PROPERTIES OF A TOMBUSVIRUS THAT INFECTS COCONA

Journal of Plant Pathology (2003), 85 (2), 105-110
Edizioni ETS Pisa, 2003
105
PROPERTIES OF A TOMBUSVIRUS THAT INFECTS COCONA
(SOLANUM SESSILIFLORUM) IN THE PERUVIAN JUNGLE
T.A. Melgarejo1, C.E. Fribourg1 and M. Russo2
2 Dipartimento
1 Departamento de Entomología y Fitopatología, Universidad Agraria La Molina, Lima, Peru
di Protezione delle Piante e Microbiologia Applicata, Università degli Studi and Istituto di Virologia Vegetale
del CNR, sezione di Bari, Via G. Amendola 165/A, I-70126 Bari, Italy
SUMMARY
Cocona (Solanum sessiliflorum) is a native plant of
the Amazon basin that is cultivated in Ecuador,
Venezuela, Brazil and Peru. From cocona plants in the
Peruvian highland jungle showing stunting, leaf deformation and necrotic spots a virus was recovered after
mechanical inoculation exhibiting isometric particles
approximately 30 nm in diameter. This virus was biologically, serologically and partly molecularly characterized.
It was transmitted by mechanical inoculation to 44 of 49
species in six different botanical families. Symptoms
were primarily localized infections that resembled those
elicited by tombusviruses. The virus was found by immunodiffusion analysis to be serologically related to several definitive tombusvirus species. A reaction of identity was found with Pear latent virus (PeLV), a recently
described tombusvirus from Italy. The coat protein
genes of the cocona virus isolate and PeLV showed a
high degree of identity, i.e. 94% at the nucleotide level
and 96% at the amino acid level.
Key words: Solanum sessiliflorum, cocona, tombusvirus, serology, sequencing, epidemiology.
INTRODUCTION
Cocona (Solanum sessiliflorum) is a partially perennial plant that grows wild in the Amazon basin. It has soft
stems and densely pubescent leaves and can reach two
meters in height. It produces round or oblong berries
ca. 10 cm long and 6 cm wide that are consumed fresh
or cooked, or are used for juice production. There is a
wide diversity of cocona ecotypes whose fruits differ in
size, shape, color and flavor. The center of origin is the
Orinoco basin (Brako and Zarucchi, 1993) and the area
of cultivation comprises Ecuador, Venezuela, Brazil and
Peru. In some remote regions, natives eat berries from
wild or half domesticated ecotypes (Salick, 1992).
Virus-like symptoms were observed in cocona plants
grown in the highland jungle of Tingo María (East
Corresponding author: M. Russo
Fax: +39.080.5442911
E-mail: [email protected]
Peru) in the year 2000. Affected plants showed severe
mosaic, chlorotic rings and necrotic spots on the leaves.
Inoculations to herbaceous hosts and electron microscope observations revealed the presence of two mechanically transmissible viruses in naturally infected
plants. One of these viruses had filamentous particles
and was identified as an isolate of the potyvirus Peru
tomato virus (PTV) (Fribourg, 1979; Fernandez-Northcote and Fulton, 1980). The other virus, referred to as
isolate AU2A, had isometric particles and was tentatively identified as a tombusvirus, since its symptoms in
herbaceous host resembled those induced by members
of this genus (Martelli, 1981). AU2A was separated
from possible mixed infections by three successive passages through single local lesions from Chenopodium
quinoa and, as reported here, was characterized biologically, serologically and, in part, molecularly. It was
found to be the same as Pear latent virus (PeLV), a
tombusvirus species recently described from southern
Italy (Russo et al., 2002).
MATERIALS AND METHODS
Viruses and antisera. An isolate of Tomato bushy
stunt virus (TBSV-type) and its antiserum were obtained
from D.E. Lesemann, Federal Biological Research Center for Agriculture and Forestry, Braunschweig, Germany; TBSV-BS3 was a Peruvian isolate from tomato
and its homologous antiserum prepared in a previous
study (Fribourg and Melgarejo, 2002). TBSV-cherry was
provided by K. Scholthof, Department of Plant Pathology, Texas A&M University, USA. An antiserum to
Petunia asteroid mosaic virus (PAMV), known to be the
same as TBSV-cherry (Koenig and Kuntze, 1982), was
utilized in the serological tests. PeLV and its homologous antiserum were those used in previous investigations (Russo et al., 2002). AU2A, was propagated in a
F1 cross of Nicotiana bigelovii x N. clevelandii, which
was used as source of this and other viruses for all subsequent experiments.
