59º C ong resso Brasileiro de G enética

Transcription

59º Congresso Brasileiro de Genética
Resumos do 59o Congresso Brasileiro de Genética • 16 a 19 de setembro de 2013
Hotel Monte Real Resort • Águas de Lindóia • SP • Brasil
www.sbg.org.br - ISBN 978-85-89109-06-2
1
DNA BARCODING AND THE BIODIVERSITY
OF NEOTROPICAL FISHES
Pereira, LHG1; Oliveira, C2.
Universidade Federal da Integração Latino-America, Foz do Iguaçu, PR; 2Instituto de Biociências, UNESP, Botucatu, SP
1
[email protected]
Keywords: Knodus, COI, Characidae
Since the proposed DNA barcoding methodology almost 2.1 million of specimens of about 177K species have been
barcoded with a successes rate around 90% and many cryptic species have been revealed. The applicability of DNA
barcoding to reveal cryptic and potentially new species has increased our knowledge regarding biodiversity in many
taxa and the use of barcoding as a tool for these purposes is becoming a reality. In this context the present study
aimed to use the barcoding methodology to indentify and delimit the species of the Knodus genus (Characiformes:
Characidae) and to assess the possibility of cryptic speciation. We analyzed the partial COI sequences of 141
specimens belonging to 21 Knodus species from distinct localities of their distribution area. The analysis revealed 30
distinct groupings with high statistic support and high interspecific genetic divergence among them (average value
= 9.4%). Seven species divided into two or more subgroups justifying the 30 groups observed. On the other hand,
the wide geographically distributed species K. moenkhausii, showed no divergence among the specimens belonging
to three distinct hydrographic basins indicating be a unique species. The presence of the K. moenkhausii in three
distinct hydrographic basins can be explained by the headwater capture events or the introduction of species due river
transposition among these basins. In summary, the results showed the efficacy of barcoding methodology in identify
and delimit the Knodus species also revealing a high cryptic speciation. These results are significant since the species
number observed (30) is high than total of species recognized to the genus (26) leading to an increase of 46% of
species number. We believe that with the increase of specimens and of the covered area the number of Knodus species
should be high and we expected that the same pattern should be true, mainly, to others small Neotropical fishes.
Financial support: FAPESP and CNPq
2
MOLECULAR PHYLOGENY OF SAND LIZARD
LIOLAEMUS ARAMBARENSIS
Pisetta, NF1; Fagundes, NJR1; Silva, CM2; Verrastro, L2.
Departamento de Genética, UFRGS, Porto Alegre, RS; 2Departamento de Zoologia, UFRGS, Porto Alegre, RS
1
[email protected]
Keywords: species tree, gene tree, sand lizard, molecular clock, Pliocene
Phylogenic analysis is employed to infer the evolutionary history of species suggesting possible events affecting species
diversification. Liolaemus arambarensis is a small, recently described lizard that is endemic to sandy beaches of the of the
Patos lagoon, in the Rio Grande do Sul state. In Brazil, the other species from this genus also occupy sandy beaches in
the Atlantic coast, but the relationship among them is unknown. While Liolaemus occipitalis occurs in Southern Brazil
and the Uruguay, close to the occurrence area of L. arambarensis, L. lutzae is restricted to Rio de Janeiro state, more than
1,000km away from the other species. In this study, we used a multilocus data set combined with a molecular clock
approach to infer the phylogenic relationship among these and other closely related species belonging to the boulengeri
group, and, more specifically, to the “wiegmanni” subgroup. We used DNA samples from L. arambarensis, L. lutzae, L.
occipitalis, L. salinicola, L. scapularis, L. multimaculatus and L. wiegmannii which were subjected to PCR amplification
for mtDNA (COI, CytB) and autosomal (PRLR, Selt, KIF) markers. After sequence aligment, a gene tree was estimated
for each marker, while the species tree was estimated using either concatenated data or based on a coalescent approach
to deal explicitly with discrepancies among gene trees. To calibrate the molecular clock we used a substitution rate of
CytB and set a prior in the time of the tree root using data from the literature and L. darwinii as an outgroup. All analysis
were performed in Beast 1.7.3 (or *Beast) using evolutionary models suggested by jModeltest. The L. arambarensis-L.
lutzae clade was well supported both by all nuclear gene trees and the species tree with concatenated data, even
though these are species not close related in geographical terms. In the species tree without concatenation, this clade
was also recovered, but with low support. In contrast, the mtDNA phylogeny suggests a L. occipitalis-L. arambarensis
clade, though with low support. The L. occipitalis-L. arambarensis-L. lutzae clade is supported by mitochondrial
phylogeny and species tree both with and without data concatenation. Interestingly, the sister relationship between L.
arambarensis and L. lutzae was also recovered with high support from the coalescent species tree based on nuclear genes
alone. Divergence times estimates among L. arambarensis, L. occipitalis and L. lutzae (~3,8 Million years ago, Mya),
and between L. arambarensis and L. lutzae (~3,3 Mya) fall in the Pliocene and might indicate that orogenic events
associated with the uplift of the “Serra do Mar”, could have been more important for the divergence of genetic lineages
in this group than the more recent Pleitocene glacial cycles and the origin of the Coastal plain in Southern Brazil.
Financial Support: CNPq
3
DIVERSITY OF ASTYANAX SCABRIPINNIS
(TELEOSTEI: CHARACIDAE) IN THE ATLANTIC
FOREST: DELIMITING SPECIES AND
EVOLUTIONARY INFERENCES
Castro, JP¹; Moura, MO²; Moreira-Filho, O³; Shibatta, OA4, Vicari, VN¹; Vicari, MR¹; Almeida, MC¹; Artoni, RF¹
Universidade Estadual de Ponta Grossa, Ponta Grossa, PR; 2Universidade Federal do Paraná, Curitiba, PR; 3Universidade
Federal de São Carlos, São Carlos, SP; 4Universidade Estadual de Londrina, Londrina, PR
1
[email protected]
Keywords: fish, karyotype, geometric morphometry
The species complex Astyanax scabripinnis is an excellent model for evolutionary studies because these fish have a
wide geographical distribution, forming isolated populations, and in some cases, in sympatry. In this study, five
populations of A. scabripinnis were analysed using geometric morphometry, cytogenetic markers, and tests for induced
breeding in order to obtain an evolutionary scenario for these populations. The morphometric data indicated that the
populations were well differentiated from each other. The cytogenetic evidence showed a more conserved karyotypic
macrostructure; however, the molecular cytogenetic results regarding in situ hybridisation indicated locations of 5S and
18S rDNA, specific to each population. The reproduction tests on three populations suggested the occurrence of prezygotic isolation between them. The combined data indicated that individuals are adapted for different environments
in a complex evolutionary scenario, where populations have been linked in a recent geological period. However, due
to reproductive isolation, populations are evolving independently, reinforcing the existence of distinct cryptic species.
Financial Support: CNPq and Fundação Araucária
4
MOLECULAR AUTHENTICATION OF THE
SNAPPERS (LUTJANIDAE - PERCIFORMES)
OF THE WESTERN ATLANTIC: RDNA 5S OR
MITOCHONDRIAL COI?
Veneza, I1, Silva, R1, Sampaio, I2, Schneider, H2 & Gomes, G1,2.
Laboratório de Genética Aplicada, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Universitário
de Bragança; 2Laboratório de Genética & Biologia Molecular, Instituto de Estudos Costeiros, Universidade Federal do
Pará, Campus Universitário de Bragança. Alameda Leandro Ribeiro, S/N, Aldeia, Bragança-Pará- Brasil.
1
[email protected]
Keywords: COI, rDNA 5S, snappers, lutjanid, molecular authentication.
The increasing demand for fishery resources in recent years has stimulated a growth in the output of processed
products, which has made the fraudulent substitution of species a common practice. The lutjanid fishes known as
snappers represent an important fishery resource in all the regions where they occur. Many species, such as the red
snappers (Lutjanus vivanus, L. purpureus, L. campechanus, L. buccanella) are highly similar morphologically and are
difficult to identify reliably based on external characteristics. This problem is exacerbated by the industrial processing of
catches, which typically involves the removal of the fillets. In the present study two different protocols were evaluated
for the molecular authentication of lutjanid species, one based on the banding pattern of the nuclear rDNA 5S gene,
and the other on the sequences of the mitochondrial Cytochrome Oxidase subunit I (COI) gene. This comparative
analysis will provide an initial step towards the development of rapid and low-cost molecular protocols that provide
an unambiguous identification of snapper species. A total of 195 samples were analyzed from specimens identified
previously as belonging to seven lutjanid species (Lutjanus purpureus, L. synagris, L. vivanus, L. jocu, L. analis, Ocyurus
chrysurus, and Rhomboplites aurorubens), as well as unidentified individuals. The results indicate the absence of a
species-specific rDNA 5S banding pattern in lutjanids. However, the 516-bp fragment of the COI gene not only
discriminated the identified lutjanid species systematically, but also defined the species of the unidentified specimens.
A total of 40 haplotypes were identified in the 195 lutjanid samples, of which the most common were those of the
species L. synagris and O. chrysurus. Lutjanus analis and L. jocu presented the largest number of haplotypes, while
all other species were represented by only one or a few haplotypes. The majority of the unidentified specimens had
haplotypes typical of one of the seven lutjanid species sampled. The species were represented by well-defined consensual
clades in the phylogenetic trees, supported by the interspecific distances and the mutations characteristic of each
species. All of the unidentified specimens were allocated to one of the seven species clades except for five individuals,
which presumably belong to other species not identified in this study. While this segment of the COI gene does not
correspond to the “barcode” region, it did prove to be a robust tool for the molecular authentication of lutjanid species.
Financial Support: This study was supported by CNPq.
5
MOLECULAR TECHNIQUES APPLIED
IN THE STUDY OF KINSHIP ANALYSIS
OF PODOCNEMIS SEXTUBERCULATA
(TESTUDINES, PODOCNEMIDIDAE)
Miguel, GSS1,2; Farias, IP³ ; Fantin, C1,4
Escola Superior de Ciências da Saúde, UEA, Manaus, AM; 2Bolsista CNPq - Programa Institucional de Bolsas de Iniciação
em Desenvolvimento Tecnológico e Inovação (PIBITI); 3Universidade Federal do Amazonas – UFAM; 4Mestrado em
Biotecnologia e Recursos Naturais, UEA, Manaus, AM
1
[email protected]
Keywords: Podocnemis; paternity; microsatellite, polyandry, genotyping.
Turtles appeared in Mesozoic Era, over 200 million years ago and are considered the oldest existing reptiles. They are
scattered among various places such rivers, lakes and swamps. The order Testudines (turtles and tortoises) is divided
into 13 families and the present study focus on the specie Podocnemis sextuberculata, Podocnemididae. This turtle
inhabits clear water rivers, is widely consumed in Amazon region and its clandestine trade is a predation factor. This
study aimed to understand the reproductive behavior (by determining the paternity type) of this specie in order to
contribute for the elaboration of further preservation studies. Study site was at Trombetas (Trumpets) River - PA,
where during spawning time six nests of P. sextuberculata were identified and marked. After eggs hatching, 100 mL
of blood from each offspring was collected, totalizing sixty samples. DNA extraction followed the CTAB method.
Extracted DNA was subjected to polymerase chain reaction (PCR) following the economic protocol described by
Schuelke, using three microsatellite loci (Puni_1D12, Puni_1H9 and Puni_2A9) developed for Podocnemis unifilis.
Amplification of microsatellite region was checked by 1% agarosis gel electrophoresis. Genotyping of amplified
microsatellite loci was performed by an automatic sequencer (ABI 3130 xl) which provided data for determining
the genotype of each offspring. Kinship level between individuals from each nest was determined by a simple alleles
counting. As result, we obtained the inference of multiple paternity in the six nests studied. Alleles number ranged
between 4 to 14, where locus 1H9 was the least polymorphic (in all studied nests) whereas locus 1D12 was the
most polymorphic (nest 1). Alleles counting of offsprings shows that nest 1 was the one with major contribution
of males (6 individuals). It is concluded, therefore, that P. sextuberculata shows polyandry as main characteristic
of mating behavior, where one female has intercourse with several other males, which is supported by our results.
Financial Support: CNPq and the Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM)
6
FIVE MICROSATELLITES LOCI TO
DETERMINE THE GENETIC VARIABILITY
IN A WILD POPULATION OF FAT SNOOK
(CENTROPOMUS PARALLELUS)
Herkenhoff, ME1; Gaulke, R2; Cordeiro, AB3; Remualdo, VR2; Lima-Rosa, CAV1,4
Centro de Ciências Agroveterinárias, UDESC, Lages, SC; 2Laboratório Genolab, Blumenau, SC; 3Universidade Santa
Cecília, Santos, SP; 4Centro de Educação Superior da Região Sul, UDESC, Laguna, SC
1
[email protected]
Keywords: snook, fat snook (Centropomus parallelus), genetic polymorphism, microsatellite, genetic of population
Microsatellites are tandem repeats located in non coding regions, which makes its efficient to determine the genetic
variability, thus their polymorphisms can’t affect the expression of the phenotype and don’t suffer the action of natural
selection. The fishes know as snook (Centropomus sp) have a wide geographical distribution and occur throughout
the Brazilian coast. These fish are highly appreciated for their meat quality, reaching a high price in the market. They
are known as “camorin” in North and Northeast Brazil and as “robalo” in the Southeast and South of Brazil. One
of the most appreciated of the snook is the fat snook (Centropomus parallelus), known as “robalo-peva”. This specie
inhabits shal-low coastal waters and estuaries form the South Florida to the Brazilian coast (tropical and subtropical).
In Brazil and in the United States, became necessary to implement measures to control the fishing of this specie,
with a view to the exploitation of this great resource and in order to protect the stock. One of the most efficient
measures for the survival of specie is the maintenance of the genetic variability being the microsatellites an excellent
tool determined this parameter. This study had to aim investigate the genetic variability in wild fat snook populations
using microsatellites loci. At moment, we collected and analyzed a blood and tissue sample from 29 wild individuals.
We used 5 microsatellites loci: Cun 01, Cun 05B, Cun 08, Cun 09 and Cun 10A. The fragments were amplified
using the polymerase chain reaction (PCR) and they were analyzed by a poliacrylamide gel (5%). We have founded
20 alleles (101-165 bp) in the Cun 01 loci, 8 alleles (147-168 bp) in the Cun 05B loci, 24 alleles (127-213 bp) in the
Cun 08 loci, 14 alleles (203-243 bp) in the Cun 09 loci and 11 alleles (143-181 bp) in the Cun 10A loci. Thirteen
alleles from the Cun 01 locus, 10 from the Cun 09 and 11 from the Cun 10A were never described before. All the
alleles form the Cun 05B and Cun 08 are never described before, because earlier studies indicated that the both loci
are showed no fragments or fragments not sufficiently resolved to indicate homology with common snook loci. The
results of the number of obtained alleles per loci are according with the minimal number alleles suggest by Barker
(1994), that need to be as more as four and also showed that the Cun 05B and Cun 08, in contrary with earlier
studies, are able to use in future variability population studies in this specie. The polymorphisms founded enable the
use of these five loci in population variability study, paternity identification and inbreeding coefficient in this specie.
Financial Support: CAPES, Santa Catarina State University (UDESC) and Laboratory Genolab
7
MOLECULAR TECHNIQUES USING
MICROSATELLITES MARKERS IN MULTIPLE
PATERNITY TEST OF PODOCNEMIS EXPANSA
(TESTUDINES, PODOCNEMIDIDAE)
Higa, AM1; Farias, IP2; Fantin, C1
Escola Superior de Ciências da Saúde, UEA, Manaus, AM; 2Laboratório de Genética Animal – LEGAL, UFAM, Manaus, AM
1
[email protected]
Keywords: Podocnemis expansa, poliandry, microsatelittes, multiple paternity, molecular techniques
Evolving since Triassic period, modern turtles arose in the Cretaceous Period and have as main characteristic, the fact
of being reptiles with shell and plastron linked to backbone and ribs, respectively. Main sub-orders are Criptodira and
Pleurodira, where Pleurodira are the less scattered specie and restricted to South hemisphere. Podocnemis expansa is
part of this group, being the biggest specie of Podocnemis genus, and can be found in South America living in rivers and
water bodies inside Amazon basin and Pantanal. Both male and female of P. expansa can travel long distances between
feeding and harvesting places, what guarantees the genic flux inside amazon basin. Another notable characteristic of
P. expansa is it high number of eggs per nest and the sperm storage capacity of females, making this specie a serious
candidate for showing poliandry, where many males contribute for generating an offspring. In this study, 84 justhatched of P. expansa from 3 nests of Trombetas (Trumpets) river - PA have their blood collected for verifying the
presence of multiple alleles, by genotyping the microsatellite region from genomic DNA. The DNA extraction was
performed by CTAB method, and amplification of target region was done by Schulke method, using loci Puni_1E1,
PE1075 and PE344. Target region amplification was confirmed by 1% agarosis gel electrophoresis, in Tris-EDTABoric acid (TEB) solution, and genotyping was performed in an automatic sequencer ABI 3130 xl. Determination
of maternal and paternal alleles was done by a simple counting of total alleles from offspring, where two are from
the mother, the other two are from one father and if there is a fifth or more alleles, multiple paternity is detected.
Preliminary results confirm the presence of 3 - 10 alleles per locus, where Puni_1E1 is the less polymorphic and locus
PE344 the most polymorphic. Trough alleles counting in each nest, it is suggested that in the first nest there was the
participation of at least 3 males, in the second 4 and in the last one at least 2 males. It is concluded that such data
suggests polyandry in P. expansa, what corroborates with the high number of eggs in each nest and the sperm storage
capacity of females.
8
KINSHIP ANALYSIS IN OFFSPRINGS OF
AMAZON TURTLE (PODOCNEMIS EXPANSA)
BY USING MICROSATELLITE MARKERS
MORAIS, J.M.1; FARIAS, I.P,2; BOTERO-ARIAS, R.3; CAMILLO, C.S.3,4, FANTIN, C.1
Mestrado em Biotecnologia e Recursos Naturais, UEA, Manaus, AM; 2Laboratório de Genética e Evolução Animal,
UFAM, Manaus, AM; 3Instituto de Desenvolvimento Sustentável Mamirauá, Tefé, AM; 4Centro de Estudos Superiores de
Tefé/CEST, UEA, Tefé, AM
1
[email protected]
Keywords: Multiple paternity, microsatellites, Podocnemis expansa
Amazon turtle (Podocnemis expansa) was widely explored, mostly by the use of meat, guts and eggs as food for local
communities. For this reason, this specie is at low risk/conservation dependant, according Red List of Endangered
Animals from International Union for Conservation of Nature - IUCN. Facing this, studies related to reproductive
system of Amazon turtle are extremely important for contributing to the conservation program of this specie. In
view of polyandric behavior evidence in P. expansa can bring genetic benefits for the specie, alongside the occurrence
of multiple paternity, increases the genetic variability from offsprings and decrease the occurrence of endogamy
between individuals. The objective of this study is identifying the polyandric behavior in Amazon Turtle (P. expansa)
from “Reserva de Desenvolvimento Sustentável Mamirauá” (RDSM), by microsatellite markers. 90 just-hatched
individuals from three nests were analyzed, collected previously from RDSM. The method used for blood sampling
was performed by punctionating the femoral vein using a 1 mL syringe, collecting until 100 µL of blood and keeping
them in microtubes containing 500 µL of absolute ethanol, and posteriorly storing them at 4ºC. After blood sampling,
offsprings were released in the local of origin. DNA extraction was performed by CTAB method, appropriate for
nucleated blood cells. After extraction, DNA is submitted to Polymerase Chain Reaction (PCR) according Schuelke
protocol. Three microsatellite loci designed for the specie (PUNI1D12, PE344 e PE519) were used. PCR products
were exposed to genotyping reaction according DeWoody protocol, performed in the DNA Automatic Sequencer ABI
3130xl. Alleles analysis observed for each locus was performed by using the software GeneMarker v.2.2.0, identifying
the genotype of each locus according the sampled individuals. Multiple paternity analysis was performed by using
a simple alleles counting. When analyzed separately, all three loci in all nests studied indicated multiple paternity,
with the participation of at least three fathers per nest. The most polymorphic locus showed ten alleles and the
less polymorphic eight for both first and second nests, and in the third nest the most polymorphic showed nine
alleles and the less polymorphic six. Such results corroborates with retrospective studies wich point as prevalent the
polyandric behavior in P. expansa. RDSM population was considered ecologically extinct, for the high predation
rate in the past centuries and the low number of females spawning. From the late 90’s, nesting areas began to be
protected in different areas of RDSM by local population. Presence of multiple paternity in similar conditions to the
most abundant populations, can be considered a sign of population recovery at RDSM. This project is part of the
activities from “Conservação de Vertebrados Aquáticos Amazônicos” (Aquavert, Conservation of Amazonian Aquatic
Vertebrates), developed by Mamirauá Institute and sponsored by Petrobras, through Programa Petrobras Ambiental.
Financial Support: Cnpq and FAPEAM
9
PHYLOGENETIC INFERENCES DETECT
SYMPATRIC DIVERSITY AND ANCESTRAL
TAXON OF THE NEOTROPICAL PERIPATIDAE
(ONYCHOPHORA) IN THE AMAZON
Williana Tamara Rocha da Cunha1,2, Rita de Cássia Oliveira dos Santos1, Iracilda Sampaio1, Horácio Schneider1,
Péricles S. Rêgo1,2
Instituto de Estudos Costeiros, UFPA, Bragança, PA; 2Laboratório de Genética e Biologia Molecular, Grupo de Genética
e Conservação, UFPA, Bragança, PA.
1
[email protected]
Keywords: Onychophora, velvet worms, molecular phylogeny, sympatry, Amazon biome.
The Onychophora (velvet worm) is a phylum of soft-bodied invertebrate animals and terrestrial, distributed worldwide.
They are nocturnal and usually found in micro-habitats of humid rainforests and caves, mainly due to the inability
to survive in environments with low humidity. Taxonomic uncertainties caused by the conserved morphology of the
velvet worms have hampered the delineation of species and the reconstruction of phylogenetic relationships. In recent
decades, studies using molecular biology techniques have revealed a high diversity of species in this group due to
cryptic diversity and endemism identified for the velvet worms. Such studies have led to a critical reappraisal of the
morphological characters used for classification, since only the use of these methods may underestimate the actual
diversity within the phylum. Due to the lack of studies in the Brazilian Amazon, the fauna of velvet worms remains
little known, for which they have cataloged three species described in the area, the Epiperipatus tucupi, the Epiperipatus
brasiliensis, and the Macroperipatus geayi; and additional records of occurrence of Oroperipatus balzani , Oroperipatus
eiseni, Epiperipatus simoni and Epiperipatus edwardsii. We evaluated the diversity, the phylogenetic relationships
and the cladogenesis chronology of lineages for 21 velvet worms distribuited at different points within the Eastern
Amazon (island and mainland). For that were used mitochondrial markers (COI and 16S) and included sequences
of Neotropical and the Asian continent species, being this the first genetic study with this group of invertebrates
for the Amazon biome. We identified three reciprocally monophyletic groups, occurring in sympatric and welldifferentiated from all the species already used in other molecular studies. The lineages identified here present high
rates of interspecific genetic divergence, ranging from 9-13%. No haplotype was found to be shared between lineages,
indicating the absence of gene flow, despite the sympatric distribution. According to the phylogenetic analyzes and
molecular dating, it is appointed an Amazonian clade (Clade PA1) as the first branch that diverged around the
Lower Miocene (~ 5.7 Ma), revealing ancestral of four genera of the Peripatidae family from the Neotropical region:
Principapillatus restricted to Central America, and Oroperipatus, Peripatus and Epiperipatus present in South and
Central Americas. This result suggests that the diversification within this family in the Americas began in the Amazon
region. Besides Clade PA1, it was confirmed the existence of two other Amazonian groups (Clade PA2 and PA3) with
divergence date estimated for the Lower Pliocene (~ 2.7 Ma), closely related to the velvet worms of the Epiperipatus
genus described outside the Amazon biome. These results come to give assistance in relation to the knowledge of the
diversity of the existing fauna and neglected for this region, and in resolving taxonomic uncertainties, aspects of great
implication in the process of species preservation.
10
USE OF MOLECULAR MARKERS IN THE STUDY
OF THE MATING SYSTEM FROM PODOCNEMIS
UNIFILIS (TESTUDINES, PODOCNEMIDIDAE)
Rollemberg, GAB1,2; Fantin, C1,3;
Escola Normal Superior, UEA, Manaus, AM; 2Bolsista PAIC, Fundação de Amparo à Pesquisa do Amazonas (FAPEAM);
Mestrado em Biotecnologia e Recursos Naturais, Manaus, AM
1
3
[email protected]
Keywords: Podocnemis unifilis; paternity; microsatellite; polyandry; allele
Chelonians are reptiles from Testudines Order, known as “bichos de casco” (shell critters) for having a bony carapace
which identifies then, and also are considered the oldest living reptiles. They are scattered among diverse places as
rivers, lakes and swamps. In Amazonian Region there are seventeen chelonian species, where five of then belongs to
the Podocnemididae Family; inside this group, there is Podocnemis unifilis, known as “tracajá”. This specie inhabits
rivers of white, black and crystalline colors in Brazil, where excessive consume and exploitation of adults, juveniles
and eggs are the main challenge for the surviving of P. unifilis. This study objective relied on getting more data about
mating system (sexual behavior, paternity type) from this specie for improving the practice of suitable handling, as
for natural populations and as for captive breeding populations, and also giving basis for further research on the
same Genus of this turtle. For having a subaquatic mating, which difficults the study by observation, microsatellite
markers were used, which are widely used for answer questions of kinship, like paternity. During spawning season of
P. unifilis in “Comunidade de Granja” (Poultry farm Community) in “Barreirinha” – AM, three nests were identified
and delimited. After hatchling, 100 µL of blood from each offspring was collected, totalizing 30 samples. DNA
extraction was performed according CTAB 4% method. Extracted DNA was amplified by the Polymerase Chain
Reaction (PCR) by using three microsatellite loci (Puni_1D12, Puni_1E1 e Puni_2E7) designed for P. unifilis, and
amplification was confirmed by 1% agarosis gel electrophoresis. After microsatellite amplification, genotyping was
performed in an automatic sequencer (ABI 3130 xl) which provided data for determining the genotype of each
offspring. Paternity type in each nest was determined by a simple alleles counting and by the inference of maternal
genotype. The number of alleles ranged between 5 to 9 alleles, being the loci Puni_1E1 the most polymorphic (nest 4)
that showed the contribution of at least 4 males in the offspring, and the loci Puni_2E7 the less polymorphic (nest 6).
Multiple paternity was observed in the three studied nests, concluding this way, that P. unifilis has polyandric behavior.
Financial Support: CNPq and Fundação de Amparo à Pesquisa do Amazonas (FAPEAM)
11
GENE EXPRESSION AND ULTRASTRUCTURE
OF CEREBELLAR CORTEX OF UCHA RATS
(VOLUNTARY ETHANOL CONSUMERS)
Oliveira, SA1; Sauce, RS1; Stefanini, MA1; Lizarte, FSN3; Tirapelli, LF3; Chuffa, LG2; Takase, LF1; Pinheiro, PF2;
Martinez, FE2; Martinez, M1.
Department of Morphology and Pathology, Federal University of São Carlos/SP, Brazil; 2Department of Anatomy,
Institute of Biosciences, UNESP/Botucatu, SP, Brazil; 3Department of Surgery and Anatomy, Medical School of Ribeirão
Preto, USP/SP, Brazil
1
[email protected]
Keywords: Alcoholism, UChA strain, Gene expression, Real Time PCR, Caspase, Xiap.
Alcoholism is a disease found worldwide and is one of the most frequent clinical diagnoses. Alcoholism is pointed
by the World Health Organization as the third bigger problem of worldwide public health and can cause generalized
disturbances in various organ systems such as the nervous, digestive, urinary and male reproductive systems, generally
associated with liver cirrhosis and different types of cancer. The UChA strain constitute rare models for studying the
relationship among the genetic, biochemical, physiologic, nutritional and pharmacological factors from the effects
of alcohol, with appetite and tolerance, which are important factors in human alcoholism. The work was designed
to investigate the impact of ethanol ingestion on UCh rats cerebellum structure. Thirty adult female rats, 150 days
old, were used. The animals were divided into two groups (n=15/group): UChA group: rats fed with 1:10 (v/v)
ethanol ad libitum (free choice for water or ethanol) drinking from <1.9mL/100g/day and control rats (non-ethanol
preferring rats with 150 days old). The treatment with ethanol occurred from day 100 till day 150, totalizing 50
days of ethanol ingestion. After treatment all animals were anesthetized, weighed and sacrificed. Gene expressions of
Caspase 3 and Xiap were analyzed with Real Time PCR. For TEM analysis, specimens were fixed by immersion in
2.5% glutaraldehyde in 0.1M phosphate buffer, pH 7.2, for 3h and then postfixed in 1% osmium tetroxide in the
same buffer for 2h. At the end of treatment, mean body weight did not differ between control and alcoholic animals.
PCR analysis showed higher expression of Caspase 3 and less expression of Xiap in UChA rats. Ultrastructural
results showed damages on UChA cerebellar Purkinje and granular cells like lipid droplets accumulation, altered
nuclei, ruptured mitochondria cristae and larger intercellular spaces. Alcoholic rats demonstrated degeneration of
white matter with aberrant myelin sheats and myelin remnants. In conclusion, ethanol induced cellular cerebellar
unbalanced in UChA rats strain and may also contribute to motor coordination impairments and cognitive deficits.
Financial support: FAPESP 2011/50466-0.
12
SNPS IN THE GENE OF HSC70 APPLIED
TO ASSESS GENETIC DIVERSITY IN WILD
POPULATIONS OF MACROBRACHIUM
AMAZONICUM PRAWN
Sasamoto, B1, Blanck, DV1, Freitas, PD1, Galetti Jr, PM1
Departamento de Genética e Evolução, UFSCar, São Carlos, São Paulo, SP.
1
[email protected]
Keywords: freshwater prawns, genetic diversity, Heat Shock Protein, polymorphisms.
SNPs (Single Nucleotide Polymorphisms) have a significant potential in studies of population genetics. They allow to
assess genetic variability and population structuring. Their presence in candidate genes related to adaptation increases
the possibility of identifying loci subject to selection and are useful to study the dynamics of these genes in wild
populations. The objective of this study was to assess the genetic diversity within and between two populations
of M. amazonicum based on SNP in the HSC70 (70-kiloDalton Heat Shock Cognate) gene fragment. A total of
77 muscle tissue samples was obtained from two wild populations of M. amazonicum (47 from river Tocantins
and 30 from river Paracauari, Para State). Amplification and sequencing of the fragments were carried-out using
two primer pairs (GenBank accession number JX948079). Based on the sequence analysis (software Geneious),13
synonymous and informative SNPs were identified. All SNP loci showed Hardy-Weinberg equilibrium in both
populations (software Genepop). These SNPs were rearranged in 17 haplotypes (PHASE algorithm), providing
high values of haplotype diversity (software DNAsp) (Hd = 0.783 and 0.655 for the population of river Tocantins
and Paracauari, respectively). The AMOVA (Arlequin software) and Fst index indicated that populations are not
genetically differentiated. . The test of assigning individuals (Software Structure) confirmed the absence of genetic
structuring between these populations (with K = 2, after correction Evano). These results indicate that SNPs markers
in the gene of HSC70 may be useful to establish management strategies in conservation programs of these species.
Financial Support: CNPq, CAPES and FAPESP
13
OBTAINING GENOMIC DNA: COMPARATIVE
ANALYSIS OF PROTOCOLS IN FISHES
(LUTJANIDAE – PERCIFORMES)
Silva, D1; Silva, R1; Veneza, I1; Silva, S1, Martins, K1; Nascimento, F1; Sampaio, I2; Schneider, H2 & Gomes, G1,2.
Universidade Federal do Pará, Instituto de Estudos Costeiros (IECOS), Laboratório de Genética Aplicada, Alameda
Leandro Ribeiro, S/N, Bragança – PA; 2Universidade Federal do Pará, Instituto de Estudos Costeiros (IECOS), Laboratório
de Genética e Biologia Molecular, Alameda Leandro Ribeiro, S/N, Bragança – PA.
1
[email protected]
Keywords: DNA, protocols, Lutjanus purpureus, commercial kits
Obtaining of DNA with adequate integrity, concentration and purity is essential for the application of any subsequent
technique in Molecular Biology Laboratories, as well as for analyses based on recombining DNA technology. Currently,
there are several DNA isolation protocols available, as well as relatively fast commercial kits. This study had the purpose
of comparing the efficiency of four extraction methods often used in genetic studies. There was a comparison between
the following protocols: phenol-chloroform (protocol I), extraction with NaCl (protocol II), Promega’s Kit Wizard
genomic (protocol III) and Quiagen’s extraction Kit DNeasy (protocol IV). For assessment of each protocol, five
individual of the Lutjanus purpureus (pargo) were used, with approximately 20 mg of biological tissue removed from
each specimen’s tongue. The qualitative analysis, as well as DNA integrity, were verified through electrophoresis in 1%
agarose gel, colored with GelRed (BIOTIUM) and viewed under ultraviolet light. The product extracted was assessed
for concentration and purity in a spectrophotometer (Nano Drop 2000- Thermo Scientific). The quality of DNA was
also verified through the PCR technique, using specific primers for amplification of the rRNA 16S mitochondrial
gene. Data regarding concentration (transformed with the use of loge) and purity were compared through ANOVA and
Kruskal-Wallis non-parametric test, respectively. Both analyses were made in the R statistic environment. No difference
was observed between the four protocols for purity levels (Hcor=5.27; p=0.153), unlike the concentration values
(df=3; F= 7. 24; p=0.002). According to Tukey test, the difference of concentration occurred between the treatments
II (5.77±0.46) and IV (4.27±0.43) and III (5.26±0.63) and IV, with the concentration of nucleic acids present in
protocol IV was statistically lower than that of the two protocols mentioned above. All the samples compared were
positive for amplification via PCR. It is concluded that the traditional DNA isolation methods have efficacy comparable
to the commercial kits investigated, and may thus be a less expensive alternative for the isolation of nucleic acids.
14
HISTONE HYPOACETYLATION AND
HYPERMETHYLATION CONTRIBUTE TO
HETEROCHROMATIN MAINTENANCE IN
TRIATOMA INFESTANS KLUG
Alvarenga, EM1; Moraes, AS1; Rodrigues, VLCC2; Mondin, M3; Mello, MLS1.
Instituto de Biologia, Unicamp, Campinas, SP; 2SUCEN, Mogi-Guaçu, SP; 3Escola Superior de Agricultura Luiz de
Queiroz, USP, Piracicaba, SP
1
[email protected]
Keywords: heterochromatin, epigenetics, Triatoma infestans
Triatoma infestans, vector of the Chagas’ disease, is characterized by several particular cell biology characteristics,
including high levels of somatic polyploidy, cell fusion, presence of holokinetic chromosomes, unusual meiotic
process, strong resistance to fasting conditions and presence of conspicuous heterochromatin bodies (chromocenters)
containing AT-rich, GC-poor DNA and undetectable DNA methylation. Whether histone modifications have a role
on the condensed chromatin of these bodies has not yet been determined. Histone epigenetic marks in chromocenters
and euchromatin, and chromatin remodeling induced by inhibitors of histone deacetylases like valproic acid (VPA)
and sodium butyrate (NaBt) were investigated here as a contribution to the knowledge of the chromatin structure of
this insect. Modifications in histones H3 and H4 were compared between the heterochromatin and the euchromatin
of 5th instar nymphs of T. infestans by immunocytochemistry. The effect of various VPA and NaBt concentrations on
chromocenter condensation was studied morphologically and in the former case also microspectrophotometrically.
Acetylated H3K9, H4K8 and H4K16 residues and mono- and dimethylated H3K9 and H4K20 residues were
mostly found in the euchromatin whereas trimethylated H3K9 signals were deeper in the chromocenters of this
insect. Chromatin decondensation was detected in the chromocenters of T. infestans specimens under specific VPA
and NaBt treatments. Survival and molting rates were found to be reduced only following the VPA treatment.
Based on histone epigenetic marks, chromatin remodeling induced by VPA and NaBt, and no previous indication
of DNA methylation in the chromocenters of T. infestans, histone hypoacetylation and hypermethylation are
suggested as significantly contributing to the maintenance of the condensed state of these heterochromatic bodies.
Financial support: FAPESP (2010/50015-6) and CNPq
15
PRINCIPLES AND TECHNIQUES FOR THE
STUDY OF MOLECULAR MARKERS FROM
MICROSATELLITES FOR KINSHIP ANALYSIS
IN PODOCNEMIS EXPANSA (TESTUDINES,
PODOCNEMIDIDAE)
Magalhães, MS1,2; Farias,IP3; Fantin, C1
Escola Superior de Ciências da Saúde, UEA, Manaus, AM; 2Bolsista PAIC da Fundação de Amparo à Pesquisa do
Amazonas (FAPEAM); 3Universidade Federal do Amazonas, UFAM
1
[email protected]
Keywords: Podocnemis expansa; paternity; microsatellite.
Podocnemis expansa is popularly known as “Tartaruga da Amazonia” (Amazonian Turtle), being the biggest pleurodira
and fresh water chelonian from South America, having a wide and smooth carapace with a grayish color. Studies
show that P. expansa alongside with P. unifilis are the first choice for consumption for having a wide size, offering
a large amount of meat. The Amazonia turtle, as major chelonians, have a long sexual maturation and in addition
with the offsprings high mortality there is a low tax of individual substitution within the population. Polyandry and
multiple paternity are reproductive strategies for the specie conservation and the Molecular Marker Technique for
Microsatellite DNA is widely used for the mating system study of chelonians. There are few studies of P. expansa,
urging the necessity of echologic information about the mating system of this specie, also for its high consuption
in Amazonia Region. The objective of this study is to investigate the mating behavior of P. expansa determined by
the kinship relation of the just-hatched offsprings from nests within the “Trombetas” River – PA (trumpets river).
3 nests were studied, totalizing 84 samples. DNA extraction of each sample was performed by CTAB method and,
with the extracted DNA, the Polymerase Chain Reaction (PCR) was performed by using the economic protocol of
Schuelke with three microsatellite loci (Pe344, 1075 e Puni_1D12). The amplified product was subjected to 1%
agarosis gel electrophoresis to validate PCR. Subsequently, genotyping was performed in an ABI 3130xl Automatic
Sequencer, for detection of polymorphism in DNA sequence. Genotype of each locus was inferred by using the Gene
Marker (v.2.2.0) software. Kinship level determination of each nest was given by a simple allele counting. Variation
of alleles number ranged between 7 to 19, whereas 1075 locus was the least polymorphic (nest 2) and Pe344 locus
was the most polymorphic (nest 3). By allelic distribution analysis of the hatchlings it is suggested that nest 1 and 2
have a minimum of 6 males which contributes for the offsprings, and within nest 3 there are 9 males, characterizing
therefore multiple paternity in the three nests studied. It is concluded that P. expansa from “Trombetas” river – PA
region has a poliandric behavior, which means that this population has many males copulating with only one female.
Financial Support: CNPq and the Fundação de Amparo à Pesquisa do Amazonas (FAPEAM)
16
AGING AND DIABETES MELLITUS TYPE
1 EFFECTS ON MOUSE HEPATOCYTE
CHROMATIN
Ghiraldini, FG1; Mello, MLS1.
Department of Structural and Functional Biology, Institute of Biolgy, UNICAMP, Campinas, SP
1
[email protected]
Keywords: type-1 diabetes mellitus, epigenetics, aging
Diabetes mellitus type I (DM1) is a disease characterized by increased glycemic levels and polyuria. Cellular changes
caused by hyperglycemia might be suspected to induce a cellular early-ageing phenotype promoting changes in
chromatin supraorganization and gene expression. Sirtuins, NAD+-dependent deacetilases, play a role in the cell
metabolism, DNA repair and chromatin remodeling. Sirt1 and Sirt6, especially, are proteins related to early-ageing,
glucose metabolism and the inflammatory response. In this work we compared processes of chromatin remodeling
in hepatocytes under the effects of hyperglycemia and aging, using mouse models. Human HepG2 cells were also
used to study the epigenetic effects caused by hyperglycemia. The methodology used involved morphological and
molecular assays. An increase in DNA content and chromatin accessibility to MNase was found more pronounced
in hepatocytes from adult hyperglycemic than from aged normoglycemic mice. Despite the high abundance of Sirt1
and Sirt6 in DM1 animals, the activity of these sirtuins was not proportionally high, accompanied by increased
DNA fragmentation, whereas in old animals there was a reduction in these parameters, increasing the acetylation
of Sirt1-histonic sites. Normoglycemic old mice presented a decrease in AgNOR+ area/nuclear area ratio because
of an association of increased nuclear and decreased AgNOR+ areas. Increased DNA methylation in the 18S rDNA
region and decreased Sirt7 abundance in the hepatocytes from old mice support the hypothesis of diminished cellular
metabolism with aging. Differential gene expression showed that hyperglycemic mice hepatocytes presented an increase
in glucose and impairment in lipid metabolism. In particular, Ppargc1a had its expression increased and proved to
be a key gene that might be regulating both processes. The decrease in lipid metabolism might promote hepatic
steatosis in DM1 mice liver as a secondary disease. Similarly to DM1, middle-aged mice also presented differentially
expressed genes in glucose, lipid and xenobiotic metabolism probably in association with the increase in polyploidy
but its consequences were not as drastic as those observed in the diabetic animals. HepG2 cells showed changes in
Apoe, Igfbp1 and Foxo1 expression in hyperglycemic medium which were reverted when the cells returned to the
normoglycemic medium. Their epigenetic marks, however, presented a progressive decrease in abundance, indicative
of a hyperglycemic memory. The nuclear phenotype of HepG2 cells was suggestive of cellular proliferation when the
cells were returned to the normoglycemic medium. Inhibition of sirtuins increased the Feulgen-DNA content and
the contrast between condensed and non-condensed chromatin, indicating a role of these proteins in cell division
and chromatin remodeling. In conclusion, DM1 and ageing cannot be considered as identical processes. While in
DM1 a compensatory mechanism may induce changes in epigenetic marks, chromatin remodeling and differential
gene expression, in aging a general decrease in cell metabolism may lead to different changes in the same parameters.
Financial Support: FAPESP (2008/58067-5; 2010/50015-6) and CNPq.
17
THE PROCESS OF COLONIZATION
BY PARTAMONA RUSTICA FEMALES
(HYMENOPTERA, APIDAE, MELIPONINI)
OVER ITS OCCURRENCE SITES
Miranda, EA1; Carvalho-Filho, AF1; Moure-Oliveira, D1; Del Lama, MA1.
Laboratório de Genética Evolutiva de Himenópteros - Universidade Federal de São Carlos - UFSCar – SP
1
[email protected]
Keywords: Stingless bees, mitochondrial markers, Cytochrome oxidase I, genetic structure, and genetics population.
Partamona rustica is a social stingless bee (Meliponini) whose occurrence, restricted to Brazilian Cerrado, ranges from
Northern Minas Gerais to Southwestern Bahia and nests inside active tree-termite colonies, and walls of human
buildings. Certain observations indicate that females are not able in fly through long distances and new colonies
foundation occur close of natal nests. Due to both haplodiploidy and sex determination system, population effective
size is diminished. Therefore, P. rustica populations must be highly structured. Once these bees are important
pollinators, understanding aspects related to colonization of new areas and population structure is a determinant
factor in the definition of rational management programs for this species, besides the obtainment of empirical
subsidies towardsg conservation. This study aimed to test the hypothesis that P. rustica populations are genetically
structured among sites of its distribution due to colonization of new areas by a few maternal lineages. Such fact allows
each colonization event occurs over conditions related to founder effect. Surveys were carried out over 23 localities
in Bahia and Minas Gerais states between May 2012 and January 2013. Ten sites were sampled and 13 nests were
obtained by locality in average, totaling 132 nests. DNA extractions were carried out in one adult worker from
each nest by Chelex® 100 method. Amplification reactions of mitochondrial region CO-I (629bp) were conducted
by using primers designed for Apis mellifera. After purification, such amplicon was sequenced for both directions
aiming to check possible nucleotide differences. We verified 10 distinct haplotypes. Three localities showed single and
exclusive haplotypes – Lontra (n=16), Boa Vista do Tupim (n=14), and Manoel Vitorino (n=16) – while remaining
sites showed two. The most common haplotype was verified in six of ten analyzed sites and, possibly, is the putative
ancestral haplotype. The genic region analyzed is conserved for P. rustica once nucleotide diversity observed is indeed
low (π = 0.00302). The presence of exclusive haplotypes enhanced haplotype diversity (Hd = 0.780). As expected,
analysis of molecular variance (AMOVA) showed that 91.57% of genetic variation is due to differences among
populations (FST= 0.9156; p=0.000). These results indicate that colonization of a site occurs by one or a few number
of founder females due to low number of haplotypes by site which are, in some cases, exclusives. Over this perspective,
sampled sites are highly structured as reflected by high FST and AMOVA results. Two other regions of mitochondrial
genome are under investigation aiming to confirm the findings reported here and to corroborate our work hypothesis.
Financial Support: FAPESP.
18
GENETIC POPULATION STUDIES OF
PROCHILODUS SPP IN THE BASINS OF
PARAOPEBA, PARÁ AND GRANDE RIVERS
Barroca, TM1, Gallotti, B.1, Kalapothakis, E1.
¹Instituto de Ciências Biológicas, Departamento de Biologia Geral-Genética, Universidade Federal de Minas Gerais.
[email protected]
Keywords: Prochilodus spp, complex hypervariable repeats marker, genetic diversity.
In South American rivers, Prochilodus species are conspicuous, abundant, and widely distributed freshwater fish .
They support important fisheries in many parts of the continent. Molecular markers are powerful tools used to study
genetic diversity and population differentiation. Microsatellites or short tandem repeats (STRs) are commonly used
molecular markers in population studies. STRs are often divided into several categories on the basis of a repeating
pattern. Complex hypervariable repeats are highly polymorphic in natural populations and have many alleles that
differ with respect to both length and sequence. These hypervariable markers are sufficient to undertake a study of
the genetic population. The objective of this study was to characterize the intra-specific genetic diversity of three fish
species of the genus Prochilodus (P. costatus, P. argenteus and P. lineatus) in three river basins to test the efficiency of
the 2V35 marker in intra-specific variability studies. 252 individuals were collected of Prochilodus spp. in the three
rivers from the state of Minas Gerais: Pará, Paraopeba and Grande. To investigate the genetic diversity we used the
2V35 DNA marker previously isolated by our group. PCR amplification was made using sets of primers for the
2V35. Consensus DNA sequences obtained by bidirectional sequencing were then aligned. Arlequin 3.5.1 was used
to measure genetic variation at the intra-population level using diversity indices, such as gene diversity, nucleotide
diversity, number of observed transitions, transversions, and indels, along with the number of haplotypes shared
among populations. The genetic structure of samples was assessed using hierarchical analyses of molecular variance
(AMOVA), which was based on the index ΦST and implemented by the program Arlequin v.3.5.1.2, using 16,000
permutations, P < 0.05 and the phylogenetic inference (Neighbor-Joining method).The complex hypervariable repeat
2V35 showed a mean Fst of 0.29846 (P <0.05) in the Prochilodus genus. The AMOVA results showed that 70.15%
of this variation resided in intra-specific genetic variation (P <0.05). Pairwise FST values ranged from 0.04308–
0.61471(P <0.05). Results indicated the presence of 36 alleles of the 2V35 marker in the three basins and only one
haplotype was shared by the three species proving the high level of discrimination by the marker for intra-specific
analyzes. In conclusion, the polymorphisms of the 2V35 marker and their high efficiency for such studies can be
used for the genomic mapping and monitoring of populations. The data can be used as a baseline in future studies
to investigate how the restocking program affects the composition, structure, and life cycle of local fish species.
In addition, these data can contribute to the development of conservation management programs for this genus.
Financial Support: CEMIG (Peixe Vivo), CNPq, CAPES, FAPEMIG.
19
GENETIC CHARACTERIZATION OF NATURAL
STOCKS OF PIRARUCUS (ARAPAIMA GIGAS)
OF THE AMAZON BASIN AND THE ARAGUAIA/
TOCANTINS SYSTEM USING MICROSATELLITE
MARKERS
Luna, LW¹; Sampaio, I¹; Souza, I L²; Araripe, J¹.
¹Universidade Federal do Pará, Bragança, PA; ²Universidade Federal de Santa Catarina, SC
[email protected]
Keywords: freshwater fish, Amazon River, genetics populations, natural populations, characterization
The pirarucu (Arapaima gigas) is a fishing resource of socioeconomic importance for the Amazon region. This fish
has its natural distribution throughout the Amazon basin, in the Araguaia-Tocantins system and upper the Essequibo
River, in the Guyana. In this work we performed the genetic characterization of natural populations of pirarucus using
microsatellite genetic markers. We analyzed populations from Jarauá and Maraã located in the Mamirauá Reserve
(AM), Santarém (PA) in Amazon basin and Tucuruí (PA), Quatro Bocas and Mimoso Lake (MT) in AraguaiaTocantins system. We isolated the DNA of 218 individuals, being 40 from Jarauá, 40 from Maraã, 40 from Santarém,
38 from Tucuruí, 44 from Mimoso Lake and 16 from Quatro Bocas Lake. Five microsatellite regions described in
literature were amplified and genotyped. To characterize the populations we used number of alleles, presence of
privates alleles, index of observed and expected heterozygosity and allele frequencies, estimated in the Arlequin 3.5,
Genepop and Microchecker softwares. We identified 40 alleles for the five loci, with averages of alleles/locus ranging
from 1.6 to 5, being smaller for the populations of Mimoso and Quatro Bocas and larger in the population of Jarauá.
The greatest diversity of alleles were observed in the populations of the Amazon basin, which presented from 55 to
62.5% of the total alleles identified, while in the populations of the Araguaia-Tocantins system was observed only 2040% of the allelic diversity. We confirmed the presence of 10 privates alleles, four from Jarauá, one from Maraã, two
from Santarém and three from Tucuruí, with frequencies varying between 1.3 and 29.2%. Considering the localities
of the Mimoso and the Quatro Bocas Lake that are genetically similar, because they share all alleles as part of the same
population, with five alleles exclusively belonging to this water system. We didn’t identify any rare alleles for any of
the populations. The rates of heterozygosity observed were lower for populations of Araguaia-Tocantins system, with
values ranging from 0.476 to 0.147, while the others presented Ho ranging from 0.560 to 0.523. Hardy-Weinberg
desequilibrium were observed in four loci, all of them with heterozygous deficiency. Three loci were monomorphic for
at least one population, all of them from the Araguaia/Tocantins system. The genetic characterization data revealed
a high genetic similarity among stocks from the southern portion of the species distribution, in the state of Mato
Grosso. The comparison between the two main water systems analyzed indicates a greater genetic variability in the
stock of pirarucus inhabiting the main channel of the Amazon River. This factor may be related to aspects related to
the differences in species abundance, the dynamics of water in these two water systems, which has great influence on
the reproduction and dispersion of this species.
20
DEVELOPMENT OF MICROSATELLITE
MARKERS FOR ANALYSIS OF GENETIC
DIVERSITY OF DUSKY GROUPER,
EPINEPHELUS MARGINATUS, AIMING
THEIR CONSERVATION AND SUSTAINABLE
MANAGEMENT
Ojeda, AP1; Silva Hilsdorf, AW1
Universidade de Mogi das Cruzes, Núcleo Integrado de Biotecnologia, Laboratório de Genética de Organismos
Aquáticos e Aquicultura.
1
[email protected]
Keywords: Garoupa, Conservation, STR, Fisheries, São Paulo
The dusky grouper, Epinephelus marginatus, is the most common species in southeastearn Brazil and it has a major
commercial importance in this country. It occurs in the Mediterranean Sea, the eastern and western Atlantic and along
the South American coast, from Argentina to Rio de Janeiro. This species is a solitary fish that likes to live alone in
rocks, and presents sequential hermaphroditism. The high rate of fishing in conjunction with the lack of management
programs for this species; as well as, the late maturation of males and aggregation behavior for reproduction have lead to
the inclusion of E. marginatus in the IUCN (International Union for Conservation of Nature) list as an overexploited
species in the world and also, more recently, this species has been considered as threatened fauna in extinction in São
Paulo state red list. To achieve the maintenance and sustainable use of this marine resource is necessary the temporal
and spatial assessment of its genetic structure, and the development of sensitive methods to estimate the loss of genetic
variability in natural populations of dusky grouper. Short tandem repeat (STR) or Microsatellites are molecular tools
that present advantages that make them ideals for analysis named above. The aim of this work is to develop microsatellite
loci for this species and use them to characterize the intra and inter population genetic variability from southeastern
coast of Brazil. The microsatellite library was designed by the company Genoscreen, giving 166 primers validated by
bioinformatic tools with motifs repeat di, tri and tetra nucleotide. The DNA was extracted of the caudal fin from 40
specimens. The PCR conditions were standardized to extend 10 microsatellite regions in E. marginatus. Although our
findings are preliminary, allowing us to establish the first microsatellite sequences of the species objet of our study.
Financial Support: FAEP, FAPESP.
21
REPRODUCTIVE STRATEGIES IN THE
NEOTROPICAL PITVIPERS BOTHROPS
SPECIES (VIPERIDAE, CROTALINAE):
INSIGHTS FROM MICROSATELLITE ANALYSIS
Salomão, MG1,3; Caparroz, R2; Travaglia-Cardoso, SR1, Sant’Anna, SS1, Grego, KF1, Albuquerque, CC1, Castro,TG3
and Telles, MPC3
Laboratório de Herpetologia, Instituto Butantan, São Paulo, Brazil; 2Departamento de Genética e Morfologia, Instituto
de Ciências Biológicas, Universidade de Brasília, DF, Brazil; 3Laboratório de Genética & Biodiversidade, Instituto de
Ciências Biológicas, Universidade Federal de Goiás, Goiás, Brazil
1
[email protected]; [email protected]
Keywords: Bothrops, parthenogenesis, polyandry, microsatellites
Lanceheaded pitvipers from the Bothrops (sensu lato) group represent a notorious etiologic agent concerning snakebite
in Latin America. Their reproductive cycle is quite similar to species from temperate hemisphere, concerning female
sperm storage, gestation and episodes of parthenogenesis. However, such events are commonly misinterpreted due
to lack of genetic analyzis. Microsatellites are quite strong tools to address these questions, but they are scarce in
literature for pitvipers. In this work we analysed eight litters of Bothrops using primers originally developed for
Bothrops insularis and successfully transferred to four species of Bothrops atrox species complex in order to check
for the presence of polyandry and parthenogenesis events. Pregnant females of B. moojeni (n=3) and B. marajoensis
(n=1) caught in wild had their offspring (n=28) investigated for seven loci of microsatellites assigned as: 52.17;
52.22; 52.7, 52.8, 60.3, 60.6 and 60.9. The same procedure was carried out with B. atrox (n=1) and B. moojeni
(n=3), captive virgin mothers, and their newborn (n=6). Total DNA was obtained from liver tissue kept in 80%
ethanol and blood samples collected in EDTA and kept in SDS/Tris solution using DNeasy Blood & Tissue
- Kiagen. Excepting for primers 52.7 and 60.9, the remaining five loci tested produced amplification product in
taxa investigated after PCR optimization. Different levels of polymorphism were observed among primers in all
species examined. Number of genotypes varied from 21 (loci 52.17 and 52.22), 11 (52.8), 5 (60.3) and 2 (60.6)
in B. atrox; 11 (52.17), 8 (52.22), 4 (52.8), 1 (60.3) and 3 (60.6) in B. marajoensis; and 31 (52.17), 24 (52.22),
11 (52.8), 1 (60.3) and 2 (60.6) in B. moojeni. Newborn and their virgin mothers presented identical genotypes
for each of the five tested loci both in B. atrox and B. moojeni. In one same litter of wild B. moojeni from the
State of São Paulo born in captivity it was possible to observe the presence of five different alleles for locus 52.22,
indicating the genetic contribution of more than one father to the same offspring. Results presented here suggest
that parthenogenesis and polyandry are more common than expected components of genus Bothrops reproduction.
Financial Support: CNPq - PDS to MGSalomão, Proc. No. 150634/2011-0; FAPEG/AUX PESQ CH 007/2009
22
TWO RIBOSOMAL PROTEINS ARE INVOLVED
IN THE PROCESS OF ANHYDROBIOSIS (LIFE
WITHOUT WATER) IN PANAGROLAIMUS
SUPERBUS
de Carli, GJ¹; Padua¹, LV¹; Evangelista, CCS¹; Borges, G¹; Arab, FE¹; Tunnacliffe, A2; Pereira, TC¹.
Lab. de Genética Molecular da Anidrobiose, Dpto de Biologia, FFCLRP USP, Brazil; 2Dept of Chemical Engineering and
Biotechnology, University of Cambridge, UK
1
[email protected]
Keywords: anhydrobiosis, desiccation tolerance, RNAi, siRNA, ribosome
Some species are able to withstand extreme desiccation by entering a state of suspended animation known as
“anhydrobiosis”. Once desiccated, anhydrobiotic species are resistant to diverse kinds of extreme stresses. We
decided to investigate the roles of two ribosomal proteins (rp): L4 and L7a in the process of anhydrobiosis in the
free living nematode Panagrolaimus superbus using RNA interference (RNAi). Nematodes were soaked with 27
bp RNA duplexes against each target individually (1 µM) for 24 h, then subjected to the following conditions:
98% relative humidity (RH); 10% RH, 100% RH and then rehydrated with M9 buffer. siRNA against GFP was
used as a negative control. Multiplex RNAi was performed by soaking worms in solutions of siRNAs against two
targets simultaneously (0.5 µM or 1 µM of each siRNA), following the previously described procedure. Silencing
rpL4 and rpL7a individually does not promote any significant decrease in survival percentage in normal conditions,
evidencing they are not essential genes. However, RNAi followed by desiccation of each one leads to clear reductions
in survival percentages: 32% and 19%, respectively. Curiously, multiplex RNAi promoted only a small reduction
after desiccation: 17%. Understanding the process of desiccation tolerance is a crucial step towards “Anhydrobiotic
Engineering”, i.e., the preservation of biological samples in the dry state. Here we identified two novel anhydrobiosisrelated genes: ribosomal proteins L4 and L7a, which are not essential to the nematode in normal conditions of
humidity. These findings suggest a specialized function for both ribosomal proteins, such as (i) synthesis of specific
polypeptides during dehydration/rehydration or (ii) large scale synthesis of proteins accumulated during anhydrobiosis.
Supported by FAPESP and CNPq.
23
IDENTIFICATION OF TWO NOVEL
ANHYDROBIOSIS-RELATED GENES IN
PANAGROLAIMUS SUPERBUS VIA MEDIUMSCALE SCREENING AND MULTIPLEX RNAI
Padua, LV¹; Evangelista, CCS¹; Borges, G¹; de Carli, GJ¹; Arab, FE¹; Tunacliffe, A2; Pereira, TC¹.
Lab. de Genética Molecular da Anidrobiose, Dpto de Biologia, FFCLRP USP, Brazil; 2Dept of Chemical Engineering and
1
[email protected]
Keywords: anhydrobiosis, desiccation tolerance, RNAi, siRNA, multiplex
Anhydrobiosis (from the Greek, “life without water”) is a very stable state of suspended animation which some
species enter when facing intense water stress. Once in this situation, the organism is resistant to various kinds
of biotic and abiotic stresses such as: radiation, ultraviolet light, extremes of temperature and pressure. There is a
huge potential use in medicine, for organ transplantation, transport of vaccines and other biological samples in
the dry stage at room temperature. This strategy, known as Anhydrobiotic Engineering, demands the complete
understanding of the molecular basis of desiccation tolerance. We decided to use RNAi to screen a panel of 25
candidate genes in the free living nematode Panagrolaimus superbus. Worms were soaked for 24 h in solutions of
siRNAs against each target (1 µM), pre-conditioned in copper sulphate (24 h), desiccated in silica gel for (24 h),
pre-rehydrated in water vapour (24 h) then rehydrated with M9 buffer. siRNA against GFP was used as a negative
control. Our first screening identified two genes: “aldoketo reductase” and “aquaporin”, which promoted 25% and
17% reductions of in viability after desiccation, respectively. Aldoketo reductases are phase I metabolising enzymes
and probably play a role in anhydrobiosis by detoxifying the cellular milieu during desiccation/dehydration.
Aquaporin is a protein which allows the controlled transport of water through the phospholibid bilayer, a very
important process during fast dehydration and rehydration. We then decided to investigate the biological effects
of multiplex RNAi in this animal model. Worms were soaked for 24 h in a solution of siRNAs against both targets
(0.5 µM or 1 µM of each siRNA), following the procedure described previously. We observed that worms submitted
to multiplex RNAi (0.5 µM) did not present any significant reductions in survival percentage after desiccation.
However, soaking at 1 µM (each) promoted a decrease of 38%, evidencing an additive effect in dual-target approach.
Multiplex analyses are interesting strategies when individual knockdown promotes small declines in viability.
Targeting two or more genes simultaneously might lead to an additive or synergistic effect, which could be more
easily detected in large-screening experiments. In summary, we identified two novel anhydrobiosis-related genes and
demonstrated that dual-target RNAi by soaking is feasible in our model. Since most of the anhydrobiotic-related
genes promoted small decreases in survival, knocking three or more genes at once may be an interesting approach.
Supported by: FAPESP and CNPq.
24
27 BP RNA DUPLEXES EFFICIENTLY TRIGGERS
RNAI IN PANAGROLAIMUS SUPERBUS
de Carli, GJ¹; Evangelista, CCS¹; Padua, LV¹; Arab, FE¹; Tunnacliffe, A2; Pereira, TC¹.
Lab. de Genética Molecular da Anidrobiose, Dpto de Biologia, FFCLRP USP, Brazil; 2 Dept of Chemical Engineering and
1
[email protected]
Keywords: anhydrobiosis, desiccation tolerance, RNAi, siRNA, dicer substrate
Anhydrobiosis is a highly stable state of biological organisation that is achieved by certain species when exposed to
extreme dehydration. During anhydrobiosis, specimens can be submitted to diverse abiotic stresses. The identification
of anhydrobiosis-related genes will allow the development of future technologies focused on preserving organs in the
dry state. RNA interference (RNAi) can be triggered in the anhydrobiotic nematode Panagrolaimus superbus through
feeding and can be used to identify genes associated with desiccation tolerance. We decided to investigate: (i) whether
soaking P. superbus with 27 bp RNA duplexes (dicer substrates) is feasible, (ii) whether dual-targeting promoted
an additive effect and (iii) whether shortening desiccation protocols alters silencing efficiency. Worms were soaked
with dicer substrates (1 µM) for 24 h then subjected to the following conditions: 98% relative humidity (RH); 10%
RH, 100% RH and then rehydrated with M9 buffer. siRNAs against GFP were used as negative control. Multiplex
RNAi was performed by soaking worms in solutions of siRNAs against two targets (0.5 µM or 1 µM of each siRNA),
following the previously described procedure. An alternative (shorter) RNAi/desiccation protocol was designed by
eliminating pre-conditioning and pre-hydration steps. We observed an efficient knockdown when soaking worms for
24 h with dicer substrates, as judged by RT-PCR. Changes in survival percentages were observed when silencing two
genes: (i) cyclophilin (cyp5) and (ii) tetratricopeptide repeat containing protein (13% and 20% decrease, respectively).
Simultaneous dual-knockdown lead to a 20% reduction in survival percentage. Our preliminary data suggests that a
shorter RNAi/desiccation protocol is not effective. Cyclophilin´s catalytic activity has been shown to enhance the rate
of protein folding as well as a role in protein processing, events that may be relevant in anhydrobiosis due to structural
alterations in protein caused by water loss and pH alteration. The precise biological function of “tetratricopeptide repeat
containing protein” remains to be unveiled. Curiously, dual-knockdown did not promote an additive effect (suboptimal
response). The alternative RNAi/desiccation protocol was not effective probably because protein knockdown was
not achieved in such a brief time, evidencing the need for longer incubation periods for effective gene silencing. In
summary, we showed that dicer substrates are effective triggering molecules for RNAi experiments and two novel
anhydrobiosis-related genes were identified. Our findings may help accelerate the understanding of anhydrobiosis.
Supported by FAPESP and CNPq.
25
SELECTION AND DIVERSITY IN THE MHC
CLASS II B LOCUS IN THE ATLANTIC GOLIATH
GROUPER
Silva-Oliveira1, GC; Silva1, ABC; Blanchard2, F; Nunes1, ZP; Torres3, RA, Sampaio1, I and Vallinoto, M1,4.
Instituto de Ecossistemas Costeiros, Universidade Federal do Pará, Brazil; 2 Institut Français de Recherche Pour
I’exploitation de la Mer. IFREMER; 3Universidade Federal de Pernambuco, Brazil; 4Centro de Investigação em
Biodiversidade and Recursos Genéticos da Universidade do Porto, Portugal.
1
[email protected]
Keywords: MhcEit-DAB, Atlantic Goliath grouper, genetic diversity, positive selection, purifying selection.
The MHC is responsible for the recognition of pathogenic molecules and the regulation of the immune system.
Given this, the investigation of the genetic variability of the DAB locus permits the understanding of the impact of
pathogens on the evolution of natural populations. No data are available on the attempt to correlates the diversity
and selection of MHC II-β locus in endangered Goliath grouper from Southern Atlantic. Given that several aspects
have been indicating the threats over this species we tested its conservation status by accessing the variation of the
MHC II-β locus. Such strategy allows investigating the selective forces affecting this region. These analyses may
also provide an important database to understand the evolutionary processes affecting the populations of the
Goliath grouper, and to predict the conservation perspectives in the species. The samples analyzed were obtained
from four locations along the Southern Atlantic in Brazil: Ajuruteua Beach (AJ=14) in the state of Pará, Parnaíba
River estuary (PA=08) in the state of Piauí, Potengi River estuary (PR=10) in the state of Rio Grande do Norte,
and Formoso River estuary (FR=09) in the state of Pernambuco. The samples of the tissue and fins were obtained
from local fishermen between 2000 and 2008. In the present study, a high degree of polymorphism was identified
in the MhcEit-DAB locus, as well as evidence of positive and purifying selection at the sequence level, which are
reflected in the stability of these loci in Epinephelus itajara in comparison with those of other organisms, which
have suffered selective pressure from pathogens. The high degree of polymorphism of the locus also supports it
use as a molecular marker for estimating the genetic diversity of other Epinephelidae species, which would also
allow the levels of depression, stability, and diversification of these alleles to be estimated in these populations.
Financial Support: CAPES and CNPq
26
GENETIC HISTORY OF POPULATIONS OF
CAPUCHIN MONKEYS IN THE AMAZON,
GENUS SAPAJUS, INFERRED FROM
MITOCHONDRIAL DNA ANALYSIS
Gomes, FNP1; Rodrigues-Filho, LF; Sampaio, I1; Schneider, H1.
Laboratório de Genética e Biologia Molecular, Instituto de Estudos Costeiros, Universidade Federal do Pará, Bragança,
Pará, Brasil.
1
[email protected]
Keywords: New World primate, Sapajus apella, mitochondrial DNA, Pleistocene refuges.
One explanation for the current distribution of primates in Amazon considers their dispersal after Pleistocene refuges.
There are many evidences suggesting that during most of the Pleistocene climatic fluctuations isolated forest refuges
that led to speciation of several vertebrate species. Considering the new world primates, studies have estimated that
the differences within each genus of platyrrhine occurred sometime during the Plio-Pleistocene. The Pleistocene
refuge hypothesis is not the only that fit in the Amazon biodiversity explanation; the rivers can pose a major barrier to
gene flow between populations of animals, including species of birds and primates. The species of capuchin monkey
presented as an excellent model for investigating the history of diversification and distribution of Amazonian primates,
due to the high polymorphism within a population and its wide distribution in South America. The present study
analyzed the genetic structure populations of Sapajus apella coming from left and right margins of the Jamari River
(Rondonia) in order to evaluate the efficiency of the river as a barrier to the dispersal of these populations. The
sequencing of the control region and Cytocromo b gene of mitochondrial DNA from 49 specimens of S. apella
revealed the presence of three distinct mitochondrial lineages, two on the left (L1 and L2) and one on the right edge
(L3). We also observe that the lineage 3 (right bank) is phylogenetically closer to lineage 2 (1.7%), L1 being the
most divergent lineage (L1/L2 - 3.3%; L1/L3 - 3 , 6%). The divergence date estimates that happened two points of
diversification in the Pleistocene, the first of which occurred in the lineage differentiation 1 is about 1.2 million years
ago (MA), followed by differentiation of lineages 2 and 3 for 700 thousand years ago . From this, our data lead us to
affirm that is currently occurring secondary contact between these genetically differentiated populations, we propose
here that initially the lineage 1 has diversified through the Pleistocene refugia and subsequently the lineages 2 and 3
had differed by a vicariance event associated with the river, and currently the Jamari River represents a weak barrier for
the isolation of these populations, it no longer prevents the movement of individuals from one bank to another. This
is the first study that examines the genetic structure of Amazon S. apella and is of great importance to elucidate the
genetic history of this species, as well as resume discussions on possible environmental and geomorphological processes
occurring in the Amazon during the period in which the lineages differed and that led to the differentiation of each.
