Issue Highlights: Editor`s Note: Editorials: Original Articles

Transcription

Contents:Volume 112, Issue 1; July 5, 2005
Issue Highlights:
Issue Highlights
Circulation 2005 112: 1
Editor's Note:
Editor’s Note
Joseph Loscalzo
Circulation 2005 112: 2,
Editorials:
Endothelial Progenitor Cells, Neointimal Hyperplasia, and Hemodialysis
Vascular Access Dysfunction: Novel Therapies for a Recalcitrant Clinical
Problem
Prabir Roy-Chaudhury
Circulation 2005 112: 3 - 5,
Cell Death and Adenosine Triphosphate: The Paradox
Jutta Schaper and Sawa Kostin
Circulation 2005 112: 6 - 8,
N-Terminal-Pro-B–Type Natriuretic Peptide: Universal Marker of
Cardiovascular Risk?
A. Mark Richards and Christopher M. Frampton
Circulation 2005 112: 9 - 11,
Original Articles:
Cardiovascular Surgery:
c
d
e
f
g
In Vivo Cell Seeding With Anti-CD34 Antibodies Successfully Accelerates
Endothelialization but Stimulates Intimal Hyperplasia in Porcine Arteriovenous
Expanded Polytetrafluoroethylene Grafts
Joris I. Rotmans, Jan M.M. Heyligers, Hence J.M. Verhagen, Evelyn Velema,
Machiel M. Nagtegaal, Dominique P.V. de Kleijn, Flip G. de Groot, Erik S.G.
Stroes, and Gerard Pasterkamp
Circulation 2005 112: 12 - 18; published online before print June 27 2005,
Coronary Heart Disease:
c
d
e
f
g
Periodontal Disease and Coronary Heart Disease: A Reappraisal of the
Exposure
James D. Beck, Paul Eke, Gerardo Heiss, Phoebus Madianos, David Couper,
Dongming Lin, Kevin Moss, John Elter, and Steven Offenbacher
c
d
e
f
g
C-Reactive Protein and the 10-Year Incidence of Coronary Heart Disease in
Older Men and Women: The Cardiovascular Health Study
Mary Cushman, Alice M. Arnold, Bruce M. Psaty, Teri A. Manolio, Lewis H.
Kuller, Gregory L. Burke, Joseph F. Polak, and Russell P. Tracy
Epidemiology:
c
d
e
f
g
Obesity, Insulin Resistance, and the Metabolic Syndrome: Determinants of
Endothelial Dysfunction in Whites and Blacks
A.A. Lteif, K. Han, and K.J. Mather
Health Services and Outcomes Research:
c
d
e
f
g
Adoption of Spironolactone Therapy for Older Patients With Heart Failure
and Left Ventricular Systolic Dysfunction in the United States, 1998–2001
Frederick A. Masoudi, Cary P. Gross, Yongfei Wang, Saif S. Rathore, Edward
P. Havranek, JoAnne Micale Foody, and Harlan M. Krumholz
Heart Failure:
c
d
e
f
g
Effects of Candesartan on the Development of a New Diagnosis of Diabetes
Mellitus in Patients With Heart Failure
Salim Yusuf, Jan B. Ostergren, Hertzel C. Gerstein, Marc A. Pfeffer, Karl
Swedberg, Christopher B. Granger, Bertil Olofsson, Jeffrey Probstfield, John
V. McMurray on behalf of the Candesartan in Heart Failure—Assessment of
Reduction in Mortality and Morbidity Program (CHARM) Investigators
c
d
e
f
g
-Myosin Heavy Chain: A Sarcomeric Gene Associated With Dilated and
Hypertrophic Phenotypes of Cardiomyopathy
Elisa Carniel, Matthew R.G. Taylor, Gianfranco Sinagra, Andrea Di Lenarda,
Lisa Ku, Pamela R. Fain, Mark M. Boucek, Jean Cavanaugh, Snjezana
Miocic, Dobromir Slavov, Sharon L. Graw, Jennie Feiger, Xiao Zhong Zhu,
Dmi Dao, Debra A. Ferguson, Michael R. Bristow, and Luisa Mestroni
Circulation 2005 112: 54 - 59,
Hypertension:
c
d
e
f
g
Elevated Blood Pressure Linked to Primary Hyperaldosteronism and
Impaired Vasodilation in BK Channel–Deficient Mice
Matthias Sausbier, Claudia Arntz, Iancu Bucurenciu, Hong Zhao, Xiao-Bo
Zhou, Ulrike Sausbier, Susanne Feil, Simone Kamm, Kyrill Essin, Claudia A.
Sailer, Usamah Abdullah, Peter Krippeit-Drews, Robert Feil, Franz Hofmann,
Hans-Günther Knaus, Chris Kenyon, Michael J. Shipston, Johan F. Storm,
Winfried Neuhuber, Michael Korth, Rudolf Schubert, Maik Gollasch, and
Peter Ruth
Circulation 2005 112: 60 - 68; published online before print May 2 2005,
Imaging:
c
d
e
f
g
Risk of Embolism and Death in Infective Endocarditis: Prognostic Value of
Echocardiography: A Prospective Multicenter Study
Franck Thuny, Giovanni Disalvo, Olivier Belliard, Jean-François Avierinos,
Valeria Pergola, Valerie Rosenberg, Jean-Paul Casalta, Joanny Gouvernet,
Geneviève Derumeaux, Diana Iarussi, Pierre Ambrosi, Raffaello Calabro,
Alberto Riberi, Frédéric Collart, Dominique Metras, Hubert Lepidi, Didier
Raoult, Jean-Robert Harle, Pierre-Jean Weiller, Ariel Cohen, and Gilbert
Habib
Molecular Cardiology:
c
d
e
f
g
Bcl-xL Gene Transfer Inhibits Bax Translocation and Prolongs Cardiac
Cold Preservation Time in Rats
Jianhua Huang, Kiminori Nakamura, Yoshinori Ito, Takeshi Uzuka, Masayuki
Morikawa, Sachie Hirai, Kei Tomihara, Toshihiro Tanaka, Yukari Masuta,
Keiji Ishii, Kazunori Kato, and Hirofumi Hamada
c
d
e
f
g
Augmented Cardiac Hypertrophy in Response to Pressure Overload in Mice
Lacking the Prostaglandin I2 Receptor
Akiyoshi Hara, Koh-ichi Yuhki, Takayuki Fujino, Takehiro Yamada, Koji
Takayama, Shuhko Kuriyama, Osamu Takahata, Hideji Karibe, Yuji Okada,
Chun-Yang Xiao, Hong Ma, Shuh Narumiya, and Fumitaka Ushikubi
c
d
e
f
g
Neuronal Nitric Oxide Synthase Mediates Statin-Induced Restoration of
Vasa Nervorum and Reversal of Diabetic Neuropathy
Masaaki Ii, Hiromi Nishimura, Kengo F. Kusano, Gangjian Qin, Young-sup
Yoon, Andrea Wecker, Takayuki Asahara, and Douglas W. Losordo
Pediatric Cardiology:
c
d
e
f
g
Early Structural and Functional Changes of the Vasculature in HIV-Infected
Children: Impact of Disease and Antiretroviral Therapy
Marietta Charakida, Ann E. Donald, Hannah Green, Clare Storry, Margaret
Clapson, Muriel Caslake, David T. Dunn, Julian P. Halcox, Diana M. Gibb,
Nigel J. Klein, and John E. Deanfield
Stroke:
c
d
e
f
g
Prediction of Myocardial Infarction by N-Terminal-Pro-B-Type Natriuretic
Peptide, C-Reactive Protein, and Renin in Subjects With Cerebrovascular
Disease
Duncan J. Campbell, Mark Woodward, John P. Chalmers, Samuel A. Colman,
Alicia J. Jenkins, Bruce E. Kemp, Bruce C. Neal, Anushka Patel, and Stephen
W. MacMahon
Vascular Medicine:
c
d
e
f
g
Statin Treatment After Onset of Sepsis in a Murine Model Improves
Survival
Marc W. Merx, Elisa A. Liehn, Jürgen Graf, Annette van de Sandt, Maren
Schaltenbrand, Jürgen Schrader, Peter Hanrath, and Christian Weber
Circulation 2005 112: 117 - 124,
Contemporary Reviews in Cardiovascular Medicine:
c
d
e
f
g
Valvular Heart Disease: Aortic Regurgitation
Raffi Bekeredjian and Paul A. Grayburn
Circulation 2005 112: 125 - 134,
New Drugs and Technologies:
Frontiers in Cardiovascular Magnetic Resonance
Valentin Fuster and Raymond J. Kim
Circulation 2005 112: 135 - 144,
Special Reports:
A Vision for the Future: Opportunities and Challenges: Notes From the Director
of the National Heart, Lung, and Blood Institute
Elizabeth G. Nabel
Circulation 2005 112: 145 - 146,
Images in Cardiovascular Medicine:
Detection of Luminal-Intimal Border and Coronary Wall Enhancement in
Intravascular Ultrasound Imaging After Injection of Microbubbles and
Simultaneous Sonication With Transthoracic Echocardiography
Manolis Vavuranakis, Ioannis A. Kakadiaris, Sean M. O’Malley,
Christodoulos Stefanadis, Sophia Vaina, Maria Drakopoulou, Ioannis
Mitropoulos, Stephane Carlier, and Morteza Naghavi
Circulation 2005 112: e1 - e2,
Detection of Carotid Atherosclerotic Plaque Ulceration, Calcification, and
Thrombosis by Multicontrast Weighted Magnetic Resonance Imaging
Baocheng Chu, Marina S. Ferguson, Hunter Underhill, Norihide Takaya,
Jianming Cai, Michel Kliot, Chun Yuan, and Thomas S. Hatsukami
Primary Lymphoma of the Heart
Jeffrey Kuvin, Nisha Parikh, Robert Salomon, Arthur Tischler, Philip Daoust,
Yevgeniy Arshanskiy, Karl Coyner, Philip Carpino, Natesa G. Pandian, Carey
Kimmelstiel, Caroline Foote, John Erban, and Hassan Rastegar
Correspondence:
Letter Regarding Article by McNair et al, "SCN5A Mutation Associated With
Dilated Cardiomyopathy, Conduction Disorder, and Arrhythmia" • Response
W.A. Groenewegen, A.A.M. Wilde, William P. McNair, Lisa Ku, Matthew
R.G. Taylor, Pam R. Fain, Eugene Wolfel, and Luisa Mestroni
Letter Regarding Article by Galbreath et al, "Long-Term Healthcare and Cost
Outcomes of Disease Management in a Large, Randomized, Community-Based
Population With Heart Failure" • Response
Ariel Linden, Thomas Wilson, Autumn Dawn Galbreath, Gregory L. Freeman,
Brad Smith, Richard A. Krasuski, Karl C. Stajduhar, Michael D. Kwan, and
Robert Ellis
Circulation 2005 112: e11,
Book Reviews:
Computed Tomography of the Coronary Arteries
Frederick L. Ruberg
Acknowledgment of Reviewers:
Acknowledgment of Reviewers
Circulation
JOURNAL
OF THE
AMERICAN HEART ASSOCIATION
Issue Highlights
Vol 111, No 1, July 5, 2005
PERIODONTAL DISEASE AND CORONARY HEART
DISEASE: A REAPPRAISAL OF THE EXPOSURE, by
Beck et al.
STATIN TREATMENT AFTER ONSET OF SEPSIS IN
A MURINE MODEL IMPROVES SURVIVAL, by Merx
et al.
There currently is great interest in understanding the role of certain
chronic infections as risk factors for cardiovascular disease. In this
regard, prior studies have suggested that chronic periodontal
disease is associated with increased cardiovascular risk, although
it remains possible that the confounding effects of smoking and
other classical risk factors explain the association. In this issue of
Circulation, Beck and colleagues investigated the relation between periodontal disease and prevalent coronary heart disease in
5002 participants in the fourth examination of the Atherosclerosis
Risk in Communities Study. They observed that elevated serum
IgG antibodies to several oral pathogens were associated with
coronary heart disease, but findings on oral examination were not.
Although further prospective studies of this question are needed,
the present study suggests that the host response to oral infection
may be more important for cardiovascular risk than the local
extent of periodontal disease. See p 19.
The clinical benefits achieved with HMG-CoA reductase inhibitors have been shown to extend well beyond the recognized
lipid-lowering effects of these agents. The pleiotropic effects
attributed to statins include increased bioavailable nitric oxide,
increased antioxidant properties, inhibition of inflammatory responses, and improvement of endothelial dysfunction. Interestingly, investigators have recognized that these pleiotropic effects
may be exploited to offer a therapeutic advantage in clinical
situations other than atherothrombotic vascular disease. For example, Merx et al have previously shown that the antiinflammatory effects of statins mediate responses to sepsis; pretreatment
with statins improved survival in a murine model of sepsis. In this
issue of Circulation, Merx et al extend their previous work and
examine the effects of initiating statin therapy after sepsis has been
established. These studies may have implications for how clinicians treat sepsis in the future. See p 117.
Visit http://www.circ.ahajournals.org:
EFFECTS OF CANDESARTAN ON THE
DEVELOPMENT OF A NEW DIAGNOSIS OF
DIABETES MELLITUS IN PATIENTS WITH HEART
FAILURE, by Yusuf et al.
Images in Cardiovascular Medicine
Detection of Luminal-Intimal Border and Coronary Wall Enhancement in Intravascular Ultrasound Imaging After Injection of Microbubbles and Simultaneous Sonication With
Transthoracic Echocardiography. See p e1.
Detection of Carotid Atherosclerotic Plaque Ulceration, Calcification, and Thrombosis by Multicontrast Weighted Magnetic Resonance Imaging. See p e3.
Angiotensin-converting enzyme inhibitors and angiotensin receptor blockers (ARBs) have been associated with a lower incidence
of diabetes mellitus in clinical trials of hypertensives and other
high-risk patients. However, it is less clear if use of renin-angiotensin axis inhibitors lowers the risk of diabetes in patients with
heart failure. In this issue of Circulation, Yusuf and colleagues
analyze data from the CHARM trial to assess the risk of developing new-onset diabetes (a prespecified secondary outcome) in
more than 5000 heart failure patients randomized to candesartan
(an ARB) or placebo. The investigators report that candesartan use
was associated with a 22% reduction in incidence of diabetes
compared with placebo. The reduction in incidence of diabetes
was consistent across clinical subgroups (age, sex, body mass
index) and was particularly striking in patients with a relatively
preserved ejection fraction. The authors emphasize that use of
ARBs in heart failure patients provides added value by lowering
the future risk of diabetes. See p 48.
Primary Lymphoma of the Heart. See p e5.
Book Review
Computed Tomography of the Coronary Arteries.
See p e7.
Correspondence
See p e9.
1
Editor’s Note
B
eginning in this issue of Circulation, we present two new features designed to enhance the
transfer of information to our clinician readers. First, you will notice that the cover
includes a new box in the lower right corner listing articles we believe comprise a clinical
cardiology curriculum. These articles include those in our regular review series as well as online
information directly relevant to clinical practice. Second, you will find at the end of original
articles with a basic focus a text box that includes a short clinical perspective on the information
contained within that article. Articles published with an accompanying “Clinical Perspective” will
be noted in the Table of Contents. We trust that these changes will enhance the appeal of the
journal to our clinical readership, and we welcome other suggestions you may have for improving
the quality of Circulation.
Joseph Loscalzo, MD, PhD
Editor-in-Chief, Circulation
2
Editorial
Endothelial Progenitor Cells, Neointimal Hyperplasia, and
Hemodialysis Vascular Access Dysfunction
Novel Therapies for a Recalcitrant Clinical Problem
Prabir Roy-Chaudhury, MD, PhD
V
hyperplasia, as expected. Rather, the endothelialized grafts
demonstrated a paradoxical increase in neointimal hyperplasia at the graft-vein anastomosis, which is the end point for
this model.
The article by Rotmans and colleagues comes at a particularly opportune moment, as it addresses 3 issues of current
interest: (1) it recognizes that the combination of recent
advances in biomedical engineering, drug delivery, and molecular biology has resulted in a fertile substrate for investigators in this field; (2) it challenges conventional wisdom
about the inverse association between endothelial repair
(endothelialization) and neointimal hyperplasia; and (3) it
draws attention to the huge but often ignored clinical problem
of hemodialysis vascular access dysfunction. This editorial
addresses each of these issues in turn.
There have been great advances in the past 5 to 10 years in
the in vivo application of both experimental and clinical
therapies for vascular stenosis and neointimal hyperplasia.
These advances have been made possible through a fusion of
advances in biomaterials, drug delivery techniques, and
molecular and cell biology. A few examples of such technologies include a multitude of drug-eluting coronary stents,6 the
use of perivascular drug-releasing or cell-containing polymers in experimental models of neointimal hyperplasia,7 and
exciting new advances in the generation of nitric oxide–
releasing polymers.9 All of these approaches share a common
thread in that they are local therapies applied directly to the
site of vascular injury. In particular, the remarkable success
of the drug-eluting coronary stents against the background of
multiple unsuccessful clinical trials of systemic therapies for
neointimal hyperplasia suggests that local therapy could be
the delivery mode of choice in the setting of vascular stenosis.
For many years the unattainable goal for vascular access
interventions has been the complete endothelialization of the
region of vascular injury after surgery or angioplasty to
prevent both thrombosis and stenosis. The recent identification of EPCs has allowed us to come another step closer to
this goal. EPCs were initially identified by Asahara and
colleagues,10 who demonstrated that a subset of CD34⫹ cells
could be differentiated ex vivo into an endothelial phenotype
(which expressed both the stem cell marker CD34 and the
endothelial marker protein VEGFR2). Other groups have
since demonstrated enhanced endothelial coverage and a
reduction in neointimal hyperplasia after an infusion of EPCs
in animal models of carotid angioplasty injury.11,12 In all of
these experiments, an increase in endothelialization of the
region of vascular injury invariably translated into a reduction
of neointimal hyperplasia. In the article by Rotmans et al,
ascular stenosis as a result of neointimal hyperplasia
is a major clinical problem that has an impact on
multiple and diverse disciplines, including cardiology (coronary restenosis), cardiothoracic and vascular surgery
(saphenous vein and polytetrafluoroethylene [PTFE] graft
failure), neurology (carotid stenosis), nephrology (dialysis
access dysfunction), and transplant medicine (chronic allograft rejection in hearts and kidneys). The traditional response
to injury hypothesis on the pathogenesis of neointimal hyperplasia focuses on the migration of medial smooth muscle cells
from the media into the intima.1 Recently, there has been a
great deal of excitement about the role of circulating smooth
muscle progenitor cells in the pathogenesis of neointimal
hyperplasia. These cells have been identified in a variety of
experimental models of vascular injury,2 and interventions
that reduce the number of these cells can attenuate neointimal
hyperplasia. In marked contrast to the deleterious effects of
smooth muscle progenitor cells on neointimal hyperplasia,
circulating endothelial progenitor cells (EPCs) are believed to
play an important role in vascular repair and in the inhibition
of neointimal hyperplasia.3
See p 12
In this issue of Circulation, Rotmans and colleagues have
attempted to achieve the “holy grail” for a vascular access
procedure: rapid and complete endothelialization.4 Their
experiments are based on a newly developed technique that
can coat the surface of stent and graft material with antibodies
against CD34 (Orbus Medical Technologies). CD34 is a
marker for hematopoietic stem cells, and previous research
has demonstrated that coronary stents coated with anti-CD34
have a significant increase in endothelialization as early as 1
hour after deployment because of the binding of circulating
CD34⫹ cells, which then differentiate into endothelial cells.5
Placement of anti-CD34 – coated grafts in an arteriovenous
model of PTFE graft stenosis by Rotmans et al resulted in
almost complete endothelialization of the grafts (both at 3
days and at the end of the experiments at 28 days). Endothelialization, however, did not result in a decrease in neointimal
The opinions expressed in this article are not necessarily those of the
editors or of the American Heart Association.
From the University of Cincinnati Medical Center, Cincinnati, Ohio.
Correspondence to Dr Prabir Roy-Chaudhury, Division of Nephrology, MSB G-258, University of Cincinnati, 231 Albert Sabin Way,
Cincinnati, OH 45267-0585. E-mail [email protected]
(Circulation. 2005;112:3-5.)
© 2005 American Heart Association, Inc.
Circulation is available at http://www.circulationaha.org
DOI: 10.1161/CIRCULATIONAHA.105.548651
3
4
Circulation
July 5, 2005
however, endothelialization of PTFE graft with anti-CD34
antibodies was accompanied by an increase rather than a
decrease in neointimal hyperplasia. What could be the possible reasons for this paradox?
Previous studies have demonstrated that it is possible to
obtain endothelial coverage of prosthetic stent or graft material by isolating or expanding EPC cultures ex vivo and then
using these cells to coat prosthetic material.13–15 Unfortunately, these approaches tend to be time consuming, labor
intensive, and expensive. In marked contrast, the ability to
store anti-CD34 – coated graft or stent material in the cardiac
catheterization laboratory, interventional radiology suite, or
operating room clearly lends itself to current clinical practice.
The Rotmans group, very appropriately, did not attempt an
ex vivo endothelialization of their prosthetic graft material
but instead tried to achieve this in vivo through the use of
anti-CD34 – coated grafts. As alluded to by the authors, the
reason for the dichotomy between endothelialization and
intimal hyperplasia in these experiments could be linked to
the fact that CD34 is a hematopoietic stem cell marker. The
antibodies to CD34, therefore, could have attracted CD34⫹
cells that still had the potential to transform into smooth
muscle cells and myofibroblasts, as has been previously
reported.16 Why was there no evidence of smooth muscle
cells on the actual PTFE graft material, which was covered
only by cells that had an endothelial phenotype? One explanation could be that the transformation of CD34⫹ cells
preferentially into smooth muscle cells may require additional stimuli such as turbulence or low shear stress, which
would be present only at the graft-vein anastomosis. Alternatively, true EPCs/endothelial cells themselves may have the
plasticity to dedifferentiate into smooth muscle cells at the
graft-vein anastomosis in response to hemodynamic and
surgical stress. Finally, it needs to be mentioned that these
studies were performed in a model of venous (rather than
arterial) stenosis, which is characterized by continuous ongoing hemodynamic stress and compliance mismatch at the
graft-vein anastomosis. Whether the results would have been
different in an arterial interposition or angioplasty model is
open to speculation.
Despite its surprising results, the study by Rotmans et al is
critically important because it is an important step forward
toward the application of EPC technology to the problem of
vascular stenosis in a manner that is clinically relevant.
Further refinements to this approach could include an antibody coating that has the specificity to bind to circulating
cells that only have the potential to differentiate into lining
endothelial cells. To do this, however, we will need to learn
more about the biology and plasticity of EPCs. For example,
it is likely that what we consider to be EPCs are in fact a
diverse population of different cell types with different
functions.3 Clearly, many more studies are needed for us to
learn how to tweak this fascinating cell so that it can be
effectively used to prevent vascular stenosis in the clinical
setting.
Finally, by using an arteriovenous model of PTFE graft
stenosis, the authors draw attention to the huge clinical
problem of hemodialysis vascular access dysfunction. There
are ⬇300 000 hemodialysis patients in the United States, a
number that is expected to double by the year 2020.8 The 2
main forms of dialysis access are the arteriovenous fistula
(32% prevalence rate in the United States) and the PTFE
arteriovenous graft (50% prevalence rate in the United
States), both of which have dismal survival rates as compared
with other vascular procedures— between 50% and 75%
1-year survival at best.17 The single most important reason for
hemodialysis vascular access dysfunction is a stenosis at the
graft-vein anastomosis of PTFE dialysis access grafts or in
the proximal vein of an arteriovenous fistula as a result of
venous neointimal hyperplasia. At a histological level, we
and others have demonstrated that venous neointimal hyperplasia in the setting of dialysis access grafts and fistulae
comprises smooth muscle cells, myofibroblasts, microvessels
within the neointima, and a peri-graft macrophage layer.18 In
marked contrast to arterial stenoses, venous neointimal hyperplasia is difficult to treat with angioplasty (nonthrombosed
PTFE grafts have a 50%, 6-month primary patency, whereas
thrombosed grafts have a 40%, 3-month primary patency
after angioplasty17). The reasons for this poor survival rate are
unclear, but they include (1) anatomic and physiological
differences between veins and arteries, (2) the presence of
continuous hemodynamic stress in the form of turbulence and
possibly low shear stress at the graft-vein or artery-vein
anastomosis, (3) recurrent needle damage during the dialysis
procedure, and (4) the presence of uremia, which could
predispose a patient to endothelial dysfunction.19
Regardless of the cause, the aggressive natural history of
neointimal hyperplasia in the setting of hemodialysis vascular
access translates into a financial cost of ⬇$1 billion per year.
More important, it results in tremendous morbidity and is
responsible for 20% of all hospital admissions in the hemodialysis population.19 Despite the huge clinical, economic,
and social impact of hemodialysis vascular access dysfunction, there are no truly effective therapies available for this
clinical problem. Percutaneous angioplasty and surgical revision are commonly used, but in marked contrast to the cardiac
literature, these are not accompanied by interventions to
prevent restenosis. Even more disappointing, when compared
with the multitude of clinical trials in the setting of coronary
stenosis, is that there are very few ongoing clinical trials
targeting hemodialysis vascular access dysfunction. The lack
of focused clinical research in this area is all the more
surprising because dialysis access grafts and fistulae could be
the ideal clinical model for testing novel local therapeutic
interventions for vascular stenosis in general. This is because
(1) the aggressive nature of vascular stenosis in hemodialysis
patients could result in clinical trials being conducted with a
smaller sample size and in a shorter time; (2) dialysis access
grafts and fistulae are superficially located and away from
important anatomic structures, making these patients ideal
candidates for the delivery of local therapies either through
the percutaneous approach or at the time of surgical placement; and (3) patients on hemodialysis have large-bore
needles placed within 3 to 6 cm of the site of venous stenosis
3 times per week for dialysis, which could allow for the
repeated delivery of novel therapies (including endothelial
progenitor cells) during the dialysis procedure itself.
Roy-Chaudhury
In summary, the article by Rotmans et al brings out both
the advantages and the pitfalls of using EPCs to reduce
vascular stenosis. Regardless of its final outcome, this study
has brought us one step closer to the use of EPCs in the
setting of clinical vascular stenosis. Perhaps most important,
this article draws attention to hemodialysis vascular access
dysfunction, a huge clinical problem that is lacking in
effective treatments but at the same time could be ideally
suited to the application of novel local therapeutic
interventions.
Acknowledgments
This work was supported by National Institutes of Health grant
DK-61689 and by a grant from Satellite Dialysis Clinics.
References
1. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s.
Nature. 1993;362:801– 809.
2. Sata M, Saiura A, Kunisato A, Tojo A, Okada S, Tokuhisa T, Hirai H,
Makuuchi M, Hirata Y, Nagai R. Hematopoietic stem cells differentiate
into vascular cells that participate in the pathogenesis of atherosclerosis.
Nat Med. 2002;8:403– 409.
3. Urbich C, Dimmeler S. Endothelial progenitor cells: characterization and
role in vascular biology. Circ Res. 2004;95:343–353.
4. Rotmans JI, Heyligers JMM, Verhagen HJM, Velema E, Nagtegaal MM,
de Kleijn DPV, de Groot FG, Stroes ESG, Pasterkamp G. In vivo cell
seeding using anti-CD34 antibodies successfully accelerates endothelialization but stimulates intimal hyperplasia in porcine arteriovenous
expanded polytetrafluoroethylene grafts. Circulation. 2005;112:12–18.
5. Ong AT, Aoki J, Kutryk MJ, Serruys PW. How to accelerate the endothelialization of stents. Arch Mal Coeur Vaiss. 2005;98:123–126.
6. Morice MC, Serruys PW, Sousa JE, Fajadet J, Ban Hayashi E, Perin M,
Colombo A, Schuler G, Barragan P, Guagliumi G, Molnar F, Falotico R.
A randomized comparison of a sirolimus-eluting stent with a standard
stent for coronary revascularization. N Engl J Med. 2002;346:1773–1780.
7. Golomb G, Fishbein I, Banai S, Mishaly D, Moscovitz D, Gertz SD, Gazit
A, Poradosu E, Levitzki A. Controlled delivery of a tyrphostin inhibits
intimal hyperplasia in a rat carotid artery injury model. Atherosclerosis.
1996;125:171–182.
EPCs for Hemodialysis Vascular Access Dysfunction
5
8. US Renal Data System. USRDS 2002 Annual Data Report: Atlas of
End-Stage Renal Disease in the United States. Bethesda, Md: National
Institutes of Health, National Institute of Diabetes and Digestive and
Kidney Diseases; 2002.
9. Frost MC, Reynolds MM, Meyerhoff ME. Polymers incorporating nitric
oxide releasing/generating substances for improved biocompatibility of
blood-contacting medical devices. Biomaterials. 2005;26:1685–1693.
10. Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T,
Witzenbichler B, Schatteman G, Isner JM. Isolation of putative progenitor
endothelial cells for angiogenesis. Science. 1997;275:964 –967.
11. Werner N, Junk S, Laufs U, Link A, Walenta K, Bohm M, Nickenig G.
Intravenous transfusion of endothelial progenitor cells reduces neointima
formation after vascular injury. Circ Res. 2003;93:e17– e24.
12. Griese DP, Ehsan A, Melo LG, Kong D, Zhang L, Mann MJ, Pratt RE,
Mulligan RC, Dzau VJ. Isolation and transplantation of autologous circulating endothelial cells into denuded vessels and prosthetic grafts:
implications for cell-based vascular therapy. Circulation. 2003;108:
2710 –2715.
13. He H, Shirota T, Yasui H, Matsuda T. Canine endothelial progenitor
cell-lined hybrid vascular graft with nonthrombogenic potential. J Thorac
Cardiovasc Surg. 2003;126:455– 464.
14. Bhattacharya V, McSweeney PA, Shi Q, Bruno B, Ishida A, Nash R,
Storb RF, Sauvage LR, Hammond WP, Wu MH. Enhanced endothelialization and microvessel formation in polyester grafts seeded with
CD34(⫹) bone marrow cells. Blood. 2000;95:581–585.
15. Shirota T, Yasui H, Shimokawa H, Matsuda T. Fabrication of endothelial
progenitor cell (EPC)–seeded intravascular stent devices and in vitro
endothelialization on hybrid vascular tissue. Biomaterials. 2003;24:
2295–2302.
16. Yeh ET, Zhang S, Wu HD, Korbling M, Willerson JT, Estrov Z. Transdifferentiation of human peripheral blood CD34⫹-enriched cell population into cardiomyocytes, endothelial cells, and smooth muscle cells in
vivo. Circulation. 2003;108:2070 –2073.
17. Schwab SJ, Harrington JT, Singh A, Roher R, Shohaib SA, Perrone RD,
Meyer K, Beasley D. Vascular access for hemodialysis. Kidney Int.
1999;55:2078 –2090.
18. Roy-Chaudhury P, Kelly BS, Miller MA, Reaves A, Armstrong J,
Nanayakkara N, Heffelfinger SC. Venous neointimal hyperplasia in polytetrafluoroethylene dialysis grafts. Kidney Int. 2001;59:2325–2334.
19. Roy-Chaudhury P, Kelly BS, Zhang J, Narayana A, Desai P, Melham M,
Duncan H, Heffelfinger SC. Hemodialysis vascular access dysfunction:
from pathophysiology to novel therapies. Blood Purif. 2003;21:99 –110.
KEY WORDS: Editorials
䡲
stenosis
䡲
grafting
䡲
hyperplasia
䡲
endothelium
Editorial
Cell Death and Adenosine Triphosphate
The Paradox
Jutta Schaper, MD, PhD; Sawa Kostin, MD
T
both modes of cell death employ different mechanisms of
initiation and cellular execution.5 Apoptosis is a preprogrammed (suicidal), mostly caspase-driven and energydependent process, whereas oncotic cell death is accidental
(because ischemic injury is not preprogrammed), is independent of caspase activation, and occurs subsequent to ATP
depletion.6 In addition, a third type of cellular demise has
been described, autophagic cell death, but this may not be of
great importance in the present animal model because it
occurs mostly in tissue exhibiting chronic degeneration, such
as Alzheimer’s disease in the brain and failure of the human
heart.7,8
Huang et al1 showed that Bcl-xL gene transfer prevented
Bax loss from the cytosol and decreased cytochrome c release
from the mitochondria, whereas Bax was translocated from
the cytosol to the mitochondria and caused massive cytochrome c release in untreated hearts.1 These data are in line
with accumulating evidence suggesting an intimate interrelationship of apoptosis and mitochondrial function that occurs
at the interface between Bcl-2 family proteins and the outer
mitochondrial membrane protein, namely voltage-dependent
anion channel (VDAC). Although Bcl-xL was shown to
stimulate VDAC closure, thereby preventing mitochondrial
alterations in response to death stimuli, Bax protein promotes
its opening to release cytochrome c and promote apoptosis.9
In the accompanying article by Huang et al,1 however,
there is no clear-cut explanation of the simultaneous occurrence of apoptosis and oncosis and their inhibition by Bcl-xL
gene transfer. Because, unfortunately, myocardial ATP levels
were not measured, the explanation of these puzzling results
must be speculative. Referring to the work of Tatsumi et al10
and Kuznetsov et al,11 Huang et al believe that the inhibition
of cytochrome c release and preservation of mitochondrial
function are decisive in preventing myocardial injury.
Kuznetsov et al reported that cytochrome c release from the
mitochondria, usually held to be a major proapoptotic event,
caused necrosis by reducing ATP levels, and that the heterogeneity and extent of cytochrome c release regulate the
switch between apoptosis and necrosis.11 Tatsumi et al10
reported that intracellular ATP plays an important role in the
execution of apoptosis and not of necrosis (or oncosis),
confirming earlier results by Leist et al.12 Tatsumi and
colleagues demonstrated in neonatal cardiomyocytes a distinct correlation between the rates of occurrence of apoptotic
cell death and ATP levels (ie, ATP is necessary for apoptosis
to take place and more apoptosis occurs at higher ATP
levels). Furthermore, they showed that necrosis appeared
exclusively in the presence of total glucose deprivation
accompanied by total loss of ATP. They also demonstrated
that constitutively expressed caspase-3 is not activated in the
he inhibition of cell death lies at the heart of the
interesting publication in this issue of Circulation by
Huang et al.1 The authors’ major message is that
Bcl-xL gene transfer prolongs the cold preservation time of
rat hearts destined for transplantation. Bcl-xL belongs to the
large Bcl-2 family and has been reported to inhibit Bax
translocation to the mitochondria and to reduce cytochrome c
release, thereby interrupting the apoptotic cascade and reducing the number of cells dying by apoptosis.2,3 This is precisely
what Huang et al1 have shown—namely, that inhibition of the
apoptotic pathway can partially prevent the deleterious effects of long-term ischemia by reducing the rate of apoptosis.
In addition, these authors show that “infarct size” was
reduced in treated hearts and that the rate of polymorphonuclear cell infiltration was minimal as compared with hearts
without gene transfer. Infarct size was determined in Langendorff buffer–perfused hearts without any coronary artery
ligation and describes the tissue area with necrotic cells as
demonstrated by triphenyltetrazolium (TTC) staining. To the
uninitiated reader it appears, therefore, that an intervention
aimed at reducing apoptosis is also able to interfere with the
process of ischemic cell death, ie, with oncosis (this is the preferred,
modern term for necrosis; necrosis proper is the process of cell
demise after any type of cell death4). The number of cardiomyocytes dying by either cell death mechanism, apoptotic or oncotic,
was reduced: Only 6.5% of all cardiomyocytes were terminal
deoxynucleotidyl transferase biotin-dUTP nick end labeling
(TUNEL) positive in hearts with Bcl-xL gene transfer, as
compared with 18.9% in the untreated hearts, and infarct size
was 23% in the treated group versus 47.7% in the hearts without
gene transfer. Creatine kinase (CK) activity measured in the
coronary outflow of Langendorff-perfused hearts was likewise
reduced in hearts with Bcl-xL gene transfer.
See p 76
The cell death paradox is here represented by the astounding phenomenon that apparently 2 modes of cell death,
apoptotic and oncotic, were influenced by Bcl-xL gene
transfer, which should exclusively interfere with the apoptotic
pathway. This is surprising given the well-known fact that
From the Department of Experimental Cardiology, Max-PlanckInstitute, Bad Nauheim, Germany.
Correspondence to Jutta Schaper, MD, Max-Planck-Institute,
Benekestrasse 2, D-61231 Bad Nauheim, Germany. E-mail
[email protected]
(Circulation. 2005;112:6-8.)
6
Schaper and Kostin
absence of ATP; however, cleavage of the procaspase (32
kDa) resulting in the activated form of caspase-3 (17 kDa)
was observed in the presence of higher ATP levels that
resulted in apoptotic cell death.10 Thus, it appears that oncosis
occurs at low to zero ATP levels and apoptosis can only occur
in the presence of higher intracellular energy stores.
When transferring this knowledge to the data presented by
Huang et al,1 it must be concluded that ATP levels in both
treated and untreated hearts must have been different in
different areas of the myocardium, resulting in either necrotic
or apoptotic cell death. Their results furthermore suggest that
ATP levels in the myocardium treated with Bcl-xL gene
transfer were elevated because infarct size (ie, the area of
necrotic cells) was reduced in this situation. Because the
number of TUNEL-positive cells was lower in hearts with
Bcl-xL gene transfer, ATP levels should have been high
enough to preserve the tissue and to prevent the occurrence of
apoptosis. Because ATP values are unknown and caspase-3
and its degree of activation were not determined, however,
this attempt to explain the data presented by Huang et al
remains purely speculative and more work is needed to
clarify this issue.
Furthermore, in the work of Tatsumi et al there is no
evidence-based reason that allows the conclusion that necrosis and apoptosis share common initial mechanisms.10 In our
opinion, this proposal is not very likely because one of the
critical differences between these 2 modes of cell death is that
damage to the sarcolemma resulting in cell membrane leakiness is one of the major and early hallmarks of oncotic cell
death, whereas in apoptosis the membrane remains intact and
functional.5 The authors noticed neither a simultaneous occurrence of apoptosis and necrosis in the same culture dish
nor the transition of necrosis to apoptosis or vice versa in the
same cell. For this reason it must be concluded from their
work that cells die either by apoptosis or by necrosis,
according to the intracellular energy level. A common mechanism of initiation is questionable.
There is ongoing discussion of whether apoptosis or
necrosis is the primary form of cell death after myocardial
injury, especially in the setting of ischemia/reperfusion.13,14
This may be the result of varying experimental design as well
as unsolved technical issues in determining the mode and rate
of cell death.
The problem of the no-reflow phenomenon is inherent to
models of long-term ischemia followed by reperfusion. Ischemia causes injury not only to the cardiomyocytes but also
to capillaries and the arteriolar endothelium so that microvascular edema is common in ischemic myocardium. This cell
swelling obliterates the vascular lumen and prevents tissue
perfusion during reperfusion. The TTC reaction used to show
the occurrence of necrotic cells may then show false-positive
results. In other words, dead tissue, instead of being TTC
negative, shows the brick red positive stain because NADH
(or NAD) has not been washed out. A reperfusion marker
such as fluorescein should have been used to show that tissue
perfusion is reestablished and uniform in the areas with
positive TTC reaction. It cannot be excluded (but again, this
is purely speculative) that endothelial edema was reduced by
Bcl-xL gene transfer and that the TTC reaction to some extent
Cell Death Paradox
7
gave false-positive results. The mechanism of action of
Bcl-xL gene transfer on endothelial cells, however, remains
unknown and its likelihood most probably is low.
Unsolved technical problems in determining the rate of
apoptosis may also play a role.15,16 The TUNEL reaction has
been shown to label not only apoptotic but also necrotic
cells,17 as well as those undergoing DNA replication18 and
this may result in false-positive numbers. For a positive
control of this technique, the use of tissue with a known rate
of apoptosis, such as small intestine, is strongly recommended. The possibility that TUNEL and TTC reaction may
be potentially misleading should be kept in mind to exclude
that the data presented may be subject to artifacts.
In conclusion, the work by Huang et al1 is not only
interesting but also thought provoking because of the astonishing effect that antiapoptotic treatment is able to reduce the
rate of apoptotic and oncotic (ischemic) cell death. Mechanisms of action are unknown at present, and an explanation is
hampered by the lack of data on local ATP content and the
activation of caspase-3. The discussion of the role of apoptotic, necrotic, and autophagic cell death in ischemia/
reperfusion is ongoing, and before any therapeutic principles
are recommended or used in human studies, the apparent cell
death paradox should be explored and clarified in more detail
in future studies.
References
1. Huang J, Nakamura K, Ito Y, Uzuka T, Morikawa M, Hirai S, Tomihara
K, Tanaka T, Masuta Y, Ishii K, Kato K, Hamada H. Bcl-xL gene transfer
inhibits Bax translocation and prolongs cardiac cold preservation time in
rats. Circulation. 2005;112:76 – 83.
2. He L, Perkins GA, Poblenz AT, Harris JB, Hung M, Ellisman MH, Fox
DA. Bcl-xL overexpression blocks bax-mediated mitochondrial contact
site formation and apoptosis in rod photoreceptors of lead-exposed mice.
Proc Natl Acad Sci U S A. 2003;100:1022–1027.
3. Green DR, Kroemer G. The pathophysiology of mitochondrial cell death.
Science. 2004;305:626 – 629.
4. Levin S, Bucci TJ, Cohen SM, Fix AS, Hardisty JF, LeGrand EK,
Maronpot RR, Trump BF. The nomenclature of cell death: recommendations of an ad hoc Committee of the Society of Toxicologic Pathologists. Toxicol Pathol. 1999;27:484 – 490.
5. Majno G, Joris I. Apoptosis, oncosis and necrosis. Am J Pathol. 1995;
146:3–15.
6. Kostin S. Pathways of myocyte death: Implications for development of
clinical laboratory markers. Adv Clin Chem. In press.
7. Kostin S, Pool L, Elsässer A, Hein S, Drexler HC, Arnon E, Hayakawa
Y, Zimmermann R, Bauer EP, Klövekorn WP, Schaper J. Myocytes die
by multiple mechanisms in failing human hearts. Circ Res. 2003;92:
715–724.
8. Hein S, Arnon E, Kostin S, Schönburg M, Elsässer A, Polyakova V,
Bauer EP, Klövekorn WP, Schaper J. Progression from compensated
hypertrophy to failure in the pressure-overloaded human heart: structural
deterioration and compensatory mechanisms. Circulation. 2003;107:
984 –991.
9. Shimizu S, Narita M, Tsujimoto Y. Bcl-2 family proteins regulate the
release of apoptogenic cytochrome c by the mitochondrial channel
VDAC. Nature. 1999;399:483– 487.
10. Tatsumi T, Shiraishi J, Keira N, Akashi K, Mano A, Yamanaka S, Matoba
S, Fushiki S, Fliss H, Nakagawa M. Intracellular ATP is required for
mitochondrial apoptotic pathways in isolated hypoxic rat cardiac
myocytes. Cardiovasc Res. 2003;59:428 – 440.
11. Kuznetsov AV, Schneeberger S, Seiler R, Brandacher G, Mark W,
Steurer W, Saks V, Usson Y, Margreiter R, Gnaiger E. Mitochondrial
defects and heterogeneous cytochrome c release after cardiac cold ischemia and reperfusion. Am J Physiol Heart Circ Physiol. 2004;286:
633– 641.
8
Circulation
July 5, 2005
12. Leist M, Single B, Castoldi AF, Kühnle S, Nicotera P. Intracellular
adenosine triphosphate (ATP) concentration: a switch in the decision
between apoptosis and necrosis. J Exp Med. 1997;185:1481–1486.
13. Jennings RB, Reimer KA. The cell biology of acute myocardial ischemia.
Annu Rev Med. 1991;42:225–246.
14. Jugdutt BI, Idikio HA. Apoptosis and oncosis in acute coronary syndromes: assessment and implications. Mol Cell Biochem. 2005;270:
177–200.
15. Elsässer A, Suzuki K, Schaper J. Unresolved issues regarding the role of
apoptosis in the pathogenesis of ischemic injury and heart failure. J Mol
Cell Cardiol. 2000;32:711–724.
16. Rodriguez M, Schaper J. Apoptosis: measurement and technical issues. J
Mol Cell Cardiol. 2005;38:15–20.
17. Ohno M, Takemura G, Ohno H, Misao J, Hayakawa Y, Minatoguchi S,
Fujiwara T, Fujiwara H. “Apoptotic” myocytes in the infarct area in
rabbit hearts may be oncotic myocytes with DNA fragmentation: analysis
by immunogold electron microscopy combined with in situ nick end
labeling. Circulation. 1998;98:1422–1430.
18. Kanoh M, Takemura G, Misao J, Hayakawa Y, Aoyama T, Nishigaki K,
Noda T, Fujiwara T, Fukuda K, Minatoguchi S, Fujiwara H. Significance
of myocytes with positive DNA end-labeling (TUNEL) in hearts with
dilated cardiomyopathy. Circulation. 1999;99:2757–2764.
Key Words: Editorials 䡲 apoptosis
proto-oncogene proteins c-bcl-2
䡲
necrosis
䡲
ischemia
䡲
Editorial
N-Terminal-Pro-B–Type Natriuretic Peptide
Universal Marker of Cardiovascular Risk?
A. Mark Richards, MD, PhD, DSc, FRACP; Christopher M. Frampton, BSc, PhD
P
frequent peripheral arterial disease, more frequent valvular
disease, and higher cholesterol, the 2 groups did differ
significantly for 2 of the biomarkers. NTproBNP and
C-reactive protein in the infarct patients were, respectively,
1.6- and 1.3-fold higher than in controls. Renin was not
significantly elevated in the MI group. Cases were then
combined with controls, creating a selective population
within which the risk of incurring MI was compared between
marker quartiles generated from the 618 patients. This interquartile comparison was conducted with 2 models: the first
unadjusted except for the previously mentioned matched
variables, and the second adjusted for baseline variables that
showed significant univariate associations with MI, ie, systolic blood pressure, cholesterol status, and presence or
absence of a history of coronary heart disease, valvular heart
disease, and peripheral arterial disease. In both models,
NTproBNP in the upper quartile was associated with a 2- to
3-fold increase in risk of MI as compared with the first
quartile. C-reactive protein exhibited a similar 2-fold increase
in risk in the first model, but in the second, CRP had no
significant association with increased risk of MI. Renin, not
seen to be significantly different in a simple univariate
comparison between cases and controls, became significant
when considered as a putative independent predictor in the
adjusted models. Upper-quartile renin was associated with a
1.7- to 1.9-fold increase in risk of MI as compared with the
bottom quartile. Combining NTproBNP with renin added
predictive power, and individuals with both NTproBNP and
renin in the highest quartiles had 4.5 times the risk of MI as
compared with both in the lowest quartile.
These findings add to reports indicating the predictive
power of B-type peptides for all-cause mortality and cardiovascular mortality and/or morbidity.1 Clinical application
may be difficult, however. The clinician does not seek the
relative risk of an MI in a given patient who has experienced
a cerebrovascular event as compared with another individual
with cerebrovascular disease of the same gender and similar
age. Rather, clinicians require the best possible assessment of
the absolute risk for an individual patient, taking all risk
factors into account as far as possible. The clinician will note
gender, age, ethnic background, blood pressure, lipid status, a
range of possible ECG abnormalities, presence or absence of
diabetes, renal function, and the presence or absence of a
history of adverse arterial events (coronary, cerebrovascular,
renovascular, or other peripheral vascular disease) and may
also be privileged to have cardiac imaging and/or stress test
data in hand. In this regard, it would have been an informative
corroborative exercise for the authors to have undertaken a
multivariate time-to-event analysis of all 5918 subjects from
PROGRESS who had blood samples available and to have
lasma brain-type natriuretic peptide (BNP) and aminoterminal proBNP (NTproBNP) provide prognostic information on cardiovascular morbidity and mortality
beyond that provided by standard risk factors. Clinical
applications of B-type peptides under ongoing research include their use in diagnosing acute heart failure (HF), in risk
stratification in both acute and established HF, in acute
coronary syndromes (ACS), in asymptomatic populations at
cardiovascular risk (older adults and people with hypertension), and as part of a screening strategy for detection of left
ventricular impairment and prediction of cardiovascular risk
in the general population.1,2 In this issue of Circulation,
Campbell and colleagues3 assess the ability of NTproBNP to
predict myocardial infarction (MI) in subjects who have
experienced a cerebrovascular event. NTproBNP (reflecting
cardiac distension) is compared with C-reactive protein (a
systemic marker of inflammation) and renin (a marker of
sodium status regulated by renal perfusion and delivery of
sodium to the renal glomerulus).
See p 110
The nested case-control study is from the 6105 participants
in the Perindopril Protection Against Recurrent Stroke Study
(PROGRESS), a placebo-controlled study of converting enzyme inhibitor– based therapy in patients with previous cerebrovascular events.4 Within PROGRESS, 206 subjects incurred an MI during 3.9 years of follow-up. The investigators
matched those incurring an MI with control PROGRESS
patients avoiding MI from time of randomization to time of
case ascertainment. Cases and controls were matched for age,
gender, treatment allocation, region, and cerebrovascular
qualifying event. The form of matching meant that individual
patients may have been controls initially and subsequently
became cases on incurring an MI during further follow-up.
Matching in this fashion may confuse the interpretation of the
nonconditioned analysis of baseline variables.
Comparing the 206 cases with 412 controls at randomization, the investigators report that in addition to higher systolic
blood pressure, more frequent known coronary disease, more
From the Department of Medicine, Christchurch School of Medicine
and Health Sciences, Christchurch, New Zealand.
Correspondence to Prof A. Mark Richards, Dept of Medicine,
Christchurch School of Medicine and Health Sciences, PO Box 4345,
Riccarton Ave, Christchurch, New Zealand. E-mail mark.richards@
cdhb.govt.nz
(Circulation. 2005;112:9-11.)
9
10
Circulation
July 5, 2005
provided readers with absolute event rates and hazard ratios
for the risk of MI (and other morbid events) adjusted not only
in the manner conducted in the present nested case-control
study but, as far as possible, for all of the above-mentioned
established indicators of coronary risk.
Curiously, in the analysis by Campbell and colleagues,
cases and controls have a similar prevalence of smoking,
diabetes, and levels of plasma creatinine—powerful established predictors of MI within the general population and
within populations with overt arterial disease. The later
multivariate analyses conducted by Campbell et al are not
therefore subject to any adjustment for these powerful predictors, which may individually and collectively confound
their conclusions.
It is notable that in suggesting NTproBNP independently
predicts MI, this article is at odds with several existing
reports. Within the Framingham offspring study, BNP levels,
though associated with increased risk of death and first
cardiovascular event, did not predict coronary heart disease
events.5 Campbell et al suggest this reflects the difference
between the Framingham offspring participants and
PROGRESS patients, who were older and had established
vascular disease as evidenced by a preceding cerebrovascular
event. If this explanation held true, BNP and NTproBNP
should have independent predictive power of MI in coronary
disease; however, this is not the case. De Lemos et al
conducted a substudy in 2525 participants in the Orbofiban in
Patients with Unstable coronary Syndromes, Thrombolysis In
Myocardial Infarction 16 (OPUS-TIMI 16) trial of an oral
glycoprotein IIb/IIIa inhibitor in ACS.6 BNP had a powerful
univariate association with the risk of MI at 30 days and 10
months; however, on multivariate analysis, though predictive
of all-cause mortality independent of age, troponin, HF, renal
insufficiency, ST-segment changes or left bundle-branch
block on the ECG, Killip class, and diabetes, BNP was not an
independent predictor of MI. Similarly, Jernberg et al, in 755
patients admitted with chest pain, found BNP predicted
all-cause mortality independent of age, gender, diabetes,
hypertension, past MI, treatment, HF, ECG changes, troponin, or renal function, but it was not reported to independently
predict MI.7 Sabatine and colleagues inspected BNP and
C-reactive protein in ⬎2000 ACS patients from OPUS-TIMI
16 and Treat angina with Aggrastat and determine Costs of
Therapy with Invasive or Conservative Strategies—Thrombolysis In Myocardial Infarction 18 (TACTICS-TIMI 18)
trials.8 They found both to be predictors of the composite end
point of mortality, MI, and/or HF independent of age,
diabetes, previous MI, HF, and ECG changes but did not
report BNP as an independent predictor of MI as a lone end
point. James et al measured NTproBNP, troponin T, and
C-reactive protein in 6809 patients with non–ST-segment
elevation ACS participating in the Global Utilization of
Streptokinase and tPA for Occluded arteries IV (GUSTO-IV)
trial of the glycoprotein IIb/IIIa inhibitor abciximab.9 Increasing quartiles of NTproBNP were powerfully related to shortand long-term mortality. Levels of troponin T and C-reactive
protein and creatinine clearance were also independently
related to 1-year mortality. These authors carefully assessed
the possible association of NTproBNP with later MI, employ-
ing a comprehensive multivariate model that included elements that were absent from the Campbell et al analysis.
Troponin T, creatinine clearance, and ST-segment depression
on the ECG all were independently related to risk of future
MI after adjustment for age, smoking status, angina, previous
MI, heart failure, diabetes, ECG changes, heart rate, and
creatinine clearance, but NTproBNP was not. An exception to
the general reported absence of independent prediction of MI
by BNP/NTproBNP in coronary populations is the report by
Richards et al.10 This study is one of a very few that include
ventricular imaging. The authors found that NTproBNP
independently predicted subsequent MI only in subjects with
reduced left ventricular function after their index MI. This
result may reflect the greater vulnerability of the dilated,
adversely remodeled ventricle (with areas of increased wall
stress, a reduced coronary perfusion pressure gradient, and a
more adverse neurohumoral milieu) to undergo detectable
myocyte necrosis for any given acute reduction in coronary
perfusion. In this regard, it would be of interest to know the
prevalence of previous unrecognized left ventricular dysfunction in the MI cases in the PROGRESS trial. The almost
universal finding that BNP/NTproBNP predict all-cause mortality may reflect the independent associations of the peptides, not only with cardiac function but also with age and
renal function.1,6 –10 Hence, the plasma BNP/NTproBNP level
integrates several powerful independent predictors of
mortality.
The additive effect of combining NTproBNP with renin is
of interest and reminds us of early reports of the relationship
between renin and coronary risk.11,12 Again, however, the
manner in which this multimarker approach may be applied
in clinical practice is unclear. The renin measurements
employed in the analysis by Campbell et al3 were undertaken
in the absence of an angiotensin converting enzyme inhibitor
or angiotensin II receptor blocker. Therefore, clinicians
would have to apply these measurements (in a combined
marker strategy) in the absence of what is now a commonly
prescribed drug class in the population experiencing cerebrovascular events. The analyses conducted by Campbell et al
are somewhat inconsistent in retaining renin, which did not
differ between cases and controls by univariate comparison,
for examination in the 2 multivariate analyses comparing
marker quartiles within the combined groups. Meanwhile,
they discarded a previous diagnosis of hypertension, smoking
status, use of certain drugs, diabetes, and renal function, all of
which likewise did not differ between cases and controls but
all of which are well-established determinants of cardiovascular risk. Furthermore, unlike NTproBNP assays, renin
assays remain widely variable in their methodology and
reference ranges throughout the world, and clinicians would
have to pay careful attention to the methods, reference ranges,
and quality control within their local laboratories to enable
correct interpretation of their locally provided renin results.
Renin is influenced by medications, being elevated by diuretics and converting enzyme inhibitors and suppressed by
␤-blockers. It is also responsive to sodium status, physical
activity, and posture via concurrent changes in renal perfusion pressure, intraglomerular sodium flux, and sympathetic
traffic to the juxtaglomerular apparatus. Renin levels differ
Richards and Frampton
substantially between ethnic groups. This vulnerability to the
influence of ethnicity, commonly prescribed drugs, commonplace changes in sodium and volume status, posture, and
activity suggests that the application of renin as a risk marker
in the individual patient will remain fraught with difficulties.
The unimpressive performance of C-reactive protein in the
adjusted models included in the Campbell et al analysis is of
interest and, as the authors point out, is concordant with
recent publications suggesting that C-reactive protein may be
a more modest predictor of coronary heart disease than
previously reported.13,14 They rightly point out that the
presence of drugs, including aspirin, may well have attenuated the predictive power of C-reactive protein within this
population. The increasingly widespread prescription of statins may also reduce C-reactive protein levels and may
modify its predictive power for later events in arteriopathic
patients. Nevertheless, the findings of Campbell et al remain
at variance to those from studies in larger groups with
coronary disease in which such drugs are widely used.8,9
NTproBNP stands out as the strongest of the 3 markers in
the current comparison; however, its independent association
with subsequent MI is at odds with the bulk of existing
reports, including some derived from large coronary disease
cohorts subjected to analysis incorporating comprehensive
multivariate models. The report by Campbell et al analyzes a
selective group of patients and requires confirmation in
further cerebrovascular cohorts with analyses that directly
lend themselves to potential application for risk stratification
in “real-life” clinical settings.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Disclosure
Dr Richards has received a research grant from, has served on the
speakers’ bureau of and/or received honoraria from, and has consulted for and/or served on the advisory board of Roche Diagnostics.
Dr Richards has also consulted for and/or served on the advisory
board of Synex.
12.
13.
References
1. Rademaker MT, Richards AM. Cardiac natriuretic peptides for cardiac
health. Clin Sci. 2005;108:23–36.
2. Olsen MH, Wachtell K, Tuxen C, Fossum E, Bang LE, Hall C, Ibsen H,
Rokkedal J, Devereux RB, Hildebrandt P. N-terminal pro-brain natriuretic peptide predicts cardiovascular events in patients with hypertension
14.
NTproBNP and Cardiovascular Risk
11
and left ventricular hypertrophy: a LIFE study. J Hypertens. 2004;22:
1597–1604.
Campbell DJ, Woodward M, Chalmers JP, Colman SA, Jenkins AJ,
Kemp BE, Neal BC, Patel A, MacMahon SW. Prediction of myocardial
infarction by N-terminal-pro-B-type natriuretic peptide, C-reactive
protein, and renin in subjects with cerebrovascular disease. Circulation.
2005;112:110 –116.
PROGRESS Collaborative Group. Randomised trial of a
perindopril-based blood-pressure–lowering regimen among 6,105 individuals with previous stroke or transient ischaemic attack. Lancet. 2001;
358:1033–1041.
Wang TJ, Larson MG, Levy D, Benjamin EJ, Leip EP, Omland T, Wolf
PA, Vasan RS. Plasma natriuretic peptide levels and the risk of cardiovascular events and death. N Engl J Med. 2004;350:655– 663.
De Lemos JA, Morrow DA, Bentley JH, Omland T, Sabatine MS,
McCabe CH, Hall C, Cannon CP, Braunwald E. The prognostic value of
B-type natriuretic peptide in patients with acute coronary syndromes.
N Engl J Med. 2001;345:1014 –1021.
Jernberg T, Stridsberg M, Venge P, Lindahl B. N-terminal pro brain
natriuretic peptide on admission for early risk stratification of patients
with chest pain and no ST-segment elevation. J Am Coll Cardiol. 2002;
40:437– 445.
Sabatine MS, Morrow DA, de Lemos JA, Gibson CM, Murphy SA, Rifai
N, McCabe C, Antman EM, Cannon CP, Braunwald E. Multimarker
approach to risk stratification in non–ST elevation acute coronary syndromes: simultaneous assessment of troponin I, C-reactive protein, and
B-type natriuretic peptide. Circulation. 2002;105:1760 –1763.
James SK, Lindahl B, Siegbahn A, Stridsberg M, Venge P, Armstrong P,
Barnathan ES, Califf R, Topol EJ, Simoons ML, Wallentin L. N-terminal
pro-brain natriuretic peptide and other risk markers for the separate
prediction of mortality and subsequent myocardial infarction in patients
with unstable coronary artery disease. A Global Utilization of Strategies
To Open occluded arteries (GUSTO)-IV Substudy. Circulation. 2003;
108:275–281.
Richards AM, Nicholls MG, Espiner EA, Lainchbury JG, Troughton RW,
Elliott J, Frampton C, Turner J, Crozier IG, Yandle TG. B-type natriuretic
peptides and ejection fraction for prognosis after myocardial infarction.
Circulation. 2003;107:2786 –2792.
Alderman MH, Madhavan S, Ooi WL, Cohen H, Sealey JE, Laragh JH.
Association of the renin-sodium profile with the risk of myocardial
infarction in patients with hypertension. N Engl J Med. 1991;324:
1098 –1104.
Meade TW, Cooper JA, Peart WS. Plasma renin activity and ischemic
heart disease. N Engl J Med. 1993;329:616 – 619.
Danesh J, Wheeler JG, Hirschfield GM, Eda S, Eiriksdottir G, Rumley A,
Lowe GD, Pepys MB, Gudnason V. C-reactive protein and other circulating markers of inflammation in the prediction of coronary heart
disease. N Engl J Med. 2004;350:1387–1397.
Tall AR. C-reactive protein reassessed. N Engl J Med. 2004;350:
1450 –1452.
KEY WORDS: Editorials 䡲 cardiovascular diseases
natriuretic peptides 䡲 renin
䡲
coronary disease
䡲
The Editors express appreciation to the following referees who served from April 1, 2004, to December 31, 2004.
Einari Aavik
Nicola Abate
Amr E. Abbas
Antonio Abbate
Kevin C. Abbott
Robert D. Abbott
Koji Abe
E. Dale Abel
George S. Abela
Benjamin S. Abella
Aiden Abidov
Alexandre Abizaid
M. Roselle Abraham
Pierre Abraham
Theodore P. Abraham
Dan Abramov
Charles S. Abrams
Jerome L. Abramson
Hugues Abriel
Stephan Achenbach
Michael Acker
Michael J. Ackerman
Stamatis Adamopoulos
Robert J. Adams
Volker Adams
Ian Adatia
Philip A. Ades
Jennifer Adgey
Marina Afanasyeva
Vahid Afshar-Kharghan
Stefan Agewall
Tetsuro Ago
Piergiuseppe Agostoni
Pietro Agricola
David Aguilar
Seyedhossein Aharinejad
Amrita Ahluwalia
Ismayil Ahmet
Enrico Aidala
Ken-ichi Aihara
Masanori Aikawa
Barbara Ainsworth
William C. Aird
Masazumi Akahoshi
Olakunle O. Akinboboye
Masahiro Akishita
Junya Ako
Christine M. Albert
Jeffrey Albert
Michelle Albert
Gabriel Aldea
Michael H. Alderman
Alexey N. Aleshin
Marie-Christine Alessi
John H. Alexander
M. Yvonne Alexander
Mark E. Alexander
Peter Alexandersen
Khaled Alfakih
Ottavio R. Alfieri
Francois Alhenc-Gelas
Ziad A. Ali
Etienne M. Aliot
Hussein R. Al-Khalidi
Lindsey D. Allan
Yves Allemann
Maurits A. Allessie
Kristina Allikmets
Matthew A. Allison
Thomas G. Allison
Kevin C. Allman
Laura Almasy
Jesus Almendral
Carlos Alonso-Villaverde
Joseph S. Alpert
Martin A. Alpert
David A. Alter
Peter Alter
Guy Alvarez
John A. Ambrose
Pierre Ambrosi
Peter Ammann
Ezra Amsterdam
Ping An
Inder S. Anand
G.M. Anantharamaiah
Burt Anderson
Gitte Andersen
H. Vernon Anderson
Jeffrey L. Anderson
Kelley P. Anderson
Mark E. Anderson
Neil Anderson
Page A.W. Anderson
Peter G. Anderson
Robert H. Anderson
Todd J. Anderson
Stefan Andreas
Arne K. Andreassen
Felicita Andreotti
Douglas Andres
Vicente Andres
Ramaroson Andriantsitohaina
Rajesh K. Aneja
Giovanni Anfossi
Annalisa Angelini
Gianni D. Angelini
Dominick J. Angiolillo
E. Angles-Cano
Stefan D. Anker
Brian H. Annex
Jack Ansell
Riitta L. Antikainen
Tarek F. Antonios
David Antoniucci
Jovan P. Antovic
Charles Antzelevitch
Piero Anversa
L.J. Appel
Ian Appleton
Andrew E. Arai
Maria Rosario G. Araneta
Stephen L. Archer
Moshe Arditi
Ross Arena
Thomas Arentz
Laurent Argaud
Gary C. Armitage
Paul W. Armstrong
Donna K. Arnett
Leonard F. Arnolda
Wilbert S. Aronow
Marie Arsenault
Margaret A. Arstall
Michael Artman
Yujiro Asada
Takayuki Asahara
Masanori Asakrua
Raimondo Ascione
Alexzander Asea
Arlene S. Ash
Euan A. Ashley
Muhammad Ashraf
Nick Ashton
Gregory K. Asimakis
Samuel J. Asirvatham
Gerd Assmann
Birgit Assmus
Brad Astor
Bela F. Asztalos
Dan Atar
Vasilios G. Athyros
Dianne L. Atkins
Larry D. Atwood
Andrew M. Atz
Johann W. Auer
Pal Aukrust
Angelo Auricchio
Gerard P. Aurigemma
Melissa A. Austin
Richard C. Austin
Michael V. Autieri
Pablo Avanzas
Abraham Aviv
Philip E. Aylward
Michel Azizi
Angelo Azzi
Jan Baan
Vladimir R. Babaev
Gerard Babatasi
Fritz H. Bach
e12
Robert J. Bache
Jean E. Bachet
Walter Backes
Peter Backx
Larry Baddour
David Badesch
Juan J. Badimon
Lina Badimon
Cornel Badorff
Stephen F. Badylak
Alexei Y. Bagrov
Ajay Bahl
Ferdinand H. Bahlmann
Colin Baigent
Steven Bailey
Donald S. Baim
Alison E. Baird
S. Paul Bajaj
Arvind Bakhru
Patricia F. Bakker
Stephan J.L. Bakker
George L. Bakris
Prabhakaran Balagopal
Stephan Baldus
Christie M. Ballantyne
Jean-Luc Balligand
Scott W. Ballinger
Enzo Ballotta
James A. Balschi
Ko Bando
José R. Banegas
Mary A. Banerji
Adrian P. Banning
David A. Baran
Eddy Barasch
Giuseppe Barbaro
John C. Barbato
Paule C. Barbeau
Jean T. Barbey
Robert Bard
Edit Bardi
Philip M. Barger
Stephen G. E. Barker
S. Serge Barold
Alain D. Baron
Lili A. Barouch
Jose A. Barrabes
Elizabeth Barrett-Connor
William H. Barry
Robyn J. Barst
Thomas Bartel
Philip Barter
Jürgen Barth
John R. Bartholomew
Matthias Barton
Benico Barzilai
Theodore A. Bass
Jean-Pierre Bassand
Craig T. Basson
Shari S. Bassuk
Eric R. Bates
Anjan Batra
Robert Bauernschmitt
Johann Bauersachs
Kenneth L. Baughman
Iris Baumgartner
Ralf W. Baumgartner
William Baumgartner
Christophe Bauters
Jeroen J. Bax
B. Timothy Baxter
Gary F. Baxter
Kirk W. Beach
M. Flint Beal
Alvarez Beatriz
Jean-Louis Beaudeux
Christoph R. Becker
Diane M. Becker
Lance B. Becker
Lewis C. Becker
Richard C. Becker
Frank Beckers
Joshua A. Beckman
Bettina Beech
Juerg H. Beer
Philipp Beerbaum
Richard H. Behrman
Berthold Bein
Sean C. Beinart
Alexa Beiser
Romualdo Belardinelli
Robert M. Bell
Jonathan N. Bella
George A. Beller
Michelle P. Bendeck
David G. Benditt
Martin Bendszus
Athanase Benetos
R. Benezra
Frank M. Bengel
Jean-Pierre Bénitah
Ivor J. Benjamin
Ralf Benndorf
Joel S. Bennett
Martin R. Bennett
William M. Bennett
Rondelet Benoit
Neal Benowitz
D. Woodrow Benson
Lee N. Benson
Merrill D. Benson
Aloys Berg
Robert A. Berg
Knut E. Berge
Alan K. Berger
Peter B. Berger
Ronald Berger
Rudolf Berger
Lars Berglund
Martin W. Bergmann
Steven R. Bergmann
Bradford C. Berk
Lisa Berkman
Javier Bermejo
Jose M. Bernal
Michael C. Berndt
Gerald J. Berry
Mark F. Berry
Donald M. Bers
Giuseppe S. Berton
Alain G. Bertoni
Michel E. Bertrand
Charles I. Berul
Patricia J.M. Best
Reinaldo B. Bestetti
Christer Betsholtz
Saroja Bharati
Aruni Bhatnagar
Deepak Bhatnagar
Deepak L. Bhatt
Italo Biaggioni
Cesario Bianchi
Marco E. Bianchi
Giorgio M. Biasi
Hans K. Biesalski
D.H. Biesma
Erik A.L. Biessen
J. Thomas Bigger
Nick R. Bijsterveld
Diane E. Bild
Jacques Billette
George Billman
Feng B. Bin
Philip F. Binkley
John D. Birkmeyer
Yochai Birnbaum
Eva Biro
Nanette H. Bishopric
John A. Bittl
Vera Bittner
Edward O. Bixler
Daniel J. Blackman
Eugene H. Blackstone
Steven N. Blair
Jean-Jacques Blanc
William S. Blaner
Stefan Blankenberg
W. Matthijs Blankesteijn
Andrew D. Blann
Alex Blatt
Andrew D. Blaufox
Erwin Blessing
Peter C. Block
David A. Bluemke
Friedrich C. Blumberg
Roger S. Blumenthal
Alex Bobik
Edimar A. Bocchi
Jorge B. Boczkowski
Peter F. Bodary
Christoph Bode
William E. Boden
Gerd Bodlaj
Manfred Boehm
Michael Boehm
Jolanda M. Boer
Guido Boerrigter
Eric Boersma
Eric Boerwinkle
Rainer H. Boger
Richard G. Bogle
Frank Bogun
David F. Bohr
William Boisvert
Joerg Bojunga
Paula M. Bokesch
Thomas Boland
Roberto Bolli
Victoria Bolotina
Marvin O. Boluyt
Massimo Bonacchi
Raoul Bonan
Nikolaos Bonaros
Lawrence I. Bonchek
Meredith Bond
Diana Bonderman
Hendrik Bonnemeier
Enzo Bonora
Robert O. Bonow
Maria R. Bonsignore
Piet W. Boonstra
Jeffrey Boord
George W. Booz
Nicolas Borenstein
Jeffrey S. Borer
Martin Borggrefe
John Boscardin
René M. Botnar
Michiel L. Bots
Chantal M. Boulanger
Anne Bouloumie
Henri M. Bounameaux
Pierre Boutouyrie
Daniel F. Bowen-Pope
Neil E. Bowles
Penelope A. Boyden
Mark R. Boyett
Biykem Bozkurt
David J. Bradley
T. Douglas Bradley
Randy W. Braith
Frederick Brancati
Ralf P. Brandes
Ruediger C. Braun-Dullaeus
Eugene Braunwald
Alan C. Braverman
Molly S. Bray
Claudia Bregonzio
Roger E. Breitbart
Ole A. Breithardt
e13
Sorin J. Brener
Kate M. Brett
Christoph Brezinka
J. Timothy Bricker
Charles R. Bridges
Regina Brigelius-Flohe
Michele Brignole
Ralph G. Brindis
Charles Brink
Eliot A. Brinton
Michael R. Bristow
Steven L. Britton
Bruce R. Brodie
Sergey V. Brodsky
Ulrich Broeckel
Alessandra Brofferio
Robert D. Brook
Maria M. Brooks
James M. Brophy
M. Julia Brosnan
K. Bridget Brosnihan
Brigitta C. Brott
Margaret E. Brousseau
Jan-Leendert P. Brouwer
Gregory L. Brower
B. Greg Brown
David L. Brown
Kathleen K. Brown
Nancy J. Brown
Warren S. Browner
Michael Brownlee
Ian N. Bruce
Christian Bruch
Josep Brugada
Ramon Brugada
Lyndia Brumback
Corinna B. Brunckhorst
Frank Martin Brunkhorst
Eric J. Brunner
Hans R. Brunner
Helle Bruunsgaard
Robert M. Bryan
Michael Bryer-Ash
Rosemary S. Bubien
Paolo Bucciarelli
Timothy G. Buchman
John Buckwalter
Matthew J. Budoff
Werner Budts
Arno Buecker
Raffaele Bugiardini
L. Maximilian Buja
Jens Bulow
Burkhard D. Bültmann
Cecil M. Burchfiel
Lora Burke
John C. Burnett
Jane C. Burns
Paul B. Burton
Ivo Buschmann
David W. Busija
e14
Rudi Busse
Javed Butler
Alfred E. Buxton
Brian F. Buxton
Peter H. Byers
Benjamin F. Byrd, III
Melissa J. Byrne
Christopher H. Cabell
Candido Cabo
Howard Cabral
Kevin S. Cahill
Hua L. Cai
Michael E. Cain
Paolo Calabro
Antonio M. Calafiore
S.C. Calaghan
Angelino Calderone
Mary Caldwell
David A. Calhoun
Robert M. Califf
Hugh Calkins
David J. Callans
Francois A. Cambien
Richard P. Cambria
Paolo G. Camici
Vito M. Campese
Umberto Campia
Antonio C. Campos de
Carvalho
Paul Canner
Christopher P. Cannon
Richard O. Cannon
Charles E. Canter
John G. Canto
Warren J. Cantor
John M. Canty
Noel M. Caplice
Maurizo C. Capogrossi
Riccardo Cappato
Thomas P. Cappola
Alessandro M. Capponi
Joseph A. Caprini
Sonia Caprio
Alessandro Capucci
Massimo Caputo
Blase A. Carabello
Brian J. Carey
Stephane G. Carlier
Mark D. Carlson
Edward Carmeliet
Pizzi Carmine
Mercedes R. Carnethon
Robert M. Carney
Clara Carpeggiani
Oscar A. Carretero
John D. Carroll
Joseph Carrozza
Jeffrey L. Carson
Andrew J. Carter
Lori Carter-Edwards
Wayne Carver
Paola Casanello
Juan P. Casas
Wayne E. Cascio
Ivan P. Casserly
Lisa A. Cassis
Agustin Castellanos
Edoardo Castelli
Alessandro Cataliotti
Marco Cattaneo
David S. Celermajer
Bojan Cercek
Antonio Ceriello
Manuel Cerqueira
Matteo Cesari
Claudia U. Chae
Mohamed Chahine
Alan Chait
Bernard R. Chaitman
Aravinda Chakravarti
Lorraine Chalifour
Angel Chamorro
Hunter C. Champion
Bysani Chandrasekar
Anthony C. Chang
Chih-Jen Chang
Ruey-Kang R. Chang
Kevin S. Channer
Keith M. Channon
M. John Chapman
Nora M. Chapman
Israel F. Charo
John C. Chatham
Lee-Young Chau
Sarwat Chaudhry
Gautam Chaudhuri
Aurea J. Chaves
Melvin D. Cheitlin
Alex F. Chen
Horng H. Chen
Ian Y. Chen
Jiu-an Chen
Peng-Sheng Chen
Shih-Ann Chen
Edouard Cheneau
Debbie Cheng
James H. Chesebro
Mordechai Chevion
Derek P. Chew
Elena Chiarpotto
Masaaki Chiku
John S. Child
William M. Chilian
Kazuo Chin
Michael T. Chin
Marcello Chinali
Randolph W. Chitwood, Jr
Ray C-J Chiu
Leslie Cho
Aram V. Chobanian
Anand Chockalingam
Eric T. Choi
Jina Choo
Tz-Chong Chou
Robin P. Choudhury
Benjamin J.W. Chow
Judith C. Chow
Timothy F. Christian
Mina Chung
Taylor Chung
Mariantonietta Cicoira
Marilyn J. Cipolla
Francesco Cipollone
Kieran Clarke
Robert Clarke
William R. Clarke
Catherine M. Clase
John G.F. Cleland
Paula R. Clemen
Ton J. Cleophas
Aldo Clerico
Angela Clerk
Alexander Clowes
William T. Clusin
Ronald I. Clyman
Andrew J. Coats
Leonard A. Cobb
William A. Coetzee
Thomas M. Coffman
David J. Cohen
Eric A. Cohen
Hillel W. Cohen
Howard A. Cohen
Marc Cohen
Michael V. Cohen
Richard A. Cohen
Jay N. Cohn
Lawrence H. Cohn
William E. Cohn
Steven D. Colan
Jamie Coleman
Désiré Collen
Barry S. Coller
Robert W. Colman
Antonio Colombo
Maria Giovanna Colombo
David Colquhoun
Catherine Communal
Gianluigi Condorelli
William E. Connor
Robert V. Considine
C. Richard Conti
Elena Conti
David J. Cook
George A. Cook
Nancy R. Cook
John P. Cooke
Joshua M. Cooper
Leslie T. Cooper
Mark E. Cooper
Richard S. Cooper
Josef Coresh
James Coromilas
Domenico Corrado
Javier Corral
Dalila Corry
Alberto Corsini
Marshal A. Corson
Roberto Corti
Joseph S. Coselli
Francesco Cosentino
Francisco G. Cosio
Marco A. Costa
Lisa C. Costello-Boerrigter
William G. Cotts
Paul J.M. Coucke
Thierry Couffinhal
David Couper
Adrian Covic
Dermot Cox
Jill P. Crandall
Michael H. Crawford
Sybil Crawford
Filippo Crea
Mark A. Creager
Harry J.G.M. Crijns
Janet B. Croft
Kevin D. Croft
Rachelle H. Crosbie
Carroll E. Cross
John R. Crouse
Richard S. Crow
J. Kennedy Cruickshank
Bruce F. Culleton
Juraj Culman
R. William Currie
Jesse W. Currier
Anne B. Curtis
Mary Cushman
Daniele M. Cusi
Jeffrey A. Cutler
Maria-Cristina Cuturi
Myron I. Cybulsky
Tillmann Cyrus
Sébastien Czernichow
Mat J.A.P. Daemen
Michael Daffertshofer
Ralph B. D’Agostino
Mohamed R. Daha
Hiroyuki Daida
James E. Dalen
Ronald L. Dalman
Edward R. Damiano
Patricia D’Amore
Nicolas Danchin
Paresh Dandona
Haim D. Danenberg
George Dangas
Peter G. Danias
Werner G. Daniel
Jean-Marie Daniel Lamaziere
Stephen R. Daniels
A.H. Jan Danser
Victor Darley-Usmar
Anthony M. Dart
Dipak K. Das
Undurti N. Das
Jean C. Daubert
Harold L. Dauerman
Alan Daugherty
Anthony P. Davenport
Tirone E. David
Sandra T. Davidge
Charles J. Davidson
Karina W. Davidson
Barry R. Davis
Patricia H. Davis
Roger A. Davis
Roger B. Davis
Russell C. Davis
Robin L. Davisson
Vedat Davutoglu
Kevin P. Davy
Dana Dawson
Jonathan R.S. Day
Sharlene M. Day
Jacques de Bakker
Fred De Beer
Bernard De Bruyne
Raffaele De Caterina
Ulf de Faires
Pim J. de Feyter
Giovanni de Gaetano
Peter de Jaegere
Paul E. de Jong
Marlies de Lange
Peter W. de Leeuw
James A. de Lemos
Michel de Lorgeril
Giuseppe De Luca
Moniek P.M. de Maat
Ebo D. de Muinck
Ramon de Nooijer
Anne De Paepe
Giovanni De Pergola
Dominique de Prost
Giovanni de Simone
Johan H. De Sutter
Robbert J. de Winter
Dick de Zeeuw
Barbara J. Deal
John E. Deanfield
Arjun Deb
Robert F. DeBusk
G. William Dec
William M. DeCampli
Jeanne M. DeCara
Robert S. Decker
Gordon R. DeFoe
Curt G. DeGroff
Gregory J. Dehmer
Jan T. Deichen
Elisabeth Deindl
Carolin Deiner
Elisabetta Dejana
Ranjan Deka
Jacqueline M. Dekker
Federica del Monte
Etienne Delacrétaz
Joris Delanghe
Claude Delcayre
Christophe Delclaux
Thomas E. Delea
Jose A. Delgado Alves
E. Patchen Dellinger
R. Phillip Dellinger
Louis J. Dell’Italia
Kevin C. Dellsperger
Mario Delmar
Michael D. Delp
Anthony N. DeMaria
Yi Deng
Donald R. Dengel
Christophe Depre
Dimitri Deserranno
Alessandro Desideri
Christopher A. DeSouza
George Despotis
Jean-Pierre Despres
Zeruesenay Desta
Anita DeStefano
Robert C. Detrano
Katherine M. Detre
Tobias Deuse
Mohan Devbhandari
Richard B. Devereux
Mieke Dewerchin
Marc Dewey
Mandeep Dhadly
Naranjan S. Dhalla
Stefan Dhein
Gerald F. Di Bona
Marcelo F. Di Carli
Carlo Di Mario
Mario Di Napoli
Pietro Di Pasquale
Michaela Diamant
George A. Diamond
David A. Dichek
Wolfgang Dichtl
Kenneth Dickstein
Sean P. Didion
Andre M. Diedrich
Jutta Dierkes
Javier Diez
Wolfgang H. Dillmann
Joseph S. Dillon
Vasken Dilsizian
John P. DiMarco
Stefanie Dimmeler
Anh Tuan Dinh-Xuan
Donald J. DiPette
Michael Diringer
Abhinav Diwan
Sanjay Dixit
Douglas W. Dockery
Torsten Doenst
Pieter A. Doevendans
Hisham Dokainish
Anna F. Dominiczak
William T. Donahoo
J. Kevin Donahue
Rosario Donato
Peter Doris
Gerald W. Dorn, II
David E. Dostal
Pamela S. Douglas
James M. Downey
Stephen W. Downing
Ramona Doyle
Kathleen Dracup
Luciano F. Drager
Mark H. Drazner
Wim Drenthen
Helmut Drexler
Daniel L. Dries
Ahmed Ben Driss
Jie Du
Terry W. Du Clos
Dayue Duan
Raghvendra K. Dubey
Anne M. Dubin
Anique Ducharme
Samuel C. Dudley
Stephen J. Duffy
Dirk J. Duncker
Daniel Duprez
Jocelyn Dupuis
Josee Dupuis
David T. Durack
Carlos M.G. Duran
William Durante
J. Larry Durstine
Firat Duru
Susan Duval
Kim A. Eagle
Elaine D. Eaker
Robert T. Eberhardt
Franz R. Eberli
Lynn E. Eberly
Steven N. Ebert
Shah Ebrahim
Dwain L. Eckberg
Robert H. Eckel
Jay M. Edelberg
Elazer R. Edelman
Robert R. Edelman
Thomas S. Edgington
L. Henry Edmunds
Igor R. Efimov
Kensuke Egashira
Satoru Eguchi
Marek P. Ehrlich
Benjamin W. Eidem
John F. Eidt
John W. Eikelboom
Howard J. Eisen
e15
Mark J. Eisenberg
Mickey S. Eisenberg
Graeme Eisenhofer
Daniel T. Eitzman
Mikael Elam
John A. Elefteriades
Michael T. Eliasziw
Uri Elkayam
Kenneth A. Ellenbogen
Myrvin Ellestad
Oyvind Ellingsen
Patrick Ellinor
Justine A. Ellis
Stephen G. Ellis
Kristin E. Ellison
Nabil El-Sherif
Mary Emond
Noriaki Emoto
Masao Endoh
Matthias Endres
Richard M. Engelman
David M. Engman
Gunnar Engstrom
Andrew E. Epstein
Frederick H. Epstein
Laurence M. Epstein
Stephen E. Epstein
Raimund R. Erbel
John M. Erikson
Einar E. Eriksson
Wolfgang Erl
Thomas P. Erlinger
Thomas Eschenhagen
Charles T. Esmon
Ricardo J. Esper
Christine Espinola-Klein
Katherine Esposito
N.A. Mark Estes
Zeev Estrov
Masato Eto
Tanenao Eto
Paulo Roberto B. Evora
Justin A. Ezekowitz
Michael D. Ezekowitz
John W. Fabre
Rosalind Fabunmi
Gianpaolo Fadini
Erling Falk
Rodney H. Falk
Bonita Falkner
James C. Fang
James I. Fann
Frank Faraci
Andrew Farb
Harrison W. Farber
Jawed Fareed
William B. Farquhar
Vladimir G. Fast
Khalil Fattouch
Elda Favari
David P. Faxon
e16
William P. Fay
Zahi A. Fayad
Jocelyne Fayn
Franz Fazekas
Sergio Fazio
William F. Fearon
Paul W.M. Fedak
Eugenia Fedoseyeva
Jeffrey A. Feinstein
Mary F. Feitosa
Robert Felder
G. Michael Felker
Michael P. Feneley
Qingping Feng
Peter Ferdinandy
James J. Ferguson, III
T. Bruce Ferguson
Francisco Fernandez-Aviles
Jose M. Fernandez-Real
Olivier Feron
Markus Ferrari
Victor A. Ferrari
Victor A. Ferraris
Paolo Ferrazzi
Robert E. Ferrell
Andreas Festa
Stephan Fichtlscherer
Anette Fiebeler
Loren J. Field
David S. Fieno
Michael A. Fifer
Hans R. Figulla
Janos G. Filep
Antonio P. Filipe, Jr.
Jeffrey R. Fineman
Mitchell S. Finkel
Toren Finkel
Dianne M. Finkelstein
Marcus Fischer
Thorsten Fischer
Richard D. Fish
Michael C. Fishbein
Edward A. Fisher
John D. Fisher
John T. Fisher
Patrick W. Fisher
Steven A. Fisher
Glenn I. Fishman
Desmond J. Fitzgerald
Garret A. FitzGerald
Peter J. Fitzgerald
Frank A. Flachskampf
Greg C. Flaker
Scott D. Flamm
Marcus D. Flather
Jerome L. Fleg
Kirsten E. Fleischmann
Ingrid Fleming
Richard M. Fleming
Markus Flesch
Gerald F. Fletcher
John S. Floras
James Floyd
Martin Fluck
Joseph Flynn
Robert Fogel
Alan M. Fogelman
Antonio F. Folino
Franco Folli
Gregg C. Fonarow
Guo-Hua Fong
Ignatius W. Fong
Vivian A. Fonseca
JoAnne M. Foody
Thomas Force
Earl S. Ford
George D. Ford
Myriam Fornage
James S. Forrester
Ulrich Forstermann
Trudy M. Forte
Elyse Foster
F. Gerald Fowkes
Caroline S. Fox
Ervin Fox
Alain Fraisse
Mark W. Frampton
Silvia Franceschi
Charles W. Francis
Gary S. Francis
Veronica Franco
Dignat-George Françoise
Nikolaos G. Frangogiannis
Markus H. Frank
Stanley S. Franklin
Wayne J. Franklin
Michael R. Franz
Robert P. Frantz
Stefan Frantz
Maria Grazia Franzosi
Nancy Frasure-Smith
Robert W.M. Frater
David S. Freedman
Bruce A. Freeman
Balz Frei
John K. French
Michael P. Frenneaux
Ulrich H. Frey
Matthias Frick
Linda F. Fried
Susan K. Fried
R.P. Friedland
Deborah M. Friedman
Paul A. Friedman
Jefferson Frisbee
Victor Froelicher
Jiri J. Frohlich
Alberto Froio
Peter C. Frommelt
Andrea Frustaci
Robert L. Frye
Ryan M. Fryer
Mingui Fu
Shmuel Fuchs
Bianca Fuhrman
Masashi Fujita
Naomi Fukagawa
Tohru Fukai
Keiichi Fukuda
Kesiuke Fukuo
Pino Fundarò
John W. Funder
Colin D. Funk
Curt D. Furberg
Raffaello Furlan
Mark I. Furman
Masato Furuhashi
Valentin Fuster
William H. Gaasch
Christian Gachet
David R. Gagnon
James V. Gainer
Fiorenzo Gaita
Patrick J. Gallagher
Claudio Galli
Augusto Gallino
James M. Galloway
Jonas B. Galper
Apoor S. Gami
Santhi Ganesh
Peter Ganz
Mario J. Garcia
Julius M. Gardin
Helena M. Gardiner
Sheila M. Gardiner
David G. Gardner
Martin J. Gardner
Roy S. Gardner
Alan Garfinkel
Philippe Garot
Peter Garred
Jean-Michel T. Gaspoz
Michael A. Gatzoulis
Kimberlee Gauvreau
Timothy P. Gavin
Haralambos P. Gavras
Irene Gavras
Meinrad Gawaz
Steffen Gay
J. William Gaynor
J. Michael Gaziano
Raul J. Gazmuri
Carmine Gazzaruso
Robert L. Geggel
Bruce D. Gelb
Jacques Genest
Yong-Jian Geng
Alfred L. George
Sarah J. George
Demetrios Georgiou
Alexander Geppert
Lior Gepstein
Hanspeter Gerber
A. Martin Gerdes
Marie D. Gerhard-Herman
Lucie Germain
Guido Germano
Bernard J. Gersh
M. Eric Gershwin
Myron C. Gerson
Welton M. Gersony
Edward P. Gerstenfeld
Robert E. Gerszten
S. David Gertz
Leonard S. Gettes
Tal Geva
Henry Gewirtz
Michael Gewitz
Jalal K. Ghali
William A. Ghali
Mihai Gheorghiade
Lorenzo Ghiadoni
Hossein A. Ghofrani
Carlo Giansante
Gary H. Gibbons
Raymond J. Gibbons
C. Michael Gibson
Samuel S. Gidding
Stephan Gielen
Martine Gilard
Ian C. Gilchrist
Thomas D. Giles
Wayne R. Giles
Linda D. Gillam
Jonathan Gillard
A. Marc Gillinov
Anne M. Gillis
Matthew W. Gillman
Richard F. Gillum
Robert F. Gilmour
Larry C. Gilstrap
Frank J. Giordano
Domenico Girelli
Cynthia J. Girman
Anselm K. Gitt
Dario Giugliano
Gregory R. Giugliano
Alexandre Giusti-Paiva
Michael M. Givertz
David Gjertson
Mark T. Gladwin
Stanton A. Glantz
Stephen P. Glasser
Stephen J. Glatt
Nicola Glorioso
Donald D. Glower
Charles J. Glueck
Robert J. Glynn
Alan S. Go
Ulrich Göbel
Andrew Gogbashian
Noyan Gokce
Diane R. Gold
Jeffrey P. Gold
Michael R. Gold
Ira J. Goldberg
Ronald B. Goldberg
Jeffrey J. Goldberger
Sherita H. Golden
Ira D. Goldfine
Joshua I. Goldhaber
Samuel Z. Goldhaber
Lee Goldman
Pascal J. Goldschmidt
Steven R. Goldsmith
Larry B. Goldstein
Michael S. Goligorsky
Paolo Golino
Jonathan Golledge
Celso E. Gomez-Sanchez
Philimon Gona
Mario D. Gonzalez
Elizabeth Goodman
Lawrence T. Goodnough
Theodore A. Gooley
John Gorcsan
Neil Gordon
Joel M. Gore
Tommaso Gori
Mark W. Gorman
Robert C. Gorman
Shinya Goto
Roberta A. Gottlieb
Stephen S. Gottlieb
Antonio M. Gotto
K. Lance Gould
Luis Henrique W. Gowdak
Kristof Graf
Patricia M. Grambsch
Juan F. Granada
Christopher B. Granger
D. Neil Granger
Augustus O. Grant
Henk L. Granzier
Guido Grassi
David Gray
Paul A. Grayburn
J. Thomas Grayston
Daniel J. Green
Darren C. Greenwood
Edward W. Gregg
Michelle Ann Grenier
Kathy K. Griendling
Brian P. Griffin
Helen R. Griffiths
Clarence E. Grim
Cindy L. Grines
Steven K. Grinspoon
Jean Ann Grisso
Francine Grodstein
William J. Groh
Marie-Louise M. Gronholdt
Robert Gropler
Garrett J. Gross
Oliver Gross
Eugene A. Grossi
Ehud Grossman
Blair P. Grubb
Eberhard Grube
Scott M. Grundy
Gary L. Grunkemeier
Eliseo Guallar
Maurizio D. Guazzi
Vilmundur G. Gudnason
Peter G. Guerra
Gerard M. Guiraudon
Martha Gulati
Giosue Gulli
Hakan Gullu
Julian Gunn
Mahesh P. Gupta
Narendra K. Gupta
Paul A. Gurbel
Enrique P. Gurfinkel
Geoffrey C. Gurtner
Swaminatha V. Gurudevan
Arjun Gururaj
Matthias Gutberlet
David D. Gutterman
Przemyslaw Guzik
Tomasz J. Guzik
Stefano Guzzetti
Katrina Gwin-Hardy
Donald C. Haas
Felix Haas
Helmut Habazettl
Robert H. Habib
Rory Hachamovitch
Walter E. Haefeli
Judith Haendeler
Hans U. Haering
Steven M. Haffner
David E. Haines
William D. Haire
Michel Haissaguerre
Roger J. Hajjar
Charles A. Hales
Kathleen J. Haley
Michael E. Halkos
Jennifer L. Hall
Par Hallberg
Hermann Haller
Jozsef Haller
Kevin J. Hallock
Perry V. Halushka
Rainer Hambrecht
Mohamed H. Hamdan
Pavel Hamet
John A. Hamilton
Christian W. Hamm
H. Kirk Hammond
Zhong C. Han
Wayne W. Hancock
Diane E. Handy
Claude E. Hanet
Graeme J. Hankey
Anthony J. Hanley
James A. Hanley
Edward L. Hannan
William H. Hansen
Goran K. Hansson
Akiyoshi Hara
Shuntaro Hara
Joshua M. Hare
Robert A. Harrington
William S. Harris
David G. Harrison
Alison L. Harte
Paula J. Harvey
Rodrigo Hasbun
David Hasdai
Naoyuki Hasebe
Gerd Hasenfuss
J. Michael Hasenkam
Naotake Hashimoto
Paul M. Hassoun
Thomas S. Hatsukami
Daniel C. Hatton
Richard N.W. Hauer
Paul J. Hauptman
Elizabeth R. Hauser
Richard J. Havel
Axel Haverich
Edward P. Havranek
Robert A. Haworth
Ilan Hay
Nissim Hay
Junichiro Hayano
David L. Hayes
Sharonne N. Hayes
Daniel Hayoz
Stanley L. Hazen
Jiang He
Ka He
Tongrong He
Anthony M. Heagerty
Harvey S. Hecht
Susan R. Heckbert
Peter S. Heeger
Timothy Heeren
Christopher Heeschen
Linda J. Heffner
Robert A. Hegele
Paul A. Heidenreich
Jörg Heierhorst
Albert Heim
Robert J. Heine
Gerardo Heiss
Alan W. Heldman
Gary V. Heller
Joan Heller Brown
Barbara L. Hempstead
Robert Henderson
Marc Hendrikx
Peter Henke
Charles H. Hennekens
Michael Hennerici
e17
Keith Henry
Timothy D. Henry
Heike M. Hermanns
Ramon C. Hermida
Adrian F. Hernandez
Miika Hernelahti
Victoria L.M. Herrera
David M. Herrington
Howard C. Herrmann
Ray E. Hershberger
Charles A. Herzog
David C. Hess
Otto M. Hess
Gerd F. Heusch
Karsten Heusser
Steven B. Heymsfield
William R. Hiatt
Yukihito Higashi
Charles B. Higgins
Denise Hilfiker-Kleiner
Joseph A. Hill
Gerhard Hindricks
Thomas H. Hintze
Shuji Hinuma
Masayasu Hiraoka
Loren F. Hiratzka
Karen K. Hirschi
Valeria Hirschler
John W. Hirshfeld
Keiichi Hishikawa
Mark A. Hlatky
Donald Hnatowich
Carolyn Ho
Helen H. Hobbs
Didier Hober
Robert W. Hobson
Judith S. Hochman
Hanoch Hod
Julien I. Hoffman
Udo Hoffmann
Peter Höglund
Thomas Hohlfeld
Stefan H. Hohnloser
Brian D. Hoit
John E. Hokanson
Fernando Holguin
Judd E. Hollander
Morley Hollenberg
Thomas A. Holly
William L. Holman
David R. Holmes
Paul Holvoet
Michael Holzer
Shunichi Homma
Myeong-Ki Hong
Yuling Hong
Rocio S. Honigmann
Jane L. Hoover-Plow
Richard Hopkins
William E. Hopkins
Uta C. Hoppe
e18
Masatsugu Hori
Lisa K. Hornberger
Benjamin D. Horne
Burkhard Hornig
John D. Horowitz
Lawrence D. Horwitz
Steven R. Houser
Barbara V. Howard
George Howard
T. Howard Howell
Henry H. Hsia
Frank B. Hu
Peifeng Hu
Paul L. Huang
Sally A. Huber
Whady A. Hueb
Joerg Huelsken
Chris C. Hughes
David Y. Hui
Heikki V. Huikuri
P.P. Hujoel
Russell D. Hull
Per M. Humpert
Karin H. Humphries
Stephen E. Humphries
Thomas Hund
Joseph Hung
Kelly J. Hunt
Steven C. Hunt
Patrick R. Hunziker
Winston L. Hutchinson
Adolph M. Hutter
Guido Iaccarino
Mark Iafrati
Sahoko Ichihara
Raymond E. Ideker
Richard G. Ijzerman
Uichi Ikeda
Katsunori Ikewaki
John S. Ikonomidis
Sabino Iliceto
Armin Imhof
Akihiro Inazu
Sandro Inchiostro
Ciro Indolfi
Julie R. Ingelfinger
David A. Ingram, Jr.
