the Thesis

Biogenesis, Maturation and Surface Trafficking of Wild-Type and Mutant
CFTR
Ph.D. Dissertation
Károly Varga, M.D.
School of Basic Medicine
Semmelweis University, Budapest
and
Department of Cell Biology
University of Alabama at Birmingham, Birmingham, AL
Supervisor:
Consultant:
Official reviewers:
LászlóRosivall, MD, PhD, DSc
James F. Collawn, PhD (UAB)
László Tretter, MD, PhD, DSc
József Kardos, PhD
Chairman of the committee: László Buday, MD, PhD, DSc
Members of the committee: Péter Várnai, MD, PhD
Gergely Szakács, MD, PhD, DSc
Budapest-Birmingham, AL
2010
TABLE OF CONTENTS
1. Abbreviations
4
2. Introduction
6
2.1. Cystic Fibrosis and CFTR
6
2.2. CFTR Structure and Biochemistry
7
2.3. The ΔF508 Mutant CFTR
7
2.4. Ablation of Internalization Signals
8
2.5. Intracellular Processing of CFTR
9
2.6. DF508 CFTR Rescue and Stability
11
3. Aims and hypotheses
14
4. Materials and methods
15
4.1. Construction of CFTR Mutants
15
4.2. Tyransient Transfection of COS-7 Cells
15
4.3. Cell Culture
15
4.4. Small Molecular Correctors (Pharmacological Chaperones
16
4.5. Immunoprecipitation
17
4.6. Biotinylation
17
4.7. Internalization Assays
18
4.8. CFTR Cell-Surface Half-Life Measurements
18
4.9. Metabolic Pulse-Chase Assays
18
4.10. Western Blot
20
4.11. Whole Cell patch Clamp Assay
20
4.12. Single Cell Patch Clamp
21
4.13. Semiquantitative RT-PCR
22
4.14. Fluorescence-Based Kinetic Real-Time PCR
22
4.15. Microscopy
23
4.16. Ussing Chamber Abnalyses
23
4.17. Statistical Analysis
24
5. Results
25
5.1. Ablation of Internalization Signals in the C-terminal Tail of CFTR
enhances Surface expression
25
2
5.1.1. Mutations in the Carboxy-Terminal Tail of CFTR Increase Surface
Expression
5.1.2. Mutations at Tyr
25
1424
1427
and Ile
Do Not Alter CFTR Maturation
Efficiency or Protein Half-life
26
5.1.3. Tyrosine 1424 and Isoleucine 1427 Are Necessary for CFTR
Endocytosis
26
5.1.4. The Y1424A and Y1424A,I1427A CFTR Have Normal Chloride
Channel Properties
27
5.2. Intracellular Processing of CFTR is Efficient in Epithelial cell Lin
35
5.2.1. Calu-3 Cells Express High Levels of CFTR Compared with
Heterologous Expression Systems
35
5.2.2. Maturation and Protein Stability Are Enhanced in Calu-3Cells
36
5.2.3. ERAD of CFTR Is Insignificant in Calu-3 Cells
37
5.2.4. Cell Surface CFTR Expression Is Elevated in Calu-3 Cells
37
5.2.5. CFTR Maturation Is Efficient in T84 Cells Grown under Standard
Tissue Culture Conditions
38
5.3. Pharmacological Chaperones Enhance Surface Stability of ΔF508CFTR 49
5.3.1. ΔF508CFTR rescue by permissive temperature in HeLaDF cells 49
5.3.2. Extended half-life of r ΔF508 CFTR at the permissive temperature
in HeLaDF cells
50
5.3.3. rΔF508CFTR endocytosis is accelerated in airway epithelial cells 50
5.3.4. Shortened cell-surface half-life of r ΔF508CFTR in CFBE41o
cells
52
5.3.5. Permissive temperature culture stabilizes r ΔF508CFTR in polarized
epithelial cells
52
5.3.6. Permissive temperature culture corrects the functional defect
associated with r ΔF508CFTR
53
5.3.7. Pharmacological chaperones correct the internalization defect and
increase the surface stability of r ΔF508CFTR
54
5.3.8. Pharmacological chaperones extend the cell-surface half-life of
rΔF508 CFTR
55
6. Discussion
66
3
7. Conclusions
75
8. Summary
77
9. My Publications associated with the Thesis
82
10. My publications not associated with the Thesis
86
11. Acknowledgements
87
12. References
89
4
1. ABBREVIATIONS
ABC
ATP-binding cassette
ATP
adenosine triphosphate
Band B
core glycosylated CFTR
Band C
complex glycosylated CFTR
BHK
baby hamster kidney
cAMP
cyclic adenosine monophosphate
Calu-3
human lung adenocarcinoma metastasis
CF
cystic fibrosis
CFBE41o-
CF bronchial epithelium
CFTR
cystic fibrosis transmembrane conductance regulator
CHO
Chinese hamster ovary
CMV
cytomegalovirus
Cor-325
(VRT-325, 4-cyclohexyloxy-2-{1[4-(4-methoxybenzensulfonyl)-piperazin-1-yl]-ethyl}-quinazoline)
Corr-4a
[2-(5-Chloro-2-methoxy-phenylamino)-4‟-methyl[4,5‟]bithiazolyl-2‟-]-phenyl-methanone
COS-7
kidney cells of the African green monkey
C-tail
carbocyl-terminal tail
ΔF508
mutation with phenylalanine missing at position 508
DMSO
dimethyl-sulfoxide
ER
endoplasmic reticulum
ERAD
endoplasmic reticulum associated degradation
HeLa
immortalized human cervical cancer cells
HTS
high throughput screening
Isc
short-circuit current
mRNA
messenger ribonucleic acid
MSD
membrane spanning domain
NBD
nucleotide-binding domain
PKA
protein kinase A
R
regulatory domain
5
rΔF508
ΔF508 mutant CFTR on plasma membrane
RIPA
radioimmune precipitation buffer
SDS-PAGE
sodium dodecyl sulfate polyacrylamide gel electrophoresis
T84
human colon carcinoma
TR
transferrin receptor
TS
temperature-sensitive
6
2. INTRODUCTION
2.1. Cystic Fibrosis and CFTR
Cystic fibrosis (CF) is the most prevalent hereditary disease among Caucasians (Collins,
1992, Cohn et al., 1993). It is an autosomal recessive genetic disorder resulting in a fatal
outcome in most cases. The affected sites are mainly the exocrine glands with a
consequent disfunction of the lungs, the pancreas, the GI tract and the reproductive
system (Rowntree and Harris, 2003). Approximately 1:25 people of European, 1:22 of
Ashkenazi Jewish, 1:46 of Hispanic 1:65 of African and 1:90 of Asian descent carry at
least one mutated CFTR allele, and about 30,000 people in the United States are living
with CF (Rosenstein and Cutting, 1998).
CF caused by mutations in the 180-kb cystic fibrosis transmembrane conductance
regulator (CFTR) gene located on the long (q) arm of chromosome 7 at position 31.2.
The gene product, the CFTR protein is a 168 kDa multidomain chloride channel that
belongs to the adenosine triphosphate (ATP)-binding casette (ABC) transporter superfamily. It is expressed in a wide variety of cell types, but it is most abundant at the
apical surface of secretory epithelia, where it functions as part of a large
macromolecular protein complex (Cohn et al., 1993). CFTR, also referred to as ABC
transporter ABCC7, plays a significant role in electrolyte and fluid movement
regulation across epithelial cell layers. Although CFTR is not the only chloride channel
in these tissues, its current is critical in maintaining transepithelial osmotic balance
(Cohn et al., 1993, Kreda et al., 2005). Functional insufficiency of the mutated CFTR
protein gives rise to CF symptoms such as pancreatic insufficiency, high salt
concentration in sweat, thick, dehydrated mucus in the airways with frequent upper
respiratory tract infections and consequential respiratory failure. Obstruction or absence
of the vas deferens in male, and reduced fertility in female CF patients are well known
complications of the disease as well (Zielenski and Tsui, 1995, Rowntree and Harris,
2003).CF is a monogenetic disorder, and its clinical severity varies widely. There are
more
than
1,500
mutations
listed
in
the
CFTR
database
(http://www.genet.sickkids.on.ca/cftr), but a 3 bp deletion resulting in a loss of a
7
phenylalanine residue at position 508 ( F508) is the most prevalent disease causing
mutation and is responsible for more than 70% of all CF cases.
2.2. CFTR Structure and Biochemistry
CFTR is comprised of two homologous halves, with each half containing a large
membrane-spanning region with six transmembrane segments (TM1 and TM2) and a
nucleotide –binding domain (NBD1 and NBD2). The two halves are separated by a
large regulatory domain (R) containing multiple consesnsus phosphorilation sites
(Bradbury et al., 1992). A schematic diagram of the CFTR structure is shown in Figure
1. Two asparagine residues of the CFTR protein are N-glycosylated in the endoplasmic
reticulum, and after proper folding, the protein traffics to the Golgi apparatus from the
ER and the carbohydrate chains are modified in the trans-Golgi network to their mature
form (O'Riordan et al., 2000). Mature, fuly glycosylated CFTR leaves the Golgi and
directly travels to the apical cell membrane or to the recycling endosomes (Bertrand and
Frizzell, 2003). Within any pool of CFTR expressed in cells there is a mixture of core
glycosylated (ER form) and complex glycosylated (post-Golgi form) CFTR. The
differentially glycosylated forms can be distinguished by the difference of their
molecular weights subjected to denaturing SDS-PAGE electrophoresis. Figure 1B.
showes the two CFTR forms as the ER form or Band B, and post-Golgi form or Band C.
2.3. The F508 Mutant CFTR
One or more deffective alleles containing the F508 mutation can be detected in more
than 90% of all CF cases. This aberrant protein is caused by a three nucleotide deletion
that results in the abscence(Δ) of a single phenylalanine (F) at position 508 within the
CFTR protein (ΔF508 or F508 CFTR)(Rowntree and Harris, 2003). The F508 position
is within the NBD1 domain, but its abscence has been found to compromise the proper
folding not only of this domain but possibly also of the NBD2, TM1 and TM2 domains
(Du et al., 2005, Younger et al., 2006). As a result, majority of the newly synthethised
F508 CFTR is recognized as misfolded protein by the ER quality controll machinery
and consequently degraded by the proteosome, resulting in CF phenotype (Cheng et al.,
8
1990a, Jensen et al., 1995a, Gelman et al., 2002). As a result of failing to exit the ER,
F508 CFTR appears as a band B only when analyzed by SDS-PAGE.Certain in vitro
conditions allow
F508 CFTR to escape the ER-associated degradation patway and
traffic to the cell surface; these mechanisms will be discussed later in this section.
2.4. Ablation of Internalization Signals
Previous studies have demonstrated that CFTR is internalized from the cell surface
(Prince et al., 1994, Lukacs et al., 1997, Prince et al., 1999) through clathrin-coated
pits(Bradbury et al., 1994, Lukacs et al., 1997). Furthermore, CFTR has been shown to
interact with PDZ-domain-containing proteins at its COOH terminus (Short et al., 1998,
Wang et al., 1998) and syntaxin 1A at its NH2 terminus (Naren et al., 1997, Naren et al.,
1998). How these interactions affect cell surface expression is not clear, but they imply
that CFTR may exist in at least two cell surface pools, one tethered to the actin
cytoskeleton and one associated with the endocytic pathway. Subcellular localization
studies reveal that CFTR is found in the endosomes in epithelial cells (Webster et al.,
1994), supporting the view that CFTR enters the endocytic pathway. Whether CFTR is
constitutively recycled is not known. In previous studies, our laboratory demonstrated
that a key feature of CFTR endocytosis was the presence of a tyrosine residue at
position 1424 in the COOH-terminal tail of CFTR. Because tyrosine-based signals have
been proposed to consist of the motif YXXΦ where Φ is a large hydrophobic residue and
X is any residue (Trowbridge et al., 1993), we tested the hypotheses that the isoleucine
residue at position 1427 is important for CFTR endocytosis and that ablation of this
putative signal YXXI would increase the steady-state surface expression of CFTR. To
this end, we performed an integrated series of biochemical and electrophysiological
assays designed to study maturation efficiency, trafficking, and Cl− channel function of
the wild-type and two COOH-terminal mutant CFTR proteins. We find that the
substitution of Tyr1424 and Ile1427 with alanine residues resulted in a 2-fold increase in
surface expression, whereas the single Y1424A mutation shows an intermediate
phenotype. CFTR internalization assays revealed that the elevated surface expression
was attributed to a dramatic decrease in endocytosis, suggesting that these residues are
necessary for CFTR internalization. Because the chloride channel activity and relative
9
surface expression of Y1424A and I1427A CFTR are elevated to a similar extent, we
propose that these substitutions affect protein trafficking but not CFTR chloride channel
function. To our knowledge, this is the first CFTR mutant that has enhanced rather than
diminished activity at the cell surface because of attenuation of internalization.
2.5. Intracellular Processing of CFTR
Newly synthesized proteins entering the secretory pathway are carefully monitored by
the ER quality control machinery to ensure that only correctly folded molecules exit
and continue their journey to the cell surface(Hampton, 2002). Misfolded membrane
and secretory proteins are promptly recognized as such and degraded by the ERassociated degradation pathway (ERAD; reviewed in (Hampton, 2002, Goldberg, 2003).
Understanding this process is critical, since a number of diseases, including cystic
fibrosis, congenital hypothyrosis, and familial hypercholesterolemia are caused by
protein folding defects that often arise from missense or deletion mutations (Aridor and
Hannan, 2000, 2002). Despite the fact that many of these mutations result in the
production of proteins that retain some biological activity, they are rapidly degraded by
ERAD, preventing proper targeting of the proteins to their biologically relevant
destinations (reviewed in Ref. (Kim and Arvan, 1998)).
Interestingly, inefficient protein biogenesis appears to occur even for “wild type”
proteins, with a number of examples that include the epithelial sodium channels (Weisz
et
al.,
2000), Shaker-type potassium
channels
(Liu
et
al.,
2001), major
histocompatibility complex class II molecules (Sant et al., 1991), the δ opioid receptor
(Petäjä-Repo et al., 2000, Petäjä-Repo et al., 2001), the erythropoietin receptor
(Yoshimura et al., 1990), the erythrocyte anion exchanger 1 (Band 3)(Li et al., 2000),
and CFTR (Cheng et al., 1990b). Many of these proteins, including CFTR, are
assembled in the cell membrane as part of a multiprotein complex (Sun et al., 2000a,
Sun et al., 2000b), suggesting that the molecular rationing of the components in these
complexes might be regulated during biogenesis.
Interestingly, even the wild type protein is substrate for ERAD, with as much as 75%
being degraded by the proteasome during biogenesis (Cheng et al., 1990b, Ward and
Kopito, 1994, Ward et al., 1995). Since only a small fraction of newly synthesized wild
10
type CFTR reaches the cell surface where it performs its biological function, the
question has often arisen as to why CFTR biogenesis so inefficient. A study by Tector
and Hartl (Tector and Hartl, 1999) suggested the possibility that transmembrane
segment 6 in TMD1 is unstable due to 3 charged residues within this domain.
Substitution of these residues with non-charged amino acids resulted in an increase in
protein stability but a loss of chloride transport(Tector and Hartl, 1999), suggesting that
protein stability had been compromised for biological function. This hypothesis has not
been evaluated in cells endogenously expressing CFTR.
It has been suggested that an appropriate cellular context may be necessary to support
proper membrane protein trafficking. In addition, it is possible that altered protein
trafficking may result from the use of overexpression systems or non-physiological
experimental conditions (reviewed in Bertrand et al. (Bertrand and Frizzell, 2003)).
Given that the initial studies of CFTR biogenesis were performed primarily in
transfected, heterologous overexpression systems, a careful analysis of endogenous
CFTR biogenesis both in the early (ER) and post-Golgi pathways is warranted.
Heterologous systems may lack CFTR binding partners such as EBP50, syntaxin 1A,
and CAL ((Sun et al., 2000b), (Naren et al., 1997, Short et al., 1998, Naren and Kirk,
2000, Cheng et al., 2002)), and association of these and other proteins with CFTR may
be required for proper maturation and/or trafficking.
In one of the studies presented below, we monitored the maturation efficiency of CFTR
in two human epithelial cell lines that endogenously expresses CFTR, Calu-3(Shen et
al., 1994), and T84 cells (Cohn et al., 1992). Metabolic pulse-chase analysis of CFTR in
these cells grown under both nonpolarizing and polarizing conditions indicated that core
glycosylated (Band B) CFTR is very efficiently (~100%) processed to a maturely
glycosylated (Band C) protein that is extremely stable. Moreover, quantitative cell
surface biotinylation assays revealed that the CFTR surface pool is substantially
elevated in Calu-3 cells compared with heterologous expression systems. Thus,
endogenous CFTR maturation differs fundamentally from the patterns reported in
recombinant overexpression systems, and these differences extend across multiple
cellular compartments. Our findings cast doubt upon the viewpoint that wild type CFTR
protein maturation is inefficient.
11
2.6. ΔF508 CFTR Rescue and Stability
ΔF508 CFTR is a well-known example of a clinically relevant TS (temperaturesensitive) processing mutant. At 37 °C, the restrictive temperature, the ΔF508 CFTR
protein is rapidly degraded by ERAD [ER (endoplasmic reticulum) associated
degradation], preventing ΔF508 CFTR expression at the cell surface and resulting in the
CF phenotype(Cheng et al., 1990b, Jensen et al., 1995b, Ward et al., 1995). At 27 °C,
the permissive temperature, some of the ΔF508 CFTR protein escapes ERAD and is
delivered to the cell membrane, where it is called rΔF508 (rescued ΔF508) CFTR.
Because rΔF508 CFTR partially retains its chloride channel activity (Dalemans et al.,
1991), several methods have been introduced to promote ΔF508 CFTR escape from
ERAD and deliver it to the cell membrane(Brown et al., 1996, Yang et al., 2003, Zhang
et al., 2003, Loo et al., 2005, Pedemonte et al., 2005, Loo et al., 2006, Norez et al.,
2006), but to date, the most efficient method for the rescue of ΔF508 CFTR is
permissive temperature cell culture (Denning et al., 1992). Although first observed 15
years ago, it remains unclear how culture at 27 °C facilitates ΔF508 CFTR escape from
ER quality control. It is well established, however, that returning cells to the restrictive
temperature after low temperature rescue results in rapid internalization and degradation
of rΔF508 CFTR (Sharma et al., 2004, Bebok et al., 2005). It is not known whether
rΔF508 CFTR displays the same cell-surface instability, or how function of rΔF508
CFTR is affected, if left at the permissive temperature.
In addition to low-temperature culture, chemical compounds such as glycerol(Sato et
al., 1996), DMSO (Bebok et al., 1998) and organic solutes (Zhang et al., 2003) have
also been shown to facilitate ΔF508 CFTR escape from ERAD. These compounds exert
their effects by enhancing the efficiency of ΔF508 CFTR folding or by increasing
differentiation and polarity of the host cell(Bebok et al., 1998). Recently, a handful of
small molecular correctors were identified by high-throughput screening based on their
ability to promote rΔF508 CFTR expression (Pedemonte et al., 2005, Loo et al., 2006,
Suen et al., 2006, Wang et al., 2007b). In most cases, the mechanism by which these
compounds facilitate ERAD escape is not known. Furthermore, their effects at the cell
surface have not been tested.
12
Although the effects of low temperature culture on ΔF508 CFTR folding in the ER has
been studied for years, it is not known whether the surface defects exhibited by rΔF508
CFTR are also TS, and therefore possibly related to the ER folding defect. Additionally,
it has not been determined whether treatment of rΔF508 CFTR with chemical
compounds known to promote rescue can affect ΔF508 CFTR cell-surface properties,
such as surface stability. Answers to these questions are essential to understand the
altered trafficking, decreased stability and compromised function of the rΔF508 CFTR
protein. In this present study, we provide more detailed information on the effects of
permissive temperature culture and of two small molecule correctors on rΔF508 CFTR
cell-surface trafficking. We used two different CFTR-expressing model cell lines, HeLa
and CFBE41o- cells, in order to identify cell-type- and polarization-specific differences
in the cell-surface trafficking of WT (wild-type) CFTR and rΔF508 CFTR, and to
determine whether methods known to facilitate ΔF508 CFTR exit from the ER also
stabilize rΔF508 CFTR at the cell surface.
13
Glycan chains
COOH
Syntaxin 1A
EC
TMD1
TMD2
Cell membrane
IC
YSDI
H3
H2
NH2
NBD1
AP-2
NBD2
COPII
NH2
ezrin
R domain
PKA
Syntaxin 8
ACTIN
Figure1. CFTR Structure
14
DTRL
EBP50
H1
E3KARP
CAL
CAP70
3. AIMS AND HYPOTHESES
First, to test the hypotheses that the isoleucine residue at position 1427 is important for
CFTR endocytosis and that ablation of this putative internalization signal YXXI would
increase the steady-state surface expression of CFTR. To test if these substitutions have
any effect on the chloride channel properties of CFTR
Second, to monitor the maturation efficiency of CFTR in heterologous expression
systems such as HeLa and COS-7 cells and in two human epithelial cell lines that
endogenously expresses CFTR, Calu-3 (Shen et al., 1994), and T84 cells (Cohn et al.,
1992) using metabolic pulse-chase analysis of CFTR in these cells grown under both
nonpolarizing and polarizing conditions, and to compare quantitative cell surface levels.
