i.e. urinary
their genetic diversity. To date, more than 160 individuals
estrogen and progesterone metabolites accessed by
living ex situ in China and approximately 30 individuals
enzyme-immunoassay, in order to understand the baseline
exhibited in North America, Austria, Mexico, Japan and
information of reproductive biology. Laboratory results
Thailand. Providing a proper semi-natural environment to
enabled Thai researchers to pinpoint timing of ovulation,
encourage natural breeding is the major goal of captive
thus the time of insemination can be accurately scheduled.
breeding program. However, success from natural mating
On the male side, fertility assessment had been conducted
does not come easy. It was reported that 74% of adults
for Chuang Chuang and the results showed that the
fail to mate naturally, caused mainly by poor mating
Chiangmai male was spermic and no degree of sub-
interest (libido) of sexually matured male pandas.
fertility or infertility was observed. However, the first
Accordingly, assisted reproductive technologies including
attempted of AI in 2007 resulted no pregnancy. In 2008, it
artificial insemination (AI) would allow population
was concluded that the female showed no signs of estrous
manager to incorporate genetically valuable male in to
from both behavioral observation and urinary enzyme-
gene pools.
immunoassay data. In the mid-February 2009, estrus
In a case of giant panda at Chiangmai Zoo; Chuang
signs such as increased vocalization, scent marking and
Chuang (9-year-old male) and Lin Hui (8-year-old female)
restlessness but decreased appetite, were observed. The
exhibited some degree of behavioral incompatibility
high percentage (90%) of vaginal epithelial morphology
that resulted in failed natural mating repeatedly from
(anucleated superficial cells) was observed on the day that
1
Zoological Park Organization under the Royal Patronage of H.M. the King, Bangkok, Thailand
2
Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand
*
Corresponding author: Email: [email protected]
200
found peak of urinary estrogen level (111.5 ng/mg
decline of estrogen level (Day 0) was considered the day
creatinine). On the first day of AI (February 17), fresh
of ovulation. In non-breeding period, average estrogen
semen (total volume=4.85 ml) was collected by
level of Lin Hui was normally at the baseline (3.37±1.1
electroejaculation from the male. Spermatozoa were
ng/mg creatinine; range 1.85-6.9 ng/mg creatinine,
diluted in TEST egg-yolk cryodiluents. The mixture was
n=115). On February 3rd, estrogen level started to rise to
divided into 2 parts; the first half was used for immediate
6.05±1.5 ng/mg creatinine (range 4.42-8.05, n=5) and
AI, and the other half was chilled at 4oC for the second
gradually increased until reaching the highest point
AI 24 h later. Eighteen hours after the peak of estrogen
at 111.46 ng/mg on February 17, and markedly dropped
was detected, the female panda was anesthetized and
to 38.19 ng/mg creatinine, respectively. Simultaneously,
placed in a dorsal recumbence position. Urinary catheter
after estrogen decline, the progesterone level was
was inserted to empty the bladder and minimize urine
increasing (Figure 1). This switching pattern of the 2
contamination to AI procedure. Catheter was inserted
hormones indicated ovulation of the female - Lin Hui.
into external cervical os. Diluted fresh semen was used
This observation is in accordance with the report by
for the first AI. The second AI was performed 24 h later
Durrant et al. (2006). The predicable ovulation could be
with chilled semen. Pregnancy watch plan was prepared
expressed to the estrus behavior as shown in Figure 1.
to evaluate AI success. Pregnancy was monitored using
The relationship between the behavioral and
the combination of progesterone assay, behavior changes
hormonal changes during the estrus cycle has been
and bi-monthly ultrasonography diagnosis. However,
reported from multiple female pandas. Shuling et al. (1997)
during the first 60-100 days, pregnancy is generally
reported that 80% of female giant pandas in captivity
indistinguishable from pseudopregnancy by behavioral
exhibiting weak estrus signs, or the absence or overt
observation, physical changes of animalís body or urinary
estrus behavior. In case of Lin Hui, estrus signs were
hormonal profile. Urinary hormone assay demonstrated
expressed in correlation with estrogen level. Increased
significant increased of progesterone level (from baseline
vocalization of bleating and chirping sounds during the
at AI day to 440 ng/mg at 82 day after AI). Beating
day of estrogen peak was observed, whereas lordosis
heart- or large arterial-like image was observed by
and tail up or receptive behaviors were closely associated
ultrasonography at day 82 but could not confirm
with falling estrogen level.
pregnancy. Nesting behavior was observed 24 hours
In accordance to the observation by Durrant and
before parturition. At day 97 after AI, female panda gave
colleagues (2006), prior to the peak of urinary estrogen
birth to a live healthy female cub (birth weight 235 g,
level, the high percentage of vaginal epithelial
length 17.50 cm) and raised the cub naturally
morphology (anucleated superficial cells) was observed
1. Factors affecting the AI success in giant
panda
(Figure 2).
The combination of endocrinology results,
Ovulation detection
behavioral and vaginal cytology data were important
Urinary hormonal profile was monitored
information to assist the detection of ovulation in female
throughout the year. In 2009 breeding season, Lin Hui
panda. These parameters were recommended to include
started to show signs of estrous behaviors from January
in the breeding plan e.g., introduction of male for natural
1. Daily urine samples were collected and analyzed for
mating or timed AI.
estrogens and progesterone metabolites to determine
Semen quality
timing of ovulation. Durrant et al. (2006) reported that
It has been reported that the active spermato-
estrogen peak level was recorded (Day -1) and the rapid
genesis in a male panda can be observed from the period
201
2009
140
ng/mg of creatine
120
Estrogen
Progesterone
111.460
100
80
60
40
20
0
9
9
9
9
9
9
9
9
9
9
9
9
09 09 09 09 09 09 09 09 09 00 009 00 00 00 00 00 00 00 00 00 00 00
2 /2 /2 /2
2 /2 /2
2 /2 /2 /2
2
20 /20 /20 /20 /20 /20 /20 /20 /20 2/2
/
/
/
/
/
2
2
2
2
2
2
2
2
2
2
2
2
2 /
2
2
2
2
2
2
2
2
/
/
/
/
/
/
/
/
/
/
/
8/ 9/ 10 11/ 12 13 14 15 16 17 18 19 20 21 22
3/ 4/ 5/ 6/ 7/
1/ 2/
Date
120
100.00
90.00
80.00
70.00
60.00
50.00
40.00
30.00
20.00
10.00
0.00
10
100
80
60
40
20
0
/2
/
09
urine estrogen (ng/mg Cr)
%vaginal cytology
Figure 1. Daily concentration of estrogen and progesterone excretion during 1-22 February
2009 demonstrates the estrogen peak occurred on 17th February 2009.
9
9
9
9
9
9
9
9
9
9
9
/0
/0
/0
/0
/0
/0
/0
/0
/0
/0
/0
/2
/2
/2
/2
/2
/2
/2
/2
/2
/2
/2
4
2
3
5
6
7
8
9
0
1
1
1
1
1
1
1
1
1
1
1
2
2
date
% Nucleated cell
% Anucleated cell
urine estrogen(ng/mg creatinine)
Figure 2. Relationship between urinary estrogen and vaginal cytology demonstrated a high
percentage of anucleated cells found on the same day of estrogen peak.
of 3 months before estrus to 2 months after estrus in a
chilled for 24 h at 4oC for the second AI on the following
presence of female (Tsutsui et al., 2006). Semen collection
day. Semen analyses revealed excellent quality (95%
using electroejaculation was conducted successfully
motility, 4.5 progressive status, and concentration of
for Chuang Chuang both in non-breeding and breeding
640x106 spermatozoa/ml). Morphological examination
seasons (2007-2009). On the day of AI (17 February 2009),
demonstrates 98% normal head and 86% normal tail
semen was collected from the male and milky projectile
spermatozoa, respectively (Figure 3B). The abnormalities
ejaculate (total volume=4.85 ml; pH 9; Figure 3A)
of spermatozoa were pear and small heads with/without
was observed during 4-5 volts electrical induction.
distal and proximal droplets. At 24 hour after refrige-
Subsequently, semen was diluted (1:1 v/v) in TEST
ration, chilled spermatozoa were motile with no apparent
egg-yolk cryodiluents. The mixture was divided into 2
abnormalities induced by cold temperature.
parts; the first half for immediate AI, and the latter
202
B
A
Figure 3. Milky ejaculated semen in a warm water-jacketed glass cup (A), and sperm morphology of giant panda
(B) William’s staining, x 1000
A
B
Figure 4. Lubricated vaginal speculum (A) was inserted to visualize the cervical opening. Plastic catheter was
transcervical inserted to deposit semen (B).
AI techniques
empty the bladder and minimize urine contamination to
Eighteen hours after peak of estrogen was detected,
AI procedure. Plastic/stainless steel catheter was inserted
the female panda was anesthetized using a combination of
into external cervical os (approximately 18 cm from vulva,
7 mg/kg of ketamine hydrochloride (Ketaleann, Animal
Figure 4B). For the first AI, extended fresh semen (total
Health Inc., Poland) and 0.5 mg/kg of xylazine (Ilium
volume= 5 ml) was deposited in to the uterus. The second
Xylazine-100, Troy Lab. PTY Ltd, Australia) and
AI was performed as described in the first AI with
maintained under isoflurane gas anesthesia. Female was
additional 4.7 ml of chilled extended semen 24 h after
placed in a dorsal recumbence position, and a lubricated
the first AI. To prevent backflow of inseminated semen,
vaginal speculum was inserted to visualize the cervical
the female rear end was lifted for 5 minutes immediately
opening (Figure 4A). Urinary catheter was inserted to
after insemination. The successful AI procedure
203
demonstrates that the technique using vaginal speculum
bi-monthly ultrasonography was conducted to maximize
and appropriate-sized catheters (5.5 to 6 mm diameter)
the chance to confirm pregnancy. During the first
were suitable for transcervical insemination in this
60-100 days after ovulation, pregnancy is generally
species.
indistinguishable from pseudopregnancy both by
2. Understanding giant panda reproduction
behavioral observation (increased bamboo consumption
Variation of gestation period caused by delayed
and sleep time), physical changes of animalís body
implantation
(enlarged abdomen, breasts, and milk let down) and
Bears are seasonal breeders. The reproductive
hormonal profiles. Only diagnostic nesting behavior was
biology in most bear species is similar. The bear gestation
observed 24 h prior to parturition in true pregnancy.
period is characterized by a long ‘embryonic diapause’ or
Urinary hormone assay demonstrated significant increased
ëdelayed implantationí that caused variation in pregnancy
of progesterone level from baseline at AI day to 440
lengths. Average pregnancy of giant panda is reported to
ng/mg creatinine at 82 day after AI. However, the observed
be 90-160 days (range 80-300 days). The large variation
profile was comparable to pseudopregnancy profile of
of pregnancy length is mainly dependent on the delayed
Lin Huiís 2007 cycle (Figure 5). This similar level of
implantation. This reproductive phenomenon is also known
progesterone could also be detected during pseudo-
as a discontinuous development of embryos inside the
pregnancy illustrating that true pregnancy cannot be
females’ uterus. Cell cycle arrest can occur at the G0/G1
distinguished from pseudopregnancy using hormonal
or G2 phase, depending on the species (Lopes et al., 2004).
assay. Beating heart- or large arterial-like image was
In several species that display pre-implantation delay,
observed by ultrasonography at day 82 but could not
including some marsupials, rodents, roe deer, nine-banded
confirm pregnancy.
armadillo, the embryos hatches from its zona pellucida
3. Conclusion and further researches
before entering into diapause. This unique biological
The study indicates that 1) ovulation can be detected
mechanism is the reason of unpredictable gestation length.
in female giant panda using behavioral observation and
urinary hormone assay thus timed AI can be conducted;
Monitoring of pregnancy using the combination
and 2) a healthy giant panda cub has been produced
of behavior changes, urinary progesterone assay, and
successfully by AI with 2 doses of fresh and chilled
Progesterone
(ng/mg creatinine)
Pregnant or pseudopregnant?
Average/Day
550
500
450
400
350
300
250
200
150
100
50
0
6
-1
AI
-9
-2
5
12
19
26
33
40
48
55
62
69
76
83
90
Day before and after AI
Progesterone 2007
Progesterone 2009
Figure 5. The progesterone profiles of giant panda Lin Hui after AI in 2007 and 2009.
97
204
extended semen. Suggested future research and
References
developments are; 1) to investigate the efficiency of
Durrant, B.S., Olson, M.A. Anderson, A., Gual-sil, F., Li,
frozen sperm for AI; and 2) to improve pregnancy
D. and Huang, Y. 2006. The value and significance
diagnosis by ultrasonography and specific assay to
of vaginal cytology. In: Giant Pandas: Biology,
detect embryo-origin signals.
Veterinary Medicine and Management. 1 st ed.
New York: Cambridge University Press. 231-244.
Acknowledgements
We gratefully thank all partners for establishing
The Project for Panda Research and Display in Thailand
Lopes, F.L., Desmarais J.A. and Murphy, B.D. 2004.
Embryonic diapause and its regulation. Reproduction
128: 669-678.
at Chiang Mai Zoo. We would like to specially thank
Steinman, K.J., Monfort, S.L., Mcgeehan, L., Kersey,
Drs. Meg Sutherland-Smith, Carlos Sanchez, JoGayle
D.C.,Gual-Sil, F., Snyder, R.J., Wang, P., Nakao, T.,
Howard, Suzan Murray, Copper Aitken-Palmer and
Czekala, N.M. 2006. Endocrinology of the giant
Mitch Bush for onsite training on anesthesia, physical
panda and application of hormone technology to
exams, electroejaculation and every other thing that we
species management. In: Giant Pandas: Biology,
learned from you all in Chiangmai in 2006. Special thanks
Veterinary Medicine and Management. 1 st ed.
to Janine Brown and David Kersey for helping us set
New York: Cambridge University Press. 198-230.
up the endocrine laboratory, and for online consultation
Shuling, Z., Zhao, Q., Zhong, X., Wildt, D.E., Seal, U.S.,
during the past 3 years. We also thank Drs. Sudson
1997. Report of the giant panda captive management
Sirividayapong and Theerawat Tarasanit (Faculty of
planning workshop, Chengdu, China. In: Shuling,
Veterinary Science, Chulalongkorn University) for
Z., Zhao, Q., Zhong, X., Wildt, D.E., Seal, U.S.
providing AI catheters.
(Eds.), IUCN - World Conservation Union/SSC
Conservation Breeding Specialist Group. IUCN,
Apple Valley, MN, 266.
Tsutsui, T., Hori, T., Nakashige, T., Narushima, E., Hara,
T., Akikawa, T., Nose, N., Saito, K., Shichiri, S.,
Hashizaki, F. and Komiya, T. 2006. Semen quality
in a Giant Panda (Ailuropoda melanoleuca) in
relation to estrus of a nearby resident female
panda. Theriogenology. 66(6-7): 1803-1806.
Aguirre-Guzman G. et al./Thai J. Vet. Med. 39(3): 205-215.
205
Review Articles
Penaeid Shrimp Immune System
Gabriel Aguirre-Guzman1* Jesus Genaro Sanchez-Martinez1
Angel Isidro Campa-Cordova2 Antonio Luna-Gonzalez3 Felipe Ascencio2
Abstract
Research on an innate immune system of penaeid shrimp is greatly motivated by economical requirements,
because their culture is limited by the development of infectious diseases. As invertebrates, shrimp’s natural
immunity acts as a fast and efficient defence mechanism against the pathogens. Their immune system involve
hemocytes (for encapsulation, nodule formation and phagocytosis), several plasma components (antimicrobial
peptides, histones, lysosomal enzymes, lipopolysaccharide, β-1,3-glucan binding proteins, and recognition
molecules), and multimeric systems (clotting protein cascade, prophenoloxidase system). When these defense
mechanisms fail to protect the shrimp against bacteria, viruses, fungi, protozoa and their products, disease
develops and a negative impact takes place in the shrimp culture system. Studying the shrimp immune system is
attractive for the advancement of a basic knowledge on invertebrate and vertebrate general immunity, because
it offers various possible alternatives for disease management in shrimp aquaculture. The aim of this document is
to present the general status of the shrimp defense system, to help in the development of strategies that favour
the control and prevention of disease.
Keywords : immune system, innate immune system, shrimp
1
Fac. de Medicina Veterinariay Zootecnia. Universidad Autonoma de Tamaulipas. Km 5 Carr. Cd. Victoria-Mante, Tamps., México, 87000.
2
Centro de Investigaciones Biologicas del Noroeste (CIBNOR), Mar Bermejo No. 195, Col. Playa Palo de Santa Rita, La Paz, BCS 23090,
México.
3
Centro Interdisciplinario de Investigacion para el Desarrollo Integral Regional, Km. 1 Carr. a Las Glorias, Guasave, Sinaloa, México. C. P.
81101
*
Corresponding author E-mail: [email protected]
Thai J. Vet. Med., 2009. 39(3): 205-215
206
∫∑§—¥¬àÕ
√–∫∫¿Ÿ¡‘§ÿâ¡°—π¢Õß°ÿâß
Gabriel Aguirre-Guzman1* Jesus Genaro Sanchez-Martinez1 Angel Isidro Campa-Cordova2
Antonio Luna-Gonzalez3 Felipe Ascencio2
ß“π«‘®—¬∑“ß√–∫∫¿Ÿ¡‘§ÿâ¡°—π ◊∫∑Õ¥¢Õß°ÿâß¡’§«“¡ ”§—≠Õ¬à“ß¬‘ËßμàÕ√–∫∫°“√º≈‘μ°ÿâß„π¥â“π°“√≈¥§«“¡ Ÿ≠‡ ’¬∑“ß
‡»√…∞°‘® ‡π◊ËÕß®“°°“√‡æ“–‡≈’È¬ß°ÿâß¡—°æ∫ªí≠À“‚√§μ‘¥‡™◊ÈÕ „π°≈ÿà¡ —μ«å∑’Ë‰¡à¡’°√–¥Ÿ° —πÀ≈—ß √–∫∫¿Ÿ¡‘§ÿâ¡°—π∑“ß∏√√¡™“μ‘®–∑”
Àπâ“∑’ËÕ¬à“ß√«¥‡√Á«·≈–¡’ª√– ‘∑∏‘¿“æ„π°≈‰°μàÕμâ“π°“√√ÿ°√“π¢Õß®ÿ≈™’æμà“ßÊ √–∫∫¿Ÿ¡‘§ÿâ¡°—πª√–°Õ∫¥â«¬‡´≈≈å Œ’‚¡‰´μå
(∑”Àπâ“∑’Ë„π°“√ √â“ß∂ÿßÀÿâ¡·≈–°“√‡°Á∫°‘π) “√πÈ” (‡ªª‰∑¥åμàÕμâ“π‡™◊ÈÕ·∫§∑’‡√’¬ Œ‘ ‚μπ ‡Õπ‰´¡å‰≈‚´‚´¡ ‰≈‚ª‚æ≈’·´§§“‰√¥å
‚ª√μ’π∑’Ë®—∫°—∫ β-1,3-°≈Ÿ·§π ·≈–‚¡‡≈°ÿ≈∑’Ë®”‡æ“–) ·≈–√–∫∫°“√∑”ß“π√à«¡°—π (¢∫«≥°“√·¢Áßμ—«¢Õß‚ª√μ’π √–∫∫‚æ√øï‚π‚≈ÕÕ°´‘‡¥ ) ‡¡◊ËÕ√–∫∫¿Ÿ¡‘§ÿâ¡°—π¥—ß°≈à“«≈â¡‡À≈«„π°“√§ÿ°§“¡ ¢Õß‡™◊ÈÕ ·∫§∑’‡√’¬ ‰«√— ‡™◊ÈÕ√“ ‚ª√‚μ´—« À√◊Õ ®ÿ≈™’æÕ◊ËπÊ °Á®–°àÕ
„Àâ‡°‘¥‚√§μà“ßÊ „π°“√‡æ“–‡≈’È¬ß°ÿâß ¥—ßπ—Èπ°“√»÷°…“∑“ß¥â“π√–∫∫¿Ÿ¡§ÿâ¡°—π¢Õß°ÿâß π—∫«à“¡’ª√–‚¬™πå¥â“π‡ªìπ¢âÕ¡Ÿ≈æ◊Èπ∞“π¢Õß
√–∫∫¿Ÿ¡‘§ÿâ¡°—π„π —μ«å∑—Èß°≈ÿà¡∑’Ë¡’·≈–‰¡à¡’°√–¥Ÿ° —πÀ≈—ß ·≈–‡æ◊ËÕ∑’Ë®–π”‰ª‡ªìπ·π«∑“ß‡≈◊Õ°„π°“√ªÑÕß°—π‚√§„πÕÿμ “À°√√¡
‡æ“–‡≈’È¬ß°ÿâß ®ÿ¥ª√– ß§å¢Õß°“√∑∫∑«π«√√≥°√√¡∫∑π’È §◊Õ „Àâ¢âÕ¡Ÿ≈æ◊Èπ∞“π¢Õß√–∫∫¿Ÿ¡‘§ÿâ¡°—π¢Õß°ÿâß ‡æ◊ËÕπ”‰ª‡ªìπ·π«
π‚¬∫“¬„π°“√§«∫§ÿ¡·≈–ªÑÕß°—π‚√§
§” ”§—≠ : √–∫∫¿Ÿ¡‘§ÿâ¡°—π √–∫∫¿Ÿ¡‘§ÿâ¡°—π ◊∫∑Õ¥ °ÿâß
1
Fac. de Medicina Veterinariay Zootecnia. Universidad Autonoma de Tamaulipas. Km 5 Carr. Cd. Victoria-Mante, Tamps., México, 87000.
Centro de Investigaciones Biologicas del Noroeste (CIBNOR), Mar Bermejo No. 195, Col. Playa Palo de Santa Rita, La Paz, BCS 23090, México.
3
Centro Interdisciplinario de Investigacion para el Desarrollo Integral Regional, Km. 1 Carr. a Las Glorias, Guasave, Sinaloa, México. C. P. 81101
*
ºŸâ√—∫º‘¥™Õ∫∫∑§«“¡ E-mail: [email protected]
2
Introduction
avoid pathogen’s access and propagation, helping in the
Total world fisheries production has decreased
reduction of loses due to mortalities and treatment
while human consumption of aquatic organisms has
costs (Flegel, 2006). Furthermore, the importance of
increased (FAO, 2006). This reduction in capture fisheries
understanding shrimp physiology and immunology is
has been partly compensated by the fast growth of the
important for the control and prevention of disease (Raico
aquaculture industry, where the commercial culture
et al., 2003). Therefore the purpose of this minireview is
of penaeid shrimp is an important sector in tropical and
to present the general status of the shrimp defense
subtropical countries (FAO, 2006). However, shrimp
system, to help in the development of strategies that
diseases have been responsible for the collapse of
favour the control and prevention of the disease. For
aquaculture in a number of countries, and are considered
practical purposes this minireview will address first the
as a limiting factor for its development (Flegel, 2006).
physical defence barriers, then the cellular and humoral
Epizootics are attributed to the inadvertent transmission
defence systems, shrimp immunostimulation and finally
of pathogens due to biosecurity problems and poor
future research perspectives.
management practices, affecting the growth of the
cultured organisms and generating important economic
I. Physical barriers
losses (FAO, 2006). The implementation of biosecurity
Physical barriers are the first line of defense on
methods and the timely diagnosis during culture may
shrimp and consist of a rigid exoskeleton, which protects
207
from injury and microbial attacks. The exoskeleton is
de Braak, 2002). These cells participate in phagocytosis,
composed of calcium carbonate, carbohydrates and
encapsulation, nodule formation, wound repair, clotting,
proteins, and contributes to different physiological
and proPO activation. They also help the production of
processes associated with the immune response
adhesion molecules, agglutinins and antimicrobial peptides
(Mylonakis and Aballay, 2005). There are reports of
(AMP) (Destoumieux et al., 1997; Bachere et al., 2000).
diffuse distribution of hemocyanin and catalytic phenol
Hemocytes also have inhibitory enzymes needed for
oxidation over the exocuticle and endocuticle of
regulating the proteolytic cascade, preventing its over
crustaceans; both are important immune response against
stimulation and the resultant tissue damage, while also
microbes (Adachi et al., 2005). However, the mechanisms
producing cytotoxic molecules such as lysozyme,
involved in crustaceans’ cuticle hardening and the role
phosphatase, esterase, phospholipase, peroxidase,
of phenoloxidase are poorly understood. For practical
protease, etc. (Van de Braak, 2002; Johansson et al., 2000).
purposes this mini-review will address first the physical
There are three classes of hemocytes, hyalinocytes,
defence barriers, then the cellular and humoral defence
granulocytes and semi-granulocytes. Hyalinocytes (5-
systems, shrimp immunostimulation and finally future
15% of circulating hemocytes or CE) are small non-
research perspectives.
refractive cells, with a small nucleus relative to their
cytoplasm, which have few or no cytoplasmic granules.
II.- Cell mediated immune defense
Hyalinocytes have no phagocytic activity and easily
Crustaceans have an open circulatory system with
adhere to glass surfaces, like fish and mammals
blue-green hemolymph, which circulates through the
macrophages. The primary role of these cells is related
hemocele and irrigates the crustacean tissues. Hemocytes
to clotting and phagocytosis (Zhang et al., 2006).
and humoral components are transported by the hemolymph
Granulocytes (10-20% of CE) have the smallest nucleus
favouring their encounter with foreign particles (Rendon
and a high number of cytoplasmic granules (0.8 μm
and Balcazar, 2003).
width). Granulocytes display phagocytic activity and
Hematopoiesis is the source for mature effectors
store the enzyme prophenoloxidase (proPo). These cells
cells for the innate immune system, which show roles on
may be stimulated by β-1,3-glucans, peptidoglycans (PG)
host defense and homeostasis. Blood cell formation is
and lipopolysaccharides (LPS) to provoke exocytosis
regulated from extra and intracellular signs that result in
and enzyme release. Their function is encapsulation,
the activation of specific downstream signalling cascades.
initiating the proPO cascade and phagocytosis (Zhang
The hematopoietic tissue (HPT) in crustaceans is an
et al., 2006). Semi-granulocytes (75% CE) have a large
extensive network of packed lobules located at the dorsal
numbers of small granules (0.4 μm width) similar to
and dorsolateral sides of the stomach, close to the antennal
vertebrate granulocytes. These cells posses β-1,3-glucans
artery and at the base of the maxillipedes. Hemocytes are
receptors and their principal function involves
produced within the walls of these tubules and released
..
into the vessel lumens (Soderhäll et al., 2003). The HPT of
phagocytosis, encapsulation and clotting (Martin
Penaeus monodon and other penaeid shrimp is located in
Phagocytosis
different areas stomach, maxillipeds and antennal gland
(Van de Braak et al., 2002).
and Graves, 2005; Zhang et al., 2006).
Phagocytosis involves the internalization of foreign
material. This is the main cellular defense mechanism
Penaeid shrimp hemocytes have the same
in invertebrates, and is carried out by the semi- and
biological properties and functions with vertebrate
granulocytes; it consists of chemotaxis, adherence,
macrophages, granulocytes and natural killer cells (Van
ingestion, pathogen destruction and exocytosis (Kondo
208
et al., 1998; Vargas-Albores and Yepiz-Plascencia 1998).
The study detected an increase in the levels of the
Phagocytic cells destroy the internalized organisms by
antioxidant enzymes and immune system molecules
two routes, an aerobic process which uses NADPH or
pointing out the important role of the antioxidant
NADH as an electron donor, and reduces an oxygen
enzymes as the immune response modulators.
electron to form the superoxide ion. This radical in turn
ROIs and reactive nitrogen intermediates (RNIs)
changes to hydrogen peroxide (H 2O2) spontaneously
are generated in phagocytic vacuoles. These molecules are
or by the action of the superoxide dismutase (SOD),
capable of crossing the cell barrier and damaging the
producing a new oxygen molecule. In penaeid hemocytes,
neighbouring cells (Nathan and Shiloh, 2000). To prevent
the activation of the aerobic process has been demonstrated
this damage, antioxidant defense strategies have been
by the use of bacteria (Vibrio parahaemolyticus and V.
developed including enzymatic substance (catalase,
vulnificus) and surface microbial antigens (β-1,3 glucan,
glutathione peroxidase (GPx), and SOD) and non-
PG, LPS, and zymosan), as both increase the phagocytic
enzymatic components (ascorbate, β-carotene, flavonoids,
capacity of hemocytes to destroy pathogens (Itami et al.,
α-tocopherol and vitamin E), which may neutralize the
1998; Song and Huang, 2000; Campa-Cordova et al., 2002).
ROIs or repair the molecular damage done to the cell
The second, anaerobic process is attribute to the action
(Nathan and Shiloh, 2000).
of diverse microbicidal enzymes, such as lysozyme and
SODs are one of the main defense mechanisms
low molecular weight AMP (Nappi and Ottaviani, 2000).
against oxidative stress caused by pollution, infections,
hypoxia, hyperoxia, temperature and immunostimulants
Encapsulation and nodule formation
(Neves et al., 2000). SODs have been classified in
Semi granulocytes are responsible for the
manganese SOD (mitochondria and prokaryotes), iron
recognition of the invading agents and their encapsulation
SOD (bacteria and plants) and copper-zinc SOD
with proteins (76 kD) that work as an opsonins associated
(eukaryotic cytosol). An extracellular SOD (EC-SOD) has
to the proPO activation system. These proteins act as
been reported in lobster, associated with phagocytosis,
a degranulation and adhesion factor for semi and
opsonization, encapsulation and generation of microbicidal
..
compounds (Homblad and Soderhäll, 1999).
granulocytes, and as an encapsulation promoter (VargasAlbores and Yepiz-Plascencia, 1998; Wang et al., 2001a;
Van de Braak, 2002). The hemolytical nodules, detected in
Oxyradical scavenging capacity
gill and hepatopancreas, are formed by numerous
The production of oxidative compounds with
hemocytes acting synergistically to trap microorganisms
antimicrobial effects has been studied in hemocytes from
or big antigens that cannot be removed by phagocytosis.
invertebrates (Van de Braak, 2002; Buggé et al., 2007).
These nodules undergo the subsequent activation of the
This cellular response is rapid and transient, and is
proPO system, melanisation and destruction of microbes
produced during microbe phagocytosis. These compounds
a
(Wang et al., 2001 ; Van de Braak, 2002).
include superoxide anions (O2-), hydroxyl radical (OH-),
H2O2, ROIs, and RNIs such as nitric oxide and peroxynitrite
Antioxidant system
(Roch, 1999). The ROIs and RNIs are an innate immune
Antioxidant factors protect the shrimp from the
responses present in echinoderms, nematodes, annelids,
cytotoxic effects caused by the cellular metabolism and
insects, crustacean and molluscs (Nappi and Ottaviani,
oxidative stress generated by the disequilibrium of the
2000). Their production is mediated by the enzymes
reactive oxygen intermediates (ROIs), stress tests had
NADPH oxidase and nitric oxide synthetase (NOS)
been done in marine organisms by Downs et al.(2001).
respectively. Other enzymes involved in ROI production
209
are xanthine oxidase and glucose oxidase (Nappi and
and hydroxyl radicals which are generated during
Ottaviani, 2000). The RNI are nitric oxide derivatives,
quinones formation (Vargas-Albores et al., 1998; Hellio
which are synthesized from L-arginin by NOS.
et al., 2007).
Prophenoloxydase system
Cytokines
Granulocytes are responsible for the synthesis,
The activation of antimicrobial responses in
storage and secretion of the proPO system, which is
invertebrates is mediated by cytokines which are
activated by fungal β-glucans, PG and LPS. These
produced by hemocytes. Some analogues of vertebrate
molecules induce the granulocyte secretion of inactive
cytokines such as interleukins (IL-1, IL-2, IL-6) and
proPO granules and their transformation (cascade reaction)
tumour necrosis factor alpha (TNF-α) have been
to proPO enzyme. This oxidizes phenols into quinones,
identified in invertebrates (annelids, echinoderms,
which may help to kill pathogens and are used for
mollusc and tunicates). These cytokines analogues have
melanin production (Lee et al., 2004; Hellio et al., 2007).
biological functions similar to their corresponding
In addition, the proteins interacting in the proPO
vertebrate molecules (Nappi and Ottaviani, 2000).
cascade process are associated with cell recognition
and hemocyte communication.
Heat shock proteins (HSP) or chaperonins are
invertebrate cytokines which are capable of protecting
Peroxynectin is a proPO system associated factor
and restoring proteins damaged by stress factors, such as
that creates cellular adhesion and acts as a peroxidase.
high temperatures, etc. (Frankenberg et al., 2000). The
This molecule is synthesized and stored by the
first study that shows association between the heat
granulocytes and activated upon cell secretion.
shock proteins and the stress or immune responses of
Hemocyte’s transmembrane receptors are responsible
shrimp was done by Wan-Yu et al. (2004), who cloned
for the peroxynectin cell adhesion, hemocyte dispersion,
and characterized the cDNA of the heat shock cognate 70
phagocytosis, encapsulation, nodule formation and
gene (652 amino acid sequence, 7.14 kDa) of P. monodon.
agglutination which resulted in peroxide activation and
..
the invading agent destruction (Soderhäll and Cerenius,
..
1998; Soderhäll et al., 2003).
This protein shows a phylogenetic relationship with
invertebrate and vertebrate hsc70 proteins, and possibly
functions as a chaperone. The expression of hsc70
mRNA, in shrimp hemocytes, increased 2 to 3 fold on
Melanization
one hour post heat shock and had a 30 min recovery
This is an interesting, little known and complex
biochemical process associated to different proteases
time, until these molecules decreased gradually to
2baseline levels.
(trypsine-like serine, serine protease) mediated by the
phenoloxidase (PO) system (Robalino et al., 2007; Pais et
Clotting protein cascade
al., 2008). Melanization plays an important role in the
Coagulation is used to prevent the loss of
invertebrate defense mechanisms wherein a thick
hemolymph through cuts and wounds in the exoskeleton,
acellular capsule of melanin is generated around foreign
and to immobilization of invading pathogens (Meng-
objects (Barillas-Mury, 2007). Melanin, a product of the
Yi et al., 2005). Three types of hemolymph clotting
proPO system, is a dark brown pigment with antibacterial
..
properties that inhibits antigens (Holmblad and Soderhäll,
systems (cascade) are known in crustaceans. Type A
1999). Although microbicidal properties have been
coagulation; type B consists of cellular aggregation with
-
limited plasma coagulation; and type C is a limited
attributed to melanin and the other agents such as O2
consists of a rapid hemocyte agglutination without plasma
210
cellular aggregation and lysis followed by plasma
proPO system activation, and LPS binding protein,
coagulation. Type C hemolymph coagulation is present
which helps in bacterial agglutination and removal by
in shrimp and other decapods (Yeh et al., 1999; Van de
phagocytosis (Vargas-Albores and Yepiz-Plascencia,
Braak, 2002). In crustaceans, the coagulation process
1998; Sritunyalucksana et al., 2002).
is regulated by clotting proteins (coagulogens) and
The innate immune system identifies pathogens
compartmentalized cellular factors within circulating cells.
through PRP and their corresponding pattern recognition
Clotting proteins in plasma are converted to covalently
receptors (PRR), which also are proteins. Toll-like
joined polymers by a Ca
++
dependent transglutaminase
b
receptors (TLRs) are an evolutionarily ancient family of
secreted by the hemocytes (Wang et al., 2001 ). The
PRRs presented in animals ranging from cnidarians to
cellular clotting proteins can be activated by LPS or
mammals, which can detect all kinds of pathogens
β-1,3-glucan, and are related to the proPO activation
(Janeway and Medzhitov, 2000; Robalino et al., 2004).
system (Roux et al., 2002).
TLRs are activated by bacterial and virus infection and
have been reported in Fenneropenaeus chinensis and
III Humoral immune defense
Litopenaeus vannamei (Li-Shi et al., 2007; Changjian
Recognition molecules
et al., 2008). In mammals, TLRs on specialized
There is little knowledge about the cell to cell
antigen-presenting cells function as signal transducers
communication system during the immune response in
by the way of nuclear factor κB, leading to the production
invertebrates (Nappi and Ottaviani, 2000). Lectins are
of pro-inflammatory cytokines and the expression of
non-enzymatic proteins or glycoproteins that act in
costimulatory molecules on the cell surface (Inamori
opsonization, agglutination, phagocytosis and pathogen
et al., 2004).
encapsulation. Invertebrate lectins are considered
primitive recognition molecules capable of detecting
carbohydrates (Nappi and Ottaviani, 2000) which
a
promote proPO system activation (Wang et al., 2001 ).
Antimicrobial peptides
An important element against invertebrate’s
pathogens are the AMP. These are cationic and
The pattern recognition proteins (PRP) are lectins
amphipathic proteins of low molecular weight (<10 kDa),
that detected the molecules like LPS, PG, bacterial
essential in organisms that lack of adaptive immunity
lipoteichoic acid, fungal β-1,3-glucans and viral RNA
..
(Song and Huang, 2000; Lee and Soderhäll, 2002),
(Marshall and Arenas, 2003). AMPs have wide spectrum
and which favour the activation of specific defense
animal cells. These peptides make pores in the cell
mechanisms by the host. The biological functions of
membranes of bacteria, fungi, parasites, enveloped viruses
PRPs are the initiation of a protein cascade and/or defense
and even cancer cells, provoking an instability of ions
mechanisms’ signalization routes and elimination of
and energy (Hancock, 1998; Bulet et al., 1999; Lehrer
blood system invaders. When PRPs detect the antigens,
and Ganz, 1999). Based on their amino acid sequence,
the hemocytes are migrating to their location by
secondary structure and functional similarities,
chemotaxis, generating an inflammatory response. The
AMPs have been classified as 1) peptides stabilized by
crustacean open circulatory system favours this
intermolecular disulphide bonds, 2) peptides and linear
phenomenon, resulting in a fast and efficient defense
polypeptides with α-helicoidal structures, and 3) peptides
mechanism against pathogens. Examples of PRPs
and linear polypeptides with a high content of proline
present in crustacean plasma are β-1,3-glucan
residues and/or glycine (Shai, 1998; Bulet et al., 1999).
binding protein which induces degranulation and
AMP activity can be reduced by a variety of in vivo
of activity, low specificity and are weakly cytotoxic to
211
factors, including high concentrations of mono and
agents (Song and Huang, 2000). Unfortunately, only an
divalent cations, polyanions, apolypoprotein A-1, etc.
innate immune system has been found in invertebrates.
However, many peptides seem to be relatively resistant
Several antigens (vibrio cells, yeast glucans or their
to several of these agents (Hancock, 1998).
Penaeidins, a family of AMPs, are initially
derivatives) have been experimentally tested to elucidate
..
the innate immune mechanisms in shrimp (Bohnel et al.,
characterized from L. vannamei, and their sequences have
1999; Sakai, 1999; Vici et al., 2000). Astanxhantins,
been described in L. setiferus, L. stylirostris, Penaeus
chitosan, fucoidan, β1-3 glucan, herbal extracts, laminaria,
semisulcatus, Marsupenaeus japonicus, P. monodon and
LPS, PG, saponins, and vitamin C are the main antigens
F. chinensis (Destoumieux et al., 1997; Gross et al., 2001;
experimentally tested in shrimp (Newman, 1999). These
Rojtinnakorn et al., 2002; Supungul et al., 2002).
substances can be administered by injection, immersion,
Penaeidins are synthesized and stored in the granulocyte,
bioencapsulation, per os intubation, and in the feed in
and present Gram (+) antibacterial and antifungal
marine organisms (Robles et al., 1998). The results
activities (Destoumieux et al., 1997; Destomieux et al.,
suggested that they can be an important element in the
1999; Bachere et al., 2000).
control of disease.
Other AMP found in the shrimp, is hemocyaninderived peptides, whose C-terminal fragments have
Glucans: These molecules are non-specific immuno-
antifungal activity; however, the mechanism by which
stimulants in crustaceans, inducing resistance against
hemocyanin is cleaved and activated are still unclear
bacterial pathogens (Vargas-Albores et al., 1998).
(Destoumieux-Garzon et al., 2001). Histone proteins;
However, crustaceans can digest glucans and use them
H 2 A, H 2 B, H 3 and H 4 found in hemocytes from
as sources of energy, losing their function in the animal
L. vannamei show antimicrobial activity against Gram (+)
immune system. Interestingly, the use of LPS together
bacteria and related to vertebrate histones, they may be a
with yeast glucan acts synergistically inducing a better
component of innate immunity more widely conserved,
stimulation of the crustacean immune system than when
and of earlier origin, than previously thought (Patat
they are used separately (Newman, 1999).
et al., 2004).
