Australian Handbook for the Identification of Fruit Flies
Transcription
Australian Handbook for the Identification of Fruit Flies
THE AUSTRALIAN HANDBOOK FOR THE IDENTIFICATION OF FRUIT FLIES Version 2.1 Species: Bactrocera bryoniae Species: Bactrocera frauenfeldi Species: Bactrocera kandiensis Species: Bactrocera tau Species: Bactrocera trilineola Species: Bactrocera umbrosa Species: Bactrocera xanthodes Species: Bactrocera newmani Department of Agriculture and Water Resources For more information on Plant Health Australia Phone: +61 2 6215 7700 Fax: +61 2 6260 4321 Email: Visit our website http://www.planthealthaustralia.com.au/ An electronic copy of this plan is available from the website listed above. © Plant Health Australia 2016 This work is copyright except where attachments are provided by other contributors and referenced, in which case copyright belongs to the relevant contributor as indicated throughout this document. Apart from any use as permitted under the Copyright Act 1968, no part may be reproduced by any process without prior permission from Plant Health Australia. Requests and enquiries concerning reproduction and rights should be addressed to: Communications Manager Plant Health Australia 1/1 Phipps Close DEAKIN ACT 2600 ISBN 978-0-9872309-0-4 In referencing this document, the preferred citation is: Plant Health Australia (2016). The Australian Handbook for the Identification of Fruit Flies. Version 2.1. Plant Health Australia. Canberra, ACT. Disclaimer: The material contained in this publication is produced for general information only. It is not intended as professional advice on any particular matter. No person should act or fail to act on the basis of any material contained in this publication without first obtaining specific, independent professional advice. Plant Health Australia and all persons acting for Plant Health Australia in preparing this publication, expressly disclaim all and any liability to any persons in respect of anything done by any such person in reliance, whether in whole or in part, on this publication. The views expressed in this publication are not necessarily those of Plant Health Australia. 1 1 Contributors This document has been made possible through consultation with and input from the following fruit fly entomologists, scientists, academics and diagnosticians: Organisation Contributor Bio-Protection Research Centre, Lincoln University Karen Armstrong Department of Agriculture and Fisheries, Queensland Jane Royer Department of Agriculture and Food, Western Australia Andras Szito, Bill Woods Department of Agriculture and Water Resources Carol Quashie-Williams, Craig Hull Department of Economic Development, Jobs, Transport and Resources, Victoria Mali Malipatil, Linda Semeraro, Mark Blacket Department of Resources, Northern Territory Austin McLennan, Mary Finlay-Doney Griffith University Dick Drew, Meredith Romig Ministry for Primary Industries NZ Dongmei Li New South Wales DPI Chris Bloomfield, Peter Gillespie, Bernie Dominiak Northern Australia Quarantine Strategy James Walker, Sally Cowan Queensland University of Technology Matt Krosch, Mark Schutze South Australian Museum Mark Adams South Australian Research and Development Institute (SARDI) Peter Crisp 2 2 Foreword The accurate identification of fruit flies is a key component of Australia’s biosecurity system that underpins the domestic movement of fruit and vegetables, maintains international market access for Australian producers and protects Australia’s borders from exotic pest incursion. In Australia’s tropics, routine surveillance of coastal and island communities results in a requirement to process and identify thousands of adult flies per hour. In some parts of southern Australia fruit fly sampling numbers are smaller, however diagnosticians still have to be skilled and equipped to identify a single fly of economic importance amongst a large range of native fruit flies that have no impact on commercial fruits and vegetables. For this second edition we have completely reviewed and updated all the diagnostic techniques currently used in Australia for the identification of fruit flies. A new set of descriptions and photographs have been prepared to assist the identification of flies by adult morphology. In addition, updated and new protocols used for the identification of fruit flies using molecular biology techniques are presented. A new section, Diagnostician’s Notes, is included in this edition which provides informal tips on adult identification. This document has been written by Australia’s fruit fly diagnosticians for diagnosticians and it is my hope that the dialogue, sharing of information and experience, and constructive discourse that brings together this publication will continue to grow. Together the combined expertise and knowledge of Australia’s fruit fly researchers, academics, surveillance officers, diagnosticians and laboratory scientists make up a formidable national resource, which when networked and coupled with extensive fruit fly reference collections, provides a world-class national capability. This valuable document provides a useful benchmark against which future updates, protocols and revisions can be developed and training programs can be delivered. I would like to thank all the entomologists and scientists who have brought this document together and have the greatest pleasure in endorsing its adoption and use by practitioners and jurisdictions in Australia. Professor Dick Drew International Centre for Management of Pest Fruit Flies Griffith University 3 3 Preface The Australian Handbook for the Identification of Fruit Flies (v2.1) Was written by diagnosticians for diagnosticians; Collates current and existing practices and knowledge into a single document; Pools experience from Australia’s network of fruit fly experts; Establishes a resource that can support and develop the confidence and expertise of all users; Provides a mechanism to possibly identify future information and research needs; and, Considers the potential of both morphological and molecular techniques. The Handbook has been an important part of building a network of fruit fly diagnosticians across Australia and it is hoped that both the network and this document continue to grow and develop in the future. We also welcome feedback from fruit fly experts around the world. The current Handbook is a compilation of diagnostic techniques for 59 fruit fly species, most of which are exotic to Australia, as well as the non-tephritid fruit infesting Drosophila suzukii. The Handbook is intended to facilitate rapid diagnosis of fruit fly species and be a comprehensive guide for Australian diagnosticians and field officers. A copy of the Handbook can be downloaded by following the link below. http://www.planthealthaustralia.com.au/national-programs/fruit-fly/handbook-for-theidentification-of-fruit-fly/ This is the second version of The Australian Handbook for the Identification of Fruit Flies. It is provided freely as a reference resource with an expectation that it is appropriately acknowledged when it is used. As a living document it is designed to be continuously updated as more information becomes available through Australia’s skilled network of fruit fly diagnosticians. For further information, please contact Plant Health Australia, 1 Phipps Close Deakin, ACT, 2600 Australia, [email protected] Funding for this important initiative was provided by the Department of Agriculture and Water Resources and the Plant Biosecurity Cooperative Research Centre (PBCRC). The PBCRC and Department of Agriculture and Water Resources would like to recognise the significant in-kind contribution made by researchers, academics, surveillance officers, diagnosticians and laboratory scientists who have collectively updated this valuable document in 2015. Project facilitation and coordination was provided by Plant Health Australia. 4 Contents 1 Contributors ................................................................................................................................... 2 2 Foreword ........................................................................................................................................ 3 3 Preface............................................................................................................................................ 4 Diagnostician’s notes .......................................................................................................................... 13 Grouping of fruit fly species by morphological similarity ...................................................................... 13 TEPHRITIDAE: DACINAE ................................................................................................................... 13 Distinctive feature: Black scutum & T/ wrap T on abdomen ........................................................... 13 TEPHRITIDAE: DACINAE ................................................................................................................... 17 Distinctive feature: Black scutum & incomplete costal band ........................................................... 17 TEPHRITIDAE: DACINAE ................................................................................................................... 19 Distinctive feature: Black scutum & broad costal band ................................................................... 19 TEPHRITIDAE: DACINAE ................................................................................................................... 21 Distinctive feature: Black scutum & abdomen, no vittae ................................................................. 21 TEPHRITIDAE: DACINAE ................................................................................................................... 23 Distinctive feature: Red- brown to golden flies ................................................................................ 23 TEPHRITIDAE: DACINAE ................................................................................................................... 25 Distinctive feature: Glossy black scutum & band on wing ............................................................... 25 Distinctive feature: Glossy or matte black scutum & faint band on wing ........................................ 27 Distinctive feature: Black scutum, heavy abdominal markings, no band on wing ........................... 28 TEPHRITIDAE: DACINAE ................................................................................................................... 29 Distinctive feature: Medial vitta........................................................................................................ 29 TEPHRITIDAE: DACINAE ................................................................................................................... 33 Distinctive feature: Other wing pattern ............................................................................................ 33 TEPHRITIDAE: DACINAE ................................................................................................................... 35 Dacus spp........................................................................................................................................ 35 TEPHRITIDAE: DACINAE ................................................................................................................... 36 Ceratitis spp..................................................................................................................................... 36 TEPHRITIDAE: TRYPETINAE ............................................................................................................ 37 TEPHRITIDAE: TRYPETINAE ............................................................................................................ 39 Rhagoletis spp. ................................................................................................................................ 39 TEPHRITIDAE: TRYPETINAE ............................................................................................................ 41 Anastrepha spp. .............................................................................................................................. 41 DROSOPHILIDAE ............................................................................................................................... 43 4 Introduction.................................................................................................................................. 44 Background ............................................................................................................................. 44 Coverage of this diagnostic handbook ................................................................................... 45 5 Detection ...................................................................................................................................... 48 Plant products affected ........................................................................................................... 48 Signs and symptoms .............................................................................................................. 48 Development stages ............................................................................................................... 48 Methods for detection ............................................................................................................. 49 5.4.1 Trap types ......................................................................................................................... 49 5.4.2 Attractants ......................................................................................................................... 52 5 6 Inspection of material, sample preparation and storage ........................................................ 54 Infested fruit ............................................................................................................................ 54 Sample collection and handling .............................................................................................. 54 Sample transportation............................................................................................................. 54 Sample processing, identification and preservation ............................................................... 54 6.4.1 Molecular Specimens ........................................................................................................ 55 7 Identification ................................................................................................................................ 57 Overview ................................................................................................................................. 57 Morphological identification .................................................................................................... 63 7.2.2 Identification ...................................................................................................................... 64 Molecular identification ........................................................................................................... 68 7.3.1 DNA extraction for adults and immature stages ............................................................... 69 7.3.2 DNA Barcoding ................................................................................................................. 71 7.3.3 PCR-RFLP ........................................................................................................................ 80 7.3.4 Real-time PCR detection of Bactrocera tryoni complex ................................................... 92 7.3.5 Allozyme electrophoresis .................................................................................................. 97 8 Diagnostic Information ............................................................................................................. 100 Key to family Tephritidae ...................................................................................................... 101 Simplified key to major pest fruit fly genera (after White and Elson-Harris 1992): Adults .... 101 Species diagnosis: Anastrepha (Tephritidae: Trypetinae: Toxotrypanini) ............................ 102 8.3.1 Anastrepha distincta (Greene) ........................................................................................ 102 8.3.2 Anastrepha fraterculus (Wiedemann) ............................................................................. 106 8.3.3 Anastrepha grandis (Macquart) ...................................................................................... 109 8.3.4 Anastrepha ludens (Loew) .............................................................................................. 112 8.3.5 Anastrepha obliqua (Macquart)....................................................................................... 115 8.3.6 Anastrepha serpentina (Wiedemann) ............................................................................. 118 8.3.7 Anastrepha striata (Schiner) ........................................................................................... 121 8.3.8 Anastrepha suspensa (Loew) ......................................................................................... 123 Species diagnosis: Bactrocera & Dacus (Tephritidae: Dacinae: Dacini) .............................. 126 8.4.1 Bactrocera (Bactrocera) albistrigata (de Meijere) ......................................................... 126 8.4.2 Bactrocera (Bactrocera) aquilonis (May) ........................................................................ 131 8.4.3 Bactrocera (Paratridacus) atrisetosa (Perkins) ............................................................... 135 8.4.4 Bactrocera (Bactrocera) bryoniae (Tryon) ...................................................................... 138 8.4.5 Bactrocera (Bactrocera) carambolae (Drew and Hancock) ............................................ 141 8.4.6 Bactrocera (Bactrocera) caryeae (Kapoor) ..................................................................... 144 8.4.7 Bactrocera (Bactrocera) correcta (Bezzi) ....................................................................... 147 8.4.8 Bactrocera (Austrodacus) cucumis (French) .................................................................. 150 8.4.9 Bactrocera (Zeugodacus) cucurbitae (Coquillett) ........................................................... 153 8.4.10 Bactrocera (Bactrocera) curvipennis (Froggatt).............................................................. 157 8.4.11 Bactrocera (Paradacus) decipiens (Drew) ...................................................................... 160 8.4.12 Bactrocera (Zeugodacus) depressa (Shiraki) ................................................................. 163 8.4.13 Bactrocera (Bactrocera) dorsalis (Hendel) ..................................................................... 165 8.4.14 Bactrocera (Bactrocera) facialis (Coquillett) ................................................................... 169 8.4.15 Bactrocera (Bactrocera) frauenfeldi (Schiner) ................................................................ 172 8.4.16 Bactrocera (Afrodacus) jarvisi (Tryon) ............................................................................ 175 8.4.17 Bactrocera (Bactrocera) kandiensis (Drew and Hancock) .............................................. 178 8.4.18 Bactrocera (Bactrocera) kirki (Froggatt) ......................................................................... 181 8.4.19 Bactrocera (Bactrocera) kraussi (Hardy) ........................................................................ 184 8.4.20 Bactrocera (Bactrocera) latifrons (Hendel) ..................................................................... 187 6 8.4.21 Bactrocera (Bactrocera) melanotus (Coquillett) .............................................................. 190 8.4.22 Bactrocera (Tetradacus) minax (Enderlein) .................................................................... 192 8.4.23 Bactrocera (Bactrocera) musae (Tryon) ......................................................................... 194 8.4.24 Bactrocera (Bactrocera) neohumeralis (Hardy) .............................................................. 198 8.4.25 Bactrocera (Bactrocera) obliqua (Malloch) ..................................................................... 201 8.4.26 Bactrocera (Bactrocera) occipitalis (Bezzi) ..................................................................... 203 8.4.27 Bactrocera (Daculus) oleae (Rossi) ................................................................................ 206 8.4.28 Bactrocera (Bactrocera) passiflorae (Froggatt) .............................................................. 208 8.4.29 Bactrocera (Bactrocera) psidii (Froggatt) ........................................................................ 211 8.4.30 Bactrocera (Bactrocera) pyrifoliae (Drew & Hancock) .................................................... 214 8.4.31 Bactrocera (Zeugodacus) tau (Walker)........................................................................... 216 8.4.32 Bactrocera (Bactrocera) trilineola (Drew) ....................................................................... 220 8.4.33 Bactrocera (Bactrocera) trivialis (Drew) .......................................................................... 223 8.4.34 Bactrocera (Bactrocera) tryoni (Froggatt) ....................................................................... 226 8.4.35 Bactrocera (Tetradacus) tsuneonis (Miyake) .................................................................. 231 8.4.36 Bactrocera (Bactrocera) tuberculata (Bezzi) ................................................................... 233 8.4.37 Bactrocera (Bactrocera) umbrosa (Fabricius) ................................................................. 235 8.4.38 Bactrocera (Notodacus) xanthodes (Broun) ................................................................... 238 8.4.39 Bactrocera (Bactrocera) zonata (Saunders) ................................................................... 241 Species diagnosis: Ceratitis (Tephritidae: Dacinae: Ceratitidini).......................................... 244 8.5.1 Ceratitis capitata (Wiedemann)....................................................................................... 244 8.5.2 Ceratitis (Pterandrus) rosa (Karsch) ............................................................................... 247 Species diagnosis: Dacus (Tephritidae) ............................................................................... 250 8.6.1 Dacus (Callantra) longicornis (Wiedemann) ................................................................... 250 8.6.2 Dacus (Callantra) solomonensis (Malloch) ..................................................................... 252 Species diagnosis: Dirioxa (Tephritidae: Phytalmiinae) ....................................................... 254 8.7.1 Dirioxa pornia (Walker) ................................................................................................... 254 Species diagnosis: Rhagoletis (Tephritidae: Trypetinae: Trypetini) ..................................... 256 8.8.1 Rhagoletis cerasi (Linnaeus) .......................................................................................... 256 8.8.2 Rhagoletis cingulata (Leow)............................................................................................ 258 8.8.3 Rhagoletis completa (Cresson)....................................................................................... 260 8.8.4 Rhagoletis fausta (Osten-Sacken) .................................................................................. 262 8.8.5 Rhagoletis indifferens (Curran) ....................................................................................... 264 8.8.6 Rhagoletis mendax (Curran) ........................................................................................... 266 8.8.7 Rhagoletis pomonella (Walsh) ........................................................................................ 268 Species diagnosis: (Diptera: Drosophilidae)......................................................................... 270 8.9.1 Drosophila (Sophophora) suzukii (Matsumura 1931) ..................................................... 270 9 Diagnostic resources ................................................................................................................ 273 Key contacts and facilities .................................................................................................... 273 Reference collections ........................................................................................................... 277 Printed and electronic resources .......................................................................................... 278 9.3.1 Morphological keys ......................................................................................................... 278 9.3.2 Electronic resources ....................................................................................................... 279 Supplier details ..................................................................................................................... 280 10 References ................................................................................................................................. 281 11 a. b. Appendices ................................................................................................................................ 288 Specificity test for Tephritidae specimens in the real-time PCR assay .................................... 312 Real-time PCR assay for B. tryoni and B. curvipennis interceptions ........................................ 313 7 Tables Table 1. Fruit flies covered in this diagnostic handbook .......................................................................... 46 Table 2. Commonly employed sample preservation techniques for molecular identification. Methods that are suitable for a particular lifestage are indicated by “+”, those that are less suitable are indicated by a “–“. ............................................................................................................................................................ 56 Table 3. Diagnostic methods used to identify fruit fly species ................................................................. 60 Table 4. Approximate size of the ITS1 amplicon for each species. Potential diagnostic size ranges are contained in a block ................................................................................................................................. 85 Table 5. Analysis of RFLP products from ITS1 fragments from fruit flies ................................................ 88 Table 6. TaqMan real-time PCR for B. tryoni complex protocol using SsoAdvanced Universal Probe Supermix (BioRad) ................................................................................................................................... 94 Table 7. Enzymes most commonly used for fruit-fly genetic identifications using allozyme electrophoresis. ........................................................................................................................................ 99 Table 8. Bactrocera frauenfeldi complex and similar species (best diagnostic characters in bold). ..... 128 Figures Figure 1. Types of fruit fly traps ............................................................................................................... 51 Figure 2. Chemical structure of cue lure and methyl eugenol. ................................................................ 53 Figure 3. Overview of fruit fly diagnostic procedures (adult specimens). ................................................ 58 Figure 4. Overview of fruit fly diagnostic procedures (larval specimens). ............................................... 59 Figure 5. Adult morphology; head (top) and wing (bottom) (White and Elson-Harris 1992). ................... 65 Figure 6. Adult morphology, Thorax; Dorsal features (White and Elson-Harris 1992). ........................... 66 Figure 7. Adult morphology, thorax; lateral features (White and Elson-Harris 1992). ............................. 67 Figure 8. Adult morphology, abdomen; male with features of typical dacini (left), Female, with extended ovipositor (right) (White and Elson-Harris 1992). ..................................................................................... 67 Figure 9. BOLD generated identification results for the closest matches for an Island Fly (Dirioxa pornia) COI sequence (accessed June 2015)...................................................................................................... 76 Figure 10. Specimen confidently assigned to species (Lamprolonchaea brouniana), (BOLD tree June 2015). ....................................................................................................................................................... 77 Figure 11. Specimen only confidently assigned to species group (Bactrocera tryoni complex), due to three closely related species (B. tryoni, B. aquilonis, B. neohumeralis) being “mixed together” (i.e. nonmonophyletic) on the phylogenetic tree (BOLD tree June 2015). ............................................................ 78 Figure 12. Closely related species (B. curvipennis) genetically distinct from the species complex (B. tryoni) but within the <2% assignment limit set by BOLD (BOLD July 2015). ......................................... 79 Figure 13. Part of the ribosomal RNA operon with the location of primer positions for Tests 1 and 2 .... 80 Figure 14. Workflow of PCR-RFLP procedures for fruit fly identification ................................................. 81 Figure 15. Amplification curves of real-time PCR assay for B. tryoni complex. The sample tested positive for B. tryoni complex, DNA sequences has further confirmed the results. ................................. 96 8 Figure 16. Anastrepha distincta ............................................................................................................. 103 Figure 17. Anastrepha distincta ............................................................................................................. 104 Figure 18. Anastrepha distincta ............................................................................................................. 104 Figure 19. Anastrepha distincta ............................................................................................................. 105 Figure 20. Anastrepha distincta ............................................................................................................. 105 Figure 21. Anastrepha fraterculus .......................................................................................................... 108 Figure 22. Anastrepha fraterculus .......................................................................................................... 108 Figure 23. Anastrepha grandis female ................................................................................................... 110 Figure 24. Anastrepha grandis wing ...................................................................................................... 110 Figure 25. Anastrepha grandis ............................................................................................................... 111 Figure 26. Anastrepha grandis ............................................................................................................... 111 Figure 27. Anastrepha ludens ................................................................................................................ 114 Figure 28. Anastrepha ludens ................................................................................................................ 114 Figure 29. Anastrepha obliqua ............................................................................................................... 117 Figure 30. Anastrepha obliqua ............................................................................................................... 117 Figure 31. Anastrepha serpentina .......................................................................................................... 120 Figure 32. Anastrepha serpentina .......................................................................................................... 120 Figure 33. Anastrepha striata ................................................................................................................. 122 Figure 34. Anastrepha suspensa ........................................................................................................... 124 Figure 35. Anastrepha suspensa ........................................................................................................... 125 Figure 36. Bactrocera albistrigata .......................................................................................................... 129 Figure 37. Bactrocera albistrigata .......................................................................................................... 130 Figure 38. Bactrocera aquilonis ............................................................................................................. 133 Figure 39. Bactrocera aquilonis ............................................................................................................. 134 Figure 40. Bactrocera atrisetosa ............................................................................................................ 136 Figure 41. Bactrocera atrisetosa ............................................................................................................ 137 Figure 42. Bactrocera bryoniae .............................................................................................................. 139 Figure 43. Bactrocera bryoniae .............................................................................................................. 140 Figure 44. Bactrocera carambolae ......................................................................................................... 143 Figure 45. Bactrocera carambolae ......................................................................................................... 143 Figure 46. Bactrocera caryeae ............................................................................................................... 146 Figure 47. Bactrocera correcta .............................................................................................................. 149 Figure 48. Bactrocera cucumis .............................................................................................................. 152 Figure 49. Bactrocera cucumis .............................................................................................................. 152 Figure 50. Bactrocera cucurbitae ........................................................................................................... 155 Figure 51. Bactrocera cucurbitae ........................................................................................................... 155 Figure 52. Bactrocera cucurbitae ........................................................................................................... 156 9 Figure 53. Bactrocera curvipennis ......................................................................................................... 158 Figure 54. Bactrocera curvipennis ......................................................................................................... 159 Figure 55. Bactrocera decipiens ............................................................................................................ 161 Figure 56. Bactrocera decipiens ............................................................................................................ 162 Figure 57. Bactrocera depressa ............................................................................................................. 164 Figure 58. Bactrocera dorsalis ............................................................................................................... 167 Figure 59. Bactrocera dorsalis ............................................................................................................... 168 Figure 60. Bactrocera facialis ................................................................................................................ 171 Figure 61. Bactrocera facialis ................................................................................................................ 171 Figure 62. Bactrocera frauenfeldi ........................................................................................................... 174 Figure 63. Bactrocera frauenfeldi ........................................................................................................... 174 Figure 64. Bactrocera jarvisi .................................................................................................................. 177 Figure 65. Bactrocera jarvisi .................................................................................................................. 177 Figure 66. Bactrocera kandiensis .......................................................................................................... 180 Figure 67. Bactrocera kirki ..................................................................................................................... 183 Figure 68. Bactrocera kirki ..................................................................................................................... 183 Figure 69. Bactrocera kraussi ................................................................................................................ 186 Figure 70. Bactrocera latifrons ............................................................................................................... 189 Figure 71. Bactrocera melanotus ........................................................................................................... 191 Figure 72. Bactrocera minax .................................................................................................................. 193 Figure 73. Bactrocera musae ................................................................................................................. 196 Figure 74. Bactrocera musae ................................................................................................................. 196 Figure 75. Bactrocera musae ................................................................................................................. 197 Figure 76. Bactrocera neohumeralis ...................................................................................................... 200 Figure 77. Bactrocera neohumeralis ...................................................................................................... 200 Figure 78. Bactrocera obliqua ................................................................................................................ 202 Figure 79. Bactrocera occipitalis ............................................................................................................ 205 Figure 80. Bactrocera occipitalis ............................................................................................................ 205 Figure 81. Bactrocera oleae ................................................................................................................... 207 Figure 82. Bactrocera oleae ................................................................................................................... 207 Figure 83. Bactrocera passiflorae .......................................................................................................... 210 Figure 84. Bactrocera passiflorae .......................................................................................................... 210 Figure 85. Bactrocera psidii ................................................................................................................... 213 Figure 86. Bactrocera psidii ................................................................................................................... 213 Figure 87. Bactrocera pyrifoliae ............................................................................................................. 215 Figure 88. Bactrocera tau....................................................................................................................... 218 Figure 89. Bactrocera tau....................................................................................................................... 218 10 Figure 90. Bactrocera tau....................................................................................................................... 219 Figure 91. Bactrocera trilineola .............................................................................................................. 221 Figure 92. Bactrocera trilineola .............................................................................................................. 222 Figure 93. Bactrocera trivialis ................................................................................................................ 224 Figure 94. Bactrocera trivialis ................................................................................................................ 225 Figure 95. Bactrocera tryoni ................................................................................................................... 229 Figure 96. Bactrocera tryoni ................................................................................................................... 229 Figure 97. Bactrocera tryoni ................................................................................................................... 230 Figure 98. Bactrocera tryoni ................................................................................................................... 230 Figure 99. Bactrocera tsuneonis ............................................................................................................ 232 Figure 100. Bactrocera tuberculate ........................................................................................................ 234 Figure 101. Bactrocera umbrosa ........................................................................................................... 236 Figure 102. Bactrocera umbrosa ........................................................................................................... 237 Figure 103. Bactrocera xanthodes ......................................................................................................... 240 Figure 104. Bactrocera xanthodes ......................................................................................................... 240 Figure 105. Bactrocera zonata ............................................................................................................... 243 Figure 106. Ceratitis capitata ................................................................................................................. 246 Figure 107. Ceratitis capitata ................................................................................................................. 246 Figure 108. Ceratitis rosa ....................................................................................................................... 249 Figure 109. Ceratitis rosa ....................................................................................................................... 249 Figure 110. Dacus longicornis ............................................................................................................... 251 Figure 111. Dacus solomonensis ........................................................................................................... 253 Figure 112. Dirioxa pornia ...................................................................................................................... 255 Figure 113. Dirioxa pornia ...................................................................................................................... 255 Figure 114. Rhagoletis cerasi ................................................................................................................ 257 Figure 115. Rhagoletis cingulata ........................................................................................................... 259 Figure 116. Rhagoletis completa ........................................................................................................... 261 Figure 117. Rhagoletis fausta ................................................................................................................ 263 Figure 118. Rhagoletis indifferens ......................................................................................................... 265 Figure 119. Rhagoletis mendax ............................................................................................................. 267 Figure 120. Rhagoletis pomonella ......................................................................................................... 269 Figure 121. Drosophila suzukii A. Female (left), Male (right). B. Female ovipositor. C. Male basal tarsal segments. ..................................................................................................................................... 272 11 THIS PAGE IS INTENTIONALLY BLANK 12 Diagnostician’s notes Grouping of fruit fly species by morphological similarity TEPHRITIDAE: DACINAE Distinctive feature: Black scutum & T/ wrap T on abdomen 1 1 6 2 5 4 3 2 Bactrocera dorsalis complex (see page 165) 1 – fore tibia usu. dark 2 – narrow costal band dips in at end of R2+3 3 - very narrow anal streak 4 – T on abdomen, can be very reduced 5 - black scutum, can have patches of brown to being mostly brown 6 - broader parallel sided vittae enclosing ia bristle Bactrocera carambolae (see page 141) 1 – spot on fore femora 2 – flared costal band - similar to B. dorsalis (p. 165) except has flared costal band and spot on fore femora - similar to B. endiandrae (Qld rainforests, ME) which can be separated by having tapered shorter vittae, wide anal streak and diffuse wraparound T - similar to B. musae (Nth Qld, ME, p. 193) which can be separated by having a broad costal band overlapping R2+3, narrow but wider anal streak, slightly tapered vittae (See p. 197) 13 1 5 2 4 3 Bactrocera occipitalis (see page 203) 3 Bactrocera caryeae (see page144) 1 – apical spots on femora 2 – narrow costal band 3 – very narrow anal streak 4 – wide basal band 5 – very narrow vittae -may appear superficially similar to B. endiandrae (E. Aus. rainforests, ME) in having a black scutum and diffuse wrap T but differs in the characters on the diagram 1 2 Bactrocera kandiensis (see page 178) 1 – spots on femora 2 – narrow vittae 3 – anteromedial corners of ppn lobes redbrown Bactrocera pyrifoliae (see page 214) 14 1 2 3 Bactrocera trivialis (see page 223) 1 - black mesonotum 2 - colourless costal cells 3 - black across T3 15 THIS PAGE IS INTENTIONALLY BLANK 16 TEPHRITIDAE: DACINAE Distinctive feature: Black scutum & incomplete costal band Bactrocera oleae (see page 206) Bactrocera tuberculata (see page 233) 1 2 Bactrocera correcta (see page 147) 1 - scutum black or red-brown with black band or lanceolate 2 - spot on end of wing - squat fly with wide abdomen - similar to B. dorsalis (Exotic, ME, p. 165) but costal band reduced to apical spot and transverse facial spots. - similar to B. zonata (Exotic, ME, p. 241) but scutum black or with black band. 17 THIS PAGE IS INTENTIONALLY BLANK 18 TEPHRITIDAE: DACINAE Distinctive feature: Black scutum & broad costal band 1 1 3 2 2 Bactrocera bryoniae (see page 138) 1 - wide costal band to R4+5 2 - distinct T 3 - black scutum - usually larger fly, may appear superficially similar to the exotic B. curvipennis (Cue, p. 157) except has T shape on abdomen and no infuscation on r-m vein. Bactrocera curvipennis (see page 157) 1 - Infuscation r-m vein 2 - broad costal band to R4+5 - superficially similar to B. bryoniae (widespread Aus., Cue, p. 138) except no T on abdomen, has infuscation on r-m vein and tapered vittae. 19 1 1 3 3 2 2 Bactrocera latifrons (see page 187) 1 - flared costal band, may appear to be spot at R4+5 2 - broad abdomen, usu. no markings 3 - narrower parallel sided vittae enclosing ia - may appear similar to B. bancroftii (E. Qld, weakly attracted to ME) in having a black scutum and broad abdomen without patterning, but differs in having a flared costal band, narrow anal streak and no apical band on the scutellum. - may appear similar to B. musae (Nth Qld, ME, p. 193) but has a uniformly orange abdomen that is quite wide and flared costal band. - also separated from the above species by host range (Solanaceae, instead of Musaceae for B. musae and Maclura cochinchinensis for B. bancroftii) and no response to ME. Bactrocera musae (see page 194) 1 - narrow costal band overlaps 2 - narrow anal streak 3 - blunt ended vittae note: variation in abdomen 20 TEPHRITIDAE: DACINAE Distinctive feature: Black scutum & abdomen, no vittae 1 3 2 Bactrocera melanotus (see page 190) Bactrocera passiflorae (see page 208) 1 - Humeral calli entirely black 2 - Mesonotum entirely black 3 - Lacks lateral and medial vittae 21 THIS PAGE IS INTENTIONALLY BLANK 22 TEPHRITIDAE: DACINAE Distinctive feature: Red- brown to golden flies 4 2 1 1 3 5 2 3 2 4 Bactrocera neohumeralis (see page 198) 1 – costal cells dark, microtrichia in both cells 2 – pointed vittae 3 – mesonotum red-brown 4 – dark humeral calli -similar to B. tryoni (widely distributed in E Aus., Cue, p. 226) except has dark humeral calli (= postprotonotal lobes). Bactrocera kraussi (see page 184) 1 – yellow tinted costal cells 2 – faint smoky tint to wing 3 – dark ‘knees’ 4 – lateral dark spots usu. most defined on T5 5 – broad basal band 6 – narrow longer vittae to ia, slightly taper - similar to B. tryoni (Cue, p. 226) except doesn’t have microtrichia in both costal cells (though often tinted), has longer less tapered vittae, lateral spots on abdomen (without medial line), narrow mesopleural stripe, broad basal band on scutellum and dark apices of the femora. 23 1 4 2 1 3 2 Bactrocera aquilonis (see page 131) Bactrocera tryoni (see page 226) 1 – microtrichia in both costal cells 2 – faint wrap T or no patterning - overall golden-orange - similar to B. tryoni (widespread E. Aus., Cue, p. 226) but paler and less patterning on abdomen 1 – short pointed vittae 2 – microtrichia in both costal cells 3 – mesonotum red-brown 4 – humeral calli entirely yellow 1 2 1 2 3 3 Bactrocera jarvisi (see page 175) 1 – joining band between npl calli and ppn lobes 2 – flared costal band 3 – distinct T Bactrocera zonata (see page 241) 1 – costal cells colourless and lacking microtrichia 2 – narrow costal band ending at apex of R2+3 3 – small spot at apex of wing 24 TEPHRITIDAE: DACINAE Distinctive feature: Glossy black scutum & band on wing 2 2 1 1 5 5 3 3 4 4 Bactrocera albistrigata (see page 126) 1 - pale ppn lobes 2 - paler legs than B. frauenfeldi 3 - band on wing 4 - usu. narrower medial line & less lateral colouring than B. frauenfeldi 5 - long vittae -similar to B. frauenfeldi (Nth Qld, Cue, p. 171) except has pale ppn lobes, paler legs and less heavy patterning on abdomen. Note: pic 20B from Drew & Romig 2013 shows variation in abdomen Bactrocera frauenfeldi (see page 172) 1 – vittae short to long 2 – dark ppn lobes, can be partly paler 3 – legs with red-brown to black markings 4 – broad medial line 5 – black triangle shallow or to end of scutellum - may appear similar to the exotic B. albistrigata (Cue, p. 126) except generally dark ppn lobes (or if lighter not as pale as vittae), darker patterning on legs, thicker medial line and more distinct lateral bands on T3-T5 - may appear similar to the exotic B. trilineola (Cue, p. 220) except vittae present and facial spots present (instead of mask) 25 2 1 Bactrocera trilineola (see page 220) 1 – vittae absent 2 – dark humeral calli -glossy black face NB: Bactrocera trilineola is similar to B. frauenfeldi (Nth Qld, Cue, p.146) but differs in having a glossy black face and no lateral vittae 26 Distinctive feature: Glossy or matte black scutum & faint band on wing 2 3 1 5 4 Bactrocera kirki (see page 181) 1 – vittae absent 2 – pale ppn lobes 3 – slight infuscation on r-m & dm-cu veins 4 – very wide medial line 5 – very wide band on scutellum - may appear superficially similar to B. frauenfeldi (Nth Qld, Cue, p. 171) but no distinct band on wing (though can have faint infuscation on r-m and dm-cu cross veins), lacks vittae, has yellow ppn lobes, very wide band on the scutellum and very thick medial line on abdomen. Bactrocera obliqua (see page 201) Bactrocera psidii (see page 211) 27 Distinctive feature: Black scutum, heavy abdominal markings, no band on wing 1 2 4 3 Bactrocera facialis (see page 169) 1 – facial spots absent 2 – pale ppn lobes 3 – narrow costal band, no transverse band on wing 4 – vittae small or absent - may appear superficially similar to B. frauenfeldi (N. Qld, Cue, p.171) except has no band on wing, legs pale, ppn lobes pale and distinct costal band. 28 TEPHRITIDAE: DACINAE Distinctive feature: Medial vitta 1 1 4 4 3 3 2 2 Bactrocera atrisetosa (see page 135) 1 – medial vitta 2 – markings can be reduced to black spot on T5 or no marking 3 – 4 sc bristles 4 – sa & prsc bristles - similar to B. cucumis (Qld, NT, NSW, p. 150) but sa and prsc bristles present Bactrocera cucumis (see page 150) 1 – medial vitta 2 – black spot 3 – 4 sc bristles 4 – sa & prsc bristles absent - similar to the exotic B. atrisetosa (Exotic, p. 135) but no sa or prsc bristles 29 2 1 5 3 4 Bactrocera cucurbitae (see page 153) Bactrocera depressa (see page 163) 1 – medial vitta 2 – Semi-circle on end of wing 3 – Infuscation dm-cu vein 4 – T shape 5 – 2 sc bristles - similar to B. chorista (E. Qld, Cue) except more golden instead of orange, only 2 sc bristles instead of 4, more distinct spot on end of wing, narrower vittae, less black markings on scutum and less heavy wrap T on abdomen. 30 1 2 3 Bactrocera tau (see page 216) Bactrocera minax (see page 192) 1 – lateral and medial vitta present 2 – apical spot at end of wing 3 – yellow scutellum with 4 scutellar bristles NB. This species is similar to Bactrocera cucurbitae (Exotic, Cue, p. 126) but lacks the pale infuscation along r-m crossvein and has four scutellar bristles instead of two 2 1 3 Bactrocera tsuneonis (see page 231) Bactrocera decipiens (see page 160) 1 – medial vitta 2 – large S shape marking on wing 3 – scutum red-brown to black - usually larger fly with distinctive wing pattern 31 Bactrocera xanthodes (see page 238) 32 TEPHRITIDAE: DACINAE Distinctive feature: Other wing pattern 1 2 Bactrocera umbrosa (see page 235) 1 - black mesonotum 2 - three obvious bands across wing Note: abdomen can vary on this species, often with longer medial line and dark markings on tergite 3 at edges. 33 THIS PAGE IS INTENTIONALLY BLANK 34 TEPHRITIDAE: DACINAE Dacus spp. Dacus longicornis (see page 250) Dacus solomonensis (see page 252) 35 TEPHRITIDAE: DACINAE Ceratitis spp. Ceratitis capitata (see page 244) Ceratitis rosa (see page 247) 36 TEPHRITIDAE: TRYPETINAE Dirioxa pornia (see page 254) 37 THIS PAGE IS INTENTIONALLY BLANK 38 TEPHRITIDAE: TRYPETINAE Rhagoletis spp. Rhagoletis cingulata (see page 258) Rhagoletis completa (see page 260) Rhagoletis fausta (see page 262) Rhagoletis indifferens (see page 264) 39 Rhagoletis mendax (see page 266) Rhagoletis cerasi (see page 256) Rhagoletis pomonella (see page 268) 40 TEPHRITIDAE: TRYPETINAE Anastrepha spp. Anastrepha fraterculus Anastrepha distincta Anastrepha grandis (see page 106) (see page 102) (see page 109) Anastrepha ludens Anastrepha obliqua Anastrepha serpentina (see page 112) (see page 115) (see page 118) Anastrepha striata Anastrepha suspensa (see page121) (see page 123) 41 THIS PAGE IS INTENTIONALLY BLANK 42 DROSOPHILIDAE Drosophila suzukii (see page 270) 43 4 Introduction Fruit flies are one of the world’s most destructive horticultural pests and pose risks to most commercial fruit and vegetable crops. This has major implications for the sustainable production and market access of Australia’s $4.8 billion horticultural industry. Worldwide there are some 4,000 species of fruit flies in the family Tephritidae of which around 350 species are of economic importance. More than 280 species of fruit fly occur in Australia although only a few of these have been found to have any degree of economic impact, with Queensland fruit fly and Mediterranean fruit fly being the species of economic concern. It is therefore important to be able to distinguish between those endemic species that pose a threat to production and domestic market access from those that do not. Furthermore, Australia is free from many species that impact production elsewhere. Neighbouring countries in Southeast Asia and the South Pacific are home to numerous species of fruit fly that pose an immediate incursion risk to Australian quarantine. Rapid diagnosis of these flies, should they arrive in Australia, is therefore a critical prerequisite to containing and eradicating the populations before they establish. Although a range of diagnostic methods are available that can be undertaken by a number of laboratories in Australia, there has not been an established agreement on (a) the number and type of tests that should be conducted to establish a positive identification, (b) the exact protocols that should be followed for specific diagnostic tests, and (c) agreement on the number and type of protocols that should be retained and maintained to facilitate a diagnosis at short notice. This project was therefore undertaken to establish an agreed national standard that is able to facilitate rapid diagnosis and streamline a national response when suspected incursions occur, and to include taxonomic identifications using morphological and molecular approaches. Plant Health Australia (PHA) would like to acknowledge the support, encouragement and professional advice contributed by all participants to this process. Background Australia has a strong, internationally recognised capacity to diagnose fruit fly species and maintains a wide network of fruit fly traps as part of a national surveillance system. From the Northern Territory and the Torres Strait Islands to Tasmania, and from Perth to Melbourne, significant expertise is maintained in state and federal government departments, universities and in the private sector to support the identification of fruit fly species. Supported by an extensive world-class fruit fly collection (albeit split across various interstate locations), Australia is fortunate to have a group of entomologists and other scientists with extensive experience and knowledge of fruit fly diagnostics. Not surprisingly, given the range of endemic and exotic fruit flies that can be encountered in different climatic zones, many jurisdictions have developed specialist expertise to identify species pertinent to regional production and quarantine requirements. Against this background, this project was undertaken to establish a diagnostic procedure that has a national focus and can assist all stakeholders to maintain the strongest capability to identify fruit flies. 