Gynura procumbens Reverses Acute and Chronic Ethanol

Article
pubs.acs.org/JAFC
Gynura procumbens Reverses Acute and Chronic Ethanol-Induced
Liver Steatosis through MAPK/SREBP-1c-Dependent and
-Independent Pathways
Xiao-Jun Li,‡,# Yun-Mei Mu,‡,# Ting-Ting Li,‡ Yan-Ling Yang,‡ Mei-Tuo Zhang,‡ Yu-Sang Li,‡
Wei Kevin Zhang,‡ He-Bin Tang,*,‡,§ and Hong-Cai Shang*,§
‡
Department of Pharmacology, College of Pharmacy, South-Central University for Nationalities, No. 182, Minyuan Road, 430074
Wuhan, China
§
Key Laboratory of Chinese Internal Medicine of MOE and Beijing, Dongzhimen Hospital, Beijing University of Chinese Medicine,
100700 Beijing, China
ABSTRACT: The present study aimed to evaluate the hepatoprotective effect and mechanism of action of Gynura procumbens
on acute and chronic ethanol-induced liver injuries. Ethanol extract from G. procumbens stems (EEGS) attenuated acute ethanolinduced serum alanine aminotransferase levels and hepatic lipid accumulation. Therefore, EEGS was successively extracted by
petroleum, ethyl acetate, and n-butyl alcohol. The results showed that the n-butyl alcohol extract was the active fraction of EEGS,
and hence it was further fractionated on a polyamide glass column. The 60% ethanol-eluted fraction that contained 13.6%
chlorogenic acid was the most active fraction, and its effect was further evaluated using a chronic model. Both the n-butyl alcohol
extract and the 60% ethanol-eluted fraction inhibited chronic ethanol-induced hepatic lipid accumulation by modulating lipid
metabolism-related regulators through MAPK/SREBP-1c-dependent and -independent signaling pathways and ameliorated liver
steatosis. Our findings suggest that EEGS and one of its active ingredients, chlorogenic acid, may be developed as potential
effective agents for ethanol-induced liver injury.
KEYWORDS: Gynura procumbens, chlorogenic acid, alcoholic liver disease, steatosis, MAPK, SREBP-1c
■
INTRODUCTION
Alcohol has long been identified as a major risk factor for liver
diseases. Sustained excessive drinking of alcohol can lead to the
development of alcoholic liver disease (ALD), which refers to a
broad range of liver injury, including steatosis, alcoholic
hepatitis, fibrosis, and cirrhosis.1 Globally, approximately 70%
of alcohol-related mortalities are directly attributed to hepatic
disease,2 and 4% of human deaths are related to ALD, which
seriously affects patients’ quality of life and places a huge
burden on health care systems.3,4 The development of ALD is a
complex process that involves a multitude of signal pathways,
and the mechanism behind ALD is still not well understood.
Although multiple attempts have been made to improve patient
outcome, we have yet to find a reliable treatment, except for
alcohol abstinence.1 During the past decades, less toxic multitargeting herbs have attracted considerable attention as
potential therapeutic candidates against ALD.5
Gynura procumbens (Lour.) Merr., a traditional food and
herb, enthusiastically used in Southeast Asia, possesses a wide
range of pharmacological properties, such as reducing blood
glucose and lipids levels,6 possessing anti-liver cancer activity,7
and relieving hepatotoxicity and other ALD-associated
symptoms.8,9 As a new food material recommended by the
National Health and Family Planning Commission of China in
2012, G. procumbens became a popular vegetable and folk
medicine. People in southern and central China like planting G.
procumbens in their yards. However, until now, very little was
known about its active ingredients or pharmacologic mechanisms. In the current study, we performed in vivo experiments
© 2015 American Chemical Society
to screen the active fraction(s) from G. procumbens for
protective effects against ethanol-induced liver steatosis and
further elucidate its probable mechanisms.
The progression of ethanol-induced liver steatosis, an early
stage in the development of ALD, is a multi-factorial and multistep process that involves multiple metabolic pathways. Acetylcoenzyme A carboxylase (ACC), which converts acetyl-CoA to
malonyl-CoA, is the committed step of the fatty acid
synthesis.10 Fatty acid synthase (FAS) is another key enzyme
that catalyzes fatty acid synthesis. The expression of genes
required for fatty acid and lipid production, including ACC and
Fasn,11,12 are positively regulated by a master regulator of lipid
homeostasis, sterol regulatory element binding protein 1c
(SREBP-1c). Previous studies have proven that SREBP-1c
activation in ALD is directly influenced by AMP-activated
protein kinase (AMPK)13 and mitogen-activated protein
kinases (MAPKs).1,14,15 AMPK is a protein kinase that inhibits
lipid synthesis through phosphorylation and inactivates key
lipogenic genes such as SREBP-1 and ACC.13 Meanwhile,
MAPKs are also the protein kinases that inhibit SREBP-1c
through phosphorylation.15 Because G. procumbens affects lipids
metabolism and SREBP-1c plays a predominant role in alcoholinduced hepatic steatosis,16 we focused on the pathways
upstream and downstream of SREBP-1c to elucidate the
Received:
Revised:
Accepted:
Published:
8460
July 20, 2015
September 7, 2015
September 7, 2015
September 8, 2015
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
Figure 1. Schematic diagram of the bioguided fractions of G. procumbens on alcohol-induced liver injury.
and identified in EEGS in our previous study. HPLC analysis was
carried out with a U3000-Dionex instrument with a 5 μm Acclaim C18 column (4.6 × 250 mm, Thermo Fisher Scientific, Inc., Waltham,
MA). Detection was carried out at 326 nm with a 70 min gradient.
Solvent A was acetonitrile, and solvent B was a 0.1% aqueous
phosphoric acid solution. The gradient system was A-B (v/v) = 19/81
(0 min) → 27/73 (65 min) → 19/81 (70 min). The flow rate of the
mobile phase was 1 mL/min (Figure 2). The contents of
neochlorogenic acid, chlorogenic acid, isochlorogenic acid A, isochlorogenic acid B, and isochlorogenic acid C in EEGS as calculated by
external standard method were 0.01%, 0.27%, 0.28%, 0.051%, and
0.12%, respectively. The contents of chlorogenic acid in petroleum
extract, ethyl acetate extract, n-butyl alcohol extract, water extract,
fraction 1, fraction 2, and fraction 3 were 0.0078%, 0.38%, 1.0%,
0.03%, 0% (not detectable), 13.6%, and 42.0%, respectively.
Screening of the Active Fraction(s) of EEGS in the Acute Alcohol
Exposure Model. The acute alcohol exposure model designed by
Carson and Pruett17 is particularly valuable when used to screen the
efficacy of agents that may offer clinical benefits and for the
mechanistic and predictive analysis of therapeutic compounds.18 In
the current study, male Kunming mice (body weight 18−22 g) were
used, and all experiments followed the WHO Guidance of Humane
Care and Use of Laboratory Animals. Ethanol (5 g/kg) was given
orally (by gavage) every 12 h for a total of three doses to induce liver
injury in the acute alcohol exposure model. EEGS and its fractions
were suspended in the ethanol solution so that the mice received
ethanol and EEGS or its fractions at the same time. The mice were
sacrificed 4 h after the last ethanol treatment, and their blood samples
and whole livers were immediately collected. Blood samples were used
to test for alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activity. Serum levels of ALT and AST were
determined using commercial spectrophotometric kits (Nanjing
Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China) according
to the manufacturer’s instructions. Liver samples were used for RTPCR, Western blot, triglyceride (TG) content analysis, and histological
examination. We performed three rounds of screening with the acute
ALD model to evaluate the active fraction(s) of G. procumbens. One
round of screening was to determine the optimal EEGS dose, and the
other two were to screen the active fraction(s) of the EEGS and nbutyl alcohol extract.
