Full PDF - JBC Protein Synthesis and Degradation

Transcription

Protein Synthesis and Degradation:
ISG15 and ISG-15 linked proteins Can
Associate with Members of the Selective
Autophagic process, HDAC6 and
SQSTM1/p62
Hiroshi Nakashima, Tran Nguyen, William F.
Goins and Ennio Antonio Chiocca
J. Biol. Chem. published online November 26, 2014
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 0 references, 0 of which can be accessed free at
http://www.jbc.org/content/early/2014/11/26/jbc.M114.593871.full.html#ref-list-1
Downloaded from http://www.jbc.org/ by guest on December 4, 2014
Access the most updated version of this article at doi: 10.1074/jbc.M114.593871
JBC Papers in Press. Published on November 26, 2014 as Manuscript M114.593871
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M114.593871
ISG15 associates with HDAC6 and p62
ISG15 and ISG-15 linked proteins Can Associate with Members of the Selective Autophagic process,
HDAC6 and SQSTM1/p62*
Hiroshi Nakashima1, Tran Nguyen1 , William F. Goins2 and Ennio Antonio Chiocca1,3
1
Harvey Cushing Neuro-oncology Laboratories, Harvard Institutes of Medicine 9th floor, Department of
Neurosurgery and Institute for the Neurosciences at the Brigham and Women's Hospital, 4 Blackfan
Circle, Boston, MA 02115
2
Department of Microbiology & Molecular Genetics, University of Pittsburgh School of Medicine,
Pittsburgh, PA, USA
*Running title: ISG15 associates with HDAC6 and p62.
3
To whom correspondence should be addressed: E. Antonio Chiocca, Department of Neurosurgery,
Brigham and Women's Hospital, 75 Francis Street, Boston, MA USA, Tel.: (617) 732-6939; Fax: (617)
734-8342; E-mail: [email protected]
the molecular events that occur in this
process are not well known. Here, we show
that the C-terminal LRLRGG of ISG15
interacts with the ubiquitin zinc finger
(BUZ) domain of Histone Deacetylase 6
(HDAC6). Since HDAC6 is involved in the
autophagic clearance of ubiquitinated (Ub)
aggregates, during which SQSTM1/p62
plays a major role as a cargo adapter, we
also were able to confirm that p62 binds to
ISG15 protein and its conjugated proteins,
upon forced expression. Both HDAC6 and
p62 colocalize with ISG15 in an insoluble
fraction of the cytosol and this
colocalization was magnified by the
proteasome inhibitor, MG132. In addition,
ISG15 was degraded via the lysosome.
Overexpression of ISG15, which leads to an
increased conjugation level of the cellular
proteome, enhanced autophagic
degradation, independent of IFN signaling
transduction. These results thus indicate
that ISG15 conjugation marks proteins for
interaction with HDAC6 and p62 upon
forced stressful conditions, likely as a step
towards autophagic clearance.
The type I interferon (IFN) signaling
pathway is the quintessential intracellular
innate defense mechanism against invading
pathogens. It sets up a robust antiviral state,
rendering cells non-permissive for infection
Capsule
Background: ISG15 is a Ub-like protein that
conjugates cellular and pathogenic proteins
during the innate immune response.
Results: ISG15 associates with the selective
autophagic factors HDAC6 and p62, leading to
degradation of ISG15-conjugates.
Conclusion: The IFN response leads to ISG15
expression allowing for its association with
HDAC and p62. This may mark proteins for
autophagy.
Significance: This finding provides evidence
of an interferon-stimulated pathway linked to
autophagy.
ABSTRACT
The ubiquitin-like interferon (IFN)stimulated gene 15 (ISG15), and its specific
E1, E2 and E3 enzymes are
transcriptionally induced by type I
Interferons (IFNs). ISG15 conjugates newly
synthesized proteins. ISG15 linkage to
proteins appears to be an important
downstream IFN-signaling event that
discrimininates cellular and pathogenic
proteins synthesized during IFN stimulation,
from existing proteins. This eliminates
potentially pathogenic proteins, as the cell
attempts to return to normal homeostasis
after IFN “stressed” conditions. However,
1
Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Keywords: Autophagy, HDAC6, ISG15, SQSTM1, p62, post-translational modification (PTM), ubiquitin,
lysosome, virus, interferon
autophagy, which plays a role in cellular
homeostasis through sequestration of
intracellular materials including pathogens
within double membrane vesicles
(autophagosomes) that fuse with lysosomes
leading to degradation of delivered cellular
contents (7). Although starvation-induced,
non-selective autophagy recycles cytosolic
contents and organelles during limited nutrient
supply, nutrient-independent, basal or selective
autophagy eliminates misfolded proteins and
damaged organelles before the accumulation of
excessive amounts of cytosolic aggregates or
inclusion bodies at the microtubule organizing
center (MTOC) (8-10). It has been reported
that aggregate-prone proteins become marked
by the lysine 63 (K63)-linked polyubiquitin
chain that functionally distinguishes them from
UPS-targeted lysine 48 (K48)-linked ones
(11,12). In this context, the cargo adaptor
protein SQSTM1/p62 plays an important role
by preferentially binding K63-linked
polyubiquitinated proteins via an ubiquitin
associated (UBA) domain at its C-terminus. To
facilitate Ub-protein aggregates and
autophagic degradation, p62 forms self- and/or
hetero-oligomerization at its N-terminal PB1
domain and recruits the LC3 membrane
protein that is anchored in phagophore
membranes for autophagosome maturation
(13-15). During selective autophagy, the
cytosolic deacetylase HDAC6 is involved in
clearance of ubiquitin-prone aggregates
(10,16). Its C-terminal BUZ (a binder of
ubiquitin zinc finger) domain can bind free
mono- and poly-Ub chains (17,18). Both the
catalytic activity and the BUZ domain are
required for HDAC6 to facilitate clearance of
ubiquitin-prone aggregates (also referred to as
"aggrephagy") and HDAC6 promotes
autophagosome-lysosome fusion through the
cortactin-dependent actin remodeling
machinery in mouse embryonic fibroblasts
(MEF) cells (19).
In this report, we report that forced
expression of HDAC6 leads to interaction with
p62 and ISG15 that structurally resembles
K63-diUb, and its ISGylated substrates,
rendering them targets for lysosomal
degradation. ISG15 localized to cytosolic
inclusion bodies with HDAC6 and p62.
2
and replication. Upon IFNs’ binding to their
receptors (type I interferon receptors,
IFNARs), plasma-membrane resident STATs
are activated through phosphorylation by
Jak1/TYK2 kinases. This leads to subsequent
translocation of STATs into nuclei where they
bind to a cis-acting DNA element upstream of
IFN stimulated genes (ISGs), leading to ISGs
transcriptional activation. The ISG family of
proteins activates IFN signaling, virus
recognition factors or pattern-recognition
receptors (PRRs), protein kinase R (PKR),
ribonuclease L (RNaseL), Mx1 and ISG15 (1).
ISG15 is a diubiquitin-like protein, able to
conjugate to lysine residues of its substrate via
isopeptide bonds, utilizing the same enzymatic
cascade as that of Ubiquitin (2). Conjugation
by ISG15 (referred to as "ISGylation") onto de
novo synthesizing polypeptides on polysomes
proceeds through a series of enzymatic
reactions, mediated by the E1-activating
UbE1L, E2-conjugating UbcH8 and HECTtype E3 ligase Herc5, which are also all IFNinducible. There is also an inverse reaction
where the IFN-inducible UBP43/USP18
protease deconjugates ISG15 from conjugated
substrates (3). ISG15 broadly conjugates IFNinduced ISG genes and progeny viral proteins
(2). It has been shown that ISG15-knockout
mice were broadly susceptible to RNA and
DNA viruses (4). Several studies have found
that free ISG15 and ISGylated host and viral
proteins interfere in the processes of virion
egress and release from the cell during the
viral life cycle (4). The fate(s) of ISG15 and
ISG15-conjugated proteins, particularly those
that belong to pathogenic organelles and
particles, is assumed to be elimination, but the
pathway of this degradation is not well
understood. The 26S proteasome, responsible
for degrading ubiquinated proteins as part of
the canonical ubiquitin-proteasome system
(UPS), is not thought to play a role of
degradation of ISG15 conjugates (5,6).
