Sequence and analysis of a swinepox virus homologue of the

Journal
of General Virology (2000), 81, 1073–1085. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Sequence and analysis of a swinepox virus homologue of the
vaccinia virus major envelope protein P37 (F13L)
Juan Ba! rcena, Marı! a M. Lorenzo, Juana M. Sa! nchez-Puig and Rafael Blasco
Centro de Investigacio! n en Sanidad Animal–INIA, Valdeolmos, E-28130 Madrid, Spain
P37 (F13L gene product), the most abundant protein in the envelope of the extracellular virus
form of the prototype poxvirus, vaccinia virus (VV), is a crucial player in the process leading to
acquisition of the envelope, virus egress and transmission. We have cloned and sequenced a
swinepox virus (SPV) gene homologous to VV F13L. The SPV gene product, termed P42, was 54 %
identical to P37, the VV F13L gene product, and, among the poxviruses, was most similar (73 %
identity) to the myxoma virus homologue. The SPV P42 gene contained late transcription signals
and was expressed only at late times during infection. The protein was palmitylated, and showed
an intracellular distribution similar to that of VV P37, both by immunofluorescence and by
subcellular fractionation. As with VV P37, SPV P42 was incorporated in extracellular enveloped
SPV particles, but was absent from the intracellular mature virus form. To check the ability of SPV
P42 to function in the context of VV infection, we inserted the SPV gene into a VV deficient in P37,
which is severely blocked in virus envelopment and cell-to-cell transmission. Despite correct
expression of SPV P42, the resulting recombinant VV showed no rescue of extracellular virus
formation or cell-to-cell virus spread. The lack of function of SPV P42 in the VV genetic background
suggests that specific interactions between SPV P42 or VV P37 and other viral proteins is required
to drive the envelopment process.
Introduction
Swinepox virus (SPV) is the sole member of the genus
Suipoxvirus, belonging to the family Poxviridae. Its biological
characteristics, and particularly its narrow host range, make it
a promising vector for recombinant vaccines for swine (Foley
et al., 1991 ; Tuboly et al., 1993 ; van der Leek et al., 1994).
The best studied member of the poxvirus family, vaccinia
virus (VV), belongs to the genus Orthopoxvirus. The classification of SPV in a separate genus, based originally on
immunological studies, was later reinforced by DNA
hybridization, restriction mapping and DNA sequencing
(Massung & Moyer, 1991 a, b). The limited sequence information available for SPV, including sequences close to the
genome ends as well as internal regions (Feller et al., 1991 ;
Massung et al., 1993 ; Schnitzlein & Tripathy, 1991) has
revealed enough similarity to other poxviruses to allow
Author for correspondence : Rafael Blasco.
Fax j34 91 620 22 47. e-mail blasco!inia.es
The EMBL accession number of the sequence reported in this paper is
AJ249689.
0001-6753 # 2000 SGM
alignment of gene maps, despite extensive sequence divergence.
The major protein component of the envelope of extracellular vaccinia virions (EEV), P37, is encoded by the F13L
open reading frame (ORF) (Hirt et al., 1986). It is a 372 amino
acid polypeptide expressed at late times during infection and is
targeted to Golgi-derived membranes where it is incorporated
into the virion by a wrapping process (Hiller & Weber,
1985 ; Schmelz et al., 1994). Thus P37 is present in the
enveloped forms of the virus, but is absent from intracellular
mature virus (IMV) (Payne, 1978). P37 is a peripheral
membrane protein, and lines the inner surface of the EEV
envelope (Roos et al., 1996 ; Schmutz et al., 1995). Palmitylation
of the protein, a process that is facilitated by other viral
proteins, is required for its membrane-association, proper
intracellular targeting and correct functioning of the protein
(Borrego et al., 1999 ; Grosenbach & Hruby, 1998 ; Grosenbach
et al., 1997 ; Schmutz et al., 1995).
Deletion of the P37 gene results in a block of the virus
envelopment process, and abolishes extracellular virus
formation and cell-to-cell virus transmission (Blasco & Moss,
1991, 1992). In addition, other virus-induced phenomena that
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
BAHD
J. Ba! rcena and others
require virus envelopment, such as engrossed actin tails and
cell–cell fusion at acid pH, are also blocked (Blasco & Doms,
1993 ; Blasco & Moss, 1992 ; Cudmore et al., 1995 ; Sanderson
et al., 1998).
Considering that P37 is the major protein in the EEV
envelope, its topology relative to the EEV envelope and the
phenotype of P37 knock-out mutants, it is likely that P37 acts
by mediating the interaction between the surface of intracellular virions and wrapping membranes. Recent reports
suggest that in addition to this structural role, P37 may have
enzymatic activities related to lipid metabolism. Indeed, the
P37 sequence contains motifs distinctive of the phospholipase
D superfamily (Koonin, 1996 ; Ponting & Kerr, 1996), and
shows phospholipase activities which may be important for
function (Baek et al., 1997 ; Sung et al., 1997).
Because of the importance of P37 in VV envelope
morphogenesis and dissemination, we mapped and sequenced
the SPV homologous gene, and present here a characterization
of the corresponding protein.
Methods
Cells and viruses. SPV (Kasza strain, ATCC VR-363) was routinely
grown in PK-15 cells, grown in EMEM containing 5 % foetal calf serum.
SPV titres were determined on ESK-4 (ATCC CL 184) cell monolayers as
described previously (Barcena & Blasco, 1998). VV strain IHD-J was
propagated on CV-1 or RK-13 cells and titrated on BSC-1 cell
monolayers. VV mutant vRB10 (Blasco & Moss, 1991), derived from VV
IHD-J by deleting 93 % of gene F13L, was used to construct recombinant
viruses.
Cloning and sequencing. SPV DNA fragment HindIII B (Massung
& Moyer, 1991 a) was excised from an agarose gel and digested with
EcoRI. A 5n5 kb HindIII–EcoRI fragment derived from the left-hand end of
the HindIII B fragment was cloned into plasmid pUC19 generating
plasmid pSPV-HE. A 1n9 kb NcoI–BamHI fragment derived from pSPVHE was cloned in plasmid pUCPTS-3 (Barcena & Blasco, 1998) to
generate pSPV-NB. Both pSPV-HE and pSPV-NB were used as templates
for sequencing the P42 gene using the dideoxy chain termination
method. Both DNA strands were sequenced.
