synthetic dna fossils - ETH E

Transcription

DISS. ETH No. 23033
SYNTHETIC DNA FOSSILS
A thesis submitted to attain the degree of
DOCTOR OF SCIENCES of ETH Zurich
(Dr. sc. ETH Zurich)
presented by
DANIELA PAUNESCU-BLUHM
MSc ETH Chemistry
born on 24.03.1988
citizen of Germany and Romania
accepted on the recommendation of
Prof. Dr. Wendelin J. Stark, examiner
Prof. Dr. Jean-Christophe Leroux, co-examiner
Dr. Robert N. Grass, co-examiner
2015
2
Gewidmet meinen Eltern und meinem Bruder
aus
tiefstem Respekt,
Dankbarkeit
&
Liebe
3
Acknowledgments
During my PhD time in the Functional Materials Laboratory FML I had the pleasure to meet
amazing people. I will never forget this period of life. Thank you all.
First of all, I would like to express my sincere gratitude to Prof. Wendelin Stark for giving me
the opportunity to perform my PhD thesis in his research group. I appreciate his enormous
knowledge about science and his passionate way of doing research. His enthusiasm is
contagious and inspires to generate new ideas. Thank you, Wendelin, for the unique working
atmosphere and the small details that improve our everyday lives in the lab and group.
I am cordially and truly grateful to Dr. Robert Grass, as my mentor and supervisor, who
pushed and encouraged me the whole long way, supported me without any doubts and there
has never been any hesitation on my part to address myself to him with whatever concerns I
had. Beginning with the question: “Hey Robert, do you have a second?” which he never deny,
on the contrary from seconds become hours of inspiriting and helpful discussions. Robert, I
am deeply thankful for all you have done for me.
Prof. Jean-Christophe Leroux is acknowledged for his interest in my work and for agreeing to
be my co-examiner.
I would like to thank Prof. Detlef Günther and Dr. Bodo Hattendorf for the collaboration in
the project of particle counting.
When I started my career in the FML as a master student Michael Rossier and Stephanie
Bubenhofer were very supportive and introduced me to the spirit of the group. I started at the
same time as Philipp Stössel, who became very fast an extremely good friend of mine and
even witness to our marriage. Thank you, Philipp for helping me in good and in bad times.
Furthermore, other people in the group became an important part of my life and supporter in
hard and stressful days, like for example Renzo Raso (my philosophe and mental support),
Carlos Mora (THE biologist and my mentor for self-confidence), Corinne Hofer (my daily
coffee partner and consultant) and Michela Puddu (my contact person for all arising
emotions).
I enjoyed the spirit of our group a lot and I am very grateful to all my colleagues form the
FML; Dirk Mohn, Lukas Langenegger, Elia Schneider, Tino Zeltner, Samuel Hess, Mario
Stucki, Antoine Herzog, Christoph Kellenberger, Michael Loepfe, Vladimir Zlateski, Gadas
Mikutis, Mirjam Giacomin and as well as to the former team-members, Christoph
4
Schumacher, Lukas Gerber, Jonas Halter, Roland Fuhrer, Alex Stepuk, Nora Hild, Aline
Rotzetter, Fabian Köhler.
My special thanks go to all my friends that were part of my PhD life at ETH Zurich during the
last three years. They supported me with interesting and motivating discussions about
research and life, whether in a coffee or lunch break.
For the financial support I am grateful to the Swiss National Science Foundation grant
(200021-150179).
Meiner Familie, der ich diese Arbeit widmen möchte, danke ich aus ganzem Herzen. Ich
danke meinen Eltern, dass sie mir die Grundbausteine für eine Ausbildung in Deutschland
ermöglicht haben und dabei selbstlos und voller Liebe zugunsten ihrer Kinder gehandelt
haben. Ich danke euch für die Werte und Prinzipien die ihr mir beigebracht habt, eure
bedingungslose Unterstützung und dass ihr mich habt fliegen lassen, wohin mich der Wind
auch wehte.
Vă mulțumesc din toată inima mea. Lieber Mihai, ohne dich wäre ich nicht das, was ich heute
bin.
Ganz zum Schluss möchte ich meinen grenzenlosen Dank an meinen Mann richten. Sierk war
derjenige, der alle Momente miterlebt hat, mich ertragen und mich immer wieder aufs Neue
motiviert hat. Danke für deine unendliche Liebe und Unterstützung.
5
Table of Contents
Acknowledgements
3
Table of Contents
5
Zusammenfassung
8
Summary
10
1.
13
How to give Particles an Identity? Strategies and Applications
1.1 Unique identifiable particles for anti-counterfeit
1.2 Unique identifiable particles as tracer-tool
1.3 Strategies to give particles an identity – The barcode
1.3.1 Graphical encoding
1.3.2 Optical encoding
1.3.3 Chemical encoding by using DNA
1.4 Next generation barcodes - Synthetic DNA fossils
1.5 Comparison of available tracers and taggants
1.5.1 Number of possible codes
1.5.2 Limit of detection
1.5.3 Stability and integrity of the barcode
1.5.4 Efforts toward the synthesis and detection
14
15
16
17
18
21
22
25
25
25
26
26
2. Reversible DNA Encapsulation in Silica to Produce ROS-Resistant and HeatResistant Synthetic DNA ‘Fossils’
29
2.1 Introduction
2.2 Experimental
2.2.1 Procedure (step-by-step protocol)
2.2.2 Troubleshooting
2.3 Result and Discussion
2.3.1 DNA encapsulation design
2.3.2Anticipated Results
30
33
33
35
36
36
41
3. DNA Protection Against Ultraviolet Irradiation by Encapsulation in a
Multilayered SiO2/TiO2 Assembly
43
3.1 Introduction
3.2 Experimental
3.2.1 DNA/SiO2/TiO2 particle synthesis
3.2.2 DNA recovery
3.2.3 UV irradiation of samples
3.2.4 Particle characterization
3.3 Results and discussion
3.3.2 UV shielding properties
3.4 Conclusions
44
46
46
46
46
48
49
49
51
56
6
4. Detecting and number counting of single engineered nanoparticles by digital
particle PCR
57
4.1 Introduction
4.2 Experimental
4.2.1 Synthesis of the 137 nm DNA/SiO2 particles
4.2.2 Additional SiO2 layer - 252 nm DNA/SiO2 particles
4.2.4 DNA recovery
4.2.5 Digital particle PCR instrumentation and workflow
4.3 Results and Discussion
4.4 Conclusion
5.
Conclusion and Outlook
Appendix A: Supplementary material
58
60
60
60
61
61
61
62
63
73
75
79
A.1
Supplementary data for chapter 3
A.1.1 t-test
A.1.2 Control experiment of radical treated free DNA
A.1.3 Calculation of attenuation coefficients
800
800
800
811
A.2
A.2.1 Encapsulate characterization
A2.2. DNA analysis
A.2.3 Particle counting by sp-ICPMS
A.2.4 Statistical estimation of particle concentration
833
833
83
85
87
References
Curriculum Vitae
91
103
7
8
Zusammenfassung
Die vorliegende Arbeit befasst sich mit einem neuartigen Konzept zum Schützen von DNA
durch synthetische Fossilierung. In einem Verkapselungsprozess von DNA in SiliciumdioxidPartikel, kann DNA vor aggressiven Umweltbedingungen geschützt werden und nach dem
Entschützen mithilfe der Fluorchemie analysiert werden. Die Synthese und Eigenschaften des
neuen Materials wurden optimiert und vollständig charakterisiert, um sie für TracerAnwendungen zu benutzen. Während die Anwendbarkeit der mit DNA markierten Partikeln
als Tracer und zur Authentifizierung durch unterschiedliche Zusammenarbeiten und
betreuende Projekte erwiesen wurde, beschäftigt sich diese Arbeit mit dem Konzept und der
Herstellung, sowie der Optimierung der Partikel. Des Weiteren wurde die erreichbare
Nachweisgrenze der markierten Partikel erforscht.
Durch die Fossilierung der DNA erhält jedes Partikel eine einzigartige DNA-Sequenz
und damit eine zugewiesene und unfälschbare Identifikation. Kapitel 1 gibt einen
allgemeinen Überblick über die Methoden, die verwendet werden, um Partikeln eine Identität
zu geben. Zusätzlich wird ihre Verwendung als Barcode zur Fälschungssicherheit und als
Tracer-Tool aufgezeigt. Beginnend mit den allgemeinen Überlegungen zu Fälschungen und
den damit verbundenen Problemen für Wirtschaft und Produktqualität wird ferner erklärt, wie
Partikel mit einer einzigartigen Identität eine geeignete Lösung für die genannten Probleme
darstellen können. Eine zusätzliche Anwendung findet sich im Bereich der NanopartikelAnalytik. In diesem Feld sind analytische Messmethoden zwingend erforderlich, um
beispielsweise Nanopartikel in der Umwelt zu verfolgen und zu detektieren. Neben den
bereits bestehenden Verfahren zur Codierung von Partikeln, werden auch die allgemeinen
Anforderungen an geeignete Barcode-Systeme ausführlich beschrieben. Resultierend daraus
wird deutlich, weshalb DNA zur Codierung der Partikel verwendet wurde. Ferner wird die
Notwendigkeit des Schutzes von DNA gegenüber aggressiven Umweltbedingungen erklärt,
sowie die daraufhin entwickelte Fossilierung von DNA in Siliciumdioxid-Partikeln.
In Kapitel 2 wird das Konzept der Einkapselung von DNA in amorphe
Siliciumdioxid-Partikel beschrieben. Analog zur DNA in Fossilien oder Sporen wurde nach
diesem Verfahren jedes DNA-Molekül durch eine dichte inorganische Materialschicht
geschützt. Der hermetische Einschluss schützte die DNA vor chemischen Angriffen (z.B.
hohe Temperaturen und aggressive radikalische Sauerstoffspezies). Das Verfahren der
Einkapselung eignete sich für kurze doppelsträngige und einzelsträngige DNA-Fragmente,
sowie für genomische DNA und Plasmide. Durch das anschliessende Entschützen der DNA
9
mit Hilfe einer fluoridhaltigen Lösung konnte die DNA unversehrt wiedergewonnen und
analysiert werden. Bei den Analysemethoden handelte es sich um biochemische
Standardverfahren wie Gelelektrophorese, quantitative Polymerase-Kettenreaktion (qPCR)
und Sequenzierung. Das Schützen und Entschützen von DNA wird in einem ausführlichen
Protokoll schrittweise erklärt und zusätzliche Information zur Fehlerbehebung und für den
sicheren Umgang mit gepufferten Fluorwasserstoff-Lösungen werden beschrieben.
Der Schutz von DNA innerhalb der in Kapitel 2 beschriebenen Partikel konnte durch
die Implementierung zusätzlicher Schichten erweitert werden. Die grösste Schwachstelle der
DNA liegt in ihrer Empfindlichkeit gegenüber UV-Strahlung. Um diese einzuschränken
wurde die DNA in ein Konstrukt aus einem Kern-Schale-Schale Partikel (SiO2-SiO2-TiO2)
eingeschlossen (Kapitel 3). Während die Siliciumdioxid-Schicht die DNA-Moleküle vor
radikalischen Sauerstoffspezies schützte, dient die zusätzliche Titandioxidschicht als
physikalischer Sonnenschutz und verringerte damit schädliche UV-C-Strahlung um 98%. Die
Beschichtung erhöhte die UV-Beständigkeit der DNA um das 42 fache, was der UVBeständigkeit von bakterieller DNA in Sporen entspricht, die als besonders umweltstabil
gelten.
Kapitel 4 beschreibt eine neue Methode zur Quantifizierung von Nanopartikeln,
welche empfindlich genug ist, um Nanopartikel einzeln zu zählen. Um dies zu ermöglichen,
wurde die Empfindlichkeit der PCR durch die Verwendung einer binären (= 0/1, ja / nein)
Messanordnung erhöht. Mit Hilfe dieser Methode konnte die absolute Partikelanzahl von
einzelnen Partikeln, in der Grössenordnung von 60-250 nm, in Trinkwasser nachgewiesen
werden. Da die anfängliche Synthese von DNA in SiO2-Partikeln zur Bildung von
Agglomeraten führte, wurde die Synthese dahingehend optimiert, dass monodisperse, einzeln
vorliegende Partikel hergestellt werden konnten. Die Produktion von einzelnen DNA
markierten Partikeln ist zwingend erforderlich, um einzelne Partikel zählen zu können. Zum
Zählen der einzelnen Partikel diente ein Standard qPCR-Gerät mit einer Messzeit von ca.
1.5 h. Zur Validierung der entwickelten Messmethode, wurden die erhaltenen Resultate mit
denen vergliechen, die mittels Massenspektrometrie mit induktiv gekoppeltem Plasma
gemessen wurden.
Kapitel 5 enthält allgemeine Schlussfolgerungen über diese Arbeit und gibt einen
Ausblick auf zukünftige Untersuchungen und auf das Potenzial der geschützten DNABarcodes in verschiedenen Anwendungen.
10
Summary
This thesis presents a novel protection concept of DNA by synthetic fossilization. An
engineered encapsulation process of DNA into silica spheres can protect the DNA from harsh
environmental conditions and the DNA can be analyzed after the subsequent deprotection by
a treatment with fluoride comprising solutions. The production and properties of the new
material were optimized and fully characterized in order to use it for tracing and tagging
applications. While the applicability of the DNA tagged particles as tracer and authenticity
tool were shown in diverse collaborated and supervised projects, this thesis deals with the
engineering and optimization aspect of the synthesis, as well as reducing the limit of detection
of the DNA tagged particles.
The fossilization of DNA enables particles to carry a unique code, which is equivalent
to a barcode for identification. Chapter 1 gives a general overview of methods used to give
particles an identity and their use as barcodes for anti-counterfeit and as tracer-tool.
Beginning with general considerations about anti-counterfeit and related problems in
economics and quality issues, it is shown how unique identifiable particles can provide a
suitable solution. Additionally, the demand of needed analytical tools for monitoring and
detecting nanoparticles in the environment is described. Drawing the field of present encoding
methods for particles, the general requirements that have to be fulfilled for a feasible
barcoding system, are discussed in detail and explain why DNA is an ideal solution for the
generation of barcodes. Furthermore, the necessity of protecting DNA from environmental
attack is presented and leads over to the need of fossilization of DNA.
In Chapter 2 the concept of encapsulating DNA into amorphous silica spheres,
mimicking the protection of nucleic acids within ancient fossils is demonstrated. Within the
glass spheres, the nucleic acid molecules were hermetically sealed and protected from
chemical attack, thereby withstanding high temperatures and aggressive radical oxygen
species (ROS). The encapsulation process was applicable to short double-stranded and singlestranded DNA fragments, genomic DNA and plasmids. Following deprotection with fluoride
comprising solutions, the DNA could be recovered without harm and analyzed by standard
biochemical methods: gel electrophoresis, quantitative polymerase chain reaction (qPCR) and
sequencing. The synthesis of the encapsulates and subsequent release of DNA is presented in
a step-by-step protocol including troubleshooting and the safe handling of the buffered
hydrogen fluoride solutions.
11
The protection system of DNA was expanded by applying additional layers on the
silica spheres. In order to protect DNA from damage induced by UV radiation, an
encapsulation process in a core-shell-shell particulate construct with 10 nm silica and 20 nm
titania layer was designed (Chapter 3). While the silica layer protected the DNA molecules
from radical oxygen species, the additional titania layer acted as a physical sunscreen and
attenuated 98% of irradiated UV-C light. The coating increased the DNA UV-resistance by 42
times, which is equivalent to the increase in UV resistance obtained by bacteria during
sporulation and is known as extremely stable against harsh environmental conditions.
Chapter 4 describes a new quantification technique, which is sensitive enough to
count individual nanoparticles, one by one. To make this possible, the sensitivity of the PCR
method was combined with a binary (= 0/1, yes/no) measurement arrangement, binomial
statistics and DNA containing monodisperse silica nanoparticles. While the initial synthesis of
DNA encapsulated SiO2 particles resulted in agglomerated particles, the improved synthesis
yielded monodisperse particles with a narrow size distribution. The formation of individual
encapsulated particles was required to reach the limit of counting particles on a single event
level. The absolute number of tagged particles in the range of 60-250 nm could be determined
in drinking water, utilizing a standard qPCR device within 1.5 h of measurement time. For
comparison, the method was validated with single particle inductively coupled plasma mass
spectrometry.
Finally, Chapter 5 gives general conclusion of this work and offers an outlook on
future investigations and the potential of protected DNA barcodes in various applications.
12
13
1. How to give Particles an Identity?
Strategies and Applications
14
1.1 Unique identifiable particles for anti-counterfeit
Counterfeits, alterations and unlawful additives in products challenge all kinds of industries
ranging from automobiles, luxury goods to pharmaceutical industries. The global market
value of counterfeit goods is estimated at around 500-600 billion USD, which is based on
26 different faked products and the economic impact on 88 countries.1 Tremendous
possibilities of counterfeiting are given by the increasing complexity and dynamics of the
global market. Products pass through a large and intransparent supply chain. In order to
distinguish genuine products from false ones a direct assigned product identity is needed.
While every human being has a genuine fingerprint, enabling direct and near to unforgeable
identification, common product identifications currently consist of visible, printed
authentication systems (e.g. barcodes, holograms, watermarks) or Radio-Frequency
Identification (RFID) chips. These systems are presently only located on the final product or
even only on the outside product packaging, which neglects the requirement of material
identification from the raw material to intermediates to the final product along the material
life cycle. Furthermore, the implementation of identification in a broad range of materials is
not trivial. For instance, how would you label bulk polymer? A direct and individual
barcoding of polymers with barcoded particles would facilitate to track and trace each single
product processing step in a supply chain spreading the global market (Figure 1.1b).
Figure. 1.1. (a) Identity giving systems. (b) Schematic illustration of barcoding requirements
along the supply chain of products.
15
Sophisticated approaches and concepts have been developed for anti-counterfeit, but in
practice the problem is still unsolved, mainly because of costs, complexity and detection
methods. However, the guarantee of quality is a critical issue for many goods. The world
health organization (WHO) consistently records drugs with incorrect ingredients, insufficient
active ingredients or false packaging, which can have serious consequences for consumers,
such as illness and even death.2
The usage of unique additives in products could provide a suitable solution for anticounterfeiting. Several prerequisites towards the additives are required for a successful
measure and market implementation: uniqueness, reliability, detection and cost. The
application of micro- or nanoparticles as tracers or taggants therefore shows a high potential.
They are too small to be seen by naked eye, but are simultaneously capable of carrying a high
density of coded information (= barcode). The usage of particles as carriers for a barcode has
further advantages of protecting the coding elements. The coding elements are commonly
chemical or biological molecules or nanoparticles with optical or electrical properties. Their
properties are unique and enable to generate individual barcodes.
1.2 Unique identifiable particles as tracer-tool
The development of nanotechnology provides new materials in the nanoscale size.
Nanoparticles of different materials, sizes and shapes have become key components in various
applications ranging from everyday products such as textiles, paints and food to
biodiagnostics and therapeutics.3 In the last decade nanoparticles have significantly impacted
in bioscience and biotechnology.4 Spherical nanoparticles with metallic, metal oxide,
semiconductor and silica cores are used for bioimaging,5,
6
biosensing7 and drug and gene
delivery.8 This increasing use of nanoparticles has become simultaneously a source of
potential risks for living beings and environment (Figure 1.2.). Risk assessments of
nanoparticles have to be performed to understand their impact and toxicity. Nanoparticles can
be toxic due to their catalytic properties based on their large active surface or due their size,
which can pass the cell membranes.9 A variety of detection and characterization tools of
nanoparticles were developed.10 Despite the progression in the field, most particle analysis
techniques are limited by concentration, particle size, costs or complexity. Particles carrying a
unique barcode could provide a new solution for tracing and tracking nanoparticles. Thanks to
the barcode, particles could be identified and detected in various media. This allows the
16
analysis of the interaction with cellular structures or biomolecules, as well as the fate of
nanoparticles in diverse media.
Figure 1.2. Exposure of nanoparticles and their unknown interaction and impact towards
environment and living beings.
1.3 Strategies to give particles an identity – The barcode
In a classic implementation a barcode consists of a sequence of space and vertical lines
(= bars) varying in their widths, which represent a unique code. Unlimited numbers of codes
can be generated by modifying the combination of space, bars and widths. The same concept
can be transferred to particles carrying a unique identity using coding elements. Methods to
encode particles were investigated extensively in the area of life science in order to carry out a
very large number of bioassays simultaneously in gene expression, drug screening and clinical
diagnostics.11 In this assays multiple independent reactions take place at the same time in the
same solution. Each unique identifiable particle acts as an individual chemistry lab that
independently identifies and tracks the potential compounds by reading out the corresponding
code. The gained knowledge of particle-based encoding methods can be translated for the use
as product identification measure. The currently available techniques can be divided into three
main strategies to generate a barcode by (a) utilizing the pattern or shape of the encoded
particles (= graphical encoding), (b) making use of unique properties
11, 12
(optical,
spectrometric or electronic) of molecules or nanoparticles, which are attached or incorporated
17
into the carrier particle and (c) applying unique chemical tags. In the following section the
different methods for encoding are presented.
1.3.1 Graphical encoding
The usual supermarket barcode is an example of graphical encoding. In the graphical
encoding, the individual codes of the particles are deciphered by the pattern or shape of the
particles themself. The coding elements can be modulated by various techniques ranging from
simple arrangements of colored polymer layer,13 striped metal nanowires14 to selective
photobleaching.15
Simons Security Systems (3S) GmbH has developed color-coded microparticles based
on melamine alkyd polymer layers of up to ten different color coatings (Figure 1.3a). The
variation of the color arrangement in the 8-100 μm sized particles allows the formation of
4.35 billion different codes.16 For the identification of the codes a pen microscope is
sufficient.
A second method writes the barcode on nanowires based on sequential electrochemical
deposition of metal ions (e.g. Ag+, Au+) into mesoporous alumina membranes, followed by
particle release (see Fig. 1.3b).12,
14, 17
The discriminability of specific optical reflectivity
results into metal striped wires/rods, where the stripes are modifiable in thickness, order and
number as well as the type of metal and the overall length of the rods. By varying these
parameters a nearly unlimited number of individual barcodes can be generated. The read-out
of the codes is accomplished by light-microscopy and recognition software. For reliable
optical detection a minimal stripe length of ~ 500 nm is needed, whereas the overall particle
length is 1 – 50 μm. For example, a 5 μm particle containing two metals with ten stripes
yields 528 individual codes.
