from laboratory to field – key points - IOBC-WPRS

Transcription

IOBC / WPRS
Working group "Insect Pathogens and
Insect Parasitic Nematodes"
OILB / SROP
Groupe de travail "Les Entomopathogènes et
les Nématodes Parasites d’Insectes"
and
COST Action 862
"Bacterial Toxins for Insect Control"
11th MEETING
" FROM LABORATORY TO FIELD – KEY POINTS "
at / à
Alés (France)
3 – 7 June, 2007
Editors:
Ralf-Udo Ehlers, Jürg Enkerli, Itamar Glazer,
Miguel Lopez-Ferber & Cezary Tkaczuk
IOBC wprs Bulletin
Bulletin OILB srop
Vol. 31, 2008
ii
The content of the contributions is in the responsibility of the authors
The IOBC/WPRS Bulletin is published by the International Organization for Biological and Integrated
Control of Noxious Animals and Plants, West Palearctic Regional Section (IOBC/WPRS)
Le Bulletin OILB/SROP est publié par l‘Organisation Internationale de Lutte Biologique et Intégrée
contre les Animaux et les Plantes Nuisibles, section Regionale Ouest Paléarctique (OILB/SROP)
Copyright: IOBC/WPRS 2008
The Publication Commission of the IOBC/WPRS:
Horst Bathon
Julius Kühn-Institute (JKI)
Federal Research Center for Cultivated Plants
Institute for Biological Control
Heinrichstr. 243
D-64287 Darmstadt (Germany)
Tel +49 6151 407-225, Fax +49 6151 407-290
e-mail: [email protected]
Luc Tirry
University of Gent
Laboratory of Agrozoology
Department of Crop Protection
Coupure Links 653
B-9000 Gent (Belgium)
Tel +32-9-2646152, Fax +32-9-2646239
e-mail: [email protected]
Address General Secretariat:
Dr. Philippe C. Nicot
INRA – Unité de Pathologie Végétale
Domaine St Maurice - B.P. 94
F-84143 Montfavet Cedex (France)
ISBN 978-92-9067-205-0
www.iobc-wprs.org
iii
This meeting was supported by the
COST Action 862
"Bacterial Toxins for Insect Control"
ESF provides the COST Office through an EC contract
COST is supported by the EU RTD Framework programme
COST - the acronym for European COoperation in the field of Scientific and Technical Research - is the oldest
and widest European intergovernmental network for cooperation in research. Established by the Ministerial
Conference in November 1971, COST is presently used by the scientific communities of 35 European countries
to cooperate in common research projects supported by national funds. The funds provided by COST - less than
1% of the total value of the projects - support the COST cooperation networks (COST Actions) through which,
with EUR 30 million per year, more than 30.000 European scientists are involved in research having a total
value which exceeds EUR 2 billion per year. This is the financial worth of the European added value which
COST achieves. A “bottom up approach” (the initiative of launching a COST Action comes from the European
scientists themselves), “à la carte participation” (only countries interested in the Action participate), “equality of
access” (participation is open also to the scientific communities of countries not belonging to the European
Union) and “flexible structure” (easy implementation and light management of the research initiatives) are the
main characteristics of COST. As precursor of advanced multi-disciplinary research COST has a very important
role for the realisation of the European Research Area (ERA) anticipating and complementing the activities of
the Framework Programmes, constituting a “bridge” towards the scientific communities of emerging countries,
increasing the mobility of researchers across Europe and fostering the establishment of “Networks of
Excellence” in many key scientific domains such as: Biomedicine and Molecular Biosciences; Food and
Agriculture; Forests, their Products and Services; Materials, Physical and Nanosciences; Chemistry and
Molecular Sciences and Technologies; Earth System Science and Environmental Management; Information and
Communication Technologies; Transport and Urban Development; Individuals, Societies, Cultures and Health. It
covers basic and more applied research and also addresses issues of pre-normative nature or of societal
importance.
Web: www.cost.esf.org
iv
The IOBC/WPRS working group "Insect Pathogens and Insect Parasitic
Nematodes" greatfully acknowledges the sponsors of the meeting in Ales.
The support from the following local organizations is greatfully acknowledged:
Écoles des Mines DÁlès,
the Region Languedoc-Roussillion,
the City of Alés,
the Region Cévennes.
Thanks are also due to the organisation
"Complexe International de Lutte Biologique Agropolis” (C.I.L.B.A.) and
Agropolis International.
We also like to acknowledge the support of the following industries:
Insect Pathogens and Insect Parasitic Nematodes
IOBC/wprs Bulletin Vol. 31, 2008
Preface
This IOBC WPRS Bulletin contains the proceedings of the 11th meeting of the IOBC/WPRS Working
Group "Insect Pathogens and Insect Parasitic Nematodes" held at the "Ecole des Mines dÁlés" in the
Cévennes Region in the South East of France from the 3rd to the 7th of June, 2007. In the 19th century
the Cévenne was a region of silkworm rearing. With increasing size and poor hygiene epizootics
developed among silkworms endangering the whole industry by 1860. The ministry of agriculture sent
a young chemist, Louis Pasteur, to investigate the problem. Here is where Pasteur developed his skills
in pathology and since that time a laboratory of comparative pathology was maintained. The meeting
was organized by Miguel Lopez-Ferber and his team to whom I like to express my gratitude for the
excellent organisation and their hospitality.
The meeting was held together with the COST Action 862 "Bacterial Toxins for Insect
Control" chaired by Neil Crickmore (www.cost862.com) and the EU Policy Support Action REBECA
"Regulation of Biological Control Agents" (www.rebeca-net.de). I like to thank these two frameworks
to make available travel support for participants of their workshops and sessions, which contributed
aspects of bacterial insect pathogens and introduced into the problems with registration of microbial
biocontrol agents.
The meeting was attended by more than 150 participants from 35 countries. Within 18
sessions 73 oral contributions were presented. One session was dedicated to discussions on the use of
bacterial agents in IPM and another two on exctoxicological impacts of microbial agents. Three
workshops were organized on fungus and virus identification and the use of Affymetrix. During 2
poster sessions 45 posters were discussed.
The Alés meeting was the first to be held together with the new subgroup "virus" and with the
subgroup "Soil Insect Pests". The IOBC/WPRS Council decided to assign the former Working Groups
"Soil Insect Pests" (formerly Melolontha) and "Slug and Snail" as subgroups of the Working Group
"Insect Pathogens and Insect Parasitic Nematodes". We now have 5 subgroups (subgroup convenors in
brackets): Fungi (Cezary Tkaczuk), Entomoparasitic Nematodes (Itamar Glazer), Virus (Miguel
Lopez-Ferber), Soil Insect Pests (Jürg Enkerli) and Slugs and Snails (William Symondson).
The meeting in Alés was the first during which I acted as the convenor of the Working Group.
I would like to thank the previous convenor, Bernard Papierok, for his valuable contribution. I also
like to thank the subgroup convenors for their efforts to support the organisation of the meeting and
the review of the contributions in their field.
I would like to announce already the next meeting, which will be organised by Primitivo
Caballero from the "Universidad Publica de Navarra" in Pamplona, Spain. Date of the meeting will be
during late spring 2009. In order to accelerate the publication of the results, I will try to have the
Bulletin (proceeding of the next meeting) ready for the conference. For submission of presentations
and posters we will therefore accept only prolonged abstracts of 4 pages following the format
published on the IOBC webpage (www.iobc-wprs.org/pub/index.html) under "instruction to the
authors; download of Bulletin Mansucript".
Hope to welcome you in Pamplona in 2009
Ralf-Udo Ehlers
Convenor Working Group "Insect Pathogens and Insect Parasitic Nematodes"
v
vi
List of participants
BDEL-RAHMAN, Mohamed
Alaa El-Dein A
Plant Protection Research Inst
El-Glaa Street, Agricultural Experi
71221 - Assiut/Egypt
[email protected]
BALAZY, Stanislaw
Research Centre for Agricultural and
Forest Environment PAS
Bukowska str.19
60-809 Poznan/Poland
[email protected]
ALTOMARE, Claudio
ISPA
Via Amendola, 122/O
70126 Bari/Italy
[email protected]
BARTA, Marek
Slovak Academy of Sciences
Department of Applied Dentrology
Vieska nad zitavou 178
951 52 Slepcany/Slovakia
[email protected]
ANAGNOU-VERONIKI, Maria
Benaki Phytopathological Institute
Entomology
8 St Delta St.
14561 Kifissia - Attica/Greece
[email protected]
BELDA, Jose Eduardo
Koppert Biological Systems
P. I. Ciudad Transporte Poniente,
Parcela 14, Nave 04745 - La Mojonera Almeria/Spain
[email protected]
ANDERMATT, Martin
Andermatt Biocontrol AG
Stahlermatten 6
6146 Grossdietwil/Switzerland
[email protected]
BERLING, Marie
EMA
6 avenue de Clavieres
30319 Ales/France
[email protected]
ANDRZEJCZAK, Sylwia
Institute of Genetics and Microbiology
Microorganisms Ecology and
Environmental
Protection
Przybyszewskiego Str. 63
51-148 Wroclaw/Poland
[email protected]
BESSE-MILLET, Samantha
NPP
35 Avenue Leon Blum
64000 Pau/France
[email protected]
BISHOP, Alistair H.
School of Science
University of Greenwich
Central Avenue
ME4 4TB Chatham Maritime/UK
[email protected]
ARIF, Basil
Great Lakes Forestry Centre
Molecular Virology
1219 Queen St. E.
P6A 2E5 - Sault Ste. Marie
Ontario/Canada
[email protected]
BLACKSHAW, Rod
University of Plymouth
Biological Sciences
Drake Circus
PL4 8AA Plymouth/UK
[email protected]
ARROYO CASTILLO, Alonso Antonio
Universidad Centro-Occidental
Lisandro Alvarado
Barquisimeto/Venezuela
[email protected]
vii
viii
BLUM, Bernard
IBMA
PO Box 18
4009 – Basel/Switzerland
[email protected]
BURJANADZE, Medea
Institut of Forest Protection
9, Mindeli Str
0186 – Tbilisi/Georgie
[email protected]
BODE, Helge
Saarland University
Pharmaceutical Biotechnology
Building A4.1
66123 Saarbruecken/Germany
[email protected]
CABALLERO, Primitivo
Universidad Publica de Navarra
Produccion Agraria
Campus de Arrosadia
31006 Pamplona – Navarra/Spain
[email protected]
BOLLHALDER, Franz
Stahlermatten 6
[email protected]
CAGAŇ, Ľudovit
Slovak University of Agriculture
Department of Plant Protection
Tr. A. Hlinku 2
949 76 Nitra/Slovakia
[email protected]
BONCHEVA, Rumyana
University of Plovdiv
24 Tzar Assen Str
4000 Plovdiv/Bulgaria
[email protected]
BONHOMME, Antoine
NPP
35 Avenue Leon Blum
64000 Pau/France
[email protected]
BORNSTEIN-FORST, Susan
Marian College
45 S. National Ave
54935 - Fond du Lac
Wisconsin/USA
[email protected]
BROWN, Andrew
Becker Underwood Ltd
Harwood Road I
BN17 7AU Littlehampton
West Sussex/UK
[email protected]
BRUCE, Mark
University of Sussex
Biochemistry
Falmer
BN1 9QG Brighgton
Sussex/UK
[email protected]
CARNERO, Aurelio
ICIA.
PO box 60
C. P. 38200 La Laguna Tenerife
Canary Islands/Spain
[email protected]
CHUBINISHVILI, Mariam
Research Institut of Plant Protection
Biocontrol Dept.
82 Chavchavdze Ave.
0162 - Tbilisi/Georgia
[email protected]
CLAVIJO, Gabriel
Produccion Agraria
Campus Arrosadia s/n
31006 Pamplona/Spain
[email protected]
COTES, Alba
CORPOICA
Biological Control
Km 14 via a Mosquera
Bogota - Cundinamarca/Colombia
[email protected]
[email protected]
ix
CRICKMORE, Neil
University of Sussex
Biochemistry
Falmer
BN1 9QG - Brighton/UK
[email protected]
ELLIS, Jonathan
Plymouth University
Biological Sciences
Drake Circus
PL4 8AA - Plymouth/UK
[email protected]
CURTO, Giovanna
Plant Protection Service
Emilia-Romagna Regional
Via Saliceto 81
40128 Bologna/Italy
[email protected]
ENKERLI, Juerg
Agroscope Reckenholz-Taenikon
Reckenholzstrasse 191
8046 Zurich/Switzerland
[email protected]
DANIEL, Claudia
Research Institute of Organic Agriculture
Ackerstrasse
CH-5070 Frick/Switzerland
[email protected]
DE MAAGD, Ruud
Plant Research International
Business Unit Bioscience
Po Box 16
6700 AA Wageningen/The Netherlands
[email protected]
DELVAUX, Sylvia
The Netherlands
[email protected]
EBERLE, Karolin
DLR Rheinpfalz/Phytomedizin
Breitenweg 71
67435 Neustadt/Germany
[email protected]
FALTA, Vladan
Research and Breeding Institut
Integrated Fruit Protection
Holovousy 1
508 01 Horice/Czech Republic
[email protected]
FFRENCH-CONSTANT, Richard
Biological Sciences
University of Exeter
Pernyn/UK
[email protected]
FIEDLER, Aneta
Institute of Plant Protection
Biocontrol & Quarantine
Miczurina 20
[email protected]
FISCHER, Esther
University of Applied Science
Gruental, PObox 335
8820 Waedenswil/Switzerland
[email protected]
EHLERS, Ralf-Udo
Institute for Phytopathology
Christian-Albrechts-University
Dept. Biotechnology & Biol. Control
Hermann-Rodewald Str. 9
24118 - Kiel/Germany
[email protected]
FODOR, Andras
Ohio State University
Animal Sciences
5651 Fredericksburg Road
OH 44691 Wooster, OHIO/USA
[email protected]
EL MENOFY, Wael
DLR Rheinpfalz/Phytomedizin
Breitenweg 71
[email protected]
FOURNIER, Anselme
Agroscope Reckenholz-Taenikon
Reckenholzstrasse 191
8046 Zurich/Switzerland
[email protected]
x
FOURNIER, Philippe
INRA
Universite Montpellier II
Place Eugene Bataillon
34095 Montpellier cedex 5/France
[email protected]
GRUNDER, Jürg
University of Appl. Sciences
Crop Protection Unit
Gruental, P.O. Box 335
CH – 8820 Waedenswil/Switzerland
[email protected]
FRANCESCHINI, Sergio
Intrachem Production
Via XXV Aprile 4/A
24050 Bergamo/Italy
[email protected]
GUSTAVSSON, Kersti
KEMI
Esplanaden 3 A
17213 Sundbyberg/Sweden
[email protected]
GALEANO REVERT, Magda
Poligono Industrial
04745 - La Mojonera - Almeria/Spain
[email protected]
HANSEN, Vinni
National Research Centre for the
Working Environment
Lerso Parkalle 105
2100 Copenhagen/Denmark
[email protected]
GARCIA DEL PINO, Fernando
Universidad Autonoma de Barcelona
Facultad de Biociencias
08193 Bellaterra-Barcelona/Spain
[email protected]
GLAZER, Itamar
ARO Volcani Center
Nematology
50 250 - Bet-Dagan/Israel
[email protected]
GOGINASHVILI, Nana
Vasil Gulisashvili Forest Inst
9 Mindeli str.
0186 - Tbilisi/Georgia
[email protected]
GOMEZ-BONILLA, Yannery
INTA
San Jose/Costa Rica
[email protected]
GOTTWALDOVA, Katarina
Slovak University of Agriculture
Tr. A. Hlinku 2
949 76 Nitra/Slovakia
[email protected]
HAUKELAND, Solveig
Norwegian Institute for Agriculture
Hogskoleveien 7
1432 - As/Norway
[email protected]
HAUSCHILD, Rüdiger
GAB Consulting GmbH
Hinter den Höfen 24
21769 Lamstedt/Germany
[email protected]
HERRERO, Salvador
University of Valencia
Genetics
Dr Moliner 50
46100 Burjassot - Valencia/Spain
[email protected]
HIRAO, Ayako
University of Kiel / Phytopathology
Hermann-Rodewald-Str. 9
[email protected]
HUBER, Juerg
JKI
Heinrichstr. 243
D-64287 Darmstadt/Germany
[email protected]
xi
JANKEVICA, Liga
LU Institute of Biology
Experimental Entomology
Miera Street 3
LV 2169 Salaspils - Riga/Latvia
[email protected]
KIRCHMAIR, Martin
University of Innsbruck
Institute for Microbiology
Technikerstrasse 25
6020 Innsbruck/Austria
[email protected]
JANS, Kris
Biobest
Ilse Velden 18
2260 Westerlo/Belgium
[email protected]
KLEESPIES, Regina
JKI
Heinrichstrasse 243
64287 - Darmstadt/Germany
[email protected]
JEHLE, Johannes
DLR Rheinpfalz
Breitenweg 71
[email protected]
JUAN, Delphine
Enigma
Hameau de Saint Veran
84190 Beaumes de Venise/France
[email protected]
JUNG, Kerstin
JKI
Heinrichstrasse 243
D-64287 Darmstadt/Germany
[email protected]
KEEL, Christoph
Department of Fundamental Microbiology
University of Lausanne
CH-1015 Lausanne/Switzerland
[email protected]
KESSLER, Philip
Stahlermatten 6
[email protected]
KHAMISS, Omaima
GEBRI-Mnoufya Univ.
Animal Biotechnology
23-rue de 220 Deglaa- Maadi
H12-029H3N08G3Y
Kairo/Egypt
[email protected]
KLINGEN, Ingeborg
Bioforsk
Hoegskoleveien 7
1432 – Aas/Norway
[email protected]
KOCOUREK, Frantisek
Crop Research Institute
Drnovska 507
16106 Prague 6/Czech Republic
[email protected]
KONTODIMAS, Dimitris
Benaki Phytopathoogical Institut
Entomology & Agricultural Zoology
8 St Delta
14561 – Kifissia - Attiki/Greece
[email protected]
KOWALSKA, Jolanta
Miczurina 20
[email protected]
KRUITBOS, Laura
Aberdeen University
Plant and Soil Science
Cruickshank Building, St Machar D
AB24 3UU - Aberdeen/UK
[email protected]
xii
LAARIF, Asma
INRA Tunisia, Plants Protection
Regional Center of Research in
Horticulture
4042 – Chott Mariem – Sousse/Tunesia
[email protected]
LACORDAIRE, Anne-Isabelle
Koppert France
Lot. Ind. du Puits des Gavottes
84300 Cavaillon/France
[email protected]
LAKATOS, Tamas
Research and Extension Centre
Vadastag 2
H-4244 Ujfeherto/Hungary
[email protected]
LAZNIK, Žiga
Biotechnical Faculty
Department of Agronomy
Jamnikarjeva 101
1111 - Ljubljana/Slovenia
[email protected]
LECLERQUE, Andreas
JKI
Heinrichstrasse 243
64287 Darmstadt/Germany
[email protected]
LERCHE, Sandra
Humboldt-University
Phytomedizin
Lentzeallee 55
14195 - Berlin/Germany
[email protected]
LERY, Xavier
IRD-Centre de Recherche
218 Avenue Charles de Gaulle
30380 St Christol les Ales/France
[email protected]
LOPEZ-FERBER, Miguel
EMA
6 Avenue de Clavieres
30319 Ales/France
[email protected]
MAGHODIA, Ajaykumar
ARO-The Volcani Centre
50250 Bet Dagan/Israel
[email protected]
MENSIK, Hans
RIVM
PO Box BA Bilthoven
1370 Bilthoven/The Netherlands
[email protected]
MORTON, Ana
Universidad Autonoma de Barcelona
Departamento de Biologia Animal
Facultad de Ciencias
08193 Bellaterra/Spain
[email protected]
MOSHAYOV, Anat
ARO Volcani Center
Nematology
50 250 - Bet-Dagan/Israel
[email protected]
MOUTON, Sandrine
Enigma
Ecotoxicology
Hameau de Saint Veran
84190 Beaumes de Venise/France
[email protected]
MUNK-HANSEN Bjarne
National Environmental Research Inst.
Frederiksborgvej 399
4000 Roskilde/Denmark
[email protected]
NAIMOV, Samir
University of Plovdiv
24 Tzar Assen Str
4000 Plovdiv/Bulgaria
[email protected]
NIELS BOHSE, Henriksen
Nat. Environmental Research institute
Box 358 Frederiksborgvej 399
4000 Roskilde/Denmark
[email protected]
xiii
NIEMI, Marina
Verdera Oy
Riihitontuntie 14 a
02201 Espoo/Finland
[email protected]
PERNEK, Milan
Forest Research Institute
Cvjetno naselje 41
10450 - Jastrebarsko/Croatia
[email protected]
NUTI, Marco
Universita de Pisa
Via del Borghetto, 80
56124 Pisa/Italy
[email protected]
PETERS, Arne
e-nema GmbH
Klausdorfer Str. 28-36
24223 Raisdorf/Germany
[email protected]
OESTERGAARD, Jesko
Institute for Phytopathology,
Christian-Albrechts-University Kiel
Ludemannstr. 66
24114 Kiel/Germany
[email protected]
PIRON, Mireille
Koppert
14 rue de la Communaute
44860- Pont St Martin/France
[email protected]
OGLIASTRO, Mylene
INRA
USTL Place Eugene Bataillon
34000 Montpellier/France
[email protected]
OPOTA, Onya
INRA UMR INRA/UNSA 112 ROSE
400 route des Chappes BP 167
06903 Sophia Antipolis/France
[email protected]
PADILLA, Angeles
ICIA - PO Box 60
C. P. 38200 La Laguna, Tenerife
Canary Islands/Spain
[email protected]
PAURON, David
INRA-Agrobiotech
400 route des Chappes
[email protected]
PECHY-TARR, Maria
UNIL - DMF
Departement de Microbiologie
Universite de Lausanne
1015 Lausanne-Dorigny/Switzerland
[email protected]
PORCAR, Manuel
University of Valencia
46071 Valencia/Spain
[email protected]
POSSEE, Robert
CEH Oxford
Mansfield Road
OX1 3S Oxford-Oxon/UK
[email protected]
PRENEROVA, Eva
Laboratory of Plant Protection Olesna
Olesna 87
Bernartice u Milevska/Czech Republic
[email protected]
QUESADA MORAGA, Enrique
University of Cordoba
C.R.A.F.-Edificio C4 CE
14071 Cordoaba/Spain
[email protected]
QUINTANA, Graciela
Imyza-Inta/IPM - Biological control
CC 25 (1712) Castelar
1712 Castelan-Buenos Aires/Argentina
[email protected]
RAGNI, Adriano
Florilab Srl
Via Deruta 175 San Martino in Campo
06132 - Perugia/Italy
[email protected]
xiv
RAVENSBERG, Willem
Veilingweg 17
2651 BE - Berkel & Rodenrijs/
The Netherlands
[email protected]
SERMANN, Helga
Humboldt-University
Phytomedizin
Lentzeallee 55-57
14195 - Berlin/Germany
[email protected]
RICE, Olivia
University College Cork
Dep. Microbiology, NUI
Cork/Ireland
[email protected]
SIERPINSKA, Alicja
Forest Research Institute
Braci Lesnej 3 - Sekocin Stary
05-090 Raszyn/Poland
[email protected]
ROSS, Jenna
University of Aberdeen
Plant and Soil Science
AB24 3UU - Aberdeen/UK
[email protected]
SIERRA, Tony
AFFYMETRIX, Inc.
Voyager, Mercury Park, Wycombe
Lane, Wooburn Green,
HP10 0HH,High Wycombe/UK
[email protected]
RUIU, Luca
University of Sassari
Via E. de Nicola
07100 - Sassari/Italy
[email protected]
SAN BLAS, Ernesto
University of Reading
Agriculture
14 Northcourt Avenue
RG2 7HA Reading/UK
[email protected]
SANTIAGO-ALVAREZ, Candido
Universidad de Cordoba
Campus de Rabanales. Edificio C4
14071 Cordoba/Spain
[email protected]
SAUPHANOR, Benoit
INRA-Domaine St Paul
Site Agroparc
84914 Avignon/France
[email protected]
SERENO, Denis
IRD
911 Avenue Agropolis
[email protected]
SIMOES, Nelson
Universidade dos Acores
Biologia
Rua Mae de Deus
9501-855 Ponta Delgada/Portugal
[email protected]
SIMON, Oihane
Produccion Agraria
Campus de Arrosadia
31006 Pamplona - Navarra/Spain
[email protected]
SOMVANSHI, Vishal
ARO-The Volcani Center
50250 Bet Dagan/Israel
[email protected]
SOSNOWSKA, Danuta
Miczurina 20
[email protected]
SOUBABERE, Olivier
NPP
35 Avenue Leon Blum
64000 Pau/France
[email protected]
xv
STARA, Jitka
Crop Research Institute - Entomology
Drnovska 507
16106 Prague 6/Czech Republic
[email protected]
STEINWENDER, Bernhardt
University of Vienna
Obere Viaduktgasse 8/18
1030 - Wien/Austria
[email protected]
STOIANOVA, Emanouela
Plant Protection Institute
Biological and Integrated Pest Control
35 Panajot Volov Str.
2230 - Kostinbrod/Bulgaria
[email protected]
STRASSER, Hermann
Microbiology
Leopold-Franzens University Innsbruck
Technikerstrasse 25
6020 - Innsbruck/Austria
[email protected]
TARASCO, Eustachio
University of Bari
DiBCA
via Amendola, 165/a
70126 - Bari/Italy
[email protected]
TKACZUK, Cezary
University of Podlasie
ul. Prusa 14
08-110 Siedlce/Poland
[email protected]
TOMALAK, Marek
Biological Pest Control and Quarantine
[email protected]
[email protected]
TOTH, Timea
Research and Extension Centre
Vadastag 2
H-4244 Ujfeherto/Hungary
[email protected]
STRAUCH, Olaf
Biotechnology & Biocontrol
Hermann-Rodewald-Str.9
24118 Kiel/Germany
[email protected]
TYPAS, Milton
University of Athens
Genetics and Biotechnology
15701 Athens/Greece
[email protected]
SUNDH, Ingvar
SLU-PO Box 7025
75007 Uppsala/Sweden
[email protected]
VAN MUNSTER, Manuella
INRA
400 route des Chappes
[email protected]
SWIECICKA, Izabela
University of Bialystok
20B Swierkowa Str.
15-950 Bialystok-Podlasie/Poland
[email protected]
TAILLIEZ, Patrick
INRA-Universite Montpellier II, Place E.
Bataillon, Bat 24
[email protected]
VASSILIOU, Vassilis
Agricultural Research Institute
Plant Protection
P.O. Box 22106
1516 - Nicosia/Cyprus
[email protected]
VILLAMIZAR, Laura
CORPOICA
Biological Control Laboratory
Km 14 via Mosquera
571 – Bogota - Cundimnamarca/Colombia
[email protected]
xvi
VINOTTI, Valerio
Agrifutur
Via Campagnole, 8
25020 Alfianello-Brescia/Italy
[email protected]
YI, Xiaoli
Biotechnology & Biological Control
Hermann-Rodewald-Str. 9
[email protected]
VOSS, Sabina
Biotechnology and Biological Control
Knorrstr. 19
24106 Kiel/Germany
[email protected]
ZARITSKY, Arieh
Dep. Of Life Sciences
Ben-Gurion University of the Negev
PO Box 653
84105 Be’er-Sheva/Israel
[email protected]
WATERFIELD, Nick
Univeristy of Bath
Biology and Biochemistry
Claverton Down
BA2 7AY - Bath/UK
[email protected]
ZEC-VOJINOVIC, Melita
University of Helsinki
Department of Applied Biology
P.O. Box 27 / Latokartanonkaari 5
00014 Helsinki/Finland
[email protected]
WEBER, Frans
Veilingweg 17
2651 BE - Berkel & Rodenrijs/
The Netherlands
[email protected]
ZEDDAM, Jean-Louis
IRD, Whymper 442 y Coruna
17 12 857 Quito/Ecuador
[email protected]
WEBERS, Wim
Biobest
Ilse Velden 18
2260 Westerlo/Belgium
[email protected]
WEGENSTEINER, Rudolf
BOKU-University-Vienna
Forest and Soil Sciences
Gregor Mendel Str. 33
A-1180 Vienna/Austria
[email protected]
ZEMEK, Rostilav
Institute of Entomology
Dept. Exp. Ecology
Branisovska 31
37005 Ceske Budejovice/Czech Republic
[email protected]
ZUGER, Markus
Stahlermatten 6
[email protected]
Contents
Preface ...................................................................................................................................... v
List of Participants .................................................................................................................. vii
Contents................................................................................................................................. xvii
Key notes and regulation of biological control agents
The significance of genetic variability in fungal biological control agents
M. Typas .......................................................................................................................... 3
Stability of beneficial traits during liquid culture of entomopathogenic nematodes
R.-U. Ehlers...................................................................................................................... 4
Evolution of the frequencies of SfMNPV genotypic variants in artificial populations
M. López-Ferber, O. Simón, T. Williams, P. Caballero .................................................. 8
Bacillus thuringiensis resistant insects and their mechanisms of resistance
S. Herrero......................................................................................................................... 9
Field resistance to Cydia pomonella granulovirus – a new challenge for research and
application of baculovirus insecticides
J. Jehle............................................................................................................................ 10
Persistent virus infections in laboratory and field insect populations: fact or myth?
R. Possee, R. I. Graham, J. P. Burden, L. A. King, R. Hails.......................................... 11
Regulation of microbial biocontrol agents in Europe – Results of the REBECA Policy
Support Action
R.-U. Ehlers ................................................................................................................... 18
Current data requirements for the environmental and ecotoxicological risk assessment
R. Hauschild ................................................................................................................... 20
REBECA Proposal on the assessment of microbial metabolites
H. Strasser, M. Typas, C. Altomare, T. M. Butt ............................................................. 21
The impact of Plant Protection Products (PPPs) on non-target organisms: soil
microbiota
C. Felici, C. Cristani, S. Degl’Innocenti, M. Nuti.......................................................... 27
How to evaluate the environmental safety of microbial pest control products? A
proposal
B.J.W.G. Mensink........................................................................................................... 28
Virus
Sf29 is a viral factor that could be involved in virion packing within the OBs
O. Simón, S. Ros, A. Gaya, P. Caballero, R. D. Possee................................................. 35
Acp26, a low transcribed gene, has no effect on AcMNPV replication and
pathogenesis in cell culture or lepidopteran hosts
O. Simón, P. Caballero, R. D. Possee............................................................................ 36
Importance of peroral infection factors (pif and pif-2) in the interactions between
genotypes of Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV)
G. Clavijo, O. Simón, D. Muñoz, T. Williams, M. López-Ferber, P. Caballero ............ 37
xvii
xviii
The role of midgut enzymes in the infectivity of baculoviruses
B. Arif, J. Slack, P. Krell ................................................................................................
Revisiting the pathology of Junonia coenia densovirus for a potential use as a
biopesticide
M. Ogliastro, D. Mutuel, M. Ravallec, A. Vendeville, X. Jousset, M. Bergoin..............
Evaluation of the per os insecticidal activity of baculoviruses by a nebulization
method
M. V. Carrera, J.-L. Zeddam, A. Pollet, X. Léry, M. López-Ferber...............................
The importance of genetic variability in a natural baculorius population
M. López-Ferber, O. Simón, T. Williams P. Caballero..................................................
Developing new baculovirus products or “How to walk a tightrope”
P. Kessler, M. Benuzzi, F. Mayoral ...............................................................................
Interactions between the ectoparasitoid Euplectrus plathypenae and two nucleopolyhedroviruses in Spodoptera exigua and S. frugiperda larvae
E. Stoianova, J. Cisneros, D. Muñoz, T. Williams, P. Caballero...................................
Compatibility of Spodoptera frugiperda nucleopolyhedrovirus with organic solvents
used for microencapsulation
L. Villamizar, M. López-Ferber, F. Martínez, A. Cotes .................................................
Effect of parasitism on a nucleopolyhedrovirus amplified in Spodoptera frugiperda
larvae parasitized by Euplectrus plathypenae
J. Cisneros, D. Muñoz, T. Williams, P. Caballero .........................................................
Influence of lepidopteran TCl4.7 transposon on Cydia pomonella granulovirus gene
transcription regulation
W. H. El Menofy, J. A. Jehle ..........................................................................................
Molecular and biological characterization of new isolates of Cydia pomonella
granulovirus (CpGV) from the Iran
M. Rezapanah, S. Shojai-Estabragh, J. Huber, J. A. Jehle............................................
A solution against resistance of French codling moth to CpGV?
M. Berling, M. López-Ferber, A. Bonhomme, B. Sauphanor.........................................
Molecular and biological analysis of a new CpGV isolate (I12) that breaks CpGV
resistance in codling moth
K. E. Eberle, S. M. Sayed, M. Rezapanah, J. A. Jehle ...................................................
Selection of a new virus isolate to control CpGV-resistant codling moth populations
M. Züger, F. Bollhalder, P. Kessler, M. Andermatt.......................................................
Resistance of codling moth (Cydia pomonella) to granulosis virus (CpGV) in
southeast France: First observations on the mode of inheritance
M. Berling, M. López-Ferber, A. Bonhomme, B. Sauphanor.........................................
The use of CpGV and mating disruption against Cydia pomonella (L.) in the organic
apple production
V. Falta, V. Stará, F. Kocourek......................................................................................
Evaluation of the persistence of Adoxophyes orana granulovirus and Cydia
pomonella granulovirus in populations of their hosts by molecular methods
J.K. Kundu J. Stará, T. Zichová, F. Kocourek ...............................................................
Control of lepidopteran pests in orchards by baculoviruses and mating disruption
V. Stará, F. Kocourek, V. Falta......................................................................................
Development of a granulovirus based insecticide to control the potato tuber moths,
Tecia solanivora and Phthorimaea operculella
L. F. Villamizar, C. Espinel, E. Grijalba, P. Cuartas, A. López-Ávila, A. Cotes...........
38
39
40
44
50
54
55
59
60
61
62
63
64
67
68
72
76
77
xix
Analysis of several Colombian Phthorimaea operculella granulovirus isolated from
Tecia solanivora: Detection of a new variable region in the PhopGV genome
X. Léry, L. Villamizar, C. Espinel, J.-L. Zeddam, A.-M. Cotes, M. López-Ferber.........
Perspectives for the control of insect pests with baculoviruses in vegetable crops in
Tunisia
A. Laarif, E. Salhi, S. Fattouch, N. Zellama, M.H. Ben Hamouda ................................
Isolation, identification and biocontrol activity of Colombian isolates of granulovirus
form Tecia solanivora larvae
L. Villamizar, C. Espinel, E. Grijalva, J. Gómez, A. Cotes, L. Torres, G. Barrera,
X. Léry, J.-L. Zeddam.....................................................................................................
Molecular and biological characterization of a novel granulovirus isolate from
Phthorimaea operculella found in Costa Rica
Y. Gómez-Bonilla, X. Léry, D. Muñoz, M. López-Ferber, P. Caballero........................
83
84
85
89
Bacteria
New hope for the microbial control of Musca domestica L.
L. Ruiu, A. Satta, D. J. Ellar, I. Floris ........................................................................... 93
The taxonomic position of the entomopathogenic bacterium Rickettsiella grylli: 16S
rRNA genes and beyond
A. Leclerque, R. G. Kleespies......................................................................................... 99
Plant-beneficial pseudomonad with insecticidal activity
M. Péchy-Tarr, E. Fischer, M. Maurhofer, J. Grunder, C. Keel ................................. 105
Insecticidal activity found in plant-beneficial pseudomonas and in Photorhabdus /
Xenorhabdus
J. Grunder, E. Fischer, M. Péchy-Tarr, M. Maurhofer, C. Keel ................................. 106
IS5056, a new Bacillus thuringiensis isolate with entomopathogenic properties
I. Swiecicka, D. K. Bideshi, B. A. Federici................................................................... 107
Development of isolation methods for Bacillus thuringiensis and evaluation of their
ability to inhibit pathogenic bacteria
S. Andrzejczak .............................................................................................................. 108
The role of solubilization and proteolytic processing in the mode of action and insect
specificity of Bacillus thuringiensis thompsoni crystal proteins
R. Boncheva, S. Naimov, R. Karlova, R. A. de Maagd................................................. 109
Characterisation of an N terminal Cry1Ac mutant that shows increased toxicity
towards a resistant population of Plutella xylostella (SERD4)
M. Bruce, N. Crickmore, A. Sayyed, J. Ferré............................................................... 110
Integrated biological control strategy to avoid resistance development of Plutella
xylostella against Bacillus thuringiensis
X. Yi, S. Schroer, R. Han, R.-U. Ehlers ........................................................................ 111
Study of the mechanism of resistance to Bacillus thuringiensis Cry3A toxin in a
natural population of the leaf beetle, Chrysomela tremulae (Coleoptera:
Chrysomelidae)
M. van Munster, S. Augustin, C. Courtin, D. Bourguet, D. Pauron ............................ 117
Efficacy of submultiples doses of Bacillus thuringiensis compounds against Lobesia
botrana (Lepidoptera, Tortricidae)
D.C. Kontodimas, O. Anastasopoulou, M. Anagnou-Veroniki .................................... 118
Acaricidal activity of Bacillus thuringiensis toxins against mite pests
R. Zemek, J. Hubert...................................................................................................... 122
xx
The efficiency of some biological insecticides against the Potato Tuber Moth Phthorimaea operculella (Ζeller) (Lepidoptera: Gelechiidae) in organic potatoes in
Cyprus
V. A. Vassiliou ..............................................................................................................
Sublethal effect of Bt-maize in semi-artificial diet on European corn borer larvae,
Ostrinia nubilalis (Hübner, 1796) (Lepidoptera, Crambidae)
L. Cagáň, M. Barta.......................................................................................................
Binding and pore formation of Cyt1Aa and Cry11Aa toxins of Bacillus thuringiensis
israelensis to brush border membrane vesicles of Tipula paludosa (Diptera:
Nematocera)
J. Oestergaard, R.-U. Ehlers, A. C. Martínez-Ramírez, M. D. Real ............................
Susceptibility of Tipula paludosa against Bacillus thuringiensis israelensis, Steinernema carpocapsae and Steinernema feltiae
O. Strauch, J. Oestergaard, R.-U. Ehlers ....................................................................
Cellular effects of the Bacillus sphaericus Binary toxin on MDCK cells expressing its
receptor
O. Opota, N. Gauthier, A. Doye, P. Gounon, C. Berry, E. Lemichez, D. Pauron .......
New molecular phylogeny of Photorhabdus and Xenorhabdus based on a multigene
approach
A. Paule, S. Pagès, C. Laroui, S. P. Stock, P. Tailliez .................................................
Identification and typing of Photorhabdus isolates from entomopathogenic
nematodes in Hungarian soils
T. Tóth, T. Lakatos, Z. Kaskötő ....................................................................................
Latest progress in the intellectual property in the field of Photorhabdus and Xenorhabdus
A. Ragni, G. Flek..........................................................................................................
Exploiting the Photorhabdus genome
R. ffrench-Constant, A. Dowling, M. Hares, J. Parkhill, N. Waterfield.......................
Photorhabdus and Xenorhabdus: potent secondary metabolite producers
A. O. Brachmann, G. Schwär, H. B. Bode ...................................................................
New aspects on Xenorhabdus antibiotic research
A. Fodor, S. Forst, L. Haynes, M. Hevesi,J. Hogan, M. G. Klein, A. MátheFodor, E. Stackebrandt, A. Szentirmai, F. Sztaricskai, T. Érsek, M. Zeller.................
Functional genomics of Photorhabdus asymbiotica - rapid virulence annotation
(RVA) of pathogen genomes using invertebrate models
M. Sánchez-Contreras, R. H. ffrench-Constant, N. R. Waterfield ...............................
Photorhabdus spp. and Xenorhabdus spp: Only feed for mass production of
nematodes?
A. Peters .......................................................................................................................
123
127
131
132
136
137
138
144
150
151
157
165
166
Fungi
Assessing winter survival of Pandora neoaphidis in soil applying bioassay and
molecular approaches
A. Fournier, F. Widmer, S. Keller, J. Enkerli .............................................................. 173
Partial purification and characterization of an insecticidal and antifeedant protein
produced by the entomopathogenic fungus Metarhizium anisopliae
A. Ortiz-Urquiza, I. Garrido-Jurado, C. Santiago-Álvarez, E. Quesada-Moraga ...... 178
xxi
Factors important for the use of Neozygites floridana in biological control of the twospotted spider mite, Tetranychus urticae
I. Klingen, K. Westrum, S. S. Nilsen, N. Trandem, G. Wærsted...................................
Supplementary data to the biology and taxonomy of fungous strains from mites and
insects
R. Mietkiewski, S. Balazy, C. Tkaczuk, M. Wrzosek.....................................................
Effects of Beauveria bassiana on Ips sexdentatus and on Thanasimus formicarius
B. M. Steinwender, R. Wegensteiner ............................................................................
Horizontal transmission of entomopathogenic fungi between sexes of the Mediterranean fruit fly Ceratitis capitata Wied. (Diptera; Tephritidae)
E. Quesada-Moraga, I. Martín-Carballo, C. Santiago-Álvarez ..................................
Laboratory evaluation of Beauveria bassiana (Bals.) Vuill. against Ips amitinus
(Coleoptera, Curculionidae)
R. Wegensteiner, J. Weiser...........................................................................................
Field application of entomopathogenic fungi against Rhagoletis cerasi
C. Daniel, S. Keller, E. Wyss........................................................................................
Natural occurrence of entomopathogenic fungi infecting the Red Palm Weevil Rhynchophorus ferrugineus (Olivier, 1790) (Coleoptera, Curculionidae) in Southern
Italy
E. Tarasco, F. Porcelli, M. Poliseno, E. Quesada Moraga, C. Santiago Álvarez,
O. Triggiani..................................................................................................................
Studies on ecological and physiological host range of entomopathogenic Hyphomycetes
R. Seskena, V. Petrova, M. Jankevica, L. Jankevica....................................................
Sampling and occurrence of entomopathogenic fungi in soil from Cameraria
ohridella (Lepidoptera: Gracillariidae) habitats
E. Prenerova, R. Zemek, F. Weyda, L. Volter ..............................................................
Dissemination strategies of the entomopathogenic fungus Lecanicillium muscarium
Zare, Gams 2000 in the host population of Frankliniella occidentalis Pergande
1895
S. Lerche, H. Sermann, C. Büttner ...............................................................................
Preliminary investigations on the occurrence of arthropod fungal pathogens in Austria
C.Tkaczuk, S. Balazy, R.Wegensteiner .........................................................................
Efficacy of entomopathogenic fungi in control of different stages of western flower
thrips (Frankliniella occidentalis Pergande)
Z.A. Fiedler, D. Sosnowska ..........................................................................................
The potential of Beauveria brongniartii and botanical insecticide to control
Otiorhynchus sulcatus larvae in potted plants
J. D. Kowalska .............................................................................................................
Efficacy of a Beauveria bassiana (Vuillemin) strain against the Castniid palm borer
Paysandisia archon (Burmeister, 1880) under laboratory and natural conditions
S. Besse-Millet, A. Bonhomme, K. Panchaud...............................................................
Efficacy of entomopathogenic fungi against larvae of the horse chestnut leafminer
Cameraria ohridella Deschka & Dimic, 1986 (Lepidoptera: Gracillariidae)
M. Kalmus, H. Sermann, S. Lerche, C. Büttner ...........................................................
Efficiency of the entomopathogenic fungus Lecanicillium muscarium on hibernating
pupae of Cameraria ohridella Deschka & Dimic, 1986 (Lepidoptera,
Gracillariidae)
D. Richter, H. Sermann, C. Jantsch, B. Jäckel, C. Büttner..........................................
186
187
188
189
190
191
195
198
204
205
209
214
215
216
220
223
xxii
Susceptibility of Rhagoletis cerasi to entomopathogenic fungi
C. Daniel, S. Keller, E. Wyss........................................................................................
Influence of plant species and pests on the development of pathogenic fungus
Paecilomyces lilacinus in soil conditions
D. Sosnowska ...............................................................................................................
Exposure of greenhouse workers to fungal biocontrol agents in vegetable production
V. M. Hansen, A. M. Madsen, N. V. Meyling, J. Eilenberg..........................................
The impact of soil treatment on soil mycobiota
M. Kirchmair, S. Neuhauser, L. Huber, H. Strasser ....................................................
Antagonists of the spruce bark beetle Ips typographus L. (Coleoptera: Scolytidae) of
German and Georgian populations
M. Burjanadze, J. C. Moser, G. Zimmermann, R. G. Kleespies...................................
The challenge of controlling multispecies white grub associations
S. Keller, Y. Dhoj G.C., C. Schweizer ..........................................................................
Sublethal effects of Nomuraea rileyi on development of Spodoptera frugiperda
(Lepidoptera: Noctuidae)
C. Espinel, A. Cotes......................................................................................................
228
234
235
239
245
251
257
Nematodes
Isolation and characterization of new populations of entomopathogenic nematodes
from Israel
N. Mikaia, L. Salame, C. Chkhubianishvili, I. Glazer..................................................
A new steinernematid epn from Sardinia island (Italy)
E. Tarasco, Z. Mráček, K. B. Nguyen, O. Triggiani.....................................................
First record of entomopathogenic nematodes in Slovenia and perspectives of their use
Ž. Laznik, T. Tóth, T. Lakatos, S. Trdan.......................................................................
Entomopathogenic nematodes from biological agriculture and identification of their
symbiotic bacteria
N. Pionnier, S. Pagès, E. Filleron, S. Pinczon Du Sel, J. Lambion, L. Romet, P.
Tailliez..........................................................................................................................
Association of Phasmarhabditis species with terrestrial molluscs
J. Ross, G. Nicol, S. Spiridonov, E. Ivanova, S. Haukeland, M. Wilson ......................
Synergistic interaction between Steinernema feltiae and Paecilomyces fumosoroseus?
M. Zec-Vojinovic ..........................................................................................................
Scavenging behaviour in some entomopathogenic nematode species
E. San-Blas, S. R. Gowen .............................................................................................
Phoresy In Entomopathogenic Nematodes - a Mode of Dispersal?
L. M. Kruitbos, S. Heritage, M. J. Wilson....................................................................
Effects of in host desiccation stress on development and infectivity of Steinernema
websteri
D. Easterhoff, A. Marion, R. Reinke, S. Bornstein-Forst .............................................
An autochthonous strain of Steinernema feltiae against Mediterranean flatheaded
rootborer, Capnodis tenebrionis (Coleoptera, Buprestidae): Field experiments
A. Morton, F. Garcia del Pino .....................................................................................
Entomopathogenic nematodes for control of codling moth: efficacy assessment under
laboratory and field conditions
S. Mouton, D. Juan, P. Coulomb .................................................................................
263
264
267
269
270
271
277
278
279
280
281
xxiii
Effectiveness of entomopathogenic nematodes in the control of Cydia pomonella
overwintering larvae in Northern Italy
A. Reggiani, G. Curto, S. Vergnani, S. Caruso, M. Boselli..........................................
Foliar application of EPNs to control Xantogaleruca luteola Müller (Coleoptera,
Chrysomelidae)
O. Triggiani, E. Tarasco ..............................................................................................
Cultivation conditions of biocomplexes applicable to control Melolontha melolontha
C. Sisak, Z. Kaskötő, T. Tóth, T. Lakatos .....................................................................
Recovery of Steinernema carpocapsae and Steinernema feltiae in liquid culture
A. Hirao, R.-U. Ehlers..................................................................................................
Differential gene expression of recovery in Heterhorabditis bacteriophora
A. Moshayov, H. Koltai, I. Glazer................................................................................
Expression of different desiccation tolerance related genes in various species of
entomopathogenic nematodes
V. S. Somvanshi, H. Koltai, I. Glazer ...........................................................................
Genetic improvement of beneficial traits mixed population of Steinernema feltiae for
enhancement of persistence and efficacy
M. Chubinishvili, L. Salame, C. Chkhubianishvili, I. Glazer.......................................
287
294
297
301
307
308
309
Soil insect pests and miscellaneous
When should we use biocontrol agents against leatherjackets (Tipula paludosa Meig.)
R.P.Blackshaw..............................................................................................................
Biocontrol of Capnodis tenebrionis (L.) (Col., Buprestidae) with entomopathogenic
fungi
P. Marannino, C. Santiago Álvarez, E. de Lillo, E. Tarasco, O. Triggiani, E.
Quesada Moraga..........................................................................................................
Infectivity of Steinernema feltiae and Heterorhabditis bacteriophora towards first
and second stage larvae of the forest cockchafer, Melolontha hippocastani
K. Jung, A. Peters, J. Pelz ............................................................................................
Susceptibility of soil-dwelling developmental stages of rose-infesting sawflies to
entomopathogenic nematodes
M.Tomalak....................................................................................................................
Field results on the use of Heterorhabditis bacteriophora against the invasive maize
pest Diabrotica virgifera virgifera
R.-U. Ehlers, U. Kuhlmann, S. Toepfer........................................................................
Pest status of Tecia solanivora (Povolny 1973) (Lepidoptera: Gelechiidae),
Guatemalan Potato Moth, in the Canary Islands
A. Carnero, A. Padilla, S. Perera, E. Hernández, E. Trujillo......................................
Development of microsatellite markers for the assessment of population structure of
the European cockchafer Melolontha melolontha
J. Enkerli, A. Gisler, R. Kölliker, F. Widmer ...............................................................
Protozoa, fungi and nematodes in Gastrophysa viridula (Coleoptera, Chrysomelidae)
from Austria and Poland
R. Wegensteiner, C. Tkaczuk, S. Balazy, H. Kaiser .....................................................
Occurrence of protozoan pathogens in Hylobius abietis L. (Col., Curculionidae) from
Austria, Poland and Sweden
S. Griesser, R. Wegensteiner........................................................................................
313
319
327
331
332
336
340
341
342
xxiv
Bioassays with entomopathogenic organisms on adult Cosmopolites sordidus
(Germar, 1824) (Coleoptera: Curculionidae)
A. Padilla Cubas, A. Carnero Hernández, L. V. López-Llorca, F. García del
Pino .............................................................................................................................. 343
Biological control of Thrips tabaci in the field – possibilities and practical limits
K. Jung ......................................................................................................................... 344
Key notes
and
Regulation of Biological Control Agents
4
p. 3
The significance of genetic variability in fungal biological control
agents
Milton Typas
Dept. Genetics and Biotechnology, Faculty of Biology, University of Athens,
Panepistemiopolis, Athens 15701, Greece
Abstract: Due to continuing success with insect control parasites, research on entomopathogenic
fungi has been intensified during the last decade, particularly aiming at the isolation and identification
of new strains with improved properties. These properties concern several different fields of studies
like effectiveness against the target pest, specificity of target, efficacy, field persistence, growth rates,
sporulation, genetic stability, resistance to harmful environmental factors, etc. To proceed with
detection and identification of new entomopathogenic fungi an extended screening and assessing of
fungal biodiversity is required, and, therefore the establishment of genetic variability at a structural genetic information- and functional -gene product- level. Moreover, the release of biological control
agents (BCAs) into the ecosystem, even if it is an endemic fungus, generates some apprehension in the
general public and the scientific community because fungi produce several secondary metabolites that
may have negative effects on human health and ecosystem stability. Thus, they accentuate the need of
efficient methods capable of monitoring the establishment of the released fungus in the field.
Like most fungal pathogens, insect pathogenic fungi use a combination of enzymes and often
mechanical force to penetrate the host cuticle and proceed with the killing of the insect. The plethora
of these enzymes and their different modes of action on target insects depend primarily on the genetic
information of each fungus. Many studies have established that this varies not only from species to
species but also from strain to strain within a species. Therefore, the detection of new–improved
fungal strains automatically demands an in depth study of genetic diversity in these BCAs. The advent
of molecular biology in the past years has shed some light on understanding the basics of fungal-insect
interactions but most importantly has render us molecular tools for the genetic detection/
identification/fingerprinting of entomopathogenic fungi. These tools can be particularly useful for
uncovering the genetic properties of every species/strain and are equally important for patenting an
efficient strain or developing markers/tags for its monitoring after release in the environment.
Molecular tools can also assist the correct taxonomic placing of new unknown fungi and through a
study of their phylogenetic relationships to create innovative strategies for the isolation of
species/strains from a particular group or family of fungi that share common metabolic activities.
Finally, the genetic diversity of entomopathogens can be exploited for studying insect targetspecificity and mechanisms of pathogenesis, as well as for screening and detecting the best fungal
producers of any particular secondary metabolite. Through this combined knowledge a better use of
fungal BCAs can be achieved that satisfies both the needs of the public to understand the social
benefits of using BCAs and the commercial enterprises that are willing to invest on these
environmentally friendly approaches. Since fungi are known to produce numerous different
metabolites, depending on their ecological niche, their genetic identity and their monitoring are crucial
aspects that have to be addressed immediately with the best solutions.
3
pp. 4-7
Stability of beneficial traits during liquid culture
of entomopathogenic nematodes
Ralf-Udo Ehlers
Institute for Phytopathology, Dept. Biotechnology and Biological Control, ChristianAlbrechts-University Kiel, Hermann-Rodewald-Str. 9, 24118 Kiel, Germany
Abstract: For commercial use, entomopathogenic nematodes (Heterorhabditis and Steinernema) are
produced in liquid culture. Prior to nematode inoculation, cultures are incubated with the symbiotic
bacteria of the nematodes. Mass production relies on the scaling-up of culture volumes from flask
cultures to volumes of several cubic meters. Stability of beneficial traits is a prerequisite for
production of high quality insect control nematodes. Quality is defined by the fitness of the
nematodes, which is tested in insect bioassays and by storability of the dauer juveniles, which is
influenced by their fat content. Beneficial traits of nematodes are reproduction potential, longevity of
the dauer juveniles, their host seeking ability and infectivity and tolerance to environmental stress
factors. Little is known about the genetic background of these traits. Classical methods of selective
breeding can be applied to enhance tolerance to stress and increase the reproduction potential.
Instability is often caused by phase variation of the symbiotic bacteria.
Key words: entomopathogenic nematodes, mass production, beneficial traits, breeding, instability
Introduction
Entomopathogenic nematodes (EPN) of the genera Heterorhabditis are symbiotically
associated with enterobacteria of the genera Photorhabdus. The infective stage is the
nematode dauer juvenile (DJ), a morphologically distinct and developmentally arrested third
juvenile stage, formed as a response to depleting food resources and adverse environmental
conditions. It carries between 200-2.000 cells of its symbiotic bacterium in the anterior part of
the intestine. The DJs search for and invade insect hosts. In the haemocoel they encounter
optimal conditions for reproduction. The DJ responds to yet unknown food signals in the
insect and exits from the DJ stage. Analogous to the nematode Caenorhabditis elegans, this
process is called "recovery" and the recovery inducing signal `food signalA. During recovery,
the DJs release the symbiont cells into the haemocoel, where they proliferate and contribute to
the death of the insect. The nematodes feed on the bacterial cells, develop to adults and
produce offspring. When the food resources are depleted, nematodes develop to DJ again. The
DJs leave the insect cadaver and search for new hosts.
For commercial use in biological control of insect pests, EPN are produced in liquid
culture (Ehlers, 2001). Liquid media are pre-incubated with the symbiotic bacteria prior to the
inoculation of DJ. The DJs recover responding to a food signal excreted by their symbiotic
bacterium. The nematodes propagate and after approximately 12 days develop to DJs, which
are then harvested, formulated and send to the users. During this production process sources
of instability are related to the recovery of the DJs and also to the instability of the symbiotic
bacteria.
4
5
Heritability of dauer juvenile recovery and yields
One bottle neck in the in vitro EPN production is the unpredictable, unsynchronized and low
DJ recovery. It prevents a synchronous population management that is required to maximise
yields and to shorten the process time and thus makes necessary additional scale-up steps. DJs
recovery stimulated by the bacterial food signals is much less effective than the food signal
inside an insect. It was therefore investigated whether genetic selection is a possible measure
to increase DJ recovery in liquid cultures of its symbiotic bacterium. To estimate the genetic
influence on recovery, the heritability of the H. bacteriophora DJ recovery was assessed. The
heritability (h5) is defined as the proportion of the genetically defined variability in the
phenotypic variation of a population evaluated under defined environmental conditions. A
high heritability is a prerequisite for a successful selection of genotypes in a breeding
programme.
100 %
h ² = 0 .3 8
Recovery after 48 h
80 %
60 %
40 %
20 %
0 %
24 28 29 21 25
2
22
F
27 11
7
26 30 10 14 23
4
3
6
17 13 12
1
8
15 19 16
5
9
18 20
I n b r e d lin e s
Figure 1. Dauer juvenile recovery of Heterorhabditis bacteriophora 48 hours after inoculation
into Photorhabdus luminescens in liquid medium. Heritability (h2) and mean recovery (n=8,
four replicates with two cultures each) of 30 inbred lines and foundation strain (F). Bars
indicate minimum and maximum values.
Homozygous nematode inbred lines were produced by selfing for several generations and
then the recovery of the inbred line DJs was assessed. The mean values of DJ recovery in the
inbred line cultures ranged from 21 to 55 % (Fig. 1). Due to the high variability within the
inbred lines no significant differences between these lines could be detected (p ≤ 0.1).
Accordingly, the calculated heritability was low (h² = 0.38). Thus genetic selection is not an
appropriate way to stabilize recovery of DJs in liquid cultures of their symbiotic bacteria.
Environmental factors and the readiness of the different DJ batches are responsible for the
variation. They have been extensively investigated and results are summarized in Ehlers
(2001) and Johnigk et al. (2004).
The heritability of the propagation potential in liquid culture was also assessed and the
results are presented in Fig. 2. The mean DJ yield between the inbred lines varied from
110,000 to 215,000 DJs/ml. The variability between the inbred lines was significantly higher
than the variability within the lines (ANOVA, F-test p ≤ 0.001), indicating that genetic
differences of the propagation potential exist between the inbred lines. The calculated
heritability for this trait was high (h² = 0.90).
acde
acde
acde
acde
acde
acde
acde
acde
bcde
cde
de
e
acde
acde
acde
acde
acde
acde
4
8
10
7
18
9
6
1
acd
13
acd
3
acd
acd
16 19 15 28
acd
acd
2
acd
ac
14 23 21 26 12 30 17 25 20
ac
F
ab
29 27 24 22
ab
a
a
6
300
h ² = 0 .9 0
Yield (1000 DJ/ml)
250
200
150
100
50
0
11
5
In b r e d lin e s
Figure 2. Dauer juvenile (DJ) yield recorded 14 days after inoculation of Heterorhabditis
bacteriophora in Photorhabdus luminescens liquid cultures. Heritability (h2) and mean DJ
yields (n=8, four replicates with two cultures each) of 30 inbred lines and foundation strain
(F). Bars indicate minimum and maximum values. Columns with the same letter are not
significantly different (Tukey HSD test, P ≤ 0.05).
The results indicate that genetic selection is a feasible approach for the enhancement of
the liquid culture production potential of the nematode H. bacteriophora. Liquid culture
conditions prevent the copulation of male and female automictic adult stages in Heterorhabditis spp. and offspring always origin from hermaphodites, thus are a result of selfing.
Continuous propagation of heterorhabditis in liquid media will thus automatically result in
inbred lines and automatically select for those lines, which have a higher offspring production
potential. This steady increase after continuous propagation in liquid has been repeated
observed in commercial production (Johnigk et al., 2002).
Instability of the symbiotic bacterium Photorhabdus spp.
Another reason for process instability is the phase shift of the symbiotic bacterium
P.luminescens first observed and described by Akhurst (1980). Phase I symbionts are isolated
from nematode infected insects. Phase variants are detected earliest at stationary growth phase
in cultures which have been inoculated with phase I. Phase I colonies absorb neutral red and
bromothymol-blue from agar media, cells carry inclusion bodies, produce antibiotic substances, lipase, phospholipase, protease, pigments and the outer membrane protein OpnB,
and, in case of P. luminescens, produce bioluminescence (Forst and Clarke, 2001). Phase II
and other variants loose some or all of these characters. Phase variation also influences the
success of nematode production. Yields of Heterorhabditis spp. from in vitro cultures with
phase I were significantly higher than from cultures with phase II. In vivo, phase II variants
were not able to support H. bacteriophora reproduction. DJs recover and developed to adults
with eggs, but these do not develop any further. In liquid culture there was hardly any
development when cultures had been inoculated with phase II bacteria (Han and Ehlers,
2001). Phase variation is one of the major reasons for process failure in industrial mass
production. The reasons why the phase variants negatively impact nematode reproduction
have not been identified yet. In mass production phase variation can be avoided by well
7
controlling process parameters and conditions during inoculation and transfer to avoid any
kind of stress, which could induce phase shift.
Conclusion
Mass production can cause the loss of traits in nematode populations and thus result in control
failure in the field. Thus monitoring of nematode quality is a prerequisite for successful and
sustainable mass production. Quality is defined as the fitness of the nematodes, which is
tested in insect bioassays and by storability of the DJs, which is influenced by their fat
content. Beneficial traits of nematodes are reproduction potential, longevity of the DJs, their
host seeking ability and infectivity and tolerance to environmental stress factors. Little is
known about the genetic background of these traits, about the potential loss during in vitro
mass production and possibilities to avoid instability. Consequently, quality control becomes
a major measure to carefully monitor beneficial traits and genetic stability and in case of
deterioration of traits, to go back to the original stock and scale-up again to mass production
volumes. Another approach is the inbreeding of lately isolated strains from field populations
into the commercial population.
References
Akhurst, R. J. 1980: Morphological and functional dimorphism in Xenorhabdus spp., bacteria
symbiotically associated with insect pathogenic nematodes Neoaplectana and Heterorhabditis. J. Gen. Microbiol. 121: 303-309.
Ehlers, R.-U. 2001: Mass production of entomopathogenic nematodes for plant protection.
Appl. Microbiol. Biotechnol. 56: 623-633.
Forst, S. & Clarke, D. 2002: Bacteria-nematodes symbiosis. In: Entomopathogenic Nematology. Ed. R. Gaugler. London: CABI Publishing: 57-77.
Han, R. & Ehlers, R.-U. 2001: Effect of Photorhabdus luminescens phase variants on the in
vivo and in vitro development and reproduction of Heterorhabditis bacteriophora and
Steinernema carpocapsae. FEMS Microbiol. Ecol. 35: 239-247.
Johnigk, S.-A., Hollmer, S., Strauch, O., Wyss, U. & Ehlers, R.-U. (2002) Heritability of the
liquid culture mass production potential of the entomopathogenic nematode Heterorhabditis bacteriophora. Biocontr. Sci. Technol. 12: 267-276.
Johnigk, S. A., Ecke, F., Poehling, M. & Ehlers, R.-U. 2004: Liquid culture mass production
of biocontrol nematodes, Heterorhabditis bacteriophora (Nematoda: Rhabditida): improved timing of dauer juvenile inoculation. Appl. Microbiol. Biotechnol. 64: 651-658.
p. 8
Evolution of the frequencies of SfMNPV genotypic variants in
artificial populations
Miguel López-Ferber1, Oihane Simón2, Trevor Williams2 and Primitivo Caballero2
1
LGEI, Ecole des Mines, Alès, France; 2Departamento de Producción Agraria, Universidad
Pública de Navarra, 31006 Pamplona, Spain
Abstract: Experimental virus populations composed by two Spodoptera frugiperda nucleopolyhedrovirus (SfMNPV) genotypes were set up to study the evolution over successive cycles of per os
infection in their natural host, the fall armyworm, Spodoptera frugiperda. The genotypes used come
from a complex SfMNPV isolate from Nicaragua. One is the prototype genotype, SfNIC-B that
contains the complete genome; the second is the Sf-NIC C, a virus harbouring à 16kb deletion. SfNICB alone presents only 30% of the potency of the complex Sf-NIC original population, and SfNIC-C
alone is unable to infect per os. When SfNIC-B and SfNIC-C infect the same insect, their progeny
viruses are able to transmit both genotypes and to recover the potency of the original population.
Mixtures of complete (B) and defective (C) variants in ratios of 90% BC10% C, 50% BC50% C
and 10% BC90% C were used to inoculate by injection S. frugiperda larvae. Viral OBs extracted from
diseased insects were subjected to four or five successive rounds of per os infection. Following
successive passages, genotype frequencies in all three experimental populations converged to a single
equilibrium frequency comprising w20% of deletion genotype C and w80% of complete genotype B.
This mirrors the relative proportions of deletion (22%) and complete (78%) genotypes observed in the
wild-type SfMNPV population. The pathogenicity of experimental populations at the final passage
was not significantly different from that of the wild-type isolate. In contrast, OBs of all genotype
mixtures were significantly more pathogenic than OBs of genotype B alone. A population genetics
model, in which virus populations were assigned linear frequencydependent transmissibility values,
was in remarkably close agreement to empirical data. Clearly, non-infectious deletion variants can
profoundly affect the likelihood of transmission and the genetic structure and stability of virus
populations.
Key words: Spodoptera frugiperda nucleopolyhedrovirus, genetic variability, synergism, evolution.
References
López-Ferber, M., Simón, O., Williams, T. & Caballero P. 2003: Defective or effective?
Mutualistic interactions between virus genotypes. Proc Roy Soc B. 270: 2249-2255.
Simón, O., Williams, T., López-Ferber, M. & Caballero, P. 2004: Genetic structure of a
Spodoptera frugiperda nucleopolyhedrovirus population: high prevalence of deletion
genotypes. Appl. Environm. Microbiol., 70: 5579-5588.
Simón, O., Williams, T., Caballero, P., López-Ferber, M. 2006. Dynamics of deletion
genotypes in an experimental insect virus population. Proc. R. Soc. B 273, 783-790.
8
p. 9
Bacillus thuringiensis resistant insects and their mechanisms of
resistance
Salvador Herrero
Departament of Genetics, Universitat de Valencia, Burjassot (Valencia), Spain
Abstract: In 1985, the first case of development of resistance to a Bacillus thuringiensis (Bt)
formulated (Dipel®) was reported in a laboratory population of the Indian Meal Moth, Plodia
interpunctella. Since then, several cases of resistance to Bt products as well as to individual Bt toxins
have been reported. Fortunately, most of these cases of resistance have been obtained after insect
selection in the laboratory and very few cases of resistance have been detected in field populations.
Toxicity of Bt-based products occurs after a complex multi-step mechanism. As a consequence,
any step in the mode of action of Bt, going from the ingestion of the toxin/spore to the cell death and
the eventually death of the insect, will be susceptible to be modify by the insect as a mechanism of
resistance. Investigations in the last 2 decades have revealed the plasticity of the insects to develop
different mechanisms of resistance. In this presentation we will review the different Bt-resistant
strains and their mechanism of resistance.
Key words: resistance, Bacillus thuringiensis
9
p. 10
Field resistance to Cydia pomonella granulovirus – a new challenge for
research and application of baculovirus insecticides
J. A. Jehle
Laboratory of Biotechnological Crop Protection, Department of Phytopathology, Agricultural
Service Center Palatinate (DLR Rheinpfalz), Neustadt a. d. Wstr., Germany
Abstract: Cydia pomonella granulovirus (CpGV) products have obtained great importance in codling
moth control in both in organic and integrated apple production. Since 2003, local field populations of
codling moth, which show an up to 100-1000fold reduced susceptibility to CpGV, have been observed
in Germany, France and a few other countries in Europe. A spread of this phenomenon is a severe
threat to the efficient control of the codling moth, particularly in organic farming. Recently, more
information on the geographic distribution, the mechanism and the mode of inheritance of the
resistance became available. In addition, new CpGV isolates, which are able to overcome the
resistance, were isolated. These isolates have very promising features in bioassays as well as field tests
and might be used in the future to improve the control of the resistant codling moth populations. The
presentation will give an overview on recent developments as well as different lines of research in
Europe.
Key words: Cydia pomonella granulovirus, CpGV, codling moth, control
10
pp. 11-17
Persistent virus infections in laboratory and field insect populations:
fact or myth?
Robert D. Possee1, Robert I. Graham1,2., John P. Burden1, Linda A. King2 and
Rosemary Hails1
1
Centre for Ecology and Hydrology, Mansfield Road, Oxford OX1 3SR, UK; 2School of Life
Sciences, Oxford Brookes University, Gipsy Lane Campus, Headington, Oxford OX3 0BP,
UK
Abstract: Horizontal transmission of baculoviruses between insects is considered to be the route by
which the pathogen is maintained in susceptible populations in the field. This view is challenged by
recent results, based on molecular analysis of insect genome DNA, which shows that apparently
healthy hosts habour low level persistent infections. These persistent virus infections may be
reactivated to the overt state spontaneously or more reliably by superinfection with another
baculovirus. Persistent baculovirus infections are found in both laboratory-maintained and fieldcollected populations. For example, all UK-collected populations of the cabbage moth (Mamestra
brassicae) contain a persistent baculovirus, which survives after extended culture of the insects in the
laboratory. Similar results were obtained with cabbage butterflies or Pieris brassicae. The implications
of these results for working with insect viruses, particularly regarding their use as biocontrol agents
are discussed. The prospects for obtaining virus-free insect populations are also considered.
Key words: persistent viruses, baculoviruses, insects
Introduction
Most viruses were originally isolated because of the fact that they caused disease in their
hosts. It is only recently, with the advent of sensitive molecular techniques such as the
polymerase chain reaction (PCR) that we are able to detect the presence of viruses in hosts
that are otherwise completely healthy. In such conditions, viruses may be present as latent or
persistent infections. The difference between these virus infections is subtle. Essentially we
consider the latent state to be one in which virus gene expression is modified considerably so
that only a few genes are expressed. Examples in vertebrates include herpes simplex virus,
which reactivates occasionally to cause cold sores (Spivack and Fraser 1987; Stevens et al.
1987). A persistent baculovirus infection is one in which virus genes are still expressed, albeit
at a very low level (Hughes et al., 1997). Virus infections in either the latent or persistent state
provide the pathogen the option of remaining associated with a host for its lifetime without
causing serious disease. Further, the virus may be transmitted vertically to the next
generation, thus ensuring longer term association with the host species.
This view of how an insect baculovirus may remain with a host for more than one
generation challenges our traditional view of virus replication. Particularly with insect viruses,
we assume a cycle of primary infection of a susceptible host in the larval stage, which results
in its death and disintegration, thus releasing progeny virus for horizontal transmission to
other individuals. This assumption forms the basis for using insect pathogens such as
baculoviruses as biological control agents. The formation of an occlusion body around
enveloped virus particles made baculoviruses an ideal vehicle to deliver an insect-specific
pathogen to pest insects in agriculture. However, there has always been some evidence that
11
12
insect populations in the field contain persistent virus infections. Before very sensitive
detection methods such as PCR became available, the best evidence for the presence of a
persistent virus in an insect came from occasions when the virus progeny resulting from
challenging the larval host differed dramatically from the inoculum. For example, Smith and
Crook (1993) showed that Pieris brassicae, challenged with Agrotis segetum GV, produced
different baculovirus genotypes instead of the virus inoculum. The problem with these studies
was that there was always the possibility that the inoculum virus stock was contaminated with
another virus.
In this report, we show that P. brassicae collected from the field and reared in the
laboratory, contained a persistent virus infection that most closely resembles P. brassicae GV.
We also discuss the significance of persistent virus infections and how they may impact on
production facilities in biocontrol programmes.
Materials and methods
Insects and DNA isolation
Pieris brassicae were collected from a cabbage field in Maidenhead, UK and reared on
organic cabbage in the laboratory until they pupated. Emerging adults were used to produce a
second generation of larvae, which were frozen at the third instar and used to isolate genomic
DNA with a Qiagen DNA extraction kit.
Polymerase chain reaction
Genomic DNA was used as template in PCR tests to detect GV DNA. Forward (5’ GGATATAATAGAGCATTAAG 3’) and reverse primers (5’ AGCGGGACCTGTGTACAATGG 3’)
were based on the sequence of the PbGV granulin gene published by Chakerian et al. (1985).
A second set of primers (5’ AGGATTACCCTTTTCAAAGAATG 3 and 5’ GCGAATAACGTCATGGGGAAC 3’) were used for a nested PCR test on products from the first reaction.
The PCR was performed as described by Burden et al. (2003). The DNA products were
analysed using agarose gel electrophoresis.
Results and discussion
Detection of PbGV DNA in Pieris brassicae
The cabbage white butterfly, or Pieris brassica, is a common pest of commercial brassica
crops and is also found on wild populations of these plants. We sampled a number of sites
containing P. brassicae in the south of England and returned insects to the laboratory for
rearing into subsequent generations. Samples from these generations were used to isolate
DNA from individuals to be used in PCR-based tests for baculovirus sequences. A first round
test yielded negative results, but a second round nested PCR produced positive results (Fig.
1). Appropriate controls were always negative using the same conditions for the nested PCR
round. These results suggested that wild populations of P. brassica contain a persistent
baculovirus. When the DNA products from the PCR tests were sequenced, they matched
granulin-specific data for P. brassica GV (Chakerian et al., 1985). Confirmation of the
identity of the virus via sequencing is very important. It minimizes the possibility that the
positive results are due to contamination with other virus DNA in the laboratory.
13
P. brassicae genomic DNA
M 1 2 3 4 5 6 7 8 9 10 1o+1o-Pb 2o-
400
200
10+ = 1st round
+ve PCR
10- = 1st round
-ve PCR
Pb = PbGV
2o- = 2nd round
-ve PCR
DNA sequencing identified virus as PbGV (i.e. a granulovirus)
Figure 1. Baculovirus sequences in field-collected insects. Pieris brassicae were collected
from the field and reared on organic cabbage in the laboratory until they pupated. Emerging
adults were used to produce a second generation of larvae, which were frozen at the third
instar and used to isolate genomic DNA. This was used as template in PCR tests to detect GV
DNA. Forward and reverse primers were based on the sequence of the PbGV granulin gene
published by Chakerian et al. (1985). A second set of primers were used for a nested PCR test
on products from the first reaction. The PCR was performed as described by Burden et al.
(2003). The DNA products were analysed using agarose gel electrophoresis
How a virus might become persistent?
To date, there are no data relevant to how a baculovirus might produce a persistent virus
infection in an insect host. If we consider the outcome of an encounter between a baculovirus
and an insect host we can speculate on what might happen. The process of baculovirus
invasion of an insect larva is well documented and will not be described in detail here. It is
sufficient to say that after the virus occlusion bodies have entered the mid gut of the insect,
they dissolve in an alkaline environment to release enveloped virus particles that fuse with
columnar epithelial cells to initiate infection. The nucleocapsids traverse the cytoplasm and
following expression of a virus envelope glycoprotein such as GP67, they may then bud from
the plasma membrane of the same cell without uncoating to release genomic DNA. This
process allows rapid access to the inner organs of the insect, without the need for the virus to
go through a complete replication cycle. The virus is thought to spread further throughout the
insect via the tracheal system, which is oxygen-rich (Engelhard et al., 1994). These studies
showed that AcMNPV recombinants tagged with a reporter gene moved through the tracheal
system. This may result in an overt, highly productive infection in which the insect dies and
releases millions of occluded viruses into the environment. However, Washburn et al. (1996)
14
also showed that when AcMNPV was used to challenge Heliothis zea, the progression of
virus infection was halted at 3 days and eventually cleared from the host insect. This
demonstrated that insects apparently non-permissive for certain baculoviruses may initially
suffer an infection which fails to progress to the overt phase owing to host defence
mechanisms. Unless a detailed analysis of the progression of the virus infection is followed at
the molecular level, this semi-permissive degree of replication would be missed.
Insects may also suffer what is called a sub-lethal infection. In such cases, some insects
may die from the overt infection, but in other individuals the virus remains in the host without
killing it, permitting progression through the pupal and adult stages to a new generation of
insects (Burden et al., 2002). However, in such examples the general health and fecundity of
the host is compromised and it is clear that the population is under stress. To be regarded as a
persistent infection, however, the virus must have no such effects on the host. In those
examples we have characterised in laboratory-reared insect populations, the host appears able
to reproduce normally and never suffers from overt virus infection. Some of these populations
have been in culture for over 25 years and have never undergone an outbreak of virus
infection. The only time that the populations develop the overt infection status is when they
are challenged by a heterologous baculovirus that seems to trigger the persistent virus to a
higher level of replication (Hughes et al., 1993; 1997).
Triggering of a persistent virus to the overt status
Suspicion that insect populations might harbour persistent virus infections arose when hosts
yielded genetically distinct progeny after challenge with a different virus (Smith and Crook,
1993). However, such results could be attributed to contamination of virus inoculum with
another isolate, or contamination of the host insect population. When M. brassicae larvae
produced MbMNPV after challenge with Panolis flammea (Pafl) NPV or AcMNPV, an
analysis of host DNA from uninfected insects using PCR showed that they contained
MbMNPV DNA (Hughes et al. 1993). Further analysis showed that all developmental stages
of the insect were infected with the virus. Although it was possible that the PaflNPV
inoculum might have contained a low level of MbNPV, as it had been propagated in M.
brassicae previously, the AcMNPV stock used had been amplified from a plaque assay in
Spodoptera frugiperda cell culture. Analysis of PaflNPV stocks using PCR has consistently
failed to detect contamination with MbNPV.
To date, challenge of a persistently infected insect host has been the most reliable trigger
of persistent viruses to the overt status. Other treatments, such as overcrowding of larvae,
fluctuating rearing temperatures and treatment with potential immune system inhibitors have
failed to provide the necessary stimulus to activate persistent viruses in a reliable fashion.
Where persistent viruses appear to have reactivated to the overt state due to some external
stimulus, a repetition of the experiment rarely gives reproducible results.
Persistent viruses in field populations
The problem of demonstrating that a field population of insects contains a persistent virus
infection is the potential for constant exposure to new virus in its natural environment. This
means that any insects returned to the laboratory as larvae and destructively sampled for
genomic DNA to detect a persistent infection may simply have recently acquired a virus that
would have developed as an overt infection. Sampling adults provides another source of
material for analysis, but owing to their mobility they have to be regarded as individuals,
rather than members of a population. Again, this means that they may simply be harbouring
the remains of a sub lethal virus infection that is carried vertically into the next generation. To
demonstrate that a population of insects collected in the field contains a persistent virus
15
infection, several individuals from a single plant need to be returned to the laboratory and
reared for a number of generations. If this is achieved without any of their number suffering
overt virus infection, then individuals’ positive for virus as determined by PCR tests probably
contains a persistent infection. This was achieved for several populations of M. brassicae
(Burden et al. 2003). In fact, we have never been able to find this species without a persistent
baculovirus infection. Similar results were obtained with Peiris brassicae collected from the
field and reared on in the laboratory (Fig. 1)
Why do insects have persistent virus infection?
Currently, this is a question that we cannot answer with any authority. It may require a major
change in our understanding of the role of viruses in the longevity of an insect population.
The prevalence of persistent MbNPV in M. brassicae populations could be attributed to
constant exposure to viruses, but when laboratory stocks of these insects are maintained, the
persistent infection remains in all individuals tested. If a low level virus load was a
disadvantage to the host, we would expect that it would be lost over prolonged rearing in the
laboratory. The same results are obtained with cultures of P. brassicae. These insects also
maintain a persistent infection over long periods of laboratory culture.
The maintenance of persistent baculoviruses in laboratory insect stocks may simply be an
artefact of their being reared in protected conditions with a very rich diet. Although we see
persistent virus infections in field populations, these may be a consequence of repeated
infection with horizontally transmitted occlusion bodies.
Perhaps the only way to determine if persistent virus infections of insects have any
positive or negative benefit to the host population is to produce insect lines in which these
infections have been eradicated and then compare their fitness with the original population.
This is a formidable task, as scientists have sought cures for virus infections for hundreds of
years with only limited success.
The problems of working with persistent virus infections.
Unlike an overt virus infection, a persistent virus infection, particularly one involving
baculoviruses, represents a condition that is at the limits of our ability to detect. Conventional
methods, such as microscopy, virus particle purification and even nucleic acid hybridization
will fail to detect the persistent virus. Only by using PCR is it possible to confirm that there is
a very low level persistent virus infection. Even this approach is fraught with dangers. The
need to use 30 + cycles in the PCR means that it is easy to contaminate PCR tests with
baculovirus DNA. If a laboratory is working with overt virus infections at the same time as
the persistent virus system, such cross contamination is inevitable from time to time.
It is necessary, therefore, to adopt a very stringent set of standard operating procedures
for studying persistent virus infection. These should involve a separate facility for extraction
of nucleic acid from insects and a separate room for setting up PCR tests with reserved sets of
oligonucleotide primers that never enter a room with high concentrations of virus DNA.
Preferably, the PCRs should be assembled in a hood, which can be sterilized with ultra violet
light. Finally, a separate room for thermocyclers to process the reactions and analyse the
products should be used. Operators should also be very careful not to move contaminating
DNA between laboratories when conducting their work. These precautions are not exhaustive
and may be beyond the facilities that are available to most laboratories. However, everyone
can be cautious with their negative controls in their PCR tests, which should be sufficient to
ensure that cross contamination can be detected.
16
Living with persistent virus infections
We suspect that many insects have persistent baculovirus infections. If this is correct, what
does this mean for the many experiments conducted routinely with laboratory stocks of
insects? Can the results from experiments to determine the biological activity of viruses be
trusted? Should we try to cure insects of these persistent infections to ensure future
experimental studies are conducted in virus-free conditions?
For experiments performed with insects containing a persistent infection, results may be
valid as long as the identity of progeny virus is confirmed with an appropriate diagnostic test.
When experiments such as bioassays require thousands of insects, this may be onerous, so
sampling of insect groups maybe appropriate. It will undoubtedly add time and expense to
experiments, but without such validation of results it is possible mixed infections may have
arisen due to activation of persistent virus.
Is it possible to remove a persistent virus from an insect population? To cure any virus
infection would be a major achievement in any field of virology. So far, we have to rely on
the host’s natural immunity to purge the host of any virus pathogen. The use of drugs in
human virus infections such as hepatitis C liver infections has been effective in reducing virus
load, but to date a complete cure is not available. It is unlikely that with the resources
currently available to insect virology world wide that we will be able to remove persistent
baculovirus infections from lepidopteran hosts in the foreseeable future.
We should also return to the issue of why baculoviruses are so persistent in insect hosts?
There may be a biological advantage to the host in having a large DNA virus associated with
it on an indefinite basis. Many genes that have been deleted from the baculovirus genome
appear to have no obvious benefit to the virus (O’Reilly, 1997). Perhaps they are retained by
the virus because they offer a selective advantage to the host? When we understand more
about the expression of virus genes in persistent infections and how it might affect insect
fitness this question may be answered. Until then, we might have to accept that some insect
species will always have a persistent baculovirus infection. Our immediate challenge will be
to ensure that they do not corrupt experiments involving virus-host interactions.
Acknowledgements
This work was supported by an award from NERC (NE/D008077/1.).
References
Burden, J. P., Griffiths, C. M., Cory, J. S., Smith, P. & Sait, S. M. 2002: Vertical transmission
of sublethal granulovirus infection in the Indian Meal Moth, Plodia interpunctella. Mol.
Ecol. 11: 547-555.
Burden, J.P., Nixon, C.P., Hodgkinson, A., Possee, R.D., Sait, S.M., King, L.A. & Hails, R.S.
2003: Covert infections as a mechanism for long term persistence of baculoviruses. Ecol.
Letts. 6: 524-531.
Burden, J.P., Hodgkinson, A., Sait, S.M., King, L.A., Hails, R.S. & Possee, R.D. 2006:
Phenotypic and genotypic characterisation of persistent baculovirus infections in populations of the cabbage moth (Mamestra brassicae) within the British Isles. Arch.Virol. 151:
635-649.
Chakerian, R., Rohrmann, G.F., Nesson, M.H., Leisy, D.J. & Beaudreau, G.S. 1985: The
nucleotide sequence of the Pieris brassicae granulosis granulin gene. J. Gen.Virol. 66:
1263-1269.
17
Engelhard, E.K., Kam-Morgan, L.N.W., Washburn, J.O. & Volkman, L.E. 1994: The insect
tracheal system: A conduit for the systemic spread of Autographa californica M nuclear
polyhedrosis virus. Proc. Natl. Acad. Sci. USA 91: 3224-3227.
Hughes, D.S., Possee, R.D. & King, L.A. (1993). Activation and detection of a latent
baculovirus resembling Mamestra brassicae nuclear polyhedrosis virus in M. brassicae
larvae. Virology 194: 608-615.
Hughes, D. S., Possee, R. D. P. & King, L. A. (1997). Evidence for the presence of a lowlevel persistent baculovirus infection of Mamestra brassicae insects. J. Gen. Virol. 78:
1801-1805.
O’Reilly, D.R. 1997: Auxiliary genes of baculoviruses. In: The Baculoviruses, ed. L.K.
Miller, Plenum: 267-300.
Smith, I. & Crook, N. 1993: Characterization of new baculovirus genotypes arising from
inoculation of Pieris brassicae with granulosis viruses. J. Gen. Virol. 74: 415-424.
Spivack, J. & Fraser, N. W. 1987: Detection of herpes simplex virus 1 transcripts during
latent infection in mice. J. Virol. 61: 3841-3847.
Stevens, J. G., Wagner, E. K., Devi-Rao, G. B., Cook, M. L. & Feldman, L. T. (1987). RNA
complementary to a herpes virus alpha gene mRNA is prominent in latently infected
neurons. Science 235: 1056-1059.
Washburn, J.O., Kirkpatrick, B.A. & Volkman, L.E. 1996: Insect protection against viruses.
Nature 383: 767.
pp. 18-19
Regulation of microbial biocontrol agents in Europe – Results of the
REBECA Policy Support Action
Ralf-Udo Ehlers
Institute for Phytopathology, Christian-Albrechts-University, Dept. Biotechnology & Biol.
Control, Hermann-Rodewald-Str. 9, 24118 Kiel, Germany
Abstract: The REBECA Action is reviewing current legislation for biological control agents (BCAs),
guidelines and guidance documents at Member State and EU level and comparing these with similar
legislation in other countries, where the introduction of new BCAs (micro-organisms, semiochemicals, botanicals and beneficial invertebrates) has proven to be more successful. Based on
specific input by researchers, regulators and product developers, proposals for appropriate and
balanced risk assessment for BCAs will been developed. It is expected that no compromises to the
level of safety will be made; in fact, more adapted risk assessment strategies might produce more
safety than the existing system. Proposals for a balanced regulatory environment will lead to better
access to BCAs for growers and farmers and therefore to further reductions in the use of chemical
pesticides. The results could serve as a scientific basis for reviewing current legislation and guidance
for BCAs. REBECA has established an internet page which provides all relevant information
(www.rebeca-net.de)
In general, it was concluded that the main hurdles for the registration and market access of BCAs
in Europe are:
1.
2.
3.
4.
5.
6.
7.
8.
Time consuming and expensive two level regulation (national and EU authorities)
Problems with mutual recognition of data and decisions by member states
Request for data not related to safety of biological control products
Lack of personnel with special knowledge in risk assessment of biocontrol agents
Little support to inexperienced applicants from SMEs and slow information flow
Less frequent acceptance of waivers compared to USA
No priority for biocontrol products like in the USA
Lack of transparency of decision making and communication
REBECA made the following proposals on how to improve the existing system:
•
Improve communication between regulators and applicants
•
Pre-submission meetings should be the rule
•
Provisional registration should be maintained
•
Provisional registration should be issued immediately after the issuing of the DAR
•
Penalties should be introduced for non respect of the fixed time frame
•
No fees should be charged for BCAs
•
OECD and similar guidance documents should be accepted and implemented
•
Compliance of mutual recognition of established waivers between OECD and MS
•
Facilitate bridging and extrapolation between existing substances and new substances
•
Improve mutual recognition of efficacy data between MS
Due to the comprehensive knowledge and in particular to the ‘OECD consensus document on
information used in the assessment of environmental applications involving baculoviruses’ the use of
baculoviruses in plant protection products should be generally assumed as safe. Therefore, REBECA
developed a proposal to include baculoviridae in Annex I without the need for further risk assessment.
In case of new baculovirus species, only data on the molecular identification and the host range should
be necessary and virus material should be deposited in a culture collection. Product-specific data,
18
19
according to Annex III data requirements, have still to be provided including the production method
(medium components ect.) and composition of the product.
In general, the current mandatory test systems for the risk assessment of microbial pest control agents
need to be reviewed and data requirements to be justified. Many of the currently used test systems are
not applicable to microbials (e.g. toxicity tests with rats, not target tests with earthworms). It should be
evaluated to what extent animal experiments with vertebrates can be substituted by in vitro methods.
Human and animal pathogens and organisms causing food poisoning are well known. Directive
2000/54 EC categorized micro-organisms into different risk groups. Micro-organisms used in plant
protection products are not on the list. Are extensive toxicity and pathogenicity tests necessary for
micro-organisms not mentioned on the 2000/54 list? The risks posed by metabolites of fungi used in
plant protection have been intensively investigated (EU project RAFBCA, www.rafbca.com).
RAFBCA concludes that the potential for exposure to these metabolites is considered extremely low.
Due to the nature of microbials and their common occurrence in agro-ecosystems it is discussed
whether data requirements for residues and fate and behaviour in the environment can be waived.
Clear pass/fail criteria for all risk assessment assays are needed for applicants and regulators.
Furthermore, circumstances should be well defined which allow waivers for risks assessment
requirements.
Key words: registration, regulation, REBECA, policy support action, biological control
agents, micro-organisms, safety
p. 20
Current data requirements for the environmental and ecotoxicological
risk assessment
Rüdiger Hauschild
GAB Consulting GmbH, Hinter den Höfen 24, D-21769 Lamstedt, Germany
Abstract: For the registration of plant protection products containing micro-organisms as the active
ingredient, information is required to assess the risk of the active substance and the product on the
environment and on non-target-species. These data requirements for the risk assessment are
summarised in 2 sections according to the EU and OECD data points. In Section 5 “Fate and
Behaviour Studies on the Microbial Pest Control Agent in the Environment”, the origin, biological
properties, survival, and residual metabolites of the micro-organism have to be described. This
information is in most cases already presented in other parts of the dossier. The viability of the microorganism under application conditions, its population dynamics, persistence, and mobility in soil,
water and air is particularly emphasized. Information on possible effects on non-target organisms is
required in Section 6 “Ecotoxicological Studies on the Microbial Pest Control Agent“ to assess the
ecological risk of a micro-organism and the corresponding product. These non-target organisms
include birds, fish, aquatic invertebrates, algae, aquatic and/or terrestrial plants, terrestrial arthropods
including bees, earthworms, and soil micro-organisms. The environmental impact of a microorganisms and the corresponding product is summarised and, if necessary, precautions are proposed to
minimise negative effects. This information does not necessarily need to be provided as standardised
guideline-studies, but can as well be submitted using published literature, or internal studies from the
applicant. Information is only needed for non-target species that are exposed to the product when it is
used as recommended. Data requirements will be presented in detail and possibilities to address them
will be discussed in the presentation.
Key words: registration, microbial plant protection products, ecology
20
pp. 21-26
REBECA Proposal on the assessment of microbial metabolites
Hermann Strasser1, Milton Typas2, Claudio Altomare3 and Tariq M. Butt4
1
Institute of Microbiology, University of Innsbruck, AT; 2Department of Genetics and Biotechnology, University of Athens; 3 Institute of Science of Food Production, CNR Bari, IT;
4
Department of Biological Sciences, University Wales Swansea, UK
Abstract: In April 2007 a proposal on “the Risk Assessment of Metabolites produced by Microorganisms in Plant Protection Products” was presented by RAFBCA experts (QLK1-CT-2001-01391)
to representatives of the European Commission, EU member states, national and international
organisations (i.e. BPSG, EFSA) and stakeholder groups (e.g. academia, industry, risk assessors) in
order to improve and facilitate the registration procedure for plant protection products containing
microbials as the active ingredient. This proposal was initiated by a working group in the REBECA
Policy Support Action (SSPE-CT-2005-022709). New insights into risk assessment of metabolites
produced by micro-organisms in plant protection products are given and were discussed in the
REBECA work shop “The assessment of metabolites and environmental risks of microbial biological
control agents (MBCAs)”. As a new approach to assess relevance/significance of metabolites
produced by micro-organisms in plant protection products the authors suggest, that the evaluation of
“toxic metabolites” and their residues should be based on TIER I toxicity tests and information on the
biology of the microbial agent. However, these studies should only be requested when a clear positive
result could be detected with the help of a sensitive test system. Otherwise metabolite and residue data
may not be required and an exemption from the requirement of a tolerance may be recommended for
products intended for use on food feed crops.
Key words: risk assessment, microbials, toxic metabolite, crude extract, registration
Introduction
A proposal on “Risk Assessment of Metabolites produced by Micro-organisms in Plant Protection Products” was initiated by the REBECA Policy Support Action and was presented by
RAFBCA experts to representatives of the EU Commission, EU member states, national and
international organisations (i.e. BPSG, EFSA) and stakeholder groups (e.g. academia,
industry, risk assessors). The proposal aimed to improve and facilitate the registration
procedure for plant protection products containing micro-organisms as the active ingredient
for Annex I inclusion and for national registrations (Strasser et. al., 2007).
Micro-organisms used as active substances in plant protection products in the EU are
regulated according to the EU Directive 91/414/EEC. Data requirements for registration of
micro-organisms as active substances and products based on micro-organisms are laid down
in the Council Directive 91/414/EEC, amended by the Commission Directive 2001/36/EC
(EC 2001). The Uniform Principles for evaluation and authorisation of plant protection
products containing micro-organisms are laid down in the Council Directive 2005/25/EC.
Safety aspects on microbial metabolites in the environment
Microbials secrete a wide range of metabolites, mostly products of secondary metabolism.
These metabolites serve different functions depending on the ecological niche of the microbe.
Some metabolites may be antibiotics that protect BCAs against antagonistic micro-organisms
21
22
whereas others may prevent growth of saprophytes on the host after it is killed by the BCA
and thus improve survival of that BCA. Some bioactive metabolites are also important pathogenicity determinants and others have antifeedant/repellent properties that presumably deter
mycophagous organisms. Based on a number of case-studies available to date, the quantities
normally detected in target hosts or the environment are usually too low to be of concern. In
other words, these metabolites usually pose no risk to humans and the environment. There is
considerable mitigating evidence that microbial BCAs do not pose a risk to humans and the
environment. Some examples are listed below:
(i) No introduced beneficial microbial BCA has been reported to have harmed humans
even though some have been used extensively for decades (e.g. Bacillus thuringiensis, Verticillium lecanii, Metarhizium anisopliae). Most reported cases of infections
are by opportunistic species usually infecting immuno-compromised patients.
(ii) Microbial BCAs occur naturally, are airborne and are often associated with food
crops. However, it appears that any risks these organisms may pose is acceptable.
They are viewed as the “background population” (Annex II, EC 2001).
(iii) In addition to species exploited as BCAs, numerous other species of fungi and
bacteria are associated with the rhizoplane and phylloplane. These include beneficial
species such mycorrhizal fungi (85% flowering plants have symbiotic relations with
these fungi), N-fixing bacteria (nodule and free living species) as well potential
human pathogens (see presentation of G. Berg at REBECA Meeting, Innsbruck 2006;
www.rebeca-net.de).
(iv) Many microbes are killed by antagonists and UV-irradiation or inhibited by
antibiotics produced by other microbes. For these reasons microbial BCAs have to be
applied frequently or at relatively high levels. Examples of soil biota feeding on
fungal BCAs include mycophagous nematodes, amoebae, rotifers, and collembolans.
(v) Most introduced microbial BCAs may only temporarily dominate – and are unlikely
to displace natural biota (including indigenous related species) which is already in
flux (Kirchmair et al., 2008).
(vi) EU funded project RAFBCA demonstrated using selected fungal BCAs that they do
not pose a risk to humans and the environment (See http://www.rafbca.com). It has
been suggested that the evaluation of microbial metabolites during registration of
BCAs could be simplified.
Risk assessment of microbial metabolites
The EU-approach to microbial metabolites is still under discussion although a lot of
information and experience has been gained within funded EU projects. The following
general conclusions were drawn by the authors:
(1) Purification of any metabolite – even in very small amounts – is time consuming and
requires the use of several analytical methods. Even under these conditions only few
of the several possible metabolites produced by these organisms could be isolated.
Therefore, a risk assessment investigation based on single metabolites is not feasible.
(2) A possible solution to overcome this problem is to study and assess the risks by using
crude extracts, which is a mixture of all possible metabolites. Crude extracts may
come after growth of BCAs on minimal and complete media. Minimal media show the
realistic aspect while complete media show the worst case scenario where all
metabolites can act synergistically.
(3) RAFBCA results can be extrapolated to other similar micro-organisms since data from
field experiments (using several different crops) clearly showed that BCAs are safe. It
is noted that experiments were performed through all stages from production to final
23
products and the worst case scenario was also examined (applied ten-times higher than
normal dose; Skrobek & Butt, 2005, Skrobek et al. 2006).
(4) In consequence, very low amounts of metabolites were detected (Boss et al. 2007;
Seger et al. 2004, Seger et al. 2005a, c; Shah et al. 2005; Skrobek & Butt 2005,
Strasser et al. 2000a,b). Therefore, RAFBCA results should be considered as a model
and more effort should be put in dissemination of these results, particularly among
regulatory people.
In the assessment of risks that fungal BCAs may pose, the ecology and the biology of BCAs
should be taken seriously into account.
(1) In most cases BCAs are already in the fields. After application of BCA the population
is increased, but after a while, the population decreases and goes back to the naturally
occurring levels in the filed (trials/studies done in BIPESCO and RAFBCA project).
(2) Sprayed conidia do not pose a risk because they germinate only after the contact to the
target (i.e. on treated pest insects). Toxins are produced under inducible conditions
within the host, therefore they exist in extremely low amounts elsewhere and crops are
safe. Metabolites did not enter the food chain (RAFBCA results: Boss et al. 2007;
Seger et al. 2005a,b; Strasser & Kirchmair 2006; Skrobek et al. 2007).
How to deal with a registration of a microbial BCA that has only recently been described/
introduced – and for which there is no information about metabolites available?
(1) Crude extracts should be the solution: Strictly control the process of the production,
use the crude extract produced in the production facility in approved bioassays.
(2) This approach does not require the set up of analytical methods with high sensitivity
for each of the known toxic metabolites of a particular microbial BCA (which is a very
time-, labour- and money-consuming task).
(3) Strain level information should be requested – do not extrapolate data between species
(see also SANCO document: Guidance developed within the Standing Committee on
the Food Chain and Animal Health on the taxonomic level of micro-organisms to be
included in Annex I to Directive 91/414/EEC (Sanco/10754/rev. 5).
(4) Find its genetic relation with other known BCA (i.e. BCA already in the market) –
basic research (see also item 6).
We are aware that the use of crude extracts has also pitfalls.
(5) There is a need to set up standard procedures for the production of crude extracts
(cultivation and extraction protocol, bioassays) for each microbial BCA that meets the
requisite of maximum expression and detection of potential toxicity of extracts.
(6) Crude extracts are usually very concentrated as they come from pure cultures of the
fungus grown in the best condition for metabolite production. This means that in
biological assays someone will use concentrations of metabolites that hardly occur in
nature. This actually is a “hazard assessment” and not a “risk assessment”, as the latter
would require an evaluation of the probability that hazardous levels of metabolites
occur in the reality after in situ production, translocation and degradation.
(7) Crude extracts are hardly expected to show zero toxicity; therefore it will be necessary
to establish tolerance levels of toxicity (i.e. cytotoxicity, ecotoxicity) by biological
assays. This should be done, of course, on the basis of scientific criteria and procedures that we have to define.
(8) Also, other possible concerns of EU representatives could stem from the following
considerations: It evaluates only acute toxicity and not toxicity due to sub-lethal doses
24
(chronic toxicity) and it is based only on in vitro testing (no tests on laboratory
animals are required).
Alternative approach to assess significance of metabolites produced by MPPPs
The actual E.U. approach to microbial metabolites is discussed in the OECD Issue Paper on
“Microbial Metabolite Residues in Treated Food Crops” (Rochon & Belliveau, 2006). The
authors concluded that for the 4th list substances (i.e. old-active compounds) experience
should be gained by using the Canadian and U.S. approach as guidance.
We also suggest that the detection of “toxic metabolites” should be based on basic
toxicity assessments (i.e. on TIER I toxicity tests) and information on the biology of the
microbial agent should be sufficient enough to evaluate the risks of microbials. However,
these studies should only be requested when a clear positive result could be detected with the
help of a sensitive test systems. Otherwise metabolite and residue data may not be required
and an exemption from the requirement of a tolerance may be recommended for products
intended for use on food feed crops.
It is conceivable that the toxicological risk associated to a particular microbial BCA
would be better foreseen by assaying mixtures of metabolites, like those in crude culture
extracts, on test systems characterised by sensitivity to a large spectrum of different
molecules, instead of assessing the toxicity of single metabolites. The investigation of the
toxigenicity (potential to produce toxins) of a microbial by crude extracts again should be
only necessary in cases when reasonable concerns exist that intolerable amounts of toxins are
produced in the environment after the application of the BCA. This risk should be always
estimated in view of the natural background level of the micro-organism in question.
Exclusive comments made by risk assessors and other REBECA participants*
(* Disclaimer: comments posted here are the opinions of the REBECA workshop participants
and therefore may not reflect the opinion of the authors)
EU regulators must assess whether potential mammalian-toxic substances could be preformed in the formulated end-use product prior to application as well as assess whether any
such toxins might be produced by the micro-organism after application to crops and/or soil on
which the crop is grown. If toxins or residues of concern are present in the formulated product
or can be produced post-application, then crop residue data may be warranted.
It was expressed that the current EU Dir. 91/414 is too much concerned with metabolites,
while attention should be paid to their effects (that is toxicity instead of compounds).
Toxicological assessment of BCAs should be especially concerned with exposure of
workers (of production plants, farmers) and consumers, while ecotoxicological assessments
should be done based on the intended use (greenhouse vs. field, soil vs. foliage) and benefit of
waivers for non relevant ecotoxicological hazards.
According to the evaluators of dossiers, waivers for non relevant ecotoxicological
assessment are already a largely used praxis, based on sensible judgment of evaluators.
There are many "metabolites" produced by any microorganism in the course of its normal
metabolism. Very few of them are likely to be toxins. The most important assessment to
address the rare potential for an unreasonable human or environmental risk from such a toxin
is the initial taxonomic identification of the microorganism and its relationship to any known
problematic microorganisms. Several of the many microbial pesticides submitted for
registration to the US EPA were found to be closely related to strains that produced known
toxins of concern and the registration applicants were asked to test to show that their isolate
did not produce these toxins. EPA generally rely on the “Maximum Hazard dose testing” in
the non-target species and rodent testing to detect potential toxicity and if they see this, the
25
tiered data requirements allow for testing of potential toxins via standard acute and/or
subchronic toxicity testing. It should be kept in mind, however, that most genotoxicity assays
do not work well with mixtures derived from microbials, especially the Ames test which will
show positive responses if Histidine is present. The two MPCA's cited in the April 2007
paper, Beauveria and Metarhizium, should be recognized as a extreme worst case example.
These are two of the very few microbial pesticides that triggered higher tier non-target
organism testing for us. But, for example, for one of the Beauveria registrations, it was found
that no cases of any epizootics had ever been found. This is one of the advantages of using
these naturally-occurring pesticides in that we can use the scientific literature to help
determine if there have been any problems with the organism.
The analysis of metabolites requested by the current regulation is difficult to fulfil and
unsatisfactory for the purpose of risk assessment, especially for new BCAs, for which
information about metabolites might be scarce or null.
For the above reasons and for those reported in the document under discussion, there is a
general consensus of the experts on the opportunity to use crude extracts of microbial BCAs
for assessment of toxicological risks (including genotoxicity).
However, there is a need to clarify how to deal with the results from the assessment of
crude extracts. How can potential risks be evaluated from data if critical toxic effects occur?
Case studies should be carried out with crude extracts from complex medium cultures.
Toxic effects can be expected to occur in any case (no negative control with a micro-organism
might be possible). It was mentioned that should crude extracts of Bacillus thuringiensis have
been assessed, this BCA might not have been authorised based on the toxic effects.
Standardized and robust procedures for cultivation of microbial BCAs and extraction of
cultures and products for the purpose of toxicological assessment should be developed and
make available to the stakeholders. Alternatively (or additionally), the formulated product
should be assessed for toxic effects. This work should be supported by public research funds.
Conclusion
An improvement in harmonisation and consistency in the risk assessment/risk management
throughout the EU (e.g. by generating guidance documents/lessons learned documents that
would help securing consistency and harmonisation) especially for the assessment of
microbial metabolites is requested. Therefore, political willingness is announced to open ways
and strategies to get microbial BCAs faster and with lower costs on the European market.
Acknowledgement
This work was supported by the European Commission, Specific Support Action SSPE022709. The authors are indebted to the RAFBCA team (QLK1-CT2001-01391) to provide
the actual reference list on metabolites. We also wish to thank Alain Vey (INRA), Willem
Ravensberg (Koppert BV), Ralf Ehlers (University Kiel), Gabi Berg (Univ. Graz), Tobias
Längle (Agriculture and Agri-Food Canada, Ottawa), Kersti Gustafsson (KEMI, Sweden),
Rüdiger Hausschild (GAB Consulting) William R. Schneider (US-EPA), John Dale
(Pesticides Safety Directorate-UK), Jeroen Meeussen (CTB-NL), Susanne Guske (BVL,
Braunschweig), Susanne Brock (Umweltbundesamt, Dessau) for their helpful discussion.
26
References
Boss, D., Maurhofer, M., Schläpfer, E. & Défago, G. 2007: Elsinochrome A production by the
bindweed biocontrol fungus Stagonospora convolvuli LA39 does not pose a risk to the
environment or the consumer of treated crops. FEMS Microbiol. Ecol. 59:194-205.
EU 2001: EC Directive 2001/36/EC. Official Journal of the European Communities L 164/1.
Kirchmair, M., Neuhauser, S., Huber, L. & Strasser, H. 2008: The impact of soil treatment on
soil mycobiota. IOBC/wprs Bulletin 31: 239-244.
RAFBCA 2007: http//www.rafbca.com/?subject=news&topic=events&subtopic=ibma_iobc_
workshop
Rochon, D. &. Belliveau, B. 2006: OECD Issue Paper – Discussion on microbial metabolite
residues in treated food crops.
Seger, C., Sturm, S., Stuppner, H, Butt, T.M. & Strasser, H. 2004: Combination of a new sample
preparation strategy and an accelerated high-performance liquid chromatography assay with
photodiode array and mass spectrometric detection for the determination of destruxins from
Metarhizium anisopliae culture broth. J. Chrom. A 1061: 35-43.
Seger, C., Längle, T., Pernfuss, B., Stuppner, H. & Strasser, H. 2005a: High-performance liquid
chromatography-diode array detection assay for the detection and quantification of the
Beauveria metabolite oosporein from potato tubers. J. Chromatogr. A 1092: 254-257.
Seger, C., Erlebach, D., Stuppner, H., Griesser, U. & Strasser, H. 2005b: Physico-chemical
characterization of oosporein, metabolite of fungus Beauveria brongniartii. Helvet. Chim.
Acta 88: 802-809.
Seger, C., Sturm, S., Längle, T., Wimmer, W., Stuppner, H. & Strasser, H. 2005c: Development
of a HPLC-DAD assay for the detection and quantification of the fungal metabolite
oosporein from fungal culture broth and biological pest control formulations. J. Agri. Food
Chem. 53: 1364-1369.
Shah, F.A., Wang, C-S. & Butt, T.M. 2005: Nutrition influences growth and virulence of the
insect-pathogenic fungus Metarhizium anisopliae. FEMS Microbiol. Let. 251: 259-266.
Skrobek, A. & Butt, T.M. 2005: Toxicity testing of destruxins and crude extracts from the insectpathogenic fungus Metarhizium anisopliae. FEMS Microbiol. Let. 251: 23-28.
Skrobek, A., Boss, D., Défago, G., Butt, T. & Maurhofer, M. 2006: Evaluation of biological test
systems to assess the toxicity of metabolites from fungal biocontrol agents. Toxicol. Let.:
161: 43-52.
Strasser, H. & Kirchmair, M. 2006: Potential health problems due to exposure in handling and
using biological control agents, in an ecological and societal approach to biological control.
(eds). Eilenberg, J. & Hokkanen, H.M.T. Springer, Dordrecht: 275-293.
Strasser, H., Typas, M., Altomare, C. & Butt, T.M. 2007: Proposal for a guidance document
on risk assessment of metabolites produced by micro-organisms in plant protection
products. (http://www.rebeca-net.de/downloads/xxx.pdf).
p. 27
The impact of Plant Protection Products (PPPs) on non-target
organisms: soil microbiota
C. Felici, C. Cristani, S. Degl’Innocenti, M. Nuti
Dept. of Crop Biology, University of Pisa, via del Borghetto 80, 56124 Pisa , Italy
Abstract: In the ERA (Environmental Risk Assessment) of PPPs there is one rather neglected area:
the evaluation of the impact on soil microorganisms. These, in the past, have been overlooked
probably because of a lack of suitable approaches (e.g. DNA-based and in situ methodologies).
Following the development of more olistic and advanced approaches in Microbial Ecology (Lynch et
al., 2004) in the ’90, this relevant area is being revitalised. Tracking Bacillus subtilis in soil as
biological control agent against soil-borne phytopathogens, and using DGGE to detect changes in soil
microbiota, Felici (2007) could show that the bacterial component is unaffected, whilst the saprophytic
fungal population undergoes detectable changes. Bacillus thuringiensis affects soil microorganisms or
their activity according to subspecies: B. t. aizawai was found to have no negative influence on N
turnover and dehydrogenase activity, when the active ingredients was applied at recommended rates.