44 This project also provides an opportunity to: collate current (existing) practices and knowledge base into a single document pool experience from all of Australia’s experts in a collegiate manner facilitate and improve the constructive exchange of ideas and material across jurisdictions and entities establish a resource that can support and develop the confidence and expertise of all users provide a mechanism to possibly identify future information and research needs, and consider the potential of both morphological and molecular techniques as they are developed and become available Coverage of this diagnostic handbook To develop this document, a review was firstly conducted to establish those fruit fly species being targeted by jurisdictions in their current surveillance programs. These species were also reviewed against diagnostic tools (e.g. electronic and internet keys) already available and in use to support routine diagnosis. This review, supported by a diagnosticics workshop in 2015, enabled the development of a revised species list to be covered by this publication (Table 1). 45 Table 1. Fruit flies covered in this diagnostic handbook Scientific name1 Common name Exotic Anastrepha distincta Anastrepha fraterculus2 South American fruit fly Exotic Exotic Anastrepha grandis Anastrepha ludens Mexican fruit fly Exotic Anastrepha obliqua West Indian fruit fly Exotic Anastrepha serpentina Sapote fruit fly Exotic Anastrepha striata Guava fruit fly Exotic Anastrepha suspensa Caribbean fruit fly Exotic Exotic Bactrocera albistrigata Bactrocera aquilonis3 Northern Territory fruit fly Present in Australia Bactrocera atrisetosa Exotic Bactrocera bryoniae Present in Australia Bactrocera carambolae Carambola fruit fly Exotic Exotic Bactrocera caryeae Bactrocera correcta Guava fruit fly Exotic Bactrocera cucumis Cucumber fruit fly Present in Australia Melon fly Exotic Bactrocera cucurbitae4 Exotic Bactrocera curvipennis Bactrocera decipiens Pumpkin fruit fly Exotic Bactrocera depressa4 Pumpkin fruit Fly Exotic Oriental fruit fly Exotic Bactrocera dorsalis s.s.5 Exotic Bactrocera facialis Bactrocera frauenfeldi6 Bactrocera jarvisi Mango fruit fly Present in Australia Jarvis's fruit fly Present in Australia Bactrocera kandiensis Exotic Bactrocera kirki Exotic Bactrocera kraussi Krauss’s fruit fly Present in Australia Bactrocera latifrons Solanum fruit fly Exotic Bactrocera melanotus Exotic Bactrocera minax Exotic Note: others that belong to species complexes, but which there is only one representative for in this handbook are: B. bryoniae (7 species) B trivialis (8 species) B. musae (17 species) B. tau (21 species) C. rosa (3 species) 1 Note: This is now accepted as a complex of species that are only recognised as morphotypes and some at least as distinct biological entities, but none described per se with names. Morphological and molecular identifications can only be down to the level of the complex. 2 3 Belongs to a species complex of which two others are listed in this table: tryoni and neohumeralis. Zeugodacus has been elevated from sub-generic rank (under genus Bactrocera) to full generic status based on molecular genetic data (Virgilio et al. 2015). This is yet to be widely accepted by the scientific community. 4 Includes B. papayae, philippinensis and invadens since their synonymisation with dorsalis sensu stricto as per Schutze et al. (2015) in Systematic Entomology. This is a taxonomic update of the previous list as opposed to an omission of these species. 5 6 Bactrocera frauenfeldi belongs to a complex of five species, including B. albistrigata and B. trilineola. 46 Scientific name1 Common name Bactrocera musae Banana fruit fly Present in Australia Bactrocera neohumeralis Lesser Queensland fruit fly Present in Australia Bactrocera obliqua Exotic Bactrocera occipitalis Exotic Bactrocera oleae Olive fruit fly Exotic Bactrocera passiflorae Fijian fruit fly Exotic Bactrocera psidii South sea guava fruit fly Exotic Exotic Bactrocera pyrifoliae Bactrocera Exotic tau4 Bactrocera trilineola Exotic Bactrocera trivialis Exotic Bactrocera tryoni7 Queensland fruit fly Bactrocera tsuneonis Exotic Bactrocera tuberculata Exotic Bactrocera umbrosa Breadfruit fruit fly Exotic Bactrocera xanthodes Pacific fruit fly Exotic Bactrocera zonata Peach fruit fly Exotic Ceratitis capitata Mediterranean fruit fly Present in Australia Ceratitis rosa Natal fruit fly Exotic Dacus longicornis Exotic Dacus solomonensis Exotic Dirioxa pornia Drosophila suzukii8 Island fly Present in Australia Spotted-wing drosophila Exotic Exotic Rhagoletis cerasi Rhagoletis Exotic cingulata9 Rhagoletis completa Walnut husk fly Exotic Rhagoletis fausta Black cherry fruit fly Exotic Rhagoletis indifferens Western cherry fruit fly Exotic Exotic Rhagoletis mendax Rhagoletis 7 Present in Australia pomonella10 Apple maggot Exotic Belongs to a species complex of which two others are listed in this table: aquilonis and neohumeralis A vinegar fly that belongs to the Drosophilidae family. Drosophila flies are sometimes called fruit flies, however, true fruit flies belong to the family Tephritidae 8 9 Belongs to a species complex which also includes R. indifferens 10 Belongs to a species complex which also includes R. mendax 47 5 Detection Plant products affected Fruit flies can infest a wide range of commercial and native fruits and vegetables. Lists of hosts are provided in the data sheets contained in Section 8. Fruit is increasingly likely to be attacked as it becomes more mature and as fruit fly populations increase during summer and autumn. A wide range of fruits are potentially vulnerable to fruit fly attack. In urban home gardens, and in orchards close to urban areas, fruit fly populations are often much higher than in outlying orchards. Plant parts liable to carry the pest in trade or transport include fruiting bodies, in which eggs or larvae can be borne internally. The illegal movement or smuggling of non-commercially produced fruit is the major risk pathway for exotic fruit fly incursions (CABI 2007). Signs and symptoms The oviposition-site punctures in the fruit are commonly referred to as ‘stings’. Stings are usually identified by making a shallow cut through the skin of the fruit and looking for the egg cavity containing eggs, larvae or the remains of hatched eggs. In fruits such as peaches, the stings are not very noticeable, while in pale, smooth-skinned fruits, the sting mark may be easily detected and can disfigure the fruit when marked by ‘gum bleed’. Some fruits, such as avocado and passionfruit, develop hard, thickened areas where they are stung. In mature citrus, the sting mark may be a small brown depressed spot, or have an indistinct, bruised appearance, while on green citrus fruit the skin colours prematurely around the sting mark. In humid conditions, the fungi responsible for green mould in citrus and brown rot in stone fruit will readily infect stung fruit. Fruit will fall from the tree as a result of larval infestation. The extent of the damage caused by larvae tunnelling through fruit varies with the type and maturity of the fruit, the number of larvae in it, and the prevailing weather conditions. Larvae burrow towards the centre in most fruits, with internal decay usually developing quickly in soft fruits. In hard fruit a network of channelling is usually seen, followed by internal decay. Larval development can be very slow in hard fruits such as Granny Smith apples. Development stages The following life history, from McKenzie et al. (2004), is based on the much-studied Queensland fruit fly. This is also relevant to most other fruit flies, although differences may occur with regard to host preference and the relationship between developmental rate and temperature. Typically, fruit flies lay their eggs in semi-mature and ripe fruit. The female fruit fly has a retractable, sharp egg-laying appendage (the ovipositor) at the tip of the abdomen that is used to insert up to six eggs into a small chamber about 3 mm under the fruit skin. Tephritid fruit fly eggs are white, banana shaped and nearly 1 mm long. Infested fruit may show ‘sting’ marks on the skin and may be stung more than once by several females. In two or three days larvae (maggots) hatch from the eggs and burrow through the fruit. To the naked eye, the larvae resemble blowfly maggots. They are creamy white, legless, blunt-ended at the rear and tapered towards the front where black mouth hooks (cephalopharyngeal skeleton) are often visible. Female flies may have an association with bacteria resident in their gut in some regions of Australia, which they regurgitate onto the fruit before ovipositing (see Appendix 5). Most of the damage sustained by the fruit is caused by the bacteria and the maggots simply lap up the juice. 48 A pair of mouth hooks allows the larvae to readily tear the fruit flesh. The larvae develop through three larval stages to become about 9 mm long and pale yellow when fully grown. Several larvae can develop in each fruit, and when fully developed they leave the fruit, falling to the soil beneath the tree and burrowing down about 5 cm to form a hard, brown, barrel-like pupal case from its own skin where it completes its development. Many flies leave the fruit while it is on the ground. Most insects cannot pupate successfully in the presence of excess moisture and fruit flies have a prepupal stage when they can 'flick' themselves over some distance, presumably to distance themselves from the host fruit or predators. The duration of pupal developmental is dependent on temperature with each stage taking from nine days to several weeks to complete. Adult flies emerge from their pupal cases in the soil and burrow towards the surface where they inflate their wings and fly away. Adults are able to mate within a week of emerging, living for many weeks with females continuing to lay eggs throughout their lifecycle. Adult fruit flies feed on carbohydrates from sources such as damaged fruit and honeydew, the sweet secretion from aphids and scale insects, as well as natural protein sources, including bird droppings and bacteria. Fruit fly larvae can be attacked by parasitoids although they appear to have little impact on populations of most fruit flies, with 0-30% levels of parasitism typical (CABI 2015). However, mortality due to vertebrate consumption of infested fruit can be very high, as can pupal mortality in the soil, either due to predation or environmental factors. Methods for detection Monitoring is carried out largely by setting traps in areas of interest. However, there is evidence that some fruit flies have different host preferences in different parts of their range (CABI 2015). As such, host fruit surveys may be required in the event of an exotic incursion. Where known, specific lures are provided for each species in the data sheets contained in Section 8. The following information and images are taken from Lawson et al. (2003). 5.4.1 Trap types All traps are designed to lure flies into a container, kill them and retain the dead flies in some manner. Traps should not touch foliage as ants may remove dead flies if an easy pathway is available. Foliage and twigs in the immediate area of the trap should be checked and pruned regularly. Spiders may also set up residence in or on traps and remove dead flies. It may be necessary to apply sticky coating such as Tanglefoot to the wire or string on which the trap is suspended to minimise fly predation or removal. All traps are hung by wire or string in shady host trees. DRY TRAPS Lynfield, Steiner and Paton traps are all ‘dry traps’ used with male attractants (cue-lure, methyl eugenol (ME) or capilure). They have a cotton dental wick impregnated with a lure and insecticide mix hung inside the trap body. The cotton dental wicks are inexpensive, provide absorption of the attractant and insecticide mix, yet still allow evaporation of the lure over relatively long periods. These traps have small holes in the bottom for drainage. Cone traps are new dry traps that normally are used with a male lure sachet. Usually information labels are placed on the outside of the trap body (Poison, lure type and contact info). 5.4.1.1 Lynfield Trap The Lynfield trap (see Figure 1a) is a pot type trap that has been in use since about 1990. It consists of a modified clear plastic container, e.g. a 1 litre container with a 100 mm base, a 90 mm diameter 49 top and depth 115 mm. There are four entry holes 25 mm in diameter evenly spaced 15 mm below the lip of the trap. Cowley et al. (1990) claimed the Lynfield trap was cheap and extremely easy to operate and inspect, compared to the Jackson sticky trap and that surveillance costs could be halved using the same density of Lynfield versus Jackson traps. The Lynfield trap is the standard trap for south eastern Australia and is the only trap type mentioned in the Code of Practice for the Management of Queensland fruit fly (Anon. 1996). 5.4.1.2 Steiner trap The Steiner trap (see Figure 1b) is an open horizontal plastic cylinder. It has openings at each end of the trap for entry of flies and to allow free movement of the attractant vapour from the cotton wick. The modified Steiner trap has ingress tubes to prevent rain getting in and flies escaping, with mesh halfway across the entry to prevent dead flies falling out. Steiner traps are used in areas of high rainfall such as far north Queensland. This design may be less effective than Jackson sticky traps in some circumstances in southern Australia (O’Loughlin et al. 1983). 5.4.1.3 Paton trap The Paton trap (see Figure 1c) is used in areas of high rainfall or wind or where traps may be set for longer periods (e.g. a month) between collections. Generally, they are used on Cape York Peninsula and the Torres Strait Islands in Queensland. They are very rain resistant, prevent flies falling out in windy situations and are able to hold about 10 000 flies (where the Steiner trap can only hold about 6 000). They often are used with cardboard spacers to maintain the samples in good condition. 5.4.1.4 Cone trap The cone trap (Figure 1e) was recently developed in Spain and has several design advantages. The ingress holes are short tunnels (similar to Steiners and Patons) rather than plain holes as found in Lynfield traps. The base of the cone trap is yellow which may be attractive to some species. Cone traps have a trap door in the bottom of the trap to facilitate removal of dead flies. Initial Australian research has demonstrated that cone traps are as effective, if not more so, at trapping fruit flies compared with Lynfield traps (pers. comm. Dominiak 2015 and Royer 2015) and work is underway comparing Steiner traps with cone traps (pers. comm. Royer 2015). This research will be published in the immediate future. WET TRAPS 5.4.1.5 MCPhail trap The McPhail trap (see Figure 1d) is a plastic flask-shaped container with an invaginated entrance at the base. It is generally used with liquid lures such as orange ammonia, proteinaceous solutions and fruit juices, which attract and kill both males and females by drowning them. They can also be used with solid lures suspended from the lid (e.g. cucumber volatile lure) and a propylene glycol solution for drowning flies (Royer et al. 2014). McPhails attract flies in far fewer numbers than male lure traps due to the short range of lure attraction (Dominiak and Nicol 2010). However, they are useful in trapping species that do not respond to male lures. They need to be cleared regularly to avoid deterioration of the specimens and attractant liquids need to be replaced at least weekly making these traps time consuming and messy to service. These traps may also be used with suspended male lures (e.g. cue-lure or ME) and propylene glycol when fresh specimens are required for DNA sequencing. Specimens are then transferred to absolute ethanol. 50 STICKY TRAPS 5.4.1.6 Jackson Trap The Jackson trap is a delta trap with a sticky base insert (Fig. 1f). Usually these traps are made from stiffened cardboard or plastic. A robust version was made from galvanised metal with a metal sliding base for easy removal. Sticky bases are sent to identification centres and flies identified either on the base or removed with a glue dissolver (e.g. Orange Power). Sticky bases can cause problems in transport and when trying to remove flies from the glue for identification and are therefore not ideal when good specimens are required. The Jackson trap was demonstrated to be more effective than other trap designs in the 1980s (O’Loughlin et al. 1983) and was a standard trap until the design of the Lynfield trap (Cowley 1990). They appear to have been withdrawn from use in the early 1990s as it took about four times as long to service compared with dry traps. Figure 1. Types of fruit fly traps (a) Lynfield trap (Image courtesy of NSW I&I) (b) Steiner trap (c) Paton trap (Image courtesy of AQIS) (d) McPhail trap 51 (e) Cone trap 5.4.2 (f) Jackson trap (Image courtesy of Western Australian Agriculture Authority) Attractants Attractants or lures are commonly used to trap fruit flies as they provide an easy way to collect large numbers of flies in a short period of time. Food-based attractants, such as those used in McPhail traps, were widely used in the past. These are still in use today as they offer the advantage of attracting both sexes of many species, including those not attracted to male lures. Males of many species respond to male attractants, which attract flies from large distances. Many species of Dacini are attracted to either cue-lure or methyl eugenol, however, many species have no known male lure attraction. There has been recent work on male lures expanding the range of attractants available for trapping. The different male lures are: Methyl eugenol (ME) (Figure 2b) - widely used in collecting Bactrocera and Dacus spp. fruit flies The ‘cue-group’ (Figure 2a) - cue-lure, raspberry ketone and raspberry ketone formate all are similar in structure and range of species attracted and are referred to as the ‘cue-group’. These male attractants are widely used in collecting Bactrocera and Dacus spp. fruit flies with cue-lure being the most widely used. o Raspberry ketone (or Willison’s lure) - one of the breakdown products of cue-lure and is itself an attractant (Metcalf et al. 1983) attracting the same range of species as cuelure but not as strongly. o Raspberry ketone formate or Melolure attracts cue-responsive species and is a stronger attractant to some species than cue-lure e.g. B. cucurbitae, B. tryoni ([Casana-Giner et al. 2003, Royer 2015], Dominiak et al. 2015a) but less attractive to others (e.g. B. neohumeralis [Royer 2015]). Zingerone - a relatively new male attractant which was found to be highly attractive to the Australian pest species B. jarvisi (Tan & Nishida 2000, Fay 2012) and attracts several species that do not respond to cue-lure or ME in addition to some cue and ME-responsive species (Fay 2012, Royer 2015, Dominiak et al. 2015b). Capilure – widely used for trapping Ceratitis spp. 52 A newer lure Isoeugenol has been found to be more attractive to the cue-responsive pest B. kraussi than cue-lure, as well as attracting several species thought to be non-responsive to male lures such as B. halfordiae (Royer 2015). Cue-lure, ME and capilure are used in Lynfield and Steiner traps, while only cue-lure and ME are used in Paton traps in Australia (because these traps are used in the tropics and Ceratitis spp. has a lower likelihood of establishing there). Figure 2. Chemical structure of cue lure and methyl eugenol. (a) Cue lure (b) Methyl eugenol Male attractants are generally highly volatile chemicals and need only to be used in small amounts to be effective. Methyl eugenol needs to be replaced every 3-4 months while cue lure can remain effective in traps for six months. Generally, a wick is impregnated with a mixture of 4 mL attractant and 1 mL or less of 50% w/v concentrate of malathion or dichlorvos and is then suspended within the trap. It is very important that lure or wick contamination does not occur during the setup process, from when the wicks are prepared through to when the traps are emptied. If this occurs, then some flies that are attracted to one lure may also end up in traps containing flies attracted to another. This can lead to confusion if the lure compound to which they are attracted is also used as part of the diagnostic identification process. Some flies attracted to methyl eugenol are repelled by cue lure: contamination of these lures may lead to a failure to detect methyl eugenol attracted flies. 53 6 Inspection of material, sample preparation and storage This section was modified/extended by Jane Royer, Mark Blacket, Matt Krosch and Karen Armstrong. Infested fruit Fruits (locally grown or samples of fruit imports) should be inspected for puncture marks and any associated necrosis. Suspect fruits should be cut open and checked for larvae. If immature stages are being raised to adults, infested fruit should be held in a container which has a gauze cover to allow aeration (See Appendix 1. Rearing fruit fly larvae to adults for the purpose of identification). The detection of small larvae can be difficult using the slicing technique. Sample collection and handling Fruit fly adults, larvae and eggs should never be handled live if there is any chance of the sample being involved with a quarantine breach. For the purposes of this protocol, all fruit fly samples, where the fruit fly adult, larva or egg has been removed from its substrate, should be placed in a sealed vial or container and be suitably preserved (see below). The sample vial should have labels stating the collection details including (at a minimum) the collector, collection date, host (if known), place of collection and where possible accession number(s). Fruit flies for molecular analysis need to be ‘repacked’ for that purpose, e.g. either as legs removed or whole specimens dry (with silica pouches or frozen) or in preservative. Sample transportation Samples should be collected and despatched in a manner compliant with PLANTPLAN (with particular reference to sampling procedures and protocols for confirmation). If any live material is to be transported, appropriate control measures must be employed – including double sealing samples to ensure quarantine-control is maintained – before placing in (the third level of containment) the postal packaging prior to dispatch (Hall 2011). Postal transport of more than 30 ml of ethanol may require special conditions (Hall 2011). Appropriately packed volumes of ethanol less than 30 ml are permitted to be posted within Australia under “Special Provision A180”, (http://www.casa.gov.au/scripts/nc.dll?WCMS:STANDARD:1001:pc=PC_100324). Sample processing, identification and preservation When samples are delivered to the reception area of a laboratory, the sample and relevant information should be recorded in a log to ensure they are not lost is subsequent processes. If they become lost, the loss will be detected and investigated. Upon delivery to the identification area, sample numbers and their contents should be recorded to ensure the samples sent from the field match the samples received. This information will be important for audits of laboratory processes and procedures. Identifications should be conducted using standard identification keys and texts. Part of the recording should be the identifier’s name and keys used to conduct the identification. These fruit fly identifications need to be matched with the data sent from the field by monitoring staff. Misidentification or attributing identifications to the wrong location or time could have market access implications. If the organisation has a paper based system, this information needs to be sent by email 54 or fax to the surveillance staff on the same day as identifications are completed. If the organisation has an electronic system, identification staff need to find the appropriate electronic surveillance entries and match the date and location with field records sent with the samples and update the electronic records. Electronic systems frequently have a reporting protocol, often the following day. This reporting step completes the full circle for the sample being physically detected in the field to the paper or electronic report on species identification returned to field staff and managers. All steps should be able to be audited and audits should be conducted at least annually. Where inconsistencies or errors are detected, a corrective action report should be issued and processes improved. If samples are to be retained in the laboratory, samples should be assigned an accession number and stored appropriately. Laboratory reared adult specimens are usually preserved as dried pinned reference specimens (e.g. Mantel & Upton 2010), while bulk field-caught (trap sample) adults are usually initially preserved using the other options listed in Table 2. If an adult fly sample is to be preserved for morphological identification, it should be kept dry in a suitably labelled clean container (as above). Adult specimens are commonly stored for pinning by freezing which doesn’t adversely affect the morphology of the specimen (e.g. Mantel & Upton 2010), or greatly affect the DNA yield (e.g. Dean and Ballard 2001). Do not store specimens for morphological identification in ethanol/alcohol/propylene glycol. They leach diagnostic colours and patterns necessary for identification. The key to maintaining good DNA for molecular analyses is to protect the tissues from moisture. Once removed from the substrate, samples from separate traps or pieces of fruit should be placed in separate sealed vials and preserved dehydrated by air drying (adults only, not recommended for humid climates) or freezing, or with the preservatives ethanol (95-100%) or propylene glycol. Note: If adults are to be used for morphological identification as well as molecular identification, they should not be placed in preservative but maintained dry to retain colour (see Section 0) Live larvae need to be placed directly into boiling water for fixing prior to preservation. 6.4.1 Molecular Specimens If a sample is being preserved for molecular identification it is important that suitable preservation methods are applied as soon as possible (Table 2). Moisture is known to damage DNA – a high concentration of alcohol, propylene glycol or freezing are suitable ways of preventing DNA degradation. Generally DNA yields are reduced as specimens age (e.g. Dean and Ballard 2001). However, all of the preservatives outlined below appear more effective when combined with low temperature (i.e. refrigeration or freezing), increasing the preservative effect (e.g. Moreau et al. 2013). Cross-contamination could be a potential issue when storing multi-species specimens in bulk, care must be taken with some types of samples (e.g. dry-frozen adult flies) that the sample used for molecular testing (e.g. leg) is from that actual specimen. Freezing: Adult specimens are commonly frozen (-20oC or -80oC) to preserve them. This is a good way to maintain DNA quality and retain a useful morphological specimen (see alcohol note below). Freezing however can be of limited use when collecting in the field. Alcohol: Highly concentrated ethanol (95-100%) is commonly employed to preserve specimens for molecular testing (all lifestages). However, please note that adult flies preserved in ethanol lose their colours over time (i.e. losing morphologically diagnostic information). Isopropanol is also sometimes 55 employed as a preservative (e.g. for midges); while other forms of alcohol, such as methylated spirits are not suitable for DNA preservation. Larval specimens are commonly blanched in hot water prior to preservation (to aid morphological identification), this practice does not seem to adversely affect DNA quality. DNA appears to degrade over time when specimens are stored in a lower concentration of ethanol (<80%), commonly employed for morphological preservation. Propylene Glycol: Adult material collected from traps is commonly collected into propylene glycol (e.g. Vink et al. 2005, Moreau et al. 2013), especially in the tropics. Propylene glycol does not evaporate (unlike ethanol) and can thus be used both for wet trapping and for subsequent preservation of specimens (e.g. Moreau et al. 2013). An additional advantage of propylene glycol is that it is non-flammable making transportation of samples easier (e.g. Moreau et al. 2013). RNAlater: This solution can be used to preserve not only the DNA but also the RNA (e.g. Vink et al. 2005). Overall, it appears that DNA yield might be reduced in RNAlater preserved material compared with ethanol or propylene glycol preservation (Moreau et al. 2013), although for some specimens RNAlater appears equally effective (e.g. Vink et al. 2005). Preservation of RNA is critical for transcriptome-based applications such as differential expression analysis and candidate gene discovery. RNAlater is not an economical option for large bulk samples and is best used to store small numbers of conspecific specimens. Critically, RNA degrades much more rapidly than DNA, thus any trapping design intended to capture RNA profiles from specimens needs to minimise the time between a specimen entering a trap and preservation. FTA cards: These can be used for preserving DNA from larval samples, and these have been shown to be suitable for use under tropical conditions (e.g. Blacket et al. 2015 a). Please note that material preserved this way does not retain any morphological characters. Table 2. Commonly employed sample preservation techniques for molecular identification. Methods that are suitable for a particular lifestage are indicated by “+”, those that are less suitable are indicated by a “–“. Dry-ambient Dry-freezing >95% Ethanol Propylene Glycol RNA later Adults -* + + + + Larvae - - + + Pupae - + + + Eggs - - + + FTA card + * Storage of dry adults (e.g. trap samples) short-term at ambient temperatures is often employed until one of the more effective preservation methods is used; wet adults stored at ambient temperature rapidly degrade (both morphologically and molecularly). 56 7 Identification Overview The National Handbook for the Identification of Fruit Flies in Australia (overview presented in Figure 3 and Figure 4) proposes that primary identification is undertaken using conventional taxonomy with the support of molecular genetic techniques for some species or immature stages. The diagnostic methods available for each species are presented in Table 3 and covered in greater detail in sections 7.2 (Morphological), 7.3 (Molecular) and Section 8 (data sheets with the specific morphological and molecular diagnostic information for each species). These techniques are currently in use in Australia and form the basis of this national protocol. Tephritid fruit fly adult specimens are primarily identified through an examination of diagnostic morphological characters. Other life stages are more problematic, with only third instar larvae (and sometimes pupae) of some species usually identified through visual examination (e.g. White & ElsonHarris 1992). Identification of earlier life stages (early instars, eggs), and adults of morphologically ambiguous species, generally requires the use of molecular techniques. Molecular techniques are best used to support or augment morphological identification. They can be used to identify early larval stages (which are hard to identify reliably on morphological features) and eggs. They also can be used for incomplete adults that may be missing specific anatomical features required for morphological keys, or specimens that have not fully developed their features (especially colour patterns). It should be recognised, however, that the success of a molecular diagnosis can be impacted by factors such as life stage, specimen quality or any delays in processing. As a result, the suitability of each method has been identified (See Section 7). The molecular protocols require a laboratory to be set up for molecular diagnostics, but can be conducted by almost any laboratory so equipped. Access to on-line published sequences is required for the DNA barcoding protocol. Most molecular techniques presented in this standard involve the amplification of particular region(s) of the fly genome using a polymerase chain reaction (PCR), while the other technique covered (allozymes) examines protein variation. The PCR target is either the mitochondrial gene for cytochrome oxidase subunit I (COI), known as the DNA barcode region, or a region of the ribosomal RNA operon, either just the first internal transcribed spacer (ITS1) or part of the 18S subunit plus the ITS1. DNA barcoding is now available in this manual as an alternative to the original ITS-based techniques. This technology, in contrast, incorporates population variation and has an international, independently growing reference dataset. However, difficulties can still arise among closely related species within species complexes. For the ITS1, the size of the PCR amplicon is useful for identification of a few species. However, restriction digestion of the ITS1 PCR amplicon, which denotes the actual sequence in defined regions of the amplicon, is recommended for all analyses as a more robust method of identification. This is referred to as restriction fragment length polymorphisms (RFLP) analysis. Reference data has been developed for the economically important species. However, the RFLP does not necessarily eliminate non-economic fruit flies for which reference data have not been developed. This national protocol is presented on the premise that most species can generally be resolved using traditional taxonomy without ambiguity. The molecular methods described here are recommended for use alongside morphological methods where there is any ambiguity; although they may be equally ambiguous in the case of species complexes. They can be used on their own for morphologically cryptic immature life stages, or when only part of a specimen is available, or when access to the appropriate taxonomic expertise is lacking. 57 Figure 3. Overview of fruit fly diagnostic procedures (adult specimens). 58 Figure 4. Overview of fruit fly diagnostic procedures (larval specimens). 59 Table 3. Diagnostic methods used to identify fruit fly species Scientific name Morphological description Anastrepha fraterculus PCRRFLP1 PCRRFLP 2 PCR- DNA Barcoding4 49/141e* 0/27e* Anastrepha distincta 3/35 b 68/174e* 52/133e* Anastrepha serpentina 8/52* Anastrepha striata 18/59 Anastrepha suspensa b 5/76e* Bactrocera albistrigata Bactrocera aquilonis a Bactrocera atrisetosa Bactrocera bryoniae Bactrocera carambolae Bactrocera caryeae 1/1g Bactrocera correcta 54/54 Bactrocera cucumis 2/11 Bactrocera cucurbitae 244/289* Bactrocera curvipennis 2/2 Bactrocera decipiens Bactrocera depressa Bactrocera dorsalis s.s. 12 >1000/1000g Bactrocera facialis 1/1 Bactrocera frauenfeldi d 2/16 Bactrocera jarvisi 3/7 Bactrocera kandiensis Bactrocera kirki13 Anastrepha grandis Anastrepha ludens Anastrepha obliqua Bactrocera kraussi 11 Allozyme qPCR11 electrophoresis 24/24 c 3/38f 1/11 110/111 17/17g d,3 5/5 3/3 Real-time PCR Includes B. papayae, philippinensis and invadens since their synonymisation with dorsalis sensu stricto as per Schutze et al. (2015). This is a taxonomic update of the previous list as opposed to an omission of these species. 12 13 B. kirki can be distinguished from B. frauenfeldi and B. trilineola using an additional enzyme Acc I 60 Scientific name Morphological description PCRRFLP1 PCRRFLP 2 PCR- DNA Barcoding4 Bactrocera latifrons 82/86 Bactrocera melanotus 3/3 Allozyme qPCR11 electrophoresis 58/58 Bactrocera minax Bactrocera musae14 21/255 Bactrocera neohumeralis a c 2/4f Bactrocera obliqua Bactrocera occipitalis Bactrocera oleae Bactrocera passiflorae Bactrocera psidii 31/34g 109/114 0/1 2/2 Bactrocera pyrifoliae 85/100* Bactrocera tau Bactrocera trilineola d 21/21 Bactrocera trivialis 3/3 Bactrocera tryoni c 48/55f a Bactrocera tsuneonis 21/21 Bactrocera tuberculata 5/5 Bactrocera umbrosa 39/39 Bactrocera xanthodes 6/7 Bactrocera zonata 36/61 Ceratitis capitata 208/292 Ceratitis rosa 46/50* 2/2 Dacus longicornis Dacus solomonensis Dirioxa pornia 3/3 The 17 species within the B. musae complex (Drew et al. 2011) have not been tested by the RFLP method, but DNA barcodes will distinguish B. musae s.s. from at least the non-pest species B. conterminal, B. prolixa, B. rufivitta, and B. tinomiscii; adults of all species can be distinguished morphologically, see section 7.2. 14 61 Scientific name Morphological description PCRRFLP1 PCRRFLP 2 PCR- DNA Barcoding4 24/29 Rhagoletis cingulata Rhagoletis completa Rhagoletis fausta Rhagoletis indifferens 21/21* 1/1 Rhagoletis mendax 2/2h Rhagoletis cerasi 17/29 Rhagoletis pomonella Allozyme qPCR11 electrophoresis 23/24h 1 Species with the same superscript letter cannot be distinguished from each other with this test. 2 This test is best used when the unknown samples may be suspected as one for which the PCR-RFLP test 1 has not been developed; all RFLP patterns available in Armstrong & Cameron (1998) are listed in Appendices 3 and 4, and includes other species not listed in this table, A. bistrigata, A. sorocula, A. zenildae and B. quadriestosa. 3 Numbers in brackets (x/y) refer to the x number of individuals of that species with publically accessible DNA (COI) barcodes on the Barcode of Life (BOLD) website and y number of total sequences available if using the BOLD identification engine; the difference represents private barcodes unavailable for download (www.boldsystems.org/views/taxbrowser.php?taxid=439) as of 18th September 2015. Where there are no specific DNA barcodes available, others for other species within the genus could be used to at least determine genus-level identification; as of 18th September 2015, there are 203 species of Bactrocera, 66 of Ceratitis, 82 of Dacus, 28 species of Rhagoletis and 1 of Toxotrypana that have barcodes available. Species with the same superscript letter cannot be distinguished from each other with DNA barcodes, or can only be identified to the level of a species complex. Species with * are not well resolved amongst a number of other species in BOLD, although low divergence clades may be apparent. Used in conjunction with other information about the specimen this may still be sufficient to make a confident identification. Complimentary identification by ITS1 PCR-RFLP could also be considered. 62 Morphological identification Approximately 90% of the dacine pest species can be identified accurately, and quickly, by microscopic examination of the adult. For these species there is no need for supporting evidence. The remaining 10% (mainly some dorsalis complex species) can be identified with this same method but require expert examination and may require additional supporting evidence such as the molecular diagnosis or host association records. Methods here are updated according to Drew & Romig (2013). Only morphological diagnostic procedures and information for adult fruit flies are contained in this document. Aside from molecular techniques, larval diagnosis has been excluded from this protocol. For routine morphological identification: Collect flies in dry traps. When clearing traps collect samples into a tissue. Put tissue in a small box with collection details on the outside. Samples in tissue can also be collected into a vial though this is less preferred particularly in the tropics as samples can sweat causing specimens to deteriorate. If collecting into vial a pencil or permanent pen label (not biro as it runs) should be put inside as writing on the outside can rub off. Store samples in freezer until ready for identification. Sort dry specimens in a petri dish under a binocular microscope. If keeping specimens after identification store in freezer to prevent deterioration. Do not store specimens in ethanol/alcohol/propylene glycol unless being kept for DNA analysis. They leach diagnostic colours and patterns necessary for morphological identification. For suspect specimens requiring further identification Store the specimen in a small vial with tissue to protect it until ready to pin or ship. Add a pencil or permanent ink label (not biro as it runs) detailing collection location, collection date, collection method, collector, tentative identification and identifier. As manipulating loose specimens with forceps tends to damage them, suspect specimens should ideally be pinned to keep them as intact as possible. If the specimen is a suspect exotic and needs to be shipped to a specialist ASAP they can be sent unpinned in a tube as above. For pinning: Put specimen in relaxing chamber with thymol (to prevent mould growth) for 6-12 hours. Using a micropin, pin through RHS of scutum. Mount micropinned specimen on a pith stage on a pin. Add label to pin. Store pinned specimens in reference collection conditions i.e. 21 OC and 50% RH. SAMPLE PREPARATION 7.2.1.1 Procedure The following apparatus and procedures should be used to prepare the specimen for identification (adapted from QDPIF 2002): Apparatus: Stereoscopic microscope or Stereomicroscope with magnification range of 7X to 35X. Light source 90mm diameter petri dishes 63 Forceps (Inox #4) Preparation procedure: 1) Ensure the workstation is clean and clear of all flies before commencing. 2) Adjust chair height and microscope, and turn on the light source (refer to specific operating procedures for the microscope in use). 3) If applicable, record the lure and trap type or host material in which the specimen was found. 4) Carefully place the fruit fly into a plastic petri dish. If examining more than one fly at once ensure there is a single layer of flies only, with room to move flies from one side of the dish to the other. 5) While looking through the microscope check each fly individually. Manipulate them with the forceps so that diagnostic features are visible. 7.2.2 Identification Key features (Figure 5, Figure 6, Figure 7 and Figure 8) used for the morphological diagnosis of adult fruit flies include: Overall colour and colour patterning Wing morphology and infuscation Presence, shape and colour of thoracic vittae. A vitta is a band or stripe of colour. Presence or absence of various setae, and relative setal size (for Trypetinae). (Note: chaetotaxy, the practice of setal taxonomy, is not as important for Dacinae, i.e Bactrocera and Dacus) Use the morphological diagnostic key and descriptions contained in Section 8 to identify the species of fruit fly under microscopic examination. If identification cannot be made using this diagnostic procedure and/or the specimen is suspected to be of quarantine concern, it should be referred to either a State or National authority (see section 9.1 Key contacts and facilities). If the specimen is identified as an exotic fruit fly, it should be referred to a National Authority within 24 hours and the appropriate National Authority notified as required in PLANTPLAN. 64 Figure 5. Adult morphology; head (top) and wing (bottom) (White and Elson-Harris 1992). ar – arista comp eye – compound eye fc – face flgm 1 – 1st flagellomere fr – frons fr s – frontal setae gn – gena (plural: genae) gn grv – genal groove g ns – genal seta i vt s – inner vertical seta lun – lunule oc – ocellus oc s – ocellar seta o vt s – outer vertical seta orb s – orbital setae pafc – arafacial area ped – pedicel poc s – postocellar seta pocl s – postcular setae ptil fis – ptilinal fissure scp – scape vrt – vertex 65 Figure 6. Adult morphology, Thorax; Dorsal features (White and Elson-Harris 1992). a npl s – anterior notopleural seta hlt – halter or haltere prepst – propisternum a sctl s – apical scutellar seta ial s – intra-alar seta presut area – presutural area a spal s – anterior supra-alar seta kepst – katepisternum a spr – anterior spiracle kepst s – katepisternal seta presut spal s – preutural supraalar seta anatg – anatergite ktg – katatergite anepm – anepimeron npl – notopleuron anepst – anepisternum p npl s – posterior notopleural seta anepst s – upper anepisternal seta b sctl s – basal scutellar seta cx – coax dc s – dorsocentral seta psctl acr s – prescutellar acrostichal seta psut sct – postcutural scutum sbsctl – subscutellum p spal s – posterior supra-alar seta scape – scapula setae p spr – posterior spiracle trn sut – transverse scuture sctl – scutellum pprn lb – postpronotal lobe pprn s – postporontal seta 66 Figure 7. Adult morphology, thorax; lateral features (White and Elson-Harris 1992). See Figure 5 for abbreviations. Figure 8. Adult morphology, abdomen; male with features of typical dacini (left), Female, with extended ovipositor (right) (White and Elson-Harris 1992). acul – aculeus ovsc – oviscape ev ovp sh – eversible ovipositer sheath st – sternites numbered 1-5 in the male and 1-6 in the female tg – tergites where 1+2 are fused to form syntergosternite 1+2, followed by tergites 3-5 in the male and 3-6 in the female 67 Molecular identification Three methods are presented here, all of which can use a common sample storage and handling technique (Section 6), DNA extraction method (Section 7.3.1), and are based on PCR (Polymerase Chain Reaction) analysis. Choice of method: The DNA barcoding method (Section 7.3.2) is generally recommended over the PCRRFLP (restriction fragment length polymorphism) methods (Section 7.3.3) because: (a) DNA barcoding can produce better resolution between species as it utilises variation in the complete sequence amplified. PCR-RFLP is limited to variation at just a few or several 4-6 bp restriction sites within the amplicon, the suite of which are dependent on the nature of the restriction enzymes used (b) DNA barcoding uses a very large reference sequence database. This is international, publicly accessible and constantly being added-to by unrelated institutions and projects. Consequently there is greater inclusion of taxonomically comparative species and population data to improve confidence in identification. PCR-RFLP generally relies on in-house developed reference restriction patterns; therefore comparative species and population data are incorporated at a significantly reduced rate without contributions from independent and international laboratories (c) DNA barcoding is quantifiable and accessible to bioinformatics analyses. PCR-RFLP is essentially qualitative, relying on visual inspection against control samples and molecular weight markers. If access to a laboratory with DNA sequencing equipment is difficult, PCR-RFLP is a useful alternative for the majority of species. There are also some species for which identification is ambiguous with DNA barcoding but not for PCR-RFLP (Table 3); however, while this may be a function of the different gene regions used, it may also be a result of the many more species and populations included in the DNA barcode database covering more of the variation. Gene regions used: DNA barcoding utilises a mitochondrial locus within the cytochrome oxidase I (COI) gene, while the RFLP methods both utilise a ribosomal DNA (rDNA) gene region that includes the first internal transcribed spacer (ITS1). Both gene regions have been chosen for the suitability of their sequences to be distinct between species (Jinbo et al 2011; Wang 2015). Preparation of general reagents is provided in Appendix 2. 68 7.3.1 DNA extraction for adults and immature stages The preferred method presented here uses the DNeasy® Blood and Tissue kit (Qiagen). This produces DNA of very high quality suitable for archiving, should any future work be needed. Other cheaper and more rapid methods, such as prepGEM (ZyGEM, AKL, NZ) and ZR Tissue & Insect DNA MicroPrep (Zymo Research, CA, USA) kits, are also highly suitable for diagnostic purposes, but the DNA is of poorer quality and not so well suited to long-term archiving. DNA should ideally be obtained using relatively non-destructive techniques, to ensure that a voucher specimen is available for future morphological examination (Floyd et al. 2010). For fruit fly adults a leg or the head of a specimen can be used, therefore retaining many other valuable morphological features of the specimen (such as wings, thorax and abdomen). For larvae, anterior and posterior sections can be sectioned off and retained, preserving the morphologically valuable mouthparts and spiracles. Alternative even less destructive methods, involving Proteinase K digestion of internal tissues, are also very effective (e.g. Gilbert et al. 2007). DNA should be extracted in a room or a bench separated from PCR set up, and from post-PCR product analysis, i.e. electrophoresis, sequencing or RFLP tests (Sections 7.3.4 and 7.3.3). Suitable DNA can be obtained from dry, frozen or ethanol / propylene glycol preserved specimens, (see Section 6.4.1). Equipment and/or material needed • Blotting paper or Kimwipe tissues • Scalpel blades (if sub-sampling each sample) • Benchtop Microcentrifuge • Microcentrifuge tubes (1.5 mL), (certified DNA free, or autoclaved) • QIAGEN extraction kit (DNeasy® Blood and Tissue kit) • Heating block or water bath to 56°C • Forceps • Sterile micro pestle • Vortexer • Bead-Mill with 3 mm solid glass beads, or plastic micropestle and matching microcentrifuge tube, (certified DNA free, or autoclaved) • QIAGEN DNeasy® Blood and Tissue Kit Handbook, July 2006 (for reference if required) METHOD The DNA is extracted by following the manufacturer’s instruction in the DNeasy Blood and Tissue kit handbook (July 2006) for animal tissue (spin column). Slight modifications are highlighted here, with additional notes, for DNA used in the real-time or quantitative PCR (qPCR) assay. Prior to starting the extraction: Check if the ATL and AL buffers have precipitated during storage and, if so, warm them until the precipitate has fully dissolved. Ensure ethanol has been added to the AW1 and AW2 buffers as specified on the reagent bottles. Heat the heating block or water bath to 56°C Pipette 100 µl x (n+1) of AE buffer into a clean 1.5 mL Eppendorf tube, and place the tube in the 56°C heating block. (n=the number of samples to be extracted). Eluting the DNA with pre69 warmed AE buffer can increase DNA yield and this is recommended for use with the real-time PCR protocol. Starting the extraction: 1) Allow several hours for processing (Proteinase K digest time dependent). 2) If using a “Bead-Mill” to homogenise the tissue add two 3 mm solid glass beads (acid-washed in 10 % HCl prior to use) to a clean microcentrifuge tube and add 20 µL of proteinase K. If using a micro pestle to homogenise the tissue, add 20 µL of Proteinase K directly to the paired microfuge tube. 3) Remove samples (e.g. larva, adult head or leg) from ethanol and dry on blotting “tissue” until ethanol evaporates (approximately 1 min). If samples were “dry” frozen or air dry omit this step. Eggs can be used, but usually require multiple eggs (>5) to be processed together to obtain enough DNA (K. Armstrong pers. comm.). Note: 1-2 eggs are sufficient for use in the real-time PCR assay. 4) Add sample to the Proteinase K tube, cleaning forceps (ethanol wipe) in between samples to prevent cross-contamination. Homogenise the specimen, either in a Bead-Mill (1 min @ 30 MHz) or with plastic micro pestle in a microfuge tube. 5) Quick-spin in centrifuge (up to 10,000 x g / rpm). 6) If processing large numbers of specimens, rotate previously “outer” samples to “inner” position of the Bead-Mill (i.e. swap the inner microcentrifuge tube insert around). Repeat Bead-Mill shaking (1 min @ 30 MHz). 7) Repeat Bead-Mill and centrifuge steps until samples contain no large visible fragments. If using a plastic pestle, initially grind until this point is reached. 8) Add 180 µL of Buffer ATL and vortex. Note: the tissue can alternatively be homogenised in 180 µl of ATL buffer plus the 20 µl of proteinase K together. 9) Incubate for 0.5-1 ½ h at 56oC, or possibly overnight for complete digestion. For empty pupal cases, or aged and dried samples, an overnight incubation is recommended. 10) Vortex, quick-spin to remove liquid from inner lid of microcentrifuge tubes. 11) Add 200 µL of Buffer AL and 200 µL of ethanol (Buffer AL and ethanol can be premixed in a large tube for multiple samples, and then dispensed [400 µL] to each sample). Vortex. 12) Pipette mixture to QIAGEN kit column to bind DNA and centrifuge at ~6000 x g for 1 min. Discard lower collection tube. 13) Place column into a new collection tube. Add 500 µL of Buffer AW1 to wash. Centrifuge at ~6,000 x g for 1 min. Discard lower collection tube. 14) Place column into a new collection tube. Add 500 µL of Buffer AW2 to wash. Centrifuge at ~20,000 x g (17,000 x g is acceptable) for 3 min. Discard lower collection tube (making sure no AW2 Buffer splashes onto the base of column). 15) Label the top and side of clean 1.5 mL microcentrifuge tube with the sample’s identification / database number. 16) Place column into the new microcentrifuge tube. Add 100 µL of AE buffer (this buffer must come into direct contact with the column filter). Incubate at room temperature for 1 min, then centrifuge for 1 min at 6000 x g to elute the DNA from the column. Note: 50 µl of pre-warmed AE buffer should be used for DNA to be used in the real-time PCR protocol. 17) Repeat elution a second time. 18) Discard column and retain microcentrifuge tube containing ~200 µL (or ~100 µL) of DNA in AE Buffer. 20) Store DNA in -20°C or -80oC freezer. Ideally, DNA can be aliquoted for long-term storage. 70 7.3.2 DNA Barcoding This test was developed by Mark Blacket, Linda Semeraro and Mali Malipatil, Victorian Department of Economic Development, Jobs, Transport and Resources (Blacket et al. 2012). This section (7.3.2) was written by Mark Blacket and Karen Armstrong. INTRODUCTION Tephritid fruit fly adult specimens are primarily identified through an examination of diagnostic morphological characters (Table 2). Other life stages are more problematic, with only third instar larvae (and sometimes pupae) of some species usually identified through visual examination (e.g. White & Elson-Harris 1992). Identification of earlier life stages (early instars, eggs), and adults of morphologically ambiguous species, generally requires the use of molecular techniques. DNA barcoding is a diagnostic molecular method that is routinely applied at the DEDJTR (Vic.) and Ministry for Primary Industries (MPI) laboratories (NZ) to identify morphologically problematic specimens and confirm new fruit fly incursions. The Australian Department of Agriculture and Water Resources (DAWR) also regularly uses it to screen immature stages (e.g. eggs) collected from fruit to exclude the non-tephritid exotic pest Drosophila suzukii (A. Broadley pers. comm.). DNA barcoding of an unknown insect specimen involves obtaining a DNA sequence of a specific region of the mitochondrial Cytochrome Oxidase I (COI) gene, and then comparing it with a database of sequences from positively identified reference specimens. There are currently many reference DNA barcoding sequences available. The Barcode of Life Data Systems (BOLD) (http://www.boldsystems.org, accessed June 2015) holds 833 x Tephritidae, including 198 x Bactrocera “species with barcodes”. This also includes data from NCBI GenBank and of regional studies covering a broad range of endemic or intercepted tephritid species – e.g. 60 species from Oceania (Armstrong and Ball 2005), 153 species from Africa (Virgilio et al. 2012), 135 species from Europe (Smit et al. 2013). However, there is no single peer-reviewed published DNA barcoding laboratory protocol that covers all of the targeted tephritid species listed in Table 3. DNA barcoding should ideally obtain DNA using relatively non-destructive techniques, to ensure that a voucher specimen is available for future morphological examination (Floyd et al. 2010). For fruit fly adults a leg or the head of a specimen can be used, therefore retaining many other valuable morphological features of the specimen (such as wings, thorax and abdomen). For larvae, anterior and posterior sections can be sectioned off and retained, preserving the morphologically valuable mouthparts and spiracles. Alternative even less destructive methods, involving Proteinase K digestion of internal tissues, are also very effective (e.g. Gilbert et al. 2007). There are a number of potential issues that should be taken into consideration when applying a DNA barcoding approach to fruit fly species identification: 1) Many studies have not used the same gene region rendering the data unusable (Boykin et al. 2012); 2) Some commonly applied combinations of standard polymerase chain reaction (PCR) primers (e.g. LCO/HCO) may amplify a nuclear copy (a numt pseudogene) of the COI barcode region in some fruit flies (Blacket et al. 2012); 3) The presence of fruit fly species complexes can limit precise species identification (e.g. Blacket et al. 2012, Jiang et al. 2014), enabling identification only to the complex level (e.g. B. tryoni complex); 4) The confidence of assigning an unknown sequence to a reference species can be problematic if all relevant potential taxa are not able to be included in the reference dataset (e.g. Virgilio et al. 2012). The degree of identification uncertainty is dependent upon a number of factors, 71 including the accuracy of the taxonomic reconstruction (Lou & Goulding 2010), how recently the sister species diverged (e.g. van Velzen et al. 2012), and the geographic scale of reference samples (Bergsten et al. 2012). Other applications of DNA barcoding data in addition to species identification are beginning to be explored. For example, in a biosecurity context the DNA sequence data generated can also be used to trace lineages (Blacket 2011) and possible source populations (Barr et al. 2014). AIM This test aims to identify fruit fly species, from any life stage, through DNA sequencing and comparison with reference sequences of the DNA barcoding region using the publicly available reference information in BOLD. TARGETS Almost all of the relevant species of fruit flies from the Australasian region are represented in BOLD (Table 3). The small number of species that have not been sequenced to date belong to genera where many other species have been examined; this allows a DNA barcoding approach to at least place these species to the appropriate genus. Note: for some species complexes COI or ITS DNA sequencing is unable to differentiate individual species (see Table 3). PROCEDURE This document provides supporting information for a three-step DNA barcoding process involving: 1) DNA extraction for fruit flies (adults and immature stages) 2) PCR of the mitochondrial COI barcode gene region from the fruit fly DNA. 3) Data analysis of the COI barcode gene region for species assignment using BOLD. 7.3.2.1 PCR OF THE MITOCHONDRIAL COI BARCODE GENE REGION FROM FRUIT FLY DNA The DNA barcode region of the COI gene is PCR amplified using a fruit fly-specific priming system, producing a ~550 bp amplicon for sequencing. The PCR Master Mix reagents and set up must be in a separate storage and at a separate bench (respectively) to the DNA extraction and post-PCR product analysis (electrophoresis or RFLP, Sections 7.3.3 and 7.3.4). Equipment and/or material needed Primers: o Forward: FruitFlyCOI-F (FFCOI-F) 5’-GGAGCATTAATYGGRGAYG-3’ (Blacket et al. 201215) o Reverse: HCO 5’- TAAACTTCAGGGTGACCAAAAATCA-3’ (Folmer et al. 1994) This primer is a fly-specific primer that was initially successfully tested on Bactrocera, Ceratitis (Tephritidae) and Calliphora (Calliphoridae) species. 