Molecular Cloning, Characterization, and mRNA Expression of

http:// www.jstage.jst.go.jp / browse / jpsa
doi:10.2141/ jpsa.0110125
Copyright Ⓒ 2013, Japan Poultry Science Association.
Molecular Cloning, Characterization, and mRNA Expression of Intestinal
Fatty Acid Binding Protein (I-FABP) in Columba Livia
Peng Xie, Lian-Long Liu, Chao Wang and Xiao-Ting Zou
Key Laboratory for Molecular Animal Nutrition of Ministry of Education, Feed Science Institute,
Zhejiang University, Hangzhou 310058, China
Intestinal fatty acid binding protein (I-FABP) is involved in fatty acid transportation in mammals. To verify its
role in fatty acid metabolism in birds, the model of pigeon intestinal organ culture was established, and a full-length
cDNA of I-FABP was cloned from the intestine of Columba livia by rapid amplification of cDNA ends (RACE)
method for the first time. The full length cDNA of C. livia I-FABP was 855 bp, including a 5′
untranslated region
(UTR) of 34 bp, a 3′
UTR of 422 bp and an open reading frame (ORF) of 399 bp encoding a protein of 132 amino acids
with the predicted molecular weight of 15.13 kDa. Sequence comparison indicated that I-FABP of C. livia had high
identity with other avian I-FABP and belonged to the first subfamily of FABPs. Using quantitative real-time PCR,
pigeon I-FABP mRNA in duodenum and jejunum increased progressively with development stage. I-FABP mRNA
was expressed at the highest level at 28 day post hatch in the duodenum, while in ileum, it reached the maximum at the
day of hatch, and decreased subsequently. The effects of fatty acids on pigeon I-FABP expression were also
investigated in vitro. The results showed that significant increases in the pigeon I-FABP mRNA level were induced
by linoleic acid and arachidonic acid, whereas I-FABP gene expression appeared to be unaffected by oleic acid and αlinolenic acid. The results indicate that I-FABP may be indicative of intestine development in pigeon, and it could be
regulated by n-6 polyunsaturated fatty acids.
Key words: cDNA cloning, Columba livia, intestinal fatty acid binding protein, long-chain fatty acids, mRNA
expression
J. Poult. Sci., 50: 9-19, 2013
Introduction
Cytosolic fatty acid binding proteins (FBAPs) are low
molecular weight (14-15 kDa) proteins with high affinities
for hydrophobic ligands, such as long-chain fatty acids
(LCFAs) (Veerkamp and Maatman, 1995). To date, at least
10 FABP isoforms have been identified in vertebrates
(Bernlohr et al., 1997). According to the initial tissue from
which they are first isolated, members of FABPs are named
as followed: Adipocyte-type FABP (A-FABP), Myelin P2
protein (MP2), Testis-type FABP (T-FABP), Epidermaltype (E-FABP), Brain-type (B-FABP), Heart-type (HFABP), Intestinal-type (I-FABP), Liver basic-type (LBFABP), Ileal-type (IL-FABP) and Liver-type (L-FABP).
Similar with other FABP isoforms, tertiary structure of IFABP consists of two short α-helices and 10 antiparallel βReceived: October 18, 2011, Accepted: June 10, 2012
Released Online Advance Publication: July 25, 2012
Correspondence: Prof. XT Zou, Key Laboratory for Molecular Animal
Nutrition of Ministry of Education, Feed Science Institute of Zhejiang
University, Yuhangtang Road 388, Hangzhou 310058, China.
(E-mail: [email protected])
strands, which organize into a helical cap and two orthogonal
β-sheets (Bernlohr et al., 1997; Marcelino et al., 2006).
LCFAs can be bound within the barrel in the central of
internal water filled cavity. Due to this protein specially
found in mature enterocytes, I-FABP was thought to be
crucial in fatty acids trafficking, and targeting ligands to
specific organelle for metabolic process. Even so, the specific function of I-FABP in animal intestine remains elusive.
LCFAs play central roles in human and animal growth and
development. Not only do they provide sources of metabolic
energy, components of membranes, or precursors for eicosanoids and docosahexenoic acid, but also serve as ligands
or transcription factors in cell signal transduction and gene
expression regulation (Innis, 2007; Woods and Fearon,
2009). Studies focused on mammals have shown that dietary
regulation can affect I-FABP expression. Rats fed with highfat diets containing 20-38% vegetable oil showed a 40-50%
increase in cytosolic content of I-FABP (Ockner and Manning, 1974). Conversely, reports also show that I-FABP expression increases by 100% after 3 days of feed deprivation
but remains unaltered by a 7-day fat feeding in the mouse
(Besnard et al., 1991; Poirier et al., 1997). However, in-
Journal of Poultry Science, 50 (1)
10
formation about avian I-FABP is very scarce. Only three
avian I-FABP sequences have been obtained, including chick
(Gallus gallus), duck (Anas platyrhynchos) and zebra finches
(Taeniopygia guttata). Knowledge on the developmental
pattern of I-FABP expression and its regulation mechanism
in birds is rarely reported.
The pigeon (Columba livia), a typical representative of
altrices, is widely bred for its meat, use in sport, and as an
experimental animal in behavioural or viral experiments
(Sales and Janssens, 2002). However, very little research
about the development mechanism and nutrient metabolism
has been studied in this species. Therefore, in the present
study, we first cloned the I-FABP gene in pigeons, and
characterized the gene expression from the embryonic period
to 28-day squab. Furthermore, we evaluated different LCFAs
on the expression profile of I-FABP in an organ culture
system. The identification and characterization of I-FABP
may contribute to a better understanding of fatty acid metabolism in avian species and develop useful strategies for
nutrient requirements in the pigeon industry.
