The Structure of the Urokinase-Type Plasminogen

From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
The Structure of the Urokinase-Type Plasminogen Activator Receptor Gene
By Janet R. Casey, John G. Petranka, Jennifer Kottra, Donald E. Fleenor, and Wendell F. Rosse
end. This cDNAwas used to probe ahuman genomic library
The cellular receptor for urokinase-type plasminogen activator (uPAR) is a glycosylphosphatidylinositol (GPII-anchored from which three clones were isolated and analyzed. The
23 kb of genomic
uPAR gene consists of
7 exons spread over
membrane protein that plays a central role in pericellular
within
DNA. Exons 2,4, and 6 code for homologous domains
plasminogen activation.It contains 313amino acid residues,
the mature protein, as do exons3,5, and 7; CD59-like homolincluding 28 cysteine residuesin a pattern of three homoloogous pairs are encoded by exons 2-3, 4-5, and6-7, respecgous repeats. The cysteine residue pattern suggests that
tively. The structure of the gene for uPAR further confirms
uPAR belongs to a superfamily of proteins including CD59,
the relationship of this molecule to the superfamily conmurine Ly-6, and a variety of elapid snake venom toxins. A
taining CD59, Ly-6, and the elapid snake venom toxins.
novel 1.7-kb uPAR cDNA was isolated that is missing exon
0 1994 by The American Societyof Hematology.
5 andthat contains 380 bp not previously repotted at the 5’
T
HE UROKINASE-TYPE plasminogen activator (uPA)
is one of two serine proteases capable of converting
the proenzyme plasminogen into plasmin and thus plays an
important role in cell migration and tissue remodeling.‘,*
Specific receptor sites for uPA are located on the cell surface
of neutrophils, monocytes, keratinocytes, and cultured endothelial cells as well as on several neoplastic cell line^.^.^ A
55- to 60-kD membrane receptor (designated uPAR) has
been identified that binds both urokinase-type plasminogen
activator (uPA) and pro-uPA with high affinity andlocalizes
plasminogen activation near the cell surface.6 uPA binds to
uPAR via an epidermal growth factor-like moiety at the
amino terminal end of the uPA pr~tein.”~
The uPAR gene has been assigned to chromosome 19”
and Roldan et all’ have isolated and sequenced a full-length
cDNA that codes for the entire human uPA receptor. The
protein is 313 residues in length and has five potential sites
for N-linked glycosylation. Compared with native uPAR
protein (apparent molecular mass 55 to 60 kD), deglycosylated uPAR has an apparent molecular mass of only 35 k D ,
suggesting that the protein is in fact highly glycosolated.”
The mature uPAR protein is attached to the cell membrane
by a glycosylphosphatidylinositol (GPI) membrane anchor
and is truncated at the COOH-terminus before its attachment.”.14Like other GPI-linked proteins, uPAR is absent on
affected peripheral blood monocytes and granulocytes from
patients with paroxysmal nocturnal hemagl~binuria.’~.’~
uPAR has a high content of cysteine residues that are
arranged in a triplicate pattern that defines three homologous
domains. This motif is shared with three other GPI-anchored
membrane proteins (murine Ly-6, CD59, and squid glycoprotein Sgp-2) and with a variety of elapid snake venom
toxins (the erabutoxin-bungarotoxin series), suggesting that
these proteins comprise a superfamily of protein^.^"*^ Further evidence of the relatedness of these proteins is provided
by structural studies2’,” describing similar patterns of disulfide pairing in CD59 and the NH2-terminaldomain of uPAR.
The genes of other members of the superfamily show
similarities in organization: they may have an untranslated
first exon; the characteristic protein unit is coded bytwo
exons, the first usually being shorter than the second; and
the last exon has an extensive 3’ untranslated region. W e
report the cloning and characterization of the human uPAR
gene and show that its organization closely parallels that of
the genes of the other members of the superfamily.
