Pierre MADL Div. of Material Sciences Dep

Transcription

The Ghost in our Genes - From the Past via the Present to the Future
12-06-13
Madl
0
Pierre MADL
Div. of Material Sciences
Dep. Physics & Biophysics
University of Salzburg
Hellbrunnerstr. 34
A-5020 Salzburg
[email protected]
http://biophysics.sbg.ac.at/home.htm
0
Basics
Genetics
Epi-
Memory
Organism
Intro (1/1)
Menu (Structural Levels):
About myself:
• Genetics – a definition,
a brief historical Overview
• Properties of DNA
Genetic code, Chromosomes,
• Cell: Replication, Transcription,
Mitosis, Meiosis;
• Organism: Mendelian Genetics,
Mutagenicity,
• Population: Epigenetics
• electronics engineer
• MSc in ecology
• PhD student
• part time service technician
Dep. of Physics & Biophysics,
Faculty of Natural Sciences
12-06-13
Madl
1
1
Basics
Genetics
Epi-
Memory
Organism
The Basics
12-06-13
Madl
2
2
Basics
Genetics
Epi-
Memory
Organism
History (1/10)
Evolution – The precursors:
• from 1815-1822 Jean Baptiste Lamarck
(1744-1829) published his “Histoire
naturelle des animaux sans vertèbres” (in
seven volumes)
•
12-06-13
Madl
3
Lamarckism or Lamarckian evolution refers to the once widely accepted idea
that an organism can pass on characteristics that it acquired during its lifetime to
its offspring (also known as based on heritability of acquired characteristics or
"soft inheritance"). It is named for the French biologist Jean-Baptiste Lamarck,
who incorporated the action of soft inheritance into his evolutionary theories and
is often incorrectly cited as the founder of soft inheritance.
It proposed that individual efforts during the lifetime of the organisms were the
main mechanism driving species to adaptation, as they supposedly would acquire
adaptive changes and pass them on to offspring. After publication of Charles
Darwin's theory of natural selection, the importance of individual efforts in the
generation of adaptation was considerably diminished. Later, Mendelian genetics
supplanted the notion of inheritance of acquired traits, eventually leading to the
development of the modern evolutionary synthesis, and the general abandonment
of the Lamarckian theory of evolution in biology. In a wider context, soft
inheritance is of use when examining the evolution of cultures and ideas, and is
related to the theory of Memetics. While enormously popular during the early
19th century as an explanation for the complexity observed in living systems, the
relevance of soft inheritance within the scientific community dwindled following
the theories of August Weismann and the formation of the modern evolutionary
synthesis.
Source: Vetsigian K. Woese C. Goldenfeld N., 2006; Collective evolution and the genetic code
PNAS Vol. 103 no. 28
3
Basics
Genetics
Epi-
Memory
Organism
History (2/10)
Evolution – The precursors:
seven volumes)
• in 1859 Charles Darwin (1809-1882)
published “The Origin of Species”
•
12-06-13
Madl
4
Vererbung erworbener Eigenschaften: Eine Vererbung von erworbenen
Eigenschaften haben jedoch bereits Jean-Baptiste Lamarck und Charles Darwin
erwogen. Darwin spekulierte, dass das Gehirn als Antwort auf Umwelteinflüsse
undefinierte Moleküle, sogenannte «Gemmulae», ausschütten könne, welche
durch den Körper wanderten und imstande wären, in den Geschlechtszellen
vererbbare Veränderungen vorzunehmen. Mit der Entdeckung der Gene wurde
die Vererbung erworbener Eigenschaften in der modernen Genetik jedoch erst
einmal ausgeklammert. Vielleicht erlebt sie nun im wachsenden Feld der
Epigenetik bald ein Comeback. Sollte dies geschehen, könnte es das Verständnis
der Tragweite von Eltern-Kind-Beziehungen radikal verändern.
Neo-Darwinism: …. The problem with this underemphasis on the environment is
that it led to an overemphasis on "nature" in the form of genetic determinism the belief that genes "control" biology …. When you are convinced that genes
control your life and you know that you had no say in which genes you were
saddled with at conception, you have a good excuse to consider yourself a victim
of heredity …. The world is filled with people who live in constant fear that, ….
they wait for cancer to explode in their lives as it exploded in the life of their
mother or brother or sister or aunt or uncle. Millions of others attribute their
failing health not to a combination of mental, physical, emotional and spiritual
causes, but simply to the inadequacies of their body's biochemical mechanics ….
Source: Lipton B. (2005) Biology of Belief, Elite Books, p.50
4
Basics
Genetics
Epi-
Memory
Organism
History (3/10)
Evolution & Genetics:
seven volumes)
• in 1859 Charles Darwin (1809-1882)
published “The Origin of Species”
• in 1889 Friedrich Leopold August
Weismann (1834-1914) in his “Essays
Upon Heredity” proved Lamarck wrong
12-06-13
Madl
5
Weismann barrier: Cutting off rat tails – a German developmental biologist,
August Weismann, …. tried to test Lamarck’s theory …. He cut off the tails of
male and female mice and mated them …. Weismann repeated the experiment for
21 more generations, but not one tail-less mouse was born, leading Weismann to
conclude that Lamarck's notion of inheritance was wrong. But Weismann’s
experiment was not a true test of Lamarck’s theory. Lamarck suggested that
such evolutionary changes could take "immense periods of time" …. Weismann's
five-year experiment was clearly not long enough to test the theory ….
The idea that germline cells contain information that passes to each generation
unaffected by experience and independent of the somatic (body) cells, came to be
referred to as the Weismann barrier, and is frequently quoted as putting a
temporary end to the theory of Lamarck and the inheritance of acquired
characteristics. While Weisman based the idea on his limited knowledge of cells
and his (largely wrong) theory of Germ Plasm, he is also widely quoted as having
'proved' the non-existence of Lamarckian inheritance by the experiment of
chopping of the tails of fifteen hundred rats, repeatedly over 20 generations, and
reporting that no rat was ever born in consequence without a tail. In fact he states
that '901 young were produced by five generations of artificially mutilated
parents and yet there was not a single example of a rudimentary tail or any other
abnormality of the organ’.7
Source: Lipton B. (2005) Biology of Belief, Elite Books, p.42
http://en.wikipedia.org/wiki/Weismann,_August
http://www.esp.org/books/weismann/essays/facsimile/
5
Basics
Genetics
Epi-
Memory
Organism
History (4/10)
Genetics - an Overview:
• in 1865 Gregor Mendel (1822-1884)
discovers the basics of inheritance
•
12-06-13
Madl
6
Discovery of the basic mechanism of inheritance in 1865 by G.Mendel:
• Genes as particles of inheritance
• Patterns of inheritance
• Genes come from both parents
• Forms of dominant genes (allele)
6
Basics
Genetics
Epi-
Memory
Organism
History (5/10)
• in 1888 H.W. Waldeyer (1836-1921)
observes the chromosomes
•
12-06-13
Madl
7
im Jahr 1888 beobachtet Heinrich Wilhelm Waldeyer die Chromosomen
7
Basics
Genetics
Epi-
Memory
Organism
History (6/10)
• in 1888 H.W. Waldeyer (1836-1921)
• in 1909 William Bateson (1861-1926)
coined the term genetics
•
12-06-13
Madl
8
im Jahr 1909 fuerht William Bateson den Begriff der Genetik ein
His credo: Whether geneticists study at the molecular, cellular, organismal,
familial, population, or evolutionary level, genes are always central to their
studies.
8
Basics
Genetics
Epi-
Memory
Organism
History (7/10)
• in 1888 H.W. Waldeyer (1836-1921)
• in 1940 C.H. Waddington (1905–1975)
coins the term epigenetics
•
12-06-13
Madl
9
In the year 1940, Conrad Hal Waddington coins the term epigenetics
9
Basics
Genetics
Epi-
Memory
Organism
History (8/10)
• in 1888 H.W. Waldeyer (1836-1921)
• in 1940 C.H. Waddington (1905–1975)
• in 1953 J.Watson & F.Crick
uncover the structure of DNA
•
12-06-13
Madl
10
im Jahr 1953 wird die Struktur der DNA von James Watson & Francis Crick
erkannt;
They postulate the Central Dogma: Information flow is from DNA to RNA via
the process of transcription, and hence to protein via translation. Transcription is
the making of an RNA molecule off a DNA template. Translation is the
construction of an amino acid sequence (polypeptide) from an RNA molecule.
Although originally called dogma, this idea has been tested repeatedly with
almost no exceptions to the rule being found (save retroviruses).
Source:http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookPROTSYn.html
10
Basics
Genetics
Epi-
Memory
Organism
History (9/19)
• in 1888 H.W. Waldeyer (1836-1921)
• in 1940 C.H. Waddington (1905–1975)
• in 1953 J.Watson & F.Crick
uncover the structure of DNA
• 2000 HGP uncovers the human genone
12-06-13
Madl
11
im Jahr 2000 wird die Entschluesselung des menschlichen genomes (human
genome project) veroeffentlicht;
i) 5 Jahre hat das HUGO gebraucht um dies zu schaffen
i) kostete U$ 6·E9
i) zeitgleich arbeiteten daran die privaten Unternehmer Francis Collins (religioes
motivier, Sprache Gottes) & Craig Venter (pragmatischer Geschaeftsmann –
meint es sei der grösster Erfolg seit der Mondlandung)
i) 2008 erstellung eines humanen genomsatzes um ca U$ 1·E3 innerhalb 3 tagen
The Human Genome Project … ‘provided the blueprint for life, but the
epigenome will tell us how this whole thing gets executed’.
Source: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=300691
11
Basics
Genetics
Epi-
Memory
Organism
History (10/10)
HUGO aimed at finding genes for:
• addiction
• aggression
• anxiety
• depression
• homosexuality
• obesity, etc.
…. looked at DNA only, thus missed the
associated proteins (nucleus contains
approx. 50% DNA & 50% proteins)
12-06-13
Madl
12
Were You Born That Way? - The Nature vs. Nurture Controversy
by George Howe Colt (Life Mag, 04,1998)
It's not just brown eyes. your inheritance could also include insomnia, obesity and
optimism. yet scientists are saying that genes are not--quite--destiny
Source:
http://www.originallifemagazines.com/LIFE-Magazine-April-1998-P2079C534.aspx
12
Basics
Genetics
Epi-
Memory
Organism
Definition (2/3)
Genetics - a fragmented science:
• Genomics
• Epi-Genomics
• Transcriptomics
• Proteomics
• Metabolomics
12-06-13
Madl
13
Genetics - a fragmented science:
•
Genomics is the study of the genomes of organisms. The field includes intensive efforts to determine the entire DNA
sequence of organisms and fine-scale genetic mapping efforts. It focuses on genes at the molecular, cellular,
organismal, familial, population, or evolutionary level.
•
EpiGenomics: A field that refers to heritable changes in phenotype (appearance) or gene expression caused by
mechanisms other than changes in the underlying DNA sequence (hence the name epi - "in addition to”, “on top of” genetics). These changes may remain through cell divisions for the remainder of the cell's life and may also last for
multiple generations. However, there is no change in the underlying DNA sequence of the organism. instead, nongenetic factors cause the organism's genes to behave (or "express themselves") differently. The best example of
epigenetic changes in eukaryotic biology is the process of cellular differentiation. During morphogenesis, totipotent
stem cells become the various pluripotent cell lines of the embryo which in turn become fully differentiated cells. In
other words, a single fertilized egg cell - the zygote - changes into the many cell types including neurons, muscle cells,
epithelium, blood vessels et cetera as it continues to divide. It does so by activating some genes while inhibiting
others.
•
Transcriptomics is the study of the transcriptome – i.e. the set of all messenger RNA (mRNA) molecules, or
"transcripts," produced in one or a population of cells. The term can be applied to the total set of transcripts in a given
organism, or to the specific subset of transcripts present in a particular cell type. Unlike the genome, which is roughly
fixed for a given cell line (excluding mutations), the transcriptome can vary with external environmental conditions.
•
Proteomics is the large-scale study of proteins, particularly their structures and functions. The proteome is the entire
complement of proteins, including the modifications made to a particular set of proteins, produced by an organism or
system. This will vary with time and distinct requirements, or stresses, that a cell or organism undergoes. The need to
look directly at the Proteins that are made. Fragments can be identified by reference to the genome, if known,
prediction. But needs powerful computers! BIOINFORMATICS
•
Metabolomics is the study of metabolism, i.e. the set of chemical reactions that occur in living organisms in order to
maintain life. These processes allow organisms to grow and reproduce, maintain their structures, and respond to their
environments. Metabolism is usually divided into two categories.
i) Catabolism breaks down organic matter, for example to harvest energy in cellular respiration.
i) Anabolism, on the other hand, uses energy to construct components of cells such as proteins and nucleic acids.
p.xxi: schauen sie sich doch mal die landschaft an. Wenn heute jemand irgendwo
als fysiker arbeitet, dann hat er ein spezielles gebiet .... Jeder hat so ein
spezialgebiet und 99% der kollegen wären gar nicht in der lage die ganze
problematik zu erfassen die ja von interdisziplinärer natur ist .... Man darf
gar keine fachdisziplin in den vordergund stellen, sondern muss die
fragestellung in den vordergrund rücken (see D.Suzuki speaking in front of
the Aussie museum society) ....
Poop F.A. (2002). Die Botschaft der Nahrung, Zweitausendeins Verlag,
FRA.a.Main - FRG
13
Basics
Genetics
Epi-
Memory
Organism
Definition (3/3)
EpiGenetics - A definition:
(epi-, Gk. - “outside” or “above” the gene)
• …. The study of changes in gene expression
• .… the study of phenotypic variation
w/o changing the genotype
• …. the spatio-temporal variations during growth
• …. the study of heritable changes in gene function;
due to the environment – historicity of organism!
e.g. how stressors influence offsprings
Conrad Hal Waddington (1905–1975)
coined the term “epigenetics” in 1940
12-06-13
Madl
14
Conrad Waddington (1905-1975) is often credited with coining the term epigenetics in 1942 as
“the branch of biology which studies the causal interactions between genes and their products,
which bring the phenotype into being”. Epigenetics appears in the literature as far back as the mid
19th century, although the conceptual origins date back to Aristotle (384-322 BC). He believed in
epigenesis: the development of individual organic form from the unformed. This controversial
view was the main argument against our having developed from miniscule fully-formed bodies.
Even today the extent to which we are preprogrammed versus environmentally shaped awaits
universal consensus. The field of epigenetics has emerged to bridge the gap between nature and
nurture. In the 21st century you will most commonly find epigenetics defined as ‘the study of
heritable changes in genome function that occur without a change in DNA sequence‘. But what
do the scientists that work in this rapidly expanding research field have to say?
What is epigenetics?
i) epigenetics refers to changes in gene expression that are stable between cell divisions, and
sometimes between generations ...
i) processes involved in the genetic development of an organism, especially the activation and
deactivation of genes ….
i) heritable changes in gene function that occur without a change in the DNA sequence ….
i) a factor that changes the phenotype without changing the genotype ….
i) the study of inherited characteristics that lie outside of the genome in organisms (from the word
epi-, meaning “outside” or “above”) ….
i) relating to the appearance of new genetic phenomena not present at previous stages of
development ….
i) explaining the interactions of genes with their environment that bring the phenotype into being
Source: http://www.metafilter.com/48343/Epigenetics
http://www.google.com/search?hl=en&defl=en&q=define:Epigenetics&ei=rGm5Sd_EAYOB_ga
pxciHBg&sa=X&oi=glossary_definition&ct=title
http://www.trwnews.net/Documents/Dioxin/Epigenetics%20-%20media%20coverage.htm
14
Basics
Genetics
Epi-
Memory
Organism
Epigenetics (1/4)
So what is EpiGenetics?
“Epigenetics has always been all the weird and
wonderful things that can’t be explained by
genetics” …. Denise Barlow (Vienna, Austria)
http://epigenome.eu/en/1,1,0
12-06-13
Madl
15
It seemed …. that any "epigenetic" changes …. could be mutable during the life
of the organism, before it generates offspring. This is what 'epigenetic' means, as
distinct from 'genetic'.
Phenotype: Epigenetic variation may explain such long-running mysteries as why
identical twins are, in many ways, no such thing, including whether they have
such supposedly genetic diseases as schizophrenia and cancer.
Spatial-temporal variation: Epigenetics may also help explain how the seeds of
many adult diseases may be planted during fetal life. Studies suggest that the
nutrition a fetus receives -- as indicated by birth weight -- might influence the
risk of adult-onset diabetes, heart disease, hypertension and some cancers. The
basis for such "fetal programming" has been largely an enigma, but epigenetics
may be key.
Source: http://epigenome.eu/en/1,1,0
15
Basics
Genetics
Epi-
Memory
Organism
Epigenetics (2/4)
“Genetics vs. Epigenetics is comparable …. to the
difference between writing and reading a book. Once a
book is written, the text (DNA) will be the same in all
the copies distributed. However, each individual reader
of a given book may interpret the story slightly
differently, with varying emotions and projections ….
In a very similar manner, epigenetics would allow
different interpretations of a fixed template (DNA) and
result in different read-outs, dependent upon the
variable conditions under which this template is
interrogated” …. Thomas Jenuwein (Vienna, Austria)
http://epigenome.eu/en/1,1,0
12-06-13
Madl
16
“The difference between genetics and epigenetics can probably be compared to
the difference between writing and reading a book. Once a book is written, the
text (the genes or DNA: stored information) will be the same in all the copies
distributed to the interested audience. However, each individual reader of a given
book may interpret the story slightly differently, with varying emotions and
projections as they continue to unfold the chapters. In a very similar manner,
epigenetics would allow different interpretations of a fixed template (the book or
genetic code) and result in different read-outs, dependent upon the variable
conditions under which this template is interrogated.” Thomas Jenuwein (Vienna,
Austria)
Source: http://epigenome.eu/en/1,1,0
16
Basics
Genetics
Epi-
Memory
Organism
Epigenetics (3/4)
“Genes are only puppets. Assorted proteins and RNAs
pull the strings, telling the genes when and where to
turn on or off”.
Pennisi, 2001, Science
12-06-13
Madl
17
Source: Pennisi E. (2001) Behind the scenes of gene expression. Science 293: 1064-1067
17
Basics
Genetics
Epi-
Memory
Organism
Epigenetics (4/4)
Obviously ….
…. “The Genome is much more complex than the
sum of the single parts”
• if not the DNA itself, who then controls gene
activity?
• Waddington’s hypothesis pushed open the door to
Quantum Biology
Slack, 2002 (adapted from Waddington)
12-06-13
Madl
18
Waddington’s epigenetic landscape is a metaphor for a dynamical system, one in which the axes
represent concentrations of all the substances, or all the gene products, in the cell. All the cells in
the embryo would evolve according to the same laws, but because of the existence of inducing
signals, cells in different regions would follow different pathways (‘chreodes’) and end up at
different attractors, which can be elegantly associated with different states of terminal
differentiation.
In certain simple physical systems, it is possible to predict the evolution of the system by
computing the potential energy that is associated with it. In such cases, the system will evolve
spontaneously to a local minimum of potential energy. René Thom in his ‘catastrophe theory’
proposed that it would be possible to compute a generalized ‘potential surface’for any dynamical
system. As these surfaces can be somewhat folded, movement ‘down’ the surface can lead to
discontinuous changes in one or more of the system variables. This is a so-called ‘catastrophe’,
representing an abrupt, discontinuous change in a system that is governed by smooth continuous
dynamics.
Epigenetics: reversible heritable changes in gene function occur without a change in the sequence
of nuclear DNA. Differentiating tissues/organs are inherently organized; such organization
emerges from within the “epigenetic landscape” rather than from without. Complex networks of
biological signalling pathways can arise from the interactions between simple pathways under
local control. These networks exhibit emergent properties: there is integration of signals across
multiple time scales; the generation of distinct outputs depend on input strength and duration;
there are self-sustaining feedback loops.
Image:
top: "The path followed by the ball, corresponds to the developmental history of a particular
organ.
bottom: Interacting network of signal transduction pathways. "The pegs in the ground represent
genes; the strings leading from them represent the pathways initiated by gene expression. The
slope of the epigenetic landscape is controlled by the pull of these numerous pathways which are
ultimately anchored to the genes."
Source: Waddington, C. H. Organisers and Genes (Cambridge Univ. Press, UK, 1940).
Slack J.M.W. Conrad Hal Waddington: the last Renaissance biologist? Nature Reviews
Genetics; Vol.3, Nov.2002: 889-895;Reviews Genetics 3, 889-895.
18
Basics
Genetics
Epi-
Memory
Organism
The “Nuclear” Level
12-06-13
Madl
19
19
Basics
Genetics
Epi-
Memory
Organism
Central Dogma (1/8)
Protein
Synthesis:
• DNA
↓ (transcription)
• RNA
↓ (translation)
• Proteins
rooted on the belief that ....
…. life is controlled by genes
12-06-13
Madl
20
…. the belief that life is controlled by genes …. Science mag: “macromolecular
ballet” in nuclear dynamics – introduction …. Statement: For higher organisms
the nucleus is the command center of the cell”
Source: Postlethwait J.H. & Hopspn J.L. 1995. The Nature of Life, 3rd ed. MacGraw-Hill.
Lipton B. 2005. Biology of Belief. Elite Books. p.16
http://www.sciencemag.org/content/288/5470/1369.full
20
Basics
Genetics
Epi-
Memory
Organism
Central Dogma (2/8)
Protein
Synthesis:
• DNA
↓ (transcription)
• RNA
↓ (translation)
• Proteins
…. a photocopy
Purves et al., 2006
12-06-13
Madl
21
Central dogma: a photocopy of the “recipe book” (genetic code)
• Information flow is from DNA to RNA via the process of transcription, and
hence to protein via translation.
• Transcription is the making of an RNA molecule off a DNA template.
Translation is the construction of an amino acid sequence (polypeptide) from an
RNA molecule.
• Although originally called dogma, this idea has been tested repeatedly with
almost no exceptions to the rule being found (however .... see retrovirus).
Source: http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookPROTSYn.html
Purves et al., Life: The Science of Biology, 4th Edition, by Sinauer Associates
(www.sinauer.com) and WH Freeman (www.whfreeman.com).
21
Basics
Genetics
Epi-
Memory
Organism
Central Dogma (3/8)
Protein
Synthesis:
• DNA
↓ (transcription)
• RNA
↓ (translation)
• Proteins
…. a photocopy
Posthletwait &
Hopkins, 1995
12-06-13
Madl
22
Protein Synthesis in a nut shell:
1. DNA replication, transcription and translation proceed rapidly in a hair
follicle.
2. In DNA replication DNA polymerase copies DNA strands using nucleotides
that diffuse in and form base pairs with the DNA.
3. In transcription, RNA polymerase copies a single strand of DNA into
messenger RNA (mRNA).
4. Newly made mRNA moves through a nuclear pore into the cell’s cytoplasm.
5. In translation, at ribosomes, bonds form between amino acids (AA) which are
alligned by tRNAs according to the nucleotide sequence in mRNA. The
joined AA-sequence form a polypeptide.
6. The main polypeptide synthesized in a hair follicle cell forms the protein
keratin which makes long fibers.
7. The fibers of keratin are about all that is left when the hair follicle cells die
and become the hair.
22
Basics
Genetics
Epi-
Memory
Organism
Central Dogma (4/8)
Reverse Transcriptase –
breaking
The Central Dogma :
• RNA dependent DNA
polymerase – transcribes
single stranded RNA
into single stranded
DNA;
• telomerase rTST
• viral rTST (e.g. HIV)
Viral RNA is transcribed into
DNA and inserted into the
DNA of the host cell.
Flexner, 2007
12-06-13
Madl
23
In biochemistry, a reverse transcriptase, also known as RNA-dependent DNA polymerase, is a
DNA polymerase enzyme that transcribes single-stranded RNA into single-stranded DNA.
Normal transcription involves the synthesis of RNA from DNA, hence reverse transcription is
the reverse of this. Reverse transcriptase was discovered by Howard Temin at the University of
Wisconsin-Madison, and independently by David Baltimore in 1970. The two shared the 1975
Nobel Prize in Physiology or Medicine with Renato Dulbecco for their discovery.
Commonly used examples of reverse transcriptases include:
• HIV-1 reverse transcriptase from the human immunodeficiency virus type 1 (PDB 1HMV).
Replication cycle of HIV with current and possible targets for antiviral intervention. Proteins that
are targets for approved drugs are coloured green: gp160, reverse transcriptase, HIVprotease and
chemokine (C-C motif) receptor 5 (CCR 5). Integrase (yellow) is a target in advanced clinical
development. Proteins that are more speculative drug targets are coloured red: chemokine (C-X-C
motif ) receptor 4 (CXCR 4), RNase H, tat, rev, nef and vif. Both the virus as well as the working
principles of RT are well understood by now; it clearly shows that the pronciples of the central
dogma can no longer be maintained as such.
• M-MLV reverse transcriptase from the Moloney murine leukemia virus.
• AMV reverse transcriptase from the avian myeloblastosis virus.
• Telomerase reverse transcriptase that maintains the telomeres of eukaryotic chromosomes
Conversion of the HIV RNA genome into DNA by viral reverse transcriptase (RT) is a key step
in the early stages of the HIV life cycle, making the enzyme an ideal target for antiretroviral
therapy. In the animation above, RT inhibitors are colored in orange. Two classes of reverse
transcriptase inhibitors are commercially available: nucleos(t)ide reverse transcriptase inhibitors
(NRTI's) and non-nucleoside reverse transcriptase inhibitors (NNRTI's). The NRTI's were the
first antiretrovirals to be made available for the treatment of HIV. Based on their similarity to the
natural nucleotide building blocks of DNA and RNA, NRTI's are incorporated into the growing
DNA strand and terminate further strand elongation. On the other hand, NNRTI's are a
chemically diverse class of drugs that bind to the same pocket near the active site of RT and as
such inhibit the enzyme.
Source: http://en.wikipedia.org/wiki/Reverse_Transcriptase
http://www.tibotec.com/bgdisplay.jhtml?itemname=HIV_discovery&product=none&s=2
Flexner C. 2007; HIV drug development: the next 25 years; Nature Reviews Drug Discovery;
23
Basics
Genetics
Epi-
Memory
Organism
Central Dogma (5/8)
Protein
Synthesis:
…. because
reverse transcription produces DNA from
RNA
…. however ….
• DNA
 (transcription)

• RNA
↓ (translation)
• Proteins
"a sequence of amino acids in a protein
can never act as a copying template for
the reverse flow of protein sequence
information into RNA.“
Steele et al. 1998
12-06-13
Madl
24
Does Steele's main scientific claim contradict the Central Dogma?
The so-called 'Central Dogma of molecular biology' (Francis Crick) seems to
forbid the inheritance of acquired characteristics:
DNA ---> RNA ---> protein
After the discovery of reverse transcription the Central Dogma, as it was known
in the textbooks, needed a little modification:
DNA <---> RNA ---> protein
because reverse transcription produces DNA from RNA. However: "a sequence
of amino acids in a protein can never act as a copying template for the
reverse flow of protein sequence information into RNA." (Steele, p 42).
Sourcce: Edward J. Steele, Robyn A. Lindley, Robert V. (1998) Lamarck's Signature. How
Retrogenes Are Changing Darwin's Natural Selection Paradig; BlandenPerseus Books
24
Basics
Genetics
Epi-
Memory
Organism
Central Dogma (6/8)
Protein
Synthesis:
Lipton, 2005
12-06-13
Madl
25
Does Steele's main scientific claim contradict the Central Dogma?
Genome studies reveal that we share about 95% of our DNA sequence with
chimpanzees. This confirms something we have known for years: We are not
solely the products of our genes, but of our genes interacting with each other and
with the environment. The outcome is a prodigiously complicated chemical
system that not only renders humans different from monkeys, but also makes
each human being (and probably each cell of each human being) unique. In
living cells, macromolecules, and especially proteins, exist in a myriad of forms.
But how many of these molecular variants are accidental products of RNA
splicing and posttranslational modification, and how many are genetically
designed and of evolutionary significance? (Bray, 2003)
How do you get that sleeve off? You need an environmental signal to spur the
"sleeve" protein to change shape, i.e. detach from the DNA’s double helix,
allowing the gene to be read. Once the DNA is uncovered, the cell makes a copy
of the exposed gene. As a result, the activity of the gene is "controlled" by the
presence or absence of the ensleeving proteins, which are in turn controlled by
environmental signals …. It is now clear that the Primacy of DNA chart
described earlier is outmoded. The revised scheme of information flow should
now be called the "Primacy of the Environment" …. (Lipton, 2005)
Source: Lipton B. (2005) Biology of Belief. Elite Books, p.68-69
Bray D. (2003) Molecular Prodigality. Science Vol. 299. no. 5610, pp. 1189 – 1190
Image: http://danbartlett.co.uk/lipton_epigenetics.htm
25
Intro
P&R
Self
Organismic
Implications
Central Dogma (7/8)
A spider‘s web ….
• is not the result of biochemical
signal transduction cascade of a
neuronal program ….
• is not even encoded in the genes
(“Genes are only puppets …. “
Pennisi, 2001)
• is nothing but the expression of a
“spider-like” world-perception !
12-06-13
Madl
26
When Whitehead calls actual occasions “drops of experience” great care must be taken not to be
mislead by his choice of language. Ordinarily we think of experience as something restricted to
living and sentient beings. Experience here refers to the way a sentient (responsive) being
receives the world. For Whitehead all entities are drops of experience. Whether we are speaking
of a rock, a subatomic particle, or a human being, these actual occasions are drops of experience.
Objectiles are drops of experience not for us, but for themselves. That is, just as a human being
might be said to be the sum of their experiences, a rock is the sum of its experiences. “…In the
becoming of an actual entity, the potential unity of many entities in disjunctive diversity…
acquires the real unity of the one actual entity; so that the actual entity is the real concrescence of
many potentials”
…. War früher die Interaktion eines Organismus mit seiner Umgebung eine Abfolge
deterministischer biochemischer Abläufe, die im Lebewesen durch die Perzeption eines externen
Stimulus ausgelöst werden, so wird nun dem organismischen Erfahrungsakt ein
selbstorganisierendes Potential zugeschrieben. Der Bau des Netzes einer Spinne wäre deshalb
nicht das Resultat eines mit Signalübertragungen gekoppelten neuronalen Programms, sondern
der Ausdruck einer spinnenhaften Welterfahrung, aus der sowohl das Netz, als auch die Form
einer Spinne in ihrem Stoffwechsel immer wieder von neuem hervorgeht.
…. our consciousness is delocalised throughout the liquid crystalline continuum of the body
(including the brain), rather than being just localized to our brain, or to our heart. By
consciousness, I include, at the minimum, the faculties of sentience (responsiveness),
intercommunication, as well as memory ….
Source: http://larvalsubjects.wordpress.com/2009/03/07/objectiles-and-actual-occasions/
Falkner & Falkner (2009); Die Bedeutung der Philosophie von Alfred North Whitehead für eine
neue Sichtweise in der Biologie
Ho M.W. (2003); The Rainbow and the Worm – The Physics of Organism – World Scientific –
Singapore, p.185
26
Basics
Genetics
Epi-
Memory
Organism
Central Dogma (8/8)
…. and the dead end of Neo-Darwinism
• is not the result mutation & selection
• …. This …. materialistic theory, is reduced to
the …. description of the changes of the
external relations b/w portions of matter.
There is nothing to evolve …. one set of
external relations is as good as any other set
of external relations …. modified after Whitehead, 1926
• neo-Darwinism is a regression, an
impoverishment of Darwin's own conceptions
…. Stewart , 2001:11
Nelsom, 1967
…. and the dead end of Neo-Darwinism
•
•
•
is not the result mutation & selection
…. This …. materialistic theory, is reduced to the …. description of the
changes of the external relations b/w portions of matter. There is nothing to
evolve …. one set of external relations is as good as any other set of external
relations …. modified after Whitehead, 1926
neo-Darwinism is a regression, an impoverishment of Darwin's own
conceptions …. Stewart , 2001:11
Source: Stewart J. (2001) Radical Constructivism in Biology and Cognitive Science. In
Foundations of Science, special issue on "The Impact of Radical Constructivism on Science",
edited by A.Riegler, vol. 6, no. 1–3: 99–124.
Basics
Genetics
Epi-
Memory
Organism
DNA (1/4)
The Genetic Code:
• DNA: double stranded macromolecule
arranged
in
chromosomes
(network
of
granules = nuclear chromatin).
• RNA: single stranded macromolecule, spherical, intranuclear
structure(s)
- nucleolus /
nucleoli.
12-06-13
Madl
28
Nucleus:
• Genetic material of both eukaryotes and prokaryotes is DNA (deoxy-ribonucleic acid). Many viruses also have DNA, but some have RNA (ribonucleic acid) genomes instead.
• DNA has two chains, each made of nucleotides composed of a deoxy-ribose
sugar, a phosphate group and a base. The chains form a double helix.
28
Basics
Genetics
Epi-
Memory
Organism
DNA (2/4)
The Genetic Code:
• Code: AGC/T (U in RNA)
• Backbone (Phosphate
Deoxy-Ribose chain)
12-06-13
Madl
29
Deoxyribose
• The base pairs are 0.34nm apart, and one full turn of the DNA helix takes
3.4nm, so there are 10 bp in a complete turn. The diameter of a dsDNA helix
is 2nm.
• Because of the way the bases H-bond with each other, the opposite sugarphosphate backbones are not equally spaced, resulting in a major and minor
groove. This feature of DNA structure is important for protein binding.
Genetic Code (sequence of AT & GC):
• Purines (double-ring, nine-membered structures) include adenine (A) and
guanine (G).
• The code corresponds to the structure of the DNA and regulates cell
functions by way of directing the synthesis of cell proteins;
• The code is transmitted to new cells during cell division;
• The coded messages are contained in the chromosomes;
29
Basics
Genetics
Epi-
Memory
Organism
DNA (3/4)
The Genetic Code:
• Deoxyribose
• Phosphate
• 4 Bases:
Adenine (Purine)
Guanine (Purine)
Cytosine (Pyrimidine)
Thymine (Pyrimidine)
Uracil (in RNA)
12-06-13
Madl
30
Genetic Code:
• A series of messages contained in the chromosomes;
• This code regulates cell functions by way of directing the synthesis of cell
proteins;
• The code corresponds to the structure of the DNA;
• The code is transmitted to new cells during cell division;
The basic unit is the nucleotide: it consists of a
• phosphate group
• deoxy-ribose sugar
There are two classes of nitrogenous bases:
a. Purines (double-ring, nine-membered structures) include adenine (A) and
guanine (G).
b. Pyrimidines (one-ring, six-membered structures) include cytosine (C),
thymine (T) in DNA and uracil (U) in RNA.
The sequence of bases determines the genetic information. Genes are specific
sequences of nucleotides that pass traits from parents to offspring.
30
Basics
Genetics
Epi-
Memory
Organism
DNA (4/4)
The Genetic Code:
• Base pairing
H-bonding
• Chargaff’s law
equal numbers of bases
A & T;
equal numbers of bases
G & C;
12-06-13
Madl
31
The bases of the two strands are held together by hydrogen bonds between
complementary bases (two for A-T pairs and three for G-C pairs). Individual Hbonds are relatively weak and so the strands can be separated (by heating, for
example). Complementary base pairing means that the sequence of one strand
dictates the sequence of the other strand.
Chargaff’s Law:
• 1st: In human DNA, for example, the four bases are present in these
percentages: A=30.9% and T=29.4%; G=19.9% and C=19.8%. This strongly
hinted towards the base pair makeup of the DNA, although Chargaff was not
able to make this connection himself.
• 2nd: is that the composition of DNA varies from one species to another, in
particular in the relative amounts of A, G, T, and C bases. Such evidence of
molecular diversity, which had been presumed absent from DNA, made
DNA a more credible candidate for the genetic material than protein.
31
Basics
Genetics
Epi-
Memory
Organism
D DN
N A
A iA
-m N
ol IM
ec
ul AT
e/ I
pa O
ck N
in
g
Chromosome (1/8)
Scaffolding:
• from DNA double helix to
• packed chromatin fiber to
• condensed chromosome
12-06-13
Madl
Protein:DNA
~
1:1 (!)
32
Eukaryotic chromosomes are linear dsDNA, and by weight contain about twice as much protein
as DNA (50% is protein) – in humans it is a 2m long thread of DNA packed into the nucleus.
The DNA-protein complex is called chromatin, and it is highly conserved in all eukaryotes.
1. Both histones and non-histones are involved in physical structure of the chromosome.
2. Histones are abundant, small proteins with a net (+) charge. The five main types are H1, H2A,
H2B, H3 and H4. By weight, chromosomes have equal amounts of DNA and histones.
3. Histones are highly conserved between species (H1 less than the others).
4. Non-histone is a general name for other proteins associated with DNA. This is a big group,
with some structural proteins, and some that bind only transiently. Non-histone proteins vary
widely, even in different cells from the same organism. Most have a net (-) charge, and bind
by attaching to histones. HMG (high mobility group) proteins are a well-studied example of
non-histone proteins.
5. Chromatin formation involves histones, and condenses the DNA so it will fit into the cell.
Chromatin formation has two components:
Two molecules each of histones H2A, H2B, H3 and H4 associate to form a nucleosome core, and
DNA wraps around it 1 3⁄4 times for a 7-fold condensation factor. Nucleosome cores are
about 11 nm in diameter.
H1 serves as the linker histone, connecting nucleosomes to create chromatin with a diameter of 30
nm, for an additional 6-fold condensation. The exact mechanism used by H1 is unknown.
6. Chromatin is arranged in looped domains of DNA similar to those formed in prokaryotic
chromosomes. Loops are anchored to the nuclear matrix at DNA sequences called MARs
(matrix attachment regions). An average human chromosome has about 2,000 looped
domains. Looped domains may be important in regulating transcription and replication.
32
Basics
Genetics
Epi-
Memory
Organism
Chromosome (2/8)
Chromosome:
• Chromatid
• Telomere
• Centromere
• Histone
Gene:
• strings
• imprinting
12-06-13
Madl
33
Eukaryotes have multiple linear chromosomes in a number characteristic of the
species. Most have two versions of each chromosome, and so are diploid (2N).
a. Diploid cells are produced by haploid (N) gametes that fuse to form a zygote.
The zygote then undergoes development, forming a new individual.
b. Examples of diploid organisms are humans (23 pairs) and Drosophila
melanogaster (4 pairs). The yeast Saccharomyces cerevisiae is haploid (16
chromosomes).
Chromosome: Genetic material in cells is organized into chromosomes (literally
“colored body” because it stains with biological dyes).
a. Prokaryotes generally have one circular chromosome.
b. Eukaryotes generally have:
i. Linear chromosomes in their nuclei, with different species having different
numbers of chromosomes.
ii. DNA in organelles (e.g., mitochondria and chloroplasts) that is usually a
circular molecule.
Chromatid: Paired chromosomes, before mitosis, the DNA chains duplicate to
form new chromosome material. The duplicated chromosomes lie side by side =
chromatid. During Mitosis = the process by which chromatids separate into
chromosomes.