15 72 PCR Master Mix: o BSA [1X] (diluted with distilled H2O from 100X BSA stock) o NEB 10X Buffer (Cat# M0267S) o dNTP’s [2.5 mM] o MgCl2 [25 mM] o Primers [10 µM] (working primer concentration is 10 µM, store stocks at 100 µm, -20oC) o NEB Taq DNA Polymerase (Cat# M0267S) o QIAGEN QIAquick Spin Handbook, March 2008 (for reference if required) DNA template of unknown specimen(s) (see Section 7.3.1) Fruit fly DNA to use as a positive control (to confirm that the PCR amplification is working) AE Buffer (or TE) from the DNA extraction kit can be used to replace DNA as a negative control (to confirm that no PCR reagents are contaminated). Thermal cycler, e.g. “T800”, Eppendorf (epgradient S) Thermocycler Additional equipment / materials: Submerged gel electrophoresis power pack, gel tank, TBE buffer, agarose etc. Methods 1) Extract fruit fly DNA for use as template (see Section 7.3.1). 2) Set up Master mix (see below), keeping all reagents on ice during setup and adding the DNA template last. 3) The Master Mix consists of 23 µL reaction volume for each sample (plus a negative and positive control). Note, if dealing with large numbers of samples (e.g. >10) an extra reaction may be required to account for retention of liquid in pipette tips: MasterMix Reagent x 1 reaction (µL) x 3 reactions (µL) 1X BSA 15.3 45.9 10X Buffer 2.5 7.5 dNTP’s 2 6 MgCl2 0.5 1.5 FFCOI-F 1.25 3.75 HCO 1.25 3.75 NEB Taq 0.2 0.6 DNA Template 2 - TOTAL: 25 µL 69 µl (x 23 µL per reaction) 73 4) PCR Conditions (“T800”, Eppendorf (epgradient S) Thermocycler): 1 x cycle 94 °C, 2 min 40 x cycles 94 °C, 30 s 52 °C, 30 s 72 °C, 30 s 1 x cycles 72 °C, 2 min 1 x hold 15 °C, indefinitely 5) After PCR is complete, load 5 µL of the PCR product (plus 2 µL loading dye) onto a 2% agarose checking gel (use 5 µL of SYBR Safe [Cat# S33102] per 50 mL liquid gel mix, before casting gel). Mix PCR product and dye together in plastic “gel loading” plate, using a new pipette tip for each sample. Run agarose gel at 100 V, for 30 min. Visualise and photograph gel on a UV light box. Estimate PCR product concentration for DNA sequencing from the agarose gel photo (weak PCR ~20 ng µL-1, strong PCR >100 ng µL-1). 6) If necessary, clean successful PCR products using QIAquick PCR Purification Kit (QIAGEN, Cat# 28104), elute final volume in 30 µL of EB Buffer (some external sequencing companies, e.g. Macrogen do this step). 7) Send to external facility (e.g. Micromon, Monash University or Macrogen, Korea) for DNA sequencing in both directions using the PCR primers above (Note, depending on each laboratories procedures, and quality of the sequence obtained therein, sequencing may be conducted in one direction only). 8) After high quality DNA sequences have been obtained (preferably with a QV or Phred score of greater than 20), and with PCR primer sequence removed and the forward and reverse consensus sequence determined (if sequencing both directions), they can be compared with a public database (i.e. BOLD, Barcode of Life website16) to identify species as outlined in Section 7.3.2.2. 16 http://www.boldsystems.org 74 7.3.2.2 DATA ANALYSIS – DNA BARCODING SPECIES IDENTIFICATION The DNA sequence data for each specimen is compared with other publicly available reference sequences for species identification. Some species, such as Bactrocera tryoni, are members of a species complex, where the very closely related species within the complex cannot be distinguished by their DNA barcode sequence; these specimens are thus reported as being identified to a species group (e.g. B. tryoni complex, rather than B. tryoni). Method 1) Go to the Barcode of Life website (http://www.boldsystems.org/). 2) Click the “Identification” tab (http://www.boldsystems.org/index.php/IDS_OpenIdEngine). 3) Paste the DNA sequence (use only the high quality section of the DNA sequence) into the “Enter sequences in fasta format:” box (the sequence can just be entered as simple text and does not need to be in FASTA format). 4) Select the “Species Level Barcode Records” (default); this selects reference sequences that are >500 bp from named (identified) specimens, but some species may be represented by only one or two specimens or be included with interim taxonomy. 5) Click the “Submit” button. 6) The top 20 matches are displayed (default), 99 best matches are available, together with the “Specimen Similarity” score (as a percentage). 7) The matches with the highest percentage similarity (listed from highest to lowest) are the reference sequences that best match the unknown specimen being identified. The best matches are listed under “Search Results” and in a “Identification Summary” table together with the percentage “Probability of Placement” (Figure 9). 8) The matches should also be viewed as a phylogenetic tree using the “Tree based Identification” button. 9) Click “View Tree” to view a PDF of the phylogenetic tree. 10) On the tree the specimen being identified is referred to as the “Unknown Specimen” (written in red) on the tree (indicated with arrows in Figure 10 and Figure 11), and is shown closest to the reference specimens that it best matches. 11) The specimen can now be assigned to the species that it is most similar to, with three caveats: a. Some specimens can only be assigned to a species group (i.e. a closely related complex of species, Figure 11), where the species within it are unable / too similar to be distinguished using DNA barcoding. The indications for this are when different specimens of the same species are mixed among other species and there is no clear single-species clade (Figure 11); this is known to occur for the complexes of B. tryoni, B. dorsalis and Anastrepha fraterculus. b. The assignments made by BOLD are based on a generic <2% within-species divergence (i.e BINs, Ratnasingham & Hebert 2013). This may not be appropriate for all of the species being analysed. For example Figure 12 shows divergences within the B. tryoni complex are very similar (<2%) to another closely related distinct species, B. curvipennis. c. The closest match is not always with the correct species. BOLD recommends that an “identification is solid unless there is a very closely allied congeneric species that has not yet been analysed”. While most pest fruit fly species of interest are represented in BOLD (e.g. Table 2), closely related congeners may not. Indications for this are difficult to observe and this caveat is dependent on knowledge of the local taxonomy. 75 Figure 9. BOLD generated identification results for the closest matches for an Island Fly (Dirioxa pornia) COI sequence (accessed June 2015). 76 Figure 10. Specimen confidently assigned to species (Lamprolonchaea brouniana), (BOLD tree June 2015). 77 Figure 11. Specimen only confidently assigned to species group (Bactrocera tryoni complex), due to three closely related species (B. tryoni, B. aquilonis, B. neohumeralis) being “mixed together” (i.e. non-monophyletic) on the phylogenetic tree (BOLD tree June 2015). 78 Figure 12. Closely related species (B. curvipennis) genetically distinct from the species complex (B. tryoni) but within the <2% assignment limit set by BOLD (BOLD July 2015). 79 7.3.3 PCR-RFLP OVERVIEW Two tests are described. Both are based on fruit fly-specific PCR of the rDNA ITS region (Figure 13). Differences in method details (sections 7.3.3.1 and 7.3.3.2) reflect subtle differences in the standard operating procedures of the original laboratories. Test 1, developed by McKenzie et al. (2004), utilises a 0.6 to 1.2 kb PCR fragment of the ITS1 only (Figure 13). As the ITS1 can be variable in length, for some species the size of the PCR fragment can be an additional diagnostic character. Separate aliquots of the PCR amplicon are digested with each of up to six different restriction enzymes to produce a species-specific RFLP profile. This number may be reduced if the potential species could be narrowed down by knowledge of likely origin and/or host, and by reference to Table 4 which illustrates which enzymes distinguish which species. This test can be used for identification of 26 fruit fly species (Table 3). Test 2, originally developed by Armstrong and Cameron (1998), is similar to Test 1 but amplifies a larger 1.5-1.8 kb DNA fragment, encompassing the 18S and the ITS1 gene regions (Figure 13). Because of this, the variability in PCR fragment length is not so discernible and is therefore not useful as an additional character. Various combinations of three or four out of 10 restriction enzymes are recommended to produce a species-specific RFLP profile. The specific suite will depend on the likely species identity if it can be narrowed down by likely country of origin or the fruit. This test can be used for identification of 33 fruit fly species (Table 3); details are available in Armstrong & Cameron (1998). In the specific circumstance to distinguish just B. tryoni complex from C. capitata the enzymes AluI, DdeI, RsaI and SspI are diagnostic. Figure 13. Part of the ribosomal RNA operon with the location of primer positions for Tests 1 and 2 ITS1 18S baITS1f 5.8S baITS1r ITS2 28S Test 1 Test 2 NS15 ITS6 The general workflow is presented in Figure 14. 80 Figure 14. Workflow of PCR-RFLP procedures for fruit fly identification 1. Choose standards to run in conjunction with unknown and up to four restriction enzymes for diagnosis Start 10. Set up fresh reactions; incubate for longer No 2. DNA extraction from unknown sample Section 7.3.3 8. Test 1 & 2 Restriction analysis. Section 7.3.3.1 or 7.3.3.2 9. Have restriction reactions gone to completion? Yes 3. PCR amplification Section 7.3.3.1 or 7.3.3.2 5. Electrophoresis test for amplified DNA 11. Compare fragment number and length with reference data 13. Consider additional enzymes, or conclude it is a different species to any of the reference species Test 1 Table 5 Test 2 Appendix 4 12. Document fruit fly identification No 6. Has DNA been amplified? Yes No 7. Test 1. Record if ITS1 fragment length is diagnostic (Table 4). 9. Is identity consistent across enzymes; does identity make sense re Yes other information on fruit host or origin? Yes End 81 SPECIES TARGETS Test 1 can distinguish 25 of 27 target species within the current list of 59 species (Table 1); three species within the Bactrocera tryoni group (including B. tryoni, B. neohumeralis and B. aquilonis) cannot be distinguished from each other. Test 2 can distinguish 24 of 33 target species within the current list of 59 species (Table 1); nine species form four species groups. Test 2a distinguishes B. tryoni complex from C. capitata only. All tests should be considered in terms of the host fruit (for immature life stage samples) and likely country/place of origin to (a) narrow the possible species at the outset for choice of restriction enzymes and (b) to check the results for reliability. Host records (Section 7) for the target taxa may assist in the elimination of possible non-target species. CHOICE OF RFLP TEST Test 1 is more rapid, the RFLP patterns less complex to interpret and the variation in size of the ITS1 region easier to detect than Test 2. Therefore this test is recommended when the potential species is within that listed for this test (Table 3). Test 2 takes slightly longer, the RFLP patterns are sometimes more complex to interpret and the variation in size of the ITS1 region not as easy to detect is in Test 1. However, a slightly modified version (Semeraro & Malipatil 2005) provided below, is recommended instead of Test 1 specifically for the diagnosis of the high-risk pest species B. tryoni (although indistinguishable from B. neohumeralis and B. aquilonis within the species complex) and Ceratitis capitata. The original method provided in Armstrong and Cameron (1998) (not included in this Handbook) is also recommended for a further 11 species not included in Test 1 but within the now extended species list in this version of the Handbook (Table 3); the diagnostic data for Test 2 is however provided in Appendices 3 and 4. Potential for misidentification: False positives are possible if other less economically important species, not included during development of the tests, have the same RFLP pattern. This scenario is reduced by increasing the number of restriction sites screened by using several restriction enzymes for an identification. It is also unlikely for exotic fruit fly interceptions given the low potential for nonpest species to reach Australia. For Australian methyl eugenol or cue lure trapped specimens, the range of taxonomically close local non-target species has not been included in development of either test. Therefore care is needed in interpretation of the results in light of other information about the sample, e.g. data on host or geographic origin (Section 8). False negatives could arise if a non-conforming RFLP pattern is produced by a population of a species that has an aberrant polymorphism at a diagnostic restriction site. This is unlikely given the range of populations included during the development of these tests. Also, the ITS1 is generally not useful for detecting population-level variation (cf COI barcodes, Section 7.3.3). False negatives could also arise if the restriction fails or fails to go to completion. DNA from a positive control (known species) should therefore be included to detect this. CHOICE OF STANDARDS All analyses should incorporate at least one standard, i.e. DNA from a known species. This can include one of the anticipated species for identity of the unknown specimen, which is useful as a positive control to help with sizing the restriction fragments of the unknown. Alternatively, it can be from a completely unrelated species, which is useful to minimise any question of contamination or mix up. Standards are essential to provide confidence that the PCR and restriction steps are operating correctly. 82 7.3.3.1 PCR-RFLP TEST 1 A) PCR Equipment Pipettors and tips Sterile disposable microcentrifuge tubes Microcentrifuge Gel tank and power pack Latex or Nitrile gloves Microwave UV transilluminator with camera Thermocycler Personal protective equipment including lab coat, eye protection, gloves Reagents (see APPENDIX 2 for reagent compositions) Manufacturer’s polymerase enzyme buffer 10X Taq polymerase enzyme (5U μL-1) Primer (McKenzie et al. 1999) are: o baITS1f 5’ GGA AGG ATC ATT ATT GTG TTC C 3’, 10 μM o baITS1r 5’ ATG AGC CGA GTG ATC CAC C 3’, 10 μM dNTP’s (2 mM) MgCl2 (50 mM) Sterile water 1X TBE buffer 1% (w/v) agarose gel: 1 g DNA grade agarose per 100 mL 1X TBE 6X Loading dye DNA molecular weight marker (aka 100 bp ladder) Gel staining solution, e.g. Ethidium bromide (final concentration 800 ng/μL), or non-toxic options such as Syber Safe, or Red Safe according to manufacturer’s instructions Method In a pre-PCR cabinet: 1) label sterile 0.2 ml PCR tubes 2) make a Reagent Master Mix for the total number of samples to be analysed according to the table below, all reagents except for the polymerase (note, recommend adding an extra volume for more than 10 samples to allow for any loss of solution via adherence to the outside of the pipette tip): Reagent Final concentration Vol per reaction (μl) Manufacturer’s reaction buffer (10X) 1X 5 MgCl2 (50 mM) 1.5 mM 1.5 dNTP’s (2 mM) 200 μM 5 Forward primer (10 μM) 1 μM 5 Reverse primer (10 μM) 1 μM 5 H2O 20.25 Taq polymerase enzyme (5U μL-1) 0.25 Total volume 42 83 3) Store Master Mix on ice in sterile 1.5 mL centrifuge tube. 4) Add 8 μL of sterile distilled H2O or DNA buffer to the first negative control tube. In a laminar flow hood or PCR cabinet: 5) Add the Taq polymerase to the Master Mix 6) Aliquot 42 μL Taq Master Mix to each PCR tube 7) Add 8 μL of DNA extract/control to each sample tube as appropriate 8) PCR amplify the DNA in a thermal cycler using the following program: Cycle 1 - denature 94°C 2 min Cycles 2 to 35 - denature 94°C 1 min, anneal 60°C 1 min, extend 72°C 1 min Cycle 36 - extend 72°C 5 min 9) 10) 11) 12) 13) Place reaction products on ice or freeze until ready to analyse. Mix 3 μL of each PCR sample with 2 μL loading dye. Load samples and 100 bp DNA ladder onto separate wells of 1% (w/v) agarose gel in 1X TBE. Electrophorese in 1X TBE buffer at 100 V for around 40 min. Stain the gel in ethidium bromide or other stain, according to local Standard Operation Procedure. 14) Visualise bands and capture image using the Gel Documentation System. Diagnostic use of ITS1 amplicon size The expected size of the amplified product is between 500 and 1000 bp, depending on the species (Table 4). For some species the size can be an additional diagnostic character. However, relying on the resolution available on a gel to distinguish the majority of these amplicon sizes is not advisable as the only diagnostic character, but is useful in conjunction with restriction analysis as described below. Flies producing fragments of less than 700 bp or greater than 900 bp are segregated and then restriction enzymes are used in series to differentiate the species. Sizes are given as a range to reflect that sizing is approximate when using low-resolution gel electrophoresis systems as here. 84 Table 4. Approximate size of the ITS1 amplicon for each species. Potential diagnostic size ranges are contained in a block Species Fragment range ITS1 amplicon ~size range (bp) Potential species 500-520 D. pornia 590-610 B. cucurbitae 640-680 A. ludens 650-690 A. obliqua 670-700 B. xanthodes 740-760 A. serpentina 740-780 R. pomonella 750-780 B. umbrosa, B. facialis 760-770 B. cucumis 760-780 B. latifrons 770-790 B. musae 770-800 B. endiandrae 780-800 B. psidii 790-840 B. bryoniae, B. tryoni sp. complex 800-820 B. moluccensis 800-840 B. dorsalis sp., B. jarvisi 810-840 B. passiflorae 820-850 B. zonata 830-860 B. carambolae, B. curvipennis, B. frauenfeldi 840-860 B. albistrigata, B. kirki 890-900 C. capitata 1000-1040 C. rosa 85 B) RESTRICTION DIGESTION OF PCR PRODUCT The use of a combination of enzymes, in series, allows definitive identification of the majority of the species. This also eliminates the reliance on discrete restriction sites and minimises the likelihood of false negatives that may arise through a rare recombination event. Restriction endonucleases used are VspI, HhaI, SspI, HinfI, BsrI, SnaBI and/or Sau3aI. During the development of this test standard enzymes purchased from New England Biolabs were used but other brands would work equally well. Enzymes were also selected based on the requirement for differences in fragment sizes to be easily detected by visual examination of an agarose gel. If the likely species can be narrowed down, e.g. by fruit or geographic region, then a reduced number of enzymes could be used. However, for robust diagnoses, it is recommended that at least four enzymes are used, even if there is a diagnostic pattern for one enzyme that distinguishes a species from all others. Equipment Pipettors and tips Sterile disposable microcentrifuge tubes Microcentrifuge Dry heating block, waterbath or similar Gel tank and power pack Latex or nitrile gloves Microwave UV transilluminator with camera and image capture and analysis software Personal protective equipment including lab coat, eye protection, gloves Reagents Sterile distilled water Bovine serum albumin (BSA, 10 μg/μL) (comes supplied with NEB enzymes) Restriction enzymes VspI, HhaI, SspI, HinfI, BsrI, SnaBI, and Sau3aI Restriction buffer supplied with enzyme Ethidium bromide solution, 800 ng/μL final concentration, or non-toxic options such as Syber Safe, or Red Safe according to manufacturer’s instructions Method 1) Label microcentrifuge tubes, including one for the positive control. 2) To each centrifuge tube add: Water 2.3 μL 10X buffer 2 μL BSA (10 ug/μL) 0.2 μL PCR product 5 μL Restriction enzyme 0.5 μL 3) Mix reagents and place tubes in a water bath preheated to 37oC for 2 h. 4) Store tubes on ice or at -20oC until ready to load on agarose gel. 5) Add 3 μL of 6X loading buffer to each tube. 6) Load the entire volume of each sample (23 μL) into a lane of a 2% (w/v) high resolution agarose gel. 7) Load 100 bp DNA molecular weight marker into one or two wells of the gel. 8) Analyse products by electrophoresis at 100 V for 50 min. 86 9) Stain the gel with ethidium bromide, or alternative non-toxic stain. 10) Visualise fragments using a UV transilluminator. 11) Capture gel image using gel documentation system. Analysis of RFLP products For diagnostic purposes, RFLP bands under 100 bp and over 1500 bp in size are disregarded due to difficulty in accurate sizing. The molecular weights of the restriction fragments are estimated with reference to the DNA molecular weight standard loaded on the same gel. Tables 4 and 5 summarise the expected fragment lengths for the six restriction enzymes used in this method. All species listed can be differentiated from each other, with the exception of those within the B. tryoni complex. Care should be taken with fragments produced for B. albistrigata and B. kirki, which are very similar for all six restriction enzymes and potentially difficult to confidently distinguish on an electrophoresis gel. Species 87 Table 5. Analysis of RFLP products from ITS1 fragments from fruit flies ITS1* Species ˂700 700-900 HinfI ˃900 DNC VspI Cuts DNC Hhal Cuts DNC A. ludens X 550 550 X A. obliqua X 450, 270 550 X 420, 250 X A. serpentina X X B. albistrigata X X B. aquilonis X B. bryoniae X B. carambolae X X B. cucumis X X B. cucurbitae X Cuts SspI DNC BsrI Cuts DNC X 550, 150 X Cuts SnaBI DNC Sau3aI Cuts DNC X X X 450, 200 X X 530, 200 X X 450, 400 X X 670, 180 620, 180 770 X 640, 190 570, 180 600, 200 X 415 760 X 620, 200 560, 180 600, 230 X 400 680, 200 X X 550, 180 X X X X X X 400, 180 X X X 480, 350 X X X 620, 170 X 650, 190 X 650, 260 600, 180 X 600, 200 B. curvipennis B. dorsalis sp. complex X B. facialis X X X B. frauenfeldi X X X B. jarvisi X B. kirki X X 770 770 650, 250 550, 200 620, 180 570, 250 X 600, 250 530, 350 450, 400 X 420 540, 320 X X 390 X 450, 400 X 420 X 450, 400 X 640, 180 700 X X 680, 190 620, 180 B. latifrons X X X 600, 190 X 600, 200 B. musae X X X 635, 220 X 600, 250 B. neohumeralis X 770 X 640, 190 570, 180 600, 200 X B. passiflorae X 770 X 650, 190 750 650, 270 X X B. psidii X X 640, 190 570, 250 X X X Cuts X X X X X 520, 320 X 420 88 Species ITS1* ˂700 700-900 HinfI DNC 770 X 640, 190 570, 180 B. umbrosa X 730 X 600, 190 680 B. xanthodes X 680 X 670, 200 380, 250 B. zonata X X 680, 190 750 X X X C. rosa X 800, 200 X X DNC Cuts DNC BsrI Cuts X Cuts SspI X C. capitata DNC Hhal B. tryoni D. pornia ˃900 VspI Cuts DNC SnaBI Cuts 600, 200 DNC Cuts Sau3aI DNC Cuts X 420 X X 380 X X 600, 200 X 535, 330 X 650, 200 X 520, 160 X X X 600, 300 X 570, 480 X X X X 300, 220 X X X The length of the ITS1 fragment and the response of each to seven restriction enzymes (HinfI, VspI, HhaI, SspI, BsrI, SnaBI, Sau3aI) are indicated for each of the target species. ITS1 fragment length is scored as one of three classes (approximate length in bp). Enzyme responses are measured in two classes - either does not cut (DNC) or cuts. (Cuts – this column shows the length of each fragment in bp). Highlighted boxes denote diagnostic RFLP patterns, which are more than 20 bp different to other fragment produced by that restriction enzyme. 89 7.3.3.2 PCR-RFLP TEST 2 A) PCR Materials and equipment As for PCR-RFLP Test 1 Section 7.3.3.1 Reagents As for PCR-RFLP Test 1 Section 7.3.3.1 with the exception of primers, which are here: NS15 5’ CAATTGGGTGTAGCTACTAC 3’ ITS6 5’ AGCCGAGTGATCCACCGCT 3’ Method In a PCR (laminar flow or clean bench) cabinet: 1) label sterile 0.2 ml PCR tubes 2) make a Reagent Master Mix for the total number of samples to be analysed according to the table below, adding the polymerase last (note, recommend adding an extra volume for more than 10 samples to allow for any loss of solution via adherence to the outside of the pipette tip): Reagent Final concentration Double-distilled H2O Vol per reaction (μl) 30.6 Expand High Fidelity polymerase buffer 1X 5 dNTPs (2.5 μM) 200 μM 4 Forward primer 10 μM (NS16) 0.5 μM 2.5 Reverse primer 10 μM (ITS6) 0.5 μM 2.5 Expand Hi Fidelity Taq Polymerase 2 Units 0.4 Total 45 3) Store Master Mix on ice. 4) Vortex DNA extractions for 5 s. 5) Aliquot 5 μL of each unknown DNA template to labelled 0.2 mL tubes, plus at least one positive control DNA and one negative control (water or the buffer in which the DNA is suspended). 6) Aliquot 45 μL of master mix to each 0.2 mL tubes (containing 5 μL of template DNA). 7) Mix product and reagents well (or vortex briefly) and centrifuge for 3-5 s. 8) Place samples in PCR machine and program the following temperature profile (based on Armstrong and Cameron 1998): • Cycle 1 - denature 94°C 2 min • Cycles 2 to 35 - denature 94°C 15 s, anneal 60°C 30 s, extend 68°C 2 min • Cycle - extend 72°C 5 min 9) Add 1 μL of loading dye to 5 μL of PCR product 10) Load onto a 1.5% agarose gel, together with a 100 bp molecular ladder at either side and electrophorese according to Appendix 2. If product visible at 1.5-1.8 kb then proceed to Section B) – restriction digestion. 90 B) RESTRICTION DIGESTION OF PCR PRODUCT Equipment See 7.3.3.1 B Reagents Restriction enzymes, on ice. o NB. Choose at least four of the enzymes listed in Appendix 3 according to which combination will provide the best discrimination for the potential species; the letters represent RFLP patterns in Appendix 4 o Note: In the specific circumstance of distinguishing only B. tryoni complex and C. capitata the enzyme combination of AluI, DdeI and RsaI (10 U/μl) and SspI (5U/μl) is diagnostic. Restriction enzyme buffers, 10X Sterile nuclease free H2O Method 1) Prepare master mix (following recipe below) for each enzyme; multiplying volumes plus one for the number of reactions required. Adapted from Armstrong & Cameron (1998) Final concentration Double-distilled H2O Vol per reaction (μl) 5.6* 10X Buffer 1X 1.0 Enzyme† 4U 0.4 Total 7.0 * volume of water can be varied to accommodate any change to DNA volumes added, see below † Standard stock concentrations are usually 10 U/µl; if not, this volume will change accordingly 2) Aliquot 7 µL of each master mix into labelled tubes 3) Add 2-3 μL (100-200 ng) PCR product into each tube depending on how strong or weak the PCR products are; adjust water in reaction mix accordingly 4) Flick to mix reagents and PCR product, centrifuge briefly for 3-5 s. 5) Place samples in incubator at 37°C 2-3 h unless otherwise recommended by the enzyme manufacturer 6) Prepare a 2-3% agarose gel according to Appendix 2, at least 10 cm in length, to visualise fragment pattern and use a 100 bp ladder for determining fragment sizes 7) Compare results with positive controls and fragment patterns in Appendix 4 8) Species diagnosis is considered positive if all four enzyme patterns agree. 91 7.3.4 Real-time PCR detection of Bactrocera tryoni complex This test was developed and validated by Dhami et al., (2015), further validation was conducted by David Waite and Dongmei Li during 2014-2015 at the Plant Health and Environment Laboratory (PHEL), Ministry for Primary Industries (MPI), New Zealand. This section (7.3.4) was written by Dongmei Li, David Waite and Disna Gunawardana. INTRODUCTION Genetically similar but morphologically different species have been reported in several fruit fly species (Clarke et al., 2005; Krosch et al., 2012). Such species are considered as belonging to “species complexes” (Drew, 2004). The commonly called ‘Queensland fruit fly’ (Q-fly) is one such species complex, consisting of four species; B. tryoni, B. aquilonis, B. neohumeralis and B. melas (Drew, 1989). However, while B. melas exists in historic documents, researchers now consider it a cryptic form of B. tryoni (Clarke et al., 2011). Analysis of microsatellite markers has shown that there is only intraspecies level of differentiation present between B. tryoni and B. aquilonis (Wang et al., 2003). Those analyses also reflect that B. neohumeralis and B. tryoni represent separate species (Clarke et al., 2005; Wang et al., 2003). The closely related species B. curvipennis, however, is difficult to distinguish from B. tryoni complex based upon DNA sequencing of the cytochrome c oxidase subunit 1 (COI) gene (Armstrong & Ball, 2005), although it is morphologically distinct. More comprehensive molecular analysis has similarly indicated that B. curvipennis has a paraphyletic relationship with the B. tryoni complex and is currently considered very close to, but not within, the B. tryoni complex sensu Drew 1989 (Blacket et al., 2012; Jiang et al., 2014). DNA barcoding relies on PCR of predetermined marker genes, DNA sequencing and comparison of those sequences to a database of reference sequences (Armstrong & Ball, 2005). Currently, DNA barcoding of the COI gene is the most commonly used technique for the molecular identification of fruit flies (Armstrong & Ball, 2005; Blacket et al., 2012). This process is still relatively time consuming, with the quickest possible identification requiring a full day. In contrast, real-time PCR, or quantitative PCR (qPCR), drastically reduces the end-to-end time of analysis. This technique is based on the amplification of DNA monitored in real time and therefore without the need of post-PCR processing (e.g. gel electrophoresis), thus it enables identification within a few hours. The premise for this technology is that highly species-specific PCR primers or probes are designed to give positive reactions only with DNA of the target species. A positive identification is determined by the measurably lower number of PCR cycles taken for the amplicon to reach a given concentration, and for fluorescence to be detected (the quantitation cycle, Cq), than would occur for a negative or suboptimal amplification, as would be expected from DNA of the wrong species. The TaqMan chemistry has the potential for greater specificity through the incorporation of a third oligonucleotide in the reaction. The method has previously been applied to other fruit fly species on the list in this manual (Burgher-MacLellan et al., 2009; Yu et al., 2005; Yu et al., 2004). Here, a real-time PCR assay for the B. tryoni complex has been developed, validated and applied by PHEL in the routine diagnostics of intercepted fruit fly material at borders, post borders and in recent New Zealand Q-fly responses. AIM This assay aims to provide a rapid method for the identification of the B. tryoni complex, from any life stage, using the real-time TaqMan technique. TARGET This assay can be used identify B. tryoni complex, (B. tryoni, B. aquilonis, and B. neohumeralis), and the closely related species B. curvipennis. 92 PROCEDURE This document provides all the supporting information for conducting the real-time PCR assay and analysis of the results, including: 1. DNA extraction and subsequent PCR from a range of life stages of the fruit flies including eggs, part of an adult (one leg is commonly used in diagnostics), part of a larva, part of a pupa, empty pupal case 2. PCR competency test 3. Real-time PCR assay for the B. tryoni complex (FAM probe) 4. Results - analysis of Real-time PCR assays. 7.3.4.1 DNA Extraction protocols See section 7.3.1. 7.3.4.2 Real-time PCR assay for B. tryoni complex Set up the PCR assay in a PCR workstation. The assay is described as run on the CFX1000 TM realtime PCR system (BioRad), with the data analysed in the CFX manager 3.0 analysis software (BioRad). Equipment and material Primers and Probe (Dhami et al., 2015) o Forward primer: Btry2F, 5’-AATTGTAACAGCCCATGC-3’ o Reverse primer: Btry1R, 5’- GTGGGAATGCTATATCGG-3’ o Probe: Btry2PL: 6FAM-AG[+C]CA[+G]TTTCC[+G]AA[+A]CC-BBQ (or BHQ1) Real-time PCR mastermix o SsoAdvanced Universal Probe Supermix (Cat#1725280, Biorad), 2x qPCR mix, containing dNTPs, Sso7d fusion polymerase, MgCl2, stabilizers, ROX normalization dyes. o Primers/probe, working concentration of 5 µM (primer stock concentration 100 µM, stored at -20°C in dark) o BSA (Bovine serum albumin, working concentration of 10ng/µl) (Sigma Cat# A78850g) DNA samples of unknown Tephritidae species extracted as in section 7.3.1. Internal positive control to test unknown DNA samples for PCR competency to avoid false negative results o Conventional PCR with Folmer primers LCO1490 and HCO2198 (Folmer et al., 1994) o TaqMan ribosomal RNA control reagents (VIC probe) (Applied Biosystems, cat # 4308329), see Appendix 1 for details. Controls for real-time PCR setup: o Positive control to monitor the performance of the real-time PCR DNA samples of B. tryoni complex or Plasmid DNA of COI insert of B. tryoni complex (available from MPI PHEL, NZ on request) o Non-template control Sterile water or PCR-clean water PCR work station or DNA/RNA-free area for PCR setup Thermal cycler: CFX96 or CFX1000 Touch Real-time PCR (BioRad). Other brands of realtime thermal cycler can be used. Additional equipment: centrifuge, pipettes, plugged PCR tips, PCR tube, PCR plates, plate seals. Method 1. PCR competency test: It is recommended prior to any qPCR analyses to test all the DNA extractions for PCR competency, using either conventional PCR or 18S internal control TaqMan assay (see Appendix 1 for details) 93 2. Set up the real-time PCR Mastermix in a PCR work station or clean area, see below for the compositions (Table 6). Include enough volume to run the samples in duplicate or triplicate plus positive and non-template controls. It can also be run at 20 µl or 10 µl volume. a. For 20 µl volume, aliquot 18 µl of master mix to each PCR tube b. For 10 µl volume, aliquot 9 µl of master mix to each PCR tube Table 6. TaqMan real-time PCR for B. tryoni complex protocol using SsoAdvanced Universal Probe Supermix (BioRad) Reagents 1 x reaction (µl)a 10x reactions (µl) b Sterile distilled H2O 2.2 22 2 x Probe Supermix 10.0 100 5 µM Btry2F (400 nM) 1.6 16 5 µM Btry1R (400 nM) 1.6 16 5 µM Btry2PL(250 nM) 1.0 10 BSA (10mg/ml) 1.6 16 DNA template 2.0 Note: aThe compositions for 20 µl are listed in this table, halve the volumes for each reagent if using in 10 µl volume. bUsing 10x reaction as an example, calculate the volumes of each reagents using the number of reactions you are going to test when conducting the assay; note, one or two extra reaction volumes should be included to account for loss due to retention of liquid in pipette tips. 3. Set up the Mastermix, mix well and spin briefly, aliquot 18 µl of the Mastermix to each labelled PCR tube or well of a plate. 4. Add the appropriate DNA template or control solution to the tubes or the wells of a plate with the aliquoted Mastermix, close the tubes or seal the plate, mix well and spin the tubes or plate briefly 5. Put the tubes/plate into real-time PCR machine and run the program below: PCR cycling parameter (CFX 1000TM Thermal cycler) 1 x cycle 95 °C, 2 min 40 x cycles 95 °C, 15 sec 65 °C, 60 sec Plate read after each cycle 6. Open CFX manager 3.0 program, set up the protocol and run the real-time PCR assay. 7. Name the assay and save the data in a folder. 8. Once the run is finished, the data can be opened in the CFX manager 3.0 and analysed. 94 7.3.4.3 Analysis of Real-time PCR results The real-time PCR results are analysed here with the CFX Manager 3.0 (BioRad). If different real-time PCR systems are used, analysis of the amplification curves will need to be carried out according to that manufacturers’ manual. 1. Open BioRad CFX Manager 3.0. 2. Click file, open the data file, and choose the real-time PCR data you have saved for the assay. 3. Click on quantification tab, the amplification curve will appear on the screen, see Figure 15 for an example. 4. Set up the baseline for 50. 5. Report: Click Tools tab and choose reports, an analysis report for the real-time PCR including amplification curves and Cq values will be generated. It can be saved as pdf format or print it out. 6. Interpretation of the results - 18S internal control: a. If Cq values ≤30 cycles, the DNA extraction is PCR competent and the samples can be used for real-time PCR assay against B. tryoni complex. b. If Cq values >30 cycles, this indicates that inhibitors are in the DNA sample or there is insufficient DNA. Re-extraction of the samples will be needed. 7. Interpretation of the results - B. tryoni complex assay (use the PCR competent DNA samples only): a. For Cq values ≤30 cycles, the sample is considered as positive for B. tryoni complex, and possible for closely related B. curvipennis (Cq values between 25-30 cycles) i. DNA barcoding needs to be conducted to confirm the species if the Cq values >25 cycles. ii. The origin of the specimen might assist in distinguishing B. tryoni and B. curvipennis (e.g. B. curvipennis is endemic to New Caledonia and not present in Australia). b. Samples with Cq values between 30-35 cycles could be interpreted as either a different species with suboptimal match to the primers or that there is a very low copy number of the target species DNA. These should be considered as questionable and require further investigation by either DNA barcoding or re-extraction of DNA. c. The negative threshold for the assay is Cq values >35, at which point the samples should be considered as negative for B. tryoni complex, and identification by another method is necessary. 8. Validation of the real-time PCR assay for B. tryoni complex used DNA extracted from fresh and aged (up to 2 year olds) samples. This included B. tryoni from NSW, VIC, QLD (n>80) and B. neohumeralis from QLD (n>20). The following results were observed; a. Cq values ≤25 cycles were obtained with the DNA extracted from the B. tryoni complex except those with empty pupal cases. b. Cq values between 25-35 cycles were observed for the DNA extracted from B. curvipennis samples. DNA barcode sequencing confirmed the identification. c. Negative results (Cq >35) were obtained for all other Tephritidae species tested (see Appendix 2). 95 Sample tested B. tryoni Positive control Water control Figure 15. Amplification curves of real-time PCR assay for B. tryoni complex. The sample tested positive for B. tryoni complex, DNA sequences has further confirmed the results. 96 7.3.5 Allozyme electrophoresis This section was written by Mark Adams. AIM Allozyme electrophoresis provides a method for the rapid molecular identification of various species of fruit fly. TARGETS Routinely targets Bactrocera tryoni, Ceratitis capitata, Dirioxia pornia, Bactrocera dorsalis s.s. and Bactrocera jarvisi (Table 3). Additional species can be incorporated where suitable reference material is provided as freshly-frozen specimens (either as larvae or adults). SUITABILITY Suitable for the comparison of genetic profiles, as expressed in a range of soluble proteins, from live, recently-dead, or freshly-frozen larvae or adults. The service is currently routinely provided by the South Australia Museum's Evolutionary Biology Unit laboratory. The procedures take 2-3 hours to complete for a single screen of up to 20 specimens for 10 different genes. Given the comparative nature of the technique and its continued reliance on reference samples, it is important to note that additional species can only be identified as "new" (i.e. not one of the five reference species) unless suitable, known-identity samples can also be provided for a putative match. Moreover, the incorporation of additional species into the routine screening procedure may also require a re-evaluation of which enzyme markers are diagnostic for these additional species, in order to satisfy the minimum requirement of three diagnostic genetic differences between every pair of species. PROCEDURE OVERVIEW Crude extracts of soluble protein from live, recently-dead, or freshly-frozen larvae or adults are compared electrophoretically against known-identity extracts representing these five species. Test samples are readily identifiable by their comparative allozyme profile (i.e. relative band mobility) at a suite of at least six enzyme markers, encoded by a minimum of 10 independent genes, and together able to unambiguously diagnose the five reference species from one another at a minimum of three genes. Neither B. aquilonis nor B. neohumeralis are listed in the five target species, so this method is not designed to differentiate between B. tryoni and these other two, genetically very similar species. 7.3.5.1 Specimen preparation Test specimens Need to be supplied either (a) alive, (b) freshly dead and kept cool and moist, or (c) frozen when alive and not allowed to thaw until tested (dry ice required for transport; ice is not suitable) Can represent any life history stage 97 Reference specimens Frozen specimens representing the species requiring discrimination must be available. When kept at -70oC, these remain suitable for use as controls for at least 10 years. A single homogenized larva provides enough homogenate to act as a reference specimen on up to eight separate occasions. Once prepared, these reference homogenates can be stored at -20 oC as separate ~5 µL aliquots inside glass capillary tubes. Thus reference specimens for any test run are usually available as pre-prepared homogenates straight from the freezer. Specimen Preparation (ideally in cold room at 4oC) Specimens are hand-homogenized in an equal volume of a simple homogenizing solution (0.02 M Tris-HCl pH 7.4 containing 2 g PVP-40, 0.5 mL 2-mercaptoethanol and 20 mg NADP per 100 mL). ~0.5 µL of homogenate loaded directly onto each gel. The remaining homogenate is transferred as a series of ~5 µL aliquots into individual glass capillary tubes and stored at -20oC. These samples can either be subjected to further allozyme analysis if doubt remains as to species identity, or used as fresh reference material for the species thus identified (activity declines over a 12 month period at -20oC). 7.3.5.2 Electrophoresis (ideally in cold room at 4oC) Allozyme analyses are conducted on cellulose acetate gels (CellogelTM) according to the principles and procedures of Richardson et al. (1986). Table 7 indicates the suite of enzymes most commonly used for fruit-fly genetic identifications and details the electrophoretic conditions employed for each. 7.3.5.3 Gel interpretation The interpretation of allozyme gels requires some expertise; the intensity of allozyme bands changes over time after a gel is stained, plus banding patterns can be affected by the “freshness” of the specimen and by what type of gut contents are present (some plants contain compounds which affect fruit fly enzymes once the sample is homogenised). Richardson et al. (1986) devote an entire section to the interpretation of allozyme gels, but there is no substitute for experience. 7.3.5.4 Recording of results All gels are routinely scanned several times over the time course of stain incubation and the resultant JPG files archived as a permanent record. 98 Table 7. Enzymes most commonly used for fruit-fly genetic identifications using allozyme electrophoresis. Enzyme Abbr E.C. No. No. of genes Buffer1 Run time Stain Aconitase hydratase ACON 4.2.1.3 2 I17 Richardson et al. (1986) C. capitata vs B. tryoni vs B. jarvisi vs B. dorsalis vs D. pornia Aminoacylase ACYC Manchenko (1994) C. capitata vs B. tryoni vs B. jarvisi / B. dorsalis vs D. pornia Richardson et al. (1986) C. capitata vs B. tryoni vs B. jarvisi vs D. pornia method 3; Manchenko (1994) C. capitata vs B. tryoni / B. dorsalis vs B. jarvisi vs D. pornia Richardson et al. (1986) C. capitata vs B. tryoni / B. jarvisi / B. dorsalis vs D. pornia Richardson et al. (1986) C. capitata vs B. tryoni / B. dorsalis vs D. pornia Richardson et al. (1986) C. capitata vs B. tryoni / B. jarvisi vs B. papaya vs D. pornia 1.2 h @ 250 V 3.5.1.14 1 C 1.5 h @ 250 V Alcohol dehydrogenase ADH Aspartate aminotransferase GOT Glycerol-3phosphate dehyrogenase GPD Glucose-6phosphate isomerase GPI 3Hydroxybutyrate dehydrogenase HBDH Isocitrate dehydrogenase IDH Malate dehydrogenase MDH Dipeptidase PEPA 1.1.1.1 2 C 1.5 h @ 250 V 2.6.1.1 2 B 1.5 h @ 250 V 1.1.1.8 1 C 1.5 h @ 250 V 5.3.1.9 1 B 1.5 h @ 250 V 1.1.1.30 1 B 1.5 h @ 250 V 1.1.1.42 2 B 1.5 h @ 250 V 1.1.1.37 2 C 1.5 h @ 250 V 3.4.13 2 B 1.3 h @ 250 V 1Code 17 Species delineated Richardson et al. (1986) B. tryoni vs B. dorsalis Richardson et al. (1986) C. capitata vs B. tryoni / B. dorsalis / B. jarvisi vs D. pornia Richardson et al. (1986) C. capitata vs B. tryoni / B. jarvisi / B. dorsalis vs D. pornia for buffers follows Richardson et al. (1986). Sample origin is placed in the centre of the gel 99 8 Diagnostic Information The data sheets for all diagnostic methods are presented here. They are compiled for each species, although not all methods are available for all species (Table 3). Morphological data follow that of White & Elson Harris (1992) and Drew & Romig (2013). Molecular data for the DNA barcoding method is not provided here and the user is guided to submit their COI barcode sequence to the BOLD identification engine at http://www.barcodinglife.com/index.php/IDS_OpenIdEngine. Alternatively, an in-house reference dataset can be composed from the public data in BOLD (see Table 3). Note: any qualifying statements made under the individual species sections to indicate issues with diagnosis were accurate as of October 2015, but may have changed subsequently if additional data has been submitted to BOLD. Molecular data for the PCR-RFLP Test 1 provided under the individual species sections refers to information in Table 5, and given as fragment lengths in bp or DNC (does not cut). Molecular data for the PCR-RFLP Test 2 is provided in Appendices 3 and 4. PCR-RFLP patterns for unknown samples should be compared within those reference datasets to that of any other species likely to have been trapped (if known) or to any closely related species for which data may be available. 100 Key to family Tephritidae The family Tephritidae can be separated from all other Diptera by the shape of the subcostal vein, which bends abruptly through a right-angle and fades to a fold before reaching the wing edge, combined with the presence of setulae (small setae) along the dorsal side of vein R1. * Zeugodacus has been elevated from sub-generic rank (under genus Bactrocera) to full generic status based on molecular genetic data (Virgilio et al. 2015). This is yet to be widely accepted by the scientific community. Simplified key to major pest fruit fly genera (after White and Elson-Harris 1992): Adults 1 Vein Sc abruptly bent forward at nearly 90°, weakened beyond the bend and ending at subcostal break; dorsal side of vein R1, with setulae. Wing usually patterned by coloured bands. Wing cell cup with an acute extension…………………......................................TEPHRITIDAE .2 - Vein Sc not abruptly bent forward, except in the Psilidae, which lack both dorsal setulae on vein R1, and frontal setae. Species associated with fruit very rarely have any wing patterning. Wing cell cup usually without an acute extension (exceptions include some Otitidae and Pyrgotidae)…………………..……………………………………..Families other than Tephritidae 2 Cell cup very narrow and extension of cell cup very long. 1st flagellomere (3rd segment of antenna) at least three times as long as broad. Wing pattern usually confined to a costal band and an anal streak. (Tropical and warm temperate Old World; adventive species in Hawaii and northern South America)……………….……………………BACTROCERA* and DACUS (p. 102) - Cell cup broader and the extension shorter. 1st flagellomere shorter. Wing pattern usually includes some coloured crossbands……………………………………….…………………………..3 3 The wing vein that terminates just behind the wing apex (vein M) is curved forwards before merging into the wing edge. Wing pattern usually similar to Figure 22. (South America, West Indies and southern USA)…………………………..………….… ………….ANASTREPHA (p. 102) - The wing vein that terminates just behind the wing apex (vein M) meets the wing edge at approximately a right angle. Wing pattern usually similar to Figure 107………………….............4 4 Cell cup, including its extension, shaped as Figure 107. Basal cells of wing usually with spotand fleck-shaped marks, giving a reticulate appearance. Scutellum convex and shiny. (Ceratitis capitata is found in most tropical and warm temperate areas; other spp. are African)…………….……………………………………..……..………………….CERATITIS (p. 244) - Cell cup, including its extension, shaped as Figure 32-Figure 116 Basal area of wing not reticulate. Scutellum fairly flat and not shiny. (Larvae develop in the fruits of Berberidaceae, Caprifoliaceae, Cornaceae, Cupressaceae, Elaeagnaceae, North temperate regions and South America).……………………………………………………………………….RHAGOLETIS (p. 266) 101 Species diagnosis: Anastrepha (Tephritidae: Trypetinae: Toxotrypanini) 8.3.1 Anastrepha distincta (Greene) TAXONOMIC INFORMATION Common Name: Inga fruit fly Previous scientific name: Anastrepha silvai Lima DIAGNOSIS 8.3.1.1 Morphological – Adult Anastrepha distincta is characterized by the presence of a dark brown spot medially over the scutoscutellar suture (sometimes absent); the mediotergite yellow to orange-brown medially and dark brown laterally; scutum entirely covered with microtrichia; wing with cell bc with microtrichia on anterior margin; male aedeagus length 2.7-4.3 mm; female aculeus length 0.34-0.43 mm at tip; dorsobasal scales on eversible membrane; large, hook-like and in a triangular pattern; wing pattern typical but similar to that in Anastrepha edentata Stone. 8.3.1.2 Morphological – Larvae See Pest Fruit Flies of the World – Larvae Via delta-intkey.com/ffa Website 8.3.1.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from A. fraterculus, A. ludens, A. obliqua, or A. suspensa. PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Anastrepha distincta utilizes Inga species as its preferred host. Also recorded from species of Chrysophyllum, Eugenia and Mangifera. DISTRIBUTION Distributed from Southern Mexico to Peru and Brazil REMARKS While Anastrepha distincta is a distinct species it can be confused with A. ludens and A. edentata. PEST STATUS Exotic A serious pest of Inga species 102 ATTRACTANT No known record FIGURES Figure 16. Anastrepha distincta Image courtesy of the United States Department of Agriculture 103 Figure 17. Anastrepha distincta Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 November 2015) Figure 18. Anastrepha distincta Image courtesy of the United States Department of Agriculture 104 Figure 19. Anastrepha distincta Image courtesy of the United States Department of Agriculture Figure 20. Anastrepha distincta Image courtesy of the United States Department of Agriculture 105 8.3.2 Anastrepha fraterculus (Wiedemann) TAXONOMIC INFORMATION Common name: South American fruit fly Previous scientific names: Dacus fraterculus Trypeta fraterculus Acrotoxa fraterculus Trypeta (Acrotoxa) fraterculus DIAGNOSIS 8.3.2.1 Morphological - Adult Among all Anastrepha species found in the Americas, A. fraterculus, A. obliqua and A. suspensa present the most difficult identification problems in the genus; these three species are likely to be confused because of the similarity of their external features. Critical differences between A. fraterculus and A. obliqua are: A. A. frateculus: a. Aculeus usually longer than the distance on vein M from the junction of MP and M to vein r-m. b. Subscutellum darkened laterally B. A. obliqua: a. Aculeus always shorter than the distance on vein M from the junction of MP and M to vein r-m. b. Subscutellum not darkened laterally. The apical arm of the S band of A. fraterculus is narrow compared with that of A. suspensa. There is frequently a distinct scutoscutellar black spot, but it is usually smaller than in A. suspensa. One of the most important distinguishing features is the nature of the aculeus tip, which has serrations only on its apical third in contrast to that of A. obliqua (Foote, Blanc and Norrbom 1993). 8.3.2.2 Morphological - Larvae - Not available/included in this edition 8.3.2.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from A. distincta, A. ludens, A. obliqua, or A. suspensa. PCR-RFLP Test 1: data not available PCR-RFLP Test 2: No individual restriction enzymes are diagnostic, but a selection will differentiate A. fraterculus from other Anastrepha and from species within other genera Allozyme eletrophoresis: data not available 106 HOST RANGE Anastrepha fraterculus has been recorded on hosts from a wide range of families. These include: Actinidiaceae, Anacardiaceae, Annonaceae, Combretaceae, Ebenaceae, Fabaceae, Juglandaceae, Lauraceae, Lythraceae, Malvaceae, Moraceae, Myrtaceae, Oleaceae, Oxalidaceae, Rosaceae, Rubiaceae, Rutaceae, Sapotaceae and Vitaceae (for a full list of recorded hosts see CABI 2007). Major commercial hosts (UF & FDACS 2009; CABI 2007): Scientific name Common name Scientific name Common name Annona cherimola cherimoya Prunus persica peach Citrus spp. citrus Psidium guajava guava Eugenia uniflora Surinam cherry Syzygium jambos rose apple DISTRIBUTION Northern Mexico south to northern Argentina, Trinidad; introduced to Galapagos Is.; occasionally trapped in USA (southern Texas), but not currently established (Carroll et al. 2002). REMARKS Anastrepha fraterculus is believed to belong to a group of closely related sibling species which, to date, have not been identified and described. In addition, it is very close to A. obliqua and A. suspensa. Consequently, A. fraterculus is difficult to diagnose and its exact area of distribution uncertain. It is regarded as a species of major economic importance (pers. comm. Drew 2010). PEST STATUS Exotic High priority pest identified in the Citrus IBP Anastrepha fraterculus is an important pest of guavas and mangoes, and also to some extent of Citrus spp. and Prunus spp. ATTRACTANT No known record, but can be captured in traps emitting ammonia. 107 FIGURES Figure 21. Anastrepha fraterculus Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) Figure 22. Anastrepha fraterculus Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 108 8.3.3 Anastrepha grandis (Macquart) TAXONOMIC INFORMATION Common name: South American cucurbit fruit fly Previous scientific names: Tephritis grandis Anastrepha latifasciata Anastrepha schineri DIAGNOSIS 8.3.3.1 Morphological – Adult Wing entirely infuscated from anterior margin to vein R4+5, a transverse band across r-m and curving back to anal streak, infuscation around dm-cu; ovipositor eversible membrane with large hook-like scales, apex of aculeus with 2 ridges, one on dorsal surface and the other on ventral surface. 8.3.3.2 Morphological – Larvae See Pest Fruit Flies of the World - Larvae via delta-intkey.com/ffa Website 8.3.3.