Peptidoglycans: PGs are a mix of amino acids and
carbohydrates from the cell wall of many bacteria and
Lysosomal enzymes
have been deemed as potent immunostimulants for the
Lysozyme degrades the mucopolysaccharides of
immune system (Lee et al., 2004). These molecules are
Gram (-) bacterial cell walls, and modifies the molecular
recognized as immunogen by the shrimp immune system,
conformation of the cell surface, allowing their
and Bifidobacterium thermophilum, Brevibacterium
recognition by phagocytic cells. Lysozymes take part in
lactofermentum and Bacillus sp. PGs have been tested
the degradation of microbes within and outside
against yellow head virus (YHV) and white spot
hemocytes, and some play a role of sterases and
syndrome virus (WSSV). The results showed that the
chitinases (de-la-Re-Vega et al., 2004).
PG exposed shrimp exhibit a higher survival rate than
non exposed shrimp (Itami et al., 1998; Lee et al., 2004).
IV. Peneaid shrimp immunostimulation
Fucoidan: These molecules are sulphated polysaccharides
Vaccination is used to stimulates the innate and
form microalgae cell walls which have been used as
acquired immune response in vertebrates. It involves the
immunostimulants for shrimp. These products have been
administration of specific and non-specific compounds
somewhat successful against pathogens like WSSV,
that induce an organismís response against pathogen
Vibrio sp. and other bacterial species. Experimental
212
administration of fucoidan mixed in the diet has resulted
diseases, and target organs during the course of infections,
in a 93% increase in survival compared to controls
(iv) the formation and activation of hemocytes in response
(Chotigeat et al., 2004). However, the action mechanisms
to pathogens. New research in those areas will involve the
are not well understood and more research with these
cooperation of biochemists, immunologists, bacteriologists,
products is necessary.
virologists, molecular biologists and infectious disease
Lipopolysaccharides: LPS affect the specific and non-
experts to discern new immune system models on
specific immune system of many animals, including
invertebrates, which will possibly have a significant
crustaceans (Vargas-Albores et al., 1998; Newman, 1999).
impact on the understanding of the immune system in
LPS are part of the cell wall of Gram (-) bacteria and are
general.
the first molecules recognized by the host’s immune
system, thus they have been used in shrimp as a potential
References
tool to prevent diseases. However, most of the work has
Adachi, K., Endo, H., Watanabe, T., Nishioka, T. and
been done under controlled laboratory conditions and
Hirata, T. 2005. Hemocyanin in the exoskeleton
results may vary when performed in the field.
of crustaceans: enzymatic properties and
immunolocalization. Pigment Cell Res. 18: 136-143
V. Future Perspectives
Bachere, E., Destoumieux, D. and Bulet, P. 2000.
Understanding the role of the invertebrate immune
Penaeidins, antimicrobial peptides of shrimp, a
system against pathogens is growing steadily; however,
comparison with other effectors of innate immune.
knowledge about the molecular and cellular mechanisms
Aquaculture. 191: 71-88.
of immune system associated in the recognition and
Barillas-Mury, C. 2007. CLIP proteases and Plasmodium
elimination is scarce. New research areas are including
melanization in Anopheles gambiae. Trends
genes, their products, and activation of genetic mechanisms
associated to the shrimp immune system. Other research
Parasitol. 23: 297-299.
..
Bohnel, H., Lohavanijaya, P., Rungin, S., Schnug, C. and
areas where further studies are warranted, including the
Seifert, H.S.H. 1999. Active immunisation of
proPO system, cell adhesion proteins, peroxinectins,
black tiger prawn (Penaeus monodon) against
pattern recognition proteins, 1,3-glucan binding protein
vibriosis in Thailand. Berl. Munch. Tierarztl.
(GBP), and hemocyte formation/activation and their
Wochenschr. 112: 289-295.
protein synthesis.
Buggé, D.M., Hégaret, H., Wikfors, G.H. and Allam, B.
Many of the previous studies on shrimp immuno-
2007. Oxidative burst in hard clam (Mercenaria
logy have been done with proteins, immune products, or
mercenaria) haemocytes. Fish Shellfish Immunol. 23:
preparations of limited purity, which made difficultly the
188-196.
understanding of their effects on the penaeid immune
Bulet, P., Hetru, C., Dimarcq, J.L. and Hoffmann, D. 1999.
system. Future studies will have to focus on (i) the use of
Antimicrobial peptides in insects; structure and
highly purified proteins or immune products, (ii) the
function. Dev. Comp. Immunol. 23: 329-344.
use of assays with the ability of quantitative detection
Campa-Cordova, A.I., Hernandez-Saavedra, N.Y.,
(real-time polymerase chain reaction, enzyme-linked
Philippis, R. De and Ascencio, F. 2002. Generation
immunosorbent assay) of individual mRNAs or
of superoxide anion and SOD activity in haemocytes
proteins during immunostimulation or disease, (iii) the
and muscle of American white shrimp (Litopenaeus
characterization of the specific microbial or viral
vannamei) as a response to β-glucan and sulphated
structures, or their products associated with infectius
polysaccharide. Fish Shellfish Immunol. 12: 353-366.
Changjian, Y., Jiquan, Z., Fuhua, L., Hongming, M., Qingli,
Z., Jose Priya, T.A., Xiaojun, Z. and Jianhai, X. 2008.
A Toll receptor from Chinese shrimp Fenneropenaeus
chinensis is responsive to Vibrio anguillarum
infection. Fish Shellfish Immunol. 24: 564-574.
Chotigeat, W., Tongsupa, S., Supamataya, K. and
Phongdara, A. 2004. Effect of fucoidan on disease
resistance of black tiger shrimp. Aquaculture.
233: 23-30
de-la-Re-Vega, E., Garcia-Orozco, K.D., CalderonArredondo, S.A., Romo-Figueroa, M.A, Islas-Osuna,
M.A., Yepiz-Plascencia, G.M. and Sotelo-Mundo,
R.R. 2004. Recombinant expression of marine
shrimp lysozyme in Escherichia coli. J. Biotechnol.
7: 298-304.
Destoumieux, D., Bulet, P., Loew, D., Van Dorsselaer,
A., Rodriguez, J. and Bachere, E. 1997. Penaeidins,
a new family of antimicrobial peptides isolated
from penaeids shrimp (Decapoda). J. Biol. Chem.
272: 28398-28406.
Destomieux, D., Bulet, P., Strub, J.M. and Bachere, E. 1999.
Recombinant expression and range of activity of
penaeidins, antimicrobial peptides from penaeid
shrimp. Eur. J. Biochem. 266: 335-346.
Destoumieux-Garzon, D., Saulnier, D., Garnier, J., Jouffrey,
C., Bulet, P. and Bachere, E. 2001. Crustacean
immunity. Antifungal peptides are generated from
the C terminus of shrimp hemocyanin in response
to microbial challenge. J. Biol. Chem. 276: 4707047077.
Downs, C., Fauth, J.E. and Woodley, C.M. 2001.
Assessing the health of grass shrimp (Palaeomonetes
pugio) exposed to natural and anthropogenic
stressors: a molecular biomarker system. Mar.
Biotechnol. 3: 380-397.
FAO (Food and Agriculture Organization of the United
Nations), 2006. The state of world fisheries and
aquaculture (SOFIA).
Flegel, T.W. 2006. The special danger of viral pathogens
in shrimp translocated for aquaculture. Sci. Asia.
32: 215-221
Frankenberg, M.M., Jackson, J.S. and Clegg, J.S. 2000.
The heat shock response of adult Artemia franciscana.
J. Therm. Biol. 25: 481-490.
213
Gross, P.S., Bartlett, T.C., Browdy, C.I., Chapman, R.W.
and Warr, G.W. 2001. Immune gene discovery by
expressed sequence tag analysis of hemocytes and
hepatopancreas in the pacific white shrimp,
Litopenaeus vannamei, and the Atlantic white
shrimp, L. setiferus. Dev. Comp. Immunol. 25:
565-577.
Hancock, R.E.W. 1998. The therapeutic potential of
cationic peptides. Expert Opin. Investig. Drugs.
7: 167-174.
Hellio, C., Bado-Nilles, A., Gagnaire, B., Renault, T. and
Thomas-Guyon, H. 2007. Demonstration of a true
phenoloxidase activity and activation of a ProPO
cascade in Pacific oyster, Crassostrea gigas
(Thunberg) in vitro. Fish Shellfish Immunol. 22:
433-440.
Holmblad, T. and Soderhäll, K. 1999. Cell adhesion
molecules and antioxidative enzyme in a crustacean,
possible role in immunology. Aquaculture. 172:
111-123.
Inamori, K., Ariki, S. and Tawabata, S. 2004. A Toll-like
receptor in horseshoe crabs. Immunol. Rev. 198:
106-115.
Itami, T., Asano, M., Tokushige, K., Kubono, K.,
Nakagawa, A., Takeno, N., Nishimura, H., Maeda,
M., Kondo, M. and Takahashi, Y. 1998. Enhancement
of disease resistance of kuruma shrimp, Penaeus
japonicus after oral administration of peptidoglycan
derived from Bifidobacterium thermophilum.
Janeway, C.A. and Medzhitov, R. 2000. Viral interference
with IL-1 and Toll signaling. Proc. Natl. Acad. Sci.
U.S.A. 97: 10682-10683.
Johansson, M., Keyser, P., Sritunyalucksana, K. and
..
Soderhäll, K. 2000. Crustacean haemocytes and
haematopoiesis. Aquaculture. 191: 45-52.
Kondo, M., Itami, T., Takahashi, Y., Fujii, R. and
Tomonaga, S. 1998. Ultrastructural and cytochemical characteristics of phagocytes in kuruma
prawn. Fish Pathol. 33: 421-427.
Lee, M.H., Osaki, T., Lee, J.Y., Baek, M.J., Zhang, R., Park,
J.W., Kawabata, S., Soderhäll , K. and Lee, B.L. 2004.
Peptidoglycan recognition proteins involved in
1,3-β-D-glucan-dependent prophenoloxidase
activation system of insect. J. Biol. Chem. 279:
3218-3227.
214
..
Lee, S.Y. and Soderhäll, K. 2002. Early events in
crustacean innate immunity. Fish Shellfish
Immunol. 12: 421-437.
Lehrer, R.I. and Ganz, T. 1999. Antimicrobial peptides
in mammalian and insect host defense. Curr.
Opin. Immunol. 11: 23-37.
Li-Shi, Y., Zhi-Xin, Y., Ji-Xiang, L., Xian-De, H.,
Chang-Jun, G., Shao-Ping, W., Siu-Ming, C.,
Xiao-Qiang, Y. and Jian-Guo, H. 2007. A toll
receptor in shrimp. Mol. Immunol. 44: 1999-2008.
Marshall, S.H. and Arenas, G. 2003. Antimicrobial
peptides: A natural alternative to chemical
antibiotics and a potential for applied biotechnology.
Electron. J. Biotechnol. 6: 271-284.
Martin, G.G. and Graves, B. 2005. Fine structure and
classification of shrimp haemocytes. J. Morphol.
185: 339-348.
Meng-Yi, C., Kuang-Yu, H.U.B, Chih-Cheng, H. and
Yen-Ling, S. 2005. More than one type of
transglutaminase in invertebrates? A second
type of transglutaminase is involved in shrimp
coagulation. Dev. Comp. Immunol. 29: 1003-1016.
Mylonakis, E. and Aballay, A. 2005. Worms and flies as
genetically tractable animal models to study
host-pathogen interactions. Infect. Immun. 73:
3833-3841.
Nappi, A.J. and Ottaviani, E. 2000. Cytotoxicity and
cytotoxic molecules in invertebrates. BioEssays.
22: 469-480.
Nathan, C. and Shiloh, M.U. 2000. Reactive oxygen and
nitrogen intermediates in the relationship between
mammalian hosts and microbial pathogens. Proc.
Natl. Acad. Sci. U.S.A. 97: 8841-8848.
Neves, C.A., Santos, E.A. and Bainy, A.C.D. 2000.
Reduced superoxide dismutase activity in
Palaemonetes argentinus (Decapoda, Paleminedae),
infected by Probopyrus ringueleti (Isopoda,
Bopyridae). Dis. Aquat. Org. 39: 155-158.
Newman, S.G. 1999. A review of the use of non specific
immune-stimulants to reduce the impact of the
WSSV. 5th Ecuadorian Aquaculture Conference.
October 28-30, Ecuador.
Pais, R., Khushiramani, R., Karunasagar, I. and
Karunasagar, I. 2008. Effect of immunostimulants
on the haemolymph haemagglutinins of tiger
shrimp Penaeus monodon. Aquac. Res. 39:
1339-1345.
Patat, S.A., Carnegie, R.B., Kingsbury, C., Gross, P.S.,
Chapman, R. and Schey, K.L. 2004. Antimicrobial
activity of histones from hemocytes of the Pacific
white shrimp. Eur. J. Biochem. 271: 4825-4833.
Raico, E., Lamela, L., Silveira, R. and Mart?nez, M.
2003. Actividad peroxidasa (POD) en juveniles del
camaron Litopenaeus schmitti. II Congreso
Iberoamericano Virtual de Acuicultura (CIVA).
p.99-104.
Rendon, L. and Balcazar, J.L. 2003. Inmunologia de
camarones: Conceptos basicos y recientes avances.
Revista AquaTIC. 19: 27-33.
Robalino, J., Browdy, C.L., Prior, S., Metz, A., Parnell, P.,
Gross, P. and Warr, G. 2004. Induction of Antiviral
Immunity by Double-Stranded RNA in a Marine
Invertebrate. J. Virol. 78: 10442-10448.
Robalino, J., Almeida, J.S., McKillen, D., Colglazier, J.,
Trent, H.F., Chen, Y.A., Peck, M.E.T., Browdy, C.L.,
Chapman, R.W., Warr, G.W. and Gross, Pí.S., 2007.
Insights into the immune transcriptome of the shrimp
Litopenaeus vannamei: tissue-specific expression
profiles and transcriptomic responses to immune
challenge. Physiol. Genomics 29: 44-56, 2007
Robles, R., Sorgeloos, P., Van Duffel, H. and Nelis, H. 1998.
Progress in biomedication using live foods. J. Appl.
Ichthyol. 14: 207-212.
Roch, P. 1999. Defense mechanisms and disease
prevention in farmed marine invertebrates.
Rojtinnakorn, J., Hirono, I., Itami, T., Takahashi, Y. and
Aoki, T. 2002. Gene expression in haemocytes of
kuruma prawn, Penaeus japonicus, in response to
infection with WSSV by EST approach. Fish
Shellfish Immunol. 13: 69-83.
Roux, M.M., Pain, A., Klimpel, K.R. and Dhar, A.K. 2002.
The lipopolysaccharide and β-1,3-glucan binding
protein gene is upregulated in white spot
virus-infected shrimp (Penaeus stylirostris). J. Virol.
76: 7140-7149.
Sakai, M. 1999. Current research status of fish
immunostimulants. Aquaculture. 172:63-92.
Shai, Y. 1998. Mode of action of antibacterial peptides.
In: Molecular mechanisms of immune responses
in insects. 1st ed. P.T. Brey and D. Hultmark (eds).
London: Chapman and Hall, 111-134.
..
Soderhäll, K. and Cerenius, L. 1998.The prophenoloxidase
activating system in invertebrate immunity. Curr.
Opin. Immunol. 10, 23-28.
..
..
Soderhäll, I., Bangyeekhun, E., Mayo, S. and Soderhäll,
K. 2003. Hemocyte production and maturation in
an invertebrate animal; proliferation and gene
expression in hematopoietic stem cells of Pacifastacus
leniusculus. Dev. Comp. Immunol. 27: 661-672.
Song, Y.L. and Huang, C.C. 2000. Aplications of
immunostimulant to prevent shrimp diseases. In:
Resent advances in marine biotechnology. 1st ed. M.
Fingerman and R. Negabhusanam (eds). Playmouth:
Science Publishers Inc.: 173-187.
..
Sritunyalucksana, K., Lee, S.Y. and Soderhäll, K. 2002.
A β-1,3-glucan binding protein from the black
tiger shrimp, Penaeus monodon. Dev. Comp.
Immunol. 26: 237-245.
Supungul, P., Klinbunga, S., Pichyangkura, R., Jitrapakdee,
S., Hirono, I., Aoki, T. and Tassanakajon, A. 2002.
Identification of immune-related genes in hemocytes
of black tiger shrimp (Penaeus monodon). Mar.
Biotechnol. 4: 487-494.
Van de Braak, K. 2002 Hemocytic defense in black tiger
shrimp (Penaeus monodon). Doctor degree thesis.
Wageningen Institute of Animal Science. Wageningen
University. The Netherlands.
Van de Braak, C.B.T., Botterblom, M.H.A., Liu, W.,
Taverne, N., Van der Knaap, W.P.W. and Rombout,
J.H.W.M. 2002. The role of the haematopoietic
tissue in haemocyte production and maturation of
the black tiger shrimp (Penaeus monodon). Fish
Vargas-Albores, F., Hernandez-Lopez, J., Gollas-Galvan,
~
T., Montano-Pérez,
K., Jiménez-Vega, F. and YepizPlascencia, G. 1998. Activation of shrimp cellular
defense functions by microbial products. In: Advances
in shrimp biotechnology. T.W. Flegel (ed). National
center for genetic engineering and biotechnology,
Bangkok, 161-166.
Vargas-Albores, F. and Yepiz-Plascencia, G. 1998. Shrimp
immunity: A review. Trends Comp. Biochem. Physiol.
5: 195-210.
215
Vici, V., Bright Sing, I.S. and Bhat, S.G. 2000.
Application of bacterins and yeast Acremonium
dyosporii to protect the larvae of Macrobrachium
rosenbergii from vibriosis. Fish Shellfish Immunol.
10: 559-563.
..
Wang, R., Lee, S.Y., Cerenius, L. and Soderhäll, K. 2001a.
Propertis of the prophenoloxidase activating
enzyme of the freshwater crayfish, Pacifastacus
leniuscalus. Eur. J. Biochem. 268: 895-902.
..
Wang, R., Liang, Z., Hal, M. and Soderhäll, K. 2001b. A
transglutaminase involved in the coagulation
system of the freshwater crayfish, Pacifastacus
leniusculus. Tissue localization and cDNA cloning.
Fish Shellfish Immunol. 11: 623-637.
Wan-Yu, L., Kuan-Fu, L., I-Chiu, L. and Yen-Ling, S. 2004.
Cloning and molecular characterization of heat shock
cognate 70 from tiger shrimp (Penaeus monodon).
Cell Stress Chaperones. 9: 332-343.
Yeh, M.S., Huang, C.J., Leu, J.H., Lee, Y.C. and Tsai, I.H.
1999. Molecular cloning and characterization of a
hemolymph clottable protein from tiger shrimp
(Penaeus monodon). Eur. J. Biochem. 266: 624-633.
Zhang, Z.F., Shao, M. and Ho Kang, K. 2006. Classification of haematopoietic cells and haemocytes in
Chinese prawn Fenneropenaeus chinensis. Fish
Srisuwatanasagul S. et al./Thai J. Vet. Med. 39(3): 217-224.
217
Original Article
Proliferation and Apoptosis of the Bitch Ovary during the
Different Stages of the Oestrous Cycle
Sayamon Srisuwatanasagul1* Sukanya Manee-in2 Promporn Raksaseri1
Kongkiat Srisuwatanasagul1
Abstract
In order to maintain homeostasis of the ovary, proliferation and apoptosis occur simultaneously in different
ovarian cell types. It was shown that steroid hormone which changed during the oestrous cycle, may regulate these
mechanisms in normal mammal ovarian tissues. Therefore, the present study was aimed to study cell proliferation
and apoptosis during different stages of the oestrous cycle in the bitch ovary by using immunohistochemistry and
TUNEL assay. The bitch ovaries were collected at 4 different stages of the oestrous cycle, which were prooestrus,
oestrus, dioestrus and anoestrus. Immunohistochemistry and TUNEL assay were applied to detect Ki-67 protein
and apoptosis respectively in different cells of the bitch ovary. The results showed that the most prominent staining
for both Ki-67 and apoptosis was found in granulosa cells of the ovarian follicles. During the oestrous cycle, high
proliferation was observed at prooestrus and oestrus in almost all ovarian cell types while no proliferating cell was
found in the bitch corpus luteum. For apoptosis, high apoptotic rate was found at prooestrus in all ovarian cells
except for luteal cells, in which apoptosis was significantly higher during dioestrus compared to the other stages.
These results indicated that proliferation and apoptosis varied not only among different ovarian cells but also
during the stages of the oestrous cycle, which may partly involve with the levels of ovarian steroid hormones.
Moreover, the granulosa cells of the ovarian follicles were the most dynamic cell types which undergo proliferation
and apoptosis during the oestrous cycle from the present study.
Keywords : apoptosis, bitch, ovary, proliferation
1
Department of Anatomy, Faculty of Veterinary Science, Chulalongkorn University, Pathumwan, Bnagkok 10330 Thailand
2
Department of Clinical Sciences and Public Health Medicine, Faculty of Veterinary Science, Mahidol University, Salaya, Nakhon Prathom,
73170 Thailand
*
Thai J. Vet. Med., 2009. 39(3): 217-224
218
∫∑§—¥¬àÕ
°“√ßÕ°¢¬“¬·≈–°“√μ“¬¢Õß‡´≈≈å√—ß‰¢à ÿπ—¢„π·μà≈–√–¬–¢Õß«ß√Õ∫°“√‡ªìπ —¥
»¬“¡≥ »√’ ÿ«—≤π“ °ÿ≈1* ÿ°—≠≠“ ¡≥’Õ‘π∑√å2 æ√À¡æ√ √—°…“‡ √’1 °âÕß‡°’¬√μ‘ »√’ ÿ«—≤π“ °ÿ≈1
√—ß‰¢à¢Õß —μ«å‡≈’È¬ß≈Ÿ°¥â«¬π¡ “¡“√∂§ß ¡¥ÿ≈‰¥â¥â«¬ °“√‡°‘¥°“√ßÕ°¢¬“¬·≈–°“√μ“¬Õ¬à“ß‡ªìπª°μ‘¢Õß‡´≈≈åμà“ßÊ ¢Õß
√—ß‰¢à ´÷ËßÕ“®®–¡’ à«π‡°’Ë¬«¢âÕß°—∫√–¥—∫¢Õß ‡μ’¬√Õ¬¥åŒÕ√å‚¡π∑’Ë‡ª≈’Ë¬π·ª≈ß„π·μà≈–√–¬–¢Õß«ß√Õ∫°“√‡ªìπ —¥ °“√»÷°…“
„π§√—Èßπ’È®÷ß¡’®ÿ¥ª√– ß§å ‡æ◊ËÕ»÷°…“§«“¡·μ°μà“ß¢Õß°“√ßÕ°¢¬“¬·≈–°“√μ“¬¢Õß‡´≈≈å√—ß‰¢à ÿπ—¢∑’Ë√–¬–μà“ßÊ ¢Õß«ß√Õ∫°“√
‡ªìπ —¥‚¥¬∑”°“√‡°Á∫μ—«Õ¬à“ß√—ß‰¢à∑’Ë√–¬–μà“ßÊ ¢Õß«ß√Õ∫°“√‡ªìπ —¥ §◊Õ √–¬–‚ª√‡Õ μ√— √–¬–‡Õ μ√— √–¬–‰¥‡Õ μ√— ·≈–
√–¬–·Õπ‡Õ μ√— À≈—ß®“°π—Èπ„™â«‘∏’Õ‘¡¡Ÿπ‚πŒ‘ ‚μ‡§¡’·≈– TUNEL assay ‡æ◊ËÕμ√«®À“‚ª√μ’π Ki-67 ´÷Ëß “¡“√∂∫àß∫Õ°∂÷ß
°“√ßÕ°¢¬“¬ ·≈–°“√μ“¬¢Õß‡´≈≈åμ“¡≈”¥—∫ º≈°“√»÷°…“æ∫«à“‡´≈≈å∑’Ë°“√ßÕ°¢¬“¬·≈–°“√μ“¬‡°‘¥Õ¬à“ß‡¥àπ™—¥ §◊Õ ‡´≈≈å
°√“πŸ‚≈´“¢ÕßøÕ≈≈‘‡§‘≈™π‘¥μà“ßÊ „π√–À«à“ß«ß√Õ∫°“√‡ªìπ —¥ “¡“√∂μ√«®æ∫°“√ßÕ°¢¬“¬‰¥â Ÿß„π‡´≈≈å‡°◊Õ∫∑ÿ°™π‘¥
¢Õß‡´≈≈å√—ß‰¢à∑’Ë√–¬–‚ª√‡Õ μ√— ·≈–‡Õ μ√— ·μà‰¡à “¡“√∂μ√«®æ∫‡´≈≈å∑’Ë„Àâº≈∫«°μàÕ‚ª√μ’π Ki-67 „π§Õ√åªí ≈Ÿ‡∑’¬¡‰¥â‡≈¬
”À√—∫°“√‡°‘¥°“√μ“¬¢Õß‡´≈≈åπ—Èπæ∫«à“‡´≈≈å√—ß‰¢à‡°◊Õ∫∑ÿ°™π‘¥¡’Õ—μ√“°“√μ“¬ Ÿß„π√–¬–‚ª√‡Õ μ√— ¬°‡«âπ„π§Õ√åªí ≈Ÿ‡∑’¬¡
´÷Ëßæ∫‡´≈≈å∑’Ë‡°‘¥°“√μ“¬‰¥â¡“° ÿ¥∑’Ë√–¬–‰¥‡Õ μ√— ®“°º≈°“√»÷°…“ “¡“√∂ √ÿª‰¥â«à“∑—Èß°“√ßÕ°¢¬“¬·≈–°“√μ“¬¢Õß‡´≈≈å¡’
°“√·ª√º—π„π·μà‡´≈≈å·μà≈–™π‘¥¢Õß√—ß‰¢à √«¡∑—Èß¡’°“√·ª√º—πμ“¡√–¬–μà“ßÊ ¢Õß«ß√Õ∫°“√‡ªìπ —¥Õ’°¥â«¬ ∑—Èßπ’È‡´≈≈å°√“πŸ‚≈´“
¢Õß√—ß‰¢à‡ªìπ‡´≈≈å∑’Ë¡’°“√‡ª≈’Ë¬π·ª≈ß®“°°“√‡°‘¥°“√ßÕ°¢¬“¬·≈–°“√μ“¬¡“°∑’Ë ÿ¥‡¡◊ËÕ‡∑’¬∫°—∫‡´≈≈å™π‘¥Õ◊ËπÊ ¢Õß√—ß‰¢à
§” ”§—≠ : °“√μ“¬¢Õß‡´≈≈å ÿπ—¢ √—ß‰¢à °“√ßÕ°¢¬“¬
1
¿“§«‘™“°“¬«‘¿“§»“ μ√å §≥– —μ«·æ∑¬»“ μ√å ®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬ °√ÿß‡∑æœ 10330
¿“§«‘™“‡«™»“ μ√å§≈‘π‘°·≈–°“√ “∏“√≥ ÿ¢ §≥– —μ«·æ∑¬»“ μ√å ¡À“«‘∑¬“≈—¬¡À‘¥≈ π§√ª∞¡ 73170
*
2
Introduction
theca cells are the cause of follicular dynamic of the
The morphology and function of the ovary could
ovary (Monniaux et al., 1997; Isobe and Yoshimura, 2000;
represent the potency in mammalian reproduction. In
Feranil et al., 2004). Ki-67 is a protein which is present
bitches, about half a million of follicles are observed in
during all active phases of the cell cycle, but is absent
newborn puppies. Thereafter, the follicles develop and
from resting cells (G0). Therefore, it is an excellent
undergo atresia in a certain amount during postnatal life.
marker for determining the growth fraction of the cell
Thus, the number of follicles decline after birth to about
population (Scholzen and Gerdes, 2000). However, little
500 follicles by the end of the reproductive cycle in the
is known about the proliferative status in different cells
bitches (Concannon, 1986; McDougall et al., 1997). It has
of the bitch ovary.
been proposed that proliferative activities and apoptosis
In addition to cellular proliferation maintain
are the mechanism involved in these events in order to
normal physiology of the ovary, the majority of follicular
maintain ovarian homeostasis in all mammals.
cells undergo follicular atresia which involve
The development of ovarian cells is considered to
programmed cell death called apoptosis. The role of
be regulated by various factors including steroid hormones
apoptosis in follicular atresia and luteal regression has
which change according to the stages of the reproductive
been investigated in different species such as in human
cycle (Maruo et al., 1999). There are studies that show
(Yuan and Giudice, 1997), rat (Tabarowski et al., 2005),
that proliferative activities occurring in granulosa and
pig (Slomczynska et al., 2006), cows (Cushman et al., 2001;
219
D’Haeseleer et al., 2006), buffalo (Feranil et al., 2005)
0.5, 2, 10, 20 and 40 ng/ml. The within-assay coefficients
and dogs (Aiudi et al., 2006; Luz et al., 2006) However,
of variation ranged from 7 to 9 %.
the study of apoptosis in different ovarian cell types,
Immunohistochemistry: Proliferative activity
especially during different stages of the oestrous cycle, is
was studied by detection of Ki-67 protein using avidin-
still needed. Therefore, the present study was aimed to
biotin-peroxidase complex (ABC) method as described
investigate cellular proliferation and apoptosis in
by Srisuwatanasagul et al. (2006). In brief, the antigen
different canine ovarian cells and at different stages of
retrieval technique was done by a microwave oven
the oestrous cycle by using immunohistochemistry and
technique at high power (750 W) in 0.01M citrate buffer,
TUNEL assay.
pH 6. The primary antibody used was a mouse monoclonal
antibody to Ki-67 protein (MIB-1, DakoCytomation,
Materials and Methods
Denmark) in a humidified chamber at room temperature
Tissue samples: Twenty four bitches, which were
(RT). The color was developed with 3,3'-diaminobenzidine
requested for ovariohysterectomy, were used in the
hydrochloride (DAB kit, Vector Lab, Inc., USA). All
present study. All bitches have reached puberty with no
sections were counterstained with Mayer’s hematoxylin.
pathological signs of the reproductive organs. The ages of
Sections treated with normal mouse immunoglobulin G
the bitches varied from 1 year to 5 years. The stages of
(IgG) (sc-2025, Santa Cruz Biotechnology Inc., USA)
the oestrous cycle were determined on the basis of
instead of the primary antibody, were used as negative
morphological appearance of the ovary and vaginal
controls. Normal canine intestine was served as positive
cytology. Besides, the serum was collected from each
control for Ki-67 immunostaining.
bitch prior to the surgery in order to determine oestradiol-
Detection of apoptosis by TUNEL assay: After
17β and progesterone level to confirm the oestrous cycle
being deparaffinized with xylene, the sections were
stages. According to these criteria, the bitches could be
rehydrated with graded alcohol and were washed in
classified into 4 groups: prooestrus (n=6), oestrus (n=6),
phosphate buffer saline (PBS, pH 7.4). The sections
dioestrus (n=6) and anoestrus (n=6).
were pretreated by the microwave oven at 700 W, 3 min
After surgery, the ovaries were immediately
3 times with the interval of 5 min after each heating.
collected and fixed in 4% paraformaldehyde for 24-36 hrs
The procedure for staining apoptotic nuclei was performed
at room temperature. Thereafter, they were histologically
using an ApopTag Peroxidase Kit (Chemicon International,
processed and embedded in paraffin. Then the 4 μm
Inc., CA, USA). Endogenous peroxidase activity was
®
quenched with an aqueous solution of 3% hydrogen
slides (Menzel-Glaser, Freiburg, Germany) for detection
peroxide for 5 min. After washing the sections in PBS,
of proliferation and apoptosis.
they were treated with equilibration buffer for 5 min at
thick sections were cut and placed on Superfrost Plus
Determination of hormone levels: Serum
RT and then incubated with TdT enzyme (diluted in a
oestradiol-17β concentrations were measured by
labeling reaction mix) for 1 hr at 37oC using parafilm
chemiluminescent immunoassay system, using
cover. Negative control sections were incubated with PBS
IMMULITE ® Estradiol kit (Diagnostic Products
instead of TdT working enzyme. Thereafter, a stop buffer
Corporation USA). The serum progesterone concentrations
was added for 10 min at RT, followed by washing in
were measured by using a commercial solid-phase
PBS and incubating with an anti-digoxigenin conjugate
progesterone radioimmunoassay (Coat-A-Count
for 30 min at RT. In order to visualize the labeled 3'-OH
Progesterone kitTM, Diagnostic Products Corporation,
ends of DNA fragments, 3,3'-diaminobenzidine was
CA, USA). The progesterone standards used were 0, 0.1,
used as a chromogen for 4 min. The slides were then
220
rinsed in distilled water, counterstained with Mayer’s
hematoxylin and mounted with glycerine gelatin.
Apoptosis: In all bitches examined, apoptotic cell
detected by TUNEL assay were completely absent in the
Microscopic evaluation: In each ovarian sample,
follicles, but were obvious in the granulosa cells of the
the follicles, corpora lutea, surface epithelium were
ovarian follicles (Figures 3 and 4B). Comparing between
evaluated. Follicles were divided into primary, secondary,
stages of the oestrous cycle, the difference was observed
tertiary and atretic follicles. The positive of Ki-67 as
only in secondary, tertiary and corpus lutea. The highest
well as positive TUNEL cells assay were determined by
apoptotic rate was significantly found in the granulosa
counting the cells presenting a brown nuclear staining or
cells of the secondary and the tertiary follicle at prooestrus,
brown apoptotic bodies. At least 100 cells of each cell
while the highest apoptotic cells in the corpora lutea were
types were counted at the magnification of 400x. If too
observed during dioestrus. Moreover, in some cell types
many cells were present, such as in the tertiary follicles
and at some stages of the oestrous cycle such as in the
and corpora lutea, 100 cells of five random areas (100x5
primary follicles at oestrus, dioestrus and anoestrus, no
fields) were counted. The results of apoptosis in the bitch
apoptotic cell were detected by TUNEL assay from the
ovary were presented as percentage of positive cells per
present study.
each cell type.
Statistic analyses: The difference of each ovarian
Discussion
cell types at different stages of the oestrous cycle were
In the present study, both Ki-67 protein and
analyzed by using general linear model (GLM) (version
TUNEL-positive cells could be detected in various
9, SAS Institute, Inc., 2002, Cary, NC, USA). The data
ovarian cell types. The most prominent staining of Ki-67
were subjected to Duncan’s test of multicomparison
and TUNEL assay was observed in the granulosa cells
among means. Results were considered to be significantly
of the different follicles while no positive staining was
different when p<0.05.
found in the germ cell. As proliferating cells tend to be
susceptible to apoptosis (Quirk et al., 2004), therefore
Results
The results of serum levels of oestradiol-17β
our results on the proliferation and apoptosis in the bitch
ovary were in agreement with this finding.
and progesterone were showed in figure 1. The level of
Regarding different stages of the oestrous cycle,
oestradiol-17β was high during prooestrus and oestrus,
high proliferative rate was found during prooestrus and
while the level of progesterone was high during dioestrus.
oestrus with low proliferative rate during dioestrus in
Proliferation: The Ki-67 positive cells were
almost all ovarian cell types. This may suggest that high
exclusively found in the nuclei of different ovarian cells
proliferative rate involved with high levels of oestrogen
(Figure 4A). The results of all ovarian cell types at
during prooestrus and oestrus. On the other hand, during
different oestrous stages were summarized in Figure 2.
dioestrus when the level of progesterone increased,
Regarding different ovarian cells, high proliferation was
proliferation was lower. These results from the
observed in the granulosa cells of various growing follicles
present study were in agreement with other studies on
while no Ki-67 positive cells were found in the corpus
proliferation in different species, which reported the
luteum nor in the follicle (germ cell). During the different
positive effects of oestrogen on cell proliferation
stages of the oestrous cycle, high proliferation was found
(Dorrington et al., 1993; Bai et al., 2000; Medh and
during proestrus and oestrus with low proliferative
Thompson, 2000; Quirk et al., 2004; Zhu and Pollard,
activity during dioestrus in almost all ovarian cells.
2007; Perniconi et al., 2008) and antiproliferative effect
with progesterone (Chaffkin et al., 1993) especially in
90
oestradiol-17β
progesterone ng/ml
80
70
221
cancer cells (Dai et al., 2002; Fauvet et al., 2006).
However, the influence of oestrogen and progesterone
on proliferation was cell type specific since different
60
50
ovarian cells showed different proliferative rates in spite
40
of the same level of plasma steroid hormone from the
30
present study.
20
In the corpus luteum, no proliferating cell was
10
0
Prooestrus
Oestrus
Dioestrus
found in this study and only small number of apoptotic
Anoestrus
cells were observed. This may indicate that the luteal cells
Figure 1 Serum levels of oestradiol-17β and progesterone
at the different stages of the oestrous cycle (Mean±SD).
may proliferate in a short period and would not be detected
by Ki-67 but may enter the apoptotic pathway for luteal
regression. In addition, Boos (1998) demonstated that
Proliferation of the bitch ovary
Prooestrus
Oestrus
Dioestrus
Anoestrus
20
luteal cellular proliferation was restricted mainly to theca
interna-derived cells and that Ki-67 positive cells were
mainly found in vascular walls and connective tissue of
15
the bovine corpus luteum. This may explain the result of
10
the present study which could not detect Ki-67 protein
in the bitch luteal cells at diestrus.
5
For apoptosis, the TUNEL assay, which detected
0
surface
primary
secondary
tertiary
corpus
atretic
epithelium
follicle
follicle
follicle
luteum
follicle
DNA fragmentation was used in the present study. In
comparison with the cascapse-3 assay, which can present
Figure 2 Proliferation of the different ovarian cell types
the DNA fragmentation only at the onset of the
during the stages of the oestrous cycle (Mean±SD).
apoptotic process, The TUNEL assay has the advantage
Different letters within the same category represented
of maintaining the DNA fragmentation. (D’Haeseleer
significantly different.
et al., 2006). The significantly higher rate of apoptosis was
detected in the granulosa cells of the secondary and
Apoptosis of the bitch ovary at different stages
of the oestrous cycle
12
tertiary follicle at prooestrus while the highest rate of
Prooestrus
Oestrus
Dioestrus
Anoestrus
10
8
This indicated that apoptosis varied among different
cells and different stages of the oestrous cycle as
6
suggested for cell proliferation. An earlier study in bovine
4
suggested that high progesterone level could trigger
2
0
apoptosis was found at dioestrus in the corpora lutea.
apoptosis in non-ovulatory tertiary follicle during the
surface
primary
secondary
tertiary
corpus
atretic
epithelium
follicle
follicle
follicle
luteum
follicle
oestrous cycle (Yang and Rajamahendran, 2000). However,
the results from the present study were different as
Figure 3 Apoptosis of the different ovarian cell types
higher apoptotic rate was always found during prooestrus
during the stages of the oestrous cycle (Mean±SD).
and oestrus, when the level of progesterone is low. These
Different letters within the same category represented
may account to the differences in the oestrous cycle as
significantly different.
well as ovulation patterns between these two species.
In addition, high proliferation was found in the bitches
222
Figure 4 Proliferation (A, C and E) and apoptosis (B, D and F) of the bitch ovary during prooestrus (A-B) and dioestrus
(C-F). Arrows represent positive staining cells while arrow heads represent negative staining cells in the granulosa cells
of ovarian follicles (A-D) and in the luteal cells (E and F). Scale bar = 100 μm.
223
Acknowledgement
during the stage of prooestrus and oestrus which should be
the reason why higher apoptotic rate was also needed
during these periods.
This study was supported by the faculty of
Veterinary Science research fund 2006 (grant number RG
Regarding corpus luteal regression, the study in the
22/2459). The authors would like to thank Dr. Panisara
bitch by Luz et al. (2006) suggested that apoptosis may
Kunkitti for some parts of sample collection and
not be the major mechanism involved in this phenomenon
Dr. Nutthee Am-in for statistical analyses.
as apoptotic cells were rarely detected. Our result was
similar. There were only few TUNEL positive cells in the
References
corpora lutea although they were significantly higher
Aiudi, G., Albrizio, M., Caira, M. and Cinone, M. 2006.
during dioestrus compared to the other stages. In contrast,
Apoptosis in canine corpus luteum during
another earlier study reported that apoptosis plays an
spontaneous and prostaglandin-induced luteal
important role in the bitch luteal regression (Aiudi et al.,
regression. Theriogenology. 66(6-7): 1454-1461.
2006). The disagreement between these two studies
Bai, W., Oliveros-Saunders, B., Wang, Q., Acevedo-
happened due to different methods of apoptosis evaluation
Duncan, M. E. and Nicosia, S. V. 2000. Estrogen
in the bitch luteal cells. Moreover, apoptotic changes may
stimulation of ovarian surface epithelial cell
occur much earlier before morphological changes of cell
proliferation. In Vitro Cell. Dev. Biol. Anim.
death; therefore, less apoptotic cells could be detected in
36(10): 657-666.
luteal regression mechanism. However, more investigation
Boos, A. 1998. Cellular proliferation in bovine luteal
was needed to clarify the mechanism of luteal regression
tissues of different reproductive states as
in the bitch ovary.
demonstrated by Ki-67 immunocytochemistry.