Estimation of the Effect of EEGS and Fraction 2 in the Chronic
Alcohol Exposure. Because acute alcohol exposure in mice induces
hepatic steatosis in a manner similar to chronic ethanol administration,
the acute model is useful as a screening tool and/or a mechanistic and
predictive analysis for agents against liver disease induced by chronic
alcohol intake.18 However, negative health consequences of alcohol
use vary according to the drinking pattern, such as acute or chronic.1
The acute model with three binge-drinking episodes did not evoke the
full range of symptoms of chronic alcohol consumption in the liver.19
molecular mechanisms underlying the protective effects of G.
procumbens against ALD.
■
MATERIALS AND METHODS
Reagents. G. procumbens was produced in Shantou, Guangdong,
China (identified by Prof. Bingkun Zhang, Wuhan Botany, Chinese
Academy of Sciences). P44/42 MAPK (Erk1/2), phospho-p44/42
MAPK (Thr202/Tyr204), p38 MAPK, phospho-p38 MAPK
(Thr180/Tyr182), acetyl-CoA carboxylase, phospho-acetyl-CoA carboxylase (Ser79) antibodies were purchased from Cell Signaling
Technology (Beverly, MA). SREBP-1 antibody was purchased from
Abcam (Cambridge, UK). AMPK1/2 and phospho-AMPK1/2
(Thr172) antibodies were obtained from Santa Cruz Biotechnology
(Santa Cruz, CA). The GAPDH antibody was purchased from AB
CLONAL Biotechnology (Wuhan, Hubei, China). Chlorogenic acid
and silymarin were purchased from Sigma-Aldrich (St. Louis, MO). All
other chemicals purchased were of the purest form commercially
available.
Animals, Grouping, Treatment, and Sampling. Preparation of
the Ethanol Extract from G. procumbens Stems (EEGS) and Its
Subfractions. Fresh stems were minced, dried in the sun, and
powdered for the experiments. The extract was prepared from 1000 g
of powder extracted by heat reflux in 10 L of 80% ethanol at 85 °C for
1 h and filtered. The extraction was repeated three times. The filters
were combined and evaporated under reduced pressure at 50 °C to
remove the solvent. Then, the extract was lyophilized to obtain EEGS
with a yield of 18.5%. The yield in the present study is always
calculated using the following formula: yield = (weight of the dried
extract/weight of sample used for extraction) × 100%.
EEGS was further fractionated according to the schematic diagram
shown in Figure 1. EEGS was dissolved in 500 mL of water, and the
solution was successively extracted by the same volumes of petroleum,
ethyl acetate, and water-saturated n-butyl alcohol. Each solvent
extraction was repeated three times. The extracts of each solvent
were combined and then evaporated under reduced pressure at 50 °C.
The crude extracts of the four fractions were classed, yielding
petroleum, ethyl acetate, n-butyl alcohol, and water at 5.4%, 14.2%,
13.3%, and 67.0%, respectively.
The n-butyl alcohol extract was further fractionated on a polyamide
glass column (custom-made, inner diameter 2 cm, packing height 40
cm). Elution was started with distilled water followed by 60% ethanol
and ending with 95% ethanol, 375 mL each, 2.5 mL/min. The eluted
fractions were evaporated under reduced pressure at 50 °C to give
fraction 1 (yield 92.74%), fraction 2 (yield 6.49%), and fraction 3
(yield 0.76%).
Analysis of Chlorogenic Acids by HPLC-UV. Five chlorogenic
acidsneochlorogenic acid, chlorogenic acid, isochlorogenic acid A,
isochlorogenic acid B, and isochlorogenic acid Chave been isolated
8461
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
Figure 2. Representative HPLC-UV chromatograms of EEGS and its subfractions. HPLC analysis was carried out with a U3000-Dionex instrument
with a 5 μm Acclaim C-18 column (4.6 × 250 mm) (Thermo Fisher Scientific, Inc. Waltham, MA). Detection was carried out at 326 nm with a 70
min gradient. Solvent A was acetonitrile, and solvent B was 0.1% aqueous phosphoric acid solution. The gradient system was A-B (v/v) = 19/81 (0
min) → 27/73 (65 min) → 19/81 (70 min). The flow rate of the mobile phase was 1 mL/min. Peaks: 1, neochlorogenic acid; 2, chlorogenic acid; 3,
isochlorogenic acid B; 4, isochlorogenic acid A; and 5, isochlorogenic acid C.
Thus, we also evaluated the protective effect of G. procubens on
chronic ethanol-induced liver steatosis. Liquid diets were based on the
Lieber−DeCarli formulation (Dyets, Inc., Bethlehem, PA). Each
mouse was housed in an individual cage and allowed ad libitum access
to ethanol-containing diet. Control animals were pair-fed the same diet
but with maltodextrin isocalorically substituted for ethanol.20 Either
the ethanol-containing diet or the isocaloric maltose-dextrin (control)
diet was fed to the animals for 8 weeks. The ethanol content began at
2.5% and was increased in a stepwise manner 0.5% every 2 days until
the end of the first week and then 0.5% every 4 days until 5% was
achieved. This level was maintained until the end of the experiment.
Silymarin, a mixture of flavonolignans with anti-oxidant and antiinflammatory features, is extracted from the seed of Silybum marianum
and protects against both acute21 and chronic22 ethanol-induced liver
injury.2 In view of its nontoxic nature, easy availability, and wellstudied quality standard, silymarin was used as the positive control in
the present experiment. Blood ethanol concentrations were measured
using gas chromatography as previously described.23,24 Blood alcohol
levels ranged between 66 and 186 mg/dL and were similar among the
groups.
Histological Assay. Liver tissues were fixed in 4% paraformaldehyde
and then embedded in paraffin. Three-micrometer sections were
stained with hematoxylin and eosin (H&E) by standard methods and
then studied by light microscopy. Hepatic lipids were determined by
staining 16 μm thick frozen liver sections with oil red O. Multispectral
imaging was performed using the Nuance Multispectral Imaging
System (Cambridge Research and Instrumentation Inc., Woburn, MA)
as described in our previous study.25 Briefly, spectral optical density
data were automatically acquired from 420 to 720 nm in 10 nm
increments. Spectral unmixing was accomplished using Nuance
software v1.42 with pure spectral libraries of oil red O (slide stained
with only oil red O). For the quantification, three equal-sized fields of
each photograph were randomly chosen for each experiment.
Measurement of Liver TG Content. Hepatic levels of TG in mice
were measured using a commercially available Tissue Triglyceride
Assay kit (Applygen Technologies Inc., Beijing, China). A 20-fold
volume of lysate was added to the 40 mg liver preparations.
Supernatants were collected after centrifugation at 2000 rpm for 5
min and analyzed for TG content according to the manufacturer’s
protocol. The TG concentrations were normalized to protein
concentrations and expressed as mg of TG/g of protein.