Materials and Methods
The experiment was conducted in accordance with Chinese
guidelines for animal welfare and was approved by the
animal welfare committee of the Animal Science College,
Zhejiang University.
Animals and Embryos
Twenty-four healthy young pigeons (C. livia), were obtained from Xingliang commercial pigeon farm (Wenzhou,
China). To study the embryogenetic expression profiles,
fertile eggs were also obtained from the same farm. They
were weighed and 24 of them were divided into four groups
with equal weight frequency distribution, average egg weight
was 18.4×1.2 g. The remaining eggs were used for intestine
organ culture. The eggs were incubated under optimal
condition (38.1℃, 55% relative humidity) in the incubator.
Six young pigeons at post-hatching day 3 (3d), 8 (8d), 14
(14d) and 28 (28d) were killed. The eggs were opened at the
blunt end using surgical scissors, and the embryos from each
group were sacrificed to be sampled on the following days:
embryonic day 11 (11e), embryonic day 13(13e), embryonic
day 15 (15e) and hatching day (0d). For each pigeon and
embryo, the small intestine was dissected and divided into
three parts, duodenum, jejunum and ileum. They were
quickly frozen in liquid nitrogen and then stored at −80℃.
Organ Culture
Tissue culture of pigeon embryonic intestine was conducted by the methods described previously with some
modifications (Shimizu et al., 1991; Chen et al., 1994).
Briefly, the jejunum was excised from the 14-day pigeon
embryo and the mesentery was removed. The embryonic
jejunum was cut into 2 mm long segments, and immediately
washed twice with calcium- and magnesium-free Hanks
balanced salt solution (HBSS, M&C Gene, China). The
fragments were placed on a rectangular grid of 60-mesh
stainless steel in the 1.5 cm-radius central well of a plastic
culture dish (BD Bioscience, USA). Then 1 ml culture me-
dium was added into the well. The serum-free culture medium was composed of a 1:1 mixture of Dulbecco’s modified
Eagle medium (DMEM; Invitrogen, USA) and Roswell
Memorial Institute 1640 medium (RPMI 1640; Genom,
China), supplemented with 10 mM HEPES, 2 mM glutamine,
and 0.2% fatty acid-free bovine serum albumin (BSA; Wako,
Japan). In order to maintain a humid environment, a ring of
sterile filter paper saturated with 150 mmol/l NaCl solution
was placed surrounding the central well. The cultures were
incubated at 37℃ in a 95% O2 and 5% CO2 atmosphere.
Enzyme Activities
To testify the availability of intestinal organ culture system, jejunum samples collected from 0 to 7d during the incubation were homogenized in lysis buffer (KeyGEN, China)
with an Ultra-Turrax (T8, IKA-Labortechnik, Staufen, Germany). This process was conducted on ice. The homogenate was centrifuged at 10,000 rpm for 1 min at 4℃, and the
supernatant was used for measuring the activities of caspase3 enzyme, alkaline phosphatase (AKP) and succinate dehydrogenase (SDH). The caspase-3 enzyme was examined
by assay kit purchased from KeyGEN Company, and AKP,
SDH and protein content in samples were determined by
assay kits purchased from Nanjing Jiancheng Institute of
Bioengineering (Nanjing, Jiangsu, China).
Preparation of Fatty Acid Sodium Salt and Fatty Acid-BSA
Complex
Preparation of fatty acid sodium salt and fatty acid-BSA
complex was made according to the method of Alvaro et al.
(2010). Briefly, 10 mg of fatty acids (oleic acid, linoleic
acid, α-linolenic acid, palmitic acid and arachidonic acid)
(Sigma-Aldrich, St. Louis, USA) were mixed with 0.5 ml
EtOH and 5 M NaOH was used to adjust the molar ratio of
fatty acids to NaOH 1:1. The mixture was dried under
nitrogen gas and then dissolved in 2 ml of sterile water to
make the stock solutions of fatty acids. 1 μM butylated
hydroxytoluene was added to the stock solutions in order to
prevent oxidation. 5 mM fatty acid free BSA was used to
combine with the fatty acids, the molar ratio of fatty acid to
BSA was 3:1, the fatty acid-BSA solutions were sterilefiltered and used fresh.
RNA Isolation and Reverse Transcription
Total RNA was extracted from the intestines using Trizol
reagent (Invitrogen) and genomic DNA was eliminated using
RNase-free DNase (TaKaRa, Dalian, China) according to the
manufacturer’s instructions. The quality of total RNA was
checked by both native RNA electrophoresis on 1.0% agarose gel and the UV absorbance ratio at 260 nm and 280 nm.
cDNA was synthesized by M-MLV reverse transcriptase
(TaKaRa) at 42℃ for 60 min with oligo dT-Adaptor primer
(Table 1) following the protocol of the manufacturer.
Cloning the Full-length cDNA of C. livia I-FABP
To identify I-FABP partial coding sequences, degenerated
primers IF-F, IF-R (Table 1) were designed based on the
highly conserved sequences of I-FABP from Gallus gallus
(NP_001007924), Taeniopygia guttata (XP_002187542),
Anas platyrhynchos (JN202313), Xenopus laevis (AAI
70117), Danio rerio (NP_571506), Sus scrofa (AAX62516),
Xie et al.: I-FABP in Pigeon
Table 1.