An alternative to this is the use of selective photobleaching. Here, the pattern is written
onto homogeneous, fluorescently dyed microspheres by a photo-induced process, which leads
to a local loss of the fluorescent properties (Figure 1.3c).12 With this method, any geometry,
symbol or barcode can be generated with different bleaching levels by using adapted confocal
scanning laser microscope (CSLM) as described by Braeckmans et al. and identified by
standard confocal microscopy.15 Theoretically, this method provides a virtually unlimited
number of codes, but is simultaneously limited for practical reasons (see section 1.5.4).
18
1.3.2 Optical encoding
Most of the encoding methods described in literature are composed of molecules with unique
properties as coding elements. In this section, we focus on unique optical properties of
molecules, which can be divided in fluorescent dyes, quantum dots and rare-earth elements.
Particles act as carriers to host these molecules. Two different approaches have been
developed to incorporate the molecules into particles.11 In the first approach, particles are
swollen in organic solvent in order to allow diffusion of the molecules into the polymer
microspheres. After transferring them into aqueous solution the particles shrink, which
encapsulates the coding elements. The particles protect the coding element from possible
degradation and exposure from environmental surroundings, which is an advantage for
incorporating the particles into raw material and its further processing. In an alternative
approach of incorporation, the molecules are directly attached on the surface of microspheres.
The by far most commonly used coding elements are fluorescent organic dyes, which
are easily produced and abundantly present in many laboratories.18 Fluorescent dyes are
identified after excitation by their structure-specific emission profiles. Different dyes with
different concentration ratios can be incorporated into particles. The intensity of each dye is
detected by a simple spectrometer and/or flow cytometer to quantify the corresponding
intensity ratio and to reveal the barcode. A prominent example of fluorescent encoding was
developed by Luminex Corp (Austin, TX): two dyes are incorporated at ten different
concentrations to obtain 100 unique barcoded particles.
With the development of quantum dots (QDs) several fluorescent molecule related
problems have been overcome.19,
20
Quantum dots are semiconducting inorganic
nanocrystallites with unique photoluminescent properties, which were successfully
incorporated into polystyrene particles for optical encoding.21, 22 The detection is conducted
by flow cytometer and/or spectrometer. In contrast to fluorescent organic dyes, QDs have a
broad absorption providing simultaneous excitation of various QDs. Their narrow and
symmetric emission spectrum (spanning from UV to near-infrared) can be tuned easily by
changing the particle size. The detection is conducted by flow cytometry and/or photo
spectrometry. A realistic system consists of five to six colors with six intensity levels to
obtain 10’000 – 40’000 unique codes.23 In contrast to fluorescent organic dyes, QDs have a
broad absorption providing simultaneous excitation of various QDs. They are also brighter
and less prone to photobleaching. Limitations to the widespread application of QDs is their
19
relatively low chemical stability24 and the cytotoxicity of the most commonly used materials
(e.g. CdS, CdSe, CdTe).
Alternatively, the unique optical properties of rare-earth ions can be used for particle
encoding. In a potential implementation, oxide nanoparticles or glass rods are doped with
rare-earth ions to generate unique barcodes.25-27 The use of rare-earth elements has significant
advantages, they are generally considered nontoxic, highly photo-stable and are excited by
infrared or ultraviolet photons. In order to overcome the limitation of code generation from
overlapping spectra, Dejneka et al. developed tags containing a pattern of different rare-earth
elements (see Figure 1.3f) into ribbons.28 This approach can generate >106 unique codes that
are identified using a UV illumination system and an optical microscope. Nevertheless, the
generation rate of these ribbon particles is extremely low and struggles with the same
production problems as the graphical methods described in the section 1.5.4.
20
Fig. 1.3 Overview of graphical and optical encoding methods. Graphical encoding: Ia) colorcoded microparticles by SECUTAG,® scale bar: 50 μm; Ib) photobleached fluorescent
microsphere,12 scale bar: 10 μm; Ic) striped metal nanorods.14 The optical encoding methods
consist of microparticles as carrier of the coding elements: IId) fluorescent dyes in silica
particles, scale bar: 1 μm (right) and microparticles with different fluorescent barcodes,29
scale bar: 10 μm (left); IIe) mixture of quantum dots (QDs), (CdSe/ZnS) tagged
microparticles, scale bar: 5 μm (right) and a series of emission colors of ZnS-capped CdSe
QDs23(left); IIf) rare-earth ions, 100 x 200 μm barcode (inset) and corresponding
fluorescence spectrum.28
21
1.3.3 Chemical encoding by using DNA
Besides unique photo-luminescent properties, molecules can have additional features, which
make them suitable for coding. In chemical encoding, chemical tags are used to build up a
code.30 The detection of these coding elements is based on identifying the molecular structure.
A variety of molecular tags are commonly used for combinatorial libraries, such as
haloaryls,31 peptides32 and oligonucleotides.33 The use of deoxyribonucleic acid (DNA) as
molecular tag has tremendous advantages as nearly an unlimited number of codes can be
generated and detected at high precision. In the following section, the advantages and
properties of DNA are highlighted to understand why in the work at hand DNA was chosen as
coding element for particle barcoding.
DNA is the natural way to store information of all known life forms (= genetic
constitution). This polymeric biomolecule consists of four nucleobases (adenine (A), cytosine
(C), guanine (G) and thymine (T)). Their arrangement gives a unique sequence with an
unlimited number of codes (Figure 1.4.). As such, DNA can be understood as the “barcode”.
Every biological species carries its unique barcode and can therefore be genuinely recognized.
This is for example used in paternity tests, forensics or crime clarification. As early as in
1977, Sanger and colleagues developed a method to identify DNA sequences.34 Based on the
high demand of parallel, efficient and low-cost sequencing, new techniques were recently
heralding the in next-generation DNA sequencing.35
Figure 1.4. DNA structure36 and short explanations of the biochemical standard analysis.
22
Today, bioanalytical methods are advanced enough to sequence the whole genome and
simultaneously the costs of DNA sequencing is decreasing tremendously. As a result, the
price of sequencing the human genome has dropped from about 10 million USD to a few
thousand dollars in six years.37 This price development makes future applications of DNA,
such as the use of DNA for information storage38-40, computing41 and product tagging highly
attractive. Several approaches as DNA-based authentication for product tracking and tracing
were designed.42-45 A commercial implementation of barcoding with DNA sequences was
realized by the pharmaceutical company Bristol-Myers Squibb in 2003.46 Another example
for using genomic codes for anti-counterfeit was performed by the food industry by adding a
specific lactic acid bacteria in Swiss Emmentaler cheese to ensure the genuine identity.47
1.4 Next generation barcodes - Synthetic DNA fossils
As a labeling technology DNA has remarkable advantages. Nevertheless, there are
limitations, mainly in the stability of DNA. DNA is a sensitive biomolecule that degrades
under harsh environmental conditions and elevated temperatures by various biochemical
processes such as hydrolysis, depurination, oxidation or alkylation.48 For a suitable tracer and
tag it is indispensable that the used code of DNA maintains its integrity during incorporation
into the product, processing and storage to the final read-out. While living organisms possess
vital repair mechanisms to avoid the loss of information, nature has also developed isolation
systems (e.g. spores or incidental in fossils, ambers)49, 50 to preserve the DNA sequence over a
long period of time. As an example of DNA stability, 300’000 year old human mitochondrial
genome was recently sequenced from a bone fossil.51 By mimicking the natural process of
protection observed in nature, recently developed methods encapsulate DNA in silica particles
using sol-gel chemistry to yield DNA comprising barcodes of high chemical and thermal
stability.52, 53
Silica is an ideal material for encapsulation as it is of high inertia and has exceptional
barrier properties. Furthermore silica is a non-toxic material, can be synthesized in water at
room temperature54 and is found as additive in everyday live products ranging from food,
textiles to paints. Monodisperse silica nanoparticles can be simply synthesized overnight by
using the Stöber reaction. In the reaction, alkyl silicates are hydrolyzed with water in an
ethanol solution to silicic acid, which is subsequently condensate to silica nanoparticles
(Figure 1.5.). While in the original Stöber reaction an ammonia solution is used as catalyst, a
23
variety of catalyst are nowadays applied. The catalyst has dramatic effects towards porosity,
density and volume of the formed silica particles.
Fig. 1.5. Preparation of silica nanoparticles.
A further advantage of the silica surface is the possibility to directly functionalize the surface
by using silanes with different functional groups (positive charged ammonium, carboxylic
acid, C6 or polyethylene glycol (PEG)). The functionalization allows the immobilization of
DNA on the surface of cationic charged silica onto a dense silica layer is deposit. The DNA is
hermetically sealed in the silica encapsulates and protected from reactive oxygen species and
heat.
In contrast to methods relying on barcode readout based on optical techniques – the
reading of the DNA code by modern nucleic acid analysis techniques (polymerase chain
reaction, Sanger Sequencing etc.) requires a recollection of the barcodes and a deencapsulation of the DNA. As shown in Figure 1.6. this is easily possible, and the DNA can
be released intact from the encapsulates by dissolution of the silica with fluoride comprising
buffers.
24
Figure 1.6. Schematic illustration of using DNA loaded nanoparticles for anti-counterfeit.
The capability to apply the protected DNA barcode as a tracer has been shown in several
studies. The tracing of food products was demonstrated by adding the encapsulated DNA into
milk and making cheese and intermediate products out of it.55 The barcode maintained its
integrity during the processing chain and extraction from the complex food-matrix and could
be correctly read-out. The used materials for the DNA tag can be regarded as food compatible
as silica, is an approved food additive (E551) and DNA is a natural component of our diet.
The determined costs of the technique amount to <0.1 USD per ton of product labeled with
10 ppb (parts per billion) of DNA comprising particles. This implementation allows a
monitoring of the supply chain and will enable to trace back the food origin, thereby ensuring
food safety and product authenticity. To apply the DNA barcodes for hydrophobic liquids
(olive oil, cosmetic oils and gasoline) the particles have been additionally equipped with
magnetic properties by utilizing Fe2O3 nanoparticles.56 In an more advanced application,
DNA comprising particulate tracers have also been used for understanding the animal-toanimal transfer in food chains,57 the behavior of silica nanoparticles in sewage plants58 and in
in vitro cell cultures.59
Within all the above mentioned applications, the barcode and particle concentrations
were determined by the encapsulated DNA using Sanger-Sequencing and PCR. The
25
quantification only requires a standard PCR machine, which is available in many laboratory
facilities and medical laboratories (15’000 – 30’000 USD).
1.5 Comparison of available tracers and taggants
Depending on the intended application of particles as tracers, individual properties of the
employed barcoding method are of importance. Nevertheless, a suitable tracer/taggant has to
fulfil several basic requirements ranging from the number of possible codes, limit of detection
to the resulting costs of implementation, which we will discuss in the following and may be
used as a guide for the development of new particulate tracer technologies.
1.5.1 Number of possible codes
A strongly limiting factor of tracers for universal and broad applicability is the number of
possible codes. Graphical encoding methods can easily generate a near to infinite number of
codes by patterning and geometric pattern arrangement. In contrast thereto, optical encoding
methods, where the codes are built up from optical properties, are limited by the spectral
overlap of available fluorescent dyes. The use of quantum dots gives some relief to this
problem and code numbers towards 10’000 – 40’000 have been proposed.23 In comparison to
chemical sequence encoding (e.g. DNA) these numbers are still small. The number of
possible combinations of DNA analysis by PCR is equal to four (= bases of DNA) raised to
the power of x, whereby x is the total number of bases of the primer and probe sequences. For
instance, a total base length of the primers and probe of 60 bases corresponds to 4 60 (>1036)
possibilities. This high versatility of the coding (equivalent to 128 bit coding in online
banking) also allows the implementation of cryptography for the protection of the barcode.60
1.5.2 Limit of detection
The detection limit is a crucial property of a tracer as it directly influences the required
amount of barcoded particle added to the final product, and with this directly the material
labeling costs. Figure 1.7. shows the detection limits of some tagging methods taken from the
patent literature. As visible in the figure, the potential detection limits of the various
technologies vary dramatically, over a range of >6 orders of magnitude, from 1 wt% down to
below 1 part per billion. This of course has a strong influence on the applicability of the
tracers – as a high loading of a particulate tracer into a final product may drastically influence
the functionality of the final product (e.g. change in mechanical/optical/electronic properties).
26
Figure 1.7. Added value of tracer depending on the detection limit of the encoding technique.
Selected examples for applications in anti-counterfeit from granted and registered patents.
a
f
CA2881728,
b
DE102008060675,
c
US6576155,
d
DE102009024685,
e
US2015/0060699,
WO2013/143014, gUS2007/0111314.
1.5.3 Stability and integrity of the barcode
The applied barcode system is only feasible, if the barcode maintains its integrity and can be
read out without errors. This presumes that the barcode is stable towards the exposure of
harsh environmental conditions and resists the implementation into the product and further
processing. The use of particles as shell for the coding elements helps to obtain certain
protection. For example, barcoded particles made from graphical or optical methods were
successfully designed to show resistance towards heat, organic solvents and water-solubility.
However, DNA cannot be used without protection (see section 1.4).
1.5.4 Efforts toward the synthesis and detection
Ideally, tracers are produced in high amounts with little effort, and can be detected with
minimal non-destructive means. From a more practical point of view and considering the
technologies described here, synthesis effort (i.e. manufacturing cost of tracer material per
kg), application concentrations (i.e. mass of tracer material required for uniquely tagging a
mass of final product) and ease of detection have to be carefully balanced. In order to build a
27
metric for this decision it is legit to calculate the value of a tracing technology as the value
added for the final tagged product. For commodity products (polymers, raw foodstuff, base
chemicals) with prices in the 1-10 USD / kg range, it is to be expected that the value of the
commodity products with the addition of a tracer will only marginally increase (i.e. 0.1 – 1%).
This is equivalent to 0.1 - 10 ct of value increase of the finally tagged material on a kg basis.
In order to calculate the potential value of the taggant itself this number has to be correlated to
the concentration of taggant required. Figure 1.7. therefore shows the potential value of the
particles as a function of the required taggant concentration, for three basic value scenarios. In
other words, a taggant that requires a 1wt% loading in the final product has to be produced at
a cost of below 1 USD per kg so that it is feasible for application under this economic
scenario. A taggant, which only requires a loading of 1 part per billion can be as expensive as
1’000’000 USD per kg, it still only adds 0.1 ct to the cost of the final tagged product. A
similar discussion can be led for the cost of the taggant versus the cost/effort of the code
readout. However, this discussion very much involves the final application scenario of the
tracer, either involving routine readout (e.g. for custom duties) or barcode readout only in rare
cases (e.g. part failure). Looking into the effort of barcode read-out Figure 1.7. already shows
a strong dichotomy, with rapid detection methods requiring large particle loadings on the left
side of the figure, and more elaborate analysis methods with very low detection limits situated
on the right side of the figure.
28
29
2. Reversible DNA Encapsulation in Silica to Produce ROSResistant and Heat-Resistant Synthetic DNA ‘Fossils’
published in parts as:
Daniela Paunescu, Michela Puddu, Justus O. B. Soellner, Philipp R. Stoessel,
Robert N. Grass, Nat. Protoc. 2013, 8, 2440-2448.
30
2.1 Introduction
Since the identification of the structure of DNA 60 years ago,36 this polymeric molecule has
revolutionized our understanding of biology. DNA has since become one of the cornerstones
of biomedical analytics, and soon we will be able to sequence whole genomes within just a
few hours.61 Among the general public, DNA is best known from forensics, in which it is used
to identify ties between family members, crime scenes and potential suspects, and is also used
to identify the biological origin of specific foods. The possibility that DNA offers of
chemically encoding and distributing information is also illustrated by the tracing/tagging of
products and property with artificial DNA.42, 45, 52 From this analytical point of view, nucleic
acids are unique, as their presence, concentration and molecular identity can be measured at a
single-molecule level with minimal infrastructure requirements (thermocycler and
fluorescence reading). There are applications for protected DNA in the field of
bionanotechnology,62 in which DNA is used as a structuring tool. The most prominent
approach is shown by Mirkin and colleagues63, 64 in the template assembly of nanoparticles.
DNA is nature’s method of storing information, and its information density surpasses
the possibilities of modern electromagnetic data storage solutions by orders of magnitude.
Very recently, whole books and computer files were successfully encoded and stored within
synthetic DNA and could be re-read without error.39,
40
However, compared with more
traditional storage solutions (methods based on magnetics and/or optics), information stability
remains an important issue. Although the chemical stability of DNA is clearly superior to that
of other encoded biopolymers (most proteins and RNA), unprotected DNA is susceptible to
hydrolysis, depurination, depyrimidination, oxidation and alkylation. Within living
organisms, this steady loss of information is constantly reversed by vital repair mechanisms.
In the absence of these mechanisms, DNA degrades because of attack by ROS, ionizing
radiation, heat, mutagenic chemicals and nucleases. However, if DNA is physically and
chemically isolated from these stresses, it can maintain its information integrity for thousands
of years, as evidenced by DNA extracted from ancient fossils49 and DNA stored in plant seeds
or bacterial spores.50, 65
If nonbiological information is to be stored and distributed over prolonged periods of time in
the form of nucleic acids, artificial protection is required. Previously developed protection
schemes include loading DNA onto filter paper,66 dry storage with trehalose67 and adsorption
of DNA into or onto porous materials.42, 68-70 Although these approaches give some physical
or chemical protection, they do not reproduce the hermetic sealing of DNA found in naturally
31
occurring fossils. Therefore, our group has developed an artificial DNA encapsulation scheme
mimicking the hermetic diffusion barrier of fossils.52 Instead of using ‘natural’ amber
(polymerized terpenes), we use amorphous silica as the encapsulating material. Silica is a
high-melting-point ceramic material with exceptional barrier properties. It can be both
molecularly synthesized and disintegrated in water at room temperature (24 °C) by choosing
appropriate chemical conditions. These characteristics make silica an ideal assembly material
for an encapsulation-release system to protect DNA.
This protocol enables experimenters to encapsulate DNA from various sources into
glass particles. After the encapsulation procedure, the DNA assumes superior biological,
chemical and thermal stability, as best evidenced by the radical treatment stability assay
(Box 1). The protocol was originally developed for the encapsulation of short dsDNA
sequences (~100 bp) for product tagging and tracing and subsequent analysis via qPCR,52 and
it has since been adopted for the encapsulation of ssDNA fragments and plasmidic and
genomic dsDNA. Possible biological tagging and/or tracing applications include marking
foodstuffs, individual cells, animals and populations thereof. For analysis, the DNA taggants
are recovered from the material of interest, the DNA is released from the glass particles and
analyzed by standard nucleic-acid analytical methods (e.g., PCR and sequencing). In addition,
the encapsulates may be used for the storage of nonbiological information in DNA over long
time periods or under challenging physical and/or chemical conditions.
Although this protocol is effective in protecting DNA from outside chemical stress,
the scheme has the following limitations in terms of providing ultimate DNA stability. (i)
DNA self-decomposition: the thermal decomposition of DNA in the absence of radical
species, oxygen and radicals is of little importance at room temperature, but it starts affecting
DNA integrity at temperatures exceeding 140 °C. (ii) UV irradiation: as silica is a material of
excellent optical (and UV) transparency, the encapsulation of DNA in silica gives the nucleic
acid little additional stability. As previously reported, however, the scattering of light by the
small encapsulate particles adds some degree of stabilization from sunlight.52 (iii) Solubility
of silica: although it is generally regarded as an insoluble material, silica has a non-negligible
solubility in water and dissolves at higher pH, making the encapsulates incompatible with
strong bases or other silica etchants.
To further improve the stability of the encapsulated DNA under the conditions
described above, a combination of the current procedure with more traditional approaches
such as freeze-drying and adding UV absorbers may be effective.
32
Box 1
Radical treatment stability assay
The radical treatment stability assay is designed to evaluate the quality of the
encapsulation process. To test the protective properties of the particles, they are
treated with a solution producing ROS.71 The concentrations of the reactants are
chosen so that they would completely disintegrate nonencapsulated DNA
(Figure 2.3., lanes 2 and 6). The reaction is quenched by EDTA, and the DNA
concentration is measured with the Qubit dsDNA HS kit (for ssDNA: Qubit
ssDNA kit).
1. Add the following solutions to 5 μl of the synthesized DNA/SiO2 particles:
Compound
Volume
Concentration
L-Ascorbic acid
2.5 μl
20 mM
H2O2
12.5 μl
20 mM
CuCl2
17.5 μl
500 μM
2. Wait for 10 min.
3. Add 17.5 μl of 100 mM EDTA and 20 μl of NH4FHF/NH4F etching solution.
The NH4FHF/NH4F etching solution is a buffered hydrogen fluoride solution.
This solution and its vapors can penetrate skin and rapidly damage cells and
bones. Working guidelines are described in Box 2.
4. Measure the DNA concentration with the Qubit assay. The value obtained is
the amount of DNA in the particles surviving the radical oxygen treatment.
5. To measure the total amount of DNA encapsulated within the particles, add
50 μl of water and 20 μl of etching solution NH4FHF/NH4F to 5 μl of the
synthesized DNA/SiO2 particles and measure the resulting DNA concentration
by using the Qubit assay.
6. The protection efficiency (ROS surviving DNA/total DNA) should be >90%.
33
2.2 Experimental
2.2.1 Procedure (step-by-step protocol)
SiO2 particle preparation ● TIMING 8 h; hands-on time 1 h
1| Mix 18 ml of ethanol, 0.8 ml of 25% (wt/wt) ammonia solution and 0.5 ml of Milli-Q H2O
in a 50-ml conical tube and add 0.8 ml of TEOS. Shake the mixture at 900 r.p.m. for 6 h at
room temperature (24 °C).
2| Centrifuge the mixture at 9’000g for 20 min at room temperature and discard the
supernatant.
3| Suspend the pellet with 20 ml of isopropanol (vortex the tube for a few seconds and
ultrasonicate it in a bath for 5 min).
