Compliance with Threshold Principles Economic Benefits

Transcription

Cotton Pest Management Programmes using Threshold-Based Interventions Developed by CIRAD and its Partners
251
Compliance with Threshold Principles
Independent of the adoption of threshold protection programmes, the economic crisis of the cotton chains
in cotton-producing countries have led to a reduction in the acreages dedicated to cotton growing over the
past few years. Investigations carried out within farmers’ associations have shown that official
recommendations are not strictly applied, with frequent under-dosing of plant protection products for
economic reasons (Sinzongan et al., 2004) or the inappropriate use of insecticides on other crops such as
cowpea (Vigna unguiculata) and tomato (Sougnabe et al., 2010). Given this context, the increase in the
number of treatments reported in Benin by Williamson et al. (2008) appears difficult to interpret.
Strict compliance with recommendations is difficult to obtain for several reasons. Prudent et al.
(2007) have shown, for example, in Benin that planters who have learned LEC techniques find it difficult
to remember the methods a few years after training. The complexity of the observations which have to be
carried out have been mentioned by Sinzogan et al. (2004). Another constraint is the necessity of
conducting weekly observations. Finally, instances of under-dosage, or non-application of insecticide,
despite a threshold being reached, are sometimes seen. The opposite is true too, with cases reported of
treatments being carried out even if the defined threshold has not been reached.
Economic Benefits
At the producer level, the job of observation in the field may be given to paid observers. In Togo, for
example, where an observer carried out the job in 10 fields in 1995, the payment was 100 cfa (= €0.15)
per observation and per field. The payment for this service, when carried out by a third party like this, is a
limitation very often mentioned by owner-producers. Another cost mentioned by producers is for the
management of the insecticides that have not been used for threshold treatments. This cost has sometimes
been included in the purchase price of products destined for producers wanting to apply LEC
programmes, but this ‘discriminatory’ policy has triggered complaints from the producers involved.
Packaging in 15 litre containers is a handicap in Cameroon because each drum opened and not
completely used must still be paid for.
There are also economic constraints to be considered at the organisational level. The cost of
‘cascade’ or ‘stepped’ training is never mentioned. In the programme offered in the Côte d’Ivoire, for
example, National Research (CNRA) has to train 205 extension officers, who in turn train 500 ‘producerinstructors’ who in turn train 1,500 producers. As a result of this, by 2012 it is forecast that in three years
1,500 ‘producer-instructors’ and 500 LEC producers will have been trained (Ochou and Amon, 2010).
And yet this training represents a major effort and investment for a number of extension staff (Bertrand
et al., 2010).
CONCLUSION
In French-speaking sub-Saharan Africa, the current situation for cotton protection programmes using
action thresholds reveals a great variation from one country to another. All the same, their development
over significant acreages in some countries provides a measure of the interest shown in this type of
programme by both producers and the organisations which provide them with technical and financial
assistance. The multiplicity of the programmes offered is sometimes, but not always, linked to an
ecological reality. For example, in those regions with endocarpic Lepidopteran species (southern Benin,
Togo and the Côte d’Ivoire) it is more difficult to envisage the application of thresholds. For cost
reasons, there is no general monitoring of adult populations of Thaumatotibia leucotreta or Pectinophora
gossypiella with sexual pheromones, and producers are reluctant to destroy green cotton bolls to evaluate
the presence of these pests. Furthermore, the ‘rosetted bloom’ damage caused by P. gossypiella does not
allow an action threshold to be established. The situation for these pests therefore remains unchanged
since the studies presented by Vaissayre (1994).
252
World Cotton Research Conference on Technologies for Prosperity
An increase in this diversity of protection programmes is a reasonable perspective, linked with new
projects under development financed by external institutions (for example, COMPACI, Cotton made in
Africa, Better Cotton Initiative). The GIPD programme, which is under development in Mali, is the only
project until now which seeks to take natural enemies into consideration through the calculation of target
pest/natural enemy ratios, such as those offered in Australia, albeit in a very different context. Producers’
knowledge of these beneficial aids to crop production is often limited (Prudent et al., 2007) and a special
effort will have to be made in terms of training.
A simplification of the numerous existing threshold-based protection programmes, logically oriented
by an ecological and a regional analysis would probably be more satisfactory for a better diffusion among
smallholders, and consequently, for a reduction of costs. It will need the development of a network
involving researchers, growers, and all the actors of the production chain. For a large scale monitoring of
the impact of these new programmes, the contribution of producers will be essential.
A future challenge will be posed to pest management in countries which adopt or will adopt
transgenic resistant cotton to Lepidoptera. Until now, only Burkina Faso has very recently grown
genetically modified (GM) cotton over large acreages. According to the available information (Leynaert,
2010, COS-Coton, 2011), the first four treatments in the ‘conventional’ programme were eliminated,
while the two applications at the end of the cycle were maintained, to control biting and sucking insects.
Research is continuing to evaluate the impact on non-targeted fauna, particularly bugs, and, with National
Research, adjustments are being made to the protection programme. In this context, definition of
thresholds for likely-emerging pests, as Mirids or Pentatomids bugs observed in other countries for
example, will be very useful.
Thus, the challenge is to develop a more theoretical approach for a better definition of threshold than the empirical one applied in many cases – and at the same time, to succeed by a participative way of
extension and field application of the threshold, with a clear message, a good management of inputs and a
collective evaluation of the economical benefits of threshold-based programmes.
ACKNOWLEDGEMENT
The authors would like to thank the cotton companies who were willing to provide the agricultural
statistics used in this article and in particular Mr Paul Asfom (Sodecoton, Cameroon), as well as Mr Marc
Leynaert (Faso Coton, Burkina Faso) for the technical information pertinent to this country.
REFERENCES
[1] Achaleke, J. and Brévault, T. (2010) - Inheritance and stability of pyrethroid resistance in the cotton bollworm Helicoverpa
armigera (Lepidoptera: Noctuidae) in Central Africa. Pest Manag. Sci. 66 : 137-41.
[2] Ayeva, B. and Agossou, Y. (2000) - La lutte étagée ciblée au Togo : bilan et perspectives. In : Réunion phytosanitaire de
l’Afrique de l’Ouest et du Centre, Lomé, Togo, 22-25 février 2000, 242 -254.
[3] Bertrand, A., Brevault, T., Theze, M. and Vaissayre, M. (2010) - De la LEC à la LOIC. Comment aider les paysans à
prendre en charge la protection phytosanitaire de leurs parcelles de coton ? In : Seiny-Boukar L., Boumard P. (Eds.) Actes
du colloque « Savanes africaines en développement : innover pour durer », 20-23 avril 2009, Garoua, Cameroun. Prasac,
N’Djaména, Tchad ; CIRAD, Montpellier, France, 12p.
[4] Beyo, J., Nibouche, S., Gozé, E. and Deguine, J.-P. (2004) - Application of probability distribution to the sampling of
cotton bollworms (Lepidoptera: Noctuidae) in Northern Cameroon. Crop Prot. 23, 1111 - 17.
[5] Brévault, T., Achaleke, J., Sougnabé, S.P. and Vaissayre, M. (2008) - Tracking pyrethroid resistance in the polyphagous
bollworm, Helicoverpa armigera, in the shifting landscape of a cotton-growing area. Bull. Entomol. Res. 98: 565-73.
[6] Brévault, T., Couston, L., Bertrand, A., Thézé, M., Nibouche, S. and Vaissayre, M. (2009) -Sequential pegboard to support
small farmers in cotton pest control decision-making in Cameroon. Crop Prot. 28: 968-73.
[7] COMPACI, CmiA and UdC. (2010) -Proceedings of the workshop: “Exchange of experiences in promoting integrated crop
protection in coton production”, 31/05- 03/06/2010, Hôtel Dako 1er, Bohicon, Benin.
[8] COS-Coton (2011) - Mise à jour relative au partenariat Union Européenne-Afrique sur le coton. Document du Comité
d’orientation et de suivi du partenariat UE-Afrique sur le coton, mai 2011, 96p.
[9] Djihinto A., Katary A., Prudent P., Vassal J.-M. and Vaissayre, M. (2009) - Variation in resistance to pyrethroids in
Helicoverpa armigera from Benin Republic, West Africa. J. Econ. Entomol. 102, 1928-34.
[10] Gautier, C., Saïbou, M. and Prudent, P. (2010) - Rapport annuel d’activité. Lutte sur Observation individuelle des chenilles
de la capsule du cotonnier. Campagne 2009/2010. CIRAD (non publié), 60 p.
Cotton Pest Management Programmes using Threshold-Based Interventions Developed by CIRAD and its Partners
253
[11] Héma, O., Somé, H.N., Traore, O., Greenplate, J. and Abdennadher M. (2008) - Efficacy of transgenic cotton plant
containing the cry1Ac and cry2Ab genes of Bacillus thuringiensis against Helicoverpa armigera and Syllepte derogata in
cotton cultivation in Burkina Faso.Crop Prot. 28: 205-14.
[12] Houndété, T.A., Kétoh, G.K., Hema, O.S.A., Brévault, T., Glitho, I.A. and Martin, T. (2010) - Insecticide resistance in
field populations of Bemisia tabaci (Hemiptera: Aleyrodidae) in West Africa. Pest Manag. Sci. 66: 1181-1185.
[13] Kranthi K.R. and Russell D.A. (2009) - Changing trends in cotton pest management. In: Integrated pest management:
Innovation-development process. R. Peshin, A. K. Dhawan (Eds), Springer Netherlands, 499-541.
[14] Kranthi K.R. and Kranthi S. (2010) - Cotton insect pests and their control in the 21st Century. In: Cotton: technology for the
21st Century, Ph.J. Wakelyn & R. Chaudhry (Eds.), International Cotton Advisory Committee, 99-122.
[15] Leynaert, M. (2010) - In: Exchange of experiences in promoting integrated crop protection in cotton production.
Workshop, 31/05 – 03/06, Hôtel Dako 1er, Bohicon, Benin.
[16] Martin, T., Ochou, O.G., Djihinto, A., Traore, D., Togola, M., Vassal, J.-M., Vaissayre, M. and Fournier, F. (2005) Controlling an insecticide-resistant bollworm in West Africa. Agriculture, Ecosys. Environ. 107: 409-411.
[17] Martin, T., Ochou, O.G., Vaissayre M. and Fournier, D. (2002) - Monitoring of the insecticides resistance in Helicoverpa
armigera (Hubner) from 1998 to 2002 in Côte d’Ivoire, West Africa. Proceedings of the World Cotton Conference - 3,
Cape Town, South Africa, March 9-13, 1061 - 1067.
[18] Matthess, A., van den Akker, E., Chougourou, D. and Midingoyi, S. Junior. (2005) - Le coton au Bénin: Compétitivité et
durabilité de cinq systèmes culturaux cotonniers dans le cadre de la filière. Eschborn, Germany: GTZ (Deutsche
Gesellschaft für Technische Zusammenarbeit), 206p.
[19] Nibouche, S., Beyo, J., Djonnewa, A., Goipaye, I., Yandia, A. (2003a) - La lutte étagée ciblée a-t-elle un avenir en Afrique
centrale? In: Jamin, J.Y., Seiny Boukar, L., Floret, C. (Eds.), Savanes africaines: des espaces en mutation, des acteurs face à
de nouveaux défis. Actes du colloque, Garoua, Cameroun, 27–31 mai 2002. CIRAD, Montpellier, 9p.
[20] Nibouche, S., Beyo, J. and Gozé, E. (2003b) - Mise au point de plans d’échantillonnage pour la protection sur seuil contre
les chenilles de la capsule du cotonnier. In: Jamin, J.Y., Seiny Boukar, L., Floret, C. (Eds.), Savanes africaines: des espaces
en mutation, des acteurs face à de nouveaux défis. Actes du colloque, Garoua, Cameroun, 27–31 mai 2002. CIRAD,
Montpellier, 5p.
[21] Ochou, O.G. and Amon, B.P. (2010) - La protection du cotonnier sur seuil en Côte d’Ivoire – Phase I. In: Exchange of
experiences in promoting integrated crop protection in cotton production. Workshop, 31/05 – 03/06, Hôtel Dako 1er,
Bohicon, Benin.
[22] Ochou, O.G., Martin, T. and Hala, N.F. (1998a) - Cotton insect pest problems and management strategies in Côte d’Ivoire,
W. Africa. Proceedings of the World Cotton Conference - 2, Athens, Greece, September 6-12, 1989, pp. 833 - 837.
[23] Ochou, G.O., Matthews, G.A. and Mumford, J.D. (1998b) - Comparison of different strategies for cotton insect pest
management in Africa. Crop Prot. 17: 735-741.
[24] Ochou, G.O., Matthews, G.A. and Mumford, J.D. (1998c) - Farmer’s knowledge and perception of cotton insect pest
problems in Côte d’Ivoire. Int. J. Pest Mgmt. 44: 5-9.
[25] Peshin, R., Bandral, R.S., Zhang, W., Wilson, L. and Dhawan A.K. (2009) - Integrated pest management: A global
overview of history, programs and adoption. In: Integrated pest management: Innovation-development process. Ed. by R
Peshin, A K Dhawan, Springer Netherlands, 1-49.
[26] Poutouli, W. Silvie, P. and Aberlenc, H.-P. (2011) - Phytophagous and predatory Heteroptera in West Africa. CTA & Quae
(eds.), 80 p.
[27] Prudent, P., Midingoyi, S.-K., Aboua, C. and Fadoegnon, B. (2006) - La lutte étagée ciblée (LEC) pour une production
durable du coton. INRAB, Bénin, Ed. GTZ (ProCGRN),105 p.
[28] Prudent, P., Loko, S., Deybe, D. and Vaissayre, M. (2007) - Factors limiting the adoption of IPM practices by cotton
farmers in Benin : a participatory approach. Expl. Agric. 43 : 113-24.
[29] Silvie, P. (1990) - Mussidia nigrivenella Ragonot (Pyralidae, Phycitinae) : un ravageur mal connu du cotonnier. Coton et
Fibres Tropicales 45 : 323-33.
[30] Silvie, P. Deguine, J.-P., Nibouche, S., Michel, B. and Vaissayre, M. (2001) -Potential of threshold-based interventions for
cotton pest control by small farmers in West Africa. Crop Protection 20, 297-301.
[31] Sinzogan, A.A.C., Van Huis, A., Kossou, D.K., Jiggins, J. & Vodouhé, S. (2004) - Farmer’s knowledge and perception of
cotton pests and pest control practices in Benin. Wageningen Journal of Life Sciences 52: 285-303.
[32] Sougnabe, S.P., Yandia, A., Acheleke, J., Brévault, T., Vaissayre, M. and Ngartoubam, L.T. (2010) - Pratiques
phytosanitaires paysannes dans les savanes d’Afrique centrale. In : Seiny-Boukar L., Boumard P. (Eds.) Actes du colloque
« Savanes africaines en développement : innover pour durer », 20-23 avril 2009, Garoua, Cameroun. Prasac, N’Djaména,
Tchad; CIRAD, Montpellier, France, 13p.
[33] Stern, V.M., Smith, R.F., Van den Bosch, R. and Hagen, K.S. (1959) - The integrated control concept. Hilgardia 29: 81-99.
[34] Traore, O., Denys, S., Vitale, J., Traore, K. and K. Bazoumana K. (2008) - Testing the Efficacy and Economic Potential of
Bollgard II under Burkina Faso Cropping Conditions. J. Cotton Sci. 12, 87–98.
[35] Tourneux, H. (1993) - La perception des pictogrammes phytosanitaires par les paysans du Nord-Cameroun. Coton et Fibres
Tropicales 48 : 41-48.
[36] Tourneux, H. (2003) - Communiquer avec les paysans dans les savanes d'Afrique centrale. In: Jamin, J.Y., Seiny Boukar,
L., Floret, C. (Eds.), Savanes africaines: des espaces en mutation, des acteurs face à de nouveaux défis. Actes du colloque,
Garoua, Cameroun, 27–31 mai 2002. CIRAD, Montpellier, 4p.
254
[37] Treen, A.J. and Burgstaller, H. (2003) - Cotton IPM. Research success and field disappointment: why are implementation
projects not succeeding? Proceedings of the World Cotton Research Conference-3. Cape Town, South Africa, March 9-13,
1001 - 6.
[38] Vaissayre, M. (1994) - Ecological attributes of major cotton pests: implications for management. Proceedings of the World
Cotton Research Conference-1. Brisbane, Australia, February 14-17, 499 - 510.
[39] Vaissayre, M., Martin, T. and Vassal, J.-M. (1998) - Pyrethroid resistance in bollworm Helicoverpa armigera (Hübner)
(Lepidoptera: Noctuidae) in West Africa. Proceedings of the World Cotton Research Conference-2. Athens, Greece,
September 6-12, 701-5.
[40] van Huis, A. (2009) -Challenges of integrated pest management in sub-saharan Africa. In: Integrated pest management:
Dissemination and impact. Ed. by R Peshin, A K Dhawan, Springer Netherlands, 395-417.
[41] Williamson, S., Ball, A. and Pretty, J. (2008) - Trends in pesticide use and drivers for safer pest management in four
African countries. Crop Prot. 27: 1327-34.
41
Can Natural Refuges Delay Insect Resistance
to Bt Cotton
Brévault Thierry1,2, Nibouche Samuel3, Achaleke Joseph4 and Carrière Yves2
1
CIRAD, UPR 102, F-34398 Montpellier, France
Department of Entomology, University of Arizona, Tucson, AZ, USA
3
CIRAD, UMR PVBMT, F-97410 Saint-Pierre, La Réunion, France
4
IRAD, PRASAC-ARDESAC, Garoua, Cameroon
2
Abstract—Non-cotton host plants without Bacillus thuringiensis (Bt) toxins can provide refuges that delay
resistance to Bt cotton in polyphagous insect pests. It has proven difficult, however, to determine the effective
contribution of such refuges and their role in delaying resistance evolution. Here we used biogeochemical markers to
quantify movement of Helicoverpa armigera moths from non-cotton hosts to cotton fields throughout the cropping
season, in three agricultural landscapes of the West African cotton belt (Cameroon) where Bt cotton was absent. We
show that the contribution of non-cotton hosts as a source of moths was spatially and temporally variable, but at least
equivalent to a 7.5% sprayed refuge of non-Bt cotton. Simulation models incorporating H. armigera biological
parameters, however, indicate that planting non-Bt cotton refuges may be needed to significantly delay resistance to
cotton producing the toxins Cry1Ac and Cry2Ab. Specifically, when the concentration of one toxin (here Cry1Ac)
declined seasonally, resistance to Bt cotton occurred rapidly when refuges of non-Bt cotton were rare, because
resistance was essentially driven by one toxin (here Cry2Ab). The use of biogeochemical markers to quantify insect
movement can provide a valuable tool to evaluate the role of non-cotton refuges in delaying the evolution of H.
armigera resistance to Bt cotton.
Cotton is widely grown in West Africa, where it helps sustain millions of resource-poor farmers and
rural communities. Transgenic cotton producing the Bacillus thuringiensis (Bt) toxins Cry1Ac and
Cry2Ab was recently introduced to Burkina Faso (1) to increase agricultural profitability. Such Bt cotton
is called “pyramid” because it produces two distinct Bt toxins active against some pest species (2-5).
Management of insect resistance to Bt crops requires production of abundant susceptible individuals in
refuges of non-Bt host plants that disperse and mate with the rare resistant survivors in Bt fields (2-5).
Because the most important insect pest of cotton in West Africa, Helicoverpa armigera, is polyphagous
and highly mobile (6, 7), non-cotton host plants could reduce the reliance on refuges of non-Bt cotton to
delay resistance. While some studies have evaluated production of H. armigera by non-cotton host plants
elsewhere (8-11), movement of moths from non-cotton hosts to cotton fields has never been quantified in
space and time. Nevertheless, it is often assumed that cotton refuges are not required to delay H.
armigera resistance to Cry1Ac/Cry2Ab cotton in agroecosystems where small fields of diversified crops
and patches of non-cultivated hosts are close together (10), such as in West Africa.
We used biogeochemical markers to measure movement of H. armigera moths from non-cotton hosts
to cotton fields in Cameroon (in the West African cotton belt). A total of 18 moth collections were taken
from pheromone traps in cotton fields from June to November 2006 at three locations (Guider, Djalingo,
and Tcholliré). Larval host plants were identified by analyzing moths’ abdomens for gossypol (a
phytochemical present in cotton) and wings for stable carbon isotope ratio. We categorized plants as
cotton, non-cotton C3 plants (e.g., weeds such as Cleome spp. and Hyptis sp.), and C4 plants (e.g., corn).
Most moths trapped early in the growing season (June-July) had signatures of C3 and C4 non-cotton
plants (Fig. 1a-c). The few gossypol-positive moths detected at that time likely originated from
overwintering pupae and possibly from early-planted cotton or cotton left in fields from the previous
growing season. When the first moth generation emerged from cotton (August), most moths had
signatures of C3 and C4 non-cotton plants (Fig. 1a-c). The contribution of non-cotton refuges to the pool
of moths trapped in cotton fields decreased during the second (September) and third (October)
generations, particularly at Djalingo, and to a lesser extent Tcholliré and Guider. At cotton harvest
(November), most moths originated from non-cotton C3 plants at Djalingo and Tcholliré, whereas moths
256
from cotton still contributed significantly to the pool of moths at Guider (Fig. 1a-c), where cotton is
usually harvested a few weeks later.
Fig. 1: (a-c). Moths Trapped in Cotton Fields (%) that Originated from Non-cotton Host Plants. Remaining Moths (100 – % Indicated by bar) Originated
from Cotton. Moths were Trapped at Three Locations (Guider, Djalingo, and Tcholliré) in Cameroon in 2006.
(d) Typical Sequence of Helicoverpa Armigera Host Plants in the West Africa Cotton Belt Throughout the Cropping Season.
Curves Represent Temporal Occurrence and Relative Area of Host plants.
We used a two-locus population genetics model incorporating empirical estimates of H. armigera
biological parameters to evaluate how movement from non-cotton refuges may affect the evolution of
resistance to Cry1Ac/Cry2Ab cotton at each of the three locations. The model considered the seasonal
decline in mortality of a strain resistant to Cry2Ab on Cry1Ac/Cry2Ab cotton (12), which paralleled the
decline in Cry1Ac concentration generally observed in Bt cotton during the course of the growing season
(5, 13). Such reduction in mortality of Cry2Ab-resistant insects on Cry1Ac/Cry2Ab cotton invalidates
one of the fundamental assumptions of the pyramid strategy, i.e., the killing of insects resistant to one
toxin by the other toxin, and thus could accelerate resistance evolution (2-5, 14).
Seasonal declines in Cry1Ac-induced mortality and more stable Cry2Ab-induced mortality
necessarily generates stronger selection for resistance to Cry2Ab than Cry1Ac. Simulations showed that
the evolution of resistance was primarily driven by Cry2Ab resistance alleles, as the initial resistance
allele frequency and the dominance of Cry1Ac resistance had little effect. Among-site variability affected
the role of non-cotton refuges in delaying resistance evolution (Fig. 2a,b). With partially recessive
resistance to Cry2Ab (DLC = 0.1) and initial resistance allele frequency of 0.0033 to Cry2Ab, non-cotton
refuges delayed resistance ≥32 years at Guider, ≥16 years at Tcholliré, and ≥8 years at Djalingo (Fig. 2a).
With partially recessive resistance to Cry2Ab (DLC = 0.1) and higher initial resistance allele frequency of
0.033 to Cry2Ab, however, resistance evolution was faster and non-cotton refuges delayed resistance ≥17
years at Guider, ≥9 years at Tcholliré, and ≤6 years at Djalingo (Fig. 2b). With higher dominance of
Cry2Ab resistance (DLC = 0.3 or 0.5), sprayed refuges of 20% non-Bt cotton in addition to non-cotton
refuges delayed resistance ≥8 years at Guider, ≤11 years at Tchollire´, and ≤8 years at Djalingo (Fig. 2b).
In a worst-case scenario with an initial resistance frequency of 0.033 and semi-dominant resistance to
Cry2Ab (DLC = 0.5), sprayed refuges of 50% non-Bt cotton delayed resistance 15 years at Guider, 8 years
at Tcholliré, and 6 years at Djalingo (Fig. 2b).
Can Natural Refuges Delay Insect Resistance to Bt Cotton
257
Fig. 2: Effect of the Abundance of Sprayed Refuges of Non-Bt cotton (%) on the Evolution of Helicoverpa Armigera Resistance to Cry1Ac/Cry2Ab Cotton
at three Locations (Guider, Djalingo, and Tcholliré) in Cameroon. For Cry2Ab, the Initial Resistance Allele Frequency Was 0.0033 (a) or 0.033 (b), and
Resistance was Partially Recessive (DLC = 0.1, Dashed line) or semi-Dominant (DLC = 0.5, Solid Line). For Cry1Ac, the Initial Resistance Allele Frequency
was 0.0003 and Resistance was Partially Recessive (DLC = 0.3). The Criterion for Resistance Evolution was >20% Survival on Bt Cotton
Our seasonal assessment of H. armigera movement shows that non-cotton refuges were equivalent to
≥7.5% non-Bt cotton refuges treated with insecticides throughout the cotton-growing season (Fig. 1b).
Despite the important but temporally and regionally variable moth contribution from non-cotton hosts to
putative Bt cotton fields, our modeling results show low efficacy of the pyramid strategy when the
concentration of Cry1Ac declines during the growing season, resistance to Cry2Ab is non-recessive, and
only non-cotton refuges are available. Under the first two conditions, refuges of non-Bt cotton would be
needed to significantly delay resistance, unless high sustained movement from non-cotton refuges to
cotton fields occurs during the growing season (e.g., Guider), or long-range migration is more important
northward than southward. More generally, we demonstrate that biogeochemical markers provide a basis
to evaluate the role of a variety of refuges in delaying the evolution of resistance to Bt crops in
polyphagous insect pests. Such markers will be useful to assess the role of non-cotton hosts in delaying
H. armigera resistance to Bt in Burkina Faso and other West African countries that may adopt Bt cotton.
REFERENCES
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
C. James, ISAAA Briefs 39, 129-132 (2008).
B.E. Tabashnik et al., Nat. Biotechnol. 26, 199-202 (2008).
B.E Tabashnik. et al., J. Econ. Entomol. 102, 2011-2025 (2009).
F. Gould, Annu. Rev. Entomol. 43, 701-726 (1998).
A.M. Showalter et al., J. Insect Sci. 9, 1-39 (2009).
T. Brévault et al., Bull. Entomol. Res. 98, 565-573 (2008).
J.M. Vassal et al., Comm. Appl. Biol. Sci., 73, 433-437 (2008).
W.M. Green et al., Afr. Entomol. 11, 21-29 (2003).
K.C. Ravi et al., Environ. Entomol. 34, 59-69 (2005).
K.M. Wu, Y.Y. Guo, Annu. Rev. Entomol. 50, 31-52 (2005).
G.H. Baker, C.R. Tann, G.P. Fitt, Aust. J. Agr. Res. 59, 723-732 (2008).
R.J. Mahon, K.M. Olsen, J. Econ. Entomol. 102, 708-716 (2009).
K.R. Kranthi et al., Curr. Sci. 89, 291-298 (2005).