Real-Time PCR Assay. Total RNA was extracted from the stored
frozen liver tissues using RNAiso Plus (TaKaRa Bio, Dalian, Liaoning,
China) according to the manufacturer’s protocol. The isolated RNA
was converted into complementary DNA using Advantage RT-forPCR Kit (TaKaRa Bio, Dalian, Liaoning, China). RT-PCR was
8462
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
Table 1. Primers Used for Quantitative PCR
gene
forward primer (5′ to 3′)
reverse primer (5′ to 3′)
CPTIA
Fabp1
Fabp4
PPAR-α
Fasn
SREBP-1
PPAR-γ
ApoB
MTTP
CD68
IL-1β
IL-6
CD163
Arginase
TGF-β
F4/80
MCP-1
TNF-α
GAPDH
CTCAGTGGGAGCGACTCTTCA
AAACTCACCATCACCTATGGAC
GATGTGCGAACTGGACACAG
TATTCGGCTGAAGCTGGTGTAC
TCCTGGGAGGAATGTAAACAGC
GATGTGCGAACTGGACACAG
CGCTGATGCACTGCCTATGA
AAGCACCTCCGAAAGTACGTG
ATACAAGCTCACGTACTCCACT
GTGTCTGATCTTGCTAGGACC
TGGTGTGTGACGTTCCCATT
CCACTTCACAAGTCGGAGGCTTA
TCCACACGTCCAGAACAGTC
ATGGAAGAGACCTTCAGCTAC
GTGTGGAGCAACATGTGGAACTCT
CTTTGGCTATGGGCTTCCAGTC
CCAGCCTACTCATTGGGATCA
ACCCTCACACTCAGATCATCTTC
TGTGTCCGTCGTGGATCTGA
GGCCTCTGTGGTACACGACAA
ATTGAGTTCAGTCACGGACTTT
CATAGGGGGCGTCAAACAG
CTGGCATTTGTTCCGGTTCT
CACAAATTCATTCACTGCAGCC
CATAGGGGGCGTCAAACAG
AGAGGTCCACAGAGCTGATTCC
CTCCAGCTCTACCTTACAGTTGA
TCCACAGTAACACAACGTCCA
TGTGCTTTCTGTGGCTGTAG
CAGCACGAGGCTTTTTTGTTG
CCAGTTTGGTAGCATCCATCATTTC
CCTTGGAAACAGAGACAGGC
GCTGTCTTCCCAAGAGTTGGG
ACGCTGAATCGAAAGCCCTGTA
GCAAGGAGGACAGAGTTTATCGTG
CTTCTGGGCCTGCTGTTCA
TGGTGGTTTGCTACGACGT
TTGCTGTTGAAGTCGCAGGAG
performed on the Thermal Cycler Dice TP800 system (TaKaRa Bio,
Otsu, Shiga Prefecture, Japan) using SYBR Premix Ex TaqII (TaKaRa
Bio, Dalian, Liaoning, China) with 30−40 cycles of denaturation at 95
°C for 5 s, annealing, and extension at 60 °C for 30 s. GAPDH was
used as an internal standard, and the mRNA expression levels of the
target genes were normalized to that of GAPDH. The sequences of
both forward and reverse primers are listed in Table 1.
Western Blotting Assay. Total proteins were extracted from liver
using Cell Lysis Buffer for Western and IP (Beyotime Institute of
Biotechnology, Haimen, Jiangsu, China) containing 1% phenylmethanesulfonyl fluoride (Beyotime Institute of Biotechnology,
Haimen, Jiangsu, China) and 1% phosphatase inhibitor cocktail
(Roche Diagnostics GmbH, Mannheim, Germany). Protein concentrations were determined by the Lowry method.26 Twenty micrograms
of protein was separated by electrophoresis on a 6%, 8%, or 12%
sodium dodecyl sulfate-polyacrylamide gel, and electrophoretically
transferred to polyvinylidene difluoride membranes. The blots were
incubated with specific primary antibodies for 1 h at room
temperature: rabbit anti-AMPKα1/2 antibodies, rabbit anti-phosphop44/42 MAPK, rabbit p44/42 MAPK, rabbit anti-phospho-p38
MAPK, and rabbit p38 MAPK antibodies (1:200 dilution); mouse
anti-SREBP-1 and rabbit anti-phospho-AMPKα1/2 (1:750 dilution);
rabbit anti-acetyl-CoA carboxylase and rabbit anti-phospho-acetyl-CoA
carboxylase antibodies (1:2000 dilution); and mouse anti-GAPDH
antibody (1:10000 dilution) overnight at 4 °C. They were then
incubated with a secondary antibody: rabbit polyclonal antiimmunoglobulin G (IgG), or mouse or rabbit monoclonal anti-IgG
(1:2000 dilution). Antibody binding was detected using an enhanced
chemiluminescence kit with hyper-enhanced chemiluminescence film.
Statistical Analysis. All results were expressed as the mean ±
standard deviation (SD). Statistical comparisons were performed using
one way analysis of variance (ANOVA) with Dunnett’s multiple
comparison test or unpaired Student’s t test. The analyses were
performed with SPSS software (version 16.0, SPSS Inc., Chicago, IL).
A p value less than 0.05 was considered to be statistically significant.
The Western blot and optical histological results were obtained from
at least three independent experiments, and the analysis was carried
out with triplicate samples.
As shown in Figure 3A, acute alcohol gavage significantly
increased serum activities of ALT (37.9 ± 6.0 U/L vs 30.5 ±
4.2 U/L); this elevation was significantly diminished by
treatment with EEGS at a dose of 50 mg/kg. EEGS at a dose
of 25 mg/kg also prevented the increase in ALT activity to a
certain extent but with no significant difference compared with
Group IB. As shown in Figure 3B, acute alcohol gavage
increased serum activities of AST. This elevation was
significantly diminished by treatment with 50 mg/kg EEGS.
EEGS at a dose of 25 mg/kg also slightly prevented the increase
in AST activity, but with no significant difference compared
with Group IB. According to the above ALT and AST results,
the suppressive effect on ethanol-induced injury occurred in a
dose-dependent manner.
To assess the effect of EEGS on hepatic steatosis induced by
acute ethanol intake, hepatic lipid accumulation was qualitatively examined by oil red O staining and quantitatively
determined by a TG quantification kit. After three doses of
ethanol administration via oral gavage, mice from both the
ethanol group and ethanol plus EEGS groups exhibited obvious
accumulation of neutral lipid droplets in their livers compared
with the control group, as illustrated by oil red O staining
(Figure 3D,E). The lipid droplets in the livers of the EEGStreated groups were much fewer than those in the model group.
Quantitative analysis (Figure 3F) confirmed the histological
results by demonstrating that acute ethanol gavage dramatically
increased the hepatic TG content in mice, and this elevation
was significantly diminished by treatment of EEGS at doses of
12.5 and 50 mg/kg. These data clearly indicated that EEGS
could effectively reverse acute ethanol-induced hepatic lipid
accumulation. Although the data from the H&E staining and oil
red O staining (Figure 3C−E) indicated the treatment with
EEGS at dose of 25 mg/kg exerted a protective effect, the data
in Figure 3F showed a tendency without statistical significance.