4| Repeat Steps 2 and 3 and centrifuge the tube at 9’000g for 20 min at room temperature.
5| Suspend the pellet in 4 ml of isopropanol (vortex the tube for a few seconds and
ultrasonicate it in a bath for 5 min). The resulting particle concentration is ~50 mg ml−1,
which is sufficient for ~120 encapsulation experiments.
Ammonium functionalization of SiO2 particles ● TIMING 13 h; hands-on time 20 min
6| Vortex the particle suspension from Step 5.
7| Transfer 1 ml of SiO2 particles (concentration = 50 mg ml−1) into a 2-ml microcentrifuge
tube.
8| Ultrasonicate the particles for 10 min until the mixture turns into a homogeneous solution.
9| Add 10 μl of TMAPS (50% (wt/wt) in methanol) solution.
10| Stir the mixture at 900 r.p.m. in a Thermomixer for 12 h at room temperature.
11| Centrifuge the tube at 21’500g for 4 min at room temperature and discard the supernatant.
12| Suspend the pellet with 1 ml of isopropanol (vortex the tube for a few seconds and
ultrasonicate it in a bath for 3 min).
14| Suspend the pellet in 1 ml of isopropanol (vortex the tube for a few seconds and
ultrasonicate it in a bath for 3 min). The solution thus obtained is sufficient for
~30 encapsulation experiments.
DNA encapsulation ● TIMING 4 d; hands-on time 2 h
15| Prepare a DNA solution at a concentration of 50 μg ml−1 in Milli-Q water.
16| Depending on the size of the DNA fragment, prepare the reaction mixture as described in
Table 2.1., adding water first, followed by DNA and functionalized particle solution. Mix the
contents by pipetting and vortexing and leave the reaction mixture at room temperature for
3 min (pH ~9). ?TROUBLESHOOTING
Troubleshooting advice can be found in Table 2.2.
34
Table 2.1. Advised composition of the DNA encapsulation reaction mixture in relation to the
type of DNA sample.
DNA fragment size (μl)
Short sequence
dsDNA or ssDNA
(~100 bp)
700
Plasmid
(~3,600 bp)
Genomic
830
850
DNA solution
320
190
170
Functionalized particle solution
35
10
10
Water
17| Centrifuge the mixture at 21,500g for 3 min at room temperature and discard the
supernatant.
18| Suspend the pellet with 1 ml of H2O, vortex it for a few seconds and ultrasonicate it in a
bath for 2 min until a homogeneous solution has formed, and then centrifuge the mixture at
21’500g for 3 min at room temperature.
19| Suspend the pellet with 500 μl of H2O, vortex it for a few seconds, and then ultrasonicate
it in a bath for 2 min until the mixture has turned into a homogeneous solution. Add 0.5 μl of
50% (wt/wt) TMAPS solution and vortex the tube for a few seconds before adding 0.5 μl of
TEOS.
20| Stir the mixture at 900 r.p.m. in a Thermomixer for 4 h at room temperature, and then add
4 μl of TEOS to the solution.
21| Stir the mixture for a further 4 d at 900 r.p.m. at room temperature.
?TROUBLESHOOTING
22| Centrifuge the mixture at 21’500g for 3 min at room temperature and discard the
supernatant.
23| Suspend the pellet in 500 μl of H2O (vortex the tube for a few seconds and ultrasonicate it
in a bath for 1 min).
25| Suspend the pellet in 100 μl of H2O (ultrasonicate in bath for 2 min).
DNA release and purification ● TIMING 40 min
26| Centrifuge 100 μl of previously synthesized DNA/SiO2 particles at 21’500g for 3 min at
room temperature and discard the supernatant.
27| Add 300 μl of the NH4FHF/NH4F etching solution.
28| Purify the released DNA by using the QIAquick PCR purification kit according to the
manufacturer’s instructions. Elute the DNA in 50 μl of buffer EB (part of the kit;
alternatively, use 10 mM Tris-HCl (pH 8.5)).
29| Measure the DNA concentration with the Qubit dsDNA HS assay (optionally: measure
with a NanoDrop spectrophotometer or use the Qubit ssDNA assay kit).
?TROUBLESHOOTING
35
2.2.2 Troubleshooting
Table 2.2. Troubleshooting table.
Step
Problem
Possible reason
Solution
16
Particles clump
during mixing
Surface of functionalized
particles is not completely
covered with DNA and the
particles stick together
Optimize the DNA/functionalized
particle ratio individually
Ratio of DNA and
functionalized particle
concentration is not optimal
Poor particle
dispersion
Mixing is not sufficient for
dispersion of particles
Vortex and mix the reaction mixture
for a few seconds and check dispersion
by holding against light
Insufficient vortexing speed
or ultrasonication energy
Increase the length and/or intensity of
ultrasonic treatment
21
Sedimentation of
particles during the
stirring process
leads to nonoptimal
conditions for the
formation of silica
layer
Stirring was too weak or the
solution was not
homogeneous before being
placed in the Thermomixer
Increase stirring velocity. Vortex the
sample for a few seconds and
ultrasonicate in a bath for 3 min before
placing the sample back into the
Thermomixer
29
Encapsulated DNA
concentration <20
μg ml−1
No optimal surface
functionalization of SiO2
particles
Check the binding capacity of
functionalized particles (Step 14) with
1-kb DNA ladder. Add 40 μl of DNA
ladder (500 μg ml−1) to 1 ml of
distilled water and 10 μl of
functionalized particles. Vortex for a
few seconds and centrifuge at 21’500g
for 3 min at room temperature.
Remove the supernatant and measure
DNA concentration of the supernatant.
The expected binding capacity is >4 μg
DNA per mg of functionalized
particle. If the binding capacity is
lower, functionalize a new batch of
SiO2 particles
Wrong composition of
etching solution
Check the pH of etching solution with
indicator paper. The expected pH is ~4
36
2.3 Result and Discussion
2.3.1 DNA encapsulation design
As opposed to previously developed methods for encapsulating DNA in silica,72, 73 the present
protocol relies on silica particles carrying positive surface charges as solid support. The use of
support particles facilitates sample handling and washing via centrifugation and resuspension.
After the adsorption of DNA onto the positively charged particles, a silica surface layer is
grown onto the DNA by the polycondensation of tetraethoxysilane (TEOS; sol-gel process).54
N-trimethoxylsilylpropyl-N,N,N-trimethylammonium chloride (TMAPS) is additionally used
as a co-interacting species to shield the negative charge of the 2-deoxyribose-phosphate
backbone (Figure 2.1.).
Figure 2.1. Workflow for DNA encapsulation and release. Silica particles are initially
functionalized by reaction with TMAPS. During encapsulation, DNA is fixated onto positively
charged support particles and a thin silica layer (12–15 nm thick) is grown as a top layer via
polycondensation. These ‘synthetic fossils’ thus withstand aggressive chemical and physical
treatments (e.g., with ROS). Upon the need for analysis, DNA can be released from the
encapsulates without damage.
Short DNA fragments (<150 bp) are adsorbed less efficiently than longer ones to the
surface of the support particles. Therefore, the amounts of DNA and support particles have to
be scaled for an optimized result (Tables 2.1. and 2.3.). The procedure is designed for a silica
37
coating thickness of 12–15 nm, and it is performed in the absence of acid or base catalysis to
maintain an optimal integrity of the encapsulated DNA. Under these conditions, the reaction
Table 2.3. Expected properties of final encapsulates (guidance values).
DNA fragment size
Short sequence
(dsDNA; ~100 bp)
Short sequence
(ssDNA; ~100 bp)
Plasmid and
genomic
3
1.5
7
Base pairs (or bases for ssDNA)
per particle
7,300
7,300
17,000
Final particle concentration (mg
ml–1)
25
25
12
1 × 1012
1 × 1012
3 × 1011
DNA loading
(μg DNA per mg particle)
Total number of particles
requires 4 d for completion (Figure 2.2.). The procedure of DNA encapsulation includes
ultrasonication, which is required in the washing steps to re-disperse the particles after fast
sedimentation by centrifugation. DNA fragments shorter than 200 bp are not affected during
these ultrasonication steps, and little effect could be observed in the encapsulation of plasmid
DNA (Figures 2.3. and 2.4.). Markedly longer DNA fragments (e.g., genomic) may be
broken into smaller fragments after prolonged periods of sonication, as it is commonly
observed by DNA shearing for sequencing library construction.
Figure 2.2. Images of DNA/SiO2 particles encapsulating a short dsDNA segment (113 bp).
(a) Transmission electron microscopy image of DNA/SiO2 particles. Scale bar, 50 nm. The
silica layer has a thickness of 12 nm, and it protects the nucleic acid from ROS and heat.
(b) Scanning electron microscopy image of DNA/SiO2 particles depicting the homogeneity of
the particles. Scale bar, 200 nm.
38
Silica can be rapidly dissolved by fluoride-containing solutions (e.g., buffered oxide
etch). Upon this treatment, the protective coating is dissolved and the support particle is
completely degraded. The result of dissolving the encapsulates with buffered oxide etch is,
therefore, DNA in a clear aqueous solution without polymeric or solid contaminants. In this
protocol, the concentrations and pH of the etchants are chosen so that the nucleic acids do not
undergo hydrolysis or denaturation during the release step. Even after 80 h, no influence of
the etching solution on the DNA integrity could be observed. In addition, the amounts of the
etchants are chosen so that the safety risks of fluoride chemistry are minimized (Box 2).
Figure 2.3. Evidence of DNA protection against ROS activity. Agarose gel electrophoresis of
dsDNA ladder (lanes 1–4) and pRSET/EmGFP plasmid expression vector (lanes 5–8) treated
as described in the protocol and Box 1. Non-encapsulated DNA (lanes 1 and 5) is completely
disintegrated by an aggressive ROS treatment (lanes 2 and 6). After encapsulation (lanes 3
and 7), the DNA survives the same aggressive treatment and it can be released without harm
(lanes 4 and 8). For the plasmid, the supercoiled (lower band) and open-circular forms
(upper band) could be identified. After processing, an increase in the fraction of opencircular DNA was evident. DNA concentrations are 15 μg ml−1 (lanes 1–4) and 10 μg ml−1
(lanes 5–8).
39
After release of the DNA by dissolution of the encapsulates, DNA is purified with
silica spin columns. This strategy serves two purposes: first, the silica fibers of the spin
column consume any unreacted fluoride ions; and second, the released DNA is purified from
contaminating ionic species (NH4+ and SiF62−). The released and purified DNA is fit for
analysis via gel electrophoresis and Sanger sequencing. At this point, qPCR can be performed
without DNA purification by diluting the released DNA solution 1:10 in water and
performing qPCR via a standard protocol.
Figure 2.4. Sequencing chromatograms obtained from plasmid DNA before encapsulation
and after release from DNA/SiO2 particles. (a–d) Sequencing chromatograms34 of
unprocessed pRSET/EmGFP plasmid (a), encapsulated/released (b) and treated with ROS for
10 min (Box 1) before release (c) and temperature-treated at 120 °C for 15 min before
release (d). Each sample could be sequenced to about 1,000 bp. In the figure, only bases 504–
544 of the pRSET/EmGFP plasmid sequence are shown. Each base call is accompanied with
the corresponding Phred25 quality score (gray background). Nonprotected DNA plasmid
treated under the same conditions (ROS or 120 °C) could no longer be sequenced using the
same routine.
40
Box 2
Radical treatment stability assay
The etching solution NH4FHF/NH4F is a buffered hydrogen fluoride solution.
This solution and its vapors can penetrate skin and rapidly damage cells and
bones.74 Although fluoride-containing solutions are feared in chemistry
laboratories, these solutions’ unique ability to dissolve silica and other metal
oxides has resulted in a widespread use of concentrated fluoride solutions (6–
50%) in electronics manufacturing and polishing applications (e.g., car wheel
polish).75 Diluted and buffered fluoride solutions are found in toothpaste (~1’000
p.p.m.) and dental products (up to 1.23% (wt/vol) fluoride) for the refluorination
of tooth enamel.76 Upon oral uptake, 5 mg kg−1 F− is considered toxic (probable
toxic dose).77 This protocol was optimized so that the user never handles fluoride
solutions with toxic potential upon oral uptake (i.e., total fluoride in solution at
any time <250 mg). Still, the precautionary measures outlined below should be
followed:
• Always wear nitrile gloves, a laboratory coat and chemical safety goggles
when you are working with etching solutions.
• Perform all operations in a fume hood.
• Use and store etching solutions in polyethylene, polypropylene or Teflon
containers. Never store the solutions in glass containers or flasks; the etchant
rapidly dissolves glass.
• Your laboratory should be equipped with a commercially available calcium
gluconate gel in case of skin contact or spill (e.g., H-F antidote gel).
• Prepare 10 g of calcium carbonate in a 50-ml plastic container. Dispose of all
waste from etching solutions in this container.
• Do not use any glassware or instruments with glass parts (NanoDrop
spectrophotometer, pH electrodes) for any step of the release procedure (except
after DNA purification, Step 28).
41
2.3.2 Anticipated Results
The DNA encapsulation procedure (Steps 15–25) yields agglomerated silica particles with
primary particle sizes of ~130 nm loaded with 0.2–0.7% (wt/wt) DNA (depending on the
sequence length; Table 2.3.).
Within the particulate structure, the support particle (silica) is surrounded by a layer of
DNA, on top of which an additional thin layer of silica has been grown (Figures 2.1. and
2.2.). Upon release of DNA from the encapsulates by etching solutions (see Box 2 for safe
working directions) and subsequent purification using standard methods (silica centrifugation
columns), the DNA maintains its original quality and functionality (confirmed by gel
electrophoresis, qPCR and sequencing; Figures 2.3.–2.5.). The yield of the overall procedure
(encapsulation, release and purification) is 25–70%. For plasmids, the fraction of supercoiled
DNA after the treatment is reduced (Figure 2.3.), whereas for genomic DNA, strand breaks
cannot be excluded because the protocol relies on ultrasonication for particle resuspension.
Depending on the nature and/or size of the original DNA, the resulting particles may be
agglomerated, especially in the case of large DNA fragments (>500 bp).
Figure 2.5 Amplification curves of dissolved DNA/SiO2 dispersions at different original
particle dilutions. After the SiO2 dissolution (Step 27) and tenfold dilution with PCR-grade
water, the released dsDNA sequences (113 bp in length) can be directly amplified by using a
standard qPCR protocol (e.g., Roche LightCycler 96).
42
While encapsulated within the silica particle, DNA resists treatments with aggressive
ROS, increased temperatures and, to some extent, sunlight irradiation, in situations in which
nonprotected DNA does not survive (as illustrated in Paunescu et al.52). As an example, we
report here evidence that the treatment of encapsulated DNA ladder and encapsulated plasmid
DNA with ROS (Box 1) and high temperatures (120 °C) does not damage the DNA, as made
clear by the integrity of the DNA determined by gel electrophoresis (Figure 2.3.) and Sanger
sequencing (Figure 2.4.). The resistance of the ‘synthetic fossils’ to ROS further proves the
hermetic sealing of the DNA from surrounding chemicals.
43
3. DNA Protection Against Ultraviolet Irradiation by
Encapsulation in a Multilayered SiO2/TiO2 Assembly
Daniela Paunescu, Carlos A. Mora, Michela Puddu, Frank Krumeich,
Robert N. Grass, J. Mater. Chem. B 2014, 2, 8504-8509.
44
3.1 Introduction
In biomedical routines DNA is regarded as a relatively stable molecule, especially compared
to other biopolymers such as RNA and proteins. DNA has also been proposed as a useful
molecule for many non-biomedical applications, including catalysis,78,
79
nanodevice
fabrication,7, 62, 64, 80, 81 DNA computing,41, 82 data storage devices39, 40 and as an anthropogenic
tracer molecule.42,
45, 56, 83
Yet the vulnerability of DNA towards light irradiation severely
limits its use and therefore technological progress in many of these areas, especially if they
involve exposure to daylight for extended time periods. UV radiation is the most harmful and
mutagenic component of solar radiation.84 UV-induced damage is usually described by direct
and indirect mechanisms, depending on the wavelength of the UV.85 The energy of a shortwavelength UV photon (UV-C <280 nm, UV-B 280-315 nm) is directly absorbed by DNA
bases, which causes the most efficient damage. Photochemical reactions are more efficient
within DNA at this wavelength, which is close to the absorption maximum of the pyrimidine
and purine bases.86 UV-C radiation is, therefore, used for convenient germicidal treatment and
is highly relevant in sterilization procedures in healthcare.87 DNA can also be damaged
indirectly by UV-A exposure through the production of radical oxygen species (ROS).88-90
The exposure of DNA to UV-A light is less efficient in inducing DNA damage, but can still
affect it via indirect photosensitizing reactions generating a variety of reactive oxygen species
(ROS). A number of sensitizers have been identified, which upon photolysis, transfer their
excitation energy onto an adjacent dioxygen molecule, converting it to singlet oxygen while
the photosensitizer molecule returns to its ground state.91
In nature, microbial spores developed an outstanding resistance to UV radiation,
amongst other harsh environmental conditions. Dormant spores can survive for extremely
long periods of time, largely because spore DNA is well protected against damage, e.g. viable
Bacillus sphaericus spores were recovered from amber after an estimated 25 to 40 million
years.50, 92
Artificial UV protection is found in everyday products, such as sunscreens, cosmetics
or paints. One of the most useful UV blocking materials is submicron titania particles,
manufactured commercially at 4 million tons per year.93 Titania is selected as both common
crystalline forms anatase and rutile are semiconductors with a bandgap of 3.2 and 3.0 eV.
This means they can efficiently absorb UV irradiation at wavelengths smaller than 388 and
414 nm.94
45
In order to circumvent the sensitivity of DNA to UV light we considered coating DNA
molecules with a thin layer of titania. However, titania is also an excellent photocatalytic
material, which generates aggressive radical oxygen species if irradiated in water with UV
light. If UV-protection of DNA by titania is to be successful, the biopolymer must not be in
direct contact with the photocatalyst. As a result of this argumentation we decided to use
silica as an insulating layer resulting in the material design illustrated in Figure 3.1. To
prepare the protection system, we first encapsulated DNA in silica particles according to
previously established routines.52,
53, 63, 72, 73, 95, 96
In a second step, a titania coating was
obtained by reacting the encapsulates with titanium n-butoxide (TBOT) in ethanol and water
at ambient temperature overnight.97, 98
Figure 3.1. DNA is adsorbed on an ammonium functionalized silica bead (gray). Silica (red)
is grown as an insulating layer via TEOS hydrolysis, titania (green) is grown from TBOT. In
the encapsulate DNA is protected from direct and indirect UV damage. DNA can be released
unharmed from the encapsulate by treating it with a mild fluoride etch.
46
3.2 Experimental
3.2.1 DNA/SiO2/TiO2 particle synthesis
DNA-labeled SiO2-particles were synthesized as described in previous studies.52, 53 Briefly,
silica particles (SiO2-R-L2897, 142 nm, 50 mg ml-1, micro particles GmbH) were
functionalized with N-trimethoxylsilylpropyl-N,N,N-trimethylammonium (TMAPS, 50% in
methanol, ABCR) to absorb double-stranded DNA on the particle surface. A silica layer was
formed on top of the DNA by adding TMAPS and tetraethoxysilane (TEOS, ≥99.0%,
Aldrich). The synthesized DNA/SiO2 particles were washed twice by sedimentation and
redispersion in 500 μl ethanol. The titania nanocoating was obtained by mixing the particle
solution with 10 μl of dH2O and a solution of 2.5 μl of titanium(IV) butoxide (TBOT, 97%,
Aldrich) in 500 μl ethanol. The reaction was stirred (900 r.p.m.) at ambient temperature
overnight and afterwards washed 3 times with ethanol and resuspended in 1 ml ethanol. Two
kinds of particles with different incorporated DNA were synthesized for variable analysis
methods. The one incorporated DNA was a double strand 113 bp amplicon (5’-ATT CAT
GCG ACA GGG GTA AGA CCA TCA GTA GTA GGG ATA GTG CCA AAC CTC ACT
CAC CAC TGC CAA TAA GGG GTC CTT ACC TGA AGA ATA AGT GTC AGC CAG
TGT AAC CCG AT-3’; Microsynth AG), which primers were designed using the online
Primer3 tool99 and tested for uniqueness using the Basic Local Alignment Search Tool100
(BLAST). The double-stranded DNA was prepared by annealing the DNA sequence with its
complementary sequence. For agarose gel electrophoresis a standard DNA ladder (DNA
ladder 1KB Plus, 1 μg μl-1, Invitrogen) was incorporated into particles.
3.2.2 DNA recovery
Encapsulated dsDNA in SiO2/TiO2 particles (2.4 μg ml-1) was recovered using a 1:100 diluted
buffered oxide etch solution (BOE, 0.23 g of NH4FHF (pure, Merck) and 0.19 g of NH4F
(puriss, Sigma-Aldrich) in 10 ml TE-buffer) prepared and safety handled as described in
previous studies.53
3.2.3 UV irradiation of samples
For comparison, free dsDNA (diluted 1:106 with starting concentration of 600 μg ml-1,
determined by Qubit dsDNA HS assay, Invitrogen), in SiO2 encapsulated dsDNA (2.4 μg ml-1
particle dispersion) and in SiO2/TiO2 encapsulated dsDNA (2.4 μg ml-1) were irradiated by
different UV sources for various times. Aqueous solutions of each sample including similar
47
DNA concentrations were placed into quartz cells (170-2700 nm, thickness 10 mm, Starna).
Following treatment 20 μl of diluted BOE (1:100) was added to 20 μl of each sample and
directly analysed by quantitative real-time PCR (qPCR).
UV-C exposure
Samples were treated with UV-C light from four low pressure mercury lamps (253.7 nm,
15 W, HNS 15 ORF, Osram). The UV-C lamps were set at a distance of 50 cm from the
sample, resulting in a dose rate of approximately 5.2 W m-2. The irradiation output was
measured by a standard photodiode sensor (PD300-UV, 200-1100 nm, 3 mW-20 pW, Ophir
Photonics). All experiments were performed in duplicates with exception of the 72 h treated
DNA/SiO2/TiO2 particle sample. Additionally to qPCR analysis, gel-electrophoresis and
Sanger sequencing of the samples were performed:
Quantitative real-time qPCR
After the TiO2 and SiO2 dissolution with diluted BOE (1:100), the released dsDNA sequence
was directly amplified using a standard qPCR protocol (Roche LightCycler 96). For the qPCR
the following primers were used: 5’-ATT CAT GCG ACA GGG GTA AG-3’ (forward
primer) and 5’-ATC GGG TTA CAC TGG CTG AC-3’ (reverse primer), (Eurofins MWG
Operon).