Financial Support: CNPq and UFPA
27
HEPATOCYTE NUCLEAR FACTOR 4 GENE
ASSOCIATED WITH BONE TRAITS AND BIRTH
WEIGHT IN MALE CHICKENS
Silva, VH1,2,3; Pandolfi JRC2; Godoy TF3; Peixoto JO2; Tessmann AL2; Cantão, ME 2, Ledur MC2
Universidade Estadual de Londrina - UEL, Londrina, PR. Endereço atual: ESALQ/USP; 2Embrapa Suínos e Aves,
Concórdia, SC; 3Universidade de São Paulo - USP/ESALQ, Piracicaba, SP
1
[email protected]
Keywords: Broiler, Bone integrity, HNF4α, SNP, GGA20
Association of candidate genes with traits can help to understand their physiology, giving insights of possible pathways
related to the expressed phenotype. The HNF4α gene (hepatocyte nuclear factor 4, alpha) is a hepatic transcription
factor normally related to the lipid and insulin metabolism in humans, being a potential candidate gene related to
general metabolism in chickens. Interestingly, some genes previously associated with bone traits in chickens, such as
Insulin-Like Growth Factor-I (IGF1) have higher affinity to insulin receptor, probably influencing in some level the
insulin metabolism. This work aimed to establish relationship between a polymorphism in the HNF4α gene (SNP
A543G) with 23 broiler bone traits and 4 body weight traits (at 1, 21, 35 and 42 days of age). A total of 1380 chickens
from the EMBRAPA TT Reference Population was genotyped by PCR-RFLP. Association analysis of the SNP with
phenotypic traits was carried out with QxPak software. A mixed model with fixed effects of hatch, sex and SNP, and
the infinitesimal and residual random effects was applied. The additive effect of the SNP was tested, including its
interaction with sex. The additive effect of the marker was strongly influenced by sex, being significant only in males for
the following traits: femur length after freezing period (P < 0.01), tibia weight after freezing period (P < 0.006), femur
weight after slaughter (P < 0.001) and birth weight (P < 0.05). The effect of this SNP on birth weight might be explained
by the higher percentage of bone tissue in newborn animals when compared with other tissues. The results indicate that
selection favoring the A allele on males from this population could contribute to improve the general bone structure.
Financial Support: CNPq Process nº 481755/2007-1 and Embrapa Project nº 02.10.06.003.00-04.
28
IS CENTROMERE REPOSITIONING
OCCURRING IN RHIPIDOMYS (CRICETIDAE,
RODENTIA)?
Carvalho, AH a; Araújo, NP b; Lopes, MOG c; Svartman, M b
Centro de Ciências Humanas e Naturais, UFES, Vitória, ES; bInstituto de Ciências Biológicas, UFMG, Belo Horizonte, MG;
IC Ambiental, Belo Horizonte, MG.
a
c
[email protected]
Keywords: Centromere Repositioning (CR), Evolutionary New Centromeres (ENC).
Most Rhipidomys species present a diploid number of 2n=44, but the fundamental number (FN) varies greatly. There
has been a proposal to divide the species of the genus into three groups on the basis of 2n and FN,: (a) the Rhipidomys
leucodactylus contains species with 2n=44 and a low FN (FN=46 to 52); the R. mastacalis group with 2n=44 and high
FN (FN=72 to 80); and the R. nitela group is composed of R. nitela with 2n=44 (FN=71), 2n=48 (FN = 67/68) and R.
cf. nitela with 2n=50 (FN = 71/72). A possible hybrid of Rhipidomys (2n=44 and FN=61) between a species with a large
FN and another one with a low FN has been reported. Most cytogenetic studies on Rhipidomys have been performed
with conventionally stained karyotypes and in less than half the GTG- CBG- or AgNOR-banding patterns were also
included. Comparative karyotypic analyses of Rhipidomys cf. macrurus, R. mastacalis and Rhipidomys sp1 specimens
suggested that Pericentric Inversions were the main, if not the exclusive, chromosome rearrangements observed in the
genus. Later, the occurrence of constitutive heterochromatin polymorphisms and Robertsonian rearrangements was
also reported. More recently, FISH experiments with telomeric probes were reported for specimens of Rhipidomys
nitela, R. mastacalis, R. leucodactylus and Rhipidomys cf. macrurus; in which no interstitial signals were observed. In this
work, we compared cytogenetically three species of Rhipidomys: R. macrurus, R. mastacalis and Rhipidomys sp2. The
three species presented a diploid number of 2n=44, but their fundamental numbers varied: FN=74 in R. mastacalis;
FN=50 in R. macrurus; and FN=48 in Rhipidomys sp2. Comparative karyotypical analyses were performed after GTGand CBG-banding and complemented with fluorescent in situ hybridization with telomeric probes and interspecific
hybridization using total genomic DNAs of Rhipidomys sp2 and R. mastacalis as probes. Comparative analyses of the
GTG-banded karyotypes allowed us to conclude that the variation in FN, which reflects the morphological differences
between 14 pairs of corresponding autosomes of the three species, seemed to result from centromeric repositioning.
This contrasts with previous reports that proposed Pericentric Inversions as the main rearrangement involved in the FN
variation in this genus. Interspecific GISH revealed an extreme conservation between the complements of each pair of
species which extended to the constitutive heterochromatin revealed by CBG-banding. FISH with the telomeric probe
produced signals only in the terminal regions of all chromosomes. If the FNs variation reported in Rhipidomys is due to
Centromere Repositioning, this genus represents a suitable model to study this still poorly understood rearrangement.
Financial support: CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior) and FAPEMIG (Fundação
de Amparo à Pesquisa do Estado de Minas Gerais).
29
TESTING MITOGENIC ACTION OF DIFFERENT
DRUGS IN CELL DIVISION OF TROPIDURUS
TORQUATUS LIZARDS (SQUAMATA)
Castro, RS; Cazetta, EA; Pazza, R; Kavalco, KF
Laboratório de Genética Ecológica e Evolutiva, Universidade Federal de Viçosa, Campus de Rio Paranaíba
[email protected]
Keywords: chromosomes, cytogenetic, lizards
Several pharmaceutical products available on the market have direct or indirect effect on the various cellular
components and can be used as mitogenic agents. These are capable of stimulating cell divisions causing cell
proliferation. During metaphase, the chromosomes reach the maximum condensation and therefore can be viewed
more easily and with detail. Suitable chromosome preparations are desired to evaluate characteristics of species or
populations. In reptiles, it is customary to carry out direct chromosome preparations from cells that are dividing
in the body. Thus, the number of dividing cells does not always allow a complete cytogenetic analysis. Therefore,
it is necessary the use of mitogenic agents that do not interfere with chromosomal characteristics. Historically it
uses the injection of a solution of phytohemagglutinin, which is being replaced by other components with better
results. One of these drugs is Nikkho-Vac, which was recently withdrawn from the market. Therefore, the aim of
this study was to evaluate different drugs with similar action to Nikkho-Vac so they can replace it in chromosome
preparations in reptiles. We collected individuals of T. torquatus (Squamata) in the Alto Parnaíba, Minas Gerais
state. There were used twenty lizards, which were divided into five groups – a control group with Nikkho-Vac,
a group treated with Broncho-Vaxom, and the drug Umckan three concentrations (0.1%, 0.5% and 1%). We
applied 0.1 mL/10g weight of the animal. For each individual we analyzed four slides for evaluating the number
of metaphases found. The results are presented as a proportion of metaphases in the control, which was assigned
the index 1. Drugs Umckan and Broncho-Vaxom concentration of 0.1 obtained index 0. In turn, Broncho-Vaxom
at concentrations of 0.5 and 1% show indices 0.09 and 0.22 respectively. We conclude that the concentration
of 1% Broncho-Vaxom showed the best results. However, it is still far from achieving efficiency of Nikkho-Vac.
Considering that this drug is no longer available in the market, it is necessary to search for other mitogenic agents.
Financial Support: FAPEMIG
30
DNA BARCODING FOR SPECIES
IDENTIFICATION AND PHYLOGEOGRAPHIC
ANALYSIS OF LOWER AMAZONIAN FISHES
Leite, DR1; Barroso, FF1; Peixoto, L2; Dutra, G2; Wosiacki, WB2; Sampaio, MI1; Figueiredo-Ready, WMBF1; Ready, JS1.
Instituto de Estudos Costeiros, UFPA Campus de Bragança, Bragança, PA; 2Museu Paraense Emílio Goeldi, Belém, PA
1
[email protected]
Keywords: Lower Amazon, fishes, molecular identification
The strategy of DNA barcoding has been successfully used for identification of fish species, though as yet there have
been few publications on the Amazonian fish fauna. This must partially be a reflection on the taxonomic uncertainty
of samples collected in the region and the requirements in Barcoding projects for best possible identification. The
objective of this study was to (1) evaluate the applicability of the DNA barcoding method for identifying Lower
Amazon fish species in a blind comparison with morphological identification and (2) investigate any possible
phylogeographic structuring in samples between the drainages sampled. Samples were collected from 17 localities
belonging to five different tributaries on the north bank of the Lower Amazon. At each locality, each preliminary
morphotype identified in the field was photographed, tissue sampled and preserved as voucher material. Further
samples were split and preserved in either ethanol or formalin to provide additional reference material to increase
sample numbers for any posterior morphological or genetic analysis. After DNA extraction the 5’ region of the
mitochondrial cytochrome oxidase 1 gene was amplified by PCR and bidirectionally sequenced for 195 samples.
All processes followed protocols indicated by the Consortium for the Barcode of Life (CBOL). For the molecular
identification a frequency plot of divergence values was produced to visually determine the potential presence of
a barcode gap, and use this to determine the number of species identifiable through the barcoding method.
Morphological identifications were made independently using standard diagnostic measurements as indicated in the
literature describing species. After determining a species delimitation of 2% pair-wise divergence from the frequency
plot, a total of 109 species were diagnosed with a mean intra-specific distance of 0.28% pair-wise divergence and a
mean inter-specific (but congeneric, after combining data with morphological identification) pair-wise divergence
of 15.3%. Pure morphological identification of the voucher samples resulted in a count of 106 species diagnosed.
There were however significant differences between the lists of species. Notably, many species of Crencicihla were
identified morphologically, but proved to belong to a single mitochondrial lineage. The converse was true for the
genus Pimelodella where two morphological species were identified but five mitochondrial lineages were identified
with >2% pair-wise divergence. In three of the five species with a sample size greater than or equal to three there
were clear indications of phylogeographic structure, with the partially divergent lineages associated with different
tributaries. Our results highlight the need for combined morphological and molecular analyses in biodiversity studies
and validate the use of DNA barcoding to provide not only species identifications but also evidence of phylogeographic
structuring of populations which can help elucidate the speciation processes underlying the existing diversity.
Financial Support: CNPq, FAPESPA
31
DMRT1 GENE EXPRESSION IN MALE
GONAD OF CHARACIDIUM SCHUBARTI
(CHARACIFORM)
Gomes, CP1; Hattori, RS2; Almeida-Toledo, LF1.
Laboratório de Ictiogenética, Instituto de Biociências, USP, São Paulo, SP; 2Graduate School of Marine Biosciences,
TUMSAT, Tokyo, Japan
1
[email protected]
Keywords: dmrt1, gene expression, sex determination, Characidium schubarti, Characiform.
The dmrt1 belongs to the Dmrt gene family, which is characterized by the presence of a DM-domain with conserved
structure and function related to the development of testes in males. The proteins translated from dmrt1 regulate
gene transcription, as observed in proteins translated from SRY gene in mammals. The dmrt1 is expressed in the
embryonic gonads of many vertebrates, like mammals, birds, reptiles, amphibians and some groups of fishes. The
Neotropical genus Characidium, the richest in number of species in the Chrenuchidae family (Characiform),
is composed by small freshwater species which are commonly used as ornamental fish. Most studies in this and
other Neotropical genus in general are limited to the cytogenetic characterization of sex chromosomes, so, the
molecular mechanisms of sex determination and differentiation are largely unknown. In this context, this work was
designed to clarify the molecular pathways of male gonad ontogenesis using Characidium schubarti. As a first step,
the RNA was obtained from the testes of adult males in the breeding season; cDNAs expressed in these gonads
were amplified by nested RT-PCR using two degenerated primers sets, designed from known sequences of dmrt1
gene of Odontesthes bonariensis, in order to isolate dmrt1 gene in specimens of C. schubarti. The RT-PCR product
was sequenced and the sequences obtained were compared with known sequences of other Teleost fish groups to
confirm the expression of dmrt1. It was detected successfully the expression of dmrt1 in gonadal tissue of adult
males of C. schubarti as recently described in other group of fishes, such as Medaka and Rainbow trout. The dmrt1
is one of the most conserved genes involved in sex determination and differentiation among the vertebrates and
fishes, being the only molecular similarity in sex determination found among phyla. Fish sex determination and
differentiation have been extensively reviewed and studied in last decade and the results presented in this study
can contribute to clarify the molecular mechanisms of sex determination in the Characidium (Characiform) specie.
Financial support: FAPESP
32
FUNCTIONAL ANALYSIS OF MOUSE CSB IN
TRANSGENIC ASSAYS
Nogueira, AF1; Moreira, RN1; Shubin, NH2; Schneider, PN1; Schneider, I1.
Instituto de Ciências Biológicas, Universidade Federal do Pará, Belém, Brasil; 2Department of Organismal Biology and
Anatomy, University of Chicago, Chicago, IL
1
[email protected]
Keywords: Digits, Gene Expression, Evolution, Hoxd, Enhancers
The, evolutionary transition of the fin of fish into the tetrapod limb, involved genetics changes in developmental program,
which resulted in the origin of the digits in tetrapods. Posterior HoxD genes are necessary for the correct development
of the autopod, the more distal region of the limb, which includes the digits. Gene expression is broadly controlled
by regulatory elements, such as enhancers. These elements control when, where and how the genes are expressed.
Enhancers are small segments of DNA that recruit transcription factors (TFs) to regulated transcription. TFs typically
recognize small 6-12 bp long DNA sequence (motifs) in enhancers, and bind to it. The expression of posterior Hoxd
genes in autopod is regulated by enhancers located in centromeric side of the Hoxd cluster. Among these enhancers,
the conserved sequence B (CsB) is of particular interest because it is present in all vertebrate genome analyzed to date.
Genomic sequence comparisons reveal that CsB is high conserved between mammals and teleost fish. In mouse, CsB
can be divided in two smaller conserved peaks, named here CsB1-2 and CsB3. In order to identify the conservation
peak sufficient to regulate expression only in digits (termed CsB-D), we have cloned mouse CsB fragments into reporter
vectors and produced transgenic mice carrying each one part of CsB (CsB1-2 or CsB3). Fragments CsB1-2 and CSB3
were PCR amplified from mouse genomic DNA and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). The
CsB element was then transferred to the destination vector gw-HSP68-LacZ by LR recombination system (Invitrogen).
The final products were confirmed by DNA sequencing (ABI Prism 3500 - Applied Biosystems). Mouse transgenic
assays were carried out by the University of Chicago Transgenic Mouse and Embryonic Stem Cell facility. We used the
same criteria followed by VISTA Enhancer Browser from Lawrence Berkeley National Laboratory (EUA), where the
regulatory activity was achieved when at least 3 transgenic embryos showed the same expression pattern of reportergene. Our results identify the mouse CsB segment sufficient to produce reporter expression in digits (CsB-D). These
findings will allow future studies of comparative analyses of CsB-D of mouse with others CsB in the vertebrates, in
order to reveal the regulatory steps underlying the evolution of HoxD gene expression and the origin of tetrapod digits.
Financial Support: CAPES and CNPq.
33
POPULATION STRUCTURE OF
ARAPAIMA GIGAS (SCHINZ, 1822)
(OSTEOGLOSSIFORMES: OSTEOGLOSSIDAE)
FROM THE AMAZON BASIN REVEALED
BY MITOCHONDRIAL CONTROL REGION
SEQUENCES
Nogueira, FN 1; Paz, FS 1; Sampaio, I 1; Queiroz, HL 2; Araripe, J 1.
Laboratório de Genética Aplicada, Instituto de Estudos Costeiros (IECOS), Universidade Federal do Pará (UFPA),
Bragança, Pará, Brasil; 2Instituto de Desenvolvimento Sustentável de Mamirauá, Amazonas, Brasil.
1
[email protected]
Keywords: genetic population, pirarucu, Arapaima, Amazon basin, conservation.
Arapaima gigas, popularly known as pirarucu, is one of the largest freshwater ﬁshes of South America and represents
one of the economically important species of the Amazon basin, where it is widely distributed. With a history of
intense exploitation, the species showed evidence of decline in their natural stocks. Previous analyzes using 14
microsatellite loci and 2,347 bp of mitochondrial DNA (ND2/ATPase) of pirarucus from the Amazon basin,
suggest that A. gigas form a panmictic population, with gene flow between locations. However, when the genetic
structure of this stock was assessed using microsatellite markers in three geographic scales, was found a high genetic
differentiation between stocks separated by about 1,500 km. This study attempts to infer on the genetic diversity
and check the level of population sub-structure in the Amazon basin using mitochondrial markers more variable
than those previously studied. We sampled 144 pirarucus along the main channel of the Amazon basin including:
Peruvian (Iquitos), Colombian (Leticia) and Brazilian Amazon (Mamirauá Reserve, Juriti, Santarém and Cutias do
Araguari). We analyzed 674 bp of the mitochondrial control region, identifying 38 polymorphic sites, with 33 of these
informative for parsimony, generating 34 haplotypes, high haplotype diversity (0.921) and low nucleotide (0.0077).
Our results show higher levels of genetic diversity for stocks Juriti and Santarém (H: 0.846 π: 0.0077 and H: 0.906
π: 0.0069, respectively). Three haplotypes were more frequent, the latter being shared among populations from at
least three areas. The population from Cutias do Araguari was the only one which didn’t share haplotype with any
other locality, being observed a single haplotype. Due to the geographic location of the population from Cutias do
Araguari, near the confluence of two major river systems (the Amazon basin and Araguaia-Tocantins basin), the
structuring between this locality and those from the main channel of the Amazon basin was tested by AMOVA. The
results indicated that 34.78% of the total variation was observed between the two groups, whereas about 54.12% is
within the total population. The pair-wise Fst statistics revealed moderate and significant values (0.55-0.44) between
the population from Cutias do Araguari and the others. Within the main channel of the Amazon basin, significant
difference was observed between some pairs of location with values ranging

from 0.12 to 0.40. The Mantel test was
significant, supporting the hypothesis of isolation by distance. Our results suggest an effective connectivity within
the Amazon Basin, with differentiation influenced by distance. However, further efforts are needed to increase the
number of sampling in the locations at the mouth of the Amazon river, seeking results that can support strategies for
management and conservation of this species, which in addition to commercially relevant, is emblematic of the Amazon.
Financial Support: Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Pró-Reitoria de Pesquisa
e Pós-Graduação da UFPA (PROPESP-UPFA), Instituto de Desenvolvimento Sustentável Mamirauá (IDSM).
34
GENETIC VARIABILITY OF SOTALIA
GUIANENSIS (VAN BÉNÉDEN 1864) ON THE
COAST OF THE STATE OF PARANÁ, BRAZIL
Savada, CS¹; Silva, WF¹; Domit, C²; Almeida, FS¹
¹Laboratório de Genética e Ecologia Animal. Universidade Estadual de Londrina, PR, Brasil; ²Laboratório de Ecologia e
Conservação, Centro de Estudos do Mar. Universidade Federal do Paraná, PR, Brasil.
[email protected]
Keywords: mtDNA, haplotype diversity, nucleotide diversity, D-loop, Conservation Genetics
Sotalia guianensis is continuously distributed from Honduras to the South of the Brazil. However, a species has population
structuring, both as ecological and genetics, along the Brazilian coast. For being the top of sentinel species and trophic
chain has an important role, but not so much due to his habit, their conservation is threatened by the intensification
of human activities and habitat degradation. The human impacts are recognized as a major cause of population
decline, which can lead to reduced genetic diversity and regional extinctions. On the coast of the state of Paraná, there
is record of a resident population of S. guianensis, which uses the region throughout the year to feed and reproduce.
In order to characterize the genetic structure of this population were collected tissue samples of 63 individuals found
stranded dead or captured by fishing along the estuarine and beach zone. Genomic DNA was extracted and analyzed
by analysis of mitochondria DNA. Was used two pairs of primers to distinct regions of control region in mtDNA, one
for part of the conserved region (CR) (t-Pro-whale and Dlp 8) and other to piece of the hypervariable region I (HR)
(THR: L15926 and TDKD). Haplotype diversity (h) and nucleotide diversity (p) were analyzed with DnaSP 5.1.
A total of 404 bp of the CR and 419 bp of the HR were analyzes. For CR, two haplotypes were defined among 63
individuals and nineteen haplotypes were defined for HR among 58 individuals. The haplotypic diversity among the
63 tucuxi dolphins for CR was estimated to be 0,032 and the nucleotide diversity was 0,00203; and for 58 individuals
for HR was 0,786 and 0,00719 respectively. The satisfactory rate of genetic diversity was observed in this population.
Other ongoing studies are essential to complement the data presented here. However, it is suggested that this region
is prioritized actions for conservation, given its importance for the maintenance of genetic diversity of the species.
Financial support: IC-UEL
35
A NEW SPECIES OF DISSOMPHALUS GROUP
ULCERATUS (HYMENOPTERA, BETHYLIDAE)
IS REVEALED BY HIGH DIVERGENCE OF DNA
BARCODE ON CRYPTIC SPECIES
Monjardim, M¹; Fagundes, V¹; Azevedo, CO1
¹Departamento de Ciências Biológicas, Centro de Ciências Humanas e Naturais, Universidade Federal do Espirito Santo,
Vitória, ES
[email protected]; [email protected]; [email protected]
Keywords: barcode, phylogeny, taxonomy, COI, genetic diversity
Cryptic species are recurrent in Hymenoptera, and identifying species using exclusively morphological characteristics
is a hard task. Bethylidae are possibly the richest family within Chrysidoidea with 2481 species and 102 genera.
Dissomphalus harbors 266 species divided into 25 groups, defined by shape and position of the genitalia and tergal
process. In the group ulceratus, two species, D. rectilineus and D. concavatus, are sympatric and share some morphological
characteristics (head shape, hypopygium, tergal process and genitalia), mainly distinguished by slightly differences in the
hypopygium posterior margin and stalk. However, some specimens showed intermediated and variable hypopygium.
Thus, we sequenced the final portion of the mitochondrial gene cytochrome oxidase I (COI, 330 pb) using primers
HCO2198 and AP-L-2176F and evaluated the genetic divergence among specimens and compared the morphology
of hypopygium against clades to validate the hypopygium as a diagnostic character species-specific. We extracted DNA
of metasoma or genitalia from 29 individuals from seven localities in Brazil using the kit NucleoSpin®. We computed
the number of haplotypes (DNASP5.0), genetic divergence (MEGA5) and inferred the phylogeny of Maximum
Likelihood (ML, PHYML) and Bayesian Inference (BI, Mr Bayes3.1). The cladogram revealed three monophyletic
groups with high support on both analyses (up to 0.8 and 70). The intraclade divergence varied from 1.3 to 13.4%,
while the interclade varied from 19 to 20%. The 21 haplotypes were clade-specifics, with exclusive mutations for
each clade, characterizing diagnostic and unique polymorphisms. After morphological an analysis we found a new
hypopygium shape and associated a distinct hypopygium to each clade, reinforcing it as a diagnostic structure. D.
rectilineus (clade I) and D. concavatus (clade II) showed 19% of divergence, were associated to two distinct morphology
of hypopygium, endorsing them as distinct species. The third clade, with exclusive characteristics of the hypopygium,
showed high genetic divergence in relation to clades I and II (19 and 20%, respectively), with exclusive mutations and
haplotypes, and was not associated with any valid species, considered herein as a new species. Our results allowed us
to conclude that the hypopygium can be used as diagnostic character for species of the group ulceratus. Also, showed
a high mtDNA COI divergence between cryptic species (up to 20%), an exceptional record for barcode DNA region.
Financial Support: CNPq and FAPES.
36
EFFECT OF HYDROXIUREA ON BIOLOGICAL
TRAITS OF DROSOPHILA MELANOGASTER
Patarro, TF; Rangel, V; Manzato, AJ; Bicudo, HEMC
Instituto de Biociências, Letras e Ciências Exatas, UNESP, São José do Rio Preto, SP
[email protected]
Keywords: progeny viability, adverse effects, biological parameters, life-history traits, drug toxicity.
Hydroxyurea (HU) (CH4N2O2) is used as a medicine in several human diseases, including sickle cell disease and cancer.
In both cases, it decreases the symptoms, but, in parallel, side-effects, some of them highly worrying, are manifested
by the users. Some of these side-effects cannot be or are difficult to be tested in humans. In this study, Drosophila
melanogaster was used as a biological model aiming to obtain some helpful information. HU 0.1 e HU 0.25 mg/ml
medium were used in six successive generations of this fly. The treated and control groups were analyzed as to several
biological traits. Data on productivity (number of progeny), oviposition rate and esterase patterns were presented
previously, showing that HU affected the three characteristics, reducing the number of progeny e the oviposition rate
and changing the esterase pattern. In the present summary, we included data on emergence and developmental time,
mortality during development and longevity of adults. Flies from control (C) and HU0.1 treatments showed complete
emergence (from the first to the last fly) in three days while in HU0.25 five days were necessary. Mean development
from egg to adult showed mean development longer for HU 0.025 treatment in both sexes. Significant differences
for mortality during development were obtained in groups HU0.25 versus C and in HU0.1 versus HU0.25, in the
egg-larva and egg-adult phases. As to the longevity, flies from the F4 generation showed significant differences in
every comparison of the three groups (C, HU0.1 and HU0.25), being the longevity of C flies greater than that of
the treated groups. Altogether the results showed that HU is toxic, affecting in different ways several biological traits.
37
MICROEVOLUTION OF AEDES AEGYPTI:
GENETICS AND MORPHOLOGY
Louise, C 1; Vidal, PO 1,2; Suesdek, L 1,2.
¹Laboratório de Parasitologia, Instituto Butantan, São Paulo, SP; ²Pós-graduação Biologia da Relação PatógenoHospedeiro, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP.
[email protected]
Keywords: geometric morphometrics, microssatelites, mosquitoes, Culicidae, wing
Aedes (Stegomyia) aegypti (Diptera: Culicidae) is the most important vector of dengue viruses in Brazil. As the vaccine
against dengue is still under development, the only way of preventing the disease is to control the vector. Currently,
the control methods have variable efficiencies and microevolution of mosquitoes is a limiting factor. This work aimed
to detect and estimate microevolution of Ae. aegypti in Butantã neighborhood (São Paulo city) during one year.
Larvae of Ae. aegypti were collected monthly between March 2011 and May 2012. The five samples were pooled
according to climatic seasons: fall/2011, winter/2011, spring/2011, summer/2011-12 and fall/2012. Right wings
of 150 females (30 per climatic sample) were mounted in a slide-coverslip, photographed and had 18 landmarks
digitised. Landmarks consisted of conspicuous and homologous wing vein crosses and its Cartesian coordinates were
submitted to geometric morphometrics standard analyses. To assess the genetic variability, DNA of individuals were
extracted and amplified for the four microsatellite loci: AED19, C2A8, T3A7 e B07. Evolution of morphologic
and genetic characters during the studied period was evaluated by comparisons between seasonal samples. All loci
were polymorphic and exhibited allelic variation across the seasons. Despite the polymorphism, overall genetic
differentiation was low (Fst = 0,0412). Pairwise genetic differentiation between the five seasonal samples were low
but significant (0,03 ≤ Fst ≤ 0,06; p < 0,05). Wing shape varied across the five seasons (Qst = 0,4732). Discriminant
analysis permitted highly accurate season identification based on wing shape (cross-validated scores ranged from
60% - 83,3%). Furthermore, pairwise Mahalanobis distance between seasonal samples also indicated significant wing
differentiation (1,99 ≤ MD ≤ 4,05; p < 0,0001). We conclude that Ae. aegypti suffered microevolutionary processes in
a period as short as one year. Both morphological and genetic markers agreed in detecting microevolution of Ae. aegypti
during the studies period. In spite of the concordance between the biological markers, the speed of morphological
variation was greater than genetic variation (Qst>Fst), suggesting an action of natural selection on wing shape.
Financial Support: Fapesp 2011/18962-8, Fapesp 2010/15039-1
38
GENETIC AND MORPHOLOGICAL VARIATION
BETWEEN WINTER AND SUMMER
POPULATIONS OF ANOPHELES CRUZII AND
ANOPHELES HOMUNCULUS
Lorenz, C; Suesdek, L
Instituto Butantan - Avenida Vital Brasil, 1500, São Paulo, Brazil CEP 05509–300 Brazil; Biologia da Relação Patógeno Hospedeiro - Instituto de Ciências Biomédicas - USP, São Paulo, SP.
[email protected]
Keywords: wing geometric morphometrics, mitochondrial gene, temporal variation.
Females of Anopheles cruzii and Anopheles homunculus are morphologically similar and both occur in sympatry in
southeastern Brazil. In this region, these species are considered respectively the primary and the secondary vectors
of Plasmodium spp. Some biological processes in mosquitoes such as pathogen transmission are possibly affected by
variations across climatic seasons. Despite the epidemiological importance of An. cruzii and An. homunculus, there have
been few studies on the temporal dynamics of these vectors. The aim of this study was to characterise populations of An.
cruzii and An. homunculus with regard to genetic and morphological polymorphism in two different seasons: summer
and winter. All specimens were collected in the Atlantic Forest in July 2011 (winter) and January 2012 (summer). We
used wing shape as the morphological marker, according to standard geometric morphometrics methods. A 400-bp
3´ end of the mitochondrial gene CO-I was sequenced and used as the genetic marker. In both species, individuals
clustered into two distinct groups in the morphospace of canonical variates according to season. Pairwise cross-validated
reclassification showed that wing shape changed significantly during the time interval examined. Genetic analysis
revealed rich haplotypic diversity (0.97) and high nucleotide diversity (0.012) within populations of An. cruzii. On
the other hand, An. homunculus exhibited a slighlty lower haplotypic diversity (0.84) and moderate values of
genetic
divergence between seasons (Φst = 0.116), suggesting that summer and winter populations are partly different. Despite
being morphologically and phylogenetically very close, the species An. cruzii and An. homunculus have distinct genetic
patterns, where An. homunculus does not have a haplotypic patrimony as rich as its congener.The interval between winter
and summer is enough for species to develop both morphological and genetic variation. Microevolutionary changes
appear to be rapid in these species and should be taken into consideration when developing vector control strategies.
Financial Support: CNPq fellowship #140964/2013-4 and FAPESP #2013/05521-8
39
THE USE OF MORPHOLOGICAL, GENETIC AND
CHEMICAL MARKERS IN THE CONSERVATION
OF MOURELLA CAERULEA (APIDAE,
MELIPONINI), A COLD CLIMATE BEE
Teixeira, JSG1; Falcón, T2; Witter, S3; Nascimento, FS1; Francoy, TM4.
Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, USP, Ribeirão Preto, SP; 2Faculdade de Medicina de Ribeirão
Preto, USP, Ribeirão Preto, SP; 3Fundação Zoobotânica do Rio Grande do Sul, Porto Alegre, RS; 4Escola de Artes, Ciências
e Humanidades, USP, São Paulo, SP.
1
[email protected]
Keywords: Mourella caerulea, mitochondrial DNA, geometric morphometrics, cuticular hydrocarbons, conservation genetics
Since bees are the main pollinators of many crops and natural ecosystems, their preservation is a major subject in
conservation maters. A great reduction of their populations is being related in the last year and habitat fragmentation,
pesticides and climate changes are among the factors affecting it. Species with restricted distribution or with very
specific ecological niches are the main candidates for studies concerning the effects of these factors in its variability
and to predict future scenarios for their conservation. Mourella caerulea is a stingless bee with distribution restricted to
southern South America, in regions of low temperature. In Brazil, its distribution is restricted to the states of Rio Grande
do Sul, Santa Catarina and Paraná. For a better understanding of this species population dynamics we characterized
the morphological and molecular variability of M. caerulea populations through three approaches: sequencing of
mitochondrial DNA, characterization of cuticular hydrocarbon profiles and with geometric morphometrics of the
wings. We collected workers from 10 natural nests in three locations in the state of Rio Grande do Sul. To analyze the
pattern of wing venation, we used 20 workers per colony, and 14 landmarks were plotted on each wing. The crossvalidation test correctly identified 89.75% of individuals within their respective areas. The cuticular hydrocarbon
analysis indicated that the population from different locations are differentiated (Wilk’s Lambda: p < 0.001) and the
Mahalanobis distances found through this method go along with the ones from morphometrics analysis. The total
DNA of one worker per nest was extracted using Chelex resin. The amplification generated products of 609 bp. Six
haplotypes were identified and the haplotype diversity (Hd) is 0.88. No haplotypes were shared among populations.
These results indicate that the variability of populations is comparable to the geographical distance between the groups
and proposes a certain isolation degree among them. This isolation is probably due to the low dispersal capacity of these
bees and to the reduction of areas of native grasslands due to the expansion of agricultural frontiers practices coupled
with inadequate soil management can destroy the land or underground nests of M. caerulea. We still have to add more
samples to these analysis, but the preliminary results already indicates great amounts of exclusive variability within
populations and low levels of shared variability. Given the restricted distribution of these bees and the already huge loss of
habitat in the Pampa Biome, the maintenance and preservation of all these groups are important to preserve this species.
Financial Support: FAPESP (2011∕02434-2; 2012∕24284-5) and CAPES.
40
CUTICLE MATURATION IN APIS MELLIFERA:
CUTICULAR HYDROCARBONS PROFILES,
EXPRESSION AND EVOLUTION OF
DESATURASES AND ELONGASES
Falcón, T1; Ferreira-Caliman, MJ2; Tanaka, ED1; Teixeira, JSG2; Nunes, FMF3; Nascimento, FS2, Bitondi, MMG2.
Faculdade de Medicina de Ribeirão Preto, USP, Ribeirão Preto, SP; 2Faculdade de Fiolosofia, Ciências e Letras de Ribeirão
Preto, USP, Ribeirão Preto, SP; 3Centro de Ciências Biológicas e da Saúde, Universidade Federal de São Carlos, São Carlos, SP
1
[email protected]
Keywords: Apis mellifera, cuticular hydrocarbons, desaturases, elongases, cuticle maturation
Cuticular hydrocarbons are important for recognition of nestmates in social insect colonies. Many studies have
shown qualitative and quantitative variations in the cuticular hydrocarbons between adult insects. However,
approaches on developmental profiles of these compounds during cuticle formation and differentiation are scarce,
and restricted to larval stages of holometabolous and nymphs of hemimetabolous. The main objective of this
work was to characterize the cuticular hydrocarbons profiles and the expression of genes potentially involved in
the biosynthesis of these compounds during the synthesis and differentiation of the adult cuticle in the honeybee.
The hydrocarbons profiles were characterized using GC/MS and showed remarkable quantitative differences, thus
discriminating the pupal, pharate-adult and adult cuticles from each other (36 bees per phase). In parallel, we used
annotated sequences of enzymes catalyzing lipid desaturation (desaturases) or elongation (elongases), available
in NCBI data bank, for primers design and gene expression analysis using RT-qPCR (3 bees per phase). Five
desaturase genes and eight elongase genes showed statistically significant expression changes in the integument of
adult bees in comparison to pupae and pharate-adults. Spearman correlation tests supported roles of some of the
desaturase and elongase genes in hydrocarbons biosynthesis for incorporation into adult cuticle. In addition, these
results go along with the hypothesis that in social insects the cuticle is just completed when the insect starts forager
activity. Taken together, these data and an analysis on the molecular evolution of desaturases and elongases allowed
suggesting the steps in the pathway of cuticular hydrocarbons biosynthesis that are catalyzed by these enzymes.
Financial Support: FAPESP grants to M.M.G.B. (10/16380-9, 11/03171-5) and F.S.N. (10/10027-5). Fellowships to
T.F. (FAPESP: 2012/24284-5); M.J.F.C. (CAPES); E.D.T. (FAPESP 12/02706-5); J.S.G.T. (FAPESP 11/02434-2).
41
WEIGHT AT EMERGENCE OF HONEY BEE
QUEENS, APIS MELLIFERA, AS A SELECTION
INDEX IN BEEKEEPING GENETICS
IMPROVEMENT PROGRAMS
Daiana A. De Souza1*, Tiago M. Francoy2 & Lionel S. Gonçalves3,4
Faculdade de Medicina de Ribeirão Preto – USP, Av. Bandeirantes 3900, CEP 14040-901, Ribeirão Preto-SP – Brasil.
(55)1636024578. [email protected]; 2Escola de Artes, Ciências e Humanidade – USP, Rua Arlindo Bettio 1000, CEP
03828-000 – São Paulo - SP – Brasil. (55)1126480120 [email protected]; 3CETAPIS-RN/UFERSA Universidade Federal Rural
do Semi-Arido, Avenida Francisco Mota CEP 59.625-900 Mossoró-RN, Brasil. [email protected]; 4Faculdade de Filosofia,
Ciências e Letras de Ribeirão Preto – USP, Av. Bandeirantes, CEP14049-900, Ribeirão Preto – SP, Brasil.
1
e-mail: xxxx
Keywords: xxxx
The influence of honey bee queen’s weight at emergence in the reproductive capacity has been questioned for a long
time. A positive correlation is proposed between queen’s weight and number of ovarioles, which allows the queen to
perform the oviposition of larger amounts of eggs throughout her lifetime. However, the influence of their weight
at emergence on the queen’s physiology is still unknown, mainly when related to genetics improvement programs.
For this reason this study aimed to verify the gene expression according to the ovariole number of two honeybee
queens group based on the weight at the emergence. We conducted analysis of TOR mRNA in honeybee queens,
which are a known pathway that plays a well-established role in growth control and lifespan, as well as the record of
the ovariole number to correlation tests. Female larvae of the same age were grafted and reared in strong queenless
colonies. At emergence, queens were weighted and separated in two groups, Light queens (<180mg) and Heavy
queens (>200mg). The abdominal fat body was collected and fresh frozed at -80°C. The ovarioles were colleted and
postfixed in 3.7% neutral buffered formaldehyde for 24 hours, for histological procedures. The RT-PCR showed
that light queens had significantly higher mRNA levels for TOR, (P=0,001) than heavy queens at the abdominal
fat body tissue. On the other hand, we found that heavy queens were born with an average of 414 ± 68 ovarioles,
while in light queens this average is 217 ± 35 ovarioles. This difference is statistically significant (P = 0.001). This
two components are not strongly correlated (R2=0.3697). Previous experiments reported that heavy queens have
significantly higher longevity, what explain the difference in TOR expression, as this pathway is strongly related, in
other insect species, with the reduction of lifespan. This is an interesting result, as long-lived and high reproductive
queens are of great interest in beekeeping and could be used in selection and genetic improvement programs.
42
20-HYDROXYECDYSONE REGULATES THE
EXPRESSION OF TWO TRANSCRIPTION
REGULATORS (GERM-CELL EXPRESSED
[GCE] AND CALPONIN [CAL]) TO DRIVE
METAMORPHIC COMMITMENT IN HONEY
BEES
Hernandes, NH1; Bitondi, MMG1; Simões, ZLP1; Nunes, FMF2
Departamento de Biologia – Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto – Universidade de São Paulo;
Departamento de Genética e Evolução – Centro de Ciências Biológicas e da Saúde – Universidade Federal de São Carlos
1
2
[email protected]
Keywords: honeybee, metamorphosis, ecdysteroids, juvenile hormone, mRNA, microRNA, expression profiles
The metamorphosis of holometabolous insects is driven by successive genetic, morphological and physiological
alterations throughout development. These changes are mainly coordinated by the action of ecdysteroids and juvenile
hormone (JH), which modulate gene expression in time- and space-specific manners. Although many studies have been
performed on this issue, the endocrine and genetic circuits that regulate the metamorphosis in social insects, such as the
honey bee Apis mellifera, are far from being completely elucidated. We selected several candidate insect ortholog genes,
including, two transcription regulators (GCE [germ-cell expressed] and Cal [calponin]), a nutrition-responsive gene
(IDGF [imaginal disc growth factor]), and a developmental-regulated microRNAs (bantam, miR-8, miR-100, miR125, miR-252a and miR-252b), and tested for their involvement in worker development. We characterized candidate
gene expression profiles with RT-qPCR during worker larval development (including molts) and the metamorphic molt
(the transformation of larvae in pupae). The genes encoding rp49 and U5 snRNA were used as references to normalize
mRNA and microRNA levels, respectively. We verified that the expression of miR-252b is opposite to the JH titer
modulation in hemolymph, indicating cross-talk between these regulatory factors. All other protein- and non-coding
transcriptional patterns were very similar, showing low peaks in feeding phases preceding larva-to-larva molts and high
mRNA abundance just after the ecdysteroid peak that triggers the metamorphic molt. Experimental manipulation in
vivo of the ecdysteroid and JH titers were then performed to determine their effects on the expression of GCE, Cal and
IDGF. Both GCE and Cal expression were suppressed in pharate-pupae injected with a 5mg of 20-hydroxyecdysone
(20E) solution compared with controls. However, gene expression was not perturbed by topical application of a 10mg
JH solution. Our data characterized novels elements involved in worker metamorphosis, including a JH-modulated
microRNA (miR-252b) and two 20E-responsive genes (GCE and Cal). This study enhances current understanding of the
genetic factors governing post-embryonic development in bees, especially signaling in commitment to metamorphosis.
Financial Support: FAPESP (2011/21731-8 and 2011/03171-5).
43
MAPPING THE MYOSIN GENE SEQUENCE IN
POLYTENE CHROMOSOMES OF ANOPHELES
DARLINGI (DIPTERA: CULICIDAE) MANAUS,
STATE OF AMAZONAS
Grangeiro, WG1; Bridi, LC2; Rafael, MS3.
Scientific Initiation Program (PIBIC), INPA / CNPq; 2Doctoral student PPG-GCBEv/INPA; 3Laboratory of Malaria and
Dengue, CSAS / INPA National Institute of Amazon Research, Manaus, AM, Brazil
1
[email protected]
Keywords: FISH; EST; expressed genes; Malaria
The Anopheles darlingi is the main vector of human malaria in the Amazon, where occurs the greatest number of cases,
whose preference is feed itself on human blood. The present study aimed to map the protein myosin in chromosomal
level. It’s an ATPase that moves along actin in the presence of ATP and is responsible for muscle contraction. In
addition to functions associated with muscle cells, myosin plays a significant role in the maintenance of salivary
glands, according to transcriptomics and functional analysis of salivary glands of Anopheles gambiae in relation to the
blood supply to adult females. This study aimed to physically map the myosin gene in chromosomes of A. darlingi,
using FISH to study the chromosomal variability and evolutionary aspects. The collects of immature A. darlingi
were performed in the city of Manaus, lumberyard Portela (S 03º 05 19’ 5’’ e W 05º 98 92’ 62’’), neighborhood
of Puraquequara, then were made preparations of slides polytene chromosomes of A. darlingi. The sequence of the
myosin EST (AdaMyo82-83) containing 568 base pairs was obtained from the functional genome of A. darlingi. Then
it was designed a pair of primers Then it was designed a pair of primers referred 82-83, whose nucleotide sequence
is 5 ‘GAACCCAACTCTGGACCTCA 3’ and 5 ‘AATCGCTGTTTTGCTTGCTT 3’; using the program Gene
Runner 3.01: www.generunner.net. Was perfomed a temperature gradient to annealing (56.5 ° C) then a reaction of
PCR and the product purification of PCR to primer pair myosin through Polythyleneglucol (PEG). The method of
fluorescent hybridization in situ on polytene chromosomes of A. darlingi was performed with labeled probe for myosin
per 2.5x Random Primer (Invitrogen Cat. No. 18187-013, USA), and stained with fluorescein-12-dUTP (ENZO®
BioProbe-42716, USA). The chromosomes containing the probe signal was stained with YOYO was 10X (Invitrogen 895247, USA) diluted in PBS 1X. The photomicrographs were obtained by light microscopy Axioplan epifluorescence
Zeizz with clear field and phase contrast. The AdaMyo82-83 gene was hybridized in the arm 3R (inversion 3RC,
Section 34c band, however, there are few articles in the literature on physical mapping of myosin in mosquitoes. This
affected the comparative analysis of this result of physical mapping of the AdaMyo82-83 gene on chromosome 3 (3R
arm, reversing 3RC, Section 34c) larvae of A. darlingi by FISH with other mosquitoes. This result represents a unique
opportunity to understand the structure and organization of the genome of this important malaria vector Neotropical.
Financial support: CNPq and Foundation for Research Support of the State of Amazonas -FAPEAM Project (PPP).
44
CHROMOSOMAL LOCALIZATION OF
MICROSATELLITE LOCI OF DROSOPHILA
MEDIOPUNCTATA
Cavasini, R; Batista, MRD; Klaczko, LB.
Dep. Genética, Evolução e Bioagentes, Instituto de Biologia, UNICAMP, Campinas, SP
[email protected]
Keywords: Drosophila mediopunctata, microsatellites, genetic (chromosomal) analysis
Drosophila mediopunctata is a forest dwelling Neotropical species and excellent model organism for genetic and
evolutionary studies. It has the typical “primitive” Drosophila karyotype with 5 pairs of rods and a pair of dot
chromosomes; but the dots do not polytenize. The synteny between D. mediopunctata and D. melanogaster chromosomes
was previously established using in situ hybridization in polytene chromosomes of highly conserved genes. In the last
years, 134 microsatellite marker loci have been described, as well as a linkage map with five linkage groups for 49 of
these loci was published. These groups were identified to D. mediopunctata’s chromosomes through cross-reference to
BLAST search on D. melanogaster genome. To confirm the previous localizations of loci and the accuracy of the BLAST
search method, we selected five loci, putatively located in each of the five major chromosomes, and determined their
location through genetic (chromosomal) analysis of two inbred strains. One of them has each of the major autosomes
marked with visible mutations: chromosome II with Delta-5 (Δ-5); chromosome III with cabernet (cb); chromosome
IV with coral (cr); and chromosome V with alfinete (al). We first identified in the F1 offspring the locus linked to the
X-chromosome by the presence of only heterozygotes in females and homozygotes in males. In a back-cross progeny
we analyzed, simultaneously, the mutation phenotype and the genotype for the microsatellites (n = 48 individuals).
Since in D. mediopunctata there is no crossing-over in males we could infer the chromosome location by the analysis of
microsatellites and mutations segregation – microsatellite and mutation in synteny don’t segregate. Thus, we found that
DmedUNICAMP_ssr021 is on the X-chromosome; DmedUNICAMP_ssr060 is on the second chromosome; DmedUNICAMP_
ssr095, DmedUNICAMP_ssr102 and DmedUNICAMP_ssr011 are on chromosomes III, IV and V, respectively. Our results
are congruent with previous chromosome localization carried out in this species. Moreover they lend further support
for the conservation of Muller’s elements in D. mediopunctata chromosomes and their synteny with D. melanogaster
elements. We are grateful to Klélia A. Carvalho, Claudete Couto and Mitsue T. Brianti for technical assistance.
Financial Support: FAPESP, CNPq, CAPES and FAEPEX-UNICAMP.
45
TIME-SERIES ANALYSIS OF GENETIC
DIVERSITY LEVELS OF THE EUROPEAN SPINY
LOBSTER (PALINURUS ELEPHAS) IN THE
WESTERN MEDITERRANEAN
Santos, LAC1; Palero, F2; Pascual, MB3.
Faculdade de Ciências Biológicas e Ambientais, UFGD, Dourados-MS; 2Instituto Cavanilles de Biodiversidad y Biología
Evolutiva, Universitat de València, València-Spain; 3Facultat de Biologia, Universitat de Barcelona, Barcelona-Spain
1
[email protected]
Keywords: Conservation genetics, fisheries, genetic resources, microsatellite markers, genetic diversity.
The European spiny lobster (Palinurus elephas) is a widely-distributed crustacean species with high commercial value
and which presents a striking larval form (phyllosoma) with a long planktonic duration. Given that local fisheries have
significantly declined in recent years due to overexploitation, there is an increasing necessity to develop conservation
plans for this species. In order to detect the presence of a trend of decline in the genetic variability, a local population
of Palinurus elephas was analyzed over several years using 10 microsatellite markers. A total of 163 samples of P. elephas
were collected over a period of four years (2006-2009) in Cullera, a small town located in the western Mediterranean.
Samples were structured within each year to include both the summer (S06, S07, S08) and winter (W06, W07, W08,
W09) seasons. Furthermore, the genetic distance between the Cullera samples and another 10 P. elephas populations
analyzed in a previous study (Western Scotland, Western Ireland, Brittany, Bay of Biscay, South Portugal, Western
Mediterranean, North Western Mediterranean, Tunisia, Sicily and Greece) was estimated. Our analyses revealed that the
observed heterozygosity were consistently smaller than the expected heterozygosity values over the whole 4-year period.
The polymorphism information content (PIC) values observed in most markers was moderate to high (0.30 to 0.89) and
allowed for estimating diversity parameters and genetic differentiation. Lower Fst values were found between the seven
samples of juvenile from Cullera and the Mediterranean populations, with the exception of Sicily, and larger differentiation
estimates were obtained when comparing them with the populations located in the Atlantic (Scotland, Ireland, Brittany,
Biscay and Portugal). Our results do not indicate a significant reduction on the genetic diversity of this population.
Financial Support: CNPq- Science without borders, BENTHOMICS (CTM2010-22218) and the FBBVA project
(BIOCON 08 – 187 ⁄ 09).
46
APPLICABILITY OF CYTOCHROME OXIDASE
I BARCODING GENE IN BETHYLIDAE
(HYMENOPTERA): CONSTRAINTS FOR
PHYLOGENETIC INFERENCE
Martinelli, AB1,2; Mugrabi, DF2; Azevedo, CO2; Fagundes, V1.
Laboratório de Genética Animal (LGA), Departamento de Ciências Biológicas, UFES, Vitória, ES; 2Instituto Bethylidae de
Sistemática (IBES), Departamento de Ciências Biológicas, UFES, Vitória, ES
1
[email protected]
Keywords: Dissomphalus, phylogeny, taxonomy, genetic distance.
Dissomphalus Ashmead, 1893 is a Pristocerinae genus of Hymenoptera (Bethylidae), distributed worldwide and has
267 species, diagnosed mainly by the male genitalia characters and the presence of two pubescent tuberculous in
the metasoma, called tergal process. Surprisingly, four of 24 newly described species of Dissomphalus from Thailand
is lacking tergal process. In this study, we aimed to identify using barcode cytochrome oxidase I (COI) another
undescribed species (called M26), also lacking the tergal process, which presents genital characters similar to
Dissomphalus but some other diagnostic characters similar to other Pristocerinae genus Protisobrachium Benoit, 1957,
also from Thailand. Our sample is composed of 50 specimens, being 11 Protisobrachium from Africa, Thailand and
Madagascar, 35 Dissomphalus from Thailand, and four M26 from Thailand and Madagascar. DNA was extracted from
leg and metasoma using kit Nucleospin (Macherey-Nagel). The COI region (650pb) was PCR-amplified using barcode
LCO1490 and HCO2198 primers. The genetic divergence was calculated in MEGA5.1 using kimura-2-parameter
model, eliminating all positions with less than 95% site coverage. For phylogenetic reconstructions, we used Maximum
Likelihood (ML) and Bayesian Inference (BI) methods. Our results showed that Dissomphalus, Protisobrachiun and
M26 shared a common ancestor. Trees showed that all 11 Protisobrachium as well as the M26 group assembled
as a monophyletic group with high support (ML>70, BI>95). Dissomphalus, however, showed a basal polytomy.
The relationship among the species was not recovered. The inter-specific genetic distances within Dissomphalus were
extremely high (20-29%) as much as the distance observe when compared Dissomphalus x Protisobrachium (30%),
M26 x Dissomphalus (27%), and M26 x Protisobrachium (28%). The average value of evolutionary divergence within
Dissomphalus was 24%, Protisobrachium 18% and M26 was 4%. Intra-specific genetic distance ranged 0,1-14%.
COI was not informative to indicate the M26 genus. Firstly, inter-specific and intergeneric genetic distance (mainly
in Dissomphalus) was similarly high and it was not possible to define limits of each genus. Secondly, COI is lacking
of the phylogenic signal to recover the evolutionary history among lineages. This scenario could be caused by the
ancient origin of Dissomphalus and the power of COI to recover recent evolutionary events. Concluding, our data
show that the use of COI in Bethylidae inter-especific taxonomic approaches must be carefully tested. This is the
first investigation of DNA barcoding in Bethylidae and bring new insights of the applicability of the COI gene.
Financial Support: PRONEX CNPq/FAPES, CAPES, NSF
47
INFORMATIVENESS OF SNPS ON THE
GENOME OF THE BRAZILIAN CHICKEN
BROILER AND LAYER LINES USING 60K
ILLUMINA BEADCHIP
Attílio, DB1; Brassaloti, RA1; Ledur, MC2; Coutinho, LL1; Rosário, MF1
Departamento de Zootecnia, Escola Superior de Agricultura “Luiz de Queiroz”, ESALQ/USP, São Paulo, SP; 2Embrapa
Suínos e Aves, Concórdia, SC.
1
[email protected]
Keywords: candidate gene, next generation sequencing, poultry, QTL, marker
Association studies may be carried out in different populations, including those that have already been developed
for QTL mapping. Embrapa Swine and Poultry and ESALQ/USP developed the Embrapa F2 Chicken Resource
Population by crossing of 7 males from a broiler (TT) and 7 females from a layer line (CC) to map QTL using
microsatellite markers. However, the development of the 60k Illumina SNP BeadChip, with 57,636 SNPs, from
Cobb-Vantress, USDA and Hendrix Genetics Consortium, has enabled a high saturation of genomic regions where
QTL were previously mapped. Therefore, our aim was to assess the informativeness of SNPs on the genome of the
TCTC population founders using the 60k SNP chip. Genomic DNA was extracted from blood and genotyping
followed the protocol Infinium® II Assay Super (Illumina®). Genotypes were analyzed based on the GenomeStudio
(Illumina®) and Excel (Microsoft®) softwares, considering the parameters: missing genotypes proportion, average
distance between SNPs, and minor allele frequency (MAF). A total of 806,904 genotypes were obtained (14 chickens
x 57,636 SNPs with average distance of 3.56 ranging from 0.001 up to 89.91 k) with call rate >0.99, of which
2.4% (19,418) were missed due to the ScoreGenCall <0.15. Out of these, 9,779 were in TT and 9,639 in CC
line. Consequently, we obtained 787.486 genotypes with success (97.6%). In the TT line 11,169 SNPs showed
MAF = 0 (~20%) while in CC were 23,578 (~42%). Among SNPs with MAF = 0 (34,747), 8,214 were the same
in both lines. SNPs with MAF = 0 correspond to those with fixed alleles (monomorphic SNPs) which present
lower genotypic variability than those with MAF > 0. The fact that CC had more SNPs with MAF=0 than TT
may be explained by the selection period in which these lines were subjected. CC and TT were selected for eight
and six generations for egg and performance traits, respectively. Therefore, favorable alleles for traits of interest in
each line tend to fixation. Also, it is important to note that both lines have different genetic backgrounds, where
CC was originated from only one breed, White Leghorn, while TT had three distinct breeds (White Plymouth
Rock, New Hampshire and White Cornish). Finally, it was possible to verify the informativeness of SNPs which are
segregating in each line using the 60k Illumina SNP BeadChip. The next step will be to select the most informative
SNPs in QTL regions for chip customization and genotyping of the F2 chickens to implement association studies.
Financial Support: CNPq, FAPESP and Embrapa/PRODETAB.
48
KARYOTYPE OF TONATIA BIDENS (SPIX, 1823)
(CHIROPTERA, PHYLLOSTOMIDAE) FOUND IN
EASTERN MATO GROSSO
Tavares, JR1; Oliveira, SL1; Sousa, TP1; Faria, KC1,2.
Programa de Pós-Graduação em Ecologia e Conservação, UNEMAT, Nova Xavantina, MT; 2Departamento de Ciências
Biológicas, UNEMAT, Nova Xavantina, MT
1
[email protected]
Keywords: bats, chromosome, cytogenetics, fluorochromes, C-banding
The genus Tonatia belongs to the subfamily Phyllostominae and comprises two species, T. bidens (Spix, 1823) and T.
saurophila (Koopman & Williams, 1951), both presenting distribution for Brazil. Tonatia bidens is a medium-sized
species, characterized by the presence of very large ears, nose leaf large, wide and bare end of the chin with rounded
tubers forming “U”. The color of this species is usually dark brown and their diet is generalist. Although the order
Chiroptera represents about 20% of living mammals, the systematics of the group is still insufficient. Cytogenetics
is a tool that has contributed to assist in the identification and understanding of taxonomic and evolutionary
aspects involved in the differentiation of species. This study aimed to characterize cytogenetically an individual of
T. bidens found in eastern Mato Grosso (Brazil). The capture of the specimen occurred in a gallery forest located
in the Parque Estadual da Serra Azul (PESA) (15° 50’ 17.5” S, 052° 14’ 56.0” W), in the municipality of Barra do
Garças. The technique for obtaining cytogenetic material followed the procedure of direct preparation of bone marrow
and were performed using conventional coloration Giemsa, C-banding, fluorochromes DAPI and chromomycin
A3 (CMA3). Morphological analysis confirmed that the specimen is a female Tonatia bidens. Cytogenetically the
specimen presented diploid number equal to 26 (2n=26) and fundamental number equal to 38 (FN = 38). The
karyotype is composed of four pairs of subtelocentric chromosomes (one large, two medium and one small), five
pairs of acrocentric chromosomes (two large, two medium and one small) and four pairs of meta-submetacentric
chromosomes (two medium and two small). The C-banding identified the regions of constitutive heterochromatin
in the pericentromeric regions of the chromosomes. The CMA3 technique revealed patterns corresponding to
R-banding (CG+) and the DAPI showed AT+ regions. The karyotype in eastern Mato Grosso differs from that
described in the literature for this species (2n = 16 and FN = 20). Thus, the capture of new specimens may provide
more information about the chromosomal constitution of this species, contributing to the knowledge of the group.
Financial support: FAPEMAT and CAPES
49
ANALYSIS OF 16S GENE AND ITS
INFORMATIVE POTENTIAL TO
EVOLUTIONARY INFERENCES IN
PENTATOMIDAE (HETEROPTERA)
Banho, CA¹; Gomes, MO¹; Itoyama, MM¹
¹Universidade Estadual Paulista “Julio de Mesquita Filho” Campus de São José do Rio Preto – Instituto de Biociências,
Letras e Ciências Exatas
[email protected]
Keywords: phylogeny, insects, molecular marker.
Currently, there is a lack of molecular information on insects belonging to the suborder Heteroptera, however recent
studies have used the mitochondrial 16S ribosomal gene as a marker for characterizing evolutionary inferences.
The present study aims to describe the characteristics of this gene in Pentatomidae family, focusing on evolutionary
potential. We performed a partial sequencing of the 16S ribosomal gene of 13 Pentatomidae species. These sequences
were analyzed descriptively, statistically and from the phylogenetic perspective, using Neighbor-joining, Parsimony
and Maximum Likelihood methodologies to construct phylogenetic trees. The obtained sequences showed, when
aligned, 564 sites, of which 255 (45,2%) were conserved sites, 292 (51,7%) were variables sites and 175 (31,0%) were
parsimonious sites, providing the informative potential for the analysis. This fragment still showed, approximately,
72,8% of AT nucleotides. The observed transition/transversion rate (Si/Sv) was 0,60. This transition and transversion rate
is comparable to other insects groups reported in the literature, corresponding to clades as homoptera. In phylogenetic
analyzes were observed the formation of 11 clades, of which 3 had bootstraps index exceeding 70% for Maximum
Parsimony, Maximum Likelihood and Neighbor-joining. This fragment, although has shown some robustness in
the estimates, formed paraphyletic groups. For these analyzes, we can also observe the Neighbor-joining method
showed higher reliability among formed clades. Thus, we can conclude that the gene 16S is an important marker and,
therefore, can help in the search for evolutionary inferences in Pentatomidae. However, further analysis is required, by
the inclusion of new markers and new taxa, in order to promote the formation of a more robust evolutionary scenario.
Financial Support: CNPq, FAPESP and FAPERP
50
A SCIENCIOMETRIC ACCOUNT OF SPATIAL
ANALYSES IN CONSERVATION GENETICS
Rodrigues, DF1; Vanessa, Bernardes1; Diniz-Filho, JAF2
Programa de Pós-Graduação em Genética e Biologia Molecular, Universidade Federal de Goiás (UFG), Goiás, Brasil;
Laboratório de Ecologia Teórica e Sintese, UFG.
1
2
[email protected]
Keywords: autocorrelation, conservation genetics, landscape genetics, scientometrics, spatial statistics
There has been an increase possibility for the application of new methods of spatial statistics to analyze population
genetic data, given the development of many new computer software to perform such analyses and the increasingly
quality of environmental and landscape data at multiple geographical scales. Using such methods is important in
the context of geographical and landscape genetics to understand the patterns of genetic variation and how they
can be associated with several natural and antropic spatially-structured processes. There is, however, a wide variation
in the spatial methods currently used. Here we used a scientometric approach to study the application of spatial
statistics in conservation genetics context and detect trends in these applications. We analyzed 580 articles from the
journal Conservation Genetics in the last 5 years (2008-2012) and recorded which statistics were used to evaluate
geographic variation in genetic data. We classified the techniques used as spatially implicit (FST and analogous
estimators of population divergence, hierarchical clustering, synthetic maps and ordination – PcoA or NMDS -,
and Bayesian clustering) and spatially explicit (Mantel tests, including Mantel correlograms, partial and multiple
Mantel test, spatial autocorrelation, evaluation of genetic discontinuity using wombling and related approaches, and
spatial regressions). We also recorded phylogeographical studies. Besides, other features of the datasets, including
continent where the study was conducted, organism type, number of populations and molecular markers used, were
also recorded. About 61% of the studies were conducted in North America and Europe, and most studies used
SSR markers (52.1%) or mtDNA sequences (33.3%). Out of the 580 studies, 23,8% were based on plants and
76,2% on animals. Most studies used more than one statistical technique, especially combinations of FST analyses
and ordination/clustering. There is a clear preponderance of spatial implicit methods. FST was used in 32.9% of
the studies, as well as Bayesian clustering in 19%. Spatial explicit techniques were used in fewer studies, including
simple Mantel (12.7%), Mantel correlograms (1.3%), genetic discontinuity (0.9%) and spatial regression (0.2%).
Throughout the years there are significant increases in Bayesian clustering (χ² = 42.6; P<0.01), and the simple
applications of FST are decreasing (χ²=16.1 P < 0.01). Phylogeographical studies, at least in conservation genetics
applications, are also significantly decreasing (χ²=14.3 P < 0.01). Our scientometric analyses reveal that spatially
explicit methods are used by a few research groups worldwide and do not seem to be increasing in the years, in the
conservation context. Applications in landscape genetics, in which discontinuity spatial analyses are more frequently
used, may have been published in other ecological (not genetic) journals. In any case, given the power of spatially
explicit analyses in conservation genetics, it is clear that more efforts to stimulate their application are urgently needed.
Apoio: FAPEG e CNPq (564717/2010-0 e 563727/2010-1) e CAPES.
51
NUTRITIONALLY-RESPONSIVE GENES IN
EARLY BRAIN DEVELOPMENT
Vieira, J1, Bomtorin, AD2, Moda, LMR1, Freitas, FCP2, Pinheiro, DG2, Barbin, FO1, Simões, ZLP3, Barchuk, AR1
Institute of Biomedical Sciences, Federal University of Alfenas, UNIFAL-MG, Alfenas/MG. Brazil; 2Genetic Department,
FMRP, University of São Paulo, Ribeirão Preto/SP, Brazil; 3Biology Department, FFCLRP, University of São Paulo, Ribeirão
Preto/SP, Brazil.
1
[email protected]
Keywords: Differential feeding, Gene expression, Neurogenesis, Apis mellifera, Brain
It is widely known that brain development is driven by both genetic and environmental factors. Among the latter, diet
has been considered to play a key role. We have recently shown that in the honeybee Apis mellifera, females fed on
copious amounts of royal jelly throughout larval development evolve bigger brains (queen). Also, brain development
is faster in these females than in those fed on smaller quantities of a mixture containing glandular secretions, pollen
and honey in the last larval stages (workers). We have also shown that this differential morphogenesis is evident from
the 4th larval (L4) stage on (Moda et al. 2013, PLoS One). This finding implies that a high nutritional input drives
nervous system development. Since there are no morphological differences between queens’ and workers’ brain before
L4, we hypothesized that the first observed differences are molecularly promoted early in development. Here we aimed
at identifying nutritionally-responsive genes in brains of queens and workers at the 3rd larval stage, the earliest stage
of differential nutrition between castes. Using RNA-Seq, we identified 60 differentially expressed genes (DEG), 29
upregulated in queens (21 with Drosophila orthologs), and 31 in workers (8 orthologs). Among the genes upregulated in
queens are masquerade (mas), notopleural (np), Cyp4s3, chitinase 3 (Cht3), dopa decarboxilase (ddc), osiris (osi), forked (f),
neurotrophin 1 (nt-1), trynity (tyn), and mucin related 89F (mur89F). Interestingly, ddc codes for an enzyme responsible
for dopamine and serotonin biosynthesis. Considering that dopamine plays a role in queen-specific behaviors, ovarian
development, and other peripheral activities via the hemolymph, ddc upregulation might be the earliest step on the
molecular pathway leading to critical morphophysiological and behavioral differentiation between honeybee castes.
Nt-1 codes for a member of the neurotrophin family of target-derived growth factors that support survival, development,
and maintenance of innervating neurons. Thus, Nt-1 upregulation in queens’ brain explains the greater and faster
development in response to the differential feeding of honeybee larvae. Twelve, out of the 60 DEGs, are located on
chromosome 15, thus suggesting co-regulation of this group of genes. In addition, we compared L3 brain transcriptome
from both queens and workers with that of diploid embryos (72h). Nine-hundred and thirty-six genes were identified
as upregulated in larvae, 547 of them with Drosophila orthologs, and associated to the following molecular functions:
structural constituent, oxidoreductase activity, neurotransmitter and GABA receptor, channel activity, molecule
binding and transmembrane transporter activity. These genes are pointed as crucial for the early brain development
in honeybees. Methylomic, microRNAomic and functional studies are underway to unravel the connections between
brain gene expression patterns and differential brain morphogenesis in honeybees, both triggered by differential feeding.
Financial Support: FAPEMIG grant APQ-01714-10; FAPESP grant 2005/03926-5; FINEP/PROINFRA 01/2008,
LABSBIOEX UNIFAL-MG; PIB-PÓS and PROAP/UNIFAL-MG.
52
CYTOGENETIC CHARACTERIZATION OF
EURYSTERNUS HIRTELLUS (COLEOPTERA,
SCARABAEIDAE)
França, LA¹; Ferreira Neto, CA²; Moura, RC¹
¹Instituto de Ciências Biológicas, UPE, Recife, Pernambuco; ²Centro de Ciências Biológicas, UFPE, Recife, Pernambuco
[email protected]
Keywords: Dung beetles; Chromosomal evolution; HC; NOR
The genus Eurysternus Dalman, 1824 has 53 species identified, with distribution in the region neotropical. They
play important role in the recycling organic matter, secondary seed dispersal, pollination and plant nutrition.
