pysam documentation Release 0.8.0 Andreas Heger, Tildon Grant Belgrad, Martin Goodson

Transcription

pysam documentation
Release 0.8.0
Andreas Heger, Tildon Grant Belgrad, Martin Goodson
November 07, 2014
Contents
1
Contents
1.1 pysam - An interface for reading and writing SAM files
1.2 Working with BAM/SAM-formatted files . . . . . . . .
1.3 FAQ . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1.4 Glossary . . . . . . . . . . . . . . . . . . . . . . . . .
1.5 Developer’s guide . . . . . . . . . . . . . . . . . . . .
1.6 Release notes . . . . . . . . . . . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
3
3
21
24
26
27
27
2
Indices and tables
31
3
References
33
Bibliography
35
Python Module Index
37
i
ii
pysam documentation, Release 0.8.0
Author Andreas Heger and contributors
Date November 07, 2014
Version 0.8.0
The SAM/BAM format is a way to store efficiently large numbers of alignments [Li2009], such as those routinely are
created by next-generation sequencing methods.
This module provides a low-level wrapper around the samtools C-API using cython and a high-level API for convenient
access to the data in SAM/BAM formatted files. Also included is an interface to the tabix C-API for reading compressed
and indexed tabular data.
The current version wraps samtools-0.1.19 and tabix-0.2.6.
Contents
1
2
Contents
CHAPTER 1
Contents
1.1 pysam - An interface for reading and writing SAM files
Pysam is a python module that makes it easy to read and manipulate mapped short read sequence data stored in
SAM/BAM files. It is a lightweight wrapper of the samtools C-API.
This page provides a quick introduction in using pysam followed by the API. See Working with BAM/SAM-formatted
files for more detailed usage instructions.
To use the module to read a file in BAM format, create a Samfile object:
import pysam
samfile = pysam.Samfile( "ex1.bam", "rb" )
Once a file is opened you can iterate over all of the read mapping to a specified region using fetch(). Each iteration
returns a AlignedRead object which represents a single read along with its fields and optional tags:
for alignedread in samfile.fetch(’chr1’, 100, 120):
print alignedread
samfile.close()
To give:
EAS56_57:6:190:289:82
EAS56_57:6:190:289:82
EAS51_64:3:190:727:308
...
0
0
0
99
99
102
<<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<;
<<<<<<;<<<<<<<<<<;<<;<<<<;8<6;9;;2;
<<<<<<<<<<<<<<<<<<<<<<<<<<<::<<<844
69
137
99
You can also write to a Samfile:
import pysam
samfile = pysam.Samfile("ex1.bam", "rb")
pairedreads = pysam.Samfile("allpaired.bam", "wb", template=samfile)
for read in samfile.fetch():
if read.is_paired:
pairedreads.write(read)
pairedreads.close()
samfile.close()
An alternative way of accessing the data in a SAM file is by iterating over each base of a specified region using the
pileup() method. Each iteration returns a PileupColumn which represents all the reads in the SAM file that
3
CTCAAGGTT
AGGGGTGCA
GGTGCAGAG
map to a single base in the reference sequence. The list of reads are represented as PileupRead objects in the
PileupColumn.pileups property:
import pysam
samfile = pysam.Samfile("ex1.bam", "rb" )
for pileupcolumn in samfile.pileup( ’chr1’, 100, 120):
print
print ’coverage at base %s = %s’ % (pileupcolumn.pos , pileupcolumn.n)
for pileupread in pileupcolumn.pileups:
print ’\tbase in read %s = %s’ % (pileupread.alignment.qname, pileupread.alignment.seq[pileup
samfile.close()
The above code outputs:
coverage at base 99 = 1
base in read EAS56_57:6:190:289:82 = A
base in read EAS56_57:6:190:289:82 = G
base in read EAS56_57:6:190:289:82 = G
base in read EAS56_57:6:190:289:82 = G
base in read EAS51_64:3:190:727:308 = G
...
Commands available in csamtools are available as simple function calls. For example:
pysam.sort( "ex1.bam", "output" )
corresponds to the command line:
samtools sort ex1.bam output
Analogous to Samfile, a Tabixfile allows fast random access to compressed and tabix indexed tab-separated
file formats with genomic data:
import pysam
tabixfile = pysam.Tabixfile( "example.gtf.gz" )
for gtf in tabixfile.fetch(’chr1’, 1000, 2000):
print gtf.contig, gtf.start, gtf.end, gtf.gene_id
Tabixfile implements lazy parsing in order to iterate over large tables efficiently.
More detailed usage instructions is at Working with BAM/SAM-formatted files.
Note: Coordinates in pysam are always 0-based (following the python convention). SAM text files use 1-based
coordinates.
Note: The above examples can be run in the tests directory of the installation directory. Type ‘make’ before
running them.
See also:
http://code.google.com/p/pysam/ The pysam Google code page, containing source code and download instructions
4
Chapter 1. Contents
http://wwwfgu.anat.ox.ac.uk/~andreas/documentation/samtools/contents.html The pysam website containing
documentation
1.1.1 API
pysam.tabix_index(filename, force=False, seq_col=None, start_col=None, end_col=None, preset=None, meta_char=’#’, zerobased=False, min_shift=-1)
index tab-separated filename using tabix.
An existing index will not be overwritten unless force is set.
The index will be built from coordinates in columns seq_col, start_col and end_col.
The contents of filename have to be sorted by contig and position - the method does not check if the file is sorted.
Column indices are 0-based. Coordinates in the file are assumed to be 1-based.
If preset is provided, the column coordinates are taken from a preset. Valid values for preset are “gff”, “bed”,
“sam”, “vcf”, psltbl”, “pileup”.
Lines beginning with meta_char and the first line_skip lines will be skipped.
If filename does not end in ”.gz”, it will be automatically compressed. The original file will be removed and
only the compressed file will be retained.
If filename ends in gz, the file is assumed to be already compressed with bgzf.
min-shift sets the minimal interval size to 1<<INT; 0 for the old tabix index. The default of -1 is changed inside
htslib to the old tabix default of 0.
returns the filename of the compressed data
pysam.tabix_compress(filename_in, filename_out, force=False)
compress filename_in writing the output to filename_out.
Raise an IOError if filename_out already exists, unless force is set.
class pysam.Tabixfile
(filename, mode=’r’, parser = None)
opens a tabix file for reading. A missing index (filename + ”.tbi”) will raise an exception. index specifies an
alternative name of the index.
parser sets the default parser for this tabix file. If parser is None, the results are returned as an unparsed string.
Otherwise, parser is assumed to be a functor that will return parsed data (see for example asTuple() and
asGTF()).
close(self )
closes the pysam.Tabixfile.
contigs
chromosome names
fetch(self, reference=None, start=None, end=None, region=None, parser=None)
fetch one or more rows in a region using 0-based indexing. The region is specified by reference, start and
end. Alternatively, a samtools region string can be supplied.
Without reference or region all entries will be fetched.
If only reference is set, all reads matching on reference will be fetched.
If parser is None, the default parser will be used for parsing.
1.1. pysam - An interface for reading and writing SAM files
5
filename
filename associated with this object.
header
the file header.