Based on recent results that epithelial specific factors regulate both CFTR biogenesis
and function, we hypothesized that CFTR biogenesis in endogenous CFTR expressing
epithelial cells may be more efficient.
Third, to determine whether the surface defects exhibited by rΔF508 CFTR are also TS,
and therefore possibly related to the ER folding defect. Additionally, to study if
treatment of rΔF508 CFTR with chemical compounds known to promote rescue can
affect ΔF508 CFTR cell-surface properties, such as surface stability. Our hypothesis
was that permissive temperature culture and small molecular correctors not only can
rescue ΔF508 CFTR from ERAD, but also stabilizes it at the cell surface.
15
4. MATERIALS AND METHODS
4.1. Construction of CFTR Mutants
CFTR (wild-type) was provided by the Gregory James Cystic Fibrosis Center Vector
Core and Dr. Jeong Hong. The construction of the Y1424A mutant was described
previously(Prince et al., 1999). For construction of the Y1424A,I1427A mutant, aBstXISgrAI fragment that coded for the COOH-terminal tail region of Y1424A CFTR was
subcloned into pSK-Bluescript (Stratagene). A second-site mutation was prepared from
the corresponding pSK-Bluescript vector containing theBstXI-SgrAI fragment from
single-stranded DNA as described previously (Trowbridge et al., 1993)by the method of
Kunkel(Kunkel, 1985). Mutants were selected by sequencing and then subcloned into
theBstXI-SgrAI
site
of
pGT-1-CFTR.
The
mutations
were
verified
by
dideoxynucleotide sequencing (Tabor and Richardson, 1987) using the Sequenase kit
(U. S. Biochemical Corp.) according to the manufacturer's directions.
4.2. Transient Transfection of COS-7 Cells
COS-7 cells were transiently transfected using LipofectAMINE PLUS reagent
(Invitrogen) according to the manufacturer's protocol. Transfected cells were cultured
for 24-48 h before analysis in a humidified incubator in 5% CO2 at 37 oC before
analysis.
4.3. Cell Culture
COS-7 cells were cultured in modified Eagle's medium (Invitrogen) with 10% FBS at
37 °C in a humidified incubator in 5% CO2 and transiently transfected using
LipofectAMINE Plus reagent (Invitrogen) according to the manufacturer's directions.
The cells were incubated at 37 °C in a humidified incubator for 24–48 h before
analysis.
Calu-3, and T84 cells were obtained from the ATCC (www.atcc.org) and maintained in
the Cystic Fibrosis Research Center at University of Alabama at Birmingham. HeLa
cells overexpressing wild type CFTR were transduced and selected as previously
described(Wu et al., 2000, Kappes et al., 2003), cultured in Dulbecco's modified Eagle's
16
medium (Invitrogen) with 10% FBS at 37 °C in a humidified incubator in 5% CO2. For
cell monolayers, Calu-3 cells were seeded on 6.5- or 12-mm diameter Transwell filters
(Corning-Costar, Corning, NY). After 2-3 days, the medium containing 10% FBS was
exchanged to 2% FBS containing media, and cells were cultured for an additional 7-9
days with liquid both at the apical and the basolateral compartments. Under these
conditions, the cells formed monolayers with trans-epithelial resistances of >800 Ω·cm2.
HeLa F (where DF indicates a cell line expressing ΔF508 CFTR), HeLaWT, CFBE41oF and CFBE41o-WT cell lines were developed and cultured as described
previously(Bebok et al., 2005). HeLa cells were grown in Eagle's modification of MEM
(minimal essential medium; Invitrogen) supplemented with 10% (v/v) FBS (fetal bovine
serum). Calu-3 cells were obtained from A.T.C.C. and were maintained in Eagle's
modification of MEM supplemented with 10% (v/v) FBS, 2 mM glutamine, 1 mM
pyruvate and 0.1 mM non-essential amino acids. CFBE41o- cell cultures were
maintained in DMEM (Dulbecco's modified Eagle's medium) Ham's F12 medium
(50:50, v/v) (Invitrogen) with 10% (v/v) FBS. For experiments requiring polarized cells,
Calu-3 CFBE41o- F and CFBE41o-WT cells were seeded on to 12 mm diameter
Transwell filters (Costar, Corning). Under these conditions, the cells formed polarized
monolayers with transepithelial resistances of >1000 W/cm2, as measured by a Millicell
electrical resistance system (Millipore).
4.4. Small molecular correctors (pharmacological chaperones)
Small molecular correctors were provided by Cystic Fibrosis Foundation Therapeutics
(Bethesda, MD, U.S.A.). Compounds tested were CFcor-325 (VRT-325, 4cyclohexyloxy-2-{1[4-(4-methoxy-benzensulfonyl)-piperazin-1-yl]-ethyl}-quinazoline)
(Loo et al., 2006, Van Goor et al., 2006)and Corr-4a ({2-(5-chloro-2-methoxyphenylamino)-4´-methyl-[4,5´]-bithiazolyl-2´-yl}-phenyl-methanone) (Pedemonte et al.,
2005). Both compounds were used at a 10 mM stock concentration in DMSO and a 10
mM working concentration in OPTIMEM medium (Invitrogen) supplemented with 2%
(v/v) FBS. The presence of the vehicle (0.1% DMSO) in the medium did not mediate
ER escape of ΔF508 CFTR in control samples, or facilitate changes in internalization.
In all experiments, control samples contained the DMSO vehicle.
17
4.5. Immunoprecipitation
Cells were lysed in RIPA buffer [1% Nonidet P40, 0.5% sodium deoxycholate, 150 mM
NaCl and 50 mM Tris/HCl (pH 8.0)] containing Complete mini protease inhibitor
(Roche). CFTR was immunoprecipitated using 1 mg/ml (final concentration) mouse
monoclonal anti-CFTR C-terminal antibody (24-1, A.T.C.C. number HB-11947) and 35
ml of Protein A–agarose (Roche)(Jurkuvenaite et al., 2006). TR (transferrin receptor)
was immunoprecipitated using 1 mg/ml (final concentration) mouse anti-TR (B3/25;
Roche) and 35 ml Protein A-agarose(Zaliauskiene et al., 2000). Immunoprecipitations
were carried out for 2h at 4 °C.
4.6. Biotinylation
Cells were cooled to 4oC, washed with phosphate-buffered saline containing 1.0 mM
MgCl2 and 0.1mM CaCl2 (PBS c/m), and incubated for 30 min with 10 mM NaIO4 in
the dark. The cells were again washed with PBS c/m and labeled with 2 mM biotin-LChydrazide in 100 mM sodium acetate (pH 5.5) for 30 min. These labeled cells were
extensively washed with PBS c/m and lysed in RIPA lysis buffer. After biotinylation
and lysis, samples were divided into two equal samples and immunoprecipitated with
anti-CFTR nucleotide binding domain 1 antibody and protein A-agarose. One of the
immunoprecipitated samples was then eluted from the beads using Laemmli sample
buffer (without bromphenol blue), diluted in RIPA buffer (150 mm NaCl, 1% Nonidet
P-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mmTris-HCl, pH 8.0) 10-fold, and the
biotinylated fraction was captured with avidin-Sepharose beads (Pierce) overnight at
4oC. Both total CFTR and biotinylated CFTR were then in vitro phosphorylated using
[γ32P]ATP (PerkinElmer Life Sciences) and cAMP-dependent protein kinase
(Promega).
18
4.7. Internalization assays
CFTR internalization assays were performed as described previously(Peter et al., 2002,
Jurkuvenaite et al., 2006). Briefly, surface carbohydrate groups on the cells were
oxidized with sodium periodate (NaIO4, 10mM), washed on ice with Mg2+- and Ca2+supplemented (0.5 mM MgCl2 and 0.9 mM CaCl2) PBS buffer and warmed to 37 °C or
27 °C for 2.5 or 10 min. Oxidized surface carbohydrate groups remaining on the cell
surface after a warm-up period were labelled with biotin–LC–hydrazide (1 mg/ml;
Pierce), followed by cell lysis in RIPA buffer. CFTR was then immunoprecipitated as
described above. CFTR internalization was identified as the percentage loss of
biotinylated CFTR during the warm-up period compared with the control samples (no
warm-up period).
4.8. CFTR cell-surface half-life measurements
Cells were metabolically labeled (Jurkuvenaite et al., 2006) and biotinylated as
described previously (Peter et al., 2002). Initial (0 time point) samples were
immediately lysed in RIPA buffer, and the rest of the samples were transferred into to a
37 °C incubator for 2, 4 and 8 h. At each time point, cells were lysed in RIPA buffer,
CFTR was immunoprecipitated and analysed by SDS/PAGE (6% gels) and Western
blotting (see below), and autoradiography was performed following the manufacturer's
instructions (PhosphorImager; Amersham Biosciences). Half-lives of the proteins were
calculated as described previously (Green et al., 1994, Jurkuvenaite et al., 2006).
4.9. Metabolic Pulse-Chase Assays
For transiently transfected COS-7 cells: One day post-transfection, COS-7 cells (one
35-mm dish/time point) were rinsed three times and incubated in methionine-free
Dulbecco's modified Eagle's medium for 1 h and then pulsed in the same media
containing 200 μCi/ml trans-[35S]methionine (ICN Biomedicals). Pulse-labeled cells
were chased for 0, 4, 14, 18, or 24 h in complete media. At each time point, the cells
were placed on ice and rinsed with cold phosphate-buffered saline, lysed in RIPA
buffer, and incubated for an additional 30 min on ice. CFTR was immunoprecipitated
from the post-nuclear supernatants and analyzed by SDS-PAGE and autoradiography
19
(PhosphorImager, AmershamBiosciences). Calculation of the protein half-lives was
performed as described by Straley et al. (1998)(Straley et al., 1998).
For endogenously expressing Calu-3 and T84 cells: One hour before addition of radio
labeled amino acids, the tissue culture medium was replaced with methionine/cysteinefree minimal essential medium. After 1 h of methionine starvation at 37 °C, 300 μCi/ml
EasyTag Protein Labeling Mixture ([35S]methionine/cysteine, PerkinElmer Life
Sciences) was added, and cells were pulse-labeled for 30 min (for the maturation
studies) or 60 min (for protein half-life analysis). The radioactive medium was then
exchanged with cold, complete medium and cultured for various chase periods. Cells
were lysed at the time points indicated and CFTR was immunoprecipitated using the 241
monoclonal
antibody
and
protein
A+G-agarose
(Roche
Diagnostics).
Immunoprecipitated samples were analyzed by SDS-PAGE (6% gels) and detected
using autoradiography (PhosphorImager, Amersham Biosciences). Calculation of
protein half-lives was performed as described by Straley et al. (1998)(Straley et al.,
1998). Maturation efficiency was measured by comparing the density of the labeled
Band B to the density of the fully glycosylated band C using IPLab software
(Scanalytics, Inc.) as described previously(Bebok et al., 2002).
For stable transduced HeLa and CFBE cells: For experiments at 37 °C, cells were
metabolically labelled as described previously (Jurkuvenaite et al., 2006). For metabolic
labelling during permissive temperature (27 °C) culture, cells were transferred to 27 °C
and the medium replaced with cysteine- and methionine-free MEM (Specialty Media,
Phillipsburg, NJ, U.S.A.) for 1 h. Cells were subsequently incubated with 300 mCi/ml
[35S]methionine/cysteine (EasyTagTM; PerkinElmer) for 18 h at 27 °C. This extended
metabolic labelling pulse was necessary to produce a labelled CFTR signal at 27 °C that
formed sufficient quantities of mature, glycosylated CFTR (C band) to follow during
the chase period. On completion of labelling, the medium was replaced with complete
medium without radioisotopes and cells were cultured at either 37 °C or 27 °C for the
time points indicated.
20
4.10. Western Blot
Total and biotinylated CFTR or TR were detected as described previously(Jurkuvenaite
et al., 2006). Briefly, CFTR and TR were immunoprecipitated and analysed by
SDS/PAGE (6% gels) and Western blotting. Membranes were blocked overnight in 3%
(w/v) BSA and 0.5% Tween 20 in PBS. All antibodies were incubated for 1 h at 25 °C.
Total CFTR was detected with polyclonal anti-[CFTR NBD (nucleotide binding
domain)2] antibody (1:5000 dilution, H-182; Santa Cruz Biotechnology). Total TR was
detected with a polyclonal anti-(TR external domain) antibody (1:5000 dilution;
MorphoSys, Raleigh, NC, U.S.A.). Biotinylated CFTR and TR were detected with HRP
(horseradish
peroxidase)-conjugated
avidin
(1:5000
dilution;
Sigma).
Chemiluminescence was induced with high-sensitivity Immobilon Western substrate
(Millipore). The membranes were exposed for different time periods (up to 3 min) and a
linear range for a standard set of diluted samples was calibrated. Western blots were
analysed and densities measured using ImageJ (National Institutes of Health),
ScionImage (National Institutes of Health), or IPLab (BD Biosciences) software.
Results are means (n 3).
4.11. Whole Cell Patch Clamp Assays
Individual dishes of transfected COS-7 cells were used in electrophysiological
recordings as described previously (Moyer et al., 1998). One modification is that
PClamp 8.0 software was used in this study. COS-7 cells were transiently transfected
with each of the CFTR constructs along with pGL-1 (pGreen Lantern-1, a green
fluorescence protein (GFP) plasmid). Under these conditions, >90% GFP and CFTR cotransfectants respond to cyclic AMP mixture (250 μM 8-Br-cAMP and chlorophenyl
thio-cAMP plus 2 μM forskolin) treatment with an increase in whole cell Cl−
conductance. Background levels of cyclic AMP-activated Cl− conductance were
monitored in non-transfected cells in the same dish that lack GFP fluorescence, in
mock-transfected cells, and in parental cells. In these whole-cell recordings, the bath
(extracellular) solution contained 145 mm Tris-Cl, 1 mm CaCl2, 1 mm MgCl2, 5 mm
glucose, 60 mm sucrose, and 5 mM HEPES, pH 7.45. The pipette (intracellular)
solution contained 145 mM Tris-Cl, 5 mM HEPES, 100 nM CaCl2 and MgCl2 (chelated
21
with 2 mM EGTA), and 5 mm Mg2+-ATP, pH 7.45. These solutions were designed to
study the only current flowing through Cl− channels because Cl− is the only permeant
ion in solution, to clamp intracellular Ca2+ at ∼100 nm, and to prevent swellingactivated Cl−currents with added sucrose in the bath solution.
4.12. Single Channel Patch Clamp
Assays of single channel recordings were obtained from membrane patches in both the
cell-attached and inside-out configurations. Recording pipettes were constructed from
borosilicate glass capillaries (Warner Instrument Corporation, Hamden, CT) using a
Narishige PC-10 microelectrode puller (Narishige Scientific Instrument Laboratory,
Tokyo, Japan) and were fire-polished with a Narishige microcentrifuge. The pipettes
were partially filled with standard pipette solution and had tip resistances of 5–10
megaohms. Experiments were performed at room temperature (20–22 °C). Currents
were recorded at 50–60 mV (negative to pipette potential) using an Axopatch 200B
patch clamp amplifier (Axon Instruments, Union City, CA) low pass-filtered at 1000 Hz
(LPF-8, Warner Instruments), sampled every 100 μs with a Digidata 1321A interface
(Axon Instruments), and stored onto the computer hard disk using PClamp 8 software
(Axon Instruments). A brief protocol of stepping the holding potential from −100 to
+100 mV and back to −100 mV served to inactivate a contaminating voltage-dependent
Cl− channel (probably ClC-2) that was hyperpolarization-activated but inactivated
permanently by a +100-mV pulse. The pipette solution contained (in mmol/liter): 150
NaCl, 1 MgCl2, 1 CaCl2, 5 HEPES, pH 7.4. The bath solution contained (in mmol/liter):
150 NaCl, 1 MgCl2, 5 EGTA, 5 HEPES, pH 7.4.
4.13. Semiquantitative RT-PCR
Total RNA was isolated from each filter using RNeasy mini kit (Qiagen). RNA
concentration was calculated based on the absorbance of samples at 260 nm. One tube
from the RT-PCR kit (Qiagen) was used to amplify the CFTR mRNA using 1 ng of total
RNA as templates. The primers were designed to anneal to two different exons (exon 10
and exon 11) to prevent possible amplification from genomic DNA and pre-mRNA. The
sequences of the primers were 5′ ACTTCACTTCTAATGATGAT 3′(exon-10F1) and 5′
AAAACATCTAGGTATCCAA 3′(exon-11R). Two primers specific for GAPDH were
22
used as controls for each sample (Li and Wang, 1999). RT-PCR was performed as
instructed by manufacturer. The number of PCR cycles for this experiment was
experimentally determined (28 cycles) to allow semiquantification of PCR products
during the log-linear phase of amplification. RNA samples isolated from CFTRnegative HeLa cells were used as control to assure the specificity of the PCR product.
The specificity of the GAPDH primers were previously tested (Li and Wang, 1999).
Controls with no template or reverse transcriptase were also included. Experiments were
repeated two times.
4.14. Fluorescence-based Kinetic Real-time PCR
Isolated RNA samples were also analyzed by fluorescence-based kinetic real-time PCR
using the ABI PRISM 7900 Sequence Detection System as described previously for
other genes (Haslett et al., 2002). One-step RT-PCR was performed on serial dilutions
of RNA isolates using Master Mix Reagent kit and Assay-on-Demand Gene Expression
Probes
(Applied
Biosystems,
CFTR
Assay
ID:
HS00357011_m1).
6-
Carboxylfluorescein was chosen as reporter dye at the 5′-end of the probe and minor
groove binder as the quencher at the 3′-end. The 5′ nuclease activity of Taq DNA
polymerase cleaves the probe and generates a fluorescent signal proportional to the
amount of starting target template. Each reporter signal is then divided by the
fluorescence of an internal reference dye 5-carboxy-X-rhodamine, to normalize for nonPCR-related fluorescence. The TaqMan RT-PCR reaction was performed in a final
volume of 20 μl containing 0.5 μl of RNA, 10 μl of TaqMan One-step RT-PCR master
mix (Applied Biosystems), 0.5 μl of Multiscribe/RNase inhibitor, and 1 μl of 20×
primer/probe set for CFTR and/or 18 S rRNA as endogenous control. Six 10-fold serial
dilutions (100-10-6) of RNA samples isolated from the models cell lines were amplified
in duplicates using CFTR and/or 18 S endogenous control. Data were exported from the
ABI Prism 7900SDS software into Microsoft Excel where relative standard curves were
plotted. Using the Excel Trendline option, a line of best fit was plotted. Data from each
cell line were analyzed based on these standard curves and relative quantities were
extrapolated. CFTR values were normalized to 18 S by dividing the CFTR values by the
corresponding 18 S values from the same sample according to the Applied Biosystems
relative quantification method. The specificity and quality of the primers is assured by
23
ABI. Appropriate controls with no RNA, primers, or reverse transcriptase were included
in each set of experiments.
4.15. Microscopy
Images were captured on an Olympus IX170 inverted epifluorescence microscope
equipped with step motor, filter wheel assembly (Ludl Electronics Products, Hawthorne,
NY), and 83,000 filter set (Chroma Technology, Brattleboro, VT). Images were
captured with SenSys-cooled charge-coupled high-resolution camera (Photometrics,
Tucson, AZ). Partial deconvolution of images was performed using IPLab software
(Scanalytics, Fairfax, VA). (Bebok et al., 2002)
4.16. Ussing chamber analyses
Measurements of Isc (short-circuit current) and Rt (transepithelial resistance) were
performed as described previously (Chen et al., 2006). Briefly, filters containing
monolayers of either CFBE41o- F or CFBE41o-WT cells were mounted in Ussing
chambers (Jim's Instruments, Iowa City, IA, U.S.A.) and bathed on both sides with
solutions containing 120 mM NaCl, 25 mM NaHCO3, 3.3 mM KH2PO4, 0.83 mM
K2HPO4, 1.2 mM CaCl2, 1.2 mM MgCl2, 10 mM Hepes (sodium-free), 10 mM mannitol
(apical compartment) and 10 mM glucose (basolateral compartment). Osmolality of all
solutions, as measured by a freezing depression osmometer (Wescor, Logan, UT,
U.S.A.), was between 290 and 300 mOsm/kg of water. The bath solutions were stirred
vigorously by continuous bubbling with 95% O2 and 5% CO2 at 37 °C (pH 7.4).