In general, apoptosis occurs at the highest
Ital. J. Anat. Embryol. 103(4 Suppl 1): 203-211.
frequency in proliferating tissues rather than quiescent
Chaffkin, L. M., Luciano, A. A. and Peluso, J. J. 1993. The
tissues in order to maintain the equilibrium between cell
role of progesterone in regulating human granulosa
growth and cell death (Guo and Hay, 1999; Schutte and
cell proliferation and differentiation in vitro. J.
Ramaekers, 2000). On the other hand, cells that have
Clin. Endocrinol. Metab. 76(3): 696-700.
exited the cell cycle are resistant to apoptosis. The finding
Concannon, P. W. 1986. Canine pregnancy and parturition.
from these earlier studies supported our results that the
Vet. Clin. North Am. Small Anim. Pract. 16(3):
highest proliferation and apoptosis were prominently
453-475.
found in the granulosa cells of the ovarian follicles
compared to luteal and ovarian surface epithelial cell.
Cushman, R. A., DeSouza, J. C., Hedgpeth, V. S. and Britt,
J. H. 2001. Alteration of activation, growth, and
In conclusion, the present study showed that
atresia of bovine preantral follicles by long-term
proliferation and apoptosis differed not only in different
treatment of cows with estradiol and recombinant
ovarian cell types, but also at different stages of the oestrous
bovine somatotropin. Biol. Reprod. 65(2): 581-586.
cycle, which may depend on the level of steroid hormones.
D’Haeseleer, M., Cocquyt, G., Van Cruchten, S., Simoens,
The granulosa cells of the ovarian follicles were the most
P. and Van den Broeck, W. 2006. Cell-specific
dynamic cells which undergo proliferation and apoptosis.
localisation of apoptosis in the bovine ovary at
Moreover, it was not completely clarified that apoptosis
different stages of the oestrous cycle. Theriogenology.
was the major mechanism involved in luteal regression in
65(4): 757-772.
the bitch ovary and therefore, further investigation was
needed.
Dai, D., Wolf, D. M., Litman, E. S., White, M. J. and
Leslie, K. K. 2002. Progesterone inhibits human
endometrial cancer cell growth and invasiveness:
down-regulation of cellular adhesion molecules
224
through progesterone B receptors. Cancer Res.
62(3): 881-886.
Dorrington, J. H., Bendell, J. J. and Khan, S. A. 1993.
Monniaux, D., Huet, C., Besnard, N., Clement, F.,
Bosc, M., Pisselet, C., Monget, P. and Mariana, J. C.
1997. Follicular growth and ovarian dynamics
Interactions between FSH, estradiol-17 beta and
in mammals. J. Reprod. Fertil. Suppl. 51: 3-23.
transforming growth factor-beta regulate growth
Perniconi, S. E., Simoes Mde, J., Simoes Rdos, S., Haidar,
and differentiation in the rat gonad. J. Steroid
M. A., Baracat, E. C. and Soares, J. M., Jr. 2008.
Biochem. Mol. Biol. 44(4-6): 441-447.
Proliferation of the superficial epithelium of ovaries
Fauvet, R., Dufournet Etienne, C., Poncelet, C., Bringuier,
in senile female rats following oral administration of
A. F., Feldmann, G. and Darai, E. 2006. Effects of
conjugated equine estrogens. Clinics. 63(3): 381-388.
progesterone and anti-progestin (mifepristone)
Quirk, S. M., Cowan, R. G., Harman, R. M., Hu, C. L. and
treatment on proliferation and apoptosis of the
Porter, D. A. 2004. Ovarian follicular growth and
human ovarian cancer cell line, OVCAR-3. Oncol.
atresia: the relationship between cell proliferation
Rep. 15(4): 743-748.
and survival. J. Anim. Sci. 82 E-Suppl: E40-52.
Feranil, J., Isobe, N. and Nakao, T. 2005. Apoptosis in
Scholzen, T. and Gerdes, J. 2000. The Ki-67 protein:
the antral follicles of swamp buffalo and cattle
from the known and the unknown. J. Cell. Physiol.
ovary: TUNEL and caspase-3 histochemistry.
182(3): 311-322.
Reprod. Domest. Anim. 40(2): 111-116.
Feranil, J. B., Isobe, N. and Nakao, T. 2004. Cell
proliferation in the atretic follicles of buffalo and
Schutte, B. and Ramaekers, F. C. 2000. Molecular switches
that govern the balance between proliferation and
apoptosis. Prog. Cell Cycle Res. 4: 207-217.
cattle ovary. Reprod. Domest. Anim. 39(6): 405-409.
Slomczynska, M., Tabarowski, Z., Duda, M., Burek, M.
Guo, M. and Hay, B. A. 1999. Cell proliferation and
and Knapczyk, K. 2006. Androgen receptor in early
apoptosis. Curr. Opin. Cell Biol. 11(6): 745-752.
Isobe, N. and Yoshimura, Y. 2000. Immunocytochemical
apoptotic follicles in the porcine ovary at pregnancy.
Folia Histochem. Cytobiol. 44(3): 185-188.
study of cell proliferation in the cystic ovarian
Srisuwatanasagul, S., Srisuwatanasagul, K. and
follicles in cows. Theriogenology. 54(7): 1159-1169.
Sirividayapong, S. 2006. Progesterone Receptors
Luz, M. R., Cesario, M. D., Binelli, M. and Lopes, M. D.
and Proliferation in the Bitch Uterus during
2006. Canine corpus luteum regression: apoptosis
Different Stages of Different Stages of the Oestrous
and caspase-3 activity. Theriogenology. 66(6-7):
Cycle. Thai J. Vet. Med. 36(3): 45-54.
1448-1453.
Maruo, T., Laoag-Fernandez, J. B., Takekida, S., Peng, X.,
Deguchi, J., Samoto, T., Kondo, H. and Matsuo, H.
Tabarowski, Z., Szoltys, M., Bik, M. and Slomczynska,
M. 2005. Atresia of large ovarian follicles of the rat.
Folia Histochem. Cytobiol. 43(1): 43-50.
1999. Regulation of granulosa cell proliferation
Yang, M. Y. and Rajamahendran, R. 2000. Involvement of
and apoptosis during follicular development.
apoptosis in the atresia of nonovulatory dominant
Gynecol. Endocrinol. 13(6): 410-419.
follicle during the bovine estrous cycle. Biol.
McDougall, K., Hay, M. A., Goodrowe, K. L., Gartley, C.
Reprod. 63(5): 1313-1321.
J. and King, W. A. 1997. Changes in the number of
Yuan, W. and Giudice, L. C. 1997. Programmed cell death
follicles and of oocytes in ovaries of prepubertal,
in human ovary is a function of follicle and corpus
peripubertal and mature bitches. J. Reprod. Fertil.
luteum status. J. Clin. Endocrinol. Metab. 82(9):
Suppl. 51: 25-31.
3148-3155.
Medh, R. D. and Thompson, E. B. 2000. Hormonal
Zhu, L. and Pollard, J. W. 2007. Estradiol-17beta
regulation of physiological cell turnover and
regulates mouse uterine epithelial cell proliferation
apoptosis. Cell Tissue Res. 301(1): 101-124.
through insulin-like growth factor 1 signaling.
Proc. Natl. Acad. Sci. U. S. A. 104(40): 15847-15851.
Jongjareanjai M. et al./Thai J. Vet. Med. 39(3): 225-229.
225
Original Article
In vitro Antibiotic Susceptibility of Aeromonas hydrophila
Isolated From Disease Ornamental Fish
Malinee Jongjareanjai* Nongnut Assawawongkasem Nantarika Chansue
Abstract
Thirty bacterial isolates were derived from ornamental fish patients (n=30) of the Veterinary Medical
Aquatic Animal Research Center (VMARC), Faculty of Veterinary Science, Chulalongkorn University. The
isolated bacterial strains were identified by using commercial biochemical identification kit (API Kits, bioMerieux®
SA France). The antibiotics susceptibility testing was performed by disc diffusion method, using 24 types of
antibiotic discs (OXOID, Oxoid Ltd, UK). The result showed that the majority of the isolated bacteria was Aeromonas
hydrophila (27/30). In the A. hydrophila susceptibility study, 66.30% of bacteria were antibiotic resistant, 9.35%
were intermediately sensitive and 24.35% were sensitive strains against the tested antibiotics. Chloramphenicol
showed the highest efficacy against the bacterial strains tested. Other effective antibiotics included
sulphamethoxazole-trimetroprim and amikacin. 100% of the isolated bacteria showed resistance to metronidazole,
92.31 were resistant to penicillin and amoxicillin. It is noticeable that there were large numbers of antibiotic
resistance fish pathogenic bacteria in ornamental fish, which indicated that the risk of ineffective antibiotic
treatment without laboratory susceptibility test in sick fish would be at least 75.65% in doubt.
Keywords : antibiotic, bacteria, ornamental fishes, sensitivity.
Veterinary Medical Aquatic Research Center, Department of Veterinary Medicine, Faculty of Veterinary Science, Chulalongkorn University,
Henry-Dunant Rd., Pathumwan, Bangkok, 10330, Thailand.
*
Thai J. Vet. Med., 2009. 39(3): 225-229
226
∫∑§—¥¬àÕ
º≈∑¥ Õ∫§«“¡‰«√—∫¢Õß‡™◊ÈÕ Aeromonas hydrophila μàÕ¬“ªØ‘™’«π–∑’Ë‰¥â®“°ª≈“
«¬ß“¡ªÉ«¬
¡“≈‘π’ ®ß‡®√‘≠„®* πßπÿ™ Õ—»««ß»å‡°…¡ π—π∑√‘°“ ™—π´◊ËÕ
°“√»÷°…“‡æ“–·¬°‡™◊ÈÕ·∫§∑’‡√’¬ 30 μ—«Õ¬à“ß®“°ª≈“ «¬ß“¡ªÉ«¬ (n=30) ∑’Ë‰¥â®“°»Ÿπ¬å«‘®—¬‚√§ —μ«åπÈ” (VMARC)
®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬ ‚¥¬«‘π‘®©—¬·¬°‡™◊ÈÕ¥â«¬™ÿ¥∑¥ Õ∫§ÿ≥ ¡∫—μ‘¢Õß‡™◊ÈÕ∑“ß™’«‡§¡’ ”‡√Á®√Ÿª API Kits bioMerie® SA
France) ·≈–∑¥ Õ∫§«“¡‰«¢Õß‡™◊ÈÕμàÕ¬“ªØ‘™’«π– 24 ™π‘¥¥â«¬·ºàπ∑¥ Õ∫ ”‡√Á®√Ÿª (OXOID, Oxoid Ltd, UK) º≈
°“√»÷°…“æ∫«à“‡™◊ÈÕ·∫§∑’‡√’¬∑’Ëæ∫¡“°∑’Ë ÿ¥„πª≈“ «¬ß“¡§◊Õ Aeromonas hydrophila (27/30) ‡¡◊ËÕ∑¥ Õ∫§«“¡‰«¢Õß‡™◊ÈÕ
A.hydrophila μàÕ¬“ªØ‘™’«π–‚¥¬‡∑’¬∫‡ªìπ —¥ à«πæ∫«à“μ—«Õ¬à“ß‡™◊ÈÕ∑—ÈßÀ¡¥¡’§«“¡¥◊ÈÕ√âÕ¬≈– 66.30 ¡’§«“¡‰«ª“π°≈“ß
√â Õ ¬≈– 9.35 ·≈–¡’ § «“¡‰«√â Õ ¬≈– 24.35 μà Õ ¬“ªØ‘ ™’ « π–∑’Ë ∑ ¥ Õ∫ ‚¥¬„π°“√»÷ ° …“π’È æ ∫«à “ ¬“ chloramphenicol ¡’
ª√– ‘∑∏‘¿“æ„π°“√μàÕμâ“π‡™◊ÈÕ·∫§∑’‡√’¬∑’Ë·¬° ·≈–æ‘ Ÿ®πå‰¥â¡“°∑’Ë ÿ¥ ≈”¥—∫∂—¥¡“§◊Õ sulphamethoxazole-trimetroprim
·≈– amikacin „π∑“ßμ√ß¢â“¡ metronidazole ‡™◊ÈÕ¡’§«“¡¥◊ÈÕμàÕ¬“√âÕ¬≈– 100 ·≈–¡’§«“¡¥◊ÈÕμàÕ¬“ penicillin ·≈– amoxicillin
√âÕ¬≈– 92.31 °“√»÷°…“π’È· ¥ß„Àâ‡ÀÁπ∂÷ßÕ—μ√“°“√¥◊ÈÕμàÕ¬“ªØ‘™’«π–∑’Ë¡’ Ÿß¢Õß‡™◊ÈÕ‚√§„πª≈“ «¬ß“¡ ·≈–¡’‚Õ°“ º‘¥æ≈“¥®“°
°“√„™â¬“ªØ‘™’«π–Õ¬à“ßπâÕ¬√âÕ¬≈– 75.65 À“°‰¡à¡’°“√∑¥ Õ∫§«“¡‰«¢Õß‡™◊ÈÕμàÕ¬“°àÕπ°“√„™â√—°…“
§” ”§—≠ : ¬“ªØ‘™’«π– ·∫§∑’‡√’¬ ª≈“ «¬ß“¡ §«“¡‰«√—∫
»Ÿπ¬å«‘®—¬‚√§ —μ«åπÈ” ¿“§«‘™“Õ“¬ÿ√»“ μ√å §≥– —μ«·æ∑¬»“ μ√å ®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬ ∂ππÕ—ß√’¥Ÿπ—ßμå ª∑ÿ¡«—π °√ÿß‡∑æœ 10330
*
Introduction
Bacterial disease is one of the most important
freshwater ornamental fish from aquarium shops in
Malaysia was mostly A. hydrophila (60%).
diseases in ornamental fishes and a significant cause of
Antibiotics have been used for treatment and
high fish morbidity and mortality rates (Barker, 2001).
prevention of bacterial diseases, but the success of
Different pathogenic, especially, gram negative bacteria
treatment depends on antibiotic susceptibility of etiologic
has been reported to be isolated from naturally-infected
bacteria (Yanong, 2006). Bacterial resistance is an
fish. Many stress factors could contribute to bacterial
important issue that needs to be considered when
infection in ornamental fish, namely, poor water quality,
choosing an appropriate antibiotic. While it may be
crowding, transportation and inadequate nutrition. (Musa
necessary to start treatment course based on personal
et al., 2008)
experience, it is also prudential to have bacterial
A. hydrophila is also considered a normal flora as
identification and antibiotic sensitivity tests carried out at
well as a primary and secondary fish pathogen, including
the same time. However, field trials and antibiotics
ornamental fish (Austin and Austin, 1999). Hettiarachchi
susceptibility profiles are essential for effective treatment.
and Cheong (1994) described A. hydrophila as the major
In this study, an in vitro screening of a wide range
cause of disease in freshwater ornamental fish. The
of antibiotics was carried out to investigate their potential
clinical signs are presence of eroded fins, hemorrhages
efficiency against bacteria isolated from diseased
on the skin and at the base of the caudal fin, sloughing
ornamental fish. The objectives of this study were to
scales and hemorrhaging intestinal wall. Also, Musa et al.
investigate the prevalence of pathogenic bacterial species
(2008) reported that bacterial isolated from sick
and to evaluate the antibiotic susceptibility profile of
227
major bacterial pathogens causing ornamental fish
zone radius was scaled from the center of the antibiotic
diseases in Thailand.
disc to the end of the clear inhibition zone. Zone diameters
were interpreted as sensitive, intermediate and resistant
according to the clinical and laboratory standard Institute
Bacteria isolation: The bacterial isolates used in this
(CLSI, 2005)
study were derived from 30 ornamental fish patients (1
Results
isolate was taken from 1 fish) brought by owner into the
Veterinary Medical Aquatic Animal Research Center
From this study, the result showed that the majority
(VMARC), Faculty of Veterinary Science, Chulalongkorn
of the isolated bacteria was Aeromonas hydrophila (27/
University, Thailand for diagnosis and treatment during
30). One strain of Enterococcus durans, Flavobacterium
2008. The samples were collected from the lesions and
sp. and Serratia marcescens were also isolated from sick
isolated by standard biological methods using blood agar
ornamental fish.
and Müeller-Hinton agar. The isolated bacterial strains
Figure 1 showed the antibiogram of the A.
were identified using an appropriate type of commercial
hydrophila isolates (n=27) against 24 types of antibiotics.
biochemical identification kit (API20E or API20Strep or
In the present study, there were 66.30% cases of antibiotic
®
API20NE kits, bioMerieux SA France).
resistance, 9.35 % of intermediate sensitivity and 24.35%
Antibiotic susceptibility: The antibiotic test discs
cases of sensitive bacterial strains against the tested
(OXOID, Oxoid Ltd, UK) with their concentrations shown
antibiotics. The data indicated that 100% of the bacteria
were used to detect antibiotic susceptibility of bacterial
tested were resistant to metronidazole, 92.31% were
isolates as follow: penicillin (P) 10 U, erythromycin (E)
resistant to penicillin and amoxicillin, 88.89% were
15μg, kanamycin (K) 30 μg, streptomycin (S) 10 μg,
resistant to colistin, 84.62% were resistant to
chloramphenicol (C) 30 μg, nalidixic acid (NA) 30 μg,
oxytretacycline, 83.33% were resistant to ampicillin,
nitrofurantoin (F) 300 μg, sulphamethoxazole-trimetroprim
81.82% were resistant to tetracycline, 80.95% were
(SXT) 25 μg, gentamicin (CN) 10 μg, neomycin (N) 10
resistant to neomycin, and 80.0% were resistant to
μg, oxolinic acid (OA) 2 μg, tetracycline (TE) 30 μg,
novobiocin.
furazolidone (FR) 15 μg, oxytetracycline (OT) 30 μg,
Chloramphenicol showed the highest efficacy
novobiocin (NV) 30 μg, ampicillin (AMP) 10 μg, colistin
against the bacterial strains tested (59.09% sensitive and
(CT) 10 μg, cephalothin (KF) 30 μg, norfloxacin (NOR)
31.82% resistant). Other effective antibiotics were
10 μg, ciprofloxacin (CIP) 5 μg, enrofloxacin (ENR) 5 μg,
sulphamethoxazole-trimetroprim (58.33% susceptibility
amoxycillin (AML) 10 μg, amikacin (AK) 30 μg and
and 41.67% resistant), amikacin (50.00% sensitive
metronidazole (MT) 2 μg.
and 50.00% resistant).
Antibiotic susceptibility test was performed by
disc diffusion method in Müeller-Hinton agar plates.
Discussion
Then, they were inoculated with 0.1 ml isolated bacteria
Aeromonas hydrophila was the dominant specie
which had been cultured in glucose-supplemented (1%)
(89.66%) found as the cause of bacterial disease in
nutrient broth for 18 hrs. Antibiotic-impregnated discs
ornamental fish investigated in this study. A. hydrophila
o
were placed on the solid medium and incubated at 30 C
has been the most common bacteria associated with
for 24 hrs. Then zones of inhibition formed around the
aquatic animal disease (Barker, 2001). In Malaysia
disc were measured. Antibiotic susceptibility was
aquarium shop, 60% of A. hydrophila were isolated from
determined by the diameter size of the clear zone. The
sick freshwater ornamental fish (Musa et al, 2008). and
228
Resistant
Intermediate
Susceptible
NOR
CIP
ENR
AML
AK
MT
Figure 1 Distribution of bacterial susceptibility to antibiotics (%). P: penicillin, E; erythromycin, K: kanamycin,
S: streptomycin, C: chloramphenicol, NA; nalidixic acid, F: nitrofurantoin, SXT: sulphamethoxazole-trimetroprim, CN:
gentamicin, N: neomycin, OA: oxolinic acid, TE: tetracycline, FR: furazolidone, OT: oxytetracycline, NV: novobiocin,
AMP: ampicillin, CT: colistin, KF: cephalothin, NOR: norfloxacin, CIP: ciprofloxacin, ENR: enrofloxacin,
AML: amoxycillin, AK: amikacin, MT: metronidazole.
in the prevalence study of fish and prawn from south India
market, 33.5% and 17.6% of A. hydrophila were isolated,
respectively (Vivekananandhan et al., 2002).
From the present study, Chloramphenicol was
found to be more effective in inhibiting growth of the
A. hydrophila isolates than other drugs therefore, it
would be the first drug of choice in application except
for the adverse effects and unsuitabilities for food fish.
The second drugs of choice were sulphamethoxazoletrimetroprim and amikacin, respectively. On the contrary,
metronidazole and colistin would not be recommended
for use as antibacterial drugs of choice (100% resistant)
while penicillin and amoxicillin were similar (92.31%
resistant). Normally, enrofloxacin and oxytretacyclin
were widely used for treatment of bacterial infection in
aquatic animals as the drug of choice, but this study showed
that enrofloxacin (37.04% susceptibility and 51.85%
resistant), and oxytretacyclin (11.54% susceptibility and
84.62% resistant) had poor efficacy to eliminate the
bacteria.
Our studies also revealed that all bacterial strains
had some level of antibiotic resistance. This might
indicate antibiotic misuse in aquatic animals. The results
showed that none of the tested drugs yielded over 59.09%
sensitivity. The minimum resistance of the drugs was as
high as 31.82%. Also, the average antibiotic resistance in
this study was as high as 66.30% % and only 24.35% were
sensitive against the tested antibiotics. This indicated
that the risk of ineffective antibiotic treatment without
laboratory susceptibility test in sick fish would be at least
75.65% in doubt. This would be considered as a high level
of resistance compared to previous reports. Musa et al.
(2008) showed average antibiotic resistance in ornamental
fish to be 41.85% with 23% intermediary and 34.5%
sensitive cases. The report on drug resistance of motile
Aeromonas sp. of fresh water fish farm by Hatha et al.
(2005) showed that 100% of the bacteria tested were
resistant fish bacterial pathogens to ampicillin, 94.5% were
resistant to novobiocin, 52.7% were resistant to amoxicillin
and 40% were resistant to oxytetracycline. However,
resistance to chloramphenicol, gentamicin and nalidixic
acid (5.5, 7.3 and 1.8% resistance, respectively) were
lower in their studies compared to the present study. It is
noticeable that the high level of antibiotic resistance
fish bacterial pathogens in Thailand may be due to the
ineffective control on the use of fish medicine. Norvick
(1981) stated that the subtherapeutic use of antibiotics in
animal husbandry practice has promoted the emergence
and maintenance of multiple antibiotic resistant (MAR)
pathogenic bacteria. There was overall increase in drug
resistance, fish-pathogens in parallel with the extensive
use of chemotherapeutic agent in Japan (Aoki, 1992).
The development of high antibiotic resistance trend create
a great deal of difficulty of the treatment of bacterial
infections in fish. Both high antibiotic resistant bacterial
strains and antibiotic residues may contaminate natural
environments, thus potentially integrated into human and
other animal food chains which should not be overlooked
in all parties concerned.
Acknowledgements
Many thanks to Ms.Krittima Anekthanakul for
her advice and assistance in the preparation of this
manuscript. We are most grateful for Assoc. Prof.
Dr. Jirasak Tangtrongpiros for the advice and support.
229
We are also thankful for Dr. Sarunsiri Nuanmanee for
all the help throughout this study.
References
Aoki, T. 1992. Chemotherapy and drug resistance in fish
farms in Japan. In: Diseases in Asian Aquaculture
Vol. I. M. Shariff, R.P. Subasinghe and J.R. Arthur
(eds.). Philippines: Fish Health Section, Asian
Fisheries Society. 519-529.
Austin, B. and Austin, D.A. 1999. Bacterial fish pathogen:
disease of farm and wild fish. 3rd ed. Springer-Praxis
19-21.
Barker, G. 2001. Bacterial diseases. In: BSAVA manual
of ornamental fish. W.H. Wildgoose (ed). Spain:
British Small Animal Veterinary Association.
185-194.
Clinical and Laboratory Standards Institute. 2005.
Performance standards for antimicrobial disk
susceptibility tests. 8th ed. CLSI M02-A8.
Hatha, M., Vivekanandhan, A.A., Joice, G.J. and Christol.
2005. Antibiotic resistance pattern of motile
aeromonads from farm raised fresh water fish. Int.
J. Food Microbiol. 98: 131-134.
Hettiarachchi, D.C and Cheong, C.H. 1994. Some
characteristics of Aeromonas hydrophila and Vibrio
species isolated from bacterial disease outbreaks
in ornamental fish culture in Sri Lanka. J. Nat. Sci.
Council. Sri Lanka. 22: 261-269.
Musa, N., Wei, S.L., Shaharom, F. and Wee, W. 2008.
Surveillance of bacteria species in diseased
freshwater ornamental fish from aquarium shop.
World Appl. Sci. J. 3: 903-905.
Novick, R.P. 1981. The development and spread of
antibiotic resistant bacteria as a consequence of
feeding antibiotics to livestock. Ann. N.Y. Acad. Sci.
368: 23-59.
Vivekanandhan, G. Savithamani, K., Hatha, A.A.M.
and Lakshmanaperumalsamy, P. 2002. Antibiotic
resistance of Aeromonas hydrophila isolated
from marketed fish and prawn of South India. Int. J.
Food Microbiol. 76: 165-168.
Yanong, R.P.E. 2006. Use of antibiotics in ornamental
fish aquaculture. A series from the Department of
Fisheries and Aquatic Sciences, Florida Cooperative
Extension Service, IFAS extension, University of
Florida. Circular 84.
Chansiripornchai N./Thai J. Vet. Med. 39(3): 231-236.
231
Original Article
Comparative Efficacy of Enrofloxacin and Oxytetracycline by
Different Administration Methods in Broilers after
Experimental Infection with Avian Pathogenic Escherichia coli
Niwat Chansiripornchai
Abstract
The aims of this study were to compare the efficacy of 2 kinds of antibiotics that are commonly used in
the Thai broiler industry and to determine the optimal times of drug administration. One hundred and sixty,
21-day-old broilers were divided into eight groups. Chickens in groups 1, 2 and 3 were challenged with avian
pathogenic E. coli (APEC) and received oxytetracycline for the first 3 days after infection via oral, drinking water
within 2 h and drinking water throughout the day, respectively. The chickens in groups 4, 5 and 6 were challenged
with APEC and received enrofloxacin for the first 3 days after infection via oral, drinking water within 2 h and
drinking water throughout the day, respectively. The chickens in group 7 and 8 served as positive and negative
control groups. Enrofloxacin treated chickens showed better results in feed conversion ratio, mortality, gross
pathology and bacterial isolation than those treated with oxytetracycline (p<0.05). Infections of chickens with
APEC can be treated with the enrofloxacin. Oral administration provided a better protection than drinking water
within 2 h and drinking water throughout the day, respectively.
Keywords : avian pathogenic E. coli, broilers, drug administration, enrofloxacin, oxytetracycline.
Avian Health Research Unit, Department of Veterinary Medicine, Faculty of Veterinary Science, Chulalongkorn University, 39 Henri Dunant
road, Bangkok 10330, Thailand.
Corresponding author E-mail:[email protected]
Thai J. Vet. Med., 2009. 39(3): 231-236
232
∫∑§—¥¬àÕ
°“√‡ª√’¬∫‡∑’¬∫ª√– ‘∑∏‘¿“æ¢Õß‡Õπ‚√ø≈Õ°´“´‘π·≈–ÕÕ°´’‡μμ√“´—¬§≈‘π„π°“√∫√‘À“√
¬“∑’Ë·μ°μà“ß°—π„π‰°à‡π◊ÈÕ¿“¬À≈—ß°“√μ‘¥‡™◊ÈÕ ‡Õ ‡™Õ√‘‡™’¬ ‚§‰≈ °àÕ‚√§„π —μ«åªï°
π‘«—μ√ ®—π∑√å»‘√‘æ√™—¬
°“√∑¥≈Õßπ’È¡’«—μ∂ÿª√– ß§å„π°“√‡ª√’¬∫‡∑’¬∫ª√– ‘∑∏‘¿“æ¢Õß¬“ªØ‘™’«π– 2 ™π‘¥ ´÷Ëßæ∫°“√„™â∫àÕ¬„πÕÿμ “À°√√¡
‰°à‡π◊ÈÕ„πª√–‡∑»‰∑¬ ·≈–‡æ◊ËÕÀ“™à«ß‡«≈“∑’Ë‡À¡“– ¡„π°“√∫√‘À“√¬“ ‚¥¬π”‰°à‡π◊ÈÕÕ“¬ÿ 21 «—π ®”π«π 160 μ—« ·∫àßÕÕ°‡ªìπ
8 °≈ÿà¡ °≈ÿà¡ 1 2 ·≈– 3 ‰¥â√—∫‡™◊ÈÕ Õ’. ‚§‰≈ °àÕ‚√§„π —μ«åªï° ·≈–‰¥â√—∫ÕÕ°´’‡μμ√“´—¬§≈‘πμ‘¥μàÕ°—π 3 «—π ‚¥¬°“√ªÑÕπª“°
°“√≈–≈“¬πÈ”¥◊Ë¡¿“¬„π 2 ™—Ë«‚¡ß·≈–°“√≈–≈“¬πÈ”¥◊Ë¡μ≈Õ¥«—π μ“¡≈”¥—∫ ‰°à°≈ÿà¡ 4 5 ·≈– 6 ‰¥â√—∫‡™◊ÈÕ Õ’. ‚§‰≈ °àÕ‚√§„π —μ«åªï°
·≈–‰¥â√—∫‡Õπ‚√ø≈Õ°´“´‘πμ‘¥μàÕ°—π 3 «—π ‚¥¬°“√ªÑÕπª“° °“√≈–≈“¬πÈ”¥◊Ë¡¿“¬„π 2 ™—Ë«‚¡ß·≈–°“√≈–≈“¬πÈ”¥◊Ë¡μ≈Õ¥«—π
μ“¡≈”¥—∫ ‰°à°≈ÿà¡ 7 ·≈– 8 ‡ªìπ‰°à°≈ÿà¡§«∫§ÿ¡∫«°·≈–≈∫ μ“¡≈”¥—∫ ‰°à∑’Ë‰¥â√—∫‡Õπ‚√ø≈Õ°´“´‘π æ∫Õ—μ√“·≈°‡π◊ÈÕ Õ—μ√“μ“¬
¡Àæ¬“∏‘«‘∑¬“·≈–°“√·¬°‡™◊ÈÕ·∫§∑’‡√’¬¥’°«à“‰°à∑’Ë‰¥â√—∫ÕÕ°´’‡μμ√“´—¬§≈‘π (p<0.05) °“√μ‘¥‡™◊ÈÕ Õ’. ‚§‰≈ °àÕ‚√§„π —μ«åªï°
“¡“√∂√—°…“¥â«¬‡Õπ‚√ø≈Õ°´“´‘π °“√∫√‘À“√¬“‚¥¬°“√ªÑÕπª“°„Àâ°“√ª°ªÑÕß∑’Ë¥’°«à“°“√≈–≈“¬πÈ”¥◊Ë¡¿“¬„π 2 ™—Ë«‚¡ß ·≈–
°“√≈–≈“¬πÈ”¥◊Ë¡μ≈Õ¥«—π μ“¡≈”¥—∫
§” ”§—≠ : Õ’. ‚§‰≈ °àÕ‚√§„π —μ«åªï° ‰°à‡π◊ÈÕ °“√∫√‘À“√¬“ ‡Õπ‚√ø≈Õ°´“´‘π ÕÕ°´’‡μμ√“´—¬§≈‘π
Àπà«¬ªØ‘∫—μ‘°“√«‘®—¬ ÿ¢¿“æ —μ«åªï° ¿“§«‘™“Õ“¬ÿ√»“ μ√å §≥– —μ«·æ∑¬»“ μ√å ®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬ ∂.Õ—ß√’¥Ÿπ—ßμå ª∑ÿ¡«—π °√ÿß‡∑æœ 10330
ª√–‡∑»‰∑¬
*
ºŸâ√—∫º‘¥™Õ∫∫∑§«“¡ E-mail:cniwat @chula.ac.th
Introduction
gram negative bacteria antibiotics. However, poultry
Colibacillosis is an important infectious disease in
veterinarians have a limited choice of efficacious
chickens especially broilers that can cause major economic
antimicrobials to relieve pain and suffering. Moreover,
loss in the Thai poultry industry (Chansiripornchai
the repeated applications of antibiotics can increase the
and Sasipreeyajan, 2002a). Colibacillosis is caused by
rate of bacterial resistance to the antibiotics. The antibiotic
Escherichia coli (E. coli) which is a gram negative
resistance of APEC isolated in Thailand during 1990-1995
bacterium. The bacteria, generally, can be found in the
revealed that more than 80% of the isolates were
intestines of many kinds of animal species, but pathogenic
resistant to nalidixic acid, oxolinic acid, sulfamethoxasole+
serotypes of E. coli could be found around 10-15% of
trimethoprim, sulfadiazine, oxytetracycline, tetracycline,
the total bacteria of healthy chickens’ intestines. Also, the
kanamycin, novobiocin and erythromycin and anti-
specific serotype found in intestines, may differ from the
bacterial resistance was low for the third generation of
serotype found in the pericardial sac in one chicken. All
quinolone groups such as norfloxacin, danofloxacin and
ages of poultry are susceptible to infection with avian
enrofloxacin (Chansiripornchai et al., 1995). This report
pathogenic E. coli (APEC) but the most seriously affected
agrees with other researchers using the third generation
are birds of 4 to 5 weeks old (Chansiripornchai et al.,
quinolones for the treatment of E. coli infections (Bauditz,
1995). Generally, APEC is a complicated infection of
1987; Scheer, 1987; Chansiripornchai and Sasipreeyajan,
the respiratory system following a former infection by
2002b). In any case, the administration techniques of the
Mycoplasma gallisepticum. Colibacillosis can be
drug delivery are also important in achieving the most
prevented and treated by broad spectrum antibiotics or
effective treatment by antibiotics of bacterial infection.
233
Most farmers apply the drug once, twice a day or available
Medication: Oxytetracycline and enrofloxacin (F.E.
throughout the day for at least 3 consecutive days. The
Pharma Co. Ltd, Thailand) were administered orally at
aims of this study were to compare the efficacy of 2
concentrations of 30 and 10 mg/kg live weight/day,
kinds of antibiotics that are commonly used in the Thai
respectively, to the chickens or in their drinking water for
broiler industry and to determine the optimal time of drug
3 consecutive days after infection. The water intake of
administration.
the birds was measured before the experiments were
commenced, so the approximate water intake of the
chickens was known and the quantity of the drug to be
Chickens: Unvaccinated Arbor Acres broiler-type chicks
dissolved in the water to give a known average intake of
of mixed sex were obtained on the day of hatching from a
drug per kg live weight of the chickens could be
commercial hatchery (Krungthai farm, Thailand). The
calculated. Before administration of the drugs, the water
chickens were fed ad libitum before and during the
was withdrawn for an hour before giving the medicated
experiments. At the onset of the experiments (21-days
water. The withdrawal periods resulted in birds being
old), there was no statistically significant difference in
sufficiently thirsty to consume all the medicated water
the average weight of the experimental groups (p>0.05).
within two hours. The medicated water was substituted
The guidelines and legislative regulations on the use
by unmedicated water immediately after all the water had
of animals for scientific purposes of Chulalongkorn
been drunk.
University, Bangkok, Thailand were followed as is
Experimental designs: One hundred and sixty, 21-day-
certified in permission no. 0831068.
old broilers were divided into eight groups of 20 birds,
Bacterial strain: The chickens were challenged with an
with each group subdivided into 2 replicates of 10 birds.
APEC strain of serotype O78 that was originally isolated
The chickens in groups 1-3 were challenged with APEC
from the air sacs of diseased chickens with a field case of
and administered with oxytetracycline twice a day; via oral,
colisepticemia (Chansiripornchai and Sasipreeyajan,
drinking water within 2 h and drinking water throughout
a
2002 ). The challenge strain was tested by disc diffusion
the day. The chickens in groups 4-6 were challenged with
test (Bauer et al., 1966; Chansiripornchai et al., 1995)
APEC and administered with enrofloxacin twice a day;
before an animal experiment had been performed. The
via oral, drinking water within 2 h and drinking water
result revealed that the challenge strain of APEC is
throughout the day. The chickens in groups 7 and 8 served
resistant to oxytetracycline (Oxoid, Hampshire, UK) and
as positive and negative control groups, respectively.
sensitive to enrofloxacin (Oxoid, Hampshire, UK). The
The broilers were euthanized at 28 days of age.
challenge material was a logarithmic-phase culture
Observed parameters and analysis: The feed conversion
produced by 10-h of static incubation of APEC in nutrient
ratio (FCR) and mortality were recorded for seven days
broth. Sekizaki et al. (1989) showed that this E. coli
following the infection of the chickens with APEC.
serotype produced high mortality in a very short time.
The pathological lesions in the dead chickens were
Each bird in every group except for the negative control
investigated at necropsy. After seven days, the surviving
group were injected with 0.3 ml of the E. coli suspension,
chickens were euthanized and APEC was isolated from
8
containing 10 cfu/ml. The APEC suspension was
their livers and identified by standard culture media and
injected into the right caudal thoracic air sac of the
biochemical tests. The ANOVA and Duncan multiple
infected chickens.
range test were used for statistical comparison of the
groups by SPSS for window.
234
Results
pericarditis, peritonitis and perihepatitis were found in
Feed conversion ratio: The broilers received enrofloxacin
chickens that received oxytetracycline, which was similar
had significantly better FCR than broilers received either
to the positive control group. Chickens that received
oxytetracycline or no medication (p<0.05). The broilers
enrofloxacin did not have different percentages of
in the positive control group showed the worst FCR. On
airsacculitis, pericarditis, peritonitis and perihepatitis
the other hand, the broilers in the negative control group
from those in the negative control group. The highest
revealed better FCR than all groups, which was similar to
bacterial culture of the livers was found in the positive
group 4. FCR of broilers received oxytetracycline
control group and this was followed by all the groups of
orally showed better results than broilers that received
the oxytetracycline treatment. The bacteria isolated from
oxytetracycline via drinking water within 2 h and
the livers of the enrofloxacin groups were significantly
drinking water throughout the day, respectively. The FCR
less than the bacteria isolated from the oxytetracycline and
of broilers that received enrofloxacin orally showed
the positive control groups (p<0.05). No bacterial cultures
better results than the FCR of broilers received enrofloxacin
were found in the negative control group (Table 1).
via their drinking water within 2 h and drinking water
throughout the day, respectively (Table 1).
Discussion
Mortality: The broilers that received enrofloxacin had
The present study showed that enrofloxacin had
significantly (p<0.05) less colibacillosis-related mortality
better efficacy than oxytetracycline to control the FCR,
than the broilers that received either oxytetracycline or
pathological lesions and mortality caused by APEC in
no medication. The broilers in the positive control group
broiler chickens. The results were supported by the work
had similar mortality rates to the broilers that received
of Glisson et al. (2004), which showed that enrofloxacin
oxytetracycline via drinking water throughout the day.
provided the lowest mortality, gross pathology and
No mortality was found in the broilers received
FCR among chickens that were given enrofloxacin,
enrofloxacin and the negative control. The mortality of
oxytetracycline and sulfadimethoxine. As for adminis-
broilers that received oxytetracycline orally and via
tration techniques, orally administered chickens tended
drinking water within 2 h was significantly better than
to show better results of FCR, mortality, gross pathology
the broilers that received either oxytetracycline via
and APEC isolation than drinking water administration
their drinking water throughout the day or having no
within 2 h or throughout the day. Also, the chickens
medication (p<0.05) (Table 1).
administered via drinking water within 2 h tended to show
Gross pathology and bacterial cultures: The chickens
better results of FCR, mortality, gross pathology and
that died within one day of challenge showed only
APEC isolation than those of the chickens administered
mild degree of airsacculitis but the typical lesions of
via drinking water throughout the day. Thus, an un-limited
APEC infection such as airsacculitis, fibrinopurulent
time for consuming the drug could reduce its efficacy.
pericarditis, fibrinopurulent perihepatitis and peritonitis
According to Chansiripornchai and Sasipreeyajan (2002a),
were clearly present in chickens that died after the first
the administration of sarafloxacin within 2 provided
day of challenge. These typical clinical lesions were
the better treatment of APEC infection in broilers. Smith
similar in the oxytetracycline treated group and the
et al. (1986) gave sarafloxacin 4 times the minimum
positive control group, but they were less evident in the
inhibitory concentration in experimental mice and found
enrofloxacin treated group. No airsacculitis, pericarditis,
that the highest efficacy against E. coli (99.9%) occurred
peritonitis and perihepatitis were found in the negative
within 2 h after giving the drug. The efficacy of the drug
control group. The highest percentages of airsacculitis,
was reduced when the administration time was prolonged.
