docMyostatin Function and Inhibition
download 
Report Transcription
Myostatin Function and Inhibition
Inhibiting Myostatin Alexandra McPherron Department of Molecular Biology & Genetics Johns Hopkins School of Medicine Myostatin Function and Inhibition •Normal function of the myostatin (Mstn) gene •Genetic crosses of the myostatin deletion (Mstn-/- ) to dystrophin deficient (mdx) mice •Blocking myostatin protein activity Myostatin Function and Inhibition •Normal function of the myostatin (Mstn) gene •Genetic crosses of the myostatin deletion (Mstn-/- ) to dystrophin deficient (mdx) mice •Blocking myostatin protein activity Day 10.5 p.c. Heart Lung Thymus Brain Kidney Seminal vesicle Pancreas Intestine Spleen Testis Skeletal muscle Liver Ovary White fat Uterus Myostatin Gene Expression Adult Mstn-/- Mstn+/+ Mstn-/- Mstn+/+ Belgian Blue Breed 929 GATTGTGATGAACACTCCACAGAATCT 955 Wild type 271 D C D E H S T E S 279 Belgian Blue D C D R I DNA sequence Protein sequence Myostatin Function and Inhibition •Normal function of the myostatin (Mstn) gene •Genetic crosses of the myostatin deletion (Mstn-/- ) to dystrophin deficient (mdx) mice •Blocking myostatin protein activity Muscle Weights in mdx and mdx/Mstn-/- Mice 0.6 * * Weight (g) 0.5 * * 0.4 mdx mdx/Mstn-/- 0.3 0.2 0.1 *P < 0.001 0 pectoralis triceps quadriceps gastrocnemius Tibialis Fiber Diameter mdx mdx/Mstn-/18 16 14 % Cells 12 10 8 6 4 2 0 5 10 15 20 25 30 35 40 45 50 55 Cell diameter (µm) 60 65 70 75 80 Histology of mdx and mdx/Mstn-/- Mice mdx Tibialis Diaphragm Diaphragm mdx/Mstn-/- wild type Forelimb Grip Strength Testing Forelimb Grip Strength 2.5 * Force (Newtons) 2.0 * * * * mdx mdx/Mstn -/wild type Mstn -/- * 1.5 1.0 0.5 0 Male Female *P < 0.01 Myostatin Function and Inhibition •Normal function of the myostatin (Mstn) gene •Genetic crosses of the myostatin deletion (Mstn-/- ) to dystrophin deficient (mdx) mice •Blocking myostatin protein activity Extracellular Intracellular nucleus myostatin protein nucleus Intracellular myostatin receptor Extracellular Intracellular nucleus myostatin protein nucleus Intracellular myostatin receptor Extracellular Intracellular nucleus myostatin protein nucleus Intracellular myostatin receptor Extracellular nucleus Intracellular nucleus myostatin protein Intracellular follistatin myostatin receptor Extracellular nucleus Intracellular nucleus myostatin protein Intracellular follistatin myostatin receptor Extracellular nucleus Intracellular nucleus myostatin protein Intracellular follistatin myostatin receptor Control Dorsal forelimbs Dorsal hindlimbs Ventral hindlimbs Follistatin Transgenic Transforming Growth Factor β Superfamily Proteolytic Processing Monomer (inactive) Pro-peptide C-terminal C-terminal Dimer (active) C-terminal •The myostatin pro-peptide stays bound to the C-terminal dimer after processing. •The myostatin pro-peptide inhibits receptor binding and activation of the C-terminal dimer. •How is myostatin normally activated? Pro-peptide Cleavage Product 46 kD full length pro-peptide 30 kD - 21 kD - cleavage product of pro-peptide Pro-peptide Cleavage Site •Cleavage occurs between amino acids arginine (R) 75 and aspartate (D) 76. RD R D Pro-peptide Cleavage Site •Cleavage occurs between amino acids arginine (R) 75 and aspartate (D) 76. RD R D D76A R75Q Wild type •Mutation analysis shows that D76 is required for cleavage. full length pro-peptide cleavage product of pro-peptide In vitro myostatin cleavage + BMP1 D76A - BMP1 + BMP1 - BMP1 Wild type Cleavage is required for myostatin activation in vitro full length cleavage product D D A A Wild type D76A Myostatin activity (RLU) In vitro myostatin activity 200,000 * wild type pro-pe ptide D76A prope ptide 150,000 100,000 50,000 0 -BMP1 +BMP1 *P < 0.01 inactive = muscle growth D D D D inactive = muscle growth D D D D inactive = muscle growth D D D D D D inactive = muscle growth D D D D D D D D active = inhibition of muscle growth Strategy: Inject D76A mutant pro-peptide (inactive) D D D D D D D D A (active) A A A A A Strategy: Inject D76A mutant pro-peptide (inactive) D D D D D D D D A (active) A A A A A A A (inactive) % increase over control Injection of D76A Myostatin Mutant Pro-peptide 30 ***** 25 20 ***** 15 10 * 5 0 IgG2am pectoralis triceps quadriceps gastrocnemius tibialis wild type (1 mg/kg) D76A (1 mg/kg) wild type (10 mg/kg) D76A (10 mg/kg) JA16 Ab *P < 0.05 Conclusions •Myostatin is a skeletal muscle specific secreted protein. •Deletion of the myostatin gene leads to an increase in skeletal muscle mass. •Deletion of the myostatin gene attenuates the severity of muscular dystrophy in mdx mice. •Inhibition of myostatin is a potential therapeutic target for treatment of muscle wasting diseases. •Potential therapies are: 1. Injection of neutralizing monoclonal antibodies 2. Injection of follistatin related proteins 3. Injection of D76A mutant pro-peptide 4. Inhibition of pro-peptide cleavage enzyme Acknowledgments Johns Hopkins School of Medicine Wyeth Research Se-Jin Lee Kathryn Wagner Nicole Winik Suzanne Sebald Paul Dunlap Ann Lawler Neil Wolfman Monique Davies Kening Song Kathleen Tomkinson Jill Wright Liz Zhao Lisa-Anne Whittemore R. Scott Thies University of Wisconsin Medical School William Pappano Daniel Greenspan Forelimb Grip Strength mdx mdx/Mstn -/- Force (Newtons) 2.5 2.0 * * * * * 1.5 1.0 0.5 0 3 6 9 3 Male 6 Female Age (months) 9 *P < 0.01 Muscle Fiber Diameter Tibialis Gastrocnemius 25 25 +/+ -/- % cells % cells 20 15 10 5 +/+ -/- 20 15 10 5 0 0 5 15 25 35 45 55 65 75 85 Cell diameter (µm) 95 5 15 25 35 45 55 65 75 85 Cell diameter (µm) 95 Tibialis 6000 * Fiber number 5000 4000 +/+ -/- 3000 2000 1000 0 *P<0.01