Monolayers were short-circuited to 0 mV, and Isc (mA/cm2) was measured with an
epithelial voltage clamp (VCC-600; Physiologic Instruments, San Diego, CA, U.S.A.).
A 10 mV pulse of 1 s duration was imposed every 10 s to monitor Rt, which was
calculated using Ohm's law. Data were collected using the Acquire and Analyse
program (version 1.45; Physiologic Instruments). Results are DIsc forskolin (response to
forskolin) and DIsc glybenclamide (response to glybenclamide). During Ussing chamber
analysis, the temperatures (27 °C or 37 °C) were maintained by using a temperaturecontrolled water bath for at least 30 min before analysis. Following establishment of
steady-state values of Isc and Rt, forskolin (10 mM) and/or the indicated inhibitors were
24
added to the apical compartments, and Isc and Rt were measured continuously until new
steady-state values were reached.
4.17. Statistical analysis
Results were expressed as means ± S.D. Statistical significance among means was
determined using the Student's t test (two samples).
25
5. RESULTS
5.1. Ablation of Internalization Signals in the C-terminal Tail of CFTR
enhances Surface expression
5.1.1. Mutations in the Carboxyl-terminal Tail of CFTR Increase
Surface Expression
Our hypothesis in these experiments is that if both tyrosine 1424 and isoleucine 1427
are important for CFTR internalization, complete disruption of these residues should
increase CFTR surface expression. Because little is known concerning the nature of
CFTR endocytosis and recycling or how these processes affect CFTR function, we
constructed a double substitution COOH-terminal mutant in which both tyrosine 1424
and the isoleucine 1427 were changed to alanine.
First, we determined the effects of these substitutions on CFTR surface expression by
comparing the percentage of wild-type and mutant CFTR at the cell surface using a
surface biotinylation assay. COS-7 cells expressing wild-type, Y1424A, and
Y1424A,I1427A CFTR were surface-biotinylated and lysed in RIPA buffer (see
“Materials and Methods”). Total CFTR was measured following immunoprecipitation
from 50% of the lysate detected by in vitro phosphorylation ([γ-32P]ATP and protein
kinase A) and analyzed by SDS-PAGE and autoradiography (Fig.2,top panel, total
CFTR). CFTR was also immunoprecipitated from the other half of the lysate. This
fraction was then eluted from the protein-A beads, reprecipitated using monomeric
avidin-Sepharose (to separate biotinylated CFTR), and detected as described above for
the total CFTR (Fig.2, top panel). The percentage CFTR at the cell surface was
markedly increased for Y1424A,I1427A CFTR compared with both wild-type (108%
increase, n = 10,p < 0.001) and Y1424A CFTR (59% increase, n = 10, p < 0.001) (Fig.
2,bottom panel). The surface biotinylation data indicated that modification of residues
Tyr1424 and Ile1427increased the steady-state surface expression of CFTR. The potential
mechanisms that could account for these differences include changes in 1) maturation
efficiency, 2) protein half-life, or 3) internalization and/or recycling rates.
26
5.1.2. Mutations at Tyr1424 and Ile1427 Do Not Alter CFTR Maturation
Efficiency or Protein Half-life
To test the effects of these mutations on maturation efficiency and protein half-life, we
performed metabolic pulse-chase experiments on COS-7 cells expressing wild-type,
Y1424A, and Y1424A, I1427A CFTR. CFTR half-lives were measured 24 h posttransfection. The results in Fig. 3 show that the half-lives for wild-type (Wt), Y1424A,
and Y1424A,I1427A CFTR were 10.3 ± 2.3, 11.3 ± 2.6, and 11.3 ± 1.5 h (mean ± S.D.).
This finding indicated that the elevated surface expression of the mutants was not
attributed to enhanced protein half-life.
5.1.3. Tyrosine 1424 and Isoleucine 1427 Are Necessary for CFTR
Endocytosis
To test whether elevated surface expression was attributed to alterations in the
internalization rate of CFTR, we performed internalization assays on COS-7 cells
expressing wild-type, Y1424A, and Y1424A,I1427A CFTR. Using a warm-up period
between periodate and the biotin LC-hydrazide treatments (0 or 2.5 min), we monitored
the loss of the surface pool of CFTR (see “Materials and Methods”). During this warmup period, previously oxidized carbohydrate residues are internalized and therefore do
not react with the membrane-impermeant biotin LC hydrazide. A representative
internalization assay for each of the constructs is shown in Fig.4, top panel. A summary
of eight assays is shown in the lower panel. For wild-type CFTR, 34% of the surface
pool was internalized in 2.5 min. For Y1424A and Y1424A,I1427A CFTR,
internalization dropped to 21 and 8%, respectively, during the same time period. These
results demonstrate that CFTR endocytosis is inhibited by 76% when these two residues
are modified.
5.1.4. The Y1424A and Y1424A,I1427A CFTR Have Normal Chloride
Channel Properties
Because the biochemical data suggested that a specific motif in the CFTR COOH
terminus dramatically affected endocytosis and because point mutations in the NH2
terminus lead to both disruption of binding to docking machinery and changes in CFTR
27
ion channel function, we tested whether the mutation of Tyr1424and Ile1427 affected
chloride channel function. Whole cell patch clamp recordings were performed to assess
the total population of CFTR Cl− channels in the plasma membrane of transfected COS7 cells. Tris-Cl-containing solutions were used in bath (extracellular) and pipette
(intracellular) solutions so that Cl− was the only major permeant ionic species in the
recordings. GFP was also expressed together with the CFTR-bearing vectors to detect
cells that were successfully transfected prior to recording. Cells that did not express
GFP served as internal controls. Three sets of transiently transfected COS-7 cells were
examined in parallel with the above biotinylation experiments (Table I). In agreement
with the surface biotinylation assays, CFTR whole cell Cl− currents in Y1424A CFTR
and Y1424A,I1427A CFTR-transfected cells were elevated compared with wild-type
CFTR-expressing cells (Table I), suggesting that the elevated Cl− channel activity was
the result of the elevated surface expression of CFTR. Typical whole cell current traces
after stimulation with cAMP agonist mixture for wild-type and mutant CFTR are shown
in Fig.5 A. Fig. 5 B shows wild-type CFTR Cl− current-voltage relationships
demonstrating insensitivity of the currents to DIDS (100 μM) and inhibition of the
currents by glibenclamide (100 μM). These pharmacological properties are consistent
with wild-type CFTR(Schwiebert et al., 1998). The time and voltage independence of
the currents and the linear I–V relationship are also consistent with CFTR chloride
channel activity. Fig. 5, C and D, show the Y1424A and Y1424A,I1427A Cl− currentvoltage relationships, respectively, and indicate that although the sensitivities to DIDS
and glibenclamide remain similar to wild-type (Fig. 5 B), the total current is elevated in
the single and double mutants. Whereas the representative I–V plots show a variability
in sensitivity to glibenclamide, inhibition with this Cl− channel-blocking drug was only
partial ranging from 50 to 90% for both wild-type and mutant currents.
Single channel biophysical properties of wild-type, Y1424A, and Y1424A,I1427A
CFTR were also assessed. Before the recording of CFTR Cl− channel properties under
cAMP-stimulated conditions was undertaken, voltage steps between −100 and +100 mV
were necessary to inactivate a pseudo-channel with similar Cl−conductance as CFTR.
The properties of this channel were not inconsistent with ClC-2, known to be expressed
in COS-7 cells(Thiemann et al., 1992). Representative recordings of wild-type,
Y1424A, and Y1424A,I1427A CFTR at 50–60 mV (negative to pipette potential) are
28
shown in Fig.5 E. Single channel conductance for all three constructs was 7–8
picoSiemens for stretches of the recordings where a subset of the channels could be
analyzed. Biophysical analysis of single channel kinetics was not possible, because each
patch obtained from a positively transfected cell had at least 10 channels. We could
never obtain patches with a single channel. Furthermore, a base line without channel
openings was not observed. Nevertheless, the whole cell and single channel recordings
together show that the difference in Cl− channel activity is attributed to elevated surface
expression without a significant change in CFTR chloride channel properties among
wild-type, Y1424A, and Y1424A,I1427A CFTR.
29
Figure 2: Surface expression levels of wild-type and mutant CFTR in COS-7 cells.
The levels of expression of wild-type (Wt), Y1424A, and Y1424A,I1427A CFTR were
analyzed in COS-7 cells 48 h after transfection. Cells were lysed in RIPA buffer, and
CFTR was immunoprecipitated using an anti-nucleotide binding domain 1 polyclonal
antibody. Total, total CFTR from 50% of the lysate. Biotinylated CFTR was eluted from
the antibody-protein A beads and reprecipitated using avidin-Sepharose beads.
Biotinylated, CFTR from 50% of the lysate. Mock transfected cells were used as a
negative control (lanes 1and 5). Immunoprecipitated (Total) and reprecipitated
(Biotinylated) CFTR were in vitro phosphorylated with protein kinase A and [γ32
P]ATP and analyzed by SDS-PAGE and autoradiography. A representative gel of 10
is shown (top panel). The relative amounts of wild-type (lanes 2 and 6), Y1424A (lanes
3 and7), and Y1424A, I1427A CFTR (lanes 4 and8) are shown. The averages ± S.E.
were calculated from the phosphorimaging analysis from 10 independent experiments.
*,p < 0.02; +, p < 0.001 (compared with wild-type CFTR (lower panel)).
30
Figure 3: Point mutations in the CFTR COOH terminus do not affect protein
stability or maturation efficiency. The protein turnover and processing of CFTR and
CFTR mutants were monitored in COS-7 cells 24 h after transfection in metabolic
pulse-chase experiments. After a 1-h pulse and the indicated chase time periods, the
cells were lysed in RIPA buffer and CFTR or CFTR mutants were immunoprecipitated
and analyzed as described under “Materials and Methods.” Mock (M) transfected cells
were used as a negative control. The top panel shows a representative gel. Bands B and
C of CFTR indicated on the left. The average half-lives and maturation efficiencies from
four independent experiments shown below demonstrate that the half-lives (left panel)
and maturation efficiencies (right panel) are not affected by these two CFTR
substitutions.
In the same series of experiments, we also compared the amount of immaturely
glycosylated CFTR (Band B) at 0 time with the amount of maturely glycosylated CFTR
(Band C) at 4 h (top panel). The average maturation efficiency for wild-type (Wt),
Y1424A, and Y1424A,I1427A CFTR were 32, 31, and 31%, respectively (bottom right
panel). This finding demonstrated that elevated surface expression of Y1424A,I1427A
CFTR was not because of alterations in maturation efficiency.
31
Figure 4: Comparisons of the internalization rates of CFTR and CFTR mutants.
COS-7 cells transfected with wild-type, Y1424A, or Y1424A,I1427A CFTR were
analyzed 48-h post-transfection. Wild-type or mutant CFTR was biotinylated using a
two-step surface periodate/LC-hydrazide biotinylation procedure. At zero time, both
steps were conducted at 4 °C to label the entire pool of CFTR. Internalization was
monitored by a loss of biotinylated of the cell surface pool by including a 37 °C
incubation period (Time (min)) between periodate and biotin LC-hydrazide treatments.
Biotinylated CFTR and total CFTR were detected as shown in Fig.2. The percentage of
wild-type, Y1424A, and Y1424A,I1427A CFTR internalized after 2.5 min was 34, 18,
and 8 respectively. 1 of 8 representative experiments is shown. In thebottom panel, the
percentage of CFTR internalized at each time point was calculated based on
phosphorimaging analysis (averages from eight experiments: *, p < 0.05 compared with
Wt; +, p < 0.001 compared with Wt).
32
cAMP-activated chloride current
1-
a
Transient transfection
Non-green
Green
Control
Wild type
Y1424A
Y1424A/I1427A
pA at +100 mV
Set 1
1-b
255 ± 36 (13)
1-c
†
1070 ± 95 (5) 1650 ± 200* (5) 2125 ± 195 (5)
(Fold-difference)
Set 2
201 ± 68 (3)
1.0
1.54
1.99
738 ± 52 (5)
986 ± 24* (5)
1451 ± 35 (5)
1.0
1.34
1.97
(Fold-difference)
Set 3
393 ± 140 (4)
†
†
1193 ± 55 (7) 1767 ± 164* (7) 3424 ± 205 (6)
(Fold-difference)
1.0
1.48
2.87
Fold-difference average
1.0
1.45 ± 0.06*
2.28 ± 0.30
†
Table I
Summary of whole cell patch clamp recordings for wild-type CFTR and for CFTR
mutants shows elevated activity in the mutants relative to wild type
33
Figure 5: Chloride channel activity of the CFTR COOH-terminal mutants is
normal but expression of the mutants is elevated. Table I. shows the complete
summary of the whole-cell patch clamp data. Panel A showed typical whole-cell current
records. Typical whole-cell I–V plots for wild-type CFTR (panel B), Y1424A (panel
C), and Y1424A,I1427A (panel D) showing cyclic AMP-stimulated chloride currents in
the absence of blockers (squares), presence of DIDS (upward triangles), and presence
of glibenclamide (inverted triangles). A non-green cell showing background cyclic
AMP-stimulated chloride currents is also shown in each plot (circles). A linear I–V
relationship and time- and voltage-independent kinetics are hallmarks of CFTR
channels and were similar in nature between wild type (WT) and the mutants. Panel E
shows representative single channel current traces for WT and the mutants. Although
these segments of recordings show more channels and more “wave-like” cooperative
gating in the mutantsversus the wild type, N or number of channels per patch could not
34
be calculated because a quiet 0-channel base line was never reserved in patches that
contained CFTR channels.
5.2. Intracellular Processing of CFTR is Efficient in Epithelial cell Lines
5.2.1. Calu-3 Cells Express High Levels of CFTR Compared with
Heterologous Expression Systems
To compare CFTR biogenesis in heterologous versus endogenous expression systems,
we first determined the relative amounts of CFTR in transiently transfected COS-7
cells, in HeLa cells stably expressing CFTR, and in cells that endogenously express
CFTR, Calu-3 cells. COS-7 cells represent a common cell type that has been used
extensively to study CFTR biogenesis(Cheng et al., 1990b, Prince et al., 1999, Peter et
al., 2002), while HeLa and Calu-3 cells (Loffing et al., 1998, Loffing et al., 1999, Sun et
al., 2000b, Bebok et al., 2002) were selected based on their stable, high expression
levels of wild type CFTR.
To compare CFTR expression levels in the model cell lines, CFTR was
immunoprecipitated from 250 μg of total cellular protein under standardized conditions.
Relative amounts of CFTR expressed in each cell type were calculated based on
densitometry and are shown in Fig. 6A. In COS-7 cells, CFTR expression levels are
dependent upon transfection efficiency, while in HeLa and Calu-3 cells, the expression
levels were consistently high. Since the relative expression level in Calu-3 cells was
similar to HeLa cells stably expressing wild type CFTR, we selected Calu-3 cells for the
initial analysis.
The simplest explanation for high CFTR levels both in HeLa and Calu-3 cells is that
they have similar CFTR mRNA levels, protein synthetic rates, and stability. To compare
CFTR mRNA levels in HeLa and Calu-3 cells, we developed a semiquantitative RTPCR using GAPDH as an internal control. As shown in Fig. 6B, while GAPDH
message levels are similar, CFTR message levels are significantly higher in HeLa cells
than in Calu-3 (in contrast to rather similar protein levels (Fig. 6A)). To further assess
these differences, we also performed TaqMan Quantitative PCR (Fig. 6C). The results
of the real-time experiments establish that CFTR message levels in HeLa cells are 3.535
fold higher than in Calu-3 cells. These findings imply that the high steady-state levels of
CFTR in Calu-3 cells must be due to increased translational rate, increased maturation
efficiency, extended protein half-life, or some combination of these effects.
5.2.2. CFTR Maturation and Protein Stability Are Enhanced in Calu-3
Cells
To monitor CFTR maturation efficiency and protein half-life in Calu-3 cells and
compare these values to previously reported results, we performed metabolic pulsechase experiments and followed CFTR maturation in COS-7, HeLa, and Calu-3 cells. In
these experiments, we compared the amount of the newly synthesized Band B CFTR
and its conversion to the fully glycosylated Band C CFTR in each cell type. The results
indicate that significantly more CFTR was synthesized in COS-7 and HeLa cells than in
Calu-3 cells, as was first described by Cheng et al. (Cheng et al., 1990b). The
conversion of the immaturely glycosylated CFTR to the maturely glycosylated form
was extremely inefficient, with 27 ± 7.1% (mean ± S.D.; n = 7) maturation efficiency in
COS-7 cells and 39 ± 5.1% (n = 11) in HeLa (Fig. 7A). In contrast, while the amount of
the newly synthesized Band B form of CFTR was the lowest in Calu-3 cells, the
maturation efficiency was 92.4 ± 8% (n = 11) after 4 h (Fig. 7B). These results indicate
that although less CFTR was being produced in Calu-3 cells, the protein was processed
much more efficiently to the mature form. Furthermore, comparing the total densities of
Band B and Band C CFTR over the 4-h chase indicated that the total densities remain
constant. This suggests that there is no early degradation, and all newly synthesized
Band B is converted into Band C, and that the maturation only reaches maximum after 4
h of the pulse.
To test whether increased CFTR maturation efficiency alone is responsible for high
CFTR levels in Calu-3 cells, we determined the half-life of the fully glycosylated CFTR
in each cell line. Using a more extended chase period in the metabolic labeling
experiments, we found that CFTR half-lives were 10.8 ± 2.5 h (mean ± S.D.) in COS-7
cells, 12.3 ± 1.7 h in HeLa cells, and 22.0 ± 4.2 h in Calu-3 cells (Fig. 8). The results
indicate that CFTR is more stable in Calu-3 cells compared with heterologous cells.
36
Therefore, more efficient CFTR maturation and elongated protein half-lives contribute
to the high steady state CFTR levels in these cells.
5.2.3. ERAD of CFTR Is Insignificant in Calu-3 Cells
Early degradation of wild type CFTR by the proteasome has been described as a
common feature of CFTR biogenesis (Jensen et al., 1995b, Ward et al., 1995, Bebok et
al., 1998). Because CFTR maturation approaches 100% efficiency in Calu-3 cells, we
hypothesized that the disappearance of Band B CFTR in these cells is clearly the result
of maturation and not degradation by the proteasome. To test this possibility, we
compared the effects of two proteasome inhibitors (ALLN (50 μM) (Jensen et al.,
1995b) and clasto-lactacystin-β-lactone (10 μm)(Dick et al., 1996)) on the half-lives of
Band B CFTR in HeLa and Calu-3 cells. As shown in Fig. 9, while 50 μM ALLN
caused a significant increase in the half-life of Band B CFTR in HeLa cells, it had no
effect on the stability of the immature CFTR in Calu-3 cells, suggesting that the coreglycosylated protein is not a substrate for ERAD in Calu-3 cells. Similar results were
seen when the proteasome was blocked using 10 μM clasto-lactacystin-β-lactone (data
not shown). These results support our hypothesis that in Calu-3 cells all newly
synthesized, core-glycosylated CFTR is processed to the fully glycosylated form, and
therefore, there is no role for the proteasome in the early events of CFTR processing in
Calu-3 cells.
5.2.4. Cell Surface CFTR Expression Is Elevated in Calu-3 Cells
To test whether increased CFTR stability translates to a higher percentage of CFTR at
the cell surface, we performed quantitative cell surface biotinylation experiments and
compared the biotinylated and total pools of CFTR in each of the cell lines. The results
shown in Fig. 10A indicate that the biotinylated CFTR pool in COS-7 cells was 11 ±
2.2% (mean ± S.D.), in HeLa was 9.7 ± 1.5%, and in Calu-3 was 20 ± 4.0%. Since
Calu-3 cells were grown on plastic dishes under standard tissue culture conditions; we
tested whether growing the cells on semipermeable supports as polarized monolayers
affects CFTR surface expression. After growing the cells for 9-12 days on 12-mm
filters, the cells formed tight monolayers as monitored by measuring transepithelial
resistance (>800 Ω·cm2). Under these conditions, the biotinylated CFTR fraction was 17
37
± 5%, similar to non-polarized cells. These results demonstrate that the surface CFTR
pool in Calu-3 cells is higher, but cell polarity does not affect the relative surface pool.
The fact that CFTR surface expression is not elevated in polarized cells was somewhat
surprising, given that in HT29 cells, a colonic epithelial cell line, CFTR surface
expression requires polarization of the colonocytes (Morris et al., 1994). To confirm
that Calu-3 cells had formed polarized monolayers, we monitored the expression a ZO1, a marker for tight junctions (red)(Coyne et al., 2002), and CFTR (green) localization
in the Calu-3 cells using immunocytochemistry (Fig. 10B). The results shown in Fig.
