Inducing systemic resistance against some tomato virus diseases

Transcription

Inducing systemic resistance
against some tomato virus diseases
By
E m an Shahw an M oheb E l-l - D in Shahw an
B.Sc. Agric. Sci., (Plant Pathology) 2002
M.Sc. Agric. Sci. (Plant Pathology) 2007
Fac. Agric., Moshtohor, Banha Univ.
DISSERTATION
Submitted in Partial Fulfillment of the
Requirements for
The Degree of
DOCTOR OF PHILOSOPHY
in
PLANT PATHOLOGY
(V iral D iseases )
Agricultural Botany Department
(Plant Pathology)
Faculty of Agriculture, Moshtohor
Banha University
2010
Title:
INDUCING SYSTEMIC RESISTANCE AGAINST SOME TOMATO VIRUS DISEASES
Name: E m an Shahw an M oheb E ll - D in Shahw an
Degree: DOCTOR OF PHILOSOPHY
Department: Agricultural Botany (Plant Pathology)
ABSTRACT
The objectives of this study were isolation and identification of the most
frequently and economically viruses causing serious losses in tomato crop in
the different location of Qalyoubia Governorate, evaluating some medicinal
plant extracts and kombucha filtrate as biotic inducers to induction systemic
acquired resistance in the tomato plants against CMV and using more effective
bioinducers as bioelicitors for control viruses infection via induction
'pathogenesis-related' (PR-1a) genes.
Target virus was chosen according to its more frequently and severity
among the isolated viruses in these locations at the winter season from the
study year. Isolated virus was confirmed biologically and serologically assays.
Extracts of two medicinal plants (Clerodendrum inerme L. Gaertn and
Mirabilis jalapa L.) and were individually or in mixture in addition to
kombucha filtrate were evaluated as bioinducers. All the four inducers were
successfully in the induction of systemic acquire resistance (SAR) in the
uninoculated tomato plants and sprayed with (50% v/v) of inducers.
Tested bioinducers were used as biocontrol to inhibiting the virus
infection of tomato plants as spraying every 15 days under greenhouse
conditions. Pathogenesis-related (PR-1a) gene was molecularly isolated and
identified via sequencer which compared with those recorded in the Gen-Bank.
In conclusion, using medicinal extracts and other natural inducers
were promise with good systemic acquired resistance against the great
numbers of plant pathogens. In future, induction of resistance can be
done cheaply and easily using natural substances
CONTENTS
Page
LIST OF FIGURES ...................................................................................... i
LIST OF TABLES ...................................................................................... iv
LIST OF PLATES..................................................................................... vii
LIST OF ABBREVIATIONS ................................................................. ix
INTRODUCTION ........................................................................................ 1
REVIEW OF LITERATURE .................................................................. 4
MATERIALS AND METHODS .......................................................... 44
EXPERIMENTAL RESULTS .............................................................. 73
Part I
1- Disease incidence and frequency of virus .................................... 73
2- Confirmation of Cucumber mosaic virus (CMV) ...................... 75
2.1. Host range ......................................................................................... 75
2.2. Transmission of CMV ................................................................... 78
2.3. In vitro properties ............................................................................ 78
2.4. Inclusion bodies ............................................................................... 80
2.5. Dot blot immunoassay (DBIA) ................................................... 80
Part II
Evaluation of biotic inducers of systemic acquired
resistance and biocontrol of CMV ................................................ 82
A. Induction of systemic acquired resistance (SAR)
by biotic inducers before virus inoculation .................... 82
1. Histopathology changes ........................................................... 82
2. Biochemical changes ................................................................. 86
2.1. Antiviral Proteins...................................................................... 86
a. Determination the elicited antiviral protein as response to
induction SAR (pre-inoculation) after 7-days........................... 86
b. Determination the elicited antiviral protein as response to
induction SAR (post-inoculation) after 25-days....................... 89
2.2- Oxidative enzymes .......................................................................92
a. Peroxidase isozyme in tomato plants sprayed with biotic
inducers to induce SAR (pre-inoculation) after 7-days ............92
b. Peroxidase isozyme in tomato plants sprayed with biotic
inducers to induce SAR (post-inoculation) after 25-days ........95
c. Polyphenol oxidase isozyme in tomato plants sprayed
with biotic to induce SAR (pre-inoculation) after 7-days........ 98
d. Polyphenol oxidase isozyme in tomato plants sprayed
with biotic to induce SAR (pre-inoculation) after 25-day.... 101
2.3. Quantification of total SA in tomato plants
treated with biotic pre-virus inoculation ..................... 104
2.4. Photosynthetic pigments content.......................................... 109
2.5. Determination of phenolic compounds .......................... 110
2.6. RNA determination in tomato plants treated with
biotic inducers pre-virus inoculation.......................... 112
3. Molecular marker for SAR detection ............................113
Analysis of molecular data by Bioinformatics ...................... 116
1- Nucleotide sequence ....................................................................... 116
2- Translation of partial nucleotide sequence of PR-la
gene for tomato plants treated with biotic inducers ....121
4- Effect of biotic inducers on virus infectivity during
induction of SAR as follows................................................... 126
B- Using of biotic inducers as bioinducers to control CMV
infection ................................................................................................ 128
1. Histopathological changes ....................................................... 128
2. Biochemical changes ................................................................... 131
2.1. Antiviral proteins.................................................................. 131
a. Determination the elicited antiviral protein as
response to treatment with bioinducers to control
infected tomato plants after 7 days of spraying ............... 131
b. Determination the elicited antiviral protein as
response to treatment with bioinducers to control
infected tomato plants after 25 days of spraying ............ 134
2.2. Oxidative enzymes ................................................................ 137
a. Peroxidase isozyme in infected tomato plants and
sprayed with bioinducers to control CMV after 7 days
of spraying.................................................................................. 137
b. Peroxidase isozyme in infected tomato plants and
sprayed with bioinducers to control CMV after 25days of spraying ........................................................................ 139
c. Polyphenol oxidase isozyme in infected tomato
plants and sprayed with bioinducers to control CMV
after 7 days of spraying .......................................................... 143
d. Polyphenol oxidase isozyme in infected tomato
plants and sprayed with bioinducers to control CMV
after 25 days of spraying ........................................................ 145
2.3- Photosynthetic pigments content ................................... 149
2.4. Determination of total phenols ........................................ 151
2.5. Total free amino acids content in inoculated
tomato plants and treated with bioinducers ............ 152
2.6. Total carbohydrates content in inoculated tomato
plants and treated with bioinducers ........................... 154
3. Effect of bioinducers on virus infectivity ........................... 155
DISCUSSION ............................................................................................ 157
SUMMERY ................................................................................................ 188
REFERENCES ......................................................................................... 198
ARABIC SUMMARY
LIST OF FIGURES
Page
Figure 1 Conceptual model for the pathway leading to the
establishment of SAR ........................................................... 29
Figure 2 Standard curve of the protein concentration using bovine
serum albumin as a standard protein. .................................. 57
Figure 3 Standard curve of glucose for determination total
carbohydrate. ........................................................................ 66
Figure 4
Standard curve of total RNA................................................ 67
Figure 5 Disease incidence and disease severity of natural viruses
affecting tomato at 5 different locations in Qalyoubia
Governorate. ......................................................................... 74
Figure 6 Effect of biotic inducers on protein content in tomato
plants pre virus inoculation................................................... 87
Figure 7 Effect of biotic inducers on protein content in tomato
plants post virus inoculation ................................................. 90
Figure 8 Effect of biotic inducers on POD activity in tomato before
CMV inoculation. ................................................................. 92
Figure 9 Effect of biotic inducers on POD activity in tomato plants
infected with CMV. .............................................................. 95
Figure 10 Effect of biotic inducers on PPO activity in tomato plants
pre- CMV inoculation. ......................................................... 98
Figure 11 Effect of biotic inducers on PPO activity in tomato plants
infected with CMV. ............................................................. 101
Figure 12 HPLC quantification of free and endogenous SA in
induced tomato plants......................................................... 105
Figure 13 Histogram illustrates the RNA content values in the
leaves of tomato plants treated with bioinducers
compared with healthy ........................................................ 113
i
Figure 14 The partial nucleotide sequence of DNA (182 bp) from
mRNA of PR-la gene of tomato plants treated with biotic
inducers. .............................................................................. 115
Figure 15 Multiple sequence alignment of the partial nucleotide
sequence of the PR-1a gene for tomato plants with
the corresponding sequence of six pathogenesis related
protein available in Gen-Bank............................................ 119
Figure 16 A Phylogenetic tree of tomato plants treated with
bioinducers and other crops. ............................................ 120
Figure 17 Histogram illustrates nucleotide frequencies of PRgene of tomato plants related to other PR-la gene of
different crops in GenBank. ............................................. 120
Figure 18 Translation of partial nucleotide sequence of PR-la gene
for tomato plants treated with biotic inducers produced
60 amino acids with MW = 6.383 kDa. .............................. 121
Figure 19 Multiple amino acids sequence aligned of the partial PR-1a
gene of the studied tomato plants with the corresponding
amino acid sequence of eleven pathogenesis related protein
of different hosts available in GenBank. ............................... 123
Figure 20 A phylogenetic tree of PR-la gene tomato based on the
amino acid sequence of the PR-la gene. ................................ 124
Figure 21 Effect of bioinducers on disease severity and virus
infectivity in tomato plants.................................................. 127
Figure 22 Effect of bioinducers on protein content in tomato plants
infected with CMV (after 7 days)......................................... 132
Figure 23 Effect of bioinducers on protein content in tomato plants
infected with CMV (after 25 days)....................................... 135
Figure 24 Effect of bioinducers on POD activity in tomato plants
infected with CMV (after 7 days) ........................................ 137
Figure 25 Effect of bioinducers on POD activity in tomato plants
infected with CMV (after 25 days). ..................................... 140
ii
Figure 26 Effect of bioinducers on PPO activity in tomato plants
infected with CMV ............................................................. 143
Figure 27 Effect of bioinducers on PPO activity in tomato plants
infected with CMV. ............................................................. 146
Figure 28 Effect of bioinducers on total free amino acids in tomato
plants infected with CMV. .................................................. 153
Figure 29 Effect of bioinducers on total carbohydrates content in
tomato plants infected with CMV ...................................... 155
Figure 30 Effect of bioinducers on CMV infectivity in tomato plants.156
iii
LIST OF TABLES
Table 1
Page
Preparation of SDS-PAGE gels. .............................................. 59
Table 2
Pathogenesis related protein (PR-1a gene) of different
crops in GenBank. ................................................................... 71
Table 3
Eleven Pathogenesis related protein (PR-1a gene) amino
acids of different hosts published in GenBank........................ 72
Table 4
Detection of viruses naturally infected tomato plants. ............ 73
Table 5
The disease incidence and disease severity of naturally
viral infected tomato plants in different 5 locations
(Qalyoubia Governorate)......................................................... 74
Table 6
The reactions of plant host species and cultivars inoculated
with CMV isolate. ................................................................... 76
Table 7
In vitro properties of CMV isolate in infectious crude sap
under laboratory conditions..................................................... 79
Table 8
Anatomical variations of tomato leaf treated with biotic
inducers (lengths measured by µm)......................................... 83
Table 9
Protein content and enzyme activities in tomato plants
treated with biotic extracts........................................................ 87
Table 10
Protein fractions of tomato plants treated with bioinducers
using SDS-PAGE..................................................................... 88
Table 11
Protein content and enzyme activities in infected tomato
plants then treated with biotic extracts. ................................... 90
Table 12
Protein fractions of CMV infected tomato plants treated
with bioinducers using SDS-PAGE. ...................................... 91
Table 13
Disc-PAGE banding patterns of peroxidase isozymes of
tomato plants non-inoculated with CMV and treated with
bioinducers. ............................................................................. 94
Table 14
tomato plants treated with bioinducers then infected by
CMV. ....................................................................................... 97
Table 15
Disc-PAGE banding patterns of polyphenol oxidase
isozymes of tomato plants treated with bioinducers ............ 100
iv
Table 16
Disc-PAGE banding pattern of polyphenol oxidase
isozymes of tomato plants treated with bioinducers then
infected by CMV. ........................................................... 102
Table 17
Protein genetic markers of tomato plants produced by
bioinducers as indication of systemic acquired resistance
against CMV infection ........................................................ 104
Table 18
Quantification of total SA in tomato plants treated
with bioinducers compared with healthy plant..................... 105
Table 19
Chlorophyll and carotenoid contents (mg/g FW) in tomato
plants treated with biotic inducers........................................ 110
Table 20 Free, conjugated and total phenols content in tomato plants
treated with biotic inducers. .................................................. 111
Table 21
Comparison between tomato plants (treated with biotic
inducers) in RNA contents and healthy, inoculated controls .112
Table 22
Comparison between bases composition of partial PR-la
gene for tomato plants treated with biotic inducers and six
pathogenesis related protein published in Gen-Bank. ........... 117
Table 23
Comparison between amino acids composition of partial
PR-la gene sequence for tomato plants treated with
bioinducers and 11 pathogenesis related protein of
different hosts published in GenBank. .................................. 125
Table 24
Effect of bioinducers on CMV infectivity in tomato plants. ..... 126
Table 25
Effect of bioinducers on anatomical structure of
tomato leaves post-CMV inoculation (lengths
measured by µm). .................................................................. 129
Table 26
infected with CMV and treated with biotic extracts (after 7
days)....................................................................................... 132
Table 27
Protein fractions of tomato plants infected with CMV and
treated with bioinducers using SDS-PAGE........................... 133
Table 28
infected with CMV and treated with biotic extracts (after
25 days).................................................................................. 135
v
Table 29
Protein fractions of CMV infected tomato plants treated
with bioinducers using SDS-PAGE................................ 136
Table 30
CMV infected tomato plants treated with bioinducers.......... 138
Table 31
CMV infected tomato plants treated with bioinducers.......... 141
Table 32
isozymes of CMV infected tomato plants treated with
bioinducers. ........................................................................... 144
Table 33
bioinducers. ........................................................................... 147
Table 34
Disc-PAGE banding patterns of polyphenol oxidase isozymes
of CMV infected tomato plants treated with bioinducers. ....... 149
Table 35
Chlorophyll and carotenoid contents in tomato plants treated
with bioinducers after CMV inoculation............................... 150
Table 36
Free, conjugated and total phenols content in tomato plants
treated with bioinducers after CMV inoculation. .................. 152
Table 37
Total free amino acids content in tomato plants treated with
bioinducers............................................................................. 153
Table 38
Total carbohydrates content (mg/g FW) in infected tomato
plants treated with bioinducers.............................................. 154
Table 39
Effect of individual bioinducers on post CMV infection in
tomato. .......................................................................................... 156
vi
LIST OF PLATES
Page
Plate 1
Different types of natural infection symptoms on tomato
leaves showing mosaic, mottling, blisters, crinkle, yellowing,
malformation and erecting.......................................................... 45
Plate 2
Plant leaves inoculated with CMV isolate showing local
symptoms on Chenopodium murale, C. quinoa, C.
amaranticolor and Datura metel. ............................................... 77
Plate 3
Host plants mechanically inoculated with CMV isolate showing
different types of symptoms on leaves. ...................................... 77
Plate 4
Epidermal strips and hairs of cucumber leaves infected with CMV
(15 days post inoculation) showing cytoplasmic inclusion bodies,
(Magnification of Light micrograph 400X). (A) CI: Crystalline
inclusion bodies. (B) AI: Amorphous inclusion bodies.. .................. 80
Plate 5
Dot Blot Immunoassay for CMV precipitation against specific
IgG-CMV polyclonal. ................................................................ 81
Plate 6A Anatomical variations in tomato leaves treated with
bioinducers. ................................................................................ 84
Plate 6B Light micrograph of tomato leaves sprayed with biotic
inducers and infected with CMV showing different changes
in cells and tissues (40X)............................................................ 85
Plate 7
pre CMV inoculation using SDS-PAGE. ................................... 88
Plate 8
post CMV inoculation using SDS-PAGE. ................................. 91
Plate 9
Native acrylamide gel (7%) electrophoresis of POD isozymes
produced in tomato plants treated with bioinducers pre CMV
inoculation. ................................................................................. 94
Plate 10 Native acrylamide gel (7%) electrophoresis of POD isozymes
produced in tomato plants treated with bioinducers post CMV
inoculation. ................................................................................. 97
vii
Plate 11 Native acrylamide gel (7%) electrophoresis of PPO isozymes
produced in tomato plants treated with bioinducers pre-CMV
inoculation. ............................................................................... 100
Plate 12 Native polyacrylamide gel (7%) electrophoresis of PPO
isozymes produced in tomato plants treated with bioinducers
post CMV inoculation. ............................................................ 103
Plate 13 2.5% agarose gel electrophoresis showing the amplified PCR
product of mRNA of PR-1a gene of tomato plants treated
with bioinducers at the correct size (182 bp). .......................... 114
Plate 14 Light micrograph of tomato plant treated with bioinducers
post CMV inoculation showing different changes in cells and
tissues (40X)............................................................................. 130
Plate 15 Protein fractions of tomato plants treated with bioinducers
post CMV inoculation using SDS-PAGE. ............................... 133
Plate 16 Protein fractions of tomato plants treated with bioinducers
post CMV inoculation using SDS-PAGE. ............................... 136
produced in tomato plants treated with bioinducers post
CMV inoculation...................................................................... 139
CMV inoculation...................................................................... 142
CMV inoculation...................................................................... 145
CMV inoculation...................................................................... 148
viii
LIST OF ABBREVIATIONS
A
AIB
APS
ASA
AVP
Bp
BA
BA2H
BI
BSA
BPB
C
CarMV
°C
Chl.a
Chl.b
cm
Cp
cDNA
CBB
CIB
Ci
CMV
cv.
dNTP
DEP
DS
DTT
DBIA
DAS-ELISA
EDTA
e.g.
EAVPs
et al.
FW
g
G
HPLC
:Adenine
:Amorphous inclusion bodies
:Ammonium persulfate
:Acetyl salicylic acid.
:Antiviral protein.
:Base pair
:Benzioc acid
:Benzioc acid 2- hydroxylase
:Biotic inducer
:Bovine serum albumin
:Bromophenol blue
:Cytosine
:Carnation mosaic virus
:Centegrate
:Chlorophyll a.
:Chlorophyll b.
:Centimeter
:Coat protein
:Complement deoxyribonucleic acid
:Coomassie brilliant blue
:Crystalline inclusion bodies
:Clerodendrum inerme
:Cucumber mosaic cucumovirus
:Cultivar
:Dideoxy nucleotide triphosphate
:Dilution end point
:Disease severity
:Dithiothreotol
:Dot blot immunoassay
:Double antibody sandwich enzyme-linked immunosorbent assay
:Ethylene diamine tetra acetic acid
:For example (Exempli gratia)
:Endogenous antiviral proteins
:And other (et alii)
:Fresh weight
:Gram
:Guanine
:High performance liquid chromatography
ix
hr
HR
i.e.
IgG
I-ELISA
IAA
ISR
K
KDa
Kg
L-DOPA
LAR
L.L.
LIV
ml
mg
min
Mixed(Mj+Ci)
Mj
mM
µg
µl
M
nm
NRC
nt
O.D
pH
PRs
POD
PMSF
PA
PAL
PBS
PBST
PGPR
PAGE
PEG
PCR
PPO
:Hour
:Hypersensitive reaction
:That is (id est)
:Immunoglobulin G
:Indirect enzyme-linked immunosorbent assay
:Indole acetic acid
:Induced systemic resistance
:Kombucha
:Kilo Dalton
:Kilo gram
:L-Dihydroxy phenylalanine
:Local acquired resistance
:Local lesion
:Longevity in vitro
:Milliliter
:Milligram
:Minute
:Mixed (Mirabilis jalapa + Clerodendron inerme)
:Mirabilis jalapa
:Millimole
:Microgram
:Microliter
:Molar
:Nanometer
:National research centre
:Nucleotide
:Optical density
:Hydrogen ion concentration
:Pathogenesis related proteins
:Peroxidase
:Phenyl methyl sulfonyl
:Phenylalanine
:Phenylalanine ammonia-lyase
:Phosphate buffer saline
:Phosphate buffer saline-Tween
:Plant growth promoting rhizobacteria
:Polyacrylamide gel electrophoresis
:Polyethylene glycol
:Polymerase chain reaction
:Polyphenol oxidase
x
PVP
PPB
PVX
R.I.
RT-PCR
RPM
RNA
RIPs
RNAsin
SAG
SA
sat RNA
SNL
SDS-PAGE
SAR
SRIs
T
TEMED
TIP
TMV
TNV
TRV
ToMoV
TSWV
UV
VIA
V/V
W/V
:Polyvinyl pyrrolidine
:Potassium phosphate buffer
:Potato virus X
:Reduction of infection
:Reverse transcriptase polymerase chain reaction
:Revolution per minute
:Ribonucleic acid
:Ribosome inactivation proteins
:RNAase inhibitor
:Glycosyl salicylic acid
:Salicylic acid
:Satellite RNA
:Small necrotic lesions
:Sodium dodecyl sulfate polyacrylamide gel electrophoresis
:Systemic acquired resistance
:Systemic resistance inducers
:Thiamine
:Tetra methylene di amine
:Thermal inactivation point
:Tobacco mosaic virus
:Tobacco necrosis virus
:Tobacco rattle tobravirus
:Tomato mottle virus
:Tomato spotted wilt-virus
:Ultraviolet
:Virus inhibitory agent
:Volume per Volume
:Weight/Volume
xi
ACKNOWLEDGMENT
All the greatest gratefulness, deepest appreciation and sincerest
thanks to ALLAH for all gifts which given me and for enabling to
overcome all problems which faced in my and throughout the course
of this investigation and helping me to achieve this hard work in the
ideal form to bring-forth to light this thesis.
The author wishes to express her deepest gratitude and
indebtedness to the supervisor of the present work Prof. D r. A bdou
M ahdy M oham ed M ahdy Professor of Plant Pathology and Vice
Dean of Faculty for Community Service and Development of
Environment, Botany Dept., Fac. Agric., Banha Univ., for his
constructive supervision, valuable advice, kind guidance, great
assistance in the preparation of this manuscript and for his help in
putting thesis in its final from.
I would like to thank Prof. D r. K haled A bdelbdel - Fatah E l-l - D ogdog
Professor of Plant Virology, Microbiology Dept., Fac. Agric., AinShams Univ., for his great help, encouragement, invaluable guidance
and his kind attitude toward me during all time of this research and in
the final preparation of this manuscript.
The author indebted to Prof. D r. Rao
Ra o uf N agui
agu i b Faw zy
Professor of Plant Pathology, Botany Dept., Fac. Agric., Banha Univ.,
for his sincere encouragement, scientific support, keeping interest and
his helps in provision of all facilities needed for the present work.
I’m also indebted to D r. M oham ed A ll - Sayed H afez Ass.
Professor of Plant Pathology, Botany Dept., Fac. Agric., Banha Univ.,
for his unlimited valuable help.
Thanks are also due to all staff members of the Fungi and Plant
Pathology Branch, Agric. Botany Dept., Fac. Agric., Banha Univ., for
their kindness and technical assistance.
INTRODUCTION
Tomato (Lycopersicon esculentum Mill., Solanum lycopersicon
L.), belongs to a large family of plants called the Solanaceae. It's one
of the most important commercially grown vegetables in Egypt and
the most popular vegetable throughout the world, and the importance
of its cultivation is threatened by a wide array of pathogens. In the
last twenty years this plant has been successfully used as a model
plant to investigate the induction of defense pathways after exposure
to fungal, bacterial, viral and abiotic molecules, showing triggering of
different mechanisms of resistance (Lancioni, 2008).
Egypt ranks fifth in the world for tomato production (FAO,
2010). In 2009/2010, farmers produced about 9,204,097 million tons
of tomato from total area of 476.190 feddan plus 2314 protected
houses (Year Book of Ministry of Agriculture & Land Reclamation).
Tomato also contains important vitamins, minerals and antioxidants.
Tomato is susceptible to many viruses and considerable yield
losses and diminished fruit quality can occur due to single or multiple
viral infections. The power of growth; decrease of yield and quality
of tomato were observed under protective and open field cultivation
(Rampersad, 2006).
Virus diseases are considered one of the most important
problems affecting tomato production in many countries. There are
about 75 viruses infecting this crop (Mohamed, 2010).
Cucumber mosaic virus (CMV), is the type species of the genus
Cucumovirus, family Bromoviridae, has isometric particles and a
positive-sense RNA with a tripartite genome. Cucumber mosaic virus
has a worldwide distribution and is of economic importance in many
-1-
Introduction
crops, vegetables, fruits and ornamentals. Cucumber mosaic virus is
difficult to control because of its extremely broad host range in
excess of 800 plant species and transmission in a non-persistent
manner by more than 60 species of aphids. On tomato, symptoms of
CMV infection include stunting of vegetative growth, distortion and
mottling of new growth, and a characteristic shoestring-like leaf
appearance (Sudhakar et al., 2007).
Virus infections cause great damage to economical crops, this
loss is so clear especially in developing countries. Investigators were
aiming to control such incurable pathogen using an alternative
biological controlling strategy depending on a clean agriculture
system. Systemic resistance for virus infections can be induced in
plants treated with certain bacteria or with bacterial products, and
also by treatment with some chemicals which may be more risky
when compared with bacteria. The role of such induced systemic
resistance described by the enhancement of the production of plant
antioxidant protective enzyme, peroxidase, besides the activation of
some plant defense genes producing pathogenesis related proteins
(PR-Ps), which are not well studied yet for its mode of action
(Shehata and El-Borollosy, 2008).
Plant viruses seem nearly impossible to control, instead,
practical attempts are made to keep them in check, to reduce losses,
basically to manage their existence within a crop. The availability of
genetically resistant varieties is clearly the best approach for all
cultivated crops; however, such varieties are often not available, and
even when they are available, there is the possibility for the
occurrence of other viruses or viral strains that are not affected by the
Introduction
-2-
resistance. The basic premise behind these approaches is to delay the
introduction of virus into the crop thereby allowing the plant to
mature to a stage of development that will essentially tolerate the
infection. Virus infection of a more mature plant typically results in
delayed movement of virus throughout the plant, reduced virus
accumulation, reduced symptom severity and losses in yield. It is
noticed that tobacco plants exhibited ‘systemic acquired resistance’
following local infection with tobacco mosaic virus. Other terms that
have been used to describe systemic resistance in plants include
‘translocated resistance’, ‘plant immunization’ and ‘induced systemic
resistance’. The term ‘induced systemic resistance’ (ISR) is used to
denote induced systemic resistance by non-pathogenic biotic agents
and may differ mechanistically from resistance induced by other
elicitors. Inducible defenses in plants may have selective advantages
over constitutive defenses. While inducible defenses are often
localized at the site of attack, plant defense mechanisms may be
activated systemically throughout the plant following a localized
infection or attack (Rampersad, 2006).
Therefore, the objective of this investigation is evaluating some
biotic inducers (water extracts of Clerodendrum inerme, Mirabilis
jalapa or their mixture and kombucha filtrate) to induce acquired
systemic resistance and safe means to control virus infection in
tomato either in the greenhouse or in the open field conditions.
-3-
Introduction
REVIEW OF LITERATURE
Part I
1- Disease incidence and frequency of virus(es):
The incidence of virus diseases of tomato (Lycopersicon
esculentum) in Mauritius was investigated in field's samples by electron
microscopy and enzyme-linked immunosorbent assay (ELISA). Two
virus diseases, potato virus Y (PVY) and tomato mosaic virus (ToMV)
were found to be widespread. ELISA may differentiate two strains of the
PVY virus (Ganoo and Saumtally, 1999).
A survey of tomato ant pepper viruses was conducted in Sudan
during the last ten years. It covered Central, Northern, Eastern, Southeastern and Western regions of Sudan. The results revealed the
presence of many mosaic - inducing virus and virus like agents.
Cucumber mosaic virus (CMV), tomato mosaic virus (ToMV),
tobacco mosaic virus (TMV), Tomato yellow leaf curl virus (TYLCV)
and potato virus Y (PVY) were all found to infect both tomato and
pepper (Elshafie et al., 2005).
Yardimci and Eryigit (2006) showed that, leaf samples were
collected from 138 tomato (Lycopersicon esculentum) plants showing
symptoms of Cucumber mosaic virus (CMV) in the north-west
Mediterranean region of Turkey. The samples were first tested by
double antibody sandwich-enzyme linked immunosorbent assay
(DAS-ELISA) using CMV specific polyclonal antibody. The DASELISA revealed that 53 of the 138 leaf samples tested were infected
with CMV. One of the ELISA-positive CMV isolates was
Review of Literature
-4-
mechanically inoculated into a set of indicator plants by conventional
leaf inoculation method for further characterization. The virus was
multiplied and showed systemic symptoms in Nicotiana tabacum
'Xanthii', Nicotiana tabacum 'Samsun NN', and Capsicum annuum.
Michael (2009) found that, A survey was conducted to determine
the incidence of Cucumber mosaic virus (CMV), Beet curly top virus
(BCTV), Tomato yellow leaf curl virus (TYLCV), Tomato chlorotic spot
virus (TcSV), Potato virus Y (PVY), Potato virus S (PVS), Tomato
spotted wilt virus (TSWV), Tomato ringspot virus (TRSV), Tomato
aspermy virus (TAV), Arabis mosaic virus (ArMV), Tobacco streak
virus (TSV), Tomato bushy stunt virus (TBSV), Tobacco mosaic virus
(TMV), and Tomato mosaic virus (ToMV) on tomato (Solanum
lycopersicum) in the major horticultural crop growing areas in the
southeast and central regions of Iran. Samples of symptomatic plants
were analyzed for virus infection by enzyme-linked immunosorbent
assay (ELISA) using specific polyclonal antibodies. ArMV and CMV
were the most frequently found viruses, accounting for 25.6 and 23.4%,
respectively, of the collected samples. BCTV, TSWV, TMV, PVY,
ToMV, and TYLCV were detected in 6.1, 5.8, 5.6, 5, 4.8, and 1.6% of
the samples, respectively. TBSV, TAV, TSV, PVS, and TRSV were not
detected in any of the samples tested. Double and triple infections
involving different combination of viruses were found in 13.9 and 1.7%
of samples, respectively. This is the first report of PVY and ArMV as
viruses naturally infecting tomato in Iran.
A survey was conducted to determine the incidence of Cucumber
mosaic virus (CMV), Beet curly top virus (BCTV), Tomato yellow leaf
-5-
curl virus (TYLCV), Tomato chlorotic spot virus (TcSV), Potato virus Y
(PVY), Potato virus S (PVS), Tomato spotted wilt virus (TSWV),
Tomato ringspot virus (TRSV), Tomato aspermy virus (TAV), Arabis
mosaic virus (ArMV), Tobacco streak virus (TSV), Tomato bushy stunt
virus (TBSV), Tobacco mosaic virus (TMV), and Tomato mosaic virus
(ToMV) on tomato (Solanum lycopersicum) in the major horticultural
crop growing areas in the southeast and central regions of Iran. A total of
1307 symptomatic leaf samples from fields and 603 samples from
greenhouses were collected from January 2003 to July 2005 in five
southeastern and central provinces of Iran. Samples of symptomatic
plants
were
analyzed
for
virus
infection
by
enzyme-linked
immunosorbent assay (ELISA) using specific polyclonal antibodies
(Massumi et al., 2009).
Lin et al. (2010) found that, Cucumber mosaic virus (CMV) has
been identified as the causal agent of several disease epidemics in
most countries of the world. Insect-mediated virus diseases, such as
those caused by CMV, caused remarkable loss of tomato (Solanum
lycopersicon) production in Taiwan.
2- Confirmation of Cucumber mosaic cucumovirus (CMV):
1. Biological characters:
1.1- Symptomatology and Host range:
In Egypt, CMV was isolated from Nicotiana gluaca (Eid et al.,
1984) sugar beet (Omar et al., 1994), pepper (Khalil et al., 1985),
cucumber (El-Baz, 2004; El-Afifi et al., 2007; Megahed, 2008 and
Taha, 2010) and tomato (Mohamed, 2010).
-6-
Tomato plants infected with CMV are often showing stunted,
have short internodes, and may have extremely distorted and
malformed leaves, known as fern-leaf (Megahed, 2008 and Taha,
2010). Hellwald et al. (2000) mentioned that, a selection of cucumber
mosaic virus (CMV) subgroup I strains originating from Asia and
Fny-CMV isolated in USA were studied for their interaction with
tomato plants. All strains caused mosaic, fern leaf expression and
stunting of tomato plants.
CMV has a wide range of hosts and attacks a great variety of
vegetables, ornamentals, and other plants (as many as 191 host species
in 40 families). Among the most important vegetables affected by
cucumber mosaic are peppers (Capsicum annuum L.), cucurbits,
tomatoes (Lycopersicon esculentum Mill.), and bananas (Musa spp.
L.) (Chabbouh and Cherif, 1990).
Fawzy et al. (1992) reported that, C. amaranticolor, C. album and
C. quinoa infected with a strain of CMV showing local infection.
Chaumpluk et al. (1994) found that, two strains of CMV caused severe
necrotic ring spot on Tetragonia expansa, contained without satellite
RNA, another strain C7-2, caused mild mosaic with ring scar on T.
expansa. Espinha and Gasper (1997) reported that, mosaic and
distortion symptoms in Cucurbita pepo, Nicotiana tabacum, Cucumis
sativus, Lycopersicon esculentum and Datura stramonium infecting with
CMV. While it gave local symptoms on C. quinoa and Gomphrena
globosa.
Barbosa et al. (1998) found that, CMV diseased banana plants
was detected by mechanically inoculated on the indicator species,
-7-
Nicotiana glutinosa, Cucurbita pepo cv. Caserta. Mosaic symptoms
observed in N. glutinosa plant and local lesions in C. pepo. Chen and
Hu (1999) stated that, CMV was shown to infect 27 plant species of 9
families, 20 species appeared systemic infection and 7 species
appeared as local lesion hosts. The virus infected many species in the
family Cucurbitaceae, but it did not infect Phaseolus vulgaris or
Vigna unguiculata.
Fukumoto et al. (2003) reported that, necrotic diseases of the
stems, petioles and leaves of pea plants (Pisum sativum) leading to
wilting and death caused by CMV. Takarai et al. (2006) found that,
green mottle, green mosaic, and chlorotic spots symptoms produced in
Momordica charantia L. plants systemically infected with Cucumber
mosaic virus (CMV).
Montasser et al. (2006) showed that, three strains of Cucumber
mosaic virus (CMV) have been found to cause a lethal disease,
referred to as fern leaf syndromes and mild mosaic symptoms in
tomato (Lycopersicon esculentum Mill.) crops grown in Kuwait. CMV
strains were detected and identified based on host range,
symptomatology, serology, electron microscopy, and ribonucleic acid
(RNA) electrophoresis in polyacrylamide gels.
Sudhakar et al. (2006) observed during a survey in January 2006
near Salem in Tamil Nadu (south India), Cucumber mosaic virus that
infecting tomatoes with an incidence of more than 70%. Plants exhibiting
severe mosaic, leaf puckering, and stunted growth were collected, and the
virus was identified using diagnostic hosts, evaluation of physical
properties of the virus, compound enzyme-linked immunosorbent assay
-8-
(ELISA) (ELISA Lab, Washington State University, Prosser), reversetranscription polymerase chain reaction (RT-PCR), and restriction
fragment length polymorphism analysis (DSMZ, S. Winter, Germany).
Balogun and Daudu (2007) reported that, the general symptoms
observed on Lycopersicon esculentum cv. Manuella were included pale
green to yellowish mosaic pattern on plant foliage, subsequent stunting of
plant, extremely distorted and malformed leaves (fern leaf) as severe
cases of CMV infection. Akhtar et al. (2008) found that, a severe
infection with CMV observed among all tomato cultivars grown in
Pakistan, evoking severe leaf malformation and shoe stringing.
Zitikaitė and Samuitienė (2009) showed that, Cucumber
mosaic virus (CMV) causing viral diseases in forage, fruit, ornamental
and vegetable crops worldwide has been isolated in Lithuania from
sweet pepper (Capsicum annuum L.) plants exhibiting mottle-mosaic
and distortion of leaves and fruits, and plant stunt symptoms.