Studies on B. t. kurstaki indicate there are no long-term effects when measuring C- and N- biomass
and soil respiration. For B. t. tenebrionis, respiration, microbial metabolic quotiens and cellulose decay
potential were not affected by recommended field application rates, when studied in litter and organic
matter turnover assays over 8-weeks period. Specific studies are not available for PPPs such as M.
anisopliae, Lecanicillium muscarium, Phlebiopsis gigantea, B. bassiana GHA and Streptomyces. For
Trichoderma viride and T. harzianum there are no reported impacts on soil respiration and nitrogen
transformation, being the notated trigger values below the ones proposed by the OECD guidelines. At
the moment it seems that the ERA of PPPs is at a developmental stage as far as soil microbes are
concerned. Virtually no studies are available on long-term effects. Data on short-term effects are often
erratic (choice of the method) and are not compared to natural (temperature, humidity, rainfall) or
anthropogenic (manuring, crop rotation, harvesting, tilling) influences. Data on the effects on soil
microbial biodiversity are scarce or not available, despite the methodologies have been developed and
extensively used in scientific literature. Furthermore, the lack of unequivocal identification tools of the
PPP released in multi-microbial environments (rhizosphere soil, bulk soil) makes it more difficult to
evaluate the enviromental impact of field released strains.
References
Felici, C. 2007: Molecular tools for monitoring Bacillus subtilis in the rhizosphere of crop
plants. PhD Thesis, University of Pisa, Italy.
Lynch, J.M. et al. 2004: Microbial diversity in soil: ecological theories, the contribution of
molecular techniques and the impact of transgenic plants and transgenic microorganisms.
Biol. Fertil. Soils 40: 363-385.
27
pp. 28-31
How to evaluate the environmental safety of microbial crop protection
products? A proposal
B.J.W.G. (Hans) Mensink
RIVM-SEC (Rijksinstituut voor Volksgezondheid en Milieu-Stoffen Expertise Centrum;
National Institute for Public Health and the Environment-Expertise Centre for Substances),
Bilthoven, The Netherlands.
Abstract: Micro-organisms used for crop protection are relatively safe when applied as prescribed.
They still require a proper pre-market safety evaluation in view of potential toxicity, infectivity and
pathogenicity. This is of particular importance as crop protection products with active microorganisms will be increasingly important for sustainable agriculture worldwide. Regulatory guidance
to evaluate the environmental safety of microbial crop protection products is limited. Therefore we
developed a risk decision tree [see figure] in cooperation with the National Board for the
Authorisation of Pesticides and the Dutch Ministry of Environment.
Key words: decision tree, micro-organisms, microbial crop protection products, environmental safety,
risk assessment
Introduction
Micro-organisms used for crop protection are allegedly safe when applied as prescribed.
However, there is consensus that crop protection products with fungi and bacteria always
require a proper pre-market safety evaluation. This is not only in view of potential toxicity,
infectivity and pathogenicity of the micro-organism to other organisms, but also because of
the possible effects of microbial contaminants and co-formulantia [spreader, sticker]. A
proper safety evaluation is of particular importance as microbial crop protection products
[MCPP] will be increasingly used for sustainable crop protection worldwide. Also, as the
efficacy of the current MCPPs is not always satisfactorily, there is a trend to improve these
products. An improved efficacy may enlarge the potential environmental impact.
How should regulatory managers from industries, regulators from governments, or
environmental scientists deal with such risks? Scientific and technical guidance on the safety
evaluation for regulatory reasons is scarce and therefore we have developed an environmental
risk decision tree in cooperation with the Dutch Ministry of Environment and the National
Board for the Authorisation of Pesticides. This decision tree enables stakeholders to assess
whether the environmental risks are acceptable, taking into account the efficacy,
characterisation, identification, use pattern, emission, exposure and environmental effects of
MCPPs.
Methods
A decision tree has been used as a format for regulatory guidance. Risk criteria and
descriptions as embedded by the EU were the starting point for this tree [EC, 2001,2005].
28
29
However, in view of harmonisation, OECD/BPSG1) and NAFTA2 descriptions and procedures have been taken into account when possible.
Results
Fig. 1 shows the importance of the submitted data and information on characterisation,
identification and efficacy [box 1]. The tree also indicates that sufficient and valid data should
be available on the emissions [box 2], exposure [box 3] and effects [box 4] on non-target
organisms. The tree first focuses on the toxic effects of an MCPP [sub 4A]. The tree zooms in
on the potential infectivity and pathogenicity, only if an MCPP is not toxic, allergenic or
competitive to an NTO [from 5D to 4B]. If the MCPP is toxic, the safety evaluation proceeds
conform the EU evaluation of a chemical synthetic pesticide [sub 5C,D].
The tree refers mainly to the first tier safety evaluation, i.e. based on rather conservative
assumptions as direct and worst case exposure, whereas the actual exposure may be much less
or indirect. The application rates in tests are preferably those in accordance with Good
Agricultural Practice3 [(sub 4A,B]. More details are found in Mensink and Scheepmaker
[2007].
Discussion and conclusions
An environmental safety evaluation without data is impossible. However, depending on the
submitted data and the overall picture of the product’s environmental safety that emerges,
some data may be waived [sub 5A]. Bridging and familiarity studies to support extrapolation
of micro-organism strain A to strain B may be helpful in this respect. Taxonomy based on
molecular, biochemical or genetical characteristics may be helpful as well. Taxonomy should
also be helpful to determine the "indigenousness" of the active microbial species, strain or
type [OECD, 2006]. However, "indigenousness" is a difficult concept and therefore of limited
value.
The decision tree leaves more room for expert judgement and discussion than the EU and
NAFTA approach. The EU, for instance, states that when the exposure of NTOs or compartments is negligible, the risk is always acceptable [from 3A directly to 6B], whereas the
proposed decision tree has build in the possibility of a scientific or regulatory reconsideration
in case the product is suspected to be toxic, infectious or pathogenic in spite of a negligible
exposure [sub 3D]. The NAFTA approach, for instance, focuses in the first tier evaluation
directly on box 4 — coming from box 2 — taking box 3 into account not earlier than in the
second tier evaluation. The behaviour and fate in the environment are not evaluated by
NAFTA countries in the first tier. Again, the decision tree is more nuanced, as it proposes a
first tier exposure assessment via box 3.
An environmental risk decision tree is proposed as a registration tool for MCPPs prior to their
marketing [Mensink & Scheepmaker, 2007]. This tree and the accompanying guidance
document should enable risk assessors and environmental scientists to verify the risk criteria
and descriptions respecting the potential environmental behaviour, fate and effects of an
MCPP under review. In this way, it should be possible to discern whether a risk is acceptable
or not. Case by case expert judgement, however, remains necessary in view of [a] the limited
knowledge of modes of action, the role of toxins and enzymes, and the microbial population
1
Organisation for Economical Cooperation and Development and the BioPesticide Steering Group which is an
OECD initiative.
2
North American Free Trade Association.
3
GAP, i.e. conform legal regulation and usage instructions.
30
dynamics, [b] the limited experience of EU countries with regulatory test protocols for microorganisms, [c] taxonomical difficulties in relation to the indigenousness of active microorganisms and [d] difficulties in extrapolating laboratory data to the field [Hokkanen and
Hajek, 2003]. Long-term effects of MCPPs are also not well studied.
Figure 1. Environmental risk decision tree for microbial crop protection products (proposal
for 1st tier evaluation). PEC: predicted environmental concentration; EC50: the median
effective concentration; NOEC: no-observed-effect concentration; TOs: target organisms;
NTOs: non-target organisms; GAP: good agricultural practice.
31
Acknowledgements
The author thanks Jacqueline Scheepmaker [RIVM], Jeroen Meeussen, Adi Cornelese,
Renske van Eekelen [all from the Board for the Authorisation of Pesticides], and Jan de Rijk
[Ministry of Environment].
References
European Commission 2001: Commission Directive 2001/36/EC of 16 May 1991, amending
Council Directive 91/414/EEC concerning the placing of plant protection products on the
market. Official Journal of the European Communities L 164/1.
European Commission 2005: Council Directive 2005/25/EC of 14 March 2005 amending
Annex VI to Directive 91/414/EEC as regards plant protection products containing
micro-organisms. Official Journal of the European Union L 90/1-34.
Hokkanen, H.M.T. and Hajek, A.E. (eds) 2003: Environmental impacts of microbial
insecticides. Kluwer Academic Publishers. Dordrecht, Boston, London.
Mensink, B.J.W.G. and Scheepmaker, J.W.A. 2007: How to evaluate the environmental safety
of microbial plant protection products: a proposal. Biocontrol Sci. Technol. 17:3-20.
OECD 2006: Working document on the evaluation of microbials for pest control (Draft).
4
Virus
5
p. 35
Sf29 is a viral factor that could be involved in virion packing within
the OBs
Oihane Simón1,2, Sarhay Ros2, Andrea Gaya2, Primitivo Caballero2 and
Robert D. Possee1
1
Centre for Ecology and Hydrology, Natural Environmental Research Council, OX1 3SR,
Oxford, United Kingdom; 2 Departamento de Producción Agraria, Universidad Pública de
Navarra, 31006 Pamplona, Spain
Abstract: During plaque assay purification of the SfMNPV wild-type population, we found genotypic
variants showing various levels of per os infectivity. Variants lacking the ORF homologue to Se030
(Sf29) had lower pathogenicity and virulence. To determine the effect of disrupting Sf29 in SfMNPV
pathogenesis, we used a PCR and bacmid-based recombination system to delete the Sf29 gene from a
SfMNPV bacmid. Different aspects of virus replication and pathogenesis were studied. The Sf29-null
bacmid was able to generate a transmissible infection in cell culture and S. frugiperda larvae. We
therefore concluded that Sf29 is not essential for propagation of viral infection. Temporal expression
revealed that Sf29 is transcribed at a similar level and just 12 h before Sfpolh in larvae. SfMNPV WT,
and SfMNPV, Sf29-null and Sf29-rescue bacmid OBs were produced. Six times less DNA was found
in polyhedra produced by the Sf29-null bacmid. We therefore investigated ODV content per occlusion
and nucleocapsid distribution among ODV populations. No differences were found in nucleocapsid
distribution among the ODV populations. However, the ODV banding pattern was less intensive in the
Sf29-null bacmid. We determined by end point dilution in Sf21 cells that Sf29-null OBs produced ~8
times less ODVs. By intrahemocelic infection of the same amount of DNA, we found that Sf29-null
DNA was as pathogenic and virulent and produced the same amount of DNA/larva and OBs/larva as
SfMNPV WT, and SfMNPV and Sf29-rescue bacmid DNAs. However less ODV are packaged within
the OBs. The presence of less ODV per occlusion explained the lower pathogenicity and virulence of
Sf29-null bacmid OBs. The Sf29 could be involved in ODV packing within the OBs during the
SfMNPV replication.
Key words: Spodoptera frugiperda, nucleopolyhedrovirus, Sf29, replication, pathogenesis, nucleocapsid, virion packing
35
p. 36
Acp26, a low transcribed gene, has no effect on AcMNPV replication
and pathogenesis in cell culture or lepidopteran hosts
Oihane Simón1,2, Primitivo Caballero2 and Robert D. Possee1
1
Centre for Ecology and Hydrology, Natural Environmental Research Council, OX1 3SR,
Oxford, United Kingdom; 2 Departamento de Producción Agraria, Universidad Pública de
Navarra, 31006 Pamplona, Spain
Abstract: A Spodoptera frugiperda nucleopolyhedrovirus (SfMNPV) bacmid system was developed.
The SfMNPV genome was cloned into pBACe3.6 using an AscI site. In the SfMNPV genome the AscI
site is located within the p26 gene, which was disrupted during bacmid cloning. To model the effects
of p26 gene disruption in SfMNPV replication, an AcMNPV bacmid system was more conveniently
used to delete the Acp26 gene. Different aspects of virus replication and pathogenesis were studied.
Temporal expression of this gene revealed that Acp26 is a late gene, is transcribed in a low temporal
expression time and at very low quantities, around 500 times less than Acpolh in larvae. The
Acp26null bacmid was able to generate a productive, transmissible infection in cell culture and larvae.
We concluded that Acp26 was not essential for propagation of viral infection. Deletion of Acp26 from
AcMNPV genome had no apparent effect on timing or production of infectious BV in cell culture or in
larvae. Furthermore, comparisons of AcMNPV and Acp26null bacmid viruses showed that Acp26 is
not essential for viral infectivity, virulence or productivity. Our results unequivocally demonstrated
that Acp26 gene is not a viral pathogenicity factor. The fact that the predicted p26 gene product seems
to have no effect on AcMNPV replication and infectivity, either in cell culture or larvae, would
facilitate the future studies of the SfMNPV gene functions using the SfMNPV bacmid system.
Key words: Autographa californica, p26, replication, pathogenesis
36
p. 37
Importance of peroral infection factors (pif and pif-2) in the
interactions between genotypes of Spodoptera frugiperda multiple
nucleopolyhedrovirus (SfMNPV)
Gabriel Clavijo1, Oihane Simón1, Delia Muñoz1, Trevor Williams2,
Miguel López-Ferber3, Primitivo Caballero1
1
Departamento de Producción Agraria, Universidad Pública de Navarra, 31006 Pamplona,
Spain; 2Instituto de Ecología A.C., Apartado Postal 63, Xalapa 91070, Estado de Veracruz,
México; 3Laboratoire de Génie de l’Environnement Industriel, Ecole des Mines d'Alès,
30319 Alès, France
Abstract: The Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) genome contains a
17.8 kb region that is rich in auxiliary genes and which also codes for two per os infection factor
genes: pif and pif-2. Eight plaque-purified genotypic variants from a wild-type (wt) SfMNPV strain
isolated in Nicaragua (SfNIC) contain genomic deletions within this region, while only one genotype
(SfNIC-B) had the complete genome. Two of the genotypes (SfNIC-C and SfNIC-D), both with
similar 16.4 kb deletions, restore the wt pathogenicity when co-occluded with SfNIC-B, which is 2.5
fold less pathogenic than the wt strain. To determine the role of the deleted region and the pif genes in
the biological activity of SfNIC, two recombinant viruses were generated using bacmid and plasmid
systems and the SfNIC-B genotype as a template. The first one lacked the same 16.3 kb genomic
region occurring in SfNIC-C, and was named SfNIC-B16K-null. The second recombinant
encompassed a 2.8 Kb deletion including only both the pif genes and was named SfNIC-Bpifs-null.
Mixed infections of each of these recombinants with SfNIC-B were both 2.4 fold more pathogenic
than SfNIC-B alone when the ratio of SfNIC-B to SfNIC-B16K-null or SfNIC-Bpifs-null was
approximately 3:1. These results demonstrate that the positive interaction between SfNIC-B and
SfNIC-C/D was due to the dilution of the pif genes in the co-occluded infectious mixture. Therefore,
an optimized SfMNPV-based bioinsecticide product should contain a genotypic combination such that
pif-containing genotypes do not account for higher than 75%. The importance of co-occlusion of
genotypes in the evolution of baculovirus pathogens of insects is discussed.
Key words: nucleopolyhedrovirus, genotypic variants, deletion recombinants, genotypes interactions,
biological activity.
37
p. 38
The role of midgut enzymes in the infectivity of baculoviruses
Basil Arif1, Jeffrey Slack1 and Peter Krell2
Laboratory for Molecular Virology, Great Lakes Forestry Centre, Sault Ste. Marie, Ontario,
Canada; 2 Molecular and Cellular Biology, University of Guelph, Ontario, Canada
1
Abstract: Baculoviruses are a family of insect viruses that have been used for decades in biocontrol
with varying degrees of success. Susceptible larvae become infected whey the forage on foliage
contaminated with viral occlusion bodies (OBs). OBs dissolve in the highly alkaline midgut
environment and occlusion-derived virions (ODVs) are liberated and initiate infection in columnar
epithelial. It has been demonstrated earlier that a number of virus encoded proteins are absolutely
essential to the infectivity of baculoviruses to larvae. The P74 first such protein demonstrated to be
essential for infectivity of baculoviruses and is present on the surfaces of ODVs. We have observed
that P74 of Autographa californica (Ac)MNPV is cleaved when a soluble form of the protein was
incubated with insect midgut tissues under alkaline conditions and that cleavage was prevented by
soybean trypsin inhibitor (SBTI). Biological assays were carried out and suggested that SBTI inhibited
baculovirus infection and that trypsin enhanced infectivity. This may be due to trypsin cleavage and
activation of P74. Analysis of the peptide sequences of P74 homologues identified a highly conserved
trypsin cleavage site that could generate the observed cleavage product. Further more, mutagenesis of
P74 trypsin cleavage sites had an effect on the oral susceptibility. In this study we link molecular
biology with practical biocontrol improvements and show evidence that plant products may affect
baculovirus efficacy.
Key words: Baculoviruses, Pathogenesis, p74 gene, midgut enzymes.
References
Faulkner, P., J. Kuzio, G. V. Williams & J. A. Wilson 1997: Analysis of p74, a PDV envelope
protein of Autographa californica nucleopolyhedrovirus required for occlusion body
infectivity in vivo. J. Gen. Virol. 78: 3091-3100.
Kuzio, J., R. Jaques & P. Faulkner 1989: Identification of p74, a gene essential for virulence
of baculovirus occlusion bodies. Virology 173: 759-763.
Kikhno, I., S. Gutierrez, L. Croizier, G. Croizier & M. López-Ferber 2002: Characterization
of pif, a gene required for the per os infectivity of Spodoptera littoralis nucleopolyhedrovirus. J. Gen. Virol. 83:3013-3022.
38
p. 39
Revisiting the pathology of Junonia coenia densovirus for a potential
use as a biopesticide
Mylène Ogliastro, Doriane Mutuel, Marc Ravallec, Agnes Vendeville, Xavière Jousset,
Max Bergoin
BiVi INRA USTL place Eugene Bataillon 34 000 Montpellier, France
Abstract: The densovirus are small, non enveloped, single stranded DNA viruses infecting a wide
variety of insects, including lepidoptera and mosquitoes. They are lethal at larval stages. Their host
range could vary, from a specialist virus, infecting only one host, to a generalist virus infecting several
hosts. The Junonia coenia Densovirus (JcDNV) belongs to the second class, infecting numerous
Lepidoptera. The tissue tropism can be restricted to the midgut or infecting all the tissues but the
midgut.
We focused our study on the infection of the pest model, Spodoptera frugiperda by the JcDNV.
The route of infection is not known, neither the targeted tissues. Our results show that the virus gets
into the intestinal cells without replicating and then spread to the whole body probably through the
tracheal system.
39
pp. 40-43
Evaluation of the per os insecticidal activity of baculoviruses by a
nebulization method
Maria Victoria Carrera 1, 2, Jean-Louis Zeddam 1, André Pollet 1, Xavier Léry 2,
Miguel López-Ferber 3
1
IRD (UR072), Pontificia Universidad Católica del Ecuador, Laboratorio de Bioquímica y
Microbiología molecular, Quito, Ecuador; 2 IRD (UR072), Centre de Recherche, 30380
Saint-Christol-les-Alès, France; 3 Ecole des Mines, LGEI, 30319, Alès, France
Abstract: Precise evaluation of the biological activity of Baculoviruses by the usual droplet method is
not appropriate for boring insect larvae that remain on plant surfaces for a limited time before
penetrating the substrate. Alternative systems using surface contamination of the substrate (Potter
tower, immersion) are often expensive and/or difficult to implement and are not always sufficiently
reliable because they produce non homogeneous and non reproducible results. A new system was
developed for evaluating precisely the biological activity of several granulovirus isolates on potato
tuber moths. In this system, the spraying of viral suspensions was carried out by a Pulmo-Aide
Sunrise® Compressor/Nebulizer usually used for the treatment of pulmonary infections. This system
delivered small drops by the Venturi effect. PVC tubes directed the aerosol to the potato surface where
it is deposited homogeneously. The system worked well in different locations where the atmospheric
pressures were significantly different. To provide an internal control, we used samples of purified viral
suspensions at appropriate dilutions mixed with Coomassie blue. Spectophotometer measurements of
the optical density of the colorant deposited on the surface after nebulization showed that the
reproducibility of the method was always greater than 95 %. This method is reliable, inexpensive and
easy to use.
Key words: aerosol, nebulization, surface contamination, granulovirus, insect borer
Introduction
The droplet method usually used for the evaluation of the biological activity of baculoviruses
is not appropriate in the case of borers like the potato tuber moths (Lepidoptera; Gelechiidae)
whose mining larvae remain on the infected surface only for a few minutes. So, the biological
activity of the Phthorimaea operculella granulovirus (PhopGV) was generally evaluated by
immersing the eggs (Sporleder et al., 2005) or the potato tubers (Zeddam et al., 1999) in viral
solutions which contain a certain number of macerated PhopGV-infected larvae (larvaequivalents). This protocol has since been improved by the use of purified virus granules
instead of larva-equivalents. However, these methods do not allow the precise determination
of the granule concentration present on the potato surface, which could lead to a high
variability between experiments. A more precise technique is the pulverization of purified
granules using a Potter tower, but its use as a routine methodology is expensive and thus not
adapted for emerging countries. A cheap, precise and repeatable method of the evaluation of
biological activity of a virus isolate is required to allow proper comparisons and quality
control. Small droplet generators are widely used in the treatment of pulmonary diseases and
the technology to produce droplets of reproducible size is well developed. We have examined
the possibility of using such devices to deliver precise and repeatable virus doses onto a given
surface.
40
41
Material and methods
Contamination device
The contamination device is composed of a medical compressor/nebulizer (DeVilbiss PulmoAide Sunrise® Compressor/Nebulizer, model 5650, Sunrise Medical, USA) coupled to a
combination of 125 mm-diameter PVC tubes constituting the tower and the chamber for
pulverisation of the viral suspensions (Fig 1). Different constructions were tested by
modifying the horizontal and vertical lengths as well as the position of the decompression
hole. The total cost of the whole device was less than 200 US$.
Figure 1. The nebulization device. A: Nebulizer, B: Nebulization chamber, C: Pulverization
tower, D: Decompression hole
Repeatability and homogeneity of the spray
A Coomassie blue solution (500 mg/L) was used to calibrate our system. The nebulization
chamber was filled with 1 to 5 ml of this colorant solution. Different volumes were tested to
assess whether the system provided consistent results over this range. Five 16 mm-diameter
plastic coverslips were randomly placed on the treated surface located at the base of the
vertical PVC tube. The coverslips were used during the tests to collect the colorant solution
deposited onto a known area and, therefore evaluate the homogeneity (i. e. the variability of
the quantity of colorant among the 5 slipcovers corresponding to a single application) and the
amount of solution recovered. After 10 to 20 min of pulverisation, the coverslips were
recovered and dried. First, the homogeneity of the drop distribution was evaluated by light
microscopy. Then, the dried coverslips were washed with 0,2 ml of water. The optical density
(OD) of this solution was measured at 556 nm wavelength (corresponding to the maximum
absorption of the Coomassie blue) using a spectrophotometer. The OD values were compared
to a standard curve. Ten experiments were carried out for each device tested. The
homogeneity of the experiments was estimated by the variation coefficient (VC = Sx/x) of the
OD obtained for each coverslip. The repeatability was estimated by comparison of the
42
different VC obtained in the 10 experiments. A non parametric test of Kruskal-Wallis was
used to compare the deposit of colorant onto the different coverslips for each construction.
These results were compared with those obtained using a Potter tower.
Granulovirus application and yields estimation
Viral bio-assays were performed using purified supensions of the Tunisian isolate of PhopGV
(Taha et al., 2000). Different purified granule dilutions (corresponding to final deposits of 0,6,
6, 60, 600 and 6000 viral inclusion bodies/mm2, respectively) were used with or without
colorant to control the quantity of virus sprayed onto the treated surface by the system. For
these controls, coverslips were laid and treated as previously described and the virus
concentration was measured at OD 450 nm, corresponding to the wavelength at which the
absorbance of the granulovirus solution is the greatest. The quantity of virus was evaluated
using the formula derived from Tchang and Tanada (1978), modified by Zeddam et al.
(2003): 6,8 x 108 x OD450 x dilution = Number of granules/ml.
Nebulization device
Various configurations of the device were evaluated by nebulizing a Coomassie solution as a
control of the quality of the deposits. The optimum homogeneity and repeatability were
obtained using the PVC pulverisation device (Fig.1). At Saint-Christol-les-Alès (France, 140
m.a.s.l.), its dimensions were the following: Horizontal length: 385 mm. Vertical length: 345
mm. Decompression hole: 28 mm in diameter placed at 260 mm above the basis of the device.
The system developed at Alès had to be adapted for use under different atmospheric pressure
conditions, i. e. in Bogota (Colombia, 2600 m.a.s.l.) and Quito (Ecuador, 2800 m.a.s.l.).
Namely, the place of the decompression hole and the length of the horizontal chamber were
modified for these two latter locations. The hole was enlarged to 28 mm in diameter and
displaced 175 mm above the device base and the length of the horizontal chamber was
reduced to 290 mm.
Repeatability and homogeneity of the deposits
In Alès, a 94,0 % homogeneity and a repeatability of 97,5 % (i. e. the variability of the
quantity of colorant deposited onto the 5 discs among the 10 repetitions) with variation
coefficients of 0,0599 and 0,0252, respectively were obtained. No difference was observed
between repetitions (Kruskal-Wallis test, Kc = 8,08; P < 0,01). One mg of Coomassie blue
spray resulted in 8,065 ng of blue deposited/mm2, representing a 9 % recovery (for an internal
diameter of the pulverisation tower of 120 mm).The same protocol applied in Quito, with a
slightly modified device, gave similar results with 94 % homogeneity and 95,8 % repetitivity
with 0,0620 and 0,0419 VC, respectively, for a 10,4 % recovery. We obtained similar results
for nebulized volumes in the range 1 to 5 ml. We carried out a comparison between
pulverisations with a Potter tower and our system, before and after its calibration. Using a
Potter tower a lumpy aspect was observed, indicating a bad dispersal due to a drop size too
large. Light microscopical observations detected a great homogeneity in the sizes of the drops
generated by the nebulization system.
Granulovirus application yields obtained with the device
After calibration with the Coomassie blue solution, the device was tested for its suitability for
uniform application of the granulovirus onto the treated surface. The results were as good as
those obtained with the colorant solution (data not shown). However, the yield was different
43
in the case of the PhopGV application. 2,5 ml of viral suspension containing 1010 granules
nebulized with our protocol allowed us to deposit 10.000 granules/mm2, representing a 1,13
% recovery. The difference between the quantities of blue and virus recovered may be due to
a superior loss of virus in the horizontal part of the device. Using the immersion method, we
estimated that only 1 of 106 granules were finally adsorbed onto the potato surface (Carrera et
al., 2002). Thus, with the same initial quantity of material, the yield of the virus deposited
using the new device would be superior by more than 104 times to the yield given by the
immersion method, which means that a much smaller amount of virus is required to perform
the assays.
The method presented here appears very useful for the realization of standardized per os
infection of potato tuber moth larvae. It is particularly suitable for the precise evaluation of
the biological activity of granuloviruses and was successfully used for this purpose (Carrera et
al., 2002). This method presents three main advantages: it is cheap, repeatable, and easy to
perform.
This device is presently used in laboratories located in several countries (France, Ecuador,
Colombia and Costa Rica). It gave reliable results as the same lethal concentration values
were obtained for the same viral isolate tested in each of these laboratories. One of the great
advantages is the possibility of using a same calibrated method to compare the virulence of
distinct PhopGV (or other granulovirus) isolates against laboratory colonies of potato moths
maintained in different laboratories.
Acknowledgements
The authors gratefully acknowledge Dr. Darrell R. Stokes (Emory University, USA), Dr.
Stéphane Dupas (IRD, France) and Dr. Olivier Dangles (IRD, France) for their comments and
help with the translation of this article.
References
Carrera, M. V., Zeddam, J-L., Léry, X., Pollet, A., López-Ferber, M. 2002. Evaluation of the
biological activity of Phthorimaea operculella granulovirus. Proc. Assoc. Fran. de Protec.
des Plantes (AFPP), 6th Int. Conf. on Pests in Agricult., 4th-6th Dec., Montpellier, France:
447-452.
Chang, P.M. & Tanada, Y. 1978. Serological study on the transmission of a granulosis virus
of the armyworm, Pseudaletia unipuncta (Lepidoptera: Noctuidae), to other lepidopterous
species. J. Invertebr. Pathol. 31: 106-117.
Sporleder, M., Kroschel, J., Huber, J., & Lagnaoui, A. 2005: The granulovirus PoGV in its
host Phthorimaea operculella. Entomol. Exp. Appl. 116: 191-197.
Taha, A., Croizier, L., López-Ferber, M., & Croizier, G. 2000: Physical map and partial
genetic map of the potato tuber moth Phthorimaea operculella (Zeller) granulovirus
(PhopGV). 19th Ann. Meeting Am. Soc. Virology, July 8-12, Univ. Colorado, Fort
Collins, Co. Ma, USA.
Zeddam, J.L., Pollet, A; Mangoendiharjo, S., Ramadham, T.H. & López-Ferber, M. 1999:
Occurrence and virulence of a granulosis virus in Phthorimaea operculella (Lep.
Gelechiidae) populations in Indonesia. J. Invertebr. Pathol. 74: 48-54.
Zeddam, J.L., Vasquez Soberón, R.M., Vargas Ramos, Z. & Lagnaoui, A. 2003: Producción
viral y tasas de aplicación del granulovirus usado para el control biológico de las polillas
de la papa Phthorimaea operculella y Tecia solanivora (Lepidoptera: Gelechiidae). Bol.
San. Veg. Plagas 29: 657-665.
pp. 44-49
The importance of genetic variability in a natural baculovirus
population
Miguel López-Ferber1, Oihane Simón2, Trevor Williams3 and Primitivo Caballero2.
1
LGEI, Ecole des Mines, Alès, France; 2 Departamento de Producción Agraria, Universidad
Pública de Navarra, 31006 Pamplona, Spain; 3 Instituto de Ecología AC, Xalapa, Ver. 91070,
Mexico.
Abstract: Analysis of a natural population of the Spodoptera frugiperda multiple nucleopolyhedrovirus revealed an important degree of internal genetic diversity. Nine major genotypes were
isolated. Understanding the contribution of each genotype to the global phenotype (pathogenicity,
virulence, yield) of the population is one way to optimise the use of biological control agents.
Comparison of the pathogenicity of the whole population and of each genotype isolated revealed that
no genotype is as pathogenic as the whole virus population. Combination of two genotypes in precise
proportions mimics the population behaviour concerning pathogenicity. Artificial populations constructed from these two genotypes in non-optimal proportions evolve towards a single equilibrium that
matches the original population.
Key words: Spodoptera frugiperda nucleopolyhedrovirus, genetic diversity, integrated control
Introduction
The genetic variability in natural populations of baculovirus has been recorded by the first
researchers that applied techniques like restriction enzyme polymorphism to the analysis of
baculovirus genomes (Lee & Miller, 1978, Maruniak et al., 1984; Brown et al., 1985), but the
significance of this variability was not explored in detail. In the early seventies, research
mainly aimed to describe the interactions between the virus and the cell (or the whole
organism), and genetic variability was more of an experimental problem than a subject of
study. At that time, obtaining a genetically homogeneous strain was the starting point for any
molecular work with a virus. Thus, most of the molecular knowledge available on the
baculoviruses comes from the studies of cloned viruses.
In Autographa californica multiple nucleopolyhedrovirus, AcMNPV, some differences in
the restriction patterns were observed between the cloned strains used in various laboratories.
The development of genome sequencing techniques allowed us to identify some variable
genes that appeared not to be essential for virus survival. In general, the function of those
genes in the virus cycle was not clearly deciphered.
The development of industrial products using baculoviruses as tools for the control of
insect populations required these products to comply with insecticide legal regulations. In
most countries, these insecticide regulations were developed for chemicals, and require the
product to be as precisely described as possible. It was tempting for the regulators to demand
the highest possible description of the active principle, and consequently, for the scientist to
use a cloned variant that could be clearly described, even sequenced, or argue that the
existence of genetic variants was an issue of minor importance.
The development of the trade-off theories in population genetics, together with the
observation of differences between the genetic variants composing the products based on
44
45
natural isolates (Corsaro & Fraser, 1987; Muñoz et al., 1998), led us to examine the precise
role of genetic variants in baculovirus populations. To this aim, the choice of the model was
one of the key points. It was important to start from a virus isolate that presented some degree
of natural genetic variability, was relatively easy to clone, and for which the host could be
easily reared. The Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV), Nicaraguan isolate (SfNIC) (Escribano et al., 1999) was chosen for this work.
Genetic composition of the virus isolate.
Restriction enzyme length polymorphism analysis of the SfNIC genome revealed an
important degree of genetic variability. Some submolar fragments were clearly visible. A total
of 164 individual genotypes were isolated from the original SfNIC virus population using the
standard plaque assay approach (King and Possee, 1992). These cloned genotypes were
amplified and classified in nine genotypic classes (A to I), according to their restriction
patterns.
This cloning system does not allow the isolation of genotypes unable to replicate autonomously in the cells. In addition, some minor variability certainly escaped to us, as the
discrimination criterion was based on restriction fragment polymorphism for a limited set of
enzymes. Accordingly, the picture obtained is likely to be an underestimate of the true
genotypic variability present in the population.
It is interesting to note that the frequency of isolation of each genotype does not
correspond to the actual proportion of this genotype in the natural population (Table 1).
The bands characterising some frequent genotypes are clearly visible in the wild-type
restriction profile as submolar fragments (see Figure 2 in Simón et al. 2004), confirming that
they are genuine variants, and that they have not been produced during the isolation procedure
through cell culture as suggested for other viruses (Heldens et al., 1996).
Table 1. Percentage prevalence of each virus genotype in the wild-type SfMNPV-NIC population estimated by: (A) cell culture (proportion of plaques of each genotype) and (B) semi-quantitative PCR using genotype-specific primers. Data from López-Ferber et al., 2003 and from
Simón et al., 2004.
Genotype
A
B
C
D
E
F
G
H
I
Cell culture
18
15
33
5
5
3
3
13
1
PCR
0.5
61
18*
3
9
0.6
0.2
5
* it was not possible to differentiate between genotypes C and D by PCR.
In this population, the variability is concentrated in a single region of about 16 kb located
between map units 14 and 27 of the SfNIC genome. In this region no gene essential for virus
survival in cell culture is located.
46
The observed variability consists of a series of deletions of various lengths, from 5 to 16
kb, affecting up to 17 genes (Simón et al., 2005). The genotype containing the longest
genome, that represent the most complete example of total genetic content of the population is
the SfNIC-B genotype, that was considered as the prototype. SfNIC-B appears to be the most
abundant genotype in the population, according to the PCR results. The shortest genomes are
those of genotypes C and D.
Biological characterisation of the virus genotypes
The biological activity of both the wild-type population and of each of the individually
isolated genotypes was analysed. It was observed that none of the genotypes isolated was as
pathogenic as the original population, following oral administration of occlusion bodies
(OBs). SfNIC-B was about one third as pathogenic as the SfNIC population, based on 50%
lethal concentration values (López-Ferber et al., 2003). No single genotype was as effective
as the natural population. In addition, the OBs of certain pure genotypes appeared not to be
able to produce lethal infections of host larvae. This was the case for genotype C, that was the
most frequently isolated variant in cell culture and that represent about 20% of the virus
population. These genotypes, however, are able to replicate in cell culture (otherwise they
would be lost in the cloning procedure) and in insects if injected. Among the genes affected
by the deletion in SfNIC-C (and SfNIC-D that is very similar), are the pif-1 and -2 genes
(Kikhno et al., 2002, Piljman et al., 2003). Pif stands for per os infectivity factor. Absence of
one of these genes completely abolishes the infectivity of the OBs, as the virions contained in
the OBs cannot initiate the primary infection of the mid gut cells in insect larvae (Gutiérrez et
al., 2005). This defect in SfNIC-C and -D can be compensated for by providing the genes in
trans to the virus-infected cell. In the laboratory, a plasmid can play this role. In natural
conditions, it is the multiple infection of the cell that accounts for the transmission of these
variants. The genotypes isolated also present differences on other biological traits, like the
speed and dynamics of killing, and OB production. Work is in progress to analyse each of
these characteristics.
Interactions between virus genotypes
Taking into account that no single genotype infection is as effective in killing larvae as the
complex wild-type population and that some genotypes were not able to survive alone, an
experiment was set up with the two most abundant genotypes, SfNIC-B and -C.
S. frugiperda larvae were fed with mixtures of OBs obtained from larvae injected with
SfNIC-B and SfNIC-C in various proportions. These larvae were reared until death or
pupation, and the genotype of the progeny OBs was analysed. Only SfNIC-B genotypes were
recovered. The pathogenicity of the mixture was evaluated for each of the various proportions
tested. The potency of each mixture relative to the potency of SfNIC-B alone reflected the
proportion of SfNIC-B OBs in the mixture (López-Ferber et al., 2003). These two results
confirmed that SfNIC-C OBs are not infectious per os. This result was not surprising as we
have previously demonstrated that pif-1 deficient viruses could not infect larvae even if
provided in mixtures with OBs that contained the PIF-1 protein (Kikhno et al., 2002).
To mimic the natural population, mixtures were set up with the same proportions of these
two genotypes, but using injection of occlusion body derived virions (ODVs) instead of
feeding. Analysis of the OBs obtained from virus-killed larvae revealed the presence of both
genotypes, at roughly the same proportions as injected (López-Ferber et al., 2003). These OBs
were used for bioassays in the same way as previously described. In this situation, when
different genotypes replicate in the same host insect, the potency of the virus mixture was
increased compared to that of SfNIC-B alone, reaching levels similar to that of the wild-type
virus population (Figure 1).
47
Wild type
3,5
3
Wild type
Potency (relative to SfNIC-B)
2,5
2
Mixed
Co-infected
1,5
1
0,5
0
100
90
75
50
25
10
0
% B genotypes
0
10
25
50
75
90
100
% C genotypes
Figure 1. Relative potency of SfNIC-B and -C genotype mixtures obtained by mixing OBs
(triangles) or by co-injecting ODVs of each genotype into insects and bioassaying the progeny
OBs (diamonds) (data from Lopez-Ferber at al., 2003).
100
90
90B:10C propn. of C
50B:50C propn. of B
50B:50C propn. of C
10B:90C propn. of B
10B:90C propn. of C
Relative proportions
90B:10C propn. of B
80
70
60
50
40
30
20
10
0
0
1
2
3
4
5
6
Passages
Figure 2. Changes in the frequencies of SfNIC-B and -C genotypes over five cycles of peroral
transmission. Data from Simón et al., 2006.
Evolution of the frequencies in artificial populations
To analyse the ability of the virus population to restore its original genotype frequencies after
a perturbation, three artificial virus populations were constructed by co-infecting larvae with
SfNIC-B and -C in a range of different ratios: 90:10, 50:50 and 10:90. The progeny OBs were
used to orally infect larvae over five cycles of infection. The frequencies of each genotype
were estimated in each generation by PCR, and the final potency of the three populations was
compared to that of the wild-type (natural) population.
In four passages, the three artificial populations reach an equilibrium that corresponded
to the original frequencies of each genotype in the original population (Figure 2). At the
equilibrium point, the potency of these artificial populations was no different from that of the
original wild-type population (Simón et al., 2006).
48
Conclusion
A Nicaraguan isolate of the Spodoptera frugiperda multiple nucleopolyhedrovirus was
analysed and appeared to consist of at least nine different genotypes. No single genotype was
as effective as the whole population in killing the host. As indicated by Frank (2003) “Pairs of
viral genomes work together to destroy their hosts more quickly. How this might occur
remains unknown, but study of the phenomenon should provide insight into how genetic
systems evolve.”
To date, we have only examined the interactions between pairs of genotypes and taking
into account only one biological character: pathogenicity. We can expect that each genotype
contributes alone, or in association with others, to the global function of the population.
We do not know if other baculovirus populations behave in a similar way, but analysis of
Phthorimaea operculella granulovirus isolates (X. Léry and M. López-Ferber, unpublished
work) seems to confirm the importance of within-population genetic diversity.
From the biocontrol viewpoint, preservation of genetic diversity becomes a major
concern in the development and use of baculovirus-based biopesticides. At least in some
cases, modification of genotype frequencies will impact on the ability of the virus to control
the host pest.
How should we preserve the appropriate levels of genetic diversity, both in number of
genotypes and in their relative proportions in mass-production and how best to describe the
active product from the registration point of view are two key points that need to be
addressed.
“Appropriate diversity” for a biological control agent used in an inundative strategy does
not necessarily imply the same diversity observed in the natural population from which it
originates: the objectives of the virus population, that aims to maximise its chances of
survival over time, and that of the farmers, that seek to protect their crops, are not inevitably
equivalent.
The REBECA project (see Ehlers, in this book), examines the different options for the
registration of genetically heterogeneous biological agents in the most appropriate way.
References
Brown, S.E., Maruniak, J.E. & Knudson, D.L. 1985: Baculovirus (MNPV) genomic variants:
characterization of Spodoptera exempta MNPV DNAs and comparison with other
Autographa californica MNPV DNAs. J. Gen. Virol. 66: 2431-2440.
Corsaro, B.G. & Fraser, M.J. 1987: Characterization of genotypic and phenotypic variation in
plaque-purified strains of HzSNPV Elkar isolate. Intervirology 28: 185-191.
Escribano, A., Williams, T., Goulson, D., Cave, R.D., Chapman, J.W. & Caballero, P. 1999:
Selection of a nucleopolyhedrovirus for control of Spodopera frugiperda (Lepidoptera:
Noctuidae): structural, genetic, and biological comparison of four isolates from the
Americas. J. Econ. Entomol. 92: 1079-1085.
Frank, S.A. 2003: Deadly partnerships. Nature 425: 251-252.
Gutiérrez, S., Mutuel, D., Grard, N., Cerutti, M. & López-Ferber, M. 2005: The deletion of
the pif gene improves the biosafety of the baculovirus-based technologies. J. Biotech.
116: 135-143.
Heldens, J.G., van Strien, E.A., Feldmann, A.M., Kulcsár, P., Munoz, D., Leisy, D.J.,
Zuidema, D., Goldbach, R.W. & Vlak, J.M. 1996: Spodoptera exigua multicapsid
nucleopolyhedrovirus deletion mutants generated in cell culture lack virulence in vivo. J.
Gen. Virol. 77: 3127-3134.
49
Kikhno, I., Gutiérrez, S., Croizier, L., Croizier, G. & López-Ferber, M. 2002: Characterization
of pif, a gene required for the per os infectivity of Spodoptera littoralis nucleopolyhedrovirus. J. Gen. Virol. 83: 3013-3022.
King, L.A. & Possee, R.D. 1992: The Baculovirus Expression System. A Laboratory Guide.
London: Chapman & Hall.
Lee, H.H. & Miller, L.K. 1978: Isolation of genotypic variants of Autographa californica
nuclear polyhedrosis virus. J. Virol. 27: 754-767.
López-Ferber, M., Simón, O., Williams, T. & Caballero, P. 2003: Defective or effective?
Mutualistic interactions between virus genotypes. Proc. R. Soc. B Biol. Sci. 270: 22492255.
Maruniak, J.E., Brown, S.E. & Knudson, D.L. 1984: Physical maps of SfMNPV baculovirus
DNA and its genomic variants. Virology 136: 221-229.
Muñoz, D., Castillejo, J.I. & Caballero, P. 1998: Naturally occurring deletion mutants are
parasitic genotypes in a wild-type nucleopolyhedrovirus population of Spodoptera
exigua. App. Environ. Microbiol. 64: 4372-4377.
Pijlman, G.P., Pruijssers, A.J. & Vlak, J.M. 2003: Identification of pif-2, a third conserved
baculovirus gene required for per os infection of insects. J. Gen. Virol. 84: 2041-2049.
Simón, O., Williams, T., López-Ferber, M. & Caballero, P. 2004: Genetic structure of a
Spodoptera frugiperda nucleopolyhedrovirus population: high prevalence of deletion
genotypes. Appl. Environ. Microbiol. 70: 5579-5588.
Simón, O., Williams, T., López-Ferber, M. & Caballero, P. 2005: Functional importance of
deletion mutant genotypes in an insect nucleopolyhedrovirus population. Appl. Environ.
Microbiol. 71: 4254-4262.
Simón, O., Williams, T., Caballero, P, & López-Ferber, M. 2006: Dynamics of deletion
genotypes in an experimental insect virus population. Proc. R. Soc. B Biol. Sci. 273: 783790.
pp. 50-53
Developing new baculovirus products or “How to walk a tightrope”
Philip Kessler 1, Massimo Benuzzi 2, and Fernando Mayoral 3
1
Andermatt Biocontrol AG, Stahlermatten 6, 6146 Grossdietwil, Switzerland; 2 IntrachemBio,
Italia, Via calcinaro 2085/7, 47023 Cesena, Italy; 3 Agrichem, Plaza Castilla 3; 14-A, 28046
Madrid, Spain
Abstract: Baculoviruses are insect pathogenic viruses. Their narrow host range and the lack of
toxicity and pathogenicity towards plants and vertebrates make them a suitable tool for the biological
control of insect pests. The world-wide use of the codling moth granulovirus demonstrated that
products based on baculoviruses can be successfully developed and commercialised. Based on this
experience, new products based on nucleopolyhedroviruses (NPV) have been recently developed
against important key pests such as Helicoverpa armigera, Spodoptera exigua and Spodoptera
littoralis. In a scientific trial on tomato in Italy, the efficiency rate for HearNPV against H. armigera
(HELICOVEX: 7.5 x 1012 NPV/L) reached almost 90% and was significantly higher than for B.t.
(E.r.: 77%) and for Indoxacarb (E.r.: 68%). In Spain, SpexNPV (SPEXIT: 3.8 x 1012 OB/L) has been
applied against S. exigua on sweet pepper. The application of SPEXIT in a 12 days interval resulted in
a reduction of the larval population of almost 88%. At an interval of 6 days, the reduction was even
95% and by far more effective than by the treatment with B.t. (75%). The application of SpliNPV
(LITTOVIR: 2 x 1012 OB/L) revealed a similar efficacy against Spodoptera littoralis as B.t. However,
the recent requirements for registration of biological control agents are hindering the commercialisation of new products based on baculoviruses. The costs for the registration dossiers and fees, as well
as the time (years) required for dossier evaluation by the registration authorities are unreasonable.
Therefore, to develop and to bring a new baculovirus product on the market was and still is a financial
risk and a tightrope walk.
Key words: baculoviruses, registrations, Helicoverpa armigera NPV, Spodoptera exigua NPV,
Spodoptera littoralis NPV
Introduction
Baculoviruses are arthropod-specific viruses that have been mainly isolated from species of
the family of Lepidoptera, and less frequently from Diptera, Hymenoptera or Coleoptera.
They are ubiquitous in the environment and are usually characterised to have a narrow host
range. No member of these viruses is infective to plants or vertebrates. No adverse effect on
human health has been observed in any toxicological investigations indicating that the use of
baculovirus is safe and does not cause any health hazards (OECD, 2002). The world-wide use
of the Cydia pomonella granulovirus (CpGV) against the codling moth (Cydia pomonella)
demonstrated that products based on baculoviruses can be successfully developed and
commercialised. Due to its excellent population control effect, CpGV is not only used by
organic producers, but also has found its way into conventional control strategies.
The Swiss company Andermatt Biocontrol AG recently developed new insecticides
based on the baculoviruses Helicoverpa armigera NPV (HELICOVEX®), Spodoptera exigua
NPV (SPEXIT®) and Spodoptera littoralis (LITTOVIR®). Results from the first field trials
using these products are presented.
50
51
Field trials with HELICOVEX
The cotton bollworm (Helicoverpa armigera) is a widespread pest in Asia, Africa, Australia
and the Mediterranean Region. The larvae of H. armigera are highly heterophagous and affect
a high number of crops. Due to the hot and dry summers of the last years, H. armigera has
been frequently observed to be a pest in Central Europe. HELICOVEX is a new biological
insecticide against this pest containing the baculovirus Helicoverpa armigera NPV
(HearNPV) as active ingredient (7.5 x 1012 NPV/L) .
HELICOVEX was tested in a small plot trial on tomato in Italy. The efficacy of
HELICOVEX was compared with the efficacy of a Bacillus thuringiensis (B.t.) product and a
chemical control agent (Indoxacarb) (Table 1). HELICOVEX and B.t. was applied three times
in a interval of eight and six days, whereas Indoxacarb was sprayed only at the first and third
application date. Three weeks after the first application, the damage has been assessed on the
tomato plants.
The first results revealed excellent efficacy of HELICOVEX. The efficiency rate for
HELICOVEX reached almost 90% and was significantly higher than for B.t. (77%) and for
Indoxacarb (68%) (Table 1). These excellent results on the damage reduction of
HELICOVEX are very promising. Furthermore viruses have a sustainable effect in the
population control of the pest, because in contrast to chemical products, viruses multiply in
their host and get released into the environment.
Table 1. Efficacy of treatments of different plant protection products on the reduction of fruit
damage caused by Helicoverpa armigera in tomato in Italy. (Data from Intrachem Bio, Italia).
Treatment
Active
ingredient
Untreated Control
Lepinox Plus B.t. kurstaki
Delfin
B.t. kurstaki
Helicovex
HearNPV
Steward
Indoxacarb
Rates
per ha
1000 g
1000 g
200 ml
125 ml
Nr of
treatments
3
3
3
2
Damaged fruits per
plant (%)
Efficacy
Mean
Std. Dev.
(Abbot %)
22.5
3.5
5.0
2.3
7.0
4.6
1.3
1.2
1.5
0.0
82.8
76.9
89.2
67.5
SPEXIT tested in Spain
SPEXIT is a new virus product containing Spodoptera exigua NPV (3.8 x 1012 NPV/L) as
active ingredient for the control of the larvae of the beet armyworm (Spodoptera exigua),
which occurs in the warmer regions of Europe, Africa and North America. Like H. armigera,
the larvae of S. exigua are extremely heterophagous, but they mainly feed on the leaves than
52
on the fruits. Outside Europe, S. exigua is responsible for many damages in cotton and
vegetables. Nowadays, it is an important pest in many vegetable cultures in Spain.
During summer 2006, SPEXIT has been tested on sweet pepper in a glasshouse trial in
Almería (Spain). SPEXIT has been applied in two different concentrations (10 ml and 20 ml
per 100 litre water) and in two different application intervals (6 and 12 days interval) and
compared to an application with B.t.kurstaki (75 g per 100 litre water).
The application with 10 ml SPEXIT in a 12 days interval resulted in a reduction of the larvae
population of almost 89%. At an interval of 6 days, the reduction was even 96% and by far
more effective than the treatment with B.t. (Table 2). SPEXIT is highly effective against S.
exigua and can also be combined with other plant protection agents. Apart from damage
control, SPEXIT has a high effectiveness on population control, which is a general advantage
in the use of baculoviruses. Therefore a combined application of SPEXIT and B.t. could effect
a broader range of pest insects, in which the population of Spodoptera exigua can be
controlled in a long term.
Table 2. Efficacy of treatments of different plant protection products on the reduction of the
number of larvae of Spodoptera exigua on sweet pepper in Spain. (Data from Agrichem, Spain).
Treatment
Active
ingredient
Untreated Control
Spexit
SpexNPV
Spexit
SpexNPV
Spexit
SpexNPV
Delfin
B.t. kurstaki
Rates
Nr of
per ha treatments
ml or g
per 100 L
10
20
10
75
1
1
2
2
Number of
larvae per plant
Efficacy
Mean
Std. Dev.
(Abbot %)
8.72
1.00
0.83
0.38
2.23
2.02
0.14
0.17
0.13
0.44
88.5
90.5
95.7
74.5
A big potential for LITTOVIR
The new product LITTOVIR contains the baculovirus Spodoptera littoralis NPV (2 x 1012
OB/L) for the control of the Egyptian cotton leafworm, Spodoptera littoralis, which is an
important pest in the Mediterranean Region, Africa and the Middle East. Like H. armigera,
huge masses of S. littoralis can invade Southern Europe from the South and can cause tremendous damages particularly in the second half of the season. The caterpillars are extremely
heterophagous and infest cotton, vegetables, corn, rice and many other crops.
LITTOVIR was tested in a small plot trial on lettuce in Italy and applied in two different
rates (100 ml and 200 ml per ha) and compared with two products containing B.t. kurstaki.
The efficacy of LITTOVIR assessed on the damaged leaves was comparable with the efficacy
of B.t. (56 to 61%). The product LITTOVIR and its application strategies will be improved to
provide a quicker control of Spodoptera littoralis in the future.
53
Registration of baculovirus products
According to the longstanding experience and studies on the use of baculoviruses in the plant
protection, the application of baculoviruses is highly effective, environmentally friendly and
safe. As the approval of baculoviruses as active ingredient in plant protection products is also
subjected to the EU Directive 91/414, the commercialisation of baculoviruses as plant
protection products is unreasonably long and expensive. A company has to invest several
millions Euros for the product development, dossier costs, and registration fees without
having the possibilities of return of investment during the long evaluation period of 4 to 8
years until inclusion in Annex 1 and national approvals in the member states. Due to the
restricted host range of baculoviruses, the markets for application of such products are usually
small. Furthermore the use of baculoviruses in plant protection is not protected by any patent.
For small and medium companies, usually involved in the development and commercialisation of baculoviruses as biological control agents, these premises are extremely difficult
and the registration hurdles are frustrating and hindering the commercialisation of new
baculovirus products. There is hope that recent efforts to adapt the Annex-1-inclusion of
baculoviruses according to its recognized efficacy and harmlessness will improve this
situation. Until then, to commercialise new baculovirus products remains a financial risk and
a tightrope walk. To go this way needs a lot of confidence, sense of balance, endurance and
optimism.
References
OECD, 2002: Consensus document on information used in the assessment of environmental
applications involving baculovirus. Series on Harmonization of Regulatory Oversight in
Biotechnology, No.20: 90 pp.
p. 54
Interactions between the ectoparasitoid Euplectrus plathypenae and
two nucleopolyhedroviruses in Spodoptera exigua and S. frugiperda
larvae
Emanouela Stoianova1,2, Juan Cisneros1, Delia Muñoz1, Trevor Williams3, and
Primitivo Caballero1
1
Spain; 2 Plant Protection Institute, BG – 2230, Kostinbrod, Bulgaria; 3 Instituto de Ecología
AC, Xalapa 91070, Veracruz, Mexico
Abstract: The present study explores the interactions between the ectoparasitoid Euplectrus
plathypenae (Howard) (Hymenoptera: Eulophidae) and two nucleopolyhedroviruses isolated from
Spodoptera exigua (Hübner) and Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae),
SeMNPV and SfMNPV, respectively. Larval parasitoid development was monitored in hosts infected
with their homologous viruses before, at the same time, and after parasitism had occurred. Parasitoid
progeny failed to complete development in host larvae of either species that had been infected prior to
parasitism. However, infection of both S. frugiperda larvae (L3 and L4) immediately after parasitism
and L4 S. exigua at 48 h post-parasitism, had no pronounced effects on the survival of parasitoid
progeny. Larval parasitoid survival was reduced in L3 S. exigua larvae inoculated at 48 h postparasitism, compared to control larvae that were only parasitized. Developmental times of E.
plathypenae larvae and pupae that survived in virus-infected S. exigua and S. frugiperda larvae did not
differ significantly from that of parasitoids in healthy hosts. Moreover, when healthy and virusinfected host larvae were exposed to E. plathypenae females, these exhibited a marked preference for
the healthy S. exigua and S. frugiperda larvae. These results suggest that SeMNPV and SfMNPV and
the parasitoid E. plathypenae are likely to be mutually compatible as control agents for S. frugiperda
and S. exigua in biorational pest control programmes.
Key words: Spodoptera frugiperda, S. exigua, nucleopolyhedrovirus, Euplectrus plathypenae,
parasitoid-pathogen-pest interactions.
54
pp. 55-58
Compatibility of Spodoptera frugiperda nucleopolyhedrovirus with
organic solvents used for microencapsulation
L. Villamiza1, M. López-Ferber2, F. Martínez3 & A. Cotes1
1
Biotechnology and Bioindustry Center, Colombian Corporation for Agricultural Research
(CORPOICA), Km 14 vía Mosquera, Bogotá; 2 Ecole Nationale Supérieure des Techniques
Industrielles et Des Mines d’Alès, 6, Avenue de Clavières, 30319 Alès cedex (France);
3
Universidad Nacional de Colombia, Ciudad Universitaria, Bogotá
Abstract: Lethal concentration and particle size of a Spodoptera frugiperda nucleopolyhedrovirus
(NPV) was characterized and its compatibility with organic solvents useful for developing microencapsulation formulation technology was assessed. Lethal concentrations were established by
bioassay and probit analysis. Viral CL50 and CL90 were 3.1x106 and 5.0x107 occlusion bodies (OBs)
ml-1, respectively. Mean particle size of OBs was 1.7 ± 0.4 µm, which is considered adequate for
formulation using microencapsulation. Virus OBs were exposed to 16 organic solvents (Benzene,
Chloroform, Xylene, Ethanol, Methanol, Dimetylsulfoxide, Toluene, Diethylic-ether, Heptane,
Propanol, Methylene chloride, Acetone, Butanol and Hexane). Virus exposed to solvents had no
negative effect on the biocontrol activity.
Introduction
Larvae of the armyworm Spodoptera frugiperda (J.E. Smith) cause important economical
losses in different agricultural crops. Expenditure of over US$ 4,2 millions per year in
chemical pesticides is spent on the control of S. frugiperda. The intensive use has resulted in
resistance development. Baculoviruses for insect biological control are an attractive control
option due to their high virulence and their low hazard to humans and the environment
(Tamez-Guerra et al., 2002). However, the insecticide activity is adversely influenced by UV
radiation (Martínez et al., 2003). Innovative formulation technology can help to overcome
these problems. This study generated basic information for development of a viral microencapsulation with organic solvents. Particle size and median lethal concentration were also
assessed.
Insect colony and virus
S. frugiperda larvae were maintained at 28°C under nonregulated photoperiod conditions.
Larvae were reared in individual cups on S. frugiperda artificial diet until pupation. Pupae
were placed in plastic cages (33cm x 33 cm x 15cm) with paper towels as oviposition
substrate. Adults were fed with honey solution and held at 28°C and 70% RH. Eggs were
collected and placed in cups until larvae emergence. The virus NPV-01 was isolated from
naturally sick S. frugiperda larvae collected in the field in Peru and purified as described
previously (Muñoz et al., 1998). The occlusion bodies (OBs) were suspended in distilled
water, counted by using a Neubauer chamber and stored at -10°C prior use. Part of the
purified virus was lyophilized at -70°C.
55
56
OBs particle size determination
OBs size was determined by direct observation with a light microscope (100x, Leica Galen
III). The arithmetic mean diameter was determined by averaging the individual values of 300
OBs.
Median Lethal Concentration
Bioassays were carried out with neonate larvae using the per-oral droplets technique (Huges
and Wood, 1981). Viral suspension were prepared by serial dilutions of purified virus and
concentrations were adjusted to 2x109, 2x108, 2x107, 2x106, 2x105 OBs ml-1. Twenty ml of
each suspension were place in an Eppendorf tube (2 ml) and mixed with 20 µl of a solution
containing blue food colorant (1%) and sacharose (10%). Droplets of 2 µm were placed on a
plastic dish forming a circle of 2 cm of diameter. Forty neonate larvae maintained during 6 h
without feeding were placed inside the droplets circle of each treatment. Thirty larvae known
to have ingested the viral suspension according to the blue colour visible through the cuticle
were placed individually in cups with artificial diet. Control treatments were without virus
ingestion. Cups were maintained at 28°C and 70% RH. All insects were evaluated daily and
dead larvae were counted. Percentage of mortality was recorded 7 days after larvae had been
exposed to treatments. Bioassays were repeated twice. Dosage response data were analyzed to
determine LC50 and LC90.
Compatibility with organic solvents
Samples of 0,01g of lyophilized purified virus were mixed with 20 µL of each solvent in
Eppendorf tubes (2 ml). Tubes were manually shaken during 30 min. and then centrifuged
(14,000 rpm, 30 min.) and the pellets washed two times with distilled water. Biocontrol
activity of virus exposed to solvents (Benzene, Chloroform, Xylene, Ethanol, Methanol,
Dimetylsulfoxide, Toluene, Diethilic-ether, Heptane, Propanol, Methilene chloride, Acetone,
Butanol and Hexane) was evaluated in a bioassay and compared with non exposed OBs.
Concentration was adjusted to 1x1010 OBs ml-1. Bioassay was carried out as previously
described. Mortality results were corrected with the control treatment by using the SchneiderOrelli equation (Zarr, 1999).
The OB diameter was in the range of 1 to 3 µm with a mean value of 1.7 ± 0.4 µm. This is in
agreement with Caballero et al. (2001), who reported a diameter in the range of 0.5 to 15 µm.
This particle size is adequate for developing a formulation by using microencapsulation
techniques, which may be used to generate microparticles between 50 to 200 µm charged with
several OBs inside the matrix. Particle size of the core that will be microencapsulated is a
very impotant parameter because it is one of the factors that determine microparticle size
(Ghosh, 2006).
Table 1. Concentration-mortality response and CL50 (OB/ml)
Replication
1
2
LC50
Slope
4.0 x 106 1.00 ± 0.134
6.4 x 106 1.26 ± 0.176
Heterogeneity
d.f.
χ2
2.42
3
2.55
3
95% fiducial limits
Lower
Upper
2.1 x 106
7.6 x 106
3.6 x 106
1.1 x 107
57
Dose-mortality results are presented in Table 1. The value of χ2 was not significant at the
95% probability level indicating no systematic heterogeneity of response in both time
replications of the bioassay. S. frugiperda mortality was affected by viral concentrations.
Mean lethal concentrations CL50 and CL90 were 5.2x106 and 7.1x107 OBs ml-1, respectively.
The lethal concentrations recorded are higher than reported by Barreto et al. (2005), who
determined the LC50 for 22 Brazilian isolates of S. frugiperda NPV between 2.9 x 102 and 6 x
105 OBs ml-1.
Figure 1. Occlusion bodies of Spodoptera frugiperda nucleopolyhedrovirus NPV-01 (100x).
Each small rule division corresponds to 1 µm.
Table 2. Insecticidal activity of exposed and nonexposed NPV to organic solvents
Treatment
Control (no virus)
Chloroform
Butanol
Methanol
Ethanol
n-Hexane
Acetone
Benceno
Methilene Chloride
Toluene
n-Propanol
Heptane
Xylene
Diethil ether
Dimetilsulfoxide
Isoamil alcohol
Ethilenglicol
Nonexposed virus
Mortality (%)
16,7
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
100,0
Slope
1,83
15,24
16,03
14,96
17,18
12,18
14,05
15,67
15,99
15,44
15,04
15,60
17,10
15,08
14,60
13,77
16,15
14,88
r
0,84
0,93
0,95
0,94
0,92
0,96
0,92
0,95
0,94
0,93
0,97
0,97
0,95
0,95
0,97
0,99
0,97
0,96
LT50
24,6
3,4
3,8
3,4
3,8
2,8
3,1
3,6
3,7
3,6
3,7
3,8
4,0
3,5
3,6
3,7
3,9
3,6
LT90
46,5
6,0
6,3
6,1
6,2
6,1
5,9
6,2
6,2
6,1
6,4
6,4
6,4
6,1
6,3
6,6
6,3
6,3
When compatibility of virus with organic solvents was evaluated, the mortality obtained
with the control treatment (no virus) was 16.7%, a value which is frequently obtained when
bioassays are carried out with neonate larvae. When virus OBs were exposed to different
organic solvents, biocontrol activity of the NPV-01 strain was not affected. Efficacy obtained
58
with exposed and nonexposed virus to organic solvents in droplet feeding assay was 100% in
all treatments after 7 days of larvae inoculation (Table 2).
Analysis of variance did not reveal differences (P > 0.05) between exposed and non
exposed virus, suggesting that NPV-01 occlusion bodies were resistant to 30 min. of exposure
to evaluated organic solvents. No morphological changes of OBs were observed using light
microscopy. Virus resistance to organic solvents could be attributed to a protective effect of
OBs, which naturally provide protection for the virions against adverse environmental
conditions. Polyhedron protein should have avoided the contact of virions with organic
solvents protecting them from the damage. If the organic solvents affected polyhedron protein
in some way, this effect did not reduced insecticidal activity. Behle et al. (2000) obtained
similar results when they exposed occluded and nonoccluded Anagrapha falcifera multiple
NPV (AfMNPV) to drying and simulated sunlight. Tamez-Guerra et al. (2002) developed
spray-dried formulations of AfMNPV by using n-Propanol as volatile solvent for drying and
none of the formulations lost significant insecticidal activity. Presented results may contribute
to develop a new commercially viable microencapsulation for NPV.
Acknowledgment
The authors thank Dr. Jean-Louis Zeddam for providing the NPV strain and for his generous
collabotarion and Biocontrole – Métodos de Controle de Pragas Ltda. for financial support.
References
Barreto, M., Guimarales, C., Teixeira, F., Paiva, E. & Valicente, F. 2005: Neotrop. Entomol.
34: 67-75.
Behle, R., McGuire, M. & Tamez, P. 2000: J. Inv. Path. 76: 120-126
Caballero, P., López-Ferber, M. & Williams, T. 2001: Los baculovirus y sus aplicaciones
como bioinsecticidas en el control biológico de plagas. Universidad Pública de Navarra.
Editorial Phytoma. España: 517 pp.
Ghosh, S. 2006: Functional Coatings. Wiley-VCH. Weinheim: 343 pp.
Hughes, P. & Wood, H. 1981: J. Inv. Path. 37: 154-159.
Martínez, A., Simón, O., Williams, T. & Caballero, P. 2003: Ent. Exp. Appl. 109: 139-146.
Muñoz, D., Castillejo, J. & Caballero, P. 1998: Appl. Env. Microbiol. 64: 4372-4377.
Tamez, P., Michael, R., McGuire, M., Behle, R., Shadha, B. & Pingel, R. 2002: J. Inv. Path.
79: 7-16.
Zar, J. 1999: Biostatistical analysis. Fourth Edition. Prentice Hall. New Jersey: 663 pp.
p. 59
Effect of parasitism on a nucleopolyhedrovirus amplified in
Spodoptera frugiperda larvae parasitized by Euplectrus plathypenae
Juan Cisneros1,2, Delia Muñoz1, Trevor Williams3 & Primitivo Caballero1
1
Spain; 2ECOSUR AP 36, Tapachula 30700, Chiapas, Mexico; 3Instituto de Ecología AC,
Xalapa 91070, Veracruz, Mexico
Abstract: In this study we evaluated the consequences of parasitism by the gregarious ectoparasitoid
Euplectrus plathypenae (Howard) on the occlusion body (OB) production, genetic composition, and
pathogenicity (LC50) of a multiple nucleopolyhedrovirus of Spodoptera frugiperda (SfMNPV). The
OB yields per larva and per gram of larval weight were 2 and 3 fold lower (P<0.05) in parasitized than
in non-parasitized larvae, respectively. However, no differences were observed in the larval weight at
death between virus-inoculated larvae (54 mg) or larvae dually parasitized and infected (44.8 mg). In
an experiment involving five serial passages of virus in parasitized and non-parasitized larvae,
restriction endonuclease analysis of viral DNA showed the characteristic wild-type virus profile in all
passages. Bioassays of OBs produced at the fifth passage in parasitized and non-parasitized second
instars did not exhibit significant differences in terms of LC50 (2.49 and 4.06 x 105 OBs/ml,
respectively). The results in this study indicate that the competition between SfMNPV and the
parasitoid E. plathypenae in S. frugiperda is detrimental to virus OB production but has no significant
influence on the biological activity or the genetic composition of the virus.
Key words: Spodoptera frugiperda, nucleopolyhedrovirus, Euplectrus plathypenae, restriction
endonuclease profile, lethal concentration.
59
p. 60
Influence of lepidopteran TCl4.7 transposon on Cydia pomonella
granulovirus gene transcription regulation
Wael. H. El Menofy1,2 and Johannes A. Jehle1
1
Laboratory of biotechnological crop protection, Agricultural Service Center, Neustadt
Wstr., Germany, [email protected]; 2 Agricultural Genetic Engineering Research
Institute (AGERI), Agricultural Research Center (ARC), Egypt
Abstract: A Tc1-like transposable element TCl4.7 found in Cydia pomonella Granulovirus (CpGV)
was previously isolated and characterized. TCl4.7 transposon horizontally escaped from the genome of
the lepidopteran Cryptophlebia leucotreta to the genome of CpGV in an in vivo cloning experiment
generating the mutant virus MCp5. The integration site of TCl4.7 was located in non protein coding
region of the CpGV genome in between two imperfect palindromes; which have been recently
characterized as origins of replication (oris) of CpGV (Hilton & Winstanley, JGV 2007, 88:14961504). Recent studies demonstrated that the transposon carrying CpGV-MCp5 had a significant
replication disadvantage compared to wt CpGV. In order to study the influence of TCl4.7 transposon
insertion on virus gene regulation, two open reading frames (Cp15 and Cp16) with unknown function
flanking the integration site of the transposon were studied. More over, the transcriptional regulation
of F-Protein (ORF 31) gene was analyzed.
Temporal transcriptional analyses using the complementary DNAs of Cp15, Cp16 and F-Protein
transcripts at 12, 24, 48, 72 and 96 hours post infection (p.i.) were performed using RT-PCR and
quantitative real time PCR. Western blot analyses of Cp15 and Cp16 protein expression at the same
time course were performed using a polyclonal antibody made against both proteins. Our results
revealed a general temporal delay of gene transcription of the mutant strain MCp5 compared to CpGV.
This might explain the replication disadvantage in the competition experiment.
Key words: Cydia pomonella granulovirus - baculoviruses- insect transposons- TCl4.7
60
p. 61
Molecular and biological characterization of new isolates of Cydia
pomonella granulovirus (CpGV) from the Iran
M. Rezapanah 1, S. Shojai-Estabragh2, J. Huber3, J. A. Jehle4
1
Biocontrol Dept., Plant Pests and Diseases Research Institute, Tehran, Iran; 2 National
Research Centre for Genetic Engineering & Biotechnology, Tehran, Iran; 3 Institute for
Biological Control, BBA, Darmstadt, Germany, 4 DLR Rheinpfalz, Neustadt/Wstr., Germany
Abstract: The Cydia pomonella granulovirus (CpGV) is a very effective biological control agent
against codling moth, C. pomonella L. (Lep.: Tortricidae). Only a few isolates originated from Mexico
(M). England (E) and Russia (R) have been described so far. It was hypothesised that the Caucasian
region as the evolutionary origin of apple and its main pest codling moth could also harbour a pool of
naturally occurring isolates of this virus. In a field survey, CpGV isolates were obtained from single or
pooled infected codling moth larvae collected at different locations in Iran. These CpGV isolates were
propagated in fourth instar larvae of codling moth. Biological variations among isolates were
evaluated by bioassay of neonate larvae. Restriction Endonuclease Analysis (EcoRI, XhoI, and PstI) of
purified DNA of the different isolates showed a considerable variation in their fragment length. Two
isolates were similar to CpGV-M but one of them showed at least a difference in the PstI profile. The
other isolates had significant differences in their EcoRI profiles. One isolate had the same 2.45 Kbp
deletion in its genome as the Russian isolate, but showed at least 6 important differences in PstI,
EcoRI and XhoI profiles. However, most if not all isolates could be attributed to genome types similar
to those found in CpGV-M, -E, and -R. Some of them were clear mixtures of different genotypes. In
conclusion, the molecular analysis of new geographic isolates of CpGV from the Irano-Caucasian
region revealed the presence of similar genotypes as previously found at different places in the world.
Thus, the presently known diversity of CpGV isolates can be mainly described as more or less
complex mixtures of genotypes constituting to these isolates. The presence or naturally occurring and
considerable different CpGV isolates in the northwest of the Irano-Causasian region emphasises the
necessity of further studies towards the diversity and evolution of CpGV.
61
p. 62
A solution against resistance of French codling moth to CpGV?
Marie Berling1, Miguel López-Ferber1, Antoine Bonhomme2, Benoît Sauphanor3
1
EMA, centre LGEI, 6 avenue de Clavières 30100 ALES, France; 2 NPP (ArystaLife Science),
avenue Léon Blum 64 000 Pau, France; 3 INRA, unité PSH, Agroparc, 84914 AVIGNON
Cedex 9, France
The Cydia pomonella Granulosis Virus (CpGV) has been used for fifteen years as a biological method
to control the codling moth (Cydia pomonella). In 2004 some insect populations less susceptible to the
virus were detected, first in organic orchards in Germany, later in France. A laboratory strain of
codling moth (RGV) was developed starting from resistant moths captured in the wild in France and
selected for resistance to a standard CpGV formulation. According to laboratory bioassays, the median
lethal concentrations (LC50) of these populations increased up to 1,000-fold in Germany and to more
than 10,000-fold in France (Eberle and Jehle, 2006; Sauphanor et al., 2006). Preliminary genetic
analyses suggested an autosomal transmission of the German type of resistance, while the French type
behaves as owning at least a sex-linked dominant gene. Apparently resistances may be locally
different.
In Europe, all commercial formulations of virus are derived from the same strain of CpGV, the
“A” type, originally found in Mexico (Tanada, 1964). Other viral isolates from various origins were
used to challenge both the susceptible and the resistant laboratory colonies of codling moth. All of
these isolates had similar efficiency on the susceptible population. The CpGV I12 isolate (type C) that
breaks the “German” resistance was also introduced in the comparison. On the French RGV strain, it
induced a LC50 1,000-fold lower than the standard “A” type strain. Nevertheless its efficiency was
lower than on the susceptible population, and still too low to be used in the field against resistant
populations. Among the other isolates tested, one, called NPP-R1, presented a higher activity against
the resistant larvae. Its LC50 on the R colony was only 10-fold higher than on the S strain. This isolate
appears thus as a better candidate to control resistance in France.
Key words: codling moth, CpGV, resistance, virus type.
References
Eberle, K. E. and Jehle, J. A. 2006: Field resistance of codling moth against Cydia pomonella
granulovirus (CpGV) is autosomal and incompletely dominant inherited. J. Invertebr.
Pathol. 93: 201-6.
Sauphanor, B., Berling, M., Toubon, J.-F., Reyes, M., Delnatte, J. and Allemoz, P. 2006:
Carpocapse des pommes: cas de résistance au virus de la granulose en vergers biologiques. Phytoma, la défense des végétaux 590: 24-27.
Tanada, Y. 1964: A granulosis virus of the codling moth, Carpocapsa pomonella (Linnaeus)
(Olethreutidae, Lepidoptera). J. Insect Pathol. 6: 378-380.
62
p. 63
Molecular and biological analysis of a new CpGV isolate (I12) that
breaks CpGV resistance in codling moth
K. E. Eberle1, S. M. Sayed1, M. Rezapanah1,2, J. A. Jehle1
1
DLR Rheinpfalz, Abteilung Phytomedizin, Biotechnologischer Pflanzenschutz,
67435 Neustadt, Deutschland; 2 Biological Control Research Department, Plant Pests and
Deseases Research Institute, PPDRI, 19395 Tehran, Iran
Abstract: The Cydia pomonella Granulovirus (CpGV) is one of the most highly pathogenic
baculoviruses and an effective control agent of the codling moth (Cydia pomonella), a worldwide pest
of apples, pears and walnuts. Three CpGV isolates were described in the past. The Mexican isolate
(CpGV-M) was found in Mexico, whereas CpGV-R was obtained from field collected larvae in Russia
and CpGV-E derived from a laboratory strain in England. Restriction analysis of CpGV isolates
originating from Georgia and the Iran indicated that the diversity of CpGV can be explained by three
main types of genomes, which we designate as types A, B and C. In CpGV-M, the A type is
predominant, whereas the B and C types are predominant in CpGV-E and CpGV-R, respectively. One
isolate (designated CpGV-I12) containing B type viruses, was shown to break the recently observed
field resistance of codling moth to CpGV. In order to find the molecular basis of its improved efficacy
against CpGV-resistant codling moths, CpGV-I12 was sequenced and compared to the genome of
CpGV-M1.
Key words: Cydia pomonella Granulovirus, CpGV, Baculoviridae.
63
pp. 64-66
Selection of a new virus isolate to control CpGV-resistant codling
moth populations
Züger, M., F. Bollhalder, P. Kessler, M. Andermatt
Andermatt Biocontrol AG, Stahlermatten 6, 6146 Grossdietwil, Switzerland
Abstract: The Cydia pomonella granulovirus (CpGV) is being successfully applied worldwide not
only in organic but also in IP orchards for the control of the codling moth (CM), Cydia pomonella.
Resistance of local CM populations towards CpGV has recently been reported to occur after intensive
spraying over numerous years. In order to overcome this resistance, a new mixture of genotypes has
been selected from the original gene-pool of the commercialised CpGV-genotypes on a resistant CM
population. For the first time it was possible to develop a new product by selection of a new mixture of
genotypes of CpGV, which is able to control resistant CM populations. Results from laboratory
bioassays and field trials are presented. The method of selecting new genotype mixtures of
baculoviruses provides a powerful tool of developing new active compositions of genotypes that can
overcome resistance in the future.
Key words: Cydia pomonella, CpGV, resistance
Introduction
The Cydia pomonella granulovirus (CpGV) is being successfully applied worldwide not only
in organic but also in IPM orchards for the control of the codling moth (CM), Cydia
pomonella. Resistance of local CM populations to CpGV has recently been reported to occur
after intensive sprayings over numerous years. In order to overcome this resistance, a new
mixture of genotypes has been selected from the original gene-pool of the commercialised
CpGV-genotypes (Mexican isolate) on a resistant CM population. For the first time, it was
possible to develop a new product by selection of a new mixture of genotypes of CpGV,
which is able to control resistant CM populations (commercialised as MADEX Plus).
The method of selecting new genotype mixtures of baculoviruses provides a powerful tool for
developing new active compositions of genotypes that can overcome resistance in the future.
Numerous bioassays were conducted to evaluate the efficacy of MADEX Plus on the sensitive
laboratory and the resistant CM strain. Newly hatched larvae (L1) were reared in multiwell
plates containing artificial diet mixed with a certain amount of the corresponding CpGV.
Results
MADEX Plus caused a comparable mortality like the conventional MADEX on the sensitive
laboratory strain (Fig.1). The dose-response relationship is comparable as well. Lethal doses
around 1x 103 CpGV/g diet were assessed for MADEX Plus.
64
65
Figure 1: Bioassay with MADEX and a newly selected MADEX Plus on CpGV-sensitive
codling moth larvae. Both virus products have a similar efficacy.
LD = lethal dose, RP = relative potency
Against the resistent CM strain MADEX Plus performs significantly better than MADEX.
The estimated relative potency of 1060 shows that resistance has successfully been overcome.
Figure 2: Bioassay with MADEX and a newly selected MADEX Plus on CpGV-sensitive
codling moth larvae.
LD = lethal dose, RP = relative potency
Field trials
In Germany field trials were carried out in 2006 comparing MADEX with MADEX Plus on
two organic farms with CpGV-resistant codling moth populations. (Kienzle et al. 2007). The
66
results of this field trials demonstrate that both, fruit damage and diapausing larvae, could
successfully be controlled using MADEX Plus (Fig. 3 and 4). In orchard 2 resistance of
codling moth to CpGV was not as strong as in orchard 1, therefore MADEX was also quite
effective to control fruit damage in this orchard.
Figure 3: Fruit infestation by resistant CM
after treatment with MADEX and MADEX
Plus.
Figure 4: Number of diapausing larvae in tree
belts after treatment with MADEX and
MADEX Plus.
Discussion
MADEX Plus has a much higher potential than the unselected CpGV to control resistant CM
as seen in bioassays and in the field. However, there are still many unanswered questions
concerning the mechanisms of the CM resistance against CpGV. Despite this lack of deeper
understanding of the processes involved, it might still be possible to overcome further
resistances through natural selection of the most appropriate mixture of genotypes from the
CpGV gene pool. For organic farmers this will be crucial in the future.
References
Kienzle, J., Zebitz, C.P.W., Zimmer, J. & Volk, F. 2007: Erste Freilanduntersuchungen zur
Wirkung von MADEX plus gegen CpGV-resistente Apfelwicklerpopulationen in ÖkoBetrieben [First Field Tests with MADEX plus against CpGV-resistant Codling Moth
Populations in Organic Orchards]. Contribution to the Conference "Zwischen Tradition
und Globalisierung" - 9. Wissenschaftstagung Ökologischer Landbau, Universität
Hohenheim, Stuttgart, Deutschland, 20.-23.03.2007.
p. 67
Resistance of Codling Moth (Cydia pomonella) to granulosis virus
(CpGV) in southeast France: First observations on the mode of
inheritance
Marie Berling1, Miguel López-Ferber1, Antoine Bonhomme2 & Benoît Sauphanor3
1
EMA, centre LGEI, 6 avenue de Clavières 30100 ALES, France; 2 NPP (ArystaLife Science),
avenue Léon Blum 64 000 Pau; 3 INRA, unité PSH, Agroparc, 84914 AVIGNON Cedex 9,
France
Abstract: A resistant population of codling moth (Cydia pomonella) was collected in autumn 2004
from an organic orchard in southern France where biological control with the Cydia pomonella
granulovirus (CpGV) had failed. Susceptibility to CpGV of this population was determined in
laboratory through biological tests with neonate larvae. The median lethal concentration (LC50) of the
virus on insects coming from the field resistant population was 13,000-fold higher than on the
susceptible reference strain (Sauphanor, 2006). To characterize the inheritance of resistance, a
selection for CpGV resistance followed by crossing experiments with the susceptible strain were
carried out. The resistance of the resulting strain (namely RGV) appeared to be either monogenic or
controlled by a single major gene. In addition, the resistance phenotype is sex-depending.
Heterozygous males transmit resistance in equal frequency to males and females in the offspring,
while heterozygous females R could not transmit their resistance to their female offspring. In
Lepidoptera, the chromosome mechanism of sex determination is different from mammals: the female
is the heterogametic sex, with most species having a WZ sex chromosome pair, whereas the males are
ZZ. The results showed that the major resistant gene of RGV was probably carried by the sexual
chromosome Z.
Key words: codling moth, CpGV, resistance, inheritance.
References
Sauphanor, B., Berling, M., Toubon, J.-F., Reyes, M., Delnatte, J. & Allemoz, P. 2006:
Carpocapse des pommes: cas de résistance au virus de la granulose en vergers
biologiques. Phytoma - La défense des végétaux 590: 24-27.
67
pp. 68-71
The use of CpGV and mating disruption against Cydia pomonella (L.)
in the organic apple production
Vladan Falta1, Jitka Stará2, František Kocourek2
1 Research & Breeding Institute of Pomology in Holovousy Ltd., 508 01 Horice,
Czech Republic; 2 Research Institute of Crop Production, Krnovská 507, Praha 16106,
Czech Republic
Abstract: Cydia pomonella granulovirus (CpGV) products (Madex, Carpovirusine) and the mating
disruption method (Isomate C Plus) were tested against codling moth (Cydia pomonella L.) in field trials
in organic apple orchards. The biological efficacy of Madex and Carpovirusine was 89.1% and 90.6%,
respectively. The effect of mating disruption was 91.4% and the combination of the both methods
(CpGV+mating disruption) was 92.5%. Mating disruption appears to be a perspective complementary
method to CpGV in the antiresistant strategy in codling moth control in organic farming.
Key words: codling moth, CpGV, mating disruption
Introduction
The control of codling moth (Cydia pomonella L.) is facing serious problems with the
selection of pest populations resistant to chemical insecticides (Stará et al. 2006, Kocourek &
Stará 2006, Berrada et al. 2005, Jaworska & Olszak 2005). Codling moth control includes 4 to
5 insecticide treatments under mild climatic conditions and many more in warmer regions.
Despite a visible improvement in IPM technologies after the registration of Isomate C Plus
and Isomate CLR in 2006, no biological preparation is available to manage higher infestation
pressure. A promising solution appears to be Cydia pomonella granolovirus (CpGV) frequently applied in organic and IPM systems in Western European countries. Three commercial
products are available on the European market: Madex (Andermatt Biocontrol, Switzerland
1988), Granupom (Hoechst, Germany, 1991) and Carpovirusine (Calliope, France, 1993).
After approximately 10 years (in 2003) the total area of CpGV treated orchards in Europe has
reached approximately 80,000ha (Lacey & Thomson, 2004). Several investigations in the
Czech Republic during the last 10 years indicte that CpGV provide comparable control results
like chemical insecticides ((Pultar et al. 1998, Stará & Kocourek 1998 & 2002 & 2003,
Kocourek et al. 2005, Kundu et al. 2006). This study investigated the efficacy of combination
of Madex 3 or Carpovirusine 2000 together with mating disruption (“Isomate C Plus”).
Location
The trials were established in the organic orchard following rules of the organic growing
system (weed management, disease control, fertilisation etc.) in East Bohemia (altitude 300
m, average temperatures 8°C to 9°C, precipitation 250mm to 300mm). The trial area consited
of square shaped plot of 5 ha and was surrounded by fields (S, E) and by smaller meadows
and groups of trees and shrubs (W, N). The major apple variety was the scab-resistant
“Topaz” planted at 1735 trees ha-1. Trees were 8 years.
68
69
CpGV and pheromone products
1) Madex 3 with 3x1013 granules l-1 (Andermatt Biocontrol AG, CH), 2) Carpovirusine 2000
with 6,7x1012 CpGV granules l-1 (NPP, F); 3) Isomate C Plus: (E,E)-8, 10-Dodecadien-1-ol
(53%), 1-Dodecanol (29.7%), 1-Tetradecanol (6%) (Shin-Etsu Chemical Co. Ltd., Japan).
Trial design
The experimental orchard was divided into 5 plots with variants as follows: 1) Isomate C
Plus, 2) Madex 3 + Isomate C Plus, 3) Carpovirusine 2000, 4) Madex 3, 5) Control. Inside the
plot treated with Isomate C Plus the CM trap with 10mg codlemone dispenser was placed to
monitor pest flight. In the orchard situated ca. 8 km from the experimental plot 3 pheromone
traps were placed to determine the optimum application dates. Isomate C Plus dispensers were
installed before a pest flight in spring (May 5, 2006) at a density of 1000 per ha. Both CpGV
products were applied at the beginning of larval hatching (1st CM generation: 2 treatments June 6, 2006 and July 3, 2006, 2nd CM generation: no treatment). The dose of Madex 3 and
Carpovirusine 2000 was 100 ml and 1,000 ml per ha, respectively.
Evaluations and data processing
1) Fruit damage was recorded during the harvest (August 21, 2006) assessing 100 per
replicate, i.e. 400 per variant. 2) During June/July paper belts were installed on tree trunks to
evaluate number of diapausing CM caterpillars. The number of paper belts was 4x15 per
variant. Evaluation was on October 3, 2006. 3) The CM caterpillars collected were analysed
by PCR using specific CpGV primers to detect low level infections (results not available yet).
Differences between variants observed in evaluations 1 and 2 were tested by ANOVA
(Tukey’s test). On the base of fruit damage and number of caterpillars present in belts the
efficacy was calculated as follows:
{
100( FDc − FDt ) 100(Cc − Ct )
}/2
+
FDc
Cc
where FDc=fruit damage in control, FDt=fruit damage in treated variant, Cc-number of
caterpillars in paper belts in control, Ct=caterpillars in treated variant.
Fruit damage and CM caterpillars in paper belts
In treated plots fruit damage evaluated during harvest varied between from 0.5% to 1.0%
with no significant difference (Fig. 1, left). Control plots had 8% damage with a significant
difference to all treatments. Similar results were obtained when caterpillars in paper belts
were evaluated (Fig. 1, right). The efficacy ranged from 89.1% (Madex 3) to 92.5% (Madex 3
+ Isomate C Plus). The effect of both CpGV products corresponded to results reported in the
literature. However, codling moth control could have been higher in variants 2-4 should a
third treatment against the 2nd pest generation have been applied. After very cold weather in
early August some egg lying occurred in the late the summer and some fruit damages
appeared during harvest.
Considering that the infestation in the control plots was high (8%) the results obtained
with “Isomate C Plus” are excellent (91.4%). On the other hand it must be mentioned that the
part of the orchard with mating distruption was on the opposite side of the major infestation
sources (village gardens). The effect of the mating disruption and the combination of mating
disruption and CpGV (92.5%) suggests that this method can be one possibilities for CM
control in CpGV resistance management strategies in organic orchards.
70
CM caterpillars in fruits, August 21, 2006
b
8
7
6
5
4
3
2
1
a
a
a
a
VAR1
VAR2
VAR3
VAR4
CM caterpillars in paper belts, October 3, 2006
b
6.00
Number of caterpillars per 1tree
percentage of attacked fruits (%)
9
0
5.00
4.00
3.00
2.00
1.00
a
a
a
a
VAR2
VAR3
VAR4
0.00
VAR5
VAR1
VAR5
Figure 1. Percentage of CM damaged fruits on August 21, 2006 (left) and number of CM
caterpillars in paper belts on October 3, 2006 (right). Same letters above columns indicate that
differences beween variants were not significant (Tukey Test, p<0.01).
Biological efficacy of treatments
biological efficacy (%)
93.0
92.0
92.5
91.4
90.6
91.0
90.0
89.1
89.0
88.0
87.0
VAR1
VAR2
VAR3
VAR4
Figure 3. Corrected control efficacy of Isomate C Plus (VAR 1), Isomate C Plus & Madex 3
(VAR 2), Carpovirusine 2000® (VAR 3) and Madex 3 (VAR 4) in trials conducted in 2006.
Acknowledgements
The trials were carried out in a framework project No. 1G58081 financed by the Ministry of
Agriculture of the Czech Republic
References
Berrada, S., D. Fournier, A. Cuany, T. & X. Nguyen 2005: Identification of resistance
mechanisms in a selected laboratory strain of Cacopsylla pyri (Homoptera: Psyllidae) Altered acetylcholinesterase and detoxifying oxidases. Pesticide Biochem. & Physiol. 48:
41-47.
Jaworska, K. & Olszak, R.W. 2005: Rise in number of pear sucker (Cacopsylla pyri L.) as
side effect of the use of some pesticides. In: Pest and Weed Control in Sustainable Fruit
Production, Proc. from a workshop held in Skierniewice, Poland, September 1-3, 2005.
71
Kocourek, F.; Pultar, O.; Kundu, J.K. & Stará, J. 2005: Detection of Cydia pomonella
granulovirus (CpGV) in larvae of codling moth (Cydia pomonella L., Lep.: Tortricidae)
after application of virus in field trials. In: Book of abstracts from the 10th European
Meeting „Invertebrate Pathogens in Biological Control: Present and Future, June 10-15,
2005, Locorotondo, Bari, Italy, p. 88.
Kocourek, F. & Stará, J. 2006: Management and control of insecticide-resistant pear psylla
(Cacopsylla pyri). In: Book of Proceedings of the International Workshop "Pest and
Weed Control in Sustainable Fruit Production", 1-3 September 2005, Skierniewice,
Poland, (Journal of Fruit and Ornamental Plant Research 14 (Suppl. 3): 167-174).
Kumar Kundu, J., Stará, J., Bohdanecká, D. & Kocourek, F. 2006: Ascertaining the efficiency
of granulovirus based bio-pesticides in Cydia pomonella and Adoxophyes orana control,
using PCR based techniques. In: Book of Abstracts of the 9th International Colloquium
on Invertebrate Pathology and Microbial Control, SIP and ICB, 27th August – 1st
September.
Lacey, L.A. & Thomson, D.R. 2004: Codling moth granulovirus: its history and mode of
action. Western Orchard Pest and Disease Management Conference. p. 18.
Pultar, O., Hrdý, I., Kuldová, J., Kocourek, F., Beránková, J. & Stará, J. 1998: Cydia pomonella granulosis virus disseminated by means of pheromone stations: a potential tool of
the codling moth management. In: Proceedings of the VIth European Congress of
Entomology, České Budějovice, Czech Republic, August 23-29, 1998, pp. 638-639.
Stará, J. & Kocourek, F. 1998: Codling moth control: improved timing of treatments by
CpGV based on monitoring of flight activity of the moth and on increased persistance of
virus. In: Proceedings of the VIth European Congress of Entomology, České Budějovice,
Czech Republic, August 23-29, 1998, pp. 637.
Stará, J., Kumar Kundu, J., Kocourek, F. & Pultar, O. 2002: The methods of the evaluation of
CPGV efficiency in biological control of codling moth. In: Book of abstracts from 7th
European Congress of Entomology, October 7-13 2002, Thessaloniki, Greece, p. 126.
Stará, J. & Kocourek, F. 2003: Evaluation of efficacy of Cydia pomonella granulovirus
(CpGV) to control the codling moth (Cydia pomonella L., Lep.: Tortricidae) in field
trials. Plant Protect. Sci. 39:117-125.
Stará, J., Nadova, K. & Kocourek, F., 2006: Insecticide resistance in the codling moth (Cydia
pomonella). J. Fruit and Ornamental Plant Research.14: 99-106.
Sarasua, M.J. 2005: Resistance of Cydia pomonella (L.) (Lepidoptera: Tortricidae) and
Cacopsylla pyri (L.) (Homoptera: Psyllidae) to insecticides. Valencia, 16th and 17th
November 2005.
pp. 72-75
Evaluation of persistence of Adoxophyes orana granulovirus and
Cydia pomonella granulovirus in populations of their hosts by
molecular methods
Jiban Kumar Kundu, Jitka Stará, Tezera Zichová & František Kocourek
Crop Research Institute, Drnovská 507, 161 06 Prague 6, Czech Republic
Abstract: The biological efficacy of the Adoxophyes orana granulovirus (AdorGV) of the product
Capex 2 (Andermatt Biocontrol, Switzerland) and formulated Cydia pomonella granulovirus (CpGV)
(provided by ZD Chelčice, CR) were evaluated for control of A. orana and C. pomonella, respectively.
Larval mortality and fruit damage were evaluated in the year of virus treatment and in the following
years. The reduction of population density of A. orana ranged from 40 to 80% after the direct
treatment with Capex 2. The CpGV treatment was more effictive in reducing the C. pomonella
population density than in reducing fruit injury. The fruit injury caused by C. pomonella ranged from
1.6 to 28.5% and number of larvae per tree ranged from 1.8 to 17.1. Polymerase chain reaction (PCR)
based techniques were developed for the detection of AdorGV and CpGV in survived larvae collected
in virus treated plots. Primers were based on the granulin gene sequence. Results indicate a strong
persistence of AdorGV in surviving larvae after direct treatment causing high mortality of larvae in the
next generations. The population density was reduced below the damage threshold within two years
after the AdorGV virus treatment. CpGV treatment caused high mortality of C. pomonella larvae in
the year of virus treatment. CpGV was found in as many as 15% of the surviving larvae 1 year after
treatment in one location. The virus was not detected in CpGV-treated orchards 2 years after
treatment. In contrast to persistence of AdorGV in A. orana population, poor persistence of CpGV in
surviving C. pomonella individual was recorded probably resulting in a slow spread in natural host
populations.
Key words: Cydia pomonella, Adoxophyes orana, AdorGV, CpGV, field persistence
Introduction
Cydia pomonella granulovirus (CpGV) and Adoxophyes orana granulovirus (AdorGV) are
frequently used in the biological control of Cydia pomonella and Adoxophyes orana,
respectively (Huber 1986, Charmillot 1992, Moscardi 1999). AdorGV is a “slow” granulovirus, i.e. the host dies in the final instar regardless of when it was infected (Flückiger 1982).
This paper reports on the development of a PCR assay for the detection and specific
identification of CpGV and AdorGV in C. pomonella and A. orana larvae, respectively and
results of monitoring virus infection in surviving individuals in natural populations after
application in the field trial.
Field trials
The field trials with CpGV were carried out in an experimental apple orchard in PragueRuzyně and a commercial apple orchard in Velké Bílovice. The experimental plots were
treated with CpGV in formulated CpGV preparation (ZD Chelčice, CR) from 1997 to 2000 in
Velké Bílovice and from 1998 to 2000 in Ruzyně. CpGV was sprayed 3-times against the first
72
73
generation and 2-times against the second generation of C. pomonella. The rates of CpGV
varied from 0.26 x 1013 GIB/ha to 1013 GIB/ha. C. pomonella larvae were collected from the
orchards in the year of application and in the following two years. Larvae from untreated
orchards, Bulhary (20 km from Velké Bílovice) and Horoměřice (15 km from Ruzyně) were
collected in 2001 and 2002 from paper belt traps randomly distributed in the experimental
plot, except from Velké Bílovice in 2000, where 2nd generation larvae were collected from
damaged fruit. Twenty larvae from fruit and from the belt traps were collected from each
experimental plot. From each belt, a single larva was used for virus detection. The larvae were
stored at -20°C until used for PCR-based detection.
Field trials with AdorGV were carried out in four localities, Libčany, Svinišťany, Slaný
and Těchlovice in 2003-2005. AdorGV (Capex 2 from Andermatt, CH, 100 ml/ha containing
5x1010granules/ml) was sprayed 2-times against the overwintering larvae (pre-bloom) and 1or 2-times against the first generation larvae (post-bloom) and disseminated by special
pheromone stations (Svinišťany, Libčany). L3-L4 of A. orana for virus PCR detection were
collected in four localities were Capex 2 was applied (Libčany, Svinišťany, Slaný,
Těchlovice) and in one locality without AdorGV treatment (Holovousy). In Svinišťany and
Libčany, larvae were collected in the first and second year of AdorGV treatment, in
Těchlovice in the second year after AdorGV treatment and in Slaný in the year of AdorGV
treatment and in the following year post treatment. Larvae of A. orana of the overwintering
and first generation were collected 10–14 days after Capex 2 treatment. In Libčany and
Svinišťany, larvae of the second generation of A. orana were collected, against which no
treatment was carried out.
Virus detection
Genomic DNA of individual larvae of A. orana and C. pomonella were isolated using DNeasy
Tissue kit (Qiagen) according to the manufactures instructions. DNA of individual larvae of
A. orana and C. pomonella was amplified using the primer pair AdorG-F/AdorG-R for
targeting 620 bp fragment of granulin gene of AdorGV and using primer pair CpG-F/CpG-R
for targeting 607 bp fragment of granulin gene of CpGV (Luque et al., 2001; Wormleaton et
al., 2003). A proofreading Taq polymerase was used (TaKaRa, Japan) for amplification in a
thermocycler (MJ Resaerch) as follows: one step at 94°C for 2 min (initial denaturation), 30
cycles of 3 steps: 94°C for 20 s (denaturation), 55°C for 30 s (annealing), and 72°C for 1 min
(polymerization) and a final step at 72°C for 10 min (elongation). PCR amplicons were
purified by Qiaquick gel extraction kit and sequenced directly using reverse and forwards
primers (for AdorGV: AdorG-F/AdorG-R and for CpGV:CpG-F/CpG-R).
The reduction of the population density of A. orana ranged from 40 % to 80 % after the direct
treatment with Capex 2. The high level of AdorGV persistence was recorded in surviving
larvae after direct treatment by AdorGV causing high mortality of larvae even in next
generations. Within the two subsequent years, the population density of A. orana was
considerably reduced in all tested apple orchards. After the second or third year of AdorGV
treatment, the population density of A. orana was reduced nearly to zero (Figure 1). In the
first year of AdorGV treatment, the portion of the overwintering larvae positive for AdorGV
was 15% in Slaný, ranged from 55% to 64% in Svinišťany and reached up to 80% in Libčany.
The presence of AdorGV in the 1st summer generation larvae was 20% in Slaný and ranged
from 52% to 80% in Svinišťany and in the 2nd generation ranged from 22% to 55% and from
70% to 80% in Svinišťany and Libčany, respectively. In the second and third year of
74
treatment, AdorGV was found in 50-60% of A. orana larvae (Svinišťany, Libčany). In the
year following the treatment, AdorGV was found in 12% (Těchlovice) and in 10-25% (Slaný)
of A. orana larvae. In the orchard without AdorGV treatment (Holovousy), AdorGV was
detected in 0% and 15% of individuals in 2004 and 2005, respectively.
70%
overwintering caterpillars
1st generation
2nd generation
shoot damage
60%
50%
40%
30%
20%
10%
0%
no treatment
years and plots
1st year CAPEX
2nd year CAPEX
3rd year CAPEX
Figure 1. Average shoot damage from all plots and years in dependence on number of years of
CAPEX 2 treatment.
The fruit injury at harvest in CpGV-treated plots ranged from 1.6 % to 28.5 % and the
number of larvae/tree ranged from 1.8-17.1. In contrast, the persistence of CpGV among the
C. pomonella individuals surviving CpGV treatment was low (15%) in CpGV-treated
orchards in the first year after treatment and was not detected in subsequent years after virus
treatment (Kundu et al. 2003).
PCR with specific primers were used for the detection of AdorGV and CpGV 620bp and
607bp fragments, respectively (Figure 2). PCR products produced with virus products as
template or from the corresponding viruses detected in survival C. pomonella or A. orana
larvae were identifcal in size.
Figure 2. AdorGV and CpGV detection with specific primers, which amplify 620 bp and 607
bp oligonucleotides of the granulin genes of the viruses, respectively. Lane M: 100 bp size
marker, lane 1: AdorGV, lane 2-4 AdorGV detected in A. orana larvae from virus treated
orchards, lane 5: A. orana larvae from non-treated, lanes 5 & 6: CpGV, lanes 8&9: CpGV
detected in C. pomonella larvae from virus treated and lane 10: C. pomonella larvae from
non-treated orchard
75
Laboratory assays have shown that despite good activity against young larvae, the
development of the disease is slow and mortality generally occurs in the final instar (Oho,
1975, Flückiger 1982). A. orana granulovirus can persist in orchards between generations in
shady locations where it can multiply in contaminated larvae (Charmillot 1992). Until present,
there were no data available on the persistence of AdorGV in A. orana larvae after AdorGV
field treatments. Using highly sensitive PCR based detection tools, we found that AdorGV
persists in A. orana larvae after virus treatment as well as in the next generations. In contrast,
persistence of CpGV in C. pomonella is low. In practice the reduction of high populations
with Capex 2 gave variable results with sometimes unacceptable efficacy (Höhn et al., 1998).
However, the application of Capex 2 has a long term effect on the population of A. orana
(Sato et al., 1986). In our experiments, the population density of A. orana was reduced by
AdorGV below the damage threshold within two years after the virus treatment (Figure 1).
Acknowledgements
This work was supported by the Ministry of Agriculture CR, project no. MZE 0002700603.
References
Charmillot, P.J. 1992: Progress and prospects for selective means of controlling tortricid pests
of orchards. Acta Phytopathologica et Entomologica Hungarica 27: 165-176.
Flückiger, C.R. 1982: Untersuchungen über drei Baculovirus-Isolate des Schalenwicklers,
Adoxophyes orana F.v. R. (Lep., Tortricidae), dessen Phänologie und erste Feldversuche,
als Grundlagen zur mikrobiologischen Bekämpfung dieses Obstschädlings. Mitt.
Schweiz. Ent. Ges. 55: 241-288.
Höhn, H., Höpli, H. & Graf, B. 1998: Einsatz von Granuloseviren in der Schweiz. In: Biologische Pflanzenschutzverfahren im Erwerbsobstbau. Eds.: Kienzle, J. & Zebitz, C.P.W.,
Fachtagung 9.-10. März 1998, Universität Hohenheim.
Huber, J. 1986: Use of baculovirus in pest management programmes. In: The Biology of
Baculoviruses, Vol. 2, Practical Application for Insect Control, eds. Granados, R. R. &
Federci, B. A. CRC Press, Boca Raton.
Kundu, J.K., Stará, J., Kocourek, F. & Pultar, O. 2003: Polymerase chain reaction assay for
Cydia pomonella granulovirus detection in Cydia pomonella population. Acta Virologica
47: 153-157.
Luque, T., Finch, R., Crook, N. O’Reilly, R.D. & Winstanley, D. 2001: The complete
sequence of the Cydia pomonella granulovirus genome. J. Gen. Virol. 82: 2531-2547.
Moscardi, F. 1999: Assessment of the application of baculoviruses for control of Lepidoptera.
Annual Review of Entomology 44: 257-289.
Oho, N. 1975: Possible utilization of a granulosis virus for control of Adoxophyes orana
Fischer von Röslerstamm (Lepidoptera: Tortricidae) in apple orchards, JIBP Synthesis 7:
61-68.
Sato, T., Oho, N. & Kodomari, S. 1986: Utilization of granulosis viruses for controlling
leafrollers in tea fields. JARQ Japan Agricultural Research Quarterly 19: 271-275.
Wormleaton, S., Kuzio, J. & Winstanley, D. 2003: The complete sequence of the Adoxophyes
orana granulovirus genome. Virology 311: 350-365.
p. 76
Control of lepidopteran pests in orchards by baculoviruses and
mating disruption
J. Stará1, F. Kocourek1, V. Falta2
1
Research Institute of Crop Production, Prague, Czech Republic; 2 Research and Breeding
Institute of Pomology, Holovousy, Czech Republic
Abstract: Cydia pomonella granulovirus (Madex 3) and Adoxophyes orana granulovirus (Capex 2)
were tested against Cydia pomonella and Adoxophyes orana, respectively, in field experiments. The
efficacy of mating disruption against C. pomonella (Isomate C plus) and A. orana (Isomate CLR) was
compared with the efficacy of baculoviruses. The efficacy of combination of mating disruption with
baculoviruses was also evaluated. The field experiments were carried out in three localities in the
Czech Republic in 2004-2006. The highest efficacy was obtained when Isomate C plus was applied in
combination with Madex 3. Similarly, the efficacy of combination of Capex 2 with Isomate CLR was
sufficient for the reduction of population density of pests and reduction of fruit injury. After the
application of Madex 3, the number of C. pomonella larvae per tree and deep entries in fruits was
considerably reduced when compared to application of mating disruption or insecticides. The efficacy
of Isomate C plus and Isomate CLR was comparable to efficacy of selective insecticides. However,
additional treatment by baculoviruses or selective insecticides is necessary when Isomate C plus is
applied in the first year in localities with high population density of C. pomonella.
Acknowledgements
The work was funded by the Ministry of Agriculture of the CR project no. 0002700603 and 1G58081.
76
pp. 77-82
Development of a granulovirus based insecticide to control the potato
tuber moths, Tecia solanivora and Phthorimaea operculella
Laura Villamizar, Carlos Espinel, Erika Grijalba, Paola Cuartas,
Aristóbulo López-Ávila, Alba Marina Cotes
Center of biotechnology and bioindustries. Colombian Corporation for Agricultural Research
CORPOICA. Km. 14 vía Mosquera, Bogotá- Colombia
Abstract: Three native granulovirus isolates, were evaluated over Tecia solanivora and Phthorimaea
operculella in this study. Variables such as cephalic capsule width, viral infection signs and mortality
were tested. Yields of viral particle production were determined for all native isolates. The highest
yields were obtained with P. operculella larvae which showed significant differences when compared
with the results obtained with T. solanivora. Larval stages time was increased when larvae of T.
solanivora and P. operculella were infected with all virus isolates presenting an overlapping of instars.
Characteristic signs as white coloration were observed. All evaluated granulovirus produced a higher
percentage of efficacy over P. operculella larvae than over T. solanivora larvae. The selected virus
isolates were produced by infecting T. solanivora larvae and two biopesticide formulations were
developed; a powder to pelletize tuber seeds and a granular formulation for field applications. The
powder formulation which is already registered in Colombia was evaluated under storage conditions
obtaining 97.7% protection.
Key words: potato moths, granulovirus, formulations, biopesticide.
Introduction
The potato tuber moths Tecia solanivora (Povolny) and Phthorimaea operculella (Zeller)
(Lepidoptera: Gelechiidae) are important economic pests of potato crops in Central and some
South American countries (Inoue et al.1994; Torres et al.1997; Pollet, 2001; Pollet et al.
2001). Chemical pesticides application is the main strategy to control these insects; however
most of the products lost effectivity and have adverse effects on the beneficial organisms and
the environmental and produce residues in the food (Benavides, 2000).
Baculoviridae are arthropod-specific pathogens that infect several lepidopteran species
and are the most studied insect virus group. However, rapid loss of insecticidal activity from
environmental conditions such as sunlight and rainfall can cause problems. The dynamics of a
disease in insect populations is influenced by host, pathogen and environment properties,
which determine the changes in host and pathogen numbers over time (Caballero et al. 2001).
Insect and virus
P. opercullella and T. solanivora larvae were reared in potato tubers as natural diet. The
granulovirus VG003, VG005 and VG001 used in this study were isolated in Colombian
provinces of Cundinamarca, Norte de Santander and Nariño, respectively (Villamizar et al.
2005). A reference granulovirus isolate from Peru originally obtained from P. opercullela was
also used in the present study. These granulovirus were characterized biochemically and in
terms of their biological activity.
77
78
Viral propagation was performed by infecting 10 cm2 disc of filter paper containing 400500 T. solanivora eggs with 200 ml of a viral suspension adjusted to 1x106 OB/ml. Each
inoculated paper was divided in smaller fragments without damaging the eggs and each
fragment was placed over one clean potato. All potatoes with eggs inoculated with the same
granulovirus isolate were placed inside a plastic cage (4L) and covered with a cloth piece
adjusted with an elastic band. Cages were maintained at 22˚C and 70% RH. All larvae were
collected from potatoes 25 days after inoculation and maintained at -20°C until virus
purification.