MATERIALS AND METHODS
Isolation ofuPAR cDNA. A probe touPAR was generated by
gene-specific polymerase chain reaction (PCR) amplification of
Blood, Vol 84, No 4 (August 15). 1994: pp 1151-1156
HeLa genomic DNA using oligonucleotide primers complementary
to theuPAR cDNA sequence reported by Roldan et al.” The sequence of the first primer was S’GGCTGCTCCTCAGCCTGGCCCTGCC3‘ (bases 961-985) and that of the second primer was
3’cagcacactggagtccggtcacacgg5‘ (bases 1134- 1 159). A resulting
198-bp PCR product was cloned in plasmid pCR (Invitrogen, San
Diego, CA) and its identity to bp 961-1159 of uPAR cDNA was
confirmed by DNA sequencing.
A HeLa cDNA library in X ZAP I1 (Stratagene, La Jolla, CA)
was probed using the 198-bp PCR fragment that was labeled with
a-dCT3’P using a random hexanucleotide DNA labeling kit (Pharmacia, Piscataway, NJ). A single 1.7-kb positive clone was isolated,
amplified, and subcloned into pUCll9. Dideoxynucleotide sequencing was performed using the Sequenase system (US Biochemical,
Cleveland, OH).
Isolation of uPAR genomic clone. The full-length uPAR cDNA
clone described above was radiolabeled by u-dCT3’P random priming and was used toscreen a human placental genomic DNA library
constructed in X FIX I1 (Stratagene). Two positive clones were isolated and amplified. A third clone was identified whenthe same
genomic DNA library was screened usingan a-dCT3*P random
primed labeled 131-bp PCR amplification product thatwas constructed usinguPAR cDNA as the template and oligonucleotides
S’CACCAGCCTI’ACCGAGGT3‘ (bp 301-318) and 3’GTAGTCTGTACTCGACACTCTCS‘ (bp 411-432) of theuPAR cDNA sequence as primers.
Characterization of uPAR genomic structure. The gene structure
ofuPARwas
analyzed by Southern analysis and by subsequent
subcloning and sequencing of relevant restriction fragments. Restriction digests using BamHI, Hind 111, Pst I, Pvu 11, Xba I, EcoRI, Sac
I, and Sma I were performed on the three genomic clones in phage
X. The restriction digests were electrophoresed on agarose gels and
transferred to nitrocellulose filters. The filters were probed with ydAT3’P (3,000 Ci/mmol; Amersham Cop, Arlington Heights, IL)
end-labeled oligonucleotides. Prehybridization and hybridization
From theDivision of Hematology/Oncology, Departments of Pediatrics and Medicine, Duke University Medical Center, Durham, NC.
Submitted January 7, 1994; accepted April 19, 1994.
Supported by Grant No. S R01 HL.47831-02 from the National
Heart, Lung, and Blood Institute of the National Institutes of Health.
Nucleic acid sequences have been deposited in GenBankunder
accession numbers U07842 and 1708839.
Address reprint requests to Wendell F. Rosse, MD, Box 3934,
Duke University Medical Center, Durham, NC 27710.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C.section 1734 solely to
indicate this fact.
0 1994 by The American Society of Hematology.
oooS-4971/94/84040012$3.00/0
1151
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
1152
CASEY ET AL
wereperformedat42°Cin
a solutioncontaining 4X SSC, 0.1%
sodium dodecyl sulfate (SDS), 0.1% NaPPi, 10 mmol HEPES, pH
7.4, 5X Denhardts, 50 pg/mL heparin, and 50 pg/mL salmon testes
DNA for 4 and16hours,respectively.Thefilterswerewashed
sequentially in 2X SSC, 0.1% SDS; 1X SSC, 0.1% SDS;and 0.5%
SSC, 0.1% SDS all for 20 minutes at 42°C. Autoradiographs were
exposed at -70°C for
4 to 24 hours using an intensifying screen.
Positivelyhybridizingrestrictionfragmentsweresubclonedinto
pUCl19 for further analysis. Dideoxynucleotide sequencing
was performed using oligonucleotide primers complementaryto the cDNA.
in the phage A
Becauseintron 3 wasnotcompletelyrepresented
genomic clones, its size was estimated by analysis of overlapping
restriction digests of genomic DNA.