Note: The header is returned as an iterator over lines without the newline character.
class pysam.asTuple
converts a tabix row into a python tuple.
Access is by numeric index.
class pysam.asGTF
converts a tabix row into a GTF record with the following fields:
contig contig
feature feature
source source
start genomic start coordinate (0-based)
end genomic end coordinate plus one (0-based)
score feature score
strand strand
frame frame
attributes attribute string.
GTF formatted entries also defined the attributes:
gene_id the gene identifier
transcript_ind the transcript identifier
class pysam.asVCF
converts a tabix row into a VCF record with the following fields:
contig contig
pos chromosomal position, zero-based
id id
ref reference
alt alt
qual qual
filter filter
info info
format format specifier.
Access to genotypes is via index:
contig = vcf.contig
first_sample_genotype = vcf[0]
second_sample_genotype = vcf[1]
6
Chapter 1. Contents
class pysam.asBed
converts a tabix row into a bed record with the following fields:
contig contig
start genomic start coordinate (zero-based)
end genomic end coordinate plus one (zero-based)
name name of feature.
score score of feature
strand strand of feature
thickStart thickStart
thickEnd thickEnd
itemRGB itemRGB
blockCount number of bocks
blockSizes ‘,’ separated string of block sizes
blockStarts ‘,’ separated string of block genomic start positions
Only the first three fields are required. Additional fields are optional, but if one is defined, all the preceeding
need to be defined as well.
class pysam.GZIterator
GZIterator(filename, int buffer_size=65536)
next
x.next() -> the next value, or raise StopIteration
class pysam.GZIteratorHead
iterate line-by-line through gzip (or bgzip) compressed file returning comments at top of file.
next
pysam.tabix_iterator(infile, parser)
return an iterator over all entries in a file.
class pysam.tabix_generic_iterator(self, infile, parser)
iterate over infile.
Permits the use of file-like objects for example from the gzip module.
next(self )
class pysam.tabix_file_iterator
iterate over a compressed or uncompressed infile.
next
class pysam.VCF
NT_ALLELES = 2
NT_GENOTYPES = 4
NT_NR_ALLELES = 3
NT_NUMBER = 1
7
NT_PHASED_GENOTYPES = 5
NT_UNKNOWN = 0
compare_calls()
Utility function: compares two calls for equality
connect()
connect to tabix file.
convertGT()
convertGTback()
enter_default_format()
error()
fetch()
Parse a stream of VCF-formatted lines. Initializes class instance and return generator
format_format()
format_formatdata()
get_expected()
getfilter()
Dictionary of ##FILTER tags, as VCF.FORMAT values
getformat()
Dictionary of ##FORMAT tags, as VCF.FORMAT values
getheader()
List of header key-value pairs (strings)
getinfo()
Dictionary of ##INFO tags, as VCF.FORMAT values
getsamples()
List of samples in VCF file
ignoreerror()
inregion()
parse()
Parse a stream of VCF-formatted lines. Initializes class instance and return generator
parse_data()
parse_format()
parse_formatdata()
parse_header()
parse_heading()
setfilter()
Dictionary of ##FILTER tags, as VCF.FORMAT values
setformat()
Dictionary of ##FORMAT tags, as VCF.FORMAT values
setheader()
List of header key-value pairs (strings)
8
Chapter 1. Contents
setinfo()
Dictionary of ##INFO tags, as VCF.FORMAT values
setreference()
Provide a reference sequence; a Python class supporting a fetch(chromosome, start, end) method, e.g.
PySam.FastaFile
setregions()
setsamples()
List of samples in VCF file
setversion()
validate()
validate vcf record.
returns a validated record.
warnerror()
write()
Writes a VCF file to a stream, using a data generator (or list)
write_data()
write_header()
write_heading()
writeheader()
Writes a VCF header
class pysam.VCFRecord
vcf record.
initialized from data and vcf meta
alt
contig
error()
raise error.
filter
format
id
info
pos
qual
ref
samples
class pysam.Fastafile
(filename)
A FASTA file. The file is automatically opened.
The file expects an indexed fasta file.
9
TODO: add automatic indexing. add function to get sequence names.
close(self )
fetch(self, reference=None, start=None, end=None, region=None)
(reference = None, start = None, end = None, region = None)
fetch AlignedRead objects in a region using 0-based indexing.
The region is specified by reference, start and end.
fetch returns an empty string if the region is out of range or addresses an unknown reference.
If reference is given and start is None, the sequence from the first base is returned. Similarly, if end is
None, the sequence until the last base is returned.
Alternatively, a samtools region string can be supplied.
filename
number of filename associated with this object.
getReferenceLength(self, reference)
return the length of reference.
lengths
tuple with the lengths of reference sequences.
nreferences
number of reference sequences in the file.
references
tuple with the names of reference sequences.
class pysam.Fastqfile
(filename)
A FASTQ file. The file is automatically opened.
close(self )
close file.
filename
next
class pysam.AlignmentFile
*(filename, mode=None, template = None, referencenames = None, referencelengths = None, text = NULL,
header = None, add_sq_text = False, check_header = True, check_sq = True )*
A SAM/BAM formatted file. The file is automatically opened.
mode should be r for reading or w for writing. The default is text mode (SAM). For binary (BAM) I/O you
should append b for compressed or u for uncompressed BAM output. Use h to output header information in text
(TAM) mode.
If b is present, it must immediately follow r or w. Valid modes are r, w, wh, rb, wb and wbu. For instance, to
open a BAM formatted file for reading, type:
f = pysam.AlignmentFile(’ex1.bam’,’rb’)
If mode is not specified, we will try to auto-detect in the order ‘rb’, ‘r’, thus both the following should work:
10
Chapter 1. Contents
f1 = pysam.AlignmentFile(’ex1.bam’ )
f2 = pysam.AlignmentFile(’ex1.sam’ )
If an index for a BAM file exists (.bai), it will be opened automatically. Without an index random access to
reads via fetch() and pileup() is disabled.
For writing, the header of a SAM file/BAM file can be constituted from several sources (see also the samtools
format specification):
1.If template is given, the header is copied from a another AlignmentFile (template must be of type AlignmentFile).
2.If header is given, the header is built from a multi-level dictionary. The first level are the four types (‘HD’,
‘SQ’, ...). The second level are a list of lines, with each line being a list of tag-value pairs. The header is
constructed first from all the defined fields, followed by user tags in alphabetical order.
3.If text is given, new header text is copied from raw text.
4.The names (referencenames) and lengths (referencelengths) are supplied directly as lists. By default,
‘SQ’ and ‘LN’ tags will be added to the header text. This option can be changed by unsetting the flag
add_sq_text.
By default, if a file is opened in mode ‘r’, it is checked for a valid header (check_header = True) and a definition
of chromosome names (check_sq = True).
close(self )
closes the pysam.AlignmentFile.
count(self, reference=None, start=None, end=None, region=None, until_eof=False)
(reference = None, start = None, end = None, region = None, callback = None, until_eof = False)
