Hyperglycemia suppresses hepatic scavenger receptor

Page Articles
1 of 50 in PresS. Am J Physiol Endocrinol Metab (October 23, 2007). doi:10.1152/ajpendo.00023.2007
Hyperglycemia suppresses hepatic scavenger receptor class B
type I expression.
By
Koji Murao*, Xiao Yu, Hitomi Imachi, Wen M. Cao, Ke Chen, Kensuke Matsumoto,
Takamasa Nishiuchi, Norman C.W. Wong1), Toshihiko Ishida.
Division of Endocrinology and Metabolism, Department of Internal Medicine, Faculty of
Medicine, Kagawa University, 1750-1 Ikenobe Miki-CHO, Kita-gun, Kagawa, Japan.
1) Departments of Medicine and Biochemistry & Molecular Biology, Faculty of
Medicine, University of Calgary, Health Sciences Center, 3330 Hospital Drive NW,
Calgary, Alberta, Canada, T2N 4N1.
Runnung head: Hyperglycemia on SR-BI expression.
Contact information
*Corresponding author
Koji Murao, M.D., Ph.D.
Division of Endocrinology and Metabolism,
Department of Internal Medicine,
Faculty of Medicine, Kagawa University
1750-1, Miki-cho, Kita-gun, Kagawa, 761-0793, Japan
Phone: 81-878-91-2145
FAX:
81-878-91-2147
E-mail: [email protected]
1
Copyright © 2007 by the American Physiological Society.
Page 2 of 50
Abstract
Hyperglycemia is a major risk factor for atherosclerotic disease. Hepatic
scavenger receptor class B type I (SR-BI) binds HDL particles that mediate reverse
cholesterol transport and thus, lowers the risk of atherosclerosis. Here, we examined
glucose regulation of SR-BI gene expression in both HepG2 cells and whole animals.
Results showed that hepatic SR-BI mRNA, protein and uptake of cholesterol from HDL
were halved following 48 h of exposure to 22.4 vs 5.6 mM glucose. As in case of the cell
culture model, hepatic expression of SR-BI was lower in diabetic rats than in euglycemic
rats. Transcriptional activity of the human SR-BI promoter paralleled endogenous
expression of the gene and this activity was dependent on the dose of glucose. Next, we
used inhibitors of select signal transduction pathways to demonstrate that glucose
suppression of SR-BI was sensitive to the p38-MAPK inhibitor.
Expression of a
constitutively active p38-MAPK inhibited SR-BI promoter activity in the presence or
absence of glucose. A dominant-negative p38-MAPK abolished the inhibitory effect of
glucose on promoter activity. Deletional analysis located a 50-bp fragment of the
promoter that mediated the effects of glucose. Within this DNA fragment, there were
several Specificity protein-1 (Sp1) binding sites, celluar knock-down of Sp1 abrogated its
suppression by glucose. Together, these results indicate that the glucose suppression of
SR-B1 expression is partially mediated by the activation of the p38-MAPK/Sp1 pathway
and raise the possibility that the inhibition of hepatic SR-BI expression under high
glucose conditions provides a mechanism for accelerated atherosclerosis in diabetics.
Key
words:
HDL,
hyperglycemia,
2
SR-BI,
Diabetes,
atherosclerosis
Page 3 of 50
Introduction
Epidemiological data from the Framingham Study (34) and the Multiple Risk
Factor Intervention Trial (50) indicate that the risk for cardiovascular death is increased
2- to 3-fold in patients with type 2 diabetes mellitus (DM). Hyperglycemia is a major risk
for cerebrovascular disease (CVD) (43) and selected key pathways, factors, and
mechanisms have been implicated, such as oxidant stress (4), advanced glycation end
products (9), aldose reductase (23), reductive stress (24), carbonyl stress (5), and protein
kinase C (PKC) activity (31) including the p38-Mitogen-Activated Protein Kinase
(MAPK) pathway.
The p38-MAPK protein is a member of the mitogen-activated
serine/threonine protein kinase family that is activated following dual phosphorylation of
Thr180 and Tyr182 by an upstream MAP kinase kinase. In endothelial cells, this pathway
is activated by stress-inducing stimuli, including reactive oxygen species (ROS),
hyperglycemia, and proinflammatory cytokines, such as tumor necrosis factor (TNF) (51).
Activation of p38-MAPK regulates genes that mediate inflammation and the recruitment
of other inflammatory signaling pathways such as nuclear factor Kappa B (NF- B) and
arachidonate-signaling (13).
Thus, activation of the p38-MAPK pathway by
hyperglycemia could contribute significantly to the development of the vascular
complications of diabetes (45).
Mouse scavenger receptor class B type I (SR-BI) mediates selective uptake of
the high-density lipoprotein (HDL) cholesterol ester (CE) into transfected chinese
hamster ovary (CHO) cells. This finding provides an important link between a specific
cell surface receptor and the uptake of HDL (1, 33, 35). Our previous report shows that
3
Page 4 of 50
the human homologue of SR-BI (hSR-BI), CD36 and LIMPII Analogous-1 (CLA-1), like
the mouse homologue functions as a receptor for HDL (25-29, 40). Overexpression of
SR-BI in mouse liver dramatically decreases plasma HDL (35, 56) and increases hepatic,
gallbladder, and biliary cholesterol concentrations (35, 48). SR-BI is a well-characterized
HDL receptor that is highly expressed in the liver and in steroidogenic tissues in rodents
(54). Its human orthologue CLA-1 (hSR-BI) has also been shown as a receptor for HDL
(40). Despite the fact that hSR-BI has not been studied as extensively as rodent SR-BI,
the physiological role of hSR-BI is generally assumed to be similar to that of rodent
SR-BI.
Several studies have established the role of high plasma cholesterol and
triglyceride levels, and of low plasma HDL levels, as risk factors for atherosclerosis in
DM (3, 16, 53). HDL plays a critical role in cholesterol metabolism because it mediates a
normal physiological process, namely, reverse cholesterol transport (RCT) (20, 52). In
this process, HDL particles shuttle cholesterol from extra-hepatic tissues to the liver for
further metabolism and excretion (20).
Several studies have indicated that
hSR-BI/CLA-1 stimulates hepatic uptake of HDL free cholesterol and its transport into
bile (36). This information prompted us to speculate whether, glucose further regulates
hSR-BI. We expect that answers to this query may shed more light on the high risk of
atherosclerotic disease in the presence of DM.
Material and Methods
4
Page 5 of 50
Material. Wortmannin, LY294002, Bisindolylmaleimide I, SB203580 were purchased
from Calbiochem.
-Amanitin was purchased from Sigma (St. Louis, MO, USA) and
used at 2 µg/ml.
Cell culture. Human hepatoma HepG2 cells (obtained from RIKEN CELL BANK,
Ibaragi, Japan) were grown in DMEM (Life Technologies, Tokyo, Japan) supplemented
with 10% heat-inactivated fetal bovine serum (Dainippon Pharmaceutical Co, Ltd.,
Osaka, Japan).
