Inducing systemic resistance against some tomato virus diseases
Transcription
Inducing systemic resistance against some tomato virus diseases
Inducing systemic resistance against some tomato virus diseases By E m an Shahw an M oheb E l-l - D in Shahw an B.Sc. Agric. Sci., (Plant Pathology) 2002 M.Sc. Agric. Sci. (Plant Pathology) 2007 Fac. Agric., Moshtohor, Banha Univ. DISSERTATION Submitted in Partial Fulfillment of the Requirements for The Degree of DOCTOR OF PHILOSOPHY in PLANT PATHOLOGY (V iral D iseases ) Agricultural Botany Department (Plant Pathology) Faculty of Agriculture, Moshtohor Banha University 2010 Title: INDUCING SYSTEMIC RESISTANCE AGAINST SOME TOMATO VIRUS DISEASES Name: E m an Shahw an M oheb E ll - D in Shahw an Degree: DOCTOR OF PHILOSOPHY Department: Agricultural Botany (Plant Pathology) ABSTRACT The objectives of this study were isolation and identification of the most frequently and economically viruses causing serious losses in tomato crop in the different location of Qalyoubia Governorate, evaluating some medicinal plant extracts and kombucha filtrate as biotic inducers to induction systemic acquired resistance in the tomato plants against CMV and using more effective bioinducers as bioelicitors for control viruses infection via induction 'pathogenesis-related' (PR-1a) genes. Target virus was chosen according to its more frequently and severity among the isolated viruses in these locations at the winter season from the study year. Isolated virus was confirmed biologically and serologically assays. Extracts of two medicinal plants (Clerodendrum inerme L. Gaertn and Mirabilis jalapa L.) and were individually or in mixture in addition to kombucha filtrate were evaluated as bioinducers. All the four inducers were successfully in the induction of systemic acquire resistance (SAR) in the uninoculated tomato plants and sprayed with (50% v/v) of inducers. Tested bioinducers were used as biocontrol to inhibiting the virus infection of tomato plants as spraying every 15 days under greenhouse conditions. Pathogenesis-related (PR-1a) gene was molecularly isolated and identified via sequencer which compared with those recorded in the Gen-Bank. In conclusion, using medicinal extracts and other natural inducers were promise with good systemic acquired resistance against the great numbers of plant pathogens. In future, induction of resistance can be done cheaply and easily using natural substances CONTENTS Page LIST OF FIGURES ...................................................................................... i LIST OF TABLES ...................................................................................... iv LIST OF PLATES..................................................................................... vii LIST OF ABBREVIATIONS ................................................................. ix INTRODUCTION ........................................................................................ 1 REVIEW OF LITERATURE .................................................................. 4 MATERIALS AND METHODS .......................................................... 44 EXPERIMENTAL RESULTS .............................................................. 73 Part I 1- Disease incidence and frequency of virus .................................... 73 2- Confirmation of Cucumber mosaic virus (CMV) ...................... 75 2.1. Host range ......................................................................................... 75 2.2. Transmission of CMV ................................................................... 78 2.3. In vitro properties ............................................................................ 78 2.4. Inclusion bodies ............................................................................... 80 2.5. Dot blot immunoassay (DBIA) ................................................... 80 Part II Evaluation of biotic inducers of systemic acquired resistance and biocontrol of CMV ................................................ 82 A. Induction of systemic acquired resistance (SAR) by biotic inducers before virus inoculation .................... 82 1. Histopathology changes ........................................................... 82 2. Biochemical changes ................................................................. 86 2.1. Antiviral Proteins...................................................................... 86 a. Determination the elicited antiviral protein as response to induction SAR (pre-inoculation) after 7-days........................... 86 b. Determination the elicited antiviral protein as response to induction SAR (post-inoculation) after 25-days....................... 89 2.2- Oxidative enzymes .......................................................................92 a. Peroxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (pre-inoculation) after 7-days ............92 b. Peroxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (post-inoculation) after 25-days ........95 c. Polyphenol oxidase isozyme in tomato plants sprayed with biotic to induce SAR (pre-inoculation) after 7-days........ 98 d. Polyphenol oxidase isozyme in tomato plants sprayed with biotic to induce SAR (pre-inoculation) after 25-day.... 101 2.3. Quantification of total SA in tomato plants treated with biotic pre-virus inoculation ..................... 104 2.4. Photosynthetic pigments content.......................................... 109 2.5. Determination of phenolic compounds .......................... 110 2.6. RNA determination in tomato plants treated with biotic inducers pre-virus inoculation.......................... 112 3. Molecular marker for SAR detection ............................113 Analysis of molecular data by Bioinformatics ...................... 116 1- Nucleotide sequence ....................................................................... 116 2- Translation of partial nucleotide sequence of PR-la gene for tomato plants treated with biotic inducers ....121 4- Effect of biotic inducers on virus infectivity during induction of SAR as follows................................................... 126 B- Using of biotic inducers as bioinducers to control CMV infection ................................................................................................ 128 1. Histopathological changes ....................................................... 128 2. Biochemical changes ................................................................... 131 2.1. Antiviral proteins.................................................................. 131 a. Determination the elicited antiviral protein as response to treatment with bioinducers to control infected tomato plants after 7 days of spraying ............... 131 b. Determination the elicited antiviral protein as response to treatment with bioinducers to control infected tomato plants after 25 days of spraying ............ 134 2.2. Oxidative enzymes ................................................................ 137 a. Peroxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 7 days of spraying.................................................................................. 137 b. Peroxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 25days of spraying ........................................................................ 139 c. Polyphenol oxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 7 days of spraying .......................................................... 143 d. Polyphenol oxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 25 days of spraying ........................................................ 145 2.3- Photosynthetic pigments content ................................... 149 2.4. Determination of total phenols ........................................ 151 2.5. Total free amino acids content in inoculated tomato plants and treated with bioinducers ............ 152 2.6. Total carbohydrates content in inoculated tomato plants and treated with bioinducers ........................... 154 3. Effect of bioinducers on virus infectivity ........................... 155 DISCUSSION ............................................................................................ 157 SUMMERY ................................................................................................ 188 REFERENCES ......................................................................................... 198 ARABIC SUMMARY LIST OF FIGURES Page Figure 1 Conceptual model for the pathway leading to the establishment of SAR ........................................................... 29 Figure 2 Standard curve of the protein concentration using bovine serum albumin as a standard protein. .................................. 57 Figure 3 Standard curve of glucose for determination total carbohydrate. ........................................................................ 66 Figure 4 Standard curve of total RNA................................................ 67 Figure 5 Disease incidence and disease severity of natural viruses affecting tomato at 5 different locations in Qalyoubia Governorate. ......................................................................... 74 Figure 6 Effect of biotic inducers on protein content in tomato plants pre virus inoculation................................................... 87 Figure 7 Effect of biotic inducers on protein content in tomato plants post virus inoculation ................................................. 90 Figure 8 Effect of biotic inducers on POD activity in tomato before CMV inoculation. ................................................................. 92 Figure 9 Effect of biotic inducers on POD activity in tomato plants infected with CMV. .............................................................. 95 Figure 10 Effect of biotic inducers on PPO activity in tomato plants pre- CMV inoculation. ......................................................... 98 Figure 11 Effect of biotic inducers on PPO activity in tomato plants infected with CMV. ............................................................. 101 Figure 12 HPLC quantification of free and endogenous SA in induced tomato plants......................................................... 105 Figure 13 Histogram illustrates the RNA content values in the leaves of tomato plants treated with bioinducers compared with healthy ........................................................ 113 i Figure 14 The partial nucleotide sequence of DNA (182 bp) from mRNA of PR-la gene of tomato plants treated with biotic inducers. .............................................................................. 115 Figure 15 Multiple sequence alignment of the partial nucleotide sequence of the PR-1a gene for tomato plants with the corresponding sequence of six pathogenesis related protein available in Gen-Bank............................................ 119 Figure 16 A Phylogenetic tree of tomato plants treated with bioinducers and other crops. ............................................ 120 Figure 17 Histogram illustrates nucleotide frequencies of PRgene of tomato plants related to other PR-la gene of different crops in GenBank. ............................................. 120 Figure 18 Translation of partial nucleotide sequence of PR-la gene for tomato plants treated with biotic inducers produced 60 amino acids with MW = 6.383 kDa. .............................. 121 Figure 19 Multiple amino acids sequence aligned of the partial PR-1a gene of the studied tomato plants with the corresponding amino acid sequence of eleven pathogenesis related protein of different hosts available in GenBank. ............................... 123 Figure 20 A phylogenetic tree of PR-la gene tomato based on the amino acid sequence of the PR-la gene. ................................ 124 Figure 21 Effect of bioinducers on disease severity and virus infectivity in tomato plants.................................................. 127 Figure 22 Effect of bioinducers on protein content in tomato plants infected with CMV (after 7 days)......................................... 132 Figure 23 Effect of bioinducers on protein content in tomato plants infected with CMV (after 25 days)....................................... 135 Figure 24 Effect of bioinducers on POD activity in tomato plants infected with CMV (after 7 days) ........................................ 137 Figure 25 Effect of bioinducers on POD activity in tomato plants infected with CMV (after 25 days). ..................................... 140 ii Figure 26 Effect of bioinducers on PPO activity in tomato plants infected with CMV ............................................................. 143 Figure 27 Effect of bioinducers on PPO activity in tomato plants infected with CMV. ............................................................. 146 Figure 28 Effect of bioinducers on total free amino acids in tomato plants infected with CMV. .................................................. 153 Figure 29 Effect of bioinducers on total carbohydrates content in tomato plants infected with CMV ...................................... 155 Figure 30 Effect of bioinducers on CMV infectivity in tomato plants.156 iii LIST OF TABLES Table 1 Page Preparation of SDS-PAGE gels. .............................................. 59 Table 2 Pathogenesis related protein (PR-1a gene) of different crops in GenBank. ................................................................... 71 Table 3 Eleven Pathogenesis related protein (PR-1a gene) amino acids of different hosts published in GenBank........................ 72 Table 4 Detection of viruses naturally infected tomato plants. ............ 73 Table 5 The disease incidence and disease severity of naturally viral infected tomato plants in different 5 locations (Qalyoubia Governorate)......................................................... 74 Table 6 The reactions of plant host species and cultivars inoculated with CMV isolate. ................................................................... 76 Table 7 In vitro properties of CMV isolate in infectious crude sap under laboratory conditions..................................................... 79 Table 8 Anatomical variations of tomato leaf treated with biotic inducers (lengths measured by µm)......................................... 83 Table 9 Protein content and enzyme activities in tomato plants treated with biotic extracts........................................................ 87 Table 10 Protein fractions of tomato plants treated with bioinducers using SDS-PAGE..................................................................... 88 Table 11 Protein content and enzyme activities in infected tomato plants then treated with biotic extracts. ................................... 90 Table 12 Protein fractions of CMV infected tomato plants treated with bioinducers using SDS-PAGE. ...................................... 91 Table 13 Disc-PAGE banding patterns of peroxidase isozymes of tomato plants non-inoculated with CMV and treated with bioinducers. ............................................................................. 94 Table 14 Disc-PAGE banding patterns of peroxidase isozymes of tomato plants treated with bioinducers then infected by CMV. ....................................................................................... 97 Table 15 Disc-PAGE banding patterns of polyphenol oxidase isozymes of tomato plants treated with bioinducers ............ 100 iv Table 16 Disc-PAGE banding pattern of polyphenol oxidase isozymes of tomato plants treated with bioinducers then infected by CMV. ........................................................... 102 Table 17 Protein genetic markers of tomato plants produced by bioinducers as indication of systemic acquired resistance against CMV infection ........................................................ 104 Table 18 Quantification of total SA in tomato plants treated with bioinducers compared with healthy plant..................... 105 Table 19 Chlorophyll and carotenoid contents (mg/g FW) in tomato plants treated with biotic inducers........................................ 110 Table 20 Free, conjugated and total phenols content in tomato plants treated with biotic inducers. .................................................. 111 Table 21 Comparison between tomato plants (treated with biotic inducers) in RNA contents and healthy, inoculated controls .112 Table 22 Comparison between bases composition of partial PR-la gene for tomato plants treated with biotic inducers and six pathogenesis related protein published in Gen-Bank. ........... 117 Table 23 Comparison between amino acids composition of partial PR-la gene sequence for tomato plants treated with bioinducers and 11 pathogenesis related protein of different hosts published in GenBank. .................................. 125 Table 24 Effect of bioinducers on CMV infectivity in tomato plants. ..... 126 Table 25 Effect of bioinducers on anatomical structure of tomato leaves post-CMV inoculation (lengths measured by µm). .................................................................. 129 Table 26 Protein content and enzyme activities in tomato plants infected with CMV and treated with biotic extracts (after 7 days)....................................................................................... 132 Table 27 Protein fractions of tomato plants infected with CMV and treated with bioinducers using SDS-PAGE........................... 133 Table 28 Protein content and enzyme activities in tomato plants infected with CMV and treated with biotic extracts (after 25 days).................................................................................. 135 v Table 29 Protein fractions of CMV infected tomato plants treated with bioinducers using SDS-PAGE................................ 136 Table 30 Disc-PAGE banding patterns of peroxidase isozymes of CMV infected tomato plants treated with bioinducers.......... 138 Table 31 Disc-PAGE banding patterns of peroxidase isozymes of CMV infected tomato plants treated with bioinducers.......... 141 Table 32 Disc-PAGE banding patterns of polyphenol oxidase isozymes of CMV infected tomato plants treated with bioinducers. ........................................................................... 144 Table 33 Disc-PAGE banding patterns of polyphenol oxidase isozymes of CMV infected tomato plants treated with bioinducers. ........................................................................... 147 Table 34 Disc-PAGE banding patterns of polyphenol oxidase isozymes of CMV infected tomato plants treated with bioinducers. ....... 149 Table 35 Chlorophyll and carotenoid contents in tomato plants treated with bioinducers after CMV inoculation............................... 150 Table 36 Free, conjugated and total phenols content in tomato plants treated with bioinducers after CMV inoculation. .................. 152 Table 37 Total free amino acids content in tomato plants treated with bioinducers............................................................................. 153 Table 38 Total carbohydrates content (mg/g FW) in infected tomato plants treated with bioinducers.............................................. 154 Table 39 Effect of individual bioinducers on post CMV infection in tomato. .......................................................................................... 156 vi LIST OF PLATES Page Plate 1 Different types of natural infection symptoms on tomato leaves showing mosaic, mottling, blisters, crinkle, yellowing, malformation and erecting.......................................................... 45 Plate 2 Plant leaves inoculated with CMV isolate showing local symptoms on Chenopodium murale, C. quinoa, C. amaranticolor and Datura metel. ............................................... 77 Plate 3 Host plants mechanically inoculated with CMV isolate showing different types of symptoms on leaves. ...................................... 77 Plate 4 Epidermal strips and hairs of cucumber leaves infected with CMV (15 days post inoculation) showing cytoplasmic inclusion bodies, (Magnification of Light micrograph 400X). (A) CI: Crystalline inclusion bodies. (B) AI: Amorphous inclusion bodies.. .................. 80 Plate 5 Dot Blot Immunoassay for CMV precipitation against specific IgG-CMV polyclonal. ................................................................ 81 Plate 6A Anatomical variations in tomato leaves treated with bioinducers. ................................................................................ 84 Plate 6B Light micrograph of tomato leaves sprayed with biotic inducers and infected with CMV showing different changes in cells and tissues (40X)............................................................ 85 Plate 7 Protein fractions of tomato plants treated with bioinducers pre CMV inoculation using SDS-PAGE. ................................... 88 Plate 8 Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. ................................. 91 Plate 9 Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers pre CMV inoculation. ................................................................................. 94 Plate 10 Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers post CMV inoculation. ................................................................................. 97 vii Plate 11 Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers pre-CMV inoculation. ............................................................................... 100 Plate 12 Native polyacrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation. ............................................................ 103 Plate 13 2.5% agarose gel electrophoresis showing the amplified PCR product of mRNA of PR-1a gene of tomato plants treated with bioinducers at the correct size (182 bp). .......................... 114 Plate 14 Light micrograph of tomato plant treated with bioinducers post CMV inoculation showing different changes in cells and tissues (40X)............................................................................. 130 Plate 15 Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. ............................... 133 Plate 16 Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. ............................... 136 Plate 17 Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers post CMV inoculation...................................................................... 139 Plate 18 Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers post CMV inoculation...................................................................... 142 Plate 19 Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation...................................................................... 145 Plate 20 Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation...................................................................... 148 viii LIST OF ABBREVIATIONS A AIB APS ASA AVP Bp BA BA2H BI BSA BPB C CarMV °C Chl.a Chl.b cm Cp cDNA CBB CIB Ci CMV cv. dNTP DEP DS DTT DBIA DAS-ELISA EDTA e.g. EAVPs et al. FW g G HPLC :Adenine :Amorphous inclusion bodies :Ammonium persulfate :Acetyl salicylic acid. :Antiviral protein. :Base pair :Benzioc acid :Benzioc acid 2- hydroxylase :Biotic inducer :Bovine serum albumin :Bromophenol blue :Cytosine :Carnation mosaic virus :Centegrate :Chlorophyll a. :Chlorophyll b. :Centimeter :Coat protein :Complement deoxyribonucleic acid :Coomassie brilliant blue :Crystalline inclusion bodies :Clerodendrum inerme :Cucumber mosaic cucumovirus :Cultivar :Dideoxy nucleotide triphosphate :Dilution end point :Disease severity :Dithiothreotol :Dot blot immunoassay :Double antibody sandwich enzyme-linked immunosorbent assay :Ethylene diamine tetra acetic acid :For example (Exempli gratia) :Endogenous antiviral proteins :And other (et alii) :Fresh weight :Gram :Guanine :High performance liquid chromatography ix hr HR i.e. IgG I-ELISA IAA ISR K KDa Kg L-DOPA LAR L.L. LIV ml mg min Mixed(Mj+Ci) Mj mM µg µl M nm NRC nt O.D pH PRs POD PMSF PA PAL PBS PBST PGPR PAGE PEG PCR PPO :Hour :Hypersensitive reaction :That is (id est) :Immunoglobulin G :Indirect enzyme-linked immunosorbent assay :Indole acetic acid :Induced systemic resistance :Kombucha :Kilo Dalton :Kilo gram :L-Dihydroxy phenylalanine :Local acquired resistance :Local lesion :Longevity in vitro :Milliliter :Milligram :Minute :Mixed (Mirabilis jalapa + Clerodendron inerme) :Mirabilis jalapa :Millimole :Microgram :Microliter :Molar :Nanometer :National research centre :Nucleotide :Optical density :Hydrogen ion concentration :Pathogenesis related proteins :Peroxidase :Phenyl methyl sulfonyl :Phenylalanine :Phenylalanine ammonia-lyase :Phosphate buffer saline :Phosphate buffer saline-Tween :Plant growth promoting rhizobacteria :Polyacrylamide gel electrophoresis :Polyethylene glycol :Polymerase chain reaction :Polyphenol oxidase x PVP PPB PVX R.I. RT-PCR RPM RNA RIPs RNAsin SAG SA sat RNA SNL SDS-PAGE SAR SRIs T TEMED TIP TMV TNV TRV ToMoV TSWV UV VIA V/V W/V :Polyvinyl pyrrolidine :Potassium phosphate buffer :Potato virus X :Reduction of infection :Reverse transcriptase polymerase chain reaction :Revolution per minute :Ribonucleic acid :Ribosome inactivation proteins :RNAase inhibitor :Glycosyl salicylic acid :Salicylic acid :Satellite RNA :Small necrotic lesions :Sodium dodecyl sulfate polyacrylamide gel electrophoresis :Systemic acquired resistance :Systemic resistance inducers :Thiamine :Tetra methylene di amine :Thermal inactivation point :Tobacco mosaic virus :Tobacco necrosis virus :Tobacco rattle tobravirus :Tomato mottle virus :Tomato spotted wilt-virus :Ultraviolet :Virus inhibitory agent :Volume per Volume :Weight/Volume xi ACKNOWLEDGMENT All the greatest gratefulness, deepest appreciation and sincerest thanks to ALLAH for all gifts which given me and for enabling to overcome all problems which faced in my and throughout the course of this investigation and helping me to achieve this hard work in the ideal form to bring-forth to light this thesis. The author wishes to express her deepest gratitude and indebtedness to the supervisor of the present work Prof. D r. A bdou M ahdy M oham ed M ahdy Professor of Plant Pathology and Vice Dean of Faculty for Community Service and Development of Environment, Botany Dept., Fac. Agric., Banha Univ., for his constructive supervision, valuable advice, kind guidance, great assistance in the preparation of this manuscript and for his help in putting thesis in its final from. I would like to thank Prof. D r. K haled A bdelbdel - Fatah E l-l - D ogdog Professor of Plant Virology, Microbiology Dept., Fac. Agric., AinShams Univ., for his great help, encouragement, invaluable guidance and his kind attitude toward me during all time of this research and in the final preparation of this manuscript. The author indebted to Prof. D r. Rao Ra o uf N agui agu i b Faw zy Professor of Plant Pathology, Botany Dept., Fac. Agric., Banha Univ., for his sincere encouragement, scientific support, keeping interest and his helps in provision of all facilities needed for the present work. I’m also indebted to D r. M oham ed A ll - Sayed H afez Ass. Professor of Plant Pathology, Botany Dept., Fac. Agric., Banha Univ., for his unlimited valuable help. Thanks are also due to all staff members of the Fungi and Plant Pathology Branch, Agric. Botany Dept., Fac. Agric., Banha Univ., for their kindness and technical assistance. INTRODUCTION Tomato (Lycopersicon esculentum Mill., Solanum lycopersicon L.), belongs to a large family of plants called the Solanaceae. It's one of the most important commercially grown vegetables in Egypt and the most popular vegetable throughout the world, and the importance of its cultivation is threatened by a wide array of pathogens. In the last twenty years this plant has been successfully used as a model plant to investigate the induction of defense pathways after exposure to fungal, bacterial, viral and abiotic molecules, showing triggering of different mechanisms of resistance (Lancioni, 2008). Egypt ranks fifth in the world for tomato production (FAO, 2010). In 2009/2010, farmers produced about 9,204,097 million tons of tomato from total area of 476.190 feddan plus 2314 protected houses (Year Book of Ministry of Agriculture & Land Reclamation). Tomato also contains important vitamins, minerals and antioxidants. Tomato is susceptible to many viruses and considerable yield losses and diminished fruit quality can occur due to single or multiple viral infections. The power of growth; decrease of yield and quality of tomato were observed under protective and open field cultivation (Rampersad, 2006). Virus diseases are considered one of the most important problems affecting tomato production in many countries. There are about 75 viruses infecting this crop (Mohamed, 2010). Cucumber mosaic virus (CMV), is the type species of the genus Cucumovirus, family Bromoviridae, has isometric particles and a positive-sense RNA with a tripartite genome. Cucumber mosaic virus has a worldwide distribution and is of economic importance in many -1- Introduction crops, vegetables, fruits and ornamentals. Cucumber mosaic virus is difficult to control because of its extremely broad host range in excess of 800 plant species and transmission in a non-persistent manner by more than 60 species of aphids. On tomato, symptoms of CMV infection include stunting of vegetative growth, distortion and mottling of new growth, and a characteristic shoestring-like leaf appearance (Sudhakar et al., 2007). Virus infections cause great damage to economical crops, this loss is so clear especially in developing countries. Investigators were aiming to control such incurable pathogen using an alternative biological controlling strategy depending on a clean agriculture system. Systemic resistance for virus infections can be induced in plants treated with certain bacteria or with bacterial products, and also by treatment with some chemicals which may be more risky when compared with bacteria. The role of such induced systemic resistance described by the enhancement of the production of plant antioxidant protective enzyme, peroxidase, besides the activation of some plant defense genes producing pathogenesis related proteins (PR-Ps), which are not well studied yet for its mode of action (Shehata and El-Borollosy, 2008). Plant viruses seem nearly impossible to control, instead, practical attempts are made to keep them in check, to reduce losses, basically to manage their existence within a crop. The availability of genetically resistant varieties is clearly the best approach for all cultivated crops; however, such varieties are often not available, and even when they are available, there is the possibility for the occurrence of other viruses or viral strains that are not affected by the Introduction -2- resistance. The basic premise behind these approaches is to delay the introduction of virus into the crop thereby allowing the plant to mature to a stage of development that will essentially tolerate the infection. Virus infection of a more mature plant typically results in delayed movement of virus throughout the plant, reduced virus accumulation, reduced symptom severity and losses in yield. It is noticed that tobacco plants exhibited ‘systemic acquired resistance’ following local infection with tobacco mosaic virus. Other terms that have been used to describe systemic resistance in plants include ‘translocated resistance’, ‘plant immunization’ and ‘induced systemic resistance’. The term ‘induced systemic resistance’ (ISR) is used to denote induced systemic resistance by non-pathogenic biotic agents and may differ mechanistically from resistance induced by other elicitors. Inducible defenses in plants may have selective advantages over constitutive defenses. While inducible defenses are often localized at the site of attack, plant defense mechanisms may be activated systemically throughout the plant following a localized infection or attack (Rampersad, 2006). Therefore, the objective of this investigation is evaluating some biotic inducers (water extracts of Clerodendrum inerme, Mirabilis jalapa or their mixture and kombucha filtrate) to induce acquired systemic resistance and safe means to control virus infection in tomato either in the greenhouse or in the open field conditions. -3- Introduction REVIEW OF LITERATURE Part I 1- Disease incidence and frequency of virus(es): The incidence of virus diseases of tomato (Lycopersicon esculentum) in Mauritius was investigated in field's samples by electron microscopy and enzyme-linked immunosorbent assay (ELISA). Two virus diseases, potato virus Y (PVY) and tomato mosaic virus (ToMV) were found to be widespread. ELISA may differentiate two strains of the PVY virus (Ganoo and Saumtally, 1999). A survey of tomato ant pepper viruses was conducted in Sudan during the last ten years. It covered Central, Northern, Eastern, Southeastern and Western regions of Sudan. The results revealed the presence of many mosaic - inducing virus and virus like agents. Cucumber mosaic virus (CMV), tomato mosaic virus (ToMV), tobacco mosaic virus (TMV), Tomato yellow leaf curl virus (TYLCV) and potato virus Y (PVY) were all found to infect both tomato and pepper (Elshafie et al., 2005). Yardimci and Eryigit (2006) showed that, leaf samples were collected from 138 tomato (Lycopersicon esculentum) plants showing symptoms of Cucumber mosaic virus (CMV) in the north-west Mediterranean region of Turkey. The samples were first tested by double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) using CMV specific polyclonal antibody. The DASELISA revealed that 53 of the 138 leaf samples tested were infected with CMV. One of the ELISA-positive CMV isolates was Review of Literature -4- mechanically inoculated into a set of indicator plants by conventional leaf inoculation method for further characterization. The virus was multiplied and showed systemic symptoms in Nicotiana tabacum 'Xanthii', Nicotiana tabacum 'Samsun NN', and Capsicum annuum. Michael (2009) found that, A survey was conducted to determine the incidence of Cucumber mosaic virus (CMV), Beet curly top virus (BCTV), Tomato yellow leaf curl virus (TYLCV), Tomato chlorotic spot virus (TcSV), Potato virus Y (PVY), Potato virus S (PVS), Tomato spotted wilt virus (TSWV), Tomato ringspot virus (TRSV), Tomato aspermy virus (TAV), Arabis mosaic virus (ArMV), Tobacco streak virus (TSV), Tomato bushy stunt virus (TBSV), Tobacco mosaic virus (TMV), and Tomato mosaic virus (ToMV) on tomato (Solanum lycopersicum) in the major horticultural crop growing areas in the southeast and central regions of Iran. Samples of symptomatic plants were analyzed for virus infection by enzyme-linked immunosorbent assay (ELISA) using specific polyclonal antibodies. ArMV and CMV were the most frequently found viruses, accounting for 25.6 and 23.4%, respectively, of the collected samples. BCTV, TSWV, TMV, PVY, ToMV, and TYLCV were detected in 6.1, 5.8, 5.6, 5, 4.8, and 1.6% of the samples, respectively. TBSV, TAV, TSV, PVS, and TRSV were not detected in any of the samples tested. Double and triple infections involving different combination of viruses were found in 13.9 and 1.7% of samples, respectively. This is the first report of PVY and ArMV as viruses naturally infecting tomato in Iran. A survey was conducted to determine the incidence of Cucumber mosaic virus (CMV), Beet curly top virus (BCTV), Tomato yellow leaf -5- Review of Literature curl virus (TYLCV), Tomato chlorotic spot virus (TcSV), Potato virus Y (PVY), Potato virus S (PVS), Tomato spotted wilt virus (TSWV), Tomato ringspot virus (TRSV), Tomato aspermy virus (TAV), Arabis mosaic virus (ArMV), Tobacco streak virus (TSV), Tomato bushy stunt virus (TBSV), Tobacco mosaic virus (TMV), and Tomato mosaic virus (ToMV) on tomato (Solanum lycopersicum) in the major horticultural crop growing areas in the southeast and central regions of Iran. A total of 1307 symptomatic leaf samples from fields and 603 samples from greenhouses were collected from January 2003 to July 2005 in five southeastern and central provinces of Iran. Samples of symptomatic plants were analyzed for virus infection by enzyme-linked immunosorbent assay (ELISA) using specific polyclonal antibodies (Massumi et al., 2009). Lin et al. (2010) found that, Cucumber mosaic virus (CMV) has been identified as the causal agent of several disease epidemics in most countries of the world. Insect-mediated virus diseases, such as those caused by CMV, caused remarkable loss of tomato (Solanum lycopersicon) production in Taiwan. 2- Confirmation of Cucumber mosaic cucumovirus (CMV): 1. Biological characters: 1.1- Symptomatology and Host range: In Egypt, CMV was isolated from Nicotiana gluaca (Eid et al., 1984) sugar beet (Omar et al., 1994), pepper (Khalil et al., 1985), cucumber (El-Baz, 2004; El-Afifi et al., 2007; Megahed, 2008 and Taha, 2010) and tomato (Mohamed, 2010). Review of Literature -6- Tomato plants infected with CMV are often showing stunted, have short internodes, and may have extremely distorted and malformed leaves, known as fern-leaf (Megahed, 2008 and Taha, 2010). Hellwald et al. (2000) mentioned that, a selection of cucumber mosaic virus (CMV) subgroup I strains originating from Asia and Fny-CMV isolated in USA were studied for their interaction with tomato plants. All strains caused mosaic, fern leaf expression and stunting of tomato plants. CMV has a wide range of hosts and attacks a great variety of vegetables, ornamentals, and other plants (as many as 191 host species in 40 families). Among the most important vegetables affected by cucumber mosaic are peppers (Capsicum annuum L.), cucurbits, tomatoes (Lycopersicon esculentum Mill.), and bananas (Musa spp. L.) (Chabbouh and Cherif, 1990). Fawzy et al. (1992) reported that, C. amaranticolor, C. album and C. quinoa infected with a strain of CMV showing local infection. Chaumpluk et al. (1994) found that, two strains of CMV caused severe necrotic ring spot on Tetragonia expansa, contained without satellite RNA, another strain C7-2, caused mild mosaic with ring scar on T. expansa. Espinha and Gasper (1997) reported that, mosaic and distortion symptoms in Cucurbita pepo, Nicotiana tabacum, Cucumis sativus, Lycopersicon esculentum and Datura stramonium infecting with CMV. While it gave local symptoms on C. quinoa and Gomphrena globosa. Barbosa et al. (1998) found that, CMV diseased banana plants was detected by mechanically inoculated on the indicator species, -7- Review of Literature Nicotiana glutinosa, Cucurbita pepo cv. Caserta. Mosaic symptoms observed in N. glutinosa plant and local lesions in C. pepo. Chen and Hu (1999) stated that, CMV was shown to infect 27 plant species of 9 families, 20 species appeared systemic infection and 7 species appeared as local lesion hosts. The virus infected many species in the family Cucurbitaceae, but it did not infect Phaseolus vulgaris or Vigna unguiculata. Fukumoto et al. (2003) reported that, necrotic diseases of the stems, petioles and leaves of pea plants (Pisum sativum) leading to wilting and death caused by CMV. Takarai et al. (2006) found that, green mottle, green mosaic, and chlorotic spots symptoms produced in Momordica charantia L. plants systemically infected with Cucumber mosaic virus (CMV). Montasser et al. (2006) showed that, three strains of Cucumber mosaic virus (CMV) have been found to cause a lethal disease, referred to as fern leaf syndromes and mild mosaic symptoms in tomato (Lycopersicon esculentum Mill.) crops grown in Kuwait. CMV strains were detected and identified based on host range, symptomatology, serology, electron microscopy, and ribonucleic acid (RNA) electrophoresis in polyacrylamide gels. Sudhakar et al. (2006) observed during a survey in January 2006 near Salem in Tamil Nadu (south India), Cucumber mosaic virus that infecting tomatoes with an incidence of more than 70%. Plants exhibiting severe mosaic, leaf puckering, and stunted growth were collected, and the virus was identified using diagnostic hosts, evaluation of physical properties of the virus, compound enzyme-linked immunosorbent assay Review of Literature -8- (ELISA) (ELISA Lab, Washington State University, Prosser), reversetranscription polymerase chain reaction (RT-PCR), and restriction fragment length polymorphism analysis (DSMZ, S. Winter, Germany). Balogun and Daudu (2007) reported that, the general symptoms observed on Lycopersicon esculentum cv. Manuella were included pale green to yellowish mosaic pattern on plant foliage, subsequent stunting of plant, extremely distorted and malformed leaves (fern leaf) as severe cases of CMV infection. Akhtar et al. (2008) found that, a severe infection with CMV observed among all tomato cultivars grown in Pakistan, evoking severe leaf malformation and shoe stringing. Zitikaitė and Samuitienė (2009) showed that, Cucumber mosaic virus (CMV) causing viral diseases in forage, fruit, ornamental and vegetable crops worldwide has been isolated in Lithuania from sweet pepper (Capsicum annuum L.) plants exhibiting mottle-mosaic and distortion of leaves and fruits, and plant stunt symptoms. The family of Cucurbitaceae were reacted with different symptoms such as cucumber plants showed severe mosaic, blisters and malformation while, squash plants gave vein clearing, severe mosaic, green vein banding, blisters and malformation. Different symptoms produced on some other species belonging to different families; N. glutinosa appeared severe mosaic, fern leaf and malformation; N tabacum cv. White Burly produced severe mosaic; D. metel showing severe mosaic and malformation, Helicrysum bracteatum showed yellowing symptoms and Petunia hybrida gave severe mosaic, malformation and discoloration (Megahed, 2008 and Taha, 2010). -9- Review of Literature 1.2-Transmission of CMV: A- Mechanical transmission: El-Baz (2004); Davino et al. (2005); Takarai et al. (2006); ElAfifi et al. (2007); Akhtar et al. (2008); Megahed (2008) and Taha (2010) reported that, CMV strains were transmitted mechanically by infectious sap. Ali and Kobayashi (2010) reported that, CMV transmitted to healthy pepper through seeds. B- Aphid transmission: The aphid species Myzus persicae, Aphis gossypii and Aphis craccivora Koch were shown to be vectors of CMV in Sudan. Aphis gossypii seemed the most efficient. The virus was not transmitted through 300 seeds from 3 plant species (Abdul Magid, 1990). CMV is transmitted in a non-persistent manner by more than 80 aphid species. The spread of the virus is generally over short distances and aphids only remain infective for periods from a few minutes up to a few hours. During our surveys of the Wimmera cropping region over a number of years the following aphid vectors of CMV were found: lucerne blue green aphid (Acyrthosiphon kondoi), cowpea aphid (Aphis craccivora), foxglove aphid (Aulacorthum solani), ornate aphid (Myzus ornatus), green peach aphid (Myzus persicae), cabbage aphid (Brevicoryne brassicae), sowthistle green aphid (Hypermyzus lactucae) and sowthistle brown aphid (Uroleocon sonchi) (Freeman and Horsham, 2006; Gildow et al., 2008 and Dheepa and Paranjothi, 2010). Review of Literature - 10 - 1.3- In vitro properties: Park et al. (1990) reported that, thermal inactivation point of CMV was 65°C, dilution end point 10-3 and its longevity in vitro 3-4 days. Fawzy et al. (1992) mentioned that, the thermal inactivation point of CMV was 60-65°C, the dilution end point 10-4-10-5 and the longevity of the strain in vitro was 48-60 hours. Kiranmai et al. (1997) reported that, CMV has longevity in vitro was 3-4 days, the thermal inactivation point was 60-65°C and the dilution end point 10-3-10-5 for the three isolates. Lee et al. (1997) found that, the stability of CMV-FK was 55°C of thermal inactivation point, dilution end point was 10-3 and longevity in vitro was 2-3 days. El-Baz (2004) showed that, thermal inactivation point of CMV was 60°C, dilution end point was 10-4 and longevity in vitro was 4 days. Megahed (2008) showed that, thermal inactivation point of CMV was 70°C, dilution end point was 10-4 and longevity in vitro was 4 days. 1.4- Inclusion bodies: Zambolim et al. (1994) stated that, CMV caused crystalloid inclusions in mesophyll cells of banana leaves. El-Baz (2004), Megahed (2008) and Taha (2010) examined epidermal strips of infected squash and cucumber leaves after 36 and 15 days, respectively after CMV inoculation showed cytoplasmic inclusion bodies in the hair cells. Amorphous inclusion bodies detected in the hair cells since these stained with red color and - 11 - Review of Literature crystalline inclusion bodies observed in hair cells of the epidermal strips of CMV-infected squash and cucumber leaves. 