Sequence analysis. Pairwise alignment of amino acid sequences
was performed using the Align program (FASTA program package,
version 2.0) (Pearson, 1990). Pairwise percentage identities (or
similarities) were calculated by dividing the number of identical residues
(and conservative changes) by the total number of positions in the
aligned sequences, including gaps. Multiple alignment of amino acid
sequences was generated using the program Clustal W version 1.7
(Thompson et al., 1994). Hydrophobicity analysis of the amino acid
sequences was based on the algorithm of Kyte & Doolittle (1982).
Plasmid construction. Plasmid pRB24 was constructed to insert
foreign genes in place of F13L, under the control of the natural F13L
promoter. The plasmid contains F13L recombination flanks, XhoI and
BglII restriction sites immediately downstream of the P37 promoter, and
a β-glucuronidase (β-gus) cassette to provide visual identification of
recombinant viruses.
The process of plasmid construction is outlined in Fig. 3 (A) (see
Results). First, the β-gus gene was amplified by PCR from plasmid pBI101
(Clontech) using primers 5h CAGGTCAGAATTCTATGTTACGTCC 3h
BAHE
(EcoRI site underlined) and 5h GGAGAGTTGCTAGCTCATTGTTTGCC 3h (NheI site underlined), and inserted into the EcoRI–NheI sites of
plasmid pRB21 (Blasco & Moss, 1995), to construct pRB21-βgus. Then,
a SphI–XhoI DNA fragment of pRB21-βgus, containing the P37 gene,
was removed and replaced by a PCR product obtained using pRB21
as template and oligonucleotides 5’ GGGGCATGCGATAAAGTTTCGAAACAGCAAAA 3h (SphI site underlined) and 5h
CGATGCCTCGAGATCTATTTAGTTACATAAAAAC 3h (XhoI and
BglII sites underlined) as primers, generating plasmid pRB24. Subsequently, the genes corresponding to SPV protein P42 or VV protein P37
were inserted into pRB24, generating plasmids pRB24-P42 and pRB24P37 respectively. The gene encoding P42 protein was amplified by PCR
from plasmid pSPV-HE using primers 5’ AAATAAAGGATCCGTATGTGGTGG 3h (BamHI site underlined) and 5h ACGTCCTGGATCCAAATATATTTTC 3h (BamHI site underlined). The PCR
product containing the P42 gene was partially digested with BamHI,
ligated to pRB24 plasmid digested with BglII, and checked by DNA
sequencing. Finally, a BamHI fragment from pSG-P37 plasmid (B.
Borrego and others, unpublished results), containing the P37 gene, was
isolated and ligated to BglII-digested pRB24 to generate pRB24-P37.
Isolation of recombinant viruses. VV recombinants I-β, I-βP37
and I-βP42 were obtained as follows. Monolayers of CV-1 cells were
infected with the VV mutant vRB10 at an m.o.i. of 0n05 and transfected
with pRB24, pRB24-P37 or pRB24-P42 by the calcium phosphate
technique, following standard protocols. Recombinant viruses were
selected by several rounds of plaque purification in the presence of XGluc (5-bromo-4-chloro-3-indolyl β--glucuronide) to reveal β-gus
expression (Carroll & Moss, 1995). Subsequently, the recombinant
viruses were amplified by infection of cell monolayers and their genomic
structures were analysed by PCR.
Antisera. A rat monoclonal antibody, 15B6 (Schmelz et al., 1994),
was used to detect the P37 protein. Antiserum against an 18-mer
synthetic peptide corresponding to the C terminus of P42 (NH #
CDIFERDWKNNSNTPITN-COOH) was obtained. The peptide, conjugated with diphtheria toxoid protein, was injected subcutaneously into
rabbits in three doses. The first dose contained 500 µg of protein in
complete Freund’s adjuvant and the following two contained 500 µg of
protein in incomplete Freund’s adjuvant.
Immunofluorescence. PK-15 cells grown on coverslips were
infected with SPV or VV (strain WR). After 23 h (for SPV) or 7 h (for VV)
at 37 mC, cells were washed twice with PBS at room temperature, fixed by
addition of ice-cold 4 % paraformaldehyde, and incubated for 12 min at
room temperature. All subsequent incubations were carried out at room
temperature. After washing once with PBS, cells were permeabilized by
incubation with 0n1 % Triton X-100 in PBS. After washing with PBS, cells
were incubated for 5 min with PBS containing 0n1 M glycine, and then
with primary antibodies diluted in PBS–20 % foetal calf serum for 30 min.
Anti-peptide antiserum was diluted 1 : 75, and anti-P37 hybridoma
supernatant was diluted 1 : 50. After washing for 5 min in PBS, the cells
were incubated for 30 min with secondary antibodies : rabbit anti-mouse
IgG or swine anti-rabbit IgG conjugated with TRITC rhodamine (Dako)
diluted 1 : 200 in PBS–20 % foetal calf serum. After a final wash, coverslips
were mounted using FluorSave mounting medium (Calbiochem).
Western blotting. Proteins were electrophoresed in 12 % SDS–
polyacrylamide gels and transferred to nitrocellulose membranes by
electroblotting. After transfer, the membranes were incubated overnight
at 4 mC in blocking buffer (PBS containing 0n1 % Tween 20 and 5 % nonfat dry milk). The membranes were then incubated with monoclonal
antibody anti-P37 (diluted 1 : 2000) or antisera anti-P42 (diluted 1 : 100) in
PBS–0n1 % Tween 20 containing 1 % BSA for 1 h at 37 mC. After four
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
Swinepox virus F13L homologue
10 min washes with PBS–0n1 % Tween 20, the membranes were incubated
for 1 h at 37 mC with rat or rabbit anti-IgG antibody (diluted 1 : 2000)
conjugated with horseradish peroxidase in PBS–0n1 % Tween 20
containing 1 % BSA. After four 10 min washes with PBS–0n1 % Tween20, bound antibodies were detected using the enhanced chemiluminescence (ECL) kit from Amersham.
Subcellular fractionation of infected cells. CV-1 cell monolayers were infected with recombinant VV at an m.o.i. of 10 p.f.u. per cell.
At 12 h post-infection (p.i.) cells were scraped into the medium, collected
by low-speed centrifugation, washed once with PBS and resuspended
in 20 mM HEPES pH 7n6, 5 mM KCl, 1 mM MgCl , 150 mM NaCl.