In view of significant effect of both 12.5 and 50 mg/kg EEGS,
the medium dose of 25 mg/kg was considered to be a turning
point, and EEGS exerted bidirectional regulation in a dosedependent manner, which usually indicates the involvement of
complex active ingredients and multiple pathways. Therefore,
■
RESULTS
EEGS Attenuated Acute Ethanol-Induced Lipid Accumulation in the Liver. ALT is released from the cytoplasm of
impaired hepatocytes. Its serum activity is most commonly used
in clinical practice as a reliable primary indicator for ALD.5,27
8463
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
Figure 3. EEGS attenuated acute ethanol-induced liver lipid accumulation. Animals were randomly divided into six groups: Group IA, control
(normal saline treated); Group IB received EEGS at a dose of 50 mg/kg only; Groups IC−IF were treated with 5 g/kg ethanol orally every 12 h for a
total of three doses; and Groups ID, IE, and IF were treated with EEGS at doses of 12.5, 25, and 50 mg/kg, respectively. The mice were sacrificed 4 h
after the last ethanol treatment. (A) Serum alanine aminotransferase (ALT) activity. (B) Serum aspartate aminotransferase (AST) activity. (C)
Representative photomicrographs of H&E staining of liver sections. Arrow indicates vacuolated hepatocytes. (D) Representative photomicrographs
of oil red O staining of liver sections and (E) densitometric analysis of staining. Red is positive oil red O staining, and blue is hematoxylin
counterstain. Top panel in (D): RGB images. Bottom panels: Unmixed oil red O images from the top panel. (F) Quantitation of hepatic triglyceride
(TG) content. Data are expressed as the mean ± SD, n = 15; ***P < 0.001 vs control; ##P < 0.001 vs model. Scale bar = 100 μm.
the medium dose of 25 mg/kg was selected as an optimal dose
for further study as specified below.
The n-Butanol Fraction Extracted from EEGS Was the
Active Fraction of EEGS. Serum ALT activity and hepatic
lipid accumulation were used as assessment criteria to screen
the active fraction(s) of EEGS. Hepatic lipid accumulation was
evaluated by vacuolation in H&E stained sections and
quantitatively determined by a TG quantification kit.
As shown in Figure 4B, acute alcohol gavage increased serum
ALT activity to a certain extent, and this elevation was
significantly diminished by treatment with the n-butyl alcohol
fraction from EEGS. In addition, the n-butyl alcohol fraction
significantly reduced the ethanol-induced hepatic lipid accumulation as shown in Figure 4A,C. Again, treatment with EEGS
only showed a tendency without statistical significance (Figure
4C), which was consistent with the data in Figure 3F.
Moreover, these data provide a further evidence for the
existence of bidirectional regulation in protective effect of
EEGS against ethanol-induced liver steatosis. Together, the n-
butanol fraction was determined to be the most active fraction
of EEGS and was selected for further fractionation by the
polyamide glass column.
Fraction 2 Was the Active Fraction of the n-Butyl
Alcohol Extract. As shown in Figure 5B, acute alcohol gavage
significantly increased serum ALT activity, and this elevation
was diminished by treatment of fraction 1, 2, or 3 to a certain
extent. In addition, fractions 1 and 2 significantly reduced the
ethanol-induced hepatic lipid accumulation as shown in Figure
5A,C. Thus, fractions 1 and 2 were determined to be the active
fractions of the n-butyl alcohol extract according to the
screening criteria mentioned above. Compared with fraction 1,
fraction 2 had fewer compounds (Figure 2) and required a
lower dose to achieve similar activity. Thus, fraction 2 was
selected for further study.
EEGS, Fraction 2, and Chlorogenic Acid Attenuated
Chronic Ethanol-Induced Hepatic Lipid Accumulation.
As shown in Figure 6D, chronic alcohol treatment increased
serum ALT activity, and this elevation was significantly
8464
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
Figure 4. The n-butanol fraction was the active fraction of EEGS. Animals were randomly divided into seven groups: Group IIA, control (normal
saline treated); Group IIB was treated with 5 g/kg ethanol only; Groups IIC, IID, IIE, IIF, and IIG received oral administration with 5 g/kg ethanol
plus EEGS (25 mg/kg), petroleum ether fraction (1.35 mg/kg), ethyl acetate fraction (3.55 mg/kg), n-butanol fraction (3.33 mg/kg), or water
fraction (16.75 mg/kg), respectively, every 12 h for a total of three doses. (A) Representative photomicrographs of H&E staining of liver sections.
The arrow indicates vacuolated hepatocytes. (B) Serum alanine aminotransferase (ALT) activity. (C) Quantitation of hepatic triglyceride (TG)
content. Data are expressed as the mean ± SD, n = 12; **P < 0.01 vs control; #P < 0.05 and ##P < 0.01 vs model. Scale bar = 100 μm.
Figure 5. Fraction 2 was the active fraction of the n-butyl alcohol extract. Animals were randomly divided into six groups with 6−9 mice per group:
Group IIIA, control (normal saline treated); Group IIIB, treated with 5 g/kg ethanol only; Groups IIIC, IIID, IIIE, and IIIF were orally treated with
5 g/kg ethanol plus the n-butanol fraction (3.33 mg/kg), fraction 1 (3.10 mg/kg), fraction 2 (0.22 mg/kg), or fraction 3 (0.03 mg/kg), respectively,
every 12 h for a total of three doses. (A) Representative photomicrographs of H&E staining of liver sections. The arrow indicates vacuolated
hepatocytes. (B) Serum alanine aminotransferase (ALT) activity. (C) Quantitation of hepatic triglyceride (TG) content. Data are expressed as the
mean ± SD, n = 6−9; **P < 0.01 vs control; #P < 0.05 and ##P < 0.01 vs model. Scale bar = 100 μm.
2, chlorogenic acid, and silymarin, attenuated chronic ethanolinduced liver lipid accumulation. EEGS and fraction 2 were
more potent than chlorogenic acid and silymarin. Fraction 2
had similar effects as EEGS but was purer and more powerful
(10 mg/kg/day vs 75 mg/kg/day).
EEGS Alleviated the Ethanol-Induced Expression of
Genes Involved in Lipid Metabolism and Inflammation
diminished by treatment with fraction 2. EEGS, chlorogenic
acid, and silymarin also prevented the increase in ALT activity
to a certain extent, but were not significantly different from
Group IVB. Chronic ethanol-induced vacuolation in H&E
staining and red staining in the oil red O staining of liver
sections were far more serious than that of the acute sections
(Figure 6A−C). All of the treatments, including EEGS, fraction
8465
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
Figure 6. EEGS, fraction 2, and chlorogenic acid attenuated chronic ethanol-induced lipid accumulation in liver. Mice were divided into eight groups
with 6−10 mice per group: Group IVA received a standard solid diet and water ad libitum; Group IVB, control (received an isocaloric maltodextrincontaining diet in a pair-fed fashion); Group IVC received an isocaloric maltodextrin-containing diet and was orally treated with EEGS (75 mg/kg/
day) for the last 2 weeks; Groups IVD−IVH were treated with an ethanol-containing diet; Groups IVE, IVF, IVG, and IVH were orally treated with
EEGS (75 mg/kg/day), fraction 2 (10 mg/kg/day), chlorogenic acid (10 mg/kg/day), or silymarin (100 mg/kg/day), respectively, for the last 2
weeks. Either the ethanol-containing diet or the isocaloric maltodextrin (control) diet was fed to the animals for 8 weeks. (A) Representative
photomicrographs of oil red O staining of liver sections and (C) densitometric analysis of staining. Red is positive oil red O staining, and blue is
hematoxylin counterstain. Top panels in (A): RGB images. Bottom panels: unmixed oil red O images of the up panel. (B) Representative
photomicrographs of H&E staining of liver sections. Arrow indicates vacuolated hepatocytes. (D) Serum alanine aminotransferase (ALT) activity.
