Effect of influent COD/SO42− ratios on mesophilic anaerobic reactor

Transcription

E¡ect of in£uent COD/SO42^ ratios on mesophilic anaerobic reactor
biomass populations: physico-chemical and microbiological
properties
Caroline O’Reilly & Emer Colleran
Environmental Microbiology Research Unit, Department of Microbiology, National University of Ireland, Galway, Ireland
Received 11 August 2004; revised 17 August
2005; accepted 4 October 2005.
First published online 21 February 2006.
doi:10.1111/j.1574-6941.2006.00066.x
Editor: Gary King
Keywords
anaerobic; methane producing archaea (MPA);
sulphate reducing bacteria (SRB); COD/SO42 ratio; competition; fluorescent in situ
hybridization (FISH).
Abstract
The competitive and syntrophic interactions between different anaerobic bacterial
trophic groups in sulphate limited expanded granular sludge bed (EGSB) reactors
was investigated. The outcome of competition between the sulphate-reducing,
methanogenic and syntrophic populations after development in reactors at varying
influent COD/SO42 ratios was examined in batch activity tests with the inclusion of
specific sulphate reducing bacteria (SRB) and methane producing archaea (MPA)
inhibitors. SRB species could not out-compete MPA species for acetate at influent
COD/SO42 ratios as low as 2. The SRB were seen to play a more significant role in
the conversion of hydrogen but did not become completely dominant. HMPA were
responsible for hydrogen utilization at an influent COD/SO42 ratio of 16, and were
still dominant when the ratio was reduced to 4. It was only when the COD/SO42
ratio was reduced to 2 that the HSRB assumed a more influential role. SRB species
were significant in the degradation of propionate at all COD/SO42 ratios applied.
Sludge samples were analysed by scanning electron microscopy (SEM), granule size
distribution and fluorescent in situ hybridization (FISH), combined with confocal
laser scanning microscopy (CLSM), to monitor any changes in granule morphology
under the various COD/SO42 ratios imposed during the reactor trial. In situ
hybridization with domain- and species-specific oligonucleotide probes demonstrated a layered architecture with an outer layer harboring mainly Eubacterial cells
and an inner layer dominated by Archaeal species.
Introduction
The microbial community involved in the anaerobic digestion process is known to be quite complex, necessitating
effective interaction between hydrolytic, fermentative,
acidogenic, and methanogenic bacteria in the conversion of
organic matter to methane and carbon dioxide. In some
cases, this situation is further compounded by the presence
of sulphate and the resultant involvement of sulphate
reducing bacteria (SRB). Application of appropriate reactor
conditions and reactor configurations is pivotal in controlling these microbial interactions and ensuring successful
anaerobic wastewater treatment. Retention of granular biomass is also a prerequisite for successful application of high
rate anaerobic reactors, such as the internal circulation (IC),
the expanded granular sludge bed (EGSB) and the upflow
anaerobic sludge bed (UASB) reactors. In order to address
syntrophic and competitive interactions within methanogenic granules and to establish links between microbial
FEMS Microbiol Ecol 56 (2006) 141–153
structure and function, the combined involvement of various techniques, e.g. immunological, microscopic, histochemical, traditional enumeration methods, molecular
methods (rRNA based methods) and bacterial activity and/
or competition studies is required.
It is also of interest to investigate how the juxapositioning
of microorganisms within anaerobic granular sludge
affects the competition between different bacterial groups –
i.e. SRB and methane producing archaea (MPA). In theory,
all of the influent organics can be degraded via sulphate
reduction if the COD/sulphate ratio is below 0.66
(Lens et al., 1998). In anaerobic reactors operated with
excess sulphate, SRB have been shown to be the dominant
species, effectively outcompeting the MPA (Rinzema
et al., 1986; Alphenaar et al., 1993; Visser et al., 1993). In
sulphate-limited reactors, the degradation pathway of
organic compounds becomes very complex. Besides the
normal competition between sulphate reducers and syntrophic consortia for mutual substrates, sulphate reducers
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
Downloaded from http://femsec.oxfordjournals.org/ by guest on October 21, 2016
Correspondence: Caroline O’Reilly,
Environmental Microbiology Research Unit,
Department of Microbiology, National
University of Ireland, Galway, Ireland. Tel.:
1353 87 9935928; fax: 1353 91 525700;
e-mail: [email protected]
142
1 : 1 : 1 : 1) (O’Reilly, 2003). Biomass samples were taken
from R1 during operation at a 2 day hydraulic retention
time (HRT) and a volumetric loading rate (VLR) of 6 kg
COD m3 day1 and when the sludge had become adapted
to varying COD/SO42 ratios (Table 1).
Competition tests
In order to ascertain whether competition between the
syntrophic, methanogenic and sulphate reducing bacterial
populations changed at the different COD/SO42 ratios
applied during the trial, competition studies were undertaken
at various times. A modification of the specific methanogenic
activity (SMA) test described by Colleran & Pistilli (1994) was
used to determine the outcome of competition between the
various populations in the reactor sludge over time. SMA
tests were carried out in the presence and absence of the
specific MPA and SRB inhibitors, bromoethane sulphonic
acid (BES) and sodium molybdate, respectively. Sulphate
(30 mM), BES (60 mM) and sodium molybdate (2 mM) and
combinations, thereof, were included in test vials (60 mL)
with anaerobic sludge, anaerobic buffer and substrate. Direct
substrate degradation and pressure increase analyses were
carried out in triplicate as a function of time. The soluble
substrates, acetate and propionate, were analysed by gas
chromatography using a Shimadzu GC-14B chromatograph
with a hydrogen flame ionization detector, fitted with a glass
column (2 m 2 mm i.d.) packed with 80/120 Carbopack
B-DA/4% Carbowax 20 M (Supelco Inc., Bellefonte, PA).
The column temperature was maintained at 175 1C and the
injection port and detector temperatures were 200 and
250 1C, respectively. Nitrogen was used as the carrier gas at a
flow rate of 150 mL min1.