Genes occur in pairs on homologous chromosomes, one from each parent;
Different effects of gene whether ♀ or ♂;
Genes modified during gametogenesis;
Gene imprinting: additional methyl groups added to DNA molecules;
Basic structure identical; in some diseases different expression (behavior)
depending on parent of origin - hereditary disease as a result of imprinting;
33
Basics
Genetics
Epi-
Memory
Organism
Chromosome (3/8)
From a
multiresolution
view ….
Ch.No.4
186·E6 bp
HGP @ UCSC, 2004
12-06-13
Madl
34
First looked through a microscope. Later Fluorescence In Situ Hybridization produces
chromosome bands. Genetic map grew to 5000 markers (places where distinctive variation
occurs, like those used in DNA fingerprinting).
The image shows Ch.No 4, with about 186 million bases. Order of the markers determined by
studying family inheritance of variations. Studies also led to the identification of genes
associated with some diseases:
• Huntington’s disease (HD), is a rare inherited neurological disorder affecting up to
approximately 10 people per 100,000 people of Western European descent and 0.1 out of
100,000 in people of Asian and African descent. HD is caused by a trinucleotide repeat
expansion in the Huntington (Htt) gene and is one of several polyglutamine (or PolyQ)
diseases. This expansion produces an altered form of the Htt protein, mutant Huntington
(mHtt), which results in neuronal cell death in select areas of the brain. Huntington's disease
is a terminal illness. HD’s most obvious symptoms are abnormal body movements called
chorea and a lack of coordination, but it also affects a number of mental abilities and some
aspects of personality. These physical symptoms occur in a large range of ages,with a mean
occurrence a person's late forties/early fifties. If the age of onset is below 20 years then it is
known as juvenile HD. As there is currently no proven cure, symptoms are managed with
various medications and care methods. Age at onset in Huntington's disease (HD) is variable
and is influenced by parental sex, paternal age, and genetic background .... We show here
that methylation at D4S95, a locus tightly linked to the HD gene, is highly variable …. Older
persons tend to have lower levels of methylation at this locus. This observation is of interest
with regard to studies that show an effect of paternal age, or more generally of 'ageing
genes', on age at onset in HD (Reik et al.)
Source: W Reik, E R Maher, P J Morrison, A E Harding, and S A Simpson (1993) Age at onset
in Huntington's disease and methylation at D4S95. J Med Genet. 1993 March; 30(3): 185–
188.
http://www.ncbi.nlm.nih.gov/projects/mapview/maps.cgi?TAXID=9606&CHR=4&MAPS=ge
nes-r%2Cpheno%2Cmorbid%2Cgenec&QUERY=HD&BEG=&END=4p16.3&thmb=on
http://en.wikipedia.org/wiki/Chromosome_4
34
Basics
Genetics
Epi-
Memory
Organism
Chromosome (4/8)
…. to a
gene
level
cluster ….
HGP @ UCSC, 2004
12-06-13
Madl
35
HD = Huntington’s disease gene. First success of RFLP (restriction fragment
length polymorphism) mapping. Found linkage in 1983 before the first RFLP
map was even constructed. Disease claimed Woody Guthrie. Nancy Wexler,
whose mother had died of the disease, became director of the Huntington’s
commission (congressional) and of NIH project. Collected family data in
Venezuela. “Lucky Jim” Gusella found a link between HD and one of the first
RFLP markers he tested. Took another 10 years to actually locate the gene. Takes
seconds on the browser.
Source: Human Genome Project @ Phoenix Eagleshadow, UC Santa Cruz (2004)
35
Basics
Genetics
Epi-
Memory
Organism
Chromosome (5/8)
…. to the
single
gene
level ….
HGP @ UCSC, 2004
12-06-13
Madl
36
`
36
Basics
Genetics
Epi-
Memory
Organism
Chromosome (6/8)
…. to the
single
exon
level ….
HGP @ UCSC, 2004
12-06-13
Madl
37
`
37
Basics
Genetics
Epi-
Memory
Organism
Chromosome (7/8)
…. to the
base-pair
level ….
HGP @
UCSC, 2004
12-06-13
caggcggactcagtggatctggccagctgtgacttgacaag
caggcggactcagtggatctagccagctgtgacttgacaag
Madl
38
A gene is the basic unit of heredity in a living organism. All living things depend
on genes. Genes hold the information to build and maintain their cells and pass
genetic traits to offspring. In general terms, a gene is a segment of nucleic acid
that, taken as a whole, specifies a trait. The colloquial usage of the term gene
often refers to the scientific concept of an allele.
In technical terms, a gene is a locatable region of genomic sequence,
corresponding to a unit of inheritance, and is associated with regulatory regions,
transcribed regions and/or other functional sequence regions.1,2 The physical
development and phenotype of organisms can be thought of as a product of genes
interacting with each other and with the environment.3
Source: http://en.wikipedia.org/wiki/Gene
1. Pearson H (2006). "Genetics: what is a gene?". Nature 441 (7092): 398–401.
2. Elizabeth Pennisi (2007). "DNA Study Forces Rethink of What It Means to Be a Gene".
Science 316 (5831): 1556–1557.
3. Nowak, Martin (October 2006), Evolutionary Dynamics: Exploring the Equations of Life,
Belknap Press; p.171M.A. Nowak, R.M. May and R.M. Anderson (1990). "The evolutionary
dynamics of HIV-1 quasispecies and the development of immunodeficiency disease". AIDS 4
(11): 95–103.
38
Basics
Genetics
Epi-
Memory
Organism
Chromosome (8/8)
Human Genome (HG):
Karyotype (22 + 1)
• 22 chromosomes
• plus sex chromosome
X chromosome
Y chromosome
Postlethwait & Hospon, 1995
12-06-13
Madl
39
karyotype shows the complete set of chromosomes in a cell (diploid). Metaphase
chromosomes are used because they are easiest to see under the microscope after
staining. The karyotype is species-specific.
a. The karyotype for a normal human male has 22 pairs of autosomes, and 1 each
of X and Y; one sex has a matched pair (e.g., human females with XX) and the
other has an unmatched pair (human male with XY). female (22+XX), male
(22+XY), altogether 23 chromosome-pairs for a human being;
b. Human chromosomes are numbered from largest (1) to smallest (although 21 is
actually smaller than 22).
c. Human chromosomes with similar morphologies are grouped (A through G).
d. Staining produces bands on the chromosomes, allowing easier identification. G
banding is an example.
i. Chromosomes are partially digested with proteolytic enzymes or treated with
mild heat, and then stained with Giemsa stain. The dark bands produced are G
bands.
ii. In humans, metaphase chromosomes show about 300 G bands, while about
2,000 can be distinguished in prophase.
iii. Drawings (ideograms) show the G banding pattern of human chromosomes.
The Human Genome Landmarks poster is a 24" by 36" wall poster that lists
selected genes, traits, and disorders associated with each of the 24 different
human chromosomes. Request a free print copy of this poster online.
Source: http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/
39
Basics
Genetics
Epi-
Memory
Organism
HUGO (1/5)
Human Genome (HG):
•
•
•
•
•
3·E9 base pairs;
35·E3 genes (10% of HG);
85% of them are known;
15% are unknown (inactive);
of the 85% only 1/5 are
known what they accomplish
12-06-13
Madl
40
The Human Genome is the sum total of all genes contained in a cell’s chromosomes:
• 3·E9 pairs of DNA nucleotides
• approx. 27,000 genes (humans and mice have about the same number of genes. But we are
so different from each other, how is this possible? One human gene can make many different
proteins while a mouse gene can only make a few!
• Genes = 10% of human genome
• Exons: parts of the DNA chain that code for specific proteins
• Introns: the parts in-between the exons that are excised lateron after transcription
• Both exons and introns are transcribed but only the exons are translated (introns are removed
from mRNA before leaving nucleus)
There are a relatively small number of human genes, less than 30,000, but they have a complex
architecture that we are only beginning to understand and appreciate.
• We know where 85% of genes are in the sequence.
• We don’t know where the other 15% are because we haven’t seen them “on” (they may only
be expressed during fetal development).
• We only know what about 20% of our genes do so far.
So it is relatively easy to locate genes in the genome, but it is hard to figure out what they do.
As the finishing touches were being applied to the sequencing of the human genome (completed
in April 2003), unaccountable anomalies kept creeping in, strangely reminiscent of the quarks
and dark matter and sundry weird forces that keep muddying the waters of theoretical physics.
Scientific American (Nov. & Dec. 2003 issues) summarizes: Only 2% of our DNA - via RNA codes for proteins. Until very recently, the rest was considered "junk," the byproduct of millions
of years of evolution. Now scientists are discovering that some of this junk DNA switches on
RNA that may do the work of proteins and interact with other genetic material. "Malfunctions in
RNA-only genes, can inflict serious damage.“
40
Basics
Genetics
Epi-
Memory
Organism
HUGO (2/5)
Human Genome (HG):
…. still some challenges left: ….
• how to pack this into the nucleus?
• why are there only 35·E3 genes?
i) a mouse has about the same,
i) DNA of apes & humans = 98%
• there are some 100·E3 proteins,
hence: 1 gene ≠ 1 protein!
12-06-13
Madl
41
A typical eukaryotic cell is about 25 m in diameter, but this average hides a large range of sizes.
The smallest cell is a type of green algae, Ostreococcus tauri, with a diameter of only 0.8
micrometers, about the size of a typical bacterium. The human sperm is about 4 m wide, but 40
m long, while the egg is about 100 m in diameter. Single neurons can be a meter or more in
length. While schematic diagrams often picture cells as simple cubes or spheres, most cells have
highly individual shapes. Human red blood cells are flattened disks indented on either side;
muscle cells are highly elongated; neurons are long and thin with many branches on each end;
and white blood cells constantly change their shapes as they crawl through the body.
The nucleus is the largest organelle in the cell (approx. 10m in diameter).
Source: http://www.bookrags.com/research/cell-eukaryotic-gen-01/
If we compare a human DNA with the DNA of the great apes, the gorillas, the orang-utans, and
chimpanzees, 98% of our DNA is identical. They are our closest relatives. And if you compare
our DNA with the DNA of a snake, of an insect, of a fish, or of a bird, or a tree, vast tracks of our
DNA are still identical. We are all related, because we are all descendents from one original cell
some 3 and a half billion years ago. And if you begin to recognize that other species are our
relatives, our kin, than as Willson and Ehrlich point out, surely the goodness, we would treat
them with greater respect and care than if we simply look at them as commodities or resources.
D. Suzuki - speaking at the Australian Museum Society in Sydney AUS - 1992 (wisdom of the
elders)
41
Basics
Genetics
Epi-
Memory
Organism
HUGO (3/5)
Human Genome (HG):
Eu- vs. Hetero-Chromatin
1. Nature of DNA sequence
2. mRNA or dsRNA expression
3. Spatial organization within the
nucleus (nucleoplasm vs. nuclear
matrix, or distinct nuclear domains).
12-06-13
Madl
42
The distinction between euchromatin and heterochromatin
Euchromatin:
* active” chromatin
* largely coding sequences
* less than 4% of the mammalian genome
* ”open” (decompacted), nuclease-sensitive
state
* complexed with transcripton/chromatin
machineries
Heterochromatin:
* historically less well studied
* important in the organization and proper functioning
of eukaryotic genomes
* “closed”, or “locked-down” state
* centromeres & telomeres: constitutive
heterochromatin
* defense mechanism
* heterochromatin serves important genome
maintenance functions
DNA-Faltung (supercoiling) – rund 2m langer DNA-faden ist im Nucleus verpackt.7 Die Gen-Expression
kann aber nur stattfinden wenn die DNA “ausgewickelt” ist (Eucjromatin), nur so koennen Abschnitte
abgelesen werden um eine mRNA-Kopie zu erstellen;
Source: 7. http://chemistry.umeche.maine.edu/CHY431/Nucleic5.html
42
Basics
Genetics
Epi-
Memory
Organism
HUGO (4/5)
Human Genome (HG):
• so, what is a gene then?
i) a gene is a union of genomic sequences encoding
a coherent set of potentially overlapping functional products,
i) coding portion that determines what can be done and a non-coding
portion that determines when the “doing” is active (expressed)
i) phenotype can be thought of as a product of genes
interacting with each other and with the environment (epigenitics!)
12-06-13
Madl
43
Not so long ago, it was assumed that a gene is the basic unit of heredity in a living organism. All
living things depend on genes. Genes hold the information to build and maintain their cells and
pass genetic traits to offspring. In general terms, a gene is a segment of nucleic acid that, taken as
a whole, specifies a trait. The colloquial usage of the term gene often refers to the scientific
concept of an allele …. In cells, a gene is a portion of DNA that contains both "coding"
sequences that determine what the gene does, and "non-coding" sequences that determine when
the gene is active (expressed). When a gene is active, the coding and non-coding sequences are
copied in a process called transcription, producing an RNA copy of the gene's information.
A concise definition of a gene, taking into account complex patterns of regulation and
transcription, genic conservation and non-coding RNA genes, has been proposed by Gerstein et
al.: "A gene is a union of genomic sequences encoding a coherent set of potentially overlapping
functional products".
The classical view of a gene as a unit of hereditary information aligned along a chromosome,
each coding for one protein, has changed dramatically over the past century. To quote Falk
(1986), ‘‘. . . the gene is . . . neither discrete . . . nor continuous . . ., nor does it have a constant
location . . ., nor a clear-cut function . . ., not even constant sequences . . . nor definite
borderlines.’
Our definition …. argues …. that final, functional gene products (rather than intermediate
transcripts) should be used to group together entities associated with a single gene. It also
manifests how integral the concept of biological function is in defining genes.
Another issue: in forensic science we are now able to work out a pretty refined pictre of a
criminal by using DNA-samples to deduct eye & skin & hair color, body stature etc. (Ballantyne &
Kayser). However, we are not able to explain why there are eyes, ears, etc in the first place!
Source: http://en.wikipedia.org/wiki/Gene
Gerstein MB, Bruce C, Rozowsky JS, Zheng D, Du J, Korbel JO, Emanuelsson O, Zhang ZD, Weissman S,
Snyder M (2007). "What is a gene, post-ENCODE? History and updated definition". Genome Research 17
(6): 669–681;
Ballantyne K and Kayser M (2009) Forensic molecular diagnostics. In: Molecular Diagnostics, van Leeuwen
WB and Vink C (Eds), in press.
43
Basics
Genetics
Epi-
Memory
Organism
HUGO (5/5)
…. Hence ….
• each gene give rise to several proteins by alternative splicing;
• genes should be seen as one long continuum;
• each protein is modified in multiple ways by epigenetic modulation
• these modified proteins further take part in different protein complexes.
Yeast (clone & 5 - 6·E3 genes)
12-06-13
Human: (~ 33·E3 genes for ~200 cell types)
Madl
44
Geneticists experienced a comparable shock when, contrary to their expectations of over 120,000
genes, they found that the entire human genome consists of approximately 33,000 genes [Pennisi
2003a and 2003b; Pearson 2003; Goodman 2003] of which 19,000 are protein coding
[www.genenames.org]…. Now that the Human Genome Project has toppled the one-gene for oneprotein concept, our current theories of how life works have to be scrapped …. There are simply
not enough genes to account for the complexity of human life or of human disease ….
We can no longer use genes to explain why humans are at the top of the evolutionary ladder. It
turns out there is not much difference in the total number of genes found in humans and those
found in primitive organisms. Let's take a look at three of the most studied animal models in
genetic research, a microscopic nematode roundworm known as Caenorhabditis elegans, the fruit
fly and the laboratory mouse (humans are not at the top of the pyramid of creationist thinking) ….
…. Caenorhabditis …. has a precisely patterned body comprised of exactly 969 cells and a simple
brain of about 302 cells …. The Caenorhabditis genome consists of approximately 24,000 genes
[Blaxter 2003]. The human body, comprised of over 80 trillion cells, contains only 1,500 more
genes than the lowly, spineless, thousand-celled microscopic worm.
Yeast: no differentiation - clonal, repetitive “immortal”; 5-6·E3 genes for metabolism & cell
division;
Human: ~27,000 genes for ~200 cell types;
Further observations: Genome size vs. gene numbers
i) Coding sequences vs. noncoding & repeatitive sequences (yeast has almost no non-coding;
human has 96% non-coding+repeats)
i) Larger transcriptional units in higher eukaryotes (30-200 kb for human)
i) Factors contributing to different epigenetic regulatory pathways:
Larger genomic size, more extensive epigenetic silencing mechanisms
Multicellularity: how to maintain multiple cell types (cellular identity)
i) Non-protein RNA considered “Junk genes” (Steve Jones) with 50% of the human genome
consisting of “transposons” (transposable elements, themselves being internalised viruses
(Villareal))
Source: http://en.wikipedia.org/wiki/Chromosome
Helen Pearson (2006) Genetics: What is a gene? Nature 441 398-401
Lipton B. (2005) Biology of Belief. Elite Books, p.62-64
44
Basics
Genetics
Epi-
Memory
Organism
Epigenetics
12-06-13
Madl
0
0
Basics
Genetics
Epi-
Memory
Organism
Epigenetics (1/4)
Epigenetics (epi = on or over the
genetic information).
Reversible changes in DNA
function, without changing the
DNA sequence.
Hence, at least 2 forms of info:
• Genetic information (genotype)
• Epigenetic information
(phenotype modulated via
environmental signals)
12-06-13
Madl
1
The effect of every gene depends both upon the environment, and upon other
genes. A gene does not act alone, it gives instructions for the manufacture of a
protein. Proteins act with other proteins, with substrates, etc... All genes interact
with the environment to some extent. Sometimes the contribution of the
environment is small, sometimes it is very significant.
• Genetic information provides the building block for the manufacture of all
Proteins needed for the cell functional activity;
• Epigenetic information provides additional instruction on how, when and
where these information should be used.
1
Basics
Genetics
Epi-
Memory
Organism
Epigenetics (2/4)
Epigenetic Modulation
1. Bookmarking
2. Paramutation
Image: mutant DNA in the cress plant
Arabidopsis may be ‘corrected’ by
inherited RNA.
Pearson, 2002
12-06-13
Madl
2
Epigenetics in multicellular organisms is not only limited to cell-differentiation, epigenetic
patterns have been observed in transgenerational epigenetic inheritance. Although most of these
multigenerational epigenetic traits are gradually lost over several generations, the possibility
remains that multigenerational epigenetics could be another aspect to evolution and adaptation.
•Bookmarking is a biological phenomenon believed to function as an epigenetic mechanism for
transmitting cellular memory of the pattern of gene expression in a cell, throughout mitosis, to its
daughter cells. This is vital for maintaining the phenotype in a lineage of cells so that, for
example, liver cells divide into liver cells and not some other cell type.
•Paramutation is a phenomenon whereby the characteristic of a gene is "remembered" and seen
in later generations, even if that particular version of the gene is no longer present. It is an
interaction between two alleles of a single locus, resulting in a heritable change of one allele that
is induced by the other allele …. What may be transmitted in such a case are RNAs such as
piRNAs, siRNAs, miRNAs or other regulatory RNAs. These are packaged in egg or sperm and
cause paramutation upon transmission to the next generation. This means that RNA is a molecule
of inheritance, just like DNA.
Pruitt and his co-workers’ analysis shows …. plants had replaced the abnormal DNA sequence
with the regular code possessed by earlier generations …. It definitely changes the view of
inheritance …. Here we show that Arabidopsis plants homozygous for recessive mutant alleles of
the organ fusion gene HOTHEAD5 (HTH) can inherit allele-specific DNA sequence information
that was not present in the chromosomal genome of their parents but was present in previous
generations. …. We postulate that these genetic restoration events are the result of a template
directed process that makes use of an ancestral RNA-sequence cache.
Image: mutant DNA in Arabidopsis may be ‘corrected’ by inherited backup-copies of RNA.
Source: http://en.wikipedia.org/wiki/Paramutation &
http://en.wikipedia.org/wiki/Bookmarking
Pearson H. (2002) What is a Gene? Nature 441: 399-401
Lolle, S. J., Victor, J. L., Young, J. M. & Pruitt. R. E. (2005) Genome-wide non-mendelian
inheritance of extra-genomic information in Arabidopsis. Nature 434: 505–509.
2
Basics
Genetics
Epi-
Memory
Organism
Epigenetics (3/4)
Bookmarking (during one’s life):
1. activation gene promotors
(in transcription)
1. histone modifications
2. cellular memory (trough mitosis)
• phenotypic changes during a life span
• is an aspect of health and disease
• ectodermal cell layer associated to
skin & CNS (= brain!)
National Center for Biotechnology Information , 2008
12-07-11
Madl
3
Bookmarking is a biological phenomenon believed to function as an epigenetic mechanism for
transmitting cellular memory of the pattern of gene expression in a cell, throughout mitosis, to its
daughter cells. This is vital for maintaining the phenotype in a lineage of cells so that, for
example, liver cells divide into liver cells and not some other cell type.
It is characterized by non-compaction of some gene promoters during mitosis. In terms of
mechanism, it is believed that:
• at some point prior to the onset of mitosis, the promoters of genes that exist in a transcriptioncompetent state become "marked" in some way,
• that this "mark" persists both during and after mitosis,
• and that the marking transmits gene expression memory by preventing the mitotic compaction of
DNA at this locus, or by facilitating reassembly of transcription complexes on the promoter, or
both.
In some cases, bookmarking is mediated by binding of specific factors to the promoter prior to
onset of mitosis, but in other cases could be mediated by patterns of histone modification or
presence of histone variants that are characteristic of active genes, and which are believed to
persist throughout mitosis.
In the case of specific genes, for example, the stress-inducible hsp70 gene, bookmarking may also
function as a mechanism for ensuring that the gene can be transcribed early in G1 phase if a stress
were to occur at that time. If this gene promoter were compacted it would take time to de-compact
in G1, during which time the cell would be unable to transcribe this cytoprotective gene, leaving it
vulnerable to stress-induced cell death. In this case, bookmarking appears to be important for cell
survival.
Source: http://en.wikipedia.org/wiki/Bookmarking
http://www.epigenetics.co.kr/epigenetics.htm
http://www.ncbi.nlm.nih.gov/About/primer/genetics_cell.html
3
Basics
Genetics
Epi-
Memory
Organism
Epigenetics (4/4)
Paramutation (cross-generations):
(par-a, Gk, “a quasi” mutation)
1. gene silencing
2. genomic imprinting
3. transvection
• refers to inheritance over several generations
• violates G.Mendel’s 1st law and
• is another aspect to evolution and adaptation
Mondin & Gardingo, 2005
12-06-13
Madl
4
Paramutation is a phenomenon whereby the characteristic of a gene is "remembered" and seen
in later generations, even if that particular version of the gene is no longer present. It is an
interaction between two alleles of a single locus, resulting in a heritable change of one allele that
is induced by the other allele …. In paramutation an allele in one generation heritably affects the
other allele in future generations, even if the allele causing the change is itself not transmitted.
What may be transmitted in such a case are RNAs such as piRNAs, siRNAs, miRNAs or other
regulatory RNAs. These are packaged in egg or sperm and cause paramutation upon transmission
to the next generation. This means that RNA is a molecule of inheritance, just like DNA.
•Gene silencing is a general term describing epigenetic processes of gene regulation. The term
gene silencing is generally used to describe the "switching off" of a gene by a mechanism other
than genetic modification. That is, a gene which would be expressed (turned on) under normal
circumstances is switched off by machinery in the cell. Genes are regulated at either the
transcriptional or post-transcriptional level.
•Genomic imprinting is a genetic phenomenon by which certain genes are expressed in a parentof-origin-specific manner. It is an inheritance process independent of the classical Mendelian
inheritance. Imprinted genes are either expressed only from the allele inherited from the mother
(eg. H19 or CDKN1C), or in other instances from the allele inherited from the father (eg. IGF2).
•Transvection is an epigenetic phenomenon that results from an interaction between an allele on
one chromosome and its homologous chromosome. It can lead to either gene activation or
repression. Formally, it can also occur between non-allelic regions of the genome as well as
regions of the genome that are not transcribed.
Image: Segregating ears showing paramutation phenotypes in the pericarp. The arrows indicate
kernels that contain paramutation events in the locus p and r.
Source: Mondin, M & Gardingo, JR (2005). Evidence of natural occurrence of paramutation at p1
locus. MNL. Vol. 79: 37
http://en.wikipedia.org/wiki/Paramutation & …. wiki/Gene_silencing & ….
wiki/Transvection_(genetics)
4
Basics
Genetics
Epi-
Memory
Organism
Gene Silencing (1/2)
Transposons (TE) – jumping genes
• Class-I RNA Retro-transposon (copy & paste)
• Class-II DNA transposon (cut & paste)
e.g. Mosaicisms
• cell with two different genotypes;
• originates from a reversible mutation during
development;
McClintock B., 1948
12-06-13
Madl
5
Transposons are sequences of DNA that can move around to different positions within the genome of
a cell, (=transposition, transposons are also called "jumping genes", examples of mobile genetic
elements). In this process, they can cause mutations and change the amount of DNA in the genome.
Insertion of a transposon into a gene can disrupt that gene's function in a reversible manner;
transposase-mediated excision of the transposon restores gene function. This produces plants in which
neighboring cells have different genotypes.
• Class-I Retrotransposons work by copying themselves and pasting copies back into the genome in
multiple places. Initially retrotransposons copy themselves to RNA (transcription) but, in addition to
being transcribed, the RNA is copied into DNA by a reverse transcriptase (often coded by the
transposon itself) and inserted back into the genome (copy & paste) …. The duplications at the
target site can result in gene duplication and this is supposed to play an important role in evolution.
Retrotransposons behave very similarly to retroviruses, such as HIV, giving a clue to the possible
evolutionary origins of such viruses.
• Class-II DNA transposons does not involve an RNA intermediate. Usually move by a mechanism
analogous to cut and paste using the transposase enzyme. Some transposase can bind to any part of
the DNA molecule, and the target site can therefore be anywhere, while others bind to specific
sequences. Transposase makes a staggered cut at the target site producing sticky ends (a staggered
cut in the target DNA filled by DNA polymerase) followed by inverted repeats (which are important
for the transposon excision by transposase).
The first transposons were discovered in maize (Zea mays), by Barbara McClintock in 1948. She
noticed insertions, deletions, and translocations, caused by these transposons. These changes in the
genome lead to a change in the color of corn kernels. About 60% of the total genome of maize consists
of transposons. The Ac/Ds system McClintock described are class II transposons (unstable inheritance
of mosaicism) .
Image: he relationship of Ac/Ds in the control of the elements and mosaic color of maize. The seed in
10 is colorless, there is no Ac element present and Ds inhibits the synthesis of colored pigments called
anthocyanins. In 11 to 13, one copy of Ac is present. Ds can move and some anthocyanin is produced,
creating a mosaic pattern. In the kernel in panel 14 there are two Ac elements and in 15 there are three.
Source: http://en.wikipedia.org/wiki/File:Corn_mosaic.jpg &
http://en.wikipedia.org/wiki/Transposon
5
Basics
Genetics
Epi-
Memory
Organism
Gene Silencing (2/2)
Transposons (TE) – jumping genes
Species
(common name) Genome size
[Gb]
Rana esculenta
Frog
5,6–8,0
Zea mays
Mais
5,0
Homo sapiens
Human
3,5
Mus musculus
Mouse
3,4
D. melanogaster
Fruitfly
0,18
C. elegans
Worm
0,1
S. cerevisiae
Yeast
0,012
E. coli
Bacter
0,0046
TE
[%]
77
60
45 (!)
40
15-22
12
3-5
0,3
Boeke & Corces, 1989
12-06-13
Madl
6
The first transposons were discovered in maize (Zea mays), by Barbara
McClintock in 1948. She noticed insertions, deletions, and translocations, caused
by these transposons. These changes in the genome lead to a change in the color
of corn kernels. About 60% of the total genome of maize consists of transposons.
The Ac/Ds system McClintock described are class II transposons (unstable
inheritance of mosaicism) .
This isn't just about yellow and brown mice. "About 45% of the human genome
is transposons," notes Prof. Jirtle.
Source: http://de.wikipedia.org/wiki/Transposon
J. D. Boeke, V. D. Corces (1989) Transcription and reverse transcription of retrotransposons In:
Annu. Rev. Microbiol. 43: 403-34.
6
Basics
Genetics
Epi-
Memory
Organism
Imprinting (1/5)
Various modes of Epigenetic imprinting
1. DNA methylation (-CH3)
2.
Epigenomics, 2005
12-06-13
Wang Y.M. et al., 2005
Madl
7
Genomic imprinting is parent-of-origin-specific allele silencing. It is maintained,
in part, by differentially methylated regions and it is normally reprogrammed in
the germline. Methylation is nature's way of allowing environmental factors to
tweak gene expression without making permanent mutations, Dr. Jirtle said.
DNA modification: Stretches of DNA can be inactivated by covalently attaching
methyl groups, which can interfere with the binding of transcriptional enzymes,
and can also be signals to recruit enzymes that modify associated histones. Cells
have enzymes called methyltransferases that bind to specific dinucleotides (a
cytosine adjacent to a guanine) and attach a methyl group to the cytosine.
Methylated DNA is silent DNA.6
DNA Methylation: (addition of a methyl-group, CH3). It is the covalent addition
of methyl group to 5th Position of cystosine with in CPG di-nucleotides which are
frequently located in the promoter region of genes. It is a complex process
catalyzed by DNA methyl transferase. The addition of the methyl group from the
universal methyl Donor s-adenosyl L -methionine. Methylated DNA-sequences
are silenced (inactivated, off).5
Heute kennt man rund 28·E6 methylisierbare gen-positionen in der DNA.
Prinzipiell wird in den keimzellen fast die gesamte methylierung geloescht
(ausnahmen)!
Source: 5. http://www.berlinews.de/artikel.php?12449
6. http://scienceblogs.com/pharyngula/2008/07/epigenetics.php
7
Basics
Genetics
Epi-
Memory
Organism
Imprinting (2/5)
3.
Zhang G., 2007
12-06-13
Madl
8
Histone modification. Those roughly spherical histone complexes also have dangling N-terminal
tails that can also be covalently modified by acetylation, phosphorylation, ubiquitination, or
methylation. These changes affect how tightly packed the chromatin will be: in loosely packed
chromatin, called euchromatin, the DNA is more accessible and more active, while in tightly
packed chromatin (heterochromatin), the DNA is more inactive.8
• Histone variants. All histones are not alike! Some variants are more permissive of
transcription, while others facilitate tighter packing. Activity in a region of DNA can be
modulated by the kinds of histones used.8
• Histone Methylation: The process is carried out by an enzyme histone methyl transferase
which directs site-specific methylation of amino-acid residues such as lys. 4&9 in the tail of the
histone H3. Methylation of lysine 9 in histone H3 directs the binding of non-coding RNA, histone
deacetylase to control chromatin structure and gene expression.
Image: The figure illustrates nucleosome models and major posttranslational modifications which
play essential roles in gene expression and regulation and disease processes.
Small Image: The dynamic nature of epigenetic modifications. The modifications that occur on
histone N-terminal tails and on DNA are shown together with the enzymes that lay down and
remove the marks. Deregulation of any of these enzymes has the potential to be oncogenic.9
Source: http://chemistry.gsu.edu/faculty/Zheng/research.html
8. http://scienceblogs.com/pharyngula/2008/07/epigenetics.php
9. http://www.abcam.com/index.html?pageconfig=resource&rid=10755&pid=10628
8
Basics
Genetics
Epi-
Memory
Organism
Imprinting (3/5)
3.
Reik & Walter, 2001
12-06-13
Madl
9
Chromatin reshaping seems to underlie healthy adaptations such as learning and memory as well
as disease processes—including cancer, seizures, schizophrenia, and depression. Even social
stress turned on a particular gene in the brains of mice through chromatin remodeling, a longlasting change that corresponded with a behavioral indicator of depression. Antidepressant
medication reversed both the behavioral sign of depression and the elevated gene activity,
underscoring a key point about the modifications: experience and chemical agents can alter gene
expression through chromatin remodeling, but such changes are reversible.
Image (L): Nucleosomes consist of DNA (black line) wrapped around histone octomers (purple).
Post-translational modification of histone tails by methylation (Me), phosphorylation (P) or
acetylation (Ac) can alter the higher-order nucleosome structure. Nucleosome structure can be
regulated by ATP-dependent chromatin remodellers (yellow cylinders), and the opposing actions
of histone acetyltransferases (HATs) and histone deacetylases (HDACs). Methyl-binding
proteins, such as the methyl-CpG-binding protein (MECP2), target methylated DNA (yellow) and
recruit HDACs. a | DNA methylation and histone deacetylation induce a closed-chromatin
configuration and transcriptional repression. b | Histone acetylation and demethylation of DNA
relaxes chromatin, and allows transcriptional activation (Johnstone).
Image (R): The figure shows a schematic pair of imprinted alleles. Hallmarks of imprinted genes
such as CpG islands and repeats (arrows) are indicated. The enlarged region below the
chromosomes highlights the allele-specific epigenetic changes, such as nucleosomal condensation
through deacetylation, and methylation (allele 1) and opening of the chromatin by acetylation and
demethylation (allele 2). The transcriptional competence of allele 2 is indicated by the binding of
a transcription complex (Reik & Walter).
Source: Johnstone RW. Histone–deacylase inhibitors: novel drugs for the treatment of cancer.
Nature Rev. Drug Discovery 2002;1: 287-299.
Wolf Reik & Jörn Walter (2001) Genomic imprinting: parental influence on the genome. Nature
Reviews Genetics 2, 21-32
9
Basics
Genetics
Epi-
Memory
Organism
Imprinting (4/5)
3. mRNA silencing
Mallery C., 2007
12-06-13
Madl
10
3) auch bei mRNA gibt es eine epigenetische Steuerung: die schnelle Eingreiftruppe wird durch
mikro-RNA erreicht; diese sind siRNA (short interference RNA) welche die mRNA zerstoeren.
Man kennt heute rund 500 verschiedene siRNA’s:
Images: Cells can inhibit the expression of individual genes (stop proteins from being made) by
interfering with a mRNA being transcribed. This is done vai a small double-stranded RNA. An
enzyme named DICER snips short interfering RNAs (siRNA) from longer double stranded RNAs
made by (A) self-copying gene sequences, (B) by replicating viruses, or (C) regulatory RNA
sequences known as microRNAs. All the RNAs (A, B, & C) are cleaved by DICER enzyme into
short siRNA pieces that can suppress gene expression.
The short siRNA pieces (A, B, & C above image) unwind into single strand RNAs, which then
combine with proteins to form a complex called RNA-Induced Silencing Complex (RISC). The
RISC then captures a native mRNA molecule that complements the short siRNA sequence. If the
pairing (native mRNA and siRNA piece) is essentially perfect, the native mRNA is cut into
useless RNA fragments that aren't translated into AA-sequences. If however, the pairing is less
than perfect then the RISC complex binds to the mRNA and blocks ribosome movement along the
native mRNA also halting translation. The net effect is NO PROTEIN IS MADE.
In diverse organisms, small RNAs derived from cleavage of double-stranded RNA can trigger
epigenetic gene silencing in the cytoplasm and at the genome level. Small RNAs can guide
posttranscriptional degradation of complementary mRNA and (at least in plants) induce
methylation of homologous DNA sequences. RNA silencing can counteract foreign sequences
(like retroviruses and transposons) and is probably involved in development (Matzke et al.).
Source: Marjori Matzke, Antonius J. M. Matzke, and Jan M. Kooter (2001). RNA: Guiding Gene
Silencing. Science 293: 1080-1083.
http://porpax.bio.miami.edu/~cmallery/150/gene/how_siRNA_works.htm
http://porpax.bio.miami.edu/~cmallery/150/gene/siRNA.htm
10
Basics
Genetics
Epi-
Memory
Organism
Imprinting (5/5)
e n 3s
et at
ic d y
svi sle
de xi
o a
(0
3:
3
004
:4
8)
3. mRNA silencing
…. Video-clip ….
en
ie
Ep
ig
Brown, 2006
12-06-13
Madl
11
Epigenetics & Imprinting:
•Parents have enzymes which add methyl groups to gamete’s genes.
•Methylation of DNA messes up the grooves to which the regulatory proteins
bind. Regulatory proteins usually have domains (zinc fingers, leucine
zippers, or helix-turn-helix) which will fit into the smooth double-helix
grooves. But adding methyl (CH3) puts bumps in the grooves.
•Histones can also bind to the TATA box so that the promotor site on the
DNA is hidden or exposed.
Source: http://www.rci.rutgers.edu/~wmbrown/
Legastenie video 03:30-04:48
11
Basics
Genetics
Epi-
Memory
Organism
Chromosome (1/13)
Properties of the Genome:
• Hologram
• Recipe book
1 recipe book = 1 genome
1 recipe = 1 gene(-products)
1 word = 1 codon (3 letters)
1 letter = 1 base (A, T, G & C)
12-06-13
Madl
12
Hologram - Top: This is how a photographic image would appear if you look at it with
magnifying glasses of increasing strength. If you were to cut away the pieces of the picture that
are outside the frame shown, the pixels containing the information would be lost and the image
could not be reconstructed. Below: The principle of information storage in the hologram. The
actual image would not be visible on the film, but the smaller sections of the film still contain the
information about the complete object. If you cut it in half or even smaller pieces, you can still
use each of the pieces to create a projection of the whole kitten.
Recipe book: Inside this giant instruction book's 23 chapters (23 pairs of chromosomes grouped
into one genome), one finds all the recipes (approx. 25,000 genes) for cooking up 100s of
thousands of proteins that make and maintain our body. By determining which genes we inherit
from your parents, chance may play a role. However, “genes themselves need instructions for
what to do, and where and when to do it.” These additional instructions are not in DNA, but on it,
in an array of chemical markers and switches, known collectively as the epigenome, that lie along
the length of the double helix. These epigenetic switches and markers in turn help switch on or
off the expression of particular genes (critical to the healthy development of organisms). These
can be dramatically tweaked by exposure to a vitamin, a toxin or even mothering, altering “the
software of our genes in ways that affect an individual’s body and brain for life.” …. Thus we are
the not simply product of our genes, but rather that of our experiences, our surroundings, and only
to a minimal extent by chance.
23 chapters = 23 pairs of chromosomes, hold all our recipes. Chromosomes are tightly bundled
threads of DNA and protein. They're wrapped up like balls of string in the nucleus of a cell.
• 1 recipe = 1 gene(-products). Some genes contain the recipe for a single protein; other genes can
make more than one protein. A gene is a section of DNA on a chromosome.
• 1 word = 1 codon is spelled by a sequence of three bases, such as TCG, along one side of the
DNA ladder. Each three-letter word is called a codon.
• 1 letter = 1 base. Four bases-A, T, G, and C-make up the rungs of the DNA ladder (A connects
to T, G connects to C). Our entire genome contains about 3 billion rungs.
Source - hologram: receipe: http://genome.pfizer.com/station2-4.cfm
http://dangerousintersection.org
12
Basics
Genetics
Epi-
Memory
Organism
Chromosome (2/13)
Human Genome (HG):
• haploid (n)
• diploid (2n)
12-06-13
Madl
13
Chromosome pairs in diploid organisms are homologous chromosomes. One member of each pair
(homolog) is inherited from each parent. Chromosomes that have different genes and do not pair
are nonhomologous chromosomes.