Data are expressed as the mean ± SD, n = 6−10; ***P < 0.001 vs pair-fed control; #P < 0.05 and ###P < 0.001 vs model. Scale bar for (A) = 100 μm.
Scale bar for (B) = 50 μm.
in an Acute Model. Ethanol significantly induced the
expression of fatty acid-uptake genes, including Fabp1 and
Fabp4, and fatty acid-synthesis genes, including Fasn and
SREBP-1, in the liver (Figure 7A). Intriguingly, EEGS
treatment reduced the expression levels of Fabp1, Fabp4,
Fasn, and SREBP-1. The genes involved in fatty acid βoxidation (CPT1A) and TG-secretion (MTTP) were also
enhanced by ethanol exposure. However, EEGS significantly
reduced the mRNA expression of CPT1A and MTTP.
Moreover, ethanol did not show any significant effects on
PPAR-α, PPAR-γ, or ApoB mRNA expression when compared
to normal controls. PPAR-γ and ApoB mRNA expressions were
upregulated by EEGS in the presence or absence of ethanol.
We also analyzed inflammation markers including CD68, IL1β, IL-6, CD163, Arginase, TGF-β, F4/80, MCP-1, and TNF-α
(Figure 7B). We found that ethanol exposure elevated the
expression of almost all of the above genes except for F4/80
and TNF-α. However, EEGS treatment reversed these ethanolinduced mRNA changes. Even F4/80 and TNF-α mRNA
expressions were reduced by EEGS treatment. These data
indicated that EEGS might relieve ethanol-induced liver
damage by regulating of lipid metabolism and reducing
inflammatory responses in the liver.
Administration of EEGS, Fraction 2, or Chlorogenic
Acid Alleviated Hepatic Steatosis through MAPK/
SREBP-1c-Dependent and -Independent Pathways.
Premature SREBP-1c (pSREBP-1c) is cleaved and activated
in response to ethanol feeding, which is closely associated with
an increased expression of hepatic lipogenic genes and the
accumulation of TG in the liver.28 To investigate the possible
underlying mechanisms of EEGS-mediated hepatic improve-
ments, we measured the changes of SREBP-1c and its upstream
regulators (MAPK and AMPK) and downstream effector
(ACC) in the chronic model. There are two obvious bands of
SREBP-1c in Figure 8A, the top one is so-called pSREBP-1c,
and the bottom one is mSREBP-1c. The pSREBP-1c band in
the present study represented both normal and phosphorylated
form of premature SREBP-1c. Both the premature and mature
forms of SREBP-1c were significantly elevated by chronic
ethanol administration. After treatment with EEGS or fraction
2, the influence of ethanol on mSREBP-1c was abolished.
Consequently, we measured the changes of key MAPK
members, which suppress SREBP-1c activity by phosphorylation.15,29 The administration of ethanol significantly
decreased the phosphorylation of both p38 MAPK and p44/
42 MAPK (Figure 8B). After treatment with EEGS or fraction
2, the influence of ethanol on the phosphorylation of both p38
MAPK and p44/42 MAPK proteins was abolished. In addition,
ethanol treatments decreased the total expression of p38
MAPK but not p44/42 MAPK.
Moreover, the effect of ethanol on SREBP-regulated
promoter activation was mediated, at least in part, through
inhibition of AMPK.30 However, neither the ethanol nor the
EEGS treatments demonstrated any effects on the expression of
the total or phosphorylated form of AMPK (Figure 8C). These
data indicated that AMPK was not involved in the SREBP-1c
pathway in the present study.
The first committed step in fatty acid biosynthesis is carried
out by ACC.10 The regulation of ACC occurs at multiple levels.
The first level is regulated by phosphorylation/dephosphorylation, and AMPK phosphorylates and inhibits ACC
enzymatic activity.10,31 The second level is regulated by
8466
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
Figure 7. Hepatic expression levels of lipid metabolism-related and inflammation marker genes in mice. Group IA, control (normal saline treated);
Group IB received EEGS at a dose of 50 mg/kg only; Groups IC−IF were treated with ethanol orally every 12 h for a total of three doses; Groups
ID, IE, and IF were treated with EEGS at a dose of 12.5, 25, and 50 mg/kg, respectively. The mice were sacrificed 4 h after the last ethanol treatment.
The mRNA expression of lipid metabolism-related genes (A) and the mRNA expression of inflammation markers (B) were evaluated by quantitative
real-time PCR analysis and normalized to the housekeeping gene GAPDH. Data are expressed as the mean ± SD of 15 mice; *P < 0.05 and **P <
0.01 vs control; #P < 0.05, ##P < 0.01, and ###P < 0.001 vs model.
transcription, and SREBP-1c increases ACC expression.11,12 In
the present study, total ACC and its phosphorylated form were
evaluated during chronic ethanol administration (Figure 8C).
However, the ratio between the phosphorylated and total ACC
forms was progressively decreased by chronic ethanol
administration, and after treatment with EEGS or fraction 2,
the influence of ethanol on the ratio was abolished.
The administration of EEGS and fraction 2 abolished the
influence of ethanol on SREBP-1c activation, its upstream
regulators (phosphorylation of both p38 MAPK and p44/42
MAPK) and downstream effectors, such as ACC. Thus, the
MAPK/SREBP-1c-dependent pathway participated in the
protective effect of EEGS and fraction 2 against hepatic
steatosis.
As one of the major active ingredients of fraction 2,
chlorogenic acid canceled the negative effect of ethanol on
ACC expression and activation. However, unlike fraction 2,
chlorogenic acid did not change the MAPK or SREBP-1c
activity in the current study. This result indicated that
chlorogenic acid inhibited ACC in a MAPK/SREBP-1cindependent manner and that there are other ingredient(s) in
fraction 2 that impact the MAPK/SREBP-1c pathway.
protective effects against ethanol-induced liver injury. A
previous review has collected 34 herbal medicines and/or
active compounds specifically used for that purpose.27 As
summarized by Ding et al. in that review, the underlying
mechanisms and active ingredients have not been sufficiently
elucidated. In the present study, the capability of EEGS and its
fractions to protect against ethanol-induced liver injury were
investigated. Emphasis was placed upon the underlying
molecular mechanisms and the active ingredient and its
contributions to the protective effect.
The ability to prevent increased serum ALT activity and
hepatic lipid accumulation in acute ethanol-induced liver
steatosis was used as an assessment criterion to screen the
active fraction(s) from EEGS. The n-butyl alcohol extract was
the active fraction of EEGS and was selected for further
fractionation by the polyamide glass column. The 60% ethanoleluted fraction that contained 13.6% chlorogenic acid was the
most active fraction, and its effects were further evaluated in the
chronic model.