Harvested infected larvae were macerated and mixture was centrifuged at 100 g during
seven minutes. Supernatant was recovered and granulovirus were pelleted by centrifugation at
27.000 g for 30 min. The pellet was resuspended in Tris 0.1M and separated by centrifuging
for 20 min. in 40%-80% glycerol gradient. The white band containing the virus was
resuspended in Tris 0.1 M in a 1:3 ratio (Virus: Buffer). This blend was centrifuged at 15.000
g for nine minutes, the pellet was diluted with distilled water and centrifuged at 18.000 g for
ten minutes, the pellet (purified virus) was diluted again with 0.5 ml of Tris 0.1M, centrifuged
at 18.000 g for ten more minutes and the pellet was stored in aliquots at -20°C (Modified from
Inoue et al. 1994).
Bioassays
Purified virus of each isolate was used to prepare a viral suspension adjusted to a
concentration of 5 x 105 Occlusion bodies (OBs)/ ml (LC90 of Peruvian strain). Three clean
potatoes were inoculated three times with each viral suspension by brushing the complete
potato surface and placed individually in 472 ml plastic cup. Fifteen T. solanivora neonate
larvae and ten P. operculella larvae were placed over each potato (Solanum tuberosum cv.
Pastusa for T. solanivora and S. phureja for P. opercullela). Experimental units were
maintained at 22˚C and 70% RH during 25 days. Control treatments consisted of each potato
variety without any viral application. Larvae were checked by destructive analysis of potato
and mortality, weight and virus yield were recorded. Larvae were recorded as dead when they
did not respond to prodding with a toothpick.
Weight measurements and yield estimation
Dead larvae showing severe disease symptoms were weighed. For yield measurement, larvae
were individually homogenized with 1 ml of sterile water, and the virus granules were counted
by using a previously standardized calibration curve (450nm). Yield was measured in 15 larvae
infected with each granulovirus isolate which were selected randomly.
Infection development
Prior to the infection development with the different virus isolates, the development of untreated
T. solanivora and P. operculella under the experimental conditions of the present work were
established. An experimental unit consisted of a Solanum phureja tuber infested with 10
neonate larvae of P. operculella (48 experimental units) or Solanum tuberosum. ssp andigena
tuber infested with 15 neonate larvae of T. solanivora (27 experiemntal units) contained in an
472 ml plastic cup. Every day of measurement, larvae were extracted from three tubers and
cephalic capsule width was observed under light microscopy (4X).
The establishment of developmental stages was carried out based on the law of Dyar,
which considers that the growth of the insect body sclerozed parts (as cephalic capsule) of
successive instars follow a regular geometric progression (Dyar, 1935, cited by Gamboa &
Notz, 1990). A distribution of frequencies was calculated with the purpose of determining
79
duration of the different larval instars of P. operculella and of T. solanivora based on range of
cephalic capsule width.
Infection signs development was evaluated on T. solanivora and P. operculella larvae
infected with the native and Peruvian isolations of granulovirus mentioned before. Pieces of
paper towel with eggs were inoculated with 3 ml of viral suspension adjusted to a concentration
of 5x106 OB/ml (CL 90 previously calculated for Peru granulovirus), experimental units were as
above. Mortality was tested, starting with neonate larvae and continuing every two days for P.
operculella and every four days for T. solanivora during 32 days. Variance analysis and Tukey
test (α=0.05) were carried out using the SAS 9.1 program.
Biopesticide prototypes
In order to obtain biopesticide prototypes for tuber seed and field applications, the selected virus
isolates were massively produced by infecting larvae as explained above. Virus suspension
(active ingredient) was prepared by macerating infected larvae and suspension quality control
was performed by determining its occlusion bodies concentration (absorbance 450 nm). A
powder to pelletize tuber seeds was adapted from formulation developed previously by
International Potato Center (Peru). This optimized product was scaled up and registered. With
the aim of developing a product for field applications seven dispersible granular biopesticide
prototypes were obtained, after selecting the excipients not affecting the virus stability. Product
characteristics as particle size by gravimetric method (Voight & Bornschein, 1982), fluidity by
dynamic method (Voight & Bornschein, 1982), density (Voight & Bornschein, 1982), porosity
by apparent volume method (Voight & Bornschein, 1982) and biocontrol activity were the
parameters considered for selecting the most promising granular prototype.
Virus yield per unit of larval weight
With all native isolates, a higher granules production was obtained with P. opercullella in
comparison with the yield obtained with T. solanivora (Table1). The native isolate VG005
yield (2.93x1010 OBs/mg) was the highest result. In T. solanivora the highest but not
significantly different OBs yield was obtained with the reference isolate from Peru (1.19x1010
CI/mg), as compared with the obtained with native isolates VG005 (1.03x1010 CI/mg) and
VG001 (9.67x109 CI/mg) (Table 1).
Results showed that native isolates produced significantly higher OBs yield in P.operculella
than in T. solanivora. This could be related with the original host of these isolates (T. solanivora). Viruses require producing more viral progeny when they infect a new host in order to
survive and adapt to that. Measurement of the virus yield per unit of larval weight over time in
different hosts might be a means of categorizing species of varying susceptibility (Dennehy et al.
2006).
Infection development
The growth of T. solanivora and P. operculella larvae follows Dyar’s law. Frequency
distribution shows four defined groups without overlapping suggesting the formation of four
larval instars. In all larval instars of infected insects were evident a major duration and
overlapping of the different instars, also, pupae formation was delayed or inhibited.
This behavior of both moths indicates that the granulovirus has an effect evidenced by a
delay in the development (results not shown), observing inhibition of development and an
increment in larval phase caused by a granulovirus infection. Infection development signs were
similar in T. solanivora and P. operculella and were not evident in first days, presenting
80
translucent larvae. However, from eighth day the appearance of masses of whitish structures was
detected through larvae abdomen, mainly in the later part. These were increasing as it lapsed the
time of infection, until larvae acquired a milky white color in all their body. Absence of
notorious signs of viral infection in first days of development possibly is due to that viral
particles are beginning replication process in the cells of insect mesenteric tissue (primary
infection) and they did not yet spread through the rest of the body of the larva (Caballero et al.
2001).
Table 1. Log of granulovirus yield (OBs.mg-1 of larva tissue) obtained in P. opercullella and T.
solanivora larvae infected with different isolates. Treatments with the same letter are not
significantly different (LSD 95%)
Insect
species
P.
operculella
T.
solanivora
VG003
VG001
Mean Standard Mean Standard
yield
deviation yield deviation
PERU
Mean Standard
yield
deviation
VG005
Mean Standard
yield deviation
10.10a
0.16
10.11a
0.17
10.14a
0.33
10.88a
0.24
9.84b
0.17
9.90b
0.23
10.03a
0.41
9.99b
0.17
Mortality
Insect larvae were observed every two days for P. operculella and every four days for T. solanivora, the number of deaths and time to death were recorded. Mortality for T. solanivora, found
during first 20 days after inoculation with all virus isolates and control treatment (without virus),
did not differ significantly (Fig. 1). This result suggests that evaluated viral concentration do not
cause mortality during first twenty days. The principal observed effect during this time was a
growth delay, related with a decrease in potato consumption and in consequence, a decrease in
potato damage was observed. Twenty-eight days after inoculation, mortality percentages for
Peruvian strain and native isolates VG001, VG003 and VG005 were 24,4%, 20%, 48,9% and
31,1% respectively. The isolate VG003 produced a significantly higher mortality than obtained
with control treatment, while other evaluated virus did not differ significantly from the control,
which suggests that isolate VG003 could be more virulent. Mortalities obtained 32 days after
inoculation were 48,9%, 62,2%, 55,6% and 51,1% for Peru, VG001, VG003 and VG005
granulovirus respectively. Mortality obtained with native isolates were significantly higher than
produced by Peruvian strain and control treatment. Mortality of P. operculella obtained with
Peruvian strain and native isolates VG001, VG003 and VG005 after 28 days of inoculation were
60%, 80%, 51,1% and 100% respectively. Peruvian virus and native isolations VG001 and
VG005 caused significantly higher P. operculella larvae mortality than isolation VG003 and
control treatment (Fig. 2). Isolate VG005 produced the significant highest mortality in
comparison with all evaluated viruses, suggesting that this isolate could be more virulent to this
host inclusive more than Peruvian strain original isolated from P. operculella. This result could
be related with the virus necessity to produce more progeny when is infecting a new host, which
could be also related with higher virulence (Dennehy et al. 2006).
81
Mortality (%)
80
70
60
50
40
30
20
10
0
4
8
12
16
20
24
28
32
Time after inoculation (days)
Control
Peru
VG001
VG003
VG005
Mortality (%)
Figure 1. Biocontrol effect of different granulovirus isolates over T. solanivora.
100
90
80
70
60
50
40
30
20
10
0
4
8
12
16
20
24
28
Time after inoculation (days)
Control
Peru
VG001
VG003
VG005
Figure 2. Biocontrol effect of different granulovirus isolates over P. operculella.
Biopesticide prototypes
A powder formulation for tubers pelletization with the following characteristics was optimized:
concentration of 105 OBs.g-1, moisture content of 0.57%, voluminosity of 0.93 ml.g-1, pH 9.52
and efficacy 97.25% (Villamizar et al. 2006). Production process was standardized and validated
and it was scaled up to a production capacity of 15 ton per month; Standard operative procedures
were developed and manufacture plant and biopesticide were registered in Colombia. In order to
develop a granular formulation for field application, the first step was to select virus compatible
formulation excipients. The effect over viral biocontrol activity of eight pharmaceutical
excipients (diluents, sunscreens and disintegrants) were evaluated and compatible substances
were selected for developing prototypes. Formulations made with and without UV protectors
were compared for persistence of insecticidal activity when exposed to monochromatic
ultraviolet lamp (254 nm) during one hour. Results showed that the formulations with the UV
protector codified as CBUV03 had more insecticidal activity remaining after light exposure
(76% of larvae mortality) than formulations without protector (31% - 52% of larvae mortality)
and unformulated virus (41% of larvae mortality). Results demonstrated that formulations made
82
with natural ingredients did not affect the biological control activity of the virus and could
improve persistence of virus-based biopesticides. Selected granular prototype presented
following characteristics: particle size of 1 mm, fluidity expressed and repose angle was 34.56°,
porosity of 90%, density of 0,5 ml/g and produced of 90.1% biocontrol efficacy under laboratory
conditions. All of these characteristics are considered adequate for this kind of formulation
which is being actually optimized.
References
Benavides, M. 2000: Protección sanitaria del cultivo de la papa para programas de manejo
integrado de plagas. Papas Colombianas 2: 62-64.
Caballero, P.; López-Ferber, M.; Williams, T. 2001: Los Baculovirus y sus aplicaciones como
bioinsecticidas en el control biológico de plagas. Editorial M. V. Phytoma. España, S.L.:
518 pp.
Dennehy, J.; Friedemberg, N.; Holt, R.; Turner, P. 2006: Viral ecology and the maintenance
of novel host use. Amer. Natur. 167 (3): 429-439.
Gamboa, M.& Notz, A. 1990: Biología de Phthorimaea operculella (Zeller) (Lepidoptera:
Gelechiidae) en papa (Solanum tuberosum). Inst. Zool. Agr. Valencia, Venezuela: 1-9.
Inoue, H.; Leal, H.; Gonzalez, M.; Estrado, R. 1994: Behavior of adults of the potato tuber
moth Scrobipalpopsis solanivora on potatoes and chemical control in Guatemala. Jap.
Agr. Res. Quart. 28: 20-25.
Pollet, A. 2001: Guatemalan moth Tecia solanivora devastating potato crops in Ecuador. Int.
Pest Cont. 43: 75-76.
Pollet, A.; Barragán, A.; Onore, G.; Aveiga, I.; Prado, M.; Lery, X.; Zedamm, J.L 2003:
Predicción de daños de la polilla guatemalteca Tecia solanivora (Povolny) 1973
(Lepidoptera: Gelechiidae) en el Ecuador. Plaga 29: 1-10.
Torres, F.; Notz, A.; Valencia, L. 1997: Ciclo de vida y otros aspectos de la biología de la
polilla de la papa Tecia solanivora (Povolny) (Lepidoptera:Gelechiidae) en el estado
Tachira, Venezuela. Bol. Ent. Ven. 12: 95-106.
Villamizar, L.; Zeddam, J.L.; Espinel, C.; Cotes, A.2005: Implementación de técnicas de
control de calidad para la producción de un bioplaguicida a base del granulovirus de
Phthorimaea operculella PhopGV. Rev. Col. Ent. 31 (2): 127-132.
Villamizar, L.; Espinel, C.; Grijalba, E.; Torres, L.; Cotes, A.; Lopéz-Ávila, A.; Barrera, G.;
Zedamm, J.L.; Herrera, L.; Gómez, J. 2006: Reconocimiento, selección y evaluación de
aislamientos nativos de virus de la granulosis para el control biológico de la polilla
guatemalteca de la papa Tecia solanivora. Bol. Téc. Corpoica. Editorial Produmedios.
Bogotá-Colombia: 24 pp.
Voight, R. & Bornschein, M. 1982: Tratado de Tecnología Farmacéutica. Ed. Acribia.
Zaragoza, España: 542 pp.
p. 83
Analysis of several Colombian Phthorimaea operculella granulovirus
isolated from Tecia solanivora: Detection of a new variable region in
the PhopGV genome
Xavier Léry1, Laura Villamizar2, Carlos Espinel2, Jean -Louis Zeddam3,
Alba Marina Cotes2, Miguel López-Ferber4
1
IRD, Centre de Recherche, 30380 St Christol-les-Alès, France; 2CORPOICA, Km 14 vía
Mosquera, Bogotá, Colombia; 3IRD, PUCE, Quito, Ecuador; 4LGEI, Ecole des Mines, Alès,
France
Abstract: Five isolates of Phthorimaea operculella granulovirus (PhopGV), obtained from Tecia
solanivora larvae sampled from three different regions of Colombia were studied. One isolate was
obtained from an infected larva collected in the north-east near the frontier with Venezuela, one from
the south-west near the frontier of Ecuador and the three others from the center of Colombia. They
were amplified on larvae of T. solanivora reared in laboratory conditions. Isolates were characterized
using 12 specific restriction endonucleases and the amplification by PCR of the four variable regions
already mentionned for PhopGV, using specific set of primers. The results indicated differences
between the strains. The three isolates from the center part of Colombia present the same profiles, and
the two others present submolar bands either with REN or with PCR analysis. The Colombian isolates
were compared with several PhopGVs originated from Peru, Ecuador and Tunisia and isolated from P.
operculella, T. solanivora and S. tangolias. Using the 4 set of primers, the three isolates from the
center part of Colombia present a profile specific to T. solanivora isolates. In the two other isolates,
the submolar bands are the same than the ones found in P. operculella profiles, indicating the presence
in the genome of at least 2 different profiles. A new variable region was detected in the 90-91 gene
region using another set of primers. With this set of primers, a 630 bp band appears, different from the
789 bp band usually found with the other PhopGV strains. The sequence of this part of the genome
indicates a deletion in the repetitive part of the 90-91 genes. This deletion appears to be a specific
modification only found in viral strains obtained from T. solanivora in Colombia.
83
p. 84
Perspectives for the control of insect pests with baculoviruses in
vegetable crops in Tunisia
Asma Laarif1, Elhem Salhi1,2, Sami Fattouch2, Nesrine Zellama1,2,
Mohamed Habib Ben Hamouda3
1
Laboratory of plant protection. Regional Research Center in Horticulture and Organic
Agriculture. BP57, Chott mariem 4042, Sousse, Tunisia; 2Laboratory of Biological
Engineering, INSAT; 3Entomology Laboratory. High Institute of Agronomy
Abstract: In recent years, there has been growing interest worldwide in the possible adverse effects of
agricultural chemicals on health and the environment. An alternative to chemical pest control are
biological agents including microbial entomopathogens. These organisms cause disease in arthropods,
particularly in insects and mites. There is a worldwide considerable interest to isolate, identify and
apply these microorganisms as pest biological control agents. They are naturally widespread in the
environment and include bacteria, fungi, viruses, nematodes and protozoa. Most are host specific, and
some cause natural epidemics in insect populations. To date however, on the Tunisian market, there is
only one microbial product available based on Bacillus thuringiens used to control moths and many
opportunities remain to be fully explored. In Tunisia, vegetables are socio-economic important crops
which are subjected to attack by lepidopterous pests especially Phthorimaea operculella (Zeller) and
Spodoptera littoralis (Boisduval). These insects are controlled conventionally using routine applications of synthetic chemical insecticides. Recently, we detected two baculoviruses isolated from
Tunisian natural insect populations: a granulovirus (GV) infecting P. operculella (Zeller) larvae and a
nucleopolyhedrovirus (NPV) identified in Spodoptera littoralis (Boisduval) larvae. A microsporidian
infection (Nosema sp.) was also found in the larvae of both insect larvae. Baculoviruses and
microsporidian have recognized as possessing the ability to develop into potential biopesticides. The
use of these entomopathogens in an integrated pest management strategy (IPM) can be developed
against Lepidoptera pests in Tunisia and becomes a realistic option.
84
pp. 85-88
Isolation, identification and biocontrol activity of Colombian isolates
of granulovirus from Tecia solanivora larvae
L. Villamizar1, C. Espinel1, E. Grijalba1, J. Gómez1, A. Cotes1, L. Torres1, G. Barrera1,
X. Léry2, J-L. Zeddam2
1
Biotechnology and Bioindustry Center, CORPOICA, Colombia; 2Institut de Recherche pour
le Développement(IRD) 213 rue La Fayette, 75480, Paris, Francia
Abstract: Objective of the present work was to create a collection of native granulovirus for control of
Tecia solanivora. Larvae were sampled from Colombian potato production areas. From 313
individuals analysed by dark field microscopy, 141 were preliminarily found positive for GV
presence. Selected samples were used for viral propagation in order to reproduce the symptoms and
signs of the disease and thus to demonstrate the presence of an infectious agent. Only 5 samples
reproduced the symptoms and signs of granulovirus infection. These were purified on sucrose
gradients and the identity confirmed by granulin identification using gel electrophoresis and by
transmission electron microscopy. Biocontrol activity of formulated and unformulated native strains
and a Peruvian reference granulovirus of Phthorimaea operculella were evaluated on T. solanivora
larvae. Formulation enhanced biocontrol activity of the Peruvian reference strain and the native
granulovirus isolates C0126 and C0404. Significant differences in mortality were found with
unformulated strains ranging between 45% and 100% control.
Key words: Tecia solanivora, GV, potato tuber moth
Introduction
In Colombia potato is grown on 180.000 ha and 90.000 families are linked to this production.
The Guatemalan potato moth Tecia solanivora (Povolny) (Lepidoptera; Gelechiidae) is one of
the most limiting potato pests in Venezuela, Colombia and Equador. Biological control using
the granulovirus of Phthorimaea operculella (Zeller) has demonstrated to be one of the main
tools for its management. CORPOICA has a commercial production plant for manufacturing
using a Peruvian viral strain of Phthorimaea operculella granulovirus (PhopGV) for
managing the Guatemalan moth under storage of potato seeds. This strain has demonstrated to
be an efficient biocontrol agent for T. solanivora. However, a strain isolated from the target
host might be more virulent than the strain from P. operculella. Actually, there are only few
literature reports on a GV from T. solanivora (Zeddam et al., 1994; Niño and Notz, 2000).
The present work pretended to isolate, identify and determine the biocontrol activity of a
Colombian GV from T. solanivora.
Collection of insects
T. solanivora larvae collections were realized in the most important potato production areas of
Colombia. Healthy larvae and those with signs of granulovirus disease were collected and
placed individually in 1 ml saline solution (0,85%) in an Eppenddorf tube. Thirty larvae were
collected from each site. Larvae were transported to the laboratory and maintained at -70˚C.
85
86
Each sample (larva) was homogenized in 1 ml saline solution and the suspension was divided
in 5 sub-samples of 200 µl which were maintained at -70˚C.
Determination of granulovirus presence
One sub-sample was utilized for checking granulovirus presence by using dark field
microscopy. Samples with small white points with Brownian motion were classified as
probably positive for granulovirus presence and used for infecting T. solanivora neonatal
larvae in order to confirm the presence of virus. One sub sample of each larval suspension
was diluted to 1 ml saline solution (0,85%) and dropped over a paper towel (10 cm2) with T.
solanivora eggs (approximately 150 eggs per paper). Each inoculated paper was divided in
smaller fragments of 1cm2 and each fragment was placed over a clean potato. All potatoes
inoculated with eggs from the same sample were placed inside a plastic cage. Cages were
maintained at 22˚C and 70% RH. Larvae were collected 25 days later and placed in Petri
dishes. Larvae with signs of white coloration were classified as positive for viral presence.
Confirmation of granulovirus presence by SDS-PAGE
Virus of each infected larvae was purified by using a sucrose gradient (45%, 65% and 80%)
and purified virus was analyzed by SDS-PAGE according to Caballero et al. (2001).
Transmission electron microscopy
Purified viruses were fixed on nets covered with foamvar. Samples were stained with
phosphotungstic acid (2%, pH 6.3) and observed under an electron microscopy (Phillips 515).
Biocontrol activity of native granulovirus isolates
The biocontrol activity of selected formulated and un-formulated Colombian isolates and the
Peruvian reference strain was determined in bioassays. Purified virus OBs of each isolate
were used to prepare a viral suspension adjusted to a concentration of 105 OBs/ml by using a
previously standardized calibration curve (450 nm). Three clean potatoes were inoculated
three times with each viral suspension by brushing the complete potato surface. All isolates
were formulated with a commercial dry powder used for seed potato treatment. Formulated
granulovirus isolates (105 OBs/g) application was carried out inside a plastic bag with three
potatoes. Plastic bag was moved. Each potato was then placed in a plastic cage and 10
neonate T. solanivora larvae were placed over each tuber. Cages were cover with plastic lids
and maintained at 22˚C and 70% RH. Control treatment consisted in potatoes without viral
inoculation. All larvae were collected 25 days later and mortality was determined. Mortality
was corrected using the Schneider-Orelli equation (Zarr, 1999).
A total of 377 larvae were collected from 19 towns. Only in one town, larvae with typical
granulosis infection symptoms were found. Results suggest that granulovirus infection
symptoms are not frequently found under field conditions, as mentioned by Laarif et al.
(2003) who studied the epidemiology of Phthorimaea operculella granulovirus under field
conditions in Tunesia. Only with five samples, signs and symptoms of granulovirus infection
were reproduced. Only five samples reproduced the granulovirus disease symptoms (Fig. 1)
and were selected for further characterization. These isolates were codified as C0404, C0611,
C0126 from Cundinamarca (centre of the country), Nr004 from Nariño (south, frontier with
Equador) and N0108 from North of Santander (north-east, frontier with Venezuela).
87
SDS-PAGE showed only one band of approximately 35 kDa for all samples (Fig. 2) that
coincide with granulin molecular weight, granulovirus main protein, which range from 25 to
38 kDa (Caballero et al., 2001). Other bands were not observed, possibly because of the very
low concentration of other proteins, considering that granulin could be as much as 96% of
granulovirus OBs total protein (Caballero et al., 2001). Structures observed with transmission
electronic microscopy presented the typical morphological characteristics of granulovirus
OBs (Fig. 3). For all samples oval particles of approximately 400 µm length and 200 µm wide
were observed within the ranges described in the literature for granulovirus OBs (a length
between 300 and 500 µm and wide between 160 and 350 µm) (Caballero et al., 2001). Virions
inside the protein matrix were visible in some pictures. Disease symptom reproduction,
protein analysis and electron microscopy pictures confirmed the identity of larvae infectious
agents as granulovirus.
1
Figure 1. Healthy (A) and granulovirus
infected (B) T. solanivora larvae
2
3
4
5
Figure 2. SDS-PAGE of native granulovirus isolates. 1. C0404, 2. N0108, 3.
C0126, 4. C0611, 5. Nr004
Colombian granulovirus isolates N0108, Nr004 y C0611 produced a mortality of 100%,
isolates C0126 and C0404 caused 45% and 50% mortality, respectively (Fig. 4). The Peruvian
isolate produced 62% larval mortality. The statistical analysis using ANOVA and the Tukey
test (95% confidence) revealed significant differences (P > 0.05) between the three isolates.
Results indicate that isolates N0108, Nr004 y C0611 are more virulent to T. solanivora than
the Peruvian strain originally isolated from P. operculella. Harvey & Volkman (1983)
reported that virus isolates obtained on the same host from different geographical zones could
have the same genetic origin but could be more adapted to one particular host and to several
other conditions in each ecosystem, elements that could generate some genetic variations and
in consequence they might also have some differences in virulence. Significant differences
were found when virus isolates were formulated (P > 0.05). For isolation N0108,
unformulated virus caused higher mortality than formulated virus (54%). Mortality of isolates
C0126, C0404 and the reference strain from Peru increased significantly when formulated
suggesting that formulation enhanced virus efficacy. Similar results were obtained by Ben
Salah & Aalbu (1992), who evaluated a P. operculella granulovirus formulated using talcum
under field conditions. The formulation enhanced viral activity, probably because small
particle size of that powder caused spiracle blocking and larvae dehydration.
88
Efficacy (%)
A
100
90
80
70
60
50
40
30
20
10
0
A A
A
A
AB
A
A
BC
C
C
C
N0108
Nr004
C0126
C0404
C0611
Perú
Isolates
Unformulated
Figure 3. Electon microcopy of Columbian
isolates A. N0108, B. C0611, C. C0404, D.
C0126, E. Nr004
Formulated
Figure 4. Efficacy of formulated and unformulated Columbian granulovirus isolates. Treatments with the same letter are not significantly
different (Tukey 95%)
Acknowledgements
The authors thank Dr. Aristóbulo López-Ávila for providing the insects for experimentation
and generous collaboration. Authors also thank Colciencias and the Ecos-Nords programme
for financial support.
References
Ben Salah, H. & Aalbu, R. 1992: Agr. Eco.Env. 38: 119-126.
Caballero, P., López-Ferber, M. & Williams, T. 2001: Los baculovirus y sus aplicaciones
como bioinsecticidas en el control biológico de plagas. Phytoma: 517 pp.
Harvey, J. & Volkman, L. 1983: Virology 124: 21-34.
Laarif, A., Fattouch, S., Essid, W., Marzouki, N., Ben Salah, H. & Ben Hammouda, M. 2003:
Bull. OEPP/EPPO 37: 335-338.
Niño, L. & Notz, A. 2000: Bol. Ent. Venezuela 15: 29-38.
Zar, J. 1999: Biostatistical analysis. Fourth Edition. Prentice Hall. New Jersey: 663 pp.
Zeddam, J.-L, Léry, X., Giannotti, J., Nino, L., Angeles, I. & Alcazar, J. 1994: VIth Int. Coll.
Invertebr. Pathol. Microb. Control, Montpellier, France, 28 August-2 September: 239240.
p. 89
Molecular and biological characterization of a novel granulovirus
isolate from Phthorimaea operculella found in Costa Rica
Yannery Gómez-Bonilla1,2,3, Xavier Léry3, Delia Muñoz2, M. López-Ferber4, and P.
Caballero2
1
Instituto Nacional de Investigación y Transferencia de Tecnología Agropecuaria (INTA),
San José, Costa Rica; 2 Departamento de Producción Agraria, Universidad Pública de
Navarra, 31006 Pamplona, Spain; 3 IRD, Centre de Recherche, av. Gén. de Gaulle, 30380, St
Christol-les-Alès, France. 4 École des Mines dÁlès, 6 avenue de Clavières, 30319 Alès cedex,
France
Abstract: The most important pests in potato (Solanum tuberosum) in Costa Rica are Phthorimaea
operculella (Zeller) and Tecia solanivora (Povolny). The control of these species with chemical
insecticides has caused the development of resistance. Alternative control methods include the use of a
granulovirus (Baculoviridae) isolated from P. operculella (PhopGV), which has already been used in
several Latin-American countries. Previous results indicated the existence of both genetic and
biological variability among isolates from different geographical origins. For this reason, the search
for indigenous PhopGV strains, adapted to the particular P. operculella and T. solanivora biotypes
within each region, and the design of tools that allow the identification of different strains, constitute
key research objectives. We isolated a novel granulovirus strain in Costa Rica. Molecular
characterization was carried out using restriction endonuclease analysis with 12 different enzymes and
PCR amplification of specific genomic variable regions. The restriction profiles indicated that the
Costa Rican isolate is a strain of PhopGV. When compared to three PhopGV reference strains,
significant differences were observed with three endonucleases (BamHI, HpaI and NdeI). The study of
five variable genomic regions gave similar PCR amplification profiles except for that of ORF129. The
biological activity of the Costa Rican isolate in terms of 50% lethal concentration (LC50) was
evaluated using a nebulization method. The LC50 was significantly higher for first instar P. operculella
(10 granules/mm2) than for T. solanivora (50 granules/mm2). Parallel bioassays conducted in France
with P. operculella with the same virus strain showed a similar LC50 value (6.5 granules/mm2). Since
these results are similar to those obtained with the three reference strains, the novel strain has potential
as a tool for the control of this pest in Costa Rica.
Key words: Phthorimaea operculella, granulovirus, geographical strains, Costa Rica, biological
activity
89
Bacteria
89
4
pp. 93-98
New hope for the microbial control of Musca domestica L.
Luca Ruiu1, Alberto Satta1, David J. Ellar2, Ignazio Floris1
1
Dipartimento di Protezione delle Piante – Entomologia Agraria, University of Sassari (Italy)
Via E. de Nicola, 07100 Sassari. 2Department of Biochemistry, University of Cambridge,
Tennis Court Road, Cambridge, CB2 1GA, United Kingdom.
Abstract: The housefly, Musca domestica L., is a pest of medical and veterinary importance because
of its nuisance value and as a vector of enteric disease microrganisms. During a screening programme
designed to isolate new entomopathogenic bacteria showing activity against fly pests, a new strain of
Brevibacillus laterosporus (Laubach) was collected in a soil sample from Sardinia (Italy).
Morphological and genetic observations, biomolecular analysis and bacterial fractionation were
carried out to identify and characterize the new B. laterosporus isolate. Lethal and sub-lethal effects
were recorded in laboratory experiments on both adults and juveniles, and spores were identified as
the main source of toxicity.The results of experimental treatments in cattle farms with a B.
laterosporus are promising and stimulate further experimentation to fully evaluate the potential use of
B. laterosporus as a biocontrol agent for housefly control.
Key words: housefly, Brevibacillus laterosporus, biological control
Introduction
The house fly is one of the major pests of medical and veterinary importance. In livestock and
poultry houses immature flies develop and adults aggregate to reach high density, which
causes annoyance to both animals and people. Due to their behaviour feeding and vomiting on
food substrates, flies moving from manure and other substrates to human food can transmit
various micro-organisms. Recent studies have confirmed the importance of the housefly in the
epidemiology of enteric diseases, especially diarrhoea and shigellosis (Cohen et al., 1991).
Adults occur also on animals, where they feed on available blood, sweat, tears, saliva and
other bodily fluids. These annoyances, due to high fly densities, can cause a reduction in milk
production (Bruce & Decker, 1958).
Common control measures involve the use of chemical pesticides against adults
(Drummond et al., 1988). However, because of the increasing interest in the use of biological
control methods, alternative housefly control strategies, such as the use of new microbial
strains, are welcome. One entomopathogen is Brevibacillus laterosporus, an aerobic sporeforming bacterium, characterized by its production of a canoe-shaped lamellar body attached
to one side of the spore (Figure 1). Its insecticidal properties against mosquitoes (Culex
quinquefasciatus Say and Aedes aegypti Linnaeus), black flies (Simulium vittatum (Zetterstedt)), coleopteran and lepidopteran larvae, nematodes and molluscs have been reported
(Favret & Yousten, 1985; Rivers et al., 1991, Singer, 1996; Oliveira et al., 2004). Some
mosquitocidal B. laterosporus strains have also been observed to produce parasporal
inclusions similar to those produced by B. thuringiensis (Smirnova et al., 1996). Insecticidal
toxins produced by B. laterosporus have recently been identified and patented for the control
of Coleoptera (Boets et al., 2004) and parasitic nematodes (Bone et al. 1991).
In comparison with other entomopathogenic bacteria, such as B. thuringiensis, the
genome of B. laterosporus is poorly characterized. However, genotypic diversity and different
93
94
pathogenicity levels of various assayed strains have been observed (Oliveira et al., 2004). The
differences in toxicity levels and in the spectrum of activity raise hope that novel strains and
toxins against new insect targets may be isolated. More recently, during a screening
programme involving soil occurring entomopathogenic bacteria carried out in Sardinia, we
have isolated a new strain of Brevibacillus laterosporus, which shows pathogenic effects on
the housefly (Ruiu et al., 2006). The present paper summarizes our recent findings involving
various laboratory and field experimentations.
Figure 1. Sporangium of Brevibacillus laterosporus. CW: cell wall; Sp: spore; PB: parasporal
body; SC: spore coat.
Insects and bacteria
Insects employed in bioassays were from the laboratory of the Department of Plant Protection
of the University of Sassari. Details of rearing techniques and conditions are described
elsewhere (Ruiu et al., 2006). The micro-organism used in this study was a strain of
Brevibacillus laterosporus collected from a soil sample in Sardinia (Italy) and known to be
toxic for the housefly (Ruiu et al., 2006). Bacteria were produced in Luria-Bertani (LB) broth
or CCY medium (Stewart et al., 1981) until pure suspensions of vegetative cells at different
stages of growth at 30°C on a shaker. Sporangia or spores were collected. An experimental
formulation containing this B. laterosporus strain was produced by e-nema GmbH-Raisdorf
(Germany). Bacteria were grown in a 500 l bioreactor and the whole sporulated culture was
then transformed into a liquid paste and subjected to gamma-irradiation to kill all spores.
Laboratory bioassays
Bacteria were incorporate into artificial diets at different concentrations and assayed against
adults and different larval stages. Details of test assay techniques and conditions are described
in Ruiu et al. (2006). Both adult and larval mortalities were assessed after 5 days.
95
Field experiments
On two cattle farms in Arborea (Sardinia) the abundance of adult housefly populations was
monitored from May to October 2003 by three yellow double-sided sticky fly traps (20x20
cm) placed at a height of 150 cm in the cow stables (Lysyk & Axtell, 1986). Traps were
replaced every week. Each removed trap was brought to the laboratory for fly identification
and counting.
In one experiment for adult management one dairy farm (Farm A) applied B. laterosporus and the nother (Farm B) used food baits poisoned with methomil (active ingredient).
Before the B. laterosporus treatments, adult housefly management in both farms was mainly
based on commercial food baits containing sugar, methomil and Z-9-tricosene, released in
trays unreachable by the cattle, at a dosage of 500 g/week. During July 2003, the use of
commercial food baits in Farm A was replaced by solid candied food prepared mixed with B.
laterosporus and sucrose at a concentration of 2x108 spores/g. Treatments were repeated three
times a week, from the 8th of July to the 8th of August 2003. In the meanwhile, fly
management in Farm B continued to be based on commercial food baits as described above.
The abundance of immature flies was monitored based on the percentage of adult
emergence from the manure samples. As a modification of the sampling method employed by
Loomis et al. (1968) and Skoda et al. (1996), a manufactured 0.5-litre standard metal core
sampler was used to take random manure samples in the farm paddock, which represented the
main juvenile development site. Samples were collected weekly and incubated in cylindrical
plastic tubes (20 cm diameter, 25 cm high) where immature flies developed until emerging
adults, moving towards the light, were collected in a second plastic transparent cylinder
connected to the tube. The B. laterosporus formulation was distributed on the surface of the
paddock at a concentration of 1x108 spores/ml and a dosage of 2 l/m2. Treated and control
areas were compared in order to evaluate the efficacy of treatments. Experiments were carried
out in three replicates.
Laboratory bioassays
Lethal and sub-lethal effects of the B. laterosporus sporulated culture against adults and
larvae were reported in Ruiu et al. (2006). Vegetative cells collected during exponential
growth were not toxic, whereas a weak toxicity (40-50% mortality after 5 days) was
associated with vegetative cells harvested during the stationary phase when assayed at the
concentration of 2x109 cell/g of diet. On the other hand, sporangia and purified spore fractions
were as toxic as the whole sporulated culture. Because sporangia contain spores, they were
identified as the main source of toxicity. By contrast the culture supernatant failed to show
any toxicity against the housefly (Tab. 1).
Boets et al. (2004) and Schnepf et al. (2003) isolated novel insecticidal proteins with
activity against Coleoptera from the culture supernatant of certain strains. By contrast, our
findings are more in line with those of Favret and Yousten (1985) and Orlova et al. (1998)
where the main insecticidal activity was associated with the vegetative cell mass and
sporulated cells, respectively. On the other hand, in our case spores have been shown to
contain the main pathogenic fraction. The presence of toxins in B. laterosporus spores has
previously been reported by Bone et al. (1991) who discovered spore toxins inhibiting egg
hatching and/or larval development of the ruminant parasitic nematode (roundworm)
Trichostrongylus colubriformis. Such differences indicate a variable toxicity among strains of
B. laterosporus, as observed for other entomopathogenic bacteria (de Maagd et al., 2003).
96
Field experiments
In both cattle farms fly abundance is influenced by weather conditions, especially temperature, reaching the highest density during summer. Under these conditions, even if B. laterosporus treatments against adults did not cause a significant reduction in adult populations, fly
abundance in the treated farm was still comparable to that of the farm treated with commercial
food baits containing methomil (Figure 2). However, the possibility that flies moving in from
neighbouring livestock farms could have influenced fly abundance under these conditions can
not be excluded. Although the treatments with the bacterial formulation in the paddock were
limited to the superficial layers, a significant reduction of about 30% in the immature fly
density in the treated area compared to the control one was recorded (Figure 3). Similar
immature housefly control has been obtained with B. thuringiensis formulations by Labib &
Rady (2001).
Even if a greater effectiveness of treatments could have been obtained by using higher
dosages and concentrations of the studied bacterial formulation, the chosen values were based
on a compromise between the toxicity effects observed in the laboratory assays and treatment
costs. For all these reasons, the method assayed in this research represents a first approach to
the use of B. laterosporus for the control of the housefly. More studies covering a much larger
treated area and assaying different concentrations and dosages of B. laterosporus should be
carried out. Finally, the results of immature housefly control in the natural breeding substrates
are suggesting that this formulation might represent a new hope for the biological
management of this pest.
Table 1. Toxicity of Brevibacillus laterosporus against housefly adults and larvae.
Brevibacillus laterosporus preparations1
Whole sporulated culture
2
Toxic
Culture supernatant
Non toxic
Exponential phase vegetative cells
Non toxic
Stationary phase vegetative cells
1
Toxicity2
Weakly toxic
Sporangia
Toxic
Spores
Toxic
Cells, sporangia and spores were administered at a concentration of 2x109 cell/g of diet;
Mortality refers to adult and larval bioassays: Toxic (more than 90 % mortality), weakly toxic
(40-50 % mortality), non toxic (no significant mortality).
Acknowledgements
This study was supported by Italian Ministero dell’Università e della Ricerca Scientifica
Project “Biotecnologie innovative per il controllo di insetti nocivi mediante l’impiego di
agenti microbiologici”. Coordinator: Prof. Ignazio Floris, University of Sassari – Italy.
97
Treatment period
300
B. laterosporus
Flies/trap/week
250
Methomil food baits
200
150
100
50
7.10
14.10
30.9
23.9
9.9
16.9
2.9
26.8
19.8
12.8
5.8
29.7
22.7
15.7
8.7
1.7
24.6
17.6
10.6
3.6
27.5
20.5
13.5
0
N. emerging flies/4 litres manure
Figure 2. Adult housefly abundance from May to October 2003 (means ±SEM) on farm
treatment with Brevibacillus laterosporus and on farm treated with food baits containing
methomil (1,00 % w/w)
160
140
BEFORE TREATMENTS
AFTER TREATMENTS
Treated
Treated
120
100
80
60
40
20
0
Control
Control
Figure 3. Comparison of immature housefly abundance (means ± SEM) between treated and
control areas, before and after treatments.
References
Boets, A., Arnaut, G., Van Rie, J., Damme, N. 2004: Toxins. U.S. Pat. No. 6,706,860. Bayer
BioScience N.V., Ghent, BE.
Bone, L.W. & Singer, S. 1991: Control of parasitic nematode ova/larvae with a Bacillus
laterosporus. U.S: Pat. No. 5,045,314. The United States of America as represented by
Secretary of, Washington, DC.
Bruce, W.N. & Decker G.C. 1958: The relationship of stable fly (Stomoxis calcitrans)
abundance to milk production in dairy cattle. J. Econ. Entomol. 51: 269-274.
Cohen, D., Green, M., Block, C., Slepon, R., Ambar, R., Wasserman, S.S. & Lavine, M.M.
1991: Reduction of transmission of shigellosis by control of houseflies (Musca
domestica). Lancet 337: 993-997.
De Maagd, R.A., Bravo, A., Berry, C., Crickmore, N. & Schnepf, H.E. 2003: Structure,
diversity, and evolution of protein toxins from spore forming entomopathogenic bacteria.
Annu. Rev. Genet. 37: 409-433.
98
Drummond, R.O., George, J.E. & Kunz, S.E. 1988: Control of Arthropod Pests of Livestock:
A Review of Technology. CRC Press. Boca Raton, FL.
Favret, E.M. & Yousten, A.A. 1985: Insecticidal activity of Bacillus laterosporus. J.
Invertebr. Pathol. 45: 195-203.
Labib, I.M. & Rady, M. 2001: Application of Bacillus thuringiensis in poultry houses as a
biological control agent against the housefly, Musca domestica sorbens. J. Egypt. Soc.
Parasitol. 31: 531-544.
Loomis, E.C., Deal, A.S. & Bowen, W.R. 1968: The relative effectiveness of cumaphos as a
poultry feed additive to control synanthropic fly larvae in manure. J. Econ. Entomol. 61:
904-908.
Lysyk, T.J. & Axtell, R.C. 1986: Field evaluation of three methods for monitoring populations
of house flies (Musca domestica)(Diptera: Muscidae) and other filth flies in three types
of poultry housing systems. J. Econ. Entomol. 79: 144-151.
Oliveira, E.J., Rabinovitch, L., Monnerat, R.G., Passos, L.K. & Zahner, V. 2004: Molecular
characterization of Brevibacillus laterosporus and its potential use in biological control.
Appl. Environ. Microbiol. 70: 6657-6664.
Orlova, M.V., Smirnova, T.A., Ganushkina, L.A., Yacubovich, V.Y. & Azizbekyan, R.R.
(1998) Insecticidal activity of Bacillus laterosporus. Appl. Environ. Microbiol. 64: 27232725.
Rivers, D.B., Vann, C.N., Zimmack, H.L., & Dean, D.H. 1991: Mosquitocidal activity of
Bacillus laterosporus. J. Invertebr. Patholol. 58: 444-447.
Ruiu, L., Delrio, G., Ellar, D.J., Floris, I., Paglietti, B., Rubino, S. & Satta, A. 2006: Lethal
and sublethal effects of Brevibacillus laterosporus on the housefly (Musca domestica).
Entomol. Exp. Appl. 118, 137-144.
Schnepf, H.E., Narva, K.E., Stockhoff, B.A., Lee, S.F., Walz, M. & Sturgis, B. 2003:
Pesticidal toxins and genes from Bacillus laterosporus strains. US Patent No. 6,605,701,
Aug. 12, 2003. Mycogen corporation, Indianapolis, IN.
Singer, S. 1996: The utility of morphological group II Bacillus. Adv. Appl. Microbiol. 42:
219-261.
Skoda, R.S., Thomas, G.D. & Campbell, J.B. 1996. Comparison of core sampling and pupal
traps for monitoring immature stable flies and house flies (Diptera: Muscidae) in beef
feedlot pens. J. Econ. Entomol. 89: 428-434.
Smirnova, T.A., Minenkova, I.B., Orlova, M.V., Lecadet, M.M. & Azizbekyan, R.R. 1996:
The crystal-forming strains of Bacillus laterosporus. Res. Microbiol.147: 343-350.
Stewart, G.S.A.B., Johnstone, K., Hagelberg, E. & Ellar, D.J. 1981: Commitment of bacterial
spores to germinte: A measure of the trigger reaction. Biochem. J. 1998: 101-106.
pp. 99-104
The taxonomic position of the entomopathogenic bacterium
Rickettsiella grylli: 16S rRNA genes and beyond
Andreas Leclerque, Regina G. Kleespies
Julius Kühn-Institute (JKI) – Federal Research Centre for Cultivated Plants, Institute for
Biological Control, Heinrichstr. 243, 64287 Darmstadt, Germany
Abstract: The genus Rickettsiella of insect pathogenic bacteria has previously been assigned to the γproteobacterial order Legionellales, family Coxiellaceae, on the basis of the determination of a 16S
rRNA encoding sequence from a strain of the species Rickettsiella grylli. Subsequently, conflicting
results have been reported with other Rickettsiella pathotypes. Here we have used the 16S rRNA gene
from a second R. grylli strain as well as the deduced sequences for two proteins, the chaperonin
GroEL and the ortholog of a Coxiella burnetii factor triggering capsule synthesis, MucZ, to check for
a corroboration of this taxonomic classification. While our study lends strong support to the
classification at the order level, the assignment to the family Coxiellaceae appears much less obvious
from our results.
Key words: Rickettsiella grylli, taxonomy, phylogeny, 16S rRNA, GroEL chaperonin, MucZ, Coxiellaceae, Legionellales
Introduction
Bacteria of the genus Rickettsiella (Philip) are obligate intracellular pathogens of a wide range
of arthropods. Characteristic steps of their life cycle are multiplication in vacuolar structures
within fat body cells and the formation of protein crystals. The taxonomy of the genus
Rickettsiella is based primarily on the identity of a specimen’s original host. The resulting
designation is partly superposed by a morpho- and serologically founded distinction of the
three species Rickettsiella popilliae (Dutky & Gooden), Rickettsiella grylli (Vago & Martoja),
and Rickettsiella chironomi (Weiser) that are named according to the respective type strain’s
pathotype (Garrity et al., 2005).
Believed to comprise “rickettsia of insects”, the genus Rickettsiella had originally been
assigned to the α-proteobacterial order Rickettsiales (Weiss et al., 1984), but in the sequel of
the determination of a 16S rRNA encoding sequence from a strain of R. grylli (Roux et al.,
1997) the entire genus has recently been „provisionally removed“ from this order and instead
been assigned to the γ-proteobacterial order Legionellales, family Coxiellaceae (Garrity et al.,
2005). Nevertheless, several Rickettsiella strains were recently removed from the genus and
instead classified in the candidate genus “Rhabdochlamydia” within the order Chlamydiales
after the respective 16S rRNA genes had been sequenced (Kostanjsek et al., 2004, Corsaro et
al., 2007). In the light of these conflicting findings, the frequent existence of multiple 16S
rRNA genes in bacterial genomes (Acinas et al., 2004), and the possibility of lateral gene
transfer resulting in intragenomic heterogeneity among the latter (Coenye & Vandamme,
2003) it might appear risky to base the taxonomic classification of the entire genus
Rickettsiella upon a single sequence determination. We therefore used information available
from the recently published draft genome sequence of another strain of R. grylli to check for a
corroboration of the above re-assignment of this species.
99
100
Here we report on identification in the genome sequence and use for phylogenetic
analysis of rRNA operons and two more phylogenetic markers, groEL and mucZ, that have
been employed previously to infer bacterial phylogeny at different taxonomic levels. The
highly conserved Hsp60 chaperonin GroEL is ubiquitously distributed throughout the
eubacterial lineage and appears functionally involved in bacterial endosymbiosis (Fares et al.,
2004) and pathogenicity (Garduño et al., 1998). Comparisons of groEL sequences have been
successfully called upon to delineate eubacterial orders (Viale et al., 1994). The mucZ gene
product from Coxiella burnetii induces capsule synthesis (mucoidy) when expressed in
Escherichia coli (Zuber et al., 1995). MucZ proteins are highly variable, and orthologs are
identifiable to date only in a limited subset of the γ-proteobacteria including Legionella
pneumophila. The mucZ gene has been used as a molecular marker to investigate the internal
phylogenetic structure of the very compact genus Coxiella (Sekeyová et al., 1999).
16S rRNA gene as well as MucZ and GroEL protein sequences were identified in the
Rickettsiella grylli draft sequence and further completely annotated genome sequences by,
respectively, BlastN and tBlastN/BlastP searches (Altschul et al., 1997) from the NCBI
homepage using the orthologous sequences from Coxiella burnetii strain RSA493 as query.
Sequence alignments were produced with the CLUSTALW function (Thompson et al., 1994) of
the MEGA 3.1 program (Kumar et al., 2004). The TREE-PUZZLE 5.2 program (Schmidt et al.,
2002) was used to estimate data set specific parameters as nucleotide frequencies, the
percentage of invariable sites, the transition/transversion ratio, and the α parameter for the Гdistribution based correction of rate heterogeneity among sites. Based on these parameters the
most appropriate model of DNA sequence evolution was chosen according to the rationale
outlined by Posada & Crandall (1998), while amino acid sequence evolution models were
directly chosen with the analysis tool implemented in TREE-PUZZLE. Organismal phylogenies
were reconstructed using the PhyML software tool (Guindon & Gascuel, 2003), using the
HKY model of nucleotide substitution (Hasegawa et al., 1985) for the analysis of the 16S
rRNA gene and the JTT model (Jones et al., 1992) for both amino acid sequence alignments.
In all three cases, a Г-distribution based model of rate heterogeneity (Yang, 1993) allowing
for eight rate categories was assumed. Confidence limits for the reconstructed ML tree
topologies were explored in non-parametric bootstrap analyses over 1,000 replicates as
implemented in the PhyML package. Trees were outgroup rooted by the respective sequence
from the δ-proteobacterium Myxococcus xanthus.
In the Rickettsiella grylli genome draft sequence, we identified two rRNA operons comprising
identical 16S rRNA encoding sequences as well as single copies of both the groEL and the
mucZ ortholog. In the case of GroEL proteins from chlamydiae where groEL gene duplication
is the rule (Karunakaran et al., 2003), the paralog showing highest homology (i.e. lowest evalue) to our query sequence (GroEL1) was retained for analysis. Expectedly, mucZ orthologs
were not identified in the genomes of chlamydiae, α-proteobacteria, and the insect associated
γ-proteobacteria Buchnera, Wigglesworthia, and Francisella.
Alignments were generated on the basis of a fragment comprising (in R. grylli
numbering) 1357 nucleotides of the 16S rRNA gene starting and ending with a highly
conserved motif and the complete deduced GroEL and MucZ amino acid sequences. The
Maximum Likelihood gene and protein trees reconstructed from these three data sets are
101
shown in Fig. 1. Both the 16S rDNA and the GroEL tree clearly separate the α- and γproteobacterial and chlamydial clades and place the R. grylli sequence in the γ-proteobacterial
branch. The MucZ tree is not informative at this level due to the lack of chlamydial and αproteobacterial sequences.
Figure 1. Maximum Likelihood tree based on the 16S rRNA genes. Numbers on branches
indicate bootstrap support values. Terminal branches are labeled by genus, species, and strain
designations and Genbank accession number. The label "R. grylli (TIGR)" refers to the
genome project strain mentioned in the text, the label "R. grylli (Roux)" to the strain studied
by Roux et al. (1997).
102
Figure 2. Maximum Likelihood tree based on the GroEL (B) and MucZ (C) protein Numbers
on branches indicate bootstrap support values. Terminal branches are labeled by genus,
species, and strain designations and Genbank accession number. The label "R. grylli (TIGR)"
refers to the genome project strain mentioned in the text, the label "R. grylli (Roux)" to the
strain studied by Roux et al. (1997).
Within the γ-proteobacteria, beyond a certain ambiguity concerning the positions of the
genera Pseudomonas and Francisella, the three trees coincide in placing the respective
Rickettsiella grylli sequences in close vicinity to the maximally supported Coxiella and
Legionella clades, in clear separation from the γ-proteobacterial insect endosymbionts Buchnera and Wigglesworthia as well as from the genus Shewanella. Expectedly, the 16S rDNA
103
sequences from both R. grylli strains form a Rickettsiella clade supported by a 100% bootstrap
value.
Nevertheless, there are conflicting outcomes concerning the exact position of the
respective R. grylli sequences. Both the 16S rDNA tree and the GroEL tree lend moderately
good support to the currently valid concept of a family Coxiellaceae comprising the genera
Coxiella and Rickettsiella, whereas the clade structure of the MucZ tree strongly supports the
idea of a closer phylogenetic association of R. grylli with the genus Legionella.
In conclusion, our study on the one hand strongly supports the current classification of
the species Rickettsiella grylli in the γ-proteobacterial order Legionellales as opposed to
alternative assignments to the orders Rickettsiales or Chlamydiales as well as to a different
taxonomic position within the γ-proteobacteria. On the other hand, our results indicate that
more careful analyses are necessary to decide about the correct position of R. grylli and
possibly the genus Rickettsiella within the Legionellales, particularly with respect to a
corroboration of its currently accepted family level classification.
References
Acinas, S.G., Marcelino, L.A., Klepac-Ceraj, V. & Polz, M.F. 2004: Divergence and
redundancy of 16S rRNA sequences in genomes with multiple rrn operons. J. Bacteriol.
186: 2629-2635.
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D.J.
1997: Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res. 25: 3389-3402.
Coenye, T. & Vandamme, P. 2003: Intragenomic heterogeneity between multiple 16S ribosomal RNA operons in sequenced bacterial genomes. FEMS Microbiol. Lett. 228: 45-49.
Corsaro, D., Thomas, V., Goy, G., Venditti, D., Radek, R. & Greub, G. 2007: ‘Candidatus
Rhabdochlamydia crassificans’, an intracellular bacterial pathogen of the cockroach
Blatta orientalis (Insecta: Blattodea). Syst. Appl. Microbiol. 30: 221-228.
Fares, M.A., Moya, A. & Barrio, E. 2004: GroEL and the maintenance of bacterial endosymbiosis. Trends Genet. 20: 413-416.
Garduño, R.A., Garduño, E. & Hoffman, P.S. 1998: Surface-associated Hsp60 chaperonin of
Legionella pneumophila mediates invasion in a HeLa cell model. Infect. Immun. 66:
4602-4610.
Garrity, G.M., Bell, J.A. & Lilburn, T. 2005: Family II. Coxiellaceae fam. nov. In: Bergey’s
Manual of Systematic Bacteriology, Second Edition, Springer, New York, Vol. II, eds.
Garrity, G.M., Brenner, D.J., Krieg, N.R. & Staley, J.T.: 237-247.
Guindon S. & Gascuel O. 2003: A simple, fast, and accurate algorithm to estimate large
phylogenies by maximum likelihood. Syst. Biol. 52: 696-704.
Hasegawa, M., Kishino, H. & Yano, T.-A. 1985: Dating of the human-ape splitting by a
molecular clock of mitochondrial DNA. J. Mol. Evol. 22: 160-174.
Jones, D.T., Taylor, W.R. & Thornton, J.M. 1992: The rapid generation of mutation data
matrices from protein sequences. Comput. Appl. Biosci. 8: 275-282.
Karunakaran, K.P., Noguchi, Y., Read, T.D., Cherkasov, A., Kwee, J., Shen, C., Nelson, C.C.
& Brunham, R.C. 2003: Molecular analysis of the multiple GroEL proteins of
Chlamydiae. J. Bacteriol. 185: 1958-1966.
Kostanjsek, R., Strus, J., Drobne, D. & Avgustin, G. 2004: `Candidatus Rhabdochlamydia
porcellionis´, an intracellular bacterium from the hepatopancreas of the terrestrial isopod
Porcellio scaber (Crustacea: Isopoda). Int. J. Syst. Evol. Microbiol. 54: 543-549.
104
Kumar, S., Tamura, K. & Nei, M. 2004: MEGA3: Integrated software for Molecular
Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5:
150-163.
Posada, D. & Crandall, K.A. 1998: MODELTEST: testing the model of DNA substitution.
Bioinformatics 14: 817-818.
Roux, V., Bergoin, M., Lamaze, N. & Raoult, D. 1997: Reassessment of the taxonomic
position of Rickettsiella grylli. Int. J. Syst. Bacteriol. 47: 1255-1257.
Schmidt, H.A., Strimmer, K., Vingron, M. & von Haeseler, A. 2002: TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18: 502-504.
Sekeyová, Z., Roux, V. & Raoult, D. 1999: Intraspecies diversity of Coxiella burnetii as
revealed by com1 and mucZ sequence comparison. FEMS Microbiol. Lett. 180: 61-67.
Thompson, J.D., Higgins, D.G. & Gibson, T.J. 1994: CLUSTALW: Improving the sensitivity
of progressive multiple sequence alignment through sequence weighting, positionsspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673-4680.
Viale, A.M., Arakaki, A.K., Soncini, F.C. & Ferreyra, R.G. 1994: Evolutionary relationships
among eubacterial groups as inferred from GroEL (chaperonin) sequence comparisons.
Int. J. Syst. Bacteriol. 44: 527-533.
Weiss, E., Dasch, G.A. & Chang, K.-P. 1984: Genus VIII. Rickettsiella Philip 1956. In:
Bergey’s Manual of Systematic Bacteriology, eds. Krieg, N.R. & Holt, J.G.. Williams &
Wilkins, Baltimore, MD Vol. I: 713-717.
Yang, Z. 1993: Maximum-Likelihood estimation of phylogeny from DNA sequences when
substitution rates differ over sites. Mol. Biol. Evol. 10: 1396-1401.
Zuber, M, Hoover, T.A. & Court, D.L. 1995: Analysis of a Coxiella burnetii gene product
that activates capsule synthesis in Escherichia coli: requirement for the heat shock
chaperone DnaK and the two-component regulator RcsC. J. Bacteriol. 177: 4238-4244.
p. 105
Plant-beneficial pseudomonad with insecticidal activity
Maria Péchy-Tarr1, Esther Fischer2, Monika Maurhofer3, Jürg Grunder2,
Christoph Keel1
1
Department of Fundamental Microbiology, University of Lausanne, CH-1015 Lausanne;
2
Natural Resources Sciences, University of Applied Sciences Waedenswil (HSW), CH-8820
Waedenswil; 3Institute of Integrative Biology, Swiss Federal Institute of Technology (ETH),
CH-8092 Zurich, Switzerland
Abstract: Recent genomic analyses have unraveled that the genomes of certain plant-associated
pseudomonads may harbour loci potentially endowing them with insecticidal activity. Some of them
are related to genes encoding potent insecticidal toxins in Photorhabdus, an endosymbiont of
entomopathogenic nematodes. This is remarkable as plant-colonizing pseudomonads have no known
insect association and some of them protect their host against fungal diseases. To date, virtually
nothing is known about the possible role and potential of the Pseudomonas insecticidal toxin loci.
Recently, we have identified a genomic locus encoding insecticidal activity in a root-associated
Pseudomonas fluorescens biocontrol agent that has potent activity against soil-borne phytopathogenic
fungi. The locus encodes a large protein resembling to some extent to the Mcf (Makes caterpillars
floppy) toxin of Photorhabdus and additional functions presumably required for toxin transport and
regulation of toxin production. We termed the toxin region fit for P. fluorescens insecticidal toxin. To
assess the biological activity of the Fit toxin, we have created a P. fluorescens mutant carrying an inframe deletion in the toxin gene. In addition, we have cloned the Fit toxin gene under the control of an
inducible promoter for controlled expression in a non-toxic Escherichia coli host. We then
demonstrated the potent insecticidal activity of the Fit toxin through a series of bio-tests in which the
effects of P. fluorescens wild-type and fit mutant cells, and fit-expressing E. coli cells were compared
following injection into larvae of the greater wax moth Galleria mellonella. Our work sheds light onto
a promising bacterial reservoir of insecticidal toxins. The fact that the novel insect toxins are produced
by efficient crop plant-colonizers may provide clues to the development of novel pest control
strategies.
Key words: Pseudomonas, roots, toxin
105
p. 106
Insecticidal activity found in plant-beneficial pseudomonas and in
Photorhabdus/Xenorhabdus
Jürg Grunder 1, Esther Fischer 1, Maria Péchy-Tarr 2, Monika Maurhofer 3,
Christoph Keel 2
1
University of Applied Sciences, Natural Resources Sciences, Plant Protection Unit, HSW,
CH-8820 Waedenswil, Switzerland; 2Department of Fundamental Microbiology, University of
Lausanne, CH-1015 Lausanne, Switzerland; 3Institute of Integrative Biology, Swiss Federal
Institute of Technology (ETH), CH-8092 Zurich, Switzerland
Abstract: The research program in Switzerland is working with Pseudomonads spp., Photorhabdus
spp. and Xenorhabdus spp. to screen for bacterial toxins, active for insect control. The long years of
research in the field of disease-suppressive soils identified a bacterial strain of the Pseudomonas group
as one of the key players in the root zone. Fascinating enough, we found interesting homologies
between the soil-inhabiting pseudomonad and the toxin complex of Photorhabdus / Xenorhabdus,
those bacteria being microsymbionts of insect-parasitic nematodes.
The principal objectives are to study the occurrence and diversity of genomic regions encoding
potentially novel insecticidal toxins in plant-associated pseudomonads and to characterize the genetic
organization. Additionally, the toxic activity of Pseudomonas, Photorhabdus, and Xenorhabdus strains
will be included in a screening program to check for effects against different insect pests. This
working program is based on a collection of more than 100 different bacterial strains. The first results
from biological assays that are based on bacterial cell injection into Galleria mellonella will be
presented. Plans are to enlarge the screening activity also in cooperation with industry partners. Within
these bacterial strains, we expect some interesting novel toxins that could be used as biocontrol agents.
Key words: Pseudomonas, roots, Photorhabdus, Xenorhabdus, biotest, screening, toxin
106
p. 107
IS5056, a new Bacillus thuringiensis isolate with entomopathogenic
properties
Izabela Swiecicka,1 Dennis K. Bideshi,2 Brian A. Federici2
1
Depart. of Microbiology, Institute of Biology, University of Bialystok, Bialystok, Poland;
2
Depart. of Entomology, University of California, Riverside, Riverside, California 92521,
USA
Abstract: A new isolate of Bacillus thuringiensis, IS5056, was obtained from soil collected in
northeast Poland. This isolate synthesized large cuboidal crystals during sporulation and was highly
toxic to larvae of Trichoplusia ni, with LC50s of 16.9 and 29.7 µg/ml of diet to, respectively, second
and fourth instars. SDS-PAGE analysis of purified crystals showed that this isolate produced a crystal
protein of approximately 130 kDa. MALDI-TOF sequence analysis of this protein revealed that it
belonged to the Cry1 type. Using primers based on cry1A, a 3.9 kb fragment was amplified by PCR.
Nucleotide sequence analysis showed that the IS5056 δ-endotoxin gene was most closely related to
cry1Ac. Southern blot analysis indicated that this gene was located on a large plasmid in IS5056.
Expression of this gene in B. thuringiensis 4Q7 using the E. coli–B. thuringiensis shuttle vector
pHT3101 yielded a crystal protein identical in mass to that produced by IS5056. In addition,
comparative analysis using gyrB and 16s rRNA sequences suggested that IS5056 is a new
entomopathogenic serotype of B. thuringiensis.
107
p. 108
Development of isolation methods for Bacillus thuringiensis and
evaluation of their ability to inhibit pathogenic bacteria
Sylwia Andrzejczak
Department of Microorganisms Ecology and Environmental Protection. Institute of Genetics
and Microbiology, Uniwersity of Wroclaw. Przybyszewskiego 63, 51-148 Wroclaw
Abstract: The purpose of the COST 862 Short Term Scientific Mission was to gain experience in
identifying Bacillus thuringiensis (Bt) strains by the use of PCR, assess the ability of Bt isolates to
decrease bacterial plant pathogens by producing lactonases that degrade AHLs messenger molecules,
as well as refine and validate new technique for the isolation of Bt strains. 1. Molecular
characterization of Polish isolates relied on identification of Bt strains by 16S rDNA PCR, RFLP
analysis of cry1 genes according to Kuo & Chak (1996) and identification of cry4 genes (Ibarra et al.
2003). Analysis of 16S rRNA sequences of both tested isolates showed, with greater than 95%
certainty that they belong to B. cereus group. RFLP analysis confirmed presence of the cry1 type gene
in 11 strains of Bt. While only three Bt isolates showed the presence of the cry4 type gene. 2. For
detection of the production of acyl homoserine lactones (AHL), quorum sensing signals in plant
pathogenic bacteria, the bioreporter system based on the Agrobacterium tumefaciens strain NTL4
(pCF218) (pCF372) was used (McLean et al. 2004). One strain, Pectobacterium atrosepticum 549,
was found to produce AHL lactones. Polish Bt isolates were used as probable AHLs quenchers,
capable of degrading AHLs signals through synthesis of enzymes – lactonases, destroying signalling
molecules (Dong et al. 2002). Some tested Bt strains exhibited strong AHL-inactivating activity
during the screening study. 3. New technique for the isolation of Bt strains bases on phenomenon of
inhibitory action of serine on growth of some bacterial strains. To refine this technique the effects of
different concentrations of serine on B. thuringiensis KNG06 and B. megaterium MEG001 cells were
studied using a micro-calorimetric methods. Moreover action of serine on enzymes activity in
threonine synthesis pathway was measured spectrophotometrically by following the NADPH
oxidation at 340nm. The results confirmed that Bt strains are resistant to inhibitory action of serine
and this phenomenon could be used for the isolation of new Bt strains.
References
Dong, Y.-H., Gusti, A.R., Zhang, Q., Xu, J.-L. & Zhang, L.-H. 2002: Identification of
Quorum-Quenching N-Acyl homoserine lactonases from Bacillus species. Appl.
Environm. Microbiol. 68: 1754-1759.
Ibarra, J.E., del Rincón, M.C., Ordúz, S., Noriega, D., Benintende, G., Monnerat, R., Regis,
L., de Oliveira, C.M.F., Lanz, H., Rodriguez, M.H., Sánchez, J., Peña, G. & Bravo, A.,
2003: Diversity of Bacillus thuringiensis strains from Latin America with insecticidal
activity against different mosquito species. Appl. Envir. Microbiol. 69: 5269-5274.
Kuo, W.S. & Chak, K.F. 1996: Identification of novel cry-type genes from Bacillus
thuringiensis strains on the basis of restriction fragment length polymorphism of the PCRamplified DNA. Appl. Environ. Microbiol. 62: 1369-1377.
McLean, R.J., Pierson, L.S. & Fuqua, C. 2004. A simple screening protocol for the
identification of quorum signal antagonists. J. Microbiol. Methods 58: 351-360.
108
p. 109
The role of solubilization and proteolytic processing in the mode of
action and insect specificity of Bacillus thuringiensis thompsoni crystal
proteins
Rumyana Boncheva 1, Samir Naimov 1, Rumyana Karlova 2, Ruud A. de Maagd 3
1
Department of Plant Physiology and Molecular Biology, University of Plovdiv, 24 Tsar
Assen Street, Plovdiv, Bulgaria; 2Department of Biochemistry, Wageningen Unversity, 6703
AH, Wageningen, The Netherlands; 3Busines Unit Bioscience, Plant Research International
B.V, P.O. Box 16, 6700 AA Wageningen, The Netherlands
Abstract: B. thuringiensis serovar. thompsoni HD542 crystals consist of two proteins, Cry15Aa and a
40 kDa protein (Brown & Whiteley, 1992). The insecticidal Cry15Aa protein is one of non-typically
organized members of Cry family, and provides a good alternative for insect pest management. There
is a limited knowledge for its biological properties and for interaction with so-called 40kDa protein
co-expressed by the same bacterial strain. The successful solubilization of Cry15Aa/40kda crystals
gives us an opportunity to analyze in more details insecticidal properties of Cry15Aa prior and after
solubilization. The solubilized protoxins were activated by trypsin treatment and also by in vitro
incubation with gut extracts of M. sexta, C. pomonella, P. rapae, S. exigua, and H. armigera.
Digestion for different time periods with optimal concentration of gut proteases from all 5 tested
insects revealed that all gut proteases produce a major protein product with the same apparent
molecular weight. The 40kDa protein in solubilized HD542 crystals was rapidly processed, whereas
Cry15 was processed more slowly and produced protein, which appeared to remain stable for at least
24hrs. SDS-PAGE analyzes displayed a small difference in the sizes of trypsin-treated protein and
digested with gut proteases Cry15, which can be explained with extra cleavage of the proteins in
insects gut by proteases different than trypsin. The products of activation by trypsin and incubation
with gut extracts were further analyzed by in-gel treatment with protease followed by liquid
chromatography to separate the ensuing fragments and mass spectroscopy to determine their molecular
weight. The data revealed that C-terminal processing site is the very same for all activated products.
And we could assume that in vitro treatment with trypsin mimicked the activation by gut proteases. On
the other hand we couldn’t identify the first N-terminal tryptic peptides, which made impossible to
conclude that the product of different activation are the same.
Key words: Bt serovar. Thompsoni, Cry15, mode of action, activation.
References
Brown, K.L. & Whiteley, H.R. 1992: Molecular characterization of two novel crystal protein
genes from Bacillus thuringiensis subsp. thompsoni. J. Bacteriol. 174: 549-557.
109
p. 110
Characterisation of an N terminal Cry1Ac mutant that shows
increased toxicity towards a resistant population of Plutella xylostella
(SERD4)
Mark Bruce1, Neil Crickmore1, Ali Sayyed1, Juan Ferre2
1
School of Life Sciences, University of Sussex, Falmer, Brighton, East Sussex BN1 9QG, UK,
2
Department of Genetics, University of Valencia, 46110-Burjassot, Valencia, Spain
Abstract: A Cry1Ac mutant called TLL has been shown to be more toxic towards a resistant
population of Plutella xylostella (SERD4) compared to wildtype. TLL was created in an attempt to
produce an N terminal cleavage resistant toxin. It has five mutations at trypsin and chymotrypsin
cleavage sites in the N terminus of Cry1Ac (Y13S, L16A, L24A, R28A, Y33A). TLL is resistance to
N terminal cleavage by trypsin, but not by gut extract (from P. xylostella). Gut extract activated TLL
appears to be the same size as gut extract wildtype. TLL was more soluble than wildtype Cry1Ac in
carbonate buffer over a range of pH values. Planar lipid bilayer experiments have shown there is no
significant difference between the pores formed by TLL and wildtype Cry1Ac in terms of size and
stability. BBMV binding studies were unable to detect any significant difference between the binding
of TLL and wildtype Cry1Ac to BBMVs prepared from the SERD4 population. TLL maintains a high
level of toxicity towards SERD4 without significant receptor binding.
Key words: Bacillus thuringiensis, Plutella xylostella, Cry1Ac.
References
Sayyed et al 2005: Common, but complex, mode of resistance of Plutella xylostella to
Bacillus thuringiensis toxins Cry1Ab and Cry1Ac. Appl. Environ. Microbiol. 71. 68636869.
110
pp. 111-116
Integrated biological control strategy to avoid resistance development
of Plutella xylostella against Bacillus thuringiensis
Xiaoli Yi, Sibylle Schroer, Richou Han & Ralf-Udo Ehlers
Institute for Phytopathology, Dept. Biotechnology and Biological Control, ChristianAlbechts-University Kiel, Germany
Abstract: The Diamondback Moth (DBM), Plutella xylostella, is a major pest of crucifers worldwide.
The intensive use of insecticides has promoted rapid evolution of resistance, even against Bacillus
thuringiensis (Bt). For resistance management other biocontrol agents were developed within the EU
Diabolo project. The entomopathogenic nematode (EPN) Steinernema carpocapsae (S.c) strain All
and two insect viruses have potential for control of DBM larvae. S.c infected more than 93.8% of 3rd
DBM 48 h after infection with 100 nematodes/larva. The PxGV (Plutella xylostella Granulosis Virus)
caused 44-90% and the AcMNPV (Autographa californica Multinucleocapsid Nucleopolyhydrosis
Virus) caused 46-72% mortality to 2nd DBM after 5 days at 25°C. It was also found that DBM larvae
developed slowly. The effect of combinations of these biocontrol agents with Bt were tested on
cabbage leaf disks in the laboratory and also in field trials in China (Guangdong Province) and
Indonesia (Java, Bromo Mountain). In leaf disk bioassays all combinations of Bt and nematodes
showed additive effects. Synergistic results were exceptional. In field trials alternating application of
the biocontrol agents was superior for control of DBM over a joint application of Bt and EPN.
Alternating applications of Bt, EPN and virus are a measure to manage resistance development of P.
xylostella against Bt.
Key words: Plutella xylostella, resistance, biocontrol agents
Introduction
The Diamondback Moth (DBM) Plutella xylostella is a major pest of crucifers worlwide. The
widespread use of chemical insecticides caused the elimination of natural enemies of DBM.
This led to increased use of insecticides, resulting in the development of insecticide resistance
in DBM against most synthetic insecticides (Talekar & Shelton, 1993). Bacillus thuringiensis
(Bt) was introduced and due to its overuse during the last 20 years, DBM also developed
resistance also against Bt (Tabashnik et al., 1990). For resistance management other
biocontrol agents were tested within the EU Diabolo Project. The entomopathogenic
nematode (EPN) Steinernema carpocapsae (S.c) and two insect viruses were tested. S.c (All
strain) infected 93.8% of 3rd DBM 48 h after application of 100 nematodes/larva (Cherry et al.
2004) and showed excellent heat (capable of infecting P. xylostella at temperatures up to
32°C) as well as desiccation tolerance (capable of surving <12 h at 70% RH) (Glazer, 2002).
The PxGV (Plutella xylostella GV) caused 44-90% and the AcMNPV (Autographa
californica Multinucleocapsid Nucleopolyhydrosis Virus) caused 46-72% mortality to 2nd
DBM after 5 days at 25°C (unpublished results). It was also found that infected DBM larvae
developed more slowly. The effect of combinations of these biocontrol agents with Bt were
tested on cabbage leaf disks in the laboratory and also in field trials in China (Guangdong
Province) and Indonesia (Java, Bromo Mountain).
111
112
Insect and nematode rearing
Plutella xylostella (population provided by Bayer Crop Science, Monheim, Germany) were
reared on savoy cabbage leaves (Brassica oleracea convar. capitata var. sabauda) at room
temperature. S. carpocapsae (All strain) (provided by e-nema GmbH, Raisdorf, Germany)
was reared in vivo according to the method of Glazer and Lewis (2000).
Bt, virus and insecticide
Four Bt products, two viruses, two insecticide products and a mixture of Bt and virus were
tested (Table 1).
Table 1. Contral agents, product name, potency and source of Bt, viruses and insecticide
products (WP=wettable powder)
Product
Bt var. kurstaki
Dipel ES
Bt var. aizawai
XenTari
Turex®
Bta
Potency
1,76×107 IU ml-1,
emulsible oil
suspension
10,3% Bta, WP
granulate
25,000 IU mg-1 (T.n)
WP
32,000 IU mg-1, WP
Nuclear Polyhedrosis virus of
the alfalfa looper, Autographa
californica
Granulosis virus of P. xylostella
AcMNPV
4×109 PIB g-1,
suspension
PxGV
109 PIB g-1, WP
Bt var. thuringiensis and
Plutella xylostella granulosis
virus
Avermectin/Phoxim
Fipronil
Btt/PxGV
16,000 IU mg-1 +
108 PIB g-1 WP
35% EC
5% suspension
Source
Staehler Agrochemie
GmbH & Co. KG,
Germany
Valent BioSciences
Corporation, USA
Certis, USA
Hubei Center of Bt
R&D, China
Xinan Bio-Technology
Company, China
Huanye Bio-insecticide
Company, China
Nanning Tiangang
Bio-tech Ltd. Co.,
China
Noposion Group, UK
Bayer AG, Germany
Leaf disk bioassay
One ml Bt suspension was sprayed on 2 cm2 cabbage leaf disks with 2,000 hPa pressure using
an air brush nozzle in a cylinder (47.5 cm high, ø16.5cm). Nematode infective juveniles (IJs)
or mixtures of Bt and IJs were sprayed in 40ml suspensions on 2 cm2 cabbage leaf disks using
a flat fan nozzle Teejet® (TP8003E) in 55cm distance with volume-flow of 0.96l min-1 at
2,000 hPa. After spraying leaf disks were transferred into 24er-well plates and one 3rd instar
DBM was added into each well. The wells were incubated at 80% RH and 25°C. The mortality
was evaluated after 48 h. Larvae not responding after a mechanical stimulus were considered
dead. Each treatment was tested with 24 larvae and the experiments were repeated 3 times.
Field trials in China
The cabbages were planted on 31 October. Spraying of cabbage was with a knapsack sprayer at
sunset at days 19, 26, 33 and 46 after cabbage plantation (Table 2). The viruses and IJs of S.c
113
were formulated with 0.5% polyacrylate, 0.3% surfactant and 0.3% xanthan gum. Water only
with the adjuvants was used as a control. The area for each treatment was approximately 60 m2.
The number of living larvae and pupae of the DBM was checked randomly from 60 samples of
cabbage plants from each treatment.
Table 2. The time of application, biocontrol agent, insecticides and their dosages
Cabbage
age (days)
19
26
33
46
Treatments
Control agents
Dosages
Treatment 1
Treatment 2
Treatment 3
Treatment 4
Treatment 5
Treatment 1
Treatment 2
Treatment 3
Treatment 4
Treatment 5
Treatment 1
Treatment 2
Treatment 3
Treatment 4
Treatment 5
Treatment 1
Treatment 2
Treatment 3
Treatment 4
Treatment 5
Avermectin/Phoxim
AcMNPV
PxGV
Bta
Water
Avermectin/Phoxim
AcMNPV
PxGV
Bta
Water
Fipronil
Bta
S. carpocapsae All
PxGV
Water
Fipronil
Bt/PxGV
Bt/PxGV
Bt/PxGV
Water
1.1 l ha-1
1,650 larvae ha-1
1,650 larvae ha-1
1.65 kg ha-1
1650 l ha-1
1.13 l ha-1
1,650 larvae ha-1
1,650 larvae ha-1
1.65 kg ha-1
1,650 l ha-1
675 ml ha-1
2.0 kg ha-1
6×109 IJs ha-1
2,025 larvae ha-1
2.0 l ha-1
810 ml ha-1
2.0 kg ha-1
2.0 kg ha-1
2.0 kg ha-1
2,000 l ha-1
Field trials in Indonesia
Plots each containing 100 plants, were randomly selected in fields A (planted Febr. 9) and C
(planted Jan. 2). Treatments were weekly, alternating, beginning with 80,000 S. carpocapsae per
plant (corresponding to 0.5 million IJs m-2) using a knapsack sprayer with 6 mm flat fan nozzle
before sunset, followed by 0.1 g Turex® per plant. The other treatments received Bt in weekly
intervals at the same concentration. Another treatment received the same amount of EPN and Bt
together in one treatment every fortnight. Control trials were treated with water. The trial in field
A was repeated once, the first sprayed on March 9 with 30 days-old plants and the second on
March 15 with 36 days-old plants. Treatments in field C were conducted with 66 days-old
cabbage treated on March 6. Before the treatment and 3, 7, 10, 14 and 21 days after the first
treatment 5 plants per plot were randomly selected and the number of living DBM larvae per
plant was recorded.
Statistical analysis
For the leaf disk bioassay the expected mortality for additive effects (Pe) was calculated using Pe
= 1- (1- P1)(1- P2) (Finney,1971). P1, P2 was the mortality of single component which was
corrected according to Abbott (1925). The expected number of dead larvae for additive effect
(De) was calculated using De = Pe × total number of larvae. Statistic analysis of difference to
additive effect was carried out with Fisher’s exact test. If the difference between expected and
114
observed number of dead larvae (De and Do) in combination was significant, then the interaction
of single component in combination was not additive, but antagonistic if De > Do or synergistic if
De < Do (Table 3).
For the field trials the data were analysed using ANOVA with significant level at P < 5%
and analysed using Duncan’s multiple range test.
Table 3. Criteria for the interaction (according to Finney, 1971)
significant difference between De and Do
no significant difference between De and Do
De > Do
De < Do
De = Do
Antagonism
Synergism
additive effect
De: expected number of dead larvae for additive effect in combination
Do: observed number of dead larvae in combination (corrected according to Abbott, 1925)
Leaf disk bioassay
We tested 4 different combinations. For the calculation of the interaction not only the effect of
combinations, but also the effect of single components in combination against DBM were
tested. In 17 tests there were 2 synergisms (12%), 1 antagonisms (6%) and 14 additive effects
(82%). Mostly additive effects were recorded at combinations of Bt (Btk, Bta) and EPN.
Synergistic effects could be exploited by reducing the concentration and thus reducing
application costs. However, synergistic effects were exceptional and additive effects were the
rule (Table 4). The use of combination thus has no advantanges over combinations, to the
contrary, for resistence management combinations should be avoided but agents should be
alternated.
Table 4. Interaction of combined agents against 3rd instar P. xylostella at 80% RH and 25°C.
Single larvae were treated with single agents or combined agents in water in 24-well dishes.
Interaction was calculated according to Finney (1971) and Fisher’s exact test.
Combination
Dipel (20ng cm-2) + XenTari (20ng cm-2)
Dipel (20ng cm-2) + S.c All (5 larva-1)
XenTari (20ng cm-2) + S.c All (5 larva-1)
XenTari (10mg l-1) + S.c All (3 larva-1)
repeat
5
4
4
4
additive
4
3
4
3
interaction
syner- Antagogism
nism
1
1
1
spray method
Mixed
one after another
one after another
Mixed
Field trials in China
Four sprays were made during the cabbage growth season (53 days). The first spray was applied
19 days after planting the cabbage when DBM were first found in the field. The next three sprays
were applied at days 26, 33 and 46 when the population on the control cabbages increased
markedly. From the second spray to the harvest of the cabbages DBM populations treated with
various agents were controlled at a very low level (0.18-0.60 larvae plant-1) when compared
with the control population (0.93-1.98 larvae plant-1) (Fig. 1). There were no differences between
115
the treatments.These experiment demonstrated that the effect of biocontrol agents against DBM
is comparable with the chemical insecticides. Avermecthin and Fipronil are new compounds and
resistance had not yet developed against these products. The biocontrol agents can be used to
substitute the chemical control.
Number P. xylostella/plant
2
1,6
1,2
0,8
0,4
0
18
25
32
39
42
45
49
53
Cabbage crops age (days)
Tre atme nt 1
Tre atme nt 2
Tre atment 3
Tre atment 4
Tre atment 5
Treatment 1: Avermectin/Phoxim (day 19, 26), Fipronil (day 33, 46)
Treatment 2: AcMNPV with adjuvants (day 19, 26), Bta (day 33), Btt/PxGV(day 46)
Treatment 3: PxGV with adjuvants (day 19, 26), S.c All with adjuvants (day 33), Btt/PxGV (day 46)
Treatment 4: Bta (day 19, 26), PxGV with adjuvants (day 33), Btt/PxGV (day 46)
Treatment 5: Control (water with adjuvants)
Figure 1. DBM density after treatment with chemicalsand biological agents. Arrows indicate
date of spraying. The number of living DBM was checked randomly from 60 cabbage plants
from each treatment
Table 5. Abbott corrected mortality (%) at different time after treatment with Bt alone or in
combination with S.c All. Sixty-six days-old plants received a weekly treatment of 0.625 g m-2 of
Turex® (Bt), alternating treatments with 0.5 million S. c. m-2 followed by 0.625 g m-2 Turex®
(EPN / Bt) or one treatment with the same amount of Turex® and nematodes (EPN + Bt) every
fortnight. Number of larvae was recorded selecting 5 plants at random per plot. Plants had been
treated with any insecticides before the experiment.
Treatment
Bt
EPN / Bt
Bt+EPN
3d
0
0
0
7d
45.1
80.7
77
Days after the first treatment
10d
14d
58.5
68.4
74.6
79.3
29.5
61.4
17d
55.4
57.4
64.6
21d
84.6
82.2
58.5
Field trials in Indonesia
Table 5 presents the results obtained in field C with 66-day old cabbage plants. The treatments
with Bt alone and with alternating treatments of EPN and Bt reached the highest mortality with
84.6 and 82.2% control 21 days after the first application, respectively. No significant differences
were recorded between the different treatments. The other two trials in field A showed similar
116
results (data not shown). Results from leaf disk bioassys and the field trial indicate that
combined applications of Bt and EPN is not feasible. The alternating applications of Bt, EPN
and virus are a powerful and reliable tool to avoid or retard development of Bt resistance in P.
xylostella.
Acknowledgements
This research was part of the EU-INCO Project DIABOLO “An integrative strategy for the
sustainable control of Diamondback Moth (Plutella xylostella) by conservation of natural
enemies and application of biocontrol agents“. We acknowledge the financial support by the EU
(contract number ICA4-2001-10003), by the Technology Foundation Schleswig-Holstein and
DAAD. Thanks are also due to the team at the Guangdong Entomological Institute in China and
University Jember in Indonisia.
References
Abbott, W.S. 1925: A method for computing the effectiveness of an insecticide. Econ. Entomol.
18: 265-267.
Cherry, A.J., Mercadier, G., Meikle, W., Castelo-Branco, M. & Schroer, S. 2004: The role of
entomopathogens in DBM biological control. In: Improving biocontrol of Plutella xylostella
- Proceedings of the International Symposium, Montpellier, France, 21-24 October, 2004.
Eds. Kirk, A.A. & Bordat, D., CIRAD: 51-70.
Finney, D.J. 1971: Probit Analysis. London, England, UK, Cambridge Univ. Press: 246-247
Glare, T.R. & O’Callagham, M. 2000: Bacillus thuringiensis: Biology, Ecology and Safety. John
Wiley & Sons, Chichester: 3
Glazer, I. 2002: Survival biology. In: Entomopathogenic nematology. Ed. Gaugler, R., CABI
Publishing, Oxon, UK: 169-187.
Glazer, I. & Lewis, E.E. 2000: Bioassays for entomopathogenic nematodes. In: Bioassays of
entomopathogenic microbes and nematodes. Navon, A. and Ascher, K.R.S., CAB
International: 229-247.
Tabashnik, B.E., N. Finson, et al. 1990: Diamondback moth resistance to Bacillus thuringiensis
in Hawaii. Diamondback moth and other crucifer pests – Proceedings of the 2nd International Workshop, Tainan, Taiwan, 10-14 December 1990. A. V. R. a. D. Center: 175-183.
Talekar, N.S. & Shelton, A.M. 1993: Biology, ecology, and management of the diamondback
moth. Annu. Rev. Entomol. 38: 275-301.
p. 117
Study of the mechanism of resistance to Bacillus thuringiensis Cry3A
toxin in a natural population of the leaf beetle, Chrysomela tremulae
(Coleoptera: Chrysomelidae)
Manuella van Munster1, Sylvie Augustin2, Claudine Courtin2, Denis Bourguet3,
David Pauron1
1
Institut National de la Recherche Agronomique, U.M.R. ROSE, 400 route des Chappes,
06903 Sophia Antipolis; 2Institut National de la Recherche Agronomique, Centre de
Recherches d’Orléans, Unité de Zoologie Forestière, Ardon, 45166 Olivet; 3Institut National
de la Recherche Agronomique, UMR CBGP, Campus International de Baillarguet, 34988
Montferrier-sur-Lez.
Abstract: Cry toxins of Bacillus thuringiensis (Bt) represent a class of bioinsecticides that are
attractive alternatives to broad-spectrum chemicals. The high specificity, potency, and environmental
safety of Cry toxins have led to their wide use in sprayable Bt formulations or transgenic crops.
However, evolution of resistance is the main threat to the widespread commercial use of Bt toxins. In
a field population of the leaf beetle Chrysomela tremulae, highly resistant individuals able to survive
on transgenic Cry3A-Bt poplar were identified. Genetic analyses showed that resistance to Cry3A
toxin was almost completely recessive and conferred by a single autosomal gene. To get more insight
in the identification of the resistance mechanism, in vitro binding experiments using a biotinylated
derivative of Cry3A on membranes prepared from midguts (BBMV) of susceptible and resistant L3
larvae C. tremulae were done. Results show that Cry3A binds specifically on BBMV isolated from
susceptible larvae while almost no binding can be detected in the case of BBMV from resistant ones
suggesting that an alteration in the binding site is responsible for such resistance. Following work will
focus on the isolation and characterization of the receptor using molecular and biochemical
techniques, thus allowing the first characterization of a Cry toxin receptor in coleopteran insects.
Key words: Bacillus thuringiensis, resistance, Chrysomela tremulae
117
pp. 118-121
Efficacy of submultiples doses of Bacillus thuringiensis compounds
against Lobesia botrana (Lepidoptera, Tortricidae)
D.C. Kontodimas, O. Anastasopoulou, M. Anagnou-Veroniki
Benaki Phytopathological Institute, Department of Entomology & Agricultural Zoology,
Laboratory of Insect Microbiology and Pathology, 8 St. Delta, 145 61, Kifissia, Greece
Abstract: The efficacy of submultiples doses of some Bacillus thuringiensis compounds on the grape
berry moth Lobesia botrana (Denis & Schiffermüller) (Lepidoptera, Tortricidae) was investigated in
laboratory. The products tested were: Agree WP (B. thuringiensis subsp. kurstaki/subsp. aizawai),
Thuricide WP (B.t. subsp. kurstaki), Xentari WG (B.t. subsp. aizawai), BMP 123 WP (B.t.
encapsulated d-entotoxin). Six trials (and six repetitions in each trial) of each product were carried out
under laboratory conditions (temperature: 26±1oC, relative humidity: 60±2% and photoperiod: 16h
light / 8h dark). Six solutions (recommended, 1/2, 1/4, 1/8, 1/16 and 1/32 of the recommended dose) of
each compound were mixed with the diet of the pest. The experiment was conducted with second
instar larvae. Three days after the treatment, the mortality of L. botrana larvae in the recommended
dose for Agree, Thuricide, Xentari and BMP was 82, 92, 93 and 54 % respectively, and after seven
days 95, 93, 100 and 88 % respectively. In the lowest dose, three days after the treatment the mortality
was 41, 51, 64 and 11% and seven days after 53, 67, 100 and 41%, respectively.
Key words: Bacillus thuringiensis, Lobesia botrana
Introduction
A lot of commercial compounds of Bacillus thuringiensis have been used against the grape
berry moth Lobesia botrana (Denis and Schiffermüller) (Lepidoptera, Tortricidae) by various
researchers (Ifoulis and Savopoulou-Soultani 2004, Moschos et al. 2004, Roditakis 1986,
2003, Anagnou & Kontodimas 2003, Neves & Frescata 2001, du Fretay & Quenin 2000,
Charmillot et al. 1992). In the present study four commercial compounds of B. thuringiensis
(Dipel, Thuricide, Xentari, Agree) were evaluated. All products were applied in doses 1/32 1/1 of the recommended dose in order to be evaluated the possibility of application of lower
doses for the control of L. botrana.
For the evaluation of the B. thuringiensis compounds against L. botrana have been tested the
following commercial products: Xentari WG (B. thuringiensis ssp. aizawai), Thuricide WP
(B. thuringiensis ssp. kurstaki), Agree WP (B. thuringiensis ssp. kurstaki x B. thuringiensis
ssp. aizawai) and BMP 23 WP (B. thuringiensis encapsulated d-endotoxin). For each
commercial product six trials (with six doses and three repetitions in each trial) (Table 1) were
carried out in plastic cylindrical vials 8 cm height and 3 cm width under laboratory conditions
(temperature: 26±1oC, relative humidity: 60±2% and photoperiod: 16h light/ 8h dark). The
products were mixed with the diet of the pests (in 57g of artificial diet were added 3g of
solution for each dose). The artificial diet of L. botrana was a mixture of water (1200ml), agar
(32g), corn flour (224g), cereal germs (56g), yeast (60g), ascorbic acid (8g), nipagine (4g),
118
119
sodium benzoate (4g) and formaldehyde (3,2ml). Each repetition has been carried out by
adding 50 second-instar larvae to the mixtured diet. In addition six vials for each insect, with
50 second-instar larvae in each vial and normal diet were the controls. The mortality of the
larvae has been observed after three days and after one week. Mortalities after seven days
have been compared by Tukey – Kramer (HSD) test (Sokal & Rohlf 1995) using the
statistical package JMP (Shall et al. 2001). The efficacy has been calculated by Abbott’s
formula (Abbott 1925, Kurstak 1982):
Table 1: The doses of B. thuringiensis compounds that have been tested.
Dose
(% of the
recommended)
100
Xentari
(g / lt)
Thuricide
(g / lt)
Agree
(g / lt)
BMP
(g / lt)
0,5
1
1
1
50
0,25
0,5
0,5
0,5
25
0,125
0,25
0,25
0,25
12.5
0,0625
0,125
0,125
0,125
6.25
0,03125
0,0625
0,0625
0,0625
3.125
0,015625
0,03125
0,03125
0,03125
The results after three and seven days are presented in the Fig. 1 and Table 2). Three days
after the treatment the mortalities of L. botrana larvae in the recommended doses for Agree,
Thuricide, Xentari and BMP were 82, 92, 93 and 54%, respectively. In dose 3,1% of the
recommended the mortalities were 41, 51, 64, and 11%, respectively. Seven days after
treatment the mortalities of L. botrana in the recommended doses were 95, 93, 100, and 88%,
respectively. In the lowest doses, seven days after the treatment, the mortalities were >41%
for all compounds. No mortality was observed in the controls, so the efficacies of the
compounds were equal to the caused mortalities. Considerably effective was recorded for the
compound Xentari. After three days it caused a mortality between 64-93% in the doses from
3,1-100% of the recommended. This compound after seven days caused mortality 100% in all
doses. Similar results have been reported from other studies (Anagnou-Veroniki &
Kontodimas 2003, Du Fretay & Quenin 2000, Keil et al. 1998). The relatively high mortality
in the low doses lead us to test the effectiveness of combinations of B. thuringiensis and other
biological compounds (e.g. azadirachtin) against L. botrana. In two studies the synergistic
effect of B. thuringiensis in combination with azadirachtin against the lepidopterous pests
Spodoptera litura (Fabricius) and Helicoverpa armigera (Hübner) (Noctuide)
(Venkadasubramanian & David 1999) and Cnaphalocrocis medinalis (Crambidae) (Nathan et
al. 2004) has been reported.
120
100%
100%
after three days
X e n ta r i
T h u r ic id e
80%
80%
60%
60%
40%
40%
20%
20%
0%
0%
3 .1 2 5
6 .2 5
1 2 .5
25
50
100
3 .1 2 5
6 .2 5
1 2 .5
25
50
100
25
50
100
100%
100%
BM P
Agre e
80%
80%
60%
60%
40%
40%
20%
20%
0%
0%
3 .1 2 5
6 .2 5
1 2 .5
25
50
100
3 .1 2 5
6 .2 5
100%
1 2 .5
T h u r ic id e
X e n ta r i
100%
80%
80%
60%
60%
40%
after seven days
40%
20%
20%
0%
0%
3 .1 2 5
6 .2 5
1 2 .5
25
50
3.125
100
6.25
12.5
25
50
100
100%
100%
BM P
Agre e
80%
80%
60%
60%
40%
40%
20%
20%
0%
0%
3 .1 2 5
6 .2 5
1 2 .5
25
50
100
3 .1 2 5
6 .2 5
1 2 .5
25
50
100
Figure 1. Mortality (%) of Lobesia botrana larvae three and seven days after exposure in
Bacillus thuringiensis compounds in doses 3.125-100% of the recommended dosage
Table 2. Mortality (%) of Lobesia botrana larvae seven days after application and comparison
by Tukey – Kramer (HSD) test.
Dose (% of the
recommended)
100
50
25
12.5
6.25
3.125
Xentari
Thuricide
Agree
BMP
100a
100a
100a
100a
100a
100a
93b
91b
84c
85c
82c
67d
95b
91b
83c
79c
71d
53e
88b
64d
57e
53e
50e
41f
121
References
Abbott, W. S. 1925: J. of Economic Entomology 18: 265-267.
Anagnou-Veroniki, M. & Kontodimas, D.C. 2003: IOBC/WPRS Bulletin 26(8): 117-119.
Charmillot, P.J., Pasquier, D., Antonin, P. & Mittaz, C. 1992: Rev. Suisse de Viticult.,
d'Arboricult. Horticult. 24: 109-116.
du Fretay, G. & Quenin, H. 2000: IOBC/WPRS Bulletin 23 (4): 175-177.
Ifoulis, A.A. & Savopoulou-Soultani, M. 2004: J. of Economic Entomology 97: 340-343.
Keil, S., Schruft, G. & Blaise, P.1998: IOBC/WPRS Bulletin 21 (2): 63-65.
Kurstak, E. 1982: Microbial and Viral Pesticides. Marcel Dekker, Inc., New York: 720 pp.
Moschos, T., Souliotis, C., Broumas, T. & Kapothanassi, V. 2004: Phytoparasitica 32: 83-96.
Nathan, S.S., Chung, P.G. & Murugan, K. 2004: Phytoparasitica 32: 433-443.
Neves, M. & Frescata, C. 2001: IOBC/WPRS Bulletin 24(7): 109-111.
Roditakis, N.E. 1986: Entomologia Hellenica 4: 31-35.
Roditakis, N.E. 2003: IOBC/WPRS Bulletin 26(8): 145-146.
Shall, J., Lehman, A., Creigthon, L. & Start, J.M.P. 2001: Statistics. A Guide to Statistics and
Data Analysis Using JMP and JMP IN Software. Duxbury Press, Ames: 524 pp.
Sokal, R.R. & Rohlf F.J. 1995: Biometry, 3rd ed. Freedman, New York: 887 pp.
Venkadasubramanian, V. & David, P.M.M. 1999: J. Biol. Control 13: 85-92.
p. 122
Acaricidal activity of Bacillus thuringiensis toxins against mite pests
Rotislav Zemek1, Jan Hubert2
1
Institute of Entomology, Biology Centre AS CR, Branisovska 31, 370 05 Ceske Budejovice, Czech
Republic, 2Crop Research Institute, Drnovska 507, Prague, 161 06 Czech Republic
Abstract: Toxins from entomopathogenic bacterium Bacillus thuringiensis Berliner (Bt) proved to be
effective against many insect pests and several formulations are widely used in pest control
programes. Besides their applications as spray, new methods of genetic engineering allowed to
incorporate genes from different subspecies of Bt directly into the plants. These genes encode
synthesis of Cry proteins making the plants either fully or partly resistant against specific insect pests.
Bt transgenic plants are commercially available since the mid 1990s and the percentage of the global
agricultural area where they are grown is rapidly increasing. Although the activity of Bt toxins is
known to be restricted to a few species within one particular order of insects, the effect on other (nontarget) organisms can not be ruled out as the mode of action is still not understood well enough. In this
paper, we summarize results of studies describing the effects of Bt in forms of whole bacteria, purified
proteins or proteins delivered via transgenic plants on mites (Acarina) of economical importance.
Some observations indicate that Bt can affect phytophagous mites. For example, Bt exotoxin applied
as spray was effective against mobile stages of tetranychid mites (Neil et al., 1987) and transgenic
plants with coleopteran-active Cry3 toxins were reported to affect the two-spotted spider mite
(Zemkova et al., 2005). On the other hand, several studies reported no significant effects of Bt toxins
on pest species belonging to families Tetranychidae, Acaridae and Pyroglyphidae when toxins were
either delivered via transgenic plants or applied in laboratory experiments. Future research should
reveal if acaricidal properties of Bt biopesticides and/or Bt transgenic plants have any implication for
pest control of mites. Searching for new, mite-specific strains of B. thuringiensis by their isolation
from naturally infected specimens is another challenging task.
This work was supported by STSM of the Cost Action 862.
Key words: acari, transgenic plants, pest control, Bacillus thuringiensis.
References
Neal, J.W., Lindquist, R.K., Gott, K.M. & Casey, M.L. 1987: Activity of the thermostable
beta-exotoxin of Bacillus thuringiensis Berliner on Tetranychus urticae and T.
cinnabarinus. J. Agric. Entomol. 4: 33-40.
Zemkova Rovenska, G., Zemek, R., Schmidt, J.E.U. & Hilbeck, A. 2005: Altered host plant
preference of Tetranychus urticae and prey preference of its predator Phytoseiulus
persimilis (Acari: Tetranychidae, Phytoseiidae) on transgenic Cry3Bb-eggplants. Biol.
Control 33: 293-300.
122
pp. 123-126
The efficiency of some biological insecticides against the Potato Tuber
Moth Phthorimaea operculella (Ζeller) (Lepidoptera: Gelechiidae) in
organic potatoes in Cyprus
Vassilis A. Vassiliou
Agricultural Research Institute, Plant Protection Section, P.O. Box 22016, 1516 Nicosia,
Cyprus
Abstract: Potato Tuber Moth Phthorimaea operculella (Zeller) is the most destructive pest of potato
Solanum tuberosum L. in Cyprus, both in the field and store. The purpose of this study was to conduct
a comparative evaluation of the efficiency of the biological insecticides M-Pede® (fatty acids),
Thuricide® (Bacillus thuringiensis product), and Neemex (neem seed extracts). Trials were carried out
in the field. Compared to the untreated control, Thuricide appeared to be the most effective compound
with less damaged potato tubers, followed by Neemex, M-Pede and Neemex with Thuricide mixed.
Thuricide and the control showed damage of 0.04 ± 0.02 and 0.34 ± 0.02, respectively. A high rate of
damage in the untreated control was observed throughout the trial years, reaching 26.0, 40.3 and
24.4% in 2004, 2005 and 2006, respectively.
Key words: Phthorimaea operculella, potatoe, Cyprus, Bacillus thuringiensis
Introduction
Potato is an important crop in Cyprus (131.000 tons in 2004) (Markou and Papadavid, 2007).
Potato Tuber Moth (PTM), Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae) is
considered one of the most serious pests on Potato - Solanum tuberosum L and other
solanacean crops. An infested tuber can be identified by faeces at the entrance of insect
galleries. Together with secondary bacterial infections it excludes tubers from consumption or
use as seed (Krambias, 1979). PTM occurs worldwide, either in the field or in stores, and is
most prevalent in sub-tropical and tropical latitudes. In Cyprus, PTM was probably introduced
during World War I in bags that previously contained infested potatoes or in infested tubers
(Morris, 1933). On Cyprus, two potato crops are grown per year; in Spring (harvest from
April to June) and the Autumn (harvest from November to December). The pest develops
between 6-10 generations per year; some of them develop under storage conditions
(Krambias, 1979). Stored potatoes can suffer severe damage all year round and this is because
the population continues to breed throughout the year. The length of the life cycle depends on
the storage temperature. The present study aimed to determine the efficiency of some
biological insecticides in protecting the organic grown potato crops from PTM.
Location and applications
The study was conducted at the Acheleia Experimental Station of the Agricultural Research
Institute in the Paphos district (Western coastal area of the island, latitude, 34.74, Longitude,
32.48). Field trials were carried out during 2004-2006 at the experimental fields on potato
Solanum tuberosum cv. Cara from the end of April until the end of May – beginning of June,
because this is the main potato production season in Cyprus.
123
124
The test was arranged in a Randomized Complete Block design (RCB) with four
treatments plus an unsprayed control and four replicates of each treatment. Each plot
consisted of six rows of plants, each 10 m long. Two rows were left to separate the blocks and
also to avoid drifting. The products and the dosages used in 100 litres of water were the
following: M-Pede® (Potassium salts of fatty acids) at the dosage of 2000 cc, Neemex
(azadirachtin 0.3%, W/W) at the dosage of 60 cc, Thuricide® HP (Bacillus thuringiensis Ber.
var. kurstaki 16000 IU/mg, WP), at the dosage of 100 g and Neemex and Thuricide at the
dosage of 60 cc and 100 g. No compounds were used in the untreated control. In all cases, a
spreader/sticker to enhance product coverage on leaves was used. The dosages used were
those that are recommended by the manufacturers. In Cyprus, these biological control agents
are registered for use in organic agriculture.
A high pressure applicator Unifarm (Udor Srl, 42048, Via A. Corradini 2, Rubiera, Italy)
with capacity of 500 litres was used. The tank was used only for biological compounds and
was equipped with one hose of 50 m and a Gamma-95 high pressure plunger pump
(maximum pressure – 60 bar; flow rate – 73.5 l/min). The applications have been conducted
by using a high pressure spraying gun with standard nozzle (2mm) for general foliage
spraying of insecticides. The spraying pressure used in our trials was 2.0 bars.
In all years, seed planting took place in mid January. Biological insecticides were used in
early morning; three applications were employed in 7-day intervals. They were applied on
20/5/04, 27/5/04 and 1/6/04; on 17/5/05, 24/5/05 and 30/5/05; and on 27/4/06, 4/5/06 and
11/5/06. Tuber harvest was conducted on June 6, 2004; June 2, 2005; and May 18, 2006. All
tubers collected from the field were packed in sacks of 25 kg and carried to the laboratory for
further examination. After all tubers have been examined carefully one by one, damage (%)
and the effectiveness of the applied biological insecticides were assessed.
Trapping
The determination of the population densities of the PTM was achieved by monitoring the
moth captures in three regular Delta-type pheromone traps that had been placed in various
potato untreated plots and other locations within the experimental station. The traps were
placed 50 m apart and fixed on wooden sticks. All pheromone traps were monitored weekly
and, in some occasions (i.e. after rain), twice a week. The moth captures were recorded as the
mean number of captured moths/trap/week. The pheromone dispensers Pherocon® containing
1mg of synthetic pheromone (Trécé®, Inc. Salinas, CA, USA) were renewed every 2 weeks.
Statistical Analysis
Treatments were pooled to provide an average measure of the PTM damage. Statistical
analysis and comparisons were performed by ANOVA (SAS, 2002). When F values were
significant (p<0.05), means were compared using Fisher’s Least Significant Difference (LSD)
test.
The moth trapping in the untreated control indicate that the pest population density was in
numbers that causes serious damage (Fig. 1). Monitoring with pheromone traps showed that
from the date of trap installation (30/4/04, 3/5/05, and 23/3/06) until the tuber harvest (6/6/04,
2/6/05, and 18/5/06), a total of 182, 242 and 136 males were trapped in 2004, 2005, and 2006,
respectively. The majority of males was caught during the first decade of May.
125
Moth captures in 2004
Mean males/week
35
30
25
20
15
10
5
0
30/04/04
06/05/04
12/05/04
18/05/04
24/05/04
30/05/04
Date
Mean males/week
50
40
30
20
10
0
03/05/05
08/05/05
13/05/05
18/05/05
23/05/05
28/05/05
28/04/06
07/05/06
Date
Mean males/week
20
15
10
5
0
23/03/06
01/04/06
10/04/06
19/04/06
Date
Figure 1. Male trapping of PTM at the Acheleia Experimental Station in 2004-2006
Assessing the potential of biocontrol agents against PTM under field conditions, Thuricide and Neemex were statistically superior compared to the untreated control. The most
efficient reduction of tuber infestation was obtained with Thuricide (Tab. 1). Significant
differences were observed between Thuricide, the other treatments and the untreated control.
In the treatment with Thuricide, real damage caused by PTM was estimated at 9.7, 2.7 and
1.8%, while the control was estimated at 26.0, 40.3, and 24.4% in 2004, 2005, and 2006,
respectively (Table 1). Damage was estimated at 4% ± 2 and 34 % ± 2, respectively.
Satisfactory results were also obtained with Neemex with a damage of 13.4, 6.5, and 3.6% in
2004, 2005, and 2006, respectively.
The continuous use of broad spectrum insecticides in Cyprus can lead to resistance,
environmental contamination, health hazards, and danger to consumers (Niroula and Vaidya,
2004). The results indicate that infestation can be significantly reduced through three
successive applications with Bt and Neemex. Synergism was not observed upon using
combination of the two agents. Bt kurstaki can be an alternative to chemical compounds in
order to manage resistance development, however, treatments must be directed to the leaves
in order to kill larvae. Bt should be applied 2-3 days after the peak of occurance of males in
pheromone traps because Bt is most effective against newly hatched larvae.
126
Table 1. Potato tuber infestation caused by the Potato Tuber Moth in 2004-2006 (means ±
SE).
Treatment
Μ-Pede
Neemex
Thuricide
Neemex +
Thuricide
Control
Mean
1
2004
No of Infested %
tubers
checked
736
152 20.7
730
98
13.4
679
66
9.7
779
163 20.9
922
769.2
240 26.0
143.8 18.1
2005
No of Infested %
tubers
checked
850
55
6.5
1005
65
6.5
991
27
2.7
853
68
8.0
760
891.8
306 40.3
104.2 12.8
2006
No of Infested %
tubers
checked
735
35
4.8
788
28
3.6
763
14
1.8
747
29
3.9
966
799.8
236
68.4
24.4
7.7
Damage1
% Means
± SE
10 ± 2 b
7 ± 2 bc
4±2c
9 ±2 b
34 ± 2 a
Means within a column followed by the same letter are not significantly different (Student’s t-test)
The most important advantage of Bt is that it poses no health risk to humans (farmers,
consumers), birds, most of beneficial insects and it is safe on potatoes destined for
consumption.
Acknowledgements
I gratefully acknowledge the Acheleia’s Experimental Station and the Plant Protection
Section’s staff for their assistance in conducting this study.
References
Krambias, A. 1979: The development of an integrated control programme for potato tuber
moth in Cyprus. Ph.D Thesis, University of Reading, Dep. of Zoology. 212 pp.
Markou, M. & Papadavid, G. 2007: Norm Input - Output. Agricultural Economics Report 46.
Agricultural Research Institute, Nicosia.
Morris, H.M. 1933: Potato tuber moth (Phthorimaea operculella) (Zell). Cyprus Agr. J. 28:
111-115.
Niroula, S.P. & Kamini Vaidya 2004: Efficacy of some botanicals against Potato tuber moth,
Phthorimaea operculella (Zeller, 1873). Our Nature 2: 21-25.