F. Gould et al., J. Econ. Entomol. 99, 2091-2099 (2006).
42
Can Tomato be a Potential Host Plant
for Pink Bollworm
N. Ariela1, S. Harpaz Liora2, R. Mario3, S. Roee4 and H.A. Rami3
1
Israel Cotton Board, P.O.B. 384 Herzlia B' 46103 Israel;
Northern R & D, P.O. Box 831, Kiryat Shmona–11016, Israel
3
Department of Entomology, Agricultural Research Organization,
Gilat Research Center, M.P. Negev, 85280, Israel
4
Department of Entomology, The Robert H. Smith Faculty of Agriculture, Food and Environment,
The Hebrew University of Jerusalem P.O.Box12, Rehovot–76100, Israel
E-mail: [email protected]
2
Abstract—The pink bollworm (PBW), Pectinophora gossypiella (Saunders) is a major pest of cotton in Israel.
Recently, processed tomatoes growers from northern Israel have reported that, suspected PBW larvae were found
inside tomato fruits in the field. Since tomato (Solanum lycopersicum) has not been recorded as a host plant for the
PBW, a laboratory study was conducted to find out whether PBW neonates can penetrate tomato fruits and complete a
whole life cycle on them. PBW eggs were placed on tomato fruits; thereafter, some neonates penetrated the fruits and
succeeded to complete a whole life cycle in tomato fruit. In another experiment, tomato plants were placed in net cages
and PBW adults were introduced into the cages. Females laid eggs on the tomato plants and a few larvae developed in
the fruits. These findings shed new light on the understanding of PBW host range and have implications on area wide
IPM programs.
INTRODUCTION
The pink bollworm (PBW), Pectinophora gossypiella (Saunders) is the major pest of cotton in Israel; and
mating disruption is a very common practice in all cotton fields (Kehat and Dunkelblum 1993, Kehat et
al. 1998). During the past ten years, the pest has spread all over the country, causing a real threat to
cotton growth in Israel. PBW is found mainly on cotton, although a few larvae were noticed also on
other Malvaceae species such as Hibiscus sp. and Okra Recently processed tomatoes growers from
northern Israel have reported that suspected PBW larvae were found inside tomato fruits in the field. As
tomato (Solanum lycopersicum) has not been recorded as a host plant for the PBWs, (Shiller et al. 1962),
a laboratory study was conducted to find out whether PBW neonates can penetrate tomato fruits and
complete on them a whole life cycle.
MATERIALS AND METHODS
Thirty ripe tomato fruits with their vines were put into plastic cups along with twenty PBW eggs placed
on each fruit. The fruits were held under standard laboratory conditions of 27±2°C, 50% humidity and
photoperiod of 14:10 hours light: dark conditions. Every few days the fruits were checked for larva
penetration.
In another experiment, three tomato plants, each from a different variety, (Brigade, 5811, 9780) were
put in net cages.
60 males and 60 females were introduced to each cage. The cages were placed on tables in outdoor
conditions (summer).
After 14 days, the fruits were checked for PBW eggs and entrance holes; then, the fruits were cut into
slices to find PBW larvae.
Can Tomato be a Potential Host Plant for Pink Bollworm
259
RESULTS AND DISCUSSION
At the first experiment, tiny holes were found on the upper part of the tomato fruit underneath the sepal.
Later on, PBW larvae were found inside the fruits feeding on flesh and seeds (figure 1).
Fig. 1: PBW Larvae Inside a Tomato Fruit
Two weeks later, exit holes and damage to fruits were detected and larvae dropped down and pupated
(figure 2, 3). Adults that emerged from the pupae mated normally and laid fertile eggs. In conclusion, the
PBW has succeeded to complete a whole life cycle in tomato fruit.
Fig. 2: Exit Hole of PBW
Fig. 3: Damage Made by PBW
260
At the second experiment with tomato plants, we found entrance holes and larvae only in the variety
9780. Penetrations of PBW larvae were detected inside just two fruits out of 25 red and green fruits that
were on the plants.
The results showed that PBW not only could develop in tomato fruits but females might lay eggs
spontaneously on tomato plants.
These findings shed new light on the understanding of PBW host range and have implications on area
wide IPM programs.
Further choice experiments will be planned to learn whether PBW females would select and lay eggs
on tomato fruits in the presence of cotton plants.
REFERENCES
[1] Kehat, M, and Dunkelblum, E. 1993. Sex pheromones: Achievements in monitoring and mating disruption of cotton pests
in Israel. Arch. Insect Biochem. Physiol. 22: 425-431.
[2] Kehat, M., Anshelevich, L, Gordon, D., Harel, M. and Dunkelblum, D. 1998. Evaluation of Shin-Etsu twist-tie rope
dispensers by the mating table technique for disrupting mating of the cotton bollworm, Helicoverpa armigera (Lepidoptera:
Noctuidae), and the pink bollworm, Pectinophora gossypiella (Lepidoptera: Gelechiidae). Bull. Entomol. Res. 88: 141-148.
[3] Shiller, I., L. W. Noble, and L.C. Fife. 1962. Host plants of pink bollworm. J. Entomol. 55: 67-70.
43
Impact of IRM Strategies on Bt Cotton
in Andhra Pradesh
T.V.K. Singh, N.V.V.S.D. Prasad, S. Sharma and S. Dayakar
Acharya N.G.Ranga Agricultural University, Rajendranagar, Hyderabad, India
Abstract—Cotton is extensively cultivated in entire Andhra Pradesh, which is one of the important agrarian states in
India under diverse farming situations with high inputs. Cotton in highly vulnerable to pest attack and insect pests
cause losses up to 87% in seed cotton yield (Taley et al. 1988). Among insect pests aphids [Aphis gossypii (Glover)],
Leaf hopper [Amrasca biguttula biguttula (Jshida)], whiteflies [Bemisia tabaci (Genn.)], thrips [Thrips tabaci (Linde)]
and boll worm complex viz., Gram caterpillar [Helicoverpa armigera (Hub.)], Tobacco caterpillar [Spodoptera litura
(Boisd.)] and Pink bollworm [Pectinophora gossypiella (Saund)] are considered to be the major constraints. Excessive
and indiscriminate use of insecticides in cotton has led to problems of insecticide resistance, pest resurgence,
accumulation of harmful residues and toxicity to non-target organisms. This has prompted the necessity for the
development of strategies for judicious management of insecticides and a window based insecticide resistance
management (IRM) strategies on cotton was implemented in three districts of Andhra Pradesh viz., Guntur,
Khammam and Kurnool. The strategies blend all crop production practices to incorporate proper and low use of
insecticides. Natural enemy populations are least disturbed and, different groups of chemicals are alternated.
The dissemination of insecticide Resistance Management (IRM) strategies at village level by way of trainings and
field visits prompted the adaptation of strategies by farmers for managing cotton pest complex on Bt cotton. To
disseminate IRM strategies, a total of 165 villages were adopted in three districts from 2008 to 2011 along with 75
villages that were selected as non IRM villages for comparing the impact of IRM strategies. The adoption of IRM
strategies led to reduction in pest incidence in IRM villages. Boll worm incidence was very less in IRM and non IRM
villages. The population of sucking pests was less in IRM villages than non IRM villages.
The strategic positioning of insecticides coupled with ecofriendly technologies led to abundance of natural enemies
in cotton ecosystem in IRM fields, while the incidence of these insects was lower in non IRM fields due to insecticidal
sprays. Impact of adoption of IRM strategies resulted in the reduction in insecticidal sprays (28.84%) in IRM villages
over non IRM villages. Cotton yield was higher in IRM adopted village (26.67 qt/ha) compared to non IRM villages
(22.46 qt/ha). Net profit per/ha was more in IRM villages than non IRM villages. Farmers, by adopting IRM
strategies realized higher net returns by saving in plant protection cost due to less number of insecticidal sprays and
increased seed cotton yield.
INTRODUCTION
Cotton popularly known as “white gold” is the most important commercial crop in India and plays a vital
role in agricultural, industrial, social and monetary affairs of the country. Area wise, India ranks first in
global scenario (about 33 per cent of the world cotton area) but with regard to production, it is ranked
next to China, which is the top producer (AICCIP,2011). The production increased from a meager 2.8
million bales (170 kg lint/bale) in 1947-48 to a high of 17.6 million bales in 1996-97 and a record of 31.5
million bales was recorded during 2007-08(AICCIP, 2008). During 2009-10, it was grown on an area of
10.3 million hectares with the production of 29.5 million bales and average lint yield of 486 kg/ha.
Among cotton growing states, Gujarat leads in production with 9.8 million bales followed by
Maharashtra (6.3 million bales) and Andhra Pradesh (5.2 million bales). However, the productivity of
cotton in India is still far less than other cotton growing countries of the world, viz., Australia (1579
kg/ha) Brazil (1480 kg/ha), China (1301kg/ha), USA (943 kg/ha), Uzbekistan (775 kg/ha) and Pakistan
(1579kg/ha) (AICCIP, 2011).
The insect pests are one of the major constraints in achieving optimum yield potential. Cotton crop
harbored 1326 species of insects from sowing to maturity in different cotton growing areas of the world
(Hargreaves, 1948) and 162 species have been reported on the crop in India. Among these, 9 are of
utmost importance inflicting significant losses in yield. The monetary value of yield losses due to insect
pests has been estimated to be Rs. 33, 9660/- million annually (Dhaliwal et al., 2010).
262
Before the introduction of Bt cotton, cotton growers were mainly using the synthetic insecticides to
combat the pests. As a result, bollworms, developed resistance to almost all major classes of pesticides.
Development of transgenic cotton resulted in an immense increase in seed cotton yield and reduction in
insecticidal sprays (Barwale et al., 2004) and it helped the farmers to manage the population of H.
armigera, the most important pest causing about 31.0 per cent loss in non-transgenic cotton (Grover and
Pental, 2003). Keeping in view the above facts, the present study on impact adoption of insecticide
resistance management (IRM) strategies in Bt cotton was planned to manage insect pests below
economic threshold level (ETL), reduction in number of sprays, and increase the cotton yield by
disseminating the IRM strategies in the adopted villages in Andhra Pradesh.
TABLE 1: DETAILS OF VILLAGES UNDER IRM AND NON-IRM IN ANDHRA PRADESH DURING 2010-11
Year
2008-09
2009-10
2010-11
TOTAL
No. of IRM
Villages
15
15
10
40
Guntur
No. of Non-IRM
Villages
2
5
5
12
Khammam
No. of IRM
No. of Non-IRM
Villages
Villages
15
15
15
15
10
3
40
33
Kurnool
No. of IRM
No. of Non-IRM
Villages
Villages
60
15
15
5
10
10
85
30
Total IRM Villages = 165
Total Non-IRM Villages = 75
MATERIAL AND METHODS
IRM module developed by CICR for Bt Cotton Pest Management was implemented for three consecutive
years during 2008 to 2011 and evaluated in 165 villages in three districts viz., Guntur, Khammam and
Kurnool districts of Andhra Pradesh. Seventy five villages were also selected as non IRM villages for
comparing the impact of IRM strategies(Table-1). A total of 6245 farmers (Table-2) followed IRM
strategies in an area of 12898.54ha during 2008 to 2011. Recommended package of practices of
ANGRAU was followed (ANGRAU Panchangam, 2011). In the beginning of every year, farmers were
educated about the IRM strategies. Various techniques, field days and field visits were conducted for
demonstrating IRM strategies in IRM adopted villages. Literature in local language pertaining to
agronomic practices, insect pests, economic threshold levels and their management strategies were
distributed to farmers.
TABLE 2: DETAILS OF BENEFICIARY FARMERS AND AREA COVERED IN ANDHRA PRADESH DURING
Year
2008-09
2009-10
2010-11
TOTAL
No. of IRM
Beneficiary
Farmers
737
653
420
1810
Guntur
Area
under
IRM (ha)
2252.50
1605.20
1026.20
4883.90
Area under
Non-IRM
(ha)
159.10
306.20
360.00
825.30
Khammam
No. of IRM
Area
Beneficiary under IRM
Farmers
(ha)
819
1110.50
787
1393.20
544
1175.20
2150
3678.90
Area under
Non-IRM
(ha)
62.10
1008.00
501.80
1571.90
Kurnool
No. of IRM
Area
Beneficiary
under
Farmers
IRM (ha)
1600
3343.56
385
565.40
300
426.78
2285
4335.74
Area under
Non-IRM
(ha)
536.20
128.94
32.00
697.14
IRM strategies which were implemented are as follows
Early Sucking Pests: No Foliar Spray (Till 60 Das)
•
•
•
•
•
•
Cultivation of sucking pest tolerant genotypes (Bt or non BT)
Intercropping with cowpea, soyabean and blackgram
Eradication of weeds in and around the cotton fields
Avoidance of chlorothalonil and organophospate sprays for sucking pest control
Stem application or soil application of dimethoate or acephate at 30-40 DAS and 50-60 DAS for
control of thrips, mirid bugs, mealybugs and other sucking pests
Neem oil 2.5 lit/ha mixed with 0.1% Nirma washing soap powder
Impact of IRM Strategies on Bt Cotton in Andhra Pradesh
263
Biological and Biopesticide Window (61-90 Das) Initial Bollworm Infestation
•
•
•
•
•
•
Verticillium lecanii to be used for sucking pest control especially for the control of mealy bugs
Cryptolaemus montrouzieri as inoculative releases on weeds or fruit crops adjacent to cotton
fields
Use of HaNPV on Bt cotton at 50% bollworm infested plants followed by the application of 5%
NSKE a week later
Not to spray against minor lepidopteran insects such as cotton leaf folder and cotton semilooper
Trichogramma can be used on non-Bt genotypes at 70-80 DAS
Not to spray Bt formulation on Bt cotton to avoid further selection pressure
Insecticide Window (91-120 Das)
•
•
•
Use of spinosad or emamectin benzoate on only non-Bt cotton at ETLs of 50% infested plants.
Avoid these insecticides on Bt cotton
Use of indoxacarb only once only on non-Bt cotton for control at ETLs of 90-100% plants
showing flared up squares
Use organophospate or carbamates only once either on Bt cotton or non-Bt cotton as effective
larvicides for control of bollworms at ETLs of 90-100% plants
Pink Bollworm Window (>120 Das) Pyrethroids
•
•
ETL based spray: Eight pink bollworm moths per trap per night for 3 consecutive nights. The
application of thiodicarb as late season sprays would be effective for pink bollworm
management.
Pyrethorid resistance in H.armigera is generally high, but pyrethroids are very effective against
pink and spotted bollworms and are ideally suited for the late season window.
The data pertaining to cultivation of different hybrids, sowing time, different agronomic practices
adopted along with the yeasrs by the individual IRM farmers was recorded and pooled.
Pests incidence: The population of leafhoppers, whiteflies, thrips, mealy bugs, tobacco caterpillar and
pink boll worm remained below the ETL in all the IRM adopted villages and was significantly less than
Non IRM villages (Table-3).
TABLE 3: OCCURRENCE OF INSECT PESTS AND NATURAL ENEMIES IN ANDHRA PRADESH PROJECT VILLAGES
Insects
Villages
IRM
Non-IRM
IRM
Whiteflies /3 leaves
Non –IRM
IRM
Thrips / 3 leaves
Non-IRM
IRM
Mealy bugs / 2.5 cm
Non IRM
IRM
Tobacco caterpillar/plant
Non-IRM
IRM
Pink Bollworm/plant
Non-IRM
IRM
Natural enemies/plant
Non-IRM
Leafhopper / 3 leaves
Guntur*
1.43
2.12
2.01
2.94
0.62
0.83
1.14
1.45
0.07
0.23
0.12
0.22
0.68
0.54
Khammam*
1.62
1.94
1.64
2.54
0.50
0.76
0.25
0.34
0.22
0.53
0.02
0.11
0.61
0.30
Kurnool*
1.33
2.41
1.87
2.48
0.41
1.14
0.11
0.19
0.55
0.62
0.09
0.23
0.63
0.20
*Mean of 3 years for the entire occurrence of insecticidal pest
The strategies positioning of insecticides coupled with ecofriendly technologies lead to abundance of
natural enemies in cotton ecosystem in IRM fields, while the incidence of these insects was lower in non
IRM fields due to insecticidal sprays (Table-3).
264
Impact of IRM strategies: The IRM strategies disseminated in IRM adopted villages on no. of sprays,
cost of sprays, cotton yield, gross income and net profit is presented in Table-4. The mean no. of sprays
for pests was 3.74 in IRM villages and 5.41 in non IRM villages. The mean cost of sprays was higher in
non-IRM villages (Rs.3230) as compared to IRM villages (Rs. 2244).
TABLE 4: IMPACT OF IRM TECHNOLOGY IN ANDHRA PRADESH
Attributes
No.of Sprays
Cost of sprays (Rs)
Cotton yield (qt/ha)
Gross income (Rs/ha)
Net profit (Rs/ha)
IRM Villages
3.74
2244
26.67
65264
41351
IRM Villages
5.41
3230
22.46
54420
34640
The yield was also higher in villages where IRM strategies were adopted (26.67 qt/ha) over non-IRM
villages (22.46 qt/ha). The grass income and net profit was more in IRM villages.
The present findings are in conformity with the results of Rajak et al., (1997) and Kranthi et
al.,(2000) who reported reduction in pesticide consumption in IRM adopted villages and increase in
yields.
ACKNOWLEDGEMENT
This work was funded by the Ministry of Agriculture under the Technology Mission on Cotton II through
DOCD with technical support in a network mode from Director, CICR, Nagpur.
REFERENCES
[1] AICCIP (2008)-All India Coordinated Cotton Improvement Project. Annual Report 2009-10, Central Institute of Cotton
Research, Regional station, Coimbatore. pp 3-5.
[2] AICCIP. (2011)- All India Coordinated Cotton Improvement Project. Annual Report 2010-11, Central Institute of Cotton
Research, Regional station, Coimbatore. pp 3-5.
[3] ANGRAU (2011)-Vyavasaya Panchangam ANGRAU, Hyd.
[4] Barwale, R.B., Godwal, V.R., Usha, Z. and Zehr, B (2004) - Prospect for Bt cotton technology is India. AgbioForm.7: 23-6.
[5] Dhaliwal, G.S., Jindal, V. and Dhawan, A.K. (2010) - Insect pest problems and crop losses: changing trends. Indian J.
Ecology 37: 1-7.
[6] Grover, A. and Pental, D. (2003) - Breeding objectives and requirements for producing transgenic for the major field crops
of India. Curr. Sci. 84: 310-20.
[7] Hargreaves, H. (1948) - List of recorded cotton insects of the world. Pp50. Commonwealth Institute of Entomology,
London.
[8] Kranthi, K.R., Banerjee, S.K. and Russell, D. (2000) - IRM strategies for sustainable cotton pest management in India.
Pestology 24: 58-67.
[9] Rajak, R.L.; Diwaker, M.C. and Mishra, M.P. (1997) - National IPM program in India. Pesticide Information 23: 23-26.
44
Efforts to Mitigate Stickiness Problem in Sudan
A. Abdelatif and E. Babiker
Agricultural Research Corporation, Sudan
Abstract—Stickiness is one of the limiting factors for cotton production and marketing in many countries and obliged
cotton grower, worldwide, to sell their sticky cotton at lower prices. In the Sudan, research programs were carried out
by Agricultural Research Corporation (ARC), addressing the causes and control measures in an attempt to find a
remedy for the problem. Of these efforts manipulating the morphological and physiological characters of the cotton
plant in such away to reduce the whitefly population and allow for easy biological, chemical and cultural control,
resulted in developing very promising lines. In addition, identification of the type of sugar causing cotton stickiness
and the establishment of reliable methods for grading cotton stickiness were developed. Stickiness research project was
endorsed and financed by the Common Fund for Commodities (CFC) during 1997-2001. The objectives of the project
were to develop a methodology to separate sticky from non-sticky cotton. Another objective of the project was the
determination of threshold levels of stickiness for spinning under different conditions to enable the utilization of sticky
cotton in spinning process.
The study revealed considerable variability in stickiness levels among the cotton production areas, and also,
considerably low levels of stickiness were observed in some schemes. Cultural practices were needed where a long term
improvement of stickiness free production were observed.
INTRODUCTION
Cotton “Gossypium” is the major natural textile fibre crop worldwide. In Sudan, cotton has been grown
for centuries. The cotton plant is indigenous and a number of its wild relatives (members of the genus
Gossypium) existed in various parts of the country.
Commercial growing of the crop, however, started in 1867. However, the big jump was in 1926,
which marked the official start of functioning of the Gezira Scheme. Likewise, large production has,
since the beginning, been backed by a strong research program The Agricultural Research Corporation
(ARC) has an intensive program to develop new varieties, increase yield and improve quality to meet the
recent demand of consumers. The bulk of the production is exported as raw fibre (90%) in a highly
competitive world market. During the last three decades Sudan cotton faced strong competition in the
world market. Sudan cotton suffered mainly from low yields and low quality due to contamination.
Major activities of the research program addressed the yield and fibre quality problems. In recent years,
however, contamination issues started to acquire their fair share in the research strategies. The main
objective of this paper is to focus on efforts to mitigate stickiness in cotton, grown in the Sudan.
STICKINESS PROBLEM
Stickiness was observed in Sudan since the early 1960’s, but was sporadic at that time and of little
importance. During the 1980’s the phenomenon became worldwide thus affecting marketability of Sudan
cotton. It caused substantial economic losses to the cotton producers, worldwide, and obliged them to sell
their sticky cotton at lower prices. In case of the Sudanese cotton the discount prices ranged from 5-30%.
(Fadlalla, 1998).
Stickiness of cotton lint was found to be caused by honey-dew excreted by the two insects whitefly
and aphids (Gameel 1969).However, other factors causing stickiness contamination has been reported in
the literature of these, broken seeds, immature fibres as well as sugary substance of cotton plant which
may directly or indirectly affect cotton lint at later processes. (Kalifa1980,Watson 2000).
NATIONAL RESEARCH PROGRAM
Intensive research was carried out regarding stickiness of cotton in Sudan. First, a scientific research
committee was established in 1967 with the objective of investigating the nature and the origin of
266
substance causing stickiness, then followed by the National Research Committee on Cotton severed
programs (Ali and Khalifa 1982, Khalifa 2001) were launched to address stickness. The programs
included:
•
•
•
•
•
Type of sugars causing cotton stickiness.
Quick methods for grading cotton stickiness
Ginning efficiency, and the spinning performance.
Integrated pest management (IPM package)
Breeding of cotton varieties tolerant to whitefly infestation.
These research programs continued and in a very short time main results by researcher were revealed.
Ali and Khalifa (1980) found that the sugar deposits mainly consist of fructose, glucose and mannose.
The whitefly excretions contained two additional unidentified components X and Y which were absent in
aphid secretions. They also reported that the sugar deposits causing stickiness were mainly the excretions
of whitefly; those of the aphids ranking second.
Results of the chemical method correlate very well with the results of the mini-card (Ali and Khalifa
1980). This method was modified to suit commercial application by shortening the test period, as well as
reducing the amount of the chemical used (Ali 1998). It was also reported that, the sticky cotton may
decrease the output of the roller gin to about 5-7 kg/gin/hour, compared to 25-30 kg/gin/hour for the
clean cotton (Khalifa and Gameel. 1983). It was found that the distribution of honeydew within the same
plant was variable. The level of cotton stickiness was higher in lint collected from bottom and middle of
the plant compared with the top (Khalifa 1982). Whitefly usually prefers humid, warm and shady
conditions, as well as protection from wind. (Gameel 1982). It was also found that the medium staple
cotton (Acala) showed higher stickiness level compared to extra long staple cotton (Barakat). This is
mainly because hirsutum (Acala) varieties are hairy and bushy, and hence more susceptible to whitefly
infestation (Khalifa 1982). It was found that a single adult could produce excretion that can cover 38
mm2 of leaf surface in one day (Gameel 1968).
The whitefly has a wide range of host plants and cotton is normally planted in Sudan during the
period July- August. When the other host plants start to dry up white flies migrate to cotton and start
breeding rapidly during September-November. They have about 10-12 generations per growing season
(Khalifa 1982). Also, distribution of honey-dew within the same plant was variable. A long term program
was conducted (early 1980’s) to breed for tolerant and resistant cultivars to whitefly infestation. Its main
objective was to manipulate the morphological and physiological characters of the cotton plant in such a
way so as to reduce the whitefly population and allow for easy biological, chemical and cultural control
(Okra shape – high gossypol content). Despite research effort the problem of stickness in Sudan cotton
persisted.
GLOBAL RESEARCH PROGRAM
Research programs addressing the causes and control measures were carried out by ARC. During 19982000, a stickiness research project financed by the Common Fund for Commodities (CFC) was executed
with the objectives of developing an objective methodology (rather than the current subjective methods
in use) to separate sticky from non-sticky cotton in order that the non-sticky part could be sold at due
price. The partners of this project were the Sudan Cotton Company (SCC) and the Agricultural Research
Corporation (ARC) in Sudan, the Institut Français du Textile et de l’Habillement (IFTH) and the Centre
de Coopération Internationale de Recherche Agronomique pour le Développement (CIRAD) in France.
The methodology was developed and, in addition, the study revealed considerable variability in
stickiness levels among the cotton production areas, and considerably low levels of stickiness were
observed in some schemes.
Efforts to Mitigate Stickiness Problem in Sudan
267
100
90
80
70
60
50
40
30
20
10
0
1989
1991
1993
1995
1997
1999
2001
2003
2005
2007
2009
2011
2013
Year
.
Source: Gourlot et al -2011: ITMF continuation survey (Gourlot et al., 2011) indicated that few stickness at a problem
with Sudaness cotton.
Fig. 1: Mentioned Stickiness Problems for Sudan Production (in % of Answers), ITMF Cotton Contamination Surveys
REFERENCES
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
Ali, N. A. and H. Khalifa (1980). Development of methods to measurecotton stickiness. Cot.Fib.Trop.xxv,4, 311-313.
Fadlalla, A.S. (1998), Summary of project Rationale, Objectives and
Execution. Annual Report, cotton Stickiness Project.
Khalifa, H. (1980). Cotton stickiness. Paper presented before the
Constituent Assembly of the International Committee for Cotton Testing, Bremen- Germany.
Khalifa, H. (1982) Variation of cotton stickiness and methods of sampling Proc. of International Committee for Cotton
Testing Conference.Bremen-Germany.
Khalifa, H. and Gameel. O.I. (1982). Breeding cotton varieties resistant to
Whitfly (Bemisa tabaci:Genn”).Symposium on cotton production and marketing. Khartoum..Sudan.pp.9.
Khalifa, H.(1982). The control of cotton stickiness through breeding resistant cotton (Bemisa tabaci:Genn”). Proc. Of
workshop of Advisory Group Meeting on the use of Nuclear Techniques for the improvement of oil seeds and other
industrial crops. Proc.IAEA/FOA p233-240, Dakar- Senegal.