The family of Cucurbitaceae were reacted with different symptoms
such as cucumber plants showed severe mosaic, blisters and
malformation while, squash plants gave vein clearing, severe mosaic,
green vein banding, blisters and malformation. Different symptoms
produced on some other species belonging to different families; N.
glutinosa appeared severe mosaic, fern leaf and malformation; N
tabacum cv. White Burly produced severe mosaic; D. metel showing
severe mosaic and malformation, Helicrysum bracteatum showed
yellowing symptoms and Petunia hybrida gave severe mosaic,
malformation and discoloration (Megahed, 2008 and Taha, 2010).
-9-
1.2-Transmission of CMV:
A- Mechanical transmission:
El-Baz (2004); Davino et al. (2005); Takarai et al. (2006); ElAfifi et al. (2007); Akhtar et al. (2008); Megahed (2008) and Taha
(2010) reported that, CMV strains were transmitted mechanically by
infectious sap.
Ali and Kobayashi (2010) reported that, CMV transmitted to
healthy pepper through seeds.
B- Aphid transmission:
The aphid species Myzus persicae, Aphis gossypii and Aphis
craccivora Koch were shown to be vectors of CMV in Sudan. Aphis
gossypii seemed the most efficient. The virus was not transmitted
through 300 seeds from 3 plant species (Abdul Magid, 1990).
CMV is transmitted in a non-persistent manner by more than 80
aphid species. The spread of the virus is generally over short distances
and aphids only remain infective for periods from a few minutes up to a
few hours. During our surveys of the Wimmera cropping region over a
number of years the following aphid vectors of CMV were found:
lucerne blue green aphid (Acyrthosiphon kondoi), cowpea aphid (Aphis
craccivora), foxglove aphid (Aulacorthum solani), ornate aphid (Myzus
ornatus), green peach aphid (Myzus persicae), cabbage aphid
(Brevicoryne brassicae), sowthistle green aphid (Hypermyzus lactucae)
and sowthistle brown aphid (Uroleocon sonchi) (Freeman and
Horsham, 2006; Gildow et al., 2008 and Dheepa and Paranjothi,
2010).
- 10 -
1.3- In vitro properties:
Park et al. (1990) reported that, thermal inactivation point of
CMV was 65°C, dilution end point 10-3 and its longevity in vitro 3-4
days. Fawzy et al. (1992) mentioned that, the thermal inactivation
point of CMV was 60-65°C, the dilution end point 10-4-10-5 and the
longevity of the strain in vitro was 48-60 hours.
Kiranmai et al. (1997) reported that, CMV has longevity in
vitro was 3-4 days, the thermal inactivation point was 60-65°C and the
dilution end point 10-3-10-5 for the three isolates. Lee et al. (1997)
found that, the stability of CMV-FK was 55°C of thermal inactivation
point, dilution end point was 10-3 and longevity in vitro was 2-3 days.
El-Baz (2004) showed that, thermal inactivation point of CMV
was 60°C, dilution end point was 10-4 and longevity in vitro was 4
days. Megahed (2008) showed that, thermal inactivation point of
CMV was 70°C, dilution end point was 10-4 and longevity in vitro was
4 days.
1.4- Inclusion bodies:
Zambolim et al. (1994) stated that, CMV caused crystalloid
inclusions in mesophyll cells of banana leaves.
El-Baz (2004), Megahed (2008) and Taha (2010) examined
epidermal strips of infected squash and cucumber leaves after 36 and
15 days, respectively after CMV inoculation showed cytoplasmic
inclusion bodies in the hair cells. Amorphous inclusion bodies
detected in the hair cells since these stained with red color and
- 11 -
crystalline inclusion bodies observed in hair cells of the epidermal
strips of CMV-infected squash and cucumber leaves.
2.2- Serological identification:
Barbosa et al. (1998) reported that, indirect ELISA and other
serological tests were used for differentiation between CMV isolated
from banana plants into severe strains (B-CMV-1 and B-CMV-2) and
1 mild strain (B-CMV-3).
Tessitori et al. (2002) stated that, ELISA of infected leaf tissue
of Polygala myrtifolia revealed the presence of CMV. El-Baz (2004)
used ELISA test for detection CMV isolated from cucumber plants.
Sharma et al. (2005) found that, CMV was detected and
characterized by bioassay, double antibody sandwich enzyme linked
immunosorbent assay (DAS-ELISA). El-Afifi et al. (2007) used
indirect enzyme linked immunosorbent assay (I-ELISA) for CMV
detection in cucumber plants. Cardin and Moury (2007) reported
that, positive reactions against CMV in leaves of Echium candicans in
France were recorded by double antibody sandwich-ELISA to CMV
specific polyclonal antibodies as well as Aramburu et al. (2007) who
stated that, DAS-ELISA analysis revealed the presence of Cucumber
mosaic virus (CMV) in the infected tomato plants. Megahed (2008)
and Sankaran et al. (2010) found that, the dot blot immunoassay
(DBIA) is very sensitive to detect CMV in infected cucumber plants
using specific polyclonal IgG-CMV.
- 12 -
Part II
Induction of systemic acquired resistance (SAR) by
biotic inducers:
I- General features of systemic acquired resistance:
The phenomenon of SAR against disease in plants following
infection has been recorded, but often not been documented as early as
the 19th century, the natural phenomenon of resistance in response to
pathogen infection or plant immunity was first recognized in 1901 by
Ray, when they worked on Botrytis cinerea. The virulence of a sterile
strain of B. cinerea could be varied by environmental parameters like
heat, cold or cultural conditions. Both researchers then used such
attenuated fungal strains to induce SAR in Begonia, either by planting in
soil inoculated with the attenuated strains or by injecting inoculums into
the plants at many points, (Ray, 1901). Carbone and Kalaljev (1932)
confirmed previous studies and showed that acquired resistance also
depends on the general fitness of the host. Chester (1933) reviewed 201
studies dealing with "the problem of acquired physiological immunity in
plants". Acquired resistance, first described by Gilpatrick and
Weintraub (1952) on Dianthus barbatus when the lower leaves were
inoculated with Carnation mosaic virus (CarMV), the upper leaves were
appeared resistant to the infection. Ross (1961a, 1961b) first investigated
the induction of resistance by localizes viruses and demonstrated the
presence of a zone around each local lesion on tobacco which was more
resistant to a second infection by the same virus. This phenomenon was
called local acquired resistance (LAR). Other leaves on the same plant
- 13 -
also showed resistance to a second infection, which was called systemic
acquired resistance (SAR).
Other terms that have been used to describe systemic resistance
in plants "translocated resistance" Hubert and Helton (1967), "plant
immunization" Kuc (1987) and "induced systemic resistance"
Hammerschmidt et al. (1982).
Hammerschmidt (1999) reported that, the phenomenon of
induced or acquired resistance to disease in plants has been studied
intensively in recent years. This has led to a better understanding of
the signaling pathways involved in the expression of systemic
resistance as well as the genetic regulation of induced or acquired
resistance. Although the induction of resistance to disease results in
the expression of less disease in the plant after challenge with
pathogens, how the plant is able to restrict the development of the
pathogen is not clearly defined. In this paper, some of the defenses
expressed in plants with induced resistance will be discussed in
relation to how the induced plants may restrict disease development.
Choudhary et al. (2007) mentioned that, plants possess a range of
active defense apparatuses that can be actively expressed in response to
biotic stresses (pathogens and parasites) of various scales (ranging from
microscopic viruses to phytophagous insect). The timing of this defense
response is critical and reflects on the difference between coping and
succumbing to such biotic challenge of necrotizing pathogens/parasites.
If defense mechanisms are triggered by a stimulus prior to infection by a
plant pathogen, disease can be reduced. Induced resistance is a state of
enhanced defensive capacity developed by a plant when appropriately
- 14 -
stimulated. Several rhizobacteria trigger the salicylic acid (SA)dependent SAR pathway by producing SA at the root surface whereas
other rhizobacteria trigger different signaling pathway independent of
SA. The existence of SA-independent ISR pathway has been studied in
Arabidopsis thaliana, which is dependent on jasmonic acid (JA) and
ethylene signaling.
Systemic acquired resistance (SAR) is a form of induced
resistance that is activated by pathogens that induce localized necrotic
disease lesions or a hypersensitive response. SAR is dependent on
salicylic acid signaling and is typically associated with systemic
expression of pathogenesis-related protein genes and other putative
defenses. Once induced, SAR-expressing plants are primed to respond
to subsequent pathogen infection by induction of defenses that are
localized at the site of attempted pathogen ingress. Finally, SAR
typically does not provide full resistance to disease indicating that the
practical application of this form of resistance will require the use of
other disease management tools (Hammerschmidt, 2009).
Biotic Inducers:
Management of viral disease can also be accomplished through
the induction of plants natural defenses, e.g., systemic acquired
resistance, Ryals et al. (1994). SAR against viral infection has been
documented using biological and chemical inducing agents Kessman
(1994); Raupach et al. (1996); Murphy et al. (2000); Zehnder et al.
(2000); Jetiyanon et al. (2003); Abo El-Nasr et al. (2004);
Fakhourin et al. (2004); Galal (2006) and Park et al. (2007).
- 15 -
A- Plant extracts:
The botanicals may induce resistance or they themselves may
act as inhibitors of viral replication. Ribosome Inactivating Proteins
(RIPs) and glycoproteins may block the replication sites. A mobile
inducing signal may be produced in treated leaves after the botanical
resistance inducers bind with the host plant surface. This signal
produces virus-inhibiting agent in the entire plant system. Certain low
molecular weight pathogenesis related proteins might also play a role
in the induction of systemic acquired resistance. Thus, biologically
active compounds present in plant products act as elicitors and induce
resistance in host plants resulting in reduction of disease development
(Verma et al., 1998).
The major chemical constituents present in Clerodendrum genus
were identified as phenolics, flavonoids, terpenes, steroids and oils
(Shrivastava and Patel, 2007).
A novel single resistance inducing protein (Crip-31) was
isolated and purified from the leaves of Clerodendrum inerme, which
is a very potent, highly stable, basic in nature, 31 kDa in molecular
mass having hydrophobic residues and induces a high degree of
localized as well as systemic resistance against three different groups
of plant viruses (i.e. CMV, PVY and ToMV), which differ at their
genomic organization and having different replication strategies,
infection in susceptible host Nicotiana tabacum. Minimum amount of
purified preparation sufficient for systemic resistance induction was ~
25 µgml−1. The systemic inhibitory activity of the Crip-31 provides
protection to whole plants within 40–60 min of its application. The
- 16 -
systemic resistance inducing properties of this protein can be of
immense biological importance, as it is similar to ribosome
inactivating proteins (RIPs) (Praveen et al., 2001).
Clerodendrum inerme contain basic protein which resistant to
proteases. Induces systemic resistance reversible by actinomycin D
inhibits infectivity of many plant viruses (Verma et al., 1991).
Two systemic antiviral resistance-inducing proteins, namely CIP29 and CIP-34, isolated from Clerodendrum inerme leaves, for ribosomeinactivating properties. CIP-29 has a polynucleotide: adenosine
glycosidase
(ribosome-inactivating protein),
that
inhibits
protein
synthesis both in cell-free systems and, at higher concentrations, in cells,
and releases adenine from ribosomes, RNA, poly (A) and DNA. As
compared with other known RIPs, CIP-29 deadenylates DNA at a high
rate, and induces systemic antiviral resistance in susceptible plants
(Olivieri et al., 1996).
Chemical analysis of clavillia (Mirabilis jalapa) was rich in
many active compounds including triterpenes, proteins, flavonoids,
alkaloids, and steroids. Purified an antiviral proteins from roots,
shoots, leaves, fruits, and seeds of Mirabilis jalapa are employed for
different affections. Thus, information about the reproductive pattern
of this culture is important for implementing experimental procedures
(Leal et al., 2001). MAPs in clavillia as being effective in protecting
economically-important crops (such as tobacco, corn, and potatoes)
from a large variety of plant viruses (such as tobacco mosaic virus,
spotted leaf virus and root rot virus) (Vivanco et al., 1999).
- 17 -
Mirabilis jalapa (Nyctaginaceae), containing a ribosome
inactivating protein (RIP) called Mirabilis antiviral protein (MAP),
against infection by potato virus X, potato virus Y, potato leaf roll
virus and potato spindle tuber viroid. Root extracts of M. jalapa
sprayed on test plants 24 h before virus or viroid inoculation inhibited
infection by almost 100%, as corroborated by infectivity assays and
the nucleic acid spot hybridization test (Vivanco et al., 1999). They
also, isolated mirabilis antiviral protein (MAP) from roots and leaves
of Mirabilis jalapa L. which possess repellent properties against
aphids and white flies. MAP showed antiviral activity against
mechanically transmitted viruses but not against aphid transmitted
viruses. MAP was highly effective in inhibiting TSWV at 60%
saturation. A minimum concentration of 400µg/ml of MAP was
sufficient to inhibit TSWV (Devi et al., 2004).
β-farnesene volatiles emitted by the whole plant as well as by
detached flowers of Mirabilis jalapa. Most remarkable were findings
that assigned the use of β-farnesene as an alarm pheromone for aphids.
By taking advantage of the aphid alarm signal, plants are able to repel
herbivores as reported for the wild potato Solanum berthaultii
(Effmert et al., 2005).
Foliar sprays of the Mirabilis jalapa leaf extract caused marked
symptom
suppression,
improved
growth
and
flowering
and
considerably reduced the virus multiplication rate in tomato treated
against tomato yellow mottle (tobacco mosaic virus str.) and tomato
yellow mosaic viruses, cucumber against cucumber mosaic and
cucumber green mottle viruses, and Phaseolus (Vigna) mungo against
- 18 -
bean mosaic virus. The aphid and whitefly (Bemisia tabaci)
populations were much lower on treated than control plants (Verma
and Kumar, 1982).
The development of viral resistance towards antiviral agent
enhances the need for new effective compounds against viral infections.
B- Kombucha fermented tea:
The Kombucha "mushroom" is a symbiotic colony of several
species of yeast and bacteria that are bound together by a surrounding
thin membrane. Although the composition of the Kombucha colony
varies, some of the species reportedly found in the mushroom include
Saccharomyces ludwigii, Bacterium xylinum, B. gluconicum, B.
xylinoides, B. katogenum, Pichia fermentans and Torula sp. Each
strain of kombucha may contain some of the following components
depending on the source of culture strain: Acetic acid, Butyric acid,
Gluconic acid, Lactic acid, Malic acid, Oxalic acid, and Usnic acid.
Kombucha also contains vitamin groups B and C, beneficial yeasts
and bacteria (Stamets, 1994).
Kombucha tea can contain up to 105% alcohol and a variety of
other metabolites (e.g, ethyl acetate, acetic acid, and lactate). During
incubation, the thin, gelatinous mushroom floats in the tea and
duplicates itself by producing a "baby" on top of original mushroom.
These offspring are then given to other persons for starting their own
cultures. FDA has evaluated the practices of the commercial producers
of the kombucha mushroom and has found no pathogenic organisms
or hygiene violations (Food and Drug Administration, 1995). When
- 19 -
prepared as directed, the pH of the tea decreases to 1.8 in 24 hours.
Although this level of acidity should prevent the survival of most
potentially contaminating organisms, tea drinkers have reported molds
growing on the Kombucha (CDC, unpublished data).
Kombucha tea is never static. New acids and nutrients are
constantly created and combined, into ever-changing–though predictable
zymurgy (Chen and Liu, 2000). Kombucha contains many different probiotic cultures along with several organic acids, active enzymes, amino
acids, anti-oxidants, and polyphenols. According to Roussin (2003), the
typical composition may [not always] include: some microorganisms, i.e.
Bacterium gluconicum, B. xylinum, Acetobacter xylinum, A. xylinoides,
A. ketogenum, Saccharomycodes ludwigii, S. cerevisiae, S. apiculatus,
Schzosaccharomyces pombe, Zygosaccharomyces. Some compounds i.e.
Acetic acid, Acetoacetic acid, Benzoic acid, propenyl ester, Benzonitrile,
Butanoic acid, Caffeine, Citric acid, Cyanocobalamin, Decanoic acid,
Ethyl acetate, Fructose, d-Gluconic acid, Glucose, Hexanoic acid,
Itaconic acid, 2-keto-gluconic acid, 5-keto-gluconic acid, 2-keto-3deoxy-gluconic acid, Lactic acid, Niacinamide, Nicotinic acid,
Pantothenic acid, Phenethyl Alcohol, Phenol, 4-ethyl, 6-Phospho
gluconate, Propionic acid, Octanoic acid, Oxalic acid, Riboflavin, dSaccharic acid (Glucaric acid), Succinic acid and Thiamin plus 40 other
acid esters in trace amount.
Shehata and Lila (2005) reported that fermented tea beverage has
antimicrobial activity against a wide spectrum of organisms including
some phytopathogenic fungi (i.e. Fusarium oxysporum, Alternaria
solani, Aspergillus niger, Penicillium).
- 20 -
Antioxidant and antimicrobial activities were achieved after
fermenting sugared black tea, green tea or tea manufacture waste with
tea fungus (Kombucha) for 12 to 15 days (Jayabalan et al., 2007).
Hafez
(2008)
found
that,
kombucha
filtrate,
expensive
consumption as a healthful beverage as it is easily and safely produced at
home, but scrimpy in the cost, can be useful as commercial applicable
alternative antifungal to control table grape bunch rot near-harvesting
without need to any chemical or fungicide applications and improving
grape quality. Kombucha produced many vitamins, enzymes, organic
acids etc., so can be used on organically certified grapes. Kombucha is a
natural alternative antifungal which could be used as near-harvest dipping
application without need to any chemical or fungicidal applications preand post-harvest especially for exportation grapes. Grapes quality was
not negatively affected as result to using a new tested substance.
Biochemical and physiological changes in induced plants:
There is a number of chemical and physiological changes have
been established to be associated with SAR state. These include, cell
death and the oxidative burst (Low and Merida, 1996), deposition of
callose and lignin (Vance et al., 1980 and Kauss, 1987), the synthesis
of phytoalexins (Dixon, 1986) and novel proteins (Gianinazzi et al.,
1970; Mahmoud, 2000, 2003; Abo El-Nasr et al., 2004 and Sekine
et al., 2006).
Many authors reported that, a large number of enzymes have
been associated with SAR, including peroxidase, phenyalanine
ammonialayase,
lipoxygenase,
β-1,3-glucanase,
- 21 -
chitinase,
poly
phenoloxidase and catalase (Van Loon, 1997; Abo El-Nasr et al.,
2004; Silva et al., 2004; Trebbi et al., 2007; Megahed, 2008 and
Taha, 2010).
The relationship between isozyme composition of host plant and
plant resistance or susceptibility to disease has been studied in some
phytosystems. Isozyme spectra of malte- dehydrogenase, peroxidase
and esterase of 10 flax cultivars were separated by PAGE. Data
indicated that, PAGE of isozyme may provide a supplementary assay
to greenhouse and field tests to distinguish qualitatively between
powdery mildew resistant or susceptible cultivars Ali et al. (2006).
Peroxidase and poly phenoloxidase activates were found to be
considerably higher in infected tomato leaves than in healthy ones.
Viral infection with yellow leaf curl and leaf roll of tomato exhibited
higher activity of peroxidase and poly phenoloxidase Disc-PAGE
isozyme, (Sherif and El-Habaa, 2000).
Van Loan (1985) and Neuenschwander et al. (1996) showed
through the analysis of SAR proteins that many of these proteins
belong to the class of pathogenesis related (PRs) proteins, which
originally identified as a new set of proteins that accumulated in
tobacco cultivars that form necrotic lesions following TMV infection
and were also termed "b protein". These proteins are classified as SAR
proteins, when its presence and activity correlates tightly with
maintenance of the resistance state. The systemic acquired induced
resistance (SAR) by biotic or abiotic agents had been recognized to
play an important role in defense against plant viruses, since this
resistance was mainly associated with the introduction of novel
- 22 -
proteins (Faccioli et al., 1994) in treated plants which was the actual
virus inhibitory proteins. These proteins thus induced antiviral state in
plants through formation of new synthesized protein and perhaps were
activate in signaling the activation of defense mechanism in
susceptible hosts and hence had been called systemic resistance
inducers (SRIs) and the novel proteins induced resembled ribosomeinactivating proteins (Verma and Varsha, 1995).
Chessin et al. (1995) reported that, four types of endogenous
antiviral proteins (EAVPs) had been characterized, and some EVAPs
had been capable of more than one activity, further complicating the
situation. The activities were (1) aggregation (forming a precipitate
with virus), (2) Inhibition of virus establishment, (3) induction of a
systemic viral resistant state, and (4) inhibition of replication by
inactive of protein synthesis (ribosome inactivation).
In tobacco, the set of SAR markers consists of at least nine
families of genes, which are coordinately induced, in uninfected
leaves of inoculated plants. These genes families are now known as
SAR genes. Several of SAR gene products have direct antimicrobial
proteins (Ward et al., 1991 and Meins et al., 1992).
The set of SAR genes that induced differs among plant species.
In cucumber, a class-III chitinase was the most highly induced SAR
gene, while in tobacco and Arabidopsis, PR-1 were the predominant
genes expressed (Cao et al., 1997, 1998).
The products of these genes include PR-1, β-1,3-glucanase, class
II chitinase, having- like protein, thoumatin-like protein, Acidic and
basic forms of class III chitinase, an extracellular β-1,3-glucanase and
- 23 -
the basic isoform of PR-1 and others. Uknes et al. (1992) mentioned
that, in Arabidopsis plants, SAR marker genes are PR-1, PR-2 and
PR-5. Whereas, Smith and Hammerschmidt (1988) showed that,
SAR in cucumber is correlated with increased peroxidase activity and
increase in class III chitinase. In pepper, also chitinase activity was the
protective effect when treated with chemical inducers (Low and
Merida, 1996).
Raskin (1992) reported that, several pathogensis-related
proteins (PRs) were commonly associated with systemic resistance.
Also, β-1,3-glucanase and chitinase were strongly induced after TNV
inoculation or salicylic acid treatment of tobacco and cucumber plants.
Avdiushko et al. (1993) stated that, induced resistance of inoculated
cucumber plants with Colletotrichum lagenarium, TNV or K2HPO4
increased the activity of peroxidase, chitinase and β-1,3-glucanase.
Maurhofer et al. (1994) found that the polyacrilamide gel
electrophoresis and enzyme assays showed that the same amount of
PR proteins (PR-1 group proteins, β-1,3-glucanase and endochitinases) were induced in the intercellular fluid of leaves of plants
grown in the presence of P. fluorescens strain CHAO. The results
indicated also that colonization of tobacco roots by strain CHAO
reduced TNV leaf necrosis and induced physiological changes in the
plant to the same extent as doe's induction of systemic resistance by
leaf inoculation with TNV. Kogel et al. (1994) reported that, induced
systemic resistance ISR against powdery mildew in barley plants is
associated with increase in PR-1, peroxidase and chitinase proteins but
not β-1,3 glucanase.
- 24 -
Mazen (2004) indicated that, faba bean seed treatment or foliar
treatment with biotic inducers i.e. P. fluorescens and P. aeruginosa
increased greatly the activities of peroxidase after 24-h and
polyphenoloxidase after 12-h compared with the untreated control
with superiority of P. aeruginosa than P. fluorescens in this respect.
On the other hand, the highest increase in β-1,3-glucanase activity was
recorded after 24-h in foliar and seed treatments with P. fluorescens
compared with P. areuginosa and control.
Venkatesan et al. (2010) reported that, Pseudomonas fluorescens
(Pf1), plant extract and bioactive compound treatments on induction of
peroxidase (PO), polyphenol oxidase (PPO), phenylalanine ammonialyase (PAL) and accumulation of phenolics in black gram to suppress the
natural incidence of Mung bean yellow mosaic bigeminivirus (MYMV)
was studied. Leaf extracts of Mirabilis jalapa, Datura metel and neem
(Azadirachta indica) oil provided reduced incidence of MYMV with
increased yield in black gram under field conditions. The bio-compatible
products
actigard®
(acibenzolar-S-methyl),
disodium
hydrogen
phosphate and alum (aluminium potassium sulphate) also suppressed
MYMV on black gram and increased yield compared with non-treated
plants under field conditions. The mean disease incidence of the two field
trial shows that the foliar spray of P. fluorescens and M. jalapa recorded
the lowest disease incidence of 39.14 and 41.48% with yields of 718 and
716.5 kg per hectare, respectively.
- 25 -
II- Detection of systemic acquired resistance:
1. Biological determinations:
Acquired resistance is measured by the reduction in diameter of
the lesions (and with some viruses, reduction in number). With bean,
one primary leaf is inoculated and the opposite primary leaf
challenged with an inoculation some days later (Megahed, 2008 and
Taha, 2010).
A high degree of resistance to TMV developed in a 1 to 2 mm
zone surrounding TMV local lesions in Samsun NN tobacco. The
zone increased in size and resistance for about 6 days after
inoculation. The zones around TMV lesions were not virus-specific, it
appeared resistant to inoculation with TNV and several other viruses.
Resistance developed not only in uninoculated parts of the inoculated
leaf but also in other leaves of the plant, lesions were about one-fifth
to one-third the size found in control leaves, (Ross, 1961a).
Systemic acquired resistance following a local necrotic reaction
was found by Loebenstein (1963) for D. stramonium L. inoculated
with TMV and Gompherena globosa L. inoculated with potato virus x
(PVX). A significant reduction in the number of lesions as well as in
their size was observed in both host- virus combinations when
uninfected leaf was challenge- inoculated with the same virus. Leaf
extract from resistant Datura tissue reduced the infectivity of TMV
more than control material.
Disease severity and incidence Tomato mottle virus (ToMoV)
disease were reduced in tomato plants under field conditions by seed
- 26 -
treatment with PGPR (Bacillus amyloliquefaciens 937a, B. subtillus
937b and B. pumilus SE34). The seed and soil drench and soil drench
treatments in greenhouse experiments by three PGPR reduced the
percentage of CMV symptomatic tomato plants ranged from 32 to
58% compared with 88 to 98% in untreated plants, (Zehnder et al.,
2000).
2. Physiological and histogical changes in induced plants:
Light microscopy used successfully for plant virus diagnosis
(Fraser and Matthews, 1979).
Dubey and Bhardwaj (1982) found that, the cortical
parenchyma of tomato stem infected with Tobacco mosaic virus are
rounded and sometimes appear wider or smaller than normal. ElShamy (1987) showed that, the upper and lower epidermis of infected
leaves (bearing mosaic mottling and abnormalities) had several
protrusions and multicellular glandular hairs with multicellular head.
Eskarous et al. (1991) reported that wall of cortical cells in tomato
stem infected with heat resistant strain of Tobacco mosaic virus are wavy
in outline. Bansal et al. (1992) reported that changes observed in leaves
of summer squash plants infected by CMV induce collapse of the upper
epidermal cells in localized areas, abnormally shaped palisade cells with
fewer chloroplasts, and spongy parenchyma with smaller air space. Plant
with severe mosaic showed disintegration and compaction of mesophyll
tissue, with large vesicles and vascular bundles with filiform symptoms,
the main changes included undifferentiating of mesophyll resulting in the
formation of compact structures lacking air spaces, disintegration and a
- 27 -
scattered arrangement of vascular bundles, hypertrophy of epidermal
cells and scanty chloroplast.
El-Dougdoug et al. (1993) stated that young orange leaves
(Citrus sinensis L.) of Citrus exocortis viroid (CEVd) infected plants
showed less active sieve elements in phloem tissue, phloem radial
thickness and secondary phloem fibers were also reduced. Moreover,
xylem tissue thickness as well as vessel diameter cut down. The
glands reduced also in both number and diameter. As for leaf
mesophyll cells the infection lessened palisade layers, these cells
showed almost cuboidal shape with fewer chloroplast.
El-Shamy et al. (2000) reported that the chloroplasts are great
in number in case of infected tomato leaves compared with healthy
ones. Sayed et al. (2001) showed that, palisade cells of virus infected
tobacco leaves were sometimes small in size rounded or intermingled
with other elongated cells.
3- Biochemical analyses:
A- The role of endogenous salicylic acid (SA) accumulation in
activation of SAR:
Dean and Kuc (1986 a & b) found that through grafting and
stem girdling experiments with cucumber and tobacco plants, the
activation of diseases resistance in parts of plant which remote from
the site of infection, implies the translocation of an endogenous signal.
A model has been proposed where by endogenous signal is
produced at the site of primary infection and is translocated through
the phloem to other parts of the plant (Fig. 1).
- 28 -
Fig (1): Conceptual model for the pathway leading to the
establishment of SAR, (Neuenschwander et al., 1996).
Malamy et al. (1990) and Metraux et al. (1990) showed that
the increase of SA by several hundred folds and the appearance of SA
in phloem sap and in upper non infected leaves of cucumber, tobacco
and Arabidopsis are correlated with the onset of SAR. Yalpani et al.
(1991) and Enydie et al. (1992) reported that in TMV-infected
tobacco, the endogenous level of SA in infected as well as in
uninfected leaves are sufficient to induce resistance and PR-proteins.
Ward et al. (1991); Uknes et al. (1992) and Vernooij et al.
(1995) found that, the exogenous application of SA can induce
expression of SAR genes. Malamy et al. (1990) showed that, the
development of the hypersensitive reaction (HR) and SAR is a
compound of a dramatic increase in the level of endogenous SA in the
- 29 -
inoculated leaves and in the systemically protected tissue, and they
reported that SA levels increase systemically following TMV
inoculation of Xanthi-nc tobacco that carries the N gene to TMV, but
not in a susceptible cultivar (Xanthi-nn).
Gaffeny et al. (1993) and Delancy et al. (1994) provided
evidence supporting this idea comes from the analysis of transgenic
tobacco and Arabidopsis plants that were engineered to over express
SA hydroxylase, an enzyme from P. putida involved in the
metabolism of naphthalene and catalyzing the conversion of SA to the
SAR-inactive catechal. Infected transgenic plants are unable to
accumulate large amounts of SA and are unable express SAR.
Ryals et al. (1996) mentioned that, as much as 70% (tobacco) and
50% (cucumber) of the increase SA in uninfected tissue of pathogen
inoculated plants, results from SA translocation from infected leaves to
uninfected leaves. That implies the systemic translocation of SA from the
site of infection to the other parts of the plants.
SA biosynthesis in plants is not accurately known, but there are
many proposed pathways by different workers. The pathway B proposes
that SA produced only from Benzoic acid (BA) using benzoic acid 2hydroxylase (BA2H) enzyme (Yalpani et al., 1993). BA may be
produced by two pathways (β oxidation and non oxidative), and SA after
that, either converted to catechol or conjugated with glucose to produce
β-O-D glucosyl salicylic acid (SAG).
In pathway A, SA produced either from BA through chain of
chemical reactions or directly from trans-cinnamic acid (t-CA) after
establishment of a middle component (2-hydroxy cinnamic acid).
- 30 -
The pathway C is different from the two previous pathways in:
first, proposed that SA may produced from coumaric acid, which can
convert to phenylalanine (PA) the mean component in the biosythesis
of SA; second, proposed that in mycobacteria, SA may produced from
chorismic acid. All three previous pathways share in one singe, that
SA is produced basically from Cinnamic acid, which resulting from
the amino acid PA.
Both BA and SA can be conjugated with another components;
regulation of SA levels through SA or BA conjugation may be
important (Ryals et al., 1996). Conjugation removes SA from the
active pool, once SA accumulates; it is rapidly converted to SAG
(Yalpani et al., 1993). Conversion of SAG to free SA represents
another potential mechanism for increase levels of free SA.
The principal form of conjugation is SA-glucose, though other
forms are found, including the volatile methyl-salicylate (Enydie et
al., 1992; Malamy et al., 1992 and Shulaev et al., 1997).
In contrast to methyl-salicylate, SAG forms free SA accumulate
only in and around HR lesions formed during the incompatible
interaction between plants and viruses, bacteria and fungi (Enydie et al.
1992). Yalpani et al. (1993) suppose that both BA and SA conjugated
with glucose are important to regulate SA levels in induced plants.
Murphy et al. (1999) mentioned that, resistance genes allow plants
to recognize specific pathogens. Recognition results in the activation of a
variety of defense responses, including localized programmed cell death
(the hypersensitive response), synthesis of pathogenesis-related proteins
and induction of systemic acquired resistance. These responses are co- 31 -
ordinated by a branching signal transduction pathway. In tobacco, one
branch activates virus resistance, and might require the mitochondrial
alternative oxidase to operate.
Singh et al. (2004) stated that, the plant signal molecule salicylic
acid (SA) can induce resistance to a wide range of pathogen types. In the
case of viruses, SA can stimulate the inhibition of all three main stages in
virus infection: replication, cell-to-cell movement and long-distance
movement. Induction of resistance by SA appears to depend, in part, on
downstream signaling via the mitochondrion. However, evidence has
recently emerged that SA may stimulate a separate downstream pathway,
leading to the induction of an additional mechanism of resistance based
on RNA interference. In this review our aims are to document these
recent advances and to suggest possible future avenues of research on
SA-induced resistance to viruses.
Huang et al. (2006) used the biosensor to observe apoplastic SA
accumulation in Nicotiana tabacum L. cv. Xanthi-nc leaves inoculated
with virulent and HR-eliciting strains of the bacterial plant pathogen
Pseudomonas syringae, then demonstrated that, the Actinobacter sp.
ADP1 biosensor is a useful new tool to non-destructively assay
salicylates in situ and to map their spatial distribution in plant tissues
against TMV infection.
Chaturvedi and Shah (2007) stated that, salicylic acid (SA)
plays an important role in plant defense. Its role in plant disease
resistance is well documented for dicotyledonous plants, where it is
required for basal resistance against pathogens as well as for the
inducible defense mechanism, systemic acquired resistance (SAR),
- 32 -
which confers resistance against a broad-spectrum of pathogens. The
activation of SAR is associated with the heightened level of
expression of the pathogenesis-related proteins, some of which
possess antimicrobial activity. Studies in the model plant Arabidopsis
thaliana have provided important insights into the mechanism of SA
signaling in plant defense.
B- Quantification of total SA:
Raskin et al. (1989) measured free endogenous SA in Alium lily
using HPLC. One gram of frozen tissue was grounded in methanol, to
prepare methanol extract and then, this extract was dried under
vacuum. After resuspention of the pellet, SA was extracted using
mixture of cyclopentane / ethylacetate / isopropanol (50:50:1). This
organic extract was dried under nitrogen and analyzed by HPLC.
Yalpani et al. (1993) measured free SA using HPLC column,
but the preparation of plant samples was different, for instance,
organic extract was also by ethylacetate / cyclopentane / isopropanol,
but in different portions (100:99:1). SA content generally was
determined by UV absorption and fluorescence after separation on a C
18 reverser-phase HPLC column to measure conjugation SA
hydrolysis with β-glucosidase enzyme (Enydie et al., 1992). Or
boiling for 30 min. in acidified phosphate buffer (Ukens et al., 1993),
must be performs.
Deng et al. (2003) found that, salicylic acid (SA) is a signaling
compound in plants such as tobacco, cucumber, and tomato which can
induce systemic acquired resistance. In the work discussed in this
- 33 -
paper a simple, rapid, and sensitive method was developed for
determination
of
salicylic
acid
in
plant
tissues
by
gas
chromatography–mass spectrometry (GC–MS). SA from tomato
leaves extracted with 9:1 (v/v) methanol–chloroform was derivatized
by use of bis (trimethylsilyl) trifluoroacetamide (BSTFA) under the
optimum reaction conditions (120°C, 60 min). Quantitative analysis
by GC–MS was performed in selected ion monitoring (SIM) mode
using an internal standard. Procedures for sample preparation and
reaction conditions were optimized. Analysis was completed within 2
h. A sensitivity of 10 ng g–1 fresh weight and a relative standard
deviation less than 5.0% for SA in tomato leaves were achieved. The
method could be used for investigation of SA in plant tissues to
monitor fast responses of plant defense.
Salem (2004), Megahed (2008) and Taha (2010) measured free
and endogenous of SA at once in squash, pepper and cucumber plants.
One gram of frozen tissue was grounded in methanol, to prepare
methanol extract and then, this extract was dried under vacuum. The
dried extracts were then resuspended in 3 ml of distilled water at 80°C
and an equal volume of 0.2M sodium acetate buffer, pH 4.5, containing
0.1 mg/ml β-glucosidase, SA was extracted using mixture of
cyclopentane/ ethylacetate/ isopropanol (50:50:1). This organic extract
was dried under nitrogen and analyzed by using HPLC- fluorescence.
Araf (2008) found that, bacterial effect on the level of endogenous SA in
plants after 5th and 7th days of bacterization, generally SA level in
treated plants was high compared to untreated plants in either after 5th or
7th days after bacterization which indicate to the effect of the strains in
- 34 -
enhancing the expression of SA genes but the level of SA was higher at
7th day than 5th which confirm that ISR reach to maximum level after
7th days of stimulation either by biotic or a biotic inducer, after 5th days
of bacterization SA was high in plants treated with Pseudomonas
fluorescence B4 while all the strains were nearly similar in its effect after
7th days of bacterization.
C. Enzyme activity:
C.1- Peroxidase (POD):
Campa (1991) found that, peroxidases have further been divided
into anionic and cationic groups according to their electrophoretic
mobility. Class III POD (EC 1.11.1.7) have been assigned a many
physiological roles in the several primary and secondary metabolic
processes like scavenging of peroxidase, participation in lignifications,
oxidation of toxic compounds, hormonal signaling, plant defense, indole
acetic acid (IAA) metabolism and ethylene biosynthesis.
Wojtaszek (1997) reported that, peroxidases play an important
role in one of the earliest observable aspects of plant defense strategy.
Chittoor et al. (1999) found that, peroxidases are a class of proteins
and therefore, may be directly associated with the increased ability of
systemically protected tissue to lignify when plants are threatened by
microorganisms or physically injured.
The treatment also elicited a systemic increase in peroxidase
activity and increase of two anionic peroxidases on isoelectric focusing