#
Subcellular fractionation was then performed as described by Grosenbach
et al. (1997). Briefly, cells were lysed by Dounce homogenization to yield
a total cell extract (TCE). The TCE was subjected to centrifugation at
700 g for 10 min at 4 mC to produce a nuclear pellet fraction (NP). The
supernatant was centrifuged at 15 000 g for 30 min at 4 mC to obtain the
virus-containing fraction (P15). Finally, the supernatant of this centrifugation was further separated into soluble (S100) and insoluble (P100)
protein fractions by centrifugation at 100 000 g for 1 h at 4 mC. Portions
of the resulting fractions were analysed by Western blot. Subcellular
fractionation of SPV-infected cells was carried out as described above
using PK-15 cell monolayers infected at an m.o.i. of 10 for 48 h.
Preparation and analysis of [3H]palmitylated VV and SPV
proteins. Infected cells were radiolabelled with [$H]palmitic acid
essentially as described by Child & Hruby (1992). Briefly, confluent
monolayers of CV-1 cells were infected with the different recombinant
VVs at an m.o.i. of 10. At 16 h p.i., cell cultures were labelled for 4 h with
200 µCi\ml [9,10-$H]-palmitic acid (Amersham, 51 Ci\mmol). Radiolabelled SPV-infected cells were prepared as described above using PK-15
cells infected for 48 h. For SDS–PAGE analysis, infected-cell extracts
were prepared by washing the cell monolayers with PBS followed by
solubilization in 2 % SDS. After electrophoresis in 11 % SDS–
polyacrylamide gels, the gels were fixed, fluorographed, dried, and
exposed to an X-ray film at k70 mC.
Virion purification and CsCl gradient analysis. For equilibrium
centrifugation, confluent monolayers of RK-13 cells in six-well plates
were infected with virus at an m.o.i. of 10. At 7 h p.i., medium was
replaced with 1 ml of solution comprising two-thirds of methionine-free
MEM and one-third of complete MEM supplemented with 25 µCi
[$&S]methionine. At 24 h p.i., 1 ml of complete MEM with 5 % foetal calf
serum was added, and the incubation continued for another 24 h.
Extracellular virus was then recovered from the medium after clarification
by low-speed centrifugation and was pelleted through a cushion of 4 ml
36 % sucrose. Finally, the virus was loaded on a gradient made by
overlaying 2, 3 and 4 ml of CsCl solutions with densities of 1n30, 1n25
and 1n20 g\ml, respectively, and centrifuged in an SW41 rotor at
32 000 r.p.m. for 60 min at 15 mC. Fractions (six drops) were collected
from the bottom of the tube, and aliquots of each fractions were assayed
for radioactivity.
Similarly, EEV and IMV forms of SPV were purified by banding in
CsCl density gradients. Confluent monolayers of PK-15 cells in six-well
plates were infected with SPV virus at an m.o.i. of 10. At 48 h p.i., culture
medium was replaced with medium containing 25 µCi [$&S]methionine as
described above, and the incubation was continued for another 24 h. In
parallel, PK-15 cells in a 175 cm# flask were infected with SPV at a
multiplicity of 10 and incubated for 72 h. From both cultures, extracellular
virus was recovered from the medium after clarification by low-speed
centrifugation, and cell-associated virus was liberated by rupturing the
cells in 10 mM Tris–HCl (pH 9) by Dounce homogenization. At this step,
both the radiolabelled and non-radiolabelled preparations of the
extracellular and cell-associated virus were mixed, pelleted through a
sucrose cushion and subjected to buoyant density centrifugation as
described above. Fractions were assayed for radioactivity and density.
Finally, radioactive peaks corresponding to fractions with densities of
1n23 g\ml and 1n27 g\ml were pooled and used as purified EEV and
IMV, respectively.
Results
Localization, cloning and sequence of the SPV P42
gene
The left-terminal genomic region of SPV DNA can be
aligned with that of VV on the basis of ORF similarity
(Massung et al., 1993). Based on the known SPV sequences and
on the VV gene map, we predicted that an SPV homologue of
the VV F13L gene could be located to the left side of the SPV
HindIII B fragment (Massung & Moyer, 1991 a). Southern blot
analysis revealed the presence of an EcoRI site located about
5n5 kb to the right of the SPV HindIII C\B boundary (not
shown). Thus, the corresponding 5n5 kb HindIII–EcoRI fragment was isolated from SPV DNA and cloned. Subsequently,
a 1n9 kb NcoI–BamHI fragment was isolated and cloned as
described in Methods. From those clones, we obtained a
1381 bp sequence (Fig. 1) which contained an ORF (nucleotides
125–1239) with the potential to code for a protein of 371
amino acids.
We compared the SPV gene with that of other poxviruses :
VV, fowlpox virus (FPV), myxoma virus (MV), orf virus (OV)
and molluscum contagiosum virus (MCV). The SPV sequence
had a high AjT content (69n4 %), similar to previous data for
SPV DNA. High AjT content was also apparent in the
corresponding genes of FPV (67n8 %) and VV (63n1 %), whereas
MV has a more equal AjT content (54 %), and OV and MCV
have a much lower AjT content (35 and 34 % respectively).
Analysis of the codon usage within the SPV ORF reflected its
high AjT content, as there was a strong bias for A or T in
codon position 3 (79n2 %). The corresponding percentages for
third codon position in other poxviruses are : 72 % (FPV),
70n4 % VV, 44n7 % (MV), 4n5 % (OV) and 18n0 % (MCV).
Coincident with these data, pairwise comparisons of the DNA
sequence of the SPV gene with that of the other poxviruses
only revealed significant homology with MV (66n8 %), VV
(62n5 %) and FPV (57 %) but not with OV or MCV genes.
Our sequencing revealed the typical poxvirus late promoter
motif TAAAT, and the similar TAAAAT motif, upstream of
the putative ATG initiation codon (see Fig. 1). The early
transcription termination sequence TTTTTNT occurs in three
different places within the ORF, suggesting an exclusively late
expression pattern.
SPV P42 amino acid sequence
The calculated molecular mass of the product of the SPV
ORF is 41 779 Da, which is similar to the calculated size of VV
P37, and somewhat larger than the size of 37 kDa estimated
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
BAHF
J. Ba! rcena and others
(A)
(B)
Fig. 1. For legend see facing page.