While in general the UPS is involved
primarily in the degradation of single
molecules, the lysosome in the process of
(macro-) autophagy is more involved in
eliminating large multiple molecules,
organelles and microbes/viruses. Type I
interferons have also been reported to induce
Pharmacological induction of aggrephagy
became more prominent if ISG15 was
overexpressed. Therefore, our results suggest
that ISG15 augments p62-mediated aggresome
formation and their autophagic degradation
under conditions of cellular stress, such as
forced expression of genes, implying an
important role during intrinsic cellular defense.
EXPERIMENTAL PROCEDURES
Materials – Reagents: Human IFNβ 1a
(11410) was obtained from PBL Assay
Science. Proteasome inhibitor MG132 (40mM
stock in DMSO) was from EMD Millipore.
Lysosomal protease inhibitors pepstatin A
(20mM in DMSO), E64d (10mg/ml in DMSO)
were from Enzo Life Science. Tubacin was
kindly obtained from Dr. Stuart Schreiber’s
(Broad Institute, MIT/Harvard, Cambridge,
MA) (20). Doxcycline hyclate was purchased
from Sigma. Protease inhibitor mixtures,
complete EDTA-free and phosphatase
inhibitor mixtures, PhosSTOP were from
Roche. Recombinant GST-tagged HDAC6
protein was from EMD Millipore. GST-tagged
p62 was from Enzo Life Science. Human
ISG15 protein was from Boston Biochem.
Anti-FLAG M1 Agarose Affinity gel and
monoclonal anti-FLAG M1 antibody were
from Sigma-Aldrich. Immobilized GST
agarose and GST protein were from Thermo.
cDNA and lentiviral vectors: HDAC6 Flag
(13823), pcDNA-hISG15 (12447),
pFlagCMV2-UbcH8 (12442), pCAGGS-HAhUBE1L (12438) and HA-p62 (28027) were
purchased from Addgene. Human HERC5
cDNA (GenBank #BC140716) was obtained
from MGC cDNA library. Tet3G system and
lentivirus vectors (pLenti CMV rtTA3G Blast,
pLenti CMVTRE3G Neo DEST and pLenti
CMVTRE3G Puro DEST) were purchased
from Addgene. pGIPZ vector was purchased
from Open Biosystems, Inc. Antibodies:
Antibodies against ISG15 (sc-50366) and
HDAC6 (sc-28386) were from Santa Cruz.
Antibodies against FLAG M2 (F3165),
αTubulin (T6074), Acetylated αTubulin
(T6793) and SQSTM1/p62 (WH0008878M1)
were from Sigma. Antibodies against
Ubiquitin (3936), LC3B (2775) and Lamin
A/C (2032) were from Cell signaling.
3
Antibodies against HA (11-867) and GST
(ab34589) were from Roche and Abcam,
respectively, and GFP (598) from MBL.
Cell Culture and Transfection – 293A
(Life technologies) and U251 cells (ATCC)
were cultured in DMEM supplemented with
10% FBS, 100µg/ml penicillin/streptomycin
and 10mM HEPES at 37 ºC in a humidified
incubator of 5% CO2. For transfections, 293A
cells were seeded at 2 x 106 cells on 60-mm
dishes and transfected with vectors using
Lipofectamine 2000 (Life technologies)
following the supplier’s protocol.
DNA constructs - For mutant constructs:
HDAC6 point mutation at histidine 611 to
alanine (H611A), and deletions from residues
841-1195 (ΔCter), from 2-837 (ΔCD1/2), from
841-1053 (ΔSE14) and from 1133-1195
(ΔBUZ) were generated from a HDAC6 Flag
plasmid DNA by PCR (QuickChnge siteDirected Mutagenesis kit, Agilent
Technologies). For lentivirus packaging, some
HDAC6 constructs were also cloned in pGIPZ
at blunt-ended NotI and XbaI sites by inserting
the SpeI-XbaI fragments that contains a CMV
IE promoter and a HDAC6 CDS. ISG15
truncated mutants in the C-terminal end
peptides LRLRGG and aspartic acid (D) insert
(LRLRGGD) were also generated from a
pcDNA-hISG15 plasmid by PCR. The
sequences of all mutant constructs were
verified by DNA sequencing analyses. For the
ISG15-CFP construct, three repeated FLAG
sequences were added in ISG15 by PCR using
the primers (5’caccctcgagctccatatggactacaaagaccatgacggtgatt
a-3’ and 5’ttaggatcccgggcccgcccacccctcaggcgcaga-3’)
and pcDNA-hISG15 as template. These were
cloned in pENTR/D-TOPO (Life
Technologies). The FLAG-ISG15 fragment
was inserted in pmTurquoise2-Golgi (Addgene,
#36205) at XhoI/BamHI sites. FLAG-tagged
mTurquoise2 (referred to CFP in this study)
was previously engineered (unpublished data).
Gene transfer was performed either by
lipofectoamine 2000 (for 293), lipofectoamine
3000 (for U251) or by lentiviral infection. For
transduction of genes via lentiviral infection,
vectors were packaged in lentiviral vector
systems using 293T (ATCC) or 293FT cells
followed by sonication and centrifugation to
collect the supernatant as the insoluble fraction.
Protein interaction assays – For the in
vitro GST pull-down assay of p62, each 2µg of
recombinant GST-p62 or GST protein was
incubated with immobilized glutathione
agarose in the binding buffer (20mM Tris-Cl
[pH7.4], 50mM NaCl, 0.1% NP40, 25µg/ml
BSA, 1mM ATP, 20µM MG-132 and protease
inhibitors cocktail), followed by a three times
wash with the binding buffer. The
recombinant mature form of human ISG15
protein (2µg) was incubated with GST protein
bound agarose over-night at 4°C before
analysis by the immunoblot. The GST-HDAC6
pull down assay was performed using the cell
lysate of 293T cells that were transfected with
mutant ISG15 constructs. For
coimmunoprecipitation assay, cells were lysed
in a buffer containing 50mM Tris-Cl [pH7.4],
150mM NaCl, 1% Trition-X 100, 2mM EGTA,
40µM MG-132, PhosSTOP and protease
inhibitors cocktail. The lysates were incubated
with anti-FLAG M2 affinity gel over-night at
4°C. Immunocomplexes were collected by
centrifugation and analyzed by immunoblots.
Immunofluorescent microscopy analysis
– Cells were cultured on German glass round
coverslip (#1 thickness) and then were washed
with 37°C PBS once before fixation with 4%
paraformaldehyde (PFA) in PBS. For prepermeabilized cell preparation, washed cells
were incubated in extraction buffer (100mM
PIPES [pH6.9], 0.5mM MgCl2, 0.1mM EDTA
and 0.5% Trition X-100) for ~20 sec before
4% PFA fixation. The samples were quenched
with 50mM NH4Cl in PBS and permeabilized
with 50 µg/ml digitonin (EMD) for nonprepermeabilized condition. The samples were
washed with 0.1% gelatin in PBS and
incubated with diluted antibodies (1/200,
αTubulin and FLAG M; 1/50, p62 and ISG15)
followed by Alexa Fluor antibodies (1/200,
Life technologies). Nuclei were counterstained
with DAPI during the wash step and then
coverslips were mounted with VectaShield.
Fluorescent images were acquired with a Zeiss
LSM510 META or LSM710 confocal
microscopy system and processed using Image
J (1.48 or earlier version, NIH). Figure panels
were assembled using Adobe Illustrator CS5.