Negative control
8
throughout the day
drinking water
within 2 h
drinking water
oral
70±0b
0C
5.53±7.81a
1.67±0.13b
0C
0C
1.73±0b
1.97±0.11b
0C
70±0b
4.94±1.58a
1.65±0.08b
45±7.07a
5.21±2.06a
0/20
(0±0 b)
(0±0b)
(8.0±1.41a)
(8.0±1.41a)
0/20
16/20
(0±0b)
(4.0±0b)
16/20
0/20
(0±0b)
(2.0±1.41b)
8/20
0/20
(0±0b)
(1.0±0b)
4/20
0/20
(8.5±0.71a)
(7.0±2.83a)
2/20
17/20
(8.0±1.41a)
(7.5±0.71a)
15/20
16/20
(8.5±0.71a)
(7.0±1.41a)
15/20
17/20
(%±SD)
Pericarditis
14/20
(%±SD)
(%±SD)
35±7.07a
Airsacculitis
mortality
percent
2.45±0.07a
FCR±SD
Note- Different superscripts indicate statistically significant differences (p< 0.05) in each experiment.
Positive control
Enrofloxacin
7
6
5
4
throughout the day
drinking water
3
oral
drinking water within 2 h
Oxytetracycline
1
(twice a day)
Administration
2
Drugs
Groups
Table 1 Feed conversion ratios, Pathological findings and E. coli isolation of experimental broilers
(0±0b)
0/20
(9.0±1.41a)
18/20
(0±0b)
0/20
(0±0b)
0/20
(0±0b)
0/20
(7.5±2.12a)
15/20
(6.0±1.41a)
12/20
(7.5±0.71a)
15/20
(%±SD)
Peritonitis
Major lesions
(0±0b)
0/20
(8.0±1.41a)
16/20
(0±0b)
0/20
(0±0b)
0/20
(0±0b)
0/20
(7.0±0a)
14/20
(5.5±0.71a)
11/20
(5.0±1.41a)
10/20
(%±SD)
Perihepatitis
(0±10b)
0/20
(10.0+0a)
20/20
(2.0±0b)
4/20
(2.0±1.41b)
4/20
(2.5±2.12b)
5/20
(9.0±1.41a)
18/20
(9.0±0a)
18/20
(9.0±1.41a)
18/20
livers (%±SD)
Culture from the
235
236
The chickens in groups 3 and 6 which received the drug
References
solution for more than 2 h in each day for 3 consecutive
Bauditz, R. 1987. Results of clinical studies with Baytril
days, showed a significant decrease in the efficacy of
in poultry. Vet. Med. Rev. 21(2): 130-136.
oxytetracycline and enrofloxacin. Thus, drug adminis-
Bauer, A.W., Kurby, W.M., Sherris, J.C. and Turck,
tration also had an effect on the efficacious treatments
M. 1966. Antibiotic susceptibility testing by a
of APEC infections. For the antibiotic sensitivity test,
standardized single disk method. Am. J. Clin.
although oxytetracycline showed the in vitro resistant to
Path. 45(4): 493-496.
the challenge strain of APEC, but in vivo revealed that
Chansiripornchai, N. and Sasipreeyajan, J. 2002a. Efficacy
the administration techniques, twice a day via oral or
of sarafloxacin in broilers after experimental
drinking water within 2 hrs (groups 1 or 2), showed
infection with Escherichia coli. Vet. Res. Comm.
the ability to protect chickens comparing to the drug
26(4): 255-262.
administration twice a day via drinking water throughout
Chansiripornchai, N. and Sasipreeyajan, J. 2002b. The
the day or the positive control group (groups 3 or 7).
efficiency of cenfloxacin in broiler chickens after
The results will help poultry veterinarians choose and
experimental E. coli infection. Thai J. Vet. Med.
prescribe the most efficacious antimicrobial and the
32(1): 53-61.
optimal time of drug application that promises to alleviate
Chansiripornchai, N., Pakpinyo, S. and Sasipreeyajan, S.
pain, suffering and thus promote health and well-being
1995. The in vitro antimicrobial sensitivity testing
among chickens that are raised for human consumption.
of Escherichia coli isolated from commercially
reared chickens. Thai J. Vet. Med. 25(4): 275-283.
Acknowledgements
Glisson, J.R., Hofacre, C.L. and Mathis, G.F. 2004.
Thanks are expressed for a grant for the
Comparative efficacy of Enrofloxacin, Oxytetracy-
development of new faculty staff year 2005, the
cline and Sulfadimethoxine for the control of
Ratchadaphiseksomphot Endowment Fund, Chulalongkorn
morbidity and mortality caused by Escherichia coli
University for supporting this work.
in broiler chickens. Avian Dis. 48(3): 658-662.
Smith, B.R., LeFrock, J.L., Donato, J.B., Joseph, W.S.
and Weber, S.J. 1986. In vitro activity of A-56619
and A56620, two new aryl-fluoroquinolone antimicrobial agents. Antimicrob Agents Chemother.
29(2): 355-358.
Sekizaki, T., Nonomura, L. and Imada, Y. 1989. Loss of
virulence associated with plasmid curing of
chicken pathogenic Escherichia coli. Nippon
Juigaku Zasshi. 51(3): 659-661.
Scheer, M. 1987. Studies on the antibacterial activity
of Baytril. Vet. Med. Rev. 21(2): 90-99.
Suriyasathaporn W. et al./Thai J. Vet. Med. 39(3): 237-243.
237
Original Article
The Indicative Influence of Oxidative Stress on
Low Milk Yields in Dairy Cattle
Witaya Suriyasathaporn1* Usanee Vinitketkumnuen2 Teera Chewonarin2
Vena Chupia3 Tanu Pinyopummintr4
Abstract
The goal of this study was to identify the correlation between milk yield and milk malondialdehyde
(MDA), an oxidative stress marker. The study was conducted using cows from eight small-holder dairy farms
during October to December 2004. The data comprised of sample date, milk yield, and the recent calving date
were recorded. Morning milk samples were collected monthly for the measurement of somatic cell counts (SCC)
and MDA level using the automate counter and the modified Smith’s method, respectively. The final data set
included 131 milk data from 74 cows. Overall means and SEM of milk yields, somatic cell scores (SCS, the
normalize transformation of SCC data), MDA and days in milk were 14.5±0.45 kg/day, 2.97±0.19, 1,643±26 ppb,
and 154.8±8.83 day, respectively. The average milk yields ranged from 9.7±2.0 to 17.7±0.9 kg/day. Results from
Pearson’s correlation coefficients show that MDA, SCS and days in milk were negatively associated with milk
yield (p<0.05). In multiple linear regression analysis, only MDA and days in milk were significantly associated
with milk yields. The study indicates that the loss of milk yield after intramammary infection may be highly
mediated by increased oxidative stress status.
Keywords : days in milk, malondialdehyde, milk yield, oxidative stress, somatic cell count
1
Department of Food Animal Clinic, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, 50100, Thailand
2
Department of Biochemistry, Faculty of Medicine, Chiang Mai University, Chiang Mai, 50200, Thailand
3
Department of Veterinary Bioscience and Veterinary Public Health, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai,
50100, Thailand
4
Department of Large Animal and Wildlife Clinical Sciences, Faculty of Veterinary Medicine, Kasetsart University, Kamphang Saen,
Nakhon Pathom, 73140, Thailand
*
Thai J. Vet. Med., 2009. 39(3): 237-243
238
∫∑§—¥¬àÕ
μ—«∫àß™’È§«“¡‡§√’¬¥ÕÕ°´‘‡¥™—Ëπ∑’Ë¡’º≈μàÕº≈º≈‘μπÈ”π¡μË”¢Õß‚§π¡
«‘∑¬“ ÿ√‘¬“ ∂“æ√1* Õÿ…≥’¬å «‘π‘®‡¢μ§”π«≥2 ∏’√– ™’‚«π√‘π∑√å2 «’≥“ ®Ÿ‡ªï¬3 ∏πŸ ¿‘≠‚≠¿Ÿ¡‘¡‘π∑√å4
«—μ∂ÿª√– ß§å¢Õß°“√»÷°…“π’È‡æ◊ËÕ· ¥ß§«“¡ —¡æ—π∏å√–À«à“ß°“√„Àâπ¡·≈–¡“≈Õπ‰¥Õ—≈¥’‰Œ¥å„ππÈ”π¡ (MDA) ´÷Ëß‡ªìπμ—«
∫àß™’È§«“¡‡§√’¬¥ÕÕ°´‘‡¥™—Ëπ ∑”°“√»÷°…“‚¥¬„™â·¡à‚§®“°ø“√å¡‚§π¡ 8 ø“√å¡ μ—Èß·μà μÿ≈“§¡ ∂÷ß ∏—π«“§¡ 2549 ∑”°“√‡°Á∫¢âÕ¡Ÿ≈
«—π‡°Á∫μ—«Õ¬à“ß ª√‘¡“≥πÈ”π¡ ·≈–«—π∑’Ë§≈Õ¥§√—Èß ÿ¥∑â“¬ μ—«Õ¬à“ßπÈ”π¡„πμÕπ‡™â“∂Ÿ°‡°Á∫∑ÿ°‡¥◊Õπ ”À√—∫°“√«—¥ª√‘¡“≥‡´≈≈å
‚´¡“μ‘° (SCC) ·≈–√–¥—∫ MDA ‚¥¬„™â‡§√◊ËÕßπ—∫‡´≈≈åÕ—μ‚π¡—μ‘ ·≈–«‘∏’∑’Ë¥—¥·ª≈ß®“°«‘∏’¢Õß ¡‘∏ μ“¡≈”¥—∫ ¢âÕ¡Ÿ≈ ÿ¥∑â“¬
ª√–°Õ∫¥â«¬ 131 ¢âÕ¡Ÿ≈πÈ”π¡®“° ·¡à‚§ 74 μ—« §à“‡©≈’Ë¬√«¡·≈– à«π‡∫’Ë¬ß‡∫π®“°§à“‡©≈’Ë¬¢ÕßπÈ”π¡ §–·ππ‡´≈≈å‚´¡“μ‘°
(SCS °“√·ª≈ß¢Õß¢âÕ¡Ÿ≈ SCC „Àâ¡’°“√°√–®“¬μ—«ª°μ‘) MDA ·≈– «—π„Àâπ¡ §◊Õ 14.5±0.45 °°./«—π 2.97±0.19 1,643±26
ppb ·≈– 154.8±8.83 «—π μ“¡≈”¥—∫ §à“‡©≈’Ë¬¢ÕßπÈ”π¡¡’æ‘ —¬®“° 9.7±2.0 ∂÷ß 17.7±0.9 °°./«—π º≈®“°§à“ —¡ª√– ‘∑∏‘Ï§«“¡
—¡æ—π∏å‡æ’¬√ —π · ¥ß„Àâ‡ÀÁπ«à“ MDA SCS ·≈–«—π„Àâπ¡¡’§«“¡ —¡æ—π∏åº°º—π°—∫ª√‘¡“≥πÈ”π¡ (p<0.05) „π°“√«‘‡§√“–Àå
¡°“√ À —¡æ—π∏å‡ âπμ√ßæ∫«à“ ¡’‡æ’¬ß MDA ·≈–«—π„Àâπ¡¡’§«“¡ —¡æ—π∏å°—∫ª√‘¡“≥πÈ”π¡Õ¬à“ß¡’π—¬ ”§—≠ °“√»÷°…“π’È· ¥ß
«à“°“√ Ÿ≠‡ ’¬πÈ”π¡®“°º≈°“√μ‘¥‡™◊ÈÕ‡¢â“‡μâ“π¡Õ“®¡’ à«π¡“®“°°“√‡æ‘Ë¡¢Õß ∂“π–§«“¡‡§√’¬¥ÕÕ°´‘‡¥™—Ëπ
§” ”§—≠ : «—π„Àâπ¡ ¡“≈Õπ‰¥ÕÕ≈¥’‰Œ¥å °“√„ÀâπÈ”π¡ §«“¡‡§√’¬¥ÕÕ°´‘‡¥™—Ëπ ‡´≈≈å‚´¡“μ‘°
1
¿“§«‘™“§≈‘π‘° —μ«å∫√‘‚¿§ §≥– —μ«·æ∑¬»“ μ√å ¡À“«‘∑¬“≈—¬‡™’¬ß„À¡à ‡™’¬ß„À¡à 50100
¿“§«‘™“™’«‡§¡’ §≥–·æ∑¬»“ μ√å ¡À“«‘∑¬“≈—¬‡™’¬ß„À¡à ‡™’¬ß„À¡à 50200
3
¿“§«‘™“™’«»“ μ√å∑“ß —μ«·æ∑¬å·≈– —μ«·æ∑¬å “∏“√≥ ÿ¢ §≥– —μ«·æ∑¬»“ μ√å ¡À“«‘∑¬“≈—¬‡™’¬ß„À¡à ‡™’¬ß„À¡à 50100
4
¿“§«‘™“‡«™»“ μ√å§≈‘π‘° —μ«å„À≠à·≈– —μ«åªÉ“ §≥– —μ«·æ∑¬»“ μ√å ¡À“«‘∑¬“≈—¬‡°…μ√»“ μ√å °”·æß· π π§√ª∞¡ 73140
*
2
Introduction
Mastitis is defined as an inflammation of the
(Suriyasathaporn et al., 2000b). The increase of SCC is also
associated with loss in milk yield (Seegers et al., 2003).
parenchyma of mammary glands regardless of its cause.
After intramammary infection, polymorphonuclear
Although mastitis occurs sporadically in all species; it is
cells move rapidly into the secretions of infected quarters
recognized as the most economic losses in the dairy
causing an increase of SCC in milk (Suriyasathaporn
industry (Barlett et al., 1990, Dijkhuizen et al., 1991).
et al., 2000a). Subsequently, the cells generate superoxide
The decrease of milk yield in mastitis manifested cows is
to kill invading microorganisms (Babior, 1999), causing
due to the damage of milk producing alveolar cells from
an increase of oxidative reaction in the udder. Although
pathogen invasion (Burvenich et al., 2003). In addition,
essential for survival, the undesirable repercussion of
many studies indicated that the damage is also caused
inappropriate or excessive oxidative reaction, the so-called
by the inflammatory processes in host factors after
oxidative stress, can cause tissue degeneration (Cohen,
intramammary infection (Burvenich et al., 2003).
1994). Consequently, the loss of milk yield from increased
However, most studies were emphasized in the cell
SCC might be stemmed from the increase of oxidative
damage after the clinical mastitis. On the other hand,
stress level. Therefore, the goal of this study was to
the less severe mastitis, subclinical mastitis, and its
identify the correlation between milk yield and
identification of intramammary infection can be
malondialdehyde levels (MDA), an oxidative stress
diagnosed by an increase of somatic cell counts (SCC)
marker.
239
Y = β0 + Σβixi + ε
where ε = R + e, R = correlation matrix, e = random
Animals and the experimental design: The study was
error, the fixed part includes the intercept (β 0) and
conducted using cows from eight small-holder dairy
covariates xi and regressors for covariates (βi)
farms in Chiang Mai province, the Northern part of
The stepwise forward regression analysis with free
Thailand, during October to December 2004. Morning
entering method was used, and the maximum restricted
milk samples were collected monthly for the measurement
log-likelihood test was calculated to identify significant
of SCC and MDA. After collection, the samples were
levels. Only significant effects, p-value < 0.05, were
immediately transported on ice to the laboratory. Milk
included in the final path models.
yield data on sample date and data on calving date were
recorded. The SCC measurement was performed within
®
24 h by the automated counter (Somacount S150,
Results
Descriptive analysis: One hundred and thirty
Bentley, USA).
three milk data from 74 cows, in lactation 1 (n = 28), 2
The measurement of milk MDA: After the SCC
(n = 19) and more than 2 (n = 27), were collected.
measurement, the milk MDA was measured by the
Numbers of data generated from the same cows were
modified Smith’s method described by Santos and
20, 43, and 9 for 1, 2, and 3 data, respectively. The
colleagues (1980). Briefly, 100 μl of milk sample was
average milk yields of farms ranged between 9.7 to 17.7
properly mixed with 1 ml of trichloroacetic acid (TCA)
kg/day. Overall means and SEM of milk yields, SCS,
using a vortex mixer. Then, 400 μl of thiobarbituric acid
MDA and days in milk were 14.5±0.45 kg/day, 2.97±0.19,
(TBA) was added. The mixture was boiled for 30 min
1,644±26 ppb and 154.8±8.8 day, respectively. Means
and subsequently cooled down by running tap water.
and standard error of mean of milk yield were 13.8±0.78
The solution was quatduplicate analyzed by UV
kg/day, 14.6±0.82 kg/day, and 15.7±0.74 kg/day, for
spectrophotometry at 532 nm against the blank reaction
lactation 1, 2 and more than 2, respectively. No significant
mixture (without TBA).
difference among lactation number was observed.
Statistical analysis: Milk yield (kg/cow/day) was the
Relationships of periods of lactation, SCS, and MDA on
dependent variable. To normalize the SCC data, they
milk yields were illustrated in Figure 1. Averages of
were transformed to somatic cell score (SCS) by taking
milk yield from either days 0-60 or days 61-120 were
log2 of (SCC/100,000) and plus 3. The SCS of cow
significantly higher than the later periods, and the average
with the SCC below 12,500 cells/cc was treated equally
of milk yield at day 121 to 180 was also higher than the
to 0. The day in milk (DIM) was an interval between
averages of milk yield at the later periods or after 181 days
date of calving and milk test date.
postpartum (p<0.05). Results from descriptive analysis
Descriptive statistics, Pearson’s correlation
showed that milk yields were associated with period
coefficients were used to describe the correlation
of lactation, SCS, and MDA. Pearson’s correlation
among milk yield, DIM, MDA and SCS. Multiple linear
coefficients for milk yield and MDA, milk yield and SCS,
regression analysis with repeated measure analysis or
and MDA and SCS were -0.46, -0.27 and 0.37 respectively.
general linear mixed model was used to define the
association of the factors to and milk yield. The general
linear mixed model structure was,
240
Milk yield (kg/cow/day)
Period of
Lactation
Milk Yield
Milk yield (kg/day)
Days in milk
SCS
Milk yield (kg/day)
Somatic cell score
MDA
Figure 2. Path diagram of events associated with
malondialdehyde (MDA), milk yield, and somatic cells
scores (SCS). β indicates a risk independent variable to
dependent variable. Data were collected during October
to December 2004 (n = 133) from small holder dairy farms
in Thailand. Superscript letters denote that the differences
along the variable were significant.
0-60, 61-120, and 121-180 days postpartum. The value
Malondialdehyde in milk (ppb)
Figure 1. The relationship of milk yield to days in milk,
somatic cell score, and malondialdehyde, as shown in 1A,
1B, and 1C, respectively. Data were collected during
October to December 2004 (n=133) from small holder
dairy farms in Thailand. Superscript letters denote that
the differences along the variable were significant.
of β-estimate for SCS was 0.33, meaning that MDA
increased 33 ppb when SCS increased 1 score.
Discussion
In general, milk yield in the first lactation of dairy
cows is lower than older cows. There was no differences
between lactation number observed in this study because
Path Models: Milk Yield and MDA: Figure 2 shows
the data used in this study were originated from single
significant relationships resulting from the models for
lactation. The genetic improvement of the first lactation
MDA and milk yield. The periods of lactation and MDA
cows might be reduced the difference of milk yield among
were negatively associated with milk yields (p<0.01), but
lactation. In this study, the peak of milk yield was during
not for SCS. Similar to the results of descriptive statistics,
60 to 120 days postpartum (Figure 1A), which coincided
averages of milk yield from either days 0-60 or days
with a previous report for Thai dairy cows (Suriyasathaporn
61-120 were significantly higher than the later periods,
et al., 2003), and gradually declined until the end of
and the average of milk yield at day 121 to 180 was also
lactation. The decline in milk production is due, in part, to
higher than the averages of milk yield at the later periods
the reduction of mammary cells in udders (Knight and
or after 180 days postpartum (p<0.05). The value of
Peaker, 1984; Wilde and Knight, 1989). The cell loss
β-estimate for MDA (x 100 ppb) was -0.35, meaning that
during the declining phase of lactation in goats and cows
milk yield decreased 0.35 kg when MDA increased 100
is apparently the result of programmed cell death, also
ppb. For the path model of MDA, MDA was associated
called apoptosis (Quarrie et al., 1994; Wilde et al., 1997).
with either SCS or period of lactation (p<0.05). A mean of
Apoptosis is mediated by oxidative stress (Best et al., 1999;
MDA in the last period (more than 240 days postpartum)
De Nigris et al., 2001). In support of our study, the MDA,
was significantly higher than the means of MDA during
as an oxidative stress marker, was highest during late
lactation (> 240 d postpartum).
241
neutrophils, and this caused an increase of oxidative
In dairy cattle, the SCC is commonly used as a
reactions (Su et al., 2002) and apoptosis (Tian et al.,
proxy to define the state of mammary gland infection
2005). Some of the oxidants produced by the respiratory
b
(Suriyasathaporn et al., 2000 ). An increase of SCC ≥
3
burst of neutrophils and other immune cells (Laurent
200x10 cells/ml or SCS ≥ 4 is optimal for the prediction
et al., 1991) could oxidize plasma ascorbic acid, thereby
of intramammary infection (Schepers et al., 1997). In
reducing its concentration. In dairy cows, lipid
support of a previous study (Hortet and Seegers, 1998),
peroxidation levels were increased and the levels of
we also found that milk yield was negatively associated
blood glutathione peroxidase, an antioxidant, were
with SCS (p<0.05). For our descriptive analysis, loss in
decreased in mastitic cows in comparisons to healthy cows
milk yield was approximately 323 g/day per one SCS
(Atroshi et al., 1996). Evidences of using antioxidants in
increased. This loss was in the same range of previous
mastitic cows showed that the ascorbic acid concentration
studies that the estimated milk loss due to the increase
in the serum of cows was decreased in mastitic cows
of each unit in SCS was approximately 91 and 181 kg/
(Kleczkowski et al., 2005). In addition, increased severity
lactation (Raubertas and Shook, 1982; Fetrow et al., 1991),
of clinical mastitis signs were associated with large
or 346 to 366 g/day (Miller et al., 2004). In other words,
decreases in concentration of vitamin C, as an antioxidant,
the effect of SCC on milk yield in this study was not
in milk from the challenged quarter (Weiss et al., 2004).
different from others.
In Figure 2, increased MDA resulted in decreased
Lipid peroxidation is a biochemical oxidative
milk yield. In addition, the exclusion of SCS from the
degradation of unsaturated fatty acids that causes
final model indicated that the effect of SCS on loss of
irreversible denaturation of essential proteins. With respect
milk yield might be mediated by increase of MDA. It is
to the widespread distribution of unsaturated fatty acid in
possible that the increase of SCC itself might not
the cellular membranes, the peroxidative damage has the
affect milk producing process, but the process might be
potential to affect many cellular functions (Stark, 2005)
impaired by the state of oxidative stress. The peroxidative
and interfere with the regulation of several metabolic
damage has the potential to affect many cellular functions
pathways (Miller et al., 1993). Antioxidants limit this
and finally lead to cell death (Stark, 2005; Esper et al.,
damage, yet peroxidative events occur when oxidant
2006; Munoz-Casares et al., 2006). Giving the importance
stress increases. Cytotoxic aldehydes, such as MDA that
to biology of oxidative stress, a variety of mechanisms
is the end product of lipid peroxidation, remain after
evolved to deal with free radicals from antioxidants, such
termination of lipid peroxidation (Halliwell and Gutteridge,
as vitamins C and E, passing by enzymes that detoxify free
1990). In this study, MDA was used as an oxidative stress
radicals to a number of enzymes that catalyze the repair of
marker in the udder. An increase of somatic cell count
damage caused by free radicals. The mere existence of
was related to the increase of MDA in milk (Figure 2).
enzymes to prevent and repair damage by free radicals is
Increased MDA in milk may be due to increased radical
a strong indicator that free radicals are biologically
formation or decreased antioxidative defenses. Oxidative
important, potentially dangerous molecules (Beckman
stress has been proposed as etiological in numerous
and Ames, 1998). In an experimental E. coli mastitis study,
pathologies causing the increased radical formation (De
loss in milk yield, as a parameter for severity of mastitis,
Haan et al., 2003). Intramammary infection, indicated by
was negatively associated with a change in concentration
increased SCC in milk, and mastitis are the important
of vitamin C, an antioxidant, in milk from the challenged
pathological condition in dairy cow udders. Milk with
quarter (Weiss et al., 2004). From the recent study, the
higher SCC has shown to have more infiltrated
results suggested that antioxidants may be effective
242
tools for protecting the mammary tissue against
Cohen, M.S. 1994. Molecular events in the activation
neutrophil-induced oxidative stress during bovine
of human neutrophils for microbial killing. Clin.
mastitis (Lauzon et al., 2005).
Inf. Dis. 18: S170-S179.
In conclusion, concentrations of MDA in milk, as
De Haan, J.B., Crack, P.J., Flentjar, N., Iannello, R.C.,
an oxidative stress marker, are negatively associated
Hertzog P.J. and Kola I. 2003. An imbalance in
with milk yields in dairy cattle. To reduce the milk yield
antioxidant defense affects cellular function: the
loss during mastitis, the attempt to decrease the severity of
pathophysiological consequences of a reduction in
oxidative stress in mastitis cows; by either decrease of
antioxidant defense in the glutathione peroxidase-1
free radical or increase of antioxidants, should be
(Gpx1) knockout mouse. Redox. Report. 8: 69-79.
investigated.
De Nigris, F., Lerman, L.O., Condorelli, M., Lerman,
A. and Napoli, C. 2001. Oxidation-sensitive
Acknowledgement
This study is jointly funded by the Commission
on Higher Education and Thailand research fund. The
transcription factors and molecular mechanisms in
the arterial wall. Antioxidants & Redox Signaling.
3: 1119-1130.
authors would like to thank the staffs in the Biochemistry
Dijkhuizen, A.A. 1991. Modelling to support animal
Laboratory, Faculty of Medicine, Chiang Mai University
health control. Agricultural Economics. 5: 263-277.
for their technical assistance.
Esper, R.J., Nordaby, R.A., Vilarino, J.O., Paragano, A.,
Cacharron, J.L. and Machado, R.A. 2006. The
References
Atroshi, F., Parantainen, J., Sankari, S., Jarvinen, M.,
endothelial dysfunction: a comprehensive appraisal.
Cardiovasc. Diabetol. 23: 4.
Lindberg, L.A. and Saloniemi, H. 1996. Changes in
Fetrow, J., Mann, D., Butcher, K. and McDaniel, B. 1991.
inflammation-related blood constituents of mastitic
Production losses from mastitis: carry-over from
cows. Vet. Res. 27: 125-132.
the previous lactation. J. Dairy. Sci. 74: 833-839.
Babior, B.M. 1999. NADPH oxidase: an update.
Blood. 93: 1464-1476.
Barlett, P.C., Miller, G.Y., Anderson, C.R. and Kirk, J.H.
Halliwell, B. and Gutteridge, J.M. 1990. Role of free
radicals and catalytic metal ions in human disease:
an overview. Methods Enzymol. 186: 81-85.
1990. Milk production and somatic cell count in
Hortet, P. and Seegers, H. 1998. Calculated milk
Michigan dairy herds. J. Dairy. Sci. 73: 2794-2800.
production losses associated with elevated somatic
Beckman, K.B. and Ames, B.N. 1998.The free radical
cell counts in dairy cows: review and critical
theory of aging matures. Physiol. Rev. 78: 547-581.
discussion. Vet. Res. 29: 497-510.
Best, P.J., Hasdai, D., Sangiorgi, G, Schwartz, R.S.,
Kleczkowski, M., Klucinski, W., Shaktur, A. and Sikora,
Holmes, D.R. Jr, Simari, R.D. and Lerman A. 1999.
J. 2005. Concentration of ascorbic acid in the blood
Apoptosis: Basic concepts and implications in
of cows with subclinical mastitis. Pol. J. Vet. Sci.
coronary artery disease. Arterioscler. Thromb. Vasc.
8: 121-125.
Biol. 19: 14-22.
Knight, C.H. and Peaker, M. 1984. Mammary
Burvenich, C., Merris Van, Mehrzad, V., Diez-Fraile, J.A.
development and regression during lactation in
and Duchateau, L. 2003. Severity of E. coli mastitis
goats in relation to milk secretion. Q. J. Exp. Physiol.
is mainly determined by cow factors. Vet. Res.
69: 331-338.
34: 521-564.
243
Laurent, F., Benoliel, A.M., Capo, C. and Bongrand, P.
Seegers, H., Fourichon, C. and Beaudeau, F. 2003.
1991. Oxidative metabolism of polymorphonuclear
Production effects related to mastitis and mastitis
leukocytes: modulation by adhesive stimuli. J.
economics in dairy cattle herds. Vet. Res. 34:
Leukoc. Biol. 49: 217-226.
475-491.
Lauzon, K., Zhao, X., Bouetard, A., Delbecchi, L., Paquette,
B. and Lacasse, P. 2005. Antioxidants to prevent
bovine neutrophil-induced mammary epithelial
cell damage. J. Dairy. Sci. 88: 4295-4303.
Stark, G. 2005. Functional consequences of oxidative
membrane damage. J. Membrane. Biol. 205: 1-16.
Su, W.J., Chang, C.J., Peh, H.C., Lee, S.L., Huang, M.C.
and Zhao, X. 2002. Apoptosis and oxidative stress of
Miller, J.K., Brazezinska-Slebodzinska, E. and Madson,
infiltrated neutrophils obtained from mammary
F.C. 1993. Oxidative stress, antioxidants and
glands of goats during various stages of lactation.
animal function. J. Dairy. Sci. 76: 2812-2823.
Am. J. Vet. Res. 63: 241-246.
Miller, R.H., Norman, H.D., Wiggans, G.R. and Wright,
Suriyasathaporn, W., Heuer, C., Noordhuizen-Stassen, E.N.
J.R. 2004. Relationship of test-day somatic cell
and Schukken, Y.H., 2000a. Hyperketonemia and
score with test-day and lactation milk yields. J.
the impairment of udder defence: a review. Vet. Res.
Dairy. Sci. 87: 2299-2306.
31: 397-412.
Munoz-Casares, F.C., Padillo, F.J., Briceno, J., Collado,
Suriyasathaporn, W., Kanistanon, K., Kowitayakorn, W.,
J.A., Munoz-Castaneda J.R., Ortega R., Cruz A.,
Punyapornwittaya, W. and Kreausukon, K. 2003.
Tunez I., Montilla P., Pera C. and Muntane J. 2006.
Defining the coefficients for the calculation of
Melatonin reduces apoptosis and necrosis induced
standard milk production and the average daily milk
by ischemia/reperfusion injury of the pancreas. J.
production for the whole lactation. Thai J. Vet.
Pineal. Res. 40: 195-203.
Med. 33: 63-71.
Quarrie, L.H., Addey, C.V. and Wilde, C.J. 1994. Local
Suriyasathaporn, W., Schukken, Y.H., Nielen, M. and
regulation of mammary apoptosis in the lactating
Brand, A. 2000b. Low somatic cell count: a risk
goat. Biochem. Soc. Trans. 22: 178S.
factor for subsequent clinical mastitis in a dairy
Raubertas, R.F. and Shook, G.E. 1982. Relationship
herd. J. Dairy Sci. 83: 1248-1255.
between lactation measures of somatic cell
Tian, S.Z., Chang, C.J., Chiang, C.C., Peh, H.C., Huang,
concentration and milk yield. J. Dairy. Sci. 65:
M.C., Lee, J.W. and Zhao, X. 2005. Comparison of
419-425.
morphology, viability, and function between blood
SAS Institute, Inc. 1997. SAS/STAT software: changes
and enhancements through release 6.12. Cary, NC,
1167 pp.
and milk neutrophils from peak lactating goats.
Can. J. Vet. Res. 69: 39-45.
Weiss, W.P., Hogan, J.S. and Smith, K.L. 2004. Changes
Santos, M.T., Valles, J., Aznar, J. and Vilches, J. 1980.
in vitamin C concentrations in plasma and milk
Determination of plasma malondialdehyde-like
from dairy cows after an intramammary infusion
materials and its clinical application in stroke
of Escherichia coli. J. Dairy. Sci. 87: 32-37.
patients. J. Clin. Pathol. 33: 973-976.
Wilde, C.J., Addey, C.V., Li, P. and Fernig, D.G. 1997.
Schepers, A.J., Lam, T.J., Schukken, Y.H., Wilmink, J.B.
Programmed cell death in bovine mammary tissue
and Hanekamp, W.J. 1997. Estimation of variance
during lactation and involution. Exp. Physiol. 82:
components for somatic cell counts to determine
943-953.
thresholds for uninfected quarters. J. Dairy. Sci.
80: 1833-1840.
Wilde, C.J. and Knight, C.H. 1989. Metabolic adaptations
in mammary gland during the declining phase of
lactation. J. Dairy. Sci. 72: 1679-1692.
Chotikatum S. et al./Thai J. Vet. Med. 39(3): 245-258.
245
Original Article
Effects of Medium Chain Fatty Acids, Organic Acids and
Fructo-oligosaccharide on Cecal Salmonella Enteritidis
Colonization and Intestinal Parameters of Broilers
Sucheera Chotikatum1 Indhira Kramomthong2 Kris Angkanaporn3*
Abstract
Medium chain fatty acids (MCA) are one of new additives used to control Salmonella infection and it is
interesting to examine their physiological role in chickens comparing with other additives. The objective of this
investigation was to study the effect of MCA, mixed organic acids (ORA) and fructo-oligosaccharide (FOS) on
cecal Salmonella enterica serovar Enteritidis colonization and physiological changes of intestine in broilers. Six
hundred, day old, male and female broiler chicks were allocated into 4 treatments. The treatments were CON:
basal corn-soybean meal diet, FOS: basal diet supplemented with 4 g/kg FOS, ORA: basal diet plus water
supplemented with ORA at 1:1,000 from day 1 to 45, MCA: basal diet plus water supplemented with MCA at
1:1,000 from day 1 to 35 and 1; 2,000 from day 36 to 42. All chickens were inoculated with 0.3 ml of 106 cfu/ml
S. Enteritidis at day 3 and 1 ml of 108 cfu/ml at day 13 post-hatching. At days 21, 35 and 45 post-hatching, body
weight and daily feed intake were recorded and averaged to calculate feed conversion ratio (FCR). Cecal samples
were examined for S. Enteritidis colonization. In situ pH determination in crop small intestine and ceca were
measured. Jejunal mucosal samples were collected for the determination of sucrase and maltase activity. Ileal
digesta were collected for nutrient digestibility using the indigestible marker technique. Cecal contents were
collected for the determination of short chain fatty acids (SCFA) and medium chain fatty acids (MCA). Plasma
samples were collected from the portal vein to determine medium chain fatty acids. For the overall period (days
1-45 post-hatching), chicks in the MCA and ORA groups had a significantly (p<0.05) higher average daily gain
and better feed conversion ratio than the CON group. Chicks in MCA, ORA and FOS groups had significantly
(p<0.05) higher body weights than the CON group. Chicks in MCA and ORA groups showed a reduction of
S. Enteritidis in the ceca which was significantly (p<0.05) lower than the CON group. Chicks in MCA, ORA and
FOS groups had a significantly (p<0.05) lower pH of crop and intestines than the CON group. Chicks in MCA
group had a significantly (p<0.05) higher disaccharidase enzyme, digestibility of nutrients, SCFA (acetic acid
and valeric acid), MCA in plasma than the CON group. In conclusion, chicks in the MCA and ORA groups had a
better growth performance, better digestibility, less S. Enteritidis colonization and lower pH in the crop and
intestines. Chicks in the FOS group tended to have decreased Salmonella colonization in ceca. The chicks in the
MCA and FOS groups had improved disaccharidase activity. Medium chain fatty acids had beneficial effects
on increased medium chain fatty acid concentrations in the portal vein and SCFA concentrations in ceca.
Therefore, MCA is one of the efficient additives appropriate for Salmonella control in broilers.