Table 1. Reactor biomass samples; analyses carried out and reactor
conditions
Reactor operational parameters
Analysis
Materials and methods
Competition study
A
B
C
Granule size analysis
Source of biomass
SEM
A mesophilic granular sludge was developed in a 5 L EGSB
reactor, (R1), treating a synthetic sulphate-containing wastewater at 37 1C. R1 was operated for a period of 581 days at
influent COD/SO42 ratios of 16 : 1, 8 : 1, 4 : 1 and 2 : 1. The
total influent COD (12 g L1) consisted of glucose (15%)
and ethanol, acetate, butyrate and propionate (COD ratio of
c
FISH
Biomass source
Day
Influent
COD/SO42
S
R1
R1
S
R1
S
R1
R1
R1
R1
0
424
564
0
581
0
293
581
293
564
16 : 1
4:1
2:1
16 : 1
2:1
16 : 1
4:1
2:1
8:1
2:1
Seed sludge developed in a full-scale digester treating citric acid produc-
tion wastewater containing sulphate at a COD/SO42 ratio of 16 : 1. SEM,
scanning electron microscopy; FISH, fluorescent in situ hybridization.
compete with each other for available sulphate (Oude
Elferink et al., 1998).
In contrast to methanogenic systems, little is known
about the immobilization and granulation of SRB in sulphidogenic systems. Although pure cultures of sulphate reducing bacteria cultivated in the laboratory often aggregate in
clumps or attach to surfaces (Widdel, 1988), the length of
time taken for the SRB to form a biofilm or to granulate in
anaerobic reactors is not clear (Visser, 1995). According to
Isa et al. (1986), the superior colonization capacity of MPA
would enable these bacteria to successfully outcompete the
SRB in biofilm reactors. On the contrary, Yoda et al. (1987)
assumed an equal attachment ability of SRB and MPA.
The aim of this study was to gain more insight into the
competitive and syntrophic interactions between the different bacterial trophic groups in sulphate-limited reactors.
For this purpose, the biomass developed in an EGSB labscale reactor (R1) operated at 37 1C and described in a
parallel study (O’Reilly, 2003) was examined using a variety
of physico-chemical and molecular techniques. Granules
present in the reactor biomass were analysed by scanning
electron microscopy (SEM), granule size distribution and
examined by fluorescent in situ hybridization (FISH), combined with confocal laser scanning microscopy (CLSM) in
order to monitor any changes in granule morphology under
different operational conditions. Activity tests in the presence of various inhibitors were carried out to fully elucidate
the outcome of competition between the sulphate reducers
and the other anaerobic consortia at varying influent
sulphate concentrations and temperatures.
Species-specific probes for FISH were chosen on the basis
of previous work carried out in our laboratory using two
molecular techniques, amplified ribosomal DNA restriction
analysis (ARDRA) and terminal restriction fragment length
polymorphism (T-RFLP)(Toomey, 2002). Previous application of these techniques had indicated that Methanosaeta
and Desulfovibrio sp. were the most abundant MPA and SRB
species, respectively, in UASB reactors regardless of whether
the reactor was operated under sulphate-rich or sulphatelimited conditions (Toomey, 2002). Domain-specific oligonucleotide probes for Eubacteria and Archaea were also
utilized to visualize the overall structure of the granules.
C. O’Reilly & E. Colleran
143
Mesophilic anaerobic reactor biomass populations
Table 2. Fluorescently labelled oligonucleotide probes used in this study
Probe Name
Target group
Probe Sequence (5 0 –3 0 )
% Formamide
Reference
EUB338
ARC915
MX825
Eubacteria
Archaea
Methanosaetaceae
–GCTGCCTCCCGTAGGAGT–
–GTGCTCCCCCGCCAATTCCT–
TCGCACCGTGGCCGACACCTAGC
5
35
20
DSV687
Desulfovibrio
–TACGGATTTCACTCCT-
35
Amann et al. (1990)
Stahl & Amann (1991)
Sekiguchi et al. (1999), Raskin et al.
(1994), Liu et al. (2002)
Liu et al. (2002), Purdy et al. (2001),
Lin et al. (1997)
Granule analysis
Hydrogenotrophic methanogens
Results
The effect of influent COD/SO42--
ratios on the
population characteristics of mesophilic EGSB
reactor biomass
Acetoclastic methanogens
Figure 1a–c illustrates the substrate depletion and biogas
formation of seed and R1 sludge developed at three different
COD/SO42 ratios against the direct methanogenic substrate, acetate, in the presence and absence of the specific
MPA and SRB inhibitors, BES and sodium molybdate (Mo).
Table 3 summarizes the specific methanogenic activity
(SMA) profiles for the seed and R1 sludge samples against
the test substrates. For all three sludge samples, complete
acetate depletion occurred in c. 20 h both in the presence
and absence of sulphate and in the presence of molybdate
(Fig. 1). The addition of sulphate or the SRB inhibitor,
molybdate, to test vials did not result in either an enhancement or a decrease in the degradation rate. Acetate
As illustrated in Table 3, the hydrogenotrophic SMA values
for the seed sludge (influent COD/SO42 ratio of 16) and for
R1 sludge at an influent COD/SO42 ratio of 4 were very
similar. H2-utilizing MPA (HMPA) appeared to be dominant and responsible for complete utilization of hydrogen by
the seed sludge. The inclusion of SO42, Mo and Mo plus
SO42 in test vials had little effect on specific methanogenic
activity values. H2/CO2 was not utilized in the presence of
BES or sulphate plus BES (Fig. 2a), and this strongly
suggests the absence of SRB capable of outcompeting HMPA
for hydrogen at the sulphate limiting conditions imposed by
the high COD/SO42 ratio of 16. Operation of R1 at an
influent COD/SO42 ratio to 4 appeared to have encouraged
the development of hydrogen utilizing SRB (HSRB) within
the sludge. In test vials containing biomass sampled at this
lower COD/SO42 ratio, the inclusion of BES or BES plus
sulphate resulted in enhanced H2/CO2 conversion (Fig. 2b).
Inclusion of Mo in test vials resulted in a decrease in the
SMA activity to 131.2 mL CH4 g1 VSS d1 (Table 3), suggesting that both HMPA and HSRB were involved in
c
Granule or particle size distribution analysis was carried out
by the wet sieving method in accordance with British
Standard (BS) Methods 1377: Part 2: British Standard 1377
(1990). Biomass samples were prepared and examined by
SEM using the method of Bitton & Marshall (1980) as
modified by O’Kelly (1987). 16S rRNA-targeted in situ
hybridization, combined with CLSM, was used to elucidate
and visualize the spatial distribution of certain microbial
populations within the sludge. Biomass samples before and
during the trial were analysed by FISH as described by
Sekiguchi et al. (1999). Four 16S rRNA-targeted probes were
used in this study, consisting of domain-specific probes for
Eubacteria and Archaea and genus-specific probes for Desulfovibrio and Methanosaetaceae (Table 2). These probes
were synthesized by Oswel DNA Laboratories (Southampton, UK) and labelled with either Cy-5 or rhodamine
fluorescent dyes. The sections hybridized with the probes
were observed with a confocal laser scanning microscope
(Zeiss LSM 510 system with LSM 510 control software
Version 2.8).
degradation did not occur in vials containing BES and BES
and SO42, suggesting that acetate-utilizing SRB did
not play a significant role in acetate conversion at any of
the three COD/SO42 ratios applied either to the seed or
R1 sludges.