Experimental host range. Forty-nine species in the
families Amaranthaceae, Chenopodiaceae, Cucurbitaceae,
Fabaceae, Lamiaceae and Solanaceae, including three local cocona ecotypes, S. sessiliflorum var. georgicum, and
106
Pear latent virus in cocona
seven additional Solanum species belonging to section
Lasiocarpa (Whalen and Caruso, 1983) were inoculated
for host range determination. Inoculations were made
by rubbing tap water extracts from infected plants on
carborundum-dusted expanded leaves of all species, except for those in the Cucurbitaceae and Fabaceae, in
which case, cotyledons and primary leaves were used.
Plants were grown in a glasshouse at 20-25ºC and observed daily for symptom development during 2-3
weeks. Infection was confirmed by back inoculation to
C. quinoa or C. amaranticolor.
Transmission by contact and through seeds. Contact
transmission tests were done by whipping systemically
infected S. sessiliflorum or F1 N. bigelovii x N. clevelandii plants onto the foliage of groups of healthy coconas. Sap was extracted from whipped plants and the
presence of AU2A ascertained by gel double diffusion
tests using the homologous antiserum.
For seed transmission 300 seeds from healthy and infected Datura stramonium plants were sown in a mixture of soil, sand and compost (1:1:1). Seedlings were
allowed to grow for three weeks before sap was extracted from groups of 10 seedlings picked at random (Maury et al., 1985), and the presence of AU2A was checked
by gel diffusion tests.
Purification, serology and electron microscopy. Purification was done by homogenizing locally infected
leaves of N. bigelovii x N. clevelandii, before necrotic lesions developed, in 0.1 M sodium phosphate buffer pH
8, 0.01 M 2-mercaptoethanol, and 0.25 g bentonite per
100 g plant tissue. After low speed centrifugation at
6,000 rpm for 20 min, the supernatant was made to
10% polyethylene glycol MW 6,000 and 0.2 M NaCl.
The resuspended precipitate was stirred overnight at
4ºC in the presence of 4% n-butanol, and centrifuged at
low speed (20 min at 10,000 rpm). The supernatant was
subjected to two alternate cycles of high speed (60 min
at 30,000 rpm in a Beckman rotor LA65) and low speed
(20 min at 10,000 rpm in a JA20 Beckman rotor) centrifugation and the virus-containing pellets were resuspended in 0.01 M sodium phosphate pH 7.
An antiserum was prepared by injecting a rabbit intramuscularly four times at weekly intervals with 1.5 mg
purified virus in 0.5 ml buffer emulsified with 0.5 ml
Freund´s incomplete adjuvant. Blood was collected one
week after the last injection and the antiserum titre was
determined by double diffusion test in Petri dishes containing 0.85% agarose, 0.85% NaCl and 0.85% NaN3.
Purified virus preparations were mounted in 2%
aqueous uranyl acetate before observation with a
Philips Morgagni electron microscope.
Sequencing of the coat protein gene. To clone the
coat protein (CP) gene, cDNA to AU2A genomic RNA
was prepared by random priming and used as template
for polymerase chain reactions (PCR) using as primers
Journal of Plant Pathology (2003), 85 (2), 105-110
the oligonucleotides 5´ CCGCCGTGGCCTGACCAAGTG 3´ and 5´ CCATGAACTGGTCTGTTCAAG 3´, homologous and complementary, respectively, to sequences flanking the PeLV CP gene
(GenBank accession number AY100482). The PCR
product was ligated to Sma I-digested, dephosphorylated pUC18, cloned in Escherichia coli strain DH5α and
sequenced on both strands by the dideoxy chain termination method (Sanger et al., 1977).
Phylogenetic analysis. Nucleotide and putative
amino acid sequences of the CP genes of several
tombusviruses, carmoviruses and dianthoviruses (Fig. 3)
were obtained from GenBank-EMBL databases using
Fasta (Pearson and Lipman, 1988) and Blast (Zhang
and Madden, 1997) programs and arranged in Pearson/Fasta format using the program Readseq Sequence
Conversion available from BioInformatics & Molecular
Analysis Section (BIMAS). Nucleotide and deduced
amino acid sequences of these viruses and AU2A were
aligned and a phylogenetic tree constructed using the
program ClustalW (1.75) with 1,000 bootstrap iterations (Felsenstein, 1985; Thompson et al., 1994). The
tree was designed with the Phylodendron program from
BIMAS.