Keywords : broilers, fructo-oligosaccharide, medium-chain fatty acids, organic acids, S. Enteritidis
1
Faculty of Veterinary Medicine, Mahanakorn University of Technology Bangkok, 2Department of Microbiology, 3Department of Physiology,
Faculty of Veterinary Science, Chulalongkorn University, Bangkok, 10330, Thailand
*
Thai J. Vet. Med., 2009. 39(3): 245-258
246
∫∑§—¥¬àÕ
º≈¢Õß°√¥‰¢¡—π “¬ª“π°≈“ß °√¥Õ‘π∑√’¬å ·≈–ø√ÿ§‚μ‚Õ≈‘‚°·´§§“‰√¥åμÕà °“√‡°“–°≈ÿ¡à ¢Õß
‡™◊ÈÕ´—≈‚¡‡π≈≈à“ ‡Õπ‡∑Õ√‘∑‘¥‘ ·≈–°“√‡ª≈’Ë¬π·ª≈ß¢Õß≈”‰ â„π‰°à‡π◊ÈÕ
ÿ™’√“ ‚™μ‘°–∏√√¡1 Õ‘π∑‘√“ °√–À¡àÕ¡∑Õß2 °ƒ… Õ—ß§π“æ√3*
°√¥‰¢¡—π “¬ª“π°≈“ß‡ªìπÀπ÷Ëß„π “√‡ √‘¡„À¡à∑’Ë™à«¬§«∫§ÿ¡°“√μ‘¥‡™◊ÈÕ´—≈‚¡‡π≈≈à“ ‡ªìπ∑’Ëπà“ π„®∂÷ßº≈∑“ß √’√«‘∑¬“
¢Õß°√¥‰¢¡—π “¬ª“π°≈“ß„π‰°à‡∑’¬∫°—∫ “√‡ √‘¡Õ◊ËπÊ °“√«‘®—¬π’È¡’«—μ∂ÿª√– ß§å‡æ◊ËÕ»÷°…“º≈¢Õß°√¥‰¢¡—π “¬ª“π°≈“ß °√¥
Õ‘π∑√’¬å√«¡ ø√ÿ§‚μ‚Õ≈‘‚°·´§§“‰√¥å μàÕ°“√‡°“–°≈ÿà¡¢Õß‡™◊ÈÕ´—≈‚¡‡π≈≈à“ ‡Õπ‡∑Õ√‘∑‘¥‘ §ÿ≥≈—°…≥–°“√‡®√‘≠‡μ‘∫‚μ ·≈–°“√
‡ª≈’Ë¬π·ª≈ß¢Õß≈”‰ â¢Õß‰°à‡π◊ÈÕ ‚¥¬„π°“√∑¥≈Õß„™â≈Ÿ°‰°à§≈–‡æ» Õ“¬ÿ 1 «—π ®”π«π 600 μ—« ·∫àß‡ªìπ 4 °≈ÿà¡ °≈ÿà¡∑’Ë 1 ‰¥â√—∫
Õ“À“√æ◊Èπ∞“π·≈–„ÀâπÈ”∏√√¡¥“ ‡ªìπ°≈ÿà¡§«∫§ÿ¡ °≈ÿà¡∑’Ë 2 ‰¥â√—∫Õ“À“√æ◊Èπ∞“π∑’Ëº ¡ø√ÿ§‚μ‚Õ≈‘‚°·´§§“‰√¥å„π√–¥—∫ 4
°.μàÕ °°.Õ“À“√ ·≈–„ÀâπÈ”∏√√¡¥“ °≈ÿà¡∑’Ë 3 ‰¥â√—∫Õ“À“√æ◊Èπ∞“π·≈–„ÀâπÈ”º ¡°√¥Õ‘π∑√’¬å„πÕ—μ√“ à«π 1:1,000 º ¡πÈ”„Àâ
°‘π∑ÿ°«—π °≈ÿà¡∑’Ë 4 ‰¥â√—∫Õ“À“√æ◊Èπ∞“π·≈–„ÀâπÈ”º ¡°√¥‰¢¡—π “¬ª“π°≈“ß„πÕ—μ√“ à«π 1:1,000 ‡ªìπ√–¬–‡«≈“ 35 «—π
À≈—ß®“°π—Èπ„Àâ„πÕ—μ√“ à«π1:2,000 º ¡πÈ”„Àâ°‘π∑ÿ°«—π®π ‘Èπ ÿ¥°“√∑¥≈Õß «—π∑’Ë 3 ∑”°“√ªÑÕπ‡™◊ÈÕ Salmonella §«“¡‡¢â¡¢âπ
106 cfu/¡≈. ®”π«π 0.3 ¡≈. ·≈–„π«—π∑’Ë 13 ∑”°“√ªÑÕπ‡™◊ÈÕ Salmonella ´È”∑’Ë§«“¡‡¢â¡¢âπ 108 cfu/¡≈. ®”π«π 1 ¡≈. ™—Ëß
πÈ”Àπ—°‰°à∑¥≈Õß∑ÿ°°≈ÿà¡·≈–∫—π∑÷°ª√‘¡“≥Õ“À“√∑’Ë°‘π‡©≈’Ë¬‡æ◊ËÕ§”π«≥Õ—μ√“°“√·≈°‡π◊ÈÕ„π«—π∑’Ë 21, 35 ·≈– 45 ¢Õß°“√∑¥≈Õß
„π«—π∑’Ë 17, 24 ·≈– 45 ∑”°“√‡°Á∫μ—«Õ¬à“ß‰ âμ—π‡æ◊ËÕμ√«®°“√‡°“–°≈ÿà¡¢Õß‡™◊ÈÕ´—≈‚¡‡π≈≈à“ «—¥§à“§«“¡‡ªìπ°√¥-¥à“ß¢Õß
°√–‡æ“–æ—° ≈”‰ â·≈–‰ âμ—π ‡°Á∫μ—«Õ¬à“ß‡´≈≈å‡¬◊ËÕ∫ÿºπ—ß≈”‰ â‡≈Á° à«π°≈“ß¡“«—¥√–¥—∫‡Õπ‰´¡å∑’Ë¬àÕ¬πÈ”μ“≈‚¡‡≈°ÿ≈§Ÿà ‡°Á∫μ—«Õ¬à“ß
Õ“À“√„π≈”‰ â‡≈Á° à«πª≈“¬¡“μ√«®À“§à“°“√¬àÕ¬‰¥â¢Õß‚ª√μ’π æ≈—ßß“π ·≈–‰¢¡—π ‡°Á∫μ—«Õ¬à“ßÕÿ®®“√–„π‰ âμ—π ·≈â«π”‰ª
«‘‡§√“–ÀåÀ“°√¥‰¢¡—π “¬ —Èπ ·≈– “¬ª“π°≈“ß ‡°Á∫μ—«Õ¬à“ß‡≈◊Õ¥‡æ◊ËÕ„™â„π°“√«‘‡§√“–ÀåÀ“°√¥‰¢¡—π “¬ª“π°≈“ß °“√‡®√‘≠
‡μ‘∫‚μ„π¿“æ√«¡μ≈Õ¥ 45 «—π¢Õß°“√∑¥≈Õß æ∫«à“‰°à∑’Ë‰¥â√—∫°√¥‰¢¡—π “¬ª“π°≈“ß ·≈–°√¥Õ‘π∑√’¬åº ¡πÈ” °“√‡®√‘≠‡μ‘∫‚μ
‡©≈’Ë¬μàÕ«—π¡“°°«à“°≈ÿà¡§«∫§ÿ¡Õ¬à“ß¡’π—¬ ”§—≠ (p<0.05) ·≈–ª√– ‘∑∏‘¿“æ°“√‡ª≈’Ë¬πÕ“À“√‡ªìπ‡π◊ÈÕ¥’°«à“‰°à„π°≈ÿà¡§«∫§ÿ¡
Õ¬à“ß¡’π¬— ”§—≠ (p<0.05) æ∫«à“πÈ”Àπ—°μ—« ÿ¥∑â“¬¢Õß‰°à°≈ÿ¡à ∑’‡Ë √‘¡°√¥‰¢¡—π “¬ª“π°≈“ß °√¥Õ‘π∑√’¬å ø√ÿ§‚μ‚Õ≈‘‚°·´§§“‰√¥å
¡“°°«à“°≈ÿà¡§«∫§ÿ¡Õ¬à“ß¡’π—¬ ”§—≠ (p<0.05) æ∫«à“º≈°“√‡°“–°≈ÿà¡¢Õß‡™◊ÈÕ´—≈‚¡‡π≈≈à“„π°≈ÿà¡∑’Ë‰¥â√—∫°√¥‰¢¡—π “¬ª“π°≈“ß
º ¡πÈ” ·≈–°√¥Õ‘π∑√’¬åº ¡πÈ” ≈¥≈ßÕ¬à“ß¡’π—¬ ”§—≠∑“ß ∂‘μ‘ (p<0.05) ‡¡◊ËÕ‡∑’¬∫°—∫°≈ÿà¡§«∫§ÿ¡ ·≈–‰°à∑¥≈Õß∑’Ë¡’°“√‡ √‘¡
°√¥‰¢¡—π “¬ª“π°≈“ß °√¥Õ‘π∑√’¬å ø√ÿ§‚μ‚Õ≈‘‚°·´§§“‰√¥å æ∫«à“§à“æ’‡Õ™„π°√–‡æ“–æ—°·≈–„π∑“ß‡¥‘πÕ“À“√≈¥≈ß·μ°μà“ß
®“°°≈ÿà¡§«∫§ÿ¡Õ¬à“ß¡’π—¬ ”§—≠ (p<0.05) πÕ°®“°π’Èæ∫°√¥‰¢¡—π “¬ª“π°≈“ß„π‡≈◊Õ¥·μ°μà“ß®“°°≈ÿà¡§«∫§ÿ¡Õ¬à“ß¡’π—¬ ”§—≠
∑“ß ∂‘μ‘ (p<0.05) ·≈–æ∫«à“„°à°≈ÿà¡∑’Ë‰¥â√—∫°√¥‰¢¡—π “¬ª“π°≈“ßº ¡πÈ” ¡’§à“°“√¬àÕ¬‰¥â∑“ß‚¿™π– ª√‘¡“≥‡Õπ‰´¡å∑’Ë¬àÕ¬
πÈ”μ“≈‚¡‡≈°ÿ≈§Ÿà·≈–√–¥—∫°√¥‰¢¡—π “¬ —Èπ (°√¥Õ–´‘μ‘°·≈–°√¥«“‡≈√‘§) ‡æ‘Ë¡¢÷Èπ Õ¬à“ß¡’π—¬ ”§—≠ (p<0.05) ‡¡◊ËÕ‡ª√’¬∫‡∑’¬∫°—∫
°≈ÿà¡§«∫§ÿ¡ °“√»÷°…“§√—Èßπ’È· ¥ß„Àâ‡ÀÁπ«à“ °√¥‰¢¡—π “¬ª“π°≈“ß ·≈–°√¥Õ‘π∑√’¬å ¡’º≈‡æ‘Ë¡°“√‡®√‘≠‡μ‘∫‚μ·≈–≈¥°“√‡°“–
°≈ÿà¡¢Õß‡™◊ÈÕ´—≈‚¡‡π≈≈à“ ≈¥√–¥—∫§«“¡‡ªìπ°√¥„π°√–‡æ“–æ—°·≈–„π≈”‰ â æ∫«à“°√¥‰¢¡—π “¬ª“π°≈“ß ·≈–ø√ÿ§‚μ‚Õ≈‘‚°·´§
§“‰√¥å ¡’º≈‡æ‘Ë¡ª√‘¡“≥‡Õπ‰´¡å´Ÿ‡§√ πÕ°®“°π’È„π‰°à°≈ÿà¡∑’Ë‡ √‘¡°√¥‰¢¡—π “¬ª“π°≈“ßæ∫°√¥‰¢¡—π “¬ª“π°≈“ß„π‡≈◊Õ¥
·≈–æ∫«à“°√¥‰¢¡—π “¬ª“π°≈“ß¡’º≈‡æ‘Ë¡°“√¬àÕ¬‰¥â¢Õß‚¿™π– ‡æ‘Ë¡ª√‘¡“≥‡Õπ‰´¡å∑’Ë¬àÕ¬πÈ”μ“≈‚¡‡≈°ÿ≈§Ÿà „π≈”‰ â‡≈Á°·≈–‡æ‘Ë¡
ª√‘¡“≥°√¥‰¢¡—π “¬ —Èπ„π‰ âμ—π °√¥‰¢¡—π “¬ª“π°≈“ß‡ªìπ “√‡ √‘¡∑“ß‡≈◊Õ°∑’Ë¡’ª√– ‘∑∏‘¿“æ„π°“√§«∫§ÿ¡‡™◊ÈÕ´—≈‚¡‡π≈≈à“
„π‰°à‡π◊ÈÕ
§” ”§—≠ : ‰°à‡π◊ÈÕ ø√ÿ§‚μ‚Õ≈‘‚°·´§§“‰√¥å °√¥‰¢¡—π “¬ª“π°≈“ß °√¥Õ‘π∑√’¬å ´—≈‚¡‡π≈≈à“ ‡Õπ‡∑Õ√‘∑‘¥‘ 1
§≥– —μ«·æ∑¬»“ μ√å ¡À“«‘∑¬“≈—¬‡∑§‚π‚≈¬’¡À“π§√ °√ÿß‡∑æœ 2¿“§«‘™“®ÿ≈™’««‘∑¬“ 3¿“§«‘™“ √’√«‘∑¬“ §≥– —μ«·æ∑¬»à“ μ√å ®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬
ª∑ÿ¡«—π °√ÿß‡∑æœ 10330
*
Introduction
247
portal vein (Papamandjari et al., 1998) but its effect on
Salmonella spp are recognized in many parts of the
physiological changes in the gut has not been elucidated.
world as a major cause of food borne infections in human
Changes in pH of gastrointestinal contents, disaccharidase
and the consequent economic loss. In recent years,
enzyme activities and nutrient digestibility are among
Salmonella enterica serotype Enteritidis (S. Enteritidis)
the important measures of the gut changes to examine
has become the dominant serotype isolated from cases of
effect of additives in Salmonella inoculated chickens.
human food poisoning in many countries, including
The objectives of this experiment were to examine the
Thailand. Considering sources of contamination,
effect of MCA compared with mixed organic acids
S. Enteritidis, was isolated from 28% of the retail chicken
(ORA) and fructo-oligosaccharide (FOS) on eliminating
meat, 4.5% of the chicken meat from slaughterhouses, and
S. Enteritidis colonizing in broiler chickens. Moreover,
6.6% of the excreta from chickens (Boonmar et al., 1998).
the effect of these three additives on growth performance,
The US Department of Agriculture Food Safety and
intestinal pH, disaccharidase activities, short chain fatty
Inspection Service (FSIS) data on S. Enteritidis in
acids and ileal digestibility of nutrients were investigated.
broiler chicken carcass rinses collected from 2000
through 2005 showed the annual number of isolates
increased >4-fold and the proportion of establishments
This study was approved by the Institutional
with S. Enteritidis-positive rinses increased nearly 3-fold
Laboratory Animal Care and Use Committee of the
(Altekruse et al., 2006) Antibiotic supplementation as a
Faculty of Veterinary Science, Chulalongkorn University.
sub-therapeutic growth promoter is widely used in poultry
Animals, diets and sample preparation: The experiment
production in the world to control Salmonella (van
was conducted in a closed concrete-floor-pen house with
Immerseel, 2002). However, this practice in animal
an evaporative cooling facility. The chicks were raised
production is under inspection because it has been
according to routine practice in terms of light and
implicated as the major cause for the rise in antimicrobial
temperature (the light: dark cycle was 24:0 hr in the first
resistance and residues in animal products and
three weeks of the trial and the cycle was changed to
environmental contamination has greatly added to the
16:8 hr in the final three weeks with room temperature
public concern regarding the use of antibiotic in the feed.
recorded and analyzed twice daily). Six hundred, one day
Since the proposed ban on antibiotic growth promoters in
old, male and female, Cobb-500 chicks were allocated
2006, it is imperative to the feed industry that alternatives
into 4 groups of 150 chicks (5 replicates of 30 chicks
to antibiotics in animal feed be searched and tested for
each). The basal diet comprised corn-soybean meal as the
ways of efficient animal production. All feed additives have
major ingredient and the proximate analysis of the diet is
advantages and disadvantages in controlling Salmonella
demonstrated in Table 1. (starter feed from day 1 to day 21
infection and improving feed utilization. Medium chain
of the trial and grower-finisher feed from day 22 to 45 of
fatty acids (MCA) are one of new additives used to
the trial). Chicks in group1 received a basal diet and were
control Salmonella infection and it is interested to
given tap water (CON). In group 2, chicks received a basal
examine their possible role in poultry production when
diet supplemented with 4 g FOS on top of 1 kg feed
compared with known supplements such as organic acids
and were given tap water until the end of the experiment
and prebiotics. MCA is composed of caproic acid (C6),
(FOS). Chicks in group 3 were given a basal diet and tap
caprylic acid (C8) and capric acid (C10) which can reduce
water that was supplemented with mixed organic acids
pathogenic bacteria (van Immerseel et al., 2004) and
(lactic acid, citric acid, ascorbic acid and propionic acid)
provide energy as they can be absorbed directly into the
(ORA) at 1:1000 until the end of the experiment. Group 4
248
chicks received a basal diet and were given tap water
an indigestible marker for 5 days (days 22-26 and days
mixed with medium chain fatty acids (MCA) at 1:1,000
43-47). On day 27 and 48 post-hatching, they were
continuously from the start until 35 days and 1:2,000 until
sacrificed with an intracardiac injection of pentobarbital
the end of the experiment. Feed and water were provided
sodium (120 mg/kg BW) and the ileum and ceca were
ad libitum throughout the experiment. Drinking water was
removed. The contents in the ileum were collected by gentle
changed daily and water intake was recorded weekly. The
squeezing with the thumb and fingers into plastic bottles.
chickens were weighed at days 1, 21, 35 and 45. Feed
The ileal contents from chickens in each replicate were
intake was recorded daily during day 0 to 21, day 22 to 35
pooled together due to the small amount of contents.
and day 36 to 45 and average feed intake was calculated
The ileal contents were kept frozen at -70 oC until analysis
in each period. Mortality was recorded daily. At day
for nutrient digestibility.
3 post-hatching, each chick was inoculated 0.3 ml
Analytical methods: Jejunal mucosal scrapings were
with tryptone soya broth (TSB) culture of S. Enteritidis
analyzed for disaccharidase activity (maltase and
r
6
(nalidixic-resistant strain, nal ) containing 1 x 10 colony
sucrase) (Dahlquist, 1968). Total protein concentrations
forming units (cfu) by oral route using an esophageal
in the jejunal mucosa were determined. (Lowry, 1951).
tube. At day 13 post-hatching, a 2nd inoculation was
Acid-insoluble ash in the ileal contents and the diets was
8
given to all chicks with one ml of 1 x 10 cfu of the same
measured as described by Choct and Annison (1992)
Salmonella culture. Twenty chickens from each treatment
and nutrient composition was analyzed using proximate
group were randomly selected and slaughtered with an
analysis (AOAC, 1995). The energy and protein contents
intracardiac injection of pentobarbital sodium (120 mg/kg
in the feed and ileal digesta were analyzed using Adiabetic
BW) at days 8, 17, 24 and 45 post-hatching. The abdomen
Bomb Calorimeter and Modified Kjeldahl methods
was exposed and the whole intestine from the duodenum
(AOAC, 1995), respectively. The percentage of ileal
to the cloaca was removed. The intestinal section from the
digestibility coefficient (IDC) of nutrients (crude protein
entry of pancreatic and bile duct to a section of Meckel’s
and energy) was calculated using the following equation:
diverticulum was taken as the jejunal (J) part. The ileal
(I) part was taken from Meckel’s diverticulum to the
ileocecal junction. Samples of the intestinal contents
IDC = 1 - (lleal nutrient (%) / lleal acid insoluble ash (%)) x 100
(Diet nutrient (%) / Diet acid insoluble ash (%))
were evacuated into containers and the pH was
immediately measured using a digital pH meter (ORION,
Cecal short-chain fatty acid concentrations (SCFA)
model 420A). The jejunal part was opened longitudinally,
were analyzed using the modified method from Erwin
rinsed with ice cold saline and placed on a foam pad.
(1961). In brief, frozen intestinal contents were weighed
Mucosal samples were scraped from the mucosa layer
and diluted with an equal volume of distilled water. The
using a glass slide, wrapped with aluminum foil and
solutions were centrifuged at 9,000 rpm for 10 min. The
o
stored at -70 C until analysis for disaccharidase activity.
supernatant was separated for SCFA determination.
A cecum was removed and placed in a plastic bag for
The mixture of four standard SCFA solutions was 70 mM
bacteriological study. Cecal content from the other cecum
acetic acid, 30 mM propionic acid, 10 mM butyric acid
o
was wrapped with aluminum foil and stored at -70 C until
and 2 mM valeric acid. The internal standard used was
analysis for short-chain fatty acids. In addition, ten
isocaproic acid. The volume of 0.4 ml working internal
chickens from each treatment group at 22 and 43 days
standard solution (containing isocaproic acid, formic
post-hatching were randomly selected. These chickens
acid and 25% metaphosphoric acid) was mixed with
were fed on diets containing celite (20 g/kg in feed) as
0.7 ml of the supernatant or standard solution. The aliquots
249
were analyzed for SCFA concentration using a gas
for 24 h at 37oC. Salmonella suspected colonies from all
chromatography equipped with a hydrogen flame
of the XLT4 agar plates were identified.
ionization detector. The concentration of individual
Statistical analysis: Data are presented as Mean±Pooled
SCFA was expressed as μmole/g cecal content.
SEM. The effects of treatment were analyzed using
Medium chain fatty acid concentration (MCFA) in
One-Way Analysis of Variance (ANOVA). If there were
the plasma and cecal content was analyzed using a method
any significant effects, Duncanís New Multiple Range Test
modified from Mingrone et al. (1995). Nonanoic acid
was used to compare the individual means. Data, which
(100μg) in 100 μl ethanol was added, as an internal
did not comply with the equal variance and homogeneity
standard, to 0.5 ml of plasma or supernatant acidified to
tests, were analyzed using non-parametric methods
pH 2-3 with 0.15 mol/l HCl , then solutes were extracted
(Kruskral Wallis test). Data on the qualitative Salmonella
by 2 volumes of ethanol kept overnight at -20oC in order
test (positive-negative) before and after treatment were
to precipitate proteins. The samples were centrifuged
analyzed by Chi-square analysis. The significant level was
o
at 4,000 g in a refrigerated centrifuge at 4 C for 10 min
set at p<0.05.
and the residue was washed twice with ethanol and recentrifuged. The solutions were reduced to 0.5-1 ml, of
Results
which 1 μl was directly injected into a Gas Liquid
The overall growth performance of chicks is
Chromatograph (GLC) (Hewlett-Packard) equipped with
demonstrated in Table 2. Chicks in the ORA and MCA
a flame ionization detector (FID). MCA were separated
groups had significantly (p<0.05) greater final body
on a 25 mm fused silica capillary column of crosslink
weights, average daily gain (ADG) than the FOS and
methyl siloxane HP-1, 0.32 mm, film thickness 0.17 μm.
CON groups (Table 2). Chicks in the CON group had a
The concentration of individual MCA was expressed as
significantly (p<0.05) lower final body weight than the
μg/ml plasma.
FOS group. There were no significant differences in daily
feed intake (DFI) and the percentage of mortality among
Qualitative and quantitative examination of S. Enteritidis
groups of chicks. The mortality rate was within normal
Cecal samples were aseptically removed from
limits considering the size of the chicken colony and
each chick. The ceca was weighed, chopped and put into
chicks died more in the finisher period than in the starter-
buffered peptone water (BPW) (Oxoid, Basingstoke,
grower period, possibly due to heat stress. Chicks in both
England) with 2 volumes of weight of ceca, then blended
the ORA and MCA groups had a significantly (p<0.05)
in a stomacher. From the initial 10-1 dilution, 10-fold
better feed conversion ratio (FCR) and average daily
serial dilutions were made in BPW at dilutions of 1:100,
gain than the CON and FOS groups.
1:1000 and spread-plated on to XLT4 agar plates plus 25
The changes in the pH of the crop and the intestinal
μg/ml of nalidixic acid. The plates were incubated for
content of the jejunum, ileum and ceca are demonstrated
o
24 h at 37 C and S. Enteritidis colonies were identified.
in Table 3. At day 24 post-hatching, the jejunum pH values
The number of colony-forming units of Salmonella was
in the FOS (6.46), ORA (6.37) and MCA (6.35) groups
expressed as log10 Salmonella per gram of cecal contents.
were significantly lower (p<0.05) than in the CON (6.63)
The cecal sample of 1:10 dilution was also incubated at
group but there were no differences in the ileal pH and
o
37 C for 24 h. Then 100 μl of BPW were inoculated on to
cecal pH among the treatment groups. Likewise, at day 45
a MSRV agar plate and incubated at 42oC for 24-48 h.
post-hatching, the pH of the crop and jejunum decreased
The suspected colonies in MSRV was cultured on XLT4
significantly (p<0.05) in the FOS, ORA and MCA groups,
agar plates plus 25 μg/ml of nalidixic acid and incubated
as compared with the CON group. Moreover, the pH in
250
the crop of MCA group was the lowest (4.86) (p<0.05). It
compared to the FOS and CON groups. The valeric acid of
is shown that the pH of ileum in the ORA and MCA groups
the MCA group was also significantly (p<0.05) higher
was lower (p<0.05) than the FOS and CON groups. There
than other groups. Likewise, on day 27 post-hatching,
was no difference in the pH of the cecum among groups
there was no difference in propionic acid and butyric
of chicks.
acid concentrations among groups. The total SCFA
The mean log10 number of S. Enteritidis per gram
concentrations of the MCA group were significantly
of cecal content in the chicks challenged with Salmonella
higher (p<0.05) than the CON and FOS groups but
was significantly decreased (p<0.05) in the MCA group,
not different from the ORA group. Portal plasma
as compared with the CON group on day 17 post-hatching
concentrations of each medium chain fatty acids at days
(Table 4). No difference in the Salmonella numbers in
21 and 45 post-hatching are shown in Table 6. The
the cecal contents was found between the FOS group
caproic (C6) concentrations were found to be the highest
and CON group. Qualitative Salmonella percentage was
in the MCA group. Moreover, the caprylic acid (C8)
significantly lower in the MCA and ORA groups
concentrations were found only in the MCA group.
compared with the CON group on days 45 post-hatching.
For the total MCFA concentration, chicks in the MCA
Furthermore, it is noted that there was no S. Enteritidis
group had the highest MCFA concentrations while there
found in any chicks in the ORA and MCA groups on day
were no MCFA found in the CON group.
45. Likewise, Salmonella percentage in the FOS group
was lower (p<0.05) compared with CON group.
The IDC of protein and energy the broilers is
demonstrated in Table 7. At day 27 post-hatching, it was
Maltase activity in the FOS and MCA groups
found that the IDC of crude protein and energy were not
were significantly higher (p<0.05) than the CON group
different among groups. However, at day 48 post-
and maltase activity of the MCA group was significantly
hatching, it was found that the IDC of protein in the
higher (p<0.05) when compared to the ORA group
FOS, ORA and MCA groups were significantly (p<0.05)
(Table 5). At day 45 post-hatching, there was no
higher than the CON group. Furthermore, it was shown
significant difference in maltase activity of the jejunal
that the broiler chickens in the MCA group had
mucosa among experimental groups. There was no
significantly (p<0.05) higher IDC of protein than ORA
significant difference in the sucrase activity of each
and FOS groups. The IDC of energy in the FOS, ORA
group on day 24 post-hatching. The sucrase activities
and MCA group was significantly (p<0.05) higher than
of MCA and FOS groups at day 45 post-hatching were
the CON group with the MCA > ORA and the ORA > FOS
significantly greater (p<0.05) than the CON and ORA
groups (p<0.05).
groups.
Cecal concentrations of each short-chain fatty
Discussion
acids at day 27 post-hatching are shown in Table 6.
The result demonstrated that chicks in the MCA
Cecal acetic acid and valeric acid significantly increased
and ORA groups had significantly better growth
(p<0.05) in the MCA group, as compared with the
performance than other groups and this may be due to
CON group. There was no significant difference in the
the antibacterial effect of both fatty acids in controlling
propionic acid and butyric acid concentrations. The level
Salmonella infection. It was found that chicks in the
of butyric acid concentration in the CON group was lower
MCA group had higher short chain fatty acids in the ceca,
(p>0.05) compared to other groups. At the finisher period
especially acetate and valerate, compared to other
(day 48 post-hatching), the concentrations of acetic acid
groups. Moreover, concentrations of SCFA similar to those
increased significantly (p<0.05) in the MCA group, as
found in the ceca, have been shown to inhibit the growth
251
Table 1 Composition and nutrient contents of basal diets
Ingredients
Starter
Grower-finisher
51.80
24.06
15.00
1.50
2.94
0.23
0.40
0.09
1.89
1.32
0.10
0.30
0.10
56.68
17.88
15.00
1.50
4.13
0.26
0.42
0.13
1.95
1.34
0.05
0.29
0.10
0.15
0.12
0.15
0.12
%
Kcal/kg
%
%
89.06
3,150
21.60
9.42
89.13
3,250
19.02
10.70
%
3.69
3.36
Corn
Soybean meal
Full fat soybean
Fat powder
Palm oil
L-Lysine HCl
DL-Methionine
L-Threonine
Mono-,dicalcium phosphate
Limestone
Sodium bicarbonate
Salt
Choline chloride 60%
Vitamin/mineral premix*
Filler (corn starch)
Nutrients (calculated)
Dry matter
ME for poultry
Crude protein
Crude fat
Crude fiber
*
Each g of Premix per kg diet comprises Vitamin A 12,000, 10,000 IU. Vitamin D3 3,000, 2,400 IU, Vitamin E 15, 12 mg,
Vitamin K3 1.5, 1.2 mg, Vitamin B1 1., 1.2 mg, Vitamin B2 5.5, 4.4 mg, Vitamin B6 2, 1.6 mg, Vitamin B12 0.01, 0.01 mg,
nicotinic acid 25, 20 mg, D-calcium pathothenate 12, 10 mg, folic acid 0.5, 0.4 mg, biotin 0.01,0.01 mg , choline chloride
250, 250 mg, Mn 80, 80 mg, Zn 60, 60 mg, Fe 40, 40 mg, Cu 8, 8 mg, I 0.5, 0.5 mg, Co 0.1, 0.1 mg, and Se 0.1, 0.1 mg
Table 2 Effect of treatments on the growth performance of broiler chickens (1-42 day posthatching)
CON
Initial weight (g/b)
Final weight (g/b)
FOS
41.5
1,827.7
ORA
40.6
c
MCA
41.7
b
1,904.5
2,004.6
SEM
41.1
a
2,009.23
1.9
a
40.9
ADG (g/b/d)
39.7
b
41.4
b
43.6
a
43.7
a
0.9
DFI (g/b/d)
72.4
74.4
73.5
73.2
3.2
FCR
1.82b
1.79b
1.68a
1.67a
0.06
Mortality (%)
0.67
1.33
0.67
2.00
5.77
a,b,c
Means in the same row with unlike superscripts differ significantly (p<0.05)
252
Table 3 Effect of treatments on the pH of the crop and intestinal segments.
Treatment
Part of GI tract
Crop
Day 45
Jejunum
Day 24
Day 45
Ileum
Day 24
Day 45
Ceca
Day 24
Day 45
CON
FOS
ORA
MCA
SEM
5.69a
5.51b
5.17c
4.86d
0.022
6.63a
6.63a
6.46b
6.38b
6.37b
6.10b
6.35b
6.17b
0.024
0.034
7.21
7.10a
7.18
6.85b
7.19
6.22c
7.13
6.18c
0.024
0.050
6.34
6.37
6.23
6.23
0.020
6.91
6.90
6.76
6.77
0.037
a,b,c,d
Table 4 Effect of treatments on Salmonella colonization in ceca of broilers.
CON
Day
FOS
ORA
MCA
%
Salmonella
%
Salmonella
%
Salmonella
%
Salmonella
Positive1
Count2
Positive
Count
Positive
Count
Positive
Count
17
100
3.35±0.38*a
100
3.26±0.38a
90
2.00±0.01b
100
2.23±0.12b
24
100
2.63±0.68
80
2.23±0.63
90
1.36±0.38
60
1.49±0.49
45
70a
ND
20b
ND
0c
ND
0c
ND
*
Mean ± SE, n = 10,
% of Salmonella positive in cecal content, 2Salmonella number in cecal content of infected chicken (log10 cfu/g content),
ND: not determined
a,b,c
1
Table 5 Effect of treatments on jejunal disaccharidase activities1 of broilers
Enzyme
Treatment
CON
FOS
ORA
MCA
SEM
Day 24
131.43b
189.58a
142.35ab
188.82a
30.17
Day 45
95.07
112.91
110.84
141.52
28.33
Day 24
31.32
35.82
30.40
31.52
6.47
Day 45
b
a
b
a
3.75
Maltase
(units/mg protein)
Sucrase
(units/mg protein)
a,b
10.74
20.68
13.08
20.66
253
Table 6 Profile of short-chain fatty acid in cecal contents (mmol/ml) and medium chain fatty acids (mmol/ml) in portal
blood of broilers at days 27 and 48 post-hatching
Treatment
CON
FOS
ORA
MCA
SEM
Acetic acid (C2)
50.82b
65.20ab
65.07ab
73.05a
10.22
Propionic acid (C3)
14.68
15.98
15.28
18.49
2.86
Butyric acid (C4)
13.75
19.54
21.29
19.40
7.41
Valeric acid (C5)
0.92b
1.02ab
1.12ab
1.31a
0.18
Total SCFA
80.38
99.51
102.75
112.25
15.38
Caproic acid (C6)
0c
8.00b
6.84b
40.43a
11.64
Caprylic acid (C8)
0b
0b
0b
27.34a
13.02
Acetic acid (C2)
49.88b
54.55b
73.22ab
93.71a
20.28
Propionic acid (C3)
16.03
17.11
21.73
25.87
4.88
Butyric acid (C4)
8.11
9.19
14.57
19.26
6.21
Valeric acid (C5)
0.66b
0.62b
1.02b
1.51a
0.31
Total SCFA
57.68b
81.47b
110.54ab
140.35a
29.42
Caproic acid (C6)
0c
13.58b
0c
34.21a
8.37
Caprylic acid (C8)
0b
0b
0b
37.70a
4.33
Day 27
Day 48
a,b,c
Table 7 Effect of treatments on percentage of ileal nutrient digestibility coefficient of broilers.
Treatment
Nutrients
Crude Protein
Energy
Day
CON
FOS
ORA
MCA
SEM
27
0.776
48
0.521
c
0.772
0.773
0.740
0.004
0.675
b
0.709
b
0.833
a
0.003
27
0.738
0.737
0.735
0.696
0.005
48
0.599d
0.739c
0.770b
0.885a
0.003
a,b,c,d
Salmonella, this inhibition is increased with the reduction
acid in the drinking water significantly reduced crop pH
in the redox potential of the ceca accompanied by a lower
and decreased the recovery of Salmonella from crop
pH of the ceca (McHan and Shotts, 1993). It may be an
samples (Byrd et al., 2001). In contrast, van Immerseel
indication that the undissociated form of volatile fatty
(2002) reported that there was no effect of FOS on the pH
acids reduced the numbers of Enterobacteriacae in vivo
of the crop because oligosaccharides were neither degraded
(van der Wielen et al., 2000). It is demonstrated that the
nor hydrolyzed in the upper intestinal tract and reached
pH of crop and small intestines in the MCA, ORA and
the ceca. However, this study demonstrated that the pH of
FOS groups were significantly decreased compared to the
the crop in chicks fed on FOS was significantly lower than
CON group. Similarly, the use of acetic, lactic, or formic
the CON group at day 45. It might be possible that FOS
254
was fermented by some Lactobacilli in the crop. Durant et
form.
al. (1999) indicated that Lactobacilli are the predominant
Salmonella infection can lead to change in the
colonizers of the stratified squamous epithelium of the crop.
intestinal mucosa (Suzuki et al., 1992). Changes in
Moreover, the production of short chain fatty acids by the
intestinal morphology such as shorter villi and deeper
intestinal flora can be stimulated by adding fermentable
crypts have been associated with the toxins, resulting in
prebiotics to the feed (Cumming, 1981). The chicks in the
the reduction of enzyme production (Yason et al., 1987).
FOS group tended to have higher SCFA in their cecal
It is possible that the MCA restored the mucosal cell
contents, compared to chicks in the CON group, but these
function as seen in the improvement of brush border
effects were not significant. There were no significant
disaccharidase enzymes by providing energy to these
differences in FCR in the FOS group compared to the
absorptive cells. MCA also have unique properties in their
control. In contrast, Xu et al. (2003) showed that the
direct transport via the portal blood to the liver and their
addition of 4 g/kg FOS significantly increased average daily
preferential oxidation in the mitochondria to provide
gain and decrease feed to gain ratio. Moreover, Ammerman
energy, CO 2 and ketone bodies (Odle, 1999). It is
et al. (1988) found that addition of 2.5 and 5 g/kg FOS
demonstrated that the chicks in the MCA group had high
significantly improved feed efficiency over the entire
MCA concentrations in portal vein. Odle (1997) showed
feeding period of 46 days. The results showed that MCA
that medium chain fatty acid had a specialized energy
and ORA demonstrated an antibacterial action against
source, and better utilized in neonatal piglets. Kishi et al.
Salmonella. The number of Salmonella colonized in ceca
(2002) showed that MCA were utilized as an immediate
of the MCA and ORA groups was significantly lower
energy source in insufficient fat digestion.
than the CON group. This may be due to the antibacterial
The gastrointestinal tract constitutes the first
activity of both fatty acids. They can diffuse into the
barrier to nutrient metabolism in animals (Cant et al.,
bacterial cells in an undissociated form. Inside the
1996). The metabolic activity of the gastrointestinal
bacterial cell, the acid dissociates, resulting in a reduction
mucosa can have a tremendous impact on nutrient supply
of intracellular pH, suppression of cytoplasmatic enzymes
to the animal. The intestinal villi and crypt morphology in
and nutrient transport systems and uncouple ATP driven
chickens has been associated with intestinal function and
pumps, leading to death (Hsiao and Siebert, 1999). van
chicken growth. In the finisher period, the numbers of
Immerseel et al. (2004) suggested that all MCA decreased
Salmonella in the CON group were significantly higher
the expression of hilA, a key regulation gene related to the
than other groups. It is proposed that Salmonella may
invasive capacity of Salmonella. The bactericidal activity
damage the villi and microvilli of the intestinal mucosa
of organic acids is directly associated with increased
and inhibit the secretion of digestive enzymes. These
concentration of undissociated organic acid and the
result in the reduction of the small intestinal absorptive
concentration of undissociated acid is dependent on both
area and the appearance of a less mature enterocyte
the total concentration of organic acid and pH (Hinton et
population. The more immature enterocytes resulted in the
al., 1990). It is proposed that the antimicrobial activity of
reduction of enzyme production. It is demonstrated that
organic acids was dependent on the pKa of the acid,
chicks in the MCA group had significantly higher maltase
molecular weight (MW) and lipophilic/ hydrophilic
activity than the CON group. Guillot et al. (1993) indi-
character (Dierick et al., 2002). The pKa of MCA was 4.9
cated that the liver is the main site of MCA utilization and
(Hsiao and Siebert, 1999) and pKa of SCFA was < 4.8 and
suggests that a substantial proportion of these acids may
the pH in the crop ranged between 4 and 7 (Soerjadi et al.,
also be utilized in the intestinal mucosa. Jorgensen et al.
1982), thus, most of the MCA were in an undissociated
(2001) demonstrated that both C6 and C8 fatty acids
255
seemed to be excellent substrates for colonocyte oxidation
(Beerman et al., 2003). This rapid absorption in the portal
in rat. The results agree with a previous study that MCA
vein can be explained by 1) a greater solubility of MCA in
have a positive effect on epithelial cell membrane bound
an aqueous medium which would facilitate their uptake by
enzyme activities (Takase and Goda, 1990). Furthermore,
the intestinal mucosa. 2) a lower affinity of the intestinal
MCA improved in intestinal morphology and function,
fatty acid binding protein (Ockner et al., 1972) and of acyl
through their positive effects on crypt cell renewal (Jenkins
CoA synthetase (Brindley and Hubscher, 1966) for MCA
and Thompson, 1993). It is demonstrated that chicks in
compared with LCFA. Moreover, it is demonstrated that
the FOS group had an increase in sucrase activities in the
there were no MCA found in the ceca of MCA group. It is
jejunum and had a slight increase in maltase activity. It is
possible that MCA were entirely absorbed in the small
possible that FOS exerted a preferential stimulatory
intestine or may have been utilized by the colonic mucosa.
effect on Bifidobacterium and Lactobacillus (Xu et al.,
Jorgensen (2001) indicated that the colonic mucosa can
2003), while it suppressed Salmonella in the small
both metabolize and transport MCA. Octanoate and
intestine. Bifidobacterium readily ferments FOS because
decanoate were oxidized to CO2 as well as butyrate and
of the innate secretion of a β-fructoside enzyme and
thus provided energy to the colonic epithelium (Jorgensen,
some other bacteria to produce short chain fatty acids
2002). This MCA serves as a ready source of energy, with
(SCFA) (Gibson, 2004). Sakata (1987) reported that
high digestion and oxidation rates (Chiang et al., 1990).
acetate, propionate and butyrate have a dose dependent
The result of this study indicated that chicks in MCA group
stimulatory effect on epithelial cell production rates in the
were supported with rapidly available energy. Furthermore,
jejunum and the distal colon. Moreover, SCFA production
chicks in the FOS group had significantly higher caproic
from the fermentable fiber may result in a decrease in
acid (C6) in the portal vein, compared to the CON group. It
mucosal atrophy by normalizing cell proliferation in the
is possible that fermentation of FOS can lead to the
mucosa (Campbell et al., 1997). In vitro studies with rats
production of some C6. However, it is noted that only one
show the trophic effects of SCFA on epithelial cell
sample from five samples in both the FOS and ORA groups
proliferation (Frankel et al., 1994). Goldin (1998) indicated
was found. Furthermore, it is demonstrated that chicks in
that the use of prebiotics can lengthen villi within the gut
MCA group also had a higher digestibility of nutrients
and also influence the length of the gut. Furthermore, the
than other groups. It is possible that MCA have an increase
Bifidobacterium and Lactobacilli spp. can synthesize
in brush border enzyme and they are absorbed more
enzymes, thus increasing the intestinal digestive enzyme
quickly into the intestinal lumen (Papamandjaris, 1998).
activity (Sissons, 1989). The digestive process is highly
In addition, MCA are not significantly incorporated into
dependent on endogenous enzyme activity (Pubol, 1991)
triglycerides and the subsequent chylomicrons as are long
and enzyme activities increase the availability of nutrients
chain fatty acids. Therefore, they leave the intestine and
in the small intestine (Sklan, 2001). It is possible that
enter the portal blood stream and reach the liver directly,
MCA were utilized as immediate energy source and a
providing a supply of energy to this organ (Bach and
substantial proportion of these acids may also be utilized
Babayan, 1982, Decker, 1996). Moreover, Galluser et al.
in the intestinal mucosa (Guillot et al., 1993). This
(1993) suggested that a greater solubility of MCA would
study showed that MCA (caproic acid and caprylic acid)
facilitate uptake by the intestinal mucosa, thus improving
were found in the portal vein of chicks fed on water
intestinal morphology and functions. Furthermore, this
supplemented with MCA. It is proposed that MCA can
study indicated that chicks in the FOS group had higher
directly be absorbed without hydrolysis and preferentially
nutrient digestibility than the CON group. It is possible
transported through the portal venous system to the liver
that FOS supplementation has been shown to increase
256
numbers of beneficial bacteria such as Bifidobacteria
Beermann, C., Jelinek, J., Reinecker, T., Hauenchild, A,
and Lactobacilli. The Bifidobacteria and Lactobacilli
Boehm, G. U. and Klor, H.U. 2003. Short term
colonizing the intestine have been reported to deliver
effects of dietary medium chain fatty acids and n-3
luminal enzymes, thus increasing digestive enzyme
long chain fatty polyunsaturated fatty acids on the
activity in the intestines (Sissons, 1989). It is proposed
fat metabolism of healthy volunteers. Lipid. Health.
that increased the enzyme activity will affect the efficiency
Dis. 17: 2-10.
of nutrient digestibility.
Boonmar, S., Bantrakulnonth, A., Pornrunangwong, S.,
In conclusion, the results of this study demonstrate
Marnrim, N., Kaneko, K. and Ogava, M. 1998.
that MCA, ORA and FOS supplemented in chicks were
Salmonella in broiler chickens in Thailand with
beneficial in ameliorating the adverse effects of
special reference to contamination of retail meat
Salmonella colonization in broilers. MCA supplementa-
with Salmonella Enteritidis. J. Vet. Med. Sci. 60:
tion was equally effective with organic acids in decreasing
1233-1236.
the levels of colonization in ceca and improved growth
Brindley, D. N. and Hubscher, G. 1996. The effect of
performance. Moreover, MCA reduced pH in the crop and
chain length on the activation and subsequent
small intestine and improved disaccharidase activity and
incorporation of fatty acids into glycerides by the
the digestibility of nutrients. In addition, MCA increased
small intestinal mucosal. Biochem. Biophys. Acta.
cecal SCFA concentrations and MCFA in portal blood.
125: 92-105.
Therefore, MCA is one of the efficient additives
appropriate for Salmonella control in broilers.
Byrd, J. A., Hargis, B. M., Caldwell, D. J., Bailey, R. H.,
Herron, K. L., Mcraynolds, J. L., Brewer, R. L.,
Anderson, R. C., Bischoff, K. M., Callaway, T. R.
Acknowledgement
and Kubena, L.F. 2001. Effect of lactic acid
The authors wish to thank to the financial support
administration in drinking water during preslaughter
by the Chulalongkorn University 90 th Anniversary,
feed withdrawal on Salmonella and Campylobacter
Ratchadaphiseksompoch Research Fund.
contamination of broilers. Poult. Sci. 80: 278-283.