Data in the chronic model demonstrated that treatment with
the n-butyl alcohol extract, 60% ethanol-eluted fraction, or
chlorogenic acid protected against ethanol-induced liver
steatosis, indicating that chlorogenic acid, at least in part,
contributed to the beneficial effect of G. procumbens on
alcoholic fatty liver. Compared with the doses of well-known
commercial products, such as Panax notoginseng saponins
■
DISCUSSION
Over the past decade, dozens of herbs and individual
compounds isolated from herbs have been shown to possess
8467
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
Figure 8. Effect of EEGS, fraction 2, or chlorogenic acid on the protein expression of the MAPK/SREBP-1c/ACC pathway. Mice were divided into
eight groups with 6−10 mice per group: Group IVA received a standard solid diet and water ad libitum; Group IVB, control (received an isocaloric
maltodextrin-containing diet in a pair-fed fashion); Group IVC received an isocaloric maltodextrin-containing diet and was orally treated with EEGS
(75 mg/kg/day) for the last 2 weeks; Groups IVD−IVH were treated with an ethanol-containing diet; Groups IVE, IVF, IVG, and IVH were orally
treated with EEGS (75 mg/kg/day), fraction 2 (10 mg/kg/day), chlorogenic acid (10 mg/kg/day), or silymarin (100 mg/kg/day), respectively, for
the last 2 weeks. Either the ethanol-containing diet or the isocaloric maltose-dextrin (control) diet was fed to the animals for 8 weeks. Western blot
analysis using a specific antibody was used to examine the expression of the proteins in the mouse liver homogenates. Bands densities were
determined using ImageJ, normalized to GAPDH, and expressed as a percentage of the standard solid diet control. Representative photographs of
Western blots of SREBP-1c (A), p44/42 MAPK and p38 MAPK (B), and ACC and AMPK (C), with quantitative analysis of blots given below each
set of photographs, where each bar represents the mean ± SD of the results obtained from three mice. *P < 0.05, **P < 0.01, and ***P < 0.001 vs
pair-fed control; #P < 0.05, ##P < 0.01, and ###P < 0.001 vs model.
(100−300 mg/kg/day),5 silymarin (100−200 mg/kg/day),21 or
most of the above-mentioned herbal medicines, the dose of
fraction 2 and chlorogenic acid used in the present study was
much lower, just 10 mg/kg/day. In addition, in the present
study, fraction 2 showed better potential than chlorogenic acid
and silymarin to prevent ethanol-induced liver steatosis.
The mechanism by which ethanol causes fatty liver and liver
injury is complicated. Anti-oxidative stress, anti-inflammation,
and lipid metabolism regulation are three major mechanisms
that are involved in the protective effect of herbal medicines
against ALD.1,27 Alcoholic fatty liver is the earliest and most
common response of the liver to alcohol and may be a
precursor of more severe forms of liver injury. SREBP-1c is a
master regulator of lipid homeostasis, and SREBP-1 knockout
mice are completely protected from ALD, indicating a causal
involvement of SREBP-1 in ALD.16 SREBP-1c positively
8468
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
In summary, our data show that G. procumbens protected
against ethanol-induced liver steatosis, possibly through
ameliorating hepatic lipid accumulation by modulating lipid
metabolism-related genes through MAPK/SREBP-1c-dependent and -independent pathways. Our findings also suggest that
G. procumbens and one of its active ingredients, chlorogenic
acid, could potentially be developed as effective agents for acute
or chronic ethanol-induced liver injury.
regulates the expression of genes encoding lipogenic enzymes,
including ACC and FAS.11,12 The most important function of
ACC is to provide the malonyl-CoA substrate for the synthesis
of fatty acids, and the main function of FAS is to catalyze the
synthesis of palmitate. The present study indicated that ethanol
induced expression levels of ACC and FAS, which is in
accordance with a previous report.28
The effect of ethanol on SREBP-regulated promoter
activation was mediated, at least in part, through inhibition of
AMPK and MAPK.30 In several studies, AMPK phosphorylation is increased,32,33 whereas in other studies, AMPK
phosphorylation is decreased.34,35 Ethanol (amount and feeding
duration) and fat (type and dose) used in these studies might
contribute to the discrepancies.36 Unlike AMPK, the changes of
MAPK were in accordance with SREBP-1c, indicating a
possible link between MAPK and SREBP-1c and its downstream genes in the present study. The administration of EEGS
and fraction 2 abolished the influence of ethanol on SREBP-1c
activation and its upstream regulators and downstream
effectors. Thus, the MAPK/SREBP-1c-dependent pathway
contributes to the mechanism of the beneficial effect of
EEGS and fraction 2 on alcoholic fatty liver.
As one of the major active ingredients of fraction 2,
chlorogenic acid was chosen to further investigate the
underlying mechanism. Chlorogenic acid has many biological
properties, including anti-bacterial, anti-oxidant, and anticarcinogenic activities. Recently, the roles and applications of
chlorogenic acid in relation to hepatic steatosis have been
highlighted.37,38 Chlorogenic acid inhibits the MAPK pathway39,40 to protect drug-induced liver injury while activating
AMPK to improve lipid metabolism in non-alcoholic fatty liver
disease.37 However, unlike fraction 2, chlorogenic acid did not
change MAPK or SREBP-1c activity in the current study, which
indicated that chlorogenic acid inhibited ACC in a MAPK/
SREBP-1c-independent pathway and that there was an
addtional ingredient(s) in fraction 2 that impacted the
MAPK/SREBP-1c pathway. In addition to AMPK, protein
kinase A also has the ability to phosphorylate ACC. Other
kinases are also suspected to be important in this regulation,
because many other possible phosphorylation sites exist on
ACC.41 Both MAPK/SREBP-1c-dependent and -independent
pathways contributed to the regulation of G. procumbens on
lipid metabolism-related genes, which exerted subsequent
protective effects against ethanol-induced hepatic lipid
accumulation.
ALD is a complex process. In addition to lipid accumulation,
ethanol-induced liver injury is highly linked to inflammatory
and oxidative stress.1 Inflammation and oxidative stress are two
etiological factors that have been suggested to play important
roles in the development of ethanol-induced liver injury.
Silymarin, the positive control in the present study, is a good
example of an agent that protects against alcohol-induced liver
disease via anti-inflammatory and anti-oxidative features.21
Increased pro-inflammatory cytokine levels have been well
documented in ALD.42 EEGS treatment alleviated the ethanolinduced upregulation of cytokine levels, which should have
resulted in a corresponding attenuation of ethanol-induced liver
injury. In addition, because chlorogenic acid is an anti-oxidant
and ethanol treatment enhances oxidative stress in the liver,43
we could assume that the reduction of oxidative stress may also
partially contribute to the prevention of liver injury in the
present study, but more precise experiments are needed to
further confirm that hypothesis.
■
AUTHOR INFORMATION
Corresponding Authors
*(H.-B.T.) Tel/fax: +86 27 6784 2332. E-mail: hbtang2006@
mail.scuec.edu.cn.
*(H.-C.S.) Tel/fax: +86 10 8401 2510. E-mail: shanghongcai@
126.com.
Author Contributions
#
X.-J.L. and Y.-M.M. contributed equally to this work.
Author Contributions
Y.-M.M., T.-T.L., M.-T.Z., Y.-L.Y., and X.-J.L. carried out the
experiments. X.-J.L., H.-B.T., and H.-C.S. proposed and
designed the research, performed the data analysis, and wrote
the paper. Y.-S.L. and W.K.Z. assisted in the data analysis and
interpretation.