RESULTS AND DISCUSSION
Host range and symptomatology. AU2A infected 44
of 49 species belonging to all six families tested (Table
1). Local chlorotic or necrotic lesions were induced in all
hosts from the Amaranthaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae, Lamiaceae, and of those in the
Solanaceae: Capsicum annuum ‘Piquillo’, C. baccatum
‘Éscabeche’, Datura metel, Lycopersicon chilense, L. esculentum
‘Marglobe’
and
‘Río
Grande’,
L.
pimpinellifolium, Nicandra physaloides, Nicotiana debneyi, N. glutinosa, N. occidentalis, N. rustica, N. tabacum
‘Samsum’ and ‘White Burley’, Petunia hybrida, Physalis
floridana, Solanum melongena, S. nigrum, and S.
villosum. Local reactions of Gomphrena globosa and
Ocimun basilicum (Fig. 1A and B) were of diagnostic value (Martelli, 1981). Only seven species, all solanaceous,
were infected systemically. These included S. sessiliflorum which reacted with mottling (Fig. 1C), stunting (Fig.
1D), and deformation of the leaves, thus reproducing
the field syndrome, and two out of seven cocona-related
species in Solanum section Lasiocarpa (Table 2). S. sessiliflorum var georgicum was not infected systemically.
Contact and seed transmission. When systemically
infected plants of N. bigelovii x N. clevelandii were used
to whip 20 healthy cocona plants, eight became infected. By contrast, no transmission was obtained when
whipping was done with infected cocona plants. No
virus was detected in the seedlings grown from infected
D. stramonium seeds. However, the percentage of ger-
Journal of Plant Pathology (2003), 85 (2), 105-110
Table 1. Experimental host range and symptoms induced by
isolate AU2A.
Host
Amaranthaceae
Amaranthus caudatus
Gomphrena globosa
Chenopodiaceae
Chenopodium amaranticolor
Chenopodium murale
Chenopodium quinoa
Cucurbitaceae
Cucumis melo
Cucumis sativus
Cucurbita maxima
Cucurbita moschata
Cucurbita pepo
Cyclanthera pedata
Luffa acutangula
Fabaceae
Dolichos biflorus
Phaseolus acutifolius
Phaseolus lunatus
Phaseolus vulgarisa
Vigna unguiculata
Lamiaceae
Ocimum basilicum
Solanaceae
Capsicum annuum
Capsicum baccatum
Datura metel
Datura stramonium
Lycopersicon chilense
Lycopersicon esculentum
Lycopersicon pimpinellifolium
Nicandra physaloides
Nicotiana benthamiana
Nicotiana bigelovii
Nicotiana clevelandii
Nicotiana debneyi
Nicotiana glutinosa
Nicotiana occidentalis
Nicotiana rustica
Nicotiana tabacum
F1 N. bigelovii x N.clevelandii
Petunia x hybrida
Physalis floridana
Physalis peruviana
Solanum melongena
Solanum nigrum
Solanum sessiliflorum ecotypes N4, T5, N3
Solanum sessiliflorum var. georgicum
Solanum villosum
Local
Systemic
NL
NL
-----
NL
NL
NL
-------
NL
--NL
CL
NL
CL
NL
---------------
--NL
NL
NL
NL
-----------
NL
---
CL
CL, NL
NL
NL
NL
CL, NL
CL, NL
NL
NL
CL, NR
CL, NL
NL
NL
NL
NL
NL
CL, NL
NL
NL
--CL, NL
NL
--NL, NR
NL
----LB, LD
ANL, CL, NL
--------AN, NL, W
AN, LD
AN, LD
----------AN, LD, M
----------LB, ACL, M, LD, RLL
-----
ACL = asteroid chlorotic lesions, AN = apical necrosis, ANL = asteroid necrotic lesions, CL = chlorotic lesions, LB = leaf blistering, LD
= leaf deformation, M = mottling-mosaic, NL = necrotic lesions, NR
= necrotic rings, RLL = reduction of leaf lamina, SLI = symptomless
local infection, W = wilting.
a Cultivars: Amanda, Michelite, Top Crop, Red Land, Green Leaf.
b Cultivars: Amarilis, Canchan, King Edward, Maria Tambeña, Michoacan, Monserrate, Santa Catalina.
minated seeds were reduced to 24% when compared
with that from healthy plants. In a preliminary test,
30% infection was recorded in cocona seedlings that
had been grown in a sterilized organic substrate (Sun
Grow Horticulture Inc.), to which sap (undiluted or diluted 1:100) from infected N. bigelovii x N. clevelandii
had been added. This suggested that, like other
Melgarejo et al.