The dominance of acetate-utilizing MPA (AMPA) in
sludge samples developed at the three COD/SO42 ratios
was confirmed by analysis of biogas evolution in test vials
(Figs 1a(ii), b(ii), c(ii)). The SMA values obtained in test
vials containing acetate only indicated that growth of AMPA
continued in R1 despite the decreasing COD/SO42 ratios
imposed – i.e. the highest SMA value for acetate
(151.4 mL CH4 g1 VSS day1) was recorded for R1 biomass
sampled at an influent COD/SO42 ratio of 2 (influent
sulphate concentration of 6 g l1) (Table 3). The inability of
any of the three sludge samples to degrade acetate in test
vials containing BES and sulphate (Fig. 1a(i), b(i), c(i))
indicated that acetate-utilizing SRB (ASRB) were not present in the seed sludge and had not developed in R1
throughout the trial.
144
10
3000
(ai)
2000
1500
1000
6
4
2
500
0
0
0
10
20
30
0
2500
10
(bi)
2000
10
20
30
(bii)
Biogas (mL)
8
1500
1000
500
6
4
2
0
0
0
2000
5
10
15
20
25
0
10
20
30
10 (cii)
(ci)
8
1500
Biogas (mL)
Acetate concentration (mg L−1)
(aii)
8
Biogas (mL)
2500
1000
500
6
4
2
0
0
0
10
20
30
Time (hrs)
0
10
20
30
Time (hrs)
40
Fig. 1. Acetate depletion (i) and biogas formation (ii) in activity test vials containing seed sludge (a) and R1 sludge (b and c) developed at influent COD/
SO4 2 ratios of 16, 4 and 2, respectively. Symbols:
: acetate;
: acetate1SO4;
: acetate1bromoethane sulphonic acid (BES);
: acetate1BES1SO4;
: acetate1Molybdate (Mo);
: acetate1Mo1SO4 and
: Blank vials.
hydrogen conversion at this influent COD/SO42 ratio. The
hydrogenotrophic SMA value obtained for R1 sludge
sampled at the lower COD/SO42 influent ratio of 2 : 1 was
significantly lower than for the previous sludge samples
(Table 3) and tests took c. 100 h for completion compared
with 25–50 h for seed and R1 sludges sampled at influent
COD/SO42 ratios of 16 and 4 (Fig. 2). The most rapid rate
of H2/CO2 conversion occurred in vials with SO42, followed
by those supplemented containing SO42 and BES (Fig. 2c),
suggesting the dominance of the HSRB population. The low
SMA results for vials containing the SRB inhibitor, Mo,
supported this assumption (Table 3).
Propionate-degrading syntrophs
Specific methanogenic activity values recorded against propionate were very low by comparison with the values
obtained for acetate and H2/CO2 (Table 3) and the activity and competition tests were of very long duration
c
Table 3. The specific methanogenic activity profiles of the seed sludge
and R1 sludge sampled at the two different influent COD/SO4 2 ratios in
the presence and absence of sulphate, Molybdate (Mo) and sulphate
plus Mo
Specific methanogenic
activity (SMA)
(mL CH4 gVSS1 day1 (STP))
COD/SO4 2
Acetate
Acetate1SO4 2
Acetate1Mo
Acetate1Mo1SO4 2
H2/CO2
H2/CO21SO4 2
H2/CO21Mo
H2/CO21Mo1SO4 2
Propionate
Propionate1SO4 2
Propionate1Mo
Propionate1Mo1SO4 2
16 : 1(S)
97.7
64
87.8
67.7
161.3
174.5
164.8
165.4
8.2
9
0.6
0.4
4 : 1(R1)
133.4
85.9
119.7
87.5
163.9
78.7
131.2
68.2
19.1
6.9
12.1
5.2
2 : 1(R1)
151.4
80.2
180.9
93.4
91.3
41.8
60.9
35.1
5.6
14
2.9
4.9
145
Pressure decrease (mv)
(a) 180
160
140
120
100
80
60
40
20
0
0
5
10
15
20
25
(b) 180
140
120
100
80
60
40
20
0
0
20
40
60
80
(c) 180
160
140
120
100
80
60
40
20
0
0
20
40
60
Time (hrs)
80
100
Fig. 2. Pressure decrease in vials with H2/CO2, containing seed sludge
(a) and R1 sludge (b and c) developed at influent COD/SO4 2 ratios of 16,
: H2/CO2;
: H2/CO21SO4;
4 and 2, respectively. Symbols:
: H2/CO21bromoethane sulphonic acid (BES);
:
: H2/CO21Molybdate (Mo);
: H2/
H2/CO21BES1SO4;
CO21Mo1SO4 and
: Blank vials.
(c. 600 h)(Fig. 3). The fact that propionate is not a direct
methanogenic substrate also made interpretation of the test
data more difficult. Analysis of substrate depletion, formation of intermediates, such as acetate, and biogas production
in test vials was more useful in evaluating the involvement of
OHPA, SRB and MPA in propionate conversion (Figs 4a–c).
With seed sludge developed at an influent COD/SO42
ratio of 16, propionate depletion was shown to occur only in
test vials containing sulphate or sulphate plus BES. In the
presence of sulphate, propionate conversion was accompanied by biogas formation [Fig. 3a(ii)] and acetate did not
accumulate during the incubation period (Fig. 4a). When
c
160
BES was included together with sulphate, propionate depletion was accompanied by a parallel increase in test vial
concentrations of acetate (Fig. 4a).
These results suggest that incomplete propionate-degrading SRB were outcompeting the obligate hydrogen producing acetogens (OHPA) and that propionate conversion by
the seed sludge, developed on an influent COD/SO42 ratio
of 16, occurred via the combined action of incomplete
propionate-degrading SRB and AMPA. No propionate degradation occurred in test vials containing Mo, either in the
presence or absence of sulphate, again indicating the dominance of propionate-utilizing SRB in propionate conversion
by the seed sludge.