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: DdeI and Sau3A are fully diagnostic DdeI:850, 270, 220,120; Sau3A: 770, 530, 110, 80 Allozyme eletrophoresis: data not available HOST RANGE Attacks fruit of Cucurbitaceae and Myrtaceae DISTRIBUTION Venezuela to Brazil, Argentina REMARKS A distinct species based on wing patterns, not likely to pose a threat to Australia PEST STATUS Exotic A pest of cucurbitaceae but cucurbit pest species of Tephritidae have a poor record for being distributed round the world ATTRACTANT No known record 109 FIGURES Figure 23. Anastrepha grandis female Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 14 October 2015) Figure 24. Anastrepha grandis wing Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 14 October 2015) 110 Figure 25. Anastrepha grandis Image courtesy of the United States Department of Agriculture Figure 26. Anastrepha grandis Image courtesy of the United States Department of Agriculture 111 8.3.4 Anastrepha ludens (Loew) TAXONOMIC INFORMATION Common name: Mexican fruit fly Previous scientific names: Trypeta ludens Acrotoxa ludens Trypeta (Acrotoxa) ludens DIAGNOSIS 8.3.4.1 Morphological - Adult Anastrepha ludens is characterized by a relatively long aculeus and oviscape, the former 3.4 - 4.7mm long and the latter correspondingly long and tapering in its apical third. This external character alone will alert the identifier to the possibility of A. ludens. The apical third of the aculeus tip is slightly expanded in the area of the lateral serrations, which are relatively few and not prominent. Anastrepha suspensa and A. fraterculus differ in having a much shorter aculeus and aculeus tip with more prominent lateral serrations and by other characters as well. Anastrepha ludens usually has a pair of lateral dark spots on the subcutellum which typically extend ventrally onto the mediotergite. The V band is usually not connected to the S band and is faint anteriorly in most specimens (Foote, Blanc and Norrbom 1993). 8.3.4.2 Morphological - Larvae - Not available/included in this edition 8.3.4.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from A. fraterculus, A. distincta, A. obliqua or A. suspensa. PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 650 bp BsrI: DNC SnaBI: DNC HhaI: DNC SspI: DNC HinfI: 550 Vspl: 550 Sau3AI: DNC PCR-RFLP Test 2: There are no fully diagnostic restriction enzymes for A. ludens. HinfI will distinguish the group A. ludens and A. suspensa, species which cannot be distinguished from each other Allozyme electrophoresis: data not available HOST RANGE Anastrepha ludens has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Caricaceae, Clusiaceae, Ebenaceae, Lauraceae, Lythraceae, Myrtaceae, Passifloraceae, Rosaceae, Rubiaceae, Rutaceae and Sapotaceae (for a full list of recorded hosts see CABI 2007). 112 Major commercial hosts (UF & FDACS 2009; CABI 2007): Scientific name Common name Scientific name Common name Annona cherimola cherimoya Mangifera indica mango Citrus spp. citrus Prunus persica peach DISTRIBUTION Texas, United States, south through Mexico to Costa Rica (Foote, Blanc and Norrbom 1993). REMARKS Anastrepha ludens is a well-defined and clearly distinct species, although there is a possibility of a separate but nearly indistinguishable form in the extreme southern part of its distribution in Costa Rica (UF & FDACS 2009). PEST STATUS Exotic High priority pest identified in Citrus IBP Anastrepha ludens is serious pest of Citrus spp. and mangoes ATTRACTANT No known record, but can be captured in traps emitting ammonia. 113 FIGURES Figure 27. Anastrepha ludens Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) Figure 28. Anastrepha ludens Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 114 8.3.5 Anastrepha obliqua (Macquart) TAXONOMIC INFORMATION Common name: West Indian fruit fly Previous scientific names: Tephritis obliqua Anastrepha obliqua DIAGNOSIS 8.3.5.1 Morphological - Adult Externally, Anastrepha obliqua quite closely resembles A. fraterculus and A. suspensa, thereby presenting problems in their separation. However, a number of characters exist that appear to be critical in separating A. obliqua from A. fraterculus. The aculeus is subtly different from those of A. fraterculus and A. suspensa, having lateral serrations on more than two-thirds of the tip in contrast to those of the other species, where they are limited to the apical two-fifths to three-fifths of the tip. In A. obliqua, the tip also is relatively wider at the base of the serrations compared with the width at the genital opening. The white medial vitta on the scutum is wider in A. obliqua than in A. suspensa and A. fraterculus, and no scutoscutellar black spot or lateral dark marks on the subscutellum are present, although the mediotergite usually has a lateral dark stripe (Foote, Blanc and Norrbom 1993). 8.3.5.2 Morphological - Larvae - Not available / included in this edition 8.3.5.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from A. fraterculus, A. distincta, A. ludens, or A. suspensa. PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 670 bp BsrI: DNC SnaBI: DNC HhaI: DNC SspI: 150, 550 HinfI: 270, 450 Vspl: 550 Sau3AI: 200, 450 PCR-RFLP Test 2: HinfI, Sau3A and SspI are diagnostic HinfI: 610, 270, 240,150,110, 80, 70; Sau3A: 770, 450, 200-170, 110; SspI: 1400,110 Allozyme electrophoresis: data not available HOST RANGE Anastrepha obliqua has been recorded on hosts from a range of families. These include: Anacardiaceae, Ebenaceae, Malpighiaceae, Moraceae, Myrtaceae, Oxalidaceae, Passifloraceae, Rosaceae, Rubiaceae, Rutaceae and Sapotaceae (for a full list of recorded hosts see CABI 2007). 115 Major commercial hosts (CABI 2007): Scientific name Common name Scientific name Common name Mangifera indica mango Spondias purpurea purple mombin DISTRIBUTION Throughout the greater and lesser Antilles, Jamaica, Trinidad, the Rio Grande Valley of Texas, Mexico to Panama, Venezuela, Ecuador, and the vicinity of Rio de Janeiro, Brazil (UF & FDACS 2009). REMARKS Anastrepha obliqua, along with A. fraterculus and A. suspensa, is best recognised by the wing colour pattern (Figure 30). It is one of the most widely distributed Anastrepha species, having been recorded from Florida (USA), Southern and Central America and the West Indian islands. It is an important pest of mangoes, guava, rose apple and Spondias (pers. comm. Drew 2010). PEST STATUS Exotic Anastrepha obliqua is one of the most important fruit fly pests of mango in Central and Southern America ATTRACTANT No known record, but can be captured in traps emitting ammonia. 116 FIGURES Figure 29. Anastrepha obliqua Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) Figure 30. Anastrepha obliqua Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 117 8.3.6 Anastrepha serpentina (Wiedemann) TAXONOMIC INFORMATION Common name: Sapote fruit fly Previous scientific names: Dacus serpentinus Acrotoxa serpentinus Anastrepha serpentina DIAGNOSIS 8.3.6.1 Morphological - Adult As in Anastrepha ocresia and a few non-U.S. Anastrepha species, the very dark wing markings of A. serpentina contrast strongly with the light hyaline areas of the wing. The S band is quite slender and is not connected to the proximal area of the V band, the apical arm of which is absent in all specimens. Anastrepha serpentina and A. ocresia are the only species of Anastrepha occurring in the United States that have a distinct pale yellow to hyaline area in cell r 1 immediately posterior to the pterostigma, but the former may be distinguished from the latter by the complete absence of the distal arm of the V band and the difference in abdominal markings. The scutum of the species is characterised by contrasting light and dark markings; the subscutellum and mediotergite are very dark, with a lighter brownish or yellowish spot or stripe dorsally (Foote et al. 1993). 8.3.6.2 Morphological - Larvae - Not available/included in this edition 8.3.6.3 Molecular DNA barcoding: BOLD reference data available, but not well resolved amongst a number of other species in BOLD. Low divergence clades may be apparent and used in conjunction with other information about the specimen may still be sufficient to make a confident identification. PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 750 bp BsrI: DNC SnaBI: DNC HhaI: DNC SspI: DNC HinfI: DNC Vspl: 250, 420 Sau3AI: 200, 530 PCR-RFLP Test 2: AluI and DdeI are fully diagnostic AluI: 800-790, 340-330, 240, 120; DdeI: 830-800, 270, 220, 210 Allozyme electrophoresis: data not available HOST RANGE Anastrepha serpentina has been recorded on hosts from eight families. These include: Anacardiaceae, Annonaceae, Clusiaceae, Lauraceae, Myrtaceae, Rosaceae, Rutaceae and Sapotaceae (for a full list of recorded hosts see CABI 2007). 118 Major commercial hosts (CABI 2007): Scientific name Common name Scientific name Common name Chrysophyllum cainito cainito Manilkara zapota sapodilla Citrus spp. citrus DISTRIBUTION Northern Mexico south to Peru and northern Argentina. Also known from Trinidad & Tobago and Curaçao (Norrbom 2003). REMARKS Anastrepha serpentina is distinguished by its very dark wing patterns (Figure 32). It is most prevalent in Mexico, Southern and Central America, as far south as Brazil. It has a wide host range but is not considered to be of significant economic importance (pers. comm. Drew 2010). PEST STATUS Exotic Not considered to be of significant economic importance ATTRACTANT No known record, but can be captured in traps emitting ammonia. 119 FIGURES Figure 31. Anastrepha serpentina Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) Figure 32. Anastrepha serpentina Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 120 8.3.7 Anastrepha striata (Schiner) TAXONOMIC INFORMATION Common name: Guava fruit fly Previous scientific names: DIAGNOSIS 8.3.7.1 Morphological - Adult A small to medium-sized species with a “normal” Anastrepha wing pattern, A. striata is one of the few species occurring in the United States that has distinct dark scutal markings in addition to darkening along the scutoscutellar suture. On the sublateral dark scutal areas, a pair of dense patches of short, brownish black setae is present, as well as some hoary pile visible only when viewed from in front, but the lateral half of the scutal brown stripe is denuded. Anastrepha striata is the only U.S. species having such scutal characters. The aculeus tip is distinctly broad and wedge-shaped with a very blunt apex and extremely fine lateral serrations. The size of the hyaline mark at the apex of vein R1 varies considerably (Foote et al. 1993). 8.3.7.2 Morphological - Larvae - Not available/included in this edition 8.3.7.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: RsaI is diagnostic, but additional restriction enzymes are needed for a robust identification RsaI: 480-450, (370-360) x2, 290 Allozyme electrophoresis: data not available HOST RANGE Anastrepha striata has been recorded on hosts from a range of families. These include: Anacardiaceae, Annonaceae, Combretaceae, Ebenaceae, Euphorbiaceae, Lauraceae, Myrtaceae, Rosaceae, Rutaceae and Sapotaceae (for a full list of recorded hosts see CABI 2007). Major commercial hosts (CABI 2007): Scientific name Common name Psidium guajava guava DISTRIBUTION Southern Texas, Mexico, Central America, south to Peru, Bolivia and Brazil. Also found in Trinidad, West Indies (UF & FDACS 2009). REMARKS Anastrepha striata is a smaller species of Anastrepha and best diagnosed by the distinct dark colour markings on the scutum, composed of a U-shaped black pattern. It is present in Mexico, Central America and most of Southern America. It is primarily a pest of guava (pers. comm. Drew 2010). 121 PEST STATUS Exotic ATTRACTANT No known record, but can be captured in traps emitting ammonia. FIGURES Figure 33. Anastrepha striata Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 122 8.3.8 Anastrepha suspensa (Loew) TAXONOMIC INFORMATION Common name: Caribbean fruit fly Previous scientific names: Trypeta suspensa Acrotoxa suspensa Trypeta (Acrotoxa) suspensa DIAGNOSIS 8.3.8.1 Morphological - Adult Anastrepha suspensa possesses external characters that closely resemble those of A. fraterculus and A. obliqua; therefore, the separation of these three species is sometimes difficult. One of the most obvious distinguishing marks in A. suspensa is the presence (except in some specimens from Jamaica) of a dark spot at the junction of the scutum and scutellum. This spot is sometimes present in A. fraterculus but is usually smaller, and it is absent in A. obliqua. The apical part of the S band in A. suspensa is relatively wide compared with that in the other two species, and its inner margin is less concave. It covers the apex of vein M or ends immediately anterior to it, whereas in the other two species it normally ends well anterior to the apex of vein M, or its inner margin is strongly concave. As in the identification of other species of Anastrepha, the shape of the aculeus tip is important. In A. suspensa, as in A. fracterculus, the serrations occupy no more than three-fifths of the tip, whereas those in A. obliqua occupy at least two-thirds; this character is variable and should be used with care (Foote et al. 1993). 8.3.8.2 Morphological - Larvae - Not available/included in this edition 8.3.8.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from A. distincta, A. fraterculus, A. ludens, or A. obliqua PCR-RFLP Test 1: data not available PCR-RFLP Test 2: There are no fully diagnostic restriction enzymes for A. ludens. HinfI will distinguish the group A. ludens and A. suspensa, species which cannot be distinguished from each other Allozyme electrophoresis: data not available HOST RANGE Anastrepha suspensa has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Arecaceae, Canellaceae, Caricaceae, Chrysobalanaceae, Clusiaceae, Combretaceae, Curcurbitaceae, Ebenaceae, Lauraceae, Lythraceae, Malpighiaceae, Moraceae, Myrtaceae, Oxalidaceae, Polygonaceae, Rosaceae, Rutaceae, Salicaceae, Sapindaceae, Sapotaceae and Solanaceae (for a full list of recorded hosts see CABI 2007). 123 Major commercial hosts (CABI 2007; UF & FDACS 2009): Scientific name Common name Scientific name Common name Annona reticulata bullock's heart Prunus persica peach Eugenia uniflora Surinam cherry Psidium guajava guava Fortunella margarita oval kumquat Syzygium jambos rose apple Manilkara zapota sapodilla Terminalia catappa Singapore almond DISTRIBUTION Cuba, Jamaica, Hispaniola, Puerto Rico, southern Florida, (United States) (UF & FDACS 2009). REMARKS Along with Anastrepha obliqua and A. fraterculus, A. suspensa is very difficult to identify. These species all have similar wing colour patterns and A. fraterculus is suspected of belonging to a complex of closely related species. Generally, A. suspensa possesses a dark spot on the posterocentral area of the scutum where it joins the scutellum. A. suspensa is distributed in Florida (USA), the Bahamas and the West Indies, has a wide host range and is considered to be of major economic importance (pers. comm. Drew 2010). PEST STATUS Exotic Major economic importance ATTRACTANT No known record, but can be captured in traps emitting ammonia. FIGURES Figure 34. Anastrepha suspensa Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 124 Figure 35. Anastrepha suspensa Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 125 Species diagnosis: Bactrocera & Dacus (Tephritidae: Dacinae: Dacini) 8.4.1 Bactrocera (Bactrocera) albistrigata (de Meijere) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus albistrigatus Dacus (Bactrocera) albistrigata DIAGNOSIS 8.4.1.1 Morphological - Adult A medium sized species; face fulvous with a pair of circular to oval black spots; postpronotal lobes yellow (anteromedial corners black); notopleura yellow; scutum mostly black; lateral postsutural vittae present; medial postsutural vitta absent; mesopleural stripe reaching to anterior npl. seta dorsally; scutellum yellow with a broad black basal band; wing with a narrow fuscous costal band which is extremely pale beyond extremity of cell sc to apex of wing, a narrow dark fuscous transverse band across wing enclosing r-m and dm-cu crossveins, a broad fuscous to dark fuscous anal streak; cells bc and c pale fuscous; microtrichia in outer corner of cell c only; abdominal terga III-V orange-brown with a narrow to medium width medial longitudinal dark fuscous to black band over all three terga and lateral dark markings which vary from narrow anterolateral dark fuscous to black corners on all three terga to broad lateral longitudinal dark fuscous to black bands over all three terga; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew and Romig 2013). For potentially morphologically confounding species see REMARKS or Table 8. 8.4.1.2 Morphological - Larvae See White and Elson-Harris 1992 p. 176. 8.4.1.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR–RFLP Test 1: approximate ITS1 fragment length: 850 bp Bsr1: DNC SnaB1: DNC HhaI: 670, 180 SspI: 180, 620 HinfI: DNC Vspl: DNC Sau3a1: 400, 450 PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available 126 HOST RANGE Bactrocera albistrigata has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Apocynaceae, Combretaceae, Moraceae, Myrtaceae and Verbenaceae (for a full list of recorded hosts see Allwood et al. 1999). Major commercial hosts (Allwood et al. 1999; Drew and Romig 2013): Scientific name Common name Scientific name Common name Mangifera indica mango Syzygium malaccense malay-apple Syzygium aqueum watery rose-apple Syzygium samarangense water apple DISTRIBUTION Andaman Islands, central to southern Thailand, Peninsular Malaysia, East Malaysia and Kalimantan (Borneo), Singapore, Indonesia east to Sulawesi, Christmas Island (Drew and Romig 2013). REMARKS Bactrocera albistrigata belongs to the frauenfeldi complex described by Drew (1989). The other species in the complex, B. caledoniensis, B. frauenfeldi, B. parafrauenfeldi and B. trilineola all possess the same basic body and wing colour patterns. See Table 8 for characters separating these species. 127 Table 8. Bactrocera frauenfeldi complex and similar species (best diagnostic characters in bold). B. frauenfeldi B. albistrigata B. trilineola B. parafrauenfeldi B. caledoniensis B. kirki * B. psidii* exotic/ Australian/ pest pest, present QLD pest, exotic (SE Asia) pest, exotic (Vanuatu) host not known, present NT no economic hosts, exotic (New Caledonia) pest, exotic (Samoa Tonga, Niue, Tahiti) pest, exotic (New Caledonia) face facial spots facial spots black mask facial spots no markings facial spots facial spots lateral vittae very short tapered or medium tapered or moderately broad & long moderately broad & long absent none or present as short narrow tawny coloured spots moderately broad & long absent medium length tapered vittae ppn lobes black or fuscous or partly to mostly orangey yellow mostly yellow fuscous to black black mostly yellow mostly yellow mostly yellow scutellum broad black basal band or triangle or broad band to apex broad black basal band broad black band to apex broad black band to apex broad black basal band about 1/3 of scutellum broad black band to apex large black triangle legs fuscous to black hind tibiae, mid & hind femora dark apically hind tibiae fuscous, femora generally fulvous tending redbrown apically hind tibiae fuscous, hind femora fuscous apically all tibiae fuscous, mid and hind femora black apically hind tibiae fuscous fuscous tibiae, femora fulvous all segments pale abdomen broad medial line and 2 broad lateral longitudinal bands narrow or medium medial line , darkened lateral margins varying from narrow elongate antero-lateral corners on T3T5 to 2 broad lateral longitudinal bands very broad medial line and 2 broad lateral longitudinal bands broad medial line and 2 broad lateral longitudinal bands all terga black except for narrow fuscous band on T5 broad medial line and 2 broad lateral longitudinal bands all terga black except for narrow fuscous band on T5 wing transverse band transverse band transverse band transverse band transverse band tinge around r-m and dm-cu cross veins that may appear to be faint band tinge around r-m and dm-cu cross veins that may appear to be faint band *not frauenfeldi complex 128 The B. frauenfeldi complex can be separated from other members of the subgenus (Bactrocera (Bactrocera)) by the presence of a dark crossband from the pterostigma (cell sc), which also includes both the r-m and dm-cu crossvein. This runs roughly parallel to the anal stripe (diagonal mark across wing base). However, the costal band is very pale and often not visible at all beyond apex of R2 + 3. PEST STATUS Exotic Medium level pest species ATTRACTANT Cue lure. FIGURES Figure 36. Bactrocera albistrigata Images courtesy of Ken Walker, Museum Victoria, www.padil.gov.au (as of 22 August 2011) 129 Figure 37. Bactrocera albistrigata Image courtesy of S. Phillips and the International Centre for the Management of Pest Fruit Flies, Griffith University 130 8.4.2 Bactrocera (Bactrocera) aquilonis (May) TAXONOMIC INFORMATION Common name: Northern Territory fruit fly Previous scientific names: Strumeta aquilonis Dacus (Bactrocera) aquilonis DIAGNOSIS 8.4.2.1 Morphological - Adult Medium sized species; large black facial spots present; postpronotal lobes and notopleura yellow; scutum pale red-brown with fuscous markings, mesopleural stripe reaching almost to anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a narrow fuscous costal band and broad fuscous anal streak, cells bc and c fuscous, microtrichia covering cell c and most of cell bc; abdominal terga III-V pale orange-brown with pale fuscous along anterior margin of tergum III and widening over lateral margins of that tergum, a medial longitudinal pale fuscous band on terga III to V; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.2.2 Morphological – Larvae See White and Elson-Harris 1992 p. 179. 8.4.2.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from B. neohumeralis or B. tryoni PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 850 bp BsrI: 600, 200 SnaBI: DNC HhaI: 650, 200 SspI: 570, 180 HinfI: 770 Vspl: DNC Sau3a1: 420 PCR-RFLP Test 2: SspI produces a B. tryoni species complex diagnostic restriction pattern; fragment sizes (bp) are 1000, 550 and 100. This species cannot be distinguished from B. neohumeralis or B. tryoni. Other restriction patterns useful for diagnosis of the complex are listed in Appendix 3, with choice based on relative distinctiveness from other species potentially trapped; descriptions of the patterns are given in Appendix 4. Cameron et al. (2010) found that there is no genetic evidence supporting the separation of B. aquilonis and B. tryoni as distinct species. Allozyme electrophoresis: data not available 131 HOST RANGE Bactrocera aquilonis has been recorded on hosts from a wide range of families. These include: Annonaceae, Arecaceae, Chrysobalanaceae, Combretaceae, Curcurbitaceae, Ebenaceae, Elaeocarpaceae, Euphorbiaceae, Lauraceae, Meliaceae, Myrtaceae, Rosaceae, Rubiaceae, Rutaceae, Santalaceae and Sapotaceae (for a full list of recorded hosts see Smith et al. 1988; Hancock et al. 2000). Major commercial hosts (CABI 2015; Hancock et al. 2000; pers. comm. Drew 2010): Scientific name Common name Scientific name Common name Anacardium occidentale cashew nut Flacourtia rukam rukam Annona muricata soursop Fortunella x crassifolia meiwa kumquat Annona reticulata bullock's heart Lycopersicon esculentum tomato Annona squamosa sugarapple Malpighia glabra acerola Averrhoa carambola carambola Malus domestica apple Blighia sapida akee apple Mangifera indica mango Capsicum annuum bell pepper Manilkara zapota sapodilla Chrysophyllum cainito caimito Prunus persica peach Citrus limon lemon Psidium guajava guava Citrus maxima pummelo Psidium littorale var. longipes strawberry guava Citrus reticulata mandarin Spondias dulcis otaheite apple Citrus x paradisi grapefruit Syzygium aqueum watery rose-apple Eriobotrya japonica loquat Syzygium jambos rose apple Eugenia uniflora Surinam cherry Syzygium malaccense malay-apple Flacourtia jangomas Indian plum Ziziphus mauritiana jujube DISTRIBUTION Northern areas of Western Australia and the Northern Territory (Hancock et al. 2000). REMARKS In the Northern Territory this species dramatically increased its host range during 1985. Since B. aquilonis and B. tryoni will produce viable offspring when crossed in the laboratory (Drew and Lambert 1986), hybridisation with B. tryoni was strongly suspected and might explain this increase (Smith and Chin 1987; Smith et al. 1988). By 1997, most but not all commercial production areas and larger towns supported populations of this fly, which attacks a wide range of cultivated hosts. Therefore, many of the Northern Territory host records for B. aquilonis since March 1985 are attributed to the suspected hybrid B. aquilonis x B. tryoni and are recorded under B. tryoni and not under B. aquilonis in the above table (Hancock et al. 2000). Bactrocera aquilonis and B. tryoni are very similar in general body and wing colour patterns. Bactrocera aquilonis differs in being an overall paler colour with the scutum pale red-brown and the abdominal terga generally fulvous without distinct fuscous markings. However, these differences are not easily observed. Also these species can be separated on the differences on the ovipositors: apex of aculeus rounded and spicules with 7-10 uniform dentations in B. tryoni compared with the more pointed aculeus and uneven dentations in B. aquilonis (Drew 1989). 132 A recent molecular genetic study of northwestern Australian fruit fly populations (Cameron et al. 2010) concluded that there is no genetic evidence supporting B. aquilonis as a distinct species from B. tryoni. They conclude that the recent increase in host range of fruit flies in northwestern Australia is due to local populations of B. tryoni (= B. aquilonis) utilising additional food resources from increased agricultural production in this region. Currently, B. aquilonis is regarded as belonging to a species complex including B. tryoni and neohumeralis. Further research is currently being undertaken. PEST STATUS Endemic Minor pest species ATTRACTANT Cue lure. FIGURES Figure 38. Bactrocera aquilonis Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University 133 Figure 39. Bactrocera aquilonis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 134 8.4.3 Bactrocera (Paratridacus) atrisetosa (Perkins) TAXONOMIC INFORMATION Common name: Previous scientific names: Zeugodacus atrisetosus Melanodacus atrisetosus DIAGNOSIS 8.4.3.1 Morphological - Adult Medium sized species; small fuscous facial spots present; postpronotal lobes and notopleura yellow; scutum red-brown with irregularly shaped fuscous markings, mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae beginning anterior to mesonotal suture, medial postsutural vitta present, scutellum yellow; wing with a narrow fuscous costal band and anal streak, cells bc and c pale fulvous with microtrichia in outer ½ of cell c only; abdominal terga III-V orange-brown occasionally with fuscous on lateral margins of tergum III and generally with narrow medial fuscous band on tergum V; posterior lobe of male surstylus long; female with aculeus tip blunt trilobed (Drew 1989; pers. comm. Drew 2010). 8.4.3.2 Morphological - Larvae - Not available/included in this edition 8.4.3.3 Molecular DNA barcoding: BOLD reference data not available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available HOST RANGE This species has been reared from eight host species in seven genera and three families, and is mainly associated with cucurbits: watermelons, honeydew and rock melons, cucumbers, pumpkins, zucchini, luffa and tomatoes (Leblanc et al. 2012). Major commercial hosts (Drew 1989): Scientific name Common name Scientific name Common name Citrullus lanatus watermelon Cucurbita pepo ornamental gourd Cucumis sativus cucumber Lycopersicon esculentum tomato DISTRIBUTION Known only from mainland Papua New Guinea (LeBlanc et al. 2001) 135 REMARKS Bactrocera atrisetosa is distinguished in having the costal band narrow (just overlapping R 2+3), scutum red-brown, wings colourless, cells bc and c pale fulvous, abdominal terga III-V orange-brown except for a narrow medial longitudinal fuscous band on tergum V and lateral margins of tergum III fuscous (Drew 1989). Bactrocera atrisetosa is very similar in appearance to the endemic B. cucumis but differs in having prescutellar and supra-alar setae present. In common with B. cucumis it also lacks pecten. PEST STATUS Exotic Medium level pest species ATTRACTANT No known record. FIGURES Figure 40. Bactrocera atrisetosa Image courtesy of Mr. S. Wilson and the International Centre for the Management of Pest Fruit Flies, Griffith University 136 Figure 41. Bactrocera atrisetosa Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 137 8.4.4 Bactrocera (Bactrocera) bryoniae (Tryon) TAXONOMIC INFORMATION Common name: Previous scientific names: Chaetodacus bryoniae Strumeta bryoniae Dacus (Strumeta) bryoniae DIAGNOSIS 8.4.4.1 Morphological - Adult Large species; irregularly circular black facial spots present; postpronotal lobes and notopleura yellow; scutum dull black, mesopleural stripe slightly wider than notopleuron, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a broad fuscous costal band and anal streak, cells bc and c fulvous, microtrichia covering outer ½ of cell c only; abdominal terga III-V orange-brown with a medial and two lateral longitudinal dark bands joined along anterior margin of tergum III; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.4.2 Morphological - Larvae - Not available/included in this edition 8.4.4.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 820 bp BsrI: 600, 230 SnaBI: DNC HhaI: 620, 200 SspI: 560, 180 HinfI: 760 Vspl: DNC Sau3A1: 400 PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available HOST RANGE Bactrocera bryoniae has been recorded on hosts from five families. These include: Curcurbitaceae, Loganiaceae, Musaceae, Passifloraceae and Solanaceae (for a full list of recorded hosts see Hancock et al. 2000). Major commercial host (Drew 1989; Hancock et al. 2000): Scientific name Common name Capsicum annuum chilli Infests wild species of Cucurbitaceae, Loganiaceae and Passifloraceae (Hancock et al. 2000). Records from banana and capsicum (Drew 1989) were from Papua New Guinea, not Queensland. 138 DISTRIBUTION Widespread and common all over Indonesia (Papua, formerly part of Irian Jaya), Papua New Guinea (every province except Bougainville and Manus), and Australia (Northern Western Australia, Northern Territory, east coast south to Sydney, New South Wales, and the Torres Strait Islands) (Drew and Romig 2013). REMARKS There are a number of species in Southeast Asia and the South Pacific with broad costal bands. However, Bactrocera bryoniae differs from these species in having costal band confluent with R4+5, lateral postsutural vittae ending at upper pa. seta, abdominal terga III-V red-brown with a broad, dark fuscous band along anterior margin of tergum III and covering lateral margins, anterolateral corners of terga IV and V fuscous and a medial longitudinal dark fuscous band over all 3 terga (Drew 1989). PEST STATUS Endemic Low level pest species in Queensland but not in Western Australia or the Northern Territory ATTRACTANT Cue group. In north Qld this species was significantly more attracted to raspberry ketone formate (Melolure) than cue-lure (Royer 2015). FIGURES Figure 42. Bactrocera bryoniae Image courtesy of S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and the Queensland Museum 139 Figure 43. Bactrocera bryoniae Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 140 8.4.5 Bactrocera (Bactrocera) carambolae (Drew and Hancock) TAXONOMIC INFORMATION Common name: Carambola fly DIAGNOSIS 8.4.5.1 Morphological - Adult Face fulvous with a pair of medium sized oval black spots; scutum dull black with brown behind lateral postsutural vittae, around mesonotal suture and inside postpronotal lobes; postpronotal lobes and notopleura yellow; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta dorsally; two broad parallel sided lateral postsutural vittae ending at or behind ia. seta; medial postsutural vitta absent; scutellum yellow; legs with femora fulvous with a large elongate oval dark fuscous to black preapical spot on outer surfaces of fore femora in some specimens, tibiae dark fuscous (except mid tibiae paler apically); wings with cells bc and c colourless, microtrichia in outer corner of cell c only, a narrow fuscous costal band slightly overlapping R2+3 and expanding slightly beyond apex of R2+3 across apex of R4+5, a narrow fuscous anal streak; supernumerary lobe of medium development; abdominal terga III-V orange-brown with a ‘T’ pattern consisting of a narrow transverse black band across anterior margin of tergum III and widening to cover lateral margins, a medium width medial longitudinal black band over all three terga, anterolateral corners of terga IV dark fuscous to black and rectangular in shape and anterolateral corners of tergum V dark fuscous, a pair of oval orange-brown shining spots on tergum V; abdominal sterna dark coloured; posterial lobe of male surstylus short; female with aculeus tip needle shaped (Drew and Romig 2013). 8.4.5.2 Morphological – Larvae See White and Elson-Harris 1992 p. 193. 8.4.5.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 850 bp BsrI: 650, 250 SnaBI: 350, 530 HhaI: 680, 200 SspI: DNC HinfI: DNC Vspl: 355, 485 Sau3A1: 400, 450 PCR-RFLP Test 2: All restriction enzymes listed in Appendix 3, except SspI, distinguish B. carambolae from others in the B. dorsalis species complex. Choice of enzyme will be based on relative distinctiveness from other species potentially trapped; descriptions of the patterns are given in Appendix 4. Allozyme electrophoresis: data not available 141 HOST RANGE Bactrocera carambolae has been recorded on hosts from a wide range of families. These include: Alangiaceae, Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Clusiaceae, Combretaceae, Euphorbiaceae, Lauraceae, Loganiaceae, Meliaceae, Moraceae, Myristicaceae, Myrtaceae, Oleaceae, Oxalidaceae, Polygalaceae, Punicaceae, Rhamnaceae, Rhizophoraceae, Rutaceae, Sapindaceae, Sapotaceae, Simaroubaceae, Solanaceae and Symplocaceae (for a full list of recorded species see Allwood et al. 1999). Major commercial hosts (Allwood et al. 1999): Scientific name Common name Scientific name Common name Averrhoa carambola carambola Syzygium jambos rose apple Manilkara zapota sapodilla Syzygium malaccense malacca apple Psidium guajava guava Syzygium samarangense wax apple Syzygium aqueum watery rose-apple DISTRIBUTION Southern Thailand, Southern Vietnam, Peninsular Malaysia, East Malaysia, Kalimantan (Borneo), Singapore, Indonesian islands east to Sumbawa, Andaman Islands, Surinam, French Guiana, Guyana, Brazil (Drew and Romig 2013). REMARKS Bactrocera carambolae is similar to B. propinqua and some specimens of B. dorsalis in possessing broad parallel sided or subparallel lateral postsutural vittae, costal band slightly overlapping R 2+3, abdominal terga III-V with narrow to medium width dark lateral margins, shining spots on abdominal tergum V pale (orange-brown to fuscous), femora entirely fulvous or with, at most, subapical dark spots on fore femora only, in addition to the general characteristics of the dorsalis complex. It differs from B. dorsalis in having a broad medial longitudinal black band on abdominal terga III-V, a broader costal band apically, and shorter male aculeus and female ovipositor and from B. propinqua in having a narrower medial longitudinal black band on abdominal terga III-V (in B. propinqua this band is very broad) and apex of the aculeus needle shaped (in B. propinqua the apex of the aculeus is trilobed). PEST STATUS Exotic High priority pest identified in the Tropical Fruit Industry Biosecurity Plan (IBP; Plant Health Australia) This species is a major economic pest throughout the region where it occurs ATTRACTANT Methyl eugenol. 142 FIGURES Figure 44. Bactrocera carambolae Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University Figure 45. Bactrocera carambolae Image courtesy of M. Romig, the International Centre for the Management of Pest Fruit Flies, Griffith University 143 8.4.6 Bactrocera (Bactrocera) caryeae (Kapoor) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus (Strumeta) caryeae Dacus (Bactrocera) caryeae DIAGNOSIS 8.4.6.1 Morphological - Adult Face fulvous with a pair of large elongate oval black spots; scutum black with a small area of dark brown posterolateral to lateral postsutural vittae; postpronotal lobes yellow (except anterodorsal corners fuscous); notopleura yellow; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta dorsally; two narrow lateral postsutural vittae which are either parallel sided or narrowing slightly posteriorly to end at or just before ia. seta; medial postsutural vitta absent; scutellum yellow with a broad black basal band; legs with femora fulvous with large dark fuscous to black preapical spots on outer surfaces of fore femora and inner surfaces of mid and hind femora, fore tibiae fuscous, mid tibiae fulvous, hind tibiae dark fuscous; wings with cells bc and c colourless, sparse microtrichia in outer corner of cell c only, a very narrow fuscous costal band confluent with R2+3 and remaining very narrow around apex of wing, a narrow fuscous anal streak contained within cell cup; supernumerary lobe of medium development; abdominal terga III-V orangebrown with dark fuscous to black across anterior 1/3 to 1/2 of tergum III, two broad lateral longitudinal dark fuscous to black bands and a narrow medial longitudinal black band over all three terga, a pair of oval orange-brown shining spots on tergum V; abdominal sterna dark coloured; posterial lobe of male surstylus short; female with aculeus tip needle shaped (Drew and Romig 2013). 8.4.6.2 Morphological - Larvae - Not available/included in this edition 8.4.6.3 Molecular DNA barcoding: BOLD reference data available. Diagnostic to the level of the B. dorsalis species complex, but difficult to resolve amongst several other species within the complex. See Table 3. PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available 144 HOST RANGE Bactrocera caryeae has been recorded on hosts from six families. These include: Anacardiaceae, Lecythidaceae, Malpighiaceae, Myrtaceae, Rutaceae and Sapotaceae (for a full list of recorded species see Allwood et al. 1999). Major commercial hosts (Allwood et al. 1999): Scientific name Common name Scientific name Common name Citrus maxima pummelo Mangifera indica mango Citrus reticulata mandarin Psidium guajava guava DISTRIBUTION Southern India (Drew and Romig 2013). REMARKS Bactrocera caryeae is similar to B. kandiensis and B. arecae in possessing narrow parallel sided lateral postsutural vittae, preapical dark markings on at least one pair of femora in addition to the general characteristics of the dorsalis complex. It differs from B. arecae in possessing preapical dark markings on all femora (in B. arecae the preapical dark markings are on fore femora only) and from B. kandiensis in possessing a broad medial longitudinal dark band and broad lateral longitudinal dark bands over abdominal terga III-V (Drew and Romig 2013). It may appear similar to the Australian ME-responsive species B. endiandrae (see diagnostician’s notes). PEST STATUS Exotic Bactrocera caryeae occurs in very large populations in many fruit growing areas of southern India and is probably responsible for much of the damage generally attributed to Bactrocera dorsalis ATTRACTANT Methyl eugenol. 145 FIGURES Figure 46. Bactrocera caryeae Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 146 8.4.7 Bactrocera (Bactrocera) correcta (Bezzi) TAXONOMIC INFORMATION Common name: Guava fruit fly Previous scientific names: Chaetodacus correctus Dacus (Strumeta) correctus DIAGNOSIS 8.4.7.1 Morphological - Adult Face fulvous with a pair of transverse elongate black spots almost meeting in centre; scutum black with dark red-brown along lateral and posterior margins; postpronotal lobes and notopleura yellow; mesopleural stripe reaching almost to anterior npl. seta dorsally; broad parallel sided lateral postsutural vittae ending behind ia. seta; medial postsutural vitta absent; scutellum yellow with narrow black basal band; legs with all segments entirely fulvous except hind tibiae pale fuscous; wings with cells bc and c colourless, both cells entirely devoid of microtrichia, a narrow pale fuscous costal band confluent with R2+3 and ending at apex of this vein, a small oval fuscous spot across apex of R4+5, anal streak absent but with a pale fuscous tint within cell cup; supernumerary lobe of medium development; abdominal terga III-V red-brown with a ‘T’ pattern consisting of a narrow transverse black band across anterior margin of tergum III and a narrow medial longitudinal black band over all three terga, narrow black anterolateral corners on terga IV and V, a pair of oval red-brown shining spots on tergum V; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew and Romig 2013). 8.4.7.2 Morphological - Larvae - Not available/included in this edition 8.4.7.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available 147 HOST RANGE Bactrocera correcta has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Cactaceae, Capparaceae, Caricaceae, Combretaceae, Curcurbitaceae, Dipterocarpaceae, Elaeocarpaceae, Euphorbiaceae, Flacourtiaceae, Lecythidaceae, Malpighiaceae, Meliaceae, Moraceae, Musaceae, Myristicaceae, Myrtaceae, Olacaceae, Oxalidaceae, Rhamnaceae, Rosaceae, Rutaceae, Sapindaceae, Sapotaceae and Simaroubaceae (for a full list of recorded hosts see Allwood et al. 1999). Major commercial hosts (Allwood et al. 1999; Drew and Romig 2013): Scientific name Common name Scientific name Common name Anacardium occidentale cashew nut Psidium guajava guava Mangifera indica mango Syzygium samarangense water apple Manilkara zapota sapodilla Terminalia catappa Singapore almond Mimusops elengi Spanish cherry Ziziphus jujuba common jujube Muntingia calabura Jamaican cherry DISTRIBUTION Sri Lanka, India, Nepal, Pakistan, Myanmar, northern Thailand, southern China, Bhutan, Peninsular Malaysia, Vietnam (Drew and Romig 2013). REMARKS Bactrocera correcta is similar to B. dorsalis in the general colour patterns of the body, wings and legs but differs from B. dorsalis in possessing transverse facial spots and an incomplete costal band. It is also similar to B. penecorrecta in the general colour patterns of the body and wings but differs from this species in having abdominal terga III-V mostly pale coloured (not mostly black as in B. penecorrecta) and the scutellum with a narrow black basal band (Drew and Romig 2013). PEST STATUS Exotic Major pest species, particularly in Vietnam ATTRACTANT Methyl eugenol. 148 FIGURES Figure 47. Bactrocera correcta Image courtesy of S. Phillips and the International Centre for the Management of Pest Fruit Flies, Griffith University 149 8.4.8 Bactrocera (Austrodacus) cucumis (French) TAXONOMIC INFORMATION Common name: Cucumber fruit fly Previous scientific names: Dacus tryoni var. cucumis Dacus cucumis Austrodacus cucumis Dacus (Austrodacus) cucumis DIAGNOSIS 8.4.8.1 Morphological - Adult Medium sized species; small fuscous to black facial spots present; postpronotal lobes and notopleura yellow; scutum orange-brown without dark markings, mesopleural stripe reaching almost to anterior npl. seta, lateral postsutural vittae beginning anterior to mesonotal suture, broad medial postsutural vitta present, scutellum yellow; wing with a narrow fuscous costal band and anal streak, cells bc and c pale fulvous (cell c slightly paler than cell bc), microtrichia in outer corner of cell c only; abdominal terga I and II orange-brown, terga III-V fulvous except for two broad lateral longitudinal orange-brown bands over all three terga and a narrow medial longitudinal band which is orange-brown on tergum III and orange-brown to dark fuscous on tergum IV and V (this band is broader on tergum V); posterior lobe of male surstylus long; female with aculeus tip blunt trilobed (Drew 1989; pers. comm. Drew 2010). 8.4.8.2 Morphological - Larvae See White and Elson-Harris 1992 p. 172. 8.4.8.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 750 bp BsrI: DNC SnaBI: DNC HhaI: 550, 180 SspI: DNC HinfI: DNC Vspl: DNC Sau3AI DNC PCR-RFLP Test 2: DraI, RsaI and SspI produce diagnostic restriction patterns (Appendix 3 and 4); DraI: 1250, 200, 120; RsaI: 570, 410, 300, 290; SspI: 880, 650 Allozyme electrophoresis: data not available HOST RANGE While cucurbits are the major hosts of this species, it has been reared at moderate to high levels from several other species in different plant families, including pawpaw and tomato (Hancock et al. 2000). The rare or incidental hosts (usually a single rearing) include mango, avocado, guava, carambola, apricot, some species of citrus, and capsicum. B. cucumis attacks wild cucurbits such as Diplocyclos palmatus and these may be reservoir hosts (CABI 2007). 150 Bactrocera cucumis has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Caricaceae, Combretaceae, Curcurbitaceae, Ebenaceae, Euphorbiaceae, Lauraceae, Myrtaceae, Oxalidaceae, Passifloraceae, Rosaceae, Rubiaceae, Rutaceae, Solanaceae and Vitaceae (for a full list of recorded hosts see Hancock et al. 2000). Major commercial hosts (Drew, 1989; Hancock et al. 2000): Scientific name Common name Scientific name Common name Carica papaya papaw Passiflora edulis passionfruit Cucumis sativus cucumber Solanum lycopersicum tomato Cucurbita moschata pumpkin Trichosanthes anguinea guada bean Cucurbita pepo squash and zucchini DISTRIBUTION Eastern Queensland appears to be the home range with Rockhampton as the centre of the range. It has been trapped very occasionally in New south Wales however these are likely to be transient populations or incursions that do not establish (Dominiak and Senior, in prep.). Hancock et al. (2000) list it as present in the Northern Territory and Torres Strait Islands but its presence there cannot be proven (pers. comm. Drew 2011). Although morphologically indistinguishable from Queensland specimens (Drew pers. comm. 2011), the Northern Territory strain does not infest commercial crops and in laboratory culture, failed to develop on undamaged cucurbit, solanaceous or other commercial hosts, but could be reared on sliced cucumber (Smith and Chin 1987). Vargas et al. 2015 place the species in Northern Territory and Queensland but the population is not continuous along the Gulf of Carpentaria. REMARKS Bactrocera cucumis is a pale orange-brown species with medial and lateral postsutural vittae present, a yellow scutellum, prsc. and sa. setae absent, 4 sc. seta present and a small elongate-oval black spot centrally on tergum V (Drew 1989). It appears similar to the exotic B. atrisetosa from PNG but lacks supra-alar and pre-scutellar bristles. Other remarks: In common with most species in, or close to, subgenus Zeugodacus, the scutum has three yellow vittae (lateral and medial stripes), four setae on the margin of the scutellum, and the males lack a deep V-shaped notch in posterior margin of 5th sternite. This species is unusual in that it also lacks both anterior supra-alar setae and prescutellar acrostichal setae, and the males lack a pecten (comb of setae on each postero-lateral corner of tergite 3) (CABI 2007). PEST STATUS Endemic Major pest species in Queensland. Regarded as a potential pest of fruit in the National Tropical Fruit IBP (page 26) ATTRACTANT No known attraction to male lures, although occasionally trapped at cue lure. It can be trapped using cucumber volatile blend or orange-ammonia in McPhail traps (Royer et al. 2014). 151 FIGURES Figure 48. Bactrocera cucumis Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum Figure 49. Bactrocera cucumis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 152 8.4.9 Bactrocera (Zeugodacus) cucurbitae (Coquillett) TAXONOMIC INFORMATION Common name: Melon fly Previous scientific names: Dacus cucurbitae Chaetodacus cucurbitae Strumeta cucurbitae Dacus (Strumeta) cucurbitae Dacus (Zeugodacus) cucurbitae Bactrocera cucurbitae DIAGNOSIS 8.4.9.1 Morphological - Adult Medium sized species; large black facial spots present; postpronotal lobes and notopleura yellow; scutum red-brown with or without fuscous markings, mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae beginning anterior to mesonotal suture, narrow medial postsutural vitta present, scuttelum yellow; wing with a broad fuscous costal band expanding into a fuscous spot at wing apex, a broad fuscous anal streak, dark fuscous along dm-cu crossvein, pale infuscation along r-m crossvein, cells bc and c colourless, microtrichia in outer corner of cell c only; abdominal terga III-V orange-brown except for a narrow transverse black band across anterior margin of tergum III which expands over anterolateral corners, a narrow medial longitudinal dark fuscous to black band over all three terga and anterolateral corners of terga IV and V fuscous; posterior lobe of male surstylus long; female with aculeus needle shaped (Drew 1989; Drew and Romig 2013). 8.4.9.2 Morphological – Larvae See White and Elson-Harris 1992 p. 268. 8.4.9.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 600 bp BsrI: DNC SnaBI: DNC HhaI: 400, 180 SspI: DNC HinfI: DNC Vspl: DNC Sau3AI: DNC PCR-RFLP Test 2: RsaI produces a highly diagnostic restriction pattern; other useful enzymes are AluI, CfoI, DraI, HinfI, Sau3A, SspI (Appendix 3 and 4) RsaI: 410, 400, 310, 290 Allozyme electrophoresis: data not available 153 HOST RANGE Bactrocera cucurbitae is primarily a pest of Cucurbitaceae, however it has also been recorded from eleven other families. These include: Agavaceae, Capparaceae, Fabaceae, Malvaceae, Moraceae, Myrtaceae, Rhamnaceae, Rutaceae, Sapotaceae, Solanaceae and Vitaceae (for a full list of recorded hosts see Allwood et al. 1999; Leblanc et al. 2012). Major commercial hosts (Drew 1989, Allwood et al. 1999): Scientific name Common name Scientific name Common name Coccinia grandis ivy gourd Cucurbita pepo ornamental gourd Cucumis melo melon Momordica charantia Trichosanthes cucumerina var. anguinea Cucumis satinus Cucurbita maxima snakegourd giant pumpkin DISTRIBUTION Widely distributed over Southeast Asia, the Indian subcontinent, southern China, northern Africa and Papua New Guinea. Introduced into the Mariana Islands, the Hawaiian Islands and from Papua New Guinea to the Solomon Islands. Present in Indonesia and East Timor. REMARKS Bactrocera cucurbitae is similar to B. emittens in possessing only a slight widening of the costal band in wing apex, a narrow infuscation along dm-cu crossvein and abdominal terga with ground colour fulvous but differs in having the spot on apex of costal band not reaching M, cells bc and c colourless, abdominal tergum III with a narrow transverse black band across base and tip of piercer of ovipositor needle shaped. The most distinctive characteristic of the adult is the wing pattern (Drew 1989). B. cucurbitae can appear similar to the endemic B. chorista widespread in eastern Qld. (see diagnostician’s notes) PEST STATUS Exotic High priority pest identified in the Tropical fruit and Vegetables IBPs Bactrocera cucurbitae is a very serious pest of cucurbit crops ATTRACTANT Cue-group. Melolure (raspberry ketone formate) was found to be a stronger attractant than cue-lure (Casana-Giner et al. 2003, Jang et al. 2007). 154 FIGURES Figure 50. Bactrocera cucurbitae Image courtesy of Ken Walker, Museum Victoria, www.padil.gov.au (as of 22 August 2011) Figure 51. Bactrocera cucurbitae Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum 155 Figure 52. Bactrocera cucurbitae Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 156 8.4.10 Bactrocera (Bactrocera) curvipennis (Froggatt) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus curvipennis Strumeta curvipennis Dacus (Strumeta) curvipennis DIAGNOSIS 8.4.10.1 Morphological - Adult Small species; very small pale fuscous facial spots present; postpronotal lobes and notoluera yellow; scutum black, mesopleural stripe reaching midway between anterior margin of notoplueron and anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a broad fuscous costal band and anal streak, a broad fuscous band along r-m crossvein, cells bc and c pale fuscous, microtrichia covering cell c and outer corner of cell bc; abdominal terga IIIV orange-brown with a narrow transverse fuscous band along anterior margin of tergum III merging into broad lateral black margins and with anterolateral corners of terga IV and V fuscous; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.10.2 Morphological - Larvae - Not available/included in this edition 8.4.10.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 850 bp BsrI: 570, 250 SnaBI: DNC HhaI: 620, 170 SspI: 550, 200 HinfI: DNC Vspl: DNC Sau3AI: 420 PCR-RFLP Test 2: RsaI and SspI produce diagnostic restriction patterns (Appendix 3 and 4); RsaI: 490, 460, 410, 290; SspI: 1020, 580, 100 Allozyme electrophoresis: data not available 157 HOST RANGE Bactrocera curvipennis has been recorded on hosts from 20 families (for a full list of recorded hosts see Leblanc et al. 2012). Major commercial hosts (Drew 1989; Leblanc et al. 2012): Scientific name Common name Scientific name Common name Citrus reticulata mandarin Mangifera indica mango DISTRIBUTION New Caledonia and one remote island in Vanuatu (Drew 1989). REMARKS Bactrocera curvipennis is distinct in having the mesopleural stripe not extending to the postpronotal lobes, microtrichia covering cell c and outer corner of cell bc, and abdominal terga III-V orange-brown with a very narrow transverse fuscous band across anterior margin of tergum III which merges into broad lateral black margins and the anterolateral corners of terga IV and V fuscous (Drew 1989). PEST STATUS Exotic ATTRACTANT Cue lure, Willison's lure. FIGURES Figure 53. Bactrocera curvipennis Image courtesy of Mr. S. Wilson and the International Centre for the Management of Pest Fruit Flies, Griffith University 158 Figure 54. Bactrocera curvipennis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 159 8.4.11 Bactrocera (Paradacus) decipiens (Drew) TAXONOMIC INFORMATION Common name: Pumpkin fruit fly Previous scientific names: Dacus (Paradacus) decipiens DIAGNOSIS 8.4.11.1 Morphological - Adult Large species; medium sized fuscous to black facial spots present; postpronotal lobes and notopluera yellow; scutum red-brown with two broad lateral longitudinal fuscous bands, mesoplural stripe reaching almost to anterior npl. seta, lateral postsutural vittae beginning anterior to mesonotal suture, broad medial postsutural vitta present, scutellum yellow: wing with a broad fucsous costal band and anal streak, an irregular recurved pale fuscous marking across wing, cells bc and c extremely pale fuscous (cell c paler in centre), microtrichia in outer 1/3 of cell c only; abdominal terga I-V fulvous except for broad lateral fuscous margins on tergum I and a narrow medial longitudinal fuscous band on tergum V; posterior lobe of male surstylus long; female with aculeus tip trilobed (Drew 1989; pers. comm. Drew 2010). 8.4.11.2 Morphological - Larvae - Not available / included in this edition 8.4.11.3 Molecular DNA barcoding: BOLD reference data not available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme: data not available HOST RANGE Pumpkin (Cucurbita pepo) is the only recorded host. Major commercial hosts (Drew 1989): Scientific name Common name Cucurbita pepo pumpkin DISTRIBUTION Papua New Guinea (New Britain) (Drew 1989). REMARKS Bactrocera decipiens is similar to B. perplexa in possessing infuscation on wings in addition to costal band and anal streak but differs in having an irregular S-shaped pale fuscous marking across wing, microtrichia in outer 1/3 of cell c only, mesoplueral stripe not extending to postpronotal lobes, abdominal terga mostly fulvous with broad lateral fuscous margins on tergum I, a narrow medial longitudinal fuscous band on tergum V and apex of piercer of ovipositor with one pair of subapical lobes (Drew 1989). 160 PEST STATUS Exotic A major pest of pumpkins in New Britain ATTRACTANT No known record. FIGURES Figure 55. Bactrocera decipiens Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum 161 Figure 56. Bactrocera decipiens Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 162 8.4.12 Bactrocera (Zeugodacus) depressa (Shiraki) TAXONOMIC INFORMATION Common Name: Previous scientific names: Zeugodacus depressus Shiraki Paradacus depressus (Shiraki) Bactrocera (Paradacus)depressa (Shiraki) DIAGNOSIS 8.4.12.1 Morphological – Adult A large species; face fulvous with a pair of small to medium ill-defined fuscous to dark fuscous spots; postpronotal lobes and notopleura yellow; scutum basically red-brown with dark markings; lateral and medial postsutural yellow vittae present; a yellow spot anterior to notopleural suture in front of lateral postsutural yellow vittae; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta dorsally; scutellum yellow; wing with cells bc and c with a pale fuscous tint, microtrichia in outer corner of cell c only; a narrow fuscous costal band slightly overlapping R2+3; a broad fuscous anal streak; a pale tint around medial posterior area of wing margin; abdominal terga III-V fulvous with a black ‘T’ pattern consisting of a narrow transverse black band across anterior margin of tergum III and a medium-width medial longitudinal black band over all three terga that is broken on posterior margin of tergum III, anterolateral corners of terga IV and V dark fuscous. 