Agarose gel electrophoresis
DNA Ladder: Volume of 300 μl of DNA ladder (6 μg ml-1, determined by Qubit dsDNA HS
assay) was treated with UV-C radiation for 1.5 h and analyzed by gel electrophoresis (E-Gel®
Agarose Gel Electrophoresis, Invitrogen).
DNA Ladder/SiO2/TiO2: Volume of 300 μl of 5.7 mg ml-1 particle dispersion was treated for
1.5 h and 100 μl of treated particles were centrifuged and dissolved in 100 μl BOE. The DNA
solution was then purified (QIAquick PCR purification kit) and the obtained DNA analyzed
by gel electrophoresis.
Sanger Sequencing
Protected DNA in SiO2/TiO2 particles and free DNA were treated with UV-C radiation for
1.5 h. Particle dispersion was dissolved in BOE, purified (QIAquick PCR purification kit) and
sequenced. DNA was sequenced with the primer 5’-CAG GGG TAA GAC CAT CAG-3’
(Microsynth AG).
48
Sunlight exposure
For exposure to solar radiation, the experiment was conducted with a solar simulator
(Newport Sun Simulator, Class A 91195A-1000, AM1.5global, 1000 W m-2, simulating
irradiation for a 37° tilted surface).
The sample was characterized using scanning electron microscopy (SEM; FEI
NovaNanoSEM 450, 5 kV). The scanning transmission electron microscopy (STEM)
investigations were performed on an aberration-corrected HD-2700CS (Hitachi) and operated
at an acceleration potential of 200 kV. An energy-dispersive X-ray spectrometer (EDXS;
Gemini system of EDAX) is used for elemental mappings (measuring time ca. 30 min). The
presence of the titania coating was confirmed by Fourier transform infrared spectrometry (FTIR spectrometer Tensor 27, Bruker Optics, equipped with a diffuse reflectance accessory,
DiffuseIR™, Pike Technologies) on sample milled with KBr (2 w/w %). A strong absorption
band in the range of 900-500 cm-1 was observed, which is associated with the characteristic
vibrational mode of TiO2.
49
3.3 Results and discussion
For the DNA protection system, DNA was first encapsulated in silica particles. To evaluate
the completeness and tightness of the coating the particles were treated with highly aggressive
heavy metal and hydrogen peroxide species, which induce the formation of ROS and are
known to disintegrate DNA.71 The DNA could be released from the particles by etching the
silica with a mild fluoride etch and >90% of the originally present DNA could be recovered
unharmed, proving a hermetic silica layer (Table 3.1.). In a second step, a titania coating was
obtained by reacting the encapsulates with titanium n-butoxide (TBOT) in ethanol and water
at ambient temperature overnight. As evidenced by energy dispersive X-ray spectroscopy
(EDXS; Figure 3.3.), infrared spectroscopy (IR; Figure 3.2.) and UV-Vis spectroscopy
(Figure 3.4.), the original structures were effectively coated with a thin (ca. 20 nm) layer of
titania.
In order to characterize the core-shell particle system, the quality of the DNA
encapsulation process was evaluated by investigating the DNA protection properties of the
particles. To understand the location of DNA in the particles, the amount of DNA bound
during the synthesis procedure was followed, together with the radical stability of the
corresponding DNA (to discriminate coated/non-coated). Following the dissolution of the
particles, the resulting DNA concentration was measured. Free DNA and DNA that was
adsorbed on the functionalized SiO2 particle surface were nearly completely destroyed after
the radical treatment. The subsequent synthesis steps of silica layer growth and the additional
TiO2 nanocoating provided DNA stability against ROS (>90%, Table 3.1.). This designed
stability assay of DNA shows, therefore, the successful encapsulation of DNA.
Table 3.1. Evidence of DNA protection against ROS activity in the core-shell particle systems.
50
Figure 3.2. IR spectra of encapsulated DNA into SiO2 and TiO2 coated SiO2 particles.
Figure 3.3. Electron microscopy images and elemental X-ray map-ping of TiO2 coated
DNA/SiO2 encapsulates. Elemental X-ray mapping shows silicon (a) in red and titanium (b) in
green. The mapping in (c) shows the coated nanostructure with SiO2 cores (Si shown in red)
and outer layers of titania (Ti shown in green). (d) SEM image of TiO2 coated nanoparticles.
The optical properties of the titania/silica encapsulates in water show a complete
blocking of light at wavelengths smaller than ~320 nm, thereby shadowing the UV absorption
peak of DNA at 260 nm (Figure 3.4.).
While it is well known from computer chip manufacturing (silicon-wafer chemistry)
that silica can be rapidly dissolved in buffered solutions of fluoride (e.g. buffered oxide etch =
51
buffered ammonium fluoride, pH~4-5), the solubility of titania under these conditions has
been less commonly exploited. The above prepared encapsulates could be dissolved rapidly
(<1 min) in diluted (2.5 wt%F-, pH = 3.8) buffered fluoride solutions, releasing the DNA
unharmed (see below).
Figure 3.4. Comparison of UV-Vis absorption spectra of unprocessed DNA (7.1 μg ml-1
orange), encapsulated DNA/SiO2 particles (0.4 mg ml-1 red) and encapsulated
DNA/SiO2/TiO2 particles (0.4 mg ml-1 green). Emission spectra of the UV-C lamp (dashed
grey, right axis) and a section of solar spectrum of direct AM 1.5 (ASTMG-173, dashed black,
right axis).
3.3.2 UV shielding properties
Having obtained a method to encapsulate DNA with silica and titania and with the possibility
of releasing the DNA from these encapsulates, we investigated the UV shielding properties of
the coating layers. Solutions of unprotected DNA, SiO2-protected DNA and SiO2 protected
DNA with the additional TiO2 layer were prepared, ensuring similar DNA concentrations (mg
ml-1 solution) in all cases. These solutions were exposed to 254 nm UV-C light at a dose rate
of 5.2 W m-2 utilizing the sterilization unit of a standard laboratory biological-safety flowbench. Following the UV-C treatment, the particles were dissolved in a diluted BOE solution.
The induced DNA damage was monitored by quantitative polymerase chain reaction (qPCR)
analysis (Figure 3.5.), which could be undertaken without further purification steps when
DNA concentrations were <10-3 µg ml-1 and a F- concentration of the buffer was chosen as
0.025 wt%.
52
Figure 3.5. qPCR analysis of TiO2 coated DNA/SiO2 particles stability compared to that of
DNA/SiO2 particles and unprotected DNA. Dispersions of both particles (2.4 μg particles ml1
) and free DNA amplicon (0.6 ng ml-1) were exposed to UV-C light (254 nm). Orange bars
represent free DNA, red bars DNA in silica particles and green bars DNA in titania coated
silica particles; star (*) indicates data below the detection limit (< 10-7 μg ml-1).
As expected, 99.2 % of the unprotected DNA was destroyed after 1 h of UV-C irradiation and
the silica layer only gave a marginal improvement. Only the DNA additionally protected by
titania withstood the one hour irradiation experiment (71 % survived) and even after 72 hours
of UV-C irradiation the DNA could still be amplified by qPCR.
Further evidence of DNA protection against UV-C irradiation was given by agarose
gel electrophoresis and DNA analysis by Sanger sequencing. To prove efficient DNA
protection by gel electrophoresis a commercial dsDNA ladder (100 to 12 000 bp) was
encapsulated with silica and titania and irradiated by UV-C light for 1.5 h. Figure 3.6a
displays both the successful encapsulation of the DNA ladder as well as the effective
protection of the encapsulated DNA from UV light at conditions in which the unprotected
DNA ladder is no longer visible by gel electrophoresis.
In order to show that the DNA sequence was neither permutated by the
encapsulation/de-encapsulation scheme, nor by UV-C irradiation, the encapsulated DNA
amplicon utilized in the qPCR study was purified by drop-dialysis and analyzed by Sanger
sequencing.34 The sequencing chromatograms in Figure 3.6b display successful sequencing
of the DNA after encapsulation, UV-irradiation and subsequent particle dissolution, neither of
53
which was different from the original DNA in sequence nor had a lower sequencing Phred
quality score (not statistically smaller from two sample t-test, Table A.1.1. in Appendix A.1).
Additionally to UV-C induced DNA damage, DNA can also be damaged by higher
wavelengths in the range of UV-B and UV-A as well as by direct sunlight irradiation. UV-A
does not usually display a direct effect on biological systems, but a significant indirect effect
is reported.101 The indirect damage is based on the formation of free radicals, which interact
with DNA causing damage, such as single- and doublestrand breaks and modified bases. The
effect of this indirect DNA damage can be mimicked by treating the materials of interest with
radical oxygen species generated chemically. As schematically illustrated in Figure 3.1.,
DNA encapsulated in SiO2 and in SiO2/TiO2 particles is well protected against ROS (>90%
DNA survived a harsh hydrogen peroxide/heavy cocktail, see Table A.1.2. in Appendix A.1).
Figure 3.6. (a) Agarose gel electrophoresis of unprotected (lane 1 and 2) and protected (lane
3 and 4) dsDNA ladder. DNA encapsulated in SiO2/TiO2 particles (lane 4) survived the UV-C
treatment, while unprotected DNA was completely destroyed (lane 2) under the same the
conditions. (b) Sequencing chromatograms of base 92-111 of unprotected dsDNA sequence
(1) and UV-C treated unprotected (2) and protected (3) DNA amplicon; (*) indicates data
below the sequencing concentration.
Results for sunlight irradiation were generated using a sun simulator (1000 W m-2,
AM1.5global, simulating irradiation for a 37° tilted surface, see Figure 3.4.) and to measure
the damage we calculated the irradiation dose required to reduce the original DNA content by
90% (amplification inhibiting doses (AID90) value, Figure 3.7.). Under these conditions the
silica layer, preventing indirect UV damage as shown above, was able to somewhat protect
54
the DNA (2 fold increase in AID90). A much more pronounced protection with a 24-fold
increase in resistance to irradiation was achieved with the additional titania coating: a total
irradiation dose to destroy 90% of the DNA of 22 * 103 kJ m-2 was required.
We obtain an increase of DNA stability against UV-induced damage by encapsulating
DNA into SiO2 and nanocoating the particles with titania. The DNA stability is shown by the
AID90 value for UV-C and solar irradiation (Figure 3.7.). The data nicely demonstrates the
extreme vulnerability of DNA to UV-C irradiation compared to the same dose of sunlight
irradiation. Additionally it shows that the protection effect of the titania coating is similar in
both irradiation cases, with a slightly more pronounced effect in the UV (24 fold increase for
sunlight, 42 fold for UV-C).
To put the data into perspective we compared the vulnerability of the protected DNA
to the UV vulnerability of biological systems. We focused especially on bacterial spores,
which are well known for their sunlight and UV tolerance (Figure 3.7.). The key reason for
their light tolerance is their unique UV photochemistry.65 A variety of important factors for
this elevated spore resistance to ionizing radiation have been presumed: (a) low core water
content that potentially reduces the ability of c-radiation to generate damaging hydroxyl
radicals. (b) UV-absorbing pigments located in the spore’s outer layers, in particular the coats
and outer membrane. These pigments can protect DNA against UV by absorbing the radiation
before it reaches the nucleic acid in the spore core.102 (c) Saturation of spore DNA with α/βtype small acid-soluble proteins (SASP) additionally protects the DNA structure. In our
artificially designed assembly every DNA molecule is protected by a dense layer, similar to
the outer coats found in spores. The silica shell acts as a hermetic diffusion barrier and
protects equally well against very small molecules (ROS) and larger (bio)chemical reactants
(e.g. nucleases). The additional titania layer absorbs and scatters UV light with an absorbance
maximum in the region of UV-C and UV-B irradiation. It therefore blocks the high energy
photons from penetrating through the particles to the DNA, similar to the UV-absorbing
pigments in spores. Of course, our biomimetic protection system lacks the DNA repair
systems, which are highly active in spores during outgrowth and can repair minor damages
that occur during the dormant period.50
55
Figure 3.7. UV-C and solar resistance of DNA in SiO2 and SiO2/TiO2 compared to spores,
viruses and protozoans. AID90 and LD90 data is presented for UV-C (grey bars) and solar
(black bars) irradiation. The definitions of AID90 and LD90 are given in the text. AID90 values
were determined for UV-C exposure (254 nm) and for simulated sunlight irradiation at 1000
Wm-2 for up to 6 h. LD90 values are the dose radiation needed to kill 90% of the population
and are given for dormant wild-type spores of Bacillus subtilis103, viruses104, and protozoans
of Cryptosporidium104; star (*) presents values from literature and (**) indicates data not
available.
For Bacillus subtilis an increased UV tolerance of 5 to 50 times has been reported for its
spores as compared to the corresponding growing cells.103 The absolute irradiation cannot be
directly compared between the microbes and our data as the microbe stability data is
generated by viability assays (LD90 values) and we utilized qPCR to measure DNA damage
(AID90 values). Nevertheless, the increase in UV tolerance of DNA protected by a 20 nm
thick titania layer (24-42 fold) is directly comparable to the increase in UV tolerance these
bacteria have by spore formation (up to 50 fold).
The UV protection of the thin titania layer can also be represented in terms of an
attenuation coefficient. Assuming a titania layer thickness of 20 nm and a linear dependency
of DNA damage of light intensity, the corresponding attenuation coefficient is β254,DNA =
1.8 106 cm-1 (see A.1.3 in Appendix for calculation). This is more than an order of magnitude
higher than the titania absorbance coefficient in the UV-C wavelength range reported in the
literature (κUV = ~0.5 105 cm-1).105 However, it is well known that submicron titania particles
utilized in white paints and sunscreen formulations create most of their optical extinction
56
effect (>90 %) through light scattering and not light absorbance.106 The values derived for the
DNA protection indicate that also in the presented case light scattering on the surface of the
titania coated particles has the most pronounced effect on UV attenuation. To further validate
this, we measured the attenuation coefficient of the DNA/SiO2/TiO2 particles in water using a
photometer (PM) (see Figure A.1.2. in Appendix). We then obtained an attenuation
coefficient (β254,PM = 0.5 106 cm-1) that largely exceeds the absorption coefficient of titania
and that is close to the attenuation coefficient derived from the DNA damage data. A control
experiment (see Figure S4) with non-encapsulated DNA in the presence of titania
nanoparticles gave no UV protection and further confirms the necessity of the layered
material design shown in Figure 3.1.
3.4 Conclusions
We engineered an approach for DNA protection against optical irradiation by incorporating
DNA in a core-shell-shell assembly with a ~10 nm silica and a ~20 nm titania layer. While the
silica layer protected the DNA molecules from radical oxygen species, the additional titania
layer attenuated ~98 % of irradiated UV-C light, mostly by light scattering. Within the
assembly DNA withstood (AID90) UV-C irradiation exceeding 100 kJ m-2 and sunlight
irradiation of over 104 kJ m-2. An even higher UV resistance may be attainable by fine tuning
the encapsulates for optimized light scattering, e.g. varying particle size. The concept
developed here may be of further use for the encapsulation of other UV-sensitive
(bio)molecules in titania.
57
4. Detecting and number counting of single engineered
nanoparticles by digital particle PCR
Daniela Paunescu, Carlos A. Mora, Lorenzo Querci, Reinhard Heckel, Michela Puddu,
Bodo Hattendorf, Detlef Günther, Robert N. Grass, ACS Nano 2015, 2, 9564-9572.
58
4.1 Introduction
The measurement of nanoparticle concentrations down to the level of single particles is
increasingly important due to the growing use in consumer goods, industrial applications and
medical diagnostics. In order to assess their potential impact, the development of suitable
analytical methods is needed to determine nanoparticle concentrations by designing portable,
inexpensive and simple detection tools able to detect unique particles in non-idealized
environments. In this context there is a demand of more and more sensitive methods, and
some market regulations (e.g. European Medical Devices)107 are asking for proving the
presence/absence of individual particles, far beyond the capability of the established
nanometrology methods.
Several analytical methods to characterize nanoparticles are already standard research
infrastructure in many laboratories, such as dynamic light scattering (DLS) for size
determination, z-potential for surface charge measurement or Brunauer-Emmett-Teller (BET)
method for surface area estimation.108 Despite the progress in the field, most particle analysis
techniques are limited by particle size and concentration, and often require large and complex
instruments. Although electron-microscopy and probe scanning techniques can provide
images of single particles, they are based on expensive instrumentation, and particle counting
is time consuming even with modern automated image recognition systems.
In the last decade, several innovative approaches for detecting single nanoparticles
have
been
developed,10
ranging
from
mechanical
biomolecules/nanoparticles by microchannel resonators)
109
(e.g.
weighing
of
to optical detection, fluorescence
microscopy110, and label-free sensing technologies such as whispering-gallery-mode (WGM)
biosensors,111 and surface plasmon resonance microscopy (SPRM).112 However, because of
their complexity the use of these techniques is restricted to few laboratories and only
applicable to a small set of samples.
In contrast thereto, medical diagnostics has common access to highly sensitive
techniques to detect and monitor biomolecules and bioparticles (cells/viruses/bacteria), close
to single molecules (down to 10-18 mol l-1, see Table 4.1.). These ultra-low limits of detection
can be achieved by either signal-based or target-based amplifying strategies.113 While the
signal-based amplification detects the increased signal after the binding of the biomolecule to
a complex-labeled system (e.g. enzyme-linked immunosorbent assay (ELISA)114), the targetbased amplification is based on the identification and exponential amplification of the target.
59
Due to the fact that the target concentration is increased exponentially, target-based
amplification strategies are more sensitive. The most common target-based amplification
method, the polymerase chain reaction (PCR), is able to detect few copies of nucleic acids.113,
115
Because of its high sensitivity, selectivity, and versatility of detection, as well as low costs
and portability, PCR has been established as the benchmark for nucleic acid detection in
different areas, ranging from clinical diagnostics to forensics and is the standard for
identification of many important viral and bacterial diseases (e.g. HIV).
Table 4.1. Standard biotechnical detection methods for protein / DNA
Method
Entity measured
Limit of detection
Measuring
duration
Effort
enzyme-linked
immunosorbent
assay (ELISA)
proteins/antigens
1-10 pM7, 113
2.5 to 4
hours
10’000 US$;
Only plate
reader required
real-time
polymerase chain
reaction (PCR)
DNA/RNA/viruses/
bacteria
1-2 hours
15’000 – 30’000
US$; Standard
qPCR machine,
benchtop
instrument
Digital droplet
PCR (ddPCR)
DNA/rare mutations
1-2 hours
~100’000 US$;
Similar
workflow to
real-time PCR
with additional
microfluidic
devices
7
10 molecules per drop
(60 μl)
< 1-10 copies116, 117
observation per PCR
reaction (20-50 μl)
1-106 copies,
20 µl split into 20’000
droplets118
observation of
individual events per nl
Attracted by the sensitivity and ease of application of the PCR method, we wanted to
exploit this method for the detection of nanoparticles, especially as geometrically (in terms of
size), many viruses and nanoparticles are comparable. In our previous work we have shown
that silica particle detection is compatible with DNA, but accessible detection limits have
been > 10’000 particles per analysis,55 still far away from the potential PCR analytics has to
offer. To reach the goal of detecting single nanoparticles, we had to significantly improve the
synthesis of DNA comprising particles to yield individual, non-agglomerated sub 100 nm
particles. Additionally to this we decided for a signal detection scheme based on taking binary
measurements for PCR with which, as shown below, individual nanoparticles can be literally
counted.
60
4.2 Experimental
DNA-labeled SiO2 particles were synthesized by optimizing a previous developed procedure
of DNA encapsulation into SiO2.52, 53 To obtain monodisperse encapsulates, a layer-by-layer
approach was followed. In a first step, 132 nm silica particles (SiO2-R-L2902, 50 mg ml-1,
micro
particles
GmbH)
were
functionalized
with
N-trimethoxysilylpropyl-N,N,N-
trimethylammonium chloride (TMAPS, 50% in methanol, ABCR) to achieve a positively
charged surface, able to adsorb double-stranded DNA. To bind DNA onto the particle surface,
35 μl of functionalized particle suspension (50 mg ml-1) was mixed with 1 ml of a 12 μg ml-1
DNA solution (dsDNA: 5'- CGT GGA AGG TAA CAG CAC CGG TGC GAG CCT AAT
GTG CCG TCT CCA CGA ACA CAA GGC TGT CCG ATC GTA TAA TAG GAT TCC
GCA ATG GGG TTA GCA AGT GG - 3' (101 bp)). After washing the particles twice with
water, 0.5 ml of 1 mg ml-1 Poly(diallyldimethylammonium chloride) solution (PDADMAC,
20 wt% in H2O, Mw 200’000-350’000 g mol-1, Sigma-Aldrich) was deposited onto the
particles. After 20 min at room temperature, the particles were washed three times and
redispersed in a 1 ml of 0.1 mg ml-1 Poly(vinylpyrrolidone) solution (PVP, Mw ~ 10’000 g
mol-1, Sigma-Aldrich) for 20 min at room temperature, followed by two washing cycles in
water and one in ethanol. The PVP layer enables the particle transfer into ethanol,119 which
allows the growth of silica via acidic catalysed Stöber reaction (233 μl EtOH, 72 μl H2O,
22.1 μl tetraethoxysilane (TEOS, ≥99.0% Aldrich), 5 μl of 10 mol l-1 HOAc)120. The reaction
mixture was stirred (900 r.p.m.) overnight at room temperature and a silica shell with a
thickness of 2-4 nm was obtained. The particles were washed twice with ethanol, once with
water and redispersed in 1 ml ethanol. In order to obtain only single particles, the particle
solution was centrifuged for 3 min at 1150g and 800 μl of the supernatant was collected. The
supernatant contained 1.32 mg ml-1 of monodisperse encapsulated DNA/SiO2 particles.