Eukaryotes have multiple linear chromosomes in a number characteristic of the species. Most
have two versions of each chromosome, and so are diploid (2N).
a. Diploid cells are produced by haploid (N) gametes that fuse to form a zygote. The zygote then
undergoes development, forming a new individual.
b. Examples of diploid organisms are humans (23 pairs) and Drosophila melanogaster (4 pairs).
The yeast Saccharomyces cerevisiae is haploid (16 chromosomes).
c. Cells within multicellular organisms can be functionally divided into two major compartments
(at embryogenesis): *Based on differentiation potency
Germ cells: totipotent (infinite proliferation potential) Ex. mammalian oocytes (40 years)
Somatic cells: differentiated also include stem cells (multipotent);
(stem cells can be activated by mitogenic signals to enter restricted number of
cell divisions);
Animals and some plants have male and female cells with distinct chromosome sets, due to sex
chromosomes. One sex has a matched pair (e.g., human females with XX) and the other has an
unmatched pair (human male with XY). Autosomes are chromosomes other than sex
chromosomes.
Chromosomes differ in size and morphology. Each has a constriction called a centromere that is
used in segregation during mitosis and meiosis. The centromere location is useful for identifying
chromosomes.
a. Metacentric means the centromere is approx. in the center, producing two equal arms.
b. Submetacentric means one arm is somewhat longer than the other.
c. Acrocentric have one long arm and a short stalk and often a bulb (satellite) as the other arm.
d. Telocentric chromosomes have only one arm, because the centromere is at the end.
13
Basics
Genetics
Epi-
Memory
Organism
Chromosome (3/13)
Meiosis:
1st meiotic division: duplication of
chromosomes;
• Prophase of meiosis: synapse &
crossover.
• Metaphase: paired arrangement
of chromosomes;
• Anaphase: migration of
homologous chromosomes;
• Telophase: new progeny cells;
2nd meiotic division: halving of
chromosomes (2n –> n + n)
12-06-13
Madl
14
In biology or life science, meiosis is a process of reductional division in which the number of
chromosomes per cell is halved. In animals, meiosis always results in the formation of gametes,
while in other organisms it can give rise to spores. As with mitosis, before meiosis begins, the
DNA in the original cell is replicated during S-phase of the cell cycle. Two cell divisions separate
the replicated chromosomes into four haploid gametes or spores.
Meiosis is essential for sexual reproduction and therefore occurs in all eukaryotes (including
single-celled organisms) that reproduce sexually. A few eukaryotes, notably the Bdelloid rotifers,
have lost the ability to carry out meiosis and have acquired the ability to reproduce by
parthenogenesis. Meiosis does not occur in archaea or bacteria, which reproduce via asexual
processes such as binary fission.
Meiosis is two successive divisions of a diploid nucleus (2n) after only one DNA replication
cycle. The result is haploid (n) gametes (animals) or meiospores (plants). The two rounds of
division in meiosis are meiosis I and meiosis II, each with a series of stages. Cytokinesis usually
accompanies meiosis, producing four haploid cells from a single diploid cell.
First meiotic division: duplication of chromosomes to form chromatids (2N)
Prophase of meiosis: homologous chromosomes lie side by side over entire length = synapse.
Interchange of segments of homologous chromosomes = crossover.
2 Xs side by side just like the autosomes.
X and Y end to end – no crossover.
Metaphase: paired chromosomes arrange in middle of cell;
Anaphase: homologous chromosomes migrate to opposite poles of the cell; each chromosome
is composed of two chromatids, the chromatids are not separated
Telophase: two new daughter cells form; each contains half the chromosome number =
reduction of chromosomes by half; interchange of genetic material occurred during synapse;
Second meiotic division = mitotic division
2 chromatids separate, 2 new daughter cells are formed with half the normal number of
chromosomes (N)
14
Basics
Genetics
Epi-
Memory
Organism
Chromosome (4/13)
Gametogenesis formation
of haploid cells (n)
during meiosis:
• Oocytes formed before
birth (arrested prophase
- up to 4 decades!);
• Spermatocytes
continous
formation
(fresh);
12-06-13
Madl
15
Gametogenesis:
Oocytes: formed before birth - prolonged prophase of first meiotic division until ovulation – more
frequent congenital abnormalities in ova of older women (longer exposure to potentially harmful
environmental influences until meiotic division resumes at ovulation);
ii. In females, oogenesis produces eggs (oocytes) in the ovary.
(1) Primordial germ cells (primary oogonia) undergo mitosis to produce secondary oogonia.
(2) Secondary oogonia transform into primary oocytes, which grow until the end of oogenesis.
(3) Primary oocytes undergo meiosis I and unequal cytokinesis, producing a large secondary
oocyte, and a small cell called the first polar body.
(4) The secondary oocyte produces two haploid cells in meiosis II. One is a very small cell, the
second polar body, and the other rapidly matures into an ovum.
(5) The first polar body may or may not divide during meiosis I. Polar bodies have no function
in most species and degenerate, so that a round of meiosis produces only one viable gamete,
the ovum. Human oocytes form in the fetus, completing meiosis only after fertilization.
Spermatocytes: continously formed (‘fresh’ sperm)
i. In males, spermatogenesis produces spermatozoa within the testes.
(1) Primordial germ cells (primary spermatogonia) undergo mitosis to produce secondary
spermatogonia.
(2) Secondary spermatogonia transform into primary spermatocytes (meiocytes) which undergo
meiosis I, giving rise to two secondary spermatocytes.
(3) Each secondary spermatocyte undergoes meiosis II, producing haploid spermatids that
differentiate into spermatozoa.
15
Basics
Genetics
Epi-
Memory
Organism
Chromosome (5/13)
Meiosis (germ line):
• Segregation
• Assortment
• Potential gametes: 2N
• Linkage
• Crossing-over (rare in mitosis)
12-06-13
Madl
16
1. Segregation: Diploid organisms must form haploid gametes via the process of meiosis. They therefore
start with two copies of every gene, but produce gametes with only one copy of each gene. Segregation is
the process by which the different alleles of a diploid organism are packaged into separate gametes.
Example: A heterozygote for the albino gene, for example, would produce two types of gametes, a and
A. This process occurs at every locus, and is a result of the seperation of homologous chromosomes
during meiosis. Segregation applies to ONE LOCUS. Segregation of alleles is 2:2. Rarely, 3:1 or 1:3
ratios are seen, due to gene conversion.
2. Independent Assortment describes the process of segregation occurring at multiple loci simultaneously:
The segregation of alleles into gametes follows the laws of probability: therefore an Aa individual would
produce 50% A gametes and 50% a gametes. If genes are on different chromosomes, alleles assort
independently of each other. This is called independent assortment. The chance of an allele at one locus
being in a particular gamete is independent for each locus.
3. Number of potential gametes: The number of potential, different, gametes a parent can produce is equal
to 2n, where n is the number of loci assorting. Thus, a heterozygote for three loci: Aa Bb Cc could form
EIGHT different gametes; e.g. ABC, ABc, AbC, aBC, Abc, aBc, abC, abc, …. By contrast, AA BB Cc
can form only two different gametes, ABc and ABC, because only one locus is assorting. For n
independently assorting loci, there are 2n different gametes that can be created. If they are truly assorting
independently, they will be present in equal numbers.
4. Linkage: Departures from independent assortment are most often caused by LINKAGE, when two loci
are close to each other on the same chromosome. Linkage causes certain combinations of alleles to be
over-represented in the gametes.
i. During meiosis alleles of some genes assort together because they are near each other on the
same chromosome.
ii. Recombination occurs when genes are exchanged between the X chromosomes of the F1
females.
e. Some relevant terminology:
i. A chiasma (plural chiasmata) is the site on the homologous chromosomes where crossover
occurs.
ii. Crossing-over is the reciprocal exchange of homologous chromatid segments, involving the
breaking and rejoining of DNA.
iii. Crossing-over is also the event leading to genetic recombination between linked genes in
both prokaryotes and eukaryotes.
f. Crossing-over occurs at the four-chromatid stage of prophase I in meiosis. Each crossover event
involves two of the four chromatids. All chromatids may be involved in crossing-over, as chiasmata
form along the aligned chromosomes.
g. For genes on different chromosomes, crossover is not involved. PD and NPD tetrads are produced
with equal frequency; and no T tetrads are expected.
16
Basics
Genetics
Epi-
Memory
Organism
Chromosome (6/13)
Crossing over & their challenges:
•
•
•
•
Allele
Genotype
Phenotype
…. But why
are there eyes
anyway?
1. Chromatid
2. Centromere
3. short arm
4. long arm
12-06-13
Madl
17
In eukaryotes, chromosomes are enormously long, linear molecules. Each chromosome
encompasses many genes, arranged linearly, and interspersed with stretches of DNA that do not
code for anything.
• a locus (plural, loci) describes a precise location (site) on a chromosome. Since the
chromosomes exist in pairs, genes are also paired;
• Allele: alternate forms of a gene can occupy the same locus (homo, hetero);
• Recessive / dominant gene: recessive expressed only when homozygous; dominant can be
homo- or hetero- or co-;
• Sex-linked gene: X, recessive, hemi
Genes are arranged on linear chromosomes: Frequently, geneticists use the terms gene and loci
interchangeably, because genes are small relative to chromosomes and seem to occupy pinpoint
locations. We speak of loci having different alleles (polymorphic), or only one allele
(monomorphic).
Phenotype vs. Genotype: An organism heterozygous for a recessive allele, such as albinism,
would exhibit the dominant trait, yet would possess the heterozygous genotype.
An organism’s PHENOTYPE is its observable characteristics.
An organism’s GENOTYPE is its genetic composition of alleles.
Another issue: in forensic science we are now able to work out a pretty refined pictre of a
criminal by using DNA-samples to deduct eye & skin & hair color, body stature etc. (Ballantyne &
Kayser). However, we are not able to explain why there are eyes, ears, etc in the first place!
Do all loci have multiple alleles? No, only a small percentage of loci have multiple alleles,
perhaps 1-5% or less, depending upon the species (again, this is a rough estimate, scientists don’t
really know and gene-hunters frequently ignore variation).
Epistasis occurs when a gene at one locus alters the expression of a gene at another locus.
Source: Ballantyne K and Kayser M (2009) Forensic molecular diagnostics. In: Molecular Diagnostics, van
Leeuwen WB and Vink C (Eds), in press.
17
Basics
Genetics
Epi-
Memory
Organism
Chromosome (7/13)
Crossing over & their challenges:
• suppressed crossover near & at centromere
in meta-, submeta-, acro- & telocentric
chromosomes
• unbalanced recombination (trisomy)
Laurent et al., 2003
12-06-13
Madl
18
Chromosomal crossover is the process by which two chromosomes pair up and exchange sections
of their DNA. This occurs often during prophase 1 of meiosis in a process called synapsis.
Crossover usually occurs when matching regions on matching chromosomes break and then
reconnect to the other chromosome. The result of this process is an exchange of genes, called
genetic recombination. Chromosomal crossovers also occur in asexual organisms and in somatic
cells, since they are important in some forms of DNA repair. Although crossovers typically occur
between homologous regions of matching chromosomes, similarities in sequence can result in
mismatched alignments. These processes are called unbalanced recombination. Unbalanced
recombination is fairly rare compared to normal recombination, but severe problems can arise if a
gamete containing unbalanced recombinants becomes part of a zygote. The result can be a local
duplication of genes on one chromosome and a deletion of these on the other, a translocation of
part of one chromosome onto a different one, or an inversion. XX side by side just like the
autosomes and X and Y end to end – no crossover.
Image: Meiotic exchange is not distributed randomly along eukaryotic chromosomes. Meiotic
recombination is generally suppressed across the centromere of eukaryotic chromosomes. The
most pronounced departure from uniformity is observed near centromeres and telomeres in a
wide variety of plant and animal genomes. The centromere exerts a negative effect on
recombination activity both within itself and in proximal regions. The figure shows the
recombination activity in the juxtacentromeric region of chromosome 21 in CEPH reference
families. Recombination rate per physical unit (cM/Mb) in female (black dots, solid line) and in
male (white dots, dashed line) have been deduced from segregation data of 24 markers
delineating intervals of known physical size, up to 6.6 Mb away from the alphoid centromeric
block (hatched box).
Source: Laurent A.M, Li M.Z, Sherman S., Roizès G., Buard J. 2003: Recombination across the
centromere of disjoined and non-disjoined chromosome 21. Human Molecular Genetics, 2003,
Vol. 12, No. 17 2229-2239 (http://hmg.oxfordjournals.org/cgi/content/full/12/17/2229)
Graves J.A.M. (2006). "Sex chromosome specialization and degeneration in mammals". Cell 124
(5): 901–14.
http://www.sanger.ac.uk/Info/Press/2005/050316-images.shtml
18
Basics
Genetics
Epi-
Memory
Organism
Chromosome (8/13)
Chromosome mutations:
(non-epigenetic!)
The three major single
chromosome
mutations;
1) deletion,
2) duplication
The major two-chromosome mutations;
3) inversion.
1) insertion
2) translocation
Wikipedia.org
12-06-13
Madl
19
Mutations, non-epigeneetic disorders: Chromosomal aberrations are
disruptions in the normal chromosomal content of a cell, and are a major cause of
genetic conditions in humans. Some chromosome abnormalities do not cause
disease in carriers, such as translocations, or chromosomal inversions, although
they may lead to a higher chance of birthing a child with a chromosome disorder.
Abnormal numbers of chromosomes or chromosome sets, aneuploidy, may be
lethal or give rise to genetic disorders. Genetic counseling is offered for families
that may carry a chromosome rearrangement. The gain or loss of chromosome
material can lead to a variety of genetic disorders.
Chromosomal mutations produce changes in whole chromosomes (more than one
gene) or in the number of chromosomes present.
* Deletion - loss of part of a chromosome
* Duplication - extra copies of a part of a chromosome
* Inversion - reverse the direction of a part of a chromosome
* Translocation - part of a chromosome breaks off and attaches to another
chromosome
Most mutations are neutral - have little or no effect
19
Basics
Genetics
Epi-
Memory
Organism
Chromosome (9/13)
(non-epigenetic!)
Genetic disorders include:
12-06-13
• Cri du chat,
• Wolf-Hirschhorn syndrome,
• Down's syndrome
• Edwards syndrome
• Patau Syndrome
• Isodicentric 15
• Jacobsen syndrome
• Klinefelter's syndrome (XXY)
• Turner syndrome (X only)
• XYY syndrome.
• Triple-X syndrome (XXX).
• Pallister-Killian syndrome.
Madl
20
• Cri du chat, which is caused by the deletion of part of the short arm of chromosome 5. "Cri du chat" means
"cry of the cat" in French, and the condition was so-named because affected babies make high-pitched
cries that sound like those of a cat. Affected individuals have wide-set eyes, a small head and jaw, and are
moderately to severely mentally retarded and very short.
• Wolf-Hirschhorn syndrome, which is caused by partial deletion of the short arm of chromosome 4. It is
characterized by severe growth retardation and severe to profound mental retardation.
• Down's syndrome, usually is caused by an extra copy of chromosome 21 (trisomy 21). Characteristics
include decreased muscle tone, stockier build, asymmetrical skull, slanting eyes and mild to moderate
mental retardation.[41]
• Edwards syndrome, which is the second-most-common trisomy (after Down syndrome). It is a trisomy of
chromosome 18. Symptoms include mental and motor retardation and numerous congenital anomalies
causing serious health problems. Ninety percent die in infancy; however, those that live past their first
birthday usually are quite healthy thereafter. They have a characteristic clenched hands and overlapping
fingers.
• Patau Syndrome, also called D-Syndrome or trisomy-13. Symptoms are somewhat similar to those of
trisomy-18, but they do not have the characteristic hand shape.
• Isodicentric 15 on chromosome 15; also called the following names due to various researches, but they all
mean the same; IDIC(15), Inverted dupliction 15, extra Marker, Inv dup 15, partial tetrasomy 15
• Jacobsen syndrome, also called the terminal 11q deletion disorder.[42] This is a very rare disorder. Those
affected have normal intelligence or mild mental retardation, with poor expressive language skills. Most
have a bleeding disorder called Paris-Trousseau syndrome.
• Klinefelter's syndrome (XXY). Men with Klinefelter syndrome are usually sterile, and tend to have longer
arms and legs and to be taller than their peers. Boys with the syndrome are often shy and quiet, and have a
higher incidence of speech delay and dyslexia. During puberty, without testosterone treatment, some of
them may develop gynecomastia.
• Turner syndrome (X instead of XX or XY). In Turner syndrome, female sexual characteristics are present
but underdeveloped. People with Turner syndrome often have a short stature, low hairline, abnormal eye
features and bone development and a "caved-in" appearance to the chest.
• XYY syndrome. XYY boys are usually taller than their siblings. Like XXY boys and XXX girls, they are
somewhat more likely to have learning difficulties.
• Triple-X syndrome (XXX). XXX girls tend to be tall and thin. They have a higher incidence of dyslexia.
• Small supernumerary marker chromosome is an extra, abnormal chromosome. Features depend on the
origin of the extra genetic material. Cat-eye syndrome and isodicentric chromosome 15 syndrome (or
Idic15) are both caused by a supernumerary marker chromosome, as is Pallister-Killian syndrome.
http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/
20
Basics
Genetics
Epi-
Memory
Organism
A DN
-m A
ol i A
ec N
ul IM
e/ A
m T
ut IO
at N
io
n/
SC
(non-epigenetic – really?)
A
Chromosome (10/13)
• Erytrhocytes - Sickle Cell
Anemia (SCA)
D
N
Russel, Gene Control, 200?
Sickle Cell Anemia: J. Herrick (1910) first described sickle-cell anemia, finding that red blood
cells (RBCs) change shape (form a sickle) under low O2 tension.
Sickled RBCs are fragile, hence the anemia.
They are less flexible than normal RBCs, and form blocks in capillaries, resulting in tissue
damage downstream.
Effects are pleiotropic, including damage to extremities, heart, lungs, brain, kidneys, GI tract,
muscles and joints. Results include heart failure, pneumonia, paralysis, kidney failure,
abdominal pain and rheumatism.
Heterozygous individuals have sickle-cell trait, a much milder form of the disease.
V.M. Ingram (1956) found that the 6th amino acid of the β chain in sickle-cell hemoglobin is
valine (no electrical charge) rather than the negatively charged glutamic acid in the β chain of
normal hemoglobin. Outline of the genetics and gene products involved in sickle-cell anemia
and trait:
Wild-type β chain allele is βA, which is codominant with βS.
Hemoglobin of βA/βA individuals has normal β subunits, while hemoglobin of those with the
genotype βS/βS has β subunits that sickle at low O2 tension.
Hemoglobin of βA/βS individuals is 1⁄2 normal, and 1⁄2 sickling form. (The two β chains of an
individual hemoglobin molecule will be of the same type, rather than mixed.) These
heterozygotes may experience sickle-cell symptoms after a sharp drop in the oxygen
content of their environment.
People with one sickle hemoglobin gene and one normal hemoglobin gene (sickle cell trait) are
somewhat more resistant to malaria than people with two normal hemoglobin genes. The
widely accepted theory is that Hb S offers selective protection against falciparum malaria
probably because of induction of sickling even at physiological oxygen tension by
P.falciparum followed by sequestration of parasitized red cells deep with in reticuloendothelial system where microenvironment is hostile for parasite growth. Thus people with
sickle cell trait would have a better chance of surviving an outbreak of malaria and passing
their genes (sickle and normal hemoglobin) to the next generation when they have children
Source: http://en.wikipedia.org/wiki/Sickle_cell
"Sickle Cell Disease: History And Origin". The Internet Journal of Haematology.
http://www.ispub.com/ostia/index.php?xmlFilePath=journals/ijhe/vol1n2/sickle.xml
Basics
Genetics
Epi-
Memory
Organism
Chromosome (11/13)
OMIM - online
mendelian inheritance
in man :
• 18·E3 entries;
However:
• 2.3% are related to
mutations only
• 97.7% are risk
indicators!
NIH.gov 2008
12-06-13
Madl
22
OMIM (online mendelian inheritance in man) mit ca. 18·E3 Eintragungen hat gezeigt dass
fenotypische Krankheitserscheinungen nur in ca. 2.3% der der Faellle auch eine genotypischen
Grundlage haben! Alle anderen korrelieren nur insofern als dass es ein Risikofaktor darstell an
dieser oder jener Krankheit zu leiden: z.b. cystic fibrosis (CF)
But single-gene disorders affect less than two percent of the population; the vast majority of
people come into this world with genes that should enable them to live a happy and healthy life.
The diseases that are today's scourges - diabetes, heart disease and cancer -short circuit a happy
and healthy life. These diseases, however, are not the result of a single gene, but of complex
interactions among multiple genes and environmental factors …. What about all those headlines
trumpeting the discovery of a gene for everything from depression to schizophrenia? ….
Scientists have rarely found that one gene causes a trait or a disease ….
In fact, only 5% of cancer and cardiovascular patients can attribute their disease to heredity
[Willett 2002]. While the media made a big hoopla over the discovery of the BRCAI and
BRCA2 breast cancer genes, they failed to emphasize that ninety-five percent of breast cancers
are not due to inherited genes. The malignancies in a significant number of cancer patients are
derived from environmentally-induced epigenetic alterations and not defective genes [Kling
2003; Jones 2001; Seppa 2000; Baylin 1997] ….
Source: http://www.ncbi.nlm.nih.gov/sites/entrez?db=omim
Lipton B. (2005) Biology of Belief. Elite Books, p.51 & 72
22
Basics
Genetics
Epi-
Memory
Organism
Chromosome (12/13)
Preventable diseases :
diet and life-style, both
contribute to
• cardiovascular disease,
• cancers
• and other causes of death
evidence indicate that
environmental factors are
most important
Willett, 2002
12-06-13
Madl
23
In fact, only 5% of cancer and cardiovascular patients can attribute their disease to heredity
[Willett 2002]. While the media made a big hoopla over the discovery of the BRCAI and BRCA2
breast cancer genes, they failed to emphasize that ninety-five percent of breast cancers are not
due to inherited genes. The malignancies in a significant number of cancer patients are derived
from environmentally-induced epigenetic alterations and not defective genes [Kling 2003; Jones
2001; Seppa 2000; Baylin 1997] ….
Genetic and environmental factors, including diet and life-style, both contribute to cardiovascular
disease, cancers, and other major causes of mortality, but various lines of evidence indicate that
environmental factors are most important. Overly enthusiastic expectations regarding the benefits
of genetic research for disease prevention have the potential to distort research priorities and
spending for health. However, integration of new genetic information into epidemiologic studies
can help clarify causal relations between both life-style and genetic factors and risks of disease.
Thus, a balanced approach should provide the best data to make informed choices about the most
effective means to prevent disease (Willett).
Image: Percentage of colon cancer, stroke, coronary heart disease, and type 2 diabetes that is
potentially preventable by life-style modiÞcations. For colon cancer, the low-risk deÞnition
includes body mass index <25 kg/m2, physical activity equivalent to >30 min per day of brisk
walking, folic acid supplement of 100 mg per day or more, less than three alcoholic drinks per
day, lifetime nonsmoking, and fewer than three servings of red meat per week. For stroke
(unpublished data) and coronary heart disease, the low-risk deÞnition includes nonsmoking, a
good diet (incorporating low intake of saturated and trans fat and glycemic load and adequate
intake of polyunsaturated fat, N-3 fatty acids, cereal Þber, and folic acid), body mass index <25
kg/m2, physical activity equivalent to >30 min per day of brisk walking, and moderate alcohol
consumption. For diabetes, the low-risk deÞnition was similar to that for coronary heart disease
except that the dietary score did not include folic acid or N-3 fatty acids.
Source: Lipton B. (2005) Biology of Belief. Elite Books, p.51 & 72
Willett W.C. (2002) Balancing Life-Style and Genomics Research for Disease Prevention.
Science 296: 695 – 698
23
Basics
Genetics
Epi-
Memory
Organism
Chromosome (13/13)
…. Yet ….
• focus still on genes (e.g. SNP in forensic science)
• we keep finding disease-associated genes
• in polygenic inherited diseases only 30% probability
of phenotypic expression
• evidence assign epigenetics a far more significant role
that’s why the EU has launched
• EPIGENOME (follow-up project);
• overall costs: 5.3·E6 [€]
12-06-13
Madl
24
Single-nucleotide Polymorphism: Epigenetic markers and patterns are so important that
researchers are rallying to begin a project to create an elaborate human epigenome project to map
out the entire human epigenome.
Image: Beispiel einer SNP mit phänotypischen Folgen: Hier werden zwei identische
Chromosomen-abschnitte (SH2D1A Gen des X Chromosoms) von zwei Individuen (A und B)
verglichen. Eine SNP ist als Variation in einem Basenpaar dargestellt. Beim Individuum B ist
Cytosin (C) durch ein Thymin (T) ersetzt worden (rosarot). Dieser "single-nucleotide"-Austausch
führt zu einer Prädisposition für eine unkontrollierte Überproduktion von B- und T-Zellen nach
einer Infektion mit dem Epstein-Barr Virus (Burkitt-Lymphom). Man kennt zwischen 1.42 und
2.1 Millionen SNP's. Die SNP's sind sehr individuelle Informationen, mit deren Hilfe heute das
genetische "Fingerprinting" für Vaterschaftsfragen oder in der Kriminalistik durchgeführt wird.
Polygenie und multifaktorielle Erbleiden: Heute kennt man Krankheiten, die durch das
Zusammenwirken von verschiedenen Genen hervorgerufen werden. Solchen Krankheiten liegt
meist Polygenie oder multifaktorielle Vererbung zugrunde. Dagegen könnten bei bekannter
Disposition (genetische und Umwelt bedingte Faktoren) eventuell prophylaktische Massnahmen
ergriffen werden. Die Suche nach den zugrundeliegenden, prädisponierenden Genvariationen
sowie Zahl und Art der beteiligten Umweltfaktoren ist aber sehr schwierig, da solche
Krankheiten nicht den einfachen Mendel'schen Gesetzen folgen. Dies zeigt, dass bei vielen
komplexen Krankheiten zwar prädisponierende polygenetische Faktoren vorhanden sein müssen.
Diese Faktoren alleine genügen aber nicht, um die Krankheit bzw. Missbildung hinreichend
erklären zu können. Es müssen bei den einzelnen Familien noch Umweltfaktoren bzw.
Unterschiede in der Lebensführung dazukommen, die im einzelnen nicht bekannt sind.
Small Image: Multifaktorielle Ursachen für eine Krankheit. Das folgende Beispiel soll eine
Krankheit zeigen, die einerseits polygenisch verursacht und andererseits von Umweltfaktoren
beeinflusst ist. In epidemiologischen Studien wurde das Vorkommen der vier für diese Krankheit
verantwortlichen Genvarianten in der kranken Bevölkerungsgruppe bestimmt. Die Abbildung
zeigt, dass nebst der genetischen Prädisposition noch weitere Faktoren (Umwelt/Lebensstil) einen
Einfluss haben, damit eine Krankheit ausbricht. Im weiteren wird deutlich, dass Varianten des
Gens A den grössten Einfluss auf die Krankheit zu haben scheinen, sie jedoch nicht hinreichend
erklären können.
Source: http://www.embryology.ch/allemand/kchromaber/genom01.html
24
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (1/9)
A hereditary mix of:
• Classical genetics passing on the recipes
of the parent genome
• Epi-Genetics Paramutation
(contradicts Mendel’s 1st law)
• is initiated by Meiosis
i.e. life cycle via gametes,
reproduction of haploid cells, (n)
12-06-13
Madl
Conrood S., 2008
25
Epigenetische Veränderungen können von Zelle zu Zelle und – in gewissen Fällen – über noch
nicht verstandene Mechanismen auch über Spermium und Eizelle von den Eltern
an ihre Nachkommen übertragen werden. Nebst dem Erbgut selbst stellen sie
eine zweite Möglichkeit dar, Informationen über Generationen weiterzugeben.
Da epigenetische Veränderungen aber von externen Umweltgegebenheiten
beeinflusst werden können, sind sie weitaus weniger stabil als Veränderungen im
DNA-Code. Die Forschung beschäftigt sich zurzeit intensiv mit dieser
Reversibilität epigenetischer Veränderungen.
Epigenetic Reprogramming in the Murine Egg and Early Embryo: Once
ovulated, the terminally differentiated mammalian oocyte will die if it does not
bind and fuse with a sperm. If fertilization occurs, however, maternal gene
products orchestrate the transformation of the egg into a totipotent zygote within
hours. The mammalian egg is endowed with factors capable of reprogramming
terminally-differentiated, transcriptionally-inactive, germ cell nuclei into
totipotent embryonic nuclei within a short time period.In the course of
differentiation processes cells change their gene expression profiles drastically.
Source: http://www.med.cornell.edu/dgm/coonrod-lab.html
http://www.fz-borstel.de/cms/index.php?id=170&L=1
25
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (2a/9)
Gametogenesis & Methylation:
• Methylation in the germ line
• Methylation in preimplantation
embryos
Reik et al., 2001
12-06-13
Madl
26
In mammalian embryos there are two major cycles of epigenetic reprogramming of the genome:
during preimplantation development and during germ cell development. Reprogramming in germ
cells is necessary for imprinting; reprogramming in preimplantation embryos paradoxically can
interfere with imprinting and has shaped imprinting mechanisms. It is possible that both
demethylation cycles involve active demethylation, and it is crucial to identify the mechanisms.
Reprogramming mechanisms in preimplantation embryos affect epigenetic modifications and
genome function of cloned embryos. Sequences that escape reprogramming may be involved in
epigenetic inheritance. It is important to examine whether in addition to germ cells and early
embryos, reprogramming is also involved in stem cell differentiation.
Image:
(A) Methylation reprogramming in the germ line. Primordial germ cells (PGCs) in the mouse
become demethylated early in development. Remethylation begins in prospermatogonia on E16 in
male germ cells, and after birth in growing oocytes. Some stages of germ cell development are
shown [modified from (29)].
(B) Methylation reprogramming in preimplantation embryos (used for preimplantaion genetic
diagnosis – see below). The paternal genome (blue) is demethylated by an active mechanism
immediately after fertilization. The maternal genome (red) is demethylated by a passive
mechanism that depends on DNA replication. Both are remethylated around the time of
implantation to different extents in embryonic (EM) and extraembryonic (EX) lineages.
Methylated imprinted genes and some repeat sequences (dashed line) do not become demethylated.
Unmethylated imprinted genes (dashed line) do not become methylated.
(C) preimplantation genetic diagnosis (PGD) is a form of genetic diagnosis performed prior to
implantation. This implies that the patient’s oocytes should be fertilized in vitro and the embryos
kept in culture until the diagnosis is established …. (preimplantation embryos is used forPGD also
known as embryo screening, PIG) - (see wikipedia)
Source: Wolf Reik, Wendy Dean, Jörn Walter (2001). Epigenetic Reprogramming in Mammalian
Development. Science Vol. 293: 1089 – 1093.
http://en.wikipedia.org/wiki/Preimplantation_genetic_diagnosis#Technical_aspects_of_preimplantation_genetic_diagnosis
26
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (2b/9)
Fertilization:
• paternal / maternal
methylation
Reik & Walter, 2001
12-06-13
Madl
27
Methylation reprogramming in the germ line and embryo.The figure shows the
level of methylation in methylated (black) and non-methylated (grey) imprinted
genes and non-imprinted sequences (red = maternal; blue = paternal) during
germ-cell and early embryonic development. The horizontal time axis and the
vertical axis indicating the relative methylation levels are not to scale. (E,
embryonic day.)
Source: Wolf Reik & Jörn Walter (2001) Genomic imprinting: parental influence
on the genome. Nature Reviews Genetics 2, 21-32
27
Basics
Genetics
Epi-
Memory
Organism
• Prader-Willi Syndrome (prat.)
• Angelman Syndrome (mat.)
12-06-13
ae
ch
D
as
G
ed
Epigenetics and Disease:
genomic modifications can be
passed on – “Epigenetic marks
tn Vid
is e o
de
rG
en
e(
12
:0
0
-1
3:
30
)
Life Cycle (2c/6)
Madl
28
In the imprinted region on human chromosome 15, small deletions were found in patients with
Prader–Willi syndrome (PWS) in the promoter region of SNURF–SNRPN,and a few kilobases
upstream of this, deletions were found in patients with Angelman syndrome (AS). PWS requires
paternal transmission of the deletion, whereas AS requires maternal transmission. The intriguing
feature of these deletions is that they lead to altered expression and altered methylation patterns
of many of the imprinted genes in the region, even if the genes are separated from the deletions
by several megabases. This is defined as ‘EPIGENOTYPE spreading’. In the PWS deletions,
when paternally transmitted, otherwise paternally expressed genes are silenced and methylated.
In the AS deletions with maternal transmission, genes that are otherwise repressed are now
demethylated and expressed.
Independent of primary gene sequence, there are genomic modifications that can be passed on
from the parental environment – “Epigenetic marks. Both of these genetic disorders are caused
by deletion of up to 4Mb on chr.15. Primary genes affected are: SNRPN (small nuclear
ribonucleoprotein polypeptide N) , NDN (necdin), MKRN3 (makorin), IPWS (imprinted in
Prader-Willi syndrome)
Prader-Willi Syndrome (abnormal father copy) del-15q11.2-13
Angelman Syndrome (abnormal mother copy) del-15q11.2-13
Deletions account for ~70%, and always of the paternal chromosome. 28% are uniparental
disomy*, always maternal, with NO genomic deletion. 2% are small mutations on the paternal
side, affecting the whole region (*usually follows trisomic rescue – 47 chromosomes in fertilised
ovum, one lost on cell division - correction by two mistakes)
However, the syndromes differ:
Prader-Willi Syndrome (PWS): obesity, muscular hypotonia, mental retardation, short
stature, hypogonadism, small limbs.
Angelman Syndrome (AS): uncontrollable laughter, jerky movements, and other motor and
mental symptoms.
Source: Wolf Reik & Jörn Walter (2001) Genomic imprinting: parental influence on the genome.
Nature Reviews Genetics 2, 21-32
28
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (2d/6)
-2
1:
40
19
:4
0
tn Vid
is e o
de
rG
en
e(
• in vitro fertilisation by
intracytoplasmic sperm
injection: girls maintained
paternal imprint
• 9% of all IVF compared to
• 4.2% naturally conceived
)
PW-AM-Syndrome:
D
as
G
ed
ae
ch
Gene de-/activation by exposure to light and artificial environment (petri dish)
• Hansen M, Kurinczuk JJ, Bower C, Webb S., 2002
12-06-13
Madl
29
Hansen M, Kurinczuk JJ, Bower C, Webb S., 2002;New England Journal of Medicine 346: 725730;
The risk of major birth defects after intracytoplasmic sperm injection and in vitro fertilization
Following
ICS, 26/301 (8.6%) ICS = intracytoplasmic sperm injection
and
IVF, 75/837 (9.0%) have major birth defects
compared with 168/4000 naturally-conceived infants (4.2%)
Assisted reproductive technology (ART) often required for sperm malfunction, but Angelman (for
example) which has increased incidence following IVF/ICS is a result of loss of maternal
methylation? Increased risk more a reflection of in vitro culture effects?
29
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (3/9)
Gametes:
• Haploid
spermatocyte
(4 x 40µm)
• Halpoid oocyte
(~100µm)
12-06-13
Madl
30
Once ovulated, the terminally differentiated mammalian oocyte will die if it does
not bind and fuse with a sperm.
30
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (4a/9)
Fertilization:
• fusion of haploid
gametes
• diploid zygote (2n)
12-06-13
Madl
31
If fertilization occurs, however, maternal gene products orchestrate the
transformation of the egg into a totipotent zygote within hours.
31
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (4b/9)
Fertilization:
• fusion of haploid
gametes
• diploid zygote (2n)
…. most important
• Zygote is totipotent (!)
12-06-13
Madl
32
32
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (5/9)
Organizer & Inducer during Individuation:
1. Blastomere stage
2. Induction of central axis
3. Hensen’s graft experiment
and Waddingtons deduction of the Organizer
Image: Graft of a duck node (indicated by an arrowhead) onto a chick blastoderm
Slack, 2002
12-06-13
Madl
33
Waddington showed that the grafting of a duck node onto an early chick embryo (at the
blastoderm stage) could induce the formation of a second body axis. The most celebrated of his
experiments was one on duck embryos in which he joined two blastoderms face to face and
showed that each Hensen's node induced another primitive streak in the adjoining blastoderm ….
Although, in his day, it was difficult to distinguish the graft from the host and hence determine
exactly which parts had been induced, this could be done to some extent on the basis of the size of
cells from the different species used. Waddington's conclusions on the organizer-like role of
Hensen's node proved essentially correct, but in my view he was not credited sufficiently when
interest in this question was re-awakened in the 1990s.
The modern equivalent of 'individuation' is the formation of many specified regions in response to
a concentration gradient of the inducer, to which the responding tissue has several threshold
responses (Dalcq & Pasteels, 1937) …. In the case of Waddington and the Needhams, it was later
known found that the neural-inducing activity ('the evocator') are related to steroids …. growth
factors, present in picomolar concentrations.
Image: Top - Graft of a duck node (indicated by an arrowhead) onto a chick blastoderm. The
original embryo body is on the left, and the induced secondary embryo is on the right. Bottom The neural tube of the secondary embryo — a cylindrical structure that runs through the midline
of the embryo — can be seen clearly in the section on the right.
Source: Slack J.M.W. (2002) Conrad Hal Waddington: the last Renaissance biologist? Nature
Reviews Genetics 3, 889-895.
33
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (6/9)
en N a
op t u
us re
-v
id
eo
Omnipotence of
the
totipotent
zygote in embry.
development
of
the frog Xenopus
laevis
X
long-distance
communication of
MFG in developmental biology
De Robertis , 2006
12-06-13
Madl
34
The entire early embryo constitutes a self-differentiating morphogenetic field, in
which cells communicate with each other over great distances. This is
demonstrated by experiments such as the one shown here, in which an African
clawed frog (Xenopus laevis) embryo was cut into two halves at the blastula
stage. If it is ensured that both halves contain part of the dorsal organizer region,
two perfect identical twins are obtained (an intact sibling is shown at the top of
the figure). In humans, identical twins are found in 3 out of 1,000 live births, and
arise most frequently by the spontaneous separation of the inner cell mass of the
mammalian blastula into two, followed by self-regulation. The ultimate example
of self-regulation is provided by another mammal, the nine-banded armadillo, in
which every blastocyst gives rise to four genetically identical siblings. Note that
each twin is longer than just half the length of the intact sibling, which represents
yet another effort to regulate towards the normal pattern. Both half-embryos
shown here are derived from the same blastula.