With biomass developed in R1 at an influent COD/SO42
ratio of 4, propionate depletion occurred in all test vials
with the exception of vials to which BES only (i.e. no
sulphate) was supplemented [Fig. 3b(ii)]. The most rapid
rates of propionate depletion and biogas evolution were
obtained in vials to which neither sulphate, BES nor Mo
(nor any combinations, thereof) were added [Fig. 3b(i)
& (ii)]. This finding suggested the presence in the biomass
of a syntrophic population which degraded propionate,
provided low H2 partial pressures were maintained by
either HSRB or HMPA. The accumulation of acetate in
test vials containing propionate, BES and sulphate indicated
the absence, in the test biomass, of an acetate-utilizing
SRB population.
The fastest rate of propionate conversion occurred in vials
supplemented with Mo, in the presence and absence of
sulphate, from biomass sampled from R1 at an influent
COD/SO42 ratio of 2, followed closely by vials containing
BES plus sulphate [Fig. 3c(i)]. It appears that when either of
the two major groups are inhibited, competition for the
substrate ceases and propionate conversion proceeds. In the
absence of these inhibitors, there appears to be active
competition between the propionate-utilizing SRB and the
syntrophs for propionate and conversion rates are slower.
Degradation proceeded in the absence of sulphate, demonstrating the role of the OHPA and indicating that the SRB
had not completely replaced the syntrophs. The OHPA were
still active in propionate conversion at this ratio as seen from
Fig. 3c(ii). The highest rate of biogas formation occurred
when the SRB were inhibited and the OHPA, in syntrophy
with the MPA, degraded propionate. The SRB species were
not involved in complete conversion of propionate as there
was significant acetate accumulation in vials containing BES
(Fig. 4c). However, the presence of sulphate at this increased
level had a negative impact on the MPA. The specific
methanogenic activity decreased significantly at this ratio,
from 19 mL CH4 g1 VSS d1 (STP) at COD : SO42 of 4 to
5.6 mL CH4 g1 VSS d1 (STP) (Table 3) and biogas formation in vials without Mo occurred at a decreased level after a
lengthy test period [Fig. 3c(ii)]. It would appear, therefore,
146
(aii) 12
2500
10
2000
Biogas (mL)
Propionate
Concentration (mg L−1)
(ai)
1500
1000
500
0
200
300
400
0
500
(bii) 12
2000
10
Biogas (mL)
2500
1500
1000
500
0
100
200
8
6
4
2
0
200
400
0
600
0
100
200
300
0
300
600
Time (hrs)
900
(cii) 14
2500
12
2000
Biogas (mL)
Propionate
4
1500
1000
500
10
8
6
4
2
0
0
0
200
400
Time (hrs)
600
800
Fig. 3. Propionate depletion (i) and biogas formation (ii) in activity test vials containing seed sludge (a) and R1 sludge (b and c) developed at influent
COD/SO4 2 ratios of 16, 4 and 2, respectively. Symbols:
: propionate;
: propionate1SO4;
: propionate1bromoethane sulphonic
: propionate1BES1SO4;
: propionate1Molybdate (Mo);
: propionate1Mo1SO4 and
: Blank vials.
acid (BES);
that propionate conversion involved both the incompletely
oxidizing SRB and the OHPA, followed by the AMPA
and possibly the HSRB species. The involvement of the
HSRB may account for the lower SMA and biogas formation
at this ratio.
The effect of influent COD/SO42-- on granule size
distribution of EGSB reactor sludge
The majority of the granules in the seed sludge and the
reactor sludges were greater than 0.6 mm. It is clear that the
sludge retained its granular nature throughout the reactor
trial, despite inclusion of sulphate at influent concentrations
as high as 6000 mg L1. The predominant granule size in the
seed sludge and in the R1 reactor biomass was found to be
greater than 1.18 and less than 2 mm.
c
Scanning electron microscopy of the sludge at
varying COD/SO42-- ratios
Sludge samples from the EGSB reactor, R1, were removed at
different times during the trial and scanning electron
microscopic observations were made of the macro- and
microstructure of the granules. While the bacteria could not
be identified by morphology alone, it was of interest to
examine the surface of the granules for any distinct structures, assemblages or changes. The granules were irregular,
well-defined porous spheres and that this configuration was
maintained throughout the trial, despite inclusion of sulphate at 6 g L1 in the influent. A dark brown/black colouring was observed in the seed sludge and was still apparent on
completion of the reactor trials. The appearance and distribution of bacteria by SEM at the outer surface of
the granules at three varying COD/SO42 ratios are shown
Propionate
100
0
(ci)
6
2
0
(bi)
8
147
(a)
appeared to be present in the sludge granules from the
beginning of the trial. The presence of short or straight
curved rods, morphologically similar to Desulfovibrio sp., as
well as bulb-shaped coccobacilli, resembling Desulfobulbustype species, were frequently observed in the R1 biomass.
This bacterial diversity was retained at the lower COD/SO42
ratios, but Methanosaeta appeared to become more dominant (Fig. 5d).
1400
1200
1000
800
600
400
200
0
(b)
200
300
400
500
600
2500
Analysis of the microbial community structure by
Fluorescent in situ hybridization (FISH)
The hybridizations shown in Figs 6 and 7 are representative
of several independent hybridizations of a large number of
individual granules.
2000
1500
1000
Overall structure of the granules
500
0
0
(c)
100
100
200
300
400
500
600
2500
2000
1500
1000
500
To visualize all Eubacteria and Archaea in the granules, the
Cy-5-labelled EUB338 probe (green) and the rhodaminelabelled ARC915(red) probe were used simultaneously in
sections of the granular sludge. As shown in Fig. 6, both
types of granule showed a characteristic structure; the outer
layer was dominated by bacterial cells and was c. 50 mm
thick, whereas the inner layer was occupied mainly by
archaeal cells interspersed with bacterial cells. There was
no discernible difference between granules from the high
influent sulphate stage of the trial (COD/SO42 ratio of 6)
(Fig. 6a) and the low influent sulphate period (COD/SO42
ratio of 2)(Fig. 6b).
0
0
200
400
Time (hrs)
600
800
Fig. 4. Acetate accumulation in propionate test vials, containing seed
sludge (a) and R1 sludge (b and c) developed at influent COD/SO4 2
ratios of 16, 4 and 2, respectively. Symbols:
: propionate;
: propionate1SO4;
: propionate1bromoethane sulpho: propionate1BES1SO4;
: propionate1
nic acid (BES);
Molybdate (Mo);
: propionate1Mo1SO4.
in Fig. 5. A heterogeneous microbial population was present
at the surface of seed sludge granules and R1 granules
sampled at the different influent COD/SO42 ratios applied
(Fig. 5). This consisted of a variety of single rods, filamentous rods and cocci. Although the seed sludge granules
(influent COD/SO42 ratio of 16) comprised of a large
diversity of bacterial morphotypes, microcolonies of single
bacterial species (e.g. Methanosaeta-like rods) were evident,
as shown in Fig. 5b. Methanosaeta-like bacteria were shown
to be present as rods and in the filamentous form. Long thin
filaments, possibly Methanobacterium bryantii or Methanobacterium formicicum, were also found on the granule surface along with Methanosarcina-like aggregates (Fig. 5a).