SAS, 2002: JMP Statistical V.4.0.2 for Windows. SAS Institute Inc., Cary, NY.
pp. 127-130
Sublethal effect of Bt-maize in semi-artificial diet on European corn
borer larvae, Ostrinia nubilalis (Hübner, 1796) (Lepidoptera,
Crambidae)
Ľudovít Cagáň, Marek Barta
Department of Plant Protection, Slovak University of Agriculture, Tr. A. Hlinku 2, Nitra
94901, Slovak Republic
Abstract: A laboratory study was conducted to determine the effect of Bt maize (Cry1Ab, event MON
810) incorporated in a standard semi-artificial diet on larval development and survival of different
European strains of Ostrinia nubilalis. The strains originated from 2 different localities in Serbia and
Slovakia, 1 locality in Germany, Romania and Austria. A simple method was designed to evaluate Bt
maize tissue consuming on development of O. nubilalis larvae in laboratory conditions. The larvae
were reared on semi-artificial diet enriched with powder of Bt maize leaves. The bioassay demonstrated slower development of larvae on Bt diet and higher mortality of larvae when compared to
individuals reared on non-Bt diet. The range of variation in larval development and survival was great
and indicated a natural variation in Bt susceptibility among geographically distinct populations of O.
nubilalis.
Kex words: Ostrinia nubilalis, Bt crop, resistance
Introduction
European corn borer, Ostrinia nubilalis (Hübner, 1796), is the most damaging insect pest of
maize (Zea mays L.) in the world. There are several traditional management strategies used by
farmers to control O. nubilalis populations, including chemical and biological control agents,
cultural practices and resistant maize varieties, including transgenic maize expressing the
Bacillus thuringiensis Cry1Ab protein (Bt maize). Only recently introduced into Europe
fields, in 2006, six EU countries grew Bt maize for commercial production with a total area of
about 70 000 ha.
Control of O. nubilalis by Bt maize hybrids is effective but concern exist about adaptation
of O. nubilalis to this toxin due to high selection pressure with subsequent development of
resistance. Several strategies of managing insect resistance to transgenic plants have been proposed. At present, the Environmental Protection Agency (EPA, 1998) recommends a strategy
with two components: high toxin dose and refuge. Recessive resistance alleles are rare in
European populations of O. nubilalis, thus a large quantity of larvae needs to be evaluated
when searching for resistant genotype. In this study we investigate the effect of Bt maize
tissue incorporated in standard semi-artificial diet on larval development and mortality of O.
nubilalis strains originated from different parts of Europe.
Continuous laboratory populations of O. nubilalis were established from larvae or moths
originally collected from maize fields in different parts of Europe (Fig. 1). Larvae were reared
on semi-artificial diet composed of 20 g agar, 40 g sugar, 150 g wheat germ, 100 g alfalfa
127
128
meal, 40 g fresh yeast, 4 g ascorbic acid, and 5 ml glacial acetic acid mixed in 1000 ml water
in 250 ml glass containers half-filled with the diet at 25±1°C, 80% RH, and 16/8 (L/D)
photoperiod. Emerged adults were released into cages and allowed to oviposit on paper strips.
Adults were fed on 2% sucrose-water supplied in small plastic trays lined with cotton. Egg
masses deposited on the paper strips were collected regularly and placed in the glass containers with fresh diet to establish a new generation. Larvae from these continuous
populations were used in the bioassay.
For the bioassay, the semi-artificial diet was enriched with powder of Bt maize leaves.
The powder was prepared in a laboratory mill from maize leaves collected from Bt maize
plants (cry1Ab, event MON 810) grown in the greenhouse. Leaves were collected from plants
in the growth stage of flowering and air-dried at room temperature for 48 hrs before grinding.
The leaf powder was added to the standard semi-artificial diet under a careful stirring to
homogenize the mixture after cooking when diet temperature had decreased <40°C. The diet
(50 ml) was poured into small transparent plastic vials (100 ml). Two different concentrations
(A: 0.5 and B variant: 1.5%) of Bt maize diet were prepared. Untreated diet (without Bt maize
powder) was used as a control variant. One egg mass (approximately 20 eggs) in the stage of
black heads was put on the surface of artificial diet in each vial. To prevent egg masses from
contact with the diet, egg masses were put on pieces of sterile aluminium foil. Ten vials for
each variant were prepared. The vials were maintained at 25±1°C, 80% RH, and 16/8
photoperiod. Numbers of hatched larvae and development in each vial were recorded. The
mortality of larvae was assessed on day 14 after hatching and weight of survivors was
measured. The corrected mortality was determined by the method of Abbott (1925). Data
from the bioassay tests were analyzed with the Tukey’s HSD test (P=0.05) to determine the
significance of differences.
Table 1. Origin of O. nubilalis laboratory populations used in the bioassay
Origin
Site of
collection
Germany
lab. population
Serbia I
Serbia II
Romania
Austria
Slovakia 477
Slovakia 3
Laliť
Zemun Polje
Fundulea
Klagenfurt
Komjatice
Komjatice
Mix
lab. population
Date of
collection
–
February 2005
February 2005
1995
July 2004
June 2004
June 2004
–
Notes / Nr. of generations in lab
provided by Institute of Environmental
Research, Aachen University, Germany /F17 in
Nitra laboratory
F6
F5
lab. population /F6 in Nitra
F6
cultures established from survivals of F2 screen
experiments [9] /F6
established by mixture of several lab.
populations
The effect of Bt diet on development of O. nubilalis larvae is shown in Table 2. Larvae from
Slovakia 3 and 477 (F2 screen) were the least affected by consuming the diet enriched with Bt
maize leaves. Mean weight of larvae after 14 days feeding on Bt diet (B variant) decreased by
about 85% when compared with larvae from controls. Serbia II, Romania, Austria, Mix, and
Germany populations were relatively more tolerant and the mean weight of larvae (B variant)
129
decreased to 8 – 12% compared to controls. The Serbia I population was the most affected
with a weight decrease of 97.5%. Generally, our results indicate that Bt maize leaves in the
diet significantly (P<0.05) reduced development of O. nubilalis larvae in all populations,
when compared with the control. Differences in larval weights between variants A and B were
not significantly different (P>0.05) in all populations except for those from Slovakia 3 and
Romania.
Table 2. Effect of semi-artificial diet supplemented with Bt maize leaves on development of
O. nubilalis larvae after 14 days of rearing, A – 0.5% and B – 1.5% of Bt maize leaves of dry
matter, * mean weights followed by the same upper-case letter within rows and the same
lower-case letter within columns are not significantly different among variants (Tukey’s HSD
test, P=0.05).
Population
Germany
Serbia I
Serbia II
Romania
Austria
Slovakia 477
Slovakia 3
Mix
Mean weight of larva in mg ± SE
Control variant*
A variant*
B variant*
79.21 ± 6.23 A,cd
22.86 ± 2.53 B,bc
9.86 ± 1.68 B,c
65.29 ± 7.54 A,bc
13.72 ± 1.68 B,a
1.74 ± 0.23 B,a
83.28 ± 3.90 A,d
19.09 ± 2.56 B,abc
10.19 ± 0.82 B,c
102.80 ± 3.90 A,e
40.71 ± 2.99 B,d
8.45 ± 2.02 C,bc
83.85 ± 4.96 A,d
23.85 ± 4.27 B,c
7.41 ± 1.86 B,bc
50.10 ± 7.38 A,ab
18.39 ± 2.86 B,abc
7.28 ± 0.68 B,bc
69.64 ± 4.89 A,cd
32.52 ± 2.99 B,d
10.53 ± 0.89 C,c
45.11 ± 6.20 A,a
15.37 ± 2.82 B,ab
5.69 ± 1.29 B,b
Consuming the Bt diet in our experiment influenced also a percent mortality of larvae
tested (Table 3). However, significantly higher mortality due to consuming Bt diet was only
observed in populations from Germany and Romania. Sublethal doses of Bt toxin usually
manifest in decreased larvae feeding, longer developmental time, and smaller size of larvae
exposed to the doses (e.g. Gutierrez et al, 2006; Ashfaq et al., 2000]. Williams et al. (1998)
reported that Helicoverpa zea Boddie fed diet containing husks and silks of Bt11 hybrids,
exhibited reduced survival and were smaller in size than larvae fed non-Bt plant material.
Developmental times of susceptible H. zea larvae were longer on Bt cotton than on non-Bt
cotton, and size at pupation was similarly reduced. The sublethal effects of Bt toxin on
developmental time of survivors are assumed to vary linearly with Bt toxin concentrations in
the diet (Gutierrez et al., 2006). Development of Slovak strains Slovakia 3 and 477
established from survivors of F2 screen bioassay (Stodola et al., 2006) were the most tolerant
to Bt toxin in the diet. This corresponds with expectancy of higher resistance. However,
differences in mean weight among the Slovak strains and other tested populations were not
significant (P>0.05).
The range of variation in Bt diet susceptibility indicated by mortality and reduced weight
of larvae among geographically different strains reflects natural diversity in Bt susceptibility
of O. nubilalis populations. Similar results were observed also for other lepidopteran host.
Median lethal dose in H. zea varied 13–16-fold among geographically different strains of the
pest (Stone and Sims, 1993). A general opinion is that sublethal effects of Bt toxin are species
and genotype specific (Gutierrez et al., 2006).
130
Table 3. Percent mortality of O. nubilalis larvae after 14-day rearing on semi-artificial diet
supplemented with Bt maize leaves, A – 0.5% and B – 1.5% of Bt maize leaves of dry matter,
* mortalities followed by the same upper-case letter within rows and the same lower-case
letter within columns are not significantly different among variants (Tukey’s HSD test,
P=0.05)
% mortality (Abott’s corrected mortality)
Control variant*
A variant*
B variant*
Germany
26.26 ± 3.98 A,ab
37.66 ± 5.78 (15.46) AB,a
45.98 ± 6.56 (26.74) B,abc
Serbia I
47.05 ± 7.87 A,c
54.38 ± 8.75 (13.84) A,a
64.70 ± 2.49 (33.33) A,de
Serbia II
41.13 ± 7.97 A,bc
51.83 ± 9.33 (18.18) A,a
60.33 ± 5.75 (32.61) A,cd
Romania
14.00 ± 4.00 A,a
36.00 ± 2.67 (25,58) B,a
38.00 ± 2.91 (27.91) B,a
Austria
27.05 ± 5.45 A,ab
36.58 ± 5.31 (13.06) A,a
41.07 ± 9.78 (19.21) A,ab
Slovakia 477 47.67 ± 9.95 A,c
52.00 ± 7.20 (8.27) A,a
68.00 ± 7.31 (38.84) A,de
Slovakia 3
37.67 ± 7.27 A,bc
48.13 ± 7.92 (16.78) A,a
55.33 ± 3.86 (28.33) A,bcd
Mix
43.95 ± 7.89 A,bc
53.77 ± 7.71 (17,52) A,a
79.00 ± 4.14 (62,53) B,e
Population
Acknowledgements
The study reported in the present paper was financially supported by the European 5th frame
program ProBenBt, project n. QLK3-CT-2002-01969.
References
Abbott, W. S. 1925: J. Econ. Entomol. 18: 265-267.
Ashfaq, M., Young, S.Y. & McNew, R.W. 2000: J. Entomol. Sci. 35: 360-372.
Environmental Protection Agency. 1998: Bacillus thuringiensis subspecies tolworthi Cry9C
protein and the genetic material necessary for its production in corn; exemption from the
requirement of a tolerance. 10 April. Fed. Reg. 3(69).
Gutierrez, A. P., Adamczyk, J. J., Ponsard, S. & Ellis, C.K. 2006: Ecological Modelling 191:
360-382.
Stodola, T., Brazier, C., Mottet, C. et al. 2006: Resistance management of Bt-maize in
Europe, COST 862 Workshop (abstracts), 6-8 April 2006, Aachen, Germany: 11.
Stone, T. B. & Sims, S. R 1993: J. Econ. Entomol. 86: 989-994.
Williams, W. P., Buckley, P. M., Sagers, J. B. & Hanten, J. A. 1998: J. Agric. Entomol. 15:
105-112.
p. 131
Binding and pore formation of Cyt1Aa and Cry11Aa toxins of
Bacillus thuringiensis israelensis to brush border membrane vesicles of
Tipula paludosa (Diptera: Nematocera)
Jesko Oestergaard1, Ralf-Udo Ehlers1, Amparo C Martínez-Ramírez2,
Maria Dolores Real2
1
Institute for Phytopathology, Dep. for Biotechnology and Biological Control, ChristianAlbrechts-University, Kiel, Germany; 2Departamento de Genetica, Facultat de Ciències
Biològiques, Universitat de Valencia, Burjassot (Valencia), Spain
Abstract: Bacillus thuringiensis svar. israelensis (Bti) produces four insecticidal crystal proteins
(Cry4A, Cry4B, Cry11A and Cyt1A). Toxicity of recombinant Bti strains expressing only one of the
toxins was determined with first instars of Tipula paludosa (Diptera: Nematocera). Cyt1A was the
most toxic protein whereas Cry4A, Cry4B and Cry11A were virtually non-toxic. Synergistic effects
were recorded when either Cry4A and/or Cry4B were combined with Cyt1A, but not with Cry11A.
The binding and pore formation are key steps in the mode of action of Bti insecticidal crystal proteins
(ICPs). Binding and pore forming activity of Cry11Aa, which is the most toxic protein against
mosquitoes, and Cyt1Aa to brush border membrane vesicles (BBMVs) of T. paludosa were analysed.
Solubilization of Cry11Aa resulted in two fragments with apparent molecular weights of 32 and 36
kDa. No binding of the 36 kDa fragment to T. paludosa BBMVs was detected, whereas the 32 kDa
fragment bound to T. paludosa BBMVs. Only a partial reduction of binding of this fragment was
observed in competition experiments indicating a low specificity of the binding. In contrast to
mosquitoes, the Cyt1Aa protein bound specifically to the BBMVs of T. paludosa, suggesting an
insecticidal mechanism based on a receptor-mediated action as described for Cry proteins. Cry11Aa
and Cyt1Aa toxins were both able to produce pores in T. paludosa BBMVs. Protease treatment with
trypsin and proteinase-K, previously reported to activate these toxins respectively, had the opposite
effect. Higher efficiency in pore formation was observed when Cyt1A was proteinase-K treated, while
the activity of trysin treated Cry11Aa was reduced. Results on binding and pore formation are
consistent with results on ICP toxicity and synergistic effect with Cyt1Aa in T. padulosa.
Keywords: Bacillus thuringiensis, Bti, Tipula paludosa, mode of action, ICP
References
Oestergaard, J., Voss, S., Lange, H., Lemke, H., Strauch, O. & Ehlers, R.-U. 2007: Quality
control of Bacillus thuringiensis ssp. israelensis products based on toxin quantification
with monoclonal antibodies. Bioc. Sci. Technol. 17: 295-302.
Oestergaard, J., Ehlers, R.-U., Martínez-Ramírez, A.C. & Real, M.D. 2007: Binding of
Cyt1Aa and Cry11Aa toxins of Bacillus thuringiensis serovar israelensis to brush border
membrane vesicles of Tipula paludosa (Diptera: Nematocera) and subsequent pore
formation. Appl. Environ. Microbiol. 73: 3623-3629.
131
pp. 132-135
Susceptibility of Tipula paludosa against Bacillus thuringiensis
israelensis, Steinernema carpocapsae and Steinernema feltiae
Olaf Strauch, Jesko Oestergaard, Ralf-Udo Ehlers
Institute for Phytopathology, Christian-Albrechts-University, Dept. Biotechnology & Biol.
Control, Hermann-Rodewald-Str. 9, 24118 Kiel, Germany
Abstract: Tipula paludosa (Diptera: Nematocera) is the major insect pest in grassland in Northwest
Europe and is an invasive species in North America. Oviposition occurs during late August and first
instars hatch from September until mid-October. Laboratory and field trials were conducted to assess
the control potential of entomopathogenic nematodes (EPN) (Steinernema carpocapsae and S. feltiae)
and Bacillus thuringiensis subsp. israelensis (Bti) against T. paludosa. Results indicate that the early
instars of the insect are most susceptible to nematodes and Bti. In the field the neonates prevail when
temperatures tend to drop below 10°C. S. carpocapsae, reaching > 80% control, is more effective
against young stages of T. paludosa than S. feltiae (< 50%), but the potential of S. carpocapsae is
limited by temperatures below 12°C. Mortality of T. paludosa caused by Bti was not affected by
temperature. Even at 4°C insects were affected but the lethal time increased with decreasing
temperatures. Synergistic effects of Bti and EPN against T. paludosa were observed in 3 out of 10
combinations in laboratory assays but not in a field trial. The potential of S. carpocapsae was
demonstrated in field trials against early instars in October reaching an efficacy of >80% with 0.5
million nematodes per m² at soil temperatures ranging between 3° and 18°C. Against early instars in
autumn between 74 and 83% control was achieved with 13 kg/ha Bti of 5,700 International Toxic
Units (ITUs) and 20 kg/ha of 3,000 ITUs. A wheat bran granular formulation with Bti was superior in
efficacy than the sprayed product against L3 stages in an application at the end of November. 10 kg/ha
Bti had no effect when it was sprayed, whereas the same amount of Bti applied with the granular
formulation had a significant efficacy of 68 % (Abbott corrected). The results indicate that spray
applications of Bti and nematodes will only be successful and economically feasible during the
occurrence of early instars. At temperatures above 12°C entomopathogenic nematodes are an effective
alternative to Bti against the first instars of T. paludosa, although Bti products might be cheaper.
Key words: Bti, Bacillus thuringiensis nematodes, Tipula paludosa, temperature
Introduction
The European crane fly (Tipula paludosa Meigen) is the major pest on pasture, meadows and
turfgrass in temperate climates in North West Europe. Several steinernematid and
heterorhabditid species have been tested against different instars of tipulid larvae and the
highest control was achieved with Steinernema feltiae (Filipjev). Peters and Ehlers (1994)
determined that the concentration to kill 50% of the tipulids (LC50) for S. feltiae differed with
the larval instars. Late first and early second instars were the most susceptible stages, which
occur in autumn when temperatures usually drop below 10°C. Another agent to control
leatherjackets is Bacillus thuringiensis subsp. israelensis (Bti) (Waalwijk et al., 1992). The
most susceptible larval stage is the L1. An application rate of 45 liters ha-1 of a product with
1200 International Toxic Units (ITU) mg-1 was necessary to reduce the population of young
instars below the economic threshold (Smits et al., 1993). The objective of this study was to
test whether sufficient control of leatherjackets can be achieved with either EPN or Bti or
their combination of both.
132
133
Eggs were collected from field sampled T. paludosa adults and hatching larvae were fed with
chickweed (Stellaria media L.). For lab trials nematodes were produced in instar Galleria
mellonella L. for lab trials and received from the company e-nema GmbH (Raisdorf,
Germany). Bti (strain IPS82) was produced in liquid culture by e-nema GmbH and spray
dried before addition of Arabic Gum (Sigma, St. Louis, MO, USA) and Bevaloid 211 (C.H.
Erbslöh KG, Germany). The ITUs were determined by the company Icybac GmbH (Speyer,
Germany). For the field trials, different production batches with ITUs ranging from 3,000 to
7,000 were used. Pathogenicity of EPN was assessed in 24 cell well plates (16 mm diameter)
half filled with moist sand (15%) and single L1 T. paludosa. Fifty or 100 DJs/larva in 50 µl
tap water were transferred to the sand. Mortality was assessed after 4 days at 15°C. Each
strain was tested on 24 tipulid larvae in 3 replicates. Pathogenicity against L4 larvae was
tested in cell well plates containing 6 wells of 36 mm diameter and larvae were fed with
lettuce leaf discs (2.5 cm2). Mortality was determined after 6 days. Bti was applied to the
leaves at 8 µg cm-2 using a potter tower and transferred into the wells. Experiments were
conduced at 4°, 8°, 15° or 20°C with 120 L1 for each temperature and mortality was recorded
daily, up to day 4 after exposure. Probit analysis determined the lethal time to kill 50% of the
larvae (LT50) and the confidence intervals at the different temperatures (Oestergaard et al.,
2006). For field testing nematodes were applied using a watering can with 0.5 million DJs per
square meter in 1 liter of tap water. Bti spray dried powder was dispersed in 500 ml of water.
Control plots remained untreated. For evaluation of the tials larvae were collected from sods
submerged in saline water (200 g l-1 NaCl) of 30°C as described by Maercks (1939).
Against Tipula L1 larvae, S. carpocapsae caused a significantly higher mortality than S.
feltiae at both concentrations of 50 and 100 DJs/larva (F = 246.9, df = 3, 8, P ≤ 0.05). At 15°C
and a concentration of 50 DJs/larva, S. carpocapsae caused a significantly higher mortality
than S. feltiae (F = 226.5, df=3, 8, P ≤ 0.05) (Fig. 1 A). At the lower temperature of 8°C, S.
carpocapsae caused a lower efficacy of 6% while S. feltiae caused a significantly higher
efficacy of 26% at a concentration of 50 DJs/larva. The efficacy of Bti against L1 T. paludosa
larvae is temperature dependent as the comparison of the different probits indicates (Fig. 1B).
Results of the field trials confirmed laboratory assays indicating that control achieved
with S. feltiae against early instar T. paludosa is low compared to the efficacy recorded for S.
carpocapsae (Table 1). A significant control was achieved only once with S. carpocapsae
reaching 82% reduction at a mean infestation of 172 tipulids m-2 in the untreated control plots.
In another field, an efficacy of 75% was recorded. However, the infestation level in the
control was low with 85 tipulids m-2 and no significant difference to the control was
calculated. These results were obtained in a year with exceptionally high autumn temperatures
ranging between 3° and 18°C in October. When temperature dropped below 11°C, no
reduction of the tipulid population was observed in plots treated with S. carpocapsae (Table
1). The temperatures decreased rapidly after application and the mean temperature during that
field trial was 6°C.
134
100
8°C
Abbott Corrected Mortality (%)
Efficacy (%)
80
100
A
15°C
60
40
20
0
S.feltiae OBSIII
90
20°C
80
70
15°C
60
50
8°C
B
40
4°C
30
20
Probit
10
0
S.carpocapsae ALL
0
2
4
6
Time (days)
Figure 1. A: Abbott corrected mortality of T. paludosa L1 after application of 50 DJs per
larva of S. f. and S.c. at 8° and 15° C (n = 72). B: Abbott corrected mortality and lethal time
for first instar Tipula paludosa at 4°, 8°, 15° and 20°C after treatment with 8µg cm-2 Bti (n =
120). Probits according to Finney (1971).
Table 1. Field trials with Steinernema feltiae and S. carpocapsae against Tipula paludosa
Trial
Nr.
Site
Treatment
Assessment
(days after
application)
Mean
Temperature
(range) (°C)
Rate
Plots Species Larval
(DJs x 106
stage
-2
m )
1
Guby
19/09/02
28
10 (1-21)
0.5
5
S. f.
1
Guby
1
19/09/02
28
10 (1-21)
0.5
5
S. f.
2
Stadum
06/11/03
28
6 (0-10)
0.5
5
S. f.
3
Lelystad
04/11/04
25
6 (1-10)
0.5
6
S. f.
5
Aukrug
05/10/05
28
10 (3-18)
0.5
3
S. c.
6
Aukrug
05/10/05
28
10 (3-18)
0.5
3
S. c.
8
Aukrug
10/11/05
26
4 (1-11)
0.5
3
S. c.
L1 +
L2
L1 +
L2
L2 +
L3
L2 +
L3
L1 +
L2
L1 +
L2
L2 +
L3
Control
Mean number of larvae m-2
(%)
Before treatment
After treatment
control treatment control treatment
331
378
0
-
-
331
289
13
-
-
272
228
16
215
162
107
123
0
-
-
172
31
82*
-
-
85
21
75
216
220
193
238
0
1
= applied second time on 03/10/02 with same rate. S.f. = S. feltiae (EN02) and S.c. = S. carpocapsae
(All), * = significant different to the untreated control (ANOVA, Fischer LSD), DJs = Dauer juveniles.
Results of field trails with Bti are summarized in Table 2. Against L1 and L2 larvae, a
significant reduction of 79% was achieved with 13 kg ha-1 of a product with 7,000 ITUs mg-1
(F = 2.13; df = 4, 20; p = 0.038). At the lower rate of 3 kg ha-1, almost no effect was detected
(trial 1). In trial 2, the same Bti product was applied at 5 and 10 kg ha-1 against L2 and L3
larvae in late autumn with control efficacy of 17 and 45%, respectively, but there were no
significant differences to the population in the controls. With a rate of 20 kg ha-1 of a product
of 3,000 ITUs mg-1, a significant reduction of 74% was recorded against L2 and L3 larvae of
T. paludosa in autumn. Doubling the rate by applying 20 kg ha-1 in a split application with a 2
week interval increased the reduction to 83%. Applying Bti in March against L3 and L4
larvae was less successful and no significant reduction of the larval population was recorded.
The efficacy did not surpass 10% even at 20 kg ha-1 with the same Bti product, indicating the
much lower susceptibility of the older larval stages. Even the use of 10 kg ha-1 of a more
concentrated product of 6,500 ITUs mg-1 resulted in a low efficacy of 32%.
135
Table 2. Field trials with Bacillus thuringiensis subsp. israelensis against Tipula paludosa
Rate
Plots
(kg ha-2)
Assessment
(days after
application)
Mean
Temperature
(range) (°C)
19/09/02
28
10 (1-21)
3
Guby
19/09/02
28
10 (1-21)
2
Stadum
06/11/03
28
2
Stadum
06/11/03
3
Lelystad
3
Trial
Nr.
Site
1
Guby
1
Treatment
Mean number of larvae m-2
ITU
mg-1
Larval
stage
5
7,000
L1 + L2
13
5
7,000
L1 + L2
-
-
331
68
79*
6 (0-10)
5
5
7,000
L2 + L3
-
-
272
225
17
28
6 (0-10)
10
5
7,000
L2 + L3
-
-
272
149
45
04/11/04
25
6 (1-10)
20
6
3,000
L2 + L3
215
122
107
16
74*
Lelystad
04/11/041
25
6 (1-10)
40
6
3,000
L2 + L3
215
187
107
16
83*
4
Lelystad
25/03/05
20
9 (4-15)
5
5
3,000
L3 + L4
98
66
75
95
0
4
Lelystad
25/03/05
20
9 (4-15)
10
5
3,000
L3 + L4
98
109
75
75
10
4
Lelystad
25/03/05
20
9 (4-15)
20
5
3,000
L3 + L4
98
103
75
74
6
4
Lelystad
25/03/05
20
9 (4-15)
10
5
6,500
L3 + L4
98
142
75
74
32
Before treatment
control treatment
-
After treatment
control
treatment
331
323
Efficacy
(%)
2
1
= rate split between two treatments with the second applied on 16/11/04. * = significant different to
the untreated control (ANOVA, Fischer LSD). ITU = International Toxic Units determined in a
standard bioassay with Aedes aegypti.
References
Finney, D.J. 1971: Probit Analysis. Cambridge Univ. Press, London, UK.
Maercks, H. 1939: Untersuchungen zur Biologie und Bekämpfung schädlicher Tipuliden.
Arb. Physiol. Angew. Entomol. 6: 222-257.
Oestergaard, J., Belau, C., Strauch, O., Ester, A., van Rozen, K. & Ehlers, R.-U. 2006:
Biological control of Tipula paludosa (Diptera: Nematocera) using entomopathogenic
nematodes (Steinernema spp.) and Bacillus thuringiensis subsp. israelensis. Biological
Control 39: 525-531.
Peters, A. & Ehlers, R.-U. 1994: Susceptibility of leatherjackets (Tipula paludosa and T.
oleracea, Tipulidae: Nematocera) to the entomopathogenic nematode Steinernema feltiae.
J. Invertebr. Pathol. 63: 163-171.
Smits, P.H., Vlug, H.J. & Wiegers, G.L. 1993: Biological control of leatherjackets with
Bacillus thuringiensis. Proc. Exp. Appl. Entomol. N.E.V. 4: 187-192.
Waalwijk, C., Dullemans, A., Wiegers, G. & Smits, P. 1992: Toxicity of Bacillus
thuringiensis variety israelensis against tipulid larvae. J. Appl. Entomol. 114: 415-420.
p. 136
Cellular effects of the Bacillus sphaericus Binary toxin on
MDCK cells expressing its receptor
Onya Opota1, Nils Gauthier2, Anne Doye2, Pierre Gounon3, Colin Berry4,
Emmanuel Lemichez2 and David Pauron1
1
Institut National de la Recherche Agronomique, UMR 1112 INRA/UNSA, 400 Route des
Chappes, BP 167, 06903 Sophia Antipolis Cedex, France, 2INSERM U 627, Faculté de
Médecine, 06107 NICE Cedex 2, France; 3Centre Commun de Microscopie Electronique
Appliquée, Faculté des Sciences, 06108 NICE Cedex 2, France; 4Cardiff School of
Biosciences, Cardiff University, Cardiff CF10 3US, United Kingdom
Abstract: The Binary toxin (Bin) produced by Bacillus sphaericus (Bs) has been extensivly used and
successfully in different parts of the world to control Anopheles and Culex mosquitoes that transmit
human born diseases. After liberation and processing in Culex pipiens gut, Bin induces its toxic effect
by binding on a specific receptor Cpm1 (Culex pipiens maltase 1) in the epithelial membrane of
intestinal cells. However, the precise mechanism of C. pipiens death remains unclear. When expressed
in the mammalian MDCK cell line, Cpm1 is anchored to the plasma membrane by a glycosylphosphatidylinositol (GPI) anchoring and is able to bind Bin. In MDCK-Cpm1 cell line Cpm1 is
enriched in lipid raft microdomains and treatment with Bin promotes the opening of pores and induces
a specific vacuolation. In this study we report that Bin rapidly induces in treated cells the appearance
of intracytoplasmic acidic vacuoles decorated by the late endosomal marker Rab7, the lysosomal
marker Lamp1 and the autophagic marker LC3. Together with electron microscopy analysis, these
data suggest an autolysosomal origine of this compartment. We also report both by immunofluorescence and ultrastructural analysis an increase of autophagic status in Bin treated cells. Life time
imaging of the vacuolation dynamic revealed that this autolysosomal enlargment is transient and that
autophagy stimulation is able to inhibit this vacuolation. While Bin is internalized, as shown with a
Bin fluorescent derivative, no association is observed with the membrane of vacuolated autolysosomes. These data suggest that autophagy is a response mechanism of MDCK-Cpm1 cells to Bin
intoxication, but, because such enlargment of autolysosomes is not physiological, one may
hypothesize that Bin mode of action interferes with the autophagic process.
136
p. 137
New molecular phylogeny of Photorhabdus and Xenorhabdus
based on a multigene approach
Armelle Paule1, Sylvie Pagès1, Christine Laroui1, S. Patricia Stock2, Patrick Tailliez1
1
UMR Ecologie Microbienne des Insectes et Interactions hôte-Pathogène, Institut National de
la Recherche Agronomique & Université Montpellier II, Place E. Bataillon, 34095
Montpellier Cedex 05, France; 2Department of Entomology, University of Arizona, Tucson,
AZ 85721, USA
Abstract: The entomopathogenic nematodes of the genera Heterorhabditis and Steinernema are
characterized by their mutualistic relationship with symbiotic bacteria of the genera Photorhabdus and
Xenorhabdus, respectively. The analysis of the molecular phylogeny of both partners can help to
understand the evolution of these associations and to highlight co-speciation and host-switch events. A
robust phylogeny for both partners is a prerequisite (Page & Hafner, 1996). However, for Photorhabdus and Xenorhabdus, the phylogeny based on 16S rRNA gene sequences appeared unreliable
(Tailliez & al., 2006) and the lack of robustness in the deeper nodes of the phylogenetic trees
prevented from comparing efficiently the tree topologies of both partners. Here, we propose a
multigene approach using a combination of RecA (DNA recombination protein) and gyrB (DNA
gyrase beta subunit) gene sequences to resolve the genealogy of these bacteria. Within the genus
Photorhabdus, three clades were determined: the P. temperata clade, the P. asymbiotica clade
including the non-luminescent strain Q614 and the P. luminescens clade. A polytomy at the node
suggests a simultaneous emergence of the three lineages from a common ancestor. P. luminescens
subsp. thracensis strain CIP108426T was classified in the P. temperata clade which is not consistent
with the classification proposed by Hazir et al., (2004) using the 16S rRNA sequences. Within the
genus Xenorhabdus, four clades were determined: CX1 included X. kozodoii, X. ehlersii, X. griffiniae,
X. doucetiae, X. romanii, X. beddingii, X. japonica, X. poinarii and the unclassified strain VN01; CX2
included X. hominickii and X. miraniensis; CX3 included X. koppenhoeferi and X. nematophila; CX4
included X. budapestensis, X. cabanillasii, X. indica, X. innexi and X. stockiae. The affiliation of three
species (X. szentirmaii, X. mauleonii and X. bovienii) remained unresolved. The phylogenetic
relationships between CX1, CX2, CX3, X. szentirmaii and X. mauleonii are still unresolved suggesting
a likely simultaneous emergence of these lineages from a common ancestor. Comparisons of the
phylogenetic trees of both partners Xenorhabdus (recA+gyrB), Steinernema (28S) (Nadler & al., 2006;
Stock & al., 2001) supports hypothesis of co-speciation and host-switch events in the evolution of the
relationships within these mutualistic partners.
Key words: Photorhabdus, Xenorhabdus, Entomopathogenic nematode, phylogeny.
References
Hazir et al. 2004: System. Appl. Microbiol. 27: 36-42.
Nadler et al., 2006: Syst. Parasitol. 63: 161-181.
Page & Hafner, 1996: In: Harvey PH et al.(eds): New uses for new phylogenies. Oxford
University Press, pp. 255-270.
Stock et al. 2001: J. Parasitol. 87:877-889.
Tailliez et al. 2006. Int. J. Syst. Evol. Microbiol. 56: 2805-2818.
137
pp. 138-143
Identification and typing of Photorhabdus isolates from
entomopathogenic nematodes in Hungarian soils
Tímea Tóth, Tamás Lakatos, Zoltán Kaskötő
Research and Extension Centre for Fruit Growing, Vadastag 2, H-4244 Újfehértó, Hungary
Abstract: Photorhabdus strains from entomopathogenic nematodes isolated from Hungarian soils
were characterized by morphological, physiological and genetic properties to survey the diversity of
bacterial symbionts of Heterorhabditis species of commercial importance. Entomopathogenic bacteria
(EPB) were isolated from 245 entomopathogenic nematode strains originated from different part of
Hungary. There were 156 Photorhabdus and 77 Xenorhabdus from the successfully cultured 233 EPB
isolates. 65 Photorhabdus isolates representing the whole collection from the point of view of
geographical and nematode host distribution were analysed. Primary form bacterial cells selected on
NBTA indicator plates were used to determine the morphological traits and to perform physiological
tests using Biolog GN microplates and API20E strips. Cytotoxic and antibacterial properties of cellfree culture broth were measured against Drosophila melanogaster S2 and Spodoptera frugiperda Sf9
cell lines or Stpahylococcus aureus and Bacillus subtilis bacteria, respectively. Morphologically and
physiologically homogenous groups of Photorhabdus isolates were characterized by partial
sequencing of the gyrB subunit gene. High physiological and morphological diversity was found
among the Photorhabdus isolates and all of physiological and morphological bacteria types could be
isolated both from Heterorhabditis megidis and H. downesi. The possible role of this diversity is
discussed.
Key words: Photorhabdus, physiological types
Introduction
Photorhabdus bacteria have an outstanding role in the life-cycle of their symbiotic partners;
nematodes belong to the Heterorhabditis genus. The bacteria highly determine the effectiveness of the symbiotic complex against different insects, why the bacteria are of interest from
the viewpoint of biocontrol practice. The genus Photorhabdus has a relatively low diversity at
the species level with only 3 described species (Boemare, 2002). Morphologically different
Photorhabdus bacteria could be isolated from the same Heterorhabditis species originating
from different soil samples in Hungary. These different bacterial isolates differed in e.g.
antibiotic production (Tóth et al., 2007). Some new isolates have a potential as biocontrol
agents of Melolontha melolontha, the key insect pest in Hungarian horticulture. The possible
impact of the bacterial symbionts on the efficacy of nematode isolates against the grubs was
the main goal of our project. This investigation surveyed the diversity of the Hungarian
Heterorhabditis – Photorhabdus symbiotic complexes, focusing on the symbiotic bacterium
of H. downesi.
Bacteria strains and physiological tests
Among the Hungarian entomopathogenic bacteria collection (Tóth, 2006; Tóth et al., 2007)
65 Photorhabdus isolates were selected. Primary form colony form of the Photorhabdus
138
139
isolates were selected on NBTA indicator plates and used to all tests. Physiological and
biochemical tests were performed at 28 °C using GN2 microplates (Biolog) and API20E
strips (Biomérieux).
Antibiotics producing activity
Primary colony form variants of the bacteria isolates were cultured in tryptic soy broth (TSY:
30 g soy peptone, 5 g yeast extract, 1000 ml distilled water) for 48 h at 28 °C. Antibiotic
activity of cell-free fermentation liquid was tested against Staphylococcus aureus ssp. aureus
DSM346 and Bacillus subtilis DSM704 by agar diffusion hole test using antibiotic media (1.5
g meat extract, 3 g yeast extract, 4 g tryptone, 6 g meat peptone, 1 g D-glucose, and 15 g agaragar in 1000 ml distilled water) or Bacillus subtilis agar (6 g meat peptone, 6 g meat extract, 4
g yeast extract and 20 g agar-agar in 1000 ml distilled water), and 100 ppm streptomycine
solution, as a control. The diameter (mm) of the clear zone around the 10 mm diameter holes
filled with 100 µl cell-free fermentation liquid were measured after overnight incubation at
37 °C.
Measuring cytotoxic activity
Cytotoxic activity of the same samples were measured by MTT cell proliferation assay, using
Drosophila melanogaster S2 (by courtesy of I. Andó, Biological Research Centre of the
Hungarian Academy of Sciences, Szeged) and Spodoptera frugiperda Sf9 (Gibco Cell Culture
System, Invitrogen) cell lines. Into the holes of a flat-bottomed 96-wells microtiter plates 180
µl log phase cell suspension in serum-added Grace’s (Invitrogen) or Shields and Sang (Sigma)
insect media (Sf9 and S2 cell lines, respectively) were measured, and 20 µl fermentation
liquid were added (10% end-concentration of tested sample). After overnight incubation at 28
or 20 °C (Sf9 and S2 cells), 100 µl of cell-free supernatant were moved, and 100 µl of 1
mg/ml MTT (3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide) solution in
serum-free Grace’s or Shields and Sang media were measured into the holes. After 2-4 h
incubation time the liquid were moved from the wells carefully and the purple formazan
cristalls were solubilized by 100 µl of dimethyl-sulfoxid. The colour intensity (which is
proportional to the cell activity) was measured at 530 nm using MRX TC Revelation
microplate reader (Thermo LabSystem). The cell activity was calculated as the percentage of
control wells (incubated with 10% TSY media). All samples were tested in 8 replications.
Identification using gyrB DNA sequence
The DNA sequence of gyrB gene was used for identification of EPB strains. The DNA
isolation and PCR amplification of the gyrB gene was carried out as described by Akhurst et
al. (2004). DNA sequence of the PCR products was determined in the laboratory of Biological
Centre of Szeged. The gyrB gene sequences were aligned against homologous sequences by
using the program Clustal X version 1.81 (Thompson et al., 1997). Evolutionary analyses
were carried out with the Phylo_Win package version 2.0 (Galtier et al., 1996). Evolutionary
distances between pairs of bacteria were determined with the correction of Jukes and Cantor,
and phylograms were derived using neighbour-joining algorithms. Significance of node was
tested by bootstrap analysis with 500 replicates. Sequence of gyrB gene of Xenorhabdus
nematophila strain AN6 was served as an outgroup. The DNA sequences originated from
Genbank public database (Tab.1) and the list of Hungarian isolates with newly sequenced
DNA are shown in Table 2.
Cluster analysis of biochemical data was carried out by R Console (http://cran.r-project.org)
version 2.4.1 using Cluster package, agglomerative nesting, Ward’s clustering method.
140
Calculation of dissimilarity matrix based on number of the same reaction (the distance
between two isolates is 0, when all studied reaction give same results, and it is 1, when all
studied reaction give different results).
Table 1. Photorhabdus isolates, of which gyrB sequences were used in this study
Species/strain
Nematode host
Photorhabdus temperata
HL81
Heterorhabditis megidis
XINach
XILit
C1
Heterorhabditis bacteriophora
Habana
Heterorhabditis sp.
Meg
NZH3
Heterorhabditis zealandica
Photorhabdus luminescens ssp. akhurstii
Tetuan
Heterorhabditis sp.
D1
Heterorhabditis indicus
Photorhabdus luminescens ssp. laumondii
HV16
K80
Heterorhabditis sp.
HP88
Photorhabdus luminescens ssp. luminescens
Hm
Heterorhabditis sp.
Hb
GenBank accession
number
Country of origin
AY278504
AY278517
AY278516
AY278497
AY278503
AY278512
AY278513
The Netherlands
Russia
Litvania
USA
Cuba
USA
New Zealand
AY278515
AY278499
Cuba
Australia
AY278506
AY278509
AY278508
Australia
Argentina
USA
AY278505
AY278501
USA
Australia
Table 2. New Photorhabdus isolates used to phylogenetic analysis and GenBank accession
numbers of the gyrB sequences
Strain/colour
Nematode host
3016 red
3086 grey
3107 grey
3173 orange
3179 yellow
3182 orange
3196 off-white
3210 cream
3240 grey
Heterorhabdits megidis
Heterorhabdits downesi
Heterorhabditis downesi
GenBank accession
number
EU053166
EU053167
EU053168
EU053169
EU053170
EU053171
EU053172
EU053173
EU053174
Place of isolation
Oak forest
Oak forest
Poplar forest
Pine forest
Pine forest
Pine forest
Forest tree nursery
Poplar plantation
Open field
Among the 65 Photorhabdus isolates 6 different types could be separated: colours of colonies
were yellow (18 isolates), red (6), orange (12), off-white (5), cream (3) or salmon-like with
grey pigmentation in the growing medium around the colonies (21). These types of bacteria
were not homogenous from the point of view of antibacterial or cytotoxic activity (Table 3).
Generally, grey isolates were the least effective antibacterial and cytotoxic compound producers.
141
Based on gyrB sequences, 4 of the 6 types of newly isolated strains could be identified
(Figure 1): red, orange and yellow bacteria were closely related to strain XINach, the type
strain of Photorhabdus temperata ssp. temperata. The off-white strain proved to be Ph.
luminescens ssp. laumondii. Isolate 3210 with cream coloured colonies could not be identified
unambiguously by gyrB sequence, but a 529 bps length part of 16S rDNA of this isolate was
99% identical to the DNA of strain DSM15199T, the type strain of Photorhabdus
luminescens ssp. thracensis (analysis is in progress, detailed data are not shown). Grey
isolates formed a clearly separated group, which could not be identified with any described
taxa.
Table 3. Antibiotics activity and cytotoxicity of the cell free fermentation liquid of the studied
isolates. *Moderate activity: less effective, than 100 ppm streptomycine, good: more effective, than 100 ppm streptomycine; **Moderate toxicity: cell activity 50-100% of the control;
‘good’ toxicity: cell activity less than 50% of the control, Underline indicates the most
frequent category
Colour of isolates
Antibacterial activity against*
Cytotoxic to**
S. aureus
B. subtilis
S2
Sf9
White
No/mod./good
Moderate
No/moderate
No/mod./good
Cream
Moderate/good
Moderate
No/moderate
Moderate/good
Yellow
No/mod./good
No/moderate
No/mod./good Moderate/good
Orange
No/mod./good
No/mod./good
No/moderate
Moderate/good
Red
Moderate/good
Moderate/good
No/moderate
Moderate
Grey
No/moderate
No/moderate
No/moderate
No/mod./good
Table 4. Distribution of different coloured bacteria among nematode species (* - identification
in progress)
Nematode host
H. bacteriophora
H. downesi
H. megidis
Colour of bacteria
White
Cream
White
Grey
Orange
Red
Yellow
White
Grey
Orange
Red
Yellow
Bacteria species
Ph. l. laumondii
Ph. l. thracensis
*
Photorhabdus sp.
Ph. temperata
Ph. temperata
Ph. temperata
*
Photorhabdus sp.
Ph. temperata
Ph. temperata
Ph. temperata
No. of
isolates
2
3
3
7
8
3
5
2
13
4
2
11
All the studied 65 isolates could use 28 of 95 carbon sources on GN2 plates, and none of
them could utilize 27 other compounds. The remaining 40 carbon source served as ‘variable’
parameters with 7 additional parameters from API20E strips for cluster analysis. On the
142
dendrogram four groups could be separated clearly (data are not shown), the most important
differential parameters were the utilization of dextrin, lactic acid, hydroxy-proline, xylitol,
sorbitol, keto-glutaric acid, glycogen and cellobiose. The groups formed by carbon source
utilization did not correspond with the taxonomic groups. Only the grey isolates constitute a
homogenous group distinguished from other isolates by lack of ability of hydroxy-proline
utilization (5% of grey and 87% of other isolates could use it), and ability of xylitol utilization
(100% of grey isolate and 36% of other bacteria could use it).
Figure 1: The phylogenetic tree of Photorhabdus genus based on the sequence of gyrB gene.
The main conclusions of this study were: 1) A relatively high Photorhabdus diversity
was found among isolates recovered from a small sampling area. At least 4 different
species/subspecies could be isolated. 2) All 3 Heterorhabditis species have at least two
different symbiotic partners (Table 4). 3) In some cases there are higher differences (in carbon
source utilization, antibiotics producing, etc.) between isolates belonging to the same
subspecies than between different subspecies.
Acknowledgements
This study was supported by the EU and the Hungarian State through the project GVOP –
3.1.1. – 2004 – 05 – 0223/3.0 and the North Great Plain Region of Hungary through the
‘Baross Gábor’ Regional Innovation Programme.
143
References
Akhurst, R.J., Boemare, N.E., Janssen, P.H., Peel, M.M., Alfredson, D.A. & Beard, C.E.
2004: Taxonomy of Australian clinical isolates of the genus Photorhabdus and proposal
of Photorhabdus asymbiotica subsp. asymbiotica subsp. nov. and P. asymbiotica subsp.
australis subsp. nov. Int. J. Sys. Evol. Microbiol. 54: 1301-1310.
Boemare, N. 2002: Biology, taxonomy and systematics of Photorhabdus and Xenorhabdus.
In: Entompathogenic nematology, ed. Gaugler: 35-56.
Galtier, N, Gouy, M. & Galtier, C. 1996: SEAVEW and PHYLO_WIN: two graphic tools for
sequence alignment and molecular phylogeny. CABIOS 12: 543-548.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.G. 1997: The
ClustalX windows interface: flexible strategies for multiple sequence alignment aided by
quality analysis tools. Nucleic Acids Res. 24: 4876-4882.
Tóth, T. 2006: Collection of entomopathogenic nematodes for biological control of insect
pests. J. Fruit Ornam. Plant Res. 14: 225-230.
Tóth, T., Lakatos, T. & Inántsy, F. 2007: Elaboration of biological control techniques against
key pests of fruit growing in Hungary. Act. Hort. (in press).
pp. 144-149
Latest progress in the intellectual property in the field of Photorhabdus
and Xenorhabdus
Adriano Ragni and Galina Flek
Via Deruta, 175 06132 San Martino in Campo Perugia. Italy
Abstract: Photorhabdus and Xenorhabdus produce metabolites which are active against bacteria and
fungi. Substances with nematocidal activity have also been detected in fermentation broths of both
bacteria genera. Strains of Photorhabdus and Xenorhabdus able to synthesize proteins with
insecticidal properties have been selected. Since the encouraging results obtained by the use of these
active metabolites and the recognition of their potential application in the medical and agricultural
fields, several patents have been filed for the use of strains and their metabolites. Most of the patent
applications are related to their insecticidal toxins and corresponding genes. In addition, there are also
intellectual property applications related to innovative formulations useful to increase the activity of
Photorhabdus insecticidal strains for field application. The importance of patent applications related
to the agricultural field will be presented and their impact on biological control practice will be
discussed.
Key words: Photorhabdus, Xenorhabdus, patent, transgenic plant, insecticide, fungicide application
Introduction
The genera Photorhabdus and Xenorhabdus contain symbiotic Enterobacteriaceae associated
with entomopathogenic nematodes of the genera Heterorhabditis and Steinernema,
respectively. Photorhabdus and Xenorhabdus secrete lipases, proteases, phospholipases and
other metabolites. In vitro, these bacteria produce metabolites with biological activities
against insects, bacteria and fungi. In the present paper a review on the inventions related to
the agricultural applications of the products derived from the two bacterial genera will be
described and their importance for the agricultural field and biological control practice will be
discussed.
The insecticidial activity of Photorhabdus and Xenorhabdus strains
The first insecticidal purified toxin and biologically active fragments thereof was isolated and
patented by Smigielski et al. (1995), from X. nematophilus strain A24. The toxin gene was
found to consist of an 834 basepair open reading frame, which translates into a 278 amino
acid protein. The identified toxin has the ability to control insects, but has no oral activity; in
fact it was administrated by injection into the haemocel of Galleria mellonella fourth instar
larvae. Injected larvae were found to be very sluggish after 30 hours, with all larvae dead
within three days.
Oral active toxins against insect were first detected in Photorhabdus luminescens subsp.
akhurstii strain W14 (Ensign et al., 1997). In this strain the native toxins are protein complexes that are produced and secreted by growing bacterial cells. The toxin complexes (TC),
with a molecular size of approximately 1,000 kDa, can be separated by SDS-PAGE gel
analysis into numerous component proteins. The toxins exhibit significant toxicity upon
administration to a number of insects belonging to Coleoptera, Homoptera, Lepidoptera,
Diptera, Acarina, Hymenoptera and Dictyoptera. In particular, when HPLC-purified toxin was
144
145
applied to diet of Manduca sexta at concentration of 7.5 µg/larva, it caused a halt in larval
weight gain. Agarose-separated protein fraction significantly inhibited larval weight gain at a
dose of 200 ng/larva. Additional 25 strains of P. luminescens were claimed in the same patent
to have similar ability to secret insect active toxins as strain W14. This strain was further
characterized in patent W098/08932 (Ensign et al., 1998a) where the isolation of several
orally toxic peptides and their genes is described. The W14 has at least four distinct genomic
regions, tca, tcb, tcc and tcd, producing 14 proteins that have oral activity against insects.
Genes coding for the Tc proteins share high DNA sequence similarity, but have no homology
with genes of known toxins. Strain W14 was further studied and new nucleotide sequences
were patented: seven genes from the tcd genomic region that are useful in heterologus
expression of orally active insect toxins (ffrench-Constant & Waterfield, 2004). A new
discovered toxin gene class (mcf=make caterpillar floppy) encodes proteins for an apoptosispromoting death domain and a membrane translocation domain. These genes and toxins were
also patented as insecticides (ffrench-Constant et al., 2003)
In contrast to W14, strain XP01 of Photorhabdus luminescens produces an intracellular
pertinacious compound that is oral toxic to Lepidopteran larvae (Ragni et al, 1998). In another
patent, an additional Photorhabdus strain (ATCC2999) (Kramer et al, 1999) with oral toxicity
against insect is characterized. The broth of this strain undiluted and diluted by 1:100
produces 100% mortality against Plutella xylostella and Diabrotica virgifera virgifera. The
oral active toxin has a molecular weight > 6,000. Five open reading frames (ORFs) are
present in the nucleic acid sequence of the toxin coding for proteins of predicted sizes from 21
kDa and 176 kDa.
Strains of Xenorhabdus were also detected as having oral activity against insect. Toxins
active against Coleoptera, Homoptera, Lepidoptera, Diptera and Acarina, were isolated from
39 strains of Xenorhabdus spp. (Ensign et al., 1998b).
Strains H31 and I73 of Xenorhabdus bovienii were selected by the mean of screening
program that involved 200 strains (Jarrett et al, 2000). The screening was done against larvae
of Pieris brassicae with a dose of 5 pl of broth per square centimeter corresponding to 10
cells/cm2. The two strains produced 100 % insect mortality. In the related patent it is also
disclosed that the two strains produce 2 major toxins (toxin H from strain H31 and toxin I
from strain I73) that have oral insecticidal activity against one or more species of insect of the
order Lepidoptera, Coleoptera and Homoptera. For instance, multi-dose assays performed
against Pieris brassicae gave the following toxicity values: H31 LC50= 78.9 ng protein/cm2,
I73 LC50= 232.2 ng protein/ cm2. Multi-dose bioassays performed against Plutella xylostella
gave the following values: H31 LC50= 4.9 ng protein/cm2, I73 LC50= 3.5 ng protein/cm2. In
leaf assay bioassays performed against Phaedon cochleariae the following values were
obtained: H31 LC50= 57.6 ng protein/ cm2, I73 LC50= 19.4 ng protein/cm2. The two toxins act
synergistically with B. thuringiensis as an oral insecticide. In fact the independent addition of
4 ng protein/cm2 of H31 or 8 ng protein/cm2 of I73 to B. thuringiensis (strain HD1) treatment
reduced the LC50 of the treatment with HD1 alone against Pieris brassicae from 8.7 ng
protein/cm2 to 2.49 ng protein/cm2. The invention further makes available nucleic acids
encoding these and variant toxins, plus vectors, host cells and plants transformed with the
same. Another strain of Xenorhabdus bovieni, ILM104, and its toxins and genes were patent
(Apel-Birkhold et al., 2005). This strain produces extracellular proteins with oral insecticidal
activity against members of the insect orders Coleoptera, Lepidoptera, Diptera, and Acarina.
Two specific toxin complex potentiators and a toxin complex (and genes encoding them)
obtainable from strain ILM104 are described.
Two toxin complexes in the strain Xwi of Xenorhabdus nematophilus are orally active
against insects, in particular against Lepidoptera. The characterization of the first toxin
146
complex (XTC-1) is described in the international patent WO 2004 067750 (Bintrim et al.,
2004).The purification of the toxin started from the supernatant of fermented broth inoculated
with the Xwi strain. The native MW of the purified protein was 860 kDa and it was
designated as Toxin xwiA. The LD50 of the toxin xwiA was determined with 50 ng/cm2
against Manduca sexta, 100 ng/cm2 against Ostrinia nubilalis, 250 ng/cm2 against Heliothis
virescens, and >1,000 ng/cm2 against Helicoverpa zea. The characterization of a second toxin
complex (XTC-2) is the object of another patent (Sheets et al, 2006). The XTC-2 is a very
large protein complex, between 1,150 - 1,300 kDa. It is composed of at least five different
subunits. Highly purified preparations of the Toxin Complex 2 were bioassayed against
Helicoverpa zea and Heliothis virescens. Against Helicoverpa XTC-2 caused 50% inhibition
of growth at between 0.01 - 0.1 µg/cm2, 100 ng/cm2 were required for fifty percent growth
inhibition by XTC-2 of Heliotis larvae. P. luminescens subsp. laumondii strain TT01 was
intensively studied. First its genome was sequenced (Duchaud et al, 2002), then three
insecticidal toxin sequences were patented (Duchaud et al, 2003). TT01 is toxic in particular
against Lepidoptera. It was bioassayed against P. xylostella with a top dose of 105 cells/ml in
a leaf assay.
The direct use of a new Photorhabdus strain formulated as biopesticide was recently
patent (Bhatnagar et al., 2005). Strain K1 of Photorhabdus luminescens subsp. akhurstii
isolated from Heterorhabditis indica had high insecticidal activity against a broad spectrum of
insect pest in laboratory and field test.
The tested formulations were: alginate beads, liquid spray formulation with and without
added chitinase. In laboratory test, liquid formulation was applied against 4th instar larvae of
P. xylostella on a leaf disc assay (200 µl treatement/15 cm2 leaf surface). The formulations
tested were loaded with 101; 102; 104 and 106 bacteria cells. After 24 hours, 100% morality
was recorded in the 104 and 106 treatments. After 96 hours the insect mortality, in the 101 and
102 treatments, increased to 83% and 97%, respectively. Similar results were obtained by
treating 3rd instar larvae of Earis vitella and Pectinophora gossypiella. Evaluations of the
sprayable formulation were performed in sugarcane field against the woolly aphid, Ceratovacuana lanigera. Treatment with 5 x 1011 cells/ha were able to reduce up to 88% of the insect
infestation (15 days after treatment). In cotton field the liquid formulation of Photorhabdus
was compared to B. thuringiensis Dipel and Heliothis armigera NP virus against bollworms.
The 1 liter /ha of Photorhabdus (1 x 1012 cells/ha) treatment was more effective than the other
products. The same formulation was more effective than the chemicals Endosulfan 35 EC
0.07%, Menocrotophos 36 WSC 0.04% and Quinolphos 25 EC 0.04% to control H. armigera
and Exelatis automosa in pigeon peas fields. The bacterial liquid fermentation was also used
successfully against white ants at the dose of 1 l per termitarius. The addition of chitinase (5
ml/ liter) to the Photorhabdus liquid formulation increased its insecticidal activity against the
White Wooly Aphids on sugarcane plantation.
The antibacterial and antifungal activities of Photorhabdus and Xenorhabdus strains
Some strains of Xenorhabdus and Photorhabdus have also been patented for their ability to
produce antibacterial and antifungal substances. Belonging to this category is the invention
described in application WO 1995/003695 (Webster et al., 1995). The objective of this patent
is to produce naturally-based fungicides with broad-spectrum capabilities to kill fungal
diseases of many classes and in many forms, such as reproductive, vegetative or resting
stages. A further objective is to produce such a fungicide, which is easy to formulate and
apply using conventional pesticide-application equipment and methods. The inventors have
found some 8 bacterial strains of the genera Xenorhabdus and Photorhabdus and the refined
or raw metabolites from culture media can be used as a fungicide for agricultural,
147
horticultural, veterinary or human use. The active ingredient in the fermented broths with
antifungal activity was identified as stilbene and indole derivates. Filtrates of the fermented
broths inhibit the growth of Pythium spp in laboratory assays. Filtrates also controlled the
germination of macroconidia of Fusarium solani and Fusarium oxysporum and conidia of
Botrytis cinerea. The stilbene derived from strain C9 of Photorhabdus luminescens has the
following Minimum Inhibition Concentration (MIC) against some the following pathogenic
fungi: Aspergillus fumigatus (MIC 12 µg/ml), A. flavus (MIC 15 µg/ml), B. cinerea (MIC 25
µg/ml), Candida tropicalis (MIC 12 µg/ml), Cryptococcus neoformans (MIC 12 µg/ml). Four
indole derivates were isolated and characterized from the strain A2 of Xenorhabdus bovienii
these were found most active against B. cinerea (MIC 12.5 µg/ml) and C. neoformans (MIC
25 µg/ml).
The antimicrobial pseudopeptides isolated from X. nematophilus strain F1, represent
another class of antifungal and antibacterial materials (Thaler et al., 2002). Those substances
are secreted into the broth 30 h after inoculation. The pseudopeptides have a molecular weight
between 1.05 and 1.09 kDa. Fifteen pseudopeptides were isolated from the supernatant of
strain F1, some of them are isomers. They have a broad spectrum of activity against phytopathogenic and human pathogenic fungi and bacteria. Laboratory test was performed with
three of the 15 purified fractions against B. cinerea, Piricularia oryzae, Helminthosporium
teres, F. culmorum, Septoria tritici, Alternaria brassicae, Rhizoctonia solani, Phytophtora sp.
and Cladosporium sp. At least one of the three fractions was able to inhibit up to 80% of the
fungal growth when administrated at the dose of 20 ppm or 40 ppm. Minimum Inhibitory
Concentration (MIC) was also determined for 5 purified pseudopeptide fractions against
environmental and human pathogenic bacteria showing high activity versus Gram positive
and negative bacteria (best MIC recorded and expressed as µg/ml: Escherichia coli 7.5,
Salmonella sp. 15, Klebsiella pneumoniae 15, Proteus vulgaris 100, Serratia entomophila 15,
Staphylococcus epidermis 30, Steptococcus sp. 200, Pseudomonas fluorescens 1.5, Bacillus
megaterium 0.75, S. aureus 25, Pseudomonas aeruginosa 12.5, Enterococcus sp. 12.5,
Enterobacter aerogenes 25 and Stentotrophomonas maltophilia 25).
Discussion
Chemical companies and public research institutions are looking for new materials and
techniques to provide better and safer pesticides. Photorhabdus and Xenorhabdus produce
new compounds with potential use to control insect, fungi and bacteria. They may provide a
source for genetic engineering in plants. Until today, 26 of 28 applications related to strains of
the two genera are in the domain of agriculture biotechnology. Patents are applied by big
companies, small medium enterprises, important private and public research centers as well as
individuals. The geographical distribution of the international applications includes: Europe
(Great Britain, France, Swiss and Italy), USA, Canada, Australia and India.
After the first patent on P. luminescens insecticidal toxins ten years ago, its importance as
a source for novel substances grows. There are now more than fifty strains of both genera that
have been found to produce bioactive molecules. New insect toxins, fungicides and
bactericides derived from these bacteria and dozens of sequences, coding for those bioactive
substances, have been discovered and protected by patenting.
TC proteins are the most studied and have now been discovered also in Serratia entomophila and Paenibacillus spp. There are three main types of TC proteins: a group that has very
high intrinsic toxicity so it can harm insects on its own and two additional groups that
enhance the toxicity of the first group. Recently it has been discovered that tc proteins can be
exchanged with each other, the toxicity of a 'stand-alone' TC protein is enhanced by one or
148
more TC protein 'potentiators' derived from an organism of a different genus. This has broad
implications and expands the present range of TC proteins utility (Hey et al., 2004). This
reduces the number of genes and transformation events needed to be expressed by a
transgenic plant to achieve effective control of a wider spectrum of target pests. Use as
synergistic factor with Bt is also possible. Disadvantages of Bt, the lower sensitivity of boll
worms, black cutworm and H. zea can possibly be overcome. Transgenic rice, maize or
tobacco that produce insect toxins TcdA and TcbA have been produced (Petell et al., 2001).
The sequences have modified base compositions making them more similar to plant genes for
enhanced expression. The new sequences are claimed to be suitable for high expression use in
both monocots and dicots.
Despite these innovations, none of these potential products are on the market. Why?
There are some explications to this fact: At first, the active strains are all protected by patents
and are mainly reserved for the production of transgenic plants. The second reason is that
there is little information on the level of toxins producible by fermentation of the bacteria.
The third is the high costs for registration of a new active substance.
Acknowledgements
We gratefully acknowledge Dr. Amir Bercovitz for the review of the manuscript.
References
Apel-Birkhold, P.A., Hey, T.D., Sheets, J.J., Meade, T., Li, Z.S., Lira, J.M., Russell, S.M.,
Thompson, R.L., Mitchell, J. & Fencill, K. 2005: Toxin complex proteins and genes from
Xenorhabdus bovienii. PCT Application WO 2005/067491. World Intellectual Property
Organization, Geneva, Switzerland, www.wipo.org.
Bhatnagar, R.K., Rajagopal Pal, R. & Roa, N.G.V. 2005: Biopesticidal compositions. PCT
Application WO 2005/055724. PCT Application WO 2003/087144. World Intellectual
Property Organization, Geneva, Switzerland, www.wipo.org.
Bintrim, S.B., Mitchell, J.C., Larrina, I.M., Apel-Birkhold, P.A., Green, S.B., Schafer, B., Bevan,
S.A., Young, S.A. & Guo, L. 2004: Xenorhabdus TC proteins and genes for pest control.
PCT application WO 2004/067750. World Intellectual Property Organization, Geneva,
Switzerland, www.wipo.org.
Duchaud, E., Taourit, S., Glaser, P., Frangeul, L., Kunst, F., Danchin, A. & Buchrieser, C. 2002:
Sequence of the Photorhabdus strain TT01 genome and uses. PCT application WO
2002/094867. World Intellectual Property Organization, Geneva, Switzerland,
www.wipo.org.
Duchaud, E., Kunst, F., Glaser, P., Buchrieser, C., Frangeul, L., Chetouani, F., Rusniok, C.,
Taourit, S., Nielsen-Le Roux, C., Boemare, N., Givaudan, A., Vincent, R., Wingate, V.P.,
Powell, K. & Derose, R. 2003: Insecticide proteins from Photorhabdus luminescens. PCT
Application WO 2003/087144. World Intellectual Property Organization, Geneva,
Ensign, J.C., Bowen, D. J., Petell, J., Fatig, R., Schoonover, S., ffrench-Constant, R.H.,
Rocheleau, T.A., Blackburn, M.B., Hey, T.D., Merlo, D.J., Orr, G.L., Roberts, J.L.,
Strickland, J.A., Guo, L., Ciche, T.A. & Sukhapinda, K. 1997: Insecticidal protein toxins
from Photorhabdus. PCT Application WO 1997/017432. World Intellectual Property
Ensign, J.C., Bowen, D. J., Petell, J., Fatig, R., Schoonover, S., ffrench-Constant, R.H.,
Rocheleau, T.A., Blackburn, M.B., Hey, T.D., Merlo, D.J., Orr, G.L., Roberts, J.L.,
Strickland, J.A., Guo L., Ciche, T.A. & Sukhapinda, K. 1998a: Insecticidal protein toxins
149
from Photorhabdus. PCT Application WO 1998/08932. World Intellectual Property
Ensign, J., Bowen, D.J., Tenor, J.L., Ciche, .A., Petell, J.K., Strickland, J.A., Orr, G.L., Fatig,
R.O., Bintrim, S.B. & ffrench-Constant, R.H. 1998b: Insecticidal protein toxins from
Xenorhabdus. PCT application WO 1998/050427. World Intellectual Property Organization, Geneva, Switzerland, www.wipo.org.
ffrench-Constant, R.H., Daboron, P.J., Dowling, A.J. & Waterfield, N.R. 2003: Photorhabdus
luminescens mcf toxin genes and uses thereof. PCT Application WO2003/102129. World
Intellectual Property Organization, Geneva, Switzerland, www.wipo.org.
ffrench-Constant, R.H, & Waterfield, N.R. 2004: DNA sequence from tcd genomic region of
Photothabdus luminescens PCT application WO 2004/044217. World Intellectual Property
Hey, T.D., Schleper, A.D., Bevan, S.A, Bintrim, S.B., Mitchell, J.C., Li, Z.S., Ni, W., Zhu,
B., Merlo, D.J., Apel-Birkhold, P., & Meade, T. 2004: Mixing and matching TC
proteins for pest control. PCT Application WO 2004/067727. World Intellectual
Property Organization, Geneva, Switzerland, www.wipo.org.
Jarrett P., Morgan J.A.W., & Ellis, D. 2000: Insecticidal agents. PCT Application WO
www.wipo.org.
Kramer, V.C., Morgan, M.K., Anderson, A.R., Hart, H.P.,Warren, G.W., Dunn, M.M. & Chen,
J.S. 1999: Insecticidal toxins from Photorhabdus. PCT application WO 1999/042589.
World Intellectual Property Organization, Geneva, Switzerland, www.wipo.org.
Petell, J.K., Merlo, D.J., Herman, R.A., Roberts, J.L. Guo, L. Schafer, B.W., Sukhapinda, K.
& Merlo, A.O. 2001: Transgenic plants expressing Photorhabdus toxin. PCT Application WO 2001/11029. World Intellectual Property Organization, Geneva, Switzerland,
www.wipo.org.
Ragni, A., Valentini, F. & Fridlender, B. 1998: Insecticidal Bacteria. PCT Application WO
98/05212. World Intellectual Property Organization, Geneva, Switzerland, www.wipo.org.
Sheets, J.J., Ni, W.W., Larrina, I.M. & Bevan, S.A. 2006: Second TC complex from Xenorhabdus. PCT application WO 2006/093552. World Intellectual Property Organization,
Geneva, Switzerland, www.wipo.org.
Smigielski, A.J & Akhurst, R.J. 1995: Toxin gene from Xenorhabdus nematophilus. PCT
Thaler, J., Givaudan, A., & Latorse, M.-P. 2002: Antimicrobial pseudopeptides. PCT
Webster, J.M., Chen, G. & Li, J. 1995: Novel fungicidal properties of metabolites, culture broth,
stilbene derivates and indole derivates produced by bacteria. PCT application
www.wipo.org.
p. 150
Exploiting the Photorhabdus genome
R. ffrench-Constant1, A. Dowling1, M. Hares1, J. Parkhill2, N. Waterfield3
1
Biological Sciences, University of Exeter, Pernyn, Cornwall, UK; 2Pathogen Sequencing
Unit, Sanger Center, Hinxton, UK, 3Biology, University of Bath, Bath, UK
Abstract: We now have two finished genomes of Photorhabdus, P. luminescens and P. asymbiotica.
We will describe the insecticidal toxins present in each genome and discuss what we know about their
biology and mode of action. We will also describe novel approaches for the rapid screening of
bacterial genomes for proteins or compounds active against invertebrates (insects, nematodes or
amoebae). Such approaches look set to increase the already growing number of insecticidal toxins
produced by these two species, including the Toxin complexes (Tc's), Makes caterpillars floppy toxins
1 and 2 (Mcf1 and Mcf2) and the PirAB toxins.
150
pp. 151-156
Photorhabdus and Xenorhabdus: potent secondary metabolite
producers
Alexander O. Brachmann, Gertrud Schwär, Helge B. Bode
Institut für Pharmazeutische Biotechnologie, Universität des Saarlandes, Gebäude A4.1,
66123 Saarbrücken, Germany
Abstract: The entomopathogenic bacteria Photorhabdus and Xenorhabdus are sources of many
secondary metabolites and over the last 25 years an increasing number of compounds could be isolated.
Many of these compounds show biological activities and have an antibacterial, antifungal, antinematodal
or cytotoxic effect. Moreover there are a few hints that secondary metabolites are also required for the
interaction between bacteria and nematodes. The recently isolated xenofuranones and anthraquinones are
examples of the nearly inexhaustible arsenal of secondary metabolites from these organsims.
Key words: secondary metabolites, Photorhabdus, Xenorhabdus, anthraquinones, xenofuranone
Introduction
Enterobacteria of the genera Photorhabdus and Xenorhabdus live in symbiosis with
nematodes of the genera Heterorhabditis and Steinernema, respectiveley (e.g., Goodrich-Blair
& Clarke, 2007). Both together are entomopathogenic against many different soil living insect
larvae and are used as biocontrol agents. Moreover, because of their complex life style,
Photorhabdus and Xenorhabdus have become model organisms to study the mutualistic
relationship between their nematode host and furthermore the interaction between nematode
host and the insect prey. In addition these bacteria are perfectly applicable in the laboratory to
study the regulation pathways determining the state of symbiosis and pathogenesis.
Recent findings showed that secondary metabolites also play an important role in
symbiosis and pathogenesis of these bacteria (Eleftherianos et al., 2007). Surprisingly
annotation of the sequenced genomes of Photorhabdus luminescens TT01 (Duchaud et al.,
2003), Xenorhabdus nematophila and Xenorhabdus bovienii (Goldman et al., in preparation)
revealed several biosynthesis gene clusters encoding polyketid synthases (PKS) and nonribosomal peptide synthetases (NRPS) which are involved in secondary metabolism. In P.
luminescens 5.9 % of the genome is dedicated to secondary metabolite biosynthesis and 21
different biosynthesis gene clusters have been identified (Figure 1). This number is
comparable to well-established secondary metabolite producers as streptomycetes and might
indicate the importance of secondary metabolites in the complex life cycle of these bacteria.
Here we would like to mention the current status of natural product research in Xenorhabdus
and Photorhabdus in general and describe its future perspective using examples from our
group.
Secondary Metabolites in Photorhabdus
The major secondary metabolite family in Photorhabdus analyzed so far are stilbenes (1-3)
(Hu et al., 2006; Paul et al., 1981), with isopropylstilbene (1) being the dominant compound.
The red colour of most Photorhabdus strains results from the production of anthraquinones
(4-10) (Brachmann et al., 2007; Richardson et al., 1988) and additional compounds that are
151
152
known from Photorhabdus are the catecholate siderophore photobactin (11) (Ciche et al.,
2003) and carbapenems (Derzelle et al., 2002). However, there is no structural information for
the latter compounds although there is genetic evidence for their production. From all these
compounds stilbenes are of special importance as Photorhabdus is the only stilbene producer
outside the plant kingdom and besides its antibiotic activity 1 has been shown recently to
inhibit the insect phenoloxidase which is a central part of the insect immune system
(Eleftherianos et al., 2007).
Figure 1. Biosynthesis gene clusters and their location in the genome of Photorhabdus
luminescens subsp. laumondii TT01. Polyketidsynthase (PKS), non-ribosomal peptidsynthetase
(NRPS), fatty acid synthase (FAS). Hybrids therof are indicated by a slash (/).
OH
R
OH
O
OH
Isopropylstilbene (1)
Ethylstilbene
(2)
OR
R
5
O
OR
OH
R= Me
R= H
Epoxystilbene
1
OH
4
OR
O
AQ-256 (4)
AQ-270a (5)
AQ-270b (6)
AQ-284a (7)
AQ-284b (8)
AQ-300 (9)
AQ-314 (10)
R
2
O
OH
HO
H
N
HO
N
3
R1
R2
R3
R4
R5
H
Me
H
Me
H
H
Me
H
H
Me
Me
Me
Me
Me
H
H
H
H
H
OH
H
H
H
H
H
H
H
OMe
H
H
H
H
Me
Me
H
(3)
O
Photobactin (11)
Figure 2. Secondary metabolites isolated from Photorhabdus strains.
N
H
O
153
Anthraquinones
Anthraquinones (AQ) have been described from fungi, plants and Gram-positive bacteria.
However, so far Photorhabdus is the only Gram-negative producer of this type of compounds.
Up to now seven different derivatives have been described in the literature (Figure 2). It is
noteworthy that compounds 9-10 were exclusivley isolated from bacteria cultivated in insect
larvae, whereas compounds 4-8 could also be isolated from bacteria grown in artifical media.
The function of these pigments is still unclear but they might be weak antibitotics involved in
outcompeting other bacteria (Sztaricskai et al., 1992).
The chemical structure of anthraquinones indicates that a type II PKS mechanism is
involved in their biosynthesis and indeed one biosynthesis gene cluster was identified in the
genome of P. luminescens strain TT01 encoding the required enzymes (Figure 3) (Brachmann
et al., 2007). Type II PKS closely resemble bacterial fatty acid synthases, however no
reduction of the β-ketogroups takes place resulting in a polyketone intermediate which is
cyclized and further modified. The minimal requirements for a type II PKS are an acyl carrier
protein (AntF) and two ketosynthases (KSα [AntD]and KSβ [AntE]) and therefore these three
proteins are also called `minimal PKS´. Furthermore, cyclases (AntC), aromatases (AntH),
ketoreductases (AntA) are responsible for building up the polycyclic structure. The
involvement of the ant cluster in AQ formation was confirmed by disruption of antE using
plasmid integration resulting in an AQ-negative mutant. As the ant cluster is only the second
example of a type II PKS encoding gene cluster from Gram-negative bacteria (Sandmann et
al., 2007) we started its molecular analysis by deleting selected genes. Surprisingly, deletion
of the aromatase (∆antH) resulted not only in the expected loss of AQ production, but in the
production of two new compounds. After NMR and mass spectrometric analysis of the
isolated compounds they could be identified as mutactin and dehydromutactin which have
also been found in different Streptomyces strains (Hertweck et al., 2007). Both products are
derived from an octaketid backbone, whereas the final AQ product shows a heptaketid
backbone, leading to the conclusion that AntH is not only responsible in aromatisation but
also in determining the final length of the polyketide chain.
Figure 3. Organisation of the anthraquinone biosynthesis cluster in Photorhabdus luminescens
TT01, phenotypes of the wild-type and ∆antH mutant, and structures of mutactin and dehydromutactin.
154
Secondary metabolites in Xenorhabdus
More than 20 secondary metabolites including derivatives of seven different core structures
have been described from different Xenorhabdus species which most of them showing
interesting activities (Figure 4). Phenylacetamides (11-13) (Hwang et al., 2003; Paik et al.,
2001) exhibit a significant antitumor activity against different human cancer cell lines, in
comparison to the well established cytostatic drug etoposide, and especially against gastric
adenocarcinoma cell line (SNU668). The smallest isolated compound so far is benzylideneacetone (14) (Ji et al., 2004) which shows antibacterial activity against some Gram-negative
bacteria. Several indol derivatives have been isolated from X. bovienii (15-18) (Paul et al.,
1981) and X. nematophila (nematophin [19]) (Li et al., 1997) which exhibit good antibacterial
activity including activity against Staphylococcus aureus strains (for 19). Moreover, 15-18 are
active against fungi of medical and agricultural importance. The largest compounds so far are
the xenocoumacins (20-21) (McInerney et al., 1991b) which show antibaterial activity against
many Gram positive bacteria and might even act against Helicobacter pylori as determined by
their antiulcerogenicity against stress-induced gastric ulcers in rats. Xenorhabdins (22-27)
(McInerney et al., 1991a) and xenorxides (28-29) (Li et al., 1998) are dithiolopyrrolone
derivatives which all have antibacterial activity against many Gram negative and postive
bacteria, and also a good insecticidal activity. Compounds 28 and 29 are most likely oxidized
products of 24 and 25, respectively. Xenofuranones (30-31) (Brachmann et al., 2006) are
discussed in in the next paragraph.
O
H
N
R
R
O
14
15
16
17
18
R1
R2
H
H
Ac
Ac
Me
Et
Me
Et
O
H
N
2
1
O
N
H
Nematophin (19)
O
O
OH
H
N
O
NH 2
OH
H
N
H
N
NH
NH 2
S
O
R
O
OH
H
N
N
H
O
OH
Xenocoumacin II (21)
O
S
22
23
24
25
26
27
O
R
2
O
S
N
1
R
N
1
R
O
R1
R2
H
H
Me
Me
Me
Me
n-pentyl
isohexyl
n-pentyl
isohexyl
isobutyl
n-propyl
28
29
OR
O
Xenorxides
Xenorhabdins
O
H
N
O
2
O
S
Xenocoumacin I (20)
OH
OR
N
H
R= Ph
R= Et
R= isopropyl
11
12
13
OH
O
R1
R2
Me
Me
n-pentyl
isohexyl
Xenofuranone A (30)
Xenofuranone B (31)
R= Me
R= H
Figure 4. Secondary metabolites isolated from Xenorhabdus strains.
Xenofuranones
Xenofuranones (30 and 31) have first been isolated from Xenorhabdus szentirmaii DSM16338
(Brachmann et al., 2006) but have recently been identified also in X. stockiae DSM17904 and X.
mauleonii DSM17908 (Figure 5). This indicates that the same compounds can be isolated from
different strains (similar to Photorhabdus strains which all produce stilbenes and most of them
AQs). However, a greater chemical diversity is present in Xenorhabdus in general indicated by
several so far unknown compounds which are unique to the single strains (Figure 5).The
155
biological function of the xenofuranones remains unclear, as these compounds show only a weak
cytotoxic activity against eukaryotic cell lines. However, furanones are known as quorum sensing
molecules, like the halogenated furanone from the red algae Delisea pulchra which inhibits
carbapenem antibiotic synthesis in Erwinia carotovora (de Nys et al., 2006) and one might
speculate that 30 and 31 might serve a similar function between the bacteria and the nematode. To
get an insight into the Xenofuranone biosynthesis we used an inverted feeding approach, in which
12
C labelled precursors are fed to a 13C enriched background and an incorporation of a precursor is
indicated by a mass shift to lower masses using mass spectroscopy coupled to gas
chromatography. Thus we could show that Xenofuranones are derived from phenylpyruvate
dimers, whereas the methyl moiety of Xenofuranone B is introduced via a S-adenosylmethioninedependent methyltransferase.
Figure 5. Production of xenofuranones and unkown compounds (*) by different Xenorhabdus
sp.
Acknowledgements
The authors would like to thank the Universität des Saarlandes for financial support. We are
grateful to our collaborators David Clarke, Nick Waterfield, Steve Forst and Heidi GoodrichBlair for sharing strains and mutants and for useful discussions.
References
Brachmann, A.O., Forst, S., Furgani, G.M., Fodor, A. & Bode, H.B. 2006: Xenofuranones A and
B: phenylpyruvate dimers from Xenorhabdus szentirmaii. J. Nat. Prod. 69: 1830-1832.
Brachmann, A.O., Joyce, S.A., Jenke-Kodama, H., Schwär, G., Clarke, D.J. & Bode, H.B. 2007:
A type II polyketide synthase is responsible for anthraquinone biosynthesis in Photorhabdus
luminescens. ChemBioChem in press.
Ciche, T.A., Blackburn, M., Carney, J.R. & Ensign, J.C. 2003: Photobactin: a catechol siderophore produced by Photorhabdus luminescens, an entomopathogen mutually associated
with Heterorhabditis bacteriophora NC1 nematodes. Appl. Environ. Microbiol. 69: 47064713.
de Nys, R., Givskov, M., Kumar, N., Kjelleberg, S. & Steinberg, P.D. 2006: Furanones. Prog.
Mol. Subcell. Biol. 42: 55-86.
Derzelle, S., Duchaud, E., Kunst, F., Danchin, A. & Bertin, P. 2002: Identification,
characterization, and regulation of a cluster of genes involved in carbapenem biosynthesis in
Photorhabdus luminescens. Appl. Environ. Microbiol. 68: 3780-3789.
156
Duchaud, E., Rusniok, C., Frangeul, L., Buchrieser, C. et al. 2003: The genome sequence of the
entomopathogenic bacterium Photorhabdus luminescens. Nat. Biotechnol. 21: 1307-1313.
Eleftherianos, I., Boundy, S., Joyce, S.A., Aslam, S., Marshall, J.W., Cox, R.J. et al. 2007: An
antibiotic produced by an insect-pathogenic bacterium suppresses host defenses through
phenoloxidase inhibition. Proc. Natl. Acad. Sci. USA 104: 2419-2424.
Goodrich-Blair, H. & Clarke, D.J. 2007: Mutualism and pathogenesis in Xenorhabdus and
Photorhabdus: two roads to the same destination. Mol. Microbiol. 64: 260-268.
Hertweck, C., Luzhetskyy, A., Rebets, Y. & Bechthold, A. 2007: Type II polyketide synthases:
gaining a deeper insight into enzymatic teamwork. Nat. Prod. Rep. 24: 162-190.
Hu, K.J., Li, J.X., Li, B., Webster, J.M. & Chen, G.H. 2006: A novel antimicrobial epoxide
isolated from larval Galleria mellonella infected by the nematode symbiont, Photorhabdus
luminescens (Enterobacteriaceae). Bioorg. Med. Chem. 14: 4677-4681.
Hwang, S.Y., Paik, S., Park, S.H., Kim, H.S. et al. 2003: N-phenethyl-2-phenylacetamide isolated from Xenorhabdus nematophilus induces apoptosis through caspase activation and
calpain-mediated Bax cleavage in U937 cells. Int. J. Oncol. 22: 151-157.
Ji, D., Yi, Y., Kang, G.H., Choi, Y.H., Kim, P., Baek, N.I. & Kim, Y. 2004: Identification of an
antibacterial compound, benzylideneacetone, from Xenorhabdus nematophila against major
plant-pathogenic bacteria. FEMS Microbiol. Lett. 239: 241-248.
Li, J., Hu, K. &Webster, J.M. 1998: Antibiotics from Xenorhabdus spp. and Photorhabdus spp.
Chem. Heterocycl. Compd. 34: 1331-1339.
Li, J.X., Chen, G.H. & Webster, J.M. 1997: Nematophin, a novel antimicrobial substance
produced by Xenorhabdus nematophilus. Can. J. Microbiol. 43: 770-773.
McInerney, B.V., Gregson, R.P., Lacey, M.J., Akhurst, R.J., Lyons, G.R., Rhodes, S.H. et al.
1991a: Biologically active metabolites from Xenorhabdus spp., Part 1. Dithiolopyrrolone
derivatives with antibiotic activity. J. Nat. Prod. 54: 774-784.
McInerney, B.V., Taylor, W.C., Lacey, M.J., Akhurst, R.J. & Gregson, R.P. 1991b: Biologically
active metabolites from Xenorhabdus spp., Part 2. Benzopyran-1-one derivatives with
gastroprotective activity. J. Nat. Prod. 54: 785-795.
Paik, S., Park, Y.H., Suh, S.I., Kim, H.S., Lee, I.S., Park, M.K. et al. 2001: Unusual cytotoxic
phenethylamides from Xenorhabdus nematophilus. Bull. Korean. Chem. Soc. 22: 372-374.
Paul, V.J., Frautschy, S., Fenical, W. & Nealson, K.H. 1981: Antibiotics in microbial ecology Isolation and structure assignment of several new anti-bacterial compounds from the insectsymbiotic bacteria Xenorhabdus spp. J. Chem. Ecol. 7: 589-597.
Richardson, W.H., Schmidt, T.M. & Nealson, K.H. 1988: Identification of an anthraquinone
pigment and a hydroxystilbene antibiotic from Xenorhabdus luminescens. Appl. Environ.
Microbiol. 54: 1602-1605.
Sandmann, A., Dickschat, J., Jenke-Kodama, H., Kunze, B., Dittmann, E. & Müller, R. 2007: A
type II polyketide synthase from the gram-negative bacterium Stigmatella aurantiaca is
involved in aurachin alkaloid biosynthesis. Angew. Chem. Int. Ed. 46: 2712-2716.
Sztaricskai, F., Dinya, Z., Batta, G.Y., Szallas, E., Szentirmai, A. & Fodor, A. 1992: Anthraquinones produced by enterobacters and nematodes. Acta Chim. Hung. 129: 697-707.
pp. 157-164
New perspectives of Xenorhabdus antibiotics research
*,1
András Fodor, 2Steven Forst, 3LeRoy Haynes, 4Mária Hevesi, 1Joseph Hogan,
5
Michael G. Klein, *,6Andrea Máthé-Fodor, 7Erko Stackebrandt, 8Attila Szentirmai,
9
Ferenc Sztaricskai, 10Tibor Érsek, 11Matthias Zeller
*Dept. Biochemistry, ELTE, Budapest, Hungary; 1Dept. of Animal Sciences, OARDC/OSU,
Wooster, OH, USA; 2Dept. Biology, University of Wisconsin-Milwaukee, USA; 3College of
Wooster, Wooster, OH, USA; 4Corvinus University, Budapest, Hungary; 5Dept. Entomology,
OARDC/OSU, Wooster, USA; 6MCIC OARDC/OSU, Wooster, OH, USA; 7DSMZ, Deutsche
Sammlung von Mikroorganismen & Zellkulturen GmbH, Brauschweig, Germany; 8Dept.
Genetics & Appl. Microbiology, University of Debrecen, Hungary; 9Antibiotics Research
Group, Hungarian Academy of Sciences, Debrecen, Hungary; 10Institute of Plant Protection
of HUS, Budapest, Hungary; 11Youngstown State University, Youngstown, OH, USA
Abstract: Antibiotics from bacterial symbionts of entomopathogenic nematodes may be used to
control microbial pathogens of agronomic and medical importance. As a part of a systematic search
for potent antibiotics, the taxonomic placement of 4 Xenorhabdus strains was determined on the basis
of 16S rRNA gene sequences and RiboPrint patterns. They are Xenorhabdus budapestensis,
Xenorhabdus ehlersii, Xenorhabdus innexi, and Xenorhabdus szentirmaii. Strong antimicrobial
activity from X. budapestensis, and X. szentirmaii strains were demonstrated on Gram-positive and
Gram-negative mastitis bacterial isolates in repeated tests and on Erwinia amylovora, the causal agent
of fire blight; as well as on Phytophthora nicotianae. The cell-free media was also effective in
repeated phytotron tests. Antibiotics from X. budapestensis have high thermo-stability, and the effects
are cytotoxic. With mastitis pathogens, Klebsiella pneumoniae was the least susceptible, and
Staphylococcus aureus showed the highest sensitivity to each Xenorhabdus strain tested. Nematophin,
a previously reported antibiotic from X. nematophila was not among the compounds produced by X.
budapestensis. The synthetic racemic nematophin proved ineffective against any bacteria tested.
Xenofuranones A and B have been isolated from cultures of X. szentirmaii. Their structures were
elucidated by NMR and mass spectroscopy. The structure of the water-insoluble, coloured, exocrystal
produced by X. szentirmaii was determined as an antibiotic pigment (iodinin), when in solution, the
iodinin is probably complexed to a polysaccharide, that can be formed from mannitol or adonitol, but
not from D-glucose, D-fructose or glycerol.
Key words: Xenorhabdus, antibiotics, Erwinia, fire blight, mastitis, Phytophthora, exocrystal, iodinin
Introduction
The role of antimicrobial compounds, produced by the bacterial symbionts of entomopathogenic nematodes, is to suppress growth of competitors within the host cadaver. Antibiotic
activity of cultures of Xenorhabdus spp. act against a wide variety of microorganisms,
including Gram-positive and Gram-negative bacteria as well as fungi. Several compounds
with antimicrobial activity have been isolated and identified, (Webster et al., 2002) and many
of them are patented. It seems rational to make a systematic search for new efficient
Xenorhabdus antibiotics, which are not only patentable, but also useable in agricultral
practices to prevent or control microbial pathogens of agronomic, veterinary and medical
importance. Despite two-decades of research, none of the identified and patented Xenorhabdus antibiotics have been made commercially available. There are at least two explana-
157
158
tions for that: (i) there is a good probability of losing highly active compounds during
chemical purification, and identifying those with reduced activity; (ii) the potential of a given
cell free culture might be based on a combination or synergism between molecules with
moderate activity. In this study the main focus was on the potential control of Erwinia
amylovora, causal agent of fire blight disease in apples; the oomycetous plant pathogen
Phytophthora species, such as P. nicotianae and pathogenic Gram positive and negative bacteria
causing mastitis in dairy cows. We compared the potential of antibiotic complexes of
Xenorhabdus strains from 7 species including four recently identified (Lengyel et al., 2005).
For any strain considered as a potential source of new antibiotics, the general toxicity of the
complexes should be separated into general antibiotics and special anti-Xenorhabdus
activities. This study includes a comparative analysis of the anti-Xenorhabdus activities of the
representative Xenorhabdus species.
A new aspect of Xenorhabdus antibiotics research suggested here will not be restricted to
systematically searching for new molecules, but will also take into consideration possible
additive or synergistic effects, improving the antibiological activities of the cell free culture of
the most potent strains such as X. budapestensis and X. szentirmaii. Another novel suggestion
is to try to clone whole operons by coding for potent antibiotics or antibiotic complexes based
on a „shot-gun” strategy to make a short cut in identification of operons over traditional ways
and cloning them one by one. This is a theoretical possibility that we discussed with respected
genetics experts in the field of plant molecular biology and biotechnology.
Bacteria, culture and storage
Frozen bacterial stocks were plated and fresh single colonies were used. Xenorhabdus,
Erwinia and the mastitis bacteria were cultured on LBA, the former two at 25 oC and the latter
at 37 oC. Luria-Broth (LB), Luria Broth Agar (LBA), Nutrient Broth (NB) and Nutrient Agar
(NA) were used as described by Ausubel et al. (1999). X. budapestensis DSM16342T and
AMF20; X. szentirmaii DSM16338T and AMF25; X. innexi DSM 16336T; X. ehlersii DSM
16337T; X. nematophila DSM3370T, ATCC 19061T, AN6/1, and N2-4; X. cabanillasii BP; X.
bovienii DSM 4766T, NYH, SF22, Vije Norway, IS6 and Sulcatus; and X. beddingii DSM
4764T were used. In the first screens strains were tested, including P. luminescence TT01 and
85 isolates from the Hungarian EPB collection. Mastitis isolates, S. aureus (Staph 1-6),
several E. coli strains and K. pneumonia #696 were obtained from The Mastitis Laboratory
at the OSU-OARDC, Wooster, OH. The fire blight pathogen, Erwinia amylovora Ea1 strain,
was isolated from apple trees with fire blight symptoms in Nyárlörinc, Hungary. The control
E. coli S17 λpir pKNOCK was given by Dr. Eric Martens. The oomycetous plant pathogen P.
nicotianae strain was provided and tested by one of us (T. Érsek in Budapest). In agar
diffusion tests, pretreated B. subtilis and B. cereus spores were incorporated into agar and
used as indicator bacteria.
Bioassays of antibiotic activities
An overlay bioassay, measuring the diameter of the clear inhibition zone after 5 days caused
by antibiotics production of a colony developed from 5 µl of overnight (O/N) Xenorhabdus
culture was used (see Fig 1B). In addition, serial dilution of 6-day cell-free Xenorhabdus
cultures was used. The Maximum Inhibition Dilution (MID) was based on serial dilutions of
the cell-free cultures. In Erwinia lab tests the “comb” technique was also used.
Antimicrobial effects
159
In phytotron tests apple branches (Idared M9) were cut and infested with E. amylovora. The
plants were grown at 25o C for 6 weeks. In some experiments, the infestation was made
simultaneously and in others the antibiotics treatment followed the infestation by a day. One
thin branch of each growing plant was infested either with aserially diluted cell-free culture of
X. budapestensis. As positive controls, 0.5 kg/ha streptomycin and 4 l/ha Kasumin 2L were
used. The size of the infected zones was measured 1 and 3 weeks after infestations.
The antimicrobial activities of fresh, stored and autoclaved 6-days old cell free cultures
were tested on Gram-postive (S. auerus Staph 6) and Gram-negative (E. coli Ec 727 and K.
pneumoniae) clinical isolates in 12-well plates. The thermostability, cytotoxic effects and
antixenorhabdus activities of 6-d old Xenorhabdus cultures were determined. The antimicrobial and anti-Xenorhabdus activities of the cultures before and after 24h incubation with
AmberliteR 1148 adsorbents were also determined. The effects of partially purified
antibiotics-complex of X. budapestensis on colony formation, zoospores and cystospores of P.
nicotianae were also tested.
Analysis of secondary metabolites of cell-free cultures of X. budapestensis and
X. szentirmaii
The antibiotics and antixenorhabdus activities of each Xenorhabdus strain were adsorbed by
AmberliteR 1148. With X. budestensis, the active compounds were eluted with 80% methanol
and fractionated (Sztaricskai et al., in preparation). Several ninhidrin positive fractions
showed antimicrobial activities. All but tryptamin were unknown and are being chemically
identified. Nematophin was not among these compounds. We sythetized racemic nematophin
and tested for antimicrobial activity (Furgani et al., submitted). From X. szentirmaii, two
antimirobial compounds, Xenofuranones A and B were identified (Brachmann et al., 2006).
The extracellular crystal of X. szentirmaii was purified, chemically identified and its structure
analysed by X-ray crystallography. Crystals were isolated with a double layer of cellophane
covering LBA. The suspension was placed on the upper surface, and the crystals were
collected from the lower layer.
Effects of Xenorhabdus antibiotics on mastitis pathogens
Of the three mastitis pathogens, S. aureus was the most sensitive and the K. pneumoniae the
most tolerant to the antibiotics of Xenorhabdus spp.. Different isolates of the same pathogen
species reacted quite uniformly. Of the four new species, X. budapestensis and X. szentirmaii
produced more antibiotic activity than X. nematophila or X. bovienii.Antibiotics of X. ehlersii
proved effective only on Staphs. Antibiotics of X. innexi were moderately potent against both
Gram-negative and positive pathogens. Unlike X. nematophila, X. bovienii showed extreme
heterogeneity in its antibiotic production. Similar conclusions could be drawn from overlay
bioassays (Table 1) and serial dilutions (Table 2).
Antibiotics activity of X. budapestensis
The antibiotics of X. budapestensis are extremely effective not only against mastitis
pathogens, but also against different strains of E. amylovora, including streptomycin resistant
strains both in laboratory and phytotron tests. The mechanism is clearly cytotoxic (Fig 1A).
The biological activities of the cell-free cultures of X. budapestensis were unchanged after
autoclaving, but disappeared after 24h incubation with AmberliteR. Unlike the antibiotic activity of other Xenorhabdus strains, this activity was not lost after 10 days at room temperature.
Table 1. Effects of Xenorhabdus antibiotics on mastitis pathogens in overlay bioassays
160
Tested on
S. aureus
Xenorhabdus species and type strains
X. nematophila
X. budapestensis
X. szentirmaii
ATCC91061T
DSM 16342T
DSM 16338T
1
Staph 1
50.33 +/-0.33
44.33 +/- 2.96
51.67+/- 3.84
Staph 2
50.00 +/-1.15
40.33 +/- 0.88
64.00 +/- 0.58
Staph 3
53.33 +/- 5.30
40.33 +/- 0.33
65.00 +/- 0.57
Staph 4
50.00 +/- 0.58
38.33 +/ 1.67
62.00 +/- 0.57
Staph 5
49.67 +/- 3,20
43.67 +/- 1.86
71.00 +/- 0.58
Staph 6
53.33 +/- 4.37
40.67 +/- 0.67
54.00 +/- 10.0
E. c. 471
37.33 +/- 0,33
31.33 +/- 1.33
51.33 +/- 1.45
E. c. 673
32.00 +/- 0.57
36.33 +/- 0.88
41.00 +/- 0.58
E. c. 707
31.00 +/- 0.58
34.00 +/- 0.58
55.00 +/- 0.58
E. c. 727
31.00 +/- 0,58
31.00 +/- 0.58
52.00 +/- 0.58
E. c. 884
33.67 +/- 0.33
30.00 +/- 0.57
60.00 +/- 0.57
E. c. 902
30.67 +/- 0.33
37.00 +/- 0.58
51.00 +/- 0.57
K. p. 696
26.00 +/- 1.73
38.00 +/- 0.57
51.00 +/- 0.58
1
Mean +/- S.E. diameters of the inhibition zones (mm) around the antibiotic producing colonies on
LBA plates (n=3) Staph = Clinical isolate of Staphylococcus aureus; E.c. = Clinical isolate of
Escherichia coli; K.p.= Clinical isolate of Klebsiella pneumoniae #696.
Table 2. MID (V/V% values) of 6-d old cell-free cultures of Xenorhabdus strains tested.
Xenorhabdus
SPECIES
STRAIN
X. budapestensis
DSM 16342T
X. szentirmaii
X. innexii
X. ehlersii
X. cabanillasii
X. bovienii
X. nematophila
DSM 16338T
DSM 16336T
DSM 16337T
BP*
DSM 4766T
NYH
DSM 3370T
ATTC19067T
S. aureus
Staph 6
10
E. coli
E.c.727
10
E. coli
E.c.902
20
Klebsiella
pneumoniae
20
20
30
40
20
30
20
20
20
20
40
>60
30
>60
20
30
30
20
50
>60
30
>60
20
30
20
40
50
>60
40
>60
40
40
40
Antimicrobial activities of ninydrin positive fractions in agar diffusion test
The outline of the separation is presented in Fig 3. Nematophin was not among the products.
Synthesized racemic nematophin was tested and showed no antimicrobial activity. The
partially purified cell-free culture of X. budapestensis inhibited the growth of colonies of P.
nicotianae at 25 ppm (see Fig. 2). At 12.5 ppm it immediately stopped zoospore motility
and disintegrated plasma membranes. At 6.25 ppm zoospores lost their motility within 1 min
and more than 90% of zoospores were disintegrated. Unlike the control (DMSO 0.1%)
zoospores, the treated ones failed to encyst and then germinate. As to cysts (cystospores), the
drug at 12.5 ppm fully inhibits the germination process of cysts in any age. At 6.25 ppm, 0
min cysts (drug is added immediately after vortexing zoospores for 1 min) do not germinate at
all. The 10-min and 20-min cysts appear to be a bit more resistant, but their germination rate
is still very low, i.e. 1-2% and 3-5%, respectively. The separation of antbiotically active
fractions of X. budapestensis wee carried out according to the scheme presented in Fig. 3
161
A
B
Figure 1. Cytotoxic activities of the cell-free cultures of X. budapestensis and X. szentirmaii
on Erwinia amylovora Ea1 strain in the lab (A), and in the greenhouse (B). Fifty and 100
v/v% cell-free cultures of X. budapestensis produced results similar to those by routinely used
antibiotics (streptomycin, kasugamycin, the right 2 columns Fig. 1B). Both significantly
reduced the extension of fire blight symptoms on infested branches when the treatment and
infestation were done simultaneously. On the ordinate of A: 10-x; the living E. amylovora
cells in 50 v/v% of cell-free media of X. budapestensis and X. szentirmaii; B: cm of infested
branch showing fire blight symptoms; EMA 0h: simultaneous treatment and infestation;
EMA-24h: Treatment with X. budapestensis followed the Erwinia infestation 24h.
Figure 2. Effect of fraction 2 (64/20) on growth of Phytophthora nicotianae (in ppm)
Antibiotics of X. szentirmaii
Two Xenofuranones, A and B, were isolated from cultures of X. szentirmaii (Brachmann et
al., 2006) and are now being characterized.
Crystallographic identification of the colored, water-insoluble exocrystal of X. szentirmaii
The type strain of X. szentirmaii has an unusual phenotype. Its swarming activity is unique
and its antibiotic activity outstanding. The colonies are metallic colored due to an exocrystal
(Fig 4). On the surface of the colonies, as well as below them in the agar media, picturesque
crystals occur with different shapes and red-violet colors. In liquid media the crystals also
appear, depending on the carbon source. In oily media such as ENGM (Fodor et al., in preparation), first purple drops occur in the oil and then the crystals. The crystals are completely
insoluble in water. The proton NMR spectrum of the crystals in deuterochloroform showed
162
that the crystals were aromatic in structure, but could not define the complete structure.
Analysis by single crystal X-ray diffraction of the chemical and crystallographic analyses
proved that it is iodinin (supporting material for full details of the crystal analysis available
for request). Its packing in the solid state is dominated by π-stacked layers connected by CH…O and strong O-H…O hydrogen bonds thus resulting in the observed low solubility.
Figure 3. Fractionation of antibiotic activity from X. budapestensis: The diameters of
inhibition zones, (tested on B. subtilis by agar-diffusion method) were proportional with the
activity
Anti-Xenorhabdus activities of strains representing 7 Xenorhabdus species:
The strongest anti-Xenorhabdus activity was shown by X. bovienii NYH. The cell-free culture
of X. ehlersii proved also toxic to many other Xenorhabdus. The strongest antibiotics
producers, X. budapestensis and X. szentirmaii proved rather vulnerable to the antiXenorhabdus compounds of others, and their compounds were hardly effective against other
Xenorhabdus species. X. innexi, a moderate antibiotics producer is highly tolerant to the antiXenorhabdus compounds of all but X. bovienii species. We concluded that there is no
correlation between the general antimicrobial and the anti-Xenorhabdus activities of the
163
Xenorhabdus species. But there was a positive corellation between the anti-Xenorhabdus
activities and sensitivity to anti-Xenorhabdus compounds.
Future perspectives: a suggestion for “shot-gun” cloning of antibiotics operons
Transgenic plants may express environmental-friendly, efficient, antibiotics produced by X.
budapestensis and X. szentirmaii. A strategy may be developed for cloning operons, or
cooperating operons, by adopting a cloning technique using large DNA fragments of 12-15
citrons randomly into a BAC vector behind an inducible promoter. We intend to benefit from
the fact that when Agrobacterium was used to transform Arabidopsis thaliana roots and
seedlings in a large number of plants, the entire binary vector was integrated (Wrenck et al.,
1997). As a first step to clone functional operons responsible for antibiotics production, a
genomic BAC (bacterial artificial chromosome) library will be constructed using a Ti-plasmid
based BAC vector, BIBAC2, supplemented with an inducible promoter. In this vector an
average insert size will be about 136.4 kb (Osoegawa et al., 2007), and our entire library
should represent a 7.5-fold genome coverage. Instead of screening the library by using
cDNAs, we are going to screen antibiotics producing A. tumefaciens colonies among the
transformants. The best construction would be used for getting transgenic A. thaliana, and
later other transgenic plants.
Crystallographic parameters: Monoclinic, P21/c: a = 6.0298(5), b = 5.0752(4), c = 15.854(1) Å, b = 90.421(2)°
Crystal size: 0.48´ 0.15´ 0.02 mm. q range: 2.57 to 28.28°. Data / restraints / parameters: 1206 / 0 / 83. GooF:
1.178. R values [I>2s(I)]: R1 = 0.0699, wR2 = 0.1659.
Figure 4. The chemical structure of the colored component (iodinin) of the exocrystal
produced by X. szentirmaii: Single Crystal Structure of Iodinin (left) and packing of iodinin in
the solid state dominated by p-stacked layers connected by C-H…O and strong O-H…hydrogen bonds resulting in extremely low solubility in organic solvents and complete insolubility
in water (right). The structure iodinin by Hanson and Huml (1969) from another organism.
Acknowledgements
The authors express appreciation to Aranka Kormány, Lajos Földes, Prof.s George P. Rédei
and László Márton (Univ.of Missouri-Columbia and South Carolina), the COST 850 and 862
communities and Prof. Ralf-Udo Ehlers, for their invaluable help through the long years.
164
References
Ausubel, F.M., Brent, R., Kingston, R.E., David D. Moore, D.D., Seidman, J.G., Smith, J.A.,
& Struhl, K. (Eds.) 1999: Short Protocols in Molecular Biology: A Compendium of
Methods from Current Protocols in Molecular Biology. John Wiley & Sons.
Brachmann, A.O., Forst, S., Furgani, G.M., Fodor, A., & Bode, H.B. 2006: Xenofuranones A
and B: phenylpyruvate dimers from Xenorhabdus szentirmaii. J. Nat. Prod. 69: 18301832.
Hanson, A. & Huml, K. 1969: Acta Crystallogr.: Struct. Crystallogr. Cryst. Chem. 25: 1766.
Hogan, J.S. & Smith, K.L. 2003: Coliform mastitis. Vet. Res. 34: 507-519.
Li, J., Chen, G., & Webster, J.M. 1997: Nematophin, a novel antimicrobial substance produced by Xenorhabdus nematophila (Enterobacteriaceae). Can. J. Microbiol. 43: 770-773.
Lengyel, K., Lang, E., Fodor, A., Szállás, E., Schumann, P., & Stackebrandt, E. 2005:
Description of four novel species of Xenorhabdus, family Enterobacteriaceae: Xenorhabdus budapestensis sp. nov., Xenorhabdus ehlersii sp. nov., Xenorhabdus innexi sp.
nov., and Xenorhabdus szentirmaii sp. nov. Syst. Appl. Microbiol. 28: 115-122.
Osoegawa, K.,Vessere, G.M., Li Shu, C., Hoskins, R.A., Abad, J.P., de Pablos, B., Villasante,
A. & de Jong, P.J. 2007: BAC clones generated from sheared DNA. Genomics 89: 291299.
Tailliez, P., Pages, S., Ginibre, N. & Boemare, N. 2006: New insight into diversity in Xenorhabdus, including the description of novel species. Int. J. Syst. Evol. Microbiol. 56:
2805-2818.
Webster, J.M., Chen. G., Hu, K. & Li, J. 2002: Bacterial metabolites. In: Gaugler R. (Ed.),
Entomopathogenic Nematology. CABI International, London: 99-114.
Wenck, A, Czakó, M., Kanevski, I. & Márton L. 1997: Frequent collinear long transfer of
DNA inclusive of the whole binary vector during Agrobacterium-mediated transformation. Plant Mol. Biol. 34: 913-922.
p. 165
Functional genomics of Photorhabdus asymbiotica - rapid virulence
annotation (RVA) of pathogen genomes using invertebrate models
María Sánchez-Contreras1, Richard H. ffrench-Constant2, Nick R. Waterfield1
1
University of Bath, UK; 2University of Exeter, UK
Abstract: Photorhabdus asymbiotica is a symbiont of entomopathogenic nematodes that is emerging
as a human pathogen. The genome sequence is almost completed and the annotation is underway. We
are interested in the functional annotation of virulence factors and as such have developed a screening
method using three model organisms: Manduca sexta, Caenorhabditis elegans and Acanthamoeba
polyphaga. Screening a genomic library of P. asymbiotica with these three organisms has allowed the
identification of toxins, secondary metabolites, secretion systems and completely novel virulence
factors. Mapping these regions in the genome and comparing with P. luminescens TT01 (an insectonly pathogen sequenced strain) has provided clues about virulence regions that are exclusive to the
human pathogen and play a role in infection. This Rapid Virulence Annotation (RVA) is also a
powerful tool to identify virulence genes in other sequenced bacterial pathogens, useful in bridging the
knowledge gap in the the post-genomic era. To illustrate the general utility of this approach we also
present the preliminary results of the application of RVA technology to a plant pathogen, Pseudomonas syringae. Finally in addition to providing an alternative to mammalian testing RVA identifies
of new targets for the development of novel insecticides, nematicides and anti-protist drugs.
References
Joyce, S., Clarke, D.J., ffrench-Constant, R.H., Nimmo, G.R., Looke, D.F.M., Feil, E.J.,
Pearce L. & Waterfield, N.R. 2006: Nematode symbiont for Photorhabdus asymbiotica.
Emerging Infectious Diseases 12: 1562-1564.
Yang, G., Dowling, A.J., Gerike, U. ffrench-Constant, R.H. & Waterfield, N.R. 2006: Photorhabdus virulence cassettes confer injectable insecticidal activity against the wax moth. J.
Bacteriol. 188: 2254-2261.
Waterfield, N.R., Wren, B.W & ffrench-Constant, R.H. 2004: Invertebrates as a source of
emerging human pathogens. Nature Rev. Microbiol. 2: 833-841.
Gerrard, J., Waterfield, N. & Vohrac, R. 2004: Human infection with Photorhabdus
asymbiotica: an emerging bacterial pathogen. Microbes & Infect. 6: 229-237.
165
pp. 166-169
Photorhabdus spp. and Xenorhabdus spp: Only feed for mass
production of nematodes?
Arne Peters
E-nema GmbH, Klausdorfer Str. 28-36, D-24223 Raisdorf, Germany
Abstract: A huge proportion in the nematode taxon Secernentea rely on bacteria as a food source.