8.4.12.2 Morphological – Larvae No information available 8.4.12.3 Molecular DNA barcoding: BOLD reference data not available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available HOST RANGE Family Cucurbitaceae (Cucurbita moschata, Cucurbita pepo, Trichosanthes quadricirrha) DISTRIBUTION Taiwan, Japan (all major islands), Korea REMARKS Bactrocera depressa is similar to Bactrocera (Zeugodacus) okunii (Shiraki) and Bactrocera (Zeugodacus) uncinata Drew & Romig in possessing a basic red-brown scutum, wings colourless except for costal band and anal streak and with the costal band expanded into an apical spot, lateral postsutural vittae ending before ia. seta. It differs from B. uncinata in lacking a recurved black barb on tergum IV and from B. okunii in having cells bc and c with a pale tint and a smaller apical spot on apex of costal band. 163 PEST STATUS Exotic A pest of cucurbit crops ATTRACTANT No known record FIGURE Figure 57. Bactrocera depressa Image courtesy of A.Carmichael, International Centre for the Management of Pest Fruit Flies, Griffith University 164 8.4.13 Bactrocera (Bactrocera) dorsalis (Hendel) TAXONOMIC INFORMATION Common name: Oriental fruit fly Previous scientific names: Dacus dorsalis Dacus (Strumeta) dorsalis Strumeta dorsalis Dacus (Bactrocera) dorsalis DIAGNOSIS 8.4.13.1 Morphological - Adult Face fulvous with a pair of medium sized circular black spots; scutum colour variable red-brown to black, with lanceolate dark patterning in intermediate forms; postpronotal lobes and notopleura yellow; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta dorsally; broad parallel sided lateral postsutural vittae ending behind ia. seta; medial postsutural vitta absent; scutellum yellow; legs with femora entirely fulvous, fore tibiae pale fuscous and hind tibiae fuscous; wings with cells bc and c colourless, microtrichia in outer corner of cell c only, a narrow fuscous costal band confluent with R2+3 and remaining very narrow around apex of wing (occasionally there can be a very slight swelling around apex of R4+5), a narrow pale fuscous anal streak; supernumerary lobe of medium development; abdominal terga III-V exhibits a range of colour patterns (see Drew and Hancock 1994) but possesses the basic pattern of a black ‘T’ consisting of a narrow transverse black band across anterior margin of tergum III, a narrow medial longitudinal black band over all three terga, narrow anterolateral fuscous to dark fuscous corners on terga IV and V; a pair of oval orange-brown to pale fuscous shining spots on tergum V; abdominal sterna dark coloured; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Schutze et al. 2015). 8.4.13.2 Morphological - Larvae See White and Elson-Harris 1992 p. 190. 8.4.13.3 Molecular DNA barcoding: BOLD reference data available. Diagnostic to the level of the B. dorsalis species complex, but difficult to resolve amongst several other species within the complex. See Table 3. PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 820 bp BsrI: 650, 260 SnaBI: 326, 540 HhaI: 656, 192 SspI: DNC HinfI: 770 Vspl: DNC Sau3AI: DNC PCR-RFLP Test 2: No distinctive restriction enzymes but a combination of several can be chosen to distinguish the complex from other Bactrocera and species in other genera. Choice of enzyme will be based on relative distinctiveness from other species potentially trapped. See Appendices 3 and 4 Allozyme electrophoresis: data not available 165 HOST RANGE Bactrocera dorsalis has been recorded on hosts from a wide range of families. These include: Alangiaceae, Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Burseraceae, Capparaceae, Caprifoliaceae, Caricaceae, Celastraceae, Chrysobalanaceae, Clusiaceae, Combretaceae, Convolvulaceae, Curcurbitaceae, Ebenaceae, Elaeocarpaceae, Euphorbiaceae, Fabaceae, Flacourtiaceae, Lauraceae, Lecythidaceae, Malpighiaceae, Meliaceae, Moraceae, Musaceae, Myrtaceae, Olacaceae, Oleaceae, Oxalidaceae, Polygalaceae, Rhamnaceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, Sapotaceae, Simaroubaceae and Solanaceae (for a full list of recorded hosts see Allwood et al. 1999; Leblanc et al. 2012). Major commercial hosts (Allwood et al. 1999): Scientific name Common name Scientific name Common name Anacardium occidentale cashew nut Mimusops elengi spanish cherry Annona reticulata bullock's heart Muntingia calabura Jamaican cherry Annona squamosa sugarapple Musa banana Averrhoa carambola carambola Prunus armeniaca apricot Capsicum annuum bell pepper Prunus avium sweet cherry Carica papaya papaw Prunus cerasus sour cherry Chrysophyllum cainito caimito Prunus domestica plum Citrus reticulata mandarin Prunus persica peach Coffea arabica arabica coffee Psidium guajava guava Dimocarpus longan longan tree Pyrus communis European pear Diospyros kaki persimmon Syzygium aqueum watery rose-apple Malpighia glabra acerola Syzygium cumini black plum Malus domestica apple Syzygium jambos rose apple Mangifera foetida bachang Syzygium malaccense malay-apple Mangifera indica mango Syzygium samarangense water apple Manilkara zapota sapodilla DISTRIBUTION Africa, India, Sri Lanka, Nepal, Bhutan, Myanmar, southern China, Taiwan, Hong Kong, northern Thailand, Vietnam, Cambodia, Laos, Hawaii, Mariana Islands, Tahiti (pers. comm. Drew 2010). REMARKS Bactrocera dorsalis is similar to B. carambolae and B. verbascifoliae in possessing broad parallel sided lateral postsutural vittae, costal band confluent with or very slightly overlapping R 2+3 and to B. verbascifoliae in having the costal band remaining very narrow beyond apex of R 2+3, femora entirely fulvous and abdominal terga III-V with a narrow medial longitudinal dark band. It differs from B. carambolae in possessing a very narrow apical section of the costal band, narrow medial longitudinal dark band on abdominal terga III-V and triangular shaped anterolateral dark corners on abdominal terga IV and V (these markings are rectangular in B. carambolae). It differs from B. verbascifoliae in possessing narrow lateral dark margins on abdominal terga IV and V. 166 Other dorsalis complex species that are similar to B. dorsalis are B. hantanae, B. irvingiae, B. raiensis and B. syzygii; however, all of these species possess a broad medial longitudinal dark band on abdominal terga III-V and have not been recorded as having males responding to methyl eugenol. See Drew and Hancock (1994) for a full discussion of type specimens, relationships and synonymies. Bactrocera dorsalis can appear similar to the Australian species B. endiandrae (eastern Australia to northern NSW) and B. musae (north Qld to Townsville) (see diagnostician’s notes). Following the publication on the dorsalis complex by Drew and Hancock (1994), there has been considerable research to investigate the integrity of many of the morphologically close species in the dorsalis complex. The review of Clarke et al. (2005) summarised the bulk of this research and has demonstrated that most taxa within the complex can be satisfactorily resolved and that the complex is undergoing rapid morphological change. Drew & Romig (2013) synonymised Bactrocera philippinensis with B. papayae; Schutze et al. (2015) synonymised B. papayae and B. invadens with B. dorsalis. PEST STATUS Exotic High priority pest identified in the Apple and Pear, Avocado, Banana, Citrus, Summerfruit, Tropical fruit and Vegetable IBPs Bactrocera dorsalis is a major economic pest and utilises a wide range of commercial, edible and rainforest fruits ATTRACTANT Methyl eugenol. FIGURES Figure 58. Bactrocera dorsalis Image courtesy of the University of Florida and the Florida Department of Agriculture and Consumer Services http://entomology.ifas.ufl.edu/creatures/index.htm (as of 22 August 2011) 167 Figure 59. Bactrocera dorsalis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 168 8.4.14 Bactrocera (Bactrocera) facialis (Coquillett) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus facialis Chaetodacus facialis Strumeta facialis Dacus (Strumeta) facialis DIAGNOSIS 8.4.14.1 Morphological - Adult Small species; facial spots absent; postpronotal lobes and notopleura yellow; scutum dark fuscous to black, mesopleural stripe reaching almost to postpronotal lobes, narrow short lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a narrow fuscous costal band and narrow pale fuscous anal streak, cells bc and c colourless with microtrichia in outer corner of cell c only; abdominal terga III-V orange-brown with a moderately broad medial longitudinal fuscous to black band over all three terga, broad lateral fuscous to black margins on tergum III and anterolateral corners of terga IV and V; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.14.2 Morphological - Larvae - Not available/included in this edition 8.4.14.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 750 bp BsrI: 580, 250 SnaBI: DNC HhaI: 600, 180 SspI: DNC HinfI: DNC Vspl: DNC Sau3AI: 400 PCR-RFLP Test 2: AluI, DraI and RsaI produce diagnostic restriction patterns for B. facialis and B. passiflorae which cannot be distinguished (Appendix 3 and 4); AluI: 770-760, 270, 170, 130, 120, 110; DraI: 1200, 290, 110; RsaI: 500, 420, 410, 290 Allozyme electrophoresis: Data not available 169 HOST RANGE Bactrocera facialis has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Combretaceae, Fabaceae, Lauraceae, Moraceae, Myrtaceae, Passifloraceae, Rosaceae, Rutaceae, Sapindaceae and Solanaceae (for a full list of recorded hosts see Leblanc et al. 2012). Major commercial hosts (Drew 1989; Leblanc et al. 2012): Scientific name Common name Scientific name Common name Capsicum annuum bell pepper Psidium guajava guava Mangifera indica mango Syzygium spp. Carica papaya papaya Citrus spp. Persea americana avocado DISTRIBUTION Known from the Tongatapu I. and the Ha’apai Group, Tonga (Drew 1989). REMARKS Bactrocera facialis is distinct in having broad black lateral margins on abdominal tergum III and anterolaterally on terga IV and V, a moderately broad medial longitudinal black band on terga III-V and lateral postsutural vittae very short and narrow ending at level of sa. setae (Drew 1989). It can appear superficially similar to B. frauenfeldi which is established in north Queensland (see diagnostician’s notes). PEST STATUS Exotic Bactrocera facialis is a major pest, which causes up to 100% fruit loss in Capsicum species in Tonga ATTRACTANT Cue lure. 170 FIGURES Figure 60. Bactrocera facialis Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum Figure 61. Bactrocera facialis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 171 8.4.15 Bactrocera (Bactrocera) frauenfeldi (Schiner) TAXONOMIC INFORMATION Common name: Mango fruit fly Previous scientific names: Dacus frauenfeldi Strumeta frauenfeldi Dacus (Strumeta) frauenfeldi DIAGNOSIS 8.4.15.1 Morphological - Adult Medium sized species; large black facial spots present; postpronotal lobes black; notopleura yellow; scutum glossy black, mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow with a black triangle on dorsal surface; wing with a narrow extremely pale fuscous costal band and broad fuscous anal streak, a narrow fuscous transverse band across wing, cells bc and c pale fuscous, microtrichia covering most of cell c; abdominal terga III-V orange-brown with a broad medial and 2 broad lateral longitudinal black bands; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; Drew and Romig 2013). For potentially morphologically confounding species see REMARKS and Table 8. 8.4.15.2 Morphological - Larvae See White and Elson-Harris 1992 p. 204. 8.4.15.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 840 bp BsrI: DNC SnaBI: DNC HhaI: 600, 200 SspI: 180, 620 HinfI: DNC Vspl: DNC Sau3AI: 400, 450 PCR-RFLP Test 2: B. frauenfeldi cannot be distinguished from B. kirki or B. trilineola. No distinctive restriction enzymes, but a combination of several can be chosen to distinguish this group from other Bactrocera and species in other genera. See Appendices 3 and 4. Allozyme electrophoresis: data not available 172 HOST RANGE Bactrocera frauenfeldi has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Caricaceae, Clusiaceae, Combretaceae, Ebenaceae, Euphorbiaceae, Lecythidaceae, Loganiaceae, Malpighiaceae, Meliaceae, Moraceae, Musaceae, Myrtaceae, Olacaceae, Oxalidaceae, Passifloraceae, Rubiaceae, Rutaceae, Sapotaceae and Solanaceae (for a full list of recorded hosts see Hancock et al. 2000; Leblanc et al. 2004; Leblanc et al. 2012). Major commercial hosts (Drew 1989; Leblanc et al. 2012): Scientific name Common name Scientific name Common name Mangifera indica mango Psidium guajava guava Syzygium malaccense malay-apple Manilkara kauki Citrus spp. DISTRIBUTION Widely distributed in Papua New Guinea and across the Bismark Archipelago to the Solomon Islands, and established in the Torres Strait and northern Queensland as far south as Townsville (Royer et al. 2015; Drew and Romig 2013). This is an exotic pest species that was detected at the tip of Queensland in the 1970s. It appears to have reached the limit of its spread south to Townsville without any controls due to climatic limitations (Royer et al. 2015). REMARKS Bactrocera frauenfeldi is similar to B. albistrigata (see diagnostician’s notes) but differs in having dark postpronotal lobes (though some specimens can have paler ppn lobes) darker leg patterning and wider medial line on the abdomen with broad lateral bands (though B. albistrigata can also have similar abdominal patterning). Bactrocera albistrigata, regarded as a synonym of B. frauenfeldi by Hardy and Adachi (1954), is a distinct species. It possesses yellow postpronotal lobes and is confined to South-east Asia (Drew 1989) and can be separated by DNA barcoding (see Armstrong pers. comm. in Royer et al. 2015). See Table 8 under B. albistrigata entry for differences with other frauenfeldi complex species. PEST STATUS Established A major pest fruit fly species in Papua New Guinea, attacking most locally grown tropical fruits and nuts (with the exception of banana which is a rare host) ATTRACANT Cue-group. Raspberry ketone formate (Melolure) was found to be a stronger attractant for this species in north Queensland (Royer 2015). 173 FIGURES Figure 62. Bactrocera frauenfeldi Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University Figure 63. Bactrocera frauenfeldi Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 174 8.4.16 Bactrocera (Afrodacus) jarvisi (Tryon) TAXONOMIC INFORMATION Common name: Jarvis’ fruit fly Previous scientific names: Chaetodacus jarvisi Chaetodacus jarvisi var. careya Dacus (Afrodacus) jarvisi Afrodacus jarvisi DIAGNOSIS 8.4.16.1 Morphological - Adult Medium sized species; medium sized irregularly oval black facial spots present; postpronotal and notopluera yellow and connected by a broad yellow band; scutum red-brown, mesopleural stripe reaching almost to anterior npl. seta, lateral postsutural vittae present, medial postsutural vittae absent, wing with a narrow fuscous costal band and broad fuscous anal streak, cells bc and c colourless with microtrichia in outer corner of cell c only; abdominal terga III-V orange-brown except for a fuscous to black transverse band across anterior margin of tergum III and fuscous to black medial longitudinal band generally over all three terga but often variable; posterior lobe of male surstylus long; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.16.2 Morphological - Larvae See White and Elson-Harris 1992 p. 169. 8.4.16.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 820 bp BsrI: 600, 250 SnaBI: DNC HhaI: 650, 180 SspI: 700 HinfI: 770 Vspl: DNC Sau3AI: 420 PCR-RFLP Test 2: SspI produces a diagnostic pattern. Additional restriction enzymes can be chosen based on relative distinctiveness from other species potentially trapped; see Appendices 3 and 4. SspI: 880, 640, 100 Allozyme electrophoresis: (Section 7.3.5). 175 HOST RANGE Bactrocera jarvisi has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Arecaceae, Cactaceae, Caricaceae, Celastraceae, Chrysobalanaceae, Clusiaceae, Combretaceae, Curcurbitaceae, Ebenaceae, Elaeocarpaceae, Lauraceae, Lecythidaceae, Malpighiaceae, Meliaceae, Moraceae, Musaceae, Myrtaceae, Oleaceae, Oxalidaceae, Passifloraceae, Punicaceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, Sapotaceae and Solanaceae (for a full list of recorded hosts see Hancock et al. 2000). Major commercial hosts (Drew 1989): Scientific name Common name Scientific name Common name Mangifera indica mango Prunus persica peach Psidium guajava guava Musa sp. banana DISTRIBUTION Northern Australia from Broome, Western Australia to eastern Arnhem Land, Northern Territory and northwest Queensland, Torres Strait islands and eastern Australia from Cape York to the Sydney district, New South Wales (Hancock et al. 2000). In recent tests using zingerone, B. jarvisi was not detected in Sydney and the southern boundary is considered to be somewhere north of Sydney (Dominiak et al. 2015b). Has been recorded from Indonesia (Irian Jaya) by White and Elson-Harris on one occasion but is not established there and should not be regarded as a permanent record (pers. comm. Drew 2010). REMARKS Bactrocera jarvisi is not morphologically similar to any Australian native species that respond to zingerone or cue-lure, or that would be reared from commercial hosts. It is distinctive by being a golden-orange colour with a joining band between the notopleural calli and postpronotal lobes, T on the abdomen and flared costal band. PEST STATUS Endemic A major pest in Queensland and the Northern Territory where it attacks a large number of fruit and vegetable crops ATTRACTANT Attracted to zingerone (Fay 2012) and also known to be attracted to cue-lure (Drew 1989, Royer & Hancock 2012, IAEA 2003). 176 FIGURES Figure 64. Bactrocera jarvisi Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum Figure 65. Bactrocera jarvisi Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 177 8.4.17 Bactrocera (Bactrocera) kandiensis (Drew and Hancock) TAXONOMIC INFORMATION Common name: Previous scientific names: DIAGNOSIS 8.4.17.1 Morphological - Adult Face fulvous with a pair of large oval black spots; scutum black except brown below and behind lateral postsutural vittae, around mesonotal suture, inside postpronotal lobes, around prsc. setae and on anterocentral margin; postpronotal lobes yellow (anteromedial corners red-brown); notopleura yellow; mesopleural stripe slightly wider than notopleuron dorsally; narrow parallel sided lateral postsutural vittae ending at ia. seta; medial postsutural vitta absent; scutellum yellow with a moderately broad black basal band; legs with femora fulvous with dark fuscous on outer apical 2/3 of fore femora, inner apical 1/2 of mid and inner apical 1/3 of hind femora, fore tibiae fuscous, mid tibiae fulvous and hind tibiae dark fuscous; wings with cells bc and c colourless, microtrichia in outer corner of cell c only, a narrow fuscous costal band confluent with R2+3 and remaining narrow around margin of wing to end between extremities of R4+5 and M, a narrow fuscous cubital streak; supernumerary lobe of medium development; abdominal terga III-V orange-brown with a narrow transverse black band across anterior margin of tergum III but not covering lateral margins, a very narrow medial longitudinal fuscous to dark fuscous band over all three terga (occasionally interrupted at intersegmental lines) and very narrow fuscous to dark fuscous anterolateral corners on terga IV and V, a pair of oval orange-brown shining spots on tergum V; abdominal sterna dark coloured; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew and Romig 2013). 8.4.17.2 Morphological - Larvae - Not available/included in this edition 8.4.17.3 Molecular DNA barcoding: BOLD reference data available. Diagnostic to the level of the B. dorsalis species complex, but difficult to resolve amongst several other species within the complex. See Table 3. PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available 178 HOST RANGE Bactrocera kandiensis has been recorded on hosts from six families, Anacardiaceae and Clusiaceae (for a full list of recorded hosts see Allwood et al. 1999). Major commercial hosts (Allwood et al. 1999; Tsuruta et al.1997): Scientific name Common name Scientific name Common name Anacardium occidentale cashew nut Psidium guajava guava Annona glabra pond apple Spondias cytherea jew plum Citrus maxima pummelo Syzygium aromaticum clove Mangifera indica mango Syzygium jambos rose apple Averrhoa carambola carambola Carica papaya papaya DISTRIBUTION Bactrocera kandiensis is confined to Sri Lanka (Drew and Hancock 1994). REMARKS Bactrocera kandiensis is similar to B. caryeae and B. neoarecae in possessing narrow parallel sided lateral postsutural vittae and dark patterns on the apices of all femora or, at least, on fore and mid femora. It differs from B. neoarecae in possessing a single ‘T’ pattern over abdominal terga III-V (not on each of the three separate terga), a narrow black basal band on the scutellum and dark markings on the apices of all femora and from B. caryeae in possessing a very narrow medial longitudinal dark band on abdominal terga III-V and narrow dark anterolateral corners on terga IV and V (pers. comm. Drew 2010). It is also similar to B. dorsalis but has narrow vittae, spots on the apices of all femora and very narrow costal band. PEST STATUS Exotic Bactrocera kandiensis is a major pest of mangoes and is probably responsible for much of the damage generally attributed to B. dorsalis in Sri Lanka ATTRACTANT Methyl eugenol. 179 FIGURES Figure 66. Bactrocera kandiensis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 180 8.4.18 Bactrocera (Bactrocera) kirki (Froggatt) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus kirki Strumeta kirki Dacus (Strumeta) kirki DIAGNOSIS 8.4.18.1 Morphological - Adult Medium sized species; large black facial spots present; postpronotal lobes yellow (anterodorsal margins black); notopluera yellow; scutum glossy black, mesoplueral stripe slightly wider than notopleuron, lateral and medial postsutural vittae absent, scutellum glossy black with extreme lateral margins yellow; wing with a narrow pale fuscous costal band and narrow fuscous anal streak, a narrow pale fuscous tinge around r-m and dm-cu crossveins, cells bc and c with extremely pale fuscous tinge and microtrichia in outer ½ of cell c only; abdominal terga glossy black except for two longitudinal orange-brown bands over terga II-V either side of a broad medial longitudinal glossy black band; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). For potentially morphologically confounding species see REMARKS or Table 8. 8.4.18.2 Morphological - Larvae - Not available/included in this edition 8.4.18.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 850 bp BsrI: DNC SnaBI: DNC HhaI: 680, 190 SspI: 180, 620 HinfI: DNC Vspl: DNC Sau3AI: 400, 450 PCR-RFLP Test 2: B. kirki cannot be distinguished from B. frauenfeldi or B. trilineola. No distinctive restriction enzymes, but a combination of several can be chosen to distinguish this group from other Bactrocera and species in other genera. See Appendices 3 and 4 Allozyme electrophoresis: data not available 181 HOST RANGE Bactrocera kirki has been recorded on hosts from a range of families. These include: Anacardiaceae, Bromeliaceae, Combretaceae, Fabaceae, Myrtaceae, Oxalidaceae, Passifloraceae, Rosaceae, Rutaceae, Solanaceae (for a full list of recorded hosts see Leblanc et al. 2012). Major commercial hosts (Drew 1989; Leblanc et al. 2012): Scientific name Common name Scientific name Common name Mangifera indica mango Persea americana avocado Psidium guajava guava Syzygium spp. Citrus spp. DISTRIBUTION Widespread in the South Pacific islands: Western Samoa, American Samoa, Tonga, Niue and Tahiti (Drew 1989). REMARKS Bactrocera kirki is similar to members of the B. frauenfeldi complex but differs in not having a distinct transverse band on the wing, although it does have infuscation on the r-m and dm-cu cross veins. It may appear similar to B. frauenfeldi (see diagnostician’s notes and Table 8 on page 128 for other separating characters). PEST STATUS Exotic High priority pest identified in the Avocado IBP Bactrocera kirki is considered a major pest, and perhaps the most significant in the South Pacific region ATTRACTANT Cue lure, Willison's lure (raspberry ketone). 182 FIGURES Figure 67. Bactrocera kirki Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum Figure 68. Bactrocera kirki Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 183 8.4.19 Bactrocera (Bactrocera) kraussi (Hardy) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus (Strumeta) kraussi Strumeta kraussi DIAGNOSIS 8.4.19.1 Morphological - Adult Medium sized species; medium sized oval facial spots present; postpronotal lobes and notopleura yellow; scutum red-brown with irregularly shaped lateral longitudinal pale fuscous to fuscous bands, mesopleural stripe reaching midway between anterior margin of notopleron and anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow with a broad redbrown to fuscous basal band; wing colourless or with a pale fulvous tint and a narrow fuscous costal band and broad fuscous anal streak, cells bc and c pale fulvous to fulvous with microtrichia in outer corner of cell c only, abdominal terga III and IV fuscous and tergum V fulvous except for broad lateral dark fuscous margins on terga III and IV and broad fuscous lateral margins on tergum V; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.19.2 Morphological - Larvae - Not available/included in this edition 8.4.19.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: Data not available PCR-RFLP Test 2: Data not available Allozyme electrophoresis: data not available HOST RANGE Bactrocera kraussi has been recorded on hosts from a wide range of families. These include: Agavaceae, Anacardiaceae, Annonaceae, Apocynaceae, Clusiaceae, Combretaceae, Cunoniaceae, Davidsoniaceae, Elaeocarpaceae, Euphorbiaceae, Flacourtiaceae, Icacinaceae, Lauraceae, Lecythidaceae, Loganiaceae, Malpighiaceae, Meliaceae, Menispermaceae, Moraceae, Musaceae, Myrtaceae, Oleaceae, Oxalidaceae, Passifloraceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, Sapotaceae, Solanaceae and Thymeliaceae (for a full list of recorded hosts see Hancock et al., 2000). Major commercial hosts (Drew 1989, Hancock et al. 2000): Scientific name Citrus sp. Mangifera indica Common name Grapefruit, mandarin, orange mango Scientific name Common name Musa sp. banana Psidium guajava guava It should be noted that fruit flies are not known to attack hard green bananas (Hancock et al., 2000). 184 DISTRIBUTION Torres Strait Islands and northeast Queensland, as far south as Townsville (Hancock et al. 2000, Royer & Hancock 2012). REMARKS Bactrocera kraussi is similar to all other species in the fagraea complex being a general red-brown fly, scutellum with a broad dark basal band and cells bc and c not covered in dense microtichia. It differs from B. rufescens in lacking a medial dark band on abdomen, from B. fagraea and B. russeola in having lateral fuscous markings on abdominal terga III and IV and from B. halfordiae in having a redbrown scutum with or without fuscous markings, abdomen usually fuscous over terga III and IV and laterally on tergum V, mesopleural stripe 1 ½ times the width of notopleuron and lateral postsutural vittae parallel sided (Drew 1989). In cue traps it is most likely to be confused with B. tryoni but differs in having tint only in both costal cells (instead of microtrichia in both), longer less tapered vittae, lateral markings only on the abdomen (instead of a wraparound T), narrow mesopleural stripe, broad basal band on the scutellum and dark apices of the femora. PEST STATUS Endemic A major pest species in North Queensland ATTRACTANT Cue lure, but is more strongly attracted to isoeugenol (Royer 2015). 185 FIGURES Figure 69. Bactrocera kraussi Image courtesy S. Sands, International Centre for the Management of Pest Fruit Flies, Griffith University 186 8.4.20 Bactrocera (Bactrocera) latifrons (Hendel) TAXONOMIC INFORMATION Common name: Solanum fruit fly Previous scientific names: Chaetodacus latifrons DIAGNOSIS 8.4.20.1 Morphological - Adult A medium sized species; face fulvous with a pair of large oval black spots; postpronotal lobes and notopleura yellow; scutum dull black; lateral postsutural vittae present; medial postsutural vitta absent; mesopleural stripe extending to anterior npl. seta dorsally; scutellum yellow; wing with a narrow fuscous costal band overlapping R2+3 and expanding into a small spot around apex of R4+5, a medium width fuscous anal streak; cells bc and c colourless; microtrichia in outer corner of cell c only; all abdominal terga entirely dark orange-brown, posterior lobe of male surstylus short; female with apex of aculeus trilobed (Drew and Romig 2013). 8.4.20.2 Morphological - Larvae See White and Elson-Harris 1992 p. 210. 8.4.20.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 770 bp Bsr1: 600, 200 SnaB1: DNC HhaI: 600, 190 SspI: DNC HinfI: DNC Vspl: DNC Sau3a1: DNC PCR-RFLP Test 2: Sau3A produces a diagnostic pattern. Other useful enzymes DraI, NcoI and RsaI Sau3A: 760, 730,110 Allozyme electrophoresis: data not available HOST RANGE Bactrocera latifrons has been recorded on hosts from a wide range of families. These include: Lythraceae, Myrtaceae, Oleaceae, Passifloraceae, Punicaceae, Rhamnaceae, Rutaceae, Sapindaceae, Solanaceae and Verbenaceae (for a full list of recorded hosts see Allwood et al. 1999). Major commercial hosts (Allwood et al. 1999): Scientific name Common name Scientific name Common name Capsicum sp. peppers Solanum lycopersicum tomato Capsicum annuum bell pepper Solanum melongena eggplant 187 DISTRIBUTION Sri Lanka, India, Pakistan through to Southern China, Japan, Taiwan, Thailand, Laos, Vietnam, Peninsular Malaysia, Indonesia, Hawaii, Tanzania (Drew and Romig 2013). REMARKS Bactrocera latifrons can be confused with species in the B. musae complex and the B. dorsalis complex in possessing similar body colour patterns. However, it is distinct in having a trilobed apex on the aculeus and uniformly dark orange-brown abdominal terga. Bactrocera musae can also have a uniformly orange abdomen but it also differs from this species in having a flared costal band. It is similar to B. citima in possessing a generally black scutum, costal band overlapping R 2+3, cells bc and c colourless and parallel sided lateral postsutural vittae but differs from this species in having redbrown around the lateral and posterior margins of the scutum, femora entirely fulvous and abdominal terga III-V entirely red-brown (Drew and Romig 2013). PEST STATUS Exotic This is a pest of solanaceous crops throughout its range ATTRACTANT Alpha-ionol and cade oil is a moderate attractant for this species. Although not as attractive as cuelure and ME are to other species it is significantly more attractive than protein bait (Flath et al. 1994, McQuate & Peck 2001, McQuate et al. 2013). 188 FIGURES Figure 70. Bactrocera latifrons Image courtesy of Y. Martin and International Centre for the Management of Pest Fruit Flies, Griffith University 189 8.4.21 Bactrocera (Bactrocera) melanotus (Coquillett) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus melanotus Chaetodacus melanotus Strumeta melanotus Dacus (Strumeta) melanotus DIAGNOSIS 8.4.21.1 Morphological - Adult Medium sized species; facial spots absent or small and pale; postpronotal lobes yellow (anterolateral corners black); notopleura glossy black; scutum glossy black, mesopleural stripe reaching to postpronotal lobe, lateral and medial postsutural vittae absent, scutellum glossy black; wing with a narrow pale fuscous costal band and narrow fuscous tint in anal cell, narrow pale fuscous markings along r-m and dm-cu crossveins, cells bc and c colourless or with a very pale fuscous tint, microtrichia in outer corner of cell c only; all abdominal terga entirely glossy black; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.21.2 Morphological – Larvae See White and Elson-Harris 1992 p. 214. 8.4.21.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: Data not available PCR-RFLP Test 2: No fully diagnostic restriction enzymes, but a combination of several can be chosen to distinguish B. melanotus from other Bactrocera and species in other genera. See Appendices 3 and 4. Allozyme electrophoresis: data not available HOST RANGE Bactrocera melanotus has been recorded on hosts from seven families. These include: Anacardiaceae, Caricaceae, Combretaceae, Fabaceae, Myrtaceae, Rutaceae and Sapindaceae (for a full list of recorded hosts see Leblanc et al. 2012). Major commercial hosts (Drew 1989; Leblanc et al. 2012): Scientific name Common name Citrus sp. Mangifera indica mango Scientific name Common name Psidium guajava guava Carica papaya papaya Syzygium spp. 190 DISTRIBUTION Restricted to Cook Is (Drew 1989). REMARKS Bactrocera melanotus is similar to B. atra and B. perfuscain possessing an entirely black scutellum, scutum black with medial and lateral postsutural vittae absent, abdominal terga black but differs from these species in having infuscation around r-m and dm-cu crossveins. In addition, it can be separated from B. atra in having postpronotal lobes mostly yellow, yellow mesopleural stripe and black femora (Drew 1989). Bactrocera melanotus is unusual in that its scutum, scutellum and abdomen are entirely dark coloured (black or very dark brown) (CABI 2007). PEST STATUS Exotic High priority pest identified in the Avocado IBP Bactrocera melanotus is considered a major pest of papaw and citrus crops ATTRACTANT Cue lure FIGURES Figure 71. Bactrocera melanotus Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 191 8.4.22 Bactrocera (Tetradacus) minax (Enderlein) TAXONOMIC INFORMATION Common Name: Chinese Citrus Fruit Fly Previous scientific names: Polistomimetes minax Enderlein Mellesis citri Chen DIAGNOSIS 8.4.22.1 Morphological – Adult A large Callantra-like species; face fulvous with a pair of large elongate black spots filling most of antennal furrow; postpronotal lobes and notopleura yellow; a lateral yellow band running from posterior margin of postpronotal lobe towards notopleuron but not reaching notopleuron; scutum redbrown with a mottled appearance from dorsoventral flight muscles and occasional irregular dark fuscous markings; lateral and medial postsutural yellow vittae present; no yellow marking anterior to notopleural suture; mesopleural stripe reaching anterior npl. seta dorsally; scutellum yellow; wing with cells bc and c fuscous, microtrichia covering outer l/2 of cell c only; a broad fuscous costal band overlapping R4+5, and with a dark fuscous spot within apex of this band; anal streak absent but with pale fuscous within cell cup; abdominal terga III-V fulvous to red-brown and generally with a dark fuscous to black ‘T’ pattern and dark fuscous to black anterolateral corners on terga IV and V. 8.4.22.2 Morphological – Larvae No information available 8.4.22.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available HOST RANGE Family Rutaceae (Citrus spp. and Fortunella spp.) DISTRIBUTION Bhutan, Nepal, northern India, southern China REMARKS Bactrocera (Tetradacus) minax (Enderlein) is similar to Bactrocera (Tetradacus) tsuneonis (Miyake) in the general shape of the thorax and abdomen and in the basic body colour patterns to a point where these species could be confused in diagnosis. However, B minax differs in lacking a.sa. setae, an incomplete lateral yellow band between the postpronotal lobe and notopleuron, a broader costal band overlapping R4+5 with a distinct dark fuscous spot within its apex and a needle-shaped apex on the piercer (not trilobed). 192 PEST STATUS Exotic Major pest of citrus in its native geographic range ATTRACTANT Weak response to methyl eugenol (Drew & Romig 2007) FIGURES Figure 72. Bactrocera minax Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 193 8.4.23 Bactrocera (Bactrocera) musae (Tryon) TAXONOMIC INFORMATION Common name: Banana fruit fly Previous scientific names: Chaetodacus musae Chaetodacus tryoni var. musa Chaetodacus musae var. dorsopicta Dacus (Strumeta) musae Strumeta musae DIAGNOSIS 8.4.23.1 Morphological - Adult Medium sized species; medium sized black facial spots present; postpronotal lobes and notopleura yellow; scutum dull black (although some Cape York Peninsula specimens have a lot of brown on the scutum), mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae present; medial postsutural vitta absent, scutellum yellow; wing with a narrow fuscous costal band and anal streak, cells bc and c colourless with microtrichia in outer corner of cell c only; abdominal terga III-V may vary from uniformly orange-brown to orange-brown with a fuscous to black medial longitudinal band and fuscous to black anterolateral corners on tergum III; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.23.2 Morphological - Larvae See White and Elson-Harris 1992 p. 217. 8.4.23.3 Molecular DNA barcoding: BOLD reference data available to distinguish B. musae s.s. from at least the nonpest species in the B. musae complex, B. conterminal, B. prolixa, B. rufivitta, and B. tinomiscii (Drew et al. 2011); however other species within the complex that are not represented in BOLD could confound diagnosis PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 820 bp BsrI: 600, 250 SnaBI: 320, 520 HhaI: 630, 220 SspI: DNC HinfI: DNC Vspl: DNC Sau3AI: DNC PCR-RFLP Test 2: CfoI and NcoI are diagnostic amongst other Bactrocera species and genera (see Appendices 3 and 4), but species within the B. musae complex have not been tested Allozyme electrophoresis: data not available 194 HOST RANGE Bactrocera musae has been recorded on hosts from nine families. These include: Capparaceae, Caricaceae, Musaceae, Myrtaceae, Olacaceae, Passifloraceae, Rubiaceae, Rutaceae and Solanaceae (for a full list of recorded hosts see Hancock et al. 2000). Major commercial hosts (Drew, 1989; Hancock et al., 2000): Scientific name Common name Musa sp. banana DISTRIBUTION Torres Strait Islands and northeast Queensland, as far south as Townsville (Hancock et al. 2000), Papua New Guinea and associated islands, Bismark Archipelago, the Solomon Islands (Drew 1989) and Indonesia (West Papua, formerly part of Irian Jaya) (Drew and Romig 2013). REMARKS There are a large number of species similar to Bactrocera musae, all placed in the musae complex. It is similar to B. bancroftii an endemic ME-responsive species in Queensland in the musae complex, but differs in not having an apical band on the scutellum, having a wider costal band and narrower anal streak. B. musae has a considerable intraspecific variation and can appear similar to the ME-responsive B. endiandrae (a Queensland rainforest species) and B. dorsalis. It differs from B. endiandrae in having a wider costal band, narrower anal streak, longer less tapered vittae and less of a distinct T on the abdomen. It differs from B. dorsalis in having a wider costal band that doesn’t dip in at the end of R2+3, wider anal streak and slightly tapering, slightly shorter vittae that usually end at the ia bristle, and usually less patterning on the abdomen (although some B. dorsalis specimens can have reduced abdominal markings similar to B. musae). PEST STATUS Endemic Major pest of commercial bananas. ATTRACTANT Methyl eugenol. 195 FIGURES Figure 73. Bactrocera musae Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum Figure 74. Bactrocera musae Image courtesy of Ken Walker, Museum Victoria, www.padil.gov.au (as of 22 August 2011)) 196 Figure 75. Bactrocera musae Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 197 8.4.24 Bactrocera (Bactrocera) neohumeralis (Hardy) TAXONOMIC INFORMATION Common name: Lesser Queensland fruit fly Previous scientific names: Chaetodacus humeralis Strumeta humeralis Dacus (Strumeta) tryoni var. neohumeralis Dacus (Strumeta) neohumeralis Dacus (Bactrocera) neohumeralis DIAGNOSIS 8.4.24.1 Morphological - Adult Medium sized species; medium sized black facial spots present; postpronotal lobes dark brown to fuscous; notopleura yellow; scutum dark red-brown with dark fuscous to black markings, mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a narrow fuscous costal band and broad fuscous anal streak, cells bc and c fuscous, microtrichia covering cell c and outer ½ of cell bc; abdominal terga III-V generally dark fuscous to dull black and tending redbrown medially; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.24.2 Morphological – Larvae See White and Elson-Harris 1992 p. 220. 8.4.24.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from B. aquilonis or B. tryoni PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 820 bp BsrI: 200, 600 SnaBI: DNC HhaI: 640, 190 SspI: 180, 570 HinfI: 770 Vspl: DNC Sau3AI: 420 PCR-RFLP Test 2: SspI produces a B. tryoni species complex diagnostic restriction pattern; fragment sizes (bp) are 1000, 550 and 100. This species cannot be distinguished from B. aquilonis or B. tryoni. Other restriction patterns useful for diagnosis of the complex are listed in Appendix 3, with choice based on relative distinctiveness from other species potentially trapped; descriptions of the patterns are given in Appendix 4. Allozyme electrophoresis: data not available 198 HOST RANGE Bactrocera neohumeralis has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Basellaceae, Cactaceae, Capparaceae, Caricaceae, Celastraceae, Chrysobalanaceae, Clusiaceae, Combretaceae, Davidsoniaceae, Ebenaceae, Elaeocarpaceae, Euphorbiaceae, Flacourtiaceae, Hippocraterceae, Lauraceae, Leeaceae, Lecythidaceae, Malpighiaceae, Melastomataceae, Meliaceae, Moraceae, Musaceae, Myrtaceae, Olacaceae, Oleaceae, Oxalidaceae, Passifloraceae, Piperaceae, Rhamnaceae, Rhizophoraceae, Rosaceae, Rubiaceae, Rutaceae, Santalaceae, Sapindaceae, Sapotaceae, Smilacaceae, Solanaceae, Verbenaceae and Vitaceae (for a full list of recorded hosts see Hancock et al. 2000). Major commercial hosts: A large number of important commercial/edible host fruits and vegetables (see Drew 1989; Hancock et al. 2000). DISTRIBUTION Common pest in Eastern Australia, south to Coffs Harbour, Torres Strait Islands and mainland Papua New Guinea (Drew 1989). It is not found in central and southern NSW (Osborne et al. 1997, Gillespie 2003, Dominiak et al. 2003) or in Sydney (Dominiak et al. 2011, 2015a, 2015b). Vargas et al. 2015 place this species along the Queensland coast and perhaps the far north coast of New South Wales. REMARKS B. neohumeralis differs from B. tryoni in having dark postprotonotal lobes (this is a distinct character) in addition to being generally darker. Although these two species are very similar morphologically, their different daily mating periods (B. tryoni at dusk and B. neohumeralis during the middle of the day) are good reason to keep them separate (Drew 1989). PEST STATUS Endemic Bactrocera neohumeralis is a major pest of commercial fruit crops in Queensland, Australia, and in some crops it occurs in equal abundance to B. tryoni ATTRACTANT Cue group. More attracted to cue-lure than raspberry ketone formate (Melolure) in north Queensland (Royer 2015). 199 FIGURES Figure 76. Bactrocera neohumeralis Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University Figure 77. Bactrocera neohumeralis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 200 8.4.25 Bactrocera (Bactrocera) obliqua (Malloch) TAXONOMIC INFORMATION Common Name: Previous scientific name: Dacus obliquus Malloch DIAGNOSIS 8.4.25.1 Morphological – Adult A dark coloured species; face black; postpronotal lobes and notopleura yellow; scutum black; lateral potsutural vittae short and tapering posteriorly; medial postsutural vitta absent; scutellum yellow with a broad medial longitudinal black band; wing with a narrow fuscous costal band and anal streak, r-m crossvein oblique and enclosed by a pale infuscation, cells bc and c colourless; all abdominal terga entirely black. 8.4.25.2 Morphological – Larvae No information available 8.4.25.3 Molecular DNA barcoding: BOLD reference data not available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Recorded from Myrtaceae (Guava and Syzygium species) DISTRIBUTION Bismarck Archipelago; Bougainville Island REMARKS B. obliqua is similar to B. psidii (Froggatt) in possessing a broad black triangular marking on dorsal surface of scutellum, infuscation on crossveins and mesonotum black with medial postsutural vitta absent but differs in having a black face, r-m crossvein longer than dm-cu crossvein, lateral postsutural vittae very short and narrow ending just behind sa. setae, legs with all tibiae and apices of femora and apical 4 segments of tarsi fuscous. PEST STATUS Exotic A minor pest of Myrtaceae (Guava, Syzygium species) ATTRACTANT No known record 201 FIGURES Figure 78. Bactrocera obliqua Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 202 8.4.26 Bactrocera (Bactrocera) occipitalis (Bezzi) TAXONOMIC INFORMATION Common name: Previous scientific names: Chaetodacus ferrugineus var. occipitalis Dacus (Strumeta) dorsalis var. occipitalis Dacus (Strumeta) occipitalis Dacus (Bactrocera) occipitalis DIAGNOSIS 8.4.26.1 Morphological - Adult Face fulvous with a pair of large oval black spots; scutum black except dark red-brown along posterior margin and enclosing prsc. setae, below and behind lateral postsutural vittae, around mesonotal suture, around anterior margin of notopleura and inside postpronotal lobes; postpronotal lobes and notopleura yellow; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta dorsally; broad parallel sided or subparallel lateral postsutural vittae ending at ia. seta (in some specimens the vittae end behind the ia. seta); medial postsutural vitta absent; scutellum yellow; legs with femora entirely fulvous, fore tibiae pale fuscous to fuscous, mid tibiae pale fuscous to fuscous basally tending paler apically, hind tibiae fuscous; wings with cells bc and c colourless, microtrichia in outer corner of cell c only, a narrow fuscous costal band distinctly overlapping R 2+3 and widening markedly across apex of wing, a narrow fuscous anal streak; supernumerary lobe of medium development; abdominal terga III-V with a narrow transverse black band across anterior margin of tergum III and expanding to cover lateral margins, dark fuscous to black rectangular markings anterolaterally on tergum IV which sometimes continue to cover posterolateral margins of this tergum, dark fuscous to black anterolateral corners on tergum V, a very broad medial longitudinal black band over all three terga, a pair of oval orange-brown shining spots on tergum V; abdominal sterna dark coloured; posterior lobe of male surstylus short; female with apex of aculeus needle shaped (Drew and Romig 2013). 8.4.26.2 Morphological - Larvae - Not available/included in this edition 8.4.26.3 Molecular DNA barcoding: BOLD reference data available. Diagnostic to the level of the B. dorsalis species complex, but difficult to resolve amongst several other species within the complex. See Table 3. PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available 203 HOST RANGE Allwood et al. (1999) host records are incomplete due to a lack of field host survey work through the area of distribution of the species (pers. comm. Drew 2010). Bactrocera occipitalis has been recorded on hosts from three families, Anacardiaceae, Myrtaceae and Rutaceae (Allwood et al. 1999). Major commercial hosts (Allwood et al. 1999): Scientific name Common name Scientific name Common name Citrus microcarpa musk lime Psidium guajava guava Mangifera indica mango DISTRIBUTION Philippines, East Malaysia (Sabah), Brunei, Indonesia (Kalimantan) (Drew and Romig 2013). REMARKS Bactrocera occipitalis is similar to some specimens of B. fuscitibia in possessing broad parallel sided lateral postsutural vittae, costal band overlapping R2+3, narrow to medium width dark patterns on lateral margins of abdominal terga III-V, shining spots on abdominal tergum V pale coloured, femora entirely fulvous or with a dark spot on outer apical surfaces of fore femora only and a broad medial longitudinal dark band on abdominal terga III-V. It differs from B. fuscitibia in having the anterolateral bare area on the scutum broad and lateral dark markings on abdominal terga IV and V of medium width (not narrow). Some populations of fruit flies throughout South-East Asia have been misidentified as B. occipitalis in previous literature. See Drew & Hancock (1994) for a complete discussion on this species and previous misidentifications (Drew and Romig 2013). PEST STATUS Exotic High priority pest identified in the Tropical fruit IBP Bactrocera occipitalis is a major pest species within the dorsalis complex of South-east Asia ATTRACTANT Methyl eugenol. 204 FIGURES Figure 79. Bactrocera occipitalis Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University Figure 80. Bactrocera occipitalis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 205 8.4.27 Bactrocera (Daculus) oleae (Rossi) TAXONOMIC INFORMATION Common Name: Olive fruit fly Previous scientific names: Musca oleae Rossi Musca oleae Gmelin DIAGNOSIS 8.4.27.1 Morphological – Adult Face fulvous with a pair of black spots; scutum black; postpronotal lobes and notopleura yellow; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta; lateral and medial postsutural yellow vittae absent, scutellum yellow; wing with cells bc and c colourless, cell sc. fuscous, a small fuscous spot around apex of vein R4+5 (costal bland absent), anal streak absent; abdominal terga III – V red-brown with dark fuscous to black anterolateral corners on terga III and IV; posterior lobe of male surstylus short; female with aculeus tip needle shaped. 8.4.27.2 Morphological – Larvae See Pest Fruit Flies of the World – Larvae 8.4.27.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: A combination of AluI, DraI, RsaI and SspI produces a diagnostic pattern. AluI: 680, 240, 170, 130, 120, 110; DraI: 1120,170, 130, 100; RsaI: 430, 400, 370, 290; SspI: 1150, 350 Allozyme electrophoresis: data not available HOST RANGE Recorded from family Oleaceae (olives) DISTRIBUTION Palearctic, Afrotropical and Oriental Regions REMARKS Bactrocera oleae is distinguished by the black scutum lacking lateral and medial postsutural yellow vittae, yellow postpronotal lobes and notopleura, yellow scutellum, wing with fuscous cell sc and a small spot around apex of R4+5 (costal band and anal streak lacking), abdominal terga III – V redbrown with dark fuscous to black on antero-lateral corners of terga III and IV. PEST STATUS Exotic High priority A major pest of olives in the Mediterranean Region 206 ATTRACTANT No known record FIGURES Figure 81. Bactrocera oleae Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 16 October 2015) Figure 82. Bactrocera oleae Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 16 October 2015) 207 8.4.28 Bactrocera (Bactrocera) passiflorae (Froggatt) TAXONOMIC INFORMATION Common name: Fijian fruit fly Previous scientific names: Dacus passiflorae Chaetodacus passiflorae Strumeta passiflorae Dacus (Strumeta) passiflorae DIAGNOSIS 8.4.28.1 Morphological - Adult Small species; facial spots absent; postpronotal lobes glossy black; notopleura yellow; scutum glossy black, mesopleural stripe reaching to or beyond anterior npl. seta, lateral and medial postsutural vittae absent, scutellum yellow; wing with a narrow fuscous costal band and narrow pale fuscous anal streak, cells bc and c colourless with microtrichia in outer corner of cell c only; abdominal terga I-IV glossy black and tergum V either glossy black with posterior margin dark fuscous or fuscous with a medial longitudinal black band; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). It may appear similar to B. melanotus from the Cook Islands in being all black but differs in having pale legs and scutellum and black postpronotal lobes. 8.4.28.2 Morphological - Larvae See White and Elson-Harris 1992 p. 223. 8.4.28.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 830 bp BsrI: 650, 270 SnaBI: DNC HhaI: 650, 190 SspI: 750 HinfI: 770 Vspl: DNC Sau3AI: DNC PCR-RFLP Test 2: AluI, DraI and RsaI produce diagnostic restriction patterns for B. facialis and B. passiflorae which cannot be distinguished (Appendix 3 and 4); AluI: 770-760, 270, 170, 130, 120, 110; DraI: 1200, 290, 110; RsaI: 500, 420, 410, 290 Allozyme electrophoresis: data not available 208 HOST RANGE Reared from host fruits in 28 plant families (see Leblanc et al. 2012). Major commercial hosts (Leblanc et al. 2012): Scientific name Common name Scientific name Common name Anacardium occidentale cashew nut Passiflora quadrangularis giant granadilla Carica papaya papaw Persea americana avocado Citrus aurantiifolia lime Psidium guajava guava Citrus reticulata mandarin Solanum melongena eggplant Mangifera indica mango Theobroma cacao cocoa Passiflora edulis passionfruit DISTRIBUTION Fiji Islands, Niue, Wallis and Futuna. There is also a separate form of B. passiflorae with paler abdomen. This is probably an undescribed new species which occurs in Fiji, Tuvalu, Tokelau and possibly the Niuas group in Tonga. Its host range and potential pest status have not yet been well studied (SPC 2006). REMARKS Bactrocera passiflorae is similar to B. thistleoni in possessing black postpronotal lobes, scutellum entirely yellow, scutum black with lateral and medial postsutural vittae absent but differs in having facial spots absent and legs entirely fulvous (Drew 1989). PEST STATUS Exotic High priority pest identified in the Avocado and Tropical Fruit IBPs ATTRACTANT Cue lure. 209 FIGURES Figure 83. Bactrocera passiflorae Image courtesy of the Secretariat of the Pacific Community Pacific Fruit Fly Web, www.spc.int/pacifly (as of 22 August 2011) Figure 84. Bactrocera passiflorae Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 210 8.4.29 Bactrocera (Bactrocera) psidii (Froggatt) TAXONOMIC INFORMATION Common name: South sea guava fruit fly Previous scientific names: Tephritis psidii Dacus psidii Strumeta psidii Dacus (Strumeta) psidii DIAGNOSIS 8.4.29.1 Morphological - Adult Medium sized species; generally small fuscous to dark fuscous facial spots present; postpronotal lobes yellow except anterodorsal corner black; notopleura yellow; scutum glossy black, mesopleural stripe equal in width to notopleuron, short lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow with a broad triangular black marking on dorsal surface; wing with a narrow tint of extremely pale fuscous colouration around costal margin and a narrow fulvous anal streak, a narrow tint of fuscous colouration around r-m and dm-cu crossveins, cells bc and c colourless to extremely pale fulvous with microtrichia in outer corner of cell c only; abdominal terga entirely glossy black; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). For potentially morphologically confounding species see Table 8. 8.4.29.2 Morphological - Larvae - Not available/included in this edition 8.4.29.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 780 bp Bsr1: DNC SnaBI: DNC HhaI: 640, 190 SspI: 200, 550 HinfI: DNC Vspl: DNC Sau3AI: DNC PCR-RFLP Test 2: No fully diagnostic restriction enzymes, but a combination of several can be chosen to distinguish B. psidii from other Bactrocera and species in other genera. See Appendices 3 and 4 Allozyme electrophoresis: data not available 211 HOST RANGE Bactrocera psidii has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Apocynaceae, Caricaceae, Combretaceae, Ebenaceae, Euphorbiaceae, Malpighiaceae, Moraceae, Myrtaceae, Oxalidaceae, Passifloraceae, Punicaceae, Rosaceae, Rutaceae and Vitaceae (Leblanc et al. 2013). Major commercial hosts (Drew 1989): Scientific name Common name Citrus sp. Mangifera indica Scientific name Common name Psidium guajava guava mango DISTRIBUTION Restricted to New Caledonia (Drew 1989). REMARKS Bactrocera psidii is similar to B. obliqua in possessing infuscation on crossveins and the scutelum yellow with a broad black triangular marking on dorsal surface. It differs from this species in having the face fulvous with small pale spots in 75% of specimens, costal band narrow and not overlapping R 2+3, r-m crossvein shorter than dm-cu crossvein, infuscation around crossveins very narrow and pale, legs entirely fulvous, lateral postsutural vittae elongated and ending before ia. setae; posterior lobe of male surstylus short; female with apex of aculeus needle shaped. This species is unusual in having wing patterning very pale (including a mark along the r-m crossvein), scutellum marked with a large black triangle and the abdomen entirely dark (black or dark orange-brown) (Drew 1989; pers. comm. Drew 2010). It may appear superficially similar to the cue-responsive B. frauenfeldi in north Queensland but differs in not having a distinct band on the wing, not having distinct medial line and lateral bands on the abdomen, having pale legs and pale ppn lobes. See Table 8 on page 128. PEST STATUS Exotic Bactrocera psidii is a major pest ATTRACTANT Cue lure, Willison's lure. 212 FIGURES Figure 85. Bactrocera psidii Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University Figure 86. Bactrocera psidii Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 213 8.4.30 Bactrocera (Bactrocera) pyrifoliae (Drew & Hancock) TAXONOMIC INFORMATION Common Name: Previous scientific names: DIAGNOSIS 8.4.30.1 Morphological – Adult Face fulvous with a pair of medium-sized circular black spots; postpronotal lobes and notopleura yellow; scutum black except dark brown posterolateral to lateral postsutural vittae and dark red-brown anterior to notopleural suture and inside postpronotal lobes, narrow lateral postsutural yellow vittae tapering posteriorly to end before ia. seta; medial postsutural yellow vitta absent; mesopleural stripe equal in width to notopleuron dorsally, scutellum yellow; legs with femora fulvous except for a small subapical oval black spot on outer surfaces of fore femora and dark fuscous around apices of mid and hind femora; fore and mid tibiae dark fuscous, hind tibiae black; wings with cells bc and c colourless, microtrichia in outer corner of cell c only; a narrow fuscous costal band confluent with R 2+3 and with a sight swelling around apex of R4+5; a narrow fuscous anal streak; supernumerary lobe weak in females, of medium development in males; abdominal terga III and IV orange-brown and generally each with its own ‘T’ pattern consisting of a narrow- to medium-width transverse dark fuscous to black band across anterior margin which expands to cover outer 1/3 of lateral margins; a narrow- to medium-width medial longitudinal dark fuscous to black band, tergum V with a narrow- to mediumwidth medial longitudinal dark fuscous to black band and dark fuscous to black anterolateral corners which may also meet along anterior margin, a pair of oval dark fuscous shining spots on tergum V; abdominal sterna dark coloured. 