2.2- Serological identification: Barbosa et al. (1998) reported that, indirect ELISA and other serological tests were used for differentiation between CMV isolated from banana plants into severe strains (B-CMV-1 and B-CMV-2) and 1 mild strain (B-CMV-3). Tessitori et al. (2002) stated that, ELISA of infected leaf tissue of Polygala myrtifolia revealed the presence of CMV. El-Baz (2004) used ELISA test for detection CMV isolated from cucumber plants. Sharma et al. (2005) found that, CMV was detected and characterized by bioassay, double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA). El-Afifi et al. (2007) used indirect enzyme linked immunosorbent assay (I-ELISA) for CMV detection in cucumber plants. Cardin and Moury (2007) reported that, positive reactions against CMV in leaves of Echium candicans in France were recorded by double antibody sandwich-ELISA to CMV specific polyclonal antibodies as well as Aramburu et al. (2007) who stated that, DAS-ELISA analysis revealed the presence of Cucumber mosaic virus (CMV) in the infected tomato plants. Megahed (2008) and Sankaran et al. (2010) found that, the dot blot immunoassay (DBIA) is very sensitive to detect CMV in infected cucumber plants using specific polyclonal IgG-CMV. Review of Literature - 12 - Part II Induction of systemic acquired resistance (SAR) by biotic inducers: I- General features of systemic acquired resistance: The phenomenon of SAR against disease in plants following infection has been recorded, but often not been documented as early as the 19th century, the natural phenomenon of resistance in response to pathogen infection or plant immunity was first recognized in 1901 by Ray, when they worked on Botrytis cinerea. The virulence of a sterile strain of B. cinerea could be varied by environmental parameters like heat, cold or cultural conditions. Both researchers then used such attenuated fungal strains to induce SAR in Begonia, either by planting in soil inoculated with the attenuated strains or by injecting inoculums into the plants at many points, (Ray, 1901). Carbone and Kalaljev (1932) confirmed previous studies and showed that acquired resistance also depends on the general fitness of the host. Chester (1933) reviewed 201 studies dealing with "the problem of acquired physiological immunity in plants". Acquired resistance, first described by Gilpatrick and Weintraub (1952) on Dianthus barbatus when the lower leaves were inoculated with Carnation mosaic virus (CarMV), the upper leaves were appeared resistant to the infection. Ross (1961a, 1961b) first investigated the induction of resistance by localizes viruses and demonstrated the presence of a zone around each local lesion on tobacco which was more resistant to a second infection by the same virus. This phenomenon was called local acquired resistance (LAR). Other leaves on the same plant - 13 - Review of Literature also showed resistance to a second infection, which was called systemic acquired resistance (SAR). Other terms that have been used to describe systemic resistance in plants "translocated resistance" Hubert and Helton (1967), "plant immunization" Kuc (1987) and "induced systemic resistance" Hammerschmidt et al. (1982). Hammerschmidt (1999) reported that, the phenomenon of induced or acquired resistance to disease in plants has been studied intensively in recent years. This has led to a better understanding of the signaling pathways involved in the expression of systemic resistance as well as the genetic regulation of induced or acquired resistance. Although the induction of resistance to disease results in the expression of less disease in the plant after challenge with pathogens, how the plant is able to restrict the development of the pathogen is not clearly defined. In this paper, some of the defenses expressed in plants with induced resistance will be discussed in relation to how the induced plants may restrict disease development. Choudhary et al. (2007) mentioned that, plants possess a range of active defense apparatuses that can be actively expressed in response to biotic stresses (pathogens and parasites) of various scales (ranging from microscopic viruses to phytophagous insect). The timing of this defense response is critical and reflects on the difference between coping and succumbing to such biotic challenge of necrotizing pathogens/parasites. If defense mechanisms are triggered by a stimulus prior to infection by a plant pathogen, disease can be reduced. Induced resistance is a state of enhanced defensive capacity developed by a plant when appropriately Review of Literature - 14 - stimulated. Several rhizobacteria trigger the salicylic acid (SA)dependent SAR pathway by producing SA at the root surface whereas other rhizobacteria trigger different signaling pathway independent of SA. The existence of SA-independent ISR pathway has been studied in Arabidopsis thaliana, which is dependent on jasmonic acid (JA) and ethylene signaling. Systemic acquired resistance (SAR) is a form of induced resistance that is activated by pathogens that induce localized necrotic disease lesions or a hypersensitive response. SAR is dependent on salicylic acid signaling and is typically associated with systemic expression of pathogenesis-related protein genes and other putative defenses. Once induced, SAR-expressing plants are primed to respond to subsequent pathogen infection by induction of defenses that are localized at the site of attempted pathogen ingress. Finally, SAR typically does not provide full resistance to disease indicating that the practical application of this form of resistance will require the use of other disease management tools (Hammerschmidt, 2009). Biotic Inducers: Management of viral disease can also be accomplished through the induction of plants natural defenses, e.g., systemic acquired resistance, Ryals et al. (1994). SAR against viral infection has been documented using biological and chemical inducing agents Kessman (1994); Raupach et al. (1996); Murphy et al. (2000); Zehnder et al. (2000); Jetiyanon et al. (2003); Abo El-Nasr et al. (2004); Fakhourin et al. (2004); Galal (2006) and Park et al. (2007). - 15 - Review of Literature A- Plant extracts: The botanicals may induce resistance or they themselves may act as inhibitors of viral replication. Ribosome Inactivating Proteins (RIPs) and glycoproteins may block the replication sites. A mobile inducing signal may be produced in treated leaves after the botanical resistance inducers bind with the host plant surface. This signal produces virus-inhibiting agent in the entire plant system. Certain low molecular weight pathogenesis related proteins might also play a role in the induction of systemic acquired resistance. Thus, biologically active compounds present in plant products act as elicitors and induce resistance in host plants resulting in reduction of disease development (Verma et al., 1998). The major chemical constituents present in Clerodendrum genus were identified as phenolics, flavonoids, terpenes, steroids and oils (Shrivastava and Patel, 2007). A novel single resistance inducing protein (Crip-31) was isolated and purified from the leaves of Clerodendrum inerme, which is a very potent, highly stable, basic in nature, 31 kDa in molecular mass having hydrophobic residues and induces a high degree of localized as well as systemic resistance against three different groups of plant viruses (i.e. CMV, PVY and ToMV), which differ at their genomic organization and having different replication strategies, infection in susceptible host Nicotiana tabacum. Minimum amount of purified preparation sufficient for systemic resistance induction was ~ 25 µgml−1. The systemic inhibitory activity of the Crip-31 provides protection to whole plants within 40–60 min of its application. The Review of Literature - 16 - systemic resistance inducing properties of this protein can be of immense biological importance, as it is similar to ribosome inactivating proteins (RIPs) (Praveen et al., 2001). Clerodendrum inerme contain basic protein which resistant to proteases. Induces systemic resistance reversible by actinomycin D inhibits infectivity of many plant viruses (Verma et al., 1991). Two systemic antiviral resistance-inducing proteins, namely CIP29 and CIP-34, isolated from Clerodendrum inerme leaves, for ribosomeinactivating properties. CIP-29 has a polynucleotide: adenosine glycosidase (ribosome-inactivating protein), that inhibits protein synthesis both in cell-free systems and, at higher concentrations, in cells, and releases adenine from ribosomes, RNA, poly (A) and DNA. As compared with other known RIPs, CIP-29 deadenylates DNA at a high rate, and induces systemic antiviral resistance in susceptible plants (Olivieri et al., 1996). Chemical analysis of clavillia (Mirabilis jalapa) was rich in many active compounds including triterpenes, proteins, flavonoids, alkaloids, and steroids. Purified an antiviral proteins from roots, shoots, leaves, fruits, and seeds of Mirabilis jalapa are employed for different affections. Thus, information about the reproductive pattern of this culture is important for implementing experimental procedures (Leal et al., 2001). MAPs in clavillia as being effective in protecting economically-important crops (such as tobacco, corn, and potatoes) from a large variety of plant viruses (such as tobacco mosaic virus, spotted leaf virus and root rot virus) (Vivanco et al., 1999). - 17 - Review of Literature Mirabilis jalapa (Nyctaginaceae), containing a ribosome inactivating protein (RIP) called Mirabilis antiviral protein (MAP), against infection by potato virus X, potato virus Y, potato leaf roll virus and potato spindle tuber viroid. Root extracts of M. jalapa sprayed on test plants 24 h before virus or viroid inoculation inhibited infection by almost 100%, as corroborated by infectivity assays and the nucleic acid spot hybridization test (Vivanco et al., 1999). They also, isolated mirabilis antiviral protein (MAP) from roots and leaves of Mirabilis jalapa L. which possess repellent properties against aphids and white flies. MAP showed antiviral activity against mechanically transmitted viruses but not against aphid transmitted viruses. MAP was highly effective in inhibiting TSWV at 60% saturation. A minimum concentration of 400µg/ml of MAP was sufficient to inhibit TSWV (Devi et al., 2004). β-farnesene volatiles emitted by the whole plant as well as by detached flowers of Mirabilis jalapa. Most remarkable were findings that assigned the use of β-farnesene as an alarm pheromone for aphids. By taking advantage of the aphid alarm signal, plants are able to repel herbivores as reported for the wild potato Solanum berthaultii (Effmert et al., 2005). Foliar sprays of the Mirabilis jalapa leaf extract caused marked symptom suppression, improved growth and flowering and considerably reduced the virus multiplication rate in tomato treated against tomato yellow mottle (tobacco mosaic virus str.) and tomato yellow mosaic viruses, cucumber against cucumber mosaic and cucumber green mottle viruses, and Phaseolus (Vigna) mungo against Review of Literature - 18 - bean mosaic virus. The aphid and whitefly (Bemisia tabaci) populations were much lower on treated than control plants (Verma and Kumar, 1982). The development of viral resistance towards antiviral agent enhances the need for new effective compounds against viral infections. B- Kombucha fermented tea: The Kombucha "mushroom" is a symbiotic colony of several species of yeast and bacteria that are bound together by a surrounding thin membrane. Although the composition of the Kombucha colony varies, some of the species reportedly found in the mushroom include Saccharomyces ludwigii, Bacterium xylinum, B. gluconicum, B. xylinoides, B. katogenum, Pichia fermentans and Torula sp. Each strain of kombucha may contain some of the following components depending on the source of culture strain: Acetic acid, Butyric acid, Gluconic acid, Lactic acid, Malic acid, Oxalic acid, and Usnic acid. Kombucha also contains vitamin groups B and C, beneficial yeasts and bacteria (Stamets, 1994). Kombucha tea can contain up to 105% alcohol and a variety of other metabolites (e.g, ethyl acetate, acetic acid, and lactate). During incubation, the thin, gelatinous mushroom floats in the tea and duplicates itself by producing a "baby" on top of original mushroom. These offspring are then given to other persons for starting their own cultures. FDA has evaluated the practices of the commercial producers of the kombucha mushroom and has found no pathogenic organisms or hygiene violations (Food and Drug Administration, 1995). When - 19 - Review of Literature prepared as directed, the pH of the tea decreases to 1.8 in 24 hours. Although this level of acidity should prevent the survival of most potentially contaminating organisms, tea drinkers have reported molds growing on the Kombucha (CDC, unpublished data). Kombucha tea is never static. New acids and nutrients are constantly created and combined, into ever-changing–though predictable zymurgy (Chen and Liu, 2000). Kombucha contains many different probiotic cultures along with several organic acids, active enzymes, amino acids, anti-oxidants, and polyphenols. According to Roussin (2003), the typical composition may [not always] include: some microorganisms, i.e. Bacterium gluconicum, B. xylinum, Acetobacter xylinum, A. xylinoides, A. ketogenum, Saccharomycodes ludwigii, S. cerevisiae, S. apiculatus, Schzosaccharomyces pombe, Zygosaccharomyces. Some compounds i.e. Acetic acid, Acetoacetic acid, Benzoic acid, propenyl ester, Benzonitrile, Butanoic acid, Caffeine, Citric acid, Cyanocobalamin, Decanoic acid, Ethyl acetate, Fructose, d-Gluconic acid, Glucose, Hexanoic acid, Itaconic acid, 2-keto-gluconic acid, 5-keto-gluconic acid, 2-keto-3deoxy-gluconic acid, Lactic acid, Niacinamide, Nicotinic acid, Pantothenic acid, Phenethyl Alcohol, Phenol, 4-ethyl, 6-Phospho gluconate, Propionic acid, Octanoic acid, Oxalic acid, Riboflavin, dSaccharic acid (Glucaric acid), Succinic acid and Thiamin plus 40 other acid esters in trace amount. Shehata and Lila (2005) reported that fermented tea beverage has antimicrobial activity against a wide spectrum of organisms including some phytopathogenic fungi (i.e. Fusarium oxysporum, Alternaria solani, Aspergillus niger, Penicillium). Review of Literature - 20 - Antioxidant and antimicrobial activities were achieved after fermenting sugared black tea, green tea or tea manufacture waste with tea fungus (Kombucha) for 12 to 15 days (Jayabalan et al., 2007). Hafez (2008) found that, kombucha filtrate, expensive consumption as a healthful beverage as it is easily and safely produced at home, but scrimpy in the cost, can be useful as commercial applicable alternative antifungal to control table grape bunch rot near-harvesting without need to any chemical or fungicide applications and improving grape quality. Kombucha produced many vitamins, enzymes, organic acids etc., so can be used on organically certified grapes. Kombucha is a natural alternative antifungal which could be used as near-harvest dipping application without need to any chemical or fungicidal applications preand post-harvest especially for exportation grapes. Grapes quality was not negatively affected as result to using a new tested substance. Biochemical and physiological changes in induced plants: There is a number of chemical and physiological changes have been established to be associated with SAR state. These include, cell death and the oxidative burst (Low and Merida, 1996), deposition of callose and lignin (Vance et al., 1980 and Kauss, 1987), the synthesis of phytoalexins (Dixon, 1986) and novel proteins (Gianinazzi et al., 1970; Mahmoud, 2000, 2003; Abo El-Nasr et al., 2004 and Sekine et al., 2006). Many authors reported that, a large number of enzymes have been associated with SAR, including peroxidase, phenyalanine ammonialayase, lipoxygenase, β-1,3-glucanase, - 21 - chitinase, poly Review of Literature phenoloxidase and catalase (Van Loon, 1997; Abo El-Nasr et al., 2004; Silva et al., 2004; Trebbi et al., 2007; Megahed, 2008 and Taha, 2010). The relationship between isozyme composition of host plant and plant resistance or susceptibility to disease has been studied in some phytosystems. Isozyme spectra of malte- dehydrogenase, peroxidase and esterase of 10 flax cultivars were separated by PAGE. Data indicated that, PAGE of isozyme may provide a supplementary assay to greenhouse and field tests to distinguish qualitatively between powdery mildew resistant or susceptible cultivars Ali et al. (2006). Peroxidase and poly phenoloxidase activates were found to be considerably higher in infected tomato leaves than in healthy ones. Viral infection with yellow leaf curl and leaf roll of tomato exhibited higher activity of peroxidase and poly phenoloxidase Disc-PAGE isozyme, (Sherif and El-Habaa, 2000). Van Loan (1985) and Neuenschwander et al. (1996) showed through the analysis of SAR proteins that many of these proteins belong to the class of pathogenesis related (PRs) proteins, which originally identified as a new set of proteins that accumulated in tobacco cultivars that form necrotic lesions following TMV infection and were also termed "b protein". These proteins are classified as SAR proteins, when its presence and activity correlates tightly with maintenance of the resistance state. The systemic acquired induced resistance (SAR) by biotic or abiotic agents had been recognized to play an important role in defense against plant viruses, since this resistance was mainly associated with the introduction of novel Review of Literature - 22 - proteins (Faccioli et al., 1994) in treated plants which was the actual virus inhibitory proteins. These proteins thus induced antiviral state in plants through formation of new synthesized protein and perhaps were activate in signaling the activation of defense mechanism in susceptible hosts and hence had been called systemic resistance inducers (SRIs) and the novel proteins induced resembled ribosomeinactivating proteins (Verma and Varsha, 1995). Chessin et al. (1995) reported that, four types of endogenous antiviral proteins (EAVPs) had been characterized, and some EVAPs had been capable of more than one activity, further complicating the situation. The activities were (1) aggregation (forming a precipitate with virus), (2) Inhibition of virus establishment, (3) induction of a systemic viral resistant state, and (4) inhibition of replication by inactive of protein synthesis (ribosome inactivation). In tobacco, the set of SAR markers consists of at least nine families of genes, which are coordinately induced, in uninfected leaves of inoculated plants. These genes families are now known as SAR genes. Several of SAR gene products have direct antimicrobial proteins (Ward et al., 1991 and Meins et al., 1992). The set of SAR genes that induced differs among plant species. In cucumber, a class-III chitinase was the most highly induced SAR gene, while in tobacco and Arabidopsis, PR-1 were the predominant genes expressed (Cao et al., 1997, 1998). The products of these genes include PR-1, β-1,3-glucanase, class II chitinase, having- like protein, thoumatin-like protein, Acidic and basic forms of class III chitinase, an extracellular β-1,3-glucanase and - 23 - Review of Literature the basic isoform of PR-1 and others. Uknes et al. (1992) mentioned that, in Arabidopsis plants, SAR marker genes are PR-1, PR-2 and PR-5. Whereas, Smith and Hammerschmidt (1988) showed that, SAR in cucumber is correlated with increased peroxidase activity and increase in class III chitinase. In pepper, also chitinase activity was the protective effect when treated with chemical inducers (Low and Merida, 1996). Raskin (1992) reported that, several pathogensis-related proteins (PRs) were commonly associated with systemic resistance. Also, β-1,3-glucanase and chitinase were strongly induced after TNV inoculation or salicylic acid treatment of tobacco and cucumber plants. Avdiushko et al. (1993) stated that, induced resistance of inoculated cucumber plants with Colletotrichum lagenarium, TNV or K2HPO4 increased the activity of peroxidase, chitinase and β-1,3-glucanase. Maurhofer et al. (1994) found that the polyacrilamide gel electrophoresis and enzyme assays showed that the same amount of PR proteins (PR-1 group proteins, β-1,3-glucanase and endochitinases) were induced in the intercellular fluid of leaves of plants grown in the presence of P. fluorescens strain CHAO. The results indicated also that colonization of tobacco roots by strain CHAO reduced TNV leaf necrosis and induced physiological changes in the plant to the same extent as doe's induction of systemic resistance by leaf inoculation with TNV. Kogel et al. (1994) reported that, induced systemic resistance ISR against powdery mildew in barley plants is associated with increase in PR-1, peroxidase and chitinase proteins but not β-1,3 glucanase. Review of Literature - 24 - Mazen (2004) indicated that, faba bean seed treatment or foliar treatment with biotic inducers i.e. P. fluorescens and P. aeruginosa increased greatly the activities of peroxidase after 24-h and polyphenoloxidase after 12-h compared with the untreated control with superiority of P. aeruginosa than P. fluorescens in this respect. On the other hand, the highest increase in β-1,3-glucanase activity was recorded after 24-h in foliar and seed treatments with P. fluorescens compared with P. areuginosa and control. Venkatesan et al. (2010) reported that, Pseudomonas fluorescens (Pf1), plant extract and bioactive compound treatments on induction of peroxidase (PO), polyphenol oxidase (PPO), phenylalanine ammonialyase (PAL) and accumulation of phenolics in black gram to suppress the natural incidence of Mung bean yellow mosaic bigeminivirus (MYMV) was studied. Leaf extracts of Mirabilis jalapa, Datura metel and neem (Azadirachta indica) oil provided reduced incidence of MYMV with increased yield in black gram under field conditions. The bio-compatible products actigard® (acibenzolar-S-methyl), disodium hydrogen phosphate and alum (aluminium potassium sulphate) also suppressed MYMV on black gram and increased yield compared with non-treated plants under field conditions. The mean disease incidence of the two field trial shows that the foliar spray of P. fluorescens and M. jalapa recorded the lowest disease incidence of 39.14 and 41.48% with yields of 718 and 716.5 kg per hectare, respectively. - 25 - Review of Literature II- Detection of systemic acquired resistance: 1. Biological determinations: Acquired resistance is measured by the reduction in diameter of the lesions (and with some viruses, reduction in number). With bean, one primary leaf is inoculated and the opposite primary leaf challenged with an inoculation some days later (Megahed, 2008 and Taha, 2010). A high degree of resistance to TMV developed in a 1 to 2 mm zone surrounding TMV local lesions in Samsun NN tobacco. The zone increased in size and resistance for about 6 days after inoculation. The zones around TMV lesions were not virus-specific, it appeared resistant to inoculation with TNV and several other viruses. Resistance developed not only in uninoculated parts of the inoculated leaf but also in other leaves of the plant, lesions were about one-fifth to one-third the size found in control leaves, (Ross, 1961a). Systemic acquired resistance following a local necrotic reaction was found by Loebenstein (1963) for D. stramonium L. inoculated with TMV and Gompherena globosa L. inoculated with potato virus x (PVX). A significant reduction in the number of lesions as well as in their size was observed in both host- virus combinations when uninfected leaf was challenge- inoculated with the same virus. Leaf extract from resistant Datura tissue reduced the infectivity of TMV more than control material. Disease severity and incidence Tomato mottle virus (ToMoV) disease were reduced in tomato plants under field conditions by seed Review of Literature - 26 - treatment with PGPR (Bacillus amyloliquefaciens 937a, B. subtillus 937b and B. pumilus SE34). The seed and soil drench and soil drench treatments in greenhouse experiments by three PGPR reduced the percentage of CMV symptomatic tomato plants ranged from 32 to 58% compared with 88 to 98% in untreated plants, (Zehnder et al., 2000). 2. Physiological and histogical changes in induced plants: Light microscopy used successfully for plant virus diagnosis (Fraser and Matthews, 1979). Dubey and Bhardwaj (1982) found that, the cortical parenchyma of tomato stem infected with Tobacco mosaic virus are rounded and sometimes appear wider or smaller than normal. ElShamy (1987) showed that, the upper and lower epidermis of infected leaves (bearing mosaic mottling and abnormalities) had several protrusions and multicellular glandular hairs with multicellular head. Eskarous et al. (1991) reported that wall of cortical cells in tomato stem infected with heat resistant strain of Tobacco mosaic virus are wavy in outline. Bansal et al. (1992) reported that changes observed in leaves of summer squash plants infected by CMV induce collapse of the upper epidermal cells in localized areas, abnormally shaped palisade cells with fewer chloroplasts, and spongy parenchyma with smaller air space. Plant with severe mosaic showed disintegration and compaction of mesophyll tissue, with large vesicles and vascular bundles with filiform symptoms, the main changes included undifferentiating of mesophyll resulting in the formation of compact structures lacking air spaces, disintegration and a - 27 - Review of Literature scattered arrangement of vascular bundles, hypertrophy of epidermal cells and scanty chloroplast. El-Dougdoug et al. (1993) stated that young orange leaves (Citrus sinensis L.) of Citrus exocortis viroid (CEVd) infected plants showed less active sieve elements in phloem tissue, phloem radial thickness and secondary phloem fibers were also reduced. Moreover, xylem tissue thickness as well as vessel diameter cut down. The glands reduced also in both number and diameter. As for leaf mesophyll cells the infection lessened palisade layers, these cells showed almost cuboidal shape with fewer chloroplast. El-Shamy et al. (2000) reported that the chloroplasts are great in number in case of infected tomato leaves compared with healthy ones. Sayed et al. (2001) showed that, palisade cells of virus infected tobacco leaves were sometimes small in size rounded or intermingled with other elongated cells. 3- Biochemical analyses: A- The role of endogenous salicylic acid (SA) accumulation in activation of SAR: Dean and Kuc (1986 a & b) found that through grafting and stem girdling experiments with cucumber and tobacco plants, the activation of diseases resistance in parts of plant which remote from the site of infection, implies the translocation of an endogenous signal. A model has been proposed where by endogenous signal is produced at the site of primary infection and is translocated through the phloem to other parts of the plant (Fig. 1). Review of Literature - 28 - Fig (1): Conceptual model for the pathway leading to the establishment of SAR, (Neuenschwander et al., 1996). Malamy et al. (1990) and Metraux et al. (1990) showed that the increase of SA by several hundred folds and the appearance of SA in phloem sap and in upper non infected leaves of cucumber, tobacco and Arabidopsis are correlated with the onset of SAR. Yalpani et al. (1991) and Enydie et al. (1992) reported that in TMV-infected tobacco, the endogenous level of SA in infected as well as in uninfected leaves are sufficient to induce resistance and PR-proteins. Ward et al. (1991); Uknes et al. (1992) and Vernooij et al. (1995) found that, the exogenous application of SA can induce expression of SAR genes. Malamy et al. (1990) showed that, the development of the hypersensitive reaction (HR) and SAR is a compound of a dramatic increase in the level of endogenous SA in the - 29 - Review of Literature inoculated leaves and in the systemically protected tissue, and they reported that SA levels increase systemically following TMV inoculation of Xanthi-nc tobacco that carries the N gene to TMV, but not in a susceptible cultivar (Xanthi-nn). Gaffeny et al. (1993) and Delancy et al. (1994) provided evidence supporting this idea comes from the analysis of transgenic tobacco and Arabidopsis plants that were engineered to over express SA hydroxylase, an enzyme from P. putida involved in the metabolism of naphthalene and catalyzing the conversion of SA to the SAR-inactive catechal. Infected transgenic plants are unable to accumulate large amounts of SA and are unable express SAR. Ryals et al. (1996) mentioned that, as much as 70% (tobacco) and 50% (cucumber) of the increase SA in uninfected tissue of pathogen inoculated plants, results from SA translocation from infected leaves to uninfected leaves. That implies the systemic translocation of SA from the site of infection to the other parts of the plants. SA biosynthesis in plants is not accurately known, but there are many proposed pathways by different workers. The pathway B proposes that SA produced only from Benzoic acid (BA) using benzoic acid 2hydroxylase (BA2H) enzyme (Yalpani et al., 1993). BA may be produced by two pathways (β oxidation and non oxidative), and SA after that, either converted to catechol or conjugated with glucose to produce β-O-D glucosyl salicylic acid (SAG). In pathway A, SA produced either from BA through chain of chemical reactions or directly from trans-cinnamic acid (t-CA) after establishment of a middle component (2-hydroxy cinnamic acid). Review of Literature - 30 - The pathway C is different from the two previous pathways in: first, proposed that SA may produced from coumaric acid, which can convert to phenylalanine (PA) the mean component in the biosythesis of SA; second, proposed that in mycobacteria, SA may produced from chorismic acid. All three previous pathways share in one singe, that SA is produced basically from Cinnamic acid, which resulting from the amino acid PA. Both BA and SA can be conjugated with another components; regulation of SA levels through SA or BA conjugation may be important (Ryals et al., 1996). Conjugation removes SA from the active pool, once SA accumulates; it is rapidly converted to SAG (Yalpani et al., 1993). Conversion of SAG to free SA represents another potential mechanism for increase levels of free SA. The principal form of conjugation is SA-glucose, though other forms are found, including the volatile methyl-salicylate (Enydie et al., 1992; Malamy et al., 1992 and Shulaev et al., 1997). In contrast to methyl-salicylate, SAG forms free SA accumulate only in and around HR lesions formed during the incompatible interaction between plants and viruses, bacteria and fungi (Enydie et al. 1992). Yalpani et al. (1993) suppose that both BA and SA conjugated with glucose are important to regulate SA levels in induced plants. Murphy et al. (1999) mentioned that, resistance genes allow plants to recognize specific pathogens. Recognition results in the activation of a variety of defense responses, including localized programmed cell death (the hypersensitive response), synthesis of pathogenesis-related proteins and induction of systemic acquired resistance. These responses are co- 31 - Review of Literature ordinated by a branching signal transduction pathway. In tobacco, one branch activates virus resistance, and might require the mitochondrial alternative oxidase to operate. Singh et al. (2004) stated that, the plant signal molecule salicylic acid (SA) can induce resistance to a wide range of pathogen types. In the case of viruses, SA can stimulate the inhibition of all three main stages in virus infection: replication, cell-to-cell movement and long-distance movement. Induction of resistance by SA appears to depend, in part, on downstream signaling via the mitochondrion. However, evidence has recently emerged that SA may stimulate a separate downstream pathway, leading to the induction of an additional mechanism of resistance based on RNA interference. In this review our aims are to document these recent advances and to suggest possible future avenues of research on SA-induced resistance to viruses. Huang et al. (2006) used the biosensor to observe apoplastic SA accumulation in Nicotiana tabacum L. cv. Xanthi-nc leaves inoculated with virulent and HR-eliciting strains of the bacterial plant pathogen Pseudomonas syringae, then demonstrated that, the Actinobacter sp. ADP1 biosensor is a useful new tool to non-destructively assay salicylates in situ and to map their spatial distribution in plant tissues against TMV infection. Chaturvedi and Shah (2007) stated that, salicylic acid (SA) plays an important role in plant defense. Its role in plant disease resistance is well documented for dicotyledonous plants, where it is required for basal resistance against pathogens as well as for the inducible defense mechanism, systemic acquired resistance (SAR), Review of Literature - 32 - which confers resistance against a broad-spectrum of pathogens. The activation of SAR is associated with the heightened level of expression of the pathogenesis-related proteins, some of which possess antimicrobial activity. Studies in the model plant Arabidopsis thaliana have provided important insights into the mechanism of SA signaling in plant defense. B- Quantification of total SA: Raskin et al. (1989) measured free endogenous SA in Alium lily using HPLC. One gram of frozen tissue was grounded in methanol, to prepare methanol extract and then, this extract was dried under vacuum. After resuspention of the pellet, SA was extracted using mixture of cyclopentane / ethylacetate / isopropanol (50:50:1). This organic extract was dried under nitrogen and analyzed by HPLC. Yalpani et al. (1993) measured free SA using HPLC column, but the preparation of plant samples was different, for instance, organic extract was also by ethylacetate / cyclopentane / isopropanol, but in different portions (100:99:1). SA content generally was determined by UV absorption and fluorescence after separation on a C 18 reverser-phase HPLC column to measure conjugation SA hydrolysis with β-glucosidase enzyme (Enydie et al., 1992). Or boiling for 30 min. in acidified phosphate buffer (Ukens et al., 1993), must be performs. Deng et al. (2003) found that, salicylic acid (SA) is a signaling compound in plants such as tobacco, cucumber, and tomato which can induce systemic acquired resistance. In the work discussed in this - 33 - Review of Literature paper a simple, rapid, and sensitive method was developed for determination of salicylic acid in plant tissues by gas chromatography–mass spectrometry (GC–MS). SA from tomato leaves extracted with 9:1 (v/v) methanol–chloroform was derivatized by use of bis (trimethylsilyl) trifluoroacetamide (BSTFA) under the optimum reaction conditions (120°C, 60 min). Quantitative analysis by GC–MS was performed in selected ion monitoring (SIM) mode using an internal standard. Procedures for sample preparation and reaction conditions were optimized. Analysis was completed within 2 h. A sensitivity of 10 ng g–1 fresh weight and a relative standard deviation less than 5.0% for SA in tomato leaves were achieved. The method could be used for investigation of SA in plant tissues to monitor fast responses of plant defense. Salem (2004), Megahed (2008) and Taha (2010) measured free and endogenous of SA at once in squash, pepper and cucumber plants. One gram of frozen tissue was grounded in methanol, to prepare methanol extract and then, this extract was dried under vacuum. The dried extracts were then resuspended in 3 ml of distilled water at 80°C and an equal volume of 0.2M sodium acetate buffer, pH 4.5, containing 0.1 mg/ml β-glucosidase, SA was extracted using mixture of cyclopentane/ ethylacetate/ isopropanol (50:50:1). This organic extract was dried under nitrogen and analyzed by using HPLC- fluorescence. Araf (2008) found that, bacterial effect on the level of endogenous SA in plants after 5th and 7th days of bacterization, generally SA level in treated plants was high compared to untreated plants in either after 5th or 7th days after bacterization which indicate to the effect of the strains in Review of Literature - 34 - enhancing the expression of SA genes but the level of SA was higher at 7th day than 5th which confirm that ISR reach to maximum level after 7th days of stimulation either by biotic or a biotic inducer, after 5th days of bacterization SA was high in plants treated with Pseudomonas fluorescence B4 while all the strains were nearly similar in its effect after 7th days of bacterization. C. Enzyme activity: C.1- Peroxidase (POD): Campa (1991) found that, peroxidases have further been divided into anionic and cationic groups according to their electrophoretic mobility. Class III POD (EC 1.11.1.7) have been assigned a many physiological roles in the several primary and secondary metabolic processes like scavenging of peroxidase, participation in lignifications, oxidation of toxic compounds, hormonal signaling, plant defense, indole acetic acid (IAA) metabolism and ethylene biosynthesis. Wojtaszek (1997) reported that, peroxidases play an important role in one of the earliest observable aspects of plant defense strategy. Chittoor et al. (1999) found that, peroxidases are a class of proteins and therefore, may be directly associated with the increased ability of systemically