10B indicate that the Calu-3 cells have formed tight monolayers as evidenced by ZO-1
staining (red) close to the apical surface and that CFTR (green) is found both at the cell
surface and in intracellular sites. Next, we tested whether the rate and efficiency of
CFTR maturation was affected by cell polarity. The results shown in Fig. 10C confirm
that similar to conventional tissue culture conditions (Fig 7 A and B), CFTR maturation
is also efficient under polarizing conditions (>90%). Interestingly, these experiments in
Calu-3 monolayers suggested that the amount of radiolabeled CFTR dramatically
decreased compared with non-polarized conditions and that rates of conversion of
newly synthesized (Band B) CFTR to fully glycosylated (Band C) CFTR was slower
than under standard conditions. Only ∼30% of the newly synthesized (Band B) CFTR
was converted into fully glycosylated (Band C) at 2 h, and maturation was completed
only after 6 h of chase.
5.2.5. CFTR Maturation Is Efficient in T84 Cells Grown under Standard
Tissue Culture Conditions
To determine whether efficient CFTR maturation is a special feature of Calu-3 cells or
present in other endogenous CFTR expressing cell lines, we also tested T84 and HT29
colonic epithelial cell lines endogenously expressing wild type CFTR. Fig 11A indicates
that steady state CFTR protein levels are highest in Calu-3 cells. In T84 and HT29 cells,
CFTR levels are 3- and >10-fold lower than in Calu-3, respectively (Fig 11A). TaqMan
RT-PCR measurements demonstrated that CFTR message levels in T84 cells are 4-fold
and in HT29 are 10-fold lower than in Calu-3 cells grown under the same conditions
(Fig 11B). Because of low transcription and consequent low translation of CFTR in
38
HT29 cells, only T84 cells synthesized sufficient amounts of the protein to effectively
follow maturation efficiency. As shown in Fig 11C, although CFTR synthetic levels
were quite low and maturation efficiency in the early chase periods was variable, by the
end of the 4th h into the chase, the maturation of the newly synthesized protein was
virtually 100% in T84 cells. These results indicate that efficient processing of
endogenous wild type CFTR is not a unique feature of Calu-3 cells but also exists in a
colonic epithelial cell line.
39
Figure 6: CFTR and mRNA levels in different cell lines.A, steady-state wild type
CFTR protein level is high in Calu-3 cells. In transfected COS-7 cells, wild type CFTR
expression levels were analyzed 48 h after transfection. HeLa cells stably expressing
CFTR, and Calu-3 cells endogenously expressing the protein, were grown under
40
standard conditions and tested at ~80% confluence. CFTR was immunoprecipitated
from 250 μg of total protein from each cell type using an anti-CFTR C-terminal
monoclonal antibody, 24-1. Immunoprecipitated CFTR was in vitro phosphorylated
with protein kinase A and [γ-32P]ATP and analyzed by SDS-PAGE and
autoradiography. A representative gel of four is shown (upper panel). The relative
amounts of wild type CFTR expressed in each of the cell lines were calculated based on
densitometry (lower panel). The averages ± S.D. were calculated from four independent
experiments. B, CFTR mRNA levels are significantly lower in Calu-3 cells than in
HeLa cells. CFTR message levels in HeLa and Calu-3 cells were tested using
semiquantitative RT-PCR using GAPDH as control (upper panel, representative gel is
shown) and TaqMan quantitative PCR using 18 S rRNA as control (lower panel).
Results are plotted as CFTR mRNA levels relative to 18 S rRNA, mean and S.D. of four
separate samples amplified under the same condition. In contrast to slightly lower
CFTR protein levels, CFTR message levels are ~4-fold higher in HeLa cells.
41
Figure 7: CFTR maturation is efficient in Calu-3 cells. COS-7, HeLa, and Calu-3
cells were pulse-labeled with 300 mCi/ml
Labeling
Mixture,
PerkinElmer
35
S-labeled amino acids (EasyTag Protein
Life
Sciences).
After
the
pulse,
the
35
[ S]methionine/cysteine-containing medium was replaced with complete medium.
Cells were lysed at the time points specified, and CFTR was immunoprecipitated with
42
anti-CFTR 24-1 antibody. Samples were separated by SDS-PAGE on 6% gels and
analyzed using a Phosphorimager (Amersham Biosciences). CFTR maturation
efficiency was measured by comparing the density of labeled band B (100%) after a 30min pulse to the density of Band C after 4 h of chase using IPLab software. A, average
maturation efficiencies at the end of a 4-h chase in each cell line tested. Results are
plotted as percent of newly synthesized Band B converted to Band C by the end of a 4-h
chase (average + S.D., n = number of experiments). B, representative pulse-chase
experiments are shown for each cell line (left panels). Arrows indicate the core (Band
B) and fully glycosylated (Band C) CFTR. Average disappearance of Band B
(maturation and/or degradation) and formation of Band C at each time point (right
panels). Disappearance of Band B (diamonds) and formation of Band C (squares) were
calculated based on densitometry at each chase time point. Results are plotted as percent
of band B density at the 0 time point (average + S.D., n = 5).
43
Figure 8: CFTR half-life is longer in Calu-3 cells compared with heterologous
expression systems. In COS-7 cells, CFTR half-lives were tested 24 h after transfection
and in HeLa and Calu-3 cells 24 h after seeding. After a 1-h pulse with [35S]methionine
(EasyTag Protein Labeling Mixture) and the indicated chase periods in complete
medium, the cells were lysed in radioimmune precipitation assay buffer and CFTR was
immunoprecipitated and analyzed as described above. A, average CFTR half-lives were
monitored by densitometry (n = number of experiments). Calculation of the protein
half-lives was performed as described by Straley et al. (1998)(Straley et al., 1998). B,
representative gels for CFTR half-life measurements are shown below for each of the
cell types.
44
Figure 9: Proteasome inhibition has no effect on CFTR processing in Calu-3 cells.
Metabolic pulse-chase experiments were performed as described in the legend to Fig. 7
on Calu-3 and HeLa in the presence (+) or absence (-) of 50 μm ALLN. In the +
samples, ALLN was present in the medium during the entire experiment. Representative
gels are shown on the left, and the densities of Band B (triangle and diamond) and Band
C (× and square) CFTR at each chase time point is plotted as percent of Band B at the 0
time point. ALLN treatment resulted in an increase of the half-life of Band B in HeLa
cells only (top, right panel). A representative of two experiments is shown.
45
Figure 10: CFTR distribution in COS-7, HeLa, and Calu-3 cells. A, the relative
surface pools of CFTR expressed in COS-7, HeLa, and Calu-3 cells were determined
using a surface biotinylation assay(Peter et al., 2002). In these assays, the total CFTR
from 50% of the lysates (T) was compared with the biotinylated fraction (B). Cells were
46
lysed in radioimmune precipitation assay buffer, and CFTR was immunoprecipitated
using anti-CFTR C-terminal (24-1) monoclonal antibody. From the other 50% of the
lysates, CFTR was immunoprecipitated as described above, eluted, and re-captured
using avidin-Sepharose beads (biotinylated CFTR (B)). Total CFTR (T) and biotinylated
CFTR (B) were in vitro phosphorylated with protein kinase A and [γ-32P]ATP,
separated by SDS-PAGE, and analyzed by Phosphorimaging and densitometry.
Representative gels of seven or more experiments are shown. The average percentage of
biotinylated CFTR for each cell type was calculated based on densitometry. B, CFTR
distribution in Calu-3 monolayers. Calu-3 cells were grown on permeable supports and
analyzed after 10-12 days of culture using indirect immunofluorescence. CFTR was
labeled with 24-1 monoclonal antibody and anti-mouse IgG, Alexa-Fluor488 (green).
Tight junctions were stained using a polyclonal (rabbit) anti-ZO1 antibody (Zymed
Laboratories Inc.) and anti-rabbit IgG Alexa-Fluor596 (red). A side view and a top view
at the apical membrane domain are shown. CFTR (green) is present at the apical
membrane and also intracellularly. Tight junctions are well developed as represented by
the organized red staining of ZO1. C, CFTR maturation efficiency in Calu-3 cells grown
on filters. Calu-3 cells were grown on 12-mm filters and metabolically labeled, and
CFTR maturation efficiency was monitored as described in the legend to Fig. 7.
Conversion of the Band B to Band C was compared at each time points of the chase.
Results are plotted as percent of Band B at the 30 min (highest density) chase time.
47
Figure 11: CFTR expression and maturation in T84 cells. CFTR protein (A) and
mRNA levels (B) were compared in Calu-3, T84, and HT29 cells as described under
“Materials and Methods.” CFTR maturation efficiency was monitored in T84 cells as
described in the legend to Fig. 7(C). A representative gel (n = 3) is shown (C, left
panel). The relative amount of fully glycosylated CFTR (Band C, squares) and core
glycosylated CFTR (Band B, diamonds) is plotted as percent of the immature Band B
after the pulse (right panel).
48
5.3. Pharmacological Chaperones Enhance Surface Stability of ΔF508
CFTR
5.3.1. ΔF508 CFTR rescue by permissive temperature in HeLa F cells
In order to study the cell-surface trafficking of rΔF508 CFTR, we first established
whether permissive temperature culture of HeLaDF cells could generate sufficient
amounts of fully glycosylated ΔF508 CFTR at the cell surface in order to measure
endocytosis rates. Following culture at 27 °C for 48 h, CFTR was immunoprecipitated
from whole-cell lysates and analysed for the presence of mature, glycosylated band C
(rΔF508 CFTR). The results in Fig. 12(A) demonstrate that a significant amount of fully
glycosylated CFTR is formed during 27 °C culture. To confirm that the fully
glycosylated rΔF508 CFTR was expressed at the cell surface, cells were surface
biotinylated using biotin–LC–hydrazide(Peter et al., 2002). Biotinylated CFTR was
detected in HeLaDF cells after 27 °C culture, but not in cells maintained at 37 °C (Fig.
12A). Control cells expressing WT CFTR served as a comparison in order to illustrate
the level of ΔF508 CFTR rescue.
To determine the stability of rΔF508 CFTR after permissive temperature rescue, WT
CFTR- or rΔF508 CFTR-expressing HeLa cells were raised to the restrictive
temperature and the protein half-lives of WT CFTR and rΔF508 CFTR were determined
by metabolic pulse–chase analysis. For these experiments, cells were cultured at 27 °C
for 24 h and metabolically labelled with [35S]-methionine for an additional 18 h at 27 °C
(see the Experimental section). The cells were then returned to 37 °C, and the labelled
proteins were chased for the time periods specified. The results indicate that the half-life
of WT CFTR is 12±1.5 h, whereas the half-life of rΔF508 CFTR is 4±1 h (Fig. 12B).
The rΔF508 CFTR protein half-life is much shorter than that of WT CFTR (P<0.001),
and these results are in agreement with previously published experiments performed in
BHK (baby-hamster kidney) and CHO (Chinese-hamster ovary) cells (Sharma et al.,
2001, Gentzsch et al., 2004).
49
5.3.2. Extended half-life of rΔF508 CFTR at the permissive temperature in
HeLaDF cells
Next, we tested whether extended culture at the permissive temperature would affect the
half-lives of WT CFTR and rΔF508 CFTR in HeLa cells. We followed the protocol
described above (see the Experimental section), but instead of transferring the cells to
37 °C after metabolic labelling, they were incubated at 27 °C for the time periods
indicated. The results show that at 27 °C, the half-lives of WT CFTR and rΔF508 CFTR
were 60±11 h and 63±9 h respectively (Fig. 12C), demonstrating that the instability of
rΔF508 CFTR compared with WT CFTR which was observed at the restrictive
temperature is not apparent at the permissive temperature; in other words, the rΔF508
CFTR half-life defect is a TS defect.
We next sought to determine why rΔF508 CFTR has a short half-life at the restrictive
temperature by examining the internalization properties of WT CFTR and rΔF508
CFTR in HeLa cells and epithelial cells (CFBE41o- and Calu-3) under both nonpolarized and polarized conditions. These experiments served to test cell-type- and
polarization-specific differences in the trafficking of the two proteins.
5.3.3. rΔF508 CFTR endocytosis is accelerated in airway epithelial cells
To determine the cell-surface stability of WT CFTR and rΔF508 CFTR in HeLa cells at
37 °C, we measured their internalization rates using a two-step biotinylation protocol
(Jurkuvenaite et al., 2006). To measure CFTR endocytosis rates, we oxidized the
surface carbohydrate groups of cell surface glycoproteins at the initial (zero) time point
(see the Experimental section) and then allowed the proteins to be internalized for 2.5
min, at which time the oxidized glycoproteins remaining at the cell surface were
labelled with biotin. An internalization time of 2.5 min was chosen for all assays
conducted at 37 °C because, at this temperature, previous internalization time courses in
multiple cell lines indicated that periodate-oxidized CFTR modified at the initial time
point did not recycle back to the cell surface (results not shown). Since the biotin–LC–
hydrazide is membrane impermeable, the only biotin-accessible CFTR is what remains
on the cell surface during the warm-up period (see the Experimental section). Therefore
changes in the surface pool of CFTR after a 2.5 min warm-up period were reflected in a
50
loss of „biotinylatable‟ CFTR, and this loss corresponds to the amount of CFTR that had
been internalized from the cell surface.
Following biotin labelling, cells were lysed and total CFTR was immunoprecipitated as
described above. At each time point, biotinylated CFTR was detected by Western blot
with HRP-conjugated avidin. With this protocol, biotin labelling of band B CFTR is not
observed unless cells are first permeabilized (Peter et al., 2002), suggesting that under
non-permeabilizing conditions such as those presented herein, this biotinylation method
used does not label intracellular proteins. The results of these experiments indicate that
both WT CFTR and rΔF508 CFTR endocytosis rates are rapid, with 25±5% and 27±5%
of the surface pool internalized in 2.5 min respectively (Fig. 13A). This result is
consistent with a previous comparison of WT CFTR and rΔF508 CFTR internalization
rates in BHK cells (Sharma et al., 2004).
Since in vivo CFTR is expressed on the apical surface in epithelial cells, we next
compared the surface stability of WT CFTR and rΔF508 CFTR in both polarized and
non-polarized human airway epithelial cells at 37 °C. In CFBE41o-WT cells grown on
plastic dishes (non-polarized cells), CFTR endocytosis slowed to 14±4% of the surface
pool internalized in 2.5 min (P=0.02 compared with HeLaWT). In contrast, 29±5% of
rΔF508 CFTR was internalized during the same time period in CFBE41o-DF (Fig.
13B), a rate similar to that seen in HeLaDF cells [P=NS (not significant)]. Furthermore,
the difference between WT CFTR and rΔF508 CFTR internalization rates was more
pronounced when the cells were grown as polarized monolayers. In polarized cells, WT
CFTR internalization dropped significantly to 3.2±2% per 2.5 min (P<0.0001 compared
with HeLaWT), whereas rΔF508 CFTR internalization remained at 30±3% per 2.5 min.
As a further control, we measured WT CFTR internalization in polarized Calu-3 cells
with similar results (5±1% per 2.5 min; P=NS), indicating that the surface pool of WT
CFTR is very stable in polarized epithelia (Fig. 13C), whereas rΔF508 CFTR is not
stable. Because it was clear that WT CFTR trafficking did not appear to be faithfully
represented in HeLa cells, and our goal was to identify the defect in rΔF508 CFTR
compared with the control WT CFTR protein, we focused our efforts on analysing the
rΔF508 CFTR trafficking defect in human airway epithelial cells.
51
5.3.4. Shortened cell-surface half-life of rΔF508 CFTR in CFBE41o-DF cells
Because polarization affected WT CFTR but not rΔF508 CFTR internalization, we then
tested the cell-surface half-lives of both WT CFTR and rΔF508 CFTR in CFBE41ocells using a cell-surface biotinylation-based assay (Fig. 14). The results indicate that
the surface half-life of biotinylated WT CFTR was 8.5±1 h in non-polarized cells (Fig.
14, top left-hand panel) and 8.3±0.3 h in polarized cells (P=NS, Fig. 14, top right-hand
panel), demonstrating that the stability of the WT CFTR protein was not affected by cell
polarization. Examination of rΔF508 CFTR indicated that the surface half-life of the
rescued protein was very short (less than 2 h) under both non-polarized and polarized
conditions (1.8±0.1 compared with 2.0±0.2 h respectively; P=NS, Fig. 14, middle
panels). Thus rΔF508 CFTR surface stability is decreased compared with WT CFTR,
and polarization did not affect the surface stability of either protein (Fig. 14, bottom
panels).
5.3.5. Permissive temperature culture stabilizes rΔF508 CFTR in polarized
epithelial cells
Since the rΔF508 CFTR trafficking defect in epithelial cells is the result of enhanced
endocytosis, we tested whether permissive temperature culture could correct this defect.
To answer this question, we compared the effects of 27 °C treatment on WT CFTR and
rΔF508 CFTR cell-surface trafficking in polarized CFBE41o- cells using cell-surface
half-life and internalization experiments. The results show that both WT CFTR and
rΔF508 CFTR are extremely stable at the cell surface at 27 °C, with cell-surface halflives much greater than 8 h (Fig. 15, top panels). Because CFTR levels were not
monitored beyond 8 h, we cannot calculate to what extent permissive temperature
culture stabilized WT CFTR or rΔF508 CFTR. However, since WT CFTR and rΔF508
CFTR surface half-life measurements were similar at 27 °C, these results reveal that 27
°C treatment eliminated the drastic difference in surface half-life between WT CFTR
and rΔF508 CFTR observed at 37 °C. Measurement of WT CFTR and rΔF508 CFTR
internalization rates at 27 °C revealed a dramatic decrease in both cell lines. In fact,
CFTR internalization was not measurable after the 2.5 min warm-up period. After a 10
min warm-up period, WT CFTR and rΔF508 CFTR internalization rates were 20±3%
52
per 10 min (P=0.05) and 22±4% per 10 min (P=0.0004) respectively (Fig. 15, middle
and bottom panels), which indicated that 27 °C treatment eliminated the difference in
internalization rates between WT CFTR and rΔF508 CFTR. Importantly, the results of
these studies indicate that both the short surface half-life and the rapid internalization
rate of rΔF508 CFTR are TS defects.
5.3.6. Permissive temperature culture corrects the functional defect
associated with rΔF508 CFTR
In addition to the trafficking defect, rΔF508 CFTR fails to respond to cAMP after
forskolin stimulation in CFBE41o-DF cells (Bebok et al., 2005). Since we observed that
permissive temperature culture corrects the endocytosis defect in rΔF508 CFTR and
restores the protein half-life to levels equivalent to WT CFTR, we then tested whether it
might also correct the functional defect(Bebok et al., 2005). In these experiments,
polarized CFTR-expressing CFBE41o-DF monolayers were cultured at 27 °C for 48 h to
facilitate rΔF508 CFTR expression on the cell surface. These monolayers were then
mounted in Ussing chambers, where cAMP-activated Isc was measured at either 37 °C
or 27 °C. Forskolin (10 mM) was added to the apical compartment to enhance
intracellular cAMP levels and activate Isc. When the current reached a maximum and
stabilized, glybenclamide was added at increasing concentrations to block Isc. In some
experiments, a CFTR-specific inhibitor was used to block currents(Yang et al., 2003), as
described previously(Chen et al., 2006). Forskolin was used consistently to activate Isc
because we found that, in both WT CFTR- and ΔF508 CFTR-expressing cells, it was
sufficient to stimulate cAMP-mediated chloride currents. A cocktail designed to
maximally stimulate cAMP responses [forskolin, IBMX (3-isobutyl-1-methylxanthine)
and bromoadenosine–cAMP] did not increase the current beyond the forskolin-induced
current. Likewise, glybenclamide was used consistently because the CFTR-specific
inhibitor did not further inhibit the currents, indicating that glybenclamide provided
maximal CFTR channel inhibition (results not shown). The magnitude of the resulting
Isc was compared with parallel CFBE41o-WT controls (see the Experimental section).
The results show that at 37 °C, cells expressing WT CFTR channels produce an anion
current that is readily stimulated by forskolin and can be inhibited completely by
glybenclamide (Fig. 16, top left-hand panel), whereas cells expressing rΔF508 CFTR
53
exhibit very weak responses to both treatments (Fig. 16, middle left-hand panel), in
agreement with our previous findings(Bebok et al., 2005). When the temperature is
maintained at 27 °C, however, rΔF508 CFTR-expressing cells exhibit an anion current
similar to cells expressing WT CFTR (Fig. 16, top and middle right-hand panels). Direct
channel stimulation by 50 mM genistein further enhanced the rΔF508 CFTR current at
27 °C (results not shown), in agreement with a previous observation that at 37 °C,
rΔF508 CFTR produced a current in response to genistein(Bebok et al., 1998). This
restoration of the functional defect suggests that the loss of cAMP response has been
regained at 27 °C. In consideration with the previous studies, these experiments reveal
that both the surface trafficking and functional activity defects of rΔF508 CFTR are TS.