Bacterial cells resembling well known sulphate reducers
In situ hybridization with Desulfovibrio cells in the
granules
The distribution and relative abundance of members of the
family Desulfovibrio within the Eubacterial population was
determined by in situ probing with the rhodamine-labelled
DSV 687 probe (red) and the Cy-5-labelled EUB 338 (green).
The results obtained are shown in Fig. 7. Simultaneous hybridization of the sections with both probes results in yellow
fluorescence. Yellow fluorescence in a substantial region of
both of the granules indicated the presence of Desulfovibrio sp.,
with greater abundance of the sulphate reducers in granules
sampled at the high influent sulphate stage of the trial (Fig. 7b).
Discussion
Outcome of competition from biomass sampled
at different sulphate loading rates
It was apparent from this study that ASRB could not outcompete AMPA as the predominant acetotrophic organisms
at the COD/SO42 ratios applied. When the MPA species
were inhibited by BES in test vials, acetate degradation was
c
0
148
Fig. 6. Simultaneous in situ hybridization of
sections of the EGSB R1 granules with EUB 338
bacterial probe (green) and ARC 915 archaeal
probe (red) viewed by confocal laser scanning
microscopy. (a) Sludge sampled at an influent
COD/SO4 2 ratio of 8. (b) Sludge sampled at an
influent COD/SO4 2 ratio of 2. Inset 4 magnification.
negligible. This dominance of AMPA was reported by a
number of other authors (Hoeks et al., 1984; Harada et al.,
1994; Visser, 1995; Yamaguchi et al., 1997; Colleran et al.,
1998; O’Flaherty et al., 1998; Fukui et al., 2001).
However, other studies have shown the dominance of
ASRB over AMPA for acetate in bioreactors treating sul2006 Federation of European Microbiological Societies
c
phate-containing wastewaters (Yoda et al., 1987; Rinzema &
Lettinga, 1988; Choi & Rim, 1991; Alphenaar et al., 1993;
Stucki et al., 1993; Visser, 1995; Omil et al., 1996, 1997;
Yamaguchi et al., 1999; Philpott, 2000). These contradictory
findings may be related to differences in acetate, sulphate
and sulphide concentrations which prevailed in the systems
Fig. 5. Scanning electron micrographs showing
the microstructure of seed sludge granules (a)
and of R1 granules sampled at influent COD/
SO4 2 concentrations of 16 (b), 4 (c) and 2 (d).
149
Fig. 7. Simultaneous in situ hybridization of
sections of the EGSB R1 granules with EUB 338
bacterial probe (green) and DSV 687 Desulfovibrio sp. probe (red) viewed by confocal laser
scanning microscopy. (a) Sludge sampled at an
influent COD/SO4 2 ratio of 8 (b) Sludge
sampled at an influent COD/SO4 2 ratio of 2.
propionate degrading SRB clearly show that they have a
competitive advantage over OHPA and this was shown to be
true in many studies (Isa et al., 1986; Visser et al., 1993). In
reactors operating at low influent sulphate concentrations
(high COD : SO42 ratios), the outcome of competition is
not so clear. In the current study, at influent COD/SO42
ratios of 4 and 2, it would appear that propionate conversion
involved both incompletely oxidizing SRB and OHPA, followed by the involvement of AMPA and possibly HSRB
species. Under sulphate limiting conditions, propionatedegrading SRB are not very effective competitors for H2
consuming SRB (Visser, 1995). Therefore, at the COD/SO42
ratios of 4 and 2, the propionate degrading SRB species had to
compete with HSRB. This could enable the propionate
utilizing OPHA to compete with the SRB, as was observed
in this study.
Characterization of granular sludge
The results obtained showed that the granular nature of the
sludge was retained during operation under different sulphate loading rates (up to influent concentrations of
6000 mg L1 sulphate). In addition to the use of a granular
source of seed sludge and application of reactor operational
parameters that favoured granulation, dilution of the influent feed with tap water may have resulted in an increase in
granule strength and stability due to mineral deposits i.e.
calcium. Divalent cations (Ca21, Fe21, Mg21, etc.) are
reported to bridge negatively charged bacteria together,
thereby promoting initial bacterial adhesion (Lettinga et al.,
1980). Granule diameter, however, did not increase in size
significantly during reactor operation, possibly because their
initial size already corresponded to a state of equilibrium
between growth and decay. Granule size analysis alone is not
a sufficient parameter for indication of granule stability. The
hydraulic loading rate (or upward liquid velocity) and the
gas loading rate, originating from methane production, also
play an important role in the granulation process (Wiegant
& Lettinga, 1985; Wiegant, 1988; Lens et al., 2003).
c
under investigation, the pH and duration of the experiments
and the reactor design. (Visser et al., 1993) found that
retained biomass reactors promoted dominance of AMBA
over ASRB and this is supported by findings of the superior
attachment properties of AMPA (Isa et al., 1986; Omil et al.,
1996, 1997; Shin et al., 1997).
HSRB were found to play a more significant role in the
conversion of hydrogen in the present study but did not
become completely dominant. HMPA were responsible for
hydrogen utilization in the seed sludge at an influent COD/
SO42 ratio of 16, and were still dominant in R1 when the
ratio was reduced to 4. It was only when the COD/SO42
ratio was reduced to 2 that the HSRB assumed a more
influential role and SMA values were significantly reduced.
These results showed that the SRB were not able to
completely replace the MPA in the sludge and are in
disagreement with much of the literature which states
that, at high influent sulphate concentrations, H2 is completely used by SRB (Mulder, 1984; Rinzema et al., 1986;
Alphenaar et al., 1993; Visser et al., 1993; Omil et al., 1997;
Yamaguchi et al., 1997; O’Flaherty et al., 1998; de Smul &
Verstaete, 1999).
The results presented in the present study revealed a
significant SRB involvement in propionate degradation.