However only the species E. caribaeus was characterized cytogenetically, it has the lowest kayotype (2n=8, neoXY) for superfamily Scarabaeioidea. The present work characterized cytogenetically the species E. hirtellus through
conventional staining, C-banding, fluorochromes staining (CMA3/DA/DAPI) and silver nitrate staining. This species
showed karyotype 2n=12, Xyp, autosome chromosomes with metacentric and submetacentric (pair 1 and 2), and
acrocentric morphology (pair 3-5). The X is meta-submetacentric and y diminute. Were observed pericentromeric
blocks of heterocromatin in the chromosomes. The constitutive heterocromatin (CH) showed richness of base pairs
GC only in a homologous of pair 5, which was negative for DAPI, while the remaining chromosomes were neutral
blocks. The staining with AgNO3 revealed a Nucleolus Organizer Region (NOR) in the sexual bivalent. These results
showed that the sex mechanism Xyp, considered primitive, has remained in E. hirtellus, differently of diploid number,
that was reduced by chromosomal rearrangements, of kind pericentric inversions followed by fusion autosomeautosome. These chromosomal rearrangements together with other chromosomal and molecular mechanism must
be involved in the reduction origins of the diploid number and neutrality of blocks of CH in the genus Eurysternus.
Financial Support: CNPq and FACEPE
53
FUNCTIONAL ANALYSIS OF ELEPHANT
SHARK (CALLORHINCHUS. MILII) HOXD
CIS-REGULATORY LANDSCAPE IN MOUSE
TRANSGENIC ASSAYS
Frota-Lima1, GN; Brabo1, JAC; Shubin, NH2; Schneider PN1, Schneider, I1.
Universidade Federal do Pará; 2The University of Chicago
1
[email protected]
Keywords: limb, Hox, enhancer, elephant shark, mouse
The tetrapod limb consists of three segments, stylopod (arm), zeugopod (forearm), and autopod (digits), and has
served as the basis for a remarkably broad adaptive radiation from wings of birds to our own hands. Hox genes
play a central role in patterning and growth of fins and limbs. Limb development is characterized by two phases
of Hox gene activity: an early phase in which expression extends throughout the future arm and forearm and is
controlled by cis-regulatory elements located on the telomeric side of HoxD cluster; and a late phase that occurs
exclusively in the developing digits and is controlled by cis-regulatory elements located on the centromeric side of
the HoxD cluster, spanning a region flanked by the lnp and atp5g3 genes. In mice, genetic removal of this regulatory
landscape completely abolishes HoxD expression in developing digits, indicating that the complete cis-regulatory
circuitry for digit expression of HoxD genes is located within this interval. Therefore, HoxD gene expression in the
autopod results from the combined action of multiple enhancers spread across this regulatory landscape. Several
of these cis-regulatory elements are conserved among tetrapods and fish, however CsB enhancer has been the
only fish element examined in functional assays. If antecedents of digits were present in fish fins, deep homology
would predict that HoxD genes in fish are under the control of the same upstream enhancer system. Nevertheless,
it has been difficult to experimentally test this, due to the sequence length of this regulatory landscape and the
pattern of enhancer distribution, which are scattered throughout the gene desert. Recently, we have identified a
BAC (BAC LM46A6) from the cartilaginous fish known as the elephant shark (Callorhinchus milii), containing
this entire regulatory region. This provided us with a unique opportunity to assay the entire interval of late phase
HoxD enhancer system in a non-digited vertebrate and determine whether HoxD digit enhancers were active in a
cartilaginous fish. To this end, we have modified BAC46A6 by means of BAC recombineering, to insert a reporter
cassette consisting of the hsp68 promoter, followed by the LacZ gene. Mouse transgenic assays were carried out by the
University of Chicago Transgenic Mouse and Embryonic Stem Cell facility. Our findings provide key insights into the
evolutionary steps involved in the evolution of HoxD gene regulation and the transition of fish fins into tetrapod limbs.
Financial Support: CNPq PVE
54
EFFECTS OF TRICHOSTATIN A, A
CHROMATIN-MODIFYING AGENT, ON
MEIOTIC PROGRESSION OF BOVINE
OOCYTES AND EMBRYONIC DEVELOPMENT
Saraiva, NZ1; Oliveira, CL2; Del Collado, M1; de Lima, MR1; Vantini, R1; Monteiro, FM3; Niciura, SCM4; Garcia, JM1.
Departamento de Medicina Veterinária Preventiva e Reprodução Animal, Universidade Estadual Paulista, Jaboticabal,
Brazil; 2Embrapa Dairy Cattle Research Center, Juiz de Fora, Brazil; 3Centro APTA Bovinos de Corte, Instituto de
Zootecnia, Sertãozinho, SP, Brazil; 4Embrapa Southeast Livestock, São Carlos, Brazil.
1
[email protected]
Keywords: epigenetics, trichostatin A, oocyte competence.
One important aspect that has been the subject of recent research is the role of epigenetics in oocyte competence
acquisition. Numerous precisely timed and coordinated events must occur in nucleus and cytoplasm in order to
achieve full meiotic and developmental competence by the oocyte. Histone acetylation is one of those epigenetic events
that occurs in oocyte nucleus. Considering that trichostatin A (TSA), an inhibitor of histone deacetylases (HDACs),
causes global hyperacetylation of histones, the aim of this study was to evaluate the possible benefits of optimized
acetylation levels caused by this agent on bovine oocyte competence and on subsequent embryonic development. For
this purpose, oocytes from ovaries of slaughtered animals were in vitro matured (IVM) in TCM 199 supplemented
with 10% FBS and hormones, and treated with 0 (control), 5, 10, 15, 50 or 100 nM TSA for 28 h. In the first
experiment, samples were collected at 20, 24 and 28 h IVM, and oocytes were stripped from cumulus cells with 2%
hyaluronidase, stained with 10 μg/mL Hoechst 33342 for 15 min and evaluated regarding meiotic progression. In the
second experiment, after 24 h IVM the oocytes were in vitro fertilized in TALP-IVF medium for approximately 20 h,
and the presumptive zygotes were cultured in SOFaa supplemented with 0.6% BSA and 2.5% FBS at 38.5° C in 5%
CO2 in air atmosphere. All results were analyzed by chi-square (χ2) or, when appropriate, by Fisher’s exact test, in SAS
v.8.2. In relation to the first experiment, after 20 h IVM we observed inhibitory effect of TSA on oocyte maturation
rates (metaphase II with extrusion of the 1st polar body) at all concentrations, whereas the concentrations 5 nM
(66/112 - 58.9%), 10 nM (64/100 - 64.0%) and 15 nM (61/99 - 61.6%) differed from the control (68/75 - 90.7%),
50 nM (36/93 - 38.7%) and 100 nM (36 / 82 to 43.9%) groups. Control group was superior to all other treatments,
while no significant difference was observed between 50 and 100 nM TSA. No differences were detected in the
subsequent evaluations (24 h and 28 h IVM), with maturation rates ranging from 62.2% to 91.5%. In the second
experiment, results were similar (p> 0.05) among all groups regarding cleavage rates (76.9% to 89.1%), despite the
lower numerical values presented by the 50 nM (277/360 - 76.9%) and 100 nM (209/268 - 78.0%) groups. However,
blastocyst development was superior in the group treated with 5 nM TSA (118/279 - 42.3%) when compared to the
other groups (control: 108/334 - 32.3%; 10 nM: 76/242 - 31.4%; 15 nM: 96/300 - 32.0%; 50 nM 80/301 - 26.6%,
100 nM: 50/212 - 23.6%). Damaging effects of TSA on development were observed when high concentrations were
used (50 and 100 nM). We conclude that TSA slows meiotic progression in low concentrations but allows maturation
rates similar to those obtained for the control group after 24 h IVM. This effect was shown to be beneficial to the
embryo development in the concentration of 5 nM TSA. Further experiments to evaluate the effect of TSA on embryo
quality are required, to better characterize the potential benefits caused by this agent during oocyte maturation.
Financial Support: FAPESP 2010/20744-6 and 2011/12983-3
55
DIFFERENT PATTERNS OF GENETIC
DIVERSITY IN THE SNAPPERS (LUTJANUS
PURPUREUS AND L. SYNAGRIS) OF
THE WESTERN ATLANTIC USING
MITOCHONDRIAL CONTROL REGION
Silva, R1, Veneza, I1, Sampaio, I2, Schneider, H2 & Gomes, G1,2.
Laboratório de Genética Aplicada, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Universitário
de Bragança; 2Laboratório de Genética & Biologia Molecular, Instituto de Estudos Costeiros, Universidade Federal do
Pará, Campus Universitário de Bragança. Alameda Leandro Ribeiro, S/N, Aldeia, Bragança-Pará- Brasil.
1
[email protected]
Keywords: Lutjanus, synagris, purpureus, control region, diversity.
The snappers Lutjanus purpureus and L. synagris are important fishery resources in the western Atlantic, where they
are exploited heavily by both industrial and artisanal operations. Recent advances in molecular biology have resulted
in the development of a series of tools for the analysis of the genetic variability of natural populations, including the
sequencing of segments of the DNA of the mitochondrial Control Region, which has been used for the analysis of
a number of commercial fish species. The present study compared the genetic variability of the L. purpureus and L.
synagris from the same geographic region. The genetic diversity of the two stocks was assessed from DNA sequences of
a fragment of the mitochondrial control region in a sample of 335 specimens of L. purpureus and 73 of L. synagris. A
total of 404 bp were obtained in the 335 L. purpureus specimens, 273 haplotypes were identified, of which 240 (88%)
were unique. The most common haplotypes were shared by only seven specimens, and were observed in all years
analyzed. Many haplotypes were recorded in 2003 (40%), and only 19 of these were observed in subsequent years, with
six in 2010, suggesting that low frequency alleles can easily be lost as a product of excessive withdrawal of individuals
for fishing over the years. For L. synagris, 403 bp were obtained from 73 specimens, 29 from Amapá, and 44 from Pará.
Only 20 of these sites (5%) were polymorphic, a proportion considerably smaller than in L. purpureus (43%). The 73
sequences were organized in 17 haplotypes. The most common haplotype was shared by 53 individuals, 32 of which
were from Pará, and 21 from Amapá. Only one other haplotype was present in both populations, while the others were
either unique or exclusive to one population, and were generally distinguished by a small number of mutations, as
indicated by the low values of genetic divergence. Observed diversity was highly discrepant in the two species. While
L. purpureus presented relatively high haplotypic and nucleotide diversity, these parameters were unexpectedly low
in L. synagris. A comparative analysis including these species and other perciforms indicated that this mitochondrial
marker is relatively efficient for the diagnosis of catastrophic past events, as was clearly the case in L. synagris, suggesting
that the diversity patterns observed are directly related to historical demography and bioecology of the species.
56
“POPULATION STRUCTURE OF THE
OCHLEROTATUS SCAPULARIS (DIPTERA:
CULICIDAE) VECTOR OF ARBOVIROSIS AND
FILARIASIS”
Vivian Petersen1, Mariana Devicari1, Lincoln Suesdek1
Instituto Butantan - São Paulo, Brazil; Biologia da Relação Patógeno - Hospedeiro – Universidade de São Paulo - São
Paulo, Brazil.
1
e-mail: xxxx
Keywords: xxxx
Ochlerotatus scapularis is a vector of filariasis and arbovirosis with a wide geographical distribution in the Neotropics.
Cases of domiciliation and urbanisation of this species have been increasingly reported. Despite Oc. scapularis clear
epidemiological relevance, it is still poorly understood. Some morphological and behavioural variations have led
authors to believe that this mosquito species is actually a complex of cryptic species. Species complexes of insects are
particularly problematic for the medical field because they are often more difficult to characterise, investigate and
control than standard species. The purpose of this study was to describe the population structure of this mosquito
and test whether it is indicative of a cryptic species. Population samples were characterised using genetic and
morphological markers: Cytochrome oxidase subunit-1 (COI) mitochondrial gene (partial), wing geometrics and
genitalia morphology. Samples of adult mosquitoes were collected between 1998 and 2011 in four municipalities in
Brazil: Tremembé, one sample (TRE); Pariquera-Açu, one sample (PAR); Itaboraí, one sample (ITA); and São Paulo,
four samples (PET 98, PET 07-08, PET 11 and BUT). Among the 147 individuals analysed, 52 COI haplotypes
were found and the haplotype diversity was high (0.916). Six haplotypes were present in 69% of the individuals and
were shared by most or all of the populations, whereas the remaining haplotypes were much less frequent. In addition,
genetic differentiation was low (Fst scores reached no more than 0.0602) and estimated gene flow was not absent,
which indicates weak population structuration. Coherently, the wing shape characteristics assessed using geometric
morphometrics were polymorphic and suggest an incomplete population structure. Morphological analysis of the
genitalia revealed that contrary to previous beliefs, the claspette filament of the gonocoxite was intrapopulationally
polymorphic and was not indicative of a cryptic species. We concluded that Oc. scapularis should be considered
as a single taxon with polymorphisms. Analyses also showed that wing shape and the COI gene evolved during a
short period of time (13 years). Taken together, these results lead us to believe that Oc. scapularis bears a rich genetic
patrimony, which may confer a broad adaptation capacity to this species. The implications of such genetic richness on
vectorial capacity, plasticity, domiciliation and ability to explore urbanised areas should be included in the next stage
of the investigation of this species.
57
KARYOTYPE CARACTERIZATION OF A
MAZAMA GOUAZOUBIRA (ARTIODACTYLA;
CERVIDAE) POPULATION FROM
NHECOLÂNDIA IN PANTANAL
Valeri, MP1,2; Tomazella, IM1,3; Duarte, JMB1
Núcleo de Pesquisa e Conservação de Cervídeos (NUPECCE), Faculdade de Ciências Agrárias e Veterinárias (FCAV),
Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP), Jaboticabal – SP; 2Curso de graduação em Zootecnia,
Faculdade de Ciências Agrárias e Veterinárias (FCAV), Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP),
Jaboticabal – SP; 3Programa de Pós-graduação em Genética e Melhoramento Animal, Faculdade de Ciências Agrárias e
Veterinárias (FCAV), Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP), Jaboticabal – SP.
1
[email protected]
Keywords: Brown Brocket Deer, Chromosomal polymorphism, G-banding, Robertsonian translocation. Karyotypic evolution
The family Cervidae, belonging to the order Aryodactila, possesses 17 genera and 52 described species and stands
by its karyotype diversity, with an extensive variation of its chromosomes and presence of B chromosomes. Among
studied species in this family there is the brown brocket deer (Mazama gouazoubira), which shows intraspecific
chromosomal polymorphism resulting from the presence of centric fusions (Robertsonian translocations) and
the presence of the B chromosomes. The chromosomes involved in these translocations and the origin of the B
chromosomes are still poorly understood and its study would help in understanding the patterns of the chromosomal
evolution of animals of the Mazama genus. Given this, the present work aims to cytogenetically characterize
a brown brocket deer population in Nhumirim Farm, located on Nhecolândia in Pantanal, in the state of Mato
Grosso do Sul, and to investigate this population’s Robertsonian translocations and B chromosomes frequency.
Therefore, chromosome preparations were obtained from the cultivation of skin samples fibroblasts stored in liquid
nitrogen from fifteen animals (nine males and six females) that were captured with anesthesic darts imbued with
transmitters. The identification of animals carrying the translocations and B chromosomes was done through
the analysis of 20 metaphases of each individual with conventional staining (Giemsa). From the obtained results
was calculated the frequency of animals carrying that polymorphism in relation to the total number of analyzed
animals. Of the 15 analyzed animals, four (26,6%) are bearers of a translocation and seven (46,6%) have B
chromosomes. From this data it was possible to cytogenetically characterize a M. gouazoubira wild population,
which showed to be polymorphic, with Robertsonian translocations and B chromosomes bearers, enabling the
development of future studies that identifies which are the chromosomes involved in Robertsonian translocations.
Financial Support: FAPESP (processo nº 2012/21044-3) and FCAV/UNESP.
58
IDENTIFICATION OF RAYS SPECIES OF THE
GENUS DASYATIS (MYLIOBATIFORMES:
ELASMOBRANCHII) FROM THE
SOUTHEASTERN AND SOUTHERN BRAZIL
THROUGH PCR-RFLP TECHNIQUE
Schmidt, BF1; Hilsdorf, AWS2; Amorim, AF1
Instituto de Pesca, APTA, SAA, Santos, SP; 2Laboratório de Genética de Organismos Aquáticos e Aquicultura,
Universidade de Mogi das Cruzes, Mogi das Cruzes, SP.
1
[email protected]
Keywords: Dasyatis, fishing, COI, enzyme.
The fisheries statistical and stocks assessment of many species of rays have been damaged by the lack of information
on the species level, since such individuals are grouped into the same category. Molecular tools have shown
great efficiency in identifying species, and the mitochondrial gene citocromo oxidase C subunit I (COI), is one
of the most used due to its high performance and facility of alignment. Given the difficulty of identification, in
the fish landings, of the four species of the genus Dasyatis rays that occur in southeastern and southern Brazil,
D. hypostigma, D. americana, D. guttata and D. centroura, the aim of this work was to develop a methodology of
PCR-RFLP, to identify the four species mentioned. The DNA was extracted with GE kit of tissue samples and the
amplification of the region COI were made with universal primers for fish developed by Ward et al. (2005) R1
and F2, generating approximately 650 bp amplicons. The sequences were analyzed in the Nebcutter program, and
restriction enzymes Ase I, Bcc I and Fok I, that generates specific DNA fragments of each species, were selected
and tested. The enzyme Fok I showed the best result, generating two fragments of 390 e 260 bp for D. hypostigma,
three fragments of 300, 180 e 155 bp for D. americana, two fragments of 370 e 300 bp for D. guttata and two
fragments of 410 e 200 bp for D. centroura. The visualization in agarose gel allowed a clear identification of the
four species. The PCR-RFLP has been used successfully in the identification of many species of fish. Although
slightly used in rays, the method was also efficient and can be an important tool in the conservation of such group.
Financial Support: FAEP, CNPq e FAPESP.
59
GENETIC DIVERSITY IN PURE CACHARA
SPECIMENS FROM NATURAL ENVIRONMENT
OF MATO GROSSO DO SUL STATE, BRAZIL
Silva, DBS1; Vaini, JO2; Crispim, BA1; Banari, AC1; Santos, JCG3; Grisolia, AB1
Faculdade de Ciências Biológicas e Ambientais, UFGD, Dourados, MS; 2Faculdade de Ciências Exatas e Tecnologia,
UFGD, Dourados, MS; 3Faculdade de Ciências Agrárias, UFGD, Dourados, MS
1
[email protected]
Keywords: Pseudoplatystoma reticulatum, microsatellite, conservation, heterozygosity, PCR
Among the fish species with the highest economic value in Mato Grosso do Sul State (MS, Brazil) is the “Cachara”
(Pseudoplatystoma reticulatum), and the presence of interspecific hybrids surubins (Pseudoplatystoma corruscans X
Pseudoplatystoma reticulatum) in MS rivers may jeopardize the integrity and genetic variability of P. reticulatum.
Therefore, information on this species genetic diversity is relevant both to its conservation and protection, as well
as for the use of genetic resources as a basis for these animals improvement and crossing. The aim of the work was
to first identify the P. reticulatum by species-specific primers and subsequently evaluate the genetic variability of this
species from the Dourados, Ivinhema, Negro, Aquidauna, Miranda and Paraguay Rivers in Mato Grosso do Sul
State using microsatellites. DNA was extracted (using 5% Chelex resin) from fin fragments of 44 fish phenotypically
identified as P. reticulatum collected in the rivers. Multiplex PCR and PCR-RFLP of RAG2, GLOBIN, EF1α,
18S rRNA and 16S rRNA genes were performed to identify the P. reticulatum genetically. Of the total molecularly
analyzed, only 16 were identified as P. reticulatum, and the genetic variability was assessed from this animals. We
analyzed 7 microsatellite loci (Pcor 01, Pcor 05, Pcor08, Pcor 10, Pcor 21, Pcor 23 and Pcor 28). The amplified
fragments were subjected to electrophoresis on 7% denaturing polyacrylamide gel, stained with silver nitrate. The
population analyzes were carried out by CERVUS 3.0, FSTAT and ARLEQUIN softwares. Genetic diversity was
3.88 and allelic richness was 3.82. A total of 27 alleles were identified between the markers. The number of alleles
per locus ranged from 2 for Pcor10 to 5 for Pcor05, Pcor08 and Pcor23, with an average of 3.86. The expected and
observed heterozygosity for the 7 loci were 0.55 and 0.59, respectively, indicating that the number of heterozygotes
in the population is higher than expected. The average polymorphic information content was 0.49, indicating that
the markers were considered informative for this population. None of the microsatellite loci were in HWE. The
population structure analysis has shown that there is a 7.19% difference in the population. Genetic differentiation
estimates based on FST were significant (p <0.05), indicating that the studied population is significantly dependent
genetically. Thus, the use of markers for purebreds’ prior selection is important so that there isn’t a genetic variability
study in hybrids, since pure animals are the purpose of the research. The loci analyzed were efficient in discriminating
individuals in the population of P. reticulatum and although the sample group is small genetic variability was low.
Financial Support: CAPES and Universidade Federal da Grande Dourados (UFGD)
60
SEQUENCING AND COMPARATIVE
ANALYSIS OF GENES INVOLVED IN FEEDING
PREFERENCE IN THE CALLIPHORIDAE FAMILY
(DIPTERA: CALLIPHORIDAE)
Monfardini, RD; Torres, TT.
Instituto de Biociências, USP, São Paulo, SP
[email protected]
Keywords: Evolution, feeding habit, myiasis, parasitism, screw-worm.
Parasitism is one of the most successful behaviors among invertebrates. In this context, the order Diptera is extremely
relevant, as it includes several species of parasites and vectors that have a severe impact in human and animal health. The
Calliphoridae family is an interesting group for the study of parasitism, since this lifestyle has evolved independently
at least three times in this family. Six genes involved in the feeding habit (for, mvl, gdh, s6k, prgp and jon) were
previously studied in Calliphoridae to discover the pattern of evolution of their expression. We are now interested in
the patterns of evolution of their coding sequences. Hence, this work aims to sequence these six genes in five species
of calliphorids (three species of Cochliomyia and two of Chrysomya) and compare the pattern of evolution of the
coding sequence and the expression. Alignments were performed using transcripts of Cochliomyia hominivorax against
the sequence of these six genes from the genomes of 12 Drosophila species using automated BLAST searches. Based
on the aligned sequences, primers were designed in conserved regions of each gene. These regions were identified
by multiple alignments between the C. hominivorax and the Drosophila sequences. Amplifications were performed
on cDNA of larvae, females and males of the four studied species. The primers proved to be efficient for all the
species. When using cDNAs from larvae, the entire segment determined by the primers was amplified. However,
when using cDNAs from adult flies (females and males) there was no amplification of the first exons in long genes.
Based on the alignments with the Drosophila sequences, a conservation of the gene sequence and structure may
be observed among Diptera, since most of the exons were recovered from the C. hominivorax transcript database
and amplifications occurred in all species. Besides the fact that the amplifications where successful only on larval
samples, the non-amplification of the first exons when using adult cDNAs suggests the existence of alternative
splicing during the development of the organism. Nevertheless, further investigation is needed to test this hypothesis.
Financial Support: FAPESP
61
ANALYSIS OF INTRASPECIFIC VARIABILITY
IN PARTAMONA HELLERI (HYMENOPTERA,
APIDAE) IN THE STATE OF ESPÍRITO SANTO
(BRAZIL)
Machado, DP1; Manhago, ZB1; Paiva, SR23;Paresque, R1; Tosta, VC13.
Universidade Federal do Espírito Santo, CEUNES/UFES, São Mateus/ES, Brasil; 2Embrapa Recursos Genéticos, EMBRAPA/
CENARGEN, Brasília/DF, Brasil; 3Pós-Graduação em Biodiversidade Tropical, CEUNES/UFES, São Mateus/ES, Brasil
1
e-mail: xxxx
Keywords: Partamona, Stingless bees, cyt B, Rio Doce, Intraspecific variability
Partamona helleri, Friese 1900 is a stingless bee species widely distributed. It is present in Atlantic forest from
the northeast Santa Catarina up to Bahia. In this species cytogenetic and molecular data indicate a great genetic
variability, presenting chromosomal polymorphism with the presence of B chromosomes. Preliminary studies showed
significant cytogenetic differences between populations from north and south of the Rio Doce river. This study aimed
to analyze the intraspecific variability in Partamona helleri in the state of Espírito Santo through the sequencing of
mitochondrial genes cytB (cytochrome B) and COII(cytochrome oxidase II). For analysis, samples were collected in
four localities of Espírito Santo: Governador Lindenberg(GL), Jaguaré(JAG), Alfredo Chaves(AC) and Venda Nova
do Imigrante(VN). Were collected four to seven nests per region. We used twenty five individuals of each locality
amounting to one hundred individuals. Sample of Partamona rustica was used as out group. DNA was extracted
using a phenol-chloroform extraction. A fragment of 485 nucleotides of cyt B region was amplified using the primers
mtD26 and mtD28 and a fragment of about 500 nucleotides of COII region was amplified with primers COIIIf and mtD18. Sequencing was performed using an automated sequencer ABI 3730 (Applied Biosystems Inc.).
For COII, all the samples showed the same haplotype. The 485 nucleotides of Cyt B presented3 haplotypes with
5 polymorphic sites (all transitions). Phylogenetic analysis using the Maximum Likelihood method revealed the
existence of two divergent lineages with high bootstrap values. One lineage was formed by the individuals from
AC and VN , located south of Rio Doce (BS=100), which showed the same haplotype (genetic divergence = 0%).
The other lineage was formed by individuals from GL and JAG, located north of Rio Doce (BS=100), with two
different haplotypes, each one for a locality. The genetic divergence between JAG and GL was 0,5%.. The genetic
divergence between allsamples and the out group was 2,2% for VN and AC, 2,5% for GL and 3,1% for JAG. These
results are consistent with previous cytogenetic data for this region whereas populations from localities south of the
Rio Doce differ from the pattern found in the northern populations. Thus, the data obtained in this work, along
with other published data suggest that the Rio Doce may have been a geographical barrier for these populations.
Financial Support: CNPq, FAPES
62
GENETIC VARIABILITY AND POPULATION
STRUCTURE OF MAIN DENGUE VECTOR,
AEDES (STEGOMYIA) AEGYPTI (DIPTERA:
CULICIDAE), FROM COLOMBIA
Jaramillo, MC1; Caldera, SM1; Cochero, SC1; Bello, B2; Uribe SI3; Bejarano1, EE; Scarpassa, VM4.
Universidad de Sucre, Sincelejo, Colombia; 2Instituto Nacional de Salud, Bogotá, Colombia; 3Universidad Nacional de
Colombia, Medellín, Colombia; 4Instituto Nacional de Pesquisas da Amazônia (INPA), Manaus, Amazonas, Brazil.
1
Keywords: Aedes aegypti, Dengue vector, ND4 gene, Population genetics
Aedes aegypti has been found in high density across throughout Colombia, contributing to increase the cases of dengue
in the later years in that country. Thus, population genetics studies are important to know population dynamic and
extension gene flow among populations, which are relevant parameters for vector control efforts. In the present
study, we analyzed genetic variability and population structure of nineteen natural populations from the eleven states,
comprising all regions in Colombia. In this study, we used 376 sequences of ND4 gene of mitochondrial DNA
and the fragment generated after the alignment was of 357 base-pairs (bp). There was evidence of heteroplasmy (~
6.12%) in the dataset, which was detected in eight populations from Northern of Colombia. Twenty haplotypes
were observed (H1 to H20), ranging from one to eight within populations. H2 haplotype was the most frequent
(45.84%) and observed in all populations sampled, followed by H3 and H8 with frequencies 21.70% and 13.22
%, respectively. The haplotype diversity (h) ranged from 0.342 (in Soledad) to 0.816 (in Pueblo Nuevo), whereas
the nucleotide diversity (p) ranged from 0.001 (in Soledad) to 0.359 (in Sahagún). The tests of neutrality (Tajima’s
D and Fu and Li’s D and F) showed positive values and non significant, with exception for five populations that
showed negative values and also non significant, suggesting no demographic expansion. Similarly, the test of Fu’s Fs
had positive values and non significant statistically in most populations, with exception for one population (Pueblo
Nuevo) that it had negative value, but no significant. The pairwise genetic distance (FST values) had a large range
from -0.12194 to 1.000, consequently the gene flow estimates (Nm values) were from infinity to 0.000. Hierarchical
analysis (AMOVA), with all populations non-clustered, indicated that the most percentage of variation occurred
within populations (62.33%); however, a significant percentage of variation (37.67%; P=0.00000 ± 0.00000)
occurred among populations. A second AMOVA, using two groups (Northern and remaining populations), showed
lower percentage of variation and non significant between groups (9.18%; P=0.07213 ± 0.00586). Haplotypes
tree (NJ) indicated two lineages (bootstrap supports = 63% and 88%); a similar result to previous studies with
this marker. Mantel test no indicated correlation between genetic and geographic distances. In conclusion,
these data allow us to infer that the populations of Ae. aegypti in Colombia are connected by restrict gene flow
and that much of genetic differentiation observed is distributed among populations from northern Colombia.
Financial Support: COLCIENCIAS, UNIVERSITY OF SUCRE-Colombia; INPA/MCTI-Brazil.
63
MOLECULAR GENETIC IDENTIFICATION
OF ROAD-KILLED ANIMALS AROUND
ECOLOGICAL STATION AND CONTRIBUTIONS
FOR MOLECULAR DATABANK
Ramazzotto, LA¹; Freitas, PD¹; Saranholi, BH¹; Gonçalves, MM¹; Bergel, MM.²; Ruffino, PHP², Galetti Jr., PM¹;
Laboratório de Biodiversidade Molecular e Conservação, Departamento de Genética e Evolução, Universidade Federal
de São Carlos, São Carlos, SP; 2Instituto Florestal de São Paulo, Itirapina, SP.
1
[email protected]
Keywords: Forensic genetic, Cox 1, Database, mtDNA, Sequence.
The presence of roads around conservation units can represent an impact on the local fauna due to specimens bowled
over road kill. Sometimes, the correct identification of these road-killed animals using only morphological characters
is almost impossible due to the conditions that the animals are found. The use of molecular genetic to acquire
information about the road-killed species and the creation of a molecular databank can help to make more efficient
and accurate the identification. Moreover, the correct identification of the specimens allow us to assess which groups
are mostly affected by the presence of roads around protected areas. This study aimed to identify the killed animals in
roads around the Ecological Station of Itirapina (São Paulo, Brazil), contribute with DNA sequences to the molecular
databank and help this conservation unit establish measures to minimize the impacts in the most affected species.
We used DNA Barcoding technique to molecular identification, which is based on the detection of small variations
in a conserved gene sequence, enabling the precise identification of an individual. We used the cytochrome c oxidase
I (COX 1), a conserved mitochondrial gene to the species identification. After DNA extraction, the fragment of the
gene was amplified by PCR. Initial analyses were made using universal primers for COX 1 described by Folmer et
al (1994). But after many problems in obtaining a satisfactory amplification of the samples, principally with that
from reptiles, we changed the primers to a pair designed in our laboratory, which improved the success rate of the
method in the three taxa analyzed (mammals, birds and reptiles). The obtained sequences were compared against
database of National Center of Biotechnology Information (NCBI) and the Barcode of Life Data Systems (BOLD).
From the 35 samples collected, 13 were identified (Cerdocyon thous, Ameiva ameiva, Didelphis albiventris, Leopardus
pardalis, Cariama cristata, Mesoclemmys vanderhaegei, Cuniculus paca, Tupinambis merianae, Crotalus durissus, Lepus
europaeus, Tamandua tetradactyla), 6 are in process of sequencing and 10 are in extraction of DNA and PCR step
of analysis. Two of them were not identified because the lack of information on both DNA sequence databases and
the other four samples couldn’t be amplified because the collected material was much degraded. From the generated
data, we hope to improve the process of identification and fill the lack of information of wild species in molecular
databases. Moreover, it can help the ecological stations to make conservation policies to minimize the effect of
roads kills around the conservation units, by providing the molecular species identification and record of the most
affected ones, favoring the elaboration strategies to mitigate the effects of the road-kills around the conservation unit.
Financial Support: SISBIOTA/MCTI/CNPq, CNPq and FAPESP.
64
GENETIC DIVERSITY OF PSEUDOPLATYSTOMA
FASCIATUM (MITOCHONDRIAL DNA
CONTROL REGION AND COI) FROM MUNIM
RIVER (MARANHÃO - BRAZIL)
Lima, JS¹; Tchaicka, L¹, Abreu-Souza, CP²; Fraga, EC3; Barros, MC3; Carvalho-Costa, LF4
Laboratório de Genética e Biologia Molecular Warwick Kerr , Curso de Ciências Biológicas, Universidade Estadual do
Maranhão – Campus São Luís; 2 Programa de Pós-Graduação em Biodiversidade e Conservação, Universidade Federal
do Maranhão; 3Centro de Estudos Superiores de Caxias, CESC-UEMA–Campus Caxias; 4Laboratório de Genética e
Biologia Molecular, Departamento de Biologia, Universidade Federal do Maranhão–Campus São Luis.
1
[email protected]
Keywords: mtDNA, surubim, genetic variation, Maranhão
The genus Pseudoplatystoma belongs to Pimelodide family, composed of fishes that can be found in major river basins
of South America, where are popularly known as Surubim. They are characterized by having a depressed head, a
very long fontanel and dark and pale bands pigmentation. Mitochondrial DNA (mtDNA) is a very useful marker
for genetic diversity and phylogenetic studies of wild populations due to its high evolutionary rate. The cytochrome
oxidase subunit I gene (COI) and the control region are particularly useful for the analysis of recent divergence,
like between populations, species and genera. Thus, we used sequences from control region and COI to assess the
levels of genetic variability of Pseudoplatystoma fasciatum, from Munim river (sampling sites: Cachoeira Grande; Nina
Rodrigues and Chapadinha). A total of 91 samples were obtained, whose genomic DNA were isolated using a saline
protocol. Molecular markers were amplified by PCR and. sequenced on ABI 3500 automated sequencer. We obtained
705 base pairs (bp) (four variable sites and two mutations) for the control region from 27 individuals (two haplotypes).
The haplotype diversity (Hd) was 0.142 and nucleotide diversity was 0.00081. Fragments of 620 bp were obtained
from COI (two variable sites and two mutations) for 39 individuals (four haplotypes). Calculated Hd and nucleotide
diversity was 0.100 and 0.00017, respectively. Further, we have compared our control region sequence data with 56
sequences of P. fasciatum (Amazon Basin) and two sequences of P. reticulatum (Paraguay river), available in Genbank.
There were no shared haplotypes among Munim population and those sequences from Genbank. Genetic distance
(p-distance) was > 4%, when comparing fish from Munim and Amazon. The value obtained in the comparison
between P. fasciatum (Munim) and P. reticulatum was 3, 7%, and 6% between P. fasciatum (Munim) and P. corruscans.
For the COI gene, Munim population diverged by 1.3%, 1.7% and 5.1%, when compared to the Amazon population,
P. reticulatum and P. corruscans, respectively. The low genetic variability found for P. fasciatum, from Munim river, may
indicate that this population may be experiencing, or has experienced, a reduction in their effective population size,
what should be take into serious consideration for managing this fisheries resource. The genetic differentiation between
Munim population and Amazon region also suggests that these groups can be considered as separate evolutionary
units, deserving equal importance for conservation purposes. All in all, our study has contributed to a better
understanding of the genetic variation and phylogenetic relationships of a relevant biological resource from Maranhão.
Financial support: FAPEMA
65
A NEW KARYOTYPE TO HYLAEAMYS
(CRICETIDAE: RODENTIA) FROM UNA (BA)
WITH 2N=48 AND FN=62-63
Porfírio, KA1; Fagundes, V2; and Paresque, R1
Centro Universitário Norte do Espírito Santo, Universidade Federal do Espírito Santo; 2Centro de Ciências Humanas e
Naturais, Universidade Federal do Espírito Santo
1
Keywords: Hylaeamys, cytogenetic, new karyotype
The rodents represent the most numerous orders inside mammals; have a wide geographic distribution, and present
extraordinary morphological and karyotypic variation. The Sigmodontinae subfamily is divided into 9 tribes:
Abrotrichini, Akodontini, Ichthyomyini, Oryzomyini, Phylontini, Reithrodontini, Sigmodontini, Thomasomyini
and Wiedomyini. Among the rodents of the Cricetidae family, Sigmodontinae subfamily, the Oryzomyini tribe show
higher diversity with about 125 species. Among these, Hylaeamys is one of the most widely distributed in Brazil,
represented by 6 species: H. acritus (MT), H. laticeps (PB, SE, BA, ES, RJ, SP e MG), H. megacephalus (AM, RR, PA,
AP, MT, MS, MA, MG, SP, GO, DF e TO), H. oniscus (AC, AM), H. perenensis (AC e AM) and H. yunganus (AC,
AM, PA, RO e MT); H. seuanezi was considerate junior synonym of the H. laticeps. This present work aimed study the
karyotype diversity to Hylaeamys from Una (BA). Four Hylaeamys sp. were cytogenetically analyzed. The metaphases
were obtained from bone marrow after “in vivo” injection of colchicine. The cells were exposure to KCl (0,075M)
solution during 25-30 minutes in 37oC. Slides were analyzed and counted 10 metaphases in the optical microscope to
established the diploid number (2n) and the number of arms autosomal (FN), and the best images were photographed.
Specimens showed 2n=48 and FN=62 or 63, consisting for 8 pairs meta or submetacentric varying in size from medium
to small (pairs 1 to 8), the pairs 9 to 11 are the largest subtelocentric, the pairs 12 to 23 are acrocentric or subtelocentric
with size gradual variation. One exemplar (LGA 3983) showed the pair 22 as heteromorphic, formed by an acrocentric
and a metacentric chromosome. The X chromosome is a medium metacentric and the Y is a puntiforme chromosome.
Compared with H. laticeps can be noted that Zanchin karyotype presented 2n=48 and FN=64 with 9 biarmed pairs,
although the Weksler karyotype showed 2n=48 and FN=60 with 7 biarmed pairs (referred as H. seuanezi). The X
chromosome described by Zanchin is a big acrocentric, and the discribed by Weksler is a big submetacentric. The Y
chromosome for Zanchin is a medium acrocentric and for Weksler is a medium subtelocentric. The specimens form
Una can be represent a new karyomorph related to H. laticeps or H. seuanezi if this is a valid species. The differences
observed in the three karyotypic forms may result from pericentric inversions and Robertsonian translocations.
Financial support: FAPES and CNPq
66
ITS 2 AS A SUITABLE MOLECULAR MARKER
FOR DIFFERENTIATION OF TWO SUGARCANE
MOTH BORER SPECIES: DIATRAEA
SACCHARALIS AND D. FLAVIPENNELLA
(LEPIDOPTERA, CRAMBIDAE)
Regueira Neto, MS1; Barros, RP1; Balbino, VQ2; Loreto, V1
Laboratório de Genética e Citogenética Animal, Departamento de Genética, Centro de Ciências Biológicas, UFPE,
Recife, PE; 2Laboratório de Bioinformática e Biologia Evolutiva, Departamento de Genética, Centro de Ciências
Biológicas, UFPE, Recife, PE
1
[email protected]
Keywords: Diatraea, ITS 2, microsatellite, moth borer, sugar cane
The two sugarcane borer species Diatraea saccharalis Fabricius, 1794 and D. flavipennella Box, 1931 are mostly known
by the damage caused to sugarcane culture. The two species are well distributed in Brazil and both can occur in the
same field. The larval and adult stages are very similar between these two species and the identification in field can
be confused. The Internal Transcribed Spacer 2 (ITS2) has been applied in phylogenetic and population studies. This
marker is located between the 5,8S and 28S ribosomal subunits. In this work we performed an analysis of the Internal
Transcribed Spacer 2 from the ribosomal gene 45S with the aim to provide a new molecular marker for distinguish
both pests found in the sugarcane field. Among larvae and adults were used 58 specimens of D. saccharalis from Rede
Interuniversitária para o Desenvolvimento do Setor Sucroenergético (RIDESA - Carpina) and 12 specimens of D.
flavipennella from Departamento de Agronomia – Fitossanidade (UFRPE-Recife). DNA was obtained using Chelex®
100 5%. The ITS2 region was PCR-amplified using primers design for Himenoptera. The ITS 2 amplicons were
sequenced and the sequences were compared via BLAST in GenBank. Analyses were performed on MEGA 5. The
amplicon size in D. saccharalis was 440 bp and in D. flavipennella was 400 bp. The GC average content was 51% in
D. saccharalis and 48% in D. flavipennella. Was observed three microsatellites sequences repeats [(AC)3, (GAC)3 and
(TCG)6] which were present in D. saccharalis and absent in D. flavipennella. The average size of ITS 2 in Crambidae
was 425 bp, ranged from 390 to 451 bp. The size of ITS 2 is specific of each species of Crambidae and this is also a
characteristic of other families from Lepidoptera. The GC content had a slightly variation among the species belonging
to Crambidae, however when compared with others families this variation is higher. The sequence size difference found
between the two species of Diatraea may be due to insertion or deletion of microsatellites sequence repeats. The ITS 2
should provide an efficient molecular marker for confirm taxonomic status of the two pests present in the sugarcane field.
Financial support: CNPq and FACEPE
67
GENETIC CHARACTERIZATION OF
SALMINUS BRASILIENSIS IN A FRAGMENTED
ENVIRONMENT
Souza, MS1; Machado, CB1; Almeida, FS2; Freitas, PD1; Galetti Jr, PM1
Universidade Federal de São Carlos - São Paulo; 2 Universidade Estadual de Londrina - Paraná
1
[email protected]
Keywords: hydroelectric dam; migratory fishes; conservation; genetic diversity; mitochondrial marker
Drastic changes in hydrographic basins caused by construction of hydroelectric plants (HEP) can bring damage
implications for biodiversity, especially for migratory fish species. Paranapanema River (Paraná River Basin) has been
impacted by the construction of HEPs in the last 50 years. In addition, it was also observed a decrease in catching
of Salminus brasiliensis, an important migratory fish species used in the gastronomy and sport fishing. It is known
that the habitat fragmentation may disrupt the gene flow, affecting the dynamics of life cycle of these species, with
consequent reduction in population size. Effects of genetic drift and loss of genetic diversity become more evident in
small populations, compromising the population viability and its evolutionary potential and increasing its extinction
risk. In this context, characterizing genetic structure of S. brasiliensis populations along the Paranapanema River can
identify subpopulations and help to establish management strategies. In this study, a fragment of D-loop mitochondrial
gene was analyzed in 18 specimens from Canoas I HEP and 18 from Canoas II HEP reservoirs, collected in 2004, in
order to assess the levels of genetic diversity and differentiation within and between these populations. The sequences
were obtained and the rates of nucleotide and haplotype diversities calculated. AMOVA and Fst were established
and the genetic distances were estimated according to Kimura 2-parameter substitution model. Fragments of 551
bp of 36 samples were analyzed and showed 80 polymorphic sites, of which 76 were parsimoniously informative.
The haplotype and nucleotide diversity were 0.863/0.032 for Canoas I and 0.908/0.042 for Canoas II, respectively.
Average genetic distance between populations was 4.9%, while within populations it was 3.5% for Canoas I and
6.2% for Canoas II. These results indicate high levels of genetic variability for both samples. Despite the location of
these populations in different HEP, the Fst value (0.0187, p>0.05) reveals no population structuring. The AMOVA
results similarly suggest no genetic divergences, since variation between and within populations were 1.87% and
98.13%, respectively. These data suggest that the passage ladders from these regions had promoted a gene flow upward
during its operation (2001-2008). After this period, however, the passage ladders were closed. Due to no presence
of tributaries in this part of the Paranapanema River, it is believed that the fish were retained in these reservoirs and
the reproductive cycle was no completed, which could promote a population decline of S. brasiliensis populations
in the area. Further analysis that consider the new condition of Canoas I and Canoas II, as well as the Capivara
and Salto Grande populations to better understand the genetic status of this species in the Paranapanema River.
Financial support: SISBIOTA/MCTI/CNPq, FAPESP and CAPES
68
KARYOTYPE STUDY FROM PHYLLOSTOMUS
HASTATUS (LINNAEUS, 1758) IN CENTRAL
REGION OF MINAS
Dias, CEFA¹; Melo, S²; Lima, CP²; Lessa, G¹
¹Mamallogy Laboratory, Museu de Zoologia, João Moojen, Universidade Federal de Viçosa-UFV; ²Laboratory of
Molecular Systematics – Beagle – Universidade Federal de Viçosa – UFV
e-mail: xxxx
Keywords: KARYOTYPE, CYTOGENETICS, KARST, PHYLLOSTOMINAE, CAVEMAN.
The order Chiroptera is a really diversified group, it represents about 22% of the known mammals species. Usually it’s
divided in two suborders: Megachiroptera and Microchiroptera. The Microchiroptera from the Family Phyllostomidae,
Phyllostomus hastatusis a wide geographical distribution, it can be found in Central and South America. In Brazil it
can be found in 20 states. It’s considered a large specie, the biggest in the genus, the distance betwen the head-body
varies between 94 and 124 centimeters. Other karyotype studies made before in Brazil’s northern showed that the
specie have sexual chromosomes, the female with diploid number 2n=32 XX and the male 2n=32 XY. This reasherd
aims report the karyotype from a P. hastatus’s population order to contribute to the characterization of this species in
southeastern Brazil. The animals where collected on Gruta Guanabara in Codisburgo, in the central region of Minas
Gerais. Extraction protocols from bone marrow of the humerus from three males ando ne female of P. hastatus were
made for getting mitotic chromosomes, it was colored using conventional techniques giemsa. The diploid number
was 32 and the karyotype formula was 2n=28m+1sm+3ª XY for males, and for females 2n=28m+2sm+2ª XX. The
karyotypes found corroborate with the cytogenetics works that already was performed although no description of the
karyotype of this species in the central state of Minas Gerais. Banding techniques as well as further studies with a larger
number of specimens will be necessary to confirm the karyotype of P. hastatus described in this study.
69
GENETIC DIVERSITY AND VIABILITY OF
MICROSATELLITE MARKERS FOR PATERNITY
EXCLUSION IN LOCALLY ADAPTED SHEEP
FROM PANTANAL REGION OF MATO GROSSO
DO SUL
Crispim, BA1; Grisolia, AB1; Seno, LO2; Egito, AA3; Vargas Junior, FM2; Souza, MR2.
Faculdade de Ciências Biológicas e Ambientais da Universidade Federal da Grande Dourados – FCBA/UFGD, Mato
Grosso do Sul – Brasil; 2Faculdade de Ciências Agrárias da Universidade Federal da Grande Dourados – FCA/UFGD, Mato
Grosso do Sul – Brasil; 3Embrapa Gado de Corte – Campo Grande, MS – Brasil
1
[email protected]
Keywords: Animal genetic resources, genetic diversity, kinship, Pantaneira sheep, genetic variability
The naturalized sheep breed from Pantanal Sul Matogrossense stands out for its hardiness and adaptability to the
edaphoclimatic conditions found in this biome, possessing desirable characteristics to production systems such as
non-reproductive seasonality, greater hulls disease resistance and heat stress tolerance. The aim of this study was to
use microsatellites to evaluate genetic diversity and the use of a commercial panel in kinship tests in this population,
thus contributing with useful information for this genetic group conservation. Animals belonging to the Pantaneira
naturalized populations from the UFGD Experimental Farm (Dourados/MS) (n = 69) and from Embrapa Pantanal
(Corumbá/MS) (n = 58), and also Bergamácia breed sheeps (Jardim/MS) (n = 30) were genotyped with eight microsatellite
loci (CSRD247, HSC, OarAE129, MAF214, OarFCB304, OarCP49, SPS113, D5S2). The Pantaneira population
from UFGD showed the highest average number of alleles and allelic richness. The polymorphic information content
was highly informative in the studied loci, with a mean of 0.67. For all markers evaluated, the observed heterozygosity
was lower than the expected. Through the molecular variance analysis it was observed that the rate of differentiation
between the Pantaneira populations was low (5.24%), indicating greater similarity between them when compared with
the Bergamácia breed (14%). The combined exclusion probability for the Pantaneira population was > 99.71% while
for Bergamácia it was lower. These results indicate that although the observed values can aid in the paternity exclusion
within these populations, it is also necessary to increase the panel of markers to increase test accuracy. The database
obtained demonstrated the microsatellites potential as a tool for analysis of genetic diversity and similarity of the
Pantaneira sheep populations, contributing to better management and genetic management of locally adapted livestock.
Financial Support: FUNDECT, CAPES and UFGD
70
SEX-SPECIFIC SPLICING OF THE FEMINIZER
GENE IN THE STINGLESS BEE MELIPONA
INTERRUPTA (HYMENOPTERA: APIDAE)
Brito, DV1; Nunes-Silva, CG2; Carvalho-Zilse, GA3.
Programa de Pós-graduação em Genética, Conservação e Biologia Evolutiva, INPA, Manaus, AM; 2Instituto de Ciências
Biológicas, UFAM, Manaus, AM; 3Grupo de Pesquisas em Abelhas, INPA, Manaus, AM
1
[email protected]
Keywords: gene expression, splice variants, sex determination, stingless bees, alternative splicing
Sex differentiation is a crucial step in the development of most derived species of eukaryotes, since it strongly
affects the physiological, morphological and behavioral aspects of organisms. In insects in general, this process is
controlled by a pathway composed of a few main regulatory genes. The feminizer gene encodes a splicing regulator
protein that is required to maintain female differentiation pathway throughout development of the honeybee
Apis mellifera. However, all possible target genes and developmental features that are affected by fem expression,
and its role in other bees are still unknown. Here we sequenced fem transcripts of males, workers and queens of
the stingless bee Melipona interrupta. We found that fem is alternatively spliced into two sex-specific transcripts.
Female-specific transcript has a total of 1970 nucleotides, and an ORF with 1236 nucleotides. This splice
variant encodes a protein composed of 411 amino acids, which has 66% of similarity with female Fem protein
of A. mellifera. Male-specific transcript differentiates from the female one by an additional short exon in fourth
position, having a total of 2029 nucleotides. However, this extra exon contains a stop codon, so males have an
incomplete ORF (525 nucleotides). These characteristics are the same as found in fem sex-specific transcripts of Apis
mellifera. Therefore, it is likely that fem is also one of the genes that regulate sex determination in M. interrupta.
More studies are being made to understand the specific roles of fem gene in the development of M. interrupta.
Financial support: CNPq, FAPEAM and CAPES
71
CASTE SEGREGATION IN BEES
MELIPONA INTERRUPTA LATREILLE, 1811
(HYMENOPTERA: MELIPONINI) UNDER
DIFFERENT TEMPERATURES IN LABORATORY
CONDITIONS
Becker, T1; Carvalho-Zilse, GA2.
Programa de Pós-Graduação em Entomologia, INPA, Manaus, AM; 2Grupo de Pesquisas em Abelhas, INPA, Manaus, AM
1
[email protected]
Keywords: Thermoregulation; Stingless bees; Caste segregation; Melipona; Phenotypic expression.
Stingless bees are able to regulate the temperature inside the nest. This phenomenon is essential for the development of
the brood and protection of adults. However, there are records of wide variation in thermoregulation in different species
of Melipona bees. Bibliographic reports show that inefficient thermoregulation can alter the development of the hive,
leading to reduction in posture and consequently decreased production of queens. In Melipona bees, the production of
queens is genetically predetermined, based on the hypothesis of the occurrence of double heterozygous for two genes,
with two alleles each. It is expected, therefore, a production until ¾ of workers and ¼ of queens in optimal conditions
of feeding. However, this ratio is not constant in hives throughout the year, which reinforces the idea that the expression
of these genes can be influenced by environmental factors such as food availability and temperature. We aimed to
study the influence of temperature on the production of queens in Melipona interrupta. Colonies (n = 15) from GPA /
INPA Meliponary, under equivalent conditions of development, were selected and randomly divided into five groups:
control (ambient temperature), A (~ 25 °C), B (~ 32 ºC), C (~ 35 ºC) and D (~ 37 ºC), and the hives were kept in
acclimatized polystyrene boxes with temperatures regulated. The posture was monitored daily, and approximately 30
days after the start of the posture, brood discs were removed, and the immatures visually identified by sex and caste. The
segregation observed in the treatment groups were compared to the control group using the chi-square test (Χ2). Then,
the Χ2 values were submitted to analysis of variance with the temperature as independent variable to test its effect on
segregation. Based on preliminary results, was observed the segregation obtained in hives exposed to higher temperatures
were more different from the segregation obtained in control group than the segregation from hives exposed to lower
temperatures. The mean values of Χ2 obtained were: 1.079 (~ 25 °C), 3.234 (~ 32 °C), 5.042 (~ 35 °C) and 2.649
(control group). However, the differences were not statistically significant in the analysis of variance, with f = 0.604
and p = 0.622. Nevertheless, was also observed increased production of queens how much higher the temperature,
and in ~ 37 ºC there was a collapse in the hives and most individuals died indicating the influence of temperature
on maintaining the hive and consequently the production of queens in Melipona. Thereby, further investigations
are necessary in order to unravel at the molecular level, the probable effects of temperature on gene expression.
Financial Support: FAPEAM, CNPq
72
SINGLE STRAND CONFORMATIONAL
POLYMORPHISM IN EXON 3 OF LEPTIN GENE
AND ITS RELATION TO LAMB CARCASS
FEATURES
Gutmanis, G1; Soares, WVB1; Pinatti, E2; Herling, VR3; Pacheco, JCG3; Lacerda, RS3; Lara, MAC1
Unidade Laboratorial de Referência em Genética, Instituto de Zootecnia, APTA–SAA/SP, Nova Odessa, SP; 2Instituto
de Economia Agrícola, APTA–SAA/SP, São Paulo, SP; 3Faculdade de Zootecnia e Engenharia de Alimentos, USP,
Pirassununga, SP
1
[email protected]
Keywords: PCR-SSCP, ethereal extract, fat, meat quality, ovine
The LEP gene, that encodes leptin, is a potential molecular marker for animal production, as it presents polymorphisms
related to feed intake, energy metabolism, fertility, performance, yield and carcass finishing. The term finishing refers
to the amount of fat present in the carcass, which should be sufficient to confer desirable traits in beef such as
tenderness, juiciness and coloring. In sheep, however, this feature is limiting due to sensory quality, since excess
fat alters the taste of this meat. This study aimed to relate the polymorphism of exon 3 of LEP gene with the
thickness of fat and ethereal extract in carcass of 65 Santa-Inês x Dorper crossed sheeps. The animals were reared
under rotational grazing, supplemented individually according to their weights, being slaughtered at 210 days of
life. The fat thickness (EGS) was measured using a digital caliper in Longissimus dorsi muscle cutting, after cooling
the carcass for 24 hours. At the same muscle, a sample was taken for evaluation of ethereal extract (EE) by the
technique of organic solvent in Soxhlet extraction battery. The polymorphism analysis was performed by PCRSSCP technique. Genomic DNA was extracted from whole blood and amplified by PCR in two steps using two
primers sets, one outer which produced fragments of 640 pb, and other inner which generated specific products
of 471 pb. The samples of 471 pb were diluted in 1:10 ratio in a solution of 95% formamide, denatured (95°C, 5
minutes, followed by ice) and applied to 10% polyacrylamide gel (1:49).The gel was subjected to 450 V and 5°C
for 20 hours and at the end, stained with silver nitrate. SSCP analysis revealed in the investigated population the
presence of two alleles, named A and C, in frequencies of 0.812 and 0.188, respectively. Genotypes AA, AC and
CC occurred at frequencies of 0.659, 0.306 and 0.035, respectively, and, for statistical purposes, the CC genotype
was discarded because it occurred in only one individual. The analysis of variance showed significant differences
(P<0.05) of genotypes only for the characteristic EGS. Means of EGS and values of EE estimated for the AA and AC
genotypes were 1.08 mm and 1.35 mm (P<0.04) and 21.19% and 22.97% (P>0.27), respectively. The average effect
of allelic substitution presented values in EGS -0.3643 ± 0.1735 and in EE -2.5246 ± 2.2752. These results indicate
that AA homozygous animals have carcass with less subcutaneous fat compared to heterozygous AC, suggesting
that the allele A may be associated with leaner body, being of great interest to the sheep industry. These findings
should be investigated in a larger sample, to confirm the relationship of this polymorphism with the evaluated traits.
Financial Support: FAPESP 2010/06542-1
73
ANALYSIS OF THE PATTERNS OF WING
VENATION AFRICANIZED HONEY BEES IN
NORTHEASTERN BRAZIL
Moretti, JM¹, Francoy, TM 2
Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto - USP, Ribeirão Preto, SP; 2Escola de Artes, Ciências e
Humanidades – USP, São Paulo, SP.
1
[email protected]
Keywords: Geometric Morphometrics, Apis mellifera, honey bees
It is estimated that there are more than 20,000 bee species worldwide, while Brazil is home to about a quarter of
these species. In its native distribution, Apis mellifera bees exhibit numerous morphological, behavioral and ecological
differences that allow them to inhabit the most diverse environments. With the introduction of African bees A. m.
scutellata in Brazil in 1956 poli-hybrid populations called Africanized honeybees appeared that become interesting for
various economic activities and essential for beekeeping in Brazil. A place that presents itself as a good candidate for
understanding the population dynamics of the Africanized bee is the Brazilian Northeast, which has recently made
great strides in the field of beekeeping. Morphometric evidence has been used to estimate the genetic composition
of these bees. Geometric morphometrics of wings a fast, inexpensive and widely used technique for identification
and evaluation of diversity in bee populations. This methodology is based on the use of homologous landmarks in
forewings to identify variations in patterns of wing venation between species and the identification of shape variations
in different specimens of the same species. In this context, this work aimed to evaluate the variability of A. mellifera
populations from different localities of northeastern Brazil by geometric morphometrics analysis. Ten workers were
collected from 20 colonies in three different regions in the states of Alagoas, Rio Grande do Norte and Piauí. To
analyze the pattern of wing venation were used five workers per colony, and scored 19 anatomical landmarks on each
wing, the data were analyzed using MorphoJ software. The cross-validation test correctly identified 65,87% of the
individuals within their respective areas. The mantel test between geographical distances and morphological distances
showed a very low correlation (r = 0.10) and not significant (P = 0.236). This lack of population structure is probably
related to high gene flow between populations, probably due to high rates of swarming during the drought season in
the northeast. Other factors also likely involved are strong migratory beekeeping in the region and, to a lesser extent,
the trade of buying and selling queens and swarms.
74
MITOCHONDRIAL GENE SEQUENCES FOR
IDENTIFICATION OF ANIMAL SPECIES
Oliveira, JA1; Crispim, BA1; Dourado, PLR2; Silva, DBS1; Grisolia, AB1
Faculdade de Ciências Biológicas e Ambientais, UFGD, Dourados, MS; 2Faculdade de Ciências Exatas e Tecnologia,
UFGD, Dourados, MS
1
[email protected]
Keywords: Maternal lineage, 16S rRNA, sequencing
Molecular techniques for classification and identification, such as the sequencing of conserved genes, are contributing
significantly to the understanding of phylogenetic relationships among different species. Molecular markers based on
mitochondrial DNA (mtDNA) have maternal inheritance, unlike the biparental inheritance that occurs with nuclear
markers. As maternal inheritance is highly conserved in many of the genes located in the mitochondrial genome,
these markers can be used to solve the relations spanning very long periods of time and evaluate phylogenetic and
taxonomic issues. The kinship diagnosis of living beings can be performed by genomic analysis of the 16S ribosomal
RNA (16S rRNA). The aim of this study was to evaluate the 16S rRNA gene of mtDNA potential to identify different
animal species and determine the degree of genetic similarity among individuals. A total of 13 animals were used being
5 sheep, 4 cattle and 4 fish. DNA was extracted from blood (sheep and cattle) and fin fragments (fish) to perform the
amplification of the mtDNA region. The samples were purified and sequenced on an ABI 3730 XL automated sequencer
(Applied Biosystems). The sequences alignment, the genetic distance calculations and the phylogenetic tree were made
with MEGA 5.10 and then were checked using BLAST. The sequences were identified on GeneBank so 5 belonged
to Ovis aries, 4 to Bos taurus, and the others belonged to the following species of fish: Prochilodus lineatus (curimba),
Pseudoplatystoma corruscans (pintado), Pseudoplatystoma reticulatum (cachara) and Leporinus obtusidens (piau). The
genetic distance within each group was 0,01 for cattle, 0,02 for sheep and 0,17 for fish. The distance between the
different animal groups was also calculated being: cattle/sheep = 0,10, cattle/fish = 0,66 and sheep/fish = 0,65. In the
phylogenetic tree it was possible to identify the existence of two classes: Mammalia (mammals) and Actinopterygii
(fish). Within the Mammalia class we observed two subfamilies: Bovinae and Caprinae, and in the Actinopterygii class
we observed two orders: Caraciforme (curimba and piau) and Siluriforme (pintado and cachara) while the last ones
also belong to the same genus. The mtDNA molecular markers technology can be used as an additional tool for species
identification and differentiation thereby assisting the work of taxonomists, as it was possible to observe in the results
found for fish in the present study. Thus, the partial sequencing of the 16S rRNA gene of mtDNA was sufficient for the
identification of cattle, sheep and different species of fish in this study, based on the similarity of that gene in BLAST.
Financial Support: Fundect and Universidade Federal da Grande Dourados (UFGD).
75
MOLECULAR TOOLS IDENTIFY FRAUD IN THE
MARKETING OF YELLOWFISH (CYNOSCION
ACOUPA, SCIAENIDAE) FILLETS
Carneiro, J; Sodré, KA; Schneider, H; Sampaio, I.
Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus de Bragança.
[email protected]
Keywords: Fraud labeling, Fish fillets, 16S, multiplex PCR, Hake yellow.
The fish trade is one of the most important activities for the world economy, which are primarily used as a food source.
With the improvement in techniques of food preservation, the fishing industry was modernized, and the fish began to
be marketed in several ways, among them, the fillet processing, one of the fastest growing in the world, mainly due to the
convenience offered to consumers. In contrast, recent studies have found a high incidence of fraud in the marketing of
fish fillets worldwide. One reason is that after processing, it becomes impossible to identify the species by morphological
characters. Another reason would be financial issues, since in most cases the fillet packing is a fish species of lower
commercial value. Cynoscion acoupa is one of the most prized marine species in Brazil, popularly known as yellowfish,
which is the highest commercial value of the Sciaenidae. The present study aimed to certify by molecular methods a
sample of 104 fillets labeled as yellowfish commercialized in Belem (Para) in 2011 and 2012 years. Was sequenced a
segment of 600 bp of the mitochondrial gene 16S rDNA. Levels of similarity equal to or higher than 99% compared to
sequences deposited in GenBank were used for species identification. Our results showed that only 15.38% of the fillets
were of the species Cynoscion acoupa. The remaining 84.62% were species of lesser commercial value of the Sciaenidae:
Cynoscion virescens (croaker, corvina), Cynoscion microlepidotus (croaker, corvina), Plagioscion auratus (black corvina)
and Plagioscion squamosissimus (white corvina). From the sequences obtained in this study, we developed specific
primers for each species identified, allowing the use of multiplex PCR, as an alternative to sequencing tool, having a
lower cost and faster results. This substitution levels observed in our study are among the highest ever reported, and
opens an alert to the need for a review of procedures for the marketing of these derivatives fisheries, in order to protect
consumers. Our work also demonstrates the importance of forensic genetics as a tool for socioeconomic applicability.
Support: CNPq, CAPES, UFPA.
76
INTEGRATED ANALYSIS OF THE
TAXONOMICALLY CHALLENGING GENUS
RHAMPHICHTHYS THROUGH DNA
BARCODING AND KARYOTYPING
Rocha, ACG1; Oliveira, SB1; Silva, PC da2; Nagamachi, C2; Figueiredo-Ready, WMB1; Pieczarka, JC2 ; Ready, JS1.
Instituto de Estudos Costeiros, UFPA Campus de Bragança, Bragança, PA; 2Laboratório de Citogenética, Instituto de
Ciências Biológicas, UFPA, Belém, PA
1
[email protected]
Keywords: Gymnotiformes, cryptic species, DNA barcoding, karyotype, Amazon
The genus Rhamphichthys (Gymnotiformes) includes large bodied (generally >50cm SL) sand knife fishes found
throughout the Amazon, Orinoco and Parana basins. Despite description of three new species in 1999, there is still
a degree of uncertainty over the taxonomic status of many species and populations. This is partially a result of their
relative rarity in collections, likely a result of their large size, and the general overall similarity between described
species in terms of colour pattern and habitat. Intensive sampling of members of this genus from the Lower Amazon
and from Mamirauá permitted a comparative analysis of genetic diversity through DNA barcoding with investigation
of karyotypic description. In addition to available CO1 sequences of R. hahni downloaded from GenBank, new
samples from the Amazon indicate at least three very distinct lineages (>3% pair-wise divergence between the most
similar lineages). The lineages with greatest similarity are sympatric in the Lower Amazon but also differ in the
karyotype presented. Although both lineages present 2n=50, one lineage presents additional microchromosomes and
the other lineage does not, suggesting a possible mode of sympatric speciation with reproductive isolation through
post-zygotic incompatibility. A third lineage with even greater divergence (>8% pair-wise divergence) is encountered
from Mamirauá in the Central Amazon basin. Morphological investigation of the samples has, as yet, not been able
to identify clear diagnostic characters for these lineages. While it is possible that the microchromosomes may be
indicative of a speciation event, the inclusion of further samples from other geographic regions and more detailed
analytical techniques will be essential to further analyse the processes which have led to speciation in this genus.
Financial Support: CNPq, FAPESPA
77
A PROTEIN-FREE DIET IMPACTS FAT BODY
TRANSCRIPTOME AND ACCELERATES AGING
IN WORKER HONEY BEES
Martelli, FS1; Pinheiro, DG2; Simões, ZLP2; Nunes, FMF3
Departamento de Genética – Faculdade de Medicina de Ribeirão Preto –USP; 2Departamento de Biologia – Faculdade
de Filosofia, Ciências e Letras de Ribeirão Preto – USP; 3Departamento de Genética e Evolução – Centro de Ciências
Biológicas e da Saúde – UFSCar
1
[email protected]
Keywords: honey bee, aging, diet, mRNA, expression profiles
Nutrition is crucial for ontogenesis and survival, and it plays a key role in aging processes associated with oxidative
stress, DNA damage, and inflammation. While it is known that nutritional metabolism and the aging are directly
linked, the underlying molecular mechanisms remain unresolved. Insect models have contributed to our understanding
of this phenomenon; in flies, high sugar levels induce cellular senescence and excess essential amino acids decreases
lifespan. Honey bee (Apis mellifera) worker is a useful model for this area of research, because its diet is restricted to
carbohydrate-rich nectar and/or protein-rich pollen, depending on its behavioral status. Along this line, we looked
at whether a protein-free diet influences the transcriptome of the fat body, a nutrient-sensing tissue of honey bees.
Newly-emerged workers were confined in separate laboratory cages maintained at 34ºC and 80% humidity. One
group received a protein-rich diet (70% pollen and 30% sucrose, w/w), while the other was fed with sugar syrup
(50% sucrose solution in water, w/v). After 7 days, total RNA from the head and the abdominal fat body were
isolated. To determine if diets trigger different phenotypes, we performed RT-qPCR to evaluate levels of vitellogenin,
a phospholipoglicoprotein with pollen-dependent expression. As expected, workers fed only sucrose solution had
significantly lower rates of vitellogenin transcripts in fat bodies (ANOVA one-way and Tukey post-hoc test, p<0.01).
In addition, there was a significant decrease in vitellogenin expression in response to the carbohydrate diet in the
head. Thereby, indicating that vitellogenin gene could be a marker of nutritional status in different tissues as well
as demonstrating molecular interactions between the brain and the fat body. We then prepared fat body pools in
triplicate for each diet type. High-throughput RNA sequencing of the six samples was performed using an Illumina
platform. Around 30 million reads were obtained per sample. We used TopHat algorithm to map the reads to the
honey bee reference genome (version 4.5). Next, we run Cufflinks package to assembly transcripts, to estimate the
abundance (FPKM index) and to test for differential gene expression. Forty differentially expressed genes were found,
32 being down- and 8 up-regulated in bees fed with a protein-free diet compared to bees fed a protein diet. In
the down-regulated genes, we found a set of genes linking aging progression, hormonal signaling and carbohydrate
metabolism (cytochromes P450, very high density lipoprotein, hexamerins, vitellogenin, odorant binding proteins,
juvenile hormone esterase, alcohol dehydrogenase, glutathione S-transferase, and carboxylesterase). On the other
hand, up-regulated genes are mainly enzymes related to glycolysis and lysosome activity. In conclusion, we found that
a protein-free diet accelerated senescence, i.e. 7-day-old bees were physiologically similar to old foragers. These results
add new information concerning mechanisms controlling social organization, opening new avenues of investigation.