107
tombusviruses, AU2A is soilborne and can be transmitted in the absence of vectors (Martelli et al., 1988).
Purification. AU2A was readily purified, yielding
preparations that apparently did not contain host contaminating material and had A260/A280 = 1.6, uncorrected for light scattering. Virus yield, based on an extinction coefficient of 4.5 (mg/ml)-1 cm-1 (Martelli et al.,
1971), was ca. 47 mg/kg of tissue. Virus particles were
about 30 nm in diameter, had a rounded outline and
surface structure typical of tombusviruses (Fig. 2A)
(Martelli et al., 1988).
Serology. The antiserum had a titer of 1:256, as estimated by gel diffusion tests using purified antigen.
AU2A and three TBSV isolates (TBSV-type, TBSV-BS3
and TBSV-cherry) were serologically related. Distinct
cross reactions were obtained in immunodiffusion tests
and a serological differentiation index (Koenig, 1976) of
3.5 to 5 was calculated. This is a value higher than 3,
which is the threshold used for species demarcation in
the genus Tombusvirus (Lommel et al., 2000). By contrast, a reaction of identity was found between AU2A
and PeLV, a newly described tombusvirus species from
Italy (Russo et al., 2002) (Fig. 2B).
Sequence of the coat protein gene. The CP cistron
consisted of 1,167 nt, encoding a putative product of
389 aa (Mr 40,842) (GenBank accession number
AY236435). The nucleotide and amino acid sequence
of the CP gene were compared with those of six
tombusviruses, two carmoviruses and two dianthoviruses. Sequence alignment and pairwise comparisons (not shown) showed that AU2A had homologies between 64 and 70% with TBSV-cherry and TBSV-BS3 as well as with statice, glauca and pepper isolates of TBSV. However, a much higher homology in
nucleotide (94%) and amino acid sequence (96%) was
found with PeLV. These values are above 93%, the
proposed identity threshold for two tombusvirus
species (Luis-Arteaga et al., 1996; Obermeier et al.,
2001).
The phylogenic tree based on the nucleotide sequence of the CP gene further showed that AU2A is
a tombusvirus grouping very close to PeLV and with
TBSV-BS3 and TBSV-statice in a clade separate from
that comprising TBSV-cherry, -pepper and -glauca, Artichoke mottled crinkle virus (AMCV) and Pelargonium
leaf curl virus (PLCV) (Fig. 3). A tree based on the deduced amino acid sequence showed a very similar
grouping (results not shown).
The results of the present investigation have shown
that the virus isolated in Peru from cocona plants has
morphological, biological, epidemiological, and molecular traits typical of members of the genus Tombusvirus
(Martelli et al., 1988). Based on serological and molecular analyses the virus recovered from cocona can be
considered as an isolate of PeLV.
108
Pear latent virus in cocona
Journal of Plant Pathology (2003), 85 (2), 105-110
Fig. 1. Typical tombusvirus-like local reactions induced by AU2A in Gomphrena globosa, i.e. red-rimmed whitish necrotic lesions
(A) and Ocimum basilicum, i.e. dark brown necrotic lesions with a lighter center (B). C. Fine mosaic and secondary leaf vein deformation in cocona ecotype N4. D. Severe stunting in cocona ecotype N4. Healthy control on the left.
Members of the family Tombusviridae have a wide
range of natural hosts and are the cause of emerging diseases in different geographical areas (Luis-Arteaga et al.,
1996; Louie et al., 2000; Galetzka et al., 2000; Takemoto
et al., 2000; Obermeier et al., 2001). So far, AU2A has
been recovered only once out of four samples originally
collected in 2000 in Tingo María. One year later, no
virus was detected by serology in 78 samples collected
in four different fields. This may indicate that the virus
is sporadic or it is mainly restricted to the roots and occasionally causes symptoms in the aerial part of the
plant, as happens with other tombusviruses (Martelli et
al., 1988).