gels which were positively correlated with induced resistance.
Peroxidases are also implicated in hypersensitivity response (Bestwick et
- 35 -
al., 1998), lignin biosynthesis ethylene production and suberization
(Quiroga et al., 2000).
Leaf extract at four o'clock flower (Mirabilis jalapa) is one
agent induced systemic resistance against the attack of red pepper
Cucumber Mosaic Virus (CMV). This study investigated the
peroxidase activity and salicylic acid content in red pepper-induced
ketahananya against CMV by using a leaf extract of M. jalapa. Result
analysis Note that the red pepper plant induced resistance CMV
attacks by leaf extract of M. jalapa shows low intensity CMV attacks,
the low content of virus, an increase in enzyme activity peroxidase 210 times, and salicylic acid content of 1.6 to 5 times compared with no
induction (control). There is a closeness of relationship high between
the intensity of CMV with peroxidase activity (r = 0.94), the
relationship between the intensity of the attacks being CMV with the
content salicylic acid (r = 0.46), low closeness of the relationship
between content of virus with CMV disease intensity (r = 0.32),
salicylic acid with activity peroxidase (r = 0.39), and there is no
closeness between the concentration of virus with salicylic acid
content (r = 0.05) and viral content with activity peroxidase (r = 0.12)
(Hersanti, 2005).
C.2- Polyphenol oxidase (PPO):
Polyphenol oxidases (PPO, EC 1.14.18.1) are involved in the
oxidation of polyphenols into quinones (antimicrobial compounds)
and lignification of plant cells during the microbial invasion. Phenol
oxidases generally catalyze the oxidation of phenolic compounds to
- 36 -
quinones using molecular oxygen as an electron acceptor (Sommer et
al., 1994). The role of PPO in plants is not yet clear, but it has been
proposed that it may be involved in necrosis development around
damaged leaf surfaces and in defense mechanisms against insects and
plant pathogen attack. Phenolic compounds may function by inhibting
bacterial growth or serve as precursors in the formation of physical
polyphenolic barriers, limiting pathogen tanslocation. PPO-generated
quinones modify plant proteins, decreasing the plants nutritive
availability to herbivores or invaders. Polymeric polyphenols seem to
be more toxic to potential phytopathogens than are the phenolic
monomers (Aydemir, 2004).
D- Determination of total amino acids:
Eisa et al. (2006) stated that the soluble protein content in the
5th leaf of the squash plants was responded differently against the
tested treatments. Ascorbic acid "AsA", CoCl2, KH2PO4, SA, MnSO4
and CaCl2 significantly increased the protein content by more than
18.9, 11.6, 10.5, 8.5, 7.9, and 3.0 fold over control treatment. While
Penconazole, OA and BA did not affect the protein content
significantly if compared with the control treatment. The highest
increase in the protein content was associated, in general, with the
middle concentration. As for interaction, AsA induced the highest
increase of soluble protein at 10mM, followed by CuSO4 at 10mM,
CuSO4 at 20mM, CuSO4 at 5mM, CoCl2 at 10mM arid CoCl2 at 20
mM, respectively. On the contrary, BA and OA (at 5, 10 and 20mM),
- 37 -
CaCl2 and CoCl2 (at 5mM) and Penconazole (at 25 ppm) did not affect
the total soluble protein content when compared with control.
E- Determination of carbohydrates:
Zahra (1990) found that, reducing, non-reducing and total
sugars were higher in diseased roots of highest and lowest susceptible
sesame cultivars than in healthy ones. Healthy roots of highest
susceptible cultivar had more reducing and total sugars than in the
lowest susceptible. While, non-reducing sugars content was more in
healthy roots of the lowest susceptible cultivar than the highest
susceptible one.
F- Determination of total phenols
Abd El-Kader (1983) reported that healthy and diseased roots
of resistant soybean cultivars contained more phenolic compounds
than in susceptible cultivar. Infection with Rhizoctonia solani, S.
rolfsii and F. oxysporum increased the phenolic contents of the roots
of both cultivars. The amount of increase was greater in the roots of
resistant cultivars than the susceptible ones.
Pathak et al. (1998) determined the amount of total phenols in
charcoal rot (Macrophomina phaseolina) resistant and susceptible
cultivars of sunflower. They found that amount of total phenols was
the maximum in the immune cultivar and the minimum in the highly
susceptible cultivar.
Kalim et al. (1999) controlled root-rot of cowpea caused by R.
solani and M. phaseolina. Reduction in disease incidence was attributed
- 38 -
to the increased enzymes activity and with higher amounts of total
phenols. Infection also caused an increase in the content of total phenols,
reducing sugar but decrease in O-dihydric phenols, flavanols, total
soluble sugars, non reducing sugars. Several investigators pointed out of
phenolic compounds than the susceptible ones.
Meena et al. (2001) investigated the effect of salicylic acid (SA)
on the induction of resistance in groundnut against late leaf spot. In
salicylic acid (SA) treated leaves, an increase in phenolic content was
observed one day after challenge inoculation with Cercospora
personatum.
Ahmad (2004) revealed that the free, conjugated and total
phenols were affected significantly by the tested treatments. All tested
treatments increased the free phenol. The highest increase in the free
phenols was induced by Topas-00 followed by K2HPO4. As for the
total phenols, all tested treatments increased the total phenols. The
highest increase in the total phenols was induced by Topas-100
followed by K2HPO4. The conjugated phenols increased by Topas-100
over control.
Sudhakar et al. (2007) indicated that, studies were undertaken
to evaluate ozone (O3) for induction of resistance against Cucumber
mosaic virus in Lycopersicon esculentum cv. PKM1 (tomato) plants.
Callus induced from tomato leaf explants on Murashige & Skoog's
(MS) medium supplemented with benzyladenine (8.82 µM) were
treated with different concentrations of ozone T(1), T(2), T(3) and for
control (C), filtered air was supplied. Regeneration of shoots was
obtained by culturing ozone treated calli on MS medium containing
- 39 -
17.3 µM benzyladenine. The plants regenerated from ozone treated
callus are referred to as T(1), T(2) and T(3) plants, which hold
remarkably increased soluble phenolic content compared to the
control plants.
Kavino et al. (2008) found that, Pseudomonas fluorescens strains
CHA0 and Pf1 were investigated for their biocontrol efficacy against
Banana bunchy top virus (BBTV) in banana (Musa spp.) alone and in
combination with chitin under glasshouse and field conditions.
Bioformulation of P. fluorescens strain CHA0 with chitin was effective
in reducing the banana bunchy top disease (BBTD) incidence in banana
under glasshouse and field conditions. In addition to disease control,
increased accumulation of oxidative enzymes, peroxidase (PO),
polyphenol oxidase (PPO), phenylalanine ammonia lyase (PAL),
pathogenesis-related (PR) proteins, chitinase, β-1,3-glucanase and
phenolics were observed in CHA0 bioformulation amended with chitintreated plants challenged with BBTV under glasshouse conditions.
G- Chlorophyll contents:
Investigation with several host-virus combinations had shown
a reduction in photosynthesis in infected leaves (Bollard and
Mathews, 1966).
Omar et al. (1986) found that Soy bean mosaic virus (SBMV),
Bean common mosaic virus (BCMV) and Lettuce mosaic virus (LMV)
caused a significant reduction in chlorophyll a, b and carotenoid
content in soy bean and lettuce leaves respectively. Brakk et al.
(1986) also found that chlorophyll content of barley plants reduced
- 40 -
due to infection with Barley stripe mosaic virus. Galal (1989) found a
reduction in the total chlorophyll of Cucurbita pepo plants infected
with Cucumber mosaic virus (CMV). Hudgson et al. (1989) found
that TMV-infected spinach leaves showed inhibition of photosynthetic
electron transport through photosystem II. They proposed that the
inhibition of photosynthesis results from the association of viral coat
protein with the PS II complex. In this respect Montalbin and
Lupatill (1989) found that chloroplasts isolated from tobacco leaves
inoculated with TMV from exhibited a strong inhibition of electron
transport by 60- 70%. Also ribulose 1, 5 diphosphate carboxylase was
decreased by 30-40%. Rajeswari and Rajamannar (1991) found
that, Betelvine mosaic virus induced biochemical changes in leaves of
piper betle plants resulting in reduction of 56, 66 and 69% in
chlorophyll a, b and total chlorophyll, respectively.
Chakraboty et al. (1994) reported that, the amounts of chlorophyll
were lower in the leaves of cucumber, pumpkin, sponge ground snake
gourd and bottle gourd, after infection with viruses causing mosaic in
these plants. Nassar (1998) found that by using electron microscope that
TMV-infection of tomato leaves appeared chloroplast with cup shape and
contained large vesicles and reduction in grana stack height if compared
with healthy tomato leaf cells, he also noticed a reduction in chlorophyll
a, b and total pigments. Hou et al. (1998) found that quantitative changes
of chlorophyll and the characteristics of fluorescence spectra of tobacco
leaves infected by TMV had their quantity of chlorophyll decreased.
They also added that, extracts of 8 species of plants, extracts of
Lithospermum erythrhizon and Rosa chinensis were effective in
- 41 -
inhibiting TMV multiplication and protecting the chloroplast from TMV
infection which resulted in an increase in chlorophyll content and
photosynthesis.
H- Molecular genetics response to SAR as pathogenesis related
proteins:
Increase in resistance was correlated with the accumulation of
pathogenesis-related (PR) proteins, generally assumed to be markers
of the defense response (Ward et al., 1991). Various novel proteins
are induced which are collectively referred to as "pathogenesis-related
proteins (PRs). These PRs defined as proteins coded by the host plant
but induced specifically in pathological or related situations (Antoniw
and Pierpoint, 1978 & Van Loon et al., 1994) do not only
accumulate locally in the infected leaf. But are also, induced
systemically, associated with the development of systemic acquired
resistance (SAR) against further infection by fungi, bacteria and
viruses. Induction of PRs had been found in many plant species
belonging to various families (Van Loon, 1999). The induction of PRproteins in various plant tissues is one of the major biochemical and
molecular events when plant are subjected to infections with
pathogens such as viroids, viruses, bacteria and fungi (Van Loon,
1997). White and Antoniw (1991) suggest that, induced resistance to
viruses based on formation of PR- protein. The relation between PRproteins and resistance to viruses had been confirmed by studying the
interspecific hybrid N. glutinosa x N. debnevi, which contain PRproteins and is highly resistant to TMV.
- 42 -
PR proteins are classified into 14 distinct families and include
both basic and acidic isoforms (Van Loon and Van Strien, 1999).
PR-proteins constitute a heterogenous group of proteins whose
expression has served as a reliable marker for induction of SAR. In
tobacco, seven families of PR-proteins are known. Although
enzymatic activities could be assigned to some proteins. Their
functions during the defense response have remained obscure. In
addition to their emergence after pathogen infection. Subsets of PRprotein are also expressed in substantial amounts in healthy plants.
The tobacco acidic PR-protein of group 1 (PR.1) for example,
accumulate in plants upon transition to flowering (Fraser, 1981).
Grüner and Pfitzner (1994) suggesting that, they play role in defense
reactions against pathogens as well as during plant development. Araf
(2008) reported that, PR-1a mRNA accumulation was examined in a
time course experiments during the early stage of root colonization,
the expression pattern was investigated by using RT-PCR approach
this method which is more sensitive. Allowed the examination of the
expression of PR-1a gene through the use specific primers, mRNAs
for this gene began to accumulate after 1 day of treatment and reached
to high levels at 6th day. This expressed in untreated and treated plants
but increased about two fold in treated plants.
- 43 -
MATERIALS AND METHODS
This study was conducted at Plant Pathology Lab. and
Greenhouses of Botany Dept., Fac. of Agric., Moshtohor, Banha Univ.
and Virology Lab., Microbiology Dept., Fac. of Agric., Ain-Shams
Univ. During 2007/08 and 2008/09 growing seasons, some tomato
fields at Qalyoubia Governorate were surveyed for viral infections.
Through the assessment of disease incidence and severity, Cucumber
mosaic cucumovirus (CMV) was the dominant one among the tomato
viruses in the surveyed fields. Identification of isolated virus (CMV)
was achieved using host range, transmission, stability in sap, inclusion
bodies and confirmed via Dot blot immunoassay (DBIA). Obtained
results dealing CMV confirmation was completely agreement with the
previous confidential recording. Therefore, many experiments were
successively to deducing if induction of systemic acquired resistance
against CMV was successfully achieved under greenhouse and open
field of tomatoes using four biotic inducers or not.
Part I
1- Disease incidence and frequency of virus(es):
Three hundred and fifty samples of infected tomato plants
showing distinct viral symptoms in the form of mosaic, mottling,
blisters, crinkle, yellowing, malformation and erecting (Plate, 1) were
collected from 5 locations of Qalyoubia Governorate (Banha, Toukh,
Qaha, Shebien El-Qanater and El-Qanater El-Khayria). The symptoms
were recorded using the following rating scale: 0 = No symptoms, 1 =
Materials and Methods
- 44 -
Vein clearing and mild mosaic, 2 = Severe mosaic, 3 = Crinkle, 4 =
Epinasty and Deformation, 5 = Erect, 6 = Rosette, 7 = Stunting and
leaf narrow and 8 = Leaves showing Vein necrosis. Disease incidence
and severity were calculated using the following formulas according to
Yang et al. (1996):
Disease incidence (%) =
Disease severity (DS%) =
Number of infected plants per location × 100
Total number of plants/location
Σ (disease grade × number of plants in each grade)x 100
Total number of plants × highest disease grade
Plate (1): Different types of natural infection symptoms on tomato
leaves showing mosaic, mottling, blisters, crinkle,
yellowing, malformation and erecting.
- 45 -
The samples were examined serologically by Double Antibody
Sandwich-enzyme Linked Immunosorbent Assay (DAS-ELISA) using
antisera specific to 5 viruses include: Cucumber mosaic virus (CMV),
Tomato mosaic virus (ToMV), Tomato yellow leaf curl virus
(TYLCV), Potato Y virus (PVY) and Potato X virus (PVX) according
to Clark and Adams (1977) as follow: 200µL of prepared
immunoglobulin G (IgG) against CMV at concentration 1µ g/ml were
diluted in coating buffer, pH 9.6 and incubated in the microtitre plate
at 4°C overnight. The wells were washed three times with washing
buffer, pH 7.4 [phosphate buffer saline (PBS) (0.15 M NaCl)
containing 0.1% Tween-20 and 0.01 sodium azide]. 200µL of each
sample were diluted 1:20 (W/V) in extraction buffer (0.01 M PBS, pH
7.4 containing 0.05% Tween-20, 2% polyvinylpyrrolidine, M.Wt.
40.000) and then incubated at 4°C overnight. The plate was washed
three times with washing buffer. 200 µL of IgG alkaline phosphatase
conjugate diluted at 1/100 in conjugate buffer, pH 7.0 [PBS, 1%
bovine serum albumin (BSA), 0.25% Tween-20] was added to each
well and incubated for 3 hr at 37°C. The conjugate was removed and
the plate washed three times with washing buffer. 200 µL of freshly
prepared substrate (ρ-nitro phenyl phosphate) in substrate buffer (10%
diethanol amine, NaN3 0.01%) at concentration 0.75 mg/ml was added
to each well. The reaction was read spectrophotometrically at wave
length 405 nm after incubation at 37°C for 30-60 min. using ELISA
reader (Labsystems Multiskan MS), after the reaction stopped by
adding 50 µL of 3 M NaOH.
- 46 -
2- Isolation, propagation and identification of an isolated virus:
2.1- Mechanical transmission:
For transmission and host range studies, mechanical inoculations
were carried out by extracting tomato, cucumber or Nicotiana tissues
infected with CMV in 0.1 M phosphate buffer, pH 7.0 containing 1.0%
sodium sulphite (1:2w/v). The infectious sap was applied to healthy
tested plants in addition to tomato. Leaves of the inoculated plants were
previously dusted with 400 mesh carborandum. For control treatment
carborundum dusted leaves were inoculated with phosphate buffer alone.
Inoculated plants were maintained in the greenhouse at 25-30ºC and
inspected daily for symptom development. The inoculated plants were
serologically tested using CMV antiserum (Dheepa and Paranjothi,
2010).
2.2- Host range:
Fourteen plant species belonging to 4 families (Chenopodiaceae,
Cucurbitaceae, Leguminoseae, and Solanaceae), Table (6) were
mechanically inoculated with virus isolate using five plants of each host.
Control plants were inoculated with buffer only. The inoculated plants
were kept under an insect proof in greenhouse conditions and observed
daily for symptoms development. The results were confirmed by Dot blot
immunoassay (DBIA) using specific CMV polyclonal antibodies.
2.3- Aphid transmission:
Pure identified aphids colonies belong to order. Hemiptera; family,
Aphididae; include: Aphis craccivora and Myzus persicae which were
kindly provided by Economic Entomology Branch, Plant Protection
- 47 -
Dept., Fac. of Agric., Moshtohor, Banha Univ. Individual colony of each
was kept in the insect proof and reared on healthy cabbage seedlings
(Brassica oleracea L. subsp. oleracea) until fourth instar nymph has
appeared.
Separately homologous colony of apterus adults of both aphids
were collected to evaluate as the isolated virus vectors. Twenty-five of
both aphids were starved for 2 hours on filter paper (inside Petridishes), allowed to acquisition feeding for 2 min on CMV infected
cucumber, then transferred to 5 healthy tomato seedlings (five aphids
per seedling) for inoculation, feeding period of 24 hours.
For the control, the same procedure was used, but virus-free
aphids where feeding for acquisition on healthy tomato plants. The
inoculated seedlings were then sprayed with the insecticide Malathion
(0.1%). Symptoms and transmission percentage were recorded at 4
weeks after inoculation.
2.4- In vitro properties:
Stability of CMV isolate, [Thermal inactivation point (TIP),
Dilution end point (DEP) and Longevity in vitro (LIV)] were
performed according to Noordam (1973), using C. amaranticolor as
local lesion host to CMV. The fresh infectious crude sap as well as
healthy sap one (control) was used to inoculate 5 plants of C.
amaranticolor. The inoculated plants were kept under the green house
conditions and the numbers of local lesions were recorded.
CMV crude sap from infected N. glutinosa leaves was diluted by
0.1 M phosphate buffer, pH 7.2 at the rate of 1:1 (v/v), and then
distributed as 0.5 ml in eppendorf tubes. The infected sap was heated
- 48 -
for 10 min in controlled water bath at various temperatures (45-75°C
intervals 5°C). The eppendorfs were immediately cooled by dipping in
tap water. Unheated infectious sap was used as a control.
Fresh infectious sap was diluted with distitelled water to prepare
a dilution series from 10-1 to 10-7. Undiluted infectious sap was used
as a control.
The infectious sap was placed in sterilized eppendorf at the rate
0.5 ml/eppendorf and kept at room temperature (25±2°C). The CMV
infectious sap was assayed daily for longevity up to 10 days.
2.5- Inclusion bodies
Crystalline inclusion bodies (CIB) were examined in the
epidermal strips from the lower surface leaves of cucumber plant
inoculated mechanically with CMV isolate (15 days after inoculation).
The strips were removed using forceps, then mounted in a drop of
distilled water on clean glass slide and covered with glass cover, then
examined under light microscope, magnification of 400-X.
The amorphous inclusion bodies (AIB) were examined in the
epidermal strips obtained from leaves of cucumber plant inoculated with
CMV isolate (15 days after inoculation). The strips treated first with 5%
solution of Triton X-100 for 10 min. The strips were immersed in a stain
solution containing 100 mg bromophenol blue and 10 mg mercuric
chloride dissolved in 100 ml distilled water for 15 min. the stained strips
were transferred to 0.5% acetic acid for 15 min and then washed in tap
water for 15 min. Finally, the strips were examined by light microscope,
magnification of 400-X. according to Mazia et al. (1953).
- 49 -
2.6- Serological confirmation
Dot blots immunoassay (DBIA):
Dot blot immunoassay was used for identification of CMV isolate
as described by Lin et al. (1990) as follows: Nitrocellulose membranes,
0.45µM pore size, were marked with a lead pencil into squares of 1 x 1
cm. Healthy and infected samples were ground in phosphate buffer, pH
9.5 (1:10, w/v). Five µl clarified in each square for each of healthy and
virus infected samples were spotted. The membrane was washed three
times with PBS-Tween [phosphate buffer saline (0.15 M NaCl)] at 5 min
interval. Then placed in the blocking solution [1% bovine serum albumin
(BSA) + 2% nonfat dried milk in PBS-Tween] and incubated for 1hr at
room temperature. The membrane was washed three times with PBSTween at 5 min interval. The treated membrane was placed in the virus
specific antiserum diluted in PBS 1:500 and then incubated for 1 hr at
room temperature with gently shacking. The membrane was washed
three times with PBS-Tween at 5 min interval. The goat anti rabbit
immunoglobuline-alkaline phosphate conjugate (Sigma A 4503) dilution
1: 1000 in conjugate buffer (PBST + 2% PVP + 0.2 % Ovalbumin) was
added to the membrane and incubated for 1 hr at room temperature. The
membrane was washed three times with PBS-Tween at 5 min interval.
The substrate solution (Nitro Blue Tetrazolium and 5-bromo 4-chloro 3indolyl phosphate) was added and incubated for 5 min at room
temperature. After the color appeared, the membrane was rinsed quickly
with H2O then air-dried.
- 50 -
Part II
Induction of systemic acquired resistance
1- Source and preparation of biotic inducers:
Fresh shoots of 2 medicinal plant [belonging 2 families] were
collected from the botanical garden of Fac. Agric., Banha Univ., and
kombucha (kindly provided by Dr. Mohamad A. Hafez) from Plant
Pathology Lab., Fac. Agric., Moshtohor, Banha Univ. were chosen
depending on previous information’s dealing their systemic resistance
inducers as producers for ribosomal inhibitor proteins (RIPs) such as:
Clerodendrum inerme L. Gaertn (Kumar et al., 1997), Mirabilis
jalapa L. (Leal et al., 2001) and kombucha (Dipti et al., 2003).
Stock aqueous crude extraction for each individual tested plant
was made by blending 1 kg leaves tissue in 1 liter heated distilled
water (65°C), and then filtered through 8 layers of sterilized muslin
cloth. The filtrate was collected and stored in the refrigerator until use.
Stock aqueous crude extract from kombucha was prepared by
fermenting sweetened green tea (100 g sucrose, 10 g Chinese green
tea per liter of water) preparations with a symbiotic colony of yeasts
and bacteria (starter). After 12 days from incubation at 28°C, mother
culture was omitted and extract was kept to self-refermentation for
additional 21 days, extract was collected, centrifuged for 10 min. at
1000 rpm to separate any debris, then sterilized using sintered glass (G6)
funnel (Betsy and Sonford, 1996). Crude kombucha filtrate was used
either as it is (100%) or diluted to 50% with distilled water.
- 51 -
2- Experimental procedures of SAR against viruses:
The
sterilized
seeds
of
Lycopersicon
esculentum
cv.
Supermarmand VFN (Egyptian Company for Seeds, Oils and
Chemicals, 2008) were sowed in clay soil at nursery. After one month,
the seedlings were transplanted in clay pots (Ø 25 cm) with 5
seedlings/pot. The pots were divided into two experiments. The first
experiment was to determine systemic acquired resistances applied to
tomato seedlings at the fourth leaves stage were sprayed (30 ml per
plant) by the potential inducers at wet film according Vivanco et al.
(1999). Five pots for each of 4 biotic inducer [Mirabilis jalapa,
Clerodendrum inerme, mixture of (Mirabilis and Clerodendrum) and
kombucha] as well as control plants which sprayed with water,
treatments were as follows:
1- Tomato plants sprayed with Mirabilis jalapa extract (Mj).
2- Tomato plants sprayed with Clerodendrum inerme extract
(Ci).
3- Tomato plants sprayed with mixture of Mirabilis and
Clerodendrum extracts (1:1, v: v); (Mj+Ci).
4- Tomato plants sprayed with kombucha (K).
5- Healthy tomato plants non-inoculated with CMV isolate
(healthy control); (H).
6- Tomato plants inoculated with CMV isolate (infected
control); (V).
Seven days after spraying tomato plants, samples from each
previous treatment (for detection acquired resistance), were taken and
other plants were rub-inoculated with CMV inoculum (CMV
- 52 -
infectious sap 10-1 diluted in phosphate buffer 0.1 M and pH 0.7) by
spatula to all treatments. Healthy control plants were inoculated with
sterile extraction buffer (PPB) and infected control plants were
inoculated with CMV. After 25 days from CMV inoculation, other
samples of tomato plants were taken.
The second experiment (biocontrol) of tomato plants was carried
out by rub-inoculating with CMV inoculum then sprayed by biotic
inducers after 15 days of virus inoculation with the same treatments in
first experiment. Then samples (for determination of biocontrol) were
taken from each treatment after 7 and 25 days of spraying inducers.
The tomato plants were immediately rinsed with water and kept
under greenhouse conditions and observed daily until symptoms
appeared after 25 days. Chenopodium amaranticolor plants were used
for qualitative and quantitative assaying.
3- Parameter and methods of SAR detection and biocontrol:
3-1. Biological detection:
3.1.1. Percentage of virus infection:
The percentage of virus infection was determined and calculated
relative to infected control, 25 days from inoculation with CMV.
3.1.2. Reduction of virus infection (RI):
The reduction of virus infection was calculated to all treatments
as follows:
Reduction of Infection (RI%)=
Control - treated x 100
Control
- 53 -
3.1.3. Disease severity:
All tomato plants in each treatment were examined weekly for
virus symptoms, after 25 days from CMV inoculation. The disease
severity was assessed as mentioned before.
3.1.4. Anatomical studies
It was intended to carry out a comparative anatomical study on
leaves of treated plants and those of the control at 22 days (preinoculated and sprayed with inducers) and 40 days (post-inoculated
and sprayed with inducers) after transplanting. Groups of each
treatment were sprayed with distilled water served as control.
Small pieces were taken from the midrib region of the 4th upper
apical leaf on the main stem, then killed and fixed in FAA (10 ml
formalin, 5 ml glacial acetic acid and 85 ml ethyl alcohol 70%),
washed in 50% ethyl alcohol, dehydrated in a series of ethyl alcohols
(70, 90, 95 and 100%), infiltrated in xylene embedded in paraffin wax
with a melting point 60-63°C. Sections were made at 15-17 µm thick
using rotary microtome, mounted on glass slides and stained with
aqueous Safranin O (1%) and Fast Green (0.1% in 95% ethanol), as
described by Ruzin (1999). Four sections treatment were
microscopically inspected to detect histological manifestations of
noticeable responses resulted from treatments. Counts and
measurements (µ) were taken using a micrometer eye piece. Averages
of readings from 4 slides/treatment were calculated. Number of
epidermal hairs was count in 720 µ in middle of the epidermis.
Sections were examined with SEIWA OPTICAL light
microscope (using a 10x lens) and photographed by Genius P931
digital camera using Image Manager 50 program. Various
measurements were performed on microscopic images.
- 54 -
3-2. Biochemical analyses:
A- Quantification of total salicylic acid (SA):
Free and endogenous of SA were measured at once in the
treatments by a method according to Raskin et al. (1989), with one
modification by Salem (2004). One gram of frozen tissue was ground
in 3 ml of 90% methanol and centrifuged at 6000 rpm for 15 min. The
pellet was back extracted with 3 ml of 99.5% methanol and
centrifuged as above. Methanol extracts were combined and then
centrifuged at 1500 to 2000 rpm for 10 min. the supernatant was dried
at 40°C under vacuum using rotary evaporator (Heidolph.). The dried
extracts were then resuspended in 3 ml of distilled water at 80°C and
an equal volume of 0.2 M sodium acetate buffer, pH 4.5, containing
0.1 mg/ml β-glucosidase (22 unit/mg, Sigma) was added, and then the
mixtures were incubated at 37°C overnight. After digestion, mixtures
were acidified to pH 1 to 1.5 with HCl. SA was extracted by adding
(1:2, v: v) of sample: cyclopentan/ethylacetate/isopropanol (50:50:1).
The organic extract was dried under nitrogen and analyzed by
HPLC [SHIMADZO RF-10 AXL Fluorescence, HPLC Lab., National
Research Center (NRC)]. One hundred microliters of each sample
were injected into Dynamax 60A8 µm guard column (46mm x 1.5cm)
linked to 40°C.
SA was separated with 23% v/v methanol in 20 mM sodium
acetate buffer, pH 5.0 at a flow rate of 1.5 ml min-1. SA level was
determined using standard curve.
- 55 -
B- Detection of antiviral proteins
B.1- Extraction of total proteins:
Tomato leaves were collected from plants treated with biotic
inducers pre and post CMV inoculation. Proteins were extracted
according to Lanna et al. (1996). One gram fresh weight was ground
in a mortar and pestle containing liquid nitrogen. The resulting
powder was macerated for 30 sec in 3 ml extraction buffer [50 mM
sodium phosphate buffer, pH 6.5, 1mM phenylmethylsulfonyl
(PMSF)], then centrifuged at 20.000 rpm for 25 min. at 4°C. The
supernatant was divided and kept in ice for the following
determination.
B.1.1- Determination of protein content:
Principle:
The protein determination is based on the observation that
coomassie brilliant blue G-250 exists in two different colour forms,
red and blue. The red form is converted to the blue form upon binding
of the dye to protein. The protein-dye complex has a high extinction
coefficient thus leading to great sensitivity in measurement of the
protein. The binding of the dye to protein causes a shift in the
absorption maximum of the dye form 465 to 595 nm and the increase
in the absorption at 595 nm in monitored. It is very rapid process
(approximately 2 min), and the protein-dye complex remain dispersed
in solution for a relatively long time (approximately 1 hr), (Bradford,
1976).
- 56 -
Preparation of the protein assay reagent:
One hundred mg of coomassie brilliant blue (CBB) G-250 were
dissolved in 50 ml of 95% ethanol. One hundred ml of 85% (w/v)
orthophosphoric acid was added and the final volume was adjusted to
1 L. The dye solution was filtered and kept for 2 weeks in dark at
20°C before use.
Procedure:
Five hundred µl of protein assay reagent added to 500 µl of
distilled water containing the protein sample. After mixing, the
absorbance was recorded at 595 nm within one hr against a blank control
in 1 cm light path cuvette using Shimadzu UV-2401 PC UV-Vis
recording spectrophotometer (Molecular Biology Lab. NRC). A standard
curve was constructed by using BSA as standard protein (Fig. 2).
12
Absorbance at 595 nm
10
8
6
4
2
0
0
5
10
15
Protein concentration (µg/ml)
Fig. (2): Standard curve of the protein concentration using bovine
serum albumin as a standard protein.
- 57 -
B.1.2- Qualitative assaying of protein:
1- Sodium dodecyl sulfate poly acrylamide gel electrophoresis
(SDS-PAGE):
Principle:
The strongly an ionic detergent SDS is used in combination with
a reducing agent (sulfhydryl compound) and heat to dissociate the
proteins before they are loaded on the gel. The denatured polypeptides
bind SDS become negatively charged. Since the amount of SDS
bound is almost always proportional to the molecular weight of the
polypeptide and is independent of its sequence, SDS-polypeptide
complexes migrate through poly acrylamide gels in accordance with
the size of the polypeptide. At saturation, approximately 1.4 g of SDS
is bound per 1g of polypeptide (Laemmli, 1970).
Procedure:
1) Gel casting:
Twelve percent acrylamide solution was made up for separating
gel as shown in Table (1) and casted in two vertical slabs (9x10x0.1
cm in size). The solution was carefully overlaid with isobutanol
saturated with water to avoid inhibition of polymerization by oxygen
diffusion and to perform a flat surface. After the polymerization of the
separating gel, the saturated isobutanol was substituted with the
stacking gel (5%) (Table 1), then the appropriate comb was inserted
and the gel was left to be polymerized.
- 58 -
2) Sample Preparation:
The protein samples were denatured by heating them at 95°C for
5 min with an equal volume of the sample buffer to dissociate the
proteins to theirs subunits.
3) Electrophoresis:
After mounting the gel in the electrophoresis apparatus, the
reservoir buffer was added to the top and bottom of the gel and the
samples were loaded into the gel wells submarine. Electrophoresis
was performed at 150 volt per two gels till the marker dye
bromophenol blue (BPB) reach the end of the gels.
4) Staining and destaining:
The gels were stained for 2 hrs in 0.1% (w/v) coomassie brilliant
blue R-250 in 40% methanol and 10% glacial acetic acid solution. The
destaining was carried out by several washes in the same solution
lacking dye.
Table (1): Preparation of SDS-PAGE gels.
Stock solution
Separating gel 12%
Stacking gel 5%
30% acrylamide
6.0 ml (12%)
1.66 ml (5%)
2% bisacrylamide
2.4 ml (0.32%)
0.65 ml (0.13%)
2.25 M Tris-HCl, pH 8.9
1M Tris-HCl, pH 6.8
H2O
2.5 ml (0.375M)
…………………..
…………………
3.97 ml
1.25 ml (0.125M)
6.335 ml
20% SDS
0.075 ml (0.1%)
0.05 ml (0.1%)
10% APS
0.05 ml (0.033%)
0.05 ml (0.05%)
TEMED
0.005 ml
0.005 ml
Total volume
15.0 ml
10.0 ml
- 59 -
2- Native polyacrylamide gel electrophoresis (PAGE):
Native polyacrylamide gel electrophoresis was used for isozyme
determination.
Principle:
Polyacrylamide gels are composed of chains of polymerized
acrylamide that are cross-linked by a bifunctional agents such as N,Ńmethylene bisacrylamide.
The native gel electrophoresis separates proteins based on their
size and charge properties. While the acrylamide pore size serves to
sieve molecules of different sizes, proteins which are more highly
charged at the pH of the separating gel have a greater mobility
(Smith, 1969).
Procedure:
1- Gel casting:
Twenty ml of 7% polyacrylamide gel was prepared by mixing
two volumes of acrylamide monomer solution, one volume of gel
buffer solution, one volume distilled water and four volumes of
freshly prepared ammonium persulfate solution, deaerated rapidly and
casted in two vertical slabs (10×10×0.1 cm in size). The appropriate
comb was inserted and the gel was left to be polymerized.
2- Sample preparation:
The samples were prepared by mixing each sample with an
equal volume of the sample buffer.
- 60 -
3- Electrophoresis:
After mounting the gel in the electrophoresis apparatus, the
reservoir buffer was added to the top and bottom of the gel and the
sample were loaded into the gel wells submarine. Electrophoresis was
performed at 150 volt per two gels till the marker dye BPB reach the end
of the gels. The gels were analyzed using Alpha EaseFC 4.0 software.
C- Determination of Peroxidase (POD):
A- Activity:
Peroxidase activity is routinely assayed by measuring the oxidation
in the presence of hydrogen peroxide and the enzyme every 30 sec
intervals using UV- 2401 PC UV- Vis recording spectrophotometer
(Central lab., fac. of Agri., Banha Univ.) in a 4 ml light path cuvettes.
The reaction mixture (unless other wise stated) contained in a volume of
3 ml : 8 µmoles hydrogen peroxidase, 60 µmoles guaiacol, 60 µmoles
sodium acetate buffer. pH 5.6 and peroxidase at concentrations which
gave a linear response over a period of 3 min. The reaction is initiated by
introducing the enzyme and mixing, a unit of peroxidase activity is
defined as that amount of enzyme which cause one optical density (OD)
change per minute (Ghazi, 1976).
B- Peroxidase activity staining:
Peroxidase activity staining was performed in 7% native
polyacrylamide gel electrophoresis by the method of Ataya (1995).
The gel was immersed in freshly prepared solution contained 266 µ
moles hydrogen peroxide and 2000 µ moles guaiacol in 100 ml of
0.05 M sodium acetate buffer, pH 5.6. The enzymatic reaction was
- 61 -
blocked after appearance of the isozyme bands by 7% acetic acid. The
gel was photographed and then analyzed by gel documentation
software (Alpha Ease FC 4.0 software).
D- Determination of polyphenol oxidase (PPO):
A- Activity:
Polyphenol oxidase activity was determined by measuring the
initial rate of quinine formation, as indicated by an increase in
absorbance at 420 nm, (Coseteng and Lee, 1978) using - 2401 PC
UV- Vis recording spectrophotometer (Central Lab., Fac. of Agri.,
Banha Univ.). One unite of enzyme activity was defined as the
amount of enzyme that caused a change in absorbance of 0.001/min,
PPO activity was assayed in triplicate measurements. The sample
cuvette contained 2.95 ml of 20 nM catechol solution in 0.1 M
phosphate buffer. pH 6.0 and 0.05 ml of the enzyme solution. The
blank sample contained only 3 ml of substrate solution.
B- Polyphenol oxidase activity staining:
The Polyphenol oxidase activity staining was performed
according
the
method
by
Aydemir
(2004)
in
7%
native
polyacryamide gel electrophoresis for separating PPO isozymes. The
gel was stained for PPO activity by 2.5 mM (L-dihydroxy
phenylalanine) L-dopa in phosphate buffer pH 8.0. After 1 h of
incubation of the gels, isozyme bands were developed. The gels were
shaken in 1 mM ascorbic acid solution for 5 min and stored in 30%
ethanol and then their photographs were taken and analyzed by gel
documentation software (Alpha Ease FC 4.0 software).
- 62 -
E- Determination of photosynthetic pigments:
Chlorophyll a, b and carotenoids were extracted and estimated
according to Wettstein (1957). As the following procedure: Fresh leaf
samples (0.5g) were homogenized in a mortar with 85% acetone in the
presence of washed dried sand and a little amount of CaCO3 (0.1g) in
order to neutralize organic acids in the homogenate of the fresh leaf.
The homogenate was then filtered through sintered glass funnel. The
residue was washed several times with acetone until the filtrate
became colorless. The optical density of this extract was determined
using a spectrophotometer at 662, 644 nm for Chl. a and b
respectively and 440 nm for carotenoids.
Calculation:
Chlorophyll a = 9.784 × E 662 - 0.99 × E 644 mg/L.
Chlorophyll b = 21.426 × E 664 – 4.65 × E 644 mg/L.
Carotenoid = 4.965 × E 440 – 0.268 × c (a+b) mg/L.
Where: c (a+b) is the sum. of chlorophyll a and b concentration in
mg/L. The results were calculated as mg/g fresh weight.
F- Determination of total phenols:
Five grams of the leaf samples were immediately placed in 50
ml of 95% ethanol in brown bottles and kept in darkness at room
temperature for one month then homogenized in sterile mortar. The
resultant homogenate was filtered through filter paper. The residue
was thoroughly washed with 80% ethanol. The ethanolic extracts were
dried at room temperature until near dryness and then were
quantitatively transferred to 10 ml with 50% isopropanol and stored in
- 63 -
vials at 5°C. The obtained ethanolic extracts were used for phenol
determination.
Phenolic compounds were determined using colorimetric method
described by Snell and Snell (1953). The free phenols were determined
by adding 1.0 ml of Folin reagent and 3.0 ml of sodium carbonate
solution (20%) to 0.025 ml of isopropanol sample. The mixture was
diluted to 10 ml with warm distilled water 30-35°C. The mixture was let
to stand for 20 minutes and then was read at 520 nm using
spectrophotometer model (Beckman-Du 7400). However, the total
phenols (free and conjugate) were determined by adding ten drops of
concentrated hydrochloric acid to 0.025 isopropanol sample, heated
rapidly to boiling over a free flame, with provision for condensation, and
then placed in a boiling water bath for 10 min. after cooling 1.0 ml of
Folin reagent was added and also, 2.5 ml of sodium carbonate (20%).
The mixture was diluted to 10 ml with distilled water, after 20 minutes
was determined at 520 nm on the same former apparatus. The conjugate
phenols were determined subtracting the free phenols from total phenols.