Reversetranscription (RT)/PCR of HeLa RNA. RTPCR was
used to confirm the presence of the previously undescribed 1.7-kb
RNA wasisolatedfrom
transcriptinHeLaRNA.HeLapoly(A)’
total RNA usingPolyATtractparamagneticparticles(Promega,
Madison, WI). Reverse transcription was performed for 45 minutes
at 42°C in a 20-pL reaction consisting of 400 ng of poly(A)+ RNA
template (or 25 ng of uPAR cDNA
for positive control), 50 pmol
of oligonucleotide primer 3’CCACCTCTTTTCGACATG5‘ (bases
612-629ofthe cDNA), I X RTbuffer (50 mmoVLTris-HC1, pH
8.3; 75 mmoliL KCI; 3 mmol/LMgCI2; 10 mmol/L dithiothreitol
[dtT]), 2 mmol/Leach WTP, 5 mmoliL D’IT, 5 pg/mL bovine
serum albumin (BSA),
0.5 U/pL RNase inhibitor (US Biochemicals),
and 50 U (or an equivalent volume of H 2 0 for negative controls)
of Moloney murine leukemia virus (M-MLV) reverse transcriptase
(US Biochemicals). PCR was performed in a 100 pL volume consisting of 10 pL of the RTreaction, 50pmol each of primers 5’CAGTATCCCTCCTGACAAAACT3’
(bases
1-22
cDNA)
of and
3’CGTCACA’ITCTGGTTGCC5’ (bases504-521 of cDNA), 1 X
PCR buffer (0.5, 1.0, 1.5, or 2.0 mmol/L MgCL2; 50 mmol/LKCI;
10mmoULTris-HC1,pH 8.3), 200 pmol/L each dNTP, and 2.5 U
AmpliTaqDNApolymerase (Perkin-Elmer, Norwalk, CT). Thirty
thermal cycles were performed (1 minute at 94°C 1 minute at 55”C,
and 1 minute at 72”C), after which the reaction mix was subjected
to electrophoresison a 2% agarose gel containing ethidium bromide.
gene for uPAR was found
within 3 HeLa genomic clones
and spans about 23 kb of genomic DNA. Southern blot analysis using oligonucleotide probescomplementary to thepublished cDNA sequence showed that the uPAR gene is composed of seven exons separated by six introns of variable
lengths (Fig2). The unreported 380-bp segment that was
found in the 1.7-kb cDNA was also foundin the two genomic
clones containing the 5’ end of the gene, thus confirming
that it was not an artifact of the cDNA. The first exon is
481 bp in length; its first 426 bp are untranslated and the
remainder codes for a highly hydrophobic signal peptide. It
is separated from exon 2 by an intron of 2.3 kb. Exon 2 is
11 1 bp in length and codes for the remainder of the signal
sequence and the beginning of the mature protein; it is separated from exon 3 by an intron of 2.3 kb. The 144-bp exon
3 codes for matureprotein and is separated from exon 4 by a
9-kb intron that was sizedby genomic Southern blot analysis.
Exon 4 is 162 bp in length, codes for mature protein, and is
separated from exon 5 by an 800-bp intron. Exons 5 , 6. and
7 code for the remainder of the mature protein and are 135,
147, and563bp
in length,respectively;these
exonsare
separated by 3.2-kb introns. Exon 7 contains a 312-bp untranslated segment at its 3’ end. Each exon isflanked by
appropriate consensus acceptor or donor splicesites (Fig 3).
The organization of exons in the UPAR gene reflects the
pattern of triplicated homologous domains observed in the
mature protein (Fig 4). Each protein domain is coded for by
a pair of exons, with the intron break within each pairalways
occurring between the fifth and sixth cyteines.
The putative promoter region 5‘ to exon 1 was sequenced
and examined for potential regulatory elements. No TATA
or CAAT elements are evident, nor are the first 100 bases
G + C rich (39%) as in the CD59 gene. However, there is a
pair of octomer sequencesat positions -50 and -34, as well
as a GATA sequence at position -23 (Fig 3).