The movie starts with photos of Hans Spemann and Hilde Mangold circa 1924. Next, it shows the author at the dissection
microscope. Two embryos can be seen, one of which has the dorsal blastopore lip, the Spemann's organizer, clearly visible
as a crescent. With the help of a tungsten needle and forceps, a square of organizer tissue is excised — the operation is
done free-hand. The organizer is pushed into the ventral side of a recipient gastrula with an eyebrow hair. One hour after
transplantation, the graft has, almost miraculously, healed into the host embryo. Two days later, a Siamese twin has
developed with two perfect body axes. The Spemann's organizer graft induced complete central nervous systems and
mesodermal somites in tissues of the host that would otherwise have become ventral tissue.
Source: De Robertis E.M.; 2006; Spemann's organizer and self-regulation in amphibian embryos;
Nature Reviews Molecular Cell Biology 7, 296-302;
http://www.nature.com/nrm/journal/v7/n4/fig_tab/nrm1855_F1.html
34
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (7/9)
Fertilization:
• the totipotent zygote
• dedifferentiation into the 3 main dermal
layers (ecto-, meso-, endo-,) and germ
line
• and their associated specialized somatic
cells (environment makes sure that liver
cells are produced where liver cells are
needed)
Lab for functional genomics, 2008
12-06-13
Madl
35
Epigenetic Reprogramming in the Murine Egg and Early Embryo: maternal gene
products orchestrate the transformation of the egg into a totipotent zygote within
hours.
The mammalian egg is endowed with factors capable of reprogramming
terminally-differentiated, transcriptionally-inactive, germ cell nuclei into
totipotent embryonic nuclei within a short time period. In the course of
differentiation processes cells change their gene expression profiles drastically.
The central Dogma: a photocopy of the “recipe book” (genetic code) – every cell
of a body has a complete set of this code (holographic memory), only the
environment determines which pages of this code are read for the appropriate
function (liver cell has to express liver-associated function, proteins, etc, not
muscle associated information).
• a specialized cell will only activate the appropriate information of this recipe
book (i.e. chapter of the liver);
• a stem-cell can specialize into any cell – therefore is pluri-potential;
Das genom einer jeden Zelle ist im gesamten Organismus identisch – nur wird lokal ein kleiner
Anteil davon zum Fenotypus expremiert (Hautzelle – hautrelevante Gene, Leberzelle leberrelevante Gene, etc.)
Source: http://www.med.cornell.edu/dgm/coonrod-lab.html
http://www.fz-borstel.de/cms/index.php?id=170&L=1
35
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (8/9)
Fertilization:
• the methylated zygote
Reik & Walter, 2001
12-06-13
Madl
36
Imprints are 'established' during the development of germ cells into sperm or
eggs. After fertilization, they are 'maintained' as chromosomes duplicate and
segregate in the developing organism. In the germ cells of the new organism,
imprints are 'erased' at an early stage (but later on re-established!). This is
followed by establishment again at a later stage of germ-cell development, thus
completing the imprinting cycle. In somatic cells, imprints are maintained and are
modified during development. For example, methylation may spread from an IC
into the promoter. The imprints are eventually read, resulting in parent-specific
gene expression
Image: Life cycle of methylation imprints. Erasure, establishment and
maintenance of methylation imprints at imprinting centres during germ cell and
embryonic development. Imprinting control elements 1 (IC1) and IC2 are shown
as examples (see chromosome 11p15.5 in FIG.1). Grey indicates modification
and white indicates no modification at the corresponding alleles. Parental
chromosomes are marked according to their sex in blue (male) or red (female).
The reading (transcriptional interpretation of the primary imprints) in the
developing embryo is indicated by arrows.
Source: Wolf Reik & Jörn Walter (2001) Genomic imprinting: parental influence
on the genome. Nature Reviews Genetics 2, 21-32
36
Basics
Genetics
Epi-
Memory
Organism
Life Cycle (9/9)
Attempts to create an EpiGenomic Map
• red T.: maternally imprinted
• blue T.: paternally -”• black T.: bi-allelically -”-
Luedi et al., 2007
12-06-13
Madl
37
Particular attention is applied to understand how variations in genetic instructions
result in human disease and to discover …. inheritable changes in gene
expression patterns that are not due to changes in DNA sequence. Such
epigenetic regulations are important mechanisms that organisms use to change
gene expression patterns and directly correlate with disease occurrence.
So far, more than 40 imprinted genes have been found; about half are expressed
when they come from the father and half when they come from the mother.
Among these are a number of disease genes, including the necdin and UBE3A
genes on chromosome 15 that are involved in Prader-Willi and Angelman
syndromes, and possibly p73, a tumor suppressor gene involved in the brain
cancer neuroblastoma. Seven, including Peg3 and Igf2, affect embryonic growth
or are expressed in the placenta.
Image: Genome-wide distribution of imprinted genes proved (filled triangles) or
predicted with high confidence (unfilled triangles) to be imprinted. Red
downward triangles, blue upward triangles, and black dots indicate genes
predicted to be maternally, paternally, or biallelically expressed, respectively.
Light blue bars highlight a 3-Mb region centered on the linkage regions presented
in Supplemental Table 6.
Source: Philippe P. Luedi, Fred S. Dietrich, Jennifer R. Weidman, Jason M. Bosko, Randy L.
Jirtle, & Alexander J. Hartemink (2007). Computational and experimental identification of novel
human imprinted genes. Genome Research Vol.17:12: 1723-1729.
37
Basics
Genetics
Epi-
Memory
Organism
Cell Cycle (1/7)
The Eukaryotic
Cell:
• Plant vs.
• Animal
again:
every cell possesses an
entire copy of the
genome (holographic
principle) – only the
closer environment
determines fate of cell.
12-06-13
Madl
38
Generalized features of higher plant and animal cells are:
a. A plasma membrane encloses the cytoplasm in both.
b. Plant cells have a rigid cell wall.
c. In both, the nucleus contains DNA complexed with proteins and organized into chromosomes.
d. The nuclear envelope is two layers of semipermeable membrane with pores that allow
movement of materials (e.g., ribosomes) between nucleoplasm and cytoplasm.
e. The cytoplasm contains many materials and organelles. Important in genetics are:
i. Centrioles (basal bodies) are in cytoplasm of nearly all animals, but not in most plants. In
animals, a pair of centrioles is associated with the centrosome region of the cytoplasm
where spindle fibers are organized in mitosis or meiosis.
ii. The endoplasmic reticulum (ER) is a double membrane system that runs through the cell.
ER with ribosomes attached collects proteins that will be secreted from the cell or
localized to an organelle.
iii. Ribosomes synthesize proteins, either free in the cytoplasm or attached to the
cytoplasmic side of the ER.
iv. Mitochondria are large organelles surrounded by double membrane that play a key role
in energy processing for the cell. They contain their own DNA encoding some
mitochondrial proteins, rRNAs and tRNAs.
v. Chloroplasts are photosynthetic structures that occur in plants. The organelle has a triple
membrane layer, and includes a genome encoding some of the genes needed for organelle
functions.
Every cell possesses an entire copy of the genome (holographic principle) – only
those genes according to the environmental context are expressed.
38
Basics
Genetics
Epi-
Memory
Organism
Cell Cycle (2/7)
Genes are only puppets.
Assorted proteins and RNAs pull the strings, telling the genes when and where
to turn on or off – like switches
(Science 293:1064)
Bookmarking
cell regeneration via meiosis
play a crucial part in it;
12-06-13
Madl
39
Source: Mae Wan Ho – The Rainbow and the colors of the Rainbow – Physics of Organism, 1998;
39
Basics
Genetics
Epi-
Memory
Organism
Cell Cycle (3/7)
Cell Cycle & Mitosis:
• Mitosis (somatic cell cycle)
growth, development, aging
(diploid cells, 2n, almost no
crossing over)
• not to be confused with Meiosis
(life cycle via gametes via
reproduction of haploid cells, n)
Postlethwait & Hospon, 1995
12-06-13
Madl
40
The cell cycle, or cell-division cycle, is the series of events that take place in a cell leading to its
division and duplication (replication). In cells without a nucleus (prokaryotes), the cell cycle
occurs via a process termed binary fission. In cells with a nucleus (eukaryotes), the cell cycle can
be divided in two brief periods: interphase—during which the cell grows, accumulating nutrients
needed for mitosis and duplicating its DNA—and the mitosis (M) phase, during which the cell
splits itself into two distinct cells, often called "daughter cells". The cell-division cycle is a vital
process by which a single-celled fertilized egg develops into a mature organism, as well as the
process by which hair, skin, blood cells, and some internal organs are renewed.
Both unicellular and multicellular eukaryotes show a continous cell cycle, with growth, mitosis
and cell division.
a. The cycle of somatic mitosis is determined by the Interphase and is composed of:
(1) Gap 1 (G1) when the cell prepares for chromosome replication.
(2) Synthesis (S) when DNA replicates and new chromosomes are formed.
(3) Gap 2 (G2) when the cell prepares for mitosis and cell division.
b. Relative time in each phase varies among cell types, with duration of G1 generally the deciding
factor. Some cells exit G1 and enter a nondividing state called G0.
c. Interphase chromosomes are elongated and hard to see with light microscopy. Sister chromatids
are held together by replicated but unseparated centromeres. The chromatids become visible in
prophase and metaphase of mitosis. When the centromeres separate, they become daughter
chromosomes
The 25,000 genes of our human DNA are widely considered to be an instruction book for our
bodies. However, “genes themselves need instructions for what to do, and where and when to do
it.” These additional instructions are not in DNA, but on it, in an array of chemical markers and
switches, known collectively as the epigenome, that lie along the length of the double helix.
These epigenetic switches and markers in turn help switch on or off the expression of particular
genes. It has long been known that epigenetic switches are critical to the healthy development of
organisms. These can be dramatically tweaked by exposure to a vitamin, a toxin or even
mothering, altering “the software of our genes in ways that affect an individual’s body and
brain for life.” Green tea, for example, has been shown to prevent the growth of cancers.
Source: Lipton B. (2005) Biology of Belief. Elite Books
40
Basics
Genetics
Epi-
Memory
Organism
Cell Cycle (4/7)
Mitosis:
• Interphase: duplication of DNA;
• Prophase: centriole migration;
• Metaphase: chromosome line-up;
• Anaphase: chromatids separation;
• Telophase: cytoplasmic division;
12-06-13
Madl
41
Mitosis is the process in which a eukaryotic cell separates the chromosomes in its cell nucleus,
into two identical sets in two daughter nuclei. It is generally followed immediately by
cytokinesis, which divides the nuclei, cytoplasm, organelles and cell membrane into two
daughter cells containing roughly equal shares of these cellular components. Mitosis and
cytokinesis together define the mitotic (M) phase of the cell cycle - the division of the mother
cell into two daughter cells, genetically identical to each other and to their parent cell.
Mitosis: somatic cells (PMAT): Daughter cells have the same number of chromosomes as the
parent cell.
•
Interphase: DNA duplication to form chromatids just before mitosis;
•
Prophase: chromosomes condense, centriole replication & migration, mitotic spindle forms;
nuclear envelope breaks down; nucleoli in nucleus cease to be discrete areas; Kinetochores
form on the centromeres and become attached to kinetochore microtubules;
•
Metaphase: chromosomes line up in centre, chromatids still joined at centromere; nuclear
envelope completely gone; kinetochore microtubules orient the chromosomes with their
centromeres in a plane between the spindle poles, the metaphase plate; a protein scaffold
causes the chromosomes to reach a highly condensed state;
•
Anaphase: chromatids separate (disjunction) and progeny chromosomes move toward
opposite poles by kinetochore microtubules; shape of the chromosomes moving toward the
poles is defined by their centromere locations; cytokinesis usually begins near the end of
anaphase.
•
Telophase starts when migration of progeny chromosomes is completed; chromosomes begin
to uncoil and form interphase chromosomes; cytoplasm divides (nuclear envelope forms
around each chromosome group); spindle microtubules disappear; nucleoli reform; nuclear
division is complete. Cytokinesis is division of the cytoplasm, compartmentalizing the new
nuclei into separate daughter cells.
41
Basics
Genetics
Epi-
Memory
Organism
Cell Cycle (5/7)
Cell Cycle
12-06-13
Madl
42
DER REGELKREIS VON WACSHTUM UND DIFFERENZIERUNG: Modell von W.Nagl und
F.A. Popp zur deutung der regulation in zellverbänden auf der fysikalischen (links) und auf der
zellulären ebene (rechts). M, G0, G1, G2 und S sind die fasen des zellzyklus. Zellen und
zellverbände durchlaufen demnach einen regelkreis der vom wechselspiel zwischen ordnung und
chaos im biofotonen-feld gesteuert wird. Die entdifferenzierung des zellgewebes …. durch
chaotische impulse verursacht ….führt zelle oder zellverband in einen aktiven, weniger
geordneten zustand, der …. von wärmeaufnahme und verstärkter biofotonen-emission begleitet
ist. Kohärente externe und interne impulse …. von der »nahrung« …. führen verband oder zelle
wieder zurück in hochgeordnete (höher differenzierte) fasen, gekennzeichnet durch
wärmeabgabe und verstärkte biofotonen-aufnahme. In dieser etappe dehnt sich die intra- und
interzelluläre kommunikation auf immer weitere bereiche aus. Biochemisch sind diese fasen
inaktiv. Das gewebewachstum, das der » chaotischen« fase vorbehalten bleibt, wird in der
geordneten fase gestoppt.
…. Damit der zellverband wachsen kann müssen dich zellen teilen. Zellen können sich aber nur
im embryonalen, entdifferenzierten zustand teilen. Hochdifferenzierte, spezialisierte zellen
wachsen und teilen sich dagegen kaum noch (mitose geht überwiegend nur bei stammzellen) ….
Bei einem hochkohärenten feldzustand bei dem in den DNS-molekülen exciplexe aktiv sind,
befinden sich die zellen eines verbandes im durchschnitt in der »G0-fase« des zellzyklus ….
Dann zerfallen im G1-stadium, ausgelöst durch chaotische impulse (z.b. sterbende zellen) die
bedeuten dass der zellverband informationen verliert …. Das feld wird immer chaotischer,
inkohärenter; eine stark erhöhte biofotonen-ausstrahlung ist jetzt aussen messbar: Gurwitsch
»degenerationsstrahlung«.
Durch dieses chaotische feld erhalten die teilungsbereiten zellen im verband den impuld zur
entdifferenzierung und teilung. Diese zellen müssen entkoppelt sein …. nur inkohärente fotonen
können wachstumnssignale sein.
Gleichzeitig werden im G2-stadium, durch zufuhr geordneter energie aus der nahrung die
exciplexe wieder aufgebaut.
Dadurch kondensiert das chromatin. Jetzt wird auch die DNS verdoppelt, und die eigentliche
zellteilung beginnt (M-fase) …. Die mitosespindel wird aufgebaut, der kern geteil und
schliesslich bilden sich zwei tochterzellen …
Source: Bischof M. (1995) Das Licht in unseren Zellen. 2001-Verlag: p.257
42
Basics
Genetics
Epi-
Memory
Organism
Cell Cycle (6/7)
Maintenance of methylation
• mitotic sub-division of
stem cells (i.e. tissue
regeneration);
• during transcription
genome duplication;
of
Reik & Walter, 2001
12-06-13
Madl
43
DNA methylation in mammals occurs in the dinucleotide CpG. Methyl groups
can be introduced into unmethylated DNA by the de novo methylation enzymes
Dnmt3a and Dnmt3b (and perhaps others). When DNA is replicated, the methyl
group on the template strand is recognized and a new one is introduced on the
opposite (daughter) strand by the enzyme Dnmt1, which can be associated with
the replication machinery. In the presence of Dnmt1, hemi-methylated DNA
becomes fully methylated and so DNA methylation patterns tend to be
maintained (maintenance methylation). Demethylation can occur in the absence
of Dnmt1 with continued rounds of DNA replication (passive demethylation), as
well as actively (without DNA replication). The nature of demethylases is
unknown.
Source: Wolf Reik & Jörn Walter (2001) Genomic imprinting: parental influence on the genome.
Nature Reviews Genetics 2, 21-32
43
Basics
Genetics
Epi-
Memory
Organism
Cell Cycle (7/7)
Growth & Protection:
• humans consists of ~80E12 cells
• millions of cells replaced daily
following a 24hr circadian clock
• replacement during phases of rest –
e.g. sleep
Merrow & Roennenberg, 2004
12-06-13
Madl
44
Growth and protection mechanisms are the fundamental behaviors required for an organism to
survive …. Every day billions of cells in your body wear out and need to be replaced. For
example, the entire cellular lining of your gut is replaced every seventy-two hours ….
It turns out that the mechanisms that support growth and protection cannot operate optimally at
the same time. In other words, cells cannot simultaneously move forward and backward …..
[Lipton, et al, 1991].
Chronic inhibition of growth mechanisms severely compromises your vitality …. In a growth /
protection continuum, eliminating the stressors only puts you at the neutral point in the range. To
fully thrive, we must not only eliminate the stressors but also actively seek joyful, loving,
fulfilling lives that stimulate growth processes.
Image: The ‘two process’ model for sleep can be extended to cell cycle regulation. Circadian
oscillations continue with a 24 hour period (2 cycles or days are shown for each panel) over a
variety of conditions, creating oscillating upper and lower thresholds for sleep propensity or the
cell cycle (A). The second process is characterized by stages, and the time it takes to complete a
stage can be modified by changing thresholds (A versus B or C) or by changing rates (A versus D
or E). Even in the absence of obvious circa 24 hour gating, the circadian clock can be modulating
the second process, namely, sleep or the cell cycle. The stages of the cell cycle are arbitrarily
designated here by blue, red, green and yellow, for G1, S, G2 and M, respectively.
Source: Lipton B.H., Bensch K.G., Karasek M.A. (1990). Microvessel endothelial cell
transdifferentiation: phenotypic characterization. Differentiation, Volume 46 Issue 2, Pages 117 –
133 (http://www3.interscience.wiley.com/cgi-bin/fulltext/119354142/PDFSTART)
Merrow M. & Roenneberg T. (2004) Cellular Clocks: Coupled Circadian and Cell Division
Cycles. Current Biology, Vol. 14, R25–R26
44
Basics
Genetics
Epi-
Memory
Organism
Memory-Effect
12-06-13
Madl
0
0
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (1/15)
Maturana & Varela (1969):
(i)
(i)
(i)
12-06-13
"What is the organization of the living?"
&
“What takes place in the phenomenon of
perception?“
Humberto Maturana
Francisco Varela
the answer to these questions in fact is the same
and expresses the basic identity of "life" and of
"cognition“ (characteristic of "autopoietic"
systems).
Madl
1
What I wish to emphasize here is that this paradigm bears a privileged
relationship to the biology of autopoiesis. Maturana (1980) has recounted his
long search for answers to two questions:
(i) "What is the organization of the living?" and
(ii) "What takes place in the phenomenon of perception?";
and his realization, in 1969, that the answers to the two questions both involved a
basic circularity and were, in fact, the same. The term "autopoiesis" was coined
by Maturana and Varela (1980), quite explicitly in order to express this basic
identity of "life" and of "cognition".
Der chilenische Neurobiologe Maturana berichtet, dass er während seiner
akademischen Lehrtätigkeit häufig mit zwei Fragen konfrontiert war (Maturana
und Varela, 1980): Erstens, was macht die Organisation lebender Systeme aus
und zweitens, was spielt sich beim Phänomen der Wahrnehmung ab?
Maturana kam schließlich zur Einsicht, dass sowohl biologische
Selbstorganisationsvorgänge als auch Wahrnehmungakte, in deren Verlauf
sich ein Organismus Kenntnis seiner Umwelt verschafft, auf ein und denselben
Prozessen beruhen müssen. Diese Einsicht führte zur Theorie ‚autopoietischer
Systeme’, mit der die Beziehung zwischen Erfahrung und Selbstkonstitution
eines Organismus ins Zentrum einer neuen Betrachtungsweise gestellt wurde, die
sich von traditionellen Vorstellungen deutlich unterschied ….
Source: Falkner G. & Falkner R. (2009) Die Bedeutung der Philosophie von Alfred North
Whitehead für eine neue Sichtweise in der Biologie, in press
1
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (2/15)
Alfred North Whitehead
• Process & Reality (1929)
• Therein, he operates with the concept of
Perception & Experience (Wahrnehmung)
• Organismic Philosophy should be applicable
to all orgamisms
• this aspects is of fundamental importance to
autopoietic systems
A.N. Whitehead, 1861-1947
12-06-13
Madl
2
Die Auswirkungen dieser neuen Sichtweise auf die Biologie sind noch nicht
abzusehen. Konsequent zu Ende gedacht, führt sie notwendigerweise zu der
Vorstellung, dass die Evolution der Arten nicht auf deterministischen Vorgängen
wie Mutation und Selektion beruht, sondern auf einem Netzwerk von
interdependenten und immer komplexer werdenden Welterfahrungen. Diese
Sichtweise befruchtet derzeit nur die Arbeit einer kleinen Gruppe von
theoretischen Biologen und Naturphilosophen. Ihr Erfolg wird entscheidend
davon abhängen, ob es gelingt, den vom Materialismus geprägten
Substanzbegriff zu überwinden, der die Biologie noch immer dominiert und der
biologische Entwicklungen auf eine Veränderung von Komponenten reduziert,
zwischen denen nur äußere Beziehungen existieren.
Eine zeitgemäßere Vorstellung der Wirklichkeit liefert die ‚organismische
Philosophie’ von Alfred North Whithead, die mit einem Erfahrungsbegriff
operiert, der für alle Organismen Gültigkeit haben soll und daher nicht von
Interpretationen ausgehen darf, mit denen der Mensch sich in der von ihm selbst
erfahrenen Wirklichkeit zurechtfindet. Aus diesem Grund war Whitehead
gezwungen, eine Terminologie zu schaffen, die üblicherweise von
Naturwissenschaftlern nicht verwendet wird. Es erscheint daher sinnvoll,
zunächst die für die Biologie relevanten Teile dieser Terminologie kurz
darzustellen, bevor versucht werden kann, auf der Basis der Philosophie von
Alfred North Whitehead zu einem erweiterten Verständnis biologischer
Selbstorganisationsvorgäge zu kommen, das die Dimension des Geistigen in der
Natur berücksichtigt und sich von überholten mechanistischen Vorstellungen
absetzt.
2
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (3/15)
Actual Entities or Actual Occasions’
• ‘actual entities’ or ‘actual occasions’
(circle in center) are acts of perception
• past-cone: indefinite sub-regions leaving
no empty space in-b/w.
• region “a“ prehends ist past from region
“b, g, e, g, x …“
• Interdependence of adaptive events (acts
of experience can‘t exist independently
from each other).
• are intrisically embeded in a historic
context.
Whitehead, 1929: 18
12-06-13
Madl
3
A 2-dimensional diagram of a 4-dimensional reality. The arrow represents the time line, so that the remaining dimension
on the sheet of paper represents the three dimensions of space.
Circle "a" divides two "cones," the one with thick lines to the left representing the past for the new actual entity, and the
one with thin lines to the right representing the future. Each cone, past and future, extends indefinitely; neither has a base.
The past-cone is divided into regions, which in the diagram are arbitrarily drawn and labelled as region "b," region "g,"
region "d," etc. There is no "empty space" between the regions, and there is an indefinite number of such regions extending
indefinitely into the past.
The new actual entity, which we will call A, exists throughout the entire left-hand cone, including region "a." Region "a" is
the position from which the new concrescence prehends its past. Regions "b," "g," "f," "S," "d," etc. all fall into A’s past
and, thus, are parts of the very identity of the new actual entity A.
We can also imagine past actual entities B, G, F, S, D, and so forth. Actual entity B would prehend its past from region
"b." Actual entity G would prehend its past from region "g," and so forth. It would make the diagram quite messy, but we
could draw cones for each of the past actual entities. For example, we could draw a "past cone" for actual entity B to the
left of region "b" and a "future cone" to the right of region "b." Region "f" would be a part of B’s past, while region "a"
would be in its future.
The key points to note are these: (a) actual entity A is not limited to "a," but exists in all the regions in the left-hand cone;
thus (b) actual entity A is a four dimensional reality that includes the indefinite past regions as a part of what it is; (c)
actual entity A not only includes the past regions but it includes the past actual entities as a part of its very identity Thus, A
not only exists in regions "b," "f," etc., but it also includes actual entities B, F, etc. as parts of its own identity. Or to be
more precise, A must include at least some aspects of B, F, etc. The past is a part of the very identity of A. The same
analysis holds true of actual entity B. Actual entity B not only is located in region "b" but also exists throughout every
region in its past. In addition, B must include actual entity F and its other past actual entities within its own identity; (d)
while the past is part of the very identity of the concrescing actual entity, the same is not true of the future. Consider the
case of actual entity A. For A, the future regions are purely potential, that is, potential sites from which future actual
entities will prehend their worlds. While A will prehend the future regions as potentials, it will not (in any direct sense)
prehend the actual entities that will occupy them. The reason is simple: the future actual entities do not exist when A
concresces.
Source: Stephen T. Franklin (2000) God and Creativity: A Revisionist Proposal within a Whiteheadian Context Process
Studies, pp. 237-307, Vol. 29, Number 2, Fall-Winter, 2000. (http://www.religion-online.org/showarticle.asp?title=3011)
3
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (4/15)
Actual Entities (AE) & Actual World
• ‘actual world’: perceivable data derive
from AEs themselves;
• AEs on the left were finalized in the
past
• results of these AEs are perceivlable in
new environmental AEs
• a coherent act of perception is
established as an ‘acts of becomming‘
Whitehead, 1929: 18, 28, 65, 69
12-06-13
Madl
4
Whitehead bezeichnet in seinem Hauptwerk Process and Reality die letzten realen Dinge,
aus denen die Welt zusammengesetzt ist, als ‚actual entities’ oder ‚actual occasions’
(Whitehead, 1929/1978, S. 18). Die Verwendung des zweiten Ausdrucks, der für
‚aktuelle Gelegenheiten des Erfahrens’ steht, soll der Tatsache gerecht werden, dass es
sich bei diesen Entitäten um Erfahrungsakte handelt, die nicht unabhängig
voneinander existieren, sondern in einem geschichtlichen Zusammenhang stehen. Die
Verwendung eines Begriffs von Erfahrung, von dem alles abstrahiert wurde, das
üblicherweise mit der Erfahrung höherer Organismen assoziiert wird, erlaubt es
Whitehead, die Welt als ein Netzwerk von Erfahrungsakten zu begreifen, bei denen die
nachfolgenden Erfahrungen den Ertrag der vorangegangen als Daten übernehmen.
Alle erfahrbaren Daten stammen somit ebenfalls von ‚actual entities’, bei denen
allerdings die Erfahrungsakte zu einem Abschluß gekommen sind und deren Ergebnis
neuen Erfahrungsakten als Umwelt (‚actual world’, Whitehead, 1929/1978, S. 28, 65)
dient.
Dadurch kommt eine gerichtete Beziehung zwischen Erfahrungsakten zustande. Die
Daten der erfahrenen Entitäten stehen zunächst getrennt zur Verfügung, werden aber im
Verlauf eines neuen Erfahrungsaktes verändert und und in einer ‚Konkreszenz’ (siehe
unten) so aufeinander abgestimmt, dass eine kohärente Welterfahrung entsteht. Auf diese
Weise sind Erfahrungsakte Akte des Werdens (‚acts of becoming’, Whitehead,
1929/1978, S. 69), denen Whitehead einen zeitlich-vektoriellen Übergang von einem
realen Außereinander der Komponenten in eine ideelle Einheit verleiht: „’becoming’ is
the transformation of incoherence to coherence, and in each particular instance ceases
with this attainment (Whitehead 1929/1978, S. 25)“.
4
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (5/15)
Act of Becomming & Emotion
• creative interpretation of “his“
environment;
• each AE is an act of experience,
a process of ‘feeling’ the data
to absorb them into a unity
to meet individual satisfaction;
• transformation of incoherence to
coherence leads to perception;
• itself generates new sets of data,
which are passed on to others;
Whitehead, 1929: 60
12-06-13
Madl
5
Diese Akte des Werdens führen in einem Prozess des ‚Empfindens’ der vielen
Daten zur Emergenz eines empfindenden Subjekts, das mit einer kreativen
Interpretation ‚seiner’ Umwelt sich selbst konstituiert und dadurch eine äußere
Form gibt, die dann als ‚Datum’ anderen Erfahrungsakten vererbt wird und für
deren Selbstkonstitution zur Verfügung steht: „Each actual entity is conceived as
an act of experience arising out of data. It is a process of ‘feeling’ the many data,
so as to absorb them into the unity of one individual satisfaction (Whitehead,
1929/1978, S. 40)”.
Acts of Becomming: ’becoming’ is the transformation of incoherence to
coherence, and in each particular instance ceases with this attainment …. that
process leads to acts of PERCEPTION (Whitehead, 1929: 25)
5
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (6/15)
Concrescence
Each actuality is essentially bipolar (physical & mental),
• the physical inheritance is essentially accompanied by a
conceptual reaction of a relevant novel contrast, but always
introducing emphasis, valuation and purpose
(= required to attain a state of inner-world harmony).
• the integration of the physical & the mental side into a
unity of experience is a self-formation which is a process of
concrescence (con-, with & -crescere, to grow)
Whitehead, 1929: 108
12-06-13
Madl
6
Nach dem oben Ausgeführten haben organische Ganzheiten, die sich durch Erfahrungakte
konstituieren und dabei zu dem werden, was sie sind, eine physisch-mentale Struktur: „Each
actuality is essentially bipolar, physical and mental, and the physical inheritance is essentially
accompanied by a conceptual reaction partly conformed to it, and partly introductory of a relevant
novel contrast, but always introducing emphasis, valuation and purpose. The integration of the
physical and the mental side into a unity of experience is a self-formation which is a process of
concrescence ….(Whitehead, 1929/1978, S. 108)”. Als ‚Konkreszenz’ bezeichnet Whitehead die
integrative Synthese der Daten zur Erreichung eines Zustandes innerweltlicher Harmonie, der
bestimmte ästhetische und logische Kriterien erfüllt. Diese Kriterien werden begrifflich (in einem
‚conceptual feeling’) als Daten erfahren, als sogenannte ‚eternal objects’. Auch sie stammen von
einer ‚actual entity’, die jedoch in überzeitlichen Erfahrungsakten existiert und die Whitehead
mit dem Namen ‚Gott’ bezeichnet. Die Konkreszenz der Daten läßt sich nicht wirkursächlich
erklären, da hier gleichzeitig verschiedene Entitäten auf einen intendierten Endzustand hin
zusammenwachsen. Eine Erklärung der Ausrichtung eines Prozesses auf diesen Endzustand, der
während des Prozesses noch nicht verwirklicht worden ist, benötigt daher eine Art von causa
finalis.
…. Every condition to which the process of becoming conforms in any particular instance has its
reason either in the character of some actual entity in the actual world of that concresence, or in
the character of the subject which is in the process of that concrescence. This category of
explanation is termed the ‘ontological principle.’ It could also be termed the ‘principle of
efficient, and final causation’. This ontological principle means that actual entities are the only
reasons; so that to search for a reason is to search for one or more actual entities. It follows that
any condition to be satisfied by one actual entity in its process expresses a fact either about the
‘real internal constitutions’ of some other actual entities, or about the ’subjective aim’
conditioning that process (quote: Whitehead)
Falkner G. & Falkner R. (2009) Die Bedeutung der Philosophie von Alfred North Whitehead für eine neue
Sichtweise in der Biologie, in press
6
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (7/15)
Enduring Objects
• AEs are microscopic acts of
experience
• actual world (environment) is
constituted
of
personally
experienced data (historicity !)
• coherent tuning enables an ever
increasing level of perception
Whitehead, 1929: 34 & 226
12-06-13
Madl
7
Um jeden Aspekt der erfahrenen Wirklichkeit berücksichtigen zu können,
konzipierte Whithead die ‚actual entities’ zunächst als mikroskopische
Erfahrungsakte, die in einer seriellen Anordnung, bei der ein ‚definierendes
Charakteristikum’ aufrechterhalten wird, ‚enduring objects’ (Whitehead,
1929/1978, S. 34) hervorbringen. Eine korpuskulare Gesellschaft (von AEs)
besteht
aus
einem
Bündel
von
‚enduring
objects’.
Durch
ineinanderverschachtelte ‚Gesellschaften’, die in ‚untergeordnete Gesellschaften’
strukturiert sind, kann es zu einer Vertiefung der Intensität einer individuellen
Erfahrung kommen, aus der komplexere ‚actual entities’ hervorgehen. Die ‚actual
world’, d.h.: die Umwelt einer werdenden ‚actual entity’ besteht dann aus den
Daten der direkt erfahrenen Entitäten, aber auch indirekt aus Daten, die im
Entstehungsprozess der direkt erfahrenen Entitäten schon früher eine Rolle
gespielt haben (Whitehead, 1929/1978, S. 226). Eine kohärente Abstimmung von
direkt und indirekt erfassten Daten führt potentiell zu einem immer
kontrastreicheren Empfinden, bei der es zu begrifflichen Umkehrungen und
Umwandlungen der von den vorangegangenen ‚actual entities’ verwirklichten
‚eternal objects’ kommen kann.
7
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (8/15)
Self-conctitution of organisms
m
an
y
po
ss
ib
ili
tie
s
…. occurs on 4 levels:
• Empty space (vacuum-field-E)
• Life histories (abiotic)
• Life histories (biotic)
• Moments in life of
enduring objects
(w/ consciousness)
…
.o
ne
fo
rm
of
Whitehead, 1929: 226
12-06-13
Madl
8
Auf diese Weise kann man eine sich entwickelnde Stufenfolge von organismischen
Selbstkonstituierungen – zu immer komplexeren Lebensformen – ableiten. In dieser
Stufenfolge beschreibt Whithead vier Arten von ‚actual entities’ (in korpuskularen
Gesellschaften), die nicht scharf voneinander unterschieden werden können:
•
first, and at the lowest, there are the actual occasions in so-called ’empty space’ (dark matter,
vacuum-field energy, nullpunkts-energie, etc.);
•
secondly, there are the actual occasions which are moments in the life histories of enduring
non-living objects, such as electrons and other primitive organisms;
•
thirdly, there are the actual occasions which are moments in the life histories of enduring
living objects;
•
fourthly, there are the actual occasions which are moments in the life histories of enduring
objects with conscious knowledge (Whitehead, 1929/1978, S. 226).
Wir beschäftigen uns hier hauptsächlich mit der dritten dieser vier Arten und betrachten die
funktionelle Integration von ‚enduring objects’ (Atome, Moleküle, Komponenten
vorangegangener Konstituierungen) zu einer organischen Ganzheit, wie sie ein
Mikroorganismus darstellt, als Modellfall einer lebendigen ‚actual entity’.
8
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (9/15)
Experience & Self-Constitution
• avoiding objectivism; i.e focusing
on the external view (is a nonmechanistic PoV)
• Coordinating principle must
include “animated bond”
• bipolar structure (mind & matter
– former can only be accessed
indirectly)
Falkner, 2009: 5
12-06-13
Madl
9
Eine Anwendung von Whitehead’s organismischer Philosophie auf
physiologische Prozesse ist besonders bei Mikroorganismen sinnvoll, weil die
metabolischen Geschehnisse, auf denen die Selbstorganisation dieser Organismen
beruht, besser charakterisiert sind als bei höheren und komplexeren Organismen
und daher eine innere Beziehung zwischen den sie konstituierenden
Teilprozessen besser dargestellt werden kann. Eine nicht ausschließlich auf
mechanistischen Vorstellungen beruhende Analyse dieser Prozesse muss eine
auf ‚Außenbetrachtung’ angelegte Forschungsstrategie vermeiden und über
eine bloße Objektivierung von zellulären Komponenten hinausgehen. Bei einer
reduktionistischen Betrachtung hat man zwar „die Teile in seiner Hand, nur das
geistige Band“, das als ‚koordinierendes Prinzip’ dafür sorgt, dass ein
Organismus, dessen Bestandteile im Stoffwechsel ständig umgebaut werden,
fehlt, leider(!) in diesem Prozess welches eine bestimmte Form aufrecht erhält
(oder in einer geordneten Weise verändert). Wie schon oben ausgeführt, kann das
geistige Band, das bei einer Beschränkung auf eine rein wirkursächliche
Beziehung zwischen Komponenten eines lebenden Systems verloren geht, in der
bipolaren Struktur von interdependenten Akten des Werdens gefunden werden.
Source: http://www.emc.maricopa.edu/faculty/farabee/biobk/BioBookATP.html
Falkner G. & Falkner R. (2009) Die Bedeutung der Philosophie von Alfred North Whitehead für
eine neue Sichtweise in der Biologie, in press
9
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (10/15)
Bipolar Structure (cellular level)
can only be accessed indirectly (not by
observing objects (i.e. biochemistry)
• mental manifestation (interprets
relevant changes) - organism responds
in creative manner to environmental
changes
• physical manifestation (once the
adaptation is completed = objectifyable)
• : organism’s new coherent state;
•
Falkner, 2009: 5
12-06-13
Madl
10
Die bipolaren Struktur läßt sich natürlich nicht von außen in einem
biochemischen Ablauf beobachten, sondern nur indirekt erschließen, indem
organismische Vorgänge auf mögliche Informationsverarbeitungsprozesse
analysiert werden, die auf einem prozessualen Übergang von einer ‚mentalen’ in
eine objektivierbare physische Manifestation beruhen könnten: Die mentale
Manifestation des Organismus ‚interpretiert’ eine für ihn relevante Änderung
seiner Umwelt kreativ in Hinblick auf seine Umgestaltung, bei der ein neues
zelluläres Subsystem entsteht. Dieses Subsystem, mit dem ein Organismus sich
in der neuen Umwelt potentiell verwirklichen kann, fungiert dann wieder als ein
objektivierbarer Konstituent und stellt somit die physische Manifestation des
betreffenden Aktes des Werdens dar. Sie geht aber nur dann mit einem Übergang
von Inkohärenz in Kohärenz einher, wenn nun nachfolgende Akte des Werdens
die Manifestation des neu entstandenen Subsystems in Hinblick auf die
Schaffung anderer abgestimmter Subsysteme interpretieren. Dies hat zur Folge,
dass in einem innerorganismischen Beziehungsgefüge immer größere Einheiten
zum Zwecke einer kohärenten Funktionsweise in dem jeweiligen Milieu
integriert werden.
10
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (11/15)
changes
• organism’s new coherent state
• : communicative principle
Falkner, 2009: 5
12-06-13
Madl
11
Man kann diesen komplexen Umbau als eine intrazelluläre Kommunikation
auffassen, bei der die Zelle sich selbst autopoietisch hervorbringt (Maturana und
Varela, 1980). Dabei entsteht aus jeder ‚mentalen’ Aktivität dieser
Kommunikationsakte, bei der die vorangegangenen physischen Manifestationen
interpretiert werden, ein neuer Konstituent, dessen Erscheinungsform
vorangegangene mentale und physische Manifestationen enthält.