4
(Life technologies) by co-transfection with
packaging vectors, psPAX2 and pMD2.G (a
gift of Dr. Didier Trono, Switzerland),
followed by lentivirus infection. U251
expressing FLAG-HDAC6 WT and derivative
mutants were stably selected by G418
treatment after infection.
Dox-inducible ISG15 conjugation system
- Construction of the Dox-inducible ISG15
conjugation system was as follows: 2A peptide
linkage constructs between Ube1L and ISG15,
and between Herc5 and UbcH8 were generated
in pENTR/D-TOPO vectors with two-step
PCR using the following primer sets, as
described previously (21): UBE1L; 5’caccaagcttgccagcatggatgccctggacgcttcg-3’, 5’gtctcctgcttgctttaacagagagaagttcgtggctccggatccc
agctcatagtgcagaggtgggaagg-3’, ISG15; 5’gccacgaacttctctctgttaaagcaagcaggagacgtggaaga
aaaccccggtcctatggaattccatatgggctgggacc-3’ and
5’- caatgtatcttatcatgtctggatccccg-3’, Herc5; 5’caccgtcgacgccagcatggagcggaggtcgcggag-3’
and 5’gtctcctgcttgctttaacagagagaagttcgtggctccggatcc
gccaaatcctctgttgttgttgatgg-3’, UbcH8; 5’gccacgaacttctctctgttaaagcaagcaggagacgtggaaga
aaaccccggtcctgcgagcatgcgagtggtgaag-3’ and
5’- gctcgagttaggagggccggtccactcc-3’. Tet-on
constructs of these 2A peptide-linked
dicistronic vectors were generated in pLenti
CMVTRE3G Neo DEST and pLenti
CMVTRE3G Puro DEST using the gateway
cloning system (Life technologies). Lentivirusmediated transformed cell lines along with
rtTA3G were initially selected by G418,
puromycin and blastosidin S. Clonal cells were
analyzed by immunoblots using antibody
against ISG15 and we used clone.7-8 of U251
(referred to U251.ISG7-8) and clone.8 of 293A
(referred to 293.ISG8) in this study.
Protein soluble and insoluble fractions –
Cells were lysed in soluble lysis buffer (50mM
Tris-Cl [pH7.4], 150mM NaCl, 2.5mM EDTA,
0.5% Trition X-100, 40µM MG-132,
PhosSTOP and protease inhibitors cocktail)
and incubated on ice for 5 min. After
centrifugation at 13,000rpm, the supernatant
was collected in the tube as the soluble fraction,
whereas the pellet was dissolved in insoluble
lysis buffer (1% SDS in soluble lysis buffer),
RESULTS
HDAC6 associates with IFN-induced
ISG15 conjugated proteins –We first attempted
to analyze whether an interaction between
ISG15-conjugated substrates and HDAC6
occurred upon IFN treatment. We attempted
to utilize two commercially available
antibodies raised against endogenous HDAC6
to detect co-immunoprecipitates of HDAC6
with ISG15-conjugates in U251 exposed to
type 1 IFN. However, we were unable to
visualize co-immunoprecipitation of
endogenous HDAC6 with ISGylated substrates
(data not shown). Although there could be
multiple reasons for this, we reasoned that
perhaps we needed to over-express HDAC6
and/or the HDAC6 antibody was not
sufficiently avid to allow coimmunoprecipitations.
We thus performed a second series of
experiments whereby the lysates of human
U251 glioma cells, forced to express FLAGtagged HDAC6 by lentivirus transduction,
were immunoprecipitated with an antibody
against FLAG-peptides and the
coimmunoprecipitates of FLAG- HDAC6 were
analyzed by Western blots using antibodies
against ISG15 or Ubiquitin. Figure 1a shows
that IFN treatment led to ISG15 conjugation.
FLAG-HDAC6 co-immunoprecipated with
ISGylated substrates and this was even more
prominent when cell were treated by MG132, a
protease inhibitor that induces formation of
intracellular aggresomes. In comparison and in
contrast, there was a specific effect of MG132
on FLAG-HDAC6 association with
ubiquitinated substrates, independent of IFN
treatment (17,18). These data thus suggested
that there was a previously undescribed, yet
visible, association of forcedly expressed
FLAG-HDAC6 with IFN-induced ISGylated
substrates even in the absence of MG132 (i.e.
when the proteasome and the unfolded protein
system - UPS- is functional).
Next, we visualized the subcellular
localization of FLAG-HDAC6 and ISG15 in
IFNβ treated cells utilizing immunofluorescent
staining with antibodies against FLAG and
ISG15 (Fig. 1b). ISG15 displayed small
5
punctate stains in the cytoplasm with a
concentration in the perinuclear region where
FLAG-HDAC6 vacuoles also appeared to
partly localize, although co-localization was
minimal, if any. To examine whether this lack
of localization reflected insoluble aggregates,
live cells were permeabilized with a pulse of
TritonX-100 to remove soluble proteins from
cytosols prior to fixation (Fig. 1 c-d). In
permeabilized cells in the absence of
proteasomal inhibition, ISG15 punctate stains
were visualized in the same perinuclear region
as that of small HDAC6 subfractions (Fig. 1c).
However, in the presence of MG132
proteasome inhibition there was visually
intensified HDAC6 immunofluorescence with
a perinuclear aggregation pattern that now also
colocalized with ISG15 speckles (Fig. 1d).
Taken together, these results suggested that the
interaction between HDAC6 and ISG15 was
localized to detergent-resistant aggregates in
the perinuclear region and that proteasome
inhibition led to a prominent co-localization of
ISG15 and HDAC6 in the same aggregates.
HDAC6 binds ISG15 at the C-terminal
LRLRGG motif via a BUZ domain – To find
out which motif of HDAC6 interacts with
ISG15, we engineered U251 cells that stably
overexpress its FLAG-tagged full-length wildtype HDAC6 (WT), or its C-terminal deletion
mutant (ΔCter; Δ841-1195) or its catalytic
subsite mutant (H611A) (Fig. 2a).
Subsequently, we performed co-IP assays with
an antibody against FLAG peptides, using cell
lysates that had been treated with IFNβ. Figure
2b shows that ISG15 was bound to FLAGHDAC6 WT and FLAG-HDAC6H611A, but
not to FLAG-HDAC6ΔCter. To further map
the ISG15 binding site in residues 841-1195 of
the HDAC6 C-terminal region, we transiently
transfected FLAG-tagged full-length HDAC6
and truncation mutants constructs of HDAC6
that lackedthe BUZ domain (BUZ), or the
SE14 domain (SE14) or both catalytic
domains (CD1/2) (see Figure 2a) together
with the HA-tagged mature form of ISG15 in
293 cells. In addition to FLAG-HDAC6 WT,
figure 2c shows that ISG15
coimmunoprecipitated with the CD1/2 and
SE14, but not with the BUZ truncation
ISG15 also bound to p62. In fact, a pull-down
assay using recombinant GST-tagged p62 did
lead to direct binding of GST-p62 to ISG15
(Fig. 3a). This indicated that ISG15, like K63linked diUb, also directly bound to p62.
In order to test if p62 was involved in the
formation and clearance of aggregates of
ISGylated proteins, we engineered U251 cells
that expressed a doxycycline (Dox)-inducible
transcriptionally regulated ISG15, as well as
UbE1L, UbcH8 and Herc5, the enzymatic
components of the ISG15 conjugation cascade
(Fig. 3b). These cells thus would express the
ISG15 conjugation system upon Dox treatment,
independent of IFN. Figure 3c shows that one
of the isolated clones (U251.ISG7-8) showed
evidence of significant induction of ISGylation
under Dox treatment. We then sought to
determine if ISGylation affected proteins
associated with p62 in soluble vs. insoluble
cellular subfractions. Uninduced or Doxinduced cells were treated with pepstatin A and
E64d (PepA/E64d, inhibitors of lysosomal
proteases) and then soluble and insoluble
fractions of cell lysates were analyzed by
Western blots. Figure 3d shows that Doxtreatment induced ISGylation of the proteome
in both soluble and insoluble fractions and that
this was even more evident when cells were
treated with PepA/E64d. Interestingly, Dox
treatment resulted in perhaps a mild increase in
p62 levels in the soluble fraction, while LC3-II
levels were increased a bit more convincingly.