RESULTS
DISCUSSION
Isolation of uPAR cDNA. A novel 1.7-kb uPAR cDNA
In this report we have identified and described the gene
was isolated from the HeLa cDNA
library. Sequence analysis
structure of thehumanuPAR.The
structure was derived
showed that the 5’ end of the cDNA contained 380 bp not
previously reported by Roldan et al.’’ To confirm that the
from analysisof three genomic clones froma human placental genomic library. The uPAR gene sequence is shown in
new380bpwasnot
artifactual,RT/PCR was performed
Fig 3, and Fig 2 depicts the seven exons and six introns of
using HeLaRNAas template. Onemember of thePCR
varying sizes.
primer pair was complementary to the 5’-most sequence of
the new cDNA and the other was complementary to sequenceIt was previously observed that the proteinstructureof
uPARbelonged to a newly described Ly-6lelapidvenom
in exon 2. A specific band of the appropriate size was obfundamental
The
structural unit
toxin (EVT)
tained (data not shown).
typical of this family is a protein of about 70 amino acids
In addition to thispreviously unreported 5’ sequence, 135
containing 10 cysteines that form internal disulfide bridges
bases corresponding precisely to exon 5 were found to be
producing a characteristic structure. This structure consists
absent in this clone. This variant probably arises as a result
of a cysteine-rich hydrophobic core from whichradiate three
of mRNA splicing caused by thealternative use of the exon
“loops” closed by the disulfide bonds. Behind this core is
4 splice donor and exon 6 splice acceptor sites. Because all
a small fourth loop. Most proteins in this superfamilyconsist
exodintron junctions in uPAR are of type 1 (ie, the break
of a single such unit, whereas uPAR consists of three such
is between the first and second bases of the codon), protein
units in series; the first of these varies from the usual pattern
translationacrossthisvariant
splicejunctionremains
in
in that one of the disulfide bridges holding a loop is missing.
frame. The onlyresultingtranslationalmodification(apart
Further evidence that these proteins belong to the same
from the missing 45 amino acids coded by exon 5 ) would
superfamilyisseenin
thefact that thestructure of their
be a substitution of valine (GUC) for isoleucine (AUC) at
genes is simi1d”2h (Fig 5). In the uPAR gene, like those of
the beginning of exon 6 (Fig I).
the snake venom toxins, there is no untranslated first exon
Isolationandstructure
of uPAR genomic clone. The
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
1153
THESTRUCTURE OF THE uPAR GENE
4.
UPAR cDNA of Roldan
G
E
E
I
L
E
...GGTGAAGAAGGGCGT .....CCCAATCCTGGAG ...
Novel UPAR cDNA
Fig 1. Comparison of UPARcDNA described by Roldan et al" with the novel cDNA described in this work. Exons are numbered, with
dotted lines separating members of exon pairs that code for homologous repeats. ( ) Previously undescribed 380-bp5' sequence. Sequence
about the spliced-out exon 5 is shown. Exon4 sequence is underlined, exon 6 sequance is double-underlined, andthe amino acidtranslation
is shown above. 'The substitution of valine for isoleucine at the beginning of exon 6 in the alternatively spliced form. (B) 3' untranslated
sequence.
as there is in the genes for CD59 and Ly-6C.1. Exon 1 of
uPAR is similar to exon 2 of CD59 and Ly-6C. 1 in that both
exons have an untranslated 5' segment and code for the
hydrophobic signal peptide.
The fundamental unit of the superfamily is coded for in
each case by two exons, one (usually shorter) coding for the
amino end of the unit and the other for the carboxyl end. In
the uPAR gene, as in the genes of the other members of the
superfamily, the exon break in each pair coding a subunit is
always type 1 and occurs in the same general part of the
molecule as in the other members of the superfamily. This
suggests that the two-exon structure of the gene was present
in the archetypal gene from which the members of the family
are derived. Because uPAR contains three of the fundamental
units characteristic of the EVT family, three exon pairs code
for the complete structure. Each of these is like the exon
pairs coding for a single unit, suggesting that the triplicate
1 Kb
Exon 1
.
Exon 2
PE H
It I.
2.3 kb
Exon 3
HB X
II I.
2.3 kb
h1 0
structure is the result of reduplication of the fundamental
unit. However, there is not sufficient homology between the
individual units either at the nucleic acid or at the protein
level to ascertain at what point evolutionarily this reduplication occurred, or in what order.