Financial support: FAPESP (2011/03171-5, 2012/02757-9), CAPES and CNPq
78
STUDY OF THE ESTERASE PATTERN IN AEDES
AEGYPTI FROM SÃO JOSÉ DO RIO PRETO, SP:
A GROUP OF BANDS PUTATIVELY INVOLVED
IN THE DEVELOPMENT OF INSECTICIDE
RESISTANCE
Bicudo, HEMC1; Pólo, AM1; Guirado, MM1;
Instituto de Biociências, Letras e Ciências Exatas - IBILCE, UNESP, São Paulo, SP
1
[email protected]
Keywords: esterase bands frequency, degree of esterase bands expression
We are analyzing the esterase pattern of Aedes aegypti (A. aegypti) from São José do Rio Preto (SJRP), SP. This mosquito
population has been submitted to analysis for this purpose since 1998. During this time, four studies have been
performed (1998; 2003; 2006; and 2011). In all of them, polyacrylamide gels were used for detecting the esterase
bands which were stained with α and β naphthyl acetates, aiming at their rank in α, β and αβ esterases, according
with the acquired colour (black, red and magenta, respectively). The number of mosquitoes used varied in the different
analyzes; in the present study we used 200 L4 larvae. Inhibitors used for biochemical analysis allowed the classification
of the bands in A. aegypti from SJRP as carboxylesterases and cholinesterases. The comparison of results obtained in
the four studies shows that some bands were found in every study while others varied. In the first case are included
the β bands EST-19 to EST-21 and the α bands EST-12 to EST-14 and EST-1 to EST-7. Bands that deserve special
mention are the αβ cholinesterases located in the most distal region of the gels. These bands have been correlated with
the development of the insecticide resistance in the A. aegypti population from SJRP. These bands were not found
in the first analysis of the mosquitoes (1998), although 162 larvae were examined. In the second analysis (2003)
they were detected with low frequency (1.5 to 13.8%). In the third study (2006) the frequency increased to 52%.
In the present analysis (2011) another increase was observed (69.5%). During the time elapsed since 1998, the A.
aegypti population from SJRP was classified by the Superintendência de Controle de Endemias (SUCEN) as to the
insecticide resistance, from susceptible population to population in resistance development and next to resistant population.
This occurred in parallel to the changes of the frequency of expression of the αβ bands. Another argument useful to
consider this group of bands as related to resistance in this population is that, in the second analysis (2003), in which
the αβ bands were present with low frequency in SJRP, another population (from Goiânia) analyzed simultaneously
and considered resistant presented high frequency of these bands (65 to 87%). Taking into account these and other
arguments, we may consider that the insecticides (pyrethroids and organophosphates) that have been used in SJRP
since the 90 decade for A. aegypti population control is still generating increased resistance. In the continuation of this
work we will perform the sequencing of the αβ group of bands in search for confirmation of their relationship with
resistance.
79
DETERMINATION OF AT GC BASE
COMPOSITION BY FLOW CYTOMETRY IN
BEES
Soares, FAF1; Carvalho, CR1; Tavares, MG1.
Laboratório de Citogenética e Citometria, Departamento de Biologia Geral, Universidade Federal de Viçosa, Viçosa, MG
1
[email protected]
Keywords: DNA content, FCM, genome size, base composition, bee
The genomic size determination and AT GC base composition should be considered an important factor in analyses
to genetic characterization, or even in studies of molecular biology and phylogenetic interpretations. Flow cytometry
(FCM) has emerged as a tool for quantification of nuclear DNA content and characterization of base composition
in many plant and animal groups, including insects. Considering the hymenopterans, about 100 species had
their DNA content determined, and 46 % of them are stingless bees. This work aimed to detail the procedure
for DNA quantification and to develop methodology for determining the AT and GC base composition by FCM
in bees. It will increase the number of species with DNA content determined and provide an effective genomic
characterization procedure. Scaptotrigona xantotricha (2C = 0.88 picograms) has been used as internal standard to
DNA content determination. In this sense, we determined the AT GC proportion of that bee to also be used as
standard in base composition analyses. Thus, the DNA content and base composition was estimated for Trigona
hyalinata and Partamona rustica. The histograms generated in the FCM showed coefficients of variation below
than 5.0 % and enabled the determination of the nuclear DNA content and AT GC proportion. P. rustica and T.
hyalinata showed 1.15 and 1.07 picograms of DNA, respectively. S. xantotricha presented 61.32 % of bases AT
and 38.68 % of GC; P. rustica presented AT = 62.82 % and GC = 37.18 %, T. hyalinata presented AT = 62.40
% and GC = 37.60 %. This work details the protocol for nuclear DNA quantification by FCM, contributing to
increasing the number of species of DNA content determined. Also provides methodology for determining the
base composition AT and GC bees using FCM. This new technique can be applied to other bee species or even
other hymenopterans insects, in order to provide relevant data for genomic characterization and genetic analyses.
Financial support: CNPq, FAPEMIG and CAPES
80
CHROMOSOMAL MAPPING OF THE 5S RDNA
AND H3 HISTONE GENE IN THE GRASSHOPPER
RHAMMATOCERUS BRASILIENSIS FROM
DISTINCT POPULATIONS OF THE STATE OF
PERNAMBUCO
Melo, SA¹; Cabral-de-Mello, DC2, Moura, RC¹
¹Laboratory of Genetics and Biodiversity of Insects, ICB, University of Pernambuco, Brazil; 2Grupo de Estudos em
Citogenômica e Evolução Animal, Univ Estatual Paulista, Rio Claro, Brazil
[email protected]
Keywords: Acrididae, multigene families, FISH
The chromosomal organization of 5S ribosomal DNA (rDNA) and H3 histone multigene families have been
recently studied in grasshoppers, in particular in Acrididae representatives. The sites of 5S rDNA sequences has been
located in one or all chromosomes in analyzed species to date, which characterizes the variability and dispersion
of 5S rDNA sequences in this group. Different from that observed for the 5S rDNA, mapping of H3 histone has
shown high conservation in relation to number of sites, with most species presenting only one chromosome pair
bearing this sequence. However, in Rhammatocerus brasiliensis was observed the dispersion and co-localization of 5S
rDNA and H3 histone sites 5S and H3 in ten of eleven autosomes pairs and in the X and B chromosomes. Here
we analyzed 17 specimens of R. brasiliensis collected in five locations of Pernambuco, Brazil, through fluorescence
in situ hybridization using probes for 5S rDNA (5 of 17 individuals) and H3 histone (17 individuals). The H3
histone gene was located in the autosomal bivalent M7 in all individual (five from Vitória de Santo Antão, four
from Itamaracá, three from Surubim, two from Serra Talhada and one from Lagoa do Carro). On the contrary, the
analysis of the 5S rDNA sequences showed differences in the number and location of sites: (1) occurrence of sites
in five autosomes, observed in two individuals from Itamaracá) and (2) sites located in four autosomal bivalents in
one individual from Surubim, one from Serra Talhada and one from Itamaracá. For the five individuals analyzed
through two color FISH, three showed marks in the M7, which presented co-located with the site of H3. The results
indicate that the primary site of histone H3 in R. Brasiliensis is located in autosomal bivalent M7 and that the 5S
rDNA is located possibly in the pair L2 or L3, so all individuals analyzed in two published studies and this study
present sites in these chromosomes. The dispersion of the sites occurs independently of co-location, showing that
evolutionary forces act differently in the dispersion of the sequences of the gene families of 5S rDNA and histone H3.
Financial Support: CNPq, FAPESP and FACEPE
81
EFFECTS OF CLIMATE CHANGES IN TWO
CONGENERIC ORNAMENTAL FISH OF THE
AMAZON: PARACHEIRODON AXELRODI AND
PARACHEIRODON SIMULANS
Fé, LML; Campos, DF; Castro, NS; Paula-Silva, MN; Val, AL; Almeida-Val, VMF.
Laboratório de Ecofisiologia e Evolução Molecular (LEEM), Manaus, AM; Coordenação de Biodiversidade (CBio), Manaus,
AM; Instituto Nacional de Pesquisas da Amazônia (INPA), Manaus, AM
[email protected]
Keywords: IPCC scenarios, cardinal tetra, green neon tetra, survival, LDH
The carbon dioxide (CO2) is the most important anthropogenic greenhouse gas. Its increase continues to contribute to
global warming and influences the climate changes. Such as our Planet, the Amazon region is considered vulnerable to
the severe global changes, and is becoming hotter and drier. These environmental challenges affect all organisms of the
region, including fish and other aquatic species. Herein we investigate the effects of the environmental scenarios provided
by the 4th IPCC Assessment Report for the year of 2100 on the fish survival, and their changes in Lactate Dehydrogenase
(LDH) genes expression. The congeneric species Paracheirodon axelrodi (cardinal tetra) and Paracheirodon simulans (green
neon tetra) are ornamental fish and inhabit similar environments differing in medium temperature along the year. Adult
specimens of cardinal tetra and green neon tetra were kept for 30 days in simulated climate scenarios: the microcosms,
which are four environmental rooms where temperature, CO2 concentrations, air humidity and photoperiod cycle are
controlled. Each room simulates the three major climate scenarios provided by the Intergovernmental Panel on Climate
Change (IPCC): mild/low (B1), moderate/medium (A1B) and dramatic/high (A2), as well as the current scenario
provided by a control room. After the 30 days exposure to those scenarios, the cardinal tetras survival was lower than
the green neon tetras. Species-specific differences in the expression of ldh-a and ldh-b genes suggest that cardinal tetra
is more dependent of the anaerobic metabolism than green neon tetra at first contact (two days) with the simulated
climate conditions. On the other hand, a reorganization of the energy metabolism can be observed in both species
after 30 days acclimatizing to the IPCC scenarios, suggesting that the activation of anaerobic glycolysis is necessary for
energy maintenance in both species. The molecular adjustments in the levels of LDH in these congeneric species reveal
the survival and biochemical adaptation strategies to face environmental changes projected for the end of the century.
Financial support: CNPq/FAPEAM, INCT/ADAPTA.
82
CHROMOSOME PAINTING ELUCIDATES
COMPLEX REARRANGEMENTS AMONG
ORYZOMYINI SPECIES FORMERLY REPORTED
WITH CONSERVED KARYOTYPES (RODENTIA,
SIGMODONTINAE)
Moreira, CN1; Yonenaga-Yassuda, Y1; Ventura, K1
1
[email protected]
Keywords: Chromosome painting, chromosomal evolution, inversions, Oryzomyini, translocations
Oryzomyini displays a range of morphological diversity hardly surpassed by other muroid groups of equivalent
taxonomic rank and cytogenetic studies evidence an exceptional range of 2n and FN, polymorphism of autosome and
sex chromosomes and supernumerary system. However conserved karyotypes with minor structural rearrangements,
an exceptional condition in Neotropical rodents, are suggested to occur in Holochilus brasiliensis (HBR), Nectomys
squamipes (NSQ) and Pseudoryzomys simplex (PSI), with 2n=56, and Nectomys rattus (NRA), with 2n=52. This four
species are close related and the three genera share morphological specializations towards a semiaquatic lifestyle.
Herein, ZOO-FSH with whole chromosome probes (WCP) of HBR obtained by flow sorting allowed consistent
elucidation of multiple rearrangements in these species being successful in highlightening microchromosomal
rearrangements. The hybridizations of the 27 autosomal set of HBR-WCP permitted that pericentric inversion or
centromeric shift involving the metacentric HBR 27 and the acrocentric PSI 21 was detected between HBR and
PSI and three tandem rearrangements and one paracentric inversion were evidenced between the two Nectomys
species. Considering more distantly related HBR and NSQ, 34 homologous segments were observed, suggesting
a notorious occurrence of 11 tandem events or five translocations plus one tandem rearrangement. Whole X
chromosome homology was detected, while on Y the homology was partial. Chromosome painting proved to
be essential in establishing a new scenario for Oryzomyini chromosome evolution, revealing species with highly
rearranged genomes even if they present the same 2n, FN, chromosome morphologies and similar banding patterns.
Financial Support: CAPES, CNPq, FAPESP and Instituto de Biociências-USP
83
KDR MUTATION IN NATURAL POPULATIONS
OF CULEX QUINQUEFASCIATUS (SAY 1803)
FROM BRAZIL
Steinhagem, FS1; Lima, JBP1; Martins, AJ1,2
Laboratório de Fisiologia e Controle de Artrópodes Vetores/ Instituto Oswaldo Cruz/ Fiocruz – Rio de Janeiro/ RJ –
Brazil; 2Instituto Nacional de Ciência e Tecnologia – Entomologia Molecular
1
e-mail: xxxx
Keywords: kdr mutation, Culex quinquefasciatus, pyrethroid resistance
Pyrethroids insecticides target the voltage gated sodium channel (NaV) from neuronal axons of insects, triggering
repetitive convulsions followed by paralysis and death – the knockdown effect. Intense application of these compounds
has been selecting resistance in a number of important species for health care and crop production. A punctual mutation
in the Nav gene (Leu1014Phe) is related to pyrethroid resistance in insect of several orders, being usually referred to as
kdr mutation (knockdown resistance). Therefore diagnostic of the kdr mutation is being adopted as an important tool
to infer pyrethroid resistance in disease vector mosquitoes, for instance. The control of Culex quinquefasciatus, vector
of lymphatic filariasis in some Brazlian localities, is mainly based on an intensive use of pyrethroids against the adult
stage. However, the NaV gene diversity of C. quinquefasciatus Brazilian populations was not known so far. Herein, we
explored the nucleotide sequence of the homologous region spanning the kdr mutation site in C. quinquefasciatus, by
cloning and sequencing pools of DNA extracted from natural populations. State Secretary of Health personnel kindly
provided some mosquitoes samples. The kdr classical mutation Leu1014Phe was found in samples from Campo
Grande/ MS. Additionally, based on the nucleotide diversity observed, we developed an allele-specific based PCR in
order to individually genotype mosquitoes from different localities. This technique was able to discriminate 1014 Leu
and 1014 Phe, respectively wild-type and mutant alleles, in either a polyacrylamide gel electrophoresis or a melting
curve analysis determined by real-time PCR reaction. To date, we genotyped more than 400 individuals throughout
the country: Oiapoque, Perpétuo Socorro and Capivara (AP State); Natal (RN State); Campo Grande (MS State);
Belo Horizonte (MG State); Duque de Caxias, Nova Iguaçu and Rio de Janeiro (RJ state). The highest kdr allele
frequency was found in Rio de Janeiro. We are now evaluating more individuals from other localities. Our perspective
is that the determination of NaV molecular diversity of C. quinquefasciatus natural populations might be applied as an
important tool for the monitoring of pyrethroid resistance.
84
IDENTIFICATION BY PCR-RFLP AND PCR
MULTIPLEX OF TWO SPECIES OF THE GENUS
STRAMONITA (MOLLUSCA, GASTROPODA,
MURICIDAE) ALONG THE COAST OF SÃO
PAULO, BRAZIL
Lima, CKZH, De Biasi, JB, Hilsdorf, AWS
Laboratório de Genética de Organismos Aquáticos e Aquicultura, Núcleo Integrado de Biotecnologia, Universidade
Mogi das Cruzes.
[email protected]
Keywords: PCR-Multiplex, PCR- RFLP, COI, ITS, primers
In Brazil, two subspecies are found: Stramonita haemastoma haemastoma and Stramonita haemastoma floridana. They
are morphologically recognized by their sizes and their seashell ornament, possibly also by their inside anatomy. This
genus has several synonyms because of its wide geografic distribution, which means much controversial taxonomy.
They are important playing an important role in the coast rocky ecosystem biota structure by controlling the density
of sessile organisms. In a recent study, accomplished with samples of organisms of the Stramonita genus taken
along the São Paulo coast, it was shown that those two subspecies can be separated into two congeneric species
by molecular analyses. The species S. brasiliensis specie, before described as S. h. floridana, is valid according to
other authors, whereas S. h. haemastoma specie has shown difficulties for taxonomic identification, therefore herein
designated as Stramonita sp. Along the São Paulo coast, thse two species are commonly known as “saquaritá”. Its
economic value is related to littoral communities for feeding and fishing bait. Indiscriminate collection without
species identification can bring damages for population integrity of one or both species. In order to have a quickly
identification of the two species, PCR-Multiplex and PCR-RFLP were applied. The DNA was extracted from
muscle samples of individuals from three places of the coast of São Paulo, Brazil. A fragment of 700 bp from COI
was amplified by PCR with the primers 5’ CAAATGGTCCTTTTCTTGTTGTTACAGGGAGCTTAAGGC
3’ and 5’ CTTTAAACTCATTGGCAAACTTTTC3’ and for gene ITS a fragment of 1.200 bp was amplified
by PCR with the primers 5’ CAAATGGTCCTTTTCTTGTTGTTACAGGGAGCTTAAGGC 3’ and 5’
CTTTAAACTCATTGGCAAACTTTTC3’. The COI PCR-RFLP was carried out using the restriction enzymes
PsiI and CviAII. PCR-RFLP resulted diagnostic bands for species discrimination. These two methodologies
were capable to identify the two Stramonita species which is an important step to assess and monitor the
population composition to establish management programs for sustainable use of these marine resources.
Financial support: PIBIC/UMC e FAPESP.
85
ASSESSMENT OF GENETIC VARIABILITY
IN POPULATIONS OF LAND CRAB, UCIDES
CORDATUS (LINNAEUS, 1763), IN THE
CENTRAL COAST OF SÃO PAULO, BRAZIL
Prado, JB¹; Faria, FCR¹; Hilsdorf, AWS¹
¹Laboratório de Genética de Organismos Aquáticos e Aquicultura – UMC, Mogi das Cruzes, SP
[email protected]
Keywords: Land crab, Ucides cordatus, Brachyura, PCR-RFLP, mtDNA.
Ucides cordatus (Linnaeus, 1763) (Brachyura: Ucidedae), popularly known in Brazil as the land crab, catanhão, crab of
the mangrove or crab true, is an endemic species of the Atlantic coast U.S., occurring in Florida (USA) to Santa Catarina
(Brazil), Traditional communities in several Brazilian states use this species as alternative source of income and food. The
consumer market of land crab became the vulnerable species, increasing their exploitation causes a drastic reduction
of fish stocks along the Brazilian coast and as a result the species was classified as threatened with overexploitation on
the National List of Species Aquatic Invertebrates and Fish. The establishment of appropriate management policies
requires a thorough knowledge of biological characteristics of populations managed, in particular on the geographical
distribution of genetic variability and gene flow between populations. These are the basic information, since that function
as predictive models of population vulnerability. The present study aims to assess the existence of genetic differences
between different populations of the coast. To obtain these results we used the PCR-RFLP in the mtDNA control
region. The molecular data were obtained from the extraction of genomic DNA from muscle tissues. The fragments
were amplified by PCR and digestions were performed using restriction enzymes MboI, AluI, DraI and HinfI. The
visualization of the bands resulting from the enzymatic digestion was carried out in agarose gel and stained with 2.0%
ethidium bromide. The PCR-RFLP showed considerable genetic variability in populations sampled from U. cordatus,
which can be used in identifying intra-specific groups, and it is essential to understand the population dynamics
of the land crab and sustainable exploitation as U. cordatus has great commercial value and increasing exploitation.
Financial Support: CNPq/UMC
86
MICROSATELLITE CROSS-AMPLIFICATION
SHOWS A HIGH VARIABILITY IN A CRITICALLY
ENDANGERED BIRD ENDEMIC TO SÃO
PAULO STATE, THE SÃO PAULO MARSH
ANTWREN, FORMICIVORA AFF. ACUTIROSTRIS
(PASSERIFORMES: THAMNOPHILIDAE)
Camargo, C1; Costa, MC2; Del Rio, GC3; Silveira, LF3; Wasko, AP1; Francisco, MR2.
Instituto de Biociências de Botucatu, Universidade Estadual Paulista “Júlio de Mesquita Filho” – UNESP, Botucatu, SP;
Departamento de Ciências Ambientais, Universidade Federal de São Carlos, Campus Sorocaba, Sorocaba, SP; 3Museu
de Zoologia da Universidade de São Paulo, MZUSP, São Paulo, SP
1
2
[email protected]
Keywords: Conservation Genetics, São Paulo Marsh Antwren, microsatellite markers, effective population size, Thamnophilidae
The São Paulo Marsh Antwren (Formicivora aff. acutirostris) is an endemic species of São Paulo State (Brazil) that was
recently discovered in the metropolitan region of São Paulo city. It occurs in restrict fragments of natural wetlands, and
especially due to its habitat destruction (a fact that is correlated to hydroelectric dam constructions, forest fire, and exotic
species introduction), it has been already considered as “critically endangered” in the Red Book of Endangered Fauna
of São Paulo State. One conservation approach to this species refers to genetic analyses of its populations in order to
establish a monitoring and management program. Population genetics can be an important tool in animal conservation,
providing information about the genetic variation, gene flow levels, and also effective population size. Among several
molecular markers commonly used to evaluate genetic diversity, microsatellites are extremely informative, although
they are commonly very costly and time consuming to be developed. An alternative approach is to use heterologous
microsatellites primers on PCR to analyze a species that does not have its microsatellite loci described yet. Therefore,
one goal of this project was to test heterologous loci from the Chestnut-Backed Antbird (Myrmeciza exsul) in F. aff.
acutirostris and analyze individuals from what is believed to be the largest fragment in which the species occur. The DNA
extraction was conducted through a phenol protocol and 26 heterologous primers were tested. The loci amplification
and polymorphism were analyzed in agarose and polyacrylamide gels, respectively. Linkage disequilibrium and allelic
richness were analyzed in FSTAT, and expected and observed heterozygosities were calculated in GENEPOP computer
program. The effective population size was estimated by ONeSAMP. Among 26 heterologous loci, 24 were able to be
amplified and 10 were polymorphic (loci ME19, ME41, ME47, M024, M034, M089, M120, M140, M162, and M176),
with the number of alleles ranging from 4 to 18 (N = 24 individuals). The average allelic richness was 7.8 (4.0-17.0),
and there was no evidence of linkage disequilibrium among loci. The average expected and observed heterozygosities
were, respectively, 0.76 (0.53-0.93) and 0.69 (0.55-0.88), and just one locus (M024) presented a significant deficit
of heterozygous (P = 0,005). The estimated effective population size ranged from 51 to 300 individuals. Although
these results indicated that the analyzed population of F. aff. acutirostris has a high genetic variability, a management
and conservation program should be developed for the species, since these animals are found on urban wetland
areas. Besides, the obtained data can provide subsidies for the creation of a protected area in its distribution range.
Financial Support: FAPESP (Ref. Proc. Nº 2012/09105-7)
87
MICRORNAS IN MUSCLE DEVELOPMENT OF
NILE TILAPIA
Nachtigall, PG1; Dias, MC2; Martins, C2; Pinhal, D1
Departmento de Genética, Instituto de Biociências, UNESP, Botucatu, SP; 2Departmento de Morfologia, Instituto de
Biociências, UNESP, Botucatu, SP.
1
e-mail: xxxx
Keywords: microRNA, muscle, Oreochromis niloticus, gene expression, non-coding RNA
The Nile tilapia (Oreochromis niloticus) is one of themost important farmed fish in fresh water aquaculture. In fishes,
the body mass gain results mainly from the growth of skeletal muscle once this tissue is about 60% of their body mass.
Their skeletal muscle is characterized by three distinct layers: the white muscle (fast-twitch fibers), the red muscle
(slow-twitch fibers) and the transitory muscle (white-red mixed fibers). However, little is known about the molecular
mechanisms responsible for the skeletal muscle development, growth, differentiation and maintenance in O. niloticus.
Recently, a class of small non-coding RNA molecules highly conserved through metazoan, the microRNAs (miRNAs),
has shown to be key regulators in several cell-specific functions and homeostasis. In the skeletal muscle, the musclespecific miRNAs, also called myomiRs, interact each other within a complex network profile which plays important
regulatory roles by targeting genes related to proliferation, differentiation, regeneration, ageing, homeostasis, disease
and embryonic development. The present study was designed to investigate the expression of myomiRs on different
time points during Nile tilapia embryogenesis. Real-time quantitative PCR (qPCR) analyses were carried out for
the detection of four myomiRs (miR-133a, -133b, -206 and -499) in the embryonic stages of 1, 3, 5 and 10 days
post-fertilization (dpf ) and in the red and white skeletal muscles from adults. The qPCR data reveals increasing
expression levels of miR-133a, -133b, -206 and -499 along embryonic developmental stages (p=0.001). Interestingly,
the miR-133a, -133b and -206 showed similar increased expression patterns (200 fold-change) whereas the miR499 showed a higher increased expression pattern (1100 fold-change). When comparing myomiRs expression in red
and white muscle fibers of adults, the miRs-133a and -133b are highly expressed in white muscle fiber (3.4 foldchange) whereas miR-499 is highly expressed in red muscle fiber (43 fold-change). Indeed, miR-133a and miR-133b
modulate the muscle proliferation by down-regulating Insulin growth factor-1 (Igf-1) whereas miR-206 induces and
maintains the innervations of neuromuscular junctions through the regulation of Histone deacetylase-4 (Hdac4).
These properties are described in mammals and probably are conserved pathways shared by all vertebrates. Moreover,
the miR-499 has been shown to modulate the red muscle fiber type differentiation through down-regulation of Sox6
and Rod1 genes and determine muscle fiber size by targeting Myostatin (Mstn). Further in situ hybridization and
functional experiments are under development in our laboratory to figure out the biological significance of myomiRs
and their target genes on the regulation of skeletal muscle development and control of muscle mass in Nile tilapia.
Financial support: FAPESP and CAPES.
88
POPULATION DIVERSITY OF SIMULIUM
HIRTIPUPA LUTZ (DIPTERA: SIMULIIDAE)
BASED ON MITOCHONDRIAL CYTOCHROME
OXIDASE SUBUNIT I SEQUENCES
Andrade-Souza, V1; Silva, JG2; Hamada, N1.
Instituto Nacional de Pesquisas da Amazônia (INPA), Manaus, AM; 2Universidade Estadual de Santa Cruz (UESC), Ilhéus, BA
1
[email protected]
Keywords: Aquatic insects, species complex, DNA barcode, Phylogeography, Watershed
Simulium hirtipupa Lutz, 1910 is restricted to Brazil where it is widely distributed. Molecular analysis with mitochondrial
DNA sequences (COI gene) has been carried out to test the hypothesis of the presence of cryptic species in this
species. Furthermore, this tool may allow for the inference of population history using intraspecific phylogeography.
The objectives of this work were to analyze the genetic structure and the phylogeography of S. hirtipupa. Sixteen
populations were included, totaling 250 sequences from eight Brazilian states (Bahia-BA (3); Espírito Santo-ES (2);
Goiás-GO (2), São Paulo-SP (1), Minas Gerais-MG (1), Pernambuco-PE (1), Tocantins-TO (1) and Mato Grosso do
Sul-MS (5). The amplification was carried out using primers LCO1490 and HC02198 for the COI gene (barcoding).
Sequences were edited using Bioedit and Arlequin and Samova were used for the population analysis. A total of 651bp
of the 123 haplotypes was obtained, none of these haplotypes was shared among all populations. In previous analysis,
the average genetic divergence among populations was 4.3% which may indicate cryptic diversity. The Mantel test
revealed a significant positive relationship between genetic and geographical distances (r=0.7069, P=0.0001). FST
values estimated for all population pairs were significantly high (P=0.05), for most populations, except between the
populations of MS and between the populations of MG, SP and ES, for which P was not significant. Four groups were
defined: Gr1 - GO and TO; Gr2 – MS; Gr3 – PE and 26BA; Gr4 – MG, ES, SP, 1BA and 15BA, which are relatively
similar to groups in the haplotype network, indicating genetic structuring. The groups recovered are consistent with
the distribution of the Brazilian watersheds, except for the populations from the East coast of the Atlantic Forest,
not including PE, which formed one group (15BA, 1BA, MG, ES and SP) distributed in the Eastern Atlantic and
Southeastern Atlantic Basins. The latitudinal division of the Atlantic forest has been observed among various groups
with rivers as barriers, different from what was observed here. The São Francisco basin separated the 26BA population
from the other populations in this state. This population formed one group with the PE population (Eastern Atlantic
Basin), although they occupy different basins and are geographically distant. The other barrier was the Serra Geral
de Goiás that separated the populations of GO and TO (Tocantins-Araguaia Basin) from each other. The results of
the Fu’s Fs test for the groups indicated that these populations underwent expansion, except for the Gr4, probably
influenced by populations 1BA and 15BA, whose test results were not significant. The estimated time of expansion
for the populations varied from 5.566 to 133.017 years ago for 8MS and 15BA, respectively. This information
and the other population parameters suggested that the state of Bahia can be the center of origin for S. hirtipupa.
Financial Support: CNPq and the Fundação de Amparo a Pesquisa do Amazonas (FAPEAM)
89
GENETIC CHARACTERIZATION OF A COUGAR
(PUMA CONCOLOR) POPULATION IN THE
SERRA DO BRIGADEIRO PARK (MINAS GERAIS,
BRAZIL)
Souza, ASMC1; Araujo, GR2; Paula, TAR2; Galetti Jr., PM1.
Departamento de Genética e Evolução, UFSCar, São Carlos, SP, Brazil; 2Departamento de Veterinária, UFV, Viçosa, MG, Brazil
1
[email protected]
Keywords: Atlantic Forest, non-invasive samples, population genetics, feline, relationship
The Serra do Brigadeiro Park is an important protected area of remaining Atlantic Forest in the southeastern of
Brazil, at Minas Gerais State. It spans 13,210 hectares in a long and narrow band of mostly secondary vegetation,
it is surrounded by urban and crops areas. Despite that, there are many animal and plant species in the park,
including endangered felines such as ocelot (Leopardus pardalis), little spotted cat (Leopardus tigrinus) and cougar
(Puma concolor). The cougar is the largest top predator in the area and its presence has an important top-down
effect on the community structure. The aims of this study was to determine both the number and the sex of cougars
inhabiting this park, and estimate the genetic diversity and relationship among then. Fourteen faecal samples were
collected on trails inside the park during 2011. Blood sample was also collected of one captured individual. The
first procedure consisted of the confirmation whether the faeces belonged to the cougar, based on the use of primers
to amplify a small region of the mitochondrial ATP6 gene. Then, nine species-specific polymorphic microsatellite
loci were used to individualize the samples, evaluate the variability and investigate relationship between individuals.
Primers that amplify a part of amelogenin gene were used to determine the sex. Ten cougar samples could be
accounted among the analyzed faecal samples and were detected at least nine cougars at the park, two females and
six males (one sample had no success in the amelogenin gene amplification). The medium diversity values (number
of alleles for loci: 4-9; gene diversity: 0.839; expected heterozygosity: 0.828; polymorphism information content
of loci: 0.742; allelic richness: 5.169) were higher than other cougar studies. The PcoC108, PcoA216 and Fca090
loci were not in Hardy-Weinberg equilibrium. The last two had null alleles, but other possible explanation for this
departure would be the endogamy. Neither loci pair was in genotypic disequilibrium. The identity (PIsibs) and
exclusion probabilities were 0.00017 and 0.99, respectively, and allow reliable individualization from microsatellites
loci. The relationship analysis indicated that five individuals were related (04/13: FS or PO; 14/15: FS; 01/04:
HS). The remaining four individuals were unrelated. These preliminary results suggest a potential inbreeding
among these animals, which could constrain their long-term prevalence in this area. It is important to increase the
number of samples and microsatellite loci to have a more definitive conclusion for better conservation policies.
Financial support: SISBIOTA/MCTI/CNPq, CNPq and FAPESP
90
GENETIC DIVERSITY AND PHYLOGEOGRAPHY
OF DENDROPSOPHUS RUBICUNDULUS
SPECIES (ANURA, HYLIDAE) IN THE CERRADO
Rosário, MD1; Oliveira, CA1; Alves, AC1; Valdujo, PH2; Silvano, DL1; Pereira, RW13; Caparroz, R4; Braga, AC1.
Curso de Ciências Biológicas, Universidade Católica de Brasília (UCB), Brasília, DF; 2WWF- Brasil; 3Programa de Pós
Graduação em Ciências Genômicas e Biotecnologia (UCB), Brasília, DF; 4Instituto de Ciências Biológicas, Universidade
de Brasília (UNB), Brasília, DF.
1
[email protected]
Keywords: Phylogeography. Dendropsophus rubicundulus. Cerrado. Cytochrome oxidase subunit I gene. Evolutionary
Significant Units
The phylogeography brings to light valuable information about the past and the present on species distribution by crossing
phylogenetic and biogeographic data. Besides helping to explain the study subject’s diversification and distribution, it
is also useful as a tool on biodiversity conservation. In this work, we analyze genetically the Dendropsophus rubicundulus
species (Anura, Hylidae), witch is widespread in the Cerrado biome, by amplifying a region of the mitochondrial
DNA cytochrome oxidase subunit I gene. We work with the hypothesis that D. rubicundulus reproduction, subject
to water courses, leads to poor dispersion of individuals and, consequently to genetic differentiation of populations
in the Cerrado biome. We succeeded at amplifying DNA and obtaining the consensus sequences of 80 individuals
from nine different populations. The haplotype network and the phylogenetic tree showed five haplogroups, revealing
genetically differentiation among the studied localities. Besides, the data confirmed differentiation among individuals
from the same locality. The most divergent locality shown in this study was Água Boa (MT) in comparison with the
other localities. It relates to the fact that this locality lies in a transition zone between the Cerrado and Amazon biomes
and it is also near the Araguaia River, that can behave as a geographical barrier due its intrinsic characteristic of being a
large wetland area. Given the significant genetic differences between the populations studied here, we suggest the five
haplogroups as Evolutionary Significant Units (ESU) and a taxonomic revision for D. rubicundulus.
91
ANALYSIS MICROGENOMIC FOR GENETIC
CHARACTERIZATION OF HAPLOTYPES IN
POPULATIONS OF SPECIES LEPTOGLOSSUS
ZONATUS (HETEROPTERA: COREIDAE)
Itoyama, MM1; Castanhole, MMU1; Marchesin, SRC1,2.
IBILCE-UNESP, São José do Rio Preto, SP; 2 UNIP, São José do Rio Preto, SP
1
[email protected]
Keywords: Coreidae; nuclear gene; 28S; Heteroptera.
Studies of genetic variability in populations of Heteroptera considered agricultural pests, are of great importance
since information about these populations are scarce. Such studies can help identify restriction on gene flow between
populations which, combined with the geographical distribution of species, plays an important role in determining
the evolution and local adaptation, including the detection of resistance to insecticides. In present study, patterns of
haplotypes were obtained for three populations of Leptoglossus zonatus, São José do Rio Preto, SP (P1); Bady Bassit SP
(P2) and Chapada do Céu, GO (P3) from analysis distance (NJ) to the 28S gene. We detected a total of 13 haplotypes;
four for the P1; eight for the P2 and one haplotype for the P3. The average intrapopulation variation was 0.002 for P1,
0.007 for P2 and 0.000 for P3. The largest variations were observed in P1 and P2 , while the P3 presented conserved
without variation, indicating restricted gene flow and local adaptation, where all individuals of this population are
responding the same way the selective pressures, as, for example, likely application of insecticides, since they were
collected in corn and is therefore selected, different from that observed in populations 1 and 2 which show small but
significant variation, indicating that they are not, yet fully adapted to local ecological conditions. However further
analysis should be conducted to identify the structure of these populations corroborating or not these findings.
92
MUGIL CUREMA: MORE COMPLEX SPECIES IN
THE GENUS MUGIL?
SILVA, APS¹; Fraga, E2; Schneider, H1; Sampaio,I.1; Rodrigues-Filho, LFS¹
Universidade Federal do Pará, Bragança, Institute for Coastal Studies(IECOS); 2Department of Chemistry and Biology,
UEMA? CESC, Caxias-MA, Brazil.
1
[email protected]
Palavras-chave: phylogeography, mullets, mitochondrial DNA.
The studies about phylogeographic status of genus Mugil are exclusively on the cosmopolitan species M. cephalus,
in which we have observed a high standard of genetic structuring in different regions of the world, reinforcing the
questionings about the presence of worldwide species. The Mugil curema has a wide distribution along the Atlantic and
Pacific coast of the American continent; it makes this specie a potential model to analyze possible genetic structuring
throughout its distribution, mainly because of questions about the taxonomical and phylogeographic conditions
of the genus Mugil. Thus, the aim of this study was to analyze the phylogeographic relationships of the species M.
curema at different points along the Atlantic and Pacific coast of Latin America, through mitochondrial markers
(16S rRNA genes and cytochrome b - Cyt b). This study used sequences of M. curema available in GenBank from
different locations (Mexico, El Salvador, Honduras, Ecuador, Peru, Venezuela, etc ...) and individuals collected in
Panama, Venezuela and in different states along the Brazilian coast. In the analysis of population structure from
Bayesian inference (BAPS), we observed the presence of three distinct groups (Pacific, Atlantic and Venezuela). The
genetic distance observed between these groups was three times lower when compared to valid species (eg M. incilis,
M. rubrioculus, M. hospes, etc ...). Phylogenetic relationships observed between the groups show a greater proximity
between Venezuela and the Pacific (Pacific x Venezuela – 16S: 0.9%; Cytb: 5.4%) than with Venezuela and Atlantic
(Atlantic x Venezuela – 16S: 1.9 %; Cytb: 8.1%) this results were found in haplotype trees and networks, and the
group of Brazil is separated from the other groups for at least 7 mutations. Recent studies have identified three
subgroups based on similar and different enzymatic and karyotype, two groups of M. curema found in Venezuela, a
group with karyotype 2n = 24 and the other with 2n = 48 living in sympatry, and the third group in Brazil with 2n
= 28. It is now known that the group with 2n = 48 represents the species M. rubrioculus. However, the sequences
generated in this study were grouped with M. curema type I (true), ruling out the possibility of other specie already
described, which is corroborated by genetic distance. This study points out two possible lineages: one distributed
along the Atlantic coast of South America (Atlantic), which coexists with another on the Venezuelan coast lineage
(Venezuela) and another lineage on the Pacific coastline. However, more samples should be analyzed over the course
of this study, for more clarity about these three groups identified as well as possible new structuring for M. curema.
Financial support: CNPq, CAPES, UFPa.
93
NUCLEOTIDIC DIVERGENCE OF THE NUCLEAR
GENE H3 HISTONE IN POPULATIONS
ASSIGNED TO MOENKHAUSIA BONITA
BENINE, 2004 (CHARACIFORMES:
CHARACIDAE)
Fabrin, TMC.1; Mota, TFM.2; Deprá, GC1; Prioli, SMAP3,4; Pavanelli, CS3; Prioli, AJ3,4.
Programa de Pós-Graduação em Ecologia de Ambientes Aquáticos Continentais, UEM, Maringá, PR; 2Programa de PósGraduação em Biologia Comparada, UEM, Maringá, PR; 3Núcleo de Pesquisas em Limnologia, Ictiologia e Aquicultura,
UEM, Maringá, PR; 4Departamento de Biotecnologia, Genética e Biologia Celular, UEM, Maringá, PR
1
[email protected]
Keywords: molecular markers, Paraná river, cryptic species.
The species Moenkhausia bonita Benine, 2004 and Hemigrammus marginatus Ellis, 1911 are very similar and differ
primarily by the degree of development of the lateral line, complete for M. bonita and incomplete for H. marginatus.
In the flood plain of the upper Paraná river, were captured some samples identified as M. bonita, however these
show different levels of development of the lateral line, individuals with complete, incomplete and interrupted lateral
line, which complicate the correct separation of H. marginatus. The molecular tools are effective to solve taxonomic
problems. In this way, the aim of this work was assess the nucleotidic divergence of the nuclear gene h3 histone of groups
identified as M. bonita with different levels of development of the lateral line. Samples collected in the flood plain of
the upper Paraná river were carried out, identified as M. bonita which shows complete lateral line (n=3), interrupted
lateral line (n=4), and incomplete lateral line (n=4) and Moenkhausia gracilima Eingenmann, 1908 (n=1). It was added
to analyses one h3 histone sequence of one individual identified as Danio rerio Hamilton, 1822 available in Genbank.
Sequences with 303 pb were obtained. Only one haplotype was found among the individuals identified as M. bonita.
The proportion of nucleotidic differences found among the haplotype and M. gracilima and D. rerio varied from 0,013
and 0,133, respectively. M. gracilima differed from D. rerio at 0,137. Thus, evidences were not found about cryptic
species among the individual identified as M. bonita which shows varied levels of development of the lateral line.
Financial Support: Nupélia; CNPq-PELD and CAPES
94
MOLECULAR EVOLUTION OF PRIMATE
MITOCHONDRIAL GENOMES
Menezes, AN1; Viana, MC1; Furtado, C1; Moreira, MAM1; Schrago, CG2; Seuánez, HN1,2.
Programa de Genetica, Instituto Nacional de Cancer, Rio de Janeiro, Rio de Janeiro; 2Departamento de Genetica,
Universidade Federal do Rio de Janeiro, Rio de Janeiro.
1
[email protected]
Keywords: mtDNA, phylogenetics, positive selection, divergence time, next generation sequencing.
The mitochondrial genomes of five neotropical primates (NP), Aotus infulatus, Chiropotes israelita, Callimico goeldii,
Brachyteles arachnoides and Callicebus lugens were sequenced and annotated. These mitochondrial genomes were analyzed
with other 65 primate mitochondrial genomes available in GenBank to check for positive selection, phylogenetic
reconstructions and estimation of divergence time. DNA libraries were prepared for runs in a HiSeq 2000 (Illumina)
and contigs were assembled with the De Novo Assembly algorithm of CLC Genomics Workbench (CLC Bio). Genes
were mapped using the Mitos website and, subsequently, manually checked. Phylogenetic reconstructions with
mitochondrial genes of other 65 primates showed a similar arrangement to a topology based on nuclear genes. Screening
for positive selection identified 15 codons in 7 genes along 9 independent lineages, three with two or more genes and
five in internal nodes, ruling out false positive estimates. The NP timescale estimated from mitochondrial genomes
placed the time to the recent common ancestor (TMRCA) of extant NP at the late Oligocene (25 Ma) was in agreement
with estimates using nuclear datasets. Mitochondrial genomes were shown to be as effective as nuclear supermatrices
for dating the diversification of extant NP lineages. Nevertheless, sequencing of additional genomes will reduce
uncertainties associated with the evolution of the major NP lineages. Sequencing of whole nuclear genome of three of
these primates, Brachyteles arachnoides, Callimico goeldii and Callicebus lugens, are currently under way out by our group.
Financial Support: CNPq, CAPES and FAPERJ
95
MOLECULAR IDENTIFICATION OF
INTERMEDIATE HOSTS OF SCHISTOSOMA
MANSONI IN THE BRAZILIAN AMAZON
REGION BY MULTIPLEX-PCR: PRELIMINARY
RESULTS
Rodrigues-Filho, LF1,3 ; Rodrigues, I2 ; Souza, GW3 ; Rodrigues, D3 ; Schneider, H1; Sampaio, I1
Federal University of Pará, Bragança Campus, Institute of Coastal Studies (IECOS), Bragança-PA, Brazil; 2Evandro Chagas
Institute – Sectretary of Health Survaillance / Ministry of Health, Section of Parasitology – Laboratory of Malacology;
3
Faculty of Castanhal (FCAT), Curso de Licenciatura em Biologia.
1
[email protected]
Keywords: Biomphalaria, ITS, PCR Multiplex.
The mollusc fauna of the Amazon region has been the target of several systematic and epidemiological studies. However
studies on identification and biogeography of the genus Biomphalaria in the Brazilian Amazon region are scarce or
nonexistent. The species belonging to this genus are important in the epidemiology of schistosomiasis because they
have different levels of susceptibility to infection by Schistosoma mansoni and also have a high degree of morphological
similarity interspecific hindering their identification by morphological examination only. This study aims to develop a
molecular tool to identify different species of the mollusk occurring in the Brazilian Amazon and to provide assistance
in the epidemiology of schistosomiasis in the study area. Thus, we developed a Multiplex-PCR from species-specific
primers in the internal transcribed spacer region (ITS) between the ribosomal genes (18 S, 5.8 S and 28 S) to identify
species. The product of this technique was subjected to electrophoresis (30 minutes, 100 v) in 1.5% agarose gel and
subsequently visualized in UV light. In this gel, we observed different patterns of bands for the species B. glabrata
(two bands of ≈ 1000 and 900 bp), B. straminea (a band of ≈ 1000 bp), B. amazonica (a band of ≈ 350 bp) and B.
khuniana (two bands of ≈ 1000 and 750 bp), serving to clearly discriminate them. Levels of intraspecific variation
were tested and no change in the profile established for each species, pre-identified using molecular data available in
the literature, was observed. Preliminary results also demonstrate that the technique is effective to differentiate the
species B. straminea and B. kuhniana, belonging to a complex characterized by high similarity between them. In
the future this study aims to identify a greater number of species of Biomphalaria present in the study area and to
establish infection of the snail host with S. mansoni for assistance in the monitoring and control of schistosomiasis.
Financial Support: IEC/SVS/MS – CNPq-UFPA-IECOS.
96
DESCRIPTION OF TWO UNDESCRIBED
SPECIES OF ASTYANAX (TELEOSTEI,
CHARACIDAE) FROM THE MUCURI RIVER,
MINAS GERAIS STATE – BRAZIL
Lima, CP; Salgado, FS; Melo, S; Dias, CEFA; Dergam, JA.
Laboratório de Sistemática Molecular – Beagle, Departamento de Biologia Animal, Universidade Federal de Viçosa, UFV,
Viçosa, MG.
[email protected]
Keywords: tetras; karyotypic variability; coastal basins; undescribed species; endemic species.
The Mucuri River Basin is one of Minas Gerais coastal drainages and it is characterized by high levels of endemism.
Fishes of genus Astyanax, popularly known tetras, are in a systematic complex condition and have high levels of
chromosome number and morphology, both between individuals of different species and among conspecific
populations. The aim of this study was to describe the karyotypes of Astyanax sp1 e Astyanax sp2 from the Mucuri
River, and thus contribute to a better understanding of the phylogenetic and phylogeography of this genus, as these
data are useful for describing evolutionary trends. The specimens were named Astyanax sp1 e Astyanax sp2 for not
fitting into any identification key. Astyanax sp1 has 33 lateral line scales; 7 pentacuspid teeth on the dentary bone, one
anterior row with 3 tricuspid teeth and a posterior row with 5 pentacuspid teeth; 2 pentacuspid teeth in the upper
maxillary bone; height 24.3 mm, standard length 67.45 mm. Astyanax sp2 presents an oval humeral spot (similar to
Astyanax bimaculatus) on the right side and two humeral spots on the left side; lateral line with 35 scales; 7 tricuspid
teeth on the dentary; teeth disarranged on the premaxilla; no teeth on the maxillary teeth; height 22.2 mm, standard
67.4 mm. Mitotic metaphase chromosomes were obtained from the anterior kidney. Chromosomes were stained with
conventional staining technique, and the chromosomes were measured using computer programs. All subjects had 2N
= 50 chromosomes, and the karyotypic formulae were: 8m +12 sm +14 st +16 t for Astyanax sp1 and Astyanax sp2 6m
+24 sm +18 st +2 t. Astyanax sp2’s karyotypic formula differs from typical coastal Astyanax species, which always show
predominance of subtelocentric and telocentric chromosomes. The preliminary study highlights the need for greater
knowledge of undescribed species or potentially endemic river basin Mucuri.
97
EFFECT OF THE ALUI POLYMORPHISM IN THE
GROWTH HORMONE RECEPTOR (GHR) GENE
ON MILK PRODUCTION OF HOLSTEIN COWS
CASARIN, T. S.¹; MATTEI, P¹; FARINA, G¹; HAX, L. T.¹; JACOMETO, C.B.¹; BOLZAN, G.N.¹; SCHNEIDER, A.¹; DEL PINO,
F.A.B.¹; XAVIER, E²; CORRÊA, M.N.¹
¹Núcleo de Pesquisa, Ensino e Extensão em Pecuária, Universidade Federal de Pelotas (UFPel). Pelotas, Rio Grande do
Sul, Brasil; ²Granjas 4 Irmãos S/A. Rio Grande, Rio Grande do Sul, Brasil.
[email protected]
Keywords: molecular markey and production.
Growthhormone (GH) acts in the regulation of the metabolism and physiology of mammals. The gene encoding
for the GH receptor may have a mutation in the promoter region denominated GHR AluI. The aim of this study
was to evaluate the effect of the GHR AluI genotype on milk production in Holstein cows reared in semi-extensive
system. We evaluated 155 Holstein cows reared in semi-extensive system on a farm in southern Rio Grande do Sul.
DNA was extracted from an aliquot of 500 µl of whole blood. The fragment to be studied was amplified by PCR
(836pb) and this product was digested with the AluI enzyme. To visualize the bands, the product of the enzymatic
digestion were subjected to electrophoresis on an agarose gel and visualized in UV system. Analysis of variance was
performed to evaluate differences in milk production using SAS (SAS Institute Inc. Cary, NC, USA, 2001). Of the
155 cows studied 29% had a GHR AluI (+/+) genotype, 57.5% had a AluI (+/-) and 13.5% a AluI (-/-) genotype.
There was no difference between the GHR AluI genotypes for milk production (+/+(n=45):5,851.53±175.48; +/(n=89):5906.46±126.36, -/-(n=21):5792.19±318.02P>0.05). The GHR hepatic expression is stimulated by insulin.
Thus, during the period of negative energy balance, the reduction of serum insulin can causes a down regulation in the
expression of this gene. Probably, the lower milk production of the evaluated cows, has conducted to a lower metabolic
challenge, overlapping the muatation effect. In short, the GHR AluI genotype did not affect the milk production of
the cows reared under semi-extensive. However, the evaluation of the negative energy balance intensity needs to be
evaluated to better elucidate the effect to this polymorphism in milk production.
98
EFFECT OF THE SNABI POLYMORPHISM ON
THE INSULIN-LIKE GROWTH FACTOR I (IGF-I)
ON THE CALVING CONCEPTION INTERVAL IN
POSTPARTUM HOLSTEIN COWS
MATTEI, P¹; CASARIN, T¹; HAX, LT¹; JACOMETO, CB¹; BOLZAN, GN¹; FARINA, G¹; SCHNEIDER, A¹; DEL PINO, FAB¹;
XAVIER, EG²; CORRÊA, MN¹
¹Núcleo de Pesquisa, Ensino e Extensão em Pecuária, Universidade Federal de Pelotas (UFPel). Pelotas, Rio Grande do
Sul, Brasil; ²Granjas 4 Irmãos S/A. Rio Grande, Rio Grande do Sul, Brasil.
[email protected]
Keywords: molecular marker, reproduction, SNP.
Due to advances in the genetic selection in dairy cows in recent decades, there has been an increase in milk production
per cow. This growth, however, is accompanied by decreased fertility due to the more pronounced negative energy
balance caused by the higher milk production. Thus it is necessary to identify molecular markers predictive of better
reproductive performance and select these individuals. Therefore, the aim of this study was to determine if the SnaBI
polymorphism in the gene encoding the insulin-like growth factor I (IGF-I), a hormone essential for follicular growth,
can influence the calving conception interval in postpartum Holstein cows reared in a semi-extensive system. One
hundred and fifty five cow were submitted to a fixed-time artificial insemination (TAI) protocol. The calving conception
interval data to 305 days of lactation was obtained through the farm management software (ALPRO®, DeLaval Herd
Management System). Blood was collected from the coccygeal vein and stored at -20 °C until DNA extraction. The
determination of the SnabI IGF-I genotype was performed using SnaBI restriction enzyme digestion of the product
of the PCR with the primers (F: TGCGTGCACAGCAGCTCAACC and R: AGCAACCCCACTGCTGGGCAT)
of 836 bp. After that fragments were separated by agarose gel electrophoresis and visualized under ultraviolet light.
The data were analyzed using the ANOVA procedure of SAS (Institute Inc. Cary, NC, USA, 2001). Of the 155 cows
evaluated for the IGF-I SnaBI polymorphism, 54 (34.9%) had the SnaBI (+/+) genotype, 71 (45.8%) the SnaBI (+/-)
and 30 (19.3%) the SnaBI (-/-). The frequency of the alleles SnaBI(+) and SnaBI(-) were 0.58 and 0.42, respectively.
The different SnaBI genotypes had no influence on the calving conception interval (Genotype +/+: 114,54±6,98;
Genotype +/-: 104,54±6,72 and Genotype -/-: 112,83±10,22. Values in days) (P> .05). The hepatic expression of
IGF-I is stimulated by the growth hormone (GH) and the liver GH receptor is expressed upon stimulation by insulin.
Therefore, during periods of negative energy balance, reduced serum insulin decreases the synthesis of hepatic IGF-I.
Thus, due to lower milk production of the cows in the study (Genotype +/+, n=54: 5771,85±163,98; Genotype +/-,
n=71: 5829,28±144,34 and Genotype -/-, n=30: 6169,03±227,21. Values in kg), the evaluated cows were probably
exposed to a reduced metabolic challenge. Such a condition can have made negligible the difference between the
IGF-I genotypes. Thus, it is concluded that the SnaBI polymorphism is not associated with the interval from calving
to conception in Holstein cows reared in a semi-extensive system. However, the evaluation of the intensity of the
negative energy balance can help better elucidate the effect of this mutation on reproductive parameters of Holstein
cows raised in a semi-extensive system.
99
SUCCESSFUL CARNIVORE IDENTIFICATION
WITH FAECAL DNA ACROSS A SILVICULTURE
LANDSCAPE IN SÃO PAULO STATE
Villela, PMS1; Brassaloti, RA1; Fuini, GR1; Longo, ALB1; Verdade, LM2; Coutinho, LL1.
Escola Superior de Agricultura “Luiz de Queiroz”, USP, Piracicaba, SP; 2Centro de Energia Nuclear na Agricultura, USP,
Piracicaba, SP
1
[email protected]
Keywords: fecal DNA, Carnivora, Mini barcodes, ATP6, Cytochrome oxidase I
Noninvasive sampling methods provide a means for studying species such as large mammalian carnivores that are
difficult to survey using traditional techniques. Sampling carnivore faeces has been widely used in wildlife ecology
studies. However, species identification based on morphology and contents of faecal samples can be inaccurate or
biased, potentially compromising the quality of all downstream data. Reliable identification of species is fundamental
in molecular ecology, conservation biology, forensic sciences and wildlife management because many studies in these
disciplines crucially depends on species identification for a wide range of applications, such as the definition of
geographic distributions, estimation of densities, and the analysis of biological and behavioral parameters. In this
study, we identified canids and felids through analysis of faecal DNA. The study site comprises two forestry farms: Três
Lagoas (23°22’0” S ; 48°28’0” O) and Arca (23°20’0” S; 48°27’30” O), both located in the municipality Angatuba,
south-eastern region of São Paulo State, with an area covering more than 3,200 ha of eucalyptus plantations mixed
with secondary semideciduos forest and savannas remnants on legal protected areas. Field expeditions were conducted
every month between January 2010 and December 2011. Samples were stored in sterile preservative-free plastic
tubes and were kept at -20ºC. Faecal DNA was extracted using a QIAmp DNA Stool Mini Kit (Quiagen). We
collected 394 potential canids or felids faeces in the study area and successfully extracted DNA from 299 samples
(~76%). We amplified two short mtDNA fragments, ATP6 (126 bp) and cytochrome oxidase I gene (COI-187
bp), as suggested by Chaves et al. (2011). PCR products were purified with ExoSAP and sequenced with ABI 3130
(Life - Applied Biosystems). In 266 samples (~88%), the mtDNA fragments were amplified, allowing us to identify
the sample species origin. The obtained sequences were compared with database described in Chaves et al. (2012),
assessed by the online sotfware “DNA Surveillance”. From 139 felids faecal samples we identifed a total of five
species, where 52 were from Puma concolor, 32 Leopardus pardalis, 22 Puma yagouarondi, 19 Leopardus tigrinus
and 14 from Leopardus wiedii. From the 127 canids faecal samples, using the same method, we identified another
five species where 77 samples were from Chrysocyon brachyurus, 24 Cerdocyon thous, 18 Lycalopex gymnocercus , 6
Lycalopex vetulus and two were from Canis familiaris. Our study revealed the success of the methodology described
by Chaves et al. (2012) for faecal samples identification from felids and canids species across a silvicultural landscape
in São Paulo State. The correct species identification from fecal samples can contribute with more accuracy data
for diet studies, better understand of distributional patterns and abundance status of the carnivore’s populations.
100
IDENTIFICATION OF IGFBPS (INSULIN-LIKE
GROWTH FACTOR-BINDING PROTEINS)
IN ZEBRAFISH (DANIO RERIO) TESTIS AND
OVARY
Daolio, GAJ1; Martinez, ERM1; Bogerd, J2; Schulz, RW 2; Nóbrega, RH1.
Universidade Estadual Paulista (UNESP/IB), Botucatu, SP; 2Utrecht University, Utrecht, Holanda
1
[email protected]
Keywords: gene expression, molecular genetics, fish.
Spermatogonial stem cell (SSC) self-renewal and differentiation are tightly regulated by mediators produced in the
spermatogonial niche, including Igf family members (insulin-like growth factor), which are modulated by gonadotropic
hormones, such as Fsh (follicle-stimulating hormone). In fish, the Igf system is composed of four types of Igfs: Igf1a,
Igf1b (a.k.a. Igf3), Igf2a and Igf2b, Igf receptors type I and II, Igf binding proteins (Igfbp), and Igfbp proteases, having
an important function on metabolism, cellular growth, survival and homeostasis. The new, gonad-specific member of
Igf family found only in fish, Igf3, is present in Sertoli cells surrouding early spermatogonia. Although its biological
role in spermatogenesis has not been fully characterized yet, we found that recombinant zebrafish Igf3 stimulated
spermatogonial proliferation and differentiation, in contrast to Amh (Anti-müllerian hormone), which maintains SSC in
their undifferentiated state. Igfs are normally bound to Igfbps which act not only as carriers of Igfs, thereby prolonging
their half–life, but also function as modulators of Igf availability and activity. In this context, Igfbp could modulte Igf
effects on cell proliferation and survival. Eight Igfbp genes for Igfbp were found in zebrafish (igfbp1a, igfbp1b, igfbp2a,
igfbp2b, igfbp3, igfbp5, igfbp6a e igfbp6b). The aim of this study is to identify the types of Igfbps expressed in zebrafish
(Danio rerio, Cyprinidae, Cypriniformes) testicular and ovarian tissue. Using specific primers designed based on fulllength cDNA sequences deposited at NCBI, we evaluated gonadal gene expression by reverse transcriptase-polymerase
chain reaction (RT-PCR). After 1% agarose gel electrophoresis, single bands with expected product sizes were found for
igfbp2a, igfbp2b, igfbp3, igfbp5 and igfbp6a, confirming the presence of these types of Igfbp in the zebrafish testis and
ovary. igfbp1a and igfbp6b presented double bands that probably correspond to different isoforms (to be confirmed by
sequencing). Our next step is to evaluate by real-time, quantitative PCR the expression of the different igfbps using in
vitro (tissue culture) or in vivo conditions where self-renewal/quiescent (estrogens, Amh) or pro-differentiation (Fsh,
Igf3, busulfan) is favoured in order to understand the role of Igf system on the regulation of SSC fate in zebrafish.
Financial Support: FAPESP (2012/00423-6); CNPq.
101
CHARACTERIZATION OF THE PROXIMAL 5’
REGION OF COLOSSOMA MACROPOMUM
GROWTH HORMONE GENE BY TAIL-PCR
TECHNIQUE
Jaser, SKK1,2; Hilsdorf, AWS2.
Programa de Pós-Graduação Interunidades em Biotecnologia, USP, São Paulo, SP; 2Laboratório de Genética de
Organismos Aquáticos e Aquicultura (LAGOAA), UMC, Mogi das Cruzes, SP
1
[email protected]
Keywords: Tambaqui, Sequencing, Promoter region
Colossoma macropomum (Cuvier, 1818) – tambaqui is the native species of greatest production volume by Brazilian
aquaculture, was included in the Brazilian genetic improvement program (AQUABRAZIL) due to its great economic
importance for neotropical aquaculture and can reach up to 40 pounds and 1 meter into natural environment. The
most responsible for the somatic growth stimulation in vertebrates is Growth Hormone (GH), secreted by pituitary
gland. GH gene has had its genome and cDNA sequences characterized and used in studies with several economic
importance species due to the mechanisms involved in its transcription and the understanding importance of its
regulatory factors. It is proven that GH increased levels in fish implies higher growth rates and polymorphisms in this
gene may be associated with performance characteristics. The characterization of GH gene regions may be an important
step in the knowledge advancement for genetic improvement of species such as C. macropomum, using as base for future
studies, correlating possible polymorphic regions to gene expression rates and performance bodily characteristics. In
this study was performed genomic DNA extraction from the caudal fin of a C. macropomum specimen. Subsequently,
we constructed foward and reverse primers based on the species GH gene cDNA sequence in order to amplify the
initial region of this gene, including introns, using conventional PCR. The obtained amplicon was sequenced and
this sequence was used for three reverse primers construction in order to amplify the GH gene 5’ proximal region by
TAIL-PCR technique. The amplified products were cloned into Escherichia coli DH5α cells, sequenced from plasmids
with forward and reverse M13 universal primers and the obtained sequences was analyzed using MEGA v.5 and
Codon Code Aligner software for obtaining the consensus sequence which was used for characterization of the gene
proximal 5’ region. In this study it was possible to characterize the first two introns and the proximal 5’ region of C.
macropomum GH gene, where CAAT Box and TATA Box regions and the ATG translation start point were identified.
These regions were identified comparing the obtained consensus sequence with GH gene sequences of species available
in the literature, such as human, bovine, sheep, mouse and other fish species. The gene regions characterized in
this study will be used as the basis for future studies that attempt to identify possible existence of polymorphisms
in both natural and captive populations in order to correlate these polymorphisms with gene expression rates and
bodily characteristics performance. Therefore, may contribute to genetic improvement programs by assisted selection.
102
PHYLOGEOGRAPHY OF THE ESTUARINE
COPEPOD ACARTIA TONSA DANA, 1849 ON
THE BRAZIL ATLANTIC COAST
Costa, KG1,2; Carneiro, JC2; Rodrigues Filho, LFS2; Sampaio, I2
Laboratório de Plâncton e Cultivo de Microalgas, UFPA, Bragança, PA; 2Laboratório de Genética e Biologia Molecular,
UFPA, Bragança, PA
1
[email protected]
Keywords: Cryptic species, mitochondrial DNA, ballast water, Molecular phylogeny, COI.
Acartia tonsa is a copepod that is considered a key factor in the energy flows of many estuaries along the Indo-Pacific and
Atlantic, as it is an excellent source of protein for the development of many crustaceans, fishes, and aquatic mammals.
Cryptic diversity is common in A. tonsa populations, due to ecological differentiations in the species and the maintenance
of local biodiversity. The present study is the first to investigate the genetic structure of A. tonsa in five coastal habitats
in the states of Amapá, Pará, Maranhão, Bahia, and Paraná. After their identification, extraction, amplification and
sequencing, statistical and population analyses were conducted to confirm the populations’ structure. Among the 58
individuals (557pb of the mtCOI gene), 13 distinct haplotypes were distinguished. As a result of these variations,
three strains (L1, L2, L3) were confirmed in the analyses, with 83% total variance (p <0.001) maintained among the
populations and 17% (p<0.001) within the populations. In the case of L3, the sharing of haplotypes from Bahia and
Paraná can arise from the Brazil Current, while, in L1, the connectivity among the individuals from Maranhão, Pará,
and Amapá may be favored by the North Brazil Current. In L2, individuals from Maranhão and Paraná do not share
haplotypes. There is a coexistence of distinct gene pools in Maranhão (L1 and L2), which suggests introduction via
ballasts due to the traffic intensity of cruise ships in the region or ecological specialization due to different environmental
conditions. The evidence from the introduction of the Paraná gene pool in the other locations via water from cruise ship
ballasts - the transportation of maritime cabotage - is highly plausible, as the direction and the circulation of marine
currents are not consistent with the dispersion of Paraná’s gene pool to Brazil’s northern region. Its high facility for
adaptation to different conditions, high reproductive capacity, and short generation period make A. tonsa populations
enormous. The copepod therefore has ample opportunities for expansion, invasion, and recolonization with the
capacity to modify/alter the genetic composition of native species. Phylogenetic analyses supported the separation of
populations, resulting in three profoundly different clades supported by high bootstrap values (95-99%). Although
the clades present a high genetic divergence within the group (7-16%) and with the out-group (18-22%), further
critical morphological comparisons among the strains are necessary, in addition to the inclusion of other sampling
locations and the utilization of nuclear markers to completely describe this “species complex”, or cryptic species.
Financial Support: CNPq – Conselho Nacional de Desenvolvimento Científico e Tecnológico and CAPES Coordenação de Aperfeiçoamento de Pessoal de Nível Superior.
103
CYTOGENETIC FEATURES IN CANINE
MAMMARY CARCINOSARCOMA: A CASE
STUDY
Affonso, PRAM1; Morais, CSD2; Bitencourt, JA3; Wenceslau, AA2.
Universidade Estadual do Sudoeste da Bahia, Dep. Ciências Biológicas, Jequié – BA; 2Universidade Estadual de Santa
Cruz, Programa de Pós-Graduação em Ciência Animal, Ilhéus, BA; 3Universidade Federal do Pará, Campus de Bragança,
Bragança, PA
1
[email protected]
Keywords: Chromosomal rearrangements, cytogenetics, dogs, cancer, polyploidy.
Both clinical and pathological traits of mammary carcinosarcomes in dogs are similar to humans, such as: sporadic
occurrence, fast tumor growth and unfavorable prognosis when compared to carcinomas. Other possible alterations
include chromosomal abnormalities which can be useful to identification of tumoral cells and diagnosis. On
the other hand, cytogenetic studies in dogs are particularly challenging once the canine karyotype is difficult to
analyze (high diploid number and acrocentric chromosomes). Therefore, this work was carried out to compare the
chromosomal features of peripheral lymphocytes and tumor cells in a mammary carcinosarcoma of a 14-year-old
female Poodle. Chromosomes were analyzed from 210 metaphases by conventional Giemsa staining, C-banding
and base-specific fluorochrome staining with chromomycin A3 (CMA3) and DAPI. Foi analisado um total de 210
metáfases. Out of the 105 blood cells, 56.3% followed the standard karyotype of dogs (2n=78). Other chromosomal
numbers in lymphocytes were related the chromosome overlapping or lack of chromosomes in metaphase spreads by
technical artifacts. In contrast, the carcinosarcoma cells showed high chromosomal numbers (104 to 153), divided
into: 80% of hypertriploid (118 to 136 chromosomes), 10.5% of hypotetraploid (137 to 153 chromosomes), 5.7%
of hypotriploid (104 to 116 chromosomes) and 3.8% of triploid cells (117 chromosomes). In human, mammary
carcinosarcoma has also resulted in complex karyotypes with chromosomal number close to triploidy. Among the
aneuploid cells identified, we highlight the trisomy of pair 1 and X chromosome once these elements are easily
recognized in karyotype because of their size (pair 1) or differential morphology. Heterochromatin in normal
cells was restricted to pericentromeric region of all chromosomes while few C-bands were observed in tumor
cells. This apparent loss of heterochromatin in neoplasic cells is supposed to favor centric fusion among formerly
acrocentric chromosomes. Fluorochrome staining reinforced this hypothesis once GC-rich segments (CMA3+)
were identified in 10 chromosomes from normal cells (2n = 78) whereas carcinosarcoma metaphases had up to 11
chromosomes bearing CMA3 signals in spite of their remarkable high chromosomal numbers. We conclude that,
like humans, the carcinosarcoma in dogs cause genome instability that eventually lead to structural and numerical
chromosomal aberrations, reinforcing that dogs can be used as reference material to study cancer in humans.
Financial support: CAPES, FAPESB.