BAHG
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
Swinepox virus F13L homologue
previously by its mobility in PAGE. On the basis of its
predicted size, the putative SPV polypeptide was termed P42.
A comparison of the amino acid sequences of P37
homologues from different poxviruses is shown in Fig. 2. SPV
P42 was most similar to the MV protein (73n1 % identity) and
VV P37 (54n3 % identity), suggesting that SPV is more closely
related to leporipoxviruses and orthopoxviruses than to the
other poxvirus genera included in this study. Indeed, this result
is in agreement with poxvirus phylogenies based on thymidine
kinase sequences (Blasco, 1995).
A multiple alignment including VV P37 homologues from
different poxviruses (Fig. 2 A) showed several conserved
features. In particular, a cysteine doublet in VV P37 (residues
185 and 186, located within a hydrophobic domain), which is
the palmitylation site of the protein and is essential for P37
function (Grosenbach & Hruby, 1998 ; Grosenbach et al., 1997),
is conserved in the SPV and MV genes. In addition, a partially
conserved phospholipase D motif (HXKXXXXD), which is also
essential for P37 function (Cao et al., 1997 ; Ponting & Kerr,
1996 ; Sung et al., 1997), is also conserved.
Construction of recombinant viruses
In order to study SPV P42, we constructed several
recombinant VVs in which either VV P37 or SPV P42 genes
were placed downstream of the natural VV P37 promoter. To
facilitate the isolation of recombinant viruses, plasmid pRB24
was constructed, as outlined in Fig. 3 (A). This plasmid contains
flanks for insertion into the P37 locus and a β-gus cassette to
allow visual identification of recombinant virus plaques. The
coding sequences of VV P37 or SPV P42 ORFs were inserted
downstream of the P37 promoter, to generate recombinant
viruses expressing either protein. As shown in Fig. 3 (B), the
DNA sequence between the promoter and the initiation ATG
was slightly changed from wild-type virus due to the cloning.
Recombinant viruses I-β, I-βP37 and I-βP42 were derived from
VV vRB10, a VV (IHD-J strain) P37 deletion mutant, by
recombination with plasmids pRB24, pRB24-P37 or pRB24P42, respectively. Recombinant viruses were isolated by
several consecutive rounds of plaque isolation in the presence
of X-Gluc.
Expression of SPV P42
An antiserum was raised against a synthetic peptide
corresponding to the C terminus of the protein. The antiserum
specifically recognized SPV P42, when this was expressed from
VV recombinant I-βP42 (Fig. 4 A). In SPV-infected PK-15 cells,
the antiserum recognized a polypeptide with an apparent
molecular mass of 40 kDa, in good agreement with the
predicted molecular mass for P42 (Fig. 4 A).
The kinetics of accumulation of P42 in SPV-infected cells
was followed by Western blot analysis with anti-P42 serum
(Fig. 4 B). The protein was first detected at 24 h p.i. and
accumulated over several days. Taking into account the slower
replication cycle of SPV compared to VV, these results showed,
as predicted from the sequence analysis, that SPV P42 was
expressed with a late expression pattern. Furthermore, P42 was
not detected after 48 h of infection in the presence of araC, an
inhibitor of DNA replication. Thus P42 showed an exclusively
late expression pattern.
Palmitylation of SPV P42
Because of the overall sequence conservation between VV
P37 and SPV P42, and the conservation of the two cysteine
residues that are modified by palmitylation in VV P37, we
wished to determine whether SPV P42 was modified by
palmitylation. Labelling with [$H]palmitic acid during infection
by SPV produced two major labelled proteins, one of which
had an apparent molecular mass of 42 kDa (Fig. 5, lane SPV).
This protein comigrated with immunoprecipitated, or
palmitate-labelled, VV P37.
Several palmitylated proteins could be detected in I-βP37infected cells, in agreement with results obtained for VV strain
IHD-J (Child & Hruby, 1992). One of the labelled proteins had
the same electrophoretic mobility as immunoprecipitated P37
protein, and was absent in I-β virus-infected cells, indicating
that this protein is P37. Interestingly, expression of SPV P42
by VV recombinant I-βP42 resulted in a pattern of palmitylated
proteins identical to that of I-βP37. These data indicate that
SPV P42 is a palmityl protein, and that it is palmitylated
efficiently when expressed via a VV recombinant.
Localization of SPV P42
In order to study the subcellular distribution of SPV P42,
and compare it to that of VV P37, cells infected with I-βP37, IβP42 or SPV were subjected to subcellular fractionation as
detailed in Methods. After fractionation, samples were
analysed by Western blot (Fig. 6 A) with anti-P37 or anti-P42
antibody. P37 was detected in significant amounts in the
nuclear fraction (NP) and the virus-containing fraction (P15),
which potentially contains some of the cytoplasmic membranebound organelles. No P37 was detected in the particulate
cytoplasmic fraction (P100) or in the soluble cytoplasmic
fraction (S100). These results are consistent with those reported
previously (Grosenbach & Hruby, 1998 ; Grosenbach et al.,
Fig. 1. Sequence of the SPV P42 gene. (A) Diagrammatic representation of the complete HindIII map of SPV DNA (Massung
& Moyer, 1991 a). The position of the P42 gene within HindIII B fragment, together with the positions of restriction sites used
for cloning, are shown below the map. (B) Sequence of the SPV P42 gene and flanks. The poxvirus late promoter motif TAAAT
and the related TAAAAT are indicated by asterisks.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
BAHH
J. Ba! rcena and others
BAHI
Fig. 2. Comparison between poxvirus P37 homologues. (A) Multiple sequence alignment. Residues that are identical in at least four of the six sequences are highlighted. Cysteine
residues that are palmitylated in VV P37 are indicated by asterisks. The conserved aspartate residues in phospholipase D motifs are indicated by arrowheads. (B) Percent identity
between different proteins. Similarities are expressed as the percentage of identical residues derived from pairwise alignments between protein sequences. Sequences used are :
SPV P42 (GenBank accession no. AJ249689) ; MV, myxoma virus (U43549) ; VV, vaccinia virus (WR strain) P37 (M12882) ; OV, orf virus (U06671) ; FPV, fowlpox virus
(M88587) ; MCV, molluscum contagiosum virus (subtype 1) (M63486).