Many species within the Rhabitida, like Caenorhabditis elegans, are opportunistically feeding on
several species of bacteria which live on decaying organic matter. The slug-parastic nematode
Phasmarhabditis hermaphrodita can be found in associations with various bacteria, while only few
associations support good nematode growth and pathogenicity against slugs (Wilson et al., 1995). The
genera Steinernema and Heterorhabditis, however, have entered into a symbiotic association with
specific bacterial symbionts. The symbiosis is obligating for the nematode but not for the bacteria,
which will easily grow in vitro without the nematode symbiont. This unilateral nutritional symbiosis is
the key to the success of these nematodes as biocontrol agents since it permits the mass production of
the bacteria on cheap artificial media and at the same time ensures the formation of rather specific
insecticidal nematodes. Besides the nutritional function of the symbiotic bacteria, they play an
important role in modulating nematode development in the insect or in the mass production.
Experience from mass production of Steinernema feltiae, S. carpocapsae and H. bacteriophora
indicate that the conditions of the bacteria preculture affect the modulation of the nematodes’
development by the bacteria.
Key words: entomopathogenic nematodes, Heterorhabditis, Steinernema, mass production
The nematode life cycle
The only free-living stage of entomopathogenic nematodes (Heterorhabditis and Steinernema
species) is the dauer-juvenile (DJ). This non-feeding stage contains symbiotic bacteria of one
species in its intestine. In Steinernema sp. the bacteria are located in a specific pouch (Endo &
Nickle, 1995) while they are distributed along the entire length of the intestine in
Heterorhabditis (Ciche & Ensign, 2003). When these DJs have successfully entered the
insect’s haemocoel they release the symbiotic bacteria and start feeding. This onset of
development is termed ”recovery”. While this first recovery event must obviously be
triggered by signals in the insect haemolymph, recovery in mass production on artificial
media can only be triggered if bacteria are pre-grown on such media. The juveniles develop
into adults which develop eggs. While the first eggs are released, the major part remains in the
uterus of the females (or automictic hermaphrodites in Heterorhabditis spp.) and the offspring
develops inside the uterus of the mother which is killed by the juveniles feeding activity
(endotokia matricida) (Johnigk & Ehlers, 1999). In Heterorhabditis spp., the availability of
food decides whether 1st juvenile stage nematodes develop into amphimictic males and
females or into pre-dauer juvenile stages. If food is scarce the pre-dauer juveniles develop into
DJs, which subsequently leave the insect cadaver. If ample food is available, the pre-dauer
juveniles will develop into hermaphrodites again and another generation is started. The
following sections describe the function of the symbiotic bacteria in modulating the
nematodes’ life cycle in the insect and in in vitro liquid-culture.
166
167
Dauer juvenile recovery
The initial onset of development from the non-feeding DJ stage into the feeding stage is
triggered by insect derived signals. Even bacteria free (axenic) nematodes or nematodes coinjected with streptomycine-sulfate consistently recover at proportions of more than 90%
when injected into Galleria mellonella (Strauch & Ehlers, 1998; Han & Ehlers, 2000). The
substances in the haemolymph triggering recovery have not been identified. In Heterorhabditis spp. recovery is signifycantly reduced if the haemolymph is taken out of the living
insect host (Strauch & Ehlers, 1998).
In vitro cultures of nematodes rely on the recovery signal produced by the symbiotic
bacteria. The bacteria are grown before monoxenic nematodes cultures are added. In liquid
culture, the recovery triggered by the bacteria signal is often lower than the recovery in
freshly infected insects. Values recorded in the commercial liquid culture production at enema range from 10 to 95% in H. bacteriophora, from 70 to 95% in S. feltiae and from 50 to
90% in S. carpocapsae. A range of abiotic factors has been shown to affect DJ recovery
(Ehlers & Shapiro-Ilan, 2005). The most pronounced effect was found in the conditions of the
bacteria pre-culture. Highest and most consistent recovery was found when the bacteria were
grown beyond the exponential phase before nematodes were added (Johnigk et al., 2004). A
characteristic shift in the pH and the respiratory quotient (CO2-uptake/O2-consumption)
during the bacteria preculture is used as a marker to identify the most suitable time for adding
the DJs to the bacteria preculture.
The bacteria derived signal for DJ recovery has been partly characterized for P.
luminescens, the symbiont of H. bacteriophora (Aumann & Ehlers, 2001). There are at least
two compounds involved, which are negatively charged, heat stable and extractable in organic
solvents. One substance is about 20 kDa, the other is about 5 kDa in size. The substances
were found in the bacteria-free supernatant of bacteria cultures. There was also an inhibitory
substance identified.
Further insight into the recovery signals can be deducted from the results of (Han &
Ehlers, 1998). Axenic dauer-juveniles of H. bacteriophora (strain HD6) were treated with
supernatants of bacteria cultures of the Photorhabdus symbionts from H. indica (LN2), H.
megidis (HNA), and an unidentified Heterorhabditis species (Q6) from China as well as with
supernatants from different Xenorhabdus species, symbionts of Steinernema spp.. Spontaneous recovery in the bacteria free culture medium was 7.5%. There was a consistently
lower recovery in the supernatants of Xenorhabdus species while recovery was raised to 45 to
55% in supernatants of all Photorhabdus isolates tested. Hence, the recovery signal was not as
specific as the overall association of the bacteria with the nematodes. A dauer-recoveryinhibiting-activity could be found in the supernatants. When testing the recovery of H.
bacteriophora in the P. luminescens from H. bacteriophora, highest values were recorded
when cells were suspended in Ringer’s solution, while recovery was reduced when bacteria
cells were suspended in the cell-free supernatant of P. temperata, P. luminescens originating
from H. indica or the unidentified Heterorhabditis sp. from China (Fig. 1). Interestingly,
nematode recovery was most suppressed in the supernatant of the symbiotically associated
bacterium isolate. Apparently, the inhibiting factor occurs mainly extracellular in the supernatant and is more specific to the symbiotically associated nematode strain than the recovery
triggering factor, which is bound or constantly released from the bacteria cells. One might
speculate whether the triggering factor is released by the bacteria and subsequently degrading
into an inhibiting factor.
168
Nutritional function
The growth and fecundity of the nematodes is dependent on the quality of the bacterial food.
Crystalline inclusions proteins (CIPs) in the bacteria cells have been identified as a crucial food
component.. Two CIPs of 22 and 26 kDa were found in X. nematophilus, the symbiont of S.
carpocapsae (Couche & Gregson, 1987). Likewise, there are two CIPs of 11,6 and 11,3 kDa
described from Photorhabdus luminescens ((Bintrim Scott & Ensign Jerald, 1998)), which make
up approximately 40% of the total protein content in stationary phase cells. If the genes encoding
these proteins were inactivated, the bacteria did no longer support nematode growth. Correspondingly, the secondary phase variant of P. luminescens, which can be induced by osmotic stress
or oxygen depletion, also lacks the ability to produce CIPs and does not support nematode
growth (Krasomil-Osterfeld, 1997). The amount of good quality bacteria is crucial for high
reproduction rates. In liquid mass production of H. bacteriophora, it bacteria precultures which
result in high nematode recovery do not necessarily provide a good quality food. More than
once, e-nema was facing processes with >80% recovery but < 5 offspring per hermaphrodites.
60%
50%
40%
30%
20%
10%
0%
Ringer
LN2
HNA
H06
Q6
Figure 1: Percent recovery of axenic dauer juveniles of Heterorhabditis bacteriophora H06 in
cells of Photorhabdus luminescens isolated from H. indica supplemented with Ringer or
supernatants of P. luminescens from H. indica LN2, H. megidis HNA, H. bacteriophora H06
and Heterorhabditis sp. Q6 (data from Han & Ehlers (1998) with author’s permission).
Steering alternative development pathways
Further down the development pathway, the availability of food is the major parameter steering
the development of freshly hatched nematodes from the hermaphrodites in Heterorhabditis spp.
If no food is available for 24 hours about 90% will develop into DJs, which themselves always
develop into automictic hermaphrodites. If put into a bacteria suspension, a high proportion of
juveniles (>60%) will develop into amphimictic females and males (Strauch et al., 1994).
Finally, during DJ formation, the dauer-recovery-inhibiting activity of the bacteria supernatant becomes important. In the insect as well as in mass production, most of the nematodes that
reproduced should become DJs, propagules for infecting new hosts. At e-nema an onset of
development of DJs at the end of the production process has so far never been identified as a
problem in Steinernema spp. but sometimes in H. bacteriophora. Dauer-juveniles which start
development before being harvested will survive only a few days in storage. Onset of DJ
development at the end of the reproduction cycle seems to be associated to populations with a
higher proportion of automictic males and females in Heterorhabditis.
169
Conclusion
The role of the symbiotic bacteria for the development of entomopathogenic nematodes is far
more than just providing a food source. The bacteria modulate the development of the nematodes
and ensure that DJs become colonised with the bacteria before leaving the insect or the
production vessel. Occasional failures in the liquid culture demonstrate the plasticity in these
functions on the side of the symbiotic bacteria. Process factors are of major importance for the
effect of the symbiotic bacterial culture on nematode development. Likewise, it can be expected
that many other active bacterial metabolites are only expressed under certain culturing
conditions.
References
Aumann, J. & Ehlers, R.U. 2001: Physico-chemical properties and mode of action of a signal
from the symbiotic bacterium Photorhabdus luminescens inducing dauer juvenile recovery in
the entomopathogenic nematode Heterorhabditis bacteriophora. Nematology 3: 849-853.
Bintrim Scott, B. & Ensign Jerald, C. 1998: Insertional inactivation of genes encoding the
crystalline inclusion proteins of Photorhabdus luminescens results in mutants with pleiotropic phenotypes. Journal of Bacteriology 180: 1261-1269.
Ciche, T.A. & Ensign, J.C. 2003: For the insect pathogen Photorhabdus luminescens, which end
of a nematode is out? Applied and Environmental Microbiology 69: 1890-1897.
Couche, G.A. & Gregson, R.P. 1987: Protein inclusions produced by the entomopathogenic
bacterium Xenorhabdus nematophilus subsp. nematophilus. J. Bacteriol. 169: 5279-5288.
Ehlers, R.U. & Shapiro-Ilan, D.I. 2005: Mass production. In: Nematodes as Biocontrol Agents,
eds. Grewal, Ehlers and Shapiro-Ilan: 65-78.
Endo, B.Y. & Nickle, W.R. 1995: Ultrastructure of anterior and mid-regions of infective
juveniles of Steinernema feltiae. Fundamental and Applied Nematology 18: 271-294.
Han, R.C. & Ehlers, R.U. 1998: Cultivation of axenic Heterorhabditis spp. dauer juveniles and
their response to non-specific Photorhabdus luminescens food signals. Nematologica 44:
425-435.
Han, R.C. & Ehlers, R.U. 2000: Pathogenicity, development, and reproduction of Heterorhabditis bacteriophora and Steinernema carpocapsae under axenic in vivo conditions.
Journal of Invertebrate Pathology 75: 55-58.
Johnigk, S.A., Ecke, F., Poehling, M. & Ehlers, R.U. 2004: Liquid culture mass production of
biocontrol nematodes, Heterorhabditis bacteriophora (Nematoda: Rhabditida): improved
timing of dauer juvenile inoculation. Applied Microbiology and Biotechnology 64: 651-658.
Johnigk, S.A. & Ehlers, R.U. 1999: Endotokia matricida in hermaphrodites of Heterorhabditis
spp. and the effect of the food supply. Nematology 1: 717-726.
Krasomil-Osterfeld, K.C. 1997: Phase II variants of Photorhabdus luminescens are induced by
growth in low-osmolarity medium. Symbiosis 22: 155-165.
Strauch, O. & Ehlers, R.U. 1998: Food signal production of Photorhabdus luminescens inducing
the recovery of entomopathogenic nematodes Heterorhabditis spp. in liquid culture. Applied
Microbiology and Biotechnology 50: 369-374.
Strauch, O., Stoessel, S. & Ehlers, R.-U. 1994: Culture conditions define automictic or amphimictic reproduction in entomopathogenic rhabditid nematodes of the genus Heterorhabditis.
Fund. Appl. Nematol. 17: 575-582.
Wilson, M.J., Glen, D.M., George, S.K. & Pearce, J.D. 1995: Selection of a bacterium for the
mass production of Phasmarhabditis hermaphrodita (Nematoda: Rhabditidae) as a biocontrol agent for slugs. Fundamental and Applied Nematology 18: 419-425.
170
Fungi
173
174
pp. 173-177
Assessing winter survival of Pandora neoaphidis in
soil applying bioassay and molecular approaches
Anselme Fournier, Franco Widmer, Siegfried Keller, Jürg Enkerli
Agroscope Reckenholz-Tänikon Research Station ART, 8046 Zürich, Switzerland
Abstract: Pandora neoaphidis (Entomophthorales) is one of the most important fungal pathogens of
aphids and it has a great potential for use in biocontrol. As cultivation of P. neoaphidis is difficult,
conservation biocontrol strategies are favoured. However, little is known on overwintering strategies
of this fungus. It is hypothesized that natural areas may play an important role for survival and that
undisturbed soil may serve as inoculum source for new populations in spring. To test these
hypotheses, we have developed a cultivation-independent PCR-based diagnostic tool that allowed for
detection of P. neoaphidis DNA in top soil samples collected during winter from a nettle field
harboring infected aphids in fall. Results suggested an overwintering stage of P. neoaphidis in top soil
layers. The PCR-based method, however, does not provide information on viability or virulence of
detected P. neoaphidis material. Therefore, a field study was initiated in summer 2006 which will last
until spring 2007. It aims at investigating winter survival of P. neoaphidis in top soil layers and to test
whether P. neoaphidis material detected with the molecular tool represents infectious fungal material.
For this purpose, molecular analyses of soil samples are accompanied with a bioassay in which aphids
are placed on soil samples and P. neoaphidis infection is monitored, and recorded as aphid mortality.
The experimental layout consists of eight replicated caged plots (0.16 m2) for each of four different
treatments: 1) paf plots: lucerne plants inoculated with pea aphids and the fungus P. neoaphidis; 2) pa
plots: lucerne plants with aphids but without artificial P. neoaphidis inoculation; 3) p plots: lucerne
plants without aphids and P. neoaphidis; and 4) bs plots: bare soil, which was covered with a weed
barrier fabric. Soil samples were collected at four different time points in 2006. To date, bioassays and
molecular analyses were carried out on soil samples from paf plots. Our preliminary results indicate a
good correlation between bioassay data and PCR-based data, and suggest a decrease of P. neoaphidis
inoculum in soil after winter begins.
Key words: Pandora neoaphidis, molecular detection, conservation biocontrol, winter survival, bioassay
Introduction
Pandora neoaphidis (Remaudière and Hennebert; Zygomycota, Entomophthorales) is one of
the most important fungal pathogens infecting aphids (Homoptera: Aphidoidea) in temperate
areas (Keller and Suter, 1980). This aphid-specific fungus has been reported to cause natural
epizootics, which can dramatically reduce host populations (e.g. Keller and Suter, 1980; Feng
et al., 1991). However, natural epizootics often occur too late to reduce aphid populations
below the damage threshold (Keller, 1998; Keller and Suter, 1980).
P. neoaphidis has a great potential for use in biological control of aphids. Two approaches i.e. inundation and inoculation biocontrol have been investigated in various studies, but
they have shown limited effectiveness (Wilding, 1981; Wilding et al. 1990; Shah et al., 2000).
Conservation biocontrol, which is defined as a “modification of the environment or existing
practices to protect and enhance specific natural enemies or other organisms to reduce the
effect of pests” (Eilenberg et al., 2001), is a promising third approach for the control of aphids
with P. neoaphidis. To implement such conservation biological control strategies, detailed
knowledge on the life cycle and ecology of the pathogen are prerequisites. However, many of
173
174
these aspects are only poorly understood for P. neoaphidis. Especially, knowledge on overwintering sites and mechanisms, as well as the initiation of infection in spring is very limited.
It is hypothesized that natural areas may play an important role for the winter survival of P.
neoaphidis (Keller, 1998) and that undisturbed soil may serve as inoculum source for new
populations in spring (Nielsen et al., 2003).
We developed a cultivation-independent PCR-based diagnostic tool that allows for a
specific, sensitive, and fast detection of P. neoaphidis DNA in various environmental samples
including infected aphid cadavers, soil samples, living plant material, and plant debris
(Fournier et al., in preparation). This tool consists of species-specific primer pairs that target
sequences in the rRNA gene cluster of P. neoaphidis. The application of this tool to soil
samples collected during winter 2004/2005 from a nettle field harbouring infected aphids in
2004, suggested an overwintering stage of P. neoaphidis in top soil layers. Although such a
PCR-based diagnostic tool may offer great advantages because of its cultivation-independence and sensitivity, it does not provide information on the viability or the virulence of the
fungal material detected in the environment.
The aims of this follow-up study were to investigate the winter survival of P. neoaphidis
in top soil layers and to test whether P. neoaphidis material detected with the molecular tool
represents infectious fungal material. For this purpose, a field experiment was initiated in
August 2006 with caged naturally and artificially infected aphid populations. P. neoaphidis
infection was monitored and the presence of the fungal inoculum in top soil layers was
investigated with a bioassay as well as with the cultivation-independent PCR-based approach.
Experimental layout
The plot experiment was established, in a grass-clover field at Agroscope ReckenholzTänikon Research Station ART (Zurich, Switzerland) in summer 2006. The experimental
layout consists of 32 plots of 0.16 m2 arranged in a complete randomized block design with 8
replicates of 4 treatments. The spacing between two plots was of 1.5 m. The four types of
treatments were designed as follows: 1) paf plots: 16 lucerne plants inoculated with
approximately 1500 healthy pea aphids (Acyrthosiphon pisum) (released on October 2) and
150 aphids that were infected with the fungus P. neoaphidis (released on October 10 and 16);
2) pa plots: Lucerne plants with aphids but without artificial P. neoaphidis inoculation; 3) p
plots: Lucerne plants without aphids and P. neoaphidis; and 4) bs plots: bare soil. p, pa, paf
plots were caged with a 200 µm Nitext® mesh fabric (Sefar, Heiden, Switzerland) to avoid
insect transit, whereas soil of bs plots was covered with a weed barrier fabric (‘GrowStop’,
Windhager, Thalgau, Austria)
Monitoring of aphid populations and prevalence of infection
After releasing the aphids infected with P. neoaphidis into paf plots, the aphid population as
well as the percentage of P. neoaphidis infected aphids was monitored at three time points
(October 22, October 29, December 10) in paf and pa plots. The aphid population was
estimated by counting all aphids present on one plant per plot. To estimate the prevalence of
P. neoaphidis infection per plot, 50 3rd to 4th instar aphid nymphs that did not display
infection symptoms were collected from each plot and were transferred to individual faba
bean (Vicia faba) plants in pots wrapped with cellophane bags (Celloclair AG, Liestal,
Switzerland). After 5 days of incubation (18oC with a 16:8 L:D), the number of aphids that
died from P. neoaphidis infection was determined.
175
Monitoring of P. neoaphidis in the soil
Top soil samples (top 1 cm soil layer) were collected from every plot at four different time
points in 2006: 1) on October 2, just before releasing aphids into pa and paf plots; 2) on
November 2, after high levels of infection with P. neoaphidis were observed in paf plots and
in pa plots; 3) on November 21, after the first nights with temperatures below freezing; and 4)
on December 13, when no more living aphids were observed in the paf and pa plots.
Bioassay: The soil samples were transferred to 10 cm Petri dishes without disturbing the
soil structure. After 24 h incubation at 18oC with a 16:8 L:D photoperiod, the soil samples
were screened for the presence of P. neoaphidis by performing a bioassay: Approximately
100 A. pisum aphids of all developmental stages originating from a laboratory culture were
introduced to each soil sample and incubated for 14h at 18oC in the dark. Subsequently, 20 3rd
to 4th instar nymphs per Petri dish were transferred to a bean plant. After 7 days of incubation,
the number of aphids that died from P. neoaphidis infection (P. neoaphidis cadavers) was
determined. Mortality was calculated according to Feng et al., 1991 as: mortality (%) =
[(number of P. neoaphidis cadavers)/(live aphids + P. neoaphidis cadavers)] x 100. For each
time point, averages were calculated for the 8 replicates per treatment.
PCR-based detection: 500 mg of soil were collected from each petri dish immediately
after collection of the top soil and metagenomic DNA was extracted according to Bürgmann
et al. (2001). The PCR-based detection of P. neoaphidis was performed using a pair of
specific primers targeting sequences in the rRNA gene cluster of P. neoaphidis (Fournier et
al., in preparation).
Monitoring of aphid populations and prevalence of infection
On October 22, less than two weeks after the inoculation of paf plots with P. neoaphidis
infected aphids, the average aphid population in paf plots was estimated at 6’700, and the
prevalence of P. neoaphidis infection reached an average of 88% per plot. At the same date,
the average aphid population in pa plots was 8’200 and the prevalence of infection with P.
neoaphidis was 16%. Even tough pa plots were not artificially inoculated with the fungus, it
rapidly established itself in these plots. The origin of the fungal material that infected the
aphids in the pa plots is not known. This material may have originated from the paf plots or
from the surrounding fields.
On October 29, due to high prevalence of P. neoaphidis infection, the aphid population
in paf plots has dropped to less than 900 individuals per plot, and the prevalence of infected
aphids was 90%. The average aphid population in pa plots increased to 11’000 individuals
and the prevalence of infection reached 68%. On December 10, no more living aphids were
present in pa and paf plots.
Bioassay and PCR-based detection
Currently, bioassays and PCR-based analyses were performed with all soil samples collected
from paf plots in 2006 (Figure 1). P. neoaphidis was neither detected with the bioassay nor
with the PCR-based method in the soil samples collected from the paf plots on October 2
(before releasing the aphids in pa and paf plots). In the paf soil samples collected on
November 2 (approximately 2 weeks after releasing P. neoaphidis in paf plots) an average
aphid mortality of 47% was recorded with the bioassay, and signals (6 strong, 2 weak) of PCR
products of the expected size were detected in all eight replicates. On November 21, the
bioassay aphid mortality was 44% and PCR signals (7 strong, 1 weak) were detected in all paf
samples. On December 13, when no more living aphids were present in the plots, the bioassay
176
aphid mortality in the bioassay dropped to 1% and overall PCR signals were weaker than on
November 2 and 21. Positive signals were detected in 6 samples of the 8 replicates (2 strong,
4 weak).
Bioassay
mortality
October 2
November 2
November 21
December 13
0%
47%
44%
1%
PCR-based
detection
Figure 1. Results of bioassays and PCR-based analyses performed with soil samples collected
from paf plots between October and December 2006. A) Bioassay results, expressed as
average percent mortality of the eight replicate soil samples collected from paf plots at each
time point. B) PCR-based detection, obtained with specific amplification of a targeted
sequence from the rRNA gene cluster of P. neoaphidis. ‘++’: strong signal of PCR product;
‘+’: weak signal; ‘–‘: no signal.
Monitoring of the aphid population and the prevalence of P. neoaphidis infection
allowed to determine that several thousands of aphids were infected with P. neoaphidis in
every pa and paf plot at the end of October 2006. At this time point the prevalence of P.
neoaphidis in paf plots was so high (90%) that the aphid population was strongly reduced
(<1000 aphids/plot). This demonstrated the potential of P. neoaphidis to control aphid
populations. The fungal material that was generated could be detected in the soil of all paf
plots with the bioassay as well as with the PCR-based method. Our results show a correlation
between the bioassay data and the PCR-based data obtained from the analyses the paf soil
samples collected at all four different time points, suggesting that P. neoaphidis material
detected by PCR may represent infectious material. Data revealed that a high level of P.
neoaphidis inoculum was present in the soil of paf plots in November 2 and 21 (after a high
P. neoaphidis prevalence was detected in these plots) but that the level of inoculum strongly
decreased until December 13 (at the beginning of winter and at a time when no more living
aphids were present in the plots). These preliminary results suggest a strong decrease of P.
neoaphidis inoculum in the soil during winter. The results of additional bioassay experiments
(in spring 2007), as well as the molecular analysis of all soil samples, will provide further
information about the role of soil as a matrix for winter survival of P. neoaphidis.
Acknowledgements
We would like to thank M. Walburger, C. Schweizer, C. Mauchle, and A. Meier for technical
assistance with the bioassay experiments. This project is part of the framework of the
European Cooperation in the Field of Scientific and Technical Research (COST), and is
financed by Swiss State Secretariat for Education and Research (SER) (BBW CO2.0051).
References
Bürgmann, H., Pesaro, M., Widmer, F., Zeyer, J. 2001. A strategy for optimizing quality and
quantity of DNA extracted from soil. J. Microbiol. Meth. 45: 7-20.
177
Eilenberg, J., Hajek, A., Lomer, C. 2001. Suggestions for unifying the terminology in biological control. BioControl 46: 387-400.
Feng, M.G., Johnson, J. B., Halbert, S. E. 1991. Natural control of cereal aphids (Homoptera:
Aphididae) by Entomopathogenic fungi (Zygomycetes:Entomophthorales) and parasitoids
(Hymenoptera: Braconidae and Encyrtidae) on irrigated spring wheat in southwestern
Idaho. Environ. Entomol. 20, 1699-1710.
Fournier, A., Enkerli, J., Keller, S., Widmer, F. (in preparation). Molecular tools for cultivation-independent monitoring of Pandora neoaphidis in conservation biocontrol.
Keller, S., Suter, H. 1980. Epizootiologische Untersuchungen über das EntomophthoraAuftreten bei feldbaulich wichtigen Blattlausarten. Acta Oecol. Oecol. Appl. 1: 63-81.
Keller, S. 1998. The role of Entomophthorales in a sustainable agriculture. Insect Pathogens
and Insect Parasitic Nematodes, IOBC/wprs Bulletin 21(4): 13-16.
Nielsen, C., Hajek, A.E., Humber, R.A., Bresciani, J., Eilenberg J. 2003. Soil as an environment for winter survival of aphid-pathogenic Entomophthorales. Biol. Control 28: 92-100.
Shah, P.A., Aebi, M., Tuor, U. 2000. Infection of Macrosiphum euphorbiae with mycelial
preparations of Erynia neoaphidis in a greenhouse trial. Mycol. Res. 104: 645-652.
Wilding, N. 1981. The effect of introducing aphid pathogenic Entomophthoraceae into field
populations of Aphis fabae. Ann. Appl. Biol. 99: 11-23.
Wilding, N., Mardell, S.K., Brobyn, P.J., Wratten, S.D., Lomas, J. 1990. The effect of introducing the aphid pathogenic fungus Erynia neoaphidis into populations of cereal aphids.
Ann. Appl. Biol. 117: 683-691.
pp. 178-185
Partial purification and characterization of an insecticidal and
antifeedant protein produced by the entomopathogenic fungus
Metarhizium anisopliae
Almudena Ortiz-Urquiza, Inmaculada Garrido-Jurado, Cándido Santiago-Alvarez,
Enrique Quesada-Moraga
Department of Agricultural and Forestry Sciences, ETSIAM, University of Cordoba. Campus
de Rabanales. Building C4 “Celestino Mutis”. Cordoba 14071. España (Spain)
Abstract: Entomopathogenic fungi (EF) produce some macromolecular compounds that may be
pathogenicity determinants and an unexplored source of new insecticidal compounds of natural origin. In
our screening approach to evaluate production of insecticidal proteins among our collection of
autochthonous strains of EF, we found one M. anisopliae isolate that secretes a protein with insecticidal
and antifeedant properties. The oral toxicity of the crude protein soluble extract (CPSE) from the shake
culture of this isolate in Adamek’s liquid medium was tested in a diet test against adults of Ceratitis
capitata (Wied.) (Diptera: Tephritidae) and with alfalfa leaf disks against 2nd instar Spodoptera littoralis
(Lepidoptera; Noctuidae). For both species, mortality caused by the CPSE progressively increased as a
function of protein concentration and exposure time. The insecticidal activity of the CPSE was significantly reduced after exposure to protease treatments and its showed high thermostability. The toxic
protein has been completely purified by liquid chromatography.
Key words: Metarhizium anisopliae, insecticidal protein, antifeedant, Ceratitis capitata, Spodoptera
littoralis
Introduction
Since synthetic chemical insecticides have toxic effects on non target organisms, including
animals and humans, it is necessary to look for an environmental friendly alternative such as
compounds of natural origin. The success of these natural products is due to their low
ecotoxicological profile and their short persistence in the environment. EF are a poorly
explored source of insecticidal compounds of natural origin that can be either low molecular
weight secondary metabolites (Amiri et al., 1999; Bandani and Butt, 1999) or high molecular
weight encoding for genes (Mazet and Vey, 1995; Quesada-Moraga and Vey, 2003; QuesadaMoraga and Vey, 2004). Twenty-five fungal isolates have been screened for secreted fungal
insecticidal proteins active against S. littoralis (Quesada-Moraga et al., 2006). Only the crude
protein soluble extract from M. anisopliae isolate EAMa 01/58-Su was active against S.
littoralis. This paper reports the insecticidal activity per os of this extract against S. littoralis
and C. capitata and its purification by liquid chromatography.
Fungal and insect origin
The isolate EAMa 01/58-su of the entomopathogenic fungus Metarhizium anisopliae was
obtained from the culture collection at CRAF Department of the University of Cordoba.
Spodoptera littoralis and Ceratitis capitata were obtained from stock colonies maintained
178
179
under insectary conditions (26°C ± 2°C, 60 ± 5 % RH and 16 h day length. The lepidopteran
species S. littoralis were fed with an artificial diet (Poitout and Bues, 1974). Flies were fed
also on an artificial diet consisting of sucrose and protein-hydrolysate (10:1 w/w).
Production of insecticidal proteins and bioassays
A primary culture was prepared by inoculating 1 ml of conidial suspension (adjusted to 1x107
spores/ml) into 100 ml Erlenmeyer flasks, containing 25 ml of Adamek’s liquid medium
(Adamek, 1963) and cultured at 25ºC on a rotatory shaker at 110 r.p.m. for 4 days. For largescale growth of the fungus, 2 ml of the primary culture were transferred into 1 l Erlenmeyer
flasks containing 250 ml of the same medium, and cultured in the same way for 7 days, before
removing the mycelial material by filtration through Whatman N°3 filter paper. The CPSE
extract were obtained by precipitation with 90% of saturation of ammonium sulphate and
centrifugation at 10,000 g for 30 min. The CPSE was desalted by dialyzing against distilled
water by means of a 6-8 kDa cut-off membrane. This desalted fraction was concentrated with
polyethylene glycol 20,000 and then centrifugated at 10,000 g for 10 min and finally filtrated
twice by pressure filtration with a GF-prefilter and a 45 µm filter respectively.
The oral toxicity of the CPSE secreted by the EAMa 01/58-Su was tested in a diet test for
S. littoralis and C. capitata. Second instar S. littoralis larvae were placed singly in plastic cup
and fed on alfalfa leaf disc (5 mm diameter). Each disc was treated with a 5 µl aliquot
containing the protein extract at three different concentrations: 2, 4 and 8 mg protein/ml,
equivalent to 10, 20, and 40 µg protein/insect, respectively. Protein concentration was determined by the Bradford assay (Bradford, 1976) using bovine serum albumin as standard. The
controls were treated with 5 µl of the desalted Adamek’s medium protein fraction. In treated
and control insects, the alfalfa leaf discs were replaced daily by a newly treated one during a 7
days period. Three replicates, 30 insects each, were used for each treatment and for controls.
To test the oral toxicity against C. capitata emerging adults were placed in cages and fed
daily with 100 µl of testing suspension consisting on CPSE incorporated in the artificial diet.
The CPSE was tested at the same concentrations. The controls were treated with the same
volume of the desalted Adamek’s medium protein fraction with sucrose and protein-hydrolysate. Each treatment consisted of three replicates, 10 insects each.
The antifeedant activity of the CPSE was tested at the highest dose (40 µg/insect
equivalent to 8mg/ml) in a non-choice assay with 2nd instar S. littoralis larvae and emerging
adults of C. capitata by measuring the ingested area of the above leaf-disc. Consumed areas in
control and treated leaf discs were measured using Image-Pro Plus 4.5.0.29 software for
Windows. The daily volume ingested by ten flies was calculated from the remaining volume
of testing suspension in the micro tube cup, measured by means of a disposable precalibrated
pipette. Evaporation of testing and control suspensions was estimated by running in parallel
several units without flies. The ingested volume was calculated as V = (X-E)(100 µl)/9 cm,
where X is the height reached in the pre-calibrated pipette by the remaining volume of testing
suspension, E is the daily average evaporation, 100µl is the volume offered to flies and 9 cm
is the height reached by 100 µl aliquot. For both insect the antifeedant index was calculated
from the following equation IA = (C-T)/(C+T), where C is the ingested leaf area (mm2) or
volume (ml), depending on the insect, in control and T is the ingested leaf area (mm2) or
volume (ml) in the treatment.
Effect of the exposure time on the insecticidal activity of crude protein soluble extract
The effect of the exposure time on the chronic insecticidal activity of the CPSE was evaluated
in S. littoralis and C. capitata, as above, at concentrations of 40 µg protein/insect equivalent
to 8 mg protein/ml, using an experimental protocol including four exposure time and the
180
controls. Insects were exposed 24, 48, 72 and 96 h. After each exposure time, insects were fed
with untreated leaf disc or 100 µl of control suspension depending on the insect species. In the
case of S. littoralis three replicates 20 insects each, were used for each group and for control.
C. capitata experiment was carried out with three replicates consisted of 10 emerging flies.
The effect of temperature and protease treatments on the insecticidal activity
The CPSE of 01/58-Su isolate was incubated at two temperatures, 60ºC for 2 h and 120ºC for
20 min. It was also incubated for 2h at 37ºC with solutions of trypsin, pronase and proteinase
K. The treated solutions were offered to second instar S. littoralis larvae and to C. capitata
adults as described above. Control insects were fed on the desalted fraction of the Adamek’s
liquid medium with the same temperature and protease treatments. Three replicates consisting
of 20 larvae or 10 flies each were used per treatment.
Purification procedure
A volume of crude extract was concentrated with methanol-trichlorometane (Wessel and
Flügge, 1984). Then, the resuspended proteins were applied to a Blue Hp column (affinity
chromatography). The pooled toxic fraction was applied to a DEAE column (ion exchange
chromatography). The pooled toxic fraction from the DEAE column was applied into a
concavaline A sepharose column (affinity chromatography). Finally, the pooled toxic fraction
from the Cn-A sepharose column was applied again to a DEAE column.
Insecticidal activity of the purified protein
The oral toxicity of one protein purified by liquid chromatography was tested in a diet test
against S. littoralis and C. capitata. The purified protein was offered to first instar S. littoralis
on alfalfa leaf disc, 5µl of purified protein at a concentration of 0.2 mg protein/ml were
applied onto each leaf disc. Control larvae were fed on untreated leaf disc. In the case of C.
capitata, the purified protein was incorporated in the artificial diet, control flies were fed with
artificial diet. Three replicates were used in each case, 10 insect each.
Analysis of data
Mortality data were analyzed using analysis of variance (ANOVA) and the Tukey test (HSD)
was used to compare means. The average survival time (AST) during the assessment period
was analyzed with Kaplan-Meier survival test. Statistical analyses were performed using
Statistix 8.0 and SPSS 12.0 for Windows.
The protein extract exhibited a dose-related and exposure-time-related chronic insecticidal
activity since in both insect species mortality increased as a function of protein concentration
(Fig. 1) and the exposure time (Fig. 2). In S. littoralis mortality varied from 61.3 to 100.0%
compared with 0.0% mortality in control larvae, whilst in C. capitata mortality was between
26.67 and 100.0%. The Average Survival Time (AST) of treated insects significantly
decreased as protein concentration increased. The AST for each insect species were 5.65, 4.30
and 3.13 days for larvae treated with 10, 20 and 40 µg/insect and 4.47, 3.57 and 2.77 days for
treated flies.
The exposure time significantly influenced toxicity of the CPSE in both species (Figure
2).
Mortality (%) (Mean + SE)
181
100
80
60
40
20
0
Control
10 µg/insect 2mg/ml
Protein Concentration
S. littoralis (µg/insect)
C. capitata (mg/ml)
Figure 1. Insecticidal activity of the crude soluble protein extract from M. anisopliae EAMa
01/58-Su isolate on instar S. littoralis larvae and C. capitata adults
Mortality (%) (Mean + SE)
Mortality increased with the exposure time, it varied from 5.00 to 100.00% in S. littoralis
and from 23.30 to 73.30% in C. capitata. ASTs, limited to 4 days, decreased with the
exposure time, which were for S. littoralis 6.70, 5.97, 3.49 and 3.13 days and for C. capitata
3.50, 3.23, 2.70 and 2.90 days for 24, 48, 72 and 96 h respectively. This dose-related and
exposure time-related insecticidal effect have been observed before with fungal secreted
secondary metabolites such as destruxins efrapeptins and cordycepin (Amiri et al., 1999;
Bandani and Butt, 1999; Gerritsen et al., 2005; Kim et al., 2002; Konstantopoulou et al.,
2006), Photorhabdus toxins (Blackburn et al., 1998), several plants derived compounds (ElAswad et al., 2003; Sadek, 2003; Wheeler and Isman, 2001; Zapata et al., 2006) and spinosad
(Raga and Sato, 2005).
100
80
60
40
20
0
0
24
48
72
96
Expousure Tim e
S. littoralis (40 µg/insect)
C. capitata (8 mg/ml)
Figure 2. Percentage mortality of second instar S. littoralis larvae and C. capitata adults
exposed to Crude Soluble Protein Extract from M. anisopliae EAMa 01/58-Su isolated at
different times periods and then transferred to conventional diet.
The evolution of the Antifeedant Index (AI) during a 5 day period of feeding on treated
alfalfa leaf disc or on testing suspension is shown in Fig. 3. The AI for S. littoralis reached
value 1 from day 1, where the AI was 0.9. The AI for C. capitata increased from days 4 and 5,
being 0.6 and 1 respectively. At relatively high dose the CPSE has only antifeedant effect on
182
Antifeedant Index
(AI)
S. littoralis. Antifeedant substances has been usually classified as suppressant (suppress biting
activity after contact) or deterrent (deter insects from further feeding after ingestion of the
material) (Schoonhoven, 1982). However, considering the mode of action, the fact of preventing insects from further feeding can be due to the affection of the peripheral nervous
system (deterrent) or to the disruption of the cellular, biochemical and physiology process
(toxicant). In S. littoralis, the quick rejection of treated food could be due to instantaneous
suppression or rapid post-ingestive-feedback (deterrant) (Bernays et al., 2000; Sadek, 2003).
Although, in C. capitata no antifeedant effect has been observed during the 3 first days, there
is a progressive increase of the AI from the 4th day which might due to possible injuries in the
midgut (toxicant).
0,9
0,4
-0,1
Day 1
Day 2
Day 3
Day 4
Day 5
-0,6
Days of Treatm ent
S. littoralis (CSPE 40 µg/insect)
C. capitata (FPEB 8mg/ml)
Figure 3. Evolution of the Antifeedant Index (AI) of second instar S. littoralis larvae (solid
line and ■) and C. capitata adults (dashed line and ▲) after feeding the Crude Soluble Protein
Extract of M. anisopliae EAMa 01/58-Su isolate incorporated on alfalfa leaf disc (40 µg/
insect) or on testing suspension (8 mg/ml).
The protease treatments had a significant effect on the insecticidal activity of the crude
protein soluble extract from EAMa 01/58-Su isolate against both insect species (F4,14 = 26.23;
P<0.0001 for S. littoralis and F4,12= 640.5; P<0.001 for C. capitata) (Fig. 4). The three tested
proteases caused a significant reduction in the insecticidal activity of the crude extract.
However, Tripsine caused the highest reduction of mortality (from 96.6 to 24.7% in S.
littoralis and from 83.3 to 20% in C. capitata) and the highest increase of AST (from 4.3 to
6.1 days for S. littoralis from 3.9 to 4.8 days for C. capitata), while Proteinase K caused the
lowest one, with a significant reduction in mortality (from 96.6 to 65.0% for S. littoralis and
83.3 to 46.5% for C. capitata), and the lowest increase of AST (from 4.3 to 4.6 days in S.
littoralis and 3.93 to 3.97 days in C. capitata). The temperature treatment had also a
significant effect on the insecticidal activity of the CPSE against both insects (F3,10=832.1
P<0.001 for S. littoralis F3,10=13.14 P=0.0048). Either in S. littoralis or C. capitata a
significance reduction in mortality (Fig. 4) and in AST were observed after incubating the
CPSE at 120ºC for 2 h. However, neither mortality nor the AST were reduced after incubating
the CPSE at 60ºC for 2 h. This study reports that the insecticidal activity detected in CSPE of
M. anisopliae EAMa 01/58-Su isolated is not due to low molecular weight protein such as
cyclopeptides, organic acids and pigments that are produced by other entomopathogenic fungi
(Kachatourians, 1996; Lysenko and Kucera, 1971; Roberts, 1981).
The protocol to obtain the CSPE, the reduction of its toxicity after protease treatments
and after a strong temperature treatment and the purification procedure by liquid chromatography show that the insecticidal activity of the CSPE of M. anisopliae EAMa O1/58-Su
resides in a protein which is highly thermostable.
Mortality % (Mean + SE)
183
100
80
60
40
20
0
1
S. l i ttora l i s
Control
C. ca pi ta ta
CPSE 20 µg/insect=4mg/ml
CPSE 20 µg/insect=4mg/ml (60º C, 2h)
CPSE 20µg/insect=4mg/ml(120º C, 20 min)
CPSE 20 µg/insect=4mg/m (Proteinasa K)
CPSE 20 µg/insect=4mg/ml (Pronasa)
CPSE 20 µg/insect=4mg/m (Tripsina)
Figure 4. Effect of protease and temperature treatments on the insecticidal activity of the
crude Soluble Protein Extract of M. anisopliae EAMa 01/58-Su isolated on second instar S.
littoralis larvae and C. capitata adults.
The 85 KDa (data not shown) purified protein secreted by M. anisopliae EAMa 01/58-Su
isolate had a significant effect (F1,5=169; P=0.002 for both insects species). Mortality in S.
littoralis and C. capitata reached 96.6% and 100% respectively in comparison to controls
where mortality was 10% and 13.3% respectively (Figure 5). ASTs varied from 7 to 4 days in
S. littoralis and from 4.7 to 3.4 days in C. capitata.
Mortality (%) (Mean+ SE)
120
100
80
60
40
20
0
S. lit t or alis cont r ol
C. capit t a cont r ol
S. lit t or alis Pr ot 2 (1µg/ leaf - disc)
C. capit t a Pr ot 2 (0,2 mg/ ml)
Figure 5. Insecticidal activity of the purified protein (Prot 2), secreted by M. anisopliae
EAMa 01/58-Su isolated, on second instar S. littoralis larvae and C. capitata adults
Acknowledgements
This research has been supported by the Spanish Commission Interministerial de Ciencia y
Tecnología (CICYT) project AGL 2004-06322-C02-01/AGR
184
References
Adamek, L. 1963: Submersed cultivation of the fungus Metarhizium anisopliae (Metsch.).
Folia Microbiol. 10: 255-257.
Amiri, B., L. Ibrahim & T.M. Butt. 1999: Antifeedandt properties of destruxins and their
potencial use with entomogenous fungus Metarhizium anisopliae for improved control of
crucifers pests. Biocontrol Sci. Technol. 9: 487-498.
Bandani, A.R. & T.M. Butt 1999: Insecticidal, antifeedant and growth inhibitor activities of
Efrapeptins, metabolites of the fungus Tolypocladium. Biocontrol Sci. Technol. 9: 499506.
Bernays, E.A., S. Oppenheimer, R.F. Chapman, H. Kwon & F. Gould 2000: Taste and
sensitivity of insect herbivores to deterrents in greater in specialist than in generalist: a
behavioural test of the hypothesis with two closely related caterpillars. J. Chem. Ecol. 26:
547-563.
Blackburn, M.B., E. Golubeva, D. Bowen & H. ffrench-Constant 1998: A novel insecticide
toxin from 'Photorhabdus luminescens', toxin complex a (Tca), and its histopathological
effects on the midgut of 'Manduca sexta'. Appl. Environ. Microbiol. 64: 3036-3041.
Bradford, M.M. 1976: A rapid and a sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding Ann. Biochem. 72: 248254.
El-Aswad, A.F., S.A.M. Abdelgaleil & M. Nakatani 2003: Feeding deterrent and growth
inhibitory properties of limonoids from Khaya senegalensis against the cotton leafworm,
Spodoptera littoralis. Pest Management Sci. 60: 199-203.
Gerritsen, L.J.M., J. Georgievan & G.L. Wiegers 2005: Oral toxicity of Photorhabdus toxins
against thrips species. J. Invert. Pathol. 88: 207-211.
Kachatourians, G.G. 1996. Biochemistry and Molecular Biology of Entomopathogenic Fungi.
In: The Mycota VI. Human and Animal Relationships, eds.: 331-363.
Kim, J.R., S. Yeon, H.S. Kim & Y.J. Ahn 2002: Larvicidal activity against Plutella xylostella
of cordycepin from the fruiting body of Cordyceps militaris. Pest Management Sci. 58:
713-717.
Konstantopoulou, M., P. Milonas & B.E. Mazomenos 2006: Partial purification and insecticidal activity of toxic metamolites secreted by a Mucor hiemalis strain (SMU-21) against
adults of Bactrocera oleae and Ceratitis capitata (Diptera: Tephritidae). J. Econ. Entomol. 99: 1657-1664.
Lysenko, O. & M. Kucera 1971: Microorganisms as source of new insecticidal chemicals. In:
Microbial Control of Insect and Mites, eds. Burges and Hussey.
Mazet, I. & A. Vey 1995: Hirsutellin A, a toxic protein produced in vitro by Hirsutella
thompsonii. Microbiology 141: 1343-1348.
Poitout, S. & R. Bues 1974: Élevage des chenilles de vingt-huit especes de lépidoptères
Noctuidae et de deux especes d'Arctiidae sur milieu artificiel simple. Particularités de
l'élevage selon les especes. Ann. Zool. Ecol. Anim. 6: 431-441.
Quesada-Moraga, E. & A. Vey 2003: Intra-specific variation in virulence and in vitro production of macromolecular toxins active against locust among Beauveria bassiana strains
and effects of in vivo and in vitro passage on these factors. Biocontrol Sci. Technol. 13:
323-340.
Quesada-Moraga, E. & A. Vey 2004: Bassiacridin, a protein toxic for locust secreted by the
entomopathogenic fungus Beauveria bassiana. Mycol. Res. 108: 441-452.
185
Quesada-Moraga, E., J.-A. Carrasco-Díaz & C. Santiago-Álvarez 2006: Insecticidal and
antifeedant activities of proteins secreted by entomopathogenic fungi against Spodoptera
littoralis (Lep., Noctuidae). J. Appl. Entomol. 130: 442-452.
Raga, A. & M.E. Sato 2005: Effect of spinosad bait against Ceratitis capitata (Wied.) and
Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) in laboratory. Neotrop. Entomol.
34: 815-822.
Roberts, D.W. 1981: Toxins of Entomopathogenic Fungi. In: Microbial Control of Pests and
Plant Diseases, ed. Burges: 441-464.
Sadek, M.M. 2003: Antifeedant and toxic activity of Adhatoda vasica leaf extract against
Spodoptera littoralis (Lep., Noctuidae). J. Appl. Entomol. 127: 396-404.
Schoonhoven, L.M. 1982: Biological aspect of antifeedants. Entomol. Exp. Appl. 31: 57-69.
Wessel, D. & U.I. Flügge 1984: A method for the quantitative recovery of protein in dilute
solution in the presence of detergents and lipids. Ann. Biochem. 138: 141-143.
Wheeler, D.A. & M.B. Isman 2001: Antifeedant and toxic activity of Trichilia americana
extract against the larvae of Spodoptera litura. Entomol. Exp. Appl. 98: 9-16.
Zapata, N., F. Budia, E. Vinuela & P. Medina 2006. Insecticidal effects of various concentrations of selected extractions of Cestrum parqui on adult and immature Ceratitis capitata.
J. Econ. Entomol. 99: 359-365.
p. 186
Factors important for the use of Neozygites floridana in biological
control of the two-spotted spider mite, Tetranychus urticae
Ingeborg Klingen, Karin Westrum, Silje Stenstad Nilsen, Nina Trandem,
and Gunnar Wærsted
Bioforsk, Norwegian Institute for Agricultural and Environmental Research, Plant Health and
Plant Protection Division, Høgskoleveien 7, 1432 Ås, Norway
Abstract: To obtain information that might help in the use of Neozygites floridana (Zygomycetes:
Entomopthorales) in biological control of Tetranychus urticae (Acari: Tetranychidae), in strawberries
and cucumbers we have tried to answer the following questions in a series of studies*): 1) When, and
at what infection levels does N. floridana occur in T. urticae populations in field grown strawberries?
2) How does N. floridana survive harsh climatic conditions (i.e winter) in Norway? 3) Where do N.
floridana infected T. urticae move and sporulate on a plant? 4) How do commonly used pesticides in
strawberries affect N. floridana and T. urticae? 5) How can N. floridana be inoculated in augmentative
microbial control of T. urticae? Results show that N. floridana infected and killed T. urticae in 12 out
of 12 Norwegian strawberry fields studied. Infection levels up to 90% were observed, and the highest
levels were observed late in the season. The infection levels throughout a season varied considerably.
N. floridana was observed to over-winter as hyphal bodies in hibernating T. urticae females
throughout the winter. Cadavers with resting spores were found from October to the end of January.
Cadavers then probably disintegrated, and resting spores were left on leaves, soil, etc. In a bioassay
where a Norwegian N. floridana isolate was tested for numbers and distance of spores thrown at three
different temperatures (13°, 18°, 23°C), results show that the highest numbers of spores (1886 and
1733 per cadaver) were thrown at 13° and 18° compared to 23°C (1302 per cadaver). Spores were
thrown at the same distance (up to about 6 mm) at all three temperatures when cadavers were placed
with dorsal side facing up. Cadavers placed with dorsal side down (hanging) threw equal numbers of
spores up (on the underside of the leaf in nature) and down (on the leaf below). The effects of
pesticides used in strawberries on the N. floridana infection level were studied to evaluate factors that
might be important for conservation biological control. The pesticides tested were three fungicides;
Euparen (tolylfluanid), Teldor (fenhexamid), Switch (cyprodinil +fludioxonil) and one acaricide/
insecticide: Mesurol (methiocarb). The experiment indicated that all three fungicides affect N.
floridana negatively but that Euparen might be the least harmful. Mesurol did not affect N. floridana.
Our attempt to inoculate N. floridana artificially in a strawberry field has not yet been successful, but
we now work on promising methods for inoculation of N. floridana in T. urticae populations in
greenhouse cucumbers. More detailed results from the studies referred to in this abstract will soon be
published elsewhere.
(*) Studies were financed by the following Norwegian Research Council projects: “Use of beneficial
fungi to control weeds, insect pests and plant pathogenic fungi”. Project leader: Richard Meadow,
Bioforsk. “Reduced use of pesticides in open field strawberries”. Project leader: Nina Trandem,
Bioforsk. “Optimizing greenhouse climate to improve growth, yield, quality and control of mildew
and biological control of pests in cut roses and cucumber”. Project leader: Hans-Ragnar Gislerød,
Norwegian University of life sciences and Nina Svae Johansen, Bioforsk (Sub project: Biolgoical
control).
Key words: Tetranychus urticae, Neozygites floridana, over-wintering, within-plant distribution
186
p. 187
Supplementary data to the biology and taxonomy of fungous strains
from mites and insects
Ryszard Mietkiewski1, Stanislaw Balazy2, Cezary Tkaczuk1, Marta Wrzosek3
1
University of Podlasie, Department of Plant Protection,ul. Prusa 14, 08-110 Siedlce,
Poland; 2Research Centre for Agricultural and Forest Environment PAS, ul. Bukowska 19,
60-809 Poznan, Poland; 3Warsaw University, Department of Plant Systematics and
Phytogeography, Al. Ujazdowskie Warsaw, Poland
Abstract: On the basis of rich collections of entomopathogenic fungi in different habitats of Poland
and some other European countries (Bałazy 2006) supplementing data on the biology, ecology and
morphology of strains isolated from insects, mites and spiders were gathered. The anamorphs of
Hirsutella, especially those mononematous isolated from mites show the greatest morphological
variability in artificial cultures except H. minnesotensis, whose strains both from nematodes and from
tarsonemid mites are entirely identical, which was confirmed by ITS-1 molecular analyses. Laboratory
assays at artificial infection of insects by the strains isolated from mites show only few positive cases
of H. nodulosa to the larvae of Scolytus ratzeburgii. Mycelia of Hirsutella spp. have also been found
in hibernating eriophyids Phyllocoptes abaenus and Aceria phloeocoptes. New eriophyid host Aculus
fockeui was recorded for the recently described entomophthoralean pathogen Neozygites abacaridis.
Apart from Hirsutella also Lecanicillium strains were common on dead eriophyid and gamasid mites
in bark rifts or under leaf-buds of plum or apple trees, as well as in cambiophagous insect tunnels
under the bark. Insect pathogenic Hirsutella and Paecilomyces strains ware subjected to
morphological and molecular comparative studies.
Key words: insects, mites, entomopathogenic fungi, biology.
References
Bałazy, S. 2006. European resources of entomopathogenic fungi. Plant Protection. Manual of
proceedings. Minsk, 30 (1): 447-450.
187
p. 188
Effects of Beauveria bassiana on Ips sexdentatus and on
Thanasimus formicarius
Bernhardt M. Steinwender and Rudolf Wegensteiner
University of Natural Ressources and Applied Life Sciences, Vienna; Gregor Mendel Str. 33,
1180 Vienna, Austria
Abstract: The main problem in bark beetle control is the fact, that they are most of their life cycle in
the bark. Therefore most control measures are not very effective, except phytosanitary measures. In
spite of these problems, little is known about action and effects of specific natural enemies on
individual and on population level. Especially pathogens could be promising candidates for pest
control. One of these is the fungus Beauveria bassiana. It is known to be a very effective pathogen for
control of a lot of pest insect species. Infected insects die usually very fast. This has the benefit, that
they have not enough time to reproduce, or at least their fecundity is reduced. There is also a
possibility that dead insects act as a new source of inoculation for individuals of the same and for
individuals of the offspring generation.
Before using Beauveria bassiana in the field, a lot of parameters have to be checked in the
laboratory. The most important among them are the effects on the targets, different bark beetles and
“side effects” on non targets. Therefore, the aim of this study was to test the effects of Beauveria
bassiana on the pine bark beetle Ips sexdentatus and on the bark beetle predator Thanasimus
formicarius. Infection experiments were conducted in the lab at 20°C and long day conditions.
Beauveria bassiana conidia were isolated from an infected Ips typographus and grown on malt extract
agar petri dishes. Ips sexdentatus attacked pine log sections were brought from the field to the lab,
incubated in the insectary, emerging beetles were collected daily. Thanasimus formicarius was
collected with baited bark beetle pheromone traps. Adult Ips sexdentatus and Thanasimus formicarius
were inoculated testing two concentrations of conidia suspension (106, 107/ml) or dry conidia from
bark beetle cadavers.
The experiments showed that Beauveria bassiana killed a high percentage of Ips sexdentatus (up
to 100%) within some few days, whereas the percentage of dead T. formicarius was remarkably low
(less than 30% with highest spore concentrations). The control groups of both beetle species showed
no mortality caused by Beauveria bassiana.
References
Wegensteiner, R. (2000): Laboratory evaluation of Beauveria bassiana (Bals.) Vuill. and
Beauveria brongniartii (Sacc.) Petch against the four eyed spruce bark beetle, Polygraphus poligraphus (L.) (Coleoptera, Scolytidae). IOBC wprs Bulletin Vol 23 (2): 161166.
188
p. 189
Horizontal transmission of entomopathogenic fungi between sexes
of the Mediterranean fruit fly Ceratitis capitata Wied. (Diptera;
Tephritidae)
E. Quesada-Moraga, I. Martín-Carballo, C. Santiago-Álvarez
Department of Agricultural and Forestry Sciences, ETSIAM, University of Cordoba. Campus de
Rabanales. Building C4 “Celestino Mutis”. Córdoba 14071. España (Spain
Abstract: The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana are being
considered as biocontrol agents for adult of Mediterranean fruit fly Ceratitis capitata. In the
laboratory, work was carried out to assess whether horizontal transmission of the fungi can take place
between sexes, as this would enhance the impact of the fungus on target populations when compared
with insecticides, and whether horizontal transmission is likely to be influenced by the sex and by the
mode of exposure to the fungal inoculum. Male and virgin female C. capitata were exposed to conidia
either whilst resting on sporulated fungal cultures or by spraying them with the fungal suspensions.
These infested males and females were then placed together with uncontaminated females and males
respectively in an initial proportion of 1:1. Transmission occurred in both directions, between male-tofemale (active transmission) and female-to-male (passive transmission), whereas the active transmission was more effective than the passive one. In addition, when adults were exposed to a powder
of dry conidia, the transmission efficacy was higher than when sprayed by a fungal suspension. In a
further experiment we used individualised flies, adding one untreated fly after each dead fly was
removed, which indicated that fly to fly transfer of lethal doses of inoculum was possible for a series
of at least five flies. The proportion of infested and uncontaminated individuals has also a significant
effect on the efficacy of the horizontal transmission. Active transmission was observed when infested
males were placed with non treated females in proportions of 1:1, 1:2, 1:5, 1:10, or 1:20, whereas it
was observed that the lower the ratio the lower the transmission efficacy. This study shows that
autodissemination of fungal inoculum between C. capitata adult males and females during mating
activity is possible under laboratory conditions.
189
p. 190
Laboratory evaluation of Beauveria bassiana (Bals.) Vuill. against
Ips amitinus (Coleoptera, Curculionidae)
Rudolf Wegensteiner1, Jaroslav Weiser2
1
University of Natural Resources and Applied Life Sciences-BOKU-Vienna, Austria;
2
Emeritus, Academy of Sciences, Prague, Czech Republic
Abstract: The bark beetle Ips amitinus (Eichh.) develops on Picea abies and on Pinus cembra with
similar requirements to phloem quality as Ips typographus or Pityogenes chalcographus. These three
beetle species are known to attack freshly cut or wind broken trees, but also standing trees, suffering
e.g. from draught, and they are assessed as dangerous spruce forest pest insects in many parts of
Europe, I. amitinus especially in higher elevation. Control measures are restricted in most European
countries to sanitation measures by removing breeding material. Till now, relatively few papers
concentrated on effects of pathogens in bark beetles. Due to the lack of efficient control measures for
bark beetles, B. bassiana was tested as possible microbial control agent.
Adult I. amitinus were collected at the time of their emergence from spruce log sections
incubated in the laboratory. Beetles were inoculated with B. bassiana preparation BOVEROL (strain
90311/48 produced by FYTOVITA, Czech Republic). Two inoculation variants were tested, 0.1%
aquaeous Tween 80 spore suspension (1 x 107 con/ml) or with dry spore powder (3 x 1010 con/g).
Inoculated and not inoculated control beetles were incubated in Petri dishes separately, together with
spruce bark pieces at 23°C (± 1°C), without light in incubators. Petri dishes were put into glass
chambers with a saturated KNO3 solution on the bottom providing relative humidity of approx. 93%.
Inoculation caused infection rates up to 100% and affected significant life span reduction of
beetles compared to beetles in the control group. No significant differences were found between the
two inoculation variants, spore powder and spore suspension inoculated beetles. No infection was
found in beetles of the control group.
References
Wegensteiner, R. (2004): Pathogens in bark beetles. Chapter 12. In: "European bark and wood
boring insects in living trees, a synthesis". Eds.: F. Lieutier, K. Day, A. Battisti, J.C.
Grégoire and H. Evans, Kluwer (ISBN 1-4020-2240-9): 291-313.
190
pp. 191-194
Field applications of entomopathogenic fungi against Rhagoletis cerasi
Claudia Daniel1,2, Siegfried Keller3 & Eric Wyss1
1
Forschungsinstitut für biologischen Landbau (FiBL), Ackerstrasse, 5070 Frick, Switzerland;
2
TU München, Wissenschaftszentrum Weihenstephan, Fachgebiet Obstbau, 85350 Freising,
Germany; 3Agroscope Research Station ART Reckenholz, Reckenholzstrasse 191, 8046
Zurich, Switzerland
Abstract: Two myco-insecticides, Naturalis-L (Beauveria bassiana) and PreFeRal®WG (Paecilomyces fumosoroseus), were applied against adult R. cerasi Loew (Diptera: Tephritidae) in two
orchards in north-western Switzerland in summer 2006. Both products were applied at a concentration
of 5.75x104 CFU/ml. With four applications at seven day intervals the whole flight period of R. cerasi
was fully covered. During this period the relative humidity averaged 66.3% (5th June – 6th July), the
temperature averaged 20.5°C. Under these conditions only Naturalis-L significantly reduced the
number of damaged fruit (efficacy: 69-74%), whereas damaged fruits were not significantly reduced
with PreFeRal (efficacy: 27%). For B. bassiana living fungal propagules were still detectable seven
days after application, while the fungal propagules of P. fumosoroseus remained only three days. A
control of R. cerasi with myco-insecticides seems possible under field conditions. However,
application regime still has to be improved.
Key words: Rhagoletis cerasi, Beauveria bassiana, Paecilomyces fumosoroseus.
Introduction
The European cherry fruit fly, Rhagoletis cerasi Loew (Diptera: Tephritidae), is a highly
destructive pest of sweet cherries in Europe. Without insecticide treatment up to 100% of the
fruits can be infested. Moreover, the currently used insecticide, Dimethoate, might be
withdrawn within the re-evaluation process for pesticides in the EU due to problems of
ecotoxicity and residues. The use of yellow sticky traps and crop netting are strategies
currently used in organic cherry production. However, they are labour-intensive and do often
not provide sufficient control. The use of micro-organisms as biological control agents against
R. cerasi might be an alternative. In previous laboratory experiments the virulence of different
entomopathogenic fungi on different life stages of R. cerasi were evaluated. Adult flies were
found to be the only life stage susceptible to fungus infection, whereby Beauveria bassiana
and Paecilomyces fumosoroseus were most virulent. Therefore these two fungus strains,
which are formulated in two commercial products Naturalis-L and PreFeRal®WG, were
tested in two field trials in 2006. The aim of these trials was to transfer the good laboratory
results into a viable field application strategy.
The trials were conducted in two 6-year old, organically managed cherry orchards in Sissach
and Wintersingen in summer 2006. The orchard in Wintersingen consisted of 30 cherry trees
arranged in a long row at intervals of 10m between trees. The orchard in Sissach consisted of
21 cherry trees arranged in 5 rows with 3 to 7 trees each at intervals of 10m in each direction.
This orchard was treated with sulphur on 26th May 2006. No other pesticide treatments were
191
192
applied. Both trials were arranged in randomized block designs with 5 replicates
(Wintersingen; 3 trees per plot) and 7 replicates (Sissach, 1 tree per plot), respectively.
Beauveria bassiana (product: Naturalis-L; Intrachem Bio Italia S.p.A.; Lot.-nr. 52806.2)
was applied in both orchards. Paecilomyces fumosoroseus (product: PreFeRal®WG, Biobest,
Belgium; Lot.-nr. 6001 14/03/06) was used only in the trial in Sissach. Both fungus strains
were applied at a concentration of 5.75x104 CFU/ml to runoff (3l per tree) using a highpressure hand held gun. Conidia concentrations for the products were adjusted according to
the concentrations given in the package instructions (250ml Naturalis-L per 100l; 2.88g
PreFeRal®WG per 100l). Four applications at 7 day intervals on 05th June, 12th June, 19th June
and 26th June 2006 were conducted. Untreated trees served as control.
To estimate the survival time of fungal propagules on the leaves, leaf samples were taken
immediately after first treatment, and 1, 3, and 7 days after the treatment. Three samples per
fungus strain and orchard were analyzed in the laboratory. Leaf samples were cooled down
immediately after sampling, cold stored at 4-7°C and analyzed 4 days later. Leaves were
roughly cut with scissors and weighed. From each sample 5g were taken, homogenized in 100
ml demineralised water containing 0.05% Tween80 with a blender at 22.000 rpm for 20 sec
and filtered through Nylon mesh (0.4 mm mesh size) under vacuum. Suspension obtained
from samples taken immediately and one day after treatment were diluted 1:10, samples taken
3 days after treatment were diluted 1:5, the samples taken 7 days after treatment remained
undiluted. 100µl of each suspension were plated on selective medium in petri dishes (Strasser
et al 1996) with a Trigalsky spatula (2 petri dishes per sample). After incubation at 22°C for
10 days the number of colonies was counted.The number of CFU per g leaf was calculated.
Flight period of R. cerasi was monitored with one yellow sticky trap per tree. The
assessment of treatment efficacy was made at harvest. A sample of 50 cherries per tree was
taken in Sissach on 06th July 2006. In Wintersingen mixed samples from the 3 trees per plot
with 75 cherries per tree (225 cherries per plot) were taken on the same date. The cherries
were dissected to estimate damage caused by R. cerasi.
Figure 1 shows the climatic conditions, the flight period of adult R. cerasi, and the application
dates. The flight of adult R. cerasi started in the first week of June and increased in Sissach
during the following warm and sunny period. In Wintersingen flight activity remained at a
low level due to intense wind in this experimentation site. With the four applications the
whole flight period was fully covered. The relative humidity averaged 66.3%, with high
humidity levels during the nights (RHmax: 100%), appearance of dew in the early morning and
low humidity during the afternoons (RHmin: 30.3%). The temperature averaged 20.5°C, with
low temperatures during the nights (Tmin: 6.9°C) and high temperatures during the afternoons
(Tmax: 31.5°C).
The number of CFU per g leaf on the different sampling dates is given in table 1. Three
days after application no living fungal propagules could be found in PreFeRal®WG treatment.
On the Naturalis-L treated trees, living conidia could still be detected seven days after
application, whereby a rapid decline was observed. One day after application only 15.2 to
20.7% and seven days after treatment only 0.5 to 1.7% of conidia were still active. Since there
was no rain between 5th and 12th June conidia were not washed off but, rather degraded by
UV. Therefore, repeated applications seem appropriate. The differences observed between
PreFeRal®WG and Naturalis-L might be due to formulation: Naturalis-L contains conidia of
B. bassiana in an oil formulation, whereas PreFeRal contains blastospores of P. fumosoroseus
formulated in water dispersible granules.
193
The cumulative number of flies per trap caught during the whole experiment is given in
Table 1. Differences between treatments were not significant. However, traps hanging in
treated trees tented to catch fewer flies. This result is not surprising since flies remain active
during 3 to 4 days post exposure and might be trapped during this time.
Number of flies
5
4
3
2
1
Precipitation
Tmin
Tmax
Wintersingen
Sunshine duration
30
900
25
750
20
600
15
450
10
300
5
150
0
01st
04th
07th
10th
13th
16th
19th
June 2006
22nd
25th
28th
01st
Application Dates
04th
07th
July 2006
10th
0
Sunshine duration (Minutes/Day)
Temperature in °C / Precipitation in mm
Sissach
Harvest
Figure 1. Climatic conditions and average number of flies per 10 traps per day.
Table 1. Number of CFU per g leaves and cumulative number of flies per trap.
Location
Treatment
Sissach
Control
Naturalis
PreFeRal
Control
Naturalis
Wintersingen
Leaf samples: CFU / g leaves ± se
directly after
1 day after
3 days after
treatment
treatment
treatment
0±0
0±0
9.2 ± 0.93 x 104 1.4 ± 0.21 x 104
3.3 ± 3.33 x 102 3.3 ± 3.33 x 102
0±0
0±0
11.6 ± 2.41x 104 2.4 ± 0.23 x 104
0±0
4.3 ± 1.42 x 103
0±0
0±0
5.2 ± 0.44 x 103
7 days after
treatment
0±0
0.5 ± 0.35 x 103
0±0
2.0 ± 0.61 x 103
Flies / Trap ±
se
11.00 ± 2.32
6.00 ± 0.82
7.57 ± 3.99
7.33 ± 0.82
4.06 ± 1.08
The level of infested fruits in Sissach was higher than in Wintersingen; the percentage
rate of damaged cherries is given in figure 2. In Wintersingen the number of larvae was
significantly reduced by Naturalis-L applications (One-way ANOVA; F1,8=19.23, p<0.01),
which resulted in an efficacy of 73.9%. In Sissach differences were not significant (One-way
ANOVA; F2,18=1.98, p=0.17). However, the efficacy of Naturalis-L (68.8%) was similar to
the trial in Wintersingen. PreFeRal®WG had a low efficacy (27.1%). Nevertheless,
infestation rate in the Naturalis-L treated plots exceeded the level of market tolerance (2% of
infested fruits) in both orchards (Wintersingen 2.5%; Sissach 4.3%).
194
12
24
a
10
20
8
% damaged cherries
% damaged cherries
Sissach
Wintersingen
n.s.
16
6
n.s.
12
b
4
2
8
n.s.
4
0
0
Control
Naturalis-L
Control
Naturalis-L
PreFeRal® WG
Figure 2. Percent damage rate of cherries (± se; One-way-ANOVA, Tukey test α=0.05).
It can be concluded that a control of adult flies under field conditions is possible. The
formulation of Naturalis-L is suitable to keep the conidia of B. bassiana viable during 7 days.
Naturalis-L treatments significantly reduced the number of damaged cherries by 69-74%.
However, the level of market tolerance was still exceeded. Further research is needed to
examine if applications in subsequent years are able to lower the infestation at a tolerable
level. Fungal propagules applied onto phylloplanes are exposed to pesticides. In organic
agriculture only sulphur is likely to be applied during the critical period. This pesticide was
found to be compatible with entomopathogenic fungi, whereas synthetical fungicides can be
toxic to entomopathogenic fungi. Thus, the integration of myco-insecticides for cherry fruit
fly control in an organic plant protection system might be possible; however, including mycoinsecticides into integrated pest management programs might be challenging.
Acknowledgements
We thank Intrachem Bio Italia S.p.A. and Andermatt Biocontrol AG for providing the products.
The project was funded by the Landwirtschaftliches Zentrum Ebenrain (Sissach, Switzerland).
References
Strasser, H., Forer, A. & Schiner, F. 1996: Developement of media for the selective isolation and
maintenance of virulence of Beauveria brongniartii. Proceedings 3rd International Workshop Microbial control of soil dwelling pests: 125-130.
pp. 195-197
Natural occurrence of entomopathogenic fungi infecting the Red Palm
Weevil Rhynchophorus ferrugineus (Olivier, 1790) (Coleoptera,
Curculionidae) in Southern Italy
Eustachio Tarasco1, Francesco Porcelli1, Michele Poliseno1, Enrique Quesada Moraga2,
Cándido Santiago Álvarez2, Oreste Triggiani1
1
DiBCA, Università di Bari, Via Amendola 165, Bari 70126, Italy; 2Universidad de Córdoba,
Campus de Rabanales, Córdoba 14071, Spain
Abstract: Surveys for natural enemies of the Red Palm Weevil Rhynchophorus ferrugineus (Olivier,
1790) (Coleoptera, Curculionidae) were conducted in several urban areas and nurseries of Southern
Italy in 2006. More than 350 larvae, pupae and adults of the weevil collected from 25 plants were
inspected for natural mortality. Entomopathogenic fungi were found to be a major factor regulating R.
ferrugineus populations, with a natural infected prevalence around 20%. Inside the palm trees
presenting infected insects, about 90% of the individuals were found to be diseased. Two species of
entomopathogenic fungi were found, Beauveria bassiana (Bals.) Vuill., the most common species and
Metarhizium anisopliae (Metch.) Sorok. Interestingly, Paecilomyces sp. was also found to infect
phoretic mites on Red Palm Weevil.
Key words: Beauveria, Metarhizium, Paecilomyces, urban entomology
Introduction
Originating in tropical Asia Rhynchophorus ferrugineus (Olivier, 1790) (Coleoptera,
Curculionidae) has spread to Africa reaching the Mediterranean area in the 1980s (Ferry &
Gómez, 2002). In Europe it was reported for the first time in Spain and recently in Italy and
France (EPPO, 2006).
The high spread rate of the weevil is certainly related to the trade of infested palm trees
and offshoots from infected areas to uncontaminated ones. Male and females of R. ferrugineus
are strong and big beetles, about 3 cm long, rusty red coloured. The female begin to oviposit
2-3 days after emergence laying about 200 eggs at the base of young leaves. The greatest
number of eggs hatch in 2-3 days and grubs feed on soft tissues of terminal buds and fresh
parts of leaves. In 45-70 days larvae reach the last instar with a size of more than 5 cm and are
ready to pupate. The larvae cause major damages excavating holes and galleries in the trunks;
severe infestations can kill the palm trees. Due to gradual oviposition 3-7 generations overlap
and all the life stages are found at the same time along the year (Fig. 1).
In 2006 a survey for natural enemies of the Red Palm Weevil was conducted in nurseries and
both public and private gardens of 5 localities (Molfetta, Maglie, Brindisi, Lecce and S. Maria
di Leuca) in Apulia Region, Southern Italy (Fig. 2). More than 350 larvae, pupae and adults of
the Red Palm Weevil collected from 25 plants were inspected for natural mortality. Infected
individuals were surface-sterilized by keeping them for 3 min. in 1% sodium hypochlorite
and rinsing them in distilled water. After this, the insects were incubated at 25°C in Petri
195
196
dishes with moistened filter paper till the presence of pathogens could be assessed. When
sporulating structures appeared on the cadaver, attemps to isolate the fungus were made by
transferring spores to potato dextrose agar in Petri dishes. Inoculated Petri dishes were then
checked every day and the tubes with pure culture were subcultured in PDA medium.
Cultures were then stored at 8°C.
Entomopathogenic fungi were found to be a major factor regulating R. ferrugineus populations, with a natural infected prevalence around 20%. Two species of entomopathogenic fungi
were isolated, Beauveria bassiana (Bals.) Vuill, the most common species, and Metarhizium
anisopliae (Metch.) Sorok (Fig. 3). It is worth to underline that Paecilomyces sp. was also
found to infect phoretic mites on Red Palm Weevil. Inside the palm trees with infected
insects, more than 90% of the individuals were found to be diseased. A similar isolation of 2
entomopathogenic fungi from R. ferrugineus was reported from Iran by Ghazavi & AvandFaghih (2002). According to Gindin et al. (2006) in Israel and El-Sufty et al. (2007) in United
Arab Emirates these entomopathogenic fungi could be consider as an important tool for future
programs of biological control of Red Palm Weevil.
Figure 1. Life cycle of R. ferrugineus.
197
Figure 3. Adults of R. ferrugineus infected by
Figure 2. Localities of the survey in Apulia
Region (Italy).
References
EPPO Reporting Service 2006: No. 11: 5-6.
Ghazavi, M. & Avand-Faghih, A. 2002: Isolation of two entomopathogenic fungi on red palm
weevil, Rhynchophorus ferrugineus (Oliver) (Col., Curculionidae) in Iran. Appl. Entomol.
Phytopath. 9: 44-45.
Ferry, M., Gómez, S. 2002: The red palm weevil in the Mediterranean. Journal of the International Palm Society 46 (4).
Gindin, G., Levski, S., Glazer, I., Soroker, V. 2006: Evaluation of the entomopathogenic fungi
Metarhizium anisopliae and Beauveria bassiana against the red palm weevil
Rhynchophorus ferrugineus. Phytoparasitica 34 (4): 370-379.
El-Sufty, R., Al-Awash, S.A., Al Amiri, A.M., Shahdad, A.S., Al Bathra, A.H., Musa, S.A.
2007: Biological Control of Red Palm Weevil, Rhynchophorus ferrugineus (Col.: Curculionidae) by the entomopathogenic fungus Beauveria bassiana in United Arab Emirates.
ISHS Acta Horticulturae 736: III International Date Palm Conference.
pp. 198-203
Studies on ecological and physiological host range of
entomopathogenic Hyphomycetes
Seskena Rita1, Petrova Valentina1, Jankevica Maija2, Jankevica Liga1
1
Department of Experimental Entomology, Institute of Biology, University of Latvia, Miera
street 3, Salaspils, LV 2169, Latvia; 2Latvian University of Agriculture, Liela street 2,
Jelgava, LV 3001, Latvia
Abstract: Researches on entomopathogenic fungi of agricultural pests were carried out in the Institute
of Biology, University of Latvia. Occurrence of entomopathogenic Hyphomycetes and their host range
were studied. Information on identified and isolated entomopathogenic fungi and their ecological hosts
recorded in Latvia since 1957 was summarised. For determination of ecological host insects with the
symptoms of mycoses (reduced movement, changes of color, cuticle covered with fungal mycelia or
conidia) were collected. Common insect pathogenic Hyphomycetes recorded in Latvia are Beauveria
bassiana, Metarhizium anisopliae and Paecilomyces farinosus. Observations shoved that B. bassiana
had a broad host range. 19 hosts of B. bassiana were recorded. Fungus B. bassiana was associated
with different orders of insects and mites: Coleoptera, Lepidoptera, Hymenoptera, Hemiptera, Diptera,
and Tetranychidae. Laboratory tests showed that B. bassiana isolate are not specific to aphids.
Aspergillus flavus were associated with pest orders: Diptera, Aphididae, Tetranychidae, and
Phytoseiidae.
Key words: entomopathogenic Hyphomycetes, Deuteromycota, physiological host, ecological host
Introduction
Entomopathogenic fungi cause lethal infections of insects and can regulate their populations
in nature by epizootics. Fungi have one of the widest spectrum of host ranges among
entomopathogens. The ecological host range is the current, yet involving, set of species with
which a parasite naturally forms symbioses, resulting in viable parasite offspring (Onstad &
McManus, 1996). Physiological host range is based solely on laboratory observations of
infection. Species identified as hosts in the laboratory may not be hosts in the field (Federici
and Maddox 1996). An association between pathogen and an insect exists when the hosts are
naturally infected in field or in the laboratory by the pathogen and the infectious propagules
are produced. When infection has been attempted but not observed, then no association exists.
A variety of factors may determine or influence the host range and specificity of a fungal
pathogen. Information on the ecological host range is necessary for evaluation and registration
of fungal preparations and assessing potential risks posed by microbial control agents.
Observations of natural epizootics and collecting of diseased insects were done regularly
in central and western part of Latvia. The aim of studies was to extend knowledge on
ecological and physiological host range of entomopathogenic Hyphomycetes. In recent years
information on identified and isolated entomopathogenic fungi was summarized in an
informative database “Ecological database of the Latvian insect pathogens”.
198
199
Studies of ecological hosts
Observations of natural epizootics of agricultural and forestry pests were done regularly in
central, western and eastern part of Latvia. Information on ecological associations between
Hyphomycetes and different insect species found since 1957 was summarized. In autumn
2006 orchards and fields in Riga district were inspected. We observed also forests in
Ventspils district covered by outbreak of Neodiprion sertifer Geoffr. Insects with the
symptoms of mycoses (reduced movement, changes of colour, cuticle covered with fungal
mycelia or conidia) were collected. Living insects were used for identification of host species.
Determination of fungi
Dead larvae were surface sterilized in 1% sodium hypochlorite for 30 sec., rinsed three times
in sterile distilled water and placed in humid conditions to encourage fungal outgrowth and
sporulation. Preliminary identification of fungi was confirmed by slide preparation. For
cadavers with conidial cushions preparations of conidia were obtained by film method.
Squash preparations of various infected insect tissues were viewed in the light microscope.
Fungi were isolated on Malt extract agar or Czapek media. Agar - coated slide technique and
staining with Lactophenol-cotton blue were used for observation of sporulating structures and
spores. Keys for the identification given by Kovaly (1974) and Bilay (1988) were used.
Fungal isolates and insects
Cultures of entomopathogenic Hyphomycetes were selected from the collection of the
Institute of Biology. Cultures: Beauveria bassiana isolate L4-R isolated from Leptinotarsa
decemlineata Say. (Jankevics et. al, 2003); Aspergillus flavus Link ex Fries isolated from
Musca domestica L. Isolates were maintained on Malt extract and stored in refrigerator to the
temperature + 8 °C. Insects: fruit flies Drosophila melanogaster Meigen were reared on semi
synthetic diet; aphids Schizaphis graminum (Rondani) were reared in laboratory on natural
food (oats Avena sativa L.); aphids Cryptomyzus ribi L. were collected in orchards and reared
on leaves of red currant, weevil Sitona lineatus L. (imago) were collected in been field and
reared on been plants.
Determination of physiological hosts
Suspensions of the fungal isolates containing 1.5 ± 0.5 x 107 conidia/ml were sprayed on
insects. Five repetitions were used, with ten insects per each. Experimental and control insects
were kept in sterilized Petri dishes or 120 ml glass flasks (D. melanogaster). They were
observed daily to determine the mortality. Squash preparations of various infected insect
tissues were viewed in light microscope.
Since 1957 twelve species of entomopathogenic Hyphomycetes were identified in Latvia.
Majority of the pathogens were isolated from the important agricultural and forest pests such
as weevils, click beetles, moths, aphids, thrips and mites. Host insects of Hyphomycetes
recorded till 2004 by researchers Cibulskaya (1967, 1977), Jegina (1972), Ozols (1963, 1985),
Cudare (1998), Jankevica (2004) and authors were summarized in Table 1.
200
Table 1. Ecological and physiological associations between entomopathogenic Hyphomycetes
and pest insects recorded in Latvia till 2004 (Cibulskaya, 1967, 1977; Jegina, 1972;
Jankevica, 2004; Ozols, 1963, 1985 and authors).
Fungus species
Host
Host species
Anthonomus pomorum
L.
Apion apricans Hrbst.
Highest taxon
Coleoptera,
Curculionidae
Ips sexdentatus Boern
Tomicus minor Hart.
Leptinotarsa
decemlineata Say
Galeruca tanaceti L.
Cycloneda sanguinea
Beauveria bassiana var. limbifer Casey
(Bals.) Vuill.
(laboratory culture)
Pieris brassicae L.
Galeria melonella L.
Cydia pomonella L.
B. brongniartii
(Saccardo) Petch
Beauveria sp.
Host plant or
habitat
Type of
infection
Apple
Natural
red clover
Pine
Coleoptera, Scolytidae
Coleoptera,
Chrysomelidae
Coleoptera,
Coccinellidae
Lepidoptera, Pieridae
Lepidoptera, Pyralidae
Lepidoptera, Tortricidae
Pine
Field
application
Natural
Field
application
Potato
Natural
Tansy
broad beans
infested by
Aphis fabae
Cabbages
semi
synthetic diet
semi
synthetic diet
cabbage
field, soil
Natural
Laboratory
tests
Natural
Natural
Natural
Field
application
Field
application
Agrotis segetum Schiff
Lepidoptera, Noctuidae
Yponomeuta malinellus
Zell.
Aradus cinnamomeus
Panz.
Malacosoma neustria
L
Lepidoptera,
Yponomeutidae
apple
Hemiptera, Aradidae
Pine
Natural
Lepidoptera,
Lasiocampidae
apple
Natural
Agrotis segetum Schiff
Lepidoptera, Noctuidae
Pieris brassicae L.
Paecilomyces
farinosus (Holm ex Laspeyresia nigricana
S. F. Gray) Brown Steph.
& Smith
Agriotes sputator L.
Agriotes obscurus L.
Athous niger L.
Limonius aeruginosus
Metarhizium
Ol.
anisopliae
Selatosomus aeneus L.
(Metschnikov)
Sorokin
Trialeurodes
vaparariorum Westw.
Aphis fabae Scop.
Thrips tabaci Lind.
Lepidoptera, Pieridae
Lepidoptera, Tortricidae
Coleoptera, Elateridae
vegetable
garden, soil
Cabbages
Natural
Pies
Natural
Soil
potato
Soil
Natural
Natural
Natural
Field
application
Field
application
Soil
Soil
Homoptera,
Aleurodidae
Homoptera, Aphididae
Thysanoptera, Thripidae
Natural
Greenhouse
Natural
Spindletree
Greenhouse
Natural
Natural
201
Ozols (1963) confirmed association between fungi Paecilomyces farinosus (syn. Isaria
farinosa) and the pea moth Laspeyresia nigricana Steph. in the field applications.
Pathogeneity of B. bassiana on L. decemlineata, Anthonomus pomorum L., Yponomeuta
malinellus Zell., Pieris brassicae L. and Tomicus minor Hart., Ips sexdentatus and Apion
apricans Hrbst. were tested in laboratory and field trials (Cibulskaya, 1967, 1977, Cibulskaya
et al, 1980, Jankevics et. al, 2003). B. bassiana cause mortality more than 51.6% of all
mentioned insects. We also found B. bassiana infected larva of Galleria mellonella L. and
Cydia pomonella.
Isolated entomopathogenic Hyphomycetes belong to order Moniliales. Fungi: B.
bassiana, B. brongniartii (Saccardo) Petch, Metarhizium anisopliae (Metschnikov) Sorokin,
Verticillium candidulum Sacc., Lecanicillium lecanii (Zimm.) Zare & W. Gams (sin. V.
lecanii (Zimmerman) Viegas), Paecilomyces farinosus (Holm ex S.F. Gray) Brown & Smith,,
Aspergillus flavus, A. ochraceus Wilhelm., A. terreus Thom., A. versicolor [Vuill] Tirabaschi,
Cladosporium herbarum (Persoon) Link ex Fries and C. lignicola Pidopl. et Deniak were
identified. Petrova and Petrov (1980) found associations between Hyphomycetes and different
species of mites (Acari, Tetranychidae and Phytoseiidae). They isolated following fungi:
Aspergillus flavus from Tetranychus urticae Koch; Aspergillus ochraceus Wilhelm. from
Tetranychus cinnabarinus Boisduval, Schizotetranychus rubi Trag. and Phytoseiulus
persimilis A.-H.; Aspergillus terreus from T. urticae and T. cinnabarinus; Aspergillus
versicolor from T. urticae and Sch. rubi Trag.; C. linicola from Oligonychus ununguis, T.
cinnabarinus and Schizotetranychus rubi; Verticillium candidulum from T. urticae, O.
ununguis, Phytoseiulus persimilis, Amblyseius andersoni, A. herbarius, and B. bassiana from
T. urticae. Laboratory experiments confirmed association between mite T. urticae and fungi
Cladosporium linicola, Aspergillus flavus, A. ochraceus, A. versicolor, A. terreus, V.
candidulum and B. bassiana (Petrova & Petrov, 1980). Cladosporium linicola, B bassiana,
Aspergillus flavus, A. ochraceus, A. versicolor, A. terreus, V. candidulum caused mortality of
T. urticae (corrected after Abbot) 11.8 %, 15.5%, 29.2% 31.7% 22.2%, 36.3%, 52.2%,
respectively (Petrova & Petrov, 1980).
Epizootics are observed rather rarely in Latvia. Few natural infections caused by
Beauveria sp., B. bassiana, A. flavus and C. herbarum were observed in autumn 2006 (Table
2). B. bassiana infected cocoons of N. sertifer were found in pine stand, where outbreak of N.
sertifer was observed in 2005. The Beauveria sp. isolate listed here closely resembles B.
bassiana but were not identified to species level because of small (and possibly in significant)
differences in conidia size and/or shape. We found fungal infected Ips typographus L. larvae,
but we had difficulties to determine the species because mentioned fungal isolate formed only
non-sporulated mycelium.
Results of determination of physiological hosts of B. bassiana and A. flavus are
summarised in Table 3. Positive association is recorded between B. bassiana isolate L4-R and
S. lineatus. It is known that a typical isolate of B. bassiana can infect a broad range of insects.
However different strains exhibit considerable variation in virulence, pathogenicity and host
range. B. bassiana isolate L4-R isolated from Colorado beetle did not show pathogenicity to
aphids (Aphididae). Imagoes and larva of aphids S. graminum and C. ribi after treatment with
suspension of B. bassiana isolate L4-R (1.5 ± 0.5 x 107 conidia/ml) did not have symptoms of
mycoses. We did not found fungal infection in squash preparations of aphid tissues viewed in
microscope. Results of artificial inoculation showed positive association between A. flavus
and aphids S. graminum and C. ribi. Imago and larva of both species of aphids showed first
symptoms of mycosis 48 hours after infection. The larva and imagoes of D. melanogaster
treated with suspension of A. flavus (1.5 ± 0.5 x 107 conidia/ml) showed no symptoms of
mycoses. We did not found fungal infection in squash preparations of fruit flies tissues
viewed in microscope.
202
Table 2. List of ecological associations between pathogenic fungi and insects recorded in
August, September 2006.
Original host
Fungi
Beauveria bassiana (Bals.)
Vuill.
Host species
Highest taxon
Leptinotarsa
decemlineata L.
Coleoptera,
Chrysomelidae
Coleoptera,
Scolytidae
Coleoptera,
Bruchidae
Hymenoptera,
Diprionidae
Lepidoptera,
Pieridae
Diptera,
Muscidae
Homoptera,
Aphididae
Coleoptera,
Scolytidae
Ips typographus L.
Bruchus pisorum L.
Neodiprion sertifer
Geoffr
Beauveria sp.
Aspergillus flavus Link ex
Fries
Cladosporium herbarum
(Persoon) Link ex Fries
Non-sporulated mycelium
Pieris brassicae L.
Musca domestica L.
Aphis gossypii Glov.
Ips typographus L.
Infected
stage
Host plant
or habitat
Larvae
Potato
Imago
Spruce
larvae,
imago
Pies
Cocoon
soil under
pine
Larvae
Cabbage
Imago
human
dwelling
Imago
Cucumber
Larvae
Spruce
Table 3. Results of artificial infection of insects by suspension of Beauveria bassiana and
Aspergillus flavus (concentration 1.5 ± 0.5 x 107 conidia/ml).
Fungal isolate
Insect species
Stage of insect Presence of mycosis
Sitona lineatus
imago
larvae, imago
not confirmed
larvae, imago
not confirmed
larvae, imago
confirmed
imago
not confirmed
Schizaphis graminum
larvae, imago
confirmed
Cryptomyzus ribi
larvae, imago
confirmed
Drosophila melanogaster
larvae, imago
not confirmed
B. bassiana isolate Schizaphis graminum
L4-R
Cryptomyzus ribi
Drosophila melanogaster
Sitona lineatus
Aspergillus flavus
confirmed
Identified Hyphomycetes are associated with pest orders: Coleoptera, Lepidoptera,
Homoptera, Hymenoptera, Hemiptera, Diptera, Thysanoptera, Tetranychidae and Phytoseiidae.
Common insect pathogenic Hyphomycetes recorded in Latvia are B. bassiana and M.
anisopliae. Observations confirmed that B. bassiana had a broad host range. 19 associations
between B. bassiana and hosts were recorded. Fungus B. bassiana was associated with
different orders of insects and mites: Coleoptera, Diptera, Lepidoptera, Hymenoptera, Hemiptera and Tetranychidae. Representatives of genera Aspergillus are associated with pest
orders: Diptera, Aphididae, Tetranychidae and Phytoseiidae.
203
Acknowledgements
Dr. Z. Cudare is acknowledged for scientific guidance and constructive criticism. Our investigations were supported by the grant from the Latvian Council of Science.
References
Bilay, V.I. 1988: Aspergillus, Naukova Dumka, Kiev: 1-181 [in Russian].
Cibulskaya, A. 1967: The use of the local isolate of Beauveria bassiana against Colorado
beetle. News of the Academy of Sciences 5: 40-45 [in Latvian].
Cibulskaya, A. 1977: The results of investigations on structure of entomopathogenic fungi
Beauveria bassiana (Bals.) Vuil. In: Entomopathogenic microorganisms and their use in
plant protection. Zinatne, Riga: 25-28 [in Russian].
Cibulskaya, A, Kononova, E. & Malykova, A. 1980: Studies of the effect of boverin on Apion
apricans Hrbst. In: Biological method of plant protection against pest insects and mite.
Zinatne, Riga: 31-37 [in Russian].
Cudare, Z. 1998: Biodiversity of entomopathogenic fungi in Latvia and their potential in plant
protection. IOBC/WPRS Bulletin 21 (4): 85-88.
Federici, B.A. & Maddox, J.V. 1996: Host specificity in microbe-insect interactions. BioScience 46: 410-421.
Jankevica, L. 2004: Latvijas entomologs 41: 60-66.
Jankevics, E., Kropa, M., Grantina, L. & Jankevica, L. 2003: IOBC/WPRS Bulletin 26 (1):
51-55.
Jegina, K. 1972: The effect of the fungus Metarhizium anisopliae (Metsch.) Sop. on the click
beetle. In: Pathology of insects and mites. Zinatne, Riga: 37-56 [in Russian].
Kovaly, E.Z. 1974: Key of entomofilous fungi USSR, Kiev: 1- 258 [in Russian].
Onstad, D.W. & McManus, M.L. 1996: Risks of host-range expansion by insect-parasitic biocontrol agents. BioScience 46: 430-435.
Ozols, E. 1963: Agricultural entomology. Latvian State Publishing House, Riga: 1-510 [in
Latvian].
Ozols, E. 1985: Dendrophagous insects of spruces and pines in Latvia. Riga: 1-206 [in
Latvian].
Petrova, V. & Petrov, V. 1980: Microflora of plant feeding mites. In: Biological method of
plant protection against pest insects and mites. Zinatne, Riga: 39-50 [in Russian].
p. 204
Sampling and occurrence of entomopathogenic fungi in soil from
Cameraria ohridella (Lepidoptera: Gracillariidae) habitats
Eva Prenerova1, Rotislav Zemek2, Frantisek Weyda2, Lubomir Volter2
1
Laboratory of Plant Protection Olesna, Olesna 87, Bernartice u Milevska, Czech Republic;
2
Institute of Entomology, Biology Centre AS CR, Branisovska 31, Ceske Budejovice, Czech
Republic
Abstract: The horse chestnut leaf-miner, Cameraria ohridella Deschka et Dimic, is an important
invasive pest of Aesculus hippocastanum spreading in Europe. It has favorable conditions for its
development in the Czech Republic because of limited spectrum of natural enemies. Damage inflicted
to the leaves results in weakening of most infested trees. Present methods of its control are based on
application of non-selective insecticides and composting or burning of leaf litter. Since these methods
also kill beneficial organisms including natural enemies of C. ohridella, new environment-friendly
approaches need to be developed. Therefore, a joint project "New alternative approaches in pest
control of the horse-chestnut leaf-miner C. ohridella supporting biodiversity of its natural enemies"
was initiated by the Laboratory of Plant Protection in Olesna and the Institute of Entomology in Ceske
Budejovice. The aim of this project is to obtain data on applicability of entomopathogenic fungi
against C. ohridella and verify if the fungi have no negative effects on biodiversity of the leaf-miner
parasitoids. Obtaining native strains of entomopathogenic fungi, which are known to be more virulent,
compared to collection strains kept on artificial medium, was the first task of our project. The
occurrence of entomopathogenic fungi was surveyed in soil samples collected at 12 localities in the
Czech Republic in autumn 2006. Soil was sampled in the vicinity of horse chestnut trees heavily
infested by C. ohridella. Ground in vicinity of these trees was natural, i.e. without asphalt or paving.
At each locality, the samples were taken from four biotopes differing in management and pollution:
(1) city park, (2) trees in gardens outside a city, (3) alley at heavy traffic road and (4) alley at low
traffic road. Totally, 48 soil samples were collected and processed. Native entomopathogenic strains
were obtained from the samples by a live-bait method using the great wax moth, Galleria mellonella
L., larvae. By means of this method we isolated 72 strains of entomopathogenic fungi (Deuteromycota: Hyphomycetes). Dominant species found were Paecilomyces fumosoroseus (Wize) Brown et
Smith, Paecilomyces farinosus (Holm ex S.F. Gray) Brown et Smith and Beauveria bassiana
(Balsamo) Vuillemin. Further research, in which we test the virulence of individual strains, currently
goes on.
This work was supported by MSMT grant No. 2B06005.
Key words: horse chestnut, leaf-miner, biological control, entomopathogenic fungi.
204
pp. 205-208
Dissemination strategies of the entomopathogenic fungus
Lecanicillium muscarium Zare, Gams 2000 in the host population of
Frankliniella occidentalis Pergande 1895
Sandra Lerche, Helga Sermann, Carmen Büttner
Humboldt-Universität zu Berlin, Landwirtschaftlich-Gärtnerische Fakultät, Inst. GBW, FG
Phytomedizin, Lentzeallee 55 – 57, 10145 Berlin, Germany
Abstract: The fungus Lecanicillium muscarium syn. Verticillium lecanii can be used to control
populations of the western flower thrips F. occidentalis. In laboratory, semi-field and greenhouse
trials, the infection and mortality of this host population were recorded (Hetsch 2004; Meyer 2007). At
the end of the disease process, the fungus grew and sporulated very well on the cadavers of F.
occidentalis. These sporulating cadavers were an effective inoculum source and therefore a centre of
infection for the host population (Lerche 2005). Now, trials were conducted to describe the
possibilities of fungal dissemination and the efficiency in this host-pathogen-relationship. The results
show different possibilities of pathogen dispersal. One of the most important ways of dissemination is
by the behaviour and movement of the hosts. The dispersal was horizontally within the population, in
and between the generations. The second way of pathogen dispersal by the host was the contamination
of the insects’s habitat. This included the growth of the fungus after death of the host, the sporulation
of infectious stages on casted off exuvia during molting and by the loss of spores during the movement
of the hosts. The physical agent running water also dispersed the pathogen efficient within the host
habitat. The results were discussed.
Key words: Lecanicillium muscarium, Frankliniella occidentalis, dissemination
Introduction
The Western flower thrips Frankliniella occidentalis is a major pest species of vegetable and
ornamental crops in greenhouses. The efficacy of the entomopathogenic fungus (EPF)
Lecanicillium muscarium against the Western flower thrips was determined in former studies.
The application of spore suspension led to an infection and secondarily death or saprophytic
development of the fungus on the host cadavers, respectively. The dissemination strategies of
L. muscarium starting out from these moulding cadavers were investigated in the host-parasitrelationship, in relation to humidity and the physical factors running water and air current.
The standard method of trials was conducted on single potted bean plants Phaseolus vulgaris
L. in climatic chambers. At first, 20 larvae (1st stadium) were dipped in a suspension (1,5 x
108 conidia/ml) of L. muscarium strain V24. Five days later, one infected, dead, and not yet
moulded larvae was put on one of the 2 primary leaves together with 10 untreated larvae (2nd
stage) of the host (inoculation). The incubation occurred in 2 treatments (65% and 95%
humidity) with 20°C and light regime L/D 16:8 with 12 replications. The degree of coverage
on the sporulating cadavers and the number of dead and moulded individuals of test
population were determined 2, 4, 7, 9 and 14 days past inoculation (dpi). After 14 days still
living adults had been transferred in wet chambers at 20°C for further 7 days. The
dissemination of spores on plants should be provided by impressing the leaves on agar plates
205
206
(14 dpi) and counting the colony forming units 5 days later (incubation at 20°C). In a second
treatment at 95% RH the mortality and moulding of the host population were determined
21dpi, 25 and 30 dpi.
The treatments for the investigations of the dissemination of the fungus by water and air
current were conducted on bean plants with 4 replications. On each leaf were put on 3
infected, dead, and not yet moulded larvae. The incubation occurred by 20°C for 5 days. The
colony forming units were counted. To assess the dissemination by water, after application of
1ml water on each leaf, the running off water was transferred to an agar plate. Additionally
the dissemination on the plant tissue was assessed by impressing the leaves on agar plates
after removal of the moulding hosts. Dissemination by air current: A straightened air current
from a fan was let over the moulding cadavers on the leaves to agar plates for 1 minute.
Results
The sporulating cadavers on leaves were effective inoculum sources, and they provided the
spores for the dissemination of L. muscarium. As expected, the mycelia grew very well at
95% humidity. Remarkably a successful development of the fungus on the cadavers was
recorded at 65% humidity, too. The differences were that the sporulation was faster and the
hyphae length significantly increased at 95% humidity. The average size of the mycelia on the
cadavers was 0,75mm2 at 95% RH or 0,15mm2 at 65% RH, respectively (Fig 1).
B o x p lo t o f 6 5 % r e l. L F ; 9 5 % r e l. L F
Size of mycelial growth in
2
mm
Data
4
a
b
3
2
1
0
6 5 % r e l. L F
9 5 % r e l. L F
Treatments
Figure 1. Size of the mycelia growth on the cadavers at 65% und 95% RH, 14 dpi. Results
with variant letters are significant different.
The fungus was able to disseminate at 65% and 95% within the test population. The
successful infection and moulding of the fungus on the hosts was provable from 21dpi. At
65% and 95%RH it were found infected, dead and mouldy hosts in the parental generation
and additionally up to the offspring at 95% RH (Fig.2). In the 2nd treatment at 95% RH the
mortality within the test population was 100% at 30dpi. All cadavers were moulded.
The movement of the hosts promoted the dissemination of L. muscarium very well. The
spores were transferred within the insect’s habitat, over the whole plant. The number of
infectious stages of the fungus on the leaves increased at higher humidity (Tab. 1).
Sporulation of L. muscarium on casted off exuvia as well as on cadavers after death of the
host increased the infectious stages in the insect’s habitat.
relative part of living and dead
insects of the test population
207
100,0
dead and moulded
dead and unmoulded
80,0
living
60,0
40,0
20,0
0,0
95% RH
65% RH
treatm ents
Figure 2. Relative part of living and dead F. occidentalis of the test population after development of the adults
Table 1. Size of the area contaminated with L. muscarium on agar plates after impressing of
the leaves
65% RH
95% RH
Leaf with cadaver
upper surface
lower surface
area size (mm2)
area size (mm2)
0,02
a
1,52
a
10,7
b
7,47
b
leaf without cadaver
Upper surface
area size (mm2)
0,36
a
1,03
a
From the tested physical factors, only water dispersed L. muscarium within the insect’s
habitat. In this treatment were founded colony forming units on the leaves (average: 307
spores/leaf) or in the running off water (average: 3389 spores/ml). The dissemination of the
fungus through air current is not possible. It was not found any cfu on the agar plates.
Discussion
This investigation showed that in this host-pathogen-relationship humidity, movement of the
hosts and running water are very important factors for the dissemination of the fungus. Higher
humidity increases the developmental rate, mycelial growth of the sporulating cadavers, and
the number of infectious stages in the host habitat. However, 65% RH fulfills the humidity
requirements for successful infection of the host population on the sporulating cadavers,
possibly leading to epidemics in thrips populations. The lack of moulding at 65% RH, as seen
in the test population during the trial period, could be the result of slower fungal development
(Hsiao et al. 1992). During their movement, thrips can individually collect spores from any
moulding cadaver and disperse conidia over the entire plant. Secondary mortality and
moulding of the insects constitute new inoculum sources and increases the infection
possibilities. Leaning on papers of Tanada (1964) and Andreadis (1987) on general dispersal
ways of entomopathogenic fungi, in the examined host-parasit-relationship the following
dissemination strategies were detected: Dissemination within the population caused by the
specific behaviour and movement of the host. The dispersal is promoted by the high mobility
of the host (Gardner et al., 1984; Kaakeh, 1996). Or dispersal through contamination of the
insect’s habitat by sporulation of the fungus on the host cadavers, on the casted-off exuvia or
208
loss of spores from the integument by the movement of the infected host. Dissemination by
physical factors is also possible. Spores are transported through water dispersal. A lack off
dissemination by air movement could be a result from the extracellular matrix, which covers
the spores (Hall 1976; Hall & Atkey 1982).
References
Andreadis, T.G. 1987: Transmission. In: J.R. Fuxa and Y. Tanada. Epizootiology of Insect
Diseases. Wiley, New York: 159-176.
Gardner, W.A.; R.D. Oetting & G.K. Storey 1984: Scheduling of Verticillium lecanii and
benomyl applications to maintain aphid (Homoptera: Aphidae) control in chrysanthemums in greenhouses. J. Econom. Entomol. 77: 514-518.
Hall, R.A. 1976: Aphid control by a fungus, Verticillium lecanii, within an integrated
programme für chrysanthemum pests and diseases. Proc. 8th Brit. Insectic. Fung. Conf.
1975: 93-99.
Hall, R.A. & P.T. Atkey 1982: Infection of aphids by Verticillium lecanii. Annual Report
1980, Glasshouse Crops Research Institute: 119.
Hetsch, N. 2004: Untersuchungen zur Virulenzstabilität von Verticillium lecanii (Zimm.)
Viégas (Hyphomycetales, Moniliaceae) unter verschiedenen Umweltbedingungen am
Beispiel von Frankliniella occidentalis (Thysanoptera, Thripidae). Dissertation, Humboldt-Universität Berlin, Landwirtschaftlich-Gärtnerische Fakultät, FG Phytomedizin.
Hsiao, W.F., M.J. Bidochka & G.G. Khachatourians 1992: Effect of temperature and relative
humidity on the virulence of Verticillium lecanii toward the Oat-bird Berry Aphid,
Rhopalosiphum padi (Hom, Aphididae). J. Appl. Entomol. 114: 484-490.
Kaakeh, W.; B.L. Reid & G.W. Bennett 1996: Horizontal transmission of the entomopathogenic fungus Metarhizium anisopliae (Imperfect Fungi: Hyphomycetes) and hydramethylnon among German Cockroaches (Dictyoptera: Blattellidae). J. Entomol. Sci. 31:
378-390.
Lerche, S., H. Sermann & C. Büttner 2005: Evaluations of the dissemination of the entomopathogenic fungus Verticillium lecanii (Zimmermann) Viegas in populations of Frankliniella occidentalis (Pergande, 1895). Mitt. DPG 35: 22-23.
Meyer, U. 2007: Untersuchungen zum Infektionsverhalten, zur Ausbreitung und zur Langzeitwirkung von Verticillium lecanii (Zimm.) Viegas (Hyphomycetales: Moniliaceae) in
einer Population des Kalifornischen Blütenthrips Frankliniella occidentalis (Pergande)
(Thysanoptera: Thripidae). Diss. Humboldt-Univ. Berlin.
Tanada, Y. 1964: Epizootiology of Insect Diseases. In: DeBach, P.: Biological Control of
Insect Pests and Weeds. Reinhold, New York: 548-567.
pp. 209-213
Preliminary investigations on the occurrence of arthropod fungal
pathogens in Austria
Cezary Tkaczuk1, Stanisław Bałazy2, Rudolf Wegensteiner3
1
University of Podlasie, Department of Plant Protection, Prusa 14, 08-110 Siedlce, Poland;
2
Research Centre for Agricultural and Forest Environment PAS, Bukowska 19, 60-809
Poznań, Poland; 3Univ.-BOKU, Institute of Forest Entomology, Forest Pathology and Forest
Protection, Hasenauerstrasse 38, 1090 Vienna, Austria
Abstract: The aim of this investigation was to improve our knowledge of fungal pathogens of insects
and mites in Austria and to compare their distribution and density in the soil from different habitats.
Twelve entomophthoralean species from different insects and one species from mites were identified.
Especially interesting is the first record to Austria of Erynia ovispora, Entomophthora israelensis,
Pandora echinospora, Pandora vomitoriae, Zoophthora opomyzae, Zoophthora petchii and Neozygites
floridana, but also two Hyphomycetes species – Hirsutella kirchneri and H. thompsonii – on eriophyid
mites. Three fungal species: Beauveria. bassiana, Metarhizium. anisopliae and Isaria fumosorosea
were isolated by means of selective medium method from the soil of different habitats in Austria. The
total CFU density of entomopathogenic fungi was 4-times higher in the soil from field afforestations
than adjacent conventionally managed arable fields. CFU of B. bassiana were the most numerous in
the soil from all investigated forest sites.
Key words: entomopathogenic fungi, occurrence, insects, mites, soil, Austria
Introduction
Entomopathogenic fungi are considered the most important pathogens of many insect and
mite pest species and they are known to have a great potential as biological control agents.
Knowledge of local species composition and distribution is important if the indigenous
population of entomopathogenic fungi should be managed in a way in which it is favoured for
the control of pest insects populations within an agroecosystem. From Austria, there is only
scanty information on the occurrence of Entomophthorales on different insects, mainly aphids
(Barta et al., 2003, 2005) and entomopathogenic Hyphomycetes in the soils under different
management (Wegensteiner et al., 1998; Hozzank et al., 2003). The aim of this investigation
was to improve our knowledge of fungal pathogens of insects and mites in Austria and to
compare their distribution and density in the soil from different habitats.
Collections of entomopathogenic fungi were conducted in August 2006 in eight sampling
areas mainly in Lower Austria (6 sites) and Burgenland (2 sites). The insects and mites with
external symptoms of fungal disease were collected from crops, grasses, orchards, forests and
urban areas. Isolation and identification of entomopathogenic fungi was performed in the
laboratory using standard methods.
The selective medium method adapted from Strasser et al. (1996) was used to determine
density of entomopathogenic fungi in the soil of arable fields and adjacent field afforestations
in three distinct localities (Dt. Jahrndorf and Albrechtsfeld in Burgenland and Porrau, Lower
Austria). The same method was used to determine density of insect pathogenic fungi in the
209
210
soil from five different forest habitats. The soils were sampled at 15 cm depth by means of
little steel shovel. The selective medium consisted of 10 g peptone, 20 g glucose, 18 g agar,
all dissolved in 1 liter distilled water and autoclaved at 120°C for 20 minutes. At temperature
of 60°C 0,6 g streptomycin, 0,05 g tetracycline and 0,05 g cycloheximide previously
dissolved in distilled, sterile water and 0,1 ml Dodine were added. Isolations on selective
medium were done with three replications and without using dilutions of soil suspension. The
data were statistically analysed with an analysis of variance (ANOVA) and expressed as
colony forming units (CFU) per gram of dry soil.