104
DYNAMICS OF MTDNA INHERITANCE IN
PUTATIVE HYBRIDS BETWEEN TRACHEMYS
DORBIGNI AND TRACHEMYS SCRIPTA IN RIO
GRANDE DO SUL, BRAZIL
Figueiredo, PICC1,2; Trigo, CC2; Fagundes, NJR1.
Departamento de Genética, UFRGS, Porto Alegre, RS; 2Centro de Estudos Costeiros, Limnológicos e Marinhos
(CECLIMAR), UFRGS, Imbé, RS
1
[email protected]
Keywords: hybridization, mtDNA, conservation genetics
The introduction of exotic species is the second leading cause of global biodiversity loss and may contribute to
a significant change in the organization and functionality of resident communities. One of the main causes of
this negative impact in native populations is hybridization between native and alien species which may produce
offspring having low fitness through the introgression of less adapted alleles in the native species. In Rio Grande do
Sul (RS), Southern Brazil, the communities of Trachemys dorbigni are affected by the introduction of subspecies of
T. scripta: T. s. elegans and T. s. scripta, both native of North America. Individuals with mixed morphological traits
can be found in RS in regions where release or escape of exotic individuals may have occurred. This study aims to
determine whether there is enough variation to distinguish among T. dorbigni, T. s. scripta, and T. s. elegans using the
mitochondrial cytochrome b gene (Cytb), and which mtDNA lineages can be found in individuals morphologically
identified as hybrids between T. dorbigni and T. scripta. So far, ten individuals were captured in Imbé, a city in RS
coastal region. Of these, six were identified as T. dorbigni, three as T. scripta, and one as a hybrid between them. A
small fragment of the interdigital membrane was sampled for the genetic analysis, and DNA was extracted using
the CTAB method. We used the PCR to amplify a fragment of Cytb for each individual, which was purified and
sent for Sanger sequencing in Macrogen (Seoul, South Korea). Chromatograms were checked and the consensus
sequence for each individual was assembled in the program Genious. Sequences were aligned in the program Bioedit
together with other sequences for these species found in the Genbank. Finally, the program MEGA 5 was used to
estimate genetic distances between different species using the Kimura-2 parameter distances. The 705bp fragment of
the Cytb studied here can unambiguously discriminate between species and subspecies, showing an average distance
of 5.2% between T. dorbigni and T. scripta, and 0.68% between the subspecies of Trachemys scripta. Noteworthy,
even the low genetic distance between T. s. scripta and T. s. elegans, allows a good discrimination between them due
to the presence of three diagnostic nucleotides in the alignment. All individuals had mtDNA lineages matching
their morphology-based classification, and the individual classified as a hybrid showed an mtDNA lineage from T.
s. elegans, which was the only T. scripta subspecies found in our study. These results show that there may be mtDNA
introgression in the native species, suggesting that the release or escape of the exotic species in the wild may affect
the genetic diversity of T. dorbigni, having consequences for its conservation and survivorship in the long-term.
105
INTRAPOPULATION ANALYSIS OF
PACHYCORIS TORRIDUS (SCUTELLERIDAE,
HETEROPTERA) FROM MOLECULAR
MARKERS COI AND 16S
Souza-Firmino, TS1; Itoyama, MM1
Universidade Estadual Paulista “Júlio de Mesquita Filho” - Campus de São José do Rio Preto – Instituto de Biociências,
Letras e Ciências Exatas – IBILCE/UNESP
1
[email protected]
Keywords: Intraspecific study, gene, bedbug
The Heteroptera are the largest and most diversified group of insects with approximately 40,000 species. Its
former existence and apparent adaptability has resulted, under the evolutionary point of view, structural diversity
and biological. The family Scutelleridae possesses 450 species, the most notable characteristic is the scutellum
that overlays the whole abdomen. The bedbug Pachycoris torridus (Scopoli) is the only of Scutelleridae family with
agricultural importance in Brazil, being phytophagous and polyphagous, their attacks have been recorded in many
cultures, however, its economic value is because of its attack the culture of Pinhão Manso (Jatrorpa turcas), used in
the production of biodiesel. Aiming the agricultural importance of Pachycoris torridus, was realized the intraspecific
study, using the molecular markers COI and 16S, for us obtain evolutionary answers on this species and verify
the informative value of each marker in these analyzes. For this, was realized the sequencing of the mitochondrial
genes COI and 16S, of 20 specimens of P. torridus. These sequences were analyzed descriptively, statistically and
under the phylogenetic standpoint, using the methodologies Neighbor-joining, Parsimony and Maximum
Likelihood for the construction of topologies. After alignment the sequences of gene COI, these showed 651 sites,
to which 623 (95.7%) were conserved, 28 (4.3%) were varied, 24 (3.7%) were parsimonious sites and 4 (0 6%)
were unique sites. The alignment the sequences of 16S showed 501 sites, of which 493 (98.4%) were conserved,
8 (1.5%) were varied, 5 (1%) were parsimonious sites and three (0.6%) were unique sites. Through analysis of
evolutionary divergence, estimated using the model of nucleotide substitution Kimura 2 parameters, observed a rate
of 0.6% of differences between the specimens by 16S and 2.9% with the COI. The topologies obtained with the
COI gene, presented more haplotypes in relation to 16S, and the maximum parsimony method was the analysis
more informative, showing six indices of bootstraps with values higher than 60%, being two for 16S and four to
the COI. In this way, we verified that the COI gene is more informative at the species level than the 16S gene.
Financial support: CNPQ, FAPESP, FUNDUNESP and FAPERP
106
MOLECULAR TOOL TO DEMONSTRATE IN
HYBRIDIZATION IN SAIMIRI (PLATHIRRINI,
PRIMATES)
Carneiro, J; Sampaio, I; Schneider, H;
Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus de Bragança.
[email protected]
Keywords: Hybridization, Squirrel monkey, Alu insertion, mitochondrial DNA
Hybridization is a process that has been widely discussed in scientific circles both for its importance as a mechanism for
evolutionary speciation, and by his influence in relation to taxonomy, conservation and species extinction. However,
questions persist about its role in the evolutionary history of living beings. Some studies have demonstrated that
hybridization of New World primates in captivity is a fairly common event, as well as the presence of possible areas
in hybrid natural environment. These hybrid zones make it very difficult for the morphological identification of
individuals by mixing characters that distinguish them usually groups recognized as “pure”. With the advancement
of molecular biology, it can be verified more thoroughly such hybrid relations. In the present study we used the
presence / absence of the insert AluTA15 with visualization on an agarose gel, and a phylogeny based on DNA
sequences of the cytochrome b gene of mitochondrial DNA to investigate the hybridization between natural S. b.
peruviensis and S. s. macrodon, these samples originated from the western Amazon rainforest, and also in a sample
of captive S. b. boliviensis National Primate Center Argentino (CAPrim). Our results revealed the occurrence
of natural hybridization in a high percentage, showing a high rate of backcrossing between these primates so as
hybrids in the population of S. b. boliviensis captivity. These results lead us to suggest greater caution for biomedical
studies, since Saimiri is the group of New World primates most commonly used in biomedical experiments.
With respect to conservation programs for these groups, it is necessary a careful mapping of natural hybrid zones,
as the results of genetic analyzes can help resolve problematic issues on the taxonomy of this group of primates.
Support: CNPq, CAPES, UFPA
107
IDENTIFICATION AND VALIDATION OF
REFERENCE GENES FOR QUANTITATIVE
REAL-TIME PCR EXPERIMENTS IN
ANASTREPHA
Nakamura, AM1; Lima, ALA1; Chahad-Ehlers, S1; Sobrinho Jr., IS1; de Brito, RA1
Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, SP
1
[email protected]
Keywords: Anastrepha, reference gene, real-time PCR, normalization, gene expression
Most species in the genus Anastrepha (Tephritidae) are endemic to the Neotropics and many are of great economic
importance because they inflict vast damage to different fruit crops. Brazil, despite being one of the largest producers
of fresh fruit, has low insertion in international markets because of phyto-sanitary barriers that force the improvement
of control techniques. At the same time, there is a considerable demand for quality products with no pesticide
residues. These aspects and the increasing use of genetic control techniques reinforce the importance of a search
for genes that have potential use in genetic control of these species. In order to do so, gene expression studies such
as quantitative real-time PCR (qPCR) are becoming a method of choice by helping to identify potential genes
differentially expressed along the life cycle and specific tissues of target species. The relative expression of a target
gene is determined against reference genes which must be validated to prevent incorrect interpretation. Commonly,
reference genes are housekeeping genes which are expected to have uniform expression during various phases of
development and physiological conditions. Since the patterns of several reference genes may vary among experimental
conditions and tissues types, their standardization to the organisms under study are a necessary first step for any qPCR
analyses. In the present study, we investigate gene expression stability of eight genes usually used as internal references,
Ribosomal protein S17 (rps17), Ribosomal protein L18 (rpl18), β-Tubulin (btub), Troponin C (TpnC), Syntaxin (Syn),
Glyceraldehyde 3 phosphate dehydrogenase (Gapdh), Actin (act) and Elongation factor 1α (eF1a) at different phases
of Anastrepha obliqua development such as larvae (instars II and III), pupae (stages I and II), males and females
virgin adults and males and females post copula. Our results showed remarkable efficiency values, among 100 and
105%, for all genes. We used the software NormFinder to evaluate gene expression stability and showed rps17 as
the best reference gene, being the most stable across the different developmental stages with a stability value of
0.020. However, since the literature points out that it is preferable to use at least two genes in expression analyses,
our analyses indicated that the best combination was btub and rpl18, with a calculated stability value of 0.016.
The NormFinder’s algorithm uses model-based comparison approach and considers both intragroup and intergroup
variation, which were lower for the three genes designated as suitable reference genes for the conditions here
considered. Thus, we believe that these reference genes can be used in forthcoming experiments involving expression
of genes along the life cycle of A. obliqua. TpnC and Syn, despite being reported in the literature as good reference
genes, did not show stable expression to our experimental conditions, which reinforces the need for standardization.
Financial Support: FAPESP, CNPq, CAPES
108
FAT DEPOSITION AND GUT LENGTH IN LG/J X
SM/J MICE
Taniguti, Cristiane H.1; Peripato, Andrea C. 1, 2
Dept. Genética e Evolução, Universidade Federal de São Carlos/São Carlos; 2 Dept. de Biociências, Universidade Federal
de São Paulo/Santos.
1
[email protected]
Keywords: Obesity, QTL, Complex Traits
According to the World Health Organization, the prevalence of obese men and women around the world is about 10
and 14%, respectively. Obesity has reached epidemic proportions globally, with at least 2.8 million of people dying
each year as a result of complication derived by this condition. In this context, uncovering the factors modulating
this disease may aid in finding better strategies to deal with this complex trait. Here we investigate the variation of
fat deposition (reproductive, mesenteric, inguinal, and kidney fat pads) and gut length in female’s mice from LG/J,
SM/J strains and their intercross. We also searched for QTLs (Quantitative Trait Loci) associated to these traits. LG/J
females had significantly more fat deposition and higher gut length when compared to SM/J females (p < 0.001, p <
0.001, respectively) and F2 females (p<0.05, p<0.05, respectively), but did not show any differences among F1 females,
whereas the latter differed significantly from F2 females only for fat deposition (p<0.001). The QTL analyses of 234 F2
females using 101 microsatellite markers spread across the mice genome revealed 12 regions linked to fat deposition
and gut length. Reproductive fat pad showed two distinct QTLs on chromosome 2 explaining together 5% of variation
for this trait. Mesenteric fat pad had five QTLs, on chromosomes 2, 8, 10 and two regions on X, accounting for about
3.7% each of variation for this trait. Inguinal and kidney fat pads have one QTL each, on chromosomes 11 (explaining
3.7% of variation), and 8 (3.4% of variation), respectively. The total fat pad had two QTLs, on chromosomes 8 and
9. Gut length had one QTL associated to small intestine size, on chromosome 9 (5% of variation), and one linked to
large intestine length, on chromosome 2 (4% of variation). These results will enable us to deal with epistatic QTLs
and the search for potential candidate genes associated to fat deposition and gut length in our intercross LG/J x SM/J.
Financial support: FAPESP
109
GENETIC MANAGEMENT FOR EX SITU
CONSERVATION OF RED-BILLED CURASSOW,
CRAX BLUMEMBACHII (AVES, CRACIDAE)
Costa, MC1; Camargo, C2; Silveira, LF3; Francisco, MR1.
Departamento de Ciências Ambientais, Universidade Federal de São Carlos, Campus Sorocaba, Sorocaba, SP; 2Instituto
de Biociências de Botucatu, Universidade Estadual Paulista “Júlio de Mesquita Filho” – UNESP, Botucatu, SP; 3Museu de
Zoologia da Universidade de São Paulo, MZUSP, São Paulo, SP
1
[email protected]
Keywords: Captive population, ex-situ breending, genetic monitoring, microsatellites marker, cracids.
The Red-billed Curassow, Crax blumenbachii (Spix, 1825), is an endemic bird of the Brazilian Atlantic Forest, and
it is already extinct in most of its original distribution, being listed as “Endangered” in the Red List of International
Union for Conservation of Nature. Captive breeding and reintroduction in natural areas are viable strategies for
the recovery of this species. Nevertheless, captive populations were founded from a small number of individuals,
generating the risk of consanguineous matings. One approach used to avoid inbreeding is the genetic monitoring of
the population, since genealogical information is not available. In these cases, the application of molecular genetic
techniques, such as microsatellites marker, makes possible the replacement of genealogies by calculating the genetic
distance among individuals in order to minimize inbreeding. Thus, the objective of this study was to implement
a genetic monitoring program in the breeding facility “Criadouro Científico e Cultural de Poços de Caldas”, in
Minas Gerais, Brazil, to guide matings, and to increase levels of heterozygosity in future generations. For this, we
used the metric (1-Ps) to calculate the pairwise genetic distance among individuals, according to their proportion
of shared alleles (Ps) in a set of nine microsatellite loci characterized for this species. A matrix was constructed by
combining each female with all the males in the population, and the highest metric values were priorized. The
analyzed captive population of C. blumenbachii had 17 adults, being six males and 11 females, that were paired
forming two couples and three trios. The prior average genetic differentiation of these couples was 0.36. However,
the analysis enabled to indicate new pairings which average genetic differentiation of 0.50. Furthermore, there
were three unpaired females, and one of them had one exclusive allele in two different loci. The exclusion of
individuals with privet alleles in the reproduction reduces the genetic diversity of the population, and may increase
the kinship levels. Accordingly, it was suggested an ideal scenario formed by one couple and five trios, so that all
females would be able to reproduce. Levels of heterozigosity in their offspring should be systematically evaluated to
access whether the genetic management provided a positive effect on the ex-situ breending program of this species.
Financial Support: FAPESP (Ref. Proc. Nº 2011/06210-1).
110
NEW HETEROLOGOUS MICROSATELLITE
AMPLIFICATIONS IN BRYCON ORBIGNYANUS
(ACTINOPTERYGII: CHARACIDAE), FOR
THE USE IN POPULATION GENETICS
MANAGEMENT, STUDIES AND SURVEYS
Silva, MA1; Carmo, FMS1,2; Nascimento, BR1; Polo, EM1,3; Yazbeck, GM1
Laboratório de Recursos Genéticos, DEZOO, UFSJ, São João Del Rei, MG; 2Faculdade de Castelo, Castelo, ES; 3Pós
Graduação em Genética, Conservação e Biologia Evolutiva, INPA, Manaus, AM
1
[email protected]
Keywords: Heterologous microsatellite, Brycon orbignyanus, B. opalinus, Salminus hilarii, S. brasiliensis, S. franciscanus
Piracanjuba is a common name of Brycon orbignyanus (Valenciennes, 1850), an endangered Neotropical freshwater fish
species from the Prata River Basin from the Southeastern South America, which meaning in the Tupi-Guarani native
languages is “yellow headed fish”. It is an omnivorous species with reasonable acceptability for hatchery conditions
and that has been informally dubbed the Brazilian salmon, for its appreciated taste. Because of its conservation status
and its promising potential for aquaculture, the development of molecular markers for genetic diversity surveys and
stock enhancement is imperative to boost well informed hatchery and environmental management measures and the
screening of useful quantitative trait loci (QTL) for genetic enhancing. Although there are current efforts to isolate de
novo microsatellite for this species, there are no specific loci described so far. We herein tested a batch of microsatellite
markers isolated in close freshwater characid species, some already tested in the literature (seven loci from Brycon
opalinus ) and some novel heterologous essays (with markers originally isolated from Salminus brasiliensis with eight,
S. hilarii, with nine and S. franciscanus with 10 loci), for cross-species amplifications in the targeted species. We tested
each cross-amplification in a sample of 49 Brycon orbignyanus individuals captured for broodstock formation in the
Itutinga Hatchery (CEMIG/Itutinga, MG). Total genomic DNA was extracted with Chelex-proteinase (200 µL of 5%
chelex-100 resin; 2µL proteinase K). For each particular reaction, annealing temperature for PCR was selected for best
results for scoring genotypes, with the aid of a temperature gradient essay. From the 34 heterologous microsatellite loci
tested, 29 loci resulted in PCR product formation. From these, only seven loci yielded intelligible polymorphic patterns
in the observed sample (four from B. opalinus: BoM1, BoM2, BoM6 and BoM13). Although previously reported in the
literature, the patterns and amplification success in cross-species amplification in B. orbignyanus was different from the
results obtained here, or too limited for the drawing of useful conclusions. For example, we succeeded with the scorable
amplification of BoM6 and BoM12, contrary to previously reported, and prior tests with successful amplifications had
very small sample sizes (n=2). Although approximately 81% of the Salminus spp. loci exhibited positive amplification,
only three heterologous markers resulted in consistent and recurrent polymorphic amplifications (Sm25, Sh01 and
Sfra04) in B. orbignyanus. We interpret these results as being indicative of the species close evolutionary relationship.
For the polymorphic heterologous amplifications, the observed number of alleles ranged from two to three (average
2.71 ± 0.48). Loci BoM1 e BoM13 showed to be in Hardy-Weinberg Equilibrium (p > 0.05). Loci BoM2, BoM12,
Sm25, Sh01 and Sfra04 departed from Hardy-Weiberg Equilibrium expectations. These new heterologous loci might
be useful in genetic, breeding, conservation and management studies, along practical measures in B. orbignyanus.
Financial Support: CEMIG-ANEEL and FAPEMIG
111
IMPLEMENTATION OF A DNA BANK FOR
THE FRESHWATER FISH FROM THE UPPER
GRANDE RIVER BASIN
Costa, LO1; Santos, RP1; Silva, MA1; Carmo, FMS1; Yazbeck, GM1
Laboratório de Recursos Genéticos, DEZOO, UFSJ, São João Del Rei, MG, Brasil
1
[email protected]
Keywords: DNA bank, freshwater fish, database, genetic resources, conservation genetics
DNA collections (or “banks”) can be used as a repository of genetic material (tissues, germoplasm, purified nucleic
acids, etc.) and genotypic data for a diversity of studies, projects and programs. The creation of DNA banks with
samples from the genetic layer of biodiversity aims to facilitate genetic studies with the widest range of applications,
such molecular phylogeny, population genetics studies, DNA identification of species and the detection of intra and
interspecific patterns of genetic diversity distribution. We herein communicate the inauguration of a centralized
DNA bank with tissue, specimen and purified DNA samples from freshwater fish species and populations from the
Upper Grande River Basin in the State of Minas Gerais, Brazil. This DNA bank is intended to gather the largest
number possible of different genomes, as well as of population samples from key species of economic and conservation
relevance. The DNA bank has collected, until now, 527 fin tissues from 15 different species from 12 different genera
and six families (Anostomidae, Characidae, Erythrinidae, Loricariidae, Pimelodidae and Prochilodontidae). The
collection also has 11 whole frozen specimens from the following species: Brycon orbignyanus, Salminus brasiliensis,
Leporinus elongatus, Astyanax bimaculatus and A. fasciatus. Tissue samples were identified, labeled and accommodated
in 1.5 mL microtubes containing 70% ethanol. DNA extractions are being conducted for each sample using Wizard
Genomic DNA Purification Kit (Promega) and one third of the resulting extraction product is being immobilized
in Whatman FTA Classic Card fragments for long term storage, one third is being precipitated and stored dry in
the microtube and the remaining sample being kept in suspension and then frozen at – 4°C (for future storage in
a -80°C ultrafreezer). All accessed samples are recorded in an electronic database, programed in Structured Query
Language (SQL), using MySQL, intended for open online broadcasting on the world wide web (http://www.ufsj.
edu.br/recgenlab.php), along with details on sample nature, origin, collector, date, river, locality and taxonomic
information, sample request forms, etc. All samples will be characterized by DNA barcode, from a partial sequence
of the Cytochrome Oxidase Subunit I (mitochondrial DNA). Genetic diversity characterization is being conducted
in Prochilodus lineatus samples (n=208) from three different localities (Volta Grande, Itutinga and Camargos), using
18 microsatellite loci, to draw inference on the population structure of these populations in the study area. The DNA
bank of fish species of the Upper Grande River Basin will be registered in the Cadastro de Coleções Biológicas (CCBIO)
from the Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA) which is the CITES
(Convention on International Trade in Endangered Species of Wild Fauna and Flora) authority in Brazil, and is open
to all the Brazilian research community in need of genetic samples from this component of Brazilian biodiversity.
Financial Support: FAPEMIG and CEMIG-ANEEL
112
ASSOCIATION OF NELLORE COWS
PRODUCTIVE AND REPRODUCTIVE TRAITS
WITH GENETIC POLYMORPHISMS
Nascimento, AV1; Crispim, BA1; Silva, DBS1; Banari, AC1; Seno, LO2; Grisolia, AB1
Faculdade de Ciências Biológicas e Ambientais, UFGD, Dourados, MS; 2Faculdade de Ciências Agrárias, UFGD, Dourados, MS
1
[email protected]
Keywords: Leptin, molecular marker, sexual precocity
The 305C>T polymorphism in exon 2 and nucleotide position 305 of the leptin gene promotes C for T nucleotide
substitution, altering the aminoacid arginine to cysteine, which can determine a change in leptin functionality. The
BM1500 microsatellite is located close to the leptin gene, 3’ of the stop codon in a noncoding region and studies
demonstrate that it may be associated with the regulation of the leptin gene operation. The aim was to identify and
associate the 350C>T polymorphism and BM1500 microsatellite loci with the body weight and age at first calving (AFC)
characteristics in 99 commercial Nellore cows. The animals were subjected to the following weightings: 120d (W120),
210d (W210), 365d (W365) and 450d (W450) and evaluated referring to the age at first calving. Genomic DNA
was extracted from peripheral blood and genotyped by PCR and PCR-RFLP (restriction endonuclease Kpn2I) for the
microsatellite and SNP, respectively. The amplified products for the BM1500 marker were analyzed by electrophoresis in
a 7% polyacrylamide gel stained with silver nitrate and the digestion product for 350C>T polymorphism was visualized
by electrophoresis on a 2% agarose gel stained with ethidium bromide. The analyzes were calculated in CERVUS 3.0
and SAS 9.2 softwares. For 350C>T polymorphism it was observed fragments with 75bp, 94bp/75bp and 94bp,
respectively for the C/C, C/T and T/T genotypes. The studied population had an allele frequency of 0,84 for C and
0,16 for T. Regarding the genotype frequencies, it was observed a higher frequency for the C/C (0,697) in 69 animals
when compared to the genotype C/T and T/T with frequencies 0,283 (28 animals) and 0,02 (2 animals), respectively.
For the BM1500 microsatellite loci we obtained 155bp, 160bp, 165bp, 170bp and 175bp fragments in 92 genotyped
animals. The allele frequency in the population was 0,0172, 0,0345, 0,0115, 0,7586 and 0,1782 for the respective
alleles 155, 160, 165, 170 and 175. As for the polymorphic information content (PIC), the BM1500 marker proved
to be moderately informative and the SNP marker was uninformative and the herd was found in Hardy-Weinberg
equilibrium (p>0,05). For AFC and weight gain characteristics, no significant associations (p>0,05) were observed with
the studied markers. These results suggest that the SNP and microsatellite selected may not be directly involved with
the studied traits, but these may be associated with another mutation located in the leptin gene region or close to it.
Financial support: CNPq, Fundect and UFGD.
113
PHENOTYPIC VARIABILITY OF QUANTITATIVE
TRAITS IN DROSOPHILA SIMULANS AND
ZAPRIONUS INDIANUS FROM FRAGMENTS
OF THE WOOD IN DIFFERENT STAGES OF
ECOLOGICAL SUCCESSION
Penariol, LV1; Madi-Ravazzi, L1
Departamento de Biologia, Universidade Estadual Paulista, campus de São José do Rio Preto – UNESP/IBILCE
[email protected]
Keywords: Phenotypic plasticity, traits morphometrics,drosophilids, Zaprionus indianus, exotic species, bioindicators
Phenotypic variation resulting from the interaction of genetic and environmental factors and is an essential component
of natural selection and adaptation of species. The sensitivity of the drosophilids to environmental effects may be
observed in ecological parameters of the assembly of these flies, and also in character genetically determined, but
strongly influenced by the environment, such as morphometric features. Drosophila simulans, an exotic species with
invasion old and Zaprionus indianus a drosophilid Afrotropical, with recent invasion in the Neotropical and Palaearctic
regions have been used as biomarkers in studies of environmental and phenotypic variability. Here, was compared
the variability of three size-related traits and the one meristic trait sternopleural (STP) bristle number in this species,
between wild-collected flies in four different wood fragments in relation the ecological succession and size. From
each population, a F1 generation, by isofemale line technique, was also grown under the stable conditions of the
laboratory and evaluated to same traits. The variability in size (CV) was higher for wild living flies than laboratory,
and higher for D. simulans than for Z. indianus, contrary to literature data. However, the differences between the
conditions and the number of bristles STP were very small and the variation was within populations and there
are more bristles in females indicating that for this trait, developmental conditions did not practically change the
phenotypic variability. D. simulans showed the highest averages for traits in samples from the largest fragments,
suggesting conditions most stable for these fragments. In a dispersion analysis of the sample data for the D. simulans
wild living flies the fragment G7 different from the other and for the morphometric traits of F1 flies, the fragment
G8 was more dispersed grouping. These differences were not observed for Z. indianus, which can be explained by
recent invasion and its high survivability in harsh conditions. This work initiates a series of studies in the evaluation
of morphometric traits in drosophilid for use in studies of conservation biology and monitoring of forest fragments.
Financial support: CAPES
114
CHARACTERIZATION OF A HYBRID ZONE
BETWEEN THE NEOTROPICAL TOAD SPECIES
RHINELLA MARINA AND R. SCHNEIDERI:
STRONG DISCORDANCE AMONG
PHENOTYPIC AND MOLECULAR MARKERS
Aviz, AC1; Vallinoto , M1,2 ; Cunha,D1 ; Sodré,D1 ; Sequeira F2 ; Sampaio,I1; Schneider,H1
Instituto de Estudos Costeiros, Universidade Federal do Pará, Bragança-PA, Brazil; 2Centro de Investigação em
Biodiversidade e Recursos Genéticos, Universidade do Porto, Porto, Portugal
1
[email protected]
Keywords: toads, hybridization, Amazonia, Cerrado
Two closely related toad species widely distributed in South America (Rhinella marina and R. schneideri) provide
a compelling case study to investigate interspecific hybridization.These species are morphologically similar, only
diagnosable by the presence of a tibial gland in R. schneideri, and ecologically divergent (R. marina occurs predominantly
in Amazonian rainforests, whereas R. schneideri inhabits dry forests of Caatinga and Cerrado). Previous studies have
suggested a historical phenomenon of extensive mtDNA unidirectional introgression from R. Schneider into R. marina
populations from south of Amazon river. We here performed a large-scale analysis using six diagnostic nuclear markers
and the species-diagnostic morphological character across an oriented North-South axis transect between North of the
state of Pará and S. Paulo (Brazil). We analyzed 137 individuals collected in 10 localities. Our results showed a wide
area of introgression (ca. 400 km long), but putative F1 hybrids were only detected in a narrow area around the region
of Palmas within the Cerrado biome. Phenotypic data conflict with molecular data, since the presence of tibial gland
was only detected in both genetically R. marina and R. schneideri individuals southward of the Amazonia rainforest
boundary. Overall, these results suggest that ongoing hybridization processes between these are unexpectedly not
coincident with the ecotone between the typically R. marina and R. schneideri habitat, which could be the result of
a southward expansion of R. marina. Theco incident steep transition from absence to presence of tibial gland, with
the ecological changes of an ecotone, is indicative that this phenotypic trait may belinked to adaptation processes.
Financial Support: CNPq, CAPES, FCT (Portugal)
115
MORPHOLOGICAL, ULTRASTRUCTURAL
AND MOLECULAR DIFFERENTIATION IN
POPULATIONS OF MACROBRACHIUM
AMAZONICUM AND M. JELSKII
Lopes, AG1; Castiglioni, L2; Madi-Ravazzi, L1 and Ceron, CR1
Instituto de Biocências, Letras e Ciências Exatas, UNESP, Câmpus de S. J. Rio Preto; 2Faculdade de Medicina de S. J. Rio Preto
1
[email protected]
Keywords: Macrobrachium, morphometric analysis, ultrastructural analysis, molecular analysis, differentiation
Prawns of the genus Macrobrachium (Palaemonidae; Decapoda) can be found near the coast and in freshwater
environments and are widely distributed throughout tropical and subtropical regions of the world. In the northwest
region of São Paulo state two exotic species are found, M. amazonicum and M. jelskii, which were recently introduced
and disseminated into the aquatic reservoirs of the hydroelectric power plants in this region. Macrobrachium have a
certain economic value because some of them are used for human diet and as bait for fishing. Species of this genus
present high rates of intraspecific variability and interspecific similarity in terms of morphological characteristics,
which are generally used to distinguish them, and may induce mistakes in taxonomic identification. The objective
of the present study was to conduct molecular, morphometric and ultrastructural analysis of M. amazonicum
and M. jelskii, in order to obtain more data about their differentiation. Prawns were collected in reservoirs of
Cervinho in Sales/SP (21º21’38’’S, 49º28’59’’W) and Barra Mansa in Mendonça/SP (21º14’27’’S, 49º56’28’’W).
Morphometric analysis of the telson and caudal thorns was carried out on 40 individuals of each species and on
40 individuals with intermediate length size thorns collected from these localities. Scanning electron microscopy
analysis was carried out on these same structures, including male appendices. Polymorphisms of the Internal
Transcribed Spacer 1 (ITS-1) of ribossomal DNA were analysed in individual samples from prawns of both species
and in samples from prawns with intermediate length size thorns. Morphometric analysis of the telson and caudal
thorn lengths evidenced three different groups: M. amazonicum, M. jelskii and a third intermediate group when
analysed by t-test (p<0.0001). The ultrastracture of the telson and male appendices did not reveal differences
between the species, nor was any polymorphism in ITS-1 region found. The presented results reinforce the high
genetic similarity between M. amazonicum and M. jelskii and indicate, by morphometric analysis, the existence of
an intermediate population, which might suggest the occurrence of natural hybridization between these species.
Financial Support: CAPES
116
LABEL RETAINING CELLS, AND
IDENTIFICATION OF PLURIPOTENCY
GENES/MARKERS IN ZEBRAFISH (DANIO
RERIO) TESTES: AS MEANS TO STUDY
SPERMATOGONIAL STEM CELLS
Doretto, LB1; Martinez, ERM1; Bogerd, J2; Schulz, RW2; Butzge, AJ¹; Nóbrega, RH1,2
¹Department of Morphology, UNESP – Botucatu, São Paulo, SP; ²Division of Developmental Biology, Utrecht University,
Utrecht, Netherlands
[email protected]
Keywords: gene expression, molecular genetics, fish
Stem cells are defined as slowly-dividing cells in multicellular organisms with the potential to either self-renew to
produce more stem cells or to differentiate into specialized cell types. In the testis, spermatogonial stem cells (SSCs)
are the male germline stem cells, being the only stem cell capable to transmit genetic information to the offspring.
The only functional assay to study SSCs available so far is based on transplanting these cells into spermatogenesisdepleted recipient testis, where donor stem cells can then regenerate the recipient´s spermatogenesis. Transplantation
assays have been developed in several species of vertebrates including fish (tilapia, zebrafish, pejerey). However, basic
information on SSC biology, such as cell cycle and molecular markers remain unknown. In this work we have used
zebrafish (Danio rerio, Cyprinidae, Cypriniformes) as vertebrate model to caracterize SSCs using the label-retaining
cell approach (BrdU pulse-chase), by identifying pluripotency genes in the testis by RT-PCR (reverse transcription
polymerase chain reaction) and by using Western-blot to evaluate the presence of the glial cell line-derived neurotrophic
factor family receptor alpha 1 (Grfalpha1), a mammalian SSC marker, to find potential markers for zebrafish SSC.
We found that both types of A undifferentiated spermatogonia (Aund* with a pale, irregular nucleus and Aund with a
dense and round nucleus) retained BrdU for a long period. However BrdU was rapidily diluted among the progenitors
of Aund while among Aund* the label remained stable. This data suggests the existence of two populations of label
retaining cells; “active” (Aund) and “reserve” (Aund*). To identify stem cell candidate markers in zebrafish gonads,
we evaluated gonadal gene expression by RT-PCR using specific primers for pluripotency genes (oct4, nanog, nanos3,
sox2, telomerase, grfα1a and grfα1b, tcf3, stat3, klf4 and geminin) designed based on full-length cDNA sequences
deposited at NCBI. From these grfα1a, grfα1b, stat3 and klf4 were not expressed in zebrafish testis and ovaries.
Western blot studies confirmed that no signal for Grfalpha1 protein was present in zebrafish testis. Mammalian and
other fish testis served as positive controls. Our next step is to identify the expression sites of these markers to examine
which ones are expressed in zebrafish SSCs. Molecular chracterization of zebrafish SSC will be useful for further
studies using either transplantation or SSC in vitro to monitor the pluripotency/differentiation state of these cells.
Finantial support: FAPESP (2012/00423-6; 2013/03384-4).
117
EXPRESSION OF GNRH VARIANTS AND THEIR
RECEPTORS IN THE ZEBRAFISH (DANIO
RERIO) TESTIS: A PRELIMINARY STUDY
Butzge, AJ1, 2; Ricci, JMB2; Doretto, L2; Martinez, ERM2; López, GC3; Somoza, GM3; Nóbrega, RH2
Pontifícia Universidade Católica do Paraná (PUCPR) – Toledo, PR; 2Instituto de Biociências – Departamento de
Morfologia UNESP – Botucatu, SP; 3IIB-INTECH (CONICET-UNSAM) – Chascomús, BA, Argentina
1
[email protected]
Keywords: fish, gene expression, immunofluorescence, molecular genetics
Hypothalamic-GnRH (Gonadotropin-Releasing Hormone) is a key hormone in vertebrate reproduction by stimulating
gonadotropin (Lh and Fsh) release from pituitary. Most vertebrates also express more than one variant of GnRH, which
can be detected in several extra-hypothalamic brain tissue and peripheral organs as well. The anatomic distribution
of the extra-hypothalamic GnRH, its regulation and function in different tissues remain poorly known in fish. The
existence of the multiple extra-hypothalamic variants suggests that besides its primary function on reproduction,
GnRH might be involved in other unknown physiological processes. In this context, the aim of this work is to evaluate
the expression of GnRH variants (zfgnrh2, zfgnrh3) and their receptors (zfgnrhr1, zfgnrhr2, zfgnrhr3, zfgnrhr4) in the
zebrafish D. rerio (Cyprinidae, Cypriniformes) testis and verify by immunofluorescence the testicular cell types that
express GnRH. Forward and reverse specific primers were designed based on the full-length cDNA sequences deposited
at NCBI public database. To evaluate the gonadal gene expression, total RNA from testes and ovaries were extracted,
followed by cDNA synthesis, and semiquantitative reverse transcription polymerase chain reaction (RT-PCR) using
different annealing temperatures (52, 54, 56, 58, 60 and 62°C). For immunofluorescence, a mammalian monoclonal
antibody raised against GnRH1 that also cross-reacts with GnRH3 was used. For the different forms of GnRH, we
found double bands for zfgnrh3 in testis and single band in the ovary. zfgnrh2 was no expressed at all in testes and
ovaries. For the receptors, all were expressed; zfgnrhr2, zfgnrhr4 showed single bands for both males and females, while
zfgnrhr1 and zfgnrhr3 double bands in females and in males. We still do not know the significance of the double bands
which persisted in all temperatures studied. Different GnRH splicing variants may be present in the gonads but this
will be further confirmed by sequencing studies of these bands. Preliminary results of the immunofluorescence, showed
that GnRH is expressed in Sertoli cells and Leydig cells. The presence of GnRH and its receptors in the gonads may
be related to paracrine/autocrine functions of GnRH on gametogenesis and gonad functions. The interpretation of
the possible role of GnRH and its receptors will be assess by real-time qPCR in different gonadal stages (recrudescence
versus differentiation) in order to understand the mechanism of action of GnRH in the gonads of zebrafish.
Financial Support: FAPESP (2012/00423-6); CNPq (482946/2012-1).
118
ANTI-MÜLLERIAN HORMONE (AMH) IN
COMMON CARP (CYPRINUS CARPIO):
IDENTIFICATION, PARTIAL SEQUENCE,
EVOLUTION AND TISSUE DISTRIBUTION
Martinez, ERM1; Severino, FE1; Ricci, JMB1,3; Vigoya, AA1,3; Schulz, RW2; Bogerd, J2; Nóbrega, RH1.
Universidade Estadual Paulista (UNESP/IB), Botucatu, SP; 2Utrecht University, Utrecht, Holanda; 3Universidade Estadual
Paulista (UNESP/CAUNESP), Jaboticabal, SP
1
[email protected]
Keywords: gene expression, molecular genetics, fish
In zebrafish, spermatogonial stem cell (SSC) niche is formed by Sertoli cells surrounding SSC and the adjacent
interstitial elements such as Leydig cells and blood vessels. Follicle-stimulating hormone (Fsh) and growth factors such
as anti-müllerian hormone (Amh) and insulin-like growth factor 3 (Igf3) play an important role in the regulation of
SSC niches in zebrafish. While Amh inhibits spermatogonial differentiation, Igf3 stimulates differentiation towards
spermatogonial proliferation and meiosis. However, it is yet unknown how Amh and Igf3 interact with each other
and if this this knowledge can be applied to large teleosts of commercial relevance, such as C. carpio (Cyprinidae,
Cypriniformes) to inhibit spermatogonial differentiation and puberty for instance. Therefore the aim of this study
was to characterize the amh cDNA in carp, and evaluate its gene expression in testis in order to better understand the
involvement of amh in spermatogenesis. To obtain a partial carp amh cDNA sequence, primers were designed based
on full-length cDNA sequences of zebrafish amh. Reverse transcription-polymerase chain reaction (RT-PCR) was
performed on cDNA of carp testis. Agarose gel electrophoresis yielded PCR products of the expected lengths that were
gel extracted, cloned, and sequenced. The obtained 720 bp sequence was coded for a protein domain homologous to
the TGF-β superfamily domain of Amh. Further comparative analysis was done with different sequences deposited
in NCBI for this Amh domain. The evolutionary analyses were conducted by a method determining phylogenetic
distance, Neigbhor joining (NJ) using a heuristic search with 1000 bootstrap replicates. The results were obtained using
the software MEGA version 5.0. A consensus cladogram was generated without rooting. The evolutionary hypothesis
for amh showed that C. carpio is in the same clade as Carassius auratus, and these two together are related to D. rerio,
forming the group Cypriniformes. Further, specific carp amh primers were designed to evaluate by RT-PCR the
expression of amh in different tissues/organs in both sex (brain, gills, heart, liver, muscle, intestine, eye, testis and ovary).
amh expression was detected in liver and gonads, being stronger in the liver of the female and testis. We aim to clone the
full-length amh cDNA and quantify by real-time qPCR amh expression in different developmental stages in the testis
as well as after different hormonal conditions in vitro to better understand the role of Amh in carp spermatogenesis.
Financial Support: CNPq (482946/2012-1; 150068/2012-3) and FAPESP (2012/00423-6).
119
CHARACTERIZATION OF TUSC3 GENE,
INVOLVED IN PROSTATE CANCER THROUGH
THE MODEL SYSTEM DROSOPHILA WING
AND OSTGAMMA SIGNALING PATHWAY
Oliveira, Marianna Nascimento; 1Dósea, Victor Nascimento; 2Costa, Mara Sílvia Alexandre; 2Saita, Ana Paula;
Ramos, Ricardo Guelerman Pinheiro; 1Octacílio-Silva, Shirlei.
1
2
Depto. de Morfologia – CCBS/UFS – São Cristóvão/SE; 2Depto. de Biologia Celular e Molecular e Bioagentes
Patogênicos – FMRP/USP - Ribeirão Preto/SP.
1
e-mail: xxxx
Keywords: xxxx
Prostate tumour is the second most common type of cancer among men and it is the 6th around the world, according
to INCA (National Institute of Cancer-Brazil). It is extensively known that tumorigenesis has its origins in the
mutation accumulation along time, presenting the highest frequency in old people because of their greater exposition
to mutagens. To a deep knowledge about the molecular basis of cell tumour, model organisms have been used,
including the insect Drosophila melanogaster, which is used in this work. In this context, it was performed a search
for human genes which mutations was related to prostate cancer and with homologues in D. melanogaster through
the tool HOMOPHILA, which compares sequences from NCBI OMIM (Online Mendelian Inheritance in Man)
databank with sequences from FlyBase databank. One of the results was the TUSC3 gene (Tumor suppressor candidate
3), mapped in the chromosome 8, band 8p22, which is deleted in metastastic tumours. TUSC3 protein presents
57% of sequence similarity with Drosophila protein Osty (Oligosaccharide Transferase gamma subunit), sharing an
OST3/OST6 domain, important for glycosilation processes. Adult heterozygous individuals from a deficiency stock
including Ostgamma, among other genes, present defects in the wing, showing cuts in the margins with variable
expressivity and penetrance of 47%. These defects could be due to the deletion of the other genes mapped in the
deficiency region, but further in silico analysis of Ostgamma, performed with the tool Feature Mapper in the Flybase
databank, shows putative transcription binding sites specially for two proteins, involved in wing development: i)
Medea, which is involved in cell cycle, apoptosis, angiogenesis through Wnt, BMP and TGF-b pathways, and is
expressed in the wing during the development; ii) Chronologically inappropriate morphogenesis (Chinmo), which is a
protein with a BTB/POZ domain and it is involved in wing disc morphogenesis. At the level of Ostgamma expression
regulation, wild type embryos, larvae, pupae and adult present a differential profile, peaking in mid-early embryonic
and mid-early pupal stages, as shown by qPCR. These results show that Ostgamma is involved in specific processes
during development. The wing cut defects are probably related to alterations in the signaling pathways controlling
cell proliferation, differentiation and death, which are impaired during tumorigenesis. Our deficiency stock presents
cuts in wing margin, making it a possible model system to study signaling pathways leading to tumorigenesis and
the sequence similarity with a gene already known to be mutated in prostate cancer specifies this model to prostate
cancer. The profound knowledge about gene relationships is important for the finding of new cancer markers, once
the current markers are not sufficient alone for the prostate cancer diagnosis.
120
INVESTIGATION OF NATURAL SELECTION
SIGNATURES IN CODING REGIONS OF THE
JAGUAR (PANTHERA ONCA) GENOME
Trindade, FJ1; Figueiró, HV1; Villela, PMS2; Gasparin, G2; Andrade, SCS2; Coutinho, LL2; Eizirik, E1.
Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre, RS; 2Escola Superior de Agricultura Luiz de
Queiroz, USP, São Paulo, SP.
1
[email protected]
Keywords: transcriptome, natural selection, genomics
Whole genome sequencing and associated techniques provide unprecedented amounts of data, allowing the use of
novel analytical tools to investigate many important questions on species biology and evolution. One research topic
that can benefit from these novelties is the identification of coding genes under natural selection, which present
specific signatures when compared to other genomic regions. One strategy used to distinguish those regions is the
quantification of synonymous and non-synonymous mutations. This can be investigated based on either genomic data
or through the analysis of processed transcripts. Transcripts can be obtained through different methods, among which
RNAseq has been gaining attention. There are two ways to obtain transcripts via RNAseq: (i) mapping-first, consisting
of aligning reads to a reference genome, and/or (ii) assembly-first, or de novo assembly, which does not require a
reference genome to perform the assembly, allowing studies on species whose genome has not been sequenced yet.
Here we use this approach to investigate the jaguar (Panthera onca) transcriptome. The jaguar is an endangered felid
that is endemic to the Americas, and which so far has not been the target of genomic studies. Our objective is to
identify coding regions on jaguar genome that historically have been under natural selection. We obtained data from
three different tissues (blood, muscle and skin) through RNAseq and assembled the transcriptome using Trinity, a
software that uses deBrujin graphs to build contigs. We then identified the ORFs with Trinity, calculating a likelihood
score for each transcript considering all possible reading frames, and generating an output with the best-scoring
ORFs. To search for orthologous genes we did a BLAST search against the transcriptome of five different species
(Ailuropoda melanoleuca, Bos taurus, Canis lupus, Felis catus and Homo sapiens) using BLASTN 2.2.25+. The percent
overlap of these transcriptomes was 93,87% with F. catus, 89,36% with A. melanoleuca, 88,93% with C. lupus,
82,37% with H. sapiens and 80,39% with B. taurus. Current steps include the use of additional filters and statistical
tests to further validate these data sets. However, the present results already show interesting patterns, such as a broad
assessment of the degree of coding-sequence similarity among species, and its rate of decline as phylogenetic distance
increases. The next steps of the project include the estimation of synonymous and non-synonymous substitution
rates for each gene identified in the jaguar, followed by a in-depth assessment of deviations from theoretic neutrality.
Financial Support: CNPq, FAPERGS, FAPESP
121
NOVEL HETEROLOGOUS AMPLIFICATION IN
SALMINUS BRASILIENSIS FROM SALMINUS
HILARII MICROSATELLITES
Nascimento, BR1; Carmo, FMS1,2 ; Silva, MA1; Yazbeck, GM1
Laboratório de Recursos Genéticos, DEZOO, UFSJ, São João Del Rei, MG, Brasil; ²Faculdade de Castelo, Castelo, ES, Brasil
1
[email protected]
Keywords: Salminus brasiliensis, S. hilarii, heterologous amplification, microsatellite, population genetics
Salminus brasiliensis (Cuvier, 1816), popularly known as golden dorado, is a reophilic Neotropical species that needs to
travel great distances upstream for the completion of its reproductive cycle, in a migratory phenomenon known to the
native nations as “piracema”. This carnivorous characid fish inhabits the Paraná River Basin in Brazil and is the single
largest in its order. S. brasiliensis is conspicuous for its importance among sport anglers and large commercial fisheries,
for its high economic value, for its excellent taste and for its natural beauty, displaying a peculiar bright golden hue.
Aiming to contribute to the development of new molecular markers of potential use in population genetic studies
and management, this work tested the transferability and utility of previously described microsatellite markers from S.
hilarii in S. brasiliensis genomic DNA. We used 19 individuals from three distinct localities in the Minas Gerais State
(Itutinga and Camargos reservoirs and Vermelho Creek) and performed population evaluations on the largest sample,
consisting of 12 individuals from Itutinga, collected for broodstock formation in the Itutinga Hatchery (CEMIG/
Itutinga, MG). Genomic DNA was extracted with Chelex-proteinase (200 µL of 5% chelex-100 and 2 µL proteinase
K). PCR conditions were set to 2 mM of MgCl2, 0.5 U of Taq DNA Polymerase, 0.2 µM of each primer, 0.1 mM of each
dNTP, 50 mM of KCl and 10 mM of Tris-HCl, in a final volume of 10 µL. Annealing temperatures for different PCRs
were selected with the aid of temperature gradient essays, for optimal genotype scoring conditions. We tested six out of
nine S. hilarii microsatellites previously described in the literature. All six loci tested exhibited positive amplifications in
the target species DNA and, from these, only one could not be salvaged, for resulting in monomorphic amplifications
in all the 19 tested individuals. Five loci resulted in polymorphic amplification (Sh01, Sh05, Sh12, Sh56 and Sh85).
The observed number of alleles ranged from 4 to 8 (6.4±1.36). Three loci did not show Hardy-Weinberg proportions
departure (Sh01, Sh56 and Sh85; p>0.05). These five markers can be used in S. brasiliensis population genetics studies
and management measures. Its application, along other markers for S. brasiliensis, in the elucidation of the genetic
population structure of this species will be of important value in fisheries management and conservation efforts.
Financial Support: CEMIG-ANEEL and FAPEMIG
122
THREE DISTINCTIVE KARYOTYPES
TO PHYLLOMYS PATTONI (RODENTIA,
ECHIMYIDAE)
Marianna Xavier Machado, Ana Heloisa de Carvalho and Valéria Fagundes
Laboratório de Genética Animal, Departamento de Ciências Biológicas, Universidade Federal do Espírito Santo, Avenida
Marechal Campos 1468, Maruípe, 29043-900 Vitória, ES, Brazil.
[email protected]
Keywords: nucleolar organizer region, karyotype diversity, cytogenetics, polymorphisms, Phyllomys
Spiny-rats of Phyllomys Lund, 1839 are representatives of the family Echimyidae found in the Atlantic Forest of
eastern Brazil. Due to the frequent taxonomic confusion and the lack of diagnoses of Phyllomys, their representatives
were included in the past under different genera of Echimyidae. Currently, thirteen species are recognized. Karyotypic
studies in Phyllomys are rare and most of them only mentioned the diploid number and the fundamental number
(FN) without a formal description of chromosome morphologies. Most of the information is restricted to personal
communications, unpublished theses and dissertations of conventionally stained karyotypes. Nine karyotypes are
known for the genus, and each karyotype is very distinctive from each other. Karyology of P. pattoni has been an
intriguing issue since two karyotypes was associated to this species. The first karyotype with 2n=80/FN=114 was
described for a specimen from the state of Espírito Santo, Brazil, based on a conventionally stained karyotype.
The second one presents 2n=72/FN=114 and was assigned to two specimens from state of Rio de Janeiro. Sex
chromosomes were not identified. At that time, it was assumed that this karyological distinction represented a
polymorphism in the species. Considering the relevance of karyological data in rodents, we analyzed metaphases
cells of 14 specimens of P.pattoni from five localities. Silver-staining, GTG- and CBG-banding were performed.
We found two karyotypes, 2n=80/FN=108 (2n=80/FN=114 reinterpreted) and a novel karyotype, 2n=76/FN=148.
The latter is composed of 33 pairs of biarmed and four pairs of uniarmed autosomes; large acrocentric X and small
metacentric Y chromosomes; constitutive heterochromatin (CH) is conspicuous and restricted to pericentromeric
region of biarmed pairs 1, 2, 3, 4, 8 and 9, and of the X and proximal to centromere of pair 33; G-banding allowed
identification of homologies of the largest pairs; Ag-NORs are interstitially to the long arm of pair 12.Our results,
combined to those from literature, revealed that three karyotypes has been associated to Phyllomys pattoni: 2n=72/
FN=114 from Rio de Janeiro; 2n=76/FN=148 from Bahia; and 2n=80/FN=108 from Bahia and Espírito Santo.
Considering the 2n and FN, the three karyotypes are very distinctive. The karyotypes 2n=76/FN=148 and 2n=80/
FN=108 are distinctive by Y chromosome morphology, CH distribution, G-banding pattern and location of AgNORs. The hypothesis of chromosomal polymorphisms in P. pattoni should consider that the three karyotypes
underwent to several rearrangements. However, those rearrangements could cause severe meiotic problems in putative
hybrids due to inability to normally segregate in meiosis. Thus, we are prone to assume that 2n=80 and 2n=76 are
not related to polymorphisms in P. pattoni but distinct and incompatible karyotypes related to non-breeding taxa.
Financial Support: CNPq, CAPES, FAPES.
123
EVOLUTIONARY DYNAMICS OF
TRANSPOSABLE ELEMENTS IN FAMILIES
STERNOPYGIDAE AND HEPTAPTERIDAE FISH
(TELEOSTEI)
Sene, VF; Pansonato-Alves, JC; Oliveira, C; Foresti, F.
Laboratory of Fish Biology and Genetics - Institute of Biosciences, Botucatu, SP - UNESP
[email protected]
Keywords: Eigenmannia, Pimelodella, Rhamdia, repetitive elements; transposons.
The genome in eukaryote organisms is composed by a considerable fraction of repetitive DNA sequences, and among
the components of this fraction the transposable elements have the ability to move around the genome. Primarily,
these elements are divided into two distinct classes comprising the transposons, which in turn move as DNA molecules
to other sites in the genome and the retrotransposons, which move through an RNA intermediate reverse transcribed
sequence. Mobile by their ability, these elements generate structural changes in the insertion sites in the chromosomes,
which could lead to changes in structure or expression of genes. Therefore, in the present work we isolated and physically
mapped the retrotransposable elements Rex1 and Rex3 on the chromosomes of six species of fish belonging to the family
Sternopygidae, more specifically to the genus Eigenmannia and to the family Heptapteridae analyzing species of the
genus Rhamdia, Imparfinis and Pimelodella collected in the components of different river basins. The organization and
genomic distribution of these elements were investigated in these groups of fish. The physical mapping of chromosomes
revealed that both elements presented a dispersed pattern throughout the genome of the species forming small cluster
in all chromosomes. A specific behavior was characterized in the species Eigenmannia sp2 that is characterized by the
presence of a multiple sex chromosome system; in this species the element Rex3 showed to be accumulated and forming
a conspicuous marked block on the Y chromosome. In species of the family Heptapteridae analyzed more specifically
in Rhamdia, Imparfinis and Pimelodella the retrotransposable elements were found quite dispersed throughout the
genome. The informations obtained about the distribution of repetitive sequences in the genome of the species revealed
that at least in the genus Eigenmannia the accumulation of repetitive elements in the Y chromosome can be an indicative
of their relationship with the mechanisms involved in sex differentiation process. Furthermore, the understanding of
movement and accumulation patterns of such saltatory elements in the genome of the species can provide meaningful
informations about the evolution of karytype and their organization and evolutionary dynamics in fish genomes.
Financial support: CNPq, FAPESP, CAPES.
124
PHENOTYPIC DIVERSITY OF NATURALIZED
CHICKENS USING MORPHOMETRIC ANALYSIS
Almeida, ECJ1; Figueiredo, NEM1; Farias Filho, RV1; Pereira, AHR1; Malhado, CHM1; Carneiro, PLS1.
Universidade Estadual do Sudoeste da Bahia, UESB, Bahia, BA
1
[email protected]
Keywords: Gallus gallus domesticus, genetic resources, multivariate analysis, conservation, Peloco.
Most livestock were introduced in Brazil during the colonial period. These animals here have adapted and reproduced
at random, giving rise to several breeds, currently known as naturalized lineages. The native breeds are characterized
by resistance, rusticity and high adaption to Brazilian environmental conditions, but they are largely endangered due
to its gradual replacement by commercial breeds. Peloco chicken is a naturalized breed found in some regions of Bahia
state. These birds are raised in free range system and seem to be adapted to the hot climate of the region. They represent
an important genetic resource for local farmers because of they demand few management and, thus, they can be raised
with less technologic investments. This study aimed to evaluate the phenotypic diversity of Peloco chicken using
multivariate techniques and quantitative morphologic data. The animals were obtained from the Poultry Section of the
State University of Southwest Bahia (UESB), located in the municipality of Itapetinga, Bahia, Brazil, from February to
July 2012. Weight and morphometric data of 27 Peloco birds (11 males and 16 females) were used. The 24 quantitative
morphological descriptors comprised: body weight - PC (kg), body length - CC (cm), wingspan - Env (cm), skull length
- CCr (mm), skull width - LCr (mm), comb length - CCT (mm), comb width - LCt (mm), ocular length - COc (mm),
ocular width - LOC (mm), length beak - CBC (mm), beak width - LBC (mm), ear lobes length - CLO (mm), ear lobes
width - LLO (mm), neck length - CPC (cm), breast length - CP (mm), breast width - LP (mm), breast girth - PT (cm),
back length - CD (cm), tail length - CCd (cm), thigh length - CCX (cm), wing length - CAs (cm), tarsus length - CTs
(cm), tarsus diameter - DTs (mm), central toe’s length - CDP (cm). Each individual was considered as a genetic group
to investigate the intrapopulation diversity. The mean Euclidian distance was used to obtain the dissimilarities matrices
of both males and females. Afterwards, we performed a principal component analysis (PCA). The results showed
differences in the distribution of phenotypic variation between sexes inasmuch as males showed higher contribution
to secondary sex traits, as comb length (CCt = 47.38%), while females had greater contribution of traits related to
growth and body development, as breast length (CP = 41.27%). Among males, the first two CP explained 85.94% of
phenotypic variation. In females, the first three CP explained 86.61% of variation. Therefore, Peloco chicken presents
phenotypic variability in several traits that can be exploited to individual selection based on the superior phenotypes.
Financial Support: CNPq, CAPES and the State University of Southwest Bahia (UESB)- Brazil
125
FIRST MOLECULAR EVIDENCE OF
HYBRIDIZATION BETWEEN TWO SPECIES OF
TRACHYCEPHALUS (ANURA, HYLIDAE) IN
NORTHEASTERN BRAZIL
Zaidan, FC; Martinelli, AB; Fagundes, V.
Laboratório de Genética Animal (LGA), Departamento de Ciências Biológicas, UFES, Vitória, ES
[email protected]
Keywords: treefrog, phylogeny, ND2, Tyrosinase, Bahia
The genus Trachycephalus Tschudi, 1838 (Anura, Hylidae) comprises 12 species, distributed from the Mexican
lowlands to North-eastern Argentina. T. nigromaculatus (Tni) is distributed in the Atlantic Coast of the states of São
Paulo/SP, Rio de Janeiro/RJ and Espírito Santo/ES and in the countryside of the states of Bahia/BA, Minas Gerais/
MG and Goiás/GO. T. mesopheus (Tme) occurs in Eastern Brazil, from Southern Pernambuco/PE to Rio Grande
do Sul/RS and inland areas of Eastern and Central MG. T. typhonius (Tty) is widely distributed, from southern
Mexico to northern Argentina, and in Brazil it is recorded from the Amazon to Rio Grande do Sul. There is sympatry
of Tni and Tme in the states of SP, RJ, MG and ES. In a previous phylogenetic study using mitochondrial DNA
of Atlantic species of Trachycephalus we observed contrasted results of two specimens from Jequié/BA, that were
morphologically identified as Tni and Tme, but genetically similar to Tni. Thus, these specimens deserved further
molecular identification. We sequenced the partial region of the mitochondrial Nicotinamide Dehydrogenase subunit
2 gene (ND2; 824bp) and the exon 1 of the nuclear Tyrosinase gene (TYR; 512bp) from 36 individuals of the three
Atlantic species of Trachycephalus (Tni/n=16; Tme/n=15, and Tty/n=5) from 23 localities in Brazil. The DNA was
extracted using the salt protocol. Amplicons were generated by PCR using primers ND2ELEUF1/ND2ALAR for
ND2 and TYR1C/TYR1G for TYR. The sequences were generated in an automatic sequencer (ABI3500, Applied
Biosystems®) at Núcleo de Genética Aplicada à Conservação da Biodiversidade/NGACB/UFES. Phylogenies were
inferred using Maximum Likelihood (ML) and Bayesian Inference (BI) approaches and genetic distances were
calculated on Mega v.5.0 using Kimura-2-parameters as evolutive model. Both ML and BI analysis for ND2 and
TYR recovered three clades, each one related to Tni, Tty and Tme species, with high support (ML>80; BI>95). ND2
analyses grouped the two individuals from Jequié/BA (Tme and Tni) in Tni clade, while TYR analyses grouped Tme
specimen to Tme clade, and Tni specimen to Tni clade. Intra-specific genetic distances were low for ND2 (1,7-2,8%)
while inter-specific varied from 13,9-16,4%. For TYR, intra-specific varied from 0,2-1,5% while inter-specific ranged
from 1,5-3,4%. For ND2, Tme from Jequié/BA is 13,5% divergent from Tme and 2,4% for Tni specimens; while
for TYR, Tme from Jequié/BA is 0,2% divergent from Tme and 3,3% for Tni specimens. These results indicated
that the Tme Jequié/BA specimen has Tni maternal lineage and Tme paternal lineage, compatible to an interspecific hybrid This is the first evidence of hybrids among Trachycephalus species, which were previously suggested
in literature based solely on field observations. Also the record of Tni in Jequié/BA represents the northernmost
known locality for Tni occurrence, increasing its geographical range in 270km north in the state of Bahia.
Financial Support: CAPES, FAPES and CNPq
126
GENETIC VARIABILITY OF THE COMMON
SNOOK (CENTROPOMUS UNDECIMALIS)
USING FIVE MICROSATELLITE LOCI
Lima-Rosa, CAV1,2; Herkenhoff, ME2; Gaulke, R3; Cordeiro, AB4; Remualdo, VR3;
Centro de Educação Superior da Região Sul, UDESC, Laguna, SC; 2Centro de Ciências Agroveterinárias, UDESC, Lages,
SC; 3Laboratório Genolab, Blumenau, SC; 4Universidade Santa Cecília, Santos, SP
1
[email protected]
Keywords: snook, common snook (Centropomus undecimalis), genetic polymorphism, microsatellite
The marine fish farming has great potential for expansion in Brazil. Due to the predatory nature of fishing, and the
increasing demand for fish in the market, it is necessary to the cultivation of marine species of economic interest.
Among the numerous species, stands out the snook, especially the common snook (Centropomus undecimalis) and fat
snook (Centropomus parallelus), having great potential due to its tasty characteristics and favorable levels of productivity.
Furthermore, the common snook has shown several biological characteristics favorable to production in captivity,
including: well adapted to captivity, easily accept inert food and have good feed conversion rate. Microsatellites are
tandem repeats located in non coding regions of the genome of eukaryotic organisms, which makes this efficient
tool to determine the genetic variability because their polymorphisms are neutral, do not affect the expression of
the phenotype and therefore do not suffer the action of natural selection. This study had to aim investigate the
nuclear genetic variability in farm and wild common snook populations using microsatellites loci. At moment, we
collected and analyzed a blood and tissue sample from 20 farm individuals. We used 5 microsatellites loci: Cun
01, Cun 05B, Cun 08, Cun 09 and Cun 10A. The fragments were amplified using the polymerase chain reaction
(PCR) and they were analyzed by a poliacrylamide gel (5%). We have founded 21 alleles (99-171 bp) in the Cun
01 locus, 6 alleles (144-159 bp) in the Cun 05B locus, 16 alleles (167-237 bp) in the Cun 08 locus, 21 alleles (241293 bp) in the Cun 09 locus and 14 alleles (159-187 bp) in the Cun 10A locus. Eleven alleles from the Cun 01
locus, 2 from the 05B, 9 from the Cun 08 and 8 from the Cun 09 were never described before. The results of the
number of obtained alleles per loci are according with the minimal number alleles suggest by Barker (1994), that
need to be as more as four. The polymorphism found in these loci enable the use of these microsatellites, in common
snook, with genetic markers in the population variability study, paternity identification and the inbreeding coefficient.
Financial Support: CAPES, Santa Catarina State University (UDESC) and Laboratory Genolab
127
KARYOTYPIC CHARACTERIZATION OF
RHIPIDOMYS EMILIAE (CRICETIDAE,
SIGMODONTINAE) BY CLASSIC AND
MOLECULAR CYTOGENETICS
Vergiana dos Santos Paixão1,3, Julio Cesar Pieczarka1,2, Adenilson Leão Pereira1, Rogério Vieira Rossi5, Ana
Cristina Mendes-Oliveira4, Cleusa Yoshiko Nagamachi1,2.
Lab. de Citogenética, ICB, Universidade Federal do Pará, Brasil; 2CNPq Researcher; 3PIBIC/CNPq Scholarship; 4Lab. de
Zoologia e Ecologia de Vertebrados, ICB, Universidade Federal do Pará, Brasil; 5Dep. de Biol. e Zool., IB, Universidade
Federal do Mato Grosso, Mato Grosso, Brasil.
1
[email protected]
Keywords: cytogenetics, rodent, Rhipidomys emiliae, chromosome banding, Amazon region.
The genus Rhipidomys has large geographic distribution, occurring from Panamá until Southeastern Brazil and North
of Argentina. In Brazil this genus is found in forests from Amazon region, Atlantic forest, Cerrado and humid places
in Caatinga. Eight species were recorded in the country, among them R. emiliae. Cytogenetic studies show that 2n=44
is the most common diploid number, with variation on the Fundamental Number (FN). However, two other diploid
numbers were found, being 2n=48 in R. nitela and 2n=50 in R. sp. B. In the present study we describe for the first time
the cytogenetic data on R. emiliae, by classic and molecular cytogenetics, in five males collected on Parauapebas and
Marabá towns, Pará state, Amazon region. The chromosome preparations were made from bone marrow and stained by
conventional staining, G- and C-banding and Fluorescence In Situ Hybridization (FISH) with telomeric probes. All the
sample has 2n=44 and FN=48, being the autosome set composed by three bi-armed pairs and 16 acrocentric, with size
variation, and one subtelocentric pair. The sex chromosomes pair X and Y are a medium sized and a small acrocentric
respectively. The G-banding pattern allowed the precise pairing of all homologue pairs. The C-banding showed
constitutive heterochromatin (CH) in the centromeric region of all autosomes and in X. The Y chromosome is almost
all heterochromatic. The FISH with telomeric probes showed positive signs only at the terminal regions of all pairs, not
being found any interstitial sequence. The karyotype of R. emiliae is quite similar to R. leucodactylus and R. macrurus.
By comparing R. emiliae with other species with the same diploid number we found differences on the FN, which can
be resulting from pericentric inversions that changed the chromosomes morphology without changing the diploid
number. By comparing R. emiliae with other species with different diploid numbers we suggest that rearrangements
like fusion/fissions can be the reason of this variation. We also found great variation on the morphology of the sex
chromosomes among the species, suggesting that addition or deletion of CH can be responsible for this variation.
Financial Support: Bionorte- CNPq/FAPESPA, VALE-FAPESPA, CNPq.
128
CHARACTERIZATION OF GENETIC
VARIABILITY OF PSEUDOPLATYSTOMA
CORRUSCANS (SILURIFORMES:
PIMELODIDAE) IN RIVERS MS/BRAZIL
Vaini, JO1; Silva, DBS2; Crispim, BA2; Banari, AC2; Hung, CP2; Grisolia, AB2
Faculdade de Ciências Exatas e Tecnologia, UFGD, Dourados, MS; 2Faculdade de Ciências Biológicas e Ambientais,
UFGD, Dourados, MS
1
[email protected]
Keywords: Conservation, hybridization, neotropical fish, microsatellite, natural environment
The presence of interspecific hybrids surubins (Pseudoplatystoma corruscans X Pseudoplatystoma reticulatum) in natural
environment may endanger the existence of their pure parental. Researches on genetic variability of P. corruscans
in rivers of the State of Mato Grosso do Sul are required. The objective was to characterize the genetic variability
of Pseudoplatystoma corruscans in rivers of the State of Mato Grosso do Sul (Paraguay and Parana Basin) and to
evaluate the efficiency of the loci analyzed to discriminate individuals/populations. Fin fragments of 183 fish (P.
corruscans, P. reticulatum and hybrid) from Dourados, Ivinhema, Brilhante (Parana Basin), Negro, Aquidauna,
Miranda, Paraguay (Paraguay Basin) rivers were used. The DNA was extracted with 5% Chelex Resin, performed
multiplex-PCR and PCR-RFLP of the RAG2, GLOBINA, EF1α, 18S rRA and 16S rRNA genes to identify
genetically pure and hybrids fishes. Of the 123 fish collected in the two hydrographic basins visually identified as P.
corruscans only 76 were genetically identified as P. corruscans (10 in the Paraguay Basin and 66 in the Parana Basin).
The samples for the variability study were reduced to 76 P. corruscans. We analyzed 7 microsatellite loci (Pcor 01,
Pcor02, Pcor05, Pcor10, Pcor21, Pcor23, Pcor28). All loci were polymorphic, resulting in total of 57 alleles. The
average number of alleles per locus was 8.14. The observed (Ho) and expected (He) heterozygosity ranged from 0.27
(Pcor02) to 0.70 (Pcor23) and from 0.66 (Pcor28) to 0.87 (Pcor10), respectively. The PIC values were informative,
with an average of 0.75. All microsatellite loci, except Pcor28 were in Hardy-Weinberg Equilibrium. In comparing
the population of the Paraguay Basin with the Parana Basin the Ho was 0.68 and 0.50, respectively, and the He
was 0.70 and 0.76, respectively, meaning, the He for each locus in the populations studied was higher than Ho.