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
Swinepox virus F13L homologue
Fig. 3. (A) Plasmid construction. Plasmid pRB21-βgus was obtained by inserting the gus gene in plasmid pRB21 (Blasco &
Moss, 1992), downstream of the PE/L promoter. Plasmid pRB24 was derived from pRB21-βgus by substituting a fragment
containing the left flank and P37 gene for an extended version of the left flank containing the natural F13L promoter.
Subsequently, genes VV P37 and SPV P42 were cloned downstream of the F13L promoter to produce plasmids pRB24-P37
and pRB24-P42, respectively. LF, left recombination flank, RF, right recombination flank, PE/L, synthetic early/late VV promoter,
PF13L, VV P37 gene promoter, β-gus, E. coli β-glucuronidase gene. (B) Viruses. All viruses used, except SPV, were derived from
a VV strain IHD-J deficient in P37 (vRB10, Blasco & Moss, 1991). Plasmids used to introduce genes downstream of the natural
P37 promoter are indicated. The sequence around the promoter/ATG region in each construct is shown. The late promoter
motif TAAAT (TAAAAT in SPV) is shown in bold letters. The ATG initiation codon is underlined.
1997). After fractionation of SPV-infected cells, P42 showed
roughly the same pattern, suggesting that P37 and P42 share
a similar intracellular distribution. Fractionation of I-βP42infected cells also produced a similar pattern (Fig. 6 A),
indicating that the SPV P42 protein expressed in the context of
a VV infection attains its correct subcellular distribution.
VV P37 is incorporated specifically to the outer envelope of
the VV EEV form, but is absent from the IMV form (Hiller et
al., 1981 ; Payne, 1978). To determine if P42 is incorporated
into the EEV envelope, we sought to detect the protein in the
two virus forms. SPV EEV and IMV particles were purified
from infected PK-15 cells by CsCl gradients and equal amounts
were analysed by Western blotting with anti-P42 serum (Fig.
6 B). P42 was detected in EEV but was absent from purified
IMV particles, indicating that SPV protein is a specific
component of EEV, in a manner similar to P37 protein in VV.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
BAHJ
J. Ba! rcena and others
Fig. 4. Expression of SPV P42. (A) Western blot analysis. An anti-peptide antiserum was used to detect the protein in
lysates of uninfected PK-15 cells (Mock), SPV-infected PK-15 cells (SPV), uninfected CV-1 cells (Mock), VV-infected CV-1
cells (I-HDJ) or CV1 infected with recombinant VV expressing P42 (I-βP42). (B) Kinetics of P42 accumulation. Lysates of
uninfected (M) or SPV-infected PK-15 cells harvested at the indicated times p.i. (in hours) were analysed by Western blotting
with anti-P42 serum. Lane 48a, PK-15 cells infected with SPV for 48 h in the presence of araC. Molecular masses of the
marker proteins are indicated in kDa at the left of each panel.
Fig. 5. Labelling with [3H]palmitate. CV-1 cells were infected with VV
recombinants expressing VV P37 (lane I-βP37), SPV P42 (lane I-βP42)
or none (lane I-β). At 16 h p.i., cell cultures were labelled for 4 h with
[3H]palmitate. In parallel, PK-15 cells that had been infected with SPV for
48 h were similarly labelled for 4 h with [3H]palmitate. Lysates were
prepared from the infected cells and the samples analysed by PAGE. As a
control, VV P37 protein from VV-infected CV-1 cells radiolabelled with
[35S]methionine/cysteine and immunoprecipitated with anti-P37 antibody
was included (lane P37).
The intracellular localization of P42 was also explored by
immunofluorescence staining of infected cells. Staining with
anti-P42 antibody in SPV-infected cells revealed a strong
juxtanuclear signal, and some dispersed punctate staining (Fig.
7 B), similar to that of P37 in VV-infected cells (Fig. 7 D). This
localization pattern is characteristic of VV EEV envelope
proteins, which at late times are enriched in the trans-Golgi
network (juxtanuclear staining), and are also present in
intracellular or cell-associated enveloped virus particles (punctated staining). The strong juxtanuclear labelling suggests
BAIA
Fig. 6. Incorporation of P42 into extracellular SPV virus. (A) Subcellular
fractionation of SPV-infected cells. Infected cells (infected with the viruses
indicated at the right of each panel) were fractionated by differential
centrifugation to yield a total cell extract (TCE), a nuclear pellet (NP), a
virus-containing fraction (P15), a particulate cytoplasmic fraction (P100)
and a soluble cytoplasmic fraction (S100). Aliquots of fractions were
analysed by Western blot using anti-P37 monoclonal antibody or anti-P42
antiserum. (B) Presence of P42 in virions. SPV EEV and IMV particles,
from infected PK-15 cells, were purified by centrifugation on CsCl
gradients and analysed by Western blotting with anti-P42 serum.
efficient trans-Golgi network targeting of P42 in the context of
SPV infection. Also, the punctate pattern obtained (which
showed fewer and in general bigger structures than in the case
of VV) is consistent with the incorporation of P42 in the
enveloped forms of the virus, by a mechanism similar to that
described for VV.
Functioning of SPV P42 in VV recombinants
The above results revealed that SPV P42 and VV P37 share,
in addition to sequence homology, a number of properties.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
Swinepox virus F13L homologue
Fig. 7. Intracellular localization of SPV P42. PK-15 cells mock infected (A, C), infected with SPV (B) or infected with VV (D). At
7 h p.i. (for VV) or 23 h p.i. (for SPV), cells were fixed, permeabilized and subjected to immunofluorescence with anti-P42
antibody (A, B), or anti-P37 antibody (C, D).
Given these similarities between VV and SPV, we wondered if
SPV P42 could substitute for P37 when expressed in VV. P37
is known to be required for VV envelopment and release.
Consequently, enveloped virus formation and cell-to-cell virus
transmission are blocked as a result of the P37 deletion. The
EEV formation defect is better appreciated in the high EEV
producer strain IHD-J. Therefore, we constructed a panel of
recombinant viruses (see above, and Fig. 3) derived from
virus vRB10, which is a P37 deletion mutant derived from
VV IHD-J.
VV recombinants expressing VV P37 (I-βP37) or SPV P42
(I-βP42) as well as P37 deleted virus (I-β) were assayed for
plaque formation, EEV release and EEV infectivity. Monolayers
of BSC-1 cells were infected with wild-type VV (IHD-J) or the
recombinant viruses and incubated under an agarose overlay.