Propionate conversion by the seed sludge (COD/SO42 ratio
of 16) appeared to be mediated by the combined action of
incomplete propionate-degrading SRB and AMPA. Incomplete oxidation of propionate to acetate by SRB has been
reported by a number of authors to be the key degradation
pathway involved (Mulder, 1984; Ueki et al., 1988; Qatibi
et al., 1990; Heppner et al., 1992; Omil et al., 1996;
O’Flaherty et al., 1998). Thermodynamic considerations
predict that propionate-OHPA bacteria should be outcompeted by complete or incomplete propionate-utilizing
SRB in the presence of sulphate (Widdel, 1988; Uberoi &
Bhattacharya, 1995; Omil et al., 1996). The DG1 (kJ/mol) for
the OHPA reaction is 176.1 compared to –37.8 for propionate oxidation by SRB (Laanbroek et al., 1984). In conditions of excess sulphate, the growth kinetic properties of
150
c
granule, however, would be most suitable for Methanosaeta
species, which have the lowest Ks (highest substrate affinity)
of the acetoclastic methanogens – i.e. the least sensitivity to
acetate diffusional limitation (Guiot et al., 1992).
Using rRNA-based molecular probes, Raskin et al. (1995)
characterized the competition in anaerobic biofilm reactor
communities in a sulphate rich environment. These authors
reported that SRB were never able to completely outcompete
methanogens. The coexistence of SRB and methanogens in
the presence of nonlimiting sulphate conditions has been
reported in the literature (Isa et al., 1986; Nielsen, 1987;
Yoda et al., 1987). SRB species are reported to occupy the
outer layer (50–100 mm) (Santegoeds et al., 1999; Sekiguchi
et al., 1999). The diffusional limitation of sulphate has been
suggested as a reason for the maintenance of MPA instead of
SRB in the internal core of aggregates treating sulphate-rich
wastewaters (Overmeire et al., 1994). Population distributions, determined by molecular probes, do not necessarily
correspond to microbial activity distributions, since bacterial populations can have very low or unpredictable activities
(Santegoeds et al., 1999). Ito et al. (2002) emphasized the
importance of combining molecular techniques with activity measurements due to certain biases or insufficiencies
associated with the former. Microsensor measurements of
activity in methanogenic-sulphidogenic aggregates have
revealed a distinct layered structure, with sulphate reducing
bacteria in the outer 50–100 mm, methanogens in the inner
part, and Eubacteria sp. (partly syntrophic bacteria) filling
the gap between SRB and MPA (Santegoeds et al., 1999).
Raskin et al. (1994, 1995) determined that the presence of
SRB (especially Desulfovibrio-species) in sludge granules was
not dependent upon the presence of sulphate, suggesting
that Desulfovibrio-species could be acting as acetogens
(OHPA). In addition to their ability to compete with
methanogens or OHPA for available electrons in the presence of nonlimiting sulphate concentrations, several SRB
have been shown to grow fermentatively on a number of
substrates, including propionate and ethanol, in a manner
similar to proton-reducing acetogens (Wu et al., 1992). This
could explain the large populations of SRB in sulphatedepleted environments (Wu et al., 1991, 1992).
Conclusions
The data obtained in this study clearly indicate that the
bacterial interactions in reactors treating sulphate wastestreams are very complex. No substrate seemed to be
completely degraded by either sulphate reducers, methanogens or acetogens. However, at an influent COD/SO42 ratio
of 2 : 1, there was evidence that acetate and hydrogen were
mainly degraded by methanogens and propionate was the
preferred substrate for sulphate reducers. The predominance
of HMPA over HSRB was unusual as HSRB are generally
Maintenance of a granule results from the interactions
between individual microorganisms. Preliminary attempts
were made in the present study to examine the population
structure and morphology of the anaerobic consortia within
the developed granules. No obvious division or layering
structure was evident in the different granules investigated
by scanning electron microscopy. A diverse variety of rods,
cocci and filamentous bacteria were observed, with Methanosaeta-like species most obvious. From the SEM micrographs obtained in the current study, the compaction of the
bacteria was evident, and this close structural arrangement is
useful when one cell type is physiologically dependent on
another. Our preliminary SEM observations corresponded
with the proposal by Morgan et al. (1991) that granules are
basically composed of numerous discrete bundles or microcolonies of Methanosaeta, separated by a less compact
matrix containing a heterogeneous population of bacteria,
and that the spatial arrangement of these two basic components differs, depending upon the depth of the granule. The
observed microcolonies in Fig. 5a and c may correlate to the
cluster morphology described by Gonzalez-Gil et al. (2001),
but the sample areas analysed by SEM were too small and
random for this to be conclusive.
While the SEM investigations in this study were inadequate in providing information to relate granule morphology to function, in situ hybridization with domain- and
species-specific oligonucleotide probes provided more useful information on spatial distribution. A multiple-microbial-layer structure in the granule was demonstrated by
applying double staining to the sections with Eubacterialand Archaeal-domain probes. Hybridization of the reactor
sludge from R1 with the EUB338 and ARC915 probes
showed a layered architecture with an outer layer harbouring mainly Eubacterial cells and an inner layer dominated by
Archaeal species. Similar layered structures were reported by
MacLeod et al. (1990), Harmsen (1996), Sekiguchi et al.
(1999) and Liu et al. (2002) for anaerobic sludges granules
degrading glucose, sucrose, starch and brewery wastewater.
Archaea made up a considerable proportion of the active
biomass in all samples, as determined by FISH. Wu et al.
(1991) found that 30–40% of the total area of thin sections
of granules was comprised of Methanosaeta microcolonies.
Similarly, Liu et al. (2002) found that the dominant member
of the archaeal cells in brewery wastewater-degrading granules was also the genus Methanosaeta (34.2% of total
archaeal rRNA) and that these species of this genus were
present primarily at the centre core of the granules.
Although Methanosaeta appeared abundant in granules
sampled in the present study, there was no evidence from
in situ hybridization to suggest a dominance of the species in
the centre of granules. Instead, probe-binding to Methanosaeta was randomly distributed throughout the granules
investigated. It has been suggested that the centre of the
151
found to predominate in mesophilic anaerobic bioreactors
treating sulphate wastewaters.
It is clear that the outcome of competition does not
depend on one single factor (i.e. influent COD/SO42 ratio,
or temperature, or type of sludge) but on a combination of
factors. However, the application of the variety of degradative, toxicity, microscopic and molecular techniques utilized
in the present study provided useful information on competitive bacterial interactions during anaerobic treatment of
sulphate wastestreams under mesophilic conditions.
References
c
Alphenaar PA, Visser A & Lettinga G (1993) The effect of liquid
upward velocity and hydraulic retention time on granulation
in UASB reactors treating wastewater with a high sulphate
content. Bioresour Technol 43: 249–258.