Twelve entomophthoralean species from insects and one species from mites were identified
(Tables 1 & 3). Especially interesting is the first record to Austria of Erynia ovispora (on
brachycerous flies), Entomophthora israelensis on midges (Cecidomyidae, Diptera), Pandora
echinospora (on lauxanid flies), Pandora vomitoriae (on calyptrate flies), Zoophthora
opomyzae (on Opomyza florum), Zoophthora petchii (on plant-hoppers) and Neozygites
floridana (on the spider-mite Bryobia rubrioculus). From Austria, there are only rather scanty
information on the occurrence of Entomophthorales, a preliminary study brought evidence of
several different species on aphids and flies (Barta et al., 2003, 2005).
Table 1. Entomophthoralean fungi identified from different insect species in Austria
Fungus species
Zoophthora dipterigena
Host species
Unidentified plant-hoppers on underside of Petasites in mid-forest
stream valley, Rothwald.
Individuals of Collembola in subcortical insects rearing of the oak
bark, Porrau (organic farm).
Midges (Cecidomyidae, Diptera) on the underside of sunflower
leaves, Albrechtsfeld.
Different calyptrate flies, vicinity of Vienna and Rothwald, few
specimens.
Unidentified aphids feeding on sunflower leaves, not numerous,
Albrechtsfeld.
Brachycerous flies attached to tree branches partly plunged in
stream water, in afforested ravine near Vienna.
Individuals of lauxanid flies found among the grasses, Vienna-Park.
Unidentified aphids feeding on sunflower, Albrechtsfeld.
Unidentified flies attached to nettle leaves in a riparian shelterbelt
North-East of Vienna.
Flies (Sciaridae, Diptera), Vienna-Park, attached to grasses.
Zoophthora petchii*
Unidentified plant-hoppers, Petasites leaves, Rothwald
Zoophthora opomyzae*
Adult of the fly Opomyza florum in Vienna-Park, under a leaf of
Arctium lappa.
Batkoa apiculata
Conidiobolus cf. adiaeretus
Entomophthora israelensis*
Entomophthora muscae
Entomophthora planchoniana
Erynia ovispora*
Pandora echinospora*
Pandora neoaphidis
Pandora vomitoriae*
* - first record in Austria
From among entomopathogenic Hyphomycetes B. bassiana was found in all investigated
habitats, with the highest frequency in alfalfa cultures on Sitona-weevils and in abandoned
orchards on plant-hoppers and small curculionid beetles (Tab. 2). Single insect specimens
infected by Isaria farinosa, M. anisopliae and I. fumosorosea occurred in forest litter where
211
as the last species was richly isolated from soil samples by the use of selective medium
method. Moreover two species, Hirsutella kirchneri and H. thompsonii, were isolated from
eriophyid mite Abacarus hystrix on grasses from road-sides and lawns. Both of them have not
been so far isolated from Austria, however these two Hirsutella species dominated on A.
hystrix in the same habitats in Poland (Miętkiewski et al. 2000; 2003).
Table 2. Hyphomycetes fungi identified from different insect species in Austria
Fungus species
Beauveria bassiana
Lecanicillium cf. lecanii
Isaria farinosa
Isaria fumosorosea
Lecanicillium muscarium
Lecanicillium cf. dimorphum
Host species
Common on different insects e.g. on Sitona sp.-weevils, planthoppers, curculionid beetles and others, overall.
An unidentified small insect in bark beetle feeding-site on Norway
spruce, Rothwald.
Individuals of insects in the forest litter near organic farm.
Larvae and pupae of Lepidoptera found in the forest litter near the
organic farm, Porrau.
Adult-gnats in reared subcortical detritus, Rothwald.
Sciarid-larva in reared subcortical detritus, Rothwald.
Beetle larva found on a deforested patch, Rothwald.
Table 3. Entomopathogenic fungi identified from different mite species in Austria
Fungus species
Neozygites floridana*
Hirsutella thompsonii*
Hirsutella kirchneri*
Hirsutella cf. brownorum*
Lecanicillium cf. lecanii
Lecanicillium cf. dimorphum
Host species
Entomophthorales
Spider-mite Bryobia rubrioculus found on apple tree shoots –
resting spores inside of the mite body, suburban Vienna.
Hyphomycetes
Gall mite Abacarus hystrix feeding on grass leaves Vienna-Park and
roadsides near Porrau.
Gall mite Abacarus hystrix feeding on grass leaves Vienna-Park and
roadsides near Porrau.
Predatory mites found in rearing materials of subcortical insects of
the spruce bark, Rothwald.
Predatory mites found in rearing materials of subcortical insects of
the spruce bark, Rothwald.
A gamasid mite in reared material from Ips typographus feeding
site, Rothwald.
* - first record in Austria
Apart from the above mentioned species the following fungal species were found in
rearing materials of subcortical insects mostly of the spruce bark: Hirsutella cf. brownorum,
Lecanicillium cf. lecanii, L. cf. muscarium and L. cf. dimorphum. Three fungal species: B.
bassiana, M. anisopliae and I. fumosorosea were isolated by means of selective medium
method from the soil of different habitats in Austria. The same three fungal species were
isolated in former studies from Austrian soils using “insect bait method” (Hozzank et al.
2003). All they were also found in 2x2 m research plots on dead insects in forest litter, where
the first and the third species were dominating.
212
18
a
16
12
10
a
3
CFU x 10 /g of soil
14
a
8
6
b
4
b
a
2
a
b
0
B. bassiana
M. anisopliae
I. fumosorosea
Total
fungal species
arable fields
field afforestations
Figure 1. Mean observed densities of CFUs of entomopathogenic fungal species in the soil of
arable fields and adjacent field afforestations in Austria (average from 3 sites), bars with
different letters are significantly different (P< 0,05)
10
a
6
3
CFU x 10 /g of soil
8
4
b
2
c
0
B. b assiana
M. anisopliae
I. fum osorosea
Figure 2. Mean densities of CFUs of entomopathogenic fungal species in the forest soils
(average from 5 forest sites); bars with different letters are significantly different (P< 0,05).
The total CFU density of entomopathogenic fungi was 4-times higher in the soil from
field afforestations than adjacent conventionally managed arable fields (Fig. 1). M. anisopliae
CFU dominated in both investigated habitats, while its density in the soil from the afforested
area was much higher (Fig. 2). I. fumosorosea also occurred in higher density in the soil of
field afforestations than arable fields, forming respectively 7,2x103 g-1 and 0,9x103 CFU g-1.
Hozzank et al. (2003) found that in soils from hedgerow in Austria significantly more
bait larvae infected by entomopathogenic fungi than in comparable other sites. In their studies
I. fumosorosea (reported under the generic name Paecilomyces) was isolated only from
hedgerow soil. Similarly to the present study, Steenberg (1995) and Meyling & Eilenberg
(2006) in Denmark and Chandler et al. (1997) in UK isolated I . fumosorosea most often from
hedgerow soils. The lowest density of entomopathogenic fungi in the intensively cultivated
arable soils could be an effect of pesticide use and cultural practices, such as tillage regimes.
Pesticides may have a direct impact on the natural occurrence, infectivity and population
dynamics of entomopathogenic fungi. They can affect other macro- and microorganisms,
213
which interact with the entomogenous fungi (Miętkiewski et al. 1997). The hedgerows and
small woodlots are probably most important for persistence of entomopathogenic fungi in
agro-ecosystems (Hozzank et al. 2003).
CFU of B. bassiana were the most numerous in all investigated forest soils, whereas M.
anisopliae which dominated in arable soils, formed here only few CFU (Fig. 2). The high
frequency of B. bassiana in the forest soil in Austria was confirmed in the former studies
carried out by means of insect bait method by Wegensteiner et al. (1998) and Hozzank et al.
(2003). This fungus was also dominant in the soil from different forest habitats in Poland
(Tkaczuk & Miętkiewski, 1998), Denmark (Steenberg, 1995) and Finland (Vanninen, 1996).
Acknowledgements
This study was supported by the WTZ programme, Austria-Poland (12/2006).
References
Barta, M., Stalmachova-Eliasova, M., Hozzank, A., Cagan, L. & Wegensteiner, R. 2003:
Results of preliminary investigations on the occurrence of Entomophthorales on aphids
in Austria. IOBC/WPRS Bull. 26 (1): 81-83.
Barta, M., Keller, S., Cate, P. & Wegensteiner, R. 2005: Observations on the occurrence of
Entomophthorales in Austria. IOBC/WPRS Bull. 28 (3): 49-52.
Chandler, D., Hay, D. & Reid, A.P. 1997: Sampling and occurrence of entomopathogenic
fungi and nematodes in UK soils. Appl. Soil Ecol. 5: 133-141.
Hozzank, A., Wegensteiner, R., Waitzbauer, W., Burnell, A., Mracek, Z. & Zimmermann, G.
2003: Investigations on the occurrence of entomopathogenic fungi and entomoparasitic
nematodes in soils from Lower Austria. IOBC/WPRS Bull. 26 (1): 77-80.
Meyling, N.V. & Eilenberg, J. 2006: Occurrence and distribution of soil entomopathogenic
fungi within a single organic agroecosystem. Agricult. Ecosyst. Environ. 113: 336-341.
Miętkiewski, R., Bałazy, S., Tkaczuk, C. 2000: Mycopathogens of mites in Poland – a review.
Biocontrol Sci. Technol. 10: 459-465.
Miętkiewski, R., Bałazy, S., Tkaczuk, C. 2003: Mycoses of eriophyid mites (Acari: Eriophyoidea) occurring on grasses. Prog. Plant Protect. 43: 268-276.
Miętkiewski, R.T., Pell, J.K. & Clark, S.J. 1997: Influence of pesticides use on the natural
occurrence of entomopathogenic fungi in arable soils in the UK: field and laboratory
comparison. Biocontrol Sci. Technol. 7: 565-575.
Steenberg, T. 1995: Natural occurrence of Beauveria bassiana (Bals.) Vuill. with focus on
infectivity to Sitona species and other insects in lucerne. Ph.D. Thesis. The Royal
Veterinary and Agricultural University, Copenhagen.
Strasser, H., Forer, A. & Schinner, F. 1996: Development of media for the selective isolation
and maintenance of virulence of Beauveria brongniartii. In: Microbial Control of Soil
Dwelling Pests. Jackson & Glare (eds.). AgResearch, Lincoln, New Zealand: 125-130.
Tkaczuk, C. & Miętkiewski, R. 1998: Mycoses of sawfly (Diprion pini L.) during hibernation
period in relation to entomopathogenic fungi occurring in soil and litter. Folia Forest.
Pol., Ser. A. 40: 25-33.
Vanninen, I. 1996: Distribution and occurrence of four entomopathogenic fungi in Finland:
Effect of geographical location, habitat type and soil type. Mycol. Res. 100: 93-101.
Wegensteiner, R., Zimmermann, G, Keller, S., Mracek, Z., Hager, H. & Schume, H. 1998:
Occurrence of entomopathogenic fungi, bacteria and nematodes in forest soils in Austria.
IOBC/WPRS Bull. 21 (4): 265-268.
p. 214
Efficacy of entomopathogenic fungi in control of different stages of
western flower thrips (Frankliniella occidentalis Pergande)
Zaneta Anna Fiedler, Danuta Sosnowska
Institute of Plant Protection, Poland, Street Miczurina 20, 60-318 Poznan, Poland
Abstract: Frankliniella occidentalis is the most important pest in greenhouse crops. This pest has a
broad host range of more than 500 species in 50 plant families and is associated with many cultivated
crops and ornamentals. Western flower thrips can cause direct damage due to feeding plant and
indirect damage due to transmission of tomato spotted wilt virus (TSWV). Successful control of this
pest is very difficult to achieve due to life cycle where some stages are not available to the
insecticides. Thrips develop in flowers, lay eggs under epidermis. Moreover prepupal and pupal stages
develop in soil. In practice, entomopathogenic fungi are mostly used in control of insect pest of
greenhouse crops because environmental factors such as temperature and humidity are optimal for
their development and efficacy.
The main objective of the research was to evaluate the pathogenicity of the Polish strains of eight
species of entomopathogenic fungi such as: Paecilomyces lilacinus, Metarhizium anisopliae,
Beauveria bassiana, Lecanicillium lecanii, Paecilomyces tenuipes, Paecilomyces farinosus, Paecilomyces fumosoroseus and Pochonia chlamydosporia to different stages of F. occidentalis.
The results revealed that B. bassiana and M. anisopliae have showed the greatest efficiency in
controlling foliage and adults stages of F. occidentalis. The fungus B. bassiana caused 97% mortality
of adults of western flower thrips. However in controlling soil stages of this pest the species: P.
lilacinus and M. anisopliae have showed the greatest efficiency. These fungi almost caused 80%
mortality of soil stages of F. occidentalis. The fungus P. chlamydosporia wasn’t efficient to all stages
of F. occidentalis.
The biological control should be a priority in plant protection, and M. anisopliae, B. bassiana and
P. lilacinus seem to be excellent candidates to be used in greenhouse biocontrol programs in control of
different stages of western flower thrips.
Keywords: Biological control, entomopathogenic fungi, wertern flower thrips
References
Lopes, R.B., Alves, S.B., Tamani, M.A. 2000: Control of Frankliniella occidentalis in
hydroponic lettuce by Metarhizium anisopliae. Scientia Agricola 57: 239-243.
Gindin, G., Barash, I., Raccah, B., Singer, S., Benzeer, J.S., Klein, M., Jenser, G., Adam, L.
1996: The potential of some entomopathogenic fungi as biocontrol agents againts the
onion thrips Thrips tabaci and the western flower thrips Frankliniella occidentalis. Folia
Entomologica Hungarica 62: 37-42.
Serman, H., Smiths, P.H. 2000: Importance of coincidence for the efficiency of the entomopathogenic fungus Vertcillium lecanii against Frankliniella occidentalis. IOBC/WPRS
Bulletin 23 (2):223-226.
214
p. 215
The potential of Beauveria brongniartii and botanical insecticide to
control Otiorhynchus sulcatus larvae in potted plants
Jolanta Dorota Kowalska
Institute of Plant Protection, Dept. Biological Control & Quarantinne, Miczurina 20 Str.,
60-318 Poznan, Poland
Abstract: Otiorhynchus sulcatus is considered as an important pest of strawberry fields. It can cause
very significant damage in a forest nursery and in ornamental potted plants. Rhododendrons are a
favorite food of these weevils Thus, feeding of imagoes and larvae lead to economical and aesthetic
losses. Laboratory trials were performed using PCV pots (diameter 6 cm) filled with soil. In each one
were placed three last-instar larvae of O. sulcatus collected from infested potted plants. The investigations were carried out using three different combinations. In the first a Polish isolate of B. brongniartii
propagated on seeds of wheat was used. The kernels covered with the fungus were applied into the
pots at the rate of 120kg/ha. In a second treatment 2 ml of water solutions of commercial available
product containing azadirachtin A (10 g of azadirachtin) were applied. In the last one, a Polish product
under development, containing 30 g of azadirachtin A + B was applied in the same way like above.
Azadirachtins were applied at recommended the dose of 500ppm. The effects of the control agents on
the pupation and mortality of insect population were observed. The efficacy of the treatments was
evaluated by counting alive individuals, during 30 days in November/December. The obtained results
suggest that all combinations gave very good control effect. Mortality of insects ranged between 8692%. Larva, pupae and imagoes were infected by fungus. In the case of azadirachtins delayed
development of insects was observed. Differences between effects caused by products containing
azadirachtin A and azadirachtin A + B was observed only at the onset of insect mortality. Results
obtained in presented experiments demonstrated that effective control of weevil infested potted plants
is possible.
Key words: black vine weevil, azadirachtin, Beauveria brongniartii, control.
References
Tkaczuk, C., Łabanowska, B.H., Augustyniuk-Kram, A. 2005: The potential of entomopathogenic fungi and nematodes against strawberry root weevil Otiorhynchus ovatus L.
(Coleoptera, Curculionidae). IOBC/WPRS Bulletin 28 (3): 173-177.
Gaffney, M.T., Maher, M., Purvis, G. 2005: Efficacy of Metarhizium anisopliae and neem
seed kernel for the control of Otiorhynchus sulcatus in nursery stock containers. Agricultural Research Forum.
Cowles, R.S. 2004: Impact of azadirachtin on vine weevil (Coleoptera: Curculionidae) reproduction. Agricultural and Forest Entomology 6: 291.
215
pp. 216-219
Efficacy of Beauveria bassiana (Vuillemin) strain against the Castniid
palm borer Paysandisia archon (Burmeister, 1880) under laboratory
and natural conditions
Samantha Besse-Millet1, Antoine Bonhomme1, Karine Panchaud2
1
Natural Plant Protection (NPP), 35 avenue Léon Blum Parc d’Activités Pau-Pyrénées,
64000 Pau (France); 2VEGETECH, 2 Impasse de l’Alisier, 83 260 La Crau (France)
Abstract: Paysandisia archon (Lepidoptera, Castniidae) is native in Argentina and has become a severe
palm trees pest. It was first detected on the French Mediterranean coast in 1999 and since declared as a
quarantine pest. Unfortunately, no chemical control is efficient because of the insect life cycle and the
palms biology. Thanks to the cooperation between two French companies, i.e. Vegetech and NPP
(Natural Plant Protection, a subsidiary of Arysta), and the support from the city of Hyères-les-Palmiers, a
strain of the entomopathogenic fungus Beauveria bassiana has been identified as pathogenic. This strain
designated Bb147 is the active ingredient of Ostrinil®, a biocontrol agent registered in France for the
control of the European Corn Borer (ECB). It has been tested under laboratory and natural conditions. In
the lab, eggs and larvae have been inoculated with a spores solution resulting in a 24 % survival in the
egg experiment and 100% mortality 14 days after the inoculation in the larval experiment. A very good
efficacy of Bb147 has been recorded both on 1 to 19 days-old larvae of Paysandisia archon. The lethal
time 50 is less than 6 days. In a second experiment, a dose response has been observed, still with high
larval mortality. A field trial has been carried out on young palms under artificial infestations of P.
archon neonate larvae in insect-proof cages. Bb 147 causes both, larval mortality and a growth delay in
surviving larvae.
Key words: Castniid Palm borer, Paysandisia archon, palms, Beauveria bassiana, Bb 147 strain
Introduction
Paysandisia archon, the palm borer, has spread from Argentina to Spain, Italy and France in
the 1990’s with importations of infested palms. It attacks many species of palms included
Trithrinax campestris, Butia yatay, but also Chamaerops humilis, Livistona chinensis, Sabal
spp., Phoenix canariensis, P. dactylifera, Trachycarpus fortunei or Washingtonia filifera.
Unfortunately, chemical or mechanical control are not very effective. We have tested the
efficacy of a Beauveria bassiana strain (Bb147), the active ingredient of Ostrinil®, on P.
archon larvae and eggs.
Pathogenicity to eggs and larvae at lab
Paysandisia archon eggs were hatched at 25°C and larvae fed on fresh pieces of Phoenix
canariensis. Another part of eggs was used for a direct Bb147 inoculation. Bb147 spores were
produced at NPP and formulated at 7x109active spores/ml. European Corn Borer larvae, the
natural host of this fungus, were simultaneously inoculated as positive control. A 1/100
dilution of the mother formulation was chosen for the inoculation because formulation
additives are not toxic at this dose. 14 eggs were inoculated with the formulation additives
216
217
only diluted at 1/100 (control) and 45 eggs with the Bb147 formulation at 1/10 with 4 µl and
then incubated at 25°C, 16:8. Thirty P. archon larvae between 1 and 19 days old were used as
control at a dilution of 1/100 and 30 larvae were inoculated with Bb 147 at the same dilution.
Larvae were soaked in the suspension with a tweezers for a few seconds. They were incubated
at 25°C and were fed with pieces of palm. The mortality was recorded from 3-27 days after
inoculations. Food was added when necessary. The Abbott corrected mortality was
determined.
Dose response experiment
Five spores concentrations from 7x106 to 7x108 CFU/ml were tested with the same protocol
as described above. This quantitative approach allows a first calibration of the effective dose
to be use in the first field trial.
Field trial
A field trial under natural conditions on artificially infected palms was launched in autumn
2006 in insect proof® cages (Diatex 8 type). Twenty 5 to 6 years-old Phoenix canariensis
palms with a 30 to 35 cm height were distributed in 4 groups of 5 individuals. Each group
corresponded to one treatment. These palms were treated with Bb 147 liquid formulation at
1.4x109, 4.1x109 and 1.4x1010 spores/tree as a preventive treatment. Spraying was with a total
volume to cover the entire foliar surface at 400 ml. Few hours after the treatment, twenty-five
21 to 37 days-old P. archon larvae were deposited on palms of each tree after drying of the
foliar crown. Palms were cut 76 days after the treatment to discover alive or dead larvae.
Efficacy of Bb 147 on P. archon eggs and larvae
Of the Bb 147- treated eggs 42% were mycosed and not hatched. On the 17 hatched larvae, 6
were dead and 5 of them were mycosed. They were infected when they left the eggs. The
larval survival rate was then only 24 % (Table 1). These observations showed the real efficacy
of the Bb 147 strain on eggs. Hatching but also the larval viability is affected. It is possible to
multiply chances of action.
Table 1. Results on eggs
Total
Blank 1/100
14
Bb 147 1/100
45
Inoculated eggs
Not mycosed
Mycosed
Not
Not
Total
Hatched
hatched Hatched
hatched
0
14
4
10
19
26
9
17
Hatched larvae
Dead
1
6 (included
5 mycosed)
Larval
Survivors survival
9
64%
11
24%
On larvae, corrected mortality reached 100 % in 14 days after inoculation and all dead
larvae were mycosed afterwards. The Lethal Time 50 (LT50) was 5 to 6 days. The European
corn borer (ECB) larvae mortality remained low during the test (inferior of 30 %), thus Bb147
was more pathogenic against P. archon larvae than against its original host, Ostrinia nubilalis
larvae.
218
In each group, 1 to 19 days-old P. archon larvae had been inoculated. The correlation was
recorded between the larval age at the moment of inoculation and the time until its death. A
90 % mortality was recorded in older larvae treated with the same dilution like younger
larvae. Results let us suggest that the fungus virulence is not influenced by larvae age and that
this treatment could be used like a curative control method. The second test confirmed the
high pathogenicity of Bb 147 to P. archon larvae and reveal a dose response: The higher the
spores concentration is, the lower is the LT50. A 1/1000 dilution shows an efficacy slightly
lower but corrected mortality reached 60 % at the end of the test. In this way, in all dilutions
except the last one, a significant larvae control was obtained within the first five days and all
larvae were dead in the first two weeks of the experiment.
Bb 147 1/10
100%
Bb 147 1/300
Bb 147 1/100
90%
80%
% of corrected mortality
Bb 147 1/30
70%
Bb 147 1/1000
60%
50%
40%
30%
20%
10%
0%
0
5
10
15
20
25
Days after inoculation
Figure 1. Dose response of P. archon larvae at Bb 147 strain treatment
Field trial
First symptoms of damage appeared after 30 days with sawdust at the larval penetration point.
Bb147 treatments reduced the palm damage significantly. An efficacy of 90% was reached at
1.4x1010 spores/tree. A very clear dose effect on larval mortality was observed. Mortality was
higher than 80 % for mean and high doses (group 3 and 4) (Table 2). For the group 2, all alive
larvae penetrated the plant at the periphery of the foliar crown. Increasing the moistening
volume could therefore possibly provide an even better efficacy. Mean initial larval length in
this trial was 10 to 12 mm. Length of surviving decreases when the spores concentration
increased. Survival of larvae in group 4 was significantly lower than in groups 1 (control) and
2 (Bb 147 low dose) (Table 3). The results indicte that Bb 147 has an efficacy at two levels: a
direct efficacy on larval mortality and an indirect efficacy inducing a growth delay.
Conclusion
With these trials it has been demonstrated that Beauveria bassiana Bb 147 is an effective
biological control agents against the Castniid Palm Borer, Paysandisia archon, effective
against eggs and young or old larvae in preventive and curative treatments. Additional trials
under natural conditions are actually conducted.
219
Table 2. Damage rate and corrected mortality
Group
Quantity
Visible
Damage
Efficacy
Surviving
of
attack
(%)
(%)
larvae
spores/tree
1
0
11
44a
13
2
1.4 x 109
6
24ab
45
8
3
4.1 x 109
2
8b
82
5
4
1.4 x 1010
1
4b
91
4
Values with the same letter are not significantly different (Chi², P<0.05)
Mortality
(%)
19a
58b
75b
82b
Corrected
mortality
(%)
48
69
78
Table 3.Survival time of P. archon larvae after preventive treatment
Larvae number
Survival larvae mean length
Group
1
2
3
4
12
8
5
4
22,50 ab 25,50 a 14,40 bc 10,50 c
Means with the same letters do not significantly differ at 5% level (t-test).
Acknowledgements
Authors want to thank the City of Hyères-les-Palmiers (France, Var) for its financial support.
References
Millet, S., Bonhomme, A. & Panchaud, K. 2007: Vers un moyen de lutte biologique contre
Paysandisia archon? Un champignon au secours des palmiers. Phytoma 604: 38-42.
Drescher, J. & Dufa, A. 2002: Importation of mature palms: a threat to native and exotic palms
in Mediterranean countries? J. Int. Palm Soc. 46: 4.
Sarto i Monteys, V. & Aguilar, L. 2005: The Castniid Palm Borer, Paysandisia archon (Burmeister, 1880), in Europe: comparative biology, pest status and possible control methods
(Lepidoptera: Castniidae). NEVA Nachrichten Entomologischer Verein Apollo. 26: 61-94.
Moore, D. & Prior, C. 1993: The potential of mycoinsecticides. Biocont. News Inf. 14: 31-40.
pp. 220-222
Efficacy of entomopathogenic fungi against larvae of the horse
chestnut leafminer Cameraria ohridella Deschka & Dimic, 1986
(Lepidoptera, Gracillariidae)
Marko Kalmus, Helga Sermann, Sandra Lerche, Carmen Büttner
Humboldt University of Berlin, Institute of Horticulture Sciences, Department of
Phytomedicine, Lentzeallee 55-57, 14195 Berlin, Germany
Abstract: Pathogenicity of Lecanicillium muscarium strain V24 (Zare & Gams, 2001) and Paecilomyces fumosoroseus strain P6 against larvae of the horse-chestnut leafminer Cameraria ohridella
within mines was investigated under laboratory conditions. Aqueous suspensions of 1x107 conidia/ml
were sprayed on eggs, deposited on leaves of seedlings with a manual sprayer. L. muscarium and P.
fumosoroseus caused mortality of 98 and 96% on larvae hatching from contaminated eggs. Mortality
of the untreated control was significantly lower (12%). In both fungal treatments only 4% of all larvae
pupated successfully. All cadavers from the treatments were moulded. In some cases the mycelium
grew out of the mines. Additionally, dimensions of the mines were determined within 21 days past
application.
Key words: entomopathogenic fungi, Lecanicillium muscarium, Verticillium lecanii, Paecilomyces
fumosoroseus, Aesculus hippocastanum, horse chestnut leafminer, Cameraria ohridella, larval
mortality
Introduction
The larvae of the horse chestnut leafminer C. ohridella cause remarkable leaf damages. In
spite of intensive investigations in Europe, no lasting control strategy has been found. Trials
were conducted to test the biocontrol potential of the entomopathogenic fungi Lecanicillium
muscarium Zare, Gams 2000 (syn. Verticillium lecanii) and Paecilomyces fumosoroseus
Brown, Smith 1957 against endophytic larvae of the chestnut leafminer C. ohridella within
their mines.
Each treatment was composed of 5 to 7 fully grown leaves on each of 3 seedlings. Each
seedling received a 9 ml suspension (1x107 conidia/ml) of L. muscarium strain V24 or P.
fumosoroseus strain 6, respectively. Controls were treated with 9 ml water. The treatments
were kept separately in plastic cages in a growth chamber for 28 days with a day/night regime
of 16-8 h, a corresponding temperature at 25-21°C and RH of 90%-98%. The dimensions of
the mines were determined 3, 7, 10, 14, 17 and 21 days past application (dpa) (n=212 mines).
After opening the mines 28 dpa, the developmental stage, mortality and fungal infection was
determined.
220
221
Results
Development of mines
At 3 dpa the development of mines in the fungal treatment seemed to be slower, than in the
control. However the difference was not significant. In the following days the development of
mines was quicker in the fungal treatments than in the control, so that later examinations
showed similar development in all treatments (Fig. 1).
L. muscarium
control
P. fumosoroseus
100
mines (%)
80
60
40
20
0
3
7
10
14
17
dpi
3
7
unhatched
comma-shaped mine
small circular mine (ø 2-4 mm)
10
14
17
dpi
3
7
10
14
17
dpi
large circular mine (ø 5-8 mm)
irregular shaped mine
Figure 1. Development of mines produced by C. ohridella after leaf application with L.
muscarium strain V24 or P. fumosoroseus strain 6 (1x107 conidia/ml) and in untreated control
Development of larvae within mines
The natural mortality of the control was significantly lower (12%) than in the fungal
treatments. The control-population consisted of 91% pupae altogether (of these 9% dead), 5%
alive moths and 4% dead larvae (Fig. 2). Mortality in L. muscarium was 98% and in P.
fumosoroseus 96%, respectively (Tab. 1). Only 4% of all larvae pupated successfully in both
fungal treatments. All larval cadavers, even the dead pupae from the treatments, were
moulded. In some cases the mycelium grew out of the mines. No mycelial growth was
observed on the dead larvae from control treatment.
Conclusion
Both fungal strains cause primarily high pathogenicity to larvae of C. ohridella in their mines.
The development of the mines indicates that the fungi developed their full effectivity at the
end of larval development and inhibited the pupation. Fungi grew through the epidermis into
the mines and infect the larvae inside. When the larvae were dead, the fungi grew through the
epidermis of the mines to the leaf surface again. The results show the effectivness of fungi
against larvae of leaf mining moths. The fungi can inhibit complete development of the
larvae, thereby reducing generational propagation and overall pathogen load on horse chestnut
tree.
222
Contr
larvae
L.
pupae
adult
P.
for each:
dead
dead and moulded
Figure 2. Stages of C. ohridella 28 d after application of L. muscarium, P. fumosoroseus
(1x107 conidia/ml) and in untreated control, temperature 25/21°C, RH 90/100%, light 18/6h.
Tabel 1. Number of dead and fungus-infected pupae, mortality and infection rate of larvae/
pupae of C. ohridella after leaf application of L. muscarium and P. fumosoroseus
larvae/pupae 28 dpa
- alive (number)
- dead (number)
mortality %
- degree of efficiency %
- significance %
mouldy larvae/pupae (number)
- moulding rate %
- significance %
control
57
51
6
11
a
0
0
a
L. muscarium
50
1
49
98
98
B
48
98
B
P. fumosoroseus
84
0
84
100
100
b
84
100
b
Acknowledgements
Thanks are due to Dr. Barbara Jäckel (Plant Protection Office Berlin) for supporting this
project.
References
Zare, R. & Gams, W. 2001: A revision of Verticillium section Prostrata. IV. The genera Lecanicillium and Simplicillium gen. nov. Nova Hedwigia 73: 1-50.
pp. 223-227
Efficiency of the entomopathogenic fungus Lecanicillium muscarium
on hibernating pupae of Cameraria ohridella Deschka & Dimic, 1986
(Lepidoptera, Gracillariidae)
Doreen Richter1, Helga Sermann1, Cornelia Jantsch1, Barbara Jäckel2,
Carmen Büttner1
1
Humboldt University of Berlin, Institute of Horticulture Sciences, Department of
Phytomedicine, Lentzeallee 55-57, 14195 Berlin; 2 Plant Protection Office of Berlin,
Germany
Abstract: Pathogenicity of strains of Lecanicillium muscarium, Paecilomyces fumosoroseus,
Metarhizium anisopliae, Beauveria bassiana was investigated under laboratory conditions on naked
pupae and pupae in their pupal cells and in a semi field trial. Aqueous suspensions of 2 x 107
conidia/ml were sprayed in the laboratory with potter towers on the pupae and pupal cells. In the semi
field trial 2,2 x 108 conidia/ml were sprayed with a hand applicator on the leaves on soil. The naked
pupae are susceptible against entomopathogenic fungi. Mortality of naked pupae occurred earlier in
Lecanicillium and Paecilomyces than in Metarhizium and Beauveria. In the pupal cells fewer pupae
died but these pupae were infected by the fungi. L. muscarium was able to infect 56% of the pupae. In
the semi field trial the fungus infected pupae of C. ohridella in their pupal cells and passed into the
next stage of adult. Together the fungus has reduced the population by approximately 60%.
Key words: Aesculus hippocastanum, horse chestnut leafminer, Cameraria ohridella, pupae, entomopathogenic fungi, Lecanicillium muscarium, Paecilomyces fumosoroseus, Metarhizium anisopliae,
Beauveria bassiana
Introduction
Up to date there is no successful method to control the horse-chestnut leaf miner Cameraria
ohridella. In an EU project (No. 10700 UEP/WÜ5, coordinator Plant Protection Office of
Berlin) we examine different methods to control this pest. Our task in this program is to
determine the efficacy of entomopathogenic fungi on the pupae of C. ohridella during the
winter on the leaf litter. The question was whether it is possible to restrict the population in
the pupal cells and especially during the winter. Are the fungi able to regulate the population
density under these conditions? Before fungi were applied against pupae in a semi field trial
during the winter, two application strategies were tested in the laboratory:
• Application of naked pupae without their pupal cells to examine susceptibility of
pupae
• Spraying on the closed pupal chamber in the leaves
Material and method
For trials four fungal strains were used from our strain collection: Lecanicillium muscarium
(syn. Verticillium lecanii) strain V 24 (HU-Berlin). This strain is effective against different
sucking insects. Paecilomyces fumosoroseus strain P 6 (BBA Darmstadt) with a broader
effectivity. Metarhizium anisopliae strain 72 (BBA Darmstadt), effective against coleopteran
species and Beauveria bassiana strain 412 (from former Agrevo, Frankfurt a.M.) with good
223
224
efficacy against different soil insects. All these strains were produced on solid media in the
laboratory and sprayed as aqueous spore suspensions.
Laboratory biotest
A Petri dish (9 cm diameter) was filled with 20 ml of non sterile soil from a chestnut location
with a water content of 10 %. On each Petri dish 10 naked pupae or closed pupal cells were
placed. There were 3 replications per treatment. The spore suspension was sprayed either on
the soil and naked pupae were transferred after application or pupal cells were laid on the soil
before fungal application. On each Petri dish 3 ml conidial suspension was sprayed (2 x 107
conidia/ml) with a potter tower corresponding to 9,1x104 conidia/cm² spore density on the
soil. The dishes were closed and incubated at temperatures of 5°C and 12°C. The parameter of
evaluation were: living, dead and mouldy pupae weekly over a period of 164 days with naked
pupae and in the case of pupal cells only one time after 164 days. In addition the infection
process was investigated with fluorescence and electron microscopy.
Semi field plot trial
Plots were of 0,8x0,8m (=0,64m²). Each plot received 1 kg of infested chestnut leaves,
corresponding to 3100 leaflets. Per treatment, there were four replications and one untreated
control. The application took place either as a winter treatment on December 22, 2005 or as a
spring treatment on March 31, 2006. A third variable was treated twice at both dates.
Applications were made with a hand applicator. One hundred ml of L. muscarium strain V 24
(2,2 x 108 spores/ml) were equally spread on the leaves of each plot, corresponding to a
density of 3,4x105 conidia/cm². Assessments were made at three dates on March, 2, April 10
and May 12. The evaluation of treatments took place in two steps. First, 10 leaves per plot
were taken, all mines opened and all pupae were examined for alive, dead and mouldy pupae.
Second, pupae found were disinfected superficially and incubated in wet chambers at 25°C.
The pupae and hatched moth were examined again in March and April after fourteen days and
in May after only after seven days counting the number of alive, dead and mouldy pupae and
moth.
Results
Sensitivity of naked pupae
Spores of all fungi stuck to the integument of pupae. A quicker germination and development
was registered with Lecanicillium and Paecilomyces. In treatments of Lecanicillium and
Paecilomyces some dead individuals were found already two weeks after application, where
as in treatments of Metarhizium and Beauveria first dead pupae appeared two weeks later.
Development of mortality was also quicker in Lecanicillium and Paecilomyces, however the
differences were not significant. Results indicate the susceptibility of naked pupae to all fungi
tested.
Effect on pupae in pupal cells
When pupae were inside their pupal cells the natural mortality was lower than recorded with
naked pupae. Also in the treatments fewer pupae died, as the leaf epidermis and the pupal
cells gave protection against spores of entomopathogenic fungi. Not any spores were found in
the pupal cells. The higher mortality of pupae at 5°C corresponded with the higher natural
susceptibility at this temperature. For M. anisopliae and B. bassiana the conditions were more
unfavourable than for L. muscarium and P. fumosoroseus. Therefore, only few pupae were
mouldy through these fungi. At 12°C only few pupae were dead, which were infected mouldy
225
pupae in all treatments. Only L. muscarium was able to infect more pupae. The differences to
the other treatments and the control were significant.
100
80
V. lecanii, V 24
60
P. fumosoroseus, P 6
M. anisopliae, M 58
40
B. bassiana, B 412
20
0
14.10
1. 11.
28. 10.
10. 12.
19. 11.
4.1
05
04
Figure 1. Pathogenicity of L. muscarium, P. fumosoroseus, B. bassiana, M. anisopliae at
12°C, 10% soil humidity in the biotest
100
dead pupae
mouldy pupae
80
60
40
20
0
K.
P. f.
L. m.
M. a.
B. b.
5°C
L. m.
K.
B. b.
P. f.
M. a.
12°C
Figure 2. Percentage dead and mouldy dead pupae of C. ohridella after application of entomopathogenic fungi on pupae cells at soil and incubation for 164 dpi at 5°C, 12°C and 10% soil
humidity in the biotest
Conclusion of Biotests
•
Entomopathogenic fungi were able to infect the pupae of C. ohridella at low temperature
•
Leaf epidermis and pupal cells provide protection against spores
•
Fungus infection of pupae was not iniciated by spores
•
L. muscarium strain V 24 reached a stable average infection in pupae in pupal cells
•
Lecanicillium had the quickest access time and reached a stable average infection
•
Therefore, in the semifield trial the work was continued with Lecanicillium
Semi field plot trial
The results of the semi field trial are presented in Fig. 3. The mortality of the C. ohridella
population was < 40% with hardly any differences between control and treatments.
226
After incubation of pupae the influence of the fungus became visible. More pupae were
dead in treatments than in the control. In the case of winter application, the difference in
relation to the control was significant (Figure 4).
100
90
tote Puppen %
80
70
Kontrolle
60
Winter
50
Winter-&Frühjahr
40
30
20
10
0
Varianten
Figure 3. Percentage of dead pupae and hatched moths of C. ohridella after application of L.
muscarium (2,2x108 conidia/ml) on leaves in the winter, sampling time May 12, 2006
100
mortality
moth
80
60
40
20
0
control
winter + spring
winterapplication
spring
Figure 4. Percentage of dead pupae of C. ohridella after application of L. muscarium (2,2x108
spores/ml) on leaves at soil from winter and winter + spring treatments. Sampling time
March, 2, 2006 and incubation of pupae at 12°C and 95% RH
100
Verpilzung %
80
Kontrolle
60
Winter
40
Winter-&Frühjahr
20
0
Varianten
Figure 5. Mouldy moths of C. ohridella after application with L. muscarium (2,2x108 sp./ml)
on the leaves at soil from winter and winter + spring treatments. Sampling time March, 2,
2006 and incubation of pupae at 12°C and 95% RH.
227
100
L.m. pupae
L.m. moth
80
60
40
20
0
K1
W1
2. 3. 06
W-F1
K2
W2
10. 4. 06
K3
W3
W-F3
F3
15. 5. 06
Figure 6 Percentage of mouldy pupae and moths of C. ohridella after application with L.
muscarium (2,2x108 sp./ml) of chestnut leaves at soil after incubation of pupae at 12°C and
95% humidity
The living pupae of all treatments and the control were observed further and an effect of
the fungus on the moth was recorded. Moths from treatments died earlier than those from the
control and mould was recorded. The difference in both treatments with winter application
was significant to the control.
In the final presentation the mortality of pupae and moths were connected. The natural
mortality of pupae was very low. In spite of the strong winter 2005 to 2006 the mortality was
only 10% in the control. In contrast to this, the mortality of pupae and moths was clearly
increased through the fungus (Fig. 6). Mouldy pupae and mouldy moths together had
achieved a higher success than pupae alone. To each control time, the mortality was
significantly higher than in the control. In March more pupae were dead than moths. In May
more dead moths than pupae were found. Together the fungus can reduced approximately the
pest population to 60%. The difference was not significant between the take out time of
March and May.
Conclusion
The results of the investigation let us conclude the following:
• The pupae of C. ohridella have a low natural mortality in their pupal cells during
winter
• Inside the pupal cells, pupae very well against abiotic and biotic influences
• The fungus L. muscarium is able to infect the pupae in their closed pupal chambers
• The fungus grew into the pupal cells and reached the pupae with hyphae
• The infection was passed into the adult stage
• The fungus was able to grow at low temperatures
• The fungus increased the natural mortality of pupae of C. ohridella during winter
• Investigation on the infection process in the pupal cell will have to follow in order to
improve the sustainability of the fungus
Lecanicillium muscarium strain V 24 is suitable for reduction of the population of
Cameraria ohridella during the winter, however, the level of infection is low. In combination
with other control methods during the summer the population of C. ohridella might be
reduced sufficiently.
pp. 228-233
Susceptibility of Rhagoletis cerasi to entomopathogenic fungi
Claudia Daniel1,2, Siegfried Keller3 & Eric Wyss1
1
Forschungsinstitut für biologischen Landbau (FiBL), Ackerstrasse, 5070 Frick, Switzerland;
2
TU München, Wissenschaftszentrum Weihenstephan, Fachgebiet Obstbau, 85350 Freising,
Germany; 3Agroscope Research Station ART Reckenholz, Reckenholzstrasse 191, 8046
Zurich, Switzerland
Abstract: The effects of six fungus strains (Deuteromycotina: Hyphomycetes) on the mortality of
different life stages of the European cherry fruit fly, Rhagoletis cerasi Loew (Diptera: Tephritidae),
were assessed in a series of laboratory experiments. All fungus strains were able to cause mycosis to
larvae and adults of R. cerasi. However, virulence varied considerably among the strains. Effects on
L3-larvae were negligible. In contrary, adults were highly susceptible to fungus infection. Beauveria
bassiana and Paecilomyces fumosoroseus caused 90 to 100% mortality and had a strong influence on
fecundity. Metarhizium anisopliae also showed reliable effects. The pathogenicity of Paecilomyces
farinosus was low. Higher conidia concentrations lead to higher mortality, whereas B. bassiana was
most efficient at low concentrations. Young flies showed lower mortality rates than older flies but,
sub-lethal effects on eclosion rate off eggs were greater in young than in older flies.
Key words: Rhagoletis cerasi, Beauveria bassiana, Metarhizium anisopliae, Paecilomyces fumosoroseus, Paecilomyces farinosus.
Introduction
The European Cherry Fruit Fly Rhagoletis cerasi Loew (Diptera: Tephritidae) is the main pest
of sweet cherries. Without treatment up to 100% of the fruit can be infested. Although the
pest insect is known since long times and although it is well studied, it still poses a challenge
to cherry growers, because of the low tolerance level of market (maximum 2% of infested
fruits). Dimethoate, the product currently used, might soon loose the registration. The use of
sticky traps and crop netting – strategies used in organic cherry production – are labourintensive and do often not provide sufficient control. The use of micro-organisms as
biological control agents might be an alternative for organic cherry growing as well as for the
integrated production. Many publications showed an susceptibility of tephritid flies to
hyphomycetous fungi (Anagnou-Veroniki et al., 2005; Carswell et al., 1998; Castillo et al.,
2000; De La Rosa et al., 2002; Dimbi et al., 2004; Ekesi et al., 2005; Konstantopoulou &
Mazomenos, 2005; Lezama-Gutierrez et al., 2000; Mochi et al., 2006; Yee & Lacey, 2005).
However, there is only very little knowledge on fungal pathogens of R. cerasi. Wiesmann
(1933) described adult flies infested by Empusa ssp. (Zygomycetes: Entomophthoraceae).
Until now, no research was done on the use of hyphomycetous fungi to control R. cerasi. The
aim of this series of laboratory experiments was to determine the effects of different fungus
strains on the mortality of different life stages of R. cerasi in order to find a new biocontrol
agent for this important pest insect.
228
229
Origin and culture of fungi
Most fungus strains used in the experiments were field collected in Switzerland (Paecilomyces fumosoroseus strain 531; Paecilomyces farinosus strain 954; Metarhizium anisopliae
strain 714, Metarhizium anisopliae strain 786). Two commercial fungus strains from the
products Naturalis-L (Beauveria bassiana strain ATCC 74040 Intrachem Bio Italia S.p.A.) and
PreFeRal® WG (Paecilomyces fumosoroseus strain Apopka 97; Biobest N.V., Belgium) were
also included in the experiments. All fungi (including the two commercial strains) were
cultured in Petri dishes on semi-selective medium adapted from Strasser et al. (1996). Petri
dishes were incubated at a temperature of 20° to 25°C during 21 to 46 days. Mature cultures
were stored at 5 to 7°C until required. Conidia suspensions were prepared using distilled
water containing 0.05% Tween®80. The viability of the conidia of each strain was tested
immediately after experiments were started by spread-plating the conidia suspension onto
water agar plates.
Experiments with adult Rhagoletis cerasi
Field collected insects were used for all experiments. Pupae collected from infested cherries
in North-western Switzerland were cold stored at 1° to 4°C for at least 160 days to break the
diapause. All flies were maintained under 16h L : 8h D at 23°C (day) / 17°C (night) and a
relative humidity of 65%.
Conidia suspension was sprayed directly onto the flies (2ml per replicate). Control flies
were treated with distilled water containing 0.05% Tween80. Mortality of flies was assessed
in 24h intervals over a period of 30 days. Dead flies were individually placed on moist peat
and incubated at 23/17°C to confirm mycosis. Effects on fecundity were assessed by counting
the number of eggs laid during the total time of experiment. Grape vine berries were used as
oviposition device. The berries were changed daily and number of eggs was counted. In the
first experiment flies were treated with fungus strains P. fumosoroseus 531, P. farinosus 954,
M. anisopliae 714, M. anisopliae 786 and B. bassiana ATCC 74040 at a concentration of
1x107 conidia/ml. Five replicates with five female and seven male flies each were set-up. At
the beginning of the experiment flies were one to five days old. Fungi used for treatments
were cultured for 28 days at 25°C. The influence of conidia concentration on fly mortality
was assessed. Flies were treated with the fungus strains P. fumosoroseus 531, P. fumosoroseus Apopka 97, M. anisopliae 714 and B. bassiana ATCC 74040 at concentrations of
1x107 conidia/ml, 5x105 conidia/ml and 2.5x104 conidia/ml. Five replicates per strain and
concentration with nine female flies and five male flies each were set-up. At beginning of the
experiment flies were one to five days old. The fungi used for the treatments were cultured for
33 days at 20°C. The influence of the age of flies at the moment of treatment on mortality was
examined. The fungus strains P. fumosoroseus 531, P. fumosoroseus Apopka 97, M.
anisopliae 714 and B. bassiana ATCC 74040 were applied at a concentration of 1x107
conidia/ml on three age-groups of flies: (1) zero to one day old flies, (2) three to four day old
flies, and (3) six to seven day old flies. Five replicates per strain and age-group with eight
female flies and eight male flies each were set-up. The fungi used for the treatments were
cultured for 37 days at 20°C and cold stored for 10 days at 5 to 7°C. In this experiment the
fertility of eggs was assessed by removing the first 50 eggs laid per treatment from the grapeberries. Eggs were placed on wet black filter paper and incubated in a climate chamber. The
number of hatched larvae was counted in 24h intervals.
230
Efficacy of different fungus strains against larvae of R. cerasi
This experiment was conducted to evaluate the efficacy of the fungus strains on mature larvae
of R. cerasi shortly before pupation. The larvae were collected by covering the soil under
infested cherry trees with large cotton sheets. Mature larvae dropping from fruits were
collected from these sheets within five minutes after dropping and dipped for five seconds in a
1x107 conidia/ml conidia suspension. The fungi (P. fumosoroseus 531, P. fumosoroseus
Apopka 97, P. farinosus 954, M. anisopliae 714, M. anisopliae 786 and B. bassiana ATCC
74040) used for the treatments were cultured for 36 days at 20 to 25°C and cold stored for 27
days at 5 to 7°C. Control larvae were dipped in sterile distilled water containing 0.05%
Tween®80. Four replicates with six L3 larvae each were set-up. Immediately after treatment
the larvae were placed in small plastic boxes on moist silica sand for pupation. The rate of
pupation, mycosis of pupae, eclosion rate of adults after breaking the diapause, mortality of
adult flies, and mycosis of adults was evaluated.
All fungus strains were pathogenic to adult flies, however, virulence varied considerably (Fig.
1). Within five days after treatment only 4% of the Paecilomyces farinosus 954 treated flies
died, whereas the other fungus strains induced mortality rates of 28-70%. Median survival
time of flies after treatment ranged from 5 to 7 days for the fungus strains Paecilomyces
fumosoroseus 531, P. fumosoroseus 97, Metarhizium anisopliae 714 und 786, and Beauveria
bassiana 74040. Therefore, a regulation of cherry fruit flies within the pre-oviposition period
of 10 days seems possible. B. bassiana 74040 and P. fumosoroseus 531 significantely reduced
fecundity (Figure 1) and showed an efficacy of over 90%. Within the first ten days after
treatment mycosis could be proven in all dead flies. Rate of mycosis declined during the
experiment or natural mortality increased, respectively. This experiment was replicated with
flies from a different collection site with similar results.
a
B. bassiana 74040
ab
M. anisopliae 786
c
B
ab
c
0
10
20
Mortality (%)
A
B
30
40
5 days
50
60
70
80
90
30 days after treatment
29.2 ± 12.6
b
244.4 ± 128.4 b
A
P. fumosoroseus 531
Control
A
b
M. anisopliae 714
P. farinosus 954
A
117.6 ± 65.7
b
630.2 ± 75.5
a
52.4 ± 33.3
b
760.8 ± 42.3
a
100
Number of eggs
Figure 1. % Mortality of flies (± se) 5 and 30 days after treatment and number of eggs per
replicate (± se). (Statistics: Mortality: Data transformed [arcsine√(x)], One-way ANOVA, Tukey
Test α=0.05, Day 5: F5,24=17.28, p<0.001, Day 30: F5,24= 21.38, p<0.001; Eggs: One-way
ANOVA, Tukey Test α=0.05, F5,24=19.19, p<0.001).
231
Figure 2 shows the results of the experiment with differently concentrated conidia
suspensions: mortality increased with increasing concentration. Mortality 5 days after
treatment, 30 days after treatment as well as number of eggs were significantly influenced by
treatments at the highest concentration (1x107 conidia/ml) compared to the untreated control
and the lowest concentration of each fungus strain. At a concentration of (5x105 conidia/ml)
mortality rates 30 days after treatment significantly differed from mortality in the control
group. However, only B. bassiana 74040 significantly reduced the number of eggs at this
concentration. At the lowest concentration (2.5x104 conidia/ml) only B. bassiana 74040
showed significant differences in mortality rate 30 days after treatment compared to the
control.
1x107
a
B. bassiana
5x105
74040
bcd
2.5x104
BCD
bcd
2.5x104
ABC
DE
cd
a
abc
d
2.5x104
Control
AB
a
AB
d
1331.8 ± 131.7 a
FG
1673.8 ± 137.1 a
G
0
10
20
Mortality (%)
13.2 ± 7.7
1046.4 ± 205.8 ab
EF
bcd
d
d
1491.2 ± 338.6 a
FG
d
47.6 ± 29.0
770.4 ± 203.0 ab
CDE
1x107
P. fumoso5
roseus 531 5x10
d
960.8 ± 190.1 ab
1x107
2.5x104
6.4 ± 0.9
759.6 ± 109.1 ab
FG
P. fumoso5
roseus 97 5x10
cd
791.2 ± 266.6 ab
ab
d
99.2 ± 91.5
461.0 ± 111.3 bc
EF
1x107
M. anisopliae
5x105
714
A
30
40
5 days
50
60
70
80
90
30 days after treatment
100
Number of eggs
Figure 2. % Mortality of flies (± se) 5 and 30 days after treatment with conidia suspensions at
three concentration levels and number of eggs per replicate (± se). (Statistics: Mortality: Data
transformed [arcsine√(x)], One-way ANOVA, Tukey Test α=0.05, Day 5: F12,52= 14.49,
p<0.001, Day 30: F12,52=32.97, p<0.001; Eggs: Data transformed [√(x+1)], One-way ANOVA,
Tukey Test α=0.05, F12,52=21.06, p<0.001).
The influence of fly age was evaluated in an experiment with three age groups of flies.
For all fungus strains the same the general trend was found: older flies (3-7 days old) had a
shorter medium survival times and showed higher mortality rates than younger flies (0-1 day
old). Fungi treatment significantly reduced the number of eggs and older flies laid
significantly fewer eggs than younger flies (Data transformed [√(x+1)]; Two-way-ANOVA:
232
fungus isolate:F4,60=53.67, p<0.001; age-groups: F2,60=13.42, p<0.001; isolate*age:
F8,60=2.15, p=0.04). Compared to the control P. fumosoroseus 531 and 97, as well as B.
bassiana 74040 reduced fertility of eggs. These sublethal effects were greater among younger
flies than among older flies. In the experiments mating occurred frequently in all treatments.
If the reduced egg fertility depends on female or male fitness, was not evaluated.
Pathogenicity of fungi against L3-larvae was low. All larvae pupated normally but, all
fungus strains were able to cause mycosis in pupae. However, infestation rate never exceeded
21%. The differences between the fungus strains and the control were not significant (Data
transformed [arcsine(√x)]; one-way-ANOVA: F8,27=1.73, p=0.2337). Hatching rate of adult
flies was not reduced by fungus treatment of L3-larvae (Data transformed [arcsine(√x)]; oneway-ANOVA: F8,27=1.13, p=0.3739). However, significant differences were found
concerning the rate of mortality of adult flies, whereby control flies showed the highest
mortality (Kruskal-Wallis-Chi-Squared-test: χ2=27.42, df=8, p=0.001). No mycosis could be
proven in dead adult flies.
In conclusion, it could be shown that all tested fungus strains were pathogenic to larvae
and adults of R. cerasi. However, virulence varied considerably among the strains. Effects on
L3-larvae were negligible; none of the fungus strains was able to induce mortality in more
than 21% of larvae. Since larvae were dipped for five seconds in a highly concentrated
conidia suspension, it is assumed that infection rates under natural conditions would be close
to zero. In contrary, adults were highly susceptible to fungus infection. Beauveria bassiana
and Paecilomyces fumosoroseus caused 90 to 100% mortality and had a strong influence on
fecundity. Metarhizium anisopliae also showed reliable effects. The pathogenicity of Paecilomyces farinosus was low. Higher conidia concentrations lead to higher mortality, whereas B.
bassiana was most efficient at low concentrations. No significant differences in mortality
were found between male and female flies. No alteration in behaviour of fungus treated flies
was observed during the experiment: flies mated and oviposited normally until shortly before
death. The effects on fecundity seem mainly to be attributed to reduced life-span of females.
Young flies showed lower mortality rates than older flies but, sub-lethal effects on eclosion
rate off eggs were greater in young than in older flies. Since the flies for the laboratory
experiments were field collected in different locations in North-Western Switzerland the
results are viable for the whole region. Median survival times ranged from five to seven days
after treatment. Thus, the biological control of R. cerasi within the pre-oviposition period of
about 10 days seems possible. Further research is needed to transfer these laboratory results
into a reliable field application strategy.
Acknowledgements
We thank Intrachem Bio Italia S.p.A. and Andermatt Biocontrol AG (Switzerland) for providing
the products Naturalis-L and PreFeRal®WG. Many thanks to Prof. Dr. D. Treutter (Technische
Universität München) for supervising this doctoral thesis and to the cherry growers for providing
infested cherries. Statistical analysis was done under the supervision of the statistical advisory
service of Swiss Federal Institute of Technology Zurich (ETH Zürich). This project was funded
by the Landwirtschaftliches Zentrum Ebenrain (LZE, Sissach, Switzerland).
References
Anagnou-Veroniki, M., Kontodimas, D.C., Adamopoulos, A.D., Tsimboukis, N.D. &
Voulgaropoulou, A. 2005: Effects of two fungal based biopesticides on Bactrocera (Dacus)
oleae (Gmelin) (Diptera: Tephritidae). IOBC/wprs Bulletin 28(9): 49-51.
233
Carswell, I., Spooner-Hart, R. & Milner, R.J. 1998: Laboratory susceptibility of Musca
domestica L. (Diptera: Muscidae) and Bactrocera tryoni (Frogatt) (Diptera: Tephritidae) to
an isolate of Metarhizium anisopliae (Metsch.) Sorokin. Australian Journal of Entomology
37: 281-284.
Castillo, M.A., Moya, P., Hernándeza, E. & Primo-Yúferab, E. 2000: Susceptibility of Ceratitis
capitata Wiedemann (Diptera: Tephritidae) to entomopathogenic fungi and their extracts.
Biological Control 19: 274-282.
De La Rosa, W., Lopez, F.L. & Liedo, P. 2002: Beauveria bassiana as a pathogen of the
mexican fruit fly (Diptera: Tephritidae) under laboratory conditions. Journal of Economic
Entomology 95: 36-43.
Dimbi, S., Maniania, N.K., Lux, S.A. & Mueke, J.M. 2004: Effect of constant temperatures on
germination, radial growth and virulence of Metarhizium anisopliae to three species of
African tephritid fruit flies. BioControl 49: 83-94.
Ekesi, S., Maniania, N.K., Mohamed, S.A. & Lux, S.A. 2005: Effect of soil application of
different formulations of Metarhizium anisopliae on African tephritid fruit flies and their
associated endoparasitoids. Biological Control 35: 83-91.
Konstantopoulou, M.A. & Mazomenos, B.E. 2005: Evaluation of Beauveria bassiana and B.
brongniartii strains and four wild-type fungal species against adults of Bactrocera oleae and
Ceratitis capitata. BioControl 50: 293-305.
Lezama-Gutierrez, R., Trujillo-De la Luz, A., Molina-Ocha, J., Rebolledo-Dominguez, O.,
Pescador, A.R., Lopez-Edwards, M. & Aluja, M. 2000: Virulence of Metarhizium anisopliae on Anastrepha ludens: Laboratory and field trials. Journal of Economic Entomology
93: 1080-1084.
Mochi, D.A., Monteiro, A.C., De Bortoli, S.A., Doria, H.O.S. & Barbosa, J.C. 2006:
Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides. Neotropical Entomology 35: 382-389.
Strasser, H., Forer, A. & Schiner, F. 1996: Development of media for the selective isolation and
maintenance of virulence of Beauveria brongniartii. Proceedings 3rd international Workshop Microbial control of soil dwelling pests: 125-130.
Wiesmann, R. 1933: Untersuchungen über die Lebensgeschichte und Bekämpfung der Kirschenfliege Rhagoletis cerasi Linné - I. Mitteilung. Landwirtschaftliches Jahrbuch der Schweiz:
711-760.
Yee, W.L. & Lacey, L.A. 2005: Mortality of different life stages of Rhagoletis indifferens
(Diptera: Tephritidae) exposed to the entomopathogenic fungus Metarhizium anisopliae.
Journal of Entomological Science 40: 167-177.
p. 234
Influence of plant species and pests on the development of pathogenic
fungus Paecilomyces lilacinus in soil conditions
Danuta Sosnowska
Institute of Plant Protection, Miczurina 20. 60-318 Poznan, Poland
Abstract: Nematophagous fungus Paecilomyces lilacinus is one of the most effective fungal species
used in control of plant-parasitic nematodes. P. lilacinus has also a good potential in control of insect
pests especially in soil conditions for instance controls well soil stages of Western flower thrips.
Development of this fungus in soil conditions depends on a plant species. A pot experiment was
conducted to study the development of P. lilacinus in tomato and cabbage rhizosphere. The fungus
was applied in concentration of 107 conidia/g of soil. The results revealed that the greatest production
of colony forming units (CFU) was in tomato rhizosphere two months after the fungal application,
then three months after the treatment the number of CFU decreased rapidly and five months after the
application the CFU was the lowest. In cabbage rhizosphere the CFU decreased every month after the
application. Upon appearance of nematode Meloidogyne arenaria population in the soil the CFU of P.
lilacinus increased until 1 month after its application and then decreased. The greatest number of CFU
was observed on tomato roots. The CFU was 16x105 of conidia/g of root and it was 8 times less than
on the cabbage roots. Potential of the fungus in control of different stages of nematode population and
Western flower thrips has been discussed.
Key words: biological control, Paecilomyces lilacinus.
References
Fiedler Z., Sosnowska D. 2007: Nematophagous fungus Paecilomyces lilacinus (Thom.)
Samson is also a biological agent for control of greenhouse insects and mite pests.
BioControl (in press).
Sosnowska D. 2004: Ilosciowy rozwoj Paecilomyces lilacinus na korzeniach i w glebie w
zaleznosci od rosliny i gatunku nicienia. Progress in Plant Protection 44: 1108-1110.
234
pp. 235-238
Exposure of greenhouse workers to fungal biocontrol agents in
vegetable production
Vinni M. Hansen1, Anne Mette Madsen1, Nicolai V. Meyling2, Jørgen Eilenberg2
1
National Research Centre for the Working Environment, Lersø Parkalle 105, DK-2100
Copenhagen, Denmark; 2Department of Ecology, Faculty of Life Sciences, University of
Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C, Denmark.
Abstract: In workplaces such as greenhouses, fungal spores are introduced into the environment to
control plant pests and plant pathogens. Exposure of the airways to bioaerosols can cause irritation and
respiratory symptoms including asthma. So far the exposure of growers to inhalable fungal spores is
not well investigated and we do not have the data needed to assess the effect of adding additional
spores, for example from microbial biocontrol products, to the working environment. In this newly
initiated project, we aim to monitor the levels of naturally occurring bioaerosols as well as introduced
organisms in greenhouses and open fields. We use GSP samplers for air sampling and quantify
microorganisms in the collected material with a modified CAMNEA method. We will also quantify
fungal biochemicals in the samples. Here, we present and discuss the preliminary results from the first
working environments visited.
Key words: occupational health; fungi; biocontrol agents
Introduction
The occupational exposure of greenhouse workers to microorganisms is not well documented
even though symptoms potentially induced by microbes have been reported among
greenhouse workers (Yoshida et al.1993; Monso et al. 2002). Data collected from other, yet
similar, professions (e.g., agriculture, biofuel) indicate that handling of biological material can
be a health risk in regard to elevated concentrations of airborne fungi and bacteria which can
cause respiratory symptoms and allergy (Madsen, 2006; Jillian et al. 1998; Krysinska-Traczyk
et al. 2004). Fungal spores are within the size range of particles, which can become airborne
and be inhaled and deposited within the alveoli space of the human lung. In addition to the
fungal spores, which are a natural part of the greenhouse microflora, spores are introduced to
the greenhouse environment through treatment against pests with biocontrol agents (BCA).
These BCA products contain spores of fungi such as Beauveria bassiana, Paecilomyces
fumosoroseus, Trichoderma harzianum etc. A review of the literature concerning airborne
fungi indicates that some of the genera or species used in BCA products have been found in
the air of untreated environments (e.g. T. viride) while others have not been detected in
previous air samplings studies (e.g. P. fumosoroseus) (Madsen et al. 2007).
As part of a newly initiated Ph.D. project airborne fungi will be monitored in greenhouses and open fields (i.e., both conventional and organic production) during different work
tasks. The concentration of fungi will be assessed as concentrations of total fungi and concentrations of fungi used in BCA products. This will enable us to compare the concentration of
fungi present in the environments in the presence and absence of BCA. Data collected during
this study will increase our knowledge of the prevalence of the above-mentioned fungi in
greenhouses and will be used for risk assessment of the working environment of growers. The
work described in this proceeding is a part of a project, which also includes monitoring of
235
236
microorganisms on vegetables produced in the investigated environments and airborne
bacteria and actinomycetes.
During 2007 and 2008 air samples will be collected in greenhouses producing tomato and
cucumber, and in outdoor fields producing broccoli and cauliflower. The investigation will
include environments with conventional pest control and environments where pests are
managed with beneficial insects and mites and/or products containing microorganisms
(BCA). On each sampling day, air samples will be collected with personal air samplers,
carried by the workers, and stationary air samplers placed in the working area to collect
background data. The air samplers are manufactured to collect aerosols within the inhalable
size fraction, which include fungal spores and bacteria.
Personal sampling of inhalable aerosols
Personal dust monitoring will be conducted with GSP inhalable samplers (CIS by BGI, INC
Waltham, MA). The inlet is placed in the breathing zone of the worker (max 20 cm from nose
and mouth) and the flow is adjusted to 3 l/min. Each worker carries two samplers. One
sampler is mounted with a teflon filter (pore size 1 µm) and another one mounted with a
polycarbonate filter (pore size 1 µm) to collected material for biochemical analysis and for
quantitative counts, respectively. The sampling continues for at least 6 hours of the working
day and we will observe the tasks being carried out by the persons monitored.
Sampling of inhalable aerosols and monitoring temperature and humidity in the working
areas
Aerosols in the working area are monitored by stationary samplers (IOM samplers) places in
between plants and on walking paths. Air temperature and humidity are monitored (Gemini,
Tinytag TGP-1500, plus data logger, UK) as well as concentration and aerodynamic particle
size of aerosols over time (APS 3320, TSI INC, USA) at a central station in the working
environment. In addition, an outdoor reference is placed upwind from the working area on
each sampling day.
Quantification of microorganisms
The day after sampling quantification of microorganisms is performed in accordance with a
modified CAMNEA method (Madsen, 2006). In short, dust is extracted into 0,05% Tween-80
and 0,85% NaCl in aqueous solution from the polycarbonate filters and 10 fold dilutions are
plated onto selective media for counts of cultivable organisms. A portion of the extract is
stained with acridine orange in acetate buffer. After mounting onto a dark polycarbonate
filter, fungi and bacteria will be counted at a magnification of 1250 times using epifluorescence microscopy. Remaining material is mixed with glycerol and kept at -80°C.
Quantification of fungal biochemicals
The dust collected on the teflon filters is weighed and extracted into pyrogen free water with
0,05% Tween-20. Cryotubes containing an amount of 1 ml is kept at -80°C for later analyses
of biochemicals produced by fungi, such as NAGase, beta-glucan etc.
Preliminary Results and discussion
So far we have visited four greenhouses and we have obtained the first impressions of the
working environments. Entering the greenhouses the air seems pleasant and clean. However,
237
the measurement of airborne particles in the breathing zone of the workers picking vegetables
and managing the plants reveals high concentrations of dust and microorganisms. The data
indicate that workers in cucumber production are exposed to higher levels then the workers in
tomato production. This might be due to variations in leaf morphology in the two types of
plants. We hypothesize that the difference in morphology changes the ability of the leaf to
detain particles that settles on the leaf surface. Dust settling on the leaves will potentially
become airborne when workers during their work tasks shake the leaves. Thus will the ability
of the leaf to detain and release particles influences the working environment. By pressing
cucumber leaves against DG-18 plates it was possible to acknowledge a very dense presence
of fungal spores on the leaves (fig. 1)
.
Figure 1. Impression on DG18 agar medium of a cucumber leaf.
One of the visited greenhouses had treated plants with a Trichoderma based product 6
month earlier, and in another greenhouse a product based on the bacteria Bacillus thuringiensis was sprayed during our monitoring. Our data from the greenhouse where pest infested
plants were treated with B. thuringiensis show that it was possible to detect the organism in
the air surrounding the person spraying the plants as well as in the surrounding air of several
colleagues working in the house. We therefore predict that our method is well suited for
monitoring airborne organisms introduced to the environment by BCA products.
Acknowledgements
We gratefully appreciate the work performed by our skilful technicians Tina Trankjaer Olsen
and Signe Hjort Nielsen. The project is funded by The Danish Environmental Protection
Agency and The National Research Centre for the Working Environment.
References
Jillian, R.M., Swan, M., Crook, B. 1998: Airborne microorganisms associated with grain
handling. Ann. Agric. Environ. Med. 5: 7-15.
238
Madsen, A.M., Hansen, V.M., Meyling, N.V., Eilenberg, J. 2007: Human exposure to airborne fungi from genera used as biocontrol agents in plant production. Ann. Agric.
Environ. Med.14: 5-24.
Madsen, A.M. 2006: Exposure to airborne microbial components in autumn and spring during
work at Danish biofuel plants. Ann. Occup. Hyg. 50(8): 821-31.
Monso, E., Magarolas, R., Badorrey, I., Radon, K., Novak, D., Morera, J. 2002: Occupational
asthma in greenhouse flower and ornamental plant growers. Am. J. Respir. Crit. Care.
Med. 165: 954-960.
Krysinska-Traczyk, E., Skorska, C., Prazmo, Z., Sitkowska, J., Cholewa, G., Dutkiewics, J.
2004: Exposure to airborne microorganisms, dust, and endotoxin during flax scutching on
farms. Ann. Agric. Environ. Med. 11: 309-317.
Yoshida, K., Ueda, A., Yamasaki, H., Sato, K., Uchida, K., Anda, M. 1993: Hypersensitivity
pneumonitis resulting from Aspergillus fumigatus in a green house. Arch Environ Health.
48(4): 260-262.
pp. 239-244
The impact of soil treatment on soil mycobiota
Martin Kirchmair1, Sigrid Neuhauser1, Lars Huber2, Hermann Strasser1
1
Institute of Microbiology, Leopold-Franzens University Innsbruck, 6020 Innsbruck, Austria;
2
Institute of Zoology, Johannes Gutenberg-University of Mainz, 55099 Mainz, Germany
Abstract: The changes in the composition of cultivable soil fungi after soil treatment with Agro
Biosol® – an organic fertiliser based on fungal biomass – and the entomopathogenic fungus Metarhizium anisopliae var. anisopliae, used to control soil dwelling insect pests, were assessed by palting
soil suspensions onto potato dextrose agar dishes. After one week incubation fungal colonies were
counted and determined to genus level. For statistical analyses the twenty most common genera were
pooled to six groups according their ecological characteristics: (i) saprobes of poor soils (Acremonium
spp., Aspergillus spp., Mortierella spp., Penicillium spp), (ii) litter decomposers (Alternaria spp.,
Cladosporium spp, Stachybotrys spp., Phoma spp., Ulocladium spp.), (iii) Mucorales (Zygomycetes)
as indicators of high organic fractions (Absidia spp., Cunninghamella spp., Mucor spp., Rhizopus
spp.), (iv) mycoparasites (Gliocladium spp., Trichoderma spp.), (v) entomopathogens (Beauveria spp.,
Metarhizium spp., Paecilomyces spp.), and (vi) phytopathogens (Cylindrocarpon spp., Fusarium spp.).
A positive influence of Agro Biosol® on mycoparasitic fungi could be observed by a canonical
correspondence analysis. No influence on saprobes and plant pathogens could be found. The influence
of M. anisopliae on soil fungi was mainly restricted to entomopathogens: Their density in soil
increased (as desired) whereas the abundances of the other ecological groups were hardly affected.
The method is sensitive for the assessment of fungal communities in soil and will be used in future
studies to estimate the influence of different soil management strategies on soil fungi.
Key words: Metarhizium, soil fungi, interaction, organic fertiliser
Introduction
Soil is a very complex and dynamical biological system and despite the availability of
sophisticated molecular tools it is still impossible to determine the composition of microbial
communities in soil.
The role of microbial communities is fundamental to the soil. Therefore, the evaluation
of changes in the soil microbiota by applying different soil management strategies in agriculture has attracted the attention of risk assessors and academia. Although, the importance of
biodiversity in the functionality of ecosystems is undisputed, there is a growing body of
evidence, that most organisms are functionally redundant (Nannipieri et al. 2003). Schwartz et
al. (2000) reported, that there is little to no support that ecosystem function is strongly dependent on the full complement of biodiversity. To adopt these statements to the assessment of
environmental risk of different agricultural practises, the minimum requirement is to keep the
functional (not the taxonomic) groups of soil microorganisms in balance. The aim of this
study was to assess the effect of the organic fertilizer Agro Biosol® as well as of the Metarhizium anisopliae based product GRANMET on (cultivable) soil fungi and to evaluate
possible influences of different agricultural management strategies on soils and their
mycobiota.
239
240
Trial sites
The field trials were carried out on three experimental sites:
(i) Phylloxera infested vineyard in the German Rheingau treated with 50 kg ha-1GRANMET
(Metarhizium anisopliae-colonised barley).
(ii) Two strawberry cultures in Northern Italy (Laimburg, Martell) treated with 50 kg ha-1
GRANMET and/or Agro Biosol®, an organic fertiliser based on fungal biomass.
Soil sampling
Soil samples (depth 0-10 cm) were taken with a core borer. Samples from each plot were
mixed, air-dried, and sieved through a 2 mm sieve. Ten gram sub-samples (three replicates)
were added to 40 mL 0.1 % (w/v) Tween80®, shaken at 150 rpm for 30 min, and then treated
in an ultrasonic bath for 30 s. Potato-Dextrose-Agar plates supplemented with Streptomycin
(100 mg/L), Tetracycline (50 mg L-1) and Dichloran (2 mg L-1 as 0.2 % w/v ethanolic
solution) were inoculated with 50 µL of these soil suspensions or dilutions thereof (four
replicates per sub sample) and were then incubated for one week at 25 °C and 60 % relative
humidity (RH). After one week the colonies were counted and assigned to the genera and
taxonomical groups identified by morphological characters (Tab. 1). All taxa were pooled into
six ecological (functional) groups (Domsch & Gams, 1980):
1) Entomopathogenes: Fungi of the genera Metarhizium, Beauveria and Paecilomyces
were classified as entomopathogenic. Dominating species were M. anisopliae (this fungus is
the active substance of GRANMET), Beauveria bassiana, as well as the pink-spored Paecilomyces species P. farinosus and P. fumosoroseus.
2) Mucorales: Most members of the Mucorales are rapidly growing fungi which mainly
use readily available nutrients. Ammonium salts, amino acids, proteins, and less important,
nitrates, nitrites or urea are utilized as nitrogen sources. Various sugars are used as the main
carbon source. Some species are also able to use fats as a carbon source. Many species are
considered as coprophilous or are typical soil fungi. In this study, Mucorales were discussed
as indicatores for a high content of organic matter (e.g. due to manure fertilization).
Dominating species were Mucor hiemalis and Cunninghamella elegans. Both species are
abundant soil fungi of many different soils with a wide pH range. These fungi can mostly be
isolated from the upper soil layers, but also down to a depth of one meter. Due to their rapid
growth, fresh substrates can be colonized very rapidly.
3) Mycoparasites: Trichoderma and Gliocladium (Clonostachys) were classified as
mycoparasites. The T. harzianum species complex and T. viride were recognized as the
dominating taxa. The genus Gliocladium was mainly represented by G. roseum and G.
catenulatum.
4) Phytpathogenic fungi: Fungi of the genera Fusarium and Cylindrocarpon were
classified as phytopathogenes. Pink colonies and slimy, multicelled conidia were seen as
characteristic for Fusarium. Colonies with a yellow-brown reverse and slimy, straight and
septate conidia were classified as Cylindrocarpon. Dominating species cannot be specified, as
the species of this genus are very difficult to identify based on morphologic characters.
5) Saprobes of poor soils: This group summarizes typical soil fungi that do not place
special demands on the substrate. Aspergillus ochraceus, Penicillium chrysogenum,
Mortierella alpina were the dominating species.
6) Litter decomposer: This group merges fungi which, despite being typical soil fungi,
prefer rotting organic substrates: The dominating species of this group were Alternaria
alternata, Cladosporium herbarum and C. cladosporoides, Stachybotrys chartarum, Ulocladium chartarum.
241
Table 1. Twenty different fungal genera were pooled to six ecological (functional) groups.
Group
Entomopathogenic fungi
Mucorales (Zygomycetes)
Mycoparasites
Phytopathogenic fungi
Saprophages
Scattered colonies
Selected fungi – indicator organisms
Beauveria spp., Metarhizium spp., Paecilomyces spp.
Absidia spp., Cunninghamella spp., Mucor spp., Rhizopus spp.
(indicator organisms for large fractions of organic matter in the soil;
e.g. manure fertilization, N indicator MOs)
Gliocladium spp., Trichoderma spp.
Cylindrocarpon spp., Fusarium spp.
Acremonium spp., Aspergillus spp., Mortierella spp., Penicillium spp.
Alternaria spp., Cladosporium spp, Stachybotrys spp., Phoma spp.,
Ulocladium spp.
Data processing and statistical analyses
For the joint comparison of all the results a canonical correspondence analysis was conducted,
using the CANOCO program (ter Braak, 1991). The canonical correspondence analysis
(CCA) was used to simultaneously elucidate the main patterns of fungal community and
environmental factors variations, and the relationships of each of the species with respect to
the environmental variables (ter Braak, 1986). CCA was performed using CANOCO 4.53 (ter
Braak and Smilauer, 2004). The dominance data were used and no other transformation was
applied.
Strawberry culture Laimburg
No significant differences between untreated and Agro Biosol® treated plots in total fungal
CFU counts could be observered (Fig. 1). Applying CCA revealed that the abundances of
members of the different functional groups were not significantly related to the treatment (Monte
Carlo permutation test, p=0.092). Mucorales and the group of mycoparasitic fungi (e.g.
Trichoderma and Gliocladium) tended towards higher abundances in the plots treated with
Agro Biosol® (Fig. 2). The fertilizing method had no effect on the groups of saprobes and
phytopathogens. Entomopathogenic fungi, which were not explicitly accumulated on the site
Laimburg, were found in the areas treated with standard fertilizer sporadically only. Litter
decomposers tended towards higher abundances in standard treated plots.
Strawberry culture Martell
Significant differences in total fungal CFU counts between untreated and Agro Biosol® treated
plots (p<0.001) as well as between untreated and GRANMET treated plots could be
observered (Fig. 3). In both cases the mean of total CFU count was lower than in the standard
plot. Applying CCA revealed that the abundances of members of the different functional groups
were significantly related to the treatment (Monte Carlo permutation test, p=0.001). Mucorales
and of the group of mycoparasitic fungi (e.g. Trichoderma and Gliocladium) tended towards
higher abundances in the plots treated with Agro Biosol® (Fig. 4). The fertilizing method had
no effect on the groups of saprobes and phytopathogens. Litter decomposers tended towards
higher abundances in standard treated plots. High abundances of entomopathogenic fungi
were found where M. anisopliae was applied.
242
Figure 1-2. Strawberry culture Laimburg: 1. Total fungal CFU count of conventionally fertigated
plots (“Standard”; n=67) and Agro Biosol® treated plots (“Fertilised”; n=54). No significant
differences could be found (p=0.287). 2. Canonical Correspondence Analysis of functional
fungal groups in conventionally fertigated plots (“Standard”) and Agro Biosol® treated plots
(“Fertiliser”). Abundances of members of the different functional groups were not significantly
related to the treatment (Monte Carlo permutation test, p=0.092).
Figure 3-4. Strawberry culture Martell: 3. Total fungal CFU count of conventionally fertigated
plots (“Standard”; n=84), Agro Biosol® treated plots (“Fertiliser”; n=72) and GRANMET treated
plots (“M. anisopliae” n=96. Significant differences could be found between conventionally
fertigated and fertilised plots (p<0.001) as well as between conventionally fertigated and M.
anisopliae treated plots (p<0.001). 4. Canonical Correspondence Analysis of functional fungal
groups in conventionally fertigated plots (“Standard”), Agro Biosol® treated plots (“Fertiliser”)
and GRANMET (“Metarhizium”) treated plots. Abundances of members of the different
ecological groups were significantly related to the treatment (Monte Carlo permutation test,
p=0.01).
243
Figure 5-6. Vineyard Geisenheim: 6. Total fungal CFU count of untreated plots (“Standard”;
n=96), sterilised barley treated plots (“Barley”; n=95) and GRANMET treated plots (“M.
anisopliae”; n=96). No significant differences could be found between untreated and barley
treated plots (p=0.048) but significant differences were determined between untreated and M.
anisopliae treated plots (p<0.001). 6. Canonical Correspondence Analysis of functional fungal
groups in untreated plots (“Control”), strerilised barley treated plots (“Barley”) and GRANMET
(“Metarhizium”) treated plots. Abundances of members of the different ecological groups were
significantly related to the treatment (Monte Carlo permutation test, p=0.014).
Vineyard Geisenheim
No significant differences in total CFU counts could be found between conventionally fertigated
and barley treated plots (p=0.048) but significant differences were determined between
conventionally fertigated and M. anisopliae treated plots (p<0.001; Fig. 5). When applying CCA,
abundances of members of the different ecological groups were significantly related to the
treatment (Monte Carlo permutation test, p=0.014). So, the fungal density of the entomopathogen Metarhizium was increased in those plots were the product GRANMET was applied.
It could be demonstrated that the presented method is sensitive enough to detect changes of
the soil mycobiota caused by various soil treatments. Despite of the inherent bias that many soil
fungi cannot be detected by a culture-based approach, the plating of soil suspension and counting
the different colonies let us get a picture of the changes in the different functional groups of soil
fungi. The nowadays widely used molecular approaches like denaturing gradient gel
electrophoresis (DGGE) are more sensitive in detection of changes in microbial communities
(for a review see Ikeda et al. 2006). Nevertheless, there is one disadvantage of DGGE because
the assignment of the different bands to specific taxonomic or even more difficult to functional
groups is only possible by spending very much effort and time. Soil seems to be characterised by
a redundancy of functions. The functional characteristics of component species are at least as
important as the number of species for the maintaining essential processes (Nannipieri et al.
2003). Therefore, an expedient assessment of environmental risks caused by different
agricultural practises should not be focused on possible changes of the abundances of particular
species; attention should be paid to keep the different functional groups of organisms in balance.
244
Acknowledgements
The authors wish to thank R. Pöder, M. Porten, E. Rühl and G. Eisenbeis for helpful
discussions. This work was supported by the companies Agrifutur s.r.l (Alfianello, Italy) and
Sandoz (Kundl, Austria), the Versuchszentrum Laimburg (Pfatten, Italy), the Forschungsring
des Deutschen Weinbaus (FDW), the Bundesanstalt für Landwirtschaft und Ernährung
(Project No. BLE 03OE001), the Feldbausch Foundation, Department of Biology, University
of Mainz and the Heinrich-Birk-Gesellschaft.
References
Domsch, K.H. & Gams, W. 1980: Compendium of Soil Fungi. Reprint 1993. IHW-Verlag,
Eching, Germany. 860 pp.
Ikeda1, S., Ytow, N., Ezura, H., Minamisawa, K. & Fujimura, T. 2006: Soil microbial community analysis in the environmental risk assessment of transgenic plants. Plant Biotechnology 23: 137–151.
Nannipieri, P., Ascher, J., Ceccherini, M.T., Landi, L., Pietramellara, G. & Renella, G. 2003:
Microbial diversity and soil functions. European Journal of Soil Science 54: 655-670.
Schwartz, M.W., Brigham, C.A., Hoeksema, J.D., Lyons, K.G., Mills, M.H. & van Mantgem,
P.J. 2000: Linking biodiversity to ecosystem function: implications for conservation
ecology. Oecologia 122: 297-305.
ter Braak, C.J.F. 1986: Canonical correspondence analysis: a new eigenvector technique for
multivariate direct gradient analysis. Ecology 67:1167-1179.
ter Braak, C.J.F. 1991: CANOCO-a FORTRAN program for CANOnical Community Ordination by (partial) (detrended) (canonical) correspondence analysis, principal components
analysis and redundancy analysis. 3.12. Microcomputer Power, New York.
ter Braak, C.J.F. & Smilauer, P. 2004: CANOCO reference manual and canodraw for Windows user's guide: software for canonical community ordination (version 4.5). Biometris,
Wageningen, Netherlands; Ceské Budejovice, Czech Republic.
pp. 245-250
Antagonists of the spruce bark beetle Ips typographus L. (Coleoptera:
Scolytidae) of German and Georgian populations
Medea Burjanadze1, John C. Moser2, Gisbert Zimmermann3, Regina G. Kleespies3
1
Vasil Gulisashvili Institute of Forest, 9 Mindeli str., Tbilisi 0186, Georgia; 2USDA Forest
Service, Southern Research Station, 2500 Shreveport Hwy., Pineville, LA, 71360, USA;
3
Julius Kühn-Institute (JKI) - Federal Research Centre for Cultivated Plants, Institute for
Biological Control, Heinrichstrasse 243, D-64287 Darmstadt, Germany
Abstract. The bark beetle, Ips typographus (Coleoptera: Scolytidae), is one of the most important pest
insects in coniferous forests of Georgia as well as of Germany. In the last years, numerous
investigations were focused on the pathogen complex of bark beetles and its possibility to impact on
insect population dynamics. For our investigations, living adult I. typographus were collected from
pheromone traps of two locations of Georgia (Borjomi gorge- Libani, district 16; Tsagveri, district 9;
and Racha, Shovi) in summer of 2003-2004, and of three locations in Germany (forest districts of
Hessen: Reinhardshagen with four areas, Darmstadt with four areas; forest district of Bavaria:
National Park Bavarian Forest, Frauenau, with five areas) in summer 2005. The beetles were removed
daily, determined, dissected and checked for infections with pathogens with the light microscope. The
following antagonistic groups were investigated: Protozoa, fungi, mites and nematodes. In Georgian
bark beetle populations, the entomopathogenic fungus Beauveria bassiana, the phoretic mites
Dendrolaelaps quadrisetus, Macrocheles sp. (no. 48138), Lasioseius penicilliger, and Trichouropoda
polytricha, Histiogaster ornatus, Dendrolaelaps apophyseus, Ereynetes propescutulis, and the nematodes Contortylenchus sp., Parasitorhabditis sp., and Bursaphelenchus sp. were found. In German
populations of I. typographus, the microsporidium Chytridiopsis typographi, the fungi Beauveria
brongniartii, B. bassiana, and Fusarium sp., and ten species of phoretic mites (Dendrolaelaps
quadrisetus, Proctolaelaps fiseri, Macrocheles sp. (no. 48249), Lasioseius penicilliger, Pleuronectocelaeno barbara, Histiostoma piceae, Uroobovella ipidis, Trichouropoda polytricha, Trichouropoda
sp. (no. 23936), Tarsonemus minimax) were identified. Furthermore, several undetermined nematodes
were observed.
Key words: Ips typographus, microsporidia, entomopathogenic fungi, entomoparasitic nematodes,
phoretic mites
Introduction
The spruce bark beetle, Ips typographus (L.) (Coleoptera: Scolytidae), is one of the most
important pests damaging the Oriental spruce, Picea orientalis in Georgia and the Norway
spruce, Picea abies (L.) in Germany. During the last years, heavy outbreaks by this bark
beetle dramatically increased tree mortality in both countries. Generally, forests have
multifunctional values, i.e. both tree species, Picea orientalis (L.) Peterm. and Picea abies,
have not only an economic value (wood production), but also an ecological (protection of
landscape against erosion) and social value (recreation area). Therefore, control of bark
beetles is necessary, but still ineffective.
The occurrence and epizootiology of pathogens in bark beetles is one of the least studied
aspects in their population dynamics. In recent studies, however, several pathogens were
described (Balazy, 1996; Haidler et al., 2003; Händel et al., 2003, Händel & Wegensteiner,
2005; Moser et al., 2005; Burjanadze, 2006; Wegensteiner et al., 2007; Kereselidze &
Wegensteiner, 2007; Tonka et al., 2007). The entomopathogenic fungus Beauveria bassiana
245
246
was previously tested in preliminary laboratory and field experiments (e.g. Kreutz et al., 2004
a, b).
The aim of the present investigations is the identification of antagonists occurring in
different I. typographus populations of Georgian and German forests. This antagonistic
complex, consisting of microsporidia, fungi, nematodes and phoretic mites, may have a great
potential for biological control and for natural regulation of I. typographus populations.
Living adults of I. typographus were collected from trap trees and pheromone traps of two
locations in Georgia (Borjomi gorge, 1000-1200 m a.s.l. Libani, district 16 and Tsagveri,
district 9; Racha, Shovi, 1200-1400 m a.s.l.) in summer of 2003-2004, and of three locations
in Germany (forest districts of Hessen: Reinhardshagen with four areas, Darmstadt with four
areas; forest district of Bavaria: National Park Bavarian Forest, Frauenau, with five areas)
during summer 2005.
Beetles were examined first for macroorganisms (nematodes, mites) using a stereomicroscope (magnification 40x). Subsequently, beetles were dissected to examine fat body,
gut, and other organs with the light microscope (magnification 400x) for entomopathogenic
microorganisms (microsporidia, fungi).
Altogether, 532 bark beetles were investigated. Wet mount preparation of dissected organs
and tissues were examined by phase contrast microscopy. Giemsa-stained smears (Giemsa’s
solution, Merck, Darmstadt, Germany) were prepared for assessment of vegetative stages of
microsporidia and spore measurements.
Collected mites were fixed in 70% ethylalcohol. For preparation of permanent slides,
mites were transferred to lactophenol for clearing, mounted in Berlese (Humason, 1972), or
glycerol, and measured with an ocular micrometer.
For identification of entomopathogenic fungi, the bark beetles were incubated in Petri
dishes with a moist filter. Outgrowing fungi were cultivated on three media, i.e. malt extract
peptone agar (MEA), potato dextrose agar (PDA) and Beauveria selective medium (BSM)
(Strasser et al., 1996) for 10-14 days at 25°C. The conidia were stained with lactophenolcottonblue and examined with the light microscope. The material was studied by using
generally accepted methods in insect fungal pathology (de Hoog, 1972; Humber, 1997).
Parasitic nematodes were isolated by using generally accepted methods in insect
nematology (Kaya & Stock, 1997). Dissection of beetles in a Petri dish with Ringer’s solution
under the stereomicroscope was carried out by hand (Pavlovski, 1957).
The complex of antagonists occurring in I. typographus populations from different sites of
German and Georgian forests is presented in Tab. 1.In light microscopical investigations of
fresh smears of I. typographus, the microsporidium Chytridiopsis typographi could be
identified in the cells of the midgut epithelium. This pathogen was found in beetles from
different sites of Reinhardshagen and of the National Park Bavarian Forest, Frauenau. The
infection rates in the forest district of Reinhardshagen were 5.3 – 13.6%, in beetle populations
of the National Park Bavarian Forest between 3.3 – 7.8%. In both sites of Georgia no
infections were found. The occurrence of Ch. typographi in populations of I. typographus was
known from former investigations (Händel & Wegensteiner, 2005).
Altogether, 337 individual mites were collected from all beetles. Ten species of phoretic
mites were identified from German I. typographus populations: Dendrolaelaps quadrisetus
(Berlese), Proctolaelaps fiseri (Vitzthum), Macrocheles sp. (no. 48249), Lasioseius penicil-
247
liger Berlese, Pleuronectocelaeno barbara Athias-Henriot, Histiostoma piceae Scheucher,
Uroobovella ipidis (Vitzthum), Trichouropoda polytricha (Vitzthum), Trichouropoda sp. (no.
23936), and Tarsonemus minimax Vitzthum. Eight species were found in Georgian bark
beetle populations: Dendrolaelaps quadrisetus, Macrocheles sp. (no. 48138), Lasioseius
penicilliger, Trichouropoda polytricha, Dendrolaelaps apophyseus Hirschmann, Ereynetes
propescutulis Hunter & Rosario, Histiogaster ornatus, and Histiostoma piceae (Tab. 2). Mites
were often observed in bark beetle populations and some of them are responsible for the
dissemination of fungus spores under the bark of spruce trees.
Table 1. Antagonists of Ips typographus in populations of different German and Georgian
forest districts.
Nematodes
(%)
105
Ch.
typographi
(%)
5.7
21.0
Fusarium sp.
Karlshafen,
Abt. 1040
66
13.6
31.8
B. bassiana
Tendelburg,
Abt. 1027
72
5.6
12.5
B. bassiana
B. brongniartii
Mariendorf,
Abt. 714
57
5.3
19.3
B. bassiana
38-61
55
5.5
20.0
–
59-10
56
5.4
21.4
–
XLI 3
51
7.8
33.3
–
XLIX 5
40
2.5
12.5
–
LIV 9
30
3.3
26.7
–
Georgia
Racha
Shovi
–
–
–
Georgia
Borjomi gorge
Libani,
district 16
120
–
42.5
Tsagveri,
district 9
215
–
26.5
Geographic location
Area and plot
Germany
Forest district
Reinhardshagen
Karlshafen,
Abt. 1051
Germany
National park Bavarian
forest, Frauenau
Beetles
(n)
Fungi
B. bassiana
For over 30 years, the USDA Forest Service has been intensively engaged in the study of
basic biology and management of the southern pine beetle, Dendroctonus frontalis
Zimmermann, which causes heavy damage to southern and other pine trees. In the pine-beetle
system, Tarsonemus mites (Acari: Tarsonemidae) inoculate trees with an Ophiostoma fungus
(Klepzig et al., 2001). The mites are fungivorous and carry ascospores of their mutual fungi in
structures called sporothecae (Moser, 1985). The discovery of Tarsonemus crassus
(Schaarschmidt) carrying Ophiostoma novo-ulmi Brasier in Austria suggested that a similar
mutualism might exist for Dutch elm disease (Moser et al., 2005).
248
Table 2. Mite species and numbers associated with Ips typographus in populations of different
German and Georgian forest districts.
Forest
District
Darmstadt
Forest
District
Reinhardshagen
National
Park
Bavarian
Forest,
Frauenau
National
Park
Bavarian
Forest,
Scheuereck
Georgia,
Racha,
Shovi
0
0
0
0
1
88
40
5
0
2
Ereynetes propescutulis
0
0
0
0
9
Histiogaster ornatus
0
0
0
0
8
Histiostoma piceae
12
15
0
0
0
Lasioseius penicilliger
0
0
0
0
1
0
0
0
0
1
0
1
0
0
0
21
0
0
0
0
Proctolaelaps fiseri
1
1
0
0
0
Tarsonemus minimax
0
1
0
0
0
21
25
3
1
1
38
0
0
0
0
Uroobovella ipidis
22
15
0
0
0
Total number of mites
203
98
8
1
23
Mite Species
Dendrolaelaps
apophyseus
Dendrolaelaps
quadrisetus
Macrocheles sp.
(no. 48138)*
Macrocheles sp.
(no. 48249)*
Pleuronectocelaeno
barbara
Trichouropoda
polytricha
Trichouropoda sp. (no.
23936)*
* No specialist could be found to determine this mite. To aid future identification, the number here
corresponds to the number printed on the voucher slide or slides of the species stored at Pineville LA
(U.S.A.).
Interactions between phoretic mites of the Tarsonemus complex, certain bark beetles and
Ophiostoma fungi were studied by Klepzig et al. (2001) and Moser et al. (2005). A key to
phoretic mites associated with I. typographus in Southern Germany was presented by Moser
& Bogenschütz (1984). It is also possible that phoretic mites may function as vectors for
entomopathogenic fungi.
The entomopathogenic fungus B. bassiana is a well known, naturally occurring, and
widely distributed antagonist of I. typographus (Bathon, 1991; Wegensteiner, 1992, Wegensteiner et al., 1996) and Pityogenes chalcographus (L.) (Wulf, 1979). Adults of I.
249
typographus from Georgian populations were found under the bark or in the galleries infected
by entomopathogenic fungi. In the district Reinhardshagen (Karlshafen, Trendelburg, and
Mariendorf) and in a Georgian location Racha (Shovi), B. bassiana was identified. From one
beetle (district Trendelburg) Beauveria brongniartii was isolated. The B. brongniartii culture
was pink in contrast to B. bassiana. The dimensions of the round conidia of B. bassiana were
(1.5-) 2.0 – 3.0 (-4.0) x (1.5-) 2.0 – 2.5 (-3.0) µm; the ovoid to elliptical conidia of B.
brongniartii were (2-) 2.5 – 4.5 (-6) x (1.5-) 2 - 2.5 (-3) µm. Additionally, single specimens of
adult bark beetles showed a mycelium with red exudates at the abdomen. After isolation and
microscopical observation a Fusarium sp. was identified.
The average number of beetles with nematodes in the forest district Reinhardshagen was
12.5% – 31.8%, and in the National Park Bavarian Forest, Frauenau, 12.5% – 33.3% (Tab. 1).
The nematodes Contortylenchus sp., Parasitorhabditis sp., and Bursaphelenchus sp. were
found in Georgian bark beetle populations. The findings of an unidentified Bursaphelenchus
sp. is interesting, as the pine wilt nematode, Bursaphelenchus xylophilus (Steiner & Buhrer)
Nickle is known to cause the pine wilt disease. The average number of beetles with
nematodes, found in midgut and hemolymph, in the forest of Borjomi gorge, Libani, district
16 was 42.5% and 26.5% in Tsagveri, district 9 (Tab. 1).
In summary, the antagonists were incapable of reducing beetle populations of I.
typographus to acceptable numbers. Further comparative investigations on the antagonist
complex of bark beetles from stricken trees are planned.
Acknowledgements
This research was supported by the DAAD Exchange Service. We wish to thank Dr. Jürg
Huber and all colleagues of the Institute for Biological Control, Darmstadt, Germany,
especially H. Radke and B. Löber as well as S. Blomquist (USDA Forest Service) for their
assistance. We also thank colleagues of the Forest Office Reinhardshagen and of the National
Park Bavarian Forest, Frauenau for collecting bark beetles, Dr. Lynn K. Carta, USDA-ARS,
Nematology Laboratory, Beltsville for nematode identification and Dr. Pavel Klimov,
Museum of Zoology, Univ. Michigan, Ann Arbor Michigan, U.S.A., who identified the
Histiogaster.
References
Balazy, S. 1996: Living organisms as regulators of population density of bark beetles in
spruce forest with special reference to entomogenous fungi. I. Poznan. Tow. Przyj. Nauk
Wydz. Nauk Roln. Lesn., Pr. Kom. Nauk Roln. Kom. Nauk Lesn. 21: 3-50.
Bathon, H. 1991: Möglichkeiten der biologischen Bekämpfung von Borkenkäfern. Mitt. Biol.
Bundesanst. Land- und Forstw., eds. Wulf, A., Kehr, R., Heft 267: 111-117.
Burjanadze, M. 2006: Fungi associated with bark beetles of oriental spruce in Georgia.
Georgian Acadamy of Sciences,”Macne”, Biology Ser. B, 4: 105-109.
De Hoog, G.S. 1972: The Beauveria, Isaria, Tritirachium and Acrodontium gen. nov. Studies
in Mycology 1: 41 pp.
Haidler, B., Wegensteiner, R. & Weiser, J. 2003: Occurrence of microsporidia and other
pathogens in associated living spruce bark beetles (Coleoptera: Scolytidae) in an Austrian
forest. IOBC/wprs Bulletin 26 (1): 257-260.
Händel, U., Wegensteiner, R., Weiser, J. & Zizka, Z. 2003: Occurrence of pathogens in
associated living bark beetles from different spruce stands in Austria. J. Pest Sci. 76: 2232.
250
Händel, U. & Wegensteiner, R. 2005: Occurrence of pathogens in bark beetles (Coleoptera:
Scolytidae) from Alpine pine (Pinus cembra L.). IOBC/wprs Bulletin 28 (3): 155-158.
Humason, G.L. 1972: Animal Tissue Techniques, 3rd edn., W.H. Freeman, San Francisco,
CA.
Humber, R.A. 1997: Fungi Identification. In: Manual of Techniques in Insect Pathology, ed.
Lacey, L.A., Academic Press, San-Diego: 153-185.
Kaya, H.K. & Stock, S.P. 1997: Techniques in insect nematology. In: Manual of Techniques
in Insect Pathology, ed. Lacey, L.A., Academic Press, San-Diego: 281-324.
Kereselidze, M. & Wegensteiner, R. 2007: Occurrence of pathogens and parasites in Ips
typographus. L. from spruce stands (Picea orientalis L.) in Georgia. IOBC/wprs Bulletin
30 (1): 207-210.
Klepzig, K.D., Moser, J.C., Lombardero, F.J., Hofstetter, R.W. & Ayres, M.P. 2001: Symbiosis and competition: Complex interactions among beetles, fungi and mites. Symbiosis
30: 83-96.
Kreutz, J., Vaupel, O. & Zimmermann, G. 2004a: Efficacy of Beauveria bassiana (Bals.)
Vuill. against the spruce bark beetle Ips typographus L., in the laboratory under various
conditions J. Appl. Ent. 128: 384-389.
Kreutz, J., Zimmermann, G. & Vaupel, O. 2004b: Horizontal transmission of the entomopathogenic fungus Beauveria bassiana among the spruce bark beetle, Ips typographus
(Col., Scolytidae), in the laboratory and under field conditions. Biocontrol Sc. Technol.
14: 837-848.
Moser, J.C. 1985: Use of sporothecae by phoretic Tarsonemus mites to transport ascospores
of coniferous bluestain fungi. Trans. Brit. Myc. Soc. 84: 750-753.
Moser, J.C. & Bogenschütz, H. 1984: A key to the mites associated with flying Ips
typographus in South Germany. Z. angew. Entomol. 97: 437-450.
Moser, J.C., Konrad, H., Kirisits, T. & Carta, L.K. 2005: Phoretic mites and nematode
associates of Scolytus multistriatus and Scolytus pygmaeus (Coleoptera: Scolytidae) in
Austria. Agric. Forest Entomol. 7: 169-177.
Pavlovski, E.N. 1957: Methods of hand anatomy of insects. AS. of USSA: 3-85.
Strasser, H., Forer, A. & Schinner, F. 1996: Development of media for the selective isolation
and maintenance of virulence of Beauveria brongniartii. In: Proc. 3rd International
Workshop on Microbial Control of Soil Dwelling Pests, eds. Jackson, T.A. & Glare, T.R.:
125-130.
Tonka, T., Pultar, O. & Weiser, J. 2007: Survival of the spruce bark beetle, Ips typographus,
infected with pathogens or parasites. IOBC/wprs Bulletin 30 (1): 211-215.
Wegensteiner, R. 1992: Untersuchungen zur Wirkung von Beauveria-Arten auf Ips typographus (Coleoptera, Scolytidae). Mitt. Dtsch. Ges. allg. angew. Ent. 8: 104-106.
Wegensteiner, R., Weiser, J. & Führer, E. 1996: Observations on the occurrence of pathogens
in the bark beetle Ips typographus L. (Col., Scolytidae). J. Appl. Ent. 120: 199-204.
Wegensteiner, R., Pernek, M. & Weiser, J. 2007: Occurrence of Gregarina typographi (Sporozoa: Gregarinidae) and Metschnikowia cf. typographi (Ascomycota: Metschnikowiaceae) in Ips sexdentatus (Coleoptera: Scolytidae) from Austria. IOBC/wprs Bulletin 30
(1): 217-220.
Wulf, A. 1979: Der insektenpathogene Pilz Beauveria bassiana (Bals.) Vuill. als Krankheitserreger des Kupferstechers Pityogenes chalcographus L. (Col., Scolytidae). Diss. Forstl.
Fak., Universität Göttingen.
pp. 251-256
The challenge of controlling multispecies white grub associations
Siegfried Keller1, Yubak Dhoj G.C.2, Christian Schweizer1
1
Agroscope Reckenholz-Tänikon Research Station ART, Reckenholzstrasse 191, CH-8046
Zurich, Switzerland; 2Tribhuvan University, Institute of Agriculture and Animal Sciences,
Rampur, Nepal
Abstract: White grubs (Scarabaeidae, Coleoptera) are important soil pest insects worldwide. In
Central Europe only a limited number of species is present and damages are normally caused by a
single species. The presence of more than one damaging species is rare but seems to increase. In Nepal
and probably elsewhere, a high species diversity exist and damages are usually done by multispecies
associations. Most common pathogens of white grubs are fungi, especially Metarhizium anisopliae,
Beauveria bassiana and B. brongniartii. Most white grub species are susceptible to M. anisopliae, but
only a few ones like Melolontha spp. can be controlled with B. brongniartii. Therefore, the control of
species complexes containing Melolontha sp. needs treatments with both fungi. Separate applications
of M. anisopliae and B. brongniartii and a mixed application of these two fungi were done in Switzerland. The results in respect to fungus development in the soils as well as to control efficacy were not
consistent. There are indications that a fungus can inhibit the other one but there seems to be no
generalised mutual inhibition of the two fungi. Consequently, good Melolontha control was also
achieved in plots treated with both fungi. Probably soil characteristics and host densities influence the
fungus development. The situation in Nepal is different. All white grub species tested so far are
susceptible to M. anisopliae. The question that needs to be answered is: Can all damaging species of
white grubs be controlled with the same isolate irrespective of their life cycles, the soil types and other
environmental conditions?
Key words: Scarabaeidae, white grubs, multispecies associations, microbial control, entomopathogenic fungi, Beauveria brongniartii, Metarhizium anisopliae.
Introduction
White grubs, the larvae of Scarabaeidae (Coleoptera) belong to the most important soil pest
insects. In Central Europe five noxious species are present: Melolontha melolontha, M. hippocastani, Amphimallon solstitiale, A. majale and Phyllopertha horticola. Usually the damages
are done by a single species, predominantly by M. melolontha. At rare occasions associations
of M. melolontha and P. horticola or exceptionally of M. melolontha, Amphimallon sp. and P.
horticola cause damages. M. melolontha is sensitive to the fungus Beauveria brongniartii but
not to Metarhizium anisopliae while the other species are sensitive to M. anisopliae but not to
B. brongniartii. Therefore, species associations with M. melolontha must be controlled with
both fungi. Field trials using these tow fungi either separately or as mixture were carried out
since 2003. In Nepal multispecies associations seem to be common. In recent investigations
21 damaging species were identified. Up to 17 species were recorded in the same field. The
dominant species vary with altitude and habitat. M. anisopliae and B. bassiana were found as
naturally occurring pathogens. So far only four scarab species were submitted to bioassays,
namely Maladera affinis, Anomala dimidiata, Adoretus lasiopygus and Phyllognathus
dionysius. In all bioassays M. anisopliae proved to be more virulent than B. bassiana.
251
252
In Switzerland three plot trials with four replicates in meadows and a combination of plot trial
and control treatment in a golf course were carried out (Table 1). At Flumserberg (both
locations) and at Schwanden M. melolontha was the dominant species over the whole
observation period. The densities of A. solstitiale were moderate at the beginning of the trials
but decreased in favour of P. horticola. The plots measured 20 x 20 m. and each treatment
was done with four replicates. At Domat/Ems all three species were present but with varying
densities and dominances. The plots measured 20 x 20 m and the two fairway sectors treated
with M. anisopliae alone and with a mixture of M. anisopliae and B. brongniartii respectively
measured 40 ha. The former sector had only low densities of M. melolontha. Both fungi were
applied as barley colonised grains at a rate of 40 kg/ha using a commercial drill machine.
Table 1. The trials done with Beauveria brongniartii (BB) and M. anisopliae (MA) at four
locations in Switzerland. UT: Untreated.
Location
Trial design
Treatment
Pest species present
Flumserberg B (SG)
Meadow
Altitude 950 m
Flumserberg K (SG)
Meadow
Altitude 1000 m
Schwanden (GL)
Meadow
Altitude 600 m
Domat/Ems (GR)
Golf course
Altitude 600 m
Randomised block
design, 4 replicates
UT, BB, MA, BB+MA
Randomised block
design, 4 replicates.
UT, BB, MA, BB+MA
Randomised block
design, 4 replicates.
UT, BB, MA, BB+MA
4 plots (UT, BB, MA,
BB+MA mixed).
2 control treatments
(MA, BB+MA mixed)
25.4.2003.
BB and MA
separately applied
25.4.2003.
BB and MA
separately applied
28.4.2003.
BB and MA
separately applied
19.4.2006.
BB and MA applied
as mixture
M. melolontha
A. solstitiale / P.
horticola
M. melolontha
A. solstitiale / P.
horticola
M. melolontha
A. solstitiale / P.
horticola
M. melolontha
A. solstitiale
P. horticola
In all trials densities of living and fungus-infected grubs were determined and soil
samples were taken 5 months, a year, two and three years after the treatment. Living grubs
were incubated in the laboratory for three months to determine the infection rates. The fungus
densities were determined by plating soil suspensions on selective medium according to
previously described methods and expressed as colony forming units (CFU) per g fresh soil
(Keller et al., 2003).
Results
Fungus densities after five months
The fungus densities after five months reflects the fungus development influenced by
environmental conditions but without substantial influence of the host densities. Figure 1
shows that both fungi were present at variable densities in the untreated plots. The treatment
with B. brongniartii increased the density of this fungus (Flumserberg B, Domat/Ems) or left
it at the original level (Flumserberg K, Schwanden). At all sites except Flumserberg K the
densities of M. anisopliae decreased. The treatment with M. anisopliae increased the density
253
of this fungus slightly (Flumserberg B) or substantially (Flumserberg K, Schwanden). The
densities of B. brongniartii remained (Flumserberg) or distinctly increased. The situation at
Domat/Ems was controversial. In the plot treated with M. anisopliae strain 997 both fungi had
nearly disappeared while in the fairway treated with M. anisopliae strain 714 the densities of
both fungi increased.