The occurrence of two isolates of the same virus in
such geographically and ecologically distant environments as the Peruvian jungle and pear orchards of
southern Italy is intriguing. Many tombusviruses are
spread and established in diverse environments mainly
via infected propagation material or contaminated water
or soil. It is unlikely but it cannot be excluded that this
is the case for PeLV. On the other hand, the slight divergence in the composition of the CP may indicate a
different and independent origin of the virus in the two
different geographical areas.
Journal of Plant Pathology (2003), 85 (2), 105-110
Melgarejo et al.
109
Table 2. Symptoms induced by AU2A in cocona-related species of the genus Solanum, section Lasiocarpa
Host
Geographic
origin
Local
Systemic a
Solanum candidum
Ecuador
---
CL, NL, M, LD, VN
Solanum hirsutissimum
Unknown
NL, NR
---
Solanum hirtum
Trinidad
---
---
Solanum lasiocarpum
Fiji
---
CL, NL, M, LD, VN
Solanum pectinatum
Ecuador
---
---
Solanum pseudolulo
Colombia
NL, NR
---
Solanum quitoense ‘Dulce’
Ecuador
CL
---
a CL
= chlorotic lesions, LD = leaf deformation, M = mosaic, NL = necrotic lesions, NR = necrotic rings, VN = vein necrosis.
Fig. 2. A. Purified preparation of AU2A particles mounted in uranyl acetate. Bar = 100 nm. B. Serological comparison of AU2A
with PeLV in agar gel double diffusion tests. Lower well contains antiserum (As) to PeLV; upper wells antigens as indicated. Identical results were obtained when lower well contained the antiserum to AU2A.
Fig. 3. Phylogenetic tree showing the relationship of AU2A
with members of the family Tombusviridae. The neighborjoining tree was constructed with nucleotide sequences of the
coat protein gene using CLUSTAL W. Bootstrap values are
shown at branch points. The scale bar represents a genetic
distance of 0.1 for the horizontal branch length. Virus names,
abbreviations, and GenBank/EMBL accession numbers in
the genus Tombusvirus: AU2A (cocona virus under study);
PeLV (Pear latent virus, AY100482); TBSV-BS3 (Tomato
bushy stunt virus BS3, AJ271328); TBSV-statice (AJ249740);
TBSV-pepper (U80935); TBSV-glauca (AJ312281); TBSVcherry (M21958); AMCV (Artichoke mottle crinkle virus,
X62493); PLCV (Pelargonium leaf curl virus, AF290026);
CIRV (Carnation Italian ringspot virus, X85215); CymRSV
(Cymbidium ringspot virus, X15511). Genus Carmovirus:
MNSV (Melon necrotic spot virus, M29671); GaMV (Galinsoga mosaic virus, Y13463). Genus Dianthovirus: SCNMV
(Sweet clover necrotic mosaic virus, L07884); RCNMV (Red
clover necrotic mosaic virus, AB034916). TMV (Tobacco mosaic virus, L35074) CP nucleotide sequence was used as outgroup.
110
Pear latent virus in cocona
ACKNOWLEDGEMENTS
The authors wish to thank Prof. G. P. Martelli for
critical reading the manuscript.
REFERENCES
Brako L., Zarucchi J.L., 1993. Catalogue of the Flowering
Plants and Gymnosperms of Peru. Vols. I, II. Missouri
Botanical Garden, Lima, Peru.
Felsentein J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791.
Fernandez-Northcote E.N., Fulton R.W., 1980. Detection and
characterization of Peru tomato virus strains infecting pepper and tomato in Peru. Phytopathology 70: 315-320.
Journal of Plant Pathology (2003), 85 (2), 105-110
In: Koenig R. (ed.). The Plant Viruses. Polyhedral Virions
with Monopartite RNA Genomes, pp. 13-72. Plenum Publishing Corporation, New York, USA.
Martelli G.P., Quacquarelli A., Russo M., 1971. Tomato bushy
stunt virus. CMI/AAB Descriptions of Plant Viruses, No.
69. Kew, Surrey, England.
Martelli G.P., 1981. Tombusviruses. In: Kurstak E. (ed.).