However, there was a clear increase by Dox of
p62 and LC3-II in the insoluble fraction which
was even more visible in PepA/E64d treated
cells. Similar findings were also obtained in
IFNβ-treated U251 cells (see Fig. 6). These
results suggested that induction of ISG15 and
ISGylation leads to upregulation of p62 and
LC3-II association with IGS15-conjugated
proteins ending up in the lysosomes, under
condition of both Dox-induced ISGylation and
IFN-stimulation (from Fig. 6). The association
with p62 and LC3-II strongly suggests an
autophagic mechanism for degradation of
ISG15.
To analyze the in vivo interaction
between p62 and ISG15-conjugated proteins,
we stably transduced 293 cells to express the
ISG15 conjugation system in response to Dox
6
mutant of HDAC6. Therefore, these findings
indicated that residues 1133-1195,
corresponding to a BUZ domain, were
responsible for ISG15 binding.
Based on this, we then sought to find the
motif in ISG15 responsible for binding to
HDAC6. It has been reported that the BUZ
domain of HDAC6 interacts with a terminal
conjugation motif of ubiquitin (ub), composed
of LRLRGG. This motif appears in Ubaggregates that contain free mono- or polyubiquitin chains (22). The mature form of
ISG15 also represents a carboxyl-terminus
LRLRGG motif and thus we asked if it also
bound to HDAC6 BUZ. We utilized a fulllength mature ISG15 (ISG15-WT) and four
mutants of ISG15 (ISG15-LRLRG; ISG15LRLR; ISG15-LRLRGGD; and ISG15-LRGG)
with deletions or additions at the C-terminus
residues (Fig. 2d). In vitro protein affinity
assays revealed that the full-length, wild-type
LRLRGG motif was the most efficient at
interacting with recombinant GST-tagged
HDAC6, while all the other mutant forms of
ISG15 failed to bind to GST-HDAC6 (Fig. 2e).
There was some relatively weak interaction
between the LRLRGG-D mutant with HDAC6.
Overall, these findings thus confirmed that the
ISG15 LRLRGG peptide motif is
indispensable for binding to the BUZ domain
of HDAC6.
ISG15 associates with p62, likely to
facilitate autophagosome/lysosome clearance
– The Ub-binding property of HDAC6 is
associated with formation and clearance of
organized aggregates (also called aggresomes),
as part of the autophagy-lysosome degradation
pathway (12,17,23). During this process, the
SQSTM1/p62 cargo protein forms aggregates
of ubiquitinated proteins and recruits LC3,
anchored in the phagophore membrane (24).
p62 preferentially binds with higher affinity to
K63-linked diUb, when compared to binding
to mono-ubiquitin and K48-linked diUb (25).
Our in silico analysis using the flexible
structure alignment (available on the PDB site:
http://www.rcsb.org/pdb/), predicted that the
structure of ISG15 (PDB ID: 1z2m)4 resembles
that of K63-linked diUb (PDB IDs; 2w9n)
rather than that of K48-linked diUb (PDB IDs;
3m3j) (26-29). We thus sought to determine if
contributes to the formation of ISG15containing aggregates in the MTOC.
An engineered ISG15 protein is a target
of lysosomal degradation – We also attempted
to detect ISG15-conjugate degradation using
an engineered ISG15 conjugate. For this, we
engineered a cyan- fluorescence protein (CFP)
fused ISG15 expression vector, in which the
C-terminal LRLRGG is linked to the Nterminal of mTurquoise2 (CFP) protein (Fig.
5a). As shown in Figure 5b, we could not
detect the fusion protein upon DNA
transfection in the absence of interferon, but
instead observed separate immunopositive
bands for ISG15 and mTurquoise2 proteins,
suggesting fairly prompt cleavage of the
expressed fusion protein, after transfection into
cells. This observation appears to agree with
that describing precursor processing of ISG15
to expose LRLRGG-terminal peptides by
proteases (30). We then took advantage of this
observed cleavage of ISG15-CFP protein to
evaluate its lysosomal degradation (Fig. 5c).
Similar to results of Fig.3, cleaved ISG15
protein was observed in the detergent insoluble
fraction and PepA/E64d treatment caused
accumulation of the ISG15 protein. These
findings thus suggested that ISG15 protein can
be a target of lysosomal degradation.
The deacetylase activity of HDAC6
contributes to ISG15 degradation – We had
shown In Fig. 2 that the BUZ domain of
HDAC6 was essential for binding to ISG15
protein and it has also been shown that
HDAC6’s deacetylase activity is involved in
the degradation of the aggresome, containing
ubiquitinated proteins via autophagy-lysosome
(10). In a similar fashion, we thus sought to
determine if HDAC6 activity was involved in
ISG15 degradation. Fig. 6 shows that type 1
IFN, as expected, visibly increased ISG15
levels and also mildly increased ISG15conjugates in both soluble and insoluble
fractions. When PepA/E64D lysosomal
protease inhibitors were added, there was a
visible increase in ISG15 levels in the
insoluble fraction. This suggests that ISG15
can be degraded by lysosomal proteases.
We then utilized Tubacin (20), a
relatively selective HDAC6 deacetylase
inhibitor, and observed a visible decrease of
7
(293.ISG8 cells), as shown in Fig. 3e. These
293.ISG8 cells were then transiently
transfected with human p62 containing a Cterminal FLAG epitope tag (FLAG-p62) or
empty vector (empty). Figure 3f shows that
FLAG-p62 coimmunoprecipitated with ISG15conjugated substrates. Interestingly, MG132
led to a visible decrease in FLAG-p62 levels,
in the input lysates that were extracted from
the detergent-containing lysis buffer (Fig. 3f).
To further try to understand this, we decided to
analyze the detergent-insoluble fraction for
p62 levels as a function of MG132 doses, with
and without Dox treatment. Figure 3g shows
that, in the absence of Dox, p62 was present
primarily in the soluble fraction without an
effect from proteasome inhibition. With Dox
(thus increasing ISGylation activity) and
increased doses of MG132, there was a visible
shift of p62 from the soluble to insoluble
fractiosn. Since MG132 treatment blocks
autophagic degradation pathway of aggregates,
there was also a MG132 dose-dependent
increase in LC3, ISGylated proteins and
HDAC6 in the insoluble fraction, although a
lot of these were still persistent in the soluble
fraction. These findings thus suggested that
ISGylation led to a shift of p62, HDAC6 and
LC3 into the insoluble aggregate fraction of
cells, which was detectable once the
proteasome was inhibited.
Therefore, to determine if p62 interacted
and directed ISG15 to accumulate in inclusion
bodies in response to IFN, we prepared prepermeabilized IFN-treated U251 cells and
immunostained them using antibodies against
p62, ISG15 and α-tubulin (Fig. 4). In the
absence of MG132, cells contained numerous
small punctuated areas of staining for p62
bodies in the cytosol, most of which also
colocalized with ISG15 (Fig. 4a). The p62positive puncta became visibly larger in
MG132 treated cells, and this was also true for
puncta in which ISG15 and p62 colocalized
(Fig. 4b). ISG15 puncta were also observed on
detergent-resistant stable microtubules,
regardless of MG132 (Fig. 4c-d), which
accumulated ISG15-positive large aggregates
at the microtubule-organizing center (MTOC)
(Fig. 4d). These results suggested that p62
ISG15-conjugation marks target substrates for
clearance via the autophagy-lysosomal
pathway, as proposed in the model shown in
Fig. 7.