At 48 h p.i. the cell monolayers were stained with crystal violet
to visualize virus plaques (Fig. 8 A). I-βP37 virus formed clearly
visible plaques, which were slightly smaller than normal IHDJ virus plaques, probably due to differences in the sequence
around the P37 promoter (shown in Fig. 3 B). As expected for
a P37 deletion mutant (Blasco & Moss, 1991), virus I-β
produced no visible plaques in 48 h and formed small plaques
after 6–7 days (not shown). I-βP42 plaques were indistinguishable from I-β plaques, indicating that P42 expression did not
rescue the defect of the VV P37 deletion mutant. When the
monolayers were maintained under a liquid medium overlay,
the characteristic comet-like plaques typical of IHD-J virus
formed after 2 days for IHD-J and I-βP37, and after 7 days for
I-β and I-βP42 (data not shown), indicating that EEV release
was not enhanced by expression of P42. These observations
were not dependent on the cell type, similar results being
obtained with swine PK-15 cells (data not shown).
As P37 deficiency also results in a strong decrease in VV
EEV formation, we determined the amount of infectious virus
in the medium of infected RK-13 cells (Fig. 8 B). All viruses
used produced roughly equivalent titres of cell-associated
virus. The P37-deficient virus I-β produced approximately 100fold less extracellular virus than normal IHD-J virus. Expression
of P37 in I-βP37 rescued EEV formation to a level similar to
that of IHD-J. In contrast, I-βP42 virus exhibited a phenotype
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
BAIB
J. Ba! rcena and others
Fig. 8. Characterization of recombinant VVs. (A) Plaque formation. Monolayers of BSC-1 cells were infected with the indicated
viruses and incubated under semi-solid medium. At 48 h p.i. the cell monolayers were stained with crystal violet.
(B) Extracellular virus production. RK-13 cell monolayers were infected at a multiplicity of 5 p.f.u. per cell and harvested at
24 h p.i. Virus from the cell lysates (white bars) and culture medium (black bars) was titrated by plaque assay on BSC-1 cell
monolayers. For titration, monolayers were stained after 2 days for IHD-J and I-βP37, and after 7 days for I-β and I-βP42.
(C) Centrifugation of extracellular virus in CsCl density gradients. Infected RK13 cells were metabolically labelled with
[35S]methionine/cysteine. Virus from the medium of infected RK-13 cells was subjected to centrifugation in CsCl gradients as
described in Methods. After centrifugation, fractions were collected from the bottom of the tube.). , I-βP37 ; >, I-βP42 ;
$, I-β.
indistinguishable from that of I-β virus. Similar results were
obtained using different cell lines such as CV-1 and BSC-1 (data
not shown).
Both the development of virus plaques (Fig. 8 A) or the
release of high virus titres into the culture medium (Fig. 8 B) are
dependent on the production and release of infectious virus.
The phenotype of I-βP42 virus could reflect either a block in
EEV formation or a defect in EEV infectivity. To distinguish
between these possibilities, infected RK13 cells were labelled
with [$&S]methionine and the virus in the medium was analysed
by CsCl gradient centrifugation (Fig. 8 C). I-βP37 produced a
high peak of radioactivity in fractions corresponding to the
density of the EEV band (1n23 g\ml). I-β and I-βP42 had
drastically reduced levels of EEV particles, although detection
of enveloped virions above background was possible. Thus,
expression of P42 was not able to rescue EEV formation in a
VV P37 deficient background.
BAIC
Discussion
We describe here the sequence and characterization of an
SPV EEV protein with similarity to VV P37, the major protein
in the VV EEV envelope. P37 gene homologues have been
previously reported for a number of poxviruses belonging to
different genera : MCV (Blake et al., 1991), FPV (Calvert et al.,
1992), OV (Sullivan et al., 1994) and MV (Jackson & Hall,
1998). Interestingly, as in other poxviruses, the SPV gene was
located near the left-hand terminus of the genome, and its
transcription orientation was towards the left genome end.
In addition to sequence homology, our characterization of
SPV P42 revealed significant resemblance to its VV
counterpart. Similar to VV P37, the SPV protein showed an
exclusively late expression pattern, had a similar intracellular
distribution, was incorporated into EEV and was absent from
IMV. These data led us to propose that both proteins share
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
Swinepox virus F13L homologue
the same function in the morphogenesis of their respective
enveloped virions. That SPV P42 is functional is supported by
the observation that despite its slower replication kinetics with
respect to VV (Massung et al., 1991 b), SPV forms larger
plaques, and releases more EEV than VV P37 deletion mutants
(J. Ba! rcena, J. M. Sa! nchez-Puig & R. Blasco, unpublished).
Deletion of the SPV gene, in a similar way to the deletion of its
VV counterpart (Blasco & Moss, 1991) would be of interest to
unequivocally determine the function of P42. However, SPV
P42 deletion will presumably require the isolation of poorly
plaquing or non-plaquing viruses, which is hampered by the
low effectiveness of selection in SPV when using marker genes
commonly used for VV selection (J. Ba! rcena & R. Blasco,
unpublished).
Several studies point to a close connection between P37
function, palmitylation and intracellular targeting. By mutation
of the palmityl acceptor cysteine residues, it has been shown
that proper subcellular localization of P37, as well as
functionality, are dependent on palmitylation of the protein
(Grosenbach & Hruby, 1998 ; Grosenbach et al., 1997). Also,
the infection context, and probably the interaction with other
envelope proteins, is important for efficient palmitylation and
targeting of P37 (Borrego et al., 1999). Since SPV P42 appears
to have the same localization as VV P37, and the palmitylation
site is conserved, we considered it likely that P42 was also
modified by palmitylation. Indeed, our data suggest that P42 is
the major palmitylated protein in a normal SPV infection (Fig.
5).
Broad similarities between SPV P42 and VV P37 led us to
attempt to rescue the VV P37 deficiency by expressing SPV
P42 in the VV genetic background. Notably, when expressed
in VV, SPV P42 seemed to be normally palmitylated and
targeted. However, no complementation of the P37 deficiency
was apparent, either for virus transmission or EEV formation.