Western bolt analysis. An antibody directed against the extracellular domain of hSR-BI
between amino acid residues 185 and 300 of the reported sequence of the isomer
containing 509 amino acid residues (10) was generated. The corresponding cDNA
fragment was amplified from THP-1 cDNA by PCR. The amplified fragment was
inserted into a pGEX-2T vector (Pharmacia) and sequenced, and the protein was
expressed
in
Escherichia
coli.
The
fusion
protein
was
isolated
with
glutathione-Sepharose 4B beads (Pharmacia) and used to generate an antiserum in guinea
pigs as described previously (40). The membranes were blocked with 0.1% Tween 20 in
PBS (PBS-T) containing anti-hSR-BI antibody (diluted 1/3,000 from whole antiserum)
(40) or anti-GAPDH antibody (Biomol Research, Plymouth Meeting, PA; diluted
1/1000).
Northern blot analysis. A full-length cDNA of hSR-BI was synthesized by PCR using
reverse-transcribed RNA from HepG2 cells and labeled with [32P]-dCTP (3000 Ci/mmol)
by the random priming method (Takara, Tokyo, Japan).
Electrophoresis and
hybridization were performed as described (41). Blots were also probed with human
5
Page 6 of 50
GAPDH to ensure equal loading of the RNA samples (41).
Real-time reverse-transcriptase–polymerase chain reaction.
Polymerase chain
reactions (PCRs) were performed in LightCycler (Roche, Mannheim, Germany) glass
capillaries. The reaction mixture consisted of 2 µl LightCycler-FastStart DNA Master
SYBR Green I (Roche), 2 µl of the cDNA template for each gene of interest, and 1 µl of
10 µM of each primer. The sequences of the forward and reverse hSR-BI primers were
5’-TTGAACTTCTGGGCAAATG-3’
and
5’-TGGGGATGCCTTCAAACAC-3’,
respectively. The cycling program consisted of initial denaturation for 600 s at 95°C
followed by 55 cycles of 95°C for 5 s, 62°C for 5 s, and 72°C for 15 s, with 20°C/s slope.
Known amounts of DNA were then diluted to provide standards and a regression curve of
crossing points versus concentration generated with the LightCycler. ß-actin was used as
housekeeping standard.
HDL Selective CE Uptake.
Human HDL (d = 1.070-1.20 g/ml) was isolated by
preparative ultracentrifugation from fresh plasma collected in EDTA (1 mg/ml) as
described (22). HDL was passed through a heparin-sepharose affinity column to remove
particles containing apolipoprotein E (39). The isolated lipoproteins were iodinated by
the Pierce IODOGEN method to a specific activity of 400-600 cpm/ng protein for HDL.
For specific uptake studies, the lipid moiety of human HDL was labeled with
[3H]cholesterol ester ([3H]CE) and the apoA-I with
125
I. The former ([3H]CE) was
prepared from [3H]cholesterol and oleic anhydride as described previously (42). Human
apolipoprotein A-I was purified from HDL, labeled with 125I, and then exchanged into the
[3H]HDL by a 24-h incubation at 37 °C (42). The values for the selective uptake of HDL
6
Page 7 of 50
CE were obtained as previous described (40).
Transfection of HepG2 cells and luciferase reporter gene assay. The reporter construct
contained the hSR-BI/CLA-1 gene sequence spanning the region from -1200 to +2 as
determined from the published sequence (11). The segment of interest was amplified
using PCR and cloned into the luciferase reporter gene (pCLA-LUC). Three constructs,
pCLA2-LUC, pCLA4-LUC and pCLA6-LUC containing promoter segments –950, –476
and –209 to +2, respectively, were synthesized using the parent pCLA-LUC as a template
in separate polymerase chain reactions. Purified reporter plasmid (0.5 µg/transfection)
was transfected into HepG2 cells (at 60% confluence) using a conventional cationic
liposome transfection method (Lipofectamine, Life Technologies, Gaithersburg, MD).
All assays were corrected for ß-galactosidase activity and total amount of protein in each
reaction was identical.
Immunoblotting of p38-MAPK.
Cells were lysed for 10 min in ice-cold buffer A
(50 mM Tris-HCl, pH 7.5/ 1 mM EDTA/1 mM EGTA/0.5 mM Na3VO4/0.1%
2-mercaptoethanol/1% Triton X-100/50 mM NaF/5 mM sodium pyrophosphate/10 mM
Na-glycerophosphate/0.1 mM PMSF/1 µM microcystin/1 µg/ml each pepstatin, aprotinin,
and leupeptin). Levels of phosphorylated and total p38-MAPK were detected with a
1:1,000 dilution of each specific antiserum (WAKO. Co. ltd).
Electrophoretic mobility shift analysis (EMSA). HepG2 cells were treated with various
concentration of glucose for 24 hours and nuclear extracts were prepared according to a
technique described previously (41). Synthetic DNA duplexes spanning 425 to 395
(AATGCAACGAAACTTTGAGGCGGGGATGTGAG,
7
synthesized
by
Life
Page 8 of 50
Technologies, Inc.) from the hSR-BI gene (Nihon Bioservice, Asagiri, Japan) used in
these studies were radiolabeled as described previously (41).
Plasmid preparation. An expression vector encoding a constitutively active p38-MAPK
( ,
, ) and a dominant-negative mutant of p38-MAPK
(p38-DN) were kindly
provided by Dr. Wu (Hong Kong University of Science & Technology, China). An
expression vector encoding Sp1 was described previously (47).
Transfection of siRNA. The siRNAs were designed to target the following cDNA
sequences: scrambled, 5'-CCGTTCTGTACAGGGAGTACT-3'; and Sp1 siRNA,
5'-AATGGCGTGCACTTTCTGCAG-3' (Santa Cruz Biotechnology, CA). Transfection
of Sp1 siRNA was performed using siPORT Amine (Ambion, CA).
Protocol for diabetic animals. Four-week-old male Long Evans Tokushima Otsuka
(LETO) rats (n = 4) and Otsuka Long Evans Tokushima Fatty (OLETF) rats (n = 4) were
supplied by Tokushima Research Institute (Otsuka Pharmaceutical, Tokushima, Japan).
All rats were kept in specific pathogen-free conditions at Kagawa University Animal
Center in rooms controlled for both temperature and light (on from 8:00 A.M. to 8:00
P.M.). The experiments were approved by the local animal ethics committee. Some rats
(LETO n = 4, OLETF n = 4) were provided with sucrose (20% sucrose solution as
drinking water) for 4–20 weeks of age. In OLETF rats (n = 4), food intake was restricted
to 70% of average daily consumption for 8–16 weeks of age. Otherwise, the rats had free
access to tap water and a diet of standard chow (Clea Japan, Tokyo).
Statistical analysis:Statistical comparisons were made by one-way analysis of variance
and Student’s t-test, with P<0.05 considered significant.
8
Page 9 of 50
Results
Effects of high glucose conditions on hSR-BI expression in HepG2 cells. We measure
the endogenous expression of SR-BI in HepG2 cells by western blot analysis in order to
determine whether glucose affected hSR-BI expression. There was an inverse correlation
between hSR-BI expression and the concentration of glucose to which the cells were
exposed. hSR-BI in the cells treated for 24 h with 22.4 mM glucose, decreased to
approximately one-half of that in the cells treated with the control medium containing 5.6
mM glucose (Fig.1A); however, no such effect was observed in the cells treated with the
osmotic control, i.e., mannitol.