protected tissue to lignify when plants are threatened by microorganisms or physically injured. The treatment also elicited a systemic increase in peroxidase activity and increase of two anionic peroxidases on isoelectric focusing gels which were positively correlated with induced resistance. Peroxidases are also implicated in hypersensitivity response (Bestwick et - 35 - Review of Literature al., 1998), lignin biosynthesis ethylene production and suberization (Quiroga et al., 2000). Leaf extract at four o'clock flower (Mirabilis jalapa) is one agent induced systemic resistance against the attack of red pepper Cucumber Mosaic Virus (CMV). This study investigated the peroxidase activity and salicylic acid content in red pepper-induced ketahananya against CMV by using a leaf extract of M. jalapa. Result analysis Note that the red pepper plant induced resistance CMV attacks by leaf extract of M. jalapa shows low intensity CMV attacks, the low content of virus, an increase in enzyme activity peroxidase 210 times, and salicylic acid content of 1.6 to 5 times compared with no induction (control). There is a closeness of relationship high between the intensity of CMV with peroxidase activity (r = 0.94), the relationship between the intensity of the attacks being CMV with the content salicylic acid (r = 0.46), low closeness of the relationship between content of virus with CMV disease intensity (r = 0.32), salicylic acid with activity peroxidase (r = 0.39), and there is no closeness between the concentration of virus with salicylic acid content (r = 0.05) and viral content with activity peroxidase (r = 0.12) (Hersanti, 2005). C.2- Polyphenol oxidase (PPO): Polyphenol oxidases (PPO, EC 1.14.18.1) are involved in the oxidation of polyphenols into quinones (antimicrobial compounds) and lignification of plant cells during the microbial invasion. Phenol oxidases generally catalyze the oxidation of phenolic compounds to Review of Literature - 36 - quinones using molecular oxygen as an electron acceptor (Sommer et al., 1994). The role of PPO in plants is not yet clear, but it has been proposed that it may be involved in necrosis development around damaged leaf surfaces and in defense mechanisms against insects and plant pathogen attack. Phenolic compounds may function by inhibting bacterial growth or serve as precursors in the formation of physical polyphenolic barriers, limiting pathogen tanslocation. PPO-generated quinones modify plant proteins, decreasing the plants nutritive availability to herbivores or invaders. Polymeric polyphenols seem to be more toxic to potential phytopathogens than are the phenolic monomers (Aydemir, 2004). D- Determination of total amino acids: Eisa et al. (2006) stated that the soluble protein content in the 5th leaf of the squash plants was responded differently against the tested treatments. Ascorbic acid "AsA", CoCl2, KH2PO4, SA, MnSO4 and CaCl2 significantly increased the protein content by more than 18.9, 11.6, 10.5, 8.5, 7.9, and 3.0 fold over control treatment. While Penconazole, OA and BA did not affect the protein content significantly if compared with the control treatment. The highest increase in the protein content was associated, in general, with the middle concentration. As for interaction, AsA induced the highest increase of soluble protein at 10mM, followed by CuSO4 at 10mM, CuSO4 at 20mM, CuSO4 at 5mM, CoCl2 at 10mM arid CoCl2 at 20 mM, respectively. On the contrary, BA and OA (at 5, 10 and 20mM), - 37 - Review of Literature CaCl2 and CoCl2 (at 5mM) and Penconazole (at 25 ppm) did not affect the total soluble protein content when compared with control. E- Determination of carbohydrates: Zahra (1990) found that, reducing, non-reducing and total sugars were higher in diseased roots of highest and lowest susceptible sesame cultivars than in healthy ones. Healthy roots of highest susceptible cultivar had more reducing and total sugars than in the lowest susceptible. While, non-reducing sugars content was more in healthy roots of the lowest susceptible cultivar than the highest susceptible one. F- Determination of total phenols Abd El-Kader (1983) reported that healthy and diseased roots of resistant soybean cultivars contained more phenolic compounds than in susceptible cultivar. Infection with Rhizoctonia solani, S. rolfsii and F. oxysporum increased the phenolic contents of the roots of both cultivars. The amount of increase was greater in the roots of resistant cultivars than the susceptible ones. Pathak et al. (1998) determined the amount of total phenols in charcoal rot (Macrophomina phaseolina) resistant and susceptible cultivars of sunflower. They found that amount of total phenols was the maximum in the immune cultivar and the minimum in the highly susceptible cultivar. Kalim et al. (1999) controlled root-rot of cowpea caused by R. solani and M. phaseolina. Reduction in disease incidence was attributed Review of Literature - 38 - to the increased enzymes activity and with higher amounts of total phenols. Infection also caused an increase in the content of total phenols, reducing sugar but decrease in O-dihydric phenols, flavanols, total soluble sugars, non reducing sugars. Several investigators pointed out of phenolic compounds than the susceptible ones. Meena et al. (2001) investigated the effect of salicylic acid (SA) on the induction of resistance in groundnut against late leaf spot. In salicylic acid (SA) treated leaves, an increase in phenolic content was observed one day after challenge inoculation with Cercospora personatum. Ahmad (2004) revealed that the free, conjugated and total phenols were affected significantly by the tested treatments. All tested treatments increased the free phenol. The highest increase in the free phenols was induced by Topas-00 followed by K2HPO4. As for the total phenols, all tested treatments increased the total phenols. The highest increase in the total phenols was induced by Topas-100 followed by K2HPO4. The conjugated phenols increased by Topas-100 over control. Sudhakar et al. (2007) indicated that, studies were undertaken to evaluate ozone (O3) for induction of resistance against Cucumber mosaic virus in Lycopersicon esculentum cv. PKM1 (tomato) plants. Callus induced from tomato leaf explants on Murashige & Skoog's (MS) medium supplemented with benzyladenine (8.82 µM) were treated with different concentrations of ozone T(1), T(2), T(3) and for control (C), filtered air was supplied. Regeneration of shoots was obtained by culturing ozone treated calli on MS medium containing - 39 - Review of Literature 17.3 µM benzyladenine. The plants regenerated from ozone treated callus are referred to as T(1), T(2) and T(3) plants, which hold remarkably increased soluble phenolic content compared to the control plants. Kavino et al. (2008) found that, Pseudomonas fluorescens strains CHA0 and Pf1 were investigated for their biocontrol efficacy against Banana bunchy top virus (BBTV) in banana (Musa spp.) alone and in combination with chitin under glasshouse and field conditions. Bioformulation of P. fluorescens strain CHA0 with chitin was effective in reducing the banana bunchy top disease (BBTD) incidence in banana under glasshouse and field conditions. In addition to disease control, increased accumulation of oxidative enzymes, peroxidase (PO), polyphenol oxidase (PPO), phenylalanine ammonia lyase (PAL), pathogenesis-related (PR) proteins, chitinase, β-1,3-glucanase and phenolics were observed in CHA0 bioformulation amended with chitintreated plants challenged with BBTV under glasshouse conditions. G- Chlorophyll contents: Investigation with several host-virus combinations had shown a reduction in photosynthesis in infected leaves (Bollard and Mathews, 1966). Omar et al. (1986) found that Soy bean mosaic virus (SBMV), Bean common mosaic virus (BCMV) and Lettuce mosaic virus (LMV) caused a significant reduction in chlorophyll a, b and carotenoid content in soy bean and lettuce leaves respectively. Brakk et al. (1986) also found that chlorophyll content of barley plants reduced Review of Literature - 40 - due to infection with Barley stripe mosaic virus. Galal (1989) found a reduction in the total chlorophyll of Cucurbita pepo plants infected with Cucumber mosaic virus (CMV). Hudgson et al. (1989) found that TMV-infected spinach leaves showed inhibition of photosynthetic electron transport through photosystem II. They proposed that the inhibition of photosynthesis results from the association of viral coat protein with the PS II complex. In this respect Montalbin and Lupatill (1989) found that chloroplasts isolated from tobacco leaves inoculated with TMV from exhibited a strong inhibition of electron transport by 60- 70%. Also ribulose 1, 5 diphosphate carboxylase was decreased by 30-40%. Rajeswari and Rajamannar (1991) found that, Betelvine mosaic virus induced biochemical changes in leaves of piper betle plants resulting in reduction of 56, 66 and 69% in chlorophyll a, b and total chlorophyll, respectively. Chakraboty et al. (1994) reported that, the amounts of chlorophyll were lower in the leaves of cucumber, pumpkin, sponge ground snake gourd and bottle gourd, after infection with viruses causing mosaic in these plants. Nassar (1998) found that by using electron microscope that TMV-infection of tomato leaves appeared chloroplast with cup shape and contained large vesicles and reduction in grana stack height if compared with healthy tomato leaf cells, he also noticed a reduction in chlorophyll a, b and total pigments. Hou et al. (1998) found that quantitative changes of chlorophyll and the characteristics of fluorescence spectra of tobacco leaves infected by TMV had their quantity of chlorophyll decreased. They also added that, extracts of 8 species of plants, extracts of Lithospermum erythrhizon and Rosa chinensis were effective in - 41 - Review of Literature inhibiting TMV multiplication and protecting the chloroplast from TMV infection which resulted in an increase in chlorophyll content and photosynthesis. H- Molecular genetics response to SAR as pathogenesis related proteins: Increase in resistance was correlated with the accumulation of pathogenesis-related (PR) proteins, generally assumed to be markers of the defense response (Ward et al., 1991). Various novel proteins are induced which are collectively referred to as "pathogenesis-related proteins (PRs). These PRs defined as proteins coded by the host plant but induced specifically in pathological or related situations (Antoniw and Pierpoint, 1978 & Van Loon et al., 1994) do not only accumulate locally in the infected leaf. But are also, induced systemically, associated with the development of systemic acquired resistance (SAR) against further infection by fungi, bacteria and viruses. Induction of PRs had been found in many plant species belonging to various families (Van Loon, 1999). The induction of PRproteins in various plant tissues is one of the major biochemical and molecular events when plant are subjected to infections with pathogens such as viroids, viruses, bacteria and fungi (Van Loon, 1997). White and Antoniw (1991) suggest that, induced resistance to viruses based on formation of PR- protein. The relation between PRproteins and resistance to viruses had been confirmed by studying the interspecific hybrid N. glutinosa x N. debnevi, which contain PRproteins and is highly resistant to TMV. Review of Literature - 42 - PR proteins are classified into 14 distinct families and include both basic and acidic isoforms (Van Loon and Van Strien, 1999). PR-proteins constitute a heterogenous group of proteins whose expression has served as a reliable marker for induction of SAR. In tobacco, seven families of PR-proteins are known. Although enzymatic activities could be assigned to some proteins. Their functions during the defense response have remained obscure. In addition to their emergence after pathogen infection. Subsets of PRprotein are also expressed in substantial amounts in healthy plants. The tobacco acidic PR-protein of group 1 (PR.1) for example, accumulate in plants upon transition to flowering (Fraser, 1981). Grüner and Pfitzner (1994) suggesting that, they play role in defense reactions against pathogens as well as during plant development. Araf (2008) reported that, PR-1a mRNA accumulation was examined in a time course experiments during the early stage of root colonization, the expression pattern was investigated by using RT-PCR approach this method which is more sensitive. Allowed the examination of the expression of PR-1a gene through the use specific primers, mRNAs for this gene began to accumulate after 1 day of treatment and reached to high levels at 6th day. This expressed in untreated and treated plants but increased about two fold in treated plants. - 43 - Review of Literature MATERIALS AND METHODS This study was conducted at Plant Pathology Lab. and Greenhouses of Botany Dept., Fac. of Agric., Moshtohor, Banha Univ. and Virology Lab., Microbiology Dept., Fac. of Agric., Ain-Shams Univ. During 2007/08 and 2008/09 growing seasons, some tomato fields at Qalyoubia Governorate were surveyed for viral infections. Through the assessment of disease incidence and severity, Cucumber mosaic cucumovirus (CMV) was the dominant one among the tomato viruses in the surveyed fields. Identification of isolated virus (CMV) was achieved using host range, transmission, stability in sap, inclusion bodies and confirmed via Dot blot immunoassay (DBIA). Obtained results dealing CMV confirmation was completely agreement with the previous confidential recording. Therefore, many experiments were successively to deducing if induction of systemic acquired resistance against CMV was successfully achieved under greenhouse and open field of tomatoes using four biotic inducers or not. Part I 1- Disease incidence and frequency of virus(es): Three hundred and fifty samples of infected tomato plants showing distinct viral symptoms in the form of mosaic, mottling, blisters, crinkle, yellowing, malformation and erecting (Plate, 1) were collected from 5 locations of Qalyoubia Governorate (Banha, Toukh, Qaha, Shebien El-Qanater and El-Qanater El-Khayria). The symptoms were recorded using the following rating scale: 0 = No symptoms, 1 = Materials and Methods - 44 - Vein clearing and mild mosaic, 2 = Severe mosaic, 3 = Crinkle, 4 = Epinasty and Deformation, 5 = Erect, 6 = Rosette, 7 = Stunting and leaf narrow and 8 = Leaves showing Vein necrosis. Disease incidence and severity were calculated using the following formulas according to Yang et al. (1996): Disease incidence (%) = Disease severity (DS%) = Number of infected plants per location × 100 Total number of plants/location Σ (disease grade × number of plants in each grade)x 100 Total number of plants × highest disease grade Plate (1): Different types of natural infection symptoms on tomato leaves showing mosaic, mottling, blisters, crinkle, yellowing, malformation and erecting. - 45 - Materials and Methods The samples were examined serologically by Double Antibody Sandwich-enzyme Linked Immunosorbent Assay (DAS-ELISA) using antisera specific to 5 viruses include: Cucumber mosaic virus (CMV), Tomato mosaic virus (ToMV), Tomato yellow leaf curl virus (TYLCV), Potato Y virus (PVY) and Potato X virus (PVX) according to Clark and Adams (1977) as follow: 200µL of prepared immunoglobulin G (IgG) against CMV at concentration 1µ g/ml were diluted in coating buffer, pH 9.6 and incubated in the microtitre plate at 4°C overnight. The wells were washed three times with washing buffer, pH 7.4 [phosphate buffer saline (PBS) (0.15 M NaCl) containing 0.1% Tween-20 and 0.01 sodium azide]. 200µL of each sample were diluted 1:20 (W/V) in extraction buffer (0.01 M PBS, pH 7.4 containing 0.05% Tween-20, 2% polyvinylpyrrolidine, M.Wt. 40.000) and then incubated at 4°C overnight. The plate was washed three times with washing buffer. 200 µL of IgG alkaline phosphatase conjugate diluted at 1/100 in conjugate buffer, pH 7.0 [PBS, 1% bovine serum albumin (BSA), 0.25% Tween-20] was added to each well and incubated for 3 hr at 37°C. The conjugate was removed and the plate washed three times with washing buffer. 200 µL of freshly prepared substrate (ρ-nitro phenyl phosphate) in substrate buffer (10% diethanol amine, NaN3 0.01%) at concentration 0.75 mg/ml was added to each well. The reaction was read spectrophotometrically at wave length 405 nm after incubation at 37°C for 30-60 min. using ELISA reader (Labsystems Multiskan MS), after the reaction stopped by adding 50 µL of 3 M NaOH. Materials and Methods - 46 - 2- Isolation, propagation and identification of an isolated virus: 2.1- Mechanical transmission: For transmission and host range studies, mechanical inoculations were carried out by extracting tomato, cucumber or Nicotiana tissues infected with CMV in 0.1 M phosphate buffer, pH 7.0 containing 1.0% sodium sulphite (1:2w/v). The infectious sap was applied to healthy tested plants in addition to tomato. Leaves of the inoculated plants were previously dusted with 400 mesh carborandum. For control treatment carborundum dusted leaves were inoculated with phosphate buffer alone. Inoculated plants were maintained in the greenhouse at 25-30ºC and inspected daily for symptom development. The inoculated plants were serologically tested using CMV antiserum (Dheepa and Paranjothi, 2010). 2.2- Host range: Fourteen plant species belonging to 4 families (Chenopodiaceae, Cucurbitaceae, Leguminoseae, and Solanaceae), Table (6) were mechanically inoculated with virus isolate using five plants of each host. Control plants were inoculated with buffer only. The inoculated plants were kept under an insect proof in greenhouse conditions and observed daily for symptoms development. The results were confirmed by Dot blot immunoassay (DBIA) using specific CMV polyclonal antibodies. 2.3- Aphid transmission: Pure identified aphids colonies belong to order. Hemiptera; family, Aphididae; include: Aphis craccivora and Myzus persicae which were kindly provided by Economic Entomology Branch, Plant Protection - 47 - Materials and Methods Dept., Fac. of Agric., Moshtohor, Banha Univ. Individual colony of each was kept in the insect proof and reared on healthy cabbage seedlings (Brassica oleracea L. subsp. oleracea) until fourth instar nymph has appeared. Separately homologous colony of apterus adults of both aphids were collected to evaluate as the isolated virus vectors. Twenty-five of both aphids were starved for 2 hours on filter paper (inside Petridishes), allowed to acquisition feeding for 2 min on CMV infected cucumber, then transferred to 5 healthy tomato seedlings (five aphids per seedling) for inoculation, feeding period of 24 hours. For the control, the same procedure was used, but virus-free aphids where feeding for acquisition on healthy tomato plants. The inoculated seedlings were then sprayed with the insecticide Malathion (0.1%). Symptoms and transmission percentage were recorded at 4 weeks after inoculation. 2.4- In vitro properties: Stability of CMV isolate, [Thermal inactivation point (TIP), Dilution end point (DEP) and Longevity in vitro (LIV)] were performed according to Noordam (1973), using C. amaranticolor as local lesion host to CMV. The fresh infectious crude sap as well as healthy sap one (control) was used to inoculate 5 plants of C. amaranticolor. The inoculated plants were kept under the green house conditions and the numbers of local lesions were recorded. CMV crude sap from infected N. glutinosa leaves was diluted by 0.1 M phosphate buffer, pH 7.2 at the rate of 1:1 (v/v), and then distributed as 0.5 ml in eppendorf tubes. The infected sap was heated Materials and Methods - 48 - for 10 min in controlled water bath at various temperatures (45-75°C intervals 5°C). The eppendorfs were immediately cooled by dipping in tap water. Unheated infectious sap was used as a control. Fresh infectious sap was diluted with distitelled water to prepare a dilution series from 10-1 to 10-7. Undiluted infectious sap was used as a control. The infectious sap was placed in sterilized eppendorf at the rate 0.5 ml/eppendorf and kept at room temperature (25±2°C). The CMV infectious sap was assayed daily for longevity up to 10 days. 2.5- Inclusion bodies Crystalline inclusion bodies (CIB) were examined in the epidermal strips from the lower surface leaves of cucumber plant inoculated mechanically with CMV isolate (15 days after inoculation). The strips were removed using forceps, then mounted in a drop of distilled water on clean glass slide and covered with glass cover, then examined under light microscope, magnification of 400-X. The amorphous inclusion bodies (AIB) were examined in the epidermal strips obtained from leaves of cucumber plant inoculated with CMV isolate (15 days after inoculation). The strips treated first with 5% solution of Triton X-100 for 10 min. The strips were immersed in a stain solution containing 100 mg bromophenol blue and 10 mg mercuric chloride dissolved in 100 ml distilled water for 15 min. the stained strips were transferred to 0.5% acetic acid for 15 min and then washed in tap water for 15 min. Finally, the strips were examined by light microscope, magnification of 400-X. according to Mazia et al. (1953). - 49 - Materials and Methods 2.6- Serological confirmation Dot blots immunoassay (DBIA): Dot blot immunoassay was used for identification of CMV isolate as described by Lin et al. (1990) as follows: Nitrocellulose membranes, 0.45µM pore size, were marked with a lead pencil into squares of 1 x 1 cm. Healthy and infected samples were ground in phosphate buffer, pH 9.5 (1:10, w/v). Five µl clarified in each square for each of healthy and virus infected samples were spotted. The membrane was washed three times with PBS-Tween [phosphate buffer saline (0.15 M NaCl)] at 5 min interval. Then placed in the blocking solution [1% bovine serum albumin (BSA) + 2% nonfat dried milk in PBS-Tween] and incubated for 1hr at room temperature. The membrane was washed three times with PBSTween at 5 min interval. The treated membrane was placed in the virus specific antiserum diluted in PBS 1:500 and then incubated for 1 hr at room temperature with gently shacking. The membrane was washed three times with PBS-Tween at 5 min interval. The goat anti rabbit immunoglobuline-alkaline phosphate conjugate (Sigma A 4503) dilution 1: 1000 in conjugate buffer (PBST + 2% PVP + 0.2 % Ovalbumin) was added to the membrane and incubated for 1 hr at room temperature. The membrane was washed three times with PBS-Tween at 5 min interval. The substrate solution (Nitro Blue Tetrazolium and 5-bromo 4-chloro 3indolyl phosphate) was added and incubated for 5 min at room temperature. After the color appeared, the membrane was rinsed quickly with H2O then air-dried. Materials and Methods - 50 - Part II Induction of systemic acquired resistance 1- Source and preparation of biotic inducers: Fresh shoots of 2 medicinal plant [belonging 2 families] were collected from the botanical garden of Fac. Agric., Banha Univ., and kombucha (kindly provided by Dr. Mohamad A. Hafez) from Plant Pathology Lab., Fac. Agric., Moshtohor, Banha Univ. were chosen depending on previous information’s dealing their systemic resistance inducers as producers for ribosomal inhibitor proteins (RIPs) such as: Clerodendrum inerme L. Gaertn (Kumar et al., 1997), Mirabilis jalapa L. (Leal et al., 2001) and kombucha (Dipti et al., 2003). Stock aqueous crude extraction for each individual tested plant was made by blending 1 kg leaves tissue in 1 liter heated distilled water (65°C), and then filtered through 8 layers of sterilized muslin cloth. The filtrate was collected and stored in the refrigerator until use. Stock aqueous crude extract from kombucha was prepared by fermenting sweetened green tea (100 g sucrose, 10 g Chinese green tea per liter of water) preparations with a symbiotic colony of yeasts and bacteria (starter). After 12 days from incubation at 28°C, mother culture was omitted and extract was kept to self-refermentation for additional 21 days, extract was collected, centrifuged for 10 min. at 1000 rpm to separate any debris, then sterilized using sintered glass (G6) funnel (Betsy and Sonford, 1996). Crude kombucha filtrate was used either as it is (100%) or diluted to 50% with distilled water. - 51 - Materials and Methods 2- Experimental procedures of SAR against viruses: The sterilized seeds of Lycopersicon esculentum cv. Supermarmand VFN (Egyptian Company for Seeds, Oils and Chemicals, 2008) were sowed in clay soil at nursery. After one month, the seedlings were transplanted in clay pots (Ø 25 cm) with 5 seedlings/pot. The pots were divided into two experiments. The first experiment was to determine systemic acquired resistances applied to tomato seedlings at the fourth leaves stage were sprayed (30 ml per plant) by the potential inducers at wet film according Vivanco et al. (1999). Five pots for each of 4 biotic inducer [Mirabilis jalapa, Clerodendrum inerme, mixture of (Mirabilis and Clerodendrum) and kombucha] as well as control plants which sprayed with water, treatments were as follows: 1- Tomato plants sprayed with Mirabilis jalapa extract (Mj). 2- Tomato plants sprayed with Clerodendrum inerme extract (Ci). 3- Tomato plants sprayed with mixture of Mirabilis and Clerodendrum extracts (1:1, v: v); (Mj+Ci). 4- Tomato plants sprayed with kombucha (K). 5- Healthy tomato plants non-inoculated with CMV isolate (healthy control); (H). 6- Tomato plants inoculated with CMV isolate (infected control); (V). Seven days after spraying tomato plants, samples from each previous treatment (for detection acquired resistance), were taken and other plants were rub-inoculated with CMV inoculum (CMV Materials and Methods - 52 - infectious sap 10-1 diluted in phosphate buffer 0.1 M and pH 0.7) by spatula to all treatments. Healthy control plants were inoculated with sterile extraction buffer (PPB) and infected control plants were inoculated with CMV. After 25 days from CMV inoculation, other samples of tomato plants were taken. The second experiment (biocontrol) of tomato plants was carried out by rub-inoculating with CMV inoculum then sprayed by biotic inducers after 15 days of virus inoculation with the same treatments in first experiment. Then samples (for determination of biocontrol) were taken from each treatment after 7 and 25 days of spraying inducers. The tomato plants were immediately rinsed with water and kept under greenhouse conditions and observed daily until symptoms appeared after 25 days. Chenopodium amaranticolor plants were used for qualitative and quantitative assaying. 3- Parameter and methods of SAR detection and biocontrol: 3-1. Biological detection: 3.1.1. Percentage of virus infection: The percentage of virus infection was determined and calculated relative to infected control, 25 days from inoculation with CMV. 3.1.2. Reduction of virus infection (RI): The reduction of virus infection was calculated to all treatments as follows: Reduction of Infection (RI%)= Control - treated x 100 Control - 53 - Materials and Methods 3.1.3. Disease severity: All tomato plants in each treatment were examined weekly for virus symptoms, after 25 days from CMV inoculation. The disease severity was assessed as mentioned before. 3.1.4. Anatomical studies It was intended to carry out a comparative anatomical study on leaves of treated plants and those of the control at 22 days (preinoculated and sprayed with inducers) and 40 days (post-inoculated and sprayed with inducers) after transplanting. Groups of each treatment were sprayed with distilled water served as control. Small pieces were taken from the midrib region of the 4th upper apical leaf on the main stem, then killed and fixed in FAA (10 ml formalin, 5 ml glacial acetic acid and 85 ml ethyl alcohol 70%), washed in 50% ethyl alcohol, dehydrated in a series of ethyl alcohols (70, 90, 95 and 100%), infiltrated in xylene embedded in paraffin wax with a melting point 60-63°C. Sections were made at 15-17 µm thick using rotary microtome, mounted on glass slides and stained with aqueous Safranin O (1%) and Fast Green (0.1% in 95% ethanol), as described by Ruzin (1999). Four sections treatment were microscopically inspected to detect histological manifestations of noticeable responses resulted from treatments. Counts and measurements (µ) were taken using a micrometer eye piece. Averages of readings from 4 slides/treatment were calculated. Number of epidermal hairs was count in 720 µ in middle of the epidermis. Sections were examined with SEIWA OPTICAL light microscope (using a 10x lens) and photographed by Genius P931 digital camera using Image Manager 50 program. Various measurements were performed on microscopic images. Materials and Methods - 54 - 3-2. Biochemical analyses: A- Quantification of total salicylic acid (SA): Free and endogenous of SA were measured at once in the treatments by a method according to Raskin et al. (1989), with one modification by Salem (2004). One gram of frozen tissue was ground in 3 ml of 90% methanol and centrifuged at 6000 rpm for 15 min. The pellet was back extracted with 3 ml of 99.5% methanol and centrifuged as above. Methanol extracts were combined and then centrifuged at 1500 to 2000 rpm for 10 min. the supernatant was dried at 40°C under vacuum using rotary evaporator (Heidolph.). The dried extracts were then resuspended in 3 ml of distilled water at 80°C and an equal volume of 0.2 M sodium acetate buffer, pH 4.5, containing 0.1 mg/ml β-glucosidase (22 unit/mg, Sigma) was added, and then the mixtures were incubated at 37°C overnight. After digestion, mixtures were acidified to pH 1 to 1.5 with HCl. SA was extracted by adding (1:2, v: v) of sample: cyclopentan/ethylacetate/isopropanol (50:50:1). The organic extract was dried under nitrogen and analyzed by HPLC [SHIMADZO RF-10 AXL Fluorescence, HPLC Lab., National Research Center (NRC)]. One hundred microliters of each sample were injected into Dynamax 60A8 µm guard column (46mm x 1.5cm) linked to 40°C. SA was separated with 23% v/v methanol in 20 mM sodium acetate buffer, pH 5.0 at a flow rate of 1.5 ml min-1. SA level was determined using standard curve. - 55 - Materials and Methods B- Detection of antiviral proteins B.1- Extraction of total proteins: Tomato leaves were collected from plants treated with biotic inducers pre and post CMV inoculation. Proteins were extracted according to Lanna et al. (1996). One gram fresh weight was ground in a mortar and pestle containing liquid nitrogen. The resulting powder was macerated for 30 sec in 3 ml extraction buffer [50 mM sodium phosphate buffer, pH 6.5, 1mM phenylmethylsulfonyl (PMSF)], then centrifuged at 20.000 rpm for 25 min. at 4°C. The supernatant was divided and kept in ice for the following determination. B.1.1- Determination of protein content: Principle: The protein determination is based on the observation that coomassie brilliant blue G-250 exists in two different colour forms, red and blue. The red form is converted to the blue form upon binding of the dye to protein. The protein-dye complex has a high extinction coefficient thus leading to great sensitivity in measurement of the protein. The binding of the dye to protein causes a shift in the absorption maximum of the dye form 465 to 595 nm and the increase in the absorption at 595 nm in monitored. It is very rapid process (approximately 2 min), and the protein-dye complex remain dispersed in solution for a relatively long time (approximately 1 hr), (Bradford, 1976). Materials and Methods - 56 - Preparation of the protein assay reagent: One hundred mg of coomassie brilliant blue (CBB) G-250 were dissolved in 50 ml of 95% ethanol. One hundred ml of 85% (w/v) orthophosphoric acid was added and the final volume was adjusted to 1 L. The dye solution was filtered and kept for 2 weeks in dark at 20°C before use. Procedure: Five hundred µl of protein assay reagent added to 500 µl of distilled water containing the protein sample. After mixing, the absorbance was recorded at 595 nm within one hr against a blank control in 1 cm light path cuvette using Shimadzu UV-2401 PC UV-Vis recording spectrophotometer (Molecular Biology Lab. NRC). A standard curve was constructed by using BSA as standard protein (Fig. 2). 12 Absorbance at 595 nm 10 8 6 4 2 0 0 5 10 15 Protein concentration (µg/ml) Fig. (2): Standard curve of the protein concentration using bovine serum albumin as a standard protein. - 57 - Materials and Methods B.1.2- Qualitative assaying of protein: 1- Sodium dodecyl sulfate poly acrylamide gel electrophoresis (SDS-PAGE): Principle: The strongly an ionic detergent SDS is used in combination with a reducing agent (sulfhydryl compound) and heat to dissociate the proteins before they are loaded on the gel. The denatured polypeptides bind SDS become negatively charged. Since the amount of SDS bound is almost always proportional to the molecular weight of the polypeptide and is independent of its sequence, SDS-polypeptide complexes migrate through poly acrylamide gels in accordance with the size of the polypeptide. At saturation, approximately 1.4 g of SDS is bound per 1g of polypeptide (Laemmli, 1970). Procedure: 1) Gel casting: Twelve percent acrylamide solution was made up for separating gel as shown in Table (1) and casted in two vertical slabs (9x10x0.1 cm in size). The solution was carefully overlaid with isobutanol saturated with water to avoid inhibition of polymerization by oxygen diffusion and to perform a flat surface. After the polymerization of the separating gel, the saturated isobutanol was substituted with the stacking gel (5%) (Table 1), then the appropriate comb was inserted and the gel was left to be polymerized. Materials and Methods - 58 - 2) Sample Preparation: The protein samples were denatured by heating them at 95°C for 5 min with an equal volume of the sample buffer to dissociate the proteins to theirs subunits. 3) Electrophoresis: After mounting the gel in the electrophoresis apparatus, the reservoir buffer was added to the top and bottom of the gel and the samples were loaded into the gel wells submarine. Electrophoresis was performed at 150 volt per two gels till the marker dye bromophenol blue (BPB) reach the end of the gels. 4) Staining and destaining: The gels were stained for 2 hrs in 0.1% (w/v) coomassie brilliant blue R-250 in 40% methanol and 10% glacial acetic acid solution. The destaining was carried out by several washes in the same solution lacking dye. Table (1): Preparation of SDS-PAGE gels. Stock solution Separating gel 12% Stacking gel 5% 30% acrylamide 6.0 ml (12%) 1.66 ml (5%) 2% bisacrylamide 2.4 ml (0.32%) 0.65 ml (0.13%) 2.25 M Tris-HCl, pH 8.9 1M Tris-HCl, pH 6.8 H2O 2.5 ml (0.375M) ………………….. ………………… 3.97 ml 1.25 ml (0.125M) 6.335 ml 20% SDS 0.075 ml (0.1%) 0.05 ml (0.1%) 10% APS 0.05 ml (0.033%) 0.05 ml (0.05%) TEMED 0.005 ml 0.005 ml Total volume 15.0 ml 10.0 ml - 59 - Materials and Methods 2- Native polyacrylamide gel electrophoresis (PAGE): Native polyacrylamide gel electrophoresis was used for isozyme determination. Principle: Polyacrylamide gels are composed of chains of polymerized acrylamide that are cross-linked by a bifunctional agents such as N,Ńmethylene bisacrylamide. The native gel electrophoresis separates proteins based on their size and charge properties. While the acrylamide pore size serves to sieve molecules of different sizes, proteins which are more highly charged at the pH of the separating gel have a greater mobility (Smith, 1969). Procedure: 1- Gel casting: Twenty ml of 7% polyacrylamide gel was prepared by mixing two volumes of acrylamide monomer solution, one volume of gel buffer solution, one volume distilled water and four volumes of freshly prepared ammonium persulfate solution, deaerated rapidly and casted in two vertical slabs (10×10×0.1 cm in size). The appropriate comb was inserted and the gel was left to be polymerized. 2- Sample preparation: The samples were prepared by mixing each sample with an equal volume of the sample buffer. Materials and Methods - 60 - 3- Electrophoresis: After mounting the gel in the electrophoresis apparatus, the reservoir buffer was added to the top and bottom of the gel and the sample were loaded into the gel wells submarine. Electrophoresis was performed at 150 volt per two gels till the marker dye BPB reach the end of the gels. The gels were analyzed using Alpha EaseFC 4.0 software. C- Determination of Peroxidase (POD): A- Activity: Peroxidase activity is routinely assayed by measuring the oxidation in the presence of hydrogen peroxide and the enzyme every 30 sec intervals using UV- 2401 PC UV- Vis recording spectrophotometer (Central lab., fac. of Agri., Banha Univ.) in a 4 ml light path cuvettes. The reaction mixture (unless other wise stated) contained in a volume of 3 ml : 8 µmoles hydrogen peroxidase, 60 µmoles guaiacol, 60 µmoles sodium acetate buffer. pH 5.6 and peroxidase at concentrations which gave a linear response over a period of 3 min. The reaction is initiated by introducing the enzyme and mixing, a unit of peroxidase activity is defined as that amount of enzyme which cause one optical density (OD) change per minute (Ghazi, 1976). B- Peroxidase activity staining: Peroxidase activity staining was performed in 7% native polyacrylamide gel electrophoresis by the method of Ataya (1995). The gel was immersed in freshly prepared solution contained 266 µ moles hydrogen peroxide and 2000 µ moles guaiacol in 100 ml of 0.05 M sodium acetate buffer, pH 5.6. The enzymatic reaction was - 61 - Materials and Methods blocked after appearance of the isozyme bands by 7% acetic acid. The gel was photographed and then analyzed by gel documentation software (Alpha Ease FC 4.0 software). D- Determination of polyphenol oxidase (PPO): A- Activity: Polyphenol oxidase activity was determined by measuring the initial rate of quinine formation, as indicated by an increase in absorbance at 420 nm, (Coseteng and Lee, 1978) using - 2401 PC UV- Vis recording spectrophotometer (Central Lab., Fac. of Agri., Banha Univ.). One unite of enzyme activity was defined as the amount of enzyme that caused a change in absorbance of 0.001/min, PPO activity was assayed in triplicate measurements. The sample cuvette contained 2.95 ml of 20 nM catechol solution in 0.1 M phosphate buffer. pH 6.0 and 0.05 ml of the enzyme solution. The blank sample contained only 3 ml of substrate solution. B- Polyphenol oxidase activity staining: The Polyphenol oxidase activity staining was performed according the method by Aydemir (2004) in 7% native polyacryamide gel electrophoresis for separating PPO isozymes. The gel was stained for PPO activity by 2.5 mM (L-dihydroxy phenylalanine) L-dopa in phosphate buffer pH 8.0. After 1 h of incubation of the gels, isozyme bands were developed. The gels were shaken in 1 mM ascorbic acid solution for 5 min and stored in 30% ethanol and then their photographs were taken and analyzed by gel documentation software (Alpha Ease FC 4.0 software). Materials and Methods - 62 - E- Determination of photosynthetic pigments: Chlorophyll a, b and carotenoids were extracted and estimated according to Wettstein (1957). As the following procedure: Fresh leaf samples (0.5g) were homogenized in a mortar with 85% acetone in the presence of washed dried sand and a little amount of CaCO3 (0.1g) in order to neutralize organic acids in the homogenate of the fresh leaf. The homogenate was then filtered through sintered glass funnel. The residue was washed several times with acetone until the filtrate became colorless. The optical density of this extract was determined using a spectrophotometer at 662, 644 nm for Chl. a and b respectively and 440 nm for carotenoids. Calculation: Chlorophyll a = 9.784 × E 662 - 0.99 × E 644 mg/L. Chlorophyll b = 21.426 × E 664 – 4.65 × E 644 mg/L. Carotenoid = 4.965 × E 440 – 0.268 × c (a+b) mg/L. Where: c (a+b) is the sum. of chlorophyll a and b concentration in mg/L. The results were calculated as mg/g fresh weight. F- Determination of total phenols: Five grams of the leaf samples were immediately placed in 50 ml of 95% ethanol in brown bottles and kept in darkness at room temperature for one month then homogenized in sterile mortar. The resultant homogenate was filtered through filter paper. The residue was thoroughly washed with 80% ethanol. The ethanolic extracts were dried at room temperature until near dryness and then were quantitatively transferred to 10 ml with 50% isopropanol and stored in - 63 - Materials and Methods vials at 5°C. The obtained ethanolic extracts were used for phenol determination. Phenolic compounds were determined using colorimetric method described by Snell and Snell (1953). The free phenols were determined by adding 1.0 ml of Folin reagent and 3.0 ml of sodium carbonate solution (20%) to 0.025 ml of isopropanol sample. The mixture was diluted to 10 ml with warm distilled water 30-35°C. The mixture was let to stand for 20 minutes and then was read at 520 nm using spectrophotometer model (Beckman-Du 7400). However, the total phenols (free and conjugate) were determined by adding ten drops of concentrated hydrochloric acid to 0.025 isopropanol sample, heated rapidly to boiling over a free flame, with provision for condensation, and then placed in a boiling water bath for 10 min. after cooling 1.0 ml of Folin reagent was added and also, 2.5 ml of sodium carbonate (20%). The mixture was diluted to 10 ml with distilled water, after 20 minutes was determined at 520 nm on the same former apparatus. The conjugate phenols were determined subtracting the free phenols from total phenols. The phenolic contents were calculated as milligrams of catichol (from standard curve) per one gram fresh weight. G- Determination of total amino acids: Total free amino acids in the ethanolic extract were determined according to the method of Rosin (1957) in which, the following four reagents (solutions) were used: Solution A: sodium cyanide 0.01 M (0.49 mg/ml). Solution B: acetate buffer (pH 5.3- 5.4) prepared by dissolving 270 g sodium Materials and Methods - 64 - acetate in distilled water and made up to 750 ml distilled water. Solution C: acetate cyanide: 0.0002 M sodium cyanide (20 ml of stock solution A) and made up to one 1000 ml with acetate buffer (solution B). Solution D: Ninhydrin 3% in acetone. A known volume (0.2 ml) ethanolic extract + 0.5 ml of solution C + 0.5 ml of solution D (Ninhydrin) were mixed thoroughly and heated in boiling water bath for 10 min. After cooling under running water, 5 ml of isopropyl alcohol: water (1:1 v/v) was added and the developed color was measured using spectrophotometer (Spectronic601) at 570 nm. Free amino acids in different samples were calculated as milligram per gram fresh weight sample. H- Determination of total carbohydrates: Total carbohydrates was determined in dry matter of tomato leaves by using phenol-sulphuric acid method described by Dubois et al. (1956) and calculated as mg/g dry weight. Ethanol extraction: Five grams of powdered leaves oven dried sample were extracted by boiling in 70% neutral ethanol for 4 hrs. under reflux condenser (Kawamura et al., 1966). The extract was filtered and the ethanol was removed by vacuum distillation. The residue was clarified with neutral lead acetate and the excess of lead salt was precipitated with potassium oxalate solution. The last solution filtered, completed to a known volume and subjected to determination of total soluble carbohydrates (Tanaka et - 65 - Materials and Methods al., 1975). The total carbohydrates were determined colorimetrically according to the method of Dubois et al. (1956) as follows: An aliquot of 1 ml of the solution was quantitatively transferred into a test tube and treated with 1 ml 5% aqueous phenol solution followed by 5 ml concentrated analar sulfuric acid. The blank experiment was carried out using 1 ml of distilled water instead of the solution. The absorbance of the yellow-orange colour was measured at 490 nm using spectrophotometer model 390. A standard curve was prepared using known concentrations of glucose where as the determination as glucose (Fig.3). 