We should note that the reported data
was mostly obtained under experimental
conditions of forced over-expression and have
not been able to detect this under normal,
homeostatic physiological conditions. This
implies that the observed results may occur
primarily when the cell is stressed (forced
over-expression of cDNAs, interferon
stimulation, inhibition of the proteasome and
lysosomal proteases).
The structural conformation of ISG15
resembles that of K63-linked diUb rather than
that of K48-linked diUb, known to associate
with the proteasomal pathway. K63-linkage
appears to function in homeostatic cellular
processes, including signal transduction (31).
In addition, when molecular chaperons and the
proteasome-degradation systems are unable to
unfold and thread misfolded/aggregated
proteins through the narrow interior proteolytic
chamber of the 26S proteasome, these proteins
get tagged with K63, designating them for the
autophagy-lysosome pathway (11,13).
Molecularly, this happens through p62 that
preferentially binds to polyubiquitinated
proteins with K63-linked chains instead of
those with K48-linked chains. This ends up
forming oligomeric aggregates of ubiquinated
proteins, organelles and intracellular pathogens
that lead to autophagic rather than proteasomal
degradation (15,25,32,33). This is also in
agreement with evidence indicating that K63linked polyubiquitin substrates are enriched in
intracellular inclusion bodies, which are also
sequestered into p62-LC3 marked
autophagosomes (34). Results in the present
study show that p62 also binds to non-covalent
ISG15 by pull-down assay and to ISG15conjugated proteins by coIP assay. In addition,
using a ISG15 fusion protein with CFP via
linkage of LRLRGG, we clearly showed that
ISG15 itself is a target of lysosomal
degradation (Fig. 5c). Therefore, this suggests
that p62 also directly targets ISG15 and
ISGylated peptides to form aggregates and
autophagosomes, in a manner that is similar to
p62 interaction with K63-linked poly-
DISCUSSION
The ubiquitin-like post-translational
modifier ISG15 is up-regulated during type 1
IFN stimulation of cells and it becomes
conjugated to newly synthesized proteins of
host cell and invading pathogens. Although
this conjugation can be reversed by a specific
protease UBP43/USP18 (3), it is not known
whether other cellular pathways may also be
operative. In this report, for the first time, we
show that: 1- ISG15 interacts via its LRLRGG
C-terminus motif with a BUZ domain of
cytosolic Ub-binding HDAC6, implicating
HDAC6 for a relevant role in ISG15’s function.
Since this interaction is the same as that known
to occur for (poly-) ubiquitin chains binding to
HDAC6, this also suggests that the ISG15
pathway may represent the IFN-stimulated
counterpart to the normal homeostatic
ubiquitin clearance pathway; 2- ISG15 also
interacts with the cargo-adapter protein,
SQSTM1/p62. Knowing that both p62 and
HDAC6 facilitate aggregate formation
(aggresomes) and clearance of ubiquitinated
cargo through the LC3-II marked
autophagosome and lysosome, this also
suggests that a similar process may be
occurring with ISGylation of proteins as Ublike cargo at innate immune response.
Therefore, our data strongly suggests that
8
ISG15 levels in both soluble and insoluble
fractions without much of a change in ISG15
conjugate levels. However, when PepA/E64D
lysosomal protease inhibitors were also added
there was no change in ISG15 levels. This
suggested that HDAC6 was needed for the
degradation of ISG15 by lysosomal proteases.
Tubacin also led to an increase of p62 and LC3
levels in the insoluble fraction. Therefore
inhibition of HDAC6 activity led to the
accumulation of p62 and LC3-II in the
insoluble fraction, suggesting inhibition of
lysosome-autophagosome fusion. It also
reduced total ISG15 levels in cells in response
to type 1 IFN, but this did not lead to an
increase in ISG15 when lysosomal proteases
were inhibited. Those results suggested that
HDAC6's deacetylase activity is important for
degradation of ISG15 via the lysosome.
evidence that HDAC6 directly binds to Ubconjugated proteins in vitro (12). We also
identify for the first time in this report that the
BUZ domain of HDAC6 interacts with the Cterminal LRLRGG peptide of free ISG15.
Coupled with the coIP evidence of FLAGHDAC6 interaction with ISG15 conjugates, we
speculate that HDAC6 may recognize and
associate with unanchored free ISG15 in the
p62 cargo, which also sequesters the substrates
of ISG15 conjugation.
The multifaceted adapter p62 plays
critical roles in the regulation of a broad range
of signaling pathways that respond to
inflammatory and oxidative stresses through its
binding to K63-linked Ub-proteins and related
binding partners such as tumor necrosis factor
receptor-associated factor (TRAF) 6 and
Kelch-like ECH-associated protein 1 (Keap1)
(31,41). ISG15 is also involved in innate
immune signaling pathway. In fact, IFNinduced ISGs proteins including IRF3 are
known substrates of ISG15 conjugation and
their function is modulated by ISGylation (42).
This report also shows for the first time that
p62 is involved in ISG15-mediated signaling
pathways, in a manner similar to published
reports related to p62 involvement in K63linked Ub-mediated signaling. However, it is
not known how p62 distinguishes ISG15conjugated proteins that remain active to
perform a function from those that are targets
for a degradation tag. One possible explanation
is that, for ISGylated proteins to remain active,
p62-scaffolding with ISG15 conjugates forms
without free ISG15 and/or free K63-Ub chains.
On the other hand, for proteins destined for
degradation, sequestration into disorganized
aggresomes occurs (and this could be induced
by blocking the UPS with MG132), in
combination with HDAC6 and LC3
recruitment (12). In fact, we did find
accumulation of free ISG15 in the detergentinsoluble fraction of cells with p62 and lipid
bound LC3-II as a function of MG132 dose.
Further, the catalytic inhibition of HDAC6
with Tubacin also suppressed lysosomal ISG15
degradation. Therefore, it is likely that type 1
IFN signaling induces ISG15, which in turn
strengthens the basal activity of selective
autophagy, leading to efficient removal of
9
ubiquitinated proteins being targeted to
autophagosomes.
ISG15 and its conjugates have been
shown to possess activity against several
viruses using cultured cells or animal models
(4). The antiviral mechanisms of ISG15
include inhibition of viral release and budding,
as well as direct ISG15 conjugation of cellular
proteins including antiviral factors (e.g. IRF3,
RIG-I, PKR) and other ISG proteins. Also,
ISG15 can be directly conjugated with capsid
proteins of papillomavirus (HPV) and Sindbis
virus (SIN) (2,35). However, it is unknown
how ISG15 modification of viral proteins acts
mechanistically. Our findings show that ISG15
not only colocalizes with p62 and HDAC6 in
the same intracellular punctuate areas (puncta),
but also associates with them. p62 and other
sequestrome-1-like receptors (SLRs) function
as cargo-adaptor proteins that target substrates
to autophagosomes via the LC3-interacting
region (LIR) motif. In xenophagy,
ubiquitination of invading bacteria is required
for antimicrobial autophagy through p62-cargo
recognition and degradation (36). In a similar
manner to antiviral autophagy (virophagy),
capsids of SIN and Chikungunya virus
(CHIKV) are targets of autophagosomes
through binding of p62 and CHIKV capsids
are also modified by ubiquitin (37,38).
Therefore, future studies should elucidate if
ISG15 enhances degradation or sequestration
of viral proteins via p62 and HDAC6 mediated
selective autophagy.