In order to further confirm this observation, we used northern blot analysis to
assess hSR-BI/CLA-1 mRNA in the cells. Results (Fig. 1B) showed a marked decrease in
the abundance of hSR-BI mRNA following treatment with 22.4 mM glucose (Fig.1B)
however, GAPDH expression remained unaltered.
To understand how hSR-BI
expression was down-regulated by high-glucose concentrations, we examined whether
mRNA stability was altered (Fig.1C). hSR-BI mRNA stability was examined in the
absence or presence of high-glucose concentrations after mRNA synthesis had been
blocked by -amanitin, an RNA polymerase II inhibitor. High glucose concentrations did
not affect hSR-BI mRNA stability, indicating that down-regulation of hSR-BI mRNA is
not due to accelerated mRNA degradation. Previous reports including that from our
laboratory showed that cells take up CE from HDL by a selective non-endocytotic
pathway (40, 42). To test whether high glucose concentrations-mediated inhibition of
9
Page 10 of 50
hSR-BI expression affected this process, we measured the kinetics of CE uptake using
doubly labeled HDL. Results showed that cellular HDL-CE uptake (Fig.2) following
high glucose-treatment was decreased as compared to the control cells. These findings
support the idea that high glucose-treatment inhibits the surface expression and function
of hSR-BI in hepatocytes.
Since glucose lowered the abundance of both hSR-BI protein and mRNA in
HepG2 cells, we speculated whether glucose regulated transcriptional activity of the
hSR-BI promoter in HepG2 cells. For these studies, we measured luciferase activity in
the HepG2 cells transfected with pCLA-LUC and exposed to varying concentrations of
glucose (Fig.3A).
In agreement with the protein and mRNA levels, high glucose
treatment also inhibited the activity of the promoter. Together these results clearly show
that glucose suppresses the activity of the hSR-BI/CLA-1 gene in HepG2 cells.
P38-MAPK signaling mediated high glucose-induced hSR-BI suppression. To further
examine how glucose suppressed the activity of the hSR-BI gene, we postulated the
potential involvement of signaling pathways. Therefore, we tested the effects of known
signaling cascade inhibitors on glucose suppression of hSR-BI promoter activity. In this
study, HepG2 cells were exposed to 22.4 mM glucose plus either a phosphatidylinositol
3-kinase (PI3-K) inhibitor (10 µM wortmannin, WM; LY294002, LY), a protein kinase C
(PKC) inhibitor (10 µM Bisindolylmaleimide I, BIS) or a p38-MAPK inhibitor (1µM
SB203580, SB). Results (Fig. 3B) showed that the inhibitory effect of glucose on hSR-BI
promoter activity persisted in the presence of PKC and PI3-K inhibitors. Unexpectedly,
10
Page 11 of 50
glucose failed to suppress hSR-BI promoter activity in the presence of SB203580, a
p38-MAPK inhibitor. This finding suggests that p38-MAPK may mediate high glucose
induced suppression of hSR-BI promoter activity.
Kinetics of p38-MAPK phosphorylation by high-glucose treatment. The preceding
studies have shown that p38-MAPK may be required for the inhibitory effects of glucose
on hSR-BI. Presuming this is true, glucose should induce p38-MAPK activity that is
measurable by analyzing the kinetics of Thr180 phosphorylation by western blot analysis.
This phosphorylation is a prerequisite for induction of p38-MAPK catalytic activity.
Results (Fig.4) showed that p38-MAPK phosphorylation was evident within 15 min and
peaked at 30 min following exposure of the HepG2 cells to 22.4 mM glucose. These
findings provide additional support that glucose induces p38-MAPK catalytic activity.
p38-MAPK regulates hSR-BI promoter activity.
Presuming that glucose activates
p38-MAPK, which, in turn, suppresses hSR-BI promoter activity, the use of
constitutively active forms of p38-MAPK should mimic the effects of glucose. To test
this hypothesis, we expressed constitutively active forms of p38-MAPK (p38 , , and )
in HepG2 cells carrying pCLA-LUC. Results (Fig. 5A) showed that the constitutively
active form of p38-MAPK suppressed hSR-BI promoter activity in the HepG2 cells. The
p38-MAPK isoform appeared to most potently suppress hSR-BI promoter activity. The
converse of this study would be on a dominant negative mutant of p38-MAPK
(p38-DN) to block the actions of glucose on hSR-BI promoter activity (Fig. 5B).
11
Page 12 of 50
Consistent with the results of previous, high glucose treatment inhibited hSR-BI
promoter activity; however, the expression of p38-DN masked the ability of high-glucose
to suppress hSR-BI promoter activity. Together, these findings support the idea that the
p38-MAPK pathway is required for glucose suppression of hSR-BI promoter activity in
HepG2 cells.
A DNA motif mediated glucose suppression of hSR-BI promoter activity. Since the
preceding data points to the hSR-BI promoter as the site of action of the p38-MAPK
cascade, we searched for a cis-acting site(s) within the DNA that may mediate the effects
of high-glucose. Therefore, templates were created by serial deletions of the hSR-BI
promoter contained within pCLA-LUC. Constructs arising from the removal of 250,
725, and 992 base pairs from pCLA-LUC yielded the templates pCLA2-LUC,
pCLA4-LUC, and pCLA6-LUC, respectively. Glucose suppression of the activity of
pCLA-LUC, and of the pCLA2-LUC, and pCLA4-LUC deletion constructs was
indistinguishable at 40 ± 4, 50 ± 7, and 55 ± 5%, respectively (Fig 6). However, glucose
could not suppress the activity of the pCLA6-LUC deletion construct (-209 to +2).
Together, these observations show that glucose suppression of hSR-BI promoter activity
requires the -476 to -210 fragment of the promoter.
Sp1 mediated high-glucose induced suppression of hSR-BI gene expression. Previous
studies have shown that the transcription factor Sp1 may mediate the actions of glucose
on hSR-BI promoter activity (47). Therefore, we conducted a DNA homology search that
12
Page 13 of 50
revealed the presence of 6 putative Sp1 binding sites within the hSR-BI promoter. To
determine whether Sp1 mediates the actions of glucose on hSR-BI promoter activity, we
began by measuring the abundance of the Sp1 protein in HepG2 cells by western blot
analysis following treatment with varying concentrations of glucose. Results (Fig. 7)
showed that glucose induced the abundance of Sp1 in a dose-dependent manner. In
contrast, basal transcriptional factor TFIID (TBP) was affected to a very small extent by
glucose (Fig. 7A).
To confirm this observation, EMSA with a specific Sp1 binding motif was
performed. The Sp1 binding activities were assayed in the nuclear extracts prepared from
the HepG2 cells exposed to 5.6, 11.2, or 22.4 mM glucose for 12 h. Results (Fig.7B)
showed that glucose stimulated Sp1 DNA binding activity. In contrast, the DNA binding
activity of the transcription factor, OCT1 to its motif was not affected by glucose.