Primer name
IF-F
IF-R
5′CDS-primer
3′CDS-primer
SMARTer II
A Oligonucleotide
UPM
11
Primer used in the present study
Primer sequence (5′
-3′
)
AGRAARYTDGSAGCYCAC
TCHGTYCCRTCWGCBAGA
(T)25VN
AAGCAGTGGTATCAACGCAGAGTAC(T)30VN
AAGCAGTGGTATCAACGCAGAGTACXXXXX
GSP1
GSP2
IF-QF
IF-QR
18S-QF
18S-QR
Oligo dT
Long: CTAATACGACTCACTATAGGGCAA
GCAGTGGTATCAACGCAGAGT
Short: CTAATACGACTCACTATAGGGC
GTGATCTTCAGATTATCGTGGGCTCC
GGAGCCCACGATAATCTGAAGATCAC
AGAGAAAGTTAGGAGCCCACGA
ACCAGTAAGTTCAGTCCCATCAG
AGCTCTTTCTCGATTCCGTG
GGGTAGGCACAAGCTGAGCC
TTTTTTTTTTTTTTTTTT
M13-47
RV-M
CGCCAGGGTTTTCCCAGTCACGAC
GAGCGGATAACAATTTCACACAGG
Application
Degenerate
primersa
For RACE-PCRb
For quantitative
real-time PCR
For reverse
transcription
Vector primer
RACE: rapid amplification of cDNA ends
a
R, A/G; Y, C/T; D, A/T/G; S, C/G; H, A/T/C; W, A/T; B, T/G/C
b
N, A/T/G/C; V, A/G/C; X: undisclosed base in the proprietary SMARTer oligo sequence
Rattus norvegicus (EDL82110).
The PCR was performed in a total volume of 25 μL on
Thermal Cycler (Longene, China), PCR mixture contained 2
μL of 2.5 mmol/L dNTP mix, 2.5 μL 10×reaction buffer, 2
μL of 25 mM MgCl2, 2 μL of each primer IF-F and IF-R, 2
μL template cDNA, 0.25 μL of ExTaq DNA polymerase (5
U/μL) (TaKaRa), and 12.25 μL of MilliQ water. RT-PCR
cycles were conducted at 95℃ for 3 min followed by 35
cycles of 94℃ for 30 s, 55℃ for 1 min, 72℃ for 1 min, and a
final cycle of 72℃ for 10 min. The PCR products were
analyzed by electrophoresis on 1.2% agarose gel, and then
purified by DNA purification kit (TaKaRa). The products
were integrated into pMD 18-T vector (TaKaRa). Vectors
containing cloned inserts were transformed into E.coli DH5α
and incubated for 12 hours at 16℃. Positive clones were
identified by blue/white screening and PCR screening with
M13-47 and RV-M primers (Table 1), and then sequenced.
Full length of pigeon I-FABP cDNA was obtained by the
method of rapid amplification of cDNA ends (RACE) technology. The SMARTTM RACE cDNA Amplification Kit
(Clontech, USA) was used to perform RT and RACE PCR.
The synthesis of the first strand cDNA was conducted using
reverse transcriptase with SMARTer II A Oligonucleotide
and 5′
-CDS primer A for 5′
RACE and 3′
-CDS primer A for
3′
-RACE. Reaction conditions were followed by the manufacturer’s instruction. For 5′
-RACE, the primer GSP1 and
the universal primer A mix (UPM) were used. For 3′
-RACE,
the primer GSP2 and UPM were used. All these primers are
listed in Table 1. The PCR reaction conditions were conducted by the manufacturer’s protocol in the AdvantageTM 2
PCR kit (Clontech, USA).
Sequence Analysis
The open reading frame (ORF) of I-FABP gene was obtained by ORF Finder (http: //www. ncbi. nlm. nih. gov/gorf/
gorf.html). The protein molecular mass and isoelectric point
(pI) of pigeon I-FABP were predicated by ExPASy Compute
pI/Mw tool (http: //web. expasy. org/compute_pi/). The homology search of nucleotide and protein sequence of pigeon
I-FABP was using BLAST program (http://www. ncbi.nlm.
gov/blast). PROSITE program was performed to analyze the
functional sites of deduced amino acid sequence (http://
www.expasy.org/prosite). The domain analysis was using
SMART tool (http://smart.embl-heidelberg.de/smart/set_
mode.cgi?NORMAL=1).
Multiple Sequences Alignment and Phylogenetic Analysis
Multiple sequence alignment of the I-FABP was performed with software ClustalX 2.0. The result was viewed
on BoxShade Server. A neighbor-joining phylogenetic tree
was constructed using MEGA software version 4.0. The
reliability of branching was tested by bootstrap analysis
which performed for values representing 1000 replicates.
I-FABP mRNA Expression in Embryonic and Post-hatching Pigeon Small Intestine
Small intestines of fertilized embryos and squabs from
different development stages (including 11e, 13e, 15e, 0d,
3d, 8d, 14d and 28d) were sampled to dissect into three parts,
duodenum, jejunum and ileum, and I-FABP mRNA expressions were separately detected by SYBR Green quantitative real-time PCR (qRT-PCR). The method for total
RNA isolation and reverse transcription was the same as
described in section 2.4.
The qRT-PCR was performed on an ABI StepOne Plus
Real-Time PCR system (Applied Biosystems, USA). Two
Journal of Poultry Science, 50 (1)
12
gene specific primers IF QF and IF QR (Table 1) were used
to amplify a 161 bp I-FABP gene fragment and two 18S
primers 18S QF and 18S QR (Table 1) were used to amplify a
256 bp 18S gene fragment as the internal control. PCR
reaction used SYBR Premix PCR kit (TaKaRa). The PCR
program was 95℃ for 30 s, followed by 42 cycles of 95℃ for
3 s, 60℃ for 10 s and 72℃ for 30 s. The standard curve was
determined using pooled samples. Each sample was performed in duplicate and negative controls without cDNA
template were included in this experiment. Specificity of the
amplification was verified at the end of PCR run by melting
curve analysis. The relative expression quantity was calculated using the 2−ΔΔCt method (Livak and Schmittgen,
2001).