count reads region using 0-based indexing. The region is specified by reference, start and end. Alternatively, a samtools region string can be supplied.
Note that a SAM file does not allow random access. If region or reference are given, an exception is raised.
fetch(self, reference=None, start=None, end=None, region=None, tid=None, callback=None, until_eof=False, reopen=True)
fetch aligned reads in a region using 0-based indexing. The region is specified by reference, start and end.
Alternatively, a samtools region string can be supplied.
Without reference or region all mapped reads will be fetched. The reads will be returned ordered by
reference sequence, which will not necessarily be the order within the file.
If until_eof is given, all reads from the current file position will be returned in order as they are within the
file. Using this option will also fetch unmapped reads.
If reopen is set to true, the iterator returned will receive its own filehandle to the htsfile effectively opening
its own copy of the file. The default behaviour is to re-open in order to safely work with multiple concurrent
iterators on the same file. Re-opening a htsfile creates some overhead, so when using many calls to fetch()
reopen can be set to False to gain some speed. Also, the tell() method will only work if reopen is set to
False.
If only reference is set, all reads aligned to reference will be fetched.
Note that a SAM file does not allow random access. If region or reference are given, an exception is raised.
filename
getrname(self, tid)
convert numerical tid into reference name.
11
gettid(self, reference)
convert reference name into numerical tid
returns -1 if reference is not known.
head(self, n)
return iterator over the first n alignments.
This is useful for inspecting the bam-file.
header
header information within the sam file. The records and fields are returned as a two-level dictionary.
lengths
tuple of the lengths of the reference sequences.
pysam.AlignmentFile.references
The lengths are in the same order as
mapped
total number of mapped alignments in file.
mate(self, AlignedSegment read)
return the mate of AlignedSegment read.
Throws a ValueError if read is unpaired or the mate is unmapped.
Note: Calling this method will change the file position. This might interfere with any iterators that have
not re-opened the file.
Note: This method is too slow for high-throughput processing. If a read needs to be processed with its
mate, work from a read name sorted file or, better, cache reads.
next
nocoordinate
total number of reads without coordinates
nreferences
number of reference sequences in the file.
pileup(self, reference=None, start=None, end=None, region=None, **kwargs)
perform a pileup within a region. The region is specified by reference, start and end (using 0-based
indexing). Alternatively, a samtools region string can be supplied.
Without reference or region all reads will be used for the pileup. The reads will be returned ordered by
reference sequence, which will not necessarily be the order within the file.
The method returns an iterator of type pysam.IteratorColumn unless a callback is provided. If a
*callback is given, the callback will be executed for each column within the region.
Note that SAM formatted files do not allow random access. In these files, if a region or reference are given
an exception is raised.
Optional kwargs to the iterator:
stepper
The stepper controlls how the iterator advances. Possible options for the stepper are
all use all reads for pileup.
pass
12
Chapter 1. Contents
skip reads in which any of the following flags are set:
BAM_FSECONDARY, BAM_FQCFAIL, BAM_FDUP
BAM_FUNMAP,
samtools same filter and read processing as in csamtools pileup
fastafile
A FastaFile object
mask Skip all reads with bits set in mask if mask=True.
max_depth Maximum read depth permitted. The default limit is 8000.
truncate By default, the samtools pileup engine outputs all reads overlapping a region (see note below). If truncate is True and a region is given, only output columns in the exact region specificied.
Note: all reads which overlap the region are returned. The first base returned will be the first base of the
first read not necessarily the first base of the region used in the query.
references
tuple with the names of reference sequences.
reset(self )
reset file position to beginning of read section.
seek(self, uint64_t offset, int where=0)
move file pointer to position offset, see pysam.AlignmentFile.tell().
tell(self )
return current file position
text
full contents of the sam file header as a string.
unmapped
total number of unmapped reads in file.
write(self, AlignedSegment read) → int
write a single pysam.AlignedSegment to disk.
returns the number of bytes written.
class pysam.IteratorRow
IteratorRow(AlignmentFile samfile, int reopen=True) abstract base class for iterators over mapped reads.
Various iterators implement different behaviours for wrapping around contig boundaries. Examples
include:
pysam.IteratorRowRegion iterate within a single contig and a defined region.
pysam.IteratorRowAll iterate until EOF. This iterator will also include unmapped reads.
pysam.IteratorRowAllRefs iterate over all reads in all reference sequences.
The method AlignmentFile.fetch() returns an IteratorRow.
Note: It is usually not necessary to create an object of this class explicitely. It is returned as a result
of call to a AlignmentFile.fetch().
13
class pysam.IteratorColumn
abstract base class for iterators over columns.
IteratorColumn objects wrap the pileup functionality of samtools.
For reasons of efficiency, the iterator points to the current pileup buffer. The pileup buffer is updated at every
iteration. This might cause some unexpected behavious. For example, consider the conversion to a list:
f = AlignmentFile("file.bam", "rb")
result = list( f.pileup() )
Here, result will contain n objects of type PileupProxy for n columns, but each object in result will
contain the same information.
The desired behaviour can be achieved by list comprehension:
result = [ x.pileups() for x in f.pileup() ]
result will be a list of n lists of objects of type PileupRead.
If the iterator is associated with a Fastafile using the addReference() method, then the iterator will
export the current sequence via the methods getSequence() and seq_len().
Optional kwargs to the iterator:
stepper The stepper controls how the iterator advances.
Valid values are None, “all” or “samtools”.
The default stepper “all” uses all reads for computing the pileup. This corresponds to the mpileup options
“-B” and “-A”.
The stepper “samtools” uses the mpileup default parameterization to advance.
fastafile A FastaFile object
max_depth maximum read depth. The default is 8000.
addReference(self, Fastafile fastafile)
add reference sequences in fastafile to iterator.
hasReference(self )
return true if iterator is associated with a reference
seq_len
current sequence length.
class pysam.AlignedSegment
AlignedSegment() Class representing an aligned segment.
This class stores a handle to the samtools C-structure representing an aligned read. Member read
access is forwarded to the C-structure and converted into python objects. This implementation should
be fast, as only the data needed is converted.