In order to determine whether Sp1 affects the transcriptional activity of the
hSR-BI promoter and to locate the site that mediates the actions of Sp1, we co-transfected
the above deletion constructs into the HepG2 cells along with the Sp1 expression vector.
Results (Fig 7C) showed that Sp1 expression inhibited the activity of pCLA-LUC,
pCLA2-LUC, and pCLA4-LUC but not of pCLA6-LUC. To further explore the role of
Sp1 in glucose suppression of hSR-BI promoter activity, we used siRNA to block
Sp1-expression. Results showed that Sp1 expression was attenuated by a specific Sp1
siRNA but not by a scrambled siRNA (Fig 7D). Next, the HepG2 cells were exposed to
Sp1 specific or scrambled siRNA and then treated with 22.4 mM glucose. Results (Fig
7D) showed that hSR-BI promoter activity was inhibited in the cells exposed to the
13
Page 14 of 50
control siRNA following treatment with 22.4 mM glucose. However, the inhibitory
activity of 22.4 mM glucose was attenuated in the cells carrying Sp1-siRNA. These
findings are in accordance with the idea that the glucose suppression of hSR-BI gene
expression requires Sp1.
Effect of high glucose on hSR-BI expression in vivo. Although in vitro experiments on
cultured cells, as mentioned above, have helped to elucidate the action of glucose, it
remains unknown whether glucose has the same effect on an in vivo model. To answer
this question, we used Otsuka Long Evans Tokushima Fatty (OLETF) rats, an animal
model of DM, and their lean nondiabetic counter parts, Long Evans Tokushima Otsuka
(LETO) rats. Sucrose feeding markedly increased blood glucose levels in OLETF rats
(18.2±1.2 mmol/l) compared to that in LETO rats (6.8±0.4 mmol/l), as previously
reported (32). We speculated whether hyperglycemia in the sucrose-fed animals would
decrease hSR-BI mRNA and protein, as observed in the in vitro model. First, we
measured the levels of endogenous SR-BI mRNA expression in the liver of these animals
by a real-time PCR method. As expected, hepatic SR-BI mRNA in OLETF rats was
decreased in comparison with that in the euglycemic controls (Fig.8A). Furthermore, the
abundance of the SR-BI protein also decreased in OLETF rats (Fig. 8B). These findings
show that in rats, hyperglycemia decreases hepatic SR-BI expression, and this finding is
similar to the observations of the in vitro study on cultured HepG2 cells.
14
Page 15 of 50
Discussion
In this report, we summarized the results of the studies on glucose suppression
of hSR-BI gene transcription. The suppressive effects of glucose on hSR-BI promoter
activity in the HepG2 cells require the participation of the p38-MAPK cascade and the
transcription factor, Sp1. More importantly, the observations in vitro were extended to an
in vivo diabetic rat model to demonstrate that hyperglycemia suppresses hSR-BI mRNA
expression. Controversially, Milliat et al. had reported that early and strong enhancement
of hepatic SR-BI expression was observed in streptozotocin-induced diabetes in
hypercholesterolemic rats (38). The discrepancy between our findings and those of the
previous report may be due to the differences in the experimental methods and the rat
species used. Further investigations will be needed to clarify the regulation of SR-BI by
glucose in vivo.
Recent reports show that the p38-MAPK pathway is activated in response to
hyperglycemia and in models of DM. In vascular smooth muscle cells, exposure to
high-glucose concentrations induces the activation of p38-MAPK (6). Another report
indicated that high glucose causes a four-fold increase in p38-MAPK in rat aortic smooth
muscle cells (30). p38-MAPK activity was increased in the glomeruli of diabetic rats
compared to the controls.
In the same cells, the investigator observed increased
phosphorylation of heat shock protein 25, a downstream substrate of p38-MAPK (15).
Although the published findings pointed toward the involvement of the p38-MAPK
cascade in mediating the actions of glucose, more direct and detailed evidence was
needed to further define its role. In the current study, we demonstrate clearly the
15
Page 16 of 50
intermediary role of p38-MAPK in glucose suppression of hSR-BI promoter activity by
using both constitutively active and dominant negative forms of p38-MAPK on hSR-BI
promoter activity (Fig.5). Our data support the model that hyperglycemia activates
p38-MAPK, which, in turn, triggers a series of steps to suppress hSR-BI promoter activity.
In agreement with this hypothesis, the constitutively active form of p38-MAPK mimics
the inhibitory action of hyperglycemia on hSR-BI promoter activity, while its dominant
negative mutant blocks the effect of glucose. Although we have pointed out the role of
p38-MAPK on hSR-BI expression, a recent report indicated that PI3-K activation
posttranslationally stimulates hepatic SR-BI function by regulating subcellular
localization of SR-BI in a PI3-K-dependent manner (49). Further studies will be needed
to determine the detailed regulatory mechanisms of hepatic SR-BI expression.
Sp1 plays a vital role in the regulation of transcription from TATA-less
promoters that commonly encode housekeeping genes (12). Cellular Sp1 activity and
concentration are regulated during development, cellular proliferation, apoptosis, and
other cellular processes (8, 17). Sp1 is involved in mediating responses to various stimuli
including induction of the TGF- receptor gene (7), epidermal growth factor-mediated
expression of the gastrin gene (13), and cAMP-dependent induction of the CYP11A gene
(2). A recent report showed that p38-MAPK participates in the LPS-induced activation of
Sp1, which, in turn, regulates the transcription of the hIL-10 gene (37). Another report
detailed the relationship between p38-MAPK and Sp1 in that the activation of the
p38-MAPK cascade enhances Sp1 phosphorylation and mediates the interaction of Sp1
with p38-MAPK. These processes are essential for force-induced filamin expression in
16
Page 17 of 50
fibroblasts (14).
Based on several reports that have detailed the connection between p38-MAPK
and Sp1, we speculated whether p38-MAPK and Sp1 were components of the pathway
leading to glucose suppression of hSR-BI promoter activity. Deletional studies on the
hSR-BI promoter led to the identification of a 266-bp DNA fragment (-476 to -210) that is
required for the effects of p38-MAPK, and embedded within this sequence were 6
putative Sp1 binding sites. This finding stands in contrast with the feature of other
cellular genes, i.e., the fact that they are regulated by multiple transcription factors. Our
studies do not exclude the participation of other factors that may cooperate with Sp1 to
regulate hSR-BI transcription. Such factors may remain masked in transient transfections
because this approach is known to generate high plasmid copy numbers and bring about
the accumulation of aberrant chromatin structure in these cells.
Efflux of cellular free cholesterol from peripheral cells to the acceptor HDL
particles is the first step in RCT and requires the binding of HDL to the hepatocyte
membrane. Several reports have suggested that rodent SR-BI is functionally related to
hSR-BI, and this protein is likely to be the receptor, that selectively takes up the HDL
cholesterol ester (1, 35). SR-BI is believed to act as a docking receptor for HDL (52).