5.3.7. Pharmacological chaperones correct the internalization defect and
increase the surface stability of rΔF508 CFTR
As shown above, maintenance of the TS ΔF508 protein at the permissive temperature
corrects multiple trafficking and functional defects, in that 27 °C treatment not only
rescues ΔF508 CFTR from ERAD, but also stabilizes the endocytosis and surface
stability defects as long as cells are maintained at 27 °C. On the basis of these results,
we investigated whether two pharmacological chaperones which facilitate ΔF508 CFTR
exit from the ER, a quinazoline compound (CFcor-325) and a bisaminomethylbithiazole
compound (Corr-4a)(Loo et al., 2006, Wang et al., 2007a), have any effect on rΔF508
CFTR or WT CFTR cell-surface trafficking at 37 °C.
First, we studied the effect of the compounds on WT CFTR and rΔF508 CFTR
endocytosis in CFBE41o- cells. For these experiments, CFBE41o-WT or -DF cells were
cultured for 48 h at 27 °C, followed by a 1 h pre-treatment with 10 mM CFcor-325,
Corr-4a, or a vehicle control (DMSO) at 37 °C. Internalization assays were then
performed at 37 °C. The results indicated that both CFcor-325 and Corr-4a decreased
the internalization rate of rΔF508 CFTR from 30% to ~5% and ~1% respectively
(P<0.005, Fig. 17, top and middle panels). Interestingly, the compounds had no effect
on WT CFTR endocytosis or TR endocytosis from the apical surface (Fig. 17, bottom
panels), suggesting that the effect was specific for rΔF508 CFTR.
54
5.3.8. Pharmacological chaperones extend the cell-surface half-life of
rΔF508 CFTR
Next, we monitored the effects of CFcor-325 or Corr-4a on the cell-surface half-life of
WT CFTR and rΔF508 CFTR. For these experiments, CFBE41o-WT or -DF cells were
cultured for 48 h at 27 °C, followed by treatment with 10 mM CFcor-325, Corr-4a or a
vehicle control (DMSO) at 37 °C. CFTR cell-surface half-lives were then evaluated in
the presence of correctors or vehicle using the surface biotinylation-based assay. The
results indicated that treatment with either small molecule corrector stabilized rΔF508
CFTR compared with untreated controls (Fig. 18). CFcor-325 extended the half-life of
rΔF508 CFTR from 2.5±0.4 h to 4.6±0.9 h (P=0.004), and Corr-4a extended the halflife from 2.6±0.6 h to 4.5±1.2 h (P=0.03), indicating that both compounds stabilized the
half-life of rΔF508 CFTR. Significantly, neither compound affected the half-lives of
neither WT CFTR nor TR (Fig. 18, bottom panels), suggesting the effects observed are
specific for rΔF508 CFTR.
55
Figure 12: ΔF508 CFTR rescue and stability in HeLa cells (A) Low temperature (27
°C) rescue of ΔF508 CFTR in HeLaDF cells. CFTR was immunoprecipitated from
HeLaDF cells that had been cultured at 27 °C or 37 °C for 48 h or HeLaWT cells
cultured at 37 °C, analysed by SDS/PAGE, Western blotted and detected using
polyclonal anti-(CFTR NBD2) antibody (Total, left-hand panel). Arrows indicate ER
(Band B) and post-ER forms (Band C) of CFTR. The presence of rΔF508 CFTR at the
cell surface (Band C) was confirmed by cell-surface biotinylation, immunoprecipitation
of CFTR and Western blotting with HRP-conjugated avidin (Surface, right-hand panel).
(B) WT CFTR and rΔF508 CFTR half-lives at 37 °C. CFTR half-lives were measured
in metabolic pulse–chase experiments (see the Experimental section). HeLaDF and
56
HeLaWT cells were cultured at 27 °C for 24 h, followed by metabolic labelling for 18 h
and chased at 37 °C for up to 18 h. At the time points indicated, cells were subjected to
lysis, CFTR immunoprecipitation, SDS/PAGE and phosphorimaging. Representative
gels of pulse–chase experiments for WT CFTR and rΔF508 CFTR (ΔF508, top and
middle panels respectively) and calculated half-lives (bottom panel) are shown (n=4).
(C) Extended half-lives of WT CFTR and rΔF508 CFTR at 27 °C. Pulse–chase
experiments were performed in HeLaDF and HeLaWT cells as described in (B), except
that the chase was performed at 27 °C (see the Experimental section). Representative
images (top and middle panels) and calculated half-lives (bottom panel) are shown
(n=4).
57
Figure 13:
rΔF508 CFTR endocytosis in HeLa and airway epithelial cells.
(A)Internalization of WT CFTR and rΔF508 CFTR in HeLa cells. CFTR endocytosis
was measured using a modified biotinylation assay (see Experimental section).
Representative gels of immunoprecipitated (Total) and cell-surface biotinylated WT
CFTR and ΔF508 CFTR (Surface) at 0 and 2.5 min of internalization (Int.) are shown.
Internalization rates of WT CFTR and rΔF508 CFTR (ΔF508) are plotted as the
percentage decrease in CFTR Band C density after a 2.5 min internalization step (n=5).
(B) WT CFTR and rΔF508 CFTR internalization in non-polarized and polarized
epithelial cells. CFBE41o-DF (ΔF508) and CFBE41o-WT (WT) cells grown under nonpolarized (plastic dishes, left-hand panels) or polarized (permeable supports, right-hand
panels) conditions were tested for CFTR internalization (Int.). Representative gels are
shown. Internalization rates are the percentage density decrease in cell surface Band C
CFTR after a 2.5 min internalization step compared with 0 min (n=5). (C) WT CFTR
58
internalization in polarized Calu-3 cells. Calu-3 cells grown under polarized conditions
(permeable supports) were tested for CFTR internalization. A representative gel
showing cell-surface biotinylated WT CFTR (surface) at 0 and 2.5 min of
internalization (Int.) is shown (n=4).
59
Figure 14: Cell-surface half-lives of WT CFTR and rΔF508 CFTR in CFBE41ocells. Representative gels are shown of WT CFTR (CFBE WT, top panels) and rΔF508
CFTR (CFBE ΔF508, middle panels) half-life measurements performed at 37 °C under
non-polarized and polarized conditions. Half-lives were calculated using densitometry
followed by analysis as described previously [34], and the results are shown in the
bottom panel (n=4).
60
Figure 15: Surface stability of rΔF508 CFTR at 27 °C in airway epithelial cells. Cell
surface stability (top panels) and internalization rates (middle panels) of CFTR were
measured at 27 °C (see Experimental section). In polarized CFBE41o- cells, both WT
CFTR and rΔF508 CFTR are extremely stable at 27 °C. There was no detectable
decrease in biotinylated Band C CFTR during the 8 h chase. Representative gels from
CFBE41o-WT and CFBE41o-DF (ΔF508) are shown (top panels). For internalization
rates, total and cell surface CFTR were detected. Representative gels are shown (middle
panels). Internalization rates are plotted as the percentage decrease in density of Band C
CFTR at 10 min (bottom panel; n=4). Biot.: biotinylated CFTR.
61
Figure 16: Ussing chamber analysis of rΔF508 CFTR after low temperature
correction. Polarized CFBE41o-WT and CFBE41o-DF (ΔF508) monolayers were
cultured at 27 °C for 48 h. Cells were mounted in Ussing chambers and temperatureequilibrated (37 °C or 27 °C as indicated) for 30 min, followed by measurement of
baseline steady state Isc and Rt values. Forskolin (FSK, 10 mM) was added to the apical
chambers, and Isc and Rt values were monitored until a new baseline was obtained. The
indicated concentrations of glybenclamide (GLYB) were then added apically, and Isc
and Rt values were monitored. Representative traces (top and middle panels) are shown.
Results are DIsc (mA/cm2) of FSK (which represents a positive current following
62
forskolin activation) or of GLYB, which represents a negative current following
administration of glybenclamide to block channel activity (bottom panels; n 5). ΔF508
CFTR-expressing monolayers exhibited significantly blunted responses to forskolin and
glybenclamide compared with WT CFTR-expressing monolayers at 37 °C (bottom
panels). These responses were significantly enhanced when monolayers were
maintained at the permissive temperature (27 °C, *P<0.005; +P<0.01), so that there
were no significant differences between WT CFTR and rΔF508 CFTR responses at this
temperature (bottom panels). For each condition, the number of experimental repeats is
indicated in parentheses.
63
Figure 17: CFcor-325 and Corr-4a increase the stability of WT CFTR and rΔF508
CFTR. Internalization assays for WT CFTR (WT) and rΔF508 CFTR (ΔF508) were
performed at 37 °C in CFBE41o-DF and CFBE41o-WT cells following low temperature
rescue in the presence or absence of CFcor-325 or Corr-4a. Representative gels (top
panels) and the percentage of CFTR internalized for each corrector is shown (middle
panels; n=4). The percentage of TR internalized, measured under identical conditions, is
also shown (bottom panels). WT CFTR and TR internalization rates were tested as
controls and ~5% of WT CFTR and ~30% of rescued ΔF508 CFTR was internalized in
2.5 min in untreated cells. Both CFcor-325 and Corr-4a treatment significantly
decreased rΔF508 CFTR internalization in CFBE41o-DF cells (n=4; P<0.05). No
changes in WT CFTR and TR internalization rates were measured.
64
Figure 18: CFcor-325 and Corr-4a extend the cell-surface half-life of rΔF508
CFTR. Polarized CFBE41o-DF (ΔF508) and CFBE41o-WT (WT) cells were cultured at
27 °C for 48 h, returned to 37 °C, and treated with CFcor-325 or Corr-4a for 8 h. Cellsurface CFTR half-lives were measured following cell-surface biotinylation.
Representative gels (top panels) and the mean CFTR half-life for each pharmacological
agent and untreated control (middle panels; n=4) are shown. The TR half-life was also
measured in the presence or absence of correctors as an additional control (bottom
panels; n=4).
65
6. DISCUSSION
The first aim of this study focused on the internalization signal for CFTR endocytosis.
Several observations suggest that the only internalization signal in CFTR is the Tyr1424X-X-Ile1427 motif in the COOH-terminal tail. First, the ablation of the only endocytosis
signal in the transferrin receptor YTRF resulted in a similar loss of internalization
activity (Collawn et al., 1990). Furthermore, the rate of endocytosis of the
20
YTRF23
→20ARTA23 mutant was the same as a transferrin receptor containing only a 4-amino
acid cytoplasmic tail, indicating that this motif and more specifically these two residues
were the only residues in the 61-amino acid cytoplasmic tail of the transferrin receptor
that were necessary for endocytosis. Second, the internalization rate of Y1424A,I1427A
CFTR is comparable with the rate of bulk flow lipid uptake via the endocytic pathway
(~2%/min.)(Mukherjee et al., 1997), suggesting that the residual internalization activity
observed in these studies reflects nonspecific uptake through clathrin-coated pits.
Considering that clathrin-coated pits constitute ~2% of the cell surface (Mukherjee et
al., 1997), our findings suggest that the double mutant has completely lost the ability to
concentrate in these surface domains. This result has particular significance given the
increasing evidence that CFTR enters the endocytic pathway via clathrin-coated pits
(Bradbury et al., 1994, Lukacs et al., 1997, Weixel and Bradbury, 2001).
The signal identified here, YXXI, appears to function only as an internalization signal
and not a “down-regulation” signal for conferring CFTR degradation. If YXXI was
important to mediate CFTR degradation, metabolic pulse-chase experiments would have
revealed an extended half-life when the signal was inactivated. Our studies indicate that
CFTR lacking YXXI is stabilized at the cell surface because endocytosis of this mutant
is severely compromised. This also suggests that CFTR participates in the membranerecycling pathway. This idea is consistent with previously reported immunolocalization
studies that have shown that CFTR co-localizes with rab4, a component of recycling
endosomes (Webster et al., 1994). The reasons why CFTR would be part of this
pathway are unclear, but it may be to regulate the amount of functional chloride
channels at the cell surface in the same manner as aquaporins and glucose transporters
are regulated (Jhun et al., 1992, Holman et al., 1994, Brown et al., 1995, Katsura et al.,
1995, Nielsen et al., 1995, Pessin et al., 1999).
66
The specific residues identified by these studies, YXXI, that are important for CFTR
endocytosis are conserved in the ten COOH-terminal tail sequences spanning from
Xenopus to human(Prince et al., 1999). The tyrosine residue is conserved among all
species with the exception of the dogfish, which has a phenylalanine residue. The
isoleucine residue is conserved in 7 of 10 sequences with a very conservative leucine
residue substitution in the other three, indicating that this motif, YXX(I/L), is highly
conserved in the sequences identified to date. Both FXXL (dogfish) and YXX(I/L)
conform to the YXXΦ motif common to internalization signals, where X is any amino
acid and Φ is a hydrophobic residue (Trowbridge et al., 1993).
The identification of the YXXI signal is also consistent with recent studies that a region
that includes this sequence interacts with the endocytic clathrin adaptor complex AP-2
using plasmon resonance analysis(Weixel and Bradbury, 2001). Together, their study
(Weixel and Bradbury, 2001) and ours support the view that CFTR endocytosis occurs
through clathrin-coated pits. Our study shows that two residues in the COOH-terminal
tail, tyrosine 1424 and isoleucine 1427, regulate the steady-state distribution of CFTR
between the plasma membrane and intracellular sites. This raises the important and
testable hypotheses that the Y1424,I1427 signal controls CFTR entry into clathrincoated pit regions at the apical membrane and that ablation of this signal abrogates one
type of microdomain targeting in polarized epithelial cells.
Regarding Aim 2., initial studies of CFTR biogenesis described complete and early
degradation of the ΔF508 CFTR and inefficient maturation of the wild type protein
(Cheng et al., 1990b, Lukacs et al., 1994, Ward and Kopito, 1994). Most of these
studies employed heterologous overexpression systems, with one exception(Ward and
Kopito, 1994). Kopito and colleagues (Ward and Kopito, 1994) compared wild type
CFTR maturation efficiency in stable HEK cells to HT29 and T84 cells endogenously
expressing wild type CFTR. In these cells, CFTR expression levels were 10-50-fold
lower than in HEK, but the maturation efficiency of CFTR was only ~25% after 2 h of
chase. In our studies, CFTR maturation in Calu-3 and T84 cells reached the maximum
(~100%) only after 4 h. Analysis of CFTR maturation efficiency in COS-7 and HeLa
cells suggested that there was no significant increase in Band C levels between the 2and 4-h chase periods, whereas in Calu-3 cells and T84 cells CFTR maturation was only
67
completed by the end of the 4th h. This slower CFTR processing noted in endogenously
expressing cells was even more pronounced in Calu-3 cells grown as polarized
monolayers. As a comparison with other cell lines, we found that CFTR mRNA and
protein levels were 4- and10-fold higher in Calu-3 cells than in T84 and HT29 cells.
While we were not able to follow the maturation of the protein in HT29 cells, analysis
in T84 revealed that CFTR maturation was very efficient and only complete by the end
of a 4-h chase.
A more rapid disappearance of Band B CFTR in T84 and HT29 than in HEK cells was
also described and attributed only to degradation(Ward and Kopito, 1994). However,
those experiments were completed before the role of the proteasome in early CFTR
degradation was described or before protein overexpression was shown to overload the
proteasome. Subsequently, it has been demonstrated that either the inhibition of the
proteasome (Ward and Kopito, 1994, Jensen et al., 1995b) or protein overproduction
(Johnston et al., 1998) could result in delayed degradation. Therefore, it is now clear
that disappearance of Band B could be due to both degradation and maturation. In our
studies, proteasome blockade revealed that in Calu-3 cells disappearance of band B was
not due to proteasomal degradation, whereas in HeLa cells it partially was.
The increased half-life of the mature CFTR in Calu-3 cells suggests that epithelial
factors stabilize CFTR. This finding is supported by studies showing that CFTR halflife in heterologous systems is 8-12 h (Lukacs et al., 1994, Peter et al., 2002), whereas
in LLC-PK1 (Heda et al., 2001) and in MDCK cells (Swiatecka-Urban et al., 2002), two
kidney epithelial cells stably expressing the wild type CFTR, the half-life is
significantly longer when the cells are grown under polarized conditions. Increased
stability of the mature wild type CFTR in epithelial cells is also consistent with our
previous findings that growing MDCK cells as polarized monolayers results in
increased steady-state CFTR levels and function. Furthermore, possible cell typespecific differences in wild type CFTR biogenesis and stability are suggested by our
findings that cellular polarization in Calu-3 cells did not have a significant effect on
total and cell surface CFTR levels in contrast to our previous findings in MDCK cells
(Bebok et al., 2001).
68
Both morphological and cell surface biotinylation studies indicate the existence of a
large intracellular CFTR pool in Calu-3 cells. The dynamics and precise cellular
localization of this pool remain unclear, but several studies (Prince et al., 1994,
BRADBURY, 1999, Bradbury et al., 1999, Prince et al., 1999, Ameen et al., 2000,
Silvis et al., 2003) have indicated that CFTR is found in endosomal and recycling
endosomal compartments. How regulation of surface localized CFTR is accomplished
in polarized epithelia and whether there is a physiological role for the intracellular pool
remain open questions.
The factors that allow efficient CFTR maturation as well as those that are responsible
for stabilizing the mature protein in Calu-3 and T84 cells have not been identified.
However, dramatic progress has been made recently in identifying tissue-specific
factors that organize the delivery and function of transport proteins to their appropriate
membrane domains (Madrid et al., 2001, Li et al., 2003, Krumins et al., 2004). These
results suggest that both the cellular context and molecular rationing of transport
components are important not only for proper function but also for intracellular
trafficking (Krumins et al., 2004). Nevertheless, normal epithelial cell function depends
on the accurate delivery of a large number of membrane components to a particular cell
surface domain, and defects in this process often lead to disease (Aridor and Hannan,
2000, 2002). Therefore, it is crucial to understand how different cell types organize the
biogenesis and intracellular processing of key molecules (Bertrand and Frizzell, 2003).
Since CFTR plays a central role in the regulation of epithelial ion transport in multiple
organ systems, understanding its biogenesis, cellular distribution, and stability in
epithelia may be the first step toward identifying the molecular defects leading to early
degradation of otherwise functional mutants, such as ΔF508 CFTR.
The importance of elucidating the biogenesis and intracellular journey of wild type
CFTR is also underscored by two publications indicating that some ΔF508 CFTR can be
found at the cell surface in native epithelia (Kalin et al., 1999, Penque et al., 2000).
These earlier reports raise the possibility that in the correct physiological milieu, even
the mutant protein might traffic differently than reported in heterologous expression
systems. Furthermore, a number of CFTR-associating proteins have been identified and
shown to regulate either the function (Naren et al., 1997) or the intracellular journey of
69
CFTR (Cheng et al., 2002). Whether these or other yet to be identified proteins have any
effect on the biogenesis and stability of the wild type protein in native epithelia remains
to be determined. Although endogenous, wild type CFTR synthesis is quite low in many
native tissues, our results suggest the usefulness of cell lines endogenously expressing
CFTR as powerful tools for investigating cell type-specific differences in CFTR
biogenesis and function.
Our third aim concentrated on understanding the trafficking of the low temperature or
chemical chaperone rescued DF508 CFTR. From previous studies it was evident that
the fate of rΔF508 CFTR at the cell surface after low temperature rescue is one of the
first examples of how the cellular quality-control mechanisms operate at the plasma
membrane and/or early endosomes (Sharma et al., 2004). Although culture at the
permissive temperature allows some of the TS ΔF508 CFTR protein to escape from
ERAD, this maturely glycosylated rΔF508 CFTR is rapidly degraded once the
temperature is raised to the restrictive temperature, 37 °C. The goal of this study was to
follow the cell surface fate of rΔF508 CFTR at the permissive and restrictive
temperatures, 27 °C and 37 °C, and compare the results with the WT CFTR protein.
Since CFTR is normally expressed in epithelial cells, we also examined the fate of both
proteins in polarized epithelia to determine whether any epithelial-specific differences
exist between WT CFTR and rΔF508 CFTR surface trafficking. Additionally, we
performed functional studies to measure transepithelial chloride currents in response to
physiological stimuli, such as cAMP. Finally, on the observation that permissive
temperature treatment stabilizes and functionally corrects rΔF508 CFTR at the cell
surface, we tested whether pharmacological chaperones that permit escape from ERAD
stabilize the rΔF508 CFTR surface pool.