The average number of alleles was 4.86 in Paraguay Basin’s population and 8.00 in Parana Basin’s population. The
structural population analysis showed difference of 6.27% between the two populations and 106.27% within each
population. Genetic differentiation estimates based on FST were not significant (p>0.05), indicating that the two
populations studied are genetically dependent. It was observed the need for conservation of P. corruscans in order
not to lose their genetic variability, because there was observed a loss of heterozygosity, a fact that may be caused by
the presence of hybrid surubin in rivers. This study also confirmed the potential of these markers for management
of pure matrices in natural environment, fish farms and programs for conservation and breeding of this species.
Financial Support: CAPES and Universidade Federal da Grande Dourados (UFGD)
129
STRUCTURAL CARACTERIZATION AND GENE
EXPRESSION OF EXUPERANTIA (EXU) GENE
IN SOUTH AMERICA FRUIT FLY ANASTREPHA
FRATERCULUS (DIPTERA: TEPHRITIDAE)
Oliveira, JL¹; Rezende, VB¹; Sobrinho Jr, IS¹; de Brito, RA¹
¹Laboratório de Genética de Populações e Evolução, Departamento de Genética e Evolução, UFSCar, São Carlos, SP.
[email protected]
Keywords: Anastrepha; exuperantia; fraterculus group; alternative splicing; RNA-seq.
Anastrepha (Tephritidae) is a group of great economic importance due to their impact in national fruiticulture. In this
genus, we are particularly interested in the evolutionary history of the fraterculus group, which includes, among other
species, Anastrepha fraterculus, Anastrepha obliqua and Anastrepha sororcula. These species share many morphological
characters, making taxonomic identification a difficult process. Thus, we seek to establish molecular markers that may
help differentiate species in this group, which would be helpful not only for taxonomy, but also to the understanding
of the evolutionary processes that led to speciation of fraterculus group. Several genes involved with the reproductive
processes have been very informative due to their rapid evolutionary rates, therefore, we wanted to investigate patterns
of molecular evolution of the gene exuperantia (exu), giving that it participates on oogenesis and spermatogenesis (exu
males and females mutants are infertile). Utilizing Next generation sequencing strategies (RNA-seq), we have constructed
cDNA libraries from immature (larvae and pupa) and adult (head and reproductive tract) of males and females from
different reproductive phases of Anastrepha fraterculus. After annotation, we have identified contigs corresponding to
exu in all libraries and partially characterized this gene. Our results indicate similar structural and expression patterns
to Drosophila melanogaster in reproductive tissues: isoforms differ in the 5’ and 3’ untranslated regions (UTR) among
sexes. Despite this, the coding region is common to these alternative isoforms, resulting in the same protein. These
alternative isoforms may result in different promoters and polyadenylation site choices, and differential splicing. In
addition, we also detected expression of exu in cephalic tissues and a new isoform in both sexes showing 5’ UTR
distinct to those of reproductive tissues. This isoform was also detected in larvae and pupa but an additional isoform
that had a different 3’ UTR was also found, albeit they shared the same 5’ UTR. These results suggest the existence of
an alternative exu promoter which may be associated with its expression outside reproductive tissues that, in addition
to the alternative polyadenilation sites and differential splicing, lead to the production of at least two new isoforms.
Financial support: CAPES, CNPq, FAPESP.
130
HIGHLY VARIABLE DERIVED KARYOTYPES
BUT LOW GENETIC DISTINCTION DO
NOT SUPPORT MORE THAN ONE SPECIES
TO THAPTOMYS NIGRITA (RODENTIA,
SIGMODONTINAE)
Colombi, VH1; Passamani, M2 & Fagundes, V1
Laboratório de Genética Animal (LGA), Departamento de Ciências Biológicas, UFES, Vitória, ES; 2Laboratório de
Ecologia e Conservação de Mamíferos, Departamento de Biologia, UFLA, Lavras, MG
1
[email protected]
Keywords: monotypic taxon, phylogeny, taxonomy, genetic distance, cytogenetics
Thaptomys is a genus endemic to the Atlantic Forest, occurring from south Bahia, up to Rio Grande do Sul, Eastern
Paraguay and northeastern Argentina. It is being considered monotypic with T. nigrita its unique species. Karyologically,
Thaptomys has being associated to seven karyotypes: 2n=52,FN=52 with acrocentric autosomes, except to one small
metacentric pair; 2n=50a/FN=48 with acrocentric autosomes, and 2n=48, 49a, 49b, 50b and 51/FN=52, with
variation of 1-4 biarmed autosomes, and one small metacentric acrocentrics, indicating two evolutionary pathways:
(I) 2n=52 to 2n=50a mainly droven by Robertsonian fission and tandem fusions and (II) 2n=52 to 2n=48-51 droven
by Robertsonian fusions. The derived karyotypes of each pathway (2n=50a/FN=48 and 2n=48-51/FN=52) are not
sympatric to each other or to 2n=52/FN=52, and could represent full reproductive barriers by leading to errors
in meiotic segregation on hypothetical hybrids, calling for taxonomic and phylogenetic evaluation. In a previous
study, phylogenetic analysis recovered two clades congruent with the karyotype 2n=52/FN=52 and 2n=50a/FN=48,
which led the authors to propose that each karyotype was associated with distinct taxa. Morphologically, the 2n=50a/
FN=48 individuals showed subtle distinction from other 2n=52/FN=52 populations, with no significance. In this
work, we inferred phylogenetic relationships from mitochondrial cytochrome oxidase b (CYTB; 801p) and nuclear
Interphotoreceptor Retinoid Binding Protein Tyrosinase gene (IRBP; 1084bp) from 112 Thaptomys representatives of
the seven karyotypes. The DNA was extracted using the salt protocol. Amplicons were generated by PCR using primers
MVZ5/MVZ16 for CYTB and +IRBP217/-IRBP1531 for IRBP. The sequences were generated in an automatic
sequencer (ABI3500, Applied Biosystems®) at Núcleo de Genética Aplicada à Conservação da Biodiversidade/
NGACB/UFES. Phylogenies were inferred using Maximum Likelihood (ML) and Bayesian Inference (BI) approaches
and genetic distances were calculated on Mega v.5.0 using Kimura-2-parameters as evolutive model. In phylogenetic
analysis, none of the karyotype was recovered as monophyletic for both genes with low divergence between the
karyotypes (1.2-2.2%). From the point of view of biological species concept three taxa are observed: (i) 2n=52/
NF=52; (II) 2n=50/FN=48, and (III) 2n=48-51, FN=52. The cytogenetic and molecular evidence showed that: there
is no genetic discontinuity between populations with different karyotypes, none of the karyotypes was recovered as
monophyletic, there is low genetic divergence between individuals with different karyotypes, and variant karyotypic
forms are derived from 2n=52. Therefore, we propose that Thaptomys remains monotypic, represented by T. nigrita.
Financial Support: CNPq, FAPES, CAPES
131
GENETIC IDENTIFICATION OF THE
GENUS STRAMONITA: IMPORTANT TOOL
FOR MONITORING FISHERIES AND
CONSERVATION
De Biasi, JB¹; TOMÁS, ARG²; HILSDORF, AWS¹.
Laboratório de Genética de Organismos Aquáticos e Aquicultura - Núcleo Integrado de Biotecnologia, Universidade
de Mogi das Cruzes, Mogi das Cruzes, SP; 2Centro APTA Pescado Marinho – Instituto de Pesca, Santos, SP.
1
[email protected]
Keywords: COI, litoral Paulista, Stramonita brasiliensis, DNA Barcode, Conservation.
There is a lack of fishery statistics or capture data of marine gastropods in Brazil. In São Paulo, the consumption of
marine gastropods is limited to the coastal communities that use them as food and alternative source of income. Among
edible gastropods, those of the genus Stramonita are collected predatorily from the rocky shores. Along the Brazilian
coast two subspecies of the genus Stramonita are present: S. haemastoma haemastoma and S. haemastoma floridana.
They are not regard as cryptic species, but taxonomic problems can be found due to their wide distribution. The
mitochondrial gene cytochrome oxidase I (COI) comparisons known as DNA Barcode is currently the most widely
methodology used for species identification. Considering the potential use of DNA barcode methodology for species
identification, the study aimed at sequencing partial sequences of the COI gene and tests the hypothesis of two species
of genus Stramonita along the coast of São Paulo. Individuals were sampled in three different regions – Ilha Bela, Santos
and Peruíbe - of the state of São Paulo littoral. The whole animal was kept in ethanol for further DNA extraction from
muscle tissue. The COI region was amplify using the primers dgLCO1490 (5’TCAACAAATCATAAAGAYATYGG
3’) and dgLHCO2198 (5’TAAACTTCAGGGTGACCAAARAAYCA 3’) and the amplicons were subsequently
sequenced. The programs Codoncode Aligner and MEGA 5.0 were used for editing, analyzing and alignment of
consensus sequences. Twenty four sequences were analyzed. The subspecies S.h. haemastoma and S.h. floridana
intraspecific divergence average (K2P) was 1% and 0% respectively. The interspecific divergence average was 6%.
Results suggest significant differences between the two subspecies, indicating that they two congeneric species
occurring sympatrically along the Brazilian coast. The previously S. h. floridana species is actually S. brasiliensis, and
S. h. haemastoma was named Stramonita sp since it presents taxonomic identification difficulties. The possibility of
hybridization should be considered until studies reveal the complete separation of species by reproductive or ecological
barriers. The correct taxonomic knowledge assists stock assessment and conservation along the coast. The uncontrolled
exploitation of these two species jeopardizes the long term viability of their populations along the Brazilian coast.
Financial Support: FAEP, CNPq e FAPESP.
132
GENETIC DIVERSITY ANALYSIS
OF TETRAGONISCA ANGUSTULA
(HYMENOPTERA: MELIPONINI) USING
MICROSATELLITE MARKERS
Medeiros,AC¹ ; Lopes,DM¹ ; Campos,LAO¹.
¹Departamento de Biologia Geral, UFV, Viçosa, MG
[email protected]
Keywords: Tetragonicsa angustula, microsatellite, diversity
Bees have great importance because they are the principal pollinators of angiosperms and also important in the
production of commercial items such as honey, beeswax, propolis, among others. The Tetragonisca genus is represented
by small bees and is broadly distributed from southern Brazil to Mexico, moreover, is composed of four described
species: Tetragonisca angustula, Tetragonisca fiebrigi, Tetragonisca weyrauchi and Tetragonisca buchwaldi. This study
aimed to analyze the genetic diversity of the species Tetragonisca angustula from the analysis of nuclear DNA, using
microsatellite markers. Three loci were chosen and amplified using specie-specific primers in populations of Minas
Gerais, São Paulo, Espírito Santo, Mato Grosso and Pará states, totaling 130 individuals. The samples were identified
by taxonomist of the area. The three loci were polymorphic. The number of alleles ranged of five to seven. The c2 test
revealed a deviation from the expected genotype frequencies with probability P <0.05 for all loci in the populations.
The medium value found

for the observed average heterozygosity (Ho = 0.10) was much lower than the expected
average heterozygosity (He = 0.69). These values suggest that this species has low genetic diversity which may reflect
the destruction of habitats where these bees are found. The dendrogram obtained from the genetic distances between
colonies analyzed showed the existence of three distinct groups: The first was formed by samples of Pará, Rio de Janeiro
and Mato Grosso. The second only by species of Minas Gerais and the third had species of São Paulo and Espírito Santo.
The Fst values found were very high (Fst = 0.58) indicating a strong genetic structure among populations. According to
some researchers the group needs taxonomic revision and exist probably more species being called T. angustula. For this
reason, the strong structure may be a reflection of errors in the identification, since different species are being compared.
Financial Support: CNPq and FAPEMIG
133
GENETIC DIVERGENCE IN POPULATIONS
OF MELIPONA MANDACAIA SMITH 1863
(HYMENOPTERA: APIDAE) FROM BAHIA
STATE BASED ON MORPHOMETRIC TRAITS
Prado-Silva, A1; Nunes, LA2; Carneiro, PLS1; Pereira, DG1; Waldschmidt, AM1
Universidade Estadual do Sudoeste da Bahia; 2Universidade Federal do Recôncavo da Bahia
1
[email protected]
Keywords: mandaçaia; geometric morphometrics; morphogenetic; anatomical marks; environmental barriers
The stingless bee Melipona mandacaia is an efficient pollinator of plant species in caatinga and its sustainable breeding
might be an income source in familiar agriculture. Nonetheless, the habitat of this species has been destroyed causing
population decline. Therefore, the goal of this study was to assess the morphogenetic structure of populations of
M. mandacaia based on morphometric traits. The specimens were collected in 15 localities along Bahia semiarid
region. The right anterior wings were removed from nine to 13 individuals per colony (three to 26 colonies per
locality). The anterior wings were mounted in glass slides from microscopy analysis and photographed. Afterwards,
12 anatomical marks were plotted per wing and the measurements were performed using the software tpsDig2.
The data were analyzed by PCA (Principal Component Analysis) and UPGMA based on mean values per colony
per locality using the software PAST. To size analysis, we used the centroid size and ANOVA was performed to
evaluate the differences among populations. Mantel’s test was carried out by comparing size and shape data, altitude
e geographic distance between colonies to verify the correlation of these variables by using the software NTSYS
v. 2.02. The three first principal components account for 74% of variation and the dendrograma showed three
clusters. The variance analysis of wing size was significant (ANOVA, P<0.01) inasmuch as populations from distinct
localities were differentiated. Mantel’s test using wing shape revealed no significant correlation with altitude (P>0.05).
However, the size and shape of wings were significantly correlated to the geographic distance of colonies (P<0.001
and P<0.05, respectively). The lack of correlation between both size and shape of wings and altitude was expected
once the sampled localities were all situated between 243 to 692 m. We conclude that populations of M. mandacaia
differ in relation to wing shape, thereby suggesting the influence of environmental barriers among sampled localities.
Support: UESB, FAPESB, CNPq.
134
THE TC1-MARINER SUPERFAMILY OF
TRANSPOSABLE ELEMENTS IN RHODNIUS
PROLIXUS GENOME
Granzotto, A1, Ribeiro, JM2, Carareto, CMA1
Instituto de Biociências, Letras e Ciências Exatas, UNESP, São José do Rio Preto, SP; 2Laboratory of Malaria and Vector
Research, NIAID-NIH, Bethesda, Maryland, USA
1
[email protected]
Keywords: Transposable elements, Tc1-mariner, Rhodnius prolixus, triatomine vector
Transposable elements (TEs) are sequences of repetitive DNA that compose the genome all living organisms and have
different transposition shapes and sequence variability. These sequences, in high copy number can provide a substrate
for illegitimate homologous recombination causing rearrangements that may be deleterious, advantageous or neutral to
their hosts. The TEs can be divided into two classes: Class I, composed of retrotransposons, and Class II, composed of
DNA transposons and each one is hierarchically classified into subclasses, orders, superfamilies, families and subfamilies.
The Tc1-mariner superfamily, focus of this study, is probably the most widespread DNA transposon in nature and is
especially prevalent in insects. The present study describes the Tc1-mariner superfamily content in the Rhodnius prolixus
genome, the most important triatomine vector of the Chagas disease in several South and Central American countries.
The genomic search of Tc1-mariner superfamily on the genome of R. prolixus (assembly RproC1) was done by (1) PSIBLAST (Position-Specific Iterated BLAST) of the coding regions, followed by (2) retrieving genomic matches larger
than 500 nt and e value < 1e-15, with additional 500 nt of flanking regions, by RPS-BLAST (Reverse PSIBLAST). The
consensus sequences of each family were constructed and compared by tBlastX to several TE databases (REPBASE,
NCBI and PFAM databases). The relationships between the sequences of each family were reconstructed through
neighbor-joining analysis using Mega 5. We found a high number of copies in this genome (1,304 sequences) of
which 447 are full-length copies. Among these sequences 1,263 were classified as new Tc1-mariner families, named
hereafter as DTT_mariner-like1 (712), DTT_mariner-like2 (303), DTT_mariner-like3 (154), DTT_mariner-like4
(50), DTT_mariner-like5 (24), DTT_mariner-like6 (15) and DTT_mariner-like7 (5). Only 41 sequences belong to
families already described as mariner (26) and pogo (15). The average evolutionary divergence between these families is
low, ranging from 0.03 (DTT_mariner-like1) to 0.15 (DTT_mariner-like5 and DTT_mariner-like6). The existence
of different families with large number of copies and low divergence, mainly DTT_mariner-like1, DTT_mariner-like2
and DTT_mariner-like3, suggests they suffered bursts of amplification. These bursts may be associated with genomic
stress since R. prolixus faced a recent bottleneck during the adaptation to domesticity. These data, combined with
population studies, might provide a global genomic scenario and better understanding of the evolution of these sequences.
135
OCCURRENCE B MICROCHROMOSOME
SPECIES OF GENDER MOENKHAUSIA GILL,
1858 (CHARACIFORMES: CHARACIDAE)
Nascimento, CN¹*; Troy, WP²; Oliveira, C¹; Foresti, F¹ e Pansonato-Alves, JC¹
¹Instituto de Biociências, Universidade Estadual Paulista “Júlio de Mesquita Filho” (UNESP) Campus de Botucatu;
²Departamento de Ciências Biológicas, Universidade do Estado de Mato Grosso (UNEMAT) Campus de Tangará da Serra.
[email protected]
Keywords: Fish Cytogenetic, karyotype banding C, Supernumerary Chromosomes
Supernumerary chromosomes or chromosomes Bs are defined as additional complement to the standard (A). In
freshwater fishes of the Neotropical region, such supernumerary chromosomes are encountered in more than 60 species
in seven orders. Representatives in order Characiformes highlights the occurrence of considerable variability in the size,
morphology and number of these supernumerary chromosomes. Within this large order of fish, also highlights the
gender Moenkhausia, the most specious groups within the family Characidae. From the viewpoint of cytogenetic this
kind shows the variation of diploid number of 2n=48 to 2n=50 chromosomes and the presence of B microchromosomes
already reported to occur in different species/populations. However, cytogenetic studies in the genus Moenkhausia
collected in headwater streams of the Amazon Basin and the Upper Paraguay River Basin in the State of Mato Grosso
are still incipient. In this sense, the present study aimed to characterize the karyotype of three species Moenkhausia, M.
cosmops, M. aff. forestii and M. oligolepis of different headwaters of the Amazon basin and the Upper Paraguay River
Basin. In this sense, we analyzed three males and two females of M. cosmops from the Verde River and 3 males and 2
females of M. oligolepis from Sangue River (Amazon Basin), municipality of Campo Novo do Parecis, MT, and 6 males
and 4 females of M. aff. forestii Ribeirão do Sapo, basin of the Upper Paraguay River, the city of Tangará da Serra,
MT. The three sampled species had 2n=50 chromosomes in karyotype formula comprised 16m+28sm +6st (NF=100),
for both sexes. However, B microchromosomes were also found in these three species. The data analysis shows that
these polymorphisms numerical range from 0 to 1 B microchromosome M. cosmops, 0 to 2 microchromosomes in M.
aff. forestii and 0 to 1 microchromosomes in M. oligolepis. The C-banding showed little heterochromatin, restricted
almost preferably in pericentromeric regions of several chromosomes of the complement (A) and considerable portions
present in heterochromatic microchromosomes extras. The existence of B microchromosomes in species Moenkhausia
the river systems of the Paraguay River and Amazon shows that the frequency of these genomic elements extras is very
broad within this group and that this feature (presence of B chromosomes) could constitute a plesiomorphic condition
for a large set species within the genus Moenkhausia. Microdissection techniques, construction of chromosomal
probes, chromosomal paintings, as well as cross-hybridization of these probes provide important information about
the origin, evolution, homologies and the existence of inter-and intraspecific variation in species of this genus.
Financial Support: FAPEMAT, FAPESP, CNPq, CAPES
136
FORENSIC GENETICS OF SHARKS FIN
COMMERCIALLY ILLEGALLY IN SOUTHEAST
BRAZIL
Perazza, CA1; Morais, LR1; Domingues, RR2; Hilsdorf, AWS1.
¹Laboratório de Genética de Organismos Aquáticos e Aquicultura – UMC; 2Instituto de Biociências da Universidade
Estadual Paulista – UNESP (Campus São Vicente - SP)
[email protected]
Keywords: PCR-Multiplex, Finning, Shark Fishing, Anequim, Molecular analysis.
The shark fishing has obtained a significant increase due to the high value of their fins, which are mainly exported
to the Asian market. The finning, a practice known involving the illegal capture of sharks, contributes significantly
to this increase. Because of this the marketing of the fins has been the subject of several legal measures in order to
regulate, monitor and identify these products from landing to export. This identification is based on morphological
characters, which may be masked by the abandonment of key pieces making it impossible to identify species illegal
by this method. Therefore, this study aims to identify by molecular analysis shark fins seized by IBAMA in Cananéia
fishing port/São Paulo and illegally traded. The samples were previously identified as Mako popularly known as
Anequim (Isurus Oxyrhynchus), through morphological analysis. Multiplex-PCR was carried out to confirm this
hypothesis using the Internal Transcribed Spacer 2 (ITS2) region of the ribosomal DNA. Two universal primers Fish
5.8SF and Fish 28SR and one specie-specific primer to the Anequim species were used. The DNA was extracted
from the samples according to Phenol - chloroform protocol. By this method, all the samples were identified as
Anequim. The species identification is a first step to control the illegal trading of fins and consequently to inspect
and monitor shark fishing. The use of Multiplex-PCR technique showed to be efficient to identify Anequim
species with clear diagnostic bands. This technique is easy to use and have low cost when compared to sequencing.
Financial support: FAEP, PIBIC/UMC e FAPESP.
137
DEVELOPMENT OF MICROSATELLITES
FOR POPULATION STUDIES OF
STEINDACHNERIDION PARAHYBAE
Leite, AC1; Fonseca, FS1; Ojeda, AP1; Caneppele, D2; Hilsdorf, AWS1
Universidade de Mogi das Cruzes, Núcleo Integrado de Biotecnologia, Laboratório de Genética de Organismos
Aquáticos e Aquicultura; 2CESP - Companhia Energética de São Paulo, Unidade de Hidrobiologia e Aquicultura,
Paraibuna.
1
e-mail: xxxx
Keywords: Surubim-the-Paraíba, Siruliformes, STR, catfish, endemic Brazilian Fauna.
The genus Steindachneridion consists of six species of catfish of medium to large size. Steindachneridion parahybae,
Surubim-the-Paraíba, is endemic to the Paraíba Sul River basin, and it used to be of relatively importance to local artisanal
fishing. This catfish is cited in the Red Book of Brazilian Fauna Threatened as critically endangered. Short Tandem
Repeat (STR) or microsatellites are genetic markers extensively used to assess levels of genetic variability in different
animal taxons. The present study aimed at developing a panel of microsatellites loci specie-specific to S. parahybae
species. Total DNA of six individuals were extracted and mixed. The DNA content of six individuals was prepared for
sequencing on a 454 GS 454 GS FLX+ - (Roche). Default parameters was used to produce minimum contigs length
of 300 base pairs (bp), 62,642 raw reads were assembled from the sequencing run. The contigs were then used to input
into MSATCOMMANDER to find sequences containing repeats. The in silico screening found 6.618 sequences with
di-, tri-, tetra and penta- nucleotide motifs. Primer3 software was employed to design primers for loci with minimum
10 repeats and adequate flanking region. The selected loci were then submitted to algorithm BLAST to ensure sequences
were not product of contamination. Ten loci were firstly picked for genetic polymorphism assessments. Five are dinucleotides, 4 tri-nucleotides and 1 tetra-nucleotides. The PCR reactions conditions for each loci were: SUR1 (56°C ;1,5
mM;152 pb), SUR2 (60°C; 1,5 mM; 219 bp), SUR3 (56°C; 1,5 mM;153 bp), SUR4 (60°C; 2,5 mM;179 bp), SUR5
(54°C; 1,5 mM; 150 bp), SUR6 (62°C; 1,5 mM; 232 bp), SUR7 (62°C; 1,5 mM;158 bp), SUR8 (56 °C;2,0 mM; 142
bp), SUR10 (54°C; 1,5mM 150 bp), SUR11 (60° C; 1,5 mM;188 bp). This panel of microsatellites will be the first
attempt for further population genetic evaluation to establish an appropriate breeding scheme for restocking programs.
138
GENETIC EVALUATION OF COAT COLOR
PATTERN IN BRAZILIAN CREOLE SHEEP
Cavalcanti, LCG1,2; Faria, DA2; McManus, CM1, Souza, CJH3. Moraes JCF3; Paiva, SR4
Pós Graduação Ciências Animais, FAV, UnB, Brasilia, DF, Brazil; 2Embrapa Recursos Genéticos e Biotecnologia, Brasília,
DF, Brazil; 3Embrapa Pecuária Sul, Bagé, RS, Brazil; 4Embrapa Sede, Secretaria Relações Internacionais, Brasília, DF, Brazil
1
Keywords: Ovis aries, conservation animal genetic resources, candidate genes
Sheep breeding in Southern Brazil was characterized by the utilization of Brazilian Creole breed in the early twentieth
century. Currently there are few breeders and for that reason Embrapa maintains a conservation nucleus, which
includes, among its objectives, studies on the genetic mechanisms related to coat color. This trait is economic
important, as the wool of these sheep is medulated and has been widely used in local crafts. Thus, identifying alleles
that regulate patterns of color variation in this breed is strategic and can be used in selection programs, marketing
the products made from naturally colored Creole sheep wool, while assisting in conservation of the breed. Two
different types of melanin are involved in determining coat color of sheep, which is defined by the interaction and
distribution of pigments; the eumelanin causes the expression of black color and white coat color originates from
pheomelanin. In this study we sequenced 954 and 668 base pairs of MCR1 (Melanocortin 1 Receptor) and TYR
(Tyrosinase) genes, respectively, in 35 samples to test the hypotheses of segregation of coat color. The animals used
were kept in the breed nucleus in the Center for Conservation of Creole sheep in Embrapa Southern Region Animal
Husbandry, Bage, Rio Grande do Sul State. After alignment of the sequences for the MC1R gene, five previously
described single nucleotide polymorphisms (SNP) were found. Among these, 218T>A and 361G>A are mutations
that determine changes in amino acid synthesis. SNPs T218 and G361 were observed at a frequency of 0.8, which
suggests complete linkage. All parents in this case had black coats (at least one was heterozygote). All white animals
were homozygotes for both markers confirming the usefulness of this haplotype for monitoring this trait. Two SNPs
were identified in exon 1 of the gene TYRP G192C and C462T with frequencies equal to 0.825 for alleles G192
and C462 which also suggest the complete linkage of these markers. All white offspring were homozygous for these
SNPs (G192 / C462), but animals of other coat colors were also observed for the same haplotype. This confirms
that these SNPs may not act directly on the control of the dominant black phenotype but rather on the brown color.
New experiments are being conducted both to increase the sample size as well as evaluate the action of more genes
within the pathway of melanin production (eg ASIP). Therefore, we expect to validate a specific diagnostic panel
to assist in the selection of animals to be used in controlled mattings and in identifying donors for the Germplasm
Bank of the Conservation Program for Animal Genetic Resources coordinated by Embrapa and partner institutions.
Financial Support: CNPq and Embrapa
139
GENETIC DIVERSITY IN PROGÊNIES OF
BRYCON ORBIGNYANUS (VALENCIENNES,
1849) OBTAINED BY INDUCED CROSSES
Oliveira, DJ¹; Ashikaga, FY¹; Senhorini, JA²; Oliveira, C¹; Foresti, F¹.
¹Laboratório de Biologia e Genética de Peixes, Instituto de Biociências de Botucatu – UNESP, Botucatu/SP; ²Centro Nacional
de Pesquisa e Conservação de Peixes Continentais – ICMBio, Pirassununga/SP.
[email protected]
Keywords: Fish conservation, fishery management, restocking, endangered species, genetic markers.
Natural stock of many fish species have been submited to different environmental stress caused by antropic factors and
have suffered a continuous process of population decline or even have disappeared from many rivers. This strong threat
of extinction hanging over the water bodies has as the main cause human actions that promote drastic changes in the
environment. In an atempt to minimize biological impacts, some conservation measures have been applied, including
restocking actions routinely performed by companies which operate hydroelectric resources. Although this practice
is an important tool for the conservation of biodiversity, the lack of genetic control in the reproductive process of the
species can result in negative outcomes for the maintenance of genetic variability of wild populations. The presented
scenario includes the fish species Brycon orbignyanus, popularly named piracanjuba which constitute an interestig and
comercially valuable product, both for its tasty flesh and search for sportive fishing. The objective of this study was to
evaluate the genetic diversity of offspring resulting from conducted crosses involving individuals from wild populations
and samples obtained from specimens bred and raised in captivity, as a conservation strategy. The crosses conducted
involved specimens collected in the wild in Ivinhema River, a tributary of the Paraná River and captive specimens
derived from stocks kept at fishery stations, according to the matrices wild x wild; captivity x captivity and wild x
captivity. The molecular analysis of the resulting progenies was performed using sequences of the mtDNA control region
(D-loop) as a molecular marker. Among 85 sequences obtained only one haplotype was detected for all youth analized.
It is considered that the low number of partners used in the reproductive process could explain the results. Thus, it is
suggested the use of a great number of wild matrices during the reproductive process, to minimize or prevent loss in the
gene pool and allowing great genetic variability. It is expected that the guidance of the reproductive process based on
genetic studies can result in better management of the species in restocking actions, and contribute to their conservation.
Financial support: CNPq, FAPESP, CEPTA/ICMBio.
140
THE MYOSTATIN-FOLLISTATIN SYSTEM IN
THE REGULATION OF MUSCLE
Galiano, CVM1; Santos, OG1; Santos, RFG1; Carvalho, DS1; Fernandes, FMC1.
Instituto de Biologia, UFBA, Salvador, BA
1
[email protected]
Keywords: Myostatin, follistatin, point mutations
The myostatin-follistatin system is thought to play an important role in the regulation of muscle and bone mass
throughout growth, development, and aging. The myostatin, if it is not interacting with follistatin, promotes the
inhibition of hypertrophy and hyperplasia. On the other hand, at the presence of follistatin this effect is stopped.
The aim of the present work was to analyze the amino acid sequences of these proteins and to look for binding sites
and specific mutations, which could change the interactions between myostatin-follistatin. A total of 27 taxons (12
species) were analyzed for the myostatin, and for the follistatin were analyzed 21 taxons (6 species). The sequences were
collected on March 17th, 2013. In order to discover more sequences, BLAST was used to detect similar sequences of
the two proteins. After the sequences edition, the myostatin presented 378 amino acid positions and the folistatin, 345
that were aligned and edited using MEGA 5.02 software. The myostatin and follistatin sequences are highly conserved
in mammals, like the Bos tauros, Capra hircus, Ovis aries, Equus caballus and Sus scrofa. There is a relevant difference in
the proteins between the orders found on the dataset: Artiodactyla, Primates, Perissodactyla and Rodentia. This could
be related to the lifestyle of these animals, but Bos taurus and Capra hircus show more significant differences related to
the rest of the dataset. This result could be explained due to the fact that genetic improvements can be more noticeable
in goats and oxen. The myostatin dataset showed about 6.78% of mutant positions, being the site 246 a clear hot spot
of mutation, while the follistatin dataset showed almost 2.31% of mutant position only. Since some mutations we
found could lead to a change in the protein structure and the interaction between proteins, we believe that the study
we are carrying out could allow us to highlight the molecular evolution of myostatin-follistatin system.
141
MORPHOLOGICAL AND MOLECULAR
IDENTIFICATION OF SPECIES OF THE GENUS
MACROBRACHIUM BATE, 1868, COLLECTED
IN THE MARANHÃO COASTAL REGION AND
BAIXADA MARANHENSE
FONSÊCA, LCA1, ALVES, JJ1, MACIEL, VL1, PEREIRA, ITF2 , PAZ, FS3; RÊGO, PS3 , TCHAICKA, L1
Laboratório de Biologia Molecular LabWick - Universidade Estadual do Maranhão; 2Pontifícia Universidade Católica do
Rio Grande do Sul; 3Universidade Federal do Pará - Campus Bragança.
1
[email protected]
Keywords: Macrobrachium. Cytochrome Oxidase I. Morphometrics.Aquaculture. Invasive Species
The systematics and taxonomy of some species of freshwater prawns of the genus Macrobrachium Bate, 1868, are
dificult. Some species of this genus have been placed in synonymy by sharing morphological characteristics, as the
second pair of pereopods. Because of its relative abundance and economic importance, its high potential for aquaculture
use in artisanal and commercial fisheries, some species of the genus have been investigated about its physiology and
morphology. There are about 20 species of the genus in Brazil. In Maranhão the following native species are found:
Macrobrachium acanthurus, Macrobrachium amazonicum, Macrobrachium brasiliense, Macrobrachium jelskii and one
more species, Macrobrachium rosenbergii is documented as invasive species. This study aimed to infer the taxonomic
classification of Macrobrachium collected in Maranhão through morphometric data and sequences of subunit I of
Cytochrome Oxidase gene (COI). A total of 46 specimens were collected. The specimens were identified using taxonomic
keys (Holthuis, 1995) and (WOWOR, 2007) and subjected to DNA extraction and amplification using the primers
described by Folmer et al (1994). The sequences obtained were compared to sequences deposited in Genbank (39)
and subjected to genetic analysis using the softwares ClustalX 1.8 and MEGA5. By the use of specific identification
key, were identified 22 specimens of Macrobrachium rosenbergii, 4 specimens of M. acanthurus, 4 M. amazonicum; and
75 specimens were diagnosed as Macrobrachium dacqueti. Using the obtained sequences, it was found that specimens
identified as M. rosembergii and M. dacqueti shared its haplotypes and were grouped with sequences of M. rosemberguii
obtained from Genbank, indicating the monophyly of specimens. For M. amazonicum and M. achanturus information
obtained from COI were not sufficient to accurate identification of the species. Were identified 30 haplotypes from M.
rosenbergii in the coast of Maranhão, the haplotypic diversity Hd was 0.431 and nucleotide diversity Pi was 0, 00686
revealing that invasive populations showed considerable level of genetic variability in relation to the original populations.
The results obtained for M. rosembergii confirm the indications from other studies that suggest that only the use of
traditional morphological characters have been insufficient in the accurate diagnosis of the genus Macrobrachium.
Financial Support: Fundação de Amparo à Pesquisa e Desenvolvimento Científico do Maranhão-FAPEMA.
142
BARCODING OF STINGLESS BEES AND
GENETIC DIVERSITY OF THE GENUS
SCAPTOTRIGONA BY MTDNA SEQUENCES
Geusa Simone Freitas1, Ana Paula Ferreira de Oliveira1, Julia Borges Veiga1, Paulo Emilio Ferreira e Alvarenga1,
Eucleia Primo Betioli Contel1, Ademilson Espencer Egea Soares1
Faculdade de Medicina de Ribeirão Preto, USP, Ribeirão Preto, SP
1
[email protected]
Keywords: Barcoding, Scaptotrigona, stingless bee, genetic diversity, mtDNA, COI
In the survey of stingless bees nests at Ribeirão Preto, USP-campus, we found two species of the genus Scaptotrigona,
S. bipunctata and S. depilis, and these two are considered a third S. aff depilis, which could not be differentiated
morphologically. Thus, the aim of this study was to analyze the genetic diversity of different populations of the genus
Scaptotrigona, besides evaluating the technical barcode to identify the following species: S. bipunctata, S. depilis, S. aff
depilis, S. postica, S. polystica and S. spp, by sequencing the mitochondrial gene cytochrome oxidase I (COI), according
to classical taxonomy. Individuals were collected from nests in several cities in Brazil and taxonomically identified
by comparison with individuals maintained in collections, and then frozen at -20 °C. Genomic DNA was extracted
using the Promega Wizard® reagents. The PCR products were verified in 1% agarose gel and treated with QIAquik
PCR purification kit protocol (Qiagen). Primers LepF1 and LepR1 were used and 638pb were sequenced in the COI
gene from 5 species of Scaptotrigona (n = 90). The search of the sequences in silico was performed in the database of
the NCBI-National Center for Biotechnology Information. The alignment of forward and reverse sequences of each
sample from Scaptotrigona COI gene were compared, corrected and edited using the softwares Chromas Lite 2.01,
and Bioedit 7.3.1.0. In the MEGA 5.05 software, the sequences were aligned by ClustalW tool 1.6 and inferences
were estimated by the method of grouping neighbors (Neighbor-Joining Tree), Maximum Likelihood method and
the bootstrap analysis. DNAsp 5.0 and Arlequin 3.1 softwares were used to estimate genetic and nucleotide diversity.
In the dendrogram, the formation of one large group was strongly supported (100%), in which the sequences with
highest similarity containing all the 5 species of Scaptotrigona. The same was not observed with 3 sequences of S.
bipunctata that was separated from the large cluster. The GTR+20 model was selected by using the Akaike information
criterion (AIC) as the nucleotide substitution model that best explains the evolution of the COI gene sequences.
The Tajima test of neutrality showed negative value of D (-1.78062) as well as the Fs Fu test (FS = -24.41340),
indicating purifying selection and population expansion. Nevertheless, we have to consider that it may be also due to
the low number of individuals in the S. sp, S. postica and S. polystica populations. Furthermore, nucleotide diversity
value was 0.017236, and the low values were found in species with high dispersal ability and related to processes of
population expansion. Thus, the necessity of a greater number of sequences and greater homogeneity between the
populations number could bring more satisfactory results to infer precisely the genetic diversity found in this study.
Financial Support: CAPES / PNPD
143
BURSICON AND ITS ROLE IN THE CONTEXT
OF METAMORPHOSIS IN APIS MELLIFERA
Costa, CP1; Bitondi, MMG2
Faculdade de Medicina de Ribeirão Preto, USP; 2Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, USP
1
[email protected]
Keywords: Bursicon; Apis melífera; Metamorphosis; Exoskeleton; Insect cuticle differentiation
The exoskeleton, or cuticle, makes the interface between the arthropod body and the environment. It functions as
a mechanical support, which allows movement and locomotion, and protects the organism against desiccation and
invasion by parasites and pathogens. The structural components of the exoskeleton are the polysaccharide chitin, several
types of cuticular proteins, lipids and phenolic compounds, which are mainly synthesized by the epidermis. Together,
exoskeleton and epidermis form the integument. The rigid exoskeleton is periodically renewed to allow larval growth
and for shaping the adult insect body. Such renewal events, or molts, ultimately lead to the formation of the melanized
and highly sclerotized (or tanned) adult exoskeleton. The neurohormone Bursicon, which is produced in the Central
Nervous System and acts via receptor coupled to G protein, has been associated to exoskeleton tanning. In this
context, the purpose of the present study was to characterize the expression and aspects of the function and regulation
of the genes encoding the subunits of Bursicon, Amburs α and Amburs β, and encoding the Bursicon receptor, Amrk
(putative ortholog of a Drosophila melanogaster gene, rickets), in the honeybee, Apis mellifera. The expression of Amburs
α and Amburs β in the honeybee brain, and also the expression of Amrk in the honeybee integument, intensify during
exoskeleton melanization and sclerotization. The expression of these genes is induced by the decrease in the ecdysteroid
titer following the peak that triggers the onset of the adult cuticle synthesis. Post-transcriptional silencing of AmBurs
α and AmBurs β mediated by RNAi decreased the expression of genes encoding enzymes (tyrosine-hydroxylase,
dopa-decarboxylase and peroxidase) with a function in cuticle sclerotization and melanization. In contrast, there was
an increase in the levels of transcripts encoding some structural cuticle proteins from the Tweedle (AmelTwdl1 and
AmelTwdl2) and CPR (AmelCPR3) families. The RNAi experiments suggest that Bursicon acts at the transcriptional
level to block the synthesis of some structural cuticle proteins whereas it concomitantly induces melanization and
intensifies sclerotization for cuticle maturation. Together, these data highlighted aspects of the role of Bursicon in the
cascade of events that induces exoskeleton maturation.
144
IDENTIFICATION AND CHARACTERIZATION
OF THE SONG SYSTEM IN TURDUS
LEUCOMELAS (OSCINES) FROM BELÉM,
BRAZIL
Luiz F. Angioletti1, Anderson Teixeira Feitosa1, Gregory Thom2, Lucas Eduardo Araújo-Silva2, Alexandre Aleixo2,
Paula Schneider1, Cláudio Mello3, Patrícia Schneider1, Igor Schneider1.
Universidade Federal do Pará, UFPA, Belém, Brazil; 2Museu Paraense Emílio Goeldi, Belém, Brazil; 3Oregon health &
Science University, OHSU, Portland, Oregon, EUA.
1
[email protected]
Keywords: vocal learning, brain nuclei, songbird, osncine, nissl.
Vocal learning is an attribute expressed in three orders of birds (hummingbirds, parrots, songbirds), cetaceans, and
humans. In songbirds, vocal learning and song production depend on a set of specialized brain nuclei known as the
song system. The ability to learn and produce song serves as a basis for the acquisition of spoken language in humans.
In vocal learning birds, the memorization and production of song share many important parallels with the process of
speech acquisition in humans and relies on a set of discrete telencephalic nuclei referred to as the song control system.
Two specific nuclei located in the most rostral part of the telencephalon have been implicated in vocal learning: Area
X of the striatum (Area X) and Lateral magnocellular nucleus of the anterior nidopallium (LMAN). Nuclei HVC, and
Robustus archistriatalis (RA) are localized in the caudal part of the telencephalon and are involved in the motor encoding
to produce vocalizations. To date, all 4 brain nuclei above have not been found in birds of the suboscine group, which
are considered not vocal learners, but only very few species have been studied. In the present work, we have examined
the presence or absence of HVC, RA, Area X and LMAN in two species of birds: Turdus leucomelas and Willisornis
poecilinotus, a representative seasonal oscine and a suboscine respectively. To determine the presence and characterize the
brain nuclei in these birds, brains were processed and cryosectioned followed by Nissl staining. Each brain hemisphere
was processed and cytoarchitectonic criteria were used to identify and define the borders of the nuclei. The resulting
data will provide the histological groundwork for future studies of molecular markers of the song system in these species.
Financial support: SISBIOTA-CNPq, Capes
145
MALATHION SURVIVAL COMPARISON
BETWEEN TWO POPULATIONS OF
ZAPRIONUS INDIANUS (DIPTERA:
DROSOPHILIDAE) IN UBERABA (MG)
Jesus, FVF1; Galego, LGC1
Universidade Federal do Triângulo Mineiro (UFTM), Uberaba (MG)
1
[email protected]
Keywords: Zaprionus indianus, malathion, insecticide resistance
Malathion is an organophosphate insecticide used in intensive control of disease vectors. In Uberaba (MG), malathion
is applied in the control of Aedes aegypty for over 20 years, which can produce some impact on populations of other
insects that are distributed by region, for example in Drosophilidae species as Zaprionus indianus. Despite this, a rural
district of Uberaba called Peirópolis has low exposure to the insecticide. The aim of this study was to compare the
malathion survival of two populations of Z. indianus, the one coming from the urban area of Uberaba

and another
collected in Peirópolis. For this, 40 individuals (20 males and 20 females) from each population were exposed for 5
hours at a 3x10-4 m L/cm2 malathion concentration in Petri dishes containing discs of paper filters of 15 cm diameter
soaked in a solution acetone/malathion. As control groups, they were organized groups with filter paper soaked in
acetone. For each group, three replicates were made. The survival of individuals per plate was counted and the data were
converted into frequency values and
the mean for each group was calculated and compared with the other groups by
chi-square test. The results showed greater survival in individuals from the urban area of Uberaba

(X = 45.6% +3.0%)
than in Peirópolis (X = 13.3% +2.0%). Whereas the urban area which is most exposed to the organophosphate than
rural one, the results suggest that the species Z indianus could be used for biomonitoring application of malathion.
Financial Support: FAPEMIG/UFTM
146
POINT MUTATIONS IN THE LUTEINIZING
HORMONE RECEPTOR MRNA OF HOLSTEIN
(BOS TAURUS) GRANULOSA CELLS – PARTIAL
RESULTS
Wohlres-Viana, S1; Fernandes, LE3; Reis, DRL2; Arashiro, EKN2; Machado, MA1,2; Viana, JHM2.
Universidade Federal de Juiz de Fora, UFJF, Juiz de Fora, MG; 2Embrapa Gado de Leite, Juiz de Fora, MG; 3Centro de
Ensino Superior de Juiz de Fora, CESJF, Juiz de Fora, MG
1
[email protected]
Keywords: Bovine, Folliculogenesis, SNP
The final steps of follicular development and ovulation are LH dependent. Variations in the LH receptor (LHR)
structure could be related to failures or deficient outcomes observed in cows undergoing reproductive protocols.
The aim of this study was to identify variations in the mRNA of the LHR in mural granulosa cells recovered from
dominant follicles of fertile Holstein cows. Cells from four previously selected cows were collected in vivo, washed in
saline solution and kept in RNA Later (Ambion). RNA extraction were performed with “RNeasy Micro Kit” (Qiagen)
and quantified by nano-spectrophotometry. Complementary DNA (cDNA) was produced using “SuperScript III
kit” (Life Technologies). Nine primer sets were designed based on the Bos taurus sequence available in GenBank
(NM_174381.1) and used in conventional PCR covering the whole transcript extension (2,106 base pairs). PCR
products were purified using the “GFX PCR DNA and Gel Band Purification Kit” (GE Healthcare) prior to DNA
sequencing reactions. Sequence chromatograms were obtained using MegaBACE 1000 DNA sequencer and sequences
were analyzed using “DNA Baser software” (http://www.dnabaser.com). So far, eight SNP’s were detected, from which
five were found exclusively in one animal each, and three was constant in all four animals. With only one exception,
all polymorphisms change amino acid sequence after translation. These polymorphisms can be related to hormonereceptor binding sites leading to a variety of reproductive responses. So far, the results of the present study suggest that
SNPs in the LHR are also present among Bos Taurus breeds, and might be related to the selection for milk production.
Financial Support: Embrapa, CNPq and FAPEMIG
147
POPULATION ANALYSIS OF EDESSA
MEDITABUNDA AND E. COLARIS
(HETEROPTERA: PENTATOMIDAE) USING THE
16S MITOCHONDRIAL GENE
Paula, JA¹; Rauber, ALN1; Souza-Firmino, TS¹; Itoyama, MM¹
¹Universidade Estadual Paulista “Julio de Mesquita Filho” - Campus de São José do Rio Preto – Instituto de Biociências,
Letras e Ciências Exatas-IBILCE/UNESP
[email protected]
Keywords: 16S, Heteroptera, molecular marker
The family Pentatomidae is, in number of species, the largest of Heteroptera. It includes approximately 760 genera
and 4,112 species. These insects are popularly known as stink bugs (in Portuguese, “Marias-fedidas”) because of
the production of an unpleasant odor emitted by ducts of odor-producing glands. In order to characterize the 16S
mitochondrial gene of Edessa meditabunda and Edessa Colaris, we performed 16S RNA sequencing in 10 specimens
of each population, focusing on the evolutionary potential. These sequences were analyzed from a phylogenetic
perspective using the Neighbor-joining, Parsimony, and Maximum Likelihood methods to construct phylogenetic
trees. Edessa meditabunda had a greater number of haplotypes groups (five in E. meditabunda and two in E. Colaris),
but low bootstrap values compared to the topology formed by E. Colaris which indicates greater variability in
specimens of E. meditabunda. The topologies generated in the analysis of the two populations of Edessa showed
themselves separated in their respective species, without haplotype sharing, even though they are congeneric. Using
the analysis of distance we observed an average range of 0.21 and 0.22 in the values of nucleotide substitution
with an average of approximately 22% between E. metidabunda and E. Colaris. From the analysis of the Minimum
Evolution (ME) method carried out by the Network program, it was possible to observe the differentiation between
the two species and no sharing of haplotypes, in a total of 85 different sites observed. The separation between the two
species of Edessa was quite evident in the analyses and, although both species are from the same genus, no haplotype
was shared indicating phylogenetic distance between them. The 16S mitochondrial gene, despite being conserved
among mitochondrial genes in our analysis, was a good marker as it highlighted the differences between species.
Financial Support: FAPESP and FAPERP
148
ASSOCIATIONS OF THE OSTEOPONTIN GENE
WITH PERFORMANCE TRAITS IN A PATERNAL
BROILER LINE
Ibelli, A.M.G.1; Fornari, M.B.1,2; Neis, K.L.3,4; Zanella, R.1,5; Tessmann, A.L.1; Pandolfi, J.R.C.1; Cantão, M.E.1; Ledur,
M.C.1 , Peixoto, J.O.1;
Embrapa Suínos e Aves, Concórdia, SC, Brasil; 2Universidade Federal do Paraná, Curitiba, PR, Brasil; 3PIBIC/CNPq fellow –
Embrapa Suínos e Aves; 4Universidade do Contestado, UnC, Concórdia, SC, Brasil; 5BJT/CNPq fellow
1
[email protected]
Keywords: Chicken, SPP1 , SNPs, Gallus gallus, GGA4
The osteopontin (SPP1) is a multifunctional gene involved with bone remodeling and mineralization. Furthermore,
it is also expressed in many types of cells and tissues being involved in several biological processes. This gene has
been associated with growth and performance traits in livestock species, like cattle, goats and swine. In chickens, this
gene is located in chromosome 4 and harbors multiple QTLs, being a possible positional candidate gene associated
with performance and bone related traits. Thus, the aim of this study was to identify SNPs in the SPP1 gene and
to test their associations with performance traits in a pure broiler line. DNA was extracted from whole blood using
a standard protocol with DNAzol reagent®. For SNPs identification a 766bp fragment of SPP1 was sequenced
in 15 animals: 10 from a paternal broiler line TT and 5 from a layer line CC, both developed at the Embrapa
Swine and Poultry National Research Center. The sequences were analyzed using Phred/Phrap/Consed/Polyphred
softwares, and 11 SNPs were identified: 7 located in intron 6 and 4 in exon 7. Out of those, 10 have not been
previously published in the dbSNP database. A SNP from intron 6 (A>T SNP) was selected to be genotyped in
1340 chickens from the TT line by PCR-RFLP technique, using the XmnI restriction enzyme. The performance
traits analyzed were: birth weight, body weight at 21, 35, 41 and 42 days of age, and feed intake, weight gain
and feed conversion from 35 to 41 days of age. SNP associations with performance traits were tested with QxPak
program v4.0 using a mixed model including the fixed effects of sex, hatch and SNP, and the infinitesimal and
residual random effects. The additive and additive + dominance effects of the SNP were tested including their
interaction with sex. From 1340 chickens genotyped for the A>T SNP, 945 (70%) had AA genotype, 363 (27%)
were heterozygous and 30 (2.32%) had TT genotype. The HWE hypothesis was rejected in this population (p<0.05),
indicating an indirect response to selection towards AA genotype. The additive model within sex had the best fit.
The association between the A>T SNP and performance traits was significant for body weight at 21, 35, 41 and 42
days (p<0.05) and feed intake from 35 to 41 days of age only in females. The results indicate a direct effect of the
SNP on those traits, being a potential marker to improve female performance in chicken breeding programs. The
next step is to evaluate the effect of this SNP in other group of traits, such as carcass, fatness and bone related traits.
Financial Support: CNPq Process nº 481755/2007-1 and Embrapa Project nº 02.10.06.003.00-04.
149
MINING FOR POLYMORPHISMS IN THE
CALB GENE AND ITS ASSOCIATIONS WITH
PERFORMANCE AND CARCASS TRAITS IN A
PATERNAL BROILER LINE
Tessmann, A.L1.; Marchesi, J.A.P.1,2,3; Zanella, R.1,4; Cantão, M.E.1; Pandolfi, J. R.C.1; Ibelli, A.M.G.1; Peixoto J.O.1;
Ledur, M.C.1
Embrapa Suínos e Aves, Concórdia, SC, Brasil; 2PIBIC/CNPq fellow; 3Universidade do Contestado, Concórdia, SC, Brasil;
BJT/CNPq fellow
1
4
[email protected]
Keywords: calbindin, chickens, candidate gene, GGA2, SNP
Genetic selection applied to produce a faster growing chicken are generating negative effects on the locomotor
and metabolic functions, causing huge economic losses to the poultry producer and industry. The calbindin gene
(CALB) is a calcium binding protein located on chicken chromosome 2 (GGA2). This gene is stimulated by
vitamin D in the duodenum, and is involved with bone ossification and calcium metabolism in chickens, being
an important functional candidate gene for broiler production traits. The objective of this study was to identify
polymorphisms in the CALB gene and to test their associations with performance and carcass traits in a paternal
broiler line (named TT) developed by Embrapa Swine and Poultry National Research Center. DNA was extracted
from blood using a standard protocol with DNAzol®. DNA quality and quantity were measured using Nanodrop
spectrophotometer. A region of the CALB gene spanning 858bp was sequenced in 15 chickens: 10 from a paternal
broiler line TT and 5 from a layer line CC. Sequences were analyzed using Phred/Phrap/Consed/Polyphred softwares
and 16 novel SNPs were identified in the intron 6. The most informative SNP (CALB_A787G) was chosen for
genotyping 1396 TT chickens using PCR-RFLP with the enzyme MslI. Out of those animals, 34.8% had the
genotype AA, 16.8% GG and 48.4% AG, accepting the hypothesis that the alleles are in HWE in this population
(p>0.07). QxPak v4.0 program was used to test the association of this SNP with 28 traits: eight performance and
twenty carcass traits, including their weights and yields. A mixed model including the fixed effects of sex, hatch
and SNP, and the infinitesimal and residual random effects was used. The additive effect of the SNP was tested,
including its interaction with sex. The additive effect within sex was the model that better explained the phenotypic
differences observed. Associations between CALB_A787G SNP and body weight at 21 days, weights of carcass,
back, drumettes, wings, thighs and whole legs, and carcass yield were found only in males (p<0.05). These results
indicate that CALB_A787G SNP could be a potential marker to be used in genetic selection to improve growth
and carcass traits in male chickens, particularly to increase the thighs and whole legs weights, which are considered
premium cuts in the market. For these traits, the additive effects of the CALB SNP were 6.2g and 8.5g, respectively.
Financial support: CNPq process n° 481755/2007-1 and Embrapa project n° 02.10.10.06.00300-04
150
EVIDENCE OF GENE FLOW AMONG DISTANT
POPULATIONS OF EUGLOSSA ANNECTANS
(HYMENOPETERA, EUGLOSSINI) EVALUATED
BY GEOMETRIC MORPHOMETRICS OF WINGS
Grassi-Sella, M. L. 1,Garofalo, C. A. 2, Francoy, T. M. 3
Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo (USP). Ribeirão Preto, SP, Brazil; 2Faculdade de
Filosofia Ciências e Letras de Ribeirão Preto, Universidade de São Paulo (USP). Ribeirão Preto, SP, Brazil; 3Escola de Artes,
Ciências e Humanidades, Universidade de São Paulo, São Paulo (USP). São Paulo, Brazil.
1
e-mail: xxxx
Keywords: Euglossini, geometric morphometric, gene flow.
Euglossini bees are main pollinators of many plants species exclusive from Neotropical forest, in especial Orchidaceae
family plants. These bees are known for the potential to fly over great distances, sometimes over than 20Km/day.
Aiming of evaluate the gene flow of these bees populations among four forest fragments (Matão, Ribeirão Preto,
Jundiaí e Gália) within São Paulo state in Brazil, we analyzed 98 Euglossa annectans samples using geometric
morphometric techniques. This methodology is based on the use of homologous landmarks plotted in the forewings
to identify variations in the wing shape of different specimens from the same species. We photographed the right
forewing of each individual and manually plotted 18 landmarks on the wing vein intersections of each sample in
order to verify the similarity among populations the existence of gene flow among them. It is important to state that
these fragments are far away from each other, between 81km to 287km apart. Mantel test was performed from the
analysis of matrix containing the Mahalanobis distances and geographical distances (between forest fragments). The
geometric morphometric analysis shows a great overlap of all bee samples from different locations, demonstrating
little morphological differentiation among groups, and the cross-validation test showed a rate of 64% accuracy.
This low success rate indicates high similarity between the groups and the Mantel test indicated the absence of
structuration among these populations (r =0.42 and p=0.26). These results indicate that these bees are probably
migrating from one forest fragment to another, assisting in the maintenance of gene flow among populations. This
behavior influences directly on the population genetic variability and contribute for the specie preservation. The
used methods were quite satisfactory, besides being of easy execution. However, to consolidate our hypotheses, more
tests will be conducted involving the use of molecular techniques that can accurately estimate the gene flow rates.
Financial Support: FAPESP & CAPES
151
DNA BARCODING FISH RIVER ITAPECURU,
MARANHÃO: A PRELIMINARY ANALYSIS
Nascimento, M.H.S.¹,²; Filho, D. L.¹ ; Almeida, M. S.¹; Vieira, M. N. S.¹; Sousa, I. R. O.; Barros, M.C.¹,²; Fraga, E.C.¹,²
¹Laboratório de Genética e Biologia Molecular/Centro de Estudos Superiores de Caxias/CESC, Universidade Estadual do
Maranhão/UEMA, Caxias – MA; ²Mestrado em Ciência Animal/UEMA, São Luis - MA
[email protected]
Keywords: COI, identification, ichthyofauna, mitochondrial DNA, taxonomic.
The Itapecuru River is genuinely Maranhense, born borders the municipalities of Mirador, Grajaú and São Raimundo
of Mangabeiras and its mouth is in the Bay of São José. The freshwater fishes of South America is the richest
in the planet, yet the Rio Itapecuru well as the vast majority of South American Rivers, have few or molecular
taxonomic studies exploring the fish fauna of addressing the identification. A tool molecular promising is the DNA
barcode in a region that consists of 648pb Cytochrome oxidase I and has shown efficacy in the identification of
various species. The present study aimed the characterization molecular River fish Itapecuru based on sequences
of the mitochondrial COI gene. The specimens were collected with aid of gill nets, cast nets, corrals at the top,
middle and lower course of the river Itapecuru. Total DNA was obtained using conventional phenol–chloroform
protocols. Polymerase chain reaction was used to amplify region of mitochondrial DNA. The fragments obtained
from PCR amplification were sequenced (automated sequencer ABI 3500 - Life Technologies) using the method
Didesoxiterminal with Big Dye kit and the sequences obtained were edited and aligned in the BioEdit program. The
phylogenetic analyses were generated in the Mega 5 program. A total of 102 specimens were collected, representing
27 species, 25 genera, 13 families and 4 orders. Characiformes, with 11 species and Siluriformes with 09, were the
richest species orders. The mean distance obtained by genetic model Kimura-2-paramentro intraspecific was 0%,
intergeneric ranged from 0-11%, intrafamilial ranged from 11-15% and intra-order ranger from16 to 18%, and
100% of samples examined and differentiated by DNA barcoding. To Leporinus piau, and the mean intraspecific
distance was 11% and formed two clade grouped with 99% bootstrap, when analyzed in two specimens platform
Bold Systems feature similarity 97.01 and 99% with Leporinus friderici, and two showed 98.84% similarity with
Leporinus elongatus. The species Rhamphichthys marmoratus and Rhamphichthys atlanticus showed divergence of 0%
and made a single clade with 100% bootstrap, all other species yield a single, cohesive cluster of barcode sequences.
The present study found that fish species studied could be identified effectively by using COI gene, confirming their
efficacy in breakdown of fish, as well as for detecting elevated genetic distance between morphologically similar
specimens. However more samples will be incorporated in the analysis to clarify some issues previously highlighted.
Financial support: UEMA, FAPEMA, CAPES.
152
UNRAVELING THE ASSOCIATIONS OF SOST
GENE WITH PRODUCTION TRAITS IN AN F2
CHICKEN RESOURCE POPULATION
Petry, B.1,2,3; Zanella, R.1,4; Ibelli, A.M.G.1; Fornari, M.B. 1,5; Pandolfi. J. R.C. 1; Cantão, M.E.1; Coutinho, L.L6; Peixoto,
J.O.1, Ledur, M.C.1
Embrapa Suínos e Aves, Concórdia, SC, Brasil; 2PIBIC/CNPq fellow – Embrapa Suínos e Aves; 3 Universidade do Oeste
de Santa Catarina, Joaçaba, SC, Brasil; 4 BJT/CNPq fellow; 5Universidade Federal do Paraná, Curitiba, PR, Brasil; 6Escola
Superior de Agricultura Luiz de Queiroz (ESALQ) – USP, Piracicaba, SP, Brasil
1
[email protected]
Keywords: Sclerostin, poultry, SNP, candidate gene, GGA27
In the last decades, Brazil has become the world’s leading exporter of poultry meat and its third-largest producer.
This success within the chicken industry was due to the better understanding of the animal requirements and
genetic improvement. Molecular techniques have helped to identify genes associated with important traits and to
unravel their mechanisms of action, which can speed up the genomic selection process. Sclerostin gene (SOST)
(NC_006114.3) is located on chicken chromosome 27 (GGA27), and it has been associated with bone-related traits
in other animal species including humans, being suggestive of an important functional candidate gene in chickens.
Therefore, the objective of this study was to identify SNPs in the SOST gene in chickens and to test their association
with important economic traits. A region spanning 1,221 bp on SOST was sequenced using 15 animals (10 from a
paternal broiler line TT and 5 from a layer line CC). Sequences were analyzed using Phred/Phrap/Consed/Polyphred
software for SNPs identification. Twelve SNPs were identified, 10 located in intron 2 and two SNPs in the exon
3. From those SNPS, six of them were not previously described in the dbSNP database. The SNP g.A3291178G
(intron 2) was selected for genotyping 835 chickens from the Embrapa F2 Chicken Recourse Population using
PCR-RFLP and the BsaAI restriction enzyme. The genotypic frequency of this SNP was 1.8% for GG, 33.05%
for AG and 65.15% for AA genotypes, accepting the hypothesis that this marker is in HWE in this F2 population
(p>0.07). Performance, carcass, fatness, organs and chemical composition traits were evaluated in the F2 population
in a total of 48 traits. Associations of the SOST SNP were tested for all those traits using QxPak software v4.0. A
mixed model including the fixed effects of sex, hatch and SNP, and the infinitesimal and residual random effects
was used. The additive and additive + dominance effects of the SNP were tested, including its interaction with
sex. The models with the best fit to the data were the additive and the additive within sex. The additive effect of
the SOST SNP was significant for liver weight and heart percentage (p<0.05). When the additive effect of this
SNP was tested within sex, an interaction was observed for wings weight and feet weight, being significant only
in males. Those results indicate that SOST gene might be associated with locomotor limbs in males. Ongoing
studies are being conducted to test the association of SOST gene with bone-related traits in this F2 population.
Financial support: Embrapa/PRODETAB
153
POPULATIONAL ANALYSIS OF
CONOTRACHELUS HUMEROPICTUS
(CURCULIONIDAE, COLEOPTERA) FROM THE
MITOCHONDRIAL GENE COI
Moura, KCD¹; Souza-Firmino, TS¹; Trevisan, O2, Itoyama, MM¹
¹Universidade Estadual Paulista “Julio de Mesquita Filho” - Campus de São José do Rio Preto – Instituto de Biociências,
Letras e Ciências Exatas – IBILCE/UNESP; 2Comissão Executiva do Plano da Lavoura Cacaueira/CEPLAC, Ouro Preto do
Oeste, RO
[email protected]
Keywords: beetle, molecular analysis, gene.
Conotrachelus humeropictus (Coleoptera) is an important pest that affects cocoa (Theobroma cacao L.) and cupuaçu
(Theobroma grandiflorum) plantations, causing great harm to their producers. Some authors believe that species of
Conotrachelus that attack populations of cocoa and cupuaçu are different, but that they are taxonomically described
as being the same. Aiming to make the genetic characterization of three populations, collected at the Experimental
Station CEPLAC / Ouro Preto do Oeste / RO of cocoa (Population 1), in Ouro Preto do Oeste / RO of cupuaçu
(Population 2), and in RECA / new California / RO of cupuaçu (Population 4), the mitochondrial COI gene of 10
specimens of each population was sequenced. These sequences were analyzed descriptively, statistically and under
the phylogenetic standpoint, using Neighbor-joining, Parsimony and Maximum Likelihood methodologies for the
construction of topologies. The obtained sequences showed 414 sites, of which 402 (97%) were preserved, 12 (2.9%)
were variable sites and 12 (2.9%) were parsimonious sites. In phylogenetic analyses were observed four haplotypes,
with bootstraps above 60%, being 3 haplotypes shared among the populations 1 and 4, and one haplotype was specific
to the population 2. Through the analysis of the evolutionary divergence estimation, using the model of Kimura 2
Parameters nucleotide substitution between the sequences, we observed a maximum of 2.7% of divergence between
populations. The analysis showed that there is genetic variation in this species. However the population 2 has been
demonstrated well established with a single haplotype for the entire population, with bootstrap value of 99% in all
methodologies. As the counterpart, populations 1 and 4 presented similar haplotypes in every analysis, rendering
possible the suggestion that these populations are closely related, more than the comparison with population 2.
Financial support: FAPESP and FAPERP
154
EFFECTS OF IN VITRO CULTURE ON
EPIGENETIC CONTROL OF BIVALENT
DOMAINS (H3K4ME3 E H3K27ME3) AND
EXPRESSION OF NEURONAL GENES IN
CORTICAL NEURONS
Oliveira, CS1,2; Saraiva, NZ2; Barros, FFPC2; Lopes, FL2; Campanha, BCS3; Nogueira, MFG3; Serapião, RV4; Monteiro
FM5; Garcia, JM2
Embrapa Dairy Cattle, Juiz de Fora, MG; 2Departamento de Medicina Veterinária Preventiva e Reprodução Animal,
Universidade Estadual Paulista, Jaboticabal, SP; 3Faculdade de Ciências e Letras, Universidade Estadual Paulista, Assis,
SP; 4PESAGRO-RIO, Niterói, RJ; 5Centro APTA Bovinos de Corte, Instituto de Zootecnia, Sertãozinho, SP, Brazil.
1
e-mail: xxxx
Keywords: xxxx
In vitro culture has the potential to alter chromatin status and gene expression in several cell types. However, cell
culture is a powerful tool to study live systems, allowing faster and more specific assessments than other approaches.
H3k4me3 and H3k27me3 are histone modifications associated to permissive and repressive chromatin states,
respectively, and together they represent bivalent domains. The purpose of this study was to address how in vitro
culture of cortical neurons affects H3k4me3 and H3k27me3 markers and mRNA expression in neuronal genes.
To assess that, neural cortex samples were collected from E.18 mouse C57bl6 fetus and dissociated into single cell
suspension. Cells were immediately fixed/frozen (GI) or cultured for 48h in Neurobasal medium and then fixed/
frozen (GII). For Experiment 1 (n=3 per group), chromatin immunoprecipitation (ChIP) was performed using
a kit, accordingly to manufacturer instructions (EzChIP, Millipore), followed by qPCR for neuronal genes using
standard curve method. Results are presented as total amount of DNA immunoprecipitated with H3k4me3 and
H3k27me3 antibodies for each gene, subtracted from IgG negative control and divided by non IgG precipitated
input. For experiment 2 (n=9 per group), gene expression assessment by qPCR was performed using standard curve
method, and results are presented as total mRNA estimated for each gene. GAPDH was used as endogenous control
gene. Results from GI and GII groups were compared using T-test. In experiment 1, we observed that although the
amount of DNA immunoprecipitated (IP) for H3k4me3 and H3k27me3 was variable between groups, no significant
difference was detected for genes Ascl1 (H3k4me3: GI 0,81±0,49; GII 31,85±42,95/ H3k27me3: GI 0,75±0,63;
GII 29,78±45,02), Nestin (H3k4me3: GI 5,60±8,92; GII 0,95±1,05/ H3k27me3: GI 0,76±0,04; GII 5,44±2,76)
and NeuroD (H3k4me3: GI 0,30±0,09; GII 0,20±0,34/ H3k27me3: GI 1,1±1,58; GII 0,01±0,003). However, for
Neurog1 we observed 1,91 fold enrichment (p<0.05) on H3k27me3 levels in GII (H3k4me3: GI 0,11±0,09; GII
0,17±0,19/ H3k27me3: GI 2,66±1,61; GII 5,09±0,29*). Regarding the pattern between H3k4me3 and H3k27me3
IP levels in each group, we observed similar distribution for Ascl1 (similar levels for H3k4me3 and H3k27me3) and
NeuroGI (higher H3k27me3 levels); for the other genes, an inversion was detected: Nestin (higher H3k4me3 for GI
and higher H3k27me3 for GII), and Neurod (higher H3k27me3 in GI and higher H3k4me in GII). In experiment
2, expression profile remained unaltered between groups for genes: Neurog1 (GI: 8,08±0,86; GII: 8,69±1,42) and
NeuroD (GI: 21,5±1,07; GII: 18,97±1,32). However, Ascl1 expression was higher (p<0.05) for GII (GI: 2,84±0,13;
GII: 3,68±0,27*) and Nestin expression was decreased (p<0.05) in GII (GI: 6,68±0,59; GII: 4,87±0,59*). We
concluded that in vitro culture can affect H3k4me3 and H3k27me3 patterns and gene expression of cortical neurons.