Flumserberg K
C F U / g s o il
3000
C FU / g soil
M.a. 2003
B.bro. 2003
B.bro. 2003
1000
500
0
1K
4000
M.a. 2003
1500
7000
6000
5000
4000
3000
2000
1000
0
2B
3M
1K
4 B+M
2B
3M
Treatment
Treatment
Schwanden
Domat/Ems
M.a. 2003
C FU / g s oil
C FU / g s oil
Flumserberg B
B.bro. 2003
2000
1000
0
4000
CFU M.a.
3000
CFU B.bro.
4 B+M
2000
1000
0
1K
2B
3M
Treatment
4 B+M
K
B 996
B+M
M 997
M 714 FW
B+M FW
Treatment
Figure 1. Densities of M. ansiopliae and B. brongniartii at the four locations five months after
the treatment. K: untreated; B: treated with B. brongniartii; M: treated with M. ansiopliae;
B+M: treated with both fungi.
In the plots treated with both fungi, the densities of both fungi increased (Flumserberg B
and K) or slightly decreased (Schwanden) in comparison with the densities in the untreated
plots. Controversial results were obtained at Domat/Ems. The treatment with the mixture was
not followed by an increase of the fungus densities but with a decrease of M. anisopliae in the
plot trial and with a decrease of B. brongniartii in the fairway trial.
Development of cockchafer populations and of B. brongniartii-infections
Good control results were achieved at Flumserberg K. The population treated with B.
brongniartii was reduced to 52% of the original density in contrast to 88% of the untreated
population. The reduction in comparison with the untreated plots was still significant after the
flight. Similar results but to a lesser extent were obtained in the plots treated with both fungi
(Figure 2).
No disease developed in the untreated plots until the end of the generation (Figure 3).
The same was found in the plots treated with M. anisopliae. The infection rates in the plots
treated with B. brongniartii and with both fungi amounted to about 10% five months after the
treatment. They increased in the following year to reach about 15% and 30% respectively. In
the year after the following flight infections caused by B. brongniartii were present in all
treatments, they were highest in the plots treated with B. brongniartii reaching over 30%
(Figure 3).
254
White grubs / m2
60
50
40
30
K
20
BB
10
MA
BB/MA
0
2003
2004
2005
2006
Year
Figure 2. Development of the Melolontha-populations at Flumserberg K. The flight took place
before the sampling of 2005.
35
% infected grubs
30
5 months after
treatment
Flight
25
20
K
15
BB
10
MA
5
BB/MA
0
2003
2004
2005
2006
Year
Figure 3. Development of the infection rates caused by B. brongniartii at Flumserberg K. The
flight took place before the sampling of 2005.
The other two trials were less successful. At Flumserberg B the disease established but
did not reduce the population. On the contrary, in the following generation the densities in all
treatments were higher than in the untreated plots. But also at this site the disease established
in the untreated plots and caused 29% mortality (Table 2).
White grubs and entomopathogenic soil fungi in Nepal
M. anisopliae and B. bassiana were isolated from soil samples and from white grubs (GC &
Keller, 2003). From both substrates M. anisopliae clearly dominated. From white grubs 24
strains of M. anisopliae were isolated and only two strains of B. bassiana (GC, 2006).
Further, bioassays showed that the former species was more virulent against four species of
white grubs, namely Maladera affinis, Anomala dimidiata, Adoretus lasiopygus and Phyllognathus dionysius.. Among M. anisopliae strain M1 proved to be the most virulent one and
was chosen for field trials. However, infection rates under field conditions remained below
20% after a season. Long-term effects were not yet studied.
255
Table 2. Development of M. melolontha populations at Flumserberg B and Schwanden treated
April 2003. Flights took place in 2002 and 2005. UT: untreated; BB: treated with B.
brongniartii; MA: treated with M. anisopliae; BB+MA: treated with both fungi.
Location Treatment
Flumser- UT
berg B
BB
MA
BB+MA
Schwan- UT
den
BB
MA
BB+MA
Grubs
/m2
10.03
23
20
15
15
16
17
22
13
Density in % of 2003
7.04
39
70
47
67
56
35
9
38
10.05
83
110
153
180
38
35
14
23
7.06
48
50
80
93
31
53
14
15
% infected white grubs
10.03
0
13
12
12
0
38
4
36
7.04
0
33
13
50
5
45
73
41
10.05
7.06
29
47
4
18
Light trap collections at five agricultural sites and in different altitudes yielded 78
species. Seventeen species could not been identified so far. At least four of them are definitely
new to science.
Samplings of white grubs in two fields over one season resulted in 13 species and in 17
species in another field (GC, 2006). The following species were present at all three locations:
Adoretus lasiopygus, A. versutus, Allisonotum simile, Anomala dimidiata, A. xanthoptera,
Anomala sp., Heteronychus lioderes, Heteronychus sp., Holotrichia seticollis and Maladera
affinis. The life cycle of most species is unknown. The duration of the development cycle of
three studied species varied between two months and a year. Most beetles have a different life
cycle. Some hibernate in the egg stage, others in the larval, pupal or adult stage. Monthly
samplings showed the presence of eggs, larvae, pupae and adults all year round.
Discussion
The control of white grub complexes containing Melolontha spp. necessitates the application
of M. anisopliae and B. brongniartii. Separate applications of these two fungi and a mixed
application of these two fungi were done in Switzerland. The results in respect to fungus
development in the soils as well as to control efficacy were not consistent. There are indications that a fungus can inhibit the other one but there seems to be no generalised mutual
inhibition of the two fungi. Probably soil characteristics and host densities influence the
fungus development. There was a general observation that after the flight following the
treatment both fungus species had spread from the treated plots to the neighbouring ones
which confirms earlier observations.
Melolontha control was achieved in plots treated with B. brongniartii alone and together
with M. anisopliae. However, in plots treated with both fungi the efficacy tended to be worse
than in plots treated with B. brongniartii alone. In all trials only a single Melolontha larva was
found infected with M. anisopliae. Efficacy data from the other species were not taken
systematically either due to low densities or due to the fact, they were in the egg stage when
samplings took place. But nevertheless, several Amphimallon and Phyllopertha larvae were
found infected with M. anisopliae during the study. The data on efficacy and fungus
development achieved with common applications of M. anisopliae and B. brongniartii are
encouraging but more trials are needed to obtain unequivocal data.
256
The white grub situation in Nepal differs completely from that in Central Europe and is
very complex consisting of up to more than 10 species. So far only M. anisopliae is identified
as potential biocontrol agent and only four grub species have been tested for susceptibility
against this fungus. The sensitivity of the other white grub species is unknown. Further, we do
not know in which way the year round presence of different species and development stages
influences the fungus development and its control potential. We may assume that such
conditions favour the development and the survival of the fungus.
Future work in Nepal has to focus on the identification of the dominant grub species,
their life cycles and their sensitivity to M. anisopliae and, if necessary, to other insect
pathogenic soil fungi as a prerequisite for a successful control. Further, the influence of the
application time, the agricultural practice and the presence of multispecies grub associations
on short- and long-term efficacy and on fungus persistence needs to be studied.
References
GC, Y.D. 2006: White grubs (Coeloptera: Scarabaeidae) associated with Nepalese agriculture
and their control with the indigenous entomopathogenic fungus Metharhizium
ansiopliae (Metsch.) Sorokin. Ph.D. thesis, University Basel, 246 pp.
GC, Y.D. & S. Keller. 2003: Towards microbial control of white grubs in Nepal with
entomopathogenic fungi. Bull. Soc. Ent. Suisse 76: 249-258.
Keller, S., P. Kessler & C. Schweizer. 2003: Distribution of insect pathogenic soil fungi in
Switzerland with special reference to Beauveria brongniartii and Metarhizium anisopliae. BioControl 48: 307-319.
pp. 257-260
Sublethal effects of Nomuraea rileyi on development of Spodoptera
frugiperda (Lepidoptera: Noctuidae)
C. Espinel & A. Cotes
Center of Biotechnology and Bioindustries. Colombian Corporation for Agricultural
Research CORPOICA. Km. 14 vía Mosquera, Bogotá- Colombia
Abstract: Nomuraea rileyi represents a promising biocontrol agent of fall armyworm Spodoptera
frugiperda. Based upon a native strain Nm005, a biopesticide prototype, which produced mortality
under laboratory conditions of S. frugiperda upper 90%, has been developed. Taking into account the
importance of studying pathogen-insect interactions as a crucial factor for optimization of biopesticides, the objective of this study was to evaluate sublethal effects of N. rileyi Nm005 over biological
parameters of S. frugiperda immature stages and adults. Nm005 was applied to eggs and second and
fifth instar larvae in a lethal concentration 30 (LC30), (2.4 x 103 conidia ml-1) to determine the effect
through a generation. Larval mortality, longevity and weight of pupae were evaluated. Surviving
adults were mated and the fecundity and fertility were determined. The same parameters were
registered in the next generation and each developmental stage was compared with a control. Second
instar larvae were the most susceptible to LC30 of N. rileyi, with 36.3% mortality, compared to
treatments of eggs or fifth instar larvae, with 17.9% and 13.2%, respectively. A sublethal effect was
evident in fertility of surviving adults when second instars had been treated with the fungus (50.5%
fertility) in comparison when eggs and fifth larvae instar had been treated (80.6% and 83.4%,
respectively). Sublethal effects were evident in adults of the second generation obtained after
treatment of eggs and second instar.
Key words: Nomurea rileyi, Spodoptera frugiperda
Introduction
Fall armyworm Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) is a tropical
neoartic insect (Andrews 1980, cited by Álvarez and Sánchez 1993 and a major pests in
maize, sorghum, cotton, rice, sugar cane and grass. Promising biological control agent of S.
frugiperda is the entomopathogenic fungus Nomuraea rileyi (Farlow) Samson (Hyphomycetes: Moniliaceae). It causes natural epizooties in this and other economic important
lepidopterans. A registered commercial biopesticide based on this microorganism does not
exist (Villamizar et al., 2004). For this reason the biological control laboratory of CORPOICA
has developed a biopesticide base on a native strain of N. rileyi. Many studies ignore sublethal
effects on development and reproduction of infected insect. Sublethal effects may have
consequences in population dynamic of susceptible species (Vargas-Osuna 2001). In
consequence, the objective of this work was to evaluate sublethal effects of N. rileyi Nm 005
on biological parameters of immature stages and reproductive parameters of surviving adults
of S. frugiperda.
N. rileyi (strain Nm 005) was originally isolated from S. frugiperda larvae. Preliminary
studies showed 95% mortality over second instar larvae of S. frugiperda under laboratory
conditions (Bosa et al. 2004). Insects came from a rearing maintained at the Biological
257
258
Control Laboratory 25°C of temperature ± 3 and 65% ± 5 of relative humidity. Healthy
cohorts of 35 individuals per each development stage (egg, second and fifth instar) were
collected. Eggs were applied by spraying 0.4 ml of a suspension of a sublethal concentration
30 of N. rileyi (2.4x103 conidia ml-1). A leaf of “Higuerilla” (Ricinus comunis) was supply as
food. Previously, leaves had been sprayed with the fungus suspension. Control consisted of
the same number of individuals without fungus application. Each group of 70 individuals
(treatments + controls) was considered an independent population. Mortality in terms of
efficacy were registered by Schneider-Orelli formula (Zar, 1999); Efficacy (%) = ((B –
K)/(100 – K)) * 100, where B = mortality percentage of each treatment, and K = mortality
percentage of control. The fecundity and fertility of 10 mated couples of survivors after
application and 10 from the control were selected. Fecundity and fertility were recorded.
Afterwards, from each offspring (F1) 15 larvae were randomly selected and fecundity and
fertility of emerged adults were registered. A complete random design was carried out, to
which each egg, larva and couple was considered as one replication. Analysis of variance and
Tukey tests (α=0.05) were performed using the SAS program. The reduction in the
reproductive net rate (Ro) for each generation of adults (parental and F1) was determined
according to the formula described by Rothman and Myers (1996): % reduction Ro = 100 x
[1-(Ro treatment / Ro control)], Ro= number of event that a population may multiply for
generation.
The application with N. rileyi Nm005 to second larval instars caused the highest mortality
(36.3%), followed by egg application (17.9%) and fifth larval instar with 4.7% (P<0.05)
(Figure 1). According to these results second instars are more susceptible.
100
Mortality (%)
90
80
70
60
50
A
40
30
20
B
C
10
C
D
E
0
Egg
Larve 2
Parental
Larve 5
F1
Figure 1. Effect of N. rileyi on immature stages in two generations of S. frugiperda. Treatments followed by the same letter are not significant different by Tukey test (α=0.05).
Significant differences were observed when mortality was compared in the parental
generation with the F1 generation for all development stages. This could indicate that a direct
effect of N. rileyi is presented on the larvae of the generation that receives fungal application,
but this parameter is not transmitted to the next generation. Torrado (2001), working with
259
Beauveria bassiana against whitefly Bemisia tabaci, found that mortality decreased through
generations. A significant reduction in fecundity was observed in adult survivors when L2 had
been treated (65.3%) in comparison to eggs and L5 (83.6% and 93.7%, respectively) (Fig. 2).
Fecundity (%)
100
A
A
80
A
A
60
B
AB
40
20
0
Egg
Larve 2
Parental
Larve 5
F1
Figure 2. Effect of N. rileyi sublethal application on fecundity in two generations of S.
frugiperda. Treatments followed by the same letter are not significant different (Tukey Test,
α=0.05).
Adult fertility of survivors was 80.6% when parental eggs and 50.5% when L2 had been
treated (Figure 3), presenting significant differences compared with the control (p<0.05).
Significant differences also were present when comparing the same treatments in the next
generation, with percentages of fertility of 77.7% for the females that came from eggs
exposed to the fungus, and about 81.6% for those of second instars. For fifth larval instar,
there were not significant differences in fertility between females treated and the control.
100
100
90
90
A
70
B
80
A
B
Fertility (%)
Fertility (%)
80
60
50
60
B
A
C
50
40
40
30
30
20
20
10
10
0
A
70
0
Parental egg
applied
Parental egg
control
F1 egg applied
F1 egg control
Parental L2 applied
Parental L2 control
F1 L2 applied
F1 L2 control
Figure 3. Effect of N. rileyi sublethal application to eggs (left) or L2 on fertility in two
generations of S. frugiperda. Treatments followed by the same letter are not significant
different (Tukey Test, α=0.05)
The reduction in fecundity and fertility could be initiated during the larval stage due to
the direct action of the fungi, which consumes energy reserve. Consumption of nutriments in
the hemolymph may weaken larvae development (Clarkson and Charnley, 1996). It could also
reflect the reaction the insect´s defence, causing weakness of survivors and alternating the
reproductive capacity which has been reported after entomopathogenic fungi or baculovirus
infection (Santiago-Álvarez and Vargas-Osuna, 1988; Fargues et al., 1991; Mulock and
Chandler, 2001; Hornbostel et al., 2004).
260
Applying the formula by Rothman and Myers (1996), it was observed that the major
reduction in Ro (62.5%) occurred when applying L2 of the parental generation. This effect is
more than 50% higher than that of treatments of sublethal application to eggs or L5 (25.3%
and 23.7%, respectively). This theoretical reduction of Ro in treated L2 could demonstrate
their higher susceptibility. From the pest control point of view, the sublethal effects and
vertical transmission of these effects can be extremely important due to an additional benefit.
In conclusion, L2 of S. frugiperda were the most susceptible to the direct sublethal application
of N. rileyi. The main sublethal effects caused by N. rileyi occurred in larvae mortality,
fecundity and fertility of S. frugiperda and sublethal effects were observed on egg and second
larval stages of the offspring (F1) of S. frugiperda.
Acknowledgements
The authors express their gratitude to CORPOICA for supporting this research and to Dr.
Fernando Rodriguez and Dr. Magnolia Ariza, for reviewing this document.
References
Bosa, C., Chávez, D., Torres, L., París, A. & Cotes, A. 2004: Rev. Col. Ent. 30: 93-97.
Clarkson, J. & Charnley, A. 1996: Tren. Micr. 4: 197-203.
Fargues, J., Delmas, J., Augé, J. & Lebrun, R. 1991: Ent. Exp.Appl. 61: 45-51.
Hornbostel, V., Ostfeld, R., Zhioua, E., Benjamin, M. 2004: J. Med. Ent. 41: 922-929.
Mulock, B. & Chandler, L. 2001: Biol. Con. 22: 16-21.
Rothman, L. & Myers, J. 1996: J. Inv. Path. 67: 1-10.
Santiago-Álvarez, C. & Vargas-Osuna, E. 1988: J. Inv. Path. 52: 142-146.
Torrado, E. 2001: Evaluación de efectos subletales producidos por Beauveria bassiana
(Bálsamo) Vuillemin (Deuteromycotina: Hyphomycetes) sobre la mosca blanca Bemisia
tabaci (Gennadius) (Hemiptera: Aleyrodidae) bajo condiciones de laboratorio. Tesis:
Magíster en Ciencias Biológicas. Universidad del Valle: 105 pp.
Vargas-Osuna, E. 2001: Efectos de dosis subletales. In: Los Baculovirus y sus aplicaciones
como bioinsecticidas en el control biológico de plagas. Eds. Primitivo Caballero, Trevor
Williams & Miguel López-Ferber. Phytoma. España: 373-387.
Villamizar, L., Arriero, C., Bosa, C. & Cotes, A. 2004: Rev. Col. Ent. 30: 99-105.
Zar, J. 1999: Biostatistical analysis. Forth edition. Prentice Hall. New Jersey U.E.: 663 pp.
Nematodes
262
p. 263
Isolation and characterization of new populations of
entomopathogenic nematodes from Israel
Nona Mikaia2, Liora Salame1, Cisia Chkhubianishvili2, Itamar Glazer1
1
Dept. of Entomology, Nematology Division, ARO, Volcani Center, Bet-Dagan, 50-250,
Israel; 2Biocontrol Dept., Kanchaveli L. Institute of Plant Protection, Ministry of Education
and Sciences of Georgia 82, Chavchavadze Ave, Tbilisi 0162, Georgia
Abstract: Entomopathogenic nematodes (Steinernematidae and Heterorhabditidae) are known as
effective biological agents against soil dwelling stages of insect pests. They inhabit diverse habitats
world wide. In the present study nematodes from different locations in Israel were isolated and than
evaluated for some beneficial traits in various bioassays: Reproduction potential, desiccation and heat
tolerance, infectivity, motility in sand columns. In each assay, all populations were tested. Large
variation between the various populations was recorded in all assays. In order to compare between the
population and to select for a superior one the performance of each population in an assay was scored
with a relative value between 1 to 10. The nematode with the highest average score was designated as
the best one for further evaluation as a biological control agent.
263
pp. 264-266
A new steinernematid from Sardinia Island (Italy)
Eustachio Tarasco1, Zdenek Mráček2, Khuong B. Nguyen3, Oreste Triggiani1
Department of Biology and Chemistry, Section of Entomology and Zoology, University of
Bari, Via Amendola 165/A, 70126 Bari, Italy; 2Laboratory of Insect Pathology, Institute of
Entomology, Czech Academy of Sciences, Branisovská 31, 370 05, Ceské Budejovice, The
Czech Republic; 3Entomology & Nematology Department, University of Florida, Gainesville,
FL, USA
1
Abstract: A new Steinernema species was isolated from three different sandy soil samples along the
Platamona Beach, in the north-west coast of Sardinia island (Italy). This new species is characterised
by the following morphological characters: infective third-stage juvenile with a body length of 866 ±
66 (767-969) µm, distance from head to excretory pore of 63 ± 2.7 (59-68) µm, tail length of 81 ± 3.2
(76-89) µm, ratio E (%) 77 ± 3.4 (68-83); male tail with a mucron only in the second generation,
spicule length of 66 ± 1.4 (64-67) µm and gubernaculum length of 44 ± 1.4 (43-46) µm in the first
generation male; female of first generation with a slight vulval protruding and ratio D (%) of 50 ± 8.6
(29-65). The new species differs distinctly from the related species (S. feltiae, S. kraussei, S. litorale,
S. oregonense) in some morphometric values and the analyses of the internal transcribed spacer (ITS)
and D2D3 regions. The new species is close to S. feltiae, S. weiseri and S. litorale based on the
sequence of the ITS region. For the D2D3 region, it is close to S. feltiae, S. oregonense and S.
kraussei. Sequences of D2D3 of other species are not available for the studies. Cross hybridisation
tests with S. feltiae, S. litorale, S. weiseri and S. oregonense showed that these species were reproductively isolated.
Key words: taxonomy, entomopathogenic nematode, new species, Sardinia, Steinernema
Introduction
During a survey of entomopathogenic nematodes in Sardinia (Italy) a new Steinernema
species was found in soil samples collected. Three strains (ItS-SAR2, ItS-SAR4 and ItSSAR6) belonging to the same new species were isolated from different sandy soil samples
along the Platamona Beach, in the north-west coast of Sardinia island. The new species
belongs to the Steinernema feltiae nematode group.
Soil samples were collected from Platamona Beach, in the north-west coast of Sardinia island.
Nematodes were recovered from sandy soil samples using the Galleria baiting technique
(Bedding & Akhurst, 1975). The reproductive compatibilities of Sardinain Steinernema
strains were examined in a series of individual diallelic crosses with Steinernema feltiae
(Filipjev, 1934) Wouts, Mráček, Gerdin and Bedding, 1982, S. litorale Yoshida, 2004, S.
weiseri Mráček, Sturhan and Reid, 2003 and S. oregonense Liu and Berry, 1996 using the
“Hanging drop” technique (Poinar, 1975). In this method a sterile drop of insect haemolymph
seeded with surface-disinfected nematode juveniles is used. A haemolymph drop obtained
from a Galleria larva by cutting a leg was released onto a cover slip, which was kept on a
cavity microscope slide inside a Petri dish with moistened filter papers. Before immersing in
264
265
the haemolymph drop, IJs were kept for 15-20 sec in Hyamine solution (0.1%), which was
also used to sterilize the larval leg surface before cutting. Between two and four IJs were
released in each haemolymph drop. The development of IJs was observed and checked
continuously and males and females were separated before mating could occur. The nematode
isolates tested were: ItS-SAR2, ItS-SAR4, ItS-SAR6, S. litorale, S. feltiae S. weiseri and S.
oregonense. Each Sardinian strain was crossed with S. litorale and S. feltiae in a series of six
individual diallelic crosses. The Sardinian strains were also crossed among each other and the
self-breedings served as controls. Light microscopy and molecular methods reported by
Triggiani et al., 2004 and Nguyen et al. 2007 were used in these studies.
This new species belongs to the “Steinernema feltiae nematode group” and it is characterised
by the following morphological characters: infective third-stage juvenile with a body length
of 866 ± 66 (767-969) µm, distance from head to excretory pore of 63 ± 2.7 (59-68) µm, tail
length of 81 ± 3.2 (76-89) µm, ratio E (%) 77 ± 3.4 (68-83); male tail with a mucron only in
the second generation, spicule length of 66 ± 1.4 (64-67) µm and gubernaculum length of 44
± 1.4 (43-46) µm in the first generation male; female of first generation with a slight vulval
protruding and ratio D (%) of 50 ± 8.6 (29-65).
Table 1. Morphological comparison of the Sardinian EPN with relative species
Character/species
Sardinian
EPN
866 ± 61
4.6 ± 0.2
46 ± 1.4
48 ± 1.8
?
66 ± 1.4
2.2
139 ± 18
67 ± 1.9
9.1 ± 2.5
Slight
S. kraussei
S. feltiae
S. litorale
S.
oregonense
IJ mean body length
950
879 ± 49
895 ± 29
980 ± 0.1
IJ c´
4.8 ± 0.2
4.3 ± 0.3
4.7
3.9
IJ D%
47
46 ± 1.4
50 ± 1.8
50 ± 4.0
IJ Hy%
44 ± 4
47
38 ± 0.4
33
IJ lateral ridges
8 (6+2)
8
7-8 (5-6+2)
7 (5+2)
M1 spicule length
49
66 ± 1.5
75 ± 4.8
71 ± 1.9
M1 manubrium L/W
1.7 ± 0.2
1.5
1.5-2.0
1
M1 S/Wx100
110
140 ± 10
174 ± 1 3
152
M1 G/Sx100
68
71 ± 4
79
80 ± 3
M2 mucron
6-12
6-12
long?
minute
F1 vulval protruding
slightly to
slight
slight
slightly to
moderately
moderately
F1 postanal swelling
no to slight
no
slight
no
no
F1 tail papilla-like
No
no
no
no
2-3
F1 – First generation female; IJ – Infective juvenile; M1 – First generation male; M2 – Second generation male; c´ – Tail length divided by tail width; D% – Anterior end to excretory pore in % of pharynx
length.; G/S – Gubernaculum length divided by spicule length; Hy% – Hyaline tail length in % of total
tail length; L/W – Length divided by width; S/W – Spicule length divided by anal body width; Bolded
– characters differ distinctly
The new species differs distinctly from the related species in some morphometric values: the
anterior end to excretory pore in % of pharynx length, the hyaline tail length in % of total tail
length and the lateral ridges of infective juveniles and the length divided by width of first
generation male manubrium, when compared with Steinernema kraussei (Steiner, 1923)
266
Travassos 1927; the lateral ridges of infective juveniles and the gubernaculum length divided
by spicule length of the first generation male, when compared with S. feltiae; the lateral ridges
and the hyaline tail length in % of total tail length of the infective juveniles, when compared
with S. litorale; the lateral ridges of infective juveniles, the mucron of the second generation
male and the first generation female tail papilla-like, when compared with S. oregonense
(Tab. 1).
The analyses of the internal transcribed spacer (ITS) and D2D3 regions of the EPN
isolate collected from Sardinia showed that it is a new species. The new species is close to S.
feltiae, S. weiseri and S. litorale based on ITS regions. For D2D3 regions, it is close to S.
feltiae, S. oregonense and S. kraussei. Sequences of D2D3 of other species are not available
for the studies (Fig. 1). Cross hybridisation tests with S. feltiae, S. litorale, S. weiseri and S.
oregonense showed that these species were reproductively isolated.
Figure 1. In the phylogenetic tree using ITS regions (left), the new species and S. feltiae form
a monophyletic group well supported by bootstrap proportion (96%). Similarly, in D2D3 tree
(right), the new species and S feltiae form a monophyletic group (91%).
References
Bedding, R.A. & Akhurst, R.J. 1975: A simple technique for the detection of insect parasitic
nematodes in soil. Nematologica 21: 109-110.
Poinar G.O. Jr., 1975: Entomogenous nematodes. E.J. Brill, Leiden, The Netherlands, 317 pp.
Triggiani, O, Mrácek, Z. & Reid, A. 2004: Steinernema apuliae n.sp. (Rhabditida: Steinernematidae): a new entomopathogenic nematode from southern Italy. Zootaxa 460: 1-12.
Nguyen, K.B., Stuart, R., Andalo, V., Gozel, U., Rogers, M.E. 2007: Steinernema texanum n.
sp. (Rhabditida: Steinernematidae), a new entomopathogenic nematode from Texas, USA
Nematology 9: 379-396.
pp. 267-268
First record of entomopathogenic nematodes in Slovenia and
perspectives of their use
Žiga Laznik1, Tímea Tóth2, Tamás Lakatos2, Stanislav Trdan1
1
University of Ljubljana, Biotechnical Faculty, Department of Agronomy, Chair of
Entomology and Phytopathology, Jamnikarjeva 101, SI-1111 Ljubljana, Slovenia; 2 Research
and Extension Centre for Fruit growing, Vadastag 2, 4244 Ujfeherto, Hungary
Abstract: Steinernema affine was recorded from an arable field, located near the village Staro selo,
which had been cultured with cabbage the year prior to isolation of the strain. Future work can now
test this nematode in outdorr field experiments against major cabbage pest insects. Cole crops are of
major importance for Slovenian agriculture.
Key words: entomopathogenic nematodes, Slovenia, Steinernema affine, cole crops
Introduction
In Slovenia research on entomopathogenic nematodes (EPN) started in 2004. Because in
Slovenia EPNs still had a status of exotic agents, all earlier research was limited to laboratory
experiments. We tested the efficacy of nematodes to control the Colorado Potato Beetle
(Leptinotarsa decemlineata [Say]), the Greenhouse Whitefly (Trialeurodes vaporariorum
[Westwood]), Western Flower Thrips (Frankliniella occidentalis [Pergande]) (Perme, 2005),
the Sawtoothed Grain Beetle (Oryzaephilus surinamensis [L.]) and the Granary Weevil
(Sitophilus granarius [L.]) (Trdan et al., 2006) and flea beetles (Phyllotreta spp.) (Laznik,
2006). The results confirmed already known facts that EPN, providing optimal conditions are
realized, are very efficient biological control agents (Laznik & Trdan, 2007a,b).
In October 2006, 77 soil samples were collected and the presence of EPN detected using the
Galleria baiting method. The nematode isolate from one sample, strain A12, which was taken
near by village Staro selo at Kobarid (NW Slovenia, 46°14'N, 13°34'E, 234 m high) from a
field that had been planted with cabbage in the previous year, was sent to the laboratory of the
Biological Research Centre in Szeged, Hungary for molecular analysis. Genomic DNA was
extracted from individual nematodes and PCR was performed to multiply the ITS1 region
using primers TW81 and AB28 (Hominick et al., 1997). PCR products were reisolated from
1% TAE-buffered agarose gel using a Gel Extraction Kit (Omega Bio-Tek, USA). Reisolated
sample was sequenced. The sample sequence was blasted against other steinernematide
sequences.
EPNs were found in 32,5 % of all samples. The BLAST analysis revealed a sequence
producing significant alignments with Steinernema affine Bovien 1937: GenBank Accession
No. AF331912 and AY230159. Its potential for biological control was confirmed only
267
268
recently (Willmott et al., 2002). S. affine has been recorded from agricultural soil (Sturhan,
1996) all over Europe. Future studies can now test the control potential of this nematode in
field trials against cabbage pests, like the maggot (Delia radicum [L.]) (Willmott et al., 2002),
flea beetles, cabbage bug and the swede midge. As the majority of arable fields in Slovenia
are planted with cole crops (24.1% or 871 ha) (Statistical office of the Republic of Slovenia,
2005), the isolation and identification of this nematode is of major importance for our
country.
Acknowledgements
This work was funded by the Slovenian Ministry of Higher Education, Science & Technology
and the Slovenian Ministry of Agriculture, Forestry and Food. (Horticulture No P4-00130481 and L4-6477-0481-04).
References
Hominick, W.M., Briscoe, B.R., del Pino, F.G., Heng, J., Hunt, D.J., Kozodoy, E., Mracek,
Z., Nguyen, K.B., Reid, A.P., Spiridonov, S., Stock, P., Sturhan, D., Waturu, C. and
Yoshida, M. 1997: Biosystematics of entomopathogenic nematodes: current status, protocols and definitions. J. Helminthol. 71: 271-298.
Laznik, Ž. 2006: Research on efficacy of four entomopathogenic nematode species (Rhabditida) against adults of flea beetles (Phyllotreta spp., Coleoptera, Chrysomelidae) under
laboratory conditions. Graduation thesis, Univ. Ljubljana, Biotech. Fac., Depart. Agronomy: 75 pp.
Laznik, Ž. & Trdan, S. 2007a: Entomopathogenic nematodes, natural enemies of foliar pests
of brassica crops. Acta agricult. Slov. (in press) [Slovenian].
Laznik, Ž. & Trdan, S. 2007b: Entomopathogenic and entomophilic nematodes – natural
enemies of thrips (Thysanoptera). Acta agricul. Slov. (in press) [Slovenian].
Perme, S. 2005: Testing the efficacy of entomopathogenic nematodes (Rhabditida) against
foliar pests of vegetables. M.Sc. Thesis, Univ.Ljubljana, Biotech. Fac., Depart. Agronomy: 89 pp.
Statistical office of the Republic of Slovenia. 2005. (12.1.2007) http://www.stat.si
Sturhan, D. 1996: Seasonal occurrence, horizontal and vertical dispersal of entomopathogenic
nematodes in a field. Mitteilungen aus der BBA für Land und Forstwirtschaft 317: 35-45.
Trdan, S., Vidrih M., Valič N. 2006: Activity of four entomopathogenic nematode species
against young adults of Sitophilus granarius (Coleoptera: Curculionidae) and Oryzaephilus surinamensis (Coleoptera: Silvanidae) under laboratory conditions. J. Plant Dis.
Prot. 113: 168-173.
Willmott, D.M., Hart, A.J., Long, S.J., Richardson, P.N. and Chandler, D. 2002: Susceptibility of cabbage root fly Delia radicum, in potted cauliflower (Brassica oleracea var.
botrytis) to isolates of entomopathogenic nematodes (Steinernema and Heterorhabditis
spp.) indigenous to the UK. Nematology 4: 965-970.
p. 269
Entomopathogenic nematodes from biological agriculture and
identification of their symbiotic bacteria
Nicolas Pionnier1, Sylvie Pagès1, Emmanuelle Filleron2, Sara Pinczon Du Sel2,
Jérome Lambion3, Lionel Romet3, Patrick Tailliez1
1
UMR Ecologie Microbienne des Insectes et Interactions hôte-Pathogène, Institut National
de la Recherche Agronomique & Université Montpellier II, Place E. Bataillon, 34095
Montpellier Cedex 05 ; 2 Domaine Expérimental La Tapy, 1881, Chemin des Galères, 84200
Carpentras-Serres ; 3 Groupe de Recherche en Agriculture Biologique, Maison de la Bio,
BP1222, 84911 Avignon Cedex
Abstract: With the objective to control insect pests of cherry and apple tree orchards (fruit fly –
codling moth) and of vegetables (Coleoptera, Agriotes lineatus) in organic farming, we investigated
the presence of EPN in soil samples from cherry and apple orchards and from tomatoes greenhouses in
the region of Avignon (France) between September and November 2006. Three sites were selected
within each habitat and 5 soil samples were collected at each site. Each soil sample was taken at a
depth of 10-20 cm in a surface of 20 m2. EPN were recovered from soil samples by insect baiting
technique using Galleria mellonella larvae. Symbiotic bacterial isolates were obtained from the
infective-stage juveniles using the hanging-drop technique. The bacterial isolates were examined for
the main phenotypic characteristics of the genera Photorhabdus and Xenorhabdus, using the methods
of Boemare & Akhurst (1988). The almost-complete 16S rRNA gene sequence of each isolates was
obtained as previously described (Tailliez & al., 2006) and compared to the sequences available in the
GenBank database (www.ncbi.nlm.nih.gov). Four isolates of P. luminescens subsp. laumondii were
found in vegetable soil samples (from organic farming). Two isolates of P. luminescens subsp.
laumondii and one isolate of P. luminescens subsp. kayaii were found in the organic cherry orchard,
whereas only one isolate of P. luminescens subsp. thracensis was found in the conventional cherry
orchard. One isolate of X. nematophila was found in the apple orchard. The nematode strains will be
identified more precisely using the 28S rRNA gene and ITS sequences as described by Stock & al.,
(2001). Presence of entomopathogenic nematodes in soils managed in organic farming and in
integrated production opens perspectives for ecological studies as well as potential use of these natural
auxiliaries in biological control.
Key words: entomopathogenic nematode, entomopathogenic bacteria, biological agriculture, orchard.
References
Boemare, N.E., Akhurst, R.J. 1988: Biochemical and physiological characterization of colony
form variants in Xenorhabdus spp. (Enterobacteriaceae). J. Gen. Microbiol. 134: 751-761.
Stock, S.P., Campbell, J.F., Nadler, S.A. 2001: Phylogeny of Steinernema Travassos, 1927
(Cephalobina: Steinernematidae) inferred from ribosomal DNA sequences and morphological characters. J. Parasitol. 87: 877-889.
Tailliez, P., Pagès, S., Ginibre, N., Boemare, N. 2006: New insight into diversity in the genus
Xenorhabdus, including the description of ten new species. Int. J. Syst. Evol. Microbiol.
56: 2805-2818.
269
p. 270
Association of Phasmarhabditis species with terrestrial molluscs
Jenna Ross1, Graeme Nicol1 , Sergei Spiridonov2, Elena Ivanova2, Solveig Haukeland3,
Michael Wilson1
1
School of Biological Sciences, University of Aberdeen, UK; 2Institute of Parasitology,
Russian Academy of Sciences, Moscow, Russia; 3Bioforsk, Norwegian Institute for
Agricultural and Environmental Research, Norway
Abstract: We conducted a survey of nematodes parasitizing terrestrial molluscs in England and
Scotland in order to gather new data regarding host range and distribution of Phasmarhabditis spp.
Out of 30 sites examined, three sites had slugs parasitized by Phasmarhabditis neopapillosa and four
sites had slugs parasitized by Phasmarhabditis hermaphrodita. P. neopapillosa was found in four
species of slugs (Deroceras reticulatum, D. panormitanum, Arion ater and A. distinctus) whereas P.
hermaphrodita was only found in D. reticulatum and A. ater. To examine inter- and intra-species
genetic variability, complete sequences of the Internal Transcribed Spacer 1 (ITS1), 5.8S and ITS2
regions were amplified and sequenced from thirteen P. hermaphrodita isolates and six P. neopapillosa
isolates. Five Norwegian P. hermaphrodita isolates were also obtained and sequenced simultaneously.
Results showed that P. hermaphrodita and P. neopapillosa differed over the ITS1, 5.8S and ITS2
regions with 86.4%, 85.3% and 90.4% identity. However, geographically distinct isolates of each
species were found to be identical over the ITS1, 5.8S and ITS2 regions, indicating a low level of
diversity.
Key words: Phasmarhabditis species, terrestrial Molluscs, biological control.
References
Grewal, S.K., Grewal, P.S. & Hammond, R.B. 2003: Susceptibility of North American native
and non-native slugs (Mollusca: Gastropoda) to Phasmarhabditis hermaphrodita
(Nematoda: Rhabditidae). Bioc. Sci. Technol. 13: 119-125.
Iglesias, J. & Speiser, B. 2001: Consumption rate and susceptibility to parasitic nematodes
and chemical molluscicides of the pest slugs Arion hortensis s.s. and A. distinctus. J. Pest
Sci. 74:159-166.
Speiser, B., Zaller, J.G. & Newdecker, A. 2001: Size-specific susceptibility of the pest slugs
Deroceras reticulatum and Arion lusitanicus to the nematode biocontrol agent
Phasmarhabditis hermaphrodita. BioControl 46: 311-320
Wilson, M.J., Glen, D.M. & George, S.K. 1993: The rhadbitid nematode Phasmarhabditis
hermaphrodita as a potential biological control agent for slugs. Bioc. Sci. Technol. 3:
503-511.
270
pp. 271-276
Synergistic interaction between Steinernema feltiae and Paecilomyces
fumosoroseus?
Melita Zec-Vojinovic
Laboratory of Applied Zoology, University of Helsinki, Box 27, FIN-00014, Helsinki, Finland
Abstract: The fungus Paecilomyces fumosoroseus was isolated from the control plots in our
experiments with Steinernema feltiae in an oilseed rape field (OSR), where it showed similar potential
as S. feltiae in the control of OSR pests. The study focused on determining the susceptibility of
Meligethes aeneus larvae to P. fumosoroseus, the compatibility of P. fumosoroseus and S. feltiae, and
determining the kind of interactions between them. Field collected M. aeneus larvae were exposed to
commercially produced S. feltiae, indigenous P. fumosoroseus and the simultaneous combination of
these two. In the first experiment, M. aeneus larvae were placed into Petri dishes filled with sand,
while in the second experiment larvae were placed into Petri dishes containing OSR flowers. In the
flower medium P. fumosoroseus, S. feltiae and their combination significantly affected mortality of M.
aeneus. In the combined treatment, mortality started to occur already on the first day when it reached
maximum, and showed synergistic effect. Cumulative mortality of the combined treatment was
significantly different on first, second and forth day than with either agent alone. In the sand medium,
P. fumosoroseus, S. feltiae and their combination significantly affected mortality of M. aeneus larvae.
S. feltiae-P. fumosoroseus combination had an additive effect on the third and fourth day. Cumulative
mortality of the S. feltiae-P. fumosoroseus combination was significantly different on the fourth and
fifth day than with either agent alone. The study showed that combination increases the speed of kill in
both media.
Key words: S. feltiae, P. fumosoroseus, Meligethes aeneus, synergism, oilseed rape
Introduction
Nematodes can be highly effective in controlling pest insects in many cropping systems
(Grewal et al. 2005). Investigation of Steinernema feltiae efficacy on pollen beetle and flea
beetles in oilseed rape (OSR) has been conducted for several years in Finland, and showed
excellent potential when applied even in low doses onto the soil at the right time, but in some
years it also yielded disappointing results. The fungus Paecilomyces fumosoroseus is an insect
pathogen that is being developed as a biological control agent for various soft-bodied insects
(Hernandez-Torres et al. 2004). Naturally occurring P. fumosoroseus was isolated from the S.
feltiae treated and untreated plots in our experiments in an OSR filed, where it showed similar
potential in untreated plots as S. feltiae in the treated plots. In the laboratory, the fungus
exhibited a high speed of killing the bait larvae, as well as rapid growth on cadavers. When
applied together, two biocontrol agents might act independently of each other in a given host
(additive effect). However, their combination might also be more (synergistic effect) or less
(antagonistic effect) effective than simply having an additive effect (Jaques and Morris,
1981). As the timing of S. feltiae application appeared to play a crucial role along with the
dose, and the impact of some biotic factors, this study focused on determining the
susceptibility of Meligethes aeneus larvae to P. fumosoroseus, the compatibility of P. fumosoroseus and S. feltiae, on determining the type of interactions when both agents are combined,
and on studying the possibility to increase the speed of kill of the target pest.
271
272
Insects, nematodes and the fungus
Field collected OSR flowers with M. aeneus larvae were placed onto the filter paper in cold
room at +4 and L2 larvae were collected from the paper after 4 hours. Commercially
produced S. feltiae was obtained from the E-nema company, Germany, and formulated in
NemaLife™ gel until use. The species was chosen because it showed excellent potential in M.
aeneus control under the field conditions. S. feltiae was used at dose of 0.5M/square meter.
The fungus P. fumosoroseus was isolated by the ‘Galleria bait method’ (Zimmermann 1986)
from an OSR filed in Finland. The conidia were harvested aseptically and placed into
sterilized distilled water containning 0.2% of the wetting agent Tween 80 and used for mass
production on agar gel. Harvested conidia were diluted to the concentration of 1 x 10[6]
conidia/ml and used in the experiments.
Laboratory experiments
In the first experiment, Petri dishes were filled with sand, in which M. aeneus larvae were
exposed to S. feltiae, P. fumosoroseus, and the combination of these two. Sand medium was
used to obtain information on what could occur under the field and/or green house conditions
in the soil. In the second experiment, OSR flowers were placed in Petri dishes on filter paper,
where M. aeneus larvae were exposed to S. feltiae, P. fumosoroseus, and the combination of
these two. This experiment delivered information on what could occur under the field and/or
green house conditions in a flower application. Flower medium was used because previous
studies with M. aeneus adults showed that pollen formed glue like mass with nematodes,
disabling the beetles to escape from the nematodes, rapidly losing their fitness and enabling
easier nematodes’ penetration. In the control treatment, only larvae were added in both flower
and sand medium. All treatments were replicated 4 times with 20 M. aeneus larvae per
replicate. Experiments were conducted at room temperature and humidity was adjusted with
tap water except for treatments with P. fumosoroseus, where the media were moistened with
the fungal suspension. Larval mortality was assessed daily for four and six days in flower and
sand medium respectively, until all treated larvae were dead. In the combined application,
nematodes and the fungus were applied on the same day. Microscopic observation of M.
aeneus larvae, during the first day, lasted for three hours in order to record the behaviour of
the larvae in the two different media.
Statistics
Before analysis, all mortality data were corrected for control mortality (Abbott 1925). In
experiments we determined the type of interaction (synergistic, additive, or antagonistic), if
any, between S. feltiae and P. fumosoroseus (Pf) using a procedure originally described by
Finney (1964), and modified by Mc Vay et al. (1977). The expected additive proportional
mortality ME for nematode-Pf combinations was calculated by ME=MN+MPf(1−MN), where
MN and MPf are the observed proportional mortalities caused by nematodes and Pf alone,
respectively. Results from a χ2 test, χ2=(MNPf−ME)2/ME, where MNPf is the observed mortality
for the nematode-Pf combination, were compared to the χ2 table value for 1 degree of
freedom. If the calculated χ2 values exceeded the table value, there would be reason to suspect
a non-additive effect, i.e., synergistic or antagonistic, between the two agents (Finney, 1964).
If the differences MNPf−ME=D had a positive value, a significant interaction was then
considered synergistic, and if D had a negative value, a significant interaction was considered
antagonistic. The percentages of larval mortality for each treatment were analyzed using
ANOVA, means were separated with Tukey’s test (SPSS 13.0). Mortality was considered
significantly different at P< 0.05.
273
Flower medium
Microscopic observation indicated that pollen formed glue like mass with the nematodes and
the fungus. Glue like mass sticks to the larval body disabling them to escape nematodes and
rapidly, within 2 h, lose their fitness. P. fumosoroseus, S. feltiae and their combination significantly affected mortality after the simultaneous application on M. aeneus larvae (F= 10,
P< 0.001, df=3). Cumulative mortality in the S. feltiae-Pf combination treatment was significantly different on the first, second and forth day from either agent alone. Nematode treatment
caused significantly higher mortality than fungal treatment on the second and sixth day. The
interaction between S. feltiae and P. fumosoroseus was synergistic on the first day (χ2= 2.76,
p= 0.1, D=59). (Figure 1).
Cumulative Mortality of M. aeneus (%)
b
100
c
b b
c
a
Mean Mortality (%)
80
Treatment
P. fumosoroseus
S. feltiae
Combination
Control
b
a
a
a
60
d
40
c
c
b
20
a
a
0
1
*
2
3
4
Day
Figure 1. Mean cumulative percentage mortality of Meligethes aeneus larvae caused by P.
fumosoroseus, S. feltiae and their combination in the flower medium. Significant synergistic
interaction is indicated by *.
In the fungal treatment, larval mortality started to occur on the second day when it
already reached its maximum. In the nematode treatment, larval mortality occurred on the first
day and reached maximum on the second day. In the combined treatment, the mortality
started on the first day when it reached its maximum, while in the control treatment mortality
occurred on the second day with highest mortality on the fourth. (Table 1)
Sand medium
In the sand medium S. feltiae was more at the top of the Petri dishes during first two days.
Next days nematodes tended to go downwards. M. aeneus larvae moved across the Petri
dishes, very few were at the bottom. Last days, fifth and sixth day, the larvae preferred to stay
in upper level (unlike nematodes). Larvae could easily skip nematodes among sand particles
274
unlike when applied onto flowers. P. fumosoroseus, S. feltiae and their combination
significantly affected mortality after the simultaneous application on M. aeneus larvae (F=
38.28, P< 0.001, df=5). Larval mortality in the fungus and nematodes alone treatment
occurred on the third day and reached its maximum on sixth day. In the combined application
mortality occurred on the third day and reached the maximum on fourth day. (Table 2)
Table 1. Mean percentage corrected mortality of Meligethes aeneus larvae by day caused by
agents in the flower medium.
Day
P. fumosoroseus S. feltiae P.f + S.f Control
First
0
13
71
0
Second
52
61
20
15
Third
9
19
0
1
Fourth
0
0
0
18
Table 2. Mean percentage corrected mortality of Meligethes aeneus larvae by day caused by
agents in the sand medium.
Day
P. fumosoroseus S. feltiae P.f + S.f Control
First
0
0
0
0
Second
0
0
0
0
Third
21
1
31
0
Fourth
13
27
49
18
Fifth
0
0
1
0
Sixth
28
48
8
1
Cumulative Mortality of M. aeneus (%)
100
b
P.fumosoroseus
S. feltiae
Combination
Control
a
80
Mean Mortality (%)
Treatment
b
ab
b
60
a
a
a
a
a
40
a
c
a
a
20
b
b
0
1
2
3
*
4
*
5
6
Day
Figure 2. Mean cumulative mortality of Meligethes aeneus caused by P. fumosoroseus, S. feltiae and their combination in sand medium. Significant additive interaction is indicated by *.
275
Cumulative mortality of the combined treatment was significantly different on the fourth
and fifth day than either agent alone. Fungus treatment was significantly higher than
nematode treatment on the first day, but no significant differences were detected between
them on other days. The interaction between the nematodes and the fungus had either no or an
additive affect. Additive effect occurred on the third day (χ2= 0.04 p= 0.05) and on the fourth
day (χ2= 0.05 p= 0.05). No such effects were detected on days five and six. (Figure 2). On the
final days, larval mortality was 100% in all treatments in both media, which is not evident
from the results because all mortality data were corrected for control mortality.
Despite numerous advantages of biological control, one of the important disadvantages is
their slow speed of kill. The study showed that combining P. fumosoroseus and S. feltiae it is
possible to achieve faster speed of kill and initially higher mortality level in both media. In the
flower medium, there are significant differences between the S. feltiae-Pf combination on all
days except on the third day, and additionally synergistic effect on the first day. Moreover, in
the flower medium, the agent that increases S. feltiae, P. fumosoroseus and their combination
speed of kill and efficacy is the pollen that creates the glue like mass that enables nematodes
and the fungus to stick to the larval body. That feature, together with the synergistic reaction
on the first day, may not be significant for the control of OSR pests, but such a potential could
possibly be important in other systems. In the sand medium, the difference in mortality of M.
aeneus is not significantly different between S. feltiae and the S. feltiae-Pf combination
treatment on day six, but it is on the third, forth and fifth day when they had an additive
effect. That would suggest that in case when speed of kill in certain systems would be
priority, the combination could be a more effective solution, while when the speed of kill is
not of significant importance, there would be no advantages to use the S. feltiae-Pf
combination. The advantage of using P. fumosoroseus instead of other fungi is its fast speed
of kill and rapid development, which is usually not characteristic of other fungi and thus the
fungus could be applied simultaneously with nematodes.
Many researches have suggested that a fungus acts as a stressor to the insect pest and
makes it more suitable for nematodes to penetrate. However, in this study we cannot claim
which agent acts as a stressor and which causes the death, because microscopic observation
indicated that larvae lose their fitness also in the nematode treatment alone and after the larval
dissection only in some larvae one to two nematodes were recovered (data not shown).
Because the synergistic effect occurred at p= 0.1 critical level, more studies are needed to
improve the synergism and reach the upper critical level of p= 0.05.
Acknowledgements
I thank Prof. Heikki M. T. Hokkanen for his help, advices, constructive criticism and supervision
References
Abbott, W.S., 1925: A method for computing the effectiveness of an insecticide. J. Econ.
Entomol. 18: 265-267.
Altre, J. & Vandenberg, J. 2001: Penetration of cuticle and proliferation in hemolymph by
Paecilomyces fumosoroseus isolates that differ in virulence against Lepidopteran larvae.
J. Invertebr. Pathol. 78: 81-86.
Ansari, M., Moens, M. & Tirry, L. 2004: Interaction between Metarhizium anisopliae clo 53
and entomopathogenic nematodes for the control of Hoplia philanthus. Biol.Contr. 31:
172-180.
276
Barbercheck, M.E. & Kaya, H.K. 1990: Interaction between Beauveria bassiana and the
entomopathogenic nematodes Steinernema feltiae and Heterorhabditis heliothidis. J.
Finney, D.J. 1964: Probit Analysis. Cambridge Univ. Press, London.
Hokkanen, H.M.T.; Menzler-Hokkanen, I. & Butt, T.M. (2003): Pathogens of oilseed rape
pests. In: Biocontrol of Oilseed Rape Pests, ed. D.V. Alford. Blackwell Science, Oxford:
299-322.
James, R.R. 2003: Combining Azadirachtin and Paecilomyces fumosoroseus (Deuteromycotina: Hyphomycetes) to Control Bemisia argentifolii (Homoptera: Aleyrodidae) J. Econ.
Entomol. 96: 25-30.
Koppenhöfer, A.M. & Kaya, H.K. 1997: Additive and synergistic interaction between
entomopathogenic nematodes and Bacillus thuringiensis for scarab grub control. Biol.
Control 8: 131-137.
Lacey, L.A., Frutos, R., Kaya, H.K. & Vail, P. 2001: Insect pathogens as biological control
agents: do they have a future? Biol. Control 21: 230-248.
McVay, J.R., Gudauskas, R.T. & Harper, J.D. 1977: Effects of Bacillus thuringiensis nuclearpolyhedrosis virus mixtures on Trichoplusia ni larvae. J. Invertebr. Pathol. 29: 367-372.
Michalaki, M.P., Athanassiou, C.G., Steenberg, T. & Buchelos, C.Th. 2007: Effect of
Paecilomyces fumosoroseus (Wise) Brown and Smith (Ascomycota: Hypocreales) alone
or in combination with diatomaceous earth against Tribolium confusum Jacquelin du Val
(Coleoptera: Tenebrionidae) and Ephestia kuehniella Zeller (Lepidoptera: Pyralidae).
Biol.Control 40: 280-286.
Zec-Vojinovic, M; Menzler-Hokkanen, I. & Hokkanen, H.M.T. 2006: Application strategies
for entomopathogenic nematodes in the control of oilseed rape pests. Proc. Int. Symp.
‘Integrated Pest Management of Oilseed Rape Pests’, Göttingen, Germany, 3-5 April
2006.
p. 277
Scavenging behaviour in some entomopathogenic nematode species
Ernesto San-Blas, Simon R. Gowen
The University of Reading, Reading, UK
Abstract: Entomopathogenic nematodes cannot be considered only as parasitic organisms. With dead
Galleria mellonella larvae we demonstrated that these nematodes can use scavenging as an alternative
survival strategy. Steinernema glaseri, S. feltiae, S. affine and Heterorhabditis indica scavenged but
there were differences among them in terms of frequency of colonization and in the time after the
death of G. mellonella larvae that cadavers were penetrated. All species tested complete their life
cycles and produce progeny. The extremes of this behaviour were represented by Steinernema glaseri
which was able to colonize cadavers which had been freeze-killed 10 days before whereas
Heterorhabditis indica only colonized cadavers which had been killed for up to 3 days before. Also,
using an olfactometer, we demonstrated that entomopathogenic nematodes were attracted to G.
mellonella cadavers.
Keywords: Scavenging, cadaver, Galleria mellonella, surviving.
277
p. 278
Phoresy in entomopathogenic nematodes - a mode of dispersal?
Laura M Kruitbos1, Stuart Heritage2, Mike J Wilson1
1
School of Biological Sciences, University of Aberdeen, United Kingdom. AB24 3UU;
2
Forest Research, Roslin, Midlothian, United Kingdom. EH25 9SY
Abstract: This study investigated whether entomopathogenic nematodes are capable of using the large
pine weevil, Hylobius abietis as a vector for phoretic dispersal. The bioassays tested whether H.
abietis promoted dispersal of Steinernema carpocapsae and Heterorhabditis megidis between two
connected terraria filled with sand and whether transported nematodes were able to infect a host, G.
mellonella. The two terraria were connected by an 18 cm polystyrene tube, where 30,000 nematodes
and 5 H. abietis were placed into Site A and 5 G. mellonella were placed into Site B. After 7 days,
100% of G. mellonella were found to be infected with S. carpocapsae and 78% for H. megidis in the
presence of H. abietis. In the absence of H. abietis no G.mellonella were found to be infected for both
species.
Further, the number of phoretics present on H. abietis were found to be significantly higher for S.
carpocapsae than H. megidis (p≤0.05) and the mean number of phoretic nematodes recovered on H.
abietis greatly differed in the two media tested (sand and peat). Thus, we show H. abietis could be a
source of facultative phoretic dispersal for nematodes, and they must be capable of leaving H. abietis
and infecting new hosts.
Key words: entomopathogenic nematodes, Hylobius abietis, Steinernema carpocapsae, Heterorhabditis megidis.
References
Eng, M.S., Preisser, E.L. & Strong, D.R. 2005. Phoresy of the entomopathogenic nematode
Heterorhabditis marelatus by a non-host organism, the isopod Porcellio scaber. Journal
of Invertebrate Pathology 88: 173-176.
Krantz, G.W. & Poinar, Jr, G.O. Mites, nematodes and the multimillion dollar weevil. Journal
of Natural History 38: 135-141.
Lacey, L.A., Kaya, H.K. & Bettencourt, R. 1995. Dispersal of Steinernema glaseri (Nematoda: Steinernematidae) in adult Japanese beetles, Popillia japonica (Coleoptera: Scarabaeidae). Biocontrol Science and Technology 5: 121-130.
278
p. 279
Effects of in host desiccation stress on development and infectivity of
Steinernema websteri
David Easterhoff, Amanda Marion, Rebecca Reinke, Susan Bornstein-Forst
Marian College, 45 S. National Ave, Fond du Lac; Wisconsin WI 54935, USA
Abstract: This study investigates the effect of in host desiccation on entomopathogenic nematode
(EPN) development and infectivity. Galleria mellonella hosts infected with the EPN Steinernema
websteri A10 were allowed to air-desiccate in an environmental chamber set at 230C for up to 31 days
post-infection (DPI) resulting in a host weight loss of approximately 64%. Host carcasses were rehydrated using nonsterile reverse-osmosis (RO) water and placed on 9 mm Whatman filter paper in
White traps to collect emergent infective juvenile populations (IJ). Populations were pooled over a
three-day time period for time points on days 10, 17, 24, and 31 DPI, respectively. IJ were counted
with an apparent peak of approximately 70,000 IJ/host cadavers coinciding with desiccated hosts
rehydrated between 17-24 DPI. Desiccation-stressed IJ populations from each time interval were
compared with fully hydrated control populations for infectivity using a number of bioassays
including lethal time for mortality (LT50), lethal dose for mortality (LD50), number of IJ/cadaver, and
sine wave movement. Significant differences (α<0.5) were observed for all conditions tested
compared with controls. This study has implications for increased infectivity of EPN in field
applications.
Key words: entomopathogenic nematode, Steinernema websteri, infectivity, dauer larvae, desiccation,
stress response
References
Serwe-Rodriguez, J., Appleman, B., Bornstein-Forst, S.M. 2004: Effects of in host
desiccation on development, survival, and infectivity of entomopathogenic nematode
Steinernema carpocapsae. J. Inv. Pathol. 85: 175-181.
Bornstein-Forst, S.M., Kiger, H. and Rector, A. 2005: Impacts of fluctuating temperature on
the development and infectivity of entomopathogenic nematode Steinernema carpocapsae
A10. J. Inv. Pathol. 88: 147-153.
279
p. 280
An autochthonous strain of Steinernema feltiae against Mediterranean
flatheaded rootborer, Capnodis tenebrionis (Coleoptera, Buprestidae):
Field experiments
A. Morton, F. Garcia del Pino
Departamento de Biología Animal, Vegetal y Ecología, Facultad de Biociencias, Universidad
Autónoma de Barcelona, Bellaterra, 08193 Barcelona, Spain
Abstract: The Mediterranean flatheaded rootborer, Capnodis tenebrionis (L.) (Coleoptera: Buprestidae), is an economically important pest of cultivated stone fruit and seed fruit in Mediterranean areas.
Field trials were conducted in a cherry tree orchard in Ullastrell, Barcelona (Spain) to evaluate the
potential of the entomopathogenic nematode S. feltiae (strain Bpa), isolated from a dead C. tenebrionis
larva. Two experiments with different nematode concentrations were applied. Trees in the first experiment received nematodes at the rate of 1 million infective juveniles per tree every week during 4
weeks, with a total dose of 4 x 10 million IJs/tree. In the second experiment, trees received a total dose
of 8 x 10 million IJs/tree (1 million IJs/tree per week). Two different application methods -watering
and injection- were used in each experiment. Number, stage and localization of insects in each tree
trunk were recorded. Persistence of nematodes was recorded until 45 days after applying treatments. In
both experiments, S. feltiae (Bpa) significantly reduced the population of C. tenebrionis relative to the
control, providing an efficacy of 95 % and 96 % for experiment 1 and experiment 2, respectively.
Comparison of injection and watering nematode applications in each trial resulted in no significant
differences in the reduction of C. tenebrionis. S. feltiae (Bpa) may be a promising biological control
agent against C. tenebrionis.
Key words: biological Control, entomopathogenic nematodos, Steinermematidae, Capnodis
tenebrionis
280
pp. 281-286
Entomopathogenic nematodes to control codling moth: efficacy
assessment under laboratory and field conditions
Sandrine Mouton, Delphine Juan, Philippe Coulomb
S.A.R.L. ENIGMA, Hameau de St. Véran, 84190 Beaumes de Venise, France
Abstract: Strategies to reduce codling moth populations in organic orchards may become inefficient
in the close future as resistance has recently been observed against the granulosis virus, the major
control strategy in organic farmering. Entomopathogenic nematodes (EPN) have shown interesting
results as biological control agents and could be a way to reduce codling moth populations. The
efficacy of two EPN species (Steinernema feltiae and Steinernema carpocapsae) was evaluated using
different exposure methods, against various life stages of the codling moth under laboratory and field
conditions. Nematodes can reach the fifth instar diapausing larvae in the ground within their cryptic
habitats which currently provide them protection from extreme environmental conditions. The
susceptibility of fifth-instar codling moth larvae was assessed under laboratory conditions using
cocooned larvae within cardboard strips. The codling moth is significantly more susceptible to
S.carpocapsae than to S.feltiae. The LC90 values for S.feltiae and S.carpocapsae were 78.8 and 3.5
infective juveniles/cm², respectively. A field trial was also conducted in an apple orchard. EPN were
applied on the soil, against cocooned larvae within cardboard strips in the ground. A test on neonate
larvae was carried out to assess the potential efficacy of foliage spraying of nematodes, using two
different exposure substrates. Even with a short time exposure, first-instar larvae may be more
susceptible to nematodes than fifth instar diapausing larvae. Neonate larvae were exposed to EPN on
wheat germ-starch artificial diet, and on young apples soaked in nematode solutions under laboratory
conditions. The results will define the optimal conditions to use nematodes in codling moth control
strategies: target pest stages, nematode species and concentration.
Key words: entomopathogenic nematodes, Steinernema, codling moth, Cydia pomonella
Introduction
The potential of codling moth to develop resistance against biological and chemical
compounds has produced major difficulties to develop efficient control strategies. Intersting
results have been achieved in field and laboratory trials with S.carpocapsae and other species
against diapausing codling moth larvae in natural and artificial substrates (Lacey and Unruh,
1998; Unruh and Lacey, 2001; Lacey et al, 2006). To define the optimal conditions to use
nematodes in codling moth control strategies, further investigations were carried out. To
confirm the results obtained by other authors, the efficacy of S. carpocapsae and S. feltiae
was compared against first instar larvae under laboratory and field conditions.
Laboratory experiments
Codling moth eggs were incubated at 25°C to obtain first-instar larvae. Neonate larvae were
exposed to EPN on wheat germ-starch artificial diet. Small blocks of this substrate were
placed in cubic pill boxes (1.9 cm wide) with a perforated lid, covered with insect-proof net.
A replicate consisted of one pill box containing one first-instar larvae. 30 replicates were
made per treatment group. Nematode´s infective juveniles (IJ) were sprayed at 6 doses,
following a logarithmic regression and chosen following the results obtained in experiments
281
282
on fifth-instar larvae (1 - 5 – 8.9 – 15.8 – 28.1 - 50 IJ/cm²) (Lacey and Unruh, 1998).140 µL
of EPN suspensions were applied to each pill box. This volume of suspension moistened the
whole substrate without saturating it. After 48 h at 25°C mortality was assessed and compared
with a water treated control.
In a second experiment apples with an average diameter of 2-3 cm.were taken from an
unsprayed orchard These apples were soaked in nematode solutions at different concentrations (105 – 1.77x105 – 3.16x105 – 5.62x105 – 106 IJ/L) (Charmillot et al., 1994). The
concentrations were according to the results obtained in the experiments previously carried
out for foliar applications (Lacey et al, 2006). Treated apples were laid into polystyrol boxes.
One replicate consisted of one apple on which 2 neonate larvae were set. 30 replicates placed
in two polystyrol boxes were made for each treatment group. After 48h at 25°C mortality and
stinging success were assessed.
In order to record the dose-repsonse, the bioassay system consisted of a 46.8 cm² cardboard strip placed in polystyrol boxes (13x18x8 cm) with a perforated lid. A filter paper was
placed at the box bottom and moistened with 2 mL of tap water just before adding larvae.
Larvae used in trials were produced on wheat germ-starch artificial diet at the INRA
(Domaine du Magneraud, France). Nematodes were provided by E-Nema GmbH, Germany.
The replicate consisted of ten fifth instar placed in each cardboard strip to spin cocoons in the
cells of the cardboard over a 24h period at 25°C . Five replicates were done for each treatment
group. Suspensions of S. feltiae and S.carpocapsae were sprayed to the surface of each
cardboard, at the same doses as in the first-instar larvae trial (1 – 5 – 8.9 – 15.8 – 28.1 – 50
IJ/cm²). Suspensions of 2 ml per box were applied. After 48 h incubation at 25°C and 70%RH
the number of dead and living larvae were counted and compared to a water treated control.
Field experiment
The field trial was carried out in an organic apple orchard located in Bouches-du-Rhône,
France. Apple trees (Golden variety) were planted between 1976 and 1986. The distance
between rows was 4.80m, and 3m on the row. Elementary plots consisted of 3 trees (6x3m per
plot). Four elementary plots were sprayed for each treatment group. In each elementary plot, 4
cardboard strips were placed containing ten larvae bagged with insect-proof net. On the day of
the application, cardboard strips were placed in the ground (about 1cm deep) on both sides of
the row. EPN application was done on 1m wide on both sides of the row so that 12m² per plot
were treated. Two doses (105 and 5x105 IJ/m²) were sprayed on the ground in a spray volume
of 1,000 l/ha. Mortality was assessed on cardboard strips collected in the field 48 h later and
compared with a non-treated control. The highest dose under field conditions (5x105 IJ/m²) is
the same as the highest one used under laboratory conditions (50 IJ/cm²). For all trials,
mortality data were analysed, for each nematode species, using a one factor (doses) variance
analysis followed by a multiple mean comparison test of Newman-Keuls at the significance
threshold of 5%. Mortality data were corrected with Abbott’s formula.
Results
Dose response effect results on first and fifth instar larvae under laboratory conditions
Mortality data obtained in the dose response tests done on first and fifth instar larvae of codling moth were analysed using a probit analysis. The LC50 and LC90 are presented in Table 1.
Following the probit analysis results, S.carpocapsae is the most effective to control
codling moth at both tested stages. The RR90 values calculated indicates that first instar larvae
of codling moth are 89.2-fold more susceptible to S.carpocapsae than to S.feltiae and fifth
instar larvae are 22.6-fold more susceptible to S.carpocapsae than to S.feltiae.
283
Table 1. Probit analysis results (LD values and 95% range) of laboratory tests on first and
fifth instars of the of codling moth (NA = confidence interval non assessed)
Codling moth
target stage
Nematodes
species
# of
tested
moths
LD10
IJ/cm²
L1
(on artificial
diet)
S.carp.
180
0.066
S.fel.
180
7.35
L5
(in cardboard
strips)
S.carp.
265
0.0013
250
S.fel.
1.23
LD50
IJ/cm²
10.45
3.3 < LD < 32.4
1043.6
NA
0.068
0.00002 < LD <
0.38
9.86
6.9 < LD < 13.2
LD90
IJ/cm²
RR50
RR90
99.8
89.2
145.23
22.6
1660.78
148222.4
3.49
78.81
100
Percentage mortality
79,3 c
80
64,1 bc
60
40
20
S.carpocapsae
48,0 b
36,2 b
40,6 b
S.feltiae
33,2 b
7,7 a
6,7 a
1/cm²
5/cm²
10,9 a
17,2 a
control
26,9 a
12,2 a
7,1 a
0
8,9/cm²
15,8/cm²
28,1/cm²
50/cm²
water
Figure 1. Mortality of first instars after 48h exposure to EPN on wheat germ-starch diet.
Numbers followed by the same letter are not significantly different at the significance level of
5%.
Dose response effect of first-instars on wheat germ substrate
Mortality of first-instars from the lowest dose of S.carpocapsae was significantly higher than
the control mortality. However mortality of first-instar larvae obtained for all the tested doses
of S.feltiae was not significantly different from the one obtained in the control (Fig.1) A
moderate dosage mortality response was observed for S.carpocapsae (R²=0.65) and for
S.feltiae (R²=0.72).
Susceptibility of firstt-instar larvae on apple
A low effect of the apple soaking treatment was observed on first-instar larvae whatever the
concentration or the nematode species used. The highest mortality was observed soaking with
106 IJ/l (16.7% died before stinging + 20% after stinging). Whatever the concentration tested,
nematodes could not kill first-instars before they caused damages to the young apples. The
number of stings observed was not significantly different between treated and control apples
with both species at each concentration (Table 2).
284
Table 2. Percentage of first instars which succeed in stinging and penetrating the apple (%
sting success) and percentage of mortality (%M) (larvae died before and after penetrating the
apple)
Treatment groups
Water treated control
% sting success
65 ab
S.carpocapsae
% sting
M%
success
66.6 ab
15 ab
56.7 a
15 ab
70 b
25 ab
55 a
16.7 ab
53.3 a
36.7 b
Nematodes
concentrations IJ/L
105
1.77x105
3.16x105
5.62x105
106
94,9 c
100
100 c
97,8 c
79,6 b
95,5 c
M%
11.7 a
S.feltiae
% sting
M%
success
66.7 a
11.7 a
58.3 a
16.7 a
53.3 a
15 a
53.3 a
15 a
56.7 a
20 a
100 c
87,8 d
77,8 d
Percentage mortality
80
61,3 cd
60
44,9 bc
S.carpocapsae
41,4 bc
S.feltiae
control
40
18 ab
20
4,2 a
0
1/cm²
5/cm²
8,9/cm²
15,8/cm²
28,1/cm²
50/cm²
water
Figure 2. Mortality in fifth instar cocooned larvae within cardboard strips after 48h exposed to
EPN under laboratory conditions: Numbers followed by the same letter are not significantly
different at the significance level of 5%.
Susceptibility of fifth-instar larvae within cardboard strips under laboratory conditions
The mortality obtained on fifth-instar larvae of codling moth exposed to S.carpocapsae was
significantly higher than the one obtained in the control. High levels of mortality were
obtained even at the lowest dose tested (80% of mortality at 1 IJ/cm²).
The mortality obtained on fouth-instar larvae of codling moth exposed to S.feltiae was
significantly higher than the one obtained in the control from the dose of 5 IJ/cm², however
the mortality obtained only reached 45% (Fig.2). A strong dosage mortality response was
observed for S.feltiae (R²=0.95). No dose mortality response was observed for S.carpocapsae
(R²=0.5).
Field test results on fifth-instar larvae of codling moth
Under field conditions, the mortality of codling moth exposed to S.feltiae was significantly
lower than the one obtained with S.carpocapsae. For both species, no dose response effect
was observed (Table 3). Mortality obtained with S.feltiae application was not significantly
different from the one obtained in the non treated control. The efficacies calculated with
Henderson & Tilton’s formula are presented in Table 4.
285
Table 3. Percent mortality obtained with EPN field applications against fifth-instar larvae
within cardboard strips (4 replicates for each treatment). The mean mortality values followed
by the same letter are not significantly different at the significance level of 5%.
Nematodes doses
105 IJ/m²
5x105 IJ/m²
control
S.carpocapsae
S.feltiae
75.3 % b
31.1 % a
60.8 % b
25.7 % a
31.0 % a
Table 4. Henderson & Tilton’s efficacies obtained by EPN field applications against fifthinstars within cardboard strips.
Doses
105 IJ/m²
5x105 IJ/m²
S.carpocapsae
63.78%
44.41%
S.feltiae
2.87%
0.19%
Discussion
The codling moth is significantly more susceptible to S.carpocapsae than to S.feltiae, whatever the tested instar (first and fifth instar larvae) or the exposure method. S.carpocapsae has
demonstrated an interesting efficacy in both laboratory and field studies to control either first
or fifth-instar larvae of codling moth.
No data are published on the efficacy of EPN against first instars, however, it gives an
indication of a potential use to also control initial codling moth attacks on fruits. On artificial
diet, first instars were susceptible to S.carpocapsae. However, on soaked apples, nematodes
could not kill codling moth fast enough to avoid fruit damage. The highest concentration used
of S.carpocapsae could reduce initial attacks preventing 30% of exposed larvae from
completing their development. The difference of efficacy observed between both exposure
substrates (artificial diet and apples) can be explained by the survival ability of nematodes.
They could stay longer active and waiting for a potential host on the artificial diet, as it is a
moistened substrate. On apple´s waterproof skin, the nematode dessication is increased, which
directly influenced their host search and infectivity abilities. More laboratory and field tests
have to be carried out to verify that this method could be adapted to field conditions. Until
now the only products available in organic orchard to control this stage was the granulovirus.
These results could open new perspectives for the use of EPN in codling moth control
strategies.
On the fifth instar, S.carpocapsae already exhibited a high efficacy under several conditions (Lacey and Unruh, 1998). Under laboratory conditions, S.feltiae becomes as effective
as S.carpocapsae when the dose used is increased. These experiments point out a higher
specificity of S.carpocapsae to codling moth compared with S.feltiae. Under field conditions,
the efficacies were lower than under laboratory conditions. According to the LD50 and LD90
we should expect higher mortalities. The low dose applied (105 IJ/m²) should have killed
almost 50% of the insects with S.feltiae (LD50 in laboratory tests on L5: 0,98x105/m²) and
more than 90% with S.carpocapsae (LD90 in laboratory tests on L5: 0,35x105/m²). Laboratory
tests provide optimal environmental conditions, host contact is assured and no barriers to
infection exist. This could explain why higher concentrations are required in the field.
Anyway, the efficacy of S.feltiae in field tests was even lower than expected, compared
with S.carpocapsae and according to the literature (Lacey et al.,2006). One hypothesis is that
286
S.feltiae was more effective under cooler conditions (below 15°C) (Lacey et al., 2006) and
less effective under hot conditions (Kaya et al., 1984). Sprayed in February, S.feltiae caused
95% of codling moth prepupae and pupae mortality whereas in July the mortality decreased to
32%. Another field test will be carried out to check whether the differences observed were
related to potential difference of conservation of both tested nematode species during the test
duration.
EPN offer an interesting alternative to control codling moth in organic orchards. They
could be adapted in several strategies to control either first or fifth-instar larvae. Further
experiments will be needed to define the optimal conditions to adapt this method of control.
Acknowledgements
We thank E-Nema GmbH for supplying nematodes required to carry out these experiments.
References
Kaya, H.K, Joos, J.L, Falcon, L.A. & Berlowitz, A.1984: Suppression of the codling moth
(Lepidoptera: Olethreuditae) with the entomogenous nematode, Steinernema feltiae
(Rhabditida: Steinernematidae). J. Econ. Entomol. 77: 1240-1244.
Lacey, L. & Unruh, T.R.1998: Entomopathogenic nematodes for control of codling moth,
Cydia pomonella (Lepidoptera: Totricidae): effect of nematode species, concentration,
temperature and humidity. Biol. Control 13: 190-197.
Lacey, L., Arthurs, S.P., Unruh, T.R., Headrick, H. & Fritts, Jr. 2006: Entomopathogenic
nematodes for control of codling moth, Cydia pomonella (Lepidoptera: Totricidae) in
apple and pear orchards: effect of nematode species and seasonnal temperatures, adjuvants, application equipment and post-application irrigation. Biol. Control 37: 214-223.
Unruh, T.R. & Lacey, L. 2001: Control of codling moth, Cydia pomonella (Lepidoptera:
Totricidae) with Steinernema carpocapsae: effects of supplemental wetting and pupation
rate on infection site. Biol. Control 20: 48-56.
Charmillot, P.J., Pasquier, D., Alipaz, N.J. 1994: Le tébufénozide, un nouveau produit sélectif
de lutte contre le carpocapse Cydia pomonella L. et la tordeuse de la pelure Adoxophyes
orana F.v.R. Revue Suisse Vitic. Arboric. Hortic. 26: 123-129.
pp. 287-293
Effectiveness of entomopathogenic nematodes in the control of Cydia
pomonella overwintering larvae in Northern Italy
Alberto Reggiani1, Giovanna Curto2, Stefano Vergnani3, Stefano Caruso5 , Mauro
Boselli2
1
Centro Agricoltura Ambiente Giorgio Nicoli s.r.l., 40014 Crevalcore (Bologna), Italy; 2Plant
Protection Service, Regione Emilia-Romagna, 40128 Bologna, Italy; 3Centro Ricerche
Produzioni Vegetali, 47020 Diegaro di Cesena Italy; 4Intrachem Bio Italia S.p.A., Research &
Development, 47023 Cesena, Italy; 5Consorzio fitosanitario provinciale, 41100 Modena, Italy
Abstract: Research on the effectiveness of entomopathogenic nematodes (EPN) in the control of
codling moth (Cydia pomonella) overwintering larvae have been performed in some pear orchards of
Emilia-Romagna, Northern Italy. The evaluation of Steinernema carpocapsae and Steinernema feltiae
activity in the larval control was checked after EPN foliar applications. The treatments were applied
either in autumn (2004-2005) or in spring (2005-2006) before the codling moth pupation at optimal
temperature (>12-14 °C) and after or during a rainfall or an irrigation. EPNs were applied at doses of
1.3 x 109 IJ ha-1, 1.7 x 109 IJ ha-1, 2.5 x 109 IJ ha-1 and 1.25 x 109 IJ ha-1.The larval mortality was
assessed on sentinel larvae placed on band traps of corrugated cardboards tied to the trunks (autumnal
and spring trials) and indirectly on the eggs laid by the females of the first codling moth generation
(2006 spring trial).
Key words: codling moth, Cydia pomonella, biological control, Steinernema
Introduction
The codling moth (CM), Cydia pomonella, is a key pest in pear and apple orchards in the
Emilia-Romagna (Italy). It completes three generations per year and overwinters as mature
larva in shelters in the bark and in the soil beneath the trees. The last instars leave the fruit and
build a light cocoon in the shelter of the bark and near the soil for pupation. In autumn the last
generation spends all the winter as mature larvae in the cocoon. The aims of this research was
to verify the effectiveness of entomopathogenic nematodes (EPN) in orchards (Shapiro-Ilan et
al., 2005) with autumn and spring treatments against CM overwintering larvae.
2004 and 2005 plot trials
Trials were carried out in autumn 2004 and in spring 2005 in the province of Bologna (Po
Valley – Northern Italy), at Crevalcore (44°43’N, 11°09’E) in pear orchards (cv. Abate Fetel)
grown as irregular palmet. In both years, the plots were distributed according a randomized
block design, with 4 replications each of 4 trees; a few hours before applying commercial
products based on Steinernema carpocapsae and Steinernema feltiae, some sections of
corrugated cardboard (band traps), containing sentinel overwintering larvae of CM (C.
pomonella), were tied to the trunks at about 1 m height, 11 sentinel larvae per plant in 2004
and 10 sentinel larvae per plant in 2005.
On October 7, 2004 and March 25, 2005 the EPNs were applied to the leaves, branches
and trunks in the afternoon (5 pm) by means of a knapsack sprayer, using about 1,000 l of
287
288
water ha-1 (Table 1). An hour after the EPN application, the same volume of only water was
distributed in every plots with the aim to maintain an adequate level of dampness.
Table 1. Autumn 2004 and spring 2005 treatments applied in the plot trials.
Year
2004
2005
Dose
Commercial product (IJ ha-1)
Millenium®
1.30 x 109
S. carpocapsae
Untreated control
–
–
Millenium®
1.70 x 109
S. carpocapsae
Nemasys®
1.70 x 109
S. feltiae
Untreated control
–
–
Treatment
After 14 days in autumn and 21 days in spring, the time considered long enough for
bacterial infection and EPN reproduction in overwintering CM larvae, the band traps were
removed and carried to the laboratory for the score of live/dead sentinel larvae. The dead
larvae of each plot were dissected and examined under a stereomicroscope, with the aim of
determining the CM mortality caused by EPNs. The data were processed by one way
ANOVA, followed by Student-Newman-Keuls test in 2005.
2005 autumn trial on wide surface
In autumn 2005 a trial on a wide surface was conducted in the province of Modena (Po Valley
– Northern Italy) at Ravarino (44°43’N, 11°06’E) in a heavy infested pear orchard (cvs.
William and Abate Fetel). Inside the orchard (2.75 ha) two blocks were selected: the first one
constituted by 4 rows and 572 trees, with a surface of 4,576 m2, the second one by 2 rows and
286 trees, with a surface of 2,288 m2. On October 4, 2005 at 4.30 pm, the orchard was
irrigated with 1,500 l water ha-1. An hour later, a foliar treatment of S. carpocapsae at the rate
of 2.5 x 109 IJ ha-1 was applied on half the surface of each block and on the area out of the
selected blocks by means of 1,500 l of water ha-1 sprayed by a conventional mist blower. The
other half part of each block was considered as untreated control.
In this trial, the assessments of the mortality of C. pomonella larvae, were performed
checking the CM larvae naturally cocooned in the bark shelters and the sentinel larvae in band
traps. A first group of sentinel larvae was buried for simulating the pupation in the soil. Fifth
stage larvae, collected in a walnut orchard by means of band traps were forced to cocoon on
corrugated cardboard (5 larvae per cardboard). The cardboard sections were placed in net
bags and stored in a dark at cool place for 7 days. The day preceeding EPN application, 20
bags were buried at a depth of 3-10 cm in the first block, 10 bags in the treated and 10 in the
untreated part.
A second group of fifth stage larvae was placed in pieces of trunk long 20 cm and about
15 cm diameter, coming from pear trees just cut down. The CM larvae were induced to
cocoon in the cracks of the bark, with the aim of reproducing the natural overwintering
conditions. Before EPN application, the small trunks, each containing 5 larvae, were arranged
at random in the blocks; each small trunk was tied at 1 m height on the tree.
A third group of sentinel larvae, coming from a mass production of the Agricultural and
Forestry Experimental Station, Laimburg, Bolzano, was placed on 16 small trunks in the first
block (5 larvae per trunk). The larvae quickly went to pupate in the cracks of the bark.
A fourth group of CM larvae coming from a pear orchard, naturally went to cocoon in
some band traps put on 60 trees of the second block, chosen randomly.
289
A fifth group was constituted by CM larvae spontaneously cocooned either on the bark
under the band traps or in bark cracks. They were counted and examined separately, because
the corrugated cardboard could have improved the EPN surviving on the tree.
A sixth and last group was constituted by overwintering CM larvae naturally present in
the orchards. They cocooned in bark shelter of the trees lacking in band traps.
On October 19, 2005 the larvae of different groups were retrieved from the field and
carried to the laboratory; they were counted and scored as either live or dead. The dead larvae
were dissected and inspected under the stereomicroscope for the EPNs inside. The number of
live/dead larvae, collected in the area treated with S. carpocapsae, was compared with the
untreated control by means of χ-square test in contingency tables 2 x 2.
2006 spring trial on wide surface
In spring 2006, a randomized block design was arranged in trials on a wide surface in two
fields in province of Modena (Castelfranco Emilia, 44°37’N, 11°03’E) and Bologna (San
Matteo della Decima, 44°43’N, 11°14’E) in organic pear orchards (cvs. William and Abate
Fetel), which in the previous years had been heavily damaged by CM. In each farm 4
treatments were performed (Table 2); two repetitions (each 1 ha) were arranged for each
treatment in the orchard of Modena province and 1 ha repetition in the orchard of Bologna
province: in total, three repetitions for each treatment were distributed in two farms.
Table 2. Spring 2006: Treatments applied in the wide surface trials.
Treatment
Commercial product
S. carpocapsae
S. carpocapsae
S. feltiae
S. feltiae
Untreated control
Nemasys C®
Nemasys C®
Nemaplus ®
Nemaplus ®
–
Dose
(IJ ha-1)
2.50 x 109
1.25 x 109
2.50 x 109
1.25 x 109
–
In the plots at lower dose of either S. carpocapsae or S. feltiae, about total 150 sentinel
overwintering larvae, cocooned in band traps of corrugated cardboard, were tied to the trunks
at about 1 m. height before applying EPNs. The treatment at either 2,5 x 109 IJ ha-1 or 1,25 x
109 IJ ha-1 mixed with an adjuvant, was carried out on March 28, 2006, at 6 pm and 8 pm in
the two fields respectively, by means of 1,500 l of water ha-1 sprayed by a conventional mist
blower. The decision to apply the treatment was taken at 5% larval pupation (according a
simulation model), temperature higher than 12-14 °C and about 83% RH. In the control the
trees were only sprayed with the same water volume. In this trial, the assessments were
performed directly on the sentinel larvae in the band traps and indirectly on the eggs laid by
the females of the first CM generation, sampling 100 fruitful bunches in the central area of
each plot in coincidence with the highest egg laying. Only in one farm, a check of fruits
damaged by the first generation was planned.
2004 and 2005 plot trials
Both years, significant differences among the treatments were evidenced (one way ANOVA:
F(1, 6)=6.3986, P=0.0447 in 2004; F(2, 9)=18.9156, P=0.0006 in 2005). The percentage of dead
290
CM larvae in the plots treated with S. carpocapsae was always significantly higher than in the
untreated control and, in 2005, even higher than in plots treated with S. feltiae (Table 3), why
this species was used in the next trial on a wide surface (Lacey & Unruh, 1998).
Table 3. C. pomonella larval mortality (%) caused by EPNs
Year
Treatment
CM larval mortality (%) (m±s.d.) *
54.0 ± 39.5 b
S. carpocapsae
2004
Untreated control
6.3 ± 12.5 a
77.5 ± 15.0 c
S. carpocapsae
2005 S. feltiae
45.0 ± 17.3 b
Untreated control
10.0 ± 8.2 a
* Different letters mean significant statistical differences (Year 2005: Student-Newman-Keuls test,
P<0,05).
Table 4. Autumn 2005: C. pomonella larval mortality (%) in the first block.
Thesis
Mortality
due to EPNs
Mortality
due to other
reasons
(%)
Live
larvae
χ² test
Dead
larvae
χ²
(%)
(%)
(%)
First group – Buried sentinel larvae
S. carpocapsae (n=24)
62.5
29.2
8.3
91.7
7.2
Untreated control (n=21)
4.8
52.3
42.9
57.1
Second group – Sentinel larvae on pieces of trunks
100.0
0.0
0.0
100.0
39.1
0.0
4.0
96.0
4.0
Third group – Sentinel larvae, coming from a mass production, on pieces of trunks
64.3
32.1
3.6
96.4
15.4
0.0
50.0
50.0
50.0
Sixth group – Larvae in the bark shelter
66.7
33.3
0.0
100.0
32.1
0.0
28.6
71.4
28.6
P
0.0072
<0.000
1
<0.000
1
<0.000
1
2005 autumnal trial on wide surface
The trial was carried out in the optimal conditions for nematode activity: temperature higher
than 12-14 °C and good RH. In every block and CM group the number of dead larvae was
always significantly higher after the S. carpocapsae application than in the untreated area
(Tabl. 4 & 5).
In the treated surface of the first and second block the mortality of the CM larval groups
due to EPNs, resulted from 63% to 100% and the live larvae from 0% to 8%. On the contrary,
only the buried sentinel larvae were found killed by nematodes in the untreated control (5%),
probably due to either indigenous EPNs living in the soil or the EPN drift during the
application. Anyway, in the untreated part, the CM larval survival was between 43% and 96%
in the first block and between 43% and 93% in the second one.
2006 spring trial on wide surface
The spring EPN application at the rate of 1.25 x 109 IJ ha-1 did not achieve any effect in the
sentinel larvae parasitization. Larvae in cardboard band traps were all found alive (total
291
amount 128) and sometimes pupated (total amount 14). Only 14 larvae died, but no one for
EPNs.
Table 5. Autumn 2005. C. pomonella larval mortality (%) in the second block.
Live
larvae
Dead
larvae
(%)
(%)
χ²
0.0
92.9
100.0
7.1
22.3 <0.0001
8.3
42.9
91.7
57.1
0.8
49.0
99.2
51.0
0.0
59.3
100.0
40.7
χ² test
7.2
0.0072
205.3 <0.0001
45.4
100
R.H. (%), rainfall (mm), leaf wet hours (
P
<0.0001
26
24
22
20
18
16
14
12
10
8
6
4
2
0
90
80
70
60
50
40
30
20
10
0
3/10/05
4/10/05
R.H.
5/10/05
Rainfall
6/10/05
leaf wet hours
7/10/05
T mean
8/10/05
T min
Temperature (°C)
Mortality
due to other
Thesis
reasons
(%)
(%)
Second group - Sentinel larvae on pieces of trunks
100.0
0.0
7.1
0.0
Fourth group - Sentinel larvae on band traps
62.5
29.2
4.8
52.3
Fifth group - Sentinel larvae under band traps
77.6
21.6
0.5
50.5
Sixth group - Sentinel larvae in the bark shelter
S. carpocapsae
(n=63)
69.8
30.2
3.7
37.0
Mortality
due to EPNs
9/10/05
T max
Figure 1. Autumn 2005-trial on a wide surface. Weather conditions in the week of S. carpocapsae application
The autumn EPN applications were very effective in controlling overwintering CM
larvae. In Northern Italy weather conditions (Figure 1) were very often optimal for EPN
viability and insect parasitization. In this case even foliar applications of a suitable product
based on S. carpocapsae supplemented with an adjuvant would have easily hit the target
(Mason et al., 1998; Grewal, 2002; Lacey et al., 2006).
In 2006 spring trials the unsuccessful results on the sentinel larvae were probably due to
the low RH in the days following the EPN application and to the temperature lower than 12°C
292
100
16
90
14
80
12
70
60
10
50
8
40
6
30
Temperature (C°)
H.R. (%), rainfall (mm
in most part of the period. These weather conditions prevented the nematodes from successfully parasitizing the CM larvae (Figure 2) (Brown & Gaugler, 1996; Smits, 1996; Brown &
Gaugler, 1997). On the other hand, the pupation was rapidly increasing in the same period so
it was impossible to postpone the EPN application, because EPNs cannot succeed in penetrating the well protected CM chrysalises. Less important seems to be in the medium EPN
application rate sprayed in the plots, because EPNs have the capability of recycling in the host
tissues in presence of suitable environmental conditions (Barbercheck & Hoy, 2005). These
results confirm what was observed by Benuzzi and Ladurner in plot spring trials (personal
communication).
4
20
2
0
0
27
/3
/0
28 6
/3
/0
29 6
/3
/0
30 6
/3
/0
31 6
/3
/0
6
1/
4/
06
2/
4/
06
3/
4/
06
4/
4/
06
5/
4/
06
6/
4/
06
7/
4/
06
8/
4/
06
9/
4/
0
10 6
/4
/0
11 6
/4
/0
12 6
/4
/0
13 6
/4
/0
6
10
R.H.
Rainfall
T mean
T min
T max
Figure 2. Spring 2006-trial on a wide surface. Weather conditions in the month of EPN
application.
In conclusion, EPNs are able to penetrate overwintering CM larvae in the cocoon: The
mortality in the sentinel larvae treated with nematodes is the same like larval mortality caused
by EPNs in the bark shelters (Unruh & Lacey, 2001). EPN effectiveness is exalted by autumn
applications on the leaves and trunks. The efficacy of EPN spring treatments seems depending
on the satisfaction of three conditions at the same time: host as mature larvae in the cocoon,
suitable temperature (>12-14 °C) and high RH for most part of 24 h. Treatments applied at the
twilight (Gaugler et al., 1992), with irrigation or high volumes of water during EPN
applications, the correct nozzles maintenance (Wright et al., 2005), the cool storage of EPN
products (Bedding, 1984) are the conditions, which have to be met for obtaining an effective
biocontrol (Lacey & Unruh, 2005). The lower EPN doses seem to be effective in autumn
treatments, in a favourable environment for EPN activity.
References
Barbercheck, M.E. & Hoy, C.W. 2005: A System Approach to Conservation of Nematodes.
In: Nematodes as Biocontrol Agents, eds. Grewal, Ehlers and Shapiro-Ilan. CABI
Publishing. Wallingford UK: 331-347.
293
Bedding, R.A. 1984: Large scale production, storage and transport of the insect-parasitic
nematodes Neoaplectana spp. and Heterorhabditis spp. Annals of Applied Biology 104:
117-120.
Brown, I.M. & Gaugler, R. 1996: Cold tolerance of steinernematid and heterorhabditid
nematodes. Journal of Thermal Biology 21: 115-121.
Brown, I.M. & Gaugler, R. 1996: Temperature and humidity influence emergence and
survival of entomopathogenic nematodes. Nematologica 43: 363-375.
Gaugler, R., Bednarek, A. & Campbell, J.F. 1992: Ultraviolet inactivation of heterorhabditid
and steinernematid nematodes. Journal of Invertebrate Pathology 59: 155-160.
Grewal, P.S. 2002: Formulation and application technology. In: Entomopathogenic Nematology, ed. Gaugler. CABI Publishing. Wallingford UK: 265-287.
Lacey, L.A. & Unruh, T.R. 1998: Entomopathogenic nematodes for control of codling moth:
effects of nematode species, dosage, temperature and humidity under laboratory and
simulated field conditions. Biological Control 13: 190-197.
Lacey, L.A. & Unruh, T.R. 2005: Biological control of codling moth (Cydia pomonella,
Tortricidae: Lepidoptera) and its role in integrated pest management, with emphasis on
entomopathogens. Vedalia 12: in press.
Lacey, L.A., Arthurs, S.P., Unruh, T.R., Headrick, H. & Fritts, R. Jr. 2006: Entomopathogenic
nematodes for control of codling moth (Lepidoptera: Tortricidae) in apple and pear
orchards: effect of nematode species and seasonal temperatures, adjuvants, application
equipment and post-application irrigation. Biological Control 37: in press.
Mason, J.M., Mattews, G.A. & Wright, D.J. 1998: Screening and selection of adjuvants for
the spray application of entomopathogenic nematodes against a foliar pest. Crop protection 17: 463-467.
Shapiro-Ilan, D.I., Duncan, L.W., Lacey, L.A. & Han, R. 2005: Orchard Applications. In:
Nematodes as Biocontrol Agents, eds. Grewal, Ehlers and Shapiro-Ilan. CABI
Publishing. Wallingford UK: 215-229.
Smits, P. 1996: Post-application persistence of entomopathogenic nematodes. Biocontrol
Science and Technology 6: 379-387.
Unruh, T.R. & Lacey, L.A. 2001: Control of codling moth, Cydia pomonella (Lepidoptera:
Tortricidae), with Steinernema carpocapsae: effects of supplemental wetting and
pupation site on infection rate. Biological Control 20: 48-56.
Wright, D.J., Peters, A., Schroer, S. & Fife, J.P. 2005: Application Technology. In: Nematodes as Biocontrol Agents, eds. Grewal, Ehlers and Shapiro-Ilan. CABI Publishing.
Wallingford UK: 91-106.
pp. 294-296
Foliar application of EPNs to control Xantogaleruca luteola Müller
(Coleoptera, Chrysomelidae)
Oreste Triggiani, Eustachio Tarasco
DiBCA, Section of Entomology and Zoology, Agriculture College, University of Bari,
Via Amendola 165/A, 70126 Bari, Italy
Abstract: Xanthogaleruca luteola Müller (Coleoptera, Chrysomelidae) is widely spread in Europe and
North America and it is a dangerous pest of elm-trees. In Italy the elm-trees are often located in urban
areas so the potential of 3 entomoparasitic nematodes (EPNs; 2 Italian strains of Steinernema
carpocapsae and S. feltiae and 1 commercial strain of Heterorhabditis bacteriophora), was evaluated
through field experiments for control of X. luteola. During the first 2 weeks of June 2006, S.
carpocapsae (ItS-MR7), S. feltiae (ItS-CL2) and H. bacteriophora (Nematop®) in gel suspensions
(with Idrosorb SR 200 and Xanthan gum) were sprayed on leaves and small branches heavily infested
by X. luteola larvae in a periurban park of Bari city (Apulia Region, South Italy). The efficiency of
these EPNs was then evaluated after 3 and 5 days. S. carpocapsae in Idrosorb + Xanthan gum
controlled 67% of the larvae after 5 days, producing significantly greater larval mortality than S.
feltiae and H. bacteriophora.
Key words: elm-tree, entomoparasitic nematodes, microbial control, southern Italy
Introduction
Xanthogaleruca luteola (Müller, 1766) (Coleoptera, Chrysomelidae) is present throughout
Europe and North America and commonly found in all regions of Italy on various elm
species. If prolonged infestations occur, the tree becomes vulnerable to attacks by bark beetles
transmitting the ascomycete Ophiostoma ulmi (Schwartz) Nannfeldt. The increasing use of
biocontrol agents based on entomopathogenic nematodes (EPNs) promotes interest in
experimenting with these organisms for the treatment of on the leaf surface as well.
Steinernema and Heterorhabditis spp., along with their symbionts Xenorhabdus and
Photorhabdus spp., are necessary insect pathogens common to Italian soils (Tarasco &
Triggiani, 1997; Triggiani & Tarasco, 2000); DJs (third-generation infective stages) penetrate
the insect through the anus, mouth, spiracles or cuticle and release their symbiont bacteria in
the hemocoel of the victim-host, causing death by septicaemia within 24 to 48 hours.
The species utilized in the experiments were S. feltiae (Filipjev,1934) Wounts, Mracek, Gerdin
and Bedding, 1982, S. carpocapsae (Weiser, 1955) Wounts, Mracek, Gerdin and Bedding,
1982, found in Puglia and a commercial product based on H. bacteriophora Poinar, 1976,
(Nematode, Rhabditida) from e-nema GmbH (Raisdorf, Germany).
In the first week of June 2006, branches of Ulmus campestris L. with a severe infestation
of X. luteola were treated with EPNs suspended in Idrosorb SR 200 (Nigem©, highly absorbent
polymer acrylic) and in Idrosorb + gum Xanthan (polysaccharide derived from the fermentation of the bacterium Xanthomonas campestris). For the control we used gel without nematodes.
294
295
The mortality of the X. luteola larvae was controlled after 3 and 5 days by examining the
3 pouches with elm branches for each nematode species and gel, and 3 pouches for the control.
The dead larvae were rinsed under running water for about 10 seconds, dried and dissected in
a physiologic solution. Data on the mortality rate of larvae underwent analysis of variance.
After 3 days of treatment, the mortality rate of X. luteola larvae varied: S. feltiae and H.
bacteriophora in both Idrosorb and Idrosorb + gum Xanthan were barely effective, and S.
feltiae in Idrosorb + gum Xanthan contained about 10% of the coleoptera larvae. The tendency
remained unchanged with time, in fact, 5 days later 12,3% of the phytophagous died. S.
carpocapsae in Idrosorb reduced the insect population by about 33%; the percentage did not
vary statistically after 5 days. The best results were obtained with S. carpocapsae in Idrosorb
+ Xanthan gum, approximately 57% of larvae died after 3 days and 67% after 5 days (Fig. 1).
Our test results showed that although S. feltiae and H. bacteriophora were of little value,
mainly due to treatment temperatures (27°-30°C), S. carpocapsae yielded more positive
results given its greater resistance to dehydration and high temperatures (Simons & Poinar,
1973; Glazer & Navon, 1990; Kung et al., 1991; Koppenhofer et al., 1995; Patel et al., 1997).
During treatment, temperature (27°-30°) was the factor limiting the action of DJs, in
particular of S. feltiae and H. bacteriophora.
100
80
X. luteola adult
mortality (%)
60
40
3
days
Control (Idr+gumXanth)
Idr+S.carpo
Idr+H.bacteriophora
5
Idr+gumXanth+S.carpo
EPN suspensions
Idr+gumXanth+H.bact.
Idr+S.feltiae
0
Idr+gumXanth+S.feltiae
20
Figure 1. Mortality (%) of X. luteola larvae 3 and 5 days after treatment with EPN.
References
Glazer, I., Navon, A. 1990: Activity and persistente of entomoparasitic nematodes tested
against Heliothis armigera (Lepidoptera, Noctuidae). Journal of Economic Entomology,
83: 1795-1800.
296
Koppenhofer, A.M., Kaya, H.K., Tarmino, S.P. 1995: Infectivity of entomopathogenic
nematodes (Rhabditida, Steinernematidae) at different soil depths and moisture. Journal
of Invertebrate Pathology 65: 193-199.
Kung, S.P, Gaugler, R., Kaya, H.K. 1991: Effects of soil temperature, moisture, and relativehumidity on entomopathogenic nematode persistence. Journal of Invertebrate Pathology,
57: 242–249.
Patel, M.N., Perry, R.N., Wright, D.J. 1997: Desiccation survival and water contents of
entomopathogenic nematodes, Steinernema spp. (Rhabditida: Steinernamatidae): International Journal for Parasitology 27: 61-70.
Simons, W.R., Poinar, G.O. 1973: Ability of Neoaplectana carpocapsae (Steinernematidae:
Nematoda) to survive extended periods of dessication. Journal of Invertebrate Pathology.
22: 228-230.
Tarasco, E., Triggiani, O. 1997: Survey of Steinernema and Heterorhabditis (Rhabditida:
Nematoda) in Southern Italian soils. Entomologica, Bari 31: 117-123.
Triggiani, O., Tarasco, E. 2000: Indagini sui nematodi entomopatogeni (Rhabditida: Steinernematidae e Heterorhabditidae) in pinete e querceti dell’Italia meridionale. Entomologica, Bari, 34: 23-32.
pp. 297-300
Cultivation conditions of biocomplexes applicable to control
Melolontha melolontha
Csaba Sisak1, Zoltan Kaskötő2, Tímea Tóth2 & Tamás Lakatos2
1
Research Institute of Chemical and Process Engineering, University of Pannonia, Egyetem
u. 10., H-8200 Veszprém, Hungary; 2Research and Extension Centre for Fruit Growing,
Vadas tag 2., H-4244 Újfehértó, Hungary
Abstract: Recently several nematode/bacterium complexes have been isolated in Hungary with
potential to grubs of the European cockchafer (Melolontha melolontha). The cultivation of one of the
most promising biocomplexes, Heterorhabditis downesi ’267’ + Photorhabdus temperata in liquid
medium can be considered to be effective if the concentration of the dauer juveniles achieves
10,000/ml. A prerequisite for the elaboration of suitable conditions for cultivation is the development
of optimal process conditions (aeration at low shear stress, medium composition, etc.) and to avoid the
occurrence of phase variants of the bacterium symbiont. Cultivation experiments with P. temperata
were performed first in shake flasks, in LB and TSY medium at 20-22 °C. The aeration rate required
by the cells during the logarithmic growth period was about 0.6-0.7 vvm. Applying a 5 litre
mechanically stirred fermenter equipped with draft-tube for bacterium growth studies, a special fedbatch technique has been elaborated. Cell numbers of the primary phase variant were sustained at high
numbers over a period of 19 days. Medium optimization studies exchanged several protein
components of LCM for lipid components and obtained considerably higher numbers of dauer
juveniles and hermaphrodites. Rape seed oil was the most suitable lipid component. In the best
medium, the initial nematode dauer juvenile number (1,000/ml) increased to 120,000/ml within 12
days. At present, scale-up studies of the biocomplex are in progress in column bioreactors of different
type.
Key words: liquid culture, Heterorhabditis downesi
Introduction
The entomopathogenic nematode (EPN)/entomopathogenic bacterium (EPB) complexes have
increasing importance as environment friendly biocontrol agents. In the last years, numerous
complexes were isolated from the soil samples originated from different Hungarian regions.
Several of them proved to be effective against the grubs of the European cockchafer
(Melolontha melolontha), the most harmful insect pest of Hungarian horticulture. One of the
most efficient biocomplexes is Heterorhabditis downesi ’267’ and Photorhabdus temperata
collected from the forests of Nyíribrony 2/D North-Eastern Hungary. Investigations were
made to determine the optimum conditions for liquid culture of this biocomplex. Optimal
conditions require a sufficient concentration of the so-called primary phase variant of the EPB
should be maintained in the broth for a quite long (12-16 days) period because this variant
functions as feed for the nematodes (de la Torre, 2003). This study presents results from
studies on process parameter improvement.
Bacterium cultivation
The bacterial symbiont culture was made in 300 ml flasks with 50-200 ml LB and TSY
media, shaken at 170 rpm. To distinguish primary and secondary phase variants P. temperate,
297
298
cells plates containing bromthymol blue and 2,3,5-triphenyltetrazolium chloride indicators
were used (Fodor et al., 1997). 50 µl samples were spread onto the indicator plates and
incubated at room temperature. Number of colonies was counted after 48 hours by means of
microscope. Long term cultivation studies were carried out in a draft-tube fermenter of 5 litre,
equipped with impeller stirrers (INEL BR97). As it known from the literature (Ehlers, 2001),
in bioreactors of this type the adequate oxygen level can be achieved without the emergence
of too intensive shear forces. Stiration rate was set at 550 rpm, air flow rate at 600 l/h. The pH
was not controlled.
EPB/EPN cultivation
The P. temperata cells were grown on LB medium for 24 h. Then 100 ml flasks containing 10
ml LCM medium were inoculated with the cells. (1 litre LCM medium contained 10g soya
peptone, 5 g yeast extract, 5 g casein peptone, 5 g meat peptone, 3 g meat extract 0.35 g KCl,
0.21g CaCl2, 5 g NaCl, 1 ml cholesterol solution of 1% w/w, 30 ml olive oil). In the 24th h of
cultivation, 800-1,000 H. downesi ’267’ dauer juveniles were added. The flasks were shaken
at 170 rpm, 20°C and samples were taken periodically for microscopic evaluation. The
composition of basic LCM medium has been varied to find an optimum composition from the
points of views of growth intensification, moreover the medium cost reduction. Among
others, LCM variant media have been composed as follows: LCM1 variant: 5 g soy peptone
and 50 ml olive oil instead of 10 g soy peptone and 30 ml olive oil; LCM2 variant: see
composition of LCM1 in exeption 50 cm3 rapeseed oil instead of 50 cm3 olive oil
Bacterial cultivation experiments
Investigating the effect of the cultivation temperature on the concentration of phase variants it
was found that the highest primary cell concentration can be achieved at 26°C (Sisak and
Kaskötő, 2004). Since primary cells serve as nutrition for nematodes, the sustainability of the
primary phase and their sensibility to temperature and the temporary lack of oxygen during
longer cultivation were tested as well.
The data of Table 1 show that the number of primary cells is significantly higher at the
lower temperature and at longer cultivation times. On the other hand, the secondary phase
variant appears in the broth mainly at the higher temperature and in the flasks filled with more
liquid, i.e. if the dissolved oxygen level is lower. It can be concluded from the data that 2022°C can be considered as temperature optimum from the point of view of the sustainability
of the culture. Regarding the aeration the ideal ratio of filling up of the flasks is about 1:3 at
170 rpm rotational speed.
On the basis of P. temperata growth studies, a special fed-batch technique was elaborated
for the draft-tube fermenter. To hinder the critical fall of the level of dissolved oxygen a step
by step feeding of a diluted substrate solution was found to be necessary. In this case, the
relative oxygen saturation level did not decrease below 50% (see Figure 1, fermentation
period between 60-120 h). Cell numbers of the primer phase were sustained for up to 460 h
(Sisak and Kaskötő, 2004).
EPB/EPN cultivation experiments
A stable growth of the complex was obtained in LCM (Sisak et al., 2005). In this medium, a
considerable percent of the dauer juveniles transformed into reproductively mature adult
hermaphrodites within 6-8 days. Nematode density increased significantly above the initial
concentration of 1,000/ml (Table 2).
299
Table 1. Number of colonies of primary and secondary phase variants on plates infected with
broth from flasks shaken at different temperatures and with liquid volumes
Volumes of
TSY (ml) +inoculum (ml)
in 300 ml flask
dilution 1:10-2
dilution 1:10-4
dilution 1:10-6
No. of colonies /
50 µl broth
No. of colonies /
50 µl broth
No. of colonies /
50 µl broth
primary Secondary primary
Secondary
Primary
Secondary
At 20 oC
45+5
290
90+10
210
240
50
180+20
35
170
170
70
o
At 26 C
45+5
80
90+10
90
110
35
180+20
150
55
210
240
Dissolved oxygen, %
120
100
80
60
40
20
0
0
50
100
150
200
Fermentation time, h
Figure 1. Time course of dissolved oxygen level at fed-batch fermentation of P. temperata in
the mechanically stirred draft-tube bioreactor
Table 2. Growth of nematodes of different life stage during cultivation in original LCM
medium, in case of 1,000/ml initial concentration of dauer juveniles
Cultivation time, h
120
144 168
192
216
240
288
336
360
2
Form of nematode
Concentration of living animals, 10 /ml
Dauer juveniles
10
12
12
10
14
12
25
28
20
Hermaphrodites
3
4
8
7
6
10
4
5
4
4
4
3
8
10
15
15
8
Other forms
Searching a more effective and cheaper medium composition the ratios of proteins, lipids
and carbohydrates was changed. The increase of the lipid content of the medium to the
detriment of its protein content (see composition of LCM1) resulted in a considerably more
300
intensive growth of the nematodes than in case of the original LCM medium – in spite of the
lower initial concentration of dauer juveniles – as it is illustrated in Table 3. If olive oil was
exchanged for rapeseed oil in the medium (see composition of LCM2), more significant
improvement was recorded in the growth data (Table 3). The other advantage of LCM2 that it
is far cheaper than the original LCM.
Table 3. Growth of nematodes of different life stage during cultivation in LCM1 (upper table)
and LCM 2 (lower table), in case 800/ml initial concentration of dauer juveniles
Cultivation time, h
120 144
168
192
216
288
336
360
2
Form of nematode
Concentration of living animals, 10 /ml
Dauer juveniles
10
15
35
50
60
60
40
40
Hermaphrodites
5
8
7
8
10
12
12
7
Other forms
3
10
15
20
30
40
20
15
10
16
55
120
180
220
250
210
4
6
7
8
16
12
10
4
5
10
15
22
20
10
Dauer juveniles
Hermaphrodites
Other forms
3
On the basis of the results in shake flasks, studies are in progress to scale up the
cultivation of Heterorhabditis downesi ’267’ + Photorhabdus temperata biocomplex. The
base bioreactor is the mechanically mixed draft-tube fermenter mentioned above. It will be
equipped with stirrers of different material and geometry to test the sensitivity of the
nematode to the shear forces.