A number of studies have shown that culturing cells at 27 °C is an efficient method of
facilitating ΔF508 CFTR delivery to the cell surface (Denning et al., 1992, Brown et al.,
1996, Sharma et al., 2001, Zhang et al., 2003, Gentzsch et al., 2004, Sharma et al., 2004,
Bebok et al., 2005, Loo et al., 2005, Pedemonte et al., 2005, Swiatecka-Urban et al.,
2005, Loo et al., 2006, Wang et al., 2007b). However, the fate of the low temperaturecultured rΔF508 CFTR at the cell surface has only been followed at 37 °C(Sharma et
al., 2004, Bebok et al., 2005, Swiatecka-Urban et al., 2005). Here, we show that when
70
the cells are kept at 27 °C, the stability of rΔF508 CFTR is enhanced, and the
differences between WT CFTR and rΔF508 CFTR trafficking and half-life that are seen
at 37 °C disappear. One potential explanation for this observation is that protein
degradation slows down at the permissive temperature, resulting in accumulation of
both the WT CFTR and ΔF508 CFTR. This hypothesis is supported by the finding that
ubiquitination of rΔF508 CFTR is inhibited at 28 °C(Sharma et al., 2004). However,
another possibility is that at 27 °C, ΔF508 CFTR folds properly and remains in a
properly-folded state, resulting not only in exit from the ER, but also in a more stable
surface phenotype at this temperature. When cells are returned to 37 °C, the
conformation of rΔF508 CFTR reverts to a misfolded stage, as proposed
previously(Sharma et al., 2001). In this misfolded conformation, proteins are more
likely to be accessible to ubiquitination and subsequent degradation by cell-surfaceassociated mechanisms.
The endocytosis defect of rΔF508 CFTR is eliminated at 27 °C, but our results indicate
that endocytosis still occurs, albeit more slowly. In a number of cell types, temperatures
between 16 °C and 22 °C block degradation of endocytosed proteins by preventing their
transport to lysosomes (Dunn et al., 1980, Parton et al., 1989, Haylett and Thilo, 1991).
ΔF508 CFTR has been shown to accumulate in endocytic-like structures similar to the
WT CFTR protein when the cells were shifted to16oC (Gentzsch et al., 2004), consistent
with the idea that the early part of the endocytic pathway still operates at this
temperature, but delivery to the later stages is blocked. It remains unclear whether
transport to the lysosome, lysosomal processing or the initial steps of ubiquitindependent endocytosis are still functional at 27 °C, but it is clear from our results here
that internalization of rΔF508 CFTR is dramatically slowed down to WT CFTR levels
at 27 °C, which is consistent with the latter possibility. Further support for this idea
comes from proteasomal inhibition studies using lactacystin in BHK cells expressing
rΔF508 CFTR(Gentzsch et al., 2004). In these studies, lactacystin treatment
dramatically stabilized the surface pool of rΔF508 CFTR (Gentzsch et al., 2004),
consistent with the idea that the free ubiquitin pool is limited during proteasomal
inhibition.
71
One important result from our study is that the surface defect of rΔF508 CFTR is due to
an enhanced endocytosis rate compared with WT CFTR. Interestingly, we have also
shown here that this defect is only present in polarized epithelial cells, such as
CFBE41o- cells, and not in HeLa cells. Our results demonstrate that WT CFTR
endocytosis is dependent both on cellular background and on polarization. In nonpolarized HeLa cells, more than 30% of WT CFTR internalizes within 2.5 min. In
CFBE41o-WT and Calu-3 cells grown on plastic dishes (non-polarized cells), CFTR
internalization slows down to ~15%. When the cells are grown on permeable supports
(polarized), CFTR internalization is only 2–5% in 2.5 min.
It is tempting to speculate that WT CFTR internalization rates are so low in polarized
epithelia because the majority of WT CFTR is anchored to the cytoskeleton and does
not participate in the internalization process. This notion is consistent with the results of
Haggie et al.(Haggie et al., 2006), in which single-particle tracking was used to
demonstrate that CFTR is coupled to the actin cytoskeleton via EBP50
(ezrin/radixin/moesin-binding phosphoprotein-50)/ezrin and immobilized at the plasma
membrane.
The difference we observed in WT CFTR internalization rates in polarized epithelia
differs from our results in HeLa cells and from the work of Lukacs and co-workers in
BHK cells (Sharma et al., 2004). One explanation for these discordant results is that in
non-polarized cells, the cell membrane and the cytoskeleton are less organized
compared with polarized cells, resulting in inefficient tethering of WT CFTR and an
increased mobile pool available for endocytosis.
Importantly, we observed that the trafficking of rΔF508 CFTR did not follow the same
kinetics as WT CFTR in polarized epithelial cells, at least at 37 °C. At this temperature,
regardless of cell line or polarization, rΔF508 CFTR endocytosis rates remain
consistently high (~30% in 2.5 min). One possible explanation for this observation is
that, in contrast to our model for WT CFTR, the majority of rΔF508 CFTR is not
tethered properly to the cytoskeleton, resulting in a more mobile surface pool. This
inefficient cytoskeletal tethering could result from the inability of the mutant protein to
interact with one or more of the cytosolic factors responsible for stabilization of the WT
72
CFTR protein. The idea that rΔF508 CFTR is not in a large macromolecular complex is
supported by the observation that rΔF508 CFTR is poorly responsive to cAMPmediated stimuli in CFBE41o-DF cells at 37 °C(Bebok et al., 2005), suggesting that
rΔF508 CFTR has lost the association with the previously identified apical signalling
complex(Naren et al., 2003, Gentzsch et al., 2004, Bebok et al., 2005). Alternatively, it
is possible that, after rescue from ERAD at the permissive temperature, rΔF508 CFTR
reverts to a misfolded state when cells are returned to the restrictive temperature. The
resulting conformational alterations in the protein may enhance its ability to interact
with
the
clathrin-based
endocytic
machinery
and/or
cell-surface-associated
ubiquitination machinery. The consequence is that rΔF508 CFTR may be endocytosed
and degraded in the lysosome more actively than the WT CFTR protein at 37 °C.
Because improved surface half-life does not necessarily translate to improved channel
activity, it is essential to note that the biochemical rescue mediated by permissive
temperature culture is accompanied by a functional correction. We showed that after
permissive temperature rescue, continued culture at 27 °C results in rΔF508 CFTR
channels which are functionally similar to WT CFTR channels in their ability to
respond to physiological stimuli such as forskolin. This functional correction also
supports the idea that at the permissive temperature, the rescued protein is associated
with the functional complex (Bebok et al., 2005) that allows activation by cAMP. The
idea that the channel activity is TS is further supported by a recent report on ΔF508
CFTR with two altered RXR motifs that demonstrated that the single channel activity of
rΔF508 CFTR decreased as the temperature was increased from 30 °C to 37 °C
(Hegedus et al., 2006).
Since extended culture at the permissive temperature slowed the endocytosis rates of
rΔF508 CFTR to WT CFTR levels in addition to mediating its escape from ERAD, an
obvious question was whether chemical correctors that facilitate ΔF508 CFTR exit from
the ER would also provide rΔF508 CFTR cell-surface stability at 37 °C. The results
illustrated that two small molecules known to rescue ΔF508 CFTR from ERAD, CFcor325 and Corr-4a, also stabilized the mutant protein at the cell surface. Importantly, these
compounds had no effect on endocytosis or the protein half-life of two other cellsurface molecules, WT CFTR and TR, suggesting that the effects are rΔF508 CFTR-
73
specific. Further support for the idea that the compounds are specific was provided by a
recent report by Clarke and co-workers demonstrating that these compounds interact
directly with CFTR (Wang et al., 2007a).
A significant result of this study is that both compounds corrected the rΔF508 CFTR
internalization defect to WT CFTR rates. Despite this effect, although the surface halflife of the rescued protein increased with these compounds, the corrected half-life
remained significantly shorter than WT CFTR. This result indicates that correcting the
internalization defect of the rΔF508 CFTR protein may not be sufficient for optimal
stabilization, and supports previous findings that impaired recycling is a critical
component in the compromised surface stability of rΔF508 CFTR (Sharma et al., 2004).
74
7. CONSLUSIONS
1. The data presented here demonstrate that two key residues in the COOH-terminal tail
dramatically regulate the steady-state distribution of CFTR between the cell surface
and intracellular sites. This is the first demonstration of a CFTR mutant whose
activity is actually enhanced relative to wild-type CFTR. We established this
observation using both surface biotinylation and patch clamp measurements. In
examining the mechanism for the elevated surface expression of CFTR, we first
showed that total expression levels of wild-type, Y1424A, and Y1424A,I1427A were
the same. We next demonstrated that maturation efficiency and protein half-life were
unaffected, suggesting that a primary alteration caused by these substitutions
involved changes in distribution between the intracellular and cell surface
compartments. This alteration could result from decreased internalization or
increased recycling or both. Moreover, we showed that Y1424A,I1427A CFTR was
internalized much more slowly than the native protein (76% inhibition at 2.5 min)
with an internalization rate of ~2%/min.
2. To our knowledge, the experiments shown here represent the first complete analysis
of wild type CFTR biogenesis in human epithelial cell lines endogenously expressing
the protein and highlight the following important points. First, in contrast to
heterologous CFTR-expressing cell lines, CFTR maturation is efficient in Calu-3 and
T84 cells. Second, the mature CFTR is very stable and a large portion of it is
intracellular. Third, since CFTR biogenesis is efficient, ERAD plays no role in the
degradation of the wild type protein. And finally, although CFTR message levels are
low in Calu-3 cells compared with transduced cells, the steady-state protein levels
are comparable with heterologous expression systems, suggesting that CFTR
biogenesis and protein stability are not faithfully reproduced in the heterologous
systems. These studies indicate that detailed analysis of endogenous CFTR
expressing cell lines is warranted.
75
3. In polarized epithelial cells, permissive temperature culture of a TS mutant, ΔF508
CFTR, not only rescues it from ERAD, but also stabilizes it at the cell surface and
restores its cAMP responsiveness, suggesting that both the stability and the
functional defects at the cell surface are TS, not just the maturation defect. Two
pharmacological chaperones, CFcor-325 and Corr-4a, mediate an effect similar to
permissive temperature treatment, but the rΔF508 CFTR correction of cell-surface
half-life is only partial. Our results indicate that permissive temperature culture of a
clinically-relevant TS ER processing mutant can facilitate correction of both cellsurface trafficking and functional defects, and offer hope that the treatments that
enhance the release of misfolded proteins from the ER may also benefit protein
stability and function at the cell surface. Understanding this process in more detail
will provide a broader base of knowledge of how pharmacological chaperones and
different classes of compounds can be used to promote protein function and stability
of this and other TS mutations.
76
8. SUMMARY
Here we show that a second substitution in the carboxyl-terminal tail of CFTR, I1427A,
on Y1424A background more than doubles CFTR surface expression as monitored by
surface biotinylation. Internalization assays indicate that enhanced surface expression of
Y1424A, I1427A CFTR is caused by a 76% inhibition of endocytosis. Patch clamp
recording of chloride channel activity revealed that there was a corresponding increase
in chloride channel activity of Y1424A, I1427A CFTR, consistent with the elevated
surface expression, and no change in CFTR channel properties. Y14124A showed an
intermediate phenotype compared with the double mutation, both in terms of surface
expression and chloride channel activity. Metabolic pulse-chase experiments
demonstrated that the two mutations did not affect maturation efficiency or protein halflife. Taken together, our data show that there is an internalization signal in the COOH
terminus of CFTR that consists of Tyr (1424)-X-X-Ile(1427) where both the tyrosine
and the isoleucine are essential residues. This signal regulates CFTR surface expression
but not CFTR biogenesis, degradation, or chloride channel function.
One unusual feature of this protein is that during biogenesis, approximately 75% of wild
type CFTR is degraded by the endoplasmic reticulum (ER)-associated degradative
(ERAD) pathway. Examining the biogenesis and structural instability of the molecule
has been technically challenging due to the limited amount of CFTR expressed in
epithelia. Consequently, investigators have employed heterologous overexpression
systems. Based on recent results that epithelial specific factors regulate both CFTR
biogenesis and function, we hypothesized that CFTR biogenesis in endogenous CFTR
expressing epithelial cells may be more efficient. To test this, we compared CFTR
biogenesis in two epithelial cell lines endogenously expressing CFTR (Calu-3 and T84)
with two heterologous expression systems (COS-7 and HeLa). Consistent with previous
reports, 20 and 35% of the newly synthesized CFTR were converted to maturely
glycosylated CFTR in COS-7 and HeLa cells, respectively. In contrast, CFTR
maturation was virtually 100% efficient in Calu-3 and T84 cells. Furthermore,
inhibition of the proteasome had no effect on CFTR biogenesis in Calu-3 cells, whereas
it stabilized the immature form of CFTR in HeLa cells. Quantitative reverse
transcriptase-PCR indicated that CFTR message levels are approximately 4-fold lower
77
in Calu-3 than HeLa cells, yet steady-state protein levels are comparable. Our results
question the structural instability model of wild type CFTR and indicate that epithelial
cells endogenously expressing CFTR efficiently process this protein to post-Golgi
compartments.
Misfolded proteins destined for the cell surface are recognized and degraded by the
ERAD [ER (endoplasmic reticulum) associated degradation] pathway. TS (temperaturesensitive) mutants at the permissive temperature escape ERAD and reach the cell
surface. In this present paper, we examined a TS mutant of the CFTR [CF (cystic
fibrosis) transmembrane conductance regulator], CFTR ΔF508, and analysed its cellsurface trafficking after rescue [rΔF508 (rescued ΔF508) CFTR]. We show that rΔF508
CFTR endocytosis is 6-fold more rapid (~30% per 2.5 min) than WT (wild-type, ~5%
per 2.5 min) CFTR at 37 °C in polarized airway epithelial cells (CFBE41o-). We also
investigated rΔF508 CFTR endocytosis under two further conditions: in culture at the
permissive temperature (27 °C) and following treatment with pharmacological
chaperones. At low temperature, rΔF508 CFTR endocytosis slowed to WT rates (20%
per 10 min), indicating that the cell-surface trafficking defect of rΔF508 CFTR is TS.
Furthermore, rΔF508 CFTR is stabilized at the lower temperature; its half-life increases
from <2 h at 37 °C to >8 h at 27 °C. Pharmacological chaperone treatment at 37 °C
corrected the rΔF508 CFTR internalization defect, slowing endocytosis from ~30% per
2.5 min to ~5% per 2.5 min, and doubled ΔF508 surface half-life from 2 to 4 h. These
effects are ΔF508 CFTR-specific, as pharmacological chaperones did not affect WT
CFTR or transferrin receptor internalization rates. The results indicate that small
molecular correctors may reproduce the effect of incubation at the permissive
temperature, not only by rescuing ΔF508 CFTR from ERAD, but also by enhancing its
cell-surface stability
78
Összefoglalás
Ezen munkában bemutatjuk, hogy egy második aminosav helyettesítés a CFTR carboxyvégén, nevezetesen I1427A az Y1424A mellett több, mint kétszeresere növeli a CFTR
sejtfelszíni megjelenését amint az biotinilációval igazolható. Internalizációs viszgálatok
azt igazolják, hogy a Y1424A,I1427A megnövekedett sejtfelszíni megjelenése
hátterében az endocytosis 76%-os gátlása áll. A klórcsatorna aktivitás Patch clamp
vizsgálatai igazolták, hogy ennek megfelelően a Y1424A,I1427A CFTR klórcsatorna
aktivitás növekedett, hasonlóan a sejtfelszíni megjelenéshez, de e mellett a CFTR
csatorna tulajdonságok nem változtak. A Y1424A egy közbenső fenotípusnak megfelelő
tulajdonságokat mutat a dupla mutációval való összehasonlitásban, mind a setfelszíni
megjelenés, mind a klórcsatorna aktivitás tekintetében. Metabolikus pulse-chase
kísérletek tanusága szerint ezen két mutációnak semmilyen hatása nem volt sem a
fehérje érésére, sem annak fél-életidejére. Mindezt összevetve elmondhatjuk, hogy
adataink tanulsága szerint a CFTR COOH-vége egy Tyr(1424)-X-X-Ile(1427)
internalizációs szignált tartalmaz, amelyben mind a tyrozin, mind az izoleucin
esszenciális összetevők. Ez a szignál a CFTR sejtfelszíni megjelenését szabályozza,
viszont annak biogenezisére, dagradációjára és klórcsatorna funkciójára nincs hatással.
Ezen fehérje egyik szokatlan tulajdonsága, hogy a biogenezis során a wild type CFTR
mintegy 75%-a degradálódik az ERAD-ban. A molekula biogenezisének és strukturális
instabilitásának vizsgálata komoly technikai kihívást jelent, mivel az epitheliális sejtek
CFTR termelése alacsony. Ebből következően a kutatók heterológ
túltermelő
rendszereket alkalmaznak. Azon új eredmények alapján melyek azt mutatják, hogy
epithelia specifikus faktorok szabályozzák mind a CFTR biogenezist, mind a funkciót,
feltételeztük, hogy a CFTR biogenezis az azt endogénen termelő epitheliális sejtekben
valószínűleg sokkal hatékonyabb. Ennek igazolására összehasonlítottuk a CFTR
biogenezist két epitheliális sejtvonalban, melyek endogénen termelik a CFTR-t (Calu-3
és T84), valamint két heterológ rendszerben (COS-7 és HeLa). A korábban közölt
adatoknak megfelelően a COS-7 és a HeLa sejtekben az újonnan termelt CFTR 20 és 35
%-a alakult át érett CFTR-é. Ezzel ellentétben a CFTR érése virtuálisan 100% volt a
Calu-3 és a T84 sejtvonalakban. Mindezen felül a proteasome gátlása a Calu-3 sejtekben
nem volt hatással a biogenezisre, viszont a HeLa sejtekben stabilizálta az éretlen CFTR
79
formát. Kvantitatív rt-PCR vizsgálatokban a CFTR message szint a Calu-3 sejtekben
négyszer alacsonyabb, mint a HeLa sejtekben, noha a steady-state fehérjeszintek
hasonlóak. Eredményeink kérdésessé teszik a wild type CFTR strukturális instabilitás
modeljét és azt igazolják, hogy a CFTR-t endogénen termelő epitheliális sejtek
hatékonyan továbbítják azt a post-Golgi kompartmentekbe.
A sejtfelszínre szánt, de nem megfelelően átalakított (missfolded) fehérjéket az ERAD
(endoplazmikus retikulumhoz társult degradáció) út felismeri és degradálja. Permisszív
hőmérsékleten a hőérzékeny mutánsok képesek kiszabadulni az ERAD-ból és elérni a
sejtfelszínt. Ezen munkában egy hőérzékeny CFTR mutáns, a ΔF508 esetében vizsgáltuk
annak sejtfelszíni forgalmát a kiszabadítást követően. Igazoljuk, hogy a kiszabadított,
ugynevezett rΔF508 CFTR endocitózis hatszor gyorsabb (mintegy 30% 2,5 perc alatt),
mint a wild type (mintegy 5% 2,5 perc alatt) 37oC-on polarizált légúti epitheliális
sejtekben (CFBE41o- ). Vizsgáltuk az rΔF508 CFTR endocitózist két másik esetben is:
permisszív hőmérsékleten (27oC) valamint pharmakológiai chaperonokkal való kezelést
követően. Alacsony hőmérsékleten a rΔF508 CFTR endocitózis a wild type szintjére
csökkent (20% 10 perc alatt), amely azt mutatja, hogy a sejtfelszíni forgalom hibája a
rΔF508 CFTR esetében hőérzékeny. Mindezen felül a rΔF508 CFTR alacsonyabb
hőmérsékleten stabil : a fél-életidő a 37oC-on mért ≤2 óráról 27oC-on ≥8 órára
emelkedik. Pharmakológiai chaperonokkal való kezelés 37oC-on korrigálja a rΔF508
CFTR internalizációs hibáját: az endocitózis mintegy 30%-ról kb. 5%-ra csökken 2,5
perc alatt, illetve a felszíni fél-életidő 2-ről 4 órára emelkedik. Ezen hatások ΔF508
CFTR specifikusak, mivel a pharmakológiai chaperonok nem voltak hatással a wild type
CFTR illetve a transferrin receptor internalizációs tulajdonságaira. Eredményeink azt
igazolják, hogy kis molekulatömegű korrektorokkal reprodukálni tudjuk a permisszív
hőmérsékleten való inkubáció hatását, nem csak azzal, hogy a ΔF508 CFTR
kiszabadítható az ERAD-ból, hanem azzal is, hogy annak sejtfelszini stabilitása szintén
nő.
80
9. MY PUBLICATIONS ASSOCIATED WITH THE THESIS
1
Bebok Z, Varga K, Hicks JK, Venglarik CJ, Kovacs T, Chen L, Hardiman KM,
Collawn JF, Sorscher EJ, Matalon S. Reactive oxygen nitrogen species decrease
cystic fibrosis transmembrane conductance regulator expression and cAMP-mediated
Cl- secretion in airway epithelia. J Biol Chem. 2002 Nov 8;277(45):43041-9. Epub
2002 Aug 22.PMID: 12194970
2
Peter K, Varga K, Bebok Z, McNicholas-Bevensee CM, Schwiebert L, Sorscher EJ,
Schwiebert EM, Collawn JF. Ablation of internalization signals in the carboxylterminal tail of the cystic fibrosis transmembrane conductance regulator enhances cell
surface expression. J Biol Chem. 2002 Dec 20;277(51):49952-7. Epub 2002 Oct 9.