Joanne S. Ingwall
Nobutaka Inoue
Teruo Inoue
Cecilia Invitti
D.P. Inwald
Dan-Dominic G. Ionescu
Kaikobad J. Irani
Mitsuhiro Isaka
Shun Ishibashi
Junnichi Ishii
Kikuo Isoda
Eric M. Isselbacher
Takaaki Isshiki
Hiroshi Ito
Masahiro Ito
Wulf D. Ito
Toshiyuki Itoi
Susan L. Ivey
D. Dunbar Ivy
Yuichi Iwaki
Tohru Izumi
Christopher L. Jackson
EdwinK. Jackson
Graham Jackson
Shaun P. Jackson
Alice K. Jacobs
David R. Jacobs
Donald W. Jacobsen
Paul Jacques
Tazeen H. Jafar
Allan S. Jaffe
Thomas Jahnke
Mukesh K. Jain
Rajan Jain
Pierre Jaïs
Jose Jalife
Jorge E. Jalil
Ik-Kyung Jang
Joseph S. Janicki
Warren R. Janowitz
Michiel J. Janse
Ian Janssen
Stefan P. Janssens
Craig T. January
James L. Januzzi
Rudolf Jarai
Mikko J. Jarvisalo
Patrick Y. Jay
Goy Jean-Jacques
David J. Jenkins
Rolf Jenni
Allen Jeremias
Michael Jerosch-Herold
Paula Jerrard-Dunne
Xavier Jeunemaitre
Ashish K. Jha
Ishwarlal Jialal
Canwen Jiang
Huang Jianhua
Bernd Jilma
Hanjoong Jo
Mark A. Jobling
Edward J. Johns
B. Delia Johnson
Bruce D. Johnson
Jason L. Johnson
Richard J. Johnson
Robert L. Johnson
Daniel W. Jones
Gregory T. Jones
Peter L. Jones
Robert H. Jones
Steven P. Jones
W. Keith Jones
Habo J. Jongsma
Shuichi Jono
Jens Jordan
Jacob Joseph
Mark E. Josephson
Kaumudi J. Joshipura
Janna Journeycake
Pekka Jousilahti
Aleksandar Jovanovic
Ian R. Jowsey
Michael J. Joyner
Bodh I. Jugdutt
J. Wouter Jukema
David N. Juurlink
Stefan Kaab
Jens J. Kaden
Alan H. Kadish
Yutaka Kagaya
Henry S. Kahn
Richard Kahn
Fumihiko Kajiya
Gabor Kaley
Christoph Kalka
Klaus Kallenbach
Jonathan M. Kalman
Lalit Kalra
Grzegorz L. Kaluza
Balaraman Kalyanaraman
Vaijinath S. Kamanna
Timothy J. Kamp
Junji Kanda
Takeshi Kanda
David E. Kandzari
Laura B. Kane
Nicholas Kang
William B. Kannel
Norman M. Kaplan
Tomas Kara
Richard H. Karas
Johan Karlberg
Joel S. Karliner
Morris Karmazyn
Aly Karsan
Karl R. Karsch
Soji Kasayama
Carlos S. Kase
Juan-Carlos Kaski
Edward K. Kasper
David A. Kass
Robert S. Kass
Ghassan Kassab
John J.P. Kastelein
Adnan Kastrati
Naoto Katakami
Sekar Kathiresan
Masahiko Kato
Tomohiro Katsuya
Hugo A. Katus
Zvonimir S. Katusic
Arnold M. Katz
Stuart D. Katz
Marc P. Kaufman
Philipp A. Kaufmann
Sanjay Kaul
Sanjiv Kaul
Koji Kawahito
Chuichi Kawai
David M. Kaye
Teruhisa Kazui
Elsadig Kazzam
Mark T. Keating
Craig A. Keebler
Beate E. Kehrel
Aaron S. Kelly
Daniel P. Kelly
Ralph A. Kelly
Malte Kelm
Anita M. Kelsey
Byron W. Kemper
Richard D. Kenagy
Thomas A. Kent
Richard E. Kerber
Dean J. Kereiakes
Karl B. Kern
Morton J. Kern
William S. Kerwin
Steven J. Keteyian
Paul Khairy
Bijoy Khandheria
Ashwani Khanna
Stefan Kiechl
Jan T. Kielstein
Shinji Kihara
Tatsuya Kiji
Dae Jung Kim
Hyo-Soo Kim
InKyeom Kim
Jason K. Kim
Raymond J. Kim
Thomas R. Kimball
Stephen E. Kimmel
Carey D. Kimmelstiel
Akinori Kimura
George L. King
Spencer B. King
John G. Kingma
Scott Kinlay
Ulrich Kintscher
Kevin E. Kip
Charles J.H.J. Kirchhof
James Kirklin
Lorrie A. Kirshenbaum
Chiharu Kishimoto
Brett M. Kissela
Toru Kita
Akira Kitabatake
Masafumi Kitakaze
Kazuo Kitamura
Richard N. Kitsis
Andre G. Kleber
Robert Kleemann
Neal S. Kleiman
Allan L. Klein
George J. Klein
Lloyd W. Klein
Paul D. Kligfield
James R. Klinger
Elizabeth S. Klings
Francis J. Klocke
Robert A. Kloner
Bradley P. Knight
John L. Knight
Anne A. Knowlton
Kirk U. Knowlton
Sarah S. Knox
Merril L. Knudtson
Juhani Knuuti
Dennis T. Ko
Yoshio Kobayashi
Colleen G. Koch
Walter J. Koch
Itsuo Kodama
Wolfgang Koenig
Theo Kofidis
Kwang K. Koh
Frank Kolodgie
Issei Komuro
Takahisa Kondo
Marvin A. Konstam
Stavros V. Konstantinides
Igor E. Konstantinov
Anatol Kontush
Marianne Eline Kooi
Willem J. Kop
Stephen L. Kopecky
Bruce A. Koplan
Ran Kornowski
Mikhail Kosiborod
Andreas Koster
Rudolph W. Koster
Sawa Kostin
Theodore A. Kotchen
Hans Kottkamp
Nicholas T. Kouchoukos
Petri T. Kovanen
Peter R. Kowey
Jun Koyama
Andrew D. Krahn
Aldi Kraja
Jonathan Krakoff
Christopher M. Kramer
Evangelia G. Kranias
William E. Kraus
Ronald M. Krauss
Andrew J. Krentz
Nancy R. Kressin
Reinhold Kreutz
Jorg Kreuzer
P.A. Krieg
Murali C. Krishna
Rajesh Krishnamurthy
Eswar Krishnan
Leonard Kritharides
Michael H. Kroll
Irving L. Kron
Marvin W. Kronenberg
Itzhak Kronzon
Florian Krotz
Paul Kubes
Nils Kucher
Karl-Heinz Kuck
Nino Kuenzli
Hartmut Kuhn
Michaela Kuhn
Helena Kuivaniemi
Marrick L. Kukin
Rakesh C. Kukreja
Lewis H. Kuller
Iftikhar J. Kullo
Premkumari Kumarathasan
Richard E. Kuntz
Calvin J. Kuo
Lih Kuo
Christian Kupatt
Dhandapani Kuppuswamy
Masahiko Kurabayashi
Tobias Kurth
Theodore Kurtz
Kengo F. Kusano
Jeffrey T. Kuvin
William A. Kuziel
Tatiana Kuznetsova
Kevin F. Kwaku
Raymond Y. Kwong
Michael Kyller
Maria T. La Rovere
David E. Laaksonen
Arthur Labovitz
Louis M. Labrousse
Roger J. Laham
Shenghan Lai
John G. Lainchbury
Edward G. Lakatta
Hanna-Maaria Lakka
Timo A. Lakka
Jules Y.T. Lam
Stephen C.T. Lam
Benoit Lamarche
John J. Lamberti
Rachel Lampert
Katja H. Lampinen
Kathryn G. Lamping
Hui Y. Lan
Gary Landreth
Donald W. Landry
Michael J. Landzberg
David A. Lane
Roberto M. Lang
Jonathan J. Langberg
Bas Langeveld
B. Lowell Langille
David Langleben
Alexandra J. Lansky
Harris Lari
John C. LaRosa
Torben B. Larsen
Warren K. Laskey
Robert D. Lasley
Larry A. Latson
Jo-Dee L. Lattimore
Joseph Lau
Wei C. Lau
Michael S. Lauer
Ulrich Laufs
Jari A. Laukkanen
Stephane Laurent
Kenneth R. Laurita
Debbie A. Lawlor
Daniel A. Lawrence
Lesley Lawrenson
Louise Lawson
Jennifer S. Lawton
Harold L. Lazar
Ronald M. Lazar
Dominique Le Guludec
Alexander Leaf
Sam D. Leary
Robert J. Lederman
Amanda J. Lee
Hon-Chi Lee
Richard T. Lee
Thomas H. Lee
C.P.M. Leeson
David J. Lefer
Jean-Francois Legare
Jacopo M. Legramante
Michael H. Lehmann
Stephan E. Lehnart
Leslie Leinwand
Norbert Leitinger
Thierry H. LeJemtel
Paul LeLorier
Giuseppe Lembo
Pedro A. Lemos
Steven R. Lentz
David A. Leon
Antonio Maria Leone
Jonathan Leor
Amir Lerman
Bruce B. Lerman
Edward J. Lesnefsky
Philippe F. Lesnik
Heather S. Lett
Donald Y. Leung
Michael C. H. Leung
Marcel M. Levi
Roberto Levi
Adeera Levin
Benjamin D. Levine
Glenn N. Levine
Robert A. Levine
Sidney Levitsky
Bernard I. Levy
Daniel Levy
Robert J. Levy
Andrew P. Levy
e19
Jerrold H. Levy
Wilbur Y. Lew
Martin M. LeWinter
Alan B. Lewis
Klaus F. Ley
Andrew C. Li
Jennifer S. Li
Jian Li
Jianhua Li
Na Li
Shengxu Li
Yan C. Li
Bruce T. Liang
Chang-seng Liang
James K. Liao
Ronglih Liao
Youlian Liao
Peter Libby
Joseph R. Libonati
David S. Liebeskind
Philip R. Liebson
Choong-Chin Liew
Stephen B. Liggett
Kathleen C. Light
Yean L. Lim
Chee Chew Lim
Joao A. Lima
Marian C. Limacher
Ming T. Lin
Shien-Fong Lin
Michael Lincoff
Bertil Lindahl
JoAnn Lindenfeld
Marshall D. Lindheimer
Jonathan R. Lindner
Volkhard Lindner
Jerry B. Lingrel
MacRae F. Linton
Gregory Y.H. Lip
William C. Little
Sheldon E. Litwin
Jun Liu
Kiang Liu
Peter P. Liu
Simin Liu
Yongge Liu
Eng H. Lo
Amanda Lochner
James E. Lock
Warren E. Lockette
Ian M. Loftus
Anne-Marie Lompre
Barry London
Gérard M. London
Carlin S. Long
Eva M. Lonn
Gary D. Lopaschuk
John J. Lopez
Patricio López-Jaramillo
Francisco Lopez-Jimenez
Christine H. Lorenz
e20
David J. Loskutoff
Douglas W. Losordo
Eric B. Loucks
Charles J. Lowenstein
Gerald Luc
Lee Lucas
Benedict R. Lucchesi
Pamela A. Lucchesi
Andreas Luchner
John Ludbrook
David Ludwig
Russell V. Luepker
Friedrich C. Luft
Esther Lutgens
Aernout L. Luttun
Robert L. Lux
Bruce W. Lytle
Christoph Maack
David M. Maahs
Renke Maas
Peter S. Macdonald
Christopher K. Macgowan
Guy A. MacGowan
Francois Mach
Stella M. Macin
Christopher Mack
Michael J. Mack
Wendy J. Mack
Isla S. Mackenzie
Rachel H. Mackey
William R. MacLellan
Michal Maczewski
Paolo Madeddu
Mohammad Madjid
Joren C. Madsen
Koji Maemura
Aldo P. Maggioni
Kenneth W. Mahaffey
Michael C. Mahaney
Lynn Mahony
Heimo Mairbaurl
Bernhard Maisch
Alan S. Maisel
William H. Maisel
Mark W. Majesky
Amy S. Major
Robert T. Mallet
Ziad Mallat
Alberto Malliani
Giuseppe Mancia
G.B. John Mancini
Pitchaiah Mandava
Olivia Manfrini
Dennis T. Mangano
Arduino A. Mangoni
Venkatesh Mani
Calin V. Maniu
Douglas L. Mann
Giovanni E. Mann
Johannes F. Mann
Kenneth G. Mann
Michael J. Mann
Stewart Mann
Peter B. Manning
Warren J. Manning
Pier M. Mannucci
Teri A. Manolio
Moussa Mansour
Michael S. Marber
Keith L. March
Simona Marchesi
Francis E. Marchlinski
Frank I. Marcus
Maurizio Margaglione
Ali J. Marian
Allyn L. Mark
Daniel B. Mark
Andrew R. Marks
Barry J. Maron
Luc Maroteaux
Michel Marre
Mario B. Marrero
Oscar C. Marroquin
Philip A. Marsden
Audrey C. Marshall
Steven P. Marso
Fabio Martelli
Douglas Martin
Jack L. Martin
Paul T. Martin
Wim Martinet
Yukio Maruyama
Thomas H. Marwick
Gerald R. Marx
Nikolaus Marx
Steven O. Marx
Attilio Maseri
Peter J. Mason
Robert J. Mason
Frederick A. Masoudi
Joseph M. Massaro
Barry M. Massie
Bashir M. Matata
Ellisiv B. Mathiesen
Hiroaki Matsubara
Hikaru Matsuda
Reiko Matsui
Kanji Matsukawa
Akira Matsumori
Hidehiro Matsuoka
Hiroaki Matsuoka
Rumiko Matsuoka
Masunori Matsuzaki
Christian M. Matter
Ray V. Matthews
Kimmo J. Mattila
Clive N. May
Bongani M. Mayosi
Melanie Maytin
Todor N. Mazgalev
Nathalie M. Mazure
Eileen McCall
William M. McClellan
Seth McClennen
Michael V. McConnell
James McCord
Brian W. McCrindle
Peter A. McCullough
James D. McCully
Mary M. McDermott
Theresa A. McDonagh
Daniel McGee
John C. McGiff
Henry C. McGill
Michael McGoon
Thomas M. McIntyre
William J. McKenna
Timothy A. McKinsey
Tracey L. McLaughlin
Vallerie V. McLaughlin
Julie R. McMullen
John J.V. McMurray
Elizabeth M. McNally
Coleen A. McNamara
Patrick H. McNulty
Tim C. McQuinn
Charles F. McTiernan
Gary E. McVeigh
Roger Mee
Mandeep R. Mehra
Roxana Mehran
Jawahar L. Mehta
Rajendra H. Mehta
Shamir R. Mehta
James B. Meigs
Cynthia J. Meininger
Gerhard W. Meissner
Jan R. Mellembakken
Philippe Menasche
Michael E. Mendelsohn
Carlos F. Mendes de Leon
Armando J. Mendez
Maurizio Menichelli
George A. Mensah
James O. Menzoian
Jean-Jacques Mercadier
Anwar T. Merchant
Yahye Merhi
Ilse L. Mertens
Franz H. Messerli
Ruben Mestril
Luisa Mestroni
Heiko Methe
Philippe Meurin
Martijn Meuwissen
Theo E. Meyer
Evangelos D. Michelakis
Holly R. Middlekauff
Michele Mietus-Snyder
Richard V. Milani
D. Craig Miller
D. Douglas Miller
Leslie W. Miller
Michael Miller
Nancy H. Miller
Todd D. Miller
Virginia M. Miller
Tohru Minamino
Erich Minar
Gary S. Mintz
Israel Mirsky
Yoshio Misawa
Seema Mital
Brett M. Mitchell
Gary F. Mitchell
Jere H. Mitchell
Richard N. Mitchell
R. Scott Mitchell
Arnold Mitnitski
Suneet Mittal
Murray A. Mittleman
Kunio Miyatake
Kohei Miyazono
Emile R. Mohler, III
Nicanor I. Moldovan
Peter Molenaar
Ernesto Molina
David J. Moliterno
Jeffery D. Molkentin
Tom E. Mollnes
Kevin M. Monahan
Laurent Monassier
Gilles Montalescot
Joan Montaner
Nicola Montano
Alan R. Moody
James C. Moon
David F. Moore
Phillip Moore
Martin Morad
Fred Morady
Christine S. Moravec
Henning Morawietz
Kerrie L. Moreau
Pierre Moreau
Pedro R. Moreno
Raul Moreno
Thomas M. Morgan
Peter M. Morganelli
Anthony P. Morise
Ryuichi Morishita
Toshisuke Morita
Nicholas W. Morrell
Joel Morrisett
John A. Morrison
Sean J. Morrison
David A. Morrow
Jason D. Morrow
Richard F. Mortensen
Lori J. Mosca
Ralph S. Mosca
Mauro Moscucci
Jeffrey W. Moses
Arthur J. Moss
Richard L. Moss
Evangeline D. Motley
Karen S. Moulton
Jean-Jacques Mourad
Issam D. Moussa
Gilbert H. Mudge
Christian Mueller
Thomas Muenzel
Alessandro Mugelli
Andreas Mugge
Joseph B. Muhlestein
Debabrata Mukherjee
Rupak Mukherjee
Barbara J.M. Mulder
James E. Muller
Jochen Muller-Ehmsen
Janet M. Mullington
Michael J. Mulvany
Neal I. Muni
Jorg Muntwyler
Joanne Murabito
David Murdoch
Toyoaki Murohara
Elizabeth Murphy
Philip M. Murphy
Timothy P. Murphy
Charles E. Murry
Timothy I. Musch
Rene J. Musters
Steven E. Mutsaers
Bulent Mutus
Robert J. Myerburg
Daniel D. Myers
Jonathan Myers
Elizabeth G. Nabel
Christoph K. Naber
Bernardo Nadal-Ginard
Zurab G. Nadareishvili
Koonlawee Nademanee
Abraham Nader
Vinay Nadkarni
Ryozo Nagai
Hideaki Nagase
Noritoshi Nagaya
Eike Nagel
Sherif F. Nagueh
Hiroshi Nakagawa
Hajime Nakamura
Takeshi Nakano
Kanji Nakatsu
Gilles Nalbone
Brahmajee K. Nallamothu
Byung-Ho Nam
Navin C. Nanda
Manasi Nandi
Raffaele Napoli
Girish Narayan
Sanjiv M. Narayan
Craig R. Narins
Krzysztof Narkiewicz
Jagat Narula
Andrea Natale
Rama Natarajan
Viswanathan Natarajan
Hendrik Nathoe
Stanley Nattel
Matthew T. Naughton
Mohamad Navab
Frank Naya
Krassen Nedeltchev
Ilka Nemere
Dario Neri
Shawna D. Nesbitt
Aleksandar N. Neskovic
Paul J. Nestel
Stefan Neubauer
Ellis J. Neufeld
Gishel New
Andrew C. Newby
David E. Newby
L. Kristin Newby
Anne B. Newman
John H. Newman
Gary E. Newton
Christopher H. Newton-Cheh
Ludwig Neyses
Graham Nichol
Stephen J. Nicholls
Wilmer W. Nichols
Andrew C. Nicholson
Georg Nickenig
Martin J. Nicklin
Pascal H. Nicod
Christoph A. Nienaber
Michael R. Nihill
Seppo T. Nikkari
Dimitar Nikolov
Richard M. Niles
Rick A. Nishimura
Mari K. Nishizaka
Steven E. Nissen
Tianhua Niu
Koichi Node
Constance T. Noguchi
Eisei Noiri
Georg Noll
Borge G. Nordestgaard
Mikael Norman
Kari E. North
Gavin R. Norton
Michel Noutsias
Gian M. Novaro
Ulrike Nowak-Gottl
Evgeny Nudler
William C. Nugent
Carole Ober
Martin Oberhoff
Edward R. O’Brien
Christopher J. Occleshaw
Ira S. Ockene
Christopher M. O’Connor
Gerald T. O’Connor
Christopher J. O’Donnell
Erwin N. Oechslin
Patrick T. O’Gara
Hisao Ogawa
Yoshihiro Ogawa
Toshio Ogihara
Jae K. Oh
Ann M. O’Hare
Takayoshi Ohkubo
Tomoko Ohkusa
Erik M. Ohman
Veronica Ojetti
Akinlolu O. Ojo
Peter M. Okin
Katashi Okoshi
Jeffrey E. Olgin
Jobien K. Olijhoek
Jeffrey W. Olin
Brian Olshansky
Timothy M. Olson
Patrick G. O’Malley
Reed A. Omary
Jeffrey H. Omens
Torbjorn Omland
Steve R. Ommen
Altan Onat
Marie S. O’Neill
William W. O’Neill
Takayuki Ono
Koji Onoda
Henry Ooi
Suzanne Oparil
Tobias Opthof
Hakan Oral
John F. Oram
E. John Orav
Trevor J. Orchard
Jose M. Ordovas
Donald Orlic
John A. Ormiston
Joseph P. Ornato
Brian O’Rourke
Michael F. O’Rourke
Robert A. O’Rourke
Tetsuya Oshima
Clive Osmond
Jan Ostergren
David Ott
Fillipo Ottani
Catherine M. Otto
Feifan Ouyang
Michel Ovize
Mehmet C. Oz
Susan E. Ozanne
Pal Pacher
Chris J. Packard
Douglas L. Packer
Francis D. Pagani
Massimo Pagani
Patrick J. Pagano
Pierre Page
e21
Richard L. Page
Ramdas G. Pai
Rosario Palacios
Wulf Palinski
Julio C. Palmaz
Lyle J. Palmer
Sebastian Palmeri
Hui-Lin Pan
Demosthenes Panagiotakos
Natesa G. Pandian
James S. Pankow
Julio A. Panza
Nicholas F. Paoni
Carlo Pappone
Gilles Paradis
Patrick Parfrey
Michael Parides
Stephen Paridon
Paolo Parini
Jeong-Euy Park
Seung-Jung Park
Donna Parker
John D. Parker
Ira A. Parness
Juan C. Parodi
Alessandro Parolari
Steve W. Parry
Vincenzo Pasceri
Ares D. Pasipoularides
Gerard Pasterkamp
Ayan Patel
Lisa Patel
Rakesh P. Patel
Vickas V. Patel
David J. Paterson
Paola Patrignani
Carlo Patrono
Richard D. Patten
Cam Patterson
Peter M. Pattynama
Walter J. Paulus
Jeffrey M. Pearl
Justin D. Pearlman
Mary A. Peberdy
Ole D. Pedersen
Susanne S. Pedersen
Patrick Peeters
Antonio Pelliccia
Patricia A. Pellikka
Theo Pelzer
Michael Pencina
Marc S. Penn
Dudley J. Pennell
William Penny
Carl J. Pepine
Mark B. Pepys
Mark A. Pereira
Francisco Perez-Vizcaino
Emerson C. Perin
Harris Perlman
Joseph K. Perloff
e22
Eduardo R. Perna
Thomas V. Perneger
Francesco Perticone
Arkadii M. Pertsov
Inga Peter
Annette Peters
Nicholas S. Peters
Eric D. Peterson
Kirk L. Peterson
J.Thomas Peterson
Eva Petkova
Patricia A. Peyser
Marc A. Pfeffer
Ivan Philip
George J. Philippides
Bradley G. Phillips
Christopher O. Phillips
Richard P. Phipps
Francesco Piarulli
Philippe Pibarot
Eugenio Picano
Michael H. Picard
J. Geoffrey Pickering
Galen M. Pieper
Luc A. Pierard
Grant N. Pierce
Burkert Pieske
Bill A. Pietra
Gabriele Piffaretti
Frank A. Pigula
Nico H.J. Pijls
Louise Pilote
Ileana Pina
Theodore Pincus
David J. Pinsky
Duane S. Pinto
Yigal M. Pinto
Tobias Pischon
Federico Piscione
Cristina Pislaru
Bertram Pitt
Maria V. Pitzalis
Manel Pladevall
Jonathan F. Plehn
Johannes Pleiner
Jorge Plutzky
A. Graham Pockley
Stuart J. Pocock
Bruno K. Podesser
Philip J. Podrid
Paul Poirier
Roberto Pola
Don Poldermans
Victoria Polyakova
Philip A. Poole-Wilson
Clive A. Pope
Jeffrey J. Popma
Richard L. Popp
J. David Port
Francesco Portaluppi
Thomas R. Porter
Wendy S. Post
Robert S. Poston
Tina S. Poulsen
Neil Poulter
Janet T. Powell
Andrew J. Powell
William S. Powell
Scott K. Powers
Henry J. Pownall
Abhiram Prasad
Francesco Prati
Domenico Pratico
Josef Prchal
Stephen M. Prescott
Russell L. Prewitt
Beth F. Printz
Frits W. Prinzen
Silvia G. Priori
Kirkwood A. Pritchard
Linda L. Pritchard
Eric N. Prystowsky
Bruce M. Psaty
William Pu
Vladimir Pucovsky
John D. Puskas
Pirkko J. Pussinen
Reed Pyeritz
Kalevi Pyorala
Stuart F. Quan
Thomas Quaschning
Thomas Quertermous
Miguel A. Quiñones
Ton J. Rabelink
Marlene Rabinovitch
Miriam T. Rademaker
Daniel J. Rader
Marek W. Radomski
Shahin Rafii
Paolo Raggi
Shahbudin H. Rahimtoola
Elaine W. Raines
Olli T. Raitakari
Satish R. Raj
Sanjay Rajagopalan
Nalini M. Rajamannan
Sumathi Ramachandran
Kenneth S. Ramos
J. Scott Rankin
Dabeeru C. Rao
L.Vijay Rao
Elliot Rapaport
Tienush Rassaf
Saif S. Rathore
Peter B. Raven
Ursula Ravens
Katya Ravid
Chester A. Ray
Reza S. Razavi
Fabio A. Recchia
Rita F. Redberg
Alluru S. Reddi
K. Srinath Reddy
Vivek Y. Reddy
Margaret M. Redfield
Andrew N. Redington
Judith G. Regensteiner
Enrique Regidor
Jalees Rehman
Johan Reiber
Nathaniel Reichek
Muredach Reilly
Sharon C. Reimold
Steven E. Reis
Peter J. Reiser
Michael J. Reiter
P.H. Reitsma
Jian-Fang Ren
Jun Ren
Helaine E. Resnick
Ariel J. Reyes
Dwight Reynolds
Matthew R. Reynolds
Shereif H. Rezkalla
Jonathan Rhodes
Flavio Ribichini
Paul M. Ribisl
Romeo Ricci
Peter A. Rice
Lawrence Rice
Michael W. Rich
Vincent Richard
A. Mark Richards
Paul M. Ridker
Barbara Riegel
Walter F. Riesen
Nader Rifai
Giorgio Rigatelli
Eric B. Rimm
Gilles Rioufol
Rebecca H. Ritchie
James M. Ritter
Eberhard Ritz
Alain Rivard
Jeffrey Robbins
Robert C. Robbins
Robert Roberts
David Robertson
Sander J. Robins
Richard B. Robinson
Simon C. Robson
Albert P. Rocchini
Luc Rochette
Howard E. Rockett
Howard A. Rockman
Dan M. Roden
David Rodman
Beatriz L. Rodriguez
Leonardo Rodriguez
Fernando Rodriguez-Artalejo
Alicia Rodriguez-Pla
Marco Roffi
Veronique L. Roger
Campbell Rogers
Ariel Roguin
John Rogus
Mary J. Roman
Mats Rönnback
Dieter Ropers
Emilio Ros
Wayne D. Rosamond
Jonathan Rosand
Noel R. Rose
Michael R. Rosen
David S. Rosenbaum
Frits R. Rosendaal
Clive Rosendorff
Michael E. Rosenfeld
Bruce R. Rosengard
Todd K. Rosengart
David N. Rosenthal
Anthony Rosenzweig
Bernard Rosner
Allan M. Ross
John Ross
Robert Ross
Andrea Rossi
Gian Paolo D. Rossi
Ranieri Rossi
Thomas Rostock
Michael Roth
Richard B. Rothman
Steven A. Rothman
Peter M. Rothwell
Philippe Rouet
Jean-Lucien Rouleau
Anna V. Roux
Anne H. Rowley
Alan Rozanski
Hong Ruan
Melvyn Rubenfire
Frederick L. Ruberg
Lewis J. Rubin
Terrence D. Ruddy
Lawrence L. Rudel
Neil B. Ruderman
Yoram Rudy
Marc Ruel
Wolfram Ruf
Zaverio M. Ruggeri
Jean-Bernard Ruidavets
Luis M. Ruilope
John A. Rumberger
John S. Rumsfeld
Marschall S. Runge
Heinz Rupp
Frank Ruschitzka
James W.E. Rush
Jeremy N. Ruskin
Kerry S. Russell
Mary E. Russell
Raymond R. Russell
Wolfgang Rutsch
Martin K. Rutter
Peter N. Ruygrok
Thomas J. Ryan
Jack Rychik
Lars Ryden
Tobias Saam
Manel Sabate
Marc S. Sabatine
Roger A. Sabbadini
Hani N. Sabbah
Joseph F. Sabik
Luigi Sacca
Ralph L. Sacco
Michael N. Sack
Jonathan D. Sackner-Bernstein
Frank M. Sacks
H. Mehrdad Sadeghi
Junichi Sadoshima
Michel E. Safar
Jeffrey E. Saffitz
Kiran B. Sagar
David J. Sahn
Yoshifumi Saijo
Yoshihiko Saito
Tomohiro Sakamoto
Ichiro Sakuma
Tomas A. Salerno
Veikko Salomaa
Koen J. Salu
Carlo Salvarani
Flora Sam
Habib Samady
Afshin Samali
Nilesh J. Samani
Gianmario Sambuceti
Jonathan M. Samet
Willis K. Samson
Prashanthan Sanders
John E. Sanderson
David C. Sane
Anthony J. Sanfilippo
L. Fernando Santana
Massimo Santini
Marisa Santos
Maria-Jesus Sanz
John L. Sapp
Maurice E. Sarano
Ian J. Sarembock
Mark J. Sarnak
Masataka Sata
Toshiaki Sato
Naveed Sattar
J. Philip Saul
Elijah Saunders
Kurt W. Saupe
Bernhard Sauter
Motoji Sawabe
Tatsuya Sawamura
Leslie A. Saxon
James W. Sayre
Angelo M. Scanu
Saul Schaefer
Juergen R. Schaefer
Klaus P. Schafers
Hartzell V. Schaff
Martin J. Schalij
Jutta Schaper
Wolfgang Schaper
Christoph Scharf
Gina Schatteman
Robert G. Schaub
Andre J. Scheen
James M. Scheiman
Dierk Scheinert
Melvin M. Scheinman
Heinrich R. Schelbert
Benjamin J. Scherlag
Ralph T. Schermuly
Urs Scherrer
Marielle Scherrer-Crosbie
Deborah A. Scheuer
James Scheuer
Ernesto L. Schiffrin
Nelson B. Schiller
Mark D. Schluchter
Klaus-Dieter Schluter
Alvin Schmaier
John F. Schmedtje
Chris Schmid
Holger Schmid
Ann-Marie Schmidt
Carsten B. Schmidt-Weber
Gerd Schmitz
David J. Schneider
Michael D. Schneider
Andreas Schober
Gabriele Schoedon
Albert Schoemig
Frederick J. Schoen
David A. Schoenfeld
Paul Schoenhagen
Peter M. Scholz
Uwe Schonbeck
Ronald Schondorf
Wilhelm Schoner
Rolf Schroeder
Stephen Schroeder
Valarie Schroeder
Karsten Schrör
Joerg B. Schulz
Rainer Schulz
Richard Schulz
P. Christian Schulze
Paul T. Schumacker
Holger J. Schunemann
Markus Schwaiger
Lee H. Schwamm
Gregory G. Schwartz
Ketty Schwartz
Peter J. Schwartz
Stephen M. Schwartz
David S. Schwartzman
Miki L. Schwartzman
Robert A. Schweikert
Robert H.G. Schwinger
Juerg Schwitter
Alan Scott
Russell S. Scott
Miran Sebestjen
Udo Sechtem
Artyom Sedrakyan
Ellen W. Seely
Harry Segall
Pravin B. Sehgal
Christine E. Seidman
Jonathan G. Seidman
Christian Seiler
Frank W. Sellke
Joseph B. Selvanayagam
Luyi Sen
Laureen Sena
Shoichi Senda
Roxy Senior
Thomas D. Sequist
Susan M. Sereika
Patrick W. Serruys
William C. Sessa
Howard D. Sesso
Peter S. Sever
Robert E. Shaddy
Ajay M. Shah
Dipen C. Shah
Pravin M. Shah
Prediman K. Shah
Robin Shandas
Richard P. Shannon
Oz M. Shapira
Arya M. Sharma
Frank R. Sharp
Norman Sharpe
A. Richey Sharrett
Michael J. Shattock
Philip W. Shaul
Leslee J. Shaw
Amanda M. Shearman
Michael Shechter
Imad Sheiban
James Shepherd
Warren Sherman
Mark V. Sherrid
Sanjay Shete
Weibin Shi
Rei Shibata
Mei-Chiung Shih
Kazuyuki Shimada
Wataru Shimizu
Hiroaki Shimokawa
Ken Shinmura
Satoshi Shintani
Ichiro Shiojima
Kalyanam Shivkumar
Michael G. Shlipak
Ralph V. Shohet
e23
Allan A. Shor
Angela C. Shore
Linda Shore-Lesserson
Ashfaq Shuaib
Robert J. Siegel
Hans-Hinrich Sievers
Ulrich Sigwart
Michael J. Silka
Marc A. Silver
Donald S. Silverberg
David I. Silverman
Gregg J. Silverman
Norman H. Silverman
Jean-Sebastien Silvestre
Robert D. Simari
R. John Simes
Paolo Simioni
Daniel I. Simon
Scott I. Simon
Orlando P. Simonetti
Leon A. Simons
Michael Simons
Maarten L. Simoons
Paul C. Simpson
John E. Sims
Alan R. Sinaiko
Jürgen R. Sindermann
Pawan K. Singal
Krishna Singh
Sanjay Singh
Lawrence I. Sinoway
Albert J. Sinusas
Karin Sipido
David S. Siscovick
Samuel C. Siu
Deborah A. Siwik
Carsten Skurk
Cornelis J. Slager
Mara Slawsky
Peter Sleight
Marvin J. Slepian
Karen Sliwa
Gregory Sloop
Joost P.G. Sluijter
Richard W. Smalling
Eric J. Smart
Otto A. Smiseth
Alberto Smith
Felicity B. Smith
George D. Smith
Gordon C.S. Smith
Jonathan Smith
Nicholas L. Smith
Scott A. Smith
Sidney C. Smith
Steven R. Smith
Ulf Smith
Warren M. Smith
William M. Smith
Pieter C. Smits
Allan D. Sniderman
e24
Marieke B. Snijder
Burton E. Sobel
Kenji Sobue
Stefan Soderberg
Kyoko Soejima
Constantinos T. Sofocleous
Raija Soininen
Minna Soinio
John Solaro
Steven J. Sollott
Scott D. Solomon
Prem Soman
John Somberg
Virend K. Somers
Paul D. Sorlie
Farzaneh Aghdassi Sorond
J. Eduardo Sousa
P.C. Souverein
James R. Sowers
Madison S. Spach
Rainer Spanbroek
Carl P. Sparrow
Christian M. Spaulding
J. David Spence
William H. Spencer
John A. Spertus
Philip Spevak
Lukas E. Spieker
Francis G. Spinale
David H. Spodick
David Spragg
Joachim Spranger
Deepak Srivastava
Martin G. St. John Sutton
Eugenio Stabile
Austin Stack
Jan A. Staessen
Diana M. Stafforini
Gregory L. Stahl
Anton F.H. Stalenhoef
Bruce S. Stambler
Jonathan S. Stamler
Meir J. Stampfer
Kenneth Stanley
William C. Stanley
Alice V. Stanton
Randall C. Starling
Brian L. Stauffer
Charles Steenbergen
Philippe G. Steg
Coen D. Stehouwer
Evan A. Stein
Kenneth M. Stein
Paul D. Stein
Francene M. Steinberg
Helmut O. Steinberg
Susan F. Steinberg
Julia Steinberger
Gustav Steinhoff
Robin H. Steinhorn
Steve R. Steinhubl
Christoph Stellbrink
Kurt R. Stenmark
David W. Stepp
Andrew Steptoe
David M. Stern
Naftali Stern
Lynne Warner Stevenson
Duncan J. Stewart
Kerry J. Stewart
Jim Stewart
Julian M. Stewart
Ralph A. H. Stewart
Roland Stocker
Jean-Claude Stoclet
Katarzyna Stolarz
Claudia Stollberger
Gregg W. Stone
Neil J. Stone
Peter H. Stone
George A. Stouffer
Vibeke Strand
Timo E. Strandberg
John R. Stratton
Bodo E. Strauer
Arnold Strauss
William B. Strawn
S. Adam Strickberger
Jack P. Strong
Allan D. Struthers
Matthias Stuber
Jorg Stypmann
Ding-Feng Su
Isabella Sudano
Peter H. Sugden
Galina K Sukhova
Yao Sun
Zhonghua Sun
Thoralf M. Sundt, III
Ruey J. Sung
H. Robert Superko
Howard K. Surks
Mark A. Sussman
Thomas M. Suter
Fraser W.H. Sutherland
George R. Sutherland
John L. Sutko
Richard Sutton
Kim Sutton-Tyrrell
Hiroshi Suzuki
Ken Suzuki
Alan F. Sved
Lars G. Svensson
Madhav Swaminathan
Lorna Swan
Karl Swedberg
G. Sweeney
Michael O. Sweeney
Charles D. Swerdlow
Bernard Swynghedauw
Christer Sylven
Zoltán Szabó
Istvan Szokodi
Roman F. Sztajzel
Ira A. Tabas
Stefano Taddei
Heinrich Taegtmeyer
Peter Taggart
Kazuhiro Takahashi
Masato M. Takahashi
Bonpei Takase
Hiroshi Takayama
Yoshiyu Takeda
Satoshi Takeo
Akira Takeshita
Renato Talamini
William T. Talman
Rasa Tamosiuniene
Chee Eng Tan
Walter A. Tan
Toshihiro Tanaka
Weihong Tang
W.H. Wilson Tang
Yao Liang Tang
Rajendra K. Tangirala
Ataru Taniguchi
Laszlo B. Tanko
Felix C. Tanner
Jean-Claude Tardif
Robert B. Tate
Hideki Tatewaki
Allen J. Taylor
Andrew M. Taylor
Anne L. Taylor
Joan M. Taylor
W. Robert Taylor
James E. Tcheng
Guillermo J. Tearney
Alain Tedgui
Usha Tedrow
Paul S. Teirstein
David F. Teitel
George Tellides
Marije ten Wolde
Koon K. Teo
Oren M. Tepper
Gail R. ter Haar
Hiroki Teragawa
Enrique Teran
Dellara F. Terry
Daniel Teupser
David Thaler
Pierre Theroux
Aravinda Thiagalingam
Perumal Thiagarajan
Chris Thiemermann
Gaetano Thiene
Victor L.J.L. Thijssen
Anita C. Thomas
James D. Thomas
MaryLou Thompson
Paul D. Thompson
Kent Thornburg
Rong Tian
Uwe J.F. Tietge
Laurence Tiret
Marc D. Tischler
Susan Tiukinoy
Jonathan M. Tobis
Geoffrey H. Tofler
Stevan P. Tofovic
Naoki Tokita
Eran Toledo
Douglas M. Tollefsen
Robert J. Tomanek
Gordon F. Tomaselli
Marcello Tonelli
Peter Tontonoz
Eric Topol
Jan H.M. Tordoir
Per Tornvall
Olga H. Toro-Salazar
Christian Torp-Pedersen
Guillermo Torre-Amione
Jan Torzewski
Tor D. Tosteson
Peter P. Toth
Florence Toti
Arturo G. Touchard
Rhian M. Touyz
Jeffrey A. Towbin
Dwight A. Towler
Jonathan N. Townend
Paul A. Townsend
Maurizio Trevisan
Richard W. Troughton
Nathan A. Trueblood
Shen K. Tsai
Min-Fu Tsan
Teresa S.M. Tsang
Philip S. Tsao
Hung-Fat Tse
Etsuko Tsuda
Gozoh Tsujimoto
Katsuhiko Tsujioka
Hiroyuki Tsukui
Jack V. Tu
Michael L. Tuck
Rubin M. Tuder
Paul A. Tunick
Zoltan G. Turi
Craig D. Turnbull
Stephen T. Turner
Alexander G.G. Turpie
Katherine R. Tuttle
E. Murat Tuzcu
Marcel Twickler
Suresh C. Tyagi
Toshimitsu Uede
Per M. Ueland
Renan Uflacker
Cuno S.P.M. Uiterwaal
Gudrun Ulrich-Merzenich
Shin-Ichiro Umemura
Paul M. Underwood
Roger H. Unger
Thomas Unger
Zoltan Ungvari
Joseph L. Unthank
Gilbert R. Upchurch
Zsolt Urbán
Fumitaka Ushikubi
Viola Vaccarino
Marco Valgimigli
Patrick J.T. Vallance
Jesus G. Vallejo
Eric Van Belle
Gerald van Belle
Marc van Bilsen
Luc M. Van Bortel
Frans J. Van de Werf
Johanna G. van der Bom
Willem J. van der Giessen
Bernd van der Loo
Freek J. van der Meer
Irene M. van der Meer
Yvonne T. van der Schouw
Jolanda van der Velden
Ger J. van der Vusse
Miranda Van Eck
George F. Van Hare
C. Heleen van Ommen
Niels van Royen
Dirk J. van Veldhuisen
David R. Van Wagoner
Anne M. VanBuskirk
Mani A. Vannan
Nerea Varo
Sudesh Vasdev
Giuseppe Vassalli
Theodoros Vassilakopoulos
Guy Vassort
Stephen F. Vatner
Matteo Vatta
Douglas E. Vaughan
William K. Vaughn
Mark A. Veazie
James L. Velianou
Richard C. Venema
Paolo Verdecchia
Pieter D. Verdouw
Stefan Verheye
Petra Verhoef
Jean Philippe Verhoye
Subodh Verma
Richard L. Verrier
Francesco Versaci
Giorgio A. Vescovo
George W. Vetrovec
Aristidis Veves
G. Wesley Vick
Neill Videlefsky
Flordeliza S. Villanueva
Francisco Villarreal
D. Geoffrey Vince
Renaud Vincent
Jakob Vinten-Johansen
Francesco Violi
Maria L. Virella
Renu Virmani
Sami Viskin
Eric Vittinghoff
Barbara Voetsch
Michael Vogel
Robert A. Vogel
Paul G.A. Volders
Stefano Volpato
Klaus von Bergmann
Jan H. von der Thüsen
Arnold von Eckardstein
Robert Voswinckel
Atsuyuki Wada
Carol Wadham
Bernard Waeber
Lynne Wagenknecht
Andreas H. Wagner
Denisa D. Wagner
Galen S. Wagner
Louis K. Wagner
Peter D. Wagner
Shawn Wagner
Ron Waksman
Albert L. Waldo
Brian R. Walker
Lars Wallentin
B. Gunnar Wallin
John Wallwork
Edward P. Walsh
Peter N. Walsh
Dirk H. Walter
Thomas Walther
Bingcheng Wang
Donna H.Wang
Thomas J. Wang
Wei Wang
Xiaohong Wang
Yibin Wang
Zhiguo Wang
Carole A. Warnes
Karl Wasserman
David D. Waters
Hugh Watkins
Steve P. Watson
Wendy A. Wattigney
Gerald F. Watts
Sergio Waxman
W. Douglas Weaver
Catherine Webb
David J. Webb
Gary Webb
Steven A. Webber
Christian Weber
Karl T. Weber
Michael A. Weber
Nina C. Weber
Keith A. Webster
Mark W.I. Webster
William Weglicki
Chiming Wei
Li Wei
Max H. Weil
Hartmut Weiler
Janice Weinberg
Tanja Weinbrenner
Andrew R. Weintraub
William S. Weintraub
Michael Weis
Richard D. Weisel
Mary C. Weiser-Evans
Myron L. Weisfeldt
Daiana Weiss
Guenter Weiss
James N. Weiss
Robert G. Weiss
Neil J. Weissman
Jeffrey I. Weitz
Babette B. Weksler
Hein J. Wellens
Ian J. Welsby
Frederick G. Welt
Francine K. Welty
Stephen E. Welty
Nanette K. Wenger
Bruce M. Wentworth
Jolanda J. Wentzel
Rene R. Wenzel
Volker Wenzel
Gerald S. Werner
Rainer Wessely
Malcolm West
Rudi G. Westendorp
Justin Westhuyzen
Charles V. Wetli
Glenn T. Wetzel
Lewis Wexler
Cornelia M. Weyand
Arthur E. Weyman
Andrew S. Weyrich
Christopher J. White
C. Roger White
Halina White
Richard H. White
William B. White
Patrick L. Whitlow
J. Lindsay Whitton
Mark H. Wholey
Lawrence Wickerham
Samuel A. Wickline
Petr Widimsky
Susan E. Wiegers
Wouter Wieling
FrankWiesmann
William Wijns
David J. Wilber
Arthur A.M. Wilde
Rachel P. Wildman
Markus J. Wilhelm
e25
Heinrike Wilkens
Ian B. Wilkinson
Bruce L. Wilkoff
Walter C. Willett
David O. Williams
Kevin J. Williams
Mark A. Williams
Paul T. Williams
Roberta G. Williams
R. Sanders Williams
Allison E. Willing
Scott R. Willoughby
Emily Wilson
Peter W. Wilson
Gayle L. Winters
Andrew L. Wit
Hanspeter Witschi
Maarten Witsenburg
Jacqueline C.M. Witteman
Rochus Witthaut
Fred H.M. Wittkampf
Joseph L.Witztum
Stephen D. Wiviott
J. Frederick Woessner
Wojciech Wojakowski
Philip A. Wolf
Michael S. Wolin
Robert Wolk
Kai C. Wollert
Ernst Wolner
Cheuk-kit Wong
LennieWong
Nathan D. Wong
John C. Wood
Mark A. Wood
Hermann Wrigge
Jackson T. Wright, Jr.
R. Scott Wright
Ed X. Wu
Gordon D. Wu
Joseph C. Wu
Kenneth K. Wu
D. George Wyse
Guohua Xi
Lei Xiao
Rui-Ping Xiao
Chengjie Xiong
Magdi H. Yacoub
Jay S. Yadav
Yoshiji Yamada
Kazuhiro Yamamoto
Yoshiharu Yamamoto
Atsushi Yamashita
Gan-Xin Yan
Xinhua Yan
Clyde W. Yancy
Qiong Yang
Xiao-Ping Yang
Zhihong Yang
Hirofumi Yasue
Frank Yatsu
e26
Richard Ye
Jerry Yee
Edward T.H. Yeh
Mao-Hsiung Yen
Midori A. Yenari
Shaw-Fang Yet
Alan C. Yeung
Seppo Yla-Herttuala
Agneta Yngve
Paul G. Yock
Junji Yodoi
Young-sup Yoon
Chaim Yosefy
Hiroshi Yoshida
Masayuki Yoshida
Noriko Yoshida
Pierre Y. Youinou
James B. Young
Lawrence H. Young
Martin E. Young
Pampee P. Young
Chun Yuan
Sun Yuhua
Salim Yusuf
Susanne Zadelaar
Kenneth G. Zahka
Osama O. Zaidat
Alberto Zanchetti
Faiez Zannad
Wojciech Zareba
Barry L. Zaret
Alan M. Zaslavsky
Marc Zee
Robert Y. Zee
Kenton J. Zehr
Andreas M. Zeiher
Darryl C. Zeldin
Andrey G. Zenovich
Uwe Zeymer
Cuihua Zhang
Yingyi Zhang
Guixiang Zhao
Zhi-Jie Zheng
Guangming Zhong
Robert Zhong
Jianhui Zhu
Xinsheng Zhu
Brenda K. Zierler
Felix Zijlstra
Michael R. Zile
Peter J. Zimetbaum
Marc Zimmermann
Jean-Marc Zingg
Douglas P. Zipes
Carmine Zoccali
William A. Zoghbi
Ai-Ping Zou
Ming Zou
Irving H. Zucker
Bram D. Zuckerman
Mahmoud Zureik
Jay L. Zweier
Dimitri E. Zylberstein
Cushman et al
TABLE 1.
CRP and Coronary Disease in the Elderly
27
Distribution of Cardiovascular Risk Factors by Baseline CRP Concentration
CRP, mg/L
⬍1
(n⫽1144)
1–3
(n⫽1783)
⬎3–10
(n⫽811)
⬎10
(n⫽233)
P for
Trend
Continuous variables
Age, y
72.9
72.4
72.4
72.6
0.16
Body mass index, kg/m2
24.7
26.8
28.6
29.0
⬍0.001
⬍0.001
Waist, cm
89.5
94.7
99.1
100.2
LDL cholesterol, mmol/L (mg/dL)
3.29 (127)
3.47 (134)
3.44 (133)
3.23 (125)
0.21
HDL cholesterol, mmol/L (mg/dL)
1.50 (58)
1.40 (54)
1.35 (52)
1.32 (51)
⬍0.001
Total cholesterol, mmol/L (mg/dL)
5.41 (209)
5.57 (215)
5.54 (214)
5.18 (200)
0.67
Pack-years (among ever smokers)
29.0
32.6
36.8
36.7
⬍0.001
Categorical variables, %
Male sex
43.4
42.5
37.0
41.2
0.02
Black race
10.9
13.5
20.0
29.2
⬍0.001
Hypertension
46.7
56.5
64.6
66.5
⬍0.001
11.2
14.0
16.9
19.4
8.2
13.7
21.8
25.0
Diabetes
IFG
Diabetes
⬍0.001
Smoking status
Former
40.9
38.8
40.8
41.2
Current
8.5
11.9
16.6
20.2
⬍0.001
Regular aspirin use
19.2
19.1
22.5
20.2
0.17
Any subclinical cardiovascular disease
55.8
63.3
67.8
69.1
⬍0.001
6.7
9.3
14.4
13.2
⬍0.001
Carotid intima-media thickness ⬎80th percentile
23.1
30.3
35.1
36.1
⬍0.001
Major ECG abnormality
19.7
23.9
25.0
25.6
0.004
Carotid stenosis ⬎25%
⬍0.001
Ankle-arm index ⬍0.9
39.4
43.8
47.7
50.4
Rose angina positive
3.1
2.4
2.6
4.3
0.78
Rose claudication positive
0.6
1.0
1.7
2.6
0.002
IFG indicates impaired fasting glucose. Values for continuous variables are means.
increased risk for CRP ⬎3 mg/L. There was no effect of
additional adjustment for baseline statin use. Further adjustment for subclinical disease yielded little attenuation; a 37%
increased risk of CHD for elevated CRP remained. When
CRP was considered a continuous variable, with adjustment
for risk factors, the relative risk associated with a 1-ln-unithigher baseline CRP was 1.27 (95% CI, 1.12 to 1.44). There
were no significant differences in associations by sex or race.
The population-attributable risk percentage for elevated CRP
was 11%.
Table 3 shows the relative risks of incident CHD for CRP
⬎3 mg/L compared with CRP ⬍1 mg/L in subgroups based
on the presence or absence of cardiovascular risk factors.
Baseline CRP was associated with CHD in all of these
groups, including those without subclinical disease and those
at low risk by the Framingham Risk Score (P for interaction
⬎0.05 for all). Although the relative risk did not differ by
subclinical disease status, among men and women, the
presence of elevated CRP together with subclinical disease
was associated with a higher incidence of CHD compared
with those with lower CRP and no subclinical disease
(Figure 3).
Figure 4 shows the 10-year sex-specific incidence of CHD
according to CRP concentration in categories of the Framingham Risk Score. In intermediate- and low-risk women, CRP
⬎3 mg/L added little to risk prediction, whereas in high-risk
women, CRP provided additional risk information. Among
women with a 10-year predicted risk ⬎20%, for intermediate
or elevated CRP, the observed incidences were 28%, and
31%, respectively, compared with only 16% for those with
low CRP. In men, CRP provided additional risk information
in intermediate- and high-Framingham-risk groups. Among
men with a 10-year predicted risk 10% to 20%, those with
CRP ⬎3 mg/L had an observed risk of 32%. Among
high-Framingham-risk men, this observed risk was 41%.
We investigated the utility of CRP ⬎10 mg/L for determining risk of CHD and the impact of hormone replacement
therapy among women. Of participants with elevated CRP,
22% were ⬎10 mg/L. Of these 233 participants, 49 (21%)
developed CHD during follow-up compared with 498 of 3738
(13.3%) with lower CRP. The age-, sex-, and race-adjusted
relative risk of CHD was 2.16 (95% CI, 1.55 to 3.00) for CRP
⬎10 compared with ⬍1 mg/L and 1.78 (95% CI, 1.26 to
2.51) after adjustment for traditional risk factors. Among 326
28
Circulation
July 5, 2005
Figure 2. Incidence rate per 1000 person-years of MI or CHD
death by baseline CRP. Incidence rates were calculated within
small intervals of CRP values and plotted with a scatterplot
smoother. Association was well fit by a quadratic function of
CRP, plotted with 95% confidence bands.
Figure 1. Cumulative rate of MI or CHD death. Top, data for
men; bottom, data for women. Unadjusted hazard ratios and
95% CIs for each group compared with reference group (CRP
⬍1 mg/L) are shown. Solid line indicates CRP ⬍1 mg/L; dotted
line, CRP 1 to 3 mg/L; and dashed line, CRP ⬎3 mg/L.
women excluded from analysis for hormone replacement
therapy use, the age-adjusted relative risk of CHD for CRP
⬎3 mg/L was 1.35 (95% CI, 0.42 to 4.32).
Discussion
In this 10-year prospective study in men and women ⱖ65
years of age, CHD risk increased with increasing CRP. When
TABLE 2.
recent clinical guidelines were applied, intermediate CRP
concentrations (1 to 3 mg/L) were weakly related to future
CHD, and elevated CRP (⬎3.0 mg/L) was associated with a
1.45-fold increased risk of CHD, with adjustment for other
vascular risk factors. There was little further confounding
with adjustment for the presence of noninvasively assessed
subclinical atherosclerosis. Elevated CRP was associated
with CHD in all subgroups defined by conventional cardiac
risk factors or subclinical disease. Among men with intermediate and high Framingham Risk Scores, CRP identified those
with higher-than-predicted risk. Among women, CRP discriminated risk best among those at high Framinghampredicted risk.
The relative risk of CHD for elevated CRP observed here
was smaller than in most studies of middle-aged subjects and
might seem modest at 1.45. However, event rates were high
in this age group, so the attributable risk percent for elevated
CRP was high at 11%, even given a modest relative risk.30
Thus, a much higher percentage of subjects with elevated
CRP subsequently had events in this study compared with
studies of younger subjects.7,8 In a recent report by Danesh et
Association of Baseline CRP With Incident MI or CHD Death Over 10 Years*
Relative Risk (95% CI) in CRP Categories
⬍1.0 mg/L
(N⫽1144, n⫽135)
1.0 –3.0 mg/L
(N⫽1783, n⫽230)
⬎3.0 mg/L
(N⫽1044, n⫽182)
Men
17.1 (74)
20.6 (127)
33.3 (96)
Women
10.4 (61)
11.0 (103)
15.5 (86)
1.0 (ref)
1.18 (0.96–1.46)
1.82 (1.46–2.28)
⬍0.001
P
Incidence rate, %
(n of events)
Model 1
Model 2
1.0 (ref)
1.08 (0.86–1.35)
1.45 (1.14–1.86)
⬍0.004
Model 3
1.0 (ref)
1.04 (0.82–1.31)
1.37 (1.06–1.78)
0.01
N is number at risk in given group; n, number of cases in given group; and ref, reference.
*Model 1 is adjusted for age, race, and sex. Model 2 is adjusted for age, sex, race, field center, hypertension,
diabetes, smoking status, log pack-years, body mass index, waist circumference, total cholesterol, HDL cholesterol,
and regular aspirin use. Model 3 is adjusted for model 2 variables plus ankle-arm index ⬍0.9, internal or common
carotid intima-media thickness ⬎80th percentile, positive responses to the Rose angina or claudication questionnaires, major ECG abnormalities, and maximum stenosis of the carotid artery ⬎25%.
Cushman et al
29
TABLE 3. Relative Risk of CHD for CRP >3 mg/L Compared With <1 mg/L by Categories of Baseline
Risk Factors
Risk Factor Present
Risk Factor
Risk Factor Absent
n/N
RR* (95% CI)
n/N
RR* (95% CI)
Smoking (former⫹current)
307/2076
1.84 (1.37–2.47)
240/1890
1.68 (1.18–2.40)
Pack-years (⬎median; ever smokers only)
171/967
2.13 (1.40–3.25)
120/1000
1.61 (1.02–2.53)
Hypertension
365/2219
1.74 (1.32–2.29)
182/1748
1.55 (1.04–2.32)
Diabetes or impaired fasting glucose
213/1130
1.49 (1.02–2.18)
334/2833
1.74 (1.30–2.32)
Hyperlipidemia
139/966
1.99 (1.25–3.19)
404/2971
1.74 (1.34–2.26)
Regular aspirin use
123/788
1.89 (1.17–3.05)
423/3176
1.79 (1.39–2.31)
Estimated 10-year Framingham Risk Score ⬎20%
181/772
2.00 (1.28–3.13)
357/3127
1.51 (1.15–1.98)
Subclinical disease
417/2477
1.85 (1.42–2.42)
130/1494
1.42 (0.91–2.22)
Carotid wall thickness ⬎80th percentile
250/1167
1.56 (1.11–2.20)
293/2784
1.71 (1.26–2.32)
Ankle-arm index ⬍0.9
95/381
1.45 (0.82–2.59)
443/3514
1.78 (1.39–2.28)
Carotid stenosis ⱖ25%
315/1726
1.68 (1.25–2.25)
230/2223
1.74 (1.22–2.47)
Major ECG abnormality
177/886
1.73 (1.15–2.61)
355/2963
1.81 (1.38–2.38)
n/N indicates number of events/number at risk in all 3 levels of CRP in specified category of each risk factor.
*Adjusted for age, race, and sex.
al,9 a similar adjusted relative risk was observed in a large
population, but in that case-control study, attributable risk
was not estimated. If elevated CRP represents a causal risk
factor as suggested by several experimental studies,31 our
estimate of attributable risk indicates a hypothesis that correction of elevated CRP could eliminate up to 11% of
incident CHD in this age group.
It has been suggested that novel risk factors or atherosclerosis imaging may identify those at intermediate CHD risk
who might benefit from aggressive risk factor interventions.32
Along with findings in middle-aged populations,7,8 our data
provide evidence that CRP assessment can identify older
patients at higher or lower than their predicted risk of
coronary events. Our findings with regard to women at low
and intermediate risk differ from findings in middle-aged
women in which CRP predicted cardiovascular events across
the entire range of Framingham Risk Scores.33 Further work
is needed to validate our findings in this age group and to
determine appropriate values defining elevated CRP in various age and sex groups.
Other studies reported weak or no associations of CRP
with subclinical disease measures.34 –38 Here, in the absence
of clinical disease, CRP was higher among those with any
single type of subclinical disease. Moreover, CHD incidence
was higher among those with elevated CRP and subclinical
disease compared with groups with only 1 or neither of these
risk factors. In this cohort, the 10-year stroke risk associated
with elevated CRP was larger among those with higher
compared with lower carotid intima-media thickness.39 In a
short-term study, the risk of MI was higher among those with
higher coronary artery calcium scores if CRP was also
elevated.40 Taken together, findings from these few studies
suggest possible roles for the assessment of both inflammation and subclinical disease. It is also possible that CRP is a
marker of subclinical disease, and if better measures of
subclinical disease were available, adjustment for subclinical
disease would further lessen the association of CRP with
CHD.
The CDC/AHA guideline for CRP testing suggest that
values ⬎10 mg/L indicate acute inflammation and have
uncertain implications for vascular risk prediction.3 In this
older population, 6% of subjects had CRP ⬎10 mg/L; when
traditional risk factors were accounted for, these subjects had
a 1.8-fold increased risk of CHD, a higher risk estimate than
Figure 3. Incidence rates per 1000
person-years of first MI or CHD death by
baseline CRP, stratified by sex and presence of subclinical atherosclerosis.
30
Circulation
July 5, 2005
measured in the whole cohort, incidence rates of CHD by
baseline CRP were calculated, and subgroup analyses could
be done.
In conclusion, we extend previous reports on the association of CRP with CHD to men and women ⱖ65 years of age.
CRP appears to be useful for risk assessment in this age
group. Because event rates are high overall in older age,
further study is required to determine optimal clinical roles of
CRP measurement, especially as related to interventions for
elevated CRP.
Acknowledgments
This research was supported by contracts N01-HC-85079 through
N01-HC-85086, N01-HC-35129, and N01-HC-15103 and grants
HL-46696, HL-8329, and HL-03618 from the NIH National Heart,
Lung and Blood Institute. A full list of participating CHS investigators and institutions can be found at http://www.chs-nhlbi.org.
References
Figure 4. Ten-year rate of CHD according to baseline CRP and
10-year predicted risk from the Framingham Risk Score. Top,
data for women; bottom, data for men. Observed incidence
based on categories of CRP was determined within each category of Framingham-predicted risk. For each category, numbers
across top represent number of events per number at risk in
that group.
for CRP ⬎3.0 mg/L. Our finding agrees with recently
reported results in middle-aged women.33 Thus, CRP values
⬎10 mg/L appear to be important in CHD risk prediction.
Limitations of this study merit consideration. The cohort,
free-living elderly who were willing to enroll in the study,
may not represent the general older population. The observational study design, even with extensive multivariate analysis,
cannot prove causal relationships. Competing risks may have
diluted associations of CRP with CHD because CRP may be
associated with other disease outcomes. In some cases,
analysis of subgroups was limited by small sample sizes.
Finally, CRP was measured only once at baseline, and it has
been suggested that repeated testing for confirmation be
considered in those with high values.3
Strengths of this study include its large size, extensive
baseline data collection, and long-term event follow-up.
Several new findings were observed on the basis of unique
aspects of the study. First, we confirmed an association of
elevated CRP with CHD incidence in an older age group;
most previous studies included younger subjects or clinical
trial participants. Second, independence of associations from
noninvasively measured subclinical atherosclerosis was documented. Third, more complete adjustment for smoking
status was made by assessing pack-years, a major determinant
of CRP concentration in smokers.34 Fourth, because CRP was
1. Psaty BM, Furberg CD, Kuller LH, Bild DE, Rautaharju PM, Polak JF,
Bovill E, Gottdiener JS. Traditional risk factors and subclinical disease
measures as predictors of first myocardial infarction in older adults: the
Cardiovascular Health Study. Arch Intern Med. 1999;159:1339 –1347.
2. Psaty BM, Anderson M, Kronmal RA, Tracy RP, Orchard T, Fried LF,
Lumley T, Robbins J, Burke G, Newman AB, Furberg CD. The association between lipid levels and the risks of incident myocardial
infarction, stroke, and total mortality: the Cardiovascular Health Study.
Am J Geriatr Soc. 2004;52:1639 –1647.
3. Pearson TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO 3rd,
Criqui M, Fadl YY, Fortmann SP, Hong Y, Myers GL, Rifai N, Smith SC
Jr, Taubert K, Tracy RP, Vinicor F. Markers of inflammation and cardiovascular disease: application to clinical and Public Health practice: a
statement for healthcare professionals from the Centers for Disease
Control and Prevention and the American Heart Association. Circulation.
2003;107:499 –511.
4. Ridker PM, Glynn RJ, Hennekens CH. C-reactive protein adds to the
predictive value of total and HDL cholesterol in determining risk of first
myocardial infarction. Circulation. 1998;97:2007–2011.
5. Ridker PM, Hennekens CH, Buring JE, Rifai N. C-reactive protein and
other markers of inflammation in the prediction of cardiovascular disease
in women. N Engl J Med. 2000;342:836 – 843.
6. Kervinen H, Palosuo T, Manninen V, Tenkanen L, Vaarala O, Manttari
M. Joint effects of C-reactive protein and other risk factors on acute
coronary events. Am Heart J. 2001;141:580 –585.
7. Ridker PM, Rifai N, Rose L, Buring JE, Cook NR. Comparison of
C-reactive protein and low-density lipoprotein cholesterol levels in the
prediction of first cardiovascular events. N Engl J Med. 2002;347:
1557–1565.
8. Koenig W, Lowel H, Baumert J, Meisinger C. C-reactive protein modulates risk prediction based on the Framingham score: implications for
future risk assessment: results from a large cohort study in southern
Germany. Circulation. 2004;109:1349 –1353.
9. Danesh J, Wheeler JG, Hirschfield GM, Eda S, Eiriksdottir G, Rumley A,
10. Tracy RP, Lemaitre RN, Psaty BM, Ives DG, Evans RW, Cushman M,
Meilhan EN, Kuller LH. Relationship of C-reactive protein to risk of
cardiovascular disease in the elderly: results from the Cardiovascular
Health Study and the Rural Health Promotion Project. Arterioscler
Thromb Vasc Biol. 1997;17:1121–1127.
11. Harris TB, Ferruci L, Tracy RP, Corti MC, Wacholder S, Ettinger WH,
Heimovitz H, Cohen HJ, Wallace R. Associations of elevated
interleukin-6 and C-reactive protein levels with mortality in the elderly.
Am J Med. 1999;106:506 –512.
12. Tice JA, Browner W, Tracy RP, Cummings SR. The relation of
C-reactive protein levels to total and cardiovascular mortality in older
U.S. women. Am J Med. 2003;114:199 –205.
13. van der Meer IM, de Maat MP, Kiliaan AJ, van der Kuip DA, Hofman A,
Witteman JC. The value of C-reactive protein in cardiovascular risk
prediction: the Rotterdam Study. Arch Intern Med. 2003;163:1323–1328.
Cushman et al
14. Cesari M, Penninx BW, Newman AB, Kritchevsky SB, Nicklas BJ,
Sutton-Tyrrell K, Rubin SM, Ding J, Simonsick EM, Harris TB, Pahor M.
Inflammatory markers and onset of cardiovascular events: results from
the Health ABC Study. Circulation. 2003;108:2317–2322.
15. Jager A, van Hinsbergh VW, Kostense PJ, Emeis JJ, Yudkin JS, Nijpels
G, Dekker JM, Heine RJ, Bouter LM, Stehouwer CD. von Willebrand
factor, C-reactive protein, and 5-year mortality in diabetic and nondiabetic subjects: the Hoorn Study. Arterioscler Thromb Vasc Biol. 1999;
19:3071–3078.
16. Mendall MA, Strachan DP, Butland BK, Ballam L, Morris J, Sweetnam
PM, Elwood PC. C-reactive protein: relation to total mortality, cardiovascular mortality and cardiovascular risk factors in men. Eur Heart J.
2000;21:1584 –1590.
17. Doggen CJM, Berckmans RJ, Sturk A, Manger Cats V, Rosendaal FR.
C-reactive protein, cardiovascular risk factors and the association with
myocardial infarction in men. J Intern Med. 2000;248:406 – 414.
18. Gram J, Bladbjerg EM, Moller L, Sjol A, Jespersen J. Tissue-type plasminogen activator and C-reactive protein in acute coronary heart disease
a nested case-control study. J Intern Med. 2000;247:205–212.
19. Packard CJ, O’Reilly DS, Caslake MJ, McMahon AD, Ford I, Cooney J,
Macphee CH, Suckling KE, Krishna M, Wilkinson FE, Rumley A, Lowe
GD. Lipoprotein-associated phospholipase A2 as an independent predictor of coronary heart disease: West of Scotland Coronary Prevention
Study Group. N Engl J Med. 2000;343:1148 –1155.
20. Folsom AR, Aleksic N, Catellier D, Juneja HS, Wu KK. C-reactive
protein and incident coronary heart disease in the Atherosclerosis Risk in
Communities (ARIC) study. Am Heart J. 2002;144:233–238.
21. Kuller LH, Shemanski L, Psaty BM, Borhani NO, Gardin J, Haan MN,
O’Leary DH, Savage PJ, Tell GS, Tracy R. Subclinical disease as an
independent risk factor for cardiovascular disease. Circulation. 1995;92:
720 –726.
22. Fried LP, Borhani NO, Enright P, Furberg CD, Gardin JM, Kronmal RA,
Kuller LH, Manolio TA, Mittelmark MB, Newman A, O’Leary DH, Psaty
B, Rautaharju P, Tracy RP, Weiler PG, CHS Research Group. The
Cardiovascular Health Study: design and rationale. Ann Epidemiol. 1991;
1:263–276.
23. Macy EM, Hayes TE, Tracy RP. Variability in the measurement of
C-reactive protein in healthy subjects: implications for reference intervals
and epidemiological applications. Clin Chem. 1997;43:52–58.
24. Rifai N, Tracy RP, Ridker PM. Clinical efficacy of an automated highsensitivity C-reactive protein assay. Clin Chem. 1999;45:2136 –2141.
25. Wilson PW, D’Agostino RB, Levy D, Belanger AM, Silbershatz H,
Kannel WB. Prediction of coronary heart disease using risk factor categories. Circulation. 1998;97:1837–1847.
26. Cushman M, Legault C, Barrett-Connor E, Stefanick ML, Kessler C, Judd
HL, Sakkinen PA, Tracy RP. Effect of postmenopausal hormones on
inflammation-sensitive proteins: the Postmenopausal Estrogen/Progestin
Interventions (PEPI) study. Circulation. 1999;100:717–722.
27. Pradhan AD, Manson JE, Rossouw JE, Siscovick DS, Mouton CP, Rifai
N, Wallace RB, Jackson RD, Pettinger MB, Ridker PM. Inflammatory
biomarkers, hormone replacement therapy, and incident coronary heart
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
31
disease: prospective analysis from the Women’s Health Initiative observational study. JAMA. 2002;288:980 –987.
Price TR, Psaty BM, O’Leary DH, Burke G, Gardin J, for the Cardiovascular Health Study Research Group. Assessment of cerebrovascular
disease in the Cardiovascular Health Study. Ann Epidemiol. 1993;3:
504 –507.
Ives DG, Fitzpatrick AL, Bild DE, Psaty BM, Kuller LH, Crowley PM,
Cruise RG, Theroux S. Surveillance and ascertainment of cardiovascular
events: the Cardiovascular Health Study. Ann Epidemiol. 1995;5:
278 –285.
Psaty BM, Koepsell TD, Manolio TA, Longstreth WT Jr, Wagner EH,
Wahl PW, Kronmal RA. Risk ratios and risk differences in estimating the
effect of risk factors for cardiovascular disease in the elderly. J Clin
Epidemiol. 1990;43:961–970.
Hirschfield GM, Pepys MB. C-reactive protein and cardiovascular
disease: new insights from an old molecule. QJM. 2003;96:793– 807.
Greenland P, Smith SC Jr, Grundy SM. Improving coronary heart disease
risk assessment in asymptomatic people: role of traditional risk factors
and noninvasive cardiovascular tests. Circulation. 2001;104:1863–1867.
Ridker PM, Cook N. Clinical usefulness of very high and very low levels
of C-reactive protein across the full range of Framingham Risk Scores.
Circulation. 2004;109:1955–1959.
Tracy RP, Psaty BM, Macy E, Bovill EG, Cushman M, Cornell ES,
Kuller LH. Lifetime smoking exposure affects the association of
C-reactive protein with cardiovascular disease risk factors and subclinical
disease in healthy elderly subjects. Arterioscler Thromb Vasc Biol. 1997;
17:2167–2176.
Redberg RF, Rifai N, Gee L, Ridker PM. Lack of association of
C-reactive protein and coronary calcium by electron beam computed
tomography in postmenopausal women: implications for coronary artery
disease screening. J Am Coll Cardiol. 2000;36:39 – 43.
Folsom AR, Pankow JS, Tracy RP, Arnett DK, Peacock JM, Hong Y,
Djousse L, Eckfeldt JH. Association of C-reactive protein with markers of
prevalent atherosclerotic disease. Am J Cardiol. 2001;88:112–117.
Blackburn R, Giral P, Bruckert E, Andre JM, Gonbert S, Bernard M,
Chapman MJ, Turpin G. Elevated C-reactive protein constitutes an independent predictor of advanced carotid plaques in dyslipidemic subjects.
Arterioscler Thromb Vasc Biol. 2001;21:1962–1968.
Wang TJ, Nam BH, Wilson PW, Wolf PA, Levy D, Polak JF, D’Agostino
RB, O’Donnell CJ. Association of C-reactive protein with carotid atherosclerosis in men and women: the Framingham Heart Study. Arterioscler Thromb Vasc Biol. 2002;22:1662–1667.
Cao JJ, Thach C, Manolio TA, Psaty BM, Kuller LH, Chaves PH, Polak
JF, Sutton-Tyrrell K, Herrington DM, Price TR, Cushman M. C-reactive
protein, carotid intima-media thickness, and incidence of ischemic stroke
in the elderly: the Cardiovascular Health Study. Circulation. 2003;108:
166 –170.
Park R, Detrano R, Xiang M, Fu P, Ibrahim Y, LaBree L, Azen S.
Combined use of computed tomography coronary calcium scores and
C-reactive protein levels in predicting cardiovascular events in nondiabetic individuals. Circulation. 2002;106:2073–2077.
Epidemiology
Obesity, Insulin Resistance, and the Metabolic Syndrome
Determinants of Endothelial Dysfunction in Whites and Blacks
A.A. Lteif, MD; K. Han, MD; K.J. Mather, MD
Background—Insulin resistance is strongly associated with obesity and other components of the metabolic syndrome
(MS). The relative importance of these components in the determination of endothelial function is unknown.
Furthermore, there is conflicting evidence about whether ethnic differences exist in the relative importance of these
components in regard to other cardiovascular outcomes. We evaluated the contributions of insulin resistance, obesity,
and the other components of the MS to impaired endothelial function.
Methods and Results—The relationships of the MS components (as defined according the National Cholesterol Education
Program) and insulin resistance (estimated using the homeostasis model) with endothelium-dependent vasodilation were
examined in 42 white and 55 black subjects. Endothelium-dependent vasodilation was assessed as the increment in leg
blood flow (measured by thermodilution) after exposure to methacholine chloride. Waist circumference, glucose, blood
pressure, and insulin resistance distributions did not differ between ethnic groups; blacks in our sample had higher HDL
cholesterol (1.31 versus 1.09 mmol/L; P⬍0.001) and lower triglyceride levels (1.01 versus 1.37 mmol/L; P⫽0.005) than
white subjects. In the absence of the MS, black subjects exhibited reduced endothelium-dependent vasodilation
compared with white subjects (P⫽0.005), and both groups demonstrated significantly worse endothelial function when
the MS was present (maximal increase in leg blood flow: blacks: 107⫾9% MS absent, 53⫾16% MS present; whites:
163⫾16% MS absent, 54⫾18% MS absent; P⫽0.007, MS absent versus present; P⫽NS for interaction of ethnicity and
MS). Multivariable regression analysis examining relationships of endothelial function with the 5 MS components
(analyzed as continuous variables) revealed independent relationships only with waist circumference (P⫽0.01) and
systolic blood pressure (P⫽0.02). Waist circumference was no longer independently associated after adding insulin
resistance to the modeling (P⫽0.02 for log of homeostasis model index of insulin resistance, P⫽0.02 for systolic blood
pressure). Ethnicity still exerted an independent effect on endothelial function after accounting for the above
components (P⫽0.04 for an additional effect of ethnic status on endothelial function), with an ethnic difference in the
effect of insulin resistance on endothelial function (P⫽0.046 for interaction of ethnicity and log of homeostasis model
index of insulin resistance).
Conclusions—These findings suggest that insulin resistance and systolic blood pressure are the principal determinants of
endothelial dysfunction in the MS and that there are ethnic differences in the relative importance of these factors. These
differences may imply different benefits from treatments targeting blood pressure or insulin resistance in different ethnic
groups. (Circulation. 2005;112:32-38.)
Key Words: endothelium 䡲 insulin resistance 䡲 metabolic syndrome 䡲 obesity
O
besity and the metabolic syndrome (MS) are associated
with impaired endothelium-dependent vasodilation
(EDV).1,2 Insulin resistance, measured with formal euglycemic hyperinsulinemic clamp protocols, is closely related to
endothelial dysfunction.1,3 Insulin resistance is postulated to
be the common underlying pathogenic link between the
various components of the MS4 and may explain the presence
of the MS even in nonobese subjects.5 These interrelationships suggest that measures of insulin resistance should
perhaps be included with other measures of obesity- and
MS-associated risks for cardiovascular outcomes. Comparatively few data are available on the value of this approach.
Insulin resistance was found to improve the association
between MS and coronary artery calcification.6 In the Women’s Health Initiative, insulin resistance was a key component
of risk factor modeling to explain cardiovascular disease
outcomes.7 The interrelationships of insulin resistance, the
MS, and endothelial function have not been previously
reported.
Relatively little information is available about ethnic differences in the relationship between insulin sensitivity and
cardiovascular outcomes. In the Insulin Resistance Atherosclerosis Study (IRAS), the intrinsic associations of insulin
resistance and other MS components did not differ across
Received November 5, 2004; revision received February 24, 2005; accepted March 4, 2005.
From Indiana University, Indianapolis.
Correspondence to Kieren Mather, 975 W Walnut St, IB424, Indianapolis, IN 46202. E-mail [email protected]
32
Lteif et al
Metabolic Syndrome, Ethnicity, and the Endothelium
ethnicities.8,9 Although associations of subclinical atherosclerosis with insulin resistance and other MS components were
seen in this observational study,10 no ethnic differences have
been reported. In other studies, the prevalence of the MS
among blacks appears to be similar to that in other ethnic
groups.11–13 Despite this finding, endothelial function has
been reported to be impaired in blacks compared with
weight-matched white subjects.14 –16 Therefore, it is unclear
whether the impact of the MS variables on various outcome
parameters, including endothelial function, is uniform across
ethnicity.
In light of these questions, we hypothesized that the
relationship of the MS components with endothelial function
would be dependent on insulin resistance and that this
relationship would be present in both black and white
subjects. We undertook a cross-sectional evaluation of the
relationships of insulin resistance and the components of the
MS with direct in vivo measurements of endothelial function,
specifically evaluating these relationships in black compared
with white subjects.
Methods
Patients/Data Set
Nondiabetic subjects entered into our database of vascular function
measurements from 1999 to 2004 were included in these analyses.
Subjects were community-dwelling volunteers who elected to participate in one of our ongoing protocols involving vascular function
measurements. These studies recruit subjects across the spectrum of
body habitus. We have not routinely studied subjects with frankly
elevated blood pressure or lipid levels; therefore, such subjects are
not overrepresented in our study population. Volunteers for our
studies of vascular function routinely undergo screening measurement of fasting lipid profiles and oral glucose tolerance testing.
Diabetes mellitus, either previously diagnosed or discovered with
screening oral glucose tolerance testing, was an exclusion criterion
for this analysis. Subjects were categorized prospectively as lean or
obese according to body mass index (female cutpoint, 28 kg/m2;
male cutpoint, 26 kg/m2). Ethnicity was self-reported by the participants. All studies were approved by the local Institutional Review
Board, and all subjects gave written informed consent. All procedures were performed in accordance with institutional guidelines
Measurements included in the analysis included anthropomorphic
measurements performed within 1 week of the vascular study, and
blood pressure and biochemical measurements were performed
immediately before the vascular study. Weight was measured on a
single stationary hospital-grade scale calibrated yearly. Height was
measured with a single wall-mounted stadiometer. Percentage body
fat was measured by dual energy x-ray absorptiometry or water
displacement (for subjects ⬎122 kg, the upper limit for the dual
energy x-ray absorptiometry machine). Waist circumference was
measured at the narrowest portion of the abdomen. Blood pressure
measurements by wall-mounted sphygmomanometers were performed in duplicate with the subject supine at rest on the study day
before initiation of study procedures. In some but not all cases,
samples for a lipid profile were also obtained before the vascular
measurements. When this was not done, these values were excluded
from analysis if the screening lipid measurements and the vascular
study were separated by ⬎4 weeks.
The data collected with these studies included duplicate fasting
insulin and glucose measurements (separated by 10 minutes) before
initiation of the vascular study. These values were used to calculate
the homeostasis model index of insulin resistance (HOMA-IR).17
HOMA-IR has been found to closely relate to formal measurements
of insulin sensitivity using hyperinsulinemic euglycemic clamp
procedures9,18 and has proved useful in epidemiological studies as an
index of insulin sensitivity.6,19 –22
33
The National Cholesterol Education Program (NCEP) Adult
Treatment Panel III cutpoints for the presence or absence of the
various components of the MS were used for analyses of the
associations of these features, alone and in combination, with
endothelial function. The MS was considered present if ⱖ3 of these
features were present.23
Assays
Blood for serum glucose determinations was put in untreated
polypropylene tubes and centrifuged with an Eppendorf microcentrifuge (Brinkman). The glucose concentration of the supernatant
was then measured by the glucose oxidase method with a glucose
analyzer (model 2300, Yellow Springs Instruments). Blood for
determination of plasma insulin was collected in heparinized tubes,
processed immediately, and frozen at ⫺20°C. Insulin determinations
were made with a dual-site radioimmunoassay specific for human
insulin and with cross-reactivity with proinsulin ⬍0.2% (Linco). The
lower detection limit is 0.56 pmol/L, and in our laboratory, the
interassay and intra-assay coefficients of variation are 4.1% and
2.6%, respectively. Standard methodologies for cholesterol and
triglyceride determinations were used for assays performed through
our the clinical laboratory of the local hospital.
Endothelial Function
All vascular studies were performed after an overnight fast, with
subjects in a supine position in a quiet, temperature-controlled room.
A 6F sheath (Cordis Corp) was placed into the right femoral vein to
allow the insertion of a custom-designed 5F double-lumen thermodilution catheter (Baxter Scientific, Edwards Division) to measure leg
blood flow (LBF). The right femoral artery was cannulated with a
5.5F double-lumen catheter to allow simultaneous infusion of substances and invasive blood pressure monitoring via a vital signs
monitor (Spacelabs). Baseline LBF and mean arterial pressure
measurements were obtained after ⱖ30 minutes of rest after the
insertion of the catheters. Femoral vein thermodilution curves were
used to measure LBF rates, calculated by integration of the area
under the curve, with a cardiac output computer (model 9520A,
American Edwards Laboratories). At baseline, 24 LBF measurements were obtained at ⬇30-second intervals. This was followed by
measurements of the LBF response to graded intrafemoral arterial
infusions of the endothelium-dependent vasodilator methacholine
chloride (5, 10, and 15 ␮g/min). Beginning 2 minutes after initiation
of each infusion rate, 10 LBF measurements were obtained at
⬇30-second intervals. The mean of these 10 measurements was
taken as the response at each step, and the percent increase in LBF
relative to baseline was calculated for each subject. These measures
were used as integrated measurements of endothelial function in the
correlation analyses with the various baseline measures discussed
above. These responses are specifically inhibited by coinfusion of
inhibitors of nitric oxide synthase such as NG-monomethyl-Larginine, confirming their utility in assessing endothelium-dependent
vasodilator responses.24 –26 This method has variability characteristics superior to other commonly used measures of endothelial
function, with within-subject coefficients of variation on the order of
10%.
Statistical Analysis
Statistical analyses were performed with JMP version 5.1 (SAS
Institute). The 97 nondiabetic subjects studied in this interval
participated in 162 leg line studies; to take advantage of the
noise-averaging effect of including multiple measurements within
individuals, random-effects modeling was used to account for these
repeated measures. One-way ANOVA was used to compare the
effect of categorical variables on endothelial function. Univariate
analyses evaluated the isolated relationships of each of the continuous variables assessed with endothelial function. Simultaneous
multivariate analyses were used to explore the concurrent associations of these variables with endothelial function. Two-sided P
values of P⬍0.05 were taken as statistically significant. HOMA-IR
was normalized with a logarithmic transformation before inclusion in
34
Circulation
TABLE 1.
July 5, 2005
Characteristics of the Study Subjects
Whites
TABLE 2. Prevalence of Positive MS Components and of the
MS in the Study Population Using the Adult Treatment
Panel III Criteria
Blacks
Parameter
Mean
SD
Mean
SD
P
Age, y
36.4
6.9
34.5
7.4
NS
Parameter
Whites, %
(95% CI)
Blacks, %
(95% CI)
Gender, M/F
31/11
35/20
NS
Waist
13.6 (3.2–23.9)
13.6 (4.5–22.6)
Patient category, lean/obese
25/17
30/25
NS
Triglycerides
19.4 (7.4–31.4)
11.6 (3.1–20.1)
BMI, kg/m2
26.1
5.5
29.2
6.1
NS
HDL cholesterol
56.7 (44.7–68.7)
41.9 (28.9–54.9)
Fat, %
26.6
11.9
27.1
11.9
NS
Blood pressure
20.9 (8.6–33.2)
28.4 (16.5–40.3)
Waist, cm
79.0
10.8
82.9
10.8
NS
Glucose
5.2
0.5
5.0
0.4
NS
MS
68.3
71.3
70.9
49.7
NS
2.7
2.5
2.8
1.8
NS
SBP, mm Hg
116.7
11.7
122.7
12.8
NS
DBP, mm Hg
71.5
9.0
75.9
10.0
NS
Glucose, mmol/L
Insulin, pmol/L
HOMA-IR
Cholesterol, mmol/L
4.26
0.67
4.36
0.79
NS
LDL, mmol/L
2.50
0.49
2.58
0.71
NS
HDL, mmol/L
1.09
0.24
1.31
0.33
0.001
Triglycerides, mmol/L
1.37
0.81
1.01
0.39
0.005
BMI indicates body mass index; SBP, systolic blood pressure; and DBP,
diastolic blood pressure.
parametric analyses,18 and values presented reflect the inverse
transformation of the results from these analyses. Except when
repeated-measures analysis for the dose-response to methacholine is
presented, the percent increase in LBF to the maximal dose of
methacholine was used as the endothelial function end point. Age
and basal (unstimulated) blood flow were important confounders of
the relationships under study; therefore, these variables were included in all multivariable analyses as covariates, in addition to the
random effect for repeated measures within individuals.
Results
The characteristics of the study population are reported in
Table 1. Notable differences between the white and black
subjects studied included higher HDL cholesterol levels and
lower triglyceride levels among black subjects. These differences were statistically significant but not large on the
clinical scale. Modest differences in body mass index and
systolic blood pressure did not reach the significance threshold. Of note with regard to the present analysis, the 2 ethnic
groups did not differ in measures of insulin, glucose, or
HOMA-IR. The prevalence of the MS was similar in both
ethnic groups (whites, 6 of 42, 14.3% [95% CI, 9.6 to 19.0];
blacks, 7 of 55, 12.7% [95% CI, 11.2 to 14.2]; P⫽NS; Table
2). There were also no ethnic differences in the prevalence of
each MS component (Table 2).
EDV was impaired in black compared with white subjects
(Figure; P⫽0.03 by repeated-measures ANOVA including all
subjects, P⫽0.005 comparing only subjects without the MS).
Both groups demonstrated significantly worse endothelial
function when the MS was present (maximal increase in LBF:
blacks: 107⫾9% MS absent, 53⫾16% MS present; whites:
163⫾16% MS absent, 54⫾18% MS absent; P⫽0.007, MS
absent versus present; P⫽NS for interaction of ethnicity and
MS).
These relationships were essentially unchanged when adjusted for age and basal LBF in multivariable linear regression
4.5 (0–10.8)
14.3 (9.6–19.0)
2.1 (0–5.9)
12.7 (11.2–14.2)
There were no differences across ethnic category in the prevalence of these
components (P⫽NS for all).
analyses (model incorporating MS and ethnicity, r2⫽0.64,
P⬍0.001; MS ␤ coefficient, 38.8; P⫽0.006; and ethnicity ␤
coefficient, 28.4; P⫽0.007). Adding logHOMA-IR to this
model removed the independent effect of the MS, leaving insulin
resistance and race as the independent variables (r2⫽0.67,
P⬍0.001; logHOMA-IR ␤ coefficient, 93.6; P⫽0.002; ethnicity
␤ coefficient, 27.5; P⫽0.009).
We analyzed the contributions of the individual components
of the MS to endothelial dysfunction using continuous variables
rather than the simple categorical designations provided by
Adult Treatment Panel III cutpoints. All analyses were adjusted
as above. The MS components that were individually associated
with impaired EDV were as follows: waist: r⫽⫺0.33,
P⬍0.0001; systolic blood pressure: r⫽⫺0.29, P⫽0.0002; and
triglycerides: r⫽0.19, P⫽0.02. Insulin resistance (ie,
logHOMA-IR) was also significantly associated by univariate
analysis (r⫽⫺0.34, P⬍0.0001). Results from multivariable
linear regression analysis modeling of all of these features
(adjusted as above) using all study subjects are presented in
Table 3. When only the defined MS variables (model 1) are
considered, waist and systolic blood pressure were independently related to EDV. Adding insulin resistance to the model
(model 2) removed the contribution of waist circumference,
suggesting that waist circumference was serving as a surrogate
Impaired EDV with MS. Box and whisker plots indicating median
value with 25th and 75th percentiles at the box boundaries and
5th and 95th percentiles at the whisker boundaries. MCh indicates methacholine chloride infused at 5, 10, or 15 ␮g/min.
Lteif et al
TABLE 3.
35
Multivariate Modeling for the Principal Determinants of EDV
Model 1 (R 2 adj, 0.67)
Model 2 (R 2 adj, 0.69)
Model 3 (R 2 adj, 0.68)
␤
F Ratio
P
␤
F Ratio
P
␤
F Ratio
P
Waist, cm
⫺2.25
6.38
0.01
⫺1.13
1.27
NS
⫺0.89
0.81
NS
SPB, mm Hg
⫺2.10
5.97
0.02
⫺2.10
5.35
0.02
⫺1.95
4.71
0.03
DBP, mm Hg
0.89
0.55
NS
1.06
0.77
NS
1.14
0.91
NS
HDL, mmol/L
⫺1.94
0.01
NS
3.15
0.01
NS
20.3
0.36
NS
TG, mmol/L
15.03
0.52
NS
4.12
0.04
NS
⫺5.55
0.07
NS
Glucose, mmol/L
0.15
0.00
NS
LogHOMA-IR, logU
䡠䡠䡠
䡠䡠䡠
䡠䡠䡠
11.18
⫺32.7
0.35
NS
5.37
0.02
8.34
⫺33.7
0.20
NS
5.87
0.02
Ethnicity
24.5
4.62
0.04
䡠䡠䡠
䡠䡠䡠
䡠䡠䡠
䡠䡠䡠
䡠䡠䡠
䡠䡠䡠
adj indicates adjusted; SPB, systolic blood pressure; DBP, diastolic blood pressure; and TG, triglycerides. ␤
Coefficients reflect the adjusted effect of a unit increment on percent vasodilation. All analyses are adjusted for age
and baseline LBF and use random-effects modeling to account for repeated measures.
measure of the effect of insulin resistance on EDV. Expanding
the modeling to include ethnicity (model 3) revealed an additional, independent effect of ethnicity on EDV. An interaction
effect for ethnicity by logHOMA-IR was significant (␤⫽58.1,
P⫽0.046), but the interaction of ethnicity by systolic blood
pressure was not. Including gender as a covariate did not alter
the results of these analyses.
Table 4 presents the results of analyzing model 2 within the
ethnicity subgroups. The white subjects exhibited largely the
same relationship as seen for all subjects combined (Table 2),
namely a dominant contribution of logHOMA-IR, but the
effect of systolic blood pressure was not significant in these
subjects. In contrast, among black subjects, the dominant
correlate of impaired EDV was systolic blood pressure, with
no important independent effect of logHOMA-IR. As with
the modeling for the entire study population, waist circumference did not contribute importantly to the determination of
impaired EDV in either subgroup when the concurrent effects
of these other variables were considered.
In light of the reduced sample sizes in these subgroup
analyses, we considered whether the loss of significance,
particularly for insulin resistance among the black subjects,
was an artifact of reduced statistical power caused by reduced
TABLE 4.
of EDV
Ethnic Differences in the Principal Determinants
Whites
(R 2 adj, 0.73; P⫽0.004)
Blacks
(R 2 adj, 0.52; P⫽0.04)
␤
F Ratio
P
␤
F Ratio
P
Waist, cm
⫺1.44
0.72
NS
0.02
0.00
NS
SPB, mm Hg
⫺1.87
1.48
NS
⫺2.52
5.35
0.03
DBP, mm Hg
2.15
0.83
NS
1.29
0.91
NS
HDL, mmol/L
⫺33.42
0.23
NS
47.02
2.04
NS
TG, mmol/L
⫺18.78
0.32
NS
15.41
0.32
NS
⫺12.68
0.35
NS
8.82
0.23
NS
Glucose, mmol/L
LogHOMA-IR, logU
19.60
0.36
NS
⫺50.89
5.49
0.03
Abbreviations as in Table 3. ␤ Coefficients reflect the adjusted effect of a
unit increment on percent vasodilation. All analyses are adjusted for age and
baseline LBF and use random-effects modeling to account for repeated
measures.
sample size. Therefore, a retrospective power calculation
using the apparent effect sizes and observed variability of
these variables was performed. With the present data, we had
an ⬇7% chance of showing an independent relationship
between logHOMA-IR and EDV in this subgroup; conversely, if such a relationship existed, because of the minimal
apparent effect size, we would have required a sample size of
⬇1300 subjects. Among whites, the retrospective power
calculation suggested that we had an ⬇12% chance of
showing an independent relationship of systolic blood pressure with EDV and would have required a sample size of
⬇320 to distinguish the apparent effect size given the
observed variability. In both cases, therefore, these are not
questions of a borderline loss of power resulting from sample
size issues.
Discussion
We have reported 2 novel findings in this analysis of the
cross-sectional determinants of impaired EDV. First, in analysis of the complete study population, the addition of the
HOMA index of insulin resistance (a simple combination of
fasting blood glucose and insulin levels) removed the independent contribution of waist circumference in the determination of endothelial dysfunction, suggesting that the effects
of the central obesity are mediated by insulin resistance.
Second, ethnicity was found to be an important independent
determinant of endothelial function, with worse endothelial
function among black than white subjects and a reduced
effect of insulin resistance to further worsen endothelial
function among black subjects.
Insulin Resistance, MS, and Impaired
Endothelial Function
Insulin resistance is thought to underlie the MS,27 and
epidemiological analyses suggest that measures of insulin
resistance are an integral component of assessing the presence of the MS.9,21,28,29 It is therefore logical to assume that
adding an assessment of insulin resistance to the NCEPdefined MS might alter the apparent contributions of the
syndrome components to a given vascular outcome. Insulin
resistance and the components of the MS have previously
been reported to associate individually with measurements of
36
Circulation
July 5, 2005
EDV. The present study used multivariable analysis to
consider the simultaneous, mutually adjusted impact of these
factors. Insulin resistance was found to exert an important
effect on endothelial function and appeared to account for the
contribution of central obesity to EDV. Conversely, waist
circumference appeared to serve as a surrogate measure of the
effect of insulin resistance on EDV.
A similar effect of using the HOMA index of insulin
resistance with the NCEP-defined MS has been found in
evaluations of coronary calcification scores as the vascular
outcome.6 In studies of cardiovascular event rates and survival, the effect of insulin resistance measures is less apparent,19,30 –32 and it is not clear that there will be an incremental
effect of insulin resistance beyond assessment of other MS
components as data on “hard” cardiovascular outcomes becomes available.33 Endothelial function is related to cardiovascular outcomes,34 –36 but it is not necessarily true that the
determinants of vascular status in the short term (ie, physiological function) will carry the same weights over the long
term. These differences in the additional contribution of
insulin resistance to the MS components in predicting a
variety of vascular outcomes might therefore reflect true
differences in vascular biology. It is equally possible, however, that differing time courses of the effects of each variable
or other unidentified modifying factors are obscuring the
relationship of insulin resistance to vascular outcomes over
longer time frames.
There is general acceptance that the measurement of
short-term physiological responses of the vasculature represents a useful, accessible window into vascular biology. The
past decade has seen considerable effort expended on the use
of such proximate or alternative end points in assessing the
effects of a variety of interventions. In this setting, the present
result implies that measurement of insulin resistance should
be included in the metabolic assessment of cardiovascular
risk associated with obesity and the MS.
Impaired Vascular Responses in Blacks
Ethnic differences in the prevalence of the MS and of its
constituent components have been described.37 In the
NHANES III data set, no ethnic differences in the patterns of
principal component factor analysis associated with the
NCEP-defined MS were seen,12 suggesting that the interrelationship of the NCEP-defined factors is comparable across
ethnicities. A similar analysis in the IRAS cohort found that
both direct and surrogate measures of insulin resistance were
integral to the “metabolic” factor in principal component
analysis,9 but again, no differences across ethnicity were seen
in these associations. These studies suggest that the biology
governing the interrelationships of the factors comprising the
MS is similar across ethnicities.
Differences in vascular biology across ethnicities have
long been recognized. Blacks, for example, have been found
to have an increased risk of macrovascular events at comparable levels of blood pressure and lipid levels.38 Subclinical
atherosclerosis is increased among blacks after adjustment for
major cardiovascular disease risk factors and insulin sensitivity.39 Consistent with our findings, normotensive blacks
have been found to have worse EDV than normotensive white
subjects.14,16 Also, black subjects exhibited comparable coronary blood flow responses to endothelium-dependent vasodilators but had an augmented corrective response to coinfusion with L-arginine.15 However, indexes of arterial elasticity
were not found to differ between blacks and whites in
subjects across the range of hypertension severity.40 Very few
molecular studies have been undertaken to explore these
differences. In one report, differences in the populations of
receptors for endothelin (a proatherosclerotic vascular hormone) across ethnicity were seen.41 Overall, the present
finding is consistent with studies demonstrating ethnic differences in other vascular end points, but the reasons for these
differences remain obscure.
In a combined analysis of the Cardiovascular Health Study
and the Atherosclerosis Risk in Communities study, the
impact of traditional cardiovascular risk factors on cerebrovascular and cardiovascular atherosclerosis was found to
differ by age and gender.42 The present findings suggest that
the metabolic determinants of endothelial function differ
between black and white subjects. This is a novel finding for
which there are few confirmatory data. In the Women’s
Health Initiative, the association of obesity with cardiovascular disease in postmenopausal women was lost among
blacks, whereas the relationship between blood pressure and
CVD was stronger among black than white women.7 This
important question has implications for the impact of therapeutic interventions and warrants further study.
Study Limitations
Our study population consisted of volunteer subjects rather
than a true population-based sample. The factors leading to
participation are presumably equal across subgroups of the
study population, so comparisons within the main study
population are likely valid. It is less clear, however, that these
subjects are clearly representative of the general population;
thus, some caution must be used when our results are
generalized.
The observations made between ethnic subgroups of our
population necessarily involved reductions in sample size,
raising concerns about loss of statistical power. However, as
detailed in the Results section, when the apparent relationships of insulin resistance and systolic blood pressure with
EDV segregated into white and black subjects, respectively,
the reason was not borderline power but rather weak effect
sizes. We are therefore confident that this observation is
robust within our data set.
The various protocols that contributed baseline data to this
analysis did not include measurements of any of the host of
novel inflammatory cardiovascular risk factors currently being investigated as markers of cardiovascular disease. These
questions are clearly relevant and will be addressed prospectively in further studies in our laboratory.
Conclusions
The NCEP-defined MS is strongly associated with the presence of endothelial dysfunction in black and white subjects.
By multivariate analysis, the association of waist circumference with endothelial dysfunction appeared to depend principally on insulin resistance, and the dominant determinants
of endothelial function across our whole study population
Lteif et al
were insulin resistance and systolic blood pressure. The
relative importance of these components differed by ethnic
subgroup, with a difference specifically in the worsening of
endothelial function as a result of insulin resistance. These
findings suggest that there are ethnic differences in vascular
biology as it relates to EDV. This possibility warrants further
study in specific ethnic subgroups because it may imply that
different approaches to therapy are needed in black and white
patients.
Acknowledgments
This project was supported by the NIH (NIDDK 42469) and by a
Junior Faculty Award from the American Diabetes Association to Dr
Mather. Dr Mather was also supported by the Sandra A. Daugherty
Foundation. The Indiana University General Clinical Research
Center is supported by the NIH (M01 RR00750). We thank Dr Alain
Baron for his guidance and mentorship on this and many other
projects. The expert nursing and technical support provided by Paula
Robinett, Donna Ford, Jan VanderLuitgaren, Chris Leffler, Kerry
Beverly, and Patti Merril is gratefully acknowledged.
References
1. Steinberg HO, Chaker H, Leaming R, Johnson A, Brechtel G, Baron AD.
Obesity/insulin resistance is associated with endothelial dysfunction:
implications for the syndrome of insulin resistance. J Clin Invest. 1996;
97:2601–2610.
2. Lavrencic A, Salobir BG, Keber I. Physical training improves flowmediated dilation in patients with the polymetabolic syndrome. Arterioscler Thromb Vasc Biol. 2000;20:551–555.
3. Petrie JR, Ueda S, Webb DJ, Elliott HL, Connell JM. Endothelial nitric
oxide production and insulin sensitivity: a physiological link with implications for pathogenesis of cardiovascular disease. Circulation. 1996;93:
1331–1333.
4. Ferrannini E, Haffner SM, Mitchell BD, Stern MP. Hyperinsulinaemia:
the key feature of a cardiovascular and metabolic syndrome. Diabetologia. 1991;34:416 – 422.
5. Cheal KL, Abbasi F, Lamendola C, McLaughlin T, Reaven GM, Ford ES.
Relationship to insulin resistance of the Adult Treatment Panel III diagnostic criteria for identification of the metabolic syndrome. Diabetes.
2004;53:1195–1200.
6. Reilly MP, Wolfe ML, Rhodes T, Girman C, Mehta N, Rader DJ.
Measures of insulin resistance add incremental value to the clinical
diagnosis of metabolic syndrome in association with coronary atherosclerosis. Circulation. 2004;110:803– 809.
7. Howard BV, Criqui MH, Curb JD, Rodabough R, Safford MM, Santoro
N, Wilson AC, Wylie-Rosett J. Risk factor clustering in the insulin
resistance syndrome and its relationship to cardiovascular disease in
postmenopausal white, black, Hispanic, and Asian/Pacific Islander
women. Metabolism. 2003;52:362–371.
8. Festa A, D’Agostino R Jr, Howard G, Mykkanen L, Tracy RP, Haffner
SM. Chronic subclinical inflammation as part of the insulin resistance
syndrome: the Insulin Resistance Atherosclerosis Study (IRAS). Circulation. 2000;102:42– 47.
9. Hanley AJ, Karter AJ, Festa A, D’Agostino R Jr, Wagenknecht LE,
Savage P, Tracy RP, Saad MF, Haffner S. Factor analysis of metabolic
syndrome using directly measured insulin sensitivity: the Insulin
Resistance Atherosclerosis Study. Diabetes. 2002;51:2642–2647.
10. Wagenknecht LE, Zaccaro D, Espeland MA, Karter AJ, O’Leary DH,
Haffner SM. Diabetes and progression of carotid atherosclerosis: the
Insulin Resistance Atherosclerosis Study. Arterioscler Thromb Vasc Biol.
2003;23:1035–1041.
11. Okosun IS, Liao Y, Rotimi CN, Prewitt TE, Cooper RS. Abdominal
adiposity and clustering of multiple metabolic syndrome in white, black
and Hispanic Americans. Ann Epidemiol. 2000;10:263–270.
12. Ford ES. Factor analysis and defining the metabolic syndrome. Ethn Dis.
2003;13:429 – 437.
13. Liese AD, Mayer-Davis EJ, Tyroler HA, Davis CE, Keil U, Duncan BB,
Heiss G. Development of the multiple metabolic syndrome in the ARIC
cohort: joint contribution of insulin, BMI, and WHR: Atherosclerosis
Risk in Communities. Ann Epidemiol. 1997;7:407– 416.
37
14. Rosenbaum DA, Pretorius M, Gainer JV, Byrne D, Murphey LJ, Painter
CA, Vaughan DE, Brown NJ. Ethnicity affects vasodilation, but not
endothelial tissue plasminogen activator release, in response to bradykinin. Arterioscler Thromb Vasc Biol. 2002;22:1023–1028.
15. Houghton JL, Philbin EF, Strogatz DS, Torosoff MT, Fein SA, Kuhner
PA, Smith VE, Carr AA. The presence of African American race predicts
improvement in coronary endothelial function after supplementary
L-arginine. J Am Coll Cardiol. 2002;39:1314 –1322.
16. Gainer JV, Stein CM, Neal T, Vaughan DE, Brown NJ. Interactive effect
of ethnicity and ACE insertion/deletion polymorphism on vascular reactivity. Hypertension. 2001;37:46 –51.
17. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner
RC. Homeostasis model assessment: insulin resistance and B cell function
from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28:412– 419.
18. Mather KJ, Hunt AE, Steinberg HO, Paradisi G, Hook G, Katz A, Quon
MJ, Baron AD. Repeatability characteristics of simple indices of insulin
resistance: implications for research applications. J Clin Endocrinol
Metab. 2001;86:5457–5464.
19. Hanley AJ, Williams K, Stern MP, Haffner SM. Homeostasis model
assessment of insulin resistance in relation to the incidence of cardiovascular disease: the San Antonio Heart Study. Diabetes Care. 2002;25:
1177–1184.
20. Han TS, Sattar N, Williams K, Gonzalez-Villalpando C, Lean ME,
Haffner SM. Prospective study of C-reactive protein in relation to the
development of diabetes and metabolic syndrome in the Mexico City
Diabetes Study. Diabetes Care. 2002;25:2016 –2021.
21. Bonora E, Kiechl S, Willeit J, Oberhollenzer F, Egger G, Bonadonna RC,
Muggeo M. Metabolic syndrome: epidemiology and more extensive phenotypic description: cross-sectional data from the Bruneck Study. Int J
Obes Relat Metab Disord. 2003;27:1283–1289.
22. Resnick HE, Jones K, Ruotolo G, Jain AK, Henderson J, Lu W, Howard
BV. Insulin resistance, the metabolic syndrome, and risk of incident
cardiovascular disease in nondiabetic American Indians: the Strong Heart
Study. Diabetes Care. 2003;26:861– 867.
23. Executive Summary of the Third Report of The National Cholesterol
Education Program (NCEP) Expert Panel on Detection, Evaluation, and
Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel
III). JAMA. 2001;285:2486 –2497.
24. Baron AD, Tarshoby M, Hook G, Lazaridis EN, Cronin J, Johnson A,
Steinberg HO. Interaction between insulin sensitivity and muscle perfusion on glucose uptake in human skeletal muscle: evidence for capillary
recruitment. Diabetes. 2000;49:768 –774.
25. Steinberg HO, Brechtel G, Johnson A, Fineberg N, Baron AD. Insulinmediated skeletal muscle vasodilation is nitric oxide dependent: a novel
action of insulin to increase nitric oxide release. J Clin Invest. 1994;94:
1172–1179.
26. Mather KJ, Lteif A, Steinberg HO, Baron AD. Interactions between
endothelin and nitric oxide in the regulation of vascular tone in obesity
and diabetes. Diabetes. 2004;53:2060 –2066.
27. DeFronzo R, Ferrannini E. Insulin resistance: a multifaceted syndrome
responsible for NIDDM, obesity, hypertension, dylipidemia, and atherosclerotic cardiovascular disease. Diabetes Care. 1991;14:173–194.
28. Meigs JB, Wilson PW, Nathan DM, D’Agostino RB Sr, Williams K,
Haffner SM. Prevalence and characteristics of the metabolic syndrome in
the San Antonio Heart and Framingham Offspring Studies. Diabetes.
2003;52:2160 –2167.
29. Shen BJ, Todaro JF, Niaura R, McCaffery JM, Zhang J, Spiro A 3rd,
Ward KD. Are metabolic risk factors one unified syndrome? Modeling
the structure of the metabolic syndrome X. Am J Epidemiol. 2003;157:
701–711.
30. Ruige JB, Assendelft WJJ, Dekker JM, Kostense PJ, Heine RJ, Bouter
LM. Insulin and risk of cardiovascular disease: a meta-analysis. Circulation. 1998;97:996 –1001.
31. Pyorala M, Miettinen H, Halonen P, Laakso M, Pyorala K. Insulin
resistance syndrome predicts the risk of coronary heart disease and stroke
in healthy middle-aged men: the 22-year follow-up results of the Helsinki
Policemen Study. Arterioscler Thromb Vasc Biol. 2000;20:538 –544.
32. Lakka HM, Laaksonen DE, Lakka TA, Niskanen LK, Kumpusalo E,
Tuomilehto J, Salonen JT. The metabolic syndrome and total and cardiovascular disease mortality in middle-aged men. JAMA. 2002;288:
2709 –2716.
33. Isomaa B, Almgren P, Tuomi T, Forsen B, Lahti K, Nissen M, Taskinen
MR, Groop L. Cardiovascular morbidity and mortality associated with the
metabolic syndrome. Diabetes Care. 2001;24:683– 689.
38
Circulation
July 5, 2005
34. Halcox JP, Schenke WH, Zalos G, Mincemoyer R, Prasad A, Waclawiw
MA, Nour KR, Quyyumi AA. Prognostic value of coronary vascular
endothelial dysfunction. Circulation. 2002;106:653– 658.
35. Neunteufl T, Heher S, Katzenschlager R, Wolfl G, Kostner K, Maurer G,
Weidinger F. Late prognostic value of flow-mediated dilation in the
brachial artery of patients with chest pain. Am J Cardiol. 2000;86:
207–210.
36. Schachinger V, Britten MB, Zeiher AM. Prognostic impact of coronary
vasodilator dysfunction on adverse long-term outcome of coronary heart
disease. Circulation. 2000;101:1899 –1906.
37. Park YW, Zhu S, Palaniappan L, Heshka S, Carnethon MR, Heymsfield
SB. The metabolic syndrome: prevalence and associated risk factor
findings in the US population from the Third National Health and
Nutrition Examination Survey, 1988 –1994. Arch Intern Med. 2003;163:
427– 436.
38. Jha AK, Varosy PD, Kanaya AM, Hunninghake DB, Hlatky MA, Waters
DD, Furberg CD, Shlipak MG. Differences in medical care and disease
39.
40.
41.
42.
outcomes among black and white women with heart disease. Circulation.
2003;108:1089 –1094.
D’Agostino RB Jr, Burke G, O’Leary D, Rewers M, Selby J, Savage PJ,
Saad MF, Bergman RN, Howard G, Wagenknecht L, Haffner SM. Ethnic
differences in carotid wall thickness: the Insulin Resistance Atherosclerosis Study. Stroke. 1996;27:1744 –1749.
Prisant LM, Resnick LM, Hollenberg SM, Jupin D. Arterial elasticity
among normotensive subjects and treated and untreated hypertensive
subjects: influence of race. Ethn Dis. 2002;12:63– 68.
Ergul A, Tackett RL, Puett D. Distribution of endothelin receptors in
saphenous veins of African Americans: implications of racial differences.
J Cardiovasc Pharmacol. 1999;34:327–332.
Howard G, Manolio TA, Burke GL, Wolfson SK, O’Leary DH. Does the
association of risk factors and atherosclerosis change with age? An
analysis of the combined ARIC and CHS cohorts: the Atherosclerosis
Risk in Communities (ARIC) and Cardiovascular Health Study (CHS)
Investigators. Stroke. 1997;28:1693–1701.
Health Services and Outcomes Research
Adoption of Spironolactone Therapy for Older Patients
With Heart Failure and Left Ventricular Systolic
Dysfunction in the United States, 1998 –2001
Frederick A. Masoudi, MD, MSPH; Cary P. Gross, MD; Yongfei Wang, MS; Saif S. Rathore, MPH;
Edward P. Havranek, MD; JoAnne Micale Foody, MD; Harlan M. Krumholz, MD, SM
Background—Concerns have been raised about the appropriateness of spironolactone use in some patients with heart
failure. We studied the adoption of spironolactone therapy after publication of the Randomized Aldactone Evaluation
Study (RALES) in national cohorts of older patients hospitalized for heart failure.
Methods and Results—This is a study of serial cross-sectional samples of Medicare beneficiaries ⱖ65 years old discharged
after hospitalization for the primary diagnosis of heart failure and with left ventricular systolic dysfunction. The first
sample was discharged before (April 1998 to March 1999, n⫽9758) and the second sample after (July 2000 to June
2001, n⫽9468) publication of RALES in September 1999. We assessed spironolactone prescriptions at hospital
discharge in patient groups defined by enrollment criteria for the trial. Using multivariable logistic regression, we
identified factors independently associated with prescriptions not meeting these criteria. Spironolactone use increased
⬎7-fold (3.0% to 21.3% P⬍0.0001) after RALES. Of patients meeting enrollment criteria, 24.1% received
spironolactone, as compared with 17.4% of those not meeting the criteria. Of all prescriptions after RALES, 30.9% were
provided to patients not meeting enrollment criteria. Spironolactone was prescribed to 22.8% of patients with a serum
potassium value ⱖ5.0 mmol/L, to 14.1% with a serum creatinine value ⱖ2.5 mg/dL, and to 17.3% with severe renal
dysfunction (estimated glomerular filtration rate ⬍30 mL · min⫺1 · 1.73 m⫺2). In multivariable analyses, factors
associated with prescriptions not meeting enrollment criteria included advanced age, noncardiovascular comorbidities,
discharge to skilled nursing facilities, and care provided by physicians without board certification.
Conclusions—Spironolactone prescriptions increased markedly after the publication of RALES, and many treated patients
were at risk for hyperkalemia. Simultaneously, many patients who might have benefited were not treated. These findings
demonstrate the importance of balancing efforts to enhance use among appropriate patients and minimizing use in
patients at risk for adverse events. (Circulation. 2005;112:39-47.)
Key Words: heart failure 䡲 aging 䡲 aldosterone antagonists 䡲 potassium
A
application of the trial results in case reports and series from
single centers.2–9 More recently, a study from Canada reported simultaneous increases in spironolactone prescriptions
and hospitalizations for hyperkalemia after the publication of
RALES.10 Although that study could not determine whether
that observation resulted from spironolactone use in patients
at high risk for hyperkalemia in clinical practice, it suggests
the possibility of inappropriate use or inadequate monitoring
of spironolactone in the community. Because aldosterone
blockade may improve survival in some patients with heart
lthough the Randomized Aldactone Evaluation Study
(RALES) demonstrated the benefits of aldosterone
blockade with spironolactone in selected patients with severely symptomatic left ventricular systolic dysfunction
(LVSD), this therapy has not been proven beneficial for all
heart failure patients.1 Spironolactone may cause serious
hyperkalemia, particularly in patients with marginal renal
function, type IV renal tubular acidosis, or relatively high
baseline potassium levels. Because of the potential risks of
spironolactone therapy, concerns have been raised about the
Received December 4, 2004; revision received March 1, 2005; accepted March 28, 2005.
From the Division of Cardiology, Department of Medicine, Denver Health Medical Center (F.A.M., E.P.H.); and the Division of Cardiology,
Department of Medicine (F.A.M., E.P.H.), and the Division of Geriatric Medicine, Department of Medicine (F.A.M.), University of Colorado Health
Sciences Center, Denver, Colo; the Colorado Foundation for Medical Care (F.A.M., E.P.H., H.M.K.), Aurora, Colo; the Colorado Health Outcomes
Program (F.A.M.), Aurora, Colo; the Section of General Internal Medicine, Department of Medicine (C.P.G.); the Section of Cardiovascular Medicine,
Department of Medicine (S.S.R., Y.W., J.M.F., H.M.K.), and the Section of Health Policy and Administration, Department of Epidemiology and Public
Health (H.M.K.), Yale University School of Medicine, New Haven, Conn; the Center for Outcomes Research and Evaluation (H.M.K., C.G.), Yale–New
Haven Hospital, New Haven, Conn; and the Section of Cardiology, Department of Medicine, West Haven Veteran’s Administration Medical Center
(J.M.F.), West Haven, Conn.
Guest Editor for this article was Clyde W. Yancy, MD.
Correspondence to Frederick A. Masoudi, MD, MSPH, Division of Cardiology, MC 0960 Denver Health Medical Center, 777 Bannock St, Denver,
CO 80204. E-mail [email protected]
39
40
Circulation
July 5, 2005
TABLE 1. Study Populations Before (1998 –1999) and After
(2000 –2001) Publication of RALES Results
1998 –1999 2000 –2001
(n⫽9758) (n⫽9468)
Meeting RALES enrollment criteria*
61.5
58.3
TABLE 1.
Continued
P
0.02
Demographics
Other
1998 –1999
(n⫽9758)
2000 –2001
(n⫽9468)
2.5
3.7
Discharge medications
Age, y
0.01
ACE inhibitor or ARB
60.9
9.9
11.0
NS
Diuretic†
89.6
88.4
0.03
␤-Blocker
21.7
43.4
⬍0.001
Potassium supplement
52.9
44.5
⬍0.001
Cardiologist
29.4
27.6
Internist with consult
22.0
25.7
Internist without consult
16.6
15.3
35.3
33.3
ARB
75–84
45.3
45.0
ⱖ85
19.4
21.6
Female
47.4
45.4
Race
0.02
NS
White
83.7
84.0
Black
12.7
13.3
Other
3.5
2.7
Physician characteristics
⬍0.001
Specialty
Medical history
Hypertension
60.7
66.0
⬍0.001
Other with consult
19.9
21.1
Coronary artery disease
67.5
70.3
⬍0.001
Other without consult
12.1
10.3
Physician board certification
71.8
75.5
16.4
17.0
Myocardial infarction
39.1
41.0
0.05
Coronary revascularization
35.8
39.8
⬍0.001
Cerebrovascular accident
16.5
19.1
⬍0.001
31.1
32.5
NS
COTH member
Diabetes
40.4
41.9
NS
Residency affiliated
24.1
21.1
Dementia
7.3
8.0
NS
Nonteaching
59.5
61.9
42.9
48.6
Teaching status
NS
Cardiac surgery capability
6.0
5.4
100–140
45.0
46.9
⬎140
49.0
47.7
1.6
10.5
⬍0.001
Atrial fibrillation
27.9
28.2
NS
Pulmonary edema on chest radiograph
77.4
75.8
0.04
Census division
NS
Spironolactone on admission
Potassium, mmol/dL
3.5–5.0
⬎5.0
Public
12.1
11.0
Not for profit
75.6
77.2
For profit
12.4
11.8
Northeast
20.0
20.3
NS
0.03
Midwest
25.2
25.1
South
40.4
40.2
5.1
5.7
West
14.4
14.4
NS
1.5–2.4
32.7
33.1
8.3
9.5
Estimated GFR, mL 䡠 min⫺1 䡠 1.73 m⫺2
NS
5.7
4.9
26.6
25.7
30–59
52.5
53.0
⬍30
15.1
16.4
Hematocrit ⬍30%
29.8
5.1
57.5
Severe LVSD
21.6
36.1
89.3
59.0
60–89
21.0
No invasive facilities
5.7
⬍1.5
⬎89
Cardiac catheterization lab
89.3
Creatinine, mg/dL
⬎2.4
⬍0.001
Ownership
Laboratory/imaging data
⬍3.5
0.01
Cardiac care facilities
Systolic blood pressure
8.2
8.2
61.5
61.3
Discharge setting
NS
NS
0.001
Home without home health care
56.0
56.5
Home with home health care
23.4
22.1
Institutional setting
18.0
17.6
⬍0.001
Hospital characteristics
Chronic pulmonary disease
Admission characteristics
⬍0.001
64.2
65–74
⬍100
P
ARB indicates angiotensin receptor blocker; COTH, Council of Teaching
Hospitals.
*RALES enrollment criteria applied included discharge prescription for ACE
inhibitor/ARB and diuretic, discharge serum creatinine ⬍2.5 mg/dL, and
discharge serum potassium ⬍5.0 mmol/L.
†Not including potassium-sparing diuretics.
failure but pose a serious risk in others, the simultaneous
assessment of appropriate and potentially inappropriate use of
spironolactone is important.
Current clinical guidelines acknowledge this difficult balance, recommending that spironolactone be restricted to
patients similar to those enrolled in RALES.11 Specifically,
the guidelines recommend spironolactone for patients with
LVSD; recent or current symptoms at rest despite the use of
digoxin, diuretics, an angiotensin-converting enzyme (ACE)
inhibitors, and (usually) a ␤-blocker; a serum potassium value
⬍5.0 mmol/L; and creatinine value ⬍2.5 mg/dL before
Masoudi et al
initiation of treatment.11 Because many community-based
patients do not fit these criteria,12 widespread use of spironolactone without consideration of these factors could expose
many patients to adverse outcomes.
The degree to which spironolactone is used for patients
who might derive a benefit and is avoided among those at
high risk for adverse events is not known. To address this
issue, we assessed national patterns of spironolactone use
before and after publication of the RALES results in September 1999 in a community-based, nationally representative
sample of patients. This study was intended to assess the rate
of adoption of spironolactone in the United States and the
degree to which the selection of patients for treatment after
publication of RALES conformed to study enrollment
criteria.
Methods
National Heart Care Project
The National Heart Care (NHC) Project is an ongoing initiative
funded by the Centers for Medicare and Medicaid Services designed
to improve the quality of care for Medicare beneficiaries with heart
failure.13 Fee-for-service Medicare beneficiaries hospitalized with a
principal discharge diagnosis of heart failure (International Classification of Diseases, Ninth Revision, Clinical Modification codes
402.01, 402.11, 402.91, 404.01, 404.91, or 428) between April 1998
and March 1999 or July 2000 and June 2001, inclusive, were
identified. These periods straddled the publication of RALES.
According to a sampling strategy described previously,13,14 discharges were grouped by state and sorted by age, sex, race, and
treating hospital, and up to 800 discharges were randomly selected
from each state. The selected records underwent detailed review by
trained data abstractors in central data abstraction centers. Patients
with invalid social security numbers, those receiving long-term
hemodialysis, those transferred to another hospital, or those who left
against medical advice based on data from the administrative records
or the chart abstraction were excluded. The NHC sample thus
consisted of 78 882 records, of which 39 477 were from 1998 to
1999 and 39 405 from 2000 to 2001.
Study Sample
Because this was a study of the prescription of spironolactone at
discharge, patients who died during hospitalization were excluded
(n⫽4126). Because RALES enrolled only patients with LVSD, we
further restricted the analysis to patients with an LV ejection fraction
⬍40% or a qualitative description of moderate or severe systolic
dysfunction, based on the evaluation closest to the discharge date
(n⫽22 928). From this group, we excluded patients younger than 65
years because younger Medicare beneficiaries are not representative
of the younger population as a whole. If a patient appeared more than
once in the sample, 1 record was included by random selection.
Patients who were transferred to another acute care hospital, left
against medical advice, were receiving long-term renal dialysis, or
with missing vital status were also excluded. A total of 3702 records
of patients with LVSD were excluded by these selection criteria,
resulting in a final study cohort of 19 226 patients (9758 in 1998 to
1999 and 9468 in 2000 to 2001).
Clinical Variables
The NHC database includes a wide range of variables, including
demographic characteristics, medical history, characteristics on presentation, diagnostic testing, laboratory data, and a comprehensive
list of the names of medications prescribed at hospital discharge. For
the purposes of interpretability, drugs were assigned to classes.
Combination drugs were assigned to all classes contained in the
combination. The following drugs were assessed to determine
spironolactone prescriptions (in alphabetical order): Aldactone
Spironolactone Prescription in Heart Failure
41
(Pfizer), Aldactazide (Pfizer), hydrochlorothiazide/spironolactone,
and spironolactone.
Spironolactone treatment was also assessed in subgroups defined
by the primary selection criteria used for RALES.1 Patients meeting
all of the following criteria were designated as conforming to these
criteria: (1) discharge prescription for an ACE inhibitor or angiotensin receptor blocker or a documented reason for nonuse of ACE
inhibitors; (2) discharge prescription for a diuretic (not including
spironolactone); (3) a serum creatinine value closest to hospital
discharge ⬍2.5 mg/dL; and (4) a serum potassium value closest to
hospital discharge of ⬍5.0 mmol/L. All other patients were designated as not meeting RALES enrollment criteria. Because the serum
creatinine value may overestimate renal function, particularly in
elderly patients, an estimated glomerular filtration rate (GFR) was
also calculated for all patients according to the abbreviated Modification of Diet in Renal Disease Study equation.15
Additional Data Sources
NHC data were linked with the American Medical Association
Physician Masterfile16,17 by using the unique physician identification
number of the attending physician, defined as the clinician primarily
responsible for the patient’s care during hospitalization.18 Hospital
characteristics were ascertained by linking with the 1998 and 2000
American Hospital Association Annual Surveys.19,20
Patient, physician, and hospital characteristics, as well as documentation of spironolactone prescription at discharge, were compared
between the 1998 to 1999 and 2000 to 2001 periods by ␹2 statistics.