I-FABP mRNA Expression in Pigeon Jejunum After Fatty
Acids Incubation In vitro
To test if fatty acids may affect the expression of I-FABP,
pigeon embryonic jejunums were treated by different concentrations (5, 50 and 250 μM) of fatty acids in organ culture
system for 24 h. The tissues were then collected to analyze
the I-FABP mRNA expression. The methods of total RNA
extraction and qRT-PCR were the same as those described
above. The primers of I-FABP and 18S for were also the
same. Each treatment had three replicates.
Statistical Analysis
All data were presented as means±S. E. of the relative
mRNA expression. The data were statistically analyzed by
one-way ANOVA by SPSS 17.0 (SPSS Inc., Chicago, IL),
and the level of statistically significant difference was set at
P＜0.05.
Results
Changes of Enzyme Activities in Pigeon Jejunum During
the Period of Organ Culture
To investigate the availability of intestinal organ culture
system, enzyme activities of caspase-3, AKP and SDH were
determined from 0 to 7 d during the culture. As shown in
Fig. 1, caspase-3 activity was increased significantly at 1 d
(P＜0.05), but it decreased subsequently and remained the
same level between days 2 and 7 except that at 6 d. No
differences were observed in AKP activity between days 0
and 2, but it increased significantly during the culture period
at day 3-7 (P＜0.05). SDH activity between days 2 and 6
was significantly higher than that at 0 and 1 d (P＜0.05).
Cloning and Identification of Pigeon I-FABP cDNA
The full-length cDNA of pigeon I-FABP was obtained by
the RACE method. The complete sequence of I-FABP cDNA
was 855 bp, containing a 5′
untranslated region (UTR) of 34
bp, a 3′
UTR of 422 bp and an ORF of 399 bp (Fig. 2). The
ORF encoded 132 amino acid residues including an 18 amino
acids cytosolic fatty-acid binding proteins signature. The
calculated molecular mass of the protein was 15.13 kDa with
theoretical pI of 6.75. The sequence of I-FABP was submitted to NCBI under GenBank accession number JF835078.
Multiple Sequences Alignment and Phylogenetic Analysis
As shown in Fig. 3, the deduced amino acids of pigeon IFABP shared high identity with reported I-FABP in other
Activity of caspase-3 enzyme, alkaline phosphatase and succinate dehydrogenase in the pigeon
embryonic jejunum at 0, 1, 2, 3, 4, 5, 6, 7 d of culture
in vitro. Data are means±S.E. (n＝3).
Fig. 1.
species. Blast search indicated that pigeon I-FABP presented 91% identity with A. platyrhynchos, 87% with G.
gallus, 80% with T. guttata, 79% with Mus musculus, 76%
with Homo sapiens. 18 amino acids, from residue 5 to 22,
were identified as a cytosolic fatty-acid binding proteins
signature in most species shown in Fig. 3 except Equus
caballus. A lipocalin domain was found in pigeon I-FABP
within the amino acids sequence started at position 4 and
ended at position 131, which was the same as it in A.
platyrhynchos, while those of other species all covered from
position 4 to position 132.
To reveal the molecular phylogenetic position of pigeon IFABP, a phylogenetic tree of reported FABPs’ amino acid
sequences was constructed by neighbor-joining method from
Xie et al.: I-FABP in Pigeon
13
Nucleotide and deduced amino acid sequence of intestinal
fatty acid binding protein of pigeon C. livia (Genbank accession
number JF835078). The cytosolic fatty-acid binding proteins signature
is underlined letters. Polyadenlation signal is double-underlined. The
asterisk indicates the stop codon.
Fig. 2.
a distance matrix, performed with the MEGA 4.0 software
(Fig. 4). Two subfamilies of FABPs were found. The adipocyte, testis, epidermal, brain, heart and intestinal FABP
and myelin P2 protein were confined to the first group. The
second group contained liver basic, ileal and liver FABP.
Pigeon I-FABP belonged to first subfamily.
Embryogenetic and Post-hatching I-FABP Expression in
Pigeon
The development patterns of I-FABP gene expression in
duodenum, jejunum, and ileum were analyzed by quantitative real-time PCR. As shown in Fig. 5, a similar expression
trend was found in duodenum and jejunum, I-FABP mRNA
level increased with progressing of development stage, and
both of them reached a peak value at post-hatching 28 day
(28d) (P＜0.05). However, an inverse expression trend was
found in the ileum, I-FABP gene expression reached a maximum at the hatching day (0d) (P＜0.05), but then gradually
decreased to embryonic level.
Effects of Fatty Acids on I-FABP mRNA Expression
To investigate whether I-FABP expression was regulated
by LCFAs, jejunum fragments in an organ culture system
were treated with oleic acid, linoleic acid, α-linolenic acid,
palmitic acid and arachidonic acid at the concentrations of 5,
50 and 250 μM respectively. The organs were incubated
with those LCFAs for 24 hours and I-FABP mRNA expression was determined. As shown in Fig. 6, oleic acid and αlinolenic acid had no effect on I-FABP mRNA expression (P
＞0.05) compared with the control group, whereas the addition of 5 and 50 μM linoleic acid significantly increased I-
FABP mRNA level by 146% and 95% (P＜0.05) respectively. However, when 250 μM linoleic acid and palmitic
acid was used, I-FABP mRNA level was decreased by 52%
and 59% (P＜0.05) respectively. In contrast, high concentrations of arachidonic acid appeared to have greater inducement since 250 μM of which can significantly increase
the I-FABP mRNA level by 150% (P＜0.05).