The phenolic contents were calculated as milligrams of catichol (from
standard curve) per one gram fresh weight.
G- Determination of total amino acids:
Total free amino acids in the ethanolic extract were determined
according to the method of Rosin (1957) in which, the following four
reagents (solutions) were used:
Solution A: sodium cyanide 0.01 M (0.49 mg/ml). Solution B:
acetate buffer (pH 5.3- 5.4) prepared by dissolving 270 g sodium
- 64 -
acetate in distilled water and made up to 750 ml distilled water.
Solution C: acetate cyanide: 0.0002 M sodium cyanide (20 ml of stock
solution A) and made up to one 1000 ml with acetate buffer (solution
B). Solution D: Ninhydrin 3% in acetone.
A known volume (0.2 ml) ethanolic extract + 0.5 ml of solution
C + 0.5 ml of solution D (Ninhydrin) were mixed thoroughly and
heated in boiling water bath for 10 min. After cooling under running
water, 5 ml of isopropyl alcohol: water (1:1 v/v) was added and the
developed color was measured using spectrophotometer (Spectronic601) at 570 nm. Free amino acids in different samples were calculated
as milligram per gram fresh weight sample.
H- Determination of total carbohydrates:
Total carbohydrates was determined in dry matter of tomato
leaves by using phenol-sulphuric acid method described by Dubois et
al. (1956) and calculated as mg/g dry weight.
Ethanol extraction:
Five grams of powdered leaves oven dried sample were
extracted by boiling in 70% neutral ethanol for 4 hrs. under reflux
condenser (Kawamura et al., 1966). The extract was filtered and the
ethanol was removed by vacuum distillation. The residue was clarified
with neutral lead acetate and the excess of lead salt was precipitated
with potassium oxalate solution.
The last solution filtered, completed to a known volume and
subjected to determination of total soluble carbohydrates (Tanaka et
- 65 -
al., 1975). The total carbohydrates were determined colorimetrically
according to the method of Dubois et al. (1956) as follows:
An aliquot of 1 ml of the solution was quantitatively transferred
into a test tube and treated with 1 ml 5% aqueous phenol solution
followed by 5 ml concentrated analar sulfuric acid. The blank
experiment was carried out using 1 ml of distilled water instead of the
solution. The absorbance of the yellow-orange colour was measured at
490 nm using spectrophotometer model 390. A standard curve was
prepared using known concentrations of glucose where as the
determination as glucose (Fig.3).
120
100
80
60
40
20
0
0
5
10
15
Fig. (3): Standard curve of glucose for determination total carbohydrate.
I- RNA determination:
This was carried out according to the method described by
Schneider (1957). It depends on a calorimetric of the ribose sugar
using orcinol reaction. 1 ml extract was mixed in a test tube with 1 ml
(0.1 g FeCl3 in 100 ml 37% HCl) and 5 mg orcin. The mixture was
heated in a water bath for 15 minutes, cooled and volume was
- 66 -
adjusted to 4 ml with the buffer used in extraction. The optical density
was measured at weave length of 670 nm using U.V-2100
spectrophotometer Unico. The RNA amount was calculated from a
standard curve (Fig. 4) which was constructed using highly
polymerized RNA-sodium salt dissolved in 5% perchloric acid (1
mg/1 ml) at 80°C for 20 minutes.
Fig. (4): Standard curve of total RNA.
3- Molecular detection of pathogenesis related protein genes:
Materials:
Chemicals, enzymes, molecular weight markers and PCR
reagents were obtained from Sigma Chemical (St. Louis, MO, USA)
Roche (Boehringer Mannheim), Promega (Woods Hollow road,
Madison, WI, USA), FMC Bioproducts (Thomaston St., Rockland,
ME, USA), Millipore Intertech (Bedford, MA, USA), Qiagene
(GmbH, Germany) and startagene Inc. (North Torrey Pines Road, La
Jolla, CA, USA).
- 67 -
1- Selected oligonucleotide primers:
The oligoneucleotide primers using on PCR reaction were
synthesized for pathogenesis related protein genes (PR-1a) in operon
(Qiagene Co.), according to Van Loon and Van Strien (1999).
Reverse primer sequence was (3'-GCTCGTAGACAAGTTGGAGTC-5')
while forward primer was (5'-ACCCACATCTTCACAGCAC-3').
2- RT-PCR amplification
A- cDNA synthesis:
Ten µl of total RNA were added to reaction mixture containing 6 µl
of 5x first strand buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl and 15
mM MgCl2), 3 µl of 0.1 M dithiothreitol (DTT), 1µg of complementary
specific primer PR-1a and sterile H2O to a final volume of 30 µl. The
annealing reaction was denatured by heating at 65°C for 5 min and
primer annealing at room temperature for 30-45 min. The annealed
reaction was added to 20 µl of a cDNA reaction mixture containing: 4 µl
of 5x first strand buffer, 2 µl of 0.1 M DTT, 1 µl of RNAsin (40 units,
promega corp., Madison, US), 5 µl of 0.3 M β-mercaptoethanol, 2.5 µl of
10 mM dNTPS and 1 µl of moloney murine leukemia virus (MMLV)
(200 U/ µl) reverse transcriptase (Promega, Corp.). Reaction was mixed
briefly and incubated for 1- 1.5 hr at 42°C.
B- Amplification of PR-1 coding sequence:
Amplification was performed by an initial denaturation step at
95°C for 5 min according to Nie and Singh (2001) in thin-walled
PCR tubes contained the following reaction mixture: Five µl of 10x
PCR buffer (160 mM (NH4)2 SO4, 670 mM Tris-HCl pH 8.8, 0.1%
- 68 -
Tween-20, 25 mM MgCl2), 1 µl of 10 mM dNTPs, 1 µl each of primer
Pr-1F and PR-1R and 2.5 units of Taq DNA polymerase, then
nuclease-free water was added to up the volume to 45 µl. Five µl from
the total DNA was added to PCR mixture and amplified with the
following cycling parameters (denaturation at 94°C for 30 sec). Primer
annealing at 55°C for 30 sec and extension at 72°C for 30 sec) for 30
cycles, with a final extension at 72°C for 5 min and cooling to 4°C.
3- Electrophoresis analysis of PCR product:
PCR amplified DNA products were separated by agarose gel
electrophoresis. Aliquots of 10 µl of PCR products were analyzed on
2.5% agarose gel in TBE buffer (1x = 89 mM Tris HCl, 89 mM borate
and 2.0 mM EDTA pH 8.3) at 100 volt for 1h. The gel was stained
with ethidium bromide at a concentration of 0.5 ml/ml. DNA
molecular weight marker (100, 200, 300, 400, 500, 600 , 700, 800,
900, 1000 bp) 1kb DNA marker was used to determine the size of
PCR amplified cDNA products of PR – mRNA. Bands of DNA were
visualized on a UV transilluminator and photographed using gel
documentation system [BIO-Doc Analyze (Biometra)].
4- Sequencing of pathogenesis related protein gene (PR-1a
gene):
4.1- Purification of DNA fragments from agarose gel:
DNA fragments were purified from agarose gel using the gel
slicing and melting methods described by (Wieslander, 1979). The
Qiagene kit (California, USA) provided rapid and efficient recovery of
DNA (80 %). It is used for recovery and purification of DNA from
- 69 -
ethidium bromide-stained agarose. The desired DNA bands were
excised from the gel using the clean razor blade and put on an
eppendorf tube. 500 µl of the Qiagene buffer was added to 300 mg of
gel fragment and vortexed for 2 min and then incubated at 50°C for 10
min. The sample was pipetted in the upper reservoir of the filter tube
and 500 µl of isopropanol was added to the dissolved gel slice and
centrifuged for 1 min. The flow through was discarded and the filter
tube was reassembled. Add 300 µl of Qiagene buffer (to dissolve
minute gel thin piece) to upper reservoir of the filter tube and
centrifuged for 2 min at 14,000 rpm. Discard the flow through and
again reassemble the filter tube and the used collection tube. Then 500
µl wash buffer PE and 250 µl of 70% ethanol was added to the upper
reservoir and centrifuge 2 min at 14,000 xg, discard the flow through.
The column was carefully removed and placed in 55°C for 2 min to
evaporate residual ethanol. The filter tube and new collection tube
were again reassembled 30 µl warm free nuclease water was added to
the upper reservoir and incubate at room temperature for 10 min then
was centrifuged for 1 min at 12,000 rpm. The flow through was kept
and called first elution. To confirm the presence of DNA fragment in
the eluted DNA, 2 µl of first elution was mixed with 2 µl of dye and
loaded in agarose gel compared to DNA marker. The first and second
elutions combined in eppendorf tube and add 1/10th volume 7.5 mM
ammonium acetate, 2.5 volume 70% ethanol was added, then
incubated at -80°C for 10 min. centrifuged for 20 min at 14,000 rpm,
the supernatant was discarded. 500 µl of 70% ethanol was added to
pellet, centrifuged for 5 min at 14,000 rpm and the pellet was
- 70 -
resuspended in 10 µl of nuclease free water. The nucleotide sequence
of PR-1a gene was obtained using DNAMAN program.
4.2- Sequencing and computer analysis:
Partial nucleotide sequencing of PCR product of PR-1a gene that
amplified with the primers was commercially carried out at Macrogen
3730XL611518-009, Korea by ABI 1.6.0 sequencer. The sequence
data multiple alignment and phytogenetic relationship were translated
and analyzed by DNAMAN program (DNAMAN V 5.2.9 package,
Madison, Wisconsin, USA).
The nucleotides and amino acids sequences of PR-1a gene were
compared with other accessions of PR available in NCBI database
using BLAST algorithm to identify closely related sequences
(http://www.ncbi.nlm.nih.gov).
Sequence
accessions
used
for
comparison were provided in Tables (2, 3).
Table (2): Pathogenesis related protein (PR-1a gene) of different
crops in Gen-Bank.
No.
Crops
1
2
3
4
5
6
7
Solanum lycopersicon
Solanum torvum
Capsicum annuum
Solanum melongena
Cucumis melo
Cucumis sativus
- 71 -
Table (3): Eleven Pathogenesis related protein (PR-1a gene) amino
acids of different hosts published in Gen-Bank.
No.
Crops
1
2
3
4
5
6
7
8
9
10
11
Capsicum annuum
Solanum melongena
Solanum torvum
Vitis pseudoreticulata
Cucumis sativus
Musa acuminata
Betula pendula
Brassica napus
Eutrema wasabi
Linum usitatissimum
- 72 -
EXPERIMENTAL RESULTS
Part I
1- Disease incidence and frequency of virus:
The collected samples of naturally infected tomato plants from
different locations at Qalyoubia Governorate showing mosaic, mottle,
blisters, crinkle, net yellow and malformation were detected by DASELISA using antisera specific to 5 viruses include: Cucumber mosaic
Cucumovirus (CMV), Tomato mosaic Tobamovirus, Tomato yellow
leaf curl Begomovirus, Potato Y Potyvirus and Potato X Potexvirus.
The ELISA reactions of tomato collected samples at Qalyoubia
Governorate were recorded in Table (4). The data reveal that, CMV
was the most frequently in samples and showed severe symptoms on
tomato; therefore this study aims to induce systemic acquired
resistance against CMV.
Table (4): Detection of viruses naturally infected tomato plants.
Antibodies (Abs)
Samples
Banha
Toukh
Qaha
Shebien El-Qanater
El-Qanater El-Khayria
CMV
ToMV
PVY
PVX
TYLCV
+
+
+
+
+
+
-+
+
--
---+
--
-+
--+
+
+
--+
+ : Positive ELISA reaction
-- : Negative ELISA reaction
Disease incidence and disease severity of virus infection in
tomato surveyed locations were recorded in Table (5) and Fig. (5).
The obtained data revealed that, the high level of disease incidence
- 73 -
Experimental Results
and severity (96.0 and 33.75%, respectively) was in Qaha followed by
Toukh (94.67 and 20.83%) and Banha gave (94.44 and 27.78%),
while the low disease incidence and disease severity were in Shebien
El-Qanater (83.08 and 21.92%) and El-Qanater El-Khayria (81.43 and
21.79%), respectively.
Table (5): The disease incidence and severity of naturally viral
infected tomato plants in different 5 locations (Qalyoubia
Governorate).
Locations
Disease incidence
(%)
Disease severity
(%)
Banha
94.44
27.78
Toukh
94.67
20.83
Qaha
96.00
33.75
Shebien El-Qanater
83.08
21.92
81.43
21.79
Percentage (%)
100
Banha
Toukh
Qaha
Shebien El-Qanater
80
60
40
20
0
Disease incidence
Disease severity
Fig. (5): Disease incidence and severity of natural viruses affecting tomato
at 5 different locations in Qalyoubia Governorate.
- 74 -
2- Confirmation of Cucumber mosaic virus (CMV):
1. Host range:
Fourteen plant species belonging to four families were
mechanically inoculated with tested CMV isolate (Table 6). The
reactions of the plants were summarized in three groups; first group,
local symptoms; Chenopodium amaranticolor, C. quinoa and C.
murale produced chlorotic local lesions. While Datura metel produced
necrotic local lesions on inoculated leaves after 7 days post
inoculation (Plate, 2) and second group systemic symptoms were
produced on Nicotiana glutinosa appeared severe mosaic, filiform leaf
and malformation; N. clevelendii and N. tabaccum cv. Samsun
showing severe mosaic and blisters, tomato plants showing vein
clearing, mosaic, vein necrosis, blisters and cucumber plants showing
severe mosaic (Plate, 3). The third group was Vigna unguiculata and
Vicia faba showed no symptoms.
- 75 -
Table (6): The reactions of plant host species and cultivars inoculated
with CMV isolate.
Families
Host plant
Common
name
C. quinoa Wild.
Quinoa
Chenopodiaceae C. amaranticolor Coste Lamb's-quarter
& Ryn
Nettle-leaved
C. murale
Goosefoot.
Cucumber
Cucumis sativus L.
Cucurbitaceae
Cucurbita pepo L.
Squash
Leguminosae
Solanaceae
Phaseolus vulgaris L.
Vigna unguiculata L.
Vicia faba L.
Pisum sativum L.
Datura metel L.
L. esculentum
N. clevelandii
N. tabacum L., cvs.
Samsun
N. glutinosa
Kidney bean
Cowpea
Broad bean
Pea
Thorn apple
Tomato
Tobacco
Symptoms DBIA
CLL
CLL
++
++
CLL
++
SM
SM
+++
+++
M
NS
NS
SM
NLL
SM, Vc, Mf
M
++
--+++
++
++++
+++
M
SM, Mf
+++
+++
CLL = Chlorotic local lesion, NLL = Necrotic local lesion, M = Mosaic, SM =
Severe mosaic, Mf = Malformation, VC = Vein clearing, NS = No symptoms.
- 76 -
Plate (2): Plant leaves inoculated with CMV isolate showing local
symptoms on Chenopodium murale (A), C. quinoa (B), C.
amaranticolor (C) and Datura metel (D).
Plate (3): Host plants mechanically inoculated with CMV isolate showing
mosaic, mottle, blisters, crinkle, net yellow and malformation on
Tomato (1,2); blisters, crinkle (3); vein-clearing, net yellow,
mottling, and malformation (4,5) on leaves of:
(1), (2) L. esculentum (3) N. clevelendii (4), (5) Cucumis sativus
- 77 -
2. Transmission of CMV:
A- Mechanical transmission:
The virus isolated was mechanically transmitted easily to
healthy tomato plants and differential host plants where as inoculated
with infectious crude tomato sap (Plate 2, 3).
B- Aphid transmission:
The virus isolate was transmitted in a non-persistent manner by
both Myzus persicae and Aphis craccivora from infected cucumber
cultivar source plants to healthy tomato ones.
3. In vitro properties:
The results in Table (7) indicate that, the stability of CMV
isolate in infectious crude sap extracted from infected N. glutinosa. It
was determined by local lesions on leaves of C. amaranticolor as an
indicator host as follows:
1) Thermal inactivation point (TIP):
The infectious crude saps were treated with temperature at 45°C
to 75°C intervals of 5°C for 10 min. in controlled water bath. The
obtained results showed that CMV was inactivated at 70°C for 10 min
in vitro.
2) Dilution end point (DEP):
Several dilutions up to 10-7 were prepared from CMV infectious
sap and results showed that, the infectivity was lost at dilution 10-4.
3) Longevity in vitro (LIV):
The effect of storing the infectious sap for 10 days at room
temperature (25±3°C) on the infectivity of CMV was determined. The
obtained data indicated that, CMV kept its infectivity for 5 days.
- 78 -
Table (7): In vitro properties of CMV isolate in infectious crude sap
under laboratory conditions.
In vitro
properties
Treatment
Mean number of
L. L. per leaf
TIP
Unheated
45
50
55
60
65
70
75
61.3
8.7
5.7
3.0
2.3
1.3
0.0
0.0
Relative
virus
activity
100
14.1
9.2
4.9
3.8
2.2
0
0
DEP
Undiluted crude
10-1
10-2
10-3
10-4
10-5
10-6
10-7
61.3
20.0
17.3
7.7
2.3
0.0
0.0
0.0
100
32.6
28.3
12.5
3.8
0
0
0
LIV
Zero time
1
2
3
4
5
6
61.3
8.0
3.3
2.3
1.3
0.7
0.0
100
13.0
5.4
3.8
2.2
1.1
0.0
* The results were calculated from 5 replicates.
* The virus stability was assayed using C. amaranticolor as local
lesion host.
- 79 -
4. Inclusion bodies:
Light microscopy examination of the epidermal strips from
infected cucumber leaves, 25 days post CMV inoculation showed
cytoplasmic inclusion bodies. The crystalline inclusions are observed
in epidermal and hair cells as well as amorphous inclusions stained by
bromophenol blue and mercuric chloride (Plate, 4).
A
B
Plate (4): Epidermal strips and hairs of cucumber leaves infected with
CMV (15 days post inoculation) showing cytoplasmic inclusion
bodies, (Magnification of Light micrograph 400X). (A) CI:
Crystalline inclusion bodies. (B) AI: Amorphous inclusion
bodies.
5. Serological identification
- Dot blot immunoassay (DBIA):
The virus antigen was serologically precipitated against specific
polyclonal IgG-CMV by immunoblotting assay Plate (5). The dot blot
immunoassay was found to be sensitive to detect CMV in all infected
plants. A purplish blue color was developed with infected tomato in
the positive reaction, whereas extracts from healthy plants remain
green in the negative reactions.
- 80 -
Plate (5): Dot Blot Immunoassay for CMV precipitation against
specific IgG-CMV polyclonal.
+ : Positive
- : Negative
Infected samples (row 1) N. glutinosa; (rows 2 and 3) Tomato
and (rows 4 and 5) Cucumber.
- 81 -
Part II
Evaluation of biotic inducers for induction of systemic
acquired resistance and biocontrol of CMV
A- Induction of systemic acquired resistance (SAR) by biotic
inducers before virus inoculation:
Four biotic inducers (three botanical extracts and kombucha
filtrate) were tested for induction of systemic acquired resistance (SAR)
in tomato plants both pre- and post-inoculated with CMV. Achieved of
SAR was detected by assessment of histopathological; biochemical
[antiviral proteins, protein content, qualitative protein, activity and
isozyme of peroxidase and polyphenol oxidase]; phytochemical [salicylic
acid level, chlorophyll, phenol, total amino acids, total carbohydrate
contents] and molecular of PRs gene changes. Finally, the efficacy of
biotic inducers on the virus isolate infectivity was biologically detected.
1. Histopathological changes:
Histopathological changes in tomato leaves tissues as
evidence of the systemic acquired resistant reaction were elicited
after 7 days of biotic inducers.
In tomato leaves sprayed with biotic inducers, tissue alterations
were observed when tissue was fixed after 7 days of treatment.
Progressive increasing in lignin accumulation in epidermal cells, number
of hairs, thickness of blade, number of xylem arms and phloem layers
(Table, 8) and (Plate, 6B). The alterations included, also, tissueshrinkage, intense staining, and precipitation of lignin in sub stomatal
cavity, mesophyll cell showing folding and layering of cell wall and
remains of host palisade cell walls (Plate, 6A).
- 82 -
- 83 -
Plate (6A): Anatomical variations in tomato leaves treated with biotic
inducers (H, A, B, C, 100X and D 60X)
H: Healthy.
A: Mesophyll cells showing folding and layering of cell walls.
B: Precipitation of lignin in sub stomatal cavity.
C: Tissue showing intense staining.
D: Increasing no. of xylem vessels (left: Non and right: treated).
- 84 -
Plate (6B): Light micrograph of tomato leaves sprayed with
biotic inducers and infected with CMV showing
different changes in cells and tissues (40X).
H: Healthy. M: tomato leaf treated with M. jalapa extract.
Y: tomato leaf treated with C. inerme extract.
M+Y: tomato leaf treated with (Mj+Ci) extract.
K: tomato leaf treated with Kombucha filtrate.
- 85 -
2. Biochemical changes:
2.1. Antiviral Proteins
a. Determination of the elicited antiviral protein as response to
induction SAR (pre-inoculation) after 7-days:
Protein content was determined in tomato plants treated with biotic
inducers pre-CMV infection related to BSA as standard protein. Total
protein content, in addition enzyme activities were increased in
treated tomato plants than untreated ones. Kombucha filtrate was
the superior in this concern (1.94 mg/g FW), while the mixture
extracts was the lowest (1.28 mg/g FW) comparing with healthy
control (1.05, mg/g FW) [Table (9) and Fig. (6)].
New proteins were elicited interior tomato plants as a result to
spraying with biotic inducers were varied in their number and density.
The variability analysis among inducers appeared 10 protein bands, the
height bands (8 protein fractions) appeared in kombucha filtrate
treatment followed by 7 protein fractions appeared in other inducers (M.
jalapa, C. inerme and mixture extracts), compared with not treated
plants gave 7 protein fractions (Plate, 7).
The molecular weight of each polypeptide was determined related
to protein marker. The most prominent alteration (polymorphic bands)
among the 4 inducers (116, 66, 29, 25 and 18) kDa with percentage
50%. These bands may be related to antiviral proteins. The prominent
polypeptide bands in all inducers (monomorphic or common
polypeptide) were (35 and 14) kDa with percentage 20%. These bands
may be related to tomato plant. The unique (polypeptide markers)
were appeared in tomato plants treated with C. inerme extract, the
mixture extracts and kombucha filtrate are (45, 36 and 17 kDa),
respectively with percentage 30% (Table, 10).
- 86 -
Table (9): Protein content and enzyme activities in tomato plants
treated with biotic extracts.
Without virus inoculation
Treatment
Protein content
(mg/g FW)
Healthy c.
1.05
180.30
171.71
102.00
97.14
M. jalapa extract
1.67
262.80
157.37
292.50
175.15
C. inerme extract
1.30
211.70
162.85
219.00
168.46
Mixture (Mj+Ci) extract
1.28
227.60
177.81
114.00
89.06
Kombucha filtrate
1.94
263.60
135.88
152.25
78.48
POD(U/g FW) *POD Specific PPO(U/g FW) *PPO Specific
activity
activity
*Specific activity (unit/mg protein)
Protein content (mg/g FW)
2
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
Healthy c.
M. jalapa
C. inerme
Mixture
(Mj+Ci)
Kombucha
Treatments
Fig. (6): Effect of biotic inducers on protein content in tomato plants
pre virus inoculation.
- 87 -
Table (10): Protein fractions of tomato plants treated with biotic
inducers using SDS-PAGE.
MW (kDa) Untreated
plant
M
116
+++
++
66
+
45
36
35
+++
++
29
++
25
+++
18
+
++
17
14
++
++
Total
4
7
polypeptide
Bioinducers
Y
M+Y
++
+
+
++
+
+++
+
+++
++
+++
+
+
++
++
7
7
K
+
+
++
+++
++
+
+
+++
Polymorphism
Polymorphic
polymorphic
Unique
Unique
Monomorphic
Polymorphic
Polymorphic
Monomorphic
Unique
Monomorphic
8
Monomorphic (Common polypeptide). Polymorphic (Specific polypeptide)
Unique (Polypeptide marker) or (genetic marker).
- = Absence of band.
+ = presence of band.
Plate (7): Protein fractions of tomato plants treated with biotic
inducers pre CMV inoculation using SDS-PAGE.
Mr: Marker. H: Healthy.
M: M. jalapa extract. Y: C. inerme
extract. M+Y: mixture (Mj+Ci) extracts. K: Kombucha filtrate.
- 88 -
induction SAR (post-inoculation) after 25-days:
Highest high protein content (2.51 mg/g FW) was due to
kombucha filtrate treatment, while the lowest content (1.62 mg/g FW)
was produced by C. inerme extract, compared with healthy and
Inoculated control (1.09, 1.21 mg/g FW), respectively [Table (11) and
Fig. (7)].
The tomato plants treated with biotic inducers and inoculated
with CMV show that four inducers varied in number and density of
protein. The variability analysis among four inducers appeared 9
protein bands; three inducers (M. jalapa, C. inerme extracts and
kombucha filtrate) gave the same number of bands (6 bands) followed
by mixture gave 5 bands while healthy control and infected plants gave
3 and 5 protein fractions, respectively (Plate, 8).
The molecular weight of each polypeptide was determined
related
to
protein
marker.
The
most
prominent
alteration
(polymorphic bands) appeared in (50, 25 and 15) kDa with percentage
33.3%. These bands may be related to antiviral proteins. The
prominent polypeptide bands in all inducers (monomorphic or
common polypeptide) were (60, 35 and 30) kDa with percentage
33.3%. These bands may be related to tomato plant. The unique
(polypeptide markers) were appeared in tomato plants treated with C.
inerme extract and kombucha filtrate in (75, 20 and 18.5) kDa with
percentage 33.3%. These bands may be related to polypeptide
markers (Table, 12).
- 89 -
Table (11): Protein content and enzyme activities in infected
tomato plants then treated with biotic extracts.
Post - virus inoculation (25 days)
Treatment
Protein content
(mg/g FW)
POD(U/g
FW)
Healthy control
1.09
170.10
156.06
160.00
146.79
Inoculated control
1.21
191.90
158.60
200.50
165.70
M. jalapa extract
2.18
272.10
124.82
385.50
176.83
C. inerme extract
1.79
195.80
109.39
263.50
147.21
Mixture (Mj+Ci) extracts
1.62
229.00
184.57
278.00
171.60
Kombucha filtrate
2.51
270.10
107.61
336.50
134.06
*POD Specific PPO(U/g FW) *PPO Specific
activity
activity
3
2.5
2
1.5
1
0.5
0
Healthy c. Infected c.
M. jalapa
C. inerme
Mixture
(Mj+Ci)
Kombucha
Treatments
Fig. (7): Effect of biotic inducers on protein content in tomato plants
post virus inoculation.
- 90 -
Table (12): Protein fractions of CMV infected tomato plants treated
with biotic inducers using SDS-PAGE.
MW (kDa)
Untreated
plant
Infected
tomato
M
75.0
--
--
--
++
--
--
Unique
60.0
+
++
+++
++
++
+++
Monomorphic
50.0
--
--
+
+
--
--
Polymorphic
35.0
+
+
++
+++
++
+
Monomorphic
30.0
+
+++
+++
++
++
++
Monomorphic
25.0
--
+
+
--
+
+
Polymorphic
20.0
--
--
--
--
--
++
Unique
18.5
--
--
--
--
--
+
Unique
15.0
--
+
+
+
+
+
Polymorphic
Total bands
3
5
6
6
5
6
Biotic inducers
Y
M+Y
K
Polymorphism
+ = weak band. ++ = moderate band. +++ = strong band
Plate (8): Protein fractions of tomato plants treated with biotic inducers post
CMV inoculation using SDS-PAGE.
Mr) Marker. M: M. jalapa extract. Y: C. inerme extract. M+Y:
mixture (Mj+Ci) extracts. K: Kombucha filtrate.
H: Healthy
control. IF: Inoculated control.
- 91 -
2.2- Oxidative enzymes:
Tomato plants treated with biotic inducers show variability in
number and density of polypeptide peroxidase and polyphenol oxidase
isozymes in pre- and post-CMV infection.
a. Peroxidase isozyme in tomato plants sprayed with biotic inducers
to induce SAR (pre-inoculation) after 7-days:
1- Enzyme Activities:
The activity of peroxidase isozyme was determined pre-CMV
inoculation. All biotic inducers were increased the peroxidase (POD)
activity in tomato plants especially kombucha filtrate treatment (263.6
U/g FW), while C. inerme extract gave slightly increase (211.7 U/g
FW) comparing with healthy control (180.3U/g FW) Fig. (8).
POD activity (U/g FW)
300
250
200
150
100
50
0
Treatments
Healthy c.
C. inerme
Kombucha
M. jalapa
Mixture (Mj+Ci)
Fig. (8): Effect of biotic inducers on POD activity in tomato before
CMV inoculation.
- 92 -
2- Peroxidase activity staining:
The results of pre-virus infection show that the total number of
peroxidase isozyme was 6 bands as shown in Table (13) and Plate (9).
The isozyme bands of 4 treatments were varied in number and
density polypeptide whereas, biotic inducers were revealed 6, 5, 6 and
6 polypeptide bands of M. jalapa, C. inerme, mixture extracts and
kombucha filtrate respectively compared with tomato plants untreated
and Inoculated control appeared 4 and 4 isozymes respectively. The
variability analysis of 4 treatments showed isozyme absent and/or
present in some treatment at RF (1.0 and 2.0) with percentage 33.3%
common in all treated tomato plants and isozyme bands may be related
to tomato plants, (0.7, 1.5, 2. 6 and 3.5 RF) specific bands
(polymorphic bands) with percentage 66.7% appearance may attribute
to the influence of each biotic inducers treatment on tomato plants.
- 93 -
6 bands
_
_
9
+
8
32 ++++ 35 ++++ 25
8
+
13
+
7
21 ++++ 27 ++ 33
10 ++ 10
+
17
20 ++ 15 ++ 10
4
6
5
++
++++
+
+++
++
++
6
Bands
K
%Fraction
Bands
%Fraction
M+Y
Bands
+++
+++
++
++
+
%Fraction
10
25
33
21
11
Y
Bands
Bands
0.7
1.0
1.5
2.0
2.6
3.5
Biotic inducers
M
%Fraction
RF
%Fraction
Untreated
plant
10 +++
20 ++++
9
+
40 +++
11 ++
10 ++
Polymorphism
Table (13): Disc-PAGE banding patterns of peroxidase isozymes in noninoculated tomato plants and treated with biotic inducers.
Polymorphic
Monomorphic
Polymorphic
Monomorphic
Polymorphic
polymorphic
6
Monomorphic: Common polypeptide
Polymorphic: Specific polypeptide. Band
density: _ : Absent.
+: Weak band. ++: Moderate band. +++: Strong band. ++++: very strong band.
Plate (9): Native acrylamide gel (7%) electrophoresis of POD isozymes produced in
tomato plants treated with biotic inducers pre CMV inoculation.
H: Healthy. V: infected tomato.
M: tomato leaf treated with Mirabilis extract.
Y: tomato leaf treated with Clerodendrum extract.
M+Y: tomato leaf treated with Mirabilis+Clerodendrum extract.
- 94 -
b. Peroxidase isozyme in tomato plants sprayed with biotic inducers
to induce SAR (post-inoculation) after 25-days:
1- Enzyme Activity:
M. jalapa extract was induced highest peroxidase activity (272.1
U/g FW), followed by kombucha filtrate (265.7 U/g FW), while the
lowest increase POD activity (195.8 U/g FW) was produced by C.
inerme extract compared with healthy and Inoculated control (170.1,
191.9 U/g FW), respectively (Fig. 9).
300
250
200
150
100
50
0
Treatments
Healthy c.
M. jalapa
Mixture (Mj+Ci)
Infected c.
C. inerme
Kombucha
Fig. (9): Effect of biotic inducers on POD activity in tomato plants
infected with CMV.
- 95 -
B- Peroxidase activity staining:
The results of post virus infection, the total number of
peroxidase isozymes was 4 bands in Table (14) and Plate (10).
density polypeptide whereas, biotic inducers revealed 3,4,4,3 bands of
M. jalapa, C. inerme, mixture extracts and kombucha filtrate
respectively compared with untreated and infected tomato plants
appeared 2 and 3 bands. Variability analysis of 4 treatments showed
some polypeptides bands absent and/or present in some treatment at
RF (2.5, 5.6) polymorphic band with percentage 50%. Two out of 4
isozyme bands were appeared in all treatments monomorphic or
common bands with percentage 50% at RF (3.0, 4.7) these bands
related to tomato plants and the number of isozyme bands was
decreased after 25 days of spraying compared with their after 7 days
due to the presence of the virus.
- 96 -
2.5
3.0
4.7
5.6
4 bands
2
Bands
K
%Fraction
Bands
%Fraction
M+Y
Bands
%Fraction
Y
Bands
M
%Fraction
Bands
35
65
++
+++
-
%Fraction
Bands
RF
tomato
%Fraction
plant
- 20 +
9
+
25 ++ 30 ++ 20 ++ 21 ++ 25 +
55 ++++ 50 +++ 50 +++ 55 +++++ 50 ++
20 ++ 20 + 10 + 15 ++ 25 +
3
3
4
4
Polymorphism
Table (14): Disc-PAGE banding patterns of peroxidase isozymes of
tomato plants treated with biotic inducers then inoculated
with CMV.
Untreated Infected
Biotic inducers
Polymorphic
Monomorphic
Monomorphic
Polymorphic
3
Polymorphic: Specific polypeptide
Band density: _ : Absent.
+: Weak band. ++: Moderate band. +++: Strong band. +++++: very strong band
Plate (10): Native acrylamide gel (7%) electrophoresis of POD
isozymes produced in tomato plants treated with
biotic inducers post CMV inoculation.
H: Healthy.
V: infected tomato.
M: tomato leaf treated with Mirabilis extract.
Y: tomato leaf treated with Clerodendrum extract.
M+Y: tomato leaf treated with Mirabilis+C. inerme extract.
- 97 -
c. Polyphenol oxidase isozyme in tomato plants sprayed with biotic
inducers to induce SAR (pre-inoculation) after 7-days:
1- Enzyme Activity:
M. jalapa extract was induced highest PPO activity (292.5 U/g
FW), while the lowest PPO activity (114.0 U/g FW) was produced by
mixture, compared with healthy control (102.0 U/g FW), (Fig. 10).
PPO activity (U/g FW)
300
250
200
150
100
50
0
Treatments
Healthy c.
C. inerme
Kombucha
M. jalapa
Mixture (Mj+Ci)
Fig. (10): Effect of biotic inducers on PPO activity in tomato plants
pre-CMV inoculation.
- 98 -
2- Polyphenol oxidase activity staining:
The obtained results of the total number of polyphenol oxidase
isozyme produced in tomato plants treated with biotic inducers preCMV infection was 6 bands are shown in Table (15) and Plate (11).
The isozyme bands of tomato plants treated with 4 biotic
inducers were varied in number and density polypeptide whereas,
biotic inducers were induced 4,4,4 and 6 polypeptide bands of M.
jalapa, C. inerme, mixture extracts and kombucha filtrate respectively
compared with untreated tomato plants appeared 5 isozymes. The
variability analysis of 4 treatments showed isozyme absent and/or
present in some treatments at RF (1.5 and 2.0) monomorphic common
in all tomato plant treatment with percentage 33.3% and (1.3 and
3.3 RF) polymorphic specific bands with percentage 33.3% may
attributed to the influence of each biotic inducers treatment on tomato
plants, 2 unique isozyme (Genetic marker) with percentage 33.4% for
each biotic inducers (0.8 and 2.5) of Kombucha filtrate treatment.
- 99 -
0.8
1.3
1.5
2.0
2.5
3.3
6
_
_
75
25
+++
+
13
40
20
+
++++
+
2
+
4
9
45
21
+
++++
+
_
10
50
25
_
25
+
4
+
++++
+
_
15
+
4
7
12
30
11
25
15
Bands
%Fraction
K
Bands
%Fraction
_
_
27
Bands
%Fraction
Bands
_
_
_
Biotic inducers
Y
M+Y
M
%Fraction
Bands
RF
%Fraction
Untreated
plant
+
+
+++
++
+++
+
6
Polymorphism
Table (15): Disc-PAGE banding patterns of polyphenol oxidase
isozymes of non-inoculated tomato plants and treated
with biotic inducers.
Unique
Polymorphic
Monomorphic
Monomorphic
Unique
Polymorphic
bands
Unique: genetic marker monomorphic: common polypeptide. Polymorphic: specific
polypeptide. +: weak band. ++: moderate band. +++: strong band
Plate (11): Native acrylamide gel (7%) electrophoresis of PPO
isozymes produced in tomato plants treated with biotic
inducers pre -CMV inoculation.
- 100 -
d. Polyphenol oxidase isozyme in tomato plants sprayed with biotic
inducers to induce SAR (post-inoculation) after 25-days:
1- Enzyme Activity:
M. jalapa extract induced highest PPO activity (385.5 U/g FW),
while the lowest PPO activity (263.0 U/g FW) was produced by C.
200.5 U/g FW), respectively (Fig. 11).
400
350
300
250
200
150
100
50
0
Treatments
Healthy c.
Inoculated c.
M. jalapa
C. inerme
Mixture (Mj+Ci)
Kombucha
Fig. (11): Effect of biotic inducers on PPO activity in tomato plants
infected with CMV.
- 101 -
Post virus infection, the total no. of polyphenol oxidase isozymes
were 3 bands.
The isozyme bands of tomato plants treated with four biotic
inducers (Table, 16) were varied in number and density polypeptide
whereas inducers were induced 3, 2, 2, 2 bands of M. jalapa, C.
inerme, mixture extracts and kombucha filtrate respectively compared
with untreated and infected tomato plants appeared 2 and 2 bands
respectively. Two out of 3 isozyme bands were appeared in all
treatments monomorphic or common bands at RF (2.1, 3.2) with
percentage 66.6% these bands related to tomato plants. One unique
isozyme (Genetic marker) for kombucha filtrate treatment at RF (1.0)
with percentage 33.34% was detected, Plate (12).
Table (16): Disc-PAGE banding pattern of polyphenol oxidase isozymes of
tomato plants treated with biotic inducers then infected by
1.0
2.1
3.2
30
70
3 bands
- 20
++ 65 +++ 45
++
35
2
++
2
35
+
++
++
40
60
++
++
3
2
55
45
Bands
K
%Fraction
Bands
%Fraction
%Fraction
Bands
Bands
Bioinducers
Y
M+Y
M
%Fraction
Bands
%Fraction
%Fraction
RF
Bands
Untreated Infected
plant
tomato
++ 30 ++
++ 70 +++
2
2
Unique: genetic marker. Monomorphic: common polypeptide.
Band density: - Absent
+: weak band.
++: moderate band. +++: strong band
- 102 -
Polymorphism
CMV.
Unique
Monomorphic
Monomorphic
Plate (12): Native polyacrylamide gel (7%) electrophoresis of PPO
biotic inducers post CMV inoculation.
H: Healthy.
V: infected tomato.
M: tomato leaf treated with M. jalapa extract.
M+Y: tomato leaf treated with mixture (Mj+Ci) extract.
We can conclude that, the biotic inducers reveal reproducibility
different levels of acquired resistance according to the number of
protein genetic markers.
Pre-virus infection, kombucha filtrate and mixture extracts
gave a highest level of protein genetic markers followed by C.
inerme and M. jalapa extracts. On the other hand, Post-virus
infection, three biotic inducers (M. jalapa, C. inerme and mixture
extracts) give the same number of genetic markers and kombucha
filtrate gave the low numbers (Table, 17).
- 103 -
Table (17): Protein genetic markers of tomato plants produced by
biotic inducers as indication of systemic acquired
resistance against CMV infection.
Parameters
M. jalapa
C. inerme
Mixture
(Mj+Ci)
Kombucha
*Pre
**Post
Pre
Post
Pre
Post
Pre
Post
SDS-PAGE
-
3
3
2
5
2
6
2
Peroxidase
2
1
2
2
2
2
2
1
Polyphenol
oxidase
Total
1
-
2
-
2
-
1
-
3
4
7
4
9
4
9
3
*Pre-virus inoculation
**Post-virus inoculation
2.3- Quantification of total SA in tomato plants treated with
biotic pre-virus inoculation:
The obtained results from quantification of total SA in induced
tomato plants before CMV inoculation were tabulated in Table
(18). These results were agreed with percentage of infection, disease
severity and virus concentration; it was observed that, the level of
total SA has been increased in treated plants compared with untreated
tomato plants with biotic inducers (H control, V Inoculated control).
The results indicate that the healthy tomato plant (non-treated)
and tomato treated with M. jalapa, C. inerme, the mixture extracts and
kombucha filtrate refers to the peaks obtained using HPLC,
desired peak must be resulted in the retention time similar to the
retention time of the standard. These peaks were used to calculate total
SA based on the area under peak (Fig. 12).
- 104 -
Kombucha filtrate gave the highest level of SA (9346.61
µ g/g FW) followed by C. inerme extract (8652.78 µ g/g FW), M.
jalapa extract (7451.63 µ g/g FW), while mixture extracts gave
the lowest level of SA (3124.18 µ g/g FW) (Table, 18).
Table (18): Quantification of total SA in tomato plants treated
with biotic inducers compared with healthy plant.
Treatments
Standard SA
Inoculated control
M. jalapa extract
C. inerme extract
Mixture (M+Y) extract
Kombucha filtrate
Healthy
No. of peak Ret. time
1
2
1
4
2
6
4
4.301
4.951
4.892
4.050
4.944
4.188
4.626
Area
Total SA
(µg/g FW)
1195.321
3861.915
17814.2
20685.7
7468.814
22344.2
702.349
1615.43
7451.63
8652.78
3124.18
9346.61
293.79
Fig. (12): HPLC quantification of free and endogenous SA in
induced tomato plants.
- 105 -
Continued Fig. (12): (H): healthy plant.
(V): Inoculated control.
- 106 -
Continued Fig. (12): (M): Tomato leaves treated with M. jalapa
extract.
(Y): Tomato leaves treated with C. inerme extract.
- 107 -
Continued Fig. (12): (M+Y): Tomato leaves treated with (Mj+Ci) extracts.
(K): Tomato leaves treated with kombucha filtrate.
- 108 -
2.4- Photosynthetic pigments content:
From the results, it is noticed that in the inoculated tomato plants
there were reduction in Chl a, Chl b and carotenoid contents (0.855,
0.761 and 0.742 mg/g FW) when compared with non-infected plants
(0.714, 0.514 and 0.662 mg/g FW) of Chl a, Chl b and carotenoids,
respectively.
Generally, tomato plants treated with M. jalapa, C. inerme,
mixture extracts and kombucha filtrate resulted an increase in Chl a
contents (1.015, 0.971, 0.944 and 1.005 mg/g FW) whereas Chl b,
(0.878, 0.823, 0.773 and 0.921 mg/g FW) and carotenoid (0.822,
0.795, 0.744 and 0.887 mg/g FW).
On the other hand, in the tomato plants treated with extract of
Mj, Ci, mixture extracts, kombucha filtrate and infected with CMV
there were increase in Chl a Chl b and carotenoids contents compared
with inoculated plants and non-treated with the tested inducers.
The content increasing were (1.485, 1.279, 1.194 and 1.196 mg/ g
FW) Chl a, (1.290, 1.111, 1.008 and 1.045 mg/g FW) Chl b and (1.286,
1.127, 1.026 and 1.495 mg/g FW) carotenoids of in plants treated with
Mj, Ci, (Mj+Ci) extracts and kombucha filtrate respectively (Table, 19).
From the obtained results the M. jalapa, C. inerme, mixture
extracts and kombucha filtrate treatments elicited tomato plants for
increasing total chlorophyll pigments and carotenoid contents as one
evidence for systemic acquired resistance (SAR).
- 109 -
Table (19): Chlorophyll and carotenoid contents (mg/g FW) in tomato
plants treated with biotic inducers.
Chlorophyll content
Treatments
Healthy plants
a
b
Carotenoids
Untreated
0.855
0.761
0.742
Plants inoculated
with virus
Plants treated with
Virus treated
0.714
0.514
0.662
Without virus
1.015
0.878
0.822
M. jalapa extract
With virus
1.485
1.290
1.286
Plants treated with
Without virus
0.971
0.823
0.795
C. inerme extract
With virus
1.279
1.111
1.127
Plants treated with
Without virus
0.944
0.773
0.744
Mixture (Mj+Ci)
With virus
1.194
1.008
1.026
Plants treated with
Without virus
1.005
0.921
0.887
Kombucha
With virus
1.196
1.045
1.495
Chlorophyll content = mg/g FW.
2.5- Determination of phenolic compounds:
Phenolic contents were increased in the non-inoculated plants
and treated with biotic inducers. The highest increase was induced by
M. jalapa extract and kombucha filtrate (49.24 and 48.41 mg/g FW)
total phenols, (29.07 and 24.76 mg/g FW) free phenols and (20.17 and
23.65 mg/g FW) conjugate phenols respectively. While C. inerme and
mixture extracts produced the lowest increase in phenols contents