3
Varga K, Jurkuvenaite A, Wakefield J, Hong JS, Guimbellot JS, Venglarik CJ, Niraj
A, Mazur M, Sorscher EJ, Collawn JF, Bebök Z. Efficient intracellular processing of
the endogenous cystic fibrosis transmembrane conductance regulator in epithelial cell
lines. J Biol Chem. 2004 May 21;279(21):22578-84. Epub 2004 Apr 1.
4
Bebok Z, Collawn JF, Wakefield J, Parker W, Li Y, Varga K, Sorscher EJ, Clancy
JP. Failure of cAMP agonists to activate rescued deltaF508 CFTR in CFBE41oairway epithelial monolayers. J Physiol. 2005 Dec 1;569(Pt 2):601-15. Epub 2005 Oct
6.
5
Jurkuvenaite A, Varga K, Nowotarski K, Kirk KL, Sorscher EJ, Li Y, Clancy JP,
Bebok
Z, Collawn JF. Mutations in the amino terminus of the cystic fibrosis
transmembrane conductance regulator enhance endocytosis. J Biol Chem. 2006 Feb
10;281(6):3329-34. Epub 2005 Dec 8.
6
Varga K, Goldstein RF, Jurkuvenaite A, Chen L, Matalon S, Sorscher EJ, Bebok Z,
Collawn JF. Enhanced cell-surface stability of rescued DeltaF508 cystic fibrosis
transmembrane conductance regulator (CFTR) by pharmacological chaperones.
Biochem J. 2008 Mar
7
15;410(3):555-64.
Tucker TA, Varga K, Bebok Z, Zsembery A, McCarty NA, Collawn JF, Schwiebert
EM, Schwiebert LM. Transient transfection of polarized epithelial monolayers with
CFTR and reporter genes using efficacious lipids. Am J Physiol Cell Physiol. 2003
Mar;284(3):C791-804. Epub 2002 Nov 6.
81
8
Estell K, Braunstein G, Tucker T, Varga K, Collawn JF, Schwiebert LM. Plasma
membrane CFTR regulates RANTES expression via its C-terminal PDZ-interacting
motif. Mol Cell Biol. 2003 Jan;23(2):594-606.
9
Rowe SM, Varga K, Rab A, Bebok Z, Byram K, Li Y, Sorscher EJ, Clancy JP.
Restoration of W1282X CFTR activity by enhanced expression. Am J Respir Cell
Mol Biol. 2007 Sep;37(3):347-56. Epub 2007 May 31.
10 Chen L, Bosworth CA, Pico T, Collawn JF, Varga K, Gao Z, Clancy JP, Fortenberry
JA, Lancaster JR Jr, Matalon S. DETANO and nitrated lipids increase chloride
secretion across lung airway cells. Am J Respir Cell Mol Biol. 2008 Aug;39(2):15062. Epub 2008 Feb 28.
Abstracts
1. Bebok Z, C Venglarik, K Varga, T Kovacs, K Shestra, J Collawn, E Sorscher, S
Matalon. Functional consequences of decreased CFTR levels caused by nitric oxide
in epithelial cell monolayers. Pediatric Pulmonology Supplement 22: 272 (Abst. 289),
2001.
2. Tucker TA, K Varga, Z Bebok, GM Braunstein, JF Collawn, EM Schwiebert.
G551D-CFTR and ΔF508-CFTR inhibit wild-type CFTR maturation and/or function
in human airway epithelial cells in a dominant negative-like manner.
Pediatric
Pulmonology Supplement 24: 185 (Abst. 13), 2002.
3. Bebok Z, K Varga, JF Collawn, J Hong, EM Schwiebert, CJ Venglarik, EJ Sorscher.
Processing of endogenous wild-type CFTR is efficient in Calu-3 cells.
Pediatric
Pulmonology Supplement 24: 185 (Abst. 14), 2002.
4. Varga K, Z Bebok, EJ Sorscher, EM Schwiebert, T Tucker, LM Schwiebert, JF
Collawn.
Wild-type CFTR surface expression and endocytosis display different
kinetics in human airway epithelial cells when compared to heterologous expression
systems. Pediatric Pulmonology Supplement 24: 195 (Abst. 45), 2002.
5. Jurkuvenaite A, Varga K, Niraj A, Horvath G, Sorscher EJ, Schwiebert E, Schwiebert
L, JF Collawn, Z Bebok Biogenesis of CFTR in CALU 3 Cells: Intracellular
processing of the wild type protein Pediatric Pulmonology Supplement 25; 193-194
(Abst. 25.) 2003
82
6. Clancy JP, Fan L, Bebok Z, Cobb B, Hardy K, Hong J, Varga K, Schorscher E.
AdCFTR Expression in CFBE 41o cells: a high resistance human airway monolayer
model Pediatric Pulmonology Supplement 25; 229 (Abst. 130) 2003
7. Varga K, Jurkuvenaite A, Niraj A, Schorscher E, Bebok Z, Collawn J. CFTR
endocytosis in polarized Calu 3 cells is remarkably slow. Pediatric Pulmonology
Supplement 25; 232 (Abst. 139) 2003
8. Jurkuvenaite A, Rab A, Varga K, Niraj A, Sorscher EJ, Collawn JF, Bebok Z.
Efficient wild type CFTR biogenesis in epithelial cells: Inhibition of the proteasome
has no effect on core-glycosylated CFTR stability. Pediatric Pulmonology Supplement
27; 190 (Abst. 6) 2004
9. BebokZ, Collawn JF, Fan L, Varga K, Li Y, Sorscher EJ, Wakefield J, Clancy JP.
Failure to activate rescued ∆F508 CFTR at the cell surface of airway epithelial Cells
using conventional receptor pathways. Pediatric Pulmonology Supplement 27; 191
(Abst. 7) 2004
10. Varga K, Jurkuvenaite A, Li Y, Clancy JP, Sorscer EJ, bebok Z, Collawn JF. Surface
stability of the rescued ∆F508 CFTR is compromised by inefficient recycling.
Pediatric Pulmonology Supplement 27; 193 (Abst. 13) 2004
11. Varga K, Jurkuvenaite A, Schwiebert EM, Sorscher EJ, Bebok Z, Collawn JF.
Lantrunculin treatment increases CFTR endocytosis in Calu-3 monolayers. Pediatric
Pulmonology Supplement 27; 193 (Abst. 14) 2004
12. Bebok Z, Wakefield J, Collawn J, Fan L, Varga K, Fortenberry J, Hong J, Sorscher E,
Clancy JP. Comparison of FRT and CFBE41o- epithelia to study CFTR processing
and function. Pediatric Pulmonology Supplement 27; 231 (Abst. 126) 2004
13. Varga K, Jurkuvenaite A, Goldstein R, Sorscher E, Bebok Z, Collawn J. Differences
in the trafficking of WT and rescued
∆F508 CFTR in human airway epithelia.
Pediatric Pulmonology Supplement 28; 196 (Abst. 18) 2005
14. Jurkuvenaite A, Varga K, Nowotarsky K, Kirk K, Li Y, Clancy J, Sorscher E, Bebok
Z, Collawn J. Two naturally-occurring mutations enhance CFTR endocytosis.
Pediatric Pulmonology Supplement 28; 196 (abst. 20) 2005
15. Matalon S, Chen L, Varga K, Bebok Z, Patel R, Collawn J. Modulation of Chloride
Secretion across Airway and Alveolar Epithelial Cells by Nitric Oxide and Its
Cngeners. Proceedings of the American Thoracic Society, Vol 2: A299, 2005
83
16. Varga K, Jurkuvenaite A, Rideg O, Rowe SM, Clancy JP, Sorscher EJ, Bebok Z,
Collawn J. ∆F508 CFTR Surface stability in human airway epithelial cells. Pediatric
Pulmonology Supplement 29; 214 (Abst. 17) 2006
17. Rideg O, Rab A, Jurkuvenaite A, Varga K, Li Y, Clancy JP, Sorscher EJ, Collawn JF,
Bebok Z. Cellular mechanisms associated with ∆F508 CFTR rescue. Pediatric
Pulmonology Supplement 29; 213 (Abst. 14) 2006
18. Rowe SM, Bebok Z, Bartoszewski R, Varga K, Collawn J, Sorscher EJ, Clancy JP.
∆F508 CFTR activity in polarized epithelial cells – distinct differences in cyclic AMP
dependent Cl- transport. Pediatric Pulmonology Supplement 30; 285 (Abst. 238) 2007
19. Varga K, Jurkuvenaite A, Goldstein R, Bartoszewski R, Sorscher EJ, Bebok Z,
Collawn J. Small molecular correctors increase the surface stability of rescued ∆F508
CFTR. Pediatric Pulmonology Supplement 30; 288 (Abst. 245) 2007
20. Rowe SM, Bebok Z, Varga K, Collawn J, Sorscher EJ, Clancy JP. Comparison of
maneuvers to correct ∆F508 CFTR: chemical agents and low temperature produce
surface targeted protein with similar activation profiles. Pediatric Pulmonology
Supplement 30; 299 (Abst. 277) 2007
21. Rowe SM, Varga K, Bebok Z, Li Y, Fan L, Nowartowski K, Prasin J, Barnes S,
Clancy JP, Sorscher EJ. Processing correction and direct activation of ∆F508 CFTR
by the Flavonoid Equol in vitro. Pediatric Pulmonology Supplement 30; 299 (Abst.
276) 2007
22. Pyle LC, Ehrhardt A, Wang W, Varga K, Nowotarski KJ, Rowe SM, Sorscher EJ.
Mechanisms underlying potentiator activation of CFTR.
Supplement 30; 305 (Abst. 292) 2007
84
Pediatric Pulmonology
10. MY PUBLICATIONS NOT ASSOCIATED WITH THE THESIS
1. Lyuksyutova OI, Varga K, Van Buren CT, Pivalizza EG. Thrombelastography in a
patient with prolonged partial thromboplastin time undergoing a kidney transplant.
Anesth Analg. 2009 Apr;108(4):1355-6.
85
11. ACKNOWLEDGEMENT
First of all my sincere thanks go to Dr. Laszlo Rosivall, the Head of PhD School of
Medical Sciences for his extraordinary help finalizing my work and for his generosity to
accept it in his program.
This work was accomplished at the Department of Cell Biology and at the Gregory
Fleming James Cystic Fibrosis Research Center at the University of Alabama at
Birmingham, Birmingham, AL, U.S.A.
The work on the internalization signal studies was supported in part by a fellowship
from the Research Development Program of the Cystic Fibrosis Foundation (CFF) (to
K. Peter and K. Varga), Grants COLLAWOOGO from the CFF and DK 60065 from the
National Institutes of Health (to J. F. Collawn), Grant DK 54367 from the National
Institutes of Health (to E. M. Schwiebert.), and a grant from the Research Development
Program of the CFF and the National Institutes of Health (to E. J. Sorscher.).
The work on the biogenesis studies was supported in part by a fellowship from the
Research Development Program of the Cystic Fibrosis Foundation (CFF) (to K. Varga),
an American Lung Association grant (to Z. Bebok), National Institutes of Health Grant
DK60065 (to J. F. Collawn), and a grant from the Research Development Program of
the CFF and the National Institutes of Health (to E. J. Sorscher).
The work on the CF corrector studies was supported by NIH (National Institutes of
Health) grants DK60065 (to J. F. Collawn), HL076587 (to Z. Bebok), HL075540 (to S.
Matalon), P30 DK072402 (to E. J. Sorscher) and by a Cystic Fibrosis Foundation grant
CFF R464-CR07 (to E. J. Sorscher).
I thank Dr Robert Bridges (Department of Physiology and Biophysics, Rosalind
Franklin University of Medicine and Science, North Chicago, IL, U.S.A.), Dr Melissa
Ashlock (Cystic Fibrosis Foundation Therapeutics, Bethesda, MD, U.S.A.) and Cystic
Fibrosis Foundation Therapeutics for providing the pharmaceutical correctors.
All of the members of the Collawn, Bebok, Sorscher and Matalon labs have been
invaluable in their contribution to this work. Particularly my sincere thanks go to James
86
F. Collawn and Zsuzsa Bebok, two extraordinary scientists, whom were not only my
teachers, supervisors and supporters, but also true friends.
87
12. REFERENCES
Ameen NA, van Donselaar E, Posthuma G, de Jonge H, McLaughlin G, Geuze HJ,
Marino C, Peters PJ (Subcellular distribution of CFTR in rat intestine supports a
physiologic role for CFTR regulation by vesicle traffic. Histochem Cell Biol
114:219-228.2000).
Aridor M, Hannan LA (Traffic Jam: A Compendium of Human Diseases that Affect
Intracellular Transport Processes. Traffic 1:836-851.2000).
Aridor M, Hannan LA (Traffic Jams II: An Update of Diseases of Intracellular Transport.
Traffic 3:781-790.2002).
Bebok Z, Collawn JF, Wakefield J, Parker W, Li Y, Varga K, Sorscher EJ, Clancy JP
(Failure of cAMP agonists to activate rescued ΔF508 CFTR in CFBE41o– airway
epithelial monolayers. The Journal of Physiology 569:601-615.2005).
Bebok Z, Tousson A, Schwiebert LM, Venglarik CJ (Improved oxygenation promotes
CFTR maturation and trafficking in MDCK monolayers. Am J Physiol Cell
Physiol 280:C135-145.2001).
Bebok Z, Varga K, Hicks JK, Venglarik CJ, Kovacs T, Chen L, Hardiman KM, Collawn
JF, Sorscher EJ, Matalon S (Reactive Oxygen Nitrogen Species Decrease Cystic
Fibrosis Transmembrane Conductance Regulator Expression and cAMP-mediated
Cl− Secretion in Airway Epithelia. Journal of Biological Chemistry 277:4304143049.2002).
Bebok Z, Venglarik CJ, Panczel Z, Jilling T, Kirk KL, Sorscher EJ (Activation of Delta
F508 CFTR in an epithelial monolayer. Am J Physiol Cell Physiol 275:C599607.1998).
Bertrand CA, Frizzell RA (The role of regulated CFTR trafficking in epithelial secretion.
Am J Physiol Cell Physiol 285:C1-18.2003).
Bradbury NA (Intracellular CFTR: Localization and Function. Physiol Rev 79:175191.1999).
Bradbury NA, Clark JA, Watkins SC, Widnell CC, Smith HS, Bridges RJ
(Characterization of the internalization pathways for the cystic fibrosis
transmembrane conductance regulator. Am J Physiol-Lung Cell Mol Physiol
276:L659-L668.1999).
88
Bradbury NA, Cohn JA, Venglarik CJ, Bridges RJ (Biochemical and biophysical
identification of cystic fibrosis transmembrane conductance regulator chloride
channels as components of endocytic clathrin-coated vesicles. Journal of
Biological Chemistry 269:8296-8302.1994).
Bradbury NA, Jilling T, Berta G, Sorscher EJ, Bridges RJ, Kirk KL (Regulation of
plasma membrane recycling by CFTR. Science 256:530-532.1992).
Brown CR, Hong-Brown LQ, Biwersi J, Verkman AS, Welch WJ (Chemical chaperones
correct the mutant phenotype of the delta F508 cystic fibrosis transmembrane
conductance regulator protein. Cell Stress Chaperones 1:117-125.1996).
Brown D, Katsura T, Kawashima M, Verkman AS, Sabolic I (Cellular distribution of the
aquaporins: a family of water channel proteins. Histochem Cell Biol 104:19.1995).
Chen L, Patel RP, Teng X, Bosworth CA, Lancaster JR, Matalon S (Mechanisms of
Cystic Fibrosis Transmembrane Conductance Regulator Activation by SNitrosoglutathione. Journal of Biological Chemistry 281:9190-9199.2006).
Cheng J, Moyer BD, Milewski M, Loffing J, Ikeda M, Mickle JE, Cutting GR, Li M,
Stanton BA, Guggino WB (A Golgi-associated PDZ Domain Protein Modulates
Cystic Fibrosis Transmembrane Regulator Plasma Membrane Expression. Journal
of Biological Chemistry 277:3520-3529.2002).
Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, O'Riordan CR, Smith
AE (Defective intracellular transport and processing of CFTR is the molecular
basis of most cystic fibrosis. Cell 63:827-834.1990a).
Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, O'Riordan CR, Smith
AE (Defective intracellular transport and processing of CFTR is the molecular
basis of most cystic fibrosis. Cell 63:827-834.1990b).
Cohn JA, Nairn AC, Marino CR, Melhus O, Kole J (Characterization of the cystic
fibrosis transmembrane conductance regulator in a colonocyte cell line.
Proceedings of the National Academy of Sciences of the United States of America
89:2340-2344.1992).
Cohn JA, Strong TV, Picciotto MR, Nairn AC, Collins FS, Fitz JG (Localization of the
cystic fibrosis transmembrane conductance regulator in human bile duct epithelial
cells. Gastroenterology 105:1857-1864.1993).
89
Collawn JF, Stangel M, Kuhn LA, Esekogwu V, Jing S, Trowbridge IS, Tainer JA
(Transferrin receptor internalization sequence YXRF implicates a tight turn as the
structural recognition motif for endocytosis. Cell 63:1061-1072.1990).
Collins FS (Cystic fibrosis: molecular biology and therapeutic implications. Science
256:774-779.1992).
Coyne CB, Vanhook MK, Gambling TM, Carson JL, Boucher RC, Johnson LG
(Regulation of Airway Tight Junctions by Proinflammatory Cytokines. Mol Biol
Cell 13:3218-3234.2002).
Dalemans W, Barbry P, Champigny G, Jallat S, Dott K, Dreyer D, Crystal RG, Pavirani
A, Lecocq JP, Lazdunski M (Altered chloride ion channel kinetics associated with
the delta F508 cystic fibrosis mutation. Nature 354:526-528.1991).
Denning GM, Anderson MP, Amara JF, Marshall J, Smith AE, Welsh MJ (Processing of
mutant cystic fibrosis transmembrane conductance regulator is temperaturesensitive. Nature 358:761-764.1992).
Dick LR, Cruikshank AA, Grenier L, Melandri FD, Nunes SL, Stein RL (Mechanistic
Studies on the Inactivation of the Proteasome by Lactacystin. Journal of
Biological Chemistry 271:7273-7276.1996).
Du K, Sharma M, Lukacs GL (The [Delta]F508 cystic fibrosis mutation impairs domaindomain interactions and arrests post-translational folding of CFTR. Nat Struct
Mol Biol 12:17-25.2005).
Dunn WA, Hubbard AL, Aronson NN (Low temperature selectively inhibits fusion
between pinocytic vesicles and lysosomes during heterophagy of 125I-asialofetuin
by the perfused rat liver. Journal of Biological Chemistry 255:5971-5978.1980).
Gelman MS, Kannegaard ES, Kopito RR (A Principal Role for the Proteasome in
Endoplasmic Reticulum-associated Degradation of Misfolded Intracellular Cystic
Fibrosis Transmembrane Conductance Regulator. Journal of Biological Chemistry
277:11709-11714.2002).
Gentzsch M, Chang X-B, Cui L, Wu Y, Ozols VV, Choudhury A, Pagano RE, Riordan
JR (Endocytic Trafficking Routes of Wild Type and {Delta}F508 Cystic Fibrosis
Transmembrane Conductance Regulator. Mol Biol Cell 15:2684-2696.2004).
Goldberg AL (Protein degradation and protection against misfolded or damaged proteins.
Nature 426:895-899.2003).
90
Green S, Setiadi H, McEver R, Kelly R (The cytoplasmic domain of P-selectin contains a
sorting determinant that mediates rapid degradation in lysosomes. J Cell Biol
124:435-448.1994).
Haggie PM, Kim JK, Lukacs GL, Verkman AS (Tracking of Quantum Dot-labeled CFTR
Shows Near Immobilization by C-Terminal PDZ Interactions. Mol Biol Cell
17:4937-4945.2006).
Hampton RY (ER-associated degradation in protein quality control and cellular
regulation. Current Opinion in Cell Biology 14:476-482.2002).
Haslett JN, Sanoudou D, Kho AT, Bennett RR, Greenberg SA, Kohane IS, Beggs AH,
Kunkel LM (Gene expression comparison of biopsies from Duchenne muscular
dystrophy (DMD) and normal skeletal muscle. Proceedings of the National
Academy of Sciences of the United States of America 99:15000-15005.2002).
Haylett T, Thilo L (Endosome-lysosome fusion at low temperature. Journal of Biological
Chemistry 266:8322-8327.1991).
Heda GD, Tanwani M, Marino CR (The Delta F508 mutation shortens the biochemical
half-life of plasma membrane CFTR in polarized epithelial cells. Am J Physiol
Cell Physiol 280:C166-174.2001).
Hegedus T, Aleksandrov A, Cui L, Gentzsch M, Chang X-B, Riordan JR (F508del CFTR
with two altered RXR motifs escapes from ER quality control but its channel
activity is thermally sensitive. Biochimica et Biophysica Acta (BBA) Biomembranes 1758:565-572.2006).