4.2.2 Additional SiO2 layer - 252 nm DNA/SiO2 particles
To obtain an additional SiO2 layer onto the encapsulated DNA/SiO2 particles a standard
Stöber reaction was performed. The above synthesized particles were centrifuged for 4 min at
21100g and redispersed in a solution of 4.2 vol% ammonia (25 wt% NH3 in water) in an
ethanol/water mixture (366 μl ethanol / 22 μl H2O). Subsequently, 16.5 μl of TEOS was
added and the reaction was stirred for 3 h (900 r.p.m., room temperature). The obtained
particles were washed twice with ethanol, once with water, and stored in ethanol (7 mg ml-1).
61
In a first step, 61 nm silica particles (sicastar® 43-00-701, 25 mg ml-1, micromod
Partikeltechnologie GmbH) were functionalized with N-trimethoxysilylpropyl-N,N,Ntrimethylammonium chloride (TMAPS, 50% in methanol, ABCR). To bind DNA onto the
particle surface, 20 μl of functionalized particle suspension (50 mg ml-1) was mixed with 1 ml
of a 12.8 μg ml-1 dsDNA solution (ssDNA (forward): 5'-(thiol modified) - AAA AAA AAA
ACA CGA GGT AAA TAT GGG ACG CGT CCG ACC TGG CTC CTG GCG TTC TAC
GCC GCC ACG TGT TCG TTA ACT GTT GAT TGG TAG CAC A - 3' (94), ssDNA
(reverse): 5'- TGT GCT ACC AAT CAA CAG TTA ACG AAC ACG TGG CGG CGT AGA
ACG CCA GGA GCC AGG TCG GAC GCG TCC CAT ATT TAC CTC GTG- 3' (84)).
After
washing
the
particles
twice
with
water,
1
ml
of
4
mg
ml-1
Poly(diallyldimethylammonium chloride) solution (PDADMAC, 35 wt% in H2O, Mw <
100’000 g mol-1, Sigma-Aldrich) was deposited onto the particles. After 20 min at room
temperature, the particles were washed three times and redispersed in a 1 ml of 0.5 mg ml-1
Poly(vinylpyrrolidone) solution (PVP, Mw ~ 10’000 g mol-1, Sigma-Aldrich) for 20 min at
room temperature, followed by two washing cycles in water and one in ethanol. The particles
were redispersed in 275 μl EtOH and subsequently 6 μl of H2O, 6 μl of tetraethoxysilane
(TEOS, ≥99.0% Aldrich) and 3 μl of 10 mol l-1 HOAc) were added. The reaction mixture was
stirred (900 r.p.m.) overnight at room temperature and a silica shell with a thickness of 6 nm
was obtained. The particles were washed twice with ethanol, once with water and redispersed
in 1 ml ethanol. In order to obtain only single particles, the particle solution was centrifuged
for 7 min at 9390g and 500 μl of the supernatant was collected.
4.2.4 DNA recovery
The dsDNA was recovered from the encapsulated DNA/SiO2 (c ≤ 1.32 μg ml-1) by using a
1:100 diluted buffered oxide etch solution (BOE, 0.23 g of NH4FHF (pure, Merck) and 0.19 g
of NH4F (puriss, Sigma-Aldrich) in 10 ml water).
4.2.5 Digital particle PCR instrumentation and workflow
The digital particle PCR (dpPCR) was performed at low concentrations. The particle solutions
were diluted in water to a concentration of 0.4 - 13 particles per μl. 1 μl of this solution was
directly pipetted into a well of a 96-well PCR plate and dissolved with 1 μl of a 1:100 diluted
BOE solution. The other PCR reagents, 2x Taqman PCR Mastermix, MgCl 2, primers and
probe (both designed and purchased by Microsynth AG, see Table A.2.1/2 in Appendix) were
62
premixed and added to the dissolved particle solution. The composition of all PCR reagents is
shown in detail in Table A.2.2. in Appendix. Each 96-well plate column contained a negative
control, corresponding to the diluted BOE solution, to ensure that the BOE does not contain
contaminating DNA. The PCR reaction was performed with a Roche LightCycler 96 using the
following parameters: 2 min at 50 °C and 10 min at 95 °C for activation, followed by 50
cycles of a two-step thermal profile (15 s at 95°C, 60 s at 60°C).
Transmission electron microscopy investigations were carried out with a Philips CM12 (W
cathode, operated at 100 kV). Particle size distributions were evaluated by counting
100 particles of the 137 & 252 nm sized particles and 70 particles of the 67 nm particles. The
morphology and homogeneity were determined by using scanning transmission electron
microscopy (STEM) with a NovaNanoSEM 450 (FEI, operated at 30 kV). Zeta potential has
been determined with Zetasizer Nano (Malvern, Worcestershire, UK) and elemental
microanalysis was performed by using ELEMENTAR (Elementar Analysensysteme).
63
4.3 Results and Discussion
Establishing a precise particle detection tool requires access to particles of excellent
homogeneity, both in size and in shape. Previously established methods for the formation of
DNA loaded nanoparticles53,
72, 95
resulted in non-spherical agglomerated particles with
relatively broad particle size distributions. While the agglomerated particles could be used as
tracers in ecological studies, the monitoring of wastewater treatment plants and the barcoding
of oils,56-58 these materials are not fit to provide single nanoparticle based analytics. In this
study we therefore combined DNA deposition on the surface of preformed silica particles via
a layer-by-layer approach with sol-gel silica formation under acid catalysis (Figure 4.1.) to
yield homogeneous particles (see results further below and in Table 4.2.).
Figure 4.1. Synthesis of DNA/SiO2 particles using a layer-by-layer approach. First, DNA was
immobilized onto the surface of positively charged silica particles via electrostatic interaction
with the negatively charged phosphate backbone of the DNA molecules. A cationic polymer,
poly(diallyldimethylammonium chloride) (PDADMAC), was then deposited onto the adsorbed
DNA. A second polymer layer of poly(vinylpyrrolidone) (PVP) was deposited before growing
the outer silica shell by a sol-gel process, using tetraorthosilicate (TEOS) as Si source.
64
Table 4.2. Evidence of DNA encapsulation in a layer-by-layer approach.
Within the encapsulates, the DNA is protected against harsh environmental conditions,
such as high temperature, radicals or UV irradiation.121 Due to the DNA therein, the particles
can be quantified by real-time PCR (= quantitative PCR, qPCR) after the silica shell has been
removed by a fluoride comprising buffer (Figure 4.2., top schematic). To avoid false signals
in the PCR from external genomic DNA, we designed DNA amplicons, which do not overlap
with known biological DNA, and tested them for uniqueness with Basic Local Alignment
Search Tool (BLAST).100 The use of qPCR gives information on the DNA concentration by
analyzing the threshold cycle (CT), the point on the fluorescence curve at which the signal
increases above the background. By using a standard curve obtained from samples of known
concentration (straight line in Figure 4.2.) the detection of released DNA allows an indirect
measurement of silica particle concentrations down to the range of parts per billion (ppb =
microgram per liter). However, if samples of even lower particle concentrations are analyzed,
the CT values obtained increase in variability for replicates and only a part of the replicates
amplify at all (Figure 4.2., bottom right).
65
Figure 4.2. Measuring SiO2 particles via PCR analysis. After the SiO2 dissolution step with a
buffered fluoride solution (F- = 250 mg/l, pH = 4-5) the released dsDNA can be directly
amplified using PCR. In the range of higher DNA/SiO2 particle concentrations (> 10 particles
/ µl) quantitative information can be obtained by comparison with a standard curve. Below a
certain amount of DNA/SiO2 particles (< 10 particles / µl), the CT values for the same
concentration of particles increase in variability. In this range, digital particle PCR can be
used to obtain quantitative information.
From a statistical point of view, this is not unexpected: If for example the sampled volume for
a PCR reaction is 1 µl (as in our case) and the concentration of suspended, randomly
distributed particles is around 1 particle/µl, already a random error of +1 or -1 particle per
reaction can have a huge impact on the amplification outcome. Nevertheless, a PCR reaction
provides information on the particle concentration, as the probability of a reaction containing
at least one (leading to a positive amplification signal) or no particle (no amplification) is a
function of the particle concentration. Using this insight, we envisioned that a digital
quantification method of particle concentration based on binary measurements (amplification
and no amplification) obtained by end-point PCR could be used to measure single particle
concentrations. A similar digital approach in combination with PCR has already been
introduced in 1992 by Sykes et al.122 for the absolute quantification of DNA itself, and was
further developed to digital droplet PCR (ddPCR), a technology enabling the detection of rare
mutations (with a detection limit of 0.001% mutant fraction for BRAF V600E mutation).118, 123
Our method, which we term digital particle PCR (dpPCR), differentiates from ddPCR by the
66
fact that it quantifies particle concentrations (containing DNA) and can be performed with a
standard qPCR thermal cycler without additional infrastructure or reagents.
For initial tests DNA loaded SiO2 particles with a diameter of 137 nm and a narrow particle
size distribution were synthesized (see Figure 4.1.). Particle suspensions with ultra-low
concentrations were prepared by serial dilution to contain ~0.4 - 13 particles per μl (~108 fold
dilution). For every concentration 14 partitions (V = 1 μl) of the particle suspension were
distributed to a PCR plate by directly pipetting into 14 wells (Figure 4.4a). For every
concentration chosen, some of the wells contain at least one particle, while others are empty.
A volume of 1.5 μl of a diluted fluoride comprising buffer solution (= buffered oxide etch,
BOE; F- = 250 mg/l, pH = 4-5) was added to each well to dissolve the silica particles and
release the DNA. Following the addition of polymerase, deoxynucleoside triphosphates and
buffer the DNA molecules were thermally amplified via PCR to end-point (experimental
details are described in Experimental section and the in Table A2.1/2 in Appendix). As the
DNA concentrations per well and cycle were monitored by Taq-man probe fluorescence in
real-time, we were able to directly differentiate wells initially containing particles (= positive
partition) or not (negative). The results of this experiment are plotted in terms of positive
partitions over total partitions (= P/T = positive partitions over total partitions) against the
relative sample concentrations from the serial dilution (data points in Figure 4.4b). While
negative control samples did not amplify in any of the cases, for practical reasons we chose a
cutoff at a CT of 39 (see Figure 4.3. for effect of cutoff choice). The minimal effect of
verifying the cut-off can be seen by plotting the respective probability (= P/T) against the
sample dilution (Figure 4.3.). The probability was calculated by using equation 1, described
in the main text.
Figure 4.3. CT distribution of diluted samples (A) and the probability function (B) with
different cut-offs.
67
The cutoff was chosen to exclude false positive signals by dpPCR since we calculated that
above a CT value of 39 a sample would contain <1 DNA molecule, whereas a single particle
contains on average 16 DNA molecules. Even if the DNA loading per particle is unevenly
distributed, the chosen cutoff and the developed approach can handle a wide DNA loading
variation, which only requires that every particle contains more than one DNA molecule. In
case of the 67 nm particles (see detailed discussion below), we further found a highly
homogeneous distribution of CT demonstrating that every particle carries a very comparable
amount of DNA.
Figure 4.4. Principle and workflow of digital particle PCR (dpPCR). a) Partitions (1 µl) of a
particle dispersion comprising ~1 particle/µl are transferred to a 96-well PCR plate and the
particles are directly dissolved with a buffered fluoride buffer. Following DNA amplification
by PCR and online detection by fluorescence, samples containing one or more tagged
particles yield positive results, whereas those without particles result in negative responses.
b) Solutions with nominative relative particle concentrations were processed by dpPCR,
resulting in digital signals (P/T = positive over total). By fitting these signals to equation 1,
the Poisson distribution of the measurement events is demonstrated. (14 positive/negative
wells per sample, performed 5 times per concentration for determination of measurement
error).
From the assumption that the particles are uniformly distributed in the solution it
follows that the number of particles in a well is binomial or approximately Poisson
distributed. Our measurements cannot be used to determine the number of particles in a well,
but it can be used to determine if a well contains one or more particles. The expected number
of positive wells over total wells (= P/T) is equal to the probability that a well contains one or
more particles and becomes, in terms of the particle concentration θ (number particles / μl)
𝑃
−θ
𝐸 (𝑇 ) = ∑ ∞
𝑘=1 𝑋θ (𝑘) = 1 − 𝑋θ (0) = 1 − 𝑒
(1)
68
where Xθ(k) is the probability of having k particles in one partition and Xθ(0) is the
probability of having an empty partition. By comparing this theoretical result with our
experimental findings shown in Figure 4.4b, we observed a good correlation, which can be
expressed by the adjusted R-Squared = 0.99 if the experimental data is fitted to the equation
above. This demonstrates that the Poisson statistics hold for the experimental procedures
performed. This further shows that dpPCR can be used as a tool to count individual particles
at very low concentrations, without the need for a calibration curve or a correction factor.
These advantages come at the cost of the limited dynamic range of the method. As shown in
Figure 4.4b a good correlation between the measured signal (= P/T) and particle
concentration can only be found in a narrow concentration range of ~0.5 – 3 particles per
partition. This is intuitive, as at higher particle concentrations essentially all wells give
positive results, and at much lower particle concentrations essentially all wells are empty
(further statistical discussion can be found in the section A.2.4. in Appendix). This is in strong
contrast to qPCR, which has an enormous dynamic range of many orders of magnitude, but
can only differentiate sample concentrations on a logarithmic scale and always requires a
standard curve for absolute quantification. In order to determine the particle concentration of
completely uncharacterized samples, a combination of qPCR and dpPCR is useful.
The obtained absolute numbers of DNA tagged particles measured by digital particle
PCR were verified by comparing the detection of the same particle dispersions with an
established single particle analysis technique: single-particle inductively coupled plasma mass
spectrometry (sp-ICPMS).124,
125
For this the measurement system was investigated under
idealized conditions: Ultrapure water was chosen as matrix and larger, 252 nm sized particles
were used to guarantee that sp-ICPMS can be performed at sufficiently high accuracy. This
method measures the silicon content in small droplets by mass spectrometry, and very similar
to dpPCR, can discriminate between empty droplets and droplets comprising particles. This
method is highly sensitive, enables to discriminate between individual particles of a wide
range of compositions and covers a wide concentration range.124 The detailed operating
conditions, the data processing, and evaluation of the sp-ICPMS method are described in the
section A.2.3 in the Appendix. The ultra-diluted particle samples (initial concentrations
7 μg/μl; diluted > 108 fold) were measured simultaneously by dpPCR and sp-ICPMS
(Figure 4.5c).
69
Figure 4.5. Detection of DNA/SiO2 particles (d = 252 nm) in ultrapure water. a)
Transmission electron microscopy (TEM) image of DNA/SiO2 particles; scale bar: 200 nm. b)
Particle size distribution obtained by transmission electron microscopy image analysis. c)
Comparison of sp-ICPMS (black spheres) with dpPCR (colored squares); measurements in
triplicate, undiluted sample concentration c0 = 7 μg/μl. d) Distribution of CT values of the
individual wells displaying the original signals, from which the data in c) is calculated.
For the dilutions corresponding to ~1 & 0.5 particles per µl the results from both
methods corresponded well to each other: Both dilutions could also be discriminated from
each other with statistical significance (t-test). For a higher concentration (~2 particles per µl),
dpPCR yielded a significantly lower result than sp-ICPMS. This already shows the narrower
measurement range of the dpPCR method as discussed above (see Figure 4.4b). Sensitivity
and measurement range of the dpPCR method may be further increased by analyzing more
than 14 wells per sample, however it has to be noted that the reagent cost is not insignificant
at ~0.5 USD per PCR well (see discussion on accuracy versus number of wells in
Figure A.2.4. in Appendix). Overall, the results obtained by dpPCR could be directly
confirmed by sp-ICPMS and showed a similar variability as the more established method.
Although similarly accurate when within its ideal measurement range, dpPCR uses standard
infrastructure, is less complex and does not require any calibration or signal correction.
To show the flexibility of the dpPCR method in terms of particle size and
independence from dissolved, contaminating silicon, three particle dilutions in the range of
70
0.5 – 2 particles per microliter were quantified with DNA tagged SiO2 particles of 137 nm and
67 nm diameter in drinking water. The particle concentration could be quantified successfully
without any disturbance by the dissolved silicon and other molecules in drinking water
(Figure 4.6.). Under these conditions the sp-ICPMS method could not be performed as it
could not detect the smaller tagged SiO2 particles, even in ultrapure water, due to background
noise, which can be assigned to Si eroded from the ICP torch, memory effects and incomplete
particle events. For this reason the measurement results are best compared with the silica
content of the undiluted sample (from gravimetry).
Figure 4.6. Analysis of nanoparticles in drinking water a) TEM image of DNA/SiO2 particles,
scale bar: 100 nm. b)&e) Particle size distribution obtained by TEM image analysis. c)
dpPCR of DNA/SiO2 (d = 137 nm) particles in drinking water, measurements in triplicate,
undiluted sample concentration c0 = 0.8 μg/μl. d) TEM image of DNA/SiO2 particles, scale
bar: 50 nm. F) dpPCR DNA/SiO2 (d = 67 nm) particles in drinking water, measurements in
triplicate, undiluted sample concentration c0 = 0.02 μg/μl. g) In case of the 67 nm particles
the distribution of CT values can be further correlated to the expected presence of 0, 1 and
>2 particles per well from Poisson statistics (see A.2.4 in Appendix for further details).
71
Assuming spherical silica particles of a uniform size and a density of 2200 kg/m3 the
theoretical result after 108 fold dilution is in the range of the measured value (ca. factor 2,
which can be explained by uncertainty in particle size measurement, Mparticle ∝ r3). High
background concentrations of silicon and other molecules further limit the application of
elemental methods for silica particle measurements in environmental samples. For example,
drinking water already contains silicic acid at 4 ppm (parts per million, Zurich 2013), making
any comparison of dpPCR for silica with alternative methods at lower sample concentrations
nearly impossible.
To put these experimental results into perspective, Table 4.3. summarizes the different
types of particle detection methods taking into account the limit of detection and the overall
effort of the method. In comparison, the method described here gives rise to nearly
unprecedented detection limits for nanoparticles in complex matrices with relatively low
infrastructural requirements. An additional advantage is that the method results in an absolute
particle number and, therefore, does not require normalization (or background correction).
Two basic requirements are needed for successful application of the dpPCR method in
more complex media: (a) the particles have to remain individual particles in the medium. If
not, the method still measures the particles concentration (particles per ml), but no longer the
primary particle number but the aggregate number. (b) The action of the polymerase during
PCR may not be interfered by the sample medium (after 1:10 dilution in PCR preparation,
with Mastermix etc.), which is possible for a large array of nonbiological samples. Biological
samples (e.g., cell suspensions) may also be compatible with the method after the diluting-out
of interfering species. The method developed here can only detect DNA loaded nanoparticles
and is therefore only useful for detecting the flow of artificial silica nanoparticles. Future
development to expand the technique to nanoparticles of other composites or particle in
various sizes can increase the application range. Investigations of particles comprising TiO2 or
Fe2O3 loaded with DNA were already conducted in previous studies and showed
compatibility with standard PCR after dissolving the particles.56,
121
The use of sol-gel
chemistry further allows to adopt the size of particles by adding layers of silica (as done in the
preparation of the 252 nm particles).
72
Table 4.3. Comparison of particle detection methods
Method
Approximate size
range
Limit of detection
Measuring
duration
Effort
Standard particle detection methods
confocal
fluorescence
microscopy110
<10 nm
ppb-ppm
(particles tagged with 102-103 particles per
fluorescent label,
µl dried out drop a
quantum dots)
hours
50’000 – 150’000
US$, large
infrastructure
skilled operator
required
scanning electron
microscopy
(SEM)
10 to >1’000 nm108
any solid inorganic
material
ppb-ppm108
102-103 particles per
hours
150’000 – 500’000
US$, large
infrastructure
skilled operator
required
atomic force
microscopy
(AFM)
0.5 to >1’000 nm108
any solid inorganic
material
hours
20’000 – 100’000
US$, highly skilled
operator required
single-particle
inductively
coupled plasma
mass
spectrometry
(sp-ICP-MS)
strongly element
dependent
< 10 to >500 nm
(e.g. Si >100-400
nm)125
ppb-ppm108
102-103 particles per
ppt-ppb
~1-103 particles / µl
minutes to
hours
100’000 – 500’000
US$, large
infrastructure and
maintenance (e.g.
substantial argon
consumption)
Examples of recent techniques for particle detection
microchannel
resonators
100 nm Au, 1.5μm
polystyrene
nanoparticles109
<fg109
~104 particles / µl b
minutes to
hours
microfluidic
device, individually
designed equipment
whisperinggallery-mode
(WGM) sensorsc
30 nm to < 175 nm
(KCl and polystyrene
nanoparticles)d
1 pg/mm2 (for
biomolecules111)e
~103 particles / mm2
minutes
individually
designed equipment
surface plasmon
resonance
microscopy
(SPRM)c
>100 nm (SiO2,
viruses)112
0.2 fg/mm2 (for viral
particles)112
~ 1 particle / mm2
minutes
skilled operator
required
1.5 hours
15’000 – 30’000
US$; standard
qPCR machine,
benchtop
instrument
This work
Digital particle
PCR (dpPCR)
a
> 60 nm (DNA
tagged silica)
< 1 ppt = < 1 fg/µl
~ 1 particle per μl
Analysis on dried sample only with evenly distributed nanoparticles. Minimum drop volume 1µl, minimal
100 particles per sample to avoid misinterpretation of artefacts (dust/aggregation). 126 Statistically robust
quantification of particle concentration is very time consuming, because of the use or very small volumes from
dried out liquids. bInjected concentrations of particles samples were between 10 7-5*108 per ml.109 c2D
technology, measure of surface density (particles /mm2 instead of volumetric particle concentration) dUltrahighquality-factor (Q) WGA microresonators were used.127 The upper size limit of particles is imposed by the
wavelength (radius<<λ). e The throughput capacity in these devices is limited in order to preserve the original
sensitivity underlying the characteristics changes of the WGM through the interaction by nanoparticles. 10
73
These different sized particles could be used for studying and analyzing their behavior in
various fluids and mixtures and the resulting particle concentrations could be measured with
the method developed here without restriction. While the method can certainly be expanded,
the method is not able to measure/detect naturally occurring or accidentally liberated
nanoparticle flows. In spite of these constraints, we believe that the dpPCR method is most
valuable in understanding/tracing/detecting the behavior of nanoparticles-down to the level of
individual particles. Also the method is most suited to test the absolute efficiency of
nanoparticle removal techniques (e.g. filtration devices). As the method gives absolute
particle numbers without normalization, it may further be useful for the calibration/correction
of other nanoparticle measurement devices (i.e., certification of calibration dispersions).