Gourlot J.-P. ), Abdin M. A. ) and Latif A., Abdalla A. (2011) long term benefit of a CFC/ICAC project global improvement
of the situition
45
Present Status of Mealy Bug Phenacoccus solenopsis
(Tinsley) on Cotton and Other Plants
in Sindh (Pakistan)
Khuhro S.N.1, A.M. Kalroo1 and R. Mahmood2
1
Central Cotton Research Institute Sakrand–67210 Sindh–Pakistan
2
CABI South Asia, Rawalpindi–Pakistan
Abstract—In Pakistan mealy bug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) was recorded first
time in 2005 on cotton and other plants. The survey was carried out in different districts of Sindh to know the status
of the mealy bug on cotton and other plants. The pest was widely sprayed in the surveyed areas attacking a number of
plants including cotton. Mean maximum population (mealy bug 2nd & 3rd instars and adults/shoot) was recorded in
the districts Shaheed Benazirabad 46.93 followed by Ghotki district (38.88), Sukkur, (32.17), Naushahro Feroze
(32.07), Khairpur (29.67), and Dadu district (14.69). Mealy bug was recorded on 22 plants in Shaheed Benazirabad
district. On unsprayed cotton (95%) mealy bugs were found parasitized by Aenasius bambawalei Hayat, followed by
(92%), on Abutilon indicum (91%), okra (87%), datura, (86%) , china rose (80%) on egg plant, and on tomato (77%)
during 2010. However, mealy bugs parasitized by Aenasius bambawalei very low in 2011 due to indiscriminate use of
pesticides and appearance of hyper parasitoid. Different insecticides were also tested for controlling mealy bug on
cotton. Maximum mortality of the mealy bug recorded in plots treated with Movento 20 SC (95.2%), followed by
Movento energy 480 SC (94.8%), Confidor 50 SC+ Ultra (93.3%), Profenofos 50 EC (92.69%), Confidor 70 WG
(92.40%), Fyfanon 57 EC (91.1%), Bono 20 SC (89.60), and Malatox 57 EC (84.65%) up to one week of spray. The
meteorological data revealed that mealy bug was more common in the field at temperatures in the range of 30.539.5°C.
Keywords: Phenacoccus solenopsis, Aenasius bambawalei, Parasitism and population
INTRODUCTION
Cotton, Gossypium hirsutum L., is the most important fiber crop of Pakistan. It is used in textile as well
as oil industries and earns foreign exchange through export in shape of raw cotton, cotton yarn, cloth,
garments and other products. It makes about 80% of national edible oil production (Agha, 1994). It
engages millions of employees in the farms and factories. It provides edible oil, animal feed, fiber, and
fuel to a large proportion of the urban and rural populations. It supplies raw material for about 1200
ginning units, 180 spinning units, about 470 textile mills, and 50 vegetable oil mills operating in the
country. It is also a major export item from the crop sector because it directly or indirectly contributes
about 66 percent to Pakistan’s export earnings (Government of Pakistan, 1995). Unfortunately, the crop
was severely attacked by many sucking and chewing insect pests including cotton mealy bug. Mealy
bugs have recently become abundant on cotton in Pakistan. These soft bodied insects belong to family
Pseudococcidae of order Hemiptera. About 5000 species of mealy bugs have been reported from 246
families of plants throughout the world. Among these, 56 species have been reported from 15 genera of
family Malvaceae, including cotton and many other plants of economic importance (Ben-Dov, 1994).
Mealy bugs were never been reported from cotton in Pakistan until 2005 when for the first time
Phenacoccus solenopsis Tinsley was recorded from Vehari-Punjab. This insect alone was held
responsible for the loss of 0.2 million bales (bale weighs 375 lbs or 170 kg) in 2007 in Pakistan
(Muhammad, 2007). Mahmood et al (2011) reviewed its world distribution. According to them it is a
new world species and has recently entered a number of countries in Asia and Australia. They reported
that this insect is widespread on the plains of Pakistan. Results of present studies carried out in different
districts of Sindh on its distribution and abundance are reported in this paper.
Present Status of Mealy Bug Phenacoccus solenopsis (Tinsley) on Cotton and Other Plants in Sindh (Pakistan)
269
Mealy Bug Population on Cotton and other Hosts
Regular survey of mealy bug was under taken to record the phenology and host range in different
areas/districts of upper Sindh including Shaheed Benazirabad, Naushahro Feroze, Dadu, Khairpur,
Sukkur and Ghotki from May to December 2010. Five terminal shoots each measuring 15cm long were
taken at random one each from the four corners and in the center of the of the cotton field. Samples of
mealy bugs collected from fields were kept in jars (laboratory (at 26± 2oC temperature and 75.5% R.H).
Samples were kept in Petri-dishes for a week for parasitoids emergence, in the lab 20C temperature and
75.5% R.H. Counts were made of healthy and mummified 2nd, 3rd instars and adult mealy bug individuals
from the samples. The observations on cotton were made from May to December 2010. Samples of same
size were also taken from other plants where the mealy bug was found. Similar experiments were
improved upon in 2011.
Efficacy of Insecticides for Controlling Mealy Bug on Cotton Crop
Eight insecticides were tested for the efficacy against cotton mealy bug. The crop was sown on 27-052010 and crop was sprayed on 03-08-2010. The trial was conducted at CCRI-Sakrand Farm in
Randomized Complete Block Design (RCBD) with four replications. Plot size was kept at 30’ x 40’.
Spray were initiated when the mealy bug population increased. The control plot was kept unsprayed for
comparison of the pest population.
Phenology
During observations the mealy bug was found breeding profusely on cotton and other plants in MayDecember. It seems to breed almost throughout the year.
Population Trends of the Mealy Bug on Cotton
The results showed that the mealy bug infestation started initially after germination of cotton plants. The
minimum infestation was in June, 2010 and maximum in September was recorded at all areas surveyed
(Table-1). The mealy bug infestations were comparatively higher at Shaheed Benazirabad and Ghotki,
compared with Khairpur, Naushahro Feroze, Sukkur and Dadu districts of Sind province (Table-1).
TABLE: 1. POPULATION OF MEALY BUG IN DIFFERENT DISTRICTS OF SINDH-IN 2010
Mealy bug Numbers Per Terminal Shoot in Following Districts
Shaheed Benazirabad Naushahro Feroze
Dadu
Khairpur
Sukkur
Jun.
10.14
5.11
0.78
0.14
4.45
Jul.
16.33
14.11
2.36
3.43
13.78
Aug.
23.70
17.10
7.10
19.30
16.8
Sept.
84.30
8.54
18.0
60.80
24.10
Oct.
113.00
98.30
22.45
67.30
65.80
Nov.
50.00
76.00
39.75
53.67
86.50
Dec.
31.00
5.29
12.33
3.00
13.75
Mean
46.93
32.07
14.69
29.67
32.17
Mealy bug on plants other than cotton
Ghotki
0.22
13.50
10.90
133.33
72.20
39.00
3.00
38.88
The mealy bug was recorded from more than 22 plants however it was consistently found on egg
plant, tomato, Abutilon indicum, okra, hollyhock and china rose. At the peak period of its population in
September, it was found most abundant on cotton, followed by china rose, Abutilon indicum, okra,
eggplant, tomato and hollyhock (Table-2). Commonality of the mealy bug on different plants has been
reported by Arif, et al. (2009) who reported the inadence of mealy bug Phenacoccus solenopsis on about
154 plants but was most abundant on cotton.
270
TABLE 2: MEALY BUG POPULATIONS ON DIFFERENT PLANTS HOSTS IN SINDH IN SEPTEMBER, 2010
English/ Local Name
Egg plant
Tomato
Abutilon
Cotton
Datura
Okra
Hollyhock
China Rose
1.
2.
3.
4.
5.
6.
7.
8.
Technical Names
Solanum melongena
Lycopersicon esculentum
Abutilon indicum
Gossypum hirsutum
Datura alba
Abelmoschus esculentus
Alcea setosa
Hibiscus rosa-sinensis
Mean Mealy Bug Infestation/ Shoot
45.12
23.41
65.74
84.64
24.46
77.13
12.71
69.23
Natural Enemies of the Mealy Bug
Since mealy bug appearance was recorded during 2005 in Pakistan only insecticides have been tried to
control the mealy bug on cotton. Natural enemies did not have much role in controlling the mealy bug.
Mahmood et al. (2011) developed techniques of conserving predators and parasitoids in field conditions
and successfully bred millions of parasitoids and predators using plant debris (mealy bug infested drying
twigs and leaves). They reported a number of predators associated with the mealy bug in 2006-2007,
however, parasitoid Aenasius bambawalei Hayat was first time reported during 2008 from Tando Jam
Sindh-Pakistan (Solangi and Mahmood, 2011). This parasitoid spreads fast and keeps the mealy bug
under control. In sprayed cotton fields though parasitoid was rare it was most common on unsprayed
cotton fields and helped keep the pest under control (Table- 3). The parasitoid was not only common in
cotton but also was common on other plants and most of the mealy bugs were found parasitized. In 2011
the parasitoid’s population was less than 2010 (Table-4).
The main reason of low population of parasitoid is the adverse effect of large scale use of pesticides
in cotton and vegetables. Moreover a hyper parasitoid Promuscidea unfasciativentris Girault has
appeared thereby impacting parasitoid population. As a result of decline in population of the parasitoid
the mealy bug population has increased severely.
TABLE 3: PARASITISM OF AENASIUS BAMBAWALEI ON DIFFERENT HOST PLANTS AT SHAHEED BENAZIRABAD DISTRICT IN AUGUST 2010
1.
2.
3.
4.
5.
6.
7.
English/Local Name
Eggplant
Tomato
Abutilon
Cotton
Datura
Okra
China Rose
Technical Names
Solanum melongena
Lycopersicon esculentum
Abutilon indicum
Gossypum hirsutum
Datura alba
Abelmoschus esculentus
Hibiscus rosa-sinensis
Parasitism Percent
80
77
92
95
87
91
86
Efficacy of Insecticides for Controlling Mealy bug on Cotton Crop
TABLE 5: EFFICACY OF INSECTICIDES FOR CONTROLLING MEALY BUG AT CCRI-SAKRAND DURING AUGUST 2010
Treatment
Bono 20 SL
Malatox 57 EC
Profenofos 50 EC
Confidor 20 SC
Fyfanon 57 EC
Confidor 20 SL+ ultra
Confidor 70 WG
Movento energy 480 SC
Control
Dose/ acre (ml/g)
125 ml
750 ml
500 ml
250 ml
500 ml
250 ml
140 gm
150 + 250 ml
-
Post-Treatment Average
Population/Shoot
48 hours
72 hours
1 week
26.07
17.41
13.17
31.12
22.01
19.45
18.31
11.21
9.26
17.0
8.0
5.0
33.0
21.0
10.0
34.0
13.0
7.0
25.0
12.0
7.0
30.0
10.0
5.0
112.81
121.62
126.74
Mortality (%)
48 hours
76.89
72.41
83.76
83.5
66.6
65.8
74.6
70.2
-
72 hours
85.70
81.90
90.78
93.5
82.9
89.8
88.1
91.6
-
1 week
89.60
84.65
92.69
95.2
91.1
93.3
92.4
94.8
-
Present Status of Mealy Bug Phenacoccus solenopsis (Tinsley) on Cotton and Other Plants in Sindh (Pakistan)
271
Results given in Table-5 indicate that, Movento 20 SC gave maximum (95.2%) mortality followed
by Movento Energy 480 SC, Confidor 50 SC+Ultrs, Profenofos 50 EC, Confidor 70 WG, Fyfanon 57
EC, Bono 20 SC and Malatox 57 EC up to one week of spray. Similes results were reported by (Aheer,
et al. 2009) who also mentioned that all tested insecticides proved significantly effective against mealy
bug up to 7 days after treatment.
METEOROLOGY DATA
The meteorology data was recorded during the survey of cotton mealy bug at CCRI-Sakrand Farm. The
results showed that the mealy bug built up its population when the temperature 290C and was maximum
in the temperature range of 30.5-39.50 C and decreased at temperatures below 290C. (Table 2,3&6).
TABLE 6: METEOROLOGICAL DATA OF 2010 SEASON RECORDED AT CENTRAL COTTON RESEARCH INSTITUTE, SAKRAND, SINDH-PAKISTAN
Month
Jun.
Jul.
Aug.
Sep.
Oct.
Nov.
Dec.
Mean Mealy Bug
Population/ Shoot at
Shaheed Benazirabad
10.14
16.33
23.70
84.30
113.00
50.00
31.00
Average
Maximum Temp.
and Range oC
40.6(29.0-45.0)
38.6(35.0-43.0)
35.7 (30.0-38.0)
34.3 (33.5-38.0)
35.7 (30.5-39.5)
29.1(24.0-33.0)
23.2(20.0-25.0)
Average
Minimum Temp.
and Range (oC)
27.4 (25.0-31.0)
28.1(24.5-29.0)
27.2 (24.5-29.0)
25.1(21.5-30.0)
21.9(18.0-25.0)
14.9 (8.5-20.5)
7.5(4.0-10.0)
Mean relative
Humidity and
Range (%)
57.8(47.0-91.5)
65.7(56.0-90.5)
73.8(63.5-90.5)
75.6(56.0-93.5)
55.9(41.7-66.0)
52.7(41.3-69.0)
55.3(42.0-72.7)
Rainfall
(mm)
45.2
136.2
72.0
50.0
-
ACKNOWLEDGEMENT
We acknowledge the financial assistance by former Ministry of Food and Agriculture, Government of
Pakistan through PSDP, to carry out the present studies under the project “Biological control of major
cotton pests including mealy bug in Pakistan Sakrand Component”. We specially thank Mr. Arshad
Ahmed, Vice President and Dr. Tasawar Malik, Ex-Director Research, Pakistan Central Cotton
Committee (PCCC) and Dr. Ibad Badar Siddiqi, Project Director BCMCP for their consistent support in
conducting research.
REFERENCES
[1] Agha, H. K. 1994. Crop Production. Published by Pakistan Book Foundation, Islamabad Pp.6.
[2] Aheer, G. M. Riaz Ahmad; Amjad Ali . 2009. Efficacy of different insecticides against cotton mealybug, Phenacoccus
solani Ferris. Journal of Agricultural Research (Lahore) Vol. 47 No. 1 pp. 47-52
[3] Arif M.I, Wazir S, Rafiq M, Ghaffar A, and Mahmood R. 2011. (Incidence of Aenasius bambawalei Hayat on mealybug
Phenacoccus solenopsis Tinsley and its hyperparasite, Promuscidea unfasciativentris Girault at Multan).
http://www.icac.org/tis/regional_networks/asian_network/meeting_5/documents/papers /PapArifMI-et_al.pdf
[4] Arif, M.I., M. Rafiq, and A. Ghaffar, 2009. Host plants of cotton mealy bug (Phenacoccus solenopsis): A new menace to
cotton agro ecosystem of Punjab, Pakistan. International Journal of Agriculture and Biology 11: 163-167.
[5] Ben-Dov, Y. 1994. A systematic catalogue of the mealy bugs of the world (Insecta: Homoptera: Coccoidea:
Pseeudococcidae and Putoidae). Intercept Ltd., Andover, P: 686.
[6] Mahmood, R, M. N. Aslam, G. S. Solangi and A. Samad. 2011. Historical Perspective and achievements in biological
management of cotton mealy bug Phenacoccus solenopsis Tinsley in Pakistan. 5th Meeting Asian Cotton Research and
Development Network, held during February 23-25. Lahore, pp. 1-17. Online at:
[7] http://www.icac.org/tis/regional_networks/asian_network/meeting_5/documents/papers/MahmoodR.pdf
[8] Muhammad, A. 2007. Mealy bug: Cotton Crop’s Worst Catastrophe. Centre for Agro-Informatics Research (CAIR),
Pakistan. Available on-line at http://agroict.org/pdf_news/Mealybug.pdf accessed Jul.2008 (verified 27 May 2009).
[9] Government of Pakistan, 1995. Economic Survey, 1994-95. Islamabad: Finance Division, Economic Adviser’s Wing.
[10] Solangi G. S. and R. Mahmood. 2011. Biology, host specificity and population trends of Aenasius bambawalei Hayat and
its role in controlling mealy bug Phencoccus solenopsis Tinsley at Tandojam Sindh. 5th Meeting Asian Cotton Research
and Development Network held on February 23-25. Lahore, pp. 1-7. Online at:
[11] http://www.icac.org/tis/regional_networks/asian_network/meeting_5/documents/papers/PapSolangiGS-et_al.pdf
46
Changing Scenario of Cotton Diseases
in India—The Challenge Ahead
D. Monga1, K.R. Kranthi2, N. Gopalakrishnan3 and C.D. Mayee4
1
Central Institute for Cotton Research (CICR), Regional Station, Sirsa
2
C.I.C.R. Nagpur, 3Rishi Bhawan, New Delhi
4
Agriculture Scientists Recruitment Board, New Delhi
Abstract—The cotton disease scenario has shown a continuous change during the past sixty four years since
independence. When mainly indigenous diploid cottons were being grown in fifties, Fusarium wilt, root rot, seedling
blight, anthracnose and grey mildew were the major problems. With the large scale cultivation of tetraploid upland
cotton (Gossypium hirsutum), bacterial blight became the major disease to which indigenous cottons were highly
resistant. After the introduction of Bt cotton hybrids during 2002 onwards and continuous increase in area under
these hybrids to around 85% of total cotton area till date, the disease scenario has also shown some change. The grey
mildew, once a serious problem for diploid cottons especially in central India has now become a major problem in Bt
cotton hybrids. Grey mildew (percent disease intensity) in central zone was recorded on Bt cotton hybrids during
2010-11 in Maharashtra in the irrigated areas of Vidarbha region (9.2 to 20.4 % & Nanded-6.5 to 27.2%). In south
zone it was severe in two states i.e. Karnataka (5.0-30.0%), and Andhra Pradesh (28.9-46.4) during the season.
Among other important diseases on Bt hybrids, Bacterial blight was reported as important disease in central zone in
Maharashtra ( Vidarbha- 8.3 to 22.2 %; Nanded 2.2 to 15.7 %) and in south zone in Karnataka (5.0-15.0 %) and
Andhra Pradesh ( 8.0-47.6%). Alternaria blight was observed serious during 2010-11 season in Gujrat’s Saurashtra
area (2.0-15.0%) and Maharashtra’s Rahuri (10.2-35.8%) and Nanded (5.0-21.5%) and in south zone states ie
Karnataka (5.0-30.0%), Andhra Pradesh (10.0-54.6%) and Tamil Nadu from 12.6 to 38.8%. (Anonymous 2011).
Fusarium wilt has become less important as upland cotton now occupying 85% area is immune to Indian race of
the pathogen. Verticillium wilt which appeared in Tamil Nadu remained restricted mainly to that state only.
In north India, the leaf curl disease caused by gemini virus and transmitted by white fly Bemisia tabaci has
become a threat to cotton cultivation due to development of new recombinant strains and introduction of a number of
susceptible Bt cotton hybrids in north zone. A disease identified as Tobacco Streak Virus (Ilar virus) transmitted by
thrips was observed in the transgenic cotton growing region of Southern Maharashtra and Andhra Pradesh. (Sharma
et al, 2007). Avoidable losses due to important diseases like cotton leaf curl virus, (53.6% ),bacterial leaf
blight(20.6%), Alternaria leaf spot (26.6%), grey mildew( 29.2%)and Myrothecium leaf spot ( 29.1%) have been
documented. Newer chemicals like propiconazole, captan+hexaconazole, tetraconazole and strobilurin compounds
(fungicides) and copper hydroxide (bactericides) have been successfully tested for the management of foliar disease of
cotton. Strategies for the integrated management of diseases causing losses in terms of yield and quality need to be
redefined.
INTRODUCTION
Cotton is an important crop for the sustainable economy of India and livelihood of the Indian farming
community. It is cultivated in 11.0 M hectares in the country. India accounts for about 32% of the global
cotton area and contributes to 21% of the global cotton produce, currently ranking second after China.
The production increased from a meager 2.3 M bales (170 kg lint/bale) in 1947-48 to an all time highest
record of 31.5 M bales during 2007-08. Cotton provides employment and sustenance to a population of
nearly 42 M people, who are involved directly or indirectly in cotton production, processing, textiles and
related activities. India has the unique distinction of being the only country in the world to cultivate all
four cultivable Gossypium species, Gossypium arboreum and G.herbaceum (Asian cotton), G.
barbadense (Egyptian cotton) and G. hirsutum (American upland cotton) besides hybrid cotton.
Approximately 65% of India’s cotton is produced under rainfed conditions and 35% on irrigated lands.
Cotton is cultivated in three distinct agro-ecological regions (north, central and south) of the country. The
northern zone is almost totally irrigated, while the percentage of irrigated area is much lower in the
central (23%) and southern zones (40%). Cotton crop is particularly sensitive to a number of biotic and
abiotic stresses and the disease problems are also distinct to some extant in agro-ecological regions
Changing Scenario of Cotton Diseases in India—The Challenge Ahead
273
referred above. A number of diseases are prevalent on cotton crop in one part of the country or another.
Under north zone, cotton leaf curl virus and root rot diseases are the major problems whereas grey
mildew, bacterial blight and Alternaria blight are severe in one or the other region in central and southern
zone.
In the present review paper, the historical background and present status of cotton diseases in India has
been presented. The information gathered on seed borne diseases, soil borne diseases and emerging
diseases is highlighted. Among emerging diseases, cotton leaf curl virus, grey mildew and fungal foliar
diseases are covered. An attempt is made to present this information in the context of Bt cotton hybrids
presently grown in the country. This is followed by information on changing disease scenario of
important diseases with major emphasis on cotton leaf curl virus disease and development of new
recombinants during recent years, preparation of disease maps and epidemiological studies and their
implications on disease scenario. Economic losses due to diseases and new molecules for disease
management are described in subsequent sections.
A number of diseases are prevalent on cotton crop in one part of the country or another (Table 1).
TABLE 1: MAJOR COTTON DISEASES IN INDIA AND EMERGING SCENARIO
Disease
Cotton leaf curl
Grey mildew
Bacterial blight
Alternaria leaf spot
Myrothecium leaf spot
Leaf Rust
Cercospora leaf spots
Helminthosporium leaf spots
Anthracnose
Tobacco streak virus
Wilt
Root rot
Verticillium wilt
Causal Agent
Seed Borne and Foliar Diseases
Gemini virus
Ramularia areola
Xanthomonas axanopodis pv malvacearum
Alternaria macrospora
Myrothecium roridum
Phakopsora gossypii
Cercospora gossypina
Helminthosporium gosyypii
Colletototricum capsici
Ilar virus
Soil Borne Diseases
Fusarium oxysporum fsp.vasinfectum
Rhizoctonia solani, R. bataticola
Verticillium dahliae
Remark
North zone (Potential threat)
Central & South zone (Emerging)
Maharashtra, Gujrat, Karnataka
Maharashtra, Gujrat, Karnataka
Madhya Pardesh
Kanataka, Andhra Pardesh (Emerging)
Andhra Pardesh (Minor)
Andhra Pardesh (Minor)
South zone (Minor)
Andhra Pardesh(Emerging)
Restricted to diploids
Scattered
Tamil Nadu, Karnataka
HISTORICAL BACKGROUND AND PRESENT STATUS OF COTTON DISEASES IN INDIA
The cotton disease scenario has shown a continuous change during the past sixty four years. Initially,
mainly indigenous diploid(Gossypium arboreum & G herbaceum)cottons were being grown in fifties and
the Fusarium wilt, root rot, seedling blight, anthracnose and grey mildew were the major problems. With
the large scale cultivation of tetraploid upland cotton (G hirsutum), bacterial blight became the major
problem to which indigenous cottons were highly resistant. The susceptibility of American cottons is
attributed to their not having been exposed to the disease till its introduction into the Americas in post–
Columbian times. Fusarium wilt became less important as upland cotton (Bt cotton hybrids) now
occupying above 85 percent area is immune to Indian race of the pathogen. Verticillium wilt which
appeared in Tamil Nadu remained restricted mainly to South zone only. The grey mildew, once a serious
problem for diploid cottons especially in central India with the continued cultivation and imposed
selection pressure got adopted to tetraploid cotton and their hybrids as well. Presently, it is a problem in
central and south India in Bt-cotton hybrids. Alternaria blight and Myrothecium leaf spots are prevalent
everywhere but are severe in the states of Karnataka and Madhya Pardesh, respectively. Other diseases
such as Cercospora and Helminthosporium leaf spots are sporadic only. Rust, although a minor disease
may assume significance in southern states in near future. In north India, the cotton leaf curl virus disease
(CLCuD) caused by a Gemini virus and transmitted by whitefly, Bemisia tabaci has become a major
threat to cotton cultivation since its appearance in 1993.
274
Grey mildew (percent disease intensity) in central zone was recorded on Bt cotton hybrids during
2010-11 in Maharashtra in the irrigated areas of Vidarbha region (9.2 to 20.4 % & Nanded-6.5 to 27.2%).
In south zone it was severe in two states ie Karnataka (5.0-30.0%), and Andhra Pradesh (28.9-46.4)
during the season. Among other important diseases on Bt hybrids, Bacterial blight was reported as
important disease in central zone in Maharashtra (Vidarbha - 8.3 to 22.2 %; Nanded 2.2 to 15.7 %) and in
south zone in Karnataka (5.0-15.0 %) and Andhra Pradesh (8.0-47.6%). Alternaria blight was observed
serious during 2010-11 season in Gujrat’s Saurashtra area (2.0-15.0%) and Maharashtra’s Rahuri (10.235.8%) & Nanded (5.0-21.5%) and in south zone states ie Karnataka (5.0-30.0%), Andhra Pradesh (10.054.6%) and Tamil Nadu from 12.6 to 38.8%. (Anonymous 2010). A disease identified as Tobacco Streak
Virus (Ilar virus) transmitted by thrips was observed in the transgenic cotton growing region of Southern
Maharashtra and Andhra Pradesh. (Sharma et al, 2007). During the surveys conducted around Guntur
(Andhra Pradesh) from September 2010 to January 2011 Tobacco Streak Virus disease incidence on
different Bt cotton hybrids varied from 1.0 to 43.7%. Maximum incidence was recorded during
September in four months old crop. The disease did not appear to cause significant losses at present
(Anonymous,2011).
The prevailing disease problems can be broadly divided into (i) Seed borne diseases (ii) soil borne
diseases and (iii) Emerging diseases.
Seed Borne Diseases
Studies on seed transmission of cotton diseases conducted at central institute for cotton research, Nagpur
(1983-1998) have indicated that leaf and boll spot pathogen Alternaria macrospora and the anthracnose
pathogen Colletotricum capsici could become deep seated (embryo borne) and seed transmitted in diploid
cottons (Gossypium arboreum, G herbaceum) varieties and hybrids. The bacterial blight caused by
bacterium Xanthomonas axanopodis pv. malvacearum was found seed transmitted mainly in tetraploid
cotton (G hirsutum, G barbadense) varieties and hybrids. The black boll rot fungus Botrydiplodia
theobromae and the stem break/root rot pathogen Macrophomina phaseolina were recorded seed
transmitted both in diploid and tetraploid varieties and hybrids (Mukewar and Kairon,2001).
Myrothecium blight has also been shown as seed borne in nature ( Srinivasan, 1994).
Soil Borne Diseases
Root Rot caused by Rhizoctonia solani and R. bataticola and wilt caused by Fusarium oxysporum f.sp.
vasinfectum are the two major soil borne fungal disease problems in India. Another soil borne disease
Verticillium wilt has been observed in some areas of Tamil Nadu and Karnataka. The root rot disease is
serious in northern India and detailed studies on various aspects have been undertaken (Monga and
Raj,1994; Monga and Raj,1994a; Monga, 1995 ; Monga and Raj, 1996; Monga and Raj,1996 b; Monga,
1997; Monga and Raj,2000 ; Monga, 2001 ; Monga and Raj, 2003 ; Monga, et. al., 2004a). The disease
affects both the hirsutum (American cotton) and arboreum (Desi) cotton species, being more serious on
desi cottons (Monga and Raj, 1994a). The wilt disease caused by Fusarium oxysporum f sp. vasinfectum
appears at any stage of plant development and affects only Desi cottons. Symptoms of Verticillium wilt
depend on the cultivar, virulence of the fungal isolate, development stage of the plant and environmental
conditions especially temperature.