There are several possible explanations for this lack of crossspecies functionality. Despite all of the above observations, we
cannot formally rule out the possibility that the two proteins
have different functions. Also, it is possible that each protein is
adapted to function exclusively in cells of the host of their
respective viruses. However, we favour an explanation based
on the likely requirements for protein–protein interactions
between P37 (or P42) and other viral proteins involved in EEV
formation. If those interactions are required for function, it is
not surprising that a structural protein like SPV P42 may not
function properly in the context of a different virus, like VV,
provided that its protein partners have also undergone enough
divergent evolution. From that point of view, the likely
scenario is that concerted evolution of several virus proteins
would result, eventually, in a lack of function of one single
protein when isolated from its genetic context.
The absence of cross-species complementation is in sharp
contrast with observations obtained with thymidine kinase
genes, which are functional after being transferred between
different poxviruses (Boyle & Coupar, 1986 ; Gruidl et al.,
1992 ; Scheiflinger et al., 1997) or even between herpesviruses
and poxviruses (Mackett et al., 1982 ; Panicali & Paoletti, 1982).
Probably, complementation is easily achieved in the case of
enzymes, where providing the enzymatic activity could be
sufficient to provide successful complementation. Conversely,
when protein interactions are required for function, the
divergence between different viruses is expected to result in
lack of complementation. This system, or similar situations
when a particular function is affected by inter-genus divergence, has potential practical applications. For instance, one
could study the protein(s) that interact with SPV P42 by
incorporating additional SPV genes in the VV background.
Also, recombinant viruses containing SPV P42–VV P37
protein chimaeras could allow study of the protein regions
involved in the protein–protein interactions required for
function.
SPV is a potential vector for the construction of recombinant vaccines for pigs. The possible widespread use of such
a vector raises several concerns related to its safety. First, the
possibility of horizontal transmission to an unintended host,
and in particular to humans, should be addressed. In this
respect, SPV shows an extremely narrow host range in vivo,
and lack of transmission of SPV to humans and other species
has been reported (Schwarte & Biester, 1941). A second
concern regarding the use of SPV, or other poxviruses, is that
the virus vector may change its biological properties, alter its
host range or pathogenicity, through mutation or recombination with a naturally occurring poxvirus. Our results
highlight the divergence of SPV with respect to VV, and
reinforce the notion that suipoxviruses and orthopoxviruses
are evolutionarily distant, and therefore unlikely to undergo
genetic rearrangements.
We thank Stuart N. Isaacs for critical reading of the manuscript. This
work was supported by grants PM92-200 and PB95-0237 from Direccio! n
General de Investigacio! n Cientı! fica y Te! cnica (DGICYT) and Contract
no. CT93-1332 from the European Commission.
References
Baek, S. H., Kwak, J. Y., Lee, S. H., Lee, T., Ryu, S. H., Uhlinger, D. J. &
Lambeth, J. D. (1997). Lipase activities of p37, the major envelope
protein of vaccinia virus. Journal of Biological Chemistry 272,
32042–32049.
Barcena, J. & Blasco, R. (1998). Recombinant swinepox virus expressing
beta-galactosidase : investigation of viral host range and gene expression
levels in cell culture. Virology 243, 396–405.
Blake, N. W., Porter, C. D. & Archard, L. C. (1991). Characterization of
a molluscum contagiosum virus homolog of the vaccinia virus p37K
major envelope antigen. Journal of Virology 65, 3583–3589.
Blasco, R. (1995). Evolution of poxviruses and African swine fever
virus. In Molecular Basis of Virus Evolution, pp. 255–269. Edited by A. J.
Gibbs, C. H. Calisher & F. Garcı! a-Arenal. Cambridge : Cambridge University Press.
Blasco, R. & Doms, R. W. (1993). Membrane fusion activity of vaccinia
virus. In Viral Fusion Mechanisms, pp. 413–424. Edited by J. Bentz. Boca
Raton, FL : CRC Press.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
BAID
J. Ba! rcena and others
Blasco, R. & Moss, B. (1991). Extracellular vaccinia virus formation and
cell-to-cell virus transmission are prevented by deletion of the gene
encoding the 37,000-dalton outer envelope protein. Journal of Virology
65, 5910–5920.
Blasco, R. & Moss, B. (1992). Role of cell-associated enveloped vaccinia
virus in cell-to-cell virus spread. Journal of Virology 66, 4170–4179.
Blasco, R. & Moss, B. (1995). Selection of recombinant vaccinia viruses
on the basis of plaque formation. Gene 158, 157–162.
Borrego, B., Lorenzo, M. M. & Blasco, R. (1999). Complementation of
P37 (F13L gene) knock-out in vaccinia virus by a cell line expressing the
gene constitutively. Journal of General Virology 80, 425–432.
Boyle, D. B. & Coupar, B. E. (1986). Identification and cloning of the
fowlpox virus thymidine kinase gene using vaccinia virus. Journal of
General Virology 67, 1591–1600.
Calvert, J. G., Ogawa, R., Yanagida, N. & Nazerian, K. (1992).
Identification and functional analysis of the fowlpox virus homolog of the
vaccinia virus p37K major envelope antigen gene. Virology 191, 783–792.
Cao, J. X., Koop, B. F. & Upton, C. (1997). A human homolog of the
vaccinia virus HindIII K4L gene is a member of the phospholipase D
superfamily. Virus Research 48, 11–18.
Carroll, M. W. & Moss, B. (1995). E. coli beta-glucuronidase (GUS) as a
marker for recombinant vaccinia viruses. Biotechniques 19, 352–354.
Child, S. J. & Hruby, D. E. (1992). Evidence for multiple species of
vaccinia virus-encoded palmitylated proteins. Virology 191, 262–271.
Cudmore, S., Cossart, P., Griffiths, G. & Way, M. (1995). Actin-based
motility of vaccinia virus. Nature 378, 636–638.
Feller, J. A., Massung, R. F., Turner, P. C., Gibbs, E. P., Bockamp, E. O.,
Beloso, A., Talavera, A., Vinuela, E. & Moyer, R. W. (1991). Isolation
and molecular characterization of the swinepox virus thymidine kinase
gene. Virology 183, 578–585.
Foley, P. L., Paul, P. S., Levings, R. L., Hanson, S. K. & Middle, L. A.
(1991). Swinepox virus as a vector for the delivery of immunogens.
Annals of the New York Academy of Sciences 646, 220–222.
Grosenbach, D. W. & Hruby, D. E. (1998). Analysis of a vaccinia virus
mutant expressing a nonpalmitylated form of p37, a mediator of virion
envelopment. Journal of Virology 72, 5108–5120.