Amann RL, Krumholz L & Stahl DA (1990) Fluorescentoligonucleotide probing of whole cells for determinative,
phylogenetic, and environmental studies in microbiology.
J Bacteriol 172: 762–770.
Bitton G & Marshall KC (1980) Adsorption of microorganisms to
surfaces. John Wiley and Sons, New York.
British Standard 13 (1990) Soil testing for civil engineering
purposes. British Standards Institution.
Choi E & Rim JM (1991) Competition and inhibition of sulfate
reducers and methane producers in anaerobic treatment.
Water Sci Technol 23: 1259–1264.
Colleran E & Pistilli A (1994) Activity test system for determining
the toxicity of xenobiotic chemicals to the methanogenic
process. Ann Microbiol Enzymol 44: 1–18.
Colleran E, Pender S, Philpot U, O’Flaherty V & Leahy B (1998)
Full-scale and laboratory-scale anaerobic treatment of citric
acid production wastewater. Biodegradation 9: 233–245.
Fukui M, Suh J-I & Urushigawa Y (2001) In situ substrates for
sulfidogens and methanogens in municipal anaerobic sewage
digesters with different levels of sulfate. Water Res 34:
1515–1524.
Gonzalez-Gil G, Lens P, van Aelst AC, Van As H, Versprille AI &
Lettinga G (2001) Cluster structure of anaerobic aggregates of
an expanded granular sludge bed reactor. Appl Environ
Microbiol 67: 3683–3692.
Guiot SR, Arcand Y & Chavarie C (1992) Advantages of
fluidization on granule size and activity development in
upflow anaerobic sludge bed reactors. Water Sci Technol 26:
897–906.
Harada H, Uemuru S & Momonoi K (1994) Interaction between
sulfate-reducing bacteria and methane-producing bacteria in
UASB reactors fed with low strength wastes containing
different levels of sulfate. Water Res 28: 355–367.
Harmsen HJM (1996) Detection, phylogeny and population
dynamics of syntrophic propionate-oxidizing bacteria in
anaerobic granular sludge. PhD thesis. Department of
Microbiology, Wageningen Agricultural University, the
Netherlands.
Heppner B, Zellner G & Dickmann H (1992) Start-up and
operation of a propionate-degrading fluidized-bed reactor.
Appl Microbiol Biotechnol 36: 810–816.
Hoeks FWJMM, Hoopen HJGT, Roels JA & Kuenen JG (1984)
Anaerobic treatment of ‘acid water’ (methane production in a
sulfate-rich environment). Progr Indus Microbiol 20: 113–119.
Isa Z, Grusenmeyer S & Verstraete W (1986) Sulfate reduction
relative to methane production in high-rate anaerobic
digestion: microbiological aspects. Appl Environ Microbiol 51:
580–587.
Ito T, Nielsen JL, Okabe S, Watanabe Y & Nielsen PH (2002)
Phylogenetic identification and substrate uptake patterns of
sulfate-reducing bacteria inhabiting an oxic-anoxic sewer
biofilm determined by combining microautoradiography and
fluorescent in situ hybridization. Appl Environ Microbiol 68:
356–364.
Laanbroek HJ, Geerlings H, Sitjtsma L & Veldkamp H (1984)
Competition for sulphate and ethanol among Desulfobacter,
Desulfobulbus and Desulfovibrio species isolated from intertidal sediments. Appl Environ Microbiol 128: 329–334.
Lens PNL, Visser A, Janssen AJH, Hulshoff Pol LW & Lettinga G
(1998) Biotechnological Treatment of Sulfate-rich
wastewaters. Crit Rev Environ Sci Technol 28: 41–88.
Lens PNL, Klijn R, van Lier JB & Lettinga G (2003) Effect of
specific gas loading rate on thermophilic (55 1C) acidifying
(pH 6) and sulfate reducing granular sludge reactors. Water
Res 37: 1033–1047.
Lettinga G, van Velsen AFM, Hobma SW, de Zeeuw W &
Klapwijk A (1980) Use of the upflow sludge blanket (UASB)
reactor concept for biological wastewater treatment, especially
for anaerobic treatment. Biotechnol Bioeng 22: 699–734.
Lin C, Raskin L & Stahl DA (1997) Microbial community
structure in gastrointestinal tracts of domestic animals:
comparative analysis using rRNA-targeted oligonucleotide
probes. FEMS Microbiol Ecol 22: 281–294.
Liu W-T, Chan O-C & Fang HHP (2002) Characterization of
microbial community in granular sludge treating brewery
wastewater. Water Res 36: 1767–1775.
MacLeod FA, Guiot SR & Costerton JW (1990) Layered structure
of bacterial aggregates produced in an upflow anaerobic sludge
bed and filter reactor. Appl Environ Microbiol 56: 1598–1607.
Morgan JW, Evison LM & Forster CF (1991) The internal
architecture of anaerobic sludge granules. J Chem Tech
Biotechnol 50: 211–226.
Mulder A (1984) The effects of high sulphate concentrations on
the methane fermentation of wastewater. Progr Indust
Microbiol 20: 133–143.
Nielsen PH (1987) Biofilm dynamics and kinetics during highrate sulfate reduction under anaerobic conditions. Appl
Environ Microbiol 53: 27–32.
O’Flaherty V, Lens P, Leahy B & Colleran E (1998) Long-term
competition between sulphate-reducing and methaneproducing bacteria during full-scale anaerobic treatment of
citric acid production wastewater. Water Res 32: 815–825.
152
c
Sekiguchi Y, Kamagata Y, Nakamura K, Ohashi A & Harada H
(1999) Fluorescence in situ hybridization using 16S rRNAtargeted oligonucleotides reveals localization of methanogens
and selected uncultured bacteria in mesophilic and
thermophilic sludge granules. Appl Environ Microbiol 65:
1280–1288.
Shin HS, Oh SE & Lee C-Y (1997) Influence of sulfur compounds
and heavy metals on the methanization of tannery wastewater.
Water Sci Technol 35: 239–245.
de Smul A & Verstaete W (1999) Retention of sulfate-reducing
bacteria in expanded granular-sludge-blanket reactors. Water
Environ Res 71: 427–431.
Stahl DA & Amann RI (1991) Development and application of
nucleic acid probes. Nucleic Acid Techniques in Bacterial
Systematics (Stackebrandt E & Goodfellow M, eds), John Wiley
and Sons Ltd, London, England.
Stucki G, Hanselmann K & Hurzerler A (1993) Biological sulfuric
acid transformation: reactor design and process optimization.
Biotechnol Bioeng 41: 303–315.