The absence of exon 5 in our cDNA would lead to translation of a protein in which the carboxyl-terminal half of the
second homologous repeat is missing. The mRNA remains
in frame at the exon 4/exon 6 splice junction, so that the
third homologous repeat as well as the GPI-anchoring signal
would presumably still be intact (with the exception of the
valine to isoleucine substitution at the splice junction). Such
a molecule would have an uneven number of cysteines in
the remaining half-domain of the second repeat, andthe
implications of this in terms of intramolecular bonding and
protein folding are not known. If such a molecule were to
be expressed, uPAR function might not be affected because
m
B
H
B
X
I
I
I
1
9.0 kb
Exon 4 Exon 5
B
P
.8 kb
Exon 6
P
H
3.2 kb
Exon 7
H
3.2 kb
h5
h8
Fig 2. The structure of tha uPAR-encoding gane. Exons are indicated by boxes; translated portions are shaded and untranslated portions
are unshaded. The restriction sites used in aasessrnent of tho structure are i n d w e d (P, pst I; E, EcoRI; H, Hindlll; B, hmHI; X, Xba I).The
intron sizes are indicated below. The three genomic clones are shown below the gene structure and their lengths depict the portion of the
gene containad within them.
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
1154
CASEY ET AL
-158
-58
43
143
243
343
6
443
933
70
1033
161
1123
202
1923
2413
2513
182
2613
316
2713
335
2811
2913
3013
3113
3120
EXON3
EXON5
EXON7
Fig3.Nucleotidesequenceandsalient
features ofthe uPAR gene. Exons are
denoted
by boldface uppercase letters, with the previously unreported 380-bpcDNAsequence
underlined.Proteinsequence
is indicated
above translated portions of exons. Consensus splice donor and acceptor sites are indicated by double underlining.
E G E E L E L V E K S ~.......~ # T H S E K T N R T L S Y R T G L K I T S L T E V V!g;.! @ G L D L @ N Q G N S
jj
TTK&NEGP
....
G R P K D D R H L R........
G~OYLPG~
E P K N Q S Y M V R G..R..... A T A S M g Q H A H L G D A F S M N H I D V S...............
.............. K S G....
..~
..?.... H P D L D V Q Y R S G
PGSNGFHNNDTFHFLH
,
Fig 4. Alignment and comparison of homologous exons ofUPAR. Homologous exons are aligned basedon conservation in the spacing of
cysteine residues (shaded). Each repeatthe
of triplicated protein mot# is coded for by a pair of exons (exons 2/3,4/5, and 8/71 with the intron
break within a pair always occurring betweenthe fifth and sixth cysteines.
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
THE STRUCTURE OF THE uPAR GENE
1155
A
E?
C
3 ' UT
C
3' UT
Ly-6C.1
A
"
"
"
2"""
CD59
A
B
3' UT
C
Erabutoxin
A
B
C
uPAR
B
C
3' UT
Fig 5. Homologies in the structure of the genes for LyGC.1, CD59, erabutoxin, and uPAR. The size of each exon is given; untranslated exons
are open and translated exons are shaded to reflect homology between the exon pairs. Each homologous domain is coded for by t w o exons,
denoted B and C. uPAR contains three homologous domains and thus three pairsof exons. Exons are shown approximately to scale; introns
are not shown to scale.
uPA-binding activity appears to reside in the amino terminal
87 residuesof the first repeat.x Kristenson etal" described an
alternatively spliced mouse cDNA that results i n premature
termination of protein translation at a similar position in the
second hgmologousrepeat. That molecule could be translated in vitro to produce a protein of the approprate size. In
addition, in situ hybridization with antisense RNAprobes
showed that the truncated mRNA was both transcribed and
differentiallylocalizedfromfull-lengthmessage
in mouse
gastrointestinaltissuc. However, it wasnotshown
that a
functional uPA-binding protein could be translated i n vivo.