HDAC6 functions to deacetylate
cytoplasmic proteins (e.g. α-tubulin) and
catalytic inhibition leads to hyper-acetylation
of α-tubulin, which stimulates canonical (bulk)
autophagy by kinesin-1 recruitment to
microtubules (MT) for autophagosome
transport toward the MTOC (39,40). In noncanonical (selective) autophagy, HDAC6
regulates the fusion of autophagosome and
lysosome through both catalytical deacetylase
and ubiquitin binding activities (10). We also
observed that this deacetylase activity is
associated with ISG15 degradation via
lysosome-autophagosome (Fig. 6). HDAC6
preferentially interacts with K63-linked
polyubiquitinated protein aggregates in vivo
(16). However, there is no biochemical
ubiquitin and ISG15-tagged unwelcome
proteins and pathogens through p62 and
HDAC6.
In summary, our studies provide novel
evidence for ISG15 association with HDAC6
and p62, implying that ISGylation can lead to
autophagic degradation, in pathways that are
similar to those utilized by the Ub system.
ISG15 mediated protein conjugation may thus
be the IFN based system that, together with or
in lieu of Ub-based selective autophagy, allows
the cell to use autophagy as an intrinsic
antipathogen defense.
10
REFERENCES
1.
2.
3.
4.
5.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
11
6.
Sadler, A. J., and Williams, B. R. (2008) Interferon-inducible antiviral effectors. Nature reviews.
Immunology 8, 559-568
Durfee, L. A., Lyon, N., Seo, K., and Huibregtse, J. M. (2010) The ISG15 conjugation system
broadly targets newly synthesized proteins: implications for the antiviral function of ISG15.
Molecular cell 38, 722-732
Malakhov, M. P., Malakhova, O. A., Kim, K. I., Ritchie, K. J., and Zhang, D. E. (2002) UBP43
(USP18) specifically removes ISG15 from conjugated proteins. The Journal of biological
chemistry 277, 9976-9981
Morales, D. J., and Lenschow, D. J. (2013) The antiviral activities of ISG15. Journal of
molecular biology 425, 4995-5008
Romijn, R. A., Westein, E., Bouma, B., Schiphorst, M. E., Sixma, J. J., Lenting, P. J., and
Huizinga, E. G. (2003) Mapping the collagen-binding site in the von Willebrand factor-A3
domain. The Journal of biological chemistry 278, 15035-15039
Liu, M., Li, X. L., and Hassel, B. A. (2003) Proteasomes modulate conjugation to the ubiquitinlike protein, ISG15. The Journal of biological chemistry 278, 1594-1602
Schmeisser, H., Bekisz, J., and Zoon, K. C. (2014) New function of type I IFN: induction of
autophagy. Journal of interferon & cytokine research : the official journal of the International
Society for Interferon and Cytokine Research 34, 71-78
Johansen, T., and Lamark, T. (2011) Selective autophagy mediated by autophagic adapter
proteins. Autophagy 7, 279-296
Shaid, S., Brandts, C. H., Serve, H., and Dikic, I. (2013) Ubiquitination and selective autophagy.
Cell death and differentiation 20, 21-30
Lee, J. Y., Koga, H., Kawaguchi, Y., Tang, W., Wong, E., Gao, Y. S., Pandey, U. B., Kaushik, S.,
Tresse, E., Lu, J., Taylor, J. P., Cuervo, A. M., and Yao, T. P. (2010) HDAC6 controls
autophagosome maturation essential for ubiquitin-selective quality-control autophagy. The
EMBO journal 29, 969-980
Tan, J. M., Wong, E. S., Kirkpatrick, D. S., Pletnikova, O., Ko, H. S., Tay, S. P., Ho, M. W.,
Troncoso, J., Gygi, S. P., Lee, M. K., Dawson, V. L., Dawson, T. M., and Lim, K. L. (2008)
Lysine 63-linked ubiquitination promotes the formation and autophagic clearance of protein
inclusions associated with neurodegenerative diseases. Human molecular genetics 17, 431-439
Hao, R., Nanduri, P., Rao, Y., Panichelli, R. S., Ito, A., Yoshida, M., and Yao, T. P. (2013)
Proteasomes activate aggresome disassembly and clearance by producing unanchored ubiquitin
chains. Molecular cell 51, 819-828
Pankiv, S., Clausen, T. H., Lamark, T., Brech, A., Bruun, J. A., Outzen, H., Overvatn, A.,
Bjorkoy, G., and Johansen, T. (2007) p62/SQSTM1 binds directly to Atg8/LC3 to facilitate
degradation of ubiquitinated protein aggregates by autophagy. The Journal of biological
chemistry 282, 24131-24145
Babu, J. R., Geetha, T., and Wooten, M. W. (2005) Sequestosome 1/p62 shuttles
polyubiquitinated tau for proteasomal degradation. Journal of neurochemistry 94, 192-203
Long, J., Gallagher, T. R., Cavey, J. R., Sheppard, P. W., Ralston, S. H., Layfield, R., and Searle,
M. S. (2008) Ubiquitin recognition by the ubiquitin-associated domain of p62 involves a novel
conformational switch. The Journal of biological chemistry 283, 5427-5440
Olzmann, J. A., Li, L., Chudaev, M. V., Chen, J., Perez, F. A., Palmiter, R. D., and Chin, L. S.
(2007) Parkin-mediated K63-linked polyubiquitination targets misfolded DJ-1 to aggresomes via
binding to HDAC6. The Journal of cell biology 178, 1025-1038
Kawaguchi, Y., Kovacs, J. J., McLaurin, A., Vance, J. M., Ito, A., and Yao, T. P. (2003) The
deacetylase HDAC6 regulates aggresome formation and cell viability in response to misfolded
protein stress. Cell 115, 727-738
18.
19.
20.
21.
22.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
12
23.
Pai, M. T., Tzeng, S. R., Kovacs, J. J., Keaton, M. A., Li, S. S., Yao, T. P., and Zhou, P. (2007)
Solution structure of the Ubp-M BUZ domain, a highly specific protein module that recognizes
the C-terminal tail of free ubiquitin. Journal of molecular biology 370, 290-302
Zuin, A., Carmona, M., Morales-Ivorra, I., Gabrielli, N., Vivancos, A. P., Ayte, J., and Hidalgo, E.
(2010) Lifespan extension by calorie restriction relies on the Sty1 MAP kinase stress pathway.
The EMBO journal 29, 981-991
Haggarty, S. J., Koeller, K. M., Wong, J. C., Grozinger, C. M., and Schreiber, S. L. (2003)
Domain-selective small-molecule inhibitor of histone deacetylase 6 (HDAC6)-mediated tubulin
deacetylation. Proceedings of the National Academy of Sciences of the United States of America
100, 4389-4394
Szymczak, A. L., Workman, C. J., Wang, Y., Vignali, K. M., Dilioglou, S., Vanin, E. F., and
Vignali, D. A. (2004) Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A
peptide-based retroviral vector. Nature biotechnology 22, 589-594
Reyes-Turcu, F. E., Horton, J. R., Mullally, J. E., Heroux, A., Cheng, X., and Wilkinson, K. D.
(2006) The ubiquitin binding domain ZnF UBP recognizes the C-terminal diglycine motif of
unanchored ubiquitin. Cell 124, 1197-1208
Ouyang, H., Ali, Y. O., Ravichandran, M., Dong, A., Qiu, W., MacKenzie, F., Dhe-Paganon, S.,
Arrowsmith, C. H., and Zhai, R. G. (2012) Protein aggregates are recruited to aggresome by
histone deacetylase 6 via unanchored ubiquitin C termini. The Journal of biological chemistry
287, 2317-2327
Kirkin, V., McEwan, D. G., Novak, I., and Dikic, I. (2009) A role for ubiquitin in selective
autophagy. Molecular cell 34, 259-269
Seibenhener, M. L., Babu, J. R., Geetha, T., Wong, H. C., Krishna, N. R., and Wooten, M. W.