Hepatic overexpression of SR-BI causes increased biliary secretion of
cholesterol without a concomitant increase in the secretion of phospholipids or bile salts
(48). SR-BI enhances the exchange of cholesterol between the surface of HDL and the
cell. SR-BI deficiency did not affect the expression of the key regulators of hepatic
cholesterol homeostasis, including HMG-CoA reductase, the low-density lipoprotein
17
Page 18 of 50
(LDL) receptor, and cholesterol 7-alpha-hydroxylase (18). However, SR-BI deficiency
reduced the cholesterol content in bile by ~40%. Regotti et al. (44) generated mice with a
targeted null mutation in the SR-BI gene and showed that plasma cholesterol
concentrations were increased because of the formation of large apolipoprotein A-I
containing particles in heterozygous and homozygous mutants, relative to the wild-type
controls. The plasma concentration of apolipoprotein A-I, the major protein in HDL,
remained unchanged in the mutants.
This data, in conjunction with the increased
lipoprotein size, suggested that the higher plasma cholesterol concentration in the
mutants was due to decreased selective cholesterol uptake. These results suggest that
SR-BI may stimulate hepatic uptake of HDL free cholesterol and its transport into bile.
Several potential links between diabetes and atherosclerosis have been
identified, and many clinical observations point toward the correlation between the risk of
vascular complications in diabetes and poor glycemic control.
A primarily important
step in the development of atherosclerosis is the uptake of modified plasma LDL by
monocyte-derived macrophages in the vascular wall (55).
This process is largely
mediated by the cell surface scavenger receptor CD36. Griffin et al. (21) recently
reported a five-fold increase in macrophage CD36 expression after prolonged exposure to
high glucose concentrations (11 and 33 mmol/l) in vitro, leading to increased translational
efficiency of CD36 mRNA. It is possible that the increased monocyte CD36 expression
observed in DM could be due to this mechanism.
A previous report indicated a
significant increase in the baseline expression of the monocyte-macrophage LDL
scavenger receptor CD36 on peripheral venous monocytes of patients with type 2 DM
18
Page 19 of 50
(46). Both good “HDL” and bad “modified LDL” metabolism may be affected by a
hyperglycemic state, such as in DM.
In summary, the results of this study show that hyperglycemia inhibits hepatic
endogenous hSR-BI expression. This inhibitory effect of hyperglycemia on hSR-BI
promoter activity is mediated by the p38-MAPK/Sp1 signaling cascade. These findings
raise the possibility that hyperglycemia may affect RTC by controlling hSR-BI
expression in diabetic patients.
19
Page 20 of 50
Acknowlegments
This wok was supported in part by Grant-in-Aid for Scientific Research 14770601 (K.M)
and Grant-in-Aid for Scientific Research 15590944 (T.I., K.M.). We thank Miss. Kazuko
Yamaji and Kiyo Ueeda for their technical assistance.
20
Page 21 of 50
References
1. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M: Identification of
scavenger receptor SR-BI as a high density lipoprotein receptor. Science 271:518–520,
1996
2. Ahlgren R, Suske G, Waterman MR, Lund J: Role of Sp1 in cAMP-dependent
transcriptional regulation of the bovine CYP11A gene. J Biol Chem 274:19422-19428,
1999
3. Ballantyne CM, Herd JA, Ferlic LL, Dunn JK, Farmer JA, Jones PH, Schein JR, Gotto
AM Jr: Influence of low HDL on progression of coronary artery disease and response to
fluvastatin therapy. Circulation 99:736-743, 1999
4. Baynes JW: Role of oxidative stress in development of complications in diabetes.
Diabetes 40:405–412, 1991
5. Baynes JW, Thorpe SR: Role of oxidative stress in diabetic complications: a new
perspective on an old paradigm. Diabetes 48:1–9, 1999
6. Begum N, Ragolia L: High glucose and insulin inhibit VSMC MKP-1 expression by
blocking iNOS via p38 MAPK activation. Am J Physio l278:C81–C91, 2000
7. Bontemps Y, Vuillermoz B, Antonicelli F, Perreau C, Danan JL, Maquart FX,
Wegrowski Y : Specific protein-1 is a universal regulator of UDP-glucose
dehydrogenase expression: its positive involvement in transforming growth
factor-beta signaling and inhibition in hypoxia. J Biol Chem 278:21566-21575, 2003
8. Bouwman P, Philipsen S: 2002. Regulation of the activity of Sp1-related transcription
factors. Mol Cell Endocrinol 195:27-38, 2002
21
Page 22 of 50
9. Brownlee M, Cerami A, Vlassara H: Advanced glycosylation endproducts in tissue
and the biochemical basis of diabetic complications. N Engl J Med 318:1315–1321,
1988
10. Calvo D, Vega MA: Identification, primary structure, and distribution of CLA-1, a
novel member of the CD36/LIMPII gene family. J Biol Chem 268:18929-18935, 1993
11. Cao WM, Murao K, Imachi H, Yu X, Dobashi H, Yoshida K, Muraoka T, Kotsuna N,
Nagao S, Wong NC, Ishida T: Insulin-like growth factor-I regulation of hepatic
scavenger receptor class BI. Endocrinology 145:5540-5547, 2004
12. Chu S, Ferro TJ: Sp1: regulation of gene expression by phosphorylation. Gene
348:1-11, 2005
13. Chupreta S, Du M, Todisco A, Merchant JL: EGF stimulates gastrin promoter through
activation of Sp1 kinase activity. Am J Physiol Cell Physiol 278:C697-708, 2000
14. D'Addario M, Arora PD, Ellen RP, McCulloch CA: Interaction of p38 and Sp1 in a
mechanical force-induced, beta 1 integrin-mediated transcriptional circuit that
regulates the actin-binding protein filamin-A. J Biol Chem 277:47541-47550, 2002
15. Dunlop ME, Muggli EE: Small heat shock protein alteration provides a mechanism to
reduce mesangial cell contractility in diabetes and oxidative stress. Kidney Int
57:464–475, 2000
16. Durrington PN: Triglycerides are more important in atherosclerosis than
epidemiology has suggested. Atherosclerosis 141; S57-S62, 1998
17. Dynan WS, Tjian R: The promoter-specific transcription factor Sp1 binds to upstream
sequences in the SV40 early promoter. Cell 35:79-87, 1983
22
Page 23 of 50
18. Elferink RP, Tytgat GN, Groen AK: Hepatic canalicular membrane 1: The role of
mdr2 P-glycoprotein in hepatobiliary lipid transport. FASEB J 11:19-28, 1997
19. Evans JL, Goldfine ID, Maddux BA, Grodsky GM: Oxidative stress and
stress-activated signaling pathways: a unifying hypothesis of type 2 diabetes. Endocr
Rev 23:599-622, 2002
20. Fielding CJ, Fielding PE: Molecular physiology of reverse cholesterol transport. J
Lipid Res 36:211-228, 1995
21. Griffin E, Re A, Hamel N, Fu C, Bush H, McCaffrey T, Asch AS: 2001. A link
between diabetes and atherosclerosis: Glucose regulates expression of CD36 at the
level of translation. Nat Med 7:840–846, 2001
22. Havel RJ, Eder HA, Bragdon JH: The distribution and chemical composition of
ultracentrifugally separated lipoproteins in human serum. J Clin Invest 34:1345-1353,