120 100 80 60 40 20 0 0 5 10 15 Fig. (3): Standard curve of glucose for determination total carbohydrate. I- RNA determination: This was carried out according to the method described by Schneider (1957). It depends on a calorimetric of the ribose sugar using orcinol reaction. 1 ml extract was mixed in a test tube with 1 ml (0.1 g FeCl3 in 100 ml 37% HCl) and 5 mg orcin. The mixture was heated in a water bath for 15 minutes, cooled and volume was Materials and Methods - 66 - adjusted to 4 ml with the buffer used in extraction. The optical density was measured at weave length of 670 nm using U.V-2100 spectrophotometer Unico. The RNA amount was calculated from a standard curve (Fig. 4) which was constructed using highly polymerized RNA-sodium salt dissolved in 5% perchloric acid (1 mg/1 ml) at 80°C for 20 minutes. Fig. (4): Standard curve of total RNA. 3- Molecular detection of pathogenesis related protein genes: Materials: Chemicals, enzymes, molecular weight markers and PCR reagents were obtained from Sigma Chemical (St. Louis, MO, USA) Roche (Boehringer Mannheim), Promega (Woods Hollow road, Madison, WI, USA), FMC Bioproducts (Thomaston St., Rockland, ME, USA), Millipore Intertech (Bedford, MA, USA), Qiagene (GmbH, Germany) and startagene Inc. (North Torrey Pines Road, La Jolla, CA, USA). - 67 - Materials and Methods 1- Selected oligonucleotide primers: The oligoneucleotide primers using on PCR reaction were synthesized for pathogenesis related protein genes (PR-1a) in operon (Qiagene Co.), according to Van Loon and Van Strien (1999). Reverse primer sequence was (3'-GCTCGTAGACAAGTTGGAGTC-5') while forward primer was (5'-ACCCACATCTTCACAGCAC-3'). 2- RT-PCR amplification A- cDNA synthesis: Ten µl of total RNA were added to reaction mixture containing 6 µl of 5x first strand buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl and 15 mM MgCl2), 3 µl of 0.1 M dithiothreitol (DTT), 1µg of complementary specific primer PR-1a and sterile H2O to a final volume of 30 µl. The annealing reaction was denatured by heating at 65°C for 5 min and primer annealing at room temperature for 30-45 min. The annealed reaction was added to 20 µl of a cDNA reaction mixture containing: 4 µl of 5x first strand buffer, 2 µl of 0.1 M DTT, 1 µl of RNAsin (40 units, promega corp., Madison, US), 5 µl of 0.3 M β-mercaptoethanol, 2.5 µl of 10 mM dNTPS and 1 µl of moloney murine leukemia virus (MMLV) (200 U/ µl) reverse transcriptase (Promega, Corp.). Reaction was mixed briefly and incubated for 1- 1.5 hr at 42°C. B- Amplification of PR-1 coding sequence: Amplification was performed by an initial denaturation step at 95°C for 5 min according to Nie and Singh (2001) in thin-walled PCR tubes contained the following reaction mixture: Five µl of 10x PCR buffer (160 mM (NH4)2 SO4, 670 mM Tris-HCl pH 8.8, 0.1% Materials and Methods - 68 - Tween-20, 25 mM MgCl2), 1 µl of 10 mM dNTPs, 1 µl each of primer Pr-1F and PR-1R and 2.5 units of Taq DNA polymerase, then nuclease-free water was added to up the volume to 45 µl. Five µl from the total DNA was added to PCR mixture and amplified with the following cycling parameters (denaturation at 94°C for 30 sec). Primer annealing at 55°C for 30 sec and extension at 72°C for 30 sec) for 30 cycles, with a final extension at 72°C for 5 min and cooling to 4°C. 3- Electrophoresis analysis of PCR product: PCR amplified DNA products were separated by agarose gel electrophoresis. Aliquots of 10 µl of PCR products were analyzed on 2.5% agarose gel in TBE buffer (1x = 89 mM Tris HCl, 89 mM borate and 2.0 mM EDTA pH 8.3) at 100 volt for 1h. The gel was stained with ethidium bromide at a concentration of 0.5 ml/ml. DNA molecular weight marker (100, 200, 300, 400, 500, 600 , 700, 800, 900, 1000 bp) 1kb DNA marker was used to determine the size of PCR amplified cDNA products of PR – mRNA. Bands of DNA were visualized on a UV transilluminator and photographed using gel documentation system [BIO-Doc Analyze (Biometra)]. 4- Sequencing of pathogenesis related protein gene (PR-1a gene): 4.1- Purification of DNA fragments from agarose gel: DNA fragments were purified from agarose gel using the gel slicing and melting methods described by (Wieslander, 1979). The Qiagene kit (California, USA) provided rapid and efficient recovery of DNA (80 %). It is used for recovery and purification of DNA from - 69 - Materials and Methods ethidium bromide-stained agarose. The desired DNA bands were excised from the gel using the clean razor blade and put on an eppendorf tube. 500 µl of the Qiagene buffer was added to 300 mg of gel fragment and vortexed for 2 min and then incubated at 50°C for 10 min. The sample was pipetted in the upper reservoir of the filter tube and 500 µl of isopropanol was added to the dissolved gel slice and centrifuged for 1 min. The flow through was discarded and the filter tube was reassembled. Add 300 µl of Qiagene buffer (to dissolve minute gel thin piece) to upper reservoir of the filter tube and centrifuged for 2 min at 14,000 rpm. Discard the flow through and again reassemble the filter tube and the used collection tube. Then 500 µl wash buffer PE and 250 µl of 70% ethanol was added to the upper reservoir and centrifuge 2 min at 14,000 xg, discard the flow through. The column was carefully removed and placed in 55°C for 2 min to evaporate residual ethanol. The filter tube and new collection tube were again reassembled 30 µl warm free nuclease water was added to the upper reservoir and incubate at room temperature for 10 min then was centrifuged for 1 min at 12,000 rpm. The flow through was kept and called first elution. To confirm the presence of DNA fragment in the eluted DNA, 2 µl of first elution was mixed with 2 µl of dye and loaded in agarose gel compared to DNA marker. The first and second elutions combined in eppendorf tube and add 1/10th volume 7.5 mM ammonium acetate, 2.5 volume 70% ethanol was added, then incubated at -80°C for 10 min. centrifuged for 20 min at 14,000 rpm, the supernatant was discarded. 500 µl of 70% ethanol was added to pellet, centrifuged for 5 min at 14,000 rpm and the pellet was Materials and Methods - 70 - resuspended in 10 µl of nuclease free water. The nucleotide sequence of PR-1a gene was obtained using DNAMAN program. 4.2- Sequencing and computer analysis: Partial nucleotide sequencing of PCR product of PR-1a gene that amplified with the primers was commercially carried out at Macrogen 3730XL611518-009, Korea by ABI 1.6.0 sequencer. The sequence data multiple alignment and phytogenetic relationship were translated and analyzed by DNAMAN program (DNAMAN V 5.2.9 package, Madison, Wisconsin, USA). The nucleotides and amino acids sequences of PR-1a gene were compared with other accessions of PR available in NCBI database using BLAST algorithm to identify closely related sequences (http://www.ncbi.nlm.nih.gov). Sequence accessions used for comparison were provided in Tables (2, 3). Table (2): Pathogenesis related protein (PR-1a gene) of different crops in Gen-Bank. No. Crops 1 2 3 4 5 6 7 Solanum lycopersicon Solanum torvum Capsicum annuum Solanum melongena Cucumis melo Cucumis sativus Solanum lycopersicon - 71 - Materials and Methods Table (3): Eleven Pathogenesis related protein (PR-1a gene) amino acids of different hosts published in Gen-Bank. No. Crops 1 2 3 4 5 6 7 8 9 10 11 Solanum lycopersicon Capsicum annuum Solanum melongena Solanum torvum Vitis pseudoreticulata Cucumis sativus Musa acuminata Betula pendula Brassica napus Eutrema wasabi Linum usitatissimum Materials and Methods - 72 - EXPERIMENTAL RESULTS Part I 1- Disease incidence and frequency of virus: The collected samples of naturally infected tomato plants from different locations at Qalyoubia Governorate showing mosaic, mottle, blisters, crinkle, net yellow and malformation were detected by DASELISA using antisera specific to 5 viruses include: Cucumber mosaic Cucumovirus (CMV), Tomato mosaic Tobamovirus, Tomato yellow leaf curl Begomovirus, Potato Y Potyvirus and Potato X Potexvirus. The ELISA reactions of tomato collected samples at Qalyoubia Governorate were recorded in Table (4). The data reveal that, CMV was the most frequently in samples and showed severe symptoms on tomato; therefore this study aims to induce systemic acquired resistance against CMV. Table (4): Detection of viruses naturally infected tomato plants. Antibodies (Abs) Samples Banha Toukh Qaha Shebien El-Qanater El-Qanater El-Khayria CMV ToMV PVY PVX TYLCV + + + + + + -+ + -- ---+ -- -+ --+ + + --+ + : Positive ELISA reaction -- : Negative ELISA reaction Disease incidence and disease severity of virus infection in tomato surveyed locations were recorded in Table (5) and Fig. (5). The obtained data revealed that, the high level of disease incidence - 73 - Experimental Results and severity (96.0 and 33.75%, respectively) was in Qaha followed by Toukh (94.67 and 20.83%) and Banha gave (94.44 and 27.78%), while the low disease incidence and disease severity were in Shebien El-Qanater (83.08 and 21.92%) and El-Qanater El-Khayria (81.43 and 21.79%), respectively. Table (5): The disease incidence and severity of naturally viral infected tomato plants in different 5 locations (Qalyoubia Governorate). Locations Disease incidence (%) Disease severity (%) Banha 94.44 27.78 Toukh 94.67 20.83 Qaha 96.00 33.75 Shebien El-Qanater 83.08 21.92 El-Qanater El-Khayria 81.43 21.79 Percentage (%) 100 Banha Toukh Qaha Shebien El-Qanater El-Qanater El-Khayria 80 60 40 20 0 Disease incidence Disease severity Fig. (5): Disease incidence and severity of natural viruses affecting tomato at 5 different locations in Qalyoubia Governorate. Experimental Results - 74 - 2- Confirmation of Cucumber mosaic virus (CMV): 1. Host range: Fourteen plant species belonging to four families were mechanically inoculated with tested CMV isolate (Table 6). The reactions of the plants were summarized in three groups; first group, local symptoms; Chenopodium amaranticolor, C. quinoa and C. murale produced chlorotic local lesions. While Datura metel produced necrotic local lesions on inoculated leaves after 7 days post inoculation (Plate, 2) and second group systemic symptoms were produced on Nicotiana glutinosa appeared severe mosaic, filiform leaf and malformation; N. clevelendii and N. tabaccum cv. Samsun showing severe mosaic and blisters, tomato plants showing vein clearing, mosaic, vein necrosis, blisters and cucumber plants showing severe mosaic (Plate, 3). The third group was Vigna unguiculata and Vicia faba showed no symptoms. - 75 - Experimental Results Table (6): The reactions of plant host species and cultivars inoculated with CMV isolate. Families Host plant Common name C. quinoa Wild. Quinoa Chenopodiaceae C. amaranticolor Coste Lamb's-quarter & Ryn Nettle-leaved C. murale Goosefoot. Cucumber Cucumis sativus L. Cucurbitaceae Cucurbita pepo L. Squash Leguminosae Solanaceae Phaseolus vulgaris L. Vigna unguiculata L. Vicia faba L. Pisum sativum L. Datura metel L. L. esculentum N. clevelandii N. tabacum L., cvs. Samsun N. glutinosa Kidney bean Cowpea Broad bean Pea Thorn apple Tomato Tobacco Symptoms DBIA CLL CLL ++ ++ CLL ++ SM SM +++ +++ M NS NS SM NLL SM, Vc, Mf M ++ --+++ ++ ++++ +++ M SM, Mf +++ +++ CLL = Chlorotic local lesion, NLL = Necrotic local lesion, M = Mosaic, SM = Severe mosaic, Mf = Malformation, VC = Vein clearing, NS = No symptoms. Experimental Results - 76 - Plate (2): Plant leaves inoculated with CMV isolate showing local symptoms on Chenopodium murale (A), C. quinoa (B), C. amaranticolor (C) and Datura metel (D). Plate (3): Host plants mechanically inoculated with CMV isolate showing mosaic, mottle, blisters, crinkle, net yellow and malformation on Tomato (1,2); blisters, crinkle (3); vein-clearing, net yellow, mottling, and malformation (4,5) on leaves of: (1), (2) L. esculentum (3) N. clevelendii (4), (5) Cucumis sativus - 77 - Experimental Results 2. Transmission of CMV: A- Mechanical transmission: The virus isolated was mechanically transmitted easily to healthy tomato plants and differential host plants where as inoculated with infectious crude tomato sap (Plate 2, 3). B- Aphid transmission: The virus isolate was transmitted in a non-persistent manner by both Myzus persicae and Aphis craccivora from infected cucumber cultivar source plants to healthy tomato ones. 3. In vitro properties: The results in Table (7) indicate that, the stability of CMV isolate in infectious crude sap extracted from infected N. glutinosa. It was determined by local lesions on leaves of C. amaranticolor as an indicator host as follows: 1) Thermal inactivation point (TIP): The infectious crude saps were treated with temperature at 45°C to 75°C intervals of 5°C for 10 min. in controlled water bath. The obtained results showed that CMV was inactivated at 70°C for 10 min in vitro. 2) Dilution end point (DEP): Several dilutions up to 10-7 were prepared from CMV infectious sap and results showed that, the infectivity was lost at dilution 10-4. 3) Longevity in vitro (LIV): The effect of storing the infectious sap for 10 days at room temperature (25±3°C) on the infectivity of CMV was determined. The obtained data indicated that, CMV kept its infectivity for 5 days. Experimental Results - 78 - Table (7): In vitro properties of CMV isolate in infectious crude sap under laboratory conditions. In vitro properties Treatment Mean number of L. L. per leaf TIP Unheated 45 50 55 60 65 70 75 61.3 8.7 5.7 3.0 2.3 1.3 0.0 0.0 Relative virus activity 100 14.1 9.2 4.9 3.8 2.2 0 0 DEP Undiluted crude 10-1 10-2 10-3 10-4 10-5 10-6 10-7 61.3 20.0 17.3 7.7 2.3 0.0 0.0 0.0 100 32.6 28.3 12.5 3.8 0 0 0 LIV Zero time 1 2 3 4 5 6 61.3 8.0 3.3 2.3 1.3 0.7 0.0 100 13.0 5.4 3.8 2.2 1.1 0.0 * The results were calculated from 5 replicates. * The virus stability was assayed using C. amaranticolor as local lesion host. - 79 - Experimental Results 4. Inclusion bodies: Light microscopy examination of the epidermal strips from infected cucumber leaves, 25 days post CMV inoculation showed cytoplasmic inclusion bodies. The crystalline inclusions are observed in epidermal and hair cells as well as amorphous inclusions stained by bromophenol blue and mercuric chloride (Plate, 4). A B Plate (4): Epidermal strips and hairs of cucumber leaves infected with CMV (15 days post inoculation) showing cytoplasmic inclusion bodies, (Magnification of Light micrograph 400X). (A) CI: Crystalline inclusion bodies. (B) AI: Amorphous inclusion bodies. 5. Serological identification - Dot blot immunoassay (DBIA): The virus antigen was serologically precipitated against specific polyclonal IgG-CMV by immunoblotting assay Plate (5). The dot blot immunoassay was found to be sensitive to detect CMV in all infected plants. A purplish blue color was developed with infected tomato in the positive reaction, whereas extracts from healthy plants remain green in the negative reactions. Experimental Results - 80 - Plate (5): Dot Blot Immunoassay for CMV precipitation against specific IgG-CMV polyclonal. + : Positive - : Negative Infected samples (row 1) N. glutinosa; (rows 2 and 3) Tomato and (rows 4 and 5) Cucumber. - 81 - Experimental Results Part II Evaluation of biotic inducers for induction of systemic acquired resistance and biocontrol of CMV A- Induction of systemic acquired resistance (SAR) by biotic inducers before virus inoculation: Four biotic inducers (three botanical extracts and kombucha filtrate) were tested for induction of systemic acquired resistance (SAR) in tomato plants both pre- and post-inoculated with CMV. Achieved of SAR was detected by assessment of histopathological; biochemical [antiviral proteins, protein content, qualitative protein, activity and isozyme of peroxidase and polyphenol oxidase]; phytochemical [salicylic acid level, chlorophyll, phenol, total amino acids, total carbohydrate contents] and molecular of PRs gene changes. Finally, the efficacy of biotic inducers on the virus isolate infectivity was biologically detected. 1. Histopathological changes: Histopathological changes in tomato leaves tissues as evidence of the systemic acquired resistant reaction were elicited after 7 days of biotic inducers. In tomato leaves sprayed with biotic inducers, tissue alterations were observed when tissue was fixed after 7 days of treatment. Progressive increasing in lignin accumulation in epidermal cells, number of hairs, thickness of blade, number of xylem arms and phloem layers (Table, 8) and (Plate, 6B). The alterations included, also, tissueshrinkage, intense staining, and precipitation of lignin in sub stomatal cavity, mesophyll cell showing folding and layering of cell wall and remains of host palisade cell walls (Plate, 6A). Experimental Results - 82 - - 83 - Experimental Results Plate (6A): Anatomical variations in tomato leaves treated with biotic inducers (H, A, B, C, 100X and D 60X) H: Healthy. A: Mesophyll cells showing folding and layering of cell walls. B: Precipitation of lignin in sub stomatal cavity. C: Tissue showing intense staining. D: Increasing no. of xylem vessels (left: Non and right: treated). Experimental Results - 84 - Plate (6B): Light micrograph of tomato leaves sprayed with biotic inducers and infected with CMV showing different changes in cells and tissues (40X). H: Healthy. M: tomato leaf treated with M. jalapa extract. Y: tomato leaf treated with C. inerme extract. M+Y: tomato leaf treated with (Mj+Ci) extract. K: tomato leaf treated with Kombucha filtrate. - 85 - Experimental Results 2. Biochemical changes: 2.1. Antiviral Proteins a. Determination of the elicited antiviral protein as response to induction SAR (pre-inoculation) after 7-days: Protein content was determined in tomato plants treated with biotic inducers pre-CMV infection related to BSA as standard protein. Total protein content, in addition enzyme activities were increased in treated tomato plants than untreated ones. Kombucha filtrate was the superior in this concern (1.94 mg/g FW), while the mixture extracts was the lowest (1.28 mg/g FW) comparing with healthy control (1.05, mg/g FW) [Table (9) and Fig. (6)]. New proteins were elicited interior tomato plants as a result to spraying with biotic inducers were varied in their number and density. The variability analysis among inducers appeared 10 protein bands, the height bands (8 protein fractions) appeared in kombucha filtrate treatment followed by 7 protein fractions appeared in other inducers (M. jalapa, C. inerme and mixture extracts), compared with not treated plants gave 7 protein fractions (Plate, 7). The molecular weight of each polypeptide was determined related to protein marker. The most prominent alteration (polymorphic bands) among the 4 inducers (116, 66, 29, 25 and 18) kDa with percentage 50%. These bands may be related to antiviral proteins. The prominent polypeptide bands in all inducers (monomorphic or common polypeptide) were (35 and 14) kDa with percentage 20%. These bands may be related to tomato plant. The unique (polypeptide markers) were appeared in tomato plants treated with C. inerme extract, the mixture extracts and kombucha filtrate are (45, 36 and 17 kDa), respectively with percentage 30% (Table, 10). Experimental Results - 86 - Table (9): Protein content and enzyme activities in tomato plants treated with biotic extracts. Without virus inoculation Treatment Protein content (mg/g FW) Healthy c. 1.05 180.30 171.71 102.00 97.14 M. jalapa extract 1.67 262.80 157.37 292.50 175.15 C. inerme extract 1.30 211.70 162.85 219.00 168.46 Mixture (Mj+Ci) extract 1.28 227.60 177.81 114.00 89.06 Kombucha filtrate 1.94 263.60 135.88 152.25 78.48 POD(U/g FW) *POD Specific PPO(U/g FW) *PPO Specific activity activity *Specific activity (unit/mg protein) Protein content (mg/g FW) 2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 Healthy c. M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Treatments Fig. (6): Effect of biotic inducers on protein content in tomato plants pre virus inoculation. - 87 - Experimental Results Table (10): Protein fractions of tomato plants treated with biotic inducers using SDS-PAGE. MW (kDa) Untreated plant M 116 +++ ++ 66 + 45 36 35 +++ ++ 29 ++ 25 +++ 18 + ++ 17 14 ++ ++ Total 4 7 polypeptide Bioinducers Y M+Y ++ + + ++ + +++ + +++ ++ +++ + + ++ ++ 7 7 K + + ++ +++ ++ + + +++ Polymorphism Polymorphic polymorphic Unique Unique Monomorphic Polymorphic Polymorphic Monomorphic Unique Monomorphic 8 Monomorphic (Common polypeptide). Polymorphic (Specific polypeptide) Unique (Polypeptide marker) or (genetic marker). - = Absence of band. + = presence of band. Plate (7): Protein fractions of tomato plants treated with biotic inducers pre CMV inoculation using SDS-PAGE. Mr: Marker. H: Healthy. M: M. jalapa extract. Y: C. inerme extract. M+Y: mixture (Mj+Ci) extracts. K: Kombucha filtrate. Experimental Results - 88 - b. Determination the elicited antiviral protein as response to induction SAR (post-inoculation) after 25-days: Highest high protein content (2.51 mg/g FW) was due to kombucha filtrate treatment, while the lowest content (1.62 mg/g FW) was produced by C. inerme extract, compared with healthy and Inoculated control (1.09, 1.21 mg/g FW), respectively [Table (11) and Fig. (7)]. The tomato plants treated with biotic inducers and inoculated with CMV show that four inducers varied in number and density of protein. The variability analysis among four inducers appeared 9 protein bands; three inducers (M. jalapa, C. inerme extracts and kombucha filtrate) gave the same number of bands (6 bands) followed by mixture gave 5 bands while healthy control and infected plants gave 3 and 5 protein fractions, respectively (Plate, 8). The molecular weight of each polypeptide was determined related to protein marker. The most prominent alteration (polymorphic bands) appeared in (50, 25 and 15) kDa with percentage 33.3%. These bands may be related to antiviral proteins. The prominent polypeptide bands in all inducers (monomorphic or common polypeptide) were (60, 35 and 30) kDa with percentage 33.3%. These bands may be related to tomato plant. The unique (polypeptide markers) were appeared in tomato plants treated with C. inerme extract and kombucha filtrate in (75, 20 and 18.5) kDa with percentage 33.3%. These bands may be related to polypeptide markers (Table, 12). - 89 - Experimental Results Table (11): Protein content and enzyme activities in infected tomato plants then treated with biotic extracts. Post - virus inoculation (25 days) Treatment Protein content (mg/g FW) POD(U/g FW) Healthy control 1.09 170.10 156.06 160.00 146.79 Inoculated control 1.21 191.90 158.60 200.50 165.70 M. jalapa extract 2.18 272.10 124.82 385.50 176.83 C. inerme extract 1.79 195.80 109.39 263.50 147.21 Mixture (Mj+Ci) extracts 1.62 229.00 184.57 278.00 171.60 Kombucha filtrate 2.51 270.10 107.61 336.50 134.06 *POD Specific PPO(U/g FW) *PPO Specific activity activity Protein content (mg/g FW) 3 2.5 2 1.5 1 0.5 0 Healthy c. Infected c. M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Treatments Fig. (7): Effect of biotic inducers on protein content in tomato plants post virus inoculation. Experimental Results - 90 - Table (12): Protein fractions of CMV infected tomato plants treated with biotic inducers using SDS-PAGE. MW (kDa) Untreated plant Infected tomato M 75.0 -- -- -- ++ -- -- Unique 60.0 + ++ +++ ++ ++ +++ Monomorphic 50.0 -- -- + + -- -- Polymorphic 35.0 + + ++ +++ ++ + Monomorphic 30.0 + +++ +++ ++ ++ ++ Monomorphic 25.0 -- + + -- + + Polymorphic 20.0 -- -- -- -- -- ++ Unique 18.5 -- -- -- -- -- + Unique 15.0 -- + + + + + Polymorphic Total bands 3 5 6 6 5 6 Biotic inducers Y M+Y K Polymorphism + = weak band. ++ = moderate band. +++ = strong band Plate (8): Protein fractions of tomato plants treated with biotic inducers post CMV inoculation using SDS-PAGE. Mr) Marker. M: M. jalapa extract. Y: C. inerme extract. M+Y: mixture (Mj+Ci) extracts. K: Kombucha filtrate. H: Healthy control. IF: Inoculated control. - 91 - Experimental Results 2.2- Oxidative enzymes: Tomato plants treated with biotic inducers show variability in number and density of polypeptide peroxidase and polyphenol oxidase isozymes in pre- and post-CMV infection. a. Peroxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (pre-inoculation) after 7-days: 1- Enzyme Activities: The activity of peroxidase isozyme was determined pre-CMV inoculation. All biotic inducers were increased the peroxidase (POD) activity in tomato plants especially kombucha filtrate treatment (263.6 U/g FW), while C. inerme extract gave slightly increase (211.7 U/g FW) comparing with healthy control (180.3U/g FW) Fig. (8). POD activity (U/g FW) 300 250 200 150 100 50 0 Treatments Healthy c. C. inerme Kombucha M. jalapa Mixture (Mj+Ci) Fig. (8): Effect of biotic inducers on POD activity in tomato before CMV inoculation. Experimental Results - 92 - 2- Peroxidase activity staining: The results of pre-virus infection show that the total number of peroxidase isozyme was 6 bands as shown in Table (13) and Plate (9). The isozyme bands of 4 treatments were varied in number and density polypeptide whereas, biotic inducers were revealed 6, 5, 6 and 6 polypeptide bands of M. jalapa, C. inerme, mixture extracts and kombucha filtrate respectively compared with tomato plants untreated and Inoculated control appeared 4 and 4 isozymes respectively. The variability analysis of 4 treatments showed isozyme absent and/or present in some treatment at RF (1.0 and 2.0) with percentage 33.3% common in all treated tomato plants and isozyme bands may be related to tomato plants, (0.7, 1.5, 2. 6 and 3.5 RF) specific bands (polymorphic bands) with percentage 66.7% appearance may attribute to the influence of each biotic inducers treatment on tomato plants. - 93 - Experimental Results 6 bands _ _ 9 + 8 32 ++++ 35 ++++ 25 8 + 13 + 7 21 ++++ 27 ++ 33 10 ++ 10 + 17 20 ++ 15 ++ 10 4 6 5 ++ ++++ + +++ ++ ++ 6 Bands K %Fraction Bands %Fraction M+Y Bands +++ +++ ++ ++ + %Fraction 10 25 33 21 11 Y Bands Bands 0.7 1.0 1.5 2.0 2.6 3.5 Biotic inducers M %Fraction RF %Fraction Untreated plant 10 +++ 20 ++++ 9 + 40 +++ 11 ++ 10 ++ Polymorphism Table (13): Disc-PAGE banding patterns of peroxidase isozymes in noninoculated tomato plants and treated with biotic inducers. Polymorphic Monomorphic Polymorphic Monomorphic Polymorphic polymorphic 6 Monomorphic: Common polypeptide Polymorphic: Specific polypeptide. Band density: _ : Absent. +: Weak band. ++: Moderate band. +++: Strong band. ++++: very strong band. Plate (9): Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with biotic inducers pre CMV inoculation. H: Healthy. V: infected tomato. M: tomato leaf treated with Mirabilis extract. Y: tomato leaf treated with Clerodendrum extract. M+Y: tomato leaf treated with Mirabilis+Clerodendrum extract. K: tomato leaf treated with Kombucha filtrate. Experimental Results - 94 - b. Peroxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (post-inoculation) after 25-days: 1- Enzyme Activity: M. jalapa extract was induced highest peroxidase activity (272.1 U/g FW), followed by kombucha filtrate (265.7 U/g FW), while the lowest increase POD activity (195.8 U/g FW) was produced by C. inerme extract compared with healthy and Inoculated control (170.1, 191.9 U/g FW), respectively (Fig. 9). POD activity (U/g FW) 300 250 200 150 100 50 0 Treatments Healthy c. M. jalapa Mixture (Mj+Ci) Infected c. C. inerme Kombucha Fig. (9): Effect of biotic inducers on POD activity in tomato plants infected with CMV. - 95 - Experimental Results B- Peroxidase activity staining: The results of post virus infection, the total number of peroxidase isozymes was 4 bands in Table (14) and Plate (10). The isozyme bands of 4 treatments were varied in number and density polypeptide whereas, biotic inducers revealed 3,4,4,3 bands of M. jalapa, C. inerme, mixture extracts and kombucha filtrate respectively compared with untreated and infected tomato plants appeared 2 and 3 bands. Variability analysis of 4 treatments showed some polypeptides bands absent and/or present in some treatment at RF (2.5, 5.6) polymorphic band with percentage 50%. Two out of 4 isozyme bands were appeared in all treatments monomorphic or common bands with percentage 50% at RF (3.0, 4.7) these bands related to tomato plants and the number of isozyme bands was decreased after 25 days of spraying compared with their after 7 days due to the presence of the virus. Experimental Results - 96 - 2.5 3.0 4.7 5.6 4 bands 2 Bands K %Fraction Bands %Fraction M+Y Bands %Fraction Y Bands M %Fraction Bands 35 65 ++ +++ - %Fraction Bands RF tomato %Fraction plant - 20 + 9 + 25 ++ 30 ++ 20 ++ 21 ++ 25 + 55 ++++ 50 +++ 50 +++ 55 +++++ 50 ++ 20 ++ 20 + 10 + 15 ++ 25 + 3 3 4 4 Polymorphism Table (14): Disc-PAGE banding patterns of peroxidase isozymes of tomato plants treated with biotic inducers then inoculated with CMV. Untreated Infected Biotic inducers Polymorphic Monomorphic Monomorphic Polymorphic 3 Monomorphic: Common polypeptide Polymorphic: Specific polypeptide Band density: _ : Absent. +: Weak band. ++: Moderate band. +++: Strong band. +++++: very strong band Plate (10): Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with biotic inducers post CMV inoculation. H: Healthy. V: infected tomato. M: tomato leaf treated with Mirabilis extract. Y: tomato leaf treated with Clerodendrum extract. M+Y: tomato leaf treated with Mirabilis+C. inerme extract. K: tomato leaf treated with Kombucha filtrate. - 97 - Experimental Results c. Polyphenol oxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (pre-inoculation) after 7-days: 1- Enzyme Activity: M. jalapa extract was induced highest PPO activity (292.5 U/g FW), while the lowest PPO activity (114.0 U/g FW) was produced by mixture, compared with healthy control (102.0 U/g FW), (Fig. 10). PPO activity (U/g FW) 300 250 200 150 100 50 0 Treatments Healthy c. C. inerme Kombucha M. jalapa Mixture (Mj+Ci) Fig. (10): Effect of biotic inducers on PPO activity in tomato plants pre-CMV inoculation. Experimental Results - 98 - 2- Polyphenol oxidase activity staining: The obtained results of the total number of polyphenol oxidase isozyme produced in tomato plants treated with biotic inducers preCMV infection was 6 bands are shown in Table (15) and Plate (11). The isozyme bands of tomato plants treated with 4 biotic inducers were varied in number and density polypeptide whereas, biotic inducers were induced 4,4,4 and 6 polypeptide bands of M. jalapa, C. inerme, mixture extracts and kombucha filtrate respectively compared with untreated tomato plants appeared 5 isozymes. The variability analysis of 4 treatments showed isozyme absent and/or present in some treatments at RF (1.5 and 2.0) monomorphic common in all tomato plant treatment with percentage 33.3% and (1.3 and 3.3 RF) polymorphic specific bands with percentage 33.3% may attributed to the influence of each biotic inducers treatment on tomato plants, 2 unique isozyme (Genetic marker) with percentage 33.4% for each biotic inducers (0.8 and 2.5) of Kombucha filtrate treatment. - 99 - Experimental Results 0.8 1.3 1.5 2.0 2.5 3.3 6 _ _ 75 25 +++ + 13 40 20 + ++++ + 2 + 4 9 45 21 + ++++ + _ 10 50 25 _ 25 + 4 + ++++ + _ 15 + 4 7 12 30 11 25 15 Bands %Fraction K Bands %Fraction _ _ 27 Bands %Fraction Bands _ _ _ Biotic inducers Y M+Y M %Fraction Bands RF %Fraction Untreated plant + + +++ ++ +++ + 6 Polymorphism Table (15): Disc-PAGE banding patterns of polyphenol oxidase isozymes of non-inoculated tomato plants and treated with biotic inducers. Unique Polymorphic Monomorphic Monomorphic Unique Polymorphic bands Unique: genetic marker monomorphic: common polypeptide. Polymorphic: specific polypeptide. +: weak band. ++: moderate band. +++: strong band Plate (11): Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with biotic inducers pre -CMV inoculation. Experimental Results - 100 - d. Polyphenol oxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (post-inoculation) after 25-days: 1- Enzyme Activity: M. jalapa extract induced highest PPO activity (385.5 U/g FW), while the lowest PPO activity (263.0 U/g FW) was produced by C. inerme extract compared with healthy and Inoculated control (160.0, 200.5 U/g FW), respectively (Fig. 11). PPO activity (U/g FW) 400 350 300 250 200 150 100 50 0 Treatments Healthy c. Inoculated c. M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Fig. (11): Effect of biotic inducers on PPO activity in tomato plants infected with CMV. - 101 - Experimental Results 2- Polyphenol oxidase activity staining: Post virus infection, the total no. of polyphenol oxidase isozymes were 3 bands. The isozyme bands of tomato plants treated with four biotic inducers (Table, 16) were varied in number and density polypeptide whereas inducers were induced 3, 2, 2, 2 bands of M. jalapa, C. inerme, mixture extracts and kombucha filtrate respectively compared with untreated and infected tomato plants appeared 2 and 2 bands respectively. Two out of 3 isozyme bands were appeared in all treatments monomorphic or common bands at RF (2.1, 3.2) with percentage 66.6% these bands related to tomato plants. One unique isozyme (Genetic marker) for kombucha filtrate treatment at RF (1.0) with percentage 33.34% was detected, Plate (12). Table (16): Disc-PAGE banding pattern of polyphenol oxidase isozymes of tomato plants treated with biotic inducers then infected by 1.0 2.1 3.2 30 70 3 bands - 20 ++ 65 +++ 45 ++ 35 2 ++ 2 35 + ++ ++ 40 60 ++ ++ 3 2 55 45 Bands K %Fraction Bands %Fraction %Fraction Bands Bands Bioinducers Y M+Y M %Fraction Bands %Fraction %Fraction RF Bands Untreated Infected plant tomato ++ 30 ++ ++ 70 +++ 2 2 Unique: genetic marker. Monomorphic: common polypeptide. Band density: - Absent +: weak band. ++: moderate band. +++: strong band Experimental Results - 102 - Polymorphism CMV. Unique Monomorphic Monomorphic Plate (12): Native polyacrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with biotic inducers post CMV inoculation. H: Healthy. V: infected tomato. M: tomato leaf treated with M. jalapa extract. Y: tomato leaf treated with C. inerme extract. M+Y: tomato leaf treated with mixture (Mj+Ci) extract. K: tomato leaf treated with Kombucha filtrate. We can conclude that, the biotic inducers reveal reproducibility different levels of acquired resistance according to the number of protein genetic markers. Pre-virus infection, kombucha filtrate and mixture extracts gave a highest level of protein genetic markers followed by C. inerme and M. jalapa extracts. On the other hand, Post-virus infection, three biotic inducers (M. jalapa, C. inerme and mixture extracts) give the same number of genetic markers and kombucha filtrate gave the low numbers (Table, 17). - 103 - Experimental Results Table (17): Protein genetic markers of tomato plants produced by biotic inducers as indication of systemic acquired resistance against CMV infection. Parameters M. jalapa C. inerme Mixture (Mj+Ci) Kombucha *Pre **Post Pre Post Pre Post Pre Post SDS-PAGE - 3 3 2 5 2 6 2 Peroxidase 2 1 2 2 2 2 2 1 Polyphenol oxidase Total 1 - 2 - 2 - 1 - 3 4 7 4 9 4 9 3 *Pre-virus inoculation **Post-virus inoculation 2.3- Quantification of total SA in tomato plants treated with biotic pre-virus inoculation: The obtained results from quantification of total SA in induced tomato plants before CMV inoculation were tabulated in Table (18). These results were agreed with percentage of infection, disease severity and virus concentration; it was observed that, the level of total SA has been increased in treated plants compared with untreated tomato plants with biotic inducers (H control, V Inoculated control). The results indicate that the healthy tomato plant (non-treated) and tomato treated with M. jalapa, C. inerme, the mixture extracts and kombucha filtrate refers to the peaks obtained using HPLC, desired peak must be resulted in the retention time similar to the retention time of the standard. These peaks were used to calculate total SA based on the area under peak (Fig. 12). Experimental Results - 104 - Kombucha filtrate gave the highest level of SA (9346.61 µ g/g FW) followed by C. inerme extract (8652.78 µ g/g FW), M. jalapa extract (7451.63 µ g/g FW), while mixture extracts gave the lowest level of SA (3124.18 µ g/g FW) (Table, 18). Table (18): Quantification of total SA in tomato plants treated with biotic inducers compared with healthy plant. Treatments Standard SA Inoculated control M. jalapa extract C. inerme extract Mixture (M+Y) extract Kombucha filtrate Healthy No. of peak Ret. time 1 2 1 4 2 6 4 4.301 4.951 4.892 4.050 4.944 4.188 4.626 Area Total SA (µg/g FW) 1195.321 3861.915 17814.2 20685.7 7468.814 22344.2 702.349 1615.43 7451.63 8652.78 3124.18 9346.61 293.79 Fig. (12): HPLC quantification of free and endogenous SA in induced tomato plants. - 105 - Experimental Results Continued Fig. (12): (H): healthy plant. (V): Inoculated control. Experimental Results - 106 - Continued Fig. (12): (M): Tomato leaves treated with M. jalapa extract. (Y): Tomato leaves treated with C. inerme extract. - 107 - Experimental Results Continued Fig. (12): (M+Y): Tomato leaves treated with (Mj+Ci) extracts. (K): Tomato leaves treated with kombucha filtrate. Experimental Results - 108 - 2.4- Photosynthetic pigments content: From the results, it is noticed that in the inoculated tomato plants there were reduction in Chl a, Chl b and carotenoid contents (0.855, 0.761 and 0.742 mg/g FW) when compared with non-infected plants (0.714, 0.514 and 0.662 mg/g FW) of Chl a, Chl b and carotenoids, respectively. Generally, tomato plants treated with M. jalapa, C. inerme, mixture extracts and kombucha filtrate resulted an increase in Chl a contents (1.015, 0.971, 0.944 and 1.005 mg/g FW) whereas Chl b, (0.878, 0.823, 0.773 and 0.921 mg/g FW) and carotenoid (0.822, 0.795, 0.744 and 0.887 mg/g FW). On the other hand, in the tomato plants treated with extract of Mj, Ci, mixture extracts, kombucha filtrate and infected with CMV there were increase in Chl a Chl b and carotenoids contents compared with inoculated plants and non-treated with the tested inducers. The content increasing were (1.485, 1.279, 1.194 and 1.196 mg/ g FW) Chl a, (1.290, 1.111, 1.008 and 1.045 mg/g FW) Chl b and (1.286, 1.127, 1.026 and 1.495 mg/g FW) carotenoids of in plants treated with Mj, Ci, (Mj+Ci) extracts and kombucha filtrate respectively (Table, 19). From the obtained results the M. jalapa, C. inerme, mixture extracts and kombucha filtrate treatments elicited tomato plants for increasing total chlorophyll pigments and carotenoid contents as one evidence for systemic acquired resistance (SAR). - 109 - Experimental Results Table (19): Chlorophyll and carotenoid contents (mg/g FW) in tomato plants treated with biotic inducers. Chlorophyll content Treatments Healthy plants a b Carotenoids Untreated 0.855 0.761 0.742 Plants inoculated with virus Plants treated with Virus treated 0.714 0.514 0.662 Without virus 1.015 0.878 0.822 M. jalapa extract With virus 1.485 1.290 1.286 Plants treated with Without virus 0.971 0.823 0.795 C. inerme extract With virus 1.279 1.111 1.127 Plants treated with Without virus 0.944 0.773 0.744 Mixture (Mj+Ci) With virus 1.194 1.008 1.026 Plants treated with Without virus 1.005 0.921 0.887 Kombucha With virus 1.196 1.045 1.495 Chlorophyll content = mg/g FW. 2.5- Determination of phenolic compounds: Phenolic contents were increased in the non-inoculated plants and treated with biotic inducers. The highest increase was induced by M. jalapa extract and kombucha filtrate (49.24 and 48.41 mg/g FW) total phenols, (29.07 and 24.76 mg/g FW) free phenols and (20.17 and 23.65 mg/g FW) conjugate phenols respectively. While C. inerme and mixture extracts produced the lowest increase in phenols contents (33.56 and 32.70 mg/g FW) total phenols, (16.52 and 18.20 mg/g FW) free phenols and (17.52 and 14.5 mg/g FW) conjugated phenols respectively compared with healthy and Inoculated controls (32.89 and 31.02 mg/g FW) total phenols, (14.24 and 10.35 mg/g FW) free Experimental Results - 110 - phenols and (20.65 and 20.67 mg/g FW) conjugated phenols respectively (Table, 20). On the other hand, tomato plants post virus inoculation showed an increase in phenolic contents in treatments of M. jalapa and mixture extracts (12.30 and 11.85 mg/g FW) total phenols, (8.71 and 8.58 mg/g FW) free phenols and (3.59 and 3.27 mg/g FW) conjugated phenols respectively, while kombucha filtrate and C. inerme extract showed the little increase in phenols contents (9.65 and 8.41 mg/g FW) total phenols, (7.60 and 6.60 mg/g FW) free phenols and (0.39 and 1.81 mg/g FW) conjugated phenols respectively compared with healthy and Inoculated controls (8.14 and 7.65 mg/g FW) total phenols, (7.06 and 6.58 mg/g FW) free phenols and (1.08 and 1.07 mg/g FW) conjugated phenols respectively. Table (20): Free, conjugated and total phenols content in tomato plants treated with biotic inducers. Treatments Free phenols Conjugated phenols Total phenols Free phenols Conjugated phenols Post virus inoculation Total phenols Pre virus inoculation Healthy control 32.89 12.24 20.65 8.14 7.06 1.08 Inoculated control 31.02 10.35 20.67 7.65 6.58 1.07 M. jalapa extract 49.24 29.07 20.17 12.30 8.71 3.59 C. inerme extract 33.56 16.52 17.04 8.41 6.60 1.81 Mixture (Mj+Ci) extract 32.70 18.20 14.50 11.85 8.58 3.27 Kombucha filtrate 48.41 24.76 23.65 9.65 7.60 0.39 - 111 - Experimental Results 2.6- RNA determination in tomato plants treated with biotic inducers pre-virus inoculation: The total RNA content values in the leaves of four treatments of tomato plant compared with healthy and infected are recorded in Table (21). From the results, the highest value of 342 µg/g was recorded in tomato plant treated with kombucha filtrate followed by the value of 325 µg/g in tomato plant treated with M. jalapa extract. While the lowest value of 305, 284 µg/g were recorded in tomato plant treated with C. inerme extract and mixture extracts respectively, compared with the value of 245, 295 µg/g in healthy and infected respectively (Fig. 13). Table (21): Comparison between tomato plants (treated with biotic inducers) in RNA contents and healthy, inoculated controls. Inoculat Tomato plants treated with ed Mixture Kombucha M. jalapa C. inerme control (Mj+Ci) Treatment Healthy O.D 0.825 1.045 1.145 1.075 1.025 1.152 Conc. (µg/g) 245 295 325 305 284 342 Experimental Results - 112 - 1.2 Mixed (Mj + Ci) Kombucha 0.2 C. inerme 0.4 M. jalapa 0.6 Infested control 0.8 Healthy Optical Density 1 295 325 305 284 342 0 245 Conc. (µg/g) Fig. (13): Histogram illustrates the RNA content values in the leaves of tomato plants treated with biotic inducers compared with healthy. 