4.4 Conclusion
In summary, this study provides a new quantification technique for measuring ultralow concentrations of tagged nanometer particles with a detection limit of < 1 particle per
microliter (i.e. < 1*10-9 μg/μl silica = < 1 ppt). dpPCR does not require a preceding
calibration for quantification and only a standard qPCR machine is needed, which is available
in many research facilities and medical laboratories. We have demonstrated that dpPCR is not
sensitive to contaminating ions and can also quantify tagged silica particles suspended in
drinking water. The sensitivity is based on the indirect measurement of the particles, which
requires the use of engineered, DNA tagged particles. Here, we used encapsulated DNA/SiO2
particles to validate our method, but the same principle can be extended to other particles. The
successful incorporation of DNA into additional inorganic nanoparticles has already been
shown in previous studies.56, 121 Engineered particles are commonly used as tagging systems
in diverse applications ranging from biological detection and imaging techniques, such as cell
labelling,6 cell tracking,5 and detection of DNA128 and proteins129 and several methods have
been proposed that use nanoparticles for the amplification of measurement signals. 130, 131 By
the use of dpPCR, the quantification of such particles on a single particle level is simplified
and will further decrease the detection limits of the particulate taggants and any measurement
derived thereof.
74
75
5. Conclusion and Outlook
76
The work presented here describes the design and optimization process of protecting DNA by
fossilization. The encapsulation process of DNA into silica nanoparticles yielded in a new
generation of protected barcodes with proven potential as tracer and taggant.
The encapsulation concept enables the protection of DNA, as sensitive chemical
species against harsh environmental conditions (e.g. elevated temperature, ROS, UV light).
Subsequent deprotection by treatment with fluoride comprising solutions allows the analysis
of DNA by standard biochemical methods: gel electrophoresis, quantitative polymerase chain
reaction (qPCR) and Sanger-Sequencing. The use of qPCR as ultrasensitive analytical method
enables the detection of DNA tagged particles with very low detection limits. This sensitivity
of PCR is used and combined with a digital approach to detect particles down to the level of
individual particles. The newly developed quantification technique of digital particle PCR
(dpPCR) provides the measurability of the absolute number of tagged nanoparticles in
drinking water.
The simple procedure of encapsulation and release of DNA was described in a stepby-step protocol, which allows a broad range of laboratories to utilize the particles in tracer
and taggant applications ranging from marking foodstuff, individual cells to animals and even
whole populations.
The fossilized DNA in silica spheres provides new material with high potential in various
applications. While the work at hand demonstrate the process of encapsulation and the
stability of DNA within the system, several studies already showed the applicability, but this
is just the beginning of the possibilities. The developed material and concept combines the
following key features: (i) DNA, as biomolecule with unlimited codes and the possibility of
ultralow and simple detection, (ii) silica particles, as non-toxic material and the associated
application for food, drugs and for in vivo and in vitro studies, (iii) nanoparticles, as one of the
current most investigated material and (iv) the general and simple protection and deprotection
system. All the above mentioned aspects can potentially be used and extended to solve
fundamental problems of today’s society.
For the successful application of the DNA encapsulated particles basic requirements are
needed: (a) the encapsulated system has to maintain its protection properties during the
applied conditions in order to protect the DNA. The encapsulating layer consists of silica,
which is generally regarded as an insoluble material, but silica can still dissolve at higher pH.
This makes the encapsulation system incompatible with strong bases or other silica etchants.
77
(b) The analysis of the encapsulated DNA is based on PCR technology. The action of the
polymerase during PCR may not be interfered by the sample medium, which is possible for a
large array of non-biological samples. Biological samples (e.g. cell suspensions) may also be
compatible with the method after diluting-out of interfering species.
Data storage
DNA is considered to be the ultimate solution for data-storage. Besides the fact that DNA is
the information carrier of all known life forms, it can store information in extreme high
density. Several studies showed the high potential of DNA as data-storage medium by
encoding i.a. books and images into the structure of DNA.39, 40, 132 To ensure the accurate read
out of the information, the DNA has to maintain its integrity. However, DNA is a sensitive
molecule and the information is lost, when the DNA is not stored under ideal conditions, such
as dry and low temperature. A feasible and successful use of DNA for storing information,
like DVDs or hard-disks requires normal storage conditions (e.g. room temperature, light).
The developed concept provides a suitable protection of the encoding information by
encapsulation the DNA into silica. Within the encapsulates the information could easily be
stored at room temperature and would even resist radical attack, UV exposure or elevated
temperature. This protection system and the tremendous decrease of prize in DNA sequencing
for encoding the information could push DNA-technology for potential data-storage
applications.
Unique labeling
Beside the use of DNA for storing information, DNA can be used as a unique barcode. The
particles act as a tag to give anything from the luxury watch to regional wine their own unique
label. The tagged particles could, therefore, be a game changer in the field of anticounterfeiting. An applied barcode system is only feasible, when the barcode maintains its
integrity and can be read-out without errors. This requirement is given by the protection of
DNA within the encapsulates. Therefore, the DNA encapsulated particles can be implemented
into any products and processed further. This implementation would allow to monitor product
streams and supply chains to provide transparency to clients and customers. The use of DNA
as barcode has an additional advantage, which is given by the ultralow detection limit based
on PCR and plays an important role in the cost of the tracing and tagging system. In order to
avoid illegal duplication of the designed encapsulated DNA tracers, additional additives such
as random DNA sequences, base-modifications or synthetic nucleic acids analogs can be
78
incorporated into the system. These added compounds would make it extremely difficult to
read-out the original DNA barcode.
Detection tool & Nanotoxicology
A unique label can not only be used for anti-counterfeit, but also be applied as detection tool
for (nano)particles. The developed method of detecting tagged particles can be used for
studying and analyzing engineered nanoparticles in order to understand their behavior and
fate in the environment and biological species. Difficult questions can be answered, such as:
How and where do nanoparticles distribute in the environment after their usage (e.g.
antiperspirant, exhaust gases)? Is the uptake of engineered nanoparticle in humans possible?
Potential impact regarding the toxicity of nanoparticles can be assessed by proving the
presence and absence of single particles in different media.
The method developed here can only detect DNA loaded silica particles and is therefore
useful for monitoring the fate of artificial silica nanoparticles. In future work, the method
could be extended to other composites or particles in various sizes to increase the range of
possible applications. Investigations of utilizing Fe2O3 particles to insert magnetic properties
to the tagging system were already conducted, as well as the use of titania as UV absorber.
The particle size could be individually designed by sol-gel chemistry. Additionally,
functionalization of the silica surface could be directly applied by using silanes with different
functional groups, such as positive charged ammonium, carboxylic acid, C6 or polyethylene
glycol (PEG).
Protection system
The general concept of protection by encapsulation can be extended to other types of
biomolecules. For instance, RNA and proteins are useful molecules with a variety of function
and applications. However, these biomolecules are extremely sensitive. For a successful and
reliable use in downstream applications it is required to store the molecules properly without
damage. Further applications of the protection system could be in preservation of blood or
other medical samples. In the case that such samples cannot be stored under optimal
conditions, such as in very hot regions of this world, new and robust protection and
deprotection are needed in order to guarantee an adequate quality after storage and shipment.
79
Appendix A: Supplementary material
80
A.1
A.1.1 t-test
Table A.1.1. Output data of a one sided unpaired two-sample t-test using Origin 8.6 on Phred
quality data of sequencing data.
Descriptive Statistics
N
Mean
SD
SEM
DNA
DNA in SiO2/TiO2 particles
(UV-C treated)
17
33.1765
9.53438
2.31243
17
44.8824
-11.706
8.99918
2.18262
Difference
t-Test Statistics
t Statistic
DF
Prob>t
Equal Variance Assumed
Equal Variance NOT
Assumed
-3.68132
32
0.99958
-3.68132
31.89379
0.99957
A.1.2 Control experiment of radical treated free DNA
To show the generation of free radicals and the associated degradation of DNA within our
designed assay, we also treated free DNA as a reference. It was treated with highly aggressive
heavy metal and hydrogen peroxide containing solutions which induce the formation of
reactive oxygen species (ROS). Under the conditions applied (230 μM CuCl2, 6.6 mM H2O2,
1.3 mM ascorbic acid) the free DNA was destroyed completely (Table A.1.2.), which proves
the effectiveness of our radical stability test.
As a control experiment, Ethylenediaminetetraacetic acid (EDTA), complexing agent was
added before the radical treatment. EDTA can generate a stable complex with Cu(I) and
inhibits the redox process with H2O2 and Cu(I) and therefore the formation of free radicals.
81
Table A.1.2. Control experiment of radical treated free DNA
Sample
Concentration (μg ml-1)
Free DNA
3.1
Free DNA + EDTA + radical treatment
3.0
Free DNA + radical treatment
< 0.0005*
star (*) indicates data below detection limit (< 0.5 ng ml-1)
A.1.3 Calculation of attenuation coefficients
The attenuation coefficient (βλ) is the sum of the absorption coefficient (κλ) and the scattering
coefficient (σλ).
𝛽𝜆 = 𝜅𝜆 + 𝜎𝜆
Attenuation coefficient of TiO2/SiO2/DNA particles measured by DNA damage:
Figure A.1.1.
Approximation of light attenuation for DNA encapsulated TiO2 coated
particles
Calculation of the attenuation coefficient of the DNA/SiO2/TiO2 particles in UV light (254
nm), assuming a linear dependency of DNA damage of light intensity and a titania layer
thickness of L = 20 *10-7cm. DNA protected in TiO2/SiO2 was determined to be 42 times
more resistant to UV-C light than the unprotected DNA.
𝐼
1
−1
=
= 𝑒 −𝛽𝜆254,𝐷𝑁𝐴 ×𝐿(𝑐𝑚 )
𝐼0
42
𝜷𝟐𝟓𝟒,𝑫𝑵𝑨 = 𝟏. 𝟖 × 𝟏𝟎𝟔 𝒄𝒎−𝟏
82
Attenuation coefficient of DNA/SiO2/TiO2 particles in water by photometer:
The attenuation coefficient can be obtained by conventional spectrophotometric
measurements as absorbance readings.
Figure A.1.2. Spectrophotometric measurement of DNA/SiO2/TiO2 particles
The experimental value of attenuation from particle suspension was obtained by photometer
(PM) (Nanodrop 2000C spectrometer, Thermo Scientific) with A254= 0.01 and a cell path
length of L=1 cm.
𝛽254,𝑃𝑀 (𝑐𝑚−1 ) =
2.303 𝐴254
= 0.023𝑐𝑚−1
𝐿 (𝑐𝑚)
Accounting for the concentration of TiO2 with c = 2 *10-7 g cm-3 and a density of ρ = 4.23 g
cm-3
∗
(𝑐𝑚2 𝑔−1 )
𝛽254,𝑃𝑀
𝛽254,𝑃𝑀 (𝑐𝑚−1 )
=
= 115 000 𝑐𝑚2 𝑔−1
𝑐(𝑔 𝑐𝑚−3 )
∗
(𝑐𝑚2 𝑔−1 ) × 𝜌𝑇𝑖𝑂2 (𝑔 𝑐𝑚−3 ) = 486 450 𝑐𝑚−1 ≈ 𝟎. 𝟓 ∗ 𝟏𝟎𝟔 𝒄𝒎−𝟏
𝛽254,𝑃𝑀 (𝑐𝑚−1 ) = 𝛽254,𝑃𝑀
83
A.2
A.2.1 Encapsulate characterization
Figure A.2.1. TEM and STEM images of the three different sized DNA/SiO2 particles
depicting the size homogeneity of the particles.
A2.2. DNA analysis
Table A.2.1. Sequences of primers and probe.
For 137 nm
and 252 nm
DNA/SiO2
particles
For 67 nm
DNA/SiO2
particles
Primer/
probe
Forward
Sequence (5'- 3')
CGTGGAAGGTAACAGCAC
Length
(bp)
18
Concentration
(nM)
450
Reverse
CCACTTGCTAACCCCATTG
19
450
Probe
(TaqMan)
TGCGAGCCTAATGTGCCGTCT
21
125
Forward
CACGAGGTAAATATGGGACG
20
450
Reverse
TGTGCTACCAATCAACAGTTAA
22
450
Probe
CGACCTGGCTCCTGGCGTTCTAC 23
125
(TaqMan)
84
Table A.2.2. Composition of PCR reagents.
Reagent
Volume (μl)
2x Taqman-Universal PCR Mastermix (life technologies, cat. 4304437
6.25
25 mM MgCl2
0.75
water
0.5
5x Primer/Probemix
2.5
Sample (particle solution + BOE)
2.5 (1+1.5)
Total
12.5
PCR raw data of 137 nm DNA/SiO2 particles and cut-off
For the data analysis, two sample columns of the 96-well PCR plate containing two negative
controls (= 14 samples) were defined as one set of data. For describing the probability
function of the 137 nm encapsulated DNA/SiO2 particle solution at extreme low
concentration, one data set was measured for each concentrations between 0.4 – 13 particles
per μl. A cut-off of a CT value of 39 was determined.
Table A.2.3. CT values of the diluted 137 nm samples
Relative sample
dilution
Relative sample
concentration
CT
one data set of 14
samples
Positive partitions (cutoff of 39)
1*10-
3.33*10
1.43*10
1.11*10
1.0*10-
5.0*10-
3.33*10
7
-8
-8
-8
8
9
-9
1
0.33
0.14
0.11
0.1
0.05
0.03
26.93
29.25
27.92
29.46
28.48
27.34
32.26
32.75
27
30.03
27.47
28.45
32.26
30.66
28.92
27.88
28.48
29.93
30.39
37.9
29.14
31.7
30.26
31.4
30.39
31.24
31.39
31.47
31.58
31.91
33.3
28.83
34.81
33.22
29.73
35.38
32.74
31.47
30.85
39.86
35.73
50
28.75
33.24
31.77
35
34.02
33
>50
>50
31.22
30.53
33.41
31.46
36.67
40.27
30.01
34.25
>50
29.67
35.21
31.3
31.67
>50
30.88
31.41
36.04
32.82
39.22
46.63
37.13
50
39.38
32.77
31.51
37
31.87
50
39.15
50
50
33.76
30.44
31.89
34.3
>50
>50
36.9
>50
>50
>50
43.77
29.74
>50
>50
>50
30.52
>50
14
14
12
11
10
8
4
85
A.2.3 Particle counting by sp-ICPMS
To count the number of the three diluted samples of 252 nm encapsulated DNA/SiO2 particles
(2/1/0.5·10-8) in ultrapure water, single particle - sector field - inductively coupled plasma
mass spectroscopy (sp-SF-ICPMS, Element XR, Thermo-Finnigan, Bremen, Germany) with a
quartz microconcentric nebulizer (MicroMist, Glass Expansion Melbourne Australia,
100 μl/min nominal uptake) and cyclonic quartz spray chamber was used. The ICPMS was
operated at 3’000 (m/Δm) mass resolving power to separate
28
Si from adjacent polyatomic
background ions (mainly N2+, CO+). Data acquisition was then carried out by so-called single
particle ICPMS mode.133-135 The instrument was set to rapidly scan a mass window near the
maximum of the mass peak a rate of 5 ms/point in order to maximize the signal/background
ratio for individual particle events. One may note that the measurement mode records signals
over a fraction of the mass spectral peak instead of the peak maximum only. This mode
increases the intensity distribution of the ion signals for a given particle size distribution to
some extent but achieves much higher efficiency for determining particle number
concentrations.
Operating conditions
The ICP operating conditions where optimized in order to achieve highest possible signal
background ratios in the nanoparticle detection experiments. Rf-power, intermediate and
carrier gas flow rates were optimized using SiO2 particles (Microparticles, Berlin, Germany)
of 335 nm diameter and the optimized operating conditions are listed in Table A.2.4.
Table A.2.4. Operation condition of sp-ICPMS.
Operating conditions
ICP RF Power
Plasma Gas Flow (Ar)
Auxiliary Gas Flow (Ar)
Sample Gas Flow
Resolution Mode
Integration Time
Mass Window
Data points per Run
Settling Time
Scan Type
Detector Mode
Runs
Passes
Measurement Duration
950 W
16 L min‐1
0.6 L min‐1
1.2 L min‐1
Medium (m/Δm=4’000)
5 ms
2%
20
1 ms
E-scan
Pulse Counting
20’000
1
35 min
86
Sample preparation
Solutions containing different particle concentrations (~600 [particle/ml]; ~1200 [particle/ml];
~2500 [particle/ml]; ~4200 [particle/ml], see Table A.2.5.) of silica particle were analyzed.
To prepare this series a concentrated suspension of particles (3.71012 [particles/ml]) was
sonicated for 2-3 minutes and diluted to the different concentrations with purified water.
Three different solutions containing an unknown amount of freshly synthetized DNA/SiO2
particles were prepared with the same procedure.
Data processing and evaluation
In this work the transport efficiency was determined via the waste collection method.136-139
The sample and the waste collected were weighed before and after every measurement to
determine the total amount of sample reaching the plasma.
The time-resolved signal intensities were converted to ion counts by multiplying the measured
intensity (in cps) with the integration time, then sorted into 10 counts wide bins and finally
plotted as an intensity distribution. A Gaussian function was used to fit the corresponding
particle mass distribution and the background intensities arising from dissolved Si and the
instrumental background. The total number of detected particles was then obtained by adding
all events under the nanoparticle mass distribution peak (Figure A.2.2.), while excluding the
background contributions. The range summed was chosen manually. To determine particle
number concentration (PNC), the counted particles in a measurement were divided by the
introduced liquid volume.
Figure A.2.2. Typical intensity distribution from sp-ICPMS for a nanoparticle suspension
DNA-loaded SiO2 (2·10-8). Red line indicates a Gaussian fit to the distribution. The threshold
value indicates the start point for summing up particle events.
87
The fraction of particles detected is only about 29 %, because nanoparticles are not
detected during the MS settling- and data transfer times and when incompletely sampled by
the mass spectrometer.
Based on the calibration, the PNC in the unknown samples was evaluated and the
results are listed in Table A.2.5. Uncertainty of the PNC was evaluated taking into account
the uncertainty from the replicate measurements and the uncertainty of the regression.
Figure A.2.3. Calibration curve used to quantify synthesized DNA/SiO2 particles, black
points are represent the external standards, red point indicate the three diluted samples
(2/1/0.5·10-8).
Table A.2.5. Amount of nanoparticle calculated based on external calibration (Figure A.2.3).
0.5·10-8
Detected [particle/ml]
234±3
Sample concentration [particle/ml]
769±19
1·10-8
462±37
2·10-8
767±52
1513±251 2505±353
A.2.4 Statistical estimation of particle concentration
The idea is to measure concentration from binary measurements by taking tiny fractions of the
solution and identifying whether this tiny fraction of the solution contains a particle or not. By
taking many of those measurements, we can obtain an estimate of the particle concentration in
the solution. Specifically, we are given a solution with particle concentration θ (in number
88
particles/μl) that we wish to estimate. The amount of the solution is m*μl. To measure
concentration, we take T (in our experiments we chose T = 14) drops of 1 μl, put it in a well,
and measure whether the well contains a particle or not.
We next explain that the number of points in each well is approximately Poisson distributed.
Consider the ith well. The total number of particles in the solution is θm. We assume that the
particles in the solution are uniformly distributed, therefore the probability that a given
particle is in the ith well is 1/m. The number of particles in the ith well, denoted by Yi, is
therefore binomial distributed with coefficients p = 1/m, n = θm, i.e., the probability that the
ith well contains k particles is
1 𝑘
1
P [Y𝑖 = k] = (𝜃𝑚
) (𝑚) (1 − 𝑚)𝜃𝑚−𝑘 .
𝑘
Since n = θm is large (>> 100) and p = 1/m is small (p < 1/200) the binomial distribution is
very well approximated by a Poisson distribution with parameter λ = np = θ, i.e.,
P [Y𝑖 = k] ≈
𝜃𝑘
𝑘!
𝑒 −𝜃 .
(1)
In the following we assume that the Yi are independent, i.e., the number of particles in the ith
well is independent of the number of particles in the other wells. This is a reasonable
assumption, since we only take T = 14 drops, and the total amount of the solution is large
(200 – 1’000 μl), therefore taking all the measurements does not change the number of
particles in the solution significantly.
In our measurements, we do not measure the number of particles in the ith well Yi, instead we
measure whether the ith well contains a particle or not. Specifically, we observe the binary
random variable:
𝑋𝑖 = {
1,
0,
the ith well contains a particle, 𝑖. 𝑒. , 𝑌𝑖 > 0
the ith well does not contain a particle, 𝑖. 𝑒. , 𝑌𝑖 = 0 .
The probability that the ith well contains a particle is determined by the concentration θ as
follows. The probability that a given particle is not in the ith well is 1 − 1/m, therefore the
probability that none of the mθ particles is in the ith well is
1
P [X𝑖 = 0] = (1 − 𝑚)𝜃𝑚 ≈ 𝑒 −𝜃 .
89
The approximation above is essentially exact for practical purposes if m is large (here m is
large, specifically m = 200, ..., 1’000). Note that we could have obtained this probability also
from the Poisson approximation in (1) by noting that P [Yi = 0] = e−θ.
Our goal is to estimate the concentration θ from the random observations X1, ..., XT. To this
end, we consider the fraction of positive wells, defined as P/T, where P is the number of
positive wells, i.e., 𝑃 = ∑𝑇𝑖=1 𝑋𝑖 .
The random variable P/T
The random variable P is binomial distributed, thus we have:
P[
𝑃
𝑘
𝑇
= ] = [𝑃 = k] = ( ) (1 − 𝑒 −𝜃 )𝑘 𝑒 −𝜃(𝑇−𝑘) .
𝑇
𝑇
𝑘
The expectation of the random variable P/T is
Е[𝑃/T] = 1 − 𝑒 −𝜃
and its variance is
1
Var(𝑃/T) = 𝑇 𝑒 −𝜃 (1 − 𝑒 −𝜃 ) .