11
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (12/15)
Adaptive event:
• organism perceives an
environmental change only if it
leads to different stat. conditions
• adaptive mode (mental can’t be
measured physically)
• adapted mode (physiological, can
be objectified via technical
instruments)
•
Falkner, 2009: 7 & 8
12-06-13
Madl
Adaptive modes of Anabaena sp using P-isotopes in cell culture
12
Aus einer von Whitehead inspirierten prozessbiologischen Sicht wird eine
Umweltänderung demnach vom Organismus nur dann ‚erfahren’, wenn sie zu
einer Abweichung von einem stationären adaptierten Zustand führt. Nach dieser
Interpretation physiologischer Vorgänge beruhen schon die Erfahrungsakte
einfachster Zellen auf einem Netzwerk von ‚adaptiven Ereignissen’, bei denen
ein Organismus in einem ‚adaptiven Operationsmodus’ nach einem neuen
‚adaptierten Zustand’ strebt.
Da der nachfolgende zelluläre Umbau die vorher angepassten Energiekonverter
potentiell beeinflusst, müssen sich diese von neuem anpassen, was wiederum
strukturelle Veränderungen in den anderen Energiekonvertern nach sich zieht.
Auf diese Weise setzt sich die durch eine Umweltänderung ausgelöste Erregung
zellulärer energie-konvertierender Subsysteme wellenartig in alle möglichen
Richtungen durch den Organismus fort und bewirkt dabei alle Arten von
molekularbiologisch charakterisierbaren Modifikationen, die nur dann im
nachfolgenden Konstitutionsprozess eine transiente Stabilisierung erfahren, wenn
aus dem kohärenten Zusammenwirken aller Subsysteme eine Zelle hervorgeht,
die unter den jeweiligen Umweltbedingungen wie ein einziger Energiekonverter
fungiert, in dem alle anderen Konverter in abgestimmter Weise operieren.
12
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (13/15)
Adaptive event:
instruments)
• cellular metabolism has “learned”
Adaptive modes of Anabaena sp using P-isotopes in cell culture
Falkner, 2009: 7 & 8
12-06-13
Madl
13
Hier entspricht also der adaptive Operationsmodus der ‚mentalen’ und der
adaptierte Zustand der physischen Manifestation eines physiologischen
Werdensaktes. Von diesen beiden Manifestationen lassen sich nur die adaptierten
und stabilen energetischen Zustände objektivieren, die in einer bestimmten
Umwelt der Aufrechterhaltung einer bestimmten Form dienen und die durch eine
externen Beobachtung nicht verändert werden. Hingegen ist der adaptive
Operationsmodus, in dem es nach einer Veränderung der Umwelt zu einem
Zusammenbruch und Neuaufbau stationärer Zustände kommt, deshalb nicht
objektivierbar, weil bei diesem Prozess der Beobachter Teil der
kommunikativen Dynamik des Systems wird, bei dem ein Organismus sich und
eine neue Umwelt kreativ wieder hervorbringt. Aus diesem Grund läßt sich die
Kreativität einer natura naturans nur in nicht-objektivierbaren Manifestationen
erschließen und ist daher kein Thema für eine objektivistische Physiologie.
13
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (14/15)
Adaptive event:
instruments)
• cellular metabolism has “learned”
• info passed on epigenetically!
Epigenetic inheritance of acquired characteristics
Falkner, 2009: 7 & 8
12-06-13
Madl
14
Cyanobacterien ,erfahren' Fluktuationen in der externen Phosphatkonzentration als eine Abfolge
von Pulsen, bei denen gelegentliche Erhöhungen der externen Konzentration von Perioden
unterbrochen werden, in denen keine Aufnahme stattfindet. Bei diesem Vorgang beeinflusst die
Art der Anpassung an den vorangegangenen Puls die Anpassung an den nachfolgenden Puls.
Während einem adaptiven Ereignis geht das Phosphat-aufnahmesystem - via einem adaptiven
Operationsmodus - von einem adaptierten Zustand in den nächsten über. Im adaptiven
Operationsmodus wird die Änderung der externen Konzentration in antizipatorischer Weise im
Lichte der vorher erfahrenen' Phosphatpulse interpretiert. Dies geschieht in einer Weise, die
potentiell die weitere Existenz des Organismus unter den neuen Bedingungen gewährleistet.
Das Wechselspiel zwischen den sich ,subjektiv' verhaltenden adaptiven Operationsmodi und den
objektivierbaren adaptiven Zuständen ist verantwortlich für den geschichtlichen Aspekt adaptiver
Ereignisse, der vorangegangen Erfahrungen mit zukünftigen Erwartungen verknüpft.
Im Übergang von einem adaptierten Zustanden in einen adaptiven Operationsmodus werden
Informationen von einem adaptiven Ereignis auf das nächste übertragen: Dabei ,ererbt' das
nachfolgende Ereignis die Ergebnisse der vorangegangenen Interpretationen. In einer selektiven
Aneignung dieser Ergebnisse beginnt seine Zukunft, in der seine eigene Interpretation auf das
kommende adaptive Ereignis übertragen wird.
Culture A: 1 pulse of 10 μM phosphate (Ppart = 1 μmol/L)
Culture B: 10 pulses of 1 μM phosphate (Ppart = 1 μmol/L)
Next day, after an increase of the chlorophyll content from 0.13 to 0.33 mg/L: study of adaptation
of cultures A and B during exposition to three pulses of 2 μM (Ppart = 5.5 μmol/L)
14
Basics
Genetics
Epi-
Memory
Organism
Autopoiesis (15/15)
Adaptive event – three examples:
• Ecotoxicology: elevated Cu++pollution events
Falkner & Falkner, 2000
• Allergy: subcutaneous injections as
used in hyposensibilization
Tinkelmann et al., 1995; Phillips et al., 2011
• Osteoporosis: supplementary Ca++
uptake increases risk of MI
Li et al., 2012
• Obesity: elevated levels of ghrelin
modulate the yo-yo-effect
Epigenetic inheritance of acquired characteristics
Sumithran et al., 2011
12-06-20
Madl
15
Ecotoxicity: Due to the inherent historicity of the perception of environmental changes the
parameters that describe the interaction of organisms with their environment cannot generally be
considered as constants. For example, Scenedesmus sp. cultivated at a low copper concentration
(0.05 µg/L) is destroyed by immediate exposure to a copper concentration above 20 µg/L.
However, if the external concentration in the growth medium is increased gradually over a period
of several days, this organism will survive a copper concentration as high as 1000 µg/L.
Allergy: symptoms reported included pruritic eyes, nose, or pharynx(46%); worsening cough
(26%); sensation of difficulty swallowing (20%); worsening nasal congestion (15%); rhinorrhea
(13%); chest tightness or shortness of breath (11%); generalized pruritus (11%); sneezing (9%);
wheeze (4%); and urticaria (2%).
Osteoporisis: Users of calcium supplements had a statistically significantly increased MI
(myocardial infarction) risk in comparison with non-users of any supplements (HR=1.86; 95% CI
1.17 to 2.96). This association was more pronounced for calcium supplement only users
(HR=2.39; 95% CI 1.12 to 5.12) and persisted after MI cases that occurred in the first 2 years of
follow-up were excluded (HR=2.70; 95% CI 1.26 to 5.79). As shown in the extended Cox
regression models, the most recent but not the cumulative calcium only supplementation was
significantly positively associated with MI risk (HR=2.17; 95% CI 1.06 to 4.42). No statistically
significant association was found between calcium supplementation and either stroke risk or
overall CVD mortality.
Obesity: it is a hard battle for people to maintain weight loss – there is a very high failure rate if you look at
them a few years down the track. Even if people are very motivated to keep their weight. Various hormones
control hunger, but following weight loss, leptin levels fall while ghrelin levels rise. Ghrelin is the hormone
that makes us feel hungry. Following weight loss ghrelin levels increased. This hormone tells us to go and
eat.
Source:
Falkner G., Falkner R (2000). Objectivistic views in biology: an obstacle to our understanding of self-organization
processes in aquatic ecosystems. Freshwater Biology, Vol.44: 553-559
Phillips JF, Lockey RF, Fox RW, Ledford DK, Glaum MC. (2011) Systemic reactions to subcutaneous allergen
immunotherapy and the response to epinephrine. Allergy Asthma Proc., Vol.32(4): 288-294.
Tinkelman DG, Cole WQ, Tunno J. (1995) Immunotherapy: a one-year prospective study to evaluate risk factors of
systemic reactions. J Allergy & Clinical Imm. Vol.95(1): 8-14.
Li KR, Kaaks R, Linseisen J, Rohrmann S. (2012). Associations of dietary calcium intake and calcium supplementation
with myocardial infarction and stroke risk and overall cardiovascular mortality in the Heidelberg cohort of the European
Prospective Investigation into Cancer and Nutrition study (EPIC-Heidelberg). Heart, Vol.98:920-925.
Sumithran P, Prendergast LA, Delbridge E, Purcell K, Shulkes A, Kriketos A, Proietto J (2011). Long-Term
Persistence of Hormonal Adaptations to Weight Loss. N Engl J Med., Vol.365:1597-1604.
15
Basics
Genetics
Epi-
Memory
Organism
Organisms (1/5)
changes
• organism’s new coherent state
• communicative principle
Falkner, 2009: 5
12-06-13
Madl
16
Coherence: Abscissa: “1” represents the balance of operation (Homeostasis) - from left to right:
Functional Complexity – from atoms, to molecules, organelles, cells, organs, organisms,
societies and beyond.
i) Holographic organism: Although biophotonic processes are predominantly associated to the
DNA, they propagate via the microtubular network of the cytoskeleton to the extracellular
matrix, thereby involving the entire organism. It is even assumed that any organism (incl.
Humans act as a holographic biocomputer). A common hypothesis claims that information in
the brain is not stored in localized areas of the brain but rather smeared like a hologram over the
entire brain (and even further including even the whole organism). Thereby, information is
retrieved via a built-in Fourier transformation and converted to distinct action potentials.
ii) Living systems are neither mere subjects, nor objects, but subjects and objects at the same
time. In contrast to the Neo-Darwinistic point of view the capacity of evolutionary
development does not originally depend on the rivalry and power in the fight for existence,
rather, it depends mainly on the capacity of communication; they can be looked upon at as
expanding antennae systems (coherent network of AEs embedded in a NEXUS).
iii) Not only tissues and organs are tied together to form an organism, also members of a group, of
a culture, a society. Symbolically, the immune system and a society perform similar tasks – it
protects the group from potentially dangerous influences. Pandemics or even epidemics are
challenges to the entire social ‘immune system’. If the feeling of being ‘crippled’ is evident
within a society, its members to a large extent reflect this attitude (see F.D.Roosevelt’s election,
1933: a handicaped president for a crippled nation trying to escape the great depression). Most
members are victims of the tribal culture.
Obige Skizze soll darstellen wie Einzeller eine vielzahl an lebensnotwendigen Interaktionen
durchfuehren und dadurch einen relativ hohen Freiheitsgrad erlangen, wohingegen in
Vielzellern der Freiheitsgrad durch zunehmende Spezialisierung & Arbeitsaufteilung je nach
Organverband drastisch sinkt. Allerdings erlangt der Gesamtorganismus dadurch einen
wiederum hoeheren Freiheitsgrad als die einzelne Zelle des Organismus.
Source: Popp F.A., et al.; 1992; Recent Advances in Biophoton Research;
16
Basics
Genetics
Epi-
Memory
Organism
Organisms (3/5)
Communicative principle
• metabolism @ cellular level
(biochemical constraints)
• changes in outer environment
result in complete reorganization
of cellular metabolic pathways
• reorganization to attain stability @
max. efficiency (min. entropy)
Falkner, 2009: 6
12-06-13
Madl
17
Aus diesen Vorgaben ist unmittelbar ersichtlich, dass eine derartige
Kommunikation von Werdensakten, die eine innere Beziehung zwischen
Konstituenten herstellen, nur in einem Constraint des Stoffwechsels gefunden
werden kann, von dem alle biochemischen Abläufe tangiert werden. Dies
verweist auf den Energiefluss durch den Organismus, weil bei einer bestimmten
Inputenergie die Veränderung des Energieflusses in einem Stoffwechselweg alle
anderen Wege beeinflusst. Die zentrale Rolle des Energieflusses wurde von
Whitehead immer betont, von ihm aber für Organismen nie ausgeführt.
Living systems are neither mere subjects, nor objects, but subjects and objects at
the same time. In contrast to the Neo-Darwinistic point of view the capacity of
evolutionary development does not originally depend on the rivalry and power in
the fight for existence, rather, it depends mainly on the capacity of
communication; they can be looked upon at as expanding antennae systems
(coherent network of AEs embedded in a NEXUS).
17
Basics
Genetics
Epi-
Memory
Organism
Organisms (2/5)
Communicative principle of the
immediate human exo-environment
on a microscopic level
surface areas of exo-environments:
• skin (~2 m2)
• lungs (<100 m2)
• intestine (~300 m2)
Madl, 2009
12-06-13
Madl
18
As with any organism, so is the human body not only surrounded by the near
exo-environment but literally penetrated by it – the skin seem s to be a protective
border, but it breaths just as any other living tissue (physiological functions
include sweating, induced by active transport of ions across the barrier). This is
by no means a one-way road as toxicology studies show that application of
chemicals applied to the skin are absorbed immediately into the system without
passing the liver(!).
The lungs (coarsely spoken a passively ventilated and everted sac) with the huge
surface area are likewise an ideal interface of metabolic exchange (gas-exchange
of CO2 and O2), however inhalation of therapeutic as well as toxic substances are
readily conveyed into the body via inhalation (aerosols of various origin, like
alcohol, drugs, pure oxygen, etc); such substances can also be introduced without
being filtered out or detoxified by the liver.
The intestine (roughly spoken a tube with two ends in which the environment is
“channeld” through) is by far the largest interface with the exo-environment;
enzymatic and digestive activity breaks down coarse organic matter to make it
absorbable via villis of the mucosa.
Surface Areas of a ~1.5 m tall person.
Skin is ~2 m2.
Lung is <100 m2.
Intestine is ~300 m2.
Source: http://www.vendian.org/envelope/dir2/lungsout.html
18
Basics
Genetics
Epi-
Memory
Organism
Organisms (4/5)
Flow of Energy
• once interpretable & interpreting manifestation are present an internal
tension responds to external changes – flow of energy increases
(ontological difference)
• system reveals memory
(smeared over the entire
organism / ecosystem)
Falkner, 2009: 6
12-06-13
Madl
19
Eine Zuordnung von mental-physischen Werdensakte zum Energiefluss ist nur
dann möglich, wenn der Energiefluss interpretierende und interpretierbare
Manifestationen aufweist. Die beiden Manifestationen verleihen den einzelnen
Akten des Werdens eine ontologische Differenz, mit der sie voneinander im
ständig stattfindenden Fluss struktureller Veränderung unterschieden werden
können. Diese ontologische Differenz erlaubt zu untersuchen, ob der Energiefluss
von einer Verknüpfung informationsverarbeitender Prozesse strukturiert wird, bei
denen das Hervorbringen objektivierbarer Subsysteme auf Interpretationen
beruht, die von der Vorgeschichte des Organismus abhängen. Mit anderen
Worten, eine Prozessphysiologie muss zeigen, dass die Energiekonversion von
einem zellulären ‚Gedächtnis’ bestimmt wird, das für die Beziehung von
Erfahrung und Selbstkonstitution von entscheidender Bedutung ist (auf
groesserer Skala ist das Gedaechtnis ueber das ganze Oekosystem
verschmiert ! ). Bevor dies an einem geeigneten biologischen Modellsystem
untersucht
wird,
soll
kurz
auf
einen
für
die
intrazelluläre
Informationsverarbeitung wichtigen Aspekt der Energiekonversion eingegangen
werden.
19
Basics
Genetics
Epi-
Memory
Organism
Organisms (5/5)
Flow of Energy
• once interpretable & interpreting manifestation are present an internal
tension responds to external changes – flow of energy increases
(ontological difference)
• system reveals memory
(smeared over the entire
organism / ecosystem)
• subsystems tend to attain
stationary states under
optimal efficiency!
Falkner, 2009: 6
12-06-13
Madl
20
Beim Energiefluss durch eine Zelle spielen energiekonvertierende Subsysteme
…. eine große Rolle. Diese Subsysteme streben danach, in einen stationären
Zustand überzugehen, der der Aufrechterhaltung einer stabilen
organismischen Manifestation dient und in dem die unter den jeweiligen
Umweltbedingungen vorhandene Energie mit optimaler Effizienz verwertet wird
(Katchalski and Curran, 1965). Zu diesem Zweck müssen ganz bestimmte
strukturelle Voraussetzungen erfüllt sein. Wirkt sich eine Änderung der Umwelt
auf die Effizienz der Energiekonversion aus, dann wird die Struktur des
Subsystems in einem physiologischen Anpassungsprozess so verändert, dass der
Organismus in seiner neuen Umwelt wieder möglichst wenig Energie
verschwendet (Kedem und Kaplan, 1965). Nun sind alle energiekonvertierenden
Subsysteme einer Zelle naturgemäß über den gemeinsamen Energiefluß
miteinander verbunden. Daher initiiert die adaptive Rekonstruktion eines
energiekonvertierenden Subsystems bei anderen Energiekonvertern ebenfalls
einen Anpassungsprozess.
20
Basics
Genetics
Epi-
Memory
Organism
Steady State (1/12)
Energy Efficiency
• reshaping of energy converting subsystems during an adaptive mode
• available energy used w/ max.
• all sub-systems interact coherently
during the adaptive phase (sensing of
environment)
WHitehead, 1929: 107
12-06-13
Madl
21
Da der nachfolgende zelluläre Umbau die vorher angepassten Energiekonverter potentiell
beeinflusst, müssen sich diese von neuem anpassen, was wiederum strukturelle Veränderungen in
den anderen Energiekonvertern nach sich zieht. Auf diese Weise setzt sich die durch eine
Umweltänderung ausgelöste Erregung zellulärer energie-konvertierender Subsysteme wellenartig
in alle möglichen Richtungen durch den Organismus fort und bewirkt dabei alle Arten von
molekularbiologisch charakterisierbaren Modifikationen, die nur dann im nachfolgenden
Konstitutionsprozess eine transiente Stabilisierung erfahren, wenn aus dem kohärenten
Zusammenwirken aller Subsysteme eine Zelle hervorgeht, die unter den jeweiligen
Umweltbedingungen wie ein einziger Energiekonverter fungiert, in dem alle anderen Konverter
in abgestimmter Weise operieren.
In den zellen gehen negentropische prozesse vor sich und der fluss der zeit ist »negativ« (d.h.
natürlich nicht dass die zeit rückwärts geht, sondern dass sie verlangsamt oder angehalten ist),
aber als ein makrozystem wächst und alter der organismus gemäss dem »normalen« positiven
zeitfluss. »Am negativsten« ist der zeitfluss (und damit die entropie am stärksten) in den gameten
.... und in der DNS: » .... Diese zellen .... enhalten eine ungeheure menge an information«. In
biologischen systemen steht die zeit in enger beziehung zur speicherung von information.
Akkumulation von information verlangsamt den zeitfluss, informationsverlust führt umgekehrt
zur beschleunigung der zeit (i.e. wir wären sonst nur ein aufblitzen im kosmos, so aber dehnen
wir die zeit und unser wirken aus anstatt einfach zu verpuffen). »Die zeit .... in den gameten bleibt
»kondensiert« .... bis sie mit dem beginn der entwicklung des fötus zu fliessen beginnt«
(pflanzensamen können bei entsprechender lagerung jahr-1000e überdauern – siehe NZZ vom
27.feb.’08, “weltgrösste saatgut-bank auf Spitzbergen“). Komprimierung der zeit fällt zusammen
mit einer komprimierung des raums (Heisenberg: im subatomaren gibt es keine aufsplittung in
raum und zeit), denn die anlagen zum späteren entfalteten organismus sind in den gameten auf ein
volumen konzentriert das im vergleich zu dem des späteren organismus winzig ist. Die anlagen
sind dort in einem impliziten, eingefalteten zustand vorhanden, so dass keimzellen als
umschlagstelle zwischen impliziter und expliziter ordnung im organismus funktionieren.
Source: Mae Wan Ho – The Rainbow and the colors of the Rainbow – Physics of Organism, 1998;
21
Basics
Genetics
Epi-
Memory
Organism
Steady State (2/12)
Energy Efficiency
• reshaping of energy converting subsystems during an adaptive mode
• available energy used w/ max.
• all sub-systems interact coherently
during the adaptive phase (sensing of
environment)
• once adapted state is reached, the many
become one and are increased by one
• that‘s real evolution !
WHitehead, 1929: 107
12-06-13
Madl
22
Dann ist der mit einer Umwelterfahrung einhergehende Akt der kreativen Selbstkonstitution
abgeschlossen, und aus den integrierten Entitäten wurde eine neue Entität geschaffen: “The many
become one and are increased by one (Whitehead, 1929/1978, S. 21)“. Der hier beschriebene
adaptive Response auf eine Umweltänderung spielt natürlich bei ortsfesten Organismen
(Korallen, Pflanzen und Mikroorganismen) eine besondere Rolle, da diese Lebewesen auf äußere
Einflüsse nicht durch Flucht, sondern mit einer Veränderung des Stoffwechsels reagieren
müssen. Bei höheren Organismen sind diese Vorgänge auf den ‚entirely living nexus’
(Whitehead, 1929/1978, S. 107) von Prozessen (z. B. in Nervenzellen) beschränkt, die am
Erfahrungsakt dieser Organismen beteiligt sind.
A Holistic relationship is a way to transform oneself from within. It depicts an everincreasing sense of inter-relatedness and thus responsibility as one ascends along the
evolutionary axis of consciousness. (Sponberg)
The ultimate metaphysical principle is the advance from disjunction to conjunction, creating a
novel entity other than the entities given in disjunction. The novel entity is at once the
togetherness of the ‘many’ which it finds, and also it is one among the disjunctive ‘many’ which
it leaves; it is a novel entity, disjunctively among the many entities which it synthesizes. The
many become one, and are increased by one. In their natures, entities are disjunctively ‘many’
in process of passage into conjunctive unity (quote: Whitehead)
22
Basics
Genetics
Epi-
Memory
Organism
Steady State (3a/12)
Communicative Dynamics:
Systems relies on matter, energy and
information:
EQM = hn0
ERT = m 0c2
dE + dm + dI = 0
(P.Manzelli, 2006)
Energy: the potential for causing change.
Information: a »bit« of information is
definable as a difference that makes a
difference (Bateson) - the content about
Form & Gestalt in a message.
Matter: the physical & objectifyable world.
12-06-13
Madl
23
Information-Energy-Matter Triad: With the quantum potential, its effect on a particle depends
on its form rather than its magnitude. The effect is the same regardless of the strength of the
wave. The wave may have larger effects even at long distances, for the wave does not carry
energy; it is an information wave with mental & physical properties (see ship travelling on
auto-pilot controlled by satellite: the information contained within the radio waves actually
guides the enormous energy possessed by the ship).
•
Energy: "the potential for causing changes", is a concept used to understand dynamics of
most physical processes
•
Information: materialized information becomes matter. Bei der Erfahrung der Umwelt
durch ein System kommuniziert die Community der Elementarprozesse Informationsinhalte
über das Verhältnis System/ Umwelt. Die Leitdifferenz zwischen System und seiner Umwelt
wird zur theoretischen Informationsverarbeitungs-möglichkeit. Damit kommen wir zur
systemtheoretischen Definition der Information: a »bit« of information is definable as a
difference that makes a difference (Bateson).
•
Matter: is the substance of which physical objects are composed. It constitutes the
observable (objectifyable) universe. According to the theory of relativity there is no
distinction between matter and energy, because matter can be converted to energy, and vice
versa.
Information is the bridge between soma and significance: The wave function is the mental (or
significance aspect) of the electron. The field (wave function) and particle are never
separate and are actually aspects of the same reality. The field (AE) acts on the particle, not
by intensity, but by its form (information). It gives rise to an activity that is identified with
meaning (proto-intelligence) guides the electron as radio waves guide the ship.
Source: Dürr H.P., Popp F.A., Schommers W., 2000; Elemente des Lebens; p.259-273;
23
Basics
Genetics
Epi-
Memory
Organism
Steady State (3b/12)
Communicative Dynamics:
The more an organism survives, the more it
experience, the more valuable its genome –
the genome is proportional to the mass or
experience compressed therein.
Kuhn, 1988
Ex-formation: explicitly discarded
information
Complexity is found between order &
disorder
Hubermann & Hogg, 1986
12-06-13
Madl
24
According to Hans Kuhn (1988), chemist ….biological evolution consists of a
series of choices where an organism relates to its surroundings. These
surroundings subject it to pressure, and it must choose to act in order to survive.
An organism’s genes contain experience in survival – otherwise there would be
no organism, and no genes. The more the organism survives, the more it
experiences. And the more valuable its genes become. So the interesting thing is
not how many genes it has – i.e. how long its DNA is. The interesting thing is
the wealth of experience deposited in its genes.
The information of organism contains it its genes has a value that is proportional
to the mass of experiences compressed there. What’s interesting is not the face
value of the information – i.e. the size of genes (genome) – but rather the
information discarded. “This quality constitutes knowledge, where ‘knowledge’
is measured by the total number of bits to be discarded”. Kuhn wrote. Biological
knowledge, then is defined as discarded information.
Exinformation is perpendicular to information. Exinformation is about the mental
work we do in order to make what we want to say sayable. Exinformation is
discarded information, every time we do not actually say but we have in our
heads when or before we say anything at all …. Exinformation is the history of
the message, information the product of that history – information without
exformation is vacuous chatter; exformation without information is not
exformation but merely discarded information ,,,,
Source: Kuhn H, (1988) Origin of Life and Physics: Diversified Microstructure-Inducement to
form Information-Carrying and Knowledge-Accumulating Systems. IBM J. Rep. Develop. 32:1
37-46
Huberman B.A. & Hogg T. (1986) Complexity and Adaptation. Physica 22D: 376-384
…. both quoted in: Norretranders T. (1988) The User Illusion. Penguin Books
24
Basics
Genetics
Epi-
Memory
Organism
Steady State (4/12)
Learning & Anticipative Properties
• adaptive event result in adapted
state (reshapes metabolism)
• this in turn determines
direction of successive events
(!)
• inherent anticipating character
of organism (teleological
orientation)
• that’s evolution!
Falkner, 2009: 8 & Balzer, 2006
12-06-13
Madl
25
In Whitehead’s Terminologie müßte man ein adaptives Ereignis als einen Nexus von ‚actual
entities’ klassifizieren, die in einem externen Quantum so aufeinander bezogen sind, dass eine
dauerhafte Entität hervorgebracht wird. In diesem Prozess ist der adaptierte Endzustand, bei dem
die unter den jeweiligen Umweltbedingungen vorhandene Energie mit höchstmöglicher Effizienz
verwertet wird, die Erstursache für die Richtung des vorangegangenen adaptiven
Ereignisses. Eine derartige irreversible Ausrichtung adaptiver Prozesse hat daher einen inhärent
antizipatorischen Charakter. Auch wenn diese Prozesse selten, und dann nur kurzeitig zu Ende
kommen, da auf Grund des gleichzeitig ablaufenden Wachstums oder Alterns oder einer
Änderungen der Umwelt zelluläre Subsysteme immer wieder von neuem aneinander angepasst
werden müssen, hat jeder einzelne adaptive Prozesse eine teleologische Ausrichtung, in der der
intendierte Endzustand ein ideelles Regulativ darstellt und als Zielvorstellung dessen
Verwirklichung steuert (Falkner et al., 1996: Plaetzer et al., 2006). Da diese physiologische
Werdensakte eine antizipatorische Ausrichtung auf einen potentiell harmonischen
Endzustand aufweisen, sind sie letztlich geist- und erkenntnisbestimmt.
A regulatory state (e.g. sector 06) is determined by the variability of a regulatory process. Upon stimulation,
regulatory patterns become more rapid - shorter periods - right side of abscissa of this sector. Faster
regulatory patterns prevail in the event of activation. Relaxation, on the other hand favors slower regulatory
patterns (longer periods - left side of abscissa within the sector). Examples of typical regulatory patterns: 17
corresponds to chronic stress; 11: deep relaxation; 52-56: neurotic state; 62-66: depressive state. Coma
patients are most likely to be found within the more rigid regulatory pattern.
The Smard-Watch is thus an instrument suitable to monitor physiological response patterns of a person under
investigation. It is a tool to show how coherent this person interacts with its surroundings. It also reveals the
persons robustness to external stress factors. Time structure manifests itself most clearly in the range of
biological rhythms that extend over some ten orders of magnitude from the millisecond oscillations of
membrane action potentials to 10·E6 for circannual rhythms, which are coherent over varying spatial
domains from single cells to entire organs and from whole organisms to populations of organisms. This
implies a vast unexplored area, as the notion of non-linear, structured time is alien to the conventional
scientific framework.
Resonance on a larger scale (Chronobiology): Periodic Regulatory States obtained from the correlated
SMARD-watch data (Electro-Myogram, Skin-Potential, Skin-Resistance).
25
Basics
Genetics
Epi-
Memory
Organism
Steady State (5/12)
Learning & Anticipative Properties
• organism creates its own
“framework” whereas,
• traditional attractor model rely
on an external framework (user)
• biological systems are able to
evolve themselves - that’s
evolution!
Falkner, 2009: 6
12-06-13
Madl
26
Das traditionelle Attraktormodell nicht-linearer Systeme wird dieser
finalursächlichen Ausrichtung nicht gerecht, auch wenn der Attaktor nach
diesem Modell von den Randbedingungen abhängt. Bei biologischen Systemen
führt der intendierte Endzustand zur Schaffung der Randbedingungen, die ein
Organismus so gestaltet, dass er sich in ihnen selbst verwirklichen kann,
während im Attraktormodell der Attraktor von den Randbedingungen bestimmt
wird. Diese Modelle liefern nur eine „Selbstorganisation ohne Selbst“, wie schon
Koutroufinis 1996 ausgeführt hat.
Interaction with the surrounding: The entire body - in particular when talking
about proteo-glycans (sugary proteins) can be considered as a huge liquidcrystalline macro-molecule, that is according to its dissipative nature subject able
to flip-flop from one state to the other (to flip over from a healthy state to a sick
state).
Oscillating Patterns in Biology (self-determined framework): Attractor: the path
in which an oscillatory process can operate;
26
Basics
Genetics
Epi-
Memory
Organism
Steady State (6/12)
Endothelial (blood-vessel lining)
cell
• change structure & function
depending on environment
• inflammation: behaves like macrophage
Bergeron et al., 2006
12-06-13
Madl
27
Studying endothelial cells, which are the blood vessel-lining cells I it is possible
to observe changes in their structure and function depending on their
environment. p.73: For example, adding inflammatory chemicals to the tissue
culture, the cells rapidly became the equivalent of macrophages, the
scavengers of the immune system (this trans-differentiation results in the
acquisition of properties usually attributed to cells of the reticulo-endothelial
system ) …. These cells were clearly showing some "intelligent' control in the
absence of their genes [Lipton et al., 1991] …. DNA does not control biology and
the nucleus itself is not the brain of the cell. Just like you and me, cells are
shaped by where they live. In other words, it's the environment ….
Image: Differentiation of hematopoietic cells (HCs) and proper vessel
development requires HIF-1-dependent factors. HIF-1 promotes the survival of
HCs, which supply VEGF. VEGF induces vasculogenesis by increasing
production and proliferation of endothelial cells. Loss of HIF-1 beta/ARNT
results in HIF deficiency, increased apoptosis of HCs, reduction in VEGF
production and endothelial cell number, and inadequate vessel growth and
branching.
Source: Lipton B (2005) Biology of Belief. Elite Books, p.72-73
Ramirez-Bergeron, D.L. et al. (2006) Dev. Cell 11:81
Lipton B.H., Bensch K.G., Karasek M.A. (1991) Microvessel endothelial cell
transdifferentiation: phenotypic characterization. Differentiation, Vol. 46 (2): 117 – 133
http://www3.interscience.wiley.com/cgi-bin/fulltext/119354142/PDFSTART
27
Basics
Genetics
Epi-
Memory
Organism
Steady State (7/12)
RBC (red blood cell)
• erythrocyte is an enucleated cell
• following an injury…. the cell
dedifferentiates and “reconstructs its
nuclear body (!),
• it acts like a stem cell and is involved in
tissue regeneration
Becker & Marino, 1982,
12-06-13
Madl
28
Sequence of morphological changes in a single frog nucleated erythrocyte
exposed to very low levels of electrical current. The same cell was photographed
at intervals of 5 minutes, demonstrating a change from the normal red cell type to
a cell that has become round, lost all its hemoglobin, and has major phase
changes in its nucleus. These cells are quite alive, surviving in cell culture and
chemically demonstrating a marked increase in RNA content and a complete
alteration in protein composition.
….
In four hours all the red blood cells in the chamber had reactivated their nuclei,
lost their hemoglobin, and became completely unspecialised in form (reactivating
the holographic principle) ….
Source: Becker R.O., Marino A.A. (1982) ELECTROMAGNETISM & LIFE. Department of
Orthopedic Surgery, State University of New York Press, p.23
Becker R.O.; Selden G.; 1985; The Body Electric; William Morrow and Company Inc. New York
– USA, p143
28
Basics
Genetics
Epi-
Memory
Organism
Steady State (8/12)
Pluripotency
• Differentiation
• Dedifferentiaion (back to pluripotency)
• technically done in 1997 (Dolly the sheep)
Surani, 2001
12-06-13
Madl
29
Most cells contain the same set of genes, but their phenotype can vary according
to which genes are expressed and repressed. Alterations in gene-expression
patterns, without changes in DNA sequences, are referred to as epigenetic
mechanisms. Epigenetic mechanisms make it possible to restore pluripotency to a
differentiated cell, and a differentiated cell can also undergo transdifferentiation
resulting in a pronounced change in its appearance and function. Mammalian
genomes contain an additional layer of epigenetic information referred to as
parental 'imprints'. These imprints are erased and re-initiated normally in the
germ line, and passed on to the offspring in which they survive into adulthood.
Parental imprints also regulate gene expression and confer functional differences
on parental genomes during development. Parental imprints can undergo changes
without affecting the fundamental property of pluripotency.
…. studies will allow us to assess more precisely events associated with
reprogramming of somatic nuclei to a pluripotent or a totipotent state.
Source: Surani M.A. (2001) Reprogramming of genome function through epigenetic inheritance.
Nature 414: 122-128.
29
Basics
Genetics
Epi-
Memory
Organism
Steady State (9/12)
Is the nucleus truly the cell's brain?
• Enucleation (extraction of nuclear body)
• following enucleation ….
i) cell survives
i) cell ingests & metabolizes
i) retains coordinated physiologic functions
i) retains ability to communicate
• without its genes, cell looses capability to
i) to adapt to changes
Brem et al., 1989
i) to divide and
12-06-13
Madl
30
Enucleation: refers to removing the nuclear body of a cell
…. But is the nucleus truly the cell's brain? If our assumption that the nucleus and its DNAcontaining material is the "brain" of the cell, then removing the cell's nucleus, a procedure called
enucleation, should result in the immediate death of the cell …. By applying a little suction, the
nucleus is drawn up into the pipette and the pipette is withdrawn from the cell. Below the
nucleus-engorged pipette lies our sacrificial cell - its "brain" torn out …. But wait! It's still
moving! My God ... the cell is still alive! …. …. Soon the cell is back on its feet (OK, its
pseudopods), fleeing the microscope's field with the hope that it will never see a doctor again (an
enucleated cell is like an erythrocyte, still alive).
Following enucleation, many cells can survive for up to two or more months without genes ….
These cells actively ingest and metabolize food, maintain coordinated operation of their
physiologic systems (respiration, digestion, excretion, motility, etc.), retain an ability to
communicate with other cells, and are able to engage in appropriate responses to growth and
protection-requiring environmental stimuli ….
Without their genes, cells are not able to divide, nor are they able to reproduce any protein parts
they lose through the normal wear and tear of the cytoplasm …. The results are unambiguous:
enucleated cells still exhibit complex, coordinated, life-sustaining behaviors, which imply that the
cell’s "brain" is still intact and functioning ….
Eventually enucleated cells die …. because they have lost their reproductive capabilities …. The
nucleus is the cell's gonad! …. Males have often been accused of thinking with their gonads, so
it's not entirely surprising that science has inadvertently confused the nucleus with the cell's brain!
Source: Lipton B. (2005) Biology of Belief. Elite Books, p.65-66.
G. Brem, B. Brenig, M. Müller, K. Springmann (1989). Ex situ cryoconservation of genomes and
genes of endangered cattle breeds by means of modern biotechnological methods in:
 
 (http://www.fao.org/DOCREP/004/T0094E/T0094E00.htm#TOC).
30
Basics
Genetics
Epi-
Memory
Organism
Steady State (10a/12)
Measles (a viral infection):
• immature immune cells create antibody;
• its DNA enodes segments of snippets
• random assemblage of -“• cells create an array of diff. genes (!)
• cell with a close physical complement to the
virus will be activated (affinity maturation)
• during somatic hypermutation 1000s of copies
of this antibody is made
• correct recipe transcribed into the genome!
(genetic memory)
Child suffering from measles; inlet: EM image of Measles virus
12-06-13
Madl
31
For example, when a measles virus infects a child, an immature immune cell is called in to create
a protective protein antibody against that virus. In the process, the cell must create a new gene to
serve as a blueprint in manufacturing the measles antibody protein ….
In generating a specific measles antibody …. their genes are a very large number of DNA
segments that encode uniquely shaped snippets of proteins. By randomly assembling and
recombining these DNA segments, immune cells create a vast array of different genes, each one
providing for a uniquely shaped antibody protein. When an immature immune cell produces an
antibody protein that is a "close" physical complement to the invading measles virus, that cell will
be activated.
Activated cells employ an amazing mechanism called affinity maturation that enables the cell to
perfectly "adjust" the final shape of its antibody protein, so that it will become a perfect
complement to the invading measles virus [Li, et al, 2003; Adams, et al, 2003].
Using a process called somatic hypermutation, activated immune cells makes hundreds of copies
of their original antibody gene. However, each new version of the gene is slightly mutated so that
it will encode a slightly different shaped antibody protein. The cell selects the variant gene that
makes the best fitting, antibody. This selected version of the gene also goes - through repeated
rounds of somatic hypermutation to further sculpt the shape of the antibody to become a "perfect"
physical complement of the measles virus [Wu, et al, 2003; Blanden and Steele 1998; Diaz and
Casali 2002; Gearhart 2002] ….
Source: Lipton B;. 2005: Biology of Belief. Elite Books, p.38
Adams, C.L. and Macleod, M.K.L. and Milner-White, E.J. and Aitken, R. and Garside, P. and
Stott, D.I. (2003) Complete analysis of the B-cell response to a protein antigen, from in vivo
germinal centre formation to 3-D modelling of affinity maturation. Immunology 108(3):pp. 274287.
Image: www.who-measles.org/Public/Web_Front/about_db.php
www.aap.org/pressroom/aappr-photos.htm
31
Basics
Genetics
Epi-
Memory
Organism
Steady State (10b/12)
Measles (a viral infection):
the immune cell:
• retain the genetic "memory" of this antibody
• antibody gene can also be passed on
hence, the immune cell
• learned about the measles virus
• created a memory that will be inherited and
propagated by its daughter cells (!)