For write access, the C-structure is updated in-place. This is not the most efficient way to build BAM
entries, as the variable length data is concatenated and thus needs to be resized if a field is updated.
Furthermore, the BAM entry might be in an inconsistent state.
One issue to look out for is that the sequence should always be set before the quality scores. Setting
the sequence will also erase any quality scores that were set previously.
In Python 3, the fields containing sequence and quality (seq, query, qual and qqual) data are of type
str. Other string data, such as the qname field and strings in the tags tuple, is represented as unicode
strings. On assignment, both bytes and unicode objects are allowed, but unicode strings must contain
only ASCII characters.
14
Chapter 1. Contents
aend
alen
aligned_pairs
bin
properties bin
blocks
cigar
cigarstring
the cigar alignment as a string.
The cigar string is a string of alternating integers and characters denoting the length and the type of an
operation.
Note: The order length,operation is specified in the SAM format. It is different from the order of the
cigar property.
Returns None if not present.
To unset the cigarstring, assign None or the empty string.
cigartuples
the cigar alignment. The alignment is returned as a list of tuples of (operation, length).
If the alignment is not present, None is returned.
The operations are:
M
I
D
N
S
H
P
=
X
BAM_CMATCH
BAM_CINS
BAM_CDEL
BAM_CREF_SKIP
BAM_CSOFT_CLIP
BAM_CHARD_CLIP
BAM_CPAD
BAM_CEQUAL
BAM_CDIFF
0
1
2
3
4
5
6
7
8
Note: The output is a list of (operation, length) tuples, such as [(0, 30)]. This is different from the
SAM specification and the cigarstring property, which uses a (length, operation) order, for example:
30M.
To unset the cigar property, assign an empty list or None.
compare(self, AlignedSegment other)
return -1,0,1, if contents in this are binary <,=,> to other
flag
properties flag
getAlignedPairs(self )
a list of aligned read and reference positions.
Unaligned position are marked by None.
getBlocks(self )
a list of start and end positions of aligned gapless blocks.
15
The start and end positions are in genomic coordinates.
Blocks are not normalized, i.e. two blocks might be directly adjacent. This happens if the two blocks are
separated by an insertion in the read.
getOverlap(self, uint32_t start, uint32_t end)
return number of aligned bases of read overlapping the interval start and end on the reference sequence.
Return None if cigar alignment is not available.
getReferencePositions(self )
a list of reference positions that this read aligns to.
inferQueryLength(self )
inferred read length from CIGAR string.
Returns None if CIGAR string is not present.
inferred_length
is_duplicate
true if optical or PCR duplicate
is_paired
true if read is paired in sequencing
is_proper_pair
true if read is mapped in a proper pair
is_qcfail
true if QC failure
is_read1
true if this is read1
is_read2
true if this is read2
is_reverse
true if read is mapped to reverse strand
is_secondary
true if not primary alignment
is_unmapped
true if read itself is unmapped
isize
mapping_quality
mapping quality
mapq
mate_is_reverse
true is read is mapped to reverse strand
mate_is_unmapped
true if the mate is unmapped
mpos
mrnm
next_reference_id
the reference id of the mate/next read.
16
Chapter 1. Contents
next_reference_start
the position of the mate/next read.
opt(self, tag)
retrieves optional data given a two-letter tag
overlap(self )
pnext
pos
positions
qend
qlen
qname
qqual
qstart
qual
query
query_aligment_length
length of the aligned query sequence.
This is equal to qend - qstart
query_alignment_end
end index of the aligned query portion of the sequence (0-based, exclusive)
query_alignment_length
length of the query template. This includes soft-clipped bases and is equal to len(seq).
This property is read-only.
Returns 0 if not available.
query_alignment_qualities
aligned query sequence quality values (None if not present). These are the quality values that correspond
to query, that is, they exclude qualities of soft clipped bases. This is equal to qual[qstart:qend].
This property is read-only.
In Python 3, this property is of type bytes.
query_alignment_sequence
aligned portion of the read.
This is a substring of seq that excludes flanking bases that were soft clipped (None if not present). It is
equal to seq[qstart:qend].
In Python 3, this property is of type bytes. Assigning a unicode string to it consisting of ASCII characters
only will work, but is inefficient.
SAM/BAM files may include extra flanking bases that are not part of the alignment. These bases may be
the result of the Smith-Waterman or other algorithms, which may not require alignments that begin at the
first residue or end at the last. In addition, extra sequencing adapters, multiplex identifiers, and low-quality
bases that were not considered for alignment may have been retained.
17
query_alignment_start
start index of the aligned query portion of the sequence (0-based, inclusive).
This the index of the first base in seq that is not soft-clipped.
query_length
the observed query template length
query_name
the query template name (None if not present)
query_qualities
read sequence base qualities, including soft clipped bases (None if not present).
In Python 3, this property is of type bytes and assigning a unicode string to it consisting of ASCII characters
Note that to set quality scores the sequence has to be set previously as this will determine the permitted
length of the quality score array.
This method raises a ValueError if the length of the quality scores and the sequence are not the same.
query_sequence
read sequence bases, including soft clipped bases (None if not present).
In Python 3, this property is of type bytes and assigning a unicode string to it consisting of ASCII characters
Note that assigning to seq will invalidate any quality scores. Thus, to in-place edit the sequence and quality
scores, copies of the quality scores need to be taken. Consider trimming for example:
q = read.qual
read.seq = read.seq[5:10]
read.qual = q[5:10]
The sequence is returned as it is stored in the BAM file. Some mappers might have stored a reverse
complement of the original read sequence.
reference_end
aligned reference position of the read on the reference genome.
aend points to one past the last aligned residue. Returns None if not available.
reference_id
reference ID
Note: This field contains the index of the reference sequence in the sequence dictionary. To obtain the
name of the reference sequence, use pysam.AlignmentFile.getrname()
reference_length
aligned length of the read on the reference genome.
This is equal to aend - pos. Returns None if not available.
reference_start
0-based leftmost coordinate
rlen
rname
rnext
seq
18
Chapter 1. Contents
setTag(self, tag, value, value_type=None, replace=True)
Set optional field of alignment tag to value. value_type may be specified, but if not the type will be inferred
based on the Python type of value
An existing value of the same tag will be overwritten unless replace is set to False.
tags
the tags in the AUX field.
This property permits convenience access to the tags. Changes it the returned list will not update the tags
automatically. Instead, the following is required for adding a new tag:
read.tags = read.tags + [("RG",0)]
This method will happily write the same tag multiple times.
tid
tlen
class pysam.PileupColumn
A pileup column. A pileup column contains all the reads that map to a certain target base.
tid chromosome ID as is defined in the header
pos the target base coordinate (0-based)
n number of reads mapping to this column
pileups list of reads (pysam.PileupRead) aligned to this column
class pysam.PileupProxy
PileupProxy() A pileup column. A pileup column contains
all the reads that map to a certain target base.
reference_id chromosome ID as is defined in the header
reference_pos the reference base coordinate (0-based)
nsegments number of segments mapping to this column
pileups list of reads (pysam.PileupRead) aligned to this column
This class is a proxy for results returned by the samtools pileup engine. If the underlying engine
iterator advances, the results of this column will change.
n
nsegments
number of reads mapping to this column.
pileups
list of reads (pysam.PileupRead) aligned to this column
pos
reference_id
the chromosome ID as is defined in the header
reference_pos
tid
class pysam.PileupRead
PileupRead() A read aligned to a column.
19
alignment
a pysam.AlignedSegment object of the aligned read
indel
indel length; 0 for no indel, positive for ins and negative for del
is_del
1 iff the base on the padded read is a deletion
is_head
is_tail
level
qpos
position of the read base at the pileup site, 0-based
class pysam.IndexedReads
IndexedReads(AlignmentFile samfile, int reopen=True) index a bamfile by read.
The index is kept in memory.
By default, the file is re-openend to avoid conflicts if multiple operators work on the same file. Set
reopen = False to not re-open samfile.
build(self )
build index.
find(self, qname)
pysam.toQualityString(qualities)
convert a list of quality score to the string representation used in the SAM format.
pysam.fromQualityString(quality_string)
return a list of quality scores from the stringn representation of quality scores used in the SAM format.
class pysam.Samfile
class pysam.AlignedRead
exception pysam.SamtoolsError(value)
exception raised in case of an error incurred in the samtools library.
class pysam.SamtoolsDispatcher(dispatch, parsers)
samtools dispatcher.
Emulates the samtools command line as module calls.
Captures stdout and stderr.
Raises a pysam.SamtoolsError exception in case samtools exits with an error code other than 0.
Some command line options are associated with parsers. For example, the samtools command “pileup -c”
creates a tab-separated table on standard output. In order to associate parsers with options, an optional list of
parsers can be supplied. The list will be processed in order checking for the presence of each option.
If no parser is given or no appropriate parser is found, the stdout output of samtools commands will be returned.
dispatch = None
getMessages()
parsers = None
20
Chapter 1. Contents
usage()
return the samtools usage information for this command
1.2 Working with BAM/SAM-formatted files
In order to follow the examples below, execute
make
in the test directory.
1.2.1 Opening a samfile
The first operation is to import the pysam module and open a pysam.Samfile:
import pysam
samfile = pysam.Samfile( "ex1.bam", "rb" )
The above command opens the file ex1.bam for reading. The b qualifier indicates that this is a BAM file. To open a
SAM file, type:
import pysam
samfile = pysam.Samfile( "ex1.bam", "r" )
1.2.2 Fetching reads mapped to a region
There are two ways to obtain the reads mapped to a genomic region. The first method follows the csamtools API and
works via a callback function. The callback will be executed for each alignment in a region:
def my_fetch_callback( alignment ):
print str(alignment)
samfile.fetch( ’seq1’, 10, 20, callback = my_fetch_callback )
Using a function object, work can be done on the alignments. The code below simply counts aligned reads:
class Counter:
def __init__(self):
self.counts = 0
def __call__(self, alignment):
self.counts += 1
c = Counter()
samfile.fetch( ’seq1’, 10, 20, callback = c )
print "counts=", c.counts
The second method uses python iterators. If you call pysam.Samfile.fetch() without a callback, an
iterator of the type pysam.IteratorRow is returned. It will iterate through mapped reads and return a
pysam.AlignedRead object for each:
iter = samfile.fetch( ’seq1’, 10, 20)
for x in iter: print str(x)
Note that both methods iterate through a BAM file on a read-by-read basis.
1.2. Working with BAM/SAM-formatted files
21
pysam.Samfile.fetch() returns all reads overlapping a region sorted by the first aligned base in the reference
sequence. Note that it will also return reads that are only partially overlapping with the region. Thus the reads returned
might span a region that is larger than the one queried.
1.2.3 Using the pileup-engine
The pileup engine of csamtools iterates over all reads that are aligned to a region. In contrast to fetching, the pileup
engine returns for each base in the reference sequence the reads that map to that particular position.
Again, there are two principal methods to iterate. The first works via a callback function:
def my_pileup_callback( pileups ):
print str(pileups)
samfile.pileup( ’seq1’, 10, 20, callback = my_pileup_callback )
The second method uses python iterators. The iterator pysam.IteratorColumn will iterate through each column
(reference bases) and return a list of aligned reads:
iter = samfile.pileup( ’seq1’, 10, 20 )
for x in iter: print str(x)
Aligned reads are returned as a pysam.PileupColumn.
1.2.4 Using samtools commands within python
Commands available in csamtools are available as simple function calls. For example:
pysam.sort( "ex1.bam", "output" )
corresponds to the command line:
samtools sort ex1.bam output
Command line options can be provided as arguments:
pysam.sort( "-n", "ex1.bam", "output" )
or:
pysam.sort( "-m", "1000000", "ex1.bam", "output" )
In order to get usage information, try:
print pysam.sort.usage()
Argument errors raise a pysam.SamtoolsError:
pysam.sort()
Traceback (most recent call last):
File "x.py", line 12, in <module>
pysam.sort()
File "/home/andreas/pysam/build/lib.linux-x86_64-2.6/pysam/__init__.py", line 37, in __call__
if retval: raise SamtoolsError( "\n".join( stderr ) )
pysam.SamtoolsError: ’Usage: samtools sort [-n] [-m <maxMem>] <in.bam> <out.prefix>\n’
Messages from csamtools on stderr are captured and are available using the getMessages() method:
22
Chapter 1. Contents
pysam.sort.getMessage()
Note that only the output from the last invocation of a command is stored.
1.2.5 Creating SAM/BAM files from scratch
The following example shows how a new BAM file is constructed from scratch. The important part here is that the
pysam.Samfile class needs to receive the sequence identifiers. These can be given either as a dictionary in a header
structure, as lists of names and sizes, or from a template file. Here, we use a header dictionary:
header = { ’HD’: {’VN’: ’1.0’},
’SQ’: [{’LN’: 1575, ’SN’: ’chr1’},
{’LN’: 1584, ’SN’: ’chr2’}] }
outfile = pysam.Samfile( tmpfilename, "wh", header = header )
a = pysam.AlignedRead()
a.qname = "read_28833_29006_6945"
a.seq="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG"