Correlates of spironolactone prescription were determined by characteristics of the patients (demographics, medical history, comorbidities, and admission variables), treating physician (board certification, cardiology specialty), and hospital (teaching status, cardiac
care facilities, urban or rural location, ownership, and US census
division). Differences in proportions were evaluated by ␹2 statistics.
To assess changes in use between 1998 to 1999 and 2000 to 2001
after adjustment for differences in patient, physician, and hospital
characteristics, logistic regression was performed, with spironolactone prescription at discharge as the dependent variable. Models
comprising statistically significant covariates (P⬍0.05) were constructed by backward selection. Subsequently, a variable indicating
the sampling time frame was introduced into the model. The
statistical significance of 2-way interactions between the time frame
variable and other covariates included in the final model was tested
to identify heterogeneity in the rate of increase in spironolactone use.
Finally, to identify characteristics associated with spironolactone
prescription that did not conform to RALES enrollment criteria, a
model in only those patients who were treated with spironolactone in
2000 to 2001 was constructed, with failure to conform to all RALES
enrollment criteria as the dependent variable. Because the characteristics composing the criteria defined the dependent variable in this
model, these variables were not candidate independent variables. All
analyses used probability weights to account for the NHC sampling
strategy, thus providing national level estimates. Statistical analyses
were conducted with Stata 7.0 (Stata Corp) and SAS version 8.0
(SAS Institute, Inc).
Results
Patient Population
In both samples, ⬇20% were at least 85 years old, the
majority were male, and most had a history of hypertension
and coronary artery disease (Table 1). Noncardiovascular
comorbidities, including diabetes and chronic pulmonary
disease, were also common. An elevated potassium level at
hospital discharge (⬎5.0 mmol/L) was present in ⬎5% of
patients. Although the prevalence of serum creatinine ⬎2.5
mg/dL was 8.3% in 1998 to 1999 and 9.5% in 2000 to 2001,
the prevalence of a severely reduced estimated GFR (ie, ⬍30
42
Circulation
July 5, 2005
TABLE 2. Rates of Spironolactone Prescription Before
(1998 –1999) and After (2000 –2001) Publication of RALES
Results by Patient and Provider Characteristics
1998 –
1999,
%
2000 –
2001,
%
Absolute
Change,
%*
3.0
21.3
18.3
No
3.2
17.4
14.2
Yes
2.9
24.1
21.2
Total
Meeting RALES enrollment criteria‡
TABLE 2.
䡠䡠䡠
⬍0.001
4.2
23.4
19.2
75–84
2.8
21.7
19.0
⬎84
1.3
17.0
15.7
Sex
2.6
21.0
18.4
Male
3.3
21.5
18.2
Race
3.0
21.5
18.6
Black
2.7
20.8
18.1
Other
3.8
15.1
11.3
Hypertension
7.4
No
2.6
21.5
18.8
Yes
3.9
20.8
16.9
No
4.0
23.0
19.0
Yes
2.7
20.7
18.0
3.9
17.9
14.0
⬍0.001
3.5
23.6
20.1
Yes
2.6
20.1
17.5
21.5
3.8
23.0
19.2
⬎2.4
1.8
14.1
12.3
18.8
NS
17.7
16.9
3.5
23.4
19.8
⬍30
2.2
17.3
15.1
⬍30%
2.5
16.8
14.3
ⱖ30%
3.0
21.7
18.7
Moderate
2.4
18.4
16.1
Severe
3.4
23.1
19.7
Home without home health care
2.9
21.4
18.6
Home with home health care
4.0
24.5
20.5
18.5
Institutional setting
1.8
17.7
15.9
17.8
Other
4.0
16.2
12.2
No
4.1
17.2
13.1
Yes
2.4
23.8
21.4
2.9
20.6
17.7
4.4
26.5
22.1
No
2.8
19.1
16.2
Yes
3.5
24.2
20.7
17.5
Yes
2.5
22.0
19.5
0.004
Coronary revascularization
NS
No
2.5
19.6
17.1
Yes
3.8
23.7
19.9
Cerebrovascular accident
NS
18.0
NS
Diabetes
NS
No
2.7
21.1
18.4
Yes
3.4
21.5
18.1
Dementia
Hematocrit
NS
Severity of LVSD
3.1
21.9
18.8
1.4
14.0
12.6
Yes
⬍0.001
23.0
100–140
4.2
23.8
19.5
⬎140
1.6
18.1
16.5
⬍0.001
Discharge ␤-blocker prescription
Admission characteristics
27.5
⬍0.001
Discharge ARB prescription
Yes
4.5
NS
Discharge ACE-inhibitor prescription
No
⬍100
NS
Discharge characteristics
No
Systolic blood pressure
NS
Discharge setting
18.4
Chronic pulmonary disease
20.9
2.7
1.5–2.4
30–59
20.7
3.0
⬍1.5
15.1
3.3
21.5
NS
20.2
No
3.0
20.1
17.9
Myocardial infarction
21.0
18.4
22.8
2.4
20.7
3.0
21.4
2.7
2.8
24.1
21.4
2.9
⬎5.0
60–89
3.4
3.0
3.5–5.0
Estimated GFR, mL 䡠 min⫺1 䡠 1.73 m⫺2
0.01
19.7
NS
⬎89
Coronary artery disease
2.8
0.05
Creatinine, mg/dL
NS
No
Yes
13.3
72.5
⬍3.5
Medical history
No
15.3
65.1
Potassium, mmol/dL
NS
White
Yes
1.9
Yes
Pulmonary edema on chest radiograph
NS
Female
No
No
Laboratory/imaging data
0.001
65–74
P†
⬍0.001
Spironolactone on admission
Atrial fibrillation
Age, y
Yes
1998 – 2000 – Absolute
1999, 2001, Change,
%
%
%*
P†
Demographics
No
Continued
NS
Masoudi et al
TABLE 2.
Continued
43
Changes in Spironolactone Prescription
1998 –
1999,
%
2000 –
2001,
%
Absolute
Change,
%*
Discharge potassium supplement
P†
NS
No
3.7
23.8
20.1
Yes
2.3
17.1
15.8
Physician characteristics
Specialty
NS
Cardiologist
3.9
24.8
20.9
Internist with consult
3.1
21.2
18.1
Internist without consult
2.6
17.5
14.9
Other with consult
2.6
21.1
18.5
Other without consult
1.7
17.9
16.2
No
2.5
19.5
17.1
Yes
3.2
21.8
18.7
COTH member
2.9
23.9
21.0
Residency affiliated
3.6
23.1
19.6
Nonteaching
2.6
19.8
17.2
Cardiac surgery capability
3.4
23.1
19.7
Cardiac catheterization lab
2.5
18.2
15.7
No invasive facilities
2.5
20.3
17.8
Physician board certification
NS
Hospital characteristics
Teaching status
NS
Cardiac care facilities
NS
Ownership
0.005
Public
2.9
19.6
16.7
Not for profit
2.8
22.2
19.4
For-profit
3.7
16.2
12.6
Northeast
2.1
19.4
17.4
Midwest
3.4
23.4
20.0
South
3.1
20.5
17.4
West
3.2
22.4
19.2
Census division
NS
Abbreviations are as defined in text and in the footnote to Table 1.
*P value comparing prescription rates between 1998 –1999 and 2000 – 01
⬍0.001 for all patient groups.
†P value for interaction between characteristic and time in multivariate
model
‡RALES enrollment criteria applied included discharge prescription for ACE
inhibitor/ARB and diuretic, discharge serum creatinine ⬍2.5 mg/dL, and
discharge serum potassium ⬍5.0 mmol/L.
mL · min⫺1 · 1.73 m⫺2) was higher (15.2% and 16.4%, respectively). Approximately 42% of patients in 2000 to 2001 did
not meet the appropriateness criteria for spironolactone
treatment.
From 1998 to 1999 and 2000 to 2001, there was a decline
in the proportion of patients treated at hospital discharge with
ACE inhibitors or angiotensin receptor blockers, diuretics
(not including spironolactone), and potassium replacements.
The proportion treated with ␤-blockers increased significantly between periods.
Overall, spironolactone prescription rates in the cohort
increased from 3.0% in 1998 to 1999 to 21.3% in 2000 to
2001 (P⬍0.001, Table 2). Although the increase in prescriptions between the 2 time periods was significant in all
patient subgroups, the change was significantly greater in
younger patients (P for interaction, 0.001); those with a
lower admission blood pressure (P⬍0.001); those with
angina (P⬍0.001); and those not admitted who were
already being treated with spironolactone (P⬍0.001).
Rates of increase did not differ significantly, however, by
levels of discharge serum creatinine, estimated GFR, or
discharge potassium supplementation.
In the population of patients discharged in 2000 to 2001,
spironolactone was prescribed for 22.8% of patients with a
serum potassium value ⬎5.0 mmol/L, for 14.1% of patients
with a serum creatinine value ⬎2.5 mg/dL, and for 17.3% of
patients with severe renal dysfunction, as defined by an
estimated GFR (⬍30 mL · min⫺1 · 1.73 m⫺2; the Figure).
Among patients not receiving an ACE inhibitor prescription,
17.2% received spironolactone, and among those receiving a
prescription for potassium supplements, 17.1% were discharged with a spironolactone prescription. Among patients
meeting study enrollment criteria after RALES, spironolactone was prescribed to 24.1% (a 21.2% absolute increase);
among those not meeting these criteria, 17.4% received a
discharge prescription for spironolactone (14.2% absolute
increase). Of all spironolactone prescriptions in 2000 to 2001,
30.9% were provided to patients not meeting enrollment
criteria.
Correlates of Spironolactone Prescription Not
Meeting RALES Criteria
Among those patients receiving a prescription for spironolactone at discharge, prescriptions not conforming to RALES
criteria were more common among older patients (compared
with an age 65- to 74-year referent; age 75 to 84 years odds
ratio [OR], 1.40; 95% confidence interval [CI], 1.14 to 1.72;
P⬍0.001; age 85⫹ OR, 1.28; 95% CI, 0.96 to 1.70; P⫽0.09,
Table 3) and were less common among women (OR, 0.80;
95% CI, 0.66 to 0.97; P⫽0.02). Prior history of heart failure,
atrial fibrillation, and higher admission systolic blood pressures were associated with a lower OR of prescription not
conforming to criteria, whereas noncardiovascular comorbidities, including chronic lung disease and anemia, were
associated with higher ORs. Patients discharged to a skilled
nursing facility had ⬎2-fold higher odds of receiving spironolactone prescriptions not meeting criteria (OR, 2.31; 95%
CI, 1.71 to 3.11; P⬍0.001). Patients cared for by nongeneralist physicians without cardiology consultation were more
likely to conform to the RALES criteria (OR, 0.57; 95% CI,
0.39 to 0.84; P⫽0.005) compared with those cared for by a
cardiologist (1.00 referent), as were those cared for by a
board-certified physician (OR, 0.70; 95% CI, 0.54 to 0.90;
P⫽0.005) compared with those cared for by a physician
without board certification.
Discussion
In this study of 2 cross-sectional cohorts of older patients
with heart failure and LVSD, prescription of spironolactone
44
Circulation
July 5, 2005
Changes in proportions of patients
receiving prescription for spironolactone
at hospital discharge between 1998 to
1999 (before RALES) and 2000 to 2001
(after RALES) in all patients and patients
stratified by serum potassium, creatinine,
and estimated GFR.
increased ⬎7-fold after publication of RALES. Of the discharge prescriptions written after RALES, almost one third
were provided to patients not fitting the study enrollment
criteria, many of whom were at high risk for hyperkalemia.
Slow adoption among patients who might benefit from
spironolactone simultaneously with rapidly increasing use
among those at higher risk for adverse consequences indicates that the integration of clinical trials results in practice
may not maximize either effectiveness or safety. These
findings demonstrate the complexity of adoption of information from new clinical trials, emphasizing the need for faster
adoption among appropriate patients and simultaneous efforts
to minimize use in patients who might suffer severe adverse
events from inappropriate use.
RALES established the efficacy of spironolactone in reducing mortality and hospitalization in selected patients with
heart failure and LVSD.1 In our study, a minority of patients
who had serum potassium and creatinine levels within the
ranges of RALES subjects and who were receiving other
evidence-based therapy for heart failure were not treated with
spironolactone at hospital discharge. This finding is concordant with other data demonstrating that standards of clinical
care lag behind the evidence generated in clinical trials. The
development of mechanisms to facilitate rapid and appropriate diffusion of trial results into patient care is likely to
improve important patient outcomes.
RALES, however, excluded patients who were not receiving evidence-based heart failure therapy and those at potentially high risk for hyperkalemia. Several factors predispose
some patients with heart failure to the risk of potentially
life-threatening hyperkalemia with an agent that impairs
aldosterone action. Both diabetes, which is associated with
type IV renal tubular acidosis,21 and renal insufficiency are
common in populations with heart failure.13,22–24 The addition
of an aldosterone antagonist to the regimen of patients with
underlying abnormalities of potassium excretion already being treated with ACE inhibitors, angiotensin receptor blockers, ␤-blockers, or potassium supplements may increase the
risk of hyperkalemia to varying degrees. Although RALES
demonstrated significant mortality benefits in a patient pop-
ulation predominantly treated with ACE inhibitors, the trial
did not enroll patients with severe renal insufficiency (defined as a serum creatinine value ⬍2.5 mg/dL) or baseline
hyperkalemia (potassium ⬎5.0 mmol/L).1 Patients in the trial
were also assessed frequently after the initiation of therapy
for the development of hyperkalemia and worsening renal
insufficiency, which may not be the case in usual clinical
practice.4
Since the publication of RALES, concerns have been
raised about the adoption of spironolactone outside the
context of a carefully controlled clinical trial.2 Within a year
of the release of RALES, a single-center case series of 25
patients treated with spironolactone were admitted with
serious hyperkalemia. These patients were predominantly
older, and none had a serum potassium value exceeding
4.8 mmol/L before admission.25 Several subsequent case
series have described patients with hyperkalemia requiring
hospitalization, some of whom died.5–9 Many patients in these
series were elderly, in whom the serum creatinine value often
overestimates true renal function. The results of our study
raise significant concerns about the safety of current patterns
of spironolactone prescription in community-based populations, particularly among older patients with noncardiovascular comorbidities.
A population-based study from Ontario, Canada, found
that the use of spironolactone increased from 3.4% before the
publication of RALES to 14.9% afterward.10 Simultaneously,
hospitalization rates for hyperkalemia increased ⬎4-fold, and
associated mortality increased by ⬎6-fold. The authors of
that study speculated that hyperkalemia resulted in part from
the inappropriate use of spironolactone but were unable to
demonstrate whether the patterns they observed were due to
misapplication of the RALES results. This is the first study in
a nationally representative sample demonstrating widespread
use of spironolactone in patients for whom there is no good
evidence for benefit, many of whom are at high risk for
hyperkalemia.
The finding of limited adoption of spironolactone use in
patients like those enrolled in RALES with simultaneous
widespread use in populations of patients at risk for hyper-
Masoudi et al
TABLE 3. Factors Independently Associated With Spironolactone Prescription Not Meeting RALES
Enrollment Criteria (2000 –2001*†)
Characteristic
Age, y
⬍75
75–84
ⱖ85
Sex
Male
Female
Race
White
Black
Other
Admission source
Noninstitutional
Nursing facilities
Other
Heart failure history
No
Yes
Chronic lung disease
No
Yes
Atrial fibrillation
No
Yes
Admission systolic blood pressure
⬍100
100–140
⬎140
Hematocrit
⬍30%
ⱖ30%
Attending physician specialty
Cardiologist
Internal medicine with cardiology consult
Internal medicine without consult
Other physician type with consultation
Other physician type without consult
Attending physician with board certification
No
Yes
Hospital ownership
Public
Not for profit
For profit
Discharge setting
Home
Home with home health
Skilled nursing facility
Other
Prescriptions Not
Meeting Enrollment
Criteria
Unadjusted OR
(95% CI)
Adjusted OR
(95% CI)
P‡
29.9%
36.8%
35.6%
Referent
1.36 (1.12–1.66)
1.29 (1.00–1.67)
Referent
1.40 (1.14–1.72)
1.28 (0.96–1.70)
䡠䡠䡠
0.002
NS
35.7%
32.0%
Referent
0.85 (0.71–1.02)
Referent
0.80 (0.66–0.97)
䡠䡠䡠
0.02
35.3%
24.4%
45.6%
Referent
0.59 (0.44–0.79)
1.53 (0.83–2.86)
Referent
0.69 (0.51–0.93)
1.78 (0.94–3.38)
䡠䡠䡠
0.02
NS
34.0%
34.6%
34.9%
Referent
1.03 (0.68–1.55)
1.04 (0.67–1.64)
Referent
0.55 (0.34–0.89)
0.87 (0.54–1.41)
䡠䡠䡠
0.01
NS
37.1%
33.3%
Referent
0.85 (0.68–1.06)
䡠䡠䡠
0.01
0.006
32.4%
37.6%
Referent
1.26 (1.05–1.52)
Referent
0.76 (0.60–0.95)
0.76
Referent
1.32 (1.08–1.61)
35.0%
31.6%
Referent
0.86 (0.70–1.05)
Referent
0.78 (0.63–0.97)
䡠䡠䡠
0.02
37.2%
37.2%
29.5%
1.00 (0.70–1.42)
Referent
0.71 (0.59–0.85)
NS
50.4%
32.9%
Referent
0.48 (0.34–0.68)
0.99 (0.69–1.42)
Referent
0.71 (0.58–0.86)
2.30
Referent
0.43 (0.30–0.62)
35.1%
33.3%
35.6%
35.0%
28.0%
Referent
0.93 (0.73–1.17)
1.02 (0.77–1.37)
1.00 (0.78–1.27)
0.72 (0.51–1.02)
Referent
0.93 (0.72–1.19)
0.95 (0.70–1.30)
0.84 (0.63–1.13)
0.57 (0.39–0.84)
䡠䡠䡠
NS
NS
NS
0.005
37.3%
33.1%
Referent
0.83 (0.68–1.03)
Referent
0.70 (0.54–0.90)
䡠䡠䡠
0.005
29.2%
34.1%
41.0%
0.81 (0.59–1.10)
Referent
1.35 (1.00–1.84)
0.89 (0.64–1.23)
Referent
1.39 (1.01–1.91)
NS
䡠䡠䡠
0.64
31.5%
31.8%
45.9%
43.0%
Referent
1.01 (0.82–1.26)
1.84 (1.44–2.37)
1.64 (0.98–2.74)
Referent
1.02 (0.82–1.28)
2.31 (1.71–3.11)
1.55 (0.90–2.67)
䡠䡠䡠
NS
⬍0.001
NS
䡠䡠䡠
0.006
䡠䡠䡠
⬍0.001
0.01
䡠䡠䡠
⬍0.001
Abbreviations are as defined in text and in the footnote to Table 1.
*RALES enrollment criteria defined as all of the following: (1) treatment with ACE inhibitor at discharge or documentation for not
prescribing an ACE inhibitor; (2) treatment with a diuretic at discharge; (3) serum creatinine ⬍2.5 mg/dL at discharge; and (4) serum
potassium ⬍5.0 mmol/L at discharge.
45
46
Circulation
July 5, 2005
kalemia has important implications for quality improvement
and patient safety initiatives in heart failure. Typically, efforts
to improve patterns of pharmacological therapy in patients
with heart failure have focused exclusively on either underuse
(eg, ACE inhibitors or ␤-blockers) or overuse (eg, type I
antiarrhythmic agents or nonsteroidal antiinflammatory
drugs).26 –28 Given the patterns of care shown in this study,
any efforts to increase the use of spironolactone in patients
with heart failure should also include mechanisms to ensure
that this drug is not used in populations in whom the risks
may outweigh the benefits.
The demonstration that spironolactone is frequently prescribed to patients at high risk in a national sample of older
patients with heart failure in conjunction with evidence of
higher population rates of hyperkalemia associated with
increasing spironolactone use10 suggest the need for action to
change current patterns of use of aldosterone-blocking drugs.
Although several mechanisms may be useful in reducing the
potential harm to patients, it is possible that changing the
labeling of aldosterone-blocking agents to reflect these concerns (eg, more stringent precautions) and efforts by industry
and professional associations to inform practitioners of these
hazards would have a positive influence. With the more
recent publication of EPHESUS, a study of the selective
aldosterone blocker eplerenone in patients with heart failure
after myocardial infarction,29 the use of aldosterone blockade
is likely to proliferate further, increasing the importance of
ensuring that these agents are used only in those populations
for whom the benefit outweighs the risk.
Certain issues should be considered in the interpretation of
these results. First, it was not possible to determine the
relation between the timing of initiation of spironolactone and
the measurement of laboratory values. Thus, in some cases,
serum potassium and creatinine levels may have reflected in
part the results of treatment with spironolactone. Patients with
elevated potassium levels and marked renal dysfunction,
however, are at relatively higher risk for hyperkalemia if
spironolactone is continued. Second, we used a relatively
conservative definition for RALES enrollment criteria. The
data did not include symptom severity by New York Heart
Association (NYHA) classification or the frequency of subsequent clinical assessments. Because RALES studied only
those patients with advanced symptoms (NYHA class III or
IV) and provided very close follow-up for hyperkalemia, it is
possible that our study overestimates the proportion of safe
prescriptions. Third, the doses of spironolactone prescribed at
discharge were not available in our dataset. Because evidence
from case series indicates that the risk of hyperkalemia
increases with higher spironolactone dose,6,25 such data might
identify a larger number of patients at risk for adverse
outcomes. Third, we were unable to assess changes in
spironolactone use after hospital discharge. Because of the
rapid adoption of spironolactone during the time period under
study, prescriptions at the time of hospital discharge may
have underestimated use in the outpatient setting. This also
prohibits an accurate assessment of the relation between
spironolactone use and outcomes such as mortality or readmission because of the potential for significant misclassification of exposure. Although we could not assess the impact of
the use of spironolactone on outcomes, there is evidence that
use of spironolactone in elderly patients without consideration of serum potassium and creatinine values can result in
adverse outcomes, including death.7–9
In conclusion, the prescription of spironolactone in older
patients with LSVD hospitalized with heart failure increased
substantially in the United States after publication of RALES.
More than one third of prescriptions were provided to patients
who did not meet enrollment criteria of the trial, many of
whom had characteristics that placed them at high risk for
hyperkalemia. The means of ensuring use only among those
patients with an acceptably low risk of adverse events will be
important for optimizing the benefits and risks of aldosterone
antagonists in the clinical care of populations of patients with
heart failure.
Acknowledgments
Dr Masoudi is supported by NIH/NIA Research Career Award
K08-AG01011. Dr Gross is supported by a Cancer Prevention,
Control and Population Sciences Career Development Award
(1K07CA-90402), the Claude D. Pepper Older Americans Independence Center at Yale (P30AG21342), and Paul Beeson career
development award in Aging (K08 AG24842). Dr Foody is supported by NIH/NIA Research Career Award K08-AG20623 and
NIA/Hartford Foundation Fellowship in Geriatrics. Saif Rathore is
supported by NIH/National Institute of General Medical Sciences
Medical Scientist Training Grant GM07205.
Disclosure
Dr Masoudi has received honoraria from Pfizer; Dr Foody has
received honoraria from Pfizer. The content of this publication does
not necessarily reflect the views or policies of the Department of
Health and Human Services, nor does mention of trade names,
commercial products, or organizations imply endorsement by the US
government. The analyses on which this publication is based were
performed under contract No. 500-02-CO01, entitled “Utilization
and Quality Control Peer Review Organization for the State (commonwealth) of Colorado,” sponsored by the Centers for Medicare
and Medicaid Services (formerly Health Care Financing Administration), Department of Health and Human Services. The authors
assume full responsibility for the accuracy and completeness of the
ideas presented herein. This article is a direct result of the Health
Care Quality Improvement Program initiated by the Centers for
Medicare and Medicaid Services, which has encouraged identification of quality improvement projects derived from analysis of
patterns of care, and therefore required no special funding on the part
of this contractor. Ideas and contributions to the author concerning
experience in engaging with issues presented are welcomed.
References
1. Pitt B, Zannad F, Remme WJ, Cody R, Castaigne A, Perez A, Palensky
J, Wittes J. The effect of spironolactone on morbidity and mortality in
patients with severe heart failure: Randomized Aldactone Evaluation
Study Investigators. N Engl J Med. 1999;341:709 –717.
2. Geraci JM, Knowlton AA. Spironolactone for heart failure: spiraling out
of control. Chest. 2000;118:1522–1523.
3. Berry C, McMurray J. Serious adverse events experienced by patients
with chronic heart failure taking spironolactone. Heart. 2001;85:e8 – e9.
4. Bozkurt B, Agoston I, Knowlton AA. Complications of inappropriate use
of spironolactone in heart failure: when an old medicine spirals out of
new guidelines. J Am Coll Cardiol. 2003;41:211–214.
5. Svensson M, Gustafsson F, Galatius S, Hildebrandt PR, Atar D.
Hyperkalaemia and impaired renal function in patients taking spironolactone for congestive heart failure: retrospective study. BMJ. 2003;327:
1141–1142.
6. Wrenger E, Muller R, Moesenthin M, Welte T, Frolich JC, Neumann KH.
Interaction of spironolactone with ACE inhibitors or angiotensin receptor
blockers: analysis of 44 cases. BMJ. 2003;327:147–149.
Masoudi et al
7. Blaustein DA, Babu K, Reddy A, Schwenk MH, Avram MM. Estimation
of glomerular filtration rate to prevent life-threatening hyperkalemia due
to combined therapy with spironolactone and angiotensin-converting
enzyme inhibition or angiotensin receptor blockade. Am J Cardiol. 2002;
90:662– 663.
8. Obialo CI, Ofili EO, Mirza T. Hyperkalemia in congestive heart failure
patients aged 63 to 85 years with subclinical renal disease. Am J Cardiol.
2002;90:663– 665.
9. Vanpee D, Swine CH. Elderly heart failure patients with drug-induced
serious hyperkalemia. Aging Clin Exp Res. 2000;12:315–319.
10. Juurlink DN, Mamdani MM, Lee DS, Kopp A, Austin PC, Laupacis A,
Redelmeier DA. Rates of hyperkalemia after publication of the Randomized Aldactone Evaluation Study. N Engl J Med. 2004;351:543–551.
11. Hunt SA, Baker DW, Chin MH, Cinquegrani MP, Feldman AM, Francis
GS, Ganiats TG, Goldstein S, Gregoratos G, Jessup ML, Noble RJ,
Packer M, Silver MA, Stevenson LW, Gibbons RJ, Antman EM, Alpert
JS, Faxon DP, Fuster V, Jacobs AK, Hiratzka LF, Russell RO, Smith SC
Jr. ACC/AHA guidelines for the evaluation and management of chronic
heart failure in the adult: executive summary a report of the American
College of Cardiology/American Heart Association Task Force on
Practice Guidelines (Committee to Revise the 1995 Guidelines for the
Evaluation and Management of Heart Failure). Circulation. 2001;104:
2996 –3007.
12. Masoudi FA, Havranek EP, Wolfe P, Gross CP, Rathore SS, Steiner JF,
Ordin DL, Krumholz HM. Most hospitalized older persons do not meet
the enrollment criteria for clinical trials in heart failure. Am Heart J.
2003;146:250 –257.
13. Havranek EP, Masoudi FA, Westfall KA, Wolfe P, Ordin DL, Krumholz
HM. Spectrum of heart failure in older patients: results from the National
Heart Failure project. Am Heart J. 2002;143:412– 417.
14. Rathore SS, Foody JM, Wang Y, Smith GL, Herrin J, Masoudi FA, Wolfe
P, Havranek EP, Ordin DL, Krumholz HM. Race, quality of care, and
outcomes of elderly patients hospitalized with heart failure. JAMA. 2003;
289:2517–2524.
15. National Kidney Foundation. K/DOQI clinical practice guidelines for
chronic kidney disease: evaluation, classification, and stratification. Am J
Kidney Dis. 2002;39(suppl 1):S1–S266.
16. Kenward K. The scope of the data available in the AMA’s Physician
Masterfile. Am J Public Health. 1996;86:1481–1482.
47
17. Baldwin LM, Adamache W, Klabunde CN, Kenward K, Dahlman C,
Warren L. Linking physician characteristics and Medicare claims data:
issues in data availability, quality, and measurement. Med Care. 2002;
40(suppl):IV-82–IV-95.
18. Iezzoni LI. Risk Adjustment for Measuring Health Care Outcomes, 2nd
ed. Chicago: Health Administration Press; 1997.
19. American Hospital Association. The AHA Annual Survey Database:
Fiscal Year 1998 Documentation. Chicago: Health Forum, AHA; 1999.
20. American Hospital Association. The AHA Annual Survey Database:
Fiscal Year 2000 Documentation. Chicago: Health Forum, AHA; 2001.
21. Tan SY, Burton M. Hyporeninemic hypoaldosteronism: an overlooked
cause of hyperkalemia. Arch Intern Med. 1981;141:30 –33.
22. Nichols GA, Hillier TA, Erbey JR, Brown JB. Congestive heart failure in
type 2 diabetes: prevalence, incidence, and risk factors. Diabetes Care.
2001;24:1614 –1619.
23. Dries DL, Exner DV, Domanski MJ, Greenberg B, Stevenson LW. The
prognostic implications of renal insufficiency in asymptomatic and symptomatic patients with left ventricular systolic dysfunction. J Am Coll
Cardiol. 2000;35:681– 689.
24. Hillege HL, Girbes AR, de Kam PJ, Boomsma F, de Zeeuw D,
Charlesworth A, Hampton JR, van Veldhuisen DJ. Renal function, neurohormonal activation, and survival in patients with chronic heart failure.
Circulation. 2000;102:203–210.
25. Schepkens H, Vanholder R, Billiouw JM, Lameire N. Life-threatening
hyperkalemia during combined therapy with angiotensin-converting
enzyme inhibitors and spironolactone: an analysis of 25 cases. Am J Med.
2001;110:438 – 441.
26. Jencks SF, Huff ED, Cuerdon T. Change in the quality of care delivered
to Medicare beneficiaries, 1998 –1999 to 2000 –2001. JAMA. 2003;289:
305–312.
27. Wenger NS, Shekelle PG. Assessing care of vulnerable elders: ACOVE
project overview. Ann Intern Med. 2001;135(pt 2):642– 646.
28. Shekelle PG, MacLean CH, Morton SC, Wenger NS. ACOVE quality
indicators. Ann Intern Med. 2001;135(pt 2):653– 667.
29. Pitt B, Remme W, Zannad F, Neaton J, Martinez F, Roniker B, Bittman
R, Hurley S, Kleiman J, Gatlin M. Eplerenone, a selective aldosterone
blocker, in patients with left ventricular dysfunction after myocardial
infarction. N Engl J Med. 2003;348:1309 –1321.
Heart Failure
Effects of Candesartan on the Development of a New Diagnosis of
Diabetes Mellitus in Patients With Heart Failure
Salim Yusuf, DPhil, FRCP; Jan B. Ostergren, MD, PhD; Hertzel C. Gerstein, MD, MSc;
Marc A. Pfeffer, MD, PhD; Karl Swedberg, MD, PhD; Christopher B. Granger, MD; Bertil Olofsson, PhD;
Jeffrey Probstfield, MD; John V. McMurray, MD; on behalf of the Candesartan in Heart Failure—Assessment of
Reduction in Mortality and Morbidity Program (CHARM) Investigators
Background—Diabetes is a risk factor for heart failure, and both conditions are increasing. Identifying treatments that
prevent both conditions will be clinically important. We previously reported that candesartan (an angiotensin receptor
blocker) reduces cardiovascular mortality and heart failure hospitalizations in heart failure patients (CHARM:
Candesartan in Heart Failure—Assessment of Reduction in Mortality and Morbidity Program).
Methods and Results—We assessed the impact of candesartan versus placebo on the development of diabetes, a predefined
secondary outcome in a randomized, controlled, double-blind study involving 5436 of the 7601 patients with heart
failure, irrespective of ejection fraction, who did not have a diagnosis of diabetes at entry into the trial. Patients received
candesartan (target of 32 mg once daily) or matching placebo for 2 to 4 years. One hundred sixty-three (6.0%)
individuals in the candesartan group developed diabetes, as compared with 202 (7.4%) in the placebo group (hazard ratio
[HR], 0.78 with a 95% confidence interval [CI] of 0.64 to 0.96; P⫽0.020). The composite end point of death or diabetes
occurred in 692 (25.2%) and 779 (28.6%), respectively, in the candesartan and placebo groups (HR, 0.86; 95% CI, 0.78
to 0.95; P⫽0.004). The results were not statistically heterogeneous in the various subgroups examined, although the
apparent magnitude of benefit appeared to be smaller among those treated concomitantly with angiotensin-converting
enzyme inhibitors at trial entry (HR, 0.88; 95% CI, 0.65 to 1.20) compared with those not receiving these drugs (HR,
0.71; 95% CI, 0.53 to 0.93; P for heterogeneity, 0.28).
Conclusions—The angiotensin receptor blocker candesartan appears to prevent diabetes in heart failure patients,
suggesting that the renin-angiotensin axis is implicated in glucose regulation. (Circulation. 2005;112:48-53.)
Key Words: renin 䡲 diabetes mellitus 䡲 prevention 䡲 heart failure 䡲 glucose
T
ype 2 diabetes mellitus (DM) is an important and
common risk factor for the development of heart failure
and for subsequent prognosis. This could be related to the
established link between diabetes and either left ventricular
hypertrophy, coronary artery disease, or other risk factors (eg,
hypertension or obesity) with heart failure. Both DM and
heart failure are increasing1 and are associated with high rates
of mortality and morbidity compared with unaffected individuals. Both conditions lead to substantial economic costs to
society. Preventing DM may prevent or delay the development of many of its complications (eg, atherosclerotic vascular disease or renal dysfunction). Recent evidence suggests
that lifestyle modification by weight loss2,3 and some
glucose-lowering drugs (eg, metformin,2 acarbose4) can reduce the risk of DM in high-risk individuals. A complementary approach may be to prevent DM by blocking the
renin-angiotensin-aldosterone system. Recent retrospective
analysis of the HOPE (Heart Outcomes Prevention Evaluation)5 and ALLHAT (Antihypertensive and Lipid-Lowering
treatment to prevent Heart Attack Trial)6 and data from a
single center in the SOLVD (Studies of Left Ventricular
Dysfunction) trials7 suggest that angiotensin-converting enzyme (ACE) inhibitors (ramipril and enalapril, respectively)
may reduce the risk of DM in individuals with atherosclerosis
or heart failure. Data from the LIFE (Losartan Intervention for
End-point Reduction) study8 suggest that losartan, an angiotensin receptor blocker (ARB), may reduce the risk of new
DM compared with atenolol, a ␤-adrenergic blocker, in
patients with hypertension and left ventricular hypertrophy.
However, it is unclear whether this difference was caused by
a lower rate of DM with losartan or an increased rate of DM
with atenolol. That angiotensin type 1 receptor blockade has
Received December 10, 2004; revision received March 10, 2005; accepted March 24, 2005.
From the Population Health Research Institute (S.Y., H.C.G.), McMaster University, and Hamilton Health Sciences, Hamilton, Canada; Karolinska
University Hospital (J.B.O.), Stockholm, Sweden; Brigham and Women’s Hospital (M.A.P.), Boston, Mass; Sahlgrenska University Hospital/Ostra
(K.S.), Goteberg, Sweden; Duke University Medical Center (C.B.G.), Durham, NC; AstraZeneca (B.O.), Molndal, Sweden; University of Washington
(J.P.), Seattle; and University of Glasgow (J.V.M.), Glasgow, Scotland.
Correspondence to Salim Yusuf, DPhil, FRCP, Department of Medicine, McMaster Clinic, Room 252, 237 Barton St, East Hamilton, Ontario, Canada
L8L 2X2. E-mail [email protected]
DOI: 10.1161.CIRCULATIONAHA.104.528166
48
Yusuf et al
Candesartan in Preventing Diabetes
49
Figure 1. Numbers of patients randomized and final disposition.
a real effect in preventing DM is suggested by recent findings
from the Valsartan Antihypertensive Long-term Use Evaluation (VALUE),9 in which valsartan significantly reduced the
new incidence of DM in comparison with amlodipine, a drug
that is considered to be metabolically neutral.
In the CHARM (Candesartan in Heart Failure: Assessment
of Reduction in Mortality and Morbidity) Program), we
prospectively specified that we would perform a secondary
analysis of the effects of candesartan compared with placebo
with respect to preventing the development of DM (and of
DM plus all-cause mortality) in a broad range of patients with
heart failure.
Methods
Detailed descriptions of the methods and results of the CHARM
program have been published previously.10 –13 In brief, the CHARM
program consisted of 3 parallel trials involving complementary
populations of patients with symptomatic heart failure. Those with a
low ejection fraction (ⱕ0.40) and with prior intolerance to an ACE
inhibitor were included in the CHARM Alternative trial, and those
receiving an ACE inhibitor were included in the CHARM Added
trial. Those with an ejection fraction ⬎0.40 and heart failure were
enrolled into the CHARM Preserved trial (whether or not they were
receiving an ACE inhibitor). Overall, 7601 patients were randomized, of whom 2163 were known to have DM as reported by the
investigators at randomization, and 5436 were not known to have
DM at baseline (Figure 1). This latter group of patients forms the
basis for this report. Patients were randomized to receive either
candesartan (n⫽2715) or placebo (n⫽2721). Patients received the
study drug in incremental doses (up to a maximum of 32 mg
candesartan once daily as tolerated) or matching placebo. Patients
were followed up at 2, 4, and 6 weeks; 6 months; and then every 4
months until the study end. The investigators were asked to report
the occurrence of a new diagnosis of DM for all patients at the end
of the trial. If a diagnosis of DM was reported after randomization,
the date of diagnosis, details of the criteria used (fasting plasma
glucose ⱖ7 mmol/L [126 mg/dL], fasting blood glucose
ⱖ6.1 mmol/L [110 mg/dL], 2-hour [oral glucose tolerance test] or a
random glucose ⱖ11.1 mmol/L [200 mg/dL]), hypoglycemic medication prescribed, and lifestyle modifications prescribed were recorded on the case record forms. The planned minimum follow-up
was 2 years with a maximum of 4 years, with the median being 3.1
years. At baseline and throughout the study, physicians were free to
prescribe various treatments, including other cardiovascular drugs
(other than ARBs) or glucose-lowering drugs.
The prespecified outcomes for this report were the development of
DM alone or as a composite with all-cause mortality (to avoid the
problem of competing risk). All analyses were based on an intentionto-treat approach with the Wald statistic in a Cox proportionalhazards model and displayed by Kaplan-Meier plots according to
treatment allocation. The hazard ratios (HRs) and 95% confidence
intervals (CIs) comparing treatments, stratified by trial, were calculated for the overall data. The results in a few key subgroups are also
presented, along with the tests of heterogeneity based on the Cox
regression model to evaluate whether the effects of candesartan
varied in the subgroups. All patients provided written, informed
consent, and the protocol was approved by the ethics committee at
each participating institution.
Results
The characteristics of the 5436 patients who were not known
to have DM at baseline are provided in Table 1 and were well
balanced between the groups allocated to candesartan or
placebo. Of note, 68% of patients had a body mass index ⬎25
kg/m2, 50% were hypertensive, 55% were taking ␤-blockers,
80% were taking diuretics, and 39% were receiving ACE
inhibitors.
50
Circulation
TABLE 1.
July 5, 2005
Baseline Characteristics
Mean age, y
Candesartan
(n⫽2715)
Placebo
(n⫽2721)
66⫾11
66⫾12
Age ⬎75 years, %
24
24
Male, %
69
69
White, %
92
93
Current smokers, %
16
15
Previous smokers, %
49
47
Mean BMI, kg/m2
28
28
⬍25, %
32
32
ⱖ25 to ⬍30, %
41
42
ⱖ30, %
27
27
130⫾19
131⫾19
II
48
48
III/IV
52
52
Hypertension, %
50
50
Previous myocardial infarction, %
48
49
Any diuretic
80
81
Thiazide diuretic
12
12
␤-Blocker
54
55
ACE inhibitor
39
38
Systolic blood pressure, mm Hg
NYHA class, %
Baseline medication, %
BMI indicates body mass index.
Proportions are in percent or mean⫾SD.
The proportion of patients receiving the study drug at 14
months was 86.0% and 89.5% and at 26 months, was 82.4%
and 86.7% in the active and placebo groups, respectively. Of
those taking the study medication, the mean dose used at the
last visit was 24.5 mg/d in the candesartan group and 28.0 mg
in the placebo group.
Overall, there were 163 (6.0%) individuals who reported a
new diagnosis of DM in the candesartan group compared
with 202 (7.4%) in the placebo group (HR, 0.78; 95% CI,
0.64 to 0.96; P⫽0.020) (Figure 2). The composite of new DM
or death occurred in 692 (25.2%) patients in the candesartan
group compared with 779 (28.6%) in the placebo group (HR,
0.86; 95% CI, 0.78 to 0.95; P⫽0.004). The difference in new
Figure 2. Effects of candesartan compared with placebo on
incidence of DM.
Figure 3. Results of candesartan in various subgroups. BMI
indicates body mass index; MI, myocardial infarction; low., lowering; and bl., blocker.
DM was most marked in patients with preserved ejection
fraction, with a favorable trend in the Alternative trial
(wherein candesartan was compared with placebo in the
absence of an ACE inhibitor) and little apparent benefit in the
Added trial (wherein candesartan or placebo was added to an
ACE inhibitor). However, the 95% CIs of these estimates
overlap, and there was no statistically significant heterogeneity. Examining the results on the composite of death or
development of DM in various subgroups also provided no
evidence of statistical heterogeneity across the 3 component
trials (Figures 3 and 4).
Figure 4. Results in each of 3 component trials.
Yusuf et al
TABLE 2. Previous Studies Evaluating ACE Inhibitors and
ARBs on Development of Diabetes
Study
Comparison
Relative Risk
(95% CI)
Ramipril vs placebo
0.66 (0.51–0.85)
ACE inhibitors
HOPE5
Captopril vs ␤-blocker/diuretics†
0.79 (0.67–0.94)
SOLVD7*
Enalapril vs placebo
0.22 (0.10–0.46)
ALLHAT6
Lisinopril vs amlodipine
Lisinopril vs diuretics†
0.83 (0.66–1.04)
0.70 (0.57–0.86)
26
CAPPP
ARBs
LIFE8
Losartan vs atenolol†
0.75 (0.63–0.88)
Candesartan vs placebo/other drugs
0.80 (0.62–1.03)
ALPINE
Candesartan/felodipine vs
␤-blocker/diuretics†
0.13 (0.02–0.99)
VALUE9
Valsartan vs amlodipine
0.77 (0.69–0.86)
SCOPE27
28
*Based on data from only 1 center of 23 in the trial and thus may be open
to biases.
†Comparator could be diabetogenic.
Results by Diagnostic Criteria and
Hypoglycemic Treatment
DM was diagnosed by the patient’s physician on the basis of
a fasting glucose sample in 130 patients allocated to placebo
compared with 112 in the candesartan group and by an oral
glucose tolerance test in 25 placebo patients compared with
21 candesartan patients. No criteria for the diagnosis of DM
were specified on the case report forms provided for 47
placebo patients and 30 candesartan patients. DM was treated
with insulin or an oral hypoglycemic drug in 151 placebo
patients compared with 117 candesartan patients and with
dietary modification alone in 51 placebo patients and 45
candesartan patients. In 1 patient with candesartan treatment,
information on treatment for DM was missing.
Subgroups
The benefits of candesartan in preventing DM were seen in
those with a high or low body mass index and in those
receiving or not receiving ␤-blockers or diuretics (Figures 3
and 4). Similar benefits were observed in those in New York
Heart Association (NYHA) classes II and III. Although the
magnitude of benefit appeared to be smaller in those receiving a concomitant ACE inhibitor (HR, 0.88; 95% CI, 0.65 to
1.20) compared with those not on it (HR, 0.71; 95% CI, 0.53
to 0.65), these differences were not heterogeneous from each
other (P for interaction, 0.28). The effect was most marked in
patients with left ventricular ejection fractions ⬎40% (the
CHARM Preserved trial), but there was no significant heterogeneity in effect between the trials in the program (P for
heterogeneity, 0.14).
Impact of Postrandomization Differences in Drugs
There was a higher proportion of patients in the placebo
group receiving a diuretic (76.5% placebo versus 72.6%
candesartan), a ␤-blocker (64.3% versus 60.0%), or an ACE
inhibitor (38.1% versus 34.3%) by the end of the trial.
Adjusting for these differences did not affect the overall
impact of candesartan in preventing DM.
51
Impact of Baseline Potassium and Changes in
Potassium Levels
Potassium levels were available for 2743 patients involved in
North America. The impact on reducing the rates of DM was
similar in those with potassium values equal to or below and
above the median (HR, 0.725; 95% CI, 0.47 to 1.11; HR,
0.81; 95% CI, 0.45 to 1.47, respectively; P for interaction,
0.81). There was a small decrease in potassium levels
(⫺0.028; SD, ⫺0.497) in the placebo group and an increase
(⫹0.144; SD, ⫹0.544) in the candesartan group (P⬍0.0001).
However, adjusting for this difference in potassium (with the
use of time-dependent covariate analysis) between the 2
groups did not alter the impact of candesartan on the
development of DM.
Impact of Postrandomization Differences
in Hospitalization
Because candesartan reduced the risk of hospitalizations
(during which patients are likely to be investigated more
intensively), we examined whether the difference in new
diagnoses of DM could be explained by differences in the
rates of hospitalization. The rates of development of DM
were similarly affected by candesartan in those with (58
versus 74; HR, 0.76; 95% CI, 0.54 to 1.06) versus those
without (105 versus 128; HR, 0.79; 95% CI, 0.61 to 1.02) an
interim hospitalization.
Discussion
Our study demonstrates that candesartan, an ARB, appears to
prevent the development of DM in patients with heart failure
and no previous diagnosis of this condition. This effect was
consistently observed in all subgroups examined, with no
evidence of heterogeneity among the 3 component trials in
this program. It appears that the magnitude of the effect may
have been smaller in those receiving concomitant ACE
inhibitors. Although the relative attenuation of the effects of
preventing DM among those receiving concomitant ACE
inhibitor is not conclusive (the test for interaction is not
significant), it is nevertheless plausible, as the mechanisms of
action of ARBs and ACE inhibitors have considerable overlap. The reduction in DM was observed in those with varying
severities of heart failure symptoms; those with varying
levels of left ventricular ejection fraction; and those with
different levels of body mass index, blood pressure, potassium, and concomitant drugs such as ␤-blockers or diuretics
(which may affect glycemic levels). The difference in DM is
not explained by differences in the rates of hospitalizations,
thereby excluding the possibility of detection biases.
Recent studies implicate angiotensin II (A-II) in the growth
and development of adipose tissue.14 Angiotensinogen is
induced early in the adipogenic differentiation of preadipocytes and is highly expressed in mature adipocytes. A-II
inhibits the adipogenic differentiation of preadipocytes, and
blockade of the angiotensin receptor enhances the response of
preadipocytes to insulin. Increased expression of both A-II
and ACE has been demonstrated in subcutaneous, abdominal,
adipose tissue of overweight and obese individuals.15 Reducing the levels of A-II with either an ACE inhibitor or blunting
the actions of A-II with ARBs could facilitate differentiation
52
Circulation
July 5, 2005
of preadipocytes to mature adipocytes and subsequently
increase lipid storage capacity in adipose tissue. Such an
effect may reduce intramyocellular and hepatic fat and
thereby improve insulin sensitivity. ARBs may also improve
insulin sensitivity by raising adiponectin levels and by increasing the serine phosphorylation of insulin receptors,
insulin receptor substrate-1, and phosphatidylinositol
3-kinase.16 It is also possible that ACE inhibitors and ARBs
increase blood flow to the pancreas and skeletal muscle or
improve insulin sensitivity or secretion by increasing potassium levels.17 Some ARBs have been demonstrated to have
an agonist effect on the peroxisome proliferator–activated
receptor-␥ enzyme, and this may also play an additional role
in reducing glucose levels and the risk of DM.18
Our clinical observation of a reduction in the development
of DM with candesartan, an ARB, is supported by several
previous studies of ACE inhibitors or ARBs (Table 2). In the
HOPE study, ramipril reduced the risk of new DM in those
with atherosclerosis.5 Similar observations have been made
with enalapril in SOLVD in patients with low ejection
fractions.7 In the LIFE study, losartan reduced the development of DM compared with a ␤-blocker; thus, that study is
not able to differentiate between a protective effect of an
ARB or an adverse effect of a ␤-blocker on the development
of DM.8 In the ALLHAT study of patients with hypertension,
lisinopril reduced the rates of new DM compared with
amlodipine (which has a neutral effect) and thiazides (which
have an adverse effect on DM rates).6 Our observation in
CHARM, wherein candesartan was compared with placebo,
indicates that the benefits are likely mediated through blocking the effects of A-II. In the absence of concomitant therapy
with an ACE inhibitor, there is an approximate one-third
relative risk reduction in DM with candesartan, which is
similar to the benefits of ramipril compared with placebo,
when used alone in the HOPE study. Therefore, although
CHARM is the only study that directly assessed the effects of
an ARB against a placebo, the collective experience from
several trials with different comparator groups provides
persuasive and coherent evidence that ACE inhibitors and
ARBs prevent DM. Recently, our finding has also gained
support from the results of the VALUE trial,9 in which
valsartan prevented DM in hypertensives in comparison with
amlodipine, a drug that is considered to be metabolically
neutral.
CHARM is the only study to provide clear evidence of the
effects of an ARB in preventing DM in heart failure patients,
most of whom were receiving a diuretic. This suggests that
blockade of the renin-angiotensin-aldosterone system to prevent DM may be applicable to many different types of
high-risk patients. Further data on this issue will be provided
by the DREAM (Diabetes Reduction Assessment With
Ramipril and Rosiglitazone Medication) study,19 which has
evaluated ramipril in ⬇5200 individuals with impaired glucose tolerance or impaired fasting glucose; the NAVIGATOR
(Nateglinide and Valsartan in Impaired Glucose Tolerance
Outcomes Research) study,20 which has evaluated valsartan in
patients with impaired glucose intolerance and atherosclerosis or multiple risk factors; and the TRANSCEND (Telmisartan Randomized Assessment Study in ACE Intolerant Sub-
jects With Cardiovascular Disease) study, which has
evaluated telmisartan in patients with impaired fasting glucose or impaired glucose tolerance and vascular disease.21
Furthermore, the ONTARGET (Ongoing Telmisartan Alone
and in Combination With Ramipril Global End-point Trial)
study21 is evaluating the relative impact of ramipril versus
telmisartan versus their combination in ⬎25 000 individuals
(two thirds of whom do not have DM) in preventing DM, as
well as a range of vascular complications.
Whereas prevention of DM should be fundamentally approached by reducing weight and increasing activity, the
observations that ACE inhibitors and ARBs prevent the
development of DM has implications for certain populations
(such as heart failure, after myocardial infarction, vascular
disease, or hypertension) in whom such drugs have already
been shown to reduce major vascular events. In such populations, preventing DM by blocking the renin-angiotensin-aldosterone system is likely to confer additional clinical benefits by reducing some of the risks associated with DM (such
as renal and vascular damage), especially during prolonged
treatment (up to 10 years), which is well beyond the time
frame of current trials (usually 2 to 5 years). This suggests
that the clinical benefits observed during the planned
follow-up of current trials of a few years may be an
underestimate of the full benefits that may accrue from longer
treatment. Supportive evidence for this hypothesis stems from
the extended follow-up of SOLVD22 and the 7-year follow-up
of the HOPE study.23
There are a few limitations of our study. First, we relied on
the clinical diagnosis of DM, rather that on serial testing of
blood glucose levels or performing an oral glucose tolerance
test. However, because this was a blinded study, no material
biases in comparing candesartan versus placebo groups
would be expected to occur. However, we may have underestimated the absolute rates of DM (and hence, the absolute
benefits). Second, our population consisted of patients with
heart failure, which is an intensely “diabetogenic” state.
Therefore, further studies with ARBs to evaluate their impact
in preventing DM in other high-risk populations are required.
In conclusion, we have demonstrated that candesartan
reduces the risk of developing DM. This benefit occurs in
addition to reductions in cardiovascular mortality and hospitalizations for heart failure,10 –13, improvement in functional
status (according to NYHA classification),24 and prevention
of atrial fibrillation.25 These benefits of candesartan in preventing multiple adverse outcomes in this high-risk population provide persuasive evidence of the clinical benefits of
ARBs in patients with heart failure.
Acknowledgments
The CHARM program was funded by AstraZeneca, which was
responsible for data collection and analysis. The Study Executive
Committee, consisting of all authors (except H. Gerstein and J.
Probstfield), supervised the management of the study and were
primarily responsible for the interpretation of the data, preparation,
review, and approval of the manuscript.
Disclosure
Dr Yusuf has received research grants, has served on speakers’
bureaus and/or received honoraria, and has served as a consultant to
Yusuf et al
several pharmaceutical companies, including AstraZeneca. Dr Pfeffer has received a research grant from, has served on the speakers’
bureau of and/or received honoraria from, and has consulted for
AstraZeneca. Dr Olofsson is employed by AstraZeneca. Dr Swedberg has received research grants or other research support, has
served on speakers’ bureaus and/or received honoraria, and has
served as a consultant. Dr Ostergren has received a research grant
from AstraZeneca; has served on the speakers’ bureaus of and/or
received honoraria from AstraZeneca, Merck, Aventis, and Novartis;
and has served as a consultant to AstraZeneca, Pfizer, Aventis, and
Novartis. Dr Gerstein is the principal investigator in a trial of ACEI
to prevent diabetes and has received research support for CHARM
CI, a substudy to prevent albuminuria. Dr Granger has received a
research grant from and has served as a consultant to AstraZeneca.
Dr Probstfield has received research grants from King, Wyeth, and
Boehringer; has served on the speakers’ bureaus of and/or received
honoraria from King, Wyeth, and Pfizer; and has served as a
consultant to King. Dr McMurray has received research grants or
other research support from, served on the speakers’ bureaus of
and/or received honoraria from, and consulted for AstraZeneca and
Takeda.
12.
13.
14.
15.
16.
17.
References
1. King H, Aubert RE, Herman WH. Global burden of diabetes, 1995–2025:
prevalence, numerical estimates, and projections. Diabetes Care. 1998;
21:1414 –1431.
2. Knowler WC, Barrett-Connor E, Fowler SE, Hamman RF, Lachin JM,
Walker EA, Nathan DM; Diabetes Prevention Program Research Group.
Reduction in the incidence of type 2 diabetes with lifestyle intervention or
metformin. N Engl J Med. 2002;346:393– 403.
3. Tuomilehto J, Lindstrom J, Eriksson JG. Prevention of type 2 diabetes
mellitus by changes in lifestyle among subjects with impaired glucose
tolerance. N Engl J Med. 2001;344:1343–1350.
4. Chiasson JL, Josse RG, Gomis R, Hanefeld M, Karasik A, Laakso M;
STOP-NIDDM Trail Research Group. Acarbose for prevention of type 2
diabetes mellitus: the STOP-NIDDM randomised trial. Lancet. 2002;359:
2072–2077.
5. Yusuf S, Gerstein H, Hoogwerf B, Pogue J, Bosch J, Wolffenbuttel BH,
Zinman B; HOPE Study Investigators. Ramipril and the development of
diabetes. JAMA. 2001;286:1882–1885.
6. ALLHAT Officers and Coordinators for the ALLHAT Collaborative
Research Group. Major outcomes in high-risk hypertensive patients randomized to angiotensin-converting enzyme inhibitor or calcium channel
blocker vs diuretic: the Antihypertensive and Lipid-Lowering Treatment
to Prevent Heart Attack Trial (ALLHAT). JAMA. 2002;288:2981–2997.
7. Vermes E, Tardif JC, Bourassa MG, Racine N, Levesque S, White M,
Guerra PG, Ducharme A. Enalapril reduces the incidence of diabetes in
patients with chronic heart failure: insight from the Studies Of Left
Ventricular Dysfunction (SOLVD). Circulation. 2003;107:1291–1296.
8. Lindholm LH, Ibsen H, Dahlof B, Devereux RB, Beevers G, de Faire U,
Fyhrquist F, Julius S, Kjeldsen SE, Kristiansson K, Lederballe-Pedersen
O, Nieminen MS, Omvik P, Oparil S, Wedel H, Aurup P, Edelman J,
Snapinn S; LIFE Study Group. Cardiovascular morbidity and mortality in
patients with diabetes in the Losartan Intervention For Endpoint reduction
in hypertension study (LIFE): a randomised trial against atenolol. Lancet.
2002;359:1004 –1010.
9. Julius S, Kjeldsen SE, Weber M, Brunner HR, Ekman S, Hansson L, Hua
T, Laragh J, McInnes GT, Mitchell L, Plat F, Schork A, Smith B,
Zanchetti A; VALUE trial group. Outcomes in hypertensive patients at
high cardiovascular risk treated with regimens based on valsartan or
amlodipine: the VALUE randomised trial. Lancet. 2004;363:2022–2031.
10. Pfeffer MA, Swedberg K, Granger CB, Held P, McMurray JJ, Michelson
EL, Olofsson B, Ostergren J, Yusuf S, Pocock S; CHARM Investigators
and Committees. Effects of candesartan on mortality and morbidity in
patients with chronic heart failure: the CHARM-Overall Programme.
Lancet. 2003;362:759 –766.
11. McMurray JJ, Ostergren J, Swedberg K, Granger CB, Held P, Michelson
EL, Olofsson B, Yusuf S, Pfeffer MA; CHARM Investigators and Committees. Effects of candesartan in patients with chronic heart failure and
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
53
reduced left ventricular systolic function treated with an ACE inhibitor:
the CHARM-Added trial. Lancet. 2003;362:767–771.
Granger CB, McMurray JJ, Yusuf S, Held P, Michelson EL, Olofsson B,
Ostergren J, Pfeffer MA, Swedberg K; CHARM Investigators and Committees. Effects of candesartan in patients with chronic heart failure and
reduced left ventricular systolic function and intolerant to ACE inhibitors:
the CHARM-Alternative Trial. Lancet. 2003;362:772–776.
Yusuf S, Pfeffer MA, Swedberg K, Granger CB, Held P, McMurray JJ,
Michelson EL, Olofsson B, Ostergren J; CHARM Investigators and
Committees. Effects of candesartan in patients with chronic heart failure
and preserved left ventricular systolic function: the CHARM-Preserved
trial. Lancet. 2003;362:777–781.
Sharma AM, Janke J, Gorzelniak K, Engeli S, Luft FC. Angiotensin
blockade prevents type 2 diabetes by formation of fat cells. Hypertension.
2002;40:609 – 611.
Gorzelniak K, Engeli S, Janke J, Luft FC, Sharma AM. Hormonal regulation of the human adipose-tissue renin-angiotensin system: relationship
to obesity and hypertension. J Hypertens. 2002;20:965–973.
Furuhashi M, Ura N, Higashiura K, Murakami H, Tanaka M, Moniwa N,
Yoshida D, Shimamoto K. Blockade of the renin-angiotensin system
increases adiponectin concentrations in patients with essential hypertension. Hypertension. 2003;42:76 – 81.
McGarry JD, Dobbins RL. Fatty acids, lipotoxicity and insulin secretion.
Diabetologia. 1999;42:128 –138.
Schupp M, Janke J, Clasen R, Unger T, Kintscher U Angiotensin type 1
receptor blockers induce peroxisome proliferator–activated receptor-␥
activity. Circulation. 2004;109:2054 –2057.
DREAM Trial Investigators. Rationale, design and recruitment characteristics for a large simple international trial of diabetes prevention: the
DREAM trial (Diabetes Reduction Assessment with Ramipril and Rosiglitazone Medications). Diabetologia. 2004;47:1519 –1527.
Nateglinide and valsartan in impaired glucose tolerance outcomes
research: rationale and design of the NAVIGATOR trial. Diabetes 2002;
51(suppl 2):A116. Abstract.
The ONTARGET/TRANSCEND Investigators. Rationale, design and
baseline characteristics of two large, simple randomized trials evaluating
telmisartan, ramipril, and their combination in high-risk patients: the
ONTARGET/TRANSCEND trials. Am Heart J. 2004;148:52– 61.
Jong P, Yusuf S, Rousseau MF, Ahn SA, Bangdiwala SI. Effect of
enalapril on 12-year survival and life expectancy in patients with left
ventricular systolic dysfunction: a follow-up study. Lancet. 2003;361:
1843–1848.
HOPE and HOPE-TOO Investigators. Long-term effects of ramipril on
cardiovascular events and diabetes: results of the HOPE Study Evaluation. Circulation. In press.
McMurray JJ, Ostergren J, Olofsson B, Granger CB, Michelson E, Young
JB, Dunlap M, Yusuf S, Swedberg K, Pfeffer MA, for the CHARM
Investigators. Candesartan improves functional class across a broad
spectrum of patients with chronic heart failure: results of the candesartan
in heart failure—assessment of reduction in mortality and morbidity
programme (CHARM). J Am Coll Cardiol. 2004;43(suppl A):206A.
Abstract.
Swedberg K, Cohen-Solal A, Granger C, McMurray J, Olsson L, Pfeffer
M, Yusuf S, Ostergren J. Prevention of atrial fibrillation in symptomatic
chronic heart failure by candesartan: results from CHARM. J Am Coll
Cardiol 2004;43(suppl A):222A. Abstract.
Effect of angiotensin-converting-enzyme inhibition compared with conventional therapy on cardiovascular morbidity and mortality in hypertension: the Captopril Prevention Project (CAPPP) randomised trial.
Lancet. 1999;353:611– 616.
Lithell H, Hansson L, Skoog I, Elmfeldt D, Hofman A, Olofsson B,
Trenkwalder P, Zanchetti A; SCOPE Study Group. The Study on Cognition and Prognosis in the Elderly (SCOPE): principal results of a
randomized double-blind intervention trial. J Hypertens. 2003;21:
875– 886.
Lindholm LH, Persson M, Alaupovic P, Carlberg B, Svensson A,
Samuelsson O. Metabolic outcome during 1 year in newly detected
hypertensives: results of the Antihypertensive Treatment and Lipid
Profile in a North of Sweden Efficacy Evaluation (ALPINE study).
J Hypertens. 2003;21:1563–1574.
␣-Myosin Heavy Chain
A Sarcomeric Gene Associated With Dilated and Hypertrophic Phenotypes
of Cardiomyopathy
Elisa Carniel, MD; Matthew R.G. Taylor, MD, PhD; Gianfranco Sinagra, MD;
Andrea Di Lenarda, MD; Lisa Ku, MS; Pamela R. Fain, PhD; Mark M. Boucek, MD;
Jean Cavanaugh, MS; Snjezana Miocic, MD; Dobromir Slavov, PhD; Sharon L. Graw, PhD;
Jennie Feiger, MS, MA; Xiao Zhong Zhu, BS; Dmi Dao, BA; Debra A. Ferguson, MS;
Michael R. Bristow, MD, PhD; Luisa Mestroni, MD
Background—Mutations in the ␤-myosin heavy-chain (␤MyHC) gene cause hypertrophic (HCM) and dilated (DCM)
forms of cardiomyopathy. In failing human hearts, downregulation of ␣MyHC mRNA or protein has been correlated
with systolic dysfunction. We hypothesized that mutations in ␣MyHC could also lead to pleiotropic cardiac phenotypes,
including HCM and DCM.
Methods and Results—A cohort of 434 subjects, 374 (134 affected, 214 unaffected, 26 unknown) belonging to 69 DCM
families and 60 (29 affected, 30 unaffected, 1 unknown) in 21 HCM families, was screened for ␣MyHC gene (MYH6)
mutations. Three heterozygous MYH6 missense mutations were identified in DCM probands (P830L, A1004S, and
E1457K; 4.3% of probands). A Q1065H mutation was detected in 1 of 21 HCM probands and was absent in 2 unaffected
offspring. All MYH6 mutations were distributed in highly conserved residues, were predicted to change the structure or
chemical bonds of ␣MyHC, and were absent in at least 300 control chromosomes from an ethnically similar population.
The DCM carrier phenotype was characterized by late onset, whereas the HCM phenotype was characterized by
progression toward dilation, left ventricular dysfunction, and refractory heart failure.
Conclusions—This study suggests that mutations in MYH6 may cause a spectrum of phenotypes ranging from DCM to
HCM. (Circulation. 2005;112:54-59.)
Key Words: genetics 䡲 myosin 䡲 cardiomyopathy, hypertrophic 䡲 cardiomyopathy, dilated
S
case of elderly-onset sporadic HCM.8 On the basis of its
behavior in human myocardial failure, we hypothesized that
␣MyHC may be relevant for myocardial function and that
mutations could cause a spectrum of cardiac phenotypes
ranging from HCM to DCM, as observed in the case of
␤MyHC.
eventeen genes encoding cytoskeletal, sarcomeric, and
nuclear proteins, including ␤-myosin heavy chain
(␤MyHC), have been associated with dilated cardiomyopathy
(DCM).1 Hypertrophic cardiomyopathy (HCM) is caused by
mutations in 9 genes encoding sarcomeric proteins; among
them, mutations in the ␤MyHC gene (MYH7) account for the
majority of cases.2
Two cardiac MyHC isoforms3 have been identified in
humans, with the genes tandemly located on chromosome 14.
MYH6 encodes ␣MyHC and MYH7 encodes ␤MyHC.3
␣MyHC and ␤MyHC are present in different amounts in
mammalian hearts4; human hearts express predominantly
␤MyHC.4 – 6 In nonfailing human hearts, ␣MyHC mRNA
represents 20% to 30% of the total myosin mRNA, whereas
␣MyHC protein represents ⬇7% of the total MyHC. These
are downregulated to 10% and ⬍1%, respectively, in failing
hearts, whereas ␤MyHC is upregulated.5,6
Few data exist on the role of MYH6 mutations in mammals.7 In humans, an MYH6 mutation has been found in one
Methods
Patient Population
Ninety families, 69 with DCM (48 familial, 21 sporadic) and 21 with
HCM, for a total of 434 subjects, 163 of whom were affected, were
studied in the Cardiology Divisions of the University of Colorado
Hospital and the University Hospital of Trieste, Italy, and were
enrolled in the Familial Cardiomyopathy Registry.1 Informed consent was obtained from all subjects enrolled in the study, according
to the institutional review committee. Accurate family history was
obtained from each individual, and family screening was performed.
All of the subjects underwent physical examination, ECG, and
laboratory analysis. Echocardiography was performed in 407 of 434
individuals (echocardiograms were not obtained for 22 relatives
classified as healthy by history, physical examination, and ECG).
Received January 30, 2004; de novo received September 17, 2004; revision received February 24, 2005; accepted March 2, 2005.
From the Familial Cardiomyopathy Registry Research Group.
Reprint requests to Dr Luisa Mestroni, University of Colorado Cardiovascular Institute, Bioscience Park Center, 12635 E Montview Blvd, Suite 150,
Aurora, CO 80010-7116. E-mail [email protected]
54
Carniel et al
TABLE 1.
␣MyHC Mutations in DCM and HCM
55
Major and Minor Criteria for the Diagnosis of Familial DCM
Major Criteria
Minor Criteria
LV systolic dysfunction: EF ⬍45% (2SD) and/or FS ⬍25% (⬎2SD)
Unexplained SV arrhythmias (AF or sustained arrhythmias)
LV dilation: LVEDD ⬎117% of predicted value
Frequent (⬎1000/24 h) or repetitive (3 or more ectopic beats with a heart rate
⬎120 bpm) Ventricular arrhythmias ⬍50 years old
LVEDD ⬎112% of predicted value
LVEF ⬍50% or FS ⬍28%
Unexplained conduction abnormalities (grade II or III AV blocks, complete LBBB, or
sinus nodal dysfunction)
Unexplained SD or stroke ⬍50 years old
Segmental wall-motion abnormalities in ⬎1 segment, or 1 if not previously
present, in the absence of ischemic heart disease
LV indicates left ventricular; FS, fractional shortening; EF, ejection fraction; LVEDD, LV end-diastolic diameter; SV, supraventricular; AF, atrial fibrillation; AV,
atrioventricular; LBBB, left bundle-branch block; and SD, sudden death.
When clinically indicated, additional studies were performed, including right and left heart catheterization, ventriculography, coronary
angiography, endomyocardial biopsy, and neuromuscular evaluation.
Diagnostic Criteria of DCM and HCM
Criteria for the diagnosis of DCM were the presence of left
ventricular fractional shortening ⬍25% (⬎2SD) and/or an ejection
fraction ⬍45% (⬎2SD) and left ventricular end-diastolic diameter
⬎117% of the predicted value by the Henry formula, corrected for
age and body surface area.9 Exclusion criteria included any of the
following conditions: blood pressure ⬎160/110 mm Hg, obstruction
⬎50% of a major coronary artery branch, alcohol intake ⬎100 g/d,
persistent high-rate supraventricular arrhythmia, systemic diseases,
pericardial diseases, congenital heart diseases, cor pulmonale, and
myocarditis.
Familial DCM was defined by the presence of 2 or more affected
subjects in the same family with DCM meeting the published
criteria.9 Family members were classified as affected, unaffected, or
unknown on the base of major and minor criteria (Table 1). The
affected status was defined by the presence of 2 major criteria, 1
major criterion and 1 minor criterion, or 3 minor criteria. The
unknown status was defined by the presence of 1 or 2 minor criteria
and the unaffected status by the presence of a normal heart or the
determination of other causes of myocardial dysfunction.
HCM was diagnosed in the presence of unexplained left ventricular hypertrophy,10 excluding secondary causes of cardiac hypertrophy, such as hypertension and valvular disease. The diagnostic
criteria of HCM are summarized in Table 2. The affected status was
defined by the presence of 1 major criterion, 2 minor echocardio-
TABLE 2.
graphic criteria, or 1 minor echocardiographic criterion and 1
electrocardiographic criterion.
Molecular Genetic Screening
Blood samples were collected from 427 of 434 subjects for DNA
analysis. MYH6 was screened for mutations by denaturing highperformance liquid chromatography and sequence analysis.
In the families in which we found either a putative disease-causing
mutation or a polymorphism, all available relatives were screened for
mutations. Criteria for classifying variants as putative disease-causing
mutations11 included changes in predicted amino acid sequences,
segregation within the family (when available), conservation across
different species (http://www.ncbi.nlm.nih.gov/BLAST/), absence in a
control population of at least 150 healthy ethnically similar subjects, and
changes in protein secondary structure, with the use of GOR 412 and
NNPREDICT software.13 The control panels were screened by denaturing high-performance liquid chromatography, and profiles different
from the wild type were sequenced.
Results
Four putative disease-causing mutations were detected (Figures 1 and 2; Table 3) in 3 of 69 probands with DCM (4.3%)
and 1 of 21 probands with HCM (4.8%).
In exon 21, a P830L substitution was found in a sporadic
DCM case. The mutation affects a highly conserved residue
of the globular head of ␣MyHC and is predicted to alter the
secondary structure of the light-chain binding domain.3,12–14
Diagnostic Criteria of HCM
Major Criteria
Minor Criteria
Echocardiography
LV wall thickness ⱖ13 mm in the anterior septum or posterior wall
or ⱖ15 mm in the posterior septum or free wall.
Severe SAM (septal-leaflet contact)
LV wall thickness of 12 mm in the anterior septum or posterior wall or 14 mm
in the posterior septum or free wall
Moderate SAM (no leaflet-septal contact)
Redundant MV leaflets
Electrocardiography
LVH⫹repolarization changes
TWI in leads I and aVL (ⱖ3mm) (with QRS–T-wave axis difference
ⱖ30°), V3–V6 (ⱖ3 mm) or II and III and aVF (ⱖ5 mm)
Abnormal Q wave (⬎40 ms or ⬎25% R wave) in at least 2 leads
from II, III, aVF (in absence of LAFB, V1–V4; or I, aVL, V5–V6)
Complete BBB or (minor) interventricular conduction defect (in LV leads)
Minor repolarization changes in LV leads
Deep S wave in V2 (⬎25 mm)
Clinical features
None
Unexplained chest pain, dyspnea, or syncope
SAM indicates systolic anterior motion of the mitral valve; LVH, left ventricular hypertrophy; TWI, T-wave inversion; LAFB, left anterior fascicular block; and BBB,
bundle-branch block. See text and the footnote to Table 1 for explanation of other abbreviations.
56
Circulation
July 5, 2005
Figure 1. MYH6 mutations detected in 4
families with DCM and HCM. Top, Pedigrees of families. Filled symbols indicate
affected subjects; open symbols with “N”
(normal) indicate tested, unaffected subjects; open empty symbols indicate subjects without history of cardiomyopathy.
In genotyped individuals, ⫹ and ⫺ indicate presence of mutant allele and wildtype allele, respectively. Middle, Elution
profiles for subjects carrying wild type
(red) and mutation (blue). Bottom,
Sequence analysis showing heterozygous nucleotide substitution.
In exon 23, an A1004S substitution was found in a different
sporadic DCM case. The change leads to an alteration in
polarity: An alanine (hydrophobic/nonpolar) is replaced by a
serine (hydrophilic/polar) in a highly conserved region of the
rod domain. In exon 24, a glutamine (neutral) to histidine
(basic) substitution (Q1065H) was found in a family with
familial HCM. This mutation occurred in a highly conserved
residue of the rod domain and was absent in 2 unaffected
relatives. The A1004S and Q1065H mutations occurred in the
fourth (g) and second (e) position, respectively, of the heptad
repeat motif of the ␣-helical coiled-coil15 (Figure 2B). In
exon 31, a glutamic acid (acidic) to a lysine (basic) (E1457K)
Figure 2. A and B, Human ␣MyHC protein structure (Swiss-Prot P13533). Amino acid sequence, functional domains,3,14,15,24 –28 and
putative disease-causing mutations are shown. Gray shaded areas represent completely conserved sequences among human MyHC
proteins.3 Mutated residues are highlighted in red. NBP indicates nucleotide-binding protein. B, S2 and LMM domains with heptad
motif.15,25–28 ACD indicates assembly-competent domain.
Carniel et al
TABLE 3.
Mutation
TSSDC010
2489C3T
TSSDC017
57
Genotypes and Phenotypes of 4 Patients With a Putative Mutation of MYH6 and Their Relatives
Family
TSSDC021
3010G3T
4369G3A
DNHOCM00 3195G3C
Codon
P830L
A1004S
E1457K
Q1065H
Age at
Diagnosis,
y
NYHA*
LVEDD,
mm*
LVFS*
(%)
LVEF,
%*
MWT,
mm*
Arrhythmias
and Conduction
Outcome
(Age, y)
ID
Phenotype
DNA
Genotype
II:2
DCM
⫹/⫺
56
I
61
25
49
11
SVT, VF, LBBB,
1° AVB
CHF (75)
NS (53)
II:4
Unaffected
NA
43†
I
NA
NA
NA
NA
䡠䡠䡠
III:2
Unaffected
NA
17†
I
43
42
NA
7
䡠䡠䡠
NS (27)
II:2
DCM
⫹/⫺
51
I
73
25
34
11
䡠䡠䡠
CHF (59)
III:1
Unaffected
NA
16†
I
47
36
63
8
䡠䡠䡠
NS (24)
II:1
Unaffected
NA
47†
I
50
36
67
10
II:2
DCM
⫹/⫺
44
II
73
18
31
12
䡠䡠䡠
LBBB, 1° AVB,
PM
III:2
Unaffected
⫺/⫺
22†
I
46
39
60
9
䡠䡠䡠
III:1
Unaffected
NA
23†
I
50
40
63
9
II:2
HCM
⫹/⫺
27
III
54
9
18
23
䡠䡠䡠
NSVT, RBBB
䡠䡠䡠
III:1
Unaffected
⫺/⫺
22†
I
53
34
62
11
III:2
Unaffected
⫺/⫺
15†
I
47
38
81
9
NS (55)
CHF, heart
transplant
(57)
NS (24)
NS (31)
Refractory
CHF,
death (45)
NS (23)
NS (17)
䡠䡠䡠
ID indicates identification in pedigree; NYHA, New York Heart Association functional class; MWT, maximal wall thickness; ⫹/⫺, presence of the mutant allele; NA,
not available; ⫺/⫺, absence of the mutant allele; SVT, supraventricular tachycardia; VF, ventricular fibrillation; 1° AVB, first-degree atrioventricular block; PM,
pacemaker; NSVT, nonsustained ventricular tachycardia; RBBB, right bundle-branch block; CHF, congestive heart failure; and NS, no symptoms. Other abbreviations
are as defined in text and in the footnotes to Tables 1 and 2.
*At enrollment.
†Age at assessment.
substitution was found in a sporadic DCM case. This mutation is predicted12 to alter the ␣-helix of the rod domain,
changing the conformation of a 4 –amino acid region from an
organized ␣-helix to a random-coil pattern.12 All putative
mutations were absent in at least 300 normal control chromosomes (and absent in an overall number of ⬎500 chromosomes tested) and conserved across different species.
Mutations in lamin A/C, actin, ␤MyHC, troponin T,
desmin, ␦-sarcoglycan, and lamina-associated polypeptide-2
genes were excluded in the DCM MYH6 mutation carriers.
Mutations in the ␤MyHC, troponin T, and myosin-binding
protein C genes were excluded in the HCM Q1065H carrier.
In addition to the putative disease-associated mutations, 7
nonsynonymous single-nucleotide polymorphisms were identified: 6 new (G56R, I275N, A1130T, E1295Q, R1502Q, and
G1826N) and 1 (A1101V) already reported (http://www.
ncbi.nlm.nih.gov/entrez/query.fcgi?db⫽snp).16 Of these new
variants, G56R was present in 8 different families in the
studied population, with no segregation with the disease
within the families, and was found in 10 of 150 healthy
controls. A1130T and E1295Q were found in 3 and 2
different families, respectively, without cosegregation with
the disease. The polymorphisms I275N, R1502Q, and
G1826S were present in the same Italian DCM family in
healthy relatives of affected subjects. The reported variants
did not meet the criteria for consideration as a diseasecausing mutation and therefore, were classified as
polymorphisms.
Disease Characteristics
Both patients and controls were white. DCM mutation carriers had a late onset of the disease (mean age, 50⫾6 years),
mild symptoms, and mild to moderate left ventricular dysfunction (Table 3). All had slow progression of the disease
(follow-up, 8 to 19 years). The proband with HCM had an
early onset of the disease and evolution toward dilation and
dysfunction, with death due to refractory heart failure while
awaiting heart transplantation. The family history was significant for sudden death at the age of 47 years in the proband’s
affected mother. The proband’s offspring were clinically
unaffected and did not carry the mutation (Figure 1, Table 3).
Discussion
This study provides genetic evidence of putative MYH6
mutations in patients that are associated with a spectrum of
phenotypes ranging from ventricular hypertrophy to dilation
(Figure 1). At enrollment, DCM mutation carriers (4.3% of
DCM probands) had mild to moderate ventricular dysfunction at diagnosis and a slow progression of the disease.
The Q1065H mutation found in familial HCM was associated with a severe phenotype, characterized by early onset,
severe hypertrophy, and evolution toward myocardial dilation, severe dysfunction and death in the fifth decade due to
refractory heart failure in the proband, or sudden death in the
proband’s mother. Overall, the currently available data suggest that ␣MyHC may represent a rare cause of HCM,8 and
consequently, the small number of carriers limits genotypephenotype correlations.
58
Circulation
July 5, 2005
The MYH6 mutation previously reported in 1 HCM case8
and the 4 novel putative mutations identified in our study are
located in both the head and rod domains of ␣MyHC and
affect highly conserved residues of the protein (Figure 2).17–21
P830L occurs in a sharp bend (amino acids 829 to 832),
which connects a long ␣-helix region,3 the light-chain binding
site, with a short C-terminal ␣-helix.14 The proline-to-lysine
substitution could alter the binding of myosin light chain,
compromise the movement of the light chain on MyHC, and
interfere with force generation.
The E1457K missense mutation is predicted to alter the
structure of the rod domain, its assembly, and its interactions
with surrounding molecules. The A1004S and the Q1065H
mutations are expected to interrupt the heptad repeat motif of
the ␣-helical coiled-coil and alter the hydrogen bonds that
stabilize the structure of the rod domain.15
The evidence that ␣MyHC, characterized by higher
ATPase activity and faster contraction,22 is downregulated in
failing hearts5 supports the hypothesis that ␣MyHC is critical
for normal myocardial function. In human left ventricles,
␣MyHC mRNA represents 20% to 30% of the total MyHC
RNA. However, the abundance of ␣MyHC protein is low,
⬇7% of total MyHC in nonfailing hearts, decreasing to ⬍1%
in failing left ventricles.6 The relatively small amount of
␣MyHC protein present in nonfailing left ventricles has
called into question the physiological significance of MyHC
isoform changes in failing human ventricles.23 Interesting
observations come from studies of myocardial gene expression in patients with heart failure.24 –26 Lowes et al24 studied
53 subjects (45 with DCM, 8 normal controls) assigned to
treatment with ␤-blockers or placebo. Before treatment,
patients with DCM had downregulation of ␣MyHC mRNA
and upregulation of ␤MyHC mRNA expression compared
with controls. Responders to ␤-blocker therapy had a significant improvement in ejection fraction and functional capacity, as well as a significant increase in the amount of ␣MyHC
mRNA and a decrease in the level of ␤MyHC mRNA. The
authors concluded that ␤-blocker therapy could reverse a
pathological fetal gene program, leading to restoration of the
fast-contracting ␣MyHC fibers and to a consequent improvement of myocardial function. Interestingly, similar changes
were also observed in placebo-treated patients who improved
spontaneously. Ladenson et al26 reported the case of a patient
with DCM and hypothyroidism: Treatment with levothyroxine led to an improvement in the patient’s clinical and
echocardiographic parameters, associated with an 11-fold
increase in ␣MyHC mRNA level. Similar data were obtained
by Sabbah et al,27 who studied the effect of passive mechanical ventricular restraint with the Acorn cardiac support
device in a dog model of chronic heart failure. At baseline,
heart failure dogs had a decreased level of ␣MyHC mRNA
and an increased amount of ␤MyHC mRNA compared with
normal dogs. Therapy with the cardiac support device was
associated with improved contractility and normalization of
␣MyHC mRNA levels. Finally, recent data from a study in
rat myocardium28 demonstrated that even a small amount of
␣MyHC may have physiological or biological significance.
All of these studies support the hypothesis that decreased
expression of the fast-contracting ␣MyHC can cause a loss of
contractile function as observed in DCM.
In summary, we have provided genetic data suggesting that
MYH6 mutations may lead to a spectrum of dilated and
hypertrophic phenotypes, including myocardial hypertrophy
with evolution toward dilation and systolic dysfunction.
Functional studies are currently in progress to clarify the role
of MYH6 mutations, to determine the mechanisms by which
these mutations can lead to the development of a cardiomyopathy phenotype, and to exclude whether any of the mutations reported here are rare polymorphisms.
Familial Dilated Cardiomyopathy Registry
Research Group
University of Colorado Cardiovascular Institute: Brian D. Lowes,
MD; Human Medical Genetics Program: Katherine Gowan, MS;
Hospital and University of Trieste, Italy: Mauro Driussi, MD, Giulio
Scherl.
Acknowledgments
The authors are supported by grants from the NIH/NHLBI (1RO1
HL69071-01, 5K23 HL67915-02), the Muscular Dystrophy Association USA (PN0007056), and the American Heart Association
(0250271N). We thank the family members for their participation in
this study and Stanislav Miertus, PhD, for his critical reading and
suggestions.
References
1. Taylor MRG, Carniel E, Mestroni L. Familial dilated cardiomyopathy.
Orphanet Databases, 2003. Available at: http://www.orpha.net/data/
patho/GB/uk-FDCardiomyopathy.pdf. Accessed June 8, 2005.
2. Richard P, Charron P, Carrier L, Ledeuil C, Cheav T, Pichereau C,
Benaiche A, Isnard R, Dubourg O, Burban M, Gueffet JP, Millaire A,
Desnos M, Schwartz K, Hainque B, Komajda M; EUROGENE Heart
Failure Project. Hypertrophic cardiomyopathy: distribution of disease
genes, spectrum of mutations, and implications for a molecular diagnosis
strategy. Circulation. 2003;107:2227–2232.
3. Weiss A, Schiaffino S, Leinwand LA. Comparative sequence analysis of
the complete human sarcomeric myosin heavy chain family: implications
for functional diversity. J Mol Biol. 1999;290:61–75.
4. Nakao K, Minobe W, Roden R, Bristow MR, Leinwand LA. Myosin
heavy chain gene expression in human heart failure. J Clin Invest. 1997;
100:2362–2370.
5. Lowes BD, Minobe W, Abraham WT, Rizeq MN, Bohlmeyer TJ, Quaife
RA, Roden RL, Dutcher DL, Robertson AD, Voelkel NF, Badesch DB,
Groves BM, Gilbert EM, Bristow MR. Changes in gene expression in the
intact human heart: down-regulation of ␣-myosin heavy chain in hypertrophied, failing ventricular myocardium. J Clin Invest. 1997;100:
2315–2324.
6. Miyata S, Minobe W, Bristow MR, Leinwand LA. Myosin heavy chain
isoform expression in the failing and nonfailing human heart. Circ Res.
2000;86:386 –390.
7. Geisterfer-Lowrance AA, Christe M, Conner DA, Ingwall JS, Schoen FJ,
Seidman CE, Seidman JG. A mouse model of familial hypertrophic
cardiomyopathy. Science. 1996;272:731–734.
8. Niimura H, Patton KK, McKenna WJ, Soults J, Maron BJ, Seidman JG,
Seidman CE. Sarcomere protein gene mutations in hypertrophic cardiomyopathy of the elderly. Circulation. 2002;105:446 – 451.
9. Mestroni L, Maisch B, McKenna WJ, Schwartz K, Charron P, Rocco C,
Tesson F, Richter A, Wilke A, Komajda M. Guidelines for the study of
familial dilated cardiomyopathies. Eur Heart J. 1999;20:93–102.
10. Taylor MRG, Carniel E, Mestroni L. Familial hypertrophic cardiomyopathy: clinical features, melecular genetics and molecular genetic testing.
Exp Rev Mol Diagn. 2003;3:89 –103.
11. Strachan T, Read AP. Molecular pathology. In: Strachan T, Read AP.
Human Molecular Genetics 2, 2nd ed. New York, New York: Wiley-Liss;
1999:377–399.
12. Combet C, Blanchet C, Geourjon C. NPS@: Network Protein Sequence
Analysis. Trends Biol Sci. 2000;25:147–150.
Carniel et al
13. Kneller DG, Cohen FE, Langridge R. Improvements in protein secondary
structure prediction by an enhanced neural network. J Mol Biol. 1990;
214:171–182.
14. Rayment I, Rypniewski WR, Schmidt-Base K, Smith R, Tomchick DR,
Benning MM, Winkelmann DA, Wesenberg G, Holden HM. Threedimensional structure of myosin subfragment-1: a molecular motor.
Science. 1993;261:50 –58.
15. Blair E, Redwood C, de Jesus Oliveira M, Moolman-Smook JC, Brink P,
Corfield VA, Ostman-Smith I, Watkins H. Mutations of the light meromyosin domain of the ␤-myosin heavy chain rod in hypertrophic cardiomyopathy. Circ Res. 2002;90:263–269.
16. National Center for Biotechnology Information. Submission of SNPs to
dbSNP. Available at: http://www.ncbi.nlm.nih.gov/SNP/get_html.cgi?
whichHtml⫽how_to_submit. Accessed April 30, 2005.
17. Weiss A, Leinwand LA. The mammalian myosin heavy chain gene
family. Annu Rev Cell Dev Biol. 1996;12:417– 439.
18. McLachlan AD, Karn J. Periodic features in the amino acid sequence of
nematode myosin rod. J Mol Biol. 1983;164:605– 626.
19. Li Y, Brown JH, Reshetnikova L, Blazsek A, Farkas L, Nyitray L, Cohen
C. Visualization of an unstable coiled coil from the scallop myosin rod.
Nature. 2003;424:341–345.
20. Sohn RL, Vikstrom KL, Strauss M, Cohen C, Szent-Gyorgyi AG,
Leinwand LA. A 29 residue region of the sarcomeric myosin rod is
necessary for filament formation. J Mol Biol. 1997;266:317–330.
21. Cohen C, Parry DAD. A conserved C-terminal assembly region in
paramyosin and myosin rods. J Struct Biol. 1998;122:180 –187.
59
22. Swynghedauw B. Developmental and functional adaptation of contractile
proteins in cardiac and skeletal muscles. Physiol Rev. 1986;66:710 –730.
23. Reiser PJ, Portman MA, Ning XH, Schomisch Moravec C. Human
cardiac myosin heavy chain isoforms in fetal and failing adult atria and
ventricles. Am J Physiol Heart Circ Physiol. 2001;280:H1814 –H1820.
24. Lowes BD, Gilbert EM, Abraham WT, Minobe WA, Larrabee P,
Ferguson D, Wolfel EE, Lindenfeld J, Tsvetkova T, Robertson AD,
Quaife RA, Bristow MR. Myocardial gene expression in dilated cardiomyopathy treated with ␤-blocking agents. N Engl J Med. 2002;346:
1357–1365.
25. Yasumura Y, Takemura K, Sakamoto A, Kitakaze M, Miyatake K.
Changes in myocardial gene expression associated with ␤-blocker
therapy in patients with chronic heart failure. J Card Fail. 2003;9:
469 – 474.
26. Ladenson PW, Sherman SI, Baughman KL, Ray PE, Feldman AM.
Reversible alterations in myocardial gene expression in a young man with
dilated cardiomyopathy and hypothyroidism. Proc Natl Acad Sci U S A.
1992;89:5251–5255.
27. Sabbah HN, Sharov VG, Gupta RC, Mishra S, Rastogi S, Undrovinas AI,
Chaudhry PA, Todor A, Mishima T, Tanhehco EJ, Suzuki G. Reversal of
chronic molecular and cellular abnormalities due to heart failure by
passive mechanical ventricular containment. Circ Res. 2003;93:
1095–1101.
28. Herron TJ, McDonald KS. Small amounts of ␣-myosin heavy chain
isoform expression significantly increase power output of rat cardiac
myocyte fragments. Circ Res. 2002;90:1150 –1152.
Hypertension
Elevated Blood Pressure Linked to Primary
Hyperaldosteronism and Impaired Vasodilation in BK
Channel–Deficient Mice
Matthias Sausbier, PhD*; Claudia Arntz, PhD*; Iancu Bucurenciu, MD; Hong Zhao, MD, PhD;
Xiao-Bo Zhou, MD; Ulrike Sausbier, PhD; Susanne Feil, PhD; Simone Kamm; Kyrill Essin, PhD;
Claudia A. Sailer, PhD; Usamah Abdullah; Peter Krippeit-Drews, PhD; Robert Feil, PhD; Franz Hofmann, MD;
Hans-Günther Knaus, MD; Chris Kenyon, MD; Michael J. Shipston, PhD; Johan F. Storm, MD, PhD;
Winfried Neuhuber, MD; Michael Korth, MD; Rudolf Schubert, MD; Maik Gollasch, MD; Peter Ruth, PhD
Background—Abnormally elevated blood pressure is the most prevalent risk factor for cardiovascular disease. The
large-conductance, voltage- and Ca2⫹-dependent K⫹ (BK) channel has been proposed as an important effector in the
control of vascular tone by linking membrane depolarization and local increases in cytosolic Ca2⫹ to hyperpolarizing K⫹
outward currents. However, the BK channel may also affect blood pressure by regulating salt and fluid homeostasis,
particularly by adjusting the renin-angiotensin-aldosterone system.
Methods and Results—Here we report that deletion of the pore-forming BK channel ␣ subunit leads to a significant blood
pressure elevation resulting from hyperaldosteronism accompanied by decreased serum K⫹ levels as well as increased
vascular tone in small arteries. In smooth muscle from small arteries, deletion of the BK channel leads to a depolarized
membrane potential, a complete lack of membrane hyperpolarizing spontaneous K⫹ outward currents, and an attenuated
cGMP vasorelaxation associated with a reduced suppression of Ca2⫹ transients by cGMP. The high level of BK channel
expression observed in wild-type adrenal glomerulosa cells, together with unaltered serum renin activities and
corticotropin levels in mutant mice, suggests that the hyperaldosteronism results from abnormal adrenal cortical function
in BK⫺/⫺ mice.
Conclusions—These results identify previously unknown roles of BK channels in blood pressure regulation and raise the
possibility that BK channel dysfunction may underlie specific forms of hyperaldosteronism. (Circulation. 2005;112:6068.)
Key Words: blood pressure 䡲 ion channels 䡲 vasoconstriction 䡲 vasodilation 䡲 hyperaldosteronism
I
ncreased arterial tone is a hallmark of elevated blood
pressure. During hypertension, pressure-induced depolarization of vascular smooth muscle cells contributes to increased vascular tone by increasing Ca2⫹ influx through
voltage-dependent Ca2⫹ channels.1,2 In vitro evidence suggests that the unique large-conductance, voltage- and Ca2⫹activated K⫹ (BK) channel limits Ca2⫹ entry and thereby
arterial contraction by repolarizing smooth muscle cells and
closing voltage-dependent Ca2⫹ channels previously opened
by pressure or vasoconstrictors.3 BK channels also mediate
steady hyperpolarization and vasorelaxation as a result of
transient outward currents carried by BK channels spontaneously activated by local release of Ca2⫹ from intracellular
stores via ryanodine receptor channels.4 The vascular BK
channel consists of 4 ␣ subunits that form the ion-conducting
pore and 4 auxiliary ␤1 subunits. The ␤1 subunits, which are
restricted to smooth muscle, maintain the normal high voltage
and Ca2⫹ sensitivity of the pore-forming ␣ subunit.5 The role
Received August 4, 2004; revision received October 12, 2004; accepted October 25, 2004.
From Pharmakologie und Toxikologie, Pharmazeutisches Institut der Universität Tübingen, Tübingen, Germany (M.S., C.A., I.B., H.Z., U.S., U.A.,
P.K.-D., P.R.); Institut für Pharmakologie für Pharmazeuten, Universitätsklinikum Hamburg-Eppendorf, Hamburg-Eppendorf, Germany (X.Z., M.K.);
Institut für Pharmakologie und Toxikologie der Technischen Universität München, München, Germany (S.F., S.K., R.F., F.H.); Helios Franz-VolhardKlinik, Med Klinik für Nephrologie und Intensivmedizin, MDC für Molekulare Medizin, Humboldt Universität Berlin, Berlin, Germany (K.E., M.G.);
Institut für Biochemische Pharmakologie, Universität Innsbruck, Innsbruck, Austria (C.A.S., H.K.); Endocrinology Unit, School of Molecular and Clinical
Medicine, Molecular Medicine Centre, Western General Hospital, Edinburgh, Scotland (C.K.); Membrane Biology Group, Division of Biomedical
Science, University of Edinburgh, Edinburgh, Scotland (M.J.S.); Department of Physiology and Centre for Molecular Biology and Neuroscience,
University of Oslo, Oslo, Norway (J.F.S.); Anatomisches Institut, Universität Erlangen-Nürnberg, Erlangen-Nürnberg, Germany (W.N.); and Institut für
Physiologie der Universität Rostock, Rostock, Germany (R.S.).
*Drs Sausbier and Arntz contributed equally to this work.
The online-only Data Supplement can be found with this article at http://circ.ahajournals.org/cgi/content/full/01.CIR.0000156448.74296.FE/DC1.
Correspondence to Dr Peter Ruth, Pharmakologie und Toxikologie, Pharmazeutisches Institut der Universität Tübingen, Tübingen, Germany. E-mail
[email protected]
DOI: 10.1161/01.CIR.0000156448.74296.FE
60
Sausbier et al
of the BK channel auxiliary ␤1 subunit in blood pressure
regulation has been tested previously by deleting its gene in
mice. The resulting loss of this subunit impaired the coupling
between Ca2⫹ release and the activation of hyperpolarizing
BK currents, leading to systemic hypertension.6,7 Recent
studies raise the possibility that changes in ␤1 subunit
expression contribute to the development of hypertension in
rat8 and that gain of function mutation in the same subunit
decreases the prevalence of diastolic hypertension in humans.9 However, even in the absence of functional ␤1
subunits, the ␣ subunit can still form functional channels,
which might be activated at physiological potentials if their
voltage and Ca2⫹ sensitivity are increased by other factors
such as endothelial factors10,11 and/or phosphorylation.12,13
Thus, functional BK channels may be operative in blood
vessels even when the ␤1 subunit is lacking. In addition, BK
channels in tissues other than vasculature, such as the adrenal
gland,14 may also influence blood pressure regulation. Therefore, we used mice lacking the BK channel ␣ subunit
(BK⫺/⫺15 to evaluate the global impact of BK channels on
blood pressure regulation.
Methods
Details are given in the online-only Data Supplement.
Mice
BK⫺/⫺ mice were generated as described.15 Wild type (WT) and
BK⫺/⫺ mice with the hybrid SV129/C57BL6 background (always F2
generation) were used. Either litter- or age-matched animals were
randomly assigned to the experimental procedures undertaken in
accordance with the German legislation on protection of animals.
Immunohistochemistry of Adrenal Gland
For immunofluorescence, on-slide 5-␮m cryostat slices from nonfixed WT and BK⫺/⫺ adrenal glands were incubated with antiBK␣(674 –1115). BK expression was analyzed with a confocal laserscanning microscope (Biorad MRC1000 attached to Nikon Diaphot
300 and equipped with a krypton-argon laser). For peroxidase/DAB
detection, 10-␮m cryosections of WT and BK⫺/⫺ adrenal glands were
perfused with 4% paraformaldehyde and incubated with antiBK␣(674 –1115). Data analysis was performed with a Zeiss Axioplan 2
microscope equipped with a Zeiss Axio Cam digital camera.
Determination of Renin Activity, Corticotropin,
and Cortisterone Levels From Serum
Plasma renin concentration was measured as the generation of
angiotensin I (ng/mL per hour) when plasma samples were incubated
with excess renin substrate (plasma with no intrinsic renin activity
from a binephrectomized rat). Angiotensin I was measured by
radioimmunoassay as previously described.16 For the determination
of corticotropin in plasma, we used a 2-site solid-phase immunoradiometric assay (IRMA) kit (Euria-acth IRMA kit) from Euro-Diagnostica AB. This assay measures intact corticotropin (1–39); in the
assay used, the limit of detection was 5 pg/mL and the intra-assay
variation ⬍5%. Serum corticosterone was analyzed with an in-house
specific radioimmunoassay, as described previously, and modified
for microtiter plate scintillation proximity assay.17
Serum Electrolytes and Serum Aldosterone Levels
Serum was separated from nonheparinized blood collected by heart
puncture from WT and BK⫺/⫺ mice euthanized by inhalation of
carbon dioxide. The serum concentrations of Na⫹ and K⫹ were
measured by flame photometry. Serum concentrations of aldosterone
were measured by radioimmunoassay.
BK Channel and Blood Pressure Regulation
61
Electrophysiology of Tibial Artery and Aortic
Smooth Muscle Cells
For cell isolation, tibial artery, a fourth-order branch of the aorta, or
aorta was incubated in Ca2⫹-free physiological saline solution (PSS)
containing papain at 37°C for 30 minutes. Then the solution was
exchanged for PSS containing Ca2⫹, collagenase type H, and
hyaluronidase, and digestion was continued for another 10 minutes at
37°C. For measuring of outward membrane currents (whole-cell
mode), the free Ca2⫹ concentration in the pipette solution was 300
nmol/L. The holding potential was ⫺50 mV (arterial cells) and ⫺20
mV (aortic cells), and test pulses of 300-ms duration were applied
every 5 seconds. For measuring membrane potentials (whole-cell
perforated patch), the pipette solution contained nystatin. For recording of macroscopic Ca2⫹ channel currents, cells were voltageclamped at a holding potential of ⫺60 mV, and the potential was
stepped, for 300 ms every 5 seconds, in 10-mV increments up to 50
mV. The inward current was measured as peak inward current with
reference to zero current.
Luminal Diameter Analysis of Small Arteries
by Videomicroscopy
Tibial small arteries were equilibrated in buffer, and an intravascular
pressure of 80 mm Hg was applied under nonflow conditions. The
chamber was continuously perfused at a rate of 2 mL/min with buffer
at 37.0⫾0.5°C. The small artery was allowed to equilibrate under
videomicroscopic recording until a stable myogenic tone spontaneously developed after 15 to 20 minutes. At the end of each
experiment, Ca2⫹-free buffer was applied to determine maximal
vessel diameters. No significant difference in maximal vessel diameter was detected between the 2 genotypes (WT, 69⫾3 ␮m; BK⫺/⫺,
63⫾2 ␮m). All compounds were administered to the adventitial side
of the pressurized small arteries. To exclude prostaglandin effects,
the buffer contained 1 ␮mol/L diclofenac.
[Ca2ⴙ]i Measurements in Aortic Smooth Muscle Cells
Single aortic smooth muscle cells (prepared as above) were loaded
with 2.5 ␮mol/L fura 2-AM. For [Ca2⫹]i measurement, cells were
transferred to a glass coverslip coated with 0.01% poly-L-lysine
solution and continuously superfused with PSS at 36°C at a flow rate
of 2 to 4 mL/min. [Ca2⫹]i measurements were performed with the use
of the dual-wavelength microfluorescence technique. Two [Ca2⫹]i
transients were elicited consecutively with a 15-minute interval in
between to allow refilling of intracellular Ca2⫹ stores.
Spontaneous Transient Outward Current and
Ca2ⴙ Spark Analysis
Cerebral arteries were placed in Ca2⫹-free Hanks’ solution supplemented with papain for 15 minutes at 36°C. The segments were then
placed in Hanks’ solution containing collagenase type F and H (ratio
30% and 70%, respectively) and 0.1 mmol/L CaCl2 for 6 minutes at
36°C. After several washes in Ca2⫹-free Hanks’ solution, single cells
were isolated. Spontaneous transient outward currents (STOCs) were
measured in the perforated patch mode. Holding potential was set at
⫺60 mV. The pipette solution contained 250 ␮g/mL amphotericin.
To measure Ca2⫹ sparks, cells were incubated with fluo 3-AM for 30
minutes at room temperature in Ca2⫹-free Hanks’ solution. Ca2⫹
sparks were measured as local fractional fluorescence increases
(F/F0) by confocal fluorescence microscopy at room temperature.
The baseline fluorescence (F0) was determined by averaging linescan images in the absence of Ca2⫹ sparks.
Long-Term Radiotelemetric Blood Pressure Analysis
Mean arterial blood pressure (MAP), heart rate (HR), and
physical activity were analyzed in conscious male WT and BK⫺/⫺
mice (n⫽7 for each genotype). Mice (aged 3 to 4 months), either
litter- or age-matched, did not significantly differ in body weight
(26.2⫾1.3 and 23.5⫾0.7 g, respectively). Mice were anesthetized
with isoflurane. A ventral midline incision was performed before
careful isolation of the left common carotid artery. For ligation
62
Circulation
July 5, 2005
Figure 1. Resting membrane potential
and current density of L-type Ca2⫹ current in tibial artery smooth muscle
cells. a, Current-voltage relationship of
K⫹ outward currents in cells from 3 WT
(blue circles) and 3 BK⫺/⫺ (red squares)
tibial arteries. Whole-cell currents were
measured at 300 nmol/L [Ca2⫹]i from a
holding potential of ⫺50mV without
(blue circles, red squares) and with 300
nmol/L iberiotoxin (respective data
points are covered by the red squares);
n⫽11 (WT) and n⫽15 (BK⫺/⫺) cells. b,
Membrane potential recordings from
WT and BK⫺/⫺ tibial artery cells with
and without iberiotoxin and
mean⫾SEM membrane potential statistics (13 and 18 cells from WT and
BK⫺/⫺ mice, respectively); *P⬍0.05. c,
Amplitudes of voltage-gated Ca2⫹
channel currents in WT and BK⫺/⫺ cells
do not differ. Currents were measured
in the whole-cell configuration, and
barium was used as charge carrier.
Inward currents were evoked by step
depolarizations (300-ms duration) of
increasing amplitude from a holding
potential of ⫺60 mV up to ⫹50 mV in
10-mV increments. Current-voltage
relationships of peak inward currents
are shown (n⫽11 from 3 WT and n⫽7
⫺/⫺
from 3 BK
mice). Mean⫾SEM current densities are plotted against the respective test potential. Inset, Averaged current tracings before (ctr) and after superfusion of a WT cell with 1 ␮mol/L nifedipine. Inward currents were activated by step depolarizations from ⫺60 to ⫹10 mV and maintained for 300 ms.
and retraction, 2 silk ligatures were passed under the vessel, one
⬇0.8 cm caudal to the bifurcation of the interior and exterior
carotid artery and another ⬇0.5 cm rostral from the caudal
ligature. A tiny incision in the carotid artery was made for
insertion of the catheter. The inserted catheter tip was advanced to
the thoracic aorta and fixed with suture. A subcutaneous pocket
was performed along the right flank for placing the transmitter
body. After subcutaneous fixation of the transmitter, the incision
was closed with 6-0 silk. MAP, HR, and physical activity were
recorded at days 5 to 7 after surgery, when mice have regained
normal locomotor activity. Radiotelemetric signals were sampled
for 1 minute at 5-minute intervals.
Results
Increased Myogenic Tone and Attenuated
cGMP-Dependent Vasorelaxation in
BKⴚ/ⴚ Small Arteries
In smooth muscle cells from the tibial artery of WT mice,
depolarization elicited large, iberiotoxin-sensitive outward
K⫹ currents, but no such currents were detected in cells from
BK⫺/⫺ cells (Figure 1a). Furthermore, BK⫺/⫺ cells did not
exhibit spontaneous hyperpolarizations and showed a more
depolarized mean membrane potential (⫺31.0⫾2.3 mV) than
WT cells (⫺41.0⫾3.9 mV). Depolarization was also observed in WT cells when BK channels were specifically
blocked by iberiotoxin (Figure 1b). The BK channel has
recently been found to be physically and functionally associated with the L-type Ca2⫹ channel.18 In the arterial cells,
however, the expression of nifedipine-sensitive L-type Ca2⫹
channels was not changed, as revealed by almost identical
current densities in BK⫺/⫺ and WT arterial cells, thereby
excluding a compensatory downregulation of this channel in
BK⫺/⫺ arteries (Figure 1c). It is conceivable that the sustained
depolarization of BK⫺/⫺ arterial cells compared with WT cells
could produce a sustained rise in cytosolic Ca2⫹ because of a
“window current” caused by incomplete inactivation of
L-type Ca2⫹ channels.19 Interestingly, the steady state calcium
window in smooth muscle cells was maximal at ⫺30 mV,19
which corresponds closely to the membrane potential in
BK⫺/⫺ cells.
Thus, the more depolarized membrane potential in BK⫺/⫺
cells may influence small-artery tone, which is obligatorily
dependent on pressure-evoked depolarization triggering Ca2⫹
entry through voltage-gated Ca2⫹ channels.20 In fact, at
physiological relevant pressures (80 and 120 mm Hg), tibial
arteries from BK⫺/⫺ mice showed increased myogenic tone
compared with arteries from WT mice (Figure 2a). However,
the myogenic response, ie, the change in myogenic tone
induced by pressure steps, was not significantly different in
BK⫺/⫺ versus WT tibial arteries (Figure 2b), suggesting that
BK channels do not determine the myogenic response per se.
Apparently, membrane depolarization and increases in global
[Ca2⫹]i plus local Ca2⫹ sparks in response to transmural
pressure are not sufficient to evoke a BK channel–mediated
negative feedback regulation of pressure-induced contraction.
Rather, BK channels seem to mediate essentially steady
dilatation over a large pressure range, inasmuch as their
deletion produced an almost parallel upward shift of the
pressure-tone relationship (Figure 2a).
It is well established that the myogenic tone can be
decreased by activation of the NO/cGMP/protein kinase G
Sausbier et al
63
Figure 2. Increased myogenic tone and
attenuated cGMP-dependent vasorelaxation in BK⫺/⫺ small arteries. a, Effect of
transmural pressure on myogenic tone in
tibial artery. Myogenic tone was calculated as (1⫺d/dmax), where d is the vessel
diameter at a certain pressure and dmax
the diameter in Ca2⫹-free buffer at that
pressure. b, Effect of pressure steps on
myogenic tone change (⌬myogenic tone,
ie, tone at end pressure minus tone at
initial pressure of the step); n⫽4 WT and
4 BK⫺/⫺ arteries. c, cGMP- and adenosine-induced relaxation of myogenic tone
of tibial artery. Relaxation was calculated
as drug-induced change of inner vessel
diameter as a percentage of maximal
diameter in Ca2⫹-free buffer; n⫽6 arteries
per genotype. All data are mean⫾SEM;
*P⬍0.05; **P⬍0.01.
(PKG) and cAMP/protein kinase A (PKA) pathways.21,22
Application of 8-pCPT-cGMP, a cell-permeable cGMP analogue that preferentially activates PKG, produced significantly less relaxation of BK⫺/⫺ arteries than WT arteries
(Figure 2c). In contrast, adenosine, which raises [cAMP]i via
A2 receptors,23 was equally potent in WT and BK⫺/⫺ arteries,
suggesting that the cGMP/PKG, but not the cAMP/PKA,
pathway requires BK channel activation to promote arterial
relaxation (Figure 2c). The partial relaxation produced by
8-pCPT-cGMP in BK⫺/⫺ arteries may involve other PKG
substrates or cross-activation of PKA at high agonist
concentrations.
Blood vessel relaxation by cGMP/PKG has been ascribed
to suppression of Ca2⫹ transients.24 To test this hypothesis,
aortic smooth muscle cells from WT and BK⫺/⫺ mice,
basically exhibiting the same differences in membrane potential as cells from tibial artery (Data Supplement Figure), were
stimulated with the ␣1-adrenergic receptor agonist phenylephrine, and the resulting Ca2⫹ transients (due to Ca2⫹ release and
influx via Ca2⫹ channels25) were measured in the absence of
8-Br-cGMP. The area under the curve (AUC) of the Ca2⫹
transients was almost identical in BK⫺/⫺ (n⫽76) and WT cells
(n⫽64) (2.1⫾0.1 and 2.2⫾0.2 arbitrary units, respectively).