3. Molecular marker for SAR detection: Pathogenesis-related protein associated with plant defense: RT-PCR amplification PR-1a gene: Total RNA were isolated from tomato plants treated with biotic inducers using CTAB method with high quality and substantially free RNA contamination. The RNAs were used as a template for RT-PCR to amplify of the PR-1a gene via the QLAGEN PCR system by use of an oligonuclutides 3'-GCTCGTAGACAAGTTGGAGTC-5' and 5'-ACCCACATCTTCACAGCAC-3' primer sets nearly full length mRNA PR-1a gene could be synthesized. The amplified PR-1a mRNA was used for conformation its specificity to the acquired resistance in tomato - 113 - Experimental Results plants. The mRNA of PR-1a gene as a PCR product with an expected size of about 182 bp DNA was amplified (Plate, 13). Plate (13): 2.5% agarose gel electrophoresis showing the amplified PCR product of mRNA of PR-1a gene of tomato plants treated with biotic inducers at the correct size (182 bp). M: Molecular weight of DNA Marker. K: Tomato leaves treated with kombucha filtrate. M+Y: Tomato leaves treated with mixture (Mj+ Ci) extract. Y: Tomato leaves treated with C. inerme extract. M: Tomato leaves treated with M. jalapa extract. V: Tomato leaves inoculated with CMV. H: Untreated leaves. Experimental Results - 114 - PR-1a gene sequence: The DNA sequence was performed using PCR produced when the specific (downstream and upstream) primers for mRNA of PR-1a gene of the tomato plants treated with biotic inducers were used. The PCR product band was cleaned using gene clearing kit as mentioned before. The result illustrated in Fig. (14) show the partial nucleotide sequence of PCR fragment with appeared to be containing 182 bp. The nucleotide sequence of PR-1a gene was recorded in Gen-Bank. 1 GCTCGTAGAC AAGTTGGAGT CGGTGGTATG ACATGCGACA ATAGGCTAGC GGCCAATGCC 61 CAGCATTACG CCAATCAtAG AGCTGCCGAC TGCAGGATGC AACACTCTGG TGGACCTTAC 121 GGTGAAAACC TAGCTGCCGC TTTCCCCCAG CTCAACGCGG CTGGTGCTGT GAAGATGTGG 181 GT Fig. (14): The partial nucleotide sequence of DNA (182 bp) from mRNA of PR-1a gene of tomato plants treated with biotic inducers. Sequencing analysis: The partial nucleotide sequence of the PCR-amplified fragment for the PR-1a gene of the tomato plants treated with biotic inducers was done to determine the relationship with other recommended pathogenesis related protein registered in GenBank (Table, 22). The sequencing was done from the forward direction at Macro gen 3730XL6-1518-009, Korea. - 115 - Experimental Results Analysis of molecular data by Bioinformatics: 1- Nucleotide sequence: The nucleotide sequence of PR-1a gene for tomato plants treated with biotic inducers revealed the highest content for Guanine (G) 54 (29.7%) followed by cytosine (C) 48 (26.4%), then adenine (A) 42 (23.1%) and thymine (T) 38 (20.9%) (Table, 22). The partial nucleotide sequence of PR-1a gene for tomato plants treated with biotic inducers was an aligned by using DNAMAN program (Wisconsin. Madison, USA) with six published pathogenesis related protein in Gen-Bank which are: Solanum lycopersicon, Solanum torvum, Capsicum annuum, Solanum melongena, Cucumis melo and Cucumis sativus. The nucleotide sequence similarity of PR-1a gene for tomato plants treated with biotic inducers with six published pathogenesis related protein were shown in Fig. (15). A phylogenetic tree of PR-1a tomato revealed 95% a moderate degree of similarity to the other S. lycopersicon pathogenesis related protein. On the other hand, revealed 84% a moderate degree of similarity to S. torvum, C. annuum and S. melongena and 60% C. melo and C. sativus pathogenesis related protein (Fig. 16). Comparison between bases composition of partial PR-1a gene sequence for tomato plants treated with biotic inducers and six pathogenesis related protein published in Gen-Bank was done to determine C+G and A+T ratio between the PR-1a gene and these international pathogenesis related protein as shown in Table (22) and Fig. (17). Experimental Results - 116 - Table (22): Comparison between bases composition of partial PR-1a gene for tomato plants treated with biotic inducers and six pathogenesis related protein published in GenBank. Base PR-1 gene and Total Weight other crops (bp.) (kDa) A C G T C+G A+T No. % No. % No. % No. % No. % No. % PR-gene tomato 182 55.782 42 23.1 48 26.4 54 29.7 38 20.9 102 56.0 80 44.0 Solanum lycopersicon 832 252.902 242 29.1 165 19.8 168 20.0 257 30.9 333 40.0 499 60.0 Solanum torvum 504 153.789 128 25.4 112 22.2 127 25.2 137 27.2 239 47.4 265 52.6 Capsicum annuum 805 245.211 248 30.8 146 18.1 167 20.7 244 30.3 313 38.9 492 61.1 Solanum melongena 258 79.186 64 24.8 56 21.7 77 29.8 61 23.6 133 51.6 125 48.4 Cucumis melo 456 139.613 130 28.5 89 19.5 118 25.9 119 26.1 207 45.4 249 54.6 Cucumis sativus 423 129.64 118 27.9 90 21.3 114 27.0 101 23.9 204 48.2 219 51.8 - 117 - Experimental Results Experimental Results - 118 - Fig. (15): Multiple sequence alignment of the partial nucleotide sequence of the PR-1a gene for tomato plants with the corresponding sequence of six pathogenesis related protein available in Gen-Bank. - 119 - Experimental Results 100%95% 90% 85% 80% 75% 70% 65% 60% PR1 gene tomato 95% S. lycopersicum 84% S. torvum 88% Capsicum annuum 89% 60% S. melongena Cucumis melo 73% Cucumis sativus Fig. (16): A phylogenetic tree of tomato plants treated with biotic inducers and other crops. Fig. (17): Histogram illustrates nucleotide frequencies of PRgene of tomato plants related to other PR-1a gene of different crops in Gen-Bank. Experimental Results - 120 - 2- Translation of partial nucleotide sequence of PR-1a gene for tomato plants treated with biotic inducers: The predict number of amino acids were produced from translation of partial (PR-1a) gene nucleotide sequence were 60 amino acids starting with Alanine (A) (Fig. 18) Translation of PR-1a (1-182) Universal code Total amino acid number: 60, MW= 6383. 10 20 30 40 50 60 1 1 GCTCGTAGACAAGTTGGAGTCGGTGGTATGACATGCGACAATAGGCTAGCGGCCAATGCC 61 21 CAGCATTACGCCAATCATAGAGCTGCCGACTGCAGGATGCAACACTCTGGTGGACCTTAC 121 41 GGTGAAAACCTAGCTGCCGCTTTCCCCCAGCTCAACGCGGCTGGTGCTGTGAAGATGTGG 181 A R R Q V G V G G 70 80 Q H G E 181 GT Y A N 130 N L M T C D N R L A 90 100 110 H R A A D C 140 150 A A A F P Q L R M Q H 160 N A A G A N A 120 S G G P Y 170 180 A V K M W Fig. (18): Translation of partial nucleotide sequence of PR-la gene for tomato plants treated with biotic inducers produced 60 amino acids with MW = 6.383 kDa. The partial PR-1a gene sequence for tomato plants was aligned by using DNAMAN program (Wisconsin, Madison, USA) with eleven published pathogenesis related protein for different hosts in Gen-Bank which are: S. lycopersicon, C. annuum, S. melongena, S. torvum, Vitis pseudoreticulata, C. sativus, Musa acuminate, Betula pendula, Brassica napus, Eutrema wasabi and Linum usitatissimum. The partial PR-1a gene sequence similarity of tomato plant treated with biotic inducers with eleven published pathogenesis related protein of - 121 - Experimental Results different hosts was shown in (Fig. 19). A phylogenetic tree of PR-la gene tomato divided into two major groups, the 1st group includes 2 subgroups. The lst subgroup divided into 2 under subgroups where, one group include PR-1 gene tomato similarity 89% with Solanum lycopersicon and Capsicum annuum and another group S. melongena revealed similarity 85% with the 1st under subgroup (PR-1 gene tomato) and the 2nd sub group include Solanum torvum similarity 84% with the 1st subgroup. The second major group contain 2 subgroups, the 1st subgroup divided into 2 under subgroups where, one group include Vitis pseudoreticulata revealed similarity 61% with the 1st sub group and the 2nd under sub group contain Cucumis sativus revealed similarity 64% with Musa acuminata. The second subgroup divided into 2 under sub groups, one group include Betula pendula which revealed a moderate similarity 68% with the 1st subgroup and Brassica napus revealed similarity 79% with Eutrema wasabi, while the 2nd under sub group include Linum usitatissimum revealed similarity 61% with the 1st sub group. The 1st major group gene tomato revealed a moderate similarity 58% with the 2nd major group (Fig. 20). Comparison between amino acids composition of partial PR-la sequence for tomato plants treated with biotic inducers and eleven pathogenesis related protein of different hosts published in Gen-Bank was done to determine the similarity in types, percentages and number of amino acids composition of partial PR-1a gene for tomato plants, where as PR-1a gene tomato was produced 19 types of 60 amino acids beginning with Alanine (A) and ended with Tryptophan (W). The PR-1a tomato was differed in percentage in each amino acid Experimental Results - 122 - composition and molecular weight with eleven pathogenesis related protein of different hosts as shown in Table (23). Fig. (19): Multiple amino acids sequence aligned of the partial PR-1 a gene of the studied tomato plants with the corresponding amino acid sequence of eleven pathogenesis related protein of different hosts available in Gen-Bank. - 123 - Experimental Results 100% 90% 80% 70% 60% 50% PR1 gene tomato 89% S. lycopersicum 94% 85% Capsicum annuum 84% Solanum melongena Solanum torvum V. pseudoreticulata 58% 61% Cucumis sativus 64% Musa acuminata 60% Betula pendula 68% Brassica napus 79% 61% Eutrema wasabi Linum usitatissimum Fig. (20): A phylogenetic tree of PR-la gene tomato based on the amino acid sequence of the PR-la gene. The dendrogram displaying the percentage of amino acid sequence homology between the PR-1a gene tomato and the other eleven pathogenesis related protein of different hosts published in Gen-Bank. Experimental Results - 124 - Table (23): Comparison between amino acids composition of partial PR-la gene sequence for tomato plants treated with biotic inducers and 11 pathogenesis related protein of different hosts published in Gen-Bank. Amino acids Ala.(A) 1 2 3 4 5 6 7 8 9 10 11 12 No. % No. % No. % No. % No. % No. % No. % No. % No. % No. % No. % No. % 13 21.7 20 11.2 19 10.6 10 11.6 19 11.3 12 6.8 10 11.8 24 14.8 17 16.7 17 10.5 15 9.3 12 14.0 Cyst. (C) 2 3.3 7 3.9 7 3.9 4 4.7 7 4.2 8 4.5 2 2.4 7 4.3 3 2.9 7 4.3 6 3.7 2 2.3 Asp.(D) 2 Glu.(E) 1 1.7 4 2.2 4 2.2 2 2.3 7 4.2 5 2.8 5 5.9 2 1.2 2 2.0 4 2.5 2 1.2 4 4.7 Phe.(F) 1 1.7 7 3.9 7 3.9 2 2.3 7 4.2 4 2.3 3 3.5 3 1.9 0 Gly.(G) 7 11.7 15 8.4 15 8.4 9 10.5 13 7.7 19 10.8 8 9.4 14 8.6 9 8.8 15 9.3 15 9.3 9 10.5 His.(H) 3 5.0 4 2.2 5 2.8 2 2.3 4 2.4 5 2.8 1 1.2 3 1.9 4 3.9 4 2.5 3 1.9 2 2.3 Ile.(I) 3.3 8 0 0 4.5 8 4.5 3 3.5 8 4.8 8 4.5 5 5.9 6 3.7 7 6.9 6 3.7 8 5.0 4 4.7 0 2 1.2 1 0.6 0 0 5 2.8 6 3.4 2 2.3 5 3.0 9 5.1 2 2.4 6 3.7 1 1.0 6 3.7 7 4.3 1 1.2 Lys.(K) 1 1.7 4 2.2 4 2.2 3 3.5 4 2.4 2 1.1 3 3.5 3 1.9 6 5.9 5 3.1 5 3.1 2 2.3 Leu.(L) 3 5.0 10 5.6 9 5.0 2 2.3 8 4.8 12 6.8 4 4.7 5 3.1 6 5.9 11 6.8 11 6.8 4 4.7 Met.(M) 3 5.0 4 2.2 4 2.2 3 3.5 4 2.4 4 2.3 0 Asn.(N) 5 8.3 18 10.1 18 10.1 7 8.1 13 7.7 17 9.7 7 8.2 14 8.6 10 9.8 15 9.3 14 8.7 6 7.0 Pro.(P) 2 3.3 9 5.0 10 5.6 3 3.5 10 6.0 7 4.0 4 4.7 8 4.9 2 2.0 6 3.7 8 5.0 2 2.3 Gln.(Q) 4 6.7 13 7.3 12 6.7 6 7.0 11 6.5 7 4.0 4 4.7 8 4.9 4 3.9 7 4.3 7 4.3 4 4.7 Arg.(R) 5 8.3 11 6.1 11 6.1 5 5.8 9 5.4 6 3.4 4 4.7 8 4.9 1 1.0 11 6.8 11 6.8 5 5.8 Ser.(S) 1 1.7 8 4.5 8 4.5 4 4.7 8 4.8 16 9.1 4 4.7 14 8.6 8 7.8 12 7.4 12 7.5 9 10.5 Thr.(T) 1 1.7 6 3.4 6 3.4 3 3.5 7 4.2 6 3.4 3 3.5 6 3.7 3 2.9 4 2.5 3 1.9 1 1.2 Val.(V) 3 5.0 10 5.6 11 6.1 7 8.1 10 6.0 14 8.0 9 10.6 14 8.6 9 8.8 15 9.3 16 9.9 6 7.0 Trp.(W) 1 1.7 6 3.4 6 3.4 4 4.7 5 3.0 5 2.8 3 3.5 4 2.5 3 2.9 4 2.5 4 2.5 3 3.5 Tyr.(Y) 2 3.3 10 5.6 9 5.0 5 5.8 9 5.4 10 5.7 4 4.7 10 6.2 7 6.9 10 6.2 10 6.2 7 8.1 Total AA no. 60 MW(kDa) 6.383 179 179 20.123 20.094 86 9.603 168 176 18.809 19.182 0 3 1.9 0 0 85 162 102 9.334 17.308 10.82 1 0.6 3 1.9 3 3.5 162 161 17.772 17.668 86 9.410 1= PR-1a gene tomato. 2= S. lycopersicon. 3= C. annuum. 4= S. melongena. 5= S. torvum. 6= V. pseudoreticulata. 7= C. sativus. 8= M. acuminata. 9= B. pendula. 10= B. napus. 11= E. wasabi.12= L. usitatissimum. - 125 - Experimental Results 4- Effect of biotic inducers on virus infectivity during induction of SAR as follows: All tested inducers showed different successful degrees in the induction of acquired systemic resistance against CMV infection in tomato plants. Reduction of infection (RI%) percentage are affected as a result to treatments, e.g. M. jalapa extract gave the highest percentage of reduction (76.0%), followed by C. inerme extract and kombucha filtrate (60.0 and 59.2%), while mixture extracts has the lowest percentage (50.0%) compared with Inoculated control 0.0% [Table (24) and Fig. (21)]. Table (24): Effect of bioinducers plants. on CMV infectivity in tomato Treatments Disease incidence% % of R.I. D.S. (%) *Conc. Inoculated control 100.0 0.0 96.2 85.5 M. jalapa extract 24.0 76.0 11.5 10.2 C. inerme extract 40.0 60.0 13.7 12.2 Mixture (Mj+Ci) extracts 50.0 50.0 24.1 21.4 Kombucha filtrate 40.7 59.2 18.0 16.0 R.I. = reduction of virus infection. D.S. = Disease severity. *Virus concentration was biology assayed as mean numbers of local lesions. Experimental Results - 126 - 100 90 80 Virus infectivity 70 60 50 40 30 20 10 0 %of infection %of R.I. Infected control C. inerme Kombucha D.S. (%) Conc. M. jalapa Mixture (Mj+Ci) Fig. (21): Effect of bioinducers on disease severity and virus infectivity in tomato plants. - 127 - Experimental Results B- Using of biotic inducers as bioinducers to control CMV infection: Systemic acquired resistance was experimentally achieved using the tested bioinducers in the tomato plants before inoculation with the virus isolate. The effect of SAR on the virus infectivity was also determined. In this experiment, tomato seedlings were firstly inoculated with the virus isolate, after 15 days were sprayed with the four tested bioagents. Seven days later, leaves samples were collected to determine the following changes between inoculated and noninoculated or sprayed or non-sprayed treatments. 1. Histopathological changes: Transversal sections from treated and non-treated leaves were examined under light microscope after contrast staining. Observations showed an important alteration between treated and non-treated samples. Plants treated with bioinducers were stronger in their growth than nontreated as a result to the increase in lignin precipitation, numbers of xylem arms, phloem layers, skin hairs and increasing thickness of cell wall, and blade (Table, 25). On the other hand, non-treated tomato plants showed plasmolysis in the mesophyll cells, cell walls collapsed and plastids become deformed and swollen a loss of orientation along the inner cell wall. These alterations were intensified with progressive tissueshrinkage and desiccation causing the walls of the palisade and spongy parenchyma to fold in a layering fashion as well as reduction in vascular bundles (Plate, 14). Experimental Results - 128 - - 129 - Experimental Results Plate (14): Light micrograph of tomato plant treated with bioinducers post CMV inoculation showing different changes in cells and tissues (40X). H: Healthy. V: infected tomato. M: tomato leaf treated with M. jalapa extract. Y: tomato leaf treated with C. inerme extract. M+Y: tomato leaf treated with mixture (Mj+Ci) extract. K: tomato leaf treated with Kombucha filtrate. Experimental Results - 130 - 2. Biochemical changes: 2.1. Antiviral Proteins a. Determination the elicited antiviral protein as response to treatment with bioinducers to control infected tomato plants after 7 days of spraying: Protein content was determined in treated tomato plants with bioinducers and infected with CMV related to BSA as standard protein (Table, 26). All bioinducers caused an increase in total protein content and enzymes activity in treated tomato plants. Kombucha filtrate induced highest protein content (1.65 mg/g FW), while the lowest content (0.93 mg/g FW) was produced by mixture extracts, compared with healthy and Inoculated control (1.05, 1.12 mg/g FW), respectively Fig. (22). The tomato plants treated with bioinducers and inoculated with CMV showed clear varied in number and density of protein. The variability analysis among four bioinducers appeared 12 protein bands (Plate, 15); eleven protein fractions appeared in tomato plants treated with M. jalapa extract followed by C. inerme extract (10 protein fractions) and mixture extracts and kombucha filtrate gave (8 protein fractions), while non-treated and infected plants gave 4 and 7 protein fractions, respectively. The molecular weight of each polypeptide was determined related to protein marker (Table, 27). The most prominent alteration (polymorphic bands) among 4 bioinducers (70, 50, 45, 36, 35, 20, 14 and 13) kDa with percentage 66.6%, these bands may be related to antiviral proteins. The prominent polypeptide bands in all bioinducers (Monomorphic or common polypeptide) were (25, 18 and 17) kDa with percentage 25%, these bands may be related to tomato plant. The unique (polypeptide - 131 - Experimental Results markers) were appeared in tomato plant treated with M. jalapa extract (65) kDa with percentage 8.3%, these bands may be related to polypeptide markers. Table (26): Protein content and enzyme activities in tomato plants infected with CMV and treated with biotic extracts (after 7 days). After 7 days of spraying bioinducers Treatments Protein content (mg/g FW) POD (U/g FW) *POD Specific activity PPO (U/g FW) *PPO Specific activity Healthy control 1.05 200.30 190.76 102.00 97.14 Inoculated control 1.12 217.70 194.38 120.00 107.14 M. jalapa extract 1.62 268.90 165.99 150.00 92.59 C. inerme extract 1.41 243.60 172.77 127.50 90.43 Mixture extracts 0.93 253.90 273.01 130.50 140.32 Kombucha filtrate 1.65 266.30 161.39 229.50 139.09 *Specific activity (unit/mg protein) Protein content (mg/g FW) 2 1.5 1 0.5 0 After 7 days of spraying bioinducers Healthy c. C. inerme Infected c. Mixture (Mj+Ci) M. jalapa Kombucha Fig. (22): Effect of bioinducers on protein content in tomato plants infected with CMV (after 7 days). Experimental Results - 132 - Table (27): Protein fractions of tomato plants infected with CMV and treated with bioinducers using SDS-PAGE. Bioinducers MW (kDa) Untreated plant Infected tomato M Y M+Y K 70 65 50 + ++ + ++ +++ + ++ - + Polymorphic Unique Polymorphic 45 36 - ++ ++ +++ ++ +++ +++ - ++ ++ Polymorphic Polymorphic 35 - - - ++ + - Polymorphic Polymorphism 25 ++ +++ +++ +++ ++ +++ Monomorphic 20 18 17 14 13 Total bands ++ + 4 ++ +++ ++ + 7 ++ ++++ +++ ++ ++ 11 + ++ +++ ++ 10 ++ +++ ++ ++ ++ 8 ++ +++ +++ ++ 8 Polymorphic Monomorphic Monomorphic Polymorphic Polymorphic Monomorphic (common polypeptide). Polymorphic (specific polypeptide). Unique (polypeptide marker) or (genetic marker). - = Absence of band + = presence of band. Plate (15): Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. H: Healthy. V: Inoculated control. M: M. jalapa extract. Y: C. inerme extract. M+Y: mixture (Mj+Ci) extracts. K: Kombucha filtrate. - 133 - Experimental Results b. Determination the elicited antiviral protein as response to treatment with bioinducers on infected tomato plants after 25 days of spraying: Protein content was determined in CMV infected tomato plants treated with bioinducers related to BSA as standard protein. All the used bioinducers caused an increase in total protein content and enzymes activity in treated tomato plants. M. jalapa extract induced highest protein content (2.63 mg/g FW), while the lowest content (1.07 mg/g FW) was produced by C. inerme extract compared with healthy and Inoculated control (1.09, 1.21 mg/g FW), respectively [Table (28) and Fig. (23)]. The tomato plants treated with bioinducers and inoculated with CMV showed clear varied in number and density of protein. The variability analysis among four bioinducers appeared 8 protein bands (Plate, 16); seven protein fractions appeared in treatment with mixture extracts followed by C. inerme extract give 6 protein fractions, M. jalapa extract and kombucha filtrate gave the same number of protein fraction (5), while non treated and infected plants gave 4 and 5 protein fractions, respectively. The molecular weight of each polypeptide was determined related to protein marker (Table, 29). The most prominent alteration (polymorphic bands) among 4 bioinducers (67, 55, 35, 25, 16 and 14) kDa with percentage 75%. These bands may be related to antiviral proteins. The prominent polypeptide bands in all bioinducers (monomorphic or common polypeptide) were (45 and 18) kDa with percentage 25%. These bands may be related to tomato plant. Experimental Results - 134 - Table (28): Protein content and enzyme activities in tomato plants infected with CMV and treated with bioinducers (after 25 days). After 25 days of spraying bioinducers Treatments Protein content POD (U/g FW) *POD Specific (mg/g FW) activity PPO (U/g FW) *PPO Specific activity Healthy control 1.09 192.80 176.88 160.00 146.79 Inoculated control 1.21 201.90 166.86 200.00 165.29 M. jalapa extract 2.63 274.00 66.16 282.50 107.41 C. inerme extract 1.07 202.20 188.97 150.00 140.19 Mixture extracts 1.11 230.00 207.21 208.50 187.84 Kombucha filtrate 1.28 274.50 214.45 247.00 192.97 *Specific activity (unit/ mg protein) Protein content (mg/g FW) 3 2.5 2 1.5 1 0.5 0 After 25 days of spraying bioinducers Healthy c. C. inerme Infected c. Mixture (Mj+Ci) M. jalapa Kombucha Fig. (23): Effect of bioinducers on protein content in tomato plants infected with CMV (after 25 days). - 135 - Experimental Results Table (29): Protein fractions of CMV infected tomato plants treated with bioinducers using SDS-PAGE. MW (kDa) Untreated plant Infected tomato 67 55 45 35 25 18 16 14 ++ ++ +++ ++ - +++ ++ ++ ++ ++ M ++ ++ ++ ++ ++ - Total bands 4 5 5 Bioinducers Y M+Y + ++ ++ ++ ++ +++ + ++ + +++ ++ ++ ++ 6 7 K +++ + ++ ++ Polymorphism Polymorphic Polymorphic Monomorphic Polymorphic Polymorphic Monomorphic Polymorphic Polymorphic 4 Monomorphic (common polypeptide). Polymorphic (specific polypeptide). - = Absence of band + = presence of band. Plate (16): Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. Mr): Marker. H: Healthy. V: Inoculated control. M: M. jalapa extract. Y: C. inerme extract. M+Y: mixture extracts (Mj+Ci) K: Kombucha filtrate. Experimental Results - 136 - 2.2- Oxidative enzymes: Tomato plants treated with bioinducers showed variability in number and density of polypeptide peroxidase and polyphenol oxidase isozymes in pre and post CMV infection. a. Peroxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 7 days of spraying: 1- Activity: The activity of peroxidase isozyme was increased as response to all bioinducers treatments. M. jalapa extract induced highest peroxidase activity (268.9 U/g FW), while the lowest POD activity (243.6 U/g FW) was produced by C. inerme extract compared with healthy and Inoculated control (200.3, 217.7 U/g FW) respectively, Fig. (24). POD activity (U/g FW) 300 250 200 150 100 50 0 Treatments Healthy c. Infected c. M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Fig. (24): Effect of bioinducers on POD activity in tomato plants infected with CMV (after 7days). - 137 - Experimental Results 2- Peroxidase activity staining: The results of the total number of peroxidase isozyme after virus inoculation was 5 bands (Table, 30). The isozyme bands of 4 treatments were varied in number and density polypeptide. Bioinducers induced 5, 3, 4 and 3 polypeptide bands of M. jalapa, C. inerme, mixture extracts of them and kombucha filtrate respectively compared with tomato plants untreated and Inoculated control appeared 3 and 3 isozymes respectively. The variability analysis of 4 treatments showed isozyme absent or present in some treatment at RF (1.9, 3.9, 4.5) monomorphic bands common in all tomato plant treatment with percentage 60%. On the other hand, isozyme band at (1.5 RF) polymorphic band with percentage 20% was appeared with the treatment of M. jalapa and mixture extracts and other band presence with M. jalapa extract treatment at RF (5.1) with percentage 20% as a unique or genetic marker (Plate, 17). 10 + - Polymorphic 20 +++ 30 ++ Monomorphic 50 ++++ 55 +++ Monomorphic 20 +++ 15 ++ Monomorphic Unique 4 3 Bands %Fraction ++ ++ ++ 3 Bands %Fraction K 10 + 20 +++ 30 40 ++++ 30 20 +++ 40 10 ++ 5 Bands %Fraction M Bands 25 ++ 45 +++ 50 +++ 45 +++ 4.5 25 ++ 10 ++ 5.1 5 bands 3 3 Bioinducers Y M+Y %Fraction 1.5 1.9 3.9 Bands %Fraction Bands RF %Fraction Untreated Infected plant tomato Polymorphis m Table (30): Disc-PAGE banding patterns of peroxidase isozymes of CMV infected tomato plants treated with bioinducers. Unique: Genetic marker. Monomorphic: Common polypeptide. Polymorphic: Specific polypeptide. Band density: _ : Absent +: Weak band. +: Moderate band. +++: Strong band. ++++: very strong band. Experimental Results - 138 - Plate (17): Native acrylamide gel (7%) electrophoresis of POD isozymes produced in inoculated tomato plants and treated with bioinducers. b. Peroxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 25 days of spraying: 1- Activity: Peroxidase activity was increased in all induced tomato plants (Fig. 25). Kombucha filtrate induced highest activity (274.5 U/g FW), while C. inerme extract induced the lowest activity (202.2 U/g FW). M. jalapa and mixture extracts induced different activity (274.0, 230.0 U/g FW) respectively compared with healthy and Inoculated control (192.8, 201.9 U/g FW) respectively. - 139 - Experimental Results POD activity (U/g FW) 300 250 200 150 100 50 0 Treatments Healthy c. Inoculated c. M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Fig. (25): Effect of bioinducers on POD activity in inoculated tomato plants (after 25-days). 2- Peroxidase activity staining: The results of the total number of peroxidase isozyme detected in tomato plants inoculated with CMV and treated with bioinducers was 5 bands (Table, 31). The isozyme bands of 4 treatments were varied in number and density polypeptide. Bioinducers were revealed 5, 5, 3 and 3 polypeptide bands of M. jalapa, C. inerme, mixture extracts and kombucha filtrate respectively compared with tomato plants untreated and Inoculated control appeared 3 and 4 isozymes respectively. The variability analysis of 4 treatments showed isozyme absent or present in Experimental Results - 140 - some treatment at RF (3.4, 4.9 and 5.6) monomorphic bands common in all tomato plants with percentage 60%. Two isozyme bands (5.2 and 6.1 RF) specific polypeptide bands with percentage 40% appearance with treatment of M. jalapa and C. inerme extracts (Plate, 18). Untreated Infected plant tomato Bioinducers Y M+Y RF Bands %Fraction Bands %Fraction Bands %Fraction Bands %Fraction Bands %Fraction Bands K %Fraction M Polymorphism Table (31): Disc-PAGE banding patterns of peroxidase isozymes of CMV infected tomato plants treated with bioinducers. 3.4 25 ++ 30 +++ 20 ++ 15 ++ 45 +++ 35 ++ Monomorphic 4.9 40 ++ 30 +++ 40 +++ 25 ++ 40 ++ 35 ++ Monomorphic 15 ++ 10 ++ 30 ++ 25 +++ 20 ++ 20 ++ 10 + 10 + - - 5 3 3 5.2 5.6 35 ++ 6.1 - - 5 bands 3 4 5 15 ++ 30 Polymorphic ++ Monomorphic Polymorphic Monomorphic: Common polypeptide Polymorphic: Specific polypeptide Band density: _ : Absent. +: Weak band. ++: Moderate band. +++: Strong band - 141 - Experimental Results Plate (18): Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers post CMV inoculation. H: Healthy. V: Inoculated with CMV. M: Treated with Mirabilis extract Y: Treated with Clerodendrum extract. M+Y: Treated with Mirabilis + Clerodendrum extracts. K: Treated with Kombucha filtrate. Experimental Results - 142 - c. Polyphenol oxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 7 days of spraying: 1- Activity: Kombucha filtrate induced highest PPO activity (229.5 U/g FW), while the lowest PPO activity (127.5 U/g FW) was produced by C. inerme extract compared with healthy and Inoculated control (102.0, 120.0 U/g FW) respectively, Fig (26). PPO activity (U/g FW) 250 200 150 100 50 0 Treatments Healthy c. Inoculated c. M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Fig. (26): Effect of bioinducers on PPO activity in tomato plants infected with CMV. 2- Polyphenol oxidase activity staining: The obtained results of the total number of polyphenol oxidase isozyme produced in tomato plants treated with bioinducers pre-CMV infection was 4 bands, Table (32). The isozyme bands of tomato plants treated with the 4 bioinducers were varied in number and density polypeptide. Bioinducers were - 143 - Experimental Results induced 4, 4, 3 and 3 polypeptide bands of M. jalapa, C. inerme and the mixture extracts and kombucha filtrate respectively compared with healthy and inoculated tomato plants appeared 3 and 3 isozymes, respectively. The variability analysis of 4 treatments showed isozyme absent or present in some treatment at RF (1.6, 3.4 and 4.0) monomorphic bands common in all tomato plants with percentage 75% and polymorphic specific bands at RF (4.2) with percentage 25% treatment of M. jalapa and C. inerme extracts (Plate, 19). Untreated Infected tomato Bioinducers Y M+Y 3.4 50 4.0 40 +++ 25 ++ 15 ++ 25 ++ 4.2 - - 10 + 15 + 4 bands 3 3 4 + 15 + Bands ++ 20 ++ 25 Bands Bands +++ 15 %Fraction 40 Bands + K %Fraction Bands 10 %Fraction %Fraction 1.6 %Fraction RF Bands M %Fraction plant +++ 35 +++ 60 +++ 40 +++ 55 +++ 65 +++ 4 20 ++ 20 - 144 - Monomorphic Monomorphic + Monomorphic - - Polymorphic 3 3 Monomorphic: common polypeptide. Polymorphic: specific polypeptide. Band density: _ : Absent. +: weak band ++: moderate band. +++: strong band Experimental Results Polymorphism Table (32): Disc-PAGE banding patterns of polyphenol oxidase isozymes of CMV infected tomato plants treated with bioinducers. Plate (19): Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation. H: Healthy. V: infected tomato. M: tomato leaf treated with M. jalapa extract. Y: tomato leaf treated with C. inerme. M+Y extracts: tomato leaf treated with mixture (Mj+Ci) extracts. K: tomato leaf treated with Kombucha filtrate. d. Polyphenol oxidase isozyme in inoculated tomato plants and treated with bioinducers to control CMV (after 25 days of spraying): 1- Activity: Tomato plants treated with bioinducers produced an increase in PPO activity by different unit/g FW. M. jalapa extract was found to be able to induce the highest activity of PPO in tomato (282.5 U/g FW), while the lowest activity was (150.0 U/g FW) in case of C. inerme extract compared with healthy and Inoculated control (160.0, 200.0 U/g FW) respectively, Fig. (27). - 145 - Experimental Results PPO activity (U/g FW) 300 250 200 150 100 50 0 Treatments Healthy c. Inoculated c. M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Fig. (27): Effect of bioinducers on PPO activity in inoculated tomato plants. 2- Polyphenol activity staining: The obtained results of the total number of polyphenol oxidase isozyme produced in tomato plants treated with bioinducers pre-CMV infection was 6 bands, Table (33). The isozyme bands of tomato plants treated with the 4 bioinducers were varied in number and density polypeptide. Bioinducers were induced 5, 3, 5 and 4 polypeptide bands of M. jalapa, C. inerme, the mixture extracts and kombucha filtrate respectively compared with untreated and infected tomato plants appeared 3 and 4 isozymes, respectively. The variability analysis of 4 treatments showed isozyme absent or present in some treatment at RF (1.6, 2.2 and 4.6) monomorphic common in all tomato plant treatment with percentage Experimental Results - 146 - 50%. (3.2 and 4.9 RF) specific bands with percentage 33.3% polymorphic bands appearance may attributed to the influence of each bioinducers treatment on tomato plants, one unique isozyme (Genetic marker) for (1.0 RF) of mixture treatment, (Plate, 20). Table (33): Disc-PAGE banding patterns of polyphenol oxidase isozymes in inoculated tomato plants and treated with bioinducers. + Polymorphism 15 %Fraction - K Bands - Bands %Fraction Bands %Fraction - %Fraction Bioinducers Y M+Y M Bands - 1.0 Bands %Fraction %Fraction RF Bands Untreated Infected plant tomato - Unique 1.6 35 ++ 45 +++ 40 +++ 25 +++ 35 +++ 25 +++ Monomorphic 2.2 40 ++ 15 ++ 15 ++ ++ 30 ++ Monomorphic - 10 + 20 + ++ 30 ++ 10 ++ 55 15 3.2 25 4.6 4.9 - - 6 bands 3 4 20 ++ 20 - - - Polymorphic ++ 20 ++ 35 ++ Monomorphic ++ - 10 ++ 10 ++ 5 3 5 4 Polymorphic Unique: genetic marker monomorphic: common polypeptide.Polymorphic: specific polypeptide. +: weak band. ++: moderate band. +++: strong band. - 147 - Experimental Results Plate (20): Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation. We can conclude that, the bioinducers revealed reproducibility different levels of bicontrol according to the number of protein genetic markers (Table, 34). The result after 7 and 25 days of treatment revealed that, M. jalapa extract has a high level of protein genetic markers followed by C. inerme and mixture extracts, while kombucha filtrate has the low level of protein genetic markers. Experimental Results - 148 - Table (34): Protein genetic markers of tomato plants produced by bioinducers as indication of systemic acquired resistance against CMV infection. M. jalapa Parameters After 7 After 25 days days C. inerme Mixture (Mj+Ci) Kombucha After 7 days After 25 days After 7 days After 25 days After 7 days After 25 days SDS-PAGE 6 2 6 2 4 3 4 1 Peroxidase 1 2 - 2 1 - - - Polyphenol oxidase 1 2 1 - - 1 - 1 Total 8 6 7 4 5 4 4 2 2.3- Photosynthetic pigments content: Virus infection caused marked reduction in Chl a, Chl b and carotenoid contents (0.714, 0.514 and 0.662 mg/g FW), while it was (0.855, 0.761 and 0.742 mg/g FW) in non-infected plants for Chl a, Chl b and carotenoids, respectively. Generally tomato plants treated with Mj, Ci, mixture extracts and kombucha filtrate resulted marked increase in Chl a, Chl b and carotenoid contents after 7 days of spraying. It is recorded (0.926, 0.920, 0.908 and 0.885 mg/g FW) Chl a, (0.780, 0.813, 0.870 and 0.734 mg/g FW) Chl b and (0.793, 0.744, 1.003 and 0.719 mg/g FW) carotenoid respectively. On the other hand, tomato plants treated with Mj, Ci, mixture extracts, kombucha filtrate and infected with CMV showed marked increase in Chl a Chl b and carotenoids after 25 days of spraying. - 149 - Experimental Results The contents were (1.231, 1.236, 1.031 and 1.195 mg/g FW) Chl a, (1.107, 1.110, 1.172 and 1.156 mg/g FW) Chl b and 1.669, 1.491, 1.303 and 1.346 mg/g FW) carotenoids of Mj, Ci, mixture extracts and kombucha filtrate respectively (Table, 35). From the obtained results, the Mj, Ci, mixture extracts and kombucha filtrate treatment exhibited an increase of total chlorophyll pigments and carotenoid contents as a bioinducers. Table (35): Chlorophyll and carotenoid contents in tomato plants treated with bioinducers after CMV inoculation. Chlorophyll content a b Carotenoids Treatments Healthy plants Untreated 0.855 0.761 0.742 Plants inoculated with virus Virus treated 0.714 0.514 0.662 After 7 days 0.926 0.780 0.793 After 25 days 1.231 1.107 1.669 After 7 days 0.920 0.813 0.744 After 25 days 1.236 1.110 1.491 After 7 days 0.908 0.870 1.003 After 25 days 1.031 1.172 1.303 After 7 days 0.885 0.734 0.719 After 25 days 1.195 1.156 1.346 Sprayed with M. jalapa extract Sprayed with C. inerme extract Sprayed with mixture (Mj+Ci) extracts Sprayed with Kombucha filtrate Chlorophyll content = mg/g FW. Experimental Results - 150 - 2.4- Determination of total phenols: Phenols contents in tomato plants were differently affected by tested bioinducers. It is increased in non-infected plants treated with M. jalapa extract and kombucha filtrate (49.24 and 48.41 mg/g FW) total phenols, (29.07 and 24.76 mg/g FW) free phenols and (20.17 and 23.65 mg/g FW) conjugated phenols respectively. While C. inerme and mixture extracts produced low phenol contents (33.56 and 32.70 mg/g FW) total phenols, (16.52 and 18.20 mg/g FW) free phenols and (17.52 and 14.5 mg/g FW) conjugated phenols respectively compared with healthy and Inoculated controls (32.89 and 31.02 mg/g FW) total phenols, (14.24 and 10.35 mg/g FW) free phenols and (20.65 and 20.67 mg/g FW) conjugated phenols respectively (Table, 36). On the other hand, inoculated tomato plants with CMV showed an increase in phenols content after treating with M. jalapa and mixture extracts (12.30 and 11.85 mg/g FW) total phenols, (8.71 and 8.58 mg/g FW) free phenols and (3.59 and 3.27 mg/g FW) conjugated phenols respectively, while kombucha filtrate and C. inerme extract showed little increase in phenols contents (9.65 and 8.41 mg/g FW) total phenols, (7.60 and 6.60 mg/g FW) free phenols and (0.39 and 1.81 mg/g FW) conjugated phenols respectively compared with healthy and inoculated controls (8.14 and 7.65 mg/g FW) total phenols, (7.06 and 6.58 mg/g FW) free phenols and (1.08 and 1.07 mg/g FW) conjugated phenols, respectively. - 151 - Experimental Results Table (36): Free, conjugated and total phenols content in inoculated tomato plants and treated with bioinducers. Treatments Total phenols Free phenols Conjugated phenols Total phenols Free phenols Conjugated phenols After 7 days of spraying After 25 days of spraying Healthy control 32.89 12.24 20.65 8.14 7.06 1.08 Inoculated control 31.02 10.35 20.67 7.65 6.58 1.07 M. jalapa extract 38.59 23.15 15.44 8.60 7.21 2.05 C. inerme extract 31.34 16.92 14.42 8.25 7.56 1.39 Mixture (Mj+Ci) extracts 32.98 23.44 9.55 7.21 6.82 0.69 Kombucha filtrate 41.24 23.57 17.66 8.25 6.80 1.45 2.5- Total free amino acids content in inoculated tomato plants and treated with bioinducers: In this analysis, amino acids content in tomato leaves inoculated with CMV and treated with bioinducers was increased comparing with healthy and Inoculated controls [Table (37) and Fig. (28)]. After 7 days of applying bioinducers, M. jalapa extract and kombucha filtrate recorded the highest amount of total amino acids content in tomato plants (12.22 and 11.82 mg/g FW) respectively followed by mixture and C. inerme extract (9.30 and 7.04 mg/g FW) respectively compared with healthy and Inoculated controls (9.05 and 7.34 mg/g FW) respectively. After 25 days of applying bioinducers, M. jalapa extract and kombucha filtrate produced the highest amount of total amino acids in tomato plants (19.04 and 16.03 mg/g FW) followed by C. inerme extract and mixture extracts (14.29 and 11.49 mg/g FW) Experimental Results - 152 - respectively compared with healthy and Inoculated controls (14.04 and 8.48 mg/g FW) respectively. Table (37): Total free amino acids content in tomato plants treated with bioinducers. Treatments After 7 days of spraying After 25 days of spraying Healthy control 9.05 14.04 Inoculated control 7.34 8.48 M. jalapa extract 12.22 19.04 C. inerme extract 7.04 14.29 Mixture (Mj+Ci) extract 9.30 11.49 Kombucha filtrate 11.82 16.03 Free amino acids content (mg/g FW) 20 18 16 14 12 10 8 6 4 2 0 After 7 days of spraying After 25 days of spraying Healthy control Infected control M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Fig. (28): Effect of bioinducers on total free amino acids in tomato plants infected with CMV. - 153 - Experimental Results 2.6- Total carbohydrates content in inoculated tomato plants and treated with bioinducers: Total carbohydrates in tomato plants were increased by using all tested bioinducers [Table (38) and Fig. (29)]. After 7 days from applying bioinducers, kombucha filtrate and M. jalapa extract produced the highest increase in total carbohydrates content (8.11 and 6.27 mg/g FW) respectively in tomato plants infested with CMV followed by mixture extracts and C. inerme extract (6.8 and 5.95 mg/g FW) respectively comparing with their respective healthy and Inoculated controls (5.05 and 4.12 mg/g FW) respectively. After 25 days from applying bioinducers, M. jalapa and C. inerme extracts produced the highest increase in total carbohydrates content (1.68 and 1.67 mg/g FW) respectively in tomato plants infested with CMV followed by mixture extracts and kombucha filtrate (1.63 and 1.10 mg/g FW) respectively comparing with their respective healthy and Inoculated controls (1.56 and 1.09 mg/g FW) respectively. Table (38): Total carbohydrates content (mg/g FW) in inoculated tomato plants and treated with bioinducers. Treatments After 7 days of spraying After 25 days of spraying Healthy control 5.05 1.56 Inoculated control 4.12 1.09 M. jalapa extract 6.27 1.68 C. inerme extract 5.95 1.67 Mixture (Mj+Ci) extract 6.8 1.63 Kombucha filtrate 8.11 1.10 Experimental Results - 154 - Total carbohydrates content (mg/g FW) 9 8 7 6 5 4 3 2 1 0 After 7 days of spraying After 25 days of spraying Healthy control M. jalapa Mixture(Mj+Ci) Inoculated control C. inerme Kombucha Fig. (29): Effect of bioinducers on total carbohydrates content in tomato plants inoculated with CMV. 3. Effect of bioinducers on virus infectivity: All treatments showed different control degrees as reduction of infection percentage (RI%), when tomato plants were treated post virus inoculation. The M. jalapa extract is the first in this concern (50.0%) followed by C. inerme extract (46.8%) then kombucha filtrate (46.1%), while mixture extracts exhibited the lowest effect (36.6%), compared with non treated control (0.0%) [Table (39) and Fig (30)]. - 155 - Experimental Results Table (39): Effect of individual bioinducers on tomato inoculated with CMV. Treatments Disease incidence % %of R.I. D.S. (%) *Conc. Inoculated control 100.0 0.0 97.5 86.6 M. jalapa extract 50.0 50.0 28.1 25.0 C. inerme extract Mixture (Mj+Ci) extracts Kombucha filtrate 53.1 46.8 36.3 32.2 63.3 36.6 35.4 31.4 53.8 46.1 29.8 26.5 R.I. = reduction of virus infection. D.S. = Disease severity. *Virus concentration was biology assayed as mean numbers of local lesions. 