Cant, J.P., Mcbride, B.W. and Croom, W.J. Jr. 1996. The
References
regulation of intestinal metabolism and its impact on
Altekruse, S., Bauer, N., Chanlongbutra, A., Desagun, R.,
whole animal energetics. J. Anim. Sci. 74: 2541-2553.
Naugle, A., Schlosser, W., Umholtz, R. and White, P.
Campbell, J.M., Fahey, G.C. Jr. and Wolf, B.W. 1997.
2006. Salmonella Enteritidis in broiler chickens,
Selected indigestible oligosaccharides affect large
United States, 2000-2005. Emerg. Infect. Dis.
bowel mass, cecal and fecal short-chain fatty acids,
12(12): 1848-1852.
pH and microflora in rats. J. Nutr. 127: 130-136.
Ammerman, E., Quarles, C. and Twining, P.V. 1988.
Chiang, S. H., Pettigrew, J.E., Clarke, S.D. and Cornelius,
Effect of fructo oligosaccharide on feed efficiency
S.G. 1990. Limits of medium chain and long chain
in floor pen reared male broilers. Poult. Sci.
triacylglycerol utilization by neonatal piglets. J.
67(suppl.1):1 (Abstr.)
Anim. Sci. 68: 1632-1638.
AOAC. 1995. Official methods of analysis. Association of
official agricultural chemists, Arlington, Virginia
Bach, A.C. and Babayan, V.K. 1982. Medium chain
triglycerides: an update. Am. J. Clin. Nutr. 56:
950-962.
Choct, M. and Annison, G. 1992. The inhabitation of
nutrient digestion by wheat pentosans. Br. J. Nutr.
67: 123-132.
Cummings, J. H. 1981. Short chain fatty acids in the
human colon. Gut. 22: 763-779.
Dahlqvist, A. 1968. Assay of intestinal disaccharidases.
Anal. Biochem. 22: 99-107.
Decker, E. A. 1996. The role of stereospecific saturated
fatty acid position on lipid nutrition. Nutr. Rev.
54: 108-110.
257
Hinton, Jr. A., Corrier, D.E., Spates, G.E., Norman, J.O.,
Ziprin, R.L., Beier, R.C. and Deloach, J.R. 1990.
Biological control of Salmonella typhimurium in
young chickens. Avian. Dis. 34: 626-633.
Hsu, C.K., Liao, J.W., Chung, Y.C., Hsieh, C.P. and
Dierick, N.A., Decuypere, J.A., Molly, K., Beek, E.V.
Chan, Y.C. 2004. Xylooligosaccharides and
amd Vanderbeke, E. 2002. The combined use of
fructooligosaccharides affect the intestinal micro-
triacyglycerols (TAGs) containing medium-chain
biota and precancerous colonic lesion development
fatty acids (MCFAs) and exogenous lipolytic
in rats. J. Nutr. 134: 1523-1528.
enzymes as an alternative for nutritional antibiotics
Hsiao, C. and Siebert, K. 1999. Modelling the inhibitory
in piglet nutrition. I. In vitro screening of release of
effects of organic acids on bacteria. Int. J. Food.
MCFAs from selected fat sources by selected
Microbiol. 47: 189-201.
exogenous lipolytic enzymes in simulated pig
Jenkins, A. and Thompson, R. 1993. Does the fatty acid
gastric conditions and their effects on the gut flora
profile trophic effect on the small intestinal
of piglets. Livest. Prod. Sci. 14: 177-193.
mucosa. Gut. 34: 358-364.
Durant, J.A., Corrier, D.E., Byrd, J.A., Stanker, L.A. and
Jorgensen, J.R., Fitch, M.D., Mortensen, P.B. and
Ricke, S.C. 1999. Feed deprivation affects crop
Fleming, S.E. 2001. In vitro absorption of medium
environment and modulates Salmonella enteritidis
chain fatty acids by the rat colon exceeds than short
colonization and invasion of Leghorn hens. Appl.
chain fatty acids. Gastroenterology. 120: 1152-1161.
Environ. Microbiol. 65: 1919-1923.
Jorgensen, J.R., Fitch, M.D., Mortensen, P.B. and Fleming,
Erwin, E.S. 1961. Volatile fatty acid analysis of blood and
S.E. 2002. Absorption and metabolism of octanoate
rumen fluid by gas chromatography. J. Dairy. Sci.
by the rat colon in vivo: concentration dependent by
44: 1768-1771.
and influenced of alternative fuels. Gastroenterology.
Frankel, W.L., Zhang, W., Singh, A., Kiurfeld, D.M., Don,
51: 76-81.
S., Sakata, T., Modling, I and Robeau, J.L. 1994.
Kishi, T., Carvajal, O., Tomoyori, H., Ikeda, I., Sugano,
Mediation of the trophic effects of short chain
M. and Imaizumi, K. 2002. Structured triglycerides
fatty acids on the rat jejunum and colon. Gastroen-
containing medium chain fatty acids and linoleic
terology. 106: 375-380.
acid differently influence clearance rate in serum of
Galluser, M., Crenischow, B., Dreyfus, H., Gosse, F.,
triglycerides in rat. Nutr. Res. 22: 1343-1351.
Guerols, B., Kachelhoffer, J., Doffoel, M. and Raul,
Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.
P. 1993. Comparison of different lipid substrates on
1951. Protein measurement with the folin phenol
intestinal adaptation in the rat. Gut. 34: 1069-1074.
reagent. J. Biol. Chem. 193: 265-275.
Gibson, G.R. 2004. Fibre and effects on probiotics
(the prebiotic concept). Clin. Nutr. Suppl. 1: 25-31.
Goldin, B.R. 1998. Health benefits of probiotics. Br. J.
Nutr. 80: S203-207.
McHan, F. and Shotts, E.B. 1993. Effect of feeding
selected short chain fatty acids on the in vivo
attachment of Salmonella typhimurium in chick
ceca. Avian. Dis. 36: 139-142.
Guillot, B.E., Vaugelade, P., Lemarchai, P., and Reart, A.
Mingrone, G., Greco, A.V., Capristo, E., Benedetti, G.,
1993. Intestinal absorption and liver uptake of
Castagneto, M. and Gabarrini, G. 1995. An improved
medium chain fatty acids in non anaesthetized
GLC method for a rapid, simulataneous analyzed of
pigs. Br. J. Nutr. 69: 431-442.
both medium chain fatty acids and medium chain
258
trigrycerides in plasma. Clin. Chem. Acta. 240:
195-207.
Ockner, R.K., Manning, J.A., Poppenhauser, R.B. and
Ho, W.K.L. 1972. A binding protein for fatty acids
in cytosol of intestinal mucosa, liver, myocardium,
and other tissue. Science 177(43): 56-58.
Takase, S. and Goda, T. 1990. Effects of medium-chain
triglycerides on brush border membrane-bound
enzyme activity in rat small intestine. J. Nutr.
120: 969-976.
van Der Wielen, P.W.J.J., Biesterveld, S., Notemans, S.,
Hofstia, H., Urling, B.A.P. and Van Knapen, F. 2000.
Odle, J. 1997. New insights into the utilization of medium
Role of volatile fatty acids in development of the
chain triglycerides by the neonate: observations
cecal microflora in broiler chickens during growth.
from a piglet model. J. Nutr. 127: 1061-1067.
Appl. Environ. Microbiol. 66: 2536-2540.
Odle, J. 1999. Medium chain triglycerides: a unique
van Immerseel, F., De Buck, J., De Smet, I., Mast, J.,
energy source for neonatal pigs. Pig. News. Inform.
Haese-Brouck, F. and Ducatelle, R. 2002. Dymanics
20: 25N-32N.
of immune cell infiltration in the cecal lamina
Papamandjaris, A.A., Macdougall, D.E. and Jone, P.J.H.
propria of chickens after neonatal infection with a
1998. Medium chain fatty acids metabolism and
Salmonellae Enteritidis strain. Develop. Comp.
energy expenditure: obesity treatment implications.
Immunol. 26: 355-364.
Life. Sci. 62: 1203-1215.
Pubol, M.H. 1991. Ratio of digestive enzymes in the
chick pancreas. Poult. Sci. 70: 337-342.
van Immerseel, F., De Buck, J., Boyen, F., Bohez, L.,
Pasmans, F., Volf, J., Sevcik, M., Rychlik, I.,
Haesebrouck, F. and Ducatelle, R. 2004.
Sakata, T. 1987. Stimulatory effect of short chain fatty
Medium-chain fatty acids decrease colonization
acids on the epithelial cell proliferation in rat
invasion though hil A Suppression shortly after
intestine: a possible explanation for trophic effects
infection of chickens with Salmonellae enterica
of fermentable fiber, gut microbes and luminal
serovar Enteritidis. Appl. Environ. Microbiol.
trophic factors. Br. J. Nutr. 58: 95-103.
70: 3582-3585.
Sissons, J.W. 1989. Potential of probiotic organisms to
Xu, Z.R., Hu, C.H., Xia, M.S., Zhan, X.A. and Wang, M.C.
prevent diarrhea and promote digestion in farm
2003. Effects of Dietary fructooligosaccharide on
animal: review. J. Sci. Food. Agric. 49: 1-13.
digestive enzyme activities, intestinal microflora
Sklan, D. 2001. Development of the digestive tract of
poultry. World. Poult. Sci. J. 57: 414-428.
and morphology of male broilers. Poult. Sci. 82:
1030-1036.
Soerjadi, A.S., Snoeyenbos, G.H. and Olga, M. 1982.
Yason, C.V., Summers, B.A. and Schat, K.A. 1987.
Adherence of Salmonella and native gut microflora
Pathogenesis of rotavirus infection in age groups
to the gastrointestinal mucosa of chicks. Avian.
of chickens and turkeys: Am. J. Vet. Res. 6: 927-938.
Dis. 26: 576-584.
Suzuki, S.K., Ohishi, T., Takahashi, Y., Tamura, M.,
Muramatsu, M., Nakamura, M. and Sato, S. 1992.
The role of 36 megadalton plasmid of Salmonella
Enteritidis for the pathogenesis in mice. J. Vet.
Med. Sci. 54: 845-850.
Yaemmeeklin W. et al./Thai J. Vet. Med. 39(3): 259-265.
259
Original Article
Efficacy of Microsatellite Markers in Parentage
Control in Swine
Wanwisa Yaemmeeklin1 Jutarat Jirasupphachok1 Weerapong Koykul2
Duangsmorn Suwattana1*
Abstract
The efficacy of microsatellite markers was evaluated in order to use in parentage control in swine.
Genomic DNA from 80 samples were extracted, and amplified using 16 microsatellite markers (D00768, KVL9000,
NLRIP0001, S0663, S0710, S0719, S0766, SJ859, SJ923, SJ924, SJ925, SJ926, SJ927, SJ929, X53085 and
X63893) in each single polymerase chain reaction (PCR). The PCR products were analyzed using agarose and
polyacrylamide gel electrophoresis (PAGE). The result showed that 15 microsatellite loci could be amplified
except SJ925. Seven suitable microsatellite markers were selected for parentage control, including D00768,
KVL9000, NLRIP0001, S0663, S0710, S0719, and S0766. Allelic numbers of the selected markers varied from 4 to
8. The values of observed and expected heterozygosities ranged from 0.3250 to 1.0000 and from 0.5456 to 0.8302,
respectively. The polymorphic information content (PIC) was 0.5179-0.8106 and the combined exclusion
probability (CEP) was 0.9946 (99.46%). The results demonstrated that the efficacy of 7 microsatellite loci was
high and they can be used as a powerful tool for parentage control in swine in Thailand.
Keywords : microsatellite marker, parentage control, swine
1
Department of Animal Husbandry 2Department of Veterinary Anatomy, Faculty of Veterinary Science
Chulalongkorn University, Pathumwan, Bangkok 10330 Thailand.
*
Thai J. Vet. Med., 2009. 39(3): 259-265
260
∫∑§—¥¬àÕ
ª√– ‘∑∏‘¿“æ¢Õß‡§√◊ËÕßÀ¡“¬æ—π∏ÿ°√√¡‰¡‚§√·´∑‡∑≈‰≈∑å„π°“√À“§«“¡ —¡æ—π∏åæàÕ
·¡à ≈Ÿ°„π ÿ°√
«—π«‘ “¢å ·¬â¡¡’°≈‘Ëπ1 ®ÿ±“√—μπå ®‘√–»ÿ¿‚™§1 «’√–æß»å ‚°¬°ÿ≈2 ¥«ß ¡√ ÿ«—±≤π1*
°“√»÷°…“¡’«—μ∂ÿª√– ß§å‡æ◊ËÕª√–‡¡‘πª√– ‘∑∏‘¿“æ¢Õß‡§√◊ËÕßÀ¡“¬æ—π∏ÿ°√√¡‰¡‚§√·´∑‡∑≈‰≈∑å„π°“√À“§«“¡ —¡æ—π∏å
æàÕ ·¡à ≈Ÿ° ®“°μ—«Õ¬à“ß¥’‡ÕÁπ‡Õ¢Õß ÿ°√®”π«π 80 μ—«Õ¬à“ß ‚¥¬„™â‡§√◊ËÕßÀ¡“¬æ—π∏ÿ°√√¡‰¡‚§√·´∑‡∑≈‰≈∑å®”π«π 16 μ”·Àπàß
‰¥â·°à D00768, KVL9000, NLRIP0001, S0663, S0710, S0719, S0766, SJ859, SJ923, SJ924, SJ925, SJ926, SJ927,
SJ929, X53085 ·≈– X63893 ∑”°“√‡æ‘¡Ë ®”π«π™‘πÈ à«π¥’‡ÕÁπ‡Õ¥â«¬«‘∏‚’ æ≈‘‡¡Õ‡√ ‡™π√’·Õ§™—π (PCR) ®“°π—πÈ «‘‡§√“–Àåº≈º≈‘μ
PCR ¥â«¬«‘∏’Õ°“‚√ ‡®≈ ·≈–‚æ≈‘Õ§√‘≈“‰¡¥å‡®≈ Õ‘‡≈Á°‚∑√øÕ‡√´‘ (PAGE) º≈°“√»÷°…“æ∫«à“ “¡“√∂‡æ‘Ë¡®”π«π™‘Èπ à«π
¥’‡ÕÁπ‡Õ‰¥â®”π«π 15 μ”·Àπàß ¬°‡«âπμ”·Àπàß SJ925 ∑”°“√§—¥‡≈◊Õ°‡§√◊ËÕßÀ¡“¬æ—π∏ÿ°√√¡‰¡‚§√·´∑‡∑≈‰≈∑å∑’Ë‡À¡“– ¡
„π°“√»÷°…“§√—Èßπ’È‰¥â∑—Èß ‘Èπ®”π«π 7 μ”·Àπàß ‰¥â·°à D00768, KVL9000, NLRIP0001, S0663, S0710, S0719 ·≈– S0766
´÷Ëßμ√«®æ∫®”π«πÕ—≈≈’≈Õ¬Ÿà√–À«à“ß 4-8 Õ—≈≈’≈ πÕ°®“°π’È®“°°“√§”π«≥§à“‡Œ∑‡∑Õ‚√‰´‚°´‘μ‘®“°°“√ —ß‡°μ (Hobs) ·≈–®“°
∑ƒ…Æ’ (Hexp) æ∫«à“¡’§à“ 0.3250-1.0000 ·≈– 0.5456-0.8302 μ“¡≈”¥—∫ §à“‚æ≈’¡Õ√åøî§Õ‘πøÕ√å¡‡¡™—Ëπ§Õπ‡∑âπ∑å (PIC) ¡’
§à“ 0.5179-0.8106 ·≈– §à“§«“¡·¡àπ¬”„π°“√«‘‡§√“–Àåº≈‡¡◊ËÕπ”‡§√◊ËÕßÀ¡“¬‰ª„™âß“π√à«¡°—π (CEP) ¡’§à“‡∑à“°—∫√âÕ¬≈– 99.46
„π°“√»÷°…“§√—Èßπ’È· ¥ß„Àâ‡ÀÁπ«à“‡§√◊ËÕßÀ¡“¬æ—π∏ÿ°√√¡‰¡‚§√·´∑‡∑≈‰≈∑å∑—Èß 7 μ”·Àπàß ¡’ª√– ‘∑∏‘¿“æ„π°“√„™âß“π Ÿß ·≈–
“¡“√∂„™â‡ªìπ‡§√◊ËÕß¡◊Õ ”À√—∫μ√«® Õ∫§«“¡ —¡æ—π∏åæàÕ ·¡à ≈Ÿ°¢Õß ÿ°√„πª√–‡∑»‰∑¬‰¥â¥’
§” ”§—≠ : ‡§√◊ËÕßÀ¡“¬æ—π∏ÿ°√√¡‰¡‚§√·´∑‡∑≈‰≈∑å §«“¡ —¡æ—π∏åæàÕ-·¡à-≈Ÿ° ÿ°√
1
*
¿“§«‘™“ —μ«∫“≈ 2¿“§«‘™“°“¬«‘¿“§»“ μ√å §≥– —μ«·æ∑¬»“ μ√å ®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬ ª∑ÿ¡«—π °√ÿß‡∑æœ 10330
Introduction
and parentage identification. Microsatellite DNAs, which
Swine production in Thailand has been continuously
are simple nucleotide repeats, have been widely used as
developed by the import of high quality breeding stock
markers in parentage control due to their high degree of
and semen from abroad. In addition, breeding and
polymorphism. The number and pattern of microsatellite
selection have been applied to increase the domestic
marker alleles vary in each animal, animals in each
production. Therefore, genetic parameters in terms of
population and animals in different populations (Toth
pedigree and progeny records, play an important role in
et al., 2000). In addition, microsatellite DNAs can be
swine breeding (Weller et al., 2004). It is estimated that
multiplied in numbers using polymerase chain reaction
20% discrepancies in progeny records could lead to a
(PCR) in which a marker of 200-600 bp with tri-
significant decrease in genetic progress calculated by
or tetranucleotide repeats, has been shown to be the most
Best Linear Unbiased Prediction (BLUP) (Banos et al.,
suitable (Lai and Sunny, 2003). The global objectives of
2001). Based on this, incomplete records on mating,
this study were to evaluate the efficacy of microsatellite
transfer of piglets, and use of multiple sires, could hamper
markers in order to use in parentage control and
the progress in swine breeding. At present, advances in
identification of swine in Thailand.
molecular genetic techniques allow the possibility of
testing on genetic polymorphism, phylogenetic studies
261
Results
Animals: Blood and semen samples were collected
PCR Products: Amplifications of microsatellite DNAs
from two groups of swine: the non- and the genetically
using polymerase chain reactions resulted in PCR
related groups. The non-genetically related group consisted
products of all markers except SJ925. Analyses of DNA
of 26 animals from two farms in Ratchaburi province
fragments using polyacrylamide gel electrophoresis
and 14 animals from a farm in Chai-nart province.
(PAGE) revealed that only 7 markers demonstrated
Animals in this group served to provide information on
polymorphism suitable for using in parentage control.
the polymorphism and diversity of each microsatellite
These markers included D00768, KVL9000, NLRIP0001,
marker. The genetically related group comprised 40
S0663, S0710, S0719 and S0766.
animals from farms in Nakornpathom province and Chai-
Microsatellite Polymorphism: The number, distribution
nart province. Swine in this group provided results
pattern and frequency of alleles of 7 polymorphic markers
from the comparison of progeny records and parentage
and the values of observed heterozygosity, expected
identification using microsatellite markers.
heterozygosity and Polymorphic Information Content, are
Microsatellite markers: Sixteen microsatellite loci
shown in Table 2. It was found that each of 7 loci expressed
were selected from the database of the National Center for
different patterns of allele frequency and PIC values
Biotechnology Information (NCBI, 2008) by choosing
with a marker S0663 expressing the highest number of
tri- or tetranucleotide repeats with the number of 100 bp or
alleles and PIC value (Figure 1 and Table 2). The tested
more, as shown in Table 1.
markers can be categorized into two groups: those of
DNA analyses: DNA was isolated from collected
almost equal proportions for each frequency (D00768,
®
samples using QIAamp DNA Mini Kit, according to
KVL9000 and S0663), and those with varied allele
the manufacturerís instruction. Isolated DNAs were
proportions (NLRIP0001, S0710, S0719 and S0766), as
assessed and quantified using agarose gel electrophoresis
shown in Figure 2.
before subjected to polymerase chain reaction (PCR)
Efficacy of Microsatellite Markers: Estimation of
using each primer of 16 selected microsatellite markers.
Exclusion Probability (EP) and Combined Exclusion
The annealing temperatures for PCR ranged from 56 to
Probability (CEP) for 7 microsatellite loci revealed that
60 oC. PCR products were then run on agarose gel
S0663 expressed the highest EP value (0.6692) while S0710
electrophoresis to assess their quality and quantity,
had the lowest (0.3443). Combined Exclusion Probability
before subjected to polyacrylamide gel electrophoresis
values from the combination of 2 to 7 markers ranged
(PAGE). Allele sizes of each marker shown on PAGE
from 0.8716 to 0.9946. Therefore, using all 7 markers in
were recorded.
parentage identification could yield the accuracy to the
Statistical analyses: Allele frequency, observed
degree of 99.46%. Results of parentage identification
heterozygosity (Hobs) and expected heterozygosity
using microsatellite markers corresponded to the
(H exp ) were calculated according to the methods
progeny record of the genetically related group. Exclusion
described by Nei (1978). Efficacy of microsatellite
Probability and CEP values from 80 samples are shown in
markers were evaluated using Polymorphic Information
Table 3 and the relationship between EP values and the
Content (PIC) (Bolstein et al., 1980), Exclusion
number of markers used is shown in Figure 3.
Probability (EP) (Wang, 2007) and Combined Exclusion
Probability (CEP) (Jamieson and Taylor, 1997).
262
Table 1 Microsatellite markers
Locus name
Primer sequences (5'-3')
Core sequences Approximated Accession no.
Size (bp)
D00768
F: GACACAGTGGATGGCATTTG
(CTTT)n
340
D00768
(GATA)n
260
EU010405
(TTTC)n
340
AY740518
(ATAG)n
240
AJ544213
(TAAA)n
330
AY253998
(GAAA)n
600
AY451240
(GAAA)n
620
AY731063
(TTTG)n
330
AB248496
(CAA)n
200
AB248491
(AAC)n
230
AB248492
(TTG)n
380
AB248490
(TTA)n
240
AB248494
(TTG)n
270
AB248493
(TTTG)n
330
AB248487
(AGGA)n
400
X53085
(GCC)n
120
X63893
R: ACATCCCTAAGGTCGTGGC
KVL9000
F: TGCAAAGTTTGGGACATCAG
R: AGGTGCTGAGGATACAGTGG
NLRIP0001
F: GATCTCAGCTTCAATACCTCC
R: GATCCTGTATTGCTGTGGCTG
S0663
F: TGGTTCGGGAACATAGGAAAAG
R: AGCTGGGTCCTCCATATGCTG
S0710
F: CTCAGCACCTTACAAACC
R: TCCCAAACCAATCCACAC
S0719
F: TCTCCAAGTCCAGGAACTTGC
R: TCGCCATACTCTTCTAATGGC
S0766
F: GTGTAGATATGTGTCTGTACA
R: AGACCTCCTATTAGAGGTGGA
SJ859
F: TCAAGAGAAAAGGACAAAATC
R: ATGAAGAGGTGGAGACTGTG
SJ923
F: CCAAGAAATAGCAACAACAA
R: AGATGATTTGGTTTGGTCTTA
SJ924
F: GATTTGTTTCCGCTGAGCCA
R: TGGGCTCACAGGCACAGTATC
SJ925
F: CACAAAGGAGGAGGCTGGAAT
R: TTGCTGTGGTCTGGCGTAGG
SJ926
F: CTACCACTGAGCCACAAGAG
R: TGGTGTAGATTTCAGATGCTG
SJ927
F: CTCAGTGTGGCATTCAGGTC
R: TGACCTACACCACAGCTCATG
SJ929
F: ATGACCCAGGAACAAGGATAG
R: TCAAAGAAATGGGGAAACAG
X53085
F: TGTTCAGTGGGTTAAGGATCG
R: TTCCCTACACCCTGCCTTC
X63893
F: GGGTCAGACCGACACCAC
R: GGTCTTGCTGTTTCCGAGAC
Sources: National Center for Biotechnology Information (NCBI)
263
Table 2 The number, distribution pattern and frequency of alleles; Observed and expected heterozygosities and
Polymorphic Information Contents of 7 microsatellite markers.
Markers
S0663
D00768
KVL9000
S0719
NLRIP0001
S0766
S0710
No. of alleles
8
6
7
5
6
4
6
Alleles
frequency (n=80)
A
0.2938
0.0812
0.1750
0.1563
0.4313
0.3625
0.6500
B
C
D
E
F
G
H
HObs
Hexp
0.0562
0.0562
0.1187
0.1063
0.1000
0.1875
0.0813
0.6375
0.8302
0.0750
0.2063
0.2625
0.1625
0.2125
0.0750
0.0937
0.0563
0.3375
0.2125
0.0500
0.3438
0.1437
0.0437
0.3125
0.1938
0.2062
0.0250
0.0750
0.0687
0.0937
0.4688
0.0750
0.0440
0.0810
0.0875
0.1250
0.0125
0.7125
0.8048
0.8875
0.7902
0.3250
0.7372
0.6750
0.7229
1.0000
0.6345
0.6250
0.5456
χ2
4.3101
1.0522
1.2129
25.0112
0.3512
26.5460
1.6943
PIC
0.8106
0.7760
0.7623
0.6926
0.6841
0.5665
0.5179
Table 3 Exclusion Probability (EP) and Combined Exclusion Probability (CEP) values of 7 microsatellite markers.
Exclusion probability (EP)
Markers
2 loci
3 loci
4 loci
5 loci
6 loci
7 loci
S0663
0.6692
0.6692
0.6692
0.6692
0.6692
0.6692
D00768
KVL9000
0.6117
0.6117
0.5992
0.6117
0.5992
0.6117
0.5992
0.6117
0.5992
0.6117
0.5992
0.5009
0.5009
0.4991
0.5009
0.4991
0.3647
0.5009
0.4991
0.3647
S0719
NLRIP0001
S0766
S0710
CEP
0.3443
0.8716
0.9485
0.9743
0.9871
0.9918
Figure 1 Distribution of alleles from marker S0663, ranging between 200-300 bp.
0.9946
264
0.7
Observed and expected heterozygosities were
Allele frequency
0.6
estimated in order to assess the heterozygous state of
0.5
Allele a
Allele b
0.4
Allele c
Allele d
0.3
Allele e
0.2
Allele f
Allele g
0.1
each genotype. It was found that Hobs of S0719 was
significantly lower than its Hexp, indicating that most of
their genotypes were homozygous. By the contrary, the
Hobs of S0766 was significantly higher than its Hexp,
Allele h
suggesting that a majority of their genotypes were
0
S0663
KVL9000
D00768 NLRIP0001
S0710
S0719
S0766
heterozygous. In addition, Hexp and PIC values of each
Figure 2 Distribution of alleles for each locus of 7
polymorphic markers.
microsatellite locus expressed propensity of either an
Exclusion Probability
Locus name
increase or a decrease towards the same direction. This
1.2
means that Hexp values can also be used to evaluate the
1
efficacy of markers when PIC values are not available.
0.8
In the present study, S0663 appeared to be the most
0.6
efficient marker (with the highest PIC and Hexp values)
0.4
whereas S0710 was the least efficient, with the lowest
0.2
PIC and Hexp values. Since PIC and Hexp values were
0
1
2
3
4
5
6
7
Number of marker
Figure 3 Relationship between EP values and the number
of markers used.
estimated from the number and frequency of alleles,
these two parameters should be considered for the
evaluation of efficacy for each marker (Radko and Slota,
2007).
Exclusion Probability (EP) and Combine Exclusion
Discussion
Probability (CEP) values were used to determine the
From 16 microsatellite loci tested, only 7 markers
efficacy of using microsatellite markers in parentage
including D00768, KVL9000, NLRIP0001, S0663, S0710,
identification. It is normally found that the CEP value
S0719 and S0766, demonstrated polymorphism suitable
increases according to the number of markers used, in
for using in parentage identification and control. Markers
combination. In this study, when all 7 microsatellite loci
D00768, KVL9000 and S0663 expressed the number of
were used, the CEP value was 0.9946, indicating that the
alleles and PIC values as 6, 7, 8 and 0.7760, 0.7623, 0.8106,
accuracy of using these markers combined, would be
respectively. These 3 markers indicated high efficacy since
99.46%. In general, CEP values could be increased
their PIC values were close to 1.000 (Jakabova et al., 2002).
when more markers were utilized although it was not
For markers NLRIP0001, S0710, S0719 and S0766, their
true in all cases, depending on the quality of markers
numbers of alleles were 6, 6, 5 and 4 respectively and the
used. Putnova et al. (2003) applied 10 microsatellite loci
PIC values ranged from 0.5179 to 0.6926, indicating of
in parentage identification in swine and found that the CEP
their moderate efficacy. However, Chen et al. (2006)
value was as high as 0.9994 (99.94%) whereas Rohrer et
reported the PIC values of S0710, S0719 and S0766 as
al. (2007) utilized 10 markers and the CEP value was 0.9904
0.74, 0.94 and 0.86 respectively, which were somewhat
(99.04%), which was lower than that in our study (using 7
different from those in our study, suggesting that efficacy
markers). However, when the number of markers used was
of microsatellite markers could vary among different
put up to 15, the CEP value could be near 100% as in one
populations.
study in swine (Nechtelberger et al., 2001). Therefore, the
number of markers to be used should be considered
along with other factors such as cost and time, in order
to reach the accepted accuracy.
In conclusion, for all 80 swine used in this study,
we were able to utilize 7 microsatellite markers in order
to identify and differentiate each animal with 99.46%
accuracy, indicating that there was only 0.54% chance
that two animals would be identically similar and
identified as one. Therefore, all seven markers selected
in this study are suitable for using in swine parentage
control in Thailand since the results corresponded to the
pedigree record of the genetically related group. However,
2-3 microsatellite loci with PIC values between 0.8-0.9,
can be added in order to increase the accuracy to 99.99%.
Acknowledgments
The authors would like to thank Dr. Teewakorn
Sirichokchatchawan for kindly providing samples used in
this study, and the Innovation Center for Veterinary
Science, Chulalongkorn University for facilitating all
necessary equipments. This work was supported by
grants from the Graduate School and Faculty of
Veterinary Science, Chulalongkorn University, Bangkok,
Thailand.
References
Banos, G., Wiggans, G.R. and Powell, R.L. 2001. Impact
of paternity errors in cow identification on genetic
evaluation and international comparisons. J. Dairy
Sci. 84: 2523-2529.
Botstein, D., White, R.L., Skolnick, M. and Davis, R.W.
1980. Construction of a genetic linkage map in man
using restriction fragment length polymorphisms.
Am. J. Hum. Genet. 32: 314-331.
Chen, K., Knorr, C., Bornemann-Kolatzki, K., Huang, L.,
Rohrer, G.A. and Brenig, B. 2006. Characterization
of the PGK2 associated microsatellite S0719 on
SSC7 suitable for parentage and QTL diagnosis.
Anim. Biotech. 17: 43-49.
265
Jakabova, D., Trandzik, J., Chrastina, J., Hudecova, L.,
Zetochova, E., Bulla, J., Bugarsky, A., Jakab, F.
and Kozlik, P. 2002. Effectiveness of six highly
polymorphic microsatellite markers in resolving
paternity cases in Thoroughbred horses in Slovakia.
Czech J. Anim. Sci. 47: 497-501.
Jamieson, A. and Taylor, S.S. 1997. Comparisons of
three probability formulae for parentage exclusion.
Anim. Genet. 28: 397-400.
Lai, Y. and Sunny, F. 2003. The relationship between
microsatellite slippage mutation rate and the number
of repeat units. Mol. Biol. Evol. 20: 2123-2131.
NCBI. 2008. “CoreNucleotide” [Online]. Available:
http://www.ncbi.nlm.nih.gov/.
Nechtelberger, D., Kaltwasser, C., Stur, I., Meyer, J-N.,
Brem, G., Mueller, M. and Mueller, S. 2001. DNA
microsatellite analysis for parentage control in
Austrian pigs. Anim. Biotech. 12: 141-144.
Nei, M. 1978. Estimation of average heterozygosity and
genetic distance from a small number of individuals.
Genetics 89: 583-590.
Putnova, L., Knoll, A., Dvorak, V. and Dvorak, J. 2003.
A novel porcine microsatellite panel for the
identification of individuals and parentage control
in the Czech Republic. Czech J. Anim. Sci. 48:
307-314.
Radko, A. and Slota, E. 2007. Polymorphism of 11
microsatellite DNA sequences used for parentage
control in Holstein-Friesian bulls of black and white
variety in Poland. Ann. Anim. Sci. 2: 189-196.
Rohrer,G.A., Freking, B.A. and Nonneman, D. 2007. Single
nucleotide polymorphisms for pig identification
and parentage exclusion. Anim. Genet. 38: 253-258.
T?th, G., G?spari, Z. and Jurka, J. 2000. Microsatellites in
different eukaryotic genomes: survey and analysis.
Genome Res. 10: 967-981.
Wang, J. 2007. Parentage and sibship exclusions: higher
statistical power with more family members.
Heredity 99: 205-217.
Weller, J.L., Feldmesser, E., Golik, M. Tager-Cohen I.,
Domochovsky, R., Alus, O. Ezra, E. and Ron, M.
2004. Factors affecting incorrect paternity
assignment in the Israeli Holstein population.
J. Dairy Sci. 87: 2627-2640.
Pakpinyo S. et al./Thai J. Vet. Med. 39(3): 267-273.
267
Original Article
Surveillance of Mycoplasma synoviae Infection in
Mixed Thai Native Chickens in the Area of
Nakornpathom Province
Somsak Pakpinyo1* Somkid Khanda2 Supanat Boonyapisitsopa1
Abstract
This study was to conduct a surveillance of Mycoplasma synoviae (MS) infection in mixed Thai native
chickens. Samples were submitted from 30 mixed Thai native chicken flocks, 15 birds per flock, aged between
1-4.5 months in the area of Nakornpathom province in the September 2005-October 2006 period. Each bird was
bled for MS serology by serum plate agglutination (SPA) and enzyme linked immunosorbent assay (ELISA) test
kits and swabbed for MS antigen detection by polymerase chain reaction (PCR) technique. Results revealed that
the positive reactors detected by the SPA test, ELISA and PCR procedure were 12, 9 and 8 flocks, respectively.
There were 4 flocks that were detected to have positive reactors in all tests. The percentage of positive results
depending on age: 1 month, 1-2 months, 2-3 months and 3-4.5 months tested by SPA, ELISA and PCR was 0-60%,
0-60% and 0-50%, respectively. This study found that the older the flock the higher the number of positive
reactors found. MS DNA was determined in birds older than 2 months. Even so, clinical signs were not observed
in the MS infected flocks in practical field.
Keywords : ELISA, mixed Thai native chickens, Mycoplasma synoviae, PCR, SPA
1
Department of Veterinary Medicine, Faculty of Veterinary Science, Chulalongkorn University, Pathumwan, Bangkok 10330, Thailand
2
Livestock Hospital, Faculty of Veterinary Science, Chulalongkorn University, Nakornpathom 73000, Thailand
*
Thai J. Vet. Med., 2009. 39(3): 267-273
268
∫∑§—¥¬àÕ
°“√ ”√«®°“√μ‘¥‡™◊ÕÈ ¡—¬‚§æ≈“ ¡“ ´‘π‚π«’Õ’ „π‰°àº ¡ “¡ “¬æ—π∏ÿ„å πæ◊πÈ ∑’®Ë ß— À«—¥π§√ª∞¡
¡»—°¥‘Ï ¿—§¿‘≠‚≠1* ¡§‘¥ ¢“π¥“2 ÿ¿≥—∞ ∫ÿ≠≠“¿‘ ‘∑∏‘Ï‚ ¿“1
°“√»÷°…“§√—Èßπ’È¡’«—μ∂ÿª√– ß§å‡æ◊ËÕ ”√«®°“√μ‘¥‡™◊ÈÕ ¡—¬‚§æ≈“ ¡“ ´‘π‚π«’Õ’ „π‰°àº ¡ “¡ “¬æ—π∏ÿå∑’Ë‡≈’È¬ß„π‡¢μ®—ßÀ«—¥
π§√ª∞¡√–À«à“ß‡¥◊Õπ °—π¬“¬π 2548 ∂÷ß μÿ≈“§¡ 2549 ®”π«π 30 ΩŸß √–À«à“ßÕ“¬ÿ 1- 4.5 ‡¥◊Õπ ‰°à·μà≈–μ—«∂Ÿ°π”¡“‡®“–‡≈◊Õ¥
‡æ◊ËÕμ√«®¥â«¬«‘∏’∑“ß´’√—¡«‘∑¬“ §◊Õ ´’√—¡‡æ≈∑·Õ°°≈Ÿμ‘‡π™—π (‡Õ æ’‡Õ) ·≈–™ÿ¥∑¥ Õ∫Õ’‰≈´“ ·≈–∂Ÿ°π”¡“ªÑ“¬‡™◊ÈÕ‡æ◊ËÕμ√«®¥â«¬
«‘∏’À“ “√æ—π∏ÿ°√√¡ (æ’´’Õ“√å) ¢Õß‡™◊ÈÕ‡ÕÁ¡‡Õ º≈æ∫«à“‰¥âº≈∫«°¥â«¬«‘∏’∑¥ Õ∫‡Õ æ’‡Õ Õ’‰≈´“ ·≈–æ’´’Õ“√å ®”π«π 12 ΩŸß 9 ΩŸß
·≈– 8 ΩŸß μ“¡≈”¥—∫ ‚¥¬¡’ 4 ΩŸß∑’Ëæ∫º≈∫«°∑—Èß 3 «‘∏’ ‡¡◊ËÕ·∫àß°≈ÿà¡°“√»÷°…“ÕÕ°μ“¡™à«ßÕ“¬ÿ ¥—ßπ’È 1 ‡¥◊Õπ 1-2 ‡¥◊Õπ 2-3 ‡¥◊Õπ
·≈– 3-4.5 ‡¥◊Õπ æ∫º≈∫«°¥â«¬«‘∏’°“√∑¥ Õ∫‡Õ æ’‡Õ Õ’‰≈´“ ·≈–æ’´’Õ“√å √–À«à“ß√âÕ¬≈– 0-60, 0-60 ·≈– 0-50 μ“¡≈”¥—∫
®“°¢âÕ¡Ÿ≈°“√»÷°…“§√—Èßπ’È™’È„Àâ‡ÀÁπ«à“‰°àº ¡ “¡ “¬æ—π∏ÿå∑’Ë¡’Õ“¬ÿ¡“°¢÷Èπ¡’‚Õ°“ æ∫°“√μ‘¥‡™◊ÈÕ‡ÕÁ¡‡Õ ¡“°¢÷Èπ¥â«¬ ‚¥¬®–æ∫
“√æ—π∏ÿ°√√¡¢Õß‡™◊ÈÕ‡ÕÁ¡‡Õ „πΩŸß‰°à∑’Ë¡’Õ“¬ÿ¡“°°«à“ 2 ‡¥◊Õπ¢÷Èπ‰ª ·¡â®–‰¡à¡’°“√· ¥ßÕ“°“√∑“ß§≈‘π‘°ÕÕ°¡“„Àâ —ß‡°μ‰¥â
§” ”§—≠ : Õ’‰≈´“ ‰°àº ¡ “¡ “¬æ—π∏ÿå ¡—¬‚§æ≈“ ¡“ ´‘π‚π«’Õ’ æ’´’Õ“√å ‡Õ æ’‡Õ
1
¿“§«‘™“Õ“¬ÿ√»“ μ√å §≥– —μ«·æ∑¬»“ μ√å ®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬ ª∑ÿ¡«—π °√ÿß‡∑æœ 10330
‚√ßæ¬“∫“≈ª»ÿ —μ«å §≥– —μ«·æ∑¬»“ μ√å ®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬ π§√ª∞¡ 73000
*
ºŸâ√—∫º‘¥™Õ∫∫∑§«“¡: E-mail: [email protected]
2
Introduction
infection. Respiratory rales frequently occur in birds
Mycoplasma synoviae (MS) is known as a
infected with MS alone. Live viral vaccines including
subclinical infection of the upper respiratory tract in
Newcastle and/or infectious bronchitis possibly increase
poultry. The complication with Newcastle and/or
the severity of airsacculitis in MS infected birds, especially
infectious bronchitis infection causes airsacculitis
in broiler chickens. MS infected layer chickens
(Kleven, 2003). Furthermore, infectious synovitis can be
apparently experience a drop in egg production up to
found in birds which have a systemic infection, leading to
10% at the beginning or almost point of peak of laying for
inflammation of the tendons or bursa sheath. Birds show
6-10 weeks.
clinical signs that include respiratory and/or lameness
MS transmission occurs via horizontal that birds
resulting in economic losses due to retarded growth,
can be infected by MS contaminated materials (Marois
decrease in egg production, infertility and hatchability
et al., 2005) or by infected bird to normal bird and/or
and ending with carcass condemnation (King et al.,
vertical transmission. For vertical transmission, MS
1973; Kleven, 2003). Chickens, turkeys and guinea
organisms from hens can be transferred to their progeny
fowls are natural hosts. Pheasants, ducks, and geese are
(Kleven, 2003).
susceptible to experimental infection (reviewed by Kleven,
MS infection can be diagnosed by 2 major
2003). All ages of chickens can be naturally infected,
methods: serology and antigen detection. Serology can be
starting at 1 week old but the disease is commonly found
assessed by serum plate agglutination (SPA) or rapid plate
at 4-16 weeks old (Kleven, 2003). The morbidity rate is
test (RPT) hemagglutination inhibition (HI) and enzyme
high, possibly up to 100%, whereas the mortality rate is
linked immunosorbent assay (ELISA), whereas antigen
low ranging 1-10% as long as there is no secondary
detection uses culture and polymerase chain reaction
269
(PCR). For the culture method, a colony of mycoplasmas
with 15% swine serum (FMS) (Kleven, 1998) and
needs to be isolated and identified as a MS colony by an
submitted to the laboratory for DNA detection by PCR
immunofluorescent antibody technique (Corstvet and
technique.