EMERGING DISEASES
Cotton Leaf Curl Virus Disease
Cotton leaf curl virus disease caused by whitefly (Bemisia tabaci) transmitted Gemini virus with single
stranded circular DNA was observed during 1993 around the border areas in Rajasthan and Punjab. The
disease in a short span of 4-5 years spread in the entire north zone as the G hirsutum varieties like F-846,
RST-9 and HS-6 being grown in the region at that time were highly susceptible to this disease. The
initiation of disease is characterized by small vein thickening (SVT) type symptoms on young upper
275
leaves of plants. Upward/downward leaf curling followed by formation of cup shaped leaf laminar out
growth of veinal tissue on the abaxial side of the leaves is other important symptom. In severe cases
reduction of internodal length leading to stunting and reduced flowering/fruiting is also noted.
TABLE 2: PROMISING CLCUD TOLERANT VARIETIES/ HYBRIDS/ BT HYBRIDS IN NORTH ZONE
Name of Variety/ Hybrid
H-1226, H-1117(Varieties), HHH-223, HHH-287(Hybrid)
F-1861,LH 2076(Varieties), LHH-144 (Hybrid )
RS-875, RS-810,RS-2013
Shresth (CSSH 198), Kalyan (CSHH-238), Simran (CSHH 243)
MRC 7361, MRC 6025, MRC 7031 BG II, MRC-7017 BG II,
MRC-6304, SP-7007, SP-7010,SWCH 4711, BIOSEED 6488,
BIOSEED 6488 BG-II, BIOSEED 6317, BIOSEED 2113,
BIOSEED 6588 BGII, PCH 877, BIOSEED 6588, ANKUR
3028, SHAKTI -9, VBCH 1008, VBCH 1534, VBCH 1518
BGII, NCEH 31, NCEH 6, JKCH-1, RCH 605, RCH 569 BG
II, NCS 855 BGII, NCS 905, VICH-307, VICH-309 BGII, PCH
401,
Source
CCS Haryana Agricultural University, Hisar
Punjab Agricultural University, Ludhiana
Rajasthan Agricultural University, (Bikaner) Sriganganagar
Central Institute for Cotton Research, Regional Station,
Sirsa
Private Sector
TABLE 3: COTTON LEAF CURL VIRUS DISEASE HOSTS REPORTED FROM INDIA
Name of Host
Sida sps, Abutilon Indicum, Hibiscus rosa
sinensis, Althea rosea
Phaseolus vulgaris, Capsicum annum, Nicotiana
tabacum, Lycopersicum esculentum
Abelmoschus esculentus, Althea rosea, Physalis
floridana, Nocotiana benthamiana, Phaseolus
vulgaris
Althea rosea, Sida sps., Ageratum sps., Hibiscus
rosa sinensis
Tribulus terrestris, Cucumis sps.
Chorchorus acutangularis, Melilotus indica,
Ageratum conyzoides
Nicotiana tabacum, Lycopersicum esculentum,
Zinnia elegans, Mentha arvensis, Capsicum sps,
Hibiscus rosa sinensis, Abelmoschus esculentus,
Sida alba
Sida sps., Achyranthus sps., Clearodendron sps.
Convolvulus arvensis, Capsicum sps., Pathenium
sps., Solanum nigrum, Digeria arvensis, Lantana
camara, Achyranthus aspera, Chenopodium album,
Spinacea sps., Xanthium strumarium
Type of Test
Based on visual symptoms
Reference
Singh et al.,1994
Transmission studies and ELISA
Nateshan et al.,1996
Transmission studies
Radhakrishnan et al., 2001
DNA-A probe hybridization
Sharma, 2002
CLCuRv-CPgene and DNA beta
amplification
DNA-A & DNA beta probe
hybridization
PCR using CP primer
Sivalingam et al., 2004
CP gene amplification
CP gene amplification
Monga et al., 2005
Monga et al., 2011b
Radhakrishnan et al., 2004
Kang et al., 2004
A vigorous exercise was then taken up by the state agricultural universities and institutions under
Indian Council of Agricultural Research (ICAR) in the region to work out strategies for its management.
Molecular diagnostic tools for detection of virus were developed.(Chakrabarty et al., 2005). The disease
could be managed by development of resistant varieties/hybrids (Table 2), control of its vector whitefly
and eradication of weeds (Table 3) harboring cotton leaf curl virus disease (Narula et al., 1999 and
Monga et al., 2001). The disease was brought under control and the damage caused by it was
considerably reduced. The disease till date is restricted to northern cotton growing zone.
The Bt cotton hybrids were introduced in north zone in 2005 by the private sector initially with six
hybrids approved by Genetic Engineering Approval Committee. Subsequently, however, a large number
of hybrids were permitted for cultivation with in a span of five years and amongst them a number of
hybrids were observed to be highly susceptible to cotton leaf curl virus disease. As a result, the incidence
of disease increased and it became an emerging problem after the introduction of susceptible Bt cotton
hybrids in north zone. Yield loss estimation was studied in Bt cotton hybrids from 2008-09 to 2010-11
based on percent disease index (PDI) ranging from 5% to 60% and disease severity grades from I to IV.
276
Based on PDI seed cotton yield reduction ranged from 0.08-59.5% at 5-60 PDI. Seed cotton yield
reduction ranged from 7.2-80.1% at severity grades of one to four in different hybrids (Monga
et al., 2011b). At present, Bt cotton hybrids tolerant to cotton leaf curl virus disease have been identified
under Technology Mission of Cotton project and being advocated to farmers (Table 2).Experiments
conducted under AICCIP (2009-11) have shown average losses of 53.6% in some Bt cotton hybrids.
Grey Mildew
The disease caused by Ramularia areola is characterized by irregular, angular, pale, translucent spots
measuring 1-10 mm in size surrounded by veinlets. The disease appears on the older leaves usually when
the plants are reaching maturity. A frosty or mildew growth consisting of conidiophores of the fungus
appear first on the under surface and subsequently on the upper surface of affected leaves. As the
infection progresses leaves become yellowish brown and fall off prematurely. The incidence of grey
mildew is assuming a serious position in central and southern zone. Majority of released Bt hybrids fall
in moderately susceptible to highly susceptible category (Hosagoudar et al., 2008).
Foliar Spots
The bacterial blight caused by Xamthomonas axanopodis pv malvacearum with four distinct phases of
the disease (seedling phase, angular leaf spot and vein blight phase, black arm phase and boll rot phase)
used to cause considerable losses till 90’s. Gossypium barbadense is more severely affected than G.
hirsutum. Resistant genes and occurrence of physiological races of the pathogen were described in detail.
Sources of resistance available in G hirsutum include 101-102B, BJA-592, Reba B-50, P14-T-128, HG-9,
Tamcot-CAMD-E, TxBonham, BJR 734, C-1412, Badnawar-1 and Khandwa-2 and have been used
extensively to develop resistant varieties/hybrids ( Srinivasan, 1994). The primary symptoms due to
Alternaria macrospora on leaves are small pale to brown round or circular spots (0.5-3.0 mm diameter)
showing concentric rings with cracked centre. These spots coalesce to form larger lesions (1 cm
diameter). Severe infection may lead to considerable defoliation. Stem cankers are formed in severe cases
and the infection may even reach bolls. Natural infection of seeds or seed inoculation results in disease
on cotyledons. The characteristic symptoms caused by Myrothecium roridum are the appearance of
circular or oval light ash coloured spots with violet to reddish brown margin. Fruiting bodies
(Sporodochia) are produced in concentric rings and protrude from lower as well as upper surface of
leaves. Under severe conditions, the lint gets strained to yellow or light brown. The rust caused by
Phakospora gossypii (Arth) Hirat. F. occurs sporadically in Tamil Nadu, Andhra Pardesh and Karnataka
during December-March. Its early appearance has potential to cause considerable loss by decreasing the
photosynthetic area and heavy defoliation. The pathogen initially affects the older leaves and then
spreads to the younger ones. Only the uredial stage of the rust occurs in India. Uredial sori appear on the
leaves as small (1-3 mm) pinkish brown spots which may coalesce to form larger patches. The uredia are
oval to circular on the pedicels and branches and the urediospores are exposed on rupture of the
epidermis. The early incidence of rust was noted during the last two seasons in Karnataka and Andhra
Pradesh (Anonymous, 2010 and 2011).
CHANGING DISEASE SCENARIO
When the incidence of important diseases in varieties/hybrids/Bt cotton hybrids was studied across the
country for the past three years, it was noted that CLCuD, Alternaria blight and Grey mildew showed an
increasing trend where as bacterial blight incidence did not show any trend but varied between 17.2 36.7% over locations (Table 4).
277
TABLE 4: INCIDENCE OF DISEASES (PDI) IN SCREENING NURSERIES
Disease
CLCuD
Location
Bt Hybrid/ Hybrid/ Variety
Faridkot (N.Z.)
F-846
Sriganganagar (N.Z.)
RST-9
Bacterial blight
Akola(C.Z.)
RCH-2
Dharwad (S.Z.)
RCH-2
Surat (C.Z.)
G. Cot hybrid-10
Alternaria blight
Rahuri (C.Z.)
LRA-5166
Dharwad (S.Z.)
RCH-2
Grey mildew
Dharwad (S.Z.)
RCH-2
N.Z.-North zone, C.Z.-Central zone, S.Z.-South zone
*Bunny Bt at Dharwad and G. Cot hybrid 12 at Surat was tested during 2010-11
2008-09
2009-10
2010-11
Percent Disease Index
0
29
96.2
35.96
100
100
26.3
30.42
22.08
36.73
27.08
17.2*
35.5
25.13
34.5*
28.66
29.3
36.6
21.28
32.67
39.5
11.53
18.75
32.2
The Bt-cotton hybrids have shown higher incidence of fungal foliar spots including grey mildews and
bacterial leaf blight diseases. A survey carried out by Hosagoudar et al. (2008) in eight districts in north
Karnataka on Bt cotton hybrids revealed higher incidence of grey mildew (5-40%), Alternaria blight
(5.0-35%) and bacterial blight (5.0-25%). In another study conducted in central zone, the bacterial blight
disease increased progressively and reached its peak in RCH-2 Bt cotton hybrid exhibiting 46.7%
incidence with intensity of 20.0% compared to 45.0% incidence and 18.7% intensity in susceptible
variety LRA-5166. Maximum temperature and sunshine hours exhibited positive and significant
correlation with disease incidence. Maximum temperature of 32.50C and relative humidity above 81
percent with sunshine hours 7.9 contributed to rapid spread and development of this disease (Ingole et
al., 2008).
In northern cotton growing zone of the country consisting of about 15 lakh ha area, Leaf curl virus
disease is one of the most significant but highly complex disease of cotton caused by the whitefly
transmitted Geminivirus. Since the outbreak of the disease in 1994 in Sri Ganganagar region of Rajasthan
in north India, the disease established endemically in the entire North West Indian states of Punjab,
Haryana and Rajasthan causing moderate to severe losses. The cotton leaf curl virus (CLCuV) emerged
with renewed aggressiveness during the crop season of 2009-10, when some of the hitherto resistant
genotypes and hybrids succumbed to its onslaught. Regular monitoring of CLCuV affected cotton is done
to characterize variability in symptoms, diversity of sequences within the associated isolates and
variability in disease pattern, if any. Four distinct symptom types were documented viz, leaf curl with
prominent enations, severe leaf curl without prominent enation, upward and downward curling of leaves.
Sequences of DNA-A and beta DNA components of the isolates associated with different symptoms
showed existence of significant variation and recombination with other strains of CLCuV. Sequence
identity matrix and RDP analysis of DNA-A and beta DNA components of six virus isolates analyzed
over a period of four years from 2006 showed sequence homology and recombination among several
isolates from India and Pakistan. Isolate G6-DC, isolated from cotton cv. RS2013, with compromised
resistance and severe leaf curl isolate S2 analyzed during 2009-10, showed close resemblance to several
CLCuV isolates from Pakistan. DNA-A component of G6-DC had major recombination events with two
Pak strains, besides other Indian strains while S2 isolate showed major recombination with three Pakistan
strains. Accumulation of recombination events over the years coupled with favorable environmental
conditions appeared to have knocked down the resistance of cotton ( Chakrabarty et al.,2010).
After the appearance of cotton leaf curl virus disease in a severe form during 2009-10 crop season in
some areas of north zone, district level disease development maps were prepared and it was noted that in
Punjab, out of nine cotton growing districts, the disease was very severe (PDI >50%) in Ferozepur
followed by severe (25-50%) in Muktsar and Faridkot and moderate (5-25%) in Moga, Bhatinda, Sangrur
and Mansa districts. In Patiala, it was low (1.1-5%) whereas It was observed in traces (0-1.0%) in
Ludhiana. However, during 2010-11 season the disease was observed to be in severe form from moderate
during 2009-10 in Sangrur and Mansa district also indicating increased severity. Similarly in Haryana the
disease was observed in traces in the major cotton growing districts of Sirsa, Fatehabad, Hisar and Jind
whereas it was not observed in other districts like Rohtak, Bhiwani, Jhajjar, Mahindergarh and Rewari
278
during 2009-10. However during 2010-11 season the disease was quite widespread in Haryana and was
found to be moderate in Sirsa, Fatehabad and Hisar followed by low in Bhiwani and traces in Rohtak
districts. In Rajasthan during both the years, the disease was moderate in Sriganganagar district and low
in Hanumangarh (Monga et al., 2011a).
In recent years epidemiological studies have thrown light on the weather factors associated with
disease development and its progress. Step wise multiple regression analysis revealed that weather
parameters altogether accounted for 53.0 – 86.7% significant variation of cotton leaf curl virus disease
during 1999-2005 at Regional Research Station, Faridkot in the state of Punjab. Minimum temperature
alone contributed 70.2% negative significant variation whereas minimum relative humidity contributed
86.7% positive significant variation. Two week lag weather parameters played significant role in
appearance of the disease over the years (Singh et al.,2010).
In another study (1999-2009) conducted at CICR Regional Station Sirsa, the multiple regression
equation of current weekly progress of disease( per cent incidence) during 27 – 31 Met weeks was tried
with thirty independent variables (six weather factors for current as well as four prior/lag weeks) using
stepwise regression. The value of coefficient of determination ( R2) was found to be 0.8230. Minimum
temperature of current and one lag week and sunshine of three lag weeks were significantly negatively
correlated and contributed to 47% variation whereas morning RH of three lag weeks, evening RH of
current week & four lag weeks, rain fall of current and three lag weeks were significantly positively
correlated and contributed to 35% variation.(Monga et al.,2011c).
ECONOMIC LOSSES CAUSED DUE TO DISEASES
Alternaria leaf spots can cause loss upto 26.6% based on results (2006-07 to 2008-09) of study
conducted in central India at Rahuri and south zone locations at Guntur and Dharwad. Five sprays of
Propiconazole (0.1%) at 35, 50, 65, 80, and 95 DAS decreased percent disease index (PDI) from 31.6 to
20.8% thereby reducing this yield loss due to Alternaria leaf spots in variety LRA-5166 ( Anonymous,
2009). In case of grey mildew disease also, a reduction of loss due to grey mildew disease up to 29.2%
with the application of five sprays of carbendazim (35,50,65,80 and 95 days after sowing) in Bt cotton
hybrid Bunny was demonstrated based on a study (2008-09 to 2010-11) conducted across central and
south zone, (Dharwad, Guntur and Nanded ). PDI showed reduction to 8.1 as compared to 20.9 in control
(Anonymous,2011).
In another important fungal disease, Myrothecium leaf spot, a reduction of loss up to 29.1% with the
application of five fungicidal sprays of Propiconazole (@ 0.1%) at an interval of 35, 50, 65, 80 and 90
DAS in variety JK-4 was observed on the basis of trial in central zone at Khandwa (2007-08 to 2009-10).
Percent disease index (PDI) showed reduction to 7.4 as compared to 22.5 in control (Anonymous,2010).
Losses to the tune of 33.8% with 0.1% propiconazole spray at 35,50,65,80 and 95 days after sowing due
to Helminthosporium leaf spot disease could be avoided in cotton variety LRA-5166 based on (2007-08
&2008-09) studies carried out at Guntur in South zone ( Bhattiprolu,2010).
Reduction of losses due to bacterial leaf blight up to 20.6% with the application of five sprays at
35,50,65,80 and 95 days after sowing of Copper oxychloride (0.2-0.3%) and Streptocyclin (100-500ppm)
on the basis of two year trials (2009-10 &2010-11) in central zone at Surat and Akola and south zone at
Dharwad and Guntur were also noted (Anonymous 2010 and 2011).
NEW MOLECULES FOR DISEASE MANAGEMENT
Tetraconazole 11.6 % w/w 900 ml/ha showed effective control ( percent disease index 9.9 compared to
28.1 in control) of Alternaria leaf blight (tested at Arupkotai, Junagarh, Rahuri, Nanded during 2009-10
&2010-11) and led to 30.5% increase of seed cotton yield over control. Kresoxim methyl (Ergon 44.3%
at 500ml/ha) when tested against foliar pathogens( Alternaria blight, myrothecium leaf spot and grey
mildew) at seven locations showed significant reduction of percent disease index. (Anonymous 2010
and 2011).
279
The fungicide captan+hexaconazole (Taqat @500g/ha) tested at Coimbatore, Junagarh, Faridkot,
Guntur and Dharwad during 2007-08 &2008-09 significantly reduced fungal foliar leaf spots (
Alternaria, Myrothecium, Grey mildew, Helminthosporium and Cercospora leaf spots) with an increase
in seed cotton yied of 12% over control(Anonymous 2008 &2009). Taqat at at 500g/ha was economical
in managing fungal leaf spot diseases at Guntur with benefit cost ratio of 1.42 (
Bhattiprolu,2010).Evaluation of copper hydroxide ( Dharwad, Surat, Akola, Khandwa, Nanded and
Rahuri) during 2007-08 &2008-09 revealed significant reduction of bacterial blight and Alternaria spots
at 1500g/ha with maximum increase of seed cotton yield of 20.8% over control.(Anonymous 2008 and
2009).
CONCLUSION
Cotton leaf curl virus disease, an important problem presently restricted to north zone need to be dealt
more seriously in the context of changed scenario leading to the development of recombinants and
breakdown of resistance. The new sources of resistance should be identified from available germplasm.
The introgression of resistance from other available sources is another option. The work on development
of transgenics using RNAi technology is in progress and shall go a long way in development of
resistance against this important viral disease. Other components of integrated disease management
strategy like cultural practices including weed management and vector control using innovative methods
need to be pursued vigorously to obtain a holistic approach. Certain other diseases like Alternaria,
Bacterial blight and grey mildew showing significant appearance in few areas at present shall need better
management options including nanotechnology. A vigil is required on the emerging problems like
tobacco streak virus and their likelihood to cause losses and minor disease like rust becoming major due
to early appearance in south zone. Another important aspect will be to focus on the disease development
and progress vis-a-vis climate changes to understand disease epidemiology and plan management
strategies.
REFERENCES
[1] Annonymous (2008) - AICCIP Annual Report (2007-08), All India Coordinated Cotton Improvement Project, Coimbatore,
Tamil Nadu.
Tamil Nadu.
Tamil Nadu.
Tamil Nadu.
[5] Bhattiprolu, S. L. (2010) - Efficacy of taqat against fungal leaf spot disease of cotton- J. Cotton Res. Dev., 24: 243-244.
[6] Chakrabarty, P.K., Sable, S., Kalbande, B., Vikas, Monga, D. and Pappu, H.R. (2010) - Molecular diversity among strains
of CLCuV prevalent in North West India and approaches to engineering resistance against the disease. Invited paper
presented at Conference on whitefly and thrips transmitted diseases held at University of Delhi-South Campus on August
27-28, 2010 p.17.
[7] Chakrabarty, P. K., Sable, S., Monga, D. and Mayee, C. D. (2005) - Polymerase chain reaction-based detection of
Xanthomonas axanopodis pv malvacearum and cotton leaf curl virus- Indian J. Agric. Sciences, 75: 524-27.
[8] Hosagoudar, G. N., Chattannavar, S. N., and Kulkarni, S. (2008) - Survey for foliar diseases of Bt Cotton Karnataka - J.
Agric. Sci., 21: 139-140.
[9] Ingole, O. V., Patil, B. R., Raut, B. T. and Wandhare, M. R. (2008)- Epidemiological studies on bacterial blight of cotton
caused by Xanthomonas axanopodis pv. Malvacearum- J. Cotton Res. Dev., 22: 107-109.
[10] Kang, S. S., Akhtar, M., Cheema, S.S., Malathi, V. G. and Radhakrishnan, G. (2004) - Quick detection of cotton leaf curl
virus - Indian Phytopathol., 57 : 245-46.
[11] Monga, D. (1995) - Integrated management of root rot of cotton - Paper published in book entitled “Integrated Disease
Management and Plant Health” edited by V. K. Gupta and R. C. Sharma- p 318.
[12] Monga, D. (1997) - Effect of fungicides on cotton root rot pathogens and biocontrol agents - J. Cotton Res. Dev.11: 272275.
[13] Monga, D. (2001) - Effect of carbon and nitrogen sources on spore germination, biomass production and antifungal
metabolism by species of Trichoderma and Gliocladium - Indian Phytopathol., 54: 435-437.
280
[14] Monga D., Chakrabarty, P. K, and Kranthi, K. R. (2011a) - Cotton leaf curl virus disease in India-Recent status and
management strategies. Paper presented at 5th meeting of Asian Cotton Research and Development Network (Full paper at
ICAC website) held at Lahore from February 23rd to 25th, 2011.
[15] Monga, D., Kumar, R., Kumar, M. (2005 ) - Detection of DNA A and satellite (DNA beta) in cotton leaf curl virus (
CLCuV) infected weeds and cotton plants using PCR technique - J. Cotton Res. Dev., 19: 105-108.
[16] Monga, D., Kumhar, Kishor Chand, Kumar, Alok , Soni Renu, and Kumar Rishi (2011b) - Identification of inoculum
source and estimation of yield losses due to cotton leaf curl virus disease - Poster presentation at 5th World Cotton Research
Conference at Mumbai from 7-11 November, 2011.
[17] Monga, D., Manocha, Veena, Kumhar, Kishor Chand, Soni, R. and Singh, N.P. (2011c) - Occurrence and prediction of
cotton leaf curl virus disease in northern zone - J. Cotton Res. Dev., 25: 273-277.
[18] Monga, D., Narula, A.M. and Raj, S. (2001) - Management of cotton leaf curl virus- A dreaded disease in North India.
Paper published in Book of Papers published by DOCD Mumbai on the occasion of National seminar on Sustainable Cotton
Production to Meet the Future Requirement of the Industry held on October 3rd and 4th 2001 at CIRCOT Mumbai .
[19] Monga, D. and Raj, S. (1994 ) - Cultural and pathogenic variability in the isolates of Rhizoctonia sps. causing root rot of
cotton - Indian Phytopathol., 47: 217-225.
[20] Monga. D, and Raj, S. (1994 a) - Progress of root rot in American ( Gossypium hirsutum ) and desi ( G .arboreum ) cotton
varieties in the northern region. Poster presented at the ‘National Symposium on current trends in the management of plant
diseases' held at CCS Haryana Agricultural University Hisar on 10-11 November, 1994.
[21] Monga, D, and Raj, S. (1996) -Varietal screening against root rot of cotton in sick field- Crop Res. 12 : 82-86.
[22] Monga, D. and Raj, S. (1996 b) - Biological control of root rot of cotton - J. Indian Soc. Cotton Improv., 21: 58-64.
[23] Monga, D. and Raj, S. (2000) - Integrated management of root rot of cotton. Paper published in Proceedings of
International Conference on Integrated Disease Management for Sustainable Agriculture (Volume II), Indian
Phytopathological society, Division of Plant Pathology, IARI, New Delhi, p 910-911.
[24] Monga, D. and Raj, S. (2003) - Development of sick field for screening against root rot of cotton - J. Cotton Res. Dev., 17:
59-61.
[25] Monga, D. Rathore, S. S., Mayee, C. D. and Sharma, T. R. (2004a) - Differentiation of isolates of cotton root rot pathogens
Rhizoctonia solani and R. bataticola using pathogenicity and RAPD markers - J. Plant Biochem. Biotechnol., 13: 135- 139.
[26] Mukewar, P.M. and Kairon, M.S. (2001) - Seed transmitted diseases of cotton and their control: A Review - J. Cotton Res.
Dev., 15: 34-45.
[27] Narula, A.M., Monga, D., Chauhan, M.S. and Raj, S. (1999) - Cotton leaf curl virus disease in India-The Challenge ahead J. Cotton Res. Dev., 13: 129-138.
[28] Nateshan, H.M., Muniyappa, V., Swanson, M.M. and Harrison, B.D. (1996) - Host range, vector relations and serological
relationships of cotton leaf curl virus from southern India - Ann. App. Biol., 128: 233-244.
[29] Radhakrishnan, G., Malathi, V. G. and Varma, A. (2001) - Novel features of cotton leaf curl virus disease in India. In. 3rd
International Gemini Virus Symposium, July 24-28, 2001, John Innes Centre, Norwich, Norfolk, U. K., p53.
[30] Radhakrishnan, S., Malathi, V.G. and Varma, A. (2004) -Biological characterization of an isolate of cotton leaf curl
Rajasthan virus from northern India and identification of sources of resistance - Indian Phytopathol., 57: 174-180.
[31] Sharma, P. (2002) - Molecular approaches for detection and diagnosis of cotton leaf curl Gemini virus and its mode of
dissemination in the field - Ph.D. thesis, Department of Plant Pathology, College of Agriculture, CCS HAU, Hisar.
[32] Sharma, O. P., Bambawale, O. M., Datar, V. V., Chattannavar, S. N., Jain, R. K., and Singh Amerika (2007)- Diseases and
disorders of cotton in changing scenario. NCIPM Technical Bulletin. Pp.20.
[33] Singh, Daljeet, Singh, Pritpal, Gill, J. S. and Brar, J. S. (2010) – Weather based prediction model for forecasting cotton leaf
curl disease in American cotton - Indian Phytopathol., 63: 87-90
[34] Singh, J., Sohi, A.S., Mann, H.S. and Kapoor, S.P. (1994) - Studies on whitefly Bemisia tabaci (Genn.) transmitted cotton
leaf curl virus disease in Punjab - J. Insect Sci., 7: 194-198.
[35] Sivalingam, P. N., Padmalatha, K. V., Mandal, B., Monga, D., Ajmera, B. D. and Malathi, V.G. (2004)-Detection of
begomoviruses in weeds and crop plants in and around cotton field surveillance: Disease forecasting and management held
at IARI, New Delhi, February 19-21, 2004. Souvenir and abstract, p.36.
[36] Srinivasan, K. V. (1994) - Cotton Diseases. Published by The Secretary, Indian Society for Cotton Improvement C/o
CIRCOT, Bombay, p 311.