Discussion
Organ culture of intact small intestine had been proved to
be a useful technique for the study of virus pathogenicity,
drug and nutrient metabolism or cell differentiation (Corradino, 1974; Batt et al., 1995; Tou et al., 2004). Kedinger
et al. (1974) reported that organ culture of adult guinea-pig
intestine can just be available for 24h on the condition that
the villi remained undamaged. However, the gut segments
from mouse embryo were grown in catenary culture for up to
10d (Hearn et al., 1999). So, it is suggested that organ culture of animal embryonic intestine seemed to have much
stronger activity than that of adult animal. In the current
study, we investigated the activity of caspase-3 which is a
key enzyme in regulation of cell apoptosis, the results
indicated that the intestine extracted from the body cultured
in vitro may require an acclimation. ALP, expressed by the
enterocytes on the top of the villi, is a marker of mucosal
enterocyte maturation (Weiser, 1973; Traber et al., 1992).
SDH is a membrane-bound dehydrogenase linked to the
respiratory chain and a key member of the tricarboxylic acid
(TCA) cycle. Continuous increase of these two enzymes
Journal of Poultry Science, 50 (1)
14
Multiple alignments of pigeon C. livia I-FABP with other
known I-FABP deduced amino acid sequence: Gallus gallus (NP_
001007924), Anas platyrhynchos (JN202313), Taeniopygia guttata (XP_
002187542), Xenopus laevis (AAI70117), Danio rerio (NP_571506),
Salmo salar (ACI69121), Homo sapiens (AAI11792), Sus scrofa (AAX
62516), Equus caballus (AAT08114), Mus musculus (NP_032006),
Rattus norvegicus (EDL82110). Cytosolic fatty-acid binding proteins
signature is enclosed with brace above the alignment. Asterisk indicates
amino acid identity. I-FABP＝intestinal fatty acid binding protein.
Fig. 3.
indicated that the pigeon embryonic gut segments in vitro
still maintained high rate of metabolism during the 7d culture. Therefore, the intestine organ culture system used in
this study was available, and it was also suggested that 24 h
should be pre-cultured before the experiment began.
Intestinal fatty acid binding protein (I-FABP) is cytosolic
protein synthesized in the polarized columnar epithelial cells
(Scapin et al., 1991). It has been thought to play an important role in shuttling fatty acids, because of its internal site for
non-covalent binding of long-chain fatty acids (Zimmerman
and Veerkamp, 2002). In the present study, we used genespecific primers to clone and analyze the pigeon I-FABP
gene sequence, the full length of pigeon I-FABP cDNA
reported encoded a putative fatty acid binding protein of 131
amino acids, which was the same as that in mammals and
other birds (Green et al., 1992; Wang et al., 2005; Jiang and
Li, 2006). Cytosolic fatty-acid binding proteins signature
from the N-terminal extremity and a lipocalin domain were
also detected. On the basis of similarities of structure, function and sequence, this family with other two, the lipocalin
and avidin/streptavidin families, form a larger group: the
calycin structural superfamily (Flower, 1993; Flower et al.,
1993). The clustalX alignment of pigeon I-FABP revealed
high identity with avian I-FABP sequences (80%-90%), but
Xie et al.: I-FABP in Pigeon
15
Fig. 4. Neighbor-joining phylogenetic tree of FABP amino acid sequences from selected species. The Genbank accession
numbers for the sequences are as follows: A-FABP, Homo sapiens (NP_001433), Mus musculus (NP_077717), Gallus gallus
(NP_989621), Anas platyrhynchos (AEH03009), Anser anser (AAl79836), Taeniopygia guttata (XP_002199746), Danio rerio
(ABB96216), Salmo salar (ACN12235); B-FABP, Homo sapiens (NP_001437), Mus musculus (AAA81904), Gallus gallus (NP_
990639), Taeniopygia guttata (XP_002188863), Danio rerio (NP_999972), Salmo salar (ACN12396); E-FABP, Homo sapiens
(NP_001435), Mus musculus (NP_034764), Sus scrofa (ABD18458); H-FABP, Homo sapiens (NP_004093), Mus musculus (NP_
034304), Gallus gallus (NP_001026060), Anas platyrhynchos (ABH10617), Danio rerio (NP_694493), Salmo salar (ACI69906);
I-FABP, Homo sapiens (AAI11792), Mus musculus (NP_032006), Gallus gallus (NP_001007924), Anas platyrhynchos
(JN202313), Taeniopygia guttata (XP_002187542), Danio rerio (NP_571506), Salmo salar (ACI69121); IL-FABP, Homo
sapiens (EAW61565), Mus musculus (EDL33855), Danio rerio (AAH72553), Salmo salar (ACI68068); LB-FABP, Anas
platyrhynchos (HM049632), Gallus gallus (AAK58094), Taeniopygia guttata (XM_002196411), Danio rerio (AAF67743),
Rhamdia sapo (P80856), Homo sapiens (NP_001434), Mus musculus (AAH09812), Gallus gallus (AAK58095), Taeniopygia
guttata (XP_002188068), Anas platyrhynchos (AEH03008), Danio rerio (NP_001038177), Salmo salar (NP_001134229); MP2,
Homo sapiens (P02689), Mus musculus (P24526), Sus scrofa (P86412); T-FABP, Homo sapiens (NP_001073995), Mus musculus
(AAH48437), Bos Taurus (NP_001179339). FABP＝fatty acid binding protein. A-FABP＝adipocyte-type fatty acid binding
protein. MP2＝myelin P2 protein. T-FABP＝testis-type fatty acid binding protein. E-FABP＝epidermal-type fatty acid
binding protein. B-FABP＝brain-type fatty acid binding protein. H-FABP＝heart-type fatty acid binding protein. I-FABP＝
intestinal-type fatty acid binding protein. LB-FABP＝liver basic-type fatty acid binding protein. IL-FABP＝ileal-type fatty acid
binding protein. L-FABP＝liver-type fatty acid binding protein.