Estimation of the concentration from P
We next discuss the estimation of the concentration θ based on the measurements X1, ..., XT .
Our intuition is that estimation of θ in general improves in T, and that we can estimate θ from
a reasonable number of measurements T only if θ is not too small or too large. Specifically, if
θ is too small, then the probability that all wells do not contain a particle is large (recall that
the probability of the ith containing a particle is 1 − e−θ), in which case we do not obtain much
information on the exact value of θ. Similarly, if θ is large, then the probability that all wells
contain a particle is large, and we do not obtain much information on the exact value of θ
either.
We formally estimate the concentration as follows. A common approach to estimate the
parameter of a statistical model is maximum likelihood estimation. The maximum likelihood
estimator for θ is log(T /(T − P )). However, the maximum likelihood estimate in its original
form is not sensible here, since for P = 0, the estimate is (i.e. log(0)) not defined. However,
we can change the maximum likelihood estimate slightly in order to obtain a sensible estimate
of θ. Specifically we consider the following estimator of θ:
90
𝑇
log(𝑇−𝑃), if 𝑃 < 𝑇
𝜃̂(𝑃) = {
log(𝑇 + 1) , if 𝑃 = 𝑇 .
Note that the estimator θ̂ is biased, i.e., its expectation is not equal to θ. However, this is
unavoidable, since no unbiased estimator for θ exists.
Properties of the estimator 𝜃̂
In order to asses how the concentration θ and the number of measurements, i.e., number of
wells, influences the quality of our estimate of the concentration θ, we consider the rootmean-square deviation (RMSD) of the relative error in concentration, defined as
̂
2
𝜃−𝜃
𝑅𝑀𝑆𝐷(𝜃̂) = √Е [ ( 𝜃 ) ] .
The RMSD is the sample standard deviation of the relative differences between predicted
values and observed values. The RMSD is plotted in Figure 1 as a function of θ and T. As we
can see from the figure, the RMSD in general improves in T.
Figure A.2.4. RMSD as a function of θ for different values T
91
References
1.
Chaudhry, P.; Zimmerman, A., The Global Growth of Counterfeit Trade. In
Protecting Your Intellectual Property Rights, Springer New York 2013; pp 7-31.
2.
Deisingh, A. K., Pharmaceutical Counterfeiting. Analyst 2005, 130, 271-279.
3.
Stark, W. J.; Stoessel, P. R.; Wohlleben, W.; Hafner, A., Industrial Applications of
Nanoparticles. Chem. Soc. Rev. 2015, 44, 5793-5805.
4.
De, M.; Ghosh, P. S.; Rotello, V. M., Applications of Nanoparticles in Biology. Adv.
Mater. 2008, 20, 4225-4241.
5.
Gao, X. H.; Cui, Y. Y.; Levenson, R. M.; Chung, L. W. K.; Nie, S. M., In Vivo
Cancer Targeting and Imaging with Semiconductor Quantum Dots. Nat. Biotechnol.
2004, 22, 969-976.
6.
Bhirde, A.; Xie, J.; Swierczewska, M.; Chen, X. Y., Nanoparticles for Cell Labeling.
Nanoscale 2011, 3, 142-153.
7.
Rosi, N. L.; Mirkin, C. A., Nanostructures in Biodiagnostics. Chem. Rev. 2005, 105,
1547-1562.
8.
Jain, R. K.; Stylianopoulos, T., Delivering Nanomedicine to Solid Tumors. Nat. Rev.
Clin. Oncol. 2010, 7, 653-664.
9.
Mura, S.; Greppi, G.; Irudayaraj, J., Latest Developments of Nanotoxicology in
Plants. In Nanotechnology and Plant Sciences, Siddiqui, M. H.; Al-Whaibi, M. H.;
Mohammad, F., Springer International Publishing 2015; pp 125-151.
10.
Yurt, A.; Daaboul, G. G.; Connor, J. H.; Goldberg, B. B.; Uenlue, M. S., Single
Nanoparticle Detectors for Biological Applications. Nanoscale 2012, 4, 715-726.
11.
Finkel, N. H.; Lou, X.; Wang, C.; He, L., Barcoding the Microworld. Anal. Chem.
2004, 76, 352-359.
12.
Braeckmans, K.; De Smedt, S. C.; Leblans, M.; Pauwels, R.; Demeester, J.,
Encoding Microcarriers: Present and Future Technologies. Nat. Rev. Drug Discov.
2002, 1, 447-456.
13.
Simons, R. Microparticle, in Particular Microparticle for Tamper-Proof Marking of
Products. EP2688011, 2014.
14.
Keating, C. D.; Natan, M. J., Striped Metal Nanowires as Building Blocks and
Optical Tags. Adv. Mater. 2003, 15, 451-454.
15.
Braeckmans, K.; De Smedt, S. C.; Roelant, C.; Leblans, M.; Pauwels, R.; Demeester,
J., Encoding Microcarriers by Spatial Selective Photobleaching. Nat. Mater. 2003, 2,
169-173.
92
16.
Simons Security Systems (3S) GmbH, SECUTAG®- legally binding counterfeit
protection.
17.
Reiss, B. D.; Freeman, R. G.; Walton, I. D.; Norton, S. M.; Smith, P. C.; Stonas, W.
G.; Keating, C. D.; Natan, M. J., Electrochemical Synthesis and Optical Readout of
Striped Metal Rods with Submicron Features. J. Electroanal. Chem. 2002, 522, 95103.
18.
Egner, B. J.; Rana, S.; Smith, H.; Bouloc, N.; Frey, J. G.; Brocklesby, W. S.;
Bradley, M., Tagging in Combinatorial Chemistry: The Use of Coloured and
Fluorescent Beads. Chem. Commun. 1997, 8, 735-736.
19.
Medintz, I. L.; Uyeda, H. T.; Goldman, E. R.; Mattoussi, H., Quantum Dot
Bioconjugates for Imaging, Labelling and Sensing. Nat. Mater. 2005, 4, 435-446.
20.
Resch-Genger, U.; Grabolle, M.; Cavaliere-Jaricot, S.; Nitschke, R.; Nann, T.,
Quantum Dots Versus Organic Dyes as Fluorescent Labels. Nat. Methods 2008, 5,
763-775.
21.
Li, Y.; Liu, E. C. Y.; Pickett, N.; Skabara, P. J.; Cummins, S. S.; Ryley, S.;
Sutherland, A. J.; O'Brien, P., Synthesis and Characterization of CdS Quantum Dots
in Polystyrene Microbeads. J. Mater. Chem. 2005, 15, 1238-1243.
22.
Gao, X. H.; Nie, S. M., Quantum Dot-Encoded Mesoporous Beads with High
Brightness and Uniformity: Rapid Readout Using Flow Cytometry. Anal. Chem.
2004, 76, 2406-2410.
23.
Han, M. Y.; Gao, X. H.; Su, J. Z.; Nie, S., Quantum-Dot-Tagged Microbeads for
Multiplexed Optical Coding of Biomolecules. Nat. Biotechnol. 2001, 19, 631-635.
24.
Hu, S. H.; Gao, X., Stable Encapsulation of Quantum Dot Barcodes with Silica
Shells. Adv. Funct. Mater. 2010, 20, 3721-3726.
25.
Beaurepaire, E.; Buissette, V.; Sauviat, M. P.; Giaume, D.; Lahlil, K.; Mercuri, A.;
Casanova, D.; Huignard, A.; Martin, J. L.; Gacoin, T., et al., Functionalized
Fluorescent Oxide Nanoparticles: Artificial Toxins for Sodium Channel Targeting
and Imaging at the Single-Molecule Level. Nano Letters 2004, 4, 2079-2083.
26.
Mialon, G.; Poggi, M.; Casanova, D.; Nguyen, T.-L.; Tuerkcan, S.; Alexandrou, A.;
Gacoin, T.; Boilot, J.-P., Luminescent Oxide Nanoparticles with Enhanced Optical
Properties. J. Lumines. 2009, 129, 1706-1710.
27.
Bouzigues, C.; Gacoin, T.; Alexandrou, A., Biological Applications of Rare-Earth
Based Nanoparticles. ACS Nano 2011, 5, 8488-8505.
28.
Dejneka, M. J.; Streltsov, A.; Pal, S.; Frutos, A. G.; Powell, C. L.; Yost, K.; Yuen, P.
K.; Muller, U.; Lahiri, J., Rare Earth-Doped Glass Microbarcodes. Proc. Natl. Acad.
Sci. U. S. A. 2003, 100, 389-393.
29.
Battersby, B. J.; Lawrie, G. A.; Trau, M., Optical Encoding of Microbeads for Gene
Screening: Alternatives to Microarrays. Drug Discov. Today 2001, 6, S19-S26.
93
30.
Lutz, J.-F., Polymer Chemistry: A Controlled Sequence of Events. Nat. Chem. 2010,
2, 84-85.
31.
Ohlmeyer, M. H. J.; Swanson, R. N.; Dillard, L. W.; Reader, J. C.; Asouline, G.;
Kobayashi, R.; Wigler, M.; Still, W. C., Complex Synthetic Chemical Libraries
Indexed with Molecular Tags. Proc. Natl. Acad. Sci. U. S. A. 1993, 90, 10922-10926.
32.
Nikolaiev, V.; Stierandova, A.; Krchnak, V.; Seligmann, B.; Lam, K. S.; Salmon, S.
E.; Lebl, M., Peptide-Encoding for Structure Determination of Nanosequenceable
Polymers within Libraries Synthesized and Tested on Solid-Phase Supports. Peptide
Res. 1993, 6, 161-170.
33.
Needels, M. C.; Jones, D. G.; Tate, E. H.; Heinkel, G. L.; Kochersperger, L. M.;
Dower, W. J.; Barrett, R. W.; Gallop, M. A., Generation and Screening of an
Oligonucleotide-Encoded Synthetic Peptide Library. Proc. Natl. Acad. Sci. U. S. A.
1993, 90, 10700-10704.
34.
Sanger, F.; Nicklen, S.; Coulson, A. R., DNA Sequencing with Chain-Terminating
Inhibitors Proc. Natl. Acad. Sci. U. S. A. 1977, 74, 5463-5467.
35.
Mardis, E. R., Next-Generation DNA Sequencing Methods. Annu. Rev. Genomics
Hum. Genet. 2008, 9, 387-402.
36.
Watson, J. D.; Crick, F. H. C., Molecular Structure of Nucleic Acids - A Sturcture
for Deoxyribose Nucleic Acid. Nature 1953, 171, 737-738.
37.
Hayden, E. C., The $1,000 Genome. Nature 2014, 507, 294-295.
38.
Bancroft, C.; Bowler, T.; Bloom, B.; Clelland, C. T., Long-Term Storage of
Information in DNA. Science 2001, 293, 1763-1765.
39.
Goldman, N.; Bertone, P.; Chen, S. Y.; Dessimoz, C.; LeProust, E. M.; Sipos, B.;
Birney, E., Towards Practical, High-Capacity, Low-Maintenance Information
Storage in Synthesized DNA. Nature 2013, 494, 77-80.
40.
Church, G. M.; Gao, Y.; Kosuri, S., Next-Generation Digital Information Storage in
DNA. Science 2012, 337, 1628-1628.
41.
Elbaz, J.; Lioubashevski, O.; Wang, F. A.; Remacle, F.; Levine, R. D.; Willner, I.,
DNA Computing Circuits Using Libraries of DNAzyme Subunits. Nat. Nanotechnol.
2010, 5, 417-422.
42.
Choy, J. H.; Oh, J. M.; Park, M.; Sohn, K. M.; Kim, J. W., Inorganic-Biomolecular
Hybrid Nanomaterials as a Genetic Molecular Code System. Adv. Mater. 2004, 16,
1181-1184.
43.
Park, D. H.; Han, C. J.; Shul, Y. G.; Choy, J. H., Avatar DNA Nanohybrid System in
Chip-on-a-Phone. Sci. Rep. 2014, 4, 1-6.
44.
Jaime, J. C.; Sabagh, J. C. V.; Simonetta, R. A. Labeling of Objects to be Identified
Consisting of at Least One DNA Fragment. EP 1384790, 2004.
94
45.
Choy, J. H.; Kwak, S. Y.; Park, J. S.; Jeong, Y. J.; Portier, J., Intercalative
Nanohybrids of Nucleoside Monophosphates and DNA in Layered Metal Hydroxide.
J. Am. Chem. Soc. 1999, 121, 1399-1400.
46.
Nelson, M.; Chang, D., Counterfeit Pharmaceuticals: A Worldwide Problem.
Trademark Rep. 2006, 96, 1068-1100.
47.
Casey, M. G.; Isolini, D.; Amrein, R.; Wechsler, D.; Berthoud, H., Naturally
Occurring Genetic Markers in Lactobacilli and their Use to Verify the Authenticity
of Swiss Emmental PDO Cheese. Dairy Sci. Technol. 2008, 88, 457-466.
48.
Lindahl, T., Instability and Decay of the Primary Structure of DNA. Nature 1993,
362, 709-715.
49.
Oskam, C. L.; Haile, J.; McLay, E.; Rigby, P.; Allentoft, M. E.; Olsen, M. E.;
Bengtsson, C.; Miller, G. H.; Schwenninger, J. L.; Jacomb, C., et al., Fossil Avian
Eggshell Preserves Ancient DNA. Proc. R. Soc. B-Biol. Sci. 2010, 277, 1991-2000.
50.
Setlow, P., I Will Survive: DNA Protection in Bacterial Spores. Trends Microbiol.
2007, 15, 172-180.
51.
Meyer, M.; Fu, Q.; Aximu-Petri, A.; Glocke, I.; Nickel, B.; Arsuaga, J.-L.; Martinez,
I.; Gracia, A.; de Castro, J. M. B.; Carbonell, E., et al., A Mitochondrial Genome
Sequence of a Hominin from Sima de los Huesos. Nature 2014, 505, 403-406.
52.
Paunescu, D.; Fuhrer, R.; Grass, R. N., Protection and Deprotection of DNA - High
Temperature Stability of Nucleic Acid Barcodes for Polymer Labeling. Angew.
Chem. Int. Ed. 2013, 52, 4269-4272.
53.
Paunescu, D.; Puddu, M.; Soellner, J. O. B.; Stoessel, P. R.; Grass, R. N., Reversible
DNA Encapsulation in Silica to Produce ROS-Resistant and Heat-Resistant Synthetic
DNA 'Fossils'. Nat. Protoc. 2013, 8, 2440-2448.
54.
Stober, W.; Fink, A.; Bohn, E., Controlled Growth of Monodisperse Silica Spheres in
Micron Size Range. J. Colloid Interface Sci. 1968, 26, 62-69.
55.
Bloch, M. S.; Paunescu, D.; Stoessel, P. R.; Mora, C. A.; Stark, W. J.; Grass, R. N.,
Labeling Milk along Its Production Chain with DNA Encapsulated in Silica. J. Agric.
Food Chem. 2014, 62, 10615-10620.
56.
Puddu, M.; Paunescu, D.; Stark, W. J.; Grass, R. N., Magnetically Recoverable,
Thermostable, Hydrophobic DNA/Silica Encapsulates and Their Application as
Invisible Oil Tags. ACS Nano 2014, 8, 2677-2685.
57.
Mora, C. A.; Paunescu, D.; Grass, R. N.; Stark, W. J., Silica Particles with
Encapsulated DNA as Trophic Tracers. Mol. Ecol. Resour. 2015, 15, 231-241.
58.
Grass, R. N.; Schälchli, J.; Paunescu, D.; Soellner, J. O.; Kaegi, R.; Stark, W. J.,
Tracking Trace Amounts of Submicrometer Silica Particles in Wastewaters and
Activated Sludge Using Silica-Encapsulated DNA Barcodes. Environ. Sci. Technol.
Lett. 2014, 1, 484-489.
95
59.
Hoop, M.; Paunescu, D.; Stoessel, P. R.; Eichenseher, F.; Stark, W. J.; Grass, R. N.,
PCR Quantification of SiO2 Particle Uptake in Cells in the ppb and ppm Range via
Silica Encapsulated DNA Barcodes. Chem. Commun. 2014, 10707-10709.
60.
Clelland, C. T.; Risca, V.; Bancroft, C., Hiding Messages in DNA Microdots. Nature
1999, 399, 533-534.
61.
Kedes, L.; Liu, E. T., The Archon Genomics X Prize for Whole Human Genome
Sequencing. Nat. Genet. 2010, 42, 917-918.
62.
Pinheiro, A. V.; Han, D.; Shih, W. M.; Yan, H., Challenges and Opportunities for
Structural DNA Nanotechnology. Nat. Nanotechnol. 2011, 6, 763-772.
63.
Auyeung, E.; Macfarlane, R. J.; Choi, C. H. J.; Cutler, J. I.; Mirkin, C. A.,
Transitioning DNA-Engineered Nanoparticle Superlattices from Solution to the Solid
State. Adv. Mater. 2012, 24, 5181-5186.
64.
Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J., A DNA-based Method
for Rationally Assembling Nanoparticles into Macroscopic Materials. Nature 1996,
382, 607-609.
65.
Setlow, P., Spores of Bacillus Subtilis: Their Resistance to and Killing by Radiation,
Heat and Chemicals. J. Appl. Microbiol. 2006, 101, 514-525.
66.
Burgoyne, L. A. Solid Medium and Method for DNA Storage. US5496562, 1988.
67.
Taylor, D. J.; Finston, T. L.; Nebert, P. D. N., The 15-Percent Solution for
Preservation Trends. Ecol. Evol. 1994, 9, 230-230.
68.
Yang, H.; Zheng, K.; Zhang, Z.; Shi, W.; Jing, S.; Wang, L.; Zheng, W.; Zhao, D.;
Xu, J.; Zhang, P., Adsorption and Protection of Plasmid DNA on Mesoporous Silica
Nanoparticles Modified with Various Amounts of Organosilane. J. Colloid Interface
Sci. 2012, 369, 317-322.
69.
Kapusuz, D.; Durucan, C., Synthesis of DNA-Encapsulated Silica Elaborated by SolGel Routes. J. Mater. Res. 2013, 28, 175-184.
70.
Pierre, A.; Bonnet, J.; Vekris, A.; Portier, J., Encapsulation of Deoxyribonucleic
Acid Molecules in Silica and Hybrid Organic-Silica Gels. J. Mater. Sci. Mater. Med.
2001, 12, 51-55.
71.
Aruoma, O. I.; Halliwell, B.; Gajewski, E.; Dizdaroglu, M., Copper-Ion-Dependent
Damage to the Bases in DNA in the Presence of Hydrogen-Peroxide. Biochem. J.
1991, 273, 601-604.
72.
Jin, C.; Han, L.; Che, S., Synthesis of a DNA-Silica Complex with Rare TwoDimensional Square p4 mm Symmetry. Angew. Chem. Int. Ed. 2009, 48, 9268-9272.
73.
Numata, M.; Sugiyasu, K.; Hasegawa, T.; Shinkai, S., Sol-Gel Reaction using DNA
as a Template: An Attempt Toward Transcription of DNA into Inorganic Materials.
Angew. Chem. Int. Ed. 2004, 43, 3279-3283.
96
74.
Scalzo, J. A.; Blume-Odom, C. M., Hydrofluoric Acid and Other Fluorides. In
Haddad and Winchester's Clinical Management of Poisoning and Drug Overdose,
Shannon, M. W.; Borron, S. W.; Burns, M., Elsevier Science Publishing Company,
Inc 2007; pp 1323 - 1335.
75.
Mullins, M. E.; Warden, C. R.; Barnum, D. W., Pediatric Death and FluorideContaining Wheel Cleaner. Ann. Emerg. Med. 1998, 31, 524-525.
76.
Featherstone, J. D. B., The Science and Practice of Caries Prevention. J. Am. Dent.
Assoc. 2000, 131, 887-899.
77.
Klasner, A. E.; Scalzo, A. J.; Blume, C.; Johnson, P.; Thompson, M. W., Marked
Hypocalcemia and Ventricular Fibrillation in Two Pediatric Patients Exposed to a
Fluoride-Containing Wheel Cleaner. Ann. Emerg. Med. 1996, 28, 713-718.
78.
Breaker, R. R., DNA Enzymes. Nat. Biotechnol. 1997, 15, 427-431.
79.
Peracchi, A., DNA Catalysis: Potential, Limitations, Open Questions. ChemBioChem
2005, 6, 1316-1322.
80.
Seeman, N. C., DNA in a Material World. Nature 2003, 421, 427-431.
81.
Simmel, F. C.; Dittmer, W. U., DNA Nanodevices. Small 2005, 1, 284-299.
82.
Ezziane, Z., DNA Computing: Applications and Challenges. Nanotechnology 2006,
17, 27-39.
83.
Mora, C. A.; Paunescu, D.; Grass, R. N.; Stark, W. J., Silica Particles with
Encapsulated DNA as Trophic Tracers. Mol. Ecol. Resour. 2014, 15, 231-241.
84.
Lindahl, T.; Wood, R. D., Quality Control by DNA Repair. Science 1999, 286, 18971905.
85.
Kuluncsics, Z.; Perdiz, D.; Brulay, E.; Muel, B.; Sage, E., Wavelength Dependence
of Ultraviolet-Induced DNA Damage Distribution: Involvement of Direct or Indirect
Mechanisms and Possible Artefacts. J. Photochem. Photobiol. B-Biol. 1999, 49, 7180.
86.
Ravanat, J. L.; Douki, T.; Cadet, J., Direct and Indirect Effects of UV Radiation on
DNA and its Components. J. Photochem. Photobiol. B-Biol. 2001, 63, 88-102.
87.
Collins, F. M., Relative Susceptibility of Acid-Fast and Non-Acid Fast Bacteria to
Ultraviolet Light. Appl. Microbiol. 1971, 21, 411-413.
88.
Ichihashi, M.; Ueda, M.; Budiyanto, A.; Bito, T.; Oka, M.; Fukunaga, M.; Tsuru, K.;
Horikawa, T., UV-Induced Skin Damage. Toxicology 2003, 189, 21-39.
89.