47
Emerging and Key Insect Pests on Bt Cotton—
Their Identification, Taxonomy,
Genetic Diversity and Management
S. Kranthi1, K.R. Kranthi1, Rishi Kumar2, Dharajothi3, S.S. Udikeri4,
G.M.V. Prasad Rao5, P.R. Zanwar6, V.N. Nagrare1, C.B. Naik1, V. Singh7
V.V. Ramamurthy8 and D. Monga2
1
Crop Protection Division, Central Institute for Cotton Research, Nagpur
2
Central Institute for Cotton Research, Regional Station, Sirsa
3
Central Institute for Cotton Research, Regional Station, Nagpur
4
Agriculture Research Station, UAS, Dharwad
5
ANGRAU, Lam farm Guntur
6
Cotton Research Station, Marathwada Agricultural University, Nanded
7
Regional Agricultural Research Station, Sriganganagar, Rajasthan
8
Entomology Division, Indian Agricultural Research Institute, New Delhi
Abstract—Technology Mission on Cotton in India has proved to be successful in the planning, implementation,
execution and monitoring of research projects in a stipulated time with a focused approach. Emerging and key insect
pests on Bt cotton- their identification, genetic diversity and management is one of the projects that addressed the
changing pest problems in different regions through strategic research. Mealybugs (Phenacoccus solenopsis,
Paracoccus marginatus), mirids (Creontiades biseratense, Campylomma livida,Hyalopeplus linefer ) , flower bud
maggots (Dasineura gossypii), safflower caterpillar (Perigea capensis) , Tea mosquito bug (Helopeltis bryadi) were
emerging insect pests while leaf hoppers (Empoasca devastans), whiteflies (Bemisia sp), pink bollworm (Pectinophora
gossypiella) and the armyworm (Spodoptera spp.) were the key pests on Bt cotton. Incidence and damage caused by
these pests varied across regions and Bt genotypes being cultivated. Timely taxonomic identification of the mealy bug,
P. solenopsis and subsequent molecular study to suggest its narrow genetic diversity led to the development of
meaningful management strategies to limit its spread. Studies on the mt COI region of the key pest E. devastans
revealed that leaf hopper populations on cotton although morphologically and taxonomically similar were genetically
distinct from leaf hoppers of South and Central India. Implications on pest management in light of this finding are
presented. Flower bug maggots that were hitherto not reported on cotton were found to cause extensive damage in
parts of Karnataka. The life cycle of D. gossypii was elucidated to identify vulnerable stages in its life cycle that can be
exploited for pest management. Two botanical formulations Mealy Kill 50EC (against sucking pests) and Mealy Quit
(against mealybugs) were identified, developed and validated in multilocation trials. Entomofungi were evaluated for
their efficacy in sucking pest management.
INTRODUCTION
India accounts for about 32% of the global cotton area and contributes to 21% of the global cotton
production after China. The production increased from a meager 2.3 M bales in 1947-48 to 17.6 M bales
in 1996-97 to an all time highest record of 31.5 M bales during 2010-2011. Prior to 2002, cotton
production in the country was plagued by bollworm that was a major limiting factor in obtaining the full
yield potential of a genotype. This was coupled with the use of genotypes with low yield potential per se.
With the introduction of Bt cotton, bollworms have been effectively controlled thus minimizing yield
losses. The biggest gain from the technology was in the form of reduced insecticide usage from 46% in
2001 to less than 26% after 2006 and to a further 21% in 2009-10 and 2010-11. The reduction in
insecticide usage in India from Rs. 7180 M in 2004 for cotton lepidopteran caterpillars to Rs.1100M with
only Rs.230M for the control of American bollworm in 2010 is the spectacular effect of Bt cotton (Vision
2030).
While effectively controlling the American bollworm widespread cultivation of Bt cotton has
resulted in emerging pest problems some of which are discussed below.
282
Emerging Pests
Observations were recorded at weekly intervals on Bt cotton from 25 DAS to 120 DAS in Sirsa
(Haryana), Nagpur, (Maharashtra) Coimbatore (Tamil Nadu), Guntur (Andhra Pradesh) and Dharwad
(Karnataka) in farmers fields cultivating Bt hybrids. Those insects apart from the known insect pests of
cotton that appeared in large numbers were recorded. Damage was also recorded.
Feeding of Perigea Capensis under Laboratory Conditions
Field collected larvae on Bunny Bt were collected from Nanded, Yavatmal and were reared to F1 on non
Bt cotton terminal leaves. F1 neonates (30 larvae per event in 3 replicates) were provided with one rupee
sized terminal leaves of different Cry events under no choice conditions and the leaves were changed
each day for a period of 7 days. Mortality was recorded every day and larval weights were recorded at the
end of the bioassay period.
Genetic Diversity of Mealy Bug, Phenacoccus Solenopsis and Cotton Leaf Hopper, Empoasca Devastans
Field collected mealy bugs from 49 locations were preserved in absolute ethanol and brought to the lab
for further studies in 2007. In 2008 mealy bug samples were collected from cotton fields reared to F1 on
potato sprouts and F1 females were used for molecular diversity studies.
Field collected leaf hopper nymphs from cotton at peak vegetative stage were collected in ethanol
from all cotton growing locations of the country with samples representing 3 fields in a village in turn
covering 3 districts of a state. Nine states were covered during the course of study.
DNA was isolated from individual insect samples and PCR COI specific primers were designed to
amplify the COI region of the mitochondrial genome of leaf hopper. Mealy bug PCR amplicons were
generated using primers designed specifically to amplify 18s and 28s rDNA. Using annealing
temperatures 50.8oC PCR amplicons of the CO1 region of leaf hopper were generated. The annealing
temperature used to generate PCR amplicons of mealy bugs was 58oC. Amplicons were subjected to
double pass analysis and the resulting sequences were aligned and phylogenetic tree was drawn using
MEGA4 (Tamura et. al., 2007).
Formulation of Mealy Kill 50 EC
Using products of insect induced signal transduction pathway limonene was extracted from citrus peel
using the cold press method and evaluated in insect bioassays against aphids, jassids whiteflies and mealy
bugs. Commercially available synthetic analogues of limonene with 98% purity was evaluated under no
choice conditions using log dose probit concentrations as diet incorporation, topical application and leaf
dip methods of bioassays and the LC50s were worked out (Finney, 1971). Soap nut powder was used as
emulsifier.
Emerging Pests
From the table it is evident that Mealy bugs were the dominant emerging pest on Bt in Haryana,
Maharashtra, Gujarat and Guntur while mirid bugs were dominant in Haveri and Belgaum districts of
Dharwad in Karnataka. Mealy bugs and mirid bugs were seen as emerging pests in Tamil Nadu (Table 1).
Species Composition of Emerging Pests
Phenacoccus solenopsis was the dominant species of mealy bugs found across the country during its first
year of incidence (2007-08). Subsequently Paracoccus marginatus emerged as a pest on cotton and other
crops of Tamil Nadu in 2009 since its first report in 2007 (Table 2).
Emerging and Key Insect Pests on Bt Cotton—Their Identification, Taxonomy, Genetic Diversity and Management
283
TABLE 1: INCIDENCE OF EMERGING PESTS
S. No. State
1
Haryana
2
3
Maharashtra
Gujarat
4
Andhra
Pradesh
Karnataka
Tamil Nadu
5
6
Locations
Incidence*
Damage
Odhan, SIrsa, Kaleriwal,
Dhabwali and Baraguda
Nanded
Surat
Emerging
pest
Mealy bug
5-44%
Mealy bug
Mealy bug
33.70**
-
Guntur
Mealy bug
5.76- 35.35 %
Grade 3: 1.66-19%
Grade 4: 1.33-19%
NR
Grade 4 in August.
Grade 2 till Jan
1.71-4
Haveri Belgaum
Coimbatore
Mirid bugs
43.85 bugs/25 squares
Mealy bug
55-83.1%
Mirid bugs
16-85.1 bugs/100 squares
* Refers to number of plants harboring mealy bugs and causing more than Grade 1 damage.
**Refers to number of mealy bugs on 2.5 cm stem length.
1.0-1.22
-
TABLE 2: DIFFERENCES BETWEEN THE 2 SPECIES OF MEALY BUGS
Phenacoccus Solenopsis
Body quite large (5mm) with dark dorso sub medial bare
spots on inter segmental areas of thorax and abdomen, these
areas forming 1 pair of dark longitudinal lines on dorsum,
with 18 pairs of lateral wax filaments, posterior pair longer up
to 1/4th inch length of body.
Paracoccus Marginatus
The adult female is yellow covered with white waxy coating
and measures approximately 2.2 mm in length and 1.4mm
wide. A series of short waxy caudal filaments less than 1/4th
the length of the body exist around the margin.
Live mealy bug colonies (P. solenopsis) collected across the country from 37 locations were
subjected to DNA isolation and PCR using 18S and 28S rDNA primers, elongation factor 1alpha and
elongation factor 1 Beta primers. PCR amplicons of approximately 350bp and 700bp were sequenced
using double pass analysis in 140 samples representing 3-4 samples per location. All the colonies
belonged to a single haplotype reflecting narrow genetic diversity. This information was important in
devising simple management strategies to be applied uniformly across the country.
Mirid Bugs
Three species have been found to cause damage of varying intensities on cotton- Creontiaedes
biseratense (Distant), Hyalopeplus lineifer (Walker), Campyloma livida (Reuters). Mirids feed on tender
shoots, squares and cause excessive shedding of flowers, small squares and parrot beaking of bolls. They
occur in large numbers moving rapidly on the plant and often miss the eye. Mirid bugs are reported to
cause maximum damage in Haveri and Belgaum districts of Karnataka with up to 2 mirids per square in
the months of October and November. Mirids were reported to cause an avoidable loss of 290Kg/Ha in
Dharwad. Yield loss due to mirids in Nagpur of Central India ranged from 25-30%. Avoidance of broad
spectrum insecticides seems to have assisted in their establishment as emerging pests of cotton. Also,
introduction of new genotypes hitherto unknown into the ecosystem seems to have encouraged the
occurrence of new pests.
Safflower caterpillar, Perigea capensis were collected as late instar larvae from Bt cotton leaves in
Vidarbha, Hingoli and Buldana. It was recorded for the first time along with Spodoptera in cotton fields
adjoining soybean in early vegetative stage. It does not feed significantly on Bt cotton leaves (BG and
BG II) in the lab as neonates die at the end of 7 days. Even though they survive a poor weight gain of
neonate larvae on non Bt cotton leaves was observed (<10mg in a 7 day period).
The adult moth is grayish brown in colour and looks like the pink bollworm moth. It has a preoviposition period of 3 days. Eggs are laid in clusters and are covered with rough hair. Egg period is 3-5
days. Neonate larvae are white in colour and translucent and very active. Full grown larvae are light
green, fleshy with prominent yellow bands across the larval segments. Full grown larvae look like
Helicoverpa with larval period between 14-17 days and a pupal period of 4-5 days.
284
Genetic Diversity of Mealy Bugs and its Implication for Mealy Bug Management
PCR amplicons of approximately 350 bp and 700 bp were sequenced using double pass analysis in 140
samples representing 3-4 samples per location. All of them had the identical sequence except one sample
of the three from Sriganaganagar which we believe may be a different species. The cotton mealy bug was
identified as Phenacoccus solenopsis (taxonomically) without any genetic diversity (molecular analysis)
throughout the country
PCR Amplification of Mealy Bug DNA From different
location with 28S- A,F & R Primers
1st Row:- Lane 1-3: Sirsa; Lane 4-6: Hissar; Lane 7-9:
Abohar; Lane 10-12: Fatehabad; Lane 13-15:
Shriganganagar; Lane 16-18: Hanumangarh; Lane 19-21:
Amravati; Lane 22-24: Jalna.
2nd Row:- Lane 1-3: Latur; Lane 4-6: Akola; Lane 7-9:
Hingoli; Lane 10-12: Washim; Lane 13-15:
Yavatmal; Lane 16-18: Nagpur; Lane 19-21: Nanded; Lane
22-24: Parbhani.
PCR Amplification of Mealy Bug DNA From different
location with 18S F & R Primers
1st Row:- Lane 1-3: Sirsa; Lane 4-6: Hissar; Lane 7-9: Abohar;
Lane 10-12: Fatehabad; Lane 13-15:
Shriganganagar; Lane 16-18: Hanumangarh; Lane 19-21:
Amravati; Lane 22-24: Jalna.
2nd Row:- Lane 1-3: Latur; Lane 4-6: Akola; Lane 7-9:
Hingoli; Lane 10-12: Washim;
Lane 13-15: Yavatmal; Lane 16-18: Nagpur; Lane 19-21:
Nanded; Lane 22-24: Parbhani.
Fig. 1: PCR Amplicons of Mealy Bugs using 18s and 28s rDNA Specific Primers
Management strategies were devised based on the following basic information and the article by
Kranthi et. al., (2011) is recommended for further reading. Pigeon pea, maize and bajra are least
preferred by the mealy bugs. Mealy bugs survive on weeds during the season and also during off-season.
Aenasius bambawalei is the most effective parasitoid. The predatory beetles Cryptolaemus montrouzieri,
Brumus suturalis and Scymnus spp. are prominent in the ecosystems in India and Pakistan. The
entomopathogenic fungi, Metarrhizium anisopliae, Beauveria bassiana, Verticillium lecanii and
Fusarium pallidoroseum are effective in infecting mealybugs. Botanical mixtures containing neem oil,
citrus peel extracts and fish oil rosin were found to be effective in controlling the mealybugs. The insect
growth regulator, Buprofezin is effective in control. Insecticides such as Malathion and Acephate, which
are considered by the WHO as only slightly hazardous (WHO III category) can be used as soil
application near the root zone. All the populations collected in India were highly homogenous, indicating
scant genetic diversity in India. This implied that a common pest management strategy could be adopted
across the country.
Eme
erging and Key Insect
I
Pests on Bt Cotton—The
eir Identification
n, Taxonomy, Ge
enetic Diversityy and Manageme
ent
285
Genetic Divversity of Leaf Hoppers andd Implication for
f Leaf Hopper Managemeent
Fig. 2: PCR Amplicons
A
of Leaf Hopper Genomic DNA
D with CO1 Speccific Primers
An unnrooted tree was generatted (MEGA 4) to show that leaf hoppper populattions from North
N
India
(Punjab, Haryana
H
and Rajasthan) and
a Gujarat formed
f
a disstinct group and
a were gennetically diffferent from
leaf hoppper populatioons collectedd from Centtral (Maharaashtra) and South
S
India (Andhra Prradesh and
Karnatakaa). This is beeing reportedd for the firstt time and is supported byy distinct diffferences in insecticide
resistancee patterns wiith leafhopper populatioons from Cen
ntral and Soouth India being atleast 5000 fold
more tolerrant to chlornnicotinyls coompared to leeaf hopper po
opulations frrom Gujarat and North In
ndia.
‘Mealy Kill’ for Sucking Pest
P Managem
ment
Mealy Kiill essentiallyy consists off a terpenoidd, and demonstrates LC50
ealy bugs),
5 values of 0.342% (me
0.123% (jjassid nymphhs, leaf dip assay)
a
and 0.421% (aphiids, diet incoorporation) inn laboratory bioassays.
The inseccticidal compponent of Mealy
M
Kill iss of botaniccal origin. Mealy
M
Kill is very effeective as it
dissolves the waxy cooating on the mealy bug thus
t
making it vulnerablee to dessicatiion and bioaagents. The
technologgy has special relevancee to citrus belt
b of Vidarrbha as citruus peels aree a rich sou
urce of the
insecticidaal componeent of Mealy Kill. Sincce the technology is eco-friendly
e
it is usefu
ul for pest
managem
ment in organnic cotton syystems. It is eco-friendly
y and reducces the depenndence on in
nsecticidal
sprays annd provides an
a alternativve to the usee of insecticcides. Reducced cost of ccultivation as
a use of a
single sprray of neoniccotinoid costts about Rs.8800 per acre while Mealyy Kill costs about Rs.200
0 per acre.
286
It is not only specific to cotton but can be used on any crop for aphid, jassid and whitefly management.
Mealy Kill 50EC formulation was supplied to 9 AICCIP centres but was tested at 4 centres namely,
Raichur, TNAU, Sirsa and Faridkot, essentially against mealy bugs. It was tested at 20ml/L in north India
and 10ml/L in South India. It offered 34% reduction when sprayed once at Sirsa and was on par with
other bio-pesticides such as V. lecanii, M. anisopliae and B. bassiana. It was superior to the biopesticides tested at Faridkot. There were no significant differences in yield in the insecticide treated plots
and Mealy Kill treated plots in Faridkot. In Raichur and TNAU the reduction in mealy bugs observed due
to Mealy Kill was 90% that was on par with the insecticidal check chlorpyriphos both in terms of pest
control and yield. Mealy Kill was superior to the other bio-pesticides tested, each, sprayed twice, at these
centres in terms of mealy bug control and yield.
ACKNOWLEDGEMENT
The funding for this work, received from TMC MMI from Ministry of Agriculture, is gratefully
acknowledged.
REFERENCES
[1] Vision 2030, CICR (2011). Compiled by K.R. Kranthi, M.V. Venugopalan and M.S. Yadav. Indian Council of Agricultural
Research, New Delhi.
[2] Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software
version 4.0. Molecular Biology and Evolution 24: 1596-1599.
[3] Finney, D.J. (1971). Probit Analysis, third ed. Cambridge University Press, Cambridge.
[4] Kranthi, K.R., V. Nagrare, S. Vennila and S.Kranthi (2011). Package of practices for mealy bug management on cotton.
ICAC, 29 (1): 13-16.
48
Efficacy of Triazoles in Management
of Major Fungal Foliar Diseases of Cotton
A.S. Ashtaputre, N.S. Chattannavar, S. Patil, Rajesh
N.K. Pawar and G.N. Hosagoudar
University of Agricultural Sciences, Dharwad, Agricultural Research Station,
Dharwad Farm, Dharwad–580007, Karnataka –India
Abstract—Grey mildew and Alternaria blight are the major fungal foliar diseases in northern region of Karnataka
and two year study was conducted to know the efficacy of triazoles against these major fugal foliar diseases of cotton,
grey mildew caused by Ramularia areola Atk. and Alternaria blight caused by Alternaria macrospore Zimm, during
kharif 2009 and 2010 under rainfed situation at Agricultural Research Station, Dharwad. The experiment was laid out
in replicated trial of randomised block with ten treatments. The study revealed that all the triazoles under study were
found to be effective in control of major foliar diseases, which in turn reflected in more yield. Among these triazoles,
Percent disease index(PDI) of Penconazole for Alternaria blight(AB) (6.10 PDI) and grey mildew(GM) (10.30 PDI)
followed by Hexaconazole (AB 8.20, GM 11.0 PDI), Difenconazole (AB 7.10, GM 11.10 PDI) and Tridemefan (AB
11.3, GM 13.5 PDI), reduced the disease severity of both the diseases effectively and also enhanced the yield. But three
sprays of Hexaconazole (0.1%) were more useful not only in reducing the cost of protection but also gave higher
benefits (B:C ratio 9.63) as compared to other treatments and can be used for the management of major fungal foliar
diseases of cotton. Hexaconazole can be recommended as one of the components in integrated disease management of
cotton as it showed the best result in the control of both diseases with higher cost benefit ratio and increased
yield(14.3 q/ha).
INTRODUCTION
Cotton, “The White Gold” enjoys a pre-eminent status among all cash crops in the country and is the
principal raw material for a flourishing textile industry. India now produces around 290.00 lakh bales of
cotton ranging from short staple to extra long staple from an area of 93.73 lakh hectares with productivity
of 526 kg per hectare (Anonymous, 2009). In Karnataka, the area under cotton cultivation is 3.90 lakh
hectares with a production of 9.00 lakh bales and an average productivity of 392 kg per hectare
(Anonymous, 2009). Cotton is known to suffer from number of diseases caused by fungal, bacterial and
viral origins. There is now more relative importance for different diseases may be air borne like grey
mildew, Alternaria leaf spot, Myrothecium leaf spot, bacterial blight, rust, cotton leaf curl virus (white fly
transmitted) or soil borne like seedling rots, Rhizoctonia root rot, Verticillium wilts and even some times
Sclerotium rolfsii affecting cotton across India. Only the type of the disease and its virulence differs with
different agro – climatic regions. These changes may be due to change over from the cultivation of
Asiatic (G. herbeceum and G. arboreum) to American cottons (G. hirsutum) and hybrids. Most of them,
even though high yielding, are susceptible to diseases. Only the type of the disease and its virulence
differs with different agro – climatic regions. These changes may be due to change over from the
cultivation of Asiatic (G. herbeceum and G. arboreum) to American cottons (G. hirsutum) and hybrids.
Most of them, even though high yielding are susceptible to diseases (Shivankar and Wangikar, 1992,
Chattannavar et al, 2009). Among the fungal diseases grey mildew and Alternaria blight are the
predominant ones causing economic losses to the cotton crop in the country. Management of diseases is a
continuous process due to development of different resistant races of pathogens imposed by climatic
changes, chemicals or even resistance to old resistant cultivars.
288
A field experiment was conducted at Agriculturl Research Station (Cotton), Dharwad farm, Dharwad ,
Karnataka during Kharif 2009-10 and 2010-11 to evaluate the field bio-efficacy of triazole group of
fungicides against major fungal foliar diseases grey mildew caused by Ramularia areola Atk. and
Alternaria blight or Alternaria leaf spot caused by Alternaria macrospore Zimm were compared with
standard recommendation Carbendazim 50% WP foliar spray treatment @ 0.1%. The experiment was
planned in Randomised block Design and replicated thrice on Bt cotton hybrid “Bunny Bt”. The
individual treatment plot size was 6.0 x 5.4 m2 with spacing of 90 x 60 cms. Normal recommended
cultural practices were adopted. Three sprays of all treatments were undertaken immediately after the
appearance of the disease at an interval of 12 days. The observations on percent disease index of
Alternaria blight and grey mildew were recorded 15 days after the last spray, on five randomly selected
plants in each treatment. In each treatment, ten plants were randomly selected and tagged. Three
branches were randomly tagged per plant and the intensity of Alternaria blight and grey mildew on all
the leaves of these tagged branches were graded by adopting 0 to 4 scale as given by Sheo Raj (1988).
Per Cent Disease Index (PDI)
The results obtained during 2009 with respect to Alternaria blight, revealed that, all the treatments were
significantly superior over untreated control. From the data, it is clear that, the treatments viz.,
Penconazole, Difenconazole, and Hexaconazole were found on par with each other with PDI of 5.80,
6.70 and 8.30 respectively and they were significantly superior to all other treatments followed by
Propiconazole, Mycobutanil, Tridemefon with PDI of 9.40, 10.30 and 11.40 respectively. The results
obtained during kharif, 2010 followed similar trend of results but in slightly higher intensity of incidence
of disease, as observed during kharif, 2009.
TABLE 1: EFFICACY OF TRIAZOLES AGAINST ALTERNARIA BLIGHT AND GREY MILDEW OF COTTON
Sl.
No
Treatments
T1
Mycobutanil @
1gm/litre
Hexaconazole
@ 1ml/litre
Penconazole @
1ml/litre
Propiconazole @
1ml/litre
Difenconazole@
1ml/litre
Tridimefon @
1gm/litre
Tridemorph @
1ml/litre
Carbendazim @
1gm/litre
Propineb @
3gm/litre
Control
T2
T3
T4
T5
T6
T7
T8
T9
T10
SEm ±
CD at 5%
Alternaria blight
PDI
2009-10
10.30
(18.73)*
8.30
(16.67)
5.80
(13.93)
9.40
(17.90)
6.70
(15.03)
11.40
(19.70)
19.90
(26.50)
20.10
(25.67)
18.20
(25.27)
30.30
(33.37)
1.187
3.527
2010-11
11.20
(19.53)
8.20
(16.59)
6.40
(14.60)
9.30
(17.73)
7.40
(15.77)
11.20
(19.57)
20.00
(26.58)
21.30
(27.50)
17.00
(24.35)
33.00
(35.08)
1.068
3.174
Pooled
mean
PDI
10.70
(19.13)
8.20
(16.63)
6.10
(14.27)
9.40
(17.82)
7.10
(15.40)
11.30
(19.63)
20.00
(26.54)
20.00
(26.58)
17.60
(24.81)
31.60
(34.22)
0.748
2.222
Grey mildew
PDI
2009-10
8.60 (17.05)
Pooled
mean
PDI
Yield (q/ha)
Pooled B:C
Yield
(q/ha)
2010-11
2009-10 2010-11
20.30(26.79) 13.90(21.92) 12.80
13.7
13.2
1.81
9.40(17.86)
12.70(20.90) 11.00(19.38)
14.30
14.8
14.5
9.63
6.70(15.04)
14.50(22.40) 10.30(18.72)
17.20
15.6
16.4
5.80
9.50(17.93)
21.00(27.28) 14.80(22.60)
14.10
15.7
14.9
6.2
8.60(17.00)
13.80(21.83) 11.10 (19.42)
14.80
15.5
15.2
3.27
8.20(16.63)
19.80(26.40) 13.50(21.51)
14.10
15.3
14.7
3.12
7.60(15.96)
23.50(28.98) 14.60(22.47)
13.60
14.2
13.9
4.83
8.20(16.67)
21.30(27.50) 14.10(22.08)
13.20
13.9
13.5
5.77
10.80(19.18)
23.00(28.65) 16.40(23.92)
12.90
14.2
13.6
3.65
23.70(29.10)
34.60(36.03) 29.00(32.57)
11.20
12.7
11.9
-
0.351
1.041
0.389
1.157
0.219
0.651
1.192
3.543
1.645
4.887
0.989
2.938
The pooled data (Table 1) of two years for Alternaria blight and grey mildew indicated that all the
treatments were significantly superior over untreated control. The triazoles under study were found to be
significantly effective in the management of the diseases. The least PDI was observed in Penconazole of
6.10 PDI and 10.30 PDI for Alternaria blight and grey mildew respectively followed by Difenconazole
Efficacy of Triazoles in Management of Major Fungal Foliar Diseases of Cotton
289
(7.10 PDI for A. blight and 11.10 PDI for grey mildew) and Hexaconazole (8.20 for A. blight and 11.00
PDI for grey mildew) which were on par with each other and significantly superior over rest of the
treatments followed by all other triazole group of fungicides under study.
Cotton Yield
The cotton yield was significantly superior in all the treatments as compared to untreated control. The
results indicated that, all the triazoles under study have showed higher yield. Next best treatments were
viz., Tridemorph (13.9 q/ha), Propineb (13.6 q/ha), Carbendazim (13.5 q/ha) and Mycobutanil (13.2
q/ha), on par with each other, but differed significantly with the untreated control.
The pooled data of two years depicted that, the triazole group of fungicides was found to be more
effective in enhancing the yields significantly (Table 1). Pooled maximum yield of both the years was
noticed in Penconazole (16.4 q/ha), which was significantly superior over all other treatments, followed
by Difenconazole (15.2 q/ha), Propiconazole (14.9 q/ha), Triadimefon (14.7 q/ha) and Hexaconazole
(14.5 q/ha) . The least yield was noticed in untreated control (11.9 q/ha).All the treatments were found to
be significantly differ with untreated control.
Benefit Cost Ratio (BCR)
From the pooled data of two years, it is evident that maximum B: C ratio was observed in Hexaconazole
(9.63) followed by Propiconazole (6.2) and Penconazole (5.80) (Table 1).
In the present investigation, it is evident that all triazoles under study were found to be effective in
control of the grey mildew and Alternaria blight disease, which in turn reflected in more cotton yield.
Among these triazoles, Penconazole followed by Hexaconazole and Difenconazole reduced the disease
severity of both the diseases effectively and also enhanced the yield. These findings are in accordance
with Khodke and Raut( 2009) who reported that these triazoles gave the effective control of grey mildew.