16
Journal of Poultry Science, 50 (1)
Fig. 5. Gene expression of intestinal fatty acid binding
protein in duodenum, jejunum, and ileum of C. livia
during embryogenesis and post-hatching stage. Gene
expression was analyzed by quantitative of real-time PCR.
The development stage included embryonic day: 11e, 13e,
15e; hatching day (0d); post-hatching day: 3d, 8d, 14d and
28d. Vertical bars represent the means±S.E. (n＝6 embryos or squabs per group) and bars with different letters
(a, b and c) are significantly different (P＜0.05).
low identity (26%-31%) with other types of avian FABPs
(data not shown). Phylogenetic analysis in this study suggested that two subfamilies of FABPs diverged from a common progenitor as previously reported (Jiang and Li, 2006;
Gong et al., 2010), which was arose by gene duplications
that occurred prior to the most recent common ancestor of
mammals and bony fishes (Hughes and Piontkivska, 2011).
Schaap et al. (2002) reported that I-FABP and other three
FABPs (E-FABP, H-FABP and B-FABP) diverged from a
common ancestral gene about 850 million years ago. Pigeon
I-FABP belonged to the first subfamily of FABPs, and was
more similar to that in A. platyrhynchos and G. gallus.
Minimal mRNA expression of intestinal fatty acid binding
protein was detected in pigeon embryonic intestine, while a
sharp increase, 1115 fold, 512 fold and 229 fold in I-FABP
expression can be found respectively in duodenum, jejunum,
and ileum at the day of hatch. Similar results were also reported in chick and turkey, I-FABP-binding activity showed
significant increases after hatch (Katongole and March,
1980; Ding and Lilburn, 2002). But in mouse, the level of IFABP mRNA rises rapidly on embryonic day 17 (Green et
al., 1992). It is thought that the intestine in birds is still an
immature organ at hatching and the expression of fatty acid
binding protein could be representative of many physiological processes that must develop post hatch before digestive
function becomes mature (Ding and Lilburn, 2002). In
addition, the increase in I-FABP may be in concert with the
uptake of dietary fatty acids. Unlike the chick and other
poultry, newly hatched pigeon squabs are fed pigeon “milk”,
called crop milk from parents for nearly 28d. It has been
reported that crop milk contains high concentrations of fat
and protein in the first five days after squabs hatching, and fat
is the principle energy source in squabs diet, which in turns
cause an 8-fold increase in body weight in the first week
(Shetty and Hegde, 1991). So, it is suggested that the development rate of function of intestinal fatty acid transportation is very rapid. However, I-FABP expression in the ileum
declined with the developmental progression, which was
different from that in duodenum and jejunum. In mice, IFABP has a horizontal gradient (duodenal to colon) of expression, with the highest levels of expression in the jejunum
and ileum (Veerkamp and Maatman, 1995). The reason for
this difference may be partially attributed to the distinct
intestinal structure of flying birds. In order to maintain the
high level of metabolism and decrease the flying load, the
digestion rate of pigeons is rapid, not only are the caeca
degenerated but the colon and rectum are very short. It is
likely that fatty acid is transported more efficiently in pigeon
duodenum and jejunum. I-FABP expression in the ileum
was higher in the early stage, which may indicate that ileum
just plays a supplementary role in fatty acid transportation.
Intestinal fatty acid binding protein has been thought to
play an important role in intracellular transport of fatty acids.
However, studies focused on the relationship between IFABP expression and dietary fat often get inconsistent results
(Ockner and Manning, 1974; Poirier et al., 1997). In crop
milk, oleic acid comprises nearly one half of the total fatty
Xie et al.: I-FABP in Pigeon
17
Regulation of pigeon I-FABP mRNA level by fatty acids of
various chain carbon length and saturation. Jejunum fragments were
incubated for 24 h with increasing concentrations (5, 50 and 250 μM) of
oleic acid, linoleic acid, α-linolenic acid, palmitic acid and arachidonic
acid separately. I-FABP mRNA expression was determined by quantitative real-time PCR. Vertical bars represent the means±S.E. (n＝3)
and bars with different letters (a, b and c) are significantly different (P＜
0.05).
Fig. 6.
acids, and palmitic acid is the commonest saturated acid in
the triglycerides, which accords for approximately 16%, and
then linoleic acid accords for 13%, α-linolenic acid and
arachidonic acid were the least, no less than 1% (Desmeth,
1980). In spite of their high concentrations in crop milk,
oleic acid and palmitic acid can not induce the increase of
pigeon I-FABP gene expression in our study, which was
different from the results of liver-FABP found in rat
(Meunier-durmort et al., 1996). Overexpression of I-FABP
gene also discloses a low rate of oleic acid incorporation but
shows a significantly increase the level of mitochondrial fatty
acid oxidation (Montoudis et al., 2006, 2008). This could be
another proof that, like I-FABP in mammals (Vassileva et al.,
2000), pigeon I-FABP may also function as a lipid-sensing
component but is not essential for fat absorption. In addition, our study found that pigeon I-FABP mRNA level had
close relationships with linoleic acid and arachidonic acid.