(2004) Sequestosome 1/p62 is a polyubiquitin chain binding protein involved in ubiquitin
proteasome degradation. Molecular and cellular biology 24, 8055-8068
Ye, Y., and Godzik, A. (2003) Flexible structure alignment by chaining aligned fragment pairs
allowing twists. Bioinformatics 19 Suppl 2, ii246-255
Narasimhan, J., Wang, M., Fu, Z., Klein, J. M., Haas, A. L., and Kim, J. J. (2005) Crystal
structure of the interferon-induced ubiquitin-like protein ISG15. The Journal of biological
chemistry 280, 27356-27365
Komander, D., Reyes-Turcu, F., Licchesi, J. D., Odenwaelder, P., Wilkinson, K. D., and Barford,
D. (2009) Molecular discrimination of structurally equivalent Lys 63-linked and linear
polyubiquitin chains. EMBO reports 10, 466-473
Trempe, J. F., Brown, N. R., Noble, M. E., and Endicott, J. A. (2010) A new crystal form of
Lys48-linked diubiquitin. Acta crystallographica. Section F, Structural biology and
crystallization communications 66, 994-998
Potter, J. L., Narasimhan, J., Mende-Mueller, L., and Haas, A. L. (1999) Precursor processing of
pro-ISG15/UCRP, an interferon-beta-induced ubiquitin-like protein. The Journal of biological
chemistry 274, 25061-25068
Komatsu, M., Kurokawa, H., Waguri, S., Taguchi, K., Kobayashi, A., Ichimura, Y., Sou, Y. S.,
Ueno, I., Sakamoto, A., Tong, K. I., Kim, M., Nishito, Y., Iemura, S., Natsume, T., Ueno, T.,
Kominami, E., Motohashi, H., Tanaka, K., and Yamamoto, M. (2010) The selective autophagy
substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of
Keap1. Nature cell biology 12, 213-223
Itakura, E., and Mizushima, N. (2011) p62 Targeting to the autophagosome formation site
requires self-oligomerization but not LC3 binding. The Journal of cell biology 192, 17-27
Searle, M. S., Garner, T. P., Strachan, J., Long, J., Adlington, J., Cavey, J. R., Shaw, B., and
Layfield, R. (2012) Structural insights into specificity and diversity in mechanisms of ubiquitin
recognition by ubiquitin-binding domains. Biochemical Society transactions 40, 404-408
34.
35.
36.
37.
38.
39.
41.
42.
13
40.
Wooten, M. W., Geetha, T., Babu, J. R., Seibenhener, M. L., Peng, J., Cox, N., Diaz-Meco, M. T.,
and Moscat, J. (2008) Essential role of sequestosome 1/p62 in regulating accumulation of Lys63ubiquitinated proteins. The Journal of biological chemistry 283, 6783-6789
Lenschow, D. J., Giannakopoulos, N. V., Gunn, L. J., Johnston, C., O'Guin, A. K., Schmidt, R. E.,
Levine, B., and Virgin, H. W. t. (2005) Identification of interferon-stimulated gene 15 as an
antiviral molecule during Sindbis virus infection in vivo. Journal of virology 79, 13974-13983
Boyle, K. B., and Randow, F. (2013) The role of 'eat-me' signals and autophagy cargo receptors
in innate immunity. Current opinion in microbiology 16, 339-348
Orvedahl, A., MacPherson, S., Sumpter, R., Jr., Talloczy, Z., Zou, Z., and Levine, B. (2010)
Autophagy protects against Sindbis virus infection of the central nervous system. Cell host &
microbe 7, 115-127
Judith, D., Mostowy, S., Bourai, M., Gangneux, N., Lelek, M., Lucas-Hourani, M., Cayet, N.,
Jacob, Y., Prevost, M. C., Pierre, P., Tangy, F., Zimmer, C., Vidalain, P. O., Couderc, T., and
Lecuit, M. (2013) Species-specific impact of the autophagy machinery on Chikungunya virus
infection. EMBO reports 14, 534-544
Geeraert, C., Ratier, A., Pfisterer, S. G., Perdiz, D., Cantaloube, I., Rouault, A., Pattingre, S.,
Proikas-Cezanne, T., Codogno, P., and Pous, C. (2010) Starvation-induced hyperacetylation of
tubulin is required for the stimulation of autophagy by nutrient deprivation. The Journal of
biological chemistry 285, 24184-24194
Reed, N. A., Cai, D., Blasius, T. L., Jih, G. T., Meyhofer, E., Gaertig, J., and Verhey, K. J. (2006)
Microtubule acetylation promotes kinesin-1 binding and transport. Current biology : CB 16,
2166-2172
Sanz, L., Diaz-Meco, M. T., Nakano, H., and Moscat, J. (2000) The atypical PKC-interacting
protein p62 channels NF-kappaB activation by the IL-1-TRAF6 pathway. The EMBO journal 19,
1576-1586
Shi, H. X., Yang, K., Liu, X., Liu, X. Y., Wei, B., Shan, Y. F., Zhu, L. H., and Wang, C. (2010)
Positive regulation of interferon regulatory factor 3 activation by Herc5 via ISG15 modification.
Molecular and cellular biology 30, 2424-2436
FOOTNOTES
FIGURE LEGENDS
FIGURE 1. HDAC6 interacts with ISG15-conjugated cellular proteins. (a) U251 expressing FLAGHDAC6 WT (full-length) were treated with IFN (1,000 unit/ml; 16h), with and without MG132 (40 µM,
4h). Anti-FLAG -immunoprecipitated (IP) proteins and input cell lysates were immunoblotted with antiFLAG, anti-ISG15 and anti-Ubiquitin (Ub) antibodies. (b-d) U251 cells expressing FLAG-HDAC6 WT
were treated with IFNβ (1,000 units/ml, 16h) in the absence (for b, c) or the presence (for d) of MG132
(40 µM, 5h). Cytoskeletal insoluble fractions were visible in pre-permeabilized cell with Triton-X 100
(c,d) Fluorescence signals for Alexa-488 (green) for FLAG, Alexa-555 (red) for ISG15 and DAPI (blue)
were visualized using confocal microscopy. High magnification views highlighted by broken line boxes
are shown in the bottom panels of the image (b). Scale bar: 20µm
FIGURE 2. Mapping the interacting domains of HDAC6 and ISG15. (a) Schematic of FLAG-tagged
HDAC6 and its deletion mutants. The two catalytic domains (CD1, CD2), a Ser-Glu-containing
tetradecapeptide repeat domain (SE14), and a binding of Ubiquitin zinc finger domain (BUZ) are shown
as closed boxes. Asterisk (*) represents the H611A point mutation in WT (b) U251 cells that express
wild-type FLAG-HDAC6 (WT), mutant without an active site histidine (H611A), an SE14-BUZ
truncated mutant (ΔCter), or empty vector (Vec), were treated with IFNβ (1,000 unit/ml; 16h). Lyates
were subjected to the co-immunoprecipitation with antibody against FLAG and analysis using antibodies
against FLAG and ISG15. (c) 293 cells were transiently co-transfected with expression vectors for a
FLAG-HDAC6 WT, a C-terminal truncation (ΔCter) mutant, a N-terminal truncation (ΔCD1/2) mutant, a
BUZ domain truncation (ΔBUZ) mutant, a SE14 domain truncation (ΔSE14) mutant or an empty vector
(Vec), along with an HA-tagged ISG15 expression vector. Lysates and immunoprecipitates were analyzed
with antibodies against FLAG and HA. (d) Schematic of HA-tagged ISG15 with wild type or mutants.
The two Ub-like domains are shown as closed boxes. HA peptides were tagged at the N-terminal and
deleted amino acid terminal of the LRLRGG peptide sequences at the C-terminal end are described as (*).
(e) 293A cells were transiently transfected with the plasmids carrying HA-tagged ISG15 vectors with
mutants. In a pull-down assay, cell lysates were incubated with purified recombinant GST-tagged
14
*This work was supported by funds from NIH grant P01 CA069246 to EAC and from a sundry fund by
the Brigham and Women’s Hospital to EAC.