Steele et al., 1998
12-06-13
Madl
Child suffering from measles; inlet: EM image of Measles virus
32
The cells retain the genetic "memory" of this antibody …. The new antibody gene
can also be passed on to all the cell's progeny when it divides. In this process, not
only did the cell "learn" about the measles virus, it also created a "memory" that
will be inherited and propagated by its daughter cells. This amazing feat of
genetic engineering is profoundly important because it represents an inherent
"intelligence" mechanism by which cells evolve [Steele, et al, 1998].
Edward J. Steele, Robyn A. Lindley, Robert V. (1998) Lamarck's Signature. How Retrogenes Are
Changing Darwin's Natural Selection Paradig; BlandenPerseus Books
http://home.planet.nl/~gkorthof/kortho39.htm
Image: www.who-measles.org/Public/Web_Front/about_db.php
www.aap.org/pressroom/aappr-photos.htm
32
Basics
Genetics
Epi-
Memory
Organism
Steady State (11/12)
Viruses & Eukaryotic Cells - viral genome editing competences (Villareal, 2005 )
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
RNA, DNA
Replicase, polymerase, integrase
DNA repair
Restriction / modification
Methylation
Division of transcription and translation
Bilayer nuclear envelope / Eukaryotic nucleus
Nuclear pores
Tubulin-based chromosome duplication
Linear chromosomes
Innate immune system (MHC-Komplex, RNAi)
Adaptive immune system
Chitin, cartilage, calcification, bones
Skin, dermal glands for poison, mucus and milk
Larvae, egg, placenta, flowering plants
Viviparous mammals
Monier, 2006
12-06-13
Madl
33
Since autopoiesis and organismic philosophy are able to explain the principles of
evolution much better than neo-Darwinism was ever able to do, it becomes
obvious that the network of life in itself is a coherent system. In order to thrive,
such a system requires constant and permanent interchange in order to initiate
meaningful, continuous synthesis and de-novo creation – this is not intelligent
design, this is real evolution.
Image: During the last decade the study of virus evolution has been disregarded
by a large part of the genomics communities. This is partially due to the
traditional view that conceptualize viruses as non-living tiny particles carrying a
few fast evolving genes stolen from their host. Such a “gene pickpocket” view of
virus discouraged further efforts to explore the history of viral genomes by
comparative sequence analysis and enclosed thinking on virus evolution into a
rigid conservative framework. Simultaneously with the accumulation of genomic
sequence data for large viruses, several authors have proposed bold new ideas
that put viruses in the center of diverse evolutionary scenarios. Consequently,
the study of virus evolution is now back on the central stage, and is probably
essential to the comprehension of the origin of cellular life.
Source: http://www.igs.cnrs-mrs.fr/SpipInternet/IMG/jpg/figure_2.jpg
Witzany G. (2007) NATURAL GENOME-EDITING COMPETENCES OF VIRUSES. Acta
Biotheoretica (2006) 54:235-253
Villarreal, L.P. (2005). Viruses and the Evolution of Life. Washington: American Society for
Microbiology Press.
33
Basics
Genetics
Epi-
Memory
Organism
Steady State (12/12)
Sharing of genetic information:
• interspecific
• antibody gene can also be
passed on
• Villarreal - continue here
Smets & Barkay,, 2005
12-06-13
Madl
34
The sharing of genetic information via gene transfer speeds up evolution since
organisms can acquire "learned" experiences from other organisms [Nitz, et al,
2004; Pennisi 2004; Boucher, et al, 2003; Dutta and Pan, 2002; Gogarten 2003]
…. Given this sharing of genes, organisms can no longer be seen as disconnected
entities; there is no wall between species. Daniel Drell, manager of the
Department of Energy's micro-bial genome program told Science in (2001
294:1634): "...we can no longer comfortably say what is a species anymore"
[Pennisi 2001] ….
Elizabeth Pennisi (2001) MICROBIAL GENOMES: Sequences Reveal
Borrowed Genes. Science Vol. 294. no. 5547, pp. 1634 – 1635
New data emerging from microbial genome sequences are so perplexing that they
call into question what defines a species. Two bugs in particular, described at a
recent meeting, seem to have nabbed enough genes from other organisms that
they no longer resemble their supposedly closest relatives--raising fascinating
questions about how and why they obtained these new traits.
Barth F. Smets and Tamar Barkay (2005). Horizontal gene transfer: perspectives
at a crossroads of scientific disciplines. Nature Reviews Microbiology 3, 675678.
Monier A., Claverie J-M. and Ogata H. (2007) Horizontal gene transfer,
nucleotide composition anomaly and large DNA viruses. BMC Genomics 2007,
8:456.
http://www.nature.com/nrmicro/journal/v3/n9/full/nrmicro1253.html
34
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (1/13)
Membrane: a a liquid crystal “semiconductor” with gates and channels ….
The Membrane is the
interface / window to the
cell's closer environment.
12-06-13
Madl
35
Here, we put forth our nominee for the true brain that controls cellular life - the membrane …. the
magical mem-Brain ….
A bacterium eats, digests, breaths, excretes waste matter and even exhibits “neurological”
processing …. They can recognize toxins and predators and purposely employ escape manoeuvres
to save their lives …. Prokaryotes display intelligence! (see E.B.Jakob’s talk @ NatGenEdit,
2008) ….
In effect, this lipid core is an electrical insulator, a terrific trait for a membrane designed to keep
the cell from being overwhelmed by every molecule in its environment (EMR-penetration) ….
There are lots of Integral Membrane Proteins (IMPs) with lots of different names, but they can be
subdivided into two functional classes: receptor proteins and effector proteins.
Receptor IMPs are the cell’s sense organs, the equivalent of our eyes, ears, nose, taste buds, etc.
Receptors function as molecular "nano-antennas" tuned to respond to specific environmental
signals. Some receptors extend inward from the membrane surface to monitor the internal milieu
of the cell. Other receptor proteins extend from the cell's outer surface, monitoring external
signals ….
Life-sustaining response, are associated to the effector proteins.
'The membrane is a liquid crystal semiconductor with gates and channels" (see Becker &
M.W.Ho) ….
Source: Lipton B. (2005) Biology of Belief. Elite Books, p.75-76, 83
http://www.sciencemag.org/content/291/5512.cover-expansion
Ho M.W. – The Rainbow and the colors of the Rainbow – Physics of Organism, 1998;
Becker R.O.; Selden G.; 1985; The Body Electric; William Morrow and Company Inc. New
York.
http://www.ncnr.nist.gov/programs/reflect/rp/biology/cell_membrane.html
http://media-2.web.britannica.com/eb-media/74/53074-004-9F65D813.jpg
35
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (2/13)
12-06-13
Madl
36
Membrane bound proteins are the main communicating interfaces at cellular
level …. When a gene product is needed a signal from its environment ….
activates the expression of the gene” (Nijhout, 1990)
signals: insulin, histamine, estrogen (attacht to receptor protein (=antenna);
effector protein translates this into a signal cascade to promote:
I) cytosolic protein activation
II) protein synthesis (nucleus)
III) coding novel genes at DNA-level
Source: Nijhout HF (1990): Metaphors and the role of genes. BioEssays,
Vol12(9): 441-446.
36
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (3/13)
Integral Membrane Proteins
• Membrane switches are units of perception - read
environmental signals and adjust cellular
metabolism
12-06-13
Madl
37
The membrane's receptors are the equivalent of sensory nerves, and the effector
proteins are the equivalent of action-generating motor nerves. Together, the
receptor-effector complex acts as a switch, translating environmental signals into
cellular behavior ….
Instead it is the membrane's effector proteins, operating in response to
environmental signals picked up by the membrane's receptors, which control the
"reading" of genes so that worn-out proteins can be replaced, or new proteins
can be created …. To exhibit "intelligent" behavior, cells need a functioning
membrane with both receptor (awareness) and effector (action) proteins. These
protein complexes are the fundamental units of cellular intelligence. Technically
they may be referred to as units of "perception". The definition of perception is:
"awareness of the elements of environment through physical sensation" ….
Integral membrane receptor-effector proteins (IMPs) are the fundamental
physical subunits of the cellular brain's "intelligence" mechanism.
Source: Lipton B. (2005) Biiology of Belief. Elite Books, p.84-87 & 128
http://spectrum.troy.edu/~cking/Biochemistry/Biochemistry%20Test%203,%20answers,%2007F.h
tm
37
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (4/13)
Electromagnetic Fields (EMF)
• weak EMF (pulsed) promote bond cell regeneration, DNA-,
RNA- and protein biosyntheses.
• Activation of the ( K+)-pump of Na-K-ATPase by an
oscillating electric field, with no consumption of ATP.
• Resonance frequencies in activating the K+-pump is 1kHz
and Na+-pump 1MHz respectively.
• Cell membrane is a site of the field amplification
(according to Maxwell relation, an external electric field is
amplified by approx. RCell/dmembrane-times).
Tsonga, 1989
12-06-13
Madl
38
Long distance cell-to-cell or organism-to-organism communications may be accomplished by
transmission and reception of electromagnetic signals through membrane receptors or enzymes.
Consistent with this idea is the observation that membrane ATPases are capable of absorbing
energy from oscillating electric fields of defined frequency and amplitude and using it to perform
chemical work. The concept of the ‘electroconformational coupling’ is used to explain how an
electric signal can modulate the activity of a membrane protein, and conversely, how an energydissipating reaction can produce an electrical signal.
Receptor "antennas" can also read vibrational energy fields such as light, sound and radio
frequencies. The antennas on these "energy" receptors vibrate like tuning forks. If an energy
vibration in the enivironment resonates with a receptor's antenna, it will alter the protein's charge,
causing the receptor to change shape [Tsong 1989] ….
Image: Activation of the Rb+ (K+)-pump of Na+-K+-ATPase by an oscillating electric field, at
4°C.
(top) Human erythrocytes were exposed to an oscillating electric field of 20 Vcm-1 at different
frequencies for 1h. Rb+ uptake was monitored by the radioactive tracer, 86Rb+ (see text and Ref.
12). Rb+ uptake of electric-field stimulated samples (0), stimulated samples treated with 0.2 mM
ouabain (D), non-stimulated samples (D), and non-stimulated sample treated with ouabain (A) are
plotted against the frequency of the applied field.
(bottom) The same experiment, with an electric field of l1kHz at different field strengths.
Symbols used are the same as in (a). In similar experiments no ouabain-sensitive Rb+ efflux was
stimulated by the electric fields. The cytoplasmic concentration of Rb+ was 27 mM, and the
external concentration of Rb+ was 10 mM. Thus, the field induced Rb+ uptake was an active
transport. No consumption of ATP was detected.
Source: Lipton B. (2005) Biology of Belief. Elite Books, p.84
Tsonga T.Y. (1989) Deciphering the language of cells. Trends in Biochemical Sciences Vol.14
(3): 89-92
38
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (5/13)
• Receptor
•
Fl
ag
(1
8:
30
–
20
:4
0)
Bray, 2003
el AN
lu I
m M
E. AT
co IO
li
N
Godesky, 2006
12-06-13
Madl
39
The receptor used by the bacterium Escherichia coli to detect temperature. This
is the very same protein - the chemotaxis receptor, Tar - that E.coli uses to
detect the amino acid aspartate. Not only that, but also to sense of the
temperature response depends upon the concentration of aspartate in the
environment …. E. coli has three other types of methyl-accepting receptors in
addition to Tar, and between them they mediate attractant and repellent responses
to perhaps 50 distinct chemicals, as well as to pH and temperature.
Combinatorial possibilities of receptor clusters. Several thousand
transmembrane chemotaxis receptors of E.coli aggregate together in the plasma
membrane by binding to downstream signaling proteins. Each receptor has eight
possible sites of methylation (white circles) and can exist in at least two
conformational states (gray or black). Four homologous types of receptor
(distinguished by the color of their binding sites) are randomly mixed within the
cluster and interact in groups of three.
Source: Bray D. (2003) Molecular Prodigality. Science Vol. 299. no. 5610, pp. 1189 – 1190
Image E.Coli: http://www.arn.org/blogs/index.php/literature/2008/06/10/on_the_evolution_of_a_key_innovation_in
39
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (6/13)
• Transport proteins: shuttle molecules and
information from one side to the other
• Na-K-ATPase
Meier, 2006
12-06-13
Madl
40
Transport proteins, for example, include an extensive family of channel proteins
that shuttle molecules and information from one side of the membrane barrier to
the other …. sodium-potassium ATPase: every cell has thousands of these
channels built into the membrane. Collectively, their activity uses almost half of
your body's energy every day ….
Na-K-ATPase not only uses up a lot of energy.
Energy-producing activity of Na-K-ATPase
As these proteins go through hundreds of cycles per second, the inside of the cell
becomes negatively charged while the outside of the cell becomes positively
charged. The negative charge below the membrane is referred to as the
membrane potential. Of course the lipid-portion of the membrane, does not let
charged atoms cross the barrier, so the internal charge stays negative. The
positive charge outside the cell and the negative charge inside make the cell
essentially a self-charging battery whose energy is used to empower biological
processes.
Image: http://www.mpibp-frankfurt.mpg.de/meier/ATPase.jpg
40
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (7/13)
• Membrane switches are units of perception - read
environmental signals and adjust cellular
metabolism
• each cell is studded with 100E3 of receptor
molecules – each one programmed to attract &
bind particular peptides
• Receptor: awareness of environment
• Effector: life-sustaining response – control the
“reading“ of genes
12-06-13
fundamental units of cellular
“intelligence“
Madl
41
While the receptor provides an awareness of environmental signals …. the life-sustaining
response is made by the effector proteins. The receptor-effector proteins area stimulus-response
mechanism …. The membrane's receptors are the equivalent of senso-ry nerves, and the effector
proteins are the equivalent of action-generating motor nerves. Together, the receptor-effector
complex acts as a switch, translating environmental signals into cellular behavior ….
Instead it is the membrane's effector proteins, operating in response to environmental signals
picked up by the membrane's receptors, which control the "reading" of genes so that worn-out
proteins can be replaced, or new proteins can be created …. To exhibit "intelligent" behavior,
cells need a functioning mem-brane with both receptor (awareness) and effector (action) proteins.
These protein complexes are the fundamental units of cellular intelligence. Technically they may
be referred to as units of "perception". The definition of perception is: "awareness of the
elements of environment through physical sensation" …. The behavior of a cell can only be
understood by considering the activities of all the switches at any given time (quorum sensing) ....
Cells became smarter by utilizing their outer membrane surface more efficiently and by
expanding the surface area of their membranes so that more IMPs could be packed in ….
Image: Controlling cell growth and differentiation: the extracellular domain contains the
binding site for growth factor and the cytosolic domain contains the tyrosine kinase catalytic site.
The two domains are connected by a single transmembrane helix.
Stryer L. Biochemistry4th ed. W.H.Freeman, p.350
http://www.uic.edu/classes/bios/bios100/mike/spring2003/lect07.htm
41
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (8/13)
• Receptor-Effector coupling lead to
• signal transduction pathway
However ….
• simplistic belief of linear life-supporting
biochemical reactions cannot keep up with ….
12-06-13
Madl
42
Conventional biologists are reductionists who believe that mechanisms of our
physical bodies can be understood by taking the cells apart and studying their
chemical building blocks.
They believe that the biochemical reactions
responsible for life are generated through sequentially arranged assembly lines
….
This reductionist model suggests that if there is a problem in the system, evident
as a disease or dysfunction, the source of the problem can be attributed to a
malfunction in one of the steps along the chemical assembly line …. This
assumption spurs the pharmaceutical industry 's search for magic bullet drugs and
designer genes.
However, because of their Newtonian, materialistic bias, conventional
researchers have completely ignored the role that energy plays in health and
disease ….
Source: Lipton B. (2005) Biiology of Belief. Elite Books, p.102-3
http://www.uic.edu/classes/bios/bios100/mike/spring2003/lect07.htm
42
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (9/13)
Information flow
• Receptor-Effector coupling lead to
• signal transduction pathway
However ….
• simplistic belief of linear life-supporting
biochemical reactions cannot keep up with ….
• the holistic network of simultaneously
interacting subunits
• manifold ways to crosstalk via other
communication loops
12-06-13
Biological systems are redundant
Madl
43
However, the quantum perspective reveals that the universe is an integration of
interdependent energy fields that are entangled in a meshwork of interactions.
Biomedical scientists …. do not recognize the massive complexity of the
intercommunication among the physical parts and the energy fields that make up
the whole .... The flow of information in a “quantum universe” is holistic …. A
biological dysfunction may arise from a miscommunication along any of the
routes of information flow ….
Recent …. research in mapping protein-protein interactions in the cell now
demonstrates the physical presence of these complex holistic pathways [Li, et al,
2004; Giot, et al, 2003; Jansen, et al, 2003] ….
Source: Lipton B. (2005) Biiology of Belief. Elite Books, p.102-4
43
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (10/13)
12-06-13
Madl
44
We can now see why pharmaceutical drugs come with information sheets
listing voluminous side effects that drug inevitably interacts with at least one
and possibly many other proteins …. Biological systems are redundant
Drosophila melanogaster is a proven model system for many aspects of human
biology. Here we present a two-hybrid–based protein-interaction map of the fly
proteome. A total of 10,623 predicted transcripts were isolated and screened
against standard and normalized complementary DNA libraries to produce a draft
map of 7048 proteins and 20,405 interactions. A computational method of rating
two-hybrid interaction confidence was developed to refine this draft map to a
higher confidence map of 4679 proteins and 4780 interactions. Statistical
modelling of the network showed two levels of organization: a short-range
organization, presumably corresponding to multi-protein complexes, and a more
global organization, presumably corresponding to intercomplex connections. The
network recapitulated known pathways, extended pathways, and uncovered
previously unknown pathway components. This map serves as a starting point for
a systems biology modelling of multicellular organisms, including humans.
Source; L. Giot et al. (2003) A Protein Interaction Map of Drosophila melanogaster. Science Vol.
302. no. 5651, pp. 1727 – 1736
Lipton B. (2005) Biiology of Belief. Elite Books, p.102-4
44
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (11/13)
Simple signal transduction:
• via thermal stress
• via EMF-stress
Boodman & Blank, 2002
Maintz & Novak, 2005
12-06-13
Madl
45
Differences in signaling pathways between magnetic stress and heat shock. The induction of
HSP70 by EMFields utilizes either of the two transduction pathways. One pathway contains steps
that are reminiscent of the heat shock pathway, i.e., HSF1-binding to HSE. In EMFields stress,
HSF1 binds to an HSE upstream of the heat shock domain. Magnetic stress also uses a pathway
that involves AP-1 binding. EM field exposures induce HSF1 phosphorylation by members of the
MAPK subfamilies (ERK1, JNK/SAPK, and p38 protein kinase) resulting in increased protein
levels for hsp70, c-Fos, AP-1 binding activity and increased MAPK/ERK1/2 phosphorylation (Jin
et al., 2000).
Abbreviations: heat shock protein HSP 70, heat shock gene; hsp, heat shock protein; HSF, heat
shock factor; HSE, heat shock element; bp, base pair; mG, milligauss; microtesla, mT (1 mT ¼ 10
mG); Hz, Hertz.
Hundreds …. of other scientific studies …. have consistently revealed that "invisible forces" of
the elec-tromagnetic spectrum profoundly impact every facet of biological regulation. These
energies include microwaves, radio frequencies, the visible light spectrum, extremely low
frequencies, acoustic frequencies and even a newly recognized form of force known as scalar
energy. Specific frequencies and patterns of electromagnetic radiation regulate DNA, RNA and
protein syntheses, alter protein shape and function, and control gene regulation, cell division, cell
differentiation, morphogenesis (the process by which cells assemble into organs and tissues),
hormone secretion, nerve growth and function …. [Liboff 2004; Goodman and Blank 2002; Sivitz
2000; Jin, et al, 2000; Blackman, et al, 1993; Rosen 1992, Blank 1992; Tsong, 1989; Yen-Patton,
et al, 1988] ….
Source: Goodman R & Blanl M (2002) Insights Into Electromagnetic Interaction Mechanisms.
Journal of Cellular Physiology 192:16 – 22
Lipton B. (2005) Biology of Belief. Elite Books p.111
45
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (12/13)
• Same signals / protein
molecules are simultaneously
used in different organs and
tissues for completely different
behavioral functions.
• Multicellular organisms can
survive with few genes (25E3) the same gene products
(protein) are used and recycled
for a variety of functions ....
e.g. Histamine in
• brain (neuro.-growth enhancer)
• extremities (inflam. response)
Maintz & Novak, 2005
12-06-13
Madl
46
The same signals or protein molecules may be simultaneously used in different
organs and tissues where they provide for completely different behavioral
functions …. While this redundancy complicates the effects of prescription drugs,
it is another remarkably efficient result of evolution. Multicellular organisms can
survive with far fewer genes than scientists once thought because the same gene
products (protein) are used for a variety of functions ....
When B is present in the blood …. the …. signal produces large gaping pores in
the walls of the blood vessels. The opening of these holes in the blood vessel's
wall is the first step in launching a local inflammatory reaction …. If histamine is
added to blood vessels in the brain, the same histamine signal increases the flow
of nutrition to the neurons, enhancing their growth and specialized functions ….
This is an example of how the same histamine signal can create two diametrically
opposed effects, depending on the site where the signal is released [Lipton, et al,
1991] ….
Histamine is deployed only where it is needed and for as long as it is needed
(pills however, affect the entire body).
Taking antihistamines …. affects histamine receptors wherever they are located
throughout the whole body ….
Laura Maintz and Natalija Novak (2005) Histamine and histamine intolerance. American Journal
of Clinical Nutrition, Vol. 85, No. 5, 1185-1196
46
Basics
Genetics
Epi-
Memory
Organism
Mem-Brain (13/13)
• Same signals / protein
molecules are simultaneously
used in different organs and
tissues for completely different
behavioral functions.
Uni Virginia Health, 2004
• Multicellular organisms can
survive with few genes (25E3) the same gene products
(protein) are used and recycled
for a variety of functions ....
e.g. Estrogen in
• female reproductive system
• & heart, blood vessels & brain
12-06-13
Madl
47
A recent example of tragic adverse reactions to drug therapy is …. synthetic hormone replacement
therapy (HRT) …. The distribution of estrogen receptors …. play an important role in the normal
function of blood vessels, the heart and the brain …. The drug also impacts and disturbs the
estrogen receptors of the heart, the blood vessels and the nervous system …. HRT has been shown
to have disturbing side effects that result in cardiovascular disease and neural dysfunctions such
as strokes [Shumaker, et al, 2003; Wassertheil-Smoller,et al, 2003; Anderson, et al, 2003; Cauley,
et al, 2003].
Source: Lipton B. (2005) Biiology of Belief. Elite Books, p.107
http://www.healthsystem.virginia.edu/uvahealth/adult_gyneonc/estrogen.cfm
Sally A. Shumaker, PhD; Claudine Legault, PhD; Stephen R. Rapp, PhD; Leon Thal, MD; Robert
B. Wallace, MD; Judith K. Ockene, PhD, MEd; Susan L. Hendrix, DO; Beverly N. Jones III, MD;
Annlouise R. Assaf, PhD; Rebecca D. Jackson, MD; Jane Morley Kotchen, MD, MPH; Sylvia
Wassertheil-Smoller, PhD; Jean Wactawski-Wende, PhD; for the WHIMS Investigators (2003).
Estrogen plus progestin and the incidence of dementia and mild cognitive impairment in
postmenopausal women: the Women's Health Initiative Memory Study: a randomized controlled
trial. JAMA 289:2651-2662.
Sylvia Wassertheil-Smoller; Susan Hendrix; Marian Limacher; Gerardo Heiss; Charles
Kooperberg; Alison Baird; Theodore Kotchen; J. David Curb; Henry Black; Jacques E. Rossouw;
Aaron Aragaki; Monika Safford; Evan Stein; Somchai Laowattana; W. Jerry Mysiw (2003). Effect
of Estrogen Plus Progestin on Stroke in Postmenopausal Women: The Women's Health Initiative:
A Randomized Trial. JAMA 289:2673-2684.
Jane A. Cauley; John Robbins; Zhao Chen; Steven R. Cummings; Rebecca D. Jackson; Andrea Z.
LaCroix; Meryl LeBoff; Cora E. Lewis; Joan McGowan; Joan Neuner; Mary Pettinger; Marcia L.
Stefanick; Jean Wactawski-Wende; Nelson B. Watts (2003) Effects of Estrogen Plus Progestin on
Risk of Fracture and Bone Mineral Density: The Women's Health Initiative Randomized Trial.
JAMA 290:1729-1738.
47
Basics
Genetics
Epi-
Memory
Organism
Memory (1/6)
One secret of life:
• cells are programmable.
• programmer lies outside the cell
• Biological behavior and gene activity
are dynamically linked to information
from the environment, which is
downloaded into the cell.
Chalmers, 2008
12-06-13
Madl
48
The first big-deal insight that comes from such an exercise is that computers and
cells are programmable. The second corollary insight is that the programmer lies
outside the computer/ cell. Biological behavior and gene activity are dynamically
linked to information from the environment, which is downloaded into the cell.
Source: Lipton B. (2005) Biiology of Belief. Elite Books, p.84
http://cchalmers.wordpress.com/2008/02/18/biological-models-for-computational-architecture/
48
Basics
Genetics
Epi-
Memory
Organism
Memory (2/6)
Memory (not skills) is
spread over the entire
organism not just the
brain!
Involves consciousness,
the faculties of sentience
(responsiveness),
intercommunication, as
well as memory
Ho, 2003
12-06-13
Madl
49
These catenated processes are responsible for the phenomenon of memory so
characteristic of living systems .... ‘memory’ is always a projection to the
future. Memory is one aspect of conscious experience.
Consciousness, must include, at the minimum, the faculties of sentience
(responsiveness), intercommunication, as well as memory …. The liquid
crystalline continuum of collagen fibers and associated bound water is therefore
ideally suited for mediating rapid intercommunication and responsiveness
throughout the body. It constitutes the body’s ‘consciousness’, which, apart from
the capacity for intercommunication and responsiveness, which also includes the
faculty of memory. …. The liquid crystalline structure and the bound water
network will retain tissue memory of previous experiences, but it will also have
the capacity to register new experiences, as all connective tissues, including
bones, are not only constantly intercommunicating and responsive, they also
undergo metabolic turnover like the rest of our body. Memory is thus
dynamically distributed in the structured network and the associated, selfreinforcing circuits of proton currents …. which will be expected to make up the
DC body field itself ….
Source Ho M.W (2003); The Rainbow and the Worm – The Physics of Organism – World
Scientific - Singapore
Image: Stan Franklin, Bernard J. Baars, Uma Ramamurthy, Matthew Ventura (2002). The Role of
Consciousness in Memory. Brains, Minds and Media, Vol. 2005, bmm150.
49
Basics
Genetics
Epi-
Memory
Organism
Memory (3/6)
Placebo Effect
osteoarthritis of the knee
recommends:
S h Di
am sco
- s ve
ur ry
ge C
r y ha
n
(0
n
4:
16 el
-0
8:
29
)
• arthroscopic lavage (10L
of fluids) or
• débridement (washing &
shaving of cartilage)
• Placebo-treatment: std.
arthroscopic débridement
procedure was simulated
Mean Values (and 95% CI) on the Knee-Specific Pain Scale. Higher scores
indicate more severe pain.
Moseley et al, 2002
12-06-13
Madl
50
The patients in the study were divided into three groups. Moseley shaved the
damaged cartilage in the knee of one group. For another group, he flushed out the
knee joint …. The third group got "fake" surgery. The patient was sedated …. All
three groups were prescribed the same postoperative care, which included an
exercise program. The results were shocking …. The placebo group improved
just as much as the other two groups! …. The results were clear to Moseley: "My
skill as a surgeon had no benefit on these patients ….
At no point did either of the intervention groups report less pain or better function
than the placebo group. For example, mean (±SD) scores on the Knee-Specific
Pain Scale (range, 0 to 100, with higher scores indicating more severe pain) were
similar in the placebo, lavage, and debridement groups: 48.9±21.9, 54.8±19.8,
and 51.7±22.4, respectively, at one year (P=0.14 for the comparison between
placebo and lavage; P=0.51 for the comparison between placebo and
debridement) and 51.6±23.7, 53.7±23.7, and 51.4± 23.2, respectively, at two
years (P=0.64 and P=0.96, respectively). Furthermore, the 95 percent confidence
intervals for the differences between the placebo group and the intervention
groups exclude any clinically meaningful difference.
Source: www.subtleenergysolutions.com/placebo-cartoon.gif
J. Bruce Moseley, M.D., Kimberly O'Malley, Ph.D., Nancy J. Petersen, Ph.D., Terri J. Menke,
Ph.D., Baruch A. Brody, Ph.D., David H. Kuykendall, Ph.D., John C. Hollingsworth, Dr.P.H.,
Carol M. Ashton, M.D., M.P.H., and Nelda P. Wray, M.D., M.P.H. (2002). A Controlled Trial of
Arthroscopic Surgery for Osteoarthritis of the Knee. New England Journal of Medicine. Volume
347 (2):81-88
50
Basics
Genetics
Epi-
Memory
Organism
Memory (4/6)
Placebo Effect
• …. our beliefs act like filters on a
camera, changing how we see the
world.
• our biology adapts to those beliefs
• we cannot readily change the codes
of our genetic blueprints, but we
can change our minds.
Colloca & Benedetti 2005
12-06-13
Madl
51
Henry Ford was right about …. about the power of the mind: "If you believe you can or if you
believe you can’t ... you're right". Think about the implications of the man who blithely drank the
bacteria that medicine had decided caused cholera. Consider the people who walk across coals
without getting burned …. Your beliefs act like filters on a camera, changing how you see the
world. And your biology adapts to those beliefs …. While we cannot readily change the codes of
our genetic blueprints, we can change our minds.
You can filter your life …. that turns everything black and makes your body/mind more
susceptible to disease. You can five a life of fear and or live a life of love. You have the choice!
But I can tell you that if you choose to see a world full of love, your body will respond by growing
in health ….
Image: Events that might take place in the brain after placebo administration. Placebo
administration (psychosocial context) might reduce pain through opioid and/or non-opioid
mechanisms via expectations and/or conditioning mechanisms. The respiratory centers may also
be inhibited by endogenous opioids. The {beta}-adrenergic sympathetic system of the heart may
also be inhibited during placebo analgesia, although the mechanism is not known (reduction of the
pain itself and/or direct action of endogenous opioids). CCK antagonizes the effects of
endogenous opioids, thereby reducing the placebo response. Placebos can also act on 5-HTdependent hormone secretion, on both the pituitary and adrenal glands, thereby mimicking the
effect of the analgesic drug sumatriptan. From Colloca and Benedetti (2005).
http://www.biology-online.org/user_files/Image/Neurobiology/NE-placeboF01.gif
51
Basics
Genetics
Epi-
Memory
Organism
Memory (5/6)
Emotion – the language of the cell
• conscious mind reads the flow of cellular signals
(which comprises the mind of the body)
• generates emotions – via controlled release of
regulatory signals (nervous system)
Liu, 2009
12-06-13
Madl
52
i) jede Entscheidung bewegt sich im emotionalen Rahmen d.h. jede entscheidung muss emotional
ertraeglich sein – nur auf der basis kommt der Intellekt zum Einsazt;
i) gr. Veraenderungen (Denk- & Verhaltensmuster) muessen sich auf emotionaler Basis
entwickeln;
i) dramatische Veraenderungen – tiefe Betroffenheit – bedeutet grundlegende Veraenderung;
i) intellektueller Impuls (z.b. du sollst nicht rauchen) reicht nicht; erst wenn man die emotionalen,
tieferen Bereiche anspricht kann eine Veraenderung induziert werden.
…. The evolution of the limbic system …. converted the chemical communication signals into
sensations that could be experienced by all of the cells in the community. Our conscious mind
experiences these signals as emotions. The conscious mind not only "reads" the flow of the
cellular coordinating signals that comprise the body's "mind", it can also generate emotions, which
are manifest through the controlled release of regulatory signals by the nervous system ….
Candace Pert …. established that the "mind" was not focused in the head, but was distributed via
signal molecules to the whole body (s. also M.W.Ho) …. Her work emphasized that emotions were
not only derived through a feedback of the body's environmental information …. While proper use
of consciousness can bring health to an ailing body, inappropriate unconscious control of emotions
can easily make a healthy body diseased …. [Pert 1997] ….
Reflex behaviors …. driving a car at sixty-five miles per hour on a crowded interstate highway
while your conscious mind is fully engaged in conversation with a passenger …. Through the
conditioned learning process, neural pathways between eliciting stimuli and behavioral responses
become hardwired to ensure a repetitive pattern ("habits“) …. Humans and other higher
mammals have evolved the prefrontal cortex associated with thinking, planning and
decision-making ….
Our responses to environmental stimuli are indeed controlled by perceptions, but not all of our
learned perceptions are accurate. Not all snakes are dangerous! Yes, perception "controls"
biology, but …. perceptions can be true or false. Therefore, it is more accurate to refer to these
perceptions as beliefs. Beliefs control biology
52
Basics
Genetics
Epi-
Memory
Organism
Memory (6/6)
Emotion – the language of the cell
• e.g. Hypothalamus-Pituitary-Adrenal-axis
• Fight or Flight Pattern
• Chronic & elevated stress level
Postlethwait & Hopson, 1995
12-06-13
Madl
53
The Hypothalamus-Pituitary-Adrenal-Axis (HPA) …. When there are no threats, the I-IPA axis is
inactive and growth flourishes …. The stress hormones released into the blood constrict the blood
vessels of the digestive tract, forcing the energy-providing blood to preferentially nourish the
tissues of the arms and legs that enable us to get out of harm’s way …. The visceral organs stop
doing their life-sustaining work of digestion, absorption, excretion and other functions that
provide for the growth of the cells and the production of the body's energy reserves ….
Activating the HPA axis also interferes with our ability to think clearly …. when you're frightened
you're dumber …. Exam stress paralyzes these students ….
We live in a "Get set" world …. Our daily stressors are constantly activating the HPA axis,
priming our bodies for action …. Almost every major illness that people acquire has been linked
to chronic stress [Segerstrom and Miller 2004; Kopp and R6thelyi 2004; McEwen and Lasky
2002; McEwen and Seeman 1999] ….
More researchers are pointing to the inhibition of neuronal growth by stress hormones as the
source of depression …. Depression is caused when the brain's stress machinery goes into
overdrive. The most prominent player in this theory is the hypothala-mic-pituitary-adrenal (HPA)
axis" [Holden 2003] ….
Image: Adrenal stress hormones constrict the blood vessels in the forebrain reducing its ability to
function. Additionally, the hormones repress activity in the brain's prefrontal cortex, the center of
conscious volitional action conscious activity. In an emergency, the vascular flow and hormones
serve to activate the hindbrain, the source of life-sustaining reflexes that most effectively control
fight or flight behavior …. It comes at a cost .... diminished conscious awareness and reduced
intelligence [Takamatsu, et al, 2003; Arnsten and Goldman-Rakic 1998; Goldstein, et al, 1996].
Stress hormones are so effective at curtailing immune system function that doctors provided them
to recipients of transplants so that their immune systems wouldn’t reject the foreign tissues ….
Lipton B. (2005) Biology of Belief. Elite Books p.148-152
53
Basics
Genetics
Epi-
Memory
Organism
Epigenetics on an Organismic level
12-06-13
Madl
0
0
Basics
Genetics
Epi-
Memory
Organism
Organisms (1/13)
A phenotypic variation ….
tumor inducing DNA (T-DNA) can be switched on
and off:
• 1st infection: leaf disks incubated with A.tumefaciens
harboring a binary vector which contained T-DNA-I;
…. -> tumor was expressed in F1-generation!
• 2nd infection: leaf disks from progeny containing TDNA-I were incubated with agrobacteria harboring a
binary vector which contained T-DNA-II;
…. -> tumor was silenced in F2-generation!
Matzke et al. 1998
Nicotiana tabacum
12-06-13
Madl
1
Tumor Inducing DNA (T-DNA) of the bacterium A.tumefaciens:
Doubly transformed tobacco plants were obtained following sequential
transformation steps using two T-DNAs encoding different selection and
screening markers:
i) T-DNA-I encoded kanamycin resistance and nopaline synthase;
i) T-DNA-II encoded hygromycin resistance and octopine synthase.
A genetic analysis of the inheritance of the selection and screening marker genes
in progeny of the doubly tranformed plants revealed that the expression of TDNA-I genes was often suppressed. This suppression could be correlated with
methylation in the promoters of these genes. Surprisingly, both the methylation
and inactivation of T-DNA-I genes occurred only in plants containing both TDNAs: when self-fertilization or backcrossing produced progeny containing only
T-DNA-I, expression of the genes on this T-DNA was restored and the
corresponding promoters were partially or completely demethylated. These
results indicated that the presence of one T-DNA could affect the state of
methylation and expression of genes on a second, unlinked T-DNA in the same
genome.
Source: M. A. Matzke, M. Primig, J. Trnovsky, and A. J. M. Matzke (1989 ). Reversible
methylation and inactivation of marker genes in sequentially transformed tobacco plant. EMBO
J.; 8(3): 643–649.
1
Basics
Genetics
Epi-
Memory
Organism
Organisms (2/13)
A phenotypic variation ….
(dsRNA inhibits target mRNA “mex-3”):
Caenorhabditis elegans
Image: Sommer R
Fire et al., 1998
(embryo 50m)
• a) negative control: lack of staining, wild
type with absence of hybridization;
• b) embryo from uninjected wild-type parent,
normal pattern of endogenous mex-3;
• c) embryo from a parent injected with
purified mex-3B; retain mex-3, although at
levels less than wild type;
• d) embryo from a parent injected with
dsRNA; no mex-3 RNA is detected;
12-06-13
Madl
2
Both petunia plants and worms helped scientists to discover a novel way to switch off genes.
Nature has several ways of silencing genes, a clever knack affording the same genome many
different expressions or epigenomes throughout one body.
Experimental introduction of RNA into cells can be used in certain biological systems to interfere
with the function of an endogenous gene. Such effects have been proposed to result from a simple
antisense mechanism that depends on hybridization between the injected RNA and endogenous
messenger RNA transcripts. RNA interference has been used in the nematode Caenorhabditis
elegans to manipulate gene expression. Here we investigate the requirements for structure and
delivery of the interfering RNA. To our surprise, we found that double-stranded RNA was
substantially more effective at producing interference than was either strand individually. After
injection into adult animals, purified single strands had at most a modest effect, whereas doublestranded mixtures caused potent and specific interference. The effects of this interference were
evident in both the injected animals and their progeny. Only a few molecules of injected doublestranded RNA were required per affected cell, arguing against stochiometric interference with
endogenous mRNA and suggesting that there could be a catalytic or amplification component in
the interference process.
…. dsRNA-mediated interference showed a surprising ability to cross cellular boundaries.
Injection of dsRNA into the body cavity of the head or tail produced a specific and robust
interference with gene expression in the progeny brood. Interference was seen in the progeny of
both gonad arms, ruling out the occurrence of a transient 'nicking' of the gonad in these injections.
dsRNA injected into the body cavity or gonad of young adults also produced gene-specific
interference in somatic tissues of the injected animal.
