Staphylococcus aureus Protein A (spa) Typing
Transcription
Staphylococcus aureus Protein A (spa) Typing
Staphylococcus aureus Protein A (spa) Typing Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman [email protected] +45 35 88 63 47 Typing method for S. aureus • Gold standard - Phage typing and PFGE – Phage and Band based – Labourious: 2-6 days – Analysis is subjective and can give non-typable results – Communication of data is problematic • DNA sequence-based methods – Standardized protocol: 1-2 days – Analysis is unambiguous – Sequence data can easily be transferred – Eg. MLST, coa, spa successfully used for S. aureus • MLST is not suitable for routine surveillance of MRSA – High cost and access to a high-throughput DNA sequencing facility The discriminative power of PFGE is generally higher than most DNA-based methods Protein A (spa) in S. aureus • • 2150bp Surface protein – Virulence factor • Binds to IgG via Fc-binding domain – Reduce phagocytosis – X-region-variable number of repeats – Highly polymorphic » Deletion and duplication of repeats, and point mutations What is a repeat? • • • Multiple copies of the same nucleotide sequence – Tandem vs. interspersed – Tandem: -------------------- HENRIKHeNRIKHEnRIKHeNRIK--------------– Interspersed Region X spontaneous point mutations, loss and/or gain of repeats Variations in the number of repeats DNA polymerase slippage and various recombination events Variations in individual repeats are a result of mutagenesis 298 repeats known today (April 19. 2009) 21-30nt (encode triplet codon) Repeats are assigned an numerical code (in Ridom/Bionummerics) spa type is deduced from the sequence and order of specific repeats Spa-typing of S. aureus PCR and sequencing RCAMCAAAA TAYATGTCGT SL r04 r20 r17 r20 r34 SR 24 nt repeats (21 to 30 nt) GAGGAAGACAATAACAAGCCTGGT AAAGAAGACAACAACAAACCTGGC r04r20r17r20r34 = t2906 r04 r20 The SPA principle How to translate sequence into SPA type? • Manually (NOT recomended) – Identify SL and SR – Identify repeats – Compare to list of all known repeat sequences • Computer-based assignment – At least two software solutions exists (Ridom and Bionumerics) – Both are quiet expensive (3000+ Euros), but you might already have Bionumerics installed. Then the spa module is a free add-on. • Or you might find a collaborating institute or hospital who has one of these programs installed. Otherwise contact your CRL (me) for help. Bionumerics v4.61 Examples of related SPA types Genetic events t034 r08r16r02r25r02r25r34 r24r25 t571 r08r16r02r25r02r25r34 r25 t011 r08r16r02r25 r34 r24r25 t108 r08r16r02r25 r24r25 t1255 r08r16 r34 r24r25 t1793 r08r16r02r25r02r25r34r24r24r25 t2876 r08r16r02r25r02r25r 24r25 t1333 r15r12r16r34 t899 r07r16 1 2 1 2 1 1 r02r25r17r24 >8 r23r02r34 >5 M L S T Examples of pittfalls in relating SPA types t528 r04 6,72,12,43,49,67,59 ST151 CC151 t524 r04r17 18,1,1,1,1,5,3 ST71 t529 r04r34 6,72,12,43,49,67,59 ST151 CC151 CC97 SPA typing vs MLST typing • SPA typing has in general higher discriminative power than MLST and lower discriminative power than PFGE! - This means that many SPA types can belong to the same MLST type (also called Sequence Type – ST). - Furthermore, closely related Sequence Types can be organized into so-called Clonal Complexes (CC’s). t011 t034 t108 t571 t1255 t1793 t2876 ST398 ST804 ST1067 ST752 ST1232 ST621 CC398 SPA typing vs MLST typing • In far the most cases, a SPA type will always belong to a certain Sequence Type. • However, a few deviations from this rule exists! The SPA type t899 has been shown to belong to both ST9 and ST398. QUESTIONS??? AFTER THE BREAK The magical world of MLST typing…. Multi Locus Sequence Typing (MLST) Senior scientist Henrik Hasman, National Food Institute-DTU Henrik Hasman [email protected] +45 35 88 63 47 CC398 S. aureus isolates can in most cases be allocated into Clonal Complexes based on their Sequence type (at least human isolates…). MLST….S(equence) T(ype)….C(lonal) C(omplex)???? • MLST is performed to obtain the Sequence Type (ST) • The ST can often be associated with certain CC’s • If not, they are called “Singletons” • S. aureus has 10-15 major (human) CC’s • Each CC has a ST as founder and many ST’s as members • MLST is performed by sequencing 7 “household genes” • These are selected based on their “molecular clock” • MLST can not substitute PFGE as they have different molecular clocks. Genes which are sequenced in the MLST • arc (Carbamate kinase) • aro (Shikimate dehydrogenase) • glp (Glycerol kinase) • gmk (Guanylate kinase) • pta (Phosphate acetyltransferase) • tpi (Triosephosphate isomerase) • yqi (Acetyle coenzyme A acetyltransferase) The MLST principle arcC Primer 1797 (100.0%) Primer 1798 (100.0%) Primer 1809 (100.0%) Primer 1810 (100.0%) S. aureus MRSA252 BX571856 2902619 bp yqiL Primer 1805 (100.0%) Primer 1806 (100.0%) Primer 1807 (95.7%) Primer 1808 (100.0%) aroE Primer 1799 (100.0%) Primer 1803 (95.0%) Primer 1800 (95.7%) Primer 1804 (100.0%) Primer 1801 (100.0%) Primer 1802 (95.7%) gmk glpF pta tpi Primers and PCR conditions http://saureus.mlst.net/misc/info.asp The MLST principle MLST allele sizes: Gene arcC: aroE: glpF: gmk: pta: tpi: yqiL: Size 456 bp 456 bp 465 bp 429 bp 474 bp 402 bp 516 bp How many different alleles? • • • • • • • • Gene arcC: aroE: glpF: gmk: pta: tpi: yqiL: Number of Alleles 109 151 118 84 112 117 108 The MLST principle A A A A T C A A T C A A T C T C G C A G C A T T T T T T A A C T A A C T G T G A A A A A A T G A A T A T G A A T A G T G A T A G A A C G A T A G A A C T G T G T A T A G G C A C A A G C A C A A T C G T C G T T A C A C G T A C A C G T G T G T 3833 0 127 128 129 130 131 132 133 134 135 136 137 T 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 G T 156 157 158 159 160 161 162 163 164 165 166 167 168 169 G 170 171 172 173 174 175 176 177 178 179 T 180 181 182 183 184 185 186 187 188 T 189 Fragment MRSA- 9B1797_179 8- 1797 The MLST principle The MLST principle Delete/trim Fragment with required length! MLST Databases http://saureus.mlst.net/ MLST Databases MLST Databases MLST Databases MLST Databases MLST Databases MLST profile: Gene arcC: aroE: glpF: gmk: pta: tpi: yqiL: Allelle 108 13 1 1 12 11 13 Finding the Sequence Type (ST): Finding the Sequence Type (ST): Finding the Sequence Type (ST): MLST – the fast version…. CLCbio DNA workbench + MLST module s o r u E 0 0 0 3 0 0 5 1 Results : s t s o C Drag’n Drop sequences http://eburst.mlst.net/ Requires Java running on the computer aroE arcC CC398 CC8 CC5 Known members of Clonal Complex 398 • • • • • • • • • • • • ST398 (founder) ST804 ST1067 ST752 ST1232 ST621 ST753 ST291 ST813 ST1066 ST1277 ST1112 Thank you for your attention Questions and remarks?