From DNA to Protein - MrsDaintreysOnlineClassroom
Transcription
From DNA to Protein - MrsDaintreysOnlineClassroom
Name:______________________________ Block:_______ DNA and Protein Synth WS #2 Protein Synthesis: From DNA to Protein 1. What is RNA? 2. What is the difference between DNA and RNA? 3. What is the structure of RNA? (Three Parts) 4. What are the types of RNA? 5. In protein sysnthesis there are two major steps, what are they? 6. What does Messenger RNA Do? 7. What does transfer RNA do? 8. What does Ribosomal RNA Do? Daintrey’s Doings J 1 Name:______________________________ Block:_______ DNA and Protein Synth WS #2 9. Synthesize the steps of translation into 5 1 2 3 4 5 10. Label the following diagram with all of the following terms: Transcription, translation, DNA, mRNA, tRNA, ribosomes, amino acids, anticodons Daintrey’s Doings J 2 Name:______________________________ Block:_______ DNA and Protein Synth WS #2 11. What are the three steps to translation? 12. Complete the table below. Use the following DNA sequence. CGGCTATTCGACCCTTACGGTATTGGG DNA Triplet CGG mRNA Codon GCC tRNA antiCodon CGG 13. DNA sequences are often used to determine relationships between organisms. DNA sequences that code for a particular gene can vary, although organisms that are closely related will have very similar sequences. This table shows the amino acid sequences of 4 organisms. Based on these sequences, which two organisms are the most closely related? Explain. Human: CCATAGCACCTA Chimpanzee: CCATAACACCTA A Pig: CCATGTAAACGA Cricket: CCTAAAGGGACG 14. What is the start codon? _______________ Daintrey’s Doings J 3 Name:______________________________ Block:_______ DNA and Protein Synth WS #2 15. What are the stop codons? _________________________________________________ 16. How are amino acids joined together? ________________________________________ 17. What is a p and an a site 18. Where is the new protein sent for final processing? 19. 20. Daintrey’s Doings J 4 Name:______________________________ Block:_______ DNA and Protein Synth WS #2 21. 22. 23. Daintrey’s Doings J 5 Name:______________________________ Block:_______ DNA and Protein Synth WS #2 24. 25. 26. Daintrey’s Doings J 6