8.4.30.2 Morphological – Larvae No information available 8.4.30.3 Molecular DNA barcoding: BOLD reference data not available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Recorded from five plant families, Araliaceae, Euphorbiaceae, Myrtaceae, Polygalaceae, Rosaceae. More common in the Rosaceae (Peach, Pear and Himalayan Cherry). DISTRIBUTION Northern Thailand and Northern Vietnam REMARKS Bactrocera pyrifoliae is a pest species within the dorsalis complex and is morphologically unique in possessing a dark ‘T’ shaped pattern on each tergum III, IV and V. 214 PEST STATUS Exotic A minor pest of stone and pome fruits ATTRACTANT Possible weak response to cue lure (Drew & Romig 2007) FIGURES Figure 87. Bactrocera pyrifoliae Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 215 8.4.31 Bactrocera (Zeugodacus) tau (Walker) TAXONOMIC INFORMATION Common name: Previous scientific names: Dasyneura tau Dacus (Zeugodacus) tau DIAGNOSIS 8.4.31.1 Morphological - Adult A medium sized species; face fulvous with a pair of medium sized circular to oval black spots; postpronotal lobes and notopleura yellow; scutum black with large areas of red-brown centrally and anterocentrally; lateral and medial postsutural vittae present; yellow spot anterior to mesonotal suture in front of lateral postsutural vittae; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta; scutellum entirely yellow; wing with a narrow dark fuscous costal band overlapping R2+3 and expanding into a distinct apical spot and broad dark fuscous anal streak; cells bc and c colourless; microtrichia in outer corner of cell c only; abdominal terga III-V fulvous with a black ‘T’ pattern and anterolateral corners of terga IV and V with broad black markings; posterior lobe of male surstylus short; female with apex of aculeus trilobed (Drew and Romig 2013). 8.4.31.2 Morphological - Larvae See White and Elson-Harris 1992 p. 273. 8.4.31.3 Molecular DNA barcoding: BOLD reference data available, but not well resolved amongst a number of other species in BOLD. Low divergence clades are apparent and when used in conjunction with other information about the specimen this may be sufficient to make a confident identification. PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Bactrocera tau has been recorded on hosts from nine families. These include: Arecaceae, Curcurbitaceae, Fabaceae, Loganiaceae, Moraceae, Myrtaceae, Oleaceae, Sapotaceae and Vitaceae (for a full list of recorded hosts see Allwood et al. 1999). Major commercial hosts (Allwood et al. 1999): Scientific name Common name Scientific name Common name Cucumis melo melon Manilkara zapota sapodilla Cucumis sativus cucumber Momordica charantia bitter gourd Cucurbita maxima giant pumpkin Psidium guajava guava Luffa acutangula angled luffa 216 DISTRIBUTION India, Sri Lanka, Bhutan, Vietnam, Southern China, Taiwan, Thailand, Peninsular Malaysia, Singapore, East Malaysia, Brunei and Indonesian provinces (Drew and Romig 2013). REMARKS Bactrocera tau is a very common species throughout southeast Asia. It is an economic pest species, mainly in cucurbit crops, but can be misidentified as it belongs to a complex of closely related species. The tau-complex includes Zeugodacus species with a black scutum, wings colourless except for a costal band and cubital streak, cells bc and c colourless or with an extremely pale tint, costal band overlapping R2+3 and expanding into a distinct spot at apex. Bactrocera tau is distinct in having an entirely yellow scutellum, abdominal terga III-V with a distinct dark ‘T’ pattern and all femora with dark preapical spots (Drew and Romig 2013). PEST STATUS Exotic A major pest of cucurbit crops ATTRACTANT Cue lure. 217 FIGURES Figure 88. Bactrocera tau Image courtesy of Ken Walker, Museum Victoria, www.padil.gov.au (as of 22 August 2011) Figure 89. Bactrocera tau 218 Figure 90. Bactrocera tau Image courtesy of S. Phillips and the International Centre for the Management of Pest Fruit Flies, Griffith University 219 8.4.32 Bactrocera (Bactrocera) trilineola (Drew) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus (Strumeta) triseriatus DIAGNOSIS 8.4.32.1 Morphological - Adult Medium sized species; face entirely glossy black; postpronotal lobes fuscous to black; notopleura yellow; scutum glossy black; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta, lateral and medial postsutural vittae absent, scutellum glossy black with lateral margins yellow; wing with a narrow extremely pale fuscous costal vein and broad fuscous anal streak, a narrow fuscous transverse band across wing, cells bc and c extremely pale fuscous, microtrichia covering outer ½ of cell c only; abdominal terga mostly glossy black except for two broad longitudinal fulvous bands on terga II-V either side of a broad medial longitudinal glossy black band; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). For potentially morphologically confounding species see REMARKS or Table 8. 8.4.32.2 Morphological - Larvae - Not available/included in this edition 8.4.32.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: B. trilineola cannot be distinguished from B. kirki or B. frauenfeldi. No distinctive restriction enzymes, but a combination of several can be chosen to distinguish this group from other Bactrocera and species in other genera. See Appendices 3 and 4. Allozyme electrophoresis: data not available HOST RANGE Bactrocera trilineola has been recorded on hosts from 17 plant families. These include: Anacardiaceae, Annonaceae, Caricaceae, Caesalpinaceae, Combretaceae, Lauraceae, Moraceae, Musaceae, Myrtaceae, Oxalidaceae, Rutaceae and Sapindaceae (for a full list of recorded hosts see Leblanc et al. 2012). Major commercial hosts: Scientific name Common name Mangifera indica mango DISTRIBUTION Restricted to Vanuatu where it is common over nearly every island (Drew 1989). The record from New Caledonia (Leblanc et al. 2012) is doubtful. 220 REMARKS Bactrocera trilineola belongs to the frauenfeldi complex. It differs from B. caledoniesis and B. frauenfeldi in possessing a glossy black face and in lacking lateral postsutural vittae and from B. parafrauenfeldi in having a glossy black face, cells bc and c extremely pale fuscous, microtrichia in outer ½ of cell c only, costal band present but very pale beyond subcostal cell and legs fulvous except apical 1/3 of hind femora and hind tibiae fuscous. The apex of piercer and the spicules on the middle segment of the ovipositor are similar in B. frauenfeldi and B. trilineola, however the apex of the aculeus is slightly more pointed in B. trilineola. See Table 8 on page 128 for comparisons with other frauenfeldi complex species. PEST STATUS Exotic ATTRACTANT Cue lure, Willison's lure. FIGURES Figure 91. Bactrocera trilineola Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum 221 Figure 92. Bactrocera trilineola Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 222 8.4.33 Bactrocera (Bactrocera) trivialis (Drew) TAXONOMIC INFORMATION Common name: Previous scientific names: Dacus (Strumeta) trivialis DIAGNOSIS 8.4.33.1 Morphological - Adult Medium sized species; medium sized pear shaped facial spots present; postpronotal lobes and notopleura yellow; scutum black, mesopleural stripe ending midway between anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a narrow fuscous costal band and anal streak, cells bc and c colourless, microtrichia in outer corner of cell c only; males with all leg segments fulvous except hind tibiae fuscous, females with dark colour patterns on femora and tibiae; abdominal terga III-V generally black with a medial longitudinal fulvous area from posterior margin of tergum III to tergum V; posterior lobe of male surstylus short; female with apex of aculeus needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.33.2 Morphological - Larvae - Not available/included in this edition 8.4.33.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: No fully diagnostic restriction enzymes, but a combination of several can be chosen to distinguish B. trivialis from other Bactrocera and species in other genera. See Appendices 3 and 4 Allozyme electrophoresis: data not available HOST RANGE Bactrocera trivialis has been recorded on hosts from ten families. These include: Anacardiaceae, Combretaceae, Euphorbiaceae, Myrtaceae, Rosaceae, Rutaceae, Santalaceae and Solanaceae (for a full list of recorded hosts see Leblanc et al. 2012). Major commercial hosts (Drew 1989; Leblanc et al. 2012): Scientific name Common name Scientific name Common name Capsicum frutescens chilli Prunus persica peach Citrus x paradisi grapefruit Psidium guajava guava Magnifera indica mango 223 DISTRIBUTION Mainland Papua New Guinea (less common in the Highlands than at low elevations), Indonesia (Irian Jaya) (Drew 1989). The record from Sulawesi (White and Elson-Harris 1992) is doubtful. Although Bactrocera trivialis is not established in the Torres Strait Islands, occasional incursions do occur. They are promptly eradicated under the Exotic Fruit Fly in Torres Strait Response Plan jointly run by the Federal Department of Agriculture and Queensland Department of Agriculture and Fisheries. REMARKS A large collection of specimens reared from grapefruit at Mt. Hagen, 1980, 1981, show sexual dimorphism in leg colour patterns: females possess fore, mid and apical 1/3 of hind femora dark fuscous, fore tibiae and apical four segments of fore tarsi fuscous, hind tibiae dark fuscous; males have all segments fulvous except hind tibiae fuscous. B. trivialis can appear similar to B. rufofuscula, a cue-responsive north Queensland rainforest species. However, B. trivialis has a black scutum whereas B. rufofuscula has a dark brown scutum. PEST STATUS High priority pest identified in the Tropical fruit IBP ATTRACTANT Cue lure. FIGURES Figure 93. Bactrocera trivialis Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum 224 Figure 94. Bactrocera trivialis Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 225 8.4.34 Bactrocera (Bactrocera) tryoni (Froggatt) TAXONOMIC INFORMATION Common name: Queensland fruit fly Previous scientific names: Tephritis tryoni Dacus tryoni Chaetodacus tryoni Chaetodacus tryoni var. juglandis Chaetodacus tryoni var. sarcocephali Dacus (Strumeta) tryoni Strumeta tryoni Dacus (Bactrocera) tryoni DIAGNOSIS 8.4.34.1 Morphological - Adult Medium sized species; medium sized black facial spots present; postpronotal lobes and notopleura yellow; scutum red-brown with fuscous markings, mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a narrow fuscous costal band and broad fuscous anal streak, cells bc and c fuscous, microtrichia covering cell c and outer ½ of cell bc; abdominal terga III-V generally red-brown with a medial and two broad lateral longitudinal fuscous bands over all three terga and joined along anterior margin of tergum III; paler forms of the abdomen are often present; posterior lobe of male surstylus short; female with apex of aculeus needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.34.2 Morphological - Larvae See White and Elson-Harris 1992 p. 231. 8.4.34.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from B. neohumeralis or B. aquilonis PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 820 bp BsrI: 200, 600 SnaBI: DNC HhaI: 640, 190 SspI: 180, 570 HinfI: 770 Vspl: DNC Sau3AI: 420 PCR-RFLP Test 2: SspI produces a B. tryoni species complex diagnostic restriction pattern; fragment sizes (bp) are 1000, 550 and 100. This species cannot be distinguished from B. aquilonis or B. neohumeralis. Other restriction patterns useful for diagnosis of the complex are listed in Appendix 3, with choice based on relative distinctiveness from other species potentially trapped; descriptions of the patterns are given in Appendix 4. 226 Allozyme electrophoresis: Section 7.3.5. HOST RANGE Bactrocera tryoni has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Cactaceae, Capparaceae, Caricaceae, Celastraceae, Clusiaceae, Combretaceae, Curcurbitaceae, Cunoniaceae, Davidsoniaceae, Ebenaceae, Elaeocarpaceae, Ericaceae, Euphorbiaceae, Fabaceae, Flacourtiaceae, Goodeniaceae, Hippocraterceae, Juglandaceae, Lauraceae, Lecythidaceae, Loganiaceae, Malpighiaceae, Melastomataceae, Meliaceae, Moraceae, Musaceae, Myrtaceae, Oleaceae, Oxalidaceae, Passifloraceae, Punicaceae, Rhamnaceae, Rosaceae, Rubiaceae, Rutaceae, Santalaceae, Sapindaceae, Sapotaceae, Smilacaceae, Solanaceae, Thymeliaceae, Tiliaceae, Verbenaceae, Vitaceae (for a full list of recorded hosts see Hancock et al. 2000; Leblanc et al. 2012). Major hosts (Hancock et al. 2000): Scientific name Common name Scientific name Common name Anacardium occidentale cashew Mangifera indica mango Annona atemoya atemoya Manikara zapota sapodilla Annona glabra pond apple Morus nigra mulberry Annona muricata soursop Passiflora edulis passionfruit Annona reticula bullock’s heart Passiflora suberosa corky passionfruit Averrhoa carambola carambola Prunus persica peach Capsicum annuum capsicum Prunus persica var. nucipersia nectarine Capsicum annuum chilli Psidium cattleianum (=littorale) cherry guava Carica papaya papaya Psidium guajava guava Casimiroa edulis white sapote Solanum lycopersicum tomato Chryosphyllum cainito star apple Syzgium aqueum water apple Coffea arabica coffee Syzygium forte ssp. forte white apple Eugenia uniflora Brazilian cherry Syzygium jambos wax jambu Eriobotrya japonica loquat Syzygium malacense Malay apple Fortunella japonica kumquat Syzygium suborbiculare red bush apple Malus sylvestris apple Syzygium tierneyanum river cherry DISTRIBUTION Occurs in large populations throughout eastern Australia from Northern Territory, Cape York (Queensland) to East Gippsland (Victoria) (Hancock et al. 2000; Dominiak and Daniels 2011, Royer & Hancock 2012). The distribution was artificially altered by the pest free region known as the Fruit Fly Exclusion Zone (FFEZ) however following the closure of the FFEZ, this species is deemed endemic in Northern Territory, Queensland, Victoria and New South Wales (Dominiak and Mapson in prep.). It is also established in New Caledonia, Austral Islands, many islands of the society group, and has been eradicated from Easter Island (Drew et al. 1982). Despite three specimens being recorded from Papua New Guinea, it is most doubtful that this species is established there (Drew 1989). 227 REMARKS Bactrocera tryoni is similar to B. aquilonis (tryoni complex) in the general patterns of the wing, thorax and abdomen but Bactrocera tryoni differs in having dark fuscous patterns on the scutum and the abdomen. In B. aquilonis the scutum and abdomen are generally pale red-brown (Drew 1989). These species can also be separated on the differences on the ovipositors: apex of aculeus rounded and spicules with 7-10 uniform dentations in B. tryoni compared with the more pointed aculeus and uneven dentations in B. aquilonis (Drew 1989). However, these differences are not easily observed (Cameron et al. 2010). In north Queensland cue traps B. tryoni can also appear similar to B. breviaculeus and B. kraussi. It differs from both species in having tapered slightly shorter vittae and microtrichia in both costal cells. Bactrocera kraussi also has a broad basal band on the scutellum, narrow mesopleural stripe and dark apices of the femora. PEST STATUS Endemic Bactrocera tryoni is the major fruit fly pest species in eastern Australia and is the target of major control and quarantine programmes ATTRACTANT Cue group, Raspberry ketone formate (Melolure) was found to be a stronger attractant than cue-lure in north Queensland (Royer 2015) but less attractive than cue-lure in Sydney (Dominiak et al. 2015a). Combinations of cue lure and methyl eugenol are more attractive in the drier inland but less so in Sydney (Dominiak et al. 2011). Zingerone is equally attractive as cue lure in Sydney (Dominiak et al. 2015b). Wet food lures such as citrus juice or protein attracted more males than females but remain the only lures attractive to female B. tryoni (Dominiak and Nicol 2010). Male lures are much more effective lures compared with wet food lures (Dominiak and Nicol 2010). 228 FIGURES Figure 95. Bactrocera tryoni Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University Figure 96. Bactrocera tryoni Image courtesy of the Department of Economic Development, Jobs, Transport and Resources 229 Figure 97. Bactrocera tryoni Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University Figure 98. Bactrocera tryoni Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 230 8.4.35 Bactrocera (Tetradacus) tsuneonis (Miyake) TAXONOMIC INFORMATION Common Name: Citrus fruit fly Previous scientific names: Dacus tsuneonis Miyake Dacus cheni Chao DIAGNOSIS 8.4.35.1 Morphological – Adult A large species; face fulvous with a pair of small to medium-sized oval black spots; postpronotal lobes and notopleura yellow; a lateral yellow band connecting postpronotal lobe and notopleuron; scutum red-brown; lateral and medial postsutural yellow vittae present; no yellow spot anterior to notopleural suture; mesopleural stripe reaching anterior npl. seta dorsally; scutellum yellow; wing with cells bc and c with a strong pale fuscous tint, microtrichia in outer corner of cell c only; a broad fuscous to pale fuscous costal band confluent with R4+5 at base and overlapping this vein towards apex of wing; anal streak reduced to pale fuscous within cell cup; abdominal terga III-V orange-brown to fulvous with a dark ’T’ pattern consisting of a narrow transverse dark fuscous band across anterior margin of tergum III and a narrow medial longitudinal black band over all three terga and in some specimens fuscous to dark fuscous in anterolateral corners of tergum IV. 8.4.35.2 Morphological – Larvae No information available 8.4.35.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Recorded from family Rutaceae (Citrus and Fortunella species) DISTRIBUTION Japan (Ryukyu Is.); Southern China REMARKS Bactrocera tsuneonis is similar to B. minax in general body shape and colour patterns and these two species may be confused. B. tsuneonis can be distinguished in possessing a yellow band running between the postpronotal lobe and notopleuron, a.sa. setae and the costal band lacking a dark fuscous spot in the apex. PEST STATUS Exotic A minor pest of citrus 231 ATTRACTANT No known record FIGURES Figure 99. Bactrocera tsuneonis Image courtesy of M. Baker, International Centre for the Management of Pest Fruit Flies, Griffith University 232 8.4.36 Bactrocera (Bactrocera) tuberculata (Bezzi) TAXONOMIC INFORMATION Common Name: Previous scientific name: Chaetodacus tuberculatus Bezzi DIAGNOSIS 8.4.36.1 Morphological – Adult A medium-sized species; face fulvous with a pair of large circular black spots; postpronotal lobes and notopleura yellow, scutum mostly black; lateral postsutural yellow vittae present; medial postsutural yellow vitta absent; no yellow spot anterior to notopleural suture; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. seta dorsally; scutellum yellow; wing with cells bc and c colourless, microtrichia in extreme outer corner of cell c only; a narrow pale fuscous to fuscous costal band confluent with R2+3 and broken beyond apex of this vein and with a small fuscous to dark fuscous spot around apex of R4+5; a narrow pale fuscous anal streak confined within cell cup; abdominal terga III-V entirely black. 8.4.36.2 Morphological – Larvae No information available 8.4.36.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Recorded from 8 plant families, some of which include commercial/edible fruit crops DISTRIBUTION Bhutan, Myanmar, Southern China, Thailand, Vietnam REMARKS Bactrocera tuberculata is similar to B. correcta and B. zonata in possessing an incomplete costal band that ends at the apex of cell sc. and a fuscous spot around apex of vein R4+5. It differs from these species in having abdominal terga III-V mostly black. PEST STATUS Exotic A minor pest of mango, papaya and some Syzygium species ATTRACTANT Methyl eugenol 233 FIGURES Figure 100. Bactrocera tuberculate Image courtesy of Y. Martin, International Centre for the Management of Pest Fruit Flies, Griffith University 234 8.4.37 Bactrocera (Bactrocera) umbrosa (Fabricius) TAXONOMIC INFORMATION Common name: Breadfruit fruit fly Previous scientific names: Dacus umbrosus Strumeta umbrosa Dacus (Strumeta) umbrosus Dacus (Bactrocera) umbrosus DIAGNOSIS 8.4.37.1 Morphological - Adult Medium sized species; medium sized black facial spots present; postpronotal lobes and notopleura yellow; scutum black, mesopleural stripe reaching to postpronotal lobe, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a broad fuscous costal band and anal streak, three transverse reddish-fuscous bands across wing with the basal one joining with the anal streak, cells bc and c fulvous with microtrichia in outer ½ of cell c only; abdominal terga varying from orange-brown with a medial longitudinal black stripe on terga IV and V to orange-brown with a broad medial and two broad longitudinal black bands over terga III-V; posterior lobe of male surstylus short; female with apex of aculeus needle shaped (Drew 1989; Drew and Romig 2013). 8.4.37.2 Morphological – Larvae See White and Elson-Harris 1992 p. 238. 8.4.37.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 780 bp BsrI: DNC SnaBI: DNC HhaI: 600, 190 SspI: 680 HinfI: 730 Vspl: DNC Sau3AI: 380 PCR-RFLP Test 2: AluI, DraI and RsaI produce diagnostic patterns (Appendix 3 and 4) Allozyme eletrophoresis: data not available HOST RANGE Bactrocera umbrosa has been recorded on hosts from only the family Moraceae (for a full list of recorded hosts see Allwood et al. 1999; Leblanc et al. 2012). Major commercial hosts (Allwood et al. 1999): Scientific name Common name Scientific name Common name Artocarpus altilis breadfruit Artocarpus heterophyllus jackfruit 235 DISTRIBUTION Widespread and very common in Malaysia, southern Thailand, Philippines, Indonesia, Palau, Papua New Guinea (much less common in the Highlands), Solomon Islands, Vanuatu and New Caledonia (Drew and Romig 2013). REMARKS Bactrocera umbrosa bears no close resemblance to other species. It is easily recognised by the three broad transverse bands across the wings which are red-brown, not the usual fuscous colour (Drew 1989; Drew and Romig 2013). However, there are a few other PNG ME-responsive non-pest species that have bands on the wings and similar pattern on the abdomen that may superficially appear similar e.g. B. seguyi and B. confluens. PEST STATUS Exotic Major pest of Artocarpus species ATTRACTANT Methyl eugenol. FIGURES Figure 101. Bactrocera umbrosa Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum 236 Figure 102. Bactrocera umbrosa Image courtesy of S. Sands and the International Centre for the Management of Pest Fruit Flies, Griffith University 237 8.4.38 Bactrocera (Notodacus) xanthodes (Broun) TAXONOMIC INFORMATION Common name: Pacific fruit fly Previous scientific names: Tephrites (Dacus) xanthodes Dacus (Tephrites) xanthodes Chaetodacus xanthodes Dacus xanthodes Notodacus xanthodes Dacus (Notodacus) xanthodes DIAGNOSIS 8.4.38.1 Morphological - Adult Medium sized species; small black facial spots present; postpronotal lobes fulvous except for a broad yellow band on posterior 2/3; notopleura orange-brown; scutum transparent with a shining orangebrown colouration and with irregular dark markings, broad lateral yellow band running from postpronotal lobe to end just before anterior end of lateral postsutural vitta, large yellow spot on pleural region in place of the normal mesopleural stripe, lateral postsutural vittae present and beginning anterior to mesonotal suture, medial postsutural vitta present, scutellum orange-brown with lateral yellow margins, wing with a narrow fuscous costal band and a broad fulvous anal streak, cells bc and c extremely pale fulvous with microtrichia in outer corner of cell c only, abdominal terga transparent and shining orange-brown with no dark markings; posterior lobe of male surstylus short; female with apex of aculeus needle shaped (Drew 1989; pers. comm. Drew 2010). 8.4.38.2 Morphological – Larvae See White and Elson-Harris 1992 p. 249. 8.4.38.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 860 bp BsrI: DNC SnaBI: DNC HhaI: 670, 200 SspI: 380, 250 HinfI: 680 Vspl: DNC Sau3AI: DNC PCR-RFLP Test 2: AluI, DraI, RsaI and SspI produce diagnostic patterns. AluI: 700-660, 200,170,130,120,110; DraI: 1150-1100, 250-240. <100, RsaI: 750,370,360; SspI: 1200, 210, 80 Allozyme electrophoresis: data not available 238 HOST RANGE Bactrocera xanthodes has been recorded on hosts from twenty plant families. These include: Anacardiaceae, Annonaceae, Apocynaceae, Caricaceae, Combretaceae, Euphorbiaceae, Lauraceae, Lecythidaceae, Moraceae, Passifloraceae, Rutaceae and Sapotaceae (for a full list of recorded hosts see Leblanc et al. 2012). Major commercial hosts (Drew 1989; Leblanc et al. 2012): Scientific name Common name Scientific name Common name Artocarpus altilis breadfruit Carica papaya pawpaw DISTRIBUTION Fiji Islands, Tonga, Niue, Samoa, American Samoa, Southern group of Cook Islands, Wallis and Futuna. Introduced on Nauru (first detected in 1992) but subsequently eradicated by male annihilation. Detected in April 1998 on Raivavae (French Polynesia) but subsequently eradicated by male annihilation (Drew 1989; Leblanc et al. 2012). REMARKS Bactrocera xanthodes is a unique species having a pair of well-developed postpronotal lobe setae, the transparent integument on the head, thorax and abdomen, a soft integument particularly noticeable on the abdomen where the terga fold ventrally in dead specimens (Drew 1989). Other remarks: Bactrocera xanthodes belongs to subgenus Notodacus, an unusual feature of which is the presence of a seta on each postpronotal lobe (i.e. shoulder). It has a very distinct V-shaped notch in the apex of its scutellum. Bactrocera paraxanthodes has this to a lesser extent. Another unusual feature of B. xanthodes is that the lateral stripes (vittae) on the scutum extend forward to the postpronotal lobes and back down the sides of the scutellum. There is also a medial yellow stripe that extends to the posterior edge of the scutum (immediately before the scutellum); this stripe is shorter in B. paraxanthodes. The most obvious difference between the closely related B. paraxanthodes and B. xanthodes is that B. xanthodes has yellow lateral margins to the scutellum while B. paraxanthodes has dark margins (CABI 2007). PEST STATUS Exotic High priority pest identified in the Avocado and Tropical fruit IBPs ATTRACTANT Methyl eugenol. 239 FIGURES Figure 103. Bactrocera xanthodes Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University and Queensland Museum Figure 104. Bactrocera xanthodes Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 240 8.4.39 Bactrocera (Bactrocera) zonata (Saunders) TAXONOMIC INFORMATION Common name: Peach fruit fly Previous scientific names: Dasyneura zonatus Dacus (Strumeta) zonatus DIAGNOSIS 8.4.39.1 Morphological - Adult Face fulvous with a pair of medium sized oval black spots; scutum red-brown with pale fuscous patterning posteriorly; postpronotal lobes and notopleura yellow; mesopleural stripe reaching to or almost to anterior npl. seta dorsally; medium width parallel sided lateral postsutural vittae ending at or just behind ia. seta; medial postsutural vitta absent; scutellum yellow; legs with all segments entirely fulvous except apices of femora red-brown and hind tibiae pale fuscous to fuscous; wings with cells bc and c colourless and entirely devoid of microtrichia, a narrow fuscous costal band confluent with R 2+3 and ending at apex of this vein, a small oval fuscous spot across apex of R 4+5, anal streak reduced to a pale tint within cell cup; supernumerary lobe of medium development; abdominal terga III-V redbrown with a ‘T’ pattern consisting of a narrow transverse black band across anterior margin of tergum III (this band is often broken in the central region) and a narrow medial longitudinal black band over all three terga (this band is often reduced to a stripe over parts of terga IV and V), narrow anterolateral fuscous corners on terga IV and V, a pair of oval red-brown shining spots on tergum V; posterior lobe of male surstylus short; female with apex of aculeus needle shaped (Drew and Romig 2013). 8.4.39.2 Morphological - Larvae - Not available/included in this edition 8.4.39.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 850 bp BsrI: 600, 200 SnaBI: 535, 330 HhaI: 680, 190 SspI: 750, 120 HinfI: DNC Vspl: DNC Sau3AI: DNC PCR-RFLP Test 2: No fully diagnostic restriction enzymes, but a combination of several can be chosen to distinguish B. zonata from other Bactrocera and species in other genera. See Appendices 3 and 4 Allozyme electrophoresis: data not available 241 HOST RANGE Bactrocera zonata has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Arecaceae, Caricaceae, Combretaceae, Curcurbitaceae, Fabaceae, Lecythidaceae, Malpighiaceae, Malvaceae, Myrtaceae, Punicaceae, Rosaceae, Rutaceae and Tiliaceae (for a full list of recorded hosts see Allwood et al. 1999; Tsuruta et al. 1997). Major commercial hosts (Allwood et al. 1999): Scientific name Common name Scientific name Common name Mangifera indica mango Psidium guajava guava Prunus persica peach DISTRIBUTION Bhutan, Sri Lanka, India, Pakistan, Thailand, Vietnam, Mauritius, Egypt, UAE (Drew and Romig 2013). REMARKS Bactrocera zonata is a red brown species that is similar in general appearance to B. tryoni. It is easily distinguished from B. tryoni in having the costal band interrupted beyond apex of R2+3. Bactrocera correcta possess a similar costal band but has a black scutum and a black ‘T’ pattern on abdominal terga III-V (Drew and Romig 2013). PEST STATUS Exotic High priority pest identified in the Tropical fruit IBP In India, Pakistan and now Egypt, it is an important fruit fly pest and causes severe damage to peach, guava and mango ATTRACTANT Methyl eugenol. 242 FIGURES Figure 105. Bactrocera zonata Image courtesy of A. Carmichael and the International Centre for the Management of Pest Fruit Flies, Griffith University 243 Species diagnosis: Ceratitis (Tephritidae: Dacinae: Ceratitidini) 8.5.1 Ceratitis capitata (Wiedemann) TAXONOMIC INFORMATION Common name: Mediterranean fruit fly Previous scientific names: Trypeta capitata DIAGNOSIS 8.5.1.1 Morphological - Adult In Australia, there are no species of Ceratitis that look similar to C. capitata. Consequently, the following characters can be used to distinguish Ceratitis capitata from all other species of Tephritidae occurring in Australia. Small to medium-sized, brightly coloured flies; scutellum swollen, rounded above, shiny black with a thin sinuate yellow streak near base dorsally; scutum yellowish with numerous black areas in a characteristic pattern; abdomen yellowish with two narrow transverse lightcoloured bands; wing relatively broad in comparison with its length, cloudy yellow, with three brown bands on apical two-thirds, all separated from each other, and smaller dark irregular-shaped streaks within the cells in the proximal half; cell cup with its apical extension short; males with a black diamond-shaped expansion of the apex of the anterior orbital seta. These characters also distinguish C. capitata from all other species in the genus wherever they may occur worldwide. Several species of the subgenus Ceratitis closely resemble C. capitata in the thoracic pattern, the apical expansion of cell cup, the presence of dark markings in the basal half of the wing, and in having the anterior orbital bristle of the male modified in some way. In C. capitata, it is black and resembles a diamond apically rather than some other shape (Foote, Blanc and Norrbom 1993). 8.5.1.2 Morphological - Larvae - Not available/included in this edition 8.5.1.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 900 bp BsrI: DNC SnaBI: DNC HhaI: DNC SspI: 520, 160 HinfI: DNC Vspl: 650, 200 Sau3AI: DNC PCR-RFLP Test 2: DdeI and RsaI are fully diagnostic for C. capitata, although most of the others provide additional diagnostic value. DdeI: 1150, 270, 220, 130; RsaI: 450,380,290,260,240,110 Allozyme electrophoresis (Section 7.3.5). 244 HOST RANGE Ceratitis capitata is a highly polyphagous species and its pattern of host relationships from region to region appears to relate largely to what fruits are available (CABI 2007). It has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Cactaceae, Caricaceae, Clusiaceae, Combretaceae, Ebenaceae, Juglandaceae, Lauraceae, Lythraceae, Malpighiaceae, Malvaceae, Muntingiceae, Myrtaceae, Passifloraceae, Rosaceae, Rubiaceae, Rutaceae, Santalaceae, Sapindaceae, Sapotaceae, Solanaceae and Vitaceae (for a full list of recorded hosts see CABI 2007). Major commercial hosts (CABI 2007): Scientific name Common name Scientific name Common name Annona cherimola cherimoya Malus domestica apple Capsicum annuum bell pepper Prunus spp. stone fruit Citrus spp. citrus Prunus salicina Japanese plum Coffea spp. coffee Psidium guajava guava Ficus carica fig Theobroma cacao cocoa DISTRIBUTION Native to Africa, has spread to the Mediterranean region, southern Europe and Middle east, Western Australia, Central and South America and Hawaii (PaDIL 2007). A review of the past and present distribution of Ceratitis capitata in Australia (Dominiak and Daniels 2011). Now only found in Western Australia, it has not been detected in any eastern State since the 1950’s. REMARKS The males of Ceratitis capitata are easily separated from all other members of the family by the black pointed expansion at the apex of the anterior pair of orbital setae. The females can be separated from most other species by the characteristic yellow wing pattern and the apical half of the scutellum being entirely black (White and Elson-Harris 1992). PEST STATUS Endemic High priority pest identified in the Mango IBP Ceratitis capitata is an important pest in Africa and has spread to almost every other continent to become the single most important pest species in the family Tephritidae It is ecologically adapted to regions of Mediterranean climate and less of a problem in subtropical and tropical areas although it can still be damaging in elevated tropical regions. ATTRACTANT Trimedlure/capilure and terpinyl acetate. 245 FIGURES Figure 106. Ceratitis capitata Image courtesy of Scott Bauer, USDA Agricultural Research Service, Bugwood.org Figure 107. Ceratitis capitata Image courtesy of Ken Walker, Museum Victoria, www.padil.gov.au (as of 22 August 2011) 246 8.5.2 Ceratitis (Pterandrus) rosa (Karsch) TAXONOMIC INFORMATION Common name: Natal fruit fly Previous scientific names: Pterandrus rosa DIAGNOSIS 8.5.2.1 Morphological - Adult Head: Anterior pair of orbital setae not modified in any way. Thorax: Scutellum marked black and yellow, with yellow lines or areas meeting margin, such that each apical scutellar seta is based in or adjacent to a yellow stripe; male mid-femora without stout ventral setae; mid-tibiae with rows of stout setae along the distal half of both the anterior and posterior edges giving a feathered appearance. Wing length 4-6 mm. The males of most species of subgenus Pterandrus have rows of stout setae on both the anterior and posterior edges of each mid-tibia, giving a feathered appearance. Ceratitis rosa can be separated from most other members of this subgenus by having this feathering confined to the distal half of the tibia and by lacking stout setae on the underside of the mid-femur. The males also lack the spatulate head appendages of subgenus Ceratitis. Unfortunately, there is no simple method of recognizing females, except that Pterandrus species tend to have brown wing bands and a generally brown body colour, which contrasts with the yellow markings of C. capitata. 8.5.2.2 Morphological - Larvae - Not available/included in this edition 8.5.2.3 Molecular DNA barcoding: BOLD reference data available, but not well resolved amongst a number of other species in BOLD. Low divergence clades are apparent and when used in conjunction with other information about the specimen may be sufficient to make a confident identification PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 1020 bp BsrI: DNC SnaBI: DNC HhaI: DNC SspI: 570, 480 HinfI: 800, 200 Vspl: 600, 300 Sau3AI: DNC PCR-RFLP Test 2: Fully diagnostic restriction enzymes are DdeI, HinfI, RsaI, Sau3A, SspI ad all other enzymes have some restriction value. DdeI: 1500, 270, 220, 170; HinfI: 780, 410,330,280,150,120; RsaI: 410, 380, 310, 290, 260, 240, 130, 110; Sau3A: 1400, 770,110; SspI: 1000, 490, 300, 240, 150 Allozyme electrophoresis: (Section 7.3.5). 247 HOST RANGE Ceratitis rosa has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Apocynaceae, Caricaceae, Clusiaceae, Combretaceae, Lauraceae, Malvaceae, Moraceae, Myrtaceae, Oxalidaceae, Rhamnaceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, Sapotaceae, Solanaceae, and Vitaceae (for a full list of recorded hosts see CABI 2007). Major commercial hosts (UF & FDACS 2009; CABI 2007): Scientific name Common name Scientific name Common name Coffea arabica coffee Prunus persica peach Citrus spp. citrus Psidium spp. guava DISTRIBUTION Angola, Ethiopia, Kenya, Malawi, Mali, Mozambique, Nigeria, Republic of South Africa (KwaZulu Natal), Rwanda, Rhodesia, Swaziland, Tanzania, Uganda, Zaire, and the islands of Mauritius and Reunion (UF & FDACS 2009). REMARKS Ceratitis rosa is best recognised by its characteristic pattern of brown wing bands, the three black areas in the apical half of the scutellum, and by the male having feathering on the mid tibiae, but no feathering on the mid femora (White and Elson-Harris 1992). This fruit fly closely resembles the Mediterranean fruit fly in appearance. It averages slightly larger and has characteristic picture wings and dark black spots on the thorax. The arista of the antenna is plumose, while that of the C. capitata bears only short pubescence. The front of the male lacks the pair of conspicuous spatulate setae which is found on the male C. capitata. The mesothoracic tibiae of the males are clothed with dorsal and ventral brushes of elongated bluish-black scales, lacking in the C. capitata. The ovipositor sheath of the female is shorter than the width at its base. Length of the fly 4 to 5 mm (UF & FDACS 2009). PEST STATUS Exotic High priority pest identified in the Mango IBP Ceratitis rosa is highly polyphagous and causes damage to a very wide range of unrelated fruit crops ATTRACTANT Trimedlure and terpinyl acetate. 248 FIGURES Figure 108. Ceratitis rosa Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) Figure 109. Ceratitis rosa Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 249 Species diagnosis: Dacus (Tephritidae) 8.6.1 Dacus (Callantra) longicornis (Wiedemann) TAXONOMIC INFORMATION Common Name: Previous scientific names: See Drew & Romig (2013), p. 373. DIAGNOSIS 8.6.1.1 Morphological – Adult A large species; face fulvous with a pair of small irregularly oval black spots; postpronotal lobes yellow except posterodorsal corners fuscous; notopleura yellow; scutum dark red-brown without distinct dark patterns; lateral and medial postsutural yellow vittae absent; a narrow yellow triangle running along anterior margin of notopleural suture with base on notopleuron; mesopleural stripe narrow equal in width to notopleuron dorsally; scutellum yellow except for broad red-brown basal band; setae: sc. 2; prsc. absent; ia. 1; p.sa. 1; a.sa. 1; mpl. 1; npl. 2; scp. 4; legs with fore femora dark red-brown to fuscous, mid femora dark red-brown to fuscous except fulvous on basal 1/4, hind femora dark fuscous; fore and mid tibiae dark red-brown to fuscous, hind tibiae dark fuscous; fore tasi with all segments dark red-brown, mid and hind tarsi with basal segment fulvous and apical four segments red-brown; wing with cells bc and c fuscous, dense microtrichia over all of cell c and most of cell bc; a broad dark fuscous costal band overlapping R4+5 for its entire length and sometimes becoming darker at apex; anal streak indistinct but a broad pale fuscous area generally over cell cup and across wing margin towards cell dm; supernumerary lobe weak; abdomen strongly petiolate, abdominal terga III-V generally dark fuscous to black with a paler band often across posterior margin of tergum III, large orange-brown spots posterocentrally on terga IV and V with the spot on tergum V often expanded anteriorly into a medial longitudinal orange-brown band. 8.6.1.2 Morphological – Larvae No information available 8.6.1.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Recorded from family Cucurbitaceae, primarily species of genus Luffa. DISTRIBUTION Widespread from Southern Asia to South-East Asia 250 REMARKS Dacus longicornis possesses significant variability in colour patterns and thus some specimens may be difficult to identify. It is distinguished by having a red-brown scutum, fuscous cells bc and c, the costal band overlapping R4+5, face fulvous with a pair of black spots, fuscous anatergite, yellow katatergite, postpronotal lobes mostly yellow and a narrow mesopleural stripe. PEST STATUS Exotic A minor pest of native cucurbits, mainly Luffa species, in village situations ATTRACTANT Cue lure FIGURES Figure 110. Dacus longicornis Image courtesy of S. Sands and the International Centre for the Management of Pest Fruit Flies, Griffith University 251 8.6.2 Dacus (Callantra) solomonensis (Malloch) TAXONOMIC INFORMATION Common Name: Previous scientific names: Dacus (Callanatra) solomonensis Malloch Callantra solomonensis (Malloch) DIAGNOSIS 8.6.2.1 Morphological – Adult Large species; face with a pair of large oval black spots; postpronotal lobes yellow to yellow-brown; notopleura yellow; scutum dark fuscous with a large irregular red-brown area on posterior region, lateral and medial postsutural vittae absent, mesopleural stripe of medium width extending midway between anterior margin of notopleuron and anterior npl. bristle, yellow triangle extending along anterior margin of mesonotal suture, scutellum usually red-brown; setae: sc. 2, prsc. absent, a.sa. 1; wing with a broad fuscous costal band and broad fulvous anal streak, costal cells orange-brown with dense microtrichia covering both cells; abdominal terga III and IV dull black with orange-brown along posterior margins and tergum V dark fuscous to dull black except for orange-brown medially and along posterior margin, posterior lobe of surstylus short, abdominal sternum V with a slight concavity on posterior margin. 8.6.2.2 Morphological – Larvae No information available 8.6.2.3 Molecular DNA barcoding: BOLD reference data not available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: AluI, DraI, RsaI and SspI provide diagnostic restriction patterns. AluI: 720-770, 170, 150, 130, 120,110; DraI: 800-750, 270, 220, 180-160; RsaI: 450, 380,320,290; SspI: 1100, 380 Allozyme eletrophoresis: data not available HOST RANGE Reared from family Cucurbitaceae (pumpkins and cucumber) DISTRIBUTION Bougainville Island; Solomon Islands REMARKS Dacus solomonensis is a unique species in possessing a large hump on abdominal tergum V. PEST STATUS Exotic A significant pest of some cucurbit crops in village situations in the area of distribution 252 ATTRACTANT Cue lure FIGURES Figure 111. Dacus solomonensis Image courtesy of S. Sands and the International Centre for the Management of Pest Fruit Flies, Griffith University 253 Species diagnosis: Dirioxa (Tephritidae: Phytalmiinae) 8.7.1 Dirioxa pornia (Walker) TAXONOMIC INFORMATION Common name: Island fly Previous scientific names: Trypeta pornia DIAGNOSIS 8.7.1.1 Morphological - Adult Head with arista plumose on dorsal surface, bare on ventral surface; thorax with scutum mostly redbrown, 6 scutellar setae; scutellum flat and bare of microsetae; legs with one strong apical spine on mid tibiae; wing pattern as per Figure 113; abdominal terga fulvous with transverse black patterns on terga III to V; male surstylus short and thick; female aculeus rounded and blunt at apex (pers. comm. Drew 2010). 8.7.1.2 Morphological - Larvae - Not available/included in this edition 8.7.1.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: approximate ITS1 fragment length - gel: 530 bp BsrI: DNC SnaBI: DNC HhaI: DNC SspI: 300, 220 HinfI: DNC Vspl: DNC Sau3AI: DNC PCR-RFLP Test 2: Data not available Allozyme electrophoresis (Section 7.3.5). HOST RANGE Dirioxa pornia attacks ripe, damaged and fallen fruit. It has been recorded on hosts from a wide range of families. These include: Anacardiaceae, Annonaceae, Araucariaceae, Capparaceae, Caricaceae, Clusiaceae, Combretaceae, Curcurbitaceae, Ebenaceae, Euphorbiaceae, Fabaceae, Lauraceae, Lecythidaceae, Loganiaceae, Moraceae, Musaceae, Myrtaceae, Oleaceae, Oxalidaceae, Passifloraceae, Proteaceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, Sapotaceae, Solanaceae and Xanthophyllaceae (for a full list of recorded hosts see Hancock et al. 2000). Major hosts: No major host fruits have been identified but has created occasional quarantine problems. DISTRIBUTION Eastern Australia, from Iron Range, Cape York Peninsula, to southern New South Wales. Introduced to Perth, Western Australia. (Hancock et al. 2000). Also in Northern Victoria. 254 REMARKS Dirioxa spp. are the only tephritids with six setae on the scutellar margin, that are likely to be found in fruit crops; the wing pattern is characteristic (White and Elson-Harris 1992). PEST STATUS Endemic ATTRACTANT Protein and citrus juice (Dominiak et aI. 2003) and is attracted to cue lure in some cases. FIGURES Figure 112. Dirioxa pornia Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 November 2015) Figure 113. Dirioxa pornia Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 255 Species diagnosis: Rhagoletis (Tephritidae: Trypetinae: Trypetini) 8.8.1 Rhagoletis cerasi (Linnaeus) TAXONOMIC INFORMATION Common Name: European Cherry Fruit Fly Previous scientific name: Musca cerasi Linnaeus DIAGNOSIS 8.8.1.1 Morphological – Adult Rhagoletis cerasi possesses a unique wing colour pattern with a short broad transverse fuscous band at base, a broad transverse fuscous band across centre from anterior margin to hind margin and enclosing r-m crossvein, a short narrow transverse fuscous band from anterior margin to vein R4+5 and an inverted L-shaped band at apex of wing, the stem of which encloses dm-cu crossvein. 8.8.1.2 Morphological – Larvae See Pest Fruit Flies of the World – Larvae 8.8.1.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Recorded from family Caprifoliaceae (Lonicera species), family Rosaceae (Prunus species) DISTRIBUTION Northern Europe (except UK); Central Asia REMARKS Rhagoletis cerasi is distinguished by its unique wing colour patterns. PEST STATUS Exotic A major pest of commercial cherries throughout its geographic range ATTRACTANT No known record 256 FIGURES Figure 114. Rhagoletis cerasi Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 14 October 2015) 257 8.8.2 Rhagoletis cingulata (Leow) TAXONOMIC INFORMATION Common name: Cherry fruit fly Previous scientific name: Trypeta cingulata DIAGNOSIS 8.8.2.1 Morphological – Adult Rhagoletis species are diagnosed primarily on wing patterns. The wing of R. cingulata possesses a broad singular dark fuscous band from anterior margin to hind margin in centre of wing, an inverted ‘U’-shaped dark fuscous pattern across apex and a dark fuscous spot across apex of R4+5. 8.8.2.2 Morphological – Larvae See Pest Fruit Flies of the World – Larvae 8.8.2.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE A significant pest in commercial cherries in the eastern half of USA DISTRIBUTION Eastern half of USA REMARKS Rhagoletis cingulata is distinguished by its wing colour patterns. It is morphologically close to Rhagoletis indifferens. See notes under R. indifferens to separate these two species. PEST SPECIES Exotic A significant pest of cherries in USA ATTRACTANT No known species 258 FIGURES Figure 115. Rhagoletis cingulata Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 14 October 2015) 259 8.8.3 Rhagoletis completa (Cresson) TAXONOMIC INFORMATION Common name: Walnut husk fly Previous scientific names: Rhagoletis suavis completa Rhagoletis suavis var. completa DIAGNOSIS 8.8.3.1 Morphological - Adult The four transverse wing bands are present and are usually distinctly separated by hyaline areas, except in occasional specimens in which the discal and subapical bands are connected posteriorly. In the former case, the pattern closely resembles that of R. berberis, but the host relationships of these two species are quite different. The thorax and abdomen of R. completa are golden yellow (completely black in R. berbeis) and the scutellum is concolorous yellow (black with a distinct yellow spot in R. berberis) (Foote et al. 1993). 8.8.3.2 Morphological - Larvae - Not available/included in this edition 8.8.3.3 Molecular DNA barcoding: BOLD reference data available, but not well resolved amongst a number of other species in BOLD. Low divergence clades may be apparent and used in conjunction with other information about the specimen may be sufficient to make a confident identification PCR-RFLP Test 1: data not available PCR-RFLP Test 2: AluI is fully diagnostic; DraI, HinfI, RsaI and SspI also have diagnostic value AluI: 640, 450, 130, 120, 110 Allozyme eletrophoresis: data not available HOST RANGE Rhagoletis completa has been recorded on hosts from two families, Juglandaceae and Rosaceae (for a full list of recorded hosts see CABI 2007). Major commercial hosts (CABI 2007): Scientific name Common name Scientific name Common name Juglans californica California walnut Juglans nigra black walnut Juglans hindsii Californian black walnut Juglans regia walnut DISTRIBUTION Southern and Central USA including Mexico; adventive in Western USA since the 1920s. Also established in Southern Europe since the early 1990s (CABI 2007). 260 REMARKS Rhagoletis completa is an unusual economic tephritid species in that it is a major pest of walnuts, in contrast to the soft fleshy fruit hosts of other fruit fly species. It is best diagnosed by the distinctive wing colour patterns (Figure 116) and a red-brown thorax. It is widely distributed over Central and Western mainland USA (pers. comm. Drew 2010). PEST STATUS Exotic High priority pest identified in the Nuts IBP ATTRACTANT No known record, but can be captured in traps emitting ammonia. FIGURES Figure 116. Rhagoletis completa Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 261 8.8.4 Rhagoletis fausta (Osten-Sacken) TAXONOMIC INFORMATION Common name: Black cherry fruit fly Previous scientific names: Trypeta (Acidia) fausta Trypeta fausta Rhagoletis fausta Acidia fausta DIAGNOSIS 8.8.4.1 Morphological - Adult Rhagoletis fausta is very close to R. striatella in that the posterior apical band in both species arises from the subapical band in the vicinity of vein r-m, making an F-shaped pattern in the apical half of the wing similar to that in the pomonella group (however, in the latter, note that the subapical band is missing and the apical bands are connected to the discal band). In wing pattern alone, R. fausta is unique among North American Rhagoletis in combining a very broad connection between the discal and subapical bands in cell dm with the presence of both an anterior and posterior apical band, the latter arising in much the same location as in R. striatella. In R. striatella, the discal and subapical bands are separate or connected only along the posterior wing margin. In many respects, the wing pattern of R. fausta resembles that of R. suavis, but R. fausta has both anterior and posterior apical bands and an isolated hyaline spot in the distal half of cell cua1. Rhagoletis suavis has a yellowish body; that of R. fausta is black and without yellowish bands at the posterior margins of the abdominal terga (Foote et al. 1993). 8.8.4.2 Morphological - Larvae - Not available/included in this edition 8.8.4.3 Molecular DNA barcoding: diagnostic BOLD reference data available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Rhagoletis fausta has been recorded on hosts the Rosaceae family (for a full list of recorded hosts see CABI 2007). Major commercial hosts (CABI 2007): Scientific name Common name Scientific name Common name Prunus avium sweet cherry Prunus cerasus sour cherry 262 DISTRIBUTION Widespread occurrence in western and eastern North America (United States and Canada) (CABI 2007). REMARKS Rhagoletis fausta is a dark coloured species with the scutum and abdominal tergites primarily black. It also has a unique wing colour pattern (Figure 117). It is widely distributed over mainland USA where it infests cherry varieties in the plant genus Prunus (pers. comm. Drew 2010). PEST STATUS Exotic High priority pest identified in the Cherry IBP Rhagoletis fausta is an important pest of cherries in North America ATTRACTANT No known record, but can be captured in traps emitting ammonia. FIGURES Figure 117. Rhagoletis fausta Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 263 8.8.5 Rhagoletis indifferens (Curran) TAXONOMIC INFORMATION Common name: Western cherry fruit fly Previous scientific names: Rhagoletis cingulata Rhagoletis cingulata indifferens DIAGNOSIS 8.8.5.1 Morphological - Adult Rhagoletis indifferens is similar to R. cingulata in wing pattern but the anterior arm of R. indifferens is broken to produce an apical spot in only about 5% of individuals in contrast to R. cingulata, in which this spot is much more commonly encountered. In addition, other characters that distinguish R. indifferens from R. cingulata are as follows: Rhagoletis indifferens: A. Apical yellow shading on posterior margin of tergite 5 of male lacking. B. Black shading always present on posterior surface of fore coxa C. Epandrium dark-coloured Rhagoletis cingulata: A. Apical yellow shading on posterior margin of tergite 5 of male present B. Fore coxae concolorous yellow C. Epandrium light-coloured Most individuals of R. indifferens may be distinguished from those of R. chionanthi and R. osmanthi by the differences in geographical distribution and hosts and by the generally smaller size and lesser development of the wing bands. (Foote et al. 1993). 8.8.5.2 Morphological - Larvae - Not available/included in this edition 8.8.5.3 Molecular DNA barcoding: BOLD reference data not available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available 264 HOST RANGE Rhagoletis indifferens has been recorded on hosts the Rosaceae family (for a full list of recorded hosts see CABI 2007). Major commercial hosts (CABI 2007): Scientific name Common name Prunus avium sweet cherry DISTRIBUTION Rhagoletis indifferens is a western North American species (Canada and United States). Adventive populations have been found in southern Switzerland since the early 1990s (CABI 2007). REMARKS Rhagoletis indifferens may not be a distinct species but a colour variety of Rhagoletis cingulata. It is distributed primarily over western regions of mainland USA where it infests wild and cultivated cherries of the plant genus Prunus (pers. comm. Drew 2010). PEST STATUS Exotic High priority pest identified in the Cherry IBP Rhagoletis indifferens is an important pest of cherries in North America ATTRACTANT No known record, but can be captured in traps emitting ammonia. FIGURES Figure 118. Rhagoletis indifferens Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 265 8.8.6 Rhagoletis mendax (Curran) TAXONOMIC INFORMATION Common Name: Blueberry maggot Previous scientific names: DIAGNOSIS 8.8.6.1 Morphological – Adult Rhagoletis mendax wing markings consist of broad dark fuscous basal band and an F-shaped pattern across the entire membrane. It also lacks dark markings on the fore femora and the female aculeus is shorter than in other species (aculeus length 0.73 – 0.89 mm). 8.8.6.2 Morphological – Larvae See Pest Fruit Flies of the World – Larvae 8.8.6.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from R. pomonella PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme eletrophoresis: data not available HOST RANGE Recorded from 11 species of the genus Vaccinium (family Ericaceae). A serious pest of blueberries in Eastern USA. DISTRIBUTION Eastern USA REMARKS Rhagoletis mendax has often been confused with R. pomonella. It is separated from R. pomonella by the absence of dark markings on the fore femora and the shorter aculeus. PEST STATUS Exotic A significant pest of blueberries in Eastern USA ATTRACTANT No known record 266 FIGURES Figure 119. Rhagoletis mendax Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 14 December 2015) 267 8.8.7 Rhagoletis pomonella (Walsh) TAXONOMIC INFORMATION Common name: Apple maggot Previous scientific names: Trypeta pomonella Trypeta (Rhagoletis) pomonella DIAGNOSIS 8.8.7.1 Morphological - Adult Rhagoletis pomonella, together with R. zephyria, R. mendax and R. cornivora are among the most readily recognised species of Rhagoletis by virture of their wing pattern, which consists of a slightly oblique discal band to which the anterior and posterior apical bands are connected, forming a characteristic F-shaped pattern in the apical half of the wing. The absence of the subapical band distinguishes the species of the pomonella group from all other species of Rhagoletis. Rhagoletis striatella, which also has an F-shaped apical wing pattern, is distinguished from R. pomonella by the colour pattern of the scutellum and the additional characters given in the key to species. Rhagoletis pomonella is separable from the other three species of the pomonella group by the presence in most specimens of heavy black shading on the posterior surface of the fore femur, and, in specimens from the northern part of its range, by a generally larger body size and by the longer aculeus (0.901.49mm). In the southern part of its range, specimens of R. pomonella generally are smaller than in the north. For that reason and because of a consequently shorter aculeus, females are not separable from those of R. mendax and R. cornivora by the use of morphological characters. Mexican specimens of R. pomonella resemble those that occur in the United States and Canada but generally are larger and possess a light spot near the base of the apical wing band (Foote, Blanc and Norrbom 1993). 