Financial support: FAPESP, FAPERJ and FAPEMIG
155
A STREAMLINED DNA TOOL FOR
IDENTIFICATION OF BILLFISH AND
SWORDFISH OFF ATLANTIC OCEAN:
A CONTRIBUTION FOR FISHERIES
MANAGEMENT
Domingues, R. R.1; Okuda, G. G.2; Biasi, J.2; Amorim, A. F.3; Hilsdorf, A. W. S2.
Universidade Estadual Paulista, UNESP, Instituto de Biociências de Rio Claro; 2Universidade de Mogi das Cruzes, Núcleo
Integrado de Biotecnologia, Laboratório de Genética de Organismos Aquáticos e Aquicultura; 3Instituto de Pesca –
APTA-SAA-SP
1
[email protected]
Keywords: PCR-RFLP, Conservation, Atlantic Ocean
The billfish and swordfish are incidental catches by commercial, artisanal and sport fisheries of several countries.
These fish, due to its high commercial value, is target specie for the surface longline fishery. In Atlantic Ocean these
species are represented by Kajikia albida, Tetrapturus georgii, Tetrapturus pfluegeri, Istiophorus platypterus, Makaira
nigricans e Xiphias gladius. The billfishes and swordfish exhibited subtle morphological differences that are difficult
to observe because of the common practice of head and evisceration, making species identification challenging. The
International Commission for the Conservation of Atlantic Tunas (ICCAT) recommends the useful of genetics
tool for billfishes and swordfish identification, especially K. albida, T. georgii and T. pfluegeri. In this study, was
developed a protocol of molecular identification by PCR-RFLP methods for the species of billfishes and swordfish
with occurrence in Atlantic Ocean. Genomic DNA was extracted from 25 mg of tissue using QIAmp Tissue kit
(Qiagen Inc., Valencia, CA, USA) and amplified the COI region of DNAmt. A PCR fragment of 800pb was amplified
and submitted the enzymatic restriction. A total of 28 enzymes cleave the sequences, but two enzymes (Taq I and
Hae III) produced differences banding patterns (A, B, C, D), that combined, distinguish species. A blind test was
applied for validate this method, with 240 analysis and 236 hits (98,3%) indicating its efficiency. In Brazil, the
species K. albida and M. nigricans have catch prohibited by Normativa Instructions 05 at IBAMA, but are captured
routinely. This methodology, confirmed by blind test, can be applied to monitoring of billfish landing, illegal trade
and forensic identification in any place of Atlantic Ocean and assist the management and conservation of these species.
156
CYTOGENETIC ANALYSIS OF THREE MALES
OF MAZAMA AMERICANA SPECIES (ERXLEBEN
1777) ORIGINATING FROM DIFFERENT
LOCALITIES OF BRAZIL
Peres, JC1,2; Tomazella, IM1,3; Duarte, JMB1
Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP), Jaboticabal – SP; 2Graduação no curso de Ciências
Biológicas, Faculdade de Ciências Agrárias e Veterinárias (FCAV), Universidade Estadual Paulista Júlio de Mesquita Filho
(UNESP), Jaboticabal – SP; 3 Programa de Pós-graduação em Genética e Melhoramento Animal, Faculdade de Ciências
Agrárias e Veterinárias (FCAV), Universidade Estadual Paulista “Júlio de Mesquita Filho” (UNESP), Jaboticabal – SP
1
[email protected]
Palavras-chave: Cervidae, red brocket deer, cytotype, chromosome banding.
The species Mazama Americana belongs to the family Cervidae and it is popularly known as red brocket deer. Cytogenetic
analyzes point out conflicts with regard to the correct taxonomy of this species, which presents extensive karyotypic
variation, despite having no intraspecific morphological variation. It is observed that these chromosomal variations
occur according to the origin of each animal, meaning that animals originated from different areas present karyotypic
differences, which raises doubts about the classification of this species. Thus, it is important to analyze animals of the
species M. americana from different localities of Brazil, aiming to identify if there are new cytotypes or just those which
have already been described, since animals from areas that have not been sampled yet were obtained. In order to do so,
lymphocytes and fibroblasts cultures from males (T326=Maranhão, T308=Paraná and T343=Rondônia).were carried
out. The chromosomal preparations obtained were subjected to conventional staining, Ag-NOR, and C-banding. For
each animal, 20 metaphases of each technique were analyzed and, from good-quality metaphases, karyotypes were
built in order to determine the diploid (2n) and the fundamental (FN) number and the occurrence of chromosomal
rearrangements among the animals analyzed. The results showed that, of all the animals analyzed, only T326 presented
cytogenetic aspects that distinguish from the cytotypes that have already been described in the literature. This animal
posses 2n=47 + 3 to 6 B chromosomes and FN=52, 2 submetacentric chromossomal pairs, 3 large-sized acrocentric
pairs, 17 small-sized acrocentric pairs and multiple sexual system (XX/XY1Y2). The Ag-NOR is located in the
terminal region of chromosomal pairs 3 (large-sized acrocentric) and 6 (small-sized acrocentric). C-banding showed
heterochromatic blocks in the centromeric region of all the chromosomes and in the interstitial region of the long
arm of X chromosome and pairs 2, 3, 4 and 5. According to our analysis, animal T308 presented 2n=53 +2 to 3B and
FN=56, indicating that this animal possess the Paraná cytotype, which was confirmed by the C-banding (centromeric
heterochromatic regions and interstitial regions of the long arm of X chromosome and pairs 1, 2, 3, and 4) and the
Ag-NOR staining (terminal region of pairs 5 and 6). The cytogenetic analysis of animal T343 has shown that it is a
variation of the Rondônia cytotype as it possesses a Robertsonian fusion, presenting 2n=42 + 1 to 4B and FN=46,
with NOR in the interstitial region of pair 1 and in the ends of pair 8, and heterochromatin in the interstitial region
of X chromosome of pairs 1, 2 and 3. Based on these data, we can conclude that an animal which possesses cytogenetic
features that distinguish from those described in the literature was found, pointing out the occurrence of a new cytotype.
Financial Support: FCAV/UNESP
157
QUANTITATIVE ANALYSIS OF METHYLATION
OF THE MHM REGION, INVOLVED IN BIRD
DOSAGE COMPENSATION
Eiras, MC1 ; Miranda-Furtado, CL1 ; Furtado, GP1 ; Ramos, ES1
Faculdade de Medicina de Ribeirão Preto, USP, São Paulo, SP
1
[email protected]
Keywords: Methylation, Epigenetic, MHM region, Chicken
Sex determination in birds is based on ZZ/ZW system (male and female, respectively). Studies indicate that the
mechanism of dosage compensation of sex chromosomes is absent in birds, due to homogametic sex (ZZ) does not
have an inactive chromosome as found in mammalian XX. The expression of DMRT1 (Z-linked gene), essential
for the development of testes, could be controlled by epigenetics mechanisms related with the MHM region
(Male Hypermethylated Region), which is located near to this gene. This region is hypermethylated in males and
hypomethylated in females. The hypomethilated pattern allows the transcription of a non-coding RNA (ncRNA)
which accumulates near the transcription site, like the XIST RNA in mammals. The accumulation of ncRNA prevents
the transcription of DMRT1 in females. Some years ago, our group developed an assay (MHM assay) based on
multiplex PCR associated to a methylation sensitive enzyme (HpaII) for sexing chickens. The objective of this work
was to validate, using bisulfite sequencing of DNA, our MHM assay results. Genomic DNA was extracted from
feathers of adult male and female Gallus gallus and the methylation pattern was analyzed by the MHM assay. To
confirm the methylation pattern, bisulfite sequencing analysis was used, in which the genomic DNA was modified
by sodium bisulfite and amplified. The PCR product was cloned in E. coli and bacterial colonies were screened
by PCR. The positive clones were sequenciated to verify the methylation pattern. The results of sequencing shows
that in the male 92.3% of the CGs analyzed were methylated (hypermethylation), while in the female 2.1% of the
CGs analyzed were methylated (hypomethylation). Recent studies involving dosage compensation in birds showed
that it occurs in a different way than in mammalian, because there was no inactivation of an entire chromosome.
Most of genes on Z chromosome escape the compensation effect and only a few local genes aggregated in
MHM valley on a distal short arm of Z chromosome are involved in dosage compensation. Our data validated
the results of the MHM assay, and allowed the quantification of the methylation levels. The association of these
two techniques could be applied in extensive studies of development and dosage compensation in chickens.
Financial Support: FAPESP, CAPES-PROEX, CAPES-NUFFIC, CNPq and FAEPA.
158
THE COMPLETE MITOCHONDRIAL GENOME
OF THE JAGUAR (PANTHERA ONCA) ENABLES
COMPARATIVE ANALYSES ACROSS ALL
SPECIES IN GENUS PANTHERA
Heidtmann, LM1; Figueiró, HV1; Coutinho, LL2; Eizirik, E1.
Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre, RS; 2Escola Superior de Agricultura Luiz de
Queiroz, USP, São Paulo, SP.
1
[email protected]
Keywords: transcriptome, mitogenome, mitochondrion, phylogeny, jaguar
The most basal divergence among extant lineages of the Felidae was that of the Panthera lineage (including the
Panthera genus [P. onca, P. pardus, P. leo, P. uncia, P. tigris] and its sister-group Neofelis), which occurred ca. 11
million years ago. Despite the large number of publications addressing the internal phylogeny of this lineage, the
relationships among these species are still controversial. One of the biggest problems is the translocation of cytoplasmic
mitochondrial DNA (cymtDNA) into the nuclear genome (numt) which is known to be the cause of discordances in
some previous phylogenetic analyses. Some solutions to deal with this problem are mitochondrial isolation followed
by PCR, long-PCR, primer walking and, more recently, through RNA sequencing (RNAseq). We have characterized
for the first time the complete mitochondrial genome (mitogenome) of the jaguar using a novel technique based on
RNAseq complemented by PCR-based DNA sequencing. We also present the first mitogenome-wide phylogenetic
analysis of the Panthera lineage, including the numt copy P. tigris. Most of the jaguar mitogenome was obtained using
RNAseq from three different tissues (muscle, blood and skin) of the same individual. The transcripts were assembled
using Trinity software, and we used the pairwise BLAST algorithm against the P. tigris mitogenome (EF551003)
as a reference to annotate the mitochondrial segments. The transcripts did not cover five segments. Based on the
domestic cat reference sequence (NC001700) these portions corresponded to approximately 300bp from one of
the repetitive sequences of the control region, 70bp from tRNA-Phe, 65bp from tRNA-Val, 20bp from tRNATrp and 150bp from tRNA-His. To resolve these missing segments, we developed specific PCR primers, with high
melting temperatures and with ca. 100bp overlapping the flanks of missing segments to confirm the similarity with
cymtDNA. The analyses performed so far (Maximum Likelihood, Maximum Parsimony, Neighbor-Joining and
Bayesian Inference) supported a congruent topology ((((N. nebulosa ((P. tigris (P. tigris numt) P. onca (P. uncia,
(P. leo, P. pardus)))))). This result based on the complete mitochondrial genome is different from recently reported
phylogenetic relationships based on nuclear markers. Future steps include in-depth analyses of the phylogenetic
relationships, divergence dating and patterns of molecular evolution in the Panthera mitochondrial genome.
Finnancial Support: CNPq, CAPES, FAPERGS, FAPESP
159
CHROMOSOMAL DESCRIPTION AND AG-NOR
DOMINANCE IN A NEW PARTHENOGENETIC
SPECIES OF LIZARD AMEIVULA SP (TEIIDAE,
SQUAMATA)
Bulhões, LN1; Yonenaga-Yassuda, Y1; Rodrigues, MT2; Santos, RML1
Departamento de Genética e Biologia Evolutiva - Instituto de Biociências Universidade de São Paulo - São Paulo – SP;
Departamento de Zoologia - Instituto de Biociências Universidade de São Paulo -São Paulo – SP
1
2
e-mail: xxxx
Keywords: cytogenetics, Ag-NOR dominance, parthenogenetic
Ameivula is a neotropical genus of teiid lizards with many recently described species that raised from the merophyletic
complex Cnemidophorus. Today, it assemble nine bissexual species (A. confusioniba, A. mumbuca, A. nigrigula, A.
jalapensis, A. ocellifera, A. abaetensis, A. cyanura, A. littoralis, A. venetecauda) and the parthenogenetic species A.
nativo. In this work we describe the karyotype of a new parthenogenetic species from this genus (Ameivula sp.,
from Reserva Biológica da Mata-Escura, Minas Gerais State) and use the Ag-NOR differential staining technique
to detect a possible nucleolar dominance, that could suggest a possible hybridization as an implied mechanism of
origin. We found a number diploid of 49 chromosomes (2n=49) and fundamental number 58 (NF=58), with 5
biarmed macrochromosomes, 17 acrocentric macrochromosomes and 27 microchromosomes,some of them biarmed.
Ag-NOR was located at the terminal site of a big acrocentric chromosome in 20 out 20 metaphases. Taken together,
our data suggest that a hybridization event between two related species of Ameivula could be implied in the origin of
this species. In fact, the parthenogenetic species A. nativo (2n=48) also shows a very similar karyotype and Ag-NOR
dominance in apparently the same acrocentric chromosome that could suggest it involvement in the origin of this new
species. Moreover, a single biarmed macrochromosome was also found in the species A. littoralis but in this latter case
it was interpreted as a XX:XY sex determination mechanism that is not our case. Cytogenetic studies in related species
that are also found in this region are in progress and may help to clarify this mechanism as well as identify the parental
species involved in the origin of Ameivula sp.
160
SOCIAL STRUCTURE OF FEMALE PAMPAS
DEER (OZOTOCEROS BEZOARTICUS) IN THE
BRAZILIAN PANTANAL FROM THE USE OF
GENETIC AND NONINVASIVE SAMPLING
Mantellatto, AMB1, Caparroz, R2, Paranhos da Costa, MJR1, Duarte, JMB1
Faculdade de Ciências Agrárias e Veterinárias de Jaboticabal, UNESP, Jaboticabal, SP; 2Departamento de Genética e
Morfologia, Instituto de Ciências Biológicas, Universidade de Brasília, Brasília, DF
1
[email protected]
Keywords: pampas deer, social structure, microsatellites, fecal DNA.
The pampas deer (Ozotoceros bezoarticus) is one of eight deer species recognized in Brazil. Poaching, introduction of
livestock, destruction, fragmentation and alteration in habitat quality are potential causes of threats to these animals,
and the existing population in the Brazilian Pantanal is the most significant species, estimated at 60,000 individuals.
Studies on the social structure and genetic pampas deer are scarce, and various issues related to their social behavior
need to be clarified. Within this context, the present study aimed to analyze the social structure of female pampas
deer in the central region of the Pantanal (MS, Brazil). Therefore, 12 females were tagged with radio transmitters,
and used as focal animals to define the social groups. Stool samples from the animals found in the same groups with
these females were collected monthly during one year. The DNA from the stool samples was extracted and amplified
using PCR method with primers for six locus microsatellite. A total of 74 different animals were identified and of
these, 52 were considered for the study of genetic characterization of the population. The genetic diversity in this
population was estimated using the program GENEPOP 1.2 and tested for the presence of errors in genotyping
was performed using the Micro-Cheker. Kinship relations were measured with the aid of the MLRelate. The results
showed that this population has high genetic diversity (expected heterozygosity of 0.75 and an average number
of 11.5 alleles / locus). Relationships (siblings, half-siblings, mother/calf ) were identified between individuals, but
the permanence of puppies with their mothers in eight groups, the average period of five months, the relationship
was more constant within groups. The results indicate that the social structure in this population of pampas deer
is based on the mother and her calf, and this fact, indicative of the mechanism of maintenance of genetic diversity
of the population, this behavior may be a way to avoid crossing inbred. These data, as well as basic information
for aggregate species conservation programs, further demonstrate the feasibility and efficiency studies from fecal
DNA amplification, allowing to obtain information that would not be easily accessed from a collection invasive.
Financial Support: Capes and the Foundation for Research Support of the State of São Paulo (FAPESP).
161
DNA BARCODING OF THE FRESHWATER FISH
FAUNA OF THE RIO TRAMANDAÍ BASIN IN
SOUTHERN BRAZIL
Zwanziger, CB¹; Fagundes, NJR¹; Ramos-Fregonezi, AMC¹; Hirschmann, A¹; Malabarba, LR¹.
¹Universidade Federal do Rio Grande do Sul, UFRGS, Rio Grande do Sul, RS, Brasil
[email protected]
Keywords: barcoding, COI, cichlidae, freshwater, neotropical
The mitochondrial gene for the cytochrome c oxidase I (COI) has been proposed as a universal genetic marker
for species identification, in a procedure commonly called DNA “barcoding”. DNA barcoding has revealed cryptic
species which are difficult to identify using traditional morphological characters, and are specially useful when
morphological data is absent, such as in metagenomics or forensics applications. Species contain different genetic
lineages and recognizing new taxa can reveal isolated populations which may have “species status”, allowing a better
characterization of biological diversity. The task of cataloging taxonomic groups is urgent to counterbalance genetic
homogenization which may result from anthropogenic factors. This is particularly important in environments such as
the Neotropical freshwater ecosystems, which are heavily impacted by human activities including water consumption,
irrigation, hydroelectric dams, and pollution by domestic and industrial effluents. The objective of this study is to
access the diversity of freshwater fish fauna of the Rio Tramandaí basin, which is an Atlantic coast drainage from the Rio
Grande do Sul state, in Southern Brazil, using DNA barcoding of approximately 80 species of fishes morphologically
delimited. We also aim to test how identification based on DNA barcoding corresponds to morphology-based
classification and if cryptic species may be identified. The analyzed material is cataloged in the collection of tissues of
the Ichthyology Laboratory, Department of Zoology, Institute of Biosciences, UFRGS. DNA was extracted using a
salting-out protocol, and ~600bp of the COI gene was amplified by PCR (Polymerase Chain Reaction) with specific
“primers”. PCR products were checked by electrophoresis on 1% agarose gel, purified enzimatically and sequenced
by the Sanger method in Macrogen (Seoul - South Korea). The sequences were aligned in the program BioEdit and
checked by eye. The Kimura parameter distance (K2P) was used to compare the sequences. A phylogenetic tree using
this distance and the neighbor-joining method (NJ) with 1000 bootstrap replications was estimated in the MEGA
program v5.0. So far, 15 specimens from 6 species from the Cichlid family were analyzed. Our preliminary results
suggest that the DNA barcode method is an efficient tool for species identification, as individuals from the same
species formed monophyletic groups in the NJ tree. In agreement with this result, the average genetic distance among
species was 0.20 and within species 0.0009. These results are not surprising, since according to the literature, these
Cichlidae species are reasonably well defined morphologically. Characterizing the “DNA barcodes” of the remaining
species will be important to fully appreciate the usefulness of this method for the freshwater ichthyofauna from coastal
drainages from Southern Brazil.
162
ISOLATION AND CHARACTERIZATION OF THE
SEQUENCE INSULIN-LIKE PEPTIDE FROM THE
ANDROGENIC GLAND OF M. AMAZONICUM
(HELLER, 1862)
Martins, LB1; Carvalho, SC1; Costa, CP1; Sampaio, MIC2,3; Maciel, CMT1; Maciel, CR1.
Laboratório de Aquicultura, UFPA, Bragança, PA; 2Laboratório de Genética e Biologia Molecular, Bragança, PA; 3Instituto
de Estudos Costeiros, UFPA, Bragança, PA.
1
[email protected]
Keywords: Androgenic Gland, Hormones, IGF, Crustaceans, Amazon river Prawn.
Macrobrachium amazonicum is a native species widely distributed in the South America with high potential to
aquaculture. Some technologies were already developed for cultivation of this species; however, physiology studies are
not enough, which are important tools manage of the cultivation. In crustaceans, hormones affect the growth rate and
reproduction, where the androgenic gland (AG) was critical for its comprehension. The AG is an exclusive organ of
males, which expels hormones responsible of sexual differentiation and induce growth. Lately, it was verified that the
AGs of decapods crustaceans express a peptides similar to insulin (IAG), but until now, this hormone was not identified
to the Amazon-prawn. Therefore, the objective of this work was to identify and characterize the similar peptides to
insulin in M. amazonicum and as well to check which tissue in males and/or female this gene is expressed. RT-PCR
results shows that this gene is only express in AG of males and in any tissue tested of the females. The peptide is formed
by 745pb, encoding 181 amino acids and is termed the MAM-IAG. The gene structure consists of signal peptide, chain
B, peptide C and chain A, having a linear structure, typical of the insulin-like peptides families. The residues of the A
and B chains were highly conserved among the M. amazonicum and others. The amino acid sequence of Man-IAG was
very similar with M. rosenbergii (90%) and M. niponnense (88%), results that agreed with the phylogenetic analysis.
Despite of the homology in structural organization, the peptides similar to the crustaceans insulin own a great variety,
however, it was registered two sites of cysteine, which were exclusives in the Macrobrachium species. The obtained results
for the amazon-prawn will contribute for the future investigations about the Man-IAG functionality and envision
new strategies for the cultivation management. Implications were determined of this gene in M. rosenbergii related
to the growth and maintenance of the secondary sexual characteristics, allowing possible biotechnological manages.
Financial Support: Fundação de Amparo à Pesquisa do Estado do Pará (FAPESPA) - Brasil.
163
PATTERNS OF GENETIC DIVERSITY
DISTRIBUTION IN H. MALABARICUS (BLOCH,
1794) FROM MARANHÃO STATE (BRAZIL)
RIVER BASINS
Abreu-Souza, CP1; Tchaicka, L2; Silva, DC3; Fraga, EC4; Barros, MC4; Piorski, NM5; Carvalho-Costa, LF6
Programa de Pós-Graduação em Biodiversidade e Conservação, Universidade Federal do Maranhão – Campus São
Luís; 2 Laboratório de Genética e Biologia Molecular Warwick Kerr , Curso de Ciências Biológicas, Universidade Estadual
do Maranhão – Campus São Luís; 3Laboratório de Genética Animal, Universidade Federal do Maranhão, Campus
– Chapadinha; 4Centro de Estudos Superiores de Caxias, CESC-UEMA – Campus Caxias; 5Laboratório de Ictiologia,
Departamento de Biologia, Universidade Federal do Maranhão – Campus São Luis; 6Laboratório de Genética e Biologia
Molecular, Departamento de Biologia, Universidade Federal do Maranhão – Campus São Luis.
1
[email protected]
Keywords: Trahira, Mitochondrial DNA, control region, genetic variation
Hoplias malabaricus is a freshwater fish species with a wide distribution along South America rivers. It is considered
a species complex, characterized by a high level of karyotype variation. Currently, seven cytotypes are recognized,
ranging in diploid number, chromosome morphology and the presence of sexual system. The cytotype 2n = 40F is
present in rivers from Maranhão, Suriname, Amazon, Tocantins and São Francisco. Maranhão State is located in a
transition region between the Amazon, Cerrado and Caatinga, possessing important rivers such as Pindaré, Itapecuru,
Parnaíba and part of the Tocantins River drainage. In this context, this study aims to increase knowledge about
the phylogeography of freshwater fishes from Maranhão drainages, by analyzing data from sequencesof the control
region (mitochondrial DNA) in specimens of H. malabaricus. Samples were collected in the following basins: Turiaçu,
Pindaré, Mearim, Itapecuru, Munim, Gurupi, Parnaíba and Tocantins. Total DNA was extracted usingthe Phenol /
Chloroform protocol. Isolation and amplification of control region was performed by PCR, whose amplicons were
purified by using commercial purification kit.Sequencing followed the chain termination method. Sequences were
visually checked, edited in MEGA 5.10 and aligned by CLUSTALW. Data for nucleotide and haplotype diversity were
obtained in DnaSP. A phylogenetic tree was generated through Maximum Likelihood method using MEGA 5.10.
Hoplias microlepis sequence (Genbank: HQ235009) was added as outgroup. The genealogical relationships among
haplotypes were estimated in NETWORK 4.6. A sequence of 439-bp (base pairs) was obtained for 186 individuals (80
variables sites and 58 parsimony informative). The specimens used in this study described 62 haplotypes, with haplotype
diversity of 0.968 and nucleotide diversity of 0.03682. Regarding the mean genetic distances between the basins, there
was a divergence greater than 5% when the population Itapecuru was compared to the populations of Tocantins,
Turiaçu and Munim. This value was between 2% and 4.9% from other basins.The haplotype network revealed the
following groups: Pindaré+Mearim+Turiaçu+Gurupi; Itapecuru+MiddleParnaíba1; MiddleParnaíba2+Tocantins1;
Munim+LowParnaíba+Tocantins2 and Tocantins3. These groups are consistent with the geographic distribution of
populations and with the endemism areas for freshwater fish from South America proposed in literature. These results
can indicate how vicariant events of marine transgressions/regressions have acted in this region between the Miocene
and Holocene and at some point have promoted communications between different basins through their tributaries.
Financial Support: CNPq, CAPES, UEMA and UFMA
164
POPULATION GENETICS OF AEDES
(STEGOMYIA) AEGYPTI
Vidal, PO1,2, Louise, C1, Suesdek, L1,2
Laboratório Parasitologia, Instituto Butantan, São Paulo, SP, Brasil; 2Programa de Pós-Graduação em Biologia da
Relação Patógeno-Hospedeiro, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP, Brasil
1
[email protected]
Keywords: Culicidae, Microsatellites, COI, Geometric morphometrics, Wing shape.
The mosquito Aedes (Stegomyia) aegypti, is native from Eastern Africa, but has spread worldwide mainly due to human
activities. The presence and dispersion of this mosquito are considered to be a public health problem because of its ability
to act as a vector for the dengue, yellow fever and chikungunya viruses. The state of São Paulo, Brazil, displays one of
the highest rates of dengue infection in the world, with 105,973 autochthonous cases being reported in the first four
months of 2013. The main way to control dengue viruses is reducing Ae. aegypti populations, because neither effective
vaccines nor antiviral drugs are available. Despite the high incidence of dengue, population genetics of Ae. aegypti
from state of São Paulo is yet poorly known. The aim of this study was to assess the population genetics of Ae. aegypti
in the state of São Paulo using recognizably adequate for such purpose: DNA microssatelites, COI mitochondrial gene
and wing geometry. Six population samples were collected during the autumn of 2011, each coming from one of the
following large cities in the state of São Paulo: Santos (SAN), São Paulo (SPA), Campinas (CAM), São Carlos (SCA),
Catanduva (CAT) and São José do Rio Preto (SRP). Those six locations were chosen because its overall epidemiological
importance: they harbour foci of dengue, they are densely inhabited by humans (120,000-10,000,000 people) and
interconnected by major highways, which presumably facilitates vector dispersal. Road distances between cities
range from 54.9 to 468.4 km. Two hundred and ten individuals (35 per location) were analysed using eight DNA
microsatellite loci, one mitochondrial gene (COI) and wing geometric morphometrics. We detected significant genetic
(0.016<Fst<0.114) and phenetic (1.93<DM<4.24) differentiation between the Ae. aegypti population samples. Gene
flow does not appear to be high among populations. Positive correlation between genetic and phenetic pairwise distances
was detected (r=0.72,p=0.002), indicating that biological markers were congruent. Neither the genetic nor phenetic
distances were correlated with geographical distance. Although six COI haplotypes were found, only one was shared
by all populations, supporting the hypothesis of low gene flow among them. SAN presented the higher number of
haplotypes (6), being that two were private. Taken together, the phenetic and genetics analyses revealed that Ae. aegypti
from São Paulo State is populationally structured. The existence of connecting highways did not guarantee extensive
gene flow among locations. The SAN population was the most phenetically and genetically distinct and polymorphic,
which is consistent with the fact that SAN contains a seaport that could act as a point of entry for foreign Ae. aegypti. The
results of this study may be useful for developing a more effective vector and dengue control in the state of São Paulo.
Financial Support: Fapesp 2010/15039-1
165
MOLECULAR STUDIES OF MYTELLA
GUYANENSIS (LAMARCK, 1819) FROM ILHA
DO MACIEL (PARANÁ STATE) BASED ON COI
SEQUENCES
Corrêa, RSG1; Marques-Silva, NS1; Beasley, CR2; Tagliaro, CH1
Laboratório de Conservação e Biologia Evolutiva, Universidade Federal do Pará, Instituto de Estudos Costeiros,
Bragança, Pará; 2Laboratório de Moluscos, Universidade Federal do Pará, Instituto de Estudos Costeiros, Bragança, Pará
1
Keywords: mussel, COI, population genetics, structure, population expansion
The mussel Mytella guyanensis (Mytilidae) is a species of ecological importance in the mangrove ecosystem
and is also of great economic value to coastal communities, where it may often be the main source of income.
The objective of this study was to characterize a population of Mytella guyanensis (Lamarck, 1819) from the
Island of Maciel, Paraná, southern Brazil, using gene sequences of cytochrome c oxidase subunit I (COI). DNA
was extracted from the adductor muscle of 31 individuals and COI amplicons of 501 bp were generated and
sequenced. Divergence values among haplotypes obtained by the Tamura-Nei model, ranged from 0 to 0.008.
Eleven haplotypes were identified and the most frequent haplotype was H1, present in 68% of the specimens.
Haplotype diversity (h) for this population was moderate (0.5484) and nucleotide diversity (π) was low (0.001545).
The values of Tajima’s (D=-2.40525, P<0,05) and Fu’s tests (Fs=-10.40776, P<0,05) showed significant negative
values, suggesting that the population has undergone recent expansion. The pairwise difference distribution
curve (mismatch distribution) agrees with the latter hypothesis (SSD=0.0001; P>0.05). When information from
four other Brazilian populations (Pará, Paraíba, Sergipe and Espírito Santo) were added, fixation indices (Fst
values) and locus-by-locus AMOVA (P<0.05) indicated heterogeneity between Paraná and the other populations.
Financial Support: CNPq (Universal 2009)
166
USE OF MOLECULAR MARKERS AS A TOOL
FOR THE STUDY OF MATING SYSTEM IN
PODOCNEMIS UNIFILIS (TESTUDINES,
PODOCNEMIDIDAE)
Fantin, C1; Oney, M2, Andrade, PCM3, Farias, IP3
Escola Normal Superior, UEA, Manaus, AM; 2Escola Superior de Ciências da Saúde, UEA, Manaus, AM; 3Universidade
Federal do Amazonas, Manaus, AM
1
[email protected]
Keywords: Tracajá, paternity, microsatellites.
Podocnemis unifilis is known as “tracajá”, and as an essentially aquatic specimen, lives in lakes, ponds, lowlands,
swamps and alongside main rivers of Amazon basin. Nowadays according the “Red List” of endangered animals from
International Union for the Conservation of Nature (IUCN), P. unifilis is considered vulnerable, for its high human
consumption and illegal trade. This study investigated the reproductive way of P. unifilis, using just-hatched offsprings
from a community of “Terra Santa” - PA. Molecular genetics has been a tool widely used in studies of reproductive way.
Between the diverse molecular techniques based in microsatellite DNA, very used to answer questions about kinship,
as the paternity type determination in a great number of species rating. 63 offsprings were genotyped, belonging
to five nests of P. unifilis with three microsatellite loci. For multiple paternity attribution a simple alleles counting
was used, where is considered the presence of five alleles per locus sampled between offsprings from each nest as a
multiple paternity indicative, where there is: two maternal alleles, two alleles from one male, and the fifth as a second
male. By this method of counting the presence of multiple paternity was evidenced, in all the five nests analyzed. The
counting of 11 different alleles at loci 1E1 and 2F6 confirms the presence of multiple paternity in the nest 1 and 2
with the contribution of five males in the offspring and in the nests 4 and 5 there is the contribution of three males
in the offspring, whereas the same occurred with the nest 3 in where there was the contribution of four males in the
offspring.
167
CHROMOSOMAL CHARACTERIZATION
OF PIARACTUS BRACHYPOMUS FROM
FISHPONDS IN SOUTHERN ESPÍRITO SANTO
Mainardi, VF1; Elert, NC1; Mendonça, PP2; David, JAO1
Centro de Ciências Agrárias, UFES, Alegre, ES; 2Instituto Federal de Educação, Ciência e Tecnologia do Espirito Santo,
IFES, Alegre, ES
1
[email protected]
Keywords: Characiformes, chromosomes, pirapitinga, pisciculture, karyotype.
The continuous and systematic cytogenetic study of certain groups of fish has led to the clarification of taxonomic
questions, the identification of cryptic species, as well as a better understanding of the structure and variability of
chromosomes, and the evolutionary processes that involve the karyotype of freshwater fish. The fish are one of the
groups of animals with higher amplitude variation in chromosome number, with references from 2n = 16 to 2n =
250 chromosomes. In Brazil, the Characiformes and Siluriformes are the orders with the greater concentration of
chromosomal information. The tambaqui (Colossoma macropomum), pacu (Piaractus mesopotamicus) and pirapitinga
(Piaractus brachypomus) belong to the family Characidae. They are popularly known as round fish and, in recent years,
the production of these fishes and their hybrids (tambacu, tambatinga, paqui and patinga) was important for the
increase in fish production in almost all the regions of the country. However, due to morphological similarity between
these fish and their hybrids, the interspecific cross is very frequent, mainly in small properties, which can lead to a
considerable drop in fertility and production. The present study aims to characterize cytogenetically fishes identified,
through morphological characteristics as pirapitinga (Piaractus brachypomus) produced at Instituto Federal do
Espírito Santo (Campus Alegre) in order to confirm the chromosome complement of the species and provide data for
comparison with other round fish produced in same institution. Eight juveniles with about 20cm long were random
collected from the production tanks and taken to the laboratory. The induction of mitosis was made by yeast injection
for 48 hours. Prior to sacrifice, all the fishes were injected with a solution of colchicine (0.025%) for 45 minutes.
The animals were then sacrificed by thermal shock and dissected to remove the kidney, which was homogenized in
hypotonic solution (KCl) and maintained in the same solution at 37°C for 15 minutes. Finally, the material was fixed
and washed in methanol:acetic acid (3:1). The cell suspension was dropped on clean glass slides and air dried. The
slides were then stained with Giemsa for analysis under light microscopy and the best metaphases were photographed.
The diploid number found in all analysed animals was 54 chromosomes. These results are in agreement with previous
reports that indicate the same numerical complement. However some differences were found in respect to the number
of metacentric and submetacentric elements. In the present study 32 metacentric and 22 submetacentric chromosomes
were observed. In other studies, the chromosomal complement was described with 34M, 20SM and 28M, 26SM for
the same species. These differences could be attributed to technical features, as chromosomal condensation.
168
MULTILOCUS DATA AND KARYOTYPIC REAVALIATION SUGGEST A RECENT HYBRID
ORIGIN AND CLONAL REPRODUCTION OF
THE PARTHENOGENETIC ENDANGERED
SPECIES AMEIVULA NATIVO (TEIIDAE:
SQUAMATA)
Santos, RML1; Gardner MG2; Rodrigues, MTR3; Yassuda, Y1
Depto de Genética e Biologia Evolutiva do Instituto de Biociências da USP/SP, Brazil; 2School of Biological Sciences,
Flinders University, Adelaide, Austrália; 3Depto de Zoologia do Instituto de Biociências da USP/SP, Brazil
1
e-mail: xxxx
Keywords: xxxx
Ameivula nativo is a species of lizard endemic of Brazilian restingas, found in the coastal sand dunes from Southern
of Bahia State to Northern of Espírito Santo State. It is an endangered species highly threatened by the loss of habitat
due to immobiliary expansion into this ecosystem. Only females are found in this species, which will reproduce by
parthenogenesis, but the process implied in its origin and maintenance are still unknown. Chromosomal data until now
only shows 2n=48 chromosomes with some heteromorphic pairs and no differential staining techniques were applied
so far. In this view, the measure of the genetic diversity could contribute for the understanding of such mechanisms
as well as give support to conservational programs. To achieve this aim, we performed a 454-pirosequencing run in
order to obtain a plenty of molecular markers, especially microsatellites and anonymous sequences, useful to access
the genetic variability of the 36 individuals of A. nativo sampled from populations of all the geographic distribution.
As results, we found no variation for all the 20 microsatellites loci and 10 anonymous sequences that suggest that
the species clonally reproduces from one original individual. More conservative markers as chromosomal data and
nuclear (NT3 and C-mos) plus mitochondrial (ND4, 16S, CytB) sequences obtained for related species, corroborated
the hypothesis of hybrid origin: the species clearly showed Ag-NOR dominance -a very strong cytogenetic marker
to detect hybridization events- in 30 out 30 metaphases; the same mitochondrial haplotype of individuals from the
sister-species Ameivula abaetensis from Abaeté sand dunes (Salvador, Bahia), considered so on the maternal species;
and finally the nuclear genes points a still unknown population related to A. ocellifera complex as a paternal lineage.
Taken together, our data shows that A. nativo is a very recent species, originated throughout the hybridization of 10%
divergent parental species (a female A. abaetensis from Abaeté - Bahia, and a male of the A. ocellifera complex), which
reproduces clonally and so should have its conservation status revaluated.
169
EVALUATION OF GENETIC DIVERSITY
AND STRUCTURE OF POPULATIONS
PYGOCENTRUS NATTERERI BASED ON
MICROSATELLITE MARKER
Luz, LA1,3; Reis, LL1,3; Nascimento, PRM2; Santos, CHA2; Almeida-Val, VMF2; Barros, MC1,3; Fraga, EC1,3.
Mestrado em Ciência Animal - CAA/UEMA, São Luís, MA; 2Laboratório de Ecofisiologia e Evolução Molecular - INPA,
Manaus, AM; 3Laboratório de Genética e Biologia Molecular - CESC/UEMA, Caxias, MA
1
[email protected]
Keywords: Serrasalmidae, Piranha, Maranhão, Variability, Conservation
The species Pygocentrus nattereri (Characiformes, Serrasalmidae) is important in commercial and artisanal fisheries
being exploited throughout its distribution. The present study aimed to analyse the levels of diversity and genetic
structure in populations of Pygocentrus nattereri in four basins hydrographic maranhenses (Parnaíba, Itapecuru, Pindaré
and Mearim) based on microsatellite marker. DNA was isolated using phenol-chloroform protocol and amplification
of microsatellite loci was performed by PCR. PCR products were genotyped on the ABI 3130xl sequencer (Applied
Biosystems). PCR products were genotyped on the ABI 3130xl sequencer (Applied Biosystems). Data analyses were
performed on programs Genetix ver. 4.0, Fstat ver. 2.9, Cervus ver. 3.0, Gda ver. 1.1 and Arlequin ver. 3.5. The analysis
of eight microsatellite loci revealed a total of 104 alleles in 48 specimens, and of these, 29 were private alleles. The
number of alleles per locus ranged from 3 to 10 with an average of 5.89 alleles. The observed heterozygosity ranged from
0.438 to 0.510 and expected heterozygosity ranged from 0.362 to 0.494. The PIC ranged from 0.223 to 0.734 with an
average of 0.414. The inbreeding coefficient (f) showed an excess of heterozygotes for all populations and both values
differ significantly from zero (P < 0.05). The FST was 0.229 with p significant (<0.00001) indicating genetic structure
among populations. The genetic distance between populations showed a variation of 0.580 (Parnaíba/Itapecuru) to
0.009 (Mearim/Pindaré) and genetic similarity ranging from 0.990 (Mearim/Pindaré) to 0.559 (Itapecuru/Parnaíba).
The tree Neighbour-Joining (NJ) based on genetic distance revealed the formation of three distinct groups, formed
by specimens from Parnaíba basin, Itapecuru and Pindaré/Mearim. The informations obtained, therefore, indicate
population structure along the basins analyzed and contribute to the development of a management policies and
appropriate conservation for each basin separately, in view of the observed genetic differentiation between the same.
Financial Support: FAPEMA, UEMA.
170
GENETIC DIVERGENCE OF INTRODUCED
POPULATIONS OF CICHLA KELBERI
(PERCIFORMES: CICHLIDAE) IN THE PARANÁ
RIVER
Reis, LL1,2; Luz, LA1,2; Fraga, EC1,2; Barros, MC1,2.
Mestrado em Ciência Animal- CCA/UEMA, São Luís, MA; 2Laboratório de Genética e Biologia Molecular, UEMA, Caxias,
MA
1
[email protected]
Keywords: Tucunaré, mitochondrial DNA, Haplotype, Variability, Conservation
Species of the genus Cichla, commonly known as tucunares, are examples of indiscriminate introduction in Brazil.
Available data on the genetic variability of populations of invasive fish are scarce and aims to know how this introduction
changed the variability of these populations. In this paper we used the control region of the mitochondrial DNA to
estimate the genetic divergence among populations of introduced of Cichla kelberi in the two points of the Paraná
River (Upper Paraná River and Itaipu hydroelectric plant-UHE). Were incorporated in our into the database sequences
of Cichla kelberi Genbank derived from the Upper Parana River. DNA was isolated using phenol-chloroform protocol
and control region and amplification was performed by PCR. PCR products were sequenced on ABI 3500 sequencer
(Life Technologies). The sequences were analyzed using specific software. We obtained a fragment of 535 bp in 33
sequences Cichla kelberi. Four haplotypes were observed, two of which (H2 and H3) were unique to the Alto Paraná,
three polymorphic sites, haplotype diversity of 0.438 and nucleotide 0.00365. The neutrality tests of D and Fs were not
significant for the analyzed populations with p <0.05. The Analysis of Molecular Variance-AMOVA indicated that most
of the molecular variation (85%) occurs between populations. The Fst index was 0.146 indicating, therefore, moderate
genetic differentiation among populations. Phylogenetic analysis indicated monophyly among the specimens analyzed.
The array of nucleotide divergence ranged from 0 to 1%. The low genetic diversity found in the two analyzed points
reveals that populations of Cichla kelberi constitute a single stock. The information obtained thus are essential in order
to establish policies for proper management and conservation of populations introduced Cichla kelberi Paraná River.
Financial Support: FAPEMA and UEMA.
171
A PHYLOGENETIC ANALYSIS USING
MULTIDIRECTIONAL CHROMOSOME
PAINTING OF FOUR SPECIES OF SUBFAMILY
PHYLLOSTOMINAE (CHIROPTERA,
PHYLLOSTOMIDAE)
Ribas,TFA1,4, Silva, NN1,5, Nagamachi, CY1,3, Rodrigues, LRR2, Gomes, AJB1,5, Rissino, JD1, Pieczarka JC1,3
Laboratório de Citogenética, ICB, UFPA, Campus do Guama, Belém, PA; 2Laboratório de Genética & Biodiversidade,
ICED, UFOPA, Campus Tapajós, Santarém, PA; 3CNPq Research; 4Scholarship Mastership FAPESPA on Genetics and
Molecular Biology; 5Scholarship Doctorate CAPES on Genetics and Molecular Biology
1
[email protected]
Keywords: bats, chromosomal phylogeny, FISH, karyotypic evolution, Phyllostomini.
The subfamily Phyllostominae includes taxa that vary considerably in feeding strategy, including carnivory, strict
insectivory and a combination of frugivory and insectivory. Phylogenetic relationships within this group classified in tribes
(Vampyrini, Macrophyllini and Phyllostomini) have difficult to be resolved despite efforts using both mitochondrial
and nuclear DNA sequences and phylogenetic relationships among tribes remain in debate. Under cytogenetic point of
view, Phyllostominae presents different rates of chromosomal evolution between genera. Chromosomal rearrangements
present a rare occurrence in the genome and have great value as phylogenetic markers and taxonomic characterization.
In this way we analyzed three species: Lophostoma silvicola (LSI), Tonatia saurophila (TSA) and Trachops cirrhosus
(TCI) representing the tribes Phyllostomini (LSI and TSA) and Macrophillini (TCI), collected in Amazon region,
by G-banding and multidirectional chromosome painting using whole chromosome painting probes from Carollia
brevicauda (CBR) and Phyllostomus hastatus (PHA). The chromosomal complement of PHA (Phyllostomini) was used
as the reference to define all detected segmental associations and/or syntenic disruptions in the representatives of the
different bat tribes. Structural rearrangements were coded as binary characters and used in a cladistic analysis using
maximum parsimony. An exhaustive search with TCI as outgroup was performed using PAUP4.0b. All characters had
the same weight, based on the premise that chromosome rearrangements occur with equal chance. With the aim of
testing the previous phylogenies of these bats using cytogenetics, we compared these results with published molecular
topologies on Phyllostominae. The specimens of TCI analyzed presented 2n=30 chromosomes and FN=56, while
LSI presented 2n=34 and FN=64 and TSA presented 2n=16 and FN=20. Comparative analysis using G-banding and
chromosome painting showed that the karyotypic complement of TSA is highly rearranged relative to LSI, TCI, PHA
and CBR. In the other hand, LSI and TCI shared many whole chromosomes and chromosome arms, differing by
only two chromosome pairs. The hybridization with probes of PHA detected respectively 16, 15 and 31 homologues
segments on the genomes of LSI, TCI and TSA, while the probes of CBR resulted respectively in 25, 24 and 31
fluorescent signals each. The results of cladistic analyses showed a strongly supported phylogeny (bootstrap >85%),
were the tribes Macrophyllini and Phyllostomini were sister taxa, congruent to the molecular topologies, due to
sharing of one chromosome 13qdist (=CBR5) entirely conserved between Phyllostomus and Trachops genera. PHA was
in basal position while TSA and LSI were sister taxa consistent to morphological topologies. Few ancestral syntenies
were conserved without rearrangement and most of associations were demonstrated to be apomorphic traits for TSA
or plesiomorphic (PHA-11, 14 and 15) for the four genera analyzed here. Our results of cladistic analysis support the
monophyly of tribe Phyllostomini and bring new evidences for phylogenetic relationships within Phyllostominae.
Financial Support: VALE-FAPESPA, BIONORTE-CNPq/FAPESPA, UFPA, UFOPA, Aotus-Consultoria,
Biodinâmica-RIO, CAPES, CNPQ.
172
THE HELENA RETROTRANSPOSON IN
ZAPRIONUS SPECIES
SIMÃO, M.C.1; GRANZOTTO, A.1; CARARETO, C.M.A1
Instituto de Biociências Letras e Ciências Exatas - Universidade Estadual Paulista, São José do Rio Preto, SP, Brasil
1
[email protected]
Keywords: Helena, LINE, transposable elements, Zaprionus, Drosophilidae
Transposable elements (TEs) contribute with the diversity of host genomes and play a key role as mediators of genome
evolution. Helena is a LINE retrotransposon identified primally in D.virilis and afterwards fully characterized in D.
simulans. Data from literature show that Helena is in different stages of its evolution in Drosophila species, however, no
study was performed out of this genus. Zaprionus, other genus of Drosophilidae family, has been accepted as good model
for genetic studies, nevertheless few studies with transposable elements were performed in this genus. In this study, we
investigated the occurrence of Helena sequences and their phylogenetic relationships in five species of the Zaprionus
genus (Z. indianus, Z.nigranus, Z. tuberculatus, Z. gabonicus and Z. davidi). For this analysis, 20 ovaries of each species
were used to extract total DNA and PCR was carried out using primers for Helena Reverse Transcriptase of D. simulans
previously used in our laboratory, which amplifies a 644 bp fragment. The sequences amplified were cloned and for
each species 10 clones were sequenced. The relationships between the sequences of each species were reconstructed
through neighbor-joining analysis using amino acid sequences for the p-distant model as implemented in Mega 5 with
1,000 bootstrap replicates. For this, the nucleotide sequences were aligned and translated into amino acid, removing
the triplet when indels were present to maintain the reading frame. Sequences of Helena downloaded from Repbase
database (D. simulans, D. sechellia, D. melanogaster, D. yakuba, D.mauritiana and D. mojavensis) were also used for
the phylogenetic analysis. The average divergence between sequences of Zaprionus was estimated under the p-distance
model, using Mega 5. The largest RTase fragment of Helena was found in Z. tuberculatus (640 bp) and the smaller
in Z. davidi (556 bp). In all species stop codons were observed, reinforcing that Helena is in process of degeneration,
as previously described for the Drosophila genus. Neighbor-joining analysis grouped the Helena sequences into two
clades (clade 1: sequences of Drosophila species; and clade 2: sequences of Zaprionus species, which is supported by
high bootstrap values). The phylogenetic analysis reflect the evolutionary relationships among the species, except
for Z. gabonicus and Z. indianus that are in same clade, these species were identified as different species lately. The
p-distances show low divergence values between the Zaprionus species, ranging from 0.002 (between Z. indianus and
Z. gabonicus) to 0.101 (between Z. davidi and Z. tuberculatus), but higher compared with the D. simulans sequences
(0.3), as expected under the hypothesis of vertical inheritance. Other five species of Zaprionus are being sequenced and
the analysis of their sequences in the phylogeny will allow a better understanding of Helena evolution in this genus.
Finnancial support: FAPESP and CNPq
173
GENETIC ANALYSIS OF AN INDEL
POLYMORPHISM IN THE BRCA2 GENE IN
CANINE BREAST TUMORS
Melo, RM1; Faro, TAS1; Pinheiro, DR1; Pereira, WLA1; Monger, SGB2; Aguirra, LRVM2; Ferreira, WAS2; Harada, ML²;
Borges, BN¹.
¹Universidade Federal Rural da Amazônia, UFRA, Belém, PA; ²Universidade Federal do Pará, UFPA, Belém, PA
[email protected]
Keywords: dog, neoplasia, mammary, polymorphism, susceptibility
The genomic instability responsible for the development of breast cancer in females of Canis lupus familiaris arise
from mutagenic alterations at several tumor suppressor genes, especially BRCA2, which works as a caretaker avoiding
the accumulation of mutations. The BRCA2 proteins are responsible for the double stranded-breaks repair mainly
on the S phase of the cell cycle, due to its interaction with other molecules like RAD-51. Several genetic alterations
were identified in the BRCA2 gene related with breast cancer susceptibility in dogs, as in humans. Therefore, our
study aims to isolate and amplify the fragment of the BRCA2 gene (exon 27) in canines in order to check the
presence / absence of an indel event (10204ins/del AAA) in both tumoral and non-tumoral tissues, and thus to
correlated the observed polymorphism with histopathologic data, race and age. Twenty-four tissue samples were
collected from mammary gland of animals attended at the UFRA’s Veterinary Hospital. DNA was obtained by
the phenol-chloroform method and the target region amplified by polymerase chain reaction, and submitted to an
automatic sequencing process. After an analysis of a fragment of ~200 base pairs from each sample, we observed that
20 samples (83.3%) were homozygous for the 10204 ins/ins AAA, a frequency much higher than the observed in the
Japanese population (47.8%). Two samples were homozygous for the 10204 del/del AAA event and the other two
were heterozygous. No statistical significance was observed between the presence of the 10204 ins AAA allele and
age at diagnosis, race or histological type. Of the analyzed samples, twenty were of paired tumoral and non-tumoral
tissues from the same patient, and in those samples we observed the same genotype in both tissues types. It is known
that the 10204 ins AAA is responsible for an amino acid alteration (M3332IK) located at the nuclear localization
signal 2 domain, resulting in an enhanced nuclear localization. In conclusion, our results suggest an influence of the
10204 ins AAA allele in the canine mammary carcinogenesis susceptibility and may be used as an molecular marker.
Financial Support: Universidade Federal Rural da Amazônia (UFRA) and CNPq
174
CHROMOSOMAL CHARACTERIZATION
OF PROECHIMYS FROM MARANHÃO AND
TOCANTINS
Amorim, APS1; Oliveira, TG2; Carvalho Neta, AV2; Tchaicka, L2.
Programa de Pós-graduação em Ciência Animal, UEMA, São Luís, MA; 2Departamento de Química e Biologia,UEMA, São
Luís, MA
1
[email protected]
Keywords: Echimyidae, karyotype, Cerrado
Rodents represent the largest order of mammals and a extensive distribuition. In this group, the taxonomic classification
is usually based on morphological studies. Due to similarities between species, Proechimys can be most accurately
identified using other techniques beyond the external morphology. Cytogenetics is a useful tool in taxonomic studies of
the genus Proechimys. This study aimed at describing the karyotype of specimens of the genus Proechimys (Echimyidae),
from Bacabal - MA, Capinzal do Norte - MA and Araguatins – TO in order to contribute to the systematic description
and distribution limits for the genus. The animals were collected using Tomahowk traps, the chromosome preparations
were obtained from the femoral bone marrow of animals, treated with hypotonic solution of 0.075 M KCl and fixed
with Carnoy fixative. The slides were stained with Giemsa and observed in the optical microscope, and at least thirty
metaphases were analyzed for each specimen. Seven individuals were collected: one male from Capinzal do Norte - MA,
three males and one female from Bacabal - MA and one male and one female from Araguatins – TO. The modal number
was 2n = 30 and NF = 56. The results indicate that individuals analyzed belong to the species P. roberti, confirming
the occurrence of this species in the states of Maranhão and Tocantins, expanding its range to east of Maranhão state.
Financial support: FAPEMA
175
DEEP SEQUENCING OF COCHLIOMYIA
HOMINIVORAX AND COCHLIOMYIA
MACELLARIA SMALL RNAS
TRANSCRIPTOMES: IDENTIFICATION AND
COMPARISON OF MICRORNAS
Paulo D F¹,³, Junqueira A C M¹,², Vicentini R¹, and Azeredo-Espin A M L¹,³.
Center for Molecular Biology and Genetic Engineering (CBMEG), Campinas State University (UNICAMP), Campinas,
SP, Brazil; 2.Center for Comparative Genomics and Bioinformatics, Pennsylvania State University, University Park, PA,
USA; 3.Department of Genetics, Evolution and Bioagents (DGEB), Institute of Biology (IB), Campinas State University
(UNICAMP), Campinas, SP, Brazil.
1.
e-mail: xxxx
Keywords: microRNAs, next generation sequencing, MiSeq, Calliphoridae, Cochliomyia hominivorax, Cochliomyia
macellaria, evolution of parasitism
MicroRNAs (miRNAs) are small non-coding RNAs that act as post-transcriptional modulators of gene expression
in Eukaryotes. The imperfect complementarity between miRNAs and the 3’ untranslated region of mRNAs inhibits
their translation in animals, being key genes for control of expression in cells. The characterization of miRNAs
provides a better understanding of biological processes and evolution of traits in different species. The family
Calliphoridae is a group of myiasis-causing flies with different feeding habits, including the species Cochliomyia
hominivorax (screwworm fly) and Cochliomyia macellaria (secondary screwworm). The screwworm fly is one of the
major pests in Neotropical region. Their larvae infest and feed on live tissues of warm-blooded vertebrates, resulting
in severe losses for livestock industry. Differently, the close-related secondary screwworm shows a saprophagous habit,
feeding on carcasses and dead tissues, being crucial for forensic entomology and public health. Because of their
close evolutionary relationship and contrasting feeding habits, they are ideal models to study the molecular basis of
parasitism and feeding specialization in the family Calliphoridae and, therefore, in order Diptera. To characterize
the miRNAs of both species, the small-RNA transcriptomes of adults (male and female) and larvae (third instar)
were sequenced using Illumina MiSeq next generation sequencing platform. The 6.2 million reads generated were
mapped against the Drosophila melanogaster genome and screened in miRBase. We identified 69 miRNAs in C.
hominivorax and 71 in C. macellaria, conserved since the Nephrozoa ancestor (641 MYA) in the basis of Bilaterian
clade. Nucleotide substitutions were biased to 3’-end portion of the miRNAs with rare seed region shifting. The
preliminary expression profile revealed 43 differentially expressed miRNAs between species, gender and life stages,
given by hierarchical clustering analysis. These results will provide new information about the genetic background
of parasitic habits in Calliphoridae, with prospects to evolutionary studies in Diptera and pest-management control.
Financial support: Fundação de Amparo a Pesquisa do estado de São Paulo (FAPESP).
176
GENETIC DIFFERENTIATION OF HOPLIAS
MALABARICUS (ERYTHRINIDAE:
CHARACIFORMES) REVEALED BY ANALYSIS
OF MITOCHONDRIAL DNA
Pires, WMM¹, Barros, MC¹, Fraga, EC¹.
¹Laboratório de Genética e Biologia Molecular – CESC/UEMA, Caxias-MA
e-mail: xxxx
Keywords: COI, Traíra, Maranhão Rivers, Genetics structure, Populations
The species H. malabaricus, popularly known as Traíra, probably represents a distinct species, today encompassed in
one specific denomination. Cytogenetic studies demonstrated large variation chromosomal among populations of
this species, being classified in seven cytotypes (A-G). Allied to this, molecular data evidenced high levels of genetic
diversity and support the hypothesis of H. malabaricus as a species complex, including independent biological
units. This study aimed to determine the levels of molecular diversity using DNA methodology BARCODE in the
species H. malabaricus. 42 specimens were collected from the Maranhão Rivers and 16 sequences of the Rivers São
Francisco, Paraná and Argentina, retrieved from GenBank were incorporated into the analyses. DNA extraction
was performed from muscle tissue using the protocol of phenol-chloroform, the genomic region amplification was
performed by PCR and sequencing using an automated sequencer 3500 (Life Technologies). The sequences were
aligned using the program BioEdit CLUSTALW, the genetic distance was estimated by neighbor-joining (NJ) by
MEGA5 and population analyses in the program Arlequin 3.11. A sequence of Prochilodus nigricans was retrieved
from GenBank was used as outgroup. The analyzes revealed a fragment of 644 bp for the mitochondrial COI gene,
with 66 polymorphic sites, 22 haplotypes and high haplotype diversity (0.907). The trees constructed haplotypes
based on the methods of grouping neighbors /NJ, Maximum Likelihood/ ML and Maximum Parsimony /MP using
the Kimura 2P model showed similar topology grouping strongly (99NJ/98ML/99MP) haplotypes Maranhão rivers
(Mearim, Itapecuru , Pindaré and Parnaíba) and haplotypes from the São Francisco River. The analysis also showed
that the haplotypes of the Paraná Rivers, São Francisco and Argentina grouped strongly in separate clades with
values (95NJ, 95ML, 98MP), (99NJ, 98ML/86MP) and (100NJ, 100ML, 100MP) respectively. The nucleotide
divergence matrix showed indices ranging from 0 to 2% between individuals of the maranhenses populations from
2 to 7% compared with the GenBank populations. The AMOVA value of Fst of 0.855 and p highly significant,
with the highest variation (64.99%) among the groups. The findings of this analysis provide us with important
information about the genetic structure in populations of H. malabaricus showing a process of genetic differentiation.
Financial support: FAPEMA, UEMA.
177
INSECTICIDE RESISTANCE IN COCHLIOMYIA
HOMINIVORAX (DIPTERA:CALLIPHORIDAE):
ANALYSIS OF SELECTION AND
GEOGRAPHICAL DISTRIBUTION OF
MUTATIONS OF CARBOXYLESTERASE E3
GENE
Bergamo, LW1, 2;Fresia, P3; Azeredo-Espin AML1, 2
Center for Molecular Biology and Genetic Engineering (CBMEG), Campinas State University (UNICAMP), Campinas, SP,
Brazil; 2Department of Genetics, Evolution and Bioagents (DGEB), Institute of Biology (IB), Campinas State University
(UNICAMP), Campinas, SP, Brazil; 3Department of Entomology and Acarology (LEA), “Luiz de Queiroz” College of
Agriculture (ESALQ), University of São Paulo (USP), Piracicaba, SP, Brazil.
1
[email protected]
Keywords: New World screwworm, myiasis, insecticide resistance, positive selection, carboxylesterase E3
Livestock production is an important economic activity in Brazil, but has been suffering significant losses due to the
impact of parasites. The New World screwworm fly (NWS), Cochliomyia hominivorax, is an important ectoparasite
and myiasis causing fly endemic from the Americas, which stand out in this scenario. The current distribution of
NWS includes part of Caribbean and all South America and has been successfully eradicated from North and part
of Central America by sterile insect technique (SIT). In South America, NWS is controlled by chemical insecticides,
whose indiscriminate use has caused the selection of resistant individuals and hence reducing their effectiveness.
The Gly137Asp and Trp251Leu substitutions in the active site of carboxylesterase E3 have been associated to
resistance of diethyl and dimethyl organophosphates, respectively. To infer selective constraints on synonymous
substitutions we aligned cDNA sequences of this esterase gene from sixteen Muscomorpha species available in
Genebank. Codon substitution models were used, in which both likelihood ratio tests between the mutation-selection
models implemented in CODEML program from PAML 4.6 (FMutSel0-M0 X FMutSel-M0 and FMutSel0-M3 X
FMutSel-M3) were statistically significant (p=0.000, d.f.=41), indicating that only the mutational bias is not sufficient
to explain the synonymous substitutions, but selection might be an important factor on their evolution. A second
approach, based on the nucleotide composition at the third codon position and codon usage bias with RSCU (Relative
Synonymous Codon Usage), showed the existence of a trend between the most abundant codons and a cytosine in
that position of part of the four and six-fold degenerate amino acids. These results are in agreement with the idea
that C-ending codons stabilize the mRNA and the efficiency of translation, and then would be favoured by selection.
Future analysis will investigate positive selection on non-synonymous substitutions of C. hominivorax E3 gene.
Financial Support: Fapesp
178
RECOVERING THE TAXONOMIC IDENTITY OF
SPECIES OF THE GENUS OXYSARCODEXIA
(DIPTERA: SARCOPHAGIDAE) BY THE ANALYSIS
OF COI SEQUENCES
Ricardo, PC1; Mello-Patiu, CA2; Lessinger, AC1
Departamento de Biologia, UFSCar, Sorocaba, SP; 2Departamento de Entomologia, Museu Nacional – UFRJ, Rio de
Janeiro, RJ.
1
[email protected]
Keywords: biodiversity, molecular markers, DNA barcodes
The Oxysarcodexia stands as one of the most species-rich genera of Sarcophagidae (so-called flesh flies), comprising 81
known species, many of which reported in Brazil. Species from Oxysarcodexia are phenotypically similar, with a few
taxonomic informative characters present almost exclusively in adult males. These morphological similarities result in
identification conflicts. MtDNA sequences analyses have been informative for supporting species identification and
for addressing taxonomic conflicts in sarcophagids, but there are few molecular data regarding Neotropical species. The
aims of this study are: 1) to provide the characterization of intra and interspecific intervals of genetic variation retrieved
from comparative analysis of DNA sequences from the COI 5’-end, known as the “barcode region”, and from the COI
3’-end in Sarcophagidae, and 2) to evaluate the usefulness of these molecular markers in recovering taxonomic identity
of Oxysarcodexia species accurately. Individuals were sampled in natural preserved areas from Cerrado (Itirapina; Santa
Rita do Passa-Quatro) and Atlantic Forest (São Miguel Arcanjo) and in urban areas (Sorocaba) in São Paulo State.
Samples were preserved in dry ice from field collection to -70°C in lab sample collection. Digital images of specimens’
aedeagus (male genitalia) were used for taxonomic identification. Only the legs were removed from the specimens and
used in DNA extraction procedures. Amplification and sequencing of COI 3’-end with the primers L2-N-3014 and
C1-J-2195 resulted in a 677 bp region, while COI 5’-end were amplified and sequenced using calliphorid taxon-specific
primers, recovering a 596 bp region. Pairwise-distances were used to characterize the intra and interspecific variation
patterns. Sarcophagidae sequences analysis, from the 3’-end region showed intraspecific distances which varied from to
0 - 1%, whereas interspecific distances remained above 2.2%, with no overlap on their distribution. On the other hand,
the barcoding region analysis reveals an intraspecific variation value of 0,8% as highest, while interspecific distances
varied from to 1.5 - 16.9%, with a less evident barcoding gap. Regarding Oxysarcodexia species, no overlap was identified
between intra and interspecific distances. These analyses suggest that COI sequences provide confident results for
recovering Oxysarcodexia species identity; however, a more comprehensive sampling is still required. This DNA-based
identification approach may be useful in assisting taxonomic efforts in Neotropical biodiversity surveys, especially as a
tool for validating cryptic species identification. Further developments of this study may provide a valuable contribution
to the project Identificação Molecular da Biodiversidade de Invertebrados Terrestres, integrating the BrBOL initiative.
Financial Support: CNPq/MCT/FNDCT n°50-2010
179
GENETIC DIVERSITY AND POPULATION
STRUCTURE OF GYNAIKOTHRIPS
UZELI ZIMMERMAN (THYSANOPTERA:
PHLAEOTHRIPIDAE) IN THE STATE OF BAHIA
Silva Junior, JC; Mascarenhas, ALS; Waldschmidt, AM
Universidade Estadual do Sudoeste da Bahia (UESB), Departamento de Ciências Biológicas (DCB), Campus Universitário
de Jequié, BA
[email protected]
Keywords: Ficus benjamina, haplodiploidy, heterozygosity, ISSR, thrips and genetic variability.
Gynaikothrips uzeli is a tiny parthenogenetic subsocial pantropical insect species that forms galls. Ficus benjamina L.
(Moraceae), a common tree in urban areas of Brazil, hosts this exotic thrip species. Since the population structure of
thrips, mainly of subsocial species, is unknown, the goal of this work was to analyze the genetic diversity and structure
in populations of G. uzeli. Sample collection was performed in six municipalities from Bahia state (Salvador, Nazaré,
Jaguaquara, Jequié, Contendas do Sincorá, and Vitória da Conquista). Three insects were obtained from gails of 10
trees, encompassing 30 specimens per locality. Total DNA extraction was performed individually from adult insects
according to Roberts (1998) with modifications. The genetic analyses were based on ISSR (inter simple sequence repeat)
markers once they are independent of previous knowledge about DNA sequences and allows detecting polymorphism
in microsatellite-flanked regions. Ten ISSR primers were selected from UBC (University British Columbia) series based
on definition, reproducibility and number of bands. The results indicated low genetic diversity (He = 0.2621 and HB =
0.2349) and high population structure (ΦST = 0.3630 and θB = 0.4797 p < 0.05). Pairwise genetic distances were reduced
between Salvador and Jaguaquara samples (0.0516) and increased between Salvador and Vitória da Conquista (0.1535).
Both UPGMA and STRUCTURE analyses grouped localities into three groups: 1. Salvador, Jaguaquara and Contendas
do Sincorá; 2. Nazaré and Jequié, and 3. Vitória da Conquista. Two-hierarchical AMOVA revealed 63.69% of genetic
variation within populations and 36.31% among them. Mantel’s test showed a weak correlation between geographic
and genetic distances (r = 0.3579; p = 0.125). Therefore, the geographic distance cannot account for the structure and
diversity of populations of G uzeli. Thus, gall behavior, fonder effects on new galls, low dispersal and haplodiploid system
might influence the genetic traits of this species. In conclusion, reports that associate molecular markers and biological
data are helpful to understand the natural history, population structure and genetic diversity in haplodiploid insects.
Financial Support: FAPESB and UESB.
180
MOLECULAR CHARACTERIZATION OF THE
GENERA PHYLLOMEDUSA (ANURA HYLIDAE)
THROUGH MITOCHONDRIAL GENES
Conceição, E1; Fraga, EC1; Pavan, D1; Barros, MC1.