Sadler, 1964; Talkington and Kleven, 1983). However,
the culture method is time consuming and laborious. PCR
detection is the simple, rapid and highly sensitive method
for MS infection (reviewed by Kleven, 2003).
MS serology:
SPA procedure: Fresh sera were tested with MS
antigen (Nobilis®, Intervet International B.V., Holland)
In Thailand, some broilers and broiler breeder
following the manufacturer’s instructions. Briefly,
farms have been found the MS infection; therefore, these
thirty μl of serum were mixed with 30 μl of antigen then
infected farms have established a MS clean status of
incubated at room temperature for 1-2 min before the
breeder flocks by prevention, control and a biosecurity
result could be observed. Negative and positive sera were
program. As we know, most backyard chickens or mixed
also included in each test. Sera were then stored at -20oC
Thai native chickens are owned by small farm holders, who
for ELISA determination.
usually have inadequate biosecurity that easily introduces
ELISA: Frozen sera were completely thawed at
MS organisms into the farms. However, no reports of
room temperature (25oC) before testing. All procedures
MS infection in mixed Thai native chickens have been
were done at room temperature. Sera were tested with
determined. Therefore, this study was to determine the
commercial test kits, ProFLOK® (Synbiotics Corporation,
surveillance and monitoring MS status in mixed Thai
USA) following the manufacturers’ instructions. Briefly,
native chickens. The data of this study will be useful for
diluted sera were added into MS antigen-coated plate,
growers, veterinarians and servicemen to prevent and
incubated, washed then peroxidase-labeled anti-chicken
control MS infection on farms. The objective of this study
antibody (conjugated antibody) was added. After
was to investigate the surveillance of MS infection in
incubation, the plate was washed then a substrate was
mixed Thai native chickens in Nakornpathom province
added and, finally, the stop solution was added. The
by serology and PCR technique.
plate was read in an ELISA reader at 405-410 nm
manufactured by Labsystems Multiskan MS Type 352,
Finland. The optical density of the negative and positive
Samples were submitted from 30 mixed Thai
controls and the samples was calculated then interpreted
native chicken flocks in the area of Nakornpathom
according to the manufacturers’ instruction. For
province, 15 birds per flock, aged between 1-4.5 months
the interpretation of ELISA, titer levels 0-269, 270-743,
and having had general vaccination program including
and equal or higher than 744 were negative, suspicious
Newcastle disease and infectious bronchitis disease
and positive reactors, respectively.
vaccines without MS vaccination during the September
DNA detection.
2005-October 2006 period. Most flocks were in a
PCR procedure: The broth sample was
healthy condition but only flock I.D. 4, 10, 12 and 24
individually determined in this study. This method is
showed mild respiratory signs while collecting samples.
described by Lauerman (1998). Briefly, the broth was
Individual birds were bled at the wing vein, swabbed at
extracted for DNA template by centrifugation at
the choanal cleft and then the numbers of blood and
15,000xg, washed with distilled water, followed by dilute
swab samples were identified. The blood samples were
pellete with distilled water, boiling for 10 min, then
separated for MS serology. The swab samples were
placed at -20oC for 10 min, ending with centrifugation and
inoculated into 2 ml of Frey’s broth medium supplemented
collection of the supernatant at -20oC until use. For PCR
270
mixture in 50 μl volume, KCl 500 mM, Tris-HCl (pH 8.3)
reactor in the same flock (flock I.D. 22). In this study, the
100 mM, dNTP (Fermentas) 1 mM, primer MSL-1
SPA could more rapidly detect the positive reactor
(5'-GAAGCAAAATAGTGATATCA-3') and primer
compared with the ELISA. Generally, the SPA test can be
MSL-2 (5'-GTCGTCTCCGAAGTTAACAA-3') (Qiagen)
used as a screening test for MG infection and generally
10 pmole each, Taq polymerase (Fermentas) 1.25 U,
shows positive reactors at about 7-10 days post
MgCl2 1.25 mM and DNA template 5 μl (250 ng). MG
vaccination or after inoculation because SPA detects
strain S6 (ATCC 15302) and MS strain WVU 1853
immunoglobulin (IgM), which is the first immuno-
(ATCC 25204) were used as negative and positive
globulin to be formed after infection (Kleven 1975;
controls, respectively. PCR mixtures were amplified in
Kleven, 1981). In contrast to Ewing et al. (1996), they
a DNA thermal cycler (PCR Sprint, Thermo Electron
found that the SPA may not be sensitive to detect the
Corporation, Milford, MA) with 94oC for 30 sec, 55oC
early stage of MS infection in some flocks, whereas the
o
for 30 sec and 72 C for 60 sec for 40 cycles and followed
o
ELISA and PCR can detect them. Interestingly, Ewing
by 72 C for 5 min. The PCR product was analyzed in 2%
et al. (1996) suggested that ELISA should be considered
agarose gel (Pharmacia Biotech AB, Uppsala, Sweden),
as a serologic screening in stead of SPA. Several reports
stained with ethidium bromide, visualized by UV
suggested that the ELISA should be used as the
transilluminator, and photographed.
screening test instead of the SPA (Higgins and Whithear,
1986; Opitz et al., 1983; Patten et al., 1984). The
Results
advantages of the SPA are more convenience in the field,
The numbers of MS-positive flocks tested by SPA,
rapid diagnosis, no requirement for special equipment
ELISA and PCR were 12 (flock numbers 4, 7, 8, 10, 12,
and/or technicians. Unfortunately, the PCR procedure
15, 17, 21, 22, 23, 24 and 27), 9 (flock numbers 2, 4, 10,
could not detect the MS DNA in birds aged 1-2 month
11, 12, 22, 24, 25 and 27) and 8 flocks (flock numbers
contrasting with the SPA and ELISA. Regularly, the PCR
4, 8, 9, 10, 12, 17, 18 and 24), respectively. In addition,
procedure could detect MS antigen more rapid and
there were 15 suspected flocks tested by ELISA (flock
sensitive in tissues and culture medium compared with
number 1, 2, 9, 11, 13, 15, 17, 18, 21, 22, 23, 25, 26, 27
isolation and identification (Salisch et al., 1998). The
and 28). Overall, there were 4 flocks (flock numbers 4,
probable reason is due to collecting sample techniques or
10, 12 and 24) that detected the positive reactor in all
the very low numbers of MS organisms in the sample.
tests (Table 1). The percentage of positive results
The percentage of positive flocks of birds, aged over 2
depending on age 1 month, 1-2 months, 2-3 months and
months, detected by the SPA was the same as that
3-4.5 months tested by SPA, ELISA and PCR was
detected by the ELISA, but only five of the thirteen
0-60%, 0-60% and 0-50%, respectively (Table 2).
flocks showed the same positive flocks (flock I.D. 4, 10,
12, 24 and 27). In addition, the flock I.D. 8 and 17 that
Discussion
MS infection was detected by the MS PCR and SPA, not
This study revealed that the mixed Thai native
ELISA indicating that the SPA was much more sensitive
chickens raised by small farm holders in the area of
than the ELISA. Even though the SPA may not be
Nakornpathom province were diagnosed as MS infection
suggested for use as the serologic screening test (Ewing
at older than 1 month. No tests could detect the positive
et al., 1996), but the result of this study and the advantages
reactors against MS infection at 1 month old. At 1-2 month
of this test including simple, no machine requirement
old, the SPA and ELISA detected positive reactors against
and rapid diagnosis shows that the SPA may be suitable
MS infection. Moreover, both tests showed the positive
to use in the field. At 1 month old, no antibody responses
271
Table 1 Number of positive flocks tested by SPA, ELISA and PCR
Flock I.D.
Age (month)
Numbers
Submission
of samples
date
Number of positive flocks/total
SPA
ELISA
PCR
(Suspected)
1
2
15
14/09/2005
0/15
0/14, (1/1)
0/15
2
3.5
15
21/09/2005
0/15
1/12, (3/3)
0/15
3
2
15
28/09/2005
0/15
0/15
0/15
4
4.5
15
28/09/2005
15/15
14/14, (1/1)
14/15
5
1
15
28/09/2005
0/15
0/15
0/15
6
2
15
09/11/2005
0/15
0/15
0/15
7
1.7
15
16/11/2005
15/15
0/15
0/15
8
3
15
07/12/2005
2/15
0/15
7/15
9
3
15
07/12/2005
0/15
0/14, (1/1)
15/15
10
3
15
07/12/2005
15/15
14/15
3/15
11
3
15
07/12/2005
0/15
1/14, (1/1)
0/15
12
3.5
15
23/07/2005
15/15
12/12, (3/3)
14/15
13
2
15
11/01/2006
0/15
0/12, (3/3)
0/15
14
2
15
18/01/2006
0/15
0/15
0/15
15
1.5
15
31/03/2006
3/15
0/14, (1/1)
0/15
16
2
15
04/04/2006
0/15
0/15
0/15
17
3
15
11/04/2006
9/15
0/14, (1/1)
1/15
18
2
15
20/04/2006
0/15
0/12, (3/3)
3/15
19
1
15
20/04/2006
0/15
0/15
0/15
20
1
15
26/04/2006
0/15
0/15
0/15
21
2
15
01/05/2006
1/15
0/14, (1/1)
0/15
22
1.5
15
16/05/2006
3/15
1/8, (7/7)
0/15
23
4
15
19/07/2006
2/15
0/9, (6/6)
0/15
24
4
15
16/082006
15/15
14/14, (1/1)
14/15
25
3
15
30/08/2006
0/15
2/10, (5/5)
0/15
26
1
15
06/09/2006
0/15
0/14, (1/1)
0/15
27
2.5
15
28/09/2006
6/15
3/8, (7/7)
0/15
28
3
15
19/10/2006
0/15
0/13, (2/2)
0/15
29
1
15
27/10/2006
0/15
0/15
0/15
30
1
15
27/10/2006
0/15
0/15
0/15
272
Table 2 Percentage of positive results depending on age: 1 month, 1-2 months, 2-3 months and 3-4.5 months tested by
SPA, ELISA and PCR.
Age
Number of flocks
Number of positive flocks (%)
(month)
SPA
ELISA
PCR
1
6
0
0
0
1-2
11
4 (36.4%)
1 (9.1%)
0
2-3
8
4 (50%)
4 (50%)
4 (50%)
3-4.5
5
3 (60%)
3 (60%)
2 (40%)
and/or evidence of MS infection were observed in this
The PCR procedure could firstly detect the MS
study. The incubation period of MS generally ranges
DNA at 2 months old. For example, the flock I.D. 18 found
11-22 days from exposure contact study (Bradbury et al.,
the MS DNA 3 out of 15 samples, but did not reveal the
1994). Therefore, birds infected at least 22 days will
antibody reactor detected by either SPA test or ELISA or
be present the evidence of infection. Moreover, natural
any clinical signs, indicating the early MS infection of
infection should take longer than the exposure contact
this flock. In this study, the MS infection was not
study. These reasons explain why the evidence of
observed at 1 month old but was observed starting at 1.5
infection and clinical signs are not observed at 1 month
month old. The possibly reason is good farm management
old.
and biosecurity during the young birdís life or the
Regarding sampling history, positive reactors
brooding period compared with that of older bird
were detected by SPA, ELISA and PCR in the older
rearing, leading to the low chance of MS infection in
flocks; respiratory signs including coughing, sneaking,
young birds.
conjunctivitis and increased lacrimation were observed only
In surveillance of Mycoplasma synoviae infection
in flock I.D.4, whereas flocks I.D. 10, 12 and 24 showed
in mixed Thai native chickens in the area of Nakornpathom
mild degrees of respiratory signs. Although some flocks
province. During the September 2005 to October 2006
showed mild degrees of respiratory signs, they presented
period, 30 flocks, aged between 1 and 4.5 months
more severe respiratory signs if they had received live
determined by SPA test, ELISA and PCR procedure were
Newcastle and/or infectious bronchitis virus vaccine.
investigated. The positive reactors detected by the SPA
Interestingly, a higher chance for MS infection was
test, ELISA and PCR procedure were 11, 8 and 6 flocks,
observed in older flocks. The possible reason is that the
respectively. This study indicates that in flocks infected
management and biosecurity of the positive farm were
with MS organisms, birds may not show clinical
not efficient. MS organisms can be transmitted by
respiratory signs. In addition, the older the flock the
contaminated vectors including growers, equipment,
higher number of positive reactors found. The SPA test is
etc. Christensen et al. (1994) found that MS organisms
appropriate to monitor the surveillance of MS infection
can sustain their viability on feathers and in the nasal
in suspected flocks.
passage for 3 days and 12 hours, respectively. Therefore,
effective farm management and biosecurity can prevent
MS infection and reduce the cost of the therapeutic
treatment.
Acknowledgement
This study was supported by the Grants for
Veterinary Science Research Fund 2008.
References
273
Kleven, S.H. 2003. Mycoplasma synoviae infection.
Bradbury, J.M., Yavari, C.A. and Giles, C.J. 1994. In vitro
In: Diseases of Poultry. 11th ed. Y.M. Saif, H.J. Barnes,
evaluation of various antimicrobials against
A.M. Fadly, J.R. Glisson, L.R. McDougald and D.E.
Mycoplasma gallisepticum and Mycoplasma
Swayne (eds.). Ames, Iowa State University Press.
synoviae by micro-broth method, and comparison
756-766.
with a commercially-prepared test system. Avian
Pathol. 23: 105-115.
Lauerman, L.H., 1998. Mycoplasma PCR assays.
In: Nucleic and Amplification Assays for Diagnosis
Christensen, N.H., Yavari, C.A., McBain, A.J. and
of Animal Diseases. L.H. Lauerman (ed.). Turlock,
Bradbury, J.M. 1994. Investigations into the survival
CA.: American Association of Veterinary Laboratory
of Mycoplasma gallisepticum, Mycoplasma
Diagnosticians. 41-42.
synoviae and Mycoplasma iowae on materials
Marois, C., Picault, J.P., Kobisch, M. and Kempf, I., 2005.
found in the poultry house environment. Avian
Experimental evidence of indirect transmission of
Pathol. 23: 127-143.
Mycoplasma synoviae. Vet Res. 36: 759-769.
Corstvet, R.E. and Sadler, W.W. 1964. The diagnosis of
Opitz, H.M., Duplessis, J.B. and Cyr, M.J., 1983. Indirect
certain avian diseases with the fluorescent antibody
micro enzyme linked immunosorbent assay (ELISA)
technique. Poult Sci. 43: 1280-1288.
for the detection of antibodies to Mycoplasma
Ewing, M.L., Lauerman, L.H., Kleven, L.H. and Brown,
M.B. 1996. Evaluation of diagnostic procedures
synoviae and Mycoplasma gallisepticum. Avian
Dis. 27: 773-786.
to detect Mycoplasma synoviae in commercial
Patten, B.E., Higgins, P.A. and Whithear, K.G., 1984. A
multiplier-breeder farms and commercial hatcheries
urease ELISA for the detection of mycoplasma infec-
in Florida. Avian Dis.40: 798-806.
tions in poultry. Aust. Vet. J. 61: 151-155.
Higgins, P.A. and Whithear, K.G. 1986. Detection and
Salisch, H., Hinz, K.H., Graack, H.D. and Ryll., M. 1998.
differentiation of Mycoplasma gallisepticum and
A comparison of a commercial PCR-based test to
Mycoplasma synoviae antibodies in chicken serum
culture methods for detection of Mycoplasma
using enzyme-linked immunosorbent assay. Avian
gallisepticum and Mycoplasma synoviae in
Dis. 30: 160-168.
concurrently infected chickens. Avian Pathol.
King, D.D., Kleven, S.H., Wenger, D.M. and Anderson,
D.P. 1973. Field studies with Mycoplasma synoviae.
Avian Dis. 17: 722-726.
Kleven, S.H. 1975. Antibody response to avian mycoplasmas. Am. J. Vet. Res. 36: 563-565
Kleven, S.H. 1981. Transmissibility of the F strain of
Mycoplasma gallisepticum in leghorn chickens.
Avian Dis. 25: 1005-1018.
Kleven, S.H. 1998. Mycoplasmosis. In: A Laboratory
Manual for the Isolation and Identification of Avian
Pathogens. D.E. Swayne, J.R. Glisson, M.W.
Jackwood, J.E. Pearson and W.M. Reed. (eds.).
American Association of Avian Pathologists,
Kennett Square, Pennsylvania. 74-80.
27: 142-147.
Talkington, F.D. and Kleven, S.H., 1983. A classification
of laboratory strains of avian Mycoplasma
serotypes by direct immunofluorescence. Avian
Dis. 27: 422-429.
Kampa J. et al./Thai J. Vet. Med. 39(3): 275-280.
275
Short Communication
Prevalence of Mycoplasma bovis and Other Contagious Bovine
Mastitis Pathogens in Bulk Tank Milk of Dairy Cattle Herds
in Khon Kaen Province, Thailand
Jaruwan Kampa1* Varaporn Sukolapong1 Arunee Buttasri1 Apirom Charoenchai2
Abstract
Mastitis is a most frequent and costly disease of dairy cattle worldwide. All three contagious mastitis
pathogens, Mycoplasma bovis, Streptococcus agalactiae and Staphylococcus aureus were investigated in 55 bulk
tank milk samples from dairy cattle herds in Khon Kaen Province Thailand, by nested PCR and/or conventional
bacterial culture. Bulk milk somatic cell count (BMSCC) was used as indicator for mastitis problem; i.e. > 5x105
somatic cells/ml of milk. The prevalence of Mycoplasma bovis, Streptococcus agalactiae and Staphylococcus aureus
were 1.8%, 21.8% and 7.3%, respectively. Results from BMSCC indicated mastitis problem in 47 herds.
However, 34 high-BMSCC with negative-contagious pathogen identification samples suggested the uncovered
problem of udder health in the studied group.
Keywords : Bulk tank milk, mastitis, Mycoplasma bovis, somatic cell count, Staphylococcus aureus, Streptococcus
agalactiae
1
Department of Pathobiology, Faculty of Veterinary Medicine, Khon Kaen University, 40002, Thailand
2
The Veterinary Research and Development Center (Upper Northeastern Region), Khon Kaen, 40260, Thailand
*
Corresponding author E-mail address: [email protected]
Thai J. Vet. Med., 2009. 39(3): 275-280
276
∫∑§—¥¬àÕ
§«“¡™ÿ°¢Õß‡™◊ÈÕ Mycoplasma bovis ·≈–‡™◊ÈÕ°àÕ‚√§‡μâ“π¡Õ—°‡ ∫μ‘¥μàÕ™π‘¥Õ◊Ëπ„ππÈ”π¡
∂—ß√«¡ ø“√å¡‚§π¡„π‡¢μ®—ßÀ«—¥¢Õπ·°àπ ª√–‡∑»‰∑¬
®“√ÿ«√√≥ §”æ“1* «√“¿√≥å »ÿ°≈æß»å1 Õ√ÿ≥’ ∫ÿμ√μ“ ’1 Õ¿‘√¡¬å ‡®√‘≠‰™¬2
‡μâ“π¡Õ—°‡ ∫‡ªìπªí≠À“∑’Ëæ∫∫àÕ¬·≈–¡’§à“„™â®à“¬ Ÿß„π°“√‡≈’È¬ß‚§π¡∑—Ë«‚≈° ‡™◊ÈÕ°àÕ‚√§‡μâ“π¡Õ—°‡ ∫μ‘¥μàÕ¡’ 3 ™π‘¥∑’Ë
”§—≠§◊Õ Mycoplasma bovis, Streptococcus agalactiae ·≈– Staphylococcus aureus ´÷Ëß‰¥â∂Ÿ°»÷°…“„πß“π«‘®—¬π’È„πμ—«Õ¬à“ß
πÈ”π¡∂—ß√«¡®“°ø“√å¡‚§π¡®”π«π 55 ø“√å¡ „π‡¢μ®—ßÀ«—¥¢Õπ·°àπ ‚¥¬‡™◊ÈÕ∑—Èß “¡∂Ÿ°«‘π‘®©—¬‚¥¬«‘∏’°“√ nested PCR √à«¡°—∫
°“√‡≈’È¬ß‡™◊ÈÕ·≈–«‘π‘®©—¬‡™◊ÈÕ∑—Ë«‰ª μ—«Õ¬à“ßπÈ”π¡®–∂Ÿ°μ√«®À“‡´≈≈å‚´¡“μ‘°‡æ◊ËÕ‡ªìπμ—«∫àß™’Èªí≠À“‡μâ“π¡Õ—°‡ ∫„πø“√å¡ π¡∂—ß
√«¡ø“√å¡¡’§à“‡´≈≈å‚´¡“μ‘° Ÿß°«à“ 5x105 ‡´≈≈å/π¡ 1 ¡≈. ®–∂Ÿ°μ—¥ ‘π„Àâ‡ªìππ¡®“°ø“√å¡∑’Ë¡’ªí≠À“‡μâ“π¡Õ—°‡ ∫ ®“°°“√
»÷°…“π’Èæ∫§«“¡™ÿ°¢Õß Mycoplasma bovis, Streptococcus agalactiae ·≈– Staphylococcus aureus ‡ªìπ 1.8%, 21.8%
·≈– 7.3% μ“¡≈”¥—∫ ·≈–¡’ 47 ø“√å¡∑’Ë¡’ BMSCC „π√–¥—∫ Ÿß Õ¬à“ß‰√°Áμ“¡¡’ø“√å¡∑’Ë¡’‡´≈≈å‚´¡“μ‘° Ÿß®”π«π 34 ø“√å¡
∑’Ëμ√«®‰¡àæ∫‡™◊ÈÕ‡μâ“π¡Õ—°‡ ∫μ‘¥μàÕ∑—Èß “¡™π‘¥ ¥—ßπ—Èπ¬—ß¡’¿“«–Õ◊Ëπ∑’Ë∑”„Àâ‡°‘¥‡μâ“π¡Õ—°‡ ∫·≈–§«√μâÕß¡’°“√»÷°…“μàÕ‰ª
§” ”§—≠ : πÈ”π¡∂—ß√«¡ ‡μâ“π¡Õ—°‡ ∫ Mycoplasma bovis ‡´≈≈å‚´¡“μ‘° Staphylococcus aureus Streptococcus agalactiae
1
¿“§«‘™“æ¬“∏‘™’««‘∑¬“ §≥– —μ«·æ∑¬»“ μ√å ¡À“«‘∑¬“≈—¬¢Õπ·°àπ 40002
»Ÿπ¬å«‘®—¬·≈–æ—≤π“°“√ —μ«·æ∑¬å ¿“§μ–«—πÕÕ°‡©’¬ß‡Àπ◊ÕμÕπ∫π ®. ¢Õπ·°àπ 40260
*
ºŸâ√—∫º‘¥™Õ∫∫∑§«“¡ E-mail address: [email protected]
2
Introduction
Mastitis, an inflammation of mammary glands, is
the most frequent and costly disease of dairy cattle
worldwide. In most of the cases, mastitis is caused by
infection of microorganism. The pathogens cause an
inflammation of the mammary glands, which then increase
number of somatic cell in the produced milk. Thus the
bulk milk somatic cell count (BMSCC) is used as a
mastitis indicator in dairy herd (Jayarao and Wolfgang,
2003; Jayarao et al, 2004). The contagious mastitis
pathogens comprise of Streptococcus agalactiae
(Str. agalactiae), Staphylococcus aureus (Sta. aureus)
and mycoplasma (Jayarao and Wolfgang, 2003).
Mycoplasmas are highly contagious and can be an
economically important cause of milk loss and increased
culling of infected cows. The infected cow produces a
low quality and quantity of milk, served as a source of the
infection and would be culled from herd. Among the
different species of mycoplasma that infect cattle,
Mycoplasma bovis (M. bovis) is the most pathogenic and
common cause of mastitis (Jasper, 1977). It is considered
an important agent of clinical mastitis in the US, Australia
and Europe (Jasper, 1977; Pfutzner and Sachse, 1996).
M. bovis causes substantial economic losses to the dairy
industry primarily though causation of an intractable,
untreatable mastitis (Brown et al., 1990; Gonzalez et al.,
1992). Moreover, mycoplasma intramammary infection
of dairy cattle is serious condition that can result in milk
loss and elimination of infected animals from a herd
because of the difficulty in treatment (Ayling et al., 2004;
Brown et al., 1990; Byrne et al., 2005; Jasper, 1982; Kirk
and Lauerman, 1994). In most of mastitis studies report
prevalence of Str. agalactiae and Sta. aureus because it
can be identified by a conventional bacterial identification
method whilst M. bovis need a more complicated step
for the identification. Thus the true prevalence of M. bovis
is probably underestimated.
Up to December 2007, there were 511 dairy herds
in Khon Kaen province of Thailand. Most of the herds
were small to medium size, i.e. 3-20 lactating cows/herds
that produce milk on average 12 kg/cow/day. Farmer
usually use milking machine, mostly are locally produced,
to collect milk from their cows. Milk in the bucket is then
transferred into herdís bulk tank before send for sell at the
nearby local co-operative milk collection centre (MC) twice
a day. At the MC the quality of milk from each farm will
collected. The milk samples will be examined, i.e. bulk
milk somatic cell count (BMSCC) and total bacterial count,
once a month at the Veterinary Research and Development
centre, Khon Kaen. Result of the milk quality testing is
used to set price of buying. In 1999, the Department of
Livestock Development of Thailand announced a dairy
herd standard which stated that the BMSCC should
not excesses 5x10 5 cells/ml of raw milk. However,
approximate 40% of the Thai dairy herds had BMSCC
greater than the standard (Bureau of Quality Control of
Livestock Products, 2009). Moreover, mastitis still be
the most concerned problem of Thai dairy farmers. Many
studies had been done on identification of the pathogenic
organisms of mastitis in Thailand; however, mycoplasma
mastitis had not been examined.
The purpose of this study was to determine the
herd prevalence of M.bovis and other contagious mastitis
pathogens in bulk milk from dairy cattle herds in
Khon Kaen province and determine the association between
presences of the identified pathogen and mean BMSCC.
Bulk tank milk samples: A survey study was carried out
in October 2008 in a MC in Mueng District of Khon Kaen
province. By monthly records from July to September
2008, the average BMSCC of about 200 dairy herds in
MC was 1.21x106 cells/ml. There were 52 bulk tank milk
(BTM) samples had bulk tank milk somatic cell count
(BMSCC) greater than 1.00x106 cells/ml for at least once
during the time. In the group, 46 herds sent their milk to
the MC on the sampling day and were then BTM collected.
Nine herds that had BTM SCC less than 0.50x106 cells/ml
from July-September, were selected as a free-mastitis
group in the study. All 55 samples were collected 60 ml.
aseptically and were kept at 4oC until analyzed.
Bacterial identification: All 55 BTMs were carried at
4oC to isolate the pathogens of interested at the Faculty of
Veterinary Medicine, Khon Kaen University on the day.
Mycoplasma bovis: To minimize the false negative
results, identification of M. bovis was done on filtrated,
cultivated milk samples. Firstly, 0.5 ml of milk were
mixed with 2 ml of modified Heyflick’s broth (DifcoTM
PPLO Broth plus 30% of DifcoTM PPLO Supplement)
before were filtrated through 0.45 micron What Man®
filter. The filtrated milk dilution was then incubated
277
at 37 oC for 8 days (Hogan et al., 1999). DNaesy ®
Blood and Tissue kits (Qiagen®, Germany) was used to
extract bacterial DNA from the cultured broth; all the
procedures were followed the manufacturer’s instruction.
A commercially available nested polymerase chain
reaction (nPCR) kits for detection of Mycoplasma bovis
(Genekam TM, Germany) was used according to the
manufactured suggestions; positive and negative
controls, which provided with the kits, were analyzed
in every steps of the nPCR.
Streptococcus agalactiae and Staphylococcus aureus:
The organisms were cultivated primarily from a 50
microlitre of vortex-mixed milk onto a sheep blood agar.
The culture plate was then incubated in 37oC incubator
overnight before were examined for the specific bacterial
colonies of the pathogens. Streptococcus agalactiae was
identified by a hemolysis pinpoint colony on blood agar,
Gram’s stain, negative-catalase test, negative-oxidase
test, negative-all four sugar utilizations (manitol, sorbital,
raffinose and inulin), negative-bile esculin test, negative
cultivation in 6.5%NaCl and positive CAMP test.
Staphylococcus aureus was identified by α- and βhemolysis colony, Gram’s stain, a positive-catalase test,
negative-oxidase test, a positive-tube coagulase test,
oxidation of manitol and yellowish colony on purple
base agar (National Mastitis Council, 1987; Quinn et al.,
1994).
Bulk tank milk somatic cell count: The milk samples
were analyzed the somatic cell numbers by using
Fossomatic 5000 Basic (Foss Electric, Denmark) at the
Veterinary Research and Development centre, Khon Kaen.
Statistical analysis: A Student’s t-test was used to test
if the BMSCC was different between pathogen negative
and positive BTM. The analysis was performed using
statistic software, Stata version 8.2 (Stata Corporation,
College Station, Texas US).
Results and Discussion
The contagious mastitis pathogens were identified
in 14 out of the overall 55 BTM (25.5%). M. bovis,
Str. agalactiae and Sta. aureus was isolated from 1 (1.8%),
12 (21.8%) and 4 (7.3%) herds, respectively.
Studies of bovine mastitis in Thailand, since
the 1990s, however, never been done on the presence of
M. bovis even the mycoplasma mastitis has been reported
278
in many geographical locations that contain intensive
dairy productions (Fox et al., 2005; Ghadersohi et al., 1999;
Kirk et al., 1997; Olde Riekerink et al., 2006; ter Laak
et al., 1992). The prevalence of M. bovis in BTM in
Khon Kaen province did not differed from other reports.
Recent studies, suggested that 1% to 6% of the dairy
herds had at least 1 cow with mycoplasma-induced
mastitis (Fox et al., 2003; Jasper et al., 1979; Kirk et al.,
1997; Kirk and Lauerman, 1994; Olde Riekerink et al.,
2006). Shedding patterns, minimum level of detection
and dilution by milk from other members and, in this
situation, the transportation of milk from herd to MC,
may influence the true detectable prevalence (Kirk
and Lauerman, 1994). Other pathogenic mycoplasmas,
however, were not examined because of the most
frequently identified and highly pathogenic mycoplasmas
is the M. bovis (Ayling et al., 2004; Gonzalez and Wilson,
2003) thus we aimed only at the species. M. bovis may be
found also in cattle that have joint and/or lung infections
but the presence in bulk milk that had very high SCC
strongly indicated the source of the pathogen.
Str. agalactiae and Sta. aureus was found in 21.8%
and 7.3% of 55 BTM, respectively. The prevalence was
lower than the study in 2002 by Sukolapong et al. The
lower prevalence may result from improve milking
practice of farmers during the time period and, probably,
sample selection. Nature of shedding the organisms in
milk may affect the true prevalence. Str. agalactiae is
shed in a larger number thus it can be easily cultured
from BTM. On the other hand, Sta. aureus is shed
infrequently and with a very low numbers and, as a result,
few Sta. aureus present in BTM (Jayarao and Wolfgang,
2003). Thus the true prevalence of Sta. aureus infection
in individual probably was higher than the detected
prevalence in BTM.
On average, the BMSCC of the 55 herds was
1.08x10 6 cells/ml of milk (range 0.00-7.65x10 6 ;
sd =0.17x106). In the low BMSCC group (9 herds), 8
herds had continuing low BMSCC in October, had not
found any mastitis pathogens and its mean BMSCC was
0.18x10 6 cells/ml. Another herd raised BMSCC to
0.65x106 cells/ml but none of the contagious pathogen
was identified. The association of the BMSCC with
presence of all three pathogens is showed in Table 1. Herd
that had BTM sample positive for any of the contagious
pathogens had a mean BMSCC that was 0.72x10 6
cells/ml higher than the counts from herds that had no
pathogens isolated (p= 0.03) .
The mean BMSCC of Str.agalactiae-positive
herds was 1.77x106 cells/ml. which higher than that of
negative herds (p=0.01). Eleven herds had BMSCC
greater than 0.50x106 cells/ml. Fenlon et al. (1995) also
reported a good correlation between the identification of
streptococci in bulk tank milk and BMSCC. One
S.agalactiae-positive herd, however, had a rather low
BMSCC (0.25x106 cells/ml) in the sampling time but
had very high level on the earlier 3-months (mean
BMSCC was 0.99x10 6 cells/ml). The recently low
BMSCC probably resulted from incomplete treatment or
the re-infection in a small proportion of lactating cows.
M. bovis and Sta. aureus were identified in herds
that had BMSCC greater than 0.50x106 cells/ml. Mean
3-months BMSCC, from July to September, of the M.bovis
positive-herd was 3.01x106 cells/ml. Because M. bovis had
identified only in one herd thus we could not determined
the effect of the pathogen on BMSCC. Moreover, in a
study by Fox et al. (2003) on BMSCC and presence of
mycoplasma, report none significantly difference between
the positive and negative-mycoplasma herds. Explanations
could be that the isolation of Mycoplasma spp. in bulk tank
milk is not related the number of the shedding cows
(Gonzalez et al., 1986).
Fourty-seven herds had high BMSCC (>0.50x106
cells/ml) but 34 of them (72.3%) had none of the
contagious pathogens in BTM. Beside udder infection
with contagious mastitis pathogens, variation in BMSCC
is also influenced by the stage of lactation, season of the
year, and individual cow responses to infection (Harmon,
1998). Thus, the high BMSCC in the free-pathogen herds
probably resulted from (1) the infections of other mastitis
pathogens, i.e. Str. dysgalactiae, Str. bovis, Coagulasenegative staphylococci and other Mycoplasma spp.,
(2) stage of lactation and (3) aseptic mastitis and (4) low
sensitivity of the BTM culture. Study in the same
population by Sukolapong et al. (2002) reported the
possibility of finding mastitis pathogen in individual
milk sample but did not found in BTM sample, was
58.1%. The finding probably resulted from the high
dilution of pathogen in normal milk of the herds which
reduced chance of discovery. Moreover, the negative
Table 1
279
The association of isolation of pathogen with average bulk milk somatic cell count (BMSCC) in bulk tank milk
samples from 55 dairy cattle herds in Khon Kaen province, Thailand.
Mean SCC
Difference
6
(x10 cells/ml)
P-value
6
(x10 cells/ml)
Isolated
None isolated
(#herds)
(#herds)
Any contagious pathogen
1.619 (14)
0.899 (41)
0.720
0.03
Mycoplasma bovis
4.481 (1)
1.080 (54)
3.461
na
Streptococcus agalactiae
1.771 (12)
0.890 (43)
0.881
0.01
Staphylococcus aureus
1.063 (4)
1.083 (51)
0.000
0.49
results on identification of mycoplasma are not
definitively indicated that herd is being free from
mycoplasma infection (Farnsworth, 1993; Gonzalez and
Wilson, 2003; Kunkel, 1985; Olde Riekerink et al., 2006).
Some infected cows are intermittently shedders of
mycoplasma in the milk, with as many as 40% of cows
shedding < 10 CFU/ml of this organism from infected
glands (Biddle et al., 2003). Thus herds that had high
BMSCC could not discard the udder infection with
mycoplasma. Furthermore, the high mean BMSCC of the
studied population indicated the uncovered udder trouble.
In conclusion, this first report of M. bovis in dairy
milk sample suggested another vigilant mastitis
pathogen among Thai dairy cattle. Further study should be
done to investigate the source of the organism in dairy
herds and also investigated the infection route; i.e.
milking machine and procedure, to provide the complete
picture of bovine mastitis in dairy herds in Thailand
which helps to prevent and correct the udder problem in
the future.
Acknowledgement
Authors thank Dr. Patcharee Thongkamkoon of the
National Institute of Animal Health for fruitful suggestions
on cultivation of mycoplasma. We also thank Dr. Niyomsak
Upatoom, head of the Veterinary Research and
Development Center (Upper Northeastern Region) for kind
help. The study was supported by KKU 40th Anniversary
Research Fund, Khon Kaen University, Thailand.
References
Ayling, R.D., Bashiruddin, S.E. and Nicholas, R.A. 2004.
Mycoplasma species and related organisms isolated
from ruminants in Britain between 1990 and 2000.
Vet. Rec. 155 (14): 413-416.
Bureau of Quality Control of Livestock Products. 2009.
“Results of Milk Quality Control” (June 2008January 2009 [Online]. Available:http://www.
dld.go.th/qcontrol/ group%20milk/milk.html
Biddle, M.K., Fox, L.K. and Hancock, D.D. 2003.
Patterns of mycoplasma shedding in the milk of dairy
cows with intramammary mycoplasma infection.
J. Am. Vet. Med. Assoc. 223(8): 1163-1166.
Brown, M.B., Shearer, J.K., Elvinger, F. 1990.
Mycoplasmal mastitis in a dairy herd. J. Am. Vet.
Med. Assoc. 196(7): 1097-1101.
Byrne, W., Markey, B., McCormack, R., Egan, J., Ball, H.
and Sachse, K. 2005. Persistence of Mycoplasma
bovis infection in the mammary glands of lactating
cows inoculated experimentally. Vet. Rec. 156(24):
767-771.
Farnsworth, R.J. 1993. Microbiologic examination of
bulk tank milk. Vet. Clin. North Am. Food Anim.
Pract. 9: 469-474.
Fenlon, D.R., Logue, D.N., Gunn, J. and Wilson, J. 1995.
A study of mastitis bacteria and herd management
practices to identify thier relationship to high
somatic cell counts in bulk tank milk. Br. Vet. J.
151(1): 17-25.
Fox, L.K., Hancock, D.D., Mickelson, A. and Britten, A.
2003. Bulk tank milk analysis: factors associated
with appearance of Mycoplasma sp. in milk. J. Vet.
280
Med. B Infect. Dis. Vet. Public Health. 50(5):
235-240.
Fox, L.K., Kirk, J.H. and Britten, A. 2005. Mycoplasma
mastitis: a review of transmission and control. J. Vet.
Med. B Infect. Dis. Vet. Public Health. 52(4):
153-160.
Ghadersohi, A., Hirst, R.G., Forbes-Faulkener, J. and
Coelen, R.J. 1999. Preliminary studies on the
prevalence of Mycoplasma bovis mastitis in dairy in
cattle in Australia. Vet. Microbiol. 65(3): 185-194.
Gonzalez, R.N., Jasper, D.E., Bushnell, R.B. and Farver,
T.B. 1986.Relationship between mastitis pathogen
numbers in bulk tank milk and bovine udder
infections in California dairy herds. J. Am. Vet. Med.
Assoc. 189(4): 442-445.
Gonzalez, R.N., Sears, P.M., Merrill, R.A. and Hayes, G.L.
1992. Mastitis due to Mycoplasma in the state of
New York during the period 1972-1990. Cornell Vet.
82(1): 29-40.
Gonzalez, R.N. and Wilson, D.J. 2003.Mycoplasmal
mastitis in dairy herds. Vet. Clin. North Am. Food
Anim. Pract. 19(1): 199-221.
Harmon, R.J. 1998. Somatic cell counts: myths vs reality.
In: The 37th National Mastitis Council, Madison,
US, 51-55.
Hogan, J.S., Gonzalez, R.N., Harmon, R.J., Nickerson,
S.C., Oliver, S.P., Pankey, J.W. and Smith, K.L. 1999.
Laboratory Handbook on Bovine Mastitis. National
Mastitis council, Inc., Madison, WI, 151-188.
Jasper, D.E. 1977. Mycoplasma and mycoplasma
mastitis. J. Am. Vet. Med. Assoc. 170: 1167-1172.