Tyrrell, R. M.; Keyse, S. M., New Trends in Photobiology - The Interaction of UVA
Radiation with Cultred-Cells. J. Photochem. Photobiol. B-Biol. 1990, 4, 349-361.
90.
Zhang, X. S.; Rosenstein, B. S.; Wang, Y.; Lebwohl, M.; Wei, H. C., Identification
of Possible Reactive Oxygen Species Involved in Ultraviolet Radiation-Induced
Oxidative DNA Damage. Free Radic. Biol. Med. 1997, 23, 980-985.
97
91.
Hargreaves, A.; Taiwo, F. A.; Duggan, O.; Kirk, S. H.; Ahmad, S. I., NearUltraviolet Photolysis of Beta-Phenylpyruvic Acid Generates Free Radicals and
Results in DNA Damage. J. Photochem. Photobiol. B-Biol. 2007, 89, 110-116.
92.
Cano, R. J.; Borucki, M. K., Revival and Identification of Bacterial Spores in 25- to
40-Million-Year-Old Dominican Amber. Science 1995, 268, 1060-1064.
93.
Robichaud, C. O.; Uyar, A. E.; Darby, M. R.; Zucker, L. G.; Wiesner, M. R.,
Estimates of Upper Bounds and Trends in Nano-TiO2 Production As a Basis for
Exposure Assessment. Environ. Sci. Technol. 2009, 43, 4227-4233.
94.
Diebold, U., The Surface Science of Titanium Dioxide. Surf. Sci. Rep. 2003, 48, 53229.
95.
Liu, B.; Han, L.; Che, S. A., Formation of Enantiomeric Impeller-Like Helical
Architectures by DNA Self-Assembly and Silica Mineralization. Angew. Chem. Int.
Ed. 2012, 51, 923-927.
96.
Liu, B.; Yao, Y.; Che, S., Template-Assisted Self-Assembly: Alignment, Placement,
and Arrangement of Two-Dimensional Mesostructured DNA-Silica Platelets. Angew.
Chem. Int. Ed. 2013, 52, 14186-14190.
97.
Hanprasopwattana, A.; Srinivasan, S.; Sault, A. G.; Datye, A. K., Titania Coatings on
Monodisperse Silica Spheres (Characterization Using 2-Propanol Dehydration and
TEM). Langmuir 1996, 12, 3173-3179.
98.
Fu, X. A.; Qutubuddin, S., Synthesis of Titania-Coated Silica Nanoparticles Using
Ono-Ionic Water-in-Oil. Colloid Surf. A-Physicochem. Eng. Asp. 2001, 178, 151156.
99.
Koressaar, T.; Remm, M., Enhancements and Modifications of Primer Design
Program Primer3. Bioinformatics 2007, 23, 1289-1291.
100.
Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J., Basic Local
Alignment Search Tool. J. Mol. Biol. 1990, 215, 403-410.
101.
Sinha, R. P.; Hader, D. P., UV-Induced DNA Damage and Repair: A Review.
Photochem. Photobiol. Sci. 2002, 1, 225-236.
102.
Nicholson, W. L.; Schuerger, A. C.; Setlow, P., The Solar UV Environment and
Bacterial Spore UV Resistance: Considerations for Earth-to-Mars Transport by
Natural Processes and Human Spaceflight. Mutat. Res.-Fundam. Mol. Mech.
Mutagen. 2005, 571, 249-264.
103.
Setlow, P., Resistance of Spores of Bacillus Species to Ultraviolet Light. Environ.
Mol. Mutagen. 2001, 38, 97-104.
104.
USEPA, Ultraviolet Disinfection Guidance Manual for the Final Long Term 2
Enhanced Surface Water Treatment Rule. US Environmental Protection Agency
Washington, DC, 2006.
98
105.
Cabrera, M. I.; Alfano, O. M.; Cassano, A. E., Absorption and Scattering
Coefficients of Titanium Dioxide Particulate Suspensions in Water. J. Phys. Chem.
1996, 100, 20043-20050.
106.
Thiele, E. S.; French, R. H., Light-Scattering Properties of Representative,
Morphological Rutile Titania Particles Studied using a Finite-Element Method. J.
Am. Ceram. Soc. 1998, 81, 469-479.
107.
SCENIHR (Scientific Committee on Emerging and Newly Identified Health Risks),
Final Opinion on the Guidance on the Determination of Potential Health Effects of
Nanomaterials Used in Medical Devices, 2015.
108.
Hasselloev, M.; Readman, J. W.; Ranville, J. F.; Tiede, K., Nanoparticle Analysis
and Characterization Methodologies in Environmental Risk Assessment of
Engineered Nanoparticles. Ecotoxicology 2008, 17, 344-361.
109.
Burg, T. P.; Godin, M.; Knudsen, S. M.; Shen, W.; Carlson, G.; Foster, J. S.;
Babcock, K.; Manalis, S. R., Weighing of Biomolecules, Single Cells and Single
Nanoparticles in Fluid. Nature 2007, 446, 1066-1069.
110.
Lichtman, J. W.; Conchello, J. A., Fluorescence Microscopy. Nat. Methods 2005, 2,
910-919.
111.
Vollmer, F.; Arnold, S., Whispering-Gallery-Mode Biosensing: Label-Free Detection
Down to Single Molecules. Nat. Methods 2008, 5, 591-596.
112.
Wang, S.; Shan, X.; Patel, U.; Huang, X.; Lu, J.; Li, J.; Tao, N., Label-Free Imaging,
Detection, and Mass Measurement of Single Viruses by Surface Plasmon Resonance.
Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 16028-16032.
113.
Giljohann, D. A.; Mirkin, C. A., Drivers of Biodiagnostic Development. Nature
2009, 462, 461-464.
114.
Rissin, D. M.; Kan, C. W.; Campbell, T. G.; Howes, S. C.; Fournier, D. R.; Song, L.;
Piech, T.; Patel, P. P.; Chang, L.; Rivnak, A. J., et al., Single-Molecule EnzymeLinked Immunosorbent Assay Detects Serum Proteins at Subfemtomolar
Concentrations. Nat. Biotechnol. 2010, 28, 595-599.
115.
Heid, C. A.; Stevens, J.; Livak, K. J.; Williams, P. M., Real Time Quantitative PCR.
Genome Res. 1996, 6, 986-994.
116.
Klein, D., Quantification using Real-Time PCR Technology: Applications and
Limitations. Trends Mol. Med. 2002, 8, 257-260.
117.
Welzel, T. M.; Miley, W. J.; Parks, T. L.; Goedert, J. J.; Whitby, D.; Ortiz-Conde, B.
A., Real-Time PCR Assay for Detection and Quantification of Hepatitis B Virus
Genotypes A to G. J. Clin. Microbiol. 2006, 44, 3325-3333.
118.
Hindson, B. J.; Ness, K. D.; Masquelier, D. A.; Belgrader, P.; Heredia, N. J.;
Makarewicz, A. J.; Bright, I. J.; Lucero, M. Y.; Hiddessen, A. L.; Legler, T. C., et
al., High-Throughput Droplet Digital PCR System for Absolute Quantitation of
DNA Copy Number. Anal. Chem. 2011, 83, 8604-8610.
99
119.
Graf, C.; Vossen, D. L. J.; Imhof, A.; van Blaaderen, A., A General Method to Coat
Colloidal Particles with Silica. Langmuir 2003, 19, 6693-6700.
120.
Pope, E. J. A.; Mackenzie, J. D., Sol-Gel Processing of Silica II. The Role of the
Catalyst. J. Non-Cryst. Solids 1986, 87, 185-198.
121.
Paunescu, D.; Mora, C. A.; Puddu, M.; Krumeich, F.; Grass, R. N., DNA Protection
against Ultraviolet Irradiation by Encapsulation in a Multilayered SiO2/TiO2
Assembly. J. Mat. Chem. B 2014, 2, 8504-8509.
122.
Sykes, P. J.; Neoh, S. H.; Brisco, M. J.; Hughes, E.; Condon, J.; Morley, A. A.,
Quantitation of Targets for PCR by Use of Limiting Dilution. Biotechniques 1992,
13, 444-449.
123.
Pinheiro, L. B.; Coleman, V. A.; Hindson, C. M.; Herrmann, J.; Hindson, B. J.; Bhat,
S.; Emslie, K. R., Evaluation of a Droplet Digital Polymerase Chain Reaction Format
for DNA Copy Number Quantification. Anal. Chem. 2012, 84, 1003-1011.
124.
Gschwind, S.; Hagendorfer, H.; Frick, D. A.; Guenther, D., Mass Quantification of
Nanoparticles by Single Droplet Calibration Using Inductively Coupled Plasma Mass
Spectrometry. Anal. Chem. 2013, 85, 5875-5883.
125.
Lee, S.; Bi, X.; Reed, R. B.; Ranville, J. F.; Herckes, P.; Westerhoff, P., Nanoparticle
Size Detection Limits by Single Particle ICP-MS for 40 Elements. Environ. Sci.
Technol. 2014, 48, 10291-10300.
126.
Handy, R. D.; von der Kammer, F.; Lead, J. R.; Hassellov, M.; Owen, R.; Crane, M.,
The Ecotoxicology and Chemistry of Manufactured Nanoparticles. Ecotoxicology
2008, 17, 287-314.
127.
Zhu, J.; Ozdemir, S. K.; Xiao, Y.-F.; Li, L.; He, L.; Chen, D.-R.; Yang, L., On-chip
Single Nanoparticle Detection and Sizing by Mode Splitting in an Ultrahigh-Q
Microresonator Nat. Photonics 2010, 4, 122-122.
128.
Taylor, J. R.; Fang, M. M.; Nie, S. M., Probing Specific Sequences on Single DNA
Molecules with Bioconjugated Fluorescent Nanoparticles. Anal. Chem. 2000, 72,
1979-1986.
129.
Nam, J.-M.; Thaxton, C. S.; Mirkin, C. A., Nanoparticle-Based Bio-Bar Codes for
the Ultrasensitive Detection of Proteins. Science 2003, 301, 1884-1886.
130.
de la Rica, R.; Stevens, M. M., Plasmonic ELISA for the Detection of Analytes at
Ultralow Concentrations with the Naked Eye. Nat. Protoc. 2013, 8, 1759-1764.
131.
Li, F. Y.; Han, J.; Jiang, L. P.; Wang, Y. L.; Li, Y. Y.; Dong, Y. H.; Wei, Q., An
Ultrasensitive Sandwich-Type Electrochemical Immunosensor Based on Signal
Amplification Strategy of Gold Nanoparticles Functionalized Magnetic Multi-Walled
Carbon Nanotubes Loaded with Lead Ions. Biosens. Bioelectron. 2015, 68, 626-632.
132.
Grass, R. N.; Heckel, R.; Puddu, M.; Paunescu, D.; Stark, W. J., Robust Chemical
Preservation of Digital Information on DNA in Silica with Error-Correcting Codes.
Angew. Chem. Int. Edit. 2015, 54, 2552-2555.
100
133.
Degueldre, C.; Favarger, P. Y., Colloid Analysis by Single Particle Inductively
Coupled Plasma-Mass Spectroscopy: A Feasibility Study. Colloid Surf. APhysicochem. Eng. Asp. 2003, 217, 137-142.
134.
Gschwind, S. C. Development and Evaluation of Discrete Sample Introduction
System for Nanoparticle Analysis by ICPMS. Dissertation No. 22251, ETH Zurich,
2014.
135.
Tuoriniemi, J.; Cornelis, G.; Hassellov, M., Size Discrimination and Detection
Capabilities of Single-Particle ICPMS for Environmental Analysis of Silver
Nanoparticles. Anal. Chem. 2012, 84, 3965-3972.
136.
Kato, K., Indirect Measuring Method of Aerosol Transport Efficiency in Inductively
Coupled Plasma Spectrometry Fresenius J. Anal. Chem. 1988, 329, 861-863.
137.
Gustavsson, A., The Determination of Some Nebulizer Characteristics Spectroc. Acta
Pt. B-Atom. Spectr. 1984, 39, 743-746.
138.
Olson, K. W.; Haas, W. J.; Fassel, V. A., Multielement Detection Limits and Sample
Nebulization Efficiencies of an Improved Ultrasonic Nebulizer and a Conventional
Pneumatic Nebulizer in Inductively Coupled Plasma-Atomic Emission Spectrometry.
Anal. Chem. 1977, 49, 632-637.
139.
Smith, D. D.; Browner, R. F., Measurement of Aerosol Transport Efficiency in
Atomic Spectrometry Anal. Chem. 1982, 54, 533-537.
101
102
103
Curriculum Vitae
Daniela Paunescu-Bluhm
Functional Materials Laboratory
Private Address:
Institute for Chemical and Bioengineering
Daniela Paunescu-Bluhm
Department of Chemistry and Applied Biosciences
Trottenstrasse 47
ETH Zurich, HCI E105
8037 Zurich
8093 Zurich
Switzerland
Switzerland
Phone: +41 44 633 41 47
Email: [email protected]
___________________________________________________________________________
Born: March 24th, 1988 in Timisoara (Romania)
Citizen of Germany and Romania
Languages: German (native), Romanian (native), English (fluent), French (basic)
Education
10/2012 – current
PhD studies in Chemical- and Bioengineering at the Functional
Materials Laboratory, Prof. Wendelin J. Stark at the Institute for
Chemical and Bioengineering, ETH Zurich (CH).
Dissertation: Synthetic DNA Fossils, Prof. Wendelin J. Stark, ETH
Zurich.
9/2010 – 8/2012
Master studies in Chemistry, ETH Zurich (CH).
Master thesis: Synthesis and applications of SiO2 Particles containing
DNA, Prof. Wendelin J. Stark, ETH Zurich.
9/2007 – 8/2010
Bachelor
studies
in
Chemistry,
Ruprecht-Karls-University
Heidelberg (DE).
Bachelor
thesis:
Goldkatalysierte
Synthese
von
tricyclischen
Verbindungen und deren weitere Verwendung, Prof. A. Stephen K.
Hashmi, Ruprecht-Karls-University Heidelberg.
6/2007-8/2007
Research project, School of Medicine at Stanford University,
California (US), Prof. Mark A. Kay.
3/2007
High-school diploma, Otto-Hahn-Gymnasium Landau (DE).
104
Refereed Journal Articles
15.
D. Paunescu, W. J. Stark, R. N. Grass, Particles with an Identity: Tracking and Tracing
in Commodity Products, Powder Technol. 2015, under review.
14.
D. Paunescu, C. A. Mora, L. Querci, R. Heckel, M. Puddu, B. Hattendorf, D. Günther,
R. N. Grass, Detecting and Number Counting of Single Engineered Nanoparticles by Digital
Particle Polymerase Chain Reaction, ACS Nano 2015, 9, 9564-9572.
13.
C. A. Mora, D. Paunescu, R. N. Grass and W. J. Stark, Silica Particles with
Encapsulated DNA as Trophic Tracers, Mol. Ecol. Res. 2015, 15, 231-241.
12.
R. N. Grass, R. Heckel, M. Puddu, D. Paunescu, W. J. Stark, Robust Chemical
Preservation of Digital Information on DNA in Silica with Error-Correcting Codes, Angew.
Chem. Int. Ed. 2015, 8, 2552-2555.
11.
C. J. Hofer, V. Zlateski, P. R. Stoessel, D. Paunescu, E. M. Schneider, R. N. Grass, M.
Zeltner, W. J. Stark, Stable dispersions of azide functionalized ferromagnetic metal
nanoparticles, Chem. Commun. 2015, 51, 1826-1829.
10.
R. N. Grass, J. Schälchli, D. Paunescu, J. O. B. Soellner, R. Kaegi, W. J. Stark,
Tracking Trace Amounts of Submicrometer Silica Particles in Wastewaters and Activated
Sludge Using Silica-Encapsulated DNA Barcodes, Environ. Sci. Technol. 2014, 1, 484-489.
9.
M. S. Bloch, D. Paunescu, P. R. Stoessel, C. A. Mora, W. J. Stark, R. N. Grass,
Labeling milk along its production chain with DNA encapsulated in silica, J. Agric. Food
Chem. 2014, 62, 10615-10620.
8.
M. Hoop, D. Paunescu, P. R. Stoessel, F. Eichenseher, W. J. Stark, R. N. Grass, PCR
quantification of SiO2 particle uptake in cells in the ppb and ppm range via silica encapsulated
DNA barcodes, Chem. Commun. 2014, 50, 10707-10709.
7.
J. G. Halter, N. H. Cohrs, N. Hild, D. Paunescu, R. N. Grass, W. J. Stark, Self-
defending anti-vandalism surfaces based on mechanically triggered mixing of reactants in
polymer foils, J. Mater. Chem. A 2014, 2, 8425-8430.
6.
R. A. Raso, A. Stepuk, D. Mohn, D. Paunescu, F. M. Koehler, and W. J. Stark,
Regenerable cerium oxide based odor adsorber for indoor air purification from acidic volatile
organic compounds, Appl. Catal. B. Environmental 2014, 147, 965-972.
105
5.
D. Paunescu, C. A. Mora, M. Puddu, F. Krumeich, R. N. Grass, DNA protection
against ultraviolet irradiation by encapsulation in a multilayered SiO2/TiO2 assembly, J.
Mater. Chem. B 2014, 2, 8504-8509.
4.
M. Puddu, D. Paunescu, W. J. Stark, R. N. Grass, Magnetically Recoverable,
Thermostable, Hydrophobic DNA/Silica Encapsulates and Their Application as Invisible Oil
Tags, ACS Nano 2014, 8, 2677-2685.
3.
D. Paunescu, M. Puddu, J. O. B. Soellner, P. R. Stoessel, R. N. Grass, Reversible
DNA encapsulation in silica to produce ROS-resistant and heat-resistant synthetic DNA
'fossils', Nat. Protoc. 2013, 52, 4269-4272.
2.
D. Paunescu, R. Fuhrer, R. N. Grass A.C.C. Rotzetter, Protection and Deprotection of
DNA-High-Temperature Stability of Nucleic Acid Barcodes for Polymer Labeling, Angew.
Chem. Int. Ed. 2013, 52, 4269-4272.
Featured on the Angew. Chem. Int. Ed. cover, 52, (2013).
Scientific/Media coverage:
Highlighted in Nature, 495 (2013): Protecting DNA in silica 'fossils'
Highlighted in CHIMIA, 67 (2013)
Featured in BBC, 2013: Tiny glass 'bottles' protect DNA from damage
1.
Y-L. Wu, F. Tancini, W. B. Schweizer, D. Paunescu, C. Boudon, J-P. Gisselbrecht, P.
D. Jarowski, E. Dalcanale, F. Diederich, Proacetylenic Reactivity of a Push-Pull Buta-1,2,3triene. New Chromophores and Supramolecular Systems, Chem. Asian J. 2012, 7, 1185-1190.
106
Conference Presentations and Proceedings
8.
D. Paunescu, M. Puddu, P. R. Stoessel, R.N. Grass, Protection and Deprotection of
DNA - High Temperature Stability of Nucleic Acid Barcodes for Polymer Labeling, poster
presentation, International Symposium on DNA-encoded chemical libraries, Zurich,
Switzerland, September 1, 2014.
7.
D. Paunescu, M. Puddu, P. R. Stoessel , R.N. Grass, Protection and Deprotection of
presentation, MRS Fall Meeting, Boston, Massachusetts, USA, December 1-6, 2013.
6.
D. Paunescu, M. Puddu, P. R. Stoessel, R. Fuhrer, R.N. Grass, Single DNA-labelled
nanoparticles, oral presentation, Swiss Aerosol Group (SAG) Meeting, Bern, Switzerland,
November 18, 2013.
5.
D. Paunescu, R. Fuhrer, P. R. Stoessel, R. N. Grass, Unique barcoding system for all
kind of materials, poster presentation, Industry Day, Zurich, Switzerland, September 12,
2013.
4.
D. Paunescu, R. Fuhrer, P. R. Stoessel, R.N. Grass, Protection and Deprotection of
presentation, SCS Fall Meeting, Lausanne, Switzerland, September 06, 2013.
3.
D. Paunescu, M. Puddu, P.R. Stoessel, R. Fuhrer, R.N. Grass, Protection and
Deprotection of DNA - High Temperature Stability of Nucleic Acid Barcodes for Polymer
Labeling, oral presentation, MRC Graduate Symposium, Zurich, Switzerland, June 13,
2013.
2.
D. Paunescu, R. Fuhrer, R.N. Grass, Protection and Deprotection of DNA - High
Temperature Stability of Nucleic Acid Barcodes for Polymer Labeling, poster presentation,
Swiss Nano Convention, Basel, Switzerland, May 23, 2013.
1.
D. Paunescu, R. Fuhrer, R.N. Grass, Protection and Deprotection of DNA - High
Temperature Stability of Nucleic Acid Barcodes for Polymer Labeling, oral presentation,
i-net Nano “NextNanoStars”, Basel, Switzerland, March 21, 2013.
107
Student supervision
3.
Andri Mani (Master thesis, 5/2015 – 9/2015): Uptake Quantification of Different
Surface Functionalized Silica Particles into A549 Human Epithelial Cells
2.
Madeleine S. Bloch (Master thesis, 9/2013 – 2/2014): Labeling food products with
silica/DNA nanoparticles,
1.
Justus O. B. Soellner (Master thesis, 11/2012 – 3/2013): Detection of DNA tagged
silica nanoparticles in wastewater treatment plants.
Teaching experience
9/2014 – 12/2014
Laboratory course – Chemical Engineering I, ETH Zurich
1/2012 – 3/2012
1/2013 – 3/2013
Laboratory course – basic chemistry for UWIS, ETH Zurich
Varia
Co‐founder and treasurer of the Society for Women in Natural Sciences (WiNS) at ETH
Zurich. Networking and career platform for women working in the Department of Chemistry
and Applied Biosciences at ETH Zurich
108

synthetic dna fossils - ETH E

Transcription

Similar documents

EasyPure Genomic DNA Spin Kit

The Masterof

WHY INTERNAL COMMUNICATIONS?

Presentation - Produce Marketing Association

DNA Structure - hrsbstaff.ednet.ns.ca

`CSI effect` impacts justice in Tucson

Rapid Trait Development System (RTDS™) in Plants

The Hammerling Experiment The Hammerling Experiment

WHO SHOULD FILL THE FORM This page need not be submitted