Acknowledgements
This study was supported by the Hungarian Ministry of Economy in cooperation with the EU
through the project GVOP-3.1.1.- 2004-05 –0223/3.0.
References
de la Torre, M. 2003: Biotechnol. Adv. 21: 407-416.
Hazir, S., Kaya, H. K., Stock, S. P., Keskün, N. 2003: Turk. J. Biol. 27: 181-202.
Fodor, A., Szállás, E., Kiss, Z., Fodor, Z., Horvath, L.I., Chitwood, D.J., Farkas, T. 1997:
Appl. Environ. Microbiol. 63: 2826-2831.
Ehlers, R-U. 2001: Appl. Microb. Biotechnol. 56: 623-633.
Sisak, C. & Kaskötő, Z. 2004: Mass production of entomopathogenic nematodes. In: Inántsy,
F. and Lakatos, T. (Eds.): Biological control – Agroadat, Újfehértó: 117-150 [in
Hungarian].
Sisak, C., Kaskötő, Z., Lakatos, T. 2005: Acta Microb. Immunol. Hung. Suppl.: 142-143.
pp. 301-306
Recovery of Steinernema carpocapsae and Steinernema feltiae
in liquid culture
Ayako Hirao & Ralf-Udo Ehlers
Institute for Phytopathology, Dep. Biotechnology and Biological Control, ChristianAlbrechts-University Kiel, Hermann-Rodewald-Str. 9, 24118 Kiel, Germany
Abstract: The development from infective Dauer juvenile (DJ) to third stage juvenile, so called
“recovery”, occurs at almost 100% when DJs infect a living insect. In contrast, recovery is much
lower, when DJs are inoculated in liquid culture media, in which the symbiotic bacteria were preincubated. For the purpose of obtaining an increase in recovery in liquid culture, recovery inducing
factor for S. carpocapsae and S. feltiae was investigated. The influence of penetration behavior on
recovery was checked. DJs injected into G. mellonella or inoculated into sand containing the insect
recovered at almost 100%. The penetration activity is excluded to influence recovery of S.
carpocapsae and S. feltiae. The high recovery in insects might to be due to a food signal present in the
serum of G. mellonella. Inoculation of DJs in purified and antibiotics-treated serum was investigated.
Whereas in vivo recovery of S. carpocapsae reached 100%, only 40% of S. feltiae recovered in
sterilize serum. Whereas a food signal triggering recovery of S. carpocapsae is found in the serum, the
composition of the G. mellonella serum seems suboptimal for recovery of S. feltiae. The influence of
the density of the symbiotic bacteria, X. nematophila and X. bovienii (isolated from S. carpocapsae
and S. feltiae, respectively) was investigated. The bacteria were proliferated in liquid medium for 36
and 48 hours. Then DJs at a density of 1,000 DJs/ml were inoculated at bacterial densities of 108, 109
and 1010 cells/ml. Recovery of S. carpocapsae was checked every two hours until 12 h post
inoculation (hpi) and S. feltiae every two hours between 4 and 10 hpi. Comparing recovery at different
bacterial densities, recovery of both nematodes increased with increasing bacterial density. However,
the recovery of S. feltiae was delayed and lower compared to results obtained with S. carpocapsae.
Culture supernatant of both bacterial symbionts contained food signal, however, the recovery was
significantly higher when bacterial cells were present.
Key words: entomopathogenic nematode, recovery, liquid culture
Introduction
Entomopathogenic nematodes, Steinernema carpocapsae and S. feltiae (Rhabditida, Nematoda) are used as biological control agents against soil dwelling insect larvae. The infective
dauer juveniles (DJ) are in developmental arrested stage and tolerant to unfavorable
surrounding condition. Once they invade into host insect, they release the symbiotic bacteria
(Xenorhabdus nematophila and X. bovienii) and develop to reproductive stages. This
developmental change is called ‘recovery’. Much research has been conducted on the
description of DJ recovery. The determination of recovery inducing factors was carried out
with Caenorhabditis elegans and Heterorhabditis bacteriophora from the aspects of
physiology, genetic and morphology (Aumann & Ehlers, 2001). According to the reports the
temperature shift, increase of CO2 concentration (Jessen et al., 2001), presence of food
resources and secondary metabolites of symbiotic bacteria (food signal) play a role for
recovery of DJ (Ehlers, 2001). In contrast, the recovery of Steinernema spp. has not received
much attention until now.
301
302
In insect hosts the recovery always reaches approximately 100%, however, the recovery
in liquid culture is much lower (Strauch & Ehlers, 1998). It has been reported that DJs react to
secondary metabolites of symbiotic bacteria, the so called “food signals”, produced in liquid
culture prior to nematode inoculation. In order to define the optimal condition for efficient
recovery, the recovery process was described and the recovery assessed in different media: in
vivo and serum of Galleria mellonella, bacterial solutions of symbionts and the secondary
metabolites of symbiotic bacteria.
Insect, nematodes and symbiotic bacteria
The last instars of Galleria mellonella were used for in vivo recovery tests. The larvae were
reared on an artificial diet at 32°C in the dark. The All strain of S. carpocapsae was used for
all experiments. The DJs were inoculated in liquid medium at the density of 1,000DJs/ml and
incubated on shaker at 180 rpm at 23°C for 14-16 days. Then they were washed with sterile
Ringer solution and the active DJs were selected with a 0.03 mm sieve. Their symbiotic
bacteria, Xenorhabdus nematophila were isolated from nematode infected G. mellonella
larvae and proliferated in YS medium. To this stock solution glycerol was added to reach 15%
and the bacteria were stored at -20°C until use. The EN02 strain of S. feltiae and their
corresponding bacterium, X. bovienii were prepared as described for S. carpocapsae.
Bioassay
To determine the recovery in larvae and the effect of inoculation method, 50 DJs in 20µl
Ringer´s solution were injected or inoculated with 10% moist sand to last instar of G.
mellonella larvae. Sand buried larvae were exposed to DJs for 6 h. Afterwards they were
collected and the surface washed with Ringer´s solution and maintained in Petri dish. At 6, 24
and 48 h post inoculation (hpi) the larvae were dissected and the number of recovered
nematodes was counted.
Preparation of insect serum from G. mellonella larvae
Insect serum of G. mellonella was used for in vitro recovery test. G. mellonella larvae were
collected on ice and the hemolymph was collected from their proleg into the 2.0 µl cap
including 0.5% phenylthiourea-acetone at 1/10 of total volume to avoid PO-activity.
Collected hemolymph was stored at -20°C until use. Before the experiment the stock was
thawed and purified by centrifugation and filtration with a 0.2 µm filter. Then 0.1% ampicillin
and 0.1% streptomycin sulfat were added and all incubated for 24 h. All handling was under
sterile conditions.
Preparation of bacteria solution
To assess the influence of the bacterial density and of the food signal on recovery in liquid
culture, bacteria were cultured in 30ml YS medium. After reaching a cell density of 109 cells/
ml, 1 ml was transferred into liquid medium and incubated on the shaker at 180 rpm for 36 h
at 23°C. Bacterial cell density was assessed with a Thoma chamber. The bacterial solution
was collected and stored at 4°C for adjusting cell density. The rest of the culture was purified
to obtain bacteria-cell-free supernatant by centrifugation and filtration through a 0.2 µm filter.
Bacterial cells density was adjusted with the purified supernatant at the density of 1010, 109
and 108 cells/ml. The supernatant and cell density of 109 cells/ml were prepared in two
batches – with and without antibiotic treatment (0.1% ampicillin and 0.1% streptomycin).
303
Recovery test
For recovery tests, 24 cell-well plates were used. 500 µl of each solution and 500 DJs were
inoculated to each well. The plate was incubated on the shaker of 180 rpm at 23oC. At 2, 4, 6,
8, 10 and 12 hpi 50µl of solution was taken for observation of recovery under the inverted
microscope at 125-fold magnification. Detailed description of recovery was observed under
600-fold magnification. In order to assess the recovery over time, the area below the recovery
graph was calculated and subjected to a one-way ANOVA analysis.
Morphologic change during recovery
The morphological changes occurring during the early phase of S. carpocapsae recovery are
described in Fig. 1. During the DJ stage the mouth and intestine lumen are closed. When the
recovery process starts, the tip of the mouth swells and the buccal cavity becomes apparent.
Afterward the mouth starts to open and the pre-dauer J2 cuticle is protruding. This curvature
disappears with the wider opening of the buccal cavity. During the whole process the cuticle
of the pre-dauer J2 remains around the recovering juvenile until it exsheathes and looses the
cuticle. In S. feltiae the morphologiocal changes are comparable with the changes in S.
carpocapsae, however, the swelling is not protruding the dimension of the body and the
juveniles are exsheathed before entering into the recovery process. In contrast to S. feltiae, the
intestine lumen in the anus region of S. carpocapsae is visible at an early stage of the
recovery process.
mouth
mouth
DJ
recover
DJ
recover
tail
DJ
Figure 1. Morphological changes during DJ recovery. Left: changes of mouth (top) and tail
(bottom) of S. carpocapsae. Right: changes of mouth of S. feltiae.
Recovery in G. mellonella larvae
Of the DJs of S. carpocapsae approximately 39% recovered within 6 hpi and the recovery
increased to 100% within the next 24 h without a difference between whether DJs had been
injected or invaded the insect by themselves. In S. feltiae recovery of injected DJs reached
63.2% and of invading 13.1% at 6 hpi. After 24 h the recovery was 99.8% and 93.8%,
respectively reaching almost 100% in both assays at 48 hpi.
Recovery in serum of G. mellonella larvae
The recovery of S. carpocapsae and S. feltiae in sterile serum of G. mellonella larvae from 2
to 60 hpi is shown in Fig. 2. The recovery of S. carpocapsae started to increase from 4 hpi
304
and reached 80% by 10 hpi. At 60 hpi the recovery reached to 95.5% regardless whether the
serum was supplemented with antibiotics or not. In contrast, S. feltiae DJs hardly reacted with
20% recovery in the serum until 12 hpi. At 60hpi the recovery reached only 40%.
recovery (%
100
80
S. carpocapsae
60
S. feltiae
40
20
0
2
4
6
8
10 12 24 36 48 60
hours post inoculation
Figure 2. Recovery of S. carpocapsae and S. feltiae in sterile serum from G. mellonella
ringer
100
supernatant
recovery (%
80
10E
9E
60
8E
40
20
0
2
4
6
8
10
12
hpi
Figure 3. Recovery of S. carpocapsae at different bacterial density
Recovery of S. carpocapsae at different bacterial density
The recovery of S. carpocapsae at vaiable bacterial density and in sterile culture supernatant
(cell free) is shown in Fig. 3. Recovery is significantly higher in 1010 and 109 cells/ml than in
the lower cell density (P<0.0001). At 4 hpi the recovery rose to 32.2% in 1010 cells/ml and
28.7% in 109 cells/ml, and reached 92.7% in 1010 cells/ml and 88.9% in 109 cells/ml at 8 hpi.
Culture supernatant promoted fewer DJs to recover, reaching 44.4% at 12 hpi. No DJs
recovered in Ringer´s solution.
Recovery of S. feltiae at different bacterial density
The recovery of S. feltiae was significantly higher (P=0.0001) in 1010 compared to both lower
bacterial densities and the sterile bacterial culture supernatant (Fig. 4). The recovery in 1010
cells/ml rose to 24.9% already at 4 hpi and reached 78.1% at 10 hpi, whereas the recovery at
lower bacterial density did not surpass 20 % until 8 hpi At 10 hpi DJs inoculated to the lower
bacterial density started to recover slowly. Bacterial culture supernatant hardly stimulated the
recovery, 32.6% at 10hpi. No DJs recovered in ringer solution.
305
Ringer
100
supernatant
10E
recovery (%
80
9E
8E
60
40
20
0
2
4
6
8
10
12
hours post inoculation
Figure 4. Recovery of S. feltiae at different bacterial density
Influence of antibiotics
Comparing the recovery in media with and without antibiotics S. carpocapsae was not
affected by the treatment, while S. feltiae recovered significantly lower in supernatant
(P=0.033) (Table 2). In serum of G. mellonella S. feltiae rarely recovered both media with and
without antibiotics. In 109 cells/ml S. feltiae recovered in solution with antibiotics at the same
rate of recovery without antibiotics, regardless of the bacterial cell activity.
The study showed that the time frame of the in vivo recovery of S. carpocapsae and S.
feltiae is comparable, reaching almost 100% at 24 hpi in G. mellonella larvae. Thus the
process of host finding and penetration has no influence on the recovery of both species,
although S. feltiae took longer time to reach the host than S. carpocapsae. Components of the
serum collected from G. mellonella larvae should induce recovery of both nematodes.
However, the in vitro recovery test results indicate that the recovery of S. carpocapsae and S.
feltiae is different in the serum. S. carpocapsae recovers even under sterile condition, whereas
the recovery of S. feltiae is not induced by the serum of Galleria mellonella itself. Either the
substance(s) triggering recovery of S. feltiae was lost during purification or a cell-bound
factor is missing. However, earlier experiments showed that the hemocytes have no influence
on recovery on both Steinernema DJs (data not shown). Another possibility is that G.
mellonella just is not the best host insect for S. feltiae.
Table 2. Statistcal analysis of results of recovery assays with S. carpocapsae and S. feltiae with
and without the presence of antibiotics in different culture substrates
Treatments
S. carpocapsae S. feltiae
Antibiotic
+
-
+
-
Supernatant
A
A
B
A
109 cells/ml
A
A
A
A
insect serum
A
A
B
B
DJs of both species respond to the bacterial cell density. Approximately 100% of S. carpocapsae DJ recovered in 1010 and 109 cells/ml, even when the cell density was lower than in the
original density of 1010. In contrast, S. feltiae reached >50% recovery only at 1010 cells/ml,
306
which was even a higher cell concentration than in the original culture of X. bovienii (8 x 199).
The assays with antibiotics in the substrate indicate that the recovery of S. feltiae depends on
the presence of the bacterial cells. S. feltiae recovery in culture supernatant supplemented with
inactivated bacterial cells was higher than in supernatant without cells. H. bacteriophora
recovery was not different in supernatant with or without cells (Strauch & Ehlers, 1998). The
response of S. feltiae to the food signal is not comparable with the other two nematode species
investigated. The presence of the food signal producer, the bacterial cell can increase the
response of the DJ.
Acknowledgements
We appreciate the financial support to the first author by the German Academic Exchange
Service.
References
Aumann, J., Ehlers, R.-U. 2001: Physico-chemical properties and mode of action of a signal
from the symbiotic bacterium Photorhabdus luminescens inducing dauer juvenile recovery
in the entomopathogenic nematode Heterorhabditis bacteriophora. Nematology 3: 849-853.
Ehlers. R.-U. 2001: Mass production of entomopathogenic nematodes for plant protection. Appl.
Microbiol. Biotechnol. 56: 623-633.
Jessen, P., Strauch, O., Wyss, U., Luttmann, R., Ehlers, R.-U. 2000: CO2 triggers dauer juvenile
recovery of entomopathogenic nematodes (Heterorhaditis spp). Nematology 2: 319-324.
Strauch, O., Ehlers, R.-U. 1998: Food signal production of Photorhabdus luminescens
inducing the recovery of entomopathogenic nematodes Heterorhabditis spp. in liquid
culture. Appl. Microbiol. Biotechnol. 50: 369-374.
p. 307
Differential gene expression of recovery in entomopathogenic
nematode Heterorhabdits bacteriophora
Anat Moshayov, Hinanit Koltai, Itamar Glazer
Department of Nematology, ARO, The Volcani Center, Bet Dagan 50250, Israel
Abstract: Nematodes of the genus Heterorhabditis are insect parasites that are widely used as
biological control agents. In Heterorhabditis bacteriophora the free-living, third juvenile stage that is
well adapted to long-term survival in the soil is the infective stage. When it infects a suitable host, the
infective juvenile (IJ) recovers from developmental arrest and resumes growth and development.
Recovery is a very important process from a commercial point of view. To characterize the process of
recovery in H. bacteriophora we aimed to isolate genes involved in this process. For this purpose, we
constructed subtraction library of recovering IJs subtracted by arrest IJs. Two hundreds twenty
expressed sequence tags (ESTs) were sequenced and annotated resulting with 109 useful ESTs that
were categorized into functional categories according to Kyoto Encyclopedia of Genes and Genomes.
Most of ESTs (38%) belongs to the metabolism category, which shows that different metabolic
pathways are highly active in the recovering IJs. Genes of several functional groups were identified.
These included protease, dauer pathway genes (daf-4 & daf-16), heat shock genes (hsp-20, hsp-40 and
hsp-16.1), and signaling proteins like GTP binding proteins (tag-210 & tag-308).
307
p. 308
Expression of different desiccation tolerance related genes in various
species of entomopathogenic nematodes
Vishal S. Somvanshi1, Hinanit Koltai2, Itamar Glazer1
Departments of 1Nematology, 2Ornamental Horticulture, Agricultural Research
Organization, the Volcani Center, Bet Dagan 50250, Israel
Abstract: Entomopathogenic nematodes used as biological control agents encounter various stress
conditions during extended periods in the soil. We investigated gene expression in desiccation stresstolerant and -susceptible nematodes, to determine whether enhanced tolerance in a nematode population is a result of ‘gene expression response’ to desiccation, or if for enhanced tolerance no gene
expression response is needed; perhaps due to constant ‘readiness’. Expression of four genes, i.e.,
Aldehyde dehydrogenase, Nucleosome Assembly Protein-1, Glutathion Peroxidase, and Heat Shock
Protein 40, was characterized during desiccation stress in five entomopathogenic nematode species
with differing stress tolerance: Steinernema feltiae IS6 strain, S. feltiae Carmiel strain, S. carpocapsae
Mexican strain, S. riobrave and Heterorhabditis bacteriophora TTO1 strain. After 24 h of desiccation,
we observed an inverse relationship between expression of the studied genes and the phenotypic
desiccation tolerance of the nematode. Heterorhabditis bacteriophora TTO1 was most susceptible to
desiccation but showed the highest expression of all the genes under desiccation. Steinernema
carpocapsae Mexican strain and S. riobrave showed least expression of these genes but were most
tolerant to desiccation. Our study showed no induction of gene expression in stress-tolerant nematodes, whereas the stress-susceptible nematodes responded to stress by induction of gene expression.
Since the different levels of gene expression were found to be related to the differing stress-tolerance
capability of different nematodes, these gene expression ratios.
308
p. 309
Genetic improvement of beneficial traits of a mixed Steinernema feltiae
population for enhancement of persistence and efficacy
Mariam Chubinishvili2, Liora Salame1, Cisia Chkhubianishvili2, Itamar Glazer1
1
Dept. of Entomology, Nematology Division, ARO, Volcani Center, Bet-Dagan, 50-250, Israel;
Biocontrol Dept., Kanchaveli L. Institute of Plant Protection, Ministry of Education and Sciences of
Georgia 82, Chavchavadze Ave, Tbilisi 0162, Georgia
2
Abstract: When entomopathogenic nematodes are being applied in an open field they encounter a
verity of hurdles and threats. That includes rapid desiccation on soil surface and gradual desiccation in
the soil depth. Rapid allocation of the target host will reduce the exposure of the infective juveniles of
the nematodes to the harsh environment. In a joint project between Israel and Georgia, we took a
genetic approach to enhance nematode survival and host finding. A mix population of various isolates
of Steinernema feltiae, recently recovered from natural soil in Israel, was subjected to genetic selection
for rapid and gradual desiccation, as well as for host finding in sand column. For selection to improve
rapid desiccation the nematodes were exposed to 60-70% RH at 25°C. The gradual desiccation assay
included a pre-exposure of the nematodes to 97% RH for 72h (this process induces a dormant state,
termed ‘Anhydrobiosis’). Afterwards juveniles were exposed to 85% RH. Selection for enhancement
of host finding was conducted using 15 cm high sand column. Nematodes were applied on top and
insect hosts (Galleria mellonella instars) were placed at the bottom. After 48 h incubation at 25°C the
insects were removed from the columns and were incubated. Dead insects (infected by nematodes)
were further incubated for nematode culture. At each selection round the surviving and host-invading
nematodes were further reproduced. Following 7-11 selection rounds substantial improvement of
desiccation tolerance or host finding was recorded. The selected population will be used in field trails
in Georgia and will be crossed to combine the improved traits in one population.
References
Segal, D. & Glazer. I. 1998: Genetic approaches for enhancing beneficial traits in entomopathogenic nematodes. Japanese J. Nematol. 28: 101-107.
309
Soil insect pests and miscellaneous
312
pp. 313-318
When should we use biocontrol agents against leatherjackets (Tipula
paludosa Meig.)
R. P. Blackshaw
School of Biological Sciences, University of Plymouth, Drake Circus, Plymouth, PL4 8AA,
UK
Abstract: Recent work has demonstrated that biological control agents directed against the larvae of
Tipula paludosa (leatherjackets) are more effective if applied against early instars in October rather
than later instars in the late winter/early spring. In this paper simulation modelling is used to identify
potential strategies for the deployment of biocontrol agents against leatherjackets in continuous grass,
and in grass/arable rotations. It is concluded that the optimal prophylactic strategy in continuous grass
lies between annual and biannual application frequencies, and that application in the autumn preceding
cultivation for a spring crop suppresses populations better than applications earlier in the rotation. A
decision tool based on economic thresholds is presented for grass/arable rotations. The results are
discussed and it is concluded that development of a robust monitoring system is necessary if
recommendations other than prophylactic applications are to be made.
Key words: Tipula paludosa, leatherjackets, biocontrol, rotations, simulation modelling
Introduction
Historically leatherjackets (mainly the larvae of Tipula paludosa Meig.) have been associated
with damage to cereal crops immediately following grass in a rotation (Blackshaw, 1988) as
well as to grass itself (e.g. French, 1969; Blackshaw, 1984). However, since those papers
were published the frequency of leatherjacket attacks in cereal crops has declined. There are a
number of reasons for this. The shift away from spring to winter sown cereals in, for example,
UK agriculture reduced the number of crops exposed to potential attack at the vulnerable
seedling stage, and the increasing arable specialisation witnessed in farm businesses removed
grass from many rotations. Since it is in grass that leatherjacket populations can build up
(Blackshaw & Coll, 1999), this has reduced the overall pest pressure from leatherjackets in
rotations.
The expansion of organic production in recent years is at least partially reversing the
cropping specialisation previously seen because of the need for fertility building phases in
rotations. Whilst there are a number of options to achieve this, the most common is a
grass/clover ley. It follows from this that there will be a commensurate increase in the
potential for leatherjacket damage to succeeding crops. Conventional approaches to the
prevention of economic damage by leatherjackets – the use of monitoring and thresholds to
determine insecticide applications– are not currently an option for organic growers, rather
there is a need to reduce overall risk to vulnerable crops. Thus the emphasis has to move from
control in the crop to management through the rotation in order to optimise the reduction in
pest pressure.
Within an organic rotation there are three viable management options to reduce damage.
The first is the obvious one of avoidance – i.e. do not grow a susceptible crop when or where
damage may occur. In some respects this is easier said than done because the crops from
which leatherjacket damage has been reported range from grasses and cereals, through several
313
314
vegetables and even includes ornamental plants (Blackshaw & Coll, 1999). The second
management tool available to organic growers is the use of seed-bed cultivations. It has been
shown experimentally, and from comparisons between concurrent surveys in grassland and
spring barley, that a mortality of 70% can be achieved when grass is cultivated (Blackshaw
1988). The third option is the application of biocontrol agents as a substitute for conventional
insecticides. It is this latter option that is the focus of this paper.
Important issues for leatherjacket management in organic rotations include the duration
of the fertility building phase and the timing of interventions. The number of possible
permutations militates against a field experimental approach, and it is preferable to at least
initiate investigations through simulation modelling.
A key requirement for this approach is to have a population model that can simulate
leatherjacket dynamics. Early work on the ecology of T. paludosa concluded that numbers
were limited by a shortage of rainfall (Milne et al., 1965), and this was subsequently
interpreted as rainfall controlling the dynamics of the species despite supporting evidence
provided by Mayor & Davies (1976) being amenable to the alternative explanation of densitydependent regulation (Blackshaw, 1999). It has now been shown conclusively that there is
strong evidence for negative feedback in the population dynamics of this species and that
density-dependence is operating as well as (occasional) weather-induced population crashes
(Blackshaw & Petrovskii, submitted).
The presence of negative feedback means that it is possible to develop population models
and a single model capable of simulating T. paludosa dynamics across the different regions of
the UK has now been achieved (Blackshaw & Petrovskii, submitted). This paper takes this
model and incorporates it into a set of simulated rotations to compare some different
leatherjacket management options using biocides. Specifically, questions are addressed
concerning prophylactic use, and timing of application in grassland, and the timing of control
in a grass/arable rotation. An economic threshold model for biocontrol interventions in grass
prior to an arable crop is also presented.
Model source and assumptions
All changes in population from one year to the next use the general simulation model
developed by Blackshaw & Petrovskii (submitted):
⎛ α +r ⎡ N t ⎤ − β
⎞
⎟
∆N t = N t ⎜10 ⎢
−
1
⎥
⎜
⎟
<
N
>
⎣
⎦
⎝
⎠
(1)
where Nt is the average population size in a given year, ∆Nt =Nt+1-Nt is the increase in
number over the consequent season, <N> is the regional mean population size, α is the
intercept and –β is the slope of a regression linking annual per capita growth rate with relative
abundance, and r is a stochastic error term resulting in + 22% variation. In the switching
model presented by Blackshaw & Petrovskii (submitted), selection of the model to estimate
∆Nt was dependent on the probability that population crashes (sensu Milne et al., 1965)
occurred. The alternative models were defined by changes in α but used a common value for β
(0.822). For the purposes of simulating crop rotations the model is restricted to that for when
weather is not adverse with α = -0.0252.
In this paper I assume that autumn applications result in 80% mortality, whereas spring
applications cause 40% mortality, irrespective of the biocontrol agent (Oestergaard et al.
2006).
315
Leatherjacket management in continuous grass
The general model (Eqn.1) with a mean population value (<N>) of 750,000 ha-1 was used to
simulate leatherjacket populations for 1000 generations. The average population over this
time period was used as a benchmark. Further simulations were run with simulated biocontrol
applications at frequency applications of every one, two, three and four years. The average
populations from these simulations were expressed as a proportion of the benchmark.
Leatherjacket management in grass/arable rotations
Simulated rotations comprising four years of grass followed by a spring barley crop were constructed from the general population model using a mean population (<N>) of 600,000 ha-1
and an initial population of 300,000 ha-1. The effect of cultivation is taken to be that reported
by Blackshaw (1988) and was assumed to reduce population levels by 70% between years
four and five of the rotation.
Biocontrol intervention treatments (i.e. 80% mortality) were introduced to the model in
the autumn preceding cultivation and in previous years, using 1000 simulated rotations. The
mean populations from each set of simulations was calculated and expressed as a proportion
of a ‘control’ without any biocontrol application.
Economic thresholds for biocontrol interventions
The rate of damage to spring barley has been calculated as 1.74 x 10-6 t leatherjacket-1 ha-1 by
Blackshaw et al. (1994). Given that the effects of seed-bed preparation on population levels
are known (Blackshaw, 1988) together with the mortality from biocides (Oestergaard et al.
2006), it is possible to calculate a set of break-even values (where cost of control equals the
benefits derived from control) for different leatherjacket populations (62,500, 125,000,
250,000, 500,000, 1,000,000, and 2,000,000 ha-1) in grass prior to cultivation over a range of
values for application costs and barley. This was done for both autumn and spring applications.
This study has not attempted to undertake a full economic analysis of biocontrol options but
has been constrained to consider relative outcomes from a range of possibilities. This is in
accordance with the limitation of the population model used to simulate dynamics in the
various rotations. Neither is the purpose of simulating rotations to provide definitive recommendations for the use of biocides against leatherjackets; rather it is to indicate areas where
future analyses and experimentation may be directed.
Leatherjacket management in continuous grass
The outcomes from the simulations show that, as would be expected, an annual application of
biocide yields the greatest response in terms of suppressing pest pressure when compared
with other application frequencies (Fig 1). Comparison with the relative costs of the different
application frequencies shows that the response curve intersects the cost line between annual
and biannual applications, suggesting that the optimal prophylactic treatment would lie
between these two frequencies (Fig 1).
In grassland systems, where leatherjackets cause greatest economic loss (Blackshaw &
Coll, 1999), the largest suppression of pest numbers occurs with annual applications.
However, there are indications that this would give sub-optimal economic returns, and that a
frequency closer to biannual would be better (Fig 1).
316
These simulations are restricted to autumnal prophylactic applications. Spring prophylaxis would yield identical conclusions since the difference between the two application dates
is a scaler. Nevertheless, it is possible that a rational approach (only applying if a population
is above an economic threshold) may give rise to different outcomes. However, the choice of
prophylaxis for an autumn treatment was pragmatic on two counts. Firstly, the October treatments used by Oestergaard et al. (2006) are at a larval stage when detection and enumeration
is difficult even for experts. There is also evidence from modelling of management options for
leatherjackets using conventional insecticides that the difference in economic returns for
rational c.f. prophylactic early autumn treatments is slight, leaving little margin to pay for
monitoring (Blackshaw, 1985).
Fig 1. Relative risk (dotted line) and control cost (solid line) of leatherjacket attack with
different frequencies of biocide application.
Leatherjacket management in grass/arable rotations
The largest suppression of leatherjacket numbers occurred with the autumn treatment
immediately preceding cultivation for the barley crop, but there was some effect noticeable
from applying the year before this (Fig 2).
Estimating economic thresholds for biocontrol interventions
Plots of the break-even lines provide a (simplified) tool for deciding when there will be an
economic benefit arising from the use of biocides in grassland to protect a subsequent spring
barley crop from leatherjacket damage (Fig 3). The decision tool is used by comparing the
application cost against the predicted value of barley; if the intercept of these two values lies
to the right of the break-even line for the estimated leatherjacket population in grass, then
treatment is worthwhile.
The conclusions from the simulations of grass/spring barley rotations are relatively
straightforward. The best time to apply a biocide to protect the arable crop is in the autumn
preceding cultivation (Fig 2), and it is possible to construct economic thresholds to guide
decisions on where to apply (Fig 3). At this stage, though, the decision tools should not be
taken at face value because there are still complexities to be incorporated. These include the
fact that overwintering mortality will occur so that, for example, a population of 500,000 ha-1
317
in the spring is not the same as one of the same size in the autumn. The same restrictions
regarding monitoring numbers at the desired application time also apply here.
Figure 2. Relative risk of leatherjackets in a spring barley crop following four years of grass
with a biocide applied the autumn preceding cultivations (0 year), and one (-1 year) or two (-2
years) previously.
Figure 3. Decision support models for biocides applied to grass in the autumn and spring
before cultivation for spring barley. It is economically worthwhile applying the biocide if the
intercept of the application costs and barley price is to the right of the line for the relevant
leatherjacket population in grassland.
Thus the outcomes of these simulations have identified a significant research shortfall
because of the need to target biocides against early instars of T. paludosa shown by
Oestargaard et al. (2006). Further progress in developing management strategies to reduce
leatherjacket damage to organic (and other) crops using biocides will be limited by the lack of
a robust and cheap monitoring system.
This study has shown that the question of when to use biocontrol agents against leatherjackets is more complex than the conclusions reached by Oestergaard et al. (2006). A closer
definition of the optimal conditions for use will necessitate economic modelling of identified
318
management options. However, unlike most pest targets for biocides, the data exist to be able
to do this for leatherjackets.
References
Blackshaw, R.P. 1984: The impact of low numbers of leatherjackets on grass yield. Gr. For.
Sci. 39: 339-343.
Blackshaw, R.P. 1985: A preliminary comparison of some management options for reducing
grass loss caused by leatherjackets in Northern Ireland. Ann. Appl. Biol. 107: 279-285.
Blackshaw, R.P. 1988: Effects of cultivations and previous cropping on leatherjacket
populations in spring barley. Res. Dev. Agr. 5: 35-37.
Blackshaw, R.P. 1999: Behaviour mediated population regulation? In: (Eds. M.B. Thomas &
T. Kedwards), Challenges in Applied Population Biology, Aspects of Applied Biology
53: 125-130.
Blackshaw, R.P. & Coll, C. 1999: Economically important leatherjackets of grassland and
cereals: biology, impact and control. Int. Pest Man. Rev. 4: 143-160.
Blackshaw, R.P. & Petrovskii, S.V. (in press): Limitation and regulation of ecological
populations: a meta-analysis of Tipula paludosa field data. Math. Mod. Nat. Phen.
Blackshaw, R.P., Stewart, R.M., Humphreys, I.C. & Coll, C. 1994: Preventing leatherjacket
damage in cereals. Association of Applied Biologists Conference on Sampling to Make
Decisions, Cambridge 22-23 March 1994: 189-196.
French, N. 1969: Assessment of leatherjacket damage to grassland and economic aspects of
control. Proc. 5th Brit. Ins. Fung. Conf. 2: 511-521.
Mayor, J.G. & Davies, M.H. 1976: A survey of leatherjacket populations in south-west
England, 1963-1974. Plant Pathol. 25: 121-128.
Milne, A., Laughlin, R. & Coggins, R.E. 1965: The 1955 and 1959 population crashes of the
leatherjacket, Tipula paludosa Meigen, in Northumberland. J. Anim. Ecol. 34: 529-534.
Oestergaard, J., Belau, C., Strauch, O., Ester, A., van Rozen, K. & Elders, R.-U. 2006: Biological control of Tipula paludosa (Diptera: Nematocera) using entomopathogenic nematodes (Steinernema spp.) and Bacillus thuringiensis subsp. israelensis. Bio. Con. 39: 525531.
pp. 319-326
Biocontrol of Capnodis tenebrionis (L.) (Coleoptera, Buprestidae) with
entomopathogenic fungi
Marannino P.1,2, Santiago-Álvarez C.1, de Lillo E.2, Tarasco E.2, Triggiani O.2,
Quesada-Moraga E.1
1
ETSIAM-Universidad de Córdoba, Campus de Rabanales, 14071 Córdoba, Spain;
2
DiBCA-Università degli Studi di Bari, Via Amendola 165/a, 70126 Bari, Italy
Abstract: A study was carried out at ETSIAM to investigate the potential of Beauveria bassiana
(Bals.) Vuill. and Metarhizium anisopliae (Metsch.) Sorok. for the control of the peach root-borer,
Capnodis tenebrionis (L.), a major threat to stone-fruit orchards in several Mediterranean countries.
The pathogenicity of 4 B. bassiana and 4 M. anisopliae isolates (from ETSIAM collection) against C.
tenebrionis neonate larvae was assessed under endophytic conditions. Mortality rates varied from 23.5
to 100%, 10 days after inoculation by dipping in a suspension with 108 conidia/ml. The most virulent
isolate, M. anisopliae EAMa 01/58-Su, was used as spore suspension (106, 107, 108 conidia/ml) for soil
application on Prunus myrobalana Lois. potted seedlings 2 days before infesting them with C.
tenebrionis neonates. The treatment caused a significant mortality (83.3 to 91.6%) on the larvae
recovered from the roots 4 weeks later. No significant difference was detected among the doses. The
susceptibility of C. tenebrionis adults to EAMa 01/58-Su was also assessed and a significant mortality
(86.7%) was ascertained after immersion in a spore suspension (108 conidia/ml). No significant
difference was pointed out between male and female mortalities. The effectiveness of the selected M.
anisopliae isolate was proved also using non-woven fiber bands impregnated with conidia. Mortality
of beetles that crossed the band varied from 85.7 to 100%. No significant correlation was found
between time needed to cross the band and survival times. Our results demonstrate that EAMa 01/58Su is suitable to target successfully both peach-borer stages.
Key words: peachborer, stonefruit, Beauveria, Metarhizium.
Introduction
Capnodis tenebrionis (Coleoptera, Buprestidae), the so called Mediterranean flat-headed peachborer, is a common pest of rosaceous stone-fruit crops in several countries of the Mediterranean
basin. As largely reported (Alfaro-Moreno, 2005), its heavy infestations result in considerable
losses of plants in nurseries and orchards, mainly due to root/collar tunnelling by larvae. Adult
beetles cause leaf drop and debarking wounds on twigs and young branches, throughout the
warm season (Garrido, 1984). Egg laying occurs in late spring and summer on the ground, close
to the trunk base; after hatching, larvae crawl through the soil (Marannino & de Lillo, 2007)
using chemical cues to locate host hypogeal organs (Rivnay, 1945) where they soon begin to
bore into cambium and sapwood.
Capnodis tenebrionis management is based on repeated foliar sprays of broad-spectrum
synthetic insecticides against feeding adults during the pre-oviposition period (Colasurdo et al.,
1997). Neonates represent a vulnerable stage and could be affected by dusting the soil with
large amounts of chemicals (Ben-Yehuda et al., 2000) or applying entomoparasitic nematodes
(Marannino et al., 2004) to prevent root colonization. Chemical applications against endophytic
larvae are unless since they live in sheltered sites. The aim of the present work was to select,
from among a list of fungal candidates, an isolate suitable to be effectively administered against
319
320
both insect stages, giving higher priority to the larvicidal effect as larvae play undoubtedly the
most relevant role in causing economic damage.
Entomopathogenic fungi
The strains used in the experiment belong to the fungal collection of Agricultural and Forestry
Sciences and Resources (AFSR-ETSIAM), Department of the University of Cordoba (Spain).
There were eight fungal isolates, four of Beauveria bassiana (Bals.) Vuill. (EABb 01/33-Su,
EABb 01/103-Su, EABb 04/01-Tip, EABb 1333) and four strains of Metarhizium anisopliae
(Metsch.) Sorok. (EAMa 01/121-Su, EAMa 01/152-Su, EAMa 01/58-Su, EAMa 01/44-Su).
Conidial suspensions were obtained by scraping conidia from 15-day-old cultures on Malt
Agar (12.75g/l malt extract, 2.75g/l dextrine, 2.35g/l glycerol, 0.78g/l gelatine peptone and
15.0 g/l agar) at 25°C in darkness into an aqueous solution of 0.2% Tween 80. Then they were
filtered through several layers of cheesecloth to remove mycelium. The concentrations of
viable conidia were estimated as colony forming units using a dilution plate count method.
Insects
Newly emerged adults (males and females) of C. tenebrionis were collected in autumn from
heavily infested stone-fruit orchards. The beetles were fed on fresh apricot twigs (de Lillo,
1998) under laboratory conditions (28-30°C, 40-50% R.H., 16:8 L:D photoperiod), which
allowed them to reach sexual maturity, mate and lay eggs in dishes filled with sifted sand,
according to the method described by Garrido et al. (1997). Incubation took place under the
same conditions. Adults of approximately the same size and neonate larvae no more than 24 h
old were selected for the experiments.
Suceptibility of C. tenebrionis neonate larvae to B. bassiana and M. anisopliae
Larvae were immersed individually for 10s in a spore suspension (1.0x108 conidia/ml) or in
0.2% Tween 80 aqueous solution (controls). Then they were transferred into a 10-mm-long
cut made at one end of about 10 cm by 1-cm-diameter pieces of apricot branches collected
from an organic orchard. Infested material was kept at 25°C and 65% R.H. in the dark. After
10 days, each branch piece was stripped of its bark and examined for larvae using a dissecting
microscope. Each of 4 replicates per fungal isolate and control consisted of 10 larvae; the
experiment was done twice.
Susceptibility of C. tenebrionis adults to EABb 04/01-Tip and EAMa 01/58-Su
Beetles were immersed individually for 10s in a conidial suspension (1.0x108 conidia/ml) or
in 0.2% Tween 80 aqueous solution (controls). Then, they were moved to clean rearing boxes
kept at 25°C, fed every day on fresh apricot twigs and monitored daily for mortality. There were
three replicates (boxes) per treatment (two isolates and the controls) and 10 individuals per
each box (5 males and 5 females). Adult mortality was assessed within 4 weeks following the
application. The cadavers were removed daily.
Potted plant bioassay with soil application of EAMa 01/58-Su isolate
The bioassay was performed with potted seedlings (5-6 months old) of cherry plum (Prunus
myrobalana Lois.), a common apricot rootstock. These nursery plants were selected mainly to
allow successively a simpler and faster detection of larvae in the root system. The plants were
maintained at 25±5ºC and 60±5% RH and regularly supplied with sterile distilled water. Five
milliliters of a spore suspension (1.0x106, 1.0x107, 1.0x108 conidia/ml) or of 0.2% Tween 80
321
aqueous solution (control) were spread onto the soil (85% organic matter, pH 6.5). Irrigation
was then stopped for 4 days to make the roots more accessible to the neonate larvae of C.
tenebrionis. Two days after the application, 4 larvae were placed in each pot near the base of
the stem and allowed to settle under the soil surface. Three weeks later, the roots were
checked for the presence of larvae inside them to assess larval mortality. Each treatment
consisted of 4 replicates, with 10 plants per replicate.
Band exposure bioassay with application of EAMa 01/58-Su isolate
Non-woven fiber bands obtained from Taotec® (Soften S.p.A., Italy) were utilized. Applying
this commercial product around tree collar or trunk prevents crawling insects (mainly
weevils) from climbing onto host plants from ground. All bands used in this bioassay
measured 100x200 mm and were composed of PEGT [poly (ethylene glycol terephtalate)]
(density of 10 kg/m3 and 0.03% hygroscopicity). The bands were impregnated by dragging on
a bed of conidia and then gently shaken to remove excess conidia. Initial conidial density on
bands, which was quantified by blending four 30 cm2 pieces of bands and counting conidia
using a hemocytometer, was 4.45x108 ± 5.0x107 condia/cm2. The fiber bands were wrapped
around the central area of each of the six 400-mm-long and 15-mm-diameter pieces of apricot
branches cut for the experiment. These pieces were placed vertically in a box containing
sterilized soil and one beetle was put close to each of them and allowed to climb. When
needed, the buprestids were also stimulated to start climbing. The test ended 15 min after the
beginning of climbing or before if the insect had crossed the barrier. Individuals were discarded when they didn’t walk enough to reach the Taotec® stripe within 10 min; in case of fall
they were put again close to the stem to restart climbing. The time of contact with the fungal
band was recorded. Test (n=120) and control (n=20) adults were individually reared in sterile
50 ml conical centrifuge tubes (JLC, Spain) with the opening covered by 1-mm-mesh window
screen stopped with a rubber band. They were fed on fresh apricot twigs and monitored daily
for mortality over a 4-week period after exposure.
Fungal outgrowth
When external signs of fungal infection were not observed, cadavers were surface sterilized
with 1% sodium hypochlorite followed by three rinses with sterile distilled water, placed on
sterile wet filter paper in sterile Petri dishes, sealed with parafilm and kept at room
temperature.
Both larval and adult mortality data were analyzed using analysis of variance (ANOVA) and
Tukey’s (HSD) test. Before conducting ANOVA, all percentages were transformed using the
arcsin transformation. In the adult band exposure assays, the cumulative mortality response
across the assessment period was analyzed with Kaplan-Meier survival analysis and Pearson
correlation was performed between time to cross the band and time of death. All analyses
were carried out using the SPSS 12.0 for Windows (SPSS 2002).
Susceptibility of C. tenebrionis neonate larvae to B. bassiana and M. anisopliae
All tested fungal isolates turned out to be pathogenic to peach-borer neonate larvae whose
mortality ranged from 23.5 to 100%, with a significant effect of the fungal treatment (F8,35=266,
P<0.001) (Fig. 1). Instead, no mortality was recorded in the control. In general, M. anisopliae
isolates caused higher mortality than those of B. bassiana. In most cases, postmortem hyphal
322
growth and sporulation were observed covering the larvae in the galleries, probably as a
consequence of the their high humidity conditions. The present susceptibility test has provided
evidence that fungal infection can occur when neonates are in their natural location for
development, demonstrating the potential of the fungi for larval control of C. tenebrionis.
Figure 1. Pathogenicity of eight fungal isolates to neonate larvae of C. tenebrionis. Means
with the same letter are not significantly different (P<0.05) according to the Tukey’s (HSD)
test.
Suseptibility of C. tenebrionis adults to EABb 04/01-Tip and EAMa 01/58-Su
Adult mortality was significantly affected (F2,17=494.0; P< 0.0001) by treatment with the two
isolates selected among the best ones of B. bassiana and M. anisopliae for controlling larvae
(Tab. 1). Mortality rates were 100.0% and 86.7% for EABb 04/01-Tip and EAMa 01/58-Su
isolates, respectively. Uninoculated individuals showed only 3.3% mortality. After inspection,
all dead insects exhibited mycosis (Fig. 3). Considering the fungal treatments, there were no
significant differences between male and female mortalities within each one (Tukey’s test;
P<0.05) as well as between the two total mortality rates, whereas a significant difference (logrank=4.51; P=0.03) was detected comparing the Average Survival Time (AST) of adults (Tab.
1).
Results of this bioassay, using the same conidial concentration (1.0x108 conidia/ml) as
the larval test, demonstrated that the selected fungal isolates are highly effective also against
the peach-borer adults. The results achieved are consistent with those reported for the
buprestid Agrilus planipennis Fairmaire, which showed no adult mortality for the first 3 days
after exposure and a cumulative mortality ranging from 97.5 to 100% using B. bassiana and
M. anisopliae at a concentration of 107 conidia/ml (Liu & Bauer, 2006). However, the AST of
treated adults, was longer for C. tenebrionis (11-12 d) than for the emerald ash borer (4.2-4.7
d), even though the conidial suspension was more concentrated (108 conidia/ml). The larger
size of C. tenebrionis individuals (15 to 25 mm long versus 7.5 to 13.5 mm) and the greater
cuticle hardiness might account, at least in part, for these differences.
Isolate EABb 04/01-Tip turned out to be statistically as effective as EAMa 01/58-Su
against the peach-borer adults, but it had been outperformed in the larval susceptibility test.
Therefore, it was decided to select the latter isolate for evaluation in the subsequent bioassays.
323
Table 1. Insecticidal activity of B. bassiana and M. anisopliae isolates on C. tenebrionis
adults.
Mortality (%) ±SE*
Treatment
Total
Male
Female
Kaplan-Meier Survival
Analysis
Confidence
AST (±SE) **
interval
15.0 ± 0.0 a
15.0 – 15.0
Control
3.3 ± 3.3 a
6.6 ± 6.6 a
0.0 ± 0.0 a
EABb
100.0 ± 0.0 b
100.0 ± 0.0 b 100.0 ± 0.0 b
11.1 ± 0.2 b
10.6 – 11.6
04/01-Tip
EAMa
86.7 ± 6.6 b
93.3 ± 6.6 b 80.0 ± 11.5 b
11.6 ± 0.5 c
10.8 – 12.5
01/58-Su
* Means within columns with the same letter are not significantly different (P<0.05) according to the
Tukey’s (HSD) test.
** Means within columns with the same letter are not significantly different (P<0.05) according to the
Log-rank test.
Potted plant bioassay with soil application of EAMa 01/58-Su isolate
Almost all seedlings (158/160) were successfully infested and 45.0 to 50.0% of applied larvae
were recovered from the roots (Tab. 2), with no significant difference among treatments. Soil
inoculation had a significant effect on the mean number of dead larvae (F3,159 =58.91;
P<0.0001), with mean mortality ranging from 83.3 to 91.6%. No significant differences
(Tukey test; α=0.05) were found among the three fungal doses with reference to larval
mortality. In most cases, fungal outgrowth was observed on larvae within the roots.
The potted plant bioassay simulated both natural endophytic conditions of the larvae and
natural rates of larvae colonizing plant tissues (Marannino et al., 2004). Experimental data
showed that the inoculum of EAMa 01/58-Su isolate introduced in the soil was capable of
infecting C. tenebrionis neonate larvae even though it found not optimal conditions to
maximize the insecticidal potential in a non-sterile soil with high organic matter content.
Since in nature peach-borer egg-laying occurs just beneath the ground surface (Guessous,
1950), it is noteworthy to point out that application of conidia to the top 20 mm of soil
provided nearly complete control of beetle larvae at each of the three assayed dosages.
Chandler and Davidson (2005) established that most conidia drenched onto the surface of
compost remained in the top layer, increasing the exposure of Delia radicum (L.) neonates to
fungi as they moved to the root zone. A strong correlation between fungal concentrations in
soil and the degree of reduction in larval mortality could not be demonstrated, in agreement
with Dolci et al. (2006), who also did not find this correlation in Beauveria brongniartii
(Saccardo) Petch. soil treatment against Melolontha melolontha L.
Band exposure bioassay with application of EAMa 01/58-Su isolate
Individuals (91) which crossed the band employed a mean period (±SE) of 648.7±22.4 s, with
a minimum of 72 s and a maximum of 878 s. This period was statistically similar to that of the
control group (623.3±18.3 s, with a minimum of 67 s and a maximum of 845 s).
Treated adults showed total mortality rates and mycosis rates ranging from 85.7 to 100%
and from 33.3 to 100.0%, respectively. No mortality was recorded in the controls. Moreover,
no relationship (P=0.99) was found between exposure time and time of death (correlation
coefficient of -0.0013) or mortality (either total or due to mycosis). AST values did not differ
(Log rank test; P<0.05) among exposures, with mean values varying between 10.3 and 16.0
days (Tab. 3).
324
Table 2. Effect of soil application with M. anisopliae EAMa 01/58-Su isolate on C. tenebrionis neonate larvae
Larvae recovered per plant (All data are mean ± SE)*
Dose
(conidia/ml)
Total
0
Dead larvae
Number
Percentage
2.0 ± 0.1 a
0.0 ± 0.0 a
0.0 ± 0.0 a
6
1.8 ± 0.1 a
1.45 ± 0.11 b
83.3 ± 4.6 b
1 x 107
1.9 ± 0.2 a
1.62 ± 0.13 bc
83.7 ± 4.8 b
1 x 108
2.0 ± 0.1 a
1.85 ± 0.12 c
91.6 ± 3.3 b
1 x 10
* Means within columns with the same letter are not significantly different (P<0.05) according to the
Tukey’s (HSD) test.
Table 3. Mortality and Kaplan-Meier survival analysis statistics of C. tenebrionis adults
inoculated by walking on non-woven fiber bands impregnated with M. anisopliae EAMa
01/58-Su isolate.
Kaplan-Meier survival analysis
Average Survival Time
95% confidence interval
(mean ± SE)*
1-2
3
11.0 ± 2.0 b
7.1 – 14.9
2-3
3
11.0 ± 1.2 b
8.7 – 13.2
3-4
0
–
–
4-5
2
13.0 ± 0.0 b
13.0 – 13.0
5-6
5
14.0 ± 1.5 b
11.1 – 16.9
6-7
5
10.8 ± 1.8 b
7.3 – 14.3
7-8
3
16.0 ± 5.1 b
5.9 – 26.1
8-9
2
14.0 ± 1.0 b
12.0 – 15.9
9-10
7
13.4 ± 2.5 b
8.6 – 18.3
10-11
6
12.5 ± 1.4 b
9.8 – 15.2
11-12
10
10.3 ± 0.8 b
8.8 – 11.8
12-13
15
12.2 ± 0.8 b
10.7 – 13.6
13-14
18
12.8 ± 0.7 b
11.4 – 14.2
14-15
41
14.4 ± 0.7 b
13.0 – 15.9
* Average Survival data with the same letter are not significantly different (Log rank statistic; α=0.05).
AST limited to 28 days.
Time on band
(minutes)
Number of
insects
Despite the scarce data available, the use of non-woven fiber bands to apply entomopathogenic fungi has been proposed by some authors (Nobuchi, 1993; Higuchi et al., 1997) as the
most effective microbial control measure for tree-boring Cerambycidae and Buprestidae. In a
laboratory study similar to ours, Dubois et al. (2004) obtained ASTs ranging from 9.0 to 10.0
days for Anoplophora glabripennis (Motschulsky) adults exposed to bands treated with B.
brongniartii. With strict regards to C. tenebrionis, adults must feed intensively before reproduction and, when emerging from soil, they are not still able to fly due to their weakness and to the
lack of optimal temperature, especially in springtime after over-wintering. As a result, adults
have to reach the host-tree canopy by climbing the trunk (Caponero et al., 2006) and are con-
325
sequently forced to cross the band impregnated with conidia. Considering that the period from
adult beetle emergence to oviposition is longer than 2 months under natural conditions (Garrido,
1984), we could expect a significant decrease of the number of females reaching the onset of
oviposition, and also a possible reduction of the biotic potential of fungally challenged females
(Quesada-Moraga et al., 2004, 2006).
Capnodis tenebrionis natural life cycle and behavior suggest that a fungal-based control
strategy may potentially lead to additional infections, as a result of soil and plant treatment.
Adults could be targeted during overwintering that occurs in/on the soil (Garrido, 1984); or while
walking across the soil surface, from plant to plant; or at the time of oviposition. In the last case,
conidia adhering to ovipositor and terminal abdominal segments may be transferred to eggs,
causing subsequent infection of larvae. Inoculation could take place also during mating, which
lasts several minutes (Chrestian, 1955; Bari et al., 2002), and involves a large contact between
the partners’ bodies (Bari et al., 2002).
In conclusion, the results of our research efforts indicate that this approach could be
successfully used to protect fruit bearing orchards, greenhouse trees and nurseries from C.
tenebrionis attack.
Acknowledgements
This research was supported by Project n° 36 of the I.F.A.P.A. (expdte 92162/1) from the
regional government of Andalusia (Junta de Andalucía). P. Marannino is a fellowship holder
at University of Bari. We are grateful to Michele Lassandro and Inmaculada Garrido Jurado
for the valuable help received in rearing the beetles and in carrying out the bioassays.
References
Alfaro-Moreno, A. 2005: Entomología Agraria. Edit. Cándido Santiago Álvarez. Diputación
Provincial de Soria: 219-221.
Bari, G., De Cristofaro, A., de Lillo, E., Germinara, S. 2002: Studio preliminare sulle interazioni intraspecifiche ed interspecifiche in Capnodis tenebrionis (L.) (Coleoptera:
Buprestide). Atti XIX Congr. Naz. It. Entomologia, Catania: 725-731.
Ben-Yehuda, S., Assal, A. & Mendel, Z. 2000: Improved chemical control of Capnodis
tenebrionis and C. carbonaria in stone-fruit plantations in Israel. Phytoparasitica 28(1):
27-41.
Caponero, A., Marannino, P., de Lillo, E. 2006: Il capnode delle drupacee preoccupa in Basilicata. Inf. Agr. 16: 66-68.
Chandler, D., Davidson, G. 2005: Evaluation of entomopathogenic fungus Metarhizium
anisopliae against soil-dwelling stages of cabbage maggot (Diptera: Anthomyiidae) in
glasshouse and field experiments and effect of fungicides on fungal activity. J. Econ.
Entomol. 98: 1856-1862.
Chrestian, P. 1955: Le Capnode noir des Rosacées. Protectorat de la République Française au
Maroc, Serv. Déf. Vég. Travaux originaux n. 6.
Colasurdo, G., Vallillo, E., Berchicci, G. & de Lillo, E. 1997: Prime esperienze di controllo
degli adulti di Capnodis tenebrionis (L.) (Coleoptera Buprestidae) in Molise. Inf. Fitop.
10: 53-57.
de Lillo, E. 1998: Andamento dell'ovideposizione di Capnodis tenebrionis (L.) (Coleoptera,
Buprestidae). Entomologica 32: 153-165.
326
Dolci, P., Guglielmo, F., Secchi, F., Ozino, O.I. 2006: Persistence and efficacy of Beauveria
brongniartii strains applied as biocontrol agents against Melolontha melolontha in the
Valley of Aosta (northwest Italy). J. Appl. Microbiol. 100: 1063-1072.
Dubois, T., Zengzhi, L., Jiafu, H., Hajek, A.E. 2004: Efficacy of fiber bands impregnated with
Beauveria brongniartii cultures against the Asian longhorned beetle, Anoplophora
glabripennis (Coleoptera: Cerambycidae). Biol. Control 31: 320-328.
Garrido, A. 1984: Bioecología de Capnodis tenebrionis L. (Col.: Buprestidae) y orientaciones
para su control. Bol. San. Veg. Plagas 10: 205-221.
Garrido, A., del Busto, T., Malagón, J. 1987: Método de recogida de huevos de Capnodis
tenebrionis L. (Coleop.; Buprestidae) y algunos factores abióticos que pueden condicionar la puesta. Bol. San. Veg. Plagas 13: 303-309.
Guessous, A. 1950. Recherches sur la ponte du Capnode noir des arbres fruitiers (Capnodis
tenebrionis L.). Rev. Path. Vég. Ent. Agr. Fr. 29: 137-151.
Higuchi, T., Saika, T., Senda, S., Mizobata, Y., Nagai, J. 1997: Development of biorational
pest control formulation against longicorn beetles using a fungus Beauveria brongniartii
(Sacc.) Petch. J. Ferment. Bioengineer. 84: 236-243.
Liu, H., Bauer, L.S. 2006. Susceptibility of Agrilus planipennis (Coleoptera: Buprestidae) to
Beauveria bassiana and Metarhizium anisopliae. J. Econ. Entomol. 99: 1096-1103.
Marannino, P., de Lillo, E. 2007: Capnodis tenebrionis (L. 1758) (Coleoptera: Buprestidae):
morphology and behaviour of the neonate larvae and soil humidity effects on the egg
eclosion. Ann. Soc. Ent. Fr. 43: 145-154.
Marannino, P., Tarasco, E. & de Lillo, E. 2004: Biological notes on larval hatching in
Capnodis tenebrionis (L.) (Coleoptera Buprestidae) and evaluation of entomopathogenic
nematodes in controlling neonate larvae. Redia (2003) 86: 101-105.
Nobuchi, A. 1993: An automatic releasing equipment of Beauveria contaminated bark beetle
for microbial control of Monochamus alternatus. Forest Pests 42: 213-217.
Quesada-Moraga, E., Ruiz-García, A., Santiago-Álvarez, C. 2006: Laboratory evaluation of
the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae against
puparia and adults of Ceratitis capitata (Diptera: Tephritidae). J. Econ. Entomol. 99:
1955-1966.
Quesada-Moraga, E., Santos-Quirós, R., Valverde-García, P., Santiago-Álvarez, C. 2004:
Virulence, horizontal transmission and sublethal reproductive effects of Metarhizium
anisopliae (Anamorphic fungi) on the German cockroach (Blattodea: Blattellidae). J.
Rivnay, E. 1945: Physiological and ecological studies on the species of Capnodis in Palestine
(Col., Buprestidae). Bull. Entomol. Res. 36: 103-119.
pp. 327-330
Infectivity of Steinernema feltiae and Heterorhabditis bacteriophora
towards first and second stage larvae of the forest cockchafer,
Melolontha hippocastani
Kerstin Jung1, Arne Peters2, Juliana Pelz1
1
JKI, Institute for Biological Control, Heinrichstrasse 243, 64287 Darmstadt, Germany
2
E∼nema GmbH, Klausdorfer Str. 28-36, 24223 Raisdorf, Germany
Abstract: At high population densities, the forest cockchafer, Melolontha hippocastani is a serious
pest insect causing death to trees and seedlings. In the southern Rhine valley of Germany, a new
gradation of M. hippocastani has built up since the 1980s. Despite considerable results on the control
of grubs with entomopathogenic nematodes (EPN), so far no nematode was identified, which efficiently infect Melolontha spp. We herein report on laboratory assays with H. bacteriophora and S. feltiae,
both alone, in combination with one another and with B. brongniartii against the 1st and 2nd instar
larvae of M. hippocastani. First instar larvae did not seem to be more susceptible than second instar
larvae. None of the nematode, alone or in combination caused high mortality, with H. bacteriophora
being a little better than S. feltiae (28 compared to 4 % at 500.000 IJ’s/m2). In conclusion, the
nematodes currently available on the German market cannot reach control reported for B. brongniartii
(BIPESCO1; 60 % at 1x1010 conidia/m2).
Key words: soil pest, white grubs, entomopathogenic nematodes, Beauveria brongniartii
Introduction
The forest cockchafer, Melolontha hippocastani, is a common pest in German forests with an
infested area of 12 000 ha of which > 2000 ha are endangered to be extincted. Although the
densities of white grubs are high (sometimes >100 L3/m2) for more than 20 years now, no
significant epizootics have developed yet. Entomopathogens, like Beauveria brongniartii and
nematodes, Steinernema and Heterorhabditis spp. are well known for their ability to control
white grub populations: B. brongniartii is being used in apple plantations and on meadows
routinely against the field cockchafer, M. melolontha in Austria, Italy and Switzerland (e.g.
Schweigkkofler & Zelger, 2002; Keller, 2004). H. bacteriophora is applied on golf courses in
Germany against Phylloperta horticola and other grubs. H. megidis was shown to be highly
infective towards Hoplia philanthus. However, both species cause significant mortality of M.
melolontha only at high dosages (5000 IJ’s/larva) and were not effective against M. hippocastani (Schmincke & Bathon, unpubl.). Out of the genus Steinernema the two species S.
glaseri and S. scarabaei cause considerable mortality in both species, M. melolontha and M.
hippocastani (Peters, 2000; Koppenhöfer et al., 2000; Berner & Schnetter, 2002). However,
both species are not indigenous to Germany and their use might therefore not be acceptable in
the open field. In a practical situation, it has been observed that a combination of H. bacteriophora and S. feltiae was better than either nematode alone and resulted in a satisfying
reduction of a M. melolontha population (Peters, pers. comm.). The objective of the experiments was to investigate whether the combination of two nematodes leads to a higher
mortality than either nematode alone and to see whether control might be comparable to that
achieved with B. brongniartii.
327
328
Insects
Grubs of M. hippocastani were collected in September 2006 and March 2007 in the forest
nearby Darmstadt. They were kept singly in plastic cups (Belaplast, 120 ml), filled with moist
potting soil (Fruhstorfer Erde, Typ Null) and fed with carrot slices when necessary. They
were held for at least four weeks in quarantine before being used in the bioassays, in order to
elliminate specimen carrying latent infections e.g. with Rickettsiella melolonthae.
Entomopathogens
S. feltiae and H. bacteriophora were provided by e∼nema GmbH (Raisdorf, Germany). They
were kept at 10°C and suspended in tap water at concentrations of 0.5 and 1 Mio IJ’s m-2 for
application. B. brongniartii (BBA-B.br. 61 = BIPESCO 1) was grown on malt pepton agar..
Conidiospores were harvested by washing off the plates with Tween 80 (0.1 %). The spore
suspension was applied at the dose of 1x1010 conidia m-2.
Bioassay
On the day of the experiment, single grub were transferred to a plastic cups, filled with 38 g
of a mixture of potting soil (Fruhstorfer, Typ Null) and sand (ratio 1:1). Each treatment
consisted of 25 specimen. Each cup received 1 ml of the pathogen suspension (in the control 1
ml of Tween 80 0.1 %), except for the combination of nematodes, which received 2 ml. The
insects were kept at 20 ± 2°C and checked in weekly intervals for a total period of seven
weeks. During this period they were fed with carrot slices. Dead specimen were placed either
in moist chambers or on mini-white traps when they appeared to be killed either by fungi or
nematodes. The identity of the killing agent was confirmed by light microscopy. During the
first experiment grubs from September 2006 were used, whereas the ones in the second
experiment had been collected in 2007. After seven weeks the surviving grubs were removed
and two larvae of the greater waxmoth were placed into the treated soil. After one week of
incubation at 20 ± 2°C, the Galleria-larvae were checked for infection by any persisting
nematode or conidia.
The results of the first experiement are presented in Figure 1. Both nematode species were
able to infect and kill M. hippocastani 1st stage larvae. The highest mortality caused by a
nematode treatments was 28%. S. feltiae alone did not harm any white grubs. Nevertheless,
when G. mellonella larvae where placed in the experimental soil after the experiment was
finished, most of them were killed by nematodes (data not shown). After 7 weeks most grubs
had been killed by B. brongniartii (60 %). The data so far collected within the second bioassay are summarized in Figure 2. By the time of presenting this talk, the experiment was still
ongoing.
In the first experiment, all white grubs were in the first larval stage. After the second
week they started to molt. At the onset of the second experiment, all white grubs had reached
the second stage. Only a few 1st stage larvae were left. They were used to repeat the
Beauveria treatment. However, they molted already after three days. By the time of the
presentation of these results the experiment was still running.
In conclusion, nematodes are able to infect and kill white grubs of M. hippocastani faster
than the fungus, because there were a few dead grubs after one week already (Figures 1 & 2),
but at the end, B. brongniartii is more effective towards the 1st stage larvae. In earlier
329
bioassays a treatment of M. hippocastani 2nd and 3rd stage larvae with B. brongniartii spores
resulted in mortality rates ≥ 80 % after three weeks (Jung & Zimmermann, 2000). Whether
the relatively low mortality of the 1st stage larvae achieved in the present bioassay is due to
differences in susceptibility between the larval stages needs to be investigated.
30
living white grubs
%
25
4
20
12
16
20
28
15
10
60
5
0
1
2
3
4
5
6
7
control
B.br. 61
H.b. 0.5 Mio
H.b. 1 Mio
S.f. 0.5 Mio
S.f. 1 Mio
H.b.+S.f. 0.5 Mio each
H.b.+S.f. 1 Mio each
weeks
Figure 1. Number of living 1st instar Melolontha hippocastani during seven weeks at 20 ± 2°C
after treatment with either one or two nematodes (H.b. = Heterorhabditis bacteriophora; S.f. =
Steinernema feltiae), or Beauveria brongniartii (B.br.61). Percentage mortality at the end of the
experiment is given on the right hand side.
living white grubs
30
25
20
15
10
5
0
1
2
3
4
5
6
weeks
control
Bbr.61 L2
Bbr.61 L1
Hb 0.5 Mio
Hb 1 Mio
S.f. 0.5 Mio
S.f. 1 Mio
Hb+S.f. 0.5 Mio each
Hb+S.f. 1 Mio each
Figure 2. Number of living 1st and 2nd instar Melolontha hippocastani during three weeks at 20 ±
2°C after treatment with either one or two nematodes (H.b. = Heterorhabditis bacteriophora; S.f.
= Steinernema feltiae), or Beauveria brongniartii (B.br.61). By the time of the presentation the
experiment was still ongoing.
330
Acknowledgements
We thank the Hesse Ministry for Environment, Agriculture and Consumer Protection for
financial support. The assistance of Arthur Kromm, Daniela Dick, Christina Grün, John Hazin
and Tanja Strecker in collecting and keeping the white grubs is gratefully acknowledged.
References
Ansari, M.A., Tirry, L. & Moens, M. 2003: Entomopathogenic nematodes and their symbiotic
bacteria for the biological control of Hoplia philanthus (Coleoptera: Scarabaeidae)
Biological Control 28: 111-117.
Berner, M. & Schnetter, W. 2002: Field trials with the entomopathogenic nematode Heterorhabditis bacteriophora against white grubs of the European cockchafer (Melolontha
melolontha) in the southern part of Germany. IOBC wprs Bulletin 25(7): 29-34.
Jung, K. & Zimmermann, G. 2000: Experiences with the development of a product based on
the fungus Beauveria brongniartii for the control of field and forest cockchafer. Mitt.
Biol. Bundesanst. Land- Forstwirtsch. 376: 183.
Keller, S. 2004: Engerlings-Vorkommen und Bekämpfung in der Schweiz. Nachrichtenbl.
Deut. Pflanzenschutzd. 56: 88-90.
Koppenhöfer, A., Wilson, M., Brown, I., Kaya, H.K. & Gaugler, R. 2000: Biological control
agents for white grubs (Coleoptera: Scarabaeidae) in anticipation to the establishment of
the Japanese beetle in California. J. Econ. Entomol. 93: 71-80.
Peters, A. 2000: Susceptibility of Melolontha melolontha to Heterorhabditis bacteriophora,
H. megidis and Steinernema glaseri. IOBC wprs Bulletin 23(1): 39-45.
Rohde, M., Bressem, U., Bornholdt, G., Brenner, U. 1996: Untersuchungen zur Bekämpfung
des Waldmaikäfers in Südhessen 1994. Forschungsberichte, Bd. 22, HLFWW Hann.
Münden, Germany.
Schweigkofler, W. & Zelger, R. 2002: Were control measures responsible for the decline of
Melolontha populations in South Tyrol? IOBC wprs Bull. 25(7): 65-71.
Zimmermann, G. 1998: Der entomopathogene Pilz Beauveria brongniartii (Sacc.) Petch und
Erfahrungen bei seinem Einsatz zur biologischen Bekämpfung von Feld- und Waldmaikäfer. Nachrichtenbl. Deut. Pflanzenschutzd. 50: 249-256.
p. 331
Susceptibility of soil-dwelling developmental stages of rose-infesting
sawflies to entomopathogenic nematodes
Marek Tomalak
Department of Biological Pest Control and Quarantine, Institute of Plant Protection, ul. Miczurina
20, 60-318 Poznan, Poland
Abstract: Wild and cultivated roses are host plants for a wide variety of sawfly species. At least some
of them can become important pests in rose nurseries and ornamental plantations. Frequently, several
of these insect species feed concurrently or in succession on the same plant, causing significant
deterioration of the ornamental quality of infested shoots or entire shrubs. In the nursery the leaffeeding sawfly larvae can be effectively controlled with contact insecticides, however, in home
gardens and public parks, particularly those located within the urban environment, application of
chemical insecticides is usually limited or completely banned due to human safety reasons. Therefore,
alternative, effective and still environmentally safe means of control of these insects would be of
particular value to the city green space management. The susceptibility of soil-dwelling developmental
stages of five common species of rose sawflies, namely Arge pagana, A. ochropus, Blennocampa
phyllocolpa, Cladius pectinicornis and Allantus viennensis to entomopathogenic nematodes was tested
under laboratory and semi-field conditions. All, but A. viennensis construct a pupal cocoon and after it
is completed the nematodes cannot reach the insects. However, the examined species showed to be
highly susceptible to nematode infection, providing the infective juveniles had been present in the soil
before the insect larvae descended for pupation. Significant differences have been observed in the
host-finding and infection process between Steinernema feltiae and Heterorhabditis megidis. S. feltiae
infected and killed all susceptible larvae before their completion of the pupal cocoon. All the
remaining insects found in cocoons proved to be uninfected. In contrast, H. megidis killed most of the
exposed insects after they managed to build their cocoons. Potential mechanism of this phenomenon
and its consequences for the nematode population persistence in the soil are discussed.
Keywords: biological control, entomopathogenic nematodes, Heterorhabditis, sawflies.
References
Mracek, Z., Becvar, S., Kindlmann, P. 2002. Do insect aggregations influence entomopathogenic nematodes occurrence ? IOBC/WPRS Bulletin 23(2): 123-128.
Tomalak, M. 2005. Potential of entomopathogenic nematodes for biological control of
selected pest insects infesting urban trees. IOBC/WPRS Bulletin 28(3): 3-7.
331
pp. 332-335
Field results on the use of Heterorhabditis bacteriophora against the
invasive maize pest Diabrotica virgifera virgifera
Ralf-Udo Ehlers1, Ivan Hiltpold3, Ulrich Kuhlmann2, Stefan Toepfer2
1
Institute for Phytopathology, Dept. Biotechnology and Biological Control, ChristianAlbrechts-University Kiel, Hermann-Rodewald-Str. 9, 24118 Kiel, Germany; 2CABI
Bioscience, Rue des Grillons 1, 2800 Delémont, Switzerland; 3University of Neuchatel, EmileArgand 11, 2000 Neuchatel, Switzerland
Abstract: The western corn rootworm (CRW) (Diabrotica virgifera virgifera LeConte, Coleoptera:
Chrysomelidae) is an invasive alien pest of maize (Zea mays L) in Europe. The three larval instars
feed on maize roots and cause the major damage. Chemical control measures usually reduce the root
damage by one unit on the Iowa root rating scale. Among several different nematode species tested in
the laboratory, Heterorhabditis bacteriophora (Nematoda: Rhabditida) was selected as the most
efficient species against larvae of the CRW and was further tested as a biological control product for
inundative releases against D. v. virgifera larvae. The control efficacy of H. bacteriophora was studied
in eight maize fields in southern Hungary between 2004 and 2006. Nematodes were either applied in
May during sowing of the maize with the precision seed drill machine or in June when plants were
>30 cm high and larvae had hatched with conventional spraying equipment. In May nematodes were
applied in liquid or powder into the soil in the row where the seed was deposited. After application the
machine covered nematodes and seeds with soil. Application in June was in liquid by solid stream
application along both sides of the plant or over the complete field with flat fan nozzles. Damage and
number of emerging adults per plant was assessed in July. In untreated control plots, 23% of plants
surpassed the economic root damage (Iowa root rating index >3). In treated plots the percentage of
plants with economic damage was between 5.6 and 8.6%. The nematode treatment reduced the mean
total root damage by 70 %. The mean number of adults per plant was 1.7 in the control plots and 0.3 in
plots applied with nematodes in liquid in May (81% reduction). The June application was often less
effective than the applications in May and application into the soil (May) or solid stream application
(June) were more successful than coverage of the whole field with flat fan nozzles.
Key words: western corn root worm, entomopathogenic nematodes, application technology, field trials
Introduction
The potential of entomopathogenic nematode (EPN) for biological control of larvae of the
Western Corn Rootworm (WCR) has been reported from laboratory experiments (Toepfer et
al. 2005). This study aimed to investigate the efficacy of Heterorhabditis bacteriophora,
Steinernema feltiae and H. megidis to control Diabrotica v. virgifera larvae in artificially
infested maize fields. Different application methods and timing of the application (during
sowing or on occurrence of the WCR larvae) were investigated.
EPN react to an SOS signal (ß-Caryophylene), emitted by maize plants as a result of
damage caused by larvae of the WCR (Rasmann et al., 2005). The investigations also tested,
whether the three species react also under field conditions.
332
333
Field sites
The study was carried out in four maize fields in the Csongrad County in southern Hungary in
2005 and 2006. All fields had been previously planted with non-host plants of D. v. virgifera to
assure the absence of the pest in the field plots. Fungicide-treated maize of the hybrid Magister
(UFA Semences, Bussigny, Switzerland) was sown between late April and early May. Magister
belongs to the hybrids that emit nematode-attracting ß-caryophyllene after D. v. virgifera attack
(Rasmann et al. 2005). The non-emitting variety Pactol was sown in trails testing the influence
of the attractant. Fields were treated once with 0.16 litres/ha herbicide Merlin SC (75%
Izoxaflutol, Bayer Crop Science) at maize leaf stage 3 to 5. No insecticides were applied.
Infestation of maize plant with WCR
Diabrotica v. virgifera eggs were obtained from a laboratory rearing of field-collected beetles
in southern Hungary. Maize plants of each field were infested in early May (1-3 leaf stage)
with about 2 x 75 viable and ready-to-hatch eggs in 2 ml water agar using a standard pipette
(Eppendorf, Germany) in 12 cm deep holes at a distance of 5 to 8 cm from either side of the
maize plant. The larvae were expected to hatch mid to end of May and second instars were
expected in June.
Nematode application
Nematodes (Heterorhabditis bacteriophora, Steinernema feltiae and H. megidis) were
received from commercial producers (e-nema, Germany and Andermatt Biocontrol, Switzerland). To ensure infectivity of the used EPNs during experiments, a quality control was
conducted following standard protocols. Applications were during sowing in April or at
occurrence of L2 in June at 0,21-0,26 million/row meter, corresponding to 3.4 x 109 juveniles/
ha. A volume of 0.4 litres of water/m was used. EPN were either applied with a flat fan nozzle
(fluid flat spary) on top of the soil or the plant or with a water stream (fluid core spray) closer
to soil or at the base of the plants. Application of the pure EPN fomulation in clay was also
tested. In the chemical control the granular soil insecticide Tefluthrin (Force 1.5 G, Syngenta,
Switzerland) was applied at 1.0 g/m in 10 cm soil depth during sowing. Untreated plots
served as controls.To compare the effect all applications were carried out in the evenings or
during cloudy afternoons to avoid destruction of EPNs by UV radiation.
Evaluation of the trials
Experimental plots were covered with gauze cages (1300x750x1500 mm, maize plants been
cut to a height of 1 m). CRW adult emergence was recorded weekly in these cages between
June 20 and August 16. Total adult emergence was normalised to 100 eggs per plant. The
EPN efficacy was evalulated as the reduction in D. v. virgifera adults compared to the controls using the Abbott’s formula (corrected efficacy % = (1- beetles in treated plots/beetles in
the control) x 100) (Abott 1925). The influence of EPN species and application timing on the
efficacy data was tested via ANOVA (log transformed data) and compared using the posthoc
LSD test (Kinnear and Gray 2000).
H. bacteriphora achieved between 75 and 81% control thus confirming the laboratory results,
which had indicted that this species has the most promising control potential (Fig.1).
334
Figure 1. Abbott corrected mean reduction (%) of D. v. virgifera adult emergence after
application of different EPN species in maize at two application dates (April and June). (A) Core
sprays of nematodes into the soil during sowing of maize; (B) Core sprays of nematodes onto the
soil and along maize rows in June. Letters on bars indicate differences between species
according to the LSD post-hoc test after ANOVA at P< 0.05; Error bars = SEM, n= 4
plot/species of 6-7 plants.
Figure 2. Abbott corrected mean reduction (%) of D. v. virgifera adult emergence after
application of different EPN species in maize fields in April (left) or June (right) in the hybrids
Magister (caryophyllene +) and Pactol (caryophyllene -). Application of 0.21 -0.26 million EPN/
row m. Letters on bars indicate differences between species according to the LSD post-hoc test
after ANOVA at P< 0.05; Error bars = SEM, n= 4 plot/species of 6-7 plants.
The reduction of the CRW population by the nematode species H. megidis was significantly
higher in the ß-caryophyllene-producing hybrid Magister in the June application. The effect was
much less pronounced in trials applied during April and particularly with the other two nematode
species (Fig. 2). Application into the rows during sowing resulted in control of 72%. As no
further activity is necessary like for spraying in June, this seems to be the most appropriate
method for control of CRW.
335
Figure 3. Abbot corrected mean percent reduction of D. v. virgifera adult emergence after
application of H. bacteriophora using different application techniques and compared to the
granular soil insecticide Tefluthrin. Application of 0.23 million EPN/ row m and 1.0 g insecticide/row m (n = number of field trials between 2004 and 2006 used for the evaluation; Letters on
bars indicate differences between application method to the LSD posthoc test after ANOVA;
Error bars = SEM).
Acknowledgements
We thank KTI Switzerland and e-nema GmbH, Germany for financial support.
References
Kinnear, P.R. & Gray, C.D. 2000: SPSS for windows. Psychology Press Ltd, UK.
Rasmann, S., Köllner,T.G., Degenhardt, J., Hiltpold, I., Toepfer, S., Kuhlmann, U., Gershenzon, J. & Turlings, T.C.J. 2005: Recruitment of entomopathogenic nematodes by insectdamaged maize roots. Nature (London) 434: 732-737.
Toepfer, S., Gueldenzoph, C., Ehlers, R.-U. & Kuhlmann, U. 2005. Screening entomopathogenic nematodes for virulence against the invasive western corn rootworm, Diabrotica v.
virgifera (Coleoptera: Chrysomelidae) in Europe. Bull. Entomol. Res. 95: 473-482.
pp. 336-339
Pest status of Tecia solanivora (Povolny 1973) (Lepidoptera:
Gelechiidae), Guatemalan Potato moth, in the Canary Islands
Aurelio Carnero1; Angeles Padilla1; Santiago Perera2; Estrella Hernández1,
Elena Trujillo2
1
Instituto Canario de Investigaciones Agrarias, POBox 60, La Laguna 38200 Tenerife, Spain.
2
Cabildo Insular de Tenerife, Plaza España s/n, 38071 Santa Cruz de Tenerife, Spain
Abstract: First reports of potato damage by Tecia solanivora in the Canary Islands date back to 1991,
in Tenerife. Although continental Europe is currently free of T. solanivora, it is an important quarantine pest elsewhere, and its spread to other islands posed a serious threat to the local staple potato crop.
Initial presence was established by placing pheromone traps in several field localities and in wholesale
seed-potato warehouses throughout Tenerife. December 2006 data showed that the entire northern side
of the island is affected, while infestations in the south are restricted to the Güimar Valley area
(Güimar, Fasnia and Arico counties). Its presence on the islands of Gomera, Grand Canary and La
Palma is also reported..
Key words: Tecia solanivora, Canary Islands
Introduction
The so called Potato Guatemalan Moth (Tecia solanivora) is one of the major economic pests
for the culture of potatoes in Central America, from where it originates, and in the South
American countries where it was introduced: Venezuela (1983), Colombia (1985) and
Ecuador (1996). Its larvae cause damages both in the field and in storage, penetrating the
tuber and making galleries. Potatoes are the only host for the moth.
On the Canaries, its introduction was first noticed in the 2000 on the island of Tenerife,
with less extended foci in the islands of Gran Canaria and La Palma. It is the first report of
this pest in Europe, where it is considered as a quarantine pest. Its potential danger is clear for
mainland Spain and the European continent. On the Canaries, potato culture is economically
and culturally important in elevated zones, where it constitutes the basic food of the Canary
population. That is why the Canarian Government took actions to control and eradicate the
pest, avoiding its spread to the rest of Spain and Europe. Potato is cultured in winter and
summer. On the Canaries potato represents the 5th crop with an annual production of 98,358 t.
and 30.42 million €, 5.1 % of the entire agricultural production of the Canaries (Canarian
Government, 2005). Potato crop occupies nearly 5,000 ha. To date, reductions in yield and in
growing surface as well as an increased crop cost are consequences of this pest. Failure to
adequately control the moth could probably lead to the collapse of the local potato industry as
well as the possibility of losing historically important cultivars (some of which descend from
plant material brought back from Central and South America in the 1500s), and the threat of
its spread to Mainland Spain and from there to the rest of Europe. Although most research to
date has focussed on integrated potato management, ongoing research on fumigation of
harvested tubers with gases such as CO2, O2, and N2 (alone or combined) appears promising.
Preliminary results show a 100% mortality of adults in potatoes exposed to CO2 (20%),
although pupae mortality was not significant.
336
337
Description and distribution of T. solanivora
Tecia (Scrobipalposis) solanivora adults are between 11 and 13.5 mm long and light brown
with diverse hues. Newly emerged larvae are white, 1.5 mm long and pinkish with violet
tonalities. During the last state, larvae are up to 16 mm long and their abdomen is greenish.
The newly formed pupae are pink and changes to light brown when the adult is ready to
emerge.
Biology and life cycle
The moth places 200 to 250 eggs inside the tuber during 11 days, putting 90 % of the eggs in
the first 7 days. T. solanivora lays eggs inside cracks near the base of the plant stem, where
tuberization takes place. Under storage, eggs are put in natural tuber hollows. Egg fertility can
reach 95 %. Incubation takes place from 7 to 15 days according to the temperature. The
larval-adult period lasts in 15-20 days, depending on the temperature also (Table 1).
Table 1. Duration of different stages of T. solanivora according to the temperature
Stage
Egg
Larvae
Pupae
Adult
Total
Duration (in days)
15ºC
20ºC
25ºC
15
7
5
29
17
15
31
24
12
20
18
10
95
56
42
When it leaves the tuber, formation of the silk cocoon begins. It is cylindrical and it is
made of diverse potato material that remains as the cocoon. It can be found in the soil, on the
walls or other rough places. T. solanivora can also pupate inside the tuber, which is dangerous
if the affected tuber is used as a seed, because it can infest the rest of the stored tubers. The
pupal stage lasts 10 days (Anonymous 2002).
Damages and symptoms
The larval stage is most harmful in the ground. As the eggs are laid near the base of the stem,
larvae can reach and damage the tubers by opening deep, winding galleries. Potato quality and
commercial value can be reduced by 100%, as it was reported along some North Tenerife
areas (Trujillo, 2006). Adults and larvae populations decrease during rainy seasons, and so the
damages produced by them. Other pest consequences are decrease of the cultivated surface
and giving up of potato cultivation, risk of disappearance of local potato varieties and increase
of the use of phytosanitary products and increase of the potato production costs.
Distribution in the Canaries
One of the first activities consisted of establishing a network of pheromone traps for the
sampling of the pest, in order to determine the real situation and to prevent its possible
appearance in other zones not affected up to that moment. Sampling began in March 2001 on
Tenerife, the most affected island, and included 24 of 31 municipalities that integrate the
island. Traps were located at three altitudes (500, 750 and 1000 msnm) at a distance of 2 km
from each other, oriented east-west. There were 98 sampling points. Traps were loaded with
capsules containing the T. solanivora sexual pheromone.
338
Sampling results/ Geographical distribution
During the first sampling period (March, 2001) it was proven that the pest was already
spreading all over the north of the island of Tenerife. From the summer 2001 the captures in
the higher zones (> 750 msnm) increased in a spectacular way ( Fig.1) (Trujillo, 2006).
A c e n te jo
V a lle d e L a O r o ta v a
Ic o d d e l o s V i n o s
Figure 1: Accumulated captures of T. solanivora (March - July 2001) in Northern Tenerife
b) Seasonal distribution
At the beginning of the culture cycle (January), the captures of Tecia solanivora usually
present minimal values, moderately increasing until the end of spring. From May the captures
begin to increase, but the higher captures are performed when the culture is harvested (June July). In some places, captures reach 1,000 adults per week. They stay high during autumn,
diminishing as the first rains appear (Fig.2) (Trujillo, 2006).
Capturas San José (750 msnm)
1990
1490
año 2001
año 2002
990
año 2003
490
no
v.
di
c.
ab
ril
m
ay
o
ju
ni
o
ju
lio
ag
os
to
se
pt
.
oc
t.
en
er
fe o
br
er
o
m
ar
zo
-10
Figure 2: Capture of Tecia solanivora in 3 years in San José (San Juan de la Rambla, 750
msl).
Control methods in the field
Natural autochthonous enemies have not yet been found why biological control cannot be
used. Importations of parasitoids and predators of affected zones of America are starting.
Copidosoma Koehler (Hymenoptera: Encyrtidae) was released for biological control of Tecia
without success (Cabrera Pérez et al., 2003). Bacillus thuringiensis can be used in the field.
The experimental use of entomopathogenic fungi and nematodes native to the Canary Islands
339
has started and baculovirus are tested. As a measure of monitoring pheromones are used at 816 traps/ha separated from each other by 30 m. Water is restored every week and adults are
counted. If more than 100 adults are captured, chemical treatments should be applied. Cultural
measures in the field include:
– Plow the area 15 days prior to planting to eliminate affected tubers of previous campaigns.
– Sowing pest free seeds and covering well with a layer of ground (bury up to 15 cm in the
soil).
– Avoid sowing in dry and warm seasons.
– Eliminate previous plants that could have sprouted during the farming.
– Frequent irrigation to avoid cracks and dryness to prevent establishment of the pest.
– During the harvest: cut the branches in order to diminish the refuge of the moths.
– If you observe damages, harvest as soon as possible to avoid egg-laying.
– Remove damaged tubers, burn or bury them in order to break the cycle of the pest.
– Alternate the potato sowing with other cultures.
For chemical control in the field clorpirifos, diazinone, oxamyl or tefluthrin are applied.
Treatments are repeated at least 50 days after planting and then applied every 15 days until 3
or 4 weeks before harvesting.
Control under storage
Put dense meshes in holes and windows and avoid holes. Clean the empty stores with a 2%
leach solution. Separate tubers for consumption and for sowing. Store at 4-5ºC. Monitor with
pheromone trap in every store and inspect traps weekly. The chemicals Phoxim and Pyrimifos
are used in stored products. Fumigation of harvested tubers with gases such as CO2, O2, and
N2 are common (Perera S. 2006).
Acknowledgment
Thanks to Alejandra Lázaro, Javier Díaz Madroñero, Agricultural Service of Cabildo Insular
de Tenerife, General Direction of Agricultural Development de la Consejería de Agricultura
of Canarian Gouvernement and the Plant Protection personnel of ICIA
References
Anonymous 2002: Medidas para el control de la polilla de la papa. Hoja Divulgadora.
Gobierno de Canarias. Consejería de Agricultura, Ganadería, Pesca y Alimentación.
Cabrera, R. et al. 2003: Control biológico de Phthorimaea operculella (Lepidoptera: Gelechiidae) con Copidosoma koehleri (Hymenoptera: Encyrtidae).
Perera, S. 2006: Actuaciones del servicio técnico de Agricultura del Cabildo Insular de
Tenerife en el control de la polilla guatemalteca. Jornadas Técnicas sobre Tecia solanivora. ICIA.
Trujillo, E. 2006: Distribución de Tecia solanivora en la isla de Tenerife: evolución y
situación actual. Jornadas Técnicas sobre Tecia solanivora. ICIA.
p. 340
Development of microsatellite markers for the assessment of
population structure of the European cockchafer Melolontha
melolontha
Jürg Enkerli, Alexandra Gisler, Roland Kölliker, Franco Widmer
Agroscope Reckenholz-Tänikon Research Station ART, Reckenholzstrasse 191, 8046 Zürich,
Switzerland
Abstract: The European cockchafer Melolontha melolontha L. (Coleoptera: Scarabaeidae), is a widespread pest throughout Central Europe. It lives in synchronous populations typically with a three year
life cycle. Damage is caused by adults feeding on tree leaves and more severely by the soil dwelling
larvae feeding on roots in arable crops and cultures such as grasslands, orchards and vineyards.
Occurrence and population dynamics of M. melolontha have been monitored and registered for several
centuries in different European countries. However, its population structure as well as the interaction
with its most important natural antagonist B. brongniartii has not been investigated on a genetic level.
As a first step to address these aspects, our goal was to develop the molecular tools needed.
We have isolated 16 microsatellite markers and we have assessed their discriminatory power in a
collection of 30 M. melolontha individuals collected from a population in south eastern Switzerland.
The number of alleles detected across the 30 individuals ranged from 3 to 13 with a mean of 6.69.
Observed heterozygosity ranged from 0.17 to 0.87 with a mean of 0.52 and expected heterozygosity
ranged from 0.31 to 0.87 with a mean of 0.66. Combined data from the 16 markers allowed for
distinction of all the 30 M. melolontha individuals tested in this study. The 16 polymorphic
microsatellite markers provide a powerful and sensitive tool to determine the population structure of
M. melolontha and they will allow for investigation of spatial and temporal patterns of M. melolontha
population development.
Key words: Melolontha melolontha, SSR, enriched genomic libraries, genetic diversity
340
p. 341
Protozoa, fungi and nematodes in Gastrophysa viridula (Coleoptera,
Chrysomelidae) from Austria and Poland
Rudolf Wegensteiner1, Cezary Tkaczuk2, Stanislaw Balazy3, Helmut Kaiser4
1
University of Natural Resources and Applied Life Sciences-BOKU-Vienna, Austria;
2
University of Podlasie, Siedlce, Poland; 3Polish Academy of Sciences, Poznan, Poland;
4
University of Graz, Austria
Abstract: The leaf beetle Gastrophysa viridula Deg. feeds mainly on broad-leaved dock (Rumex
obtusifolius). This food pattern is the reason that G. viridula has been considered for biological control
strategies. Due to possible occurrence of pathogens and nematodes, expected effects of this beetle
species might be reduced. Adult beetles were collected at two localities in Poland and at two localities
in Austria in 2006. Beetles were dissected individually on microscopical slides. Nematodes were
separated and fixed. Fresh smears were inspected in a normal light microscope at magnification x40 to
x400, dry and methanol fixed smears were re-inspected after staining with Giesma’s dye at
magnification x1000 for identification of pathogens. Till now, few pathogens have been described
from adult G. viridula – protozoa were found: two microsporidia occurring in field collected beetles,
Nosema equestris and Nosema gastroidea, and in lab infection experiments it was possible to infect G.
virudula with Nosema algerae. Furthermore, the occurrence of fungal pathogens was described,
Entomophthora sphaerosperma and a Zoophthora sp., both belonging to Zygomycota. In our study
one microsporidium was found, identified by morphological features, most probably it is Nosema
equestris, in a relatively high proportion of beetles from Poland. In contrast, only a Gregarina sp. was
found in one beetle from Austria. Fungus from the genus Zoophthora was found on adults and larvae
of G. viridula as well, and caused mortality up to 30% in host population in two distant places in
Eastern Poland. Furthermore, parasitic and postparasitic larvae of mermithids were found in beetles
from the two Austrian sites.
References
Hostounsky, Z. & J. Weiser 1980: A microsporidian infection in Otiorrhynchus equestris
(Coleoptera, Curculinoidae). Vest. cs. Spolec. Zool. 44: 160-165.
Tkaczuk, C., M. Wrzosek & B. Papierok 2005: A peculiar Zoophthora found on Chrysomelids (Coleoptera) in Poland. IOBC Meeting Locorotondo (Bari), June 10 - 15, 2005.
Kaiser, H. 1977: Untersuchungen zur Morphologie, Biometrie, Biologie und Systematik von
Mermithiden. Ein Beitrag zum Problem der Trennung morphologisch schwer unterscheidbarer Arten. Zool. Jb. Syst. 104: 20-71.
341
p. 342
Occurrence of protozoan pathogens in Hylobius abietis L. (Col.,
Curculionidae) from Austria, Poland and Sweden
Sonja Griesser1, Rudolf Wegensteiner2
1
University of Natural Resources and Applied Life Sciences, BOKU, Vienna; 2University of
Natural Resources and Applied Life Sciences, BOKU, Vienna
Abstract: Hylobius abietis L. (Col., Curculionidae) is one of the most harmful pests in coniferous
forests of temperate regions. Beetles attack several coniferous tree species, particularly Norway spruce
(Picea abies), Scots pine (Pinus sylvestris) and European Larch (Larix decidua). The larvae are
especially difficult to control because of their life cycle in the roots of fresh stumps and only a few
chemical pesticides are available for the control of the adults. Therefore, knowledge on occurrence of
natural enemies is very important as basic information before starting with artificial infection and field
tests.
The aim of this study was to investigate the occurrence of natural enemies in Hylobius abietis
from several localities in Austria, Poland and Sweden with regard to number of caught beetles. In
2005 monitoring of Hylobius abietis was conducted at 16 and in 2006 at 6 plots in 3 districts of
Carinthia (Austria) by use of trap bark pieces or trap log sections. The study plots differed in size,
altitude and tree species mixture. In 2006 individuals from Bialowieza National Park (Poland) and
from 2 plots in Sweden were inspected. Only living beetles were dissected and microscopically
examined for the presence of entomopathogenic protozoa, parasitic nematodes and parasitic hymenoptera. The investigation brought evidence of the Eugregarine, Gregarina hylobii (Fuchs), the Neogregarine, Ophryocystis hylobii (Purrini & Ormieres), and the Microsporidium, Nosema hylobii
(Purrini), in beetles from Austria, Poland and Sweden. However, differences could be noticed in the
presence and in the abundance of these pathogens in beetles from different countries respectively
sampling sites as well as in male and female beetles.
References
Fuchs, G. 1915: Die Naturgeschichte der Nematoden und einiger anderer Parasiten 1. des Ips
typographus L., 2. des Hylobius abietis L. Zoologisches Jahrbuch Abteilung für Systematik 38: 109-222.
Purrini, K. 1981: Nosema hylobii n.sp. (Nosematidae, Microsporida), a new microsporidian
parasite of Hylobius abietis L. (Curculionidae, Coleoptera). Zeitschrift für angewandte
Entomologie 92: 1-8.
Purrini, K., & Ormieres, R. 1982: Gregarina hylobii and Ophryocystis hylobii n.sp. (Ophryocystidae, Neogregarinida) parasitizing Hylobius abietis (Curculionidae, Coleoptera).
Journal of Invertebrate Pathology 39: 164-173.
342
p. 343
Bioassays with entomopathogenic organisms on adult Cosmopolites
sordidus (Germar, 1824) (Coleoptera: Curculionidae)
Angeles Padilla Cubas1, Aurelio Carnero Hernández1, Luis Vicente López-Llorca2,
Fernando García del Pino3
1
ICIA Canary Islands, PO box 60, C. P. 38200, La Laguna, Tenerife; 2IMEM "Ramón
Margalef", Lab. Fitopatología, Depto. de Ciencias del Mar y Biología Aplicada, Universidad
de Alicante, Apdo. 99, 03080 Alicante, Spain; 3Departamento de Biología Animal, Vegetal y
Ecología, Facultad de Biociencias, Universidad Autónoma de Barcelona, Bellaterra, 08193
Barcelona, Spain
Abstract: The banana weevil, Cosmopolites sordidus, spends an important part of its life cycle in the
banana mat or in the cut vegetable rests laying on the soil. This environment is appropriate for
entomopathogens to be used. Tests have been carried out to assess the potential of fungi and nematodes present in the Canary Islands to control C. sordidus adults. Biological tests were performed on
C. sordidus adults, in Petri dishes, incubated at 25°C in the dark. Mortality was checked every day,
and dead individuals were analysed to confirm the cause of mortality. The infectious capacity of
nematodes was evaluated in function of the banana weevil sex, hermeticity of their elytra, and culture
conditions. No difference in mortality was found between male and female weevils when challenged
with various nematode strains. The presence of food increased the successful colonisation of the
weevils, especially by Steinernema carpocapsae reaching a 60% of mortality. When elytra were not
hermetic (broken, missformed), 100% mortality was obtained upon challenge with a local strain of
Steinernema, while no mortality was obtained in perfectly hermetic elytra. Several strains from
various species of fungi were used. The fungi virulence, production of enzymes, and behaviour were
analysed in function of the temperature, pH and water available in the media. Adult banana weevils
appeared to be susceptible to all the strain and the fungi tested, specially Beauveria bassiana (100 %)
and Metarhizium anisopliae (93-100 %), independently to the length of the exposure to fungi applied.
According to the results obtained the use of nematodes and fungi as agents for the biological control of
C. sordidus represents an alternative to chemical control.
343
pp. 344-348
Biological control of Thrips tabaci in the field – possibilities and
practical limits1
Kerstin Jung
SafeCrop and JKI, Institute for Biological Control, Heinrichstr. 243, 64287 Darmstadt
Abstract: Field trials against Thrips tabaci, an economically important pest insect, were conducted in
2003 at four different sites in Germany. The effect of the combined use of entomopathogenic
nematodes and fungi on thrips should be investigated, in comparison to the effect of either pathogen
®
®
alone. Commercially available products, Mycotal (Koppert NL), PreFeRal (Biobest BE), Naturalis
®
®
®
L (Intrachem IT), Nemaplus and Nemagreen (both E-Nema DE), were used. The trials were
®
performed in onion, leek and chives, according to the EPPO guideline PP 1/85(3). Perfekthion was
®
®
used as chemical standard in onion. In leek, Spruzit and Neudosan were applied alternately. No
chemical standard was applied in chives. The biocontrol products were applied either alone or in a
mixture using common spray equipment. The nematodes were applied at a rate of 1x106 infective
®
juveniles/m2. The dosage of the fungi was 1 kg (1.5 l in the case of Naturalis L )/ha. The treatments
started mid June and were repeated up to six times in weekly intervals.
Insect pressure was low at all four sites, throughout the summer. T. tabaci was recorded only in
medium numbers (mean of 30 specimen/plant max.). In two trials, no differences were detected
between the treatments and the control. In the third trial (onion), a significant reduction was recorded
for the treatment ‘PreFeRal+Nemaplus’, both in the number of thrips/plant (2 compared to 6 in the
control) and the frequency of infestation (38 % compared to 93 % in the control), one week after the
final application (3 times in total). Also in the fourth trial (leek), the number of thrips/plant was lowest
for the treatments ‘fungi+nematode’ (4 compared to 7 in the control), one week after the final
application (6 times in total). In this trial, yield was measured additionally, and the weight/plant
registered at harvest was 20 % higher for the treatments ‘Nemaplus’ and ‘Mycotal+Nemaplus’ than in
the control (425 and 412 g/plant compared to 345 g respectively).
The results presented here, show that the use of biocontrol nematodes and fungi need not be
restricted to protected environments, field application against insects on the upper parts of plants is
possible. Moreover, their combination has the potential to give a better reduction of the pest
population than each agent alone. In consideration of the extreme weather conditions in Germany in
2003, and in comparison to the effect of the chemical standards, the results are regarded as promising.
However, each crop situation needs its own proof of feasibility, since factors like the microclimate,
created by the plant’s individual characteristics and the canopy it forms, may influence the activity of
the pathogens and by this their efficacy.
Keywords: Thrips tabaci, insect pathogenic fungi, Beauveria bassiana, Lecanicillium muscarium
Paecilomyces fumosoroseus, insect pathogenic nematodes, Heterorhabditis bacteriophora, Steinernema feltiae, biocontrol, field testing
Introduction
Thrips are economically important pest insects. They can cause serious damage to many
different crops. The plant protection service of Hessian, one of the Federal States of Germany,
reported in its Annual Report (Anonymous, 2004) economically significant yield loss in a
variety of different field crops (e.g. cabbage, green beans, leek, onion and sweet corn) due to
1
This paper had been presented at the 10th European meeting of the IOBC/wprs Working Group “Insect
Pathogens and Insect Parasitic Nematodes“ at Locorotondo, 2005. Unfortunately, it was not included in the
IOBC/wprs Bulletin 30(1), 2007.
344
345
thrips damage. The onion thrips, Thrips tabaci, is listed among the most harmful thrips
species in the open. Its small size and hiding behaviour makes it difficult to control, especially
when no chemical insecticides are allowed, like in organic farming.
Possible control options against thrips in Germany include seed coating with
imidacloprid (e.g. Gaucho®) or spraying of dimethoate (Perfekthion®) for conventional
farming. Organic growers can use crop-protective nets, or spray either kali-soap (Neudosan®)
or pyrethrine plus rape seed oil (Spruzit®). As biological means, both, predators (e.g. mites,
like Hypoaspis spp. or pirate bugs, like Macrolophus spp.) and pathogens (nematodes) are
available. No fungal plant protection product is registered in Germany. In general, these
biocontrol agents are mostly used in the greenhouse only, and they are commonly assumed as
being unsuited for field application.
The field experiments reported herein were intended to demonstrate the feasibility of
applying entomopathogenic fungi and nematodes against thrips under conditions other than in
the greenhouse. Moreover, the hypothesis that a combination of fungi and nematodes will
achieve a higher efficacy than either of the pathogens alone should be verified.
Field trials at four different sites were conducted in co-operation with plant protection
services and a research station in summer 2003. In order to standardize the different
experiments, the EPPO Guideline for efficacy evaluation of insecticides, PP 1/85(3) „Thrips
on outdoor crops“, was followed as far as possible. Briefly: Plot size at least 20 m2; four
replicates per treatment; untreated control and a chemical reference product included (here:
Perfekthion®, or alternate spraying of Spruzit® and Neudosan®, at the recommended dosages);
assessments by counting the number of living thrips either at five random groups of four
successive plants per plot (onion and leek), or on the plants of 5 x 0.5 m row lengths per plot
(chives). At three of the four sites, counting took place before the first treatment, in between
treatments and after the final treatment. At the fourth site it was reduced to one assessment
seven days after the final treatment. In leek, the final evaluation included two additional
assessments: First, a judgment on the marketability was made by estimating the percentage
damaged leaf area, and yield was assessed by weighing five plants per replicate.
Commercially available preparations of the following pathogens were tested: Lecanicillium
muscarium (Mycotal®, Koppert NL), Paecilomyces fumosoroseus (PreFeRal®, Biobest BE),
Beauveria bassiana (Naturalis L®, Intrachem IT), Steinernema feltiae (Nemaplus®, E-Nema
DE) and Heterorhabditits bacteriophora, (Nemagreen®, E-Nema DE). They were applied
alone and in combination using common spray equipment (motorized sprayer, nozzle type
e.g. Teejet 8003 VK, 2-3 bar). A wetting agent was added [either Addit® (Koppert, NL) or
ProFital® fluid (ProAgro, DE)] and – when nematodes were applied – all filters were
removed. Application rates were 1x106 infective juveniles/m2 for the nematodes, and 1 kg
(respectively 1.5 l for Naturalis L®)/ha for the fungi. All treatments were applied with 1000 l
water/ha. Starting from the beginning of June (week 24), the plants were treated in weekly
intervals, up to six times. In leek, yield was measured in September.
Data were analysed by analysis of variance and means were separated using the Duncan
grouping (SAS, 1989).
Results and conclusions
Generally, the infestation rates were low (2-20 thrips/plant at the onset of the field trials,
mean of 30 thrips/plant at maximum) throughout the summer at all sites. In two of the four
346
field trials (onion and chives), no differences between the treatments and the untreated control
could be detected at the end.
In contrast, in the second field trial in onion the highest efficacy (approx. 60 %) was
achieved with the combined application of P. fumosoroseus and S. feltiae (compared to
approx. 20 % for the chemical reference, Perfekthion®, or either of the two pathogens alone;
see figure 1). Application of the two pathogens together resulted in a significant reduction of
both, the number of thrips/plant and the frequency of infestation one week after the final
application (3 times in total) (figure 1).
PreFeRal+ Nemaplus
d
b
cd
PreFeRal+ Nemagreen
ab
ab
Mycotal
ab
abc
ab
abc
Nemagreen
ab
bc
ab
Nemaplus
PreFeRal
infestation rate [%]
thrips/plant
Perfekthion
bc
ab
-20
0
20
40
60
80
100
Figure 1: Efficacy [%] of entomopathogenic fungi (PreFeRal®, Mycotal®), nematodes (Nemaplus®, Nemagreen®), and a chemical reference (Perfekthion®) (calculated for the number of
thrips per plant and the infestation rate [%]), one week after the last application (three in total)
in a field trial in onion. Different letters indicate significant differences (Duncan, α≤0.05)
In the fourth field trial, in leek, results were less supportive of the work hypothesis
mentioned above. Although the lowest number of thrips/plant (4 compared to 7 in the control,
respectively) was counted within the ‘fungus+nematode’-combination-treatments (fungus
here: Lecanicillium muscarium, Mycotal®) 4 days after the last application (6 times in total),
16 days later a significant difference was recorded for the Nemaplus®-treatment only (16
thrips/plant compared to 28 in the untreated control, respectively; see figure 2). No significant
differences between treatments were detected for the frequency of infestation. Estimated
values of damaged leaf area were as such, that none of the treatments had rendered
marketable plants (damaged leaf area ≥ 14 % ). Interestingly, at harvest, three weeks after the
final application, the weight/plant was approx. 20 % higher for the treatments ‘Nemaplus®’
and ‘Mycotal®+Nemaplus®’ in comparison to the control (425, 412 and 345 g/plant,
respectively; see figure 2).
In conclusion, the results of the two field trials (in onion and in leek) are in support of the
statement that the use of entomopathogenic nematodes and fungi does not need to be
restricted to protected environments, e.g. greenhouses, but can be extended to the open field.
347
It is assumed that in both trials growth characteristics of the crop contributed to the outcome:
On the one hand, the closed canopy of the early sawn onions, whereas on the other hand, the
overlapping leek leaves, provided a micro-climate in a way that even under the extremely
adverse weather conditions in summer 2003 (very hot and dry) the biocontrol agents
performed good, sometimes even better than the chemical standard. These findings will be
taken into consideration for future continuation of this research. Modifications of the
experimental design presented herein which are worth to be considered with respect to an
improvement, are e.g. a higher frequency of applications with a possible reduction of
application rates, or alternating applications of fungi and nematodes. Most imminent is the
development of a plant protection concept in close cooperation with farmers, and according to
their specific requirements.
c
b
bc
Nemagreen
ab
bc
Mycotal+ Nemaplus
ab
bc
PreFeRal
ab
b
Mycotal+ Nemagreen
ab
bc
Mycotal
ab
bc
0
Nemaplus
ab
20
40
Spruzit/ Neudosan
60
yield [g/plant]
thrips/plant
80
100
Figure 2: Efficacy [%] of entomopathogenic fungi (PreFeRal®, Mycotal®), nematodes (Nemaplus®, Nemagreen®), and a chemical reference (Spruzit®/Neudosan®) (calculated for the
number of thrips three weeks after the last application, and yield [g/plant] at harvest,
respectively), in a field trial in leek (six applications in total). Different letters indicate
significant differences (Duncan, α≤0.05)
Still the severest limitations for the use of biocontrol agents are the relatively high costs, the
often unpredictable performance under varying environmental conditions and, especially in
Germany, the lack of registered (fungal) biopreparations.
Acknowledgements
This research was financed by the „Bundesprogramm Ökologischer Landbau“ from the
Federal Research Center for Agriculture and Nutrition (Project No. 02OE091). I‘m grateful
for the assistance by Doris Schmidt, Petra Beverung, Frauke May, Larissa Kerckhoff and
Robert Koller. Many thanks are due to the active support by the following institutions and
persons: LWK Rheinland, LPP Mainz, SLFA Schifferstadt, LfP Stuttgart, Johannes Keßler,
348
Pedro Garcia, Dr. Norbert Laun, Dr. Frank Burghause, Dr. Reinhard Albert and Melanie
Störmer.
References
Anonymous (2004): Jahresbericht 2004. Pflanzenschutzdienst Wetzlar und Kassel. Regierungspräsidium Gießen, Gießen.
SAS (1989): SAS/STAT User’s Guide. – SAS Institute, Cary, NC.

from laboratory to field – key points - IOBC-WPRS

Transcription

Similar documents

Insect Order ID: Coleoptera (Beetles, Weevils)

Sexual Selection I

SCIENTIFIC NOTE

Ag Talk Newsletter August 2015

201501 garden view - Ontario Horticultural Association

Delusory Parasitosis

Read the entire story here.

dansk blue umber