(33.56 and 32.70 mg/g FW) total phenols, (16.52 and 18.20 mg/g FW)
free phenols and (17.52 and 14.5 mg/g FW) conjugated phenols
respectively compared with healthy and Inoculated controls (32.89
and 31.02 mg/g FW) total phenols, (14.24 and 10.35 mg/g FW) free
- 110 -
phenols and (20.65 and 20.67 mg/g FW) conjugated phenols
respectively (Table, 20).
On the other hand, tomato plants post virus inoculation showed
an increase in phenolic contents in treatments of M. jalapa and
mixture extracts (12.30 and 11.85 mg/g FW) total phenols, (8.71 and
8.58 mg/g FW) free phenols and (3.59 and 3.27 mg/g FW) conjugated
phenols respectively, while kombucha filtrate and C. inerme extract
showed the little increase in phenols contents (9.65 and 8.41 mg/g
FW) total phenols, (7.60 and 6.60 mg/g FW) free phenols and (0.39
and 1.81 mg/g FW) conjugated phenols respectively compared with
healthy and Inoculated controls (8.14 and 7.65 mg/g FW) total
phenols, (7.06 and 6.58 mg/g FW) free phenols and (1.08 and 1.07
mg/g FW) conjugated phenols respectively.
Table (20): Free, conjugated and total phenols content in tomato
plants treated with biotic inducers.
Treatments
Free
phenols
Conjugated
phenols
Total
phenols
Free
phenols
Conjugated
phenols
Post virus inoculation
Total
phenols
Pre virus inoculation
Healthy control
32.89
12.24
20.65
8.14
7.06
1.08
Inoculated control 31.02
10.35
20.67
7.65
6.58
1.07
M. jalapa extract
49.24
29.07
20.17
12.30
8.71
3.59
C. inerme extract
33.56
16.52
17.04
8.41
6.60
1.81
Mixture (Mj+Ci)
extract
32.70
18.20
14.50
11.85
8.58
3.27
Kombucha filtrate
48.41
24.76
23.65
9.65
7.60
0.39
- 111 -
2.6- RNA determination in tomato plants treated with biotic
inducers pre-virus inoculation:
The total RNA content values in the leaves of four treatments of
tomato plant compared with healthy and infected are recorded in
Table (21). From the results, the highest value of 342 µg/g was
recorded in tomato plant treated with kombucha filtrate followed by
the value of 325 µg/g in tomato plant treated with M. jalapa extract.
While the lowest value of 305, 284 µg/g were recorded in tomato
plant treated with C. inerme extract and mixture extracts respectively,
compared with the value of 245, 295 µg/g in healthy and infected
respectively (Fig. 13).
Table (21): Comparison between tomato plants (treated with biotic
inducers) in RNA contents and healthy, inoculated
controls.
Inoculat
Tomato plants treated with
ed
Mixture
Kombucha
M. jalapa
C. inerme
control
(Mj+Ci)
Treatment
Healthy
O.D
0.825
1.045
1.145
1.075
1.025
1.152
Conc. (µg/g)
245
295
325
305
284
342
- 112 -
1.2
Mixed (Mj + Ci)
Kombucha
0.2
C. inerme
0.4
M. jalapa
0.6
Infested control
0.8
Healthy
Optical Density
1
295
325
305
284
342
0
245
Conc. (µg/g)
Fig. (13): Histogram illustrates the RNA content values in the leaves
of tomato plants treated with biotic inducers compared
with healthy.
3. Molecular marker for SAR detection:
Pathogenesis-related protein associated with plant defense:
RT-PCR amplification PR-1a gene:
Total RNA were isolated from tomato plants treated with
biotic inducers using CTAB method with high quality and
substantially free RNA contamination. The RNAs were used
as a template for RT-PCR to amplify of the PR-1a gene via
the QLAGEN PCR system by use of an oligonuclutides
3'-GCTCGTAGACAAGTTGGAGTC-5'
and
5'-ACCCACATCTTCACAGCAC-3'
primer sets nearly full length mRNA PR-1a gene could be
synthesized. The amplified PR-1a mRNA was used for
conformation its specificity to the acquired resistance in tomato
- 113 -
plants. The mRNA of PR-1a gene as a PCR product with an
expected size of about 182 bp DNA was amplified (Plate, 13).
Plate (13): 2.5% agarose gel electrophoresis showing the amplified
PCR product of mRNA of PR-1a gene of tomato plants
treated with biotic inducers at the correct size (182 bp).
M: Molecular weight of DNA Marker.
K: Tomato leaves treated with kombucha filtrate.
M+Y: Tomato leaves treated with mixture (Mj+ Ci) extract.
Y: Tomato leaves treated with C. inerme extract.
M: Tomato leaves treated with M. jalapa extract.
V: Tomato leaves inoculated with CMV.
H: Untreated leaves.
- 114 -
PR-1a gene sequence:
The DNA sequence was performed using PCR produced
when the specific (downstream and upstream) primers for mRNA of
PR-1a gene of the tomato plants treated with biotic inducers were
used.
The PCR product band was cleaned using gene clearing
kit as mentioned before. The result illustrated in Fig. (14) show
the partial nucleotide sequence of PCR fragment with appeared to
be containing 182 bp. The nucleotide sequence of PR-1a gene was
recorded in Gen-Bank.
1
GCTCGTAGAC AAGTTGGAGT CGGTGGTATG ACATGCGACA ATAGGCTAGC GGCCAATGCC
61 CAGCATTACG CCAATCAtAG AGCTGCCGAC TGCAGGATGC AACACTCTGG TGGACCTTAC
121 GGTGAAAACC TAGCTGCCGC TTTCCCCCAG CTCAACGCGG CTGGTGCTGT GAAGATGTGG
181 GT
Fig. (14): The partial nucleotide sequence of DNA (182 bp) from
mRNA of PR-1a gene of tomato plants treated with
biotic inducers.
Sequencing analysis:
The partial nucleotide sequence of the PCR-amplified
fragment for the PR-1a gene of the tomato plants treated with biotic
inducers was done to determine the relationship with other
recommended pathogenesis related protein registered in GenBank (Table, 22). The sequencing was done from the forward
direction at Macro gen 3730XL6-1518-009, Korea.
- 115 -
Analysis of molecular data by Bioinformatics:
1- Nucleotide sequence:
The nucleotide sequence of PR-1a gene for tomato plants treated
with biotic inducers revealed the highest content for Guanine (G) 54
(29.7%) followed by cytosine (C) 48 (26.4%), then adenine (A) 42
(23.1%) and thymine (T) 38 (20.9%) (Table, 22).
The partial nucleotide sequence of PR-1a gene for tomato
plants treated with biotic inducers was an aligned by using
DNAMAN program (Wisconsin.
Madison, USA) with six
published pathogenesis related protein in Gen-Bank which are:
Solanum lycopersicon, Solanum torvum, Capsicum annuum,
Solanum melongena, Cucumis melo and Cucumis sativus.
The nucleotide sequence similarity of PR-1a gene for
tomato plants treated with biotic inducers with six published
pathogenesis related protein were shown in Fig. (15). A
phylogenetic tree of PR-1a tomato revealed 95% a moderate
degree of similarity to the other S. lycopersicon pathogenesis
related protein. On the other hand, revealed 84% a moderate
degree of similarity to S. torvum, C. annuum and S. melongena and
60% C. melo and C. sativus pathogenesis related protein (Fig. 16).
Comparison between bases composition of partial PR-1a
gene sequence for tomato plants treated with biotic inducers and
six pathogenesis related protein published in Gen-Bank was
done to determine C+G and A+T ratio between the PR-1a gene and
these international pathogenesis related protein as shown in
Table (22) and Fig. (17).
- 116 -
Table (22): Comparison between bases composition of partial PR-1a
gene for tomato plants treated with biotic inducers
and six pathogenesis related protein published in GenBank.
Base
PR-1 gene and Total Weight
other crops (bp.) (kDa)
A
C
G
T
C+G
A+T
No. % No. % No. % No. % No. % No. %
PR-gene
tomato
182 55.782 42 23.1 48 26.4 54 29.7 38 20.9 102 56.0 80 44.0
Solanum
lycopersicon
832 252.902 242 29.1 165 19.8 168 20.0 257 30.9 333 40.0 499 60.0
Solanum
torvum
504 153.789 128 25.4 112 22.2 127 25.2 137 27.2 239 47.4 265 52.6
Capsicum
annuum
805 245.211 248 30.8 146 18.1 167 20.7 244 30.3 313 38.9 492 61.1
Solanum
melongena
258 79.186 64 24.8 56 21.7 77 29.8 61 23.6 133 51.6 125 48.4
Cucumis
melo
456 139.613 130 28.5 89 19.5 118 25.9 119 26.1 207 45.4 249 54.6
Cucumis
sativus
423 129.64 118 27.9 90 21.3 114 27.0 101 23.9 204 48.2 219 51.8
- 117 -
- 118 -
Fig. (15): Multiple sequence alignment of the partial nucleotide
sequence of the PR-1a gene for tomato plants with
the corresponding sequence of six pathogenesis related
protein available in Gen-Bank.
- 119 -
100%95% 90% 85% 80% 75% 70% 65% 60%
PR1 gene tomato
95%
S. lycopersicum
84%
S. torvum
88%
Capsicum annuum
89%
60%
S. melongena
Cucumis melo
73%
Cucumis sativus
Fig. (16): A phylogenetic tree of tomato plants treated with
biotic inducers and other crops.
Fig. (17): Histogram illustrates nucleotide frequencies of PRgene of tomato plants related to other PR-1a gene of
different crops in Gen-Bank.
- 120 -
2- Translation of partial nucleotide sequence of PR-1a gene for
tomato plants treated with biotic inducers:
The predict number of amino acids were produced from
translation of partial (PR-1a) gene nucleotide sequence were 60 amino
acids starting with Alanine (A) (Fig. 18)
Translation of PR-1a (1-182)
Universal code
Total amino acid number: 60, MW= 6383.
10
20
30
40
50
60
1
1
GCTCGTAGACAAGTTGGAGTCGGTGGTATGACATGCGACAATAGGCTAGCGGCCAATGCC
61
21
CAGCATTACGCCAATCATAGAGCTGCCGACTGCAGGATGCAACACTCTGGTGGACCTTAC
121
41
GGTGAAAACCTAGCTGCCGCTTTCCCCCAGCTCAACGCGGCTGGTGCTGTGAAGATGTGG
181
A
R R Q V G V G G
70
80
Q H
G E
181
GT
Y A N
130
N L
M T C D N R L A
90
100
110
H R A A D C
140
150
A A A F
P
Q L
R M Q H
160
N A A G
A
N A
120
S G G P Y
170
180
A V
K M W
Fig. (18): Translation of partial nucleotide sequence of PR-la gene for
tomato plants treated with biotic inducers produced 60
amino acids with MW = 6.383 kDa.
The partial PR-1a gene sequence for tomato plants was aligned
by using DNAMAN program (Wisconsin, Madison, USA) with
eleven published pathogenesis related protein for different hosts in
Gen-Bank which are: S. lycopersicon, C. annuum, S. melongena, S.
torvum, Vitis pseudoreticulata, C. sativus, Musa acuminate, Betula
pendula, Brassica napus, Eutrema wasabi and Linum usitatissimum.
The partial PR-1a gene sequence similarity of tomato plant treated
with biotic inducers with eleven published pathogenesis related protein of
- 121 -
different hosts was shown in (Fig. 19). A phylogenetic tree of PR-la gene
tomato divided into two major groups, the 1st group includes 2 subgroups. The lst subgroup divided into 2 under subgroups where, one
group include PR-1 gene tomato similarity 89% with Solanum
lycopersicon and Capsicum annuum and another group S. melongena
revealed similarity 85% with the 1st under subgroup (PR-1 gene tomato)
and the 2nd sub group include Solanum torvum similarity 84% with the
1st subgroup. The second major group contain 2 subgroups, the 1st
subgroup divided into 2 under subgroups where, one group include Vitis
pseudoreticulata revealed similarity 61% with the 1st sub group and the
2nd under sub group contain Cucumis sativus revealed similarity 64%
with Musa acuminata. The second subgroup divided into 2 under sub
groups, one group include Betula pendula which revealed a moderate
similarity 68% with the 1st subgroup and Brassica napus revealed
similarity 79% with Eutrema wasabi, while the 2nd under sub group
include Linum usitatissimum revealed similarity 61% with the 1st sub
group. The 1st major group gene tomato revealed a moderate similarity
58% with the 2nd major group (Fig. 20).
Comparison between amino acids composition of partial PR-la
sequence for tomato plants treated with biotic inducers and eleven
pathogenesis related protein of different hosts published in Gen-Bank
was done to determine the similarity in types, percentages and number
of amino acids composition of partial PR-1a gene for tomato plants,
where as PR-1a gene tomato was produced 19 types of 60 amino
acids beginning with Alanine (A) and ended with Tryptophan (W).
The PR-1a tomato was differed in percentage in each amino acid
- 122 -
composition and molecular weight with eleven pathogenesis related
protein of different hosts as shown in Table (23).
Fig. (19): Multiple amino acids sequence aligned of the partial PR-1 a gene
of the studied tomato plants with the corresponding amino acid
sequence of eleven pathogenesis related protein of different hosts
available in Gen-Bank.
- 123 -
100%
90%
80%
70%
60%
50%
PR1 gene tomato
89%
S. lycopersicum
94%
85%
Capsicum annuum
84%
Solanum melongena
Solanum torvum
V. pseudoreticulata
58%
61%
Cucumis sativus
64%
Musa acuminata
60%
Betula pendula
68%
Brassica napus
79%
61%
Eutrema wasabi
Linum usitatissimum
Fig. (20): A phylogenetic tree of PR-la gene tomato based on the
amino acid sequence of the PR-la gene.
The dendrogram displaying the percentage of amino acid sequence
homology between the PR-1a gene tomato and the other eleven
pathogenesis related protein of different hosts published in Gen-Bank.
- 124 -
Table (23): Comparison between amino acids composition of partial PR-la
gene sequence for tomato plants treated with biotic inducers
and 11 pathogenesis related protein of different hosts published
in Gen-Bank.
Amino
acids
Ala.(A)
1
2
3
4
5
6
7
8
9
10
11
12
No. % No. % No. % No. % No. % No. % No. % No. % No. % No. % No. % No. %
13 21.7 20 11.2 19 10.6 10 11.6 19 11.3 12 6.8 10 11.8 24 14.8 17 16.7 17 10.5 15 9.3 12 14.0
Cyst. (C) 2 3.3 7 3.9 7 3.9 4 4.7 7 4.2 8 4.5 2 2.4 7 4.3 3 2.9 7 4.3 6 3.7 2 2.3
Asp.(D)
2
Glu.(E)
1 1.7 4 2.2 4 2.2 2 2.3 7 4.2 5 2.8 5 5.9 2 1.2 2 2.0 4 2.5 2 1.2 4 4.7
Phe.(F)
1 1.7 7 3.9 7 3.9 2 2.3 7 4.2 4 2.3 3 3.5 3 1.9 0
Gly.(G)
7 11.7 15 8.4 15 8.4 9 10.5 13 7.7 19 10.8 8 9.4 14 8.6 9 8.8 15 9.3 15 9.3 9 10.5
His.(H)
3 5.0 4 2.2 5 2.8 2 2.3 4 2.4 5 2.8 1 1.2 3 1.9 4 3.9 4 2.5 3 1.9 2 2.3
Ile.(I)
3.3 8
0
0
4.5 8 4.5 3 3.5 8 4.8 8 4.5 5 5.9 6 3.7 7 6.9 6 3.7 8 5.0 4 4.7
0
2 1.2 1 0.6 0
0
5 2.8 6 3.4 2 2.3 5 3.0 9 5.1 2 2.4 6 3.7 1 1.0 6 3.7 7 4.3 1 1.2
Lys.(K)
1 1.7 4 2.2 4 2.2 3 3.5 4 2.4 2 1.1 3 3.5 3 1.9 6 5.9 5 3.1 5 3.1 2 2.3
Leu.(L)
3 5.0 10 5.6 9 5.0 2 2.3 8 4.8 12 6.8 4 4.7 5 3.1 6 5.9 11 6.8 11 6.8 4 4.7
Met.(M)
3 5.0 4 2.2 4 2.2 3 3.5 4 2.4 4 2.3 0
Asn.(N)
5 8.3 18 10.1 18 10.1 7 8.1 13 7.7 17 9.7 7 8.2 14 8.6 10 9.8 15 9.3 14 8.7 6 7.0
Pro.(P)
2 3.3 9 5.0 10 5.6 3 3.5 10 6.0 7 4.0 4 4.7 8 4.9 2 2.0 6 3.7 8 5.0 2 2.3
Gln.(Q)
4 6.7 13 7.3 12 6.7 6 7.0 11 6.5 7 4.0 4 4.7 8 4.9 4 3.9 7 4.3 7 4.3 4 4.7
Arg.(R)
5 8.3 11 6.1 11 6.1 5 5.8 9 5.4 6 3.4 4 4.7 8 4.9 1 1.0 11 6.8 11 6.8 5 5.8
Ser.(S)
1 1.7 8 4.5 8 4.5 4 4.7 8 4.8 16 9.1 4 4.7 14 8.6 8 7.8 12 7.4 12 7.5 9 10.5
Thr.(T)
1 1.7 6 3.4 6 3.4 3 3.5 7 4.2 6 3.4 3 3.5 6 3.7 3 2.9 4 2.5 3 1.9 1 1.2
Val.(V)
3 5.0 10 5.6 11 6.1 7 8.1 10 6.0 14 8.0 9 10.6 14 8.6 9 8.8 15 9.3 16 9.9 6 7.0
Trp.(W)
1 1.7 6 3.4 6 3.4 4 4.7 5 3.0 5 2.8 3 3.5 4 2.5 3 2.9 4 2.5 4 2.5 3 3.5
Tyr.(Y)
2 3.3 10 5.6 9 5.0 5 5.8 9 5.4 10 5.7 4 4.7 10 6.2 7 6.9 10 6.2 10 6.2 7 8.1
Total
AA no.
60
MW(kDa) 6.383
179
179
20.123 20.094
86
9.603
168
176
18.809 19.182
0
3 1.9 0
0
85
162
102
9.334
17.308
10.82
1 0.6 3 1.9 3 3.5
162
161
17.772 17.668
86
9.410
1= PR-1a gene tomato. 2= S. lycopersicon. 3= C. annuum. 4= S. melongena. 5= S. torvum. 6= V.
pseudoreticulata. 7= C. sativus. 8= M. acuminata. 9= B. pendula. 10= B. napus. 11= E. wasabi.12=
L. usitatissimum.
- 125 -
4- Effect of biotic inducers on virus infectivity during
induction of SAR as follows:
All tested inducers showed different successful degrees in the
induction of acquired systemic resistance against CMV infection in
tomato plants. Reduction of infection (RI%) percentage are affected as
a result to treatments, e.g. M. jalapa extract gave the highest
percentage of reduction (76.0%), followed by C. inerme extract and
kombucha filtrate (60.0 and 59.2%), while mixture extracts has the
lowest percentage (50.0%) compared with Inoculated control 0.0%
[Table (24) and Fig. (21)].
Table (24): Effect of bioinducers
plants.
on CMV infectivity in tomato
Treatments
Disease
incidence%
% of
R.I.
D.S. (%)
*Conc.
Inoculated control
100.0
0.0
96.2
85.5
M. jalapa extract
24.0
76.0
11.5
10.2
C. inerme extract
40.0
60.0
13.7
12.2
Mixture (Mj+Ci)
extracts
50.0
50.0
24.1
21.4
Kombucha filtrate
40.7
59.2
18.0
16.0
R.I. = reduction of virus infection.
D.S. = Disease severity.
*Virus concentration was biology assayed as mean numbers of local lesions.
- 126 -
100
90
80
Virus infectivity
70
60
50
40
30
20
10
0
%of infection
%of R.I.
Infected control
C. inerme
Kombucha
D.S. (%)
Conc.
M. jalapa
Mixture (Mj+Ci)
Fig. (21): Effect of bioinducers on disease severity and virus
infectivity in tomato plants.
- 127 -
B- Using of biotic inducers as bioinducers to control CMV
infection:
Systemic acquired resistance was experimentally achieved using
the tested bioinducers in the tomato plants before inoculation with the
virus isolate. The effect of SAR on the virus infectivity was also
determined.
In this experiment, tomato seedlings were firstly inoculated with
the virus isolate, after 15 days were sprayed with the four tested
bioagents. Seven days later, leaves samples were collected to
determine the following changes between inoculated and noninoculated or sprayed or non-sprayed treatments.
1. Histopathological changes:
Transversal sections from treated and non-treated leaves were
examined under light microscope after contrast staining.
Observations
showed an important alteration between treated and non-treated samples.
Plants treated with bioinducers were stronger in their growth than nontreated as a result to the increase in lignin precipitation, numbers of
xylem arms, phloem layers, skin hairs and increasing thickness of cell
wall, and blade (Table, 25). On the other hand, non-treated tomato plants
showed plasmolysis in the mesophyll cells, cell walls collapsed and
plastids become deformed and swollen a loss of orientation along the
inner cell wall. These alterations were intensified with progressive tissueshrinkage and desiccation causing the walls of the palisade and spongy
parenchyma to fold in a layering fashion as well as reduction in vascular
bundles (Plate, 14).
- 128 -
- 129 -
Plate (14): Light micrograph of tomato plant treated with bioinducers
post CMV inoculation showing different changes in cells and tissues
(40X).
H: Healthy.
V: infected tomato.
M: tomato leaf treated with M. jalapa extract.
M+Y: tomato leaf treated with mixture (Mj+Ci) extract.
- 130 -
2. Biochemical changes:
2.1. Antiviral Proteins
a. Determination the elicited antiviral protein as response to
treatment with bioinducers to control infected tomato plants
after 7 days of spraying:
Protein content was determined in treated tomato plants with
bioinducers and infected with CMV related to BSA as standard protein
(Table, 26). All bioinducers caused an increase in total protein content and
enzymes activity in treated tomato plants. Kombucha filtrate induced
highest protein content (1.65 mg/g FW), while the lowest content (0.93
mg/g FW) was produced by mixture extracts, compared with healthy and
Inoculated control (1.05, 1.12 mg/g FW), respectively Fig. (22).
The tomato plants treated with bioinducers and inoculated with
CMV showed clear varied in number and density of protein. The
variability analysis among four bioinducers appeared 12 protein bands
(Plate, 15); eleven protein fractions appeared in tomato plants treated with
M. jalapa extract followed by C. inerme extract (10 protein fractions) and
mixture extracts and kombucha filtrate gave (8 protein fractions), while
non-treated and infected plants gave 4 and 7 protein fractions, respectively.
The molecular weight of each polypeptide was determined related to
protein marker (Table, 27). The most prominent alteration (polymorphic
bands) among 4 bioinducers (70, 50, 45, 36, 35, 20, 14 and 13) kDa with
percentage 66.6%, these bands may be related to antiviral proteins. The
prominent polypeptide bands in all bioinducers (Monomorphic or
common polypeptide) were (25, 18 and 17) kDa with percentage 25%,
these bands may be related to tomato plant. The unique (polypeptide
- 131 -
markers) were appeared in tomato plant treated with M. jalapa extract
(65) kDa with percentage 8.3%, these bands may be related to
polypeptide markers.
infected with CMV and treated with biotic extracts (after 7
days).
After 7 days of spraying bioinducers
Treatments
Protein content
(mg/g FW)
POD (U/g FW) *POD Specific
activity
PPO
(U/g FW)
*PPO Specific
activity
Healthy control
1.05
200.30
190.76
102.00
97.14
Inoculated control
1.12
217.70
194.38
120.00
107.14
M. jalapa extract
1.62
268.90
165.99
150.00
92.59
C. inerme extract
1.41
243.60
172.77
127.50
90.43
Mixture extracts
0.93
253.90
273.01
130.50
140.32
Kombucha filtrate
1.65
266.30
161.39
229.50
139.09
*Specific activity (unit/mg protein)
2
1.5
1
0.5
0
Healthy c.
C. inerme
Infected c.
Mixture (Mj+Ci)
M. jalapa
Kombucha
Fig. (22): Effect of bioinducers on protein content in tomato plants
infected with CMV (after 7 days).
- 132 -
Table (27): Protein fractions of tomato plants infected with CMV and
treated with bioinducers using SDS-PAGE.
Bioinducers
MW (kDa)
Untreated
plant
Infected
tomato
M
Y
M+Y
K
70
65
50
+
++
+
++
+++
+
++
-
+
Polymorphic
Unique
Polymorphic
45
36
-
++
++
+++
++
+++
+++
-
++
++
Polymorphic
Polymorphic
35
-
-
-
++
+
-
Polymorphic
Polymorphism
25
++
+++
+++
+++
++
+++
Monomorphic
20
18
17
14
13
Total bands
++
+
4
++
+++
++
+
7
++
++++
+++
++
++
11
+
++
+++
++
10
++
+++
++
++
++
8
++
+++
+++
++
8
Polymorphic
Monomorphic
Monomorphic
Polymorphic
Polymorphic
Monomorphic (common polypeptide). Polymorphic (specific polypeptide).
Unique (polypeptide marker) or (genetic marker).
- = Absence of band
Plate (15): Protein fractions of tomato plants treated with bioinducers post
CMV inoculation using SDS-PAGE.
H: Healthy. V: Inoculated control. M: M. jalapa extract. Y: C.
inerme extract.
M+Y: mixture (Mj+Ci) extracts. K: Kombucha filtrate.
- 133 -
treatment with bioinducers on infected tomato plants after
25 days of spraying:
Protein content was determined in CMV infected tomato plants
treated with bioinducers related to BSA as standard protein. All the
used bioinducers caused an increase in total protein content and
enzymes activity in treated tomato plants. M. jalapa extract induced
highest protein content (2.63 mg/g FW), while the lowest content
(1.07 mg/g FW) was produced by C. inerme extract compared with
healthy and Inoculated control (1.09, 1.21 mg/g FW), respectively
[Table (28) and Fig. (23)].
The tomato plants treated with bioinducers and inoculated with
CMV showed clear varied in number and density of protein. The
variability analysis among four bioinducers appeared 8 protein bands
(Plate, 16); seven protein fractions appeared in treatment with mixture
extracts followed by C. inerme extract give 6 protein fractions, M. jalapa
extract and kombucha filtrate gave the same number of protein fraction
(5), while non treated and infected plants gave 4 and 5 protein fractions,
respectively.
The molecular weight of each polypeptide was determined related to
protein marker (Table, 29). The most prominent alteration (polymorphic
bands) among 4 bioinducers (67, 55, 35, 25, 16 and 14) kDa with
percentage 75%. These bands may be related to antiviral proteins. The
prominent polypeptide bands in all bioinducers (monomorphic or
common polypeptide) were (45 and 18) kDa with percentage 25%. These
bands may be related to tomato plant.
- 134 -
infected with CMV and treated with bioinducers (after 25
days).
Treatments
Protein content POD (U/g FW) *POD Specific
(mg/g FW)
activity
PPO
(U/g FW)
*PPO Specific
activity
Healthy control
1.09
192.80
176.88
160.00
146.79
Inoculated control
1.21
201.90
166.86
200.00
165.29
M. jalapa extract
2.63
274.00
66.16
282.50
107.41
C. inerme extract
1.07
202.20
188.97
150.00
140.19
Mixture extracts
1.11
230.00
207.21
208.50
187.84
Kombucha filtrate
1.28
274.50
214.45
247.00
192.97
*Specific activity (unit/ mg protein)
3
2.5
2
1.5
1
0.5
0
Healthy c.
C. inerme
Infected c.
Mixture (Mj+Ci)
M. jalapa
Kombucha
Fig. (23): Effect of bioinducers on protein content in tomato plants
infected with CMV (after 25 days).
- 135 -
Table (29): Protein fractions of CMV infected tomato plants treated
with bioinducers using SDS-PAGE.
MW (kDa)
Untreated
plant
Infected
tomato
67
55
45
35
25
18
16
14
++
++
+++
++
-
+++
++
++
++
++
M
++
++
++
++
++
-
Total bands
4
5
5
Bioinducers
Y
M+Y
+
++
++
++
++
+++
+
++
+
+++
++
++
++
6
7
K
+++
+
++
++
Polymorphism
Polymorphic
Polymorphic
Monomorphic
Polymorphic
Polymorphic
Monomorphic
Polymorphic
Polymorphic
4
Monomorphic (common polypeptide). Polymorphic (specific polypeptide).
- = Absence of band
Plate (16): Protein fractions of tomato plants treated with bioinducers
post CMV inoculation using SDS-PAGE.
Mr): Marker. H: Healthy. V: Inoculated control. M: M. jalapa
extract. Y: C. inerme extract. M+Y: mixture extracts (Mj+Ci) K:
Kombucha filtrate.
- 136 -
2.2- Oxidative enzymes:
Tomato plants treated with bioinducers showed variability in
number and density of polypeptide peroxidase and polyphenol oxidase
isozymes in pre and post CMV infection.
a. Peroxidase isozyme in infected tomato plants and sprayed with
bioinducers to control CMV after 7 days of spraying:
1- Activity:
The activity of peroxidase isozyme was increased as response to all
bioinducers treatments. M. jalapa extract induced highest peroxidase
activity (268.9 U/g FW), while the lowest POD activity (243.6 U/g FW)
was produced by C. inerme extract compared with healthy and
Inoculated control (200.3, 217.7 U/g FW) respectively, Fig. (24).
300
250
200
150
100
50
0
Treatments
Healthy c.
Infected c.
M. jalapa
C. inerme
Mixture (Mj+Ci)
Kombucha
Fig. (24): Effect of bioinducers on POD activity in tomato plants
infected with CMV (after 7days).
- 137 -
The results of the total number of peroxidase isozyme after virus
inoculation was 5 bands (Table, 30).
density polypeptide. Bioinducers induced 5, 3, 4 and 3 polypeptide
bands of M. jalapa, C. inerme, mixture extracts of them and kombucha
filtrate respectively compared with tomato plants untreated and
Inoculated control appeared 3 and 3 isozymes respectively. The
variability analysis of 4 treatments showed isozyme absent or present in
some treatment at RF (1.9, 3.9, 4.5) monomorphic bands common in all
tomato plant treatment with percentage 60%. On the other hand,
isozyme band at (1.5 RF) polymorphic band with percentage 20% was
appeared with the treatment of M. jalapa and mixture extracts and other
band presence with M. jalapa extract treatment at RF (5.1) with
percentage 20% as a unique or genetic marker (Plate, 17).
10
+
- Polymorphic
20 +++ 30 ++ Monomorphic
50 ++++ 55 +++ Monomorphic
20 +++ 15 ++ Monomorphic
Unique
4
3
Bands
%Fraction
++
++
++
3
Bands
%Fraction
K
10
+
20 +++ 30
40 ++++ 30
20 +++ 40
10 ++
5
Bands
%Fraction
M
Bands
25 ++ 45 +++
50 +++ 45 +++
4.5
25 ++ 10 ++
5.1
5 bands
3
3
Bioinducers
Y
M+Y
%Fraction
1.5
1.9
3.9
Bands
%Fraction
Bands
RF
%Fraction
Untreated Infected
plant
tomato
Polymorphis
m
CMV infected tomato plants treated with bioinducers.
Unique: Genetic marker. Monomorphic: Common polypeptide.
Polymorphic: Specific polypeptide. Band density: _ : Absent
+: Weak band. +: Moderate band. +++: Strong band. ++++: very strong band.
- 138 -
Plate (17): Native acrylamide gel (7%) electrophoresis of POD
isozymes produced in inoculated tomato plants and treated
with bioinducers.
b. Peroxidase isozyme in infected tomato plants and sprayed with
bioinducers to control CMV after 25 days of spraying:
1- Activity:
Peroxidase activity was increased in all induced tomato plants
(Fig. 25). Kombucha filtrate induced highest activity (274.5 U/g FW),
while C. inerme extract induced the lowest activity (202.2 U/g FW).
M. jalapa and mixture extracts induced different activity (274.0, 230.0
U/g FW) respectively compared with healthy and Inoculated control
(192.8, 201.9 U/g FW) respectively.
- 139 -
300
250
200
150
100
50
0
Treatments
Healthy c.
Inoculated c.
M. jalapa
C. inerme
Mixture (Mj+Ci)
Kombucha
Fig. (25): Effect of bioinducers on POD activity in inoculated tomato
plants (after 25-days).
The results of the total number of peroxidase isozyme detected in
tomato plants inoculated with CMV and treated with bioinducers was 5
bands (Table, 31).
density polypeptide. Bioinducers were revealed 5, 5, 3 and 3
polypeptide bands of M. jalapa, C. inerme, mixture extracts and
kombucha filtrate respectively compared with tomato plants untreated
and Inoculated control appeared 3 and 4 isozymes respectively. The
variability analysis of 4 treatments showed isozyme absent or present in
- 140 -
some treatment at RF (3.4, 4.9 and 5.6) monomorphic bands common
in all tomato plants with percentage 60%. Two isozyme bands (5.2 and
6.1 RF) specific polypeptide bands with percentage 40% appearance
with treatment of M. jalapa and C. inerme extracts (Plate, 18).
Untreated Infected
plant
tomato
Bioinducers
Y
M+Y
RF
Bands
%Fraction
Bands
%Fraction
Bands
%Fraction
Bands
%Fraction
Bands
%Fraction
Bands
K
%Fraction
M
Polymorphism
CMV infected tomato plants treated with bioinducers.
3.4
25
++
30 +++
20
++
15
++
45
+++
35
++ Monomorphic
4.9
40
++
30 +++
40
+++ 25
++
40
++
35
++ Monomorphic
15
++
10
++
30
++
25 +++
20
++
20
++
10
+
10
+
-
-
5
3
3
5.2
5.6
35
++
6.1
-
-
5 bands
3
4
5
15
++
30
Polymorphic
++ Monomorphic
Polymorphic
Polymorphic: Specific polypeptide
Band density: _ : Absent. +: Weak band. ++: Moderate band. +++: Strong band
- 141 -
Plate (18): Native acrylamide gel (7%) electrophoresis of POD isozymes
CMV inoculation.
H: Healthy.
V: Inoculated with CMV.
M: Treated with Mirabilis extract
Y: Treated with Clerodendrum extract.
M+Y: Treated with Mirabilis + Clerodendrum extracts.
K: Treated with Kombucha filtrate.
- 142 -
c. Polyphenol oxidase isozyme in infected tomato plants and
sprayed with bioinducers to control CMV after 7 days of
spraying:
1- Activity:
Kombucha filtrate induced highest PPO activity (229.5 U/g FW),
while the lowest PPO activity (127.5 U/g FW) was produced by C.
120.0 U/g FW) respectively, Fig (26).
250
200
150
100
50
0
Treatments
Healthy c.
Inoculated c.
M. jalapa
C. inerme
Mixture (Mj+Ci)
Kombucha
Fig. (26): Effect of bioinducers on PPO activity in tomato plants infected
with CMV.
isozyme produced in tomato plants treated with bioinducers pre-CMV
infection was 4 bands, Table (32).
The isozyme bands of tomato plants treated with the 4 bioinducers
were varied in number and density polypeptide. Bioinducers were
- 143 -
induced 4, 4, 3 and 3 polypeptide bands of M. jalapa, C. inerme and the
mixture extracts and kombucha filtrate respectively compared with
healthy and inoculated tomato plants appeared 3 and 3 isozymes,
respectively. The variability analysis of 4 treatments showed isozyme
absent or present in some treatment at RF (1.6, 3.4 and 4.0)
monomorphic bands common in all tomato plants with percentage 75%
and polymorphic specific bands at RF (4.2) with percentage 25%
treatment of M. jalapa and C. inerme extracts (Plate, 19).
Untreated Infected
tomato
Bioinducers
Y
M+Y
3.4
50
4.0
40 +++ 25
++
15
++
25
++
4.2
-
-
10
+
15
+
4 bands
3
3
4
+
15
+
Bands
++ 20 ++ 25
Bands
Bands
+++ 15
%Fraction
40
Bands
+
K
%Fraction
Bands
10
%Fraction
%Fraction
1.6
%Fraction
RF
Bands
M
%Fraction
plant
+++ 35 +++ 60 +++ 40 +++ 55 +++ 65 +++
4
20
++ 20
- 144 -
Monomorphic
Monomorphic
+
Monomorphic
-
-
Polymorphic
3
3
Monomorphic: common polypeptide. Polymorphic: specific polypeptide.
Band density: _ : Absent.
+: weak band
++: moderate band.
+++: strong band
Polymorphism
bioinducers.
isozymes produced in tomato plants treated with bioinducers
post CMV inoculation.
H: Healthy. V: infected tomato. M: tomato leaf treated with M. jalapa
extract. Y: tomato leaf treated with C. inerme. M+Y extracts:
tomato leaf treated with mixture (Mj+Ci) extracts. K: tomato leaf
treated with Kombucha filtrate.
d. Polyphenol oxidase isozyme in inoculated tomato plants and
treated with bioinducers to control CMV (after 25 days of
spraying):
1- Activity:
Tomato plants treated with bioinducers produced an increase in
PPO activity by different unit/g FW. M. jalapa extract was found to be
able to induce the highest activity of PPO in tomato (282.5 U/g FW),
while the lowest activity was (150.0 U/g FW) in case of C. inerme
extract compared with healthy and Inoculated control (160.0, 200.0
U/g FW) respectively, Fig. (27).
- 145 -
300
250
200
150
100
50
0
Treatments
Healthy c.
Inoculated c.
M. jalapa
C. inerme
Mixture (Mj+Ci)
Kombucha
Fig. (27): Effect of bioinducers on PPO activity in inoculated tomato plants.
2- Polyphenol activity staining:
isozyme produced in tomato plants treated with bioinducers pre-CMV
infection was 6 bands, Table (33).
The isozyme bands of tomato plants treated with the 4 bioinducers
were varied in number and density polypeptide. Bioinducers were
induced 5, 3, 5 and 4 polypeptide bands of M. jalapa, C. inerme, the
mixture extracts and kombucha filtrate respectively compared with
untreated and infected tomato plants appeared 3 and 4 isozymes,
respectively. The variability analysis of 4 treatments showed isozyme
absent or present in some treatment at RF (1.6, 2.2 and 4.6)
monomorphic common in all tomato plant treatment with percentage
- 146 -
50%. (3.2 and 4.9 RF) specific bands with percentage 33.3%
polymorphic bands appearance may attributed to the influence of each
bioinducers treatment on tomato plants, one unique isozyme (Genetic
marker) for (1.0 RF) of mixture treatment, (Plate, 20).
isozymes in inoculated tomato plants and treated with
bioinducers.
+
Polymorphism
15
%Fraction
-
K
Bands
-
Bands
%Fraction
Bands
%Fraction
-
%Fraction
Bioinducers
Y
M+Y
M
Bands
-
1.0
Bands
%Fraction
%Fraction
RF
Bands
Untreated Infected
plant
tomato
-
Unique
1.6
35
++ 45 +++ 40 +++ 25 +++ 35 +++ 25 +++
Monomorphic
2.2
40
++
15
++
15
++
++ 30 ++
Monomorphic
-
10
+
20
+
++ 30
++
10
++ 55
15
3.2
25
4.6
4.9
-
-
6 bands
3
4
20
++
20
-
-
-
Polymorphic
++
20
++ 35
++ Monomorphic
++
-
10
++ 10
++
5
3
5
4
Polymorphic
Unique: genetic marker monomorphic: common polypeptide.Polymorphic:
specific polypeptide. +: weak band. ++: moderate band. +++: strong band.
- 147 -
bioinducers post CMV inoculation.
We can conclude that, the bioinducers revealed reproducibility
different levels of bicontrol according to the number of protein genetic
markers (Table, 34).
The result after 7 and 25 days of treatment revealed that, M.
jalapa extract has a high level of protein genetic markers
followed by C. inerme and mixture extracts, while kombucha
filtrate has the low level of protein genetic markers.
- 148 -
Table (34): Protein genetic markers of tomato plants produced by
bioinducers as indication of systemic acquired resistance
against CMV infection.
M. jalapa
Parameters
After 7 After 25
days
days
C. inerme
Mixture (Mj+Ci)
Kombucha
After 7
days
After 25
days
After 7
days
After 25
days
After 7
days
After 25
days
SDS-PAGE
6
2
6
2
4
3
4
1
Peroxidase
1
2
-
2
1
-
-
-
Polyphenol
oxidase
1
2
1
-
-
1
-
1
Total
8
6
7
4
5
4
4
2
2.3- Photosynthetic pigments content:
Virus infection caused marked reduction in Chl a, Chl b and
carotenoid contents (0.714, 0.514 and 0.662 mg/g FW), while it was
(0.855, 0.761 and 0.742 mg/g FW) in non-infected plants for Chl a, Chl
b and carotenoids, respectively.
Generally tomato plants treated with Mj, Ci, mixture extracts and
kombucha filtrate resulted marked increase in Chl a, Chl b and
carotenoid contents after 7 days of spraying. It is recorded (0.926,
0.920, 0.908 and 0.885 mg/g FW) Chl a, (0.780, 0.813, 0.870 and 0.734
mg/g FW) Chl b and (0.793, 0.744, 1.003 and 0.719 mg/g FW)
carotenoid respectively.
On the other hand, tomato plants treated with Mj, Ci, mixture
extracts, kombucha filtrate and infected with CMV showed marked
increase in Chl a Chl b and carotenoids after 25 days of spraying.
- 149 -
The contents were (1.231, 1.236, 1.031 and 1.195 mg/g FW) Chl
a, (1.107, 1.110, 1.172 and 1.156 mg/g FW) Chl b and 1.669, 1.491,
1.303 and 1.346 mg/g FW) carotenoids of Mj, Ci, mixture extracts and
kombucha filtrate respectively (Table, 35).
From the obtained results, the Mj, Ci, mixture extracts and
kombucha filtrate treatment exhibited an increase of total chlorophyll
pigments and carotenoid contents as a bioinducers.
Table (35): Chlorophyll and carotenoid contents in tomato plants
treated with bioinducers after CMV inoculation.
Chlorophyll content
a
b
Carotenoids
Treatments
Healthy plants
Untreated
0.855
0.761
0.742
Plants inoculated with virus
Virus treated
0.714
0.514
0.662
After 7 days
0.926
0.780
0.793
After 25 days
1.231
1.107
1.669
After 7 days
0.920
0.813
0.744
After 25 days
1.236
1.110
1.491
After 7 days
0.908
0.870
1.003
After 25 days
1.031
1.172
1.303
After 7 days
0.885
0.734
0.719
After 25 days
1.195
1.156
1.346
Sprayed with M. jalapa extract
Sprayed with C. inerme extract
Sprayed with mixture (Mj+Ci)
extracts
Sprayed with Kombucha filtrate
Chlorophyll content = mg/g FW.
- 150 -
2.4- Determination of total phenols:
Phenols contents in tomato plants were differently affected by
tested bioinducers. It is increased in non-infected plants treated with
M. jalapa extract and kombucha filtrate (49.24 and 48.41 mg/g FW)
23.65 mg/g FW) conjugated phenols respectively. While C. inerme
and mixture extracts produced low phenol contents (33.56 and 32.70
mg/g FW) total phenols, (16.52 and 18.20 mg/g FW) free phenols and
(17.52 and 14.5 mg/g FW) conjugated phenols respectively compared
with healthy and Inoculated controls (32.89 and 31.02 mg/g FW) total
phenols, (14.24 and 10.35 mg/g FW) free phenols and (20.65 and
20.67 mg/g FW) conjugated phenols respectively (Table, 36).
On the other hand, inoculated tomato plants with CMV showed
an increase in phenols content after treating with M. jalapa and
mixture extracts (12.30 and 11.85 mg/g FW) total phenols, (8.71 and
8.58 mg/g FW) free phenols and (3.59 and 3.27 mg/g FW) conjugated
phenols respectively, while kombucha filtrate and C. inerme extract
showed little increase in phenols contents (9.65 and 8.41 mg/g FW)
1.81 mg/g FW) conjugated phenols respectively compared with
healthy and inoculated controls (8.14 and 7.65 mg/g FW) total
phenols, (7.06 and 6.58 mg/g FW) free phenols and (1.08 and 1.07
mg/g FW) conjugated phenols, respectively.
- 151 -
Table (36): Free, conjugated and total phenols content in inoculated
tomato plants and treated with bioinducers.
Treatments
Total
phenols
Free
phenols
Conjugated
phenols
Total
phenols
Free
phenols
Conjugated
phenols
After 7 days of spraying After 25 days of spraying
Healthy control
32.89
12.24
20.65
8.14
7.06
1.08
Inoculated control
31.02
10.35
20.67
7.65
6.58
1.07
M. jalapa extract
38.59
23.15
15.44
8.60
7.21
2.05
C. inerme extract
31.34
16.92
14.42
8.25
7.56
1.39
Mixture (Mj+Ci) extracts
32.98
23.44
9.55
7.21
6.82
0.69
Kombucha filtrate
41.24
23.57
17.66
8.25
6.80
1.45
2.5- Total free amino acids content in inoculated tomato plants
and treated with bioinducers:
In this analysis, amino acids content in tomato leaves inoculated
with CMV and treated with bioinducers was increased comparing with
healthy and Inoculated controls [Table (37) and Fig. (28)]. After 7
days of applying bioinducers, M. jalapa extract and kombucha filtrate
recorded the highest amount of total amino acids content in tomato
plants (12.22 and 11.82 mg/g FW) respectively followed by mixture
and C. inerme extract (9.30 and 7.04 mg/g FW) respectively compared
with healthy and Inoculated controls (9.05 and 7.34 mg/g FW)
respectively. After 25 days of applying bioinducers, M. jalapa extract
and kombucha filtrate produced the highest amount of total amino
acids in tomato plants (19.04 and 16.03 mg/g FW) followed by C.
inerme extract and mixture extracts (14.29 and 11.49 mg/g FW)
- 152 -
respectively compared with healthy and Inoculated controls (14.04
and 8.48 mg/g FW) respectively.
Table (37): Total free amino acids content in tomato plants treated
with bioinducers.
Treatments
After 7 days of
spraying
After 25 days of
spraying
Healthy control
9.05
14.04
Inoculated control
7.34
8.48
M. jalapa extract
12.22
19.04
C. inerme extract
7.04
14.29
9.30
11.49
Kombucha filtrate
11.82
16.03
Free amino acids content (mg/g FW)
20
18
16
14
12
10
8
6
4
2
0
After 7 days of spraying
Healthy control
Infected control
M. jalapa
C. inerme
Mixture (Mj+Ci)
Kombucha
Fig. (28): Effect of bioinducers on total free amino acids in tomato plants
infected with CMV.
- 153 -
2.6- Total carbohydrates content in inoculated tomato plants and
treated with bioinducers:
Total carbohydrates in tomato plants were increased by using
all tested bioinducers [Table (38) and Fig. (29)]. After 7 days from
applying bioinducers, kombucha filtrate and M. jalapa extract
produced the highest increase in total carbohydrates content (8.11 and
6.27 mg/g FW) respectively in tomato plants infested with CMV
followed by mixture extracts and C. inerme extract (6.8 and 5.95 mg/g
FW) respectively comparing with their respective healthy and
Inoculated controls (5.05 and 4.12 mg/g FW) respectively. After 25
days from applying bioinducers, M. jalapa and C. inerme extracts
produced the highest increase in total carbohydrates content (1.68 and
1.67 mg/g FW) respectively in tomato plants infested with CMV
followed by mixture extracts and kombucha filtrate (1.63 and 1.10
mg/g FW) respectively comparing with their respective healthy and
Inoculated controls (1.56 and 1.09 mg/g FW) respectively.
Table (38): Total carbohydrates content (mg/g FW) in inoculated
tomato plants and treated with bioinducers.
Treatments
After 7 days of
spraying
After 25 days of
spraying
Healthy control
5.05
1.56
Inoculated control
4.12
1.09
M. jalapa extract