Funding
This study was supported by grants from the National Natural
Science Foundation of China (81403188 and 81373842), the
Modernization Engineering Technology Research Center of
Ethnic Minority Medicine of Hubei province (2015ZY002),
and the Natural Science Foundation of China Hubei
(2013CFB451).
Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS USED
EEGS, ethanol extract from Gynura procumbens stems; MAPK,
mitogen-activated protein kinase; SREBP-1c, sterol regulatory
element binding protein 1c; ALT, alanine transaminase; AST,
aspartate transaminase; ALD, alcoholic liver disease; AMPK, 5′adenosine monophosphate-activated protein kinase; TG,
triglyceride; H&E, hematoxylin and eosin; RT-PCR, real-time
polymerase chain reaction; IgG, immunoglobulin G; ACC,
acetyl-coenzyme A carboxylase; CPT1A, carnitine palmitoyltransferase 1A; Fabp1, fatty acid binding protein 1; Fabp4, fatty
acid binding protein 4; PPAR-α, peroxisome proliferatoractivated receptor-α; Fas, fatty acid synthase; PPAR-γ,
peroxisome proliferator-activated receptor-γ; ApoB, apolipoprotein B; MTTP, microsomal triglyceride transfer protein;
CD68, cluster of differentiation 68; IL-1β, interleukin-1β; IL-6,
interleukin-6; CD163, cluster of differentiation 163; TGF-β,
transforming growth factor-β; F4/80, EGF-like modulecontaining mucin-like hormone receptor-like 1; MCP-1,
monocyte chemotactic protein 1; TNF-α, tumor necrosis
factor-α
■
REFERENCES
(1) Louvet, A.; Mathurin, P. Alcoholic liver disease: mechanisms of
injury and targeted treatment. Nat. Rev. Gastroenterol. Hepatol. 2015,
12, 231−42.
(2) Testino, G.; Leone, S.; Ansaldi, F.; Borro, P. Silymarin and Sadenosyl-L-methionine (SAMe): two promising pharmacological
agents in case of chronic alcoholic hepathopathy. A review and a
point of view. Minerva Gastroenterol. Dietol. 2013, 59, 341−56.
8469
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
(3) Xiao, S. J.; Fu, G. J.; Lv, Y. L.; Zhong, X. N.; Wang, R. H.
Prevalence and risk factors of fatty liver disease in young and middleaged population: one center study in Southwestern China. J.
Gastroenterol. Hepatol. 2014, 29, 358−64.
(4) O’Shea, R. S.; Dasarathy, S.; McCullough, A. J. Alcoholic liver
disease. Am. J. Gastroenterol. 2010, 105, 14−32 (quiz 33).
(5) Ding, R. B.; Tian, K.; Cao, Y. W.; Bao, J. L.; Wang, M.; He, C.;
Hu, Y.; Su, H.; Wan, J. B. Protective effect of panax notoginseng
saponins on acute ethanol-induced liver injury is associated with
ameliorating hepatic lipid accumulation and reducing ethanolmediated oxidative stress. J. Agric. Food Chem. 2015, 63, 2413−22.
(6) Algariri, K.; Meng, K. Y.; Atangwho, I. J.; Asmawi, M. Z.; Sadikun,
A.; Murugaiyah, V.; Ismail, N. Hypoglycemic and anti-hyperglycemic
study of Gynura procumbens leaf extracts. Asian Pac. J. Trop. Biomed.
2013, 3, 358−66.
(7) Nisa, F.; Hermawan, A.; Murwanti, R.; Meiyanto, E.
Antiproliferative effect of gynura procumbens (lour.) Merr. Leaves
etanolic extract on 7,12-dimethylbenz(a)antracene induced male rat
liver. Adv. Pharm. Bull. 2012, 2, 99−106.
(8) Shwter, A. N.; Abdullah, N. A.; Alshawsh, M. A.; Alsalahi, A.;
Hajrezaei, M.; Almaqrami, A. A.; Salem, S. D.; Abdulla, M. A.
Chemoprevention of colonic aberrant crypt foci by Gynura
procumbens in rats. J. Ethnopharmacol. 2014, 151, 1194−201.
(9) Mahmood, A. A.; Mariod, A. A.; Al-Bayaty, F.; Abdel-Wahab, S. I.
Anti-ulcerogenic activity of Gynura procumbens leaf extract against
experimentally-induced gastric lesions in rats. J. Med. Plant Res. 2010,
4, 685−91.
(10) Kim, C. W.; Moon, Y. A.; Park, S. W.; Cheng, D.; Kwon, H. J.;
Horton, J. D. Induced polymerization of mammalian acetyl-CoA
carboxylase by MIG12 provides a tertiary level of regulation of fatty
acid synthesis. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 9626−31.
(11) Shimano, H. Sterol regulatory element-binding proteins
(SREBPs): transcriptional regulators of lipid synthetic genes. Prog.
Lipid Res. 2001, 40, 439−52.
(12) Horton, J. D.; Goldstein, J. L.; Brown, M. S. SREBPs: activators
of the complete program of cholesterol and fatty acid synthesis in the
liver. J. Clin. Invest. 2002, 109, 1125−31.
(13) Li, Y.; Xu, S. Q.; Mihaylova, M. M.; Zheng, B.; Hou, X. Y.; Jiang,
B. B.; Park, O.; Luo, Z. J.; Lefai, E.; Shyy, J. Y. J.; Gao, B.; Wierzbicki,
M.; Verbeuren, T. J.; Shaw, R. J.; Cohen, R. A.; Zang, M. W. AMPK
Phosphorylates and Inhibits SREBP Activity to Attenuate Hepatic
Steatosis and Atherosclerosis in Diet-Induced Insulin-Resistant Mice.
Cell Metab. 2011, 13, 376−388.
(14) Hong-Brown, L. Q.; Brown, C. R.; Huber, D. S.; Lang, C. H.
Alcohol and indinavir adversely affect protein synthesis and
phosphorylation of MAPK and mTOR signaling pathways in C2C12
myocytes. Alcohol.: Clin. Exp. Res. 2006, 30, 1297−307.
(15) Knebel, B.; Lehr, S.; Hartwig, S.; Haas, J.; Kaber, G.; Dicken, H.
D.; Susanto, F.; Bohne, L.; Jacob, S.; Nitzgen, U.; Passlack, W.; MullerWieland, D.; Kotzka, J. Phosphorylation of sterol regulatory elementbinding protein (SREBP)-1c by p38 kinases, ERK and JNK influences
lipid metabolism and the secretome of human liver cell line HepG2.
Arch. Physiol. Biochem. 2014, 120, 216−27.
(16) Ji, C.; Chan, C.; Kaplowitz, N. Predominant role of sterol
response element binding proteins (SREBP) lipogenic pathways in
hepatic steatosis in the murine intragastric ethanol feeding model. J.
Hepatol. 2006, 45, 717−24.
(17) Carson, E. J.; Pruett, S. B. Development and characterization of
a binge drinking model in mice for evaluation of the immunological
effects of ethanol. Alcohol.: Clin. Exp. Res. 1996, 20, 132−8.
(18) Massey, V. L.; Arteel, G. E. Acute alcohol-induced liver injury.
Front. Physiol. 2012, 3, 193.