Source: http://www.nature.com/nature/journal/v391/n6669/abs/391806a0.html
http://www.eb.tuebingen.mpg.de/departments/4-evolutionary-biology/department-4-evolutionary-biology
Andrew Fire, SiQun Xu, Mary K. Montgomery, Steven A. Kostas, Samuel E. Driver & Craig C.
Mello (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis
elegans. Nature 391, 806-811
2
Basics
Genetics
Epi-
Memory
Organism
Organisms (3/13)
A phenotypic variation:
•Heterozygous male mice w/
one Kittm1Alf allele and one
normal wild-type (+) allele
have a spotted white tail-tip;
•Progeny carry a wild-type Kit allele from father;
action of the transmitted aberrant RNAs still gives rise
to the spotted tail;
•Loss of aberrant RNAs over successive generations
leads to gradual loss of paramutation.
Rassoulzadegan et al. 2006
12-06-13
Madl
3
Paramutation is a heritable epigenetic modification induced in plants by cross-talk between
allelic loci. …. and involves transmission of RNAs such as piRNAs, siRNAs, miRNAs or other
regulatory RNAs. These are packaged in egg or sperm and cause paramutation upon transmission
to the next generation. RNA is a molecule of inheritance, just like DNA.
Scientists, based at the French Institute of Health and Medical Research (Inserm) and the
University of Nice-Sophia Antipolis, used mice which carry one normal version of Kit and one
mutant version (Kittm1Alf), giving them spotted tails. They bred these mice together, producing
offspring with a range of Kit gene combinations:
* two mutant genes (these die shortly after birth)
* one mutant and one normal gene (these should be "spotty" like their parents)
* no mutants - two normal genes (not spotty).
In spite of a homozygous wild-type genotype, their offspring maintain, to a variable extent, the
white spots characteristic of Kit mutant animals. Efficiently inherited from either male or female
parents, the modified phenotype results from a decrease in Kit messenger RNA levels with the
accumulation of non-polyadenylated RNA molecules of abnormal sizes. Sustained transcriptional
activity at the postmeiotic stages—at which time the gene is normally silent—leads to the
accumulation of RNA in spermatozoa. Microinjection into fertilized eggs either of total RNA
from Kittm1Alf/+ heterozygotes or of Kit-specific microRNAs induced a heritable white tail
phenotype. Our results identify an unexpected mode of epigenetic inheritance associated with the
zygotic transfer of RNA molecules.
Source: http://epigenetica.blogspot.com/2007/04/rna-mediated-non-mendelian-inheritance.html
Minoo Rassoulzadegan, Valérie Grandjean, Pierre Gounon, Stéphane Vincent, Isabelle Gillot &
François Cuzin (2006). RNA-mediated non-mendelian inheritance of an epigenetic change in the
mouse. Nature 441, 469-474.
http://www.nature.com/nature/journal/v441/n7092/full/nature04674.html
http://www.nature.com/nature/journal/v441/n7092/fig_tab/441413a_F1.html
3
Basics
Genetics
Epi-
Memory
Organism
Organisms (4a/13)
A phenotypic variation:
• same parents
• same age
• no mutation in pigmentation
Image: Jirtle, 2007
…. all mice are genetically IDENTICAL ….
…. but they are epigenetically different !
12-06-13
Madl
4
…. A study published in Molecular and Cellular Biology found that an enriched environment can
even override genetic mutations in mice [Waterland and Jirtle 2003]. In the study, scientists
looked at the effect of dietary supplements on pregnant mice with the abnormal "agouti" gene.
Agouti mice have yellow coats and are extremely obese, which predisposes them to cardiovascular
disease, diabetes and cancer ….
Methyl groups also inactivate remnants of past viral infections, called transposons. 45% of the
human genome is made up of parasitic transposons. Methylation is nature's way of allowing
environmental factors to tweak gene expression without making permanent mutations, Dr. Jirtle
said. Methyl groups are entirely derived from the foods people eat. And the effect may be
good or bad. Maternal diet during pregnancy is consequently very important, but in ways that are
not yet fully understood.
For his experiment, Dr. Jirtle chose a mouse that happens to have a transposon right next to the
gene that codes for coat color. The transposon induces the gene to overproduce a protein that
turns the mice pure yellow or mottled yellow and brown. The protein also blocks a feeding control
center in the brain. Yellow mice therefore overeat and tend to develop diabetes and cancer. To see
if extra methylation would affect the mice, the researchers fed the animals a rich supply of methyl
groups in supplements of vitamin B12, folic acid, choline and betaine from sugar beets just before
they got pregnant and through the time of weaning their pups. The methyl groups silenced the
transposon, Dr. Jirtle said, which in turn affected the adjacent coat color gene. The babies, born a
normal brownish color, had an inherited predisposition to obesity, diabetes and cancer negated by
maternal diet.
Source: http://blog.plantpoisonsandrottenstuff.info/category/vitamins/
Waterland R.A. & Jirtle R.L.(2003). "Transposable Elements: Targets for Early Nutritional
Effects on Epigenetic Gene Regulation." Molectilar and Cell Biology 23(15): 5293-5300.
Randy L. Jirtle & Michael K. Skinner (2007) Environmental epigenomics and disease
susceptibility. Nature Reviews Genetics 8, 253-262
4
Basics
Genetics
Epi-
Memory
Organism
Organisms (4b/13)
These transgenic Mice:
• yellow pups develop
obese, cancer & diabetes
• brown pups are healthy
Wong, et al. Hum Mol Genet 14:R11, 2005
IJirtle R. 2007
12-06-13
Madl
5
Gene expression is conditioned by environment: developmental interactions
occur from conception till death - Depends on what environments and what
sequence the organism encounters them.
Epigentic signals can be transmitted to the next generation i.e. display meiotic
stability. Not all epigenetic signals are erased and reprogrammed during
gametogenesis. This partly explains incomplete penetrance and variable
expressivity – not all offsprings are affected (see phenotypic expression of agouti
mice mutants).
Example: mouse agouti locus
Isogenic Avy/a mice range in colour from yellow to black (pseudoagouti)
Darkness proportional to amount of DNA methylation in agouti gene
(complete methylation  black). Transplants’ colour influenced by genetic
mother not surrogate.
Source: http://www.pbs.org/wgbh/nova/sciencenow/3411/02.html
Waterland R.A. & Jirtle R.L.(2003). "Transposable Elements: Targets for Early Nutritional Effects on
Epigenetic Gene Regulation." Molectilar and Cell Biology 23(15): 5293-5300.
Albert H.C. Wong, Irving I. Gottesman and Arturas Petronis (2005) Phenotypic differences in
genetically identical organisms: the epigenetic perspective. Human Molecular Genetics 14:R11R18
5
Basics
Genetics
Epi-
Memory
Organism
These transgenic Mice:
• yellow pups develop
obese, cancer & diabetes
• brown pups are healthy
• cause: maternal diet (!)
Jirtle R, 2007
12-06-13
Ep
ig
en
et
ic C
s- a
1 ta
vi ly
d e st
o
(0
4:
40
-0
7:
30
)
Organisms (4c/13)
Madl
6
Agouti mothers received methyl-group-rich supplements …. When methyl
groups attach to a gene's DNA, it changes the binding characteristics of
regulatory chromosomal proteins. If the proteins bind too tightly to the gene, the
protein sleeve cannot be removed and the gene cannot be read. Methylating
DNA can silence or modify gene activity …. The mothers who got the methyl
group supplements produced standard, lean, brown mice, even though their
offspring had the same agouti gene as their mothers. The agouti mothers who
didn't get the supplements produced yellow pups, which ate much more than the
brown pups. The yellow pups wound up weighing almost twice as much as their
lean, "pseudo-agouti" counterparts ….
Waterland R.A. & Jirtle R.L.(2003). "Transposable Elements: Targets for Early Nutritional Effects on
Epigenetic Gene Regulation." Molectilar and Cell Biology 23(15): 5293-5300.
6
Basics
Genetics
Epi-
Memory
Organism
Organisms (5/13)
Rats & EndoCrine Disruptors:
•Epigenetic transgenerational
actions of endocrine disruptors
through the male germ line
•Reduced sperm motility – up to
the 4th generation (F4);
Skinner, 2006
12-06-13
Madl
7
Michael Skinner von der Washington State University in Pullman, USA setzte schwangere Ratten
Giftstoffen aus, welche ihren Geschlechtshormonhaushalt durcheinanderbrachten. Zusätzlich
verursachten die Giftstoffe in den Keimzellen des männlichen Nachwuchses DNAMethylierungen an verschiedenen Genen und eine verminderte Schwimmfähigkeit der Spermien.
Kreuzte man die männlichen Nachkommen dieser Mütter in der Folge mit unbehandelten
Weibchen, wurde zum Erstaunen der Forscher sowohl das Methylierungsprofil als auch die
reduzierte Spermienmobilität bis in die vierte Generation weitervererbt. Die Bedingungen im
Mutterleib der ersten Generation prägten den Nachwuchs also noch über mehrere Generationen
hinweg. Wie mehrere Studien von Emma Whitelaw von der University of Sydney in Australien
zudem zeigen, ist so eine generationenübergreifende Vererbung epigenetischer Veränderungen
nicht nur auf die männlichen Keimzellen beschränkt, sondern kann auch über Eizellen stattfinden.
Endocrine disruptors have recently been shown to promote an epigenetic transgenerational
phenotype involving a number of disease states (e.g. male infertility). The anti-androgenic
fungicide vinclozolin was found to act transiently at the time of embryonic sex determination to
promote in the F1 generation a spermatogenic cell defect and subfertility in the male. When the
animals were allowed to age up to 1 yr, a number of other disease states developed. This
phenotype was transferred through the male germ line to all subsequent generations analyzed
(F1–F4). The ability of an environmental factor (i.e. endocrine disruptor) to promote an epigenetic
transgenerational phenotype impacts the potential hazards of environmental toxins, mechanisms
of disease etiology, and evolutionary biology. The biological importance of the epigenetic actions
of environmental agents is reviewed in the context of the primordial germ cell and development
of epigenetic transgenerational phenotype
Source: Anway D.M. & Skinner M.K. (2006) Epigenetic Transgenerational Actions of Endocrine
Disruptors. Endocrinology Vol. 147, No. 6 s43-s49
7
Basics
Genetics
Epi-
Memory
Organism
Organisms (6a/13)
Phenotypic variations in twins
• nutrition (provided by the mother)
• physico-chemical environment
i) womb – close environment
i) hormonal exposure (mother)
i) sound, vibration,
google
12-06-13
Madl
8
Consider identical twins, who always have identical genomes, and they really do
(always!) develop into unique individuals. Yes, they correlate with each other in
many ways. Often they resemble each other, but everyone who knows identical
twins knows that they actually look different and they have unique personalities.
When you make a phone call to talk to an identical twin, it matters which one of
the two answer the phone. Nobody confuses identical twins (or triplets) as the
kinds of identical marching robots that a mad scientist might create.
Reproduction of genomes appears to be highly overrated.
Source: “DNA Is Not Destiny The new science of epigenetics rewrites the rules of disease,
heredity, and identity.”: http://www.discover.com/issues/nov-06/cover/?page=1
8
Basics
Genetics
Epi-
Memory
Organism
Organisms (6b/13)
Phenotypic variations in twins
• twins separated at birth
• left: malnourished for years
• physical and behavioral changes
Discovery magazine, 2006twins
12-06-13
Madl
9
Though these two men are genetically identical, they were separated at birth.
The man on the left was malnourished for years. Bone structure changes brought
about by environmental factors is thus one of many ways (physical and
behavioral) in which the environment can dramatically affect the way in which
the genes express themselves.
The 25,000 genes of our human DNA are widely considered to be an instruction
book for our bodies. However, “genes themselves need instructions for what to
do, and where and when to do it.” These additional instructions are not in DNA,
but on it, in an array of chemical markers and switches, known collectively as the
epigenome, that lie along the length of the double helix.
These epigenetic
switches and markers in turn help switch on or off the expression of particular
genes. It has long been known that epigenetic switches are critical to the healthy
development of organisms. These can be dramatically tweaked by exposure to a
vitamin, a toxin or even mothering, altering “the software of our genes in ways
that affect an individual’s body and brain for life”.
Source: http://dangerousintersection.org
http://www.pbs.org/wgbh/nova/sciencenow/3411/02.html
Image: “DNA Is Not Destiny The new science of epigenetics rewrites the rules of disease,
heredity, and identity.”: http://www.discover.com/issues/nov-06/cover/?page=1
9
Basics
Genetics
Epi-
Memory
Organism
Organisms (6c/13)
Twin Study on Cancer:
• inherited
predisposition
• Epigenetic
exposure
• Trigger
(threshold)
Wong, et al. Hum Mol Genet 14:R11, 2005
12-06-13
Madl
10
Twin studies:
Minnesota Study of Twins Reared Apart:
Compared MZ twins reared together (MZT) vs MZ twins reared apart (MZA)
Degree of dissimilarity between MZT vs MZA assumed to be due to environment
Correlations within MZT and MZA twin pairs were almost identical for most traits
Personality test, fingerprint ridges, ECG patterns, systolic BP, heart rate, IQ, social
attitudes
Bouchard et al. Science 250:223, 1990
Swedish Twin Registry:
Similar results with respect to migraines (in females), smoking (in males), peptic ulcers
Headache 43:235, 2003; Arch Gen Psych 57:886, 2000; Arch Intern Med 160:105, 2000
http://www.pbs.org/wgbh/nova/sciencenow/3411/02.html
Albert H.C. Wong, Irving I. Gottesman and Arturas Petronis (2005) Phenotypic differences in genetically
identical organisms: the epigenetic perspective. Human Molecular Genetics 14:R11-R18
10
Basics
Genetics
Epi-
Memory
Organism
Organisms (7/13)
cloning humans in an artificial womb?
• nutrition (provided by the mother)
• environmental factor during pregnancy
(womb)
• Dolly suffered from arthritis as she was
cloned from a cell of her mother’s udder (!)
Time Mag. 03-1997
12-06-13
Madl
11
Human cloning should no longer be portrayed as it often is in the media.
Epigenetics demonstrates that having an identical genome is highly overrated.
Genetic cloning cannot really result in identical phenotypic expression. The
apple (even if it is a clone) can fall a long way from the tree (the donor). The
outcome
is
highly
dependent
environmental factors.
upon
and
subject
to
innumerable
I’m not suggesting that cloning is a good idea.
Epigenetics demonstrates that cloning will fail to accomplish the egotistic ends
that sometimes motivate the desire to clone humans. Further, cloning is ultimate
expressing of unbridled egotism. The field of epigenetics is further proof that recreating a complete and exact genetic code cannot duplicate a human
individual.
Society will continue to see reproductive cloning as a crass and simplistic attempt
to create a monument to the clone’s parent’s ego, a monument that will too often
reflect badly on the parent.
Das geklonte Schaf dolly ist aus einer Euterzelle der Mutter entstanden, mit entsprechender
Praegung wodurch Dolly vorzeitige Alterserscheinungen zeigte und verstarb.
Source: www.coverbrowser.com/covers/time/78
“DNA Is Not Destiny The new science of epigenetics rewrites the rules of disease, heredity, and
identity.”: http://www.discover.com/issues/nov-06/cover/?page=1
11
Basics
Genetics
Epi-
Memory
Organism
Organisms (8/13)
Another phenotypic
variation ….
…. obviously ….
we are more than the
sum of our genes!
12-06-13
Madl
12
Many people assume that DNA precisely predetermines our body shapes,
personalities and diseases. The field of epigenetics, however, is disproving this.
“We appear to have a measure of control over our genetic legacy.” We need to
substantially revise our idea of genetics. All of the things people eat or smoke
“can affect our gene expression and that of future generations. Epigenetics
introduces the concept of free will into our idea of genetics.” The ramifications
go much further, though, and the stakes are extremely high.
The field of
epigenetics can serve as a bridge between biology and responsible politics ….
“We are more than the sum of our genes” (Klar 1998)
“You can inherit something beyond the DNA sequence” (Watson 2003)
Source: http://www.calisafe.org/_disc1/40000029.htm
12
Basics
Genetics
Epi-
Memory
Organism
Organisms (9/13)
Epigenetics & phenotypic variation:
Primacy of the environment
• development of multicell.
organisms
• environment-organism
interaction
• pathogenesis of diseases
•Environment shapes genetic code
(Changes of DNA-metabolism = genetic engineering genes)
Thaller, 1994
12-06-13
Madl
13
Genes are not destiny! Environmental influences, including nutrition, stress and
emotions, can modify those genes, without changing their basic blueprint.
And those modifications, epigeneticists have discovered, can be passed on to
future generations as surely as DNA blueprints are passed on via the Double
Helix [Reik and Walter 2001; Surard 2001] ….
i) Gene expression is conditioned by environment;
i) Developmental interactions occur from conception till death.
i) Depends on what environments and what sequence the organism encounters them
(psychosomatic axis).
Rewriting genes when necessaryis thus essential; (changes of DNA-metabolism = genetic
engineering genes)!
Source: Surani, M. A. H (2001) Reprogramming of genome function through epigenetic
inheritance. Nature Genet. 27, 255–256.
Wolf Reik & Jörn Walter (2001) Genomic imprinting: parental influence on the genome. Nature
Reviews Genetics 2, 21-32
DS Thaler (1994) The evolution of genetic intelligence. Science 264: 224-225
13
Basics
Genetics
Epi-
Memory
Organism
Organisms (10/13)
Another phenotypic variation ….
Sir Winston Leonard Spencer Churchill
(1874-1965)
•
•
•
•
•
•
•
Overweight
√√√
Drinker
√√√
Smoker
√√√
Exercise
--Healthy diet
--Stressy Job @ 80 (British PM)
Died @ age 90
12-06-13
Madl
14
xxx
14
Basics
Genetics
Epi-
Memory
Organism
Organisms (11/13)
Oeverkalix study
12-06-13
9:
07
)
A
N Wut E
ri PI
tio G
n EN
(0
ET
7:
00
IK
–
0
•exposure to cigarette smoke can lead to a transgenerational
effect but is restricted to boys.
•poor food supply of paternal grandparents was followed by
reduced mortality in grandchildren.
•rich food supply of paternal grandparents was followed by
increased mortality in grandchildren.
Madl
15
Oeverkalix-studie (unkonventionelle epigenetic): detaillierte aufstellung der
lebensgewohnheiten und todesursachen der grosseltern-generation;
i) systematische langzeitstudie mit 14·E3 kindern vor der pubertaet:
i) einfluss der ernaehrung auf koerpergewicht und gesundheit der nachkommen;
i) grosses nahrungsangebor bei den grossvaetern verkuerzte die lebenserwartung
der enkel (diabetesrisiko stieg an)
i) knappes nahrungsangebot bei den vaetern verrringerte das kardio-vaskulaere
und diabetes-risiko bei den kindern;
i) es hat sich gezeigt das epigenetische praegungen mindestens ueber 2
generationen anhalten koennen;
Source: Bygren, Lars Olov; Kaati, Gunnar; Edvinsson, Sören (2001) Longevity Determined by
Paternal Ancestors' Nutrition during Their Slow Growth Period
Acta Biotheoretica (2001) 49:53-59.
Marcus E Pembrey, Lars Olov Bygren, Gunnar Kaati, Sören Edvinsson, Kate Northstone, Michael
Sjöström, Jean Golding and The ALSPAC Study Team (2006) Sex-specific, male-line
transgenerational responses in humans. Eur J Hum Genet 14: 159-166
15
Basics
Genetics
Epi-
Memory
Organism
Organisms (12/13)
Starvation in Holland 1944
People exposed to undernutrition
in utero - 2nd gen. offspring had
….
• more diabetes
• 3-fold increase in coronary
heart disease prevalence.
• more pulmonary disease.
• increased levels of microalbuminuria.
12-06-13
People conceived in famine had ….
• F1-babies w / normal birth weights;
F2-babies weighed 200-300g less
• higher LDL/HDL cholesterol ratios.
• more likely to be obese.
• suffer from altered coagulation.
• consider th/vs psychologically less fit.
• aggerated response to stress - higher
blood pressure rise under stress.
•increased risk of stroke.
Madl
16
The Dutch famine near the end of World War II led to an increased incidence of
schizophrenia in adults who had been food-deprived during the first trimester of
their mothers' pregnancy. Malnourishment among pregnant women in the South
during the Civil War and the Depression has been proposed as an explanation for
the high incidence of stroke among subsequent generations.
Microalbuminuria occurs when the kidney leaks small amounts of albumin into
the urine. In other words, when there is an abnormally high permeability for
albumin in the renal glomerulus.
Weitere beispiele epigenetischer effekte
i) hungerwinter in Holland 1944 (NS-embargo): muetter mit mangelernaehrung
(400-800kcal tagesration) gebaren kinder mit niedrigem geburtsgewicht, diese
gebaren ihrerseits (trotz normaler ernaehrung) wieder untergewichtige kinder;
i) zum zeitpunkt der untersuchung () litten doppelt so oft an herz-kreislauferkrankungen wie ihre altersgenossen;
i) hauefiger brustkrebs und uebergewicht
Source: http://www.hongerwinter.nl/index.php?lang=english
RC Painter, TJ Roseboom, OP Bleker . Prenatal Exposure to the Dutch
Famine and disease in later life: an overview. Reprod Toxicol. 2005 SepOct; 20 (3): 345-352.
http://linkinghub.elsevier.com/retrieve/pii/S0890623805000882
16
Basics
Genetics
Epi-
Memory
Organism
Organisms (13/13)
Diethylstilbestrol (DES)
• active synthetic nonsteroidal estrogen
• first synthesized in 1938
• in 1971: was found to be a teratogen
when given to pregnant women
• DES was given to many pregnant
women in the late 1950s with their
daughters subsequently getting vaginal
cancer.
12-06-13
Madl
17
Diethylstilbestrol (DES) is a drug, an orally active synthetic nonsteroidal estrogen that was first
synthesized in 1938. In 1971 it was found to be a teratogen when given to pregnant women.
On April 15, 1971, the New England Journal of Medicine published a report by three physicians
at Massachusetts General Hospital on the association of DES therapy …. during the first trimester
of pregnancy by mothers of girls and young women were diagnosed with adenocarcinoma of the
vagina …. More than 30 years of research have confirmed that DES is a teratogen, an agent that
can cause malformations of an embryo or fetus. However, not all exposed persons will experience
the following DES-related health problems.
Image: Toxic end-points such as death or presence of a tumour are dependent on the sensitivity of
the strains which are used. Figure shows the response of two strains of rats to diethylstilbestrol.
In the outbred Sprague-Dawley rats there was a low incidence of spontaneous mammary tumours
(this was the only significant type), but this was reduced in the treated group. Exactly the opposite
was found in the ACI strain rats in which the treated group had over 70% tumours ….
Conclusions :
1. outcome of a conventional toxicity test depend entirely on the strain of animals which are used.
2. A toxicologist using Sprague-Dawley rats alone would have revealed that DES is not
carcinogenic in rats. If in the 1950s it was tested on ACI rats then it would have appeared to be
quite unsafe.
3. Toxicologists mostly use genetically heterogeneous rats and mice since on a random-bred stock
is more likely that at least a few individuals will respond to the administration.
Source: http://en.wikipedia.org/wiki/Diethylstilbestrol
http://dccps.nci.nih.gov/ACSRB/pubs/DES_Pubs/National_Education_Project/nationalproject.htm
l
Shellabarger,C.J., Stone,J.P., and Holtzman,S. (1978): Rat differences in mammary tumor
induction with estrogen and neutron irradiation. Journal of the National Cancer Institute, 61:15051508.
Herbst AL, Ulfelder H, Poskanzer DC (1971). "Adenocarcinoma of the vagina. Association of
maternal stilbestrol therapy with tumor appearance in young women". N Engl J Med 284 (15):
878–81.
17
Basics
Genetics
Epi-
Memory
Organism
Predisposition (1/7)
Triggering chain of events:
•stress factor (here, increase
of cytoplasmic temperature)
• enhances negative feedback
loop of HSC/HSP
Boodman & Blank, 2002
12-06-13
Madl
18
Negative feedback loop. The steady state concentration of the constitutive stress
protein hsc70 is shown by the fine line. Under conditions of stress, there is
enhanced expression of the HSP70 gene leading to the synthesis of the inducible
form, the molecular chaperone hsp70, shown by the heavy line. The
concentrations of both hsc70 and hsp70 are controlled by negative feedback,
indicated by the minus signs.
DNA sequence in the heat shock protein 70 (HSP70) promoter
Source: GOODMAN R & BLANK M (2002) Insights Into Electromagnetic
Interaction Mechanisms. JOURNAL OF CELLULAR PHYSIOLOGY 192:16 –
22
18
Basics
Genetics
Epi-
Memory
Organism
The dynamic balance between
Health & Disease
• Chaotic pattern;
i.e. non-linear dynamics
Bifurcation Pattern
12-06-13
Madl
19
Health & Disease: In case of brief disturbances, homeostasis is restored sooner
or later as the disturbance passes. On the other hand, if the disturbance or is
significantly long, a series of irreversible events bring the organism to a new
‘steady state’. Chronic disturbances favour development or differentiation of
“new” tissues (cancer as a result of prolonged and repetitive events of distress?).
However, the tumour cell as such does not exist: the bad cell, the bad virus =
HN15N, the bad bacteria = Mycobacterium tuberculosis, the bad plant =
Caulerpa taxifolia, the bad animal = Canis lupus, the bad individual = Homos
sapiens sapiens, the bad group of people = Iran, the evil state = Bush’s USA,
etc.). It just depends on the interaction with its surroundings (the relation is
much more important then the entities themselves). Here the disease itself
becomes a messenger, the vehicle that tries to communicate to the outside world /
brain (i.e. to the westener that sees the body as something separate from the
mind). Hence, disease is a just a mere tool of non-verbal communication.
Source: Ho M.W.; 2003; The Rainbow and the Worm: The Physics of Organisms; 2nd ed.; p.28;
Dürr H.P., Popp F.A., Schommers W., 2000; Elemente des Lebens; p.107-108, 132, 194;
19
Basics
Genetics
Epi-
Memory
Organism
Stressors of any kind shift the metabolic activity towards tasks that
are originally not the main objective of the cellular activity – reduces
the cell’s vitality.
12-06-13
Madl
20
The metabolic map shows tha various pathways that are essential for a cell’s
activity in performing its tasks within the organism. Once environmental
stressors from outside are introduced, the cellular system reacts (e.g. via
membrane receptors). In an attempt to mitigate (harmful) effects that may result
from a substance (e.g. xenobiotic), the cell allocates a certain amount of its
metabolic activity to counteract its interfering role. Doing so, the overall cellular
vitality to some extent becomes reduced.
The more stress-burdens are applied to the cell, the more the cell allocates
resources (at the expense of other, less vital metabolic activities) to deal with the
stressor. However, if the stress burden becomes too high, the cellular system
eventually collapses.
http://www.genome.jp/kegg/pathway/map/map01100.html
20
Basics
Genetics
Epi-
Memory
Organism
The dynamic balance
between Health & Disease
(Chronobiology):
Periodic Regulatory States
obtained from the correlated
SMARD-watch data:
Electro-Myogram,
Skin-Potential,
Skin-Resistance;
Balzer 2005
12-06-13
Madl
21
A regulatory state (e.g. sector 06) is determined by the variability of a regulatory process. Upon
stimulation, regulatory patterns become more rapid - shorter periods - right side of abscissa of this
sector. Faster regulatory patterns prevail in the event of activation. Relaxation, on the other hand
favors slower regulatory patterns (longer periods - left side of abscissa within the sector).
Examples of typical regulatory patterns: 17 corresponds to chronic stress; 11: deep relaxation; 5256: neurotic state; 62-66: depressive state. Coma patients are most likely to be found within the
more rigid regulatory pattern.
The Smard-Watch is thus an instrument suitable to monitor physiological response patterns of a
person under investigation. It is a tool to show how coherent this person interacts with its
surroundings. It also reveals the persons robustness to external stress factors.
Time structure manifests itself most clearly in the range of biological rhythms that extend over
some ten orders of magnitude from the millisecond oscillations of membrane action potentials to
10·E6 for circannual rhythms, which are coherent over varying spatial domains from single cells
to entire organs and from whole organisms to populations of organisms. This implies a vast
unexplored area, as the notion of non-linear, structured time is alien to the conventional
scientific framework.
21
Basics
Genetics
Epi-
Memory
Organism
Epigenetic modulation:
• induced via
i) DNA-methylation
i) histone-modification
i) siRNA
…. modify graph &
remove text of figure
….
Wang, 2008
12-06-13
Madl
22
The roles of epigenetic histone modifications in cell growth, proliferation and
differentiation is shown in the figure. We are interested in the epigenetic
mechanisms that regulate the expression of tumor suppressor genes (e.g. p53
target genes), which play important roles in cell cycle control and apoptosis. The
goal of our research is to unveil molecular mechanisms underlying epigenetic
gene silencing, and identify novel drug target for cancer treatment. Our research
has a broad implication to human physiology and diseases, including cancer,
innate immunity, and autoimmune diseases.
To investigate the roles of histone Arg modifications in transcription (Figure 2).
Recent work by us and many others have found that (1) promoter-specific
conversion of methyl-Arg to citrullination via demethylimination regulates the
expression of specific genes, such as p53 and estrogen receptor target-genes; (2)
it is also formally possible that reversible Arg methylation and demethylation
plays important role in gene regulation; (3) histone hypercitrullination by
peptidylarginine deiminase 4 plays a role in high order chromatin structure.
Source: http://www.bmb.psu.edu/faculty/wang/wang.html
22
Basics
Genetics
Epi-
Memory
Organism
Epigenetic modulation:
cooperation of
• genetic
and
epigenetic
alterations may cooperate in
the genesis of cancer.
• genetic change may precede
epigenetic change, and vice
versa
Bannister, 2008
12-06-13
Madl
23
Epigenetic alterations in the genesis of cancer - Genetic and epigenetic interplay
towards cancer. Much effort has been invested in identifying genetic mutations in
cancer. In inherited cancer syndromes this approach has proved successful.
Furthermore, mutations early in the genesis of common cancers have also been
identified and these are likely to be associated with tumour initiation. In contrast,
few specific genetic mutations have been linked to tumour progression, leading
Feinberg to suggest that epigenetic changes are involved. Epigenetic changes
occur without a change in the DNA sequence and they can be induced by various
factors. Thus it is possible, for example, that a DNA mutation leads to cellular
transformation, but induced changes in the epigenome of the transformed cell
enhances the probability that it will be capable of metastasising. In this scenario,
a genetic mutation can initiate the cancer but epigenetic change promotes its
progression.
Image: Epigenetic processes may also be involved in cancer initiation. It is
possible that epigenetic change may lead directly to cancer initiation.
Alternatively, changes already induced within the epigenome may 'prime' cells in
such a way as to promote cellular transformation upon a subsequent DNA
mutagenic event. In this case the epigenetic component of the cancer initiation is
intricately entwined with the genetic component. The involvement of epigenetic
change in cancer initiation is of course not mutually exclusive to it having also a
role in cancer progression as discussed above.
Source: http://www.abcam.com/index.html?pageconfig=resource&rid=10755&pid=10628
23
Basics
Genetics
Epi-
Memory
Organism
Cancer - Selection,
outgrowth
•more autonomous
growth
•ignore death and
senescence signals
•escape immune
surveillance
•trigger angiogenesis
•invasion, metastasis
Risk @ age 40: x10
Risk @ age 65: x100
12-06-13
Under the influence of epigenetics!
Madl
24
Chromosomal infrastructure is essential for gene control, determining both active and repressed
states. It is important not only to turn the right genes on but also to turn the right genes off.
Histones and chromatin components have key roles in this decision making process. If as few as
three inappropriate genes are turned off, a normal cell can be converted into a cancer cell. This
epigenetic silencing of genes underlies a new approach to cancer therapy. Mistargeting of these
enzymes leads to tumorigenesis, but inhibition of their activity presents a novel approach to
therapy.
The list of genes that are found to be inactivated by DNA methylation events is growing rapidly
and includes genes involved in the following:
• Signal transduction cascade pathways.
• Cell cycle regulation.
• Angiogenesis.
• Apoptosis.
• DNA repair
Recent Cancer methylation studies predict that hundred (100) of CPG islands could be methylated
in a tumor cell. However, it is clear that both the genome-wide methylation studies and candidate
gene approaches that each tumor type may have its own set of cancer cell type specific genes that
are more susceptible to methylation. Thus each cancer type may have the potential to be typed or
classified according to methylation profile.
Cancer is usually a disease of old age (Bookmarking). It is not due to a single gene. Cancer is
also not a static disease; some tumors (eg colon, breast, melanoma, cervical, pancreatic, bladder,
lung etc) display a progression from benign to pre-malignant to invasive to metastatic stages.
Increasing numbers/kinds of genetic abnormalities correspond to progression.
• Liquid tumours (leukemias, lymphomas): Precursors already mobile and invasive. Only one
or two mutations may be required.
• Solid tumours – epithelial or mesenchymal. Most human cancers arise from epithelium.
Precursors are immobile. At least three to five mutations, in different pathways, appear to be
required to develop solid tumours in adults. Rb, p53, RAS and telomerase (TERT) pathways.
24
Basics
Genetics
Epi-
Memory
Organism
Cancer (1/5)
C
an
ce
rC
lu C
st a
er ta
-v ly
id st
eo
(0
0:
22
-0
1:
30
Nature Rev Cancer 5:676, 2005
J Mamm Gland Biol Neo 6:235, 2001
)
Breast cancer:
12-06-13
Madl
25
Breast cancer: BRCA gene is a breast cancer susceptibility gene, that is tumor suppressor gene
responsible for both normal development and carcinogenesis in breast. BRCA1, reveals multi
functional protein involved in DNA repair. Cell cycle regulation, transcription and apoptosis.
BRCA1 mutations may play a significant role in the tumor-genesis of familial breast cancer.
Breast cancer model: COX2 = prostaglandin-endoperoxide synthase 2; often overexpressed in
DCIS;
• Increases HMEC growth,
• estrogen synthesis,
• mutagen production,
• angiogenesis,
• invasion potential,
• decreases immune surveillance and apoptosis
Normal epithelial cells:
Proliferate and form spheroids (acini) with hollow lumens and polarized surrounding cells.
Resembles in vivo structures eg lumenal secretory cells surrounding lumen; surrounded by
myoepithelial cells that are in contact with basement membrane.
Breast tumour cell lines:
Proliferate but do not form acini; form nonpolarized, disordered clusters with limited
differentiation.
Similar to IDBC where tumour cells form nests, poorly formed tubules, cords and sheets with
cell-cell junctions.
Reversed by eg down-regulation/blocking function of b1-integrin and EGFR; or inhibition of
MAPK or PI3K pathways; or restoration of dystroglyan (DG1; polarization) or CEACAM1
(adhesion molecule) expression.
Source: Nature Rev Cancer 5:676, 2005 & J Mamm Gland Biol Neo 6:235, 2001
25
Basics
Genetics
Epi-
Memory
Organism
Cancer (2/5)
Ep
ig
en
et
ic Ca
svi tal
d e ys
o t
(0
4:
00
-0
4:
40
)
Metastasis:
• Intravasion
• Extravasion
Nat Rev Cancer. 2002;2:563-72
12-06-13
Madl
26
Steps in metastasis:
• Detachment from primary tumour (intravasion): due to invasion into vessels or abnormal
vessels; may involve decreased levels adhesion molecules (e.g. cadherins), increased
expression of proteases (e.g. metaloproteinases) and motility factors (e.g. Scatter Factor);
• Tumour cell arrest: cells are large compared to capillaries, so lodge in first capillary bed
encountered (lung, liver);
• Extravasion of tumour cells: attachment to and invasion through endothelium and basement
membrane/matrix; involves adhesion molecules and proteases;
26
Basics
Genetics
Epi-
Memory
Organism
Cancer (3/5)
Metastasis:
• Fighting cancer with angiogenesis
blocker increases virulence of
metastatic cells
•Symptomatic cure does not include
epigenetic modulation
Mazzone et al., 2009
12-06-13
Madl
27
A key function of blood vessels, to supply oxygen, is impaired in tumors because
of abnormalities in their endothelial lining. PHD proteins serve as oxygen sensors
and may regulate oxygen delivery. We therefore studied the role of endothelial
PHD2 in vessel shaping by implanting tumors in PHD2+ mice. Hap-lod
efficiency of PHD2 did not affect tumor vessel density or lumen size, but
normalized the endothelial lining and vessel maturation. This resulted in
improved tumor perfusion and oxygenation and inhibited tumor cell invasion,
intravasation, and metastasis. Haplod efficiency of PHD2 redirected the
specification of endothelial tip cells to a more quiescent cell type, lacking
filopodia and arrayed in a phalanx formation. This transition relied on HIFdriven upregulation of (soluble) VEGFR-1 and VE- cadherin. Thus, decreased
activity of an oxygen sensor in hypoxic conditions prompts endothelial cells to
readjust their shape and phenotype to restore oxygen supply. Inhibition of PHD2
may offer alternative therapeutic opportunities for anticancer therapy.
Image: (D and E) Panc02 tumors (yellow line) are more invasive and metastatic
in WT than PHD2+ mice, as evidenced by hemorrhagic ascites, metastatic
nodules (blue line), jaundiced liver, and liver metastases (arrowheads).
Source: M. Mazzone, D. Dettori, R. Leite de Oliveira, S. Loges, T. Schmidt, B. Jonckx, Y. Tian,
A. Lanahan, P. Pollard, C. Ruiz de Almodovar (2009). Heterozygous Deficiency of PHD2
Restores Tumor Oxygenation and Inhibits Metastasis via Endothelial Normalization. Cell,
Volume 136, Issue 5, Pages 839-851.
27
Basics
Genetics
Epi-
Memory
Organism
Cancer (4/5)
Cancer protection gene:
• Less than 5 % of cancer cases are
due to an inherited predisposition
(incl.epigenetics).
• Epigenetics modulates expression
of natural cancer suppression gene
activity.
Maga et al., 2007
12-06-13
Madl
28
Specialized DNA polymerases (DNA pols) are required for lesion bypass in human cells1.
Auxiliary factors have an important, but so far poorly understood, role. Here we analyse the
effects of human proliferating cell nuclear antigen (PCNA) and replication protein A (RP-A) on
six different human DNA pols—belonging to the B, Y and X classes—during in vitro bypass of
different lesions. The mutagenic lesion 8-oxo-guanine (8-oxo-G) has high miscoding potential. A
major and specific effect was found for 8-oxo-G bypass with DNA pols l and g. PCNA and RP-A
allowed correct incorporation of dCTP opposite a 8-oxo-G template 1,200-fold more efficiently
than the incorrect dATP by DNA pol l, and 68- fold by DNA pol g, respectively. Experiments
with DNA-pol-l- null cell extracts suggested an important role for DNA pol l. On the other hand,
DNA pol i, together with DNA pols a, d and b, showed a much lower correct bypass efficiency.
Our findings show the existence of an accurate mechanism to reduce the deleterious consequences
of oxidative damage and, in addition, point to an important role for PCNA and RP-A in
determining a functional hierarchy among different DNA pols in lesion bypass.