Handbook of Plant Virus Infections and Comparative Diagnosis. Elsevier North-Holland Biomedical Press, Amsterdam. The Netherlands.
Maury Y., Duby C., Bossennec J.M., Boudazin G., 1985.
Group analysis using ELISA: determination of the level of
transmission of soybean mosaic virus in soybean seed.
Agronomie 5: 405-415.
Fribourg C.E., 1979. Host plant reactions, some properties,
and serology of Peru tomato virus. Phytopathology 69: 441445.
Obermeier C., Sears J.L., Liu H.Y., Schlueter K.O., Ryder
E.J., Duffus J.E., Koike S.T., Wisler G.C., 2001. Characterization of distinct tombusviruses that cause diseases of lettuce and tomato in the western United States. Phytopathology 91: 797-806.
Fribourg C.E., Melgarejo T.A., 2002. Detección de la raza
BS3 del virus del enanismo arbustivo del tomate (Tomato
bushy stunt virus, TBSV) en el Perú. Fitopatología: in press.
Pearson W.R., Lipman D.J., 1988. Improved tools for biological sequence analysis. Proceeding of the National Academy
of Sciences, USA 85: 2444-2448.
Galetzka D., Russo M., Rubino L., Krczal G., 2000. Molecular characterization of a tombusvirus associated with a disease of statice [Goniolimon tataricum (L.) Boiss.]. Journal
of Plant Pathology 82: 151-155.
Russo M., Vovlas C., Rubino L., Grieco F., Martelli G.P.,
2002. Molecular characterization of a tombusvirus associated with the red leaf disease of pear in Apulia. Journal of
Plant Pathology 84: 161-166.
Koenig R., 1976. A loop-structure in the serological classification system of tymoviruses. Virology 72: 1-5.
Salick J., 1992. Crop domestication and the evolutionary ecology of cocona (Solanum sessiliflorum Dunal). Evolutionary
Biology 26: 247-285.
Koenig R., Kuntze L., 1982. Identification of tombusvirus isolates form cherry in Southern Germany as Petunia asteroid
mosaic virus. Journal of Phytopathology 103: 361-368.
Lommel S.A., Martelli G.P., Russo M., 2000. Family
Tombusviridae. In: van Regenmortel M.H.V., Fauquet
C.M., Bishop D.H.L., Carstens E.B., Estes M.K., Lemon
S.M., Maniloff J., Mayo M.A., McGeoch D.J., Pringle
C.R., Wickner R.B. (eds.). Virus Taxonomy: The Classification and Nomenclature of Viruses. The Seventh Report of
the International Committee on Taxonomy of Viruses, pp.
791-825. Academic Press, San Diego, USA.
Louie R., Redinbaugh M.G., Gordon D.T., Abt J.J., Anderson
R.J., 2000. Maize necrotic streak virus, a new maize virus
with similarity to species of the family Tombusviridae. Plant
Disease 84: 1133-1139.
Luis-Arteaga M., Rodriguez-Cerezo E., Fraile A., Sáenz E.,
Garcia-Arenal F., 1996. Different tomato bushy stunt virus
strains that cause disease outbreaks in solanaceous crops in
Spain. Phytopathology 86: 535-542.
Martelli G.P., Gallitelli D., Russo M., 1988. Tombusviruses.
Received 2 December 2002
Accepted 11 February 2003
Sanger F., Nicklen S., Coulson A.R., 1977. DNA sequencing
with chain-terminating inhibitors. Proceeding of the National Academy of Sciences, USA 74: 5463-5467.
Takemoto Y., Kanehira T., Shinohara M., Yamashita S., Hibi
T., 2000. The nucleotide sequence and genome organization of Japanese iris necrotic ring virus, a new species in the
genus Carmovirus. Archives of Virology 145: 651-657.
Thompson J.D., Higgins D.G., Gibson T.J., 1994. CLUSTALW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting position
specific gap penalties and weight matrix choice. Nucleic
Acids Research 22: 4673-4680.
Whalen M.D., Caruso E.E., 1983. Phylogeny in Solanum sect.
Lasiocarpa (Solanaceae): Congruence of morphological and
molecular data. Systematic Botany 8: 369-380.
Zhang J., Madden T.L., 1997. Power BLAST: a new network
BLAST application for interactive or automated sequence
analysis and annotation. Genome Research 7: 649-656.