The benefit cost ratio is an important parameter for recommendation of any treatment for successful
control of plant disease. In the present study, though the treatments containing three sprays of
Penconazole, Hexaconazole, Difenconazole, Triadimefon and Propiconazole gave significant control of
both the diseases, maximum Cost Benefit ratio of 9.63 was realized in treatments containing three sprays
of Hexaconazole (0.1%) followed by Propiconazole (6.2) and Penconazole (5.80). This clearly indicated
that three sprays of Hexaconazole (0.1%) are more useful not only in reducing the cost of protection but
also gave higher benefits as compared to other treatments and can be recommended as one of the
components in integrated disease management of cotton. This is followed by Difenconazole and
Penconazole applications. Similar types of findings are observed by many workers (Khodke and Raut,
2009, Algarsamy and Tagarajan, 1986). Hence, spraying of Hexaconazole (0.1%) could be considered as
an effective management practice to manage major fungal foliar diseases.
REFERENCES
[1] Anonymous, 2009, Ann. Rep. of All India Co-ordinated Cotton Improvement Project, for 2008-09, Central Institute for
Cotton Research Regional Station, Coimbatore.
[2] Algarsamy, C. and Tagarajan, R., 1986, Efficacy of fungicides against grey mldew disease of Cotton. Madras agric. J.,73:
651-652
[3] Chattannavar, S. N., Hosagoudar, G. N., Ashtaputre, S. A. and Ammajamma, R., 2009, Evaluation of cotton genotypes for
grey mildew and Alternaria blight diseases. J. Cotton Res. Dev., 23(1) : 159-162.
[4] Khodke, S.W and Raut, B.T., 2009, Chemical management of grey mildew caused by Ramularia areola Atk. of diploid
cotton
[5] Sheo Raj, 1988, Grading for cotton disease, CICR, Nagpur. Bull., pp. 1-7.
[6] Shivankar, S. K. and Wangikar, P. D., 1992, Estimation of crop loss due to grey mildew disease of cotton caused by
Ramularia areola. Indian Phytopath. 45: 74-76.
49
Damage Caused in Cotton by Different Levels
of Ramulosis in Brazil
Alderi Emídio De Araújo1,
Alexandre Cunha De Barcellos Ferreira2 and Camilo De Lelis Morello2
1
Embrapa Algodão, CP: Campina Grande, PB, Brazil 174, CEP 58428–095
Embrapa Algodão, Research Group of Cerrado, Embrapa Arroz e Feijão C.P. 179,
CEP 75375–000, Santo Antônio de Goiás, GO, Brazil
e-mail: [email protected]
2
Abstract—The ramulosis caused by Colletotrichum gossypii var. cephalosporioides is one of the most important
diseases of cotton in Brazil. The damage can range from 20 to 30% reaching 85% in severe cases. This study aimed to
assess the damage to cotton caused by different levels of disease severity. The experiment was carried out in state of
Goiás, in the season of 2006. The treatments were five severity indexes based on the following descriptive key: 1- plant
without symptoms; 2-plants with necrotic spots in the young leaves; 3- necrotic spots in the leaves, shortening of
internodes and initial broom; 4- necrotic spots in the leaves, shortening of internodes, broom little developed and
height reduction; 5- necrotic spots in the leaves, shortening of internodes, broom very developed and height reduction.
The plants with 40 days old age were inoculated with a suspension of 2x105 conidia/ml of the pathogen and to assure
the occurrence of different levels of severity, the treatments with low scores of the key were sprayed with fungicides
according to disease development. The experimental design was in randomized blocks with 5 treatments and 4
repetitions. Were assessed the following variables: height of the plants, number of bolls, weight of the bolls and lint
production. The more important damage caused by disease were the reduction in the weight of the bolls and in the lint
production. To these variables the reduction was more than 70% when the severity of the disease was high. The
reduction in the plant height was higher when the disease severity achieved the 3 and 4 points of the key. Based on
these results we conclude that is very important the control of the disease in the initial stages until the point 2 of the
descriptive key to avoid significant damage to the fiber production
Keywords: disease, fungus, control, Colletotrichum
INTRODUCTION
The ramulosis, caused by Colletotrichum gossypii var. cephalosporioides, is one of the most important
diseases of cotton in Brazil. The main characteristic of this disease is the breaking of apical dominance,
which induces successive shoots, giving to the plant the appearance of a broom. The damage can range
from 20% to 30%, reaching 85% in severe cases. In Mato Grosso were reported damages of up to 80%
(Freire et al., 1997).
The environmental conditions more favorable to ramulosis are high rainfall, temperatures of 25 º C to
30 º C and relative humidity above 80% (Miranda; Suassuna, 2004; Silveira, 1965). In state of Mato
Grosso, the temperature range favorable for the development of the disease ranged from 20 C to 30 º C
(Araújo, Farias, 2003), while in state of Minas Gerais the optimum temperature for the higher incidence
of disease was 18.3 ° C (Santos, 1993).
The first symptoms of ramulosis occur in young leaves and are characterized by circular necrotic
spots. Afterwards the tissue of these spots breaks up and detaches itself, resulting in star-shaped
perforations. The uneven growth of the tissue induces wrinkling of the leaf. Soon after the emergence of
the first leaf injury, death occurs from the apical meristem of the affected branch, halting its growth
stimulating the sprouting of lateral buds, which culminates in the formation of a cluster of branches with
short internodes and swollen, giving the plant the aspect of a broom (Araújo; Suassuna, 2003; Suassuna,
Coutinho, 2007).
Damage Caused in Cotton by Different Levels of Ramulosis in Brazil
291
The ramulosis can also affect the quality of fiber, like length, fineness, uniformity and micronaire and
the damage can cause the reduction in weight of bolls and in the percentage of fibers (Carvalho et al.,
1984).This study aimed to determine the damage caused to cotton by different levels of severity
ramulose.
The experiment was carried ou at the Experimental Station of Embrapa / GO Foundation in Santa Helena
de Goiás, in the season of 2006. The cultivar used was BRS Ipe, whose seeds were treated with the
insecticide imidacloprid (270 g kg ai/100), and fungicides tolylfluanida (75 g kg ai/100) + pencycuron
(75 g ai/100 kg).
The treatments were of five levels of disease severity based on the descriptive key proposed by
Araújo et al. (2003): 1- plant without symptoms; 2-plants with necrotic spots in the young leaves; 3necrotic spots in the leaves, shortening of internodes and initial broom; 4- necrotic spots in the leaves,
shortening of internodes, broom little developed and height reduction; 5- necrotic spots in the leaves,
shortening of internodes, broom very developed and height reduction.
Infection of plants was obtained through inoculation of a suspension of 2x105conidia / ml of the
pathogen, 40 days after emergence. Plants with level 1 of the descriptive key were not inoculated. In
order to ensure the different levels of severity of the disease, plants with disease severity with levels 1
and 2 were sprayed with the fungicide propiconazole + trifloxystrobin(125 + 125 g / L a.i. / ha), based on
data obtained by monitoring the evolution of disease. The other levels of the descriptive key were
obtained through the systematic control of the development of the disease with spray with trifloxystrobin
+ propiconazole (125 +125 g / L a.i. / ha) when necessary in both cases. The first spray was made at the
levels 3 and 4, and one application was sufficient to maintain levels while level 5 was obtained without
spray.
The design was randomized blocks, with five treatments and four replicates, and the parcel had four
lines 5 m, considering how useful the two central rows. The evaluation was performed at 140 days after
emergence, having been employed the descriptive key proposed by Araújo et al. (2003). The measured
variables were: plant height, number of bolls / plant, boll weight and cotton lint production.
Based on the results shown in Table 1, it was observed that the disease has negatively affected all
variables. The largest damage were observed for boll weight and in production of cotton lint per plant.
For these variables, the decrease was greater than 70%, indicating that the ramulosis, in advanced stages,
causes severe damage to production. Although the differences in the number bolls per plant were not as
expressive, it is important to note that the weight the boll was reduced with the increase in disease
severity, reflecting directly in the production of cotton lint. The number of capsules suffered the greatest
reduction when there was increase in the severity of the disease, Based on the results shown in Table 1, it
was observed that the disease has negatively affected all variables. The largest damage were observed for
boll weight and in production of cotton lint per plant. For these variables, the decrease was greater than
70%, indicating that the ramulosis, in advanced stages, causes severe damage to production.
Although the differences in the number of bolls per plant were not as expressive, it is important to
note that the weight the boll was reduced with the increase in disease severity, reflecting directly in the
production of cotton lint. The number of capsules suffered the greatest reduction when there was increase
in the severity of the disease, as can be observed the data relating to notes 4 and 5 of the descriptive key.
This phenomenon is associated the fact that higher levels of severity of the ramulosis can induce an
increased production of branches vegetative rather than fruiting branches, what determines a reduction in
production boll. The reduction in plant size was observed more steeply from the notes 3 and 4 of the
descriptive key. From these levels disease severity, there were also further damage to production. Thus,
based the observations, there is the need for control the disease in the earliest stage, in view of the
irreversibility of damage since the early symptoms of broom, that begin to manifest when the plant shows
increased levels of severity recorded from the level 3 of the descriptive key.
292
These results corroborate those already obtained by Carvalho et al. (1984), in the state of
Pernambuco. However, it should be pay attention to the fact that climatic conditions of Goiás state may
be more favorable to ramulosis, due to higher rainfall and regular rainfall usually recorded in the
Midwest of Brazil, with a view that C. gossypii var. cephalosporioides is widespread primarily by
splashing water, and the rain is a major agent of dispersal of inoculum. Therefore, monitoring of disease
in the state of Goiás, in brazilian Midwest should be more systematic, given the more favorable
conditions the development of disease. Therefore, the use of resistant cultivars is recommended and the
permanent monitoring of farming, to prevent that the disease reach to rates of high severity and induce
significant damage to production.
The control measures that prevent the increase of inoculums such as the use of seed health and crop
rotation should be privileged. The chemical control should be implemented in the early stages and should
never exceed the level 2 of the descriptive key used for the evaluation of disease severity.
TABLE 1: PLANT HEIGHT (CM), NUMBER OF BOLLS, BOLL WEIGHT (G) AND COTTON LINT PRODUCTION / PLANT (G) OF COTTON FOR DIFFERENT LEVELS OF SEVERITY RAMULOSE.
SANTA HELENA DE GOIAS, BRAZIL, 2006.
Level of the Descriptive Key*
Plant Height
Number of Bolls
Boll Weight
Fiber Production
1
126,16 a
3,33a
32,51a
12,01a**
2
121,50ab
2,58ab
27,92ab
9,47b
3
111,34b
2,31ab
20,94bc
7,23b
4
85,41c
1,96b
14,54cd
5,51bc
5
69,8d
1,53b
8,48d
3,21c
VC
6,3
24,88
21,12
23,64
*Descriptive key: 1- plant without symptoms; 2-plants with necrotic spots in the young leaves; 3- necrotic spots in the
leaves, shortening of internodes and initial broom; 4- necrotic spots in the leaves, shortening of internodes, broom little
developed and height reduction; 5- necrotic spots in the leaves, shortening of internodes, broom very developed and height
reduction.
**Means followed by same letter vertically do not differ by Tukey test at 5% probability.
REFERENCES
[1] Araújo, A E., Suassuna, N. D., Farias, F. J. C., Freire, E. C. Escalas de Notas Para Avaliação de Doenças Foliares do
Algodoeiro. In: Congresso Brasileiro de Algodão, 4., 2003, Goiânia. anais... campina grande. Embrapa Algodão, 2003, 1
cd-rom.
[2] Araújo, A. E.; Farias, F. J. C. Progress of witches broom disease of cotton in Mato Grosso State Brazil. In: World Cotton
Research Conference, 3., 2003, Cape Town, Anais... Cape Town, ICAC, p. 1428-1430.
[3] Carvalho, L. P.; Cavalcanti, F. B., Lima, E. F., Santos, E. V. Influência da ramulose nas características de fibra do
algodoeiro. Fitopatologia Brasileira, v. 9, p. 593-598. 1984.
[4] Freire, E. C.; Soares, J. J.; Farias, F. J. C.; Arantes, E. M.; Andrade, F. P.; Paro, H.; Laca-Buendia, J. P. Cultura do
algodoeiro no estado de Mato Grosso. Campina Grande-PB: Embrapa Algodão, 1997, 65 p. (Embrapa Algodão. Circular
Técnica 23).
[5] Miranda, J. E.; Suassuna, N. D. Guia de Identificação e controle das principais pragas e doenças do algodoeiro. Campina
Grande: Embrapa Algodão, 2004. 47 p. (Embrapa Algodão. Circular Técnica, 76).
[6] Santos, G. R. Progresso da ramulose do algodoeiro e transmissão de Colletotrichum gossypii South var. cephalosporioides
Costa pelas sementes. 1993. 53 p. Dissertação (Mestrado em Fitopatologia) – Universidade Federal de Viçosa, Viçosa, MG,
1993.
[7] Silveira, A. P. Fungos e bactérias. In: Instituto Brasileiro De Potassa. Cultura e adubação do algodoeiro. São Paulo, 1965.
p. 417- 419
50
Insecticidal Toxin Genes from Bacterial Symbiont of
Thermotolerant Isolate of Heterorhabditis indica,
Entomopathogenic Nematode
Nandini Gokte-Narkhedkar, Kanchan Bhanare, Prachi Nawkarkar,
Prashanth Chiliveri and K.R. Kranthi
Division of Crop Protection, Central Institute for Cotton Research, Nagpur
INTRODUCTION
In the last two to three decades use of chemical control for pest management has become less acceptable
as concerns about contamination of soil and water and deleterious effects on man and livestock have led
to restrictions on their use. This and development of resistance in insects against commonly used
chemicals has led to demand for development of alternates for pest management and biological control is
one such option. Entomopathogenic nematodes with their associated bacteria have been identified as
viable option for insect management and toxicity of EPN-bacterial system to insects is largely attributed
to toxins produced by bacterial symbiont . Considerable progress has been made in identification of toxin
genes from bacteria Photorhabdus and Xenorhabdus (Williamson and Kaya, 2003). Toxin genes from
EPN- bacterial system can be used as alternative to Bt toxins or can be used to pyramid multiple
resistance genes for broad range and effective resistance against insect pests. A thermophilic isolate of
EPN Heterorhabditis indica has been developed at CICR and bacterial isolate found associated with this
EPN was found to be very effective against sucking pests of cotton in field trials undertaken at CICR,
Nagpur, its regional station Sirsa and at Nanded. Therefore Bacteria isolated from thermophilic EPN
H.indica isolate were taken up for further characterization and identification of toxin genes.
Bacteria were isolated from juveniles of nematode H.indica on standard bacteriological media and
bacteria were taken up for molecular and biochemical characterization. (Bergy’s Manual). The
biochemical parameters taken up were Colony Morphology on Nutrient Agar,Gram Stain, Pigmentation,
Levan production, Methyl Red, Voges-Proskauer Test, starch hydrolysis, oxygen requirement, H2S
production, indole production, nitrate reduction, Urease test, ADH test, citrate, catalase, gelatinase,
motility, tyrosinase and Galactosidase tests. Carbohydrates fermentation studies for the bacterial isolate
were carried out for 21 carbohydrates.
For molecular characterization 16s ribosomal RNA sequence of bacterial isolate was
amplified using oligonuceotide primers (5’GGA GAG TTA GAT CTT GGC TC3’ sense and 5’AAg
GAG GTG ATC CAG CCG CA3’(Brunel et al., 1997). Samples amplified using 25µl of reaction with
10mM of each primer, 0.1 µg of DNA template, 12.5 µl 2X PCR- master mix and distilled Water. PCR
conditions were same as Brunel et al., 1997 with amplification at 570C. The sequence amplified was
around 1550 bp and it was cloned in pEMT vector for sequencing.
TOXIN ISOLATION
For isolation of toxins, the bacteria was cultured on LB broth for 48 hrs. on shaker. Extracellular and
intracellular fractions separated by centrifugation and sonication . Different fractions from the
extracellular and intracellular components of bacterium separated using columns, centrifugal devices and
gel filteration were bioassayed against 3rd instar larva of Helicoverpa armigera for insecticidal activity.
Protein content of different fractions was estimated and fractions were tested against 3rd instar larva of
Helicoverpa armigera for insecticidal activity.
294
DESIGNING OF PRIMERS FOR AMPLIFICATION OF TOXIN GENES
The primer pairs have been designed by identifying 8-10 amino acid stretch in protein that is rich in
amino acid codes by only one or more codons (Met, Trp, Phe, Cys, His, Lys, Asp, Gly, Gln, Tyr) and that
has no or few amino acids coded by six codon (Ser, Leu, Arg). Primers have also been designed by
aligning known toxin sequences from data bases.
F-5’ACCGCCGAGTCCCTTGGCTA3’,R-CGCTGCTGTCTGTGGAGCGTT
F-5’CTTCGGCGCCATTCCCCGTT 3’, R-GCGCTACTCTCGGCAGCAGG
F-5’GCGGAGGATGGCCGCAAACT 3’, R-CGTGCTGTGCTACCGCGTCA
F-5’CTTCGGCGCCATTCCCCGTT 3’,R-GCGCTACTCTCGGCAGCAGG
F-5’CGGTGACGCCGCACAGTTCT3’,R-TCTGTGCGACCGGAAACGGC
F -5’ TACC AATA TGTTAATTG TGGAC 3’, R R - 5’ CCA TCA TTTCAC ATA ACCG 3’
F-5’ TTCG AATA CCAA TATG TTAA TTGTGGAC 3’, R-5’ CCA TCA TTTCAC ATA ACCG 3’
F-5’ ATTACCAATATGT TAATTGTGG 3’, R - 5’ TCATCATATATTTTATAATG
F -5’ GGTCTAGAATGTAAAGGCAACAC-3'), R- 5'-GGAAGGACGGAAAGTGGAGA-3‘
F-(5'-ACCATACGCATCGGACAAAC-3'), R-5'-CGTAGCGGTTATTCACTCTTCT-3‘
F -TCAGACTGATGCCAAAGG, R - CCATCAATAGTTCCTGCC,
F -TCAGACTGATGCCAAAGG, R -CCATCAATAGTTCCTGCC
F-5’ TACTTAGTTGAGCGGTCAGG, R - 5’ GCCATGCTCAGTTACTGC
F-5’ TACTTGCTCA GACATTTCTCTATGG 3’,R – TTATTTAATGGTGTAGCG 3’
F 5’ACCATACGCATCGGACAAAC-3’, R 5’’CGTAGCGGTTATTCACTCTTCT-3’
F- 5’GGTCTAGAATGTAAAGGC-3’, R -5’GGAAGGACGGAAAGT 3’
F- 5’TACCACTGACAATACGTTTAT 3’, R- 5’CGGTTACTGACGATTGCTG3’
F- 5’ TCATGAAATACGTCCTAAGTGG 3’, R- 5’ AAA TATGT AAAACTATGGG GTTC3’
F- 5’ ACCTTAACTAATACAGACTTAG 3’, R- 5’ AA AGAAAAGAAATTTACGCGTG 3’
F - 5’ TGTAGTTACAAGAAAGAACC 3’, R- 5’ ATGTCTAAATACAAATTAAACC 3’
F-5’ CTTATACTATACTCAGGCAG 3’, R- 5’ ATTGCAAGATATTAATTACAAAG 3’
Molecular Characterization of Bacterial Isolate
Fig. 1
The sequence amplified was around 1550 bp and it was cloned in pEMT vector for sequencing.
Plasmid DNA was isolated using Qiagen miniprep kit and sequenced. The sequences were blasted. The
sequence of bacterial isolate showed 96% similarity to Paenibacillus sp. As this bacterial isolate showed
toxicity to sucking insect pests, this bacterial isolate was also characterized for biochemical parameters.
Biochemical characterization of bacterial isolate associated with H. indica and identified as
Paenibacillus sp.
Insecticidal Toxin Genes from Bacterial Symbiont of Thermotolerant Isolate of Heterorhabditis indica
295
Test
Result
Test
Result
Gram Stain
Gram Positive.
Methyl Red Test
Negative.
Pigmentation
No pigmentation.
Voges-Proskauer Test
Positive
Levan Production
No levan Production.
Gelatin Test
Weakly positive
Urease Test
Negative
Oxygen requirement
Facultatively anaerobic.
Tyrosinase Test
Positive
Production of H2S Gas.
No H2S production was observed.
Citrate Test
Positive
Production of Indole.
No Indole production was seen.
Catalase Test
Positive
Nitrate Reduction
Negative
Amino Acid decarboxylase Negative
Growth on Mc Conkey Agar Growth observed
Starch hydrolysis test
Positive.
Esculin Hydrolase Test
Positive
Casein Hydrolysis
Positive
Arginine Hydrolase Test
Negative
Motility Test
Negative
Oxidase Test
Negative
Carbohydrate Fermentation test The Test strongly positive for Glucose, Fructose, Galactose, Maltose, Raffinose, Sucrose,
Salicin, Trehalose and weakly positive for adonitol.
The test is negative for—Arabinose, Cellobiose, Inositol, Inulin, Lactose, Mannose, Mannitol, Melibiose, Rhamnose,
Sorbitol, Xylose and Dulcitol. No gas production was observed.
Toxin Isolation
Different fractions from the extracellular and intracellular components separated using columns,
centrifugal devices and gel filteration were bioassayed against 3rd instar larva of Helicoverpa armigera
for insecticidal activity. Protein content of different fractions was estimated and found to range between
1.32 -1.68 mg/ml. The fractions were tested against 3rd instar larva of Helicoverpa armigera for
insecticidal activity.
TABLE 1: INSECTICIDAL EFFICACY OF DIFFERENT FRACTIONS AT 10 μG
Fraction
1KG
3KG
10KG
50kG
100KG
Control
% Dead Intrahaemocoelic
22
40
58
67
45
10
% Dead Oral
20
60
80
100
40
0
1K-More than 1kDa, 3-more than 3kDa, 10, More than 1kDa, 50- More than 1kDa, 100 -More than
1kDa
Individual fractions at three different concentrations were (5, 10 and 15µg) were injected into
haemocoel of 3rd instar H.armigera larvae. At l0 µg difference in efficacy of different fractions was
evident and results are presented in Table 1. Control was maintained with physiological saline solution.
Observations on insect mortality after 24 hrs revealed that fraction 50 -100 kDa recorded more than 98%
mortality after 24 h while 10K fraction recorded 60% morality. In other fractions mortality was recorded
after 48 hrs only while in control there was nil mortality up to 48 hr. These fractions were also evaluated
for oral toxicity with H.armigera neonates. 50K fraction was also recorded to have oral toxicity.
50K fraction was run on native PAGE and individual bands were cut, eluted in buffer (140 mm NaCl,
2.7 mM KCl, 10mM Na2HPO4, 1.8 mMKH2PO4, pH 7.3) and analysed for insecticidal activity.
Fig. 2
296
The elutes of bands were applied to artificial diet for oral toxicity to Helicoverpa armigera neonates.
These were also injected in intrahaemoceolic for toxicity to H.armigera. LC50 experiments were
conducted for 48 h with neonate larvae, and were replicated on three separate occasions with 12 larvae
per treatment. Growth inhibition studies were 72 h in duration and were repeated twice with 12
individuals per treatment. Mortality data from the LC50 experiments was analyzed by Probit analysis.
Results indicate that two bands of approximately 950kDa had insecticidal effect. Lc50 for A band was
calculated at 0.1 µg while Lc50 for B band was 0.12 µg. At concentration of 0.18 µg injected in
haemocoel mortality ranged between 89-87%. Oral toxicity to neonates of H. armigera was also
recorded. At 0.05 µg oral toxicity to neonates was recorded with 78-85% mortality of neonates.
Evaluation of toxicity of these components against sucking pests is underway.
Rajagopal and Bhatnagar(2002) has isolated two protein complexes of approx. 1000kDa from
Photorhabdus luminescens subsp. akhurstii which were active against Spodoptera litura and Galleria
mellonella.
Amplification of Toxin Genes
Fig. 3
Insecticidal Toxin Genes from Bacterial Symbiont of Thermotolerant Isolate of Heterorhabditis indica
297
D6TcdB, Wg TcdA, D6TcdA2,Wg TcdA2,G1 TcdB, G1 TcdAB, G5 TcdA2, Photo TcdA, WgTcd
Ab could be amplified by using primers designed for amplification of toxin genes and standardization of
PCR conditions. These were cloned in pGEM-T vector and sequenced.
The sequences of PhotoTcdAB, TcdB were blasted. These were found to have 98% similarily with
Serine protease gene and phospholipase of Bacillus thuringiensis and B.cereus.
Amplification of Tcc Genes from Paenibacillus sp. is significant as this appears to be first reports of
a Paenibacillus species, strain, or protein having toxicity to lepidopterans. Furthermore, this may also
first known report of a Paenibacillus having toxin complex (TC)-like proteins controlling insects and like
pests. Genes from Photorhabdus encode large insecticidal toxin complexes which cause septicaemia in
insects. Arabidopsis thaliana plants expressing toxin A from Photorhabdus luminescens showed
considerable activity against lepidopteran insects and moderate activity against colepteran insects (Liu et
al, 2003). Identification and cloning of toxin genes from Paenibacillus would make available genes
effective against sucking pests. Further work on cloning of full length gene and their expression in
suitable vector is underway.
REFERENCES
[1] Brunel B., Givaudan A., Lanois A., Akhurst R.J. and Boemare N.E. (1997). Fast and accurate identification of Xenorhabdus
and Photorhabdus by restriction analysis of PCR amplification. Appl. Environ. Microbiol., 63:574-580.
[2] Liu, D., Burton, S., Glancy T., Li, Z.S., Hampton, R., Meade, T. and Merlo, D.J. (2003). Insect resistance conferred by 283
kDa Photorhabdus luminescens protein TcdA in Arabidopsis thaliana. Nat. Biotechnology 21: 1022-1028.
[3] Rajagopal, R. and Bhatnagar, R.K. (2002). Insecticidal toxic proteins produced by Photorhabdus luminescens akurstii, a
symbiont of Heterorhabdits indica. J.Nematol. 34” 23-27.
[4] Williamson, V.M. and Kaya, H.K. (2003). Sequence of a symbiont. Nat. Biotechnology 21: 1294-1295.
51
Identification and Characterization of a Novel Source
of Resistance to Root-Knot Nematode in Cotton
Mota C. Fabiane, Giband Marc, Carneiro, D.G. Marina, Silva, H. Esdras, Furlanetto
Cleber, Nicole Michel, Barroso, A.V. Paulo and Carneiro and M.D.G. Regina
Research Scientist, Cirad, UMR AGAP–Embrapa Algodão, Rodovia Go–462, Km 12, Zona Rural
75.375–000 Santo Antônio de Goiás, Go–Brazil
E-mail: [email protected].
Abstract—The root-knot nematode (RKN) Meloidogyne incognita Kofoid and White 1919, Chitwood 1949 is a major
constraint in cotton (Gossypium hirsutum L.) production in numerous countries. Control of RKN has been hampered
by the lack of high-quality local varieties exhibiting high levels of resistance as well as the lack of options for crop
rotation. High levels of resistance occur in breeding lines, but this high level of resistance has not been readily
transferred to cultivated varieties. Resistance to RKN is also found in wild tetraploid cotton accessions that represent
valuable resources for novel genes/mechanisms to be used for cotton improvement.
In this work, accessions of Gossypium spp. were evaluated for resistance to RKN in greenhouse experiments.
Responses to infection by M. incognita varied among the tested accessions, ranging from highly susceptible to
resistant. Some accessions displayed a significant reduction in the nematode reproduction. Histological observations of
one of the highly resistant G. barbadense accession showed that resistance may occur through two-stage mechanism
involving a hypersensitive-like response.