6.27
1.68
C. inerme extract
5.95
1.67
6.8
1.63
Kombucha filtrate
8.11
1.10
- 154 -
Total carbohydrates content (mg/g FW)
9
8
7
6
5
4
3
2
1
0
Healthy control
M. jalapa
Mixture(Mj+Ci)
Inoculated control
C. inerme
Kombucha
Fig. (29): Effect of bioinducers on total carbohydrates content in tomato
plants inoculated with CMV.
3. Effect of bioinducers on virus infectivity:
All treatments showed different control degrees as reduction of
infection percentage (RI%), when tomato plants were treated post
virus inoculation. The M. jalapa extract is the first in this concern
(50.0%) followed by C. inerme extract (46.8%) then kombucha filtrate
(46.1%), while mixture extracts exhibited the lowest effect (36.6%),
compared with non treated control (0.0%) [Table (39) and Fig (30)].
- 155 -
Table (39): Effect of individual bioinducers on tomato inoculated
with CMV.
Treatments
Disease
incidence %
%of R.I.
D.S. (%)
*Conc.
Inoculated control
100.0
0.0
97.5
86.6
M. jalapa extract
50.0
50.0
28.1
25.0
C. inerme extract
Mixture (Mj+Ci)
extracts
Kombucha filtrate
53.1
46.8
36.3
32.2
63.3
36.6
35.4
31.4
53.8
46.1
29.8
26.5
R.I. = reduction of virus infection.
D.S. = Disease severity.
*Virus concentration was biology assayed as mean numbers of local lesions.
100
Virus infectivity (%)
90
80
70
60
50
40
30
20
10
0
%of infection
%of R.I.
Inoculated control
C. inerme
Kombucha
D.S. (%)
Conc.
M. jalapa
Mixture (M+Cl)
Fig. (30): Effect of bioinducers on CMV infectivity in tomato plants.
- 156 -
DISCUSSION
The objectives of this study were induction systemic acquired
resistance in some tomato varieties against virus infection with
Cucumber mosaic cucumovirus (CMV). No strategies are currently
available to completely protect these plants against the virus. There
remains another possibility for the management of this disease which
involves the use of biotic inducers of systemic resistance. We try to
realize this purpose, many experiments were successively to deducing
if induction of systemic acquired resistance was successfully achieved
could also protect tomato against infection by CMV.
PART I
1- Disease incidence and frequency of virus:
Cucumber mosaic cucumovirus (CMV) was more incidence and
frequently among 5 viruses found in the all tomato fields surveyed for
viral diseases in the 5 locations at Qalyoubia Governorate were for
virus infection. So, CMV was chosen as target in this study.
These results are in agreement with those previously recorded by
many investigators after surveying tomato fields for virus infection
(Ganoo and Saumtally, 1999; Elshafie et al., 2005 and Massumi et al.,
2009). For example, Yardimci and Eryigit (2006) collected leaf
samples from 138 tomato (Lycopersicon esculentum) plants showing
symptoms of Cucumber mosaic virus (CMV) in the north-west
Mediterranean region of Turkey. The samples were first tested by double
antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA)
using CMV specific polyclonal antibody. The DAS-ELISA revealed that
Discussion
- 157 -
53 of the 138 leaf samples tested were infected with CMV. One of the
ELISA-positive CMV isolates was mechanically inoculated into a set of
indicator plants by conventional leaf inoculation method for further
characterization. In the other study, CMV was the most frequently found
viruses, accounting 23.4% of the collected tomato samples in the
Southeast and Central Regions of Iran (Michael, 2009). Lin et al. (2010)
identified Cucumber mosaic virus (CMV) as the causal agent of several
disease epidemics in most countries of the world. Insect-mediated virus
diseases, such as those caused by CMV, caused remarkable loss of
tomato (Solanum lycopersicon) production in Taiwan.
2- Identification of Cucumber mosaic cucumovirus (CMV):
The CMV isolate used in this study was identified based on
biological and serological properties. Chenopodium amaranticolor was
used as local lesion in all assayed trials. Nicotiana glutinosa showed
severe systemic symptoms in the form of severe mosaic and
malformation was used as propagative host. The isolated virus have a
wide host range of plant species and cultivars, this isolate was shown to
infect 11 species and cultivars belonged to 4 families. Eight species and
cultivars showed systemic symptoms while only 3 species showed local
lesions as local hosts. It is easily mechanical transmitted to healthy
susceptible test plants. Also, transmitted in a non-persistent manner by
both Myzus persicae and Aphis craccivora from infected tomato
(Lycopersicon esculentum) source plants to healthy tomato. In vitro
properties were thermal inactivation point is 70°C, dilution end point 10-4
and the virus completely inactivated after 5 days at room temperature
Discussion
- 158 -
(25±3°C). Cytoplasmic inclusions (crystalline and amorphous inclusions)
were found in the epidermic cells of the infected leaves. Dot blot
immunoassay was used for identification of CMV isolate. Obtained
results dealing the isolated virus confirmation were corroboratory with
those recorded in the universal virus database of the International
Committee on Taxonomy of Viruses (ICTVdb, 2010) online updated to
July 2010.
PART II
Systemic acquired resistance (SAR) and control:
If defense mechanisms are triggered by a stimulus prior to infection
by a plant pathogen, disease can be reduced. This is the basic theory of
induced resistance, one of the most intriguing forms of resistance, in
which a variety of biotic and abiotic treatments prior to infection can turn
a susceptible plant into a resistant one. Induced resistance is not the
creation of resistance where there is none, but the activation of latent
resistance mechanisms that are expressed upon subsequent, so-called
“challenge” inoculation with a pathogen. Induced resistance can be
triggered by certain chemicals, non-pathogens, avirulent forms of
pathogens, incompatible races of pathogens, or by virulent pathogens
under circumstances where infection is stalled due to environmental
conditions. Plant resistance and induced forms of resistance are generally
associated with a rapid response, and the defense compounds are often
the same.
Generally, induced resistance is systemic, because the
defensive capacity is increased not only in the primary infected plant
parts, but also in non-infected, spatially separated tissues. The SAR
defense signalling networks appear to share significant overlap with those
Discussion
- 159 -
induced by basal defenses against pathogen-associated molecular
patterns. The nature of the molecule that travels through the phloem from
the site of infection to establish systemic immunity has been sought after
for decades. Accumulation of salicylic acid (SA) is required for SAR,
but only in the signal-perceiving systemic tissue and not in the signal
generating tissue. These observations led to the suggestion that systemic
acquired resistance (SAR) might provide a new strategy for crop
protection, either by discovering compounds that stimulate the plants'
natural disease resistance mechanisms, or by developing transgenic
plants that constitutively express components of the disease resistance
mechanism in order to make them more resistant to pathogen attack
(Lancioni, 2008).
Upon primary infection or insect attack, plants develop enhanced
resistance against subsequent invaders. A classic example of such a
systemically induced resistance is activated after primary infection with a
necrotizing pathogen, rendering distant, uninfected plant parts more
resistant towards a broad spectrum of virulent pathogens, including
viruses, bacteria and fungi. This form of induced resistance is often
referred to as systemic acquired resistance (SAR) and has been
demonstrated in many plant–pathogen interactions (Walter et al., 2007).
Firstly, histopathological, histochemical, total RNA and
molecular changes between treated and non-treated plants with bioinducers were demonstrated. Comparison between histochemical,
total RNA and molecular changes were made after 7 (pre-inoculation)
and 25 (post-inoculation) days from spraying with inducers. Virus
infectivity was biologically measured to insure of SAR induction.
Discussion
- 160 -
Histopathological Studies:
Histopathological changes (as indicator to SAR) in tomato leaf
tissues sprayed before 7 days with inducers and pre-virus inoculation
were examined. Progressive increasing in lignin accumulation in
epidermal cells, number of hairs, thickness of blade, number of xylem
arms and phloem layers. The alterations included tissue-shrinkage,
intense staining and precipitation of lignin in sub stomatal cavity,
mesophyll cell showing folding and layering of cell wall and remains of
host palisade cell walls. Histopathological changes simultaneity with
elicitation of systemic acquired resistance was tend toward growth
enhancement in the sprayed plants with tested bio-inducers than those
untreated ones.
Foliar application of elicitors showed in most cases a significant
increase in plant growth parameters. These increases may be attributed
to elicitors effect on physiological processes in plant such as ion
uptake, cell elongation, cell division, enzymatic activation and protein
synthesis. In this concern, SA enhanced growth of plants. Plants
respond to pathogen attack or elicitor treatments by activating a wide
variety of protective mechanisms designed to prevent pathogen
replication and spreading (Farouk et al., 2008).
Passive defenses include the presence of preformed surface wax
and cell walls, antimicrobial enzymes, and secondary metabolites. The
plant cell wall is the first and the principal physical barrier. This
cellulose-rich structure consists of a highly organized network of
polysaccharides, proteins, and phenylpropanoid polymers that forms a
resistant layer surrounding the cell plasma membrane. Cutin, suberine,
Discussion
- 161 -
and waxes also provide protection through the reinforcement of the
epidermal layer of the leaves (Lancioni, 2008).
Lignin is a phenolic polymer. It is the second most abundant biopolymer on Earth (after cellulose), and plays an important role in
providing structural support to plants. Its hydrophobicity also facilitates
water transport through the vascular tissue. Finally, the chemical
complexity and apparent lack of regularity in its structure make lignin
extremely suitable as a physical barrier against insects and fungi
(Vermerris and Nicholson, 2006). Lignins are extremely resistant to
microbial degradation and are often induced at sites of pathogen
infection, playing important roles in cell wall reinforcement and,
consequently, increased defense response against infection. The
induction of lignin synthesis or lignin-related genes after virus challenge
has been reported in incompatible interactions in herbaceous plants.
Lignification is seems to help prevent viral infection (Freitas-Astúa et
al., 2007).
Total Protein:
In this study, total protein including biosynthesis proteins (free,
conjugate, pathogenesis-related enzymes, their isozymes and antiviral)
was determined with different techniques and many types of proteins
were found as response to induction treatments. Proteins have a
distinguish role in the resistance to many phytopathogens either before or
after pathogen challenged leaves. The quantitative, qualitative and
activity of antiviral proteins as protein content, patterns, isozymes of
peroxidase and polyphenol oxidase were determined using SDS-PAGE
Discussion
- 162 -
as response to sprayed tomato plants with tested electors pre and post
virus inoculation.
Quantitative proteins of induced cucumber plants were
determined using SDS-PAGE, the results indicated that, a new pattern
of proteins were produced, as well as, different increasing in the
density of bands among biotic inducers treatments. It has been
suggested that, the induced proteins may help to limit virus spread or
multiplication (Abu-Jawdah, 1982; Mahmoud, 2000 and Chen et
al., 2006). The continuous accumulations of newly-induced proteins
may help in the localization of viral infection; the reverse is not true,
since the presence of a non significant amount of induced proteins is a
necessary condition to the observed systemic infection.
Based on current knowledge of the biochemistry of resistance, it
can be concluded that SAR results from the expression of several
parameters, including changes in cell wall composition and de novo
synthesis of phytoalexins and PR (pathogenesis related) proteins.
Moreover, the local de novo synthesis of phytoalexins is often related
to the induced resistance stage (Walter et al., 2007).
Botanical Antiviral (Antiviral protein):
The present work was carried out with an objective to Screen
promising botanicals Mirabilis jalapa (Nyctaginaceae), Clerodendrum
inerme (Verbenaceae) and their mixture for their antiviral activity
against CMV in tomato plants.
The botanicals may induce resistance or they themselves may
act as inhibitors of viral replication. Ribosome Inactivating Proteins
Discussion
- 163 -
(RIPs) and glycoproteins may block the replication sites. A mobile
inducing signal may be produced in treated leaves after the botanical
resistance inducers bind with the host plant surface. This signal
produces virus-inhibiting agent in the entire plant system. Certain low
molecular weight pathogenesis related proteins might also playa, role
in the induction of systemic acquired resistance. Thus, biologically
active compounds present in plant products act as elicitors and induce
resistance in host plants resulting in reduction of disease development
(Verma et al., 1998).
The roots, leaves and stem of Mirabilis jalapa show high
inhibitory activity against plant viruses. Verma and Kumar (1980)
showed that M. jalapa leaf extract suppressed the disease symptoms
on a few systemic hosts when the extract was used! as a foliar spray 24
h prior to virus inoculation.
Foliar sprays of the M. jalapa leaf extract caused marked symptom
suppression, improved growth and flowering and considerably reduced
the virus multiplication rate in cucumber treated against CMV. The aphid
and whitefly (Bemisia tabaci) populations were much lower on treated
than control plants (Verma and Kumar, 1982).
Antiviral protein designated as MAP [Mirabilis antiviral protein,
30 kDa (ribosome inactivating proteins, RIPs)] extracted from roots
and leaves of M. jalapa was highly active against mechanical
transmission and almost complete inhibition of cucumber mosaic
cucumovirus (Kubo et al., 1990). Hersanti (2005) reported that leaf
extract of Mirabilis jalapa is one agent induced systemic resistance
against the attack of red pepper by CMV.
Discussion
- 164 -
A novel single resistance inducing protein (Crip-31) was
isolated and purified from the leaves of Clerodendrum inerme, which
is a very potent, highly stable, basic in nature, 31 kDa in molecular
mass having hydrophobic residues and induces a high degree of
localized as well as systemic resistance against three different groups
of plant viruses (i.e. CMV, PVY and ToMV), which differ at their
genomic organization and having different replication strategies,
infection in susceptible host Nicotiana tabacum. Minimum amount of
purified preparation sufficient for systemic resistance induction was ~
25 µgml−1. The systemic inhibitory activity of the Crip-31 provides
protection to whole plants within 40–60 min of its application. The
systemic resistance inducing properties of this protein can be of
immense biological importance, as it is similar to ribosome
inactivating proteins (RIPs) (Praveen et al., 2001).
The chemical constituents of the Clerodendrum genus were
isolated, identified and biotechnological prospects also characterized.
The major chemical constituents present in this genus were identified
as phenolics, flavonoids, terpenes, steroids and oils (Shrivastava and
Patel (2007).
Kombucha tea is never static. New acids and nutrients are
constantly created and combined, into ever-changing – though predictable
zymurgy (Chen and Liu, 2000). Kombucha contains many different probiotic cultures along with several organic acids, active enzymes, amino
acids, anti-oxidants, and polyphenols.
Accordingly, anti-infective activity may induce one or more of
the following activities:
Discussion
- 165 -
In the mechanism of action for any of the antiviral proteins,
there are only tantalizing hints as to where the block occurs in the
virus life cycle. The process of virus infection of a plant can be
separated into two phases establishment and replication. Events which
occur during the establishment phase include initial wounding by
abrasion or a vector, cell penetration and virus uncoating. Replication
is characterized by the various viral nucleic acid and viral protein
synthesis, reassembly of the virion, and subsequent movement into
another cell or another part of the plant. Determining effects on
establishment or replication by utilizing tissue assay are hampered by
the fact that, the period during which the uncoating of the virus
inoculum occurs overlaps the initiation of viral protein and nucleic
acid synthesis (Goodman et al., 1986 and Matthews, 1991).
Considers an inhibitor be an inhibitor of replication of its
effective when applied 5 to 8 hours after virus inoculation
(Loebenstein, 1972). Four types of antiviral protein activities have
been characterized, and some antiviral proteins have been capable of
more than one activity. The activities were (1) Aggregation, (2)
Inhibition of establishment, (3) Induction of a systemic viral resistant
state and (4) Inhibition of replication by inactivation of protein
synthesis, cited from Chessin et al. (1995).
(1) Aggregation: obviously, aggregation is purely a physical
phenomenon, depending on ionic conditions and concentration,
(Kassanis and Kleozkowski, 1948 and Kumon et al., 1990). As a
resulting the antiviral proteins may able to form a precipitate with virus.
Discussion
- 166 -
(2) Inhibition of establishment: The virus coat proteins (also virus
genome) compete with AVP for attachment in cell receptors. Whereas
(Mahmoud, 2000) postulated that, the AVP similar to coat protein in
amino groups. These cell receptors might be of common importance to
both virus and infection RNA in early phases of virus establishment.
These sites probably possess a strong affinity for certain amino groups in
the AVP show a stronger reactivity in this respect than similar groups in
the coat protein similar groups in the coat protein of complete virus or
virus RNA. Therefore, AVP may be substitute for the virus particles. It is
well known that, amino groups are necessary in virus to preserve its
biological activity: This hypothesis was confirmed by amino acid
composition for AVP, whereas it had relatively highly content of basic
amino acid and lysine.
(3) Induced of systemic resistance: several plant viruses induce
systemic resistance to virus. A protein virus inhibitory agent (VIA)
can be isolated from the resistant tissue (Faccioli et al., 1994).
(4)
Ribosome
inactivation:
RIPs
(ribosome
inactivation
proteins) damage ribosomes so that elongation step of protein
synthesis in efficiency prevented. Specifically, RIPs depurinate the
adenine at position 4324 in mammalian 28S rRNA and position 3017
in plant 25S rRNA rendering the 60S ribosomal subunit in capable of
binding EF-2 (Stripe et al., 1992). Generally, RIPs cannot depurinate
prokaryotic ribosomes but can modify naked 235 rRNA (Wood et al.,
1992 and Endo et al., 1988).
Meanwhile, Mirabilis jalapa (Nyctaginaceae), containing a
ribosome inactivating protein (RIP) called Mirabilis antiviral protein
Discussion
- 167 -
(MAP), against infection by potato virus X, potato virus Y, potato leaf
roll virus, and potato spindle tuber viroid. Root extracts of M. jalapa
sprayed on test plants 24 h before virus or viroid inoculation inhibited
infection by almost 100%, as corroborated by infectivity assays and
the nucleic acid spot hybridization test (Vivanco et al., 1999). MAP
was highly effective in inhibiting TSWV at 60% saturation. A
minimum concentration of 400µg/ml of MAP was sufficient to inhibit
TSWV (Devi et al., 2004). In addition, Mirabilis antiviral protein
(MAP) was isolated from roots and leaves of M. jalapa L. which
possess repellent properties against aphids and white flies. MAP
showed antiviral activity against mechanically transmitted viruses but
not against aphid transmitted viruses (Vivanco et al., 1999).
Two systemic antiviral resistance-inducing proteins, CIP-29 and
CIP-34, isolated from Clerodendrum inerme leaves, for ribosomeinactivating properties. CIP-29 has a polynucleotide: adenosine
glycosidase (ribosome-inactivating protein), that inhibits protein
synthesis both in cell-free systems and, at higher concentrations, in
cells, and releases adenine from ribosomes, RNA, poly (A) and DNA.
As compared with other known RIPs, CIP-29 deadenylates DNA at a
high rate, and induces systemic antiviral resistance in susceptible
plants (Olivieri et al., 1996).
Chemical analysis of clavillia (Mirabilis jalapa) was rich in
many active compounds including triterpenes, proteins, flavonoids,
alkaloids, and steroids. Purified an antiviral proteins from roots,
shoots, leaves, fruits, and seeds of M. jalapa are employed for
different affections. Thus, information about the reproductive pattern
Discussion
- 168 -
of this culture is important for implementing experimental procedures
(Leal et al., 2001). MAPs in clavillia as being effective in protecting
economically-important crops (such as tobacco, corn, and potatoes)
from a large variety of plant viruses (such as tobacco mosaic virus,
spotted leaf virus and root rot virus) (Vivanco et al., 1999).
In the present study, applying biotic inducers (M. jalapa, C. inerme,
mixture and kombucha) pre- and post- virus inoculation resulted in an
increase in bio-chemical components i.e total sugars and total free amino
acids content which increased in treated plants to increase the plant
tolerant of infection. These results were agreed with (Kahler and Allard,
1981; Coseteng and Lee, 1978 and Doebley, 1989).
Kombucha tea contains among its symbiotic structure (bacteria
and yeasts) a like-endophytic bacteria named Gluconacetobacter
kombuchae sp. nov. can fixing atmospheric nitrogen which utilized for
plant growth (Dutta and Gachhui, 2007).
Jayabalan et al. (2007) in addition to polyphenolic compounds
found that, concentration of acetic acid has reached maximum up to 9.5
g/l in green tea kombucha on 15th day and glucuronic acid concentration
was reached maximum up to 2.3 g/l in black tea kombucha on 12th day of
fermentation. Köhler and Köhler (1985) observed that glucuronic acid
is able to combine with over two hundred known toxins within the plant
cell and these included substances absorbed from acidic and radioactive
rains and specific chemical groups such as nitrites as well as atmospheric
pollutions from the gases sulphur dioxide and ozone. Most surprising was
the discovery that Kombucha offers genetic protection so that growth
patterns are normalised after disruption by endogenic or exogenic
Discussion
- 169 -
poisons. The implications of this for the survival of many species of
plants that have suffered considerable damage as a result of global
environmental pollution are remarkable.
So, we can transpire an important role of kombucha as bioelictor
can be enhanced plant growth and induction systemic acquired
resistance (SAR) against phytopathogens. Possibility of using the
kombucha as bioantiviral against plant viruses is available now.
Enzymes and Isozymes Activities:
SAR in cucumber is correlated with increasing in peroxidase
activity, as well as polyphenol oxidase (PPO) in N. glutinosa (Ali et
al., 2006). In addition, proteins and isozyme polymorphisms are good
indicators of response to biotic and abiotic stresses (Doebley, 1989).
The time course of accumulation of novel proteins was very
essential to accumulate pathogenesis related proteins; such proteins
had been found to play a key role in inducing strong systemic
resistance in susceptible host against viruses (Devi et al., 2004 and
Effmert et al., 2005).
Peroxidases (PO) have been found to play a major role in the
regulation of plant cell elongation, phenolic compounds oxidation,
polysaccharide cross-linking, Indole acetic acid oxidation, cross-linking
of extension monomers and mediate the final step in the biosynthesis of
lignin and other oxidative phenols. PO and PPO activities were greater in
the plants treated with mixtures of rhizobacteria and endophytic bacteria
and challenged with viruliferous aphids, compared to control plants. PPO
can be induced through octadecanoid defense signal pathway and it
Discussion
- 170 -
oxidizes phenolic compounds to quinines, and the enzyme itself is
inhibitory to viruses by inactivating the RNA of the virus. Enhanced PPO
activities against disease and insect pests have been reported in several
beneficial plant–microbe interactions (Harish et al., 2009).
Activities of POD in infected leaves tended to increase during
the first phase post-inoculation. After that, POD activities of CMV
singly infected leaves declined first. Whereas the activities of CMV
and satRNAs co-infected leaves increased till day 30 and declined
continuously thereafter (Shang et al., 2009).
Salicylic acid as signal for pathogenesis-related proteins:
When pathogen infection induces a necrotic lesion many
biochemical changes take place. Among these are the induction of the
phenylpropanoid pathway which leads to the synthesis of flavonoids
and lignins and to the synthesis of SA. The SA is released into the
phloem, where it is translocated throughout the plant and is eventually
perceived by its target cells, which comprise the leaf mesophyll cells
and possibly other cell types. Presumably, SA binds a receptor which
transduces the signal, by a process that is apparently independent of
protein synthesis, leading to the induction of a number of genes to
very high levels in the target cells. The proteins synthesized from
these genes then act cooperatively to protect the plant from further
infection by other pathogens (Wray, 1992).
Salicylic acid (SA) belongs to phenolic group and is ubiquitous in
plants. SA is involved in signal transduction, pondering over the plant
resistance to stress and generates significant impact on photosynthesis,
Discussion
- 171 -
transpiration, uptake and transport of ions and growth and development.
The increases in endogenous levels of SA either paralleled or preceded
the increase in expression of PR genes and development of SAR.
Salicylic acid SA accumulation is essential for expression of multiple
modes of plant disease resistance (Hayat and Ahmad, 2007).
SA was measured quantitatively in situ Nicotiana tabacum L.
cv. Xanthi-nc leaves inoculated with Tobacco mosaic virus (TMV).
The biosensor revealed accumulation of apoplastic SA before the
visible appearance of hypersensitive response (HR) lesions (Huang et
al., 2006).
Present study revealed that endogenous levels of SA were
increased as response to spraying with tested bioelicitors especially
kombucha.
The rapid accumulation of salicylic acid after Cucumber mosaic
virus inoculation leads to increase in activity of enzymes known to be
involved with systemic acquired resistance such as phenylalanine
ammonialyase, and peroxidase. Salicylic acid is assumed to be the
systemic signal molecule that induces synthesis of pathogenesis-related
proteins and/or other components of systemic acquired resistance.
Salicylic acid activates resistance mechanisms such as phytoalexin
production,
lignification.
proteinase
inhibitors,
Phenylalanine
cell
wall
ammonialyase
strengthening
(PAL)
catalyses
and
the
deamination of phenylalanine to produce transcinnamic acid, the first step
in controlling the rate of phenylpropanoid metabolism. The production of
phenylpropanoid compounds is important in plant development, plantmicrobe signalling and plant defense. Peroxidase (POX) enzymes
Discussion
- 172 -
involved in the oxidation of phenols to more toxic quinones, are known
to increase in several infected plants (Sudhakar et al., 2007).
Salicylic acid (SA) application on tobacco enhanced the resistance
to CMV and the resistance was shown to be due to inhibition of systemic
virus movement. Induction of resistance to CMV occurred via signal
transduction pathway that may also be triggered by antimycin A, an
inducer of the mitochondrial enzyme alternative to oxidase (AOX). In A.
thaliana inhibition of CMV systemic movement was also induced by SA
and antimycin A. In squash (Cucurbita pepo), SA-induced resistance to
CMV was attributed to the inhibition of virus accumulation in directly
inoculated tissue most likely through inhibition of cell-to-cell movement.
Different host plant species may adopt markedly different approaches to
tackle infection by the same virus. It is essential that adequate caution has
to be exercised, while attempting to apply findings on plant-virus
interactions from model systems to a wider range of host species
(Mayers et al., 2005).
The obtained result from quantification of endogenous SA using
HPLC in induced tomato plants were agreed with percentage of
infection, disease severity and CMV concentration.
The same trend was observed by many authors (Vernooij et al.,
1995; Dong and Beer, 2000; Mahmoud, 2003; Abo El-Nasr et al.,
2004; Megahed, 2008 and Taha, 2010).
An increase in endogenous salicylic acid in tobacco infected
with TMV caused a hypersensitive response with systemic induction
of PR proteins (Yalpani et al., 1991). Raskin (1992) found that, it is
Discussion
- 173 -
possible that SA is an endogenous messengers that activities important
element of host resistance pathogens.
Endogenous SA is a key signal, involved in the activation of plant
defense responses to fungal, bacterial and viral attacks. Classical studies
performed on tobacco plants, infected with tobacco mosaic virus (TMV)
demonstrated a substantial SA accumulation in these plants, an
acquirement of resistance to subsequent infection, and the development
of systemic resistance in these plants. In 1990s, a correlation was found
between SA content in plants and their resistance to the virus. A necessity
of SA for the development of plant resistance to TMV was substantiated
by using transgenic plants. Later, the involvement of SA in the
development of plant resistance to other pathogens was also shown. Plant
treatment with SA is one of the most efficient ways to protect plants
against unfavorable biotic and abiotic environmental factors (Hayat and
Ahmad, 2007).
Photosynthetic pigments:
Photosynthetic pigments content were positive markedly
affected as result to using the four tested bioelicitors and became one
of visible evidence of sufficient of treatments.
The Chl a and b contents slightly increased with the growth of
N. glutinosa, irrespective of infected N. glutinosa with CMV. There
was no great difference in Chl a and b contents between infected or
healthy leaves after the first week of virus infection, however, 30 days
after virus infection, the infected leaves had a significantly lower Chl
content compared to healthy leaves. Meanwhile, the Chl a/b was not
Discussion
- 174 -
significantly influenced by viral infection. Chl content was higher in
CMV infected leaves by using both satRNAs together than by using
single satRNA (Shang et al., 2009).
Repression in gene expression was also observed for some
transcripts that code for the key chlorophyll synthesis enzymes
protoporphyrin
IX
magnesium
chelatase
and
glutamyl-tRNA
reductase (GluTR) suggesting that, as expected, the presence of the
virus has influence on photosynthesis as well, even before the
appearance of macroscopic symptoms (Freitas-Astúa et al., 2007).
These results are in harmony with the study carried by Farouk et
al. (2008) who recorded that, the application of elicitors increased the
total chlorophyll content of the cucumber plants. This increment may be
due to stimulating pigment formation and enhancing the efficacy of
photosynthetic apparatus with a better potential for resistance and
decrease in photophosphorylation rate usually occurring after infection.
Elicitors were found to increase potassium content, which may increase
the number of chloroplasts per cell, number of cells per leaf and
consequently leaf area.
SA increased significantly photosynthetic
pigments content. Moreover, SA proved to decrease ethylene production
and subsequently increased chlorophyll, and activated the synthesis of
carotenoids which protect chlorophyll from oxidation and finally
increased chlorophyll content as reported in this study.
In fact, in a compatible host-pathogen interaction, studying the upregulated genes is very important, but a careful review of repressed ones
can be relevant as well. The repressed genes can lead to important cues to
understanding viral interference in plant metabolism in order to establish
Discussion
- 175 -
an adequate environment for the development of the disease. Repression
of genes involved in chlorophyll synthesis has been found not only in
plants undergoing biotic, but also abiotic- such as cold-stress. Similarly, it
has been shown that enzymes involved in the photorespiratory pathway,
may play an important role in the response not only to biotic, but also to
abiotic stress (Freitas-Astúa et al., 2007).
It appeared from our results that biotic inducers treatment
induced tomato plants for increasing total chlorophyll pigments and
carotenoids contents as an indication of systemic acquired resistance
and help infected tomato plants to tolerant the virus infection (as
bioinducer agents), while M. jalapa extract and kombucha filtrate
gave the high content of chlorophyll pigments and C. inerme and
mixture extracts gave the lowest chlorophyll content in two cases.
In order to examine the effect of used inducers on the plant
challenged with the virus chlorophyll content was analyzed result in
increasing the percentage of chlorophyll a, b and carotenoids related
to healthy plants may be due to that biotic inducers induce signal
suppress or inhibit virus replication and reduce its spread.
Many plant infections are the cause of localized changes in
chloroplasts and modify their structures and function (Zaitlin and
Hull, 1987 and Galal, 2006). The effect of pathogens on chloroplasts
and cellular processes might be translated into effects on growth and
yield through shifts in carbohydrate metabolism, source-sink
relationships, biomass partitioning between roots and shoots, etc
(Balachandran et al., 1997).
Discussion
- 176 -
Chlorophyll lowering was noticed more in a than b in treated
plants comparable to the untreated which mean that virus infection
lead to destroy chlorophyll a at the expense of b. The decrease in
chlorophyll is considered to be a symptom of oxidative stress
condition this decrease after virus infection might be due to the
generation of reactive oxygen species (ROS) causing damage to
chlorophyll a that is mean the plant failed to capture the light and so
photosynthesis will decrease or stopped (Ali et al., 2006).
Phenolic compounds:
Usually increased as response to plant defense against
pathogens or as elicitation by some biotic and abiotic inducers. In this
study, phenol contents were increased after treatments of M. jalapa
extract and kombucha filtrate, C. inerme and mixture extracts either
before or after inoculation with tested virus isolate.
Phenolic acids are generally not abundant in most plants. There
are a few exceptions: gallic acid and salicylic acid (SA). Gallic acid is
a precursor for the ellagitannins and gallotannins. Salicylic acid is an
important defense compound because it mediates systemic acquired
resistance (SAR), a resistance mechanism whereby SA is used as a
signaling molecule to relay information on pathogen attack to other
parts of the plant. Upon receiving the SA signal, a general defense
response is activated that includes the biosynthesis of pathogenesisrelated (PR) proteins (Vermerris and Nicholson, 2006).
Plants have several lines of defense against invading pathogens
including preformed barriers and induced responses. Systemic acquired
Discussion
- 177 -
resistance is characteristically associated with accumulation of salicylic
acid, enhanced expression of pathogenesis-related proteins and activation
of phenylpropanoid pathway, leading to the synthesis of higher phenolic
compounds. Phenolics have been associated extensively with the defense
of plants against microbes, insects and other herbivores. A number of
phenols are regarded as pre-infection inhibitors, providing the plant with
a certain degree of basic resistance against pathogenic micro-organisms.
Phenol metabolism and cell wall lignification are thus involved in, and
have consequences for, a number of cellular, whole plant and ecological
processes, that might even provide plants, the immunity against
destructive agents. Several associations have been reported between
phenolics and the resistance of plants to pathogen. Phenolic acids are
involved in phytoalexin accumulation, biosynthesis of lignin and
formation of structural barriers, which play a major role in resistance
against the pathogen (Sudhakar et al., 2007).
It can be easily imagined that, the antimicrobial products of
peroxidase restricts the development of challenging Cucumber mosaic
virus. Peroxidase also catalyses the condensation of phenolic
compounds into lignin and is associated with disease resistance in
plants (Hammerschmidt et al., 1982).
Discussion
- 178 -
Amino acids:
Amino acids are the smallest unit in protein structures. The
primary structures of a protein defines the sequence of the amino acid
residues and is dictated by the base sequence of the corresponding
gene(s). Phenolic compounds, enzymatic activity and pathogenesisrelated (PR) proteins are closely related with amino acids. Production
of a new and more amino acids as result to using biotic inducers were
achieved in this study.
It has become clear that there is yet another systemic resistance
phenomenon in plants: RNA silencing. In contrast to SAR and ISR,
RNA silencing is highly specific with respect both to its induction and
activity. RNA silencing is a homology-based RNA degradation
mechanism that probably occurs in all eucaryotes, including plants. In
plants, it appears to function, at least in part, as a defense mechanism
against viruses (Gilliland et al., 2006).
Nucleic Acids:
There are many types of RNAs in the cells of the plant
especially after infection with phytopathogens (fungi, bacteria and
viruses). Some of these closely related with viruses or viroids or virusplant interactions. RNA with different sequences was a rise as product
of many physiological processes. In this study, mRNA from plant
cells was induced and elicited pathogenesis-related (PR) proteins
during the induction of systemic acquired resistance (SAR) as
response to spraying tomato plants with the tested biotic inducers
before virus-inoculation.
Discussion
- 179 -
Nine classes of mRNAs that accumulate to high levels in
uninfected leaves during the induction of SAR in tobacco have been
identified. The leaves of several plants were pooled and RNA was
extracted. The accumulation of mRNA for PR-1 acidic, PR-1 basic, class
I, II and III glucanase, class I, II, III and IV chitinase, PR-4, PR-5,
SAR8.2 and the lignin-forming peroxidase was determined in these
samples by northern blot analysis. Within 2-4 h after SA treatment RNA
accumulation was dramatically increased for PR-1 acidic, PR-1 basic,
class II and III glucanase, class II, III and IV chitinase. PR-4, PR-5 and
SAR8.2. There was not a consistent increase in the mRNA for class I
glucanase, class I chitinase or the lignin-forming peroxidase (Wray,
1992).
Experiments with Tobacco mosaic virus (TMV) and Potato virus
X (PVX), leaf disks which had been pretreated with SA reduced the
overall accumulation of viral RNA. In tobacco and Arabidopsis, the
defense signal transduction pathway branches downstream of SA
which triggers induction of resistance to DNA and RNA viruses
(Harish et al., 2009).
Molecular marker for SAR:
Hooft Van Huijsduijnen et al. (1986) stated that, in at least 16
plant species, the hypersensitive response to virus infection is
accompanied by the de novo synthesis of 'pathogenesis-related' (PR)
proteins. The association of these proteins with systemic acquired
resistance led to the suggestion that they function in a defence
mechanism. This hypothesis is supported by spraying tobacco plants with
Discussion
- 180 -
salicylic acid or acetylsalicylic acid that induces both the synthesis of PR
proteins and resistance to infection with tobacco mosaic virus (TMV).
Moreover, a tobacco hybrid that produces PR proteins constitutively is
highly resistant to TMV infection. To learn more about the functions of
PR proteins, we cloned and sequenced DNA copies of the mRNAs for
the PR-1 proteins of tobacco. This revealed a 90% amino acid sequence