8.8.7.2 Morphological - Larvae - Not available/included in this edition 8.8.7.3 Molecular DNA barcoding: BOLD reference data available, but cannot be distinguished from R. mendax PCR-RFLP Test 1: data not available PCR-RFLP Test 2: HinfI and RsaI are fully diagnostic; DraI also has some diagnostic value HinfI: 640, 260,190,150, 110, 80, 70 Allozyme eletrophoresis: data not available HOST RANGE Rhagoletis pomonella has been recorded on hosts from the Rosaceae family (for a full list of recorded hosts see CABI 2007). Major commercial hosts (CABI 2007): Scientific name Common name Malus domestica apple 268 DISTRIBUTION Canada, United States and Mexico (Carroll et al. 2002). REMARKS Rhagoletis pomonella possesses primarily a black scutum and abdomen and a distinctive wing colour pattern (Figure 120). R. pomonella is difficult to distinguish from R. mendax. It has been the subject of extensive taxonomic, ecological and pest management research in the USA and is considered the major economic pest species within the genus Rhagoletis. It is a major pest of cultivated apples. It is distributed over the central and north-eastern regions of mainland USA and extreme southern Canada. In 1979 it was introduced into the western coastline of the USA and is now widespread in that region (pers. comm. Drew 2010). PEST STATUS Exotic High priority pest identified in the Apple and Pear, and Cherry IBPs Rhagoletis pomonella, which primarily attacks apples, is the most serious fruit fly pest in North America ATTRACTANT No known record, but can be captured in traps emitting ammonia. FIGURES Figure 120. Rhagoletis pomonella Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 269 Species diagnosis: (Diptera: Drosophilidae) 8.9.1 Drosophila (Sophophora) suzukii (Matsumura 1931) TAXONOMIC INFORMATION Common name: Spotted Wing Drosophila (SWD) Previous scientific names: Leucophenga suzukii DIAGNOSIS 8.9.1.1 Morphological – Adult A factsheet (PHA 2013) and draft diagnostic identification protocol have been produced for Australia (Blacket et al. 2015 b). Drosophilidae are characterised by head with 1 pair of proclinate and 1 or 2 pairs of reclinate orbital bristles; post-vertical bristles, when present, parallel or convergent; arista usually branched above and below; mesopleuron bare; costa twice broken; auxiliary vein not reaching costal margin (Bock 1976). Sophophora species are characterised by relatively narrow cheeks and possession (in most species) on the abdominal tergites of dark posterior bands that are not interrupted in the mid-line (Bock 1980). SWD has a uniform apricot coloured thorax that is free of stripes, spots or patterns, with unbroken dorsal bands on its abdomen (Blacket et al. 2015 b). Male SWD have a single apical wing spot (Figure 121A) and a single row of apical dark combs running across (rather than parallel with) each of the basal two tarsal segments (Figure 121C). Female SWD possess an ovipositor that is strongly sclerotized with robust teeth (typically with 30-36 teeth, Seljak 2013), very strongly developed along the lower half towards the ovipositor tip with a sawlike lower edge (Figure 121B), the ovipositor is 6-7 times longer than the diameter of the spermatheca (only 2-3 times longer in most other Drosophila species) (Hauser 2011). 8.9.1.2 Morphological - Larvae - Not available/included in this edition 8.9.1.3 Molecular DNA barcoding: BOLD reference data is available PCR-RFLP Test 1: data not available PCR-RFLP Test 2: data not available Allozyme electrophoresis: data not available Published molecular tests: DNA barcoding has been employed by to confirm SWD in Europe (Calabria et al. 2012). A PCR-RFLP test has been developed by Kim et al. (2014). A High Resolution Melt Real Time PCR test has been developed by Dhami & Kumarasinghe (2014). Species-specific multiplex PCR primers have also been developed by Murphy et al. (2015). 270 HOST RANGE Spotted Wing Drosophila (SWD), is one of the few species of Drosophilidae known to be a pest of healthy, unripe fruit (Walsh et al. 2011, Atallah et al. 2014), Drosophila generally prefer to breed in fruit that is already decaying and fermenting. SWD is a highly polyphagous pest that breeds in a wide variety of mostly thin skinned small fruits (particularly Rosaceae) and is currently known from fifteen plant families (Cini et al. 2012): Actinidiaceae, Adoxaceae, Caprifoliaceae, Cornaceae, Ebenaceae, Elaeagnaceae, Ericaceae, Grossulariaceae, Moraceae, Myricaceae, Myrtaceae, Rhamnaceae, Rosaceae, Rutaceae, Vitaceae. Major commercial hosts (PHA 2013): Scientific name Common name Scientific name Common name Prunus sp. cherries & stone fruit Fragaria ananassa strawberry Rubus sp. berries Vitis sp. grapes Malus sp. apples Pyrus sp. pears DISTRIBUTION Worldwide SWD has recently rapidly spread from eastern Asia to many other regions (Walsh et al. 2011), including parts of Oceania, North America, Europe and South America. SWD is currently unknown from Australia. REMARKS A large number of Drosophila species are known from Australia and many Drosophila species have larvae that are commonly found in rotting fruit. SWD belong to the Sophophora subgenus of Drosophila, a group that contains a large number of species (>300 worldwide), including the common cosmopolitan D. melanogaster and D. simulans. There are twenty species currently known from Australia (Atlas of Living Australia, http://www.ala.org.au/). Male D. melanogaster and D. simulans are superficially similar to SWD in usually possessing dark tipped abdomens, but they differ in the morphology of the combs on their basal tarsal segments and in having non-spotted wings (Blacket et al. 2015 b). Female D. immigrans are superficially similar in the morphology of the ovipositor, however the relative size of the ovipositor compared with the spermatheca differs substantially between these two species, and in SWD the ovipositor (Figure 121B) is strongly sclerotized with robust teeth very strongly developed along the lower half towards the ovipositor tip (Hauser 2011). PEST STATUS Exotic. High level, highly invasive, pest species of a large number of soft fruits. ATTRACTANT Adults are known to be attracted to traps baited with a combination of wine, vinegar and soap (Landolt et al. 2012). 271 FIGURES Figure 121. Drosophila suzukii A. Female (left), Male (right). B. Female ovipositor. C. Male basal tarsal segments. Images courtesy of Deprá et al. 2014 272 9 Diagnostic resources Key contacts and facilities Contact Facility Area of expertise Prof. RAI (Dick) Drew International Centre for Management of Pest Fruit Flies Over four decades of research experience in taxonomy, ecology and pest management of tropical fruit flies in the Subfamily Dacinae [email protected] Griffith University 170 Kessels Road, Nathan, Qld 4111, Australia Phone: (07) 3735 3696 Fax: (07) 3735 3697 Dr. David Yeates CSIRO Entomology Curator of Diptera GPO Box 1700, Canberra, ACT 2601 [email protected] Phone: (02) 6246 4001 Fax: (02) 6246 4177 Mr. Peter S. Gillespie Orange Agricultural Institute Insect Collection Manager NSW DPI [email protected] 1447 Forest Road, Orange, NSW 2800 Phone: (02) 6391 3986 Fax: (02) 6391 3899 Mr. Bernie Dominiak Orange Agricultural Institute [email protected] NSW DPI 1447 Forest Road, Orange, NSW 2800 Surveillance, sterile insect technique, mass rearing, market access Phone: (02) 6391 3986 Fax: Leigh Pilkington (02) 6391 3899 NSW DPI Locked Bag 26 Gosford NSW 2250 Phone: (02) 4348 1953 Prof. Phillip Taylor Macquarie University Director, Biosecurity Futures Research Centre Department of Biological Sciences [email protected] Phone: (02) 9850 1311 Sydney, NSW 2109 Fax: Dr. Anthony (Tony) R Clarke Senior Lecturer in Ecology [email protected] (02) 9850 4299 Fruit fly biology and environmentally benign management, sterile insect technique, lures, monitoring, male annihilation technique Queensland University of Technology Science and Engineering Faculty GPO Box 2434, Brisbane, Qld 4001, Australia Phone: (07) 3138 5023 Fax: (07) 3138 1535 273 Contact Facility Area of expertise Dr Mark Schutze Queensland University of Technology Fruit fly integrative taxonomy and systematics [email protected] Science and Engineering Faculty GPO Box 2434, Brisbane, Qld 4001, Australia Phone: (07) 3138 5023 Fax: Ms. Jane Royer Entomologist [email protected] (07) 3138 1535 Queensland Department of Agriculture & Fisheries Ecosciences Precinct, 41 Boggo Rd, Dutton Park, Brisbane. QLD 4102 Phone: (07) 3255 4385 Mr. James Walker Department of Agriculture [email protected] Box 96 Airport Administration Centre Cairns International Airport Cairns, QLD 4870 Morphological identification of most of the 109 species of Australian Bactrocera and Dacus, pest species of southeast Asia and the Pacific and common species trapped in PNG Phone: (07) 4241 7845 Ms. Sally Cowan Department of Agriculture [email protected] Box 96 Airport Administration Centre Cairns International Airport Cairns, QLD 4870 Phone: (07) 4241 7857 Fax: (07) 4241 7845 Mr. Glenn Bellis AQIS Darwin Entomologist 1 Pederson Road, Marrara, NT 0812 [email protected] Phone: (08) 8920 7000 Fax: Ms. Linda Semeraro Entomologist [email protected] (08) 8920 7011 Department of Economic Development, Jobs, Transport and Resources, Victoria - AgriBio 5 Ring Road, Bundoora, Vic. 3083 Morphological identification Tephritid molecular diagnostics Laboratory: AgriBio, Bundoora. Reference Collection: Victorian Agricultural Insect Collection, Bundoora. Phone: (03) 9032 7000 Fax: (03) 9032 7604 274 Contact Facility Area of expertise Dr. Mali Malipatil Department of Economic Development, Jobs, Transport and Resources, Victoria - AgriBio Morphological identification Principal Research Scientist [email protected] 5 Ring Road, Bundoora, Vic. 3083 Laboratory: AgriBio, Bundoora. Reference Collection: Victorian Agricultural Insect Collection, Bundoora. Phone: (03) 9032 7000 Fax: Dr Mark Blacket Entomologist [email protected] (03) 9032 7604 Department of Economic Development, Jobs, Transport and Resources, Victoria - AgriBio 5 Ring Road, Bundoora, Vic. 3083 Morphological identification Tephritid molecular diagnostics Laboratory: AgriBio, Bundoora. Reference Collection: Victorian Agricultural Insect Collection, Bundoora. Phone: (03) 9032 7000 Fax: Dr. Darryl Hardie Entomologist [email protected] (03) 9032 7604 Department of Agriculture and Food Western Australia Surveillance and fruit fly pest management Entomology Branch Locked Bag 4, Bentley Delivery Centre, WA 6983 Phone: (08) 9368 3721 Fax: Mr. Andras Szito Entomologist [email protected] (08) 9474 2405 Department of Agriculture and Food Western Australia Entomology Branch Morphological identification of Tephritidae Locked Bag 4, Bentley Delivery Centre, WA 6983 Phone: (08) 9368 3721 Fax: Mr Bill Woods [email protected] (08) 9474 2405 Department of Agriculture and Food Western Australia Fruit fly biology and management Entomology Branch Locked Bag 4, Bentley Delivery Centre, WA 6983 Phone: (08) 9368 3721 Fax: (08) 9474 2405 Mr. Mark Adams South Australian Museum [email protected] Science Centre Morgan Thomas Lane, Adelaide, SA 5000 Phone: (08) 8207 7305 Fax: (08) 8207 7222 Molecular systematics of taxonomically-problematic groups among the Australian fauna, including 25 years’ experience in the rapid genetic identification of fruit fly larvae 275 Contact Facility Area of expertise Dr. Karen Armstrong Lincoln University [email protected] Bio-Protection Research Centre Tephritid molecular diagnostics PO Box 85084, Lincoln University, Canterbury 7647, New Zealand Phone: (03) 423 0918 Fax: (03) 325 3864 Dr. Brian Thistleton Department of Resources Principal Entomologist, Plant Industries GPO Box 3000, Darwin NT 0801 [email protected] Phone: (08) 8999 2257 Fax: (08) 8999 2312 For international fruit fly authorities, see www.sel.barc.usda.gov/Diptera/tephriti/TephWork.htm 276 Reference collections Collection Location Victorian Agricultural Insect Collection, DEDJTR Vic. AgriBio Building, DEDJTR Bundoora Campus, 5 Ring Road, Bundoora, Victoria 3083. Queensland Primary Industries Insect Collection, DAF. Biosecurity Queensland, DAF Ecosciences Precinct, 41 Boggo Rd, Dutton Park Brisbane QLD 4102, Australia. NAQS Insect Collection. Airport Business Park, Cairns Airport Building 114, Catalina Cresent, Cairns QLD 4870, Australia. The Northern Territory Economic Insect Reference Collection. Department of Resources, Primary Industry, Berrimah Farm, Makagon Road, Berrimah NT 0828, Australia. Museum and Art Gallery of the Northern Territory, NRETAS. Conacher Street, Fannie Bay, Darwin NT 0820, Australia. 277 Printed and electronic resources 9.3.1 Morphological keys In practice in Australia the four paper keys that are most commonly used are: Drew, R.A.I. (1989) The tropical fruit flies (Diptera: Tephritidae: Dacinae) of the Australian and Oceanian regions. Memoirs of the Queensland Museum. 26: 1-521. Drew, R.A.I. and Hancock, D.L. (1994) The Bactrocera dorsalis complex of fruit flies (Diptera: Tephritidae: Dacinae) in Asia. Bulletin of Entomological Research. Supplementary Series 2: 168. Drew, R. A., and Romig, M. C. (2013). Tropical Fruit Flies (Tephritidae Dacinae) of South-East Asia: Indomalaya to North-West Australasia. CABI, Wallingford. White, I.M. and Elson-Harris, M.M. (1992) Fruit Flies of Economic Significance: Their Identification and Bionomics. CAB International. Oxon, UK. 601 p. Other paper-based keys include: Drew, R.A.I. and Raghu, S. (2002) The fruit fly fauna (Diptera: Tephritidae: Dacinae) of the rainforest habitat of the Western Ghats, India. Raffles Bulletin of Zoology. 50, 327-352. Drew, R. A., and Romig, M. C. (2013). Tropical Fruit Flies (Tephritidae Dacinae) of South-East Asia: Indomalaya to North-West Australasia. CABI, Wallingford. Drew, R.A.I., Hancock, D.L. and White, I.M. (1998) Revision of the tropical fruit flies (Diptera: Tephritidae: Dacinae) of South-east Asia. II. Dacus Fabricius. Invertebrate Taxonomy, 12, 567-654. Drew, R.A.I. and Romig, M.C. (2001) The fruit fly fauna (Diptera: Tephritidae: Dacinae) of Bougainville, the Solomon Islands and Vanuatu. Australian Journal of Entomology, 40, 113150. Drew, R.A.I., Hooper, G.H.S. and Bateman, M.A. (1982) Economic fruit flies of the South Pacific region. Queensland Department of Primary Industries, Brisbane, Queensland. 139 pp. White, I.M. and Elson-Harris, M.M. (1992) Fruit Flies of Economic Significance: Their Identification and Bionomics. CAB International. Oxon, UK. 601 p. Rohani, I. (1987) Identification of larvae of common fruit fly pest species in West Malaysia. Journal of Plant Protection in the Tropics, 4 (2), 135-137. Hardy, E.D. (1986) Fruit flies of the subtribe Acanthonevrina of Indonesia, New Guinea, and the Bismarck and Solomon Islands (Diptera: Tephritidae: Trypetinae: Acanthonevrina). Pacific Insect Monographs, No. 42. Honolulu, Hawaii. 191 p. Hardy, E.D. (1974) The fruit flies of the Philippines (Diptera - Tephritidae). Pacific Insect Monographs, No. 32. Honolulu, Hawaii. 266 p. Significant information on the larvae of many Australian fruit flies, including ones not of economic importance but that might turn up during sampling, was given in the PhD thesis of Dr Marlene Elson-Harris lodged at the University of Queensland. Electronic keys available include: White, I.M. and Hancock, D.L. (2003) Fauna Malesiana [electronic key to fruit flies]. ISBN 9075000359. White, I.M. and Hancock, D.L. (1997) Indo-Australasian Dacini Fruit Flies (CABIKEY) International Institute of Entomology, London. CD-ROM. 278 An interactive key is also available on the Fruit Flies of the World website: http://deltaintkey.com/ffa Key to Fruit Flies of New South Wales: http://www1.dpi.nsw.gov.au/keys/fruitfly/index.html 9.3.2 Electronic resources Tephritid Barcoding Initiative (TBI): www.barcodeoflife.org. The TBI aims to barcode 10,000 specimens representing 2,000 species of fruit flies, including all taxa (about 350 species) of major and minor economic importance. The Diptera Site: www.sel.barc.usda.gov/Diptera/tephriti/tephriti.htm. Contains a large amount of biological and other information about fruit flies. Pest Fruit Flies of the World: http://delta-intkey.com/ffa. Contains comprehensive information and keys on fruit flies of all regions. ANIC Anatomical atlas of flies: http://www.ento.csiro.au/biology/fly/fly.php. Great for illustrations of every feature of acalyptrate flies. On the fly: interactive atlas and key to Australian fly families: www.csiro.au/resources/ps236.html. Australian Pest and Diseases Image Library (PaDIL): www.padil.gov.au. Contains species information as well as photos for a number of fruit fly species (endemic and exotic). NSW government fruit fly resource: www.agric.nsw.gov.au/Hort/ascu/fruitfly/fflyinde.htm. List of fruit fly species found in New South Wales or believed to be present there, with links to summary information on each and key. International Centre for Management of Pest Fruit Flies (Griffith University and Malaysia): http://www.icmpff.org South Pacific fruit fly website (Pacifly): http://www.pacifly.org. Contains profiles of all species found in the South Pacific. Featured Creatures: http://entomology.ifas.ufl.edu/creatures/index.htm. Contains profiles for a limited number of fruit fly species. The Australian Plant Pest Database (APPD): http://pha.vpac.org. A national, online database of pests and diseases of Australia's economically important plants. Atlas of Living Australia: http://www.ala.org.au/ 279 Supplier details Supplier Address Contact details Life Technologies 5 Caribbean Drive Ph: 1 300 735 292 (for PCR) Scoresby, VIC 3179 Fax: 1 800 067 639 http://www.thermofisher.com Astral Scientific PO Box 232 Ph: 1800 221 280 Gymea, NSW 2227 Fax: (02) 9540 2051 http://astralscientific.com.au/ Bio-Rad Laboratories Pty. Ltd. Level 5, 446 Victoria Road Gladesville, NSW 2111 GENESEARCH 14 Technology Drive (agents for New England Biolabs) Arundel, QLD 4214 Interpath services 1/46 Sheehan Rd Heidelberg West, VIC 3081 Ph: (02) 9914 2800 or 1800 224 354 Fax: (02) 9914 2888 Ph: 1800 074 278 or (07) 5594 0299 www.genesearch.com.au Ph: (03) 9457 6277 or 1800 626 369 Fax: (03) 9458 4010 http://www.interpath.com.au/ Invitrogen PO Box 4296 Ph: 1800 331 627 (for primer synthesis) Mulgrave, VIC 3170 Fax: (03) 9562 7773 Mirella Research Pty. Ltd. PO Box 365 Ph: (03) 9388 1088 or 1800 640 444 Brunswick, VIC 3056 Promega Corporation PO Box 7417 (for Molecular weight marker) Alexandria, NSW 2015 Fax: (03) 9388 0456 Ph: (02) 8338 3800 or 1800 225 123 Fax: (02) 8338 3855 or 1800 626 017 www.promega.com Qiagen Pty Ltd PO Box 25 Ph: (03) 9489 3666 (for DNA extraction) Clifton Hill, VIC 3068 Fax: (03) 9489 3888 www.qiagen.com Roche Diagnostics Australia Pty. Ltd. 31 Victoria Avenue Ph: (02) 9899 7999 Castle Hill, NSW 2154 Fax: (02) 9634 2949 Sigma-Aldrich Pty. Ltd. PO Box 970 (for chemicals) Castle Hill, NSW 1765 Ph: 1800 800 097 or (02) 9841 0555 Fax: 1800 800 096 or (02) 9841 0500 www.sigmaaldrich.com 280 10 References Allwood, A.J., Chinajariyawong, A., Drew, R.A.I., Hamacek, E.L. and Hancock, D.L. (1999). Host plant records for fruit flies (Diptera: Tephritidae) in South East Asia. Raffles Bulletin of Zoology Supplement No. 7: 1-92. Anon. (1996). Code of Practice for the management of Queensland Fruit Fly. Standing Committee on Agriculture and Resource Management, Department of Primary Industries, Canberra. Armstrong K.F. and Cameron, C.M. (1998). Molecular Kit for Species Identification Fruit Flies (Tephritidae), Lincoln University. Armstrong K.F., and Ball S.L. (2005). DNA barcodes for biosecurity: invasive species identification. Philosophical Transactions of the Royal Society of London B: Biological Sciences. 360: 1813–1823. Armstrong, K. F., Cameron, C. M., & Frampton, E. R. (1997). Fruit fly (Diptera: Tephritidae) species identification: a rapid molecular diagnostic technique for quarantine application. Bulletin of Entomological Research, 87(02): 111-118. doi: doi:10.1017/S0007485300027243 Atallah J, Teixeira L, Salazar R, Zaragoza G, & Kopp A. (2014). The making of a pest: the evolution of a fruit-penetrating ovipositor in Drosophila suzukii and related species. Proceedings of the Royal Society B: Biological Sciences 281, 20132840. Barr N., Ruiz-Arce R., and Armstrong K. (2014). Using Molecules to Identify the Source of Fruit Fly Invasions. pp 321-378 In: Trapping and the Detection, Control, and Regulation of Tephritid Fruit Flies, Springer, Netherlands. Bergsten J., Bilton D.T., Fujisawa T., Elliott M., Monaghan M.T., Balke M., Hendrich L., Geijer J., Herrmann J., Foster G.N., Ribera I., Nilsson A.N., Barraclough T.G. and Vogler A.P. (2012). The Effect of Geographical Scale of Sampling on DNA Barcoding. Systematic Biology 61: 851–869 Blacket M.J. (2011). Identification of Queensland Fruit Flies using molecular markers: Mitochondrial DNA sequence variation in Southern QFF. Department of Primary Industries Victoria Report (June 2011). Blacket M.J., Rice A.D., Semeraro L., and Malipatil M.B. (2015 a). DNA-based identifications reveal multiple introductions of the vegetable leafminer Liriomyza sativae (Diptera: Agromyzidae) into the Torres Strait Islands and Papua New Guinea. Bulletin of Entomological Research. 105(05): 533-544. Blacket M.J., Semeraro L, & Malipatil MB. (2015 b). Draft diagnostic protocol for Spotted Wing Drosophila (Drosophila suzukii). Submitted to the Australian Grape and Wine Authority (AGWA) and the Subcommittee on Plant Health Diagnostics (SPHD). Blacket M.J., Semeraro L., and Malipatil M.B. (2012). Barcoding Queensland Fruit Flies (Bactrocera tryoni): impediments and improvements. Molecular Ecology Resources, 12: 428–436. Bock IR. (1976). Drosophilidae Australia. I. Drosophila (Insecta:Diptera) Australian Journal of Zoology Supplementary Series 40, 1–105. Boykin L.M., Armstrong K., Kubatko L. and De Barro P. (2012). DNA barcoding invasive insects: database roadblocks. Invertebrate Systematics. 26: 506–514. Burgher-MacLellan, K.L., Gaul, S., MacKenzie, K. and Vincent, C. (2009). The use of real-time PCR to identify blueberry maggot (Diptera: Tephritidae, Rhagoletis mendax) from other Rhagoletis species and in lowbush blueberry fruit (Vaccinium angustifolium). Acta Horticulturae 810, 265-274 DOI: 10.17660/ActaHortic.2009.810.34 http://dx.doi.org/10.17660/ActaHortic.2009.810.34 281 CABI (2007) Crop Protection Compendium, 2007 Edition. CAB International, Wallingford, UK. Online version: http://www.cabi.org/compendia/cpc/ [accessed September 2015]. Calabria G, Maca J, Bachli G, Serra L, & Pascual M. (2012). First records of the potential pest species Drosophila suzukii (Diptera: Drosophilidae) in Europe. Journal of Applied Entomology 136, 139-147. Cameron, E.C., Sved, J.A., and Gilchrist, A.S. (2010). Pest fruit fly (Diptera: Tephritidae) in northwestern Australia: one species or two? Bulletin of Entomological Research. 100(2):197-206. Carroll, L.E., I.M. White, A. Freidberg, A.L. Norrbom, M.J. Dallwitz, and F.C. Thompson. (2002 onwards). Pest fruit flies of the world. Version: 8th December 2006. http://delta-intkey.com [accessed May 2010]. Casana-Giner V, Oliver JE, Jang EB & Carvalho LA. (2003). Synthesesand behavioral evaluations of fluorinated and silylated analogs ofraspberry ketone as attractants for melon fly, Bactrocera cucurbitae (Coquillett). Journal of Entomological Science 38: 111–119. Clarke, A.R., Armstrong, K.F., Carmichael, A.E., Milne, J.R., Raghu, S., Roderick, G.K. and Yeates, D.K. (2005). Invasive phytophagous pests arising through a recent tropical evolutionary radiation: The Bactrocera dorsalis complex of fruit flies. Annual Review of Entomology 50: 293-319. Clarke, A. R., Powell, K. S., Weldon, C. W., & Taylor, P. W. (2011). The ecology of Bactrocera tryoni (Diptera: Tephritidae): what do we know to assist pest management? Annals of Applied Biology 158(1): 26-54. Cowley, J.M. (1990). A new system of fruit fly surveillance trapping in New Zealand. New Zealand Entomologist 13: 81-84. Cowley, J.M., Page, F.D., Nimmo, P.R. and Cowley, D.R. (1990). Comparison of the effectiveness of two traps for Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) and implication for quarantine surveillance systems. Journal of the Australian Entomological Society 29: 171-176. Dean M.D. and Ballard J.W. (2001). Factors affecting mitochondrial DNA quality from museum preserved Drosophila simulans. Entomologia Experimentalis et Applicata 98: 279–283 Deprá M, Poppe JL, Schmitz HJ, De Toni DC, & Valente VLS. (2014). The first records of the invasive pest Drosophila suzukii in the South American continent. Journal of Pest Science 87, 379-383. Dhami, M., Gunawardana, D. N., Voice D. & Kumarasinghe L. (2015). A real-time PCR toolbox for accurate identification of invasive fruit fly species. Journal of Applied Entomology. In press Dhami MK & Kumarasinghe L. (2014). A HRM real-time PCR assay for rapid and specific identification of the emerging pest Spotted-Wing Drosophila (Drosophila suzukii). PLoS ONE 9, e98934. Dominiak, B.C., Gilmour, A.R., Kerruish, B., and Whitehead, D. (2003). Detecting low populations of Queensland fruit fly Bactrocera tryoni (Froggatt) with McPhail and Lynefield traps. General and Applied Entomology 32: 49-54. Dominiak, B.C. and Nicol, H.I. (2010). Field performance of McPhail and Lynefield traps for monitoring male and female sterile Bactrocera tryoni (Froggatt) and wild Dacus newmani (Perkins). Pest Management Science 66: 741-744. Dominiak, B. C. and Daniels, D. (2011). Review of the past and present distribution of Mediterranean fruit fly (Ceratitis capitata Wiedemann) and Queensland fruit fly (Bactrocera tryoni Froggatt) in Australia. Australian Journal of Entomology 51: 104-115. Dominiak, B.C., Kerruish, B., Barchia, I., Pradhan, U., Gilchrist, A.S., and Nicol, H.I. (2011). The influence of mixtures of parapheromone lures on trapping of fruit fly in New South Wales, Australia. Plant Protection Quarterly 26(4): 136-140. 282 Dominiak, B.C., Campbell, A.J., Jang, E.B., Ramsey, A. and Fanson, B.G. (2015a). Field evaluation of melolure, a formate analogue of cuelure, and reassessment of fruit fly species trapped in Sydney, New South Wales, Australia. Journal of Economic Entomology 108: 1176-1181. Dominiak, B.C., Fay, H.A.C. and Fanson, B.G. (2015b). Field evaluation of the efficacy of zingerone and other chemical lures on seven species of fruit fly in Sydney, New South Wales, Australia. Plant Protection Quarterly 30: 67-71. Dominiak, B.C. and Senior, L. (in prep.). Review of the biology, distribution and control of Cucumber Fruit Fly, Bactrocera cucumis (French) (Diptera: Dacinae) in Australia. Drew, R.A.I. (1989). The tropical fruit flies (Diptera: Tephritidae: Dacinae) of the Australian and Oceanian regions. Memoirs of the Queensland Museum. 26: 1-521. Drew, R.A.I. (2004). Biogeography and speciation in the Dacini (Diptera: Tephritidae: Dacinae). Bishop Museum Bulletin in Entomology 12: 165-178. Drew, R.A.I. and Hancock, D.L. (1994). The Bactrocera dorsalis complex of fruit flies (Diptera: Tephritidae: Dacinae) in Asia. Bulletin of Entomological Research. Supplementary Series 2: 1-68. Drew, R.A.I., G.H.S. Hooper and M.A. Bateman. (1982). Economic Fruit Flies of the South Pacific Region. Queensland Department of Primary Industries. Drew, R.A.I. and Lambert, D.M. (1986). On the specific status of Dacus aquilonis and Dacus tryoni Diptera Tephritidae. Annals of the Entomological Society of America. 79(6): 870-878. Drew, R.A.I., J. Ma, S. Smith, and J. M. Hughes. (2011). The taxonomy and phylogenetic relationships of species in the Bactrocera musae complex of fruit flies (Diptera: Tephritidae: Dacinae) in Papua New Guinea. Raffles Bull. Zool. 59:145–162. Drew, R. A. and Romig, M. C. (2007). Records of fruit flies and new species of Dacus (Diptera: Tephritidae) in Bhutan. Raffles Bulleting of Zoology 55: 1-21. Drew, R. A., and Romig, M. C. (2013). Tropical Fruit Flies (Tephritidae Dacinae) of South-East Asia: Indomalaya to North-West Australasia. CABI. Fay, H.A.C. (2012). A highly effective and selective male lure for Bactrocera jarvisi (Tryon) (Diptera: Tephritidae). Australian Journal of Entomology 51: 189–197. Flath, R.A., Cunningham, R.T., Liquido, N.J. and McGovern, T.P. (1994). Alpha-Ionol as Attractant for Trapping Bactrocera latifrons (Diptera: Tephritidae). Journal of Economic Entomology 87(6):14701476. Floyd, R., Lima, J., deWaard, J., Humble, L., and Hanner, R. (2010). Common goals: policy implications of DNA barcoding as a protocol for identification of arthropod pests. Biological Invasions. 12: 2947-2954. Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular marine biology and biotechnology 3: 294-299. Foote, R.H., Blanc, F.L. and Norrbom, A.L. (1993). Handbook of the Fruit Flies (Diptera: Tephritidae) of America North of Mexico. Comstock, Ithaca, N.Y. Gilbert MTP, Moore W, Melchior L, Worobey M (2007). DNA Extraction from Dry Museum Beetles without Conferring External Morphological Damage. PLoS ONE 2(3): e272. doi:10.1371/journal.pone.0000272 Gilbert, M.T.P., Moore, W., Melchior, L., and Worobey, M. (2007). DNA extraction from dry museum beetles without conferring external morphological damage. PLoS ONE 2: e272. 283 Gillespie, P. (2003). Observations on fruit flies (Diptera: Tephritidae) in New South Wales. General and Applied Entomology 32: 41-47. Hall B. (2011). How to send samples for diagnosis in Australia: Plant disease and Insect identification. CRC Plant Biosecurity Publication, http://plantbiosecuritydiagnostics.net.au/wordpress/wpcontent/uploads/2012/12/CRC-packaging-brochure.pdf Hancock, D.L., Hamacek, E.L., Lloyd, A.C. and Elson-Harris, M.M. (2000). The distribution and host plants of fruit flies (Diptera: Tephritidae) in Australia. Queensland Department of Primary Industry. Information series Q199067. Brisbane, Queensland. 75pp. Hauser M. (2011). A historic account of the invasion of Drosophila suzukii (Matsumura) (Diptera: Drosophilidae) in the continental United States, with remarks on their identification. Pest Management. Science 67, 1352–1357. [IAEA] International Atomic Energy Agency. (2003). Trapping guidelines for area-wide fruit fly programmes. IAEA/FAO-TG/FFP. IAEA, Vienna, Austria. Jiang F., Jin Q., Liang L., Zhang A.B. and Li Z.H. (2014). Existence of Species Complex Largely Reduced Barcoding Success for Invasive Species of Tephritidae: A Case Study in Bactrocera spp. Molecular Ecology Resources. 14: 1114–1128. Jinbo U., Kato T. and Ito M. (2011). Current progress in DNA barcoding and future implications for entomology. Entomological Science 14: 107–124 Kim SS, Tripodi AD, Johnson DT, & Szalanski AL. (2014). Molecular Diagnostics of Drosophila suzukii (Diptera: Drosophilidae) using PCR-RFLP. Journal of Economic Entomology 107, 1292-1294. Krosch, M. N., Schutze, M. K., Armstrong, K. F., Graham, G. C., Yeates, D. K., & Clarke, A. R. (2012). A molecular phylogeny for the Tribe Dacini (Diptera: Tephritidae): systematic and biogeographic implications. Molecular Phylogenetics and Evolution 64(3): 513-523. doi: 10.1016/j.ympev.2012.05.006 Landolt PJ, Adams T, Davis TS, & Rogg H. (2012). Spotted Wing Drosophila, Drosophila suzukii (Diptera: Drosophilidae), Trapped with Combinations of Wines and Vinegars. Florida Entomologist 95, 326-332. Lawson, A.E., McGuire, D.J., Yeates, D.K., Drew, R.A.I. and Clarke, A.R. (2003). Dorsalis: an interactive identification tool to fruit flies of the Bactrocera dorsalis complex. Griffith University. Brisbane, Australia. [CD-ROM] Leblanc L, Vueti ET, Drew RAI & Allwood AJ. (2012). Host plant records for fruit flies (Diptera: Tephritidae: Dacini) in the Pacific islands. Proceedings of the Hawaiian Society 44: 11-53. Leblanc L, William J & Allwood AJ. (2004). Host Fruit of Mango Fly (Bactrocera frauenfeldi (Schiner)) (Diptera: Tephritidae) in the Federated States of Micronesia. Micronesica 37: 21-31. Leblanc, L; Balagawi, S; Mararuai, A; Putulan, D; Tenakanai, D; Clarke, A R. (2001). Fruit flies in Papua New Guinea. Pest Advisory Leaflet, Secretariat of the Pacific Community. Plant Protection Service; 37. Lou M., and Golding G.B. (2010). Assigning sequences to species in the absence of large interspecific differences. Molecular Phylogenetics and Evolution 56: 187–194 Manchenko, G.P. (1994). Handbook of detection of enzymes on electrophoretic gels. CRC Press, Boca Raton, Florida. Mantel BL & Upton MS. (2010). Methods for Collecting, Preserving and Studying Insects and Other Terrestrial Arthropods, 5th edition. The Australian Entomological Society Miscellaneous Publication no. 3. pp. 81. 284 McKenzie, C., Gillispie, P. and Hailstones, D. (2004). Draft molecular diagnostic standard for fruit flies of economic significance to Australia. Plant Health Australia and NSW Department of Primary Industries. McKenzie, L., Dransfield, L., Driver, F. and Curran, J. (1999). Molecular protocols for species identification of tephritid fruit flies. Report to AQIS. CSIRO, Canberra. McQuate GT & Peck SL. (2001). Enhancement of attraction of alpha ionol to male Bactrocera latifrons (Diptera: Tephritidae) by addition of a synergist cade oil. Journal of Economic Entomology 94: 39–46. McQuate GT, Jang EB & Siderhurst M. (2013). Detection/Monitoring of Bactrocera latifrons (Diptera: Tephritidae): Assessing the potential of prospective new lures. Proceedings of the Hawaiian Entomological Society 45: 69-81 Metcalf, R.L., Mitchell, W.C., and Metcalf, E.R. (1983). Olfactory receptors in the melon fly Dacus cucurbitae and the oriental fruit fly Dacus dorsalis. Proceedings of the National Academy of Sciences of the United States of America 80: 3143-3147. Moreau C.S., Wray B.D., Czekanski-Moir J.E. and Rubin B.E.R. (2013). DNA preservation: a test of commonly used preservatives for insects. Invertebrate Systematics 27: 81–86 http://dx.doi.org/10.1071/IS12067 Murphy KA, Unruh TR, Zhou LM, Zalom FG, Shearer PW, Beers EH, Walton VM, Miller B, & Chiu JC. (2015). Using comparative genomics to develop a molecular diagnostic for the identification of an emerging pest Drosophila suzukii. Bulletin of Entomological Research 105, 364-372. Norrbom, A.L. (2003). The Diptera site. Systematic Entomology Laboratory, ARS, USDA and Department of Entomology, NMNH, SI. www.sel.barc.usda.gov/diptera/tephriti/tephriti.htm [accessed May 2010]. O’Loughlin, G.T., East, R.W., Kenna, G.B. and Harding, E. (1983). Comparison of the effectiveness of traps for the Queensland fruit fly, Dacus tryoni (Froggatt) (Diptera: Tephritidae). General and Applied Entomology 15: 3-6. Osborne, R., Meats, A., Frommer, M., Sved, J.A., Drew, R.A.I., and Robson, M.K. (1997). Australian Distribution of 17 Species of Fruit Flies (Diptera: Tephritidae) Caught in Cue Lure Traps in February 1994. Australian Journal of Entomology 36: 45-50. PaDIL (2007). Pest and disease image library. An Australian Government initiative. www.PaDIL.gov.au [accessed May 2010]. PHA. (2013). Fact Sheet: Spotted-winged drosophila. http://www.planthealthaustralia.com.au/pests/spotted-winged-drosophila/ Queensland Department of Primary Industries and Fisheries (2002). OP-03: Fruit fly identification guidelines. Operational Procedures. August, 2002. Ratnasingham S., and Hebert P.D.N. (2013) DNA-Based Registry for All Animal Species: The Barcode Index Number (BIN) System. PLoS ONE 8(8): e66213. doi:10.1371/journal.pone.0066213 Richardson, B. J., Baverstock, P. R., and Adams, M. (1986). Allozyme electrophoresis. A handbook for animal systematics and population studies. Academic Press, Sydney, Australia. Royer JE & Hancock DL. (2012). New distribution and lure records of Dacinae (Diptera: Tephritidae) from Queensland, Australia, and a description of a new species of Dacus Fabricius. Australian Journal of Entomology 51: 239–247. Royer JE, DeFaveri S & Lowe G. (2014). Cucumber volatile blend, a promising female-biased lure for Bactrocera cucumis (French 1907) (Diptera: Tephritidae: Dacinae), a pest fruit fly that does not respond to male attractants. Australian Journal of Entomology 53: 347–352 285 Royer JE, Wright CW & Hancock DL. (2015). Bactrocera frauenfeldi (Schiner) (Diptera: Tephritidae), an invasive fruit fly in Australia that may have reached the extent of its spread due to environmental variables. Australian Journal of Entomology accepted, in press. Royer JE. (2015). Responses of fruit flies (Tephritidae: Dacinae) to novel male attractants in north Queensland, Australia, and improved lures for some pest species. Australian Journal of Entomology. early view available at: http://onlinelibrary.wiley.com/doi/10.1111/aen.12141/pdf Schutze M.K., Aketarawong N., Amornsak W., Armstrong K.F., Augustinos A.A., Barr N., Bo W., Bourtzis K., Boykin L.M., Cáceres C., Cameron S.L., Chapman T.A., Chinvinijkul S., Chomič A., De Meyer M., Drosopoulou E., Englezou A., Ekesi S., Gariou-Papalexiou A.,Geib S.M., Hailstones D., Hasanuzzaman M., Haymer D., Hee A.K.W., Hendrichs J., Jessup A., Ji Q., Khamis F.M., Krosch M.N., Leblanc L., Mahmood K., Malacrida A.R., Mavragani-Tsipidou P., Mwatawala M., Nishida R., Ono H., Reyes J., Rubinoff D., San Jose M., Shelly T.E., Srikachar S., Tan K.H., Thanaphum S., Haq I., Vijaysegaran S., Wee S.L., Yesmin F., Zacharopoulou A., & Clarke A.R. (2015) Synonymization of key pest species within the Bactrocera dorsalis species complex (Diptera: Tephritidae): taxonomic changes based on 20 years of integrative morphological, genetic, behavioural, and physiological data. Systematic Entomology 40(2): 456-471. Secretariat of the Pacific Community (2006). Pacific Fruit Fly Web. www.spc.int/pacifly [accessed May 2010] Seljak G. (2013). PM 7/115 (1) Drosophila suzukii. Bulletin OEPP/EPPO Bulletin 43, 417–424 Semeraro, L. and Malipatil, M.B., (2005). Molecular diagnostic test for Queensland fruit fly larvae (Bactrocera tryoni Froggatt). Smit J., Reijnen B., and Stokvis F. (2013). Half of the European fruit fly species barcoded (Diptera, Tephritidae); a feasibility test for molecular identification. ZooKeys 365: 279–305. Smith, E.S.C. and Chin D. (1987). Current fruit fly research in the Northern Territory. Proceedings of the 4th Workshop in Tropical Entomology. Darwin, NT 10-15 May 1987, pp. 128-135. Smith, E.S.C., Chin, D., Allwood, A.J., and Collins, S.G. (1988). A revised host list of fruit flies (Diptera: Tephritidae) from the Northern Territory of Australia. Queensland Journal of Agricultural and Animal Sciences 45(1): 19-28. Tan KH & Nishida R. (2000). Mutual reproductive benefits between a wild orchid, Bulbophyllum patens, and Bactrocera fruit flies via a floral synomone. Journal of Chemical Ecology 26: 533–546. Tsuruta, K., White, I.M., Bandara, H.M.J., Rajapakse, H., Sundaraperuma, S.A.H., Kahawatta, S.B.M.U.C., and Rajapakse, G.B.J.P. (1997). A preliminary notes on the host plants of fruit flies of the tribe Dacini (Diptera: Tephritidae) in Sri Lanka. Esakia 37: 149-160. University of Florida and the Florida Department of Agriculture and Consumer Services (2009). Featured Creatures. http://entomology.ifas.ufl.edu/creatures/index.htm [accessed May 2010]. Van Velzen R, Weitschek E, Felici G, Bakker FT (2012). DNA Barcoding of Recently Diverged Species: Relative Performance of Matching Methods. PLoS ONE 7(1): e30490. doi:10.1371/journal.pone.0030490 Vargas, R.I., Pinero, J.C. and Leblanc, L. 2015. An overview of Pest Species of Bactrocera Fruit Flies (Diptera: Tephritidae) and the Integration of Biopesticides with other biological approaches for their management with a focus on the Pacific Region. Insects 6: 297-318. Vink C.J., Thomas S.M., Paquin P., Hayashi C.Y., and Hedin M. (2005). The effected of preservatives and temperature on arachnid DNA. Invertebrate Systematics 19: 99-104. Virgilio M., Jordaens K., Breman F.C., Backeljau T., De Meyer M. (2012). Identifying Insects with Incomplete DNA Barcode Libraries, African Fruit Flies (Diptera: Tephritidae) as a Test Case. PLoS ONE 7: e31581. 286 Virgilio, M., Jordaens, K., Verwimp, C., White, I. M., & De Meyer, M. (2015). Higher phylogeny of frugivorous flies (Diptera, Tephritidae, Dacini): Localised partition conflicts and a novel generic classification. Molecular phylogenetics and evolution 85: 171-179. Walsh DB, Bolda, MP, Goodhue, RE, Dreves, AJ, Lee, J et al. (2011). Drosophila suzukii (Diptera: Drosophilidae): Invasive Pest of Ripening Soft Fruit Expanding its Geographic Range and Damage Potential. Journal of Integrated Pest Management 2, 1-7. Wang X-C., Liu C., Huang L., Bengtsson-Palme J., Chen H., Zhang J-H., Cai D. and Li J-Q. (2015). ITS1: a DNA barcode better than ITS2 in eukaryotes? Molecular Ecology Resources 15: 573–586 Wang, Y., Yu, H., Raphael, K., & Gilchrist, A. S. (2003). Genetic delineation of sibling species of the pest fruit fly Bactocera (Diptera: Tephritidae) using microsatellites. Bulletin of Entomological Research 93(04): 351-360. doi: doi:10.1079/BER2003249 Waterhouse, D. F. (1993). The Major Arthropod Pests and Weeds of Agriculture in Southeast Asia. Canberra, Aust.: ACIAR. Monograph 21: 141. White, I.M. and Elson-Harris, M.M. (1992). Fruit Flies of Economic Significance: Their Identification and Bionomics. CAB International. Oxon, UK. 601 p. Yu, D., Chen, Z., Zhang, R., & Yin, W. (2005). Real-time qualitative PCR for the inspection and identification of Bactrocera philippinensis and Bactrocera occipitalis (Diptera: Tephritidae) using SYBR Green assay. The Raffles Bulletin of Zoology 53(1): 73-78. Yu, D., Zhang, G., Chen, Z., Zhang, R., & Yin, W. (2004). Rapid identification of Bactrocera latifrons (Dipt., Tephritidae) by real‐time PCR using SYBR Green chemistry. Journal of Applied Entomology 128(9‐10): 670-676. 287 11 Appendices 288 APPENDIX 1 Rearing fruit fly larvae to adults for the purpose of identification – basic method Pupae need to develop in a dry medium such as sand or sawdust. Once flies start to emerge they need to be provided with access to water and sugar for survival and for colour development. After about four days they may be collected, killed and prepared for study (Lawson et al. 2003). You will need: a clear plastic tub with a well fitted lid with a large hole cut in it mesh to put between the tub and the lid river sand or untreated sawdust as a pupation media sugar cubes, water, chux type sponge, inactive torula yeast (protein source) - to feed the flies Process: Put about 1cm of sand or sawdust in the bottom of the tub. Put infested fruit on the sawdust. If the fruit is large, wet and sloppy you may want to put the fruit on another smaller container with a mesh lid, inside the other container, so it drains into that rather than the media. Leave the tub somewhere that is roughly the same temperature as outside, away from ants and direct sunlight. If it is cooler and you have access to a controlled temperature room, you may want to keep the fruit at warmer temperatures e.g. 27OC and 70% RH. Allow about 5+ days for the larvae to pupate. In cooler conditions or with harder fruit such as apples this may take up to 30 days. After 5 days check for pupae that have emerged as adults. Don’t open the lid as any adults may escape. Check for adults every day after this. Once you see adults they will need the food and water. Put a sugar cube on top of the mesh; put a 3cm slice of the chux in a small container of water and have one end resting on the gauze so the flies can drink from the wicking chux; mix the yeast with enough water to make a paste put a dob of this on top of the gauze. Wait 5-7 days after flies have emerged to kill them. They need this amount of time to fully develop and colour up so they are identifiable. You can kill the flies by putting the whole rearing tub in a large freezer. Note: if you have fruit that may be a quarantine intercept, rearing should only be undertaken in an appropriately accredited quarantine containment laboratory. You may have an exotic and don’t want to breed it and have them escape! Suppliers: Fermex Inactive Yeast from Lesaffre. See website for contacts in your state http://www.fermex.com.au/products/?id=7 (~$70/15kg) http://www.fermex.com.au/contact_us/ Inactive torula yeast in smaller quantities can also be purchased from health food stores. APPENDIX 2 Composition and preparation of reagents 5X TBE buffer Combine: 450 mM Tris base 450 mM Boric acid 10 mM EDTA (pH 8.0) Store at room temperature Dilute to 1X TBE with millipore water prior to use. 1% Agarose gel 1. 1 g of DNA grade agarose per 100 mL of 1X TBE. 2. Melt in a microwave. 3. Pour into a prepared gel tray when agarose has cooled sufficiently. 4. Allow the gel to set at room temperature for at least 30 min before use. 6 x Loading dye Combine: 1X TBE buffer 0.25% (w/v) Bromophenol Blue 0.25% (w/v) Xylene cyanol FF 30 % (v/v) Glycerol Store at room temperature. 10X PBS Combine: 1.37 M NaCl 27 mM KCl 43 mM Na2HPO4.7H2O 14 mM KH2PO4 Autoclave and store stock at room temperature. Dilute to 1X PBS with sterile water for use. Store at room temperature in sterile bottle. Preparing PCR primers, 10 μM 1. Add nuclease free water to the freeze-dried primer stock: to calculate quantity of water to add, find the nmol reading for each primer and move decimal place forward (to right) of the nmol reading eg. 51.7 nmol = 517 μL of nuclease free water to be added to primer stock. 2. Prepare a 1 in 10 dilution of primer for final stock of 1 μM, e.g. if preparing 500 μL, then add 450 μL of nuclease free water and 50 μL of primer from 10 μM stock. Preparing dNTP’s These can be purchased premixed, or be contained within a PCR kit. A cheaper alternative is to prepare by combining individual nucleotide stocks, each with initial concentration of 100 mM. To prepare a 400 μl dNTP stock, final concentration of 2.5 mM: Prepare Eppendorf tubes (1.5 ml) for final stock Add 360 μl nuclease free water to each Eppendorf tube Add 10 μl of each dNTP to each final stock eg. 10 μl of A, 10 μl of C, 10 μl of G, 10 μl of T, to each tube. Mix well This should make a 1 in 10 dilution = 2.5 mM. Preparing molecular weight marker (100 bp ladder) For 250 μg mL-1 concentration of marker: 400 μL marker 200 μL loading dye 600 μL double-distilled H2O Proportion is 2:1:3 respectively Preparing an agarose gel - basic equipment and materials agarose powder electrolytic buffer (TAE or TBE) SYBR® Safe DNA gel stain (or ethidium bromide if alternative is not available) loading dye (X6) large glass flask and plastic jar (250 mL) molecular weight marker (100 bp ladder) microwave plate and combs pipette tips - non-aerosol pipettes Preparation of gel: 1. Gel size may be 50 mL, 100 mL, or 200 mL. 2. Use a 1.5% agarose gel for PCR product resolution and a 2-3 % gel for restriction digest products 3. According to gel size and concentration, add TBE to the appropriate weight of agarose powder 4. Microwave until boiling point and solution is clear; care not to superheat and cause solution erruption 5. Pour agarose into a plastic beaker and add SYBR® Safe to solution once the agarose is heated. Add 1 μL of SYBR® Safe to 10 ml of agarose solution. If using ethidium bromide, add directly to glass beaker and use the same quantity per mL, but make sure to use a 1 in 10 ethidium bromide solution. 6. Pour gel onto plate and allow to cool for 30 min or until gel is opaque. 7. Run electrophoresis machine. Time will vary depending on size and density of gel eg. 250 mL gel can run at 90 V for 3-4 h. A 50 mL gel may run for 30 min to 1 h at 100 V. Viewing Results: 1. For gels with SYBR Safe, place onto the Safe Imager Transilluminator (with amber filter unit) and cover with camera box for viewing image on screen. If using ethidium bromide place gel onto a UV light trans-illuminator and cover with camera box. 2. Save gel image electronically or print. 3. For PCR products, a single bright band at around 500-1000 bp (Test 1) or 1500 bp (Test 2) indicates successful PCR amplification; any samples showing multiple bands should not be used for RFLP, and either the source of contamination (two DNA’s in the sample) or PCR optimisation needs to be considered 4. For restriction digest products, use a 100 bp ladder to determine size of fragments and compare with species fragment size chart in Armstrong & Cameron 1998; results of all enzymes used need to agree for diagnosis. APPENDIX 3 Restriction Enzyme Haplotype Chart (adapted from Armstrong & Cameron 1998) Restriction enzyme pattern types (see photographs in Appendix 4) are represented by different letters. Same letters with different numbers are similar patterns, but distinguishable within a pattern type. A minimum of four enzymes is recommended, to include one or more of those highlighted where possible. = unique pattern, Genus Subgenus Anastrepha Bactrocera Ceratitis Dacus Rhagoletis Afrodacus Austrodacus Bactrocera Daculus Notodacus Zeugodacus Ceratitis Callantra = unique within a pattern type, Species2 Abv.3 Alu I Cfo I A. bistrigata A. fraterculus A. grandis aA. ludens A. obliqua A. serpentina A. sororcula A. striata aA.suspensa A. zenildae B. jarvisi B. cucumis bB. aquilonis B. carambolae B. curvipennis cB. dorsalis dB. facialis eB. frauenfeldi B. kirki4 B. latifrons B. melanotus B. musae bB. neohumeralis cB. papayae18 dB. passiflorae cB. philippinensis18 B. psidii B. quadriestosa eB. trilineola B. trivialis bB. tryoni B. umbrosa B. zonata B. oleae B. xanthodes B. cucurbitae C. capitata C rosa D. solominensis R. completa R. pomonella Ab Af Ag Al Ao As Aso Ast Asp Az Bj Bc Ba Bcm Bcp Bd Bf Bfr Bk Bl Bm Bmu Bn Bpy Bp Bph Bpd Bq Btl Btr Bt Bu Bz Bo Bx Bcb Cc Cr Ds Rc Rp A2/A3 A1 A2 A1 A2 A3 A1 A2 A1 A1 B2 B4 B2 B1 B2 B2 B2 B1 B1 B3 B2 C B2 B2 B2 B2 B2 B2 B1 B2 B2 B3 B1 B4 A2 B5 A4 A5 A1 A3 B3 A2 A1 A2 A1 A2 B A1 A2 A1 A1 C1 D1 C3 C5 C1 C1 C2 C5 C5 C3 C1 C1 C3 C1 C2 C1 C1 C1 C5 C3 C3 C4 C5/C1 C6 C7 D2 D3 D4 E F D1 = unique to group of indistinguishable species. Restriction Enzyme Pattern Types1 Dde I Dra I Hinf I Nco I A1 A1 B A1 A1 C A1 A1 A1 A1 A5 A3 A5 A6 A5 A5 A4 A6 A6 A4 A5 A5 A5 A5 A4 A5 A5 A5 A6 A5 A5 A4 A6/A5 A2 A2 A1 D E A1 A3 A4 A1/A2 A1 A3 A1 A1 A2 A1 A2 A1 A1 E1 B1 E1 D1 E1 D2 D3 E2 E2 E3 E1 D2 E1 D2 D3 D2 E1 E1 E2 E1 E1 F D1/D2 G1 C B2 D1 E4 B3 B4 G2 B A1 B C A2 B A1 B C D E1 F1 E1 E2 E1 E1 E3 E1 E1 E3 E1 E1 E1 E1 E3 E1 E1 E1 E1 E1 E1 E3 E1/E2 E4 E4 F2 E2 H F1 A3 G A1 A1 A1 A1 A1 A2 A1 A1 A1 A1 A2 A1 A2 B1 A2 A2 A2 A2 A2 B2 A2 B3 A2 A2 A2 A2 A2 A2 A2 A2 A2 A2 B1/A2 A1 A1 A1 A3 A4 A1 A2 A2 Rsa I Sau 3A Ssp I B4 A B1 A A B2 A B3 A A C1 F1 C1 D C2 C1 E1 D D E2 C1 C1 C1 C1 E1 C1 C1 C1 D C1 C1 G D/C1 B5 I J K N L F2 M A1/A2 A1 B A1 C1 C2 C3 A2 A1 A1 D1 A3 D1 D3 D1 E1 D2 D3 D3 F D1 E1 D1 E1 D2 E1 D1 D1 D3 D1 D1 D2 D3/E1 A2 A1 A4 E2 G A1 A2 A3 Some species show two patterns correlating with different populations, given as Type 1/Type 2 respectively. Species in bold are listed on the Biosecurity (Notifiable Organisms) Amendment Order (1997); species prefaced with the same superscript letter are as yet indistinguishable using the current list of restriction enzymes. 3 Abbreviated species names assigned for routine use as in Appendix 7. 4 B. kirki can be distinguished from B. frauenfeldi and B. trilineola using an additional restriction enzyme Acc I, see Addendum. 1 2 18 Synonymised with B. dorsalis D2 A1 B1 A1 D1 A2 A1 D2 A1 A1 E F1 G1 D3 G3 D3 D3 H H A2 H D3 G1 D3 D3 D3 I A2 H D3 G1 D3 D3 B3 C F3 G2 J B2 F2 I APPENDIX 4 Diagnostic restriction patterns (adapted from Armstrong & Cameron, 1988) The restriction patterns are summarised in the following photographs (overpage). Aim to use four enzymes to identify unknown specimens. At least one example of each species is presented; see Appendix 3 for species names in full. The tables of fragments provide only approximate sizes (bp) based on the limitations of estimating from electrophoresis gels. However, comparative estimations are still diagnostic. mw, molecular weight marker (100bp ladder, Gibco BRL) where highlighted bands indicate 2000 bp (top), 600 bp (middle) and 100 bp (bottom). B. correcta, not included in the report or elsewhere in that Manual. Alu I (AG/CT) D1 F E D3 D2 C7 C6 C4 C3 C5 C1 C1 C2 C3 C1 C1 C3 C5 C5 C2 C1 C1 C5 A1 D1 C1 A1 A1 A2 A1 B A2 A1 A2 A1 Rp Rc Ds Cc Bcb Bx Bo Bu Bt Btl Bq Bpd Bp Bn Bmu Bm Bl Bk Bfr Bf Bd Bcp Bcm Az Bc Bj mw mw D1 D3 D4 Rp Cc ____Cr____ mw mw C1 C5 C1 D2 C3 C3 C3 C3 C3 C3 Bpy Bcm Bd Bcb Btr Bt Bn Ba Btr Bl Bcr Bcm Bd Bz1 Bz2 mw mw C5C5C1 C5 C1 mw mw Haplotype Az Asp As tAso As Ao Al Ag Af mw A1 A1 A2 A1 B A2 A1 A2 A1 A2 A2 Az Asp Ast AsoAsAo Al Ag AfAb2Ab1 mw mw mw Fragment sizes (bp) A1 1080-1050 240 120 A2 1150-1100 240 120 240 120 B 800-790* 340-330 C1 790-770 C2 770-760 C3 780-770 C4 770 C5 780-760 C6 D4 240-230* 250 330-310 240 700-660* 200 180-170 130 120 110 170 130 120 110 170 130 120 110 170 130 120 110 170 130 120 110 170 130 120 110 170 130 120 110 130 120 110 130 120 110 130 120 110 130 120 110 130 120 110 130 120 110 1200-1180 D2 D3 270 680 C7 D1 290-280 980 1300 1700 E 720-700* F 640 450 170 150 ______________________________________________________________________________________ *Sometimes double band Cfo I (GCG/C) B3 A3 A1 A4 B5 A2 B4 B3 B2 B1 B2 B2 B2 B2 C B2 B3 B1 B1 B2 B2 B2 B1 A1 B4 B2 A1 A1 A2 A1 A3 A2 A1 A2 A1 Bt Btl Bq Bpd Bp Bn BmuBm Bl Bk Bfr Bf Bd Bcp Bcm Az Bc Bj Az Asp Ast AsoAs Ao Al Ag Af Rp Rc Ds Cc Bcb Bx Bo Bu mw B3 A4 mw A5 Rp Cc ___Cr___ mw mw B2 B1 B2 B5 B2 B2 B2 B2 B2 B3 B1 B1 B2 B1 B1 A1 A1 A3 A1 A3A2A1 A2 A1 A3 A2 Bpy Bcm Bd Bcb Btr Bt Bn Ba Btr Bl Bcr Bcm Bd Bz1 Bz2 Az Asp Ast AsoAsAoAl Ag Af Ab2 Ab1 mw mw mw mw mw mw Note: refer to original photograph to check for consistency with subtle variation between B group. Haplotype Fragment size (bp) A1 980-940 A2 A5 B1 B2 530 1000 A3 A4 mw 530 1050-1020 530 1250 530 1600 530 1010-990 980-930* B3 B4 B5 C 900 870-820 530 180-170 530 180 530 180-170 530 170 720-700* 530 900-880* 530 170 240 ___________________________________________________________ * Sometimes double band Dde I (C/TNAG) A4 A3 A1 D A1 A2 A2 A4 A5 A6 A5 A5 A4 A5 A5 A5 A4 Rp Rc Ds Cc BcbBx Bo Bu mw A6 A6 A4 A5 A5 A6 A1 A3 Bt Btl Bq Bpd Bp BnBmuBm Bl mw A4 D E Rp Cc ___Cr___ A5 A1 A1 A1 A1 C A1 A1 B A1 Bk Bfr Bf Bd Bcp Bcm Az Bc mw Bj Az AspAstAso As Ao Al Ag Af mw mw A5 A6 A5 A1 A5 A5 A5 A5 A5 A4 A6 A6 A5 A6 A5 A1 A1 A1 A1 C A1 A1 B A1 A2 A1 Bpy Bcm Bd Bcb Btr Bt Bn Ba Btr Bl Bcr Bcm Bd Bz1 Bz2 Az Asp Ast Aso AsAo Al AgAf Ab2 Ab1 mw mw mw mw Haplotype mw mw mw Fragment size (bp) A1 800-750 270 220 180-160 A2 860-830 270 220 170 A3 900 270 220 160-150 A4 950-930 270 220 160 270 220 170-160 270 220 170-160 270 220 270 220 210 270 220 270 220 A5 1000-980* A6 1030 B 850 C D E 830-800* 1150 1500 120 130 170 ___________________________________________________________________________________ * Sometimes double band Dra I (TTT/AAA) G2 B4 B3 D1B2 C G1 F E1 E2 E1 E1 D3 E1 D2E1E3 E2 E2 D3 D2 E1 D1A1 B1 E1 A1 A1 A2 A1 A2 A1 A1 A3 A1 Rp Rc Ds Cc BcbBx Bo Bu Bt Btl Bq Bpd BpBnBmuBmBl Bk Bfr Bf Bd Bcp Bcm Az Bc Bj Az AspAstAsoAsAo Al Ag Af mw mw G2 D1 E4 Rp Cc ___Cr___ mw mw A1 A1 A2 A1 A2 A1 A1 A3 A1 A1 A2 Bt Bn Ba Btr Bl Bcr Bcm Bd Bz1Bz2 Az Asp Ast Aso As Ao Al Ag Af Ab2 Ab1 mw mw mw mw mw mw Fragment size A1 1150-1080 A2 1150-1100 400 A3 370 1180 320 1250 B2 1100 B3 B4 mw E1 E3 D3 D1 D2 D1 D2 Haplotype B1 mw E1 E1 E1 200 120 200 120 1120 180 1250 C 1150-1100* D1 1200 D2 1220-1200 D3 1200 150 180 130 250-240* 70? 360-350 110-100 320-310 110 290 E1 1030-990* E2 1020 E3 1020 E4 1040 F 1020 G1 1120 G2 1120 110 320-310 180-160 110-100 360-350 180-150* 280 160 410 110 (160)x2 280 160 170 200 _________________________________________________________________________________ *Sometimes double band 110 110 [90,70?] 150 130 140 120 100 Hinf I (G/ANTC) G A3 F1 E2 F2 E4 E4 E3 E1 E1 E1 E1 E3 E1 E1E1E3 E1 E1 E3 E1 E1 E2 D F1 E1 D C B A1 B A2 C B A1 Rp Rc Ds Cc Bcb BxBoBu Bt Btl Bq Bpd Bp BnBmuBmBl Bk Bfr Bf Bd BcpBcmAz BcBj AzAspAst Aso As Ao Al Ag Af mw mw G E2 H Rp Cc ____Cr_____ mw mw mw mw E1 E3E1Φ E2 E1 E2 E1 D C B A1 B A2 C B A1 B B Btr Bt Bn Ba Btr Bl Bcr BcmBd Bz1 Bz2 AzAspAstAsoAsAo Al Ag Af Ab2 Ab1 mw mw mw Haplotype mw mw mw Frgagment size (bp) A1 580-570 A2 610 A3 B mw E1 E1 E1 E1 630 280 260 240 150 110 80 270 240 150 110 80 260 1200-1100 C 590-580 490-480 D 380 70 150 110 80 70? 