Laboratório de Genética e Biologia Molecular – CESC/UEMA, Caxias-MA
1
[email protected]
Keywords: Taxonomy, 16S rRNA, Phyllomedusa
In Brazil there are 946 species of frogs and 32 belonging to the genera Phyllomedusa, the species of this genera present
taxonomic difficulties arising from the high morphological similarity between their representatives. Molecular data
have been used as a tool in classification and resolution of this issue. This study aimed to characterize molecularly
the genera Phyllomedusa and thus contribute to the resolution of taxonomic uncertainties that genera. The samples
from Maranhão, Pará and Piauí of different biomes, such as cerrado, caatinga and amazon forest. The total DNA
was extracted from muscle tissue using the phenol-chloroform protocol. Isolation and amplification of the 16S
rRNA gene was performed by PCR using specific primers that were sequence through the sequencer ABI 3500
by Life Technology. Sequences were edited and aligned in the program Bioedit. DNA polymorphism, haplotype
diversity (h) and nucleotide (π) were determined in the program DnaSP, phylogenetic trees and distance matrix
were obtained in the MEGA program. We analyzed 32 sequences of the 16S rRNA gene comprising the three
states. Hylomantis hulli (GQ 366226) and Phasmahyla guttata (AY8437161) were used as outgroup. A fragment
of 532 bp was obtained revealing the occurrence of 509 conserved sites, 23 variable and 14 parsimony informative
for the 11 haplotypes, haplotype diversity 0.8046 and 0.00596 nucleotide. The estimated genetic divergence
ranged from 0.2 to 3.5%. The phylogenetic trees generated independent of the model revealed clusters strongly
supported. The magnitude of genetic divergence added to the phylogeny and distribution area is an indication
that the specimens in question belong to the same status specific independent of the occurrence of biome.
Financial Support: UEMA and FAPEMA
181
USE OF MOLECULAR TOOL TO IDENTIFY
SPECIES OF FISH IN THE FORM OF
COMMERCIALLY FROZEN STEAKS: A STUDY
IN SUPERMARKETS IN BELEM, PARA
Wagner Cunha, Jeferson Costa Carneiro, João Braullio Luna Sanes, Juliana Araripe, Horacio Schneider & Iracilda
Sampaio
Laboratório de Genética e Biologia Molecular, Instituto de Estudos Costeiros, Universidade Federal do Pará
[email protected]
Keywords: fish fillets, Molecular identification, Mitochondrial DNA, DNA sequencing.
The marketing of fish fillet is a common practice in the supermarkets of large Brazilian urban centers and the world.
However, due to processing, marketed species can not be easily identified by the appearance of the fillet, which often
results in substitution species. This study used the mitochondrial 16S gene sequencing DNA as a tool for identification
of frozen fillets purchased in supermarkets in Belém, Pará. We analyzed 12 batches (46 different pieces of fillets),
labeled as Yellow fish (pescada amarela), White fish (pescada branca), Cat fishes (piramutaba, dourada, gurijuba and
rosado). The Gurijuba (Sciades parkeri) was the only fish that DNA identification confirmed the labeling, while all
other species were replaced. In most cases of replacement species of greatest commercial value was replaced by a low
value. In others, as in the case of White fish, were found several species of the family Sciaenidae, which does not
necessarily characterize a fraud, but a failure of legal advice or dificult on the identification. The global percentage of
replacement was 72%. This study confirmed the high efficiency of the DNA protocol for evaluating the marketing of
derivatives fishing in the region.
182
CURRALEIRO HORSES IN GOIÁS: IS THIS
A NEW BREED OF HORSES FROM THE
BRAZILIAN SAVANA?
Silva, DC1,2; da Silva, MC1; da Cruz, AS3,5; Fioravanti, MCS1,2; da Cruz, AD5; Sereno, JRB4
Programa de Pós-Graduação em Ciência Animal, Escola de Veterinária e Zootecnia, Universidade Federal de Goiás,
Goiânia, Goiás; 2Escola de Veterinária e Zootecnia, Universidade Federal de Goiás, Goiânia, Goiás; 3Programa de
Pós-Graduação em Biologia Celular e Molecular, Universidade Federal de Goiás, Goiânia, Goiás; 4Empresa Brasileira
de Pesquisa Agropecuária, Embrapa, Planaltina, Distrito Federal; 5Núcleo de Pesquisas Replicon, Departamento de
Biologia, Pontifícia Universidade Católica de Goiás, Goiânia, Goiás.
1
[email protected]
Keywords: Equine, Genetic resource, Savana, Phenotype, Breeds
In Vão do Paranã, Goiás, Brazil, a population of horses constituted potential breed called Curraleiro. In the literature,
the most frequently described characteristics for these animals were small height, hardiness, and work endurance.
However, until 2013 there were no studies designed to identify and understand the genetic resources of Curraleiro
horses from the Brazilian savanna. The aim of this study was to assess traditional knowledge regarding the existence
of Curraleiro horses in the northeast region of Goiás. The study also allowed for the observation of the animals in loco
to generate a phenotypic profile in order to discriminate them from the other breeds. We applied a semistructured
questionnaire and the results were analyzed according to Bardin (2004). Blood samples, hair bulbs, and morphometric
measurements were collected from each observed animal. We visited 5 northeast villages in Goiás and observed 25
horses (16 males and 9 females). With respect to the interviews it was noted that the term Curraleiro is frequently
disclosed in the speeches. This potential breed was different from other recognized breeds, and the animals could be
distinguished by their phenotypic traits, including small to medium height, small ears, short and steep hip (called
pig’s hip), small hoof (called ass’ hoof ), large amount of hair under the jaw, and in the regions of the pastern and
fetlock. Some typical traits of breeds officially recognized can be used as exclusion criteria for the Curraleiro horse
such as: large stature, large head with a convex profile, long and sloping hindquarters, and large hooves. As in the
literature, the interviews revealed that the Curraleiro horse were sturdy and rustic, ideal for work in the stony soil
of the region where the animals were found. Based on the phenotypic descriptors, the observed animals could be
grouped by degree of purity, which could then be confirmed by genotyping microsatellite markers as recommended
by the International Society for Animal Genetics. Preliminarily, 7 animals were considered Curraleiro with minimal
introgression from other racial groups, and these animals were usually found in places with difficult access, which
reveals a possible correlation between the allele frequencies of the markers and the characteristics of the landscape and
local development. Therefore, we concluded that the Curraleiro horse in Goiás is not an extinct genetic group, and
although scarce, it is still possible to locate and phenotypically differentiate them from recognized equine breeds. This
scenario leads to a favorable prospect regarding the identification and registration of a new equine breeds within Brazil.
The sample group will be increased and genotyped in order to assist with conservation strategies of this genetic resource.
Financial Support: CNPq and the Centre Nacional de la Recherche Scientifique (CNRS)- France
183
RELATEDNESS BETWEEN PAIRS OF THE
EXTINCT-IN-THE–WILD SPIX´S MACAW
(CYANOPSITTA SPIXII)
Monteiro, RS1; Miyaki, CY1.
1
[email protected]
Keywords: parentage, inbreeding, conservation, reintroduction, kinship
Spix’s macaw (Cyanopsitta spixii) is one of the most endangered birds of the world and is extinct in the wild. Several
coordinated studies are being conducted for its management and conservation in captivity for future reintroduction.
Small populations tend to have strong effects of genetic drift and may suffer deleterious effects of inbreeding, further
reducing heterozygosity and genetic diversity, which are important for long-term conservation. Microsatellites are
useful markers to estimate relatedness between individuals and this data can be used to minimize the deleterious effects
of inbreeding, recommending less closely related pairs for the captive breeding program. The addition of genetic data
(four microsatellites) of four chicks recently born in Germany to the dataset previously produced in our laboratory by
Flavia Presti (77 individuals) resulted in few changes on the values of genetic similarity between pairs of individuals.
However, three of these four chicks (two males and one female) present relatively low indices of similarity and of
relatedness with other birds and can be important reproducers in the future. Specific polymorphic microsatellites are
currently being tested. Financial Support: FAPESP, CAPES, and CNPq.
184
IDENTIFYING POPULATION UNITS OF SPINNER
DOLPHINS (STENELLA LONGIROSTRIS GRAY,
1828) IN BRAZILIAN COASTLINE THROUGH
MICROSATELLITE ANALYSIS
Faria, DM1; Silva-Jr, JM2; Marino, CL3; Moreno, I4; Siciliano,S5; Barbosa, L6; Meirelles, ACO7; Di Tullio, J8; Andriollo,
A 9; Paiva, SR10; Farro, APC1
Universidade Federal do Espírito Santo (UFES), São Mateus, ES, Brazil; 2Centro Mamíferos Aquáticos - Instituto Chico
Mendes de Biodiversidade (ICMBio), Brazil; 3Universidade Estadual Paulista (UNESP), Botucatu, SP, Brazil; 4Universidade
Federal do Rio Grande do Sul (UFRGS), RS, Brazil; 5Fundação Oswaldo Cruz (FIOCRUZ), RJ, Brazil; 6Instituto ORCA
(Organização Consciência Ambiental), Vila Velha, ES, Brazil; 7Programa de Conservação de Mamíferos Marinhos,
AQUASIS, Brazil; 8Universidade Federal do Rio Grande (FURG), RS, Brazil; 9Universidade Federal de Juiz de Fora (UFJF),
MG, Brazil; 10EMBRAPA - Recursos Genéticos e Biotecnologia- Brasília, DF, Brazil.
1
[email protected]
Keywords: cetaceans; conservation; genetic diversity; molecular markers; population structure.
Spinner dolphins show significant genetic structure in North Pacific Ocean, however little is known about the South
Atlantic Ocean stocks. In order to test this hypothesis through the Brazilian coastline, 223 samples collected in
nine different localities were tested with seven polymorphic microsatellite loci. We observed high average values
of observed (Ho=0.973) and expected (He=0.813) heterozygosity and genetic diversity (Dg=0.812). Deviations of
EHW were significant (p<0.05) for individuals from Fernando de Noronha Archipelago and Rio de Janeiro coastline.
The Bayesian cluster analysis and Principal Coordinate Analysis (PCA) revealed the genetic structuring of spinner
dolphins of the Brazilian coastline in two population units, AMOVA (FST= 2.16; P≤0.05) and genetic differentiation
indexes (FST: 0.0198; RST: 0.0165; P≤0.001) confirmed such results with significant values. The two population
units showed high genetic diversity (P1: Dg=0.7936; P2: Dg=0.783), observed heterozigosity (P1: Ho=0.962; P2:
Ho=0.980) and expected heterozygosity (P1: He=0.820; P2: He =0.794) and allelic richness (P1: Ra=13.1; P2:
Ra=8.5). Both population units showed significant deviations of EHW in all loci. The genetic structuration identified
revealed the existence of at least two population units of spinner dolphin in Brazilian coastline and that there is
gene flow among individuals from different and distant localities. Spinner dolphins sampled in the Fernando de
Noronha Archipelago were separated in two different clusters suggesting the existence of two population units
in this locality, probably one resident and another composed by transients, with this second sharing alleles more
effectively with other localities. With this differentiation it is possible the existence of two management units
of spinner dolphin in Fernando de Noronha. There is the necessity of inclusion of more samples from different
localities to verify if this number of population units is maintained or increased for the species in Brazilian coast.
Financial Support: FAPES and PETROBRAS
185
CHROMOSOMAL ANALYSIS IN
BOTHUS OCELLATUS (BOTHIDAE,
PLEURONECTIFORMES) FROM MARAÚ
PENINSULA – BA
Argolo,LA1; Bitencourt, JA2; Affonso, PRAM1.
Universidade Estadual do Sudoeste da Bahia, Departamento de Ciências Biológicas, Jequié, BA; 2Universidade Federal
do Pará, Instituto de Estudos Costeiros, Bragança, PA
1
[email protected]
Keywords: Banding, chromosomes, cytogenetics, flatfish, Pleuronectiformes
Pleuronectiformes (flatfishes) is a derived order within teleosteans, representing one of the few groups with remarkable
chromosomal variation from marine and estuarine systems. Cytogenetic reports are available for nearly 60 species,
revealing diploid numbers from 2n = 28 to 2n = 48. Nonetheless, most reports are based on traditional methods and
banding data are scarce. To increase the chromosomal data in flatfishes, cytogenetic analyses were carried out in specimens
of Bothus ocellatus from Maraú Peninsula in Bahia coast, northeastern Brazil. Metaphase cells were obtained from anterior
kidney and chromosomes were stained with Giemsa for karyotyping. The karyotype formula and the fundamental
arm number (FN) were calculated based on chromosomal arm ration. Location and composition of heterochromatin
were determined by C-banding and fluorochrome staining (CMA3/DA/DAPI). Active ribosomal sites (NORs) were
identified by silver nitrate staining. All individuals presented a modal diploid number of 2n=32, divided into 18 meta/
submetacentric (m/sm) and 14 subtelo/acrocentric (st/a) chromosomes (NF = 50), as previously described for other
populations. This result shows an unique apomorphic condition in relation to basal karyotype of marine teleosteans
(2n=48, FN = 48), suggesting the occurrence of several centric fusions during the karyoevolutionary pathway of
Pleuronectiformes. On the other hand, banding data revealed the maintenance of conserved microstructural traits in
marine fish such as the presence of single NORs on short arms of a m/sm pair and small amounts of pericentromeric
and NOR-associated heterochromatin. The heterochromatic blocks interspersed to NORs were GC-rich, as commonly
reported in fish. Therefore, the present data provide the first karyotype description of Bothus ocellatus from northeastern
Brazil that can be used as chromosomal markers to infer the evolutionary and phylogenetic aspects of this order.
Financial Support: CAPES, FAPESB.
186
DNA DEGRADATION PATTERN IN DEER FECAL
SAMPLES
Perles, L1,2; Figueiredo, MG1,3; Duarte, JMB1
Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP), Jaboticabal – SP; 2Curso de graduação em Medicina
Veterinária, Faculdade de Ciências Agrárias e Veterinárias (FCAV), Universidade Estadual Paulista Júlio de Mesquita Filho
(UNESP), Jaboticabal – SP; 3Programa de Pós-graduação em Genética e Melhoramento Animal, Faculdade de Ciências
Agrárias e Veterinárias (FCAV), Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP), Jaboticabal – SP.
1
[email protected]
Keywords: Cervidae, fecal samples, non-invasive sampling, degradation, brocket deer.
The use of non-invasive methods has become an important tool for genetic studies of wild populations, making it
possible to obtain a larger number of samples than it would be by the use of invasive methods. Nevertheless, there
might be problems to obtain genetic material from fecal samples, as they present low concentration and quality of
DNA when compared to the samples of tissues and hair. In order to identify the main factors that affect the quantity
and quality of the DNA obtained, this paper was carried out using ten samples of fresh faeces of brown brocket deer
(Mazama gouazoubira) kept in captivity at NUPECCE/UNESP. The samples were stored in a BOD incubator at 25,5°
C and 69-76% of humidity. Three pellets of each animal were taken from the incubator at different periods of time
(estimated by the number of days that they were stored): 0, 1, 3, 6, 14, 30, 45 and 60 days. The DNA was extracted
by the use of the Silica Protocol and it was quantified in a real-time (RT-PCR) thermocycler, using a standard curve
from five dilutions that varied from 250ng to 1,5ng, from a DNA that presented known concentration. The values
obtained in the quantification varied according to the samples: fresh samples (0 and 1 day) – 0 to 269 ng; non-fresh
samples (30 and 45 days) – 0 to 23.710 ng for mitochondrial DNA and 0 to 98ng and 0 to 494ng for nuclear DNA.
The nuclear DNA amplification was obtained at 100% of the fresh feces and at 83% of non-fresh, and regarding the
mitochondrial DNA, it was obtained 95% and 83%, respectively. We observed that the freshest samples presented
lower variation of DNA quantity when compared to the older samples. However, we were able to obtain high rates
of amplification even from the oldest samples, which shows that this kind of samples should not be discarded.
Financial Support: FAPESP (processo nº 2011/10036-7) and FCAV/UNESP.
187
GENE EXPRESSION PROFILE OF AATK IN MILK
CELLS FROM DAIRY GYR COWS INFECTED
WITH STREPTOCOCCUS AGALACTIAE
Martins, MF1; Fonseca, I2; Pinto, ISB3; Santos, ASO3; Vieira, FO4; Martins, SAV4; Fogaça, GN4; Lima, KR5; Cardoso,
FF6; Guimarães, SEF2
Embrapa Dairy Cattle,, Juiz de Fora, MG; 2Universidade Federal de Viçosa, Viçosa, MG; 3Universidade Federal de Juiz de
Fora, Juiz de Fora, MG; 4Centro de Ensino Superior de Juiz de Fora, Juiz de Fora, MG; 5Universidade Presidente Antônio
Carlos, Juiz de Fora, MG; 6Embrapa South Animal Husbandry & Sheep, Bagé, RS
1
[email protected]
Keywords: immune response, mastitis, qPCR
Mastitis is characterized by the presence of an inflammatory response in the mammary gland caused by metabolic
and physiological alterations, injuries or, more frequently, pathogenic microorganisms, being speed and efficiency of
the host’s immune response a crucial factor for establishment, persistence and severity of the infection. Associated
with sanitary care, the selection of animals that are resistant to the disease and the incorporation of this trait into the
herds seem to be a promising way to reduce problems caused by this disease. The genes involved in immune response
have been suggested as strong candidates for the resistance phenotype and susceptibility to this disease. Therefore,
by means of real time PCR technique it was evaluated the profile for the expression of AATK (apoptosis-associated
tyrosine kinase) gene in milk cells of 17 Gyr cows artificially inoculated with a strain of Streptococcus agalactiae. Milk
samples were collected before inoculation (hour 0) and 24 hours after inoculation. Total RNA was extracted from
milk and the first strand of the cDNA was synthesized. Primers used to analyze AATK gene expression and both
endogenous references (RPLP0 - ribosomal protein large P0 - and Ubiquitin) were designed using Primer Express
software (Applied Biosystem) based on sequences from GenBank database. Statistical analysis were performed using
REST©2009 software, developed by M. Pfaffl (Technical University Munich) and Qiagen. Comparisons between
gene expression levels indicated that on time 24, animals expressed 11.2 times more AATK than on time 0 (p <
0.001). It is known that damage to the mammary tissue can be induced by apoptosis or necrosis, and the AATK
gene has a function related to apoptosis. The increase in the expression of this gene can indicate the induction of
apoptosis in the mammary gland after experimental infection with Strep. agalactiae. Furthermore, the difference
in the expression profile of this gene suggests that AATK possibly plays an important role in the mechanisms of
resistance to bovine mastitis. The knowledge generated by studies of the expression of candidate genes can help in
the selection of better adapted and more productive animals, enabling a reduced need to administer drugs, with
consequent reduction of production costs and levels of contamination of dairy products and the environment.
Financial Support: CNPq, CAPES, FAPEMIG and EMBRAPA/AGROFUTURO
188
STUDY OF THE EVOLUTIONARY HISTORY OF
ROBUST CAPUCHIN MONKEYS (SAPAJUS)
FROM THE SOUTH OF AMAZON: RIVERS ARE
EFFECTIVE GEOGRAPHICAL BARRIERS?
Martins-Junior, AMG1, Gomes, F1, Sampaio, I1, Schneider, H1.
Instituto de Estudos Costeiros (IECOS), UFPA, Bragança – Pará
1
[email protected]
Keywords: Capuchin monkeys, D-loop, Tocantins River, Sapajus, South Amazon
Capuchin monkeys (Cebus and Sapajus) are generalist primates who have broad distribution in the Neotropics, from
Central America to northern Argentina. The problematic taxonomic around these groups is emphasized due to the
large variation of forms and, although have recently emerged hypotheses about their diversification, there are still
gaps, especially in relation to the current distribution of Sapajus in the southern region of the Amazon. Some authors
suggest that the Pleistocene forest refugia were important for the radiation of primates in the Amazon, although there
is evidence weakening this hypothesis. Others showed that Amazonian rivers would be an important vicariant factor
in the diversification of primates. Then, the present study aims to analyze whether the Tocantins River in the southern
region of the Amazon is a geographical barrier to capuchin monkeys. For this purpose, 132samples of S. apella
were sequenced from both the left margin (n=13) and the right margin (n=119) by the molecular marker D-loop.
Employing specific conditions and primers, the marker was amplified, viewed on a 2% agarose gel, purified and
sequenced on Genetic Analyzer3500XL/Applied Biosystems. Sequences were aligned and edited in software Bioedit,
totaling 557pb. Using the software DnaSP 10.5.1, was estimated haplotype diversity. The population structure along
the study area was estimated by BAPS6.0 program using the methodology of not mixing and admixture and haplotype
network was constructed by the software HaploView 4.0. From jModelTest 2.0.2, was chosen evolutionary model
HKY + I to then analyze the phylogenetic relationships among lineages found employing topological reconstruction
of haplotypes by Bayesian Inference in the program BEAST 1.7.2, with generation time of 50.000.000. We found
20 different haplotypes (Hd=0.725) and six population structures: three on the right side and three on the left bank.
The haplotype network supports the six structures, three on the left and three on the right bank. Still, the Bayesian
inferences corroborate the six structures with the same distribution along the left and right margins. Clearly, our data
show that different populations from the left edge are separated from those of the right bank, with those in the same
bank are close together. These finding supports the hypothesis of the Tocantins River as geographical barrier, which
can lead to species diversification. Corroborating our data, Vallinoto et al. (2006) showed that the Tocantins River is
a geographical barrier for the primates tamarins.
189
DEVELOPMENT AND CHARACTERIZATION
OF MICROSATELLITE MARKERS IN A SPECIES
OF RODENT IN THE TRIBE AKODONTINI,
AKODON MONTENSIS (RODENTIA: MURIDAE)
Shenia P. B. Silva1; Thales Renato O. Freitas2; Iris Hass3.
Graduate Program in Genetics - Department of Genetics – UFPR; 2Dr. Professor, Department of Genetics – UFRGS; 3Dr.
Professor, Department of Genetics – UFPR.
1
[email protected]
Keywords: Akodon montensis, microsatellite, population
Microsatellite markers are co-dominant, found in high frequency and wide distribution in the genomes of eukaryotes.
They are being used in studies of populations of different organisms. We isolated and characterized 15 microsatellite
primers for the species Akodon montensis using two libraries enriched (GT) and (GATA). Research indicates that this
rodent species, despite not being endangered, have been suffering a decrease in population. The development of molecular
markers is important to analyze the genetic diversity and develop management strategies for conservation. The genomic
DNA was extracted using the CTAB method and microsatellites were isolated according to the protocol described by
Refseth et al. al. (2007). The DNA was digested with the restriction enzyme TaqI. The fragments were hybridized with
biotinylated probes and captured by magnetic beads coated with streptavidin. The cloning was done using a plasmid
vector in competent cells of Escherichia coli. The satellite sequences were aligned in the MEGA 5.1 program, than analyzed
by the ClustalW to identify similar clones. The program Primer3 was used to project the initiators. The fluorescence
Universal M13 (-21) staining with FAM was used as a strategy to fluorescently labeled primers for the analysis of
semi-automated method. From 15 microsatellite primers, four didn´t amplify successfully (Akom 1, 2, 3 and 15) and
the alleles Akom 5 and 6, showed two extra peaks and were discarded. The nine remaining primers were tested on 24
individuals from FLONA-SFP in the state of Rio Grande do Sul. The alleles showed polymorphism, ranging from 4 to
10 and with an average of 7.5 alleles per locus. The analysis made by the program MicroChecker detected null alleles
in loci Akom 7, 8, 11, 12 and 14, which had their numbers of homozygous genotypes adjusted to reflect the actual
population estimates. The average for all loci was 0.8125 to He and 0.6065 to Ho after this correction. The p values
were higher than the α value (0.05) to 7 of the 9 loci studied, showing deviations from the equilibrium Akom 8 and
14. The inbreeding coefficient (Fis) that was valued at 0.1435, implies 15% increase in the rate of homozygous of the
population. The polymorphic information content was rated as uninformative for Akom 10; moderately informative
for Akom 4, Akom 7, Akom 8, Akom 9, Akom 11, Akom 13 and Akom 14, and very informative for Akom 12.
Thus the species Akodon montensis has now a molecular tool for analysis of their populations and evolutionary history.
Financial Support: UFPR, UFRGS, Fundação Araucária.
190
EXPRESSION ANALYSIS OF CCL20 IN CELLS
FROM THE MILK OF GYR COWS BEFORE AND
24 HOURS AFTER ARTIFICIAL INFECTION
WITH STREPTOCOCCUS AGALACTIAE
Vieira, FO1; Fonseca, I2; Pinto, ISB3; Santos, ASO3; Martins, SAV1; Fogaça, GN1; Lima, KR4; Cardoso, FF5; Guimarães,
SEF2; Martins, MF6
Centro de Ensino Superior de Juiz de Fora, Juiz de Fora, MG; 2Universidade Federal de Viçosa, Viçosa, MG; 3Universidade
Federal de Juiz de Fora, Juiz de Fora, MG; 4Universidade Presidente Antônio Carlos, Juiz de Fora, MG; 5Embrapa South
Animal Husbandry & Sheep, Bagé, RS; 6Embrapa Dairy Cattle, Juiz de Fora, MG
1
[email protected]
Keywords: gene expression, mastitis, qPCR
Dairy cattle breeds of European origin are recognized as being more productive and also more demanding in terms
of management and nutrition than are Zebu breeds. Therefore, the expected higher production is not always borne
out in tropical regions in dairy farms that are less technically advanced. Among the zebuine breeds, the Gyr breed is
particularly well adapted to Brazilian environmental conditions. For this reason, it has been intensely used in crosses,
and is the preferred breed for the formation of crossbred dairy herds in Brazil. Several factors affect dairy production,
among animal health problems, infecto-contagious diseases stand out the most, and mastitis is the main such disease
afflicting dairy cattle from an economic standpoint. Mastitis is an inflammatory response of the mammary gland
caused frequently by pathogenic microorganisms. The genes involved in the immune response have been indicated
as likely candidates for understanding resistance and susceptibility to this disease. The identification of factors that
contribute to the predisposition of the mammary gland to mastitis will facilitate the development of new strategies
to control this disease, such as identification of genes that can be used as markers in animal breeding programs.
Therefore, by means of real time PCR technique it was evaluated the profile for the expression of CCL20 (chemokine
C-C motif ligand 20) gene in milk cells of 17 Gyr cows artificially inoculated with a strain of Streptococcus agalactiae.
Milk samples were collected before inoculation (hour 0) and 24 hours after inoculation. Total RNA was extracted
from milk and the first strand of the cDNA was synthesized. Primers used to analyze CCL20 gene expression and
both endogenous references (RPLP0 - ribosomal protein large P0 - and Ubiquitin) were designed using Primer Express
software (Applied Biosystem) based on sequences from GenBank database. Statistical analysis were performed using
REST©2009 software, developed by M. Pfaffl (Technical University Munich) and Qiagen. Comparisons between
gene expression levels indicated that on time 24, animals expressed 13.2 times more CCL20 than on time 0 (p <
0.001). CCL20 is a chemokine that interacts with the CCR6 receptor and the CCL20-CCR6 pair is responsible
for the chemoattraction of immature dendritic cells, T effector cells and B cells. The recruitment of these cell types
provides the link to the humoral immune response. During bacterial infection of the bovine mammary gland, a large
number of leukocytes migrate to the udder to establish the response against the pathogen. However, the population of
leukocytes is not yet well defined, therefore studies of gene expression related to the immune response can help to better
characterize this population and to understand how the host responds to a determined pathogenic microorganism.
Financial Support: CNPq, CAPES, FAPEMIG and EMBRAPA/AGROFUTURO
191
USING MOLECULAR BARCODES AS A
TOOL FOR THE STUDY OF CICHLID FISHES
(CICHLIDAE: PERCIFORMES) IN RAPID OF THE
ARAGUAIA RIVER/TO/BR
Carvalho, SV¹; Meliciano, NV¹; Hrbek, T¹.
¹Instituto de Ciências Biológicas, UFAM, Manaus, AM
[email protected]
Keywords: fish, rapids, Cichlidae, DNA Barcode, COI
The Cichlidae are one of the most diverse fish families in the world, with over 1300 species, of which approximately
450 occur in South America. Although most species occur in lentic waters, some genera have independently specialized
to occupy rapids. The South American rheophilic cichlids include species of the genera Retroculus and Teleocichla
as well as reophilic specialists of the genera Geophagus and Crenicichla. Same as other rheophilic groups, reophilic
cichlids are often endemic, have specializations for living in turbulent waters environments and are dependent on
environmental factors typical of rapids. Such habitats are found in a number of Amazonian rivers that descend
from the Guyana and Brazilian shields, but whose reophilic habitats are being eliminated by the construction of
hydroelectric power plants. In this scenario, it is of imminent interest to use methodologies that help to qualify
accurately the richness and composition of the resident ichthyofauna of these rapids. This study used the DNA
barcode methodology to discriminate and evaluate the species composition of cichlid fishes associated with rapids
of the Araguaia river (TO / BR), more specifically in the areas of influence of the project “Usina Hidrelétrica Santa
Isabel”. This method makes it possible not only corroboration of traditional taxonomic identification, but also
assists in resolving impasses of traditional taxonomy, as cryptic species and morphological variation. Calculations
of intraspecific and interspecific genetic distance as the phylogenetic reconstruction were performed using the
parameters suggested by Herbert et al., 2003 to DNA Barcode. Sampling has obtained sequences of 67 individuals
of four species (Geophagus altifrons, Retroculus lapidifer, Cichla piquiti, Crenicichla sp.) collected in the Araguaia
river rapids along the upstream, reservoir and downstream of the dam site foreseen. All specimens are identified
and properly deposited in Ichthyological Collection of INPA and Tissue Collection of Animal Genetics / UFAM.
The COI fragment generated has in total 566 base pairs, of which 212 are variable and 186 are parsimoniously
informative. The smallest intraspecific distance was observed in Crenicichla sp. with 0.002 ± 0.001. On the other
hand the species that showed the highest intraspecific distance, 0.052 ± 0.005, was Cichla piquiti. The distances
between species ranged from a minimum of 0.182 ± 0.018 between Geophagus altifrons and Retroculus lapidifer, up
to 0.282 ± 0.024 between Geophagus altifrons between Crenicichla sp. The DNA Barcode methodology satisfactorily
identified species, staying all monophyletic and with very good reliability (99% boostrap). Identifications using
molecular characters were congruent with the identification made prior using morphological characters, even with a
very high degree of similarity (> 99%) between the fragments undergo consultation and available in online databases.
192
UNRAVELING THE SPECIES COMPLEX
“OLIGORYZOMYS FLAVESCENS”: NEW
MOLECULAR AND CYTOGENETIC DATA
HELPED TO RECOGNIZE A NEW CLADE FROM
BOLIVIA AND ARGENTINA
Paresque, R1; Salazar-Bravo, J2
Centro Universitário Norte do Espírito Santo, Universidade Federal do Espírito Santo; 2Biology Department, Texas Tech
University
1
e-mail: xxxx
Keywords: Oligoryzomys flavescens, cytochrome b, beta-fibrinogen intron 7, cytogenetic, B-chromosomes, Neotropical
Fauna
Oligoryzomys flavescens was described by Waterhouse in 1837 with specimens from Maldonado in Uruguay. O.
flavescens is widely distributed in South America occurs on the east coast of Brazil from Bahia, Espírito Santo, São
Paulo, Paraná, Santa Catarina to Rio Grande do Sul. It was also recorded in Uruguay, Argentina and Paraguay. In
this study, we analyzed sequences the mtDNA gene Cytochrome b (1140pb), beta-fibrinogen intron 7 (610pb) and
cytogenetic data (2n/FN). The sample was constituted by 16 specimens of O. flavescens from Argentina: Cordoba
(n=6), and Brazil: Espírito Santo (n=6), São Paulo (n=2) and Rio Grande do Sul (n=2); and 35 specimens of O. aff.
flavescens from Argentina (n=2) and Bolivia: Beni (n=1), Chuquisaca (n=5), Cochabamba (n=14), La Paz (n=3),
Santa Cruz (n=1) and Tarija (n=9). Our results indicated a new taxon, different from known species O. flavescens,
named here as O. aff. flavescens. O. aff. flavescens spread throughout the Andes of Bolivia and Argentina. Cytogenetic
analysis showed O. flavescens with 2n=64-66 and FN=66-68-70. O. aff. flavescens exhibited a variation of 2n=64, 66
or 68 and FN=66 or 68 and 2n=66 and FN= 72, with many chromosomal rearrangements previously unpublished in
literature for this group. The autosomal variation is due the presence or absence of small metacentric chromosomes,
reported in the literature as B chromosomes. Phylogenetic analyzes revealed O. longicaudatus as sister group
to O. flavescens from Argentina and Brazil and O. aff. flavescens from Argentina and Bolivia. The molecular and
karyotypic data indicate that these two species can be found in Argentina. The high FST values among animals
of Brazil and Bolivia (FST = 0.73 to 0.81) confirmed that these clades are really isolated and do not have gene
flow between populations. Among the animals from Bolivia, some populations appear to be more isolated than
others. For example, specimens from Cochabamba, collected at higher altitudes, showed higher FST values when
compared to other (FST =0.34 to 0.43). The lowest FST values were observed between populations of Chuquisaca
and Tarija and Chuquisaca and Argentina (FST = 0.13 and 0.25, respectively). The hypotheses of phylogenetic
relationships obtained in this work revealed new data that may contribute to the systematic of Oligoryzomys.
FAPES, FAPESP, CNPq
193
B CHROMOSOMES STRUCTURE IN
CHARACIDIUM SPECIES (CHARACIFORMES,
CRENUCHIDAE) BASED ON GENE PHYSICAL
MAPPING AND RDNA SEQUENCE ANALYSIS
Serrano EA, Pansonato-Alves JC, Oliveira C, Foresti F
Laboratório de Biologia e Genética de Peixes – Instituto de Biociências de Botucatu – UNESP, Bairro: Distrito de Rubião
Júnior s/n. 18618-970, Botucatu-SP, Brasil.
e-mail: xxxx
Keywords: xxxx
B chromosomes are supernumerary or extra elements to the standand complement present in several groups
of eukaryotic organisms, such as plants, fungi and animals. Different mechanisms appear to be involved in their
origin, including direct derivation from components of the standard set, from sex chromosomes and even as a
result of interspecific crosses, which mark them as an interesting model for genetic and evolutionary studies. The
present study aimed to analyze B chromosomes present in three fish species of the genus Characidium, identified
as C. gomesi, C. oiticicai and C. pterostictum using molecular cytogenetic techniques involving physical mapping
of repetitive sequences of 18S and 5S rDNA, amplification and genetic distance analyses involving the sequences
amplified from genomic DNA of individuals that showed no B chromosomes and DNA from microdissected B
chromosomes. Fluorescent in situ hybridization experiments using probes of ribosomal DNA 18S and 5S showed
no marks in B chromosomes of the three species. In contrast, although not located by FISH, 5S rDNA sequences
were amplified by PCR from microdissected B chromosomes from the three species, which are probably related
to the presence of this site in number below the limit of sensitivity of FISH technique. The genetic distance
analysis conducted with the 5S rDNA sequences obtained from B chromosomes and A chromosomes of the C.
gomesi and C. pterostictum showed greater similarity in intra-specific level. However, in C. oiticicai the sequences
were quite divergent, both in relation to other types of B chromosomes, as the A chromosomes of three species
analyzed, indicating they are not sharing these sequences with their host genome. The results corroborate previous
work and reinforce the hypothesis of intraspecific origin for B chromosomes of C. pterostictum and C. gomesi since
they have similar sequences, and point to a common ancestry with those chromosomes found in standard set.
However, the supernumerary chromosome of C. oiticicai possibly arose from interspecific relationships, since the
5S rDNA sequences are different from those found in the A complement of this species. One can hypothesize that
the presence in B chromosomes of sequences also found in elements of the A complement can indicate that the have
participated in the process of formation or even have been transposed into these chromosomes after their emergence.
Financial Support: FAPESP, CNPq, CAPES.
194
PURIFYING SELECTION ACTING ON THE GENE
FRUITLESS IN DROSOPHILA MOJAVENSIS AND
D. ARIZONAE
SANTOS, W.1 & CARARETO, C.M.A.1
Instituto de Biociências Letras e Ciências Exatas - Universidade Estadual Paulista, São José do Rio Preto, SP, Brasil
1
[email protected]
Keywords: fruitless, speciation, Drosophila, reproductive isolation, positive selection.
The process of speciation is a key event in evolutionary biology. Despite the importance of speciation events, their
mechanisms of action remain not completely understood, particularly in relation to genetic changes that lead to the
emergence of reproductive isolation. Thus, it becomes important to investigate genetic alterations in early stages of
speciation, analyzing genes that may be involved in the reproductive isolation. Among these genes we can highlight
fruitless (fru), a gene that plays a predominant role in the specification of the potential for male sexual behavior in
Drosophila. Being fru one of the key elicitors of male courtship behavior, variation in its nucleotide sequence could
be subjected to sexual selection; thus it has been hypothesized that a pattern of rapid divergence due to positive
selection would be found, as reported for its connecting region (C3 exon) in a species of the genus Anastrepha.
In this study, we investigated the genetic variability in the fru C3 exon in two recently diverged species of the
genus Drosophila: D. mojavensis and D. arizonae. A fragment of 828 bp of fru connecting region from strains of D.
mojavensis (4) and of D. arizonae (2) was amplified and cloned and eight clones for each strain were sequenced. The
divergence between sequences was estimated using p-distance model and the relationships between the sequences
were reconstructed using the method Neighbor-joining with substitution model p-distance and 1,000 bootstrap
replicates. These phylogenetic analyses were implemented by MEGA 5 and selection tests were carried out in
DnaSP 5.1 by estimating the ratio between the number of non-synonymous substitutions per non-synonymous
sites and the number of synonymous substitutions per synonymous sites (Ka/Ks). The average distances between
populations of each species was 0,008 (±0,003) and 0,035 (±0,0003) between species. The phylogenetic analyses
grouped the sequences in two major clusters with high bootstrap support which represent the two species. Within
these groups, the four strains of D. mojavensis and the two of D. arizonae showed reciprocal monophyly with high
bootstrap support, indicating the connecting region of fru as a good interspecific as well as intraspecific marker. The
selection tests revealed that the connecting region of fru is under purifying selection in the strains of D. mojavensis
and D. arizonae, although more relaxed between the two species (0,212) than between strains within species (0,097).
Finnancial support: FAPESP and CNPq.
195
CHROMOSOME INSTABILITY AND
EXPRESSION OF TERT, BRAF AND P53 GENES
IN A NEW MURINE POLYPLOID CELL LINE (JP
CELLS)
Machado, PHA¹; Brito-de-Souza, J1; Polloni, L1; Antunes-Miranda, S1; Oliveira-Júnior, RJ1; Morelli, S1.
Instituto de Genética e Bioquímica, Universidade Federal de Uberlândia, MG.
1
[email protected]
Keywords: Chromosome instability, Aberrations, Aneuploidy, NORs, Real Time PCR.
Most cancers, noted for their rapid growth, display various levels of aneuploidy, deﬁned as a karyotype that is not a
multiple of the haploid complement. This cell event results in an unbalanced genome with different copy numbers
for genes on different chromosomes. Many evidences support the idea of tetraploidy as a link to aneuploidy, so
in order to verify the effects of polyploidy in chromosomal organization of cells. This work performed classical
cytogenetic to analyze Nucleolus Organizer Regions (NORs) and the fundamental number in a new cell line of
mouse fibroblasts. In addition was a performed real time PCR experiment to quantify levels of expression of the
following classes of genes: (A)-Genes responsible to promoting cell proliferation as BRAF and Telomerase (TERT);
(B)-The P53 gene responsible by tumor suppressing. Mouse fibroblasts were obtained from foreskin biopsies and
grown 24h in vitro using RPMI-1640 medium with 10% fetal calf serum (FCS), 25 mM HEPES, 1% penicillinstreptomycin, and 2 mM L-glutamine. Then, non-aderent cells were washed and after growing for a week, an
aliquot of fibroblast cells were frozen and after another week, the confluent culture were treated with colcemid
10µg/mL for 24h. Cells were washed and allowed to grow for 3 months. During cell passages, aliquots of cells were
frozen with 10% of dimethylsulfoxide (DMSO) in fetal calf serum. The cells were transferred to histology slides,
stained with 5% Giemsa and examined under an optical microscope. NORs detection was performed using the
technique of silver nitrate impregnation. For analysis of genic expression was performed real time PCR according
to the manufacturer’s instructions. It was detected nine or ten NOR bearing chromosomes, a greater number than
normal cells. The fundamental number ranging from 25 to 117, average value was 70, median and modal number of
chromosome arm was 73. BRAF gene in JP polyploid cell line showed low expression levels. P53 gene also presented
low expression levels in JP cells but this cell line expressed higher levels of telomerase. The results indicate a high
genetic instability in this cell line and the fundamental number suggests polyploidization. Telomerase over-expression
in JP cell line is further evidence that these cells underwent transformation. One of the most relevant characteristics
of a proliferative and immortalized tumor cell is the telomerase activation or over-expression. As JP polyploidy is a
newly established cell line, it may not have acquired mutational events that lead to BRAF deregulation. High P53
expression was not expected in immortalized cells, once that its role is proliferation inhibition. Cytogenetics studies
using murine cells as models are essential to evidence the importance of chromosomal abnormalities in carcinogenesis.
Financial support: FAPEMIG, UFU, Capes, CNPq.
196
PEPTIDES FOR BOVINE BRUCELLOSIS
DIAGNOSIS SELECTED BY PHAGE DISPLAY
Santos, FAA1 ; Fujimura, PT1; Castro, ACH1,2; Oliveira-Júnior, RJ1; Brito-Madurro, AG1,2; Goulart, LR1.
Instituto de Genética e Bioquímica, Universidade Federal de Uberlândia, MG; 2Instituto de Química, Universidade
Federal de Uberlândia, MG.
1
[email protected]
Keywords: Brucellosis, diagnostics, biosensors, peptides, phage display.
Bovine brucellosis is a disease with a major impact on animal production and human health. Estimates indicate
that brucellosis is responsible for decrease in production of milk and meat, and reduces the production of calf.
Although many officers and sensitive diagnostic tests are used, there is still not having an ideal serological test for
all epidemiological situations, because tests are cumbersome, complex and high cost. Because of this, we developed
peptides that mimic regions of antigenic proteins of Brucella abortus and can be used in serological diagnosis.
These peptides were selected from PhD-C7C phage display random peptide library for their ability to bind in
antibodies present in sera of positive animals for brucellosis. Nine clones were randomly selected, sequenced
and translated. Two peptides (Ba4 and Ba9) were chemically synthesized and verified its potential diagnostic.
The peptides were tested in ELISA with 80 sera positive and 80 sera negative, and showed a sensitivity of up to
97.5% for the detection of antibodies circulating animals with brucellosis. Aiming diagnostic application, the
peptide BA9 was incorporated onto a biolectrode (graphite modified with poly-3-hydroxyphenylacetic acid) and
direct serum detection was demonstrated by differential pulse voltammetry. The electrochemical sensor system
proved to be highly effective in discriminating sera from positive and negative animals. This immunosensor was
highly sensitive and selective for positive IgG, contaminants did not affect measurements, and were based on a
simple, fast and reproducible electrochemical system that in future can be performed in laboratory or in the field.
Financial Support: CNPq, CAPES, FAPEMIG and UFU.
197
DIRECT GENERATION OF OLFACTORY
SENSORY NEURONS BY FORCED EXPRESSION
OF DEFINED TRANSCRIPTION FACTORS
Tolentino, F.T.; Papes, F.
Universidade Estadual de Campinas, UNICAMP
e-mail: xxxx
Keywords: cell differentiation, olfactory sensory neuron, transcription factor, retrovirus, transdifferentiation
The mammalian Olfactory System enables the vast majority of animal species to identify the presence and quality
of food, predators, competitors, conspecifics and potential mates in the environment. Olfactory stimuli detected
by sensory neurons are interpreted by brain processing pathways to generate appropriate behavioral and endocrine
responses. Despite its central importance in mammalian physiology, several aspects about the biology of this sensory
system remain uncharacterized. For example, it is known that each olfactory sensory neuron (OSN) in the nasal cavity
expresses only one gene out of a large multi-gene family coding for receptors involved in odorant and pheromone
detection. However, the molecular mechanisms behind this process of olfactory receptor gene choice are not fully
understood. The study of this and many other aspects of olfaction has been made difficult by the lack of appropriate
in vitro cellular models. An efficient way to obtain cultured OSNs would thus be extremely useful, enabling
researchers to investigate the sensory neuron’s activity in a controllable environment, avoiding obstacles imposed
by the cellular heterogeneity found in sensory organs in vivo. In this study, we aimed at obtaining OSNs directly
differentiated from mouse embryonic fibroblasts (MEF) using the forced expression of specific transcription factors
(TF) via retroviral vectors. We therefore selected a group of 12 TFs known to be key factors in OSN development.
Several different combinations of such TFs, including Mash1, Ngn1 and NeuroD1, were overexpressed in target MEFs
in order to induce their transdifferentiation into mature olfactory sensory neurons. For this purpose, we used a
retrovirus-mediated protocol that leads to highly efficient introduction of the desired genes into MEFs in culture.
As a result, we have observed that forced expression of some combinations of TFs in fibroblasts were able to induce
the appearance of neuron-like cells in our culture system. Additionally, in situ hybridization detected the expression
of the Olfactory Marker Protein (OMP), characteristically expressed in OSNs, in the differentiated cells, indicating
that OSN-like cells were generated in vitro. We will also present the characterization of differentiated cells by RTqPCR, immunocytochemistry and in situ hybridization for the detection of typical olfactory neuron markers, such as
Olfactory Marker Protein, adenylyl cyclase III and class III β-tubulin.
198
HIGHLY EFFICIENT IN SITU HYBRIDIZATION
FOR FLUORESCENT DETECTION OF TWO OR
MORE TARGET MRNA
Nakahara, T. S.1, Cardozo, L. M.1, Trintinalia, G. Z.,1 Papes, F.1
State University of Campinas - UNICAMP
1
[email protected]
Keywords: Fluorescent In situ Hybridization, Gene expression, gene detection
In situ detection of gene expression is relevant to research in a variety of biological phenomena. In many cases, it is
crucial to analyze the expression of more than one gene simultaneously in order to investigate co-localization patterns.
In the present study, we developed and validated protocols for highly efficient detection of more than one mRNA,
including low-abundance messages, in animal histological tissue sections. Moreover, our new protocols ensure low
spectral cross-talk between fluorescent signals from two genes. Our methods combine colorigenic and fluorescent
(or two simultaneous fluorescent) signal development phases, for the detection of probes labeled with the haptens
digoxigenin or fluorescein. Our results show that the developed protocols result in signal development with exquisite
cellular resolution for the detection of co-expressed genes, even when they have distinct expression levels. Our protocols
could be applied to a large range of tissues and systems. The protocols have been particularly validated for the study
of the nervous system. enabling the evaluation of expression of such genes coding for membrane receptors, enzymes,
transcription factors, cellular markers, among others.
199
EVOLUTION AND KARYOTYPE
DIFFERENTIATION IN TWO SPECIES OF FISH
THE GENUS TRICHOMYCTERUS
Oliveira, MLM1, Pansonato-Alves, JC1, Scacchetti, PC1, Utsonomia, R1, Oliveira, C1, Foresti, F1.
Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Botucatu, SP
1
[email protected]
Keywords: Trichomycterus, karyotype evolution, 5S and 18S rDNA, heterochromatin
Advances in cytogenetic techniques contributed significantly to studies in Neotropical freshwater fish. A group already
well described, but little studied from the point of cytogenetic view is the genus Trichomycterus, which aggregates
species commonly known as “candirus”. The aim of this study was to analyze the evolutionary chromosomal
differentiation of two species of this group of fish, using conventional cytogenetic and molecular analyzes. The
studies were conducted with specimens of Trichomycterus diabolus, collected in Rio Hortelã, Botucatu / SP and
Trichomycterus zonatus collected in Rio Grande, Ubatuba / SP. The diploid number of 2n = 54 chromosomes was
common to all specimens analyzed, however, the location of NORs, the distribution of constitutive heterochromatin
and the physical location of the 18S and 5S rDNA showed significant results. The application of the technique
of Ag-NORs in the same way that the mapping of sites nucleolar organizer probe with the 18S rDNA marked
interstitial region of the long arms in pair 2 T. diabolus and the first metacentric karyotype of T. zonatus. The
C-banding revealed the presence of small heterochromatic blocks in just two chromosome pairs of T. diabolus, while
T. zonatus presented blocks located in the pericentromeric region of most chromosomes, and interstitial blocks
coincident with NORs. The FISH technique disclosed 5S rDNA site on the 18S synteny with the two karyotypes
for analysis, but located in different chromosome pairs, and T. diabolus the pair 2 and T. zonatus at par 24. The
latter species also presented markings on 5S rDNA and 18S rDNA par 18 in metacentric pairs 1 and 3. These
analyzes show how the techniques of molecular cytogenetics present themselves as important tools for the study of
karyotype evolution in fish, revealing that while the macrostructure chromosomal these two species appears to be
quite conserved, important variations between the karyotypes could be identified with respect the microstructure.
Financial support: FAPESP, CAPES, CNPq
200
INTERGALL GENETIC DIVERSITY IN
GYNAIKOTHRIPS UZELI ZIMMERMAN
(THYSANOPTERA: PHLAEOTHRIPIDAE) IN
FICUS BENJAMINA (MORACEAE)
Pinto, LLT; Mascarenhas, ALS; Waldschmidt, AM; Silva Junior, JC
Universidade Estadual do Sudoeste da Bahia (UESB), Departamento de Ciências Biológicas (DCB),
Campus Universitário de Jequié, BA
Keywords: Ficus benjamina, haplodiploidy, heterozygosity, ISSR, thrips and genetic variability.
The order Thysanoptera comprises haplodiploid insects of diversified behavior, ranging from solitary to eusocial
species that have been intensively studied, mainly gall-formers and/or pest species. The biological study of these
insects associated with genetic analyses might be helpful to elucidate the evolution of social behavior. Nonetheless,
molecular and cytogenetic reports in Gynaikothrips uzeli are scarce. Amongst the several molecular markers to be used
in studies of genetic variation, ISSR (Inter Simple Sequence Repeats) markers that amplify DNA fragments flanked
by microsatellites without previous DNA sequencing have been widely used. Even though this a dominant markers,
this approach technique provides a large number of informative bands of high reproducibility and allows analyzing
multiple loci in a single PCR for intra and interpopulation genetic analyses in vegetal and animal species. The goal
of this work was to assess the genetic variability in G. uzeli from different gall in a same tree by ISSR. Two adult
individuals per gall from eight galls were collected to DNA extraction, comprising 16 individuals per tree. Two trees
were chosen at random. DNA extraction followed the procedure reported by Roberts (1998) with modifications.
Four ISSR primers were used based on amplification profile and high number of bands. The data were analyzed
using the softwares TFPGA v1., Arlequin v3.5.1.2., HICKORY 1.1 and STRUCTURE v. 2.3.1.. A total of 34
bands were analyzed from individuals of one tree, with a mean heterozygosity (He) of 0.1614 and HB = 0.1841; ΦST
of 0.6613 and θB = 0.5923 and intergall variation (66.13%) was higher than within galls (33.87%). The individuals
from the second tree presented 30 bands, He of 0.1614 and HB = 0.2254; ΦST of 0.5532 and θB = 0.5644 and, again,
the variation between galls (55.32%) was higher than that within galls (44.68%). The low heterozygosis, the high
values of population structure and a decreased variation within galls than among galls are, putatively, consequence of
haplodiploid, genetic drift and gall behavior and low dispersal abilities of G. uzeli. These data reinforce the high degree
of similarity among individuals from a same gall and serve to define samplings for population analyses in G. uzeli.
Financial Support: FAPESB and UESB.
201
GENETIC CHARACTERIZATION AND
GEOGRAPHIC OF MARMOSA MURINA
THROUGH OF GENE MITOCHONDRIAL
CYTOCHROME B
Nascimento, DC1,2; Fraga, E2; Barros, MC2
Center of Agrarian Sciences, State University of Maranhão/UEMA; 2Laboratory of Genetics and Molecular Biology of the
State University of Maranhão, Center for Advanced Studies of Caxias/CESC-UEMA
1
[email protected]
Keywords: Marsupials, Geographical distribution, Genetic diversity, Phylogenetic, Taxonomic status
Marmosa is a genus of marsupial arboricolous small size of the order Didelphimorphia, has nine species with
wide distribution in America, occurring from Mexico to northern Argentina. The difficulty in delimiting species
of this genus is currently the target of several investigations, because due to the wide geographical distribution
of some species, intraspecific distinct features are being detected, thus compromising their taxonomic status. The
species Marmosa mexicana, Marmosa murina, and Marmosa robinsoni have problems regarding their taxonomic
classifications, being subdivided by some authors in two or three species. M. murina occurs from northern Venezuela
to central south Brazil in the Amazon Rainforest, Atlantic Forest, Cerrado and Pantanal, and by virtue of his hard
demarcation of boundaries intraspecific, objective of this work was to infer as to its taxonomic status by molecular
data. Specimens were collected in APA municipal Inhamum Maranhão through traps pitfall, sherman and tomahawk.
Were made DNA extraction by phenol-chloroform protocol and amplification cytochrome b gene by Polymerase
Chain Reaction (PCR) with sequencing performed in automated sequencer ABI PRIM 3500 genetic analyzer
(Life Technologies). 45 sequences of cytochrome b gene were obtained, five specimens of Maranhão and 40 from
GenBank representing South American countries Bolivia (HM106397 and HM106396), Ecuador (HM106383),
Peru (HM106382, HM106385, HM106386, HM106401, HM106402, and AJ487002 AJ487003), Guyana
(AJ606448 - AJ606450) French Guiana (AJ486998 - AJ487001, AJ486989 - AJ486996) and Brazil of states
Amazonas (HM106398 - HM106400), Tocantins (HM106393), Pará (HM106395 and HM106394), Espírito
Santo (GU112897, GU112893 and GU112898), Bahia (GU112894), Mato Grosso (HM106391 and HQ622146)
and Mato Grosso do Sul (HM106392). The species Micoureus demerarae (AJ487005) and Monodelphis brevicaudata
(AJ606462) were used as outgroup. There was obtained 714 bp, of these 470 were kept, 244 variables and 160
informative for parsimony, genetic divergence intraspecific ranged from 0.0 to 11.5% with a mean of 7.51%, which
is considered high when it comes the same species, the largest divergence occurred between species of Maranhão and
Amazon. The phylogenetic trees generated using phylogenetic methods of Maximum Parsimony (MP), Neighbor
Joining (NJ) with the algorithm Tamura-Nei and Maximum Likelihood (ML) were similar and resulted in five wellsupported clades. Specimens of Maranhão clustered with species of Pará and the Centre of Brazil with 98%, but
differed significantly with specimens of the state of Amazonas, these latter grouped with Peru and Bolivia with 92%,
Espírito Santo and Bahia grouped with 100%, Guyana and French Guiana with 97% and three specimens from
Peru and Ecuador teamed up with 100%. Given the high genetic divergence within of the group and between the
specimens Maranhão/Amazon found in this study reveals the need for a taxonomic revision of the species M. murina.
Financial Support: CAPES, FAPEMA, UEMA
202
EFFECTS OF THE MADEIRA RIVER IN THE
BIOGEOGRAFIC PATTERNS OF SMALL
MAMMALS: A CASE STUDY WITH MICOUREUS
DEMERARAE
Souza, I.S¹.; Nunes, M.S¹.; da silva, M.N.F².; Farias, I.P¹.; Hrbek, T¹.
¹Universidade Federal do Amazonas (UFAM), Manaus, AM; ²Instituto Nacional de Pesquisas na Amazônia (INPA), Manaus, AM
[email protected]
Keywords: phylogeography; cytochrome b; Micoureus demerarae; Madeira River; small mammals.
In the Amazon marsupials are popularly known as opossums and play an important role in the ecosystem. The species
Micoureus demerarae is distributed throughout the Amazon basin and displays considerable morphological and genetic
variation. Its occurrence spans several biogeographic provinces, two of which are delimited by the Madeira River. This
study focused on testing the hypothesis that the Madeira River acts as a geographical barrier for M. demerarae. This
study used 1074 bp of the mitochondrial cytochrome b gene, analyzing 70 individuals collected from the left and right
banks of the river (localities: Autazes Jirau, Abuna, and Morrinhos Aripuanã). DNA was extracted from muscle tissue,
followed by amplification, purification and sequencing of the PCR amplified products on the ABI 3130xl Genetic
Analyzer. Of the 70 samples/sequences, 38 sequences belong to the samples of Amazonas and Rondônia states and 32
to samples from the state of Mato Grosso along the Teles Pires River and farms in the municipalities of Indiavaí and
Araputanga. The Mato Grosso samples acted as contrast and outgroup samples. Phylogenetic relationships among
individuals were inferred by the method of maximum likelihood reconstruction, performed in the program Treefinder.
The analysis identified five principal groups in the Madeira River basin, with four groups representing individuals
collected on the right bank of the Madeira River, and one group that includes individuals from the left bank. The leftbank group is phylogenetically nested within the right-bank group with an estimated 1.1 million year divergence from
its right-bank sister clade. This phylogenetic pattern suggests a colonization event of the left bank from the right bank,
and that the Madeira River acts as a barrier to dispersal for M. demerarae. In our analysis, three of our sequences clustered
unexpectedly showed 5-13% genetic divergence, exceeding the expected intraspecific values. Of these, two were collected
in Autazes and in expanded analyses grouped with individuals of a clade distributed on the Guyana shield. The third
sequence represents a new lineage and potentially a new species phylogenetically related to the sub-Andean and transAndean species such as Micoureus paraguayanus, Micoureus constantiae and Micoureus alstoni, pending additional detailed
taxonomic studies. The results of this study suggest two possibilities: 1) western Amazon was colonized from the region
of the Brazilian Shield, or 2) the origin of the Madeira River is younger than the diversification of Micoureus demerarae.
Financial Support: FAPEAM – Manaus, AM
203
NONLINEAR REACTION NORMS IN
DROSOPHILA MEDIOPUNCTATA:
CONNECTING THE DOTS TOWARDS
THE UNDERSTANDING OF GENOTYPEENVIRONMENT INTERACTION
Rocha, FB1 & Klaczko, LB1.
Laboratório de Biodiversidade Genética e Evolução de Drosophila, Departamento de Genética e Evolução, Instituto de
Biologia, Unicamp.
1
[email protected]
Keywords: pigmentation, parabola, polynomial adjustment, thermal adaptation, genetic correlation.
In a previous study, we have shown that the reaction norms (RN) of the number of dark spots in the abdominal
tergites of eight strains of D. mediopunctata to temperature could be significantly better described by parabolas (NS =
a + bT + cT2 – where NS=mean number of spots; T=temperature). The mean number of spots across all temperatures
and the curvature parameter (c) of these RNs are significantly negatively correlated, suggesting this to be a case
where the genetic variation of RNs, i.e. the genotype-environment interaction (GxE), might be described by a simple
general rule where two continuous variables are linearly related. Yet, the distribution of mean values weakens such
interpretation, since the eight strains formed two distinct phenotypic groups: a light group with low mean number
of spots (mean=1.5, ranging from 1.2 to 1.7) and a dark group with high mean number of spots (2.3; from 2.2
to 2.6). Here, we test the generality of the pattern previously described by verifying whether genotypes conferring
intermediate mean phenotypic values show the same correlation between mean value and RN curvature. Three crosses
were performed between one dark strain (O) and one of three light strains (X; D; G), and four crosses involved only
light strains (GxI; IxH; GxH; XxI). Experimental procedures and statistical analysis were similar to our previous work:
each genotype was tested on eleven temperatures and each RN was described by a parabola tested for the significance
of the curvature parameter (c). Only two crossings (GxI and IxH) showed RNs with significantly positive curvatures;
the remaining five crossings had RNs which showed no significant improvement of fit for parabolas when compared
to linear equations. Among these five curves, two (OxG and OxX) had nearly zero values of c, i.e. their RNs were
nearly linear. The three remaining curves showed no significant c values, lying between these two cases. These results
corroborate and complement the pattern previously reported: the mean phenotypic values and the curvatures (c) of
the seven heterozygous RNs described show a significant correlation (R=-0.917; p<0.005); using the data from both
homozygous and heterozygous genotypes, the correlation previously reported became even more significant (R=-0.923;
p<0.0001). These results give support for a simple general rule of RN variation for the number of abdominal spots of
D. mediopunctata trait: genotypes leading to low phenotypic values should have RNs with positive c values (parabolas
bowed down); genotypes producing high phenotypic values should have RNs with negative c values (parabolas bowed
up); and genotypes with intermediate phenotypic values should have RNs with c values near zero, i.e. linear RNs. To
our knowledge, this is the first time that GxE has been described in terms of a continuous pattern of RN variation.
Financial support: FAPESP; CNPq, CAPES, FAEPEX-UNICAMP.
204
MOLECULAR IDENTIFICATION OF ESTUARINE
FISH FROM BAHIA COAST BASED ON 16S
RDNA
Brandão, JHSG1; Bitencourt, JA2; Affonso, PRAM1; Sampaio, I2.
Laboratório de Genética Molecular, UESB, Jequié, BA; 2Laboratório de Biologia Molecular, UFPA, Bragança, PA
1
[email protected]
Keywords: ichthyofauna, species identification, mitochondrial 16S rDNA, coast of Bahia, estuarine fish
The coast of Bahia encompasses nearly 1,000 km with distinct ecosystems and a rich ichthyofauna. In this work, we
sequenced the mitochondrial 16S rDNA region in several estuarine fish from estuaries in Bahia to test its efficacy on species
identification. Tissue samples were obtained of individuals from distinct species in families Haemulidae, Lutjanidae,
Scaridae, Pomacentridae (Perciformes), Scorpaenidae (Scorpaeniformes) and Lophiiformes (Ogcocephalidae) collected
along Camamu Bay and TinharéIsland. All species were previously identified based on morphological traits, being
divided into six species (Pomadasyscroco, Pomadasyscorvinaeformis, Nicholsinausta, Stegastesvariabilis, Lutjanussynagri
s,Scorpaenaplumieri, and Ogcocephalusvespertilio).After DNA extraction, the 16S rDNA was amplified via PCR and
sequenced. The sequences were aligned and edited in Bioedit and compared to other sequences using BLAST (Basic
Local Alignment Search Tool) in NCBI (National Center for Biotechnology Information). A Neighbor-Joining tree
was constructed using Mega v. 5 to compare the sampled sequences with others from the same species and relatives
available in GenBank. Invariably, the sequences proved to be useful to identify species correctly such as L. synagris. In
some cases, the DNA sequences were more informative than morphological identification, For instance, out of the 14
specimens previously identified as N. usta, 13 grouped with Sparisoma radians and one with Sparisomaaxillare (bootstrap
of 100 and 99%, respectively), being separated of N. usta sequences from GenBank (bootstrap = 100). Similarly,
all individuals of Pomadasyswere similar toPomadasyscorvinaeformis and distinguished from P.croco from GenBank.
Interestingly, the samples of S. variabilis from Bahia coast were clustered apart from other S. variabilis and S. fuscus
sequences (100% of bootstrap), suggesting they comprise distinct evolutionary units. Moreover, the few sequences
available in GenBank indicated that Ogocephalus and Zalieutesare paraphyletic once O. vespertiliofrom our study was
more related to Zalieutes elater than to O. nasutus but other gene sequences need to be analyzed to confirm this hypothesis.
Finally, this report highlights the importance of molecular data to proper species identification of estuarine fish.
Financial Support: FAPESB and CNPq.
205
FUNCTIONAL ANALYSIS AND
EVOLUTIONARY CONSERVATION
BETWEEN CIRCADIAN CLOCK PROTEINS
OF DROSOPHILA MELANOGASTER AND
LUTZOMYIA LONGIPALPIS
Amoretty, PR1,2; Padilha, KP1; Mendonça, AI2 ;Machado, RC1;Bruno, RV1,3; Meireles Filho, AC4; Peixoto, AA1,3
Laboratório de Biologia Molecular de Insetos, IOC-FIOCRUZ, Rio de Janeiro/RJ; 2Centro Universitário de Volta Redonda
(UniFOA), Volta Redonda/RJ; 3Instituto Nacional de Ciência e Tecnologia em Entomologia Molecular (INCT-EM)/CNPq,
Brazil; 4Research Institute of Molecular Pathology (IMP), Viena/Austria.
1
[email protected]
Keywords: Drosophila, Lutzomyia longipalpis, Circadian Clock
Circadian rhythms are daily oscilations in behavior and physiology of insects and other organisms controlled by the
circadian clock. In Drosophila, it is known that a molecular mechanism controls the clock, comprising three loops
of negative auto regulation involving several genes. In the main regulatory loop, the transcriptional factors CLOCK
(CLK) and CYCLE (CYC) form a heterodimer and promote the transcription of period (per) and timeless (tim) genes.
PERIOD (PER) and TIMELESS (TIM) proteins enter in the nucleus and repress their own transcription by the
interaction with CLK-CYC. Our group has been studying the circadian clock genes in Lutzomyia longipalpis, the main
vector of Leishmania infantum, using Drosophila as a model. We observed that, although the core clock is conserved
between these two insects, there are marked differences in some functional domains of CLK and CYC proteins. The
transactivation domain poly-Q, present in Drosophila CLK, seems to have been replaced by a functional BCTR domain,
present in Lu. longipalpis CYC. Possibly, BCTR domain has been lost during evolution in Drosophila. To assess the
functional conservation between of Drosophila and Lu. longipalpis clock proteins, independent transgenic lines were
generated expressing Lu. longipalpis cyc and tim genes carried by UAS-Gal4 system. The locomotor activity of flies was
tested through Drosophila Activity Monitoring System (Trikinetcs). The flies were kept in a incubator at a constant
temperature of 25 °C and exposed to cycles of twelve hours of light followed by twelve hours of darkness (LD12:12) for
five days, and then for 10 days in constant darkness (DD). In this work, we investigated if Lu. longipalpis proteins could
replace functionally those missing in the Drosophila clock mutants. Indeed, the Lu. longipalpis proteins TIM and CYC
restored, respectively, the rhythmic behavior of the arrhythmic tim0 and Clkjrk, cyc0 (double mutant) mutants. These
results showed that, although these species probably diverged about 250 million years ago, the functional domains of
these proteins retained their functions and interacted in order to restore the normal behavior of mutant flies, even in the
heterodimer CLK CYC-domains were of different types. This approach also showed that Drosophila transgenics are useful
tools in the study of insects circadian clock because they enable to study in vivo the effect on gene expression behavior.
Financial Support: HHMI, CNPq, FAPERJ, FIOCRUZ
206
ISOLATION OF MOLECULAR MARKERS
IN THE PIRACEMA FISH PROCHILODUS
LINEATUS (CHARACIFORMES) AND
CHACARTERIZATION OF A MOLECULAR
MARKER PANEL
Barroca, TM ¹; Pinto, PBDF; Paixao, HPR ¹; Kalapothakis, E ¹.
Instituto de Ciências Biológicas, UFMG, Belo Horizonte, MG, Departamento de Biologia Geral – Genética (UFMG), Belo
Horizonte, MG, Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG.
1
[email protected]
Keywords: Prochilodus lineatus, molecular marker panel, genomic library, piracema species.
In the last decades, many reservoirs have been constructed in order to generate energy for the cities. This can be seen
at Grande River, which belongs to the Paraná River basin, has 891.309 km2, drains South and Midwest regions of
Brazil and has 13 dams. These constructions can cause many negative impacts at the ichthyofauna, because they
change the flood regime and block routes of migratory fishes. Moreover isolate native populations of fishes, which
can reduce the genetic variability. Molecular markers have been used in population analysis of many species of fish
to evaluate the variability of populations from the knowledge of their genetic structure. After that, it’s possible to
measure the impact of the dams and the efficiency of restocking in rivers. The most common marker used in this
kind of study are microsatellites. The aim of the present study was the isolation of molecular markers useful for
the population study of the species P. lineatus and a characterization of a molecular marker panel. This specie has
a very important role for commercial and subsistence fisheries in the Grande River, MG, Brazil and in other river
basins as well. Genomic DNA was extracted from P. lineatus muscle tissue using proteinase k and phenol-chloroform
method. A primary genomic library was constructed from this genomic DNA. A total of 77 positive clones were
sequenced with M13 using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA,
USA) on an ABI 3130 automated sequencer (Life Technologies). Repetitive sequences were identified using the
Simple Sequence Identification Tool. Clones were sequenced in both directions to build consensus contigs using
Phred/Phrap/Consed, in order to search new molecular markers for the genus. In this research, 8 molecular markers
were isolated, and internal and external primers used in the DNA amplification . These isolated markers were effective
for the genus and added to the 32 molecular markers panel. The panel has been useful tool for studies of genetic
population as well as in hatchery programs, and they can be used in the evaluation of hatchery programs success.
Financial Support: FUNDEP, CEMIG (Peixe Vivo), CNPq, CAPES, FAPEMIG