homology between PR-la, -lb and -lc, and showed that PR-1 proteins are
derived from precursors by removal of a signal peptide of 30 amino
acids. This is consistent with the observation that PR proteins accumulate
in the intercellular spaces of the leaf. A 14000 mol. wt. (14K) protein of
tomato (p 14) which is induced by infection with TMV or viroids has a
60% amino acid homology with the tobacco PR-1b protein.
An
antiserum against p14 was shown to cross-react with tobacco PR-1
proteins and a PR protein from cowpea, indicating that PR proteins from
different plant species may be closely related.
Our working hypothesis has been that genes responsible for
maintaining an induced resistant state would be expressed at all in
healthy, uninduced tissue, and their expression would increase
concomitantly with the onset of SAR. We refer to genes that would fulfill
these criteria as SAR genes. To determine which of the isolated cDNAs
represented SAR genes, their expression was correlated with the onset of
SAR.
Molecular and biochemical results revealed that the mRNAs for
this gene began to accumulate after one day of treatment and reach to
high levels at 6th day. This mRNA was expressed in untreated and
treated plants but increased about two folds in treated plant. PCR
Discussion
- 181 -
approach allowed us to correlate the expression of PR-1a gene with
the early stage of ISR formation, so samples of treated tomato plants
with four biotic inducers were taken after 7 days treatment to correlate
the onset of ISR with the induction of gene expression. RT-PCR of
mRNA PR-1a gene isolated from tomato plants treated with biotic
inducers was used to amplify a fragment of about (182 bp) using
primers according to Van Loon (1999).
In the present study, PR-1a mRNA accumulation was examined
in a time course experiments during the early stage of filtrate, the
expression pattern was investigated by using PCR approach this
method which is more sensitive, allowed the examination of the
expression of PR-1a gene through the use of specific primers. PR-1a
elicited gene was molecularly detected via RT-PCR and sequenced,
then identified compared with the related genes in the Gen-Bank.
The six SAR-related gene families include pathogenesis-related
protein 1 (PR-1), (3-1,3-glucanases, chitinases, protease inhibitors,
pathogenesis-related protein 4 (PR-4) and SAR8.2. The PR-1 family
comprises at least four members that can be grouped into two classes.
Class I includes the acidic, extracellular proteins PR-la, PR-lb and PRlc. Class II includes the basic isoform of these proteins which has only
one species identified so far. The function of the PR-1 family is
currently unknown; however, a wealth of data concerning the
characterisation and localisation of the protein, as well as studies on
the PR-1 gene family and its regulation of expression, have been dealt
with in recent reviews (Wray, 1992).
Discussion
- 182 -
Many conditions have been described to induce SAR as well as
defence related proteins. Particularly, the expression of a PR-1 gene or
protein is usually taken as a molecular marker to indicate that SAR
was induced. All PR-1 genes in plants appear to be inducible by SA,
and endogenous production or exogenous application of SA has been
shown to be both necessary and sufficient to elicit the induced state.
Pathogen induced synthesis of SA in tobacco is considered to occur
from benzoate, whereas the evidence in Arabidopsis points to
isochorismate as the immediate precursor (Walter et al., 2007).
Plants are challenged by a variety of abiotic and biotic stresses.
The differential activation of distinct sets of genes or gene products in
response to these challenges is referred to as specificity. SA is a key
regulator of pathogen-induced systemic acquired resistance (SAR).
The SA involved plant defense responses are characterized as species
specific. Even in two phylogenetic closely related plant species such
as tomato and tobacco, the SA-dependent defense pathway does not
trigger the same defense responses (Peng et al., 2004).
In case of viruses, SA promotes the inhibition of viral replication,
cell-to-cell movement and also long-distance movement. SA has been
shown to modulate HR-associated cell death, reactive oxygen species
(ROS) level, activation of lipid peroxidation and generation of free
radicals, all of which could potentially influence plant defense against
pathogens. SA at low concentrations also promotes the faster and
stronger activation of callose deposition and gene expression in response
to pathogen or microbial elicitors, a process called 'priming', which
contributes to induced defense mechanisms. The increases in endogenous
Discussion
- 183 -
levels of SA either paralleled or preceded the increase in expression of
PR genes and development of SAR. Elevated levels of SA and
constitutive expression of the PR genes also correlated with elevated
resistance to TMV in a Nicotiana glutinosa x N. debneyi hybrid (Hayat
and Ahmad, 2007).
Plant responses to pathogens are a multilayer network of defence
reactions, which try to limit and eventually stop the invading microbial
pathogen. The reactions include the rapid generation of reactive oxygen
species, cross-linking of cell wall polymers, the production of
antimicrobial pathogenesis-related proteins, and low molecular weight
phytoalexins. The network of responses requires common signalling
pathways and one key compound is salicylic acid (SA). When invaded
by pathogens, resistant plants induce defence reactions both locally and
in distant organs. Of interest in this study is the regulation of gene
expression by SA and its analogues which are useful tools for elucidating
SA-signalling pathways (Eichhorn et al., 2006).
Carbohydrates and carbohydrate complexes:
Carbohydrates and carbohydrate complexes, beside other
polymers make the supported cytoskeleton of the plant cells, as well
as binding with proteins to form glycoproteins which referred to as
post-translational modification during biosynthesis of proteins.
Numerous reports have indicated that carbohydrate metabolism in
the source leaf is influenced by viral infection. Infected source leaves are
usually characterized by a decrease in the concentration of soluble sugars,
and often starch accumulation. Changes in the capacities of enzymes in
Discussion
- 184 -
various metabolic pathways have been measured during infection of
cotyledons of Cucurbita pepo L. with Cucumber mosaic virus (CMV).
CMV infection significantly altered carbohydrate metabolism, with a
sharp increase in the concentrations of soluble sugars observed in the
infected leaves. These changes were associated with a decrease in leaf
starch content. An increase in reducing sugars and a reduction in starch
content due to CMV-induced higher starch hydrolase and lower ADPGlc pyrophosphorylase activities. It has been proposed that the inhibition
of starch accumulation or starch degradation is probably due to the
increased demand for soluble sugars required to maintain the high
respiration rate (Freitas-Astúa et al., 2007).
Virus infectivity:
The first criterion to judge the occurrence of SAR in tomato
plants treated with biotic inducers. The reduction of percentage of
infection, four inducers were able to reduce number of CMV infected
tomato plants. The antiviral activity was assayed by the number of
lesions on the indicator leaf. The reduction in the number of lesions
indicated the resistance of the plant to the virus.
The obtained results showed that four biotic inducers reduce the
CMV infection at range 24.0-50.0% by percentage related to (M.
jalapa extract) (76.0%), (C. inerme extract) (60.0%), mixture extracts
(50.0%) and (kombucha filtrate) (59.2%). The same results were
obtained by many authors (Raupach et al., 1996; Zehnder et al.,
2000; Helmy and Maklad, 2002; Jetiyanon and Kloepper, 2002
and Megahed, 2008).
Discussion
- 185 -
The obtained results supports that use of botanicals can be
useful strategy to reduce the incidence of viruses. The botanicals may
induce resistance or they themselves may act as inhibitors of viral
replication. Thus, biologically active compounds present in plant
products act as elicitors and induce resistance in host plants resulting
in reduction of disease development.
Plant immunity:
In the last twenty years the plant immune system has become a
primary topic for Plant Science: inducing forms of resistance in plants
through processes of immunization, or genetically engineering a
cultivar in order to express resistance factors to a particular pathogen,
are not challenges anymore, but real scenarios for plant defense
(Stuiver and Custers, 2001).
Plants have evolved several layers of immunity that recognize
pathogen-associated molecular patterns or pathogen effector molecules
(or their altered host targets) through receptors, such as receptor kinases
containing a leucine-rich repeat domain or resistance proteins containing
a nucleotide-binding site and leucine-rich repeats. This alarm system
activates pathogen-associated molecular pattern-triggered immunity
(non-host/basal resistance) or effector-triggered immunity (resistance
gene-mediated resistance), respectively. Both forms of resistance are
associated with physiological changes in the infected cells, such as a
rapid increase in reactive oxygen species, ion fluxes, the accumulation of
salicylic acid (SA), the synthesis of anti-microbial phytoalexins and the
induction of defense-associated genes, including several families of
pathogenesis-related genes. These immune responses also are often
associated with programmed cell death at the sites of pathogen entry,
Discussion
- 186 -
which leads to the formation of necrotic lesions; this phenomenon is
known as the hypersensitive response. In addition, the uninfected
portions of the plant frequently develop SAR, which is accompanied by
increases in SA levels and heightened pathogenesis-related gene
expression. Systemic acquired resistance (SAR) in plants is a state of
heightened defense that provides long-lasting, broad spectrum resistance
to microbial pathogens and is activated systemically following a primary
infection. In many aspects, SAR resembles the immune response in
animals, which is composed of both innate and adaptive components.
The immediate, innate response is nonspecific and mediated by humoral,
chemical, and cellular barriers, whereas the adaptive immune system
involves the recognition of specific “non-self” antigens in the presence of
“self”; this allows the development of immunologi-calmemory.
However, plants lack mobile defender cells and instead rely on the innate
immunity of each cell, which can be activated in uninfected tissues by
systemic signal(s) originating from the site of infection. A number of
studies have provided important insights into the immune response
occurring in infected plant cells (Park et al., 2009).
Plants possess an immune system to defend themselves against
pathogen infection. An intensively studied inducible immune response
occurs when a pathogen carrying an avirulence (avr) gene is recognized
directly or indirectly by a cognate resistance (R) gene in the plant. This
leads to activation of defenses that restrict pathogen growth in infected
tissues and in non-infected tissues by a process referred to as systemic
acquired resistance (SAR) (Brodersen et al., 2005).
Discussion
- 187 -
SUMMARY
This study was conducted at Plant Pathology Lab. and
Greenhouses of Botany Dept., Fac. of Agric., Moshtohor, Banha Univ.
and Virology Lab., Microbiology Dept., Fac. of Agric., Ain-Shams
Univ. During 2007/2008 and 2008/2009 growing seasons, different
tomato fields at Qalyoubia Governorate were surveyed for viruses
infections.
Part I
Through, the assessment of disease incidence and severity,
Cucumber mosaic cucumovirus (CMV) was the dominant one among
the tomato viruses in the surveyed fields. Identification of isolated
virus (CMV) was achieved using host range, transmissition, stability
in sap, inclusion bodies and confirmed via Dot blot immunoassay
(DBIA). Obtained results dealing CMV confirmation was completely
agreement with the previous confidential recording. Therefore, many
experiments were successively to deducing if induction of systemic
acquired resistance against CMV was successfully achieved under
greenhouse and open field of tomatoes using four biotic inducers or
not.
Part II
The effects of four inducers (three botanical extracts and
kombucha filtrate) in induction systemic resistance (SAR) in tomato
plants against CMV were detected via study the histopathological;
biochemical [dealing antiviral proteins (protein content, qualitative
protein, activity and isozyme of peroxidase and polyphenol oxidase)];
- 188 -
Summary and Conclusions
phytochemically [salicylic acid level, chlorophyll, phenols, total
amino acids, total carbohydrate contents] changes and detection
molecular marker of PRs gene. Virus infectivity was biologically
measured (disease incidence and severity and concentration of virus).
Firstly, SAR induction was check after performed the following
experiments which summarized as:
1- Histopathological changes in tomato leaves sprayed with
biotic inducers, tissue alterations were observed as progressive
increase in lignin accumulation in epidermal cells, number of
hairs, thickness of blade, number of xylem arms and phloem
layers. The alterations included, also, tissue-shrinkage, intense
staining, and precipitation of lignin in sub stomatal cavity,
mesophyll cell showing folding and layering of cell wall and
remains of host palisade cell walls.
2- Antiviral proteins as indicate on elicitations by inducers were
assessed after 7 days from spraying via protein content,
patterns, activities which markedly increased in treated tomato
plants than non-treated ones. In this concern, kombucha
filtrate was superior, but mixture extracts was the lowest
compared with healthy control. After 25 days from spraying
with inducers and inoculated with CMV, also plants treated
with kombucha filtrate produced the highest values of
proteins, while lowest produced as response to C. inerme
extract compared with healthy ones. Electrophoretic for
proteins using SDS-PAGE showed new protein bands with
- 189 -
3-
molecular weight previously known for antiviral proteins
were elicited by M. jalapa, C. inerme extracts and kombucha
filtrate. Peroxidase (POD) were markedly increased as result
to mixture extracts treatment, while polyphenol oxidase (PPO)
increased as result to M. jalapa extract treatment when tomato
plants were sprayed with inducers post-inoculation with CMV.
Kombucha filtrate elicited peroxidase isozyme in tomato noninoculated with CMV, followed by the mixture extracts, while
post-inoculation M. jalapa extract was induced highest
activity of POD and lowest increase caused by C. inerme
extract. Polyphenol oxidase isozyme was highly activated with
M. jalapa extract, followed by C. inerme extract, then the
mixture of them.
4- Total salicylic acid was quantitatively determined in the
tomato plant sprayed with bioelicitors pre-inoculated with
CMV. SA was increased in the treated plants than non-treated,
and HPLC showed high levels of SA were elicited via
kombucha filtrate, followed by C. inerme, M. jalapa, and the
mixture extracts.
5- Photosynthetic pigments content (as Chlorophyll a, b plus
carotenoids) were reduced, generally in infected plants than
healthy ones. But, when tomato treated with the tested
elicitors pre-inoculation, Chl a, Chl b and carotenoids were
increased as result to spraying with M. jalapa, C. inerme,
mixture extracts and kombucha filtrate. The same trend was
- 190 -
observed when inoculated plants were treated with the same
order of elicitors.
6- Phenols contents, was increased in the non-inoculated plants
and treated with biotic inducers. The highest increase of total,
free and conjugate phenols were induced by M. jalapa extract
and kombucha filtrate, while lowest increase were recorded by
C. inerme and mixture extracts compared with control. Postinoculation, all phenol contents were increased as response to
treatments with M. jalapa, mixture extracts, kombucha filtrate
and C. inerme, respectively.
7- Total RNA values (µg/g) were high in the non-inoculated but
treated tomato leaves with kombucha filtrate, M. jalapa
extract, followed by C. inerme extract then mixture extracts.
8- Molecular marker for SAR detection was achieved using RT-
PCR to amplify of the PR-1a gene which elicited with
bioinducers in the tomato plants pre-inoculated. PR-1a gene
was isolated and molecularly sequenced and identified
compared with the related genes in the Gen-Bank.
9- Virus infectivity was determined to insure that systemic
acquired resistance is achieved. Reduction in the disease
severity percentage was recorded as result to spraying tomato
plants with bioelicitors (M. jalapa extract, followed by C.
inerme extract, kombucha filtrate then mixture extracts) then
inoculated with CMV. Also, concentration of the virus was
biologically assayed as means of local lesions.
- 191 -
Secondly, after insure that the tested inducers were elicited
systemic acquired resistance against CMV in tomato plants under
greenhouse conditions, another experiments were performed using the
tested elicitors as biocontrol agents spraying on inoculated plants and
results were summarized as:
1- Histopathological changes as response to SAR induction was
examined in the inoculated tomato leaves and sprayed with
bioelicitors using light microscope. Generally, noticed that
treated plants were stronger in their growth than non-treated
plants as result to the increase in lignin precipitation,
numbers of xylem arms, phloem layers, skin hairs and
increasing thickness of cell wall, and blade. Infected plants
showed plasmolysis in the mesophyll cells, cell walls collapsed
and plastids become deformed and swollen a loss of orientation
along the inner cell wall. These alterations were intensified
with progressive tissue-shrinkage and desiccation causing the
walls of the palisade and spongy parenchyma to fold in a
layering fashion as well as reduction in vascular bundles.
2- Antiviral proteins as one of the protein contents and product
of induction process were increased in the inoculated plants
especially when sprayed with kombucha filtrate, while lowest
increase due to mixture extracts. After 7 days of spraying,
protein bands via variability analysis appeared 12 protein
bands, 11 in tomato plants treated with M. jalapa extract, 10 by
C. inerme extract and 8 for both mixture extracts and kombucha
filtrate, while non-treated and infected plants gave only 4 and 7
- 192 -
protein fractions. Meanwhile, after 25 days proteins content and
enzymes activity were markedly increased as result to
spraying with M. jalapa extract, lowest increase via C. inerme
extract compared to control. Variability analysis appeared 8
protein bands, 7 in mixture extracts, 6 in C. inerme extract,
and 5 in both M. jalapa extract and kombucha filtrate
treatments. Highest peroxidase and its isozyme activities was
induced by M. jalapa extract, and lowest by C. inerme extract
after 7 days of spraying. After 25 days, kombucha filtrate
induced highest peroxidase activity, followed by M. jalapa
extract, mixture extract then C. inerme extract. Peroxidase
isozyme activity was arranged as treatments of M. jalapa, C.
inerme, mixture extracts and kombucha filtrate, while
polyphenole oxidase isozyme was highest activity in
kombucha filtrate treatment, followed by M. jalapa extract,
then lowest increase with other treatments. After 7 days,
polyphenole oxidase activity was similar to peroxidase
isozyme, while after 25 days polyphenole oxidase isozyme
was highest activity in M. jalapa extract treatment, followed
by kombucha filtrate, mixture extracts, but decreased in C.
inerme than control.
Variability analysis of polyphenole
oxidase isozyme showed 5, 3, 5 and 4 polypeptide bands of M.
jalapa, C. inerme, the mixture extracts and kombucha filtrate,
respectively. The result after 7 and 25 days, highest level of
protein genetic markers induced by M. jalapa extract
followed by C. inerme and mixture extracts, while
- 193 -
kombucha filtrate induced low level of protein genetic
markers.
3- Photosynthetic pigments content (as Chlorophyll a, b plus
carotenoids) were reduced, generally in infected plants than
healthy ones. But, when tomato treated with the tested
elicitors pre-inoculation, Chl a, Chl b and carotenoids were
increased as result to spraying with M. jalapa, C. inerme,
mixture extracts and kombucha filtrate. The same trend was
observed when inoculated plants were treated with the same
order of elicitors.
4- Total phenols, was increased in the non-inoculated plants and
treated with biotic inducers. The highest increase of total, free
and conjugate phenols were induced by M. jalapa extract and
kombucha filtrate, while lowest increase were recorded by C.
inerme and mixture extracts compared with control.
Post-
inoculation, all phenol contents were increased as response to
treatments with M. jalapa, mixture extracts, kombucha filtrate
and C. inerme, respectively.
5- Total free amino acids content were determined in inoculated
tomato leaves then sprayed with bioagents. After 7 days from
spraying, M. jalapa extract and kombucha filtrate recorded the
highest amount of total amino acids, followed by mixture and
C. inerme extracts. While, after 25 days from spraying, M.
jalapa extract and kombucha filtrate produced the highest
amount of total amino acids, followed by C. inerme and
mixture extracts compared with control.
- 194 -
6- Total carbohydrate content was increased after 7 days from
spraying inoculated tomato leaves with kombucha filtrate and
M. jalapa extract, followed by mixture and C. inerme extracts.
After 25 days, M. jalapa and C. inerme extracts produced the
highest increase in total carbohydrates content, followed by
mixture extracts and kombucha filtrate compared with control.
7- Virus infectivity was determined as indicator of control.
Reduction in the disease severity percentage was recorded as
result to spraying tomato plants with M. jalapa extract,
followed by C. inerme extract, kombucha filtrate then mixture
extracts compared with control. Also, concentration of the
virus was biologically assayed as means of local lesions.
Highest inhibition of virus infectivity due to M. jalapa extract,
kombucha filtrate, mixture extracts and C. inerme extract
compared with control.
- 195 -
CONCLUSIONS
The objectives of this study were isolation and identification of the
most frequently and economically viruses causing serious losses in
tomato crop in the different location of Qalyoubia Governorate,
evaluating some medicinal plant extracts and kombucha filtrate as biotic
inducers to induction systemic acquired resistance in the tomato plants
against CMV and using more effective bioinducers as bioelicitors for
control viruses infection via induction 'pathogenesis-related' (PR-1a)
genes.
Target virus was chosen according to its more frequently and
severity among the isolated viruses in these locations at the winter season
from the study year. Isolated virus was confirmed biologically and
serologically assays. Extracts of two medicinal plants (Clerodendrum
inerme L. Gaertn and Mirabilis jalapa L.) and were individually or in
mixture in addition to kombucha filtrate were evaluated as bioinducers.
All the four inducers were successfully in the induction of systemic
acquire resistance (SAR) in the uninoculated tomato plants and sprayed
with (50% v/v) of inducers.
Tested bioinducers were used as biocontrol to inhibiting the virus
infection of tomato plants as spraying every 15 days under greenhouse
conditions. Pathogenesis-related (PR-1a) gene was molecularly isolated
and identified via sequencer which compared with those recorded in the
Gen-Bank.
In conclusion, using medicinal extracts and other natural inducers
were promise with good systemic acquired resistance against the great
numbers of plant pathogens. In future, induction of resistance can be
done cheaply and easily using natural substances.
- 196 -
RECOMMENDATIONS
This study can be recommended, for obtained healthy tomato
plants and reduced crop losses, with the following:
1- Periodicity explore the tomato plants from sowing date until
harvested and eliminate any plants exhibited virus-like
symptoms and burn them.
2- Surrounded the small cultivated area (for seed production or
breeding program searches) with enclosure of Mirabilis
jalapa L. plants as an embellishment plant which release
volatile substances work as antifeedant for numbers of pest
insects (as virus vectors).
3- Soak the root system of tomato seedlings in the 50% of the
following inducers, and spraying tomato plants every 15
days with 50% of water extracts of both Clerodendrum
inerme and Mirabilis jalapa or their mixture, or kombucha
filtrate from transplanting date to harvest.
- 197 -
REFERENCES
Abd El-Kader, M.A.M. (1983): Studies on certain diseases of
soybean. Ph.D. Thesis, Fac. of Agric. Assiut Univ.
Abdul Magid, A. (1990): Studies on the host range and transmission
of an isolate of Cucumber Mosaic Virus. East African
Agricultural and Forestry Journal, 56, No 1-4.
Abo EI-Nasr, M.A.; El-Dougdoug, Kh.A.; El-Kattan, M.H. and
Salem, E.A. (2004): Induction of salicylic acid in cucumber
against ZYMV potyvirus by some nutrient chemicals. Egyptian.
J. Virol., 1:301-312.
Abu-Jawdah, Y. (1982): Changes in the soluble protein patterns of
bean leaves upon fungal or viral infections after chemical injury.
Phytopathologia meditterranea, 103: 272-279.
Ahmad, G.A. (2004): Using plant extracts to control powdery mildew
disease that attack cucumber plants under protected houses. M. Sc.
Fac. of Agric., Moshtohor. Zagazig Univ., Benha Branch 170pp.
Akhtar, K.P.; Ryu, K.H.; Saleem, M.Y.; Asghsr, M.; Jamil, F.F.;
Haq, M.A. and Khan, I.A. (2008): Occurrence of Cucumber
mosaic virus subgroup IA in tomato in Pakistan. Journal of Plant
Disease and Protection, 115(1): 2-3.
Ali, A. and Kobayashi, M. (2010): Seed transmission of Cucumber
mosaic virus in pepper. J. of Virology Methods, 163: 234-237.
Ali, S.H.; Eisa, S.S. and El-Dougdoug, Kh. (2006): Role of reactive
oxygen species and anti-oxidants in hypersensitive local virusinfected plants. J. Agric. Sci. Mansoura Univ. 31(11): 6465-6480.
Antoniw, J.F. and Pierpoint, W.S. (1978): Purification of tobacco
leaf protein associated with resistance to virus infection.
Biochemical Society Transactions, 6: 248-250.
198
References
Araf, Rasha, M. (2008): Molecular genetic studies on biotic
induction of plant resistance to Cucumber mosaic virus. M.Sc.
Thesis, Fac. Agric., Ain Shams University, Cairo, Egypt, 129p.
Aramburu, J.; Galipienso, L. and Lopez, C. (2007): Reappearance
of Cucumber mosaic virus isolates belonging to subgroup IB in
tomato plants in North-eastern Spain. Journal of Phytopathology,
155(9): 513-518.
Avdiushko, S.A.; Ye, X.S. and Kuc, J. (1993): Detection of several
enzymatic activities in leaf prints of cucumber plants.
Physiological and Molecular Plant Pathology, 42:441-454.
Aydemir, T. (2004): Partial purification and characterization of
polyphenol oxidase from artichoke (Cynara scolymus L.) heads.
Food Chemistry, 87: 59-67.
Balachandran, S.; Hurry, V.M.; Kelley, S.E.; Osmond, C.B.;
Robinson, S.A.; Rohozinski, J.; Seaton, G.G.R. and Sims,
D.A. (1997): Concepts of plant biotic stress: Some insights into
the stress physiology of virus-infected plant from the perspective
of photosynthesis. Physiologia plantarum, 100:203-213.
Balogun, O.S. and Daudu, A.K. (2007): Comparative pathogenic
responses of some tomato accessions to Cucumber mosaic virus.
Research on Crops, 8(3): 689-694.
Bansal, R.D.; Sharma, O.P.; Kaul, V.K. and Cheema, S.S. (1992):
Histopathological changes induced in Cucurbita pepo infected
with Cucumber mosaic virus. Indian Journal of Virology, 8(2):
111-114.
Barbosa, C.D.J.; Cumani, L.A.L.; Roes, B.; Olivereira, R.P. and
Silva, K.M.D (1998): Cucumber mosaic virus identification on
banana plants in the north of Parana state. Revista Brasiliara de
Fruicultura, 20(1): 112-114. (English abstract).
References
199
Bestwick, C.S.; Brown, I.R. and Mansfield, J.W. (1998): Localized
changes in peroxidase activity accompany hydrogen peroxidase
generation during the development of a non host hypersensitive
reaction in lettuce. Plant Physiology, 118: 1068-1078.
Betsy, P. and Sonford, H. (1996): Kombucha Phenomenon. The
Miracle Health tea how to safely make and use kombucha. 2nd ed
sierra sunrise Publishing Inc.
Bollard, E.G. and Mathews, R.E.F. (1966): The physiology of
parasitic diseases. In F.C. steward (Ed) plant physiology 4(b)
Acad. Pres, New York, 599p.
Bradford, M.M. (1976): A rapid and sensitive method for
quantification of microgram quantities of protein utilizing the
principal of protein dye binding. Anal. Biochem., 72:248-254.
Brakk, M.K.; White, J.L.; Sawsan, R.G. and Johi (1986):
Chlorophyll, chloroplast and ribosomal RNA are reduced by
Barley strip mosaic virus systemic infection, Phyto, 78: 670-674.
Brodersen P.; Malinovsky, F.G.; Hématy, K.; Newman, M.A. and
Mundy, J. (2005): The role of salicylic acid in the induction of cell
death in Arabidopsis acd11. Plant Physiology, 138: 1037–1045.
Campa, A. (1991): Biological roles of plant peroxidases; known and
potential function, in: J. evrse, M.B. Grisham (eds.), PeroxiBoca Raton, pp. 25-50.
Cao, H.; Glazebrook, J.; Clarke, J.; Volko, S. and Dong, X.N.
(1997): The Arabidopsis NPRI gene that controls systemic
acquired resistance encodes a novel protein containing ankyrin
repeats. Cell, 88: 57-63.
Cao, H.; Li, X. and Dong, X.N. (1998): Generation of broad
spectrum disease resistance by over expression of an essential
regulatory gene in systemic acquired resistance. Proc.NAT.
Acad. SCI. USA, 95:6531-6536.
200
References
Carbone, D. and Kalaljev, A. (1932): Ricercha sulla vaccinaxione
della plante. Phtopathologia mediterranea, 5: 91-98.
Cardin, L. and Moury, B. (2007): First report of Cucumber mosaic
virus in Echium candicans in France. Plant Disease, 91(11):
1516.
Chabbouh, N. and Cherif, C. (1990): Cucumber mosaic virus in
artichoke. FAO Plant Prot. Bull., 38:52-53.
Chakraboty, S.; Singa, A. and Reddy, B.V. (1994): Effect of
cucurbit mosaic viruses on chlorophyll and total phenol content
of cucurbits. Crop Research (Hisar), 7(3): 461-465.
Chaturvedi, R. and Shah, J. (2007): Salicylic Acid in Plant Disease
Resistance. Book of Salicylic Acid: A Plant Hormone, pp 335370.
Chaumpluk, P.; Saski, Y.; Saitoh, A.; Koiwa, H.; Hikichi, Y. and
Suzuki, A. (1994): Comparison of two isolates of cucumber
mosaic virus (CMV) from gentian plant in Iwate Prefecture. Ann.
of the Society of Plant Protection of North Japan, 45: 88-92.
Chen, C. and Liu, B.Y. (2000): Changes in major components of tea
fungus metabolites during prolonged fermentation. Journal of
Applied Microbiology, 89(5): 834-839.
Chen, C.C. and Hu, C.C. (1999): Purification and characterization of
cucumovirus from Lisianthus rusellianus. Plant Protection
Bulletin Taipei, 14(3): 179-198.
Chen, M.; Qiu, D.W.; Liu, Z.; Yang, X.F. and Cao, K.Q. (2006):
Inhibition of RNA replication and coat protein synthesis in
Tobacco mosaic virus by a plant activator protein. Chinese
Journal of Biological Control, 22 (1): 63-66. (English abstract).
Chessin, M.; Deborde, D. and Zipf, A. (1995): Antiviral proteins in
high plants. CRC press, Boca Raton, Ann Arbor, London,
Tokyo, 180 P.
References
201
Chester, K. (1933): The problem of acquired physiological immunity
in plants. Quart. Rev. Biol. 8: 129-151.
Chittoor, J.M.; Leach, J.E. and White, F.F. (1999): Induction of
peroxidase during defense against pathogens. In: Pathogenesis:
Related proteins in plants, 291 p. S.K. Datta, S. Muthukrishnan
(eds.), CRC Press, Boca Raton, FL
Choudhary, D.K. ; Prakash, A. and Johri, B.N. (2007): Induced
systemic resistance (ISR) in plants: mechanism of action. Indian
Journal of Microbiology. 47 (4): 289-297.
Clark, M.F. and Adams, A.N. (1977): Characteristics of the
microplate method of enzyme-linked immunosorbent assay for
the detection of plant viruses. J. of Gen. Virology, 34: 475-483.
Coseteng, M.Y. and Lee, C.Y. (1978): Changes in apple polyphenol
oxidase and polyphenol concentrations in relation to degree of
browning. Journal of Food Science. 52: 985.
Davino, S.; Bellardi, M.G.; Bella, M.D.; Davino, M. and
Bertaccini, A. (2005): Characterization of a Cucumber mosaic
virus isolate infecting Mandevilla sanderi (Hemsl.) Woodson.
Phytopathologia Mediterranea, 44: 220-225.
Dean, R.A. and Kuc, J. (1986a): Induced systemic protection in
cucumber: the source of the signal. Physiol. Mol. Plant Pathol.,
28: 227-233.
Dean, R.A., and Kuc, J. (1986b): Induced systemic protection in
cucumber: time of production and movement of the signal.
Phytopathology, 76: 966-970.
Delancy, T.; Uknes, S.; Vernoij, B.; Friedrich, L.; Weymann, K.;
Negrotto, D.; Gaffney, T.; Gut-Rella, T.; Kessmann, M.;
Ward, H. and Ryals, J. (1994): A central role of salicylic acid
in plant disease resistance. Science, 266: 1247-1250.
202
References
Deng, C.; Zhang, X.; Zhang, J.; Qian, J. and Zhu, W. (2003):
Rapid Determination of Salicylic Acid in Plant Materials by Gas
Chromatography–Mass Spectrometry. Journal Chromatographia,
58(3-4): 225-229.
Devi, P.R.; Doraiswamy, S.; Nakkeeran, S.; Rabindran, R.;
Ganapathy, T.; Ramiah, M. and Mathiyazhagan, S. (2004):
Antiviral action of Harpulia Cupanioides and Mirabilis Jalapa
against tomato spotted wilt virus. Archives of Phytopathology
and Plant Protection, 37(4): 245-259.
Dheepa, R. and Paranjothi, S. (2010): Transmission of Cucumber
Mosaic Virus (CMV) infecting banana by aphid and mechanical
methods. Emir. J. Food Agric., 22 (2): 117-129.
Dipti, P.; Yogesh, B.; Kain, A.K.; Pauline, T.; Anju, B.; Sairam,
M.; Singh, B.; Mongia, S.S.; Kumar, G.I. and Selvamurthy,
W. (2003): Lead induced oxidative stress: beneficial effects of
Kombucha tea. Biomed Environ Sci., 16(3):276-82.
Dixon, R.A. (1986): The phytoalexin response: Elicitation, signaling,
and control of host gene expression. Biol. Can. Philos. Soc. 61:
239-292.
Doebley, J. (1989): Isozymic evidence and the evolution of crop
plants, In: Isozymes in Plant Biology, D. Soltis, and P. Soltis,
eds. (Portland, Oregon: Dioscorides Press), pp. 165-191.
Dong, H. and Beer, S.V. (2000): Riboflavin induces disease
resistance in plants by activating a novel signal transduction
pathway. Phytopathology, 90(8): 801-811.
Dubey, G.S. and Bhardwaj, S.V. (1982): Histopathological studies
in tomato infected with TMV. Indian Phtopathology, 35(1): 175.
Dutta, D. and Gachhui, R. (2007): Nitrogen-fixing and celluloseproducing Gluconacetobacter kombuchae sp. nov., isolated from
References
203
Kombucha tea. International Journal of Systematic and
Evolutionary Microbiology, 57, 353–357.
Effmert, U.; Große, J.; Röse, U.S.R.; Ehrig, F.; Kägi, R. and
Piechulla, B. (2005): Volatile composition, emission pattern,
and localization of floral scent emission in Mirabilis jalapa
(Nyctaginaceae). American Journal of Botany, 92(1): 2–12.
Eichhorn, H.; Klinghammer, M.; Becht, P. and Tenhaken, R. (2006):
Isolation of a novel ABC-transporter gene from soybean induced
by salicylic acid. Journal of Experimental Botany, 57, (10): 2193–
2201.
Eid, S.A.; Kishtah, A.A. and Abu-Zeid, A.A. (1984): Nicotiana
gluaca L., a natural host for cucumber mosaic virus. Agric. Res.
Rev. 62: 367-378.
Eisa, Nawal A.; El-Fiki, A.I.I.; Mohamed, F.G. and El-Habbak,
M.H. (2006): Biochemical changes in squash leaves sprayed
with some chemicals for inducing resistance to powdery mildew.
The 2nd Conf. On farm Integrated Pest Management 2006,
Fayoum, Egypt., pp. 211-222.
El-Afifi, Sohir, L; EI-BoroIIosy, A.M. and Mahmoud, S.Y.M.
(2007): Tobacco callus culture as a propagating medium for
Cucumber mosaic cucumovirus. Intern. J. Virology, 3(2): 73-79.
El-Baz, Reham, M. (2004): Physicochemical, physiological and
histopathological studies on cucumber mosaic virus. M.Sc.
Thesis. Fac. of Sci. Helwan Univ., Cairo, Egypt, 192 p.
El-Dougdoug, Kh.A.; El-Deeb, S.H. and Abou-Zeid, A.A. (1993):
Anatomical and ultra-structural changes in orange leaves
infected with Citrus exocortis viroid (CEVd). Annals
Agriculture Science. Ain Shams University, 38 (1): 101-117.
Elshafie, E.; Daffalla, G.; Gebre, K. and Marchoux, G. (2005):
Mosaic -Inducing Viruses And Virus Like- Agents Infecting
204
References
Tomato And Pepper In Sudan. International Journal of Virology,
1(1): 28-28.
El-Shamy, M.M. (1987): Studies on a virus naturally infecting plants
of economic importance to Egypt. M.Sc. Thesis Faculty of
Science, Menoufia University, Egypt, 173p.
El-Shamy, M.M; Sayed, E.T.A. and Soweiha, H.E. (2000): Light
microscopic anatomical studies of tomato leaves infected with a
new yellow severe strain of Tobacco mosaic virus. Bulletin
Faculty of Science, Assiut University, Egypt, 173p.
Endo, Y.; Tsurugi, K. and Lambert, J.M. (1988): The site of action
of six different ribosome-inactivation proteins from plants in
eukaryotic ribosomes: the RNA N-glycosidase activity of the
proteins. Biochemistry Biophysics Research of Community,
150: 1032-1039.
Enyedi, A.J.; Yalpani, N.; Silverman, P. and Raskin, I. (1992):
Localization, conjugation and function of salicylic acid in
tobacco during the hypersensitive reaction to tobacco mosaic
virus. Proc. Natl. Acad. Sci. USA, 89: 2480-2484.
Eskarous, J.K.; Sayed, E.T. and El-Shamy, M.M. (1991):
Histopathology of tomato root, stem and leaf infected with a heat
resistant strain of TMV. Mansura Science Bulletin, 18(2): 219.
Espinha, L.M. and Caspar, J.O. (1997): Partial chracterrization of
cucumber mosaic virus isolated from Catharanthus roseus.
Fitopatologia Brasileira, 22(2): 209-212.
Faccioli, G.; Forni, M. and Bizzi, L. (1994): Further characteristics
of antiviral factors (AVF) produced by virus-infected plants.
Phytopathologia Mediterranea, 33(1): 17-26.
Fakhourin, W.D.; Neemann, M.; Walker, F. and Buchenauer, H.
(2004): Application of fluorescent pseudomonads in combination
with acibenzolar-S-methyl induces disease resistance in tomato and
References
205
tobacco. Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz,
111(5): 494-505. (English abstract).
FAO (2010): FAOSTAT statistical database. Rome (available at
http://faostat.fao.org).
Farouk, S.; Ghoneem, K.M. and Abeer A. Ali (2008): Induction and
expression of systemic resistance to downy mildew disease in
cucumber by elicitors. Egypt. J. Phytopathol., 36(1-2): 95-111.
Fawzy, R.N.; Mahdy, A.M.M. and El-Mageed, A.M.H. (1992):
Identification of a strain of cucumber mosaic virus isolated from
naturally infected Philodendron selloum. Annals of Agric. Sci.,
Moshtohor, 30(3): 1219-1232.
Food and Drug Administration (1995): FDA cautions consumers on
"Kombucha Mushroom Tea" {News release}. Washington, DC:
US Department of Health and Human Services, Public Health
Service, Food and Drug Administration, March 23, 1995.
Fraser, L. and Matthews, R.E.F. (1979): Specific pathways of
cytological change in individual Chinese cabbage protoplasts
infected with Turnip yellow mosaic virus. Journal of General
Virology, 45: 623-630.
Fraser, R.S.S. (1981): Evidence for the occurrence of the
pathogenesis related proteins in leaves of healthy tobacco plants
during flowering. Physiology Plant Pathology, 19:69-76.
Freeman, A. and Horsham, M.A. (2006): Temperate Pulse Viruses:
Cucumber Mosaic Virus (CMV). Information notes No. AG1207,
http://new.dpi.vic.gov.au/agriculture/pests-diseases-and-weeds/plantdiseases/grains-cereals/general-vegetable-diseases/ag1207-temperatepulse-viruses-cucumber-mosaic-virus-cmv
Freitas-Astúa, J.; Bastianel, M.; Locali-Fabris, E.C.; Novelli,
V.M.; Silva-Pinhati, A.C.; Basílio-Palmieri, A.C.; Targon,
M.L.P.N. and Machado, M.A. (2007): Differentially expressed
206
References
stress-related genes in the compatible citrus-Citrus leprosis virus
interaction. Genetics and Molecular Biology, 30 (3 suppl.): 980990.
Fukumoto, F.; Masuda, Y. and Hnada, K. (2003): Pea tissue
necrosis induce by Cucumber mosaic virus alone or together
with watermelon mosaic virus. Plant Disease, 87(4): 324-328.
Gaffney, T.; Friedrich, L.; Vernooij, B.; Negrotto, D.; Nye, G.;
Uknes, S.; Ward, E.; Kessmann, H. and Ryals, J. (1993):
Requirement of salicylic acid for the induction of systemic
acquired resistance. Science, 261: 754-756.
Galal, A.M.M. (1989): Antiviral against local and systemic viral
infection of Phaseolus vulgaris. Ph.D. Thesis. Faculty of
Science. Zagazig University, Zagazig, Egypt, 333p.
Galal, A.M.M. (2006): Induction of systemic acquired resistance in
cucumber plant against Cucumber mosaic cucumovirus by local
Streptomyces strains. Plant Pathology Journal Faisalabad, 5(3):
343-349.
Ganoo, S. and Saumtally, S. (1999). Incidence of virus diseases in
tomato. In: Lalouette, J. A., Bachraz, D. Y.; Sakurdeep, N. (eds).