Toomey M (2002) Genetic Analysis of Anaerobic Digestion
Biomass in the Presence and Absence of Sulphate and Nitrite.
PhD thesis. Department of Microbiology, National University
of Ireland, Galway.
Uberoi V & Bhattacharya SK (1995) Interactions among sulfate
reducers, acetogens, and methanogens in anaerobic
propionate systems. Water Environ Res 67: 330–339.
Ueki K, Kotaka K, Itoh K & Ueki A (1988) Potential availability of
anaerobic treatment with digester slurry of animal waste for
the reclamation of acid mine water containing sulfate and
heavy metals. J Ferment Technol 66: 43–50.
Visser A (1995) The anaerobic treatment of sulphate containing
wastewater. PhD thesis, Wageningen Agricultural University,
Wageningen, the Netherlands.
Visser A, Beeksma L, van der Zee F, Stams AJM & Lettinga G
(1993) Anaerobic degradation of volatile fatty acids at different
sulphate concentrations. Appl Microbiol Biotechnol 40:
549–556.
Widdel F (1988) Microbiology and ecology of sulphate- and
sulphur-reducing bacteria. Biology of Anaerobic
Microorganisms (Zehnder AJB, ed), pp. 469–586. John Wiley
and Sons, New York.
Wiegant WM (1988) The ‘Spaghetti theory’ on anaerobic sludge
formation, or the inevitability of granulation. Granular
Anaerobic sludge: Microbiology and Technology (Lettinga G,
Zehnder AJB, Grotenhuis JTC & Hulshoff Pol LW, eds),
pp. 146–152. Pudoc, Wageningen, the Netherlands.
Wiegant WM & Lettinga G (1985) Thermophilic anaerobic
digestion of sugars in upflow anaerobic sludge blanket
reactors. Biotechnol Bioeng 27: 1603–1607.
Wu W-M, Hickey RF & Zeikus JG (1991) Characterization of
metabolic performance of methanogenic granules treating
brewery wastewater: role of sulfate-reducing bacteria. Appl
Wu W-M, Jain MK, Conway DME, Thiele JH & Zeikus JG (1992)
Microbial composition and characterisation of prevalent
O’Kelly (1987) Anaerobic digestion in fixed-film reactors. PhD
thesis. National University of Ireland, Galway.
O’Reilly C (2003) Biological treatment of sulphate-containing
industrial wastewater. PhD thesis, National University of
Ireland, Galway.
Omil F, Lens P, Visser A, Hulshoff Pol LW & Lettinga G (1996)
Effect of upward velocity and sulphide concentration on
volatile fatty acid degradation in a sulphidogenic granular
sludge reactor. Proc Biochem 31: 699–710.
Omil F, Lens P, Hulshoff Pol LW & Lettinga G (1997)
Characterization of biomass from a sulfidogenic, volatile fatty
acid-degrading granular sludge reactor. Enzyme Microb
Technol 20: 229–236.
Oude Elferink SJWH, Vorstman WJC, Sopjes A & Stams AJM
(1998) Characterization of the sulfate-reducing and
syntrophic population in granular sludge from a full-scale
anaerobic reactor treating papermill wastewater. FEMS
Microbiol Ecol 27: 185–194.
Overmeire A, Lens P & Verstraete W (1994) Mass transfer
limitation of sulfate in methanogenic aggregates. Biotechnol
Bioeng 44: 387–391.
Philpott U (2000) Mesophilic and thermophilic UASB treatment
of sulphate-containing wastewater. PhD thesis, National
University of Ireland, Galway.
Purdy KJ, Nedwell DB, Embley TM & Takii S (2001) Use of 16S
rRNA-targeted oligonucleotide probes to investigate the
distribution of sulphate-reducing bacteria in estuarine
sediments. FEMS Microbiol Ecol 36: 165–168.
Qatibi A, Bories A & Garcia PA (1990) Effects of sulphate on
lactate and C2-, C3-volatile fatty acid anaerobic degradation by
a mixed microbial culture. Antonie van Leeuwenhoek 58:
241–248.
Raskin L, Stromley JM, Rittmann BE & Stahl DA (1994) Groupspecific 16S rRNA hybridization probes to describe natural
communities of methanogens. Appl Environ Microbiol 60:
1232–1240.
Raskin L, Zheng D, Griffin ME, Stroot PG & Misra P (1995)
Characterization of microbial communities in anaerobic
bioreactors using molecular probes. Antonie van Leeuwenhoek
68: 297–308.
Rinzema A & Lettinga G (1988) The effect of sulphide on the
anaerobic degradation of propionate. Environ Technol Lett 9:
83–88.
Rinzema A, Paardekooper A, DeVegt AL & Lettinga G (1986)
Anaerobic treatment of edible oil refinery wastewater in
granular sludge UASB reactors. Paper presented at The
Proceedings of the NVA/EWPCA Conference, Anaerobic
Treatment a Grown-up Technology (pp. 205–217),
Amsterdam, the Netherlands.
Santegoeds CM, Damgaard LR, Hesselink G, Zopfi J, Lens P,
Muyzer G & De Beer D (1999) Distribution of sulfate-reducing
and methanogenic bacteria in anaerobic aggregates
determined by microsensor and molecular analyses. Appl
153
methanogens and acetogens isolated from syntrophic
methanogenic granules. Appl Environ Microbiol 9: 77–82.
Yamaguchi T, Harada H & Tseng I-C (1997) Competitive
exclusion of methane-producing bacteria by sulfate-reducing
bacteria in anaerobic degradation of long-chain fatty acids.
Proceedings from the 8th International Conference on
Anaerobic Digestion, Sendai International Centre, Sendai,
Japan.
Yamaguchi T, Harada H, Hisano T, Yamazaki S & Tseng I-C
(1999) Process behavior of UASB reactor treating a
wastewater containing high strength sulfate. Water Res 33:
3182–3190.
Yoda M, Kitagawa M & Miyaji Y (1987) Long-term competition
between sulphate-reducing bacteria and methane-producing
bacteria for acetate in anaerobic biofilm. Water Res 21:
1547–1556.
c

Effect of influent COD/SO42− ratios on mesophilic anaerobic reactor

Transcription

Similar documents

R9008928123 Raaco Dulapuri pentru depozit 928-123

Site Partner Supervision - Christin Marshall, AmeriCorps Cape Cod

Lamella - Hydro International

Decentralized Faecal Sludge Treatment (DEFAST) and Reuse

Rhodium sulphate plating solution RJ100S

Barnstable County AmeriCorps Cape Cod FireCorps

Introduction to Paques