a.flag = 99
a.rname = 0
a.pos = 32
a.mapq = 20
a.cigar = ( (0,10), (2,1), (0,25) )
a.mrnm = 0
a.mpos=199
a.isize=167
a.qual="<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<"
a.tags = ( ("NM", 1),
("RG", "L1") )
outfile.write(a)
outfile.close()
1.2.6 Using streams
Pysam does not support reading and writing from true python file objects, but it does support reading and writing from
stdin and stdout. The following example reads from stdin and writes to stdout:
infile = pysam.Samfile( "-", "r" )
outfile = pysam.Samfile( "-", "w", template = infile )
for s in infile: outfile.write(s)
It will also work with BAM files. The following script converts a BAM formatted file on stdin to a SAM formatted file
on stdout:
infile = pysam.Samfile( "-", "rb" )
outfile = pysam.Samfile( "-", "w", template = infile )
for s in infile: outfile.write(s)
Note, only the file open mode needs to changed from r to rb.
1.2.7 Extending pysam
Using pyximport, it is (relatively) straight-forward to access pysam internals and the underlying samtools library. An
example is provided in the test directory. The example emulates the samtools flagstat command and consists of
three files:
1.2. Working with BAM/SAM-formatted files
23
1. The main script pysam_flagstat.py. The important lines in this script are:
import pyximport
pyximport.install()
import _pysam_flagstat
...
flag_counts = _pysam_flagstat.count( pysam_in )
The first part imports, sets up pyximport and imports the cython module _pysam_flagstat. The second
part calls the count method in _pysam_flagstat.
2. The cython implementation _pysam_flagstat.pyx. This script imports the pysam API via:
from csamtools cimport *
This statement imports, amongst others, AlignedRead into the namespace. Speed can be gained from declaring variables. For example, to efficiently iterate over a file, an AlignedRead object is declared:
# loop over samfile
cdef AlignedRead read
for read in samfile:
...
3. A pyxbld providing pyximport with build information. Required are the locations of the samtools and pysam
header libraries of a source installation of pysam plus the csamtools.so shared library. For example:
def make_ext(modname, pyxfilename):
from distutils.extension import Extension
import pysam, os
dirname = os.path.dirname( pysam.__file__ )[:-len("pysam")]
return Extension(name = modname,
sources=[pyxfilename],
extra_link_args=[ os.path.join( dirname, "csamtools.so")],
include_dirs = pysam.get_include(),
define_macros = pysam.get_defines() )
If the script pysam_flagstat.py is called the first time, pyximport will compile the cython extension
_pysam_flagstat.pyx and make it available to the script. Compilation requires a working compiler and cython
installation. Each time _pysam_flagstat.pyx is modified, a new compilation will take place.
pyximport comes with cython.
1.3 FAQ
1.3.1 pysam coordinates are wrong
pysam uses 0-based coordinates and the half-open notation for ranges as does python. Coordinates and intervals
reported from pysam always follow that convention.
Confusion might arise as different file formats might have different conventions. For example, the SAM format is
1-based while the BAM format is 0-based. It is important to remember that pysam will always conform to the python
convention and translate to/from the file format automatically.
The only exception is the region string in the Samfile.fetch() and Samfile.pileup() methods. This string
follows the convention of the samtools command line utilities. The same is true for any coordinates passed to the
samtools command utilities directly, such as pysam.mpileup().
24
Chapter 1. Contents
1.3.2 BAM files with a large number of reference sequences is slow
If you have many reference sequences in a bam file, the following might be slow:
track = pysam.Samfile(fname, "rb")
for aln in track.fetch():
pass
The reason is that track.fetch() will iterate through the bam file for each reference sequence in the order as it is defined
in the header. This might require a lot of jumping around in the file. To avoid this, use:
track = pysam.Samfile(fname, "rb")
for aln in track.fetch( until_eof = True ):
pass
This will iterate through reads as they appear in the file.
1.3.3 Weirdness with spliced reads in samfile.pileup(chr,start,end) given spliced
alignments from an RNA-seq bam file
Spliced reads are reported within samfile.pileup. To ignore these in your analysis, test the flags is_del == True
and indel=0 in the PileupRead object.
1.3.4 I can’t edit quality scores in place
Editing reads in-place generally works, though there is some quirk to be aware of. Assigning to AlignedRead.seq will
invalidate any quality scores in AlignedRead.qual. The reason is that samtools manages the memory of the sequence
and quality scores together and thus requires them to always be of the same length or 0.
Thus, to in-place edit the sequence and quality scores, copies of the quality scores need to be taken. Consider trimming
for example:
q = read.qual
read.seq = read.seq[5:10]
read.qual = q[5:10]
1.3.5 Why is there no SNPCaller class anymore?
SNP calling is highly complex and heavily parameterized. There was a danger that the pysam implementations might
show different behaviour from the samtools implementation, which would have caused a lot of confusion.
The best way to use samtools SNP calling from python is to use the pysam.mpileup() command and parse the
output directly.
1.3.6 I get an error ‘PileupProxy accessed after iterator finished’
Pysam works by providing proxy objects to objects defined within the C-samtools package. Thus, some attention must
be paid at the lifetime of objects. The following to code snippets will cause an error:
s = Samfile(’ex1.bam’)
for p in s.pileup(’chr1’, 1000,1010):
pass
1.3. FAQ
25
for pp in p.pileups:
print pp
The iteration has finished, thus the contents of p are invalid. A variation of this:
p = next(Samfile(’ex1.bam’).pileup(’chr1’, 1000, 1010))
print pp
Again, the iteration finishes as the temporary iterator created by pileup goes out of scope. The solution is to keep a
handle to the iterator that remains alive:
i = Samfile( ’ex1.bam’ ).pileup( ’chr1’, 1000, 1010)
p = next(i)
print pp
1.4 Glossary
BAM Binary SAM format. BAM files are binary formatted, indexed and allow random access.
cigar
An alignment format string. In the python API, the cigar alignment is presented as a list of tuples
(operation,length). For example, the tuple [ (0,3), (1,5), (0,2) ] refers to an alignment
with 3 matches, 5 insertions and another 2 matches.
column Reads that are aligned to a base in the reference sequence.
csamtools The samtools C-API.
fetching Retrieving all mapped reads mapped to a region.
pileup Pileup
Reference The sequence that a tid refers to. For example chr1, contig123.
region A genomic region, stated relative to a reference sequence. A region consists of reference name (‘chr1’), start
(100000), and end (200000). 0-based coordinates. Can be expressed as a string (‘chr1:10000:20000’)
SAM A textual format for storing genomic alignment information.
sam file A file containing aligned reads. The sam file can either be a BAM file or a TAM file.
samtools The samtools package.
tabix file A sorted, compressed and indexed tab-separated file created by the command line tool tabix or the