Low concentration of linoleic acid and high concentration of
Journal of Poultry Science, 50 (1)
18
arachidonic acid all could increase the expression of IFABP. So, pigeon I-FABP expression was not sensitive to
those fatty acids accord for high concentrations in crop milk,
and I-FABP expression may be different when animals were
fed diets with different fatty acid composition. Peroxisome
proliferator activated receptors (PPARs) play a key role in
lipid metabolism (Issemann and Green, 1990; Palmer et al.,
1998), which are found to be candidates for transcription of
liver-FABP (Poirier et al., 2001). Gene structure analysis
also show that I-FABP in mammals contain putative PPAR
binding element (DR-1) at upstream region (Sweetser et al.,
1987; Green et al., 1992), which suggests that I-FABP expression may be regulated by the factors which can interact
with PPARs. Meanwhile, the relative potency for PPAR
activation has been compared among the fatty acids as
followed: linoleic acid ＞ arachidonic acid ＞ oleic acid, and
saturated fatty acids showed the lowest affinity with the
receptor (Jump and Clark, 1999). Therefore, it could explain
our founding that I-FABP expression in pigeon was prone to
be affected by linoleic acid at lower concentration compared
with arachidonic acid, and oleic acid and palmitic acid
showed less influences on I-FABP expression. However, in
the present study, I-FABP mRNA level was not affected by
α-linolenic acid, which suggested that I-FABP gene expression in C. livia was probably regulated by n-6 polyunsaturated fatty acids.
In summary, this is the first report of identification and
characterization of I-FABP in pigeon C. livia. Pigeon IFABP shared high identity with other avian I-FABP, and it
belonged to the first subfamily of FABPs. Cytosolic fattyacid binding proteins signature and lipocalin domain were
also detected on the amino acid sequence. Pigeon I-FABP
gene expression showed a distinct development pattern
which is different from that in mammals, and it also can be
regulated by linoleic acid and arachidonic acid.
Acknowledgments
The authors thank all the members in the institute for their
generous technical advice. This research was supported by
National Natural Funds of China (No. 30871803 and No.
31072047).
References
Alvaro A, Rosales R, Masana L and Vallvé JC. Polyunsaturated
fatty acids down-regulate in vitro expression of the key intestinal cholesterol absorption protein NPC1L1: no effect of
monounsaturated nor saturated fatty acids. Journal of Nutritional Biochemistry, 21: 518-525. 2010.
Batt RM, Embaye H, van de Waal S, Burgess D, Edwards GB and
Hart CA. Application of organ culture of small intestine to the
investigation of enterocyte damage by equine rotavirus. Journal
of Pediatric Gastroenterology and Nutrition, 20: 326-332.
1995.
Besnard P, Besnard A and Carlier H. Quantification of mRNA
coding for enterocyte fatty acid binding proteins (FABP) in
rats: effect of high lipid diet and starvation. Comptes Rendus de
Academie Bulgare des Sciences, 312: 407-413. 1991.
Bernlohr DA, Simpson MA, Hertzof AV and Banaszak LJ.
Intracellular lipid-binding proteins and their genes. Annual
Review of Nutrition, 17: 277-303. 1997.
Chen Q, Barros H, Florén CH and Nilsson Å. Absorption and
incorporation into tissue lipids of 3 H-arachidonic- and 14 Clinoleic acid: effects of ethanol in jejunal tissue cultures and in
vivo. Scandinavian Journal of Clinical and Laboratory Investigation, 54: 495-504. 1994.
Corradino RA. Embryonic chick intestine in organ culture: interaction of adenylate cyclase system and vitamin D3-mediated
calcium absorptive mechanism. Endocrinology, 94: 1607-1614.
1974
Desmeth M. Lipid composition of pigeon cropmilk-II fatty acids.
Comparative Biochemistry and Physiology - Part B, 66: 135138. 1980.
Ding ST and Lilburn MS. The ontogeny of fatty acid-binding protein in turkey (Meleagridis gallopavo) intestine and yolk sac
membrane during embryonic and early posthatch development.
Poultry Science, 81: 1065-1070. 2002.
Flower DR. Structural relationship of streptavidin to the calycin
protein superfamily. FEBS Letters, 333: 99-102. 1993.
Flower DR, North ACT and Attwood TK. Structure and sequence
relationships in the lipocalins and related proteins. Protein
Science, 2: 753-761. 1993.
Gong YN, Li WW, Sun JL, Ren F, He L, Jiang H and Wang Q.
Molecular cloning and tissue expression of the fatty acidbinding protein (Es-FABP) gene in female Chinese mitten crab
(Eriocheir sinensis). Journal of Molecular Biology, 11: 71-82.
2010.
Green RP, Cohn SM, Sacchettini JM, Jackson KE and Gordon JI.
The mouse intestinal fatty acid binding protein gene: nucleotide
Sequence, pattern of developmental and regional expression,
and proposed structure of its protein product. DNA and Cell
Biology, 11: 31-41. 1992.
Hearn CJ, Young HM, Ciampoli D, Lomax AE and Newgreen D.
Catenary cultures of embryonic gastrointestinal tract support
organ morphogenesis, motility, neural crest cell migration, and
cell differentiation. Developmental Dynamics, 214: 239-247.
1999.
Hughes AL and Piontkivska H. Evolutionary diversification of the
avian fatty acid-binding proteins. Gene, doi:10.1016/j.gene.
2011.09.016. 2011.
Innis SM. Fatty acids and early human development. Early Human
Development, 83: 761-766. 2007.
Issemann I and Green S. Activation of a member of the steroid
hormone receptor superfamily by peroxisome proliferators.
Nature, 347: 645-650. 1990.
Jiang YZ and Li XW. Molecular cloning and tissue-specific expression of intestinal-type fatty acid binding protein in porcine.
Journal of Genetics and Genomics, 33: 125-132. 2006.
Jump DB and Clark SD. Regulation of gene expression by dietary
fat. Annual Review of Nutrition, 19: 63-90. 1999.