1955
23. Hotta N: New approaches for treatment in diabetes: aldose reductase inhibitors.
Biomed Pharmacother 49:232–243, 1995
24. Ido Y, Kilo C, Williamson JR: Cytosolic NADH/NAD+, free radicals, and vascular
dysfunction in early diabetes mellitus. Diabetologia 40:S115–S117, 1999
25. Imachi H, Murao K, Sato M, Hosokawa H, Ishida T, Takahara J: CD36 LIMPII
analogous-1, a human homolog of the rodent scavenger receptor B1, provides the
cholesterol ester for steroidogenesis in adrenocortical cells. Metabolism 48:627-630,
1999
26. Imachi H, Murao K, Sayo Y, Hosokawa H, Sato M, Niimi M, Kobayashi S, Miyauchi
23
Page 24 of 50
A, Ishida T, Takahara J: Evidence for a potential role for HDL as an important source
of cholesterol in human adrenocortical tumors via the CLA-1 pathway. Endocr J
46:27-34, 1999
27. Imachi H, Murao K, Hiramine C, Sayo Y, Sato M, Hosokawa H, Ishida T, Kodama T,
Quehenberger O, Steinberg D, Takahara J: Human scavenger receptor B1 is involved
in recognition of apoptotic thymocytes by thymic nurse cells. Lab Invest 80:263-270,
2000
28. Imachi H, Murao K, Cao WM, Ohyama T, Sato M, Sasaguri Y, Ishida T, Takahara J:
Expression of HDL receptor, CLA-1 in human smooth-muscle cells and effect of
interferon-gamma on its regulation. Horm Metab Res 33:389-393, 2001
29. Imachi H, Murao K, Cao W, Tada S, Taminato T, Wong NC, Takahara J, Ishida T:
Expression of human scavenger receptor B1 on and in human platelets. Arterioscler
Thromb Vasc Biol 23:898-904, 2003
30. Igarashi M, Wakasaki H, Takahara N, Ishii H, Jiang ZY, Yamauchi T, Kuboki K,
Meier M, Rhodes CJ, King GL: Glucose or diabetes activates p38 mitogen-activated
protein kinase via different pathways. J Clin Invest 103:185–195, 1999
31. Ishii H, Daisuke K, King GL: Protein kinase C activation and its role in the
development of vascular complications in diabetes mellitus. J Mol Med 76:21–31,
1998
32. Iwase M, Uchizono Y, Tashiro K, Goto D, Iida M: Islet hyperperfusion during
prediabetic phase in OLETF rats, a model of type 2 diabetes. Diabetes 51:2530-2535,
2002
33. Ji Y, Jian B, Wang N, Sun Y, Moya ML, Phillips MC, Rothblat GH, Swaney JB, Tall,
24
Page 25 of 50
AR: Scavenger receptor BI promotes high density lipoprotein-mediated cellular
cholesterol efflux. J Biol Chem 272:20982–20985, 1997
34. Kannel WB, McGee DL: Diabetes and cardiovascular disease: the Framingham Study.
JAMA 241:2035–2038, 1979
35. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M:
Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol
levels. Nature 387: 414–417, 1997
36. Krieger M: Scavenger receptor class B type I is a multiligand HDL receptor that
influences diverse physiologic systems. J Clin Invest 108:793-797, 2001
37. Ma W, Lim W, Gee K, Aucoin S, Nandan D, Kozlowski M, Diaz-Mitoma F, Kumar
A: The p38 mitogen-activated kinase pathway regulates the human interleukin-10
promoter
via
the
activation
of
Sp1
transcription
factor
in
lipopolysaccharide-stimulated human macrophages. J Biol Chem 276:13664-13674,
2001
38. Milliat F, Gripois D, Blouquit ME, Ferezou J, Serougne C, Fidge NH, Lutton C: Short
and long-term effects of streptozotocin on dietary cholesterol absorption, plasma
lipoproteins and liver lipoprotein receptors in RICO rats. Exp Clin Endocrinol
Diabetes 108:436-446, 2000
39. Murakami M, Horiuchi S, Takata K, Morino Y: Distinction in the mode of
receptor-mediated endocytosis between high density lipoprotein and acetylated high
density lipoprotein: evidence for high density lipoprotein receptor-mediated
cholesterol transfer. J Biochem 101:729-741, 1987
25
Page 26 of 50
40. Murao K, Terpstra V, Green SR, Kondratenko N, Steinberg D, Quehenberger O:
Characterization of CLA-1, a human homologue of rodent scavenger receptor BI, as a
receptor for high density lipoprotein and apoptotic thymocytes. J Biol Chem
272:17551-17557, 1997
41. Murao K, Wada Y, Nakamura T, Taylor AH, Mooradian AD, Wong NC: Effects of
glucose and insulin on rat apolipoprotein A-I gene expression. J Biol Chem
273:18959-18965, 1998
42. Pittman RC, Knecht TP, Rosenbaum MS, Taylor CA Jr: A nonendocytotic mechanism
for the selective uptake of high density lipoprotein-associated cholesterol esters. J Biol
Chem 262:2443-2450, 1987
43. Pugliese G, Tilton RG, Williamson JR: Glucose-induced metabolic imbalances in the
pathogenesis of diabetic vascular disease. Diabetes Metab Rev 7:35–59, 1991
44. Rigotti A, Trigatti BL, Penman M, Rayburn H, Herz J, Krieger M: A targeted
mutation in the murine gene encoding the high density lipoprotein (HDL) receptor
scavenger receptor class B type I reveals its key role in HDL metabolism. Proc Natl
Acad Sci U S A 94:12610-12615, 1997
45. Rousseau S, Houle F, Landry J, Huot J: p38 MAP kinase activation by vascular
endothelial growth factor mediates actin reorganization and cell migration in human
endothelial cells. Oncogene 15:2169-2177, 1997
46. Sampson MJ, Davies IR, Braschi S, Ivory K, Hughes DA: Increased expression of a
scavenger receptor (CD36) in monocytes from subjects with Type 2 diabetes.
Atherosclerosis 167:129-134, 2003
26
Page 27 of 50
47. Samson SL, Wong NC: Role of Sp1 in insulin regulation of gene expression. J Mol
Endocrinol 29:265-279, 2002
48. Sehayek E, Ono JG, Shefer S, Nguyen LB, Wang N, Batta AK, Salen G, Smith JD, Tall
AR, Breslow JL: Biliary cholesterol excretion: a novel mechanism that regulates
dietary cholesterol absorption. Proc Natl Acad Sci U S A 95:10194-10199, 1998
49.