(19) Kanuri, G.; Weber, S.; Volynets, V.; Spruss, A.; Bischoff, S. C.;
Bergheim, I. Cinnamon extract protects against acute alcohol-induced
liver steatosis in mice. J. Nutr. 2009, 139, 482−7.
(20) Lieber, C. S.; DeCarli, L. M.; Sorrell, M. F. Experimental
methods of ethanol administration. Hepatology 1989, 10, 501−10.
(21) Song, Z.; Deaciuc, I.; Song, M.; Lee, D. Y.; Liu, Y.; Ji, X.;
McClain, C. Silymarin protects against acute ethanol-induced
hepatotoxicity in mice. Alcohol.: Clin. Exp. Res. 2006, 30, 407−13.
(22) Chou, C. H.; Chen, Y. C.; Hsu, M. C.; Tsai, W. L.; Chang, C. Y.;
Chiu, C. H. Effect Of Silymarin on Lipid And Alcohol Metabolism In
Mice Following Long-Term Alcohol Consumption. J. Food Biochem.
2012, 36, 369−377.
(23) Zuba, D.; Parczewski, A.; Reichenbacher, M. Optimization of
solid-phase microextraction conditions for gas chromatographic
determination of ethanol and other volatile compounds in blood. J.
Chromatogr. B: Anal. Technol. Biomed. Life Sci. 2002, 773, 75−82.
(24) Nanji, A. A.; Jokelainen, K.; Lau, G. K. K.; Rahemtulla, A.;
Tipoe, G. L.; Polavarapu, R.; Lalani, E. N. Arginine reverses ethanolinduced inflammatory and fibrotic changes in liver despite continued
ethanol administration. J. Pharmacol. Exp. Ther. 2001, 299, 832−839.
(25) Li, Y. S.; Wang, J. X.; Jia, M. M.; Liu, M.; Li, X. J.; Tang, H. B.
Dragon’s blood inhibits chronic inflammatory and neuropathic pain
responses by blocking the synthesis and release of substance P in rats.
J. Pharmacol. Sci. 2012, 118, 43−54.
(26) Lowry, O. H.; Rosebrough, N. J.; Farr, A. L.; Randall, R. J.
Protein measurement with the Folin phenol reagent. J. Biol. Chem.
1951, 193, 265−75.
(27) Ding, R. B.; Tian, K.; Huang, L. L.; He, C. W.; Jiang, Y.; Wang,
Y. T.; Wan, J. B. Herbal medicines for the prevention of alcoholic liver
disease: a review. J. Ethnopharmacol. 2012, 144, 457−65.
(28) You, M.; Fischer, M.; Deeg, M. A.; Crabb, D. W. Ethanol
induces fatty acid synthesis pathways by activation of sterol regulatory
element-binding protein (SREBP). J. Biol. Chem. 2002, 277, 29342−7.
(29) Xiao, J.; Wang, J.; Xing, F.; Han, T.; Jiao, R.; Liong, E. C.; Fung,
M. L.; So, K. F.; Tipoe, G. L. Zeaxanthin dipalmitate therapeutically
improves hepatic functions in an alcoholic fatty liver disease model
through modulating MAPK pathway. PLoS One 2014, 9, e95214.
(30) You, M.; Crabb, D. W. Molecular mechanisms of alcoholic fatty
liver: role of sterol regulatory element-binding proteins. Alcohol 2004,
34, 39−43.
(31) Kahn, B. B.; Alquier, T.; Carling, D.; Hardie, D. G. AMPactivated protein kinase: ancient energy gauge provides clues to
modern understanding of metabolism. Cell Metab. 2005, 1, 15−25.
(32) Shearn, C. T.; Smathers, R. L.; Jiang, H.; Orlicky, D. J.; Maclean,
K. N.; Petersen, D. R. Increased dietary fat contributes to
dysregulation of the LKB1/AMPK pathway and increased damage in
a mouse model of early-stage ethanol-mediated steatosis. J. Nutr.
Biochem. 2013, 24, 1436−45.
(33) Everitt, H.; Hu, M.; Ajmo, J. M.; Rogers, C. Q.; Liang, X.;
Zhang, R.; Yin, H.; Choi, A.; Bennett, E. S.; You, M. Ethanol
administration exacerbates the abnormalities in hepatic lipid oxidation
in genetically obese mice. Am. J. Physiol. Gastrointest. Liver Physiol.
2013, 304, G38−47.
(34) Shen, Z.; Liang, X.; Rogers, C. Q.; Rideout, D.; You, M.
Involvement of adiponectin-SIRT1-AMPK signaling in the protective
action of rosiglitazone against alcoholic fatty liver in mice. Am. J.
Physiol. Gastrointest. Liver Physiol. 2010, 298, G364−74.
(35) Garcia-Villafranca, J.; Guillen, A.; Castro, J. Ethanol
consumption impairs regulation of fatty acid metabolism by decreasing
the activity of AMP-activated protein kinase in rat liver. Biochimie
2008, 90, 460−6.
(36) Shearn, C. T.; Backos, D. S.; Orlicky, D. J.; SmathersMcCullough, R. L.; Petersen, D. R. Identification of 5′ AMP-activated
kinase as a target of reactive aldehydes during chronic ingestion of high
concentrations of ethanol. J. Biol. Chem. 2014, 289, 15449−62.
(37) Meng, S.; Cao, J.; Feng, Q.; Peng, J.; Hu, Y. Roles of
Chlorogenic Acid on regulating glucose and lipids metabolism: a
review. Evid. Based Complement. Alternat. Med. 2013, 2013, 801457.
(38) Mubarak, A.; Hodgson, J. M.; Considine, M. J.; Croft, K. D.;
Matthews, V. B. Correction to Supplementation of a high-fat diet with
chlorogenic acid is associated with insulin resistance and hepatic lipid
accumulation in mice. J. Agric. Food Chem. 2015, 63, 1882.
(39) Feng, R. T. The chemopreventive activity of chlorogenic acid is
mediated by inhibiting AP-1-MAPKs pathway and inducing phase II
8470
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471
Article
Journal of Agricultural and Food Chemistry
detoxifying enzyme through stimulating Nrf2 signaling. Cancer Epidem.
Biomar. 2004, 13, 1880s.
(40) Ji, L.; Jiang, P.; Lu, B.; Sheng, Y.; Wang, X.; Wang, Z.
Chlorogenic acid, a dietary polyphenol, protects acetaminopheninduced liver injury and its mechanism. J. Nutr. Biochem. 2013, 24,
1911−9.
(41) Brownsey, R. W.; Boone, A. N.; Elliott, J. E.; Kulpa, J. E.; Lee,
W. M. Regulation of acetyl-CoA carboxylase. Biochem. Soc. Trans.
2006, 34, 223−7.
(42) Kawaratani, H.; Tsujimoto, T.; Douhara, A.; Takaya, H.; Moriya,
K.; Namisaki, T.; Noguchi, R.; Yoshiji, H.; Fujimoto, M.; Fukui, H.
The effect of inflammatory cytokines in alcoholic liver disease.
Mediators Inflammation 2013, 2013, 495156.
(43) Wu, D.; Cederbaum, A. I. Oxidative stress and alcoholic liver
disease. Semin. Liver Dis. 2009, 29, 141−54.
8471
DOI: 10.1021/acs.jafc.5b03504
J. Agric. Food Chem. 2015, 63, 8460−8471