Proceedings of the 3rd Annual Meeting of Agricultural Scientists,
Réduit, Mauritius, 17-18 November 1998. AMAS 1998. Food and
Agricultural Research Council, Réduit, Mauritius.
Ghazi, A.M. (1976): Comparative biochemical studies on plant
peroxidases. Ph.D. Thesis. Fac. of Sci., Al-Azhar Univ., Cairo,
Egypt. 224 p.
Gianinazzi, S.; Martin, C. and Valle, J.C. (1970): Hypersenstivity
to viruses, temperature and solable proteins in Nicotiana xanthi
n.c. Appearance of new macromolecules at the repression of
viral synthesis. Comptes Rendus Acad. Sci. Ser. Paris, 270:
2382-2386. (English abstract).
References
207
Gildow, F.E.; Shah, D.A.; Sackett, W.M.; Butzler, T.; Nault, B.A.
and Fleischer, S.J. (2008): Transmission efficiency of
Cucumber mosaic virus by aphids associated with virus
epidemics in snap bean. Phytopathology, 98(11):1233-41.
Gilpatrick, J.D. and Weintraub, M. (1952): An usual type of
protection with the carnation mosaic virus. Science, 115: 701-702.
Goodman, R.N.; Kiraly, Z. and Wood, K.R. (1986): The
biochemistry and physiology of plant disease, University of
Missouri Press. Columbia, 295P.
Grüner, R. and Pfitzner, U.M. (1994): The upstream region of the gene
for the pathogenesis-related protein 1a from tobacco responds to
environmental as well as to developmental signals in transgenic
plants. European Journal of Biochemistry, 220: 247-255.
Hafez, M.A. (2008): Pre-harvest application of Kombucha filtrate to
control postharvest bunch rot of table grapes. Annals of Agric.
Sci., Moshtohor, 46(2):23-34.
Hammerschmidt, R. (1999): Induced disease resistance: how do
induced plants stop pathogens? Physiological and Molecular
Plant Pathology, 55 (2): 7-84.
Hammerschmidt, R. (2009): Chapter 5 Systemic Acquired
Resistance. Advances in Botanical Research, 51, 173-222.
Hammerschmidt, R.; Nuckles, E.M. and Kuc, J. (1982):
Association of enhanced peroxidase activity with induced
systemic resistance of cucumber to Colletotrichum lagenarium.
Physiol. Plant Pathol., 20: 73-82.
Harish, S.; Kavino, M.; Kumar, N.; Balasubramanian, P. and
Samiyappan, R. (2009): Induction of defense-related proteins
by mixtures of plant growth promoting endophytic bacteria
against Banana bunchy top virus. Biological Control, 51:16–25.
208
References
Hayat, S. and Ahmad, A. (2007): Salicylic Acid: A Plant Hormone. 1st
Ed. Published by Springer, Dordrecht, The Netherlands, 401pp.
Hellwald, K.H.; Zimmermann, C. and Buchenauer, H. (2000):
RNA 2 of Cucumber Mosaic Virus Subgroup I Strain NT-CMV
is Involved in the Induction of Severe Symptoms in Tomato.
European Journal of Plant Pathology, 106(1): 95-99.
Helmy, Yomna, I. and Maklad, F.M. (2002): Induced systemic
resistance in cucumber plants under plastic houses against
cucumber mosaic virus using biotic inducers. Egypt. J. Hort., 29(1):
1-16.
Hersanti, C. (2005): The Analysis of peroxidase activity and salicylic
acid content of resistant red chilli plant to Cucumber mosaic
virus (CMV) induced by crude extract of leaf Mirabilis jalapa.
Indonesian Journal of Plant Protection, XI:1
Hooft Van Huijsduijnen, R.A.M.; Alblas, S.W.; De Rijk, R.H. and
Bol, J.F. (1986): Induction by salicylic acid of pathogenesis-related
proteins and resistance to Alfalfa mosaic virus infection in various
plant species. J. Gen. Virol., 67: 2135-2143.
Hopper, D.G.; Venere, R.J.; Brinkerhoff, L.A. and Ghoslson, R.K.
(1975): Necrosis induction in cotton. Phytopathology, 65: 206213.
Hou, L.; Li, C.; Liu, Y.; Cai, Z.; Fei, J.; Hou, Y. and Cai, Z.N.
(1998): Effects of antiviral agents to interaction of TMV with
tobacco chloroplast. Plant Protection, 24: (2): 10-13.
Huang, W.E.; Huang, L.F.; Preston, G.M.; Naylor, M.; Carr, J.P.;
Li, Y.H.; Singer, A.C.; Whiteley, A.S. and Wang, H. (2006):
Quantitative in situ assay of salicylic acid in tobacco leaves
using a genetically modified biosensor strain of Acinetobacter
sp. ADP1. Plant J., 46(6): 1073-1083.
References
209
Hubert, J.J. and Helton, A.W. (1967): A translocatable-resistance
phenomenon in Prunus domesticu induced by initial infection
with Cytospora cineta. Phytopathology, 57: 1094-1098.
Hudgson, R.A.; Beachy, R.N. and Pakrasi, H.B. (1989): A selective
inhibition of photosystem II in spanich by Tobacco mosaic virus:
An effect of the viral coat protein. Febsett, 245(2):267-270.
ICTVdB (2010): Index of Viruses – Bromoviridae. The ICTVdB virus
code 00.010.0.04. Cucumovirus, In: ICTVdB - The Universal Virus
Database of the International Committee on Taxonomy of Viruses
version 4. Büchen-Osmond, C (Ed), Columbia University, New
York, USA.http://www.ncbi.nlm.nih.gov/ICTVdb/Ictv/fs_index.htm
Jayabalan, R.; Marimuthu, S. and Swaminathan, K. (2007):
Changes in content of organic acids and tea polyphenols during
kombucha tea fermentation. Food Chemistry, 102(1): 392-398.
Jetiyanon, K. and J.W. Kloepper (2002). Mixtures of plant growthpromoting rhizobacteria for induction of systemic resistance
against multiple plant diseases. Biological Control, 24: 285-291.
Jetiyanon, K.; Fowler, W.D. and Kleopper, J.W. (2003): Broadspectrum protection against several pathogens by PGPR
mixtures under field conditions in Thailand. Plant Disease,
87(11): 1390-1394.
Kahler, A.L. and Allard, R.W. (1981): Worldwide patterns of
genetics variation among four esterase loci in barely (Hordeum).
Journal of TAG Theoretical and Applied Genetics, 59: 101-111.
Kalim, S.; Luthra, Y.P. and Gandhi, S.K. (1999): Copper induced
effect on biochemical constituents in cowpea suscebtible to
Rhizoctonia species. Acta Phytopathologica et Entomologica
Hungarica, 34(3): 199-210.
210
References
Kassanis, B. and Kleozkowski, A. (1948): The isolation and some
properties of a virus-inhibiting protein from Phytolacca
esculenta. Journal of Genetics Microbiology, 2: 143-147.
Kauss, H. (1987): Some aspects of calcium-dependent regulation in
plant metabolism. Annu. Rev. Plant Physiol., 38: 47-72.
Kavino, M.; Harish, S.; Kumar, N.; Saravanakumar, D. and
Samiyappan, R. (2008): Induction of systemic resistance in
banana (Musa spp.) against Banana bunchy top virus (BBTV) by
combining chitin with root-colonizing Pseudomonas fluorescens
strain CHA0. European Journal of Plant Pathology, 120 (4): 353362.
Kawamura, S.; Tada, M. and Narsaki, T. (1966): Sugar of
cotyledon, hull and hypocotyls of soybean. J. Jap. Soc. Food and
Nutr., 19: 268.
Kessman, H.; Staub, T.; Hofmann, C.; Maetzke, T.; Herzog, J.;
Ward, E.; Uknes, S. and Rvals, J. (1994): Induction of
systemic acquired disease resistance in plants by chemicals.
Annu. Rev. Phytopathol., 32: 439-459.
Khalil, E.M.; Hassan, El.Sh. and Bekhit, R.S. (1985): Reaction of
selected pepper cultivars to mosaic virus diseases under Egypt
conditions. The 1st Nat. Conf. of Pests and Dis. of Veg. and Field
Crops in Egypt. Ismailia, Egypt.
Kiranmai, G.; Sreenivasulu, P. and Nayudu, M.V. (1997):
Characterization of cucumber mosaic cucumovirus isolates
naturally infecting three solanaceous vegatible crops in Andhra
Prodesh. Indian Phytopathology, 50(3): 416-425.
Kogel, K.H.; Beckhove, U.; Dreschers, J.; Munch, S. and Romme, Y.
(1994): Acquired resistance in barley (The resistance mechanism
induced by 2,6-Dichloroisonicotinic acid is a phenocopy of a
References
211
genetically based mechanism governing race- specific powedery
mildew resistance). Plant Physiol., 106(4): 1269-1277.
Köhler, Valentin and Köhler, J. (1985): Glucuronic acid as an ecological aid.
In the Book: Sofotheilung des Waldes, Vol.1, 2nd Edt. (H. Kaegelmann
ed.), Windecke-Rosbach (in German)
Kubo, S.; Ikeda, T.; Imaizumi, S.; Takanami, Y. and Mikami, Y.
(1990): A potent plant virus inhibitor found in Mirabilis
jalapa L. Annals of the Phytopathological Society of Japan,
56(4):481-487.
Kuc, J. (1987): Plant immunization and its applicability for disease
control. In: 1. Chet (ed), Innovative Approaches to Plant Disease
Control. John Wiley, New York. pp. 225-274.
Kumar, D.; Verma, H.N.; Tuteja, N. and Tewari, K.K. (1997):
Cloning and characterisation of a gene encoding an antiviral
protein from Clerodendrum aculeatum L. Plant Molecular
Biology, 33: 745–751.
Kumon, K.; Sasski, K.; Sejima, M.; Akeuchi, Y.T. and Hayashi,
Y. (1990): Interactions between Tobacco mosaic virus, pokweed
antiviral protein and tobacco cell wall. Phytopathology, 80: 636640.
Laemmli, U.K. (1970): Cleavage of structural proteins during the
assembly of the head of bacteriophage. T4. Nature, 227: 680-685.
Lancioni, P. (2008): Studies on biotic and abiotic elicitors inducing
defense responses in tomato. Ph.D. Thesis, Phytopathology
Dept., Fac. Agric., University of Bologna, Italy 125pp.
Lanna, A.C.; Oliveira, M.G.A.; Barros, E.G. and Moreira, M.A.
(1996): Kinatic parameters of leaf lipoxygenase pool from
normal soybean genotypes and from a line devoid of seed
lipoxygenase. Rev. Bras. Fisiol. Vegetal., 8: 87-92.
Leal, A.A.; Terada, Y. and Machado, M.P. (2001): Floral biology
of a population of Mirabilis jalapa L. (Nyctaginaceae) from
212
References
Southern Brazil.Acta Scientiarum Maringá, 23(2): 587-591.
Lee, S.Y.; Park, S.J. and Choi, J.K. (1997): Characterization of an ;
isolate of cucumber mosaic virus from Forsythia (Forsythia
koreana nakai). Korean Journal of Plant Pathology, 13(5): 358-363.
Yalpani, N.; Leon, J.; Lawton, M.A. and Raskin, I. (1993):
Pathway of Salicylic Acid Biosynthesis in Healthy and VirusInoculated Tobacco. Plant Physiology, 103(2): 315-321.
Lin, C.H.; Sheu, F.; Lin, H.T. and Pan, T.M. (2010): Allergenicity
Assessment of Genetically Modified Cucumber Mosaic Virus
(CMV) Resistant Tomato (Solanum lycopersicon). J. Agric.
Food Chem., 58 (4): 2302–2306.
Loebenstein, G. (1963): Further evidence on systemic resistance
induced by localized necrotic virus infections in plants.
Loebenstein, G. (1972): Localization and induced resistance in virus
infected plants. Annual Review of Phytopathology, 10: 177-181.
Low, P.S. and Merida, J.R. (1996): The oxidative burst in plant
defense: function and signal transduction. Physiol. Plant., 96:
533-542.
Gilliland, A.; Murphy, A.M.; Wong, C.; Carson, R. and Carr, J.P.
(2006): Mechanisms Involved in Induced Resistance to Plant
Viruses. In: Multigenic and Induced Systemic Resistance in
Plants, 2006, 335-359.
Magid, A.G.M.A. (1991): Host range and transmission of an isolate
of cucumber mosaic virus from the Sudan. East African
Agricultural and Forestry Journal, 56(1-4): 63-67.
Mahmoud, S.Y.M. (2000): Antiviral substances induced in plants as
a result of virus infection. Ph.D. Thesis. Faculty of Agriculture,
Ain Shams University, Cairo, Egypt, 171 p.
References
213
Mahmoud, S.Y.M. (2003): Systemic acquired resistance induced in
viral infected tobacco plants via viral necrotizing and plant
decapitation. Assiut Journal of Agricultural Science, 34(5): 334351.
Malamy, J.; Carr, J.P.; Klessig, D.F. and Rasken, I. (1990):
Salicylic acid: a likely endogenous signal in the resistance
response of tobacco to viral infection. Science, 250: 1002-1004.
Malamy, J.; Hennig, J. and Klessig, D.F. (1992): Temperaturedependent induction of salicylic acid and its conjugates during
the resistance response to tobacco mosaic virus infection. Plant
Cell, 4: 359-366.
Massumi, H.; Shaabanian, M.; Pour, A.H.; Heydarnejad, J. and
Rahimian, H. (2009): Incidence of Viruses Infecting Tomato
and Their Natural Hosts in the Southeast and Central Regions of
Iran. Plant Disease, 93(1): 67-72.
Matthews, F.E.F. (1970): Student edition, plant virology. Academic
press, INC., New York, 778p.
Maurhofer, M.; Hase, C.; Meuwly, P.; Metraux, J.P. and Defago,
G. (1994): Induction of systemic resistance to tobacco necrosis
virus by the root-colonizing Pseudomonas fluorescens strain
CHAO: Influence of the gacA gene and pyoverdine production.
Maurhofer, M.; Hase, C.; Meuwly, P.; Metraux, P. and Defago, G.
(1993): Induction of systemic resistance of tobacco to tobacco
necrosis virus by the root – colonizing Pseudomonas fluorescens
strain GHAO : influence of the gac A Gene and of Phyoverdine
production. Phytopathology, 24 (2): 139- 146.
Mayers, C.N.; Lee, K.C.; Moore, C.A.; Wong, C.A. and Carr, J.P.
(2005): Salicylic acid- induced resistance to Cucumber mosaic
virus in squash and Arabidopsis thaliana: contrasting
214
References
mechanisms of induction and antiviral action. Mol. Plant
Microbe Interact., 18: 428-434.
Mazen, M.A. (2004): Resistance induction against diseases of faba bean
crop. Ph.D. Thesis., Fac. of Agric., Suez Canal Univ., 159pp.
Mazia, D.; Brewer, P.A. and Alfert, M. (1953): The cytochemical
staining and measurement of protein with mercuric bromophenol
blue. Biol. Bull. 35: c 17.
Meena, B.; Marimuthu, T. and Velazhahan, R. (2001): Salicylic
acid induces systemic resistance in groundnut against late leaf
spot caused by Cercosporidium persenatum. Journal of
Mycology and Plant Pathology, 31(2): 139-145.
Megahed, A.A. (2008): Effect of antiviral proteins produced by
bacterial and fungal isolates on some viruses infecting vegetable
crops. M.Sc. Thesis, Faculty of Agriculture, Ain Shams
University, Cairo, Egypt. 193p.
Meins, F.; Neuhaus, J.M.; Sperison, C. and Ryals, J. (1992): The
primary structure of plant pathogenesis-related glucanohydrolases and their genes. pp. 245-282. In: Genes Involved in
Plant Defense, eds. T. Boiler, FJ Meins, Vienna: SpringerVerlag, Heidekberg, Berlin, Germany.
Metraux, J.P.; Singer, H.; Ryals, J.; Ward, E.; Wyss-Benz, M.;
Gaudin, J.; Raschdofr, K.; Schmid, E.; Blim, W. and Inverardi,
B. (1990): Increase in salicylic acid at the onset of systemic
acquired resistance in cucumber. Science, 250: 1004-1006.
Michael, R.D. (2009): Incidence of Viruses Infecting Tomato and
Their Natural Hosts in the Southeast and Central Regions of
Iran, 93(1):67-72.
Mohamed, E.F. (2010): Interaction Between Some Viruses Which
Attack Tomato (Lycopersicon esculentum Mill.) Plants and
References
215
Their Effect on Growth and Yield of Tomato Plants. Journal of
American Science, 6(8): 311-320.
Montalbin, P. and Lupatill, M. (1989): Effect of localized and systemic
Tobacco mosaic virus infection on some photochemical and
enzymatic activities in tobacco. Phytopathology, 75(2): 126-132.
Montasser, M.S.; Dashti, N.H.; Ali, N.Y.; Bhardwaj, R.G. and AlHamar, B. (2006): Occurrence of Three Strains of Cucumber
mosaic virus Affecting Tomato in Kuwait. Archive Detail,
22(1): 51-62.
Murphy, A.M.; Chivasa, S.; Singh, D.P. and Carr, J.P. (1999):
Salicylic acid induced resistance to viruses and other pathogens:
a parting of the ways?. Trends in Plant Science, 4, 155-160.
Murphy, J.F.; Zehnder, G.W.; Schuster, D.J.; Sikora E.J.;
Polston, J.E. and Kloepper, J.W. (2000): Plant growthpromoting rhizobacterial mediated protection in tomato against
tomato mottle virus. Plant Disease. 84: 779-784.
Nassar, G.A. (1998): Algal activity against local and systemic plant
viral infection. Ph.D. Thesis, Faculty of Science, Zagazig
University, Zagazig, Egypt, 164p.
Neuenschwander, U.; Lawton, K. and Ryals, J. (1996): Systemic
acquired resistance in Plant-Microbe Interaction, Vol. 1, pp. SI-108.
G. Stacey and N.T. Keen, eds New York: Chapman and Hall.
Nie, X. and Singh, R.P. (2001): Differential accumulation of Potato
virus x and expression of pathogenesis-related genes in resistant
potato cv. Shepody upon graft inoculation. Phytopathology, 91:
197-203.
Noordam, D. (1973): Identification of Plant Viruses: Methods and
Experiments. Center for Agriculture Publishing and
Documentation, Wageningen, the Netherlands, 207 p.
216
References
Olivieri, F.; Prasad, V.; Valbonesi, P.; Srivastava, S.; GhosalChowdhury, P.; Barbieri, L.; Bolognesi, A. and Stirpe, F.
(1996): A systemic antiviral resistance-inducing protein isolated
from Clerodendrum inerme Gaertn. is a polynucleotide: adenosine
glycosidase (ribosome-inactivating protein). FEBS Lett., 396(2-3):
132-134.
Omar, R.A.; Mehiar, F.F.; Zayed, E.A. and Dief, A.A. (1986):
Physiological and biochemical studies on soy beans and lettuce
plants infected with seed borne virus. Acta Phytopathological et
Entomological Hungarica, 21: 63-72.
Omar, R.A; EL-Kewey, S.A.; Sidaros, S.A. and Mahmoud, S.Y.
(1994): Unusual strain of CMV affecting sugar beet in Egypt.
Proc. of the seventh Congress of Phytopathology. 1:14, Cairo,
Egypt.
Park, S.W.; Kaimoyo, E.; Kumar, D.; Mosher, S. and KIcssig,
D.F. (2007): Methyl salicylate is a critical mobile signal for
plant systemic acquired resistance. Science Washington,
318(5847): 113-116.
Park, S.W.; Liu, P.P.; Forouhar, F.; Vlot, A.C.; Tong, L.; Tietjen, K.
and Klessig, D.F. (2009): Use of a synthetic salicylic acid analog
to investigate the roles of methyl salicylate and its esterases in plant
disease resistance. The Journal of Biological Chemistry,
284(11):7307–7317.
Park, W.M.; Ryu, K.H. and Choi, J.K. (1990): Properties and
purification of cucumber mosaic virus as new strain. Korean
Journal of Plant Pathology, 6(3): 393-401.
Pathak, D.; Srivastava, M.P. and Deka, S.C. (1998): Biochemical
basis of charcoal rot [Rhizoctonia bactericola (Taub.) Buter]
resistant and susceptible cultivars of sunflower in relation to
References
217
total phenols, free amino acids, insoluble pectin and polyphenol
oxidase activity. Annals of Biology (Ludhiana), 14(2): 189-193.
Peng, J.Y.; Deng, X.J.; Huang, J.H.; Jia, S.H.; Miao, X.X. and
Huang, Y.P. (2004): Role of salicylic acid in tomato defense
against Cotton Bollworm, Helicoverpa armigera Hubner. Z.
Naturforsch. 59: 856-862.
Praveen, S.; Tripathi, S. and Varma, A. (2001): Isolation and
characterization of an inducer protein (Crip-31) from
Clerodendrum inerme leaves responsible for induction of
systemic resistance against viruses. Plant Science, 161: 453–459.
Quiroga, M.; Guerrero, C.; Botella, M.A.; Barcelo, A.; Amaya, I.;
Madina, M.I.; Alanso, F.J.; Forchetti, S.M.D.; Tigier, H. and
Valpuesta, V. (2000): A tomato peroxidase involved in the
synthesis of lignin and suberin. Plant Physiol., 122: 1119-1128.
Rajeswari, B. and Rajamannar, M. (1991): Effect of Betelivine
mosaic virus infection on chlorophyll and carbohydrate
fractions. Orissa Journal of Horticulture, 19; 102: 30-31.
Raskin, I. (1992): The role of salicylic acid in plant. Annu. Rev. plant
Physiol. Mol. Boil., 43: 439-463.
Raskin, L; Turner, I.M. and Melander, W.R. (1989): Regulation of
heat production in the inflorescences of an Arum lily byendogenous salicylic acid. Proc. Natl. Acad. Sci USA., 86: 22142218.
Raupach, G.S.; Liu, L.; Murphy, J.; Tuzun, S. and Kloepper, J.W.
(1996): Induced systemic resistance in cucumber and tomato
against cucumber mosaic cucumovirus using plant growthpromoting rhizobacteria (PGPR). Plant Disease, 80: 891-894.
Ray, J. (1901): Les maladies cryptogamiquies des vegetaux.
Rev.Gen. de Bot. 13: 145-154. (c.f. Kessman et al, 1994).
218
References
Rosin, H. (1957): A modified ninhydrin colorimetric analysis for
amino acid. Arch Biochem. Biophys., 67: 10-51.
Ross, A.F. (1961a): Localized acquired resistance induced to plant
virus infection in localized virus infections in hypersensitive
hosts. Virology, 14:329-339.
Ross, A.F. (1961b): Systemic acquired resistance induced by
localized virus infections in plants. Virology, 14: 340-358.
Roussin, M. (2003): Analyses of Kombucha Ferments.
http://www.Kombucha-research.com/.
Ruzin, S.E. (1999): Staining Techniques. In: Ruzin SE, ed. Plant
Microtechnique and Microscopy. New York: Oxford University
Press, 87–116.
Ryals, J.; Neuenschwander, U.; Willits, M.; Molina, A.; Steiner,
H. and Hunt, M. (1996): Systemic acquired resistance. Plant
Cell, 8: 1809-1819.
Ryals, J.; Ukness, S. and Ward, E. (1994): Systemic acquired
resistance. Plant Physiol. 104: 1109-1112.
Salem, E.A. (2004): Induction of salicylic acid by some chemical
substance used to control virus infection under protected
Agriculture. M.Sc. Thesis.Fac. of Agric., Ain Shams.Univ.
Cairo, Egypt, 118 P.
Sankaran, S.; Mishra, A.; Ehsani, R. and Davis, C. (2010): A
review of advanced techniques for detecting plant diseases.
Computers and Electronics in Agriculture, 72: 1-13.
Sayed, E.T.; Soweiha, H.E. and El-Steamy, M.M. (2001):
Anatomical and cytopathological alterations induced by a strain
of Tobacco mosaic virus in tobacco leaf tissues. Egyptian
Journal of Microbiology, 36(3): 329-342.
Schneider, W.C. (1957): Colorimetric analysis of sugar. Methods in
Enzymology, (3). pp. 73-107.
References
219
Sekine, K.; Ishihara, T.; Hase, S.; Kusano, T.; Shah, J. and
Takahashi, H. (2006): Single amino acid alterations in
Arabidopsis haliana RCY1 compromise resistance to Cucumber
mosaic virus, but differentially suppress hypersensitive responselike cell death, plant Molecular Biology, 62(4-5): 669-682.
Shang, J.; Xi, D.H.; Huang, Q.R.; Xu, M.Y.; Yuan, S.; Wang,
S.D.; Jia, S.D.; Cao, S.; Zhou, Z.L. and Lin, H.L. (2009):
Effect of two satellite RNAs on Nicotiana glutinosa infected
with Cucumber mosaic virus (CMV). Physiological and
Molecular Plant Pathology, 74 : 184-190.
Sharma, A.; Mahinghara, B.K.; Singh, A.K.; Kulshrestha, S.;
Raikhy, G.; Singh, L.; Verma, N.; Hallan, V. Ram, R. and
Zaidi, A.A. (2005): Identification, detection and frequency of
lily iruses in North India. Scientia Horticulturae, 106: 213-227.
Shehata, Sawsan F. and Abdel-Aty, Lila (2005): Antimicrobial
activity of the fermented Kombucha. Annals Agric. Sci., AinShams Univ., Cairo, 50(2):467-477.
Sherif, E.A. and EI-Habaa, O.M. (2000): Biochemical changes and
specific protein synthesis related to fungal, bacterial and viral
infection in tomato plants. Annals of Agric. Sci. Moshtohor, 38:
165-177.
Shrivastava, N. and Patel, T. (2007): Clerodendrum and Healthcare:
An Overview- Part II: Phytochemistry and Biotechnology.
Medicinal and Aromatic Plant Science and Biotechnology, 1(2):
209-223.
Shulaev, V.; Silverman, P. and Raskin, I. (1997): Airborne
signaling by methyl salicylate in plant pathogen resistance.
Nature, 385: 718-721.
Silva, H.S.A.; Romeiro, R.S.; Macagnon, D.; Halfeld-Viera, B.A.;
Pereira, M.C.B. and Mounteer, A. (2004): Rhizobacterial
220
References
induction of systemic resistance in tomato plants: non-specific
protection and increase in enzyme activities. Biological Control.
29: 288-295.
Singh, D.P.; Moore, C.A.; Gilliland, A. and Carr, J.P. (2004):
Activation of multiple antiviral defense mechanisms by salicylic
acid. Molecular Plant Pathology, 5, 57–63.
Smith, J. and Hammerschmidt, R. (1988): Comparative study of
acidic peroxidase associated with induced resistance in
cucumber, muskmelon and watermelon. Physiol. Mol. Plant
Pathol., 33: 255-261.
Snell, F.D. and Snell, C.T. (1953): Calorimetric methods of analysis
including some turbidimetric and nephelometric methods. D.
van. Nostrand company Inc. Toronto. New York London., 111,
606pp.
Sommer, A.; Nee'man, E.; Steffens, J.C.; Mayer, A.M. and Harel,
E. (1994): Import, targeting and processing of a plant
polyphenol oxidase, Plant Physiol., 105(4): 1301-1311.
Stall, R.E. and Cook, A.A. (1966): Multiplication of Xanthomonas
vesicatoria and lesion development in resistant and susceptible
pepper. Phytopathology, 56: 1152.
Stamets, P. (1994): My adventures with the blob. Mushroom – the
journal (Winter) 1994:5-9.
Stripe, F.; Parbiri, L.; Batteui, M.G.; Soria, M. And Lappi. D.A.
(1992): Ribosome inactivating proteins from plants: present
status and future prospects. Bio- technology, 10: 405-412.
Stuiver, M.H. and Custers, J.H.H.V. (2001): Engineering disease
resistance in plants, Nature, 411: 865-868.
Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N. and Murugesan,
K. (2006): First Report of Cucumber mosaic virus Subgroup II
Infecting Lycopersicon esculentum in India. 90(11): 1457.
References
221
Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N. and Murugesan,
K. (2007): Induction of systemic resistance in Lycopersicon
esculentum cv. PKM1 (tomato) against Cucumber mosaic virus
by using ozone. J. Virol. Methods., 139(1): 71-7.
Taha, M.A.T. (2010): Biological control of cucumber mosaic virus
(cucumovirus) by certain local streptomycetal isolates. M.Sc.
Thesis, Faculty of Agriculture, Ain Shams University, Cairo,
Egypt. 217p.
Takarai, K.; Okubo, H.; Yamasaki, S.; Takeshita, M. and
Takanami, Y. (2006): A Cucumber mosaic virus isolated from
Momordica charantia L. Journal of General Plant Pathology, 72
(6): 391-392.
Tanaka, M.; Thananunkul, D.; Lee, T.C. and Chichester, C.O.
(1975): A simplified method for the quantitative determination
of sucrose, raffinose and stachyose in legume seeds. J. Food Sci.,
40: 1087.
Tessitori, M.; Rein, A.; Catara, V. and Polizzi, Z. (2002): Polygala
myrtifolia as a new natural host of Cucumber mosaic virus. Plant
Disease, 86(12): 1403-1409.
Trebbi, G.; Borghini, F.; Lazzarato, L.; Torrigiani, P.; Calzoni,
G.L. and Betti, L. (2007): Extremely low frequency weak
magnetic fields enhance resistance of NN tobacco plants to
Tobacco mosaic virus and elicit stress-related biochemical
activities. Bioelectromagnetics, 28(3): 214-223.
Uknes, S.; Mauch-Mani, B.; Moyer, M.; Potter, S.; Williams, S.;
Dincher, S.; Chandler, D.; Slusarenko, A.; Ward, E. and Ryals,
J. (1992): Biological induction of systemic acquired resistance in
Arabidopsis. Mol. Plant Microbe Interact., 6: 692-698.
Uknes, S.; Winter, A.; Delaney, T.; Vernooij, B.; Friedrich, L.;
Morse, A.; Potter, S., Ward, E. and Ryals, J. (1993): Biological
222
References
induction of systemic acquired resistance in Arabidopsis. Mol.
Plant microbe Interact., 6: 692-698.
Van Loon L.C.; Bakker, P.A.H.M. and Pieterse, C.M.J. (1998):
Systemic resistance induced by rhizosphere bacteria. Annu. Rev.
Phytopamol., 36: 453-483.
Van Loon, L.C. (1985): Pathogenesis related proteins. Plant Mol.
Biol., 4:111-116.
Van Loon, L.C. (1997): Induced resistance in plants and the role of
pathogenesis-related proteins. European Journal Plant Pathology,
103:753-765.
Van Loon, L.C. (1999): Occurrence and properties of plant
pathogenesis- related proteins. In: Pathogenesis-related proteins
in plants Datta, S.K.; Muthukrishnan, S. (eds). Boca Raton, FL.
CRC Press. Pp. 1-19.
Van Loon, L.C. and Van Strien, E.A. (1999): The families of
pathogenesis related proteins and comparative analysis of PR-1
type proteins. Physiological and Molecular Plant Pathology,
55:85-97.
Van Loon, L.C.; Pierpoint, W.S.; Boller, T. and Conejero, V.
(1994): Recommendations for naming plant pathogenesis related
proteins. Plant Molecular Biology Reporter, 12: 245-264.
Vance, C.P.; Kirk, T.K. and Sherwood, R.T. (1980): Lignification
as a mechanism of disease resistance. Annu. Rev. Phytopathol.
18:259-288.
Venkatesan, S.; Radjacommare, R.; Nakkeeran, S. and
Chandrasekaran, A. (2010): Effect of biocontrol agent, plant
extracts and safe chemicals in suppression of Mungbean Yellow
Mosaic Virus (MYMV) in black gram (Vigna mungo). Archives
of Phytopathology And Plant Protection, 43(1): 59 – 72.
Verma, H.N.; Baranwal, V.K. and Srivastava, S. (1998): Antiviral
References
223
Substances of Plant Origin. In: Plant Disease Control. Hadidi,
A.; R.K. Khetarpal and H. Koganezawa (Eds.), APS Press, St.
Paul, Minnesota, pp: 154-162.
Verma, H.N. and Kumar, V. (1982): Prevention of plant virus
diseases by Mirabilis jalapa leaf extract. New Botanist, 7:87-91.
Verma, H.N. and Kumar, V. (1980): Prevention of plant virus diseases
by Mirabilis jalapa leaf extract, New Botanist, 7: 87-91.
Verma, H.N. and Varsha, I. (1995): Prevention of natural
occurrence of tobacco leaf curl disease by primed Clerodendrum
aculeatum leaf extract. In: Detection of plant pathogens and their
management J.P. Verma, A. Verma and D.kumar, eds. Ahgeror
publishers (p) Ltd New Delhi, Pages 202-206.
Verma, H.N.; Varsha and Srivastava, S. (1991): Antivral agents
from plants for control of viral diseases, Abstracts: International
Conference on Virology in the Tropics, Lucknow, India, p. 250.
Vermerris, W. and Nicholson, R.L. (2006): Phenolic Compound
Biochemistry. 284 pp. Published by Springer, P.O. Box 17, 3300
AA Dordrecht, The Netherlands.
Vernooij, B.; Friedrich, L.; Ahl-Goy, P.; Staub, T.; Kessmann, H.
and Ryals, J. (1995): 2,6-Dichloroisonicotinic acid-induced
resistance to pathogens does not require the accumulation of
salicylic acid. Mol. Plant-Microbe Interact., 8: 228-234.
Vivanco, J.M.; Querci, M.; and Salazar, L.F. (1999): Antiviral and
antiviroid activity of MAP containing extracts from Mirabilis
jalapa roots. Plant Dis., 83: 1116-1121.
Walter, D.; Newton, A. and Lyon, G.D. (2007): Induced Resistance
for Plant Defence: A Sustainable Approach to Crop Protection.
1st. ed., Blackwell Publishing Ltd, Oxford, UK, 272pp.
Ward, E.R.; Uknes, S.J.; Williams, S.C.; Dincher, S.S.; Wiederhold,
D.L.; Alexander, D.C.; Ahl-Goy, P.; Metraux, J.P. and Ryals,
224
References
J.A. (1991): Coordinate gene activity in response to agents that
induce systemic acquired resistance. Plant Cell, 3: 1085-1094.
Wettstein, D. (1957): Chlorophyll-letale and submikroskopishe
fromvechsel derplastiden. Experimental cell Research, 12: 427506. (English abstract)
White, R.F. and Antoniw, J.F. (1991): Virus induced resistance
responses in plants. Plant Science, 9: 443-455.
Wieslander, L. (1979): A simple method to recover high molecular
weight RNA and DNA after electrophoresis separation in low
gelling temperature agarose gels. Anal. Biochem. 98: 305-308.
Wojtaszek, P. (1997): Oxidative burst: an early plant response to
pathogen infection. Biochem.J., 322: 681-692.
Wood, I.G.; Gluck, A. and Endo, Y. (1992): Ribotoxin recognition
of ribosomal RNA and a proposal for the mechanism for
translocation. TIBS, 17: 266-269.
Wray, J.L. (1992): Inducible Plant Proteins: Their Biochemistry and
Molecular Biology. Society for Experimental Biology, Seminar
Series: 49, 1st Pub., Published by the Press Syndicate of the
University of Cambridge, UK, 309pp.
Yalpani, N.; Silverman, P.; Wilson, T.M.A.; Kleier, D.A. and
Raskin, I. (1991): Salicylic acid is a systemic signal and an
inducer of pathogenesis-related proteins in virus-infected
tobacco. Plant Cell, 3:809-818.
Yalpani, N.; Leon, J.; Lawton, M. and Raskin, I. (1993): Pathway
of salicylic acid biosynthesis in healthy and virus-inoculated
tobacco. Plant Physiol. 103:312-315.
Yang, X.; Liangyi, K. and Tien, P. (1996). Resistance of tomato
infected with cucumber mosaic virus satellite RNA to potato
spindle Tuber viroid. Ann. Appl. Biol., 129: 543-551.
References
225
Yardimci, N. and Eryigit, H. (2006): Identification of Cucumber
mosaic virus in tomato (Lycopersicon esculentum) growing areas
in the north-west Mediterranean region of Turkey. New Zealand
Journal of Crop and Horticultural Science, 34(2): 173 – 175.
Zahra, A.M. (1990): Studies on wilt disease of sesame (Sesamum
indicum L.) in upper Egypt. Ph.D. Thesis, Fac. Agric., Assuit Univ.
Zaitlin, M. and Hull, R. (1987): Plant virus-host interactions. Annual
Review of plant Physiology, 38: 291-315.
Zambolim, E.M.; Assais, M.I.T.; Zambolim, L.; Venturia, J.A.
and Carvalho, j.M.G. (1994): Natural infection of banana
cultivar prata (AAB) by cucumber mosaic virus in the state
Minas Gerals, Brazil. Fitopathologia Brasilena, 19(3): 483-484.
Zehnder, G.W.; Yao, C.B.; Murphy, J.F.; Sikora, E.R. and
Kloepper, J.W. (2000): Induction of resistance in tomato
against cucumber mosaic cucumovirus by plant growthpromoting rhizobacteria. Biocontrol, 45 (1): 127-137.
Zitikaitė, I. and Samuitienė, M. (2009): Detection and
characterization of cucumber mosaic virus isolated from sweet
peppers. Scientific Works of the Lithuanian Institute of
Horticulture and Lithuanian University of agriculture.
Sodininkystėir Daržininkystė, 28(3): 281-288.
226
References
‫ﺍﺳﺘﺤﺜﺎﺙ ﺍﳌﻘﺎﻭﻣﺔ ﺍﳉﻬﺎﺯﻳﺔ‬
‫ﺿﺪ ﺑﻌﺾ ﺃﻣﺮﺍﺽ ﺍﻟﻄﻤﺎﻃﻢ ﺍﻟﻔﲑﻭﺳﻴﺔ‬
‫ﺭﺳﺎﻟﺔ ﻣﻘﺪﻣﺔ ﻣﻦ‬
‫‪< <á]çã<àè‚Ö]<g¦<á]çã<á^µc‬‬
‫‪< <NLLN<Dl^fÞ<š]†Ú_E<íéÂ]…ˆÖ]<Ýç×ÃÖ]<Œçè…çÖ^Óe‬‬
‫‪< <NLLS<Dl^fÞ<š]†Ú_E<íéÂ]…ˆÖ]<Ýç×ÃÖ]<jŠq^Ú‬‬
‫‪< <^ãße<íÃÚ^qI†ãjÚ<íÂ]…‡<íé×Ò‬‬
‫ﻻﺳﺘﻴﻔﺎء ﻣﺘﻄﻠﺒﺎﺕ ﺍﳊﺼﻮﻝ ﻋﻠﻰ ﺩﺭﺟﺔ‬
‫ﺩﻛﺘﻮﺭﺍﺓ ﺍﻟﻔﻠﺴﻔﺔ ﰲ ﺍﻟﻌﻠﻮﻡ ﺍﻟﺰﺭﺍﻋﻴﺔ‬
‫ﺃﻣﺮﺍﺽ ﺍﻟﻨﺒﺎﺕ‬
‫)ﺃﻣﺮﺍﺽ ﻓﲑﻭﺳﻴﺔ(‬
‫ﻗﺴﻡ ﺍﻝﻨﺒﺎﺕ ﺍﻝﺯﺭﺍﻋﻲ‬
‫)ﻓﺭﻉ ﺃﻤﺭﺍﺽ ﺍﻝﻨﺒﺎﺕ(‬
‫ﻜﻠﻴﺔ ﺍﻝﺯﺭﺍﻋﺔ ﺒﻤﺸﺘﻬﺭ‬
‫ﺠﺎﻤﻌﺔ ﺒﻨﻬﺎ‬
‫‪٢٠١٠‬‬
‫א
א‬
‫)(' &‪ $%‬א‪
#‬א" ! و ع אض א א א
א‪ ،‬‬
‫א
א !‪ ،* ) ،*+,‬و‪ -%‬ع א‪01‬و) א‪./‬و)‪ ،‬‬
‫א
א‪=6 K23 4 ) ،‬ل ; ز
א א‪D#* ٢٠٠٩L٢٠٠٨ – ٢٠٠٨L٢٠٠٧ 789‬‬
‫‪E‬وא‪/P"+‬وא‪O‬אضא‪01‬و"‪N‬א‪789‬دونא‪HIJK‬א"‪#G+‬אم‬
‫א‪#/‬אوא‪8.‬و(א‪
7IZ8[Q
R‬א‪WXY‬א‪V‬وא‪TU‬א وא‪T+‬لא‪S
#+‬‬
‫^]‪\(9‬لא
אא‪ K1X‬‬
‫ﺍﳉﺰء ﺍﻷﻭﻝ‬
‫و_‪8‬א‪D#*`/‬א"‪b#JU+‬א‪
,+a‬א‪01‬و"א‪UT!1+G/‬لא‪N789‬‬
‫‪c‬ل‪XE‬אو‪gT‬א א‪U/‬א‪' ef‬א"‪9‬א‪
+6d‬אא‪0‬و)‬
‫‪jF‬א‪i‬א‪_E‬א‪0‬مא‪R/‬د‪08l‬و"&‪0W‬وس زא(‪-‬א‪0،
l‬وسزא(‪-‬‬
‫א‪6#‬ن‪0،‬وس‪# p‬و
אقא‪789‬א‪0،1U/‬وسوא‪q‬א‪279‬و‪0‬وس‪2I‬א‪K279‬‬
‫و)‪#‬ن&‪0Ir‬و"‪I4Q#(#‬د(‪0F‬وسوא‪E#c‬و‪jF96I‬‬
‫‪0 Z‬وس دא‪ 6‬א‪ KE‬و)‪ #‬ن ‪ _e‬א א‪ q#] f‬אض א‪ i‬א‪01‬و" ‪j‬‬
‫א‪/‬زא(‪-‬و א‪ uvw+‬و ‪j‬אو ‪ # p‬و א‪1‬א
‪ .t‬و]‪ Z.s &,‬لא‪01‬و" *‪K‬‬
‫و‪y‬אא‪x(V/‬و‪ *]#t‬و)‪#‬ن‪0‬وسزא(‪-‬א‪
l‬א‪js CMVzU+G/‬‬
‫‪.]W‬א
‪4‬א‪i‬א‪01‬و""א‪J‬א‪1‬د(وא‪}~-%،{l‬و]‪ً)}+‬‬
‫א"‪ ] 9‬א_ א‪ [/‬א‪1/‬د‪ Q‬א‪ *a.( f‬א‪01‬وس ‪ a W‬א
` ‪C.‬‬
‫‪% t amaranticolor‬א א‪01‬وس‪ K‬و~ ‪ jI‬א‪01‬وس ‪ N‬א‪]a W U‬‬
‫د‪6‬ن)]زא‪K‬و~א‪
#}+(&Z#+‬א"א[}‪،‬و‪#‬א‪$‬א א‪،‬و‪7‬قא‪ }+a‬א‪،1+G/‬‬
‫و(‪Q,(=6N}a.‬א ‪)Z‬م‪+E‬א‪،Q‬ود
א"‪6‬א}א‪'(1‬و‪D‬א‪،8 /‬‬
‫و‪ً06‬א ~ א‪ }+(& Z 'j+‬א‪0‬و) א"‪ 9‬א‪
+6d‬א و‪ 'a‬א‪ +‬א‪UT+/‬‬
‫*‪/9‬دونً‪N‬א‪/‬א)_א‪/‬قوא‪\N*D /‬ل]‪gG,‬و] (א‪01‬و"‬
‫א]‪ K‬‬
‫‪-١-‬‬
‫ا
ا‬
‫ﺍﳉﺰء ﺍﻟﺜﺎﻧﻲ‬
‫‪c‬و‪=6Z‬لא‪
#‬א"א‪(K+‬وא‪9+‬א‪HI+‬و" و‪/P‬و‬
‫א‪O‬אض א‪01‬و" "‪#G+‬אم ‪" 7 jT+‬א‪ J‬و ً ‪UG+ j‬‬
‫‪t]a‬א ‪ M. jalapa‬وא;‪4‬א‪1 C. inerme‬د‪Q‬و‪ ،9+‬و‪ 0‬و‬
‫‪%&NFvZ‬אאل‪
jE‬وא‪`t‬א‪Q0Ft8.‬و‪q%+].], N a(0+.‬‬
‫‪ W‬א‪ q,‬א‪ R6O‬و]‪1‬ز ‪ 8\ } N‬ض ‪ (R‬و א وא‪ 8.‬و ‬
‫א‪R/‬دא א( و‪R‬دא א‪01‬و" و‪ +‬وאد ‪R‬د‪ Q# Q‬و‪KEsaI 9,‬‬
‫و‪-]0R~#v‬א‪ NjT+/‬عאضא‪.‬א
א‪* ) J‬و‪#v‬‬
‫א‪" " p N *c W J 0+6‬א‪ 21a N J‬אل و ‪ Kb6 d\ N‬و)('‬
‫\‪Z8‬א‪(#+‬אوא‪T+‬א‪w‬و]وא‪sai‬وא(‪a.IZT+V‬א‪+‬‬
‫‪]a‬א‪8789‬وא*ز(א‪#[jT+/‬א‪01‬و"א]‪ K}#Z‬‬
‫ﺃﻭﻵ‪ :‬ﲡﺎﺭﺏ ﺍﺳﺘﺤﺜﺎﺙ ﺍﳌﻘﺎﻭﻣﺔ ﺍﳉﻬﺎﺯﻳﺔ‬
‫‪#$ J١‬א" א! א
א א א א‬
‫وא! ‪-456‬ن‪ 1%2*3‬وسو‪-$.‬ن‪*+‬א)"('&‪%‬‬
‫! א
‪46‬ز‪3‬دא
>"
א*=<‪39:#$.;*+‬א‪،‬و‪$+‬دא@ א
‬
‫א‪ ، %! I‬و ‪ GH‬א<‪$+ ، 4F‬د ‪-‬ذ‪#‬ع א‪ BC‬و‪ 2‬א*‪K GLM KA‬‬
‫@‪ R‬א‪ NS ، =Q‬א‪ R@ > !F‬א‪ B" ، PM6Q‬א*=< > ‪N3O‬‬
‫א!‪K#‬‬
‫‪ J٢‬א"‪ X‬אش אد א‪ 6$‬و‪ P2& 45‬א ‪ 1‬وس ‪V ;*+‬ج‬
‫و<
‪Y6‬د *‪ 1‬و"
@‪3- ٧ $‬م ‪ P6‬אش‪ ،‬و‪M‬ن ‪ > [M-‬א<
‬
‫אא`א‪S‬و‪%*5-‬ز‪3‬د>א<
א_*^‪B]F*6‬‬
‫א*‪ 4‬و א‪ K*6@6 ! #26 H‬و@‪# P6 ً63 ٢٥ $‬ش א<
א‪2b‬‬
‫‪;*+-dS‬و<
‪Y6‬د*‪ 1‬وس=א@‪S*6‬و‪45-‬ز‪3‬د>‬
‫א<
א ‪ g*h‬א‪f<S #26 H‬ول‪ K‬و‪ $31‬א‪]%S‬‬
‫*‪G‬אو<
‪k&
%l‬مو<
‪P+3j‬א<
א*و‪M‬ن‪-‬و‪%i‬‬
‫א<‪P+O‬אش‪B
F*h‬א*‪n4‬א‪%*3%*mnH‬אش‬
‫ا
ا‬
‫‪-٢-‬‬
‫א` א‪ 3$2 KS‬א‪ okp‬و‪ > %%6‬א<
א@‪ *6‬وא! ‪*6@6‬‬
‫&‪ r‬ز‪3‬د ط *‪ G‬א‪ > okp‬א<
א@‪ P+ *6‬א! ‪ K*6@6‬و‪M‬ن‬
‫ط א و‪$M‬אز ‪ > ;*+-‬א<
א _*^ ‪ ]F*6‬א<
‪6- K‬‬
‫א] ‪<s‬ل ‪-‬و‪$M‬אز ‪Ss‬ن ‪ > ً M-‬א<
א ‪B g*h‬‬
‫א*‪K4‬א"<‪1‬אشא`א‪S‬ط‪3kVt6‬א و‪$M‬אز>א<
‬
‫א! ‪ 1 2u‬وس‪ %*3 K‬א<‪ P+ O‬אش _*^ ‪ ]F*6‬א<
‪6- ،‬‬
‫= ‪ $@ t‬א‪ dSs P2v‬ز‪3‬د‪ = t‬אش ‪ B g*h‬א*‪< 4‬‬
‫א‪G*dY1w‬א‪3k‬د=אش‪g*h‬א‪KH‬و‪x1‬א<="=*‪d‬‬
‫‪y6‬א‪t‬א‪<s]*]okp‬ل‪-‬و‪$M‬אز‪K‬‬
‫‪ 3$2 J٣‬א‪ R6v ]S‬א*‪ r& G‬ز‪3‬د‪ > t‬א<
א א`‬
‫א‪ 1 %<2& 45 S‬وس ‪ %*3‬ز‪3‬د = אش ‪ g*h‬א‪n H‬‬
‫‪B‬א*‪*mn4‬طא*‪KF‬‬
‫‪- r& J٤‬ن '!
א‪ 4‬א‪ > ]|Y‬א<
<‪ > g5‬א<
א‪P+ F‬‬
‫א*‪-)VK‬نא
א‪
;*+‬אא! ‪ 12u‬وس‬
‫زאد
‪u‬א[ ‪ - 4s#*M P6‬و } و‪ !' GLM‬א‪#S‬و و‪ ':‬א‬
‫‪ B g*h‬א*‪ n 4‬א‪ n H‬א‪ %< ^*C‬و‪ :-‬א ‪#‬א` א‪KS‬‬
‫و‪x1‬א‪y6dn$&~&9‬א<
א‪ 12b‬وسو<‪x1‬א‪KBf‬‬
‫‪ J٥‬زאد ‪ u‬א<
א! ‪ 2u‬وא@‪ P+ *6‬א! ‪P6 *6@6‬‬
‫א‪<1‬ل‪K‬و‪M‬ن‪<1* kM;*+-‬لא‪>]*S‬א<
א‪Bg*h‬‬
‫א*‪# n 4‬א` א‪ S‬و‪M‬ن א‪3k‬د ‪ > 45-‬א<
א ‪g*h‬‬
‫א‪^*:nH‬א*‪f<S#26
F‬ول‪K‬و@‪P2&$‬א<
‪ 1‬وس‬
‫زאد
א‪ )<1‬א‪ = *S‬אش ‪ B g*h‬א*‪ t*3 4‬אش ‪*h‬ط‬
‫א‪ 1‬و"
‪n‬א`א‪S‬و‪ :-‬אًאش‪g*h‬א‪KH‬‬
‫‪-٣-‬‬
‫ا
ا‬
‫‪ 3$2 %l- J٦‬א‪Q‬ض א<و‪ P6 3‬ع ‪ RNA‬א‪ *S‬و‪- $.‬ن ‪> @16 %M‬‬
‫א<
א! ‪ 1 2u‬وس وא א` א‪B g*h n S‬‬
‫א*‪g*6%*34‬א‪nH‬אش‪*h‬طא*‪KF‬‬
‫‪- J٧‬د
א@‪
*6‬א‪:.4+k13v‬ص‪2h‬و‪ s6‬وس‪CMV‬‬
‫>
א‪ 1%<2&45‬وس‪K‬و‪k+$5‬لאو‪5ys@6‬א‪K$+‬‬
‫و‪26 < t#26‬و‪ x1< *n 6‬א‪ 1‬وس و‪
9|@ :- P6 PS‬‬
‫‪1*m‬א"‪V;*+%n‬ج‪x1‬אوذ‪G<3P+G‬א<
‪K‬‬
‫‪ J٨‬א‪ @s n $6 :‬א‪ 1‬وس = אش א وو‪- $.‬ن‬
‫א<
א ‪ $ 3$2 $@ ' *6 d'-‬א‪ 'p‬ض >‬
‫א<
א@‪K*6‬و‪-‬ن‪*+‬א‪d1@i-k1‬א<طא‪ 1*]i‬وس@‪3$2$‬‬
‫‪3$23P+ً.KkM‬א‪y2‬א‪kMn$6;*+5*@i‬‬
‫א‪ 1‬وس‪K‬‬
‫ً‬
‫ﺛﺎﻧﻴﺎ‪ :‬ﲡﺎﺭﺏ ﺍﳌﻘﺎﻭﻣﺔ ﺍﳉﻬﺎﺯﻳﺔ ﺍﳌﺴﺘﺤﺜﺔ‬
‫‪26= J١‬و‪6‬א‪ 1‬وس
א@&‪ ! dn$‬א
א‬
‫
א א‪ 1 2b‬وس وא! ‪ = 2u‬א@‪G* P6 K*6‬‬
‫א! א
‪-‬ن א<
‪ B" = 5- dM‬א*=< > ‪ 39: #$.‬א‬
‫‪2s‬و‪ d6‬א‪f:‬אق א‪v‬א
א<‪ ،*5‬زאد
‪$+-‬אد א‪Q‬و‪ +‬א<‪ B: P6 *5‬و‪، Av‬‬
‫و‪GLM‬א@ א
א!*‪،‬زאد‪GH‬א<‪>
[
%lK4F‬א<
‬
‫א‪ > d* F‬אא ‪ B‬א‪ 39C‬א‪F 4F<* S‬א< א@د‬
‫وא)"‪،E]=<1‬و<‪$+>g5‬دو‪4S‬א‪kv‬مא‪ K|+‬‬
‫‪d J٢‬א)"‪1‬د‪#P6‬د‪
4@s‬א*
א@א*‪1‬א‬
‫> ‪V‬ج و<
‪ > $3$.‬א<
‪26‬و‪ 1* 6‬وس‪3- ٧ $@ K‬م ‪# P6‬ش א<
‬
‫א א‪ 2b‬א` א‪ > dS S‬א<
‪G* P6 M ;*+-‬‬
‫אو<
‪K‬و‪%*5-‬ز‪3‬د‪>dM‬א<
א_*^‪B]F*6‬א*‪4‬و‬
‫ا
ا‬
‫‪-٤-‬‬
‫א‪#P6ً63 ٢٥$@6-K*6@6 !#26H‬شא<
א‪dS2b‬‬
‫‪ ;*+‬و<
‪Y6‬د *‪ 1‬وس = א@‪ S *6‬و‪ 45-‬ز‪3‬د >‬‫א<
א ‪ g*h‬א‪f<S #26 H‬ول‪ K‬و‪ $31‬א‪]%S‬‬
‫*‪G‬אو<
‪k&
%l‬مو<
‪P+3j‬א<
א*و‪M‬ن‪-‬و‪%i‬‬
‫א<‪P+O‬אش‪B
F*h‬א*‪n4‬א‪%*3%*mnH‬אش‬
‫א` א‪ 3$2 KS‬א‪ okp‬و‪ > %%6‬א<
א@‪ *6‬وא! ‪*6@6‬‬
‫&‪ r‬ز‪3‬د ط *‪ G‬א‪ > okp‬א<
א@‪ P+ *6‬א! ‪ K*6@6‬و‪M‬ن‬
‫ط א و‪$M‬אز ‪ > ;*+-‬א<
א _*^ ‪ ]F*6‬א<
‪6- K‬‬
‫א] ‪<s‬ل ‪-‬و‪$M‬אز ‪Ss‬ن ‪ > ً M-‬א<
א ‪B g*h‬‬
‫א*‪K4‬א"<‪1‬אشא`א‪S‬ط‪3kVt6‬א و‪$M‬אز>א<
‬
‫א! ‪ 1 2u‬وس‪ %*3 K‬א<‪ P+ O‬אش _*^ ‪ ]F*6‬א<
‪6- ،‬‬
‫= ‪ $@ t‬א‪ dSs P2v‬ز‪3‬د‪ = t‬אش ‪ B g*h‬א*‪< 4‬‬
‫א‪G*dY1w‬א‪3k‬د=אش ‪g*h‬א‪KH‬و‪x1‬א<="=*‪d‬‬
‫‪y6‬א‪t‬א‪<s]*]okp‬ل‪-‬و‪$M‬אز‪K‬‬
‫‪n3 J٣‬ز‪
!'y3‬א<
א‪2I‬م@*א‪4‬א‪>]|Y‬א<
א‪P+F‬‬
‫א*‪ K‬و&‪- r‬ن ‪26‬و‪ 6‬א‪ 1‬وس > א<
א‪ 2b‬א@‬
‫"‪;*+$+‬ز‪3‬د‪u‬א[‪،} ،-4s#*MP6‬و‪!'GLM‬א‪#S‬وو‪':‬‬
‫א ‪ B g*h‬א*‪ n 4‬א‪ n H‬א‪ %<6 ^*C‬و‪ :-‬א ‪#‬א`‬
‫א‪KS‬و‪x1‬א‪y6dn$&~&9‬א<
א‪ 12b‬وسو<‪x1‬א‪KBf‬‬
‫‪ J٤‬א‪
)<1‬א‪*S‬زאد
>א<
א‪2b‬وא@‪P+
*6‬א! ‪K*6@6‬‬
‫و‪M‬ن‪<1*kM;*+-‬لא‪>]*S‬א<
א‪ Bg*h‬א*‪n4‬‬
‫‪#‬א` א‪ S‬و‪M‬ن א‪3k‬د ‪ > 45-‬א<
א ‪ g*h‬א‪n H‬‬
‫‪^*:‬א*‪f<S#26
F‬ول‪K‬و@‪P2&P6 ٢٥$‬א<
‪ 1‬وسزאد
‬
‫א‪
)<1‬א‪=*S‬אش‪Bg*h‬א*‪t*34‬אش‪*h‬طא‪ 1‬و"
‬
‫‪n‬א`א‪S‬و‪ :-‬אًאش‪g*h‬א‪KH‬‬
‫‪-٥-‬‬
‫ا
ا‬
‫‪ 3$2 J٥‬א‪Q‬ض א<و‪ RNA 3‬א‪3- ٧ $@ *S‬م ‪# P6‬ش א<
א‪2b‬‬
‫‪ 1‬وسو‪-$.‬ن‪>@16%M‬א<
א‪Bg*h‬א*‪t*34‬‬
‫‪#‬א`א‪^*:nS‬א*‪F‬و‪ :-‬אًאش‪g*h‬א‪$@6-KH‬‬
‫‪3 ٢٥‬م ‪-‬د אش ‪ B g*h‬א*‪# t*3 4‬א` א‪ ;*+- V S‬ز‪3‬د >‬
‫א‪Q‬ضא<و‪RNA3‬א‪>t*3*S‬ذ‪G‬אش‪gh‬א‪^*:nH‬‬
‫א*‪f<S#26F‬ول‪K‬‬
‫‪-r& J٦‬ن‪u‬א‪#$[S‬א
א‪>*S‬א<
א‪ 12b‬وسو@‪3- ٧$‬م‬
‫‪$5%#P6‬زאد=א@‪*6‬א`א‪Bg*hnS‬א*‪t*34‬אش‬
‫*ط ‪ n‬אش ‪ g*h‬א‪3 ٢٥ $@ 6- KH‬م ‪ P6‬אش ‪ $2s‬زאد
‬
‫א‪#$[S‬א
א‪ = *S‬אش ‪ B g*h‬א*‪ t*3 4‬אش ‪g*h‬‬
‫א‪ H‬و‪ 45- dM‬ز‪3‬د = אش ‪*h‬ط א*‪ t*3 F‬אش א`‬
‫א‪VS‬ذא‪f<Sd#56‬ول‪K‬‬
‫‪
%l- J٧‬א=‪}#‬א‪2‬و‪6‬א‪ s$i‬وس‪6‬زא‪G3‬א‪>#C‬א‪K‬‬
‫و‪$5‬ذ‪9:P6ً3OG‬ل‪5‬س‪$‬א‪'p‬ضو‪^3$2‬‬
‫ط א‪ 1‬وس א‪ kM } ]i‬א‪ 1‬وس ‪$+ ;*+ A< ً.‬د א‪y2‬‬
‫א‪@i‬א‪;*+S‬א@|‪4‬א‪K*F1<6*6@64St<2&$@GLgF‬و‪$5‬‬
‫د‪#‬ش
אא‪ 12b‬وس‪B
g*h‬א*‪^V4‬‬‫‪ $‬אض ‪ > t*3‬ذ‪ G‬אش ‪ g*h‬א‪# n H‬א` א‪ S‬و‪ :-‬אً‬
‫‪*m‬ط‪g*6‬א<‪f<S#26‬ول‪K‬‬
‫ا
ا‬
‫‪-٦-‬‬
‫ﺍﳋﻼﺻــــــــﺔ‬
‫('&‪ !"#$%‬אאلوو
وسزא‬
‫א‪ 5**6 # *7‬א‪ 2.*34‬א‪)*+ # ,' -.* (/ 0 1‬‬
‫א‪)>%‬אً‪:;<:‬א ‪ !"8*9‬אא‪#‬א‪
,‬و*‪5‬א‪BCD‬א‪?@A‬‬
‫א‪02.*34‬א‪-.*1‬א‪%E*7‬א‪ K‬‬
‫א'&‪ 5**6 # I*6 5*@%&'( J‬א '*‪H 0 ;<:> IH‬א‪-G‬‬
‫‪ %Q‬אא ‪ ، O'MP‬و ‪
'C‬א ‪* L%‬س א‪ 5*%1‬א‪ L% ً*6( ;M1‬ن‬
‫‪#
<:*>>*RST6<
9U*3V‬א‪5*66(1‬א‪,%'W5**60E1‬و‪R*C‬‬
‫א‪D‬אض א‪ # 66('1‬א‪
,‬و*‪ *3Q ، 5‬א'&م ‪K*3O@%&'( T%C ً*X‬‬
‫وא'&م ‪ ً*X‬א[\ א‪: _%*: #G*QF *[63:‬ن ‪ ; #‬אع ‪ #‬א‪*
':6‬‬
‫وא‪ ;
37‬א* ‪a 3‬אً ‪ L%‬א‪ E`*M‬و('‪*,‬د ‪ #‬وא[\ ‪ %‬א‪0 5*G*:‬‬
‫א‪ 0 *"3d 8*9 `*M‬א ‪ #‬א‪g‬א? א‪!f‬א‪ G‬وא‪# <: ae‬‬
‫א‪D‬אض ‪ 0‬א‪*(l‬ن وא‪k‬אن وא‪ *3Q 5*6‬د‪ L% J‬ذ א‪ h*iD‬א‪;M1‬‬
‫وא[‪ L% `'m *On‬אد ‪*X‬د; ‪:3%‬و>*‪ K5‬و‪ oG*' #I6‬אא ن ‪%‬‬
‫א‪1‬אد א'‪ 5**6 J<n‬א‪*'q L% 2.*34‬ج >و*‪*X 5‬د; ‪
,%‬وس >(?‬
‫'‪*,‬و‪ K‬و‪ J'69‬א'א‪ 5‬א'‪ mM‬وא‪ H3:‬وא‪0 *OH*r sg‬‬
‫א'‪h*<n‬א‪*1‬وא‪0k‬א‪E5*6‬א‪
,*>>*Rl‬و*‪ K5‬‬
‫ ‪eC #‬ل אא ل و ‪ Ia‬א‪*1‬و א‪* 0 $@&'1‬و‬
‫
وس زא א‪ 5*6 0 *7‬א‪> 2.*34‬א‪ 4‬א‪*6'Ct‬א‪ 5‬א‪ sg‬و*‬
‫א'*‪>B*PoG‬א‪5*a#5*g‬و‪K6(5*%‬و‪t*PQU‬‬
‫ع‪w*rM%ًt*x‬א‪5*@%&'(1‬وאא[\א‪-u0;v'&1‬א‪*1‬وא‪*,‬‬
‫‪E‬א‪
,‬وس[*ً‪L%‬א|‪3‬عא‪{Ju`X7‬و‪z‬א@>و‪0‬א‪ Kyk‬‬
‫‪-٧-‬‬
‫ا
ا‬
‫ﺍﻟﺘﻮﺻﻴـــــــﺎﺕ‬
‫‪_R‬אא‪*1‬وא‪
,‬و*‪5‬א‪2.*34%E31‬و‪
*H0R*C‬وس‬
‫زאא‪*6~>*7‬عא‪47‬א‪5‬א}‪ W‬‬
‫‪ >*' J١‬א‪ 0 5**6‬א‪ y'M1‬وא@> وא‪*)'*> yk‬م وא'‪*@s‬ل ` ‪5**6‬‬
‫@*>وא'&‪k*>*O$%‬قو‪U>ًt‬ول‪ K‬‬
‫‪ J٢‬زא‪?[5*6‬א‪H5*6Qy%‬لא‪k‬لو‪H‬אضאאو‪0R*C‬‬
‫א‪ 5*H*(1‬א@‪ ;
f‬א‪*'l @@&1‬ج א‪!6‬و و >א‪ o‬א> ‪* 5**6‬و‬
‫وذ‪،IEf‬و‪*3"t‬نא‪5*6‬ود‪aL%‬א‪
M> 8‬א‪#5‬‬
‫‪,*O.‬زאد‪*.;*.‬د;‪3g‬א‪Mk‬א‪5‬א‪;*4‬و*‪#*V‬א'‪!f‬‬
‫‪F‬א‪eC # ;' %1‬ل ‪ $d t ;M h*i‬אא‪ * EI‬‬
‫‪ 2.*34%‬א‪ # *3k‬א‪Mk‬א‪ 5‬א*‪ %‬و‪@ v' !Q‬אً وאق‬
‫وא‪!g‬و א‪&'( A‬م ('&‪ *O@%‬א‪* 0 *,> _G*1‬و א‪# <:‬‬
‫א‪D‬אضو‪R*C‬א‪
,‬و‪ K‬‬
‫‪!a J٣‬و ['‪ 5e‬א‪ y6 2.*34‬אא ‪ ١٥ ;1‬د ‪ 0‬א‪ $%&'(1‬א‪_G*1‬‬
‫‪?[5**6‬א‪y%‬وא*‪I‬و‪،*3OT%C‬و‪0‬א[\א‪F*[63:‬א‪3g‬‬
‫>‪ KE٪٥٠ Q‬ش ‪ 5**6‬א‪*)'*> 2.*34‬م ‪ ١٥ – ١٠ yQ‬م >א ‪#‬‬
‫['‪*O%‬و‪L'H‬و‪J‬א@ل>*‪$%&'(1‬א‪5**6%_G*1‬א(*>وא[\‬
‫א‪Q*>*[63:‬א(*ذ‪K Q‬‬
‫ا
ا‬
‫‪-٨-‬‬

Inducing systemic resistance against some tomato virus diseases

Transcription

Similar documents

Fact Sheet Jet Star Tomato.pub

Read about us in Bucks County

Pretty Ugly

View Bethpage`s Take Home Menu

404.386.1940 20 years Emory Special

Pioneer Chow - Troop 158, Herndon VA

WRAP-IT-UP MEAL SOUTHERN-STyLE DRUMMERS MONSTER

Spring 2013 - Chippewa Valley Growers

tomato hornworm - Mud Puddles to Meteors

36192 Hotel Menu advert:Layout 3