100 Virus infectivity (%) 90 80 70 60 50 40 30 20 10 0 %of infection %of R.I. Inoculated control C. inerme Kombucha D.S. (%) Conc. M. jalapa Mixture (M+Cl) Fig. (30): Effect of bioinducers on CMV infectivity in tomato plants. Experimental Results - 156 - DISCUSSION The objectives of this study were induction systemic acquired resistance in some tomato varieties against virus infection with Cucumber mosaic cucumovirus (CMV). No strategies are currently available to completely protect these plants against the virus. There remains another possibility for the management of this disease which involves the use of biotic inducers of systemic resistance. We try to realize this purpose, many experiments were successively to deducing if induction of systemic acquired resistance was successfully achieved could also protect tomato against infection by CMV. PART I 1- Disease incidence and frequency of virus: Cucumber mosaic cucumovirus (CMV) was more incidence and frequently among 5 viruses found in the all tomato fields surveyed for viral diseases in the 5 locations at Qalyoubia Governorate were for virus infection. So, CMV was chosen as target in this study. These results are in agreement with those previously recorded by many investigators after surveying tomato fields for virus infection (Ganoo and Saumtally, 1999; Elshafie et al., 2005 and Massumi et al., 2009). For example, Yardimci and Eryigit (2006) collected leaf samples from 138 tomato (Lycopersicon esculentum) plants showing symptoms of Cucumber mosaic virus (CMV) in the north-west Mediterranean region of Turkey. The samples were first tested by double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) using CMV specific polyclonal antibody. The DAS-ELISA revealed that Discussion - 157 - 53 of the 138 leaf samples tested were infected with CMV. One of the ELISA-positive CMV isolates was mechanically inoculated into a set of indicator plants by conventional leaf inoculation method for further characterization. In the other study, CMV was the most frequently found viruses, accounting 23.4% of the collected tomato samples in the Southeast and Central Regions of Iran (Michael, 2009). Lin et al. (2010) identified Cucumber mosaic virus (CMV) as the causal agent of several disease epidemics in most countries of the world. Insect-mediated virus diseases, such as those caused by CMV, caused remarkable loss of tomato (Solanum lycopersicon) production in Taiwan. 2- Identification of Cucumber mosaic cucumovirus (CMV): The CMV isolate used in this study was identified based on biological and serological properties. Chenopodium amaranticolor was used as local lesion in all assayed trials. Nicotiana glutinosa showed severe systemic symptoms in the form of severe mosaic and malformation was used as propagative host. The isolated virus have a wide host range of plant species and cultivars, this isolate was shown to infect 11 species and cultivars belonged to 4 families. Eight species and cultivars showed systemic symptoms while only 3 species showed local lesions as local hosts. It is easily mechanical transmitted to healthy susceptible test plants. Also, transmitted in a non-persistent manner by both Myzus persicae and Aphis craccivora from infected tomato (Lycopersicon esculentum) source plants to healthy tomato. In vitro properties were thermal inactivation point is 70°C, dilution end point 10-4 and the virus completely inactivated after 5 days at room temperature Discussion - 158 - (25±3°C). Cytoplasmic inclusions (crystalline and amorphous inclusions) were found in the epidermic cells of the infected leaves. Dot blot immunoassay was used for identification of CMV isolate. Obtained results dealing the isolated virus confirmation were corroboratory with those recorded in the universal virus database of the International Committee on Taxonomy of Viruses (ICTVdb, 2010) online updated to July 2010. PART II Systemic acquired resistance (SAR) and control: If defense mechanisms are triggered by a stimulus prior to infection by a plant pathogen, disease can be reduced. This is the basic theory of induced resistance, one of the most intriguing forms of resistance, in which a variety of biotic and abiotic treatments prior to infection can turn a susceptible plant into a resistant one. Induced resistance is not the creation of resistance where there is none, but the activation of latent resistance mechanisms that are expressed upon subsequent, so-called “challenge” inoculation with a pathogen. Induced resistance can be triggered by certain chemicals, non-pathogens, avirulent forms of pathogens, incompatible races of pathogens, or by virulent pathogens under circumstances where infection is stalled due to environmental conditions. Plant resistance and induced forms of resistance are generally associated with a rapid response, and the defense compounds are often the same. Generally, induced resistance is systemic, because the defensive capacity is increased not only in the primary infected plant parts, but also in non-infected, spatially separated tissues. The SAR defense signalling networks appear to share significant overlap with those Discussion - 159 - induced by basal defenses against pathogen-associated molecular patterns. The nature of the molecule that travels through the phloem from the site of infection to establish systemic immunity has been sought after for decades. Accumulation of salicylic acid (SA) is required for SAR, but only in the signal-perceiving systemic tissue and not in the signal generating tissue. These observations led to the suggestion that systemic acquired resistance (SAR) might provide a new strategy for crop protection, either by discovering compounds that stimulate the plants' natural disease resistance mechanisms, or by developing transgenic plants that constitutively express components of the disease resistance mechanism in order to make them more resistant to pathogen attack (Lancioni, 2008). Upon primary infection or insect attack, plants develop enhanced resistance against subsequent invaders. A classic example of such a systemically induced resistance is activated after primary infection with a necrotizing pathogen, rendering distant, uninfected plant parts more resistant towards a broad spectrum of virulent pathogens, including viruses, bacteria and fungi. This form of induced resistance is often referred to as systemic acquired resistance (SAR) and has been demonstrated in many plant–pathogen interactions (Walter et al., 2007). Firstly, histopathological, histochemical, total RNA and molecular changes between treated and non-treated plants with bioinducers were demonstrated. Comparison between histochemical, total RNA and molecular changes were made after 7 (pre-inoculation) and 25 (post-inoculation) days from spraying with inducers. Virus infectivity was biologically measured to insure of SAR induction. Discussion - 160 - Histopathological Studies: Histopathological changes (as indicator to SAR) in tomato leaf tissues sprayed before 7 days with inducers and pre-virus inoculation were examined. Progressive increasing in lignin accumulation in epidermal cells, number of hairs, thickness of blade, number of xylem arms and phloem layers. The alterations included tissue-shrinkage, intense staining and precipitation of lignin in sub stomatal cavity, mesophyll cell showing folding and layering of cell wall and remains of host palisade cell walls. Histopathological changes simultaneity with elicitation of systemic acquired resistance was tend toward growth enhancement in the sprayed plants with tested bio-inducers than those untreated ones. Foliar application of elicitors showed in most cases a significant increase in plant growth parameters. These increases may be attributed to elicitors effect on physiological processes in plant such as ion uptake, cell elongation, cell division, enzymatic activation and protein synthesis. In this concern, SA enhanced growth of plants. Plants respond to pathogen attack or elicitor treatments by activating a wide variety of protective mechanisms designed to prevent pathogen replication and spreading (Farouk et al., 2008). Passive defenses include the presence of preformed surface wax and cell walls, antimicrobial enzymes, and secondary metabolites. The plant cell wall is the first and the principal physical barrier. This cellulose-rich structure consists of a highly organized network of polysaccharides, proteins, and phenylpropanoid polymers that forms a resistant layer surrounding the cell plasma membrane. Cutin, suberine, Discussion - 161 - and waxes also provide protection through the reinforcement of the epidermal layer of the leaves (Lancioni, 2008). Lignin is a phenolic polymer. It is the second most abundant biopolymer on Earth (after cellulose), and plays an important role in providing structural support to plants. Its hydrophobicity also facilitates water transport through the vascular tissue. Finally, the chemical complexity and apparent lack of regularity in its structure make lignin extremely suitable as a physical barrier against insects and fungi (Vermerris and Nicholson, 2006). Lignins are extremely resistant to microbial degradation and are often induced at sites of pathogen infection, playing important roles in cell wall reinforcement and, consequently, increased defense response against infection. The induction of lignin synthesis or lignin-related genes after virus challenge has been reported in incompatible interactions in herbaceous plants. Lignification is seems to help prevent viral infection (Freitas-Astúa et al., 2007). Total Protein: In this study, total protein including biosynthesis proteins (free, conjugate, pathogenesis-related enzymes, their isozymes and antiviral) was determined with different techniques and many types of proteins were found as response to induction treatments. Proteins have a distinguish role in the resistance to many phytopathogens either before or after pathogen challenged leaves. The quantitative, qualitative and activity of antiviral proteins as protein content, patterns, isozymes of peroxidase and polyphenol oxidase were determined using SDS-PAGE Discussion - 162 - as response to sprayed tomato plants with tested electors pre and post virus inoculation. Quantitative proteins of induced cucumber plants were determined using SDS-PAGE, the results indicated that, a new pattern of proteins were produced, as well as, different increasing in the density of bands among biotic inducers treatments. It has been suggested that, the induced proteins may help to limit virus spread or multiplication (Abu-Jawdah, 1982; Mahmoud, 2000 and Chen et al., 2006). The continuous accumulations of newly-induced proteins may help in the localization of viral infection; the reverse is not true, since the presence of a non significant amount of induced proteins is a necessary condition to the observed systemic infection. Based on current knowledge of the biochemistry of resistance, it can be concluded that SAR results from the expression of several parameters, including changes in cell wall composition and de novo synthesis of phytoalexins and PR (pathogenesis related) proteins. Moreover, the local de novo synthesis of phytoalexins is often related to the induced resistance stage (Walter et al., 2007). Botanical Antiviral (Antiviral protein): The present work was carried out with an objective to Screen promising botanicals Mirabilis jalapa (Nyctaginaceae), Clerodendrum inerme (Verbenaceae) and their mixture for their antiviral activity against CMV in tomato plants. The botanicals may induce resistance or they themselves may act as inhibitors of viral replication. Ribosome Inactivating Proteins Discussion - 163 - (RIPs) and glycoproteins may block the replication sites. A mobile inducing signal may be produced in treated leaves after the botanical resistance inducers bind with the host plant surface. This signal produces virus-inhibiting agent in the entire plant system. Certain low molecular weight pathogenesis related proteins might also playa, role in the induction of systemic acquired resistance. Thus, biologically active compounds present in plant products act as elicitors and induce resistance in host plants resulting in reduction of disease development (Verma et al., 1998). The roots, leaves and stem of Mirabilis jalapa show high inhibitory activity against plant viruses. Verma and Kumar (1980) showed that M. jalapa leaf extract suppressed the disease symptoms on a few systemic hosts when the extract was used! as a foliar spray 24 h prior to virus inoculation. Foliar sprays of the M. jalapa leaf extract caused marked symptom suppression, improved growth and flowering and considerably reduced the virus multiplication rate in cucumber treated against CMV. The aphid and whitefly (Bemisia tabaci) populations were much lower on treated than control plants (Verma and Kumar, 1982). Antiviral protein designated as MAP [Mirabilis antiviral protein, 30 kDa (ribosome inactivating proteins, RIPs)] extracted from roots and leaves of M. jalapa was highly active against mechanical transmission and almost complete inhibition of cucumber mosaic cucumovirus (Kubo et al., 1990). Hersanti (2005) reported that leaf extract of Mirabilis jalapa is one agent induced systemic resistance against the attack of red pepper by CMV. Discussion - 164 - A novel single resistance inducing protein (Crip-31) was isolated and purified from the leaves of Clerodendrum inerme, which is a very potent, highly stable, basic in nature, 31 kDa in molecular mass having hydrophobic residues and induces a high degree of localized as well as systemic resistance against three different groups of plant viruses (i.e. CMV, PVY and ToMV), which differ at their genomic organization and having different replication strategies, infection in susceptible host Nicotiana tabacum. Minimum amount of purified preparation sufficient for systemic resistance induction was ~ 25 µgml−1. The systemic inhibitory activity of the Crip-31 provides protection to whole plants within 40–60 min of its application. The systemic resistance inducing properties of this protein can be of immense biological importance, as it is similar to ribosome inactivating proteins (RIPs) (Praveen et al., 2001). The chemical constituents of the Clerodendrum genus were isolated, identified and biotechnological prospects also characterized. The major chemical constituents present in this genus were identified as phenolics, flavonoids, terpenes, steroids and oils (Shrivastava and Patel (2007). Kombucha tea is never static. New acids and nutrients are constantly created and combined, into ever-changing – though predictable zymurgy (Chen and Liu, 2000). Kombucha contains many different probiotic cultures along with several organic acids, active enzymes, amino acids, anti-oxidants, and polyphenols. Accordingly, anti-infective activity may induce one or more of the following activities: Discussion - 165 - In the mechanism of action for any of the antiviral proteins, there are only tantalizing hints as to where the block occurs in the virus life cycle. The process of virus infection of a plant can be separated into two phases establishment and replication. Events which occur during the establishment phase include initial wounding by abrasion or a vector, cell penetration and virus uncoating. Replication is characterized by the various viral nucleic acid and viral protein synthesis, reassembly of the virion, and subsequent movement into another cell or another part of the plant. Determining effects on establishment or replication by utilizing tissue assay are hampered by the fact that, the period during which the uncoating of the virus inoculum occurs overlaps the initiation of viral protein and nucleic acid synthesis (Goodman et al., 1986 and Matthews, 1991). Considers an inhibitor be an inhibitor of replication of its effective when applied 5 to 8 hours after virus inoculation (Loebenstein, 1972). Four types of antiviral protein activities have been characterized, and some antiviral proteins have been capable of more than one activity. The activities were (1) Aggregation, (2) Inhibition of establishment, (3) Induction of a systemic viral resistant state and (4) Inhibition of replication by inactivation of protein synthesis, cited from Chessin et al. (1995). (1) Aggregation: obviously, aggregation is purely a physical phenomenon, depending on ionic conditions and concentration, (Kassanis and Kleozkowski, 1948 and Kumon et al., 1990). As a resulting the antiviral proteins may able to form a precipitate with virus. Discussion - 166 - (2) Inhibition of establishment: The virus coat proteins (also virus genome) compete with AVP for attachment in cell receptors. Whereas (Mahmoud, 2000) postulated that, the AVP similar to coat protein in amino groups. These cell receptors might be of common importance to both virus and infection RNA in early phases of virus establishment. These sites probably possess a strong affinity for certain amino groups in the AVP show a stronger reactivity in this respect than similar groups in the coat protein similar groups in the coat protein of complete virus or virus RNA. Therefore, AVP may be substitute for the virus particles. It is well known that, amino groups are necessary in virus to preserve its biological activity: This hypothesis was confirmed by amino acid composition for AVP, whereas it had relatively highly content of basic amino acid and lysine. (3) Induced of systemic resistance: several plant viruses induce systemic resistance to virus. A protein virus inhibitory agent (VIA) can be isolated from the resistant tissue (Faccioli et al., 1994). (4) Ribosome inactivation: RIPs (ribosome inactivation proteins) damage ribosomes so that elongation step of protein synthesis in efficiency prevented. Specifically, RIPs depurinate the adenine at position 4324 in mammalian 28S rRNA and position 3017 in plant 25S rRNA rendering the 60S ribosomal subunit in capable of binding EF-2 (Stripe et al., 1992). Generally, RIPs cannot depurinate prokaryotic ribosomes but can modify naked 235 rRNA (Wood et al., 1992 and Endo et al., 1988). Meanwhile, Mirabilis jalapa (Nyctaginaceae), containing a ribosome inactivating protein (RIP) called Mirabilis antiviral protein Discussion - 167 - (MAP), against infection by potato virus X, potato virus Y, potato leaf roll virus, and potato spindle tuber viroid. Root extracts of M. jalapa sprayed on test plants 24 h before virus or viroid inoculation inhibited infection by almost 100%, as corroborated by infectivity assays and the nucleic acid spot hybridization test (Vivanco et al., 1999). MAP was highly effective in inhibiting TSWV at 60% saturation. A minimum concentration of 400µg/ml of MAP was sufficient to inhibit TSWV (Devi et al., 2004). In addition, Mirabilis antiviral protein (MAP) was isolated from roots and leaves of M. jalapa L. which possess repellent properties against aphids and white flies. MAP showed antiviral activity against mechanically transmitted viruses but not against aphid transmitted viruses (Vivanco et al., 1999). Two systemic antiviral resistance-inducing proteins, CIP-29 and CIP-34, isolated from Clerodendrum inerme leaves, for ribosomeinactivating properties. CIP-29 has a polynucleotide: adenosine glycosidase (ribosome-inactivating protein), that inhibits protein synthesis both in cell-free systems and, at higher concentrations, in cells, and releases adenine from ribosomes, RNA, poly (A) and DNA. As compared with other known RIPs, CIP-29 deadenylates DNA at a high rate, and induces systemic antiviral resistance in susceptible plants (Olivieri et al., 1996). Chemical analysis of clavillia (Mirabilis jalapa) was rich in many active compounds including triterpenes, proteins, flavonoids, alkaloids, and steroids. Purified an antiviral proteins from roots, shoots, leaves, fruits, and seeds of M. jalapa are employed for different affections. Thus, information about the reproductive pattern Discussion - 168 - of this culture is important for implementing experimental procedures (Leal et al., 2001). MAPs in clavillia as being effective in protecting economically-important crops (such as tobacco, corn, and potatoes) from a large variety of plant viruses (such as tobacco mosaic virus, spotted leaf virus and root rot virus) (Vivanco et al., 1999). In the present study, applying biotic inducers (M. jalapa, C. inerme, mixture and kombucha) pre- and post- virus inoculation resulted in an increase in bio-chemical components i.e total sugars and total free amino acids content which increased in treated plants to increase the plant tolerant of infection. These results were agreed with (Kahler and Allard, 1981; Coseteng and Lee, 1978 and Doebley, 1989). Kombucha tea contains among its symbiotic structure (bacteria and yeasts) a like-endophytic bacteria named Gluconacetobacter kombuchae sp. nov. can fixing atmospheric nitrogen which utilized for plant growth (Dutta and Gachhui, 2007). Jayabalan et al. (2007) in addition to polyphenolic compounds found that, concentration of acetic acid has reached maximum up to 9.5 g/l in green tea kombucha on 15th day and glucuronic acid concentration was reached maximum up to 2.3 g/l in black tea kombucha on 12th day of fermentation. Köhler and Köhler (1985) observed that glucuronic acid is able to combine with over two hundred known toxins within the plant cell and these included substances absorbed from acidic and radioactive rains and specific chemical groups such as nitrites as well as atmospheric pollutions from the gases sulphur dioxide and ozone. Most surprising was the discovery that Kombucha offers genetic protection so that growth patterns are normalised after disruption by endogenic or exogenic Discussion - 169 - poisons. The implications of this for the survival of many species of plants that have suffered considerable damage as a result of global environmental pollution are remarkable. So, we can transpire an important role of kombucha as bioelictor can be enhanced plant growth and induction systemic acquired resistance (SAR) against phytopathogens. Possibility of using the kombucha as bioantiviral against plant viruses is available now. Enzymes and Isozymes Activities: SAR in cucumber is correlated with increasing in peroxidase activity, as well as polyphenol oxidase (PPO) in N. glutinosa (Ali et al., 2006). In addition, proteins and isozyme polymorphisms are good indicators of response to biotic and abiotic stresses (Doebley, 1989). The time course of accumulation of novel proteins was very essential to accumulate pathogenesis related proteins; such proteins had been found to play a key role in inducing strong systemic resistance in susceptible host against viruses (Devi et al., 2004 and Effmert et al., 2005). Peroxidases (PO) have been found to play a major role in the regulation of plant cell elongation, phenolic compounds oxidation, polysaccharide cross-linking, Indole acetic acid oxidation, cross-linking of extension monomers and mediate the final step in the biosynthesis of lignin and other oxidative phenols. PO and PPO activities were greater in the plants treated with mixtures of rhizobacteria and endophytic bacteria and challenged with viruliferous aphids, compared to control plants. PPO can be induced through octadecanoid defense signal pathway and it Discussion - 170 - oxidizes phenolic compounds to quinines, and the enzyme itself is inhibitory to viruses by inactivating the RNA of the virus. Enhanced PPO activities against disease and insect pests have been reported in several beneficial plant–microbe interactions (Harish et al., 2009). Activities of POD in infected leaves tended to increase during the first phase post-inoculation. After that, POD activities of CMV singly infected leaves declined first. Whereas the activities of CMV and satRNAs co-infected leaves increased till day 30 and declined continuously thereafter (Shang et al., 2009). Salicylic acid as signal for pathogenesis-related proteins: When pathogen infection induces a necrotic lesion many biochemical changes take place. Among these are the induction of the phenylpropanoid pathway which leads to the synthesis of flavonoids and lignins and to the synthesis of SA. The SA is released into the phloem, where it is translocated throughout the plant and is eventually perceived by its target cells, which comprise the leaf mesophyll cells and possibly other cell types. Presumably, SA binds a receptor which transduces the signal, by a process that is apparently independent of protein synthesis, leading to the induction of a number of genes to very high levels in the target cells. The proteins synthesized from these genes then act cooperatively to protect the plant from further infection by other pathogens (Wray, 1992). Salicylic acid (SA) belongs to phenolic group and is ubiquitous in plants. SA is involved in signal transduction, pondering over the plant resistance to stress and generates significant impact on photosynthesis, Discussion - 171 - transpiration, uptake and transport of ions and growth and development. The increases in endogenous levels of SA either paralleled or preceded the increase in expression of PR genes and development of SAR. Salicylic acid SA accumulation is essential for expression of multiple modes of plant disease resistance (Hayat and Ahmad, 2007). SA was measured quantitatively in situ Nicotiana tabacum L. cv. Xanthi-nc leaves inoculated with Tobacco mosaic virus (TMV). The biosensor revealed accumulation of apoplastic SA before the visible appearance of hypersensitive response (HR) lesions (Huang et al., 2006). Present study revealed that endogenous levels of SA were increased as response to spraying with tested bioelicitors especially kombucha. The rapid accumulation of salicylic acid after Cucumber mosaic virus inoculation leads to increase in activity of enzymes known to be involved with systemic acquired resistance such as phenylalanine ammonialyase, and peroxidase. Salicylic acid is assumed to be the systemic signal molecule that induces synthesis of pathogenesis-related proteins and/or other components of systemic acquired resistance. Salicylic acid activates resistance mechanisms such as phytoalexin production, lignification. proteinase inhibitors, Phenylalanine cell wall ammonialyase strengthening (PAL) catalyses and the deamination of phenylalanine to produce transcinnamic acid, the first step in controlling the rate of phenylpropanoid metabolism. The production of phenylpropanoid compounds is important in plant development, plantmicrobe signalling and plant defense. Peroxidase (POX) enzymes Discussion - 172 - involved in the oxidation of phenols to more toxic quinones, are known to increase in several infected plants (Sudhakar et al., 2007). Salicylic acid (SA) application on tobacco enhanced the resistance to CMV and the resistance was shown to be due to inhibition of systemic virus movement. Induction of resistance to CMV occurred via signal transduction pathway that may also be triggered by antimycin A, an inducer of the mitochondrial enzyme alternative to oxidase (AOX). In A. thaliana inhibition of CMV systemic movement was also induced by SA and antimycin A. In squash (Cucurbita pepo), SA-induced resistance to CMV was attributed to the inhibition of virus accumulation in directly inoculated tissue most likely through inhibition of cell-to-cell movement. Different host plant species may adopt markedly different approaches to tackle infection by the same virus. It is essential that adequate caution has to be exercised, while attempting to apply findings on plant-virus interactions from model systems to a wider range of host species (Mayers et al., 2005). The obtained result from quantification of endogenous SA using HPLC in induced tomato plants were agreed with percentage of infection, disease severity and CMV concentration. The same trend was observed by many authors (Vernooij et al., 1995; Dong and Beer, 2000; Mahmoud, 2003; Abo El-Nasr et al., 2004; Megahed, 2008 and Taha, 2010). An increase in endogenous salicylic acid in tobacco infected with TMV caused a hypersensitive response with systemic induction of PR proteins (Yalpani et al., 1991). Raskin (1992) found that, it is Discussion - 173 - possible that SA is an endogenous messengers that activities important element of host resistance pathogens. Endogenous SA is a key signal, involved in the activation of plant defense responses to fungal, bacterial and viral attacks. Classical studies performed on tobacco plants, infected with tobacco mosaic virus (TMV) demonstrated a substantial SA accumulation in these plants, an acquirement of resistance to subsequent infection, and the development of systemic resistance in these plants. In 1990s, a correlation was found between SA content in plants and their resistance to the virus. A necessity of SA for the development of plant resistance to TMV was substantiated by using transgenic plants. Later, the involvement of SA in the development of plant resistance to other pathogens was also shown. Plant treatment with SA is one of the most efficient ways to protect plants against unfavorable biotic and abiotic environmental factors (Hayat and Ahmad, 2007). Photosynthetic pigments: Photosynthetic pigments content were positive markedly affected as result to using the four tested bioelicitors and became one of visible evidence of sufficient of treatments. The Chl a and b contents slightly increased with the growth of N. glutinosa, irrespective of infected N. glutinosa with CMV. There was no great difference in Chl a and b contents between infected or healthy leaves after the first week of virus infection, however, 30 days after virus infection, the infected leaves had a significantly lower Chl content compared to healthy leaves. Meanwhile, the Chl a/b was not Discussion - 174 - significantly influenced by viral infection. Chl content was higher in CMV infected leaves by using both satRNAs together than by using single satRNA (Shang et al., 2009). Repression in gene expression was also observed for some transcripts that code for the key chlorophyll synthesis enzymes protoporphyrin IX magnesium chelatase and glutamyl-tRNA reductase (GluTR) suggesting that, as expected, the presence of the virus has influence on photosynthesis as well, even before the appearance of macroscopic symptoms (Freitas-Astúa et al., 2007). These results are in harmony with the study carried by Farouk et al. (2008) who recorded that, the application of elicitors increased the total chlorophyll content of the cucumber plants. This increment may be due to stimulating pigment formation and enhancing the efficacy of photosynthetic apparatus with a better potential for resistance and decrease in photophosphorylation rate usually occurring after infection. Elicitors were found to increase potassium content, which may increase the number of chloroplasts per cell, number of cells per leaf and consequently leaf area. SA increased significantly photosynthetic pigments content. Moreover, SA proved to decrease ethylene production and subsequently increased chlorophyll, and activated the synthesis of carotenoids which protect chlorophyll from oxidation and finally increased chlorophyll content as reported in this study. In fact, in a compatible host-pathogen interaction, studying the upregulated genes is very important, but a careful review of repressed ones can be relevant as well. The repressed genes can lead to important cues to understanding viral interference in plant metabolism in order to establish Discussion - 175 - an adequate environment for the development of the disease. Repression of genes involved in chlorophyll synthesis has been found not only in plants undergoing biotic, but also abiotic- such as cold-stress. Similarly, it has been shown that enzymes involved in the photorespiratory pathway, may play an important role in the response not only to biotic, but also to abiotic stress (Freitas-Astúa et al., 2007). It appeared from our results that biotic inducers treatment induced tomato plants for increasing total chlorophyll pigments and carotenoids contents as an indication of systemic acquired resistance and help infected tomato plants to tolerant the virus infection (as bioinducer agents), while M. jalapa extract and kombucha filtrate gave the high content of chlorophyll pigments and C. inerme and mixture extracts gave the lowest chlorophyll content in two cases. In order to examine the effect of used inducers on the plant challenged with the virus chlorophyll content was analyzed result in increasing the percentage of chlorophyll a, b and carotenoids related to healthy plants may be due to that biotic inducers induce signal suppress or inhibit virus replication and reduce its spread. Many plant infections are the cause of localized changes in chloroplasts and modify their structures and function (Zaitlin and Hull, 1987 and Galal, 2006). The effect of pathogens on chloroplasts and cellular processes might be translated into effects on growth and yield through shifts in carbohydrate metabolism, source-sink relationships, biomass partitioning between roots and shoots, etc (Balachandran et al., 1997). Discussion - 176 - Chlorophyll lowering was noticed more in a than b in treated plants comparable to the untreated which mean that virus infection lead to destroy chlorophyll a at the expense of b. The decrease in chlorophyll is considered to be a symptom of oxidative stress condition this decrease after virus infection might be due to the generation of reactive oxygen species (ROS) causing damage to chlorophyll a that is mean the plant failed to capture the light and so photosynthesis will decrease or stopped (Ali et al., 2006). Phenolic compounds: Usually increased as response to plant defense against pathogens or as elicitation by some biotic and abiotic inducers. In this study, phenol contents were increased after treatments of M. jalapa extract and kombucha filtrate, C. inerme and mixture extracts either before or after inoculation with tested virus isolate. Phenolic acids are generally not abundant in most plants. There are a few exceptions: gallic acid and salicylic acid (SA). Gallic acid is a precursor for the ellagitannins and gallotannins. Salicylic acid is an important defense compound because it mediates systemic acquired resistance (SAR), a resistance mechanism whereby SA is used as a signaling molecule to relay information on pathogen attack to other parts of the plant. Upon receiving the SA signal, a general defense response is activated that includes the biosynthesis of pathogenesisrelated (PR) proteins (Vermerris and Nicholson, 2006). Plants have several lines of defense against invading pathogens including preformed barriers and induced responses. Systemic acquired Discussion - 177 - resistance is characteristically associated with accumulation of salicylic acid, enhanced expression of pathogenesis-related proteins and activation of phenylpropanoid pathway, leading to the synthesis of higher phenolic compounds. Phenolics have been associated extensively with the defense of plants against microbes, insects and other herbivores. A number of phenols are regarded as pre-infection inhibitors, providing the plant with a certain degree of basic resistance against pathogenic micro-organisms. Phenol metabolism and cell wall lignification are thus involved in, and have consequences for, a number of cellular, whole plant and ecological processes, that might even provide plants, the immunity against destructive agents. Several associations have been reported between phenolics and the resistance of plants to pathogen. Phenolic acids are involved in phytoalexin accumulation, biosynthesis of lignin and formation of structural barriers, which play a major role in resistance against the pathogen (Sudhakar et al., 2007). It can be easily imagined that, the antimicrobial products of peroxidase restricts the development of challenging Cucumber mosaic virus. Peroxidase also catalyses the condensation of phenolic compounds into lignin and is associated with disease resistance in plants (Hammerschmidt et al., 1982). Discussion - 178 - Amino acids: Amino acids are the smallest unit in protein structures. The primary structures of a protein defines the sequence of the amino acid residues and is dictated by the base sequence of the corresponding gene(s). Phenolic compounds, enzymatic activity and pathogenesisrelated (PR) proteins are closely related with amino acids. Production of a new and more amino acids as result to using biotic inducers were achieved in this study. It has become clear that there is yet another systemic resistance phenomenon in plants: RNA silencing. In contrast to SAR and ISR, RNA silencing is highly specific with respect both to its induction and activity. RNA silencing is a homology-based RNA degradation mechanism that probably occurs in all eucaryotes, including plants. In plants, it appears to function, at least in part, as a defense mechanism against viruses (Gilliland et al., 2006). Nucleic Acids: There are many types of RNAs in the cells of the plant especially after infection with phytopathogens (fungi, bacteria and viruses). Some of these closely related with viruses or viroids or virusplant interactions. RNA with different sequences was a rise as product of many physiological processes. In this study, mRNA from plant cells was induced and elicited pathogenesis-related (PR) proteins during the induction of systemic acquired resistance (SAR) as response to spraying tomato plants with the tested biotic inducers before virus-inoculation. Discussion - 179 - Nine classes of mRNAs that accumulate to high levels in uninfected leaves during the induction of SAR in tobacco have been identified. The leaves of several plants were pooled and RNA was extracted. The accumulation of mRNA for PR-1 acidic, PR-1 basic, class I, II and III glucanase, class I, II, III and IV chitinase, PR-4, PR-5, SAR8.2 and the lignin-forming peroxidase was determined in these samples by northern blot analysis. Within 2-4 h after SA treatment RNA accumulation was dramatically increased for PR-1 acidic, PR-1 basic, class II and III glucanase, class II, III and IV chitinase. PR-4, PR-5 and SAR8.2. There was not a consistent increase in the mRNA for class I glucanase, class I chitinase or the lignin-forming peroxidase (Wray, 1992). Experiments with Tobacco mosaic virus (TMV) and Potato virus X (PVX), leaf disks which had been pretreated with SA reduced the overall accumulation of viral RNA. In tobacco and Arabidopsis, the defense signal transduction pathway branches downstream of SA which triggers induction of resistance to DNA and RNA viruses (Harish et al., 2009). Molecular marker for SAR: Hooft Van Huijsduijnen et al. (1986) stated that, in at least 16 plant species, the hypersensitive response to virus infection is accompanied by the de novo synthesis of 'pathogenesis-related' (PR) proteins. The association of these proteins with systemic acquired resistance led to the suggestion that they function in a defence mechanism. This hypothesis is supported by spraying tobacco plants with Discussion - 180 - salicylic acid or acetylsalicylic acid that induces both the synthesis of PR proteins and resistance to infection with tobacco mosaic virus (TMV). Moreover, a tobacco hybrid that produces PR proteins constitutively is highly resistant to TMV infection. To learn more about the functions of PR proteins, we cloned and sequenced DNA copies of the mRNAs for the PR-1 proteins of tobacco. This revealed a 90% amino acid sequence homology between PR-la, -lb and -lc, and showed that PR-1 proteins are derived from precursors by removal of a signal peptide of 30 amino acids. This is consistent with the observation that PR proteins accumulate in the intercellular spaces of the leaf. A 14000 mol. wt. (14K) protein of tomato (p 14) which is induced by infection with TMV or viroids has a 60% amino acid homology with the tobacco PR-1b protein. An antiserum against p14 was shown to cross-react with tobacco PR-1 proteins and a PR protein from cowpea, indicating that PR proteins from different plant species may be closely related. Our working hypothesis has been that genes responsible for maintaining an induced resistant state would be expressed at all in healthy, uninduced tissue, and their expression would increase concomitantly with the onset of SAR. We refer to genes that would fulfill these criteria as SAR genes. To determine which of the isolated cDNAs represented SAR genes, their expression was correlated with the onset of SAR. Molecular and biochemical results revealed that the mRNAs for this gene began to accumulate after one day of treatment and reach to high levels at 6th day. This mRNA was expressed in untreated and treated plants but increased about two folds in treated plant. PCR Discussion - 181 - approach allowed us to correlate the expression of PR-1a gene with the early stage of ISR formation, so samples of treated tomato plants with four biotic inducers were taken after 7 days treatment to correlate the onset of ISR with the induction of gene expression. RT-PCR of mRNA PR-1a gene isolated from tomato plants treated with biotic inducers was used to amplify a fragment of about (182 bp) using primers according to Van Loon (1999). In the present study, PR-1a mRNA accumulation was examined in a time course experiments during the early stage of filtrate, the expression pattern was investigated by using PCR approach this method which is more sensitive, allowed the examination of the expression of PR-1a gene through the use of specific primers. PR-1a elicited gene was molecularly detected via RT-PCR and sequenced, then identified compared with the related genes in the Gen-Bank. The six SAR-related gene families include pathogenesis-related protein 1 (PR-1), (3-1,3-glucanases, chitinases, protease inhibitors, pathogenesis-related protein 4 (PR-4) and SAR8.2. The PR-1 family comprises at least four members that can be grouped into two classes. Class I includes the acidic, extracellular proteins PR-la, PR-lb and PRlc. Class II includes the basic isoform of these proteins which has only one species identified so far. The function of the PR-1 family is currently unknown; however, a wealth of data concerning the characterisation and localisation of the protein, as well as studies on the PR-1 gene family and its regulation of expression, have been dealt with in recent reviews (Wray, 1992). Discussion - 182 - Many conditions have been described to induce SAR as well as defence related proteins. Particularly, the expression of a PR-1 gene or protein is usually taken as a molecular marker to indicate that SAR was induced. All PR-1 genes in plants appear to be inducible by SA, and endogenous production or exogenous application of SA has been shown to be both necessary and sufficient to elicit the induced state. Pathogen induced synthesis of SA in tobacco is considered to occur from benzoate, whereas the evidence in Arabidopsis points to isochorismate as the immediate precursor (Walter et al., 2007). Plants are challenged by a variety of abiotic and biotic stresses. The differential activation of distinct sets of genes or gene products in response to these challenges is referred to as specificity. SA is a key regulator of pathogen-induced systemic acquired resistance (SAR). The SA involved plant defense responses are characterized as species specific. Even in two phylogenetic closely related plant species such as tomato and tobacco, the SA-dependent defense pathway does not trigger the same defense responses (Peng et al., 2004). In case of viruses, SA promotes the inhibition of viral replication, cell-to-cell movement and also long-distance movement. SA has been shown to modulate HR-associated cell death, reactive oxygen species (ROS) level, activation of lipid peroxidation and generation of free radicals, all of which could potentially influence plant defense against pathogens. SA at low concentrations also promotes the faster and stronger activation of callose deposition and gene expression in response to pathogen or microbial elicitors, a process called 'priming', which contributes to induced defense mechanisms. The increases in endogenous Discussion - 183 - levels of SA either paralleled or preceded the increase in expression of PR genes and development of SAR. Elevated levels of SA and constitutive expression of the PR genes also correlated with elevated resistance to TMV in a Nicotiana glutinosa x N. debneyi hybrid (Hayat and Ahmad, 2007). Plant responses to pathogens are a multilayer network of defence reactions, which try to limit and eventually stop the invading microbial pathogen. The reactions include the rapid generation of reactive oxygen species, cross-linking of cell wall polymers, the production of antimicrobial pathogenesis-related proteins, and low molecular weight phytoalexins. The network of responses requires common signalling pathways and one key compound is salicylic acid (SA). When invaded by pathogens, resistant plants induce defence reactions both locally and in distant organs. Of interest in this study is the regulation of gene expression by SA and its analogues which are useful tools for elucidating SA-signalling pathways (Eichhorn et al., 2006). Carbohydrates and carbohydrate complexes: Carbohydrates and carbohydrate complexes, beside other polymers make the supported cytoskeleton of the plant cells, as well as binding with proteins to form glycoproteins which referred to as post-translational modification during biosynthesis of proteins. Numerous reports have indicated that carbohydrate metabolism in the source leaf is influenced by viral infection. Infected source leaves are usually characterized by a decrease in the concentration of soluble sugars, and often starch accumulation. Changes in the capacities of enzymes in Discussion - 184 - various metabolic pathways have been measured during infection of cotyledons of Cucurbita pepo L. with Cucumber mosaic virus (CMV). CMV infection significantly altered carbohydrate metabolism, with a sharp increase in the concentrations of soluble sugars observed in the infected leaves. These changes were associated with a decrease in leaf starch content. An increase in reducing sugars and a reduction in starch content due to CMV-induced higher starch hydrolase and lower ADPGlc pyrophosphorylase activities. It has been proposed that the inhibition of starch accumulation or starch degradation is probably due to the increased demand for soluble sugars required to maintain the high respiration rate (Freitas-Astúa et al., 2007). Virus infectivity: The first criterion to judge the occurrence of SAR in tomato plants treated with biotic inducers. The reduction of percentage of infection, four inducers were able to reduce number of CMV infected tomato plants. The antiviral activity was assayed by the number of lesions on the indicator leaf. The reduction in the number of lesions indicated the resistance of the plant to the virus. The obtained results showed that four biotic inducers reduce the CMV infection at range 24.0-50.0% by percentage related to (M. jalapa extract) (76.0%), (C. inerme extract) (60.0%), mixture extracts (50.0%) and (kombucha filtrate) (59.2%). The same results were obtained by many authors (Raupach et al., 1996; Zehnder et al., 2000; Helmy and Maklad, 2002; Jetiyanon and Kloepper, 2002 and Megahed, 2008). Discussion - 185 - The obtained results supports that use of botanicals can be useful strategy to reduce the incidence of viruses. The botanicals may induce resistance or they themselves may act as inhibitors of viral replication. Thus, biologically active compounds present in plant products act as elicitors and induce resistance in host plants resulting in reduction of disease development. Plant immunity: In the last twenty years the plant immune system has become a primary topic for Plant Science: inducing forms of resistance in plants through processes of immunization, or genetically engineering a cultivar in order to express resistance factors to a particular pathogen, are not challenges anymore, but real scenarios for plant defense (Stuiver and Custers, 2001). Plants have evolved several layers of immunity that recognize pathogen-associated molecular patterns or pathogen effector molecules (or their altered host targets) through receptors, such as receptor kinases containing a leucine-rich repeat domain or resistance proteins containing a nucleotide-binding site and leucine-rich repeats. This alarm system activates pathogen-associated molecular pattern-triggered immunity (non-host/basal resistance) or effector-triggered immunity (resistance gene-mediated resistance), respectively. Both forms of resistance are associated with physiological changes in the infected cells, such as a rapid increase in reactive oxygen species, ion fluxes, the accumulation of salicylic acid (SA), the synthesis of anti-microbial phytoalexins and the induction of defense-associated genes, including several families of pathogenesis-related genes. These immune responses also are often associated with programmed cell death at the sites of pathogen entry, Discussion - 186 - which leads to the formation of necrotic lesions; this phenomenon is known as the hypersensitive response. In addition, the uninfected portions of the plant frequently develop SAR, which is accompanied by increases in SA levels and heightened pathogenesis-related gene expression. Systemic acquired resistance (SAR) in plants is a state of heightened defense that provides long-lasting, broad spectrum resistance to microbial pathogens and is activated systemically following a primary infection. In many aspects, SAR resembles the immune response in animals, which is composed of both innate and adaptive components. The immediate, innate response is nonspecific and mediated by humoral, chemical, and cellular barriers, whereas the adaptive immune system involves the recognition of specific “non-self” antigens in the presence of “self”; this allows the development of immunologi-calmemory. However, plants lack mobile defender cells and instead rely on the innate immunity of each cell, which can be activated in uninfected tissues by systemic signal(s) originating from the site of infection. A number of studies have provided important insights into the immune response occurring in infected plant cells (Park et al., 2009). Plants possess an immune system to defend themselves against pathogen infection. An intensively studied inducible immune response occurs when a pathogen carrying an avirulence (avr) gene is recognized directly or indirectly by a cognate resistance (R) gene in the plant. This leads to activation of defenses that restrict pathogen growth in infected tissues and in non-infected tissues by a process referred to as systemic acquired resistance (SAR) (Brodersen et al., 2005). Discussion - 187 - SUMMARY This study was conducted at Plant Pathology Lab. and Greenhouses of Botany Dept., Fac. of Agric., Moshtohor, Banha Univ. and Virology Lab., Microbiology Dept., Fac. of Agric., Ain-Shams Univ. During 2007/2008 and 2008/2009 growing seasons, different tomato fields at Qalyoubia Governorate were surveyed for viruses infections. Part I Through, the assessment of disease incidence and severity, Cucumber mosaic cucumovirus (CMV) was the dominant one among the tomato viruses in the surveyed fields. Identification of isolated virus (CMV) was achieved using host range, transmissition, stability in sap, inclusion bodies and confirmed via Dot blot immunoassay (DBIA). Obtained results dealing CMV confirmation was completely agreement with the previous confidential recording. Therefore, many experiments were successively to deducing if induction of systemic acquired resistance against CMV was successfully achieved under greenhouse and open field of tomatoes using four biotic inducers or not. Part II The effects of four inducers (three botanical extracts and kombucha filtrate) in induction systemic resistance (SAR) in tomato plants against CMV were detected via study the histopathological; biochemical [dealing antiviral proteins (protein content, qualitative protein, activity and isozyme of peroxidase and polyphenol oxidase)]; - 188 - Summary and Conclusions phytochemically [salicylic acid level, chlorophyll, phenols, total amino acids, total carbohydrate contents] changes and detection molecular marker of PRs gene. Virus infectivity was biologically measured (disease incidence and severity and concentration of virus). Firstly, SAR induction was check after performed the following experiments which summarized as: 1- Histopathological changes in tomato leaves sprayed with biotic inducers, tissue alterations were observed as progressive increase in lignin accumulation in epidermal cells, number of hairs, thickness of blade, number of xylem arms and phloem layers. The alterations included, also, tissue-shrinkage, intense staining, and precipitation of lignin in sub stomatal cavity, mesophyll cell showing folding and layering of cell wall and remains of host palisade cell walls. 2- Antiviral proteins as indicate on elicitations by inducers were assessed after 7 days from spraying via protein content, patterns, activities which markedly increased in treated tomato plants than non-treated ones. In this concern, kombucha filtrate was superior, but mixture extracts was the lowest compared with healthy control. After 25 days from spraying with inducers and inoculated with CMV, also plants treated with kombucha filtrate produced the highest values of proteins, while lowest produced as response to C. inerme extract compared with healthy ones. Electrophoretic for proteins using SDS-PAGE showed new protein bands with Summary and Conclusions - 189 - 3- molecular weight previously known for antiviral proteins were elicited by M. jalapa, C. inerme extracts and kombucha filtrate. Peroxidase (POD) were markedly increased as result to mixture extracts treatment, while polyphenol oxidase (PPO) increased as result to M. jalapa extract treatment when tomato plants were sprayed with inducers post-inoculation with CMV. Kombucha filtrate elicited peroxidase isozyme in tomato noninoculated with CMV, followed by the mixture extracts, while post-inoculation M. jalapa extract was induced highest activity of POD and lowest increase caused by C. inerme extract. Polyphenol oxidase isozyme was highly activated with M. jalapa extract, followed by C. inerme extract, then the mixture of them. 4- Total salicylic acid was quantitatively determined in the tomato plant sprayed with bioelicitors pre-inoculated with CMV. SA was increased in the treated plants than non-treated, and HPLC showed high levels of SA were elicited via kombucha filtrate, followed by C. inerme, M. jalapa, and the mixture extracts. 5- Photosynthetic pigments content (as Chlorophyll a, b plus carotenoids) were reduced, generally in infected plants than healthy ones. But, when tomato treated with the tested elicitors pre-inoculation, Chl a, Chl b and carotenoids were increased as result to spraying with M. jalapa, C. inerme, mixture extracts and kombucha filtrate. The same trend was - 190 - Summary and Conclusions observed when inoculated plants were treated with the same order of elicitors. 6- Phenols contents, was increased in the non-inoculated plants and treated with biotic inducers. The highest increase of total, free and conjugate phenols were induced by M. jalapa extract and kombucha filtrate, while lowest increase were recorded by C. inerme and mixture extracts compared with control. Postinoculation, all phenol contents were increased as response to treatments with M. jalapa, mixture extracts, kombucha filtrate and C. inerme, respectively. 7- Total RNA values (µg/g) were high in the non-inoculated but treated tomato leaves with kombucha filtrate, M. jalapa extract, followed by C. inerme extract then mixture extracts. 8- Molecular marker for SAR detection was achieved using RT- PCR to amplify of the PR-1a gene which elicited with bioinducers in the tomato plants pre-inoculated. PR-1a gene was isolated and molecularly sequenced and identified compared with the related genes in the Gen-Bank. 9- Virus infectivity was determined to insure that systemic acquired resistance is achieved. Reduction in the disease severity percentage was recorded as result to spraying tomato plants with bioelicitors (M. jalapa extract, followed by C. inerme extract, kombucha filtrate then mixture extracts) then inoculated with CMV. Also, concentration of the virus was biologically assayed as means of local lesions. Summary and Conclusions - 191 - Secondly, after insure that the tested inducers were elicited systemic acquired resistance against CMV in tomato plants under greenhouse conditions, another experiments were performed using the tested elicitors as biocontrol agents spraying on inoculated plants and results were summarized as: 1- Histopathological changes as response to SAR induction was examined in the inoculated tomato leaves and sprayed with bioelicitors using light microscope. Generally, noticed that treated plants were stronger in their growth than non-treated plants as result to the increase in lignin precipitation, numbers of xylem arms, phloem layers, skin hairs and increasing thickness of cell wall, and blade. Infected plants showed plasmolysis in the mesophyll cells, cell walls collapsed and plastids become deformed and swollen a loss of orientation along the inner cell wall. These alterations were intensified with progressive tissue-shrinkage and desiccation causing the walls of the palisade and spongy parenchyma to fold in a layering fashion as well as reduction in vascular bundles. 2- Antiviral proteins as one of the protein contents and product of induction process were increased in the inoculated plants especially when sprayed with kombucha filtrate, while lowest increase due to mixture extracts. After 7 days of spraying, protein bands via variability analysis appeared 12 protein bands, 11 in tomato plants treated with M. jalapa extract, 10 by C. inerme extract and 8 for both mixture extracts and kombucha filtrate, while non-treated and infected plants gave only 4 and 7 - 192 - Summary and Conclusions protein fractions. Meanwhile, after 25 days proteins content and enzymes activity were markedly increased as result to spraying with M. jalapa extract, lowest increase via C. inerme extract compared to control. Variability analysis appeared 8 protein bands, 7 in mixture extracts, 6 in C. inerme extract, and 5 in both M. jalapa extract and kombucha filtrate treatments. Highest peroxidase and its isozyme activities was induced by M. jalapa extract, and lowest by C. inerme extract after 7 days of spraying. After 25 days, kombucha filtrate induced highest peroxidase activity, followed by M. jalapa extract, mixture extract then C. inerme extract. Peroxidase isozyme activity was arranged as treatments of M. jalapa, C. inerme, mixture extracts and kombucha filtrate, while polyphenole oxidase isozyme was highest activity in kombucha filtrate treatment, followed by M. jalapa extract, then lowest increase with other treatments. After 7 days, polyphenole oxidase activity was similar to peroxidase isozyme, while after 25 days polyphenole oxidase isozyme was highest activity in M. jalapa extract treatment, followed by kombucha filtrate, mixture extracts, but decreased in C. inerme than control. Variability analysis of polyphenole oxidase isozyme showed 5, 3, 5 and 4 polypeptide bands of M. jalapa, C. inerme, the mixture extracts and kombucha filtrate, respectively. The result after 7 and 25 days, highest level of protein genetic markers induced by M. jalapa extract followed by C. inerme and mixture extracts, while Summary and Conclusions - 193 - kombucha filtrate induced low level of protein genetic markers. 3- Photosynthetic pigments content (as Chlorophyll a, b plus carotenoids) were reduced, generally in infected plants than healthy ones. But, when tomato treated with the tested elicitors pre-inoculation, Chl a, Chl b and carotenoids were increased as result to spraying with M. jalapa, C. inerme, mixture extracts and kombucha filtrate. The same trend was observed when inoculated plants were treated with the same order of elicitors. 4- Total phenols, was increased in the non-inoculated plants and treated with biotic inducers. The highest increase of total, free and conjugate phenols were induced by M. jalapa extract and kombucha filtrate, while lowest increase were recorded by C. inerme and mixture extracts compared with control. Post- inoculation, all phenol contents were increased as response to treatments with M. jalapa, mixture extracts, kombucha filtrate and C. inerme, respectively. 5- Total free amino acids content were determined in inoculated tomato leaves then sprayed with bioagents. After 7 days from spraying, M. jalapa extract and kombucha filtrate recorded the highest amount of total amino acids, followed by mixture and C. inerme extracts. While, after 25 days from spraying, M. jalapa extract and kombucha filtrate produced the highest amount of total amino acids, followed by C. inerme and mixture extracts compared with control. - 194 - Summary and Conclusions 6- Total carbohydrate content was increased after 7 days from spraying inoculated tomato leaves with kombucha filtrate and M. jalapa extract, followed by mixture and C. inerme extracts. After 25 days, M. jalapa and C. inerme extracts produced the highest increase in total carbohydrates content, followed by mixture extracts and kombucha filtrate compared with control. 7- Virus infectivity was determined as indicator of control. Reduction in the disease severity percentage was recorded as result to spraying tomato plants with M. jalapa extract, followed by C. inerme extract, kombucha filtrate then mixture extracts compared with control. Also, concentration of the virus was biologically assayed as means of local lesions. Highest inhibition of virus infectivity due to M. jalapa extract, kombucha filtrate, mixture extracts and C. inerme extract compared with control. Summary and Conclusions - 195 - CONCLUSIONS The objectives of this study were isolation and identification of the most frequently and economically viruses causing serious losses in tomato crop in the different location of Qalyoubia Governorate, evaluating some medicinal plant extracts and kombucha filtrate as biotic inducers to induction systemic acquired resistance in the tomato plants against CMV and using more effective bioinducers as bioelicitors for control viruses infection via induction 'pathogenesis-related' (PR-1a) genes. Target virus was chosen according to its more frequently and severity among the isolated viruses in these locations at the winter season from the study year. Isolated virus was confirmed biologically and serologically assays. Extracts of two medicinal plants (Clerodendrum inerme L. Gaertn and Mirabilis jalapa L.) and were individually or in mixture in addition to kombucha filtrate were evaluated as bioinducers. All the four inducers were successfully in the induction of systemic acquire resistance (SAR) in the uninoculated tomato plants and sprayed with (50% v/v) of inducers. Tested bioinducers were used as biocontrol to inhibiting the virus infection of tomato plants as spraying every 15 days under greenhouse conditions. Pathogenesis-related (PR-1a) gene was molecularly isolated and identified via sequencer which compared with those recorded in the Gen-Bank. In conclusion, using medicinal extracts and other natural inducers were promise with good systemic acquired resistance against the great numbers of plant pathogens. In future, induction of resistance can be done cheaply and easily using natural substances. - 196 - Summary and Conclusions RECOMMENDATIONS This study can be recommended, for obtained healthy tomato plants and reduced crop losses, with the following: 1- Periodicity explore the tomato plants from sowing date until harvested and eliminate any plants exhibited virus-like symptoms and burn them. 2- Surrounded the small cultivated area (for seed production or breeding program searches) with enclosure of Mirabilis jalapa L. plants as an embellishment plant which release volatile substances work as antifeedant for numbers of pest insects (as virus vectors). 3- Soak the root system of tomato seedlings in the 50% of the following inducers, and spraying tomato plants every 15 days with 50% of water extracts of both Clerodendrum inerme and Mirabilis jalapa or their mixture, or kombucha filtrate from transplanting date to harvest. Summary and Conclusions - 197 - REFERENCES Abd El-Kader, M.A.M. (1983): Studies on certain diseases of soybean. Ph.D. Thesis, Fac. of Agric. Assiut Univ. Abdul Magid, A. (1990): Studies on the host range and transmission of an isolate of Cucumber Mosaic Virus. East African Agricultural and Forestry Journal, 56, No 1-4. Abo EI-Nasr, M.A.; El-Dougdoug, Kh.A.; El-Kattan, M.H. and Salem, E.A. (2004): Induction of salicylic acid in cucumber against ZYMV potyvirus by some nutrient chemicals. Egyptian. J. Virol., 1:301-312. Abu-Jawdah, Y. (1982): Changes in the soluble protein patterns of bean leaves upon fungal or viral infections after chemical injury. Phytopathologia meditterranea, 103: 272-279. Ahmad, G.A. (2004): Using plant extracts to control powdery mildew disease that attack cucumber plants under protected houses. M. Sc. Fac. of Agric., Moshtohor. Zagazig Univ., Benha Branch 170pp. Akhtar, K.P.; Ryu, K.H.; Saleem, M.Y.; Asghsr, M.; Jamil, F.F.; Haq, M.A. and Khan, I.A. (2008): Occurrence of Cucumber mosaic virus subgroup IA in tomato in Pakistan. Journal of Plant Disease and Protection, 115(1): 2-3. Ali, A. and Kobayashi, M. (2010): Seed transmission of Cucumber mosaic virus in pepper. J. of Virology Methods, 163: 234-237. Ali, S.H.; Eisa, S.S. and El-Dougdoug, Kh. (2006): Role of reactive oxygen species and anti-oxidants in hypersensitive local virusinfected plants. J. Agric. Sci. Mansoura Univ. 31(11): 6465-6480. Antoniw, J.F. and Pierpoint, W.S. (1978): Purification of tobacco leaf protein associated with resistance to virus infection. Biochemical Society Transactions, 6: 248-250. 198 References Araf, Rasha, M. (2008): Molecular genetic studies on biotic induction of plant resistance to Cucumber mosaic virus. M.Sc. Thesis, Fac. Agric., Ain Shams University, Cairo, Egypt, 129p. Aramburu, J.; Galipienso, L. and Lopez, C. (2007): Reappearance of Cucumber mosaic virus isolates belonging to subgroup IB in tomato plants in North-eastern Spain. Journal of Phytopathology, 155(9): 513-518. Avdiushko, S.A.; Ye, X.S. and Kuc, J. (1993): Detection of several enzymatic activities in leaf prints of cucumber plants. Physiological and Molecular Plant Pathology, 42:441-454. Aydemir, T. (2004): Partial purification and characterization of polyphenol oxidase from artichoke (Cynara scolymus L.) heads. Food Chemistry, 87: 59-67. Balachandran, S.; Hurry, V.M.; Kelley, S.E.; Osmond, C.B.; Robinson, S.A.; Rohozinski, J.; Seaton, G.G.R. and Sims, D.A. (1997): Concepts of plant biotic stress: Some insights into the stress physiology of virus-infected plant from the perspective of photosynthesis. Physiologia plantarum, 100:203-213. Balogun, O.S. and Daudu, A.K. (2007): Comparative pathogenic responses of some tomato accessions to Cucumber mosaic virus. Research on Crops, 8(3): 689-694. Bansal, R.D.; Sharma, O.P.; Kaul, V.K. and Cheema, S.S. (1992): Histopathological changes induced in Cucurbita pepo infected with Cucumber mosaic virus. Indian Journal of Virology, 8(2): 111-114. Barbosa, C.D.J.; Cumani, L.A.L.; Roes, B.; Olivereira, R.P. and Silva, K.M.D (1998): Cucumber mosaic virus identification on banana plants in the north of Parana state. Revista Brasiliara de Fruicultura, 20(1): 112-114. (English abstract). References 199 Bestwick, C.S.; Brown, I.R. and Mansfield, J.W. (1998): Localized changes in peroxidase activity accompany hydrogen peroxidase generation during the development of a non host hypersensitive reaction in lettuce. Plant Physiology, 118: 1068-1078. Betsy, P. and Sonford, H. (1996): Kombucha Phenomenon. The Miracle Health tea how to safely make and use kombucha. 2nd ed sierra sunrise Publishing Inc. Bollard, E.G. and Mathews, R.E.F. (1966): The physiology of parasitic diseases. In F.C. steward (Ed) plant physiology 4(b) Acad. Pres, New York, 599p. Bradford, M.M. (1976): A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principal of protein dye binding. Anal. Biochem., 72:248-254. Brakk, M.K.; White, J.L.; Sawsan, R.G. and Johi (1986): Chlorophyll, chloroplast and ribosomal RNA are reduced by Barley strip mosaic virus systemic infection, Phyto, 78: 670-674. Brodersen P.; Malinovsky, F.G.; Hématy, K.; Newman, M.A. and Mundy, J. (2005): The role of salicylic acid in the induction of cell death in Arabidopsis acd11. Plant Physiology, 138: 1037–1045. Campa, A. (1991): Biological roles of plant peroxidases; known and potential function, in: J. evrse, M.B. Grisham (eds.), PeroxiBoca Raton, pp. 25-50. Cao, H.; Glazebrook, J.; Clarke, J.; Volko, S. and Dong, X.N. (1997): The Arabidopsis NPRI gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell, 88: 57-63. Cao, H.; Li, X. and Dong, X.N. (1998): Generation of broad spectrum disease resistance by over expression of an essential regulatory gene in systemic acquired resistance. Proc.NAT. Acad. SCI. USA, 95:6531-6536. 200 References Carbone, D. and Kalaljev, A. (1932): Ricercha sulla vaccinaxione della plante. Phtopathologia mediterranea, 5: 91-98. Cardin, L. and Moury, B. (2007): First report of Cucumber mosaic virus in Echium candicans in France. Plant Disease, 91(11): 1516. Chabbouh, N. and Cherif, C. (1990): Cucumber mosaic virus in artichoke. FAO Plant Prot. Bull., 38:52-53. Chakraboty, S.; Singa, A. and Reddy, B.V. (1994): Effect of cucurbit mosaic viruses on chlorophyll and total phenol content of cucurbits. Crop Research (Hisar), 7(3): 461-465. Chaturvedi, R. and Shah, J. (2007): Salicylic Acid in Plant Disease Resistance. Book of Salicylic Acid: A Plant Hormone, pp 335370. Chaumpluk, P.; Saski, Y.; Saitoh, A.; Koiwa, H.; Hikichi, Y. and Suzuki, A. (1994): Comparison of two isolates of cucumber mosaic virus (CMV) from gentian plant in Iwate Prefecture. Ann. of the Society of Plant Protection of North Japan, 45: 88-92. Chen, C. and Liu, B.Y. (2000): Changes in major components of tea fungus metabolites during prolonged fermentation. Journal of Applied Microbiology, 89(5): 834-839. Chen, C.C. and Hu, C.C. (1999): Purification and characterization of cucumovirus from Lisianthus rusellianus. Plant Protection Bulletin Taipei, 14(3): 179-198. Chen, M.; Qiu, D.W.; Liu, Z.; Yang, X.F. and Cao, K.Q. (2006): Inhibition of RNA replication and coat protein synthesis in Tobacco mosaic virus by a plant activator protein. Chinese Journal of Biological Control, 22 (1): 63-66. (English abstract). Chessin, M.; Deborde, D. and Zipf, A. (1995): Antiviral proteins in high plants. CRC press, Boca Raton, Ann Arbor, London, Tokyo, 180 P. References 201 Chester, K. (1933): The problem of acquired physiological immunity in plants. Quart. Rev. Biol. 8: 129-151. Chittoor, J.M.; Leach, J.E. and White, F.F. (1999): Induction of peroxidase during defense against pathogens. In: Pathogenesis: Related proteins in plants, 291 p. S.K. Datta, S. Muthukrishnan (eds.), CRC Press, Boca Raton, FL Choudhary, D.K. ; Prakash, A. and Johri, B.N. (2007): Induced systemic resistance (ISR) in plants: mechanism of action. Indian Journal of Microbiology. 47 (4): 289-297. Clark, M.F. and Adams, A.N. (1977): Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. of Gen. Virology, 34: 475-483. Coseteng, M.Y. and Lee, C.Y. (1978): Changes in apple polyphenol oxidase and polyphenol concentrations in relation to degree of browning. Journal of Food Science. 52: 985. Davino, S.; Bellardi, M.G.; Bella, M.D.; Davino, M. and Bertaccini, A. (2005): Characterization of a Cucumber mosaic virus isolate infecting Mandevilla sanderi (Hemsl.) Woodson. Phytopathologia Mediterranea, 44: 220-225. Dean, R.A. and Kuc, J. (1986a): Induced systemic protection in cucumber: the source of the signal. Physiol. Mol. Plant Pathol., 28: 227-233. Dean, R.A., and Kuc, J. (1986b): Induced systemic protection in cucumber: time of production and movement of the signal. Phytopathology, 76: 966-970. Delancy, T.; Uknes, S.; Vernoij, B.; Friedrich, L.; Weymann, K.; Negrotto, D.; Gaffney, T.; Gut-Rella, T.; Kessmann, M.; Ward, H. and Ryals, J. (1994): A central role of salicylic acid in plant disease resistance. Science, 266: 1247-1250. 202 References Deng, C.; Zhang, X.; Zhang, J.; Qian, J. and Zhu, W. (2003): Rapid Determination of Salicylic Acid in Plant Materials by Gas Chromatography–Mass Spectrometry. Journal Chromatographia, 58(3-4): 225-229. Devi, P.R.; Doraiswamy, S.; Nakkeeran, S.; Rabindran, R.; Ganapathy, T.; Ramiah, M. and Mathiyazhagan, S. (2004): Antiviral action of Harpulia Cupanioides and Mirabilis Jalapa against tomato spotted wilt virus. Archives of Phytopathology and Plant Protection, 37(4): 245-259. Dheepa, R. and Paranjothi, S. (2010): Transmission of Cucumber Mosaic Virus (CMV) infecting banana by aphid and mechanical methods. Emir. J. Food Agric., 22 (2): 117-129. Dipti, P.; Yogesh, B.; Kain, A.K.; Pauline, T.; Anju, B.; Sairam, M.; Singh, B.; Mongia, S.S.; Kumar, G.I. and Selvamurthy, W. (2003): Lead induced oxidative stress: beneficial effects of Kombucha tea. Biomed Environ Sci., 16(3):276-82. Dixon, R.A. (1986): The phytoalexin response: Elicitation, signaling, and control of host gene expression. Biol. Can. Philos. Soc. 61: 239-292. Doebley, J. (1989): Isozymic evidence and the evolution of crop plants, In: Isozymes in Plant Biology, D. Soltis, and P. Soltis, eds. (Portland, Oregon: Dioscorides Press), pp. 165-191. Dong, H. and Beer, S.V. (2000): Riboflavin induces disease resistance in plants by activating a novel signal transduction pathway. Phytopathology, 90(8): 801-811. Dubey, G.S. and Bhardwaj, S.V. (1982): Histopathological studies in tomato infected with TMV. Indian Phtopathology, 35(1): 175. Dutta, D. and Gachhui, R. (2007): Nitrogen-fixing and celluloseproducing Gluconacetobacter kombuchae sp. nov., isolated from References 203 Kombucha tea. International Journal of Systematic and Evolutionary Microbiology, 57, 353–357. Effmert, U.; Große, J.; Röse, U.S.R.; Ehrig, F.; Kägi, R. and Piechulla, B. (2005): Volatile composition, emission pattern, and localization of floral scent emission in Mirabilis jalapa (Nyctaginaceae). American Journal of Botany, 92(1): 2–12. Eichhorn, H.; Klinghammer, M.; Becht, P. and Tenhaken, R. (2006): Isolation of a novel ABC-transporter gene from soybean induced by salicylic acid. Journal of Experimental Botany, 57, (10): 2193– 2201. Eid, S.A.; Kishtah, A.A. and Abu-Zeid, A.A. (1984): Nicotiana gluaca L., a natural host for cucumber mosaic virus. Agric. Res. Rev. 62: 367-378. Eisa, Nawal A.; El-Fiki, A.I.I.; Mohamed, F.G. and El-Habbak, M.H. (2006): Biochemical changes in squash leaves sprayed with some chemicals for inducing resistance to powdery mildew. The 2nd Conf. On farm Integrated Pest Management 2006, Fayoum, Egypt., pp. 211-222. El-Afifi, Sohir, L; EI-BoroIIosy, A.M. and Mahmoud, S.Y.M. (2007): Tobacco callus culture as a propagating medium for Cucumber mosaic cucumovirus. Intern. J. Virology, 3(2): 73-79. El-Baz, Reham, M. (2004): Physicochemical, physiological and histopathological studies on cucumber mosaic virus. M.Sc. Thesis. Fac. of Sci. Helwan Univ., Cairo, Egypt, 192 p. El-Dougdoug, Kh.A.; El-Deeb, S.H. and Abou-Zeid, A.A. (1993): Anatomical and ultra-structural changes in orange leaves infected with Citrus exocortis viroid (CEVd). Annals Agriculture Science. Ain Shams University, 38 (1): 101-117. Elshafie, E.; Daffalla, G.; Gebre, K. and Marchoux, G. (2005): Mosaic -Inducing Viruses And Virus Like- Agents Infecting 204 References Tomato And Pepper In Sudan. International Journal of Virology, 1(1): 28-28. El-Shamy, M.M. (1987): Studies on a virus naturally infecting plants of economic importance to Egypt. M.Sc. Thesis Faculty of Science, Menoufia University, Egypt, 173p. El-Shamy, M.M; Sayed, E.T.A. and Soweiha, H.E. (2000): Light microscopic anatomical studies of tomato leaves infected with a new yellow severe strain of Tobacco mosaic virus. Bulletin Faculty of Science, Assiut University, Egypt, 173p. Endo, Y.; Tsurugi, K. and Lambert, J.M. (1988): The site of action of six different ribosome-inactivation proteins from plants in eukaryotic ribosomes: the RNA N-glycosidase activity of the proteins. Biochemistry Biophysics Research of Community, 150: 1032-1039. Enyedi, A.J.; Yalpani, N.; Silverman, P. and Raskin, I. (1992): Localization, conjugation and function of salicylic acid in tobacco during the hypersensitive reaction to tobacco mosaic virus. Proc. Natl. Acad. Sci. USA, 89: 2480-2484. Eskarous, J.K.; Sayed, E.T. and El-Shamy, M.M. (1991): Histopathology of tomato root, stem and leaf infected with a heat resistant strain of TMV. Mansura Science Bulletin, 18(2): 219. Espinha, L.M. and Caspar, J.O. (1997): Partial chracterrization of cucumber mosaic virus isolated from Catharanthus roseus. Fitopatologia Brasileira, 22(2): 209-212. Faccioli, G.; Forni, M. and Bizzi, L. (1994): Further characteristics of antiviral factors (AVF) produced by virus-infected plants. Phytopathologia Mediterranea, 33(1): 17-26. Fakhourin, W.D.; Neemann, M.; Walker, F. and Buchenauer, H. (2004): Application of fluorescent pseudomonads in combination with acibenzolar-S-methyl induces disease resistance in tomato and References 205 tobacco. Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz, 111(5): 494-505. (English abstract). FAO (2010): FAOSTAT statistical database. Rome (available at http://faostat.fao.org). Farouk, S.; Ghoneem, K.M. and Abeer A. Ali (2008): Induction and expression of systemic resistance to downy mildew disease in cucumber by elicitors. Egypt. J. Phytopathol., 36(1-2): 95-111. Fawzy, R.N.; Mahdy, A.M.M. and El-Mageed, A.M.H. (1992): Identification of a strain of cucumber mosaic virus isolated from naturally infected Philodendron selloum. Annals of Agric. Sci., Moshtohor, 30(3): 1219-1232. Food and Drug Administration (1995): FDA cautions consumers on "Kombucha Mushroom Tea" {News release}. Washington, DC: US Department of Health and Human Services, Public Health Service, Food and Drug Administration, March 23, 1995. Fraser, L. and Matthews, R.E.F. (1979): Specific pathways of cytological change in individual Chinese cabbage protoplasts infected with Turnip yellow mosaic virus. Journal of General Virology, 45: 623-630. Fraser, R.S.S. (1981): Evidence for the occurrence of the pathogenesis related proteins in leaves of healthy tobacco plants during flowering. Physiology Plant Pathology, 19:69-76. Freeman, A. and Horsham, M.A. (2006): Temperate Pulse Viruses: Cucumber Mosaic Virus (CMV). Information notes No. AG1207, http://new.dpi.vic.gov.au/agriculture/pests-diseases-and-weeds/plantdiseases/grains-cereals/general-vegetable-diseases/ag1207-temperatepulse-viruses-cucumber-mosaic-virus-cmv Freitas-Astúa, J.; Bastianel, M.; Locali-Fabris, E.C.; Novelli, V.M.; Silva-Pinhati, A.C.; Basílio-Palmieri, A.C.; Targon, M.L.P.N. and Machado, M.A. (2007): Differentially expressed 206 References stress-related genes in the compatible citrus-Citrus leprosis virus interaction. Genetics and Molecular Biology, 30 (3 suppl.): 980990. Fukumoto, F.; Masuda, Y. and Hnada, K. (2003): Pea tissue necrosis induce by Cucumber mosaic virus alone or together with watermelon mosaic virus. Plant Disease, 87(4): 324-328. Gaffney, T.; Friedrich, L.; Vernooij, B.; Negrotto, D.; Nye, G.; Uknes, S.; Ward, E.; Kessmann, H. and Ryals, J. (1993): Requirement of salicylic acid for the induction of systemic acquired resistance. Science, 261: 754-756. Galal, A.M.M. (1989): Antiviral against local and systemic viral infection of Phaseolus vulgaris. Ph.D. Thesis. Faculty of Science. Zagazig University, Zagazig, Egypt, 333p. Galal, A.M.M. (2006): Induction of systemic acquired resistance in cucumber plant against Cucumber mosaic cucumovirus by local Streptomyces strains. Plant Pathology Journal Faisalabad, 5(3): 343-349. Ganoo, S. and Saumtally, S. (1999). Incidence of virus diseases in tomato. In: Lalouette, J. A., Bachraz, D. Y.; Sakurdeep, N. (eds). Proceedings of the 3rd Annual Meeting of Agricultural Scientists, Réduit, Mauritius, 17-18 November 1998. AMAS 1998. Food and Agricultural Research Council, Réduit, Mauritius. Ghazi, A.M. (1976): Comparative biochemical studies on plant peroxidases. Ph.D. Thesis. Fac. of Sci., Al-Azhar Univ., Cairo, Egypt. 224 p. Gianinazzi, S.; Martin, C. and Valle, J.C. (1970): Hypersenstivity to viruses, temperature and solable proteins in Nicotiana xanthi n.c. Appearance of new macromolecules at the repression of viral synthesis. Comptes Rendus Acad. Sci. Ser. Paris, 270: 2382-2386. (English abstract). References 207 Gildow, F.E.; Shah, D.A.; Sackett, W.M.; Butzler, T.; Nault, B.A. and Fleischer, S.J. (2008): Transmission efficiency of Cucumber mosaic virus by aphids associated with virus epidemics in snap bean. Phytopathology, 98(11):1233-41. Gilpatrick, J.D. and Weintraub, M. (1952): An usual type of protection with the carnation mosaic virus. Science, 115: 701-702. Goodman, R.N.; Kiraly, Z. and Wood, K.R. (1986): The biochemistry and physiology of plant disease, University of Missouri Press. Columbia, 295P. Grüner, R. and Pfitzner, U.M. (1994): The upstream region of the gene for the pathogenesis-related protein 1a from tobacco responds to environmental as well as to developmental signals in transgenic plants. European Journal of Biochemistry, 220: 247-255. Hafez, M.A. (2008): Pre-harvest application of Kombucha filtrate to control postharvest bunch rot of table grapes. Annals of Agric. Sci., Moshtohor, 46(2):23-34. Hammerschmidt, R. (1999): Induced disease resistance: how do induced plants stop pathogens? Physiological and Molecular Plant Pathology, 55 (2): 7-84. Hammerschmidt, R. (2009): Chapter 5 Systemic Acquired Resistance. Advances in Botanical Research, 51, 173-222. Hammerschmidt, R.; Nuckles, E.M. and Kuc, J. (1982): Association of enhanced peroxidase activity with induced systemic resistance of cucumber to Colletotrichum lagenarium. Physiol. Plant Pathol., 20: 73-82. Harish, S.; Kavino, M.; Kumar, N.; Balasubramanian, P. and Samiyappan, R. (2009): Induction of defense-related proteins by mixtures of plant growth promoting endophytic bacteria against Banana bunchy top virus. Biological Control, 51:16–25. 208 References Hayat, S. and Ahmad, A. (2007): Salicylic Acid: A Plant Hormone. 1st Ed. Published by Springer, Dordrecht, The Netherlands, 401pp. Hellwald, K.H.; Zimmermann, C. and Buchenauer, H. (2000): RNA 2 of Cucumber Mosaic Virus Subgroup I Strain NT-CMV is Involved in the Induction of Severe Symptoms in Tomato. European Journal of Plant Pathology, 106(1): 95-99. Helmy, Yomna, I. and Maklad, F.M. (2002): Induced systemic resistance in cucumber plants under plastic houses against cucumber mosaic virus using biotic inducers. Egypt. J. Hort., 29(1): 1-16. Hersanti, C. (2005): The Analysis of peroxidase activity and salicylic acid content of resistant red chilli plant to Cucumber mosaic virus (CMV) induced by crude extract of leaf Mirabilis jalapa. Indonesian Journal of Plant Protection, XI:1 Hooft Van Huijsduijnen, R.A.M.; Alblas, S.W.; De Rijk, R.H. and Bol, J.F. (1986): Induction by salicylic acid of pathogenesis-related proteins and resistance to Alfalfa mosaic virus infection in various plant species. J. Gen. Virol., 67: 2135-2143. Hopper, D.G.; Venere, R.J.; Brinkerhoff, L.A. and Ghoslson, R.K. (1975): Necrosis induction in cotton. Phytopathology, 65: 206213. Hou, L.; Li, C.; Liu, Y.; Cai, Z.; Fei, J.; Hou, Y. and Cai, Z.N. (1998): Effects of antiviral agents to interaction of TMV with tobacco chloroplast. Plant Protection, 24: (2): 10-13. Huang, W.E.; Huang, L.F.; Preston, G.M.; Naylor, M.; Carr, J.P.; Li, Y.H.; Singer, A.C.; Whiteley, A.S. and Wang, H. (2006): Quantitative in situ assay of salicylic acid in tobacco leaves using a genetically modified biosensor strain of Acinetobacter sp. ADP1. Plant J., 46(6): 1073-1083. References 209 Hubert, J.J. and Helton, A.W. (1967): A translocatable-resistance phenomenon in Prunus domesticu induced by initial infection with Cytospora cineta. Phytopathology, 57: 1094-1098. Hudgson, R.A.; Beachy, R.N. and Pakrasi, H.B. (1989): A selective inhibition of photosystem II in spanich by Tobacco mosaic virus: An effect of the viral coat protein. Febsett, 245(2):267-270. ICTVdB (2010): Index of Viruses – Bromoviridae. The ICTVdB virus code 00.010.0.04. Cucumovirus, In: ICTVdB - The Universal Virus Database of the International Committee on Taxonomy of Viruses version 4. Büchen-Osmond, C (Ed), Columbia University, New York, USA.http://www.ncbi.nlm.nih.gov/ICTVdb/Ictv/fs_index.htm Jayabalan, R.; Marimuthu, S. and Swaminathan, K. (2007): Changes in content of organic acids and tea polyphenols during kombucha tea fermentation. Food Chemistry, 102(1): 392-398. Jetiyanon, K. and J.W. Kloepper (2002). Mixtures of plant growthpromoting rhizobacteria for induction of systemic resistance against multiple plant diseases. Biological Control, 24: 285-291. Jetiyanon, K.; Fowler, W.D. and Kleopper, J.W. (2003): Broadspectrum protection against several pathogens by PGPR mixtures under field conditions in Thailand. Plant Disease, 87(11): 1390-1394. Kahler, A.L. and Allard, R.W. (1981): Worldwide patterns of genetics variation among four esterase loci in barely (Hordeum). Journal of TAG Theoretical and Applied Genetics, 59: 101-111. Kalim, S.; Luthra, Y.P. and Gandhi, S.K. (1999): Copper induced effect on biochemical constituents in cowpea suscebtible to Rhizoctonia species. Acta Phytopathologica et Entomologica Hungarica, 34(3): 199-210. 210 References Kassanis, B. and Kleozkowski, A. (1948): The isolation and some properties of a virus-inhibiting protein from Phytolacca esculenta. Journal of Genetics Microbiology, 2: 143-147. Kauss, H. (1987): Some aspects of calcium-dependent regulation in plant metabolism. Annu. Rev. Plant Physiol., 38: 47-72. Kavino, M.; Harish, S.; Kumar, N.; Saravanakumar, D. and Samiyappan, R. (2008): Induction of systemic resistance in banana (Musa spp.) against Banana bunchy top virus (BBTV) by combining chitin with root-colonizing Pseudomonas fluorescens strain CHA0. European Journal of Plant Pathology, 120 (4): 353362. Kawamura, S.; Tada, M. and Narsaki, T. (1966): Sugar of cotyledon, hull and hypocotyls of soybean. J. Jap. Soc. Food and Nutr., 19: 268. Kessman, H.; Staub, T.; Hofmann, C.; Maetzke, T.; Herzog, J.; Ward, E.; Uknes, S. and Rvals, J. (1994): Induction of systemic acquired disease resistance in plants by chemicals. Annu. Rev. Phytopathol., 32: 439-459. Khalil, E.M.; Hassan, El.Sh. and Bekhit, R.S. (1985): Reaction of selected pepper cultivars to mosaic virus diseases under Egypt conditions. The 1st Nat. Conf. of Pests and Dis. of Veg. and Field Crops in Egypt. Ismailia, Egypt. Kiranmai, G.; Sreenivasulu, P. and Nayudu, M.V. (1997): Characterization of cucumber mosaic cucumovirus isolates naturally infecting three solanaceous vegatible crops in Andhra Prodesh. Indian Phytopathology, 50(3): 416-425. Kogel, K.H.; Beckhove, U.; Dreschers, J.; Munch, S. and Romme, Y. (1994): Acquired resistance in barley (The resistance mechanism induced by 2,6-Dichloroisonicotinic acid is a phenocopy of a References 211 genetically based mechanism governing race- specific powedery mildew resistance). Plant Physiol., 106(4): 1269-1277. Köhler, Valentin and Köhler, J. (1985): Glucuronic acid as an ecological aid. In the Book: Sofotheilung des Waldes, Vol.1, 2nd Edt. (H. Kaegelmann ed.), Windecke-Rosbach (in German) Kubo, S.; Ikeda, T.; Imaizumi, S.; Takanami, Y. and Mikami, Y. (1990): A potent plant virus inhibitor found in Mirabilis jalapa L. Annals of the Phytopathological Society of Japan, 56(4):481-487. Kuc, J. (1987): Plant immunization and its applicability for disease control. In: 1. Chet (ed), Innovative Approaches to Plant Disease Control. John Wiley, New York. pp. 225-274. Kumar, D.; Verma, H.N.; Tuteja, N. and Tewari, K.K. (1997): Cloning and characterisation of a gene encoding an antiviral protein from Clerodendrum aculeatum L. Plant Molecular Biology, 33: 745–751. Kumon, K.; Sasski, K.; Sejima, M.; Akeuchi, Y.T. and Hayashi, Y. (1990): Interactions between Tobacco mosaic virus, pokweed antiviral protein and tobacco cell wall. Phytopathology, 80: 636640. Laemmli, U.K. (1970): Cleavage of structural proteins during the assembly of the head of bacteriophage. T4. Nature, 227: 680-685. Lancioni, P. (2008): Studies on biotic and abiotic elicitors inducing defense responses in tomato. Ph.D. Thesis, Phytopathology Dept., Fac. Agric., University of Bologna, Italy 125pp. Lanna, A.C.; Oliveira, M.G.A.; Barros, E.G. and Moreira, M.A. (1996): Kinatic parameters of leaf lipoxygenase pool from normal soybean genotypes and from a line devoid of seed lipoxygenase. Rev. Bras. Fisiol. Vegetal., 8: 87-92. Leal, A.A.; Terada, Y. and Machado, M.P. (2001): Floral biology of a population of Mirabilis jalapa L. (Nyctaginaceae) from 212 References Southern Brazil.Acta Scientiarum Maringá, 23(2): 587-591. Lee, S.Y.; Park, S.J. and Choi, J.K. (1997): Characterization of an ; isolate of cucumber mosaic virus from Forsythia (Forsythia koreana nakai). Korean Journal of Plant Pathology, 13(5): 358-363. Yalpani, N.; Leon, J.; Lawton, M.A. and Raskin, I. (1993): Pathway of Salicylic Acid Biosynthesis in Healthy and VirusInoculated Tobacco. Plant Physiology, 103(2): 315-321. Lin, C.H.; Sheu, F.; Lin, H.T. and Pan, T.M. (2010): Allergenicity Assessment of Genetically Modified Cucumber Mosaic Virus (CMV) Resistant Tomato (Solanum lycopersicon). J. Agric. Food Chem., 58 (4): 2302–2306. Loebenstein, G. (1963): Further evidence on systemic resistance induced by localized necrotic virus infections in plants. Phytopathology, 50: 306-308. Loebenstein, G. (1972): Localization and induced resistance in virus infected plants. Annual Review of Phytopathology, 10: 177-181. Low, P.S. and Merida, J.R. (1996): The oxidative burst in plant defense: function and signal transduction. Physiol. Plant., 96: 533-542. Gilliland, A.; Murphy, A.M.; Wong, C.; Carson, R. and Carr, J.P. (2006): Mechanisms Involved in Induced Resistance to Plant Viruses. In: Multigenic and Induced Systemic Resistance in Plants, 2006, 335-359. Magid, A.G.M.A. (1991): Host range and transmission of an isolate of cucumber mosaic virus from the Sudan. East African Agricultural and Forestry Journal, 56(1-4): 63-67. Mahmoud, S.Y.M. (2000): Antiviral substances induced in plants as a result of virus infection. Ph.D. Thesis. Faculty of Agriculture, Ain Shams University, Cairo, Egypt, 171 p. References 213 Mahmoud, S.Y.M. (2003): Systemic acquired resistance induced in viral infected tobacco plants via viral necrotizing and plant decapitation. Assiut Journal of Agricultural Science, 34(5): 334351. Malamy, J.; Carr, J.P.; Klessig, D.F. and Rasken, I. (1990): Salicylic acid: a likely endogenous signal in the resistance response of tobacco to viral infection. Science, 250: 1002-1004. Malamy, J.; Hennig, J. and Klessig, D.F. (1992): Temperaturedependent induction of salicylic acid and its conjugates during the resistance response to tobacco mosaic virus infection. Plant Cell, 4: 359-366. Massumi, H.; Shaabanian, M.; Pour, A.H.; Heydarnejad, J. and Rahimian, H. (2009): Incidence of Viruses Infecting Tomato and Their Natural Hosts in the Southeast and Central Regions of Iran. Plant Disease, 93(1): 67-72. Matthews, F.E.F. (1970): Student edition, plant virology. Academic press, INC., New York, 778p. Maurhofer, M.; Hase, C.; Meuwly, P.; Metraux, J.P. and Defago, G. (1994): Induction of systemic resistance to tobacco necrosis virus by the root-colonizing Pseudomonas fluorescens strain CHAO: Influence of the gacA gene and pyoverdine production. Phytopathology, 84: 139-146. Maurhofer, M.; Hase, C.; Meuwly, P.; Metraux, P. and Defago, G. (1993): Induction of systemic resistance of tobacco to tobacco necrosis virus by the root – colonizing Pseudomonas fluorescens strain GHAO : influence of the gac A Gene and of Phyoverdine production. Phytopathology, 24 (2): 139- 146. Mayers, C.N.; Lee, K.C.; Moore, C.A.; Wong, C.A. and Carr, J.P. (2005): Salicylic acid- induced resistance to Cucumber mosaic virus in squash and Arabidopsis thaliana: contrasting 214 References mechanisms of induction and antiviral action. Mol. Plant Microbe Interact., 18: 428-434. Mazen, M.A. (2004): Resistance induction against diseases of faba bean crop. Ph.D. Thesis., Fac. of Agric., Suez Canal Univ., 159pp. Mazia, D.; Brewer, P.A. and Alfert, M. (1953): The cytochemical staining and measurement of protein with mercuric bromophenol blue. Biol. Bull. 35: c 17. Meena, B.; Marimuthu, T. and Velazhahan, R. (2001): Salicylic acid induces systemic resistance in groundnut against late leaf spot caused by Cercosporidium persenatum. Journal of Mycology and Plant Pathology, 31(2): 139-145. Megahed, A.A. (2008): Effect of antiviral proteins produced by bacterial and fungal isolates on some viruses infecting vegetable crops. M.Sc. Thesis, Faculty of Agriculture, Ain Shams University, Cairo, Egypt. 193p. Meins, F.; Neuhaus, J.M.; Sperison, C. and Ryals, J. (1992): The primary structure of plant pathogenesis-related glucanohydrolases and their genes. pp. 245-282. In: Genes Involved in Plant Defense, eds. T. Boiler, FJ Meins, Vienna: SpringerVerlag, Heidekberg, Berlin, Germany. Metraux, J.P.; Singer, H.; Ryals, J.; Ward, E.; Wyss-Benz, M.; Gaudin, J.; Raschdofr, K.; Schmid, E.; Blim, W. and Inverardi, B. (1990): Increase in salicylic acid at the onset of systemic acquired resistance in cucumber. Science, 250: 1004-1006. Michael, R.D. (2009): Incidence of Viruses Infecting Tomato and Their Natural Hosts in the Southeast and Central Regions of Iran, 93(1):67-72. Mohamed, E.F. (2010): Interaction Between Some Viruses Which Attack Tomato (Lycopersicon esculentum Mill.) Plants and References 215 Their Effect on Growth and Yield of Tomato Plants. Journal of American Science, 6(8): 311-320. Montalbin, P. and Lupatill, M. (1989): Effect of localized and systemic Tobacco mosaic virus infection on some photochemical and enzymatic activities in tobacco. Phytopathology, 75(2): 126-132. Montasser, M.S.; Dashti, N.H.; Ali, N.Y.; Bhardwaj, R.G. and AlHamar, B. (2006): Occurrence of Three Strains of Cucumber mosaic virus Affecting Tomato in Kuwait. Archive Detail, 22(1): 51-62. Murphy, A.M.; Chivasa, S.; Singh, D.P. and Carr, J.P. (1999): Salicylic acid induced resistance to viruses and other pathogens: a parting of the ways?. Trends in Plant Science, 4, 155-160. Murphy, J.F.; Zehnder, G.W.; Schuster, D.J.; Sikora E.J.; Polston, J.E. and Kloepper, J.W. (2000): Plant growthpromoting rhizobacterial mediated protection in tomato against tomato mottle virus. Plant Disease. 84: 779-784. Nassar, G.A. (1998): Algal activity against local and systemic plant viral infection. Ph.D. Thesis, Faculty of Science, Zagazig University, Zagazig, Egypt, 164p. Neuenschwander, U.; Lawton, K. and Ryals, J. (1996): Systemic acquired resistance in Plant-Microbe Interaction, Vol. 1, pp. SI-108. G. Stacey and N.T. Keen, eds New York: Chapman and Hall. Nie, X. and Singh, R.P. (2001): Differential accumulation of Potato virus x and expression of pathogenesis-related genes in resistant potato cv. Shepody upon graft inoculation. Phytopathology, 91: 197-203. Noordam, D. (1973): Identification of Plant Viruses: Methods and Experiments. Center for Agriculture Publishing and Documentation, Wageningen, the Netherlands, 207 p. 216 References Olivieri, F.; Prasad, V.; Valbonesi, P.; Srivastava, S.; GhosalChowdhury, P.; Barbieri, L.; Bolognesi, A. and Stirpe, F. (1996): A systemic antiviral resistance-inducing protein isolated from Clerodendrum inerme Gaertn. is a polynucleotide: adenosine glycosidase (ribosome-inactivating protein). FEBS Lett., 396(2-3): 132-134. Omar, R.A.; Mehiar, F.F.; Zayed, E.A. and Dief, A.A. (1986): Physiological and biochemical studies on soy beans and lettuce plants infected with seed borne virus. Acta Phytopathological et Entomological Hungarica, 21: 63-72. Omar, R.A; EL-Kewey, S.A.; Sidaros, S.A. and Mahmoud, S.Y. (1994): Unusual strain of CMV affecting sugar beet in Egypt. Proc. of the seventh Congress of Phytopathology. 1:14, Cairo, Egypt. Park, S.W.; Kaimoyo, E.; Kumar, D.; Mosher, S. and KIcssig, D.F. (2007): Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science Washington, 318(5847): 113-116. Park, S.W.; Liu, P.P.; Forouhar, F.; Vlot, A.C.; Tong, L.; Tietjen, K. and Klessig, D.F. (2009): Use of a synthetic salicylic acid analog to investigate the roles of methyl salicylate and its esterases in plant disease resistance. The Journal of Biological Chemistry, 284(11):7307–7317. Park, W.M.; Ryu, K.H. and Choi, J.K. (1990): Properties and purification of cucumber mosaic virus as new strain. Korean Journal of Plant Pathology, 6(3): 393-401. Pathak, D.; Srivastava, M.P. and Deka, S.C. (1998): Biochemical basis of charcoal rot [Rhizoctonia bactericola (Taub.) Buter] resistant and susceptible cultivars of sunflower in relation to References 217 total phenols, free amino acids, insoluble pectin and polyphenol oxidase activity. Annals of Biology (Ludhiana), 14(2): 189-193. Peng, J.Y.; Deng, X.J.; Huang, J.H.; Jia, S.H.; Miao, X.X. and Huang, Y.P. (2004): Role of salicylic acid in tomato defense against Cotton Bollworm, Helicoverpa armigera Hubner. Z. Naturforsch. 59: 856-862. Praveen, S.; Tripathi, S. and Varma, A. (2001): Isolation and characterization of an inducer protein (Crip-31) from Clerodendrum inerme leaves responsible for induction of systemic resistance against viruses. Plant Science, 161: 453–459. Quiroga, M.; Guerrero, C.; Botella, M.A.; Barcelo, A.; Amaya, I.; Madina, M.I.; Alanso, F.J.; Forchetti, S.M.D.; Tigier, H. and Valpuesta, V. (2000): A tomato peroxidase involved in the synthesis of lignin and suberin. Plant Physiol., 122: 1119-1128. Rajeswari, B. and Rajamannar, M. (1991): Effect of Betelivine mosaic virus infection on chlorophyll and carbohydrate fractions. Orissa Journal of Horticulture, 19; 102: 30-31. Raskin, I. (1992): The role of salicylic acid in plant. Annu. Rev. plant Physiol. Mol. Boil., 43: 439-463. Raskin, L; Turner, I.M. and Melander, W.R. (1989): Regulation of heat production in the inflorescences of an Arum lily byendogenous salicylic acid. Proc. Natl. Acad. Sci USA., 86: 22142218. Raupach, G.S.; Liu, L.; Murphy, J.; Tuzun, S. and Kloepper, J.W. (1996): Induced systemic resistance in cucumber and tomato against cucumber mosaic cucumovirus using plant growthpromoting rhizobacteria (PGPR). Plant Disease, 80: 891-894. Ray, J. (1901): Les maladies cryptogamiquies des vegetaux. Rev.Gen. de Bot. 13: 145-154. (c.f. Kessman et al, 1994). 218 References Rosin, H. (1957): A modified ninhydrin colorimetric analysis for amino acid. Arch Biochem. Biophys., 67: 10-51. Ross, A.F. (1961a): Localized acquired resistance induced to plant virus infection in localized virus infections in hypersensitive hosts. Virology, 14:329-339. Ross, A.F. (1961b): Systemic acquired resistance induced by localized virus infections in plants. Virology, 14: 340-358. Roussin, M. (2003): Analyses of Kombucha Ferments. http://www.Kombucha-research.com/. Ruzin, S.E. (1999): Staining Techniques. In: Ruzin SE, ed. Plant Microtechnique and Microscopy. New York: Oxford University Press, 87–116. Ryals, J.; Neuenschwander, U.; Willits, M.; Molina, A.; Steiner, H. and Hunt, M. (1996): Systemic acquired resistance. Plant Cell, 8: 1809-1819. Ryals, J.; Ukness, S. and Ward, E. (1994): Systemic acquired resistance. Plant Physiol. 104: 1109-1112. Salem, E.A. (2004): Induction of salicylic acid by some chemical substance used to control virus infection under protected Agriculture. M.Sc. Thesis.Fac. of Agric., Ain Shams.Univ. Cairo, Egypt, 118 P. Sankaran, S.; Mishra, A.; Ehsani, R. and Davis, C. (2010): A review of advanced techniques for detecting plant diseases. Computers and Electronics in Agriculture, 72: 1-13. Sayed, E.T.; Soweiha, H.E. and El-Steamy, M.M. (2001): Anatomical and cytopathological alterations induced by a strain of Tobacco mosaic virus in tobacco leaf tissues. Egyptian Journal of Microbiology, 36(3): 329-342. Schneider, W.C. (1957): Colorimetric analysis of sugar. Methods in Enzymology, (3). pp. 73-107. References 219 Sekine, K.; Ishihara, T.; Hase, S.; Kusano, T.; Shah, J. and Takahashi, H. (2006): Single amino acid alterations in Arabidopsis haliana RCY1 compromise resistance to Cucumber mosaic virus, but differentially suppress hypersensitive responselike cell death, plant Molecular Biology, 62(4-5): 669-682. Shang, J.; Xi, D.H.; Huang, Q.R.; Xu, M.Y.; Yuan, S.; Wang, S.D.; Jia, S.D.; Cao, S.; Zhou, Z.L. and Lin, H.L. (2009): Effect of two satellite RNAs on Nicotiana glutinosa infected with Cucumber mosaic virus (CMV). Physiological and Molecular Plant Pathology, 74 : 184-190. Sharma, A.; Mahinghara, B.K.; Singh, A.K.; Kulshrestha, S.; Raikhy, G.; Singh, L.; Verma, N.; Hallan, V. Ram, R. and Zaidi, A.A. (2005): Identification, detection and frequency of lily iruses in North India. Scientia Horticulturae, 106: 213-227. Shehata, Sawsan F. and Abdel-Aty, Lila (2005): Antimicrobial activity of the fermented Kombucha. Annals Agric. Sci., AinShams Univ., Cairo, 50(2):467-477. Sherif, E.A. and EI-Habaa, O.M. (2000): Biochemical changes and specific protein synthesis related to fungal, bacterial and viral infection in tomato plants. Annals of Agric. Sci. Moshtohor, 38: 165-177. Shrivastava, N. and Patel, T. (2007): Clerodendrum and Healthcare: An Overview- Part II: Phytochemistry and Biotechnology. Medicinal and Aromatic Plant Science and Biotechnology, 1(2): 209-223. Shulaev, V.; Silverman, P. and Raskin, I. (1997): Airborne signaling by methyl salicylate in plant pathogen resistance. Nature, 385: 718-721. Silva, H.S.A.; Romeiro, R.S.; Macagnon, D.; Halfeld-Viera, B.A.; Pereira, M.C.B. and Mounteer, A. (2004): Rhizobacterial 220 References induction of systemic resistance in tomato plants: non-specific protection and increase in enzyme activities. Biological Control. 29: 288-295. Singh, D.P.; Moore, C.A.; Gilliland, A. and Carr, J.P. (2004): Activation of multiple antiviral defense mechanisms by salicylic acid. Molecular Plant Pathology, 5, 57–63. Smith, J. and Hammerschmidt, R. (1988): Comparative study of acidic peroxidase associated with induced resistance in cucumber, muskmelon and watermelon. Physiol. Mol. Plant Pathol., 33: 255-261. Snell, F.D. and Snell, C.T. (1953): Calorimetric methods of analysis including some turbidimetric and nephelometric methods. D. van. Nostrand company Inc. Toronto. New York London., 111, 606pp. Sommer, A.; Nee'man, E.; Steffens, J.C.; Mayer, A.M. and Harel, E. (1994): Import, targeting and processing of a plant polyphenol oxidase, Plant Physiol., 105(4): 1301-1311. Stall, R.E. and Cook, A.A. (1966): Multiplication of Xanthomonas vesicatoria and lesion development in resistant and susceptible pepper. Phytopathology, 56: 1152. Stamets, P. (1994): My adventures with the blob. Mushroom – the journal (Winter) 1994:5-9. Stripe, F.; Parbiri, L.; Batteui, M.G.; Soria, M. And Lappi. D.A. (1992): Ribosome inactivating proteins from plants: present status and future prospects. Bio- technology, 10: 405-412. Stuiver, M.H. and Custers, J.H.H.V. (2001): Engineering disease resistance in plants, Nature, 411: 865-868. Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N. and Murugesan, K. (2006): First Report of Cucumber mosaic virus Subgroup II Infecting Lycopersicon esculentum in India. 90(11): 1457. References 221 Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N. and Murugesan, K. (2007): Induction of systemic resistance in Lycopersicon esculentum cv. PKM1 (tomato) against Cucumber mosaic virus by using ozone. J. Virol. Methods., 139(1): 71-7. Taha, M.A.T. (2010): Biological control of cucumber mosaic virus (cucumovirus) by certain local streptomycetal isolates. M.Sc. Thesis, Faculty of Agriculture, Ain Shams University, Cairo, Egypt. 217p. Takarai, K.; Okubo, H.; Yamasaki, S.; Takeshita, M. and Takanami, Y. (2006): A Cucumber mosaic virus isolated from Momordica charantia L. Journal of General Plant Pathology, 72 (6): 391-392. Tanaka, M.; Thananunkul, D.; Lee, T.C. and Chichester, C.O. (1975): A simplified method for the quantitative determination of sucrose, raffinose and stachyose in legume seeds. J. Food Sci., 40: 1087. Tessitori, M.; Rein, A.; Catara, V. and Polizzi, Z. (2002): Polygala myrtifolia as a new natural host of Cucumber mosaic virus. Plant Disease, 86(12): 1403-1409. Trebbi, G.; Borghini, F.; Lazzarato, L.; Torrigiani, P.; Calzoni, G.L. and Betti, L. (2007): Extremely low frequency weak magnetic fields enhance resistance of NN tobacco plants to Tobacco mosaic virus and elicit stress-related biochemical activities. Bioelectromagnetics, 28(3): 214-223. Uknes, S.; Mauch-Mani, B.; Moyer, M.; Potter, S.; Williams, S.; Dincher, S.; Chandler, D.; Slusarenko, A.; Ward, E. and Ryals, J. (1992): Biological induction of systemic acquired resistance in Arabidopsis. Mol. Plant Microbe Interact., 6: 692-698. Uknes, S.; Winter, A.; Delaney, T.; Vernooij, B.; Friedrich, L.; Morse, A.; Potter, S., Ward, E. and Ryals, J. (1993): Biological 222 References induction of systemic acquired resistance in Arabidopsis. Mol. Plant microbe Interact., 6: 692-698. Van Loon L.C.; Bakker, P.A.H.M. and Pieterse, C.M.J. (1998): Systemic resistance induced by rhizosphere bacteria. Annu. Rev. Phytopamol., 36: 453-483. Van Loon, L.C. (1985): Pathogenesis related proteins. Plant Mol. Biol., 4:111-116. Van Loon, L.C. (1997): Induced resistance in plants and the role of pathogenesis-related proteins. European Journal Plant Pathology, 103:753-765. Van Loon, L.C. (1999): Occurrence and properties of plant pathogenesis- related proteins. In: Pathogenesis-related proteins in plants Datta, S.K.; Muthukrishnan, S. (eds). Boca Raton, FL. CRC Press. Pp. 1-19. Van Loon, L.C. and Van Strien, E.A. (1999): The families of pathogenesis related proteins and comparative analysis of PR-1 type proteins. Physiological and Molecular Plant Pathology, 55:85-97. Van Loon, L.C.; Pierpoint, W.S.; Boller, T. and Conejero, V. (1994): Recommendations for naming plant pathogenesis related proteins. Plant Molecular Biology Reporter, 12: 245-264. Vance, C.P.; Kirk, T.K. and Sherwood, R.T. (1980): Lignification as a mechanism of disease resistance. Annu. Rev. Phytopathol. 18:259-288. Venkatesan, S.; Radjacommare, R.; Nakkeeran, S. and Chandrasekaran, A. (2010): Effect of biocontrol agent, plant extracts and safe chemicals in suppression of Mungbean Yellow Mosaic Virus (MYMV) in black gram (Vigna mungo). Archives of Phytopathology And Plant Protection, 43(1): 59 – 72. Verma, H.N.; Baranwal, V.K. and Srivastava, S. (1998): Antiviral References 223 Substances of Plant Origin. In: Plant Disease Control. Hadidi, A.; R.K. Khetarpal and H. Koganezawa (Eds.), APS Press, St. Paul, Minnesota, pp: 154-162. Verma, H.N. and Kumar, V. (1982): Prevention of plant virus diseases by Mirabilis jalapa leaf extract. New Botanist, 7:87-91. Verma, H.N. and Kumar, V. (1980): Prevention of plant virus diseases by Mirabilis jalapa leaf extract, New Botanist, 7: 87-91. Verma, H.N. and Varsha, I. (1995): Prevention of natural occurrence of tobacco leaf curl disease by primed Clerodendrum aculeatum leaf extract. In: Detection of plant pathogens and their management J.P. Verma, A. Verma and D.kumar, eds. Ahgeror publishers (p) Ltd New Delhi, Pages 202-206. Verma, H.N.; Varsha and Srivastava, S. (1991): Antivral agents from plants for control of viral diseases, Abstracts: International Conference on Virology in the Tropics, Lucknow, India, p. 250. Vermerris, W. and Nicholson, R.L. (2006): Phenolic Compound Biochemistry. 284 pp. Published by Springer, P.O. Box 17, 3300 AA Dordrecht, The Netherlands. Vernooij, B.; Friedrich, L.; Ahl-Goy, P.; Staub, T.; Kessmann, H. and Ryals, J. (1995): 2,6-Dichloroisonicotinic acid-induced resistance to pathogens does not require the accumulation of salicylic acid. Mol. Plant-Microbe Interact., 8: 228-234. Vivanco, J.M.; Querci, M.; and Salazar, L.F. (1999): Antiviral and antiviroid activity of MAP containing extracts from Mirabilis jalapa roots. Plant Dis., 83: 1116-1121. Walter, D.; Newton, A. and Lyon, G.D. (2007): Induced Resistance for Plant Defence: A Sustainable Approach to Crop Protection. 1st. ed., Blackwell Publishing Ltd, Oxford, UK, 272pp. Ward, E.R.; Uknes, S.J.; Williams, S.C.; Dincher, S.S.; Wiederhold, D.L.; Alexander, D.C.; Ahl-Goy, P.; Metraux, J.P. and Ryals, 224 References J.A. (1991): Coordinate gene activity in response to agents that induce systemic acquired resistance. Plant Cell, 3: 1085-1094. Wettstein, D. (1957): Chlorophyll-letale and submikroskopishe fromvechsel derplastiden. Experimental cell Research, 12: 427506. (English abstract) White, R.F. and Antoniw, J.F. (1991): Virus induced resistance responses in plants. Plant Science, 9: 443-455. Wieslander, L. (1979): A simple method to recover high molecular weight RNA and DNA after electrophoresis separation in low gelling temperature agarose gels. Anal. Biochem. 98: 305-308. Wojtaszek, P. (1997): Oxidative burst: an early plant response to pathogen infection. Biochem.J., 322: 681-692. Wood, I.G.; Gluck, A. and Endo, Y. (1992): Ribotoxin recognition of ribosomal RNA and a proposal for the mechanism for translocation. TIBS, 17: 266-269. Wray, J.L. (1992): Inducible Plant Proteins: Their Biochemistry and Molecular Biology. Society for Experimental Biology, Seminar Series: 49, 1st Pub., Published by the Press Syndicate of the University of Cambridge, UK, 309pp. Yalpani, N.; Silverman, P.; Wilson, T.M.A.; Kleier, D.A. and Raskin, I. (1991): Salicylic acid is a systemic signal and an inducer of pathogenesis-related proteins in virus-infected tobacco. Plant Cell, 3:809-818. Yalpani, N.; Leon, J.; Lawton, M. and Raskin, I. (1993): Pathway of salicylic acid biosynthesis in healthy and virus-inoculated tobacco. Plant Physiol. 103:312-315. Yang, X.; Liangyi, K. and Tien, P. (1996). Resistance of tomato infected with cucumber mosaic virus satellite RNA to potato spindle Tuber viroid. Ann. Appl. Biol., 129: 543-551. References 225 Yardimci, N. and Eryigit, H. (2006): Identification of Cucumber mosaic virus in tomato (Lycopersicon esculentum) growing areas in the north-west Mediterranean region of Turkey. New Zealand Journal of Crop and Horticultural Science, 34(2): 173 – 175. Zahra, A.M. (1990): Studies on wilt disease of sesame (Sesamum indicum L.) in upper Egypt. Ph.D. Thesis, Fac. Agric., Assuit Univ. Zaitlin, M. and Hull, R. (1987): Plant virus-host interactions. Annual Review of plant Physiology, 38: 291-315. Zambolim, E.M.; Assais, M.I.T.; Zambolim, L.; Venturia, J.A. and Carvalho, j.M.G. (1994): Natural infection of banana cultivar prata (AAB) by cucumber mosaic virus in the state Minas Gerals, Brazil. Fitopathologia Brasilena, 19(3): 483-484. Zehnder, G.W.; Yao, C.B.; Murphy, J.F.; Sikora, E.R. and Kloepper, J.W. (2000): Induction of resistance in tomato against cucumber mosaic cucumovirus by plant growthpromoting rhizobacteria. Biocontrol, 45 (1): 127-137. Zitikaitė, I. and Samuitienė, M. (2009): Detection and characterization of cucumber mosaic virus isolated from sweet peppers. Scientific Works of the Lithuanian Institute of Horticulture and Lithuanian University of agriculture. Sodininkystėir Daržininkystė, 28(3): 281-288. 226 References ﺍﺳﺘﺤﺜﺎﺙ ﺍﳌﻘﺎﻭﻣﺔ ﺍﳉﻬﺎﺯﻳﺔ ﺿﺪ ﺑﻌﺾ ﺃﻣﺮﺍﺽ ﺍﻟﻄﻤﺎﻃﻢ ﺍﻟﻔﲑﻭﺳﻴﺔ ﺭﺳﺎﻟﺔ ﻣﻘﺪﻣﺔ ﻣﻦ < <á]çã<àè‚Ö]<g¦<á]çã<á^µc < <NLLN<Dl^fÞ<š]†Ú_E<íéÂ]…ˆÖ]<Ýç×ÃÖ]<Œçè…çÖ^Óe < <NLLS<Dl^fÞ<š]†Ú_E<íéÂ]…ˆÖ]<Ýç×ÃÖ]<jŠq^Ú < <^ãße<íÃÚ^qI†ãjÚ<íÂ]…‡<íé×Ò ﻻﺳﺘﻴﻔﺎء ﻣﺘﻄﻠﺒﺎﺕ ﺍﳊﺼﻮﻝ ﻋﻠﻰ ﺩﺭﺟﺔ ﺩﻛﺘﻮﺭﺍﺓ ﺍﻟﻔﻠﺴﻔﺔ ﰲ ﺍﻟﻌﻠﻮﻡ ﺍﻟﺰﺭﺍﻋﻴﺔ ﺃﻣﺮﺍﺽ ﺍﻟﻨﺒﺎﺕ )ﺃﻣﺮﺍﺽ ﻓﲑﻭﺳﻴﺔ( ﻗﺴﻡ ﺍﻝﻨﺒﺎﺕ ﺍﻝﺯﺭﺍﻋﻲ )ﻓﺭﻉ ﺃﻤﺭﺍﺽ ﺍﻝﻨﺒﺎﺕ( ﻜﻠﻴﺔ ﺍﻝﺯﺭﺍﻋﺔ ﺒﻤﺸﺘﻬﺭ ﺠﺎﻤﻌﺔ ﺒﻨﻬﺎ ٢٠١٠ א א )(' & $%א #א" ! و ع אض א א א א ، א א ! ،* ) ،*+,و -%ع א01و) א./و) ، א א=6 K23 4 ) ،ل ; ز א אD#* ٢٠٠٩L٢٠٠٨ – ٢٠٠٨L٢٠٠٧ 789 Eوא/P"+وאOאضא01و"Nא789دونאHIJKא"#G+אم א#/אوא8.و(א 7IZ8[Q RאWXYאVوאTUא وאT+لאS #+ ^]\(9لא אא K1X ﺍﳉﺰء ﺍﻷﻭﻝ و_8אD#*`/א"b#JU+א ,+aא01و"אUT!1+G/لאN789 cلXEאوgTא אU/א' efא"9א +6dאא0و) jFאiא_Eא0مאR/د08lو"&0Wوس زא(-א0، lوسزא(- א6#ن0،وس# pو אقא789א0،1U/وسوאqא279و0وس2IאK279 و)#ن&0Irو"I4Q#(#د(0FوسوאE#cوjF96I 0 Zوس دא 6א KEو) #ن _eא א q#] fאض א iא01و" j א/زא(-و א uvw+و jאو # pو א1א .tو] Z.s &,لא01و" *K وyאאx(V/و *]#tو)#ن0وسزא(-א lאjs CMVzU+G/ .]Wא 4אiא01و""אJא1د(وא}~-%،{lو]ً)}+ א" ] 9א_ א [/א1/د Qא *a.( fא01وس a Wא ` C. % t amaranticolorא א01وس Kو~ jIא01وس Nא]a W U د6ن)]زאKو~א #}+(&Z#+א"א[}،و#א$א א،و7قא }+aא،1+G/ و(Q,(=6N}a.א )Zم+Eא،Qود א"6א}א'(1وDא،8 / وً06א ~ א }+(& Z 'j+א0و) א" 9א +6dא و 'aא +אUT+/ */9دونًNא/א)_א/قوא\N*D /ل]gG,و] (א01و" א] K -١- ا ا ﺍﳉﺰء ﺍﻟﺜﺎﻧﻲ cو=6Zلא #א"א(K+وא9+אHI+و" و/Pو אOאض א01و" "#G+אم " 7 jT+א Jو ً UG+ j t]aא M. jalapaوא;4א1 C. inermeدQو ،9+و 0و %&NFvZאאل jEوא`tאQ0Ft8.وq%+].], N a(0+. Wא q,א R6Oو]1ز 8\ } Nض (Rو א وא 8.و אR/دא א( وRدא א01و" و +وאد Rد Q# QوKEsaI 9, و-]0R~#vא NjT+/عאضא.א א* ) Jو#v א" " p N *c W J 0+6א 21a N Jאل و Kb6 d\ Nو)(' \Z8א(#+אوאT+אwو]وאsaiوא(a.IZT+Vא+ ]aא8789وא*ز(א#[jT+/א01و"א] K}#Z ﺃﻭﻵ :ﲡﺎﺭﺏ ﺍﺳﺘﺤﺜﺎﺙ ﺍﳌﻘﺎﻭﻣﺔ ﺍﳉﻬﺎﺯﻳﺔ #$ J١א" א! א א א א א وא! -456ن 1%2*3وسو-$.ن*+א)"('&% ! א 46ز3دא >" א*=<39:#$.;*+א،و$+دא@ א א ، %! Iو GHא<$+ ، 4Fد -ذ#ع א BCو 2א*K GLM KA @ Rא NS ، =Qא R@ > !Fא B" ، PM6Qא*=< > N3O א!K# J٢א" Xאش אد א 6$و P2& 45א 1وس V ;*+ج و< Y6د * 1و" @3- ٧ $م P6אش ،وMن > [M-א< אא`אSو%*5-ز3د>א< א_*^B]F*6 א* 4و א K*6@6 ! #26 Hو@# P6 ً63 ٢٥ $ش א< א2b ;*+-dSو< Y6د* 1وس=א@S*6و45-ز3د> א< א g*hאf<S #26 Hول Kو $31א]%S *Gאو< k& %lمو< P+3jא< א*وMن-و%i א<P+OאشB F*hא*n4א%*3%*mnHאش ا ا -٢- א` א 3$2 KSא okpو > %%6א< א@ *6وא! *6@6 & rز3د ط * Gא > okpא< א@ P+ *6א! K*6@6وMن ط א و$Mאز > ;*+-א< א _*^ ]F*6א< 6- K א] <sل -و$Mאز Ssن > ً M-א< א B g*h א*K4א"<1אشא`אSط3kVt6א و$Mאز>א< א! 1 2uوس %*3 Kא< P+ Oאش _*^ ]F*6א< 6- ، = $@ tא dSs P2vز3د = tאش B g*hא*< 4 אG*dY1wא3kد=אشg*hאKHوx1א<="=*d y6אtא<s]*]okpل-و$MאزK 3$2 J٣א R6v ]Sא* r& Gز3د > tא< א א` א 1 %<2& 45 Sوس %*3ز3د = אش g*hאn H Bא**mn4طא*KF - r& J٤ن '! א 4א > ]|Yא< < > g5א< אP+ F א*-)VKنא א ;*+אא! 12uوس زאد uא[ - 4s#*M P6و } و !' GLMא#Sو و ':א B g*hא* n 4א n Hא %< ^*Cو :-א #א` אKS وx1אy6dn$&~&9א< א 12bوسو<x1אKBf J٥زאد uא< א! 2uوא@ P+ *6א! P6 *6@6 א<1لKوMن<1* kM;*+-لא>]*Sא< אBg*h א*# n 4א` א SوMن א3kد > 45-א< א g*h א^*:nHא*f<S#26 FولKو@P2&$א< 1وس زאد א )<1א = *Sאش B g*hא* t*3 4אش *hط א 1و" nא`אSو :-אًאشg*hאKH -٣- ا ا 3$2 %l- J٦אQض א<و P6 3ع RNAא *Sو- $.ن > @16 %M א< א! 1 2uوس وא א` אB g*h n S א*g*6%*34אnHאش*hطא*KF - J٧د א@ *6א:.4+k13vص2hو s6وسCMV > א 1%<2&45وسKوk+ $5لאو5ys@6אK$+ و26 < t#26و x1< *n 6א 1وس و 9|@ :- P6 PS 1*mא"V;*+%nجx1אوذG<3P+Gא< K J٨א @s n $6 :א 1وس = אش א وو- $.ن א< א $ 3$2 $@ ' *6 d'-א 'pض > א< א@K*6و-ن*+אd1@i-k1א<طא 1*]iوس@3$2$ 3$23P+ً.KkMאy2אkMn$6;*+5*@i א 1وسK ً ﺛﺎﻧﻴﺎ :ﲡﺎﺭﺏ ﺍﳌﻘﺎﻭﻣﺔ ﺍﳉﻬﺎﺯﻳﺔ ﺍﳌﺴﺘﺤﺜﺔ 26= J١و6א 1وس א@& ! dn$א א א א 1 2bوس وא! = 2uא@G* P6 K*6 א! א -ن א< B" = 5- dMא*=< > 39: #$.א 2sو d6אf:אق אvא א< ،*5زאد $+-אد אQو +א< B: P6 *5و، Av وGLMא@ א א!*،زאدGHא<> [ %lK4Fא< א > d* Fאא Bא 39CאF 4F<* Sא< א@د وא)"،E]=<1و<$+>g5دو4Sאkvمא K|+ d J٢א)"1د#P6د 4@sא* א@א*1א > Vج و< > $3$.א< 26و 1* 6وس3- ٧ $@ Kم # P6ش א< א א 2bא` א > dS Sא< G* P6 M ;*+- אو< Kو%*5-ز3د>dMא< א_*^B]F*6א*4و ا ا -٤- א#P6ً63 ٢٥$@6-K*6@6 !#26Hشא< אdS2b ;*+و< Y6د * 1وس = א@ S *6و 45-ز3د >א< א g*hאf<S #26 Hول Kو $31א]%S *Gאو< k& %lمو< P+3jא< א*وMن-و%i א<P+OאشB F*hא*n4א%*3%*mnHאش א` א 3$2 KSא okpو > %%6א< א@ *6وא! *6@6 & rز3د ط * Gא > okpא< א@ P+ *6א! K*6@6وMن ط א و$Mאز > ;*+-א< א _*^ ]F*6א< 6- K א] <sل -و$Mאز Ssن > ً M-א< א B g*h א*K4א"<1אشא`אSط3kVt6א و$Mאز>א< א! 1 2uوس %*3 Kא< P+ Oאش _*^ ]F*6א< 6- ، = $@ tא dSs P2vز3د = tאش B g*hא*< 4 אG*dY1wא3kد=אش g*hאKHوx1א<="=*d y6אtא<s]*]okpل-و$MאزK n3 J٣ز !'y3א< א2Iم@*א4א>]|Yא< אP+F א* Kو&- rن 26و 6א 1وس > א< א 2bא@ ";*+$+ز3دuא[،} ،-4s#*MP6و!'GLMא#Sوو': א B g*hא* n 4א n Hא %<6 ^*Cو :-א #א` אKSوx1אy6dn$&~&9א< א 12bوسو<x1אKBf J٤א )<1א*Sزאد >א< א2bوא@P+ *6א! K*6@6 وMن<1*kM;*+-لא>]*Sא< א Bg*hא*n4 #א` א SوMن א3kد > 45-א< א g*hאn H ^*:א*f<S#26 FولKو@P2&P6 ٢٥$א< 1وسزאد א )<1א=*SאشBg*hא*t*34אش*hطא 1و" nא`אSو :-אًאشg*hאKH -٥- ا ا 3$2 J٥אQض א<و RNA 3א3- ٧ $@ *Sم # P6ش א< א2b 1وسو-$.ن>@16%Mא< אBg*hא*t*34 #א`א^*:nSא*Fو :-אًאشg*hא$@6-KH 3 ٢٥م -د אش B g*hא*# t*3 4א` א ;*+- V Sز3د > אQضא<وRNA3א>t*3*SذGאشghא^*:nH א*f<S#26FولK -r& J٦نuא#$[Sא א>*Sא< א 12bوسو@3- ٧$م $5%#P6زאد=א@*6א`אBg*hnSא*t*34אش *ط nאش g*hא3 ٢٥ $@ 6- KHم P6אش $2sزאد א#$[Sא א = *Sאش B g*hא* t*3 4אش g*h א Hو 45- dMز3د = אش *hط א* t*3 Fאش א` אVSذאf<Sd#56ولK %l- J٧א=}#א2و6א s$iوس6زאG3א>#CאK و$5ذ9:P6ً3OGل5س$א'pضو^3$2 ط א 1وس א kM } ]iא 1وس $+ ;*+ A< ً.د אy2 א@iא;*+Sא@|4אK*F1<6*6@64St<2&$@GLgFو$5 د#ش אא 12bوسB g*hא*^V4 $אض > t*3ذ Gאش g*hא# n Hא` א Sو :-אً *mطg*6א<f<S#26ولK ا ا -٦- ﺍﳋﻼﺻــــــــﺔ ('& !"#$%אאلوو وسزא א 5**6 # *7א 2.*34א)*+ # ,' -.* (/ 0 1 א)>%אً:;<:א !"8*9אא#א ,و*5אBCDא?@A א02.*34א-.*1א%E*7א K א'& 5**6 # I*6 5*@%&'( Jא '*H 0 ;<:> IHא-G %Qאא ، O'MPو 'Cא * L%س א 5*%1א L% ً*6( ;M1ن # <:*>>*RST6< 9U*3Vא5*66(1א,%'W5**60E1وR*C אDאض א # 66('1א ,و* *3Q ، 5א'&م K*3O@%&'( T%C ً*X وא'&م ً*Xא[\ א: _%*: #G*QF *[63:ن ; #אع #א* ':6 وא ; 37א* a 3אً L%א E`*Mو('*,د #وא[\ %א0 5*G*: א 0 *"3d 8*9 `*Mא #אgא? א!fא Gوא# <: ae אDאض 0א*(lن وאkאن وא *3Q 5*6د L% Jذ א h*iDא;M1 وא[ L% `'m *Onאد *Xد; :3%و>* K5و oG*' #I6אא ن % א1אد א' 5**6 J<nא*'q L% 2.*34ج >و**X 5د; ,%وس >(? '*,و Kو J'69א'א 5א' mMوא H3:وא0 *OH*r sg א'h*<nא*1وא0kאE5*6א ,*>>*Rlو* K5 eC #ل אא ل و Iaא*1و א* 0 $@&'1و وس زא א 5*6 0 *7א> 2.*34א 4א*6'Ctא 5א sgو* א'*>B*PoGא5*a#5*gوK6(5*%وt*PQU عw*rM%ًt*xא5*@%&'(1وאא[\א-u0;v'&1א*1وא*, Eא ,وس[*ًL%א|3عא{Ju`X7وzא@>و0א Kyk -٧- ا ا ﺍﻟﺘﻮﺻﻴـــــــﺎﺕ _Rאא*1وא ,و*5א2.*34%E31و *H0R*Cوس زאא*6~>*7عא47א5א} W >*' J١א 0 5**6א y'M1وא@> وא*)'*> ykم وא'*@sل ` 5**6 @*>وא'&k*>*O$%قوU>ًtول K J٢زא?[5*6אH5*6Qy%لאkلوHאضאאو0R*C א 5*H*(1א@ ; fא*'l @@&1ج א!6و و >א oא> * 5**6و وذ،IEfو*3"tنא5*6ودaL%א M> 8א# 5 ,*O.زאد*.;*.د;3gאMkא5א;*4و*#*Vא'!f FאeC # ;' %1ل $d t ;M h*iאא * EI 2.*34%א # *3kאMkא 5א* %و@ v' !Qאً وאق وא!gو א&'( Aم ('& *O@%א* 0 *,> _G*1و א# <: אDאضوR*Cא ,و K !a J٣و [' 5eא y6 2.*34אא ١٥ ;1د 0א $%&'(1א_G*1 ?[5**6אy%وא*Iو،*3OT%Cو0א[\אF*[63:א3g > KE٪٥٠ Qش 5**6א*)'*> 2.*34م ١٥ – ١٠ yQم >א # ['*O%وL'HوJא@ل>*$%&'(1א5**6%_G*1א(*>وא[\ אQ*>*[63:א(*ذK Q ا ا -٨-