Numerous investigations of the epidemiology of cancer reveal that only 5 to 10% of breast,
prostate or bowel cancer and 1-2% of melanoma cases are attributable to genetic mutations, while
the large bulk does not involve an inherited predisposition at all. [2,3]
Image: Proportion of cases of breast cancer that involve an inherited predisposition
(susceptibility).
Source: http://www.genetics.com.au/factsheet/fs51.html
[1] Maga G, Villani G, Crespan E, Wimmer U, Ferrari E, Bertocci B, Hübscher U. (2007) 8-oxo-guanine bypass by human
DNA polymerases in the presence of auxiliary proteins. Nature 447, 606-608.
[2] Willett W.C. (2002). Balancing Life-Style and Genomics Research for Disease Prevention. Science, Vol.296(5568):
695-698.
[3] Barlow-Stewart K., Dunlop K., Reid V., Saleh M. (2007). The Australian Genetics Resource Book. Centre for Genetics
Education. Fact Sheet No. 48, 49, 50, 51; available online: www.genetics.edu.au/factsheet
28
Basics
Genetics
Epi-
Memory
Organism
Cancer (5/5)
Conventional vs. holistic
approach:
• reintegration of the
diseased part
• restoration of the
holobiont
Payrhuber et al., 2007
12-06-13
Madl
29
However,
• Tumor cell lost contact with surrounding (no longer able to interact with
its closer environment);
• Uncontrolled growth; divides continuously (mitosis), not knowing when to
stop;
• As outlined so far and according to epigenetics …. a tumor cell as such does
not exists (tumor is a process).
Source: Payrhuber D., Frass M., Madl P.: Information Alters Matter; Proceedings
of the 6th Biosemiotic Gathering, Umweb (Helsinki 2007);
29
Basics
Genetics
Epi-
Memory
Organism
Implications (1/13)
Bookmarking:
Cocaine consume & Histone modifications
Kumar et al., 2005
Experiment
Gene
Results
30 min.
Acute Cocaine
1 hr.
cFos
------- Acetylated H4 -------
FosB
Acetylated H4
90 min.
3 hr.
1 day
7 days
-- Phosphoacetylated H3 -Chronic Cocaine
Cocaine Withdrawal
12-06-13
FosB
Acetylated H3
BDNF
------------------------------ Acetylated H3 ----------------------------
Cdk5
------------------------------ Acetylated H3 ----------------------------
BDNF
----------- Acetylated H3: Levels rise to 3-fold to 14-fold after 7 days ------------
Cdk5
----------- Acetylated H3: Levels rise to 3-fold to 14-fold after 7 days -------------
Madl
30
The researchers found chemical modifications to histone 3 (H3) and histone 4
(H4)—major proteins that form the structure of chromosomes—at areas linked
with four genes. Acetylation of H3 and H4 and phosphoacetylation of H3 alter
the proteins' chemical structure, facilitating gene activation.
• Acute Cocaine: Rats received a single injection, either saline or cocaine (20
mg/kg).
• Chronic Cocaine: Rats received an injection of either saline or cocaine (20
mg/kg) daily for 7 days.
• Cocaine Withdrawal: Rats received an injection of either saline or cocaine (20
mg/kg) daily for 7 days and did not receive the drug again.
Source: www.nida.nih.gov/NIDA_notes/NNvol21N4/gene.html
Arvind Kumar, Kwang-Ho Choi, William Renthal, Nadia M. Tsankova, David E.H. Theobald,
Hoang-Trang Truong, Scott J. Russo, Quincey LaPlant, Teresa S. Sasaki, Kimberly N. Whistler,
Rachael L. Neve, David W. Self, and Eric J. Nestler (2005) Chromatin remodeling is a key
mechanism underlying cocaine-induced plasticity in striatum. Neuron 48(2):303-314.
30
Basics
Genetics
Epi-
Memory
Organism
Implications (2/13)
Bookmarking - Stress:
•
•
•
•
psychological abuse
HPA-axis
increased risk of depression
increased risk of suicide
McGowan et al.,2009
12-06-13
Madl
31
Brona McVittie reports that child abuse can leave epigenetic marks on DNA, a team of McGill
University and Douglas Institute scientists recently explored the links that such changes might
have on the likelihood of abuse victims to commit suicide. They looked at epigenetic marks on
genes that mediate our stress-response.
Increased levels of maternal cortisol during pregnancy affect the development of the embryonic
brain – it will so to speak tuned to a stressy environment; although the offspring is not necessarily
depressive, it tends to show an increased risk to suffer from depression later in life. In young
age, these children reveal a disrupted regulatory pattern of the psyche.
Source: Wiggins R.C. & Gottesfeld Z. (1986). Restraint stress during late pregnancy in rats elicits
early hypermyelination in the offspring. Metabolic Brain Disease 1(3): 197-203.
31
Basics
Genetics
Epi-
Memory
Organism
Implications (3/13)
Bookmarking - Allergy:
• DNA-methylation &
histone modifications
• HPA-axis
•
Garcia et al., 2007
12-06-13
Madl
32
Allergy medications may indeed make a subsequent allergic attack even stronger, according to a
study. Pal Johansen at the University of Zurich, Switzerland, conducted a study on mice to
determine the long-term effects of antihistamines …. He and his colleagues injected 50 mice with
bee venom, a substance to which almost all organisms develop an allergy upon exposure. Half of
the mice were also given 100 micrograms of the antihistamine Clemastine just before they were
given venom, and 100 micrograms on each of the two days afterwards. After six weeks, the
researchers injected the mice with another dosage of bee venom, and monitored the allergic
reactions. They found that mice given antihistamines reacted more violently to the second venom
injection. “We believe that the antihistamines were doing more than disrupting the immediate
immune reaction to the first venom dosage. We think they were also keeping the immune system
from getting used to that dosage”. The findings, published in Clinical and Experimental Allergy,
suggest that the mice on allergy medication had not developed tolerance to the allergen.
Epigenetic factors are chemically stable, potentially reversible, and can be modulated or induced
by environmental factors. In the case of allergic disease, epigenetics could explain not only the
discordances observed between monozygous twins but also phenomena such as incomplete
penetrance, variable expression, gender and progenitor effects, and sporadic cases. …. Among the
different epigenetic factors, mention must be made of DNA methylation, covalent histone
modifications, and other mechanisms that include different protein complexes and RNA-mediated
modifications. The regulatory effect of these phenomena upon immune response has important
implications for allergic diseases. At present, different lines of pharmacological research are
being conducted, based on the modulation of epigenetic factors, modifying expression of the
genes that encode for proteins implicated in allergic processes. Among such modulators, mention
can be made of antisense oligonucleotides, ribozymes and interference RNA.
Source: Isidoro-García M, Dávila-González I, Pascual de Pedro M, Sanz-Lozano C, LorenteToledano F (2007): Interactions between genes and the environment. Epigenetics in allergy.
Allergol Immunopathol (Madr). 35(6):254-8
32
Basics
Genetics
Epi-
Memory
Organism
Implications (4/13)
Bookmarking - Trauma:
•
•
•
•
suppressed innate immune system
adaptive immune system affected
susceptible to viral-, & bacterial- infection
dormant “pathogens” more virulent
NZZ, 2009
12-06-13
Madl
33
Kindsmissbrauch scheint epigenetische Veränderungen hervorzurufen - Missbrauch schwächt das
Immunsystem. Sind Kleinkinder körperlicher Bestrafung oder Missbrauch ausgesetzt, kann dies
später im Leben zu starken psychischen Leiden wie Depressionen führen. Aber nicht nur extreme
Formen frühkindlicher Erlebnisse hinterlassen Spuren: Nach einer schweren Kindheit ist auch das
Immunsystem Jahre später noch geschwächt. Manche Verwundungen bleiben ein Leben lang.
Schlimme Erfahrungen in der Kindheit hinterlassen jedoch nicht nur Narben in der Seele, sondern
auch im Körper. Amerikanische Kinderärzte und Psychologen zeigen nun, dass Stress in der
frühen Kindheit dauerhaft das Immunsystem schwächen kann (PNAS, online). "Die emotionale
Umgebung wirkt sich sehr lange auf die Gesundheit aus", sagt S.Pollak von der University of
Wisconsin in Madison, der die Studie geleitet hat.
Die Wissenschaftler haben 155 Jugendliche untersucht. Von ihnen hatten 80 eine vergleichsweise
glückliche Kindheit ohne Traumatisierung erlebt - ihr Immunsystem war intakt. Jene 34
Jugendlichen in der Studie, die körperlich missbraucht worden waren und daher in emotional
instabilen Verhältnissen aufwuchsen, konnten sich hingegen nicht gut gegen Viren, Bakterien und
andere Eindringlinge wehren. ie Mediziner analysierten, wie das Abwehrsystem ihrer Probanden
auf Herpes-Simplex-Viren, Typ 1 (HSV-1), reagierte. Mehr als zwei Drittel der Bevölkerung
tragen die Erreger von Fieberbläschen und Halsschmerzen in sich, ohne deshalb gleich
Beschwerden zu haben. Symptome treten erst auf, wenn das Virus reaktiviert wird - unter Stress,
im Krankheitsfall und wenn das Immunsystem auf andere Weise beeinträchtigt ist. Jugendliche,
die in ihrer Kindheit missbraucht worden waren, konnten in der aktuellen Studie die Herpes-Viren
in ihrem Körper nicht gut in Schach halten. Sie mussten mehr Antikörper gegen die Erreger
produzieren und auch andere Abwehrmechanismen ihres Immunsystems waren geschwächt. "Bei
der Geburt ist unser Immunsystem noch nicht vollständig ausgeprägt", sagt Christopher Coe von
der University of Wisconsin, der an der Studie beteiligt war. "Die Zellen sind zwar vorhanden,
aber wie sie sich entwickeln und reguliert werden, ist davon abhängig, wie man aufwächst.”
Source: Shirtcliff E.A. Coeb C.L. Pollakc S.D. (2009) Early childhood stress is associated with
elevated antibody levels to herpes simplex virus type 1. PNAS 106 (8): 2963-2967
33
Basics
Genetics
Epi-
Memory
Organism
Implications (5/13)
Paramutation - Parental loss (orphans):
…. in mice ….
• overstimulated immune system due to chronic
stress stimulation
• low birth weight (<85%) & growth retardation
• increased mortality (mortality >88%)
• loss of maternal insticts
Pennisi, 2001
12-06-13
Madl
34
Forscher untersuchten die Immunreaktion Jugendlicher und junger Erwachsener, die ihre früheste
Kindheit in Waisenhäusern in Rumänien zugebracht hatten, aber nun in stabilen Verhältnissen in
Adoptivfamilien lebten. Das Abwehrsystem dieser 41 Probanden war ähnlich stark geschwächt
wie das der Jugendlichen, die körperlich missbraucht worden waren. "Diese Kinder hatten zwar
eine schwierige Kindheit, erleben aber seit mehr als einem Jahrzehnt erleben emotionale
Sicherheit", sagt Pollak. "Trotzdem steht ihr Körper unter Stress als ob sie missbraucht worden
wären.“
In order to increase his country's population and workforce, in 1966, communist dictator Nicolai
Ceausescu set Romania's banned birth control and abortion and created financial incentives for
women to have more children. The birth rate soared. So did child abandonment. When Ceausescu
fell from power in 1989, the scale of his social experiment would come to light. According to
NGO estimates, more than 170,000 orphans were languishing in orphanages under appalling
conditions.
A mouse lacking an imprinted gene called Mest fails to retrieve and care for her pups the way a
normal female does …. Mest (also called Peg1), is paternally expressed during development,
especially in the mesoderm. Loss of Mest decreases body size and birthweight to less than 85% of
normal, with weight continually decreasing with time after birth …. Lacking a clear causal
explanation in the offspring, researchers looked to the behavior of Mest-deficient mothers to
explain this significantly increased mortality. These mothers had 88% of their offspring die,
regardless of the genotype of the offspring (Mest-deficient vs. Mest-positive). These same pups
could be successfully fostered with normal wild-type females, suggesting that deficiencies in the
maternal behavior of the mothers were the cause of mortality. Analyses of maternal behavior in
Mest-less females showed that while they approached and sniffed their pups just like normal
mothers, they were severely impaired in other aspects of the maternal behavioral repertoire. They
the pups unattended for long periods, they did not retrieve them, and their nest building skills
were impaired (Lefebvre et al.).
Source: Elizabeth Pennisi (2001) Behind the Scenes of Gene Expression. Science Vol. 293. no.
5532, pp. 1064 – 1067.
Lisa M. Goos, Irwin Silverman (2001). The influence of genomic imprinting on brain
development and behavior. Evolution and Human Behavior Vol.22, Issue 6: 385-407.
Lefebvre, L., Viville, S., Barton, S.C., Ishino, F., Keverne, E.B. and Surani, M.A., 1998.
Abnormal maternal behavior and growth retardation associated with loss of the imprinted gene
Mest. Nature Genetics 20, pp. 163–169
34
Basics
Genetics
Epi-
Memory
Organism
Implications (6/13)
Bookmarking – Parental misguidance:
• excessive austereness
• lack of personal freedom
leads to
• emotional instability (depression)
UNsafe at Home, 2008
12-06-13
Madl
35
Psychiatrists are also getting interested in the role of epigenetic factors in diseases like
schizophrenia, Dr. Petronis said. Methylation that occurs after birth may also shape such
behavioral traits as fearfulness and confidence, said Dr. Michael Meaney, a professor of medicine
and the director of the program for the study of behavior, genes and environment at McGill
University in Montreal. For reasons that are not well understood, methylation patterns are absent
from very specific regions of the rat genome before birth. Twelve hours after rats are born, a new
methylation pattern is formed. The mother rat then starts licking her pups. The first week is a
critical period, Dr. Meaney said. Pups that are licked show decreased methylation patterns in an
area of the brain that helps them handle stress. Faced with challenges later in life, they tend to be
more confident and less fearful. "We think licking affects a methylation enzyme that is ready and
waiting for mother to start licking," Dr. Meaney said. In perilous times, mothers may be able to
set the stress reactivity of their offspring by licking less. When there are fewer dangers around,
the mothers may lick more.
Andauernde Strenge oder emotionale Kälte ziehen nicht selten eine erhöhte Stressanfälligkeit
oder spätere Angstzustände nach sich. Seit 1997 zeigten Michael Meaney und seine Kollegen dass
Ratten, welche in den ersten Lebenswochen in den Genuss von vermehrter mütterlicher Fürsorge
gekommen waren, sprich besonders häufig gewärmt und abgeleckt wurden, später gelassener in
Stresssituationen reagierten als Artgenossen, welche in der gleichen Zeit vernachlässigt worden
waren. Die gut umsorgten Rattenkinder waren als erwachsene Tiere beispielsweise weniger
ängstlich und wagten sich früher von einem dunklen in einen hell beleuchteten Käfig. Im Gehirn
der Tiere äusserte sich dies auf molekularer Ebene im Hippocampus, einer für die Stressreaktion
mitverantwortlichen Hirnregion. Die gut umsorgten Ratten wiesen dort eine erhöhte Anzahl von
Glucocorticoid-Rezeptoren auf, das sind die Andockstellen für Glucocorticoide, eine Gruppe von
Hormonen, welche unter anderem die Stressreaktion regulieren. Diese Hormone werden auf
Anregung des Gehirns in Gefahren- oder Stresssituationen von der Nebenniere ins Blut
ausgeschüttet und erhöhen so die momentane Alarmbereitschaft des Körpers. Da Glucocorticoide
aber auch den Blutdruck und den Blutzuckergehalt anheben und so auf Dauer
gesundheitsgefährdend sind, muss ihre Ausschüttung stets überwacht werden: Über das Blut
gelangen die Hormone ins Gehirn, wo ihre Konzentration durch die Glucocorticoid-Rezeptoren
gemessen wird. Je mehr dieser Rezeptoren vorhanden sind, desto weniger der Hormone werden in
der Folge produziert, was eine Abfederung der Stressreaktion und einen entspannteren Umgang
mit stressigen Situationen bewirkt. Es zeigte sich, dass das Glucocorticoid-Rezeptor-Gen bei den
misshandelten Personen deutlich stärker methyliert war und weniger der mRNA im Hippocampus
vorhanden war als bei den nicht misshandelten Suizidopfern und den natürlich Verstorbenen. In
35
Basics
Genetics
Epi-
Memory
Organism
Implications (7/13)
Paramutation - Depression:
exposure to maternal mood:
• alteres HPA-response in offspring
• modified Glucocorticoid-Receptor
• increased rate of methylation
(NR3C1 gene)
Oberlander et al., 2008
12-06-13
Madl
36
In animal models, variations in early maternal care are associated with differences in
hypothalamic-pituitary-adrenal (HPA) stress response in the offspring, mediated via changes in
the epigenetic regulation of glucocorticoid receptor (GR) gene (Nr3c1) expression. Objective: To
study this in humans, relationships between prenatal exposure to maternal mood and the
methylation status of a CpG-rich region in the promoter and exon 1F of the human GR gene
(NR3C1) in newborns and HPA stress reactivity at age 3 months were examined. Methods: The
methylation status of a CpG-rich region of the NR3C1 gene, including exon 1F, in genomic DNA
from cord blood mononuclear cells was quantified by bisulfite pyrosequencing in infants of
depressed mothers treated with a serotonin reuptake inhibitor antidepressant (SRI) (n=33), infants
of depressed non treated mothers (n=13) and infants of non depressed/non treated mothers (n=36).
To study the functional implications of the newborn methylation status of NR3C1 in newborns,
HPA function was assessed at 3 months using salivary cortisol obtained before and following a
non noxious stressor and at a late afternoon basal time. Results: Prenatal exposure to increased
third trimester maternal depressed/anxious mood was associated with increased methylation of
NR3C1 at a predicted NGFI-A binding site. Increased NR3C1 methylation at this site was also
associated with increased salivary cortisol stress responses at 3 months, controlling for prenatal
SRI exposure, postnatal age, and pre and postnatal maternal mood. Conclusions: Methylation
status of the human NR3C1 gene in newborns is sensitive to prenatal maternal mood and may
offer a potential epigenetic process that links antenatal maternal mood and altered HPA stress
reactivity during infancy.
Source: Tim F. Oberlander, Joanne Weinberg, Michael Papsdorf, Ruth Grunau, Shaila Misri
&Angela M. Devlin (2008). Prenatal exposure to maternal depression, neonatal methylation of
human glucocorticoid receptor gene (NR3C1) and infant cortisol stress responses. Epigenetics,
Vol. 3(2): 97-106
36
Basics
Genetics
Epi-
Memory
Organism
Implications (8/13)
Chronic Fear:
•
•
•
•
•
•
Increase in heart rate
altered heart rate variability
change in skin resistance
hormonal changes (adrenaline)
altered sense perception (hearing!)
Holsboer, 2009
12-06-13
Madl
37
Durch gravierende äußere Einflüsse kann die Aktivierbarkeit unserer Gene
dauerhaft verändert werden. Diese akuten Ereignisse können bereits beim Fetus
im Mutterleib Veränderungen auf unsere Erbsubstanz hinterlassen (Abbildung 3).
Besonders wichtig sind solche Prägungen aber in der frühkindlichen
Entwicklung. So wissen wir, dass Kleinkinder, die schweren körperlichen
Bestrafungen, Missbrauch, aber auch emotionaler Vernachlässigung ausgesetzt
waren, ein größeres Erkrankungsrisiko für Depression besitzen. In all diesen
Fällen finden sich lebenslang Veränderungen der Stresshormonregulation. Die
biochemischen Ursachen dieser erworbenen Veranlagungen fassen wir unter dem
Begriff „Epigenetik“ zusammen. Im Tierexperiment haben verschiedene
Forschergruppen, vor allem in Kanada, den USA, aber auch am Max-PlanckInstitut für Psychiatrie in München gezeigt, wie molekulare Mechanismen im
Zusammenhang mit der physiologischen Anpassung an Stresssituationen stehen
und wie durch Traumata in frühen Entwicklung biochemische Veränderungen auf
unserer Erbsubstanz verursacht werden. Solche epigenetischen Veränderungen
gibt es auch beim Menschen.
Source: http://www.holsboer.de/PDF/Aktuelles_Rotary%20Club_Vortrag.pdf
37
Basics
Genetics
Epi-
Memory
Organism
Implications (9/13)
Paramutation - Child abuse:
•
•
•
•
•
•
•
lack of paternal love & affection
methylation of genes
changes in Hippocampus
psychological instability
increased risk of depression
passed on to next generation
increases risk of suicide
Meaney & Szyf, 2004
12-06-13
Madl
38
Gewalt in der Kindheit hinterlässt offenbar Spuren am Erbgut der Betroffenen.
Das zeigt eine Studie kanadischer Forscher an Suizidopfern. Vernachlässigung
und Missbrauch in der frühen Kindheit können die Hirnchemie der Opfer
zeitlebens verändern. Auf welchem Wege die traumatischen Eindrücke ihre
Spuren in den Neuronen hinterlassen, ist eines der großen Rätsel der
Hirnforschung. Eine Studie kanadischer Forscher an Suizidopfern deutet aber
darauf hin, dass Gewalterlebnisse und fehlende Liebe die Aktivität der Gene im
Hippocampus verändern können, der Hirnregion, die bei der Verarbeitung von
Emotionen eine zentrale Rolle spielt. Diese Veränderungen könnten auch der
Grund dafür sein, dass sich die Menschen das Leben genommen haben, vermuten
die Forscher in dem Bericht, der am Mittwoch im Fachblatt PLoS One (Bd. 3,
e2085).
In Versuchen an Ratten hatte seine Arbeitsgruppe allerdings bereits vor vier
Jahren gezeigt, dass das Verhalten der Mutter das Genaktivierungsmuster in den
Gehirnen von neugeborenen Ratten nachweislich beeinflusst. "Ähnliche
Beobachtungen haben wir auch in unserem Labor gemacht", sagt Marcus Ising
vom Max-Planck-Institut für Psychiatrie in München. "Die Studie zeigt, dass sich
diese Resultate offenbar auf den Menschen übertragen lassen.”
Source: Meaney MJ, Szyf M. (2005) Environmental programming of stress responses through
DNA methylation: life at the interface between a dynamic environment and a fixed genome.
Dialogues Clin Neurosci.7(2):103-2
38
Basics
Genetics
Epi-
Memory
Organism
Implications (10/13)
Paramutation - Prenatal Stress:
• increased DNA methylation in
newborn
• increased stress hormone level in
newborn
• low gonadal weight
• increased risk of diabetes
• increased risk of cardiovascular
disease during adult life
Gonadal-somatic index (gonadal weight vs. body weight) of prenatal
stressed and control offsprings from LNL and HNL groups
Rodriguez et al. 2007
12-06-13
Madl
39
Prenatal stimulations have been shown to have long-term effects on at reproductive activity. We
evaluated the influence of the prenatal stress on the hypothalamic-pituitary-gonad (HPG) axis in
male rat-offsprings from mothers with high number of offsprings per litter (HNL) and low
number of offsprings per litter (LNL) after hypothesizing that the number of offsprings per litter
may modify the effect of the prenatal stress on the HPG of adult offsprings …. The offspring
males coming from LNL showed a decrease in testicle weight and TES levels, without changes in
the plasmatic LH levels. However, the offspring of HNL showed a decrease of LH levels. It is
possible to conclude that in LNL prenatal stress would produce alterations to gonadal level, while
in HNL the effect of stress would be evident at pituitary level.
Image: Gonadal-somatic index (gonadal weight vs. body weight) of prenatal stressed and control
offsprings from LNL and HNL groups.
Einfluss der Eltern vor der Geburt: Dennoch deutet die neue Studie gemeinsam mit den
Untersuchungen an Ratten darauf hin, dass frühkindliche Erfahrungen epigenetische
Veränderungen auslösen können, die das ganze Leben beeinflussen. Wie Psychologen und
Kinderärzte unter der Leitung von Tim Oberlander von der Universität von British Columbia in
Vancouver vor einem Jahr aufzeigen konnten, beginnt der Einfluss der Mutter auf die Epigenetik
des Kindes bereits vor der Geburt. Das Forscherteam begleitete angehende Mütter vom zweiten
Trimester der Schwangerschaft an bis nach dem Gebären. Mit Hilfe von psychologischen Tests
wurden die Schwangeren entweder als besonders ängstlich und zu Depressionen neigend oder als
emotional unbelastet eingestuft. Wie sich herausstellte, gebaren ängstliche oder depressive Mütter
Kinder, in deren Blut die Forscher schon bei der Geburt Anzeichen einer erhöhten DNAMethylierung des Glucocorticoid-Rezeptor-Gens fanden. Entsprechend wiesen diese Säuglinge
dann im Alter von drei Monaten erhöhte Stresshormonwerte auf. Obwohl ein postnataler
Einfluss nicht ganz ausgeschlossen werden kann, deuten diese Resultate an, dass bereits die Zeit
während der Schwangerschaft ausreicht, um die Stressresistenz eines Kindes über epigenetische
Mechanismen zu prägen.
Source: Meaney MJ, Szyf M. (2005) Maternal care as a model for experience-dependent
chromatin plasticity? Trends Neurosci. 28(9):456-63
RODRIGUEZ, Nancy, MAYER, Nora y GAUNA, Héctor F. (2007) Effects of prenatal stress on
male offspring sexual maturity. Biocell (Mendoza) 31(1): 67-74.
39
Basics
Genetics
Epi-
Memory
Organism
Paramutation - Parental diet:
•
•
•
•
low birth weight
increased risk of obesity
increased risk of diabetes
increased risk of
cardiovascular disease during
adult life
Jimenez–Chillaron et al.,2008
12-06-13
Madl
40
The modern western diet, so full of fats and sugars, could be exerting epigenetic
effects on future generations, positive or negative. Abnormal methylation patterns
are a hallmark of most cancers, including colon, lung, prostate and breast cancer,
said Dr. Peter Laird, an associate professor of biochemistry and molecular
biology at the University of Southern California School of Medicine. The
anticancer properties attributed to many foods can be linked to nutrients, he said,
as well as to the distinct methylation patterns of people who eat those foods.
An expectant mother might well logically reason that what she eats will affect her
unborn child. But the evidence is mounting that not only her children, but her
grandchildren and subsequent generations will be affected by her nutrition. What
she eats may not only affect her descendants as they develop, but potentially
throughout their adult lives.
A recent study published in Diabetes by Josep Jimenez–Chillaron and colleagues
indicate that low birth weight is associated with increased risk of obesity,
diabetes and cardiovascular disease during adult life, the team wanted to know
whether such disease risks might be passed on to future generations.
Source: http://epigenome.eu/en/1,63,0 &
http://blog.plantpoisonsandrottenstuff.info/category/vitamins/
Josep C. Jimenez-Chillaron, Elvira Isganaitis, Marika Charalambous, Stephane Gesta, Thais
Pentinat-Pelegrin, Ryan R. Faucette, Jessica P. Otis, Alice Chow, Ruben Diaz, Anne FergusonSmith & Mary-Elizabeth Patti (2008) Intergenerational Transmission of Glucose Intolerance and
Obesity by In Utero Undernutrition in Mice. Diabetes 58:460-468.
Melissa Woo1 and Mary-Elizabeth Patti (2008). Diabetes Risk Begins In Utero. Cell Metabolism,
Volume 8, Issue 1: 5-7.
40
Nucleus
Cell
Organism
Population
Biophysics
Paramutation - Obese Babies:
•
•
•
•
obese mothers give birth to obese babies
20 genes seem to be involved
however, only 1-3% is gene-related
metabolic related diseases in later life
Jimenez–Chillaron et al.,2008
12-06-13
Madl
41
Nach neuen Forschungsarbeiten spielt neben einer bestehenden Stoffwechselstörung der Mutter
wie einem Diabetes auch ihr Gewicht vor und während der Schwangerschaft eine wichtige Rolle.
Dicke Mütter bekommen demnach viel häufiger dicke Kinder als normalgewichtige Frauen
.... Für das Übergewicht der Mütter sind verschiedene Faktoren ausschlaggebend. Man kennt
heutzutage rund 20 Gene, von denen manche Varianten zu einer Anfälligkeit für Übergewicht
führen. Doch höchstens 1 bis 3 Prozent aller Personen seien aufgrund eines Gendefekts fettleibig,
erläutert Horber.
Aus Tierstudien mit Ratten wisse man inzwischen, wie mütterliche Ernährung und mütterliches
Übergewicht vor und während der Schwangerschaft das Gewicht des Neugeborenen und dessen
Risiko für eigenes Übergewicht beeinflussten, sagt die Berliner Ärztin Rodekamp. Bei
übergewichtigen Müttern gelange nämlich – ebenso wie bei Diabetikerinnen – deutlich mehr
Zucker via Nabelschnur in den Blutkreislauf des Ungeborenen. Dadurch werde die fötale
Bauchspeicheldrüse ständig angeregt Insulin herzustellen. Dieses Insulin wird mit dem Blut ins
Gehirn des Kindes transportiert. Dort wirkt es über spezielle Rezeptoren, vor allem in einer
Hirnregion namens Hypothalamus. Diese ist unter anderem auch für die Regulation der
Nahrungsaufnahme zuständig. Wenn nun ständig zu viel Insulin im sich entwickelnden
Hypothalamus ankommt, wird der Sättigungs-Sollwert höher eingestellt. Die Einstellung des
Sättigungs-Sollwerts erfolgt im Mutterleib. Dies führt zusammen mit der wachstumsfördernden
Wirkung des Insulins dazu, dass beim Fötus einer übergewichtigen Frau zu viele Fettdepots
angelegt werden.
In diesen Fettzellen wird nun das Hormon Leptin produziert. Dieses signalisiert im Normalfall
dem Gehirn, wann ausreichend Depots angelegt sind. Wenn ein Fötus aber bereits zu viele
Fettzellen besitzt, produziert er mehr Leptin als schlanke Ungeborene. Somit verfügt das sich
entwickelnde Gehirn nicht nur über zu viel Insulin, sondern auch über zu viel Leptin.
Tierversuche deuteten darauf hin, dass es bei übergewichtigen Föten und Neugeborenen zu einer
gewissen Leptin-Unempfindlichkeit kommt, wie die Forscher erläutern. Dies führe im späteren
Leben dazu, dass die Leptin-Signale vom Gehirn weniger gut wahrgenommen und beachtet
würden. So könnten sich mehr unnötige Fettdepots ansammeln. Und da Insulin und Leptin im
Zusammenspiel mit anderen Hormonen wie Orexin oder Neuropeptid Y die Nahrungsaufnahme
und -verwertung regulierten, gerate durch ein Überangebot der beiden erstgenannten Hormone
das komplexe Regulationssystem aus dem Gleichgewicht.
Source: Übergewichtige Babys – mit schwerer Hypothek ins Leben NZZ 70: 25.3.09
41
Basics
Genetics
Epi-
Memory
Organism
Paramutation - Suicide:
•
•
•
•
neglected during childhood
hippocampus reduced in size
cognitive impairments
DNA methylation in brains
involved in patho-psychology
• rRNA hypermethylated
Wittenberg-blog.,2008
McGowan et al., 2008
12-06-13
Madl
42
Suicide: Alterations in gene expression in the suicide brain have been reported and for several
genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that
encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA
gene promoter methylation determine rRNA transcription.
Comparing brain tissue from three groups; 12 suicide victims who were abused, 12 suicide
victims who weren’t abused and 12 normal individuals, the team found different epigenetic marks
on the gene that makes glucocorticoid receptors in the brains of the abused group to those in nonabuse victims or normal individuals. Coupling this with previous research findings, the results
suggest that childhood experiences can lower the expression of glucocorticoid receptors, which
has a knock-on effect on the hypothalamic-pituitary-adrenal (HPA) function. The subsequent
over-activation of the HPA axis affects our ability to cope with stress, leaving affected individuals
at risk of suicide.
Findings: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative realtime PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the
brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected
for a history of early childhood neglect/abuse, which is associated with decreased hippocampal
volume and cognitive impairments. rRNA was significantly hypermethylated throughout the
promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA
expression in the hippocampus. This difference in rRNA methylation was not evident in the
cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by
nearest neighbor.
Conclusion: This is the first study to show aberrant regulation of the protein synthesis machinery
in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology
of suicide.
Source: Patrick O McGowan, Aya Sasaki, Ana C D'Alessio, Sergiy Dymov, Benoit Labonté,
Moshe Szyf, Gustavo Turecki & Michael J Meaney. (2009). Epigenetic regulation of the
glucocorticoid receptor in human brain associates with childhood abuse. Nature Neuroscience 12,
342 - 348 (2009)
McGowan PO, Sasaki A, Huang TC, Unterberger A, Suderman M, Ernst C, Meaney MJ, Turecki
G, Szyf M. (2008). Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the
suicide brain. PLoS ONE;3(5):e2085.
42
Basics
Genetics
Epi-
Memory
Organism
Some final words (1/4)
So J.B.Lamarck (1744-1829) was not so wrong at all:
•Transient or heritable changes in gene expression
through modulation of chromatin, which is not
brought about by changes in DNA sequence
• These regulatory mechanisms for chromatin
indexing are known as “epigenetics”
• Evolution of the genetic code, translation,
and cellular organization itself follows a
dynamic whose mode is …. Lamarckian
(Inheritance of acquired characteristics).
Vetsigian K. Woese C. Goldenfeld N., 2006;
12-06-13
Madl
43
Lamarckism or Lamarckian evolution (named for the biologist Jean-Baptiste
Lamarck) refers to the once widely accepted idea that an organism can pass on
characteristics that it acquired during its lifetime to its offspring (also known as
based on heritability of acquired characteristics or "soft inheritance"). It is, who
incorporated the action of soft inheritance into his evolutionary theories and is
often incorrectly cited as the founder of soft inheritance.
It proposed that individual efforts during the lifetime of the organisms were the
main mechanism driving species to adaptation, as they supposedly would acquire
adaptive changes and pass them on to offspring.
In a wider context, soft inheritance is of use when examining the evolution of
cultures and ideas, and is related to the theory of Memetics. While enormously
popular during the early 19th century as an explanation for the complexity
observed in living systems, the relevance of soft inheritance within the scientific
community dwindled following the theories of August Weismann and the
formation of the modern evolutionary synthesis.
Source: Vetsigian K. Woese C. Goldenfeld N., 2006; Collective evolution and the genetic code
PNAS Vol. 103 no. 28
43
Basics
Genetics
Epi-
Memory
Organism
Implications for humanity and the wider biosphere :
…. Genetically Modified Organisms (GMO) ….
Genetically engineered crops are not analogous to products of normal evolution.
If epigenetic causation is the motor of evolution as proposed, and genes play a
subordinate, consolidating role, then going at the properties of an organism by
manipulating its genes is not even really “engineering.” It is the hit-or-miss
production of potentially useful monstrosities.
Walker 2005
12-06-13
Madl
44
Advocates of genetic engineering claim that it is no different from what evolution
has done, and that it is in fact a new form of evolution. But genetically engineered
crops are not analogous to products of normal evolution. If epigenetic causation is
the motor of evolution as proposed, and genes play a subordinate, consolidating
role, then going at the properties of an organism by manipulating its genes is not
even really “engineering.” It is the hit-or-miss production of potentially useful
monstrosities.
This sharing of genetic information is not an accident. It is nature's method of
enhancing the survival of the biosphere. As discussed earlier, genes are physical
memories of an organism’s learned experiences. The recently recognized
exchange of genes among individuals disperses those memories, thereby
influencing the survival of all organisms that make up the community of life
(GMO - shifting the nodes w/n the web of life) …. For example, tinkering with
the genes of a tomato may not stop at that tomato, but could alter the entire
biosphere in ways that we cannot foresee. Already there is a study that shows
that when humans digest genetically modified foods, the artificially created
genes transfer into and alter the character of the beneficial bacteria in the
intestine [Heritage 2004; Netherwood, et al, 2004]. Similarly, gene transfer
among genetically engineered agricultural crops and surrounding native species
has given rise to highly resistant species deemed superweeds (for epigenetic
modifications see Caulerpa taxifolia) [Milius 2003; Haygood, et al, 2003;
Desplanque, et al, 2002; Spencer and Snow 2001]
Source: Walker C., 2005: Epigenetics vs. Genetic Determinism - An Interview with Stuart
Newman; Wild Duck Review, Vol V, (2) & Lipton B. (2005). Biology of Belief. Elite Books p.45
44
Basics
Genetics
Epi-
Memory
Organism
•
•
•
•
intricate web of life (interspecies)
socio-economic consequences
eco-systemic consequences
political consequences
• holistic worldview (GAIA)
Popp, 1992
“ …. evolution is more dependent on the interaction among species than it
is on the interaction of individuals within a species
Lenton, 1998
12-06-13
Madl
45
Biosphere: The evolutionary push for ever-bigger communities is simply a reflection of the
biological imperative to survive. The more awareness an organism has of its environment, the
better its changes for survival. When cells band together they increase their awareness
exponentially. Timothy Lenton provides evidence that evolution is more dependent on the
interaction among species than it is on the interaction of individuals within a species.
Evolution becomes a matter of the survival of the fittest groups rather than the survival of the
fittest individuals. In a 1998 article in Nature, Lenton wrote that rather than focusing on
individuals and their role in evolution, ."...We must consider the totality of organisms and their
material environment to fully understand which traits come to persist and dominate" [Lenton
1998].
Source: Lipton B. 2005. The biology of Belief. Elite Books. p.40 & 46
Lenton T.M. (1998). Gaia and natural selection. Nature, Vol.394:439-447.
GAIA: energy stored in matter; biota are far better energy storage systems than dead matter;
Biodiversity is much more important for the homoeostasis of the planet than generally recognized.
The residence time of the energy within the biosphere is directly related to the energy stored, and
hence, to species diversity or equivalently, the size of the trophic web .... which on the planetary
level, is the space-time organization of the global ecological community.
A different view of the previous slide is shown here. The MGF in BP bridges the explicate orders
of bio-molecules all the way up to societies. From Cell to Organism and beyond: Abscissa: “1”
represents the Balance of Operation (homeostasis) - from left to right: Functional Complexity
Source: Popp F.A., 1992: Evolution as the Expansion of Coherent States; Ch.21; in Popp F.A., Li
K.H. Gu Q., (eds) Recent Advances in Biophoton Research and its Applications; World Scientific
Publishing – Singapore;
45
Basics
Genetics
Epi-
Memory
Organism
Epigenetics highlights the principle, that ….
…. all live is in a delicate dynamic balance,
not only with other life forms,
but also with the physical environment as well.
It is life’s harmony – not life’s struggle
12-06-13
Madl
46
Epigenetics questions not only Darwin’s dog-eat-dog version of evolution but also biology’s Central Dogma,
the premise that genes control life …. Infact, genes are not “self-emergent”, Something in the
environment has to trigger gene activity.
We are not victims of our genes, but masters of our fates!
Source: Lipton B. 2005; Biology of Belief. Elite Books. p.25 / 26 / 27
46

Pierre MADL Div. of Material Sciences Dep

Transcription

Similar documents

Zahn- und Maulhöhlenerkrankungen bei Katzen und

lesen Sie weiter