commands tabix_compress() and tabix_index(). The file is indexed by chromosomal coordinates.
tabix row A row in a tabix file. Fields within a row are tab-separated.
TAM Text SAM file. TAM files are human readable files of tab-separated fields. TAM files do not allow random
access.
target The sequence that a read has been aligned to. Target sequences have bot a numerical identifier (tid) and an
alphanumeric name (Reference).
tid The target id. The target id is 0 or a positive integer mapping to entries within the sequence dictionary in the
header section of a TAM file or BAM file.
26
Chapter 1. Contents
1.5 Developer’s guide
1.5.1 Code organization
The top level directory is organized in the following directories:
pysam Code specific to pysam
samtools Original and unmodified source code from csamtools. Use setup.py to obtain the latest code.
tests Examples and data for testing
1.5.2 Importing csamtools
Running setup.py will import the csamtools source code. The command:
python setup.py import PATH
where PATH points to a csamtools source directory. For example:
python setup.py import ~/samtools-0.1.6
Note that files will not be overwritten. To import all anew, delete all *.c and *.h files in the samtools directory
first.
1.5.3 Unit testing
Unit tests are in the scripts pysam_test.py and tabix_test.py.
1.5.4 Contributors
The following people have contributed to pysam:
• Andreas Heger
• Tildon Grant Belgrad
• Kevin Jacobs
• Florian Finkernagel
• Ben Schiller
• Marcel Martin
• Gerton Lunter
• Martin Goodson
• Leo Goodstadt
1.6 Release notes
1.6.1 Release 0.8.0
• Disabled features
1.5. Developer’s guide
27
– IteratorColumn.setMask() disabled as htslib does not implement this functionality?
• Not implemented yet:
– reading SAM files without header
– samtools stepper
• tabix needs to be re-indexed
• tabix iterators will not return comments (TODO: full iterator)
• tabix raises always ValueError for invalid intervals
1.6.2 Release 0.7.8
• added AlignedRead.setTag method
• added AlignedRead.blocks
• unsetting CIGAR strings is now possible
• empty CIGAR string returns empty list
• added reopen flag to Samfile.fetch()
• various bugfixes
1.6.3 Release 0.7.7
• added Fastafile.references, .nreferences and .lengths
• tabix_iterator now uses kseq.h for python 2.7
1.6.4 Release 0.7.6
• added inferred_length property
• issue 122: MACOSX getline missing, now it works?
• seq and qual can be set None
• added Fastqfile
1.6.5 Release 0.7.5
• switch to samtools 0.1.19
• issue 122: MACOSX getline missing
• issue 130: clean up tempfiles
• various other bugfixes
1.6.6 Release 0.7.4
• further bugfixes to setup.py and package layout
28
Chapter 1. Contents
1.6.7 Release 0.7.3
• further bugfixes to setup.py
• upgraded distribute_setup.py to 0.6.34
1.6.8 Release 0.7.2
• bugfix in installer - failed when cython not present
• changed installation locations of shared libraries
1.6.9 Release 0.7.1
• bugfix: missing PP tag PG records in header
• added pre-built .c files to distribution
1.6.10 Release 0.7
• switch to tabix 0.2.6
• added cigarstring field
• python3 compatibility
• added B tag handling
• added check_sq and check_header options to Samfile.__init__
• added lazy GTF parsing to tabix
• reworked support for VCF format parsing
• bugfixes
1.6.11 Release 0.6
• removed references to deprecated ‘samtools pileup’ functionality
• AlignedRead.tags now returns an empty list if there are no tags.
• added pnext, rnext and tlen
1.6.12 Release 0.5
• switch to samtools 0.1.16 and tabix 0.2.5
• improved tabix parsing, added vcf support
• re-organized code to permit linking against pysam
• added Samfile.positions and Samfile.overlap
1.6. Release notes
29
1.6.13 Release 0.4
• switch to samtools 0.1.12a and tabix 0.2.3
• added snp and indel calling.
• switch from pyrex to cython
• changed handling of samtools stderr
• added Samfile.count and Samfile.mate
• deprecated AlignedRead.rname, added AlignedRead.tid
1.6.14 Release 0.3
• added support for tabix files
• numerous bugfixes including
– permit simultaneous iterators on the same file
– working access to remote files
30
Chapter 1. Contents
CHAPTER 2
Indices and tables
Contents:
• genindex
• modindex
• search
31
32
Chapter 2. Indices and tables
CHAPTER 3
References
See also:
The samtools homepage http://samtools.sourceforge.net
The cython C-extensions for python http://cython.org/
The python language http://www.python.org
33
34
Chapter 3. References
Bibliography
[Li2009] The Sequence Alignment/Map format and SAMtools. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J,
Homer N, Marth G, Abecasis G, Durbin R; 1000 Genome Project Data Processing Subgroup. Bioinformatics.
2009 Aug 15;25(16):2078-9. Epub 2009 Jun 8. PMID: 19505943
35
36
Bibliography
Python Module Index
p
pysam, 5
37
38
Python Module Index
Index
A
D
addReference() (pysam.IteratorColumn method), 14
aend (pysam.AlignedSegment attribute), 15
alen (pysam.AlignedSegment attribute), 15
aligned_pairs (pysam.AlignedSegment attribute), 15
AlignedRead (class in pysam), 20
AlignedSegment (class in pysam), 14
alignment (pysam.PileupRead attribute), 19
AlignmentFile (class in pysam), 10
alt (pysam.VCFRecord attribute), 9
asBed (class in pysam), 6
asGTF (class in pysam), 6
asTuple (class in pysam), 6
asVCF (class in pysam), 6
dispatch (pysam.SamtoolsDispatcher attribute), 20
B
BAM, 26
bin (pysam.AlignedSegment attribute), 15
blocks (pysam.AlignedSegment attribute), 15
build() (pysam.IndexedReads method), 20
C
cigar, 26
cigar (pysam.AlignedSegment attribute), 15
cigarstring (pysam.AlignedSegment attribute), 15
cigartuples (pysam.AlignedSegment attribute), 15
close() (pysam.AlignmentFile method), 11
close() (pysam.Fastafile method), 10
close() (pysam.Fastqfile method), 10
close() (pysam.Tabixfile method), 5
column, 26
compare() (pysam.AlignedSegment method), 15
compare_calls() (pysam.VCF method), 8
connect() (pysam.VCF method), 8
contig (pysam.VCFRecord attribute), 9
contigs (pysam.Tabixfile attribute), 5
convertGT() (pysam.VCF method), 8
convertGTback() (pysam.VCF method), 8
count() (pysam.AlignmentFile method), 11
csamtools, 26
E
enter_default_format() (pysam.VCF method), 8
error() (pysam.VCF method), 8
error() (pysam.VCFRecord method), 9
F
Fastafile (class in pysam), 9
Fastqfile (class in pysam), 10
fetch() (pysam.AlignmentFile method), 11
fetch() (pysam.Fastafile method), 10
fetch() (pysam.Tabixfile method), 5
fetch() (pysam.VCF method), 8
fetching, 26
filename (pysam.AlignmentFile attribute), 11
filename (pysam.Fastafile attribute), 10
filename (pysam.Fastqfile attribute), 10
filename (pysam.Tabixfile attribute), 5
filter (pysam.VCFRecord attribute), 9
find() (pysam.IndexedReads method), 20
flag (pysam.AlignedSegment attribute), 15
format (pysam.VCFRecord attribute), 9
format_format() (pysam.VCF method), 8
format_formatdata() (pysam.VCF method), 8
fromQualityString() (in module pysam), 20
G
get_expected() (pysam.VCF method), 8
getAlignedPairs() (pysam.AlignedSegment method), 15
getBlocks() (pysam.AlignedSegment method), 15
getfilter() (pysam.VCF method), 8
getformat() (pysam.VCF method), 8
getheader() (pysam.VCF method), 8
getinfo() (pysam.VCF method), 8
getMessages() (pysam.SamtoolsDispatcher method), 20
getOverlap() (pysam.AlignedSegment method), 16
getReferenceLength() (pysam.Fastafile method), 10