Shetty
S,
Eckhardt
ER,
Post
SR,
van
der
Westhuyzen
DR:
Phosphatidylinositol-3-kinase regulates scavenger receptor class B type I subcellular
localization and selective lipid uptake in hepatocytes. Arterioscler Thromb Vasc Biol
26:2125-2131, 2006
50. Stamler J, Vaccaro O, Neaton JD, Wentworth D: Diabetes, other risk factors, and
12-yr cardiovascular mortality for men screened in the Multiple Risk Factor
Intervention Trial. Diabetes Care 16:434–444, 1993
51. Surapisitchat J, Hoefen RJ, Pi X, Yoshizumi M, Yan C, Berk BC: Fluid shear stress
inhibits TNF-alpha activation of JNK but not ERK1/2 or p38 in human umbilical vein
endothelial cells: Inhibitory crosstalk among MAPK family members. Proc Natl Acad
Sci USA 98:6476-6481, 2001
52. Tall AR: Plasma high density lipoproteins. Metabolism and relationship to
atherogenesis. J Clin Invest 6:379-384, 1990
53. Taskinen MR: Quantitative and qualitative abnormalities in diabetes mellitus.
Diabetes 41: 12-17, 1992
54. Trigatti BL, Krieger M, Rigotti A: Influence of the HDL receptor SR-BI on
lipoprotein metabolism and atherosclerosis. Arterioscler Thromb Vasc Biol
27
Page 28 of 50
23:1732-1738, 2003
55. Van Berkel TJ, Van Eck M, Herijgers N, Fluiter K, Nion S: Scavenger receptor classes
A and B. Their roles in atherogenesis and the metabolism of modified LDL and HDL.
Ann NY Acad Sci 902:113–126, 2000
56. Wang N, Arai T, Ji Y, Rinninger F, Tall AR: Liver-specific overexpression of
scavenger receptor BI decreases levels of very low density lipoprotein ApoB, low
density lipoprotein ApoB, and high density lipoprotein in transgenic mice. J Biol
Chem 273:32920-32926, 1998
28
Page 29 of 50
Figure legends
Figure 1.
Effects of glucose on hSR-BI expression in HepG2 cells.
(A),
Dose-dependent suppression of hSR-BI protein by glucose. HepG2 cells were seeded in
6-well plates and exposed to the indicated amounts of glucose for 24 h. hSR-BI in the
total cell lysate was detected by western blot analysis probed with an anti-hSR-BI
antibody. Abundance of GAPDH served as the control and is shown at the bottom of each
lane. The hSR-BI/GAPDH ratio is shown as % of the control in the figure. Each data
point shows the mean ± SEM of 3 separate experiments.
significant difference (P<0.01).
The asterisk denotes a
(B), Hyperglycemia decreases hSR-BI mRNA
expression. hSR-BI mRNA was quantified by Northern blot analysis and normalized to
GAPDH mRNA. A graph showing the mean ± SEM of 3 experiments for each treatment
group is shown. The asterisk denotes a significant difference (P<0.01). C) hSR-BI
mRNA stability under high-glucose treatment and the effect of high-glucose on the rate of
decay of hSR-BI mRNA in HepG2 cells. HepG2 cells were incubated in the medium with
5.6 mM glucose for 24 h (starting time 0h) followed by incubation in 5.6 mM or 22.4 mM
glucose for the indicated periods of time in the presence of 2 µg/ml of -amanitin. RNA
at each point of time was analyzed by real-time PCR methods, and relative hSR-BI
mRNA abundance (normalized to -actin mRNA) was expressed as a percentage of the
hSR-BI mRNA present at 0 (percentage of maximum value), 6, 12, and 24 h. Open
circles, 5.6 mM glucose + -amanitin; closed circles, 22.4 mM glucose + -amanitin.
Each data point shows the mean ± SEM of 3 separate experiments.
29
Page 30 of 50
Figure 2. Selective uptake of HDL CE. The cells treated with the indicated glucose
concentrations were incubated at 37 C for 1.5 h with 10 µg/ml of [125I, 3H]-HDL,
followed by processing to determine HDL CE selective uptake. Values represent the
mean of triplicate determinations. The asterisk denotes a significant difference (P<0.01).
Figure 3. Effect of hyperglycemia on hSR-BI transcriptional activity in HepG2 cells.
(A) Hyperglycemia decreases hSR-BI gene transcription. HepG2 cells were transfected
with 1 µg of pCLA-LUC and treated with the indicated glucose concentrations for 24 h
prior to cell harvesting. All assays were corrected for ß-galactosidase activity, and the
total amount of protein in every reaction was identical. The results were expressed as
relative luciferase activity, as compared to the control cells arbitrarily set at 100. Each
data point shows the mean ± SEM of 4 separate transfections that were performed on
separate days. The asterisk denotes a significant difference (P<0.01 or 0.05). (B) A
p38-MAPK inhibitor blocks the actions of hyperglycemia. Effects of the PI3K inhibitors
Wortmannin (WM) or LY294002 (LY), the PKC inhibitor Bisindolylmaleimide I (BIS),
the p38-MAPK inhibitor SB203580 (SB) with 5.6 mM glucose or 22.4 mM glucose on
hSR-BI transcriptional activity in HepG2 cells. Vehicle; 0.1 % DMSO. Each data point
shows the mean ± SEM of 3 separate transfections that were performed on separate days.
The asterisk denotes a significant difference (P<0.05).
Figure 4. Hyperglycemia stimulates the phosphorylation of p38-MAPK. Cells were
exposed to 22.4 mM glucose for 0, 5, 15, 30, 60, and 120 min.
30
Abundance of
Page 31 of 50
phosphorylated p38-MAPK was detected by western blot analysis of total cell protein
using a phospho-specific p38-MAPK antibody (phosph-p38, upper portion). To show
equal loading of the protein in each lane, the same blot was probed a second time with a
p38-MAPK-specific antibody. The phospho-p38-MAPK/p38-MAPK ratio is shown as %
of the basal in the figure. Each data point shows the mean ± SEM of 3 separate
experiments.
Figure 5. Role of p38-MAPK signal transduction pathway on hSR-BI promoter
activity under conditions of hyperglycemia. (A) Effects of p38-MAPK isoforms on
hSR-BI promoter activity. HepG2 cells were transfected with pCLA-LUC and either an
empty vector (Cont), or expression vectors of constitutive active forms of p38-MAPK
(p38- ,
,
) for 24 h prior to cell harvesting.
All assays were corrected for
ß-galactosidase activity, and the total amount of protein in every reaction was identical.
The results are expressed as relative luciferase activity, as compared to the control cells
arbitrarily set at 100. Each data point shows the mean ± SEM of 4 separate transfections
that were performed on separate days. The asterisk denotes a significant difference
(*P<0.01, **P<0.005).
(B)
Dominant negative p38-MAPK (p38-DN) blocks
hyperglycemia-induced inhibition of hSR-BI transcription. HepG2 cells were transfected
with pCLA-LUC and either the empty vector or p38-DN and then treated with 22.4 mM
glucose for 24 h prior to cell harvesting. The results are expressed as relative luciferase
activity, as compared to the control cells arbitrarily set at 100. Each data point shows the
mean ± SEM of 4 separate transfections that were performed on separate days. The
31
Page 32 of 50
asterisk denotes a significant difference (P<0.01). N.S., no significant difference.
Figure 6, Deletion of the –476 to –210 fragment of the hSR-BI promoter abolished the
response to hyperglycemia. HepG2 cells were transfected with 1 µg of several constructs
{empty vector (vector), pCLA-LUC (CLA), pCLA2-LUC (CLA2), pCLA4-LUC
(CLA4), or pCLA6-LUC (CLA6)} and treated with 22.4 mM glucose for 24 h prior to
cell harvesting.