In all the members of the superfamily that are membrancbound, the last exon (exon 4 in CD59 and Ly-6C.I; exon 7
in uPAR) codesfor thecarboxyl terminus of the mature
protein, a s well as for the signal sequence for GP1 anchor
attachment, and ends with a long untranslated segment (Fig
5). In the snake venom toxins, which are secreted, the last
exondoes not encodethe characteristichydrophobic
scquence of amino acids necessary for GP1 attachment. Pykc
et a l L X have recently described an alternatively spliced uPAR
mKNA in which exon 7 is replaced by an alternative final
exon encoding a 29-residue hydrophilic sequence that presumably gives rise to a soluble secreted form of uPAR. This
alternative exon 7 resides S78 bp downstream from the end
of theoriginallydescribed
final exon and is homologous
neither with the other exons of uPAR nor with the sequence
of any known protcin. Despite this, the cysteines at positions
240 and 250 of the alternative final exon are spaced at approximately the same interval as the first two cysteines of
the typical exon 7; this provides the possibility, at least, that
the intramolecular disulfidc bonds that maintain
loops one
and two within the thirdhomologousrepeat
may be pre-
served. Whether or not these disulfides are present,
uPAK
functionmight well not be affectedbecauseuPA-binding
activity appears to reside in the first homologous repeat.
These studies show that the gene for uPAliclosely resemblesthe gene structure of theothermembers of the EVT
superfamily, but has been triplicated. The remarkable consistency with whichthis gene structurehasbeenpreserved
suggests that there may be some evolutionary advantage to
it. Further studieswill be necessary to determine thebiologic
significance, if any, of the three uPAR mRNA variants that
have thus far been described.
REFERENCES
I. Ellis V, Scully MP, Kakkar VV: Plasminogen aclivation initi-
atcd by single-chainurokinase-typeplasminogenactivator.
J Biol
Chem 264:2 185, 1989
2. StephensRW, Piilliinen J, 'l'apiovaara H, Leung K, Sin1 P.
Salonen E, R0nnc E, Behrendt N, Dan0 K , Vahcri A: Activation of
pro-urokinase and plasminogen on human sarcoma cells: A protcolyticsystcm with surface-hound reactants. J Cell Biol 108:1987,
I989
3. Haddock RC, Spcll ML, Baker CD, Grammer JR, Parks JM,
Spcidcl M, Booyse FM: Urokinase binding and receptor identitication i n cultured cndothclial cells. J Biol Chem 266:21466, 1991
4. Miles LA, Plow EF: Receptor tnediatcd binding of the tibrinolytic components, plasminogen and urokinase,
to peripheral blood
cells. 'Thromb Hacmost SX:93h, 1987
S. McNcill H, Jensen PJ: A high-affinity rcccptor for urokinase
plasminogen activator on human kcratinocytes: Characterizationand
potential modulation during migration. Cell Kcgul I:843, 1990
h. Nielsen LS, Kellerman GM, Bchrcndt N, Picone R, Dan0 K ,
Hlasi F: A 55,000-h0,000 M,receptorprotcin
lor urokinase-type
plasminogen activator. J Biol Chern 263:2358, 1988
7. Appella E, Robinson EA,Ullrich SJ, Stoppelli MP, Corti A,
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
1156
Cassani G, Blasi F: The receptor-binding sequence of urokinase. J
Biol Chem 262:4437, 1987
8. Behrendt N, Ploug M, Patthy L, Houen G, Blasi F, Dane K:
The ligand-binding domain of the cell surface receptor for urokinasetype plasminogen activator. J Biol Chem 266:7842, 1991
9. Vassalli J, Baccino D, Belin D: A cellular binding site for the
M, 55,000 form of the human plasminogen activator, urokinase. J
Cell Biol 100:86, 1985
10. Berglum AD, Byskov A, Ragno P, Roldan AL, Tripputi P,
Cassani G, Dan0 K, Blasi F, Bolund L, Kruse TA: Assignment of
the urokinase-type plasminogen activator receptor gene (PLAUR)
to chromosome 19q13.1-q13.2. Am J Hum Genet 50:492, 1992
11. Roldan AL, Cubellis MV, Masucci MT, Behrendt N,Lund
LR, Dane K, Appella E, Blasi F: Cloning and expression ofthe