The highly resistant accession was crossed with a susceptible one to generate F1 and F2 plants for further genetic
studies. Analysis of the response of these F1 and F2 plants to RKN inoculation indicated that resistance is recessive,
and controlled by at least one major gene. Analyses using molecular markers associated to known RKN resistance loci
showed that the allele(s) involved are different from those previously described.
The characterization of the genetics and of the defense mechanisms associated with this novel source of resistance
to RKN in cotton constituted a first step towards its use in crop improvement.
Keywords: Gossypium, cotton, root-knot nematode, host-plant resistance, hypersensitive response
INTRODUCTION
The root-knot nematode (RKN) [Meloidogyne incognita Kofoid and White 1919 (Chitwood 1949)] is a
major constraint in cotton (Gossypium hirsutum L.) production in a number of countries, causing direct
damages and increasing in the severity of other root diseases, including Fusarium wilt disease (Hyer et
al. 1979; Shepherd 1982; Jeffers and Roberts 1993). The importance of this pest has been increasing over
the years, and in some regions, it has become one of the major causes of yield reduction.
Resistant varieties not only help control the disease and maintaining crop productivity, but they also
help decrease nematode populations in the soil and protect following rotations (Williamson and Hussey
1996; Ogallo et al. 1999; Starr et al. 2007; Davis and Kemerait 2009). Control of RKN has been
hampered by the lack of high-quality locally-adapted varieties exhibiting high levels of resistance as well
as the lack of adequate options for crop rotation.
Search for high levels of RKN resistant in cotton germplasm has been undertaken over the years, in
both cultivated species as well as in wild relatives (Jenkins et al.1979; Shepherd 1983; Robinson and
Percival 1997). Despite these efforts, few accessions with a high level of resistance have been identified.
In a more recent study, Robinson et al. (2004) identified three accessions of G. hirsutum (TX-25, TX1828, and TX-1860) that showed resistance levels equivalent to that of Auburn 623 RNR. This elite
breeding line (Shepherd 1974a), that was selected from crossing between two moderately-resistant
accessions – Clevewilt 6 and Wild Mexican Jack Jones (Shepherd 1974b), exhibits the highest level of
resistance to RKN known to date in cotton, and has been used to derive a number of breeding lines
(Shepherd et al. 1996). Nevertheless, the high level of resistance of Auburn 623 RNR and of its
derivatives (“M-series”) has not been transferred to superior cultivars. Only very recently were
Identification and Characterization of a Novel Source of Resistance to Root-Knot Nematode in Cotton
299
lines with high levels of resistance released (Davis et al. 2011; Starr et al. 2011). The cultivar Clevewilt 6
is also at the origin of the obsolete varieties Stoneville LA 887 (Jones et al. 1991) and Paymaster (Hartz)
1560, that were widely cultivated for their moderate levels of resistance to RKN, and of their sister lines
(La. RN 4-4, La. RN 909, La. RN 910, La. RN 1032) (Jones et al. 1988). To date, the only available
moderately RKN-resistant varieties with desirable agronomical and quality standards are Acala Nem X
(Oakley 1995) and Acala NemX H Y (Anonymous 2005), which have a restricted diffusion due to their
particular characteristics (“Acala-type cotton”).
Variability in virulence of RKN isolates on resistant cotton genotypes has been demonstrated
(Robinson and Percival 1997; Zhou et al. 2000). Furthermore, selection of isolates with increased
reproduction on resistant varieties after repeated exposures to resistant cotton was also evidenced (Ogallo
et al. 1997), indicating the need to increase the number of the sources of resistance to achieve effective
durable resistance. Indeed, cotton breeding for RKN resistance presently relies on a small number of – if
not a unique – source of resistance, which make such genotypes vulnerable to resistance breakdown.
Alternating sources of resistance, or pyramiding resistance factors constitutes a way to mitigate this
problem.
Breeding for nematode resistance in cotton has been an arduous task. The difficulty in the phenotypic
screening for resistance on a scale compatible with that of breeding programs, and the lack of a clear
understanding of the genetic basis of resistance has made progress difficult. Genetic analyses involving
different sources of resistance point out to the presence of multiple genes. Depending on the source of
resistance and on the crosses used, genes with dominant and others with recessive effects have been
detected; additive effects as well as transgressive segregation have also been shown to occur (Shepherd
1974b; Bezawada et al. 2003; McPherson et al. 2004; Zhang et al. 2007; Wang et al 2008; Ulloa et al
2010).
The efficient transfer of RKN resistance to improved commercial cultivars will largely depend on a
clear knowledge of the genetics of the trait and on the availability of tools to facilitate such a transfer.
Furthermore, the knowledge of resistance gene/locus diversity and of the allelic relations between these
genes/loci is important to achieve a durable high level of resistance.
Molecular genetics tools, and in particular the genetic mapping of resistance genes/loci and the
identification of molecular markers tightly associated with these resistance genes or loci have been useful
in better understanding the genetics of RKN resistance in cotton, in studying the genetic relation between
genes/loci, and represent powerful tools to assist the transfer of resistance for cotton crop improvement.
In recent years, a number of genetic mapping studies have been undertaken aiming at the mapping
resistance of loci and at identifying molecular markers associated with RKN resistance (Bezawada et al
2003; Shen et al 2006; Wang and Roberts 2006; Wang et al 2006; Ynturi et al 2006; Niu et al 2007;
Wang et al 2008; Gutiérrez et al 2010; Shen et al 2010). These studies have allowed to clarify the status
of nematode resistance loci in cotton, and to identify molecular markers tightly associated to major
resistance genes that are useful in breeding.
These and other studies (Roberts and Ulloa 2010) point out to chromosome 11 as bearing major
genes in at least two sources of resistance, and have resulted the identification of markers closely
associated to resistance. In Acala NemX, the microsatellite marker CIR316 is closely associated with a
major recessive gene (rkn1) (Wang et al 2006). In the Auburn 623 RNR-derived sources of resistance
(M240 and M120), the same markers is associated with a major dominant gene, Mi-C11(Gutiérrez et al
2010, Shen et al 2010). It is not clear whether these loci are allelic or not. Interestingly, Clevewilt 6, one
of the parental lines used to develop the highly resistant Auburn 623 RNR accession, also carries a
resistance QTL associated with marker CIR316 (Bezawada et al 2003, Gutiérrez et al 2010). Similarly, a
major QTL for resistance (galling index) was mapped on the same chromosome in M-495, a wild cotton
germplasm line (He et al 2010). In G. barbadense, in addition to these major genes, chromosome 11 has
also been shown to carry a transgressive segregation factor (RKN2) associated with the recessive rkn1
gene. On its own, RKN2 does not impart resistance, but when present with the rkn1 allele, RKN2
300
increases resistance (Wang et al 2008). The major resistance allele identified by marker CIR316 is not
present in Wild Mexican Jack Jones (WMJJ), the second parental line of Auburn 623 RNR. Instead,
WMJJ carries another locus on chromosome 14, linked to markers BNL 3545 and BNL 3661 that is also
present in Auburn 623 RNR and its derivatives, but not in Clevewilt 6 (Gutiérrez et al 2010).
Consistent with previous studies, this latter molecular mapping study also showed that each one of
the major genes/loci is responsible for different resistance mechanisms, that, when present together, lead
to the highest level of resistance. The gene/locus on chromosome 11 primarily impacts root galling, while
the proper allelic combination at locus on chromosome 14 induces a reduced egg production. The
favorable allelic composition at all three markers lead to the highest level of resistance (Gutiérrez et al
2010).
IDENTIFICATION OF A NOVEL SOURCE OF RESISTANCE TO RKN IN COTTON
Accessions of Gossypium species, which included modern or obsolete cultivars, breeding lines, and wild
accessions of G. hirustum, G. barbadense, and G. arboreum with known or suspected resistance to RKN
were evaluated for their resistance to a Brazilian isolate of M. incognita race 3 under controlled
conditions in a greenhouse. Resistance was evaluated based on three criteria: galling index (GI), egg
mass index (EMI) and reproduction factor (RF).
Among the accessions tested, reactions to RKN inoculation varied from highly susceptible to
resistant (data not shown). In agreement with previous studies (Shepherd 1983; Robinson and Percival
1997; Robinson et al. 2004), no general trend between species and reaction to inoculation was observed.
Similarly, no relation with geographical origin was evidenced. Most of the accessions that had been
tested in other studies showed responses in agreement with published results. Among the accessions
tested, the G. barbadense accession from Peru CIR1348 showed highly reduced nematode reproduction
(Table 1), and was classified as highly resistant. This accession was as efficient as M-315RNR – the
resistant control – in reducing nematode reproduction (RF = 0.01 vs. RF = 0.03 for M315RNR). In
addition, this accessions displayed very low galling index (GI = 0) and egg mass index (EMI = 0).
TABLE 1: GALLING INDEX (GI), EGG MASS INDEX (EMI) AND REPRODUCTION FACTOR (RF) PRESENTED BY DIFFERENT GOSSYPIUM SPP. 120 DAYS AFTER INOCULATION WITH 5,000 M.
INCOGNITA EGGS PER PLANT
Accession
GI1
EMI1
RF2
FM966 – susceptible control G. hirsutum
5
5
14a
M-315RNR – resistant control G. hirsutum
0.8
0
0.03b
CIR1348 G. barbadense
0
0
0.01b
1
Mean value (8 repetitions) of GI or EMI. 0: no galls or egg masses, 1: 1-2 galls or egg masses, 2: 3-10 galls or egg masses,
3: 11-30 galls or egg masses, 4: 31-100galls or egg masses, and 5 >100 galls or egg masses per root system.
2
RF = FP/IP, were FP = final nematode population and IP = initial nematode population (IP = 5,000). Mean values
(8 repetitions) were transformed in log (x+1). Means followed by different letters are significantly (P< 0.05) according to
Scott-Knot’s test.
Accession CIR1348 thus appears to be as resistant to RKN inoculation as the accessions that display
the highest level of resistance known to date (Auburn 623RNR and derivatives). Interestingly, CIR1348
is wild accessions of G. barbadense from Peru. South America, and in particular Peru, is considered to be
the center of origin and diversity of G. barbadense (Giband et al 2010). It is thus expected that a rich
genetic variability is encountered in wild accessions from this region (Westengen et al. 2005), including
for resistance to RKN and other disease or pests. This situation is similar to that of wild accessions and
landraces of G. hirsutum from Mexico, the center of origin of the species, which include the accessions
Wild Mexican Jack Jones and TX-25 in which notable levels of resistance were identified (Shepherd
1983; Robinson and Percival 1997; Robinson et al. 2004).
HISTOLOGICAL CHARACTERIZATION OF THE RESISTANCE REACTION IN ACCESSION CIR1348
The mechanism of the resistant displayed by the highly resistant accession CIR1348 was studied through
the observation of histological sections of root samples using bright-field and UV microscopy.
301
Stage 2 juvenile (J2) penetration was not affected in accession CIR1348, since similar numbers of J2s
could be observed in the susceptible and resistant accessions. Similar observations were made in the
moderately resistant accession Clevewilt-6 (McClure et al. 1974), in the highly resistant accession M-315
RNR (Jenkins et al. 1995), and in number of other resistant accessions (Faske and Starr 2009). Preexisting mechanisms which could impede nematode penetration seems to be apparently absent in cotton.
Rather, in accession CIR1348, as in other RKN-resistant accessions of cotton, it appears that resistance
may result from post-penetration events associated with the blocking or delay of nematode development
and reproduction.
Root sections harvested at 7-21 days after inoculation (DAI) showed major alteration in the cells in
contact with the nematodes. Hypersensitive- response (HR)-like lesions were found around all nematodes
after they penetrated the epidermis and migrated through the cortex, or when they reached the vascular
cylinder. Sections also showed almost entire bodies of nematodes completely surrounded by
autofluorescence or toluidine dark-stained components.
At 21-29 DAI, only a few giant cells were observed, some of them showing multiple nuclei and
reduced thickening of walls. At 21 DAI, strongly deformed J3/J4 juveniles were detected in the vicinity
of the altered giant cells. At 29 DAI, most giant cells had degenerated, and presented a retracted
cytoplasm containing numerous small vacuoles. No adult female with eggs were seen in any of the 34-45
DAI sections that were analyzed.
It thus appears that in CIR1348 at least two different mechanisms could be involved in the expression
of resistance. One mechanism, which occurs at about 7 DAI, blocks or delays the development of J2 that
have penetrated the roots. The second, that involves a mechanism impeding the formation of functional
feeding sites, occurs at about 21 DAI and further impedes the formation of adult females.
Genetic analyses (McPherson et al. 2004; Zhang et al. 2007) point out to a 2-gene model for the
inheritance of resistance to RKN in cotton. In their study, Jenkins et al. (1995) proposed that one gene
acting at an earlier stage is responsible for the mechanism seen at 8 DAI, while the second explains the
later (24 DAI) phenomenon. Molecular mapping data (Ynturi et al. 2006; Gutiérrez et al. 2010) support
these hypotheses, and revealed the occurrence of QTLs on chromosomes 11 and 14 to explain the
resistance in cotton accessions (Auburn 634 RNR and M-240 RNR, respectively) which share the same
source of resistance as M-315 RNR. The QTL on chromosome 11 is associated with reduced root galling
index, while that on chromosome 14 is associated with reduced egg production (Gutiérrez et al. 2010).
Whether this situation holds true for accession CIR1348 remains to be clarified.
GENETIC ANALYSIS OF THE RESISTANCE IN ACCESSION CIR1348
The highly resistant accession CIR1348 was crossed with a susceptible one (the susceptible control
FM966) to generate F1 and F2 plants for further genetics studies. As above, progenies were assessed for
GI, RMI, and RF after RKN inoculation under controlled conditions. The analysis of the response of the
F1 plants clearly showed that resistance in accession CIR1348 is recessive, the F1 showing a GI = 5, EMI
= 4.8, and RF = 25, values similar to that of the susceptible parent FM966 (GI = 5, EMI = 5 and
RF = 29).
The results of the F2 plants were more complex to analyze. Analyses conducted on a reduced number
of plants (n = 18) showed that at least one major recessive gene is involved in the determination of the
phenotype. Nevertheless, these analyses cannot rule out the hypothesis that a second recessive gene, with
a more moderate effect on the phenotype, is also involved in determining the high level of resistance
observed in accession CIR1348. The analysis of a larger number of F2 plants is underway to clarify this
point.
If the second hypothesis holds true, the situation in accession CIR1348 would be similar to that in
other sources of resistance, with the main difference being that the resistance in the former is recessive,
while it is usually considered dominant (or partially dominant) in the latter.
302
A number of studies (Shen et al 2006; Wang et al 2006; Gutiérrez et al 2010; He et al 2010; Shen et
al 2010) have shown that the SSR marker CIR316, mapped on chromosome 11, is associated to RKN
resistance in a number of accessions. To verify if the same locus is also involved in the resistance in
accession CIR1348, we applied marker CIR316 and analyzed the resulting amplification profile.
While the susceptible and resistant controls (FM966 and M-315RNR, respectively) exhibited the
banding pattern expected for marker CIR316, accession CIR1348 showed an amplification pattern
different from that of both controls. It thus appears that resistance in accession CIR1348 is determined by
allele(s) different from that (those) previously described for known sources of resistance.
The present study on the characterization of the genetics and of the defense mechanisms associated
with this novel source of resistance to RKN in cotton constituted a first step towards its use in crop
improvement.
REFERENCES
[1] Anonymous (2005). Plant variety protection certification no. 200500113 for cotton Acala
[2] NemX HY. Plant Variety Protection Office, Agricultural Marketing Service, US Department of Agriculture, Washington,
DC.
[3] Bezawada, C., Saha, S., Jenkins, J.N., Creech, R.G.,and McCarty J.C. (2003). SSR marker(s) associated with root knot
resistance gene(s) in cotton. The Journal of Cotton Science, 7, 179-184.
[4] Davis, R. F. and Kemerait, R.C. (2009). The multi-year effects of repeatedly growing cotton with moderate resistance to
Meloidogyne incognita. Journal of Nematology, 41, 140-145.
[5] Davis, R.F., Chee, P., W., Lubbers, E. L., and May, O. L. (2011). Registration of GA120R1B3 germplasm line of cotton.
Journal of Plant Registrations, 5, 384-387.
[6] Faske, T. R. and Starr, J. L. (2009). Mechanism of resistance to Meloidogyne incognita in resistant cotton genotypes.
Nematropica, 39, 281-288.
[7] Giband, M., Dessauw, D., and Barroso P. A. V. (2010). Cotton: Taxonomy, Origin, and Domestication. In Wakelyn, P.J. &
Chaudhry M.R (Eds) Cotton: Technology for the 21st Century (pp 5-17). International Cotton Advisory Committee,
Washington DC, USA.
[8] Gutiérrez, O.A., Jenkins, J.J., McCarty, J.C., Wubben, M.J., Hayes, R.W. and Callahan, F.E. (2010). SSR markers closely
associated with genes for resistance to root-knot nematode on chromosomes 11 and 14 of Upland cotton. Theoretical and
Applied Genetics, 121, 1323-1337.
[9] He, Y., Iqbal, N., Shen, X., Davis, R.F., and Chee, P. (2010). QTL mapping of resistance to root-knot nematode in the wild
cotton germplasm line M-495RNR. P. 763. In: Proceedings of the Beltwide Cotton Conference, New Orleans, LA, Jan 4–7,
2010. National Cotton Council of America, Memphis, TN, USA.
[10] Hyer, A. H, Jorgenson, E. C., Garber, R. H., and Smith, S. (1979). Resistance to root-knot nematode in control of root-knot
nematode – Fusarium wilt disease complex in cotton. Crop Science, 19, 898-901.
[11] Jeffers, D. P., and Roberts, P. A. (1993). Effect of plant date and host genotype on the root-knot – Fusarium wilt disease
complex of cotton. Phytopathology, 83, 645-654.
[12] Jenkins, J. N., Parrott, W. L., Kappelman, A. J., & Shepherd, R. (1979). Registration of JPM 781-783 cotton germplasm.
Crop Science, 19, 932.
[13] Jenkins, J. N., Creech, R. G., Tang, B., Lawrence, G. W., & McCarty, J. C. (1995). Cotton resistance to root-knot nematode
: II. Post-penetration development. Crop Science, 35, 369-373.
[14] Jones, J. E., Beasley, J. P., Dickson, J. I., & Caldwell, W. D.(1988). Registration of four cotton germplasm lines with
resistance to reniform and root-knot nematodes. Crop Science, 28, 199-200.
[15] Jones, J. E., Dickson, J. I., Aguillard, W., Caldwell, W. D., Moore, S. H., Hutchinson, R. L., et al. (1991). Registration of
‘LA 887’ cotton. Crop Science, 31, 1701.
[16] McClure, M. A., Ellis, K. C., & Nigh, E. L. (1974). Post-infection development and histopathology of Meloidogyne
incognita in resistant cotton. Journal of Nematology, 1, 21-26.
[17] McPherson, G.R., Jenkins, J.N., Watson, C.E, and McCarty, J.C. (2004). Inheritance of root-knot nematode resistance in M315 RNR and M78-RNR cotton. Journal of Cotton Science, 8, 154-161.
[18] Niu, C., D.J. Hinchliffe, R.G. Cantrell, C. Wang, P.A. Roberts, and J. Zhang. (2007). Identification of molecular markers
associated with root-knot nematode resistance in upland cotton. Crop Science, 47, 951-960.
[19] Oakley, S. R. (1995). CPCSSD Acala C-225: A new nematode resistant Acala variety for California’s San Joaquin Valley.
In: Proceedings of 1995 Beltwide Cotton Production Research Conference (p. 39). Memphis, TN: National Cotton Council
of America.
[20] Ogallo, J.L., Goodell, P.B., Eckert, J., & Roberts, P.A. (1997). Evaluation of NemX, a new cultivar of cotton with high
resistance to Meloidogyne incognita. Journal of Nematology, 29, 531-537.
[21] Ogallo, J.L., Goodell, P.B., Eckert, J., and Roberts, P.A. (1999) Management of root-knot nematodes with resistant cotton
cv. NemX. Crop Science, 39, 418-421.
303
[22] Roberts, P.A., and Ulloa, M. (2010). Introgression of root-knot nematode resistance into tetraploid cottons. Crop Science,
50, 940-951.
[23] Robinson, A. F. & Percival, A. E. (1997). Resistance to Meloidogyne incognita raça 3 and Rotylenchulus reniformis in wild
accessions of Gossypium hirsutum and G. barbadense from Mexico. Journal of Nematology, 29, 746-755.
[24] Robinson, A. F., Bridges, A. C., & Percival, E. (2004). New source of resistance to the reniform (Rotylenchus reniformis
Linford and Oliveira) and root-knot (Meloidogyne incognita Kofoid &White, Chitwood) nematode in upland (Gossypium
hirsutum L.) and Sea Island (G. barbadense L.) cotton. The Journal of Cotton Science, 8, 191-197.
[25] Shen, W., Van Becelaere, G., Kumar, P., Davis, R.F., May, O.L., and Chee, P. (2006). QTL mapping for resistance to rootknot nematodes in M-120 RNR Upland cotton line (Gosspypium hirsutum L.) of the Auburn 623 RNR source. Theoretical
and Applied Genetics, 113, 1539-1549.
[26] Shen,X., He, Y., Lubbers, E.L., Davis, R.F., Nichols, R.L., and Chee, P.W. (2010). Fine mapping QMi-C11 a major QTL
controlling root-knot nematode resistance in Upland cotton. Theoretical and Applied Genetics, 121, 1623-1631.
[27] Shepherd, R. L. (1974a). Registration of ‘Auburn 623 RNR’ cotton germplasm. Crop Science, 35, 373-375.
[28] Shepherd, R. L. (1974b). Transgressive segregation for root-knot nematode resistance in cotton. Crop Science, 14, 872–875.
[29] Shepherd, R. L. (1982). Genetic resistance and its residual effects for control of the root-knot nematode – Fusarium wilt
complex in cotton. Crop Science, 22, 1151-1155.
[30] Shepherd, R. L. (1983). New sources of resistance to root-knot nematodes among primitive cottons. Crop Science, 23, 9991002.
[31] Shepherd, R. L., McCarty, J. C., Jenkins, J. N., & Parrott, W. L. (1996). Registration of nine cotton gernplasm lines
resistant to root-knot nematode. Crop Science , 36, 820.
[32] Starr, J. L., Koenning, S. R., Kirkpatrick, T. L., Robinson, A. F., Roberts, P. A., and Nichols, R. L. (2007). The future of
nematode management in cotton. Journal of Nematology, 39, 283-294.
[33] Starr, J.L., Smith, C.W., Ripple, K., Zhou, E., Nichols, R.L., and Faske, T.R. (2011). Registration of TAM RKRNR-9 and
TAM RKRNR-12 germplasm lines of upland cotton resistant to reniform and root-knot nematodes. Journal of Plant
Registrations, 5, 393-396.
[34] Ulloa, M., Wang, C., and Roberts, P. A. (2010). Gene action analysis by inheritance and quantitative trait loci mapping of
resistance to root-knot nematodes in cotton. Plant Breeding, 129, 541-550.
[35] Wang, C. and Roberts, P.A. (2006). Development of AFLP and derived CAPS markers for root-knot nematode resistance in
cotton. Euphytica, 152, 185-196.
[36] Wang, C., Ulloa, M., and Roberts, P.A. (2006). Identification and mapping of microsatellite markers linked to a root-knot
nematode resistance gene (rkn1) in Acala NemX cotton. Theoretical and Applied Genetics, 112, 770-777.
[37] Wang C. Ulloa, M., and Roberts, P.A. (2008). A transgressive segregation factor (RKN2) in Gossypium barbadense for
nematode resistance clusters with gene rkn1 in G. hirsutum. Molecular Genetics and Genomics, 279, 41-52.
[38] Williamsom, V. M., and Hussey, R. S. (1996). Nematode pathogenesis and resistance in plants. The Plant Cell, 8, 17351745.
[39] Westengen, O. T, Huamán, Z., and Heun, M. (2005). Genetic diversity and geographic pattern in early South American
cotton domestication. Theoretical and Applied Genetics, 110, 392-402.
[40] Ynturi, P., Jenkins, J.J. MacCarty, J.C., Guttierrez, O.A., and Saha, S. (2006). Association of root-knot nematode resistance
genes with simple sequence repeat markers on two cromosomes in cotton. Crop Breeding and Genetics, 46, 2670-674.
[41] Zhang, J. F., Waddell, C., Sengupta-Gopalan, C., Potenza, C., and Cantrell, R.G. (2007). Diallel analysis of root-knot
nematode resistance based on galling index in upland cotton. Plant Breeding, 126, 164-168.
[42] Zhou, E., Wheeller, T. A., & Starr, J. L. (2000). Root galling and reproduction of Meloidogyne incognita isolates from
Texas on resistant cotton genotypes. Journal of Nematology, 32, 513-518.
52
Predominance of Resistance Breaking Cotton Leaf
Curl Burewala Virus (ClCuBuv)
in Northwestern India
Prem A. Rajagopalan1, Amruta Naik1, Prashanth Katturi1, Meera Kurulekar1
Ravi S. Kankanallu2 and Radhamani Anandalakshmi1
1
Plant-Virus Interactions Lab, Mahyco Research Center, Maharashtra Hybrid Seeds Company
Limited, Dawalwadi, Post Box no-76, Jalna, Maharashtra–431 203, India
2
Vegetable Research Center, Maharashtra Hybrid Seeds Company Limited, Bettanagera Village,
Huskur Post, Bangalore–562 123, India
Cotton leaf curl disease (CLCuD) is the most devastating among viral diseases of cotton Gossypium
hirsutum (L.) in northwestern India (Varma and Malathi, 2003). Plants susceptible to the virus show upward and down-ward leaf curling,thickening of veins, enations on the leaf abaxial surface, overall
stunting, and flower and fruit abortion leading to low productivity. CLCuD is caused by a group of
geminivirus species from the genus Begomovirus, in the family Geminiviridae. Cotton infecting
begomoviruses (CBVs) like the majority of Old World begomoviruses, are monopartite having genomes
that consist of only one circular single-stranded DNA (ssDNA) molecule and are associated with
betasatellite (Briddon et al. 2003) and frequently a third component known as alphasatellite (Briddon et
al., 2004). The CBVs complex is transmitted by the whitefly Bemisia tabaci (Genn.)
Though CBVs was first reported from IARI, New Delhi, India in 1989, it was identified as the causal
agent of severe epidemic outbreaks of the CLCuD in Punjab and adjacent SriGanganagar in 1994. Since
then, CBVs has spread to all of the cotton growing regions of north westerns India, where it has become
the limiting factor for cotton production in every season, causing up to 100% yield loss. The major
begomoviruses associated with CLCuD are Cotton leaf curl Rajasthan virus (CLCuRV), Cotton leaf curl
Multan virus (CLCuMuV) and Cotton leaf curl Kokhran virus (CLCuKoV).
During 2002, we commenced a comprehensive study to understand the distribution, diversity and
biological characterization of CBVs in northwestern India. In surveys conducted during 2002-2005, we
noticed predominance of CLCuRV in fields when compared to either CLCuMuV or CLCuKoV. The
cotton hybrids and varieties which were developed and marketed by the different seed companies and
public institutions were showing varying degrees of tolerance to different CBVs.