All assays were corrected for ß-galactosidase activity, and the total
amount of protein in every reaction was identical. The results are expressed as relative
luciferase activity, as compared to the control cells arbitrarily set at 100. Each data point
shows the mean ± SEM of 4 separate transfections that were performed on separate days.
The asterisk denotes a significant difference (P<0.01).
Figure 7. Transcriptional factor, Sp1 is involved in high glucose treatment-induced
suppression of hSR-BI transcriptional activity. (A) Dose-dependent induction of Sp1
protein in nuclear protein by glucose. HepG2 cells were exposed to the indicated
amounts of glucose for 24 h. Sp1 in nuclear protein was detected by western blot analysis
probed with an anti-Sp1 antibody. Abundance of TFIID served as the control and is
shown at the bottom of each lane. The Sp1/TFIID ratio is shown as % of the control in the
figure. Each data point shows the mean ± SEM of 3 separate experiments. The asterisk
denotes a significant difference (P<0.01).
(B) Effects of glucose on Sp1 binding to the
Sp1 probe. Cells were exposed to varying concentrations of glucose as indicated (lane 1,
only the probe; lane 2, 5.6 mM glucose; lane 3, 11.2 mM glucose; and lane 4, 22.4 mM
32
Page 33 of 50
glucose) for 24 h before preparing the nuclear extracts. The binding activity of Sp1 was
examined by EMSA, as described under Material and Methods. Abundance of OCT1
served as the control and is shown at the bottom of each lane. An identical experiment
that was independently performed yielded similar results. (C) Deletion of the –476 to
–210 fragment of the hSR-BI promoter abolished the response to Sp1. HepG2 cells
were transfected with 1 µg of several constructs {empty vector (vector), pCLA-LUC
(CLA), pCLA2-LUC (CLA2), pCLA4-LUC (CLA4), or pCLA6-LUC (CLA6)} and
co-transfected with the Sp1 expression vector.
All assays were corrected for
ß-galactosidase activity, and the total amount of protein in every reaction was identical.
The results were expressed as relative luciferase activity, compared to the control cells
arbitrarily set at 100. Each data point shows the mean ± SEM of 4 separate transfections
that were performed on separate days. The asterisk denotes a significant (P<0.01). N.S.,
no significant difference.
(D) Effects of Sp1-knock down on hSR-BI promoter
activity in HepG2 cells. siRNA for Sp1 or scramble siRNA (sc) was transfected into
HepG2 cells with the pCLA-LUC plasmid for 24 h prior to cell harvesting. The upper
panel shows the efficiency of siRNA on Sp1 expression by western blot analysis. All
assays were corrected for ß-galactosidase activity, and the total amount of protein in
every reaction was identical. The results are expressed as relative luciferase activity,
compared to the control cells arbitrarily set at 100. Each data point shows the mean ±
SEM of 4 separate transfections that were performed on separate days. The asterisk
denotes a significant difference (P<0.01). N.S., no significant difference.
33
Page 34 of 50
Figure 8. Decreased level of SR-BI in diabetic rats. This graph shows the level of rat
SR-BI mRNA (A) and protein (B) in diabetic OLETF rats, as compared to the chow-fed
control, LETO rats by a real-time PCR method and western blot analysis, respectively. A
graph showing the mean ± SEM of 3 experiments for each treatment group is shown. The
asterisk denotes a significant difference (P<0.01).
34
Page 35 of 50
5.6
11.2
22.4
A
hSR-BI
GAPDH
Ratio of hSR-BI/GAPDH
120
100
*
80
60
*
40
20
0
5.6
11.2
Glucose concentration (mM)
22.4
Page 36 of 50
B
5.6
11.2
22.4
hSR-BI
Ratio of hSR-BI/GAPDH mRNA
120
GAPDH
100
*
80
*
60
40
20
0
5.6
11.2
Glucose concentration (mM)
22.4
Page 37 of 50
C
hSR-BI mRNA expression
(% of max.value at t = 0)
120
100
5.6 mM Glucose
22.4 mM Glucose
80
60
40
20
0
0
6
12
18
Times (hours)
24
30
Page 38 of 50
120
HDL CE selective uptake
(% of control)
100
*
80
*
60
40
20
0
5.6
11.2
Glucose concentration (mM)
22.4
Page 39 of 50
A
*
*
Relative promoter activity of hSR-BI
(% of control)
120
100
80
60
40
20
0
5.6
11.2
22.4
Glucose concentration (mM)
Page 40 of 50
B
Relative promoter activity of hSR-BI
(% of control)
120
100
*
80
60
40
20
0
vehicle
vehicle
LY
WM
SB
BIS
5.6
22.4
22.4
22.4
22.4
22.4
Glucose concentration (mM)
Page 41 of 50
phosph-p38
p38
0
5
15
30
60
120 (min)
Ratio of phospho-p38-MAPK / p38-MAPK
(% of basal)
300
200
100
0
0
5
15
30
Time (min)
60
120
Page 42 of 50
A
Relative promoter activity of hSR-BI
(% of control)
120
100
*
80
*
60
**
40
20
0
mock
p38-α
p38-β
p38-γ
Page 43 of 50
B
N.S.
Relative promoter activity of hSR-BI
(% of control)
120
*
100
80
60
40
20
0
control
mock
p38-DN
22.4 mM glucose
Page 44 of 50
*
Relative promoter activity of hSR-BI
(% of control)
200
N.S.
*
*
*
CLA
CLA2
CLA4
150
100
50
0
vector
5.6
22.4
5.6
22.4
5.6
22.4
5.6
Glucose concentration (mM)
22.4
CLA6
5.6
22.4
Page 45 of 50
A
Glucose concentration (mM)
5.6
11.2
22.4
105kD
Sp1
95kD
TFIID(TBP)
*
300
Ratio of Sp1/TFIID
(% of control)
200
*
100
0
5.6
11.2
Glucose concentration (mM)
22.4
Page 46 of 50
B
Glucose concentration (mM)
P
5.6 11.2 22.4
Sp1
OCT1
Page 47 of 50
C
N.S.
150
Relative promoter activity of hSR-BI
(% of control)
N.S.
*
*
*
100
50
0
Sp1
-
+
vector
-
+
CLA
-
+
CLA2
-
+
CLA4
-
+
CLA6
Page 48 of 50
D
siRNA
sc
Sp1
Sp1
TFIID
*
Relative promoter activity of hSR-BI
(% of control)
120
N.S.
100
80
60
40
20
0
siRNA sc
5.6
siRNA Sp1
22.4
5.6
Glucose concentration (mM)
22.4
Ratio of SR-BI / ß-actin mRNA
(% of control)
Page 49 of 50
A
120
100
80
60
40
*
20
0
LETO
OLETF
Page 50 of 50
B
LETO OLETF
SR-BI
Ratio of SR-BI/GAPDH
(% of control)
120
GAPDH
100
80
*
60
40
20
0
LETO
OLETF