150 110 80 70 150 110 80 70 270 240 200 150 110 80 70 E1 1010-970* 260 150 110 80 70 E2 1050 260 150 110 80 70 260 150 110 80 70 260 E3 920 E4 880-860 F1 900-850 F2 780 G H 640 780 150 110 80 70 370 150 80 70 370 150 80 70 150 110 80 70 260 410 330 280 190 150 120 ________________________________________________________________________________ * Sometimes double band NcoI (C/CATGG) A2 A2 A1 A3 A1 A1 A1 A2 A2 A2 A2 A2 A2 A2B3A2 B2 A2 A2 A2 A2 A2 B1 A1 A1 A2 A1 A1 A1 A1 A2 A1 A1 A1 A1 Rp Rc Ds Cc Bcb BxBoBu Bt Btl Bq BpdBp BnBmuBm Bl Bk Bfr Bf Bd Bcp Bcm Az Bc Bj Az AspAstAso As Ao Al Ag Af mw A3 mw A4 Cc ____Cr____ mw mw mw mw A2 B1 A2 A1 A2 A2 A2 A2 A2 B2A2Φ B1 A2 B1 A2 Bpy Bcm Bd Bcb Btr Bt Bn Ba Btr Bl Bcr Bcm Bd Bz1 Bz2 Az Asp Ast Aso As Ao Al Ag Af Ab2 Ab1 mw mw mw mw Haplotype m w mw A3 mw Fragment size A1 A2 A1 A1 A1 A1 A2 A1 A1 A1 A1 A1 A1 1600-1500 (uncut) 1700 (uncut) 1800 (uncut) B1 1050 B2 1050 B3 1050 680 __________________________________________________ 590 630 Rsa I (GT/AC) M F2 L K J I B5 G Rp Rc Ds Cc Bcb Bx Bo Bu mw C1 D C1 C1 E1 C1 C1 C1 E2 D D E1 C1 C2 D Bt Btl Bq Bpd Bp Bn Bmu Bm Bl Bk Bfr Bf Bd Bcp Bcm Az Bc Bj mw I K N mw A A B3 A B2 A A B1 A Az Asp Ast Aso As Ao Al Ag Af mw BpyBcm Bd Bcb Btr Bt Bn Ba mw mw mw C1 E2 DΦ D C1 D C1 C1 D C1 J C1 C1 C1 C1 Bx Cc ___Cr____ A F1 C1 Btr Bl Bcr Bcm Bd Bz1 Bz2 Az Asp Ast Aso As Ao Al AgAfAb2Ab1 mw mw Haplotye mw A A B3 A B2 A A B1 A B4 B4 mw mw mw Fragment size A 380-340∆ B1 440 430 B2 480 B3 480-450 B5 430 C1 530-500* C2 490 360 290 380 370 290 (370-360)x2 B4 290 290 410 380 370 290 400 370 290 460-440* 410 290 460 410 290 410 290 D 520-500 E1 500 420 410 290 E2 500 (410)x2 290 F1 570 F2 570 G I 490 410 380 510-500* 300 290 300 290 410 750 290 260 150 370 360 J 310 290 K 450 410 400 380 290 260 240 110 L 450 380 320 M 580 380 330 ___________________________________________________________________________________ ∆ Several patterns, combinations of 3 bands; * sometimes double band 290 230 Sau 3A (/GATC) A3 A2 A1 E2 A4 A1 A2 D2 D1 D1 D3 D1 E1 D1 D2 D1 E1 D1 F D3 D3 D2 E1 D1 D3 D1 A3 D1 A1 A1 A2 C3 C2 C1 A1 B A1 Rp Rc Ds Cc Bcb Bx Bo Bu Btr Bt Btl Bq Bpy Bpd Bp Bn Bmu Bm Bl Bk Bfr Bf Bd Bcp Bcm Ba Bc Bj Az Asp Ast Aso As Ao Al Ag Af mw mw A3 E2 G Rp Cc ____Cr____ mw mw E1 D3 E1 A4 D1 D1 D1 D1 D1 F Bpy Bcm Bd Bcb Btr Bt Bn Ba Btr Bl Bcr Bcm Bd Bz1 Bz2 mw mw D3 D3 E1 D3 E1 mw mw A1 A1 A2 C3 C2 C1 A1 B A1 A2 A1 Az Asp Ast Aso As Ao Al Ag Af Ab2 Ab1 mw mw Haplotype mw Fragment size A1 770 A2 770 A3 770 700 A4 770 530 110 B 770 530 110 80 C1 770 C2 770 C3 770 D1 770 D2 770 D3 770 E1 E2 800 880 620-580* 110 670-660* 110 110 450 520/500/480/400** 440 200-170 110 200-190 110 140-130 410-400 390-360* 380 360 450-440* 380-370 110 110 110 110 770 110 770 110 F 760 730 110 ____________________________________________________________________________________________ Diagnostic 80 bp and 100 bp bands not visible here, see photograph above; * sometimes double band. ** any combination of two bands Ssp I (AAT/ATT) D3 A2 I D3 H A2 H H H D3 D3 D3 D3 D3 G1 G1 G1 E F3 C B3 F1 D2 A1 A1 D2 A2 D1 A1 A1 B1 A1 A1 Btr Bq Bpd BmuBm Bl Btl Bk Bfr Bp Bf Bcm Bpy Bd Bt Bn Ba Bj Bcb Bx Bo Bc Ab Az Aso Ast As Ao Asp Al Ag Af Af mw mw B2 G2 J J G1 G1 G1 D3 I Ds Cc Cr Cr mw mw A2 E G3 Bt Bn Ba Bp Bpd Bq Bj Bcp mw mw D3 D3 A2 D3 D3 D3 D3 Rp Rc Ds Cc Bu Btr Bl Bcr Bcm Bd Bz1 Bz2 mw mw mw Fragment size A1 1500 (uncut) 1700 (uncut) B1 1050 B2 370 1100 B3 350 1200 D1 (60) 380 1150 C 210 110 1350-1300 150-140 1650-1600 100 E 880 F1 100 650 900 640 F3 880 G1 500 1000 G2 1020 G3 1020 H 640 880 F2 550 100 520 580 100 100 1450 I 1350 250 _____________________________________________________________________________________________________ 80 1400 D2 D3 F2 B2 G2 mw mw Haplotype A2 I mw D3 Fragment not always visible 150 100 APPENDIX 5 Dominiak, Daniels, and Mapson, (2011). Review of the outbreak threshold for Queensland fruit fly (Bactrocera tryoni Froggatt). Plant Protection Quarterly, 26(4), 141. This paper has been reproduced with permission. Plant Protection Quarterly Vol.26(4) 2011 141 Review of the outbreak threshold for Queensland fruit fly (Bactrocera tryoni Froggatt) i. Bernard C. DominiakA, David DanielsB and Richard MapsonC Department of Primary Industry NSW, Locked Bag 21, Orange, New South Wales 2800, Australia and the Department of Biological Sciences, Macquarie University, New South Wales 2109, Australia. B Department of Agriculture, Fisheries and Forestry, PO Box 858, Canberra, ACT 2601, Australia. C Department of Primary Industries Victoria, 621 Burwood Highway, Knoxfield, Victoria 3180, Australia. A ii. Abstract Fruit flies cause losses in horticultural produce across the world and are a major quarantine concern for most countries. Queensland fruit fly (Qfly) is a native to Australia and is also present in a small number of Pacific Island countries. The detection of Qfly in recognized pest free areas triggers quarantine restrictions from domestic and international markets. In Australia, the detection of five male flies has been taken to indicate an outbreak (i.e. unacceptable risk). Matching the domestic standard, many countries have accepted the 5-fly limit as a quarantine threshold. But some other countries have set the detection of two male flies, or even a single fly, as the threshold for an outbreak. This different standard creates an administrative complexity for exporters and trade regulators. In this paper, we review the published science covering the impediments to pest establishment. Outbreak data from Victoria and New South Wales during 2007 and 2009 are reviewed in relation to the 2-fly and 5-fly thresholds. Large volumes of fruit have been traded within Australia and internationally based on the 5-fly threshold without incident and there is no evidence that the 2-fly threshold is more appropriate. While Qfly is recognized as being capable of longer distance dispersal than some other fruit fly species, it is also recognized as a poor colonizer. The 5-fly threshold is proposed as the most appropriate threshold for imposition of quarantine restrictions and is recommended as a universal standard for harmonization of quarantine regulations. iii. Introduction There are about 4500 species of fruit flies worldwide. In the Pacific area alone, there are 350 species of which at least 25 species are regarded as being of major economic importance (Allwood 2000). The genus Bactrocera contains over 400 species, distributed primarily though the Asia-Pacific area including Australia (Drew 1974). Tephritid fruit flies cause direct losses to many fresh fruit and some vegetable industries, resulting in adverse impacts on trade and economies of many countries (Li et al. 2010, Stephenson et al. 2003). With the increasing globalization of trade (Stanaway et al. 2001, Plant Health Australia 2010), fruit flies pose a major quarantine concern that is currently monitored through regional surveillance programs (International Atomic Energy Agency 2003, Stephenson et al. 2003, Oliver 2007). The Queensland fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) (Qfly) is a major fruit fly pest of Australian horticulture, attacking most fruit and many vegetable crops (e.g. stone fruit, citrus, coffee, tomato, capsicum, pome fruit) (Bateman 1991, Anon. 1996, Hancock et al. 2000). Qfly is an Australian native and is currently only found in Australia and on some Pacific islands (Drew 1989, White and Elson-Harris 1992). Given its pest status within Australia, Qfly is also a significant quarantine concern for many trading partners. Markets trading in commodities that may be subject to Qfly infestation require assurance of reliable monitoring grids, evidence-based outbreak thresholds and appropriate quarantine measures (Bateman 1991, Anon. 1996, Clarke et al. 2011). In the early 1990s, Bateman (1991) reviewed existing domestic trade conditions and recommended a uniform agreement among the Australian states for the management of and trade in Qfly host commodities. In response, the Code of Practice for the Management for Queensland Fruit Fly (Anon. 1996) was published, with particular emphasis on managing the TriState Fruit Fly Exclusion Zone (FFEZ) so that fruit could be traded domestically with increased efficiency. The FFEZ production area is managed as a pest free area and is recognized by all Australian states as being free from economic fruit flies. Strict quarantine measures are in place to prevent entry of fruit flies and any incursions invoke a rapid and thorough eradication response. Within the FFEZ, four separate pest free areas have been established to facilitate trade into international markets. These include the Riverina area of New South Wales, the Sunraysia region of Victoria/New South Wales, the Riverland area of South Australia, and the Shepparton Irrigation Region of Victoria. Under some circumstances, Qfly do enter the FFEZ and are detected in monitoring traps (Dominiak et al. 2003a, Dominiak and Coombes 2009). Single-fly detections are almost always isolated incursions that do not indicate breeding populations (Meats et al. 2003). For domestic trade (Anon. 1996), an outbreak is declared following one (or more) of three thresholds. These thresholds are the detection of: (1) five male flies within 1 km within 14 days, or (2) one mated female, or (3) one or more larvae in fruit grown in the area. The quarantine distance around any outbreak is 15 km. This domestic trade agreement (Anon. 1996) was broadly adopted in principle by 19 countries as the basis of international trade. However some key components of this agreement, such as the outbreak threshold, have not been accepted by some importing countries. In 1996, the outbreak threshold varied from 1, 2 and 5 male flies for 1, 14, and 3 countries respectively (Robert McGahy personal communication). The threshold of two male flies and five flies (hereafter referred to as 2-fly and 5-fly thresholds) are the most commonly used quarantine thresholds. The 2-fly threshold is based on detections within 400 m while the 5-fly threshold is based on detections within 1 km. By 2009, with increased international acceptance of the 5-fly threshold, this position had changed with 1, 11 and 9 countries accepting 1, 2 and 5 male flies respectively as outbreak thresholds (David Daniels personal communication). These different outbreak thresholds lack a robust scientific basis and create complex administration procedures for trade regulators. An agreed evidence-based Qfly outbreak threshold would harmonize market requirements and thereby facilitate domestic and international trade (Clarke et al. 2011). A universal outbreak threshold would have major implications for trade, quarantine and the minimization of pesticides in the environment as part of eradication programs (cover and bait sprays). There is a geometric expansion of areas requiring disinfestation unnecessarily by each kilometre of quarantine radius for outbreaks triggered by a low threshold (Clarke et al. 2011). The purpose of this paper is to review the data from February 2007 to April 2009 for 2-fly and 5-fly thresholds for fruit fly outbreaks in Victoria and New South 142 Plant Protection Quarterly Vol.26(4) 2011 Wales, and to examine the published scientific evidence since 1996 regarding incursions, survival, breeding populations and the resultant outbreak thresholds. This review will focus only on male flies as most outbreaks are triggered by the detection of male flies. iv. Impediments establishment Founding propagules to pest It has been shown that the introduction of fruit flies into pest free areas is most often the result of illegal transportation into and the inappropriate disposal of infested host material within the pest free area (Bateman 1991, Dominiak et al. 2000, Dominiak and Coombes 2009). This indicates that relatively small parcels of fruit flies are the source of most Qfly detections. Qfly dispersal from these points of introduction is limited by lifespan and the ability to find food to sustain the effort of longer or frequent short flights, survive adverse weather and avoid predation (Meats and Smallridge 2007, Meats and Edgerton 2008, Gilchrist and Meats 2011, Weldon and Taylor 2011). Immature fruit flies disperse for about two weeks in random directions and do not travel in pairs (Fletcher 1974a). Following the introduction of small numbers of Qfly into fruit fly free areas, the chances of a sexually mature male and female occurring in the same tree or group of trees after many days of dispersal is extremely low (Fletcher 1974a, Bateman 1977, Meats 1998, Weldon 2003, 2007, Weldon and Meats 2010). Following the introduction of propagules of infested fruit into fruit fly free areas, Meats (1998) and Meats et al. (2003) proposed that flies disperse into a mate-free void and self extinguish, as it becomes increasingly unlikely that they will participate in mating and will therefore not establish a breeding population. Nutrition Nutrition is key for Qfly survival, dispersal, reproduction and establishment of new populations. Wild flies must find sugar, minerals, water and protein from products such as bird faeces, honeydew and fruit juice (Bateman 1972, Drew et al. 1984, Dalby-Ball and Meats 2000). In dry environments, these products are difficult to find. The average lifespan of Qfly without food and water is approximately 45 hours (Weldon and Taylor 2010, Dominiak unpublished). Qfly require a balanced diet, as diets with too much or too little protein and carbohydrate result in adverse effects on either longevity or reproduction (Prabhu et al. 2008, Fanson et al. 2009). Protein feeding by post-teneral Qfly has been consistently reported to enhance sexual performance (Perez-Staples et al. 2007, 2008, Prabhu et al. 2008). Bacteria on the surfaces of leaves and fruit appear to be a key food source for Qfly (Drew 1987, Drew and Lloyd 1987, Fletcher 1987). However in fruit fly free regions of southern Australia, populations of these bacteria may be infrequent and erratic owing to unfavourable climate (Drew et al. 1984, Courtice and Drew 1984). In the absence of these bacteria, Qfly must find protein from alternative ephemeral sources (Perez-Staples et al. 2007, Weldon and Taylor 2011) and therefore a large proportion of flies may not reach sexual maturity and contribute to population growth. Climate in the FFEZ is normally dry and crops require irrigation. The combination of low humidity and starvation are considerably more punitive for Qfly survival than starvation alone (Weldon and Taylor 2010). Desiccation resistance is generally lower for females than males and resistance also declines with age. Therefore, the lack of available food resources in the environment diminishes the chance of survival to maturity and the chance to compete for a mating. In summary, the FFEZ usually presents as a hostile environment and affords very limited resources for the establishment and spread of Qfly. Dispersal before mating Qfly actually spend very little time flying. Fletcher (1973, 1989) noted that flies spend most of their time making trivial flights or walking within the tree canopy. In response to higher fruit abundance, both male and female Qfly visit more leaves and hence spend more time in trees containing more fruit (Dalby-Ball and Meats 2000). Flies move around the canopy primarily by walking, and when they do fly, it is usually over distances of less than 50 mm in an upward direction. In laboratory observations, wild Qfly spend only about 0.6% of their time in flight with walking (67.5%), inactivity (18.0%) and grooming (14%) taking up the remainder of their time (Weldon et al. 2010). In the field, Ero et al. (2011) reported that resting was the most commonly observed behaviour for Qfly while feeding was rarely observed. The flight activity patterns and shortrange dispersal patterns of emerged adults are similar for male and female Qfly (Weldon and Meats 2007, Weldon et al. 2010). Clarke and Dominiak (2010) found a high correlation between male and female trap catches and suggested that changes in male distribution also reflect the distribution of female Qfly. Fletcher (1973) reported that the weekly declines of released Qfly were similar for males and females. Meats (1998) also assumed that males and females had similar dispersal. Therefore the trapping of male flies is likely to reflect a similar number of female flies in the environment. Mating after dispersal Male Qfly use pheromones and acoustic signals to attract sexually receptive females, and mate only during a brief period of about 30 minutes at dusk (Tychsen and Fletcher 1971). Males gather on the upwind side of trees, where they release pheromone and fan their wings, directing the pheromone stream through the foliage (Tychsen 1977). Male calling is energetically expensive and calling in aggregations maximizes their chances of mating success (Weldon 2007). Males downwind of an aggregation might fly upwind in response to pheromone being released by calling males. There is a period of only about ten minutes during which males could fly to join the flying swarm (Tychsen 1977), and only enough time to mate once at each dusk, although males may mate in many dusk periods over their lifetime (Fay and Meats 1983, Radhakrishnan and Taylor 2008, Radhakrishnan et al. 2009). Males do not mate when temperatures at dusk are below 15°C with 50% of males mating at 20°C or higher temperatures (Meats and Fay 2000). Qfly have a relatively poor capacity to locate an odour source and it has been suggested that pheromones operate mainly within a single tree canopy (Meats and Hartland 1999, Weldon 2007). Acoustic cues are only effective over a short distance of about 50 cm (Mankin et al. 2004, 2008, Sivinski personal communication). Female Qfly move directly towards the males from up to 50 cm away (Tychsen 1977). Odour plumes carried by light winds in trees usually become chaotic within a few centimetres of their source and provide few cues as to the direction of the source (Griffiths and Brady 1995). Qfly compensate for the diffused odour by making a series of short flights or walks (Meats and Hartland 1999) or by using large visual cues such as foliage to locate the source of odours (Dalby-Ball and Meats 2000). Female Qfly visit single male Qfly less frequently than aggregations (Weldon 2007). If the Qfly population is sparse, these limitations therefore result in single males being unlikely to attract a female and mate. Meats (1998) estimated the chance of a successful mating between two Qfly on the same tree of 5 m × 5 m to be about 0.1%. Even in small cages, the chance of mating was only 0.8% (Fay and Meats 1983). A male Qfly has about a one in 400 chance of being in the right place at the right time if the density of males in the area was only one per hectare. Meats (1998) estimated that a single mating was probable when there were six male and six female Qfly present per hectare. Current outbreak thresholds Following the detection of small numbers of male Qfly (the number depends on the importing market), trading partners may fear that fruit harvested for trade could contain larvae that might establish populations in areas currently free from this Plant Protection Quarterly Vol.26(4) 2011 143 pest. In Anon. (1996), a breeding population is considered to have three indicators. Two are direct indicators; larvae detected in fruit harvested within the area or a mated female detected in monitoring traps. In fruit fly free areas, larval searches are not routinely undertaken by regulatory authorities at times when no fruit flies are detected, although they are sometimes conducted to meet some importing country requirements. If present, larvae are generally detected and reported by the public but these are rare events in the FFEZ. Because of inefficiency and difficulty of detecting larvae, a monitoring grid or array has been established to provide an early warning of incursions by adult Qfly. Qfly populations are known to occur naturally in about a 50:50 male:female ratio (Dominiak et al. 2008, Clarke and Dominiak 2010). In the FFEZ, female Qfly are poorly attracted to monitoring traps (Dominiak et al. 2003a, Dominiak 2006, Dominiak and Nicol 2010). However, these traps and lures may be more successful in tropical regions (Clarke and Dominiak 2010). Due to the lack of reliable female lures, the monitoring array relies primarily on the trapping of male flies and this is a common situation in most countries (International Atomic Energy Agency 2003). In Australia, Willison discovered that male Qfly are attracted to raspberry ketone and subsequently experimented with a related chemical, cuelure (Allman 1958). Cuelure breaks down into raspberry ketone and this process is accelerated in the presence of moisture (Metcalf 1990). Sexually mature male Qfly are attracted to raspberry ketone in nature (Tan and Nishida 1995). While male flies trapped may be sexually mature, there is no current technology which can indicate if a Qfly male has mated and therefore that a breeding population exists. In the absence of this technology, Bateman (1991) proposed that five male flies are an indicator of a breeding population and this is later supported by Meats (1998). male flies are detected within one kilometre of each other within 14 days, 31 supplementary traps must be deployed within 200 metres (the outbreak zone) of the 2-fly detection and fruit must be checked for larvae. Supplementary traps must stay in place for nine weeks and be inspected twice weekly. If fewer than five male Qfly are trapped within 1 km within any 14 day period, an outbreak is not declared. In essence, it is deemed that a breeding population does not exist. If a total of five or more Qfly are detected within any 14 day period, an outbreak is declared for all domestic and international markets. After the outbreak declaration, no produce within the outbreak zone (within 200 m of the detection point) can be traded. All produce between 200 m and 15 km (the suspension area) must be treated with an approved disinfestation protocol before being transported into or sold in fruit fly sensitive markets (Jessup et al. 1998, De Lima et al. 2007). The detection date of the last fly trapped is used to determine the reinstatement of area freedom based on generation tables in Anon. (1996). For some countries, these reinstatement periods vary from one generation plus 28 days, 12 weeks, three generations and one year. However apart from noting these differing standards, these reinstatement periods will not be discussed in detail further in this paper. Some countries have adopted the 2-fly threshold (within 400 m) as the outbreak threshold rather than the 5-fly threshold (within 1 km). For Australian exporters and regulators, the different outbreak thresholds result in disrupted trade and an administration burden. Moreover, the disparity in outbreak thresholds and reinstatement periods places regulatory authorities in a difficult position, needing to impose movement controls on host commodities destined for markets with different requirements. Conditions under the current code Australian states and territories have agreed to the 5-fly threshold as an outbreak threshold. This agreement allows susceptible produce to be traded based on the specified conditions before or after an outbreak is declared. What happens when a trading partner requires a different threshold? In the Australian response, the detection of two flies requires the deployment of supplementary traps and fruit searches. However since the Australian 5-fly outbreak threshold is not reached, no movement controls are imposed and fruit may move unrestricted from a 2-fly zone to any part of the pest free area or the rest of Australia. Further, no chemical control measures are deployed. This contrasts with countries that are more risk averse Bateman (1991) and subsequently Anon. (1996) recommended that five male flies trapped within 1 km of each other within a 14 day period was an appropriate outbreak threshold, or in essence indicated unacceptable risk of a breeding population. This standard has been accepted for domestic trade within Australia and by many international trading partners. However, some countries choose lower outbreak thresholds. Presumably, these lower standards are thought to provide a higher level of assurance, but there have been no empirical studies to support this. As part of the 5-fly standard in Anon. (1996), there is an intermediate step, presumably to further investigate for the presence of a breeding population. When two v. Implications for different outbreak thresholds and use a 2-fly threshold. A fruit fly outbreak in any country normally requires an eradication response and movement controls. Since Australia does not deploy these responses for a 2-fly threshold, the interpretation by a 2-fly importing country is that potentially infested produce can move from the area immediately around the 2-fly threshold to any other district. What is the Australian response to these mixed thresholds? Australia only imposes eradication or movement controls after a 5-fly threshold and therefore countries using the 2-fly threshold may deem the entire or part of the pest free area infested. Trade in fruit fly host commodities under area freedom arrangements into 2-fly sensitive markets is likely to cease for the entire or part of the pest free area. Costly phytosanitary treatments are usually required for these 2-fly markets. The alternative is that Australia aligns its trade standard with the 2-fly threshold, and moves to a lower universal outbreak threshold. This action would decrease fruit fly free trade because the 2-fly threshold is reached more frequently than the 5-fly threshold. Due to the difficulties in servicing markets with different outbreak thresholds, would markets currently accepting the 5fly threshold then also align with the2fly threshold? This possible change in outbreak threshold results in potentially all countries accepting the lowest outbreak threshold. One country is even more risk averse, requiring a 1-fly threshold for Qfly. If this strategy was adopted internationally by all countries for all species, the 1-fly threshold would become an unreasonable burden on all international trade. This strategy would significantly increase pesticide use in field eradication programs and cause most fruit to be unnecessarily treated with undesirable impact on the environment; some chemicals such as methyl bromide are green house gases. There would be significant benefits in harmonizing outbreak thresholds, but empirical evidence is required to support a preferred universal threshold. vi. New information published since the early 1990s. Bateman’s (1991) report was the basis for the current thresholds for outbreaks and these were adopted as a code of practice (Anon. 1996). More data of Qfly outbreaks have been published since Bateman (1991) and Anon. (1996), and these more recent publications may prove instructive in assessing the relative merits of the 5-fly and 2-fly thresholds. The monitoring grid is either a 400 m array in towns or a 1000 m array in orchards (Anon. 1996, Meats 1998). Fruit flies are reported to rarely disperse as far as one kilometre over their lifetime (Maelzer 1990, Bateman 1991, Meats 1996, Dominiak et al. 2003b, Meats et al. 2003, 2006, Meats and Edgerton 2008, 144 Plant Protection Quarterly Vol.26(4) 2011 Weldon and Meats 2010, Gilchrist and Meats 2011). Given the large size of the FFEZ, we can then surmise that introductions of Qfly usually result from the carriage by humans of infested produce, and this is supported by assessment at roadblocks (Bateman 1972, Dominiak et al. 2000, Sved et al. 2003, Maelzer et al. 2004, Dominiak and Coombes 2009). Clift and Meats (2005) used Bayesian scenario analysis to show that introductions by local inhabitants contributed more to outbreaks than passing travellers. Most humans reside in urban areas and therefore the more intense monitoring array (400 m) in towns is a reflection of the greater risk (Meats 1998, Maelzer et al. 2004). Townships also provide better environments for survival and development of fruit flies than the surrounding rural areas (Yonow and Sutherst 1998, Raghu et al. 2000, Dominiak et al. 2006). Backyard environments are typically well watered and contain both sheltered microclimates and host fruit trees. Larger urban areas have an urban heat island which further minimizes the adverse effects of cold weather (Torok et al. 2001, Dominiak et al. 2006). The one kilometre grid is used in lower risk rural and orchard areas. These relatively sparsely populated rural areas are unlikely to be the first point of introduction of infested fruit and if they are, rural areas generally provide less favourable environments for fruit fly survival (Dominiak et al. 2006). Meats (1998) suggests that a detection of two male flies within a two week period on the one kilometre grid represents a density between 2.1 and 6.57 flies per hectare within the outbreak zone (200 m radius from the discovery point). The upper estimate of 6.57 flies per hectare represents the most extreme situation in which the source of the incursion is directly in the centre of four adjacent traps in a grid, maximizing its distance from any trap. Meats (1998) proposed that when the density of flies within the outbreak zone exceeded six flies per hectare (of each sex), there was potential (albeit a very low risk) for one pair to mate. Superficially, the upper estimate of 6.57 flies per hectare appears to exceed the minimum density required for a mating to occur by 0.57 flies per hectare. However the theoretical minimum breeding density proposed by Meats (1998) of six male flies is an extremely conservative estimate and is essentially only a ‘best guess’ based on the information available at that time. Several critical factors used to obtain this theoretical minimum breeding estimate remain poorly understood. Meats (1998) estimated that the probability of a successful mating in the field was less than 0.1 although in calculating the minimum breeding density, the model assumed that it was equal to 0.1. This estimate of 0.1 was based on unpublished observations and has not been substantiated with data or confirmed experimentally in the field. The model also assumes that there are ten dusk periods available for mating and that mating can occur each and every dusk period. Tychsen and Fletcher (1971) concluded that mating only occurs within a 30 minute period each day so that sexually mature flies must be in close proximity at this time for mating to occur. Meats (1998) acknowledges that his estimate of ten dusk periods is also too high as it does not take into account adverse weather, the inhospitable environment, and other factors unfavourable to fruit flies. In reality, mating will only occur under favourable conditions and in the presence of an adequate population. Another factor included in the estimate was dispersal behaviour observed by Fletcher (1973, 1974a, 1974b) in a commercial orchard at Wilton, New South Wales. Fletcher’s conclusions are specific to the coastal environment where his study was conducted and cannot be directly applied to inland pest free areas that are much less favourable to fruit flies (Dominiak et al. 2006). Meats (1998) also acknowledged in his closing remarks that verification of the models is still required and to date this issue remains unresolved. Meats (1998) recognized that his interpretation of trapping rates on the 1 km grid is conservative, and accordingly did not recommend that the detection of two flies should be the threshold for quarantine precautions, but rather a threshold to intensify the grid. vii. Data for 2007–2009 period The period from February 2007 to April 2009 was chosen as a base to compare 2fly and 5-fly thresholds. Information was provided by the state departments of agriculture in Victoria and New South Wales; there were no outbreaks in the South Australian portion of the FFEZ during this period. Climatically, autumn 2007 experienced near neutral values for the Southern Oscillation Index (SOI) with most parts of New South Wales and Victoria receiving average rainfall (Braganza 2008). The study area received slightly above average rainfall in spring and summer of 2007 followed by dry conditions in autumn, winter and spring 2008 (Duell 2009, Qi 2009). Average to below average rainfall occurred in the FFEZ in summer 2008–2009 and autumn 2008 however several exceptional heatwaves occurred in February 2009 (Mullen 2009). In this period, there were 27 outbreaks and these were allocated to one of two categories. Category A was a response after detection of two flies, where 31 supplementary traps were deployed and larval searches undertaken according to Anon. (1996). No eradication or product movement controls were imposed. Trade to countries using the 2-fly threshold would have been suspended for that area. Trade was reinstated only after no flies were trapped for a period of one generation plus 28 days. There was no restriction of trade with any Australian states or any 5-fly markets. There were 19 outbreaks in this category (Victoria: Invergorden 18 March 2008; Cobram 12 March 2008; Barooga 13 March 2008; Shepparton 10 April 2008; Bunbartha 11 April 2008; Katunga 14 April 2008; Numurkah 15 April 2008; Cobram East 2 June 2008; Echuca 18 September 2008; Irymple 24 March 2009. New South Wales: Yenda 11 April 2007; Darlington Point 26 April 2007; Yanco 29 May 2007; Lake Wyangan 12 March 2008; Hillston town 15 April 2008; Yenda 16 April 2008; Yanco 16 September 2008; Leeton town 16 September 2008; Hillston orchard 22 September 2008). Category B was based on a 5-fly threshold. Subsequent procedures were according to Anon. (1996); supplementary traps and larval searches were conducted, eradication programs and product movement controls were initiated, and a 15 km suspension zone was established. Trade in fruit fly free produce to all domestic and international markets (including countries using the 2-fly threshold) was suspended for all host commodities grown within the suspension zone until there were no flies trapped for one generation plus 28 days. There were eight outbreaks in this category (Victoria: Koonoomoo 2 February 2007; Invergordon 20 March 2008; Bunbartha 22 April 2008; Katunga 13 May 2008; Cobram East 19 June 2008; Shepparton 3 April 2009. New South Wales; Narrandera 23 May 2007; Yanco 28 October 2008.) Of the 27 outbreaks, 19 Category A outbreaks (70.4% of all outbreaks) did not progress to a Category B outbreak despite supplementary trapping and larval searches. Even with the low level of progression to the 5-fly threshold (29.6%), all susceptible host produce from the pest free area required disinfestation before being exported to markets requiring any threshold other than the 5-fly threshold. Meats et al. (2003) found 71% of single Qfly detections did not lead to 5-fly outbreaks and self extinguished without any eradication response. The 2007–2009 data for the 2-fly threshold of 70.4% is consistent with Meats et al. (2003). Riverina trade volume since 1996 There has been considerable trade in host produce from the FFEZ since 1996 using the 5-fly threshold without any reports of larvae found in produce. This confirms that area freedom certification procedures for Australia’s pest free area are robust given that consumers are highly likely to report and return damaged fruit to retailers. The volume of produce varies from year to year. Australian Bureau of Statistics (2008) reported that, for the statistic local areas of Carrathool, Griffith, Leeton and Murrumbidgee, 8586, 166 689 and 172 387 tonnes of stone fruit, oranges and Plant Protection Quarterly Vol.26(4) 2011 145 other citrus respectively was produced. These combined industries are valued at $86.492 M (Australian Bureau of Statistics 2008). Given the volume and value of fruit traded annually, if the 2-fly threshold was an accurate indicator of crop infestation, it is likely that Qfly would have been detected in consignments in domestic or international market during the past 15 years. viii. Closing comments ix. Acknowledgments x. References Qfly is recognized as a poor colonizer in fruit fly free areas such as the FFEZ, owing to hostile conditions for survival and reproduction (Bateman 1972, 1977, Fletcher 1987, Edge et al. 2001, Meats et al. 2003, Weldon 2007). Even introduction by human activity (jump dispersal) very rarely results in establishment (Maelzer et al. 2004, Meats and Edgerton 2008). Given the large volume of produce traded without incident, the 5-fly threshold has a proven track record of success in providing highly effective phytosanitary assurance. Based on the evaluation of outbreak data, there is no indication that the 2-fly threshold provides any additional assurance. On this basis, we recommend that international trading partners adopt the 5-fly threshold as a universal threshold that provides a high level of assurance and also enables increased trading opportunity. The authors would like to thank the many trap inspectors who inspect and report on fly detections in Victoria and New South Wales. The identification services in both states are also greatly appreciated. The administration and Information and Communications Technology services in state Departments also make a significant contribution to maintaining and reporting of databases which provided the information in this paper. Earlier versions of this manuscript were improved by comments from Satendra Kumar, Sarah Sullivan, Lionel Hill and Associate Prof Phil Taylor. Allman, S.L. (1958). Queensland fruit fly. New South Wales Department of Agriculture. Conference of Commonwealth and State Entomologists. Brisbane, May 1957. Commonwealth Scientific and Industrial Research Organisation, pp. 68-70. Allwood, A. (2000). Regional approach to the management of fruit flies in the Pacific Island countries and territories. In ‘Area-wide control of fruit flies and other insect pests’, ed. K.H. Tan, pp. 439-48. (Penerbit Universiti Sains Malaysia, Penang). Anon. (1996). Code of practice for the management of Queensland fruit fly. Standing Committee on Agriculture and Resource Management, Department of Primary Industries, Canberra. Australian Bureau of Statistics (2008). Agricultural commodities: small area data, Australia, 2005–2006. Report 71250DO003. Bateman, M.A. (1972). The ecology of fruit flies. Annual Review of Entomology 17, 493-518. Bateman, M.A. (1977). Dispersal and species interactions as factors in the establishment and success of tropical fruit flies in new areas. Proceedings of the Ecological Society of Australia 10, 106-12. Bateman, M.A. (1991). The impact of fruit flies on Australian horticulture. Horticultural Policy Council Report No. 3. ISBN 0642161100. Braganza, K. (2008). Seasonal climate summary southern hemisphere (autumn 2007): La Nina emerges as a distinct possibility in 2007. Australian Meteorological Magazine 57, 65-75. Clarke, A.R. and Dominiak, B.C. (2010). Positive correlation of male and female Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) catches in orange-ammonia traps. General and Applied Entomology 39, 9-13. Clarke, A.R., Powell, L.S., Weldon, C.W. and Taylor, P.W. (2011). The ecology of Bactrocera tryoni (Diptera: Tephritidae): what do we know to assist pest management? Annals of Applied Biology 158, 26-54. Clift, A. and Meats, A. (2005). Use of a Bayesian Belief Network to identify situations that favour fruit fly incursions in inland SE Australia. International Congress on Modelling and Simulation MODSIM 2005, eds A. Zerger and R.M. Argent, pp. 170-6. (Modelling and Simulation Society of Australia and New Zealand). Courtice, A.C. and Drew, R.A.I. (1984). Bacterial regulation of abundance in tropical fruit flies (Diptera: Trephritidae). Australian Zoology 21, 251-68. Dalby-Ball, G. and Meats, A. (2000). Influence of the odour of fruit, yeast and cuelure on the flight activity of the Queensland fruit flies, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). Australian Journal of Entomology 39, 195-200. De Lima, C.P.F., Jessup, A.J., Cruickshank, L., Walsh, C.J. and Mansfield, E.R. (2007). Cold disinfestation of citrus (Citrus spp.) for Mediterranean fruit fly (Ceratitis capitata) and Queensland fruit fly (Bactrocera tryoni) (Diptera: Tephritidae). New Zealand Journal of Crop and Horticultural Science 35, 39-50. Dominiak, B.C. (2006). Review of the use of protein food based lures in McPhail traps for monitoring Queensland fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). General and Applied Entomology 35, 7-12. Dominiak, B.C., Campbell, M., Cameron, G. and Nicol, H. (2000). Review of vehicle inspection historical data as a tool to monitor the entry of hosts of Queensland fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) into a fruit fly free area. Australian Journal of Experimental Agriculture 40, 763-71. Dominiak, B.C. and Coombes, N.M. (2009). Fruit carrying characteristics of travellers into a quarantine zone in New South Wales in 1999/2000. Plant Protection Quarterly 24, 14-19. Dominiak, B.C., Gilmour, A.R., Kerruish, B. and Whitehead, D. (2003a). Detecting low populations of Queensland fruit fly Bactrocera tryoni (Froggatt) with McPhail and Lynfield traps. General and Applied Entomology 32, 49-53. Dominiak, B.C., Mavi, H.S. and Nicol, H.I. (2006). Effect of town microclimate on the Queensland fruit fly Bactrocera tryoni. Australian Journal of Experimental Agriculture 46, 1239-49. Dominiak, B.C., McLeod, L.J. and Landon, R. (2003b). Further development of a low-cost release method for sterile Queensland fruit fly, Bactrocera tryoni (Froggatt) in rural New South Wales. Australian Journal of Experimental Agriculture 43, 407-17. Dominiak, B.C. and Nicol, H.I. (2010). Field performance of Lynfield and McPhail traps for monitoring male and female sterile (Bactrocera tryoni Froggatt) and wild Dacus newmani (Perkins). Pest Management Science 66, 741-4. Dominiak, B.C., Sundaralingham, S., Jiang, L., Jessup, A.J. and Barchia, I.M. (2008). Production levels and life history traits of mass reared Queensland fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) during 1999/2002 in Australia. Plant Protection Quarterly 23, 131-5. Drew, R.A.I. (1974). The responses of fruit fly species (Diptera: Tephritidae) in the South Pacific area to male attractants. Journal of the Australian Entomological Society 13, 267-70. Drew, R.A.I. (1987). Behavioural strategies of fruit flies of the genus Dacus (Diptera: Tephritidae) significant in mating and host-plant relationships. Bulletin of Entomological Research 77, 73-81. Drew, R.A.I. (1989). The tropical fruit flies (Diptera: Tephritidae) of the Australasian and Oceanian regions. Memoirs of the Queensland Museum. 26, 1-521. Drew, R.A.I. and Lloyd, A.C. (1987). Relationship of fruit flies (Diptera: Tephritidae) and their bacteria to host plants. Annals of the Entomological Society of America 80, 629-36. Drew, R.A.I., Zalucki, M.P. and Hooper, H.H.S. (1984). Ecological studies of Eastern Australia fruit flies (Diptera: Tephritidae) in their endemic habitat. I. Temporal variation in abundance. Oecologia (Berlin) 64, 267-72. Duell, R. (2009). Seasonal climate summary southern hemisphere (autumn 2008): a return to neutral ENSO conditions 146 Plant Protection Quarterly Vol.26(4) 2011 in the tropical Pacific. Australian Meteorological and Oceanographic Journal 58, 63-77. Edge, V., Gardner, R., Green, A., Cock, K. and Cornish, J. (2001). Technical review of the Tri-State Strategy for Queensland Fruit Fly. Report to Standing Committee on Agriculture and Resource Management. January 2001, 62 pp. Ero, M.M., Hamacek, E. and Clarke, A.R. (2011). Foraging behaviours of Diachasmimorpha kraussi (Fullaway) (Hymenoptera: Braconidae) and its host Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) in a nectarine (Prunus persica (L.) Batsch var. nectarina (Aiton) Maxim) orchard. Australian Journal of Entomology 50, 234-40. Fanson, B.G., Weldon, C.W., Perez-Staples, D., Simpson, S.J. and Taylor, P.W. (2009). Nutrients, not caloric restriction, extend lifespan in Queensland fruit flies (Bactrocera tryoni). Aging Cell 8, 1-10. Fay, H.A.C. and Meats, A. (1983). The effects of age, ambient temperature, thermal history and mating history on mating frequency in males of the Queensland fruit fly, Dacus tryoni. Entomologia Experimentalis et Applicata 35, 273-6. Fletcher, B.S. (1973). The ecology of a natural population of the Queensland fruit fly, Dacus tryoni IV. The immigration and emigration of adults. Australian Journal of Zoology 21, 541-65. Fletcher, B.S. (1974a). The ecology of a natural population of the Queensland fruit fly, Dacus tryoni V. The dispersal of adults. Australian Journal of Zoology 22, 189-202. Fletcher, B.S. (1974b). The ecology of a natural population of the Queensland fruit fly, Dacus tryoni VI. Seasonal changes in fruit fly numbers in the areas surrounding the orchard. Australian Journal of Zoology 22, 353-63. Fletcher, B.S. (1987). The biology of dacine fruit flies. Annual Review of Entomology 32, 115-44. Fletcher, B.S. (1989). Movements of tephritid fruit flies. In ‘Fruit flies, their biology, natural enemies and control’ Vol. 3B, eds A.S. Robinson and G. Hooper, pp. 209-19. (Elsevier, Amsterdam). Gilchrist, A.S. and Meats, A.W. (2011). Factors affecting the dispersal of largescale releases of the Queensland fruit fly, Bactrocera tryoni. Journal of Applied Entomology 37, 186-8. Griffiths, N. and Brady, J. (1995). Wind structure in relation to odour plumes in tsetse fly habitats. Physiological Entomology 20, 286-92. Hancock, D.L., Hamacek, E.L., Lloyd, A.C. and Elson-Harris, M.M. (2000). The distribution and host plants of fruit flies (Diptera: Tephritidae) in Australia. DPI Publications, Brisbane, Australia. ISSN 0727-6273. International Atomic Energy Agency (2003). Trapping guidelines for areawide fruit fly programmes. International Atomic Energy Agency, Vienna. pp. 47. Jessup, A.J., Carswell, I.F. and Dalton, S.P. (1998). Disinfestation of fresh fruits from Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) with combination mild heat and modified atmosphere packaging. Australian Journal of Entomology 37, 186-8. Li, B., Ma, J., Hu, X., Liu, H., Wu, J., Chen, H. and Zhang, R. (2010). Risk of introducing exotic fruit flies, Ceratitis capitata, Ceratitis cosyra and Ceratitis rosa (Diptera: Tephritidae), into southern China. Journal of Economic Entomology 103, 1100-11. Maelzer, D.A. (1990). Fruit fly outbreaks in Adelaide, S.A., from 1948–49 to 1986– 87. I. Demarcation, frequency and temporal patterns of outbreak. Australian Journal of Zoology 38, 439-52. Maelzer, D.A., Bailey, P.T. and Perepelicia, N. (2004). Factors supporting the non-persistence of fruit fly populations in South Australia. Australian Journal of Experimental Agriculture 44, 109-26. Mankin, R.W., Anderson, J.B., Mizrach, A., Epsky, N.D., Shuman, D., Heath, R.R., Mazor, M., Hetzroni, A., Grinshpun, J., Taylor, P.W. and Garrett, S.L. (2004). Broadcasts of wing-fanning vibrations recorded from calling male Ceratitis capitata (Diptera: Tephritidae) increases captures of females in traps. Journal of Economic Entomology 97,1299-309. Mankin, R.W., Lemon, M., Harmer, A.M.T., Evans, C.S. and Taylor, P.W. (2008). Time-pattern and frequency analyses of sounds produced by irradiated and untreated male Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) during mating behaviour. Annals of the American Entomological Society 101, 66474. Meats, A. and Fay, F.A.C. (2000). Distribution of mating frequency among males of the Queensland fruit fly, Bactrocera tryoni (Froggatt), in relation to temperature, acclimation and change. General and Applied Entomology 29, 27-30. Meats, A. and Hartland, C.L. (1999). Upwind anemotaxis in response to cuelure by the Queensland fruit fly Bactrocera tryoni. Physiological Entomology 24, 90-7. Meats, A. and Smallridge, C.J. (2007). Short and long range dispersal of Medfly, Ceratitis capitata (Diptera: Tephritidae) and its invasive potential. Journal of Applied Entomology 8, 518-23. Meats, A., Smallridge, C.J. and Dominiak, B.C. (2006). Dispersion theory and the sterile insect technique: application to two species of fruit fly. Entomologia Experimentalis et Applicata 119, 247-54. Meats, A.M. (1996). Demographic analysis of sterile insect trials with Queensland fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). General and Applied Entomology 27, 2-12. Meats, A.M. (1998). The power of trapping grids for detecting and estimating the size of invading propagules of the Queensland fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) risks of subsequent infestation. General and Applied Entomology 28, 47-55. Meats, A.M., Clift, A.D. and Robson, M.K. (2003). Incipient founder populations of Mediterranean and Queensland fruit flies in Australia: the relation of trap catch to infestation radius and models for quarantine radius. Australian Journal of Experimental Agriculture 43, 397-406. Meats, A.M. and Edgerton, J.E. (2008). Short- and long-distance dispersal of Queensland fruit fly, Bactrocera tryoni and its relevance to invasive potential, sterile insect technique and surveillance trapping. Australian Journal of Experimental Agriculture 48, 1237-45. Metcalf, R.L. (1990). Chemical ecology of Dacine fruit flies (Diptera: Tephritidae). Annals of the Entomological Society of America 83, 1017-30. Mullen, C. (2009). Seasonal climate summary southern hemisphere (summer 2008-09): a weak, brief La Nina returns. Bumper wet season in tropical Australia: exceptional heatwaves in southeastern Australia. Australian Meteorological and Oceanographic Journal 58, 275-84. Oliver, J. (2007). Summary of national fruit fly-related activities released. Plant Protection News. February 2007. Department of Agriculture, Fisheries and Forestry. Perez-Staples, D., Harmer, A.M.T., Collins, S.R. and Taylor, P.W. (2008). Potential for pre-release diet supplements to increase the sexual performance and longevity of male Queensland fruit flies. Agricultural and Forest Entomology 10, 255-62. Perez-Staples, D., Prabhu, V. and Taylor, P.W. (2007). Post-teneral protein feeding enhances sexual performance of Queensland fruit flies. Physiological Entomology 32, 127-35. Plant Health Australia (2010). National Plant Biosecurity Strategy. Plant Health Australia, Deakin, Australian Capital Territory. Prabhu, V., Pérez-Staples, D. and Taylor, P.W. (2008). Protein: carbohydrate ratios promoting sexual activity and longevity of male Queensland fruit flies. Journal of Applied Entomology 132, 57582. Qi, L. (2009). Seasonal climate summary southern hemisphere (spring 2008): La Nina pattern returning across equatorial Pacific. Australian Meteorological and Oceanographic Journal 58, 199-208. Plant Protection Quarterly Vol.26(4) 2011 147 Radhakrishnan, P., Perez-Staples, D., Weldon, C.W. and Taylor, P.W. (2009). Multiple mating and sperm depletion in male Queensland fruit flies: effects on female remating behaviour. Animal Behaviour 78, 839-46. Radhakrishnan, P. and Taylor, P.W. (2008). Ability of male Queensland fruit flies to inhibit receptivity in multiple mates, and the associated recovery of accessory glands. Journal of Insect Physiology 54, 421-8. Raghu, S., Clarke, A.R., Drew, R.A.I. and Hulsman, K. (2000). Impact of habitat modification on the distribution and abundance of fruit flies (Diptera: Tephritidae) in southeast Queensland. Population Ecology 42, 153-60. Stanaway, M.A., Zalucki, M., Gillespie, P.S., Rodriguez, C.M. and Maynard, G.V. (2001). Pest risk assessment of insects in sea cargo containers. Australian Journal of Entomology 40, 180-92. Sved, J.A., Yu, H., Dominiak, B. and Gilchrist, A.S. (2003). Inferring modes of colonization for pest species using heterozygosity comparisons and sharedallele test. Genetics 163, 823-31. Stephenson, B.P., Gill, G.S.C., Randall, J.L. and Wilson, J.A. (2003). Biosecurity approaches to surveillance and response for new plant pest species. New Zealand Plant Protection 56, 5-9. Tan, K.H. and Nishida, R. (1995). Incorporation of raspberry ketone in the male rectal glands of the Queensland fruit fly Bactrocera tryoni Froggat (Diptera: Tephritidae). Applied Entomology and Zoology 30, 494-7. Torok, S.J., Morris, J.G., Skinner, C. and Plummer, N. (2001). Urban heat island features of southeast Australian towns. Australian Meteorological Magazine 50, 113. Tychsen, P.H. (1977). Mating behaviour of the Queensland fruit fly, Dacus tryoni (Diptera: Tephritidae), in field cages. Journal of the Australian Entomological Society 16, 459-65. Tychsen, P.H. and Fletcher, B.S. (1971). Studies on the rhythm of mating in the Queensland fruit fly, Dacus tryoni. Journal of Insect Physiology 17, 2139-56. Weldon, C. (2003). Effectiveness of coloured unbaited sticky traps for monitoring dispersal of gamma-irradiated Queensland fruit fly Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). General and Applied Entomology 32, 55-60. Weldon, C. (2007). Influence of male aggregation size on female visitation in Bactrocera tryoni (Froggatt) (Diptera: Tephritidae). Australian Journal of Entomology 46, 29-34. Weldon, C. and Meats, A. (2007). Shortrange dispersal of recently emerged males and females of Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) monitored by sticky sphere traps baited with protein and Lynfield traps baited with cue-lure. Australian Journal of Entomology 46, 160-6. Weldon, C. and Meats, A. (2010). Dispersal of mass-reared sterile, laboratory-domesticated and wild male Queensland fruit flies. Journal of Applied Entomology 134, 16-25. Weldon, C.W., Prenter, J. and Taylor, P.W. (2010). Activity patterns of Queensland fruit flies (Bactrocera tryoni) are affected by both mass-rearing and sterilization. Physiological Entomology 35, 148-53. Weldon, C.W. and Taylor, P.W. (2010). Desiccation resistance of adult Queensland fruit flies Bactrocera tryoni decreases with age. Physiological Entomology 35, 385-90. Weldon, C.W. and Taylor, P.W. (2011). Sexual development of wild and massreared male Queensland fruit flies in response to natural food sources. Entomologia Experimentalis et Applicata 139, 17-24. White, I.M. and Elson-Harris, M.M. (1992). ‘Fruit flies of economic significance: their identification and bionomics’. (CAB International, Oxon, UK). Yonow, T. and Sutherst, R.W. (1998). The geographical distribution of the Queensland fruit fly, Bactrocera (Dacus) tryoni, in relation to climate. Australian Journal of Agricultural Research 49, 93553. APPENDIX 6 Real-time PCR 18S internal control for PCR competency All DNA extractions need to be tested for PCR competency before performing the real-time PCR assay. This can be done by using the 18S internal control TaqMan real-time PCR assay (Applied Biosystems) or conventional PCR using LCO1490 and HCO2198 primers (Folmer et al., 1994). The 18S real-time PCR assay is conducted using TaqMan Ribosomal RNA Control Reagent kit (VIC probe) according to the Manufacturer’ instructions with modification. The kit is supplied with primers, probe and control material. The PCR assay should be run in duplicate for each sample, and with 20 µl or 10 µl volumes. The PCR compositions are listed in Table S1 and the PCR cycles are listed below the table. Table S1 TaqMan Internal Control of qPCR for 18S ribosomal RNA (20µl*) PCR reagent mix Reaction volume (1 x) Master mix (10 x) Sterile distilled water 7.7 77 2X SsoAdvanced Universal Probe supermix 10 100 10 µM forward primer (Rib for) 0.1 1.0 10 µM reverse primer (Rib rev) 0.1 1.0 40 µM 18S probe (Rib pr) 0.1 1.0 DNA template 2.0 *For 10 µl volume, halve all reagents. PCR cycling parameter 1 x cycle 95 °C, 2 min 40 x cycles 95 °C, 5 sec 60 °C, 5 sec Plate read after each cycle For the analysis of the real-time PCR, see section 7.3.4.3. In this assay, VIC is the fluorophore attached to the 18S probe. For the interpretation of the results, Cq values of 30 is the cut-off point: If the Cq values ≤30 cycles, the DNA extraction is PCR competent, and the DNA can be used for real-time PCR assay for B. tryoni complex. If the Cq values >30 cycle, re-extraction is required. APPENDIX 7 Additional information on the validation of the real-time PCR assay for B. tryoni complex a. Specificity test for Tephritidae specimens in the real-time PCR assay Specificity testing showed that the real-time PCR assay could detect the targeted species: B. tryoni, B. aquilonis, and B. neohumeralis (Table S2), but did not cross-react with the non-target species, including B. correcta, B. cucurbitae, B. dorsalis, B. papaya, B. invadens, B. kandiensis, B. jarvisi, B. zonata, Ceratitis capitata, C. cosyra, C. rosa and Dirioxa pornia (Dhami et al., 2015). Different body parts were used for DNA extraction (Table S2). All B. tryoni complex samples tested gave Cq value under 25 cycles except the DNA samples from the empty pupal case (Table S2). Table S2 Tephritidae samples tested in the real-time PCR assay for B. tryoni, showing parts of the samples tested. Sample Reference Morphological identification Mean Cq Method BQ166 life stage, body part B. tryoni 18.62 QG Adult abdomen × 1 BQ136 B. tryoni 13.81 QG Adult abdomen × 1 T15_00083 Tephritidae 19.21 QG Larva pieces T15_00500a Tephritidae 15.95 QG Larva pieces T14_00158 B. tryoni 21.54 QG Adult leg x 1 T14_01221 B. tryoni 23.01 QG Adult leg x 1 BQ14 B. aquilonis 11.53 QG Abdomen x 1 NM11 B. neohumeralis 20.48 NM Abdomen x 1 NM12 B. neohumeralis 17.37 NM Head/thorax NM13 B. neohumeralis 18.79 NM Abdomen x 1 NM14 B. neohumeralis 17.71 NM Head/thorax NM15 B. neohumeralis 21.33 NM Head/thorax T15_6386/33 B. tryoni 26.67 QG Empty pupal case T15_6386/34 B. tryoni 27.21 QG Empty pupal case Note: All samples were tested in duplicate or triplicate and all Cq values provided are means of the repeats. DNA extraction method refers to Qiagen Blood and Tissue kit (QG) and NucleoMag 96 Tissue Kit (NM). Empty pupal case samples were extracted using an overnight incubation step. b. Real-time PCR assay for B. tryoni and B. curvipennis interceptions B. curvipennis and B. tryoni samples were tested using the real-time PCR assay against B. tryoni complex. One leg from each individual adult specimen and part of larvae intercepted in 2015 was used for DNA extraction (method see section 7.3.1). The B. curvipennis adult samples were from a laboratory colony in New Caledonia 2013 and are dry mounted specimens in the PHEL collection; one leg from each specimen was used for DNA extraction. All the DNA samples were tested with 18S internal control PCR and B. tryoni real-time PCR assays. All DNA extractions were PCR competent in the 18S internal control assay with Cq less than 30 cycles (Table S3 and Figure S1). The B. tryoni complex real-time PCR assay gave Cq <25 cycles for B. tryoni samples and >27 cycles for B. curvipennis (Table S3 and Figure S1). Table S3 Cq values of B. tryoni and B. curvipennis samples using 18S internal controls and B. tryoni real-time PCR assays Species IDa Life stage Year collected Cq (18S) Cq (B. tryoni) B. tryoni larva 2015 23.07 15.21 B. tryoni larva 2015 21.26 14.78 B. tryoni adult 2015 23.07 20.59 B. tryoni adult 2015 23.81 20.62 B. curvipennis larva 2015 25.9 27.85 B. curvipennis larva 2015 21.63 27.72 B. curvipennis adult 2013 24.51 34.81 B. curvipennis adult 2013 27.56 28.47 Note: aSpecies ID are confirmed by morphology and/ or COI sequences. DNA was extracted using a piece of a larva or an adult leg. Note: B. curvipennis adult samples were over two-year-old dried mounted specimens, conventional PCR of the DNA with LCO1490 and HCO2198 primers produced faint PCR products (not shown), indicating DNA degradation in the samples. 18S (VIC) B. tryoni B. curvipennis B. tryoni (FAM) B. tryoni B. curvipennis Figure S1 Amplification curves for 18S internal control (top) and B. tryoni assays (bottom). Top (18S internal control assay): the orange colour curves shows amplification of B. curvipennis samples and the dark green of B. tryoni samples. Bottom (B. tryoni assay): the orange colour curves show amplification of B. curvipennis samples and blue curves B tryoni samples Plant Health Australia 1/1 Phipps Close DEAKIN ACT 2600 Phone: +61 2 6215 7700 Email:[email protected] PHA 15-025 www.planthealthaustralia.com.au