During our reconnaissance studies in the 2005 cropping season, some of the plants in farmer’s fields
in SriGanganagar showed the severe symptoms in cotton cultivars which were earlier resistant to
“Rajasthan strain’ (CLCuRV), Later we confirmed that the plants were infected by the e resistance
breaking virus “Burewala strain” and now recognized as a distinct begomovirus species- ‘Cotton leaf curl
Burewala virus’(CLCuBuV).
However, during 2009 -2010, severe and wide spread CLCuD was observed on cotton in the fields of
Bathinda, Abohar, Fazilka, SriGanganagar, and the surrounding Punjab and Rajasthan states and causing
yield loss even up to 100%. Most cotton cultivars previously resistant to CBVs were found to be severely
affected
To identify the specific viral genotype(s) involved in the recent outbreak, begomovirus field isolates
were collected from cotton fields and subjected to DNA sequencing. Partial sequences of 258, as well as
full-length sequences of 30 complete virus genome sequences were determined and sequences were
compared to those isolates from 2003-2008. Based on partial and full length genome sequences, it can be
concluded that the new emergent, resistance-breaking strain, CLCuBuV has become established in
northwestern India.
Predominance of Resistance Breaking Cotton Leaf Curl Burewala Virus
305
Nearly 93% (238 out of 258) of the samples were infected with CLCuBuV and full length
characterization studies showed that this virus isolates are prevalent in three putative mutant forms. We
have noticed two major variations when compared to place of origin of the mutant virus. Amrao et al.
(2010) reported the prevalence of three C2 mutants in Vehari, Pakistan, but we were able to collect only
one type of mutant in our surveys. Further Amrao et al. (2010) speculated that, C2 mutation is an escape
mechanism in CLCuD resistant G.hirsutm lines. Interestingly, we have isolated CLCuBuV carrying
intact C2, also from these tolerant lines. How these different mutant viruses are vectored by whiteflies
and how the virus is thriving on different genotypes of cotton from one season to another need to be
looked into for devising effective control measures to combat the spread of CLCuD
REFERENCES
[1] Amrao L, Amin I, Shahid MS, Briddon RW, Mansoor S (2010a) Cotton leaf curl disease in resistant cotton is associated
with a single begomovirus that lacks an intact transcriptional activator protein. Virus Res 152:153–163
[2] Briddon RW (2003) Cotton leaf curl disease, a multi component begomovirus complex. Mol Plant Pathology 4:427–434
[3] Briddon RW, Bull SE, Amin I, Mansoor S, Bedford ID, Rishi N, Siwatch S, Zafar MY, Abdel-Salam AM, Markham PG,
(2004) Diversity of DNA1; a satellite-like molecule associated with monopartite begomovirus–DNA complexes. Virology
324:462–474
[4] Varma A, Malathi VG (2003) Emerging geminivirus problems: A serious threat to crop production. Annals of Applied
Biology 142:145–164
Cotton Production, Physiology and Economics
53
Cotton Genotypes Performance
under Rainfed and Irrigated Conditions
in two Regions of Northern Argentina
Marcelo Paytas1 and Jose Tarrago2
1
INTA EEA Reconquista, Santa Fe, (3560), Argentina
2
INTA EEA Las Brenas, Chaco, (3722), Argentina
Abstract—Narrow-row cotton production systems have became popular in Argentina in the last few years. It is mainly
cultivated under rainfed conditions as a low input crop which is challenging and risky. Irrigation can improve the
performance of current genotypes and may reduce the variability in yield produced under rainfed conditions across different
environments. This research was aimed to understand the differences in growth, development and yield of two cotton
cultivars in a narrow row system under rainfed and irrigated conditions.
Experiments were conducted during 2010-11 under rainfed and irrigated conditions at the Research Station of INTA
Reconquista, Santa Fe (29º11´S, 59º42’W) and INTA Las Brenas, Chaco (27º05´S, 61º06’W). The annual rainfall and its
distribution, temperatures, evaporative demand and soil types differ between both cotton regions. The experimental design in
each location was a split plot design with four replications: two genotypes (NuOpal and DP402) with two moisture levels
(rainfed and irrigated). The results indicated differences between genotypes in terms of days to crop maturity. Earliness was
found for DP402 for both locations compared with NuOpal. However, no significant differences in terms of phenology were
found between rainfed and irrigated conditions due the amount of soil water content available from rainfall for the plant in
both systems. Dry matter production and partitioning to reproductive organs was affected by genotypes and moisture levels.
DP402 with shorter vegetative and reproductive stages produced significant differences in dry matter between moisture levels
than NuOpal with later maturity. Percentage of fruit retention increased by maturity in DP402 compared with NuOpal
under both rainfed and irrigated conditions, although NuOpal produced higher number of nodes and fruiting sites but higher
fruit abortion in the lower part of the plant.
INTRODUCTION
Narrow-row cotton has become popular in Argentina in the last few years reaching about 90% of the
national sowing area. By reducing distance between rows and increasing plant population, plants became
smaller and harvested with stripper machines reducing harvesting costs compared with previous
traditional cotton systems. Cotton is mainly cultivated under dryland conditions as a low input crop
which is challenging and risky. However, irrigation practices can improve the current genotypes
performances and may reduce the variability in yield.
Changing row spacing and plant population has been used to increase yield in many other crops. By
changing the spacing between plants, competition for light, water and nutrients is altered, which can
change fruit number and retention per plant and the size of the plant (Bednarz, 2000). Due to the
influence of environmental conditions on plant growth and development, specific row spacing and
population recommendations for crops may vary. The optimum plant population for any crop is the
population that maximizes yield while optimising resource use (Willey and Heath, 1969). Nowadays,
Argentinean cotton farmers are mainly using 52 cm as row spacing and 220,000 plants per hectare.
Whether this population is optimal or not to produce high yielding cotton with current Bt varieties is
focus of numerous studies.
Boll retention and distribution within a plant play an important role in determining final yield, and
are linked to the allocation of assimilate produced during vegetative growth by the plant. If the
availability of assimilate is adequate to support the developing bolls, then the bolls will be retained
(Constable, 1991; Jenkins et al., 1990a). However, if the demand from growing bolls exceeds the
assimilate supply, the retention of bolls will decline as a result of an increase in the boll shedding (Guinn,
1998; Mason, 1922).
310
Most of the time, research has been done comparing different crop configuration, while in this work
the aim was to maintain the same configuration and vary the inputs of water to increase source
availability for maximizing cotton yield, using two different genotypes and two growing environmental
conditions. Increased resource availability by irrigation may reduce the variability in yield produced
under rainfed conditions across these different environments. This research was aimed to understand the
differences in growth, development and yield of two cotton cultivars in narrow row systems under
rainfed and irrigated conditions.
Experiments were conducted during 2010-11 under rainfed and irrigated conditions at the Research
Station of INTA Reconquista, Santa Fe (29º11´S, 59º42’W) and INTA Las Brenas, Chaco (27º05´S,
61º06’W), Argentina. The experimental design in each location was a split plot design with four
replications: two cultivars (NuOpal and DP402) were sown at a spacing of 0.52 m between rows having
11 plants per meter. Two soil moisture treatments (irrigated and rainfed) were compared. In both the
locations, irrigated plots received three irrigations at the time of flowering (about 90 mm in Las Brenas
and 60 mm in Reconquista) besudes water from rainfall. Neutron moisture meter measurements were
used to monitor soil moisture content (0-150 cm depth). Harvests for total biomass, biomass partitioning,
radiation interception and yield, as well as mapping, were done at various developmental stages
throughout the season. Meteorological conditions were recorded during the season.
The annual rainfall and its distribution, temperatures, evaporative demand and soil types differ between
both cotton regions. Wetter conditions were found at Reconquista, Santa Fe compared with Las Brenas,
Chaco. Differences between cultivars were observed in terms of days to crop maturity. Earliness was
found for DP402 for both locations compared with NuOpal. However, no significant differences in terms
of phenology were found between rainfed and irrigated conditions due the amount of soil water content
available from rainfall for the plant in both systems.
Dry matter production and partitioning to reproductive organs was affected by genotypes and
moisture levels. DP402 with shorter vegetative and reproductive stages produced significant differences
in dry matter production between moisture levels than NuOpal with later maturity. In both locations,
similar responses were found in terms of dry matter production and partitioning to reproductive organs.
Lower solar radiation interception was found in the lower part of the canopy in NuOpal. Possibly, the
greater vegetative growth in NuOpal may have contributed to reduced boll growth and shedding of
flowers and young bolls lower in the canopy due to poor light infiltration. Percentage of fruit retention in
first fruit positions on the main stem increased by maturity in DP402 compared with NuOpal under both
rainfed and irrigated conditions. NuOpal produced higher number fruits abortions in the lower part of the
plant. It is likely that solar radiation and photosynthesis in low position fruiting sites become a limitation,
with a bigger plant and complete canopy closure resulting in fruit abortions and decrease in the yield
potential in conventional cropping systems (Constable and Rawson, 1980b; Wullschleger and Oosterhuis,
1990a; 1990b).
The longer period to maturity in NuOpal may compensate after reproductive organs in the first few
positions were aborted, with higher number of nodes and fruiting sites on lateral and upper part of the
canopy, increasing final cotton yield in a wet season for both locations. However, DP402 with shorter
vegetative and reproductive period produced higher seed cotton yields than NuOpal (Table 1) in both
locations, with a better crop performance under narrow row systems in a subtropical environment with
humid crop season.
Cotton Genotypes Performance under Rainfed and Irrigated Conditions in two Regions of Northern Argentina
311
TABLE 1: SEED COTTON YIELD (KG*HA-1) FOR TWO GENOTYPES UNDER RAINFED AND IRRIGATED CONDITIONS FOR TWO LOCATIONS IN NORTH ARGENTINA
Location: Reconquista, Seed Cotton yield (kg*ha-1)
Santa Fe
NuOpal-I
3.298
NuOpal-RF
3.045
DP402-I
3.788
DP402-RF
3.540
Significance
*
I: Irrigated treatment
RF: Rainfed treatment
*Significance (P 0.05)
Location: Las Brenas, Chaco
Seed Cotton yield (kg*ha-1)
NuOpal-I
NuOpal-RF
DP402-I
DP402-RF
2.160
2.156
3.231
3.340
*
REFERENCES
[1] Bednarz, C.W., Bridges, D.C. and Brown, S.M. (2000) - Analysis of cotton yield stability across population densities.
Agronomy Journal 92, 128-135.
[2] Constable, G.A. and Rawson, H.M. (1980b) - Carbon production and utilization in cotton - inferences from a carbon
budget. Australian Journal of Plant Physiology 7: 539-553.
[3] Constable, G.A. (1991) - Mapping the Production and Survival of Fruit on Field-Grown Cotton. Agronomy Journal 83:
374-378.
[4] Guinn, G. (1998) - Causes of square and boll shedding. Beltwide Cotton Conferences, pp. 1355–1364.
[5] Jenkins, J.N., McCarty, J.C. and Parrott, W.L. (1990) - Effectiveness of fruiting sites in cotton - yield. Crop Science 30:
365-369.
[6] Mason, T.G. (1922) - Growth and abscission in Sea Island cotton. Annals of Botany 36: 457-484.
[7] Willey, R. and Heath, S. (1969) - The quantitative relationship between plant population and crop yield. Advances in
Agronomy 21: 281-321.
[8] Wullschleger, S.D. and Oosterhuis, D.M. (1990a) - Photosynthetic and respiratory activity of fruiting forms within the
cotton canopy. Plant Physiology 94: 463-469.
[9] Wullschleger, S.D. and Oosterhuis, D.M. (1990b) - Photosynthetic carbon production and use by developing cotton leaves
and bolls. Crop Science 30: 1259-1264.
54
The Adaptation of Irrigated Cotton
to the Tropical Dry Season
S.J. Yeates1,2
1
Principal Research Scientist, CSIRO–Plant Industry, Ayr, Qld, Australia
2
The Australian Cotton Cooperative Research Centre
Abstract—The reintroduction of cotton to most of the Australian tropics was prevented by insect pests that are
dominant during the wet (summer) season and a perception that the crop could only be grown in the wet season.
Growing cotton during the dry (winter) season has avoided these pests. However the photothermal pattern of the dry
season is the reverse of the wet season and that of spring sown cotton in temperate latitudes. Average night
temperatures are cool mid season (12 to 14 oC) with extremes < 6 oC and high temperatures are likely early and late in
the season. Solar radiation is 20% less than at temperate latitudes mid season and could also limit crop growth. It was
not known what yield or fibre quality was possible. Over three seasons two upland Bt-transgenic cultivars and one
Gossypium barbadense cultivar were sown from March to June in field experiments at the Ord River (15.5oS). A pot
experiment conducted at Katherine, (14.5oS) over two seasons where average ambient minimum temperatures were
4oC lower than the field experiments during flowering were compared with temperatures 6 oC higher by moving plants
into a glasshouse at night. Despite the photothemal constraints, lint yields were at the high end of Australian and
international benchmarks when sown in March and April. The lower temperature and radiation during flowering and
early boll growth for the March and April sowings combined to reduce the crop growth rate during this phase
compared with cotton grown at temperate latitudes. However, assimilate supply was adequate because boll demand
was also lower at this time due to early flowers having slower development, lower retention and smaller bolls.
Increasing late season temperature and radiation permitted yield compensation via an extended flowering period and a
greater contribution to yield from later pollinated flowers on the top and outside of the plant. The Katherine
experiment found boll retention and size was correlated (p < 0.01) with minimum temperature during flowering. Full
yield recovery occurred because cold minimums were episodic. RUE was negatively correlated with average
temperature up to first flower a response not reported previously in cotton and explained some of variation in RUE
measured here and elsewhere. Cool temperatures during fibre development reduced fibre length and strength at March
and April sowings. Further screening may identify cultivars with suitable fibre length and strength in these
conditions.
Introduction
There have been many attempts to grow cotton in the Australian semi-arid tropics (SAT). The region is
vast, approximately 30% of the Australian continent, and largely unutilised for cropping of any species.
The region contains about 66 drainage basins or river catchments; these account for around 60% of
Australia’s surface water runoff, with significant ground water and arable soils (NLWRA 2001). The
only significant commercial production of cotton in the region occurred at the Ord River between 1963
and 1974. Cotton was grown during the wet season (November to April) with irrigation supplementing
rainfall to finish the crop early in the dry season (April to June) (Hearn, 1975). Despite yields similar to
south-eastern Australia during the same period, cotton production became uneconomic due to poor fibre
quality and resistance of Helicoverpa armigera to insecticides, which resulted in excessive pesticide
usage (Hearn, 1975).
The reintroduction of cotton to the Australian SAT is being assessed via a multidisciplinary study
that evaluates a novel production system designed to avoid the pest management problems of the
previous cotton industry. The new system involves dry season cropping to avoid peak numbers of the
key pests Helicoverpa armigera, Helicoverpa punctigera, Spodoptera litura, Pectinophora gossypiella
and Anomis spp., which characterise the wet season, and incorporates Integrated Pest Management and Bt
transgenic genotypes (Strickland et al.,, 1998). A comparison of the proposed system with the previous
wet season system is shown in Table 1. Sowing of cotton crops from March 1st is desirable in the Ord
River and much of the Australian SAT as they flower during the cooler months of May to August
avoiding key insect pests (Strickland et al.,, 1998 & 2003). Once the first field is sown in a valley all
Genetic Diversity Analysis in Cotton Germplasm
313
cotton must be sown within five weeks of that date to minimise the number of generations of
Helicoverpa armigeria exposed to Bt proteins (Monsanto and Cotton Australia, 2010). Pest management
research to date demonstrates effective insect management was achieved by adopting this system,
requiring only 3.5 insecticide sprays per crop (Strickland et al.,, 1998; Annells and Strickland, 2003)
compared with 40 for the 1970’s industry (Hearn, 1975).
TABLE 1: KEY ELEMENTS OF A NOVEL COTTON PRODUCTION SYSTEM FOR THE ORIA CONTRASTED WITH THE PREVIOUSLY UNSUCCESSFUL SYSTEM OF
THE 1970S (ADAPTED FROM STRICKLAND ET AL., 1998)
1970s Industry
Wet season planting window that was long – November to
February.
Flowering from wet season (February) to early dry season
(May).
Conventional cultivars
Broad spectrum insecticides
No pesticide resistance management
New Industry
Dry season (winter) cropping, with a narrow planting window
(5 weeks) in March – April.
Flowering in low pest months of May to August.
Bt transgenic cultivars
IPM systems
Pre-emptive Bt resistance management
The key agronomic change in this proposed production system is the requirement for a five week
planting window that can commence on March 1st. Hence it is pertinent to ask why sowing after February
was not practiced previously in the Ord? Firstly, there was a perception that cotton growth and
development during the coldest months of May-August would be poor, delaying boll set until
temperatures increased and pushing harvest into the wet season. Results and recommendations on sowing
date were contradictory (Toms, 1963; Stern, 1965; Thomson, 1965; Hearn, 1975) prompting the
conclusion ‘the possibility of March sowings warrants further investigation’ (Thomson, 1965). Secondly,
larger modern pickers combined with all weather storage of seed cotton are now available and reduce the
possibility of a long harvest and ginning season and UV light damage to fibre that occurred in the 1970’s
(Hearn, 1975). Thirdly, prior to 1972, water storage capacity was insufficient to irrigate large areas of a
fully irrigated dry season crop but the irrigation system capacity is now expanded.
Growing cotton in the dry season creates new challenges for crop growth and the timing of farming
operations. A possible growing season of sowing in April, when trafficability is least affected by wet
season rain, then picking in October is the reverse of temperate Australia in terms of temperature and
daylength where cotton is usually sown in October and picked in April. Figure 1 compares the dry season
in the ORIA (Kununurra, 15oS) with temperate summer cotton at Narrabri, NSW (30oS), for monthly
rainfall, maximum and minimum temperature and solar radiation. Growing season rainfall is much less at
Kununurra (Fig. 1A), although rainfall prior to sowing is higher and may cause difficulties with land
preparation and sowing operations. It will be important to pick promptly at Kununurra as rainfall
increases significantly each month after October.
Monthly temperatures (Fig. 1B) are higher early and late in the season, while mid season minimum
temperatures are cooler averaging 14oC with extremes below 10oC (Cook and Russell, 1983) which could
be problematic for fibre quality and boll growth (Gipson and Ray 1970; Hearn 1994) and would delay
crop development (Constable and Shaw, 1988). High temperatures during September and October could
also be detrimental to boll growth (Hearn, 1994), but should enhance boll desiccation and improve
defoliant efficacy.
Potential daily photosynthesis is lower during flowering and boll growth at Kununurra because daily
radiation is about 80% of Narrabri during this phase (Fig. 1C) (Hearn, 1994). However, it is not known
whether reduced daily radiation will translate into lower yields as cooler temperatures may compensate
via slower development rate and less night respiration
314
A
Mean monthly rainfall (mm)
200
180
160
140
Pick
Plant
120
100
80
60
40
20
Ju
l/J
an
Au
g/
Fe
b
Se
p/
M
ar
O
ct
/A
pr
N
ov
/M
ay
D
ec
/J
un
Ja
n/
Ju
l
Fe
b/
Au
g
M
ar
/S
ep
Ap
r/O
ct
M
ay
/N
ov
Ju
n/
D
ec
0
B
Mean Monthly Temperature (oC)
40
35
30
25
20
15
10
1st quare
1st Flo wer
Cut Out
1st Open B o ll
5
0
Apr/Oct
May/Nov
Jun/Dec
Jul/Jan
Aug/Feb
Sep/Mar
Oct/Apr
C
26
Mean Monthly Solar Radiation
(MJ/m2/day)
M aturity
24
22
20
18
16
14
12
10
Apr/Oct
May/Nov
Jun/Dec
Jul/Jan
Aug/Feb
Sep/Mar
Oct/Apr
Fig. 1: Climatic Comparison the Proposed Tropical Dry or Winter Growing Season in the Ord River (April to October) and the Temperate Summer
Growing Season at Narrabri 30oS (October to April) A) Mean Monthly Rainfall; B) Average Monthly Temperatures,
with Possible Development States Shown for the Ord River Based on Degree day Sums (Constable and Shaw 1988); C)
mean daily Radiation for each Month. Where − Narrabri, --- Ord River.
There is very little literature reporting cotton grown during the dry season in the SAT worldwide.
Cotton is known to be grown during the dry season in several tropical regions, such as eastern Asia,
Central America, Colombia, Sudan, and Malawi. In most cases production is near the coast or large lakes
where temperature extremes are minimised and these countries have lower economic yield expectations
than Australia (Hearn, 1995). Hence, there is a need to develop and evaluate the dry season production
system outlined in Table 1, as a prerequisite to assessing the feasibility of reintroducing cotton into the
Australian SAT. The Ord River is suitable for this evaluation as it is one of the few valleys north of 21oS
developed for irrigation and expansion of the cropping area was planned for the near future (Yeates,
2001; Yeates et al., 2002a).
While insect management and crop husbandry research was being conducted separately to this
research (Strickland et al., 1998; Annells and Strickland 2003; Yeates et al., 2002b), the research
reported here addresses the following important crop adaptation issues relevant to dry season cotton
production:
Genetic Diversity Analysis in Cotton Germplasm
•
•
•
315
Does the photothermal regime of the tropical dry season affect crop development or limit the
conversion of radiation to dry matter and its partitioning.
What yield and quality is possible using modern genotypes and management given the potential
limitations of temperature and radiation in the dry season?
What is the optimum sowing window for yield and quality given sowing must commence after
March 1 to avoid insect pests and there must be sufficient time to pick by before the start of the
wet season?
The research described here integrates four papers (Yeates et al., 2010a,b,c and Yeates et al., 2011) and
some previously unpublished research into one document.
Field Experiments
Sowing date by cultivar experiments conducted over three seasons at the Frank Wise Institute, 13 km
NW of Kununurra WA, Australia (15o39’S, 128o43’E) in the Ord River Irrigation Area were used to
collect relevant data. These experiments are described in detail in Yeates et al., (2010a). To summarise,
the Gossypium barbadense cultivar Pima S7 was compared with two Bt transgenic Gossypium hirsutum
(upland) cultivars: Siokra L23i and Sicot 50i (producing the Monsanto Cry1Ac protein). In the first
season, the non Bt transgenic equivalent of the upland cultivars (Siokra L23 and CS50) were sown.
Where data are combined for the three seasons these cultivars are referred to as L23 and S50. In each of
the 3 seasons these cultivars were sown on 4 occasions (main plots): 27 to 29 March, 21 to 29 April, 15
to 23 May and 9 to 14 June; there were 4 replications. The experiments were furrow-irrigated. The crop
was sowing a at 90 cm row spacing on wide beds accommodating two rows per bed. Plots were 6 rows
wide and 20m in length. Rows were in an east – west direction.
Boll period was measured by tagging 30 recently pollinated (white or pink) first position flowers in
each plot on 3 occasions with the date and node number recorded, which represented the flowers on
lower, middle and upper part of the main-stem. The date of tagging was identified by different coloured
tags Bolls were hand picked on alternate days, the number of bolls and date picked was recorded and the
boll period calculated as the time from tagging to the median open day. Seed cotton was machine
harvested from 13m of a centre row of each plot. Above ground biomass from 1m2 from each plot was
partitioned into stems, leaves, squares, flowers and bolls prior to drying at 80oC for 3 – 4 days in a fan
forced oven. Biomass was partitioned at early squaring, at first flower, at approximately 30 and 60 days
after first flower and when approximately 60% of the bolls were open. The final biomass sampling was
made prior to chemical defoliation. The measurement of RUE was described in detail in Yeates et al.,
(2010b). To determine the effect of temperature on RUE, the average RUE calculated for the different
growth phases for each sowing month of each variety was plotted against the average minimum,
maximum and mean temperature for the duration of the growth phase. Biomass was converted to a
glucose equivalent using the method of Wall et al. (1994).
Pot Experiment
The experiments were located at the Katherine Research Station, 4 km east of Katherine (14o28' S,
132o18' E), Northern Territory, Australia (see Yeates et al., 2011, for more details). Due to greater
distance from the ocean Katherine has a greater probability of cooler dry season minimums than the Ord
River, with similar maximum temperatures, photoperiod and monthly radiation (Cook and Russell,
1983). Minimum temperature was manipulated by protecting plants in a glasshouse at night during
flowering (‘warm’ plants) and comparing these with plants grown at ambient temperatures at night
(‘cool’ plants). Glasshouse temperatures were maintained approximately 5oC above ambient to ensure
similar daily variation in minimum temperature to plants grown at ambient temperatures. The only
316
exceptions were when ambient temperatures were < 6oC, on these nights glasshouse temperatures were
not permitted to fall below 10.3oC and when ambient temperatures were warm, glasshouse minimum
temperatures did not exceed 24oC. The experiment was run over two seasons with sowing occurring in
late April. To ensure plants were exposed to the same minimum temperatures prior to flowering all plants
were grown outside until 6 and 7 days prior to first flower in 2003 and 2004 respectively. When the
temperature treatments commenced the warm night plants were moved inside at night for the next 60 and
53 days in 2003 and 2004 respectively; that is at least 15 days after flowering was completed.
Results and Discussion
Lint Yield
For the field experiments Lint yields exceeded 2000 kg/ha when sowing occurred during March and
April for the upland cultivars (Fig. 2). For Pima S7 sowing in March produced the highest lint yields
which were approximately 1800 kg/ha. Yields declined rapidly when sown after mid May. Despite the
photothermal limitations described above these lint yields were at worst in line with recent Australian
commercial irrigated yields (ABS 2006) and commonly reported research yields for irrigated cotton in
temperate Australia and the USA, where lint yield was inflated by laboratory ginning, (e.g. Fritschi et al.,
2003; Hutmacher et al., 2004; Bange and Milroy, 2004) and at the top of international averages
elsewhere (ICAC 2002). The lower yield of the Gossypium barbadense cultivar Pima S7 compared to the
Gossypium hirsutum cultivars was consistent with research and commercial experience with this species
from temperate regions (Fritschi et al., 2003). Hence sowing in March or April of either species should
meet current commercial expectations if repeated reliably on a larger scale, provided fibre quality
standards are achieved. Moreover sowing before May would ensure picking could occur before the onset
of the wet season (Yeates et al., 2010a).
Lint Yield (kg/ha)
2500
2000
1500
1000
Upland
500
Pima S7
0
27 to 29 March
21 to 29 April
15 to 23 May
9 to 14 June
sowing Date
Fig 2: The Effect of Sowing Date on Average Lint Yield for Three Seasons for Upland Varieties and Pima S7. Bars show Range of
Yields. Adapted from Yeates et al. 2010a. How were Yields Achieved?
Final crop biomass did not limit yield. For the highest yielding March and April sowings final crop
biomass was mostly > 1000 g /m2 (Fig 3). This was similar to the maximum values reported for irrigated
cotton in temperate Australia (Sadras 1996; Bange and Milroy 2004) and the USA (Fritschi et al., 2003).
These biomasses were also 25 to 60 % higher than for dry season cotton but similar to wet season cotton
grown in the 1960’s at this location (Stern, 1965; Thomson, 1965).

Compliance with Threshold Principles Economic Benefits

Transcription

Similar documents

Tudeshk ref. 20588 Around 1950 Related to the Nain carpets Soft

Cotton Traders case study

Camp Shirts - Wolfmarkties

Cuddle Up! May 2013 Issue | © 2013 Sandow Media

LADIES STRETCH TANK SK103

s,!m,!l,!xl! - North Bay Aquatics

PDF - Wilson Quarterly

Welcome to Stylecraft`s first Spring Summer Collection of the Season.

The Cotton Wrap - The February 2016 Edition