Jasper, D.E. 1982. The role of mycoplasma in bovine
mastitis. J. Am. Vet. Med. Assoc. 181: 158-162.
Jasper, D.E., Dellinger, J.D., Rollins, M.H. and Hakanson,
H.D. 1979. Prevalence of mycoplasmal bovine
mastitis in California. Am. J. Vet. Res. 40(7):
1043-1047.
Jayarao, B.M., Pillai, S.R., Sawant, A.A., Wolfgang, D.R.
and Hegde, N.V. 2004. Guidelines for monitoring
bulk tank somatic cell and bacterial counts. J.
Dairy Sci. 80: 3561-3573.
Jayarao, B.M. and Wolfgang, D.R. 2003. Bulk-tank milk
analysis: A useful tool for improving milk quality and
herd udder health. Vet. Clin. North. Am. Food Anim.
Pract. 19: 75-92.
Kirk, J.H., Glenn, K., Ruiz, L. and Smith, E. 1997.
Epidemiologic analysis of Mycoplasma spp isolated
from bulk-tank milk samples obtained from dairy
herds that were members of a milk cooperative. J.
Am. Vet. Med. Assoc. 211(8): 1036-1038.
Kirk, J.H. and Lauerman, L.H. 1994. Mycoplasma
mastitis in dairy cows. Veterinarian. 16: 541-551.
Kunkel, J.R. 1985. Isolation of Mycoplasma bovis from
bulk milk. Cornell Vet. 75(3): 398-400.
Olde Riekerink, R.G., Barkema, H.W., Veenstra, S., Poole,
D.E., Dingwell, R.T. and Keefe, G.P. 2006.
Prevalence of contagious mastitis pathogens in bulk
tank milk in Prince Edward Island. Can. Vet. J. 47(6):
567-572.
Pfutzner, H. and Sachse, K. 1996. Mycoplasma bovis
as an agent of mastitis, pneumonia, arthritis and
genital disorders in cattle. Rev. Sci. Tech. 15(4):
1477-1494.
National Mastitis Council. 1987. Laboratory and filed
handbook on bovine mastitis. National Mastitis
Council, Inc. 208 pp.
Quinn, P.J., Carter, M.E., Markey, B.K. and Carter, G.R.,
1994. Clinical Veterinary Microbiology. Mosby-Year
Book Europe Limited. 648 pp.
Sukolapong, V., Aiumlamai, S., Chanlun, A., Jarassaeng,
C., Pattanawong, J., Sarachoo, K. and Viriyametharoj,
S. 2002. Determination of mastitis in dairy cattle
using bulk tank milk analysis. In: The 28 th
Veterinary Medicine and Livestock Development
Ann. Con., Bangkok, Thailand.
ter Laak, E.A., Wentink, G.H. and Zimmer, G.M. 1992.
Increased prevalence of Mycoplasma bovis in the
Netherlands. Vet Q. 14(3): 100-104.
Wanasawaeng W. et al./Thai J. Vet. Med. 39(3): 281-286.
281
Short Communication
Growth Characteristics of the H5N1 Avian Influenza Virus
in Chicken Embryonic Eggs and MDCK Cells
Wisanu Wanasawaeng1 Napawan Bunpapong1 Wichet Leelamanit2
Roongroje Thanawongnuwech1*
Abstract
Chicken embryonic eggs and Madin-Darby canine kidney (MDCK) cell line were used for comparing the
propagation of avian influenza A (H5N1) virus (C2105Dx1, a Thai isolate). The growth of the H5N1 virus was
determined by using HA test and 50% infectivity dose to assess the suitability of the systems supporting the
propagation of the virus. The results indicated that the Thai H5N1 virus was propagated better in the chicken
embryonic eggs, which should be considered as a system of choice for the avian H5N1 virus isolation. The
optimal time for harvesting the selected Thai H5N1 virus was at 24 hours after inoculation in the chicken
embryonic eggs, yielding the virus titer of at least 9 log2 HAU/50μl or 107.0 TCID50/ml.
Keywords : avian influenza virus, chicken embryonic eggs, H5N1, MDCK cells
1
Department of Veterinary Pathology, Faculty of Veterinary Science, Chulalongkorn University, Pathumwan, Bangkok, 10330 Thailand.
2
Faculty of Pharmacy, Mahidol University, Ratchathewi, Bangkok, 10400, Thailand
*
Thai J. Vet. Med., 2009. 39(3): 281-286
282
∫∑§—¥¬àÕ
≈—°…≥–°“√‡®√‘≠‡μ‘∫‚μ¢Õß‡™◊ÈÕ‰«√— ‰¢âÀ«—¥π° —∫‰∑ªá H5N1 „πμ—«ÕàÕπ≈Ÿ°‰°à ·≈–‡´≈≈å
‡æ“–‡≈’È¬ß™π‘¥ MDCK Cells
«‘…≥ÿ «√√≥· «ß1 π¿«—≈¬å ∫√√ææß»å1 «‘‡™…∞å ≈’≈“¡“π‘μ¬å2 √ÿàß‚√®πå ∏π“«ß…åπÿ‡«™1*
°“√‡ª√’¬∫‡∑’¬∫≈—°…≥–°“√‡®√‘≠‡μ‘∫‚μ¢Õß‡™◊ÈÕ‰«√— ‰¢âÀ«—¥π° —∫‰∑ªá H5N1 (C2105Dx1) ∑’Ë·¬°‡™◊ÈÕ‰«√— ‰¥â®“°
ª√–‡∑»‰∑¬„πμ—«ÕàÕπ≈Ÿ°‰°à„π‰¢àøí° ·≈–‡´≈≈å‡æ“–‡≈’È¬ß™π‘¥ Madin-Darby canine kidney (MDCK) cell line ‚¥¬°“√∑¥ Õ∫
¥â«¬‡∑§π‘§ Hemagglutination (HA) test ·≈– 50% Infectivity dose ‡æ◊ËÕª√–‡¡‘πª√– ‘∑∏‘¿“æ„π°“√ àß‡ √‘¡°“√‡®√‘≠‡μ‘∫‚μ
¢Õß‡™◊ÈÕ‰«√— „π‚Œ μå·μà≈–™π‘¥ º≈°“√»÷°…“æ∫«à“ ‡™◊ÈÕ‰«√— H5N1 “¬æ—π∏ÿå¥—ß°≈à“« “¡“√∂‡æ‘Ë¡®”π«π‰¥â¥’„πμ—«ÕàÕπ≈Ÿ°‰°à
„π‰¢àøí°´÷Ëß‡ªìπ‚Œ μå∑’Ë‡À¡“– ¡ ”À√—∫°“√·¬°‡™◊ÈÕ‰«√— ‚¥¬√–¬–‡«≈“∑’Ë‡À¡“– ¡ ”À√—∫°“√‡°Á∫‡™◊ÈÕ‰«√— ∑’Ë·¬°‰¥â®“°ª√–‡∑»
‰∑¬§√—Èßπ’È§◊Õ ¿“¬À≈—ß°“√©’¥‡™◊ÈÕ‰«√— „πμ—«ÕàÕπ≈Ÿ°‰°à„π‰¢àøí°‡ªìπ‡«≈“ 24 ™—Ë«‚¡ß´÷Ëß‰¥âª√‘¡“≥‡™◊ÈÕ‰«√— ¡“°∑’Ë ÿ¥Õ¬à“ßπâÕ¬ 9
log2 HAU/50μl À√◊Õ 107.0 TCID50/ml
§” ”§—≠ : ‡™◊ÈÕ‰«√— ‰¢âÀ«—¥π° μ—«ÕàÕπ≈Ÿ°‰°à H5N1 MDCK cells
1
¿“§«‘™“æ¬“∏‘«‘∑¬“ §≥– —μ«·æ∑¬»“ μ√å ®ÿÃ“≈ß°√≥å¡À“«‘∑¬“≈—¬ ª∑ÿ¡«—π °√ÿß‡∑æœ 10330
§≥–‡¿ —™»“ μ√å ¡À“«‘∑¬“≈—¬¡À‘¥≈ √“™‡∑«’ °√ÿß‡∑æ 10400
*
ºŸâ√—∫º‘¥™Õ∫∫∑§«“¡ E. mail: [email protected]
2
Introduction
Influenza viruses are members of the family
Orthomyxoviridae composing of 4 genera, A, B, C and
Thogotovirus based on the basis of the nucleocapsid or
matrix antigen (Brown, 2000). However, only type A
influenza viruses are able to infect a variety of avian
and mammalian hosts and can cause severe disease in
many species (Lee et al., 2004).
Influenza virus is an enveloped RNA virus
containing 8 segments of single stranded negative-sense
RNA genomes. The envelope contains haemagglutinin
(HA) and neuraminidase (NA) proteins. Sixteen serotypes
of HA (H1-H16) and nine (N1-N9) of NA have been
identified in both mammalian and avian influenza A
viruses (Stevens et al., 2006). The viral particles are
approximately 50-120 nm in diameter for spherical
forms (Brown, 2000). Most laboratory-adapted influenza
viruses existing in the spherical morphology of approximately 100 nm in diameter are grown in the cell culture
system. However, influenza viruses isolated from the
clinical specimens are believed to be predominantly
filamentous particles (Sieczkarski and Whittaker, 2005).
In addition, the internalization of the filamentous
influenza virus particles is delayed according to their
spherical particles.
The laboratory techniques based on isolation and
propagation of influenza viruses are important in the
surveillance, studies of host range, pathogenesis and
vaccine production (Seo et al., 2001). Avian influenza
virus isolation often uses chicken embryonic eggs.
However, the cell culture system is an alternative method
in some laboratories. Cultivation of influenza viruses in
the embryonated chicken eggs (CE) is also the system of
choice for generating of large quantities of virus used in
the laboratory studies (Murphy and Webster, 1996).
However, the virulent strains of type A influenza virus
after inoculating into the allantoic cavities of chicken
embryos rapidly kills the embryos and yields a low virus
titer.
The disadvantages of using chicken embryonic eggs
are that the eggs may contain various microbiological
contamination and residual endotoxin (Oxford et al., 2003),
and the eggs may be unavailable in some laboratories. The
alternative techniques using tissue culture system may be
considered in some laboratories since it is easy to obtain
and maintain the culture system. Attempting to propagate
the influenza virus in the tissue culture system has been
done using primary chick embryo kidney cell (Austin
et al., 1978), Vero cells (Youil et al., 2004), Hep2 and RD
cells (WHO, 2005). Currently Madin-Darby canine
kidney cell (MDCK) is the cell culture of choice using for
a wide variety of influenza A viruses propagation,
comprising of human, equine, porcine and avian origins
(Tobita et al. 1975). WHO (2005) also recommends MDCK
cells as the preferred cell line for culturing the influenza
viruses. The advantage of the MDCK cell line is the
availability from the cell bank system and free of other
microbiological contaminants (Oxford et al., 2003). In
addition, the MDCK cells are also used for large
quantities of the H5N1 virus production especially for
vaccine production.
The objectives of this study are to compare the two
systems for a Thai first isolated H5N1 virus (C2105Dx1)
propagation and to learn more on the nature of this Thai
isolate. The results might be very useful for the avian
influenza research when using this virus and other
related H5N1 virus.
Virus: Avian influenza A (H5N1) virus used in this study
was isolated from 25-day-old broiler chickens in Thailand
during the first outbreak in 2004 and named C2105Dx1
(Veterinary Diagnostic Laboratory, Faculty of Veterinary
Science, Chulalongkorn University, Thailand). The
stock virus from the second passage of 10-day-old
embryonating chicken eggs, containing the titer of 7.78
log10EID50/ml, was prepared as a described by OIE
(2004). All viral manipulations were performed under
the appropriate biosafety level 3 laboratory conditions.
MDCK cells: MDCK cells used in this study (passage
number 53) were kindly provided by Dr. Christopher
Olsen from the Veterinary School, University of Wisconsin-Madison.
1. Viral propagation in MDCK cells
Flask preparation: Confluent monolayer of MDCK
cell line was prepared in a 75 cm2 flask. After washing
MDCK cells with 10 ml of PBS, pH 7.0, 1 ml of trypsin
was added to the flask to detach the cells and discarded.
The flask again filled with 3 ml of trypsin and shaked
until all cells detached from the plastic surface. After that,
3 ml of 5% FBS (Fetal Bovine Serum, GIBCO, Invitrogen
Corp) of MEM (Modified Eagle Medium, GIBCO,
Invitrogen Corp was added to inactivate the trypsin
digestion.
Inoculation of the virus: 5% FBS of MEM from
283
the flask was discarded and the flask was washed 2-3
times with 3 ml of MEM. The inoculum was prepared by
diluting the virus with MEM to multiplicity of infection
(MOI) of 1.8, then inoculated onto the monolayer of
MDCK cells and incubated for 1 hr at 37oC and in 5%
CO2 incubator to allow the viral adsorption. After that,
the inoculum was descanted and 10 ml of 3% FBS of
MEM were added to the monolayer.
Harvesting of the virus: The flask containing virus
was freezed and thawed twice before harvesting the
supernatant at 0, 8, 16, 24, 32, 40, 48, 56, 64 and 72 hrs
post inoculation (hpi) and kept at -80oC before virus
titration.
2. Viral propagation in chicken embryonic
eggs: Stock virus containing the titer of 7.78 log
10EID50/ml was inoculated approximately 0.2 ml/egg in
the 9-days old embryonic chicken eggs. Four eggs at
each incubation period of 0, 4, 8, 12, 16, 20, 24, 28 and
32 hpi were collected and the allantoic fluid was
harvested aseptically for virus titration.
3. Virus titration: To determine the haemagglutination titer, 1% (v/v) chicken red blood cells (RBCs)
was used in 96 wells V-bottom micro titer plates (NUNC,
Denmark) (OIE, 2004). Briefly, 0.05 ml of PBS was
dispensed into each well of a micro titer plate. Then, 0.05
ml of the infected allantoic fluid was placed in the first
well and two-fold dilutions of 0.05 ml volume of the
suspension was performed across the plate. The 0.05% of
RBCs was added to each well, mixed by tapping the
plate and settled for 30 min at room temperature. HA was
determined by tilting the plate and observed the presence
or absence of the agglutination. The titration was read to
the highest dilution yielding complete agglutination.
To determine of the infectivity titer, MDCK cell
line was used in 96 well microplates (NUNC, Denmark).
The harvested virus from each incubation period was
diluted in a ten-fold dilution manner. The diluted virus
was transferred to the monolayer of MDCK cells
microplates and allowed to absorb at 37oC for 1 hr in 5%
CO2 incubator. Then, the inoculum was discarded and
washed with 150 μl of PBS twice. A hundred and eighty
microlitres of 3% MEM was added to all wells. Cells
were incubated at 37oC, 5% CO2 incubator for 72 hr. The
plates were observed daily for cytopathic effect (CPE)
under the inverted microscope. The CPE characterized
284
as a rounding up of infected cells was microscopically
recognized. Then, the viral titer was calculated in
TCID50/ml of log10 values as described in Reed and
Munch (1938).
Results and Discussion
The isolation and propagation of influenza viruses
are important in epidemiological surveillance, studies
of host range, pathogenesis, diagnosis and vaccine
production. Therefore, chicken embryonic eggs and
Madin-Darby canine kidney (MDCK) cell line were used
to compared the propagation ability of avian influenza
A (H5N1) virus (C2105Dx1), a Thai isolate.
Using the MDCK monolayer at the MOI of 1.8, the
H5N1 virus initially grew between 8 to 16 hours after
inoculation and reached maximum titer between 40 to
48 hrs after inoculation. The infectivity titer of viral
propagation in MDCK cells was between 2.4 to 4.2 TCID50/
ml, whereas, the HA titer was between 2.0 to 2.5 log2
(Figure 1 and 2). Morphological change of cytopathic
effect (CPE) was firstly observed at 16 hpi in accordance
with viral infectivity and HA determination (Figure 3).
The infected chicken embryonic eggs died within 32 hpi
according to the characterization of virulent strains as
described by Park et al. (2001), thus the study was
performed until 32 hpi. The virus initially grew between
12 to 16 hours after inoculation and reached maximum
titer between 24 to 28 hrs after inoculation. The infectivity
titer of viral propagation in chicken embryonic eggs
was between 5.7 to 7.4 TCID50/ml and between 7.3 to
9.0 log2 of HA titer (Figure 4 and 5). Thus, for the Thai
H5N1 virus studied in this work, the infectivity and HA
titers of the H5N1 virus in chicken embryonic egg were
better than those of MDCK cells (>3 log10 and >5 log2,
respectively). The poor replication efficiency of the Thai
H5N1 virus in MDCK cells was similar to the previous
study (Seo et al., 2001) that the replication efficiencies
of the 1997 H5N1 viruses ranged from 1.5 to 5.0
log10TCID50/ml. The virus initially appears initially on the
surface epithelium of the allantoic membrane, then in the
vascular endothelial cells of chorioallantoic membrane
and the visceral organs of the embryos, before spreading
to the parenchymal cells of many organs. In contrast to
the virulent strains, non-virulent virus strain confines in
the allantoic membrane and sometimes may not kill the
embryos (Park et al., 2001).
The binding property of the virus to the host cell is
determined by two factors, the receptor binding affinity
of the virus and the receptor density on the host cell
surface (Asaoka et al., 2006). These binding specificities
correspond to the types of sialic acid linkages within
those hosts. Avian influenza viruses preferentially bind
to 5-N-acetylneuraminic acid α-2, 3-galactose (Neu5Ac
α-2,3Gal) linkage, while human influenza viruses
preferentially bind to Neu5Acα-2,6Gal (Roger et al.,
1983). The allantoic cells of chicken embryonated eggs
contain Neu5Acα2,3Gal but no Neu5Acα2,6Gal, while
amniotic cells and MDCK cells contain both linkages
(Ito et al., 1997). The H5N1 virus in Thailand contained
a glutamine 222 (226 in H3) and a glycine at position
224 (228 in H3) in HA1, which are preferential related
to avian cell-surface receptor or Neu5Acα-2,3Gal
(Kaewcharoen et al., 2004). Therefore, the allantoic
cavities should be the most preferential sites of viral
replication.
Since, cell surface sialyloligosaccharides play an
important role in the selection and maintenance of the
receptor specificities of influenza viruses (Ito et al., 1997),
cultivation of the H5N1 virus in the Neu5Acα2,3Galriched allantoic cavities will not select the virus variant
with mutations as previously described in human
influenza viruses (Widjaja et al., 2006; Gambaryan et al.,
1999; Ito et al., 1997; Hardy et al., 1995). Undoubtedly,
the chicken embryo still remains the best system of choice
for the isolation and propagation of the Thai H5N1 virus.
The optimal time for harvesting the selected Thai isolate
from our study was 24 hours after inoculation, which
yield the titer of at least 9.0 log2 HAU/50μl or 107.0
TCID50/ml.
In this study, the replication efficiency of the
H5N1 virus was greater in chicken embryonic eggs than
MDCK cells due to the binding property between the virus
from the avian origin and host cell. To culture large scale
of the H5N1 virus such as vaccine production or antigen
preparation for further researches, the chicken embryonic
eggs are the most appropriate system with minimal viral
selection. However, diagnostic laboratories receiving the
specimens from various species may consider MDCK
cell as an alternative system for a wide variety of
influenza A virus isolation.
285
6
1.E+05
TCID50/ml
HA-units
5
4
3
2
1
1.E+04
1.E+03
1.E+02
1.E+01
0
0
8
16
24
32
40
48
56
64
1.E+00
72
0
8
16
24
32
40
48
56
64
72
Hrs post infection
Hrs post infection
Figure 1 Growth curves of the virus in MDCK cells based
on HA test determination (HAU/50μl). The HA titers were
between 4.0 to 5.7 HAU/50μl (2.0 to 2.5 log2 HAU/50μl).
Figure 2 Growth curves of the virus in MDCK cells based
on 50% infectivity dose determination (TCID50/ml). The
infectivity titers were between 2.4 to 4.2 log10 TCID50/ml.
Control
32 hpi
Figure 3 Photomicrographs of normal MDCK cells cultured (left) and sequential changes after viral infection 32 hpi
(right). Morphological change of CPE was firstly observed at 16 hpi in accordance with viral infectivity and HA
determination.
600
1.E+08
400
1.E+06
TCID50/ml
HA-units
500
300
200
100
1.E+04
1.E+02
0
0
4
8
12
16
20
24
28
32
Hrs post infection
1.E+00
0
4
8
12
16
20
24
28
32
Hrs post infection
Figure 4 Growth curves of the virus in chicken embryonic
eggs based on HA test determination (HAU/50μl). The HA
titers were between 158 to 512 HAU/50μl (7.3 to 9.0
log2 HAU/50μl).
Figure 5 Growth curves of the virus in chicken embryonic
eggs based on 50% infectivity dose determination (TCID50/
ml). The infectivity titers were between 5.7 to 7.4 log
10 TCID50/ml.
Acknowledgements
References
The authors would like to thank Dr. Rachod
Tantilertcharoen for his excellent technical assistance.
This study was supported by the National Research
Council of Thailand (NRCT0005-3886).
Asaoka, N., Tanaka, Y., Sakai, T., Fujii, Y., Ohuchi, R. and
Ohuchi, M. 2006. Low growth ability of recent
influenza clinical isolates in MDCK cells is due to
their low receptor binding affinities. Microbes
Infect. 8: 511-519.
286
Austin, M.A.A., Monto, A.S. and Maassab, H.F. 1978.
Growth characteristics of influenza virus type C in
avian hosts. Arch. Virol. 58: 349-353.
Brown, E.G. 2000. Influenza virus genetics. Biomed.
& Pharmacother. 54: 196-209.
Gambryan, A.S., Karasin, A.I., Tuzikov, A.B., Chinarev,
A.A., Pazynina, G.V., Bovin, N.V., Matrosovich,
M.N., Olsen, C.W. and Klimov, A.I. 2005. Receptorbinding properties of swine influenza viruses
isolated and propagated in MDCK cells. Virus Res.
114: 15-22.
Hardy, C.T., Young, S.A., Webster, R.G., Naeve, C.W. and
Owens, R.J. 1995. Egg fluids and cells of the
chorioallantoic membrane of embryonated chicken
eggs can select different variants of influenza A
(H3N2) viruses. Virology. 211: 302-306.
Ito, T., Suzuki, Y., Tanaka, A., Kawamoto, A., Otsuki, K.,
Masuda, H., Yamada, M., Suzuki, T., Kida, H. and
Kawaoka, Y. 1997. Differences in sialic acidgalactose linkages in the chicken egg amnion and
allantois influenza human influenza virus receptor
specificity and variant selection. J. Virol. 71(4):
3357-3362.
Keawcharoen, J., Oraveerakul, K., Kuiken, T., Fouchier,
R.A.M., Amonsin, A., Payunporn, S., Noppornpanth,
S., Wattanodorn, S., Theamboonlers, T., Tantilertcharoen, R., Pattanarangsan, R., Arya, N., Ratanakorn,
P., Osterhaus, D.M.E. and Poovorawan, Y. 2004.
Avian influenza H5N1 in tigers and leopards.
Emerg. Infect. Dis. 10(12): 2189-2191.
Lee, C.W., Senne, D.A., Linares, J.A., Woodcock, P.R.,
Stallknecht, D.E., Spackman, E., Swayne, D.E. and
Suarez, D. L. 2004. Characterization of recent H5
subtypes avian influenza viruses from US poultry.
Avian Pathol. 33(3): 288-297.
Murphy, B.R. and Webster, R.G. 1996. Orthomyxoviruses.
In: Fields Virology, 3rd ed. B.N. Fielsds, D.M. Knipe,
P.M. Howley (eds.). Philadelphia: Lippincott-Raven
Publishers. 1397-1445.
OIE, 2004. “Terrestrial animal health code: 13th ed.”.
[Online]. Available: http://www.oie.int/eng/
en_index.htm.
Oxford, J.S., Al-Jabri, A.A., Lambkin, R., Palache, A.M.
and Fleming, D.M. 2003. Non-responders to egg
grown influenza vaccine seroconvert after booster
immunization with MDCK cell grown vaccine.
Vaccine. 21: 2743-2746.
Park, C.H., Ozaki, H., Takada, A., Ochiai, K. and
Umenmura, T. 2001. Primary target cells of virulent
strains of type A influenza virus in chicken embryos.
Avian Pathol. 30: 269-272.
Reed, L. J., and H. Muench. 1938. A simple method of
estimating fifty percent endpoints. Am. J. Hyg. 27:
493-497.
Rogers, G.N. and Paulson, J.C. 1983. Receptor
determinants of human and animal influenza virus
isolates: differences in receptor specificity of the H3
hemagglutinin based on species of origin. Virology.
127: 361-373.
Seo, S.H., Goloubeva, O., Webby, R. and Webster, R.G.
2001. Characterization of a porcine lung epithelial
cell line suitable for influenza virus studies. J. Virol.
75(19): 9517-9525.
Sieczkarski, S.B. and Whittaker, G.R. 2005. Characterization of the host cell entry of filamentous influenza
virus. Arch. Virol. 150: 1783-1796.
Stevens, J., Blixt, O., Glaser, L., Taubenberger, J.K., Palese,
P., Paulson, J.C. and Wilson, I.A. 2006. Glycan
microarray analysis of the haemagglutinins from
modern and pandemic influenza viruses reveals
different receptor specificities. J. Mol. Biol. 355:
1143-1155.
Tobita, K., Sugiura, A., Enomote, C. and Furuyama, M.
1975. Plaque assay and primary isolation of
influenza A viruses in an established line of canine
kidney cells (MDCK) in the presence of trypsin.
Med. Microbiol. Immunol. 162(1): 9-14.
WHO, 2005. Recommended laboratory tests to identify
avian influenza A virus in specimens from humans.
WHO Geneva. 9 pp.
Widjaja, L., Ilyushina, N., Webster, R.G. and Webby, R.J.
2006. Molecular changes associated with adaptation
of human influenza A virus in embryonated chicken
eggs. Virology. 350: 137-145.
Youil, R., Su, Q., Toner, T.J., Szymkoviak, C., Kwan, W.S.,
Rubin, B., Petrukhin, L., Kiseleva, I., Shaw, A.R. and
DiStefano, D. 2004. Comparative study of influenza
virus replication in Vero and MDCK cell lines. J.
Virol. Methods. 120: 23-31.
Buranakarl C. et al./Thai J. Vet. Med. 39(3): 287-288.
287
Diagnostic Forum
ECG Quiz
Chollada Buranakarl1* Kris Angkanaporn1
Winai Chansaisakorn2
These lead II ECG strips were recorded from a
radiograph revealed whole heart enlargement especially
14 years old, castrated male, mixed breed dog, weighing
left atrium, elevated trachea and main stem bronchi with
13.6 kg. The dog had non-productive cough, pale pink
normal lung field.
mucous membrane and normal appetite. Thoracic
Please answer before turning to the next page.
1
Department of Physiology,
2
Small Animal Teaching Hospital, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330,
Thailand
*
Corresponding author: [email protected]
Thai J. Vet. Med., 2009. 39(3): 287-288
288
Buranakarl C. et al./Thai J. Vet. Med. 39(3): 287-288.
Interpretation
The atrioventricular dissociation with junctional
escape rhythm
Heart rate is approximately 45 beats per minute.
arrow). These positive P waves may emerge periodically
The QRS complexes were regular in rhythm with slow rate.
from sinoatrial node which cannot function properly while
Please notice that the QRS complexes occurred without
these impulses do not conduct through the AV node. The
preceded P wave suggested that the QRS complexes may
SA arrest with blocking normal AV transmission suggests
be originated from the atrioventricular node (AV) node or
the disease affected the normal natural pacemaker. The
tissues nearby. The escape rhythm represents a safety or
normal beats are overridden by ectopic rhythm which
rescuing mechanism that operates when normal pacemaker
emerges near the AV node and possibly passing through
stops pacing. The negative P waves in junctional complexes
normal Bundle of His. Therefore, the shape and duration
may precede, be superimposed on or follow the QRS
of QRS are normal. The atropine challenge test is suggested
nd
complex (arrows in 2 strip). The rhythm of 45 beats
in this case to demonstrate the rate and AV transmission
per minute is corresponding to the pacemaker rhythm
of the impulses originated from SA node. The cardiac
of AV node. On the first ECG strip, one premature
output in this dog may be adequate but frequent
ventricular complex was seen right after the regular
monitoring is important. If the disease is more advanced,
junctional AV complex (straight arrow). The positive
an insufficient flow may occur and the animal may
P waves can also be seen at the end of the strip (curve
need an advanced treatment such as artificial pacemaker.
Tuntivanich N./Thai J. Vet. Med. 39(3): 289-290.
289
Diagnostic Forum
Ophthalmology Snapshot
Nalinee Tuntivanich
History
A 13 yr-old female, spayed cat was referred from
once daily. Initial ophthalmic examinations of both eyes
a private animal hospital to the Small Animal Teaching
revealed positive menace response and pupillary light
Hospital, Chulalongkorn University with a history of
reflex. STT levels were 5 and 7 mm of wetness on the
persistent ocular pain during the past 2 weeks. The cat did
right and left eye, respectively.
not respond to chloramphenicol eye ointment applied
Figure 1. A photograph of the cat presented with unilateral ocular pain.
Questions
1. Which eye is abnormal? What is that abnormality?
2. Please give differential diagnosis.
3. What ophthalmic examinations are necessary to perform on this case?
(For better quality, figures can be viewed in the TJVM website.)
Please turn to the next page for answers .....
Ophthalmology Clinic, Department of Surgery, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand
Thai J. Vet. Med., 2009. 39(3): 289-290
290
Tuntivanich N./Thai J. Vet. Med. 39(3): 289-290.
Answers
1. The left eye is abnormal. The color of the
3. Measurement of the intraocular pressure
iris is darkening, while the pupil is smaller in size and
(IOP), slit-lamp biomicroscopic evaluation of the surface
irregular in shape compared to the other eye.
of the iris.
2. Iris melanoma (malignant or benign), Iris
hyperpigmentation
Figure 2. A close up photograph of the left eye revealing mottled appearance of the iris. Change in thickness and
surface texture was seen via slit-lamp biomicroscopy.
Comments
(The mean IOP of the right and left eye was 21
and 49 mmHg, respectively.)
of the lesion can be performed to identify cellular
malignancy. Secondary glaucoma can occur if the
iridocorneal angle is invaded, and enucleation is
Feline (diffuse) iris hyperpigmentation is common.
advised. Appropriate time to enucleate the affected eye is
It can be either chronic uveitis inducing iris hyper-
controversy (especially when an eye is still visual), based
pigmentation or tumor. History, clinical signs and rate of
on the progression of the disease via regular re-evaluation.
progression should be reviewed to differentiate the
abnormality. Iris tumor is usually presented as focal to
References
diffuse iris hyperpigmentation rather than a discrete
Barnett, K.C. and Crispin, S.M., 1998. Uveal tract. In:
nodule or mass. Multiple areas of pigmentation with
Feline Ophthalmology. An Atlas and Text. London:
irregularity of the iris surface or pupil can clinically be
W.B. Saunders 125-126
diagnosed as the iris melanoma. Monitoring of the
Krohne, S. 2002. Ocular tumors of the dog and cat. In:
pigmented area enlargement is necessary, as well as
Cancer in dogs and cats. 3 rded W.B. Morrison
further investigation of the tumor metastasis. Fine needle
Philadelphia. Lippincott: Williams & Wilkins 715-718
aspiration of aqueous humor or sector iridectomy biopsy
Diagnostic Forum
Ultrasound Diagnosis
Phiwipha Kamonrat
History
Ultrasonographic Findings
A nine-month-old, spayed female, domestic
Real-time, ultrasonography was performed using
short-hair cat was presented at the Chulalongkorn
an 8 MHz microconvex, phased array transducer with the
University, Small Animal, Veterinary Teaching Hospital
cat in dorsal recumbency. A moderate volume of anechoic
for evaluation of a several-week duration of progressive
fluid accumulated in the peritoneal cavity. Echogenicity
abdominal distension. The cat had undergone an ovariohys-
of the renal cortex is slightly greater than that of hepatic
terectomy two months ago. There was no history or
parenchyma and slightly less than that of splenic
evidence of trauma. The cat was in good body condition,
parenchyma, compared at approximately the same depth.
had a normal appetite and showed no clinical signs. Water
A hyperechoic band was observed at the corticomedullary
intake and urination were normal. A physical examination
junction of each kidney. The renal contour was smooth.
revealed slightly pale mucous membranes and a tense
Linear measurements of right and left kidneys were
abdomen. A firm mass, about 4 x 6 cm in diameter was
3.1 x 3.7 and 2 x 3.3 cm, respectively. The right kidney
palpated in the region of the right kidney. Results of a
was surrounded by a moderate amount of anechoic
complete blood count and serum biochemical analyses
fluid containing echogenic strands (Figure 1 and 2). The
were within normal limits. Blood morphology showed
entire right kidney, including the surrounding subcapsular
anisocytosis. A urine specimen could not be obtained.
fluid, measured 4.2 x 5 cm in diameter. The urinary
Plain radiographs of the abdomen demonstrated right
bladder was moderately distended with urine containing
renomegaly, of soft tissue opacity and a round to oval
some sediments. The urinary bladder wall was smooth
shape with smooth margins. The gastrointestinal tract was
and 1.1 mm thick. Other abdominal organs appeared
normal in appearance. Ultrasonography of the kidneys
normal in echotexture.
and the entire abdomen were performed.
Department of Surgery, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand
Thai J. Vet. Med., 2009. 39(3): 291-293
292
Kamonrat P./Thai J. Vet. Med. 39(3): 291-293.
A
B
Figure 1 Sagittal (A) and transverse (B) ultrasonographic images through the right kidney, of nine-month-old,
domestic short-hair cat, in dorsal recumbency. A moderate volume of anechoic fluid accumulation
with strands in it, surrounds the renal parenchyma in this cat with a perinephric pseudocyst. A hyperechoic
band has also been observed at the corticomedullary junction.
A
B
Figure 2 Schematics of the relative positions of the structures scanned in figure 1. F-anechoic fluid; C-renal cortex;
M -renal medulla; B-a hyperechoic band that parallels the corticomedullary junction.
Kamonrat P./Thai J. Vet. Med. 39(3): 291-293.
Diagnosis
Ultrasonographic diagnosis
293
during ultrasonography may be normal or abnormal. Fat
Unilateral
perinephric pseudocysts.
vacuoles in the cortical tubular epithelium may increase
renal cortical echogenicity of normal cats (Yeager and
Anderson, 1989). The hyperechoic band observed at the
Comments
Perinephric pseudocysts are formed in cats by
accumulation of large amounts of cystic fluid between
corticomedullary junction is associated with mineral
deposits in the medullary tubular lumen (Barr et al.,
1989).
the capsule and parenchyma of one or both kidneys. This
Pseudocyst formation can occur at variable
disorder is also known as capsular hydronephrosis,
degrees of renal dysfunction on presentation. The
capsular cyst, capsulogenic renal cyst, pararenal pseudocyst
prognosis for cat with pseudocyst formation is related
and perirenal pseudocyst. The cyst is termed pseudocyst
to the degree of renal dysfunction at time of diagnosis.
because it is a fluid-filled fibrous sac that is not lined by an
Analysis of the pseudocyst fluid is usually consistent
epithelium. Perinephric pseudocysts are usually seen in
with a transudate. In this cat, Staphylococcus coagulase
older male cats and are infrequently seen in dogs. There is
was found in the serosanguineous fluid aspirated from
no sex or breed predilection. The cause of pseudocyst
the pseudocyst surrounding the right kidney, following
formation is usually unknown. It is commonly associated
percutaneous fine-needle drainage one month later.
with chronic renal failure and urinary tract infection
(Ochoa et al., 1999). It is unclear if underlying renal
References
disease causes perinephric pseudocyst or the pseudocyst
Barr, F.J., Patteson, M.W., Lucke, V.M. and Gibbs, C. 1989.
causes renal failure. Differential diagnosis of perinephric
Hypercalcemic nephropathy in three dogs:
pseudocysts can be made by multiple imaging modalities
Sonographic appearance. Vet. Radiol. 30: 169-173.
(Essman et al., 2000). However, ultrasound examination
Essman, S.C., Drost, W.T., Hoover, J.P., Lemire, T.D.
is a less-invasive technique used to define perinephric
and Chalman, J.A. 2000. Imaging of a cat with
pseudocysts. An ultrasound-guided, fine-needle, aspiration
perirenal pseudocysts. Vet. Radiol. Ultrasound. 41:
further helps in classifying the pseudocyst fluid of mixed
329-334.
echogenicity. Ultrasonographic findings that are consistent
Ochoa, V.B., DiBartola, S.P., Chew, D.J., Westropp, J.,
in appearance with perinephric pseudocyst include the
Carothers, M. and Biller, D. 1999. Perinephric
presence of a large amount of encapsulated, anechoic fluid
pseudocysts in the cat: A retrospective study
surrounds the kidney, between the renal parenchyma
and review of the literature. J. Vet. Intern. Med.
and renal capsule, and may extend into the caudal
13: 47-55.
retroperitoneal space.
Yeager, A.E. and Anderson, W.I. 1989. Study of
In the cat, the increase in renal cortical echogenicity,
association between histologic features and
relative to liver and spleen, and the presence of a
echogenicity of architecturally normal cat kidneys.
hyperechoic band at the corticomedullary junction
Am. J. Vet. Res. 50: 860-863.
Diagnostic Forum
What is Your Diagnosis
Pranee Tuntivanich
Suwicha Chuthatep
Clinical Examination
Signalment
A 4-month-old male American Pit Bull.
Hard textured presentation of the swelling area was
detected via palpation. The dog had a slight fever. Blood
History
examination showed mild leukocytosis.
The dog had been presented with lameness of all
four limbs regardless of history of trauma. Severe pain and
Radiographic Examination
ataxia had been first noticed; forelimbs in particular, then
Mediolateral and dorsopalmar radiographs from
slowly improved during the last 2 weeks. However, marked
distal aspects of both radius and ulna were taken to assess
swelling surround the distal part of both forelimbs
the radiographic changes of bones and soft tissue.
remained.
(1)
(2)
(3)
(4)
Figure 1, 2. Mediolateral radiographs of the right (1) and left (2) distal aspects of the radius and the ulna.
Figure 3, 4. Dorsopalmar radiographs of the right (3) and left (4) distal aspects of the radius and the ulna.
Give your diagnosis and turn to the next page.
Department of Surgery, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand
Thai J. Vet. Med., 2009. 39(3): 295-296
296
Tuntivanich P. & Chuthatep S./Thai J. Vet. Med. 39(3): 295-296.
Radiographic findings
could be detected (Figures 1-6). Periosteal bone formation
All radiographs revealed transverse irregular
radiolucent lines running from the proximal to the distal
was found close to the distal physis of the left radius
(Figures 4, 6).
physis in the metaphyseal regions of both radius and
ulna (Figures 1-6). Thickening of the metaphysis that was
due to severe periosteal reaction and soft tissue swelling
Radiographic diagnosis
Hypertrophic osteodystrophy (late stage)
Figure 5. Close-up mediolateral view of the left
distal aspects of the radius and the ulna shows
irregular radiolucent zone from the proximal to the
distal physis of the radius and the ulna (small arrows).
Figure 6. Close-up dorsopalmar view of the left
distal aspects of the radius and the ulna shows
irregular periosteal bone formation separated from
metaphyseal region of the radius (large arrows).
(5)
(6)
Discussion
sions of orthogonal radiography and contralateral limb
Hypertrophic osteodystrophy or metaphyseal
examination. If the lameness cannot be localized to a
osteopathy is a developmental bone disease that is usually
specific region of the limb, several radiographs of the
diagnosed by using radiographic examination. It is a
limb should be consider.
self-limiting disease of unknown etiology that frequently
affects large and giant breed dogs between two and seven
References
months of age. Dogs usually recover after two to three
Baines, E. 2006. Clinically significant developmental
weeks regardless of treatment. Cases that present severe
radiological changes in the skeletally immature
involvement of bone reaction in the physis can result in
dog: 1. long bones. In practice. 28(4): 188-199.
premature physeal closure, subsequently develop bilateral
valgus deformities in the mid and distal forelimbs.
Farrow, C.S. 2003. Congenital and developmental bone
In order to evaluate the developmental bone dis-
disease. In: Veterinary Diagnosis Imaging the Dog
ease, a comparison should be made between two dimen-
and Cat. 1sted. St. Louis, Missouri: Mosby. 167-176.

PDF FILE

Transcription

Similar documents

Celadon restaurant review

Saladang Song is a Thai restaurant located in a mixed commercial

2015 SINGHA IWWF Asian Championships` Things to Do Guide

here - YOUTHCOACH project

Milk Barfi

www.nycacc.org - Animal Care Centers of NYC

Jaltemba Bay Animal Rescue Newsletter Fall 2015

Cobra Courier Kingsville Public

Product Request Form

BCC CA - One Pager - Med Learning Group