39
getReferencePositions()
(pysam.AlignedSegment
method), 16
getrname() (pysam.AlignmentFile method), 11
getsamples() (pysam.VCF method), 8
gettid() (pysam.AlignmentFile method), 11
GZIterator (class in pysam), 7
GZIteratorHead (class in pysam), 7
mrnm (pysam.AlignedSegment attribute), 16
N
n (pysam.PileupProxy attribute), 19
next (pysam.AlignmentFile attribute), 12
next (pysam.Fastqfile attribute), 10
next (pysam.GZIterator attribute), 7
next (pysam.GZIteratorHead attribute), 7
H
next (pysam.tabix_file_iterator attribute), 7
hasReference() (pysam.IteratorColumn method), 14
next() (pysam.tabix_generic_iterator method), 7
head() (pysam.AlignmentFile method), 12
next_reference_id (pysam.AlignedSegment attribute), 16
header (pysam.AlignmentFile attribute), 12
next_reference_start (pysam.AlignedSegment attribute),
header (pysam.Tabixfile attribute), 6
16
nocoordinate (pysam.AlignmentFile attribute), 12
I
nreferences (pysam.AlignmentFile attribute), 12
nreferences (pysam.Fastafile attribute), 10
id (pysam.VCFRecord attribute), 9
nsegments (pysam.PileupProxy attribute), 19
ignoreerror() (pysam.VCF method), 8
NT_ALLELES (pysam.VCF attribute), 7
indel (pysam.PileupRead attribute), 20
NT_GENOTYPES (pysam.VCF attribute), 7
IndexedReads (class in pysam), 20
inferQueryLength() (pysam.AlignedSegment method), 16 NT_NR_ALLELES (pysam.VCF attribute), 7
NT_NUMBER (pysam.VCF attribute), 7
inferred_length (pysam.AlignedSegment attribute), 16
NT_PHASED_GENOTYPES (pysam.VCF attribute), 7
info (pysam.VCFRecord attribute), 9
NT_UNKNOWN (pysam.VCF attribute), 8
inregion() (pysam.VCF method), 8
is_del (pysam.PileupRead attribute), 20
O
is_duplicate (pysam.AlignedSegment attribute), 16
is_head (pysam.PileupRead attribute), 20
opt() (pysam.AlignedSegment method), 17
is_paired (pysam.AlignedSegment attribute), 16
overlap() (pysam.AlignedSegment method), 17
is_proper_pair (pysam.AlignedSegment attribute), 16
P
is_qcfail (pysam.AlignedSegment attribute), 16
is_read1 (pysam.AlignedSegment attribute), 16
parse() (pysam.VCF method), 8
is_read2 (pysam.AlignedSegment attribute), 16
parse_data() (pysam.VCF method), 8
is_reverse (pysam.AlignedSegment attribute), 16
parse_format() (pysam.VCF method), 8
is_secondary (pysam.AlignedSegment attribute), 16
parse_formatdata() (pysam.VCF method), 8
is_tail (pysam.PileupRead attribute), 20
parse_header() (pysam.VCF method), 8
is_unmapped (pysam.AlignedSegment attribute), 16
parse_heading() (pysam.VCF method), 8
isize (pysam.AlignedSegment attribute), 16
parsers (pysam.SamtoolsDispatcher attribute), 20
IteratorColumn (class in pysam), 13
pileup, 26
IteratorRow (class in pysam), 13
pileup() (pysam.AlignmentFile method), 12
PileupColumn (class in pysam), 19
L
PileupProxy (class in pysam), 19
lengths (pysam.AlignmentFile attribute), 12
PileupRead (class in pysam), 19
lengths (pysam.Fastafile attribute), 10
pileups (pysam.PileupProxy attribute), 19
level (pysam.PileupRead attribute), 20
pnext (pysam.AlignedSegment attribute), 17
pos (pysam.AlignedSegment attribute), 17
M
pos (pysam.PileupProxy attribute), 19
pos (pysam.VCFRecord attribute), 9
mapped (pysam.AlignmentFile attribute), 12
positions (pysam.AlignedSegment attribute), 17
mapping_quality (pysam.AlignedSegment attribute), 16
pysam (module), 5
mapq (pysam.AlignedSegment attribute), 16
mate() (pysam.AlignmentFile method), 12
Q
mate_is_reverse (pysam.AlignedSegment attribute), 16
mate_is_unmapped (pysam.AlignedSegment attribute), qend (pysam.AlignedSegment attribute), 17
16
qlen (pysam.AlignedSegment attribute), 17
mpos (pysam.AlignedSegment attribute), 16
qname (pysam.AlignedSegment attribute), 17
40
Index
qpos (pysam.PileupRead attribute), 20
qqual (pysam.AlignedSegment attribute), 17
qstart (pysam.AlignedSegment attribute), 17
qual (pysam.AlignedSegment attribute), 17
qual (pysam.VCFRecord attribute), 9
query (pysam.AlignedSegment attribute), 17
query_aligment_length (pysam.AlignedSegment attribute), 17
query_alignment_end (pysam.AlignedSegment attribute),
17
query_alignment_length (pysam.AlignedSegment attribute), 17
query_alignment_qualities (pysam.AlignedSegment attribute), 17
query_alignment_sequence (pysam.AlignedSegment attribute), 17
query_alignment_start
(pysam.AlignedSegment
attribute), 17
query_length (pysam.AlignedSegment attribute), 18
query_name (pysam.AlignedSegment attribute), 18
query_qualities (pysam.AlignedSegment attribute), 18
query_sequence (pysam.AlignedSegment attribute), 18
R
ref (pysam.VCFRecord attribute), 9
Reference, 26
reference_end (pysam.AlignedSegment attribute), 18
reference_id (pysam.AlignedSegment attribute), 18
reference_id (pysam.PileupProxy attribute), 19
reference_length (pysam.AlignedSegment attribute), 18
reference_pos (pysam.PileupProxy attribute), 19
reference_start (pysam.AlignedSegment attribute), 18
references (pysam.AlignmentFile attribute), 13
references (pysam.Fastafile attribute), 10
region, 26
reset() (pysam.AlignmentFile method), 13
rlen (pysam.AlignedSegment attribute), 18
rname (pysam.AlignedSegment attribute), 18
rnext (pysam.AlignedSegment attribute), 18
S
SAM, 26
sam file, 26
Samfile (class in pysam), 20
samples (pysam.VCFRecord attribute), 9
samtools, 26
SamtoolsDispatcher (class in pysam), 20
SamtoolsError, 20
seek() (pysam.AlignmentFile method), 13
seq (pysam.AlignedSegment attribute), 18
seq_len (pysam.IteratorColumn attribute), 14
setfilter() (pysam.VCF method), 8
setformat() (pysam.VCF method), 8
setheader() (pysam.VCF method), 8
Index
setinfo() (pysam.VCF method), 8
setreference() (pysam.VCF method), 9
setregions() (pysam.VCF method), 9
setsamples() (pysam.VCF method), 9
setTag() (pysam.AlignedSegment method), 18
setversion() (pysam.VCF method), 9
T
tabix file, 26
tabix row, 26
tabix_compress() (in module pysam), 5
tabix_file_iterator (class in pysam), 7
tabix_generic_iterator (class in pysam), 7
tabix_index() (in module pysam), 5
tabix_iterator() (in module pysam), 7
Tabixfile (class in pysam), 5
tags (pysam.AlignedSegment attribute), 19
TAM, 26
target, 26
tell() (pysam.AlignmentFile method), 13
text (pysam.AlignmentFile attribute), 13
tid, 26
tid (pysam.AlignedSegment attribute), 19
tid (pysam.PileupProxy attribute), 19
tlen (pysam.AlignedSegment attribute), 19
toQualityString() (in module pysam), 20
U
unmapped (pysam.AlignmentFile attribute), 13
usage() (pysam.SamtoolsDispatcher method), 20
V
validate() (pysam.VCF method), 9
VCF (class in pysam), 7
VCFRecord (class in pysam), 9
W
warnerror() (pysam.VCF method), 9
write() (pysam.AlignmentFile method), 13
write() (pysam.VCF method), 9
write_data() (pysam.VCF method), 9
write_header() (pysam.VCF method), 9
write_heading() (pysam.VCF method), 9
writeheader() (pysam.VCF method), 9
41

pysam documentation Release 0.8.0 Andreas Heger, Tildon Grant Belgrad, Martin Goodson

Transcription

Similar documents

Restraining Order Against Sam Lufti

pysam documentation Release 0.8.1 Andreas Heger, Tildon Grant Belgrad, Martin Goodson

Document 6437414

Exercise 1. Using Tophat/Cufflinks to analyze the RNAseq data.

(Harrisburg Area Community College Project), Series of 2016 Sta

MACHINE LEARNING

ONLINE ONLY AUCTION—Motorcycle, furniture, antiques, tools

—Think Brighter“ Cards

Machine Learning with WEKA

Attribute analysis of GPR and seismic data for material property