1
Harvey Cushing Neuro-oncology Laboratories, Harvard Institutes of Medicine 9th floor, Department of
Neurosurgery and Institute for the Neurosciences at the Brigham and Women's Hospital, 4 Blackfan
Circle, Boston, MA 02115
2
To whom correspondence should be addressed: E. Antonio Chiocca, Department of Neurosurgery,
Brigham and Women's Hospital, 75 Francis Street, Boston, MA USA, Tel.: (617) 732-6939; Fax: (617)
734-8342; E-mail: [email protected]
3
The abbreviations used are: ISG15, interferon-stimulated gene 15; IFN, interferon; HDAC, histone
deacetylase; BUZ, a binder of ubiquitin zinc finger; Ub, ubiquitin; IFNAR, interferon α/β receptor; PRR,
pattern-recognition receptor; PKR, protein kinase R; RNaseL, ribonuclease L; ISGylation, ISG15
conjugation; UPS, ubiquitin proteasome system; MTOC, microtubule organizing center; K63, lysine 63;
K48, lysine 48; UBA, ubiquitin associated; MEF, mouse embryonic fibroblast; CD, catalytic domain;
SE14, serine-glutamate containing tetradecapeptide; PepA/E64d, pepstatin A and E64d; SLR,
sequestrome-1 like receptor; LIR, LC3 interacting region; HPV, human papillomavirus; SIN, Sindbis
virus; CHIKV, Chikungunya virus; MT, microtubule; TRAF6, tumor necrosis factor receptor-associated
factor 6; Kerp1, Kelch-like ECH-associated protein 1
4
Research Collaboratory for Structural Bioinformatics Protein Databank = PDB #1z2m, 2w9n, 3m3j
HDAC6 or control GST, bound to glutathione-Sepharose beads, subjecting to the analysis with antibodies
against HA and GST.
FIGURE 4. ISG15 and p62 colocalization in insoluble fraction. (a-d) U251 cells were treated with IFNβ
(1000 units/ml, 16h) before treatment with MG132 (40 µM, 5h) (b,d) or without it (a,c). Prepermealized
cells were fixed with 4% PFA and subjected to fluorescence microscopy analysis using alexa-488 (green)
against p62 and αTubulin, alexa-555 (red) against ISG15 and DAPI (blue). High magnification rescans of
the broken line box ROIs are shown in the panels on the right of each sample image. Scale bar: 50µm
FIGURE 5. Lysosomal degradation of cleaved ISG15. (a) Schematic of ISG15-CFP and CFP expressing
cDNA vector and its product protein (a.a.). the LRLRGG c-terminal end of FLAG-tagged human ISG15
is linked to the N-terminal of mTurquoise2 (referred to as CFP). Control CFP is tagged with FLAG at the
C-terminal end. (b) Cell lysates were prepared in RIPA buffer three days after transient transfection of
the vectors as indicated, and were immunoblotted using antibodies against GFP, ISG15, HDAC6 and p62.
(c) Immunoblots of detergent soluble (Soluble) and –insoluble (Insoluble) fractions of U251 with 24h
transient transfection of the indicated vectors in the presence or absence of pepstatin A and E64d
(PepA/E64d; each 20 µg/ml, 6h), were probed for the indicated proteins. Volumes of insoluble fractions
are 5-fold (x5) higher concentration than those of the soluble fractions. Numbers shown on the left images
indicate protein sizes (kDa).
FIGURE 6. The HDAC6 deacetylase inhibitor suppresses ISG15 degradation. U251 cells were treated
with IFNβ (1000 units/ml, 12h) and Tubacin (5µM, 13h) before treatment with PepA/E64d (20 µg/ml,
6h). Cell lysates prepared as soluble and insoluble fraction was immunoblotted using antibodies against
indicated proteins. An immunoblot against ISG15 shows both a short-exposure (short) and a longexposure (long) time to compare the levels in non-conjugated ISG15.
FIGURE 7. Schematic model of ISG15-mediated degradation. a. IFNs are known to stimulate via the
STAT-JAKs pathway a number of interferon-stimulated genes including ISG15, UbE1L, UbcH8, Herc5
that lead to ISGylation process and UBP43 that deconjugates ISGylated proteins. b. The K63-linked
diUb-like protein, ISG15, conjugates to lysine (K) residues of newly synthesized proteins at the LRLRGG
terminal end (2). Some ISG15-conjugates are also deconjugated to remove ISG15. c. Our findings
indicate that HDAC6 and SQSTM1/p62 can independently bind ISG15 to recognize ISG15 and ISG15conjugates directly or indirectly. ISG15-aggregates or aggresomes would be formed through
15
FIGURE 3. ISG15 up-regulation of aggregate formation of p62 (a) Purified recombinant ISG15 proteins
were pulled down with glutathione-Sepharose beads bound purified recombinant GST-tag fusion p62 or
control GST and analyzed as indicated. (b) Schematic inducible co-expression vectors of ISG15 and the
core enzyme genes, ISG15 E1 UbE1L, E2 UbcH8 and E3 Herc5 using self-cleavage peptide sequences
(P2A) under the control of the tet-on promoter (Ptet-on). The details of the vector constructs are described
in Materials and Methods. (c) U251.ISG7-8 exhibited overexpression of ISG15 and ISG15 conjugation to
cellular proteins in the presence of doxycycline (Dox; 100 ng/ml, 24h) prior to IB with anti-ISG15
antibody. (d) Immunoblots of detergent soluble (Soluble) and –insoluble (Insoluble) fractions of
U251.ISG7-8 cells with and without Dox treatment (100 ng/ml, 24h) in the presence or absence of
pepstatin A and E64d (PepA/E64d; each 20 µg/ml, 4h), were probed for the indicated proteins. (e)
293.ISG8 exhibited overexpression of ISG15 and conjugation in the presence of Dox (200 ng/ml, 24h).
(f) 293-ISG8 cells were transiently transfected with FLAG-tagged p62 or control empty vector and were
treated with MG132 (40 µM, 6h). Anti-FLAG immunoprecipitated (IP) proteins and input cell lysates
were immunoblotted (IB) with anti-FLAG and anti-ISG15 antibodies. g, Immunoblots of 0.5% Triton X100 detergent soluble (Soluble) and –insoluble (Insoluble) lysate fraction of 293.ISG8 cells treated with
Dox (200 ng/ml, 24h) in the presence or absence of MG132 (6h) at indicated doses prior to collecting the
cells, were probed for the indicated proteins.
oligomerization and recruitment of autophagosomes-bound LC3 by p62. The [roteasome inhibitor,
MG132, induces and enhances this aggregate formation and accumulation in the insoluble fraction d. The
deacetylase activity of HDAC6 can mediate lysosomal fusion of ISG15-containing aggregates for
clearance and this is inhibited by the specific HDAC6 inhibitor, Tubacin. Pepstatin A and E64d
(pepA/E64d) inhibit lysosomal digestion of peptide contents.
.
16
Figure 1
17
Figure2
18
Figure 3
19
Figure 4
20
Figure 5
21
Figure 6
22
Figure 7
23
24

Full PDF - JBC Protein Synthesis and Degradation

Transcription

Similar documents

Molecular basis for ubiquitin and ISG15 cross

2015/2016 autofagia

NRP Instructor Course Neonatal Resuscitation program December 11 - 12, 2014

Cells Compared to The Human Body

Knowledge and Global Order By Dr Nayef Al‐Rodhan “Why do they hate us?” is a question often asked ...

A study reveals common features in the proteins that trigger

IFITM3 Peptide PRODUCT DATA SHEET Bioworld Technology CO., Ltd.

SOMAscan™: A Quantitative Multiplex Proteomic