Grosenbach, D. W., Ulaeto, D. O. & Hruby, D. E. (1997). Palmitylation
of the vaccinia virus 37-kDa major envelope antigen. Identification of a
conserved acceptor motif and biological relevance. Journal of Biological
Chemistry 272, 1956–1964.
Gruidl, M. E., Hall, R. L. & Moyer, R. W. (1992). Mapping and molecular
characterization of a functional thymidine kinase from Amsacta moorei
entomopoxvirus. Virology 186, 507–516.
Hiller, G. & Weber, K. (1985). Golgi-derived membranes that contain an
acylated viral polypeptide are used for vaccinia virus envelopment.
Journal of Virology 55, 651–659.
Hiller, G., Eibl, H. & Weber, K. (1981). Characterization of intracellular
and extracellular vaccinia virus variants : N"-isonicotinoyl-N#-3-methyl4-chlorobenzoylhydrazine interferes with cytoplasmic virus dissemination and release. Journal of Virology 39, 903–913.
Hirt, P., Hiller, G. & Wittek, R. (1986). Localization and fine structure of
a vaccinia virus gene encoding an envelope antigen. Journal of Virology
58, 757–764.
Jackson, R. J. & Hall, D. F. (1998). The myxoma virus EcoRI-O fragment
encodes the DNA binding core protein and the major envelope protein
of extracellular poxvirus. Virus Genes 17, 55–62.
Koonin, E. V. (1996). A duplicated catalytic motif in a new superfamily
of phosphohydrolases and phospholipid synthases that includes poxvirus
envelope proteins. Trends in Biochemical Sciences 21, 242–243.
BAIE
Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the
hydropathic character of a protein. Journal of Molecular Biology 157,
105–132.
Mackett, M., Smith, G. L. & Moss, B. (1982). Vaccinia virus : a selectable
eukaryotic cloning and expression vector. Proceedings of the National
Academy of Sciences, USA 79, 7415–7419.
Massung, R. F. & Moyer, R. W. (1991 a). The molecular biology of
swinepox virus. I. A characterization of the viral DNA. Virology 180,
347–354.
Massung, R. F. & Moyer, R. W. (1991 b). The molecular biology of
swinepox virus. II. The infectious cycle. Virology 180, 355–364.
Massung, R. F., Jayarama, V. & Moyer, R. W. (1993). DNA sequence
analysis of conserved and unique regions of swinepox virus : identification
of genetic elements supporting phenotypic observations including a
novel G protein-coupled receptor homologue. Virology 197, 511–528.
Panicali, D. & Paoletti, E. (1982). Construction of poxviruses as cloning
vectors : insertion of the thymidine kinase gene from herpes simplex virus
into the DNA of infectious vaccinia virus. Proceedings of the National
Academy of Sciences, USA 79, 4927–4931.
Payne, L. (1978). Polypeptide composition of extracellular enveloped
vaccinia virus. Journal of Virology 27, 28–37.
Pearson, W. R. (1990). Rapid and sensitive sequence comparison with
FASTP and FASTA. Methods in Enzymology 183, 63–98.
Ponting, C. P. & Kerr, I. D. (1996). A novel family of phospholipase D
homologues that includes phospholipid synthases and putative endonucleases : identification of duplicated repeats and potential active site
residues. Protein Science 5, 914–922.
Roos, N., Cyrklaff, M., Cudmore, S., Blasco, R., Krijnse-Locker, J. &
Griffiths, G. (1996). A novel immunogold cryoelectron microscopic
approach to investigate the structure of the intracellular and extracellular
forms of vaccinia virus. EMBO Journal 15, 2343–2355.
Sanderson, C. M., Frischknecht, F., Way, M., Hollinshead, M. & Smith,
G. L. (1998). Roles of vaccinia virus EEV-specific proteins in intracellular
actin tail formation and low pH-induced cell-cell fusion. Journal of General
Virology 79, 1415–1425.
Scheiflinger, F., Falkner, F. G. & Dorner, F. (1997). Role of the fowlpox
virus thymidine kinase gene for the growth of FPV recombinants in cell
culture. Archives of Virology 142, 2421–2431.
Schmelz, M., Sodeik, B., Ericsson, M., Wolffe, E. J., Shida, H., Hiller, G.
& Griffiths, G. (1994). Assembly of vaccinia virus : the second wrapping
cisterna is derived from the trans Golgi network. Journal of Virology 68,
130–147.
Schmutz, C., Rindisbacher, L., Galmiche, M. C. & Wittek, R. (1995).
Biochemical analysis of the major vaccinia virus envelope antigen.
Virology 213, 19–27.
Schnitzlein, W. M. & Tripathy, D. N. (1991). Identification and nucleotide sequence of the thymidine kinase gene of swinepox virus. Virology
181, 727–732.
Schwarte, L. H. & Biester, H. E. (1941). Pox in swine. American Journal
of Veterinary Research 2, 136–140.
Sullivan, J. T., Mercer, A. A., Fleming, S. B. & Robinson, A. J. (1994).
Identification and characterization of an orf virus homologue of the
vaccinia virus gene encoding the major envelope antigen p37K. Virology
202, 968–973.
Sung, T. C., Roper, R. L., Zhang, Y., Rudge, S. A., Temel, R., Hammond,
S. M., Morris, A. J., Moss, B., Engebrecht, J. & Frohman, M. A. (1997).
Mutagenesis of phospholipase D defines a superfamily including a transGolgi viral protein required for poxvirus pathogenicity. EMBO Journal
16, 4519–4530.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
Swinepox virus F13L homologue
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W :
improving the sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties and weight
matrix choice. Nucleic Acids Research 22, 4673–4680.
Tuboly, T., Nagy, E. & Derbyshire, J. B. (1993). Potential viral vectors
for the stimulation of mucosal antibody responses against enteric viral
antigens in pigs. Research in Veterinary Science 54, 345–350.
van der Leek, M. L., Feller, J. A., Sorensen, G., Isaacson, W., Adams,
C. L., Borde, D. J., Pfeiffer, N., Tran, T., Moyer, R. W. & Gibbs, E. P.
(1994). Evaluation of swinepox virus as a vaccine vector in pigs using an
Aujeszky’s disease (pseudorabies) virus gene insert coding for glycoproteins gp50 and gp63. Veterinary Record 134, 13–18.
Received 9 October 1999 ; Accepted 14 December 1999
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Mon, 24 Oct 2016 14:02:59
BAIF