receptor for human urokinase plasminogen activator, a central molecule in cell surface, plasmin dependent proteolysis. EMBO J 9:467,
1990
12. Behrendt N, Renne E, Ploug M, Petri T, Lober D, Nielsen
LS, Schleuning W, Blasi F, Appella E, Dan0 K: The human receptor
for urokinase plasminogen activator. J Biol Chem 265:6453, 1990
13. Ploug M, Renne E, Behrendt N, Jensen AL,Blasi F, Dan0
K: Cellular receptor for urokinase plasminogen activator. Carboxylterminal processing and membrane anchoring by glycosyl-phosphatidylinositol. J Biol Chem 266:1926, 1991
14. Ploug M, Behrendt N, Leber D, Dane K:Protein structure
and membrane anchorage of the cellular receptor for urokinase-type
plasminogen activator. Semin Thromb Hemost 17:183, 1991
15. Ploug M, Plesner T, Renne E, Ellis V, Hoyer-Hansen G,
Hansen NE, Dan0 K: The receptor for urokinase-type plasminogen
activator is deficient on peripheral blood leukocytes in patients with
paroxysmal nocturnal hemoglobinuria. Blood 79: 1447, 1992
16. Ploug M, Eriksen J, Plesner T, Hansen NE,Dane K: A soluble
form of the glycolipid-anchored receptor for urokinase-type plasminogen activator is secreted from peripheral blood leukocytes from
patients with paroxysmal nocturnal hemoglobinuria. Eur J Biochem
208:397, 1992
17. Williams AF: Emergence of the Ly-6 superfamily of GPIanchored molecules. Cell Biol Int Rep 15:769, 1991
18. Davies A, Simmons DL, Hale G, Harrison RA, Tighe H,
CASEY ET AL
Lachmann PJ, Waldmann H: CD59, an Ly-6-like protein expressed
in human lymphoid cells, regulates the action of the complement
membrane attack complex on homologous cells. J Exp Med 170:637,
1989
19. Williams AF, Tse AG-D, Gagnon J: Squid glycoproteins with
structural similarities to Thy-l and Ly-6 antigens. Immunogenetics
27:265, 1988
20. Palfree RGE: The urokinase-type plasminogen activator receptor is a member of the Ly-6 superfamily. Immunol Today 12:170,
1991 (letter)
21. Ploug M, Kjalke M, Renne E, Weidle U, Heyer-Hansen G,
Dan0 K: Localization of the disulfide bonds in theNH,-terminal
domain of the cellular receptor for human urokinase-type plasminogen activator. A domain structure belonging to a novel superfamily
of glycolipid-anchored membrane proteins. J Biol Chem 268: 17539,
1993
22. Sugita Y, Nakano Y, Oda E, NodaK, Tobe T, Miura NH,
Tomita M: Determination of carboxyl-terminal residue and disulfide
bonds of MACIF (CD59), a glycosyl-phosphatidylinositol-anchored
membrane protein. J Biochem 114:473, 1993
23. Petranka JG, Fleenor DE, Sykes K, Kaufman RE, Rosse WF:
Structure of theCD59-encoding gene: Further evidence of a relationship to murine lymphocyte antigen Ly-6 protein. ProcNatlAcad
Sci USA 89:7876, 1992
24. Tone M, Walsh LA, Waldmann H: Gene structure of human
CD59 and demonstration that discrete mRNAs are generated by
alternative polyadenylation. J Mol Biol 227:971, 1992
25. Bothwell A, Pace PE, LeClair Kp: Isolation and expression
of
an
IFN-responsive Ly-6C chromosomal gene. J Immunol
140:2815, 1988
26. Fuse N, Tsuchiya T, Nonomura Y, Menez A, Tamiya T:
Structure of the snake short-chain neurotoxin, erabutoxin c, precursor
gene. Eur J Biochem 193:629, 1990
27. Kristensen P, Eriksen J, Blasi F, Dan0 K: Two alternatively
spliced mouse urokinase receptor mRNAs with different histological
localization in the gastrointestinal tract. J Cell Biol 115:1763 1991
28. Pyke C, Eriksen J, Solberg H, Schnack Nielsen B, Knstensen
P, Lund LR, Dane K An alternatively-spliced variant of mRNA for
the human receptor for urokinase plasminogen activator. FEBS Lett
326:69, 1993
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
1994 84: 1151-1156
The structure of the urokinase-type plasminogen activator receptor
gene
JR Casey, JG Petranka, J Kottra, DE Fleenor and WF Rosse
Updated information and services can be found at:
http://www.bloodjournal.org/content/84/4/1151.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.