Additionally, the ratio between consecutively elicited Ca2⫹
transients (AUC 2/AUC 1) was not significantly different in
BK⫺/⫺ and WT cells (87⫾8% and 103⫾7%, respectively)
(Figure 3). Preincubation with 8-Br-cGMP diminished the
second transients in WT cells to 38⫾7% of control, whereas
BK⫺/⫺ cells were less affected (72⫾11%). The attenuated
suppression in BK⫺/⫺ cells suggests that BK channel activation via cGMP/PKG is important for relaxation, probably
involving hyperpolarization-induced inhibition of voltagegated Ca2⫹ channels. The small residual cGMP-induced
suppression of Ca2⫹ transients in BK⫺/⫺ smooth muscle cells
may be caused by cGMP-mediated inhibition of Ca2⫹ release
from IP3-sensitive stores.26
The amount of Ca2⫹ in intracellular stores of aortic cells
was apparently not changed by the absence of the BK
channel. Caffeine at 10 mmol/L stimulated Ca2⫹ release from
the sarcoplasmic reticulum to a similar extent in BK⫺/⫺
(3.6⫾0.2 arbitrary units of AUC; n⫽108) and WT cells
(3.4⫾0.2; n⫽92).
Figure 3. Reduced suppression of Ca2⫹
transients by cGMP in BK⫺/⫺ aortic
smooth muscle cells. Left, Consecutive
[Ca2⫹]i transients (first and second transients are shown), elicited by phenylephrine (10 ␮mol/L for 1 minute, arrows) at
15-minute intervals, in WT (blue) and
BK⫺/⫺ (red) aortic cells, after preincubation with or without 8-Br-cGMP
(1 mmol/L, 5 minutes). Right, [Ca2⫹]i transients were quantified as AUC (40 to 63
cells per genotype). All data are
mean⫾SEM; *P⬍0.05; **P⬍0.01.
64
Circulation
July 5, 2005
Figure 4. Lack of STOCs but presence of normal Ca2⫹ sparks in BK⫺/⫺ cerebral artery smooth muscle cells. a, STOC activity in WT and
BK⫺/⫺ cerebral arterial cells recorded at increasing membrane potentials and STOC frequency at ⫺20 mV from 5 to 7 WT and BK⫺/⫺
cells. b, Confocal line scans of fluo 3–loaded WT and BK⫺/⫺ cells and time course of corresponding Ca2⫹ sparks. Spark amplitudes
were measured as local fractional fluorescence increases (F/F0; F0 is baseline). Spark duration was measured at half-maximal amplitude; n⫽5 to 12 cells per genotype. All data are mean⫾SEM; *P⬍0.05; **P⬍0.01.
Lack of STOCs in BKⴚ/ⴚ Arterial Cells Did Not
Affect Ca2ⴙ Sparks
Transient activation of outward hyperpolarizing currents
(STOCs), carried by BK channels, has been proposed as a
mechanism for the paradoxical Ca2⫹ spark–mediated relaxation of small arteries.27 Furthermore, STOCs have been
proposed to provide a negative feedback mechanism to
control Ca2⫹ spark dynamics through regulation of voltagedependent calcium entry and resultant changes in sarcoplasmic reticulum Ca2⫹ loading and ryanodine receptor sensitization. We examined STOCs and Ca2⫹ spark activity in BK⫺/⫺
cells. As expected, STOCs were completely absent in BK⫺/⫺
cerebral arterial cells, even at depolarized membrane potentials that promote Ca2⫹ influx via voltage-gated Ca2⫹ channels
(Figure 4a), implicating that STOCs are carried by BK
channels. However, Ca2⫹ spark parameters were not affected
in BK⫺/⫺ cells, arguing against a feedback between STOCs
and Ca2⫹ sparks via Ca2⫹ entry (Figure 4b). In summary, 2
mechanisms important for determining vascular tone were
absent in BK⫺/⫺ small arteries: (1) BK channel activity as a
major effector of cGMP/PKG-mediated relaxation and (2) the
steady hyperpolarizing effect in response to Ca2⫹ sparks.
Hence, pathophysiological consequences for systemic blood
pressure were expected in BK⫺/⫺ mice.
Elevated Blood Pressure and Hyperaldosteronism
in BKⴚ/ⴚ Mice
MAP in the carotid artery, HR, and locomotor activity were
measured by radiotelemetry in male mice. BK⫺/⫺ mice were
Sausbier et al
Figure 5. Elevated arterial blood pressure in BK⫺/⫺ mice. a,
Locomotor activity recorded by radiotelemetry for 24 hours at
days 5, 6, and 7 after surgery. Bar indicates period of MAP and
HR measurement shown below; open bar indicates dark phase.
b, Mean values of MAP, HR, and activity from telemetric blood
pressure analysis are calculated hour by hour between 12 AM
and 6 PM, the period when WT and BK⫺/⫺ mice exhibited comparable locomotor activity; n⫽7 per genotype. c, Correlations
between locomotor activity and MAP. Linear regression lines
were y⫽4.56x⫹97.5 (R2⫽0.85) (WT) and y⫽4.44x⫹103.6
(R2⫽0.69) (BK⫺/⫺). d, Absence of cardiac hypertrophy in BK⫺/⫺
mice. Statistics of heart weight (Hw)/body weight (Bw) (mg/g)
from 10 to 11 mice per genotype are shown. All data are
mean⫾SEM; *P⬍0.05; **P⬍0.01.
significantly less active during the dark phase as a result of
motor impairment15 (Figure 5a). Because physical activity
affects MAP, we measured it during an interval (12 AM to 6
PM) when the 2 genotypes showed similar activity (Figure 5a,
5b). The BK⫺/⫺ mice showed a significantly (5.4 mm Hg)
higher MAP than WT mice (Figure 5b). Additionally, diastolic and systolic blood pressures were significantly elevated
in the mutants, whereas HR did not differ. This excludes the
possibility that higher sympathetic tone and HR caused MAP
elevation. Analysis of the MAP of BK⫺/⫺ and WT mice as a
function of locomotor activity suggested that for any activity
the MAP was shifted upward by 6.1 mm Hg in the mutants
(Figure 5c). However, BK⫺/⫺ mice did not show high-range
65
locomotor activity because of their ataxia.15 In contrast to
BK␤1 knockouts,6,7 the increase in blood pressure in BK⫺/⫺
mice was not accompanied by significant cardiac hypertrophy
in 4- to 6-month-old animals, as indicated by heart/body
weight ratio (WT, 4.6⫾0.2 mg/g; BK⫺/⫺, 4.8⫾0.1 mg/g)
(Figure 5d). Nevertheless, the elevated MAP observed under
resting conditions in BK⫺/⫺ mice exhibiting HRs similar to
those of WT mice supports the hypothesis that vascular BK
channels may be important for the control of vascular tone
and systemic blood pressure in vivo, mainly because of their
effector role for both cGMP signaling and Ca2⫹ sparks.
However, blood pressure regulation also involves essential
endocrine mechanisms such as the renin-angiotensin-aldosterone system, which might also be affected by BK channels.28
Analysis of the serum electrolytes revealed a genderindependent decrease in the K⫹ concentration ([K⫹]serum) in
mutants compared with WT (male WT 8.3⫾0.3 mmol/L
versus male BK ⫺/⫺ 6.5⫾0.8 mmol/L; female WT
9.2⫾0.2 mmol/L versus female BK⫺/⫺ 7.5⫾0.4 mmol/L). In
general, [K⫹]serum values of WT mice were in agreement with
previously published [K⫹]serum values of mice with a genetic
background similar to the BK⫺/⫺ mice.29 However, [Na⫹]serum
did not differ between the 2 genotypes (male WT
140⫾4 mmol/L versus male BK⫺/⫺ 137⫾2 mmol/L; female
WT 137⫾2 mmol/L versus female BK⫺/⫺ 141⫾2 mmol/L)
(Figure 6a). The lower [K⫹]serum of BK⫺/⫺ mice was associated
with markedly increased serum aldosterone levels in both
genders (male WT 185⫾24 pg/mL versus male BK⫺/⫺
573⫾108 pg/mL; female WT 236⫾33 pg/mL versus female
BK⫺/⫺ 597⫾132 pg/mL) (Figure 6b). Consistent with this
phenotype, we found high levels of BK channel ␣ subunit
expression in the zona glomerulosa (Figure 6c). Here, these
channels may control aldosterone production and/or release
by influencing the membrane potential and hence the open
probability of voltage-gated Ca2⫹ channels (L- and/or T-type)
via the membrane potential.30,31 In contrast to glomerulosa
cells, cortisol-synthesizing cells from zona fasciculata were
very weakly stained with the BK channel antibody (Figure
6c). In agreement herewith is the finding that corticosterone
levels in the serum were not altered between WT and BK⫺/⫺
mice (Figure 6d). A potential causative role of the renin/angiotensin system and/or the pituitary for the observed increase in aldosterone was also considered. The determination
of serum corticotropin and serum renin activity, however,
revealed no significant changes of these 2 parameters between both genotypes, suggesting that the hyperaldosteronism found in BK⫺/⫺ mice was of a primary nature. Thus,
elevation of blood pressure in BK⫺/⫺ mice may be attributed
to both vascular and hormonal dysfunctions.
Discussion
The deletion of the BK channel ␣ subunit permitted the
identification of physiological functions of this unique channel in regulating arterial blood pressure. BK⫺/⫺ mice exhibit
a moderate increase in blood pressure that was traced back to
vascular and endocrine abnormalities. Our data indicate that
the vascular abnormalities arise from lack of spontaneous
outward currents that contribute to the mean resting membrane potentials in small and large vessels (Figure 1b; Data
66
Circulation
July 5, 2005
Figure 6. Primary hyperaldosteronism in BK⫺/⫺ mice and BK channel expression in adrenal glomerulosa cells. a, Statistics of serum electrolyte concentrations from 6 to 9 male (M) and female (F) mice per genotype (WT, blue; BK⫺/⫺, red). b, Statistical analysis of serum aldosterone
from 6 to 9 mice per genotype and gender. c, Left, Immunohistochemical detection of BK channels in the adrenal gland by peroxidase/DAB
staining. Prominent staining is found in the zona glomerulosa (G), very weak staining in the zona fasciculata (F) and reticularis (R), and intermediate staining in the adrenal medulla (M). Sections from BK⫺/⫺ adrenal were not stained under identical conditions. Right, Confocal single
optical section demonstrates specific BK immunofluorescence on the surface (dashed line) of zona glomerulosa cells (arrows) of adrenal cortex (bar⫽100 ␮m). BK⫺/⫺ sections showed no staining (not shown). d, Statistical analysis of serum renin activity, corticosterone, and corticotropin (ACTH) levels from 8 to 16 mice per genotype. All data are mean⫾SEM; *P⬍0.05; **P⬍0.01.
Supplement Figure, panel b). Thus, the lack of BK channels
may account for the observed membrane depolarization
(Figure 1b), which will tend to increase myogenic tone, ie,
vessel tone in response to intravascular pressure (Bayliss
effect; Figure 2). The pathophysiology of an increased
vascular tone in BK⫺/⫺ mice apparently includes several
mechanisms. First, we found that relaxation of myogenic tone
by cGMP is impaired in BK⫺/⫺ vessels. This finding indicates
that the vascular BK channel is an important effector of the
cGMP/cGMP kinase pathway. Previous studies, in which
several mouse models with genetic ablations were used, have
shown that this pathway contributes to basal blood pressure
regulation.24,32,33 By contrast, cAMP-mediated relaxation of
small arteries involves effectors other than the BK channel,
although cAMP kinase has also been shown to control BK
channel activity in vascular smooth muscle cells.34
Second, BK channel deficiency abolished the transient
outward K⫹ currents that are induced by local Ca2⫹ release
from internal stores or, alternatively, by Ca2⫹ influx through
T-type Ca2⫹ channels, a mechanism that recently was pro-
Sausbier et al
posed to operate in coronary vessels.35 Regardless of the Ca2⫹
source, the lack of transient K⫹ currents should increase the
open probability of voltage-gated Ca2⫹ channels, thus contributing to vasoconstriction of small arteries. In such arteries,
myogenic tone in response to intravascular pressure was
absent when L-type Ca2⫹ channels of the Cav1.2 type were
inactivated specifically in smooth muscle.36 This suggests
that the increased myogenic tone in BK⫺/⫺ arteries is mediated by enhanced Ca2⫹ influx through Cav1.2 channels,
presumably because of the less negative membrane potential
of arterial muscle cells and an attendant increase of the
Cav1.2 “window current.”19 The subsequent increase of
global [Ca2⫹]i, however, seems to be insufficient for stimulating the frequency or intensity of Ca2⫹ sparks evoked from
intracellular stores (Figure 4b). Apart from these vascular
dysfunctions, we found a marked hyperaldosteronism that
probably contributes to the blood pressure elevation in BK⫺/⫺
mice. Aldosterone, via the mineralocorticoid receptor, is the
major regulator of ENaC expression and activity in the
cortical collecting duct, thereby providing renal Na⫹ reabsorption, which also necessitates increased water reabsorption
to maintain Na⫹ concentration at or near 140 mmol/L. Several
rare forms of inherited hypertension are based on monogenetic defects associated with increased mineralocorticoid
synthesis or dysfunctional aldosterone signaling (for a review, see Lifton et al37). We also found that BK channel
protein is localized in the cortices of adrenal glands and is
highest in zona glomerulosa cells therein. However, the
physiological contribution of BK channels to aldosterone
secretion from this cell layer is controversial.28,38 Both T-type
and L-type voltage-dependent Ca2⫹ channels are expressed in
glomerulosa cells and have been implicated in steroidogenesis and aldosterone secretion.30,31,39,40 Interestingly, both
types have been described to be functionally associated with
BK channels in other cell types.18,35 Thus, loss of control of
Ca2⫹ influx through Ca2⫹ channels in glomerulosa cells may
be a plausible mechanism for the observed hyperaldosteronism in BK⫺/⫺ mice. In support of this idea is the finding that
neither the renin/angiotensin pathway nor pituitary hormones
seem to evoke the hyperaldosteronism.
Considering that the BK⫺/⫺ mice showed several synergistic mechanisms that all tend to increase blood pressure, it
seems surprising that their blood pressure elevation was not
more severe. The relative mildness of their blood pressure
elevation was confirmed by the absence of significant cardiac
hypertrophy in 4- to 6-month-old mutants (Figure 5d). We
hypothesize that other peripheral or central regulators that are
able to dampen blood pressure may be more active in BK⫺/⫺
than in WT mice. This idea is supported by the finding that
deletion of the less widespread regulatory BK channel ␤1
subunit caused a more severe blood pressure elevation6,7 (and
consequently also significant cardiac hypertrophy in mutant
mice6) than the deletion of the BK␣ subunit in the present
study. The predominant expression of the BK␤1 subunit in
smooth muscle5 suggests that BK␤1⫺/⫺ mice rather than
BK␣⫺/⫺ mice represent the more selective “vascular” BK
channel deletion, although lack of the BK␤1 subunit leaves
intact ␣ subunits that can be still activated at physiological
voltages by high local Ca2⫹, cGMP/cGMP kinase, and addi-
67
tional pathways. Presumably, a selective deletion of only the
vascular BK␣ subunit would produce an even more severe
blood pressure elevation than BK␤1⫺/⫺ deletion. However, in
terms of revealing the basis of genetically anchored diseases
and identifying susceptibility genes contributing to hypertension, the condition of a naturally occurring loss of function
mutation of the BK␣ gene is best reflected by the general BK
channel knockout as presented here.
In conclusion, the results of this study indicate that the
systemic blood pressure phenotype of complete BK channel
deletion is relatively mild—milder than expected—at least
under resting conditions. We hypothesize that the renovascular role of the BK channel, which often acts as an “emergency
brake”,41,42 may become more evident when studying microvasculature function and organ perfusions in BK⫺/⫺ animals
that are challenged with pathophysiological conditions such
as ischemia.
Acknowledgments
We thank Dan-Yang Huang and Dr Volker Vallon for assisting us in
flame photometry analysis, Isolde Breuning and Janina Smykowsky
for excellent technical assistance, and Deutsche Forschungsgemeinschaft, Fonds zur Förderung der Wissenschaftlichen Forschung, The
Wellcome Trust, Research Council of Norway, Thyssen-Stiftung and
Schilling Foundation for financial support.
References
1. Harder DR, Smeda J, Lombard J. Enhanced myogenic depolarization in
hypertensive cerebral arterial muscle. Circ Res. 1985;57:319 –322.
2. Wellman GC, Cartin L, Eckman DM, Stevenson AS, Saundry CM,
Lederer WJ, Nelson MT. Membrane depolarization, elevated Ca(2⫹)
entry, and gene expression in cerebral arteries of hypertensive rats.
Am J Physiol. 2001;281:H2559 –H2567.
3. Brayden JE, Nelson MT. Regulation of arterial tone by activation of
calcium-dependent potassium channels. Science. 1992;256:532–535.
4. Nelson MT, Cheng H, Rubart M, Santana LF, Bonev AD, Knot HJ,
Lederer WJ. Relaxation of arterial smooth muscle by calcium sparks.
Science. 1995;270:633– 637.
5. Wallner M, Meera P, Ottolia M, Kaczorowski GJ, Latorre R, Garcia ML,
Stefani E, Toro L. Characterization of and modulation by a beta-subunit
of a human maxi KCa channel cloned from myometrium. Receptors
Channels. 1995;3:185–199.
6. Brenner R, Perez GJ, Bonev AD, Eckman DM, Kosek JC, Wiler SW,
Patterson AJ, Nelson MT, Aldrich RW. Vasoregulation by the beta1
subunit of the calcium-activated potassium channel. Nature. 2000;407:
870 – 876.
7. Plüger S, Faulhaber J, Fürstenau M, Löhn M, Waldschütz R, Gollasch M,
Haller H, Luft FC, Ehmke H, Pongs O. Mice with disrupted BK channel
beta1 subunit gene feature abnormal Ca(2⫹) spark/STOC coupling and
elevated blood pressure. Circ Res. 2000;87:E53–E60.
8. Amberg GC, Santana LF. Downregulation of the BK channel beta1
subunit in genetic hypertension. Circ Res. 2003;93:965–971.
9. Fernández-Fernández JM, Tomás M, Vazquez E, Orio P, Latorre R, Sentí
M, Marrugat J, Valverde MA. Gain-of-function mutation in the
KCNMB1 potassium channel subunit is associated with low prevalence
of diastolic hypertension. J Clin Invest. 2004;113:1032–1039.
10. Fisslthaler B, Popp R, Kiss L, Potente M, Harder DR, Fleming I, Busse
R. Cytochrome P450 2C is an EDHF synthase in coronary arteries.
Nature. 1999;401:493– 497.
11. Archer SL, Gragasin FS, Wu X, Wang S, McMurtry S, Kim DH, Platonov
M, Koshal A, Hashimoto K, Campbell WB, Falck JR, Michelakis ED.
Endothelium-derived hyperpolarizing factor in human internal mammary
artery is 11,12-epoxyeicosatrienoic acid and causes relaxation by activating smooth muscle BK(Ca) channels. Circulation. 2003;107:769 –776.
12. Han G, Kryman JP, McMillin PJ, White RE, Carrier GO. A novel
transduction mechanism mediating dopamine-induced vascular relaxation: opening of BKCa channels by cyclic AMP-induced stimulation of
the cyclic GMP-dependent protein kinase. J Cardiovasc Pharmacol.
1999;34:619 – 627.
68
Circulation
July 5, 2005
13. Zhou XB, Arntz C, Kamm S, Motejlek K, Sausbier U, Wang GX, Ruth
P, Korth M. A molecular switch for specific stimulation of the BKCa
channel by cGMP and cAMP kinase. J Biol Chem. 2001;276:
43239 – 43245.
14. Payet MD, Bilodeau L, Drolet P, Ibarrondo J, Guillon G, Gallo-Payet N.
Modulation of a Ca(2⫹)-activated K⫹ channel by angiotensin II in rat
adrenal glomerulosa cells: involvement of a G protein. Mol Endocrinol.
1995;9:935–947.
15. Sausbier M, Hu H, Arntz C, Feil S, Kamm S, Adelsberger H, Sausbier U,
Sailer CA, Feil R, Hofmann F, Korth M, Shipston MJ, Knaus HG, Wolfer
DP, Pedroarena CM, Storm JF, Ruth P. Cerebellar ataxia and Purkinje
cell dysfunction caused by Ca2⫹-activated K⫹ channel deficiency. Proc
Natl Acad Sci U S A. 2004;101:9474 –9478.
16. Millar JA, Leckie BJ, Morton JJ, Jordan J, Tree M. A microassay for
active and total renin concentration in human plasma based on antibody
trapping. Clin Chim Acta. 1980;101:5–15.
17. MacPhee IA, Antoni FA, Mason DW. Spontaneous recovery of rats from
experimental allergic encephalomyelitis is dependent on regulation of the
immune system by endogenous adrenal corticosteroids. J Exp Med. 1989;
169:431– 445.
18. Liu G, Shi J, Yang L, Cao L, Park SM, Cui J, Marx SO. Assembly of a
Ca(2⫹)-dependent BK channel signaling complex by binding to beta2
adrenergic receptor. EMBO J. 2004;23:2196 –2205.
19. Fleischmann BK, Murray RK, Kotlikoff MI. Voltage window for sustained elevation of cytosolic calcium in smooth muscle cells. Proc Natl
Acad Sci U S A. 1994;91:11914 –11918.
20. Schubert R, Mulvany MJ. The myogenic response: established facts and
attractive hypotheses. Clin Sci (Lond). 1999;96:313–326.
21. Schubert R, Serebryakov VN, Mewes H, Hopp HH. Iloprost dilates rat
small arteries: role of K(ATP)- and K(Ca)-channel activation by cAMPdependent protein kinase Am J Physiol. 1997;272:H1147–H1156.
22. Sausbier M, Schubert R, Voigt V, Hirneiss C, Pfeifer A, Korth M,
Kleppisch T, Ruth P, Hofmann F. Mechanisms of NO/cGMP-dependent
vasorelaxation. Circ Res. 2000;87:825– 830.
23. Kleppisch T, Nelson MT. Adenosine activates ATP-sensitive potassium
channels in arterial myocytes via A2 receptors and cAMP-dependent
protein kinase. Proc Natl Acad Sci U S A. 1995;92:12441–12445.
24. Pfeifer A, Klatt P, Massberg S, Ny L, Sausbier M, Hirneiss C, Wang GX,
Korth M, Aszodi A, Andersson KE, Krombach F, Mayerhofer A, Ruth P,
Fassler R, Hofmann F. Defective smooth muscle regulation in cGMP
kinase I-deficient mice. EMBO J. 1998;17:3045–3051.
25. Furutani H, Zhang XF, Iwamuro Y, Lee K, Okamoto Y, Takikawa O,
Fukao M, Masaki T, Miwa S. Ca2⫹ entry channels involved in contractions of rat aorta induced by endothelin-1, noradrenaline, and vasopressin. J Cardiovasc Pharmacol. 2002;40:265–276.
26. Schlossmann J, Ammendola A, Ashman K, Zong X, Huber A, Neubauer
G, Wang GX, Allescher HD, Korth M, Wilm M, Hofmann F, Ruth P.
Regulation of intracellular calcium by a signalling complex of IRAG, IP3
receptor and cGMP kinase Ibeta. Nature. 2000;404:197–201.
27. Jaggar JH, Porter VA, Lederer WJ, Nelson MT. Calcium sparks in
smooth muscle. Am J Physiol. 2000;278:C235–C256.
28. Ganz MB, Nee JJ, Isales CM, Barrett PQ. Atrial natriuretic peptide
enhances activity of potassium conductance in adrenal glomerulosa cells.
Am J Physiol. 1994;266:C1357–C1365.
29. McDonald FJ, Yang B, Hrstka RF, Drummond HA, Tarr DE, McCray PB
Jr, Stokes JB, Welsh MJ, Williamson RA. Disruption of the beta subunit
of the epithelial Na⫹ channel in mice: hyperkalemia and neonatal death
associated with a pseudohypoaldosteronism phenotype. Proc Natl Acad
Sci U S A. 1999;96:1727–1731.
30. Hausdorff WP, Catt KJ. Activation of dihydropyridine-sensitive calcium
channels and biphasic cytosolic calcium responses by angiotensin II in rat
adrenal glomerulosa cells. Endocrinology. 1988;123:2818 –2826.
31. Lotshaw DP. Role of membrane depolarization and T-type Ca2⫹
channels in angiotensin II and K⫹ stimulated aldosterone secretion. Mol
Cell Endocrinol. 2001;175:157–171.
32. Huang PL, Huang Z, Mashimo H, Bloch KD, Moskowitz MA, Bevan JA,
Fishman MC. Hypertension in mice lacking the gene for endothelial nitric
oxide synthase. Nature. 1995;377:239 –242.
33. Lopez MJ, Wong SK, Kishimoto I, Dubois S, Mach V, Friesen J, Garbers
DL, Beuve A. Salt-resistant hypertension in mice lacking the guanylyl
cyclase-A receptor for atrial natriuretic peptide. Nature. 1995;378:65– 68.
34. Barman SA, Zhu S, White RE. Protein kinase C inhibits BKCa channel
activity in pulmonary arterial smooth muscle. Am J Physiol. 2004;286:
L149 –L155.
35. Chen CC, Lamping KG, Nuno DW, Barresi R, Prouty SJ, Lavoie JL,
Cribbs LL, England SK, Sigmund CD, Weiss RM, Williamson RA, Hill
JA, Campbell KP. Abnormal coronary function in mice deficient in
alpha1H T-type Ca2⫹ channels. Science. 2003;302:1416 –1418.
36. Moosmang S, Schulla V, Welling A, Feil R, Feil S, Wegener JW,
Hofmann F, Klugbauer N. Dominant role of smooth muscle L-type
calcium channel Cav1.2 for blood pressure regulation. EMBO J. 2003;
22:6027– 6034.
37. Lifton RP, Gharavi AG, Geller DS. Molecular mechanisms of human
hypertension. Cell. 2001;104:545–556.
38. Lotshaw DP. Effects of K⫹ channel blockers on K⫹ channels, membrane
potential, and aldosterone secretion in rat adrenal zona glomerulosa cells.
Endocrinology. 1997;138:4167– 4175.
39. Rossier MF, Python CP, Capponi AM, Schlegel W, Kwan CY, Vallotton
MB. Blocking T-type calcium channels with tetrandrine inhibits steroidogenesis in bovine adrenal glomerulosa cells. Endocrinology. 1993;132:
1035–1043.
40. Spat A, Hunyady L. Control of aldosterone secretion: a model for convergence in cellular signaling pathways. Physiol Rev. 2004;84:489 –539.
41. Gribkoff VK, Starrett JE, Dworetzky SI. Maxi-K potassium channels:
form, function, and modulation of a class of endogenous regulators of
intracellular calcium. Neuroscientist. 2001;7:166 –177.
42. Hu H, Shao LR, Gu N, Chavoshy S, Tieb M, Behrens R, Laake P, Pongs
O, Knaus HG, Ottersen OP, Storm JF. Presynaptic Ca2⫹-activated K⫹
channels in glutamatergic hippocampal terminals and their role in spike
repolarization and regulation of transmitter release. J Neurosci. 2001;21:
9585–9597.
Imaging
Risk of Embolism and Death in Infective Endocarditis:
Prognostic Value of Echocardiography
A Prospective Multicenter Study
Franck Thuny, MD; Giovanni Disalvo, MD; Olivier Belliard, MD; Jean-François Avierinos, MD;
Valeria Pergola, MD; Valerie Rosenberg, MD; Jean-Paul Casalta, MD; Joanny Gouvernet, MD, PhD;
Geneviève Derumeaux, MD; Diana Iarussi, MD; Pierre Ambrosi, MD; Raffaello Calabro, MD;
Alberto Riberi, MD; Frédéric Collart, MD; Dominique Metras, MD; Hubert Lepidi, MD;
Didier Raoult, MD, PhD; Jean-Robert Harle, MD; Pierre-Jean Weiller, MD;
Ariel Cohen, MD; Gilbert Habib, MD
Background—The incidence of embolic events (EE) and death is still high in patients with infective endocarditis (IE), and
data about predictors of these 2 major complications are conflicting. Moreover, the exact role of echocardiography in
risk stratification is not well defined.
Methods and Results—In a multicenter prospective European study, including 384 consecutive patients (aged 57⫾17
years) with definite IE according to Duke University criteria, we tested clinical, microbiological, and echocardiographic
data as potential predictors of EE and 1-year mortality. Transesophageal echocardiography was performed in all patients.
Embolism occurred before or after IE diagnosis (total-EE) in 131 patients (34.1%) and after initiation of antibiotic
therapy (new-EE) in 28 patients (7.3%). Staphylococcus aureus and Streptococcus bovis were independently associated
with total-EE, whereas vegetation length ⬎10 mm and severe vegetation mobility were predictors of new-EE, even after
adjustment for S aureus and S bovis. One-year mortality was 20.6%. In multivariable analysis, independently of the other
predictors of death (age, female sex, creatinine serum ⬎2 mg/L, moderate or severe congestive heart failure, and S
aureus) and comorbidity, vegetation length ⬎15 mm was a predictor of 1-year mortality (adjusted relative risk⫽1.8;
95% CI, 1.10 to 2.82; P⫽0.02).
Conclusions—In IE, vegetation length is a strong predictor of new-EE and mortality. In combination with clinical and
microbiological findings, echocardiography may identify high-risk patients who will need a more aggressive therapeutic
strategy. (Circulation. 2005;112:69-75.)
Key Words: echocardiography 䡲 embolism 䡲 endocardium 䡲 prognosis
D
some authors reported an increased risk of EE and/or mortality in patients with large and mobile vegetation,9,10,13,17–19
others did not find such a correlation.8,11,14 –16,20 Several
reasons may explain such conflicting results, including the
changing pattern of the disease over time,4,21 the retrospective
design of some studies,5,7–9,11–16,21 the small number of
patients,8 –11 the heterogeneous definition of IE,8 –12,18 the
underutilization of transesophageal echocardiography (TEE),8,9,12,16
which enhances sensitivity of vegetation detection,2 and the
inclusion of EE occurring before echocardiography instead of
postdiagnosis events.10,15,19 Subsequently, no general agreement emerges from currently available guidelines,22,23 which
give discordant recommendations with regard to surgical
indications on the basis of vegetation length.
espite recent improvement in diagnostic1 and therapeutic strategies,2 infective endocarditis (IE) is still associated with high in-hospital mortality, ranging from 16% to
25%,3–5 and a high incidence of embolic events (EE), ranging
from 13% to 49%.6 These wide ranges of complications
underscore the heterogeneity of the disease and the critical
need for baseline risk stratification in order to focus aggressive management toward high-risk subsets of patients. However, previous studies that attempted to identify baseline
predictors of mortality5,7–14 and embolism8,10,13,15–19 led to
conflicting results. In particular, despite the key role played
by echocardiography in IE diagnosis,1 its prognostic value
has been questioned, specifically that of vegetation characteristics, namely, vegetation length and mobility. Whereas
Received February 14, 2004; de novo received July 18, 2004; revision received February 12, 2005; accepted March 11, 2005.
From the Departments of Cardiology of La Timone Hospital, Marseille, France (F.T., J.A., J.C., J.G., P.A., A.R., F.C., D.M., H.L., D.R., J.H., P.W.,
G.H.); Saint-Antoine Hospital, Paris, France (O.B., V.R., A.C.); Charles Nicolle Hospital, Rouen, France (G. Derumeaux); and Second University,
Naples, Italy (G. Disalvo, V.P., D.I., R.C.).
Correspondence to Dr Gilbert Habib, Département de Cardiologie, Hôpital de la Timone, Boulevard Jean Moulin, 13005, Marseille, France. E-mail
[email protected], [email protected]
69
70
Circulation
July 5, 2005
To resolve these issues, we undertook a large multicenter,
prospective study of patients with a definite diagnosis of IE
by current diagnostic criteria in the contemporary era, with
systematic use of TEE, to assess the predictive value of
clinical and echocardiographic parameters on the subsequent
risk of embolism and death. We hypothesized that in addition
to clinical and microbiological variables, echocardiography
provides accurate baseline risk stratification of patients diagnosed with IE.
Methods
Patient Sample
From January 1993 to March 2003, all consecutive patients admitted
in 4 referral European centers with a suspected diagnosis of IE were
eligible for study entry (n⫽613). The only exclusion criterion was
pacemaker IE (n⫽34). Written informed consent was obtained from
all participating patients, as required by the institutional review
board under an approved protocol. Monthly screening of echocardiography and microbiology databases of all patients hospitalized for
suspected IE was performed by each center to ensure that a
consecutive sample of all definite diagnoses was obtained. Blood
cultures, serological assessment, transthoracic echocardiography
(TTE), TEE, and cerebral and thoracoabdominal CT scans were
systematically performed within 48 hours of admission in all except
7 patients, who underwent abdominal echography and no CT scan
because of severe renal insufficiency. Patients with definite diagnosis of IE according to Duke University criteria1 formed the final
prospective cohort (n⫽384). Antibiotic therapy was started immediately after diagnosis.
Clinical Data
The following clinical and biological parameters were prospectively
collected at diagnosis and during hospitalization: age, sex, fever
(temperature ⬎38°C), previous heart disease, intravenous drug
abuse, HIV infection, diabetes, history of cancer, comorbidity,24
moderate or severe congestive heart failure (CHF) diagnosed as
previously described,25 and serum creatinine ⬎2 mg/dL. Early
surgery was defined as valve replacement or repair performed during
the course of antibiotic therapy.
Echocardiography
TTE and TEE were performed in all cases, as previously reported,19
and were reviewed by 2 experienced echocardiographers, blinded to
patients’ clinical status. Echocardiographic data included the presence, maximal length, and mobility of vegetation.19 Measurements
of vegetation length were performed in various planes, and maximal
length was used. In the presence of multiple vegetations, the largest
length was used for analysis. Mobility was evaluated with the use of
a 4-point scale,9 as follows: absent, fixed vegetation with no
detectable independent motion; low, vegetation with a fixed base but
with a mobile free edge; moderate, pedunculated vegetation that
remains within the same chamber throughout the cardiac cycle; and
severe, prolapsing vegetation that crosses the coaptation plane of the
leaflets during the cardiac cycle. An abscess was defined as a
thickened area or mass with a heterogeneous echogenic or echolucent appearance.26 Valvular regurgitations were assessed semiquantitatively.27,28 Echocardiographic data were stored electronically and
used unaltered for subsequent analysis.
End Points
End points were embolic events that occurred before or after
initiation of antibiotic therapy (total-EE), embolic events that occurred after initiation of antibiotic therapy (new-EE), and 1-year
mortality. Diagnosis of EE was based on clinical or CT scans data or
both. CT scans, systematically performed at study entry, were
subsequently repeated if clinically indicated. Specific diagnosis of
cerebral embolism was eventually confirmed by an experienced
neurologist during the clinical course, who was unaware of the
microbiological and echocardiographic findings. Cutaneous manifestations and EE occurring after surgery were not included. The
outcome at 1 year was obtained by contacting the patients’
physicians.
For discrete variables, the relation between a variable and an event
was studied by ␹2 test or Fisher exact test (2 tailed) if the expected
count in any cell was ⬍5. Mann-Whitney test were used for
continuous variables.
For the end point of total-EE, logistic regression analysis was
performed with the use of clinical and microbiological variables as
previously defined; among echo variables, vegetation length and
vegetation mobility were not included in this analysis because these
2 parameters defined at index echo and potentially evolving with
time could not be used as predictors of past events. Variables
significantly associated with this end point in single-variable analysis
(P⬍0.05) were included as candidate predictors in an ascending
stepwise logistic regression analysis.
For the second end point of new-EE, only the echo variables
vegetation length and vegetation mobility were tested as potential
predictors, first in a single-variable analysis and then after adjustment for predictors of total-EE.
One-year survival was estimated by the Kaplan-Meier method.
Baseline clinical, microbiological, and echocardiographic variables
were tested as potential predictors of 1-year mortality with Cox
proportional hazards modeling. Variables with P⬍0.10 were included into the multivariable model.
Receiver operating characteristic (ROC) curve analysis was performed to determine the optimal cutoff value of vegetation length
that best predicted end points. P⬍0.05 was considered significant.
All analyses were performed with SPSS for Windows, release
10.0.1999.Chicago (SPSS Inc).
Finally, interobserver variability was good for both vegetation
length (␬⫽0.8) and mobility (␬⫽0.75).
Results
Patient Characteristics on Admission
Among the 384 patients with a definite diagnosis of IE, 294
had 2 major clinical Duke University criteria, 89 had 1 major
and 3 minor criteria, and only 1 patient had 5 minor criteria.
Baseline patient features are reported in Table 1, and microbiological data are reported in Table 2.
Mean⫾SD age was 57⫾17 years (range, 16 to 94 years), and
26% of patients were older than 70 years. Ninety-eight patients
(25%) presented with moderate or severe CHF on admission,
and 103 patients (26.8%) had already had an EE, including
stroke in 46 patients (12%). A vegetation was identified by TEE
in 320 patients (83%) but in only 192 patients (50%) by TTE. An
abscess was identified by TEE in 94 patients (24%), and a new
moderate to severe regurgitation was identified in 209 (54%).
Indications for Surgery
Early surgery was performed in 201 patients (52.3%) at a
median time of 12 days (range, 0 to 50) after institution of
antibiotic treatment. One hundred nine patients (28.4%) were
operated on in an urgent setting, ⬍15 days after diagnosis and
the beginning of antibiotic therapy, 60 (15.6%) between 15
and 30 days, and 32 (8.3%) after 30 days. The indications for
surgery included moderate or severe CHF in 72 cases,
persistent vegetation after systemic embolization in 56 cases,
abscess formation in 77 cases, acute severe aortic or mitral
regurgitation without CHF in 29 cases, and early prosthetic
valve IE in 9 cases. Forty-three patients with moderate or
Thuny et al
Prognosis of Infective Endocarditis
71
TABLE 1. Clinical and Laboratory Findings in 384 Cases of IE With and Without
Embolic Events Occurring Before or After Initiation of Antibiotic Therapy (Total-EE)
All Patients
(n⫽384)
Total-EE
(n⫽131)
Without Total-EE
(n⫽253)
P*
Age, mean⫾SD, y
57⫾17
56⫾17
57⫾17
0.53
Male
274 (71)
92 (70)
182 (72)
0.72
Mitral
191 (50)
70 (53)
121 (48)
0.33
Aortic
214 (53)
67 (51)
147 (58)
0.20
Prosthetic valves
91 (24)
28 (21)
63 (25)
0.70
Multivalvular†
60 (16)
24 (18)
36 (14)
0.30
Right-heart IE‡
34 (9)
18 (14)
16 (6)
0.02
180 (47)
54 (41)
126 (50)
0.13
24 (6)
13 (10)
11 (4)
0.04
Valve localization
Previous heart disease§
IVDA
HIV infection
13 (3)
4 (3)
9 (4)
1.0
History of cancer
23 (6)
8 (6)
15 (6)
1.0
Diabetes
27 (7)
12 (9)
15 (6)
0.29
Comorbidity index ⬎2储
69 (18)
26 (20)
43 (17)
0.49
Moderate or severe CHF
98 (25)
37 (28)
61 (24)
0.38
Serum creatinine ⬎2 mg/L
70 (18)
28 (21)
42 (17)
0.27
Values are number (%). IVDA indicates intravenous drug abuse.
*Comparison between total-EE group and without total-EE group. Bold values are significant.
†At least 2 locations.
‡Only right heart localization.
§Including 91 patients with prosthetic valve, 33 congenital heart disease (27 bicuspid aortic valves,
3 interventricular septal defects, 2 Fallot, and 1 quadricuspid aortic valve), 27 mitral valve diseases,
26 aortic valve diseases, 3 obstructive cardiomyopathies.
储Charlson comorbidity scale.
severe CHF or abscess or both were not operated on because
of severe comorbidity in 41 and refusal in 2. The median
duration of hospital stay was 43 days (range, 0 to 167).
Embolic Risk
Total Embolic Events
Among 384 patients, 131 (34.1%) had ⱖ1 total-EE. Sites of
embolization were central nervous system (62 cases), spleen
(49 cases), kidney (22 cases), lungs (16 cases), peripheral
arteries (10 cases), mesentery (3 cases), coronary circulation
(2 cases), and eye (1 case). Thirty-three patients (8.6%)
presented with ⬎1 total-EE. Embolism was silent in 19
patients (4.9%). There was no statistical difference between
patients with and without total-EE with regard to age, sex,
presence of previous heart disease or prosthetic valve, localization of infection (mitral or aortic), and predisposing factors
TABLE 2. Microbiological Findings in 384 Cases of IE With and Without Embolic
Events Occurring Before or After Initiation of Antibiotic Therapy (Total-EE)
All Patients
(n⫽384)
Total-EE
(n⫽131)
Without Total-EE
(n⫽253)
P*
S bovis
63 (16)
32 (24)
31 (12)
0.003
Enterococci
28 (7)
14 (11)
14 (5)
0.07
Oral streptococci
95 (25)
24 (18)
71 (28)
0.045
S aureus
82 (21)
37 (28)
45 (18)
0.03
Coagulase-negative staphylococci
17 (4)
4 (3)
13 (5)
0.44
Others†
40 (10)
15 (19)
25 (10)
1
Negative blood cultures‡
76 (20)
15 (11)
61 (24)
0.003
Values are number (%).
*Comparison between total-EE group and without total-EE group. Bold values are significant.
†Including Q fever (n⫽9), HACEK group (Haemophilus, Actinobacillus, Cardiobacterium, Eikenella,
Kingella 关n⫽6兴), Candida species (n⫽6), Escherichia coli (n⫽4), Enterobacter cloacae (n⫽2),
Gemella morbillorum (n⫽3), Corynebacterium (n⫽3), Bartonella quintana (n⫽2), Bartonella henselae
(n⫽2), Streptococcus agalactiae (n⫽1), Mycoplasma hominis (n⫽1), Propionibacterium acnes (n⫽1).
‡Definite IE diagnosis using clinical Duke criteria: 1 major and 3 minor criteria (n⫽75), 5 minor
criteria (n⫽1).
72
Circulation
July 5, 2005
TABLE 3. Predictors of Embolic Events in Multivariate Analysis
P
Adjusted
Odds Ratio
95% CI
⬍0.001
3.9
1.86–8.21
0.002
2.4
1.15–4.83
Total-EE
S bovis
S aureus
New-EE
TABLE 5. Predictors of 1-Year Mortality
(Cox Multivariable Analysis)
Adjusted RR
95% CI
P
Age
1.02
1.01–1.04
0.007
Female sex
1.6
1.01–2.58
0.048
Comorbidity index ⬎2
1.6
0.92–2.64
0.1
1.9
1.16–3.23
0.01
Vegetation length ⬎10 mm
0.004
9
1.98–40.8
Prosthetic valve
1.6
0.99–2.68
0.053
Severe vegetation mobility
0.04
2.4
1.02–5.42
S aureus IE
2
1.19–3.24
0.001
S bovis
0.19
1.9
0.73–4.74
1.6
1.02–1.54
0.04
S aureus
0.12
2
0.84–4.76
1.8
1.10–2.82
0.02
and comorbidity (Table 1). However, total-EE were more
frequent in patients with intravenous drug abuse (P⫽0.04),
right-side IE (P⫽0.02), positive blood cultures (P⫽0.003),
Streptococcus bovis (P⫽0.003), and Staphylococcus aureus
IE (P⫽0.03). Total-EE were less frequently observed in oral
streptococcal IE (P⫽0.04) (Table 2). By multivariable analysis, S bovis and S aureus remained the only predictors of
total-EE (Table 3).
Embolic Events During Antibiotic Therapy
New-EE occurred in 28 patients (7.3%). Sites of embolization
were central nervous system (14 cases), spleen (9 cases),
kidney (5 cases), peripheral arteries (5 cases), eye (2 cases),
coronary circulation (2 cases), and pulmonary circulation (2
cases). These events occurred at a median time of 7 days
(range, 1 to 38) after institution of adequate antibiotic therapy
(20 [71.4%] in the first 15 days).
By single-variable analysis, vegetation length was predictive of new-EE (P⬍0.001). Vegetation length (median) was
larger in patients with new-EE than in those without
(15.5 mm [range, 0 to 40] versus 9 mm [range, 0 to 50],
respectively; P⬍0.001). A vegetation length threshold of
10 mm was identified as having the highest predictive value
for new-EE by ROC curve analysis. New-EE occurred more
frequently in patients with vegetation length ⬎10 mm than in
those with vegetation length ⱕ10 mm (13.7% [26/190] versus
1% [2/194]; P⬍0.001). New-EE were also more frequent
TABLE 4. Predictors of 1-Year Mortality
(Cox Single-Variable Analysis)
RR
95% CI
P
Age
1.03
1.01–1.04
0.0003
Female sex
1.8
1.16–2.86
0.009
Comorbidity index ⬎2
1.8
1.10–2.90
0.03
2.9
1.80–4.53
⬍0.0001
Prosthetic valve
1.6
0.99–2.58
0.05
S aureus IE
2.1
1.35–3.39
0.002
Cerebral embolism
1.4
0.83–2.48
0.2
1.9
1.21–3.01
0.005
Abscess
1.2
0.72–1.92
0.53
Moderate or severe regurgitation
1.1
0.72–1.75
0.61
Vegetation length, mm
1.03
1.01–1.06
0.01
2.1
1.34–3.26
0.001
among 117 patients with severe vegetation mobility (16.2%
[19/117] versus 3.4% [9/267]; P⬍0.001). Conversely,
new-EE occurred in only 2 patients with both vegetation
length ⬍10 mm and no severe mobility. After adjustment for
the 2 multivariate predictors of total-EE, ie, S aureus and S
bovis, vegetation length ⬎10 mm and severe vegetation
mobility remained the only predictors of new-EE (Table 3).
In the subgroup of 14 patients with new cerebral embolism,
vegetation length was ⬎10 mm in all 14 patients. In those
patients, vegetation mobility was severe in 12 patients.
Mortality
Incidence and Causes of Death
One-year mortality was 20.6%. Thirty-seven patients (9.6%)
died during their hospital stay at a median time of 16 days
(range, 0 to 73) after institution of antibiotic therapy. The
causes for death were severe CHF (10 cases), multiorgan
failure (9 cases), cerebral embolism (9 cases), septic shock (6
cases), cerebral hemorrhage (3 cases), atrioventricular block
(1 case), and myocardial infarction (1 case). Forty-two
patients died after dismissal. The cause for late death was a
direct consequence of the cardiac lesions induced by IE in 26
patients (severe valve regurgitation in 21 and postoperative
left ventricular dysfunction in 5). In the remaining 16 patients, the cause for late death was not directly related to
cardiac lesions, including stroke in 2 patients, myocardial
infarction in 1, IE recurrence in 1, noncardiac cause in 8, and
unknown in 4.
Factors associated with 1-year mortality are summarized in
Table 4. Vegetation length was predictive of 1-year mortality
(relative risk [RR]⫽1.03 per millimeter; 95% CI, 1.01 to
1.06; P⫽0.01), and ROC curve demonstrated vegetation
length ⬎15 mm to have the best predictive value (RR⫽2.1;
95% CI, 1.34 to 3.26; P⫽0.001). The Figure shows 1-year
survival curves according to vegetation length.
By multivariable analysis, baseline predictors of 1-year
mortality were vegetation length ⬎15 mm (adjusted RR⫽1.7;
95% CI, 1.10 to 2.64; P⫽0.03), age (adjusted RR⫽1.02; 95%
CI, 1.01 to 1.04; P⫽0.009), female sex (adjusted RR⫽1.6;
95% CI, 1.01 to 2.57; P⫽0.04), serum creatinine ⬎2 mg/L
(adjusted RR⫽2.1; 95% CI, 1.29 to 3.46; P⫽0.003), S aureus
(adjusted RR⫽1.9; 95% CI, 1.16 to 3.14; P⫽0.01), and
moderate or severe CHF (adjusted RR⫽1.6; 95% CI, 1.02 to
2.54; P⫽0.04). Vegetation length ⬎15 mm remained a
Thuny et al
73
Embolic Risk in IE
One-year survival (⫾SE) according to vegetation length (L).
predictor even when comorbidity index was included in the
model (Table 5).
Among the 114 patients with vegetation length ⬎15 mm,
75 had at least 1 standard clinical indication for surgery
(CHF, n⫽35; acute severe aortic regurgitation without CHF,
n⫽24; abscess, n⫽28; recurrent embolism despite appropriate antibiotic therapy, n⫽18; prosthetic valve IE with paravalvular leak, n⫽9).
Risk of Embolism and Death in Prosthetic Versus
Native Valve Endocarditis
Embolic Risk
New-EE were observed in 22 (7.5%) among the 293 patients
with native valve IE and in 6 (6.5%) among the 91 patients
with prosthetic valve IE. Vegetation length and mobility
remained predictors of new-EE in native valve IE subgroup
(vegetation length ⬎10 mm [odds ratio⫽5.9; P⫽0.006] and
severe vegetation mobility [odds ratio⫽3.5; P⫽0.03]) but not
in prosthetic valve IE subgroup.
Mortality
One-year mortality was 18.4% and 27.5% in the subgroups of
patients with native and prosthetic valve IE, respectively.
Vegetation length ⬎15 mm remained associated with death
(RR⫽2.2; 95% CI, 1.27 to 3.71; P⫽0.004) in the native valve
IE subgroup but not in the prosthetic valve IE subgroup, in
which only S aureus was predictive of death (RR⫽2.9; 95%
CI, 1.30 to 6.67; P⫽0.009).
Discussion
The present study shows that echocardiography, performed
early in the course of IE, has a strong prognostic value. Along
with baseline clinical and microbiological features, the assessment of vegetation characteristics (length and mobility)
allows identification of patients who are at highest risk for
new-EE and death.
Embolism represents one of the most frequent and severe
complications of IE and has been reported to occur in 13% to
49% with IE.6 If the total risk of embolism associated with IE
is very high, the risk of new embolism occurring after
initiation of therapy is much lower, from 6% to 21% in past
series10,17,19,29 and 7.3% in the present series. The risk of
embolism seems particularly high during the first 2 weeks
after diagnosis,8 and this point was confirmed by the present
study because 71.4% of new-EE occurred during the first 15
days after diagnosis.
The exact role of echocardiography in predicting embolism
has been largely debated,8,10,13,15–19 and past studies gave
conflicting results. The causes for these discrepancies are
well known. Limitations of past studies include small sample
size,8 –11 use of TTE alone,8,9,12,16 inclusion of EE occurring
before echocardiography,10,15,19 and poor standardization of
diagnostic criteria. The present study overcomes all these
limitations because it included prospectively a large cohort of
patients with definite IE according to Duke University criteria, with special attention to new-EE. In addition, this is the
largest study in which vegetation characteristics were prospectively collected and TEE was systematically performed.
The main result is that the echocardiographic characteristics
of vegetation are clearly associated with the embolic risk. In
a previous study from our center,19 178 patients with IE were
included, and a significant correlation was found between EE
and vegetation size and mobility. However, a limitation of
this study was the inclusion of patients with previous EE and
the relative small number of new-EE. The present large
multicenter study was initiated to overcome these limitations
and allowed us both to include a larger number of patients and
to analyze a more significant number of new-EE. The results
of the present study confirm that large vegetations ⬎10 mm
or severe vegetation mobility or both are associated with an
increased embolic risk. Conversely, new-EE were infrequent
in a low-risk subgroup of patients with both vegetation length
⬍10 mm and no severe mobility.
Predictors other than vegetation characteristics were identified by several studies. For example, antiphospholipid
antibodies, coagulation parameters, and endothelial cell activation have been associated with an increased embolic risk.30
Bacteriologic factors and localization of IE have also been
previously reported to influence the incidence of EE. For
example, S aureus31 and S bovis32 have been associated with
an increased embolic risk. In our study, S aureus and S bovis
infection were associated with an increased risk of total-EE.
However, in regard to the occurrence of new-EE, vegetation
length and mobility remained the only predictors after adjustment for these microbiological variables. Finally, our study
did not confirm the previously reported higher incidence of
EE in mitral valve IE.2,10
Mortality
Mortality is still high in IE, although it has declined in recent
years.11,13,21 The low mortality rate observed in our study may
be related to a more aggressive surgical approach33 (28.4% of
all patients underwent surgery before the 15th day of antibiotic therapy) and a lower incidence of S aureus IE compared
74
Circulation
July 5, 2005
with the most recent American studies.20,21 In addition, a high
incidence of S bovis IE was observed in our study, and IE
caused by this microorganism has been associated with a
good prognosis.4
Mortality in IE may be related to factors related to the
patient or to factors related to the disease, the former being
potentially preventable. Thus, the identification of factors
associated with increased mortality is a crucial challenge
because it will allow the identification of high-risk patients in
whom an aggressive strategy will be potentially useful.
Several markers have previously been identified in past
studies, including age,34 occurrence of complications, staphylococcal infection, and prosthetic valve IE.2 Other studies
found different results; for example, Netzer et al5 found that
only neurological symptoms, arthralgia, and weight loss were
independent predictors of mortality, and Wallace et al7 found
that clinical indices such as abnormal white cell count, serum
albumin concentration, serum creatinine concentration, or
visible vegetation were the best predictors of bad prognosis.
The most comprehensive study has recently been published
by Hasbun et al.14 They studied 6-month mortality in a series
of 513 patients with complicated IE. They found that comorbidity, abnormal mental status, moderate to severe CHF,
staphylococcal infection, and medical therapy were independent predictors of mortality. In these series, the presence of
vegetation was not associated with increased mortality, but
the vegetation size and mobility were not specifically analyzed. In addition, the presence of vegetation was considered
a criterion for “complicated IE” in this study, and only
patients with complicated IE were included; thus, some
patients without vegetation were probably not included, and
this may explain why the presence of vegetation did not
predict mortality in this study. Similarly, in the recent study
of Chu et al,20 early echocardiographic findings were not
predictive of death, but in this report, which included possible
and definite diagnosis of IE, TEE was performed in only 66%
of patients, and data on vegetation size were not prospectively
collected.
In our study several factors were associated with a poor
prognosis, including age, female sex, serum creatinine, S
aureus, and moderate or severe CHF. More importantly, we
also found vegetation length ⬎15 mm to be a predictor of
1-year mortality, even after adjustment for the other predictors and comorbidity. Older series failed to give a prognostic
value to the presence or size of vegetation, probably because
of the small number of patients studied or use of TTE
alone.8,11,16 However, our results are in agreement with the
recent series of Cabell et al,13 who found a direct relationship
between vegetation size and mortality at 30 days and 1 year.
Finally, the fact that very large vegetations were independently associated with a worse prognosis is not surprising
because this feature is frequently associated with severe valve
destruction and a high embolic risk. Interestingly, among the
patients with vegetation length ⬎15 mm, 34% had no other
indication for surgery and would have been identified as
high-risk patients by echocardiography before standard indications for surgery were met.
Study Limitations
This study has several limitations. First, it was subject to a
referral bias because it was performed in referral centers. The
early surgery policy of these centers could have reduced the
incidence of new-EE. Moreover, a repeated CT scan was not
systematically performed after antibiotic therapy in all patients, and therefore the exact incidence of new silent EE may
have been underestimated. In addition, the incidence of EE
was low in the subgroup of patients with prosthetic valve IE,
and therefore no definite conclusion can be drawn concerning
the value of TEE in predicting EE in this particular subgroup.
The rate of negative blood cultures was relatively high in
our study. The causes for negative blood cultures may include
prior antibiotic therapy and a relatively high incidence of Q
fever endocarditis in our countries, as previously reported.35
It is our policy to perform a systematic serological assessment
of multiple microorganisms in case of suspected IE, allowing
identification of a high rate of “atypical” microorganisms
(Coxiella burnetii, Bartonella species, Mycoplasma species)
consistent with IE and not identified by blood cultures.
Conclusion
Echocardiography has a strong predictive value in IE. Independently of other baseline characteristics, vegetation length
has major prognostic implications by predicting both EE
under antibiotic therapy and mortality. Thus, the measurement of vegetation length at the time of diagnosis of IE is
strongly recommended as part of the initial risk stratification.
Patients with the largest vegetations should be considered at
high risk for subsequent serious complications. Whether a
more aggressive therapeutic strategy (ie, early surgery) is
required in those patients requires further prospective studies.
References
1. Durack DT, Lukes AS, Bright DK. New criteria for diagnosis of infective
endocarditis: utilization of specific echocardiographic findings: Duke
Endocarditis Service. Am J Med. 1994;96:200 –209.
2. Bayer AS, Bolger AF, Taubert KA, Wilson W, Steckelberg J, Karchmer
AW, Levison M, Chambers HF, Dajani AS, Gewitz MH, Newburger JW,
Gerber MA, Shulman ST, Pallasch TJ, Gage TW, Ferrieri P. Diagnosis
and management of infective endocarditis and its complications. Circulation. 1998;98:2936 –2948.
3. Mylonakis E, Calderwood SB. Infective endocarditis in adults. N Engl
J Med. 2001;345:1318 –1330.
4. Hoen B, Alla F, Selton-Suty C, Béguinot I, Bouvet A, Briançon S, Casalta
JP, Danchin N, Delahaye F, Etienne J, Le Moing V, Leport C, Mainardi
JL, Ruimy R, Vandenesch F. Changing profile of infective endocarditis:
results of a 1-year survey in France. JAMA. 2002;288:75– 81.
5. Netzer RO, Zollinger E, Seiler C, Cerny A. Infective endocarditis: clinical
spectrum, presentation and outcome: an analysis of 212 cases 1980 –1995.
Heart. 2000;84:25–30.
6. Habib G. Embolic risk in subacute bacterial endocarditis: role of transesophageal echocardiography. Curr Cardiol Rep. 2003;5:129 –136.
7. Wallace SM, Walton BI, Kharbanda RK, Hardy R, Wilson AP, Swanton
RH. Mortality from infective endocarditis: clinical predictors of outcome.
Heart. 2002;88:53– 60.
8. Steckelberg JM, Murphy JG, Ballard D, Bailey K, Tajik AJ, Taliercio CP,
Guiliani ER, Wilson WR. Emboli in infective endocarditis: the prognostic
value of echocardiography. Ann Intern Med. 1991;114:635– 640.
9. Sanfilippo AJ, Picard MH, Newell JB, Rosas E, Davidoff R, Thomas JD,
Weyman AE. Echocardiographic assessment of patients with infectious
endocarditis: prediction of risk for complications. J Am Coll Cardiol.
1991;18:1191–1199.
10. Mugge A, Daniel WG, Frank G, Lichtlen PR. Echocardiography in
infective endocarditis: reassessment of prognostic implications of vege-
Thuny et al
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
tation size determined by the transthoracic and the transesophageal
approach. J Am Coll Cardiol. 1989;14:631– 638.
Jaffe WM, Morgan DE, Pearlman AS, Otto CM. Infective endocarditis,
1983–1988: echocardiographic findings and factors influencing morbidity
and mortality. J Am Coll Cardiol. 1990;15:1227–1233.
Malquarti V, Saradarian W, Etienne J, Milon H, Delahaye JP. Prognosis
of native valve infective endocarditis: a review of 253 cases. Eur Heart J.
1984;5(suppl C):11–20.
Cabell CH, Pond KK, Peterson GE, Durack DT, Corey GR, Anderson DJ,
Ryan T, Lukes AS, Sexton DJ. The risk of stroke and death in patients
with aortic and mitral valve endocarditis. Am Heart J. 2001;142:75– 80.
Hasbun R, Vikram HR, Barakat LA, Buenconsejo J, Quagliarello
VJ. Complicated left-sided native valve endocarditis in adults: risk classification for mortality. JAMA. 2003;289:1933–1940.
De Castro S, Magni G, Beni S, Cartoni D, Fiorelli M, Venditti M,
Schwartz SL, Fedele F, Pandian NG. Role of transthoracic and transesophageal echocardiography in predicting embolic events in patients
with active infective endocarditis involving native cardiac valves.
Am J Cardiol. 1997;80:1030 –1034.
Heinle S, Wilderman N, Harrison JK, Waugh R, Bashore T, Nicely LM,
Durack D, Kisslo J. Value of transthoracic echocardiography in predicting embolic events in active infective endocarditis: Duke Endocarditis
Service. Am J Cardiol. 1994;74:799 – 801.
Vilacosta I, Graupner C, San Roman JA, Sarria C, Ronderos R, Fernandez
C, Mancini L, Sanz O, Sanmartin JV, Stoermann W. Risk of embolization
after institution of antibiotic therapy for infective endocarditis. J Am Coll
Cardiol. 2002;39:1489 –1495.
Tischler MD, Vaitkus PT. The ability of vegetation size on echocardiography to predict clinical complications: a meta-analysis. J Am Soc Echocardiogr. 1997;10:562–568.
Di Salvo G, Habib G, Pergola V, Avierinos JF, Philip E, Casalta JP,
Vailloud JM, Derumeaux G, Gouvernet J, Ambrosi P, Lambert M,
Ferracci A, Raoult D, Luccioni R. Echocardiography predicts embolic
events in infective endocarditis. J Am Coll Cardiol. 2001;37:1069 –1076.
Chu VH, Cabell CH, Benjamin DK, Kuniholm EF, Fowler VG,
Engemann J, Sexton DJ, Corey GR, Wang A. Early predictors of
in-hospital death in infective endocarditis. Circulation. 2004;109:
1745–1749.
Cabell CH, Jollis JG, Peterson GE, Corey GR, Anderson DJ, Sexton DJ,
Woods CW, Reller LB, Ryan T, Fowler VG. Changing patient characteristics and the effect on mortality in endocarditis. Arch Intern Med.
2002;162:90 –94.
Bonow RO, Carabello B, de Leon AC, Edmunds LH, Fedderly BJ, Freed
MD, Gaasch WH, McKay CR, Nishimura RA, O’Gara PT, O’Rourke RA,
Rahimtoola SH. ACC/AHA guidelines for the management of valvular
heart disease. Circulation. 1998;98:1949 –1984.
Horstkotte D, Follath F, Gutschik E, Lengyel M, Oto A, Pavie A,
Soler-Soler J, Thiene G, von Graevenitz A. Guidelines on prevention,
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
75
diagnosis and treatment of infective endocarditis: full guidelines: the Task
Force on Infective Endocarditis executive summary; the Task Force on
Infective Endocarditis of the European Society of Cardiology. Eur
Heart J. 2004;25:267–276.
Charlson ME, Pompei P, Ales KL, MacKenzie CR. A new method of
classifying prognostic comorbidity in longitudinal studies: development
and validation. J Chronic Dis. 1987;40:373–383.
Richardson JV, Karp RB, Kirklin JW, Dismukes WE. Treatment of
infective endocarditis: a 10-year comparative analysis. Circulation. 1978;
58:589 –597.
Daniel WG, Mugge A, Martin RP, Lindert O, Hausmann D, NonnastDaniel B, Laas J, Lichtlen PR. Improvement in the diagnosis of abscess
associated with endocarditis by transesophageal echocardiography.
N Engl J Med. 1991;324:795– 800.
Helmcke F, Nanda NC, Hsiung MC, Soto B, Adey CK, Goyal RG,
Gatewood RP. Color Doppler assessment of mitral regurgitation with
orthogonal planes. Circulation. 1987;75:175–183.
Perry GJ, Helmcke F, Nanda NC, Byard C, Soto B. Evaluation of aortic
insufficiency by Doppler color flow mapping. J Am Coll Cardiol. 1987;
9:952–959.
Rohmann S, Erbel R, Gorge G, Makowski T, Mohr-Kahaly S, Nixdorff
U, Drexler M, Meyer J. Clinical relevance of vegetation localization by
transoesophageal echocardiography in infective endocarditis. Eur
Heart J. 1992;13:446 – 452.
Kupferwasser LI, Hafner G, Mohr-Kahaly S, Erbel R, Meyer J, Darius H.
The presence of infection-related antiphospholipid antibodies in infective
endocarditis determines a major risk factor for embolic events. J Am Coll
Cardiol. 1999;33:1365–1371.
Erbel R, Liu F, Ge J, Rohmann S, Kupferwasser I. Identification of
high-risk sub-groups in infective endocarditis and the role of echocardiography. Eur Heart J. 1995;16:588 – 602.
Pergola V, Di Salvo G, Habib G, Avierinos JF, Philip E, Vailloud JM,
Thuny F, Casalta JP, Ambrosi P, Lambert M, Riberi A, Ferracci A,
Mesana T, Metras D, Harle JR, Weiller PJ, Raoult D, Luccioni R.
Comparison of clinical and echocardiographic characteristics of Streptococcus bovis endocarditis with that caused by other pathogens.
Am J Cardiol. 2001;88:871– 875.
Alexiou C, Langley SM, Stafford H, Lowes JA, Livesey SA, Monro JL.
Surgery for active culture-positive endocarditis: determinants of early and
late outcome. Ann Thorac Surg. 2000;69:1448 –1454.
Di Salvo G, Thuny F, Rosenberg V, Pergola V, Belliard O, Derumeaux
G, Cohen A, Iarrussi D, Giorgi R, Casalta JP, Caso P, Habib G. Endocarditis in the elderly: clinical, echocardiographic, and prognosis features.
Eur Heart J. 2003;24:1575–1582.
Habib G, Derumeaux G, Avierinos JF, Casalta JP, Jamal F, Volot F,
Garcia M, Lefevre J, Biou F, Maximovitch-Rodaminoff A, Fournier PE,
Ambrosi P, Velut JG, Cribier A, Harle JR, Weiller PJ, Raoult D, Luccioni
R. Value and limitations of the Duke criteria for the diagnosis of infective
endocarditis. J Am Coll Cardiol. 1999;33:2023–2029.
Molecular Cardiology
Bcl-xL Gene Transfer Inhibits Bax Translocation and
Prolongs Cardiac Cold Preservation Time in Rats
Jianhua Huang, MD; Kiminori Nakamura, DDS, PhD; Yoshinori Ito, MD; Takeshi Uzuka, MD;
Masayuki Morikawa, MD, PhD; Sachie Hirai, BS; Kei Tomihara, DDS; Toshihiro Tanaka, MD, PhD;
Yukari Masuta, BS; Keiji Ishii, MD; Kazunori Kato, PhD; Hirofumi Hamada, MD, PhD
Background—Apoptosis is an important cause of early graft loss after heart transplantation. Bcl-xL was reported to protect
the heart against normothermic ischemia and reperfusion injury. In this study, we determined whether overexpression
of Bcl-xL could inhibit tissue injury resulting from prolonged cold preservation followed by warm reperfusion of heart
transplants.
Methods and Results—Lewis rat hearts were transduced with an adenovirus vector harboring Bcl-xL cDNA (AxCAhBclxL) 4 days before collection of tissue. After preservation in University of Wisconsin solution at 4°C for 24 hours, the
heart was either perfused with a Langendorff device ex vivo or used for heterotopic heart transplantation in vivo. Bcl-xL
gene transfer significantly reduced the infarct size (23.0⫾2.6% versus 47.7⫾7.0% in saline control and 48.6⫾6.1% in
vector control, P⬍0.01) after 2-hour reperfusion at 37°C with the Langendorff device and significantly decreased
creatine kinase release (0.82⫾0.27 IU, versus 1.57⫾0.33 and 1.50⫾0.37 IU in saline and vector controls, respectively;
P⬍0.05). In heart transplantation, overexpresson of Bcl-xL inhibited Bax translocation from the cytosol to the
mitochondria, resulting in decreased cytochrome c release from the mitochondria; it also significantly decreased cardiac
cell apoptosis and improved graft survival rate after long cold preservation, followed by warm reperfusion.
Conclusions—Bcl-xL gene transfer inhibited the translocation of Bax and prolonged the cold preservation time of cardiac
transplants. This may be a potential therapeutic method in clinical practice. (Circulation. 2005;112:76-83.)
Key Words: gene therapy 䡲 ischemia 䡲 reperfusion 䡲 transplantation 䡲 apoptosis
W
ith the development of new technologies and improvements in immunotherapy methods, there has been a
worldwide increase in the number of cases of cardiac transplantation in recent decades. One of the limitations of heart
transplantation is the lack of donor hearts, attributable at least
in part to the current duration of heart preservation time,
which is limited to 4 to 6 hours in clinical practice.1 Although
using cardiac preservation liquids such as the University of
Wisconsin solution (UWS) prolongs the preservation time of
heart grafts, 18 hours is the maximum preservation time for
functional recovery of the heart in different experimental
protocols.2
reperfusion injury7,8 or cold ischemia and reperfusion
injury2 in the heart. Several studies proved that cardiac
dysfunction could be prevented by the antiapoptotic Bcl-2
gene in rats9 or transgenic mice.10 On the other hand,
cobalt protoporphyrin (heme oxygenase-1 inducer) was
reported to prolong graft survival after 24-hour preservation at 4°C in a cardiac transplantation model in which
Bcl-2 expression was elevated.11 Thus, the strategy of a
combination of antiapoptotic gene transfer and cold preservation seems to be reasonable for success of heart
transplants.
Bcl-xL belongs to the same family as Bcl-2, which was
shown to play an important role in cardiac protection by
hepatocyte growth factor12 and insulin-like growth factor1.13 Bcl-xL was also reported to inhibit Bax translocation
to the mitochondria, decrease the release of cytochrome c
(cyto-c) from the mitochondria to the cytosol, and protect
retinal cell apoptosis in transgenic mice.14 Because cold
ischemia and reperfusion cause mitochondrial dysfunction
and release of cyto-c from the mitochondria to the cytosol,15 we hypothesized that Bcl-xL would be useful in
See p 6
Long cold preservation and warm reperfusion are considered important causes of early cardiac graft loss. Although calcium flux,3 acidosis,4 ATP depletion,5 and
reactive oxygen species6 have been defined as putative
causative factors, there may be other mediator factors that
remain to be identified. Indeed, besides necrosis, apoptosis
is one of the early events of either warm ischemia and
Received June 27, 2004; de novo received January 12, 2005; revision received February 25, 2005; accepted March 8, 2005.
From the Department of Molecular Medicine (J.H., K.N., Y.I., S.H., K.T., T.T., Y.M., K.I., K.K., H.H.), the Division of Gene Therapy (Y.I., H.H.),
and the Department of Thoracic and Cardiovascular Surgery (T.U., M.M.), Sapporo Medical University, Sapporo, Japan.
Correspondence to Hirofumi Hamada, MD, PhD, Department of Molecular Medicine, Sapporo Medical University, South 1, West 17, Chuo-ku,
Sapporo, 060-8556, Japan. E-mail [email protected]
76
Huang et al
preventing cold ischemia and warm reperfusion injury of
the heart.
We previously demonstrated that adenovirus-mediated
Bcl-xL gene transduction to the heart improved cardiac
function and decreased the infarct size of the heart after warm
ischemia and reperfusion.16 In the present study, we used
adenovirus-mediated Bcl-xL gene transfer to the heart to
ascertain whether it could inhibit cold ischemia and warm
reperfusion injury and prolong the cold preservation time of
heart grafts in a rat heterotopic transplantation model.
Methods
Bcl-xL Prolongs Cardiac Cold Preservation
77
PharMingen) was applied, and the Vector ABC kit (Vector Laboratories) was used as described by the manufacturer.
Langendorff Perfusion and CK Measurement
To determine the effect of long cold preservation and warm
reperfusion on the heart, we first performed the Langendorff perfusion of the heart ex vivo. After 24 hours of cold preservation, the
heart was transferred to the Langendorff perfusion system and
perfused with a modified Krebs-Henseleit solution gassed with 95%
O2 and 5% CO2 through the aorta at 85 mm Hg of perfusion
pressure.16 The heart was perfused at 37°C for 2 hours, the coronary
effluent flow for the first 15 minutes after the start of reperfusion was
collected for creatine kinase (CK) measurement,21 and CK activity
was measured by an enzymatic assay.
Adenoviral Vectors
TTC Staining
The adenoviral vector (Adv) encoding human Bcl-xL17 or Escherichia coli ␤-galactosidase (LacZ)18,19 was used in the experiment.
Adv propagation and purification were described previously.18 Before use, the viral titer (particle units/mL [PU/mL]) and the contamination of replication-competent Adv in the viral stock were evaluated as previously reported.19
Triphenyltetrazolium chloride (TTC) staining has been a standard for
the measurement of infarct size and has been used previously for
assessment of infarct size resulting from apoptosis and necrosis.22
Thus, we performed TTC staining to detect the infarct size of the
heart after 2 hours of Langendorff perfusion. The heart was cut
evenly into 4 slices transversely from the apex to the base and
immersed into 1% TTC (Sigma-Aldrich) in PBS at 37°C for 30
minutes, and then the reaction was stopped by addition of 10%
neutralized formalin. The heart sections were photographed and
captured as a digital image. Infarct size was analyzed with NIH
software, and infarct size percentage was calculated as infarct area
(white area)/total area of the left ventricle (brick red area⫹white
area).16
Animal Model
Syngeneic Lewis rats (male, 250 to 350 g) were purchased from
Sankyo Labo Service (Tokyo, Japan). The rats were anesthetized by
intramuscular injection with ketamine (40 mg/kg) and xylazine (4
mg/kg). The donor rat was intubated with a 17-gauge needle tube and
supported by a rodent respirator. A median thoracotomy was made
and the aorta was exposed. AxCAhBclxL (1010 PU in 100 ␮L of
0.9% saline) was injected into the heart at the root of the aorta. The
aorta and pulmonary artery were clamped for 30 seconds after Adv
injection and then released (n⫽10). For control, 1010 PU AxCAZ3 in
100 ␮L of 0.9% saline or 100 ␮L of 0.9% saline was injected into rat
hearts in the same way (n⫽10 each).
After 4 days, the thoracotomy was re-opened, and the heart was
arrested by perfusion with UWS at 4°C, collected, and stored in the
UWS at 4°C for 24 hours. The heterotopic heart transplantation was
performed as described previously.20 In brief, a laparotomy was
made in the recipient rat. The infrarenal aorta and inferior vena cava
were exposed. The heart transplantation was performed by an
end-to-side anastomosis of the donor’s aorta to the recipient’s
infrarenal aorta and the donor’s pulmonary artery to the recipient’s
inferior vena cava. Graft survival was determined by daily palpation.
The study was performed in accordance with institutional guidelines
for animal experiments.
Detection of Bcl-xL Expression in the Heart After
Adv Transduction of the Heart
To determine the effectiveness of Bcl-xL gene transfer in the heart
via aortic root injection, both X-gal staining of hearts injected with
1010 PU AxCAZ3 and Bcl-xL immunostaining of hearts injected with
1010 PU AxCAhBclxL were performed. X-gal staining was performed as described previously.16 For Bcl-xL immnofluorescence
detection, cryosections of heart were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100 in phosphate-buffered
saline (PBS), and blocked with 3% bovine serum albumin in PBS.
The sections were incubated with anti-human Bcl-xL antibody
(65186E, BD PharMingen) and anti–␣-sarcomeric actinin monoclonal antibody (EA-53, Sigma-Aldrich) for 30 minutes, washed with
PBS, and then incubated with goat anti-rabbit IgG and goat antimouse IgG secondary antibody coupled to Alexa 488 or Alexa 594
(Molecular Probes, Inc). All images were captured with a confocal
microscope (Zeiss/Pascal).
To determine the duration of Bcl-xL expression after Bcl-xL gene
transfer, the time course of Bcl-xL expression in the heart was
determined by Western blotting and immunostaining. Western blotting of Bcl-xL was performed as previously described.16 For immunostaining of Bcl-xL, an anti-human Bcl-xL antibody (65186E, BD
Histological Examination
After 2-hour perfusion in the Langendorff device or 24 hours of
heterotopic heart transplantation, tissue was excised from the middle
of the heart between the apex and base, fixed with 10% neutralized
formalin, dehydrated, and embedded in paraffin. Five-micron sections were cut, and randomly selected sections were stained with
hematoxylin and eosin. The sections were observed under the light
microscope.
TUNEL Staining
After 24 hours of cold preservation and 15 minutes after heart
transplantation, tissue was excised from the middle of the heart
between the apex and base, and cryosections were cut and randomly
selected for terminal dUTP nick end-labeling (TUNEL) staining as
previously described.16 Nuclei were counterstained with methyl
green. The total numbers of nuclei and of TUNEL-positive nuclei
were counted in 5 randomly chosen fields of view per tissue section
in a blinded manner, and results were expressed as the number of
TUNEL-positive nuclei divided by the number of counterstained
nuclei.
Immunochemical Analysis of Bcl-xL, Bax, and
Cyto-c in the Heart
After 24 hours of cold preservation and 15 minutes after transplantation, the heart was collected. Bcl-xL expression was determined by
Western blotting as previously described.16
To determine Bax translocation and cyto-c release after 15
minutes of heart transplantation, the heart was immersed in 4 mL
lysis buffer containing 250 mmol/L sucrose, 20 mmol/L HEPES,
10 mmol/L KCl, 1 mmol/L MgCl2, 1 mmol/L EDTA, 1 mmol/L
EGTA, 1 mmol/L dithiothreitol, and 1 mmol/L phenylmethylsulfonyl fluoride, pH 7.5, and incubated for 5 minutes on ice.23 The heart
was homogenized with a mixing homogenizer (Kinematica AG), and
the suspension was centrifuged at 750g for 10 minutes at 4°C to
sediment the nuclear fraction. The supernatant was collected and
centrifuged at 12 000g for 10 minutes at 4°C to sediment the
mitochondrial fraction. The resultant supernatant was further centrifuged at 14 000g for 10 minutes at 4°C and then filtered through a
0.22-␮m ultrafilter (Millipore) to generate a purified cytosolic
fraction.24
78
Circulation
July 5, 2005
Immunoblotting was performed according to standard protocols.
The protein concentration was measured by the bicinchoninic acid
method (Pierce). Aliquots of 40 ␮g of each sample were loaded on
15% sodium dodecyl sulfate polyacrylamide gels, subjected to
electrophoresis, and then transferred to nitrocellulose membranes.
The membranes were blocked with 5% milk in Tris-buffered saline
containing 0.1% Tween 20 at 4°C overnight and then probed with
rabbit antibody to Bax (sc-526, Santa, Cruz Biotechnology) and
mouse antibody to cyto-c (7H8.2C12, PharMingen), followed accordingly by horseradish peroxidase– conjugated anti-rabbit IgG
(Zymed) or horseradish peroxidase– conjugated anti-mouse IgG
(Amersham Biosciences) at room temperature for 1 hour. The
horseradish peroxidase was detected with a chemoluminescence
ECL-Plus kit (Amersham Biosciences UK). Cyto-c oxidase IV was
detected with mouse antibody to cyto-c oxidase IV (COX, A-6431,
Molecular Probes) as the mitochondrial marker, and ␣-tubulin was
detected with mouse antibody to ␣-tubulin (B-5-1-2, Sigma-Aldrich)
as an internal protein control.
Data were expressed as mean⫾SD. Statistical comparisons were
performed with ANOVA followed by Bonferroni/Dunn testing. A
probability value ⬍0.05 was considered statistically significant.
Results
Efficiency of Bcl-xL Gene Transfer and Duration
of Expression of Bcl-xL in the Heart
X-gal staining showed that the Adv expression was distributed in both the left and right ventricles after aortic root
injection of Adv vector (Figure 1A) and that the transductive
efficiency for cardiomyocytes was ⬇45% to 50% (data not
shown). Bcl-xL expression was also clearly proved by immunostaining methods (Figure 1B). Both immunostaining
and Western blotting showed that after Adv gene transduction, the expression of Bcl-xL was strong for 2 to 7 days after
gene transfer, then decreased, and almost reached normal
levels after 21 days (Figure 1C and 1D).
Bcl-xL Gene Transfer Decreased Infarct Size and
Inhibited CK Release in the Heart
The effects of Adv-mediated Bcl-xL gene transfer on infarct
size and CK release were assessed in isolated rat hearts
perfused with the Langendorff device. As shown in Figure 2A
and 2B, after 24-hour preservation in UWS at 4°C and 2-hour
reperfusion at 37°C, infarct size was 23.0⫾2.6% in the
AxCAhBclxL-treated group, 47.7⫾7.0% in the saline group,
and 48.6⫾6.1% in the AxCAZ3 group (n⫽4 in each group).
Bcl-xL gene transfer significantly reduced the infarct size
compared with saline or AxCAZ3 (P⬍0.01). Histological
examination showed that in control hearts, a large proportion
of cardiomyocytes underwent cell membrane rupture,
whereas AxCAhBclxL-treated heart did not show such
changes (data not shown). The coronary effluent was collected during the first 15 minutes of reperfusion, and total CK
level was measured as an index of myocardial damage. As
shown in Figure 2C, the CK level in hearts treated with
AxCAhBclxL was 0.82⫾0.27 IU; in contrast, the CK level
was 1.57⫾0.33 IU in saline-treated hearts and 1.50⫾0.37 IU
in AxCAZ3-treated hearts (n⫽4 each). Bcl-xL gene transfer
significantly decreased the CK level in the perfusate
(P⬍0.05).
Figure 1. A and B, LacZ and Bcl-xL expression in rat hearts
after Adv gene transduction via aortic root injection. Rat
hearts were harvested after 4 days of Adv gene transduction,
and LacZ and Bcl-xL expressions were detected by X-gal
staining and separate immunostaining . A, LacZ detection by
X-gal staining in whole hearts. B, Bcl-xL detection by immunostaining. Left, normal heart; right, Bcl-xL gene–transduced
heart. Cardiac myocytes appear red, Bcl-xL–positive cardiac
myocytes appear green, Bar⫽50 ␮m. C and D, Time course
of Bcl-xL expression after Adv Bcl-xL gene transduction via
aortic root injection. C, Bcl-xL expression detected by immunostaining. D, Bcl-xL expression detected by Western blotting. ␤-Tubulin was used as internal control. 1, Normal heart
and after AxCAhBclxL transfection: 2, 2 days; 3, 4 days; 4, 7
days; 5, 14 days; 6, and 21 days. Magnification ⫻400.
Bcl-xL Gene Transfer Prolonged Survival of
Cardiac Isografts After Cold Ischemia and Warm
Reperfusion Insult
To determine whether Bcl-xL prolonged the preservation
time, rat hearts that had been transduced with Bcl-xL gene
were harvested and preserved in UWS at 4°C for 24 hours;
subsequently, heterotopic heart transplantation was
performed.
As shown in Figure 3A and 3B, 70% (7 of 10) of the
control hearts that underwent 24 hours of cold ischemia
ceased to beat as early as ⬍15 minutes after transplantation
Huang et al
79
Figure 2. Effect of Bcl-xL gene transfer on
infarct size and CK release. Rat hearts
were stored at 4°C for 24 hours, perfused
in Langendorff device at 37°C for 2 hours,
and then cut evenly into 4 slices transversely from apex to base. A, Representative TTC-stained sections from perfused
heart. Top, saline-treated heart; middle,
AxCAZ3 (LacZ)-treated heart; bottom,
AxCAhBclxL (Bcl-xL)-treated heart. B,
Infarct size determined by TTC staining.
Data are mean⫾SD, n⫽4, **P⬍0.01. C, CK
activity in coronary effluent measured for
first 15 minutes of reperfusion. Value represent mean⫾SD, n⫽4, *P⬍0.05.
into syngeneic Lewis rats. Only 1 graft survived ⬎14 days in
the control group. In contrast, 88% (8 of 9 rats [1 rat died
because of complications of surgery]) of cardiac isografts
with Bcl-xL gene transfer survived ⬎14 days.
Bcl-xL Gene Transfer Decreased Cardiac Cell
Death and Inflammatory Cell Infiltration After
Heart Transplantation
Cardiac cell apoptosis was detected after 24 hours of cold
preservation and 15 minutes after heart transplantation. The
average number of TUNEL-positive nuclei was 6.5⫾1.9% in
AxCAhBclxL-treated hearts compared with 18.9⫾6.1% in
saline-treated hearts (Figure 4). Thus, Bcl-xL significantly
decreased cardiac cell apoptosis (P⬍0.01).
Hematoxylin-eosin staining was performed after 24 hours
of heart transplantation. As shown in Figure 5, there were
large numbers of cardiomyocytes that underwent necrosis in
the control saline and AxCAZ3-treated rat hearts, as evidenced by infiltration of polymorphonuclear and mononu-
clear leukocytes in the interstitium of the myocardium. In
contrast, in the AxCAhBclxL-treated hearts, myocardial
structure was well preserved, and only a few infiltrating
leukocytes were observed in the myocardium.
Bcl-xL Expression After 24 Hours of Cold
Preservation and 15 Minutes After Heterotopic
Heart Transplantation
We previously reported that preadministration of AxCAhBclxL resulted in a robust Bcl-xL expression in the rat heart.16
To determine whether cold preservation and warm reperfusion had some effect on the expression of Bcl-xL, immunoblot analysis of the heart after 24 hours of cold preservation
with or without heart transplantation was performed.
As shown in Figure 6, expression of Bcl-xL decreased after
24 hours of cold preservation and 15 minutes after heart
transplantation in control hearts (lanes 6, 9). In contrast, even
after 24 hours of cold preservation with or without heart
Figure 3. Graft survival after 24 hours of
cold preservation in rat heterotopic heart
transplantation model. A, Survival curve
after heterotopic heart transplantation in
hearts treated with AxCAhBclxL, saline,
and AxCAZ3 (n⫽10 in each group). B,
Survival time of individual hearts in each
group after heterotopic heart
transplantation.
80
Circulation
July 5, 2005
Figure 4. Detection of apoptosis in
hearts after 24 hours of cold preservation
and 15 minutes after heart transplantation by TUNEL staining. a, normal heart;
b, heart treated with saline; c, heart
treated with AxCAhBclxL. Normal nuclei
appear light blue; TUNEL-positive nuclei
appear dark brown. Magnification ⫻400.
Value represent mean⫾SD, n⫽4,
*P⬍0.01.
transplantation, Bcl-xL still showed high expression in
AxCAhBclxL-transfected hearts (lanes 2, 3).
Overexpression of Bcl-xL Inhibited Bax Translocation
and reperfusion caused Bax translocation from the cytosol to
the mitochondria, resulting in increased release of cyto-c
from the mitochondria to the cytosol. Overexpression of
Bcl-xL inhibited Bax translocation and cyto-c release.
Cold ischemia and reperfusion cause dysfunction of mitochondria and cyto-c release.15 To examine the effect of
Bcl-xL overexpression on Bax and cyto-c after 24 hours of
cold preservation and 15 minutes after heart transplantation,
we determined the effect of Bcl-xL overexpression on the
subcellular localization of Bax and cyto-c by immunoblot
analysis.
As shown in Figure 7, 24-hour cold preservation and
15-minute reperfusion after heart transplantation resulted in
Bax loss in the cytosol and release of cyto-c from the
mitochondria to the cytosol in controls (lanes 2, 3). In
contrast, overexpression of Bcl-xL by Adv transduction of the
heart prevented Bax loss from the cytosol and decreased the
cyto-c release (lane 4). The data show that cold preservation
Miniati et al25 found that Adv up-regulation of Bcl-2 inhibited
oxidative stress and graft coronary artery disease in rat heart
transplants. The authors performed the syngeneic-allogeneic
retransplantation technique to allow for maximal translation
of the Bcl-2 gene product at the time of allogeneic transplant
reperfusion. In the present study, we preadministered Adv
vector to the donor heart 4 days before transplantation and
found that Bcl-xL was efficiently expressed in the heart after
Adv vector transduction via the root of aorta. Overexpression
of Bcl-xL in the heart inhibited the cold ischemia and warm
reperfusion injury by decreasing cardiac cell apoptosis and
prolonged the preservation time of heart grafts. Rat hearts
Discussion
Figure 5. Histological examination of hearts after 24 hours of cold preservation and 24 hours after heart transplantation. a, e, normal
heart, no cold preservation; b, f, heart treated with saline; c, g, heart treated with AxCAZ3; d, h, heart treated with AxCAhBclxL. Magnifications are ⫻100 (upper panel) and ⫻400 (low panel). In hearts treated with AxCAhBclxL, inflammatory and polymorphonuclear cell
infiltration was obviously less than in hearts treated with saline or AxCAZ3.
Huang et al
81
Figure 6. A, Representative Western blot analysis of Bcl-xL after 24 hours of cold preservation and 15 minutes after heart transplantation. Lanes 1, 4, and 7, normal control heart; lanes 2 and 3, heart treated with AxCAhBclxL; lanes 5 and 6, heart treated with saline;
lanes 8 and 9, heart treated with AxCAZ3; lanes 2, 5, and 8, heart after 24 hour of cold preservation; lanes 3, 6, and 9, heart after 24
hours of cold preservation and 15 minutes after heart transplantation. ␤-Tubulin was used as internal control. B, Densitomery of Bcl-xL
expression in heart after 24 hours of cold preservation and 15 minutes after heart transplantation. Value represent mean⫾SD, n⫽3,
*P⬍0.05.
exposed to a prolonged period of cold ischemia (24 hours,
4°C) failed to function after transplantation into syngeneic
recipients.26 Our study suggests that Bcl-xL can serve as a
powerful cardiac preservation agent in heart transplantation.
Figure 7. A, Representative Western blot analysis of Bax and
cyto-c in mitochondrial and cytosolic fractions after 24 hours of
cold preservation and 15 minutes after heart transplantation.
Left, mitochondrial fraction; right, cytosolic fraction. 1, Normal
control heart; 2, heart treated with saline; 3, heart treated with
AxCAZ3; 4, heart treated with AxCAhBclxL. COX-V was used as
mitochondrial marker; ␣-tubulin was used as internal control of
cytosolic fraction. B, Densitometry of cytosolic Bax. Results are
representative of 3 independent experiments.
In the field of heart transplantation, various attempts
have been made to prolong cardiac preservation time. Most
of them have been designed to limit energy loss, maintain
intracellular ionic composition, and prevent hypothermic
myocyte swelling; however, even with optimal preservation after a long period of cold preservation, reperfusion of
the heart causes dysfunction and apoptosis and/or necrosis
of cardiac myocytes. There have been reports that Advmediated Bcl-xL16 or TAT-BH427 inhibited apoptosis of
cardiac myocytes caused by warm ischemia and reperfusion injury. In the present study, overexpression of Bcl-xL
was shown to decrease cardiac injury in a stringent and
clinically relevant model of 24-hour cold ischemia and
warm reperfusion followed by syngeneic transplantation.
Ex vivo experiments also showed that after 24-hour cold
preservation and 2-hour reperfusion at 37°C, infarct size
and CK levels were significantly reduced by Bcl-xL gene
transfer.
Mitochondria play a critical role in cell apoptosis.28,29 In
the heart, prolonged cold ischemia and warm reperfusion
jeopardize the myocardial capacity to regenerate energy by
mitochondrial oxidative phosphorylation30 and are correlated with a progressive loss of mitochondrial function.31
Cyto-c release from mitochondria occurs in both normothermic32 and cold ischemia and reperfusion,15 and cyto-c
release activates the caspase pathway, with consequent
induction of apoptosis.33 Furthermore, in pathophysiolog-
82
Circulation
July 5, 2005
ical settings, apoptosis frequently induces inflammation
because of the onset of secondary necrosis and stimulation
of cytokine and chemokine expression, which inevitably
result in the demise of adjacent cells that are not directly
damaged by the original insult. Necrosis is another form of
cardiac cell death after cold preservation and reperfusion.
The cardiac necrosis that was evidenced by infarct size
after ex vivo perfusion (Figure 2A) and inflammatory
response after heart transplantation (Figure 5d and 5h)
were decreased in the AxCAhBclxL-treated group, which
indicated that Bcl-xL may play a role in antinecrosis.
Recently, it has been suggested that cyto-c release potentially induces necrosis by depleting cellular ATP levels15;
thus, the pathway leading to apoptosis or necrosis can be
shared.34 The heterogeneity and extent of cyto-c release are
critical for regulating the switch between alternative development of apoptosis or necrosis.15
Thus, before irreversible changes occur in the mitochondria, inhibition of cyto-c release and protection of mitochondrial integrity would be important in preventing heart injury
caused by prolonged cold preservation and warm reperfusion.
Cyclosporin A, an inhibitor of mitochondrial permeability
transition, was proven to inhibit the apoptosis of cultured
neonate cardiac myocytes by decreasing the release of cytoc.23 In the present study, we showed that prolonged cold
expression and warm reperfusion decreased Bcl-xL level of
the heart, but in Bcl-xL gene–transduced hearts, even after 24
hours of cold preservation followed by 15 minutes of heart
transplantation, Bcl-xL still had strong expression. TUNEL
staining showed that after a long period of cold preservation,
cardiac cell apoptosis during the early stage of reperfusion in
the control group was significantly higher than in the
AxCAhBclxL-treated group. We found that overexpression
of Bcl-xL inhibited the translocation of Bax to the mitochondrial and decreased the release of cyto-c from the mitochondria to the cytosol. This is in accordance with results in a
transgenic mice model in which overexpression of Bcl-xL
prevented retinal cell apoptosis by inhibiting the translocation
of Bax.14 Therefore, inhibition of Bax translocation may be
one of the mechanisms through which Bcl-xL protects the
heart against prolonged cold preservation and warm reperfusion injury.
Our finding validated the feasibility of use of the Bcl-xL
gene in heart transplantation. This may contribute to the
development of a novel method aimed at prolongation of
cardiac cold preservation time.
Acknowledgments
This work was supported in part by a grant to Drs Hamada and Ito
from the Ministry of Education, Science, Japan.
References
1. Stringham JC, Southard JH, Hegge J, Triemstra L, Fields BL, Belzer FO.
Limitations of heart preservation by cold storage. Transplantation. 1992;
53:287–294.
2. Masters TN, Fokin AA, Schaper J, Pool L, Gong G, Robicsek F. Changes
in the preserved heart that limit the length of preservation. J Heart Lung
Transplant. 2002;21:590 –599.
3. Siegmund B, Zude R, Piper HM. Recovery of anoxic-reoxygenated cardiomyocytes from severe Ca2⫹ overload. Am J Physiol. 1992;263(pt
2):H1262–1269.
4. Thatte HS, Rhee JH, Zagarins SE, Treanor PR, Birjiniuk V, Crittenden
MD, Khuri SF. Acidosis-induced apoptosis in human and porcine heart.
Ann Thorac Surg. 2004;77:1376 –1383.
5. Harrison GJ, Willis RJ, Headrick JP. Extracellular adenosine levels and
cellular energy metabolism in ischemically preconditioned rat heart. Cardiovasc Res. 1998;40:74 – 87.
6. Flitter WD. Free radicals and myocardial reperfusion injury. Br Med Bull.
1993;49:545–555.
7. Fliss H, Gattinger D. Apoptosis in ischemic and reperfused rat myocardium. Circ Res. 1996;79:949 –956.
8. Zhao ZQ, Nakamura M, Wang NP, Wilcox JN, Shearer S, Ronson RS,
Guyton RA, Vinten-Johansen J. Reperfusion induces myocardial apoptotic cell death. Cardiovasc Res. 2000;45:651– 660.
9. Chatterjee S, Stewart AS, Bish LT, Jayasankar V, Kim EM, Pirolli T,
Burdick J, Woo YJ, Gardner TJ, Sweeney HL. Viral gene transfer of the
antiapoptotic factor Bcl-2 protects against chronic postischemic heart
failure. Circulation. 2002;106(suppl I):I-212–I-217.
10. Brocheriou V, Hagege AA, Oubenaissa A, Lambert M, Mallet VO,
Duriez M, Wassef M, Kahn A, Menasche P, Gilgenkrantz H. Cardiac
functional improvement by a human Bcl-2 transgene in a mouse model of
ischemia/reperfusion injury. J Gene Med. 2000;2:326 –333.
11. Katori M, Buelow R, Ke B, Ma J, Coito AJ, Iyer S, Southard D, Busuttil
RW, Kupiec-Weglinski JW. Heme oxygenase-1 overexpression protects
rat hearts from cold ischemia/reperfusion injury via an antiapoptotic
pathway. Transplantation. 2002;73:287–292.
12. Nakamura T, Mizuno S, Matsumoto K, Sawa Y, Matsuda H, Nakamura
T. Myocardial protection from ischemia/reperfusion injury by endogenous and exogenous HGF. J Clin Invest. 2000;106:1511–1519.
13. Yamamura T, Otani H, Nakao Y, Hattori R, Osako M, Imamura. IGF-I
differentially regulates Bcl-xL and Bax and confers myocardial protection
in the rat heart. Am J Physiol Heart Circ Physiol. 2001;280:
H1191–H1200.
14. He L, Perkins GA, Poblenz AT, Harris JB, Hung M, Ellisman MH, Fox
DA. Bcl-xL overexpression blocks bax-mediated mitochondrial contact
site formation and apoptosis in rod photoreceptors of lead-exposed mice.
Proc Natl Acad Sci U S A. 2003;100:1022–1027.
15. Kuznetsov AV, Schneeberger S, Seiler R, Brandacher G, Mark W,
Steurer W, Saks V, Usson Y, Margreiter R, Gnaiger E. Mitochondrial
defects and heterogeneous cytochrome c release after cardiac cold ischemia and reperfusion. Am J Physiol Heart Circ Physiol. 2004;286:
H1633–H1641.
16. Huang J, Ito Y, Morikawa M, Uchida H, Kobune M, Sasaki K, Abe T,
Hamada H. Bcl-xL gene transfer protects the heart against ischemia/
reperfusion injury. Biochem Biophys Res Commun. 2003;311:64 –70.
17. Shinoura N, Yoshida Y, Asai A, Kirino T, Hamada H. Relative level of
expression of Bax and Bcl-XL determines the cellular fate of apoptosis/
necrosis induced by the overexpression of Bax. Oncogene. 1999;18:
5703–5713.
18. Dehari H, Ito Y, Nakamura T, Kobune M, Sasaki K, Yonekura N,
Kohama G, Hamada H. Enhanced antitumor effect of RGD fibermodified adenovirus for gene therapy of oral cancer. Cancer Gene Ther.
2003;10:75– 85.
19. Takahashi K, Ito Y, Morikawa M, Kobune M, Huang J, Tsukamoto M,
Sasaki K, Nakamura K, Dehari H, Ikeda K, Uchida H, Hirai S, Abe T,
Hamada H. Adenoviral-delivered angiopoietin-1 reduces the infarction
and attenuates the progression of cardiac dysfunction in the rat model of
acute myocardial infarction. Mol Ther. 2003;8:584 –592.
20. Ono K, Lindsey ES. Improved technique of heart transplantation in rats.
J Thorac Cardiovasc Surg. 1969;57:225–229.
21. Granville DJ, TASHAkkor B, Takeuchi C, Gustafsson AB, Huang C,
Sayen MR, Wentworth P Jr, Yeager M, Gottlieb RA. Reduction of
ischemia and reperfusion-induced myocardial damage by cytochrome
P450 inhibitors. Proc Natl Acad Sci U S A. 2004;101:1321–1326.
22. McCully JD, Wakiyama H, Hsieh YJ, Jones M, Levitsky S. Differential
contribution of necrosis and apoptosis in myocardial ischemiareperfusion injury. Am J Physiol Heart Circ Physiol. 2004;286:
H1923–H1935.
23. Shiraishi J, Tatsumi T, Keira N, Akashi K, Mano A, Yamanaka S, Matoba
S, Asayama J, Yaoi T, Fushiki S, Fliss H, Nakagawa M. Important role
of energy-dependent mitochondrial pathways in cultured rat cardiac
myocyte apoptosis. Am J Physiol Heart Circ Physiol. 2001;281:
H1637–H1647.
24. Deng Y, Wu X. Peg3/Pw1 promotes p53-mediated apoptosis by inducing
Bax translocation from cytosol to mitochondria. Proc Natl Acad Sci
U S A. 2000;97:12050 –12055.
Huang et al
25. Miniati DN, Lijkwan MA, Murata S, Martens J, Coleman CT, Hoyt EG,
Robbins RC. Effects of adenoviral upregulation of bcl-2 on oxidative
stress and graft coronary artery disease in rat heart transplants Transplantation. 2003;76:382–386.
26. Akamatsu Y, Haga M, Tyagi S, Yamashita K, Graca-Souza AV, Ollinger
R, Czismadia E, May GA, Ifedigbo E, Otterbein LE, Bach FH, Soares
MP. Heme oxygenase-1– derived carbon monoxide protects hearts from
transplant associated ischemia reperfusion injury. FASEB J. 2004;18:
771–772.
27. Sugioka R, Shimizu S, Funatsu T, Tamagawa H, Sawa Y, Kawakami T,
Tsujimoto Y. BH4-domain peptide from Bcl-xL exerts anti-apoptotic
activity in vivo. Oncogene. 2003;22:8432– 8440.
28. Kluck RM, Bossy-Wetzel E, Green DR, Newmeyer DD. The release of
cytochrome c from mitochondria: a primary site for Bcl-2 regulation of
apoptosis. Science. 1997;275:1132–1136.
29. Kroemer G, Reed JC. Mitochondrial control of cell death. Nat Med.
2000;6:513–519.
83
30. Kay L, Daneshrad Z, Saks VA, Rossi A. Alteration in the control of
mitochondrial respiration by outer mitochondrial membrane and creatine
during heart preservation. Cardiovasc Res. 1997;34:547–556.
31. Kuwabara M, Takenaka H, Maruyama H, Onitsuka T, Hamada M. Effect
of prolonged hypothermic ischemia and reperfusion on oxygen consumption and total mechanical energy in rat myocardium: participation of
mitochondrial oxidative phosphorylation. Transplantation. 1997;64:
577–583.
32. Weiss JN, Korge P, Honda HM, Ping P. Role of the mitochondrial
permeability transition in myocardial disease. Circ Res. 2003;93:
292–301.
33. Gottlieb RA, Burleson KO, Kloner RA, Babior BM, Engler RL. Reperfusion injury induces apoptosis in rabbit cardiomyocytes. J Clin Invest.
1994;94:1621–1628.
34. Tatsumi T, Shiraishi J, Keira N, Akashi K, Mano A, Yamanaka S, Matoba
S, Fushiki S, Fliss H, Nakagawa M. Intracellular ATP is required for
mitochondrial apoptotic pathways in isolated hypoxic rat cardiac
myocytes. Cardiovasc Res. 2003;59:428 – 440.
Augmented Cardiac Hypertrophy in Response to Pressure
Overload in Mice Lacking the Prostaglandin I2 Receptor
Akiyoshi Hara, PhD; Koh-ichi Yuhki, PhD; Takayuki Fujino, MD; Takehiro Yamada, PhD; Koji Takayama, MD;
Shuhko Kuriyama, MD; Osamu Takahata, MD; Hideji Karibe, PhD; Yuji Okada, MD; Chun-Yang Xiao, PhD;
Hong Ma, MD; Shuh Narumiya, MD; Fumitaka Ushikubi, MD
Background—In the heart, the expressions of several types of prostanoid receptors have been reported. However, their
roles in cardiac hypertrophy in vivo remain unknown. We intended to clarify the roles of these receptors in pressure
overload–induced cardiac hypertrophy using mice lacking each of their receptors.
Methods and Results—We used a model of pressure overload–induced cardiac hypertrophy produced by banding of the
transverse aorta in female mice. In wild-type mice subjected to the banding, cardiac hypertrophy developed during the
observation period of 8 weeks. In mice lacking the prostaglandin (PG) I2 receptor (IP⫺/⫺), however, cardiac hypertrophy
and cardiomyocyte hypertrophy were significantly greater than in wild-type mice at 2 and 4 weeks but not at 8 weeks,
whereas there was no such augmentation in mice lacking the prostanoid receptors other than IP. In addition, cardiac
fibrosis observed in wild-type hearts was augmented in IP⫺/⫺ hearts, which persisted for up to 8 weeks. In IP⫺/⫺ hearts,
the expression level of mRNA for atrial natriuretic peptide, a representative marker of cardiac hypertrophy, was
significantly higher than in wild-type hearts. In vitro, cicaprost, an IP agonist, reduced platelet-derived growth
factor–induced proliferation of wild-type noncardiomyocytes, although it could not inhibit cardiotrophin-1–induced
hypertrophy of cardiomyocytes. Accordingly, cicaprost increased cAMP concentration efficiently in
noncardiomyocytes.
Conclusions—IP plays a suppressive role in the development of pressure overload–induced cardiac hypertrophy via the
inhibition of both cardiomyocyte hypertrophy and cardiac fibrosis. Both effects have been suggested as originating from
the action on noncardiomyocytes rather than cardiomyocytes. (Circulation. 2005;112:84-92.)
Key Words: hypertrophy 䡲 myocardium 䡲 pressure 䡲 prostaglandins 䡲 thromboxanes
C
ardiac hypertrophy in response to pressure overload is a
compensatory mechanism to maintain circulatory homeostasis.1 When the mechanical overload on the heart is
severe and prolonged, however, it is an important risk factor
in cardiac morbidity and mortality.2 In addition, many patients suffer from this condition because hypertension is a
common cardiovascular disease that over time leads to
cardiac hypertrophy. Therefore, the mechanisms underlying
the development of pressure overload–induced cardiac hypertrophy have been studied extensively. Until now, several
extracellular signaling molecules, such as endothelin, angiotensin II, and cardiotrophin-1, have been proposed as mediators promoting pressure overload–induced cardiac hypertrophy.3–5 In contrast, little is known about these signaling
molecules that ameliorate pressure overload–induced cardiac
hypertrophy.
Prostanoids, consisting of prostaglandins (PGs) and
thromboxane, exert various actions in the cardiovascular
system.6 – 8 PGI2 is known as a vasodilator and an inhibitor of
platelet activation. In contrast, thromboxane A2 is a potent
vasoconstrictor and a platelet stimulator. In the heart, several
prostanoids, such as PGE2 and PGI2, have been reported to
show cardioprotective actions against ischemia/reperfusion
injury.9 –11 In regard to cardiac hypertrophy, several reports
suggest the participation of prostanoids in its development.
These include inhibitory effects of PGI2 and its analogue on
angiotensin II–induced hypertrophy in cultured cardiomyocytes12 and their inhibitory effects on proliferation and
collagen synthesis in cultured cardiac fibroblasts.13 In addition, synthesis of PGE2 and PGI2 has been reported to be
elevated in the hypertrophied and failing heart14,15 along with
an upregulation of cyclooxygenase (COX)-2.16 The hypertrophic effect of exogenously administered PGF2␣ on cardiomyocytes has also been reported.17,18 Furthermore, several
types and subtypes of prostanoid receptors have been reported to be expressed in the heart.6,7 These results suggest
Received June 28, 2004; de novo received December 1, 2004; revision received February 28, 2005; accepted March 9, 2005.
From the Department of Pharmacology, Asahikawa Medical College, Asahikawa (A.H., K.Y., T.F., T.Y., K.T., S.K., O.T., H.K., Y.O., C.-Y.X., H.M.,
F.U.), and the Department of Pharmacology, Kyoto University Faculty of Medicine, Kyoto (S.N.), Japan.
The online-only Data Supplement can be found with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.104.527077/DC1.
Correspondence to Fumitaka Ushikubi, MD, Department of Pharmacology, Asahikawa Medical College, Midorigaoka-Higashi 2-1-1-1, Asahikawa
078-8510, Japan. E-mail [email protected]
84
Hara et al
some roles played by these receptors in the development of
pressure overload–induced cardiac hypertrophy; their exact
roles in vivo, however, remain unknown.
DP, EP, FP, IP, and TP are the receptors for PGD2, PGE2,
PGF2␣, PGI2, and thromboxane A2, respectively. In addition,
there are 4 subtypes of EP: EP1, EP2, EP3, and EP4.6,7 In the
present study we intended to clarify the roles of prostanoid
receptors in pressure overload–induced cardiac hypertrophy
using mice each lacking one of these receptors.
Role of PGI2 Receptor in Cardiac Hypertrophy
85
TABLE 1. Effects of Aortic Banding on Heart Rate and Blood
Pressure in Mice Lacking Prostanoid Receptors
WT
n
HR, bpm
SBP, mm Hg
DBP, mm Hg
72⫾2
14
631⫾18
100⫾3
EP2⫺/⫺
5
649⫾11
90⫾2
65⫾2
EP3⫺/⫺
5
598⫾19
106⫾2
76⫾2
FP⫺/⫺
4
643⫾21
105⫾3
68⫾5
76⫾4
8
636⫾21
101⫾5
TP⫺/⫺
4
637⫾17
97⫾4
70⫾5
F2 WT
7
646⫾12
100⫾3
72⫾5
Mice
EP4⫺/⫺
7
607⫾30
110⫾4
81⫾4
The generation and maintenance of mice lacking EP2, EP3, EP4, FP,
IP, or TP (EP2⫺/⫺, EP3⫺/⫺, EP4⫺/⫺, FP⫺/⫺, IP⫺/⫺, and TP⫺/⫺ mice,
respectively) have been reported.19 –24 All mice, including the wildtype control mice, but with the exception of EP4⫺/⫺ mice, have a
genetic background of C57BL/6 mice. EP4⫺/⫺ mice have a mixed
genetic background of 129sv/ola and C57BL/6 mice.21 For the
experiments in which EP4⫺/⫺ mice were used, F2 wild-type mice with
a mixed genetic background similar to that of EP4⫺/⫺ mice were used
as a control. All experiments, which were approved by the Asahikawa Medical College Committee on Animal Research, were
performed with the use of 12- to 15-week-old female mice or 18- to
20-day fetuses.
Heart rate (HR), systolic blood pressure (SBP), and diastolic blood pressure
(DBP) were measured by the tail-cuff method in wild-type (WT), EP2⫺/⫺, EP3⫺/⫺,
FP⫺/⫺, IP⫺/⫺, TP⫺/⫺, F2 wild-type (F2 WT), and EP4⫺/⫺ mice at 4 weeks of aortic
banding. Each value represents mean⫾SEM.
Methods
Expression of mRNAs for Prostanoid Receptors
To examine the expression of mRNAs for prostanoid receptors in the
heart, we prepared total RNA from the heart using Isogen (Nippon
Gene) and performed reverse transcription–polymerase chain reaction (RT-PCR) as reported.11,25 A similar procedure was used in the
examination of IP mRNA expression in cardiomyocytes and
noncardiomyocytes.
A Model of Pressure Overload–Induced
Cardiac Hypertrophy
Pressure overload was produced by banding of the transverse aorta
(transverse aortic constriction procedure) according to the reported
method26 with minor modifications. Briefly, mice anesthetized with
ketamine (100 mg/kg IP) and xylazine (5 mg/kg IP) were maintained
under a respirator (model 480-7, Shinano Industry). After thoracotomy, the transverse aorta was exposed between the carotid arteries
and was constricted by ligation with 7-0 nylon string along with a
blunted 24-gauge needle, which needle was then pulled out. As
controls, sham-operated mice were produced; they received essentially the same operation except for the aortic ligation. At indicated
times after the banding, wet weight of the heart (HW) and body
weight (BW) were measured, and their ratios (HW/BW ratio) were
used as indices of cardiac hypertrophy.
To assess the degree of pressure overload, a polyethylene cannula,
connected to a pressure transducer, was inserted into the right and
left carotid arteries in some of the wild-type and IP⫺/⫺ mice. Arterial
pressure was measured before and at a steady state within 10 minutes
after the banding.