Holman GD, Lo Leggio L, Cushman SW (Insulin-stimulated GLUT4 glucose transporter
recycling. A problem in membrane protein subcellular trafficking through
multiple pools. Journal of Biological Chemistry 269:17516-17524.1994).
Jensen TJ, Loo MA, Pind S, Williams DB, Goldberg AL, Riordan JR (Multiple
proteolytic systems, including the proteasome, contribute to CFTR processing.
Cell 83:129-135.1995a).
Jensen TJ, Loo MA, Pind S, Williams DB, Goldberg AL, Riordan JR (Multiple
proteolytic systems, including the proteasome, contribute to CFTR processing.
Cell 83:129-135.1995b).
Jhun BH, Rampal AL, Liu H, Lachaal M, Jung CY (Effects of insulin on steady state
kinetics of GLUT4 subcellular distribution in rat adipocytes. Evidence of
91
constitutive GLUT4 recycling. Journal of Biological Chemistry 267:1771017715.1992).
Johnston JA, Ward CL, Kopito RR (Aggresomes: A Cellular Response to Misfolded
Proteins. J Cell Biol 143:1883-1898.1998).
Jurkuvenaite A, Varga K, Nowotarski K, Kirk KL, Sorscher EJ, Li Y, Clancy JP, Bebok
Z, Collawn JF (Mutations in the Amino Terminus of the Cystic Fibrosis
Transmembrane Conductance Regulator Enhance Endocytosis. Journal of
Biological Chemistry 281:3329-3334.2006).
Kalin N, Claass A, Sommer M, Puchelle E, Tummler B (Delta F508 CFTR protein
expression in tissues from patients with cystic fibrosis. J Clin Invest 103:13791389.1999).
Kappes JC, Wu X, Wakefield JK (Production of trans-lentiviral vector with predictable
safety. Methods Mol Med 76:449-465.2003).
Katsura T, Verbavatz JM, Farinas J, Ma T, Ausiello DA, Verkman AS, Brown D
(Constitutive and regulated membrane expression of aquaporin 1 and aquaporin 2
water channels in stably transfected LLC-PK1 epithelial cells. Proceedings of the
National Academy of Sciences of the United States of America 92:72127216.1995).
Kim PS, Arvan P (Endocrinopathies in the Family of Endoplasmic Reticulum (ER)
Storage Diseases: Disorders of Protein Trafficking and the Role of ER Molecular
Chaperones. Endocr Rev 19:173-202.1998).
Kreda SM, Mall M, Mengos A, Rochelle L, Yankaskas J, Riordan JR, Boucher RC
(Characterization of wild-type and deltaF508 cystic fibrosis transmembrane
regulator in human respiratory epithelia. Mol Biol Cell 16:2154-2167.2005).
Krumins AM, Barker SA, Huang C, Sunahara RK, Yu K, Wilkie TM, Gold SJ, Mumby
SM (Differentially Regulated Expression of Endogenous RGS4 and RGS7.
Journal of Biological Chemistry 279:2593-2599.2004).
Kunkel TA (Rapid and efficient site-specific mutagenesis without phenotypic selection.
Proceedings of the National Academy of Sciences of the United States of America
82:488-492.1985).
92
Li G, Alexander EA, Schwartz JH (Syntaxin Isoform Specificity in the Regulation of
Renal H+-ATPase Exocytosis. Journal of Biological Chemistry 278:1979119797.2003).
Li J, Quilty J, Popov M, Reithmeier RA (Processing of N-linked oligosaccharide depends
on its location in the anion exchanger, AE1, membrane glycoprotein. Biochem J
349:51-57.2000).
Li J, Wang C-c (“Half of the Sites” Binding ofd-Glyceraldehyde-3-phosphate
Dehydrogenase Folding Intermediate with GroEL. Journal of Biological
Chemistry 274:10790-10794.1999).
Liu TI, Lebaric ZN, Rosenthal JJC, Gilly WF (Natural Substitutions at Highly Conserved
T1-Domain Residues Perturb Processing and Functional Expression of Squid Kv1
Channels. J Neurophysiol 85:61-71.2001).
Loffing J, Moyer BD, McCoy D, Stanton BA (Exocytosis is not involved in activation of
Cl- secretion via CFTR in Calu-3 airway epithelial cells. Am J Physiol Cell
Physiol 275:C913-920.1998).
Loffing J, Moyer BD, Reynolds D, Stanton BA (PBA increases CFTR expression but at
high doses inhibits Cl- secretion in Calu-3 airway epithelial cells. Am J Physiol
Lung Cell Mol Physiol 277:L700-708.1999).
Loo T, Bartlett M, Clarke D (Rescue of Folding Defects in ABC Transporters Using
Pharmacological Chaperones. Journal of Bioenergetics and Biomembranes
37:501-507.2005).
Loo TW, Bartlett MC, Wang Y, Clarke DM (The chemical chaperone CFcor-325 repairs
folding defects in the transmembrane domains of CFTR-processing mutants.
Biochem J 395:537-542.2006).
Lukacs GL, Mohamed A, Kartner N, Chang XB, Riordan JR, Grinstein S
(CONFORMATIONAL MATURATION OF CFTR BUT NOT ITS MUTANT
COUNTERPART (DELTA-F508) OCCURS
IN THE ENDOPLASMIC-
RETICULUM AND REQUIRES ATP. Embo J 13:6076-6086.1994).
Lukacs GL, Segal G, Kartner N, Grinstein S, Zhang F (Constitutive internalization of
cystic fibrosis transmembrane conductance regulator occurs via clathrindependent endocytosis and is regulated by protein phosphorylation. Biochem J
328:353-361.1997).
93
Madrid R, Le Maout S, Barrault MB, Janvier K, Benichou S, Merot J (Polarized
trafficking and surface expression of the AQP4 water channel are coordinated by
serial and regulated interactions with different clathrin-adaptor complexes. Embo
J 20:7008-7021.2001).
Morris AP, Cunningham SA, Tousson A, Benos DJ, Frizzell RA (Polarization-dependent
apical membrane CFTR targeting underlies cAMP-stimulated Cl- secretion in
epithelial cells. Am J Physiol Cell Physiol 266:C254-268.1994).
Moyer BD, Loffing J, Schwiebert EM, Loffing-Cueni D, Halpin PA, Karlson KH,
Ismailov II, Guggino WB, Langford GM, Stanton BA (Membrane Trafficking of
the Cystic Fibrosis Gene Product, Cystic Fibrosis Transmembrane Conductance
Regulator, Tagged with Green Fluorescent Protein in Madin-Darby Canine
Kidney Cells. Journal of Biological Chemistry 273:21759-21768.1998).
Mukherjee S, Ghosh RN, Maxfield FR (Endocytosis. Physiol Rev 77:759-803.1997).
Naren AP, Cobb B, Li C, Roy K, Nelson D, Heda GD, Liao J, Kirk KL, Sorscher EJ,
Hanrahan J, Clancy JP (A macromolecular complex of β2 adrenergic receptor,
CFTR, and ezrin/radixin/moesin-binding phosphoprotein 50 is regulated by PKA.
Proceedings of the National Academy of Sciences of the United States of America
100:342-346.2003).
Naren AP, Kirk KL (CFTR Chloride Channels: Binding Partners and Regulatory
Networks. News Physiol Sci 15:57-61.2000).
Naren AP, Nelson DJ, Xie W, Jovov B, Pevsner J, Bennett MK, Benos DJ, Quick MW,
Kirk KL (Regulation of CFTR chloride channels by syntaxin and Munc18
isoforms. Nature 390:302-305.1997).
Naren AP, Quick MW, Collawn JF, Nelson DJ, Kirk KL (Syntaxin 1A inhibits CFTR
chloride channels by means of domain-specific protein–protein interactions.
Proceedings of the National Academy of Sciences of the United States of America
95:10972-10977.1998).
Nielsen S, Chou CL, Marples D, Christensen EI, Kishore BK, Knepper MA (Vasopressin
increases water permeability of kidney collecting duct by inducing translocation
of aquaporin-CD water channels to plasma membrane. Proceedings of the
National Academy of Sciences of the United States of America 92:10131017.1995).
94
Norez C, Noel S, Wilke M, Bijvelds M, Jorna H, Melin P, DeJonge H, Becq F (Rescue of
functional delF508-CFTR channels in cystic fibrosis epithelial cells by the
[alpha]-glucosidase inhibitor miglustat. FEBS Letters 580:2081-2086.2006).
O'Riordan CR, Lachapelle AL, Marshall J, Higgins EA, Cheng SH (Characterization of
the oligosaccharide structures associated with the cystic fibrosis transmembrane
conductance regulator. Glycobiology 10:1225-1233.2000).
Parton R, Prydz K, Bomsel M, Simons K, Griffiths G (Meeting of the apical and
basolateral endocytic pathways of the Madin- Darby canine kidney cell in late
endosomes. J Cell Biol 109:3259-3272.1989).
Pedemonte N, Lukacs GL, Du K, Caci E, Zegarra-Moran O, Galietta LJV, Verkman AS
(Small-molecule correctors of defective ΔF508-CFTR cellular processing
identified by high-throughput screening. The Journal of Clinical Investigation
115:2564-2571.2005).
Penque D, Mendes F, Beck S, Farinha C, Pacheco P, Nogueira P, Lavinha J, Malho R,
Amaral MD (Cystic fibrosis F508del patients have apically localized CFTR in a
reduced number of airway cells. Lab Invest 80:857-868.2000).
Pessin JE, Thurmond DC, Elmendorf JS, Coker KJ, Okada S (Molecular Basis of Insulinstimulated GLUT4 Vesicle Trafficking. Journal of Biological Chemistry
274:2593-2596.1999).
Petäjä-Repo UE, Hogue M, Laperrière A, Bhalla S, Walker P, Bouvier M (Newly
Synthesized Human δ Opioid Receptors Retained in the Endoplasmic Reticulum
Are Retrotranslocated to the Cytosol, Deglycosylated, Ubiquitinated, and
Degraded by the Proteasome. Journal of Biological Chemistry 276:44164423.2001).
Petäjä-Repo UE, Hogue M, Laperrière A, Walker P, Bouvier M (Export from the
Endoplasmic Reticulum Represents the Limiting Step in the Maturation and Cell
Surface Expression of the Human δ Opioid Receptor. Journal of Biological
Chemistry 275:13727-13736.2000).
Peter K, Varga K, Bebok Z, McNicholas-Bevensee CM, Schwiebert L, Sorscher EJ,
Schwiebert EM, Collawn JF (Ablation of Internalization Signals in the Carboxylterminal Tail of the Cystic Fibrosis Transmembrane Conductance Regulator
95
Enhances Cell Surface Expression. Journal of Biological Chemistry 277:4995249957.2002).
Prince LS, Peter K, Hatton SR, Zaliauskiene L, Cotlin LF, Clancy JP, Marchase RB,
Collawn JF (Efficient Endocytosis of the Cystic Fibrosis Transmembrane
Conductance Regulator Requires a Tyrosine-based Signal. Journal of Biological
Chemistry 274:3602-3609.1999).
Prince LS, Workman RB, Marchase RB (Rapid endocytosis of the cystic fibrosis
transmembrane conductance regulator chloride channel. Proceedings of the
National Academy of Sciences of the United States of America 91:51925196.1994).
Rosenstein BJ, Cutting GR (The diagnosis of cystic fibrosis: a consensus statement.
Cystic Fibrosis Foundation Consensus Panel. J Pediatr 132:589-595.1998).
Rowntree RK, Harris A (The phenotypic consequences of CFTR mutations. Ann Hum
Genet 67:471-485.2003).
Sant A, Hendrix L, Coligan J, Maloy W, Germain R (Defective intracellular transport as a
common mechanism limiting expression of inappropriately paired class II major
histocompatibility complex alpha/beta chains. J Exp Med 174:799-808.1991).
Sato S, Ward CL, Krouse ME, Wine JJ, Kopito RR (Glycerol Reverses the Misfolding
Phenotype of the Most Common Cystic Fibrosis Mutation. Journal of Biological
Chemistry 271:635-638.1996).
Schwiebert EM, Morales MM, Devidas S, Egan ME, Guggino WB (Chloride channel and
chloride conductance regulator domains of CFTR, the cystic fibrosis
transmembrane conductance regulator. Proceedings of the National Academy of
Sciences of the United States of America 95:2674-2679.1998).
Sharma M, Benharouga M, Hu W, Lukacs GL (Conformational and temperature-sensitive
stability defects of the delta F508 cystic fibrosis transmembrane conductance
regulator in post-endoplasmic reticulum compartments. J Biol Chem 276:89428950.2001).
Sharma M, Pampinella F, Nemes C, Benharouga M, So J, Du K, Bache KG, Papsin B,
Zerangue N, Stenmark H, Lukacs GL (Misfolding diverts CFTR from recycling to
degradation: quality control at early endosomes. J Cell Biol 164:923-933.2004).
96
Shen RQ, Finkbeiner WE, Wine JJ, Mrsny RJ, Widdicombe JH (CALU-3 - A HUMAN
AIRWAY EPITHELIAL-CELL LINE THAT SHOWS CAMP-DEPENDENT
CL- SECRETION. Am J Physiol 266:L493-L501.1994).
Short DB, Trotter KW, Reczek D, Kreda SM, Bretscher A, Boucher RC, Stutts MJ,
Milgram SL (An Apical PDZ Protein Anchors the Cystic Fibrosis Transmembrane
Conductance Regulator to the Cytoskeleton. Journal of Biological Chemistry
273:19797-19801.1998).
Silvis MR, Picciano JA, Bertrand C, Weixel K, Bridges RJ, Bradbury NA (A Mutation in
the Cystic Fibrosis Transmembrane Conductance Regulator Generates a Novel
Internalization Sequence and Enhances Endocytic Rates. Journal of Biological
Chemistry 278:11554-11560.2003).
Straley KS, Daugherty BL, Aeder SE, Hockenson AL, Kim K, Green SA (An Atypical
Sorting Determinant in the Cytoplasmic Domain of P-Selectin Mediates
Endosomal Sorting. Mol Biol Cell 9:1683-1694.1998).
Suen YF, Robins L, Yang B, Verkman AS, Nantz MH, Kurth MJ (Sulfamoyl-4oxoquinoline-3-carboxamides: Novel potentiators of defective [Delta]F508-cystic
fibrosis
transmembrane
conductance
regulator
chloride
channel
gating.
Bioorganic & Medicinal Chemistry Letters 16:537-540.2006).
Sun F, Hug MJ, Bradbury NA, Frizzell RA (Protein Kinase A Associates with Cystic
Fibrosis Transmembrane Conductance Regulator via an Interaction with Ezrin.
Journal of Biological Chemistry 275:14360-14366.2000a).
Sun F, Hug MJ, Lewarchik CM, Yun C-HC, Bradbury NA, Frizzell RA (E3KARP
Mediates the Association of Ezrin and Protein Kinase A with the Cystic Fibrosis
Transmembrane Conductance Regulator in Airway Cells. Journal of Biological
Chemistry 275:29539-29546.2000b).
Swiatecka-Urban A, Brown A, Moreau-Marquis S, Renuka J, Coutermarsh B, Barnaby R,
Karlson KH, Flotte TR, Fukuda M, Langford GM, Stanton BA (The Short Apical
Membrane Half-life of Rescued ΔF508-Cystic Fibrosis Transmembrane
Conductance Regulator (CFTR) Results from Accelerated Endocytosis of ΔF508CFTR in Polarized Human Airway Epithelial Cells. Journal of Biological
Chemistry 280:36762-36772.2005).
97
Swiatecka-Urban A, Duhaime M, Coutermarsh B, Karlson KH, Collawn J, Milewski M,
Cutting GR, Guggino WB, Langford G, Stanton BA (PDZ Domain Interaction
Controls the Endocytic Recycling of the Cystic Fibrosis Transmembrane
Conductance Regulator. Journal of Biological Chemistry 277:40099-40105.2002).
Tabor S, Richardson CC (DNA sequence analysis with a modified bacteriophage T7
DNA polymerase. Proc Natl Acad Sci U S A 84:4767-4771.1987).
Tector M, Hartl FU (An unstable transmembrane segment in the cystic fibrosis
transmembrane conductance regulator. Embo J 18:6290-6298.1999).
Thiemann A, Grunder S, Pusch M, Jentsch TJ (A chloride channel widely expressed in
epithelial and non-epithelial cells. Nature 356:57-60.1992).
Trowbridge IS, Collawn JF, Hopkins CR (SIGNAL-DEPENDENT MEMBRANEPROTEIN TRAFFICKING IN THE ENDOCYTIC PATHWAY. Annu Rev Cell
Biol 9:129-161.1993).
Van Goor F, Straley KS, Cao D, Gonzalez J, Hadida S, Hazlewood A, Joubran J, Knapp
T, Makings LR, Miller M, Neuberger T, Olson E, Panchenko V, Rader J, Singh A,
Stack JH, Tung R, Grootenhuis PDJ, Negulescu P (Rescue of {Delta}F508-CFTR
trafficking and gating in human cystic fibrosis airway primary cultures by small
molecules. Am J Physiol Lung Cell Mol Physiol 290:L1117-1130.2006).
Wang S, Raab RW, Schatz PJ, Guggino WB, Li M (Peptide binding consensus of the
NHE-RF-PDZ1 domain matches the C-terminal sequence of cystic fibrosis
transmembrane conductance regulator (CFTR). FEBS Letters 427:103-108.1998).
Wang Y, Loo TW, Bartlett MC, Clarke DM (Correctors Promote Maturation of Cystic
Fibrosis Transmembrane Conductance Regulator (CFTR)-processing Mutants by
Binding to the Protein. Journal of Biological Chemistry 282:33247-33251.2007a).
Wang Y, Loo TW, Bartlett MC, Clarke DM (Modulating the Folding of P-Glycoprotein
and Cystic Fibrosis Transmembrane Conductance Regulator Truncation Mutants
with Pharmacological Chaperones. Molecular Pharmacology 71:751-758.2007b).
Ward CL, Kopito RR (Intracellular turnover of cystic fibrosis transmembrane
conductance regulator. Inefficient processing and rapid degradation of wild-type
and mutant proteins. Journal of Biological Chemistry 269:25710-25718.1994).
Ward CL, Omura S, Kopito RR (DEGRADATION OF CFTR BY THE UBIQUITINPROTEASOME PATHWAY. Cell 83:121-127.1995).
98
Webster P, Vanacore L, Nairn AC, Marino CR (Subcellular localization of CFTR to
endosomes in a ductal epithelium. Am J Physiol Cell Physiol 267:C340348.1994).
Weisz OA, Wang J-M, Edinger RS, Johnson JP (Non-coordinate Regulation of
Endogenous Epithelial Sodium Channel (ENaC) Subunit Expression at the Apical
Membrane of A6 Cells in Response to Various Transporting Conditions. Journal
of Biological Chemistry 275:39886-39893.2000).
Weixel KM, Bradbury NA (μ2 Binding Directs the Cystic Fibrosis Transmembrane
Conductance Regulator to the Clathrin-mediated Endocytic Pathway. Journal of
Biological Chemistry 276:46251-46259.2001).
Wu X, Wakefield JK, Liu H, Xiao H, Kralovics R, Prchal JT, Kappes JC (Development
of a novel trans-lentiviral vector that affords predictable safety. Mol Ther 2:4755.2000).
Yang H, Shelat AA, Guy RK, Gopinath VS, Ma T, Du K, Lukacs GL, Taddei A, Folli C,
Pedemonte N, Galietta LJV, Verkman AS (Nanomolar Affinity Small Molecule
Correctors of Defective ΔF508-CFTR Chloride Channel Gating. Journal of
Biological Chemistry 278:35079-35085.2003).
Yoshimura A, Longmore G, Lodish HF (Point mutation in the exoplasmic domain of the
erythropoietin receptor resulting in hormone-independent activation and
tumorigenicity. Nature 348:647-649.1990).
Younger JM, Chen L, Ren H-Y, Rosser MFN, Turnbull EL, Fan C-Y, Patterson C, Cyr
DM (Sequential Quality-Control Checkpoints Triage Misfolded Cystic Fibrosis
Transmembrane Conductance Regulator. Cell 126:571-582.2006).
Zaliauskiene L, Kang S, Brouillette CG, Lebowitz J, Arani RB, Collawn JF (DownRegulation of Cell Surface Receptors Is Modulated by Polar Residues within the
Transmembrane Domain. Mol Biol Cell 11:2643-2655.2000).
Zhang X-M, Wang X-T, Yue H, Leung SW, Thibodeau PH, Thomas PJ, Guggino SE
(Organic Solutes Rescue the Functional Defect in ΔF508 Cystic Fibrosis
Transmembrane Conductance Regulator. Journal of Biological Chemistry
278:51232-51242.2003).
Zielenski J, Tsui LC (Cystic fibrosis: genotypic and phenotypic variations. Annu Rev
Genet 29:777-807.1995).
99