Katongole JBD and March BE. Fat utilization in relation to intestinal fatty acid binding protein and bile salts in chicks of
different ages and different genetic sources. Poultry Science,
59: 819-827. 1980.
Kedinger M, Haffen K and Hugon JS. Organ culture of adult guineapig intestine. I. Ultrastructural aspect after 24 and 48 hours of
culture. Zeitschrift für Zellforschung und Mikroskopische
Anatomie, 147: 169-181. 1974.
Livak KJ and Schmittgen TD. Analysis of relative gene expression
data using real time quantitative PCR and the 2−ΔΔCT method.
Methods, 25: 402-408. 2001.
Xie et al.: I-FABP in Pigeon
Marcelino AM, Smock RG and Gierasch LM. Evolutionary coupling of structural and functional sequence information in the
intracellular lipid-binding protein family. Proteins, 63: 373384. 2006.
Meunier-durmort C, Poirier H, Niot I, Forest C and Besnard P. Upregulation of the expression of the gene for liver fatty acidbinding protein by long-chain fatty acids. Biochemical Journal,
319: 483-487. 1996.
Montoudis A, Delvin E, Menard D, Beaulieu JF, Jean D, Tremblay
E, Bendayan M and Levy E. Intestinal-fatty acid binding
protein and lipid transport in human intestinal epithelial cells.
Biochemical and Biophysical Research Communications, 339:
248-254. 2006.
Montoudis A, Seidman E, Boudreau F, Beaulieu JF, Menard D,
Elchebly M, Mailhot G, Sane AT, Lambert M, Delvin E and
Levy E. Intestinal fatty acid binding protein regulates mitochondrion β-oxidation and cholesterol uptake. Journal of Lipid
Research, 49: 961-972. 2008.
Ockner RK and Manning JA. Fatty acid-binding protein in the small
intestine. Identification, isolation and evidence for its role in
intracellular fatty acid transport. Journal of Clinical Investigation, 54: 326-338. 1974.
Palmer CN, Hsu MH, Griffin KJ, Raucy JL and Johnson EF. Peroxisome proliferators activated receptor-α expression in human
liver. Molecular Pharmacology, 53: 14-22. 1998.
Poirier H, Niot I, Degrace P, Monnot MC, Bernard A and Besnard P.
Fatty acid regulation of fatty acid-binding protein expression in
the small intestine. American Journal of Physiology, Gastrointestinal and Liver Physiology, 273: G289-G295. 1997.
Poirier H, Niot I, Monnot MC, Braissant O, Meunier-Durmort C,
Costet P, Pineau T, Wahli W, Willson TM and Besnard P.
Differential involvement of peroxisome-proliferator-activated
receptors alpha and delta in fibrate and fatty-acid-mediated
inductions of the gene encoding liver fatty-acid-binding protein
in the liver and the small intestine. Biochemical Journal, 355:
481-488. 2001.
Sales J and Janssens GPJ. Nutrition of the domestic pigeon
(Columba livia domestica). World’s Poultry Science Journal,
59: 221-232. 2002.
Scapin G, Gordon JF and Sacchettini JC. Refinement of the structure
of recombinant rat intestinal fatty acid-binding apoprotein at
1.2-Å resolution. Journal of Biological Chemistry, 267: 4253-
19
4269. 1991.
Schaap FG, van der Vusse GJ and Glatz JF. Evolution of the family
of intracellular lipid binding proteins in vertebrates. Molecular
and Cellular Biochemistry, 239: 69-77. 2002.
Shetty S and Hegde SN. 1991. Changes in lipids of pigeon “milk” in
the first week of its secretion. Lipids, 26: 930-933.
Shimizu K, Harada T and Okada S. Toxicity of gentamicin in organ
culture of fetal rat intestine. Cell Biology International Reports,
15: 479-484. 1991.
Sweetser DA, Birkenmeier EH, Klisak IJ, Zollman S and Sparkes
RS. The human and rodent intestinal fatty acid binding protein
genes. A comparative analysis of their structure, expression,
and linkage relationships. Journal of Biological Chemistry,
262: 16060-16071. 1987.
Traber PG, Yu L, We G and Judge T. Sucraseisomaltase gene
expression along the crypt-villus axis of human small intestine
is regulated at the level of mRNA abundance. American
Journal of Physiology, Gastrointestinal and Liver Physiology,
262: G123-G130. 1992.
Tou L, Liu Q and Shivdasani RA. Regulation of mammalian epithelial differentiation and intestine development by class I
histone deacetylases. Molecular and Cellular Biology, 24:
3132-3139. 2004.
Vassileva G, Huwyler L, Poirier K, Agellon LB and Toth MJ. The
intestinal fatty acid binding protein is not essential for dietary
fat absorption in mice. FASEB Journal, 14: 2040-2046. 2000.
Veerkamp JH and Maatman R. Cytoplasmic fatty acid-binding
proteins: their structure and genes. Progress in Lipid Research,
34: 17-52. 1995.
Wang QG, Li H, Liu S, Wang GH and Wang YX. Cloning and tissue
expression of chicken heart fatty acid-binding protein and
intestine fatty acid-binding protein genes. Animal Biotechnology, 16: 191-205. 2005.
Wieser MM. Intestinal epithelial cell surface membrane glycoprotein synthesis. Journal of Biological Chemistry, 248: 25362541. 1973.
Woods VB and Fearon AM. Dietary sources of unsaturated fatty
acids for animals and their transfer into meat, milk and eggs: A
review. Livestock Science, 126: 1-20. 2009.
Zimmerman AW and Veerkamp JH. New insights into the structure
and function of fatty acid-binding proteins. Cellular and Molecular Life Sciences, 59: 1096