Blood pressure and heart rate of conscious mice were measured by
the tail-cuff method (BP-98A, Softron) between 9 AM and noon at
indicated times after the banding, as reported.10 The values were
obtained by averaging at least 5 measurements. The results showed
that blood pressure and heart rate were not significantly different
between wild-type and IP⫺/⫺ mice at 1, 2, 4, or 8 weeks of the
banding (data not shown). Similarly, blood pressure and heart rate at
4 weeks of the banding were not significantly different among
wild-type, EP2⫺/⫺, EP3⫺/⫺, FP⫺/⫺, and TP⫺/⫺ mice or between F2
wild-type and EP4⫺/⫺ mice (Table 1).
Histological Analysis of the Heart
At indicated times, hearts were fixed with 10% formalin and
embedded in paraffin. Five transverse sections (5-␮m thickness)
IP
⫺/⫺
were prepared from the middle segment of the heart at intervals of
0.3 mm. The sections were stained with hematoxylin and eosin for
examination of their gross appearance and were stained by the van
Gieson method for measurements of cardiomyocyte hypertrophy and
cardiac fibrosis. Cardiomyocyte hypertrophy was assessed by measuring cross-sectional area of 100 cardiomyocytes having nearly
circular capillary profiles and nuclei in the left ventricle near the
endocardial region. Cardiac fibrosis was assessed separately as
interstitial and perivascular fibrosis by calculating the ratio of van
Gieson–stained area of interstitial or perivascular fibrosis to total
area of cardiac tissue in each section. These analyses were performed
by digital planimetry with the use of NIH Image computer
software.27
Expression of mRNAs for COXs and Atrial
Natriuretic Peptide
We examined whether the cardiac expression of mRNAs for COX-1,
a constitutive isoform, and COX-2, an inducible isoform, changes on
pressure overload. We also examined cardiac expression of mRNA
for atrial natriuretic peptide (ANP), a representative marker of
cardiac hypertrophy. Total RNA was prepared from the left ventricles at indicated times,11 and the expression levels of the mRNAs
were determined by RT-PCR with the use of the expression level of
18S ribosomal RNA (rRNA) as an internal control. The sequences
of the primers used were as follows: COX-1 (sense), 5⬘CTGCTGAGAAGGGAGTTCATT3⬘; COX-1 (antisense), 5⬘GTCGCACACGCGGTTATGTT3⬘; COX-2 (sense), 5⬘ACACTCTATCACTGGCACCC3⬘; COX-2 (antisense), 5⬘GGACGAGGTTTTTCCACCAG3⬘; ANP (sense), 5⬘ATGGGCTCCTTCTCCATCACC3⬘; ANP
(antisense), 5⬘TCCACTCTGGGCTCCAATCCTGT3⬘; 18S rRNA
(sense), 5⬘ATCCTGCCAGTAGCATATGC3⬘; and 18S rRNA (antisense), 5⬘CCGAGGTTATCTAGAGTCAC3⬘.
Measurements of 6-Keto-PGF1␣ Contents
in the Heart
To determine whether pressure overload increases PGI2 production
in the heart, we measured the tissue contents of 6-keto-PGF1␣, a
stable metabolite of PGI2. Tissue samples were prepared from the left
ventricle of wild-type mice at indicated times after the aortic
banding, and the contents of 6-keto-PGF1␣ were measured with an
EIA kit (Cayman Chemical).
In Vitro Examination of Cardiomyocyte
Hypertrophy and Noncardiomyocyte Proliferation
Cultures of cardiomyocytes and noncardiomyocytes were performed
as reported.11 In short, cardiac ventricles of fetal mice were minced
and then incubated with a buffer containing 0.1% collagenase
(Wako) for 60 minutes at 37°C. The cells were filtrated through a
nylon mesh, suspended in a culture medium (DMEM/F-12 supple-
86
Circulation
July 5, 2005
mented with 100 U/mL penicillin and 100 ␮g/mL streptomycin)
containing 2.5% fetal calf serum, and then preplated onto a dish to
separate cardiomyocytes from noncardiomyocytes. After incubation
for 30 minutes, unattached cardiomyocytes were harvested and used
for an assay. Attached noncardiomyocytes were grown to near
confluence and then used for an assay.
Hypertrophy of cardiomyocytes was estimated by [14C]leucine
incorporation, and proliferation of noncardiomyocytes was by
[3H]thymidine incorporation and cell number. Cardiomyocytes were
plated into 24-well culture plates at 105 cells per well. Noncardiomyocytes were plated into 24-well culture plates at 104 cells per well
and into 6-well culture plates at 5⫻104 cells per well for examination
of [3H]thymidine incorporation and cell number, respectively. After
48 hours of culture, culture medium was changed to a fresh one
containing vehicle or cicaprost (10⫺5 mol/L, Schering), and indomethacin (10⫺5 mol/L, Sigma). In cardiomyocytes, cardiotrophin-1
(10⫺10 mol/L, Genzyme/Techne) and [14C]leucine (0.1 mCi/mL,
Amersham) were added to the culture medium, and the cells were
cultured for 48 hours. In noncardiomyocytes, platelet-derived growth
factor (PDGF) (Peprotec) or fetal calf serum was added at 5 ng/mL
or 0.5%, respectively, to the culture medium 30 minutes after the
medium change. For examination of [3H]thymidine incorporation,
the cells were cultured for 24 hours, and then [3H]thymidine (2
mCi/mL, Amersham) was added, and the cells were cultured for an
additional 6 hours. For cell number count, the cells were cultured for
48 hours, harvested by trypsin-EDTA treatment, and counted with a
hemocytometer. Amounts of [14C]leucine and [3H]thymidine incorporated into cardiomyocytes and noncardiomyocytes, respectively,
were quantified by liquid scintillation counter.
TABLE 2. Effects of Aortic Banding on BW, HW, and BW/HW
Ratio in Mice Lacking Prostanoid Receptors
Measurements of cAMP Accumulation
BW and HW were measured in wild-type (WT), EP2⫺/⫺, EP3⫺/⫺, FP⫺/⫺, IP⫺/⫺,
TP⫺/⫺, F2 wild-type (F2 WT), and EP4⫺/⫺ mice at 4 weeks of aortic banding or
sham operation. Each value represents mean⫾SEM.
*P⬍0.05 vs corresponding sham-operated mice; †P⬍0.05 vs aortic-banded
wild-type mice.
The cardiomyocytes and noncardiomyocytes were preincubated for
30 minutes at 37°C in the culture medium containing 10⫺5 mol/L
indomethacin and 1 mmol/L 3-isobutyl-1-methylxanthine (SigmaAldrich). Then the cardiomyocytes were stimulated with vehicle,
cicaprost (10⫺6 or 10⫺5 mol/L), or isoproterenol (10⫺7 mol/L, Nacalai
Tesque), and the noncardiomyocytes were stimulated with vehicle or
cicaprost (10⫺6 or 10⫺5 mol/L). After stimulation for 30 minutes at
37°C, the levels of intracellular cAMP ([cAMP]i) were measured as
reported.25 We determined the protein contents of the cells by use of
a BCA protein assay kit (Pierce Chemical).
All values are expressed as mean⫾SEM. Statistical analysis was
performed with 1-way (Figure 5 and Tables 1 and 2) or 2-way
(Figures 1C, 2B, 3B, and 4 and Table 3) ANOVA followed by
Duncan’s test for multiple comparisons. A difference was considered
statistically significant at P⬍0.05 from the 2-tailed test. All data
were analyzed with the software program Super ANOVA, version
1.11.
Results
Expression of mRNAs for Prostanoid Receptors in
the Heart
We first examined which types and subtypes of prostanoid
receptors are expressed in the heart using the RT-PCR
method. We found the expression of mRNAs for EP2, EP3,
EP4, FP, IP, and TP but not for EP1 and DP (Figure 1A).
In Vivo Model of Pressure Overload–Induced
Cardiac Hypertrophy
On the basis of the results of RT-PCR analysis, we next
examined cardiac hypertrophy using a model of pressure
overload–induced cardiac hypertrophy in EP2⫺/⫺, EP3⫺/⫺,
EP4⫺/⫺, FP⫺/⫺, IP⫺/⫺, and TP⫺/⫺ mice. In wild-type mice, HW
and HW/BW ratio at 4 weeks after aortic banding were
significantly higher than that in sham-operated mice, indicat-
n
BW, g
HW, mg
HW/BW,
mg/g
Sham-operated mice
WT
14
22.5⫾0.6
⫺/⫺
104.3⫾2.6
4.7⫾0.1
6
EP3⫺/⫺
5
21.6⫾0.8
99.4⫾3.9
4.6⫾0.1
22.8⫾0.2
106.0⫾2.1
FP⫺/⫺
4.6⫾0.1
5
21.5⫾0.5
103.9⫾2.2
IP⫺/⫺
4.8⫾0.1
8
23.7⫾0.8
113.1⫾5.7
4.6⫾0.1
TP
5
22.0⫾0.7
105.9⫾2.9
4.8⫾0.1
F2 WT
7
21.6⫾0.5
99.9⫾3.3
4.7⫾0.2
EP4⫺/⫺
7
22.9⫾1.5
110.7⫾5.0
4.9⫾0.1
EP2
⫺/⫺
Aortic-banded mice
WT
8
22.7⫾0.5
151.6⫾9.1*
6.7⫾0.5*
EP2⫺/⫺
5
23.1⫾0.5
147.5⫾9.1*
6.4⫾0.3*
EP3⫺/⫺
7
25.1⫾0.6
158.1⫾9.6*
6.3⫾0.3*
FP⫺/⫺
5
21.7⫾1.0
152.7⫾11.7*
7.1⫾0.8*
IP
6
24.2⫾0.4
195.5⫾14.1*†
8.2⫾0.7*†
TP⫺/⫺
5
24.4⫾1.0
160.9⫾8.1*
6.6⫾0.4*
⫺/⫺
F2 WT
6
23.8⫾0.7
150.9⫾12.4*
6.3⫾0.4*
EP4⫺/⫺
5
24.3⫾0.9
162.2⫾12.0*
6.7⫾0.5*
ing that the procedure induced cardiac hypertrophy. In IP⫺/⫺
mice, however, HW and HW/BW ratio were significantly
greater than those in wild-type mice, suggesting that IP
mediated an antihypertrophic effect (Table 2 and Figures 1B
and 1C). In contrast, there were no such differences among
wild-type, EP2⫺/⫺, EP3⫺/⫺, FP⫺/⫺, and TP⫺/⫺ mice or between
F2 wild-type and EP4⫺/⫺ mice (Table 2). In sham-operated
groups, there was no significant difference in HW, BW, and
HW/BW ratio among wild-type, EP2⫺/⫺, EP3⫺/⫺, FP⫺/⫺, and
TP⫺/⫺ mice or between F2 wild-type and EP4⫺/⫺ mice (Table
2). These results suggest that IP is the only prostanoid
receptor able to affect the development of pressure overload–
induced cardiac hypertrophy, at least in the present model.
When the time course of the hypertrophy was examined, it
was already apparent at 1 week after the banding, reached a
maximum level at 2 weeks, and continued at a similar level
thereafter (Figure 1C and Table 3). The HW or HW/BW ratio
at 1 week was not significantly different between wild-type
and IP⫺/⫺ mice. At 2 and 4 weeks, however, both HW and
HW/BW ratio in IP⫺/⫺ mice were significantly greater than
those in wild-type mice (Figure 1C and Table 3). At 8 weeks
after the banding, however, there was no significant difference in the HW/BW ratio between wild-type and IP⫺/⫺ mice,
whereas HW was still significantly greater in IP⫺/⫺ mice than
in wild-type mice. There was no significant difference in BW
after the banding between wild-type and IP⫺/⫺ mice throughout the experiment (Table 3). These results clearly indicate
that IP participates in the suppression of pressure overload–
induced cardiac hypertrophy.
Hara et al
Figure 1. Expression of mRNAs for prostanoid receptors in the
heart and degree of cardiac hypertrophy induced by pressure
overload in mice lacking prostanoid receptors individually. A,
Expressions of mRNAs for prostanoid receptors were determined in cardiac ventricles of wild-type mice by RT-PCR. B,
Representative photographs of whole heart isolated from wildtype and IP⫺/⫺ mice at 2 weeks of aortic banding and corresponding midtransverse sections stained with hematoxylin and
eosin. C, HW/BW ratios at 1, 2, 4, and 8 weeks after aortic
banding in wild-type and IP⫺/⫺ mice. n⫽4 to 7. *P⬍0.05 vs corresponding sham-operated mice; †P⬍0.05 vs aortic-banded
wild-type mice.
Before the banding, the systolic pressures in carotid arteries were 71.0⫾8.8 (n⫽4) and 70.0⫾6.4 (n⫽3) mm Hg in
wild-type and IP⫺/⫺ mice, respectively. After the banding, the
systolic pressures in right carotid artery increased to
88.5⫾8.5 and 87.3⫾7.5 mm Hg, respectively, and those in
left carotid artery decreased to 65.5⫾6.9 and
65.0⫾4.9 mm Hg, respectively, resulting in a pressure gradient of 23.0⫾1.6 and 22.3⫾2.7 mm Hg, respectively. This
suggests that a similar degree of pressure overload was given
between wild-type and IP⫺/⫺ hearts by the procedure.
Cardiomyocyte Hypertrophy and Cardiac Fibrosis
Cardiac hypertrophy is associated frequently with both cardiomyocyte hypertrophy and cardiac fibrosis, with the latter
consisting of both interstitial and perivascular fibrosis. To
determine whether the antihypertrophic role of IP is due to
inhibition of cardiomyocyte hypertrophy or cardiac fibrosis,
we measured the cross-sectional area of cardiomyocytes
(Figure 2) and the area of cardiac fibrosis (Figure 3). In
wild-type mice, the cross-sectional area of cardiomyocytes
and the area of cardiac fibrosis increased significantly after
the banding compared with those in sham-operated mice,
indicating the development of both cardiomyocyte hypertrophy and cardiac fibrosis.
87
Figure 2. Cardiomyocyte hypertrophy induced by pressure
overload in wild-type and IP⫺/⫺ mice. A, Histological manifestation of cardiomyocytes at 2 weeks after aortic banding. Magnification ⫻300. B, Cross-sectional area of cardiomyocytes was
measured at 1, 2, 4, and 8 weeks after aortic banding. n⫽4 to
9. *P⬍0.05 vs corresponding sham-operated mice; †P⬍0.05 vs
aortic-banded wild-type mice.
At 1 week after the aortic banding, the cross-sectional area
of cardiomyocytes was not significantly different between
wild-type and IP⫺/⫺ hearts (Figure 2B). At 2 and 4 weeks after
the banding, however, it was significantly more augmented in
IP⫺/⫺ hearts than in wild-type hearts, indicating that IPmediated signal suppressed the development of cardiomyocyte hypertrophy. At 8 weeks after the banding, the crosssectional area of cardiomyocytes in IP⫺/⫺ hearts was not
significantly different from that in wild-type hearts, suggesting that mechanisms leading to cardiomyocyte hypertrophy
caught up with the suppressive effect of IP.
In wild-type hearts, the increase in the area of perivascular
fibrosis was already apparent at 1 week after the banding, and
it further increased gradually thereafter (Figure 3B, top). In
contrast, the increase in the area of interstitial fibrosis was not
apparent at 1 week after the banding, reached a maximum
level at 2 weeks, and then declined gradually (Figure 3B,
bottom). The difference in the appearance times of perivascular and interstitial fibrosis may be derived from the different timing of inflammatory cell infiltration into these 2
areas,28 and the late-phase decline of interstitial fibrosis may
suggest decreased contents of type III collagen during progression of cardiac fibrosis.29 At 1 week after the banding,
both fibrotic areas were not significantly different between
wild-type and IP⫺/⫺ hearts (Figure 3B). At 2 and 4 weeks,
however, these areas were significantly enlarged in IP⫺/⫺
hearts compared with those in wild-type hearts. In contrast to
cardiomyocyte hypertrophy, these fibrotic areas at 8 weeks
were still significantly larger in IP⫺/⫺ hearts than in wild-type
88
Circulation
July 5, 2005
There was no significant difference in the cross-sectional
area of cardiomyocytes and the area of interstitial and
perivascular fibrosis among wild-type, EP2⫺/⫺, EP3⫺/⫺, FP⫺/⫺,
and TP⫺/⫺ mice or between F2 wild-type and EP4⫺/⫺ mice at
4 weeks after the banding (see online-only Data Supplement).
Expression of ANP mRNA in the Heart
We next examined whether IP deficiency affects the cardiac
expression of hypertrophy-related genes, in which we used
ANP mRNA as a marker. In wild-type mice, the expression
level of ANP mRNA increased significantly at 2 weeks of the
banding compared with that in sham-operated mice (Figure
4), indicating that pressure overload induced gene expression
along with the development of cardiac hypertrophy. In IP⫺/⫺
hearts, however, expression levels were significantly higher
than those in wild-type hearts throughout the experimental
period. Moreover, in IP⫺/⫺ hearts, its significant increase was
apparent as early as 1 week after the banding. Interestingly,
the expression level in sham-operated IP⫺/⫺ mice was slightly
but significantly higher than that in sham-operated wild-type
mice, suggesting an inhibitory effect of basally produced
PGI2 on ANP mRNA expression. These results suggest that
stimulation of IP is able to modulate the expression of
hypertrophy-related genes in the heart.
Expression of COX mRNAs and Production of
PGI2 in the Heart
Figure 3. Cardiac fibrosis induced by pressure overload in wildtype and IP⫺/⫺ mice. A, Histological manifestation of van Gieson–stained interstitial and perivascular fibrosis in sections of
cardiac ventricles at 2 weeks after aortic banding. Arrows indicate fibrotic area. Magnification ⫻20. B, Ratios of area of
perivascular (top) and of interstitial (bottom) fibrosis to total cardiac area at 1, 2, 4, and 8 weeks after aortic banding were presented. n⫽4 to 10. *P⬍0.05 vs corresponding sham-operated
mice; †P⬍0.05 vs aortic-banded wild-type mice.
hearts, suggesting a potent antifibrotic role of IP. These
results indicate that IP participates in the suppression of both
cardiomyocyte hypertrophy and cardiac fibrosis.
To determine whether pressure overload affects the expression of COXs and production of PGI2, we measured the
expression levels of COX mRNAs and 6-keto-PGF1␣ contents in the left ventricle of wild-type mice. The expression
level of mRNA for COX-1 or COX-2 did not change
significantly after the banding throughout the experimental
period compared with that before the banding (data not
shown). In addition, the expression of COX-2 mRNA was
barely detectable by the present method, and its level was
significantly lower than that of COX-1 mRNA compared
with the use of an 18S rRNA as an internal control. Accordingly, there was no significant change in the cardiac level of
6-keto-PGF1␣ throughout the experimental period; these
values were 10.4⫾2.1 (n⫽4) and 9.3⫾2.3 (n⫽5) pg/mg wet
weight in aortic-banded and sham-operated groups, respectively, at 1 week of the banding. These results indicate that
the pressure overload did not affect COX mRNA expression
or PGI2 production in the heart, whereas significant amounts
of PGI2 were being produced in the heart irrespective of the
presence or absence of pressure overload.
Effects of Cicaprost on Noncardiomyocyte
Proliferation and Cardiomyocyte Hypertrophy
Figure 4. Changes in expression levels of ANP mRNA induced
by pressure overload in wild-type and IP⫺/⫺ mice. Expression
levels of ANP mRNA in left ventricle were determined by
RT-PCR at 1, 2, 4, and 8 weeks after aortic banding. n⫽3 to 5.
*P⬍0.05 vs corresponding sham-operated mice; †P⬍0.05 vs
corresponding wild-type mice.
To determine whether the antihypertrophic effect of IP is
derived from its action on noncardiomyocytes or cardiomyocytes, we examined the effects of cicaprost, an IP agonist, on
noncardiomyocyte proliferation and cardiomyocyte hypertrophy. In wild-type noncardiomyocytes, PDGF increased
[3H]thymidine incorporation 113% above control, indicating
that PDGF could stimulate DNA synthesis of noncardiomyocytes (Figure 5A). Cicaprost significantly inhibited the
PDGF-induced increase in [3H]thymidine incorporation in
Hara et al
TABLE 3.
89
Effects of Aortic Banding on BW and HW in Wild-Type and IPⴚ/ⴚ Mice
Weeks After Aortic Banding
1
2
4
8
BW, g
WT (SO)
20.8⫾0.6 (4)
22.7⫾1.4 (4)
22.5⫾1.2 (4)
24.1⫾1.0 (4)
WT (AB)
20.7⫾0.6 (10)
21.7⫾0.4 (9)
22.7⫾0.4 (9)
23.5⫾0.7 (6)
IP⫺/⫺ (SO)
21.8⫾1.6 (4)
22.8⫾1.3 (4)
22.2⫾0.8 (4)
24.1⫾0.8 (4)
IP⫺/⫺ (AB)
20.7⫾0.3 (7)
22.7⫾0.3 (8)
23.6⫾0.7 (7)
26.1⫾0.9 (9)
115.5⫾3.9 (4)
HW, mg
WT (SO)
98.0⫾1.6 (4)
104.6⫾5.5 (4)
104.6⫾5.0 (4)
WT (AB)
113.9⫾4.6 (10)
144.2⫾3.7 (9)*
143.8⫾7.6 (9)*
151.1⫾9.3 (6)*
IP⫺/⫺ (SO)
107.7⫾5.4 (4)
108.9⫾5.5 (4)
99.0⫾3.4 (4)
109.7⫾7.0 (4)
IP⫺/⫺ (AB)
122.7⫾6.6 (7)
172.1⫾6.4 (8)*†
177.2⫾11.6 (7)*†
181.5⫾10.4 (9)*†
BW and HW were measured in wild-type (WT) and IP⫺/⫺ mice at 1, 2, 4, and 8 weeks of aortic
banding (AB) or sham operation (SO). Each value represents mean⫾SEM. Numbers in parentheses
represent number of animals.
*P⬍0.05 vs corresponding sham-operated mice; †P⬍0.05 vs aortic-banded wild-type mice.
wild-type noncardiomyocytes, an effect that disappeared in
IP⫺/⫺ noncardiomyocytes, indicating that the effect was mediated by IP. Interestingly, the slight inhibitory effect of
cicaprost on [3H]thymidine incorporation was also observed
in PDGF-unstimulated wild-type noncardiomyocytes. Accordingly, cicaprost significantly inhibited PDGF-induced
increase in cell number only in wild-type noncardiomyocytes
(Figure 5B). These results indicate that stimulation of IP
could inhibit proliferation of noncardiomyocytes induced by
PDGF. In contrast, cicaprost failed to inhibit serum-induced
proliferation of wild-type noncardiomyocytes (data not
shown), suggesting a difference in signaling mechanisms
between PDGF and serum. In wild-type cardiomyocytes,
cardiotrophin-1 increased [14C]leucine incorporation 43%
above control, indicating that cardiotrophin-1 could induce
cardiomyocyte hypertrophy (Figure 5C). However, cicaprost
could not modulate the cardiotrophin-1–induced increase in
[14C]leucine incorporation, presenting the possibility that IP
signaling is defective in cardiomyocytes.
To further evaluate the IP signaling in cardiomyocytes and
noncardiomyocytes, we examined IP expression and its
second messenger system in these cell types. When IP mRNA
expression was examined by the RT-PCR method, we found
that both cell types from wild-type mice expressed IP mRNA
but those from IP⫺/⫺ mice did not, and we found that its
expression level was apparently much higher in noncardiomyocytes than in cardiomyocytes when GAPDH mRNA
expression was used as a reference (Figure 5D). We next
examined functionally whether stimulation of IP could activate the second messenger system in these cell types by
measuring [cAMP]i because IP belongs to a Gs-coupled
receptor family. In noncardiomyocytes, cicaprost increased
[cAMP]i prominently: the increase was 260% above control
at a concentration of 10⫺5 mol/L (Figure 5E). In contrast, the
increase in cardiomyocytes was only 40%, whereas the
␤-adrenergic agonist isoproterenol could increase it extensively in this cell type. These results indicate that IP-mediated
signaling works more efficiently in noncardiomyocytes than
in cardiomyocytes.
Discussion
In the present study pressure overload produced by the aortic
banding caused marked cardiac hypertrophy, consisting of
cardiomyocyte hypertrophy and cardiac fibrosis. The degree
of cardiac hypertrophy after the banding was significantly
greater in IP⫺/⫺ mice than in wild-type mice and was
accompanied by augmentation of both cardiomyocyte hypertrophy and cardiac fibrosis. In addition, the increase in the
expression level of ANP mRNA after the banding was
significantly augmented in IP⫺/⫺ hearts compared with in
wild-type hearts. These findings provide direct evidence that
IP-mediated signaling plays a suppressive role in the development of pressure overload–induced cardiac hypertrophy
and fibrosis.
Synthesis of PGI2 has been reported to be elevated in the
hypertrophied and failing heart15 along with an upregulation
of COX-2.16 In the present study, however, we found no
significant increase in COX mRNA expression and PGI2
production after the aortic banding. This discrepancy may be
derived from the differences in experimental conditions used
or diseases studied. Accordingly, COX-2 upregulation in the
heart has been reported in patients having congestive heart
failure,16 and increased cardiac PGI2 production was transient
in dogs subjected to aortic banding.15 Recently, involvement
of proinflammatory cytokines in the pathogenesis of heart
failure due to a variety of causes has been suggested.30 Our
procedure of aortic banding was relatively mild in degree and
did not induce apparent cardiac failure, suggesting little
participation of inflammatory cytokines, a common inducer
of COX-2, in the pathogenesis of the present cardiac hypertrophy. Nevertheless, cardiac 6-keto-PGF1␣ concentrations
before and after the aortic banding were grossly estimated to
be 30 to 50 nmol/L, a well-working range of PGI2. These
results suggest that basally produced PGI2 could exhibit an
antihypertrophic effect on the heart on a pressure overload
and that increased production of PGI2 via COX-2 induction in
failing hearts would further contribute to the suppression of
cardiac hypertrophy.
90
Circulation
July 5, 2005
Figure 5. Effects of cicaprost on noncardiomyocyte proliferation
and cardiomyocyte hypertrophy. A, Incorporation of [3H]thymidine in PDGF-stimulated or -unstimulated noncardiomyocytes.
Values are percentage of [3H]thymidine incorporation in PDGFuntreated controls, the mean values of which were 2319 and
2496 cpm per well in wild-type and IP⫺/⫺ noncardiomyocytes,
respectively. n⫽5 to 12. B, Cell number in PDGF-stimulated or
-unstimulated noncardiomyocytes. Values are percentage of cell
number in PDGF-untreated controls. n⫽4. C, Incorporation of
[14C]leucine in the cardiotrophin (CT)-1–stimulated or
-unstimulated cardiomyocytes from wild-type mice. Values are
percentage of [14C]leucine incorporation in cardiotrophin-1– untreated controls, the mean value of which was 2527 cpm per
well. n⫽4 to 12. Concentrations of cicaprost, PDGF, and
cardiotrophin-1 were 10⫺5 mol/L, 5 ng/mL, and 10⫺10 mol/L,
respectively. *P⬍0.05 vs PDGF- or cardiotrophin-1– untreated
control group; †P⬍0.05 vs PDGF-treated control group. D,
Expression of IP mRNA in noncardiomyocytes (NCM) and cardiomyocytes (CM) from wild-type and IP⫺/⫺ mice. GAPDH
mRNA was used as loading control. E, Effects of cicaprost on
[cAMP]i in noncardiomyocytes (NCM) and cardiomyocytes (CM)
from wild-type and IP⫺/⫺ mice. These cells were incubated with
vehicle or cicaprost (10⫺6 or 10⫺5 mol/L). Isoproterenol (10⫺7
mol/L) increased [cAMP]i to 1115.0⫾37.9 pmol/mg protein in
cardiomyocytes. n⫽4 or 5. *P⬍0.05 vs control group.
Because pressure overload–induced cardiac hypertrophy
was accompanied by both cardiomyocyte hypertrophy and
cardiac fibrosis, we next investigated whether the antihypertrophic role of IP depends on its effect on cardiomyocytes or
noncardiomyocytes. In wild-type noncardiomyocytes, cicaprost significantly suppressed PDGF-induced proliferation;
this growth factor was reportedly implicated in the development of cardiac hypertrophy and fibrosis.31 This result is in
good agreement with a report that PGI2 was a major prosta-
noid produced by cultured cardiac fibroblasts and that an IP
agonist inhibited fibroblast proliferation and expression of
collagen type I and III mRNAs.13 In addition, antifibrotic
effects of PGI2 have also been reported in extracardiac
tissues, such as blood vessels and the kidney.32,33 These
results indicate that stimulation of IP reduces the proliferation
of noncardiomyocytes and suggest that stimulation of IP on
fibroblasts accounts for its suppressive effect on pressure
overload–induced cardiac fibrosis.
In wild-type cardiomyocytes, cicaprost failed to reduce the
cardiotrophin-1–induced hypertrophy, agreeing with a previous report that PGI2 did not show a direct antihypertrophic
action on cultured rat cardiomyocytes.12,17 It is noteworthy
that angiotensin II–induced cardiomyocyte hypertrophy was
totally dependent on several factors secreted from noncardiomyocytes, such as endothelin and cardiotrophin-1.34,35 Accordingly, the action of IP on noncardiomyocytes may be
involved in the underlying mechanism of its suppressive
effects on cardiomyocyte hypertrophy in vivo. In support of
this idea, PGI2 was reported to be capable of attenuating
hypertrophy of cardiomyocytes when they were cocultured
with noncardiomyocytes, although it did not have a direct
antihypertrophic effect on cardiomyocytes.12 These results
suggest that PGI2 acts on noncardiomyocytes and inhibits
their release of hypertrophy-inducible factors, leading to the
suppression of cardiomyocyte hypertrophy.
In the present study the expression of IP mRNA and the
IP-mediated increase in [cAMP]i were apparently much
greater in noncardiomyocytes than in cardiomyocytes, suggesting further that activation of IP on noncardiomyocytes
would be more important in the suppression of cardiac
hypertrophy. However, we could not exclude a role of IP on
cardiomyocytes in the suppression of cardiac hypertrophy
because IP mRNA was expressed in cardiomyocytes and
because its stimulation induced a small but significant increase in [cAMP]i. Further studies would be required to
clarify the detailed mechanisms of antihypertrophic role of IP
in pressure overload–induced cardiac hypertrophy.
We found the expression of mRNAs for EP2, EP3, EP4, FP,
and TP in addition to that for IP in the heart. In a model of
pressure overload–induced cardiac hypertrophy in vivo, however, the degree of cardiac hypertrophy in EP2⫺/⫺, EP3⫺/⫺,
EP4⫺/⫺, FP⫺/⫺, or TP⫺/⫺ mice was not significantly different
compared with that in their respective wild-type mice. This
result suggests that neither EP subtype, FP, or TP plays a
major role in the present model of pressure overload–induced
cardiac hypertrophy. In contrast, there are several reports
suggesting hypertrophic effects of exogenously administered
PGF2␣ on rat cardiomyocyte both in vivo and in vitro,17,18
although there has been no report showing the hypertrophic
effect of endogenous PGF2␣. The apparent discrepancy in the
effect of PGF2␣ may be derived from a species difference, as
reported; the hypertrophic effect of PGF2␣ on cultured
cardiomyocytes found in rats was not observed in mice.36
Alternatively, amounts of endogenously produced PGF2␣
may be insufficient to affect pressure overload–induced
cardiac hypertrophy in vivo.
PGI2 is a major prostanoid in the cardiovascular system and
exerts a variety of actions in the system. It exhibits a
Hara et al
cardioprotective effect in ischemia/reperfusion injury10 and
plays a part in the late phase of ischemic preconditioning.9 A
recent study has shown that neointimal formation in the
carotid artery after endothelial injury is markedly enhanced in
IP⫺/⫺ mice, suggesting an antiproliferative effect of PGI2 on
vascular smooth muscle cells.37 In agreement with this effect,
PGI2 analogues have long been used for the treatment of
primary pulmonary hypertension.38 Recently, a gene therapy
using PGI2 synthase gene transfection has been tested in rat
models of cardiovascular diseases, such as pulmonary hypertension,39 vascular remodeling,40 and peripheral vascular
occlusion,41 and has been shown to be promising. Furthermore, the present study showed a novel role of IP in pressure
overload–induced cardiac hypertrophy, emphasizing, along
with previous reports, a potent therapeutic potential of PGI2
for cardiovascular diseases. It should be noted, however, that
there may be a species difference in the effect of IP, as shown
in the present study for the effect of FP on cardiomyocyte
hypertrophy, indicating that the usefulness of PGI2 for the
treatment of cardiac hypertrophy and heart failure remains to
be determined in future studies.
In conclusion, the present study clearly showed that IPmediated signaling suppresses the development of pressure
overload–induced cardiac hypertrophy via its inhibition of
both cardiomyocyte hypertrophy and cardiac fibrosis. The
finding should contribute to better understanding of the
mechanism underlying cardiac hypertrophy.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Acknowledgments
This work was supported by a grant-in-aid for scientific research
from the Ministry of Education, Science, Sports, and Culture of
Japan and by the research grant for cardiovascular disease (14A-1)
from the Ministry of Health and Welfare of Japan. This work was
also supported by grants from Ono Pharmaceutical Co, Smoking
Research Foundation, Akiyama Foundation, and Hokkaido Heart
Association.
20.
21.
References
1. Scheuer J, Buttrick P. The cardiac hypertrophic responses to pathologic
and physiologic loads. Circulation. 1987;75(suppl I):63– 68.
2. Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic
implications of echocardiographically determined left ventricular mass in
the Framingham Heart Study. N Engl J Med. 1990;322:1561–1566.
3. Ito H, Hiroe M, Hirata Y, Fujisaki H, Adachi S, Akimoto H, Ohta Y,
Marumo F. Endothelin ETA receptor antagonist blocks cardiac hypertrophy provoked by hemodynamic overload. Circulation. 1994;89:
2198 –2203.
4. Senbonmatsu T, Ichihara S, Price E Jr, Gaffney FA, Inagami T. Evidence
for angiotensin II type 2 receptor–mediated cardiac myocyte enlargement
during in vivo pressure overload. J Clin Invest. 2000;106:R25–R29.
5. Takimoto Y, Aoyama T, Iwanaga Y, Izumi T, Kihara Y, Pennica D,
Sasayama S. Increased expression of cardiotrophin-1 during ventricular
remodeling in hypertensive rats. Am J Physiol. 2002;282:H896 –H901.
6. Coleman RA, Smith WL, Narumiya S. International Union of Pharmacology classification of prostanoid receptors: properties, distribution, and
structure of the receptors and their subtypes. Pharmacol Rev. 1994;46:
205–229.
7. Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid receptors: structures,
properties, and functions. Physiol Rev. 1999;79:1193–1226.
8. Ushikubi F, Hirata M, Naruniya S. Platelet prostaglandin receptors. In:
von Bruchhausen F, Walter U, eds. Hand Book of Experimental Pharmacology, Volume 126: Platelets and Their Factors. Berlin, Germany:
Springer-Verlag; 1997:135–154.
9. Shinmura K, Tang XL, Wang Y, Xuan YT, Liu SQ, Takano H, Bhatnagar
A, Bolli R. Cyclooxygenase-2 mediates the cardioprotective effects of the
22.
23.
24.
25.
26.
27.
91
late phase of ischemic preconditioning in conscious rabbits. Proc Natl
Acad Sci U S A. 2000;97:10197–10202.
Xiao CY, Hara A, Yuhki K, Fujino T, Ma H, Okada Y, Takahata O,
Yamada T, Murata T, Narumiya S, Ushikubi F. Roles of prostaglandin I2
and thromboxane A2 in cardiac ischemia-reperfusion injury: a study using
mice lacking their respective receptors. Circulation. 2001;104:
2210 –2215.
Xiao CY, Yuhki K, Hara A, Fujino T, Kuriyama S, Yamada T, Takayama
K, Takahata O, Karibe H, Taniguchi T, Narumiya S, Ushikubi F. Prostaglandin E2 protects the heart from ischemia-reperfusion injury via its
receptor subtype EP4. Circulation. 2004;109:2462–2468.
Ritchie RH, Schiebinger RJ, LaPointe MC, Marsh JD. Angiotensin
II–induced hypertrophy of adult rat cardiomyocytes is blocked by nitric
oxide. Am J Physiol. 1998;275:H1370 –H1374.
Yu H, Gallagher AM, Garfin PM, Printz MP. Prostacyclin release by rat
cardiac fibroblasts: inhibition of collagen expression. Hypertension.
1997;30:1047–1053.
Zamorano B, Carmona MT. Prostaglandin-E2 and cyclic adenosine 3⬘-5⬘
monophosphate levels in hypertrophied rat heart. Biol Res. 1992;25:
85– 89.
Newman WH, Frankis MB, Halushka PV. Increased myocardial release
of prostacyclin in dogs with heart failure. J Cardiovasc Pharmacol.
1983;5:194 –201.
Wong SC, Fukuchi M, Melnyk P, Rodger I, Giaid A. Induction of
cyclooxygenase-2 and activation of nuclear factor-␬B in myocardium of
patients with congestive heart failure. Circulation. 1998;98:100 –103.
Adams JW, Migita DS, Yu MK, Young R, Hellickson MS, Castro-Vargas
FE, Domingo JD, Lee PH, Bui JS, Henderson SA. Prostaglandin F2␣
stimulates hypertrophic growth of cultured neonatal rat ventricular
myocytes. J Biol Chem. 1996;271:1179 –1186.
Lai J, Jin H, Yang R, Winer J, Li W, Yen R, King KL, Zeigler F, Ko A,
Cheng J, Bunting S, Paoni NF. Prostaglandin F2␣ induces cardiac
myocyte hypertrophy in vitro and cardiac growth in vivo. Am J Physiol.
1996;271:H2197–H2208.
Hizaki H, Segi E, Sugimoto Y, Hirose M, Saji T, Ushikubi F, Matsuoka
T, Noda Y, Tanaka T, Yoshida N, Narumiya S, Ichikawa A. Abortive
expansion of the cumulus and impaired fertility in mice lacking the
prostaglandin E receptor subtype EP2. Proc Natl Acad Sci U S A. 1999;
96:10501–10506.
Ushikubi F, Segi E, Sugimoto Y, Murata T, Matsuoka T, Kobayashi T,
Hizaki H, Tuboi K, Katsuyama M, Ichikawa A, Tanaka T, Yoshida N,
Narumiya S. Impaired febrile response in mice lacking the prostaglandin
E receptor subtype EP3. Nature. 1998;395:281–284.
Segi E, Sugimoto Y, Yamasaki A, Aze Y, Oida H, Nishimura T, Murata
T, Matsuoka T, Ushikubi F, Hirose M, Tanaka T, Yoshida N, Narumiya
S, Ichikawa A. Patent ductus arteriosus and neonatal death in prostaglandin receptor EP4-deficient mice. Biochem Biophys Res Commun. 1998;
246:7–12.
Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y, Nishimura T, Oida
H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K, Murata T, Hirata
M, Ushikubi F, Negishi M, Ichikawa A, Narumiya S. Failure of parturition in mice lacking the prostaglandin F receptor. Science. 1997;277:
681– 683.
Murata T, Ushikubi F, Matsuoka T, Hirata M, Yamasaki A, Sugimoto Y,
Ichikawa A, Aze Y, Tanaka T, Yoshida N, Ueno A, Oh-ishi S, Narumiya
S. Altered pain perception and inflammatory response in mice lacking
prostacyclin receptor. Nature. 1997;388:678 – 682.
Kabashima K, Murata T, Tanaka H, Matsuoka T, Sakata D, Yoshida N,
Katagiri K, Kinashi T, Tanaka T, Miyasaka M, Nagai H, Ushikubi F,
Narumiya S. Thromboxane A2 modulates interaction of dendritic cells
and T cells and regulates acquired immunity. Nat Immunol. 2003;4:
694 – 670.
Ma H, Hara A, Xiao CY, Okada Y, Takahata O, Nakaya K, Sugimoto Y,
Ichikawa A, Narumiya S, Ushikubi F. Increased bleeding tendency and
decreased susceptibility to thromboembolism in mice lacking the prostaglandin E receptor subtype EP3. Circulation. 2001;104:1176 –1180.
Rockman HA, Ross RS, Harris AN, Knowlton KU, Steinhelper ME, Field
LJ, Ross J Jr, Chien KR. Segregation of atrial-specific and inducible
expression of an atrial natriuretic factor transgene in an in vivo murine
model of cardiac hypertrophy. Proc Natl Acad Sci U S A. 1991;88:
8277– 8281.
Akishita M, Iwai M, Wu L, Zhang L, Ouchi Y, Dzau VJ, Horiuchi M.
Inhibitory effect of angiotensin II type 2 receptor on coronary arterial
remodeling after aortic banding in mice. Circulation. 2000;102:
1684 –1689.
92
Circulation
July 5, 2005
28. Nicoletti A, Michel JB. Cardiac fibrosis and inflammation: interaction
with hemodynamic and hormonal factors. Cardiovasc Res. 1999;41:
532–543.
29. Weber KT, Janicki JS, Shroff SG, Pick R, Chen RM, Bashey RI. Collagen
remodeling of the pressure-overloaded, hypertrophied nonhuman primate
myocardium. Circ Res. 1988;62:757–765.
30. Murray DR, Freeman GL. Proinflammatory cytokines: predictors of a
failing heart? Circulation. 2003;107:1460 –1462.
31. Suzuki J, Baba S, Ohno I, Endoh M, Nawata J, Miura S, Yamamoto Y,
Sekiguchi Y, Takita T, Ogata M, Tamaki K, Ikeda J, Shirato K. Immunohistochemical analysis of platelet-derived growth factor-B expression
in myocardial tissues in hypertrophic cardiomyopathy. Cardiovasc
Pathol. 1999;8:223–231.
32. Kouchi Y, Esato K, O-Hara M, Zempo N. Effect of prostaglandin I2
analogue TRK-100 on the suppression of intimal fibrous proliferation. J
Vasc Surg. 1992;16:232–238.
33. Yokoyama C, Yabuki T, Shimonishi M, Wada M, Hatae T, Ohkawara S,
Takeda J, Kinoshita T, Okabe M, Tanabe T. Prostacyclin-deficient mice
develop ischemic renal disorders, including nephrosclerosis and renal
infarction. Circulation. 2002;106:2397–2403.
34. Harada M, Itoh H, Nakagawa O, Ogawa Y, Miyamoto Y, Kuwahara K,
Ogawa E, Igaki T, Yamashita J, Masuda I, Yoshimasa T, Tanaka I, Saito
Y, Nakao K. Significance of ventricular myocytes and nonmyocytes
interaction during cardiocyte hypertrophy: evidence for endothelin-1 as a
paracrine hypertrophic factor from cardiac nonmyocytes. Circulation.
1997;96:3737–3744.
35. Kuwahara K, Saito Y, Harada M, Ishikawa M, Ogawa E, Miyamoto Y,
Hamanaka I, Kamitani S, Kajiyama N, Takahashi N, Nakagawa O,
Masuda I, Nakao K. Involvement of cardiotrophin-1 in cardiac myocytenonmyocyte interactions during hypertrophy of rat cardiac myocytes in
vitro. Circulation. 1999;100:1116 –1124.
36. Deng XF, Rokosh DG, Simpson PC. Autonomous and growth factor–induced hypertrophy in cultured neonatal mouse cardiac myocytes:
comparison with rat. Circ Res. 2000;87:781–788.
37. Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T,
Lawson JA, FitzGerald GA. Role of prostacyclin in the cardiovascular
response to thromboxane A2. Science. 2002;296:539 –541.
38. Archer S, Rich S. Primary pulmonary hypertension: a vascular biology
and translational research “work in progress.” Circulation. 2000;102:
2781–2791.
39. Nagaya N, Yokoyama C, Kyotani S, Shimonishi M, Morishita R,
Uematsu M, Nishikimi T, Nakanishi N, Ogihara T, Yamagishi M,
Miyatake K, Kaneda Y, Tanabe T. Gene transfer of human prostacyclin
synthase ameliorates monocrotaline-induced pulmonary hypertension in
rats. Circulation. 2000;102:2005–2010.
40. Todaka T, Yokoyama C, Yanamoto H, Hashimoto N, Nagata I, Tsukahara
T, Hara S, Hatae T, Morishita R, Aoki M, Ogihara T, Kaneda Y, Tanabe
T. Gene transfer of human prostacyclin synthase prevents neointimal
formation after carotid balloon injury in rats. Stroke. 1999;30:419 – 426.
41. Hiraoka K, Koike H, Yamamoto S, Tomita N, Yokoyama C, Tanabe T,
Aikou T, Ogihara T, Kaneda Y, Morishita R. Enhanced therapeutic
angiogenesis by cotransfection of prostacyclin synthase gene or optimization of intramuscular injection of naked plasmid DNA. Circulation.
2003;108:2689 –2696.
Neuronal Nitric Oxide Synthase Mediates Statin-Induced
Restoration of Vasa Nervorum and Reversal
of Diabetic Neuropathy
Masaaki Ii, MD, PhD; Hiromi Nishimura, MD, PhD; Kengo F. Kusano, MD, PhD; Gangjian Qin, MD;
Young-sup Yoon, MD, PhD; Andrea Wecker, BS; Takayuki Asahara, MD, PhD; Douglas W. Losordo, MD
Background—Peripheral neuropathy is a frequent and major complication of diabetes.
Methods and Results—Severe peripheral neuropathy developed in type II diabetic mice, characterized by significant
slowing of motor and sensory nerve conduction velocities. Rosuvastatin restored nerve vascularity, including vessel size,
and nerve function also recovered to the levels of nondiabetic mice. Neuronal nitric oxide synthase expression in sciatic
nerves was reduced in diabetic mice but was preserved by rosuvastatin. Coadministration of a nitric oxide synthase
inhibitor with rosuvastatin attenuated the beneficial effects of rosuvastatin on nerve function and limited the recovery
of vasa nervorum and nerve function. In vitro, rosuvastatin inhibited downregulation of neuronal nitric oxide synthase
expression induced by high-glucose conditions in cultured Schwann cells. Furthermore, Akt phosphorylation in
Schwann cells, downregulated by high-glucose conditions, was also restored by rosuvastatin, consistent with the change
of neuronal nitric oxide synthase expression. Akt inhibition independently reduced neuronal nitric oxide synthase
expression in Schwann cells in low-glucose cultures.
Conclusions—These data indicate that the HMG-CoA reductase inhibitor rosuvastatin has a favorable effect on diabetic
neuropathy independent of its cholesterol-lowering effect. Our data provide evidence that this effect may be mediated
in part via neuronal nitric oxide synthase/nitric oxide and phosphatidylinositol 3-kinase/Akt-signaling pathways and also
suggest that restoration or preservation of the microcirculation of the sciatic nerve may be involved. (Circulation. 2005;
112:93-102.)
Key Words: diabetes mellitus 䡲 nervous system 䡲 nitric oxide synthase
P
ripheral nervous system associated with destruction of vasa
nervorum. These prior studies have also documented that
vascular endothelial growth factor (VEGF) gene transfer
successfully modifies the neuropathy by restoring microcirculation in vasa nervorum.12,13 In addition, prior studies from
our laboratory and others have revealed that HMG-CoA
reductase inhibitors, or “statins,” can exert an angiogenic
effect in ischemic tissues.14 –16 Moreover, recent data have
suggested a potential beneficial effect of statins that extends
beyond the traditional indications of hyperlipidemia and that
may be especially prominent in people with diabetes.17–22
Accordingly, we investigated the hypothesis that diabetic
neuropathy can be reversed by administration of statins. In
the present report we document that the disordered peripheral
nerve physiology resulting from experimental diabetes is
associated with marked destruction of the vasa nervorum of
the sciatic nerve and that neuronal function may be successfully restored by administration of rosuvastatin, a new HMGCoA reductase inhibitor. Nerve recovery induced by rosuv-
eripheral neuropathy is one of the major complications of
diabetes that can lead to significant morbidity. Sensory
abnormalities predominate,1 leading to a failure to detect
minor trauma of the lower extremities, ultimately contributing to skin ulcerations. Indeed, some reports indicate that
20% of all hospital admissions among diabetic patients in the
United States are for foot problems.2 Even with intensive
therapy, including insulin and more effective oral agents, the
incidence of neuropathy has increased to as much as 16%3 of
the 17 million diabetic patients in the United States alone.
The pathogenic mechanisms of diabetic neuropathy that have
been considered include the following: degeneration of proteins critical to neural function by nonenzymatic glycosylation,4 altered neural polyol metabolism,5,6 reduction of neurotrophic factors,1,7 and microvascular disease with impaired
blood flow.6,8,9 Ischemia in diabetic nerves10,11 has also been
considered in the pathogenesis of diabetic complications.
Indeed, we have shown previously that experimentally induced diabetes causes physiological dysfunction in the pe-
Received October 7, 2004; revision received March 8, 2005; accepted March 11, 2005.
From the Division of Cardiovascular Research, Caritas St Elizabeth’s Medical Center, Tufts University School of Medicine, Boston, Mass (M.I.,
K.F.K., G.Q., Y.Y., A.W., T.A., D.W.L.), and Regenerative Medicine, Institute for Biomedical Research and Innovation, Kobe, Japan (H.N., T.A.).
Correspondence to Douglas W. Losordo, MD, Division of Cardiovascular Research, Caritas St Elizabeth’s Medical Center, Tufts University School
of Medicine, 736 Cambridge St, Boston, MA 02135. E-mail [email protected]
93
94
Circulation
July 5, 2005
astatin is accompanied by replenishment of the vasa
nervorum; however, our results also suggest that this statin
may have neurogenic effects that augment the demonstrated
vascular effects. Together, these findings provide additional
evidence of a vasculogenic etiology of diabetic neuropathy,
documenting statin-induced angiogenesis and vasodilatation
of the vasa nervorum, and suggest potential direct neurotrophic effects of statins.
Methods
Reagent
Rosuvastatin was supplied by AstraZeneca UK. Rosuvastatin is a
hydrophilic inhibitor of HMG-CoA reductase.23,24
Animals
All protocols were approved by St Elizabeth’s Institutional Animal
Care and Use Committee. In all experiments, investigators performing the follow-up examinations were blinded to the treatment
administered. Male C57BLKS/J-m⫹/⫹Leprdb homozygous (db/db)
mice (Jackson Laboratories, Bar Harbor, Maine) aged 8 to 12 weeks
were used. Age-matched heterozygotes (db/m), a nonpenetrant
genotype (Jackson Laboratories), were used as the control animals.
Mice were treated with daily subcutaneous injection of rosuvastatin
(1 mg/kg) or saline as a vehicle. Serum glucose and total cholesterol
levels were measured with the use of an instant check meter (Roche)
at days 0 and 28 after each treatment.
Neurophysiological Measurements
Sciatic nerve conduction velocity was measured with standard
orthodromic surface recording techniques and a Teca TD-10 (Oxford
Instruments) portable recording system in all mice at baseline (before
treatment) and then at 2 and 4 weeks after treatment, as described
previously.25 Briefly, motor nerve conduction velocity (MCV) was
calculated by dividing the distance between stimulating electrodes by
the average latency difference between the peaks of the compound
muscle action potentials evoked from 2 sites (sciatic notch and
ankle). Sensory nerve conduction velocity (SCV) was calculated by
dividing the distance between stimulating and recording electrodes
by the latency of the signal from the stimulation artifact to the onset
of the peak signal. For each nerve, maximal velocities were determined bilaterally. All measured data from both sides were averaged.
Tail-Flick Testing
This behavioral test examined the response of each mouse to a
thermal noxious stimulus administered to its tail with a variation of
the tail immersion test. This measure was chosen because of the role
that small fiber dorsal root ganglia sensory neurons play in pain
transmission. The animals were loosely restrained with their tails
immersed in a beaker of water to a depth of ⬇2 cm. The beaker was
uniformly heated at a rate of ⬇2°C per minute beginning at 38°C. A
magnetic stirring bar was used to maintain a uniform temperature.
The temperature at which each animal flicked its tail out of the water
was recorded to the nearest 0.5°C.
fluorescent microscope (⫻20), and vessel cross-sectional areas were
measured by NIH Image (version 1.62) in the same sections. Because
BS1-lectin binds to vascular endothelium, the fluorescent labeling
that occurs by intracardiac injection of the FITC-conjugated BS1lectin is restricted to vascular structures. Vessels are identified as
small circular/punctate areas of fluorescence in the cross-sectional
images and were counted in 10 randomly selected cross sections
under the fluorescent microscope (⫻20). Vessel cross-sectional area,
which reflects vessel size, was measured with the use of NIH Image
(version 1.62) in the same nerve cross sections.
Double-Fluorescent Immunohistochemistry
Sciatic nerves were isolated from mice at the time of euthanasia and
prepared for frozen sections. Frozen tissue sections (4 ␮m in
thickness) were air dried and fixed with 100% acetone for 5 minutes
at ⫺20°C. Nonspecific protein binding was blocked with 10%
normal horse serum. Sections were incubated overnight at 4°C with
a rabbit polyclonal antibody against endothelial nitric oxide synthase
(eNOS) (1:250), neuronal nitric oxide synthase (nNOS) (1:200), and
VEGF (1:500) (Santa Cruz Biotechnology, Santa Cruz, Calif) diluted
in 2% goat serum/PBS, followed by 30 minutes of incubation with a
secondary antibody, Cy3-conjugated anti-rabbit IgG (1:500) (Jackson ImmunoResearch). Normal rabbit IgG was used as a negative
control. After they were washed with PBS, sections were incubated
with second primary antibodies biotinylated isolectin B4 (ILB4)
(1:100, Vector Laboratories) for detection of endothelial cells or goat
polyclonal anti-S100 (1:100, Santa Cruz) for detection of Schwann
cells at 4°C overnight, followed by FITC-conjugated streptavidin
(1:500) or Cy2-conjugated anti-goat IgG (1:500) (Jackson ImmunoResearch) as a secondary antibody, respectively. Sections were
counterstained with DAPI (1:5000) and mounted in aqueous mounting medium.
Immunocytochemistry for BrdU
Cells were fixed with 4% paraformaldehyde for 5 minutes in 4-well
chamber slides (Nalge Nunc). After they were washed with PBS,
slides were incubated with 2N HCl for 20 minutes at 37°C followed
by incubation with 100 mmol/L sodium borate buffer for 20 minutes,
and nonspecific protein binding was blocked with 10% normal goat
serum. Sections were incubated with biotinylated sheep anti-BrdU
antibody (1:100, BIODESIGN) at 4°C overnight, followed by
rhodamine-conjugated streptavidin (1:500, Jackson ImmunoResearch) as a secondary antibody. Nuclei were stained with DAPI
(1:5000), and slides were mounted in aqueous mounting medium.
Proliferation activity was evaluated under fluorescent microscopy as
an average percentage of BrdU-positive cells in 5 randomly selected
high-powered fields per well.
nNOS Inhibition Study
Mice were treated with a daily subcutaneous injection of rosuvastatin
(1 mg/kg) or rosuvastatin (1 mg/kg) plus selective nNOS inhibitor
1,2-trifluoromethylphenyl imidazole (TRIM) (50 mg/kg) (Sigma).
MCV and SCV were measured at 2 and 4 weeks after the treatment.
The assessment of vascularity in sciatic nerve with FITC-conjugated
BS1-lectin was performed at the time of euthanasia, as described
above.
Assessment of Vascularity in Sciatic Nerve
Cell Culture
Vascularity of sciatic nerves from both nondiabetic and diabetic mice
was assessed by in situ fluorescent staining with the use of the
endothelial cell–specific marker FITC-conjugated BS1-lectin (Vector Laboratories). After anesthesia, BS1-lectin (0.1 mg per mouse)
was injected systemically by direct cardiac puncture. Ten minutes
later, the animals were euthanized, and sciatic nerves were harvested
and fixed in 2% paraformaldehyde for 2 hours. After fixation, nerves
were either whole mounted for longitudinal analysis or embedded in
OCT compound for frozen cross section. Samples were analyzed
with the use of a computer-assisted Nikon fluorescence microscope
with a digital camera (ECLIPS TE200, Nikon Inc). The number of
vessels was counted in 10 randomly selected cross sections under
Primary mouse Schwann cells were obtained from sciatic nerve by
explant method as described previously.26 Cells were seeded on
10-cm plastic culture dishes coated with rat type I collagen (300
␮g/mL) (Sigma) and cultured in DMEM F-12 (GIBCO) supplemented with 20% fetal bovine serum (FBS), 10 ng/mL progesterone,
5 ␮g/mL transferrin, 5 ␮g/mL insulin, 10 ␮g/mL putrescine (Sigma),
B27 supplement, 25 mmol/L HEPES, 100 U/mL penicillin, and 100
␮g/mL streptomycin (GIBCO). Cultured Schwann cells were identified on the basis of cell soma and nuclear morphology, and the
purity was also confirmed by immunocytochemical labeling for
cytoplasmic S100 protein and glial fibrillary acidic protein to be
⬎95% (data not shown). Mouse Schwann cell line MSC80 was a
Ii et al
kind gift from Dr Jean-Jaques Hauw (Raymond Escourolle Neuropathology Laboratory, Paris, France). MSC80 was cultured and
maintained in DMEM (GIBCO) supplemented with 4 mmol/L
glutamine, 100 U/mL penicillin, 100 ␮g/mL streptomycin, and 10%
FCS (GIBCO).
Primary human adult dermal microvascular endothelial cells
(HMVECs), obtained from BioWhittaker, were cultured in endothelial basal medium supplemented with 5% FBS, 0.1 mg/mL bovine
brain extract, 10 ng/mL epidermal growth factor, 0.5 mg/mL
hydrocortisone, and 100 ␮g/mL gentamicin (Cambrex). All the cells
were maintained at 37C° and 5% CO2.
Proliferation Assay
The number of viable Schwann cells was determined with a validated
nonradioactive cell proliferation assay kit (CellTiter 96; Promega).
Cells were seeded in 96-well plates at 80% confluence (1⫻104 cells
per well) and cultured in 0.5% FBS medium for 48 hours. Then
rosuvastatin was added at concentrations from 0.0001 to 10 ␮mol/L
in 20% FBS medium. Twenty percent FBS medium alone was used
as a control. After 48 hours, 15 ␮L of dye solution was added per
well, and cells were incubated for 4 hours before measurement of
absorbance at 570 nm. The proliferation activity of HMVECs was
evaluated by BrdU incorporation as described previously.27 Cells
were seeded in human fibronectin-coated (50 ␮g/mL at 37°C for 1
hour) 4-well Laboratory-Tek chamber slides (Nalge Nunc) at a
density of 1⫻105 cells per well and cultured in 0.5% FBS medium
for 24 hours. Then rosuvastatin was added at concentrations from
0.01 to 10 ␮mol/L in 5% FBS medium. Five percent FBS medium
was used as a control. After 18 hours of exposure to each treatment,
BrdU (Sigma) was added to each well at a concentration of 10
␮mol/L, and its incorporation into the cells was determined after 6
hours. Immunocytochemistry for BrdU was performed as described
above. BrdU-positive and total cells in each well were counted in 10
high-powered fields (⫻40), and the percentage of BrdU-positive
cells was calculated.
Migration Assay
Schwann cell and HMVEC migrations were evaluated with a
modified Boyden’s chamber assay as described previously.25 Briefly,
the polycarbonate filter (8-␮m pore size) (Poretics) was placed
between upper and lower chambers. Cells were preincubated in
DMEM F-12 or endothelial basal medium for 30 minutes with
rosuvastatin at concentrations from 0.0001 to 10 ␮mol/L. Cell
suspensions (1⫻104 cells per well) were placed in the upper
chamber, and the lower chamber was filled with medium containing
human recombinant nerve growth factor (100 ng/mL) or VEGF (50
ng/mL) (R&D Systems). The chamber was incubated for 4 hours at
37°C and 5% CO2. Migration activity was evaluated as the mean
number of migrated cells in 5 high-powered fields (⫻40) per
chamber.
Dominant Negative Akt and Myristoylated Forms
of Akt/Adenovirus Infection
Cultured MSC80s were transduced with an adenoviral construct
encoding dominant negative Akt (dn-Akt) or myristoylated Akt
(myr-Akt) at a multiplicity of infection of 500 for 3 hours in DMEM
with supplement. On the following day, cells were used for Western
blot analysis.
Western Blot Analysis
MSC80s were cultured with the following conditions for 48 hours:
mannitol (25 mmol/L), glucose (5 and 25 mmol/L), high glucose
(25 mmol/L) in the presence of rosuvastatin ranging from 0.001 to 10
␮mol/L, and high glucose (25 mmol/L) with rosuvastatin (1 ␮mol/L)
in the presence of the phosphatidylinositol 3-kinase (PI3K)/Akt
inhibitor LY294002 (10 ␮mol/L). Cells were lysed in 100 ␮L SDS
sample buffer (20% SDS, 5% ␤-mercaptoethanol, 10% glycerol in
50 mmol/L Tris-HCl, pH 7.4) per 35-mm culture dish. Protein
extracts were separated by 7.5% SDS-PAGE and transferred to a
0.2-␮m PVDF membrane (Bio-Rad). The membranes were blocked
Statins Reverse Diabetic Neuropathy
95
with 10% nonfat dry milk and 0.2% Tween-20 in PBS, pH 7.4, then
immunoblotted overnight at 4°C with rabbit polyclonal antibodies
against mouse nNOS (1:1000; BD Pharmingen), phospho-Akt/Akt
(1:1000; Cell Signaling), and a goat polyclonal antibody against
␣-actin (1:1000, Santa Cruz). Blots were washed with 0.2%
Tween-20 in PBS and incubated for 45 minutes with horseradish
peroxidase–linked goat antibody against rabbit IgG (1:5000; Santa
Cruz). Immunoreactive bands were visualized with ECL reagent
(Amersham). Densitometric analyses for the blots were performed
with the use of NIH Image software.
Measurement for NO Production in Schwann Cells
MSC80s were cultured on 24-well plates at 70% to 80% confluence
under low-glucose (5 mmol/L) and high-glucose (25 mmol/L)
conditions with or without rosuvastatin (1 and 10 ␮mol/L) for 48
hours. Culture medium was collected for the measurement of
nitrate/nitrite. NO production was evaluated by its final metabolite
nitrate/nitrite. The concentration of nitrite was measured as an OD
value at 540 nm with the use of a Nitrate/Nitrite Colorimetric Assay
Kit (Cayman) according to the manufacturer’s instructions.
All results are presented as mean⫾SEM. Statistical comparisons
between 2 groups were performed by Student t test, and ANOVA
was performed for serial analysis. Probability values ⬍0.05 were
considered statistically significant. All in vitro experiments were
repeated at least in triplicate and analyzed.
Results
Nerve Conduction Velocities and Characterization
of Mice
db/db mice develop a severe peripheral neuropathy at 8
weeks, as described previously.28 Electrophysiological recordings in db/db mice documented significant slowing of
MCV and SCV (MCV⫽29.1⫾1.2 m/s and SCV⫽24.6⫾1.4
m/s) compared with those of control mice (MCV⫽46.7⫾2.4
m/s and SCV⫽52.5⫾1.5 m/s; P⬍0.01 for both MCV and
SCV). Placebo-injected db/db mice showed persistent, stable
neuropathy 4 weeks after initiation of treatment
(MCV⫽27.0⫾0.5 m/s and SCV⫽29.6⫾1.0 m/s), whereas
rosuvastatin-injected db/db mice demonstrated nearly complete recovery of MCV and SCV back to levels of nondiabetic mice. Specifically, MCV and SCV in rosuvastatininjected db/db mice were 47.2⫾1.6 and 44.7⫾1.8 m/s, and
those in nondiabetic mice were 49.1⫾2.1 and 47.3⫾2.3 m/s,
respectively (nondiabetic mice versus rosuvastatin-injected
diabetic mice; P⫽NS) (Figure 1a and 1b). Tail-flick testing,
a measure of the function of small fiber dorsal root ganglia
sensory neurons, was also performed 4 weeks after treatment.
In saline-injected db/db mice, tail-flick temperatures were
significantly increased to 46.1⫾0.2°C (P⬍0.001 versus nondiabetic mice). In contrast, tail-flick temperatures recorded in
rosuvastatin-injected db/db mice did not differ significantly
from those of age-matched nondiabetic control animals
(44.6⫾0.3°C in rosuvastatin-injected mice versus
44.9⫾0.3°C in control mice; P⫽NS) (Figure 1c). Blood
glucose and serum total cholesterol levels before and after
treatment in db/db mice were not significantly different in
rosuvastatin-injected versus saline-injected mice (Table).
Vascularity of Vasa Nervorum in Sciatic Nerve
To investigate the potential role of microvascular pathology
in the development of diabetic neuropathy, we performed in
96
Circulation
July 5, 2005
(Figure 2a and 2d) (24.0⫾1.2 versus 24.0⫾1.6 vessels per
cross section [P⫽NS] and 78.4⫾5.8 versus 79.0⫾4.7 ␮m2
per vessel [P⫽NS], respectively; n⫽8) (Figure 2g and 2h).
nNOS, eNOS, and VEGF Expression in Sciatic Nerve
Prior investigations have established the roles of eNOS and
VEGF signaling in the angiogenic response to ischemia. To
investigate the contribution of these molecules in the recovery of vasa nervorum, we performed fluorescent immunohistochemistry for not only eNOS and VEGF but also nNOS
expression in vasa nervorum in diabetic mice. There were
marked differences of nNOS (Figure 3a), eNOS (Figure 3b),
and VEGF (Figure 3c) expression between saline-injected
db/db mice and rosuvastatin-injected db/db mice. The expression of nNOS was most notably decreased in saline-injected
db/db mice in comparison to rosuvastatin-injected db/db
mice. In contrast, the expression of nNOS in rosuvastatininjected db/db mice was similar to that seen in nondiabetic
mice (data not shown).
TRIM Partly Reversed the Effect of Rosuvastatin
on Nerve Dysfunction
Figure 1. Rosuvastatin (ROS) treatment reverses nerve conduction slowing and sensory deficit in diabetic mice. Nondiabetic
mice were used as controls (control; n⫽10), and db/db mice
were randomly assigned to saline injection (saline; n⫽10) or
rosuvastatin injection (ROS; n⫽10). Data are expressed as
mean⫾SEM. Electrophysiological parameters MCV (a) and SCV
(b) were performed before and 2 and 4 weeks after the initiation
of treatment. P⫽NS, *P⬍0.01, **P⬍0.0001, saline vs rosuvastatin. Tail-flick testing, to assess sensory function, was performed
4 weeks after initiation of treatment (c). P⫽NS, *P⬍0.01 compared with nondiabetic control.
situ fluorescent imaging of the vasa nervorum by in vivo
perfusion of FITC-labeled BS1-lectin. In the nerves of
saline-injected db/db mice, the vascularity of vasa nervorum
was markedly reduced (Figure 2b and 2e). Cross sections
from these nerves disclosed a significant reduction not only in
the number (capillary density) but also in the size (crosssectional area) of vasa nervorum compared with that of
nerves from control mice (16.4⫾0.8 versus 24.0⫾1.6 vessels
per cross section [P⬍0.01] and 53.0⫾2.8 versus 79.0⫾4.7
␮m2 per vessel [P⬍0.01], respectively; n⫽8) (Figure 2g and
2h). In contrast, in the nerves of rosuvastatin-injected db/db
mice, the vascularity of vasa nervorum was well preserved
(Figure 2c and 2f), and cross-sectional images from BS1lectin–perfused db/db mice revealed vessel numbers and
cross-sectional areas similar to those of nondiabetic mice
To further investigate whether NO production is essential for
rosuvastatin-mediated improvement in diabetic neuropathy,
we inhibited nNOS by coadministration of a selective nNOS
inhibitor, TRIM, with rosuvastatin. In rosuvastatin-injected
db/db mice, significant restoration of MCV and SCV was
observed at 2 and 4 weeks after treatment (MCV⫽37.3⫾0.9
and 47.2⫾1.6 m/s for 2 and 4 weeks versus 26.4⫾1.3 m/s at
week 0; SCV⫽38.2⫾2.1 and 44.7⫾1.8 m/s for 2 and 4 weeks
versus 22.7⫾1.3 at week 0, respectively; P⬍0.01 for both
MCV and SCV; n⫽10 in each group). In contrast,
rosuvastatin-injected mice receiving TRIM did not demonstrate the full extent of neurological recovery seen in
rosuvastatin-injected mice in which nNOS function was
unimpaired (Figure 4a and 4b). Nerve conduction velocity
measurements in rosuvastatin- versus rosuvastatin⫹TRIMtreated diabetic mice revealed significant reduction in the
beneficial effect of rosuvastatin on nerve function resulting
from inhibition of nNOS (2 weeks [SCV, 38.2⫾2.1 for
rosuvastatin versus 32.7⫾1.3 m/s for rosuvastatin⫹TRIM;
P⬍0.01] [Figure 4b] and 4 weeks [MCV, 47.2⫾1.6 for
rosuvastatin versus 35.8⫾1.3 m/s for rosuvastatin⫹TRIM;
SCV, 44.7⫾1.8 for rosuvastatin versus 34.9⫾0.9 m/s for
rosuvastatin⫹TRIM; P⬍0.01] [Figure 4a and 4b]) Inhibition
of nNOS also prevented the normalization of tail-lick temperature by rosuvastatin (rosuvastatin 44.6⫾0.3°C versus
Blood Glucose and Serum Total Cholesterol Levels
Glucose, mg/dL
Cholesterol, mg/dL
0 Weeks
4 Weeks
0 Weeks
4 Weeks
db/m mice (control; n⫽5)
168⫾23.5
168.3⫾28.7
155.0⫾3.0
156.9⫾2.5
db/db mice (saline; n⫽10)
530⫾14.8
539⫾18.0
155.9⫾1.0
157.8⫾1.7
db/db mice (ROS; n⫽10)
538⫾11.6
546⫾14.7
154.3⫾1.1
153.3⫾1.2
Statistical significance
NS
NS
Values are mean⫾SEM. Statistical comparisons between 0 and 4 weeks were made by Student
t test.
Ii et al
97
Effect of Rosuvastatin on HMVEC Proliferation
and Migration
To determine whether the direct action of rosuvastatin on the
vasa nervorum includes direct modulation of endothelial cell
phenotype, we investigated the effect of rosuvastatin on
HMVEC proliferation and migration at concentrations from
0.001 to 10 ␮mol/L. Rosuvastatin significantly promoted
proliferative activity of HMVECs from 60% to 28% at
concentrations from 0.001 to 0.1 ␮mol/L (Figure 5a). In
contrast, rosuvastatin significantly promoted VEGF-induced
HMVEC migration by 30% at lower concentrations (0.001
␮mol/L) and inhibited migration by 40% and 50% at higher
concentrations (1 and 10 ␮mol/L, respectively) (Figure 5b).
Rosuvastatin Directly Modulates Schwann Cell
Proliferation and Migration
To determine whether the effect of rosuvastatin on the nerve
recovery might also be the result of a direct neurotrophic
effect, we investigated the effect of rosuvastatin on Schwann
cell proliferation and migration at concentrations from 0.001
to 10 ␮mol/L. Rosuvastatin significantly promoted proliferative activity of Schwann cells by up to 86% at concentrations of 0.1 ␮mol/L (Figure 5c). Rosuvastatin also enhanced
nerve growth factor–induced Schwann cell migration significantly by 25% to 62% at concentrations from 0.01 to 10
␮mol/L in a dose-dependent manner (Figure 5d).
Figure 2. Rosuvastatin (ROS) treatment restores vasa nervorum
in diabetic mice. Representative fluorescence photomicrographs
show longitudinal views of whole-mounted mouse sciatic nerves
(a, b, and c) and their respective cross sections (d, e, and f) 4
weeks after treatment. The network of vasa nervorum is markedly reduced in the diabetic saline injection group (b and e). The
vascularity of vasa nervorum in the rosuvastatin group (c and f)
appears well preserved, and the number and size of visible vessels in the cross sections appear similar to those of nondiabetic
controls (a and d). Bar⫽200 ␮m. Vascularity was quantified in
tissue cross sections of mouse sciatic nerve. Before euthanasia
at 4 weeks after treatment, mice were perfused with FITCconjugated BS1-lectin to visualize vasa nervorum. Ten cross
sections per frozen sample were randomly selected from each
specimen, and the number (capillary density) (g) and size (crosssectional vessel area) (h) of vessels per cross section were
quantified and averaged. Data are expressed as mean⫾SEM
(n⫽5 per study group). P⫽NS, *P⬍0.01 compared with control.
rosuvastatin⫹TRIM 45.7⫾0.2°C, P⬍0.01; saline 46.1⫾0.2°C
versus rosuvastatin⫹TRIM 45.7⫾0.2°C, P⫽NS) (Figure 4c).
The vascularity of vasa nervorum documented by BS1-lectin in
rosuvastatin⫹TRIM-treated db/db mice was also less developed
(Figure 4f and 4i) as well as saline-injected db/db mice (Figure
4d and 4g) compared with that in the rosuvastatin-injected group
(Figure 4e and 4h). These findings indicate that nNOSdependent NO signaling is required for a portion of the recovery
in nerve function induced by rosuvastatin. Quantitative analyses
also show significant reversal of the improvement in nerve
vascularity in both the number (capillary density) and the size
(cross-sectional vessel area) in the rosuvastatin⫹TRIM group
compared with the rosuvastatin group (15.7⫾1.4 versus
24.0⫾1.6 vessels per cross section [P⬍0.01] and 50.4⫾2.9
versus 79.0⫾4.7 ␮m2 per vessel [P⬍0.01], respectively).
Rosuvastatin Preserves NO Production
Downregulated by High Glucose in Schwann Cells
To confirm that rosuvastatin upregulates not only nNOS
expression under high-glucose conditions but also promotes
NO production in Schwann cells, we evaluated the actual NO
production by measuring its final metabolite nitrate/nitrite in
culture medium. Rosuvastatin significantly preserved NO
production by Schwann cells despite high-glucose conditions
(Figure 5e).
Effect of Rosuvastatin on Downregulated nNOS
Expression in Schwann Cells by High Glucose
The expression of nNOS in MSC80 was reduced by 60% in
high-glucose conditions. In contrast, the same concentration
of osmotic substance, mannitol, did not affect nNOS expression (Figure 6a). Rosuvastatin significantly preserved nNOS
expression at doses ranging from 0.1 to 10 ␮mol/L despite
high-glucose conditions. Phosphorylated Akt expression was
also evaluated and coincided with nNOS expression, showing
a decrease in high-glucose conditions with restoration of
phospho-Akt expression by increasing concentrations of rosuvastatin (Figure 6a). To provide further evidence of the
association between Akt and nNOS, we performed Western
blot for nNOS using a PI3K inhibitor and dn-Akt adenoviral
vector. Rosuvastatin restored nNOS expression in highglucose conditions. However, both a PI3K inhibitor and
dn-Akt adenoviral transduction reversed the effect of rosuvastatin on nNOS expression. On the other hand, overexpression of myr-Akt by adenoviral transduction resulted in
preservation of nNOS expression despite high-glucose conditions. The expression of phosphorylated Akt was also
consistent with that of nNOS. These data indicate that
98
Circulation
July 5, 2005
Figure 3. Representative photomicrographs of fluorescent immunohistochemistry for nNOS (a),
eNOS (b), and VEGF (c) in sciatic nerves in nondiabetic and diabetic mice 4 weeks after treatment.
Reduced expression of nNOS, eNOS, and VEGF,
identified by red fluorescence, was observed in
saline injection group (saline) compared with the
rosuvastatin injection group (ROS) and nondiabetic
control. Schwann cells and capillaries were identified by specific markers S100 and ILB4 (green),
respectively. Merged images indicate colocalization
of S100 and nNOS, ILB4 and eNOS, and ILB4 and
VEGF (orange). Bar⫽100 ␮m.
Ii et al
99
rosuvastatin acts via PI3K to phosphorylate Akt, which in
turn mediates the effect of rosuvastatin on nNOS (Figure 6b).
Discussion
This is the first study to investigate the effect of HMG-CoA
reductase inhibitors on diabetic peripheral neuropathy. The
data demonstrate lipid-independent effects of the HMG-CoA
reductase inhibitor rosuvastatin on the recovery of vasa
nervorum and nerve function in diabetic neuropathy. Moreover, these data indicate that HMG-CoA reductase inhibitors
may have direct neurotrophic effects.
In our in vivo studies, the development of diabetic neuropathy is related to loss of vasa nervorum responsible for
perfusion of peripheral nerves. Nerve function correlated with
morphological observations of the vasa nervorum in the
affected nerves of the diabetic mice. The overall restoration
of the number and cross-sectional area of vasa nervorum in
db/db mice to a pattern similar to that of nondiabetic mice
was observed after rosuvastatin administration. The coincidence of restoration of vasa nervorum accompanied by
functional nerve recovery has now been documented in
diabetic animal models with the use of 3 distinct angiogenic
agents, VEGF,12 sonic hedgehog,13 and now rosuvastatin. In
the present study the recovery of vasa nervorum was mainly
associated with recovery of nNOS/NO production to nondiabetic levels. Moreover, we found that coadministration of
rosuvastatin and an nNOS specific inhibitor, TRIM, partially
reversed the effect of rosuvastatin. These results suggest that
NO production through nNOS might play an important role in
the regeneration of vasa nervorum. Multiple prior reports
have provided evidence of a link between statins, eNOS, and
angiogenesis14,16,29,30 and that rosuvastatin enhances release
of NO from the rat aortic vascular endothelium. Weis et al31
have reported that cerivastatin increases endothelial VEGF
release and modulates VEGF receptor-2 expression in endothelial cells. As indicated in these studies, the evidence that
statins regulate eNOS and VEGF in endothelial cells has
already been shown. However, no reports have shown that
statin also regulate nNOS, which is mainly expressed in
neuronal tissue and has the potential to produce more NO
than eNOS. Our in vitro data suggest that rosuvastatin
directly upregulates nNOS/NO in Schwann cells via the
PI3K/Akt signaling pathway. Together with these prior findings, our data support a vascular mechanism for at least part
Figure 4. Rosuvastatin (ROS)-induced restoration of nerve dysfunction is nNOS dependent. To determine whether
rosuvastatin-induced recovery of nerve function required nNOS,
we used the nNOS inhibiter TRIM and assessed MCV, SCV, and
tail-flick temperature in diabetic mice. db/db mice were randomly assigned to saline control, rosuvastatin injection (n⫽5), or
rosuvastatin injection⫹TRIM administration (n⫽5). Sciatic nerve
conduction measurements were performed at the time of treatment (0 week) and then at 2 and 4 weeks. Tail-flick testing was
performed at 4 weeks after treatment. Data are expressed as
mean⫾SEM. a and b, P⫽NS, *#P⬍0.01, **P⬍0.0001 compared
with saline. c, P⫽NS, *P⬍0.01 compared with nondiabetic control. P⫽NS, saline vs rosuvastatin⫹TRIM. d to i, Fluorescence
photomicrographs of representative longitudinal views of wholemounted mouse sciatic nerves (d to f) and their respective cross
sections (g to i) 4 weeks after treatment. Total network of vasa
nervorum in rosuvastatin injection group was well developed
and preserved (e and h). In contrast, vascularity of vasa nervorum in the rosuvastatin⫹TRIM group (f and i) was reduced and
appears similar to that in saline injection group (d and g).
Bar⫽200 ␮m. j and k, Quantitative analyses of nerve vascularity
(j, capillary density; k, cross-sectional vessel area) in the
rosuvastatin⫹TRIM group compared with the rosuvastatin group
in 10 randomly selected cross sections per nerve. Data are
expressed as mean⫾SEM (n⫽5 per study group). P⫽NS,
*P⬍0.01 compared with control.
100
Circulation
July 5, 2005
Figure 5. Effects of rosuvastatin (ROS) on HMVEC or Schwann cell
(ScC) proliferation and migration. For proliferation assay, HMVECs
were incubated with rosuvastatin for 24 hours after 24-hour serum
deprivation. BrdU (10 ␮mol/L) was added 6 hours before evaluation.
Proliferation activity was assessed by quantifying BrdU-positive cells
as a percentage of total cells (a). *P⬍0.05, **P⬍0.001 compared with
non-rosuvastatin control. Schwann cells were incubated with rosuvastatin for 48 hours after 30-hour serum deprivation. Proliferation activity
was assessed by absorbance at OD 570 nm (c). For migration assay,
cells were incubated with rosuvastatin for 4 hours in a modified Boyden chamber. Migrated cells were counted in 3 randomly selected
high-powered fields and averaged in each well. *P⬍0.001 compared
with non-rosuvastatin control (HMVEC, b). *P⬍0.05, **P⬍0.001 compared with non-rosuvastatin control (ScC, d). e, Effect of rosuvastatin
on NO production in Schwann cells. MSC80s were cultured in low
glucose (5 mmol/L [L]), high glucose (25 mmol/L [H]), and high glucose with rosuvastatin (1 ␮mol/L [H-ROS1] and 10 ␮mol/L
[H-ROS10]). After 48-hour incubation, nitrite concentrations in the culture medium from 6 wells were measured by colorimetric method as
NO productivity and averaged. P⫽NS, *P⬍0.0001 compared with low
glucose. All data are expressed as mean⫾SEM.
Figure 6. Rosuvastatin (ROS) restores downregulated Akt phosphorylation and nNOS expression in high glucose– exposed
Schwann cells. a, MSC80 cells were cultured in low glucose
(5 mmol/L [L]), high glucose (25 mmol/L [H]), mannitol
(25 mmol/L [M]), and high glucose with rosuvastatin in concentrations ranging from 0.001 to 10 ␮mol/L (H⫹ROS). After 48
hours in culture, cells were harvested and processed for Western analysis. Immunoblots were quantified and expressed as
relative values compared with low glucose. Immunoblots of
␣-actin and t-Akt were used as loading controls for nNOS and
p-Akt, respectively. Data are expressed as mean⫾SEM. a, High
glucose reduces nNOS and p-Akt in Schwann cells, and rosuvastatin restores both nNOS and p-Akt in a dose-dependent
manner. b, MSC80s were cultured in low (5 mmol/L) or high
(25 mmol/L) glucose in the presence of rosuvastatin (1 ␮mol/L),
dn-Akt, LY294002 (10 ␮mol/L), or myr-Akt for 48 hours. As
shown in b, dn-Akt and LY294002 both prevent rosuvastatinmediated restoration of nNOS and p-Akt in high glucose– exposed Schwann cells. P⫽NS, *P⬍0.01 compared with highglucose condition alone.
of the documented statin-mediated restoration of nerve
function.
Prior reports about the effect of statins on angiogenesis
have been conflicting between a stance of promotion14,15,32
and inhibition.33,34 These discrepant data may result from the
different cell types used or may be attributed to the different
statin concentrations. Indeed, recent data indicate that statins
have biphasic effects on angiogenesis.30,31 In our in vitro
studies, we used a wide range of concentrations of rosuvastatin to permit identification of a dose-response effect.30
Rosuvastatin promoted HMVEC proliferation at low concentrations (0.0001 to 0.1 ␮mol/L). However, a dose-dependent
inhibitory effect of rosuvastatin on HMVEC migration was
Ii et al
observed at concentrations from 0.1 to 10 ␮mol/L. On the
other hand, rosuvastatin dose-dependently promoted both
Schwann cell proliferation and migration at concentrations
from 0.0001 to 10 ␮mol/L. The interpretation of these in vitro
findings, specifically attempting to use these data to explain
the in vivo observations, is complicated by several factors.
First, the cell culture results are observations made in monoculture and therefore lack the dynamic environment of the
intact organism. Second, the concentrations used, which
bracket the serum concentrations in patients, may not perfectly reflect the microenvironment of the nerve. With these
caveats, however, the in vitro data demonstrate direct effects
of statins on neural elements. Indeed, in vivo proliferation in
the nerve assessed by the BrdU labeling technique indicated
that statin slightly promoted Schwann cell proliferative activity for at least 4 weeks after initiation of treatment (data not
shown). These results may explain why TRIM incompletely
reversed electrophysiological recovery induced by rosuvastatin. The restoration of vasa nervorum resulting from rosuvastatin treatment was almost completely reversed by administration of TRIM, as demonstrated by in situ fluorescent
imaging of whole-mounted explants of sciatic nerve (Figure
4). These data suggest that rosuvastatin may have not only a
vasodilating effect on the vasa nervorum but also direct
neurotrophic effects on the sciatic nerve itself. Administration
of TRIM to diabetic mice, without rosuvastatin, was not
performed in this study because our goal was to evaluate the
effect of nNOS antagonism on the salutary effects of rosuvastatin rather than in the native diabetic state. Nevertheless,
one could expect further worsening of nerve function by
inhibiting nNOS expression, which is already reduced in
diabetic mice, because nNOS has been shown to play a role
as a neuroprotective factor35,36 as well as a NO producer. The
data also suggest that statins could act by upregulating nNOS
expression via Akt activation in Schwann cells. The in vivo
data show that rosuvastatin resulted in recovery of both vessel
number and size in diabetic mice up to the nondiabetic level.
It is tempting to conclude, on the basis of this association, that
statin-induced angiogenesis led to nerve recovery; however,
further study will be needed to provide definitive evidence of
the sequence of events induced by statin administration that
led to restoration of nerve function.
Certain pieces of prior data are consistent with our present
findings. For example, Cameron et al37 showed improvement
in nerve function in a streptozotocin-induced model of
diabetes after administration of rosuvastatin. The same authors documented the impact of rosuvastatin on NOdependent function in aorta and corpus cavernosum of diabetic mice.38 Finally, and perhaps most importantly, Fried et
al39 studied patients with diabetes and showed a potential
attenuating effect of statin therapy on the advent of neuropathy in diabetic patients. In contrast, there is a significant
body of literature suggesting a positive relationship between
statin use and the onset of neuropathy.40 Together these prior
studies and the present data suggest that additional study is
required to achieve comprehensive understanding of both the
mechanisms of diabetic neuropathy and the potential therapeutic impact of statins.
101
In summary, rosuvastatin, a new HMG-CoA reductase
inhibitor, has a favorable effect on diabetic neuropathy that is
independent of its cholesterol-lowering effect and that is
associated with restoration of vasa nervorum. The effect of
rosuvastatin on vasa nervorum appears to be mediated via an
NO-dependent pathway. Moreover, we found that rosuvastatin restituted downregulated nNOS expression in Schwann
cells under high-glucose conditions at least in part via a
PI3K/Akt signaling pathway. Rosuvastatin also has a direct
neurotrophic effect, promoting proliferation and migration
activity of Schwann cells.
In the clinical setting, statins generally have been shown to
reduce cardiovascular events in association with reducing
lipid levels. In addition, however, recent data have revealed
that cardioprotective effects are extended to populations of
patients without significant lipid abnormalities. Our observations suggest an additional lipid-independent activity of
statins that may be of therapeutic relevance.
Acknowledgments
This study was supported in part by National Institutes of Health
grants (HL-53354, HL-60911, HL-63414, HL-63695, HL-66957)
and a grant from AstraZeneca US. We thank M. Neely and Deirdre
Costello for secretarial assistance.
Disclosure
Drs Ii and Losordo have received a research grant from AstraZeneca.
References
1. Tomlinson DR, Fernyhough P, Diemel LT. Role of neurotrophins in
diabetic neuropathy and treatment with nerve growth factors. Diabetes.
1997;46(suppl 2):S43–S49.
2. Reiber GE, Smith DG, Carter J, Fotieo G, Deery HG II, Sangeorzan JA,
Lavery L, Pugh J, Peter-Riesch B, Assal JP, del Aguila M, Diehr P,
Patrick DL, Boyko EJ. A comparison of diabetic foot ulcer patients
managed in VHA and non-VHA settings. J Rehabil Res Dev. 2001;38:
309 –317.
3. The Diabetes Control and Complications Trial Research Group. The
effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes
mellitus. N Engl J Med. 1993;329:977–986.
4. Cullum NA, Mahon J, Stringer K, McLean WG. Glycation of rat sciatic
nerve tubulin in experimental diabetes mellitus. Diabetologia. 1991;34:
387–389.
5. Greene DA, Lattimer SA, Sima AA. Sorbitol, phosphoinositides, and
sodium-potassium-ATPase in the pathogenesis of diabetic complications.
N Engl J Med. 1987;316:599 – 606.
6. Cameron NE, Cotter MA, Low PA. Nerve blood flow in early experimental diabetes in rats: relation to conduction deficits. Am J Physiol.
1991;261:E1–E8.
7. Apfel SC, Arezzo JC, Brownlee M, Federoff H, Kessler JA. Nerve growth
factor administration protects against experimental diabetic sensory neuropathy. Brain Res. 1994;634:7–12.
8. Tuck RR, Schmelzer JD, Low PA. Endoneurial blood flow and oxygen
tension in the sciatic nerves of rats with experimental diabetic neuropathy.
Brain. 1984;107:935–950.
9. Tesfaye S, Harris N, Jakubowski JJ, Mody C, Wilson RM, Rennie IG,
Ward JD. Impaired blood flow and arterio-venous shunting in human
diabetic neuropathy: a novel technique of nerve photography and fluorescein angiography. Diabetologia. 1993;36:1266 –1274.
10. Dyck PJ. Hypoxic neuropathy: does hypoxia play a role in diabetic
neuropathy. Neurology. 1989;39:111–118.
11. Stevens EJ, Carrington AL, Tomlinson DR. Nerve ischaemia in diabetic
rats: time-course of development, effect of insulin treatment plus comparison of streptozotocin and BB models. Diabetologia. 1994;37:43– 48.
12. Schratzberger P, Walter DH, Rittig K, Bahlmann FH, Pola R, Curry C,
Silver M, Krainin JG, Weinberg DH, Ropper AH, Isner JM. Reversal of
102
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Circulation
July 5, 2005
experimental diabetic neuropathy by VEGF gene transfer. J Clin Invest.
2001;107:1083–1092.
Kusano K, Allendoerfer KL, Munger W, Pola R, Bosch-Marce M,
Kirchmair R, Yoon YS, Curry C, Silver M, Kearney M, Asahara T,
Losordo DW. Sonic hedgehog induces arteriogenesis in diabetic vasa
nervorum and restores function in diabetic neuropathy. Arterioscler
Thromb Vasc Biol. 2004;24:2102–2107.
Kureishi Y, Luo Z, Shiojima I. The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in
normocholesterolemic animals. Nat Med. 2000;6:1004 –1010.
Llevadot J, Murasawa S, Kureishi Y, Uchida S, Masuda H, Kawamoto A,
Walsh K, Isner JM, Asahara T. HMG-CoA reductase inhibitor mobilizes
bone marrow–derived endothelial progenitor cells. J Clin Invest. 2001;108:
399–405.
Dimmeler S, Aicher A, Vasa M, Mildner-Rihm C, Adler K, Tiemann M,
Rutten H, Aeiher AM. HMG-CoA-reductase inhibitors (statins) increase
endothelial progenitor cells via the P13 kinase/Akt pathway. J Clin Invest.
2001;108:391–397.
Lacoste L, Lam JY, Hung J, Letchacovski G, Solymoss CB, Waters D.
Hyperlipidemia and coronary disease: correction of the increased thrombogenic potential with cholesterol reduction. Circulation. 1995;92:
3172–3177.
Bustos C, Hernandez-Presa MA, Ortego M, Tunon J, Ortega L, Perez F,
Diaz C, Hernandez G, Egido J. HMG-CoA reductase inhibition by atorvastatin reduces neointimal inflammation in a rabbit model of atherosclerosis. J Am Coll Cardiol. 1998;32:2057–2064.
Laufs U, Liao JK. Post-transcriptional regulation of endothelial nitric
oxide synthase mRNA stability by RHo GTPase. J Biol Chem. 1998;273:
24266 –24271.
West of Scotland Coronary Prevention Study Group. Influence of pravastatin
and plasma lipids on clinical events in the West of Scotland Coronary
Prevention Study (WOSCOPS). Circulation. 1998;97:1440–1445.
Heart Protection Study Collaborative Group. MRC/BHF Heart Protection
Study of cholesterol lowering with simvastatin in 20,536 high-risk individuals: a randomised placebo-controlled trial. Lancet. 2002;360:7–22.
Collins R, Armitage J, Parish S, Sleigh P, Peto R. MRC/BHF Heart
Protection Study of cholesterol-lowering with simvastatin in 5963 people
with diabetes: a randomised placebo-controlled trial. Lancet. 2003;361:
2005–2016.
McTaggart F, Buckett L, Davidson R, Holdgate G, McCormick A,
Schneck D, Smith G, Warwick M. Preclinical and clinical pharmacology
of rosuvastatin, a new 3-hydroxy-3-methylglutaryl coenzyme A reductase
inhibitor. Am J Cardiol. 2001;87:28B–32B.
Olsson AG. Statin therapy and reductions in low-density lipoprotein
cholesterol: initial clinical data on the potent new statin rosuvastatin.
Am J Cardiol. 2001;87:33B–36B.
Schratzberger P, Schratzberger G, Silver M, Curry C, Kearney M,
Magner M, Alroy J, Adelman LS, Weinberg DH, Ropper AH, Isner JM.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
Favorable effect of VEGF gene transfer on ischemic peripheral neuropathy. Nat Med. 2000;6:405– 413.
Chi H, Horie H, Hikawa N, Takenaka T. Isolation and age-related characterization of mouse Schwann cells from dorsal root ganglion explants in
type I collagen gels. J Neurosci Res. 1993;35:183–187.
Ii M, Hoshiga M, Fukui R, Negoro N, Nakakoji T, Nishiguchi F, Kohbayashi E,
Ishihara T, Hanafusa T. Beraprost sodium regulates cell cycle in vascular smooth
muscle cells through cAMP signaling by preventing down-regulation of
p27(Kip1). Cardiovasc Res. 2001;52:500–508.
Robertson DM, Sima AA. Diabetic neuropathy in the mutant mouse
[C57BL/ks(db/db)]: a morphometric study. Diabetes. 1980;29:60 – 67.
Stalker TJ, Lefer AM, Scalia R. A new HMG-CoA reductase inhibitor,
rosuvastatin, exerts anti-inflammatory effects on the microvascular endothelium: the role of mevalonic acid. Br J Pharmacol. 2001;133:406 – 412.
Urbich C, Dernbach E, Zeiher AM, Dimmeler S. Double-edged role of
statins in angiogenesis signaling. Circ Res. 2002;90:737–744.
Weis M, Heeschen C, Glassford AJ, Cooke JP. Statins have biphasic
effects on angiogenesis. Circulation. 2002;105:739 –745.
Pourati I, Kimmelstiel C, Rand W, Karas RH. Statin use is associated
with enhanced collateralization of severely diseased coronary arteries. Am
Heart J. 2003;146:876 – 881.
Sato I, Ma L, Ikeda M, Morita I, Murota S. Simvastatin, a potent
HMG-CoA reductase inhibitor, inhibits the proliferation of human and
bovine endothelial cells in vitro. J Atheroscler Thromb. 1998;4:102–106.
Vincent L, Chen W, Hong L, Mirshahi F, Mishal Z, Mirshahi-Khorassani
T, Vannier JP, Soria J, Soria C. Inhibition of endothelial cell migration by
cerivastatin, an HMG-CoA reductase inhibitor: contribution to its antiangiogenic effect. FEBS Lett. 2001;495:159 –166.
Thippeswamy T, Jain RK, Mumtaz N, Morris R. Inhibition of neuronal
nitric oxide synthase results in neurodegenerative changes in the axotomised dorsal root ganglion neurons: evidence for a neuroprotective role
of nitric oxide in vivo. Neurosci Res. 2001;40:37– 44.
Keilhoff G, Fansa H, Wolf G. Nitric oxide synthase, an essential factor in
peripheral nerve regeneration. Cell Mol Biol (Noisy-le-grand). 2003;49:
885–897.
Cameron N, Cotter M, Inkster M, Nangle M. Looking to the future:
diabetic neuropathy and effects of rosuvastatin on neurovascular function
in diabetes models. Diabetes Res Clin Pract. 2003;61(suppl 1):S35–S39.
Nangle MR, Cotter MA, Cameron NE. Effects of rosuvastatin on nitric
oxide– dependent function in aorta and corpus cavernosum of diabetic
mice: relationship to cholesterol biosynthesis pathway inhibition and lipid
lowering. Diabetes. 2003;52:2396 –2402.
Fried LF, Forrest KY, Ellis D, Chang Y, Silvers N, Orchard TJ. Lipid
modulation in insulin-dependent diabetes mellitus: effect on microvascular outcomes. J Diabetes Complications. 2001;15:113–119.
Chong PH, Boskovich A, Stevkovic N, Bartt RE. Statin-associated peripheral neuropathy: review of the literature. Pharmacotherapy. 2004;24:
1194 –1203.
CLINICAL PERSPECTIVE
Peripheral polyneuropathy occurs in 50% of patients with long-standing diabetes. The sensory deficits that characterize this
condition are a major factor in the development of skin ulcerations that contribute to a major source of morbidity in diabetic
patients. Despite the frequency of diabetic neuropathy, its pathophysiology remains incompletely characterized, and, as a result,
no uniformly effective therapy has been developed for preventing or reversing this condition. Among the prevailing hypotheses
for the pathophysiology of diabetic neuropathy, attrition of the vasa nervorum recently has gained momentum as a result of
clinical and experimental studies. Tesfaye et al (N Engl J Med. 2005;352:341–350) recently reported the strong association
between vascular risk factors and the advent of neuropathy in people with diabetes, who also exhibit reduced circulating levels
of endothelial progenitor cells, and our laboratory has shown in multiple models that nerve dysfunction in diabetes is preceded
by loss of the vasa and that the process can be prevented or reversed by angiogenic factors. In diabetic patients treated with
vascular endothelial growth factor gene therapy, improvements in nerve function have been observed. The statins have been
shown to act as angiogenic factors by multiple potential mechanisms. In the present study, we show that statins may reverse or
prevent the onset of diabetic neuropathy by preserving the integrity of the vasa nervorum. The data suggest that this effect is
mediated in part by a previously unrecognized salutary effect of statins on neuronal nitric oxide synthase expression by neural
elements. These findings may add to the growing list of indications for statin administration early in the course of diabetes, but
of course this recommendation awaits confirmation in clinical trials.
Pediatric Cardiology
Early Structural and Functional Changes of the Vasculature
in HIV-Infected Children
Impact of Disease and Antiretroviral Therapy
Marietta Charakida, MD; Ann E. Donald, AVS; Hannah Green, MSc; Clare Storry, BSc, AVS;
Margaret Clapson, RGN, RSCN, RHV, BSc; Muriel Caslake, PhD; David T. Dunn, PhD;
Julian P. Halcox, MD, MA, MRCP; Diana M. Gibb, MD, MSc; Nigel J. Klein, PhD, FRCPCH;
John E. Deanfield, BA, BChir, MB, FRCP
Background—Premature cardiovascular disease is increasingly recognized in HIV-infected patients, but the mechanisms
involved are unclear. The purpose of this study was to determine the impact of HIV infection and antiretroviral therapy
(ART) on markers of early vascular disease in children.
Methods and Results—We studied 83 HIV-infected children (56 had taken ART, of whom 31 received a regimen containing
protease inhibitors [PIs]; 27 were never treated) and a control group of 59 healthy children. Carotid intima-media thickness
(IMT) and brachial artery flow-mediated dilatation (FMD) were measured. IMT was significantly greater in HIV-infected
children compared with the control subjects (P⬍0.001). Among the HIV-infected children, age and treatment were
significantly associated with increased IMT. Children exposed to PIs had greater IMT compared with both non–PI-treated
children and untreated children (P⫽0.02). FMD was also significantly reduced in the HIV-infected children compared with
control subjects (P⫽0.02). Pairwise comparisons of different treatment exposure groups revealed that FMD was impaired by
a mean of 3.6% (95% CI, 1.8 to 5.3; P⬍0.001) for children exposed to PIs compared with untreated children and by a mean
of 1.8% (95% CI, 0.01 to 3.5; P⫽0.05) compared with non–PI-treated children. HIV-infected children had lipid abnormalities,
but they did not account for the observed differences in either FMD or IMT.
Conclusions—HIV infection in childhood is associated with adverse structural and functional vascular changes that are
most pronounced in children exposed to PI therapy. Longitudinal studies are required to differentiate the relative impact
of HIV disease and ART and to assess the potential for prevention. (Circulation. 2005;112:103-109.)
Key Words: endothelium 䡲 HIV 䡲 protease inhibitors
H
of atherogenesis begins earlier.7 Numerous cardiovascular
risk factors have been shown to affect both endothelial
vascular function and early structural arterial wall changes
from the first decade of life.8,9
We therefore studied children who acquired HIV through
mother-to-child transmission to examine the potential effect of
chronic HIV infection and ART on measures of vascular
structure and function. This population provides the opportunity
not only to investigate the impact of HIV infection and ART on
the vasculature but to do so without the confounding effect of the
cumulative risk factor burden present by adulthood.
uman immunodeficiency virus (HIV) infection is a major
cause of morbidity and mortality worldwide. In developed
countries, life expectancy has increased considerably as a result
of antiretroviral therapy (ART), and cardiovascular disease has
emerged as an important late concern.1,2 Recent studies have
shown a 26% increase in myocardial infarction in HIV-infected
adults per year exposure to ART and that metabolic abnormalities related to the use of combination therapy may contribute.3–5
Protease inhibitors (PIs), in particular, are associated with
dyslipidemia, insulin resistance, and lipodystrophic phenotype,
which may be due to hepatic overproduction of VLDL and, to a
lesser extent, impaired clearance.5,6 It has been difficult, however, to separate the effects of HIV disease itself, drug treatment,
metabolic consequences, or interactions with the exposure to
classic risk factors for atherosclerosis.
Although clinical manifestations of atherosclerosis do not
typically present until middle and late adulthood, the process
Methods
Study Population and Design
We studied HIV-infected children attending Great Ormond Street
Hospital (GOSH) NHS Trust (London, UK). Children with current
Received October 26, 2004; revision received February 7, 2005; accepted March 8, 2005.
From the Vascular Physiology Unit (M. Charakida, A.E.D., C.S., J.P.H., J.E.D.) and Infectious Diseases and Microbiology Unit (N.J.K.), Institute of
Child Health, London (N.J.K.); Medical Research Council Clinical Trials Unit, London (H.G., D.T.D., D.M.G.); Infectious Diseases Unit, Great Ormond
Street Hospital for Children, NHS TRUST, London (M. Clapson); Department of Vascular Biochemistry, Division of Cardiovascular and Medical
Sciences, University of Glasgow, Glasgow (M. Caslake), UK.
Correspondence to Marietta Charakida, Vascular Physiology Unit, 30 Guilford St, London, WC1N 1EH, UK. E-mail [email protected]
103
104
Circulation
July 5, 2005
opportunistic infections or cardiovascular risk factors, including
hypertension, diabetes, and renal failure, were excluded. Of the 96
HIV-infected children identified as eligible for the study, 83 agreed
to participate. Fifty-nine healthy volunteer children were recruited as
control subjects from healthy siblings of the HIV-infected children
and children of staff working at the hospital. No formal matching
was used in selecting the control children (apart from siblings). None
had a current or recent infectious illness, nor were they receiving any
medication or vitamin supplementation.
All children had a clinical examination, including blood pressure
measurements, blood sampling, anthropometry, and vascular measurements. Details of past clinical and ART history were extracted
from the UK Collaborative HIV Pediatric Study (CHIPS) database.10
The HIV clinic at GOSH does not use rigid criteria for initiating
ART. However, ART is usually started for persistently low or
declining CD4% counts and/or clinical deterioration. The nature of
the ART regime was not based on measures of disease severity.
Ethnicity data were obtained from the National Study of HIV in
Pregnancy and Childhood (NSHPC).
Institutional Review Board approval was received, and all parents
or caregivers and children, when appropriate, gave written informed
consent to participate in the study at the time of the visit.
Anthropometric Measurements
Weight and height were recorded, and body mass index (BMI;
kg/m2) was calculated. Values were converted to age- and sexadjusted z scores with the use of UK reference curves.11 Blood
pressure was measured as the average of 3 seated readings with an
automated oscillometric device (Omron). A pediatric cuff was used
when the arm circumference was ⬍25 cm and an adult cuff when the
arm circumference was ⬎25 cm.
Blood Sample Analysis
Nonfasting blood was taken from all children in heparinized tubes,
and 1 mL of plasma was stored at ⫺80°C. Lipid levels and
inflammatory markers (see below) were measured in all subjects, and
markers of disease activity were assessed in the HIV-infected
children.
obtained. The optimal longitudinal image was acquired on the R
wave of the ECG and continuously recorded on videotape for 5
seconds. Measurements of the posterior wall of the artery were made
from stored images with electronic calipers. IMT was calculated as
the distance between the first bright line (lumen-intima interface) and
the leading edge of the second bright line (media-adventitia interface). Six measurements, the 3 maximum measurements of the right
common carotid artery in 3 different frames and the 3 maximum
measurements of the left common carotid artery in 3 different
frames, were averaged.
FMD Study
Each child underwent measurement of endothelium-dependent vascular responses of the right brachial artery by high-resolution
ultrasound imaging with an Acuson 5- to 10-MHz linear probe as
previously reported.8 Brachial artery diameter was measured offline
by an automatic edge detection system (Brachial Tools) and expressed as a percentage change from baseline diameter.14 Dopplerderived flow measurements (using a pulsed-wave Doppler signal at
a 70° angle) were also obtained continuously. The increase in blood
flow after the release of the cuff was expressed as a percentage
change from the baseline flow. Endothelium-independent response
to glyceryl trinitrate (GTN) was also calculated as a percentage
change from the baseline diameter after sublingual administration of
25 ␮g GTN in the HIV-infected children only.
In descriptive analyses, parametric summary statistics and significance tests were used when the data were approximately normally
distributed; otherwise, nonparametric methods were used. All FMD
and GTN analyses were adjusted for baseline diameter; GTN
analyses were adjusted for weight. Multivariate regression analysis
was used to examine relationships between vascular measurements
and HIV infection status and ART exposure with adjustment for
potential confounders. Confounders included age, sex, ethnicity,
Centers for Disease Control (CDC) stage, hsCRP, glucose, and
selected lipid parameters. Variables that were not normally distributed were log10 transformed to reduce the influence of outlying
observations.
Markers of HIV Severity and Inflammation
HIV RNA viral load was measured by branched DNA assay (Chiron
Diagnostics) with a lower limit of detection of 50 copies per 1 mL.
CD4% was measured by flow cytometry. For viral load and CD4%
measurements, the closest measurements (within 3 months before the
study visit) were used if available. High-sensitivity C-reactive
protein (hsCRP) was analyzed with an in-house ELISA method.12
Lipoprotein Analysis
Total cholesterol was measured by enzymatic colorimetry; HDL was
measured directly in plasma after precipitation with polyethylene
glycol (Roche Diagnostics). Apolipoprotein B (apoB) and lipoprotein (a) [Lp(a)] were measured by immunoturbimetry kits from
WAKO and Diasys Diagnostic Systems, respectively. LDL peak and
mean particle diameters were determined by PAGE, as described in
detail elsewhere.13
Vascular Measurements
All vascular measurements were undertaken by 2 experienced
investigators. Measurement on a random sample of 10 HIV-infected
and 10 control children performed by both investigators showed no
evidence of systematic observer bias (mean difference in intimamedia thickness [IMT], 0.003 [P⫽0.80, paired t test]; mean difference in flow-mediated dilation [FMD], 0.25 [P⫽0.40, paired t test]).
IMT Study
The right and left common carotid arteries were scanned with a 5- to
10-MHz linear-array transducer (Acuson). The carotid bulb was
identified, and longitudinal 2D ultrasonographic images of the
common carotid artery 1 to 2 cm proximal to the carotid bulb were
Results
Study Population
The 83 HIV-infected children had a mean age of 11.0 years
(range, 5.4 to 17.7 years); 70% were black; and all had
acquired HIV from mother-to-child transmission. The control
children were 1 year older than the HIV-infected children;
80% were white and had similar age-adjusted BMI scores
(Table 1).
Twenty-seven HIV-infected children had never received
ART. The remaining 56 children had taken ART for a median
of 5 years (range, 0.2 to 14 years). Of these 56, 31 had
received regimens containing a PI (Table 2). At the time of
the study, 48 children were taking ART (23 including a PI),
and 35 children were not receiving any ART. Of the 31
PI-exposed children, 8 were on combination therapy that did
not include a PI at the time of the study visit (median duration
since a PI was taken, 1.3 years; range, 0.5 to 2.8 years).
Twenty HIV-infected children (24%) had previously experienced a CDC stage C disease15; all 20 had been treated with
ART (15 exposed to PI therapy) (Table 2).
Lipoprotein Parameters
Triglycerides, non-HDL cholesterol, apoB, and Lp(a) were
significantly higher in HIV-infected children compared with
control subjects. In addition, HIV-infected children had
Charakida et al
Vascular Consequences of HIV and Its Treatment
105
TABLE 1. Demographic Data, Clinical Parameters, Lipid Results, and Vascular
Measurements in HIV-Infected Children and Control Subjects
Demographic data
Age, y
Male, %
Height z score (IQR)
BMI z score (IQR)
Clinical parameters
Diastolic blood pressure, mm Hg
Heart rate, bpm
Glucose, mmol/L
hsCRP, median (IQR), mg/L
Lipid/blood results
Total cholesterol, mmol/L
HDL cholesterol, mmol/L
Non-HDL cholesterol, mmol/L
Mean particle diameter, nm
Peak particle diameter, nm
ApoB, mg/dL
Lp(a), median (IQR), mg/dL
Triglycerides, median (IQR), mmol/L
Vascular measurements
IMT, mm
FMD,† %
GNT-mediated dilation,‡ %
HIV-Infected Children
(n⫽83)
Control Subjects
(n⫽59)
11.0 (3.1)
57
⫺0.31 (⫺1.26–0.27)
0.04 (⫺0.78–0.87)
12.2 (2.8)
47
0.30 (⫺0.15–0.94)
0.20 (⫺0.46–1.04)
P*
0.014
0.31
0.0002
0.39
104 (10)
61 (9)
80 (13)
4.4 (0.7)
0.6 (0.2–2.3)
110 (12)
63 (8)
72 (12)
5.1 (0.3)
0.2 (0.1–0.6)
0.0009
0.09
0.0003
⬍0.0001
⬍0.0001
4.1 (0.9)
1.2 (0.5)
2.9 (0.8)
28.2 (1.0)
27.8 (1.2)
75 (17)
42 (23–69)
1.0 (0.7–1.3)
3.8 (0.7)
1.4 (0.3)
2.4 (0.6)
29.0 (1.1)
28.6 (1.4)
64 (11)
23 (14–51)
0.6 (0.5–0.8)
0.06
0.02
0.0007
⬍0.0001
0.0009
0.0001
0.02
⬍0.001
0.6 (0.07)
7.9 (4.9)
15.1 (5.3)
0.47 (0.06)
9.4 (5.8)
⬍0.0001
0.02
IQR indicates interquartile range. Height, BMI, blood pressure, heart rate, and lipid measurements
only were available for 56, 56, 55, 55, and 43 control children, respectively. Values are given as
mean (SD) unless otherwise stated.
*Based on the 2-sample t test or Wilcoxon 2-sample test when appropriate.
†Adjusted for baseline diameter; estimates given for mean baseline diameter of 2.86 mm.
‡Adjusted for baseline diameter and weight; estimates given for mean baseline diameter of
2.81 mm and mean weight of 36.9 kg.
significantly lower HDL cholesterol levels and mean and
peak LDL particle sizes (Table 1).
Within the HIV cohort, differences in lipid parameters
were observed between those receiving different treatment
regimens (Table 2). Total cholesterol was higher in children
receiving ART (both with and without PI) compared with
untreated HIV-infected children. Lp(a), apoB, and triglyceride levels were higher in PI-treated children compared with
non–PI-treated and untreated HIV-infected children. HDL
cholesterol levels were lower in the untreated HIV-infected
children compared with treated children, and the latter had
levels similar to those in the control children.
CRP Measurement
hsCRP was significantly higher in the HIV-infected children
compared with control subjects (Table 1). Eight HIV-infected
children had markedly increased hsCRP values (CRP ⬎10
mg/L); although they did not have clinical evidence of acute
infection, these CRP levels are compatible with acute inflammation. However, the difference in CRP values between
control subjects and HIV-infected children remained when
the analysis was performed with these 8 children omitted.
Vascular Measurements
IMT Assessment
IMT measurements were available for 77 of the 83 HIVinfected children and 45 of the 53 control subjects. IMT was
higher in the HIV-infected children compared with the
control subjects (P⬍0.0001; Table 1) in both unadjusted and
adjusted analyses. There was a significant association between IMT and age in the HIV-infected children that was not
observed in the control subjects (Figure 1A); for every year
increase in age, IMT was increased on average by 0.005 mm
(95% CI, 0.0003 to 0.01). There was no association between
ethnicity and IMT in either HIV-infected or control children.
There was evidence of a treatment effect when the HIVinfected children were categorized as ever exposed to PIs,
non–PI-treated, and untreated (P⫽0.03; Table 2). Exposure to
PIs was associated with a higher mean IMT compared with
both those untreated (P⫽0.04) and the non–PI-treated group
(P⫽0.01; Figure 1B). Similar results were found when the
children were categorized according to their treatment regimen at the time of the test (data not shown). There was no
association between IMT and CD4% or viral load at the time
of the study, but more advanced CDC stage was associated
106
Circulation
TABLE 2.
July 5, 2005
Comparison of ART Exposure in HIV-Infected Children
PI Treated
(n⫽31)
Non–PI Treated
(n⫽25)
Untreated
(n⫽27)
P*
Demographic data
Age, y
11.1 (3.5)
11.5 (3.0)
10.3 (2.5)
0.39
62
44
63
0.72
Height z score, median (IQR)
⫺0.59 (⫺1.35–0.18)
⫺0.40 (⫺0.94–0.06)
⫺0.24 (⫺1.32–0.38)
0.75
BMI z score, median (IQR)
⫺0.20 (⫺0.81–0.75)
0.04 (⫺0.93–0.56)
0.62 (⫺0.25–1.19)
0.13
Male, %
Clinical parameters
103 (10)
103 (8)
106 (10)
0.37
61 (12)
60 (7)
61 (6)
0.90
Heart rate, bpm
79 (11)
79 (12)
83 (15)
0.37
Glucose, mmol/L
4.4 (0.8)
4.3 (0.6)
4.4 (0.7)
0.79
1.1 (0.2–2.0)
1.2 (0.4–6.7)
0.4 (0.4–2.0)
0.14
0
⬍0.0001
hsCRP, median (IQR), mg/L
Clinical parameters related to HIV and ART
CDC stage C, %
CD4%, median (IQR)
HIV RNA, log10 copies/mL
48
26 (21–34)
2.30 (0.98)
Exposure to ART, median (IQR), y
5.3 (4.7–6.8)
Exposure to PIs, median (IQR), y
4.2 (2.7–5.1)
20
26 (14–29)
2.68 (1.11)
22 (19–24)
0.18
4.08 (0.70)
⬍0.0001
0.002
3.8 (2.3–6.0)
Lipid/blood results
Total cholesterol, mmol/L
4.6 (0.9)
4.0 (0.8)
3.6 (0.8)
HDL cholesterol, mmol/L
1.4 (0.5)
1.3 (0.5)
1.0 (0.3)
0.0007
Non-HDL cholesterol, mmol/L
3.2 (1.0)
2.7 (0.7)
2.7 (0.7)
0.02
ApoB, mg/dL
80 (20)
73 (15)
72 (15)
0.13
Mean particle diameter, nm
28.0 (1.1)
28.3 (0.7)
28.3 (1.2)
0.52
Peak particle diameter, nm
27.7 (1.2)
27.0 (1.3)
27.8 (1.3)
0.74
Lp(a), median (IQR), mg/dL
50 (38–86)
33 (17–45)
34 (21–63)
0.01
Triglycerides, median (IQR), mmol/L
1.1 (0.8–1.4)
0.9 (0.8–1.2)
0.9 (0.6–1.4)
0.31
Vascular measurements
IMT, mm
0.62 (0.07)
0.58 (0.06)
0.58 (0.06)
FMD,† %
6.3 (5.4)
8.1 (5.9)
9.9 (5.7)
14.5 (8.4)
14.0 (9.5)
17.2 (8.9)
GTN-mediated dilation,‡ %
0.03
0.0005
0.08
IQR indicates interquartile range. Eight of the PI-treated children were on combination therapy that did not include a PI at the time
of the study visit. Eight children in the non-PI group were off all treatment at the time of the study visit. CD4% and HIV RNA: closest
measurement within 3 months before the time of the study visit (n⫽78 for CD4%, n⫽77 for HIV RNA). There are 4 CDC stages that
reflect the extent of HIV disease progression: N signifies no signs or symptoms; A, B, and C, increasingly severe disease; and C, AIDS).
Values are given as mean (SD) unless otherwise stated.
*Global probability values are based on ANOVA or the Kruskal-Wallis test when appropriate.
†Adjusted for baseline diameter; estimates given for mean baseline diameter of 2.80 mm.
‡Adjusted for baseline diameter and weight; estimates given for mean baseline diameter of 2.80 mm and mean weight of 36.9 kg.
with greater IMT. However, in multivariate analyses, the
higher IMT in children with exposure to PIs could not be
accounted for by CDC stage or other potential confounders.
Notably, there was no association between IMT and duration
of PI therapy.
FMD Assessment
FMD measurements were available for 82 of the 83 HIVinfected children and 57 of the 59 control children. Resting
vessel size, blood flow, and reactive hyperemia were similar
in both groups. FMD was lower in the HIV-infected children
than in the control subjects after adjustment for baseline diameter (P⫽0.02; Table 1 and Figure 2A). The relationship remained after adjustment for age, sex, and other potential confounders. There was no evidence of an association between age,
sex, ethnicity, lipids, and hsCRP in the whole cohort.
Among the HIV-infected children, there were no differences in baseline vessel diameter, baseline flow, or reactive
hyperemia in the different treatment groups. FMD was
significantly lower in those exposed to PIs compared with
non–PI-treated (P⫽0.05) and untreated (P⬍0.001) children.
Similar results were obtained when the analysis was performed by current therapy (Figure 2B). The response to GTN
was not associated with exposure to ART (Table 2). As for
IMT, CDC stage C was associated with lower FMD. FMD
was also inversely related to hsCRP, and this relationship
remained after the 8 HIV-infected children whose hsCRP was
⬎10 mg/L were excluded. However, the relationship between
FMD and ART exposure remained after adjustment for CDC
stage, hsCRP, and other potential confounders in multivariate
analysis.
Charakida et al
Figure 1. IMT in HIV-infected children and control subjects. A,
IMT and age. IMT was increased on average by 0.005 mm/y
(95% CI, 0.0003 to 0.01; P⫽0.04) (solid line) in HIV-infected children, whereas no association with age was found in control
subjects (dotted line). B, IMT according to exposure to treatment. IMT was significantly higher in children who had received
PIs. *P⫽0.04, **P⫽0.01.
Discussion
This study demonstrates that structural and functional
changes of the vasculature are already present during childhood in HIV-infected children. These changes were most
pronounced in children receiving PIs but were also observed
in non–PI-treated and untreated children. Our findings support a role for both HIV infection itself and ART, particularly
PIs, in the pathogenesis of early vascular disease, likely to be
relevant to future clinical atherosclerosis.
Several studies have raised concerns about the effect of
HIV and ART on both progression of atherosclerosis and
cardiovascular events in adults.4,16 PIs in particular are
associated with metabolic abnormalities and lipodystrophic
phenotype in adults, which may add to the background risk
factor profile.5 However, the relative impact of disease,
treatment, and underlying risk factor profile remains unclear.
These factors are particularly hard to disentangle in adults
because the timing of HIV infection is often unknown and
there may be an interaction between the presence of classic
risk factors for atherosclerotic disease and ART.
The long-term consequences of HIV infection are particularly important for young individuals. With newer antiretroviral regimens, HIV has now become a chronic illness in
107
Figure 2. Endothelial function in HIV-infected children and control subjects. A, FMD was significantly reduced in HIV-infected
children. *P⫽0.02. B, FMD according to ART received at time of
study visit. FMD was reduced in children receiving PIs.
*P⫽0.006, **P⬍0.0001.
developed countries. Thus, HIV-infected children have the
potential to survive even to the third or fourth decade of life.
Because cardiovascular disease is emerging as an important
health concern at these ages, it is critically important to
determine the early impact of both the HIV infection and its
treatment on the arterial wall in these children.
In our study, we measured carotid IMT to assess structural
disease of the arterial wall. IMT represents the cumulative
burden of adverse influences operating from the earliest
stages of disease. Increased IMT, shown to reflect conventional risk factor burden in children as young as 10 years of
age, is an independent predictor of adverse cardiovascular
outcome.17 We also assessed endothelial function, which is
known to be a key event in the initiation and progression of
preclinical atherosclerosis.18 In particular, reduction in local
nitric oxide bioavailability, reflected by the magnitude of
FMD response, is associated with a proinflammatory, proliferative, and procoagulant phenotype that establishes a locally
atherogenic environment. FMD is a dynamic measure of
arterial function that can be used to assess the impact of both
risk factors and interventions.19,20 Using these 2 wellvalidated measurements of arterial structure and function, we
have described the impact of disease and treatment, minimizing the effects of exposure to confounding risk factors usually
present in adults.
Only 1 other study has examined the vascular changes of
long-term exposure to HIV in children. FMD was impaired,
108
Circulation
July 5, 2005
as in our study, but IMT was not increased.21 The more
extensive vascular changes in our population may be due to
older age and worse disease. IMT was related to both age (a
surrogate for duration of HIV) and CDC stage. The observed
differences between HIV-infected children and control subjects remained after differences in the baseline characteristics
between the groups were accounted for, suggesting that these
changes may be related to HIV disease. Our study also raised
the possibility that vascular function may be related to ART.
Both IMT and FMD were impaired in children receiving
ART; this was most pronounced in the PI-treated children.
However, these findings must be viewed with some caution.
Although PIs would not have been included or excluded on
the basis of disease severity, there have been changes in the
ART regimens since triple therapy became available for
children in 1997. Perhaps most important is that triple therapy
at that time would likely have included a PI. In recent years,
however, there has been a trend toward the use of a nonnucleoside reverse-transcriptase inhibitor as first-line therapy.
We have attempted to control for variables such as age that
may have influenced our analyses, but more studies are
required to clarify the role of ART on vascular dysfunction.
It is also unclear whether the observed vascular changes
that appear to be associated with ART are driven by changes
in the metabolic profile of these children. Insulin resistance
and metabolic syndrome have been independently associated
with vascular disease and accelerated cardiovascular disease
in HIV-infected adults. Insulin resistance and the full metabolic syndrome are prevalent in overweight youth, and it has
been suggested that they are increasingly prevalent in highrisk HIV-infected young people, especially blacks.22 In the
present study, we did not find major differences in BMI z
scores between cases and controls and between HIV-infected
children receiving different antiretroviral regimens. Further
studies are required to ascertain the vascular effects of ART
in childhood and to provide insight into the mechanisms
contributing to vascular disease.
HIV may promote atherosclerosis by activating the vascular endothelium directly or indirectly by systemic cytokine
stimulation by the virus.23 In addition, opportunistic agents
such as cytomegalovirus or herpesvirus, often present in HIV
may contribute to endothelial damage.24,25 In this study,
HIV-infected children had elevated total cholesterol and
cholesterol subfractions. In particular, it is interesting to note
that Lp(a) levels, which are highly genetically determined,
also were elevated in HIV-infected children compared with
control subjects. This finding, however, must be interpreted
with caution. The average Lp(a) level is higher in black than
in white children, so ethnic differences may contribute to the
Lp(a) variability. Furthermore, within the HIV cohort, the
most pronounced changes in Lp(a) were noted in children
receiving PI therapy. It is possible that increased synthesis or
clearance of the particle related to HIV infection and PI
therapy can account for our observed differences. The disturbances of lipids [increased total cholesterol and Lp(a) and a
smaller LDL particle size] in our children receiving PIs are
similar to those reported in adults but did not account for the
observed vascular abnormalities.26 Nevertheless, the impact
of lipid abnormalities on vascular disease progression in HIV
certainly warrants further prospective exploration. Other
mechanisms may also contribute to the adverse effect of HIV
and ART on vascular disease, including enhanced expression
of macrophage scavenger receptors and mitochondrial
toxicity.23,27
HIV infection and ART are associated with an atherogenic
structural and functional arterial phenotype from early childhood. Because death rates among HIV-infected children have
decreased 5-fold since the introduction of the highly active
antiretroviral treatment, careful long-term monitoring appears
warranted to detect emerging cardiovascular disease. Longitudinal studies are needed to understand the cause of vascular
disease and to ascertain the contribution of different ART
regimens. Pharmacological or physiological interventions
may be required to prevent future vascular events in HIVinfected children.
Acknowledgments
We thank the Greek State Scholarship Foundation, which supported
Marietta Charakida, and CORDA, which supported Ann Donald
through the Silcock legacy. We thank the MRC Childhood Nutrition
Research Center for funding Clare Storry. We are extremely grateful
to all the children who took part in this study and the HIV Study
Team, particularly Dr Vas Novelli. We thank T. Duong, Gill Wait,
and K. Dierholt at MRC Clinical Trials Unit for assistance in
extracting data from the CHIPS cohort.
References
1. Gortmaker SL, Hughes M, Cervia J, Brady M, Johnson GM, Seage GR,
III, Song LY, Dankner WM, Oleske JM. Effect of combination therapy
including protease inhibitors on mortality among children and adolescents
infected with HIV-1. N Engl J Med. 2001;345:1522–1528.
2. Palella FJ Jr, Delaney KM, Moorman AC, Loveless MO, Fuhrer J, Satten
GA, Aschman DJ, Holmberg SD. Declining morbidity and mortality
among patients with advanced human immunodeficiency virus infection:
HIV Outpatient Study Investigators. N Engl J Med. 1998;338:853– 860.
3. Carr A, Cooper DA. Adverse effects of antiretroviral therapy. Lancet.
2000;356:1423–1430.
4. Friis-Moller N, Sabin CA, Weber R, d’Arminio MA, El Sadr WM, Reiss
P, Thiebaut R, Morfeldt L, De Wit S, Pradier C, Calvo G, Law MG, Kirk
O, Phillips AN, Lundgren JD. Combination antiretroviral therapy and the
risk of myocardial infarction. N Engl J Med. 2003;349:1993–2003.
5. Walli R, Herfort O, Michl GM, Demant T, Jager H, Dieterle C, Bogner
JR, Landgraf R, Goebel FD. Treatment with protease inhibitors associated
with peripheral insulin resistance and impaired oral glucose tolerance in
HIV-1–infected patients. AIDS. 1998;12:F167–F173.
6. Carr A, Samaras K, Chisholm DJ, Cooper DA. Pathogenesis of HIV-1protease inhibitor–associated peripheral lipodystrophy, hyperlipidaemia,
and insulin resistance. Lancet. 1998;351:1881–1883.
7. Stary HC. Evolution and progression of atherosclerotic lesions in
coronary arteries of children and young adults. Arteriosclerosis. 1989;9:
I19-I32.
8. Bennett-Richards K, Kattenhorn M, Donald A, Oakley G, Varghese Z,
Rees L, Deanfield JE. Does oral folic acid lower total homocysteine
levels and improve endothelial function in children with chronic renal
failure? Circulation. 2002;105:1810 –1815.
9. Jarvisalo MJ, Raitakari M, Toikka JO, Putto-Laurila A, Rontu R, Laine S,
Lehtimaki T, Ronnemaa T, Viikari J, Raitakari OT. Endothelial dysfunction and increased arterial intima-media thickness in children with
type 1 diabetes. Circulation. 2004;109:1750 –1755.
10. Gibb DM, Duong T, Tookey PA, Sharland M, Tudor-Williams G, Novelli
V, Butler K, Riordan A, Farrelly L, Masters J, Peckham CS, Dunn DT.
Decline in mortality, AIDS, and hospital admissions in perinatally HIV-1
infected children in the United Kingdom and Ireland. BMJ. 2003;
327:1019.
11. Freeman JV, Cole TJ, Chinn S, Jones PR, White EM, Preece MA. Cross
sectional stature and weight reference curves for the UK, 1990. Arch Dis
Child. 1995;73:17–24.
Charakida et al
12. Packard CJ, O’Reilly DS, Caslake MJ, McMahon AD, Ford I, Cooney J,
Macphee CH, Suckling KE, Krishna M, Wilkinson FE, Rumley A, Lowe
GD. Lipoprotein-associated phospholipase A2 as an independent predictor of coronary heart disease: West of Scotland Coronary Prevention
Study Group. N Engl J Med. 2000;343:1148 –1155.
13. Belo L, Caslake M, Gaffney D, Santos-Silva A, Pereira-Leite L,
Quintanilha A, Rebelo I. Changes in LDL size and HDL concentration in
normal and preeclamptic pregnancies. Atherosclerosis. 2002;162:
425– 432.
14. Leeson CP, Whincup PH, Cook DG, Donald AE, Papacosta O, Lucas A,
Deanfield JE. Flow-mediated dilation in 9- to 11-year-old children: the
influence of intrauterine and childhood factors. Circulation. 1997;96:
2233–2238.
15. Centers for Disease Control. 1994 Revised classification system for
human immunodeficiency virus infection in children less than 13 years of
age. MMWR. 1994;43:RR-12.
16. Rickerts V, Brodt H, Staszewski S, Stille W. Incidence of myocardial
infarctions in HIV-infected patients between 1983 and 1998: the
Frankfurt HIV-Cohort Study. Eur J Med Res. 2000;5:329 –333.
17. Jarvisalo MJ, Jartti L, Nanto-Salonen K, Irjala K, Ronnemaa T, Hartiala
JJ, Celermajer DS, Raitakari OT. Increased aortic intima-media thickness:
a marker of preclinical atherosclerosis in high-risk children. Circulation.
2001;104:2943–2947.
18. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s.
Nature. 1993;362:801– 809.
19. de Jongh S, Lilien MR, op’t Roodt J, Stroes ES, Bakker HD, Kastelein JJ.
Early statin therapy restores endothelial function in children with familial
hypercholesterolemia. J Am Coll Cardiol. 2002;40:2117–2121.
20. Engler MM, Engler MB, Malloy MJ, Chiu EY, Schloetter MC, Paul SM,
Stuehlinger M, Lin KY, Cooke JP, Morrow JD, Ridker PM, Rifai N,
21.
22.
23.
24.
25.
26.
27.
109
Miller E, Witztum JL, Mietus-Snyder M. Antioxidant vitamins C and E
improve endothelial function in children with hyperlipidemia: Endothelial
Assessment of Risk From Lipids in Youth (EARLY) Trial. Circulation.
2003;108:1059 –1063.
Bonnet D, Aggoun Y, Szezepanski I, Bellal N, Blanche S. Arterial
stiffness and endothelial dysfunction in HIV-infected children. AIDS.
2004;18:1037–1041.
Bitnun A, Sochett E, Dick PT, To T, Jefferies C, Babyn P, Forbes J, Read
S, King SM. Insulin sensitivity and beta-cell function in protease inhibitor–treated and –naive human immunodeficiency virus–infected
children. J Clin Endocrinol Metab. 2005;90:168 –174.
Lewis W. Atherosclerosis in AIDS: potential pathogenetic roles of antiretroviral therapy and HIV. J Mol Cell Cardiol. 2000;32:2115–2129.
Alber DG, Vallance P, Powell KL. Enhanced atherogenesis is not an
obligatory response to systemic herpesvirus infection in the apoEdeficient mouse: comparison of murine gamma-herpesvirus-68 and
herpes simplex virus-1. Arterioscler Thromb Vasc Biol. 2002;22:
793–798.
Nieto FJ, Adam E, Sorlie P, Farzadegan H, Melnick JL, Comstock GW,
Szklo M. Cohort study of cytomegalovirus infection as a risk factor for
carotid intimal-medial thickening, a measure of subclinical atherosclerosis. Circulation. 1996;94:922–927.
Stein JH, Klein MA, Bellehumeur JL, McBride PE, Wiebe DA, Otvos JD,
Sosman JM. Use of human immunodeficiency virus-1 protease inhibitors
is associated with atherogenic lipoprotein changes and endothelial dysfunction. Circulation. 2001;104:257–262.
Dressman J, Kincer J, Matveev SV, Guo L, Greenberg RN, Guerin T,
Meade D, Li XA, Zhu W, Uittenbogaard A, Wilson ME, Smart EJ. HIV
protease inhibitors promote atherosclerotic lesion formation independent
of dyslipidemia by increasing CD36-dependent cholesteryl ester accumulation in macrophages. J Clin Invest. 2003;111:389 –397.
Stroke
Prediction of Myocardial Infarction by
N-Terminal-Pro-B–Type Natriuretic Peptide,
C-Reactive Protein, and Renin in Subjects With
Cerebrovascular Disease
Duncan J. Campbell, MD, PhD; Mark Woodward, PhD; John P. Chalmers, MD, PhD;
Samuel A. Colman, MBios; Alicia J. Jenkins, MD; Bruce E. Kemp, PhD; Bruce C. Neal, MD, PhD;
Anushka Patel, MD; Stephen W. MacMahon, PhD
Background—B-type natriuretic peptide (BNP), C-reactive protein (CRP), and renin are elevated in persons at risk for
cardiovascular disease. However, data that directly compare these markers in the prediction of myocardial infarction
(MI) are limited.
Methods and Results—N-terminal-proBNP (NT-proBNP), CRP, and renin were measured in baseline blood samples from
a nested case-control study of the 6105 participants of the Perindopril Protection Against Recurrent Stroke Study
(PROGRESS), a placebo-controlled study of a perindopril-based blood pressure–lowering regimen among individuals
with previous stroke or transient ischemic attack. Each of 206 subjects who experienced MI, either fatal or nonfatal,
during a mean follow-up of 3.9 years was matched to 1 to 3 control subjects. Most MI cases (67%) occurred in subjects
without a history of coronary heart disease. NT-proBNP, CRP, and renin each predicted MI; the odds ratio for subjects
in the highest compared with the lowest quarter was 2.2 (95% CI, 1.3 to 3.6) for NT-proBNP, 2.2 (95% CI, 1.3 to 3.6)
for CRP, and 1.7 (95% CI, 1.1 to 2.8) for renin. NT-proBNP and renin, but not CRP, remained predictors of MI after
adjustment for all other predictors, including LDL and HDL cholesterol levels. Individuals with both NT-proBNP and
renin in their highest quarters had 4.5 times the risk of MI compared with subjects with both biological markers in their
lowest quarters.
Conclusions—NT-proBNP and renin, but not CRP, are independent predictors of MI risk after stroke or transient ischemic
attack, providing information additional to that provided by classic risk factors, and may enable more effective targeting
of MI prevention strategies. (Circulation. 2005;112:110-116.)
Key Words: C-reactive protein 䡲 myocardial infarction 䡲 natriuretic peptides 䡲 renin 䡲 risk factors
lthough known risk factors account for ⱖ90% of the
population-attributable risk for myocardial infarction
(MI),1 the costs of prevention strategies have led to a targeted
approach to prevention of coronary heart disease, whereby
interventions are tailored to the estimated risk of the individual.2,3 To better identify individuals at highest risk, many
different potential plasma markers have been assessed for
prediction of MI risk, including C-reactive protein (CRP),
B-type natriuretic peptides (BNP), and renin,4 –14 and there
has been recent debate about the magnitude of risk associated
with elevated CRP levels.15,16 When measured after an acute
coronary event, both BNP-related peptides and CRP, separately and together, predict mortality, MI, and heart failure.17–21 However, limited data are available that directly
compare BNP-related peptides, CRP, and renin in stable
A
persons at risk of MI, and it is unknown whether screening for
⬎1 of these biological markers provides better prognostic
information than screening for 1 marker.
See p 9
We evaluated the prognostic performance of N-terminal
(NT)-proBNP, CRP, and renin in a population with cerebrovascular disease and increased risk of MI by conducting a
nested case-control study of 206 subjects who developed MI
and 412 control subjects who did not develop MI who were
participants in the Perindopril Protection Against Recurrent
Stroke Study (PROGRESS). PROGRESS was a multicenter,
randomized, double-blind, placebo-controlled study designed
to determine the effects of active therapy with a perindoprilbased blood pressure–lowering regimen on the risks of stroke
Received November 30, 2004; revision received December 23, 2004; accepted March 4, 2005.
From St Vincent’s Institute of Medical Research (D.J.C., B.E.K.) and Department of Medicine (D.J.C., A.J.J., B.E.K.), University of Melbourne, St
Vincent’s Hospital, Fitzroy, Victoria; CSIRO Health Sciences and Nutrition (B.E.K.), Parkville, Victoria; and The George Institute for International
Health (M.W., J.P.C., S.A.C., B.C.N., A.P., S.W.M.), University of Sydney, Camperdown, New South Wales, Australia.
Correspondence to Dr D.J. Campbell, St. Vincent’s Institute of Medical Research, 41 Victoria Parade, Fitzroy, Victoria 3065, Australia. E-mail
[email protected]
110
Campbell et al
and other major vascular events among individuals with a
stroke or transient ischemic attack (TIA) within the previous
5 years.22–24 This regimen substantially reduced the risk of
stroke by 28%, major coronary events by 26%, congestive
heart failure (CHF) by 26%, and nonfatal MI by 38%.22,24
Methods
Patients and Study Protocol
We conducted a prospective nested case-control analysis among
PROGRESS participants, who were a predominantly elderly population with cerebrovascular disease and were at high risk of both
coronary events and CHF.24 The design and major outcomes of
PROGRESS have been described in detail elsewhere.22–24 Briefly,
6105 participants were recruited from 172 collaborating centers in 10
countries from Australasia, Europe, and Asia between 1995 and
1997. Participants were randomized to either placebo (n⫽3054) or
active therapy (n⫽3051), comprising a flexible regimen based on the
ACE inhibitor perindopril (4 mg daily) with the addition of the
diuretic indapamide at the discretion of treating physicians. The
institutional ethics committee of each collaborating center approved
the trial, and all participants provided written, informed consent.
Individuals were potentially eligible if they had a history of cerebrovascular disease (ischemic stroke, hemorrhagic stroke, or TIA but
not subarachnoid hemorrhage) within the previous 5 years and no
clear indication for or contraindication to ACE inhibitor treatment.
There were no blood pressure criteria for entry, but it was recommended that the blood pressure of all hypertensive subjects be
controlled with agents other than ACE inhibitors and angiotensin
receptor blockers before entry into the study. CHF was a study
exclusion criterion.
Before randomization, information was collected on history of
vascular disease, other vascular risk factors, and current medications.22–24 The presence of coronary heart disease at baseline was
based on a history of MI or coronary revascularization or a history of
angina supported by documented ECG or angiographic evidence of
coronary disease. Blood samples were collected (nonfasting, 10 mL
into heparin and 10 mL into EDTA Vacutainer tubes) from 5918 of
the 6105 subjects on enrollment before the run-in phase of the study,
at which time none of the subjects was receiving ACE inhibitor or
angiotensin receptor blocker therapy. After randomization, participants were scheduled to be seen on 5 occasions in the first year and
every 6 months thereafter until the end of the scheduled follow-up
period or death. Information on all serious adverse events, including
those resulting from stroke, coronary heart disease, and CHF, were
routinely recorded. All outcomes were coded according to the ninth
revision of the International Classification of Diseases (ICD-9). The
diagnosis of MI, either fatal (death within 28 days of MI) or nonfatal,
was based on the combination of an appropriate clinical history
supported by ECG changes and/or an elevation of cardiac enzymes
or other biochemical markers of myocardial injury (ICD-9 code
410.0 to 410.9). Sudden deaths were excluded from this outcome
because of uncertainty about the cause of death in this population
with preexisting cerebrovascular disease, as were deaths resulting
from other acute, subacute, or chronic forms of ischemic heart
disease. An adjudication committee, blinded to study treatment
allocation, reviewed source documentation for every potential MI,
stroke, and all deaths recorded during the study follow-up period.
Biochemical Analyses
Coded blood samples were shipped at 4°C to the local laboratory,
where they were centrifuged at 2000g for 10 minutes at 4°C, and the
plasma was frozen in aliquots and stored at ⫺80°C until assay.
Lipids were measured on first-thaw EDTA plasma by automated
direct-measurement assay (Olympus AU2700, Olympus America
Inc). LDL cholesterol was calculated for those with triglycerides
⬍4.5 mmol/L by use of Friedewald’s equation.25 Plasma levels of
active renin were measured on first-thaw heparin plasma by immunoradiometric assay (Nichols Institute Diagnostics). NT-proBNP
was measured by radioimmunoassay with an Elecsys instrument
Prediction of MI in Cerebrovascular Disease
111
(Roche Diagnostics),26 and CRP was measured by high-sensitivity
nephelometry (Dade Behring) on heparin plasma that had been
thawed once or twice before assay. We previously showed that
NT-proBNP and CRP are stable in plasma that was thawed twice
(unpublished). Plasma samples from cases and controls were assayed
for lipids, renin, NT-proBNP, and CRP in identical and masked
fashion. The local laboratory at each study center measured plasma
creatinine.
Statistical Methods
The base population for study was taken as all those who had plasma
frozen and stored at baseline (n⫽5918). A nested case-control
sample was selected from this base population. Cases (n⫽206) were
anyone from the base population who developed MI during the mean
follow-up of the PROGRESS trial of 3.9 years. By design, 412
(206⫻2) matched controls without MI during follow-up in the
PROGRESS trial were sampled, giving a total of 618 cases and
controls for biochemical analysis. For calculation of odds ratios, each
case was matched with 1 to 3 controls randomly sampled from this
group of 618 subjects who were alive and did not have an MI
between randomization and the time of case ascertainment; anyone
who became a case after the onset of MI in the index case was
eligible for selection as a match, and controls could be matched for
⬎1 case.27 Matching variables were age (within 5 years), gender,
treatment allocated (perindopril based or placebo, monotherapy or
dual therapy), region (Australia and New Zealand, China, Japan,
France and Belgium, Italy, Sweden, United Kingdom, and Ireland),
and most recent qualifying event (ischemic stroke or TIA, hemorrhagic stroke, stroke of unknown type) at randomization. If cases
who acted as controls for other cases and controls who acted for
multiple cases are included, 45 cases had 3 matched controls, 157
had 2 matched controls, and 4 had 1 matched control. Because no
matched controls were available, 3 cases were matched on incomplete criteria: Two were not matched for region, and 1 was not
matched for region and most recent qualifying event.
Baseline variables were compared between cases and controls by
the use of ␹2, parametric, or nonparametric tests as appropriate.27 The
case-control data were analyzed using 2 different conditional logistic
regression models to obtain odds ratios for NT-proBNP, CRP, and
renin, according to equal quarters of the distribution of each plasma
marker in the total sample (cases and controls).27 Model 1 was
unadjusted except for the matching variables. Model 2 was adjusted
through matching and for all baseline predictors of MI: baseline
systolic blood pressure, total cholesterol, HDL cholesterol, LDL
cholesterol, and a history of coronary heart disease, valvular heart
disease, and peripheral arterial disease. In addition, model 2 for
NT-proBNP was adjusted for CRP and renin; model 2 for CRP was
adjusted for NT-proBNP and renin; and model 2 for renin was
adjusted for NT-proBNP and CRP. Continuous variables are shown
as mean⫾SD, except for plasma levels of triglycerides, NT-proBNP,
CRP, and renin, which were not normally distributed and are
presented as median (interquartile range). Odds ratios are shown as
mean (95% CI). All probability values were 2 tailed, and values of
P⬍0.05 were considered to indicate statistical significance. All
analyses were performed with SAS version 8.2 (SAS Institute Inc).
Results
The baseline clinical and biochemical characteristics of the
206 MI cases and 412 controls without MI are given in Table
1. Most MI cases (67%) did not have a previous history of
coronary heart disease. Compared with controls without MI
during the period of observation, MI cases had higher
baseline systolic blood pressure and were more likely to have
a history of coronary heart disease, valvular heart disease, and
peripheral arterial disease (Table 1). In addition, MI cases had
higher baseline total and LDL cholesterol, lower HDL cholesterol, and higher levels of NT-proBNP and CRP (Table 1).
112
Circulation
July 5, 2005
TABLE 1.
Baseline Clinical and Biochemical Characteristics of Patients
Characteristic
Cases
(n⫽206)
Controls Without MI
(n⫽412)
Mean age, y
68⫾8
68⫾8
Male, n (%)
P
0.88*
170 (83)
336 (82)
0.77*
Asian,† n (%)
45 (22)
96 (23)
0.68*
Randomization to perindopril-based therapy,
n (%)
81 (39)
164 (40)
0.91*
Qualifying event‡
Ischemic stroke, n (%)
143 (69)
286 (69)
1
Cerebral hemorrhage, n (%)
16 (8)
32 (8)
1
Unknown stroke, n (%)
20 (10)
30 (7)
0.30
TIA or amaurosis fugax, n (%)
51 (25)
105 (25)
0.84
Time since qualifying event, mo
8 (3–19)
8 (3–19)
0.97
153⫾19
149⫾19
0.03
86⫾12
84⫾11
0.12
Other vascular disease history
Hypertension,§ n (%)
109 (53)
188 (46)
Antihypertensive therapy, n (%)
112 (54)
210 (51)
0.43
History of coronary heart disease,储 n (%)
68 (33)
94 (23)
0.007
History of atrial fibrillation, n (%)
17 (8)
37 (9)
0.76
9 (4)
5 (1)
0.01
Left ventricular hypertrophy on ECG,
n (%)
16 (8)
41 (10)
0.38
Peripheral arterial disease, n (%)
22 (11)
24 (6)
0.03
Current smoker, n (%)
47 (23)
79 (19)
0.29
History of diabetes, n (%)
37 (18)
58 (14)
0.21
26.4⫾3.6
26.0⫾3.5
0.19
Valvular heart disease, n (%)
0.09
Other medical history
Body mass index, kg/m2
Current medications
␤-Blockers, n (%)
54 (26)
103 (25)
0.74
Calcium channel blockers, n (%)
90 (44)
150 (36)
0.08
Diuretics, n (%)
37 (18)
61 (15)
0.31
Other antihypertensives, n (%)
16 (8)
32 (8)
160 (78)
313 (76)
Statins, n (%)
17 (8)
39 (9)
0.62
Oral anticoagulants, n (%)
19 (9)
49 (12)
0.32
Antiplatelet agents, n (%)
1
0.64
Plasma lipids,¶ mmol/L
Total cholesterol
5.8⫾1.1
5.5⫾1.1
0.002
HDL cholesterol
1.18⫾0.31
1.26⫾0.38
0.01
0.0002
LDL cholesterol
3.59⫾1.0
3.27⫾0.94
Triglycerides
2.1 (1.5–3.1)
2.0 (1.4–2.8)
0.11
Creatinine, ␮mol/L
96⫾24
94⫾23
0.34
NT-proBNP, pmol/L
23.2 (9.4–59.1)
14.8 (7.4–32.8)
0.0002
CRP, mg/L
2.7 (1.4–6.8)
2.1 (1.0–5.0)
0.0004
Renin, mU/L
27 (15–46)
23 (11–39)
0.10
Continuous variables are shown as mean⫾SD or median (interquartile range).
*Controls were matched for these criteria.
†Participants were recruited from People’s Republic of China or Japan.
‡Subjects could have ⬎1 qualifying event.
§Baseline systolic blood pressure ⱖ160 mm Hg or diastolic blood pressure ⱖ90 mm Hg.
储History of MI, coronary revascularization, or angina (supported by documented ECG or angiographic evidence of coronary disease).
¶To convert values for cholesterol to mg/dL, divide by 0.02586; to convert values for triglycerides
to mg/dL, divide by 0.01129; to convert values for creatinine to mg/L, multiply by 0.113; to convert
values for NT-proBNP to ng/L, multiply by 8.4.
Campbell et al
113
TABLE 2. Odds Ratios for MI According to Baseline Plasma Levels of
NT-proBNP, CRP, and Renin
Quarter
Variable
1
2
3
P for
Trend
4
NT-proBNP (pmol/L)
Mean
4.2
12.0
27.2
115.4
Range
0.5–8.2
8.3–17.3
17.4–41.3
42.3–686.7
Model 1
Odds ratio
1
95% CI
0.89
1.87
2.17
0.53–1.48
1.10–3.18
1.30–3.62
0.0004
Model 2
Odds ratio
1
95% CI
0.91
1.99
2.67
0.51–1.60
1.08–3.68
1.43–4.97
0.0002
CRP, mg/L
Mean
0.6
1.7
3.7
12.0
Range
0.1–1.1
1.1–2.4
2.4–5.5
5.5–62.6
Model 1
Odds ratio
1
95% CI
1.72
1.75
2.18
1.03–2.86
1.04–2.94
1.32–3.61
0.004
Model 2
Odds ratio
1
95% CI
1.50
0.92
1.33
0.85–2.65
0.50–1.66
0.75–2.35
0.68
116.0
Renin, mU/L
Mean
7.6
17.5
31.6
Range
0.5–12.4
12.5–23.3
23.5–40.6
40.7–1050.8
Model 1
Odds ratio
1
95% CI
1.11
1.08
1.73
0.68–1.81
0.65–1.80
1.06–2.81
0.03
Model 2
Odds ratio
95% CI
1
1.10
1.41
1.91
0.64–1.90
0.80–2.49
1.10–3.32
0.001
Model 1 is not adjusted, except through matching. Model 2 is adjusted through matching and for
baseline systolic blood pressure, total cholesterol, HDL cholesterol, LDL cholesterol, and history of
coronary heart disease, valvular heart disease, and peripheral arterial disease. In addition, model 2
for NT-proBNP is adjusted for CRP and renin; model 2 for CRP is adjusted for NT-proBNP and renin;
and model 2 for renin is adjusted for NT-proBNP and CRP.
The odds ratio for MI increased with increasing levels of
baseline NT-proBNP, CRP, and renin. For subjects in the
highest compared with the lowest quarter, the odds ratio was
2.2 (95% CI, 1.3 to 3.6) for NT-proBNP, 2.2 (95% CI, 1.3 to
3.6) for CRP, and 1.7 (95% CI, 1.1 to 2.8) for renin (Table 2).
NT-proBNP and renin, but not CRP, remained independent
predictors of MI in multivariable analysis (model 2, Table 2).
Other variables that were predictors after multivariable analysis were HDL cholesterol and LDL cholesterol. Although
there was a trend for MI cases to be more likely to be taking
calcium channel blocker therapy, addition of this parameter to
model 2 did not significantly change the calculated odds
ratios. To examine why CRP failed to predict MI risk in
multivariable analysis, we examined the effects of other
variables in model 2. CRP predicted MI (P⬍0.05) when a
history of coronary heart disease, valvular heart disease, and
peripheral arterial disease, as well as total cholesterol, LDL
cholesterol, and renin, were included in the model. However,
when HDL cholesterol (P⫽0.20), systolic blood pressure
(P⫽0.13), or NT-proBNP (P⫽0.12) was added separately to
the model, CRP was no longer a statistically significant
predictor of MI. The combination of NT-proBNP and renin
had a multiplicative effect on the odds ratio for MI, so that
individuals with both NT-proBNP and renin in their highest
quarters had 4.5 times the risk of MI compared with subjects
with both biological markers in their lowest quarters (the
Figure).
Discussion
NT-proBNP and renin were independent predictors of MI
risk, and each marker provided information additional to that
obtained from established risk factors. Although CRP predicted MI risk in an analysis adjusted for the matching
variables alone (model 1, Table 2), it did not predict MI in
multivariable analysis including all other predictors (model 2,
Table 2).
114
Circulation
July 5, 2005
Multivariable-adjusted odds ratio for MI according to quarters of
NT-proBNP and renin concentration. Reference group is those
subjects in quarter 1 for both NT-proBNP and renin. Ranges of
NT-proBNP and renin levels for each quarter are shown in Table
2. Variables adjusted for are listed for model 2 in the footnote
for Table 2.
We found that NT-proBNP levels above the median of 17
pmol/L were associated with increased risk of MI. This
median NT-proBNP level was within the normal range for
NT-proBNP levels.28 –30 Median NT-proBNP levels from
population studies approximate 33 pmol/L,28,29 although a
lower median of 16 to 19 pmol/L is reported for healthy
subjects without a history or symptoms of heart disease or
other chronic disease.29,30 We recently showed that similar
levels of NT-proBNP were associated with increased risk of
CHF in PROGRESS participants.31 Wang et al6 similarly
found that BNP levels within a range currently regarded as
normal were associated with an increased risk of death and
first cardiovascular event, including heart failure, atrial fibrillation, and stroke or TIA in the Framingham Offspring Study.
However, BNP did not predict coronary heart disease events
in the Framingham Offspring Study.6 The difference between
prediction of MI risk by NT-proBNP in PROGRESS participants and failure to predict coronary heart disease events by
BNP in the Framingham Offspring Study may have been due
to differences between the 2 study populations. PROGRESS
participants had a mean age of 68 years, and all had
established vascular disease, as evidenced by preceding
stroke or TIA, whereas subjects in the Framingham Offspring
Study were younger (mean age, 58 years), and most were free
of cardiovascular disease at baseline. In addition, we used a
narrower definition of coronary heart disease events than
Wang et al.6
When measured after an acute coronary event, both BNPrelated peptides and CRP, separately and together, predict
mortality, MI, and heart failure.17–21 Other studies of stable
subjects without acute coronary syndrome show that BNP
and NT-proBNP predict all-cause mortality and cardiovascular events, although MI risk was not specifically examined in
these studies.7–9 Plasma BNP level predicted dopamineinduced myocardial ischemia in patients with known or
suspected coronary heart disease,32 suggesting that increased
BNP levels may be associated with subclinical cardiac
ischemia and therefore increased risk of MI. Our study
provides additional new information by demonstrating that
NT-proBNP predicts MI in stable patients, most of whom did
not have a history of coronary heart disease. Elevated BNP
and NT-proBNP levels may indicate ventricular strain,33 and
release of BNP from ventricular myocytes may be an important compensatory response. BNP has beneficial effects in
heart failure34 and is reported to reduce infarct size in
experimental MI.35
CRP is an established risk factor for cardiovascular events,
including MI,4,5 although there has been recent debate about
the magnitude of risk associated with elevated CRP levels.15,16 Our finding that NT-proBNP was superior to CRP in
the prediction of MI risk may be a result of CRP being a
nonspecific marker of acute-phase response,36 whereas NTproBNP is a cardiac-specific marker. Increased BNP and
NT-proBNP levels are associated with a broad range of
cardiac conditions,37 most of which relate to increased ventricular strain.33 NT-proBNP and CRP were independent
predictors of risk of CHF in PROGRESS participants.31 It is
of note that 78% of MI cases and 76% of controls without MI
were receiving antiplatelet agents (Table 1), predominantly
aspirin. Ridker et al4 showed that aspirin therapy attenuated
prediction of risk of MI and stroke by CRP in the Physicians’
Health Study, and aspirin therapy may have similarly attenuated the prediction of MI risk by CRP in our study.
Our finding that renin predicted MI risk in subjects with
cerebrovascular disease is in agreement with previous reports
that renin predicted coronary heart disease in hypertensive
subjects,10,12,14 although other studies failed to observe such
an association in either normotensive or hypertensive subjects.11,13 Further evidence for an association between renin
and cardiovascular disease is its association with increased
urinary albumin excretion in essential hypertension.38 The
relatively few studies of renin as a risk factor for cardiovascular disease may be due in part to the difficulties in
measuring plasma renin activity. Our demonstration of renin
as an independent predictor of MI risk using a simple
immunoradiometric assay for active renin may lead to further
assessment of the potential value of renin as a risk factor for
cardiovascular disease.
A large body of data implicates angiotensin II in the
pathogenesis of vascular disease,39 and angiotensin II may
provide the link between increased renin levels and MI risk.
However, it is also possible that increased renin levels are a
marker of MI risk without playing a pathogenic role.13 For
example, increased MI risk and increased renin levels may
both be consequences of generalized vascular disease, including renovascular disease, which may cause increased renin
secretion.40 Perindopril-based therapy reduced the incidence
of major coronary events by 26% in PROGRESS participants; however, our study did not have sufficient statistical
power to examine whether baseline plasma levels of NTproBNP, CRP, or renin predicted benefit from this therapy.
Campbell et al
The potential limitations of these data merit consideration.
Our analyses were based on single baseline determinations
that may not accurately reflect NT-proBNP, CRP, and renin
levels over the mean follow-up of 3.9 years. This source of
variability may have contributed to the failure of CRP to
predict MI risk in multivariable analysis, but it cannot
account for the observed associations between NT-proBNP,
renin, and MI risk because any random misclassification
would bias results toward the null hypothesis. Our definition
of MI may have excluded cases of silent MI or those that
resulted in sudden death; however, our MI cases did not include
instances of death not caused by MI. In our nested case-control
design, we matched for 5 baseline variables but were unable to
match for all predictors of MI such as known cardiac disease
because of difficulty in matching for ⬎5 variables; however, we
were able to adjust for these baseline predictors of MI in our
multivariable analysis (model 2, Table 2).
What is the clinical value of measurement of NT-proBNP
and renin? We have shown that NT-proBNP and renin
provided prognostic information additional to that provided
by classic risk factors, including systolic blood pressure, total
cholesterol, HDL cholesterol, LDL cholesterol, and a history
of coronary heart disease, valvular heart disease, and peripheral arterial disease. Moreover, MI cases and controls were
matched for age, sex, region, qualifying event, and allocated
treatment. Whereas measurement of NT-proBNP and renin is
unlikely to influence management of individuals who already
qualify for intensive strategies for prevention of cardiovascular disease, measurement of these markers may assist in the
identification of individuals at increased risk of MI who may
not otherwise be identified by classic risk factors.
In conclusion, we performed a head-to-head evaluation of
a range of potential risk factors for MI, including classic risk
factors, in subjects with previous stroke or TIA. We found
that NT-proBNP and renin, but not CRP, independently
predicted MI risk. The prognostic information provided by
NT-proBNP and renin was additional to that provided by
traditional cardiovascular risk factors and may enable more
effective targeting of MI prevention strategies. Further studies are required to assess whether the use of NT-proBNP and
renin levels to guide management improves patient outcomes.
Acknowledgments
This study was funded by grants from the NIH (5-R01-HL-071685),
National Health and Medical Research Council of Australia, and
National Heart Foundation of Australia. Drs Campbell and Neal are
recipients of Career Development Awards, and Dr Jenkins is a
recipient of a Clinical Research Fellowship from the National Heart
Foundation of Australia. Dr Kemp is an Australian Research Council
Federation Fellow. PROGRESS was funded by grants from Servier,
the Health Research Council of New Zealand, and the National
Health and Medical Research Council of Australia.
Disclosure
Dr Campbell has had research contracts with Solvay Pharmaceuticals
and Novartis and has received consulting fees from Novartis during
the past 5 years. Drs Chalmers and MacMahon hold research grants
from Servier, as Chief Investigators for PROGRESS and ADVANCE, administered by the University of Sydney. Drs Chalmers,
Patel, Neal, Woodward, and MacMahon have also received honoraria from Servier for speaking in relation to PROGRESS and/or
ADVANCE at scientific meetings.
115
References
1. Yusuf S, Hawken S, Ounpuu S, Dans T, Avezum A, Lanas F, McQueen
M, Budaj A, Pais P, Varigos J, Lisheng L. Effect of potentially modifiable
risk factors associated with myocardial infarction in 52 countries (the
INTERHEART study): case-control study. Lancet. 2004;364:937–952.
2. Greenland P, Smith SC Jr, Grundy SM. Improving coronary heart disease
risk assessment in asymptomatic people: role of traditional risk factors
and noninvasive cardiovascular tests. Circulation. 2001;104:1863–1867.
3. National Cholesterol Education Program, National Heart, Lung, and
Blood Institute, National Institutes of Health. Third report of the National
Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult
Treatment Panel III): final report. Circulation. 2002;106:3143–3421.
4. Ridker PM, Cushman M, Stampfer MJ, Tracy RP, Hennekens CH.
Inflammation, aspirin, and the risk of cardiovascular disease in apparently
healthy men. N Engl J Med. 1997;336:973–979.
5. Pearson TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO 3rd,
Criqui M, Fadl YY, Fortmann SP, Hong Y, Myers GL, Rifai N, Smith SC
Jr, Taubert K, Tracy RP, Vinicor F. Markers of inflammation and cardiovascular disease: application to clinical and public health practice: a
statement for healthcare professionals from the Centers for Disease
Control and Prevention and the American Heart Association. Circulation.
2003;107:499 –511.
6. Wang TJ, Larson MG, Levy D, Benjamin EJ, Leip EP, Omland T, Wolf
PA, Vasan RS. Plasma natriuretic peptide levels and the risk of cardiovascular events and death. N Engl J Med. 2004;350:655– 663.
7. McDonagh TA, Cunningham AD, Morrison CE, McMurray JJ, Ford I,
Morton JJ, Dargie HJ. Left ventricular dysfunction, natriuretic peptides,
and mortality in an urban population. Heart. 2001;86:21–26.
8. Ueda R, Yokouchi M, Suzuki T, Otomo E, Katagiri T. Prognostic value
of high plasma brain natriuretic peptide concentrations in very elderly
persons. Am J Med. 2003;114:266 –270.
9. Olsen MH, Wachtell K, Tuxen C, Fossum E, Bang LE, Hall C, Ibsen H,
Rokkedal J, Devereux RB, Hildebrandt P. N-terminal pro-brain natriuretic peptide predicts cardiovascular events in patients with hypertension
and left ventricular hypertrophy: a LIFE study. J Hypertens. 2004;22:
1597–1604.
10. Brunner HR, Laragh JH, Baer L, Newton MA, Goodwin FT, Krakoff LR,
Bard RH, Buhler FR. Essential hypertension: renin and aldosterone, heart
attack and stroke. N Engl J Med. 1972;286:441– 449.
11. Doyle AE, Jerums G, Johnston CI, Louis WJ. Plasma renin levels and
vascular complications in hypertension. BMJ. 1973;2:206 –207.
12. Alderman MH, Madhavan S, Ooi WL, Cohen H, Sealey JE, Laragh JH.
Association of the renin-sodium profile with the risk of myocardial
infarction in patients with hypertension. N Engl J Med. 1991;324:
1098 –1104.
13. Meade TW, Cooper JA, Peart WS. Plasma renin activity and ischemic
heart disease. N Engl J Med. 1993;329:616 – 619.
14. Alderman MH, Ooi WL, Cohen H, Madhavan S, Sealey JE, Laragh JH.
Plasma renin activity: a risk factor for myocardial infarction in hypertensive patients. Am J Hypertens. 1997;10:1– 8.
15. Danesh J, Wheeler JG, Hirschfield GM, Eda S, Eiriksdottir G, Rumley A,
16. Tall AR. C-reactive protein reassessed. N Engl J Med. 2004;350:
1450 –1452.
17. de Lemos JA, Morrow DA, Bentley JH, Omland T, Sabatine MS,
McCabe CH, Hall C, Cannon CP, Braunwald E. The prognostic value of
B-type natriuretic peptide in patients with acute coronary syndromes.
N Engl J Med. 2001;345:1014 –1021.
18. Jernberg T, Stridsberg M, Venge P, Lindahl B. N-terminal pro brain
natriuretic peptide on admission for early risk stratification of patients
with chest pain and no ST-segment elevation. J Am Coll Cardiol. 2002;
40:437– 445.
19. Sabatine MS, Morrow DA, de Lemos JA, Gibson CM, Murphy SA, Rifai
N, McCabe C, Antman EM, Cannon CP, Braunwald E. Multimarker
approach to risk stratification in non–ST elevation acute coronary syndromes: simultaneous assessment of troponin I, C-reactive protein, and
B-type natriuretic peptide. Circulation. 2002;105:1760 –1763.
20. James SK, Lindahl B, Siegbahn A, Stridsberg M, Venge P, Armstrong P,
Barnathan ES, Califf R, Topol EJ, Simoons ML, Wallentin L. N-terminal
pro-brain natriuretic peptide and other risk markers for the separate
prediction of mortality and subsequent myocardial infarction in patients
with unstable coronary artery disease: a Global Utilization of Strategies to
116
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
Circulation
July 5, 2005
Open Occluded Arteries (GUSTO)-IV substudy. Circulation. 2003;108:
275–281.
Richards AM, Nicholls MG, Espiner EA, Lainchbury JG, Troughton RW,
Elliott J, Frampton C, Turner J, Crozier IG, Yandle TG. B-type natriuretic
peptides and ejection fraction for prognosis after myocardial infarction.
Circulation. 2003;107:2786 –2792.
PROGRESS Collaborative Group. Randomised trial of a
perindopril-based blood-pressure–lowering regimen among 6,105 individuals with previous stroke or transient ischaemic attack. Lancet. 2001;
358:1033–1041.
PROGRESS Management Committee. Blood pressure lowering for the
secondary prevention of stroke: rationale and design for PROGRESS.
J Hypertens. 1996;14(suppl 2):S41–S46.
PROGRESS Collaborative Group. Effects of a perindopril-based blood
pressure lowering regimen on cardiac outcomes among patients with
cerebrovascular disease. Eur Heart J. 2003;24:475– 484.
Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the
preparative ultracentrifuge. Clin Chem. 1972;18:499 –502.
Karl J, Borgya A, Gallusser A, Huber E, Krueger K, Rollinger W, Schenk
J. Development of a novel, N-terminal-proBNP (NT-proBNP) assay with
a low detection limit. Scand J Clin Lab Invest Suppl. 1999;230:177–181.
Woodward M. Epidemiology: Study Design and Data Analysis. 2nd ed.
Boca Raton, Fla: Chapman and Hall/CRC; 2005.
Groenning BA, Raymond I, Hildebrandt PR, Nilsson JC, Baumann M,
Pedersen F. Diagnostic and prognostic evaluation of left ventricular
systolic heart failure by plasma N-terminal pro-brain natriuretic peptide
concentrations in a large sample of the general population. Heart. 2004;
90:297–303.
Raymond I, Groenning BA, Hildebrandt PR, Nilsson JC, Baumann M,
Trawinski J, Pedersen F. The influence of age, sex and other variables on
the plasma level of N-terminal pro brain natriuretic peptide in a large
sample of the general population. Heart. 2003;89:745–751.
Groenning BA, Nilsson JC, Sondergaard L, Pedersen F, Trawinski J,
Baumann M, Larsson HB, Hildebrandt PR. Detection of left ventricular
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
enlargement and impaired systolic function with plasma N-terminal pro
brain natriuretic peptide concentrations. Am Heart J. 2002;143:923–929.
Campbell DJ, Woodward M, Chalmers JP, Colman SA, Jenkins AJ,
Kemp BE, Neal BC, Patel A, MacMahon SW. Prediction of heart failure
by amino-terminal-pro-B-type natriuretic peptide and C-reactive protein
in subjects with cerebrovascular disease. Hypertension. 2005;45:69 –74.
Asada J, Tsuji H, Iwasaka T, Thomas JD, Lauer MS. Usefulness of
plasma brain natriuretic peptide levels in predicting dobutamine-induced
myocardial ischemia. Am J Cardiol. 2004;93:702–704.
Liang F, Wu J, Garami M, Gardner DG. Mechanical strain increases
expression of the brain natriuretic peptide gene in rat cardiac myocytes.
J Biol Chem. 1997;272:28050 –28056.
Marcus LS, Hart D, Packer M, Yushak M, Medina N, Danziger RS,
Heitjan DF, Katz SD. Hemodynamic and renal excretory effects of human
brain natriuretic peptide infusion in patients with congestive heart failure:
a double-blind, placebo-controlled, randomized crossover trial. Circulation. 1996;94:3184 –3189.
D’Souza SP, Yellon DM, Martin C, Schulz R, Heusch G, Onody A,
Ferdinandy P, Baxter GF. B-type natriuretic peptide limits infarct size in
rat isolated hearts via KATP channel opening. Am J Physiol. 2003;284:
H1592–H1600.
Pepys MB, Hirschfield GM. C-reactive protein: a critical update. J Clin
Invest. 2003;111:1805–1812.
de Lemos JA, McGuire DK, Drazner MH. B-type natriuretic peptide in
cardiovascular disease. Lancet. 2003;362:316 –322.
Baldoncini R, Desideri G, Bellini C, Valenti M, De Mattia G, Santucci A,
Ferri C. High plasma renin activity is combined with elevated urinary
albumin excretion in essential hypertensive patients. Kidney Int. 1999;
56:1499 –1504.
Dzau VJ. Tissue angiotensin and pathobiology of vascular disease: a
unifying hypothesis. Hypertension. 2001;37:1047–1052.
Brown JJ, Davies DL, Lever AF, Robertson JIS. Plasma renin concentration in human hypertension, III: renin in relation to complications of
hypertension. BMJ. 1966;1:505–508.
Vascular Medicine
Statin Treatment After Onset of Sepsis in a Murine Model
Improves Survival
Marc W. Merx, MD*; Elisa A. Liehn, MD*; Jürgen Graf, MD;
Annette van de Sandt; Maren Schaltenbrand; Jürgen Schrader, MD;
Peter Hanrath, MD; Christian Weber, MD
Background—HMG-CoA-reductase inhibitors have been shown to exhibit pronounced immunomodulatory effects
independent of lipid lowering. We have recently demonstrated that pretreatment with simvastatin profoundly improves
survival in a cecal ligation and perforation (CLP) model of sepsis. Here, we studied whether treatment with simvastatin
after onset of sepsis-induced hemodynamic alterations is beneficial and whether prolonged survival can also be achieved
with other statins.
Methods and Results—Mice were rendered septic by CLP. At 6 hours after sepsis induction, when profound hemodynamic
alterations were manifest, treatment with atorvastatin, fluvastatin, pravastatin, simvastatin, or placebo was initiated.
Except for fluvastatin (27⫾2.3 hours), survival time was extended from 23⫾1.2 hours for placebo-treated mice to
37⫾3.6 hours for simvastatin-treated, to 40⫾4.2 hours for atorvastatin-treated, and to 39⫾3.9 hours for pravastatintreated mice. This profound improvement is based on the preservation of cardiac function and hemodynamic status in
statin-treated animals, both of which are severely impaired in untreated CLP mice. As underlying mechanisms,
improved susceptibility to endothelial nitric oxide synthase stimulation and reduced endothelial adhesion of leukocytes
could be demonstrated after statin treatment.
Conclusions—Well established in the treatment of lipid disorders and coronary artery disease, statins harbor the additional
and novel potential of effective sepsis treatment. This benefit extends to several but not all statins tested. (Circulation.
2005;112:117-124.)
Key Words: hemodynamics 䡲 inflammation 䡲 leukocytes 䡲 sepsis
S
and microvascular function, and modulation of endothelial
nitric oxide synthase.15 In particular, statins have been found
to reduce the increased endothelial adhesiveness of monocytes from hypercholesterolemic individuals or after stimulation with cytokines under flow and static conditions.16,17
This appears to be partly attributable to reduced expression of
both monocytic and endothelial adhesion molecules because
of selective inhibition of the integrin leukocyte function
antigen-1 (LFA-1) by affecting Rho GTPases.17 In retrospective analysis, patients with bacteremia who were concomitantly treated with statins had a reduced overall and attributable mortality compared with bacteremic patients not on
statin therapy.18
Recently, we were able to demonstrate that pretreatment
with simvastatin results in profoundly improved survival in
the clinically relevant, polimicrobial cecal ligation and perforation (CLP) model of sepsis.19 The improvement in survival observed after simvastatin pretreatment was based on
the complete preservation of cardiac function and hemody-
epsis, defined by consensus conference as “the systemic
inflammatory response syndrome that occurs during infection,”1 is generally viewed as a disease aggravated by the
inappropriate immune response encountered in the affected
individual (see elsewhere for review2,3). Thus, basic research
and clinical trials have focused on agents capable of blocking
steps within the inflammatory cascade.4 –10 However, despite
the multitude of therapeutic approaches evaluated, the only
inflammation-modulating substances demonstrated to date to
benefit patients with severe sepsis are activated protein C6
and low-dose hydrocortisone.11
HMG-CoA-reductase inhibitors (statins) such as simvastatin have been shown to exhibit important immunomodulatory
effects independent of lipid lowering.12,13 In fact, these
so-called pleiotropic effects are now considered to contribute
significantly to the morbidity and mortality benefit observed
in patients with coronary heart disease who are treated with
statins. Pleiotropic effects have been demonstrated to comprise antiinflammatory actions,14 improvement of endothelial
Received August 23, 2004; revision received January 17, 2005; accepted January 20, 2005.
From Medizinische Klinik I (M.W.M., J.G., A. vd S., M.S., P.H., C.W.) and Kardiovaskuläre Molekularbiologie (E.A.L., C.W.), RWTH Aachen, and
Institut für Herz- und Kreislaufphysiologie (J.S.), Heinrich-Heine-Universität, Düsseldorf, Germany.
*Drs Merx and Liehn contributed equally to this study.
Correspondence to Dr med M.W. Merx, Medizinische Klinik I, Universitätsklinikum RWTH Aachen, Pauwelsstraße 30, 52057 Aachen, Germany.
E-mail [email protected]
117
118
Circulation
July 5, 2005
namic stability observed only in treated mice. As an underlying mechanism, we demonstrated in septic mice that increased mononuclear cell adhesiveness, an important
contributor to sepsis pathophysiology, was reversed by statin
treatment. In a clinical, prospective, observational cohort
study, Almog et al20 added strong supportive evidence with
reduced rate of severe sepsis in patients pretreated with a
statin for ⱖ1 month before hospital admission for acute
bacterial infection.
In the present study, we approached the question of
whether treatment with simvastatin after the onset of hemodynamic alterations might improve cardiovascular function in
sepsis. Because antiinflammatory properties are known to
vary between individual statins, we compared the effect of
simvastatin with respect to cardiac output (CO) and sepsis
survival with several other statins. We investigated atorvastatin as a powerful repressor of major histocompatibility
class II,12 pravastatin as a hydrophilic substance without
LFA-1 inhibitory properties,13 and fluvastatin, which can
induce cyclooxygenase-2.21 To elucidate underlying mechanisms, stimulation of endothelial nitric oxide synthase
(eNOS) and endothelial adhesion of leukocytes were examined ex vivo and in vitro.
Methods
Animals
Male C57 mice were kept according to federal regulations. All
studies were approved by the local ethics committee and the state
animal welfare commission.
All animals had ad libitum access to standard chow and water.
Mice were kept under pathogen-free conditions (specific pathogen
free) and under a 12-hour day/night cycle. All studies were performed at the same time of day to obviate circadian influences.
Mice ranged in body weight from 24 to 36 g and in age from 12
and 18 weeks. Mice were divided into subgroups matched for age
and body weight as outlined later.
Sepsis Induction
Sepsis was induced as described previously.19 In brief, anesthesia
was induced by intraperitoneal administration of ketamine (60 ␮g/g
body weight) and xylazine (10 ␮g/g body weight). The cecum was
then subjected to a single “through and through” perforation with a
20-gauge needle. Sham-operated mice underwent the same procedure except for ligation and perforation of the cecum. Preoperatively
and postoperatively, all mice had unlimited access to chow and
water. In addition, analgesia (tramadol 20 ␮g/g body weight) was
applied subcutaneously immediately after the induction of sepsis and
every 6 hours thereafter. At the same time points, volume support
(NaCl 0.9%, 0.05 mL/g body weight, prewarmed) was administered
through subcutaneous injection.
Six and 18 hours after sepsis induction, age- and body weight–
matched groups of 10 mice each were treated by intraperitoneal
injection of atorvastatin, fluvastatin, pravastatin, simvastatin (0.2
␮g/g body weight; injected volume, 0.02 mL/g body weight), or
placebo (carrier only, 0.02 mL/g body weight). Statins were dissolved in EtOH at a concentration of 10 mg/mL and diluted with
NaCl 0.9% in a ratio of 1:1000 to yield a final concentration of 10 ␮g
statin per 1 mL carrier. The NaCl 0.9%– based carrier solution for the
placebo group was prepared accordingly to include EtOH only (ie,
without statin) at a concentration of 1:1000.
Blood Pressure Measurements
Anesthesia was induced as above in CLP simvastatin-treated, CLP
placebo-treated, sham simvastatin-treated, and sham placebo-treated
mice matched for age and body weight (10 per group) 20⫾2 hours
after sepsis induction. The carotid artery was cannulated, and
pressure was recorded at baseline and after intraperitoneal injection
of dobutamine (1.5 ␮g/g body weight) and ethylthiourea (ETU; 1
␮mol/g⫽185.1 ␮g/g body weight).
Langendorff Setup and Protocol
Preparation of murine hearts explanted from CLP simvastatintreated, CLP placebo-treated, sham simvastatin-treated, and sham
placebo-treated mice matched for age and body weight (10 per
group) was initiated 20⫾2 hours after sepsis induction, and retrograde perfusion at 100 mm Hg constant pressure with modified
Krebs-Henseleit buffer was performed essentially as described,22
with a commercially available isolated heart apparatus (Hugo Sachs
Elektronik). Perfusion pressure, perfusate oxygen concentration,
aortic flow, left ventricular developed pressure (the difference
between minimal diastolic pressure and maximal systolic pressure),
and heart rate were measured continuously. Hearts were stimulated
at 600 bpm. Bradykinin and adenosine were applied at a concentration of 5 and 1 ␮mol, respectively.
Echocardiography
Conscious CLP statin-treated (atorvastatin, simvastatin, pravastatin,
or fluvastatin), CLP placebo-treated (10 per group), sham statintreated (atorvastatin, simvastatin, pravastatin, or fluvastatin), and
sham placebo-treated mice matched for age and body weight (6 per
group) were examined by echocardiography 20⫾2 hours after sepsis
induction as described previously.23 To avoid bradycardia, seen
occasionally when echocardiography is performed in awake mice,
mice were trained to tolerate the handling associated with echocardiographic examination on 3 to 4 separate occasions per day over a
period of 3 days. After this training period, all mice remained calm
during the examination. If image recording of sufficient quality
could not be initiated within 2 minutes, the animal was allowed to
rest, and images were obtained later to ensure minimal time span of
animal handling.
Using a 15-MHz linear transducer connected to a Sonos 5500
(Phillips Medical Systems), we obtained 2D guided M-mode images
at the aortic root for offline aortic diameter measurements. Aortic
flow velocity was measured with pulsed-wave Doppler.
Aortic flow velocity-time integral (VTI) and aortic root dimension
(AoD) were obtained from the respective frozen images as above,
and mean values from 3 to 6 heartbeats were used for further
analysis. CO was calculated from the following equations:
CSA⫽(AoD/2)2⫻␲, SV⫽CSA⫻VTI, and CO⫽SV⫻HR, where CSA
is aortic cross-sectional area, SV is stroke volume, and HR is heart
rate.
The same procedure was followed for echocardiography involving
dobutamine (1.5 ␮g/g body weight) application. Images were obtained within 7 and 11 minutes after intraperitoneal injection, a time
frame shown to represent the plateau pharmacological effect in
preliminary experiments.
Cell Isolation, Culture, and Shear Flow
Blood samples were taken from weight- and age-matched mice
treated by intraperitoneal injection of atorvastatin, fluvastatin, pravastatin, or simvastatin as described above (n⫽8 per group) by
cardiac puncture 24⫾2 hours after sepsis induction. Mononuclear
cells were isolated from mouse blood by gradient centrifugation with
Lympholyte-Mammalian (Cedarlain). Cell suspensions were washed
and resuspended (5⫻105) in HHMC (HBSS, 10 mmol/L HEPES,
1 mmol/L Ca2⫹, 1 mmol/L Mg2⫹, 0.5% BSA). Viability was ⬎97%
as determined by trypan blue dye exclusion.
WEHI-274.1 (mouse monocytes, ATCC) were cultured in DMEM
(⫹2 mmol/L glutamine⫹0.05 mmol/L2 mercaptoethanol⫹10% FBS)
as described by ATCC. For the experiments, the cells were incubated
with 1 ␮mol atorvastatin, fluvastatin, or pravastatin with or without
the addition of 100 ␮mol mevalonic acid for 30 minutes and 24 hours
or were left untreated, washed, and resuspended (1⫻106) in HHMC.
SV40-immortalized murine endothelial cells (kindly provided by
Dr H. Hengel, Berlin) were cultured in DMEM (⫹5% FKS), grown
Merx et al
Statin Treatment After Onset of Sepsis
119
to confluence in 35-mm Petri dishes, stimulated with tumor necrosis
factor (TNF)-␣ (200 U/mL; Sigma), and incubated with 1 ␮mol
atorvastatin, fluvastatin, or pravastatin with or without 100 ␮mol
mevalonic acid for 30 minutes or 24 hours or left untreated. The cells
were washed, and the dishes were assembled as the lower wall in a
parallel-wall flow chamber and mounted on the stage of an Olympus
IX50 microscope.24,25 Mononuclear cells or WEHI-274.1 monocytes
were perfused into the flow chamber at a rate of 1 dyne/cm2 for 7
minutes. After 3 minutes, the adherent cells were counted in multiple
high-power fields and recorded with a JVC 3CCD video camera.
The investigator responsible for cell counts in the abovementioned assays was blinded to treatment regimen.
Mean values with appropriate SEM are reported. All study groups
analyzed were initially tested for normality with the KolmogorovSmirnov procedure with Lilliefors correction. By this assessment, all
groups studied fulfilled the criteria of normal distribution.
Groups were then analyzed by ANOVA, followed by Dunnett-T3
post hoc test for comparisons between groups. For cell studies,
Newman-Keuls multiple-comparison test was used as a post hoc test
for comparisons between groups after the initially preformed
ANOVA. A value of P⬍0.05 was taken to indicate statistical
significance. All statistical analyses were calculated with SPSS 12.0
(SPSS Inc).
Results
Sepsis Survival Is Extended by Statin Treatment
Sepsis was induced through CLP, with sham-operated animals serving as controls. In preliminary experiments, we
observed a hyperdynamic followed by a hypodynamic physiological state, similar to hemodynamic alterations in septic
patients. Echocardiography revealed a significant increase in
CO of at least 20% in all septic mice 6 hours after CLP. We
thus chose to initiate statin therapy 6 hours after sepsis
induction by CLP, because at this time point a “clinical”
diagnosis based on the changes in hemodynamic status could
have been made. Mice were treated with atorvastatin, fluvastatin, pravastatin, simvastatin, or placebo 6 and 18 hours
after CLP. No deaths occurred in sham-operated animals. The
degree of sepsis induced in CLP operated mice was equal
across all groups studied at the time point of treatment (ie, 6
hours after sepsis induction) as assessed by the presence of
conjunctivitis, absence of grooming activities with resulting
ruffled fur, no oral uptake of food or water, and lethargy. In
addition, hyperdynamic cardiovascular states were documented at 6 hours after sepsis induction in subsets of mice
from all CLP operated groups. Survival curves and mean
survival times for mice in which CLP was performed in
Figure 1 clearly delineate the survival benefit sustained from
treatment. Compared with 23⫾1.2 hours of mean survival
time in CLP placebo-treated mice, survival was extended by
70% to 39⫾3.9 hours with atorvastatin, by 74% to 40⫾4.2
hours with pravastatin, and by 61% to 37⫾3.6 hours with
simvastatin treatment (n⫽10; P⬍0.05 versus placebo). Surprisingly, fluvastatin treatment did not result in a significant
survival time increase (increase of 17% to 27⫾2.3 hours;
n⫽10; P⫽0.759 versus placebo).
Cardiac Function and Hemodynamics Are
Preserved by Statin Treatment
To explore changes in CO due to sepsis, we studied conscious
mice by echocardiography preoperatively and 20⫾2 hours
Figure 1. Survival curves and mean survival times after sepsis
induction by CLP. Mean survival time (large gray symbols) of
mice treated 6 hours after sepsis induction with statins was profoundly increased vs that for untreated CLP mice (P⬍0.05),
except for fluvastatin treatment (P⫽0.759). No deaths occurred
in sham-operated mice.
after sepsis induction by CLP and evaluated responsiveness
to ␤-adrenoceptor stimulation using dobutamine. Preoperatively, no differences were observed between any of the
groups. At 20 hours after CLP (Figure 2A), CO declined from
1.22⫾0.03 to 0.82⫾0.03 mL · min⫺1 · g⫺1 in CLP placebotreated mice (P⬍0.005; n⫽10) while remaining unaltered in
CLP mice treated with atorvastatin (1.26⫾0.03 mL · min⫺1 ·
g⫺1 preoperatively versus 1.28⫾0.03 mL · min⫺1 · g⫺1 20
hours after CLP; P⫽NS; n⫽10), pravastatin (1.16⫾0.03 mL
· min⫺1 · g⫺1 preoperatively versus 1.12⫾0.02 mL · min⫺1 ·
g⫺1 20 hours after CLP; P⫽NS; n⫽10), or simvastatin
(1.20⫾0.03 mL · min⫺1 · g⫺1 preoperatively versus 1.17⫾0.02
mL · min⫺1 · g⫺1 20 hours after CLP; P⫽NS; n⫽10). CLP
fluvastatin-treated animals, however, displayed a decline in
CO, albeit not to the extent of CLP placebo-treated animals
(1.18⫾0.03 mL · min⫺1 · g⫺1 preoperatively versus 0.98⫾0.03
mL · min⫺1 · g⫺1 20 hours after CLP; P⬍0.01; n⫽10). No
significant changes between preoperative and postoperative
CO were detected in sham-operated animals. After dobutamine stimulation, CO increased in all groups preoperatively.
A similar increase was documented after postoperative dobutamine stimulation in sham-operated mice. Placebo-treated
CLP mice remained refractory to ␤-stimulation (Figure 2B).
Notably, the responsiveness to dobutamine was restored in
CLP mice by treatment with atorvastatin, pravastatin, or
simvastatin (Figure 2B), whereas CLP fluvastatin-treated
mice showed a dampened response. For all groups in which
CO was augmented by dobutamine stimulation, the effect was
secondary to a small increase in heart rate and a larger
increase in stroke volume (eg, in CLP atorvastatin-treated
mice, heart rate increased by 5% and stroke volume by 14%
after dobutamine stimulation 20 hours after sepsis induction).
Subsequently, we performed invasive blood pressure measurements in simvastatin- and placebo-treated anesthetized
mice (20 hours after CLP) by cannulating the carotid artery.
Again, we applied dobutamine as inotropic stimulus and
120
Circulation
July 5, 2005
Figure 2. CO as assessed by echocardiography 20⫾2 hours
after sepsis induction. A, At 20⫾2 hours after sepsis induction,
CO decreased significantly in CLP placebo-treated mice (clp;
P⬍0.005 vs preoperation; n⫽10) whereas CO remained stable
in CLP mice treated 6 hours after sepsis induction with atorvastatin, pravastatstatin, or simvastatin. However, fluvastatin treatment was less efficient in maintaining CO of septic mice
(P⬍0.01 vs preoperation). B, Dobutamine stimulation increased
CO in all groups (P⬍0.001 vs unstimulated 20 hours postoperation for simvastatin, pravastatin, and atorvastatin; n⫽10) except
in CLP placebo-treated mice (P⫽NS vs CLP; n⫽10), with fluvastatin-treated mice showing a dampened response (P⬍0.005 vs
unstimulated 20 hours postoperation; n⫽10).
ETU, an unspecific inhibitor of NOS, to analyze changes in
vascular resistance. Mean arterial blood pressure was decreased by 19⫾7 mm Hg (P⬍0.01; n⫽10) in CLP placebotreated mice compared with sham-operated mice but remained unaltered in CLP simvastatin-treated mice (Figure
3A). Simvastatin treatment had no effect on blood pressure in
sham-operated mice (Figure 3A). Dobutamine stimulation led
to an increase in arterial blood pressure in sham-operated and
in CLP simvastatin-treated mice, whereas CLP placebotreated mice displayed no significant change in arterial blood
pressure (Figure 3A). NOS blockade with ETU led to an
⬇50% increase in mean arterial pressure. However, the
absolute value reached by CLP placebo-treated mice remained significantly below the other groups (Figure 3A).
This is in concordance with the lower CO in CLP placebotreated mice within the same time frame but may also
correspond to a reduction in peripheral vascular resistance
mediated only partly by NO.
Figure 3. Coronary flow and blood pressure measurements. A,
Baseline blood pressure measured 20⫾2 hours after sepsis
induction was decreased in CLP placebo-treated animals (CLP;
P⬍0.001; n⫽10). Dobutamine stimulation led to an increase in
blood pressure in all study groups (CLP⫹simvastatin,
sham⫹simvastatin, and sham⫹placebo dobutamine vs unstimulated 20 hours postoperation: P⬍0.01; n⫽10) except in CLP
placebo-treated mice (CLP⫹placebo dobutamine vs unstimulated 20 hours postoperation: P⫽NS; n⫽10). Administration of
ETU resulted in increase in blood pressure in all groups
(CLP⫹placebo ETU vs unstimulated 20 hours postoperation:
P⬍0.01; CLP⫹simvastatin, sham⫹simvastatin, and
sham⫹placebo ETU vs unstimulated 20 hours postoperation;
P⬍0.005; n⫽10). B, After eNOS stimulation by bradykinin, coronary flow increased most substantially in CLP placebo-treated
mice (CLP⫹placebo vs sham⫹placebo and vs unstimulated 20
hours postoperation: P⬍0.005; n⫽10), with other groups displaying more moderate increase (CLP⫹simvastatin, sham⫹simvastatin, and sham⫹placebo vs unstimulated 20 hours postoperation; P⬍0.01; n⫽10). Adenosine stimulation led to substantial
increase with similar resulting flow in all groups (CLP⫹placebo,
CLP⫹simvastatin, sham⫹simvastatin, and sham⫹placebo vs
unstimulated 20 hours postoperation: P⬍0.001; n⫽10). Hearts
from CLP placebo-treated mice, however, displayed significantly
reduced response to adenosine in relation to their baseline flow.
Effects on eNOS Stimulation and Coronary Flow
Reserve
Simvastatin treatment preserved contractility of isolated
hearts, which was impaired by 48% in CLP placebo-treated
mice compared with sham-operated animals (P⬍0.005;
n⫽10; the Table). Similarly, left ventricular developed pres-
Merx et al
121
Contractile Function of Langendorff-Perfused Isolated Hearts
CLP⫹Placebo
CLP⫹Simvastatin
Sham⫹Simvastatin
dP/dtmax, mm Hg/s
2654⫾150*
4562⫾320
4892⫾267
Sham⫹Placebo
5139⫾226
LVDP, mm Hg
73.7⫾1.9†
97.9⫾5.5
104⫾5.4
112.5⫾4.9
LVDP indicates left ventricular developed pressure. Values are mean⫾SEM. CLP placebo-treated mice showed
significant contractile impairment (*P⬍0.005, †P⬍0.01; sample size, n⫽10 for all groups), whereas CLP
simvastatin-treated mice remained at par with sham-operated mice. Simvastatin treatment alone had no influence on
contractile function in sham-operated mice.
sure was also decreased solely in CLP placebo-treated mice
(the Table), as were other parameters of contraction and
relaxation (eg, time to peak pressure, relaxation half-time)
and oxygen consumption.
Basal coronary flow was increased by 32% in CLP
placebo-treated mice compared with CLP simvastatin-treated
mice (Figure 3B). No significant difference was detected in
basal coronary flow between the latter and sham-operated
animals regardless of whether they were treated with simvastatin. With a coronary flow increase of 33%, susceptibility to
eNOS stimulation by bradykinin was 3 times as pronounced
in CLP placebo-treated mice as in untreated sham-operated
mice (Figure 3B). Treatment with simvastatin attenuated the
enhanced susceptibility to eNOS stimulation in CLP mice.
Maximal coronary flow, measured after adenosine application, was similar in all groups. However, coronary flow
reserve was severely reduced in CLP placebo-treated mice in
which adenosine stimulation resulted in a similar degree of
flow increase as observed under bradykinin application.
incubated with atorvastatin or fluvastatin (Figure 5A and 5B).
Because the effect was evident after 30 minutes and was not
reversible after addition of mevalonic acid, a short-term
exposure appears to be sufficient for inhibition of adhesion,
suggesting a direct interference with LFA-1 activity in
leukocytes or stimulation of eNOS and subsequent antiadhesive effects. This is substantiated by the fact that adhesion of
monocytes pretreated with pravastatin (known not to interact
with LFA-1) for 30 minutes remained unaltered. Indeed, for
Effects on Leukocyte-Endothelial Adhesion
Absolute leukocyte count was reduced in all mice subjected
to CLP compared with sham-operated respective controls
(Figure 4A). No differences in leukocyte count were observed
between placebo- and statin-treated septic mice with the
exception that atorvastatin treatment significantly attenuated
the reduction in leukocyte counts compared with placebo in
CLP mice (Figure 4A).
To investigate the effects of sepsis and statin treatment on
leukocyte-endothelial interaction, mononuclear cells were
isolated from septic and sham-operated mice that had received placebo, atorvastatin, fluvastatin, pravastatin, or simvastatin treatment and subjected to adhesion assays on cytokine-stimulated murine endothelial cells under physiological
flow conditions. The adhesion of monocytes isolated from
placebo-treated CLP mice was significantly increased compared with that of placebo-treated sham operated mice (Figure 4B). Treatment with statins significantly reduced the
adhesion of leukocytes from sham-operated mice and septic
CLP mice (Figure 4B). Thus, sepsis did not lead to increased
leukocyte adhesion to endothelium in statin-treated animals,
indicating a therapeutic inhibition of adhesion (Figure 4B).
In parallel to our previously published in vitro analysis of
simvastatin,19 the effect of atorvastatin, fluvastatin, or pravastatin was also evaluated in vitro by treatment of WEHI-274.1
cells and stimulated SV40-immortalized murine endothelial
cells with the statins for 30 minutes or 24 hours. After 30
minutes of treatment, the number of adherent cells was
reduced when monocytes, endothelial cells, or both were
Figure 4. Leukocyte counts and mononuclear cell adhesion to
endothelium ex vivo. Leukocyte counts were significantly lower
in all septic animals (A, black bars), with atorvastatin treatment
resulting in milder leukopenia (*P⬍0.05 vs placebo and other
statins). Mononuclear cells were isolated from blood of CLP or
sham-operated mice treated with placebo (control), atorvastatin,
pravastatin, simvastatin, or fluvastatin and subjected to adhesion assays on activated microvascular endothelium under flow
conditions (1.5 dyne/cm2). Number of firmly attached cells was
determined after 5 minutes. Arrest of monocytes from CLP mice
(black bars) was significantly increased vs those from shamoperated animals (B; white bars; *P⬍0.05 vs sham; n⫽8). Treatment with above-mentioned statins significantly reduced arrest
of monocytes in sham-operated (*P⬍0.05 vs sham⫹placebo;
n⫽8) and CLP animals (*P⬍0.05 vs CLP⫹placebo; n⫽8).
122
Circulation
July 5, 2005
Figure 6. Monocyte adhesion to endothelium under physiological flow conditions in vitro after 24 hours of treatment. Similar
degree of adhesion inhibition is observed after 24 hours of treatment with atorvastatin (A) or fluvastatin (B) (*P⬍0.01; n⫽6) vs 30
minutes of treatment. However, after 24-hour treatment period,
inhibition is completely reversible with mevalonate for both
statins.
Discussion
Figure 5. Monocyte adhesion to endothelium under physiological flow conditions in vitro after 30 minutes of treatment. Monocytes and/or endothelial cells were incubated with atorvastatin
(A), fluvastatin (B), or pravastatin (C) 1 ␮mol/L with or without
mevalonate coincubation (100 ␮mol/L) for 30 minutes as indicated and subjected to adhesion assays. Number of monocytes
firmly adherent to activated endothelium at 1.5 dyne/cm2 was
determined after 5 minutes. For pravastatin, treatment of both
monocytes and endothelium is required to achieve adhesion
inhibition, whereas treatment of monocytes or endothelium
alone is sufficient to inhibit adhesion with atorvastatin or fluvastatin. Inhibition of adhesion by above-mentioned statins is not
reversible after addition of mevalonate (*P⬍0.01; **P⬍0.001).
pravastatin, treatment of both monocytes and endothelium
was necessary to achieve reduced endothelial adhesion (Figure 5C).
After 24 hours, the inhibitory effect of atorvastatin and
pravastatin was completely reversible (ie, no longer significantly reduced compared with control) by coincubation with
mevalonic acid of monocytes, endothelial cells, or both cell
types (Figure 6A and 6B). This indicates that interference
with the mevalonic acid– dependent pathway by atorvastatin
and pravastatin (eg, inhibition of Rho-GTPase membrane
localization and activity) is predominantly responsible for
adhesion effects after 24 hours of treatment with the above
statins.
Following our promising recent study involving pretreatment
with simvastatin to improve survival in sepsis,19 the present
results give rise to even greater optimism. Significantly
improved survival is demonstrated for treatment after the
onset of sepsis, a situation more akin to clinical reality,
especially because a time point with clinically detectable
sepsis effects was chosen for treatment initiation. Furthermore, this benefit is not limited to simvastatin but extends to
2 of 3 additional statins currently evaluated, namely atorvastatin and pravastatin. As with pretreatment, the improvement
in survival observed here stems from the complete preservation of cardiac function and hemodynamic stability observed
in mice treated 6 hours after sepsis induction with atorvastatin, pravastatin, or simvastatin. Increased mononuclear cell
adhesiveness in septic mice, an important contributor to
sepsis pathophysiology, is reversed by treatment with all
studied statins and represents 1 of the underlying
mechanisms.
Because the CLP model of sepsis closely resembles the
pathophysiology of human sepsis,26 it provided us with the
opportunity to define a time point at which hemodynamic
alterations secondary to sepsis induction became apparent.
These hemodynamic alterations, namely a hyperdynamic
followed by a hypodynamic physiological state, that also
typically are found in patients affected by sepsis were readily
detectable in our model by serial echocardiographic studies.
A hyperdynamic increase in excess of 20% above baseline
was observed in all septic mice 6 hours after sepsis induction
by CLP; thus, this time point was chosen for the beginning of
statin therapy.
Merx et al
In concordance with our previous studies of simvastatin
pretreatment in sepsis,19 impaired CO is secondary to reduced
contractility of septic hearts, and this acute septic cardiomyopathy is refractory to catecholamine stimulation, a fact
paralleled in human pathophysiology.27 The reduced arterial
blood pressure of septic mice and the limited rise in blood
pressure observed after nonselective NOS inhibition suggest
that reduced peripheral vascular resistance is mediated by NO
and further vasodilatory agents. The pronounced cardiac
dysfunction and hypodynamic circulation present severe
manifestations of sepsis contributing to the poor outcome and
short survival time documented in our mouse model of sepsis.
Although not reaching the ⬇4-fold increase in median survival time observed in simvastatin-pretreated septic mice,19
our median survival time was increased by ⬎60% for
atorvastatin, pravastatin, and simvastatin treatment. Indeed,
therapeutic benefit from these statins was so robust that
cardiac function and hemodynamic status remained completely unaffected 20 hours after sepsis induction.
Because TNF-␣ mimics sepsis by enhancing the endothelial expression of adhesion molecules, chemokines,28 and
cytokines,29 we isolated peripheral blood mononuclear cells
from mouse blood and studied their adhesion to TNF-␣–
stimulated endothelial cells. As expected, adhesion of monocytes isolated from septic animals was increased. However,
monocytes from statin-treated septic animals showed markedly attenuated adhesion to endothelium.
Because mevalonate is the precursor not only of cholesterol but also of many other nonsteroidal isoprenoid products,
HMG-CoA reductase inhibition might affect several other
cellular functions. Pleiotropic actions of statins include suppression of T-cell responses,30 reduced expression of class II
major histocompatibility complexes on antigen-presenting
cells,12 and reduced chemokine synthesis in peripheral blood
mononuclear cells. 31 The above-mentioned observations12,30,31 could all be reversed by the addition of mevalonate, indicating that they are causally related to the inhibition of HMG-CoA reductase. However, Weitz-Schmidt et al13
demonstrated that several statins are capable of blocking the
LFA-1–ICAM-1 interaction, providing a mevalonate- and
thus HMG-CoA reductase–independent pathway for antiinflammatory and immunomodulatory statin actions. In accordance with these findings, in our in vitro experiments, even a
very short incubation of monocytes with atorvastatin and
fluvastatin (and simvastatin, as published previously19) but
not pravastatin (with pravastatin known to differ from atorvastatin and fluvastatin in that it does not interact with
LFA-1) resulted in reduced adhesion of monocytes to endothelium not reversible by mevalonic acid. However, other
mechanisms such as decreased CD11b expression and reduced CD-11b– dependent adhesion of monocytes on endothelium also demonstrated for simvastatin32 cannot be excluded. Moreover, effects of lovastatin on ␤1-integrin–
mediated adhesion have been demonstrated.33 Because both
of these effects are reversible with mevalonic acid, an
involvement of geranylgeranylated proteins has been postulated.33 Such mechanisms are indeed more likely because
pravastatin was effective in reducing monocyte adhesiveness
after 24 hours in a mevalonate-reversible fashion. In addition,
123
the absence of pravastatin effects on monocyte adhesion after
30 minutes of incubation might be interpreted as a pharmacokinetic effect, especially because pravastatin was the only
hydrophilic statin studied. Under this hypothesis, we would
expect uptake of pravastatin to be delayed compared with
more lipophilic statins, so treatment of both monocytes and
endothelial cells would be required to achieve the observed
significant inhibition by additive effects. This is also supported by the tendency toward reduced adhesion after treatment of endothelial cells alone with pravastatin for 30
minutes. In addition, fluvastatin did not improve survival
despite blocking LFA-1–mediated adhesion, so interference
with LFA-1 does not seem to be the sole mechanism required
to provide effective sepsis therapy with statins.
Incubation of endothelial cells with atorvastatin and fluvastatin (and as previously reported with simvastatin19) for 30
minutes also led to a decline in monocyte adhesion. Because
this incubation period is too short to modify the cellular sterol
pool or the function of Rho, mechanisms operating independently of the cholesterol synthesis pathway must exist. One of
these mechanisms could be NO release from endothelium
observed as early as 8 minutes after exposure to statins.34
Indeed, the increase in coronary flow observed after bradykinin stimulation of hearts from sham-operated animals after
treatment with simvastatin is likely mediated by increased
endothelial NO release. Statins have been described to
decrease the phosphorylation of p44 (encoded by ERK1
gene), which is partially enhanced by the addition of mevalonate, while suppressing the phosphorylation p42 (encoded
by ERK 2 gene), which is not restored by the addition of
mevalonate.35 Although this mechanism was described in
smooth muscle cells, these proteins have also been implicated
in endothelial cell responses to shear stress.36 In light of our
experiments, these signal elements might be more prominently involved in endothelial responses to statins than
previously appreciated.
In summary, atorvastatin, pravastatin, and simvastatin,
well established in the treatment of lipid disorders and
coronary artery disease, might have the additional potential of
being effective agents in the treatment of sepsis. We believe
that the promising results presented here, established in a
clinical relevant disease model and applying a clinically
feasible therapeutic regimen, in conjunction with abundant
safety data resulting from the widespread application of
statins and encouraging clinical retrospective18 and observational data,20 warrant prospective phase III trials.
Acknowledgment
This work was supported in part by Deutsche Forschungs Gemeinschaft grant ME 1821 to Dr Merx. We thank S. Becher and I.
Moshkova for excellent technical assistance.
References
1. Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus WA,
Schein RM, Sibbald WJ. Definitions for sepsis and organ failure and
guidelines for the use of innovative therapies in sepsis. Chest. 1992;101:
1644 –1655.
2. Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis.
N Engl J Med. 2003;348:138 –150.
3. Riedemann NC, Guo R-F, Ward PA. Novel strategies for the treatment of
sepsis. Nat Med. 2003;9:517–524.
124
Circulation
July 5, 2005
4. Bone RC, Fisher CJ Jr, Clemmer TP, Slotman GJ, Metz CA, Balk RA. A
controlled clinical trial of high-dose methylprednisolone in the treatment
of severe sepsis and septic shock. N Engl J Med. 1987;317:653– 658.
5. Annane D. Corticosteroids for septic shock. Crit Care Med. 2001;29:
S117–S120.
6. Bernard GR, Vincent JL, Laterre PF, LaRosa SP, Dhainaut JF, LopezRodriguez A, Steingrub JS, Garber GE, Helterbrand JD, Ely EW, Fisher
CJ. The recombinant human activated protein: efficacy and safety of
recombinant human activated protein C for severe sepsis. N Engl J Med.
2001;344:699 –709.
7. Fisher CJ, Agosti JM, Opal SM, Lowry SF, Balk RA, Sadoff JC,
Abraham E, Schein RMH, Benjamin E, for the Soluble TNF Receptor
Sepsis Study Group. Treatment of septic shock with the tumor necrosis
factor receptor: Fc fusion protein. N Engl J Med. 1996;334:1697–1702.
8. Fisher CJ Jr, Slotman GJ, Opal SM, Pribble JP, Bone RC, Emmanuel G,
Ng D, Bloedow DC, Catalano MA. Initial evaluation of human recombinant interleukin-1 receptor antagonist in the treatment of sepsis syndrome: a randomized, open-label, placebo-controlled multicenter trial: the
IL-1RA Sepsis Syndrome Study Group. Crit Care Med. 1994;22:12–21.
9. Ziegler EJ, Fisher CJ Jr, Sprung CL, Straube RC, Sadoff JC, Foulke GE,
Wortel CH, Fink MP, Dellinger RP, Teng NN. Treatment of gramnegative bacteremia and septic shock with HA-1A human monoclonal
antibody against endotoxin: a randomized, double-blind, placebocontrolled trial: the HA-1A Sepsis Study Group. N Engl J Med. 1991;
324:429 – 436.
10. Bernard GR, Wheeler AP, Russel JA, Schein R, Summer WR, Steinberg
KP, Fulkerson WJ, Wright PE, Christmann BW, Dupont WD, Higgins
SB, Swindell BB. The effects of ibuprofen on the physiology and survival
of patients with sepsis. N Engl J Med. 1997;912–918.
11. Annane D, Bellissant E, Bollaert PE, Briegel J, Keh D, Kupfer Y.
Corticosteroids for severe sepsis and septic shock: a systematic review
and meta-analysis. BMJ. 2004;329:480.
12. Kwak B, Mulhaupt F, Myit S, Mach F. Statins as a newly recognized type
of immunomodulator. Nat Med. 2000;6:1399 –1402.
13. Weitz-Schmidt G, Welzenbach K, Brinkmann V, Kamata T, Kallen J,
Bruns C, Cottens S, Takada Y, Hommel U. Statins selectively inhibit
leukocyte function antigen-1 by binding to a novel regulatory integrin
site. Nat Med. 2001;7:687– 692.
14. Pruefer D, Makowski J, Schnell M, Buerke U, Dahm M, Oelert H,
Sibelius U, Grandel U, Grimminger F, Seeger W, Meyer J, Darius H,
Buerke M. Simvastatin inhibits inflammatory properties of Staphylococcus aureus alpha toxin. Circulation. 2003;15:2104 –2110.
15. Laufs U, Liao JK. Post-transcriptional regulation of endothelial nitric
oxide synthase mRNA stability by Rho GTPase. J Biol Chem. 1998;273:
24266 –24271.
16. Serrano J, Yoshida VM, Venturinelli ML, D’Amico E, Monteiro HP,
Ramires JA, da Luz PL. Effect of simvastatin on monocyte adhesion
molecule expression in patients with hypercholesterolemia. Atherosclerosis. 2001;157:505–512.
17. Yoshida M, Sawada T, Ishii H, Gerszten RE, Rosenzweig A, Gimbrone
MA Jr, Yasukochi Y, Numano F. HMG-CoA reductase inhibitor modulates monocyte-endothelial cell interaction under physiological flow
conditions in vitro: involvement of Rho GTPase-dependent mechanism.
18. Liappis AP, Kan VL, Rochester CG, Simon GL. The effect of statins on
mortality in patients with bacteremia. Clin Infect Dis. 2001;33:
1352–1357.
19. Merx MW, Liehn EA, Janssens U, Lütticken R, Schrader J, Hanrath P,
Weber C. HMG-CoA reductase inhibitor simvastatin profoundly
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
improves survival in a murine model of sepsis. Circulation. 2004;109:
2560 –2565.
Almog Y, Shefer A, Novack V, Maimon N, Barski L, Eizinger M, Friger
M, Zeller L, Danon A. Prior statin therapy is associated with a decreased
rate of severe sepsis. Circulation. 2004;110:880 – 885.
Chen JC, Huang KC, Wingerd B, Wu WT, Lin WW. HMG-CoA
reductase inhibitors induce COX-2 gene expression in murine macrophages: role of MAPK cascades and promoter elements for CREB and
C/EBPbeta. Exp Cell Res. 2004;301:305–319.
Merx MW, Flogel U, Stumpe T, Godecke A, Decking UK, Schrader J.
Myoglobin facilitates oxygen diffusion. FASEB J. 2001;15:1077–1079.
Heger J, Godecke A, Flogel U, Merx MW, Molojavyi A, Kuhn-Velten
WN, Schrader J. Cardiac-specific overexpression of inducible nitric oxide
synthase does not result in severe cardiac dysfunction. Circ Res. 2002;
90:93–99.
Ostermann G, Weber KS, Zernecke A, Schroder A, Weber C. JAM- 1 is
a ligand of the beta (2) integrin LFA-1 involved in transendothelial
migration of leukocytes. Nat Immunol. 2003;3:151–158.
Baltus T, Weber KSC, Johnson Z, Proudfoot AEI, Weber C. Oligomerization of RANTES is required for CCR1-mediated arrest but not CCR5mediated transmigration of leukocytes on inflamed endothelium. Blood.
2003;102:1985–1988.
Deitch EA. Animal models of sepsis and shock: a review and lessons
learned. Shock. 1998;1–11.
Parrillo JE, Parker MM, Natanson C, Suffredini AF, Danner RL, Cunnion
RE, Ognibene FP. Septic shock in humans: advances in the understanding
of pathogenesis, cardiovascular dysfunction, and therapy. Ann Intern
Med. 1990;113:227–242.
Carlos TM, Harlan JM. Leukocyte-endothelial adhesion molecules.
Blood. 1994;84:2068 –2101.
RajavashisthTB, Andalibi AS, Territo MC, Berliner JA, Navab M,
Fogelman AM, Lusis AJ. Induction of endothelial cell expression of
granulocyte and macrophage colony stimulation factors by modified
low-density lipoprotein. Nature. 1990;344:254 –257.
Kurakata S, Kada M, Shimada Y, Komai T, Nomoto K. Effects of
different inhibitors of 3-hydroxy-3-methylglutaryl coenzyme A
(HMG-CoA) reductase, pravastatin sodium and simvastatin, on sterol
synthesis and immunological functions in human lymphocytes in vitro.
Immunopharmacology. 1996;34:51– 61.
Romano M, Diomede L, Sironi M, Massimiliano L, Sottocorno M, Polentarutti N, Guglielmotti A, Albani D, Bruno A, Fruscella P, Salmona M,
Vecchi A, Pinza M, Mantovani A. Inhibition of monocyte chemotactic
protein-1 synthesis by statins. Lab Invest. 2000;80:1095–1100.
Weber C, Erl W, Weber KSC, Weber PC. HMG-CoA reductase inhibitors
decrease CD11b expression and CD11b-dependent adhesion of
monocytes to endothelium and reduce increased adhesiveness of
monocytes isolated from patients with hypercholesterolemia. J Am Coll
Cardiol. 1997;30:1212–1217.
Li X, Liu L, Tupper JC, Bannerman DD, Winn RK, Sebti SM, Hamilton
AD, Harlan JM. Inhibition of protein geranylgeranylation and
RhoA/RhoA kinase pathway induces apoptosis in human endothelial
cells. J Biol Chem. 2002;277:15309 –15316.
Kaesemeyer WH, Caldwell RB, Huang J, Caldwell RW. Pravastatin
sodium activates endothelial nitric oxide synthase independent of its
cholesterol-lowering actions. J Am Coll Cardiol. 1999;33:234 –241.
Sindermann JR, Schmidt A, Breithardt G, Buddecke E. Lovastatin
controls signal transduction in vascular smooth muscle cells by modulating phosphorylation levels of mevalonate-independent pathway. Basic
Res Cardiol. 2001;96:283–289.
Tseng H, Peterson TE, Berk BC. Fluid shear stress stimulates mitogenactivated protein kinase in endothelial cells. Circ Res. 1995;77:869 – 878.
Contemporary Reviews in Cardiovascular Medicine
Valvular Heart Disease
Aortic Regurgitation
Raffi Bekeredjian, MD; Paul A. Grayburn, MD
Abstract—Aortic regurgitation (AR) is characterized by diastolic reflux of blood from the aorta into the left ventricle (LV).
Acute AR typically causes severe pulmonary edema and hypotension and is a surgical emergency. Chronic severe AR
causes combined LV volume and pressure overload. It is accompanied by systolic hypertension and wide pulse pressure,
which account for peripheral physical findings, such as bounding pulses. The afterload excess caused by systolic
hypertension leads to progressive LV dilation and systolic dysfunction. The most important diagnostic test for AR is
echocardiography. It provides the ability to determine the cause of AR and to assess the severity of AR and its effect
on LV size, function, and hemodynamics. Many patients with chronic severe AR may remain clinically compensated
for years with normal LV function and no symptoms. These patients do not require surgery but can be followed carefully
for the onset of symptoms or LV dilation/dysfunction. Surgery should be considered before the LV ejection fraction falls
below 55% or the LV end-diastolic dimension reaches 55 mm. Symptomatic patients should undergo surgery unless
there are excessive comorbidities or other contraindications. The primary role of medical therapy with vasodilators is
to delay the need for surgery in asymptomatic patients with normal LV function or to treat patients in whom surgery
is not an option. The goal of vasodilator therapy is to achieve a significant decrease in systolic arterial pressure. Future
therapies may focus on molecular mechanisms to prevent adverse LV remodeling and fibrosis. (Circulation. 2005;112:
125-134.)
Key Words: aorta 䡲 echocardiography 䡲 valves 䡲 ventricles
A
ortic regurgitation (AR) is characterized by diastolic
reflux of blood from the aorta into the left ventricle (LV)
due to malcoaptation of the aortic cusps. Its clinical presentation is variable and depends on a complex interplay of a
number of factors, including acuity of onset, aortic and LV
compliance, hemodynamic conditions, and severity of the
lesion. Although chronic AR is generally well tolerated for
many years, acute AR may lead to rapid cardiac decompensation and, if untreated, to early death.1 This review focuses
on the clinical manifestations of AR, evaluation of its severity
and hemodynamic consequences, and its treatment.
associated with modest increases in aortic root size but not
AR when age is included in the model.3,4 The Strong Heart
Study5 showed an overall prevalence of AR of 10% in a
Native American population. Most cases were of mild severity; age and aortic root diameter, but not gender, were
independent predictors of AR in this study.
Etiology
AR results from malcoaptation of the aortic leaflets due to
abnormalities of the aortic leaflets, their supporting structures
(aortic root and annulus), or both. Diseases that primarily
affect the leaflets include bicuspid aortic valve and other
congenital abnormalities, atherosclerotic degeneration, infective endocarditis, rheumatic heart disease, connective tissue
or inflammatory diseases, antiphospholipid syndrome, and
use of anorectic drugs.6 –12 The leaflets can also be affected by
trauma, due either to chest wall or deceleration injury, or a jet
lesion, due to dynamic or fixed subaortic stenosis. Diseases
that primarily affect the annulus or aortic root include
idiopathic aortic root dilation, aortoannular ectasia, Marfan
syndrome, Ehlers-Danlos syndrome, osteogenesis imperfecta,
aortic dissection, syphilitic aortitis, or various connective
tissue diseases.13 A bicuspid aortic valve is commonly associated with dilation of the aortic root in addition to the
Prevalence
The prevalence of chronic AR and incidence of acute AR are
not precisely known. Singh et al2 reported the prevalence of
chronic AR detected by color Doppler echocardiography in a
large unselected adult population (the Framingham Offspring
Study). The overall prevalence AR in men was 13% and in
women 8.5%. However, most of the AR in this population
was trace or mild in severity; moderate or severe AR was rare
(Table 1). Multiple logistic regression analysis revealed age
and male gender to be predictors of AR. Interestingly,
hypertension did not predict AR on multivariate analysis,
confirming results of earlier studies that hypertension is
From the Department of Cardiology, University of Heidelberg, Heidelberg, Germany (R.B.), and Department of Internal Medicine, Cardiology Section,
Baylor University Medical Center, Dallas, Tex (P.A.G.).
Correspondence to Paul A. Grayburn, MD, Baylor Heart and Vascular Institute, 621 N Hall St, Suite H030, Dallas, TX 75226. E-mail
[email protected]
125
126
Circulation
July 5, 2005
TABLE 1. Prevalence of AR in the Framingham
Offspring Study
Age, y
26 –39
40 – 49
50 –59
60 – 69
70 – 83
(n⫽91)
(n-352)
(n⫽433)
(n⫽359)
(n⫽91)
None
96.7%
95.4%
91.1%
74.3%
75.6%
Trace
3.3%
2.9%
4.7%
13.0%
10.0%
0%
1.4%
3.7%
12.1%
12.2%
Men
Mild
ⱖModerate
0.3%
0.5%
0.6%
2.2%
Women
(n⫽93)
0%
(n⫽451)
(n⫽515)
(n⫽390)
(n⫽90)
None
98.9%
96.6%
92.4%
86.9%
73.0%
Trace
1.1%
2.7%
5.5%
6.3%
10.1%
Mild
0%
0.7%
1.9%
6.0%
14.6%
ⱖModerate
0%
0%
0.2%
0.8%
2.3%
By multivariate analysis, only age and gender predicted AR prevalence.
Adapted from Singh et al.2
congenital leaflet abnormality.14,15 Ankylosing spondylitis
can cause disease of both the leaflets and the aortic root.
Finally, chronic severe AR of any cause can lead to progressive enlargement of the aortic root and further worsening of
AR over time.
Acute AR is most commonly caused by bacterial endocarditis, aortic dissection, or blunt chest trauma.16 –18 Other less
common causes of acute AR include nonbacterial endocarditis,19 laceration of the aorta,20 and complications of invasive
procedures such as aortic valvuloplasty and percutaneous
balloon dilatation of aortic coarctation.21 Fortunately, acute
AR, which has a poor prognosis, is rare.
The prevalence of chronic AR is much higher, and its
causes are different. In a prospective study of 104 patients
with chronic AR, 35% had unknown causes, 26% idiopathic
root dilation, 13% congenital abnormalities, 12% rheumatic
heart disease, 10% infective endocarditis, and 7% degenerative valve disease.22 A different study of 246 patients demonstrated 40% degenerative causes, 28% congenital causes,
19% aortic root enlargement, 6% rheumatic causes, 3%
aortitis, and 3% endocarditis.23 These numbers only represent
a rough estimate because demographic changes in population
age, geographic location, and socioeconomic status may
affect prevalence of different diseases, such as rheumatic
heart disease.
Pathophysiology
Chronic severe AR imposes a combined volume and pressure
overload on the LV. The volume overload is a consequence of
the regurgitant volume itself and is therefore directly related
to the severity of the leak. Thus, whereas mild AR produces
only minimal volume overload, severe AR can produce
massive LV volume overload and progressive chamber dilation. The pressure overload results from systolic hypertension, which occurs as a result of increased total aortic stroke
volume, because both the regurgitant volume and the forward
stroke volume are ejected into the aorta during systole.24
Systolic hypertension can contribute to a cycle of progressive
dilation of the aortic root and subsequent worsening of AR.
In early, compensated severe AR, the LV adapts to the
volume overload by eccentric hypertrophy, in which sarcomeres are laid down in series and myofibers are elongated.25,26 Eccentric hypertrophy preserves LV diastolic compliance, such that LV filling pressures remain normal or mildly
increased despite a large regurgitant volume. In addition,
eccentric hypertrophy increases LV mass, such that the LV
volume/mass ratio is normal, and LV ejection fraction
(LVEF) is maintained by increased preload. The slope of the
LV pressure volume relationship (elastance or Emax), a loadindependent measure of myocardial function, is normal.27
Over time, progressive LV dilation and systolic hypertension
increase wall stress and the volume/mass ratio. As this
occurs, there is a phase during which LVEF is still normal,
but Emax decreases, indicating early myocardial dysfunction
that is largely masked by increased preload. At this stage,
LVEF still increases after successful valve replacement.27
Eventually, the increase in wall stress leads to overt LV
systolic dysfunction, manifested by a decline in LVEF and
severely reduced Emax. In chronic severe AR, end-systolic
wall stress can be as high as in aortic stenosis.28 Marked LV
hypertrophy (cor bovinum) develops with increased LV
volume and mass and spherical geometry.29
In decompensated severe AR, LV systolic dysfunction is
accompanied by decreased LV diastolic compliance as a
result of hypertrophy and fibrosis, leading to high filling
pressures and heart failure symptoms. Exertional dyspnea is
the most common manifestation, but angina can also occur
because of a reduction in coronary flow reserve with predominantly systolic coronary flow.30,31 In experimental animals,
the transition from a compliant (chronic compensated AR) to
a stiff (decompensated AR) LV chamber appears to involve
upregulation of several cardiac fibroblast genes.32,33 Acute
AR leads to rapid decompensation due to low forward cardiac
output and pulmonary congestion. There is not time for
compensatory LV dilation to occur, and severe hypotension
occurs rather than the systolic hypertension that is characteristic of chronic severe AR. The different stages of AR are
shown in Figure 1.
Physical Findings
A variety of physical signs have been described for AR. On
auscultation, a high-frequency, decrescendo diastolic murmur
is typically heard over the third or fourth intercostal space at
the left sternal border. In some patients, a mid and late
diastolic apical rumble (Austin-Flint murmur) is heard, possibly because of vibration of the anterior mitral leaflet as it is
struck by a posteriorly directed AR jet.34 A systolic ejection
murmur due to high ejection volumes should be present in
significant AR. Further findings on auscultation are soft or
absent second heart sound and presence of a third heart
sound. In acute AR, the diastolic murmur may be absent
because of rapid equilibration of aortic and LV diastolic
pressures. The only clue may be an absent second heart sound
in the setting of severe hypotension and pulmonary edema.
In chronic severe AR, the elevated stroke volume and
systolic hypertension produce a variety of interesting physical
findings. Among these are the bounding carotid pulse (Corrigan’s pulse), head bobbing (de Musset’s sign), pulsation of
Bekeredjian and Grayburn
127
Figure 1. Different stages of AR. Top left, In mild
AR, LV size, function, and hemodynamics are normal. Top right, In acute severe AR, there is equilibration of aortic and LV pressures (80/40 mm Hg
in this example). Left atrial pressure is elevated,
leading to pulmonary edema. Bottom left, In
chronic severe, compensated AR, the LV may
begin to dilate, but LVEF is often maintained in the
normal range by increased preload. There is systolic arterial hypertension and a wide pulse pressure. However, LV filling pressures are normal or
only slightly elevated, such that dyspnea is absent.
Bottom right, In decompensated chronic severe
AR, the LV is dilated and hypertrophied, and LV
function is often depressed as a result of afterload
excess. Forward output is decreased, leading to
fatigue and other low-output symptoms. Fibrosis
and hypertrophy decrease LV compliance, leading
to increased filling pressures and dyspnea.
the uvula (Muller’s sign), and pistol shot sounds over the
femoral artery with compression (Traube’s sign). During
compression with a glass slide, capillary pulsations can be
seen on the fingernail (Quincke’s sign).
Progression and Natural History
Progression of AR involves a complicated interaction of
several variables, including AR severity, aortic root pathology, and the adaptive response of the LV. AR severity may
worsen as a result of progressive leaflet pathology and/or
further dilation of the aortic root. In addition, LV dilation
occurs gradually and progressively, depending on the severity
of AR, hemodynamic factors, and the degree of eccentric
hypertrophy and remodeling, which may vary from patient to
patient and may be related to genetic factors. Reimold et al35
have shown that quantitative measures of AR severity by
echocardiography worsen over time. Padial et al36 showed
that patients with more rapidly progressive increases in aortic
root size also tend to have significant worsening of AR
severity and LV dilation.
A few studies have investigated the mortality and morbidity of chronic AR if left without surgical treatment. Bonow et
al37 studied 104 asymptomatic patients with severe AR and
normal LVEF. The rate of attrition (defined as death, symptoms, or asymptomatic LV dysfunction) was ⬍5%/y over
11-year follow-up. The rate of sudden death was only 0.4%/y.
At 11 years, 58% of patients remained asymptomatic with
normal LV systolic function. Borer et al22 found similar
results in 104 different patients monitored for a mean of 7.3
years. The rate of attrition was 6.2%/y and was predicted by
the change in LVEF or LVEF adjusted for wall stress from
rest to exercise. At 5 years, 75% of patients remained free of
death, symptoms, or LV dysfunction. Dujardin et al23 investigated the fate of 246 patients with moderately severe or
severe AR with a mean follow-up time of 7 years. Unlike the
2 prior studies, these patients were not all asymptomatic with
normal LV systolic function. The 10-year mortality rate was
34%, with independent predictors of survival being age,
functional class, comorbidity index, atrial fibrillation, LV
end-systolic diameter, and ejection fraction (EF). As shown
in Figure 2, patients with greater NYHA functional class or
LV end-diastolic diameters ⬎25 mm/m2 had an adverse
prognosis. Taken together, these studies indicate that asymptomatic patients with normal LV function generally have a
favorable prognosis and indicate that decline in LVEF with
exercise or serial follow-up may identify patients who will
Figure 2. Top, Survival of patients with chronic severe AR by
symptoms (NYHA class). Survival in asymptomatic patients (class I)
is no different than expected (P⫽0.38). However, patients with
class II symptoms have a significantly worse survival (P⫽0.02), and
patients with class II to IV symptoms have a markedly worse survival (P⬍0.001). Bottom, Survival for patients stratified by LV endsystolic dimension (LVESD). Patients with LV end-systolic dimension ⬍25 mm/m2 have a markedly worse survival (P⬍0.001).
Adapted from Dujardin et al.23
128
Circulation
TABLE 2.
July 5, 2005
Natural History of AR
Asymptomatic patients with normal LV systolic function
Progression to symptoms and/or LV dysfunction ⬍6%/y
Progression to asymptomatic LV dysfunction ⬍3.5%/y
Sudden death ⬍0.2%/y
Asymptomatic patients with LV systolic dysfunction
Progression to symptoms ⬎25%/y
Symptomatic patients
Mortality rate ⬎10%/y
Adapted with permission from ACC/AHA guidelines.38
require surgical intervention. Patients with even moderate
symptoms or evidence of LV dilation are at higher risk and
should be considered for early intervention. The American
College of Cardiology/American Heart Association Guidelines for Management of Patients with Valvular Heart Disease have nicely summarized the natural history of chronic
AR (Table 2).38
Echocardiography
The most important diagnostic test for evaluation of AR is
echocardiography. It allows (1) assessment of the anatomy of
the aortic leaflets and the aortic root, (2) detection of the
presence and severity of AR, and (3) characterization of LV
size and function. The American Society of Echocardiography guidelines for quantification of valvular regurgitation
emphasize the need to integrate all of this information to
properly evaluate patients with AR.39
Anatomy of the Aortic Root and Leaflets
Echocardiographic evaluation of the anatomy of the aortic
root, annulus, and leaflets is important in defining the
etiology and severity of AR. As noted earlier, disorders such
as aortic root dilation, bicuspid aortic valve, endocarditis,
degenerative aortic valve disease, and dissection of the
ascending aorta have different implications with regard to
treatment. Although it is common to see mild AR with a
structurally normal aortic valve and supporting apparatus, it is
rare for severe AR to occur without major lesions of the
leaflets or the aortic root. Figure 3 shows echocardiographic
examples of different causes of AR.
Color Flow Mapping
Doppler color flow mapping is widely used to identify the
presence of AR and estimate its severity. In general, color
flow jets are composed of 3 distinct segments. The proximal
flow convergence zone is the area of flow acceleration into
the orifice, the vena contracta is the narrowest and highestvelocity region of the jet at or just downstream from the
orifice, and the jet itself occurs distal to the orifice in the LV
cavity in the case of AR. Measurement of jet area or
penetration into the LV cavity is not accurate in assessing AR
severity. Perry et al40 compared the ratio of AR jet width to
LV outflow tract (LVOT) width in a parasternal long-axis
view to angiography. A jet width/LVOT width ⬍25% is
specific for mild AR, whereas a jet width/LVOT width ratio
⬎65% is specific for severe AR (Figure 4). This works best
when the regurgitant orifice is relatively round in shape.
Figure 3. Echocardiographic images from different patients with AR due to different pathologies. Top left, Parasternal long-axis view
showing a dilated aortic root (arrows) due to aortoannular ectasia. Top right, Parasternal long-axis view showing large, mobile vegetation (arrow) on the aortic valve in a patient with infective endocarditis. Bottom left, Parasternal short-axis view showing a bicuspid aortic valve with characteristic elliptical opening (arrow). Bottom right, Parasternal long-axis view of a patient with acute AR due to aortic
dissection. Intimal flap is shown by arrows.
129
Figure 4. Color flow images from
parasternal long-axis views in patients
with mild (left) and severe (right) AR. Jet
width is ⬍25% of LVOT width in mild
AR. This jet is eccentric; width is measured at the origin of the jet adjacent to
the leaflets. In severe AR, jet width is
usually ⬎50% of LVOT width. A jet
width/LVOT width ⬎65% (as in this
patient) is specific for severe AR.39
When it is elliptical, as in bicuspid aortic valves, this ratio can
lead to underestimation of AR severity.41 The short-axis view
is helpful in identifying such cases.
Vena Contracta Imaging
Vena contracta is defined as the narrowest central flow region
of a jet. In AR, it can be measured in a parasternal long-axis
or short-axis view in a color Doppler mode. Animal studies
have shown good correlation of vena contracta width and
severity of AR.42 Clinical studies have confirmed the usefulness of this measurement for judging AR severity.43,44
Tribouilloy et al43 demonstrated in a study with 79 patients
that a vena contracta width of ⱖ6 mm correlates well with
severe AR, having a sensitivity of 95% and a specificity of
90%. Conversely, a vena contracta width ⬍0.3 cm is specific
for mild AR. Willett et al44 compared vena contracta width by
transesophageal echocardiography to simultaneous aortic
flow probe measurements of regurgitant volume and fraction
in an intraoperative setting. Figure 5 shows an example of the
vena contracta in a patient with moderate AR.
Jet Eccentricity
Eccentricity of the regurgitant jet may contribute to the
understanding of mechanisms of aortic valve dysfunction.45 A
centrally directed jet entrains fluid on all sides and generally
appears larger and wider than eccentric jets directed anteriorly toward the ventricular septum or posteriorly toward the
anterior mitral leaflet. This should be taken into account when
AR severity is graded.
Proximal Isovelocity Surface Area Method
It is less common to identify a clear proximal flow convergence in AR compared with MR. However, when it is
present, the Nyquist velocity should be shifted toward the
direction of the jet to produce a clearly visible, round
proximal isovelocity surface area (PISA) region that is as
large as possible. The surface area of the PISA region is 2␲r2,
where r is the radius from the alias line to the orifice. Peak
regurgitant flow is obtained by multiplying this value by the
aliasing velocity, and effective regurgitant orifice area is the
peak regurgitant flow divided by the peak velocity obtained
by continuous wave Doppler. The PISA method has been
shown to work in AR but is less accurate in eccentric jets or
aortic root dilation.46
Quantitative Doppler Flow Measurements
AR volume and fraction can be calculated by comparing flow
at the aortic level (total stroke volume) with that at the mitral
valve level (forward stroke volume).39 The total stroke
volume is generally measured in the LVOT by multiplying
the LVOT area times the velocity time integral of pulsed
Doppler LVOT flow. The mitral stroke volume is measured
in similar fashion but is more prone to error because of
difficulty in accurately measuring the mitral annulus and
placing the pulsed Doppler sample volume at the level of the
annulus. Effective regurgitant orifice area can be calculated
by dividing the regurgitant volume by the velocity time
integral of the AR jet obtained from continuous wave
Doppler. This method, although tedious, provides quantitative measures of AR severity. The cut points for AR severity
measured by regurgitant volume, regurgitant fraction, and
effective regurgitant orifice area are shown in Table 3.39
Supportive Findings
A number of echocardiographic findings provide supporting
evidence for AR severity. By M-mode echocardiography,
early mitral valve closure indicates increased LV filling
pressures and is often present in severe AR, unless masked by
tachycardia.47 The continuous wave Doppler spectral signal
Figure 5. Vena contracta images of AR jet
by transesophageal echocardiography in
long-axis (left) and short-axis (right) views.
The vena contracta is seen as the narrowest part of the jet as it emerges from the
regurgitant orifice. The short-axis view is
difficult to orient precisely in the plane of
the vena contracta but is useful in determining whether the jet is central and round
(in which case the long-axis vena contracta accurately describes AR severity) or
markedly elliptical, as in bicuspid aortic
valves (in which the long-axis vena contracta may underestimate AR severity).
Reprinted from Willett et al,44 copyright
2001, with permission from the American
College of Cardiology Foundation.
130
TABLE 3.
Circulation
July 5, 2005
Application of Specific and Supportive Signs, and Quantitative Parameters in the Grading of Aortic Regurgitation Severity
Specific signs for AR severity
Supportive signs
Mild
Moderate
Severe
Central jet, width ⬍25% of LVOT†
Vena contracta ⬍0.3 cm†
No or brief early diastolic flow reversal in
descending aorta
Signs of AR ⬎mild present
but no criteria for severe AR
Central jet, width ⱖ65% of LVOT†
Vena contracta ⬎0.6 cm†
Pressure half-time ⬎500 ms
Normal LV size*
Intermediate values
Pressure half-time ⬍200 ms
Holodiastolic aortic flow reversal in
descending aorta
Moderate or greater LV enlargement‡
Quantitative parameters§
RVol, mL/beat
⬍30
30–44
45–59
ⱖ60
RF, %
⬍30
30–39
40–49
ⱖ50
⬍0.10
0.10–0.19
0.20–0.29
ⱖ0.30
EROA, cm2
*LV size applied only to chronic lesions.
†At a Nyquist of 50 – 60 cm/s.
‡In the absence of other etiologies of LV dilatation.
§Quantitative parameters can help sub-classify the moderate regurgitation group into mild-to-moderate and moderate-to-severe regurgitation as shown.
AR indicates aortic regurgitation; EROA, effective regurgitant orifice area; LV, left ventricle; LVOT, left ventricular outflow tract; RVol, regurgitant volume; and RF,
regurgitant fraction.
Table reprinted with permission of the American Society of Echocardiography from Zoghbi et al,39 Table 6.
of the AR jet provides clues to the severity of the leak. With
severe AR, diastolic pressure will decrease rapidly in the
aorta, thus leading to a shorter pressure half-time or more
rapid deceleration slope (Figure 6).48,49 As a general rule, an
AR pressure half-time ⬍200 ms indicates severe AR,
whereas a pressure half-time ⬎500 ms suggests mild AR.39
LV end-diastolic pressure can be calculated as the diastolic
blood pressure minus the end-diastolic pressure gradient
calculated from the modified Bernoulli equation (Figure 6).48
Importantly, the rate of deceleration of AR velocities simply
reflects the rate of equilibration of the diastolic pressure
gradient between the aorta and LV. In chronic compensated
AR, a large regurgitant volume may not significantly shorten
the pressure half-time. Conversely, moderate AR into a stiff
LV, especially in the acute or subacute setting, may significantly shorten pressure half-time. Thus, pressure half-time
and early mitral closure should be considered markers of the
hemodynamic consequences of AR rather than the regurgitant
volume itself. A complete echocardiographic study provides
measurements of the severity of the leak (regurgitant volume,
fraction, and orifice area) and the hemodynamic effects of AR
(LV volumes, pressure half-time, LV end-diastolic pressure).
Another important supportive sign of severe AR is diastolic flow reversal in the descending aorta. Although brief early
diastolic flow reversal is often seen in normal subjects,
holodiastolic flow reversal usually indicates at least moderate
Figure 6. Continuous wave Doppler of
AR jet in a patient with moderate AR and
a long-standing history of hypertension.
The slope of velocity deceleration is fairly
steep, with a pressure half-time (PHT) of
315 ms. LV end-diastolic pressure
(LVEDP) can be calculated by converting
end-diastolic velocity (measured at the R
wave peak) to pressure gradient by 4V2
and subtracting this value from the diastolic blood pressure (BP). Patients with
chronic compensated AR may have a
relatively flat slope, reflecting a compliant
LV with a normal or only slightly elevated
LVEDP.
AR.50 Diastolic flow reversal in the descending aorta is best
measured with pulsed-wave Doppler from a suprasternal
probe position.
LV Size and Geometry
Echocardiography is useful in measuring LV dimensions,
volumes, and LVEF, all of which are important determinants
of the need for surgery in chronic severe AR. Serial progression of LV dilation predicts the need for surgery.37 Because
LV chamber dilation and systolic dysfunction can occur from
other causes (ie, cardiomyopathy), it is important to establish
a link between severity of AR and LV dysfunction. This can
be difficult at times and underscores the need for accurate,
careful quantification of AR severity. Repeated echocardiography to assess progression of LV dilation and severity of AR
is recommended every 2 to 3 years in stable asymptomatic
patients with normal LV size and function.38 In asymptomatic
patients with LV dilation, more frequent echocardiography
(every 6 to 12 months) is indicated.38
Cardiac Catheterization
Even if echocardiography accurately identifies severity of AR
and degree of LV function, catheterization may be needed to
evaluate coronary anatomy in patients requiring surgical
intervention. As a general rule, men aged ⬎35 years, premenopausal women aged ⬎35 years with risk factors for
coronary artery disease, or postmenopausal women should
undergo preoperative coronary arteriography.38 Supravalvular aortography provides a semiquantitative approach to grade
AR during heart catheterization. Visual grading of AR
severity is based on the amount of contrast that appears in the
LV after aortography. Mild or 1⫹ AR is contrast appearing in
the LV but clearing with each beat. Moderate or 2⫹ AR is
faint opacification of the entire LV over several cardiac
cycles. Moderately severe or 3⫹ AR is opacification of the
entire LV with the same intensity as in the aorta. Severe or
4⫹ AR is opacification of the entire LV on the first heart beat
with an intensity higher than in the aorta. Unfortunately, this
method is subjective, depends on the amount of contrast
injected and the size of the LV, and correlates poorly with
regurgitant volume, particularly in patients with dilated
LVs.51
Cine MRI can also be used to detect and quantify AR.52–54
Phase velocity encoding is used to calculate forward stroke
volume through the aortic valve. Total LV stroke volume is
determined from LV end-diastolic and end-systolic volumes,
which are measured by summing the volumes of a stack of
slices of known thickness (typically 8 to 10 mm) through the
LV from base to apex. The difference between aortic and LV
stroke volumes is the regurgitant volume. Although cine
magnetic resonance is not as well validated as echocardiography for quantification of AR severity, it provides highly
accurate measurements of LV volumes, mass, and EF and
therefore could be useful for detecting progressive LV dilation and timing of operation for asymptomatic severe AR.
Role of Exercise Testing
Many asymptomatic patients with valvular heart disease have
gradually and imperceptibly reduced their activities or lead a
131
sedentary lifestyle. In such patients, exercise testing may be
very useful in eliciting symptoms or determining functional
capacity. Some studies have suggested that an exerciseinduced decrease in LVEF is a predictor of poor outcome that
warrants surgery.22,55–57 However, most of these studies
included patients who already had symptoms, LV dilation, or
decreased resting LVEF. Thus, it is not clear that exercise
LVEF is helpful in determining the need for surgery in
asymptomatic patients with normal LV size and function.38
Surgical Treatment
In acute AR, immediate surgical intervention is necessary
because the acute volume overload results in life-threatening
hypotension and pulmonary edema.1 Vasodilator therapy with
sodium nitroprusside may stabilize the patient during transport to the operating department. Aortic balloon counterpulsation is contraindicated because it worsens AR. ␤-Blockers
should be avoided in acute AR because they prolong diastole
and may worsen AR. Atrial pacing to increase heart rate
might be of theoretical benefit58,59; however, this does not
have an established role in clinical practice. Several studies
have demonstrated that emergency aortic valve replacement
can be performed with low operative mortality and good
long-term results in acute AR.60 – 62
In contrast to acute AR, patients with chronic AR may be
asymptomatic for many years or even their entire life.
Therefore, the critical issue is to determine if and when
surgical intervention is required. There are no randomized
controlled trials to guide surgical decision making. However,
reasonable guidelines have been proposed on the basis of the
aforementioned natural history of AR, retrospective studies,
and expert opinion.38 The operative mortality for isolated
aortic valve replacement is ⬇4%.63– 65 It is higher with
concomitant aortic root replacement or coronary bypass
surgery or if there are substantial comorbidities, including
advanced age. As shown in Table 2, the death rate for
asymptomatic patients with normal LV size and function is
⬍0.2%/y. Therefore, asymptomatic patients with normal LV
size and systolic function do not require surgery but should be
monitored carefully for development of symptoms, LV dysfunction, or progressive LV dilation. In contrast, symptomatic
patients with chronic severe AR have a mortality ⬎10%/y
and therefore should undergo surgery unless there are excessive comorbidities or a condition with a known short life
expectancy. The more difficult issue is when to operate on
asymptomatic patients to prevent irreversible LV dysfunction
from occurring. Outcomes are better in patients with an
LVEF ⬎55% or an end-systolic LV diameter ⬍55 mm (or
⬍25 mm/m2).23,38,66,67 This has been termed the “55 rule.”67
Careful, serial echocardiographic follow-up is necessary to
identify patients for surgery before their LV values reach
these thresholds.
Surgery for symptomatic patients with severe AR has been
shown to reduce LV volumes, LV mass, and wall stress and
to increase LVEF.68 –71 Even patients with dilated LV or low
LVEF can benefit from surgery. Chaliki et al72 reported the
results of surgery in 450 patients with severe AR. Operative
mortality was 14%, 6.7%, and 3.7% for those with LVEF
⬍35%, 36% to 49%, and ⱖ50%, respectively (Figure 7).
132
Circulation
July 5, 2005
Figure 7. Data from Chaliki et al72 show
survival in patients after aortic valve
replacement as a function of preoperative LVEF. LoEF indicates markedly
reduced LV function; MedEF, moderately
reduced LV function; and Nl EF, normal
LV function. Reprinted with permission.
Moreover, surgical survivors with low preoperative LVEF
had improved symptoms and LV function. Thus, it is almost
never “too late” to operate in chronic severe AR, although
patients with severe LV dysfunction and a systolic blood
pressure ⬍120 mm Hg may be at particularly high risk.73
Medical Therapy
The regurgitant volume in AR is determined by the regurgitant orifice area, the square root of the diastolic pressure
gradient across the valve, and the duration of diastolic flow
(which may not be holodiastolic if the LV is stiff and pressure
equilibrates early).74 Medical therapy is not able to significantly reduce regurgitant volume in chronic severe AR
because the regurgitant orifice area is relatively fixed and the
diastolic blood pressure is already low.74 Further reducing
diastolic blood pressure might adversely affect coronary
perfusion and should be avoided. Moreover, the square root
function dictates that a 25% reduction in diastolic pressure
gradient would only achieve a 13% reduction in regurgitant
volume.74 Therefore, the main goal of medical therapy is to
reduce the systolic hypertension associated with chronic
severe AR and thereby reduce wall stress and improve LV
function.74,75 A number of small studies have investigated the
effects of various vasodilators on hemodynamics and LV
function in chronic AR.76 – 82 Only 2 randomized, placebocontrolled studies have demonstrated significant reductions in
LV end-diastolic diameter and an increase in LVEF with
vasodilator therapy using hydralazine in 45 patients77 and
nifedipine in 72 patients.82 Medical therapy with nifedipine
has been shown to delay the need for surgery compared with
digoxin in a randomized trial.83 Thus, medical therapy may be
beneficial in delaying the need for surgery in asymptomatic
patients with normal LV function. It may also be useful in
patients with severe AR who are not considered candidates
for surgery. Importantly, the goal of medical therapy is to
significantly reduce systolic blood pressure to relieve the
afterload mismatch that burdens the LV in chronic severe AR.
It is conceivable that further insights into molecular mechanisms of myocardial adaptation to volume overload may yield
new therapeutic targets to reduce myocardial fibrosis and
hypertrophy and preserve LV systolic function. Endocarditis
prophylaxis is important for all patients with AR.
Future developments in interventional cardiology may
offer new alternatives for patients with severe AR who are not
considered surgical candidates. Percutaneous transcatheter
implantation of a heart valve prosthesis may be possible in
such patients, although this is still investigational at this
time.84
Conclusions
On the basis of available evidence and consensus opinion,
surgery is indicated for patients with severe AR who either
(1) are symptomatic or (2) have evidence of increasing LV
size or decreasing LVEF. It appears that it is best to operate
before LV end-diastolic diameter increases to ⬎55 mm or
25 mm/m2 or before LVEF falls to ⬍55%. This underscores
the importance of careful quantification of AR severity and
LV function. The role of medical therapy, particularly vasodilators, is primarily to decrease systolic hypertension and
delay the onset of LV dysfunction in asymptomatic patients.
References
1. Cohn LH, Birjiniuk V. Therapy of acute aortic regurgitation. Cardiol
Clin. 1991;9:339 –352.
2. Singh JP, Evans JC, Levy D, Larson MG, Freed LA, Fuller DL, Lehman
B, Benjamin EJ. Prevalence and clinical determinants of mitral, tricuspid,
and aortic regurgitation (the Framingham Heart Study) [published correction appears in Am J Cardiol. 1999;84:1143]. Am J Cardiol. 1999;83:
897–902.
3. Kim M, Roman MJ, Cavallini MC, Schwartz JE, Pickering TG, Devereux
RB. Effect of hypertension on aortic root size and prevalence of aortic
regurgitation. Hypertension. 1996;28:47–52.
4. Vasan RS, Larson MG, Levy D, Larson MG, Freed LA, Fuller DL,
Lehman B, Benjamin EJ. Determinants of echocardiographic aortic root
size. Circulation. 1995;91:734 –740.
5. Lebowitz NE, Bella JN, Roman MJ, Liu JE, Fishman DP, Paranicas M,
Lee ET, Fabsitz RR, Welty TK, Howard BV, Devereux RB. Prevalence
and correlates of aortic regurgitation in American Indians: the Strong
Heart Study. J Am Coll Cardiol. 200;36:461– 467.
6. Olson LJ, Subramanian R, Edwards WD. Surgical pathology of pure
aortic insufficiency: a study of 225 cases. Mayo Clin Proc. 1984;59:
835– 841.
7. Waller BF, Howard J, Fess S. Pathology of aortic valve stenosis and pure
aortic regurgitation: a clinical-morphologic assessment: part II. Clin
Cardiol. 1994;17:15–16.
8. Waller BF, Taliercio CP, Dickos DK, Howard J, Adlam JH, Jolly W. Rare
or unusual causes of chronic, isolated, pure aortic regurgitation. Clin
Cardiol. 1990;13:577–581.
9. Guiney TE, Davies MJ, Parker DJ, Leech GJ, Leatham A. The aetiology
and course of isolated severe aortic regurgitation: a clinical, pathological,
and echocardiographic study. Br Heart J. 1987;58:358 –368.
10. Roberts WC, Morrow AG, McINtosh CL, Jones M, Epstein SE. Congenitally bicuspid aortic valve causing severe, pure aortic regurgitation
without superimposed infective endocarditis. Am J Cardiol. 1981;47:
206 –209.
11. Tarasoutchi F, Grinberg M, Spina GS, Sampaio RO, Cardoso LF, Rossi
EG, Pomerantzeff P, Laurindo F, da Luz PL, Ramires JA. Ten-year
clinical laboratory follow-up after application of a symptom-based therapeutic strategy to patients with severe chronic aortic regurgitation of
predominant rheumatic etiology. J Am Coll Cardiol. 2003;41:1316 –1324.
12. Michel PL, Acar J, Chomette G, Iung B. Degenerative aortic regurgitation. Eur Heart J. 1991;12:875– 882.
13. Roman MJ, Devereux RB, Niles NW, Hochreiter C, Kligfield P, Sato N,
Spitzer MC, Borer JS. Aortic root dilatation as a cause of isolated, severe
aortic regurgitation. Ann Intern Med. 1987;106:800 – 807.
14. Hahn RT, Roman MJ, Mogtader AH, Devereux RB. Association of aortic
dilation with regurgitant, stenotic and functionally normal bicuspid aortic
valves. J Am Coll Cardiol. 1992;19:283–288.
15. Ferencik M, Pape LA. Changes in size of ascending aorta and aortic valve
function with time in patients with congenitally bicuspid aortic valves.
Am J Cardiol. 2003;92:43– 46.
16. Mann T, McLaurin L, Grossman W, Craige E. Assessing the hemodynamic severity of acute aortic regurgitation due to infective endocarditis.
N Engl J Med. 1975;293:108 –113.
17. Gustavsson CG, Gustafson A, Albrechtsson U, Larusdottir H, Stahl E,
Olin C. Diagnosis and management of acute aortic dissection, clinical and
radiological follow-up. Acta Med Scand. 1988;223:247–253.
18. Obadia JF, Tatou E, David M. Aortic valve regurgitation caused by blunt
chest injury. Br Heart J. 1995;74:545–547.
19. Kardaras FG, Kardara DF, Rontogiani DP, Sioras EP, ChristopoulouCokkinou V, Lolas CT, Anthopoulos LP. Acute aortic regurgitation
caused by non-bacterial thrombotic endocarditis. Eur Heart J. 1995;6:
1152–1154.
20. Yeo TC, Ling LH, Ng WL, Chia BL. Spontaneous aortic laceration
causing flail aortic valve and acute aortic regurgitation. J Am Soc Echocardiogr. 1999;12:76 –78.
21. McCrindle BW, for the Valvuloplasty and Angioplasty of Congenital
Anomalies (VACA) Registry Investigators. Independent predictors of
immediate results of percutaneous balloon aortic valvotomy in children.
Am J Cardiol. 1996;77:286 –293.
22. Borer JS, Hochreiter C, Herrold EM, Supino P, Aschermann M, Wencker
D, Devereux RB, Roman MJ, Szulc M, Kligfield P, Isom OW. Prediction
of indications for valve replacement among asymptomatic or minimally
symptomatic patients with chronic aortic regurgitation and normal left
ventricular performance. Circulation. 1998;97:525–534.
23. Dujardin KS, Enriquez-Sarano M, Schaff HV, Bailey KR, Seward JB,
Tajik AJ. Mortality and morbidity of aortic regurgitation in clinical
practice: a long-term follow-up study. Circulation. 1999;99:1851–1857.
24. Carabello BA. Aortic regurgitation: a lesion with similarities to both
aortic stenosis and mitral regurgitation. Circulation. 1990;82:1051–1053.
25. Ricci DR. Afterload mismatch and preload reserve in chronic aortic
regurgitation. Circulation. 1982;66:826 – 834.
26. Ross J Jr, McCullagh WH. Nature of enhanced performance of the dilated
left ventricle during chronic volume overloading. Circ Res. 1972;30:
549 –556.
27. Starling MR, Kirsh MM, Montgomery DG, Gross MD. Mechanism for
left ventricular systolic dysfunction in aortic regurgitation: importance for
predicting the functional response to aortic valve replacement. J Am Coll
Cardiol. 1991;17:887– 897.
28. Wisenbaugh T, Spann JF, Carabello BA. Differences in myocardial performance and load between patients with similar amounts of chronic
aortic versus chronic mitral regurgitation. J Am Coll Cardiol. 1984;3:
916 –923.
29. Magid NM, Young MS, Wallerson DC, Goldweit RS, Carter JN,
Devereux RB, Borer JS. Hypertrophic and functional response to experimental chronic aortic regurgitation. J Mol Cell Cardiol. 1988;20:
239 –246.
30. Nitenberg A, Foult JM, Antony I, Blanchet F, Rahali M. Coronary flow
and resistance reserve in patients with chronic aortic regurgitation, angina
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
133
pectoris and normal coronary arteries. J Am Coll Cardiol. 1988;11:
478 – 486.
Ardehali A, Segal J, Cheitlin MD. Coronary blood flow reserve in acute
aortic regurgitation. J Am Coll Cardiol. 1995;25:1387–1392.
Borer JS, Truter S, Herrold EM, Falcone DJ, Pena M, Carter JN, Dumlao
TF, Lee JA, Supino PG. Myocardial fibrosis in chronic aortic regurgitation: molecular and cellular responses to volume overload. Circulation.
2002;105:1837–1842.
Truter SL, Goldin D, Kolesar J, Dumlao TF, Borer JS. Abnormal gene
expression of cardiac fibroblasts in experimental aortic regurgitation.
Am J Ther. 2000;7:237–243.
Rahko PS. Doppler and echocardiographic characteristics of patients
having an Austin Flint murmur. Circulation. 1991;83:1940 –1950.
Reimold S, Orav EJ, Come PC, Caguioa ES, Lee RT. Progressive
enlargement of the regurgitant orifice in patients with chronic aortic
regurgitation. J Am Soc Echocardiogr. 1998;11:259 –265.
Padial LR, Oliver A, Sagie A, Weyman AE, King ME, Levine RA.
Two-dimensional echocardiographic assessment of the progression of
aortic root size in 127 patients with chronic aortic regurgitation: role of
the supraaortic ridge and relation to the progression of the lesion. Am
Heart J. 1997;134:814 – 821.
Bonow RO, Lakatos E, Maron BJ, Epstein SE. Serial long-term
assessment of the natural history of asymptomatic patients with chronic
aortic regurgitation and normal left ventricular systolic function. Circulation. 1991;84:1625–1635.
Bonow RO, Carabello B, de Leon AC Jr, Edmunds LH Jr, Fedderly BJ,
Freed MD, Gaasch WH, McKay CR, Nishimura RA, O’Gara PT,
O’Rourke RA, Rahimtoola SH, Ritchie JL, Cheitlin MD, Eagle KA,
Gardner TJ, Garson A Jr, Gibbons RJ, Russell RO, Ryan TJ, Smith SC Jr.
ACC/AHA guidelines for the management of patients with valvular heart
disease: a report of the American College of Cardiology/American Heart
Association Task Force on Practice Guidelines (Committee on Management of Patients With Valvular Heart Disease). J Am Coll Cardiol.
1998;32:1486 –1588.
Zoghbi WA, Enriquez-Sarano M, Foster E, Grayburn PA, Kraft CD,
Levine RA, Nihoyannopoulos P, Otto CM, Quinones MA, Rakowski H,
Stewart WJ, Waggoner A, Weissman NJ. Recommendations for evaluation of the severity of native valvular regurgitation with twodimensional and Doppler echocardiography. J Am Soc Echocardiogr.
2003;16:777– 802.
Perry GJ, Helmcke F, Nanda NC, Byard C, Soto B. Evaluation of aortic
insufficiency by Doppler color flow mapping. J Am Coll Cardiol. 1987;
9:952–959.
Taylor AL, Eichhorn EJ, Brickner ME, Eberhart RC, Grayburn PA.
Aortic valve morphology: an important in vitro determinant of proximal
regurgitant jet width by Doppler color flow mapping. J Am Coll Cardiol.
1990;16:405– 412.
Ishii M, Jones M, Shiota T, Yamada I, Heinrich RS, Holcomb SR,
Yoganathan AP, Sahn DJ. Quantifying aortic regurgitation by using the
color Doppler-imaged vena contracta: a chronic animal model study.
Circulation. 1997;96:2009 –2015.
Tribouilloy CM, Enriquez-Sarano M, Bailey KR, Seward JB, Tajik AJ.
Assessment of severity of aortic regurgitation using the width of the vena
contracta: a clinical color Doppler imaging study. Circulation. 2000;102:
558 –564.
Willett DL, Hall SA, Jessen ME, Wait MA, Grayburn PA. Assessment of
aortic regurgitation by transesophageal color Doppler imaging of the vena
contracta: validation against an intraoperative aortic flow probe. J Am
Coll Cardiol. 2001;37:1450 –1455.
Cohen GI, Duffy CI, Klein AL, Miller DP, Cosgrove DM, Stewart WJ.
Color Doppler and two-dimensional echocardiographic determination of
the mechanism of aortic regurgitation with surgical correlation. J Am Soc
Echocardiogr. 1996;9:508 –515.
Tribouilloy CM, Enriquez-Sarano M, Fett SL, Bailey KR, Seward JB,
Tajik AJ. Application of the proximal flow convergence method to
calculate the effective regurgitant orifice area in aortic regurgitation. J Am
Coll Cardiol. 1998;32:1032–1039.
Meyer T, Sareli P, Pocock WA, Dean H, Epstein M, Barlow J. Echocardiographic and hemodynamic correlates of diastolic closure of mitral
valve and diastolic opening of aortic valve in severe aortic regurgitation.
Am J Cardiol. 1987;59:1144 –1148.
Grayburn PA, Handshoe R, Smith MD, Harrison MR, DeMaria AN.
Quantitative assessment of the hemodynamic consequences of aortic
regurgitation by means of continuous wave Doppler recordings. J Am
Coll Cardiol. 1987;10:135–141.
134
Circulation
July 5, 2005
49. Teague SM, Heinsimer JA, Anderson JL, Sublett K, Olson EG, Voyles
WF, Thadani U. Quantification of aortic regurgitation utilizing continuous wave Doppler ultrasound. J Am Coll Cardiol. 1986;8:592–599.
50. Touche T, Prasquier R, Nitenberg A, de Zuttere D, Gourgon R.
Assessment and follow-up of patients with aortic regurgitation by an
updated Doppler echocardiographic measurement of the regurgitant
fraction in the aortic arch. Circulation. 1985;72:819 – 824.
51. Croft CH, Lipscomb K, Mathis K, Firth BG, Nicod P, Tilton G,
Winniford MD, Hillis LD. Limitations of qualitative angiographic
grading in aortic or mitral regurgitation. Am J Cardiol. 1984;53:
1593–1598.
52. Kozerke S, Schwitter J, Pedersen EM, Boesiger P. Aortic and mitral
regurgitation: quantification using moving slice velocity mapping. J
Magn Reson Imaging. 2001;14:106 –112.
53. Chatzimavroudis GP, Oshinski JN, Franch RH, Pettigrew RI, Walker PG,
Yoganathan AP. Quantification of the aortic regurgitant volume with
magnetic resonance phase velocity mapping: a clinical investigation of
the importance of imaging slice location. J Heart Valve Dis. 1998;7:
94 –101.
54. Krombach GA, Kuhl H, Bucker A, Mahnken AH, Spuntrup E, Lipke C,
Schroder J, Gunther RW. Cine MR imaging of heart valve dysfunction
with segmented true fast imaging with steady state free precession. J
Magn Reson Imaging. 2004;19:59 – 67.
55. Lewis SM, Riba AL, Berger HJ, Davies RA, Wackers FJ, Alexander J,
Sands MJ, Cohen LS, Zaret BL. Radionuclide angiographic exercise left
ventricular performance in chronic aortic regurgitation: relationship to
resting echographic ventricular dimensions and systolic wall stress index.
Am Heart J. 1982;103:498 –504.
56. Goldman ME, Packer M, Horowitz SF, Meller J, Patterson RE, Kukin M,
Teichholz LE, Gorlin R. Relation between exercise-induced changes in
ejection fraction and systolic loading conditions at rest in aortic regurgitation. J Am Coll Cardiol. 1984;3:924 –929.
57. Greenberg B, Massie B, Thomas D, Bristow JD, Cheitlin M, Broudy D,
Szlachcic J, Krishnamurthy G. Association between the exercise ejection
fraction response and systolic wall stress in patients with chronic aortic
insufficiency. Circulation. 1985;71:458 – 465.
58. Meyer TE, Sareli P, Marcus RH, Patel J, Berk MR. Beneficial effect of
atrial pacing in severe acute aortic regurgitation and role of M-mode
echocardiography in determining the optimal pacing interval.
Am J Cardiol. 1991;67:398 – 403.
59. Firth BG, Dehmer GJ, Nicod P, Willerson JT, Hillis LD. Effect of
increasing heart rate in patients with aortic regurgitation: effect of incremental atrial pacing on scintigraphic, hemodynamic and thermodilution
measurements. Am J Cardiol. 1982;49:1860 –1867.
60. Pompilio G, Brockmann C, Bruneau M, Buche M, Amrani M, Louagie Y,
Eucher P, Rubay J, Jamart J, Dion R, Schoevaerdts JC. Long-term
survival after aortic valve replacement for native active infective endocarditis. Cardiovasc Surg. 1998;6:126 –132.
61. Vogt PR, von Segesser LK, Jenni R, Niederhauser U, Genoni M, Kunzli
A, Schneider J, Turina MI. Emergency surgery for acute infective aortic
valve endocarditis: performance of cryopreserved homografts and mode
of failure. Eur J Cardiothorac Surg. 1997;11:53– 61.
62. Ergin MA, McCullough J, Galla JD, Lansman SL, Griepp RB. Radical
replacement of the aortic root in acute type A dissection: indications and
outcome. Eur J Cardiothorac Surg. 1996;10:840 – 844.
63. Edwards FH, Peterson ED, Coombs LP, DeLong ER, Jamieson WR,
Shroyer ALW, Grover FL. Prediction of operative mortality after valve
replacement surgery. J Am Coll Cardiol. 2001;37:885– 892.
64. Florath I, Rosendahl UP, Mortasawi A, Bauer SF, Dalladaku F, Ennker
IC, Ennker JC. Current determinants of operative mortality in 1400
patients requiring aortic valve replacement. Ann Thorac Surg. 2003;76:
75– 83.
65. Henry Wl, Bonow RO, Borer JS, Ware JH, Kent KM, Redwood DR,
McIntosh CL, Morrow AG, Epstein SE. Observations on the optimum
time for operative intervention for aortic regurgitation, I: evaluation of the
results of aortic valve replacement in symptomatic patients. Circulation.
1980;61:471– 483.
66. Borer JS, Bonow RO. Contemporary approach to aortic and mitral regurgitation. Circulation. 2003;108:2432–2438.
67. Carabello BA, Crawford FA. Valvular heart disease. N Engl J Med.
1997;337:32– 41.
68. Ishii K, Hirota Y, Suwa M, Kita Y, Onaka H, Kawamura K. Natural
history and left ventricular response in chronic aortic regurgitation.
Am J Cardiol. 1996;78:357–361.
69. Bonow RO, Dodd JT, Maron BJ, O’Gara PT, White GG, McIntosh CL,
Clark RE, Epstein SE. Long-term serial changes in left ventricular
function and reversal of ventricular dilatation after valve replacement for
chronic aortic regurgitation. Circulation. 1988;78:1108 –1120.
70. Taniguchi K, Nakano S, Kawashima Y, Sakai K, Kawamoto T, Sakaki S,
Kobayashi J, Morimoto S, Matsuda H. Left ventricular ejection performance, wall stress, and contractile state in aortic regurgitation before
and after aortic valve replacement. Circulation. 1990;82:798 – 807.
71. Roman MJ, Klein L, Devereux RB, Kligfield P, Niles NW, Hochreiter C,
Isom OW, Borer JS. Reversal of left ventricular dilatation, hypertrophy,
and dysfunction by valve replacement in aortic regurgitation. Am Heart J.
1989;118:553–563.
72. Chaliki HP, Mohty D, Avierinos J-F, Scott CG, Schaff HV, Tajik AJ,
Enriquez-Sarano M. Outcomes after aortic valve replacement in patients
with severe aortic regurgitation and markedly reduced left ventricular
function. Circulation. 2002;106:2687–2693.
73. Carabello BA. Is it ever too late to operate on the patient with valvular
heart disease? J Am Coll Cardiol. 2004;44:376 –383.
74. Levine HJ, Gaasch WH. Vasoactive drugs in chronic regurgitant lesions
of the mitral and aortic valves. J Am Coll Cardiol. 1996;28:1083–1091.
75. Grayburn PA. Vasodilator therapy for chronic aortic and mitral regurgitation. Am J Med Sci. 2000;320:202–208.
76. Kleaveland JP, Reichek N, McCarthy DM, Chandler T, Priest C,
Muhammed A, Makler PT Jr, Hirshfeld J. Effects of six-month afterload
reduction therapy with hydralazine in chronic aortic regurgitation.
Am J Cardiol. 1986;57:1109 –1116.
77. Greenberg B, Massie B, Bristow JD, Cheitlin M, Siemienczuk D, Topic
N, Wilson RA, Szlachcic J, Thomas D. Long-term vasodilator therapy of
chronic aortic insufficiency: a randomized double-blinded, placebocontrolled clinical trial. Circulation. 1988;78:92–103.
78. Dumesnil JG, Tran K, Dagenais GR. Beneficial long-term effects of
hydralazine in aortic regurgitation. Arch Intern Med. 1990;150:757–760.
79. Lin M, Chiang HT, Lin SL, Chang MS, Chiang BN, Kuo HW, Cheitlin
MD. Vasodilator therapy in chronic asymptomatic aortic regurgitation:
enalapril versus hydralazine therapy. J Am Coll Cardiol. 1994;24:
1046 –1053.
80. Wisenbaugh T, Sinovich V, Dullabh A, Sareli P. Six month pilot study of
captopril for mildly symptomatic, severe isolated mitral and isolated
aortic regurgitation. J Heart Valve Dis. 1994;3:197–204.
81. Schon HR, Dorn R, Barthel P, Schomig A. Effects of 12 months quinapril
therapy in asymptomatic patients with chronic aortic regurgitation.
J Heart Valve Dis. 1994;3:500 –509.
82. Scognamiglio R, Fasoli G, Ponchia A, Dalla-Volta S. Long-term nifedipine unloading therapy in asymptomatic patients with chronic severe
aortic regurgitation. J Am Coll Cardiol. 1990;16:424 – 429.
83. Scognamiglio R, Rahimtoola SH, Fasoli G, Nistri S, Dalla Volta S.
Nifedipine in asymptomatic patients with severe aortic regurgitation and
normal left ventricular function. N Engl J Med. 1994;331:1417–1423.
84. Boudjemline Y, Bonhoeffer P. Steps toward percutaneous aortic valve
replacement. Circulation. 2002;105:775–778.
New Drugs and Technologies
Valentin Fuster, MD, PhD; Raymond J. Kim, MD
C
ardiovascular magnetic resonance (MR) is emerging as a
multipurpose imaging modality for the assessment of
cardiovascular disease in general and ischemic heart disease
in particular. Currently, the pace of innovation is rapid, and
the modality is changing from one that is used primarily as a
research tool to one that is increasingly used in routine
clinical practice. The process of innovation includes not only
improvements in scanner hardware, such as coil and gradient
technology, and the development of new contrast agents but
also the development of novel pulse sequences. The concept
of the pulse sequence, in which programming changes at the
scanner can lead to fundamental changes in activating tissue,
is unique to MR and gives this modality the potential to
assess a vast number of biological parameters.
Cardiovascular MR promises to play an important clinical
and investigational role in both vascular and cardiac systems.
Current and potential future applications of cardiovascular
MR will be discussed with a particular focus on ischemic
heart disease. Multidetector-row computed tomography, another promising and complementary noninvasive imaging
technology, will be discussed briefly in relation to cardiovascular MR for the assessment of atherothrombotic disease.
elements such as crystalline cholesterol and cholesteryl esters
intermixed with monocyte-derived macrophages and other cells;
(3) thrombotic, or deposition of platelets and/or fibrin; and (4)
calcification, usually related to fibrous rather than to lipid-rich
plaques.1,5,6 Varying proportions of these components occur in
different plaques, thus giving rise to a heterogeneity or spectrum
of lesions. These components mainly affect the intima, but
secondary changes also occur in the media and adventitia; these
presumably include growth of vasa vasorum and extravasated
erythrocytes.7,8 As examples of the heterogeneity of lesions,
disruption-prone plaques in the coronary arteries, the so-called
vulnerable plaques, tend to have a thin fibrous cap (cap thickness
⬇65 to 150 ␮m ) and a large lipid core (⬎40% of the total lesion
area).9 About two thirds of the acute coronary syndromes (ACS)
result from disruption of a modestly stenotic vulnerable plaque,
not visible by x-ray angiography, which triggers an acute
thrombus formation that may result in a thrombotic occlusion.9
Similar observations have been made of small lipid-rich lesions
of the thoracic aorta, which, after disruption and thrombosis,
may result in stroke.10 Unlike coronary and aortic vulnerable
plaques, carotid plaques prone to disruption and thrombosis are
predominantly fibrotic and severely stenotic.10 Similar observations have been made of severely stenotic and fibrotic plaques
leading to thrombotic complications (presumably favored by a
hypercoagulant state) that affect the peripheral arteries and
occasionally the coronary arteries, which explains approximately
one third of the ACS.10 Therefore, in atherothrombotic disease, it
has been proposed that the term “high-risk plaque” may be used
interchangeably with the classic term “vulnerable plaque,” which
traditionally implies the presence of a lipid-rich core.2
Accordingly, reliable noninvasive imaging modalities able to
detect atherothrombotic disease in the various stages and regions
and to characterize plaque composition are clinically desirable.
Additionally, the availability of such imaging modalities will
improve our understanding of the pathophysiological mechanisms underlying the atherothrombotic processes and allow us to
better risk-stratify the “burden” of disease. Moreover, such tools
may permit optimal tailoring of treatment and allow direct
monitoring of the vascular response.10 Most invasive techniques,
such as coronary angiography and intravascular ultrasound,
identify luminal diameter or stenosis, wall thickness, and plaque
The Vasculature and
Atherothrombotic Disease
Nomenclature and Evolving Imaging Assessment
Atherothrombosis is a systemic or multiterritory arterial
disease that primarily affects the large- and medium systemic
arteries, including the aorta and the carotid, coronary, and
peripheral arteries. Although the epicardial coronary arteries
appear to be the most susceptible to atherothrombosis,1,2
intramyocardial arteries are relatively resistant. The concept
of multiterritory atherothrombosis has been addressed in 2
large studies of symptomatic patients that showed that at
entry into the studies, 3% to 8% had symptomatic atherothrombotic disease in all 3 main arterial districts and 23% to
32% had disease in 2 districts.3,4
From a structural point of view, the 4 main components of the
atherothrombotic plaques are as follows: (1) fibrocellular, or
extracellular matrix of various fibril types intermixed with
smooth muscle cells and other cells; (2) lipid-cellular, or lipid
From the Zena and Michael A. Wiener Cardiovascular Institute and The Marie-Josee and Henry R. Kravis Cardiovascular Health Center (V.F.), The
Mount Sinai School of Medicine, New York, NY, and Duke Cardiovascular Magnetic Resonance Center (R.J.K.), Duke University Medical Center,
Durham, NC.
The online-only Data Supplement, which contains Movies I through V, can be found with this article at http://www.circulationaha.org.
Correspondence to Raymond J. Kim, MD, Duke Cardiovascular MRI Center, DUMC-3934, Durham, NC 27710 (e-mail
[email protected]), or Valentin Fuster, MD, PhD, Mount Sinai School of Medicine, Box 1030, New York, NY 10029 (e-mail
[email protected]).
(Circulation. 2005;112:135-144.)
DOI: 10.1161/01.CIR.0000155618.37779.A0
135
136
Circulation
July 5, 2005
MR and CT Angiography of the Coronary Arteries
Reference
Technique
Patients, Sensitivity, Specificity,
n
%
%
Regenfus et al67
MRA
61
85
90
Plein et al68
MRA
40
74
88
Watanabe et al69
MRA
22
80
85
Kim et al70 (non-CE)
MRA
109
93
42
Nikolaou et al71
MRA
40
72
60
Ropers et al72
MDCTA (16)
77
92
93
Nieman et al73
MDCTA (16)
59
95
86
Knez et al74
MDCTA (4)
44
78
98
Nieman et al
MDCTA (4)
35
81
97
Achenbach et al76
MDCTA (4)
64
85
76
Kuettner et al77
MDCTA (4)
66
37
99
75
MDCTA indicates MDCT angiography; CE, contrast enhanced.
volume.11 However, 2 emerging and most promising techniques— computed tomography (CT) and MR—are likely to
gain wider acceptance by the medical community and to be
applied to larger populations groups because they are noninvasive and can both evaluate luminal stenosis (CT) and characterize plaque composition (MR).12
MR Imaging
Because atherothrombotic disease affects the entire arterial
system, simultaneous assessment from supra-aortic arteries to
the distal runoff vessels has been proposed with contrastenhanced, whole-body MR angiography (MRA). Most importantly, high-resolution MRI has emerged as the potential
leading noninvasive in vivo imaging modality for atherosclerotic plaque characterization.
Whole-Body, Contrast-Enhanced MRA
MRA is highly specific and sensitive compared with x-ray
angiography for the detection of luminal narrowing ⬎50%.13
Whole-body MRA excludes the intracranial and coronary arteries, for which a dedicated examination is still required. Several
coronary MRA techniques have been proposed for the assessment of coronary stenosis, anomalies, and patency of bypass
grafts. Thus far, the sensitivity and specificity of coronary MRA
with later-generation 3D techniques are quite reasonable in
select patient cohorts (Table).12–14 Coronary MRA, however, is
technically challenging, and currently there are limitations in
spatial coverage and resolution, temporal resolution, and image
quality that preclude the routine use of coronary MRA for
everyday clinical application.
Overall, it is possible that in the near future, contrast-enhanced
MRA with the use of gadolinium-based contrast agents will provide
complete assessment of the systemic arterial tree, whereas noninvasive CT with intravenous injection of contrast medium may
replace conventional diagnostic coronary angiography in part.12
However, contrast-enhanced molecular MRA, when added to regional high-resolution MRI (ie, coronary arteries), may provide
additional information in plaque characterization.
Regional High-Resolution MRI for
Plaque Characterization
MR differentiates plaque components on the basis of biophysical
and biochemical parameters such as chemical composition,
Figure 1. In vivo black-blood MR cross-sectional T2-weighted
image of patient with significant plaque in right carotid artery
(arrow). Magnified image (bottom left) shows complex lipid-rich
plaque. Courtesy Z.A. Fayad, Mount Sinai School of Medicine.
water content, physical state, molecular motion, or diffusion.
Specifically, recent improvements in MR techniques (eg, blackblood MRI, faster imaging and detection coils), conducive to
high-resolution and contrast imaging, have permitted the study
of the various plaque components with multicontrast MR,
generated by T1- and T2-weighted, proton-density–weighted, and
time-of-flight imaging.11,12,15,16 Moreover, MR provides imaging without ionizing radiation and can be repeated over time.
MRI Studies of Carotid Artery Plaques
The superficial location and relative absence of motion of the
carotid arteries allows excellent delineation of plaque by MR
techniques (Figure 1). Thus far, MR studies have shown the
characterization of normal and pathological arterial walls,12,16
the quantification of plaque size and therapeutic regression,17,18
and the detection of fibrous cap integrity, as well as disruptionrelated transient ischemic attack or stroke.19 Thus, it can be
predicted that MRA, which demonstrates the severity and
distribution of stenotic plaques, and high-resolution MRI, which
characterizes such plaques, will eventually be combined.12
MRI Studies of Aortic Plaques
The principal challenges associated with high-resolution MRI of
the thoracic aorta are that attainment of sufficient sensitivity for
submillimeter imaging and the exclusion of artifacts caused by
respiratory motion and blood flow. Matched MRI and transesophageal echocardiography cross-sectional aortic segments
showed a strong correlation for plaque thickness, whereas MRI
was the best contributor to plaque characterization and therapeutic regression (Figure 2).17,20 In a recent study of asymptomatic
subjects, the Framingham Heart Study showed by MRI that
aortic plaque prevalence and burden (ie, plaque volume/aortic
volume) significantly increased with age and were higher in the
abdominal aorta than in the thoracic aorta.21 Importantly, the
Framingham Heart Study coronary risk score was strongly
associated with asymptomatic aortic plaques as detected by
Fuster and Kim
137
Figure 3. In vivo MR black-blood cross-sectional images of
human coronary arteries demonstrating plaque, presumably with
deposition of fat (arrow, A), concentric fibrotic lesion (B) in left
anterior descending artery (LAD), and ectatic but atherosclerotic
right coronary artery (C). RV indicates right ventricle; LV, left
ventricle. Modified with permission from Fayad et al.25
Figure 2. T2-weighted MR images at 2 different time points (baseline and 24 months after initiation of lipid-lowering therapy by
statins) from same patient. Details of descending aorta are shown.
At 24 months after lipid lowering, MRI shows thinner plaque and
smaller lipid area (hypointense signal from 1 to 4 o’clock) compared with baseline (arrows). Bar scale indicates 10 mm.
MRI. Such an approach may turn out to be very valuable for
identification, quantification, and the therapeutic management of
plaque burden, particularly in asymptomatic individuals with a
high risk factor profile.12
MRI Studies of Peripheral Arteries
High-resolution MR of the femoral and popliteal arteries and of
the response to balloon angioplasty has been reported.22 The
extent of the plaques could be defined such that even in
angiographically normal segments of vessel, lesions with crosssectional areas ranging from 49% to 76% of potential lumen area
were identified. After angioplasty, plaque fissuring and local
dissection were identified easily, and serial changes in lumen
diameter, blood flow, and lesion size were documented. In the
future, this technology, when combined with contrast-enhanced
molecular MRA as discussed later, may be of great value for the
postinterventional assessment of different therapeutic strategies
such as new antithrombotic or antifibrotic drugs.
MRI Studies of Coronary Artery Plaques
With a combination of multicontrast MR imaging sequences,
differentiation of fibrocellular, lipid-rich, and calcified regions of the atherosclerotic coronary plaque is feasible, as
shown in an ex vivo study on human coronary arteries
correlated to histopathology.23 Black-blood MR methods
used in the human carotid artery and aorta have been applied
to imaging of the coronary arterial lumen and wall. The
method was validated in swine coronary lesions induced by
balloon angioplasty.24 High-resolution black-blood MR of
both normal and atherosclerotic human coronary arteries was
performed for direct assessment of coronary wall thickness
and the visualization of focal atherosclerotic plaque in the
wall (Figure 3).25 To alleviate the need for breath holding,
real-time navigator for respiratory gating and real-time sliceposition correction have been reported.26 Near-isotropic
spatial-resolution black-blood imaging may provide a quick
way to image a long segment of the coronary artery wall and
may be useful for rapid coronary plaque burden measurements.27 A crucial ultimate goal of cardiovascular noninvasive imaging is to have reliable technology for plaque
characterization of the coronary arteries. Guided by contrast-
enhanced CT, high-resolution MRI coupled with contrastenhanced molecular MRA promises to fulfill this goal.
Contrast-Enhanced Molecular MRI for
Plaque Characterization
An alternative approach to high-resolution MRI for plaque
characterization is to image plaque through the introduction of
contrast agents that are targeted to specific cells, molecules, or
processes that can be precisely localized and quantified.15,28 –31
Examples might include the following (Figure 4): adhesion
molecules (vascular cell adhesion molecule-1, intercellular adhesion molecule, and selectins), macrophages within the context
of apoptosis (phosphatidylserine and synaptotagmin), fibrous cap
within the context of proteolysis (matrix metalloproteinases),
lipid core (nonspecific lipophilic; Figure 5), angiogenesis (integrin ␣V␤3), and thrombosis (fibrin and integrin ␣IIb␤3).15,28 –31
Targeted imaging agents are generally created by chemically
attaching an affinity ligand, such as an antibody, peptide, or
small molecule, to a magnetic compound, such as superparamagnetic particles of iron oxide or gadolinium chelates.15,28 Our
expanding understanding of cellular and molecular events within
atherosclerotic plaque has been accompanied by imaginative
application of imaging tools, which has led to the new field of
contrast-enhanced molecular MRI. Such molecular technology,
when combined with high-resolution MRI, promises complementary structural and biological information and, therefore,
more detailed plaque characterization. In addition, thinner slices,
such as those obtained with 3D MR acquisition techniques, and
other evolving MR technologies, such as water diffusion weighting, magnetization transfer weighting, and steady-state freeprecession (SSFP) sequences, all promise to further improve
artery wall structural and biological imaging.
Functional Vascular MRI
Noninvasive imaging techniques such as CT and MRA allow
assessment of vascular anatomy but do not provide information
about blood flow. For clinical purposes, flow information is
important, because anatomy and function may not be directly
related. Global coherent free precession (GCFP) is a new
concept in MRI that can be used to produce images that depict
vascular anatomy simultaneously with vascular function (blood
flow).32 Protons in moving blood are “tagged” every few
milliseconds as they travel through an arbitrary region in space.
Simultaneous with tagging of new blood, previously tagged
blood is maintained in the GCFP state, which allows acquisition
of consecutive movie frames as the heart pushes blood through
the vasculature. Body tissue surrounding the moving blood is
138
Circulation
July 5, 2005
Figure 4. Examples of molecular targets
and technological modalities relevant to
cardiovascular imaging. AHA indicates
American Heart Association. Modified
with permission from Choudhury et al.31
never excited and is invisible. With this approach, pulsating
blood can be seen flowing through 3D space for distances of up
to 16 cm (Figure 6). Although additional technical development
will be required before the full potential of GCFP MRI can be
recognized, the current data demonstrate that GCFP MRI can be
used to produce cine angiograms that are remarkably similar to
those produced by invasive X-ray angiography, but noninvasively and without the need for contrast agents or ionizing
radiation.
Figure 5. A, In vivo T1-weighted MR transverse image of
abdominal aorta, 24 hours after gadofluorine injection. B, Magnification shows plaque enhancement after injection. C, Corresponding histological section. Combined Masson elastin staining allows characterization of different components of plaque
(original magnification ⫻10). Appearance of MR image correlates closely with matched histological section shown in C. Ad
indicates adventitia; FC, fibrous cap; L, lumen; and LC, lipid
core. Modified with permission from Sirol et al.29
Future Integration of Noninvasive Coronary CT
and MRI
Today, 2 different modes of CT are available.12 One uses
nonmechanical movement of the x-ray source (ie, electronbeam CT), and another involves the motion of the x-ray
source and table, combined with multiple detectors to acquire
the data in spiral or helical fashion (ie, multidetector-row CT
[MDCT]). Although electron-beam CT has been considered
the “gold standard” for the assessment of calcified plaques,
MDCT usually includes an initial nonenhanced scan for the
screening and quantification of coronary artery calcium
followed by CT angiography for direct visualization of
coronary artery disease.12 Results of a number of studies
concerning the use of contrast-enhanced MDCT for noninvasive coronary angiography have been published. It appears
that the diagnostic accuracy is reasonable (Table), but complete assessment can be hindered by calcium deposits in the
vessel wall and by motion artifacts, particularly in patients
with high heart rates.12 Two studies with 16-slice scanners
have been reported recently, each with improved accuracy
Figure 6. Single movie frames from GCFP MRI (left) and invasive catheterization (right) in same patient. GCFP images did not
require invasive procedure, contrast agent, or ionizing radiation.
Total GCFP acquisition time was 15 seconds. Full-motion movies can be viewed in the online-only Data Supplement (select
Movie I). Modified with permission from Rehwald et al.32
Fuster and Kim
139
Figure 7. MR images of morphology (a),
motion (b), perfusion (c), and delayed
enhancement (d) in patient with left atrial
mass (arrows). Biopsy demonstrated
recurrent invasive thymoma (note several
extracardiac masses are also present).
Perfusion is reduced compared with left
ventricular myocardium. Hyperenhancement is present in heterogeneous fashion. Full-motion movies can be viewed in
the online-only Data Supplement (select
Movie II).
compared with reports with 4-slice scanners (Table). The next
generation of MDCT scanners will almost certainly allow for
even faster gantry rotation and simultaneous acquisition of
⬎16 slices. The breath-hold time may decrease to ⬍10
seconds, thus reducing the volume of contrast media needed
for sufficient enhancement of the coronary arteries. Temporal
and spatial resolution may further improve, ideally to 100 ms
and 0.6-mm slice thickness. These enhancements may help in
the detection, differentiation, and reliable quantification of
calcified and noncalcified coronary artery plaques. Improvement of spatial resolution and new image-reconstruction
algorithms should further reduce beam-hardening artifacts
and partial volume effects caused by calcifications and
improve the assessment of complex mixed plaques. Further
optimization of multisegmental reconstruction algorithms
may allow the investigation of patients with higher heart rates
without any loss in image quality.
CT and MRI together may provide unique information, such
as assessment of subclinical disease, the study of atherothrombotic progression, and response to therapy. CT may first be used
to localize suspicious atherothrombotic lesions in the coronary
arteries within a short scan time. MRA does the same in the
systemic arteries but within a much longer scan time. Highresolution MRI and contrast-enhanced molecular MRI can then
be used for structural and biological plaque characterization of
the problem sites. Furthermore, the role of MRI in the in vivo
monitoring of therapies can be pivotal for the better understanding of new pharmacological agents before clinical trials are
undergone. It can also serve as a guide to assess the vascular wall
response by individual patients to proven beneficial therapies.
The Myocardium
The purpose of this section is to highlight some of the recent
technical advances in cardiac MR, and in particular, to focus on
how these advances may affect the clinical assessment of
patients. Rather than providing a comprehensive review of the
literature, we will speculate on how these new techniques could
be optimally used in clinical practice, currently and in the near
future. Additionally, we will discuss how some recent findings
by cardiac MR provide insights into cardiac pathophysiology.
Morphology and Function
MR provides arguably the best and most comprehensive approach to evaluating the structure and function of the heart. A
number of techniques have been developed, including those that
can render fat or flowing blood invisible, allow rapid imaging
that is free of motion artifacts even during free breathing, and,
with the addition of gadolinium contrast, provide information
regarding tissue perfusion, necrosis, and fibrosis. The rapid pace
of innovation, however, raises some issues that are perhaps more
unique to MR than to the other imaging modalities. For instance,
there is often a discrepancy between the newer techniques that
are quickly adopted in clinical practice and those that are
described in the published literature. This problem is compounded by the fact that new techniques in MR often include
new relationships between image intensity and the underlying
physiology rather than just the provision of improved signal-tonoise ratio or improved resolution. It is important to realize that
concepts or algorithms associated with older techniques may not
apply to the newer techniques.
Consider MR for the assessment of cardiac masses. This
literature is extensive; however, the vast majority of the data,
even those from recent publications,33 were acquired by early
spin-echo techniques that have several limitations. They are slow
(several minutes per image) and prone to motion artifacts due to
free breathing during image acquisition, and they provide limited
T1 weighting. Much of this literature involved attempts at tissue
characterization by comparison of image intensities on T1-, T2-,
and proton-density–weighted images. Differentiation between
benign and malignant masses from image intensity features,
however, was usually poor.33
These older spin-echo techniques are no longer used in
clinical practice. Instead, at present, a typical protocol for the
evaluation of a cardiac mass would consist of the following: (1)
1 or more stacks of single-shot imaging that combines rapid
(0.25 seconds/slice) image acquisition with comprehensive an-
140
Circulation
July 5, 2005
Future effort should be directed toward testing whether changes in
cardiac parameters as measured by MR indeed translate into
differences in patient outcome.
Infarction and Viability
Figure 8. Comparison of long-axis cine views acquired with
conventional gradient-recalled echo (GRE) and SSFP techniques. Slow flow of blood inhibits delineation of endocardial
border of left ventricular apex on GRE cine. With SSFP, there is
overall higher signal-to-noise ratio and excellent contrast
between myocardium and blood. Full-motion cines can be
viewed in the online-only Data Supplement (select Movie III).
atomic coverage to quickly delineate morphology (Figure 7a);
(2) cine imaging to view motion during the cardiac cycle (Figure
7b); (3) first-pass perfusion imaging during the transit of an
intravenous bolus of gadolinium contrast (Figure 7c); and (4)
postcontrast delayed-enhancement imaging, which accentuates
differences in contrast uptake between the mass and normal
myocardium and between different regions of the mass (Figure
7d). Each of these steps consists of pulse sequences that have
improved significantly, even in the last 2 to 3 years. For instance,
delineation of morphology with black-blood HASTE (half Fourier single-shot turbo spin-echo34) is currently of sufficient
quality that segmented black-blood sequences, which require 8to 10-second breath holds per slice, are used sparingly.
We expect that tissue characterization of cardiac masses will be
improved substantially by the performance of first-pass perfusion
and delayed-enhancement imaging (also see following sections for
further description of these techniques). In particular, there will be
excellent discrimination between cardiac thrombus and tumors. We
speculate that these techniques will become the standard approach
for the noninvasive assessment of cardiac masses. Several centers
are currently investigating these strategies.
One of the most significant advances in MR has been the
robust implementation of SSFP sequences. SSFP (also designated as TrueFISP, FIESTA, or balanced FFE) provides substantially higher signal-to-noise ratio than can be obtained by
conventional gradient-echo techniques, along with excellent
contrast between myocardium and blood35 (Figure 8). Implementations include single-shot 2D versions with or without
prepulses to provide rapid snapshot images to delineate morphology, first-pass perfusion, or delayed enhancement; 3D
sequences to provide angiogram-like views of the vasculature
without the need for contrast media; and multiphase segmented
2D sequences to provide high-resolution cine images of the
heart.35 The latter is currently the “gold standard” approach to
assess ventricular volumes, mass, and function.
The accuracy and reproducibility of MR in assessing cardiac
morphology and function leads to low interstudy variability in
quantifying these parameters. This is turn translates into significant
reductions in sample sizes that are required to test the efficacy of
therapeutic interventions on these parameters.36 It is expected that
the number of drug and device trials that use cardiac MR parameters
as study end points will increase substantially in the future. Ultimately, however, patient outcome is the relevant clinical issue.
Recently, numerous studies have demonstrated the effectiveness of a segmented inversion-recovery gradient-echo sequence after the intravenous administration of gadolinium
contrast for detecting myocardial infarction (MI) and determining viability. This technique, termed delayed contrastenhanced MRI (DE-MRI), was first described fewer than 5
years ago,37 but there is already consideration that “DE-MRI
may well represent the new gold standard in the detection of
irreversibly damaged myocardium.”38
The results in the literature with DE-MRI should not be
grouped with the results with older MR techniques. A major
limitation of the initial techniques was insufficient image contrast between normal and infarcted myocardium. DE-MRI, on
the other hand, provides image intensity differences that are
10-fold greater.39 Suboptimal image quality was a major factor
in leading to the erroneous conclusion that chronic infarcts do
not hyperenhance and, conversely, the speculation that viable
myocytes could exhibit hyperenhancement.
There is a wealth of data in animal models of ischemic injury
that directly compares DE-MRI to histopathology.37,40,41 These
data demonstrate that DE-MRI can delineate between reversible
and irreversible myocardial injury independent of wall motion,
infarct age, or reperfusion status. Human studies demonstrate
that DE-MRI is effective in identifying the presence, location,
and extent of MI in both the acute and chronic settings.39,42
Additionally, DE-MRI provides scar-size measurements that are
closely correlated with positron emission tomography in patients
with ischemic cardiomyopathy,43,44 provides results superior to
single-photon emission computed tomography (SPECT) in patients with subendocardial infarctions,45 and can be used to
predict reversible myocardial dysfunction in those undergoing
revascularization procedures.44,46,47
A major advantage of DE-MRI is the high spatial resolution.
With a standard implementation, a group of 10 hyperenhanced
pixels (voxel, 1.9⫻1.4⫻6 mm) in a typical image would represent
an infarction of 0.16 g, or a region one thousandth of the left
ventricular myocardial mass.42 This level of resolution, more than
40-fold greater than SPECT, allows visualization of even microinfarcts that cannot be detected by other imaging techniques.48
Besides spatial resolution, DE-MRI is different from radionuclide imaging in that it provides direct visualization of both
nonviable and viable myocardium. For instance, rather than
simply identifying a region of acute infarction as nonviable
because of reduced tracer activity, DE-MRI can distinguish
between acute infarcts with necrotic myocytes and acute infarcts
with necrotic myocytes and damaged microvasculature. The
latter, termed the “no-reflow phenomenon,” indicates compromised tissue perfusion despite restoration of epicardial artery
patency. The incidence and extent of early no-reflow appears to
be associated with worse left ventricular remodeling and outcome. Although the initial MR studies of no-reflow used
single-shot perfusion sequences 1 to 2 minutes after contrast
injection,49 DE-MRI performed 5 to 10 minutes after contrast
Fuster and Kim
141
Figure 9. No-reflow phenomenon revealed by DE-MRI. Labels refer to time after administration of gadolinium contrast. Subendocardial
black zone surrounded by hyperenhancement corresponds to region of no-reflow (arrow) within acute infarction. This region can be distinguished from normal myocardium because it is encompassed in 3D space by hyperenhanced myocardium or left ventricular cavity
and by the fact that it slowly becomes hyperenhanced over time. Reprinted with permission from Kim et al.50
provides higher image quality and delineates regions with more
profound microvascular damage (Figure 9).50
The ability to simultaneously visualize nonviable and viable
myocardium provides additional advantages. For example, DEMRI can accurately assess ventricular remodeling after acute MI
at an early time point before measurements of ventricular
volumes, internal dimensions, and ventricular mass have
changed. This is possible because DE-MRI can assess serially,
concurrent directionally opposite changes such as resorption of
infarcted tissue and hypertrophy of viable myocardium.51
When only viable myocardium can be visualized, the percentage of viability in a given segment is assessed indirectly and
generally refers to the amount of viability in the segment
normalized to the segment with the maximum amount of
viability or to data from a gender-specific database of controls.
Conversely, when both viable and infarcted myocardium can be
visualized, the percentage of viability can be assessed directly
and expressed as the amount of viability in the segment normalized to the amount of viability plus infarction in the same
segment (Figure 10a). These differences in the way in which
viability is measured can alter clinical interpretation. Figure 10b
demonstrates MR images in a patient with chronic coronary
disease and an akinetic anterior wall. Although the anterior wall
is thinned, only a small subendocardial portion of the anterior
wall is infarcted. In this case, the indirect method would show
that the anterior wall is only 39% viable (compared with the
remote region), whereas the direct method would show that the
anterior wall is 70% viable. The indirect method would predict
no recovery of wall motion after revascularization, whereas the
direct method would predict recovery. The postrevascularization
images (bottom right of Figure 10b) demonstrate in this patient
that the direct method is correct.
The ability of DE-MRI to directly visualize the transmural
extent of infarction (and viability) has led to some recent
observations that appear to refute certain traditional concepts
regarding cardiac pathophysiology. For example, prior studies
indicate that in patients with coronary disease and ventricular
dysfunction, regions with thinned myocardium represent scar
tissue and cannot improve in contractile function after coronary
revascularization.52 The patient example in Figure 10, along with
data from an ongoing pilot study,53 however, suggest that
thinning should not be equated with the lack of viability and that
in some patients, these regions can improve after revascularization.54 Likewise, it is commonly assumed that a threshold
phenomenon exists between the transmural extent of infarction
and systolic wall thickening. This assumption is based on results
by Lieberman et al,55 who demonstrated in a dog model of acute
infarction that akinesia or dyskinesia is expected if infarction
involves ⱖ20% of the wall thickness. Evaluation by DE-MRI in
humans, however, suggests that a threshold phenomenon does
not exist.56,57 These data suggest that it is unwise to extrapolate
the results of Lieberman et al,55 who did not consider the effects
of stunning or ongoing ischemia, to humans with MI who may
not have residual stunning, ischemia, or hibernation. Additional
studies will be needed in these controversial topics.
Ischemia
There are a variety of MR techniques that can be used to
detect myocardial ischemia. Whereas coronary MRA can
provide detail concerning anatomy, stress testing with imaging of myocardial contraction or perfusion can provide
information concerning the presence and functional significance of coronary lesions. Dobutamine MR to detect ische-
Figure 10. a, Cartoon highlighting differences between direct
and indirect method of quantifying regional viability. Viable myocardium is black, and infarct is white. “Remote” zone represents
segment with maximum amount of viability. b, Long-axis MR
images of patient before and 2 months after revascularization.
Although akinetic anterior wall is “thinned” (diastolic wall thickness 5 mm; remote zone 9 mm), DE-MRI demonstrates that
there is only subendocardial infarction (1.5 mm thick). Direct
assessment of viability would show that anterior wall is predominately viable (3.5/5 mm⫽70% viable), whereas indirect method
would show that anterior wall is predominately nonviable
(3.5/9 mm⫽39% viable). Cine views after revascularization demonstrate recovery of wall motion and diastolic wall thickness. Fullmotion movies can be viewed in the online-only Data Supplement
(select Movie IV). Modified with permission from Kim et al.54
142
Circulation
July 5, 2005
mia-induced wall-motion abnormalities is an established
technique for the diagnosis of coronary disease. It yields
higher diagnostic accuracy than dobutamine echocardiography58 and can be effective in patients not suited for echocardiography because of poor acoustic windows.59 Since the
publication of these studies, MR image quality has improved
with the widespread availability of SSFP imaging. Parallel
imaging techniques that use spatial information from arrays
of radiofrequency detector coils to accelerate imaging are
expected to improve image quality further. Nonetheless,
logistic issues regarding patient safety and adequate monitoring are nontrivial matters that require thorough planning and
experienced personnel.
Currently, stress perfusion MR is less established for clinical
application. There are convincing data that correlate MR indexes
of perfusion with tissue perfusion in animal models60,61 and
excellent correlations with radionuclide imaging and invasive
x-ray angiography in humans.62– 64 However, the published data
so far do not demonstrate the feasibility of stress perfusion MR
for everyday clinical use. The current studies are limited in that
they were either retrospective (for patient enrollment and data
analysis), required central venous catheters, imaged only 1 to 2
slices per heartbeat, or excluded patients with diabetes. Additionally, most studies required extensive interactive postprocessing after data collection, which reduces the applicability of this
technique for routine clinical diagnosis.
Despite these limitations, we speculate that stress perfusion
MR will not only become a routine clinical procedure but also
the dominant stress MR modality in the future. Perfusion MR is
promising for a number of reasons. Decreased perfusion is the
first step in the ischemic cascade. Techniques that assess
perfusion have the potential to be more sensitive than techniques
that assess later steps. Regarding logistics, stress perfusion
imaging is quick and simple. For example, we perform adenosine stress imaging as follows. After cine imaging, the patient
table is pulled out partially to allow full access to the patient;
adenosine is then infused at 140 ␮g · kg⫺1 · min⫺1 for 2 minutes.
At this time, the perfusion sequence is applied, which automatically centers the patient back into the scanner and commences
image acquisition. Gadolinium contrast followed by a saline
flush is infused rapidly by a peripheral vein at this time as well.
On the console, real-time updates of myocardial perfusion
images are shown as the images are acquired. Once the gadolinium bolus has transited the left ventricular myocardium, the
adenosine is stopped, and imaging is completed. The patient
table then can be pulled back out of the scanner bore if
necessary. The total time of imaging for stress perfusion is 30 to
45 seconds, and the total time of adenosine infusion is ⬍3
minutes.
The pulse sequences used for stress perfusion imaging are
undergoing rapid evolution. SSFP and parallel imaging techniques continue to improve image quality. These improvements
are expected to allow quick visual interpretation of the perfusion
images for routine clinical diagnosis (Figure 11). Moreover,
there is no reason to interpret the stress perfusion images in
isolation. We expect that a multiprotocol approach with incorporation of cine and DE-MRI results with the perfusion findings
will not only provide a comprehensive cardiac evaluation but
also improve the accuracy of MR for the detection of coronary
Figure 11. Short-axis view of stress perfusion (a), rest perfusion
(b), function (c), and delayed enhancement (d) in patient with left
anterior descending coronary artery disease. Perfusion images
were acquired with saturation recovery gradient-echo sequence
with parallel imaging acceleration. Note large anteroseptal perfusion defect (arrow) is present only at stress. Wall motion and
delayed enhancement are normal. Full-motion movies can be
viewed in the online-only Data Supplement (select Movie V).
disease. On this point, it should be noted that perfusion imaging
is quite demanding in terms of scanner hardware. Images are
acquired in ⬇100 ms rather than built up over several cardiac
cycles, which is the case for conventional cine and DE-MRI
imaging. Thus, the signal-to-noise ratio is substantially lower for
perfusion imaging, and even with the latest improvements,
artifacts can obscure diagnosis. One of our current strategies to
improve the accuracy of MR for the detection of coronary
disease is to incorporate rest perfusion (performed 15 minutes
after stress perfusion) and DE-MRI findings with the stress
perfusion results in a proscribed manner. This algorithmic
approach (Figure 12) is based on the assumption that DE-MRI is
the most sensitive and specific MR technique for the detection of
MI and that hyperenhancement patterns on DE-MRI can be
accurately classified as ischemic or nonischemic.65,66 Conceptually, it then follows that perfusion defects that have similar
intensity and extent during both stress and rest (“fixed defect”)
but do not have hyperenhancement (no infarct) are artifactual
and should not be considered as caused by coronary disease.
This approach needs to be tested in large prospective clinical
trials. We anticipate that clinical MR examinations will become
increasingly comprehensive (eg, coronary MRA, cine imaging,
Figure 12. Flow chart for potential algorithm incorporating
stress and rest perfusion MR along with delayed enhancement
imaging (DE-MRI) for detection of coronary disease (CAD). *Positive DE-MRI study would be presence of hyperenhancement in
ischemic pattern.65,66
Fuster and Kim
stress and rest perfusion, and DE-MRI) in the near future. We
foresee that effort will be needed not only to improve the
imaging technology but to categorize and understand the discordant results that may occur among the different MR protocols for
a given patient.
Summary
Cardiovascular MR encompasses a variety of different techniques that provide a comprehensive evaluation of the range
of cardiovascular disorders. Atherothrombosis throughout the
vascular system can be directly imaged, quantified, and
characterized according to plaque components. By providing
information about vascular blood flow concurrent with vascular anatomy, the functional significance of stenotic lesions
can be determined. The morphology and function of the
cardiac system can be viewed in exquisite detail that rivals
any other imaging modality. Pathophysiological processes
such as MI and ischemia, stunning and hibernation, and
scarring and fibrosis can be identified easily using quick and
simple protocols. Published studies, however, describe a variety
of different pulse sequences and protocols for similar imaging
purposes and consist of relatively small numbers of patients. The
goals of future investigation will be to refine the technology,
establish standard protocols for image acquisition and interpretation, address the issue of cost-effectiveness, and validate a
range of clinical applications in large-scale clinical trials.
Acknowledgments
This work was supported in part by National Institutes of Health,
Specialized Center of Research HL54469 (Dr Fuster), NHLBI
RO1-HL61801 (Dr Fuster), and NHLBI R01-HL64726 (Dr Kim).
References
1. Fuster V, Badimon L, Badimon JJ, et al. The pathogenesis of coronary
artery disease and the acute coronary syndromes: parts 1 and 2. N Engl
J Med. 1992;326:242–250;310 –318.
2. Maseri A, Fuster V. Is there a vulnerable plaque? Circulation. 2003;107:
2068 –2071.
3. Aronow WS, Ahn C. Prevalence of coexistence of coronary artery
disease, peripheral arterial disease, and atherothrombotic brain infarction
in men and women ⬎ or ⫽ 62 years of age. Am J Cardiol. 1994;74:
64 – 65.
4. CAPRIE Steering Committee. A randomised, blinded, trial of clopidogrel
versus aspirin in patients at risk of ischaemic events (CAPRIE). Lancet.
1996;348:1329 –1339.
5. Stary HC. Natural history and histological classification of atherosclerotic
lesions: an update. Arterioscler Thromb Vasc Biol. 2000;20:1177–1178.
6. Virmani R, Kolodgie FD, Burke AP, et al. Lessons from sudden coronary
death: a comprehensive morphological classification scheme for atherosclerotic lesions. Arterioscler Thromb Vasc Biol. 2000;20:1262–1275.
7. Moreno PR, Purushothaman KR, Fuster V, et al. Intimomedial interface
damage and adventitial inflammation is increased beneath disrupted atherosclerosis in the aorta: implications for plaque vulnerability. Circulation. 2002;105:2504 –2511.
8. Kolodgie FD, Gold HK, Burke AP, et al. Intraplaque and progression of
coronary atheroma. N Engl J Med. 2003;349:2316 –2325.
9. Falk E, Shah PK, Fuster V. Coronary plaque disruption. Circulation.
1995;92:657– 671.
10. Fayad ZA, Fuster V. Clinical imaging of the high-risk or vulnerable
atherosclerotic plaque. Circ Res. 2001;89:305–316.
11. MacNeill ED, Lowe HC, Takano M, et al. Intravascular modalities for
detection of vulnerable plaque: current status. Arterioscler Thromb Vasc
Biol. 2003;23:1333–1342.
12. Fayad ZA, Fuster V, Nikolaou K, et al. Computed tomography and
magnetic resonance imaging for noninvasive coronary angiography and
plaque imaging: current and potential future concepts. Circulation. 2002;
106:2026 –2034.
143
13. Ruehm SG, Goyen M, Barkhausen J, et al. Rapid magnetic resonance
angiography for detection of atherosclerosis. Lancet. 2001;357:
1086 –1091.
14. Kim WY, Danias PG, Stuber M, et al. Coronary magnetic resonance
angiography for the detection of coronary stenoses. N Engl J Med.
2001;345:1863–1869.
15. Choudhury RP, Fuster V, Badimon JJ, et al. MRI and characterization of
atherosclerotic plaque: emerging applications and molecular imaging.
16. Yuan C, Mitsumori LM, Ferguson MS, et al. In vivo accuracy of multispectral magnetic resonance imaging for identifying lipid-rich necrotic
cores and intraplaque hemorrhage in advanced human carotid plaques.
Circulation. 2001;104:2051–2056.
17. Corti R, Fuster V, Fayad ZA, et al. Lipid lowering by simvastatin induces
regression of human atherosclerotic lesions: two years’ follow-up by
high-resolution noninvasive magnetic resonance imaging. Circulation.
2002;106:2884 –2887.
18. Zhao XQ, Yuan C, Hatsukami TS, et al. Effects of prolonged intensive
lipid-lowering therapy on the characteristics of carotid atherosclerotic
plaques in vivo by MRI: a case-control study. Arterioscler Thromb Vasc
Biol. 2001;21:1623–1629.
19. Yuan C, Zhang SH, Polissar NL, et al. Identification of fibrous cap
rupture with magnetic resonance imaging is highly associated with recent
transient ischemic attack or stroke. Circulation. 2002;105:181–185.
20. Fayad ZA, Nahar T, Fallon JT, et al. In vivo MR evaluation of atherosclerotic plaques in the human thoracic aorta: a comparison with TEE.
Circulation. 2000;101:2503–2509.
21. Jaffer FA, O’Donnell CJ, Larson MG, et al. Age and sex distribution of
subclinical aortic atherosclerosis: a magnetic resonance imaging examination of the Framingham Heart Study. Arterioscler Thromb Vasc Biol.
2002;22:849 – 854.
22. Coulden RA, Moss H, Graves MJ, et al. High resolution magnetic resonance imaging of atherosclerosis and the response to balloon angioplasty. Heart. 2000;83:188 –191.
23. Itskovich VV, Samber DD, Mani V, et al. Quantification of human
atherosclerotic plaques using spatially enhanced cluster analysis of
multicontrast-weighted magnetic resonance images. Magn Reson Med.
2004;52:515–523.
24. Worthley SG, Helft G, Fuster V, et al. Noninvasive in vivo magnetic
resonance imaging of experimental coronary artery lesions in a porcine
model. Circulation. 2000;101:2956 –2961.
25. Fayad ZA, Fuster V, Fallon JT, et al. Noninvasive in vivo human
coronary artery lumen and wall imaging using black-blood magnetic
resonance imaging. Circulation. 2000;102:506 –510.
26. Botnar RM, Stuber M, Kissinger KV, et al. Free-breathing 3D coronary
MRA: the impact of “isotropic” image resolution. J Magn Reson Imaging.
2000;11:389 –393.
27. Kim WY, Stuber M, Bornert P, et al. Three-dimensional black-blood
cardiac magnetic resonance coronary vessel wall imaging detects positive
arterial remodeling in patients with nonsignificant coronary artery
disease. Circulation. 2002;106:296 –299.
28. Jaffer FA, Weissleder R. Seeing within: molecular imaging of the cardiovascular system. Circ Res. 2004;94:433– 445.
29. Sirol M, Itskovich VV, Mani V, et al. Lipid-rich atherosclerotic plaques
detected by gadofluorine-enhanced in vivo magnetic resonance imaging.
Circulation. 2004;109:2890 –2896.
30. Wickline SA, Lanza GM. Nanotechnology for molecular imaging and
targeted therapy. Circulation. 2003;107:1092–1095.
31. Choudhury RP, Fuster V, Fayad ZA. Imaging atherosclerosis and
thrombosis in drug discovery. Nat Drug Develop. In press.
32. Rehwald WG, Chen EL, Kim RJ, et al. Noninvasive cineangiography by
magnetic resonance global coherent free precession. Nat Med. 2004;10:
545–549.
33. Hoffmann U, Globits S, Schima W, et al. Usefulness of magnetic resonance imaging of cardiac and paracardiac masses. Am J Cardiol. 2003;
92:890 – 895.
34. Semelka RC, Kelekis NL, Thomasson D, et al. HASTE MR imaging:
description of technique and preliminary results in the abdomen. J Magn
Reson Imaging. 1996;6:698 – 699.
35. Barkhausen J, Ruehm SG, Goyen M, et al. MR evaluation of ventricular
function: true fast imaging with steady-state precession versus fast
low-angle shot cine MR imaging: feasibility study. Radiology. 2001;219:
264 –269.
36. Grothues F, Smith GC, Moon JC, et al. Comparison of interstudy reproducibility of cardiovascular magnetic resonance with two-dimensional
144
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
Circulation
July 5, 2005
echocardiography in normal subjects and in patients with heart failure or
left ventricular hypertrophy. Am J Cardiol. 2002;90:29 –34.
Kim RJ, Fieno DS, Parrish TB, et al. Relationship of MRI delayed
contrast enhancement to irreversible injury, infarct age, and contractile
Shan K, Constantine G, Sivananthan M, et al. Role of cardiac magnetic
resonance imaging in the assessment of myocardial viability. Circulation.
2004;109:1328 –1334.
Simonetti OP, Kim RJ, Fieno DS, et al. An improved MR imaging
technique for the visualization of myocardial infarction. Radiology. 2001;
218:215–223.
Fieno DS, Kim RJ, Chen EL, et al. Contrast-enhanced magnetic resonance imaging of myocardium at risk: distinction between reversible and
irreversible injury throughout infarct healing. J Am Coll Cardiol. 2000;
36:1985–1991.
Rehwald WG, Fieno DS, Chen EL, et al. Myocardial magnetic resonance
imaging contrast agent concentrations after reversible and irreversible
ischemic injury. Circulation. 2002;105:224 –229.
Wu E, Judd RM, Vargas JD, et al. Visualisation of presence, location, and
transmural extent of healed Q- wave and non-Q-wave myocardial
infarction. Lancet. 2001;357:21–28.
Klein C, Nekolla SG, Bengel FM, et al. Assessment of myocardial
viability with contrast-enhanced magnetic resonance imaging: comparison with positron emission tomography. Circulation. 2002;105:
162–167.
Knuesel PR, Nanz D, Wyss C, et al. Characterization of dysfunctional
myocardium by positron emission tomography and magnetic resonance:
relation to functional outcome after revascularization. Circulation. 2003;
108:1095–1100.
Wagner A, Mahrholdt H, Holly TA, et al. Contrast-enhanced MRI and
routine single photon emission computed tomography (SPECT) perfusion
imaging for detection of subendocardial myocardial infarcts: an imaging
study. Lancet. 2003;361:374 –379.
Kim RJ, Wu E, Rafael A, et al. The use of contrast-enhanced magnetic
resonance imaging to identify reversible myocardial dysfunction. N Engl
J Med. 2000;343:1445–1453.
Choi KM, Kim RJ, Gubernikoff G, et al. Transmural extent of acute
myocardial infarction predicts long-term improvement in contractile
Ricciardi MJ, Wu E, Davidson CJ, et al. Visualization of discrete microinfarction after percutaneous coronary intervention associated with mild
creatine kinase-MB elevation. Circulation. 2001;103:2780 –2783.
Lima JA, Judd RM, Bazille A, et al. Regional heterogeneity of human
myocardial infarcts demonstrated by contrast-enhanced MRI; potential
mechanisms. Circulation. 1995;92:1117–1125.
Kim RJ, Choi KM, Judd RM. Assessment of myocardial viability by
contrast enhancement. In: Higgins CB, de Roos A, eds. Cardiovascular
MRI & MRA. Philadelphia, Pa: Lippincott Williams & Wilkins; 2003:
209 –237.
Fieno DS, Hillenbrand HB, Rehwald WG, et al. Infarct resorption, compensatory hypertrophy, and differing patterns of ventricular remodeling
following myocardial infarctions of varying size. J Am Coll Cardiol.
2004;43:2124 –2131.
Cwajg JM, Cwajg E, Nagueh SF, et al. End-diastolic wall thickness as a
predictor of recovery of function in myocardial hibernation: relation to
rest-redistribution T1-201 tomography and dobutamine stress echocardiography. J Am Coll Cardiol. 2000;35:1152–1161.
Shah DJ, Kim HW, Elliott M, et al. Contrast MRI predicts reverse
remodeling and contractile improvement in akinetic thinned myocardium.
Circulation. 2003;108(suppl IV):IV-697. Abstract.
Kim RJ, Shah DJ. Fundamental concepts in myocardial viability
assessment revisited: when knowing how much is “alive” is not enough.
Heart. 2004;90:137–140.
Lieberman AN, Weiss JL, Jugdutt BI, et al. Two-dimensional echocardiography and infarct size: relationship of regional wall motion and
thickening to the extent of myocardial infarction in the dog. Circulation.
1981;63:739 –746.
Mahrholdt H, Wagner A, Parker M, et al. Relationship of contractile
function to transmural extent of infarction in patients with chronic
coronary artery disease. J Am Coll Cardiol. 2003;42:505–512.
Nelson C, McCrohon J, Khafagi F, et al. Impact of scar thickness on the
assessment of viability using dobutamine echocardiography and thallium
single-photon emission computed tomography: a comparison with
contrast-enhanced magnetic resonance imaging. J Am Coll Cardiol. 2004;
43:1248 –1256.
58. Nagel E, Lehmkuhl HB, Bocksch W, et al. Noninvasive diagnosis of
ischemia-induced wall motion abnormalities with the use of high-dose
dobutamine stress MRI: comparison with dobutamine stress echocardiography. Circulation. 1999;99:763–770.
59. Hundley WG, Hamilton CA, Thomas MS, et al. Utility of fast cine
magnetic resonance imaging and display for the detection of myocardial
ischemia in patients not well suited for second harmonic stress echocardiography. Circulation. 1999;100:1697–1702.
60. Wilke N, Jerosch-Herold M, Wang Y, et al. Myocardial perfusion
reserve: assessment with multisection, quantitative, first-pass MR
imaging. Radiology. 1997;204:373–384.
61. Klocke FJ, Simonetti OP, Judd RM, et al. Limits of detection of regional
differences in vasodilated flow in viable myocardium by first-pass
magnetic resonance perfusion imaging. Circulation. 2001;104:
2412–2416.
62. Al-Saadi N, Nagel E, Gross M, et al. Noninvasive detection of myocardial
ischemia from perfusion reserve based on cardiovascular magnetic resonance. Circulation. 2000;101:1379 –1383.
63. Schwitter J, Nanz D, Kneifel S, et al. Assessment of myocardial perfusion
in coronary artery disease by magnetic resonance: a comparison with
positron emission tomography and coronary angiography. Circulation.
2001;103:2230 –2235.
64. Nagel E, Klein C, Paetsch I, et al. Magnetic resonance perfusion measurements for the noninvasive detection of coronary artery disease. Circulation. 2003;108:432– 437.
65. McCrohon JA, Moon JC, Prasad SK, et al. Differentiation of heart failure
related to dilated cardiomyopathy and coronary artery disease using
gadolinium-enhanced cardiovascular magnetic resonance. Circulation.
2003;108:54 –59.
66. Kim RJ, Judd RM. Gadolinium-enhanced magnetic resonance imaging in
hypertrophic cardiomyopathy: in vivo imaging of the pathologic substrate
for premature cardiac death? J Am Coll Cardiol. 2003;41:1568 –1572.
67. Regenfus M, Ropers D, Achenbach S, et al. Diagnostic value of
maximum intensity projections versus source images for assessment of
contrast-enhanced three-dimensional breath-hold magnetic resonance
coronary angiography. Invest Radiol. 2003;38:200 –206.
68. Plein S, Jones TR, Ridgway JP, Sivananthan MU. Three-dimensional
coronary MR angiography performed with subject-specific cardiac acquisition windows and motion-adapted respiratory gating. AJR Am J
Roentgenol. 2003;180:505–512.
69. Watanabe Y, Nagayama M, Amoh Y, et al. High-resolution selective
three-dimensional magnetic resonance coronary angiography with
navigator-echo technique: segment-by-segment evaluation of coronary
artery stenosis. J Magn Reson Imaging. 2002;16:238 –245.
70. Kim WY, Danias PG, Stuber M, et al. Coronary magnetic resonance
angiography for the detection of coronary stenoses. N Engl J Med.
2001;345:1863–1869.
71. Nikolaou K, Huber A, Knez A, et al. Navigator echo-based respiratory
gating for three-dimensional MR coronary angiography: reduction of scan
time using a slice interpolation technique. J Comput Assist Tomogr.
2001;25:378 –387.
72. Ropers D, Baum U, Pohle K, et al. Detection of coronary artery stenoses
with thin-slice multi-detector row spiral computed tomography and multiplanar reconstruction. Circulation. 2003;107:664 – 666.
73. Nieman K, Cademartiri F, Lemos PA, et al. Reliable noninvasive
coronary angiography with fast submillimeter multislice spiral computed
tomography. Circulation. 2002;106:2051–2054.
74. Knez A, Becker CR, Leber A, et al. Usefulness of multislice spiral
computed tomography angiography for determination of coronary artery
stenoses. Am J Cardiol. 2001;88:1191–1194.
75. Nieman K, Oudkerk M, Rensing BJ, et al. Coronary angiography with
multi-slice computed tomography. Lancet. 2001;357:599 – 603.
76. Achenbach S, Giesler T, Ropers D, et al. Detection of coronary artery
stenoses by contrast-enhanced, retrospectively electrocardiographicallygated, multislice spiral computed tomography. Circulation. 2001;103:
2535–2538.
77. Kuettner A, Kopp AF, Schroeder S, et al. Diagnostic accuracy of multidetector computed tomography coronary angiography in patients with
angiographically proven coronary artery disease. J Am Coll Cardiol.
2004;43:831– 839.
KEY WORDS: magnetic resonance imaging 䡲 atherosclerosis
infarction 䡲 coronary disease 䡲 vasculature
䡲
myocardial
Special Report
A Vision for the Future
Opportunities and Challenges
Notes From the Director of the National Heart, Lung, and Blood Institute
Elizabeth G. Nabel, MD
I
t is a pleasure and a privilege to address the readership of
Circulation in my new capacity as Director of the National
Heart, Lung, and Blood Institute (NHLBI). Our Institute has
a long and distinguished record of scientific progress in
cardiovascular, lung, and blood diseases and sleep disorders,
and the present transition affords an opportunity for reflection
and critical assessment of our future directions. In this first
edition of what I hope will be many “Notes From the
Director,” I want to share my vision for the Institute. This
vision is based on a fundamental set of values— excellence,
innovation, integrity, respect, and compassion—that will
permeate all activities of the NHLBI. I believe that scientific
discovery provides the basis for progress and that the NHLBI
is uniquely positioned to catalyze changes that must be made
to transform our new scientific knowledge into tangible
improvements in health. Within this framework, let me
outline some priorities for the coming years—priorities that
will, of course, undergo reevaluation and reformulation as we
seek the input of our grantees, constituents, and advisors.
in heart, lung, blood, and sleep diseases and that give these
creative scientists the intellectual freedom to pursue their
ideas and follow them in unexpected or serendipitous directions. By bringing unconventional perspectives and originality to bear on key research questions, awardees may develop
seminal theories or technologies that will propel fields forward and facilitate the translation of discovery into treatments
to improve human health.
The Institute also will pursue funding approaches that
make it easier for scientists to conduct interdisciplinary
research. For instance, the National Institutes of Health (NIH)
is considering granting principal investigator status not just to
a single investigator, as is the norm, but to all key members
of a research team. Integrated reviews of NHLBI-solicited
programs would take into account the melding of various
disciplines to address the problem at hand and provide
encouragement for interdisciplinary teams to evolve in both
directed and unexpected ways.
The NHLBI Division of Intramural Research is a special
program that has the resources to conduct bold, innovative,
distinctive basic and clinical research. The Division is well
positioned to take on high-risk, cutting-edge projects that
complement work performed in the extramural community,
and we are committed to maintaining and nurturing this
extraordinary scientific resource.
Basic Research
Basic research provides the foundation of the NHLBI portfolio and has been one of its great strengths. The typical
model of investigation—research conducted by single investigators or small groups of investigators on projects of their
own inspiration—accounts for most of the unanticipated and
major scientific discoveries in this country. I believe strongly
that we must protect and nurture investigator-initiated research. The NHLBI will continue to invest in the most
talented scientists conducting the highest-caliber research.
In addition to renewed support of investigator-initiated
research, the NHLBI must exert national leadership in capturing research opportunities, taking risks, and developing an
innovative and distinctive research portfolio that is science
driven. We intend to make the most of exciting and unprecedented opportunities to support emerging scientific fields.
One approach is to develop funding mechanisms (eg, for
support of high-risk research) that encourage innovative
thinkers to turn their attention to the major current challenges
Clinical Investigations, Trials, and Networks
Clinical research is critical if we are to translate basic
discoveries into the reality of better health. Such work is often
time consuming and inefficient, however, and is increasingly
burdened by regulatory requirements. Our challenge is to
expand clinical research to complement the exciting basic
science discoveries, while making it more efficient and
cost-effective.
We intend to develop a translational research agenda
supported by clinical trials, clinical networks, and clinical
workforce training. Clinical trials must be driven by science
and designed to foster evidence-based decision-making in
clinical practice. Key components should focus on increasing
From the National Heart, Lung, and Blood Institute, Bethesda, Md.
Correspondence to Elizabeth G. Nabel, MD, Director, National Heart, Lung, and Blood Institute, National Institutes of Health, Bldg 10/8C103, 10
Center Dr, Bethesda, MD 20892. E-mail [email protected]
This article has been copublished in the July 1, 2005, issue of SLEEP and will be copublished in the July 15, 2005, issue of Blood and the August 1,
2005, issue of the Journal of Respiratory and Critical Care Medicine.
(Circulation 2005;112:145-146.)
145
146
Circulation
July 5, 2005
interactions between basic and clinical investigators and
easing the movement of new tools from the laboratory to the
clinic. An infrastructure that comprises core facilities to
provide clinical researchers access to sophisticated manufacturing capacity, along with expert advice to ensure that drug
development regulations are observed, could expedite the
translational process.
The NHLBI has a rich history of developing and supporting clinical research networks, and we plan to build on this
strength to develop new partnerships among organized patient communities, community-based physicians, and academic researchers. Integrated clinical networks of academic
health centers that include community practices will enhance
our ability to conduct clinical trials. Such efforts also will
require improved bioinformatics and clinical databases, better
standards for clinical research protocols, and cooperation
between patient advocacy groups and the NHLBI. Thought
also must be given to the development of metrics to improve
the ascertainment of clinical outcomes as well as quality
assessment. This research will require the tools and expertise
of many fields, including those focused on health education,
outcomes, healthcare delivery, and healthcare economics.
The NHLBI also must cultivate clinical researchers who have
skills commensurate with the complexity and needs of our
research enterprise. Clinicians must be trained to work in
interdisciplinary, team-oriented environments and must possess
skills in an array of relevant disciplines, including genetics,
epidemiology, biostatistics, and behavioral medicine.
Training, Mentoring, and Education
We intend to conduct a careful review of NHLBI training
programs with an eye toward improving their ability to equip
emerging scientists with the knowledge and skills needed for
success in an ever-changing and complex research environment. During these times of tight budgets, we will focus on
helping our new investigators make the transition from
fellowships to independent faculty positions (for instance, by
designing portable mentored awards that provide more flexibility and control in pursuing their research interests). I
believe strongly that skills-development programs should be
included in all program projects, specialized centers of
research, and other large multicomponent grants. Opportunities to develop research interests and skills should be made
available to students at all levels, beginning with high school,
and should focus special attention on underrepresented
groups, such as racial and ethnic minorities and individuals
from disadvantaged backgrounds.
Health Disparities
Disparities in health status constitute a significant global issue
and a long-standing concern of the NHLBI. Research is essential
to understand the contributions of genetics, health behavior, diet,
socioeconomic status, culture, and environmental exposures to
health disparities of relevance to the NHLBI and to formulate,
evaluate, and disseminate intervention programs. This work will
necessarily entail a vigorous effort to increase the representation
of minorities in the ranks of NHLBI researchers. A full resolution of the health disparities problem will only occur through
committed and sustained efforts by many in our government,
health centers, and society.
Outreach and Communication
Our mission extends beyond research alone; we have an obligation to translate our research findings into education and
dissemination programs, particularly to address the health needs
of at-risk populations in underserved communities. We will
continue to work collaboratively with our federal colleagues,
including the Centers for Disease Control and Prevention (CDC)
and Health Resources and Services Administration (HRSA), to
support prevention and treatment programs. In addition, we have
an unprecedented opportunity to work with the relevant professional organizations that have a large stake in developing and
implementing practice guidelines and monitoring their effectiveness, and with patient advocacy groups. Education of our
patients and the public at large regarding prevention and treatment of heart, lung, blood, and sleep disorders must be one of
our highest priorities.
Rates of cardiovascular disease, asthma, chronic obstructive
pulmonary disease, and blood-borne diseases are rising worldwide, and I am committed to our involvement in global health
issues. We will take this opportunity to review the NHLBI
portfolio in international programs in light of changing global
demographics and to establish priorities and goals for these
programs so that Institute resources are used most effectively.
As co-chair (with Dr Allen Spiegel, Director of the
National Institute of Diabetes and Digestive and Kidney
Diseases) of the NIH Obesity Research Task Force, I am
working to enhance obesity research and education across the
NIH. My vision is to bring to the Task Force an emphasis on
basic research into the mechanisms of obesity-induced cardiovascular and pulmonary disease development and progression; on clinical investigations of cardiovascular, pulmonary,
and sleep complications of obesity; and on education programs to prevent onset and progression of obesity, especially
among our youth. Our NIH efforts will be coordinated with
the Department of Health and Human Services, other federal
agencies, professional societies, and consumer groups to
achieve synergy in our efforts. I am fortunate, indeed, to be
able to draw on the many productive experiences of the
NHLBI in the field of obesity, as well as the Institute’s
proven models for outreach and education, to share successful
approaches that might be applied at the NIH level.
The Challenge
In summary, I foresee an array of opportunities to build and
diversify the strengths of the NHLBI. Our challenge is to take
the Institute to the next level of excellence. The realization of
this vision will require the advice, wisdom, and efforts of
many. I look forward to working with you to achieve these
goals. We are engaged in a special form of public service—
that is, the promotion of patient and public health. Be assured
that I will work diligently to preserve public trust in our
Institute, the NIH, and the biomedical research enterprise, and
to ensure that the NHLBI serves the public with the highest
level of integrity. I hope you will join me in this exciting
venture.
Detection of Luminal-Intimal Border and Coronary Wall
Enhancement in Intravascular Ultrasound Imaging After
Injection of Microbubbles and Simultaneous Sonication
With Transthoracic Echocardiography
Manolis Vavuranakis, MD, FESC; Ioannis A. Kakadiaris, PhD; Sean M. O’Malley, BS;
Christodoulos Stefanadis, MD, FESC; Sophia Vaina, MD; Maria Drakopoulou, MD;
Ioannis Mitropoulos, MD; Stephane Carlier, MD, PhD; Morteza Naghavi, MD
A
61-year-old man presented with unstable angina (Braunwald class 2B). Coronary angiography revealed a mild
lesion on the very proximal segment of the left anterior
descending coronary artery (LAD) and a significant stenosis
(80%) in the mid-segment. Intracoronary ultrasound was used
to further evaluate proximal coronary artery stenosis. It was
found to be a soft plaque without significant luminal stenosis
but without clear definition of the luminal-intimal boundary.
Intravenous injection of gas-filled microbubble ultrasound
contrast agents have been used for endocardial border detection, especially when they are sonicated by acoustic power
and produce harmonics. We performed continuous intracoronary ultrasound recordings (EndoSonics; 20 MHz) in the
proximal left anterior descending coronary artery before
(Figure 1, A), during (Figure 1, B) and after injection (Figure
1, C) of 4 mL of SonoVue (ultrasound contrast agent with
lyophilized capsule filled with sulfurhexafluoride). Simultaneously with contrast injection, ultrasound acoustic power
of 0.6 mechanical index was delivered via a transthoracic
transducer (2.5 MHz) toward the left main to sonicate the
delivered microbubbles. Immediately after the passage of the
microbubble contrast agent, which was clearly detected by the
intracoronary ultrasound probe, an enhancement of the entire
plaque and adventitia was seen. The luminal-intimal
boundary appeared to show a ring-like enhancement,
which clearly defined the inner borders of the coronary
arterial wall (Figure 2). The precise mechanism of this
observation is not clearly defined, although the adhesion of
microbubbles to inflamed endothelial cells was reported
previously. Sonication of the microbubbles by the external
acoustic energy may facilitate adherence to endothelium
for a short time, and then may be washed out by the
forthcoming blood. Acute coronary syndromes are the result of
plaque rupture or endothelial erosion in the majority of cases.
Therefore, techniques that can help define the integrity of the
luminal-intimal border and intraplaque leakage of blood through
the vasa vasorum or plaque cap could be of major importance for
detecting vulnerable plaque and understanding the pathophysiology of acute coronary syndromes.
Disclosure
Dr Naghavi is a share-holder in and consultant to Volcano Corporation and Endothelix Inc and is a scientific advisor to Pfizer Inc.
From Department of Cardiology, University of Athens, Hippokration Hospital, Athens, Greece (M.V., C.S., S.V., M.D., I.M.); Department of Computer
Science, University of Houston, Houston, Tex (I.A.K., S.M.O.); Intravascular Imaging & Physiology, Cardiovascular Research Foundation, New York,
NY (S.C.); and Association for Eradication of Heart Attack, Houston, Tex (M.N.).
Correspondence to Manolis Vavuranakis, MD, for the Ultimate IVUS at University of Houston Collaborative Project, Haimanda 24-26, Marousi 15122,
Greece. E-mail [email protected]
(Circulation. 2005;112;e1-e2.)
e1
e2
Circulation
July 5, 2005
Figure 1. A, Baseline IVUS image of a non–flow-limiting plaque (35%)
in the proximal LAD. Arrows indicate areas where the luminal-intimal
border is not clearly defined. B, Detection of gas-filled microbubble
ultrasound contrast agent passage around the intracoronary ultrasound catheter at the imaging site. C, Significant changes in the signal
intensity of the entire plaque area, including the adventitia, are
observed. Note the luminal-intimal interface ring, indicating an echoreflectant halo by microbubbles.
Figure 2. Differential IVUS images showing the subtracted
postinjection signals from baseline signals. A, Black and white
(signal intensity of Figure 1A⫺Figure 1C); B, color-coded panel
A; C, thresholded to show most significant areas of
enhancement.
Detection of Carotid Atherosclerotic Plaque Ulceration,
Calcification, and Thrombosis by Multicontrast Weighted
Magnetic Resonance Imaging
Baocheng Chu, MD, PhD; Marina S. Ferguson, MT; Hunter Underhill, MD;
Norihide Takaya, MD, PhD; Jianming Cai, MD, PhD; Michel Kliot, MD;
Chun Yuan, PhD; Thomas S. Hatsukami, MD
A
62-year-old man presented to the emergency department
with a chief complaint of severe headache and decreased
vision in his left eye. Initial physical examination demonstrated
a new-onset left homonymous hemianopsia, which warranted a
stroke workup. The patient’s head CT was significant for a
2.3⫻3.7-cm acute hemorrhage in the right posterior parietal and
occipital lobes. Conventional angiography was performed and
interpreted as ⬎90% stenosis of both internal carotid arteries
without ulceration. The remainder of the work-up, including
echocardiogram, was negative. An ensuing carotid magnetic
resonance examination with a phased-array carotid coil and
high-resolution (0.3⫻0.3 mm pixel size) multicontrast weighted
sequences confirmed the stenosis and demonstrated ulceration
and calcification in both carotids and mural thrombus formation
in the left carotid (Figures 1 and 2). After completely recovering
from the stroke, the patient underwent staged bilateral carotid
endarterectomy. Histological examination of the specimens confirmed the MRI findings of bilateral ulceration and left mural
thrombus formation (Figure 3).
Disclosure
Dr Kliot is cofounder of a company, UltraImage Corp, which is now
part of Pathway Medical Technologies and develops and makes MRI
phase-array coils similar to those used in this article.
Figure 1. 3-D time-of-flight (TOF) image
shows a surface ulcer (long arrow) in the
distal right common carotid artery.
Black-blood, fast-spin echo, T1-weighted
(T1W), postcontrast-enhanced T1W
(T1W-CE), proton density weighted
(PDW), and T2-weighted (T2W) images
confirm surface discontinuity. The
hypointense areas on all 4 weightings
correspond to calcifications (short
arrows).
From the Departments of Radiology (B.C., M.S.F., H.U., N.T., J.C., C.Y.) and Surgery (M.K., T.S.H.), University of Washington, Seattle, and VA
Puget Sound Health Care System (T.S.H.), Seattle, Wash.
Correspondence to Baocheng Chu, MD, PhD, Department of Radiology, Box 357115, University of Washington, 1959 NE Pacific St, Seattle, WA
98195. E-mail [email protected]
(Circulation. 2005;112;e3-e4.)
e3
e4
Circulation
July 5, 2005
Figure 2. All weightings of the left
carotid artery show a distinct ulcer (long
arrows) and a small calcification (short
arrows). The striking hyperintensity on
the ulcer surface in the T2-weighted
(T2W) image indicates the presence of a
mural thrombus. Focal contrast enhancement on postcontrast-enhanced T1W
(T1W-CE) indicates vasculature at the
base of the thrombus.
Figure 3. H&E stain of right and left
carotid endarterectomy specimens. The
right plaque contained extensive calcifications and fibrosis. A well-defined penetrating ulcer extends 4 mm from the
lumen surface through a fibrotic matrix.
A penetrating ulcer with mural thrombus
formation is seen in the left carotid endarterectomy specimen. Asterisks are
placed in the lumen of the common and
the internal arteries of both carotids.
Location indicators are millimeter distance to the bifurcation. ⫹ indicates
locations in the internal carotid artery; –,
locations in the common carotid artery.
Primary Lymphoma of the Heart
Jeffrey Kuvin, MD; Nisha Parikh, MD; Robert Salomon, MD; Arthur Tischler, MD; Philip Daoust, MD;
Yevgeniy Arshanskiy, MD; Karl Coyner, MD; Philip Carpino, PA; Natesa G. Pandian; Carey Kimmelstiel, MD;
Caroline Foote, MD; John Erban, MD; Hassan Rastegar, MD
A
previously healthy 65-year-old woman presented with
palpitations and positional chest discomfort 3 weeks
after she sustained chest wall trauma in a motor vehicle
accident. Physical examination revealed occasional premature ventricular beats and low-grade fever. Her erythrocyte
sedimentation rate was elevated (66 mm/h). Transthoracic
and transesophageal echocardiography revealed a 3⫻3-cm,
well-demarcated, homogeneous, round mass moving with the
heart adjacent to the right atrium (Figures 1A, B). There was
invagination of nearby cardiac chambers but no obstruction to
right heart filling. MRI showed a circumscribed mass with
dense tissue characterization (isointense to myocardium) not
consistent with blood or fat (Figure 2A). There was minimal
enhancement of the mass after gadolinium injection. Coronary angiography was normal. Two weeks later, the patient’s
symptoms improved. Repeat transthoracic echocardiogram
showed no change in size or consistency of the mass. A
PET/CT (combined positron emission tomography and computed tomography) scan after administration of F-18 fluorodeoxyglucose (FDG) revealed focal intense activity adjacent
to the right heart (Figure 2B), which correlated with a cardiac
wall mass on the CT images. The distribution of F-18 FDG in
whole-body imaging was otherwise unremarkable, and no
additional abnormal masses were identified.
The patient underwent surgery. The pericardium was thin,
with a small amount of cloudy pericardial fluid. A round, firm
mass was detected, originating from the atrioventricular groove,
attaching to the right atrium and free wall of the right ventricle,
and encasing the right coronary artery (Figure 3A). The mass
was excised without removing any portion of right atrium or
ventricle. The right coronary artery was preserved by peeling the
tumor from the vessel after the mass was divided into 2 halves
(Figure 3B). Immunophenotyping by flow cytometry and tissue
staining demonstrated that the malignant cells were positive for
CD45, CD19, and CD20, and were negative for surface immunoglobulin. These findings were diagnostic of a diffuse large
B-cell lymphoma (Figure 4). The pericardial fluid also showed
evidence of lymphoma. A bone marrow biopsy obtained from
the sternum at time of resection revealed benign lymphoid
nodules and a mediastinal node adjacent to the pericardium was
negative for lymphoma. The patient made an uneventful recovery from surgery, received systemic chemotherapy, and 1 year
later remains in complete remission.
Figure 1. A, Transthoracic echocardiogram, apical 4-chamber view. Round
mass adjacent to right heart (arrow) with
invagination of right atrial wall and right
ventricular inflow. B, Transesophageal
echocardiogram: Well-demarcated mass
(arrow) adjacent to the right atrium (RA).
A linear structure with color Doppler flow
(dashed arrow) is noted within the mass.
From the Departments of Medicine (J.K., N.P., C.K., N.G.P., C.F., J.E.), Pathology (R.S., A.T., P.D.), Radiology (Y.A.), and Surgery (P.C., H.R.),
Tufts-New England Medical Center, Tufts University School of Medicine, Boston, Mass; and the Department of Radiology (K.C.), Brigham and Women’s
Hospital, Harvard Medical School, Boston, Mass.
Correspondence to Jeffrey Kuvin, MD, Division of Cardiology, Department of Medicine, Tufts-New England Medical Center, 750 Washington St, Box
315, Boston, MA 02111. E-mail [email protected]
(Circulation. 2005;112:e5-e6.)
e5
e6
Circulation
July 5, 2005
Figure 2. A, MRI, coronal multislice single shot. Round mass in the region of
the right atrioventricular groove (arrow),
isointense to the myocardium. B, F-18
FDG PET imaging, coronal view. Intense
focal FDG activity (arrow) adjacent to the
right atrium correlates with the round
mass shown on the accompanying MRI
image.
Figure 4. Microscopic pathology (hematoxylin-eosin stain, original magnification ⫻300) reveals packed sheets of large cells
with round, lobulated nuclear contours, fine punctate chromatin,
and distinct nucleoli. Frequent apoptotic cells, moderate number
of mitoses, and areas of coagulation necrosis were present (not
all represented in this image). Immunostaining for CD20 (insert)
demonstrates a large B-cell lymphoma.
Figure 3. A, Intraoperative photograph of the well-circumscribed
epicardial mass adherent to the right heart (arrow), enveloping
the right coronary artery (dashed arrow). This vessel corresponds to the color Doppler signal noted on echocardiography
in Figure 1B. B, Excised lesion (cut into halves) shows a smooth
outer surface; the inner surface is indented (arrows) from passage of the right coronary artery.
Book Review
examination including coronary imaging, is more demanding at
the image-acquisition stage.
The book then covers coronary imaging, beginning with
normal coronary anatomy (Chapter 3) and a review of the
histological basis of coronary disease with illustrations by CT
(Chapter 4). Chapters 5 through 12 progress through topics
systematically including stenosis/occlusion, plaque imaging,
stent patency and collateral flow assessment, imaging of coronary anomalies, and bypass-graft imaging. There is also a chapter
that reviews the data relevant to coronary calcification (Chapter
7) and the Agatston calcium scoring algorithm. Although a
calcium score can be obtained with multidetector CT, typically,
an electron-beam CT system (EBCT) is used for this test.
Noncoronary applications of CT, including evaluation of cardiac
masses and imaging of the great vessels, are discussed in
Chapters 13 to 16. There is an invaluable review of artifacts and
their manifestations (Chapter 18), beautifully illustrated in sharp,
clear examples. Chapter 19, which reviews the timing techniques
during the iodinated contrast bolus, seems better placed at the
beginning of the book because it reviews the technical aspects of
image acquisition. The text concludes with a brief discussion of
left ventricular function assessment and presents the editors’
perspective on the future of coronary CT, including a few
64-slice studies.
The straightforward explanations of potentially complex concepts and striking illustrations of volume-rendered and multiplanar reconstructed images, nearly always presented with the
correlative gold standard, x-ray angiography, make this an
excellent foundation book. Furthermore, the crisp cartoon-like
illustrations reiterate points made in the accompanying text and
reinforce the concepts.
Multidetector CT technology has rapidly evolved during the
past 4 years from 4- to 8- to 16- and now 64-slice devices, each
capable of imaging the coronary arteries in less time. The
majority of examples in this book, and in the literature, are taken
with 16-slice systems. Although individual institutions with
access to the newest systems (including the editors of this text)
have reported high sensitivities/specificities as compared with
cardiac catheterization for the detection of significant coronary
stenoses, the rapid pace of change has not permitted large-scale,
multicenter demonstrations of efficacy. In spite of the potential
for CT to be used as a screening tool for low- to intermediate-risk
patients, nearly all of the published studies have examined
patients with a high clinical suspicion of coronary artery disease.
Data from an intermediate-risk population for which CT may be
most beneficial have yet to be reported. The editors do include a
chapter entitled “The Emergency Department” (Chapter 14),
which seems to suggest that coronary CT has a role in the
evaluation of patients with chest pain in the emergency department; however, the chapter reviews the data supporting stratification of risk based on CT-determined calcium score and not
angiography. CT angiography may prove useful in this setting
and the high negative predictive value (⬎97%) reported with
16-slice devices does suggest that CT may be good at screening.
The text presents CT angiography as a safe procedure with
minimal risk as compared with x-ray angiography, and in the
acute setting, this is undoubtedly true; however, a risk– benefit
analysis must also include consideration of radiation exposure
because with 16- and 64-slice CT, the dose may be at least 4-fold
greater than diagnostic x-ray angiography. The long-term risk
Computed Tomography of the Coronary Arteries
Pim J. de Feyter, MD, PhD, and Gabriel P. Krestin, MD,
PhD, eds.
208 pp. London, UK: Taylor & Francis; 2005. $85.00.
ISBN 1-84184-439-X
Nearly 5 decades have passed since F. Mason Sones, MD,
performed the first coronary angiogram. Despite transformative
advances in the treatment of coronary atherosclerosis, this
traditional procedure remains the foundation on which state-ofthe-art diagnosis and management rests. Noninvasive imaging
modalities such as scintigraphy and echocardiography have
contributed immeasurably to the care of the patient with coronary
disease, but these techniques only indirectly determine coronary
patency. During the past few years, imaging methods that
approach the accuracy of x-ray angiography have become increasingly available with the advent of the latest generation of
MRI and multidetector/multislice CT scanners.
Although these 2 modalities use a common vocabulary,
considerably more attention has been focused recently on CT,
primarily because of its strikingly clear image quality. Not to be
overlooked are the economic implications of CT in terms of
reimbursement and control of technology. The arrival of coronary CT has opened a new front in the seemingly perpetual to
and fro between the cardiology and radiology camps, with battles
now being fought at the state and national regulatory levels.
Coverage of coronary CT in the lay press and aggressive
marketing of CT imaging technology to cardiologists and patients only serves to increase tension. A recently posted animated
advertisement on The New York Times web site beckons patients
to “ask their doctor” about the latest-generation CT scanners that
can scan the heart in 8 to 10 seconds and provide an instant
diagnosis. Widespread awareness necessitates that the general
cardiologist familiarize him- or herself with this new imaging
language. In fact, it is now necessary to understand the fundamentals of MRI and CT imaging to critically review the
contemporary literature.
It is in this context that Drs de Feyter and Krestin have crafted
an exquisitely illustrated and clearly written text entitled Computed Tomography of the Coronary Arteries. This is neither a
technical manual nor an exhaustive reference text, but rather a
concise overview of CT technique for the general cardiologist or
non–CT-educated specialist in cardiac imaging. The text reflects
the collaboration between a radiologist (Dr Krestin) and cardiologist (Dr de Feyter) from Erasmus Medical Center, Rotterdam,
The Netherlands, and is representative of the importance of
collaboration across specialties. Well aware of the turf wars this
technology has incited, the editors note in the preface that this
book would not have been written “without the faithful and
friendly cooperation between cardiologists and radiologists in
our institution.”
The book is organized as a comprehensive introductory text,
with 20 concise chapters. The first 2 chapters cover the basic
principles of CT imaging and specific relevant aspects of image
processing. There is less emphasis on CT technique and more on
image interpretation. This is appropriate, for in practice, CT
technology has advanced to a degree that the acquisition of data
is largely automated. In contrast, cardiovascular MRI (CMR),
which has the potential to provide a comprehensive functional
(Circulation. 2005;112:e7-e8.)
e7
e8
Book Review
associated with this level of exposure, perhaps multiplied by
repeats scans, is undefined.
That being said, noninvasive coronary imaging by CT is likely
here to stay. Its importance to the future of cardiology is
evidenced by the preparation of Core Cardiology Training
Symposium (COCATS) guidelines to specify fundamental and
advanced training requirements in cardiology fellowship programs. Whoever ultimately reads CT scans, and this reviewer
strongly advocates a cooperative model as put forth in Computed
Tomography of the Coronary Arteries, interpretation of the scan
results in the context of the patient’s overall clinical presentation
will be essential. The general cardiologist will need to integrate
imaging information with functional stress testing. Interestingly,
interventional cardiologists may receive more referrals for pre-
viously unrecognized and clinically silent stenoses. Although we
are potentially nearing a time when a patient’s coronary anatomy
can be defined in ⬍10 seconds, we as cardiologists will need to
understand the applications and limitations of CT techniques.
Computed Tomography of the Coronary Arteries is a concise and
easy-to-follow overview of the relevant concepts of CT coronary
angiography. The authors and editors should be commended for
producing this exceptional introduction to a complex yet promising technique.
Frederick L. Ruberg, MD
Section of Cardiology
Boston University School of Medicine
Boston, Mass
Correspondence
Letter Regarding Article by McNair et al, “SCN5A
Mutation Associated With Dilated Cardiomyopathy,
Conduction Disorder, and Arrhythmia”
2. Groenewegen WA, Firouzi M, Bezzina CR, Vliex S, van Langen IM,
Sandkuijl L, Smits JP, Hulsbeek M, Rook MB, Jongsma HJ, Wilde
AA. A cardiac sodium channel mutation cosegregates with a rare
connexin40 genotype in familial atrial standstill. Circ Res. 2003;92:
14 –22.
3. Bezzina CR, Rook MB, Groenewegen WA, Herfst LJ, van der Wal
AC, Lam J, Jongsma HJ, Wilde AA, Mannens MM. Compound heterozygosity for mutations (W156X and R225W) in SCN5A associated
with severe cardiac conduction disturbances and degenerative changes
in the conduction system. Circ Res. 2003;92:159 –168.
To the Editor:
In their article on the SCN5A mutation D1275N, McNair et al1
claim that the mutation is the primary cause of a familial form of
dilated cardiomyopathy (DCM) with conduction disorder and supraventricular arrhythmias. Although DCM has been reported with
both SCN5A and other ion channel mutations, McNair et al claim
their family is remarkable because “there is a strong correlation
between the penetrance of a conduction disorder and the manifestation of dilation.”
A close look at their data reveals that ventricular dysfunction (shortening fraction ⬍28%) is primarily present in the
older members of the family, 4 of 5 also with atrial fibrillation. In only one of these individuals is the ventricular
dimension given, and this dimension is within normal limits.
In our article on the same SCN5A mutation in a family with
atrial standstill2 (co-inherited with polymorphisms in the
atrial-specific gap junction channel protein Connexin40), only
one atrial standstill patient showed left atrial enlargement and
none had DCM.
On the basis of the data provided, there is no doubt that the
conduction disorders, the various atrial arrhythmias, and the
associated (bi-) atrial dilatation are linked to the SCN5A
mutation. These features (and stroke at young age) largely
determine the proposed score.1 This phenotype is part of the
plethora of described sodium channelopathies, which in more
extensively affected patients may also include the development of fibrosis.3 The link to DCM by this single mutation,
which in expression studies performed thus far does not
significantly affect sodium channel function, has not been
proven, however. First, a LOD score for linkage between
patients with ventricular dysfunction and D1275N and/or
D3S1211 allele 1 (also presumably D1275N carriers, although
this has not been proven) is estimated to be at best ⬇1.2 (ie,
an ⬇10% chance of a false-positive result), and is therefore
far less than the LOD score of 3 usually required for statistical
evidence of genetic linkage. Second, DCM is not present in
the above-described family with the same mutation.2 The
predominant presence in older adult patients favors DCM to
be secondary to long-lasting atrial arrhythmias. Hence, these
data do not permit the listing of “mild” SCN5A mutations as
DCM causing genetic aberrations. Alternatively, another gene
with reduced penetrance, in linkage disequilibrium with the
D1275N mutation, plays a role in the DCM phenotype.
Response
Groenewegen and Wilde question the strength of the “link”
between the dilated cardiomyopathy (DCM) phenotype and the
SCN5A mutation (D1275N) reported in our article.1 In their
study, they proposed that the cardiac phenotype (atrial standstill)
was caused by the concurrence of the same mutation (D1275N)
with a connexin40 polymorphism.2
In addition to the 6 subjects with ventricular dilation and/or
dysfunction in the original article by Olson et al,3 we provided
evidence for ventricular dilation and/or dysfunction in 3 other
subjects (III:4, III:10, IV:2), as shown in our table.1 The
autopsy report of subject II:1 confirmed “4-chamber dilation.”
Furthermore, shortly after the publication of our article, Olson
et al4 reported the results of their survey of the SCN5A gene
in a large DCM population (including the same family), citing
additional cases in which SCN5A mutations cosegregate with
the DCM phenotype. These data, together with the previous
identification of incidental DCM cases in LQT3 and HERG
mutation carriers,1 and the recent identification of ABCC9
mutations (SUR2A subunit of the cardiac KATP channel) in a
DCM population,5 strongly suggest a link between ion channel mutations and myocardial dysfunction.
Groenewegen points out that if the phenotype of DCM (a
late-onset finding) is used in isolation, then only a modest
LOD score could be obtained. We argue that it is inappropriate to score only patients with DCM as affected when the
SCN5A mutation in this family produces a complex phenotype
that includes arrhythmias and conduction disease. His suggestion to use a LOD score of 3.0 in a candidate gene study is an
incorrect approach (that criterion applies to genome-wide
approaches); also, in a candidate approach, a LOD score of 1.2
is closer to a 1%, not a 10%, false-positive rate. This is of
little consequence, in fact, because Olson et al recently
reported a LOD score of 5.8 in this family.4 The lack of DCM
in the family reported by Groenwegen and associates carrying
the identical mutation,2 who were younger at the time of
reporting (late teens to 33 years in their study versus 24 to 88
years in our study), does not disprove the DCM hypothesis
because additional genetic or environmental factors could
account for the differences between the 2 families. Whether
the observed late-onset DCM is a direct consequence of the
underlying SCN5A mutation or a reflection of chronic arrhythmia remains to be determined.
Acknowledgment
Supported in part by the Netherlands Heart Foundation
(M96.001).
W.A. Groenewegen, PhD
Department of Medical Physiology
University Medical Center Utrecht
Utrecht, The Netherlands
William P. McNair, BA
Lisa Ku, MS
Matthew R.G. Taylor, MD
Pam R. Fain, PhD
Eugene Wolfel, MD
Luisa Mestroni, MD
University of Colorado Cardiovascular Institute
University of Colorado Health Sciences Center
Denver, Colo
A.A.M. Wilde, MD, PhD
Department of Cardiology
Academic Medical Center
Amsterdam, The Netherlands
1. McNair WP, Ku L, Taylor MR, Fain PR, Dao D, Wolfel E, Mestroni L;
Familial Cardiomyopathy Registry Research Group. SCN5A mutation
associated with dilated cardiomyopathy, conduction disorder, and arrhythmia. Circulation. 2004;110:2163–2167.
e9
e10
Correspondence
Note
Please note that one of the original authors of our article, Dmi Dao,
could not be reached to provide her consent to this response;
therefore, she has not been listed as an author on this response.
1
1. McNair WP, Ku L, Taylor MR, Fain PR, Dao D, Wolfel E, Mestroni L;
Familial Cardiomyopathy Registry Research Group. SCN5A mutation
associated with dilated cardiomyopathy, conduction disorder, and arrhythmia. Circulation. 2004;110:2163–2167.
2. Groenewegen WA, Firouzi M, Bezzina CR, Vliex S, van Langen IM,
Sandkuijl L, Smits JP, Hulsbeek M, Rook MB, Jongsma HJ, Wilde AA.
A cardiac sodium channel mutation cosegregates with a rare connexin40
genotype in familial atrial standstill. Circ Res. 2003;92:14 –22.
3. Olson TM, Keating MT. Mapping a cardiomyopathy locus to chromosome 3p22-p25. J Clin Invest. 1996;97:528 –532.
4. Olson TM, Michels VV, Ballew JD, Reyna SP, Karst ML, Herron KI, Horton
SC, Rodeheffer RJ, Anderson JL. Sodium channel mutations and susceptibility ot heart failure and atrial fibrillation. JAMA. 2005;293:447–454.
5. Bienengraeber M, Olson TM, Selivanon VA, Kathmann EC, O’Cochlain
F, Gao F, Karger AB, Ballew JD, Hodgson DM, Zingman LV, Pang Y-P,
Alekseev AE, Terzic A. ABCC9 mutations identified in human dilated
cardiomyopathy disrupt catalytic KATP channel gating. Nat Genet. 2004;
36:382–387.
Correspondence
Letter Regarding Article by Galbreath et al,
“Long-Term Healthcare and Cost Outcomes of
Disease Management in a Large, Randomized,
Community-Based Population With Heart Failure”
We also agree with Wilson and Linden that disease management will
have the greatest impact when there is substantial room for improvement in therapies being applied as well as in compliance with those
therapies. We were impressed with the level of treatment at baseline in
our population and concluded that the lack of reduction in healthcare
utilization and costs resulted in part from that fact. All of the patients in
this study had an established diagnosis of congestive heart failure and
almost all had primary care physicians at the time of study entry. This
differs from many trials of disease management in which study entry
occurred during the initial hospitalization for heart failure in patients
who may have had little previous access to health care. It is important
to point out, however, that because of the nature of the intervention we
tested, a disease management program that provided feedback and
recommendations to patients and primary care physicians but did not
have independent prescriptive authority, medication doses were not
routinely maximized and blood pressure control at the end of the trial
was often suboptimal. Thus, there remains further room for improvement in the management of congestive heart failure in our patients, but
the disease management program we tested was not successful in
bringing it about.
To realize this ultimate goal, requiring the participation of large
groups of patients in adjunct programs such as the one we tested will not
suffice. The significant challenge remains in developing systems that
allow more complete control of patient management in such large
groups, so that treatment end points are achieved without interfering
with a patient’s relationship with a primary care provider who must
manage the patient’s overall health care (often encompassing numerous
medical problems) and who must concur with specific therapy recommendations of the disease management program. Only when this goal
has been reached will truly optimal disease management be possible.
To the Editor:
We commend Dr Galbreath and colleagues on a well-designed study
evaluating the impact of a disease management program on health
status, utilization, and cost.1 There is, however, one extremely important
point that requires comment. The authors indicate that the results of this
study are generalizable because the “catchment” area spanned 70 000
mi2 in south Texas. This study has strong “internal validity,” but we
would argue that the “external validity”2 of the findings will apply only
to similar people, settings, treatments, and outcomes.3 Such a “generalizable” population would be one with a high level of baseline
compliance with recommended treatment guidelines. In this study, the
authors state that 77% of the patients were taking either an angiotensin-converting enzyme inhibitor or angiotensin receptor blockers at the
time of enrollment, as compared with the 30% to 50% rate noted in
other trials. This is not a trivial issue because drug therapy is a central
part of recommended guidelines.3 The authors correctly noted that
under circumstances of high adherence to guidelines “the value added
by a disease management program will be more difficult to
demonstrate.”
This factor alone may account for why no reductions in utilization or
costs were realized in the study group when compared with the
reference. Disease management by its very name implies that participants will be guided toward improving control of their condition. The
mainstay of these programs is in bringing the individual and his or her
physician in line with evidence-based practice guidelines. If individuals
already adhere to self-management behaviors, then there is little gain to
be expected from a disease management program.
Disclosure
Ariel Linden, DrPH, MS
Linden Consulting Group
Hillsboro, Ore
[email protected]
The Department of Defense funded this study; its interests were
in determining whether disease management when applied to
federal beneficiaries with congestive heart failure would be
effective in reducing mortality, morbidity, and healthcare costs.
If significant improvements over usual care were observed, then
this or a similar model would have been instituted on a local and
perhaps national level in military treatment facilities.
Thomas Wilson, DrPH, PhD
Wilson Research, LLC
Loveland, Ohio
[email protected]
Autumn Dawn Galbreath, MD
Gregory L. Freeman, MD
Division of Cardiology
University of Texas Health Science Center
University of Texas Disease Management Center
San Antonio, Tex
1. Galbreath AD, Krasuski RA, Smith B, Stajduhar KC, Kwan MD, Ellis R,
Freeman GL. Long-term healthcare and cost outcomes of disease management in a large, randomized, community-based population with heart
failure. Circulation. 2004;110:3518 –3526.
2. Wilson TW, MacDowell M. Framework for assessing causality in disease management programs: principles. Dis Manag. 2003;6:143–158.
3. Linden A, Adams JL, Roberts N. Generalizing disease management program
results: how to get from here to there. Manag Care Interface. 2004;17:38–45.
Brad Smith, PhD
University of Texas Disease Management Center
Altarum Institute
San Antonio, Tex
Response
We agree with Drs Wilson and Linden that before applying a study’s
results to one’s own patient population, the similarity between the
patient groups must be carefully considered. Unlike previous studies
that have evaluated the impact of disease management strategies in
small populations of patients from a single hospital or health maintenance organization, we studied a large group of patients recruited from
a wide spectrum of healthcare systems and demographics. We enrolled
patients from large cities (San Antonio, Austin), from small towns
(Beeville, Three Rivers), and from isolated rural settings in Texas.
Although it could be argued that a ranch in south Texas is different from
a dairy farm in New England, we again emphasize that this was a
broadly heterogeneous population from a range of backgrounds. Thus,
we feel justified in stating that our results are more generally applicable
than those of less diverse previous studies.
Richard A. Krasuski, MD
Wilford Hall Medical Center
San Antonio, Tex
Karl C. Stajduhar, MD
Michael D. Kwan, MD
Brooke Army Medical Center
San Antonio, Tex
Robert Ellis, MD
Tricare Southwest
San Antonio, Tex
e11
The Editors express appreciation to the following referees who served from April 1, 2004, to December 31, 2004.
Einari Aavik
Nicola Abate
Amr E. Abbas
Antonio Abbate
Kevin C. Abbott
Robert D. Abbott
Koji Abe
E. Dale Abel
George S. Abela
Benjamin S. Abella
Aiden Abidov
Alexandre Abizaid
M. Roselle Abraham
Pierre Abraham
Theodore P. Abraham
Dan Abramov
Charles S. Abrams
Jerome L. Abramson
Hugues Abriel
Stephan Achenbach
Michael Acker
Michael J. Ackerman
Stamatis Adamopoulos
Robert J. Adams
Volker Adams
Ian Adatia
Philip A. Ades
Jennifer Adgey
Marina Afanasyeva
Vahid Afshar-Kharghan
Stefan Agewall
Tetsuro Ago
Piergiuseppe Agostoni
Pietro Agricola
David Aguilar
Seyedhossein Aharinejad
Amrita Ahluwalia
Ismayil Ahmet
Enrico Aidala
Ken-ichi Aihara
Masanori Aikawa
Barbara Ainsworth
William C. Aird
Masazumi Akahoshi
Olakunle O. Akinboboye
Masahiro Akishita
Junya Ako
Christine M. Albert
Jeffrey Albert
Michelle Albert
Gabriel Aldea
Michael H. Alderman
Alexey N. Aleshin
Marie-Christine Alessi
John H. Alexander
M. Yvonne Alexander
Mark E. Alexander
Peter Alexandersen
Khaled Alfakih
Ottavio R. Alfieri
Francois Alhenc-Gelas
Ziad A. Ali
Etienne M. Aliot
Hussein R. Al-Khalidi
Lindsey D. Allan
Yves Allemann
Maurits A. Allessie
Kristina Allikmets
Matthew A. Allison
Thomas G. Allison
Kevin C. Allman
Laura Almasy
Jesus Almendral
Carlos Alonso-Villaverde
Joseph S. Alpert
Martin A. Alpert
David A. Alter
Peter Alter
Guy Alvarez
John A. Ambrose
Pierre Ambrosi
Peter Ammann
Ezra Amsterdam
Ping An
Inder S. Anand
G.M. Anantharamaiah
Burt Anderson
Gitte Andersen
H. Vernon Anderson
Jeffrey L. Anderson
Kelley P. Anderson
Mark E. Anderson
Neil Anderson
Page A.W. Anderson
Peter G. Anderson
Robert H. Anderson
Todd J. Anderson
Stefan Andreas
Arne K. Andreassen
Felicita Andreotti
Douglas Andres
Vicente Andres
Ramaroson Andriantsitohaina
Rajesh K. Aneja
Giovanni Anfossi
Annalisa Angelini
Gianni D. Angelini
Dominick J. Angiolillo
E. Angles-Cano
Stefan D. Anker
Brian H. Annex
Jack Ansell
Riitta L. Antikainen
Tarek F. Antonios
David Antoniucci
Jovan P. Antovic
Charles Antzelevitch
Piero Anversa
L.J. Appel
Ian Appleton
Andrew E. Arai
Maria Rosario G. Araneta
Stephen L. Archer
Moshe Arditi
Ross Arena
Thomas Arentz
Laurent Argaud
Gary C. Armitage
Paul W. Armstrong
Donna K. Arnett
Leonard F. Arnolda
Wilbert S. Aronow
Marie Arsenault
Margaret A. Arstall
Michael Artman
Yujiro Asada
Takayuki Asahara
Masanori Asakrua
Raimondo Ascione
Alexzander Asea
Arlene S. Ash
Euan A. Ashley
Muhammad Ashraf
Nick Ashton
Gregory K. Asimakis
Samuel J. Asirvatham
Gerd Assmann
Birgit Assmus
Brad Astor
Bela F. Asztalos
Dan Atar
Vasilios G. Athyros
Dianne L. Atkins
Larry D. Atwood
Andrew M. Atz
Johann W. Auer
Pal Aukrust
Angelo Auricchio
Gerard P. Aurigemma
Melissa A. Austin
Richard C. Austin
Michael V. Autieri
Pablo Avanzas
Abraham Aviv
Philip E. Aylward
Michel Azizi
Angelo Azzi
Jan Baan
Vladimir R. Babaev
Gerard Babatasi
Fritz H. Bach
e12
Robert J. Bache
Jean E. Bachet
Walter Backes
Peter Backx
Larry Baddour
David Badesch
Juan J. Badimon
Lina Badimon
Cornel Badorff
Stephen F. Badylak
Alexei Y. Bagrov
Ajay Bahl
Ferdinand H. Bahlmann
Colin Baigent
Steven Bailey
Donald S. Baim
Alison E. Baird
S. Paul Bajaj
Arvind Bakhru
Patricia F. Bakker
Stephan J.L. Bakker
George L. Bakris
Prabhakaran Balagopal
Stephan Baldus
Christie M. Ballantyne
Jean-Luc Balligand
Scott W. Ballinger
Enzo Ballotta
James A. Balschi
Ko Bando
José R. Banegas
Mary A. Banerji
Adrian P. Banning
David A. Baran
Eddy Barasch
Giuseppe Barbaro
John C. Barbato
Paule C. Barbeau
Jean T. Barbey
Robert Bard
Edit Bardi
Philip M. Barger
Stephen G. E. Barker
S. Serge Barold
Alain D. Baron
Lili A. Barouch
Jose A. Barrabes
Elizabeth Barrett-Connor
William H. Barry
Robyn J. Barst
Thomas Bartel
Philip Barter
Jürgen Barth
John R. Bartholomew
Matthias Barton
Benico Barzilai
Theodore A. Bass
Jean-Pierre Bassand
Craig T. Basson
Shari S. Bassuk
Eric R. Bates
Anjan Batra
Robert Bauernschmitt
Johann Bauersachs
Kenneth L. Baughman
Iris Baumgartner
Ralf W. Baumgartner
William Baumgartner
Christophe Bauters
Jeroen J. Bax
B. Timothy Baxter
Gary F. Baxter
Kirk W. Beach
M. Flint Beal
Alvarez Beatriz
Jean-Louis Beaudeux
Christoph R. Becker
Diane M. Becker
Lance B. Becker
Lewis C. Becker
Richard C. Becker
Frank Beckers
Joshua A. Beckman
Bettina Beech
Juerg H. Beer
Philipp Beerbaum
Richard H. Behrman
Berthold Bein
Sean C. Beinart
Alexa Beiser
Romualdo Belardinelli
Robert M. Bell
Jonathan N. Bella
George A. Beller
Michelle P. Bendeck
David G. Benditt
Martin Bendszus
Athanase Benetos
R. Benezra
Frank M. Bengel
Jean-Pierre Bénitah
Ivor J. Benjamin
Ralf Benndorf
Joel S. Bennett
Martin R. Bennett
William M. Bennett
Rondelet Benoit
Neal Benowitz
D. Woodrow Benson
Lee N. Benson
Merrill D. Benson
Aloys Berg
Robert A. Berg
Knut E. Berge
Alan K. Berger
Peter B. Berger
Ronald Berger
Rudolf Berger
Lars Berglund
Martin W. Bergmann
Steven R. Bergmann
Bradford C. Berk
Lisa Berkman
Javier Bermejo
Jose M. Bernal
Michael C. Berndt
Gerald J. Berry
Mark F. Berry
Donald M. Bers
Giuseppe S. Berton
Alain G. Bertoni
Michel E. Bertrand
Charles I. Berul
Patricia J.M. Best
Reinaldo B. Bestetti
Christer Betsholtz
Saroja Bharati
Aruni Bhatnagar
Deepak Bhatnagar
Deepak L. Bhatt
Italo Biaggioni
Cesario Bianchi
Marco E. Bianchi
Giorgio M. Biasi
Hans K. Biesalski
D.H. Biesma
Erik A.L. Biessen
J. Thomas Bigger
Nick R. Bijsterveld
Diane E. Bild
Jacques Billette
George Billman
Feng B. Bin
Philip F. Binkley
John D. Birkmeyer
Yochai Birnbaum
Eva Biro
Nanette H. Bishopric
John A. Bittl
Vera Bittner
Edward O. Bixler
Daniel J. Blackman
Eugene H. Blackstone
Steven N. Blair
Jean-Jacques Blanc
William S. Blaner
Stefan Blankenberg
W. Matthijs Blankesteijn
Andrew D. Blann
Alex Blatt
Andrew D. Blaufox
Erwin Blessing
Peter C. Block
David A. Bluemke
Friedrich C. Blumberg
Roger S. Blumenthal
Alex Bobik
Edimar A. Bocchi
Jorge B. Boczkowski
Peter F. Bodary
Christoph Bode
William E. Boden
Gerd Bodlaj
Manfred Boehm
Michael Boehm
Jolanda M. Boer
Guido Boerrigter
Eric Boersma
Eric Boerwinkle
Rainer H. Boger
Richard G. Bogle
Frank Bogun
David F. Bohr
William Boisvert
Joerg Bojunga
Paula M. Bokesch
Thomas Boland
Roberto Bolli
Victoria Bolotina
Marvin O. Boluyt
Massimo Bonacchi
Raoul Bonan
Nikolaos Bonaros
Lawrence I. Bonchek
Meredith Bond
Diana Bonderman
Hendrik Bonnemeier
Enzo Bonora
Robert O. Bonow
Maria R. Bonsignore
Piet W. Boonstra
Jeffrey Boord
George W. Booz
Nicolas Borenstein
Jeffrey S. Borer
Martin Borggrefe
John Boscardin
René M. Botnar
Michiel L. Bots
Chantal M. Boulanger
Anne Bouloumie
Henri M. Bounameaux
Pierre Boutouyrie
Daniel F. Bowen-Pope
Neil E. Bowles
Penelope A. Boyden
Mark R. Boyett
Biykem Bozkurt
David J. Bradley
T. Douglas Bradley
Randy W. Braith
Frederick Brancati
Ralf P. Brandes
Ruediger C. Braun-Dullaeus
Eugene Braunwald
Alan C. Braverman
Molly S. Bray
Claudia Bregonzio
Roger E. Breitbart
Ole A. Breithardt
e13
Sorin J. Brener
Kate M. Brett
Christoph Brezinka
J. Timothy Bricker
Charles R. Bridges
Regina Brigelius-Flohe
Michele Brignole
Ralph G. Brindis
Charles Brink
Eliot A. Brinton
Michael R. Bristow
Steven L. Britton
Bruce R. Brodie
Sergey V. Brodsky
Ulrich Broeckel
Alessandra Brofferio
Robert D. Brook
Maria M. Brooks
James M. Brophy
M. Julia Brosnan
K. Bridget Brosnihan
Brigitta C. Brott
Margaret E. Brousseau
Jan-Leendert P. Brouwer
Gregory L. Brower
B. Greg Brown
David L. Brown
Kathleen K. Brown
Nancy J. Brown
Warren S. Browner
Michael Brownlee
Ian N. Bruce
Christian Bruch
Josep Brugada
Ramon Brugada
Lyndia Brumback
Corinna B. Brunckhorst
Frank Martin Brunkhorst
Eric J. Brunner
Hans R. Brunner
Helle Bruunsgaard
Robert M. Bryan
Michael Bryer-Ash
Rosemary S. Bubien
Paolo Bucciarelli
Timothy G. Buchman
John Buckwalter
Matthew J. Budoff
Werner Budts
Arno Buecker
Raffaele Bugiardini
L. Maximilian Buja
Jens Bulow
Burkhard D. Bültmann
Cecil M. Burchfiel
Lora Burke
John C. Burnett
Jane C. Burns
Paul B. Burton
Ivo Buschmann
David W. Busija
e14
Rudi Busse
Javed Butler
Alfred E. Buxton
Brian F. Buxton
Peter H. Byers
Benjamin F. Byrd, III
Melissa J. Byrne
Christopher H. Cabell
Candido Cabo
Howard Cabral
Kevin S. Cahill
Hua L. Cai
Michael E. Cain
Paolo Calabro
Antonio M. Calafiore
S.C. Calaghan
Angelino Calderone
Mary Caldwell
David A. Calhoun
Robert M. Califf
Hugh Calkins
David J. Callans
Francois A. Cambien
Richard P. Cambria
Paolo G. Camici
Vito M. Campese
Umberto Campia
Antonio C. Campos de
Carvalho
Paul Canner
Christopher P. Cannon
Richard O. Cannon
Charles E. Canter
John G. Canto
Warren J. Cantor
John M. Canty
Noel M. Caplice
Maurizo C. Capogrossi
Riccardo Cappato
Thomas P. Cappola
Alessandro M. Capponi
Joseph A. Caprini
Sonia Caprio
Alessandro Capucci
Massimo Caputo
Blase A. Carabello
Brian J. Carey
Stephane G. Carlier
Mark D. Carlson
Edward Carmeliet
Pizzi Carmine
Mercedes R. Carnethon
Robert M. Carney
Clara Carpeggiani
Oscar A. Carretero
John D. Carroll
Joseph Carrozza
Jeffrey L. Carson
Andrew J. Carter
Lori Carter-Edwards
Wayne Carver
Paola Casanello
Juan P. Casas
Wayne E. Cascio
Ivan P. Casserly
Lisa A. Cassis
Agustin Castellanos
Edoardo Castelli
Alessandro Cataliotti
Marco Cattaneo
David S. Celermajer
Bojan Cercek
Antonio Ceriello
Manuel Cerqueira
Matteo Cesari
Claudia U. Chae
Mohamed Chahine
Alan Chait
Bernard R. Chaitman
Aravinda Chakravarti
Lorraine Chalifour
Angel Chamorro
Hunter C. Champion
Bysani Chandrasekar
Anthony C. Chang
Chih-Jen Chang
Ruey-Kang R. Chang
Kevin S. Channer
Keith M. Channon
M. John Chapman
Nora M. Chapman
Israel F. Charo
John C. Chatham
Lee-Young Chau
Sarwat Chaudhry
Gautam Chaudhuri
Aurea J. Chaves
Melvin D. Cheitlin
Alex F. Chen
Horng H. Chen
Ian Y. Chen
Jiu-an Chen
Peng-Sheng Chen
Shih-Ann Chen
Edouard Cheneau
Debbie Cheng
James H. Chesebro
Mordechai Chevion
Derek P. Chew
Elena Chiarpotto
Masaaki Chiku
John S. Child
William M. Chilian
Kazuo Chin
Michael T. Chin
Marcello Chinali
Randolph W. Chitwood, Jr
Ray C-J Chiu
Leslie Cho
Aram V. Chobanian
Anand Chockalingam
Eric T. Choi
Jina Choo
Tz-Chong Chou
Robin P. Choudhury
Benjamin J.W. Chow
Judith C. Chow
Timothy F. Christian
Mina Chung
Taylor Chung
Mariantonietta Cicoira
Marilyn J. Cipolla
Francesco Cipollone
Kieran Clarke
Robert Clarke
William R. Clarke
Catherine M. Clase
John G.F. Cleland
Paula R. Clemen
Ton J. Cleophas
Aldo Clerico
Angela Clerk
Alexander Clowes
William T. Clusin
Ronald I. Clyman
Andrew J. Coats
Leonard A. Cobb
William A. Coetzee
Thomas M. Coffman
David J. Cohen
Eric A. Cohen
Hillel W. Cohen
Howard A. Cohen
Marc Cohen
Michael V. Cohen
Richard A. Cohen
Jay N. Cohn
Lawrence H. Cohn
William E. Cohn
Steven D. Colan
Jamie Coleman
Désiré Collen
Barry S. Coller
Robert W. Colman
Antonio Colombo
Maria Giovanna Colombo
David Colquhoun
Catherine Communal
Gianluigi Condorelli
William E. Connor
Robert V. Considine
C. Richard Conti
Elena Conti
David J. Cook
George A. Cook
Nancy R. Cook
John P. Cooke
Joshua M. Cooper
Leslie T. Cooper
Mark E. Cooper
Richard S. Cooper
Josef Coresh
James Coromilas
Domenico Corrado
Javier Corral
Dalila Corry
Alberto Corsini
Marshal A. Corson
Roberto Corti
Joseph S. Coselli
Francesco Cosentino
Francisco G. Cosio
Marco A. Costa
Lisa C. Costello-Boerrigter
William G. Cotts
Paul J.M. Coucke
Thierry Couffinhal
David Couper
Adrian Covic
Dermot Cox
Jill P. Crandall
Michael H. Crawford
Sybil Crawford
Filippo Crea
Mark A. Creager
Harry J.G.M. Crijns
Janet B. Croft
Kevin D. Croft
Rachelle H. Crosbie
Carroll E. Cross
John R. Crouse
Richard S. Crow
J. Kennedy Cruickshank
Bruce F. Culleton
Juraj Culman
R. William Currie
Jesse W. Currier
Anne B. Curtis
Mary Cushman
Daniele M. Cusi
Jeffrey A. Cutler
Maria-Cristina Cuturi
Myron I. Cybulsky
Tillmann Cyrus
Sébastien Czernichow
Mat J.A.P. Daemen
Michael Daffertshofer
Ralph B. D’Agostino
Mohamed R. Daha
Hiroyuki Daida
James E. Dalen
Ronald L. Dalman
Edward R. Damiano
Patricia D’Amore
Nicolas Danchin
Paresh Dandona
Haim D. Danenberg
George Dangas
Peter G. Danias
Werner G. Daniel
Jean-Marie Daniel Lamaziere
Stephen R. Daniels
A.H. Jan Danser
Victor Darley-Usmar
Anthony M. Dart
Dipak K. Das
Undurti N. Das
Jean C. Daubert
Harold L. Dauerman
Alan Daugherty
Anthony P. Davenport
Tirone E. David
Sandra T. Davidge
Charles J. Davidson
Karina W. Davidson
Barry R. Davis
Patricia H. Davis
Roger A. Davis
Roger B. Davis
Russell C. Davis
Robin L. Davisson
Vedat Davutoglu
Kevin P. Davy
Dana Dawson
Jonathan R.S. Day
Sharlene M. Day
Jacques de Bakker
Fred De Beer
Bernard De Bruyne
Raffaele De Caterina
Ulf de Faires
Pim J. de Feyter
Giovanni de Gaetano
Peter de Jaegere
Paul E. de Jong
Marlies de Lange
Peter W. de Leeuw
James A. de Lemos
Michel de Lorgeril
Giuseppe De Luca
Moniek P.M. de Maat
Ebo D. de Muinck
Ramon de Nooijer
Anne De Paepe
Giovanni De Pergola
Dominique de Prost
Giovanni de Simone
Johan H. De Sutter
Robbert J. de Winter
Dick de Zeeuw
Barbara J. Deal
John E. Deanfield
Arjun Deb
Robert F. DeBusk
G. William Dec
William M. DeCampli
Jeanne M. DeCara
Robert S. Decker
Gordon R. DeFoe
Curt G. DeGroff
Gregory J. Dehmer
Jan T. Deichen
Elisabeth Deindl
Carolin Deiner
Elisabetta Dejana
Ranjan Deka
Jacqueline M. Dekker
Federica del Monte
Etienne Delacrétaz
Joris Delanghe
Claude Delcayre
Christophe Delclaux
Thomas E. Delea
Jose A. Delgado Alves
E. Patchen Dellinger
R. Phillip Dellinger
Louis J. Dell’Italia
Kevin C. Dellsperger
Mario Delmar
Michael D. Delp
Anthony N. DeMaria
Yi Deng
Donald R. Dengel
Christophe Depre
Dimitri Deserranno
Alessandro Desideri
Christopher A. DeSouza
George Despotis
Jean-Pierre Despres
Zeruesenay Desta
Anita DeStefano
Robert C. Detrano
Katherine M. Detre
Tobias Deuse
Mohan Devbhandari
Richard B. Devereux
Mieke Dewerchin
Marc Dewey
Mandeep Dhadly
Naranjan S. Dhalla
Stefan Dhein
Gerald F. Di Bona
Marcelo F. Di Carli
Carlo Di Mario
Mario Di Napoli
Pietro Di Pasquale
Michaela Diamant
George A. Diamond
David A. Dichek
Wolfgang Dichtl
Kenneth Dickstein
Sean P. Didion
Andre M. Diedrich
Jutta Dierkes
Javier Diez
Wolfgang H. Dillmann
Joseph S. Dillon
Vasken Dilsizian
John P. DiMarco
Stefanie Dimmeler
Anh Tuan Dinh-Xuan
Donald J. DiPette
Michael Diringer
Abhinav Diwan
Sanjay Dixit
Douglas W. Dockery
Torsten Doenst
Pieter A. Doevendans
Hisham Dokainish
Anna F. Dominiczak
William T. Donahoo
J. Kevin Donahue
Rosario Donato
Peter Doris
Gerald W. Dorn, II
David E. Dostal
Pamela S. Douglas
James M. Downey
Stephen W. Downing
Ramona Doyle
Kathleen Dracup
Luciano F. Drager
Mark H. Drazner
Wim Drenthen
Helmut Drexler
Daniel L. Dries
Ahmed Ben Driss
Jie Du
Terry W. Du Clos
Dayue Duan
Raghvendra K. Dubey
Anne M. Dubin
Anique Ducharme
Samuel C. Dudley
Stephen J. Duffy
Dirk J. Duncker
Daniel Duprez
Jocelyn Dupuis
Josee Dupuis
David T. Durack
Carlos M.G. Duran
William Durante
J. Larry Durstine
Firat Duru
Susan Duval
Kim A. Eagle
Elaine D. Eaker
Robert T. Eberhardt
Franz R. Eberli
Lynn E. Eberly
Steven N. Ebert
Shah Ebrahim
Dwain L. Eckberg
Robert H. Eckel
Jay M. Edelberg
Elazer R. Edelman
Robert R. Edelman
Thomas S. Edgington
L. Henry Edmunds
Igor R. Efimov
Kensuke Egashira
Satoru Eguchi
Marek P. Ehrlich
Benjamin W. Eidem
John F. Eidt
John W. Eikelboom
Howard J. Eisen
e15
Mark J. Eisenberg
Mickey S. Eisenberg
Graeme Eisenhofer
Daniel T. Eitzman
Mikael Elam
John A. Elefteriades
Michael T. Eliasziw
Uri Elkayam
Kenneth A. Ellenbogen
Myrvin Ellestad
Oyvind Ellingsen
Patrick Ellinor
Justine A. Ellis
Stephen G. Ellis
Kristin E. Ellison
Nabil El-Sherif
Mary Emond
Noriaki Emoto
Masao Endoh
Matthias Endres
Richard M. Engelman
David M. Engman
Gunnar Engstrom
Andrew E. Epstein
Frederick H. Epstein
Laurence M. Epstein
Stephen E. Epstein
Raimund R. Erbel
John M. Erikson
Einar E. Eriksson
Wolfgang Erl
Thomas P. Erlinger
Thomas Eschenhagen
Charles T. Esmon
Ricardo J. Esper
Christine Espinola-Klein
Katherine Esposito
N.A. Mark Estes
Zeev Estrov
Masato Eto
Tanenao Eto
Paulo Roberto B. Evora
Justin A. Ezekowitz
Michael D. Ezekowitz
John W. Fabre
Rosalind Fabunmi
Gianpaolo Fadini
Erling Falk
Rodney H. Falk
Bonita Falkner
James C. Fang
James I. Fann
Frank Faraci
Andrew Farb
Harrison W. Farber
Jawed Fareed
William B. Farquhar
Vladimir G. Fast
Khalil Fattouch
Elda Favari
David P. Faxon
e16
William P. Fay
Zahi A. Fayad
Jocelyne Fayn
Franz Fazekas
Sergio Fazio
William F. Fearon
Paul W.M. Fedak
Eugenia Fedoseyeva
Jeffrey A. Feinstein
Mary F. Feitosa
Robert Felder
G. Michael Felker
Michael P. Feneley
Qingping Feng
Peter Ferdinandy
James J. Ferguson, III
T. Bruce Ferguson
Francisco Fernandez-Aviles
Jose M. Fernandez-Real
Olivier Feron
Markus Ferrari
Victor A. Ferrari
Victor A. Ferraris
Paolo Ferrazzi
Robert E. Ferrell
Andreas Festa
Stephan Fichtlscherer
Anette Fiebeler
Loren J. Field
David S. Fieno
Michael A. Fifer
Hans R. Figulla
Janos G. Filep
Antonio P. Filipe, Jr.
Jeffrey R. Fineman
Mitchell S. Finkel
Toren Finkel
Dianne M. Finkelstein
Marcus Fischer
Thorsten Fischer
Richard D. Fish
Michael C. Fishbein
Edward A. Fisher
John D. Fisher
John T. Fisher
Patrick W. Fisher
Steven A. Fisher
Glenn I. Fishman
Desmond J. Fitzgerald
Garret A. FitzGerald
Peter J. Fitzgerald
Frank A. Flachskampf
Greg C. Flaker
Scott D. Flamm
Marcus D. Flather
Jerome L. Fleg
Kirsten E. Fleischmann
Ingrid Fleming
Richard M. Fleming
Markus Flesch
Gerald F. Fletcher
John S. Floras
James Floyd
Martin Fluck
Joseph Flynn
Robert Fogel
Alan M. Fogelman
Antonio F. Folino
Franco Folli
Gregg C. Fonarow
Guo-Hua Fong
Ignatius W. Fong
Vivian A. Fonseca
JoAnne M. Foody
Thomas Force
Earl S. Ford
George D. Ford
Myriam Fornage
James S. Forrester
Ulrich Forstermann
Trudy M. Forte
Elyse Foster
F. Gerald Fowkes
Caroline S. Fox
Ervin Fox
Alain Fraisse
Mark W. Frampton
Silvia Franceschi
Charles W. Francis
Gary S. Francis
Veronica Franco
Dignat-George Françoise
Nikolaos G. Frangogiannis
Markus H. Frank
Stanley S. Franklin
Wayne J. Franklin
Michael R. Franz
Robert P. Frantz
Stefan Frantz
Maria Grazia Franzosi
Nancy Frasure-Smith
Robert W.M. Frater
David S. Freedman
Bruce A. Freeman
Balz Frei
John K. French
Michael P. Frenneaux
Ulrich H. Frey
Matthias Frick
Linda F. Fried
Susan K. Fried
R.P. Friedland
Deborah M. Friedman
Paul A. Friedman
Jefferson Frisbee
Victor Froelicher
Jiri J. Frohlich
Alberto Froio
Peter C. Frommelt
Andrea Frustaci
Robert L. Frye
Ryan M. Fryer
Mingui Fu
Shmuel Fuchs
Bianca Fuhrman
Masashi Fujita
Naomi Fukagawa
Tohru Fukai
Keiichi Fukuda
Kesiuke Fukuo
Pino Fundarò
John W. Funder
Colin D. Funk
Curt D. Furberg
Raffaello Furlan
Mark I. Furman
Masato Furuhashi
Valentin Fuster
William H. Gaasch
Christian Gachet
David R. Gagnon
James V. Gainer
Fiorenzo Gaita
Patrick J. Gallagher
Claudio Galli
Augusto Gallino
James M. Galloway
Jonas B. Galper
Apoor S. Gami
Santhi Ganesh
Peter Ganz
Mario J. Garcia
Julius M. Gardin
Helena M. Gardiner
Sheila M. Gardiner
David G. Gardner
Martin J. Gardner
Roy S. Gardner
Alan Garfinkel
Philippe Garot
Peter Garred
Jean-Michel T. Gaspoz
Michael A. Gatzoulis
Kimberlee Gauvreau
Timothy P. Gavin
Haralambos P. Gavras
Irene Gavras
Meinrad Gawaz
Steffen Gay
J. William Gaynor
J. Michael Gaziano
Raul J. Gazmuri
Carmine Gazzaruso
Robert L. Geggel
Bruce D. Gelb
Jacques Genest
Yong-Jian Geng
Alfred L. George
Sarah J. George
Demetrios Georgiou
Alexander Geppert
Lior Gepstein
Hanspeter Gerber
A. Martin Gerdes
Marie D. Gerhard-Herman
Lucie Germain
Guido Germano
Bernard J. Gersh
M. Eric Gershwin
Myron C. Gerson
Welton M. Gersony
Edward P. Gerstenfeld
Robert E. Gerszten
S. David Gertz
Leonard S. Gettes
Tal Geva
Henry Gewirtz
Michael Gewitz
Jalal K. Ghali
William A. Ghali
Mihai Gheorghiade
Lorenzo Ghiadoni
Hossein A. Ghofrani
Carlo Giansante
Gary H. Gibbons
Raymond J. Gibbons
C. Michael Gibson
Samuel S. Gidding
Stephan Gielen
Martine Gilard
Ian C. Gilchrist
Thomas D. Giles
Wayne R. Giles
Linda D. Gillam
Jonathan Gillard
A. Marc Gillinov
Anne M. Gillis
Matthew W. Gillman
Richard F. Gillum
Robert F. Gilmour
Larry C. Gilstrap
Frank J. Giordano
Domenico Girelli
Cynthia J. Girman
Anselm K. Gitt
Dario Giugliano
Gregory R. Giugliano
Alexandre Giusti-Paiva
Michael M. Givertz
David Gjertson
Mark T. Gladwin
Stanton A. Glantz
Stephen P. Glasser
Stephen J. Glatt
Nicola Glorioso
Donald D. Glower
Charles J. Glueck
Robert J. Glynn
Alan S. Go
Ulrich Göbel
Andrew Gogbashian
Noyan Gokce
Diane R. Gold
Jeffrey P. Gold
Michael R. Gold
Ira J. Goldberg
Ronald B. Goldberg
Jeffrey J. Goldberger
Sherita H. Golden
Ira D. Goldfine
Joshua I. Goldhaber
Samuel Z. Goldhaber
Lee Goldman
Pascal J. Goldschmidt
Steven R. Goldsmith
Larry B. Goldstein
Michael S. Goligorsky
Paolo Golino
Jonathan Golledge
Celso E. Gomez-Sanchez
Philimon Gona
Mario D. Gonzalez
Elizabeth Goodman
Lawrence T. Goodnough
Theodore A. Gooley
John Gorcsan
Neil Gordon
Joel M. Gore
Tommaso Gori
Mark W. Gorman
Robert C. Gorman
Shinya Goto
Roberta A. Gottlieb
Stephen S. Gottlieb
Antonio M. Gotto
K. Lance Gould
Luis Henrique W. Gowdak
Kristof Graf
Patricia M. Grambsch
Juan F. Granada
Christopher B. Granger
D. Neil Granger
Augustus O. Grant
Henk L. Granzier
Guido Grassi
David Gray
Paul A. Grayburn
J. Thomas Grayston
Daniel J. Green
Darren C. Greenwood
Edward W. Gregg
Michelle Ann Grenier
Kathy K. Griendling
Brian P. Griffin
Helen R. Griffiths
Clarence E. Grim
Cindy L. Grines
Steven K. Grinspoon
Jean Ann Grisso
Francine Grodstein
William J. Groh
Marie-Louise M. Gronholdt
Robert Gropler
Garrett J. Gross
Oliver Gross
Eugene A. Grossi
Ehud Grossman
Blair P. Grubb
Eberhard Grube
Scott M. Grundy
Gary L. Grunkemeier
Eliseo Guallar
Maurizio D. Guazzi
Vilmundur G. Gudnason
Peter G. Guerra
Gerard M. Guiraudon
Martha Gulati
Giosue Gulli
Hakan Gullu
Julian Gunn
Mahesh P. Gupta
Narendra K. Gupta
Paul A. Gurbel
Enrique P. Gurfinkel
Geoffrey C. Gurtner
Swaminatha V. Gurudevan
Arjun Gururaj
Matthias Gutberlet
David D. Gutterman
Przemyslaw Guzik
Tomasz J. Guzik
Stefano Guzzetti
Katrina Gwin-Hardy
Donald C. Haas
Felix Haas
Helmut Habazettl
Robert H. Habib
Rory Hachamovitch
Walter E. Haefeli
Judith Haendeler
Hans U. Haering
Steven M. Haffner
David E. Haines
William D. Haire
Michel Haissaguerre
Roger J. Hajjar
Charles A. Hales
Kathleen J. Haley
Michael E. Halkos
Jennifer L. Hall
Par Hallberg
Hermann Haller
Jozsef Haller
Kevin J. Hallock
Perry V. Halushka
Rainer Hambrecht
Mohamed H. Hamdan
Pavel Hamet
John A. Hamilton
Christian W. Hamm
H. Kirk Hammond
Zhong C. Han
Wayne W. Hancock
Diane E. Handy
Claude E. Hanet
Graeme J. Hankey
Anthony J. Hanley
James A. Hanley
Edward L. Hannan
William H. Hansen
Goran K. Hansson
Akiyoshi Hara
Shuntaro Hara
Joshua M. Hare
Robert A. Harrington
William S. Harris
David G. Harrison
Alison L. Harte
Paula J. Harvey
Rodrigo Hasbun
David Hasdai
Naoyuki Hasebe
Gerd Hasenfuss
J. Michael Hasenkam
Naotake Hashimoto
Paul M. Hassoun
Thomas S. Hatsukami
Daniel C. Hatton
Richard N.W. Hauer
Paul J. Hauptman
Elizabeth R. Hauser
Richard J. Havel
Axel Haverich
Edward P. Havranek
Robert A. Haworth
Ilan Hay
Nissim Hay
Junichiro Hayano
David L. Hayes
Sharonne N. Hayes
Daniel Hayoz
Stanley L. Hazen
Jiang He
Ka He
Tongrong He
Anthony M. Heagerty
Harvey S. Hecht
Susan R. Heckbert
Peter S. Heeger
Timothy Heeren
Christopher Heeschen
Linda J. Heffner
Robert A. Hegele
Paul A. Heidenreich
Jörg Heierhorst
Albert Heim
Robert J. Heine
Gerardo Heiss
Alan W. Heldman
Gary V. Heller
Joan Heller Brown
Barbara L. Hempstead
Robert Henderson
Marc Hendrikx
Peter Henke
Charles H. Hennekens
Michael Hennerici
e17
Keith Henry
Timothy D. Henry
Heike M. Hermanns
Ramon C. Hermida
Adrian F. Hernandez
Miika Hernelahti
Victoria L.M. Herrera
David M. Herrington
Howard C. Herrmann
Ray E. Hershberger
Charles A. Herzog
David C. Hess
Otto M. Hess
Gerd F. Heusch
Karsten Heusser
Steven B. Heymsfield
William R. Hiatt
Yukihito Higashi
Charles B. Higgins
Denise Hilfiker-Kleiner
Joseph A. Hill
Gerhard Hindricks
Thomas H. Hintze
Shuji Hinuma
Masayasu Hiraoka
Loren F. Hiratzka
Karen K. Hirschi
Valeria Hirschler
John W. Hirshfeld
Keiichi Hishikawa
Mark A. Hlatky
Donald Hnatowich
Carolyn Ho
Helen H. Hobbs
Didier Hober
Robert W. Hobson
Judith S. Hochman
Hanoch Hod
Julien I. Hoffman
Udo Hoffmann
Peter Höglund
Thomas Hohlfeld
Stefan H. Hohnloser
Brian D. Hoit
John E. Hokanson
Fernando Holguin
Judd E. Hollander
Morley Hollenberg
Thomas A. Holly
William L. Holman
David R. Holmes
Paul Holvoet
Michael Holzer
Shunichi Homma
Myeong-Ki Hong
Yuling Hong
Rocio S. Honigmann
Jane L. Hoover-Plow
Richard Hopkins
William E. Hopkins
Uta C. Hoppe
e18
Masatsugu Hori
Lisa K. Hornberger
Benjamin D. Horne
Burkhard Hornig
John D. Horowitz
Lawrence D. Horwitz
Steven R. Houser
Barbara V. Howard
George Howard
T. Howard Howell
Henry H. Hsia
Frank B. Hu
Peifeng Hu
Paul L. Huang
Sally A. Huber
Whady A. Hueb
Joerg Huelsken
Chris C. Hughes
David Y. Hui
Heikki V. Huikuri
P.P. Hujoel
Russell D. Hull
Per M. Humpert
Karin H. Humphries
Stephen E. Humphries
Thomas Hund
Joseph Hung
Kelly J. Hunt
Steven C. Hunt
Patrick R. Hunziker
Winston L. Hutchinson
Adolph M. Hutter
Guido Iaccarino
Mark Iafrati
Sahoko Ichihara
Raymond E. Ideker
Richard G. Ijzerman
Uichi Ikeda
Katsunori Ikewaki
John S. Ikonomidis
Sabino Iliceto
Armin Imhof
Akihiro Inazu
Sandro Inchiostro
Ciro Indolfi
Julie R. Ingelfinger
David A. Ingram, Jr.
Joanne S. Ingwall
Nobutaka Inoue
Teruo Inoue
Cecilia Invitti
D.P. Inwald
Dan-Dominic G. Ionescu
Kaikobad J. Irani
Mitsuhiro Isaka
Shun Ishibashi
Junnichi Ishii
Kikuo Isoda
Eric M. Isselbacher
Takaaki Isshiki
Hiroshi Ito
Masahiro Ito
Wulf D. Ito
Toshiyuki Itoi
Susan L. Ivey
D. Dunbar Ivy
Yuichi Iwaki
Tohru Izumi
Christopher L. Jackson
EdwinK. Jackson
Graham Jackson
Shaun P. Jackson
Alice K. Jacobs
David R. Jacobs
Donald W. Jacobsen
Paul Jacques
Tazeen H. Jafar
Allan S. Jaffe
Thomas Jahnke
Mukesh K. Jain
Rajan Jain
Pierre Jaïs
Jose Jalife
Jorge E. Jalil
Ik-Kyung Jang
Joseph S. Janicki
Warren R. Janowitz
Michiel J. Janse
Ian Janssen
Stefan P. Janssens
Craig T. January
James L. Januzzi
Rudolf Jarai
Mikko J. Jarvisalo
Patrick Y. Jay
Goy Jean-Jacques
David J. Jenkins
Rolf Jenni
Allen Jeremias
Michael Jerosch-Herold
Paula Jerrard-Dunne
Xavier Jeunemaitre
Ashish K. Jha
Ishwarlal Jialal
Canwen Jiang
Huang Jianhua
Bernd Jilma
Hanjoong Jo
Mark A. Jobling
Edward J. Johns
B. Delia Johnson
Bruce D. Johnson
Jason L. Johnson
Richard J. Johnson
Robert L. Johnson
Daniel W. Jones
Gregory T. Jones
Peter L. Jones
Robert H. Jones
Steven P. Jones
W. Keith Jones
Habo J. Jongsma
Shuichi Jono
Jens Jordan
Jacob Joseph
Mark E. Josephson
Kaumudi J. Joshipura
Janna Journeycake
Pekka Jousilahti
Aleksandar Jovanovic
Ian R. Jowsey
Michael J. Joyner
Bodh I. Jugdutt
J. Wouter Jukema
David N. Juurlink
Stefan Kaab
Jens J. Kaden
Alan H. Kadish
Yutaka Kagaya
Henry S. Kahn
Richard Kahn
Fumihiko Kajiya
Gabor Kaley
Christoph Kalka
Klaus Kallenbach
Jonathan M. Kalman
Lalit Kalra
Grzegorz L. Kaluza
Balaraman Kalyanaraman
Vaijinath S. Kamanna
Timothy J. Kamp
Junji Kanda
Takeshi Kanda
David E. Kandzari
Laura B. Kane
Nicholas Kang
William B. Kannel
Norman M. Kaplan
Tomas Kara
Richard H. Karas
Johan Karlberg
Joel S. Karliner
Morris Karmazyn
Aly Karsan
Karl R. Karsch
Soji Kasayama
Carlos S. Kase
Juan-Carlos Kaski
Edward K. Kasper
David A. Kass
Robert S. Kass
Ghassan Kassab
John J.P. Kastelein
Adnan Kastrati
Naoto Katakami
Sekar Kathiresan
Masahiko Kato
Tomohiro Katsuya
Hugo A. Katus
Zvonimir S. Katusic
Arnold M. Katz
Stuart D. Katz
Marc P. Kaufman
Philipp A. Kaufmann
Sanjay Kaul
Sanjiv Kaul
Koji Kawahito
Chuichi Kawai
David M. Kaye
Teruhisa Kazui
Elsadig Kazzam
Mark T. Keating
Craig A. Keebler
Beate E. Kehrel
Aaron S. Kelly
Daniel P. Kelly
Ralph A. Kelly
Malte Kelm
Anita M. Kelsey
Byron W. Kemper
Richard D. Kenagy
Thomas A. Kent
Richard E. Kerber
Dean J. Kereiakes
Karl B. Kern
Morton J. Kern
William S. Kerwin
Steven J. Keteyian
Paul Khairy
Bijoy Khandheria
Ashwani Khanna
Stefan Kiechl
Jan T. Kielstein
Shinji Kihara
Tatsuya Kiji
Dae Jung Kim
Hyo-Soo Kim
InKyeom Kim
Jason K. Kim
Raymond J. Kim
Thomas R. Kimball
Stephen E. Kimmel
Carey D. Kimmelstiel
Akinori Kimura
George L. King
Spencer B. King
John G. Kingma
Scott Kinlay
Ulrich Kintscher
Kevin E. Kip
Charles J.H.J. Kirchhof
James Kirklin
Lorrie A. Kirshenbaum
Chiharu Kishimoto
Brett M. Kissela
Toru Kita
Akira Kitabatake
Masafumi Kitakaze
Kazuo Kitamura
Richard N. Kitsis
Andre G. Kleber
Robert Kleemann
Neal S. Kleiman
Allan L. Klein
George J. Klein
Lloyd W. Klein
Paul D. Kligfield
James R. Klinger
Elizabeth S. Klings
Francis J. Klocke
Robert A. Kloner
Bradley P. Knight
John L. Knight
Anne A. Knowlton
Kirk U. Knowlton
Sarah S. Knox
Merril L. Knudtson
Juhani Knuuti
Dennis T. Ko
Yoshio Kobayashi
Colleen G. Koch
Walter J. Koch
Itsuo Kodama
Wolfgang Koenig
Theo Kofidis
Kwang K. Koh
Frank Kolodgie
Issei Komuro
Takahisa Kondo
Marvin A. Konstam
Stavros V. Konstantinides
Igor E. Konstantinov
Anatol Kontush
Marianne Eline Kooi
Willem J. Kop
Stephen L. Kopecky
Bruce A. Koplan
Ran Kornowski
Mikhail Kosiborod
Andreas Koster
Rudolph W. Koster
Sawa Kostin
Theodore A. Kotchen
Hans Kottkamp
Nicholas T. Kouchoukos
Petri T. Kovanen
Peter R. Kowey
Jun Koyama
Andrew D. Krahn
Aldi Kraja
Jonathan Krakoff
Christopher M. Kramer
Evangelia G. Kranias
William E. Kraus
Ronald M. Krauss
Andrew J. Krentz
Nancy R. Kressin
Reinhold Kreutz
Jorg Kreuzer
P.A. Krieg
Murali C. Krishna
Rajesh Krishnamurthy
Eswar Krishnan
Leonard Kritharides
Michael H. Kroll
Irving L. Kron
Marvin W. Kronenberg
Itzhak Kronzon
Florian Krotz
Paul Kubes
Nils Kucher
Karl-Heinz Kuck
Nino Kuenzli
Hartmut Kuhn
Michaela Kuhn
Helena Kuivaniemi
Marrick L. Kukin
Rakesh C. Kukreja
Lewis H. Kuller
Iftikhar J. Kullo
Premkumari Kumarathasan
Richard E. Kuntz
Calvin J. Kuo
Lih Kuo
Christian Kupatt
Dhandapani Kuppuswamy
Masahiko Kurabayashi
Tobias Kurth
Theodore Kurtz
Kengo F. Kusano
Jeffrey T. Kuvin
William A. Kuziel
Tatiana Kuznetsova
Kevin F. Kwaku
Raymond Y. Kwong
Michael Kyller
Maria T. La Rovere
David E. Laaksonen
Arthur Labovitz
Louis M. Labrousse
Roger J. Laham
Shenghan Lai
John G. Lainchbury
Edward G. Lakatta
Hanna-Maaria Lakka
Timo A. Lakka
Jules Y.T. Lam
Stephen C.T. Lam
Benoit Lamarche
John J. Lamberti
Rachel Lampert
Katja H. Lampinen
Kathryn G. Lamping
Hui Y. Lan
Gary Landreth
Donald W. Landry
Michael J. Landzberg
David A. Lane
Roberto M. Lang
Jonathan J. Langberg
Bas Langeveld
B. Lowell Langille
David Langleben
Alexandra J. Lansky
Harris Lari
John C. LaRosa
Torben B. Larsen
Warren K. Laskey
Robert D. Lasley
Larry A. Latson
Jo-Dee L. Lattimore
Joseph Lau
Wei C. Lau
Michael S. Lauer
Ulrich Laufs
Jari A. Laukkanen
Stephane Laurent
Kenneth R. Laurita
Debbie A. Lawlor
Daniel A. Lawrence
Lesley Lawrenson
Louise Lawson
Jennifer S. Lawton
Harold L. Lazar
Ronald M. Lazar
Dominique Le Guludec
Alexander Leaf
Sam D. Leary
Robert J. Lederman
Amanda J. Lee
Hon-Chi Lee
Richard T. Lee
Thomas H. Lee
C.P.M. Leeson
David J. Lefer
Jean-Francois Legare
Jacopo M. Legramante
Michael H. Lehmann
Stephan E. Lehnart
Leslie Leinwand
Norbert Leitinger
Thierry H. LeJemtel
Paul LeLorier
Giuseppe Lembo
Pedro A. Lemos
Steven R. Lentz
David A. Leon
Antonio Maria Leone
Jonathan Leor
Amir Lerman
Bruce B. Lerman
Edward J. Lesnefsky
Philippe F. Lesnik
Heather S. Lett
Donald Y. Leung
Michael C. H. Leung
Marcel M. Levi
Roberto Levi
Adeera Levin
Benjamin D. Levine
Glenn N. Levine
Robert A. Levine
Sidney Levitsky
Bernard I. Levy
Daniel Levy
Robert J. Levy
Andrew P. Levy
e19
Jerrold H. Levy
Wilbur Y. Lew
Martin M. LeWinter
Alan B. Lewis
Klaus F. Ley
Andrew C. Li
Jennifer S. Li
Jian Li
Jianhua Li
Na Li
Shengxu Li
Yan C. Li
Bruce T. Liang
Chang-seng Liang
James K. Liao
Ronglih Liao
Youlian Liao
Peter Libby
Joseph R. Libonati
David S. Liebeskind
Philip R. Liebson
Choong-Chin Liew
Stephen B. Liggett
Kathleen C. Light
Yean L. Lim
Chee Chew Lim
Joao A. Lima
Marian C. Limacher
Ming T. Lin
Shien-Fong Lin
Michael Lincoff
Bertil Lindahl
JoAnn Lindenfeld
Marshall D. Lindheimer
Jonathan R. Lindner
Volkhard Lindner
Jerry B. Lingrel
MacRae F. Linton
Gregory Y.H. Lip
William C. Little
Sheldon E. Litwin
Jun Liu
Kiang Liu
Peter P. Liu
Simin Liu
Yongge Liu
Eng H. Lo
Amanda Lochner
James E. Lock
Warren E. Lockette
Ian M. Loftus
Anne-Marie Lompre
Barry London
Gérard M. London
Carlin S. Long
Eva M. Lonn
Gary D. Lopaschuk
John J. Lopez
Patricio López-Jaramillo
Francisco Lopez-Jimenez
Christine H. Lorenz
e20
David J. Loskutoff
Douglas W. Losordo
Eric B. Loucks
Charles J. Lowenstein
Gerald Luc
Lee Lucas
Benedict R. Lucchesi
Pamela A. Lucchesi
Andreas Luchner
John Ludbrook
David Ludwig
Russell V. Luepker
Friedrich C. Luft
Esther Lutgens
Aernout L. Luttun
Robert L. Lux
Bruce W. Lytle
Christoph Maack
David M. Maahs
Renke Maas
Peter S. Macdonald
Christopher K. Macgowan
Guy A. MacGowan
Francois Mach
Stella M. Macin
Christopher Mack
Michael J. Mack
Wendy J. Mack
Isla S. Mackenzie
Rachel H. Mackey
William R. MacLellan
Michal Maczewski
Paolo Madeddu
Mohammad Madjid
Joren C. Madsen
Koji Maemura
Aldo P. Maggioni
Kenneth W. Mahaffey
Michael C. Mahaney
Lynn Mahony
Heimo Mairbaurl
Bernhard Maisch
Alan S. Maisel
William H. Maisel
Mark W. Majesky
Amy S. Major
Robert T. Mallet
Ziad Mallat
Alberto Malliani
Giuseppe Mancia
G.B. John Mancini
Pitchaiah Mandava
Olivia Manfrini
Dennis T. Mangano
Arduino A. Mangoni
Venkatesh Mani
Calin V. Maniu
Douglas L. Mann
Giovanni E. Mann
Johannes F. Mann
Kenneth G. Mann
Michael J. Mann
Stewart Mann
Peter B. Manning
Warren J. Manning
Pier M. Mannucci
Teri A. Manolio
Moussa Mansour
Michael S. Marber
Keith L. March
Simona Marchesi
Francis E. Marchlinski
Frank I. Marcus
Maurizio Margaglione
Ali J. Marian
Allyn L. Mark
Daniel B. Mark
Andrew R. Marks
Barry J. Maron
Luc Maroteaux
Michel Marre
Mario B. Marrero
Oscar C. Marroquin
Philip A. Marsden
Audrey C. Marshall
Steven P. Marso
Fabio Martelli
Douglas Martin
Jack L. Martin
Paul T. Martin
Wim Martinet
Yukio Maruyama
Thomas H. Marwick
Gerald R. Marx
Nikolaus Marx
Steven O. Marx
Attilio Maseri
Peter J. Mason
Robert J. Mason
Frederick A. Masoudi
Joseph M. Massaro
Barry M. Massie
Bashir M. Matata
Ellisiv B. Mathiesen
Hiroaki Matsubara
Hikaru Matsuda
Reiko Matsui
Kanji Matsukawa
Akira Matsumori
Hidehiro Matsuoka
Hiroaki Matsuoka
Rumiko Matsuoka
Masunori Matsuzaki
Christian M. Matter
Ray V. Matthews
Kimmo J. Mattila
Clive N. May
Bongani M. Mayosi
Melanie Maytin
Todor N. Mazgalev
Nathalie M. Mazure
Eileen McCall
William M. McClellan
Seth McClennen
Michael V. McConnell
James McCord
Brian W. McCrindle
Peter A. McCullough
James D. McCully
Mary M. McDermott
Theresa A. McDonagh
Daniel McGee
John C. McGiff
Henry C. McGill
Michael McGoon
Thomas M. McIntyre
William J. McKenna
Timothy A. McKinsey
Tracey L. McLaughlin
Vallerie V. McLaughlin
Julie R. McMullen
John J.V. McMurray
Elizabeth M. McNally
Coleen A. McNamara
Patrick H. McNulty
Tim C. McQuinn
Charles F. McTiernan
Gary E. McVeigh
Roger Mee
Mandeep R. Mehra
Roxana Mehran
Jawahar L. Mehta
Rajendra H. Mehta
Shamir R. Mehta
James B. Meigs
Cynthia J. Meininger
Gerhard W. Meissner
Jan R. Mellembakken
Philippe Menasche
Michael E. Mendelsohn
Carlos F. Mendes de Leon
Armando J. Mendez
Maurizio Menichelli
George A. Mensah
James O. Menzoian
Jean-Jacques Mercadier
Anwar T. Merchant
Yahye Merhi
Ilse L. Mertens
Franz H. Messerli
Ruben Mestril
Luisa Mestroni
Heiko Methe
Philippe Meurin
Martijn Meuwissen
Theo E. Meyer
Evangelos D. Michelakis
Holly R. Middlekauff
Michele Mietus-Snyder
Richard V. Milani
D. Craig Miller
D. Douglas Miller
Leslie W. Miller
Michael Miller
Nancy H. Miller
Todd D. Miller
Virginia M. Miller
Tohru Minamino
Erich Minar
Gary S. Mintz
Israel Mirsky
Yoshio Misawa
Seema Mital
Brett M. Mitchell
Gary F. Mitchell
Jere H. Mitchell
Richard N. Mitchell
R. Scott Mitchell
Arnold Mitnitski
Suneet Mittal
Murray A. Mittleman
Kunio Miyatake
Kohei Miyazono
Emile R. Mohler, III
Nicanor I. Moldovan
Peter Molenaar
Ernesto Molina
David J. Moliterno
Jeffery D. Molkentin
Tom E. Mollnes
Kevin M. Monahan
Laurent Monassier
Gilles Montalescot
Joan Montaner
Nicola Montano
Alan R. Moody
James C. Moon
David F. Moore
Phillip Moore
Martin Morad
Fred Morady
Christine S. Moravec
Henning Morawietz
Kerrie L. Moreau
Pierre Moreau
Pedro R. Moreno
Raul Moreno
Thomas M. Morgan
Peter M. Morganelli
Anthony P. Morise
Ryuichi Morishita
Toshisuke Morita
Nicholas W. Morrell
Joel Morrisett
John A. Morrison
Sean J. Morrison
David A. Morrow
Jason D. Morrow
Richard F. Mortensen
Lori J. Mosca
Ralph S. Mosca
Mauro Moscucci
Jeffrey W. Moses
Arthur J. Moss
Richard L. Moss
Evangeline D. Motley
Karen S. Moulton
Jean-Jacques Mourad
Issam D. Moussa
Gilbert H. Mudge
Christian Mueller
Thomas Muenzel
Alessandro Mugelli
Andreas Mugge
Joseph B. Muhlestein
Debabrata Mukherjee
Rupak Mukherjee
Barbara J.M. Mulder
James E. Muller
Jochen Muller-Ehmsen
Janet M. Mullington
Michael J. Mulvany
Neal I. Muni
Jorg Muntwyler
Joanne Murabito
David Murdoch
Toyoaki Murohara
Elizabeth Murphy
Philip M. Murphy
Timothy P. Murphy
Charles E. Murry
Timothy I. Musch
Rene J. Musters
Steven E. Mutsaers
Bulent Mutus
Robert J. Myerburg
Daniel D. Myers
Jonathan Myers
Elizabeth G. Nabel
Christoph K. Naber
Bernardo Nadal-Ginard
Zurab G. Nadareishvili
Koonlawee Nademanee
Abraham Nader
Vinay Nadkarni
Ryozo Nagai
Hideaki Nagase
Noritoshi Nagaya
Eike Nagel
Sherif F. Nagueh
Hiroshi Nakagawa
Hajime Nakamura
Takeshi Nakano
Kanji Nakatsu
Gilles Nalbone
Brahmajee K. Nallamothu
Byung-Ho Nam
Navin C. Nanda
Manasi Nandi
Raffaele Napoli
Girish Narayan
Sanjiv M. Narayan
Craig R. Narins
Krzysztof Narkiewicz
Jagat Narula
Andrea Natale
Rama Natarajan
Viswanathan Natarajan
Hendrik Nathoe
Stanley Nattel
Matthew T. Naughton
Mohamad Navab
Frank Naya
Krassen Nedeltchev
Ilka Nemere
Dario Neri
Shawna D. Nesbitt
Aleksandar N. Neskovic
Paul J. Nestel
Stefan Neubauer
Ellis J. Neufeld
Gishel New
Andrew C. Newby
David E. Newby
L. Kristin Newby
Anne B. Newman
John H. Newman
Gary E. Newton
Christopher H. Newton-Cheh
Ludwig Neyses
Graham Nichol
Stephen J. Nicholls
Wilmer W. Nichols
Andrew C. Nicholson
Georg Nickenig
Martin J. Nicklin
Pascal H. Nicod
Christoph A. Nienaber
Michael R. Nihill
Seppo T. Nikkari
Dimitar Nikolov
Richard M. Niles
Rick A. Nishimura
Mari K. Nishizaka
Steven E. Nissen
Tianhua Niu
Koichi Node
Constance T. Noguchi
Eisei Noiri
Georg Noll
Borge G. Nordestgaard
Mikael Norman
Kari E. North
Gavin R. Norton
Michel Noutsias
Gian M. Novaro
Ulrike Nowak-Gottl
Evgeny Nudler
William C. Nugent
Carole Ober
Martin Oberhoff
Edward R. O’Brien
Christopher J. Occleshaw
Ira S. Ockene
Christopher M. O’Connor
Gerald T. O’Connor
Christopher J. O’Donnell
Erwin N. Oechslin
Patrick T. O’Gara
Hisao Ogawa
Yoshihiro Ogawa
Toshio Ogihara
Jae K. Oh
Ann M. O’Hare
Takayoshi Ohkubo
Tomoko Ohkusa
Erik M. Ohman
Veronica Ojetti
Akinlolu O. Ojo
Peter M. Okin
Katashi Okoshi
Jeffrey E. Olgin
Jobien K. Olijhoek
Jeffrey W. Olin
Brian Olshansky
Timothy M. Olson
Patrick G. O’Malley
Reed A. Omary
Jeffrey H. Omens
Torbjorn Omland
Steve R. Ommen
Altan Onat
Marie S. O’Neill
William W. O’Neill
Takayuki Ono
Koji Onoda
Henry Ooi
Suzanne Oparil
Tobias Opthof
Hakan Oral
John F. Oram
E. John Orav
Trevor J. Orchard
Jose M. Ordovas
Donald Orlic
John A. Ormiston
Joseph P. Ornato
Brian O’Rourke
Michael F. O’Rourke
Robert A. O’Rourke
Tetsuya Oshima
Clive Osmond
Jan Ostergren
David Ott
Fillipo Ottani
Catherine M. Otto
Feifan Ouyang
Michel Ovize
Mehmet C. Oz
Susan E. Ozanne
Pal Pacher
Chris J. Packard
Douglas L. Packer
Francis D. Pagani
Massimo Pagani
Patrick J. Pagano
Pierre Page
e21
Richard L. Page
Ramdas G. Pai
Rosario Palacios
Wulf Palinski
Julio C. Palmaz
Lyle J. Palmer
Sebastian Palmeri
Hui-Lin Pan
Demosthenes Panagiotakos
Natesa G. Pandian
James S. Pankow
Julio A. Panza
Nicholas F. Paoni
Carlo Pappone
Gilles Paradis
Patrick Parfrey
Michael Parides
Stephen Paridon
Paolo Parini
Jeong-Euy Park
Seung-Jung Park
Donna Parker
John D. Parker
Ira A. Parness
Juan C. Parodi
Alessandro Parolari
Steve W. Parry
Vincenzo Pasceri
Ares D. Pasipoularides
Gerard Pasterkamp
Ayan Patel
Lisa Patel
Rakesh P. Patel
Vickas V. Patel
David J. Paterson
Paola Patrignani
Carlo Patrono
Richard D. Patten
Cam Patterson
Peter M. Pattynama
Walter J. Paulus
Jeffrey M. Pearl
Justin D. Pearlman
Mary A. Peberdy
Ole D. Pedersen
Susanne S. Pedersen
Patrick Peeters
Antonio Pelliccia
Patricia A. Pellikka
Theo Pelzer
Michael Pencina
Marc S. Penn
Dudley J. Pennell
William Penny
Carl J. Pepine
Mark B. Pepys
Mark A. Pereira
Francisco Perez-Vizcaino
Emerson C. Perin
Harris Perlman
Joseph K. Perloff
e22
Eduardo R. Perna
Thomas V. Perneger
Francesco Perticone
Arkadii M. Pertsov
Inga Peter
Annette Peters
Nicholas S. Peters
Eric D. Peterson
Kirk L. Peterson
J.Thomas Peterson
Eva Petkova
Patricia A. Peyser
Marc A. Pfeffer
Ivan Philip
George J. Philippides
Bradley G. Phillips
Christopher O. Phillips
Richard P. Phipps
Francesco Piarulli
Philippe Pibarot
Eugenio Picano
Michael H. Picard
J. Geoffrey Pickering
Galen M. Pieper
Luc A. Pierard
Grant N. Pierce
Burkert Pieske
Bill A. Pietra
Gabriele Piffaretti
Frank A. Pigula
Nico H.J. Pijls
Louise Pilote
Ileana Pina
Theodore Pincus
David J. Pinsky
Duane S. Pinto
Yigal M. Pinto
Tobias Pischon
Federico Piscione
Cristina Pislaru
Bertram Pitt
Maria V. Pitzalis
Manel Pladevall
Jonathan F. Plehn
Johannes Pleiner
Jorge Plutzky
A. Graham Pockley
Stuart J. Pocock
Bruno K. Podesser
Philip J. Podrid
Paul Poirier
Roberto Pola
Don Poldermans
Victoria Polyakova
Philip A. Poole-Wilson
Clive A. Pope
Jeffrey J. Popma
Richard L. Popp
J. David Port
Francesco Portaluppi
Thomas R. Porter
Wendy S. Post
Robert S. Poston
Tina S. Poulsen
Neil Poulter
Janet T. Powell
Andrew J. Powell
William S. Powell
Scott K. Powers
Henry J. Pownall
Abhiram Prasad
Francesco Prati
Domenico Pratico
Josef Prchal
Stephen M. Prescott
Russell L. Prewitt
Beth F. Printz
Frits W. Prinzen
Silvia G. Priori
Kirkwood A. Pritchard
Linda L. Pritchard
Eric N. Prystowsky
Bruce M. Psaty
William Pu
Vladimir Pucovsky
John D. Puskas
Pirkko J. Pussinen
Reed Pyeritz
Kalevi Pyorala
Stuart F. Quan
Thomas Quaschning
Thomas Quertermous
Miguel A. Quiñones
Ton J. Rabelink
Marlene Rabinovitch
Miriam T. Rademaker
Daniel J. Rader
Marek W. Radomski
Shahin Rafii
Paolo Raggi
Shahbudin H. Rahimtoola
Elaine W. Raines
Olli T. Raitakari
Satish R. Raj
Sanjay Rajagopalan
Nalini M. Rajamannan
Sumathi Ramachandran
Kenneth S. Ramos
J. Scott Rankin
Dabeeru C. Rao
L.Vijay Rao
Elliot Rapaport
Tienush Rassaf
Saif S. Rathore
Peter B. Raven
Ursula Ravens
Katya Ravid
Chester A. Ray
Reza S. Razavi
Fabio A. Recchia
Rita F. Redberg
Alluru S. Reddi
K. Srinath Reddy
Vivek Y. Reddy
Margaret M. Redfield
Andrew N. Redington
Judith G. Regensteiner
Enrique Regidor
Jalees Rehman
Johan Reiber
Nathaniel Reichek
Muredach Reilly
Sharon C. Reimold
Steven E. Reis
Peter J. Reiser
Michael J. Reiter
P.H. Reitsma
Jian-Fang Ren
Jun Ren
Helaine E. Resnick
Ariel J. Reyes
Dwight Reynolds
Matthew R. Reynolds
Shereif H. Rezkalla
Jonathan Rhodes
Flavio Ribichini
Paul M. Ribisl
Romeo Ricci
Peter A. Rice
Lawrence Rice
Michael W. Rich
Vincent Richard
A. Mark Richards
Paul M. Ridker
Barbara Riegel
Walter F. Riesen
Nader Rifai
Giorgio Rigatelli
Eric B. Rimm
Gilles Rioufol
Rebecca H. Ritchie
James M. Ritter
Eberhard Ritz
Alain Rivard
Jeffrey Robbins
Robert C. Robbins
Robert Roberts
David Robertson
Sander J. Robins
Richard B. Robinson
Simon C. Robson
Albert P. Rocchini
Luc Rochette
Howard E. Rockett
Howard A. Rockman
Dan M. Roden
David Rodman
Beatriz L. Rodriguez
Leonardo Rodriguez
Fernando Rodriguez-Artalejo
Alicia Rodriguez-Pla
Marco Roffi
Veronique L. Roger
Campbell Rogers
Ariel Roguin
John Rogus
Mary J. Roman
Mats Rönnback
Dieter Ropers
Emilio Ros
Wayne D. Rosamond
Jonathan Rosand
Noel R. Rose
Michael R. Rosen
David S. Rosenbaum
Frits R. Rosendaal
Clive Rosendorff
Michael E. Rosenfeld
Bruce R. Rosengard
Todd K. Rosengart
David N. Rosenthal
Anthony Rosenzweig
Bernard Rosner
Allan M. Ross
John Ross
Robert Ross
Andrea Rossi
Gian Paolo D. Rossi
Ranieri Rossi
Thomas Rostock
Michael Roth
Richard B. Rothman
Steven A. Rothman
Peter M. Rothwell
Philippe Rouet
Jean-Lucien Rouleau
Anna V. Roux
Anne H. Rowley
Alan Rozanski
Hong Ruan
Melvyn Rubenfire
Frederick L. Ruberg
Lewis J. Rubin
Terrence D. Ruddy
Lawrence L. Rudel
Neil B. Ruderman
Yoram Rudy
Marc Ruel
Wolfram Ruf
Zaverio M. Ruggeri
Jean-Bernard Ruidavets
Luis M. Ruilope
John A. Rumberger
John S. Rumsfeld
Marschall S. Runge
Heinz Rupp
Frank Ruschitzka
James W.E. Rush
Jeremy N. Ruskin
Kerry S. Russell
Mary E. Russell
Raymond R. Russell
Wolfgang Rutsch
Martin K. Rutter
Peter N. Ruygrok
Thomas J. Ryan
Jack Rychik
Lars Ryden
Tobias Saam
Manel Sabate
Marc S. Sabatine
Roger A. Sabbadini
Hani N. Sabbah
Joseph F. Sabik
Luigi Sacca
Ralph L. Sacco
Michael N. Sack
Jonathan D. Sackner-Bernstein
Frank M. Sacks
H. Mehrdad Sadeghi
Junichi Sadoshima
Michel E. Safar
Jeffrey E. Saffitz
Kiran B. Sagar
David J. Sahn
Yoshifumi Saijo
Yoshihiko Saito
Tomohiro Sakamoto
Ichiro Sakuma
Tomas A. Salerno
Veikko Salomaa
Koen J. Salu
Carlo Salvarani
Flora Sam
Habib Samady
Afshin Samali
Nilesh J. Samani
Gianmario Sambuceti
Jonathan M. Samet
Willis K. Samson
Prashanthan Sanders
John E. Sanderson
David C. Sane
Anthony J. Sanfilippo
L. Fernando Santana
Massimo Santini
Marisa Santos
Maria-Jesus Sanz
John L. Sapp
Maurice E. Sarano
Ian J. Sarembock
Mark J. Sarnak
Masataka Sata
Toshiaki Sato
Naveed Sattar
J. Philip Saul
Elijah Saunders
Kurt W. Saupe
Bernhard Sauter
Motoji Sawabe
Tatsuya Sawamura
Leslie A. Saxon
James W. Sayre
Angelo M. Scanu
Saul Schaefer
Juergen R. Schaefer
Klaus P. Schafers
Hartzell V. Schaff
Martin J. Schalij
Jutta Schaper
Wolfgang Schaper
Christoph Scharf
Gina Schatteman
Robert G. Schaub
Andre J. Scheen
James M. Scheiman
Dierk Scheinert
Melvin M. Scheinman
Heinrich R. Schelbert
Benjamin J. Scherlag
Ralph T. Schermuly
Urs Scherrer
Marielle Scherrer-Crosbie
Deborah A. Scheuer
James Scheuer
Ernesto L. Schiffrin
Nelson B. Schiller
Mark D. Schluchter
Klaus-Dieter Schluter
Alvin Schmaier
John F. Schmedtje
Chris Schmid
Holger Schmid
Ann-Marie Schmidt
Carsten B. Schmidt-Weber
Gerd Schmitz
David J. Schneider
Michael D. Schneider
Andreas Schober
Gabriele Schoedon
Albert Schoemig
Frederick J. Schoen
David A. Schoenfeld
Paul Schoenhagen
Peter M. Scholz
Uwe Schonbeck
Ronald Schondorf
Wilhelm Schoner
Rolf Schroeder
Stephen Schroeder
Valarie Schroeder
Karsten Schrör
Joerg B. Schulz
Rainer Schulz
Richard Schulz
P. Christian Schulze
Paul T. Schumacker
Holger J. Schunemann
Markus Schwaiger
Lee H. Schwamm
Gregory G. Schwartz
Ketty Schwartz
Peter J. Schwartz
Stephen M. Schwartz
David S. Schwartzman
Miki L. Schwartzman
Robert A. Schweikert
Robert H.G. Schwinger
Juerg Schwitter
Alan Scott
Russell S. Scott
Miran Sebestjen
Udo Sechtem
Artyom Sedrakyan
Ellen W. Seely
Harry Segall
Pravin B. Sehgal
Christine E. Seidman
Jonathan G. Seidman
Christian Seiler
Frank W. Sellke
Joseph B. Selvanayagam
Luyi Sen
Laureen Sena
Shoichi Senda
Roxy Senior
Thomas D. Sequist
Susan M. Sereika
Patrick W. Serruys
William C. Sessa
Howard D. Sesso
Peter S. Sever
Robert E. Shaddy
Ajay M. Shah
Dipen C. Shah
Pravin M. Shah
Prediman K. Shah
Robin Shandas
Richard P. Shannon
Oz M. Shapira
Arya M. Sharma
Frank R. Sharp
Norman Sharpe
A. Richey Sharrett
Michael J. Shattock
Philip W. Shaul
Leslee J. Shaw
Amanda M. Shearman
Michael Shechter
Imad Sheiban
James Shepherd
Warren Sherman
Mark V. Sherrid
Sanjay Shete
Weibin Shi
Rei Shibata
Mei-Chiung Shih
Kazuyuki Shimada
Wataru Shimizu
Hiroaki Shimokawa
Ken Shinmura
Satoshi Shintani
Ichiro Shiojima
Kalyanam Shivkumar
Michael G. Shlipak
Ralph V. Shohet
e23
Allan A. Shor
Angela C. Shore
Linda Shore-Lesserson
Ashfaq Shuaib
Robert J. Siegel
Hans-Hinrich Sievers
Ulrich Sigwart
Michael J. Silka
Marc A. Silver
Donald S. Silverberg
David I. Silverman
Gregg J. Silverman
Norman H. Silverman
Jean-Sebastien Silvestre
Robert D. Simari
R. John Simes
Paolo Simioni
Daniel I. Simon
Scott I. Simon
Orlando P. Simonetti
Leon A. Simons
Michael Simons
Maarten L. Simoons
Paul C. Simpson
John E. Sims
Alan R. Sinaiko
Jürgen R. Sindermann
Pawan K. Singal
Krishna Singh
Sanjay Singh
Lawrence I. Sinoway
Albert J. Sinusas
Karin Sipido
David S. Siscovick
Samuel C. Siu
Deborah A. Siwik
Carsten Skurk
Cornelis J. Slager
Mara Slawsky
Peter Sleight
Marvin J. Slepian
Karen Sliwa
Gregory Sloop
Joost P.G. Sluijter
Richard W. Smalling
Eric J. Smart
Otto A. Smiseth
Alberto Smith
Felicity B. Smith
George D. Smith
Gordon C.S. Smith
Jonathan Smith
Nicholas L. Smith
Scott A. Smith
Sidney C. Smith
Steven R. Smith
Ulf Smith
Warren M. Smith
William M. Smith
Pieter C. Smits
Allan D. Sniderman
e24
Marieke B. Snijder
Burton E. Sobel
Kenji Sobue
Stefan Soderberg
Kyoko Soejima
Constantinos T. Sofocleous
Raija Soininen
Minna Soinio
John Solaro
Steven J. Sollott
Scott D. Solomon
Prem Soman
John Somberg
Virend K. Somers
Paul D. Sorlie
Farzaneh Aghdassi Sorond
J. Eduardo Sousa
P.C. Souverein
James R. Sowers
Madison S. Spach
Rainer Spanbroek
Carl P. Sparrow
Christian M. Spaulding
J. David Spence
William H. Spencer
John A. Spertus
Philip Spevak
Lukas E. Spieker
Francis G. Spinale
David H. Spodick
David Spragg
Joachim Spranger
Deepak Srivastava
Martin G. St. John Sutton
Eugenio Stabile
Austin Stack
Jan A. Staessen
Diana M. Stafforini
Gregory L. Stahl
Anton F.H. Stalenhoef
Bruce S. Stambler
Jonathan S. Stamler
Meir J. Stampfer
Kenneth Stanley
William C. Stanley
Alice V. Stanton
Randall C. Starling
Brian L. Stauffer
Charles Steenbergen
Philippe G. Steg
Coen D. Stehouwer
Evan A. Stein
Kenneth M. Stein
Paul D. Stein
Francene M. Steinberg
Helmut O. Steinberg
Susan F. Steinberg
Julia Steinberger
Gustav Steinhoff
Robin H. Steinhorn
Steve R. Steinhubl
Christoph Stellbrink
Kurt R. Stenmark
David W. Stepp
Andrew Steptoe
David M. Stern
Naftali Stern
Lynne Warner Stevenson
Duncan J. Stewart
Kerry J. Stewart
Jim Stewart
Julian M. Stewart
Ralph A. H. Stewart
Roland Stocker
Jean-Claude Stoclet
Katarzyna Stolarz
Claudia Stollberger
Gregg W. Stone
Neil J. Stone
Peter H. Stone
George A. Stouffer
Vibeke Strand
Timo E. Strandberg
John R. Stratton
Bodo E. Strauer
Arnold Strauss
William B. Strawn
S. Adam Strickberger
Jack P. Strong
Allan D. Struthers
Matthias Stuber
Jorg Stypmann
Ding-Feng Su
Isabella Sudano
Peter H. Sugden
Galina K Sukhova
Yao Sun
Zhonghua Sun
Thoralf M. Sundt, III
Ruey J. Sung
H. Robert Superko
Howard K. Surks
Mark A. Sussman
Thomas M. Suter
Fraser W.H. Sutherland
George R. Sutherland
John L. Sutko
Richard Sutton
Kim Sutton-Tyrrell
Hiroshi Suzuki
Ken Suzuki
Alan F. Sved
Lars G. Svensson
Madhav Swaminathan
Lorna Swan
Karl Swedberg
G. Sweeney
Michael O. Sweeney
Charles D. Swerdlow
Bernard Swynghedauw
Christer Sylven
Zoltán Szabó
Istvan Szokodi
Roman F. Sztajzel
Ira A. Tabas
Stefano Taddei
Heinrich Taegtmeyer
Peter Taggart
Kazuhiro Takahashi
Masato M. Takahashi
Bonpei Takase
Hiroshi Takayama
Yoshiyu Takeda
Satoshi Takeo
Akira Takeshita
Renato Talamini
William T. Talman
Rasa Tamosiuniene
Chee Eng Tan
Walter A. Tan
Toshihiro Tanaka
Weihong Tang
W.H. Wilson Tang
Yao Liang Tang
Rajendra K. Tangirala
Ataru Taniguchi
Laszlo B. Tanko
Felix C. Tanner
Jean-Claude Tardif
Robert B. Tate
Hideki Tatewaki
Allen J. Taylor
Andrew M. Taylor
Anne L. Taylor
Joan M. Taylor
W. Robert Taylor
James E. Tcheng
Guillermo J. Tearney
Alain Tedgui
Usha Tedrow
Paul S. Teirstein
David F. Teitel
George Tellides
Marije ten Wolde
Koon K. Teo
Oren M. Tepper
Gail R. ter Haar
Hiroki Teragawa
Enrique Teran
Dellara F. Terry
Daniel Teupser
David Thaler
Pierre Theroux
Aravinda Thiagalingam
Perumal Thiagarajan
Chris Thiemermann
Gaetano Thiene
Victor L.J.L. Thijssen
Anita C. Thomas
James D. Thomas
MaryLou Thompson
Paul D. Thompson
Kent Thornburg
Rong Tian
Uwe J.F. Tietge
Laurence Tiret
Marc D. Tischler
Susan Tiukinoy
Jonathan M. Tobis
Geoffrey H. Tofler
Stevan P. Tofovic
Naoki Tokita
Eran Toledo
Douglas M. Tollefsen
Robert J. Tomanek
Gordon F. Tomaselli
Marcello Tonelli
Peter Tontonoz
Eric Topol
Jan H.M. Tordoir
Per Tornvall
Olga H. Toro-Salazar
Christian Torp-Pedersen
Guillermo Torre-Amione
Jan Torzewski
Tor D. Tosteson
Peter P. Toth
Florence Toti
Arturo G. Touchard
Rhian M. Touyz
Jeffrey A. Towbin
Dwight A. Towler
Jonathan N. Townend
Paul A. Townsend
Maurizio Trevisan
Richard W. Troughton
Nathan A. Trueblood
Shen K. Tsai
Min-Fu Tsan
Teresa S.M. Tsang
Philip S. Tsao
Hung-Fat Tse
Etsuko Tsuda
Gozoh Tsujimoto
Katsuhiko Tsujioka
Hiroyuki Tsukui
Jack V. Tu
Michael L. Tuck
Rubin M. Tuder
Paul A. Tunick
Zoltan G. Turi
Craig D. Turnbull
Stephen T. Turner
Alexander G.G. Turpie
Katherine R. Tuttle
E. Murat Tuzcu
Marcel Twickler
Suresh C. Tyagi
Toshimitsu Uede
Per M. Ueland
Renan Uflacker
Cuno S.P.M. Uiterwaal
Gudrun Ulrich-Merzenich
Shin-Ichiro Umemura
Paul M. Underwood
Roger H. Unger
Thomas Unger
Zoltan Ungvari
Joseph L. Unthank
Gilbert R. Upchurch
Zsolt Urbán
Fumitaka Ushikubi
Viola Vaccarino
Marco Valgimigli
Patrick J.T. Vallance
Jesus G. Vallejo
Eric Van Belle
Gerald van Belle
Marc van Bilsen
Luc M. Van Bortel
Frans J. Van de Werf
Johanna G. van der Bom
Willem J. van der Giessen
Bernd van der Loo
Freek J. van der Meer
Irene M. van der Meer
Yvonne T. van der Schouw
Jolanda van der Velden
Ger J. van der Vusse
Miranda Van Eck
George F. Van Hare
C. Heleen van Ommen
Niels van Royen
Dirk J. van Veldhuisen
David R. Van Wagoner
Anne M. VanBuskirk
Mani A. Vannan
Nerea Varo
Sudesh Vasdev
Giuseppe Vassalli
Theodoros Vassilakopoulos
Guy Vassort
Stephen F. Vatner
Matteo Vatta
Douglas E. Vaughan
William K. Vaughn
Mark A. Veazie
James L. Velianou
Richard C. Venema
Paolo Verdecchia
Pieter D. Verdouw
Stefan Verheye
Petra Verhoef
Jean Philippe Verhoye
Subodh Verma
Richard L. Verrier
Francesco Versaci
Giorgio A. Vescovo
George W. Vetrovec
Aristidis Veves
G. Wesley Vick
Neill Videlefsky
Flordeliza S. Villanueva
Francisco Villarreal
D. Geoffrey Vince
Renaud Vincent
Jakob Vinten-Johansen
Francesco Violi
Maria L. Virella
Renu Virmani
Sami Viskin
Eric Vittinghoff
Barbara Voetsch
Michael Vogel
Robert A. Vogel
Paul G.A. Volders
Stefano Volpato
Klaus von Bergmann
Jan H. von der Thüsen
Arnold von Eckardstein
Robert Voswinckel
Atsuyuki Wada
Carol Wadham
Bernard Waeber
Lynne Wagenknecht
Andreas H. Wagner
Denisa D. Wagner
Galen S. Wagner
Louis K. Wagner
Peter D. Wagner
Shawn Wagner
Ron Waksman
Albert L. Waldo
Brian R. Walker
Lars Wallentin
B. Gunnar Wallin
John Wallwork
Edward P. Walsh
Peter N. Walsh
Dirk H. Walter
Thomas Walther
Bingcheng Wang
Donna H.Wang
Thomas J. Wang
Wei Wang
Xiaohong Wang
Yibin Wang
Zhiguo Wang
Carole A. Warnes
Karl Wasserman
David D. Waters
Hugh Watkins
Steve P. Watson
Wendy A. Wattigney
Gerald F. Watts
Sergio Waxman
W. Douglas Weaver
Catherine Webb
David J. Webb
Gary Webb
Steven A. Webber
Christian Weber
Karl T. Weber
Michael A. Weber
Nina C. Weber
Keith A. Webster
Mark W.I. Webster
William Weglicki
Chiming Wei
Li Wei
Max H. Weil
Hartmut Weiler
Janice Weinberg
Tanja Weinbrenner
Andrew R. Weintraub
William S. Weintraub
Michael Weis
Richard D. Weisel
Mary C. Weiser-Evans
Myron L. Weisfeldt
Daiana Weiss
Guenter Weiss
James N. Weiss
Robert G. Weiss
Neil J. Weissman
Jeffrey I. Weitz
Babette B. Weksler
Hein J. Wellens
Ian J. Welsby
Frederick G. Welt
Francine K. Welty
Stephen E. Welty
Nanette K. Wenger
Bruce M. Wentworth
Jolanda J. Wentzel
Rene R. Wenzel
Volker Wenzel
Gerald S. Werner
Rainer Wessely
Malcolm West
Rudi G. Westendorp
Justin Westhuyzen
Charles V. Wetli
Glenn T. Wetzel
Lewis Wexler
Cornelia M. Weyand
Arthur E. Weyman
Andrew S. Weyrich
Christopher J. White
C. Roger White
Halina White
Richard H. White
William B. White
Patrick L. Whitlow
J. Lindsay Whitton
Mark H. Wholey
Lawrence Wickerham
Samuel A. Wickline
Petr Widimsky
Susan E. Wiegers
Wouter Wieling
FrankWiesmann
William Wijns
David J. Wilber
Arthur A.M. Wilde
Rachel P. Wildman
Markus J. Wilhelm
e25
Heinrike Wilkens
Ian B. Wilkinson
Bruce L. Wilkoff
Walter C. Willett
David O. Williams
Kevin J. Williams
Mark A. Williams
Paul T. Williams
Roberta G. Williams
R. Sanders Williams
Allison E. Willing
Scott R. Willoughby
Emily Wilson
Peter W. Wilson
Gayle L. Winters
Andrew L. Wit
Hanspeter Witschi
Maarten Witsenburg
Jacqueline C.M. Witteman
Rochus Witthaut
Fred H.M. Wittkampf
Joseph L.Witztum
Stephen D. Wiviott
J. Frederick Woessner
Wojciech Wojakowski
Philip A. Wolf
Michael S. Wolin
Robert Wolk
Kai C. Wollert
Ernst Wolner
Cheuk-kit Wong
LennieWong
Nathan D. Wong
John C. Wood
Mark A. Wood
Hermann Wrigge
Jackson T. Wright, Jr.
R. Scott Wright
Ed X. Wu
Gordon D. Wu
Joseph C. Wu
Kenneth K. Wu
D. George Wyse
Guohua Xi
Lei Xiao
Rui-Ping Xiao
Chengjie Xiong
Magdi H. Yacoub
Jay S. Yadav
Yoshiji Yamada
Kazuhiro Yamamoto
Yoshiharu Yamamoto
Atsushi Yamashita
Gan-Xin Yan
Xinhua Yan
Clyde W. Yancy
Qiong Yang
Xiao-Ping Yang
Zhihong Yang
Hirofumi Yasue
Frank Yatsu
e26
Richard Ye
Jerry Yee
Edward T.H. Yeh
Mao-Hsiung Yen
Midori A. Yenari
Shaw-Fang Yet
Alan C. Yeung
Seppo Yla-Herttuala
Agneta Yngve
Paul G. Yock
Junji Yodoi
Young-sup Yoon
Chaim Yosefy
Hiroshi Yoshida
Masayuki Yoshida
Noriko Yoshida
Pierre Y. Youinou
James B. Young
Lawrence H. Young
Martin E. Young
Pampee P. Young
Chun Yuan
Sun Yuhua
Salim Yusuf
Susanne Zadelaar
Kenneth G. Zahka
Osama O. Zaidat
Alberto Zanchetti
Faiez Zannad
Wojciech Zareba
Barry L. Zaret
Alan M. Zaslavsky
Marc Zee
Robert Y. Zee
Kenton J. Zehr
Andreas M. Zeiher
Darryl C. Zeldin
Andrey G. Zenovich
Uwe Zeymer
Cuihua Zhang
Yingyi Zhang
Guixiang Zhao
Zhi-Jie Zheng
Guangming Zhong
Robert Zhong
Jianhui Zhu
Xinsheng Zhu
Brenda K. Zierler
Felix Zijlstra
Michael R. Zile
Peter J. Zimetbaum
Marc Zimmermann
Jean-Marc Zingg
Douglas P. Zipes
Carmine Zoccali
William A. Zoghbi
Ai-Ping Zou
Ming Zou
Irving H. Zucker
Bram D. Zuckerman
Mahmoud Zureik
Jay L. Zweier
Dimitri E. Zylberstein

Issue Highlights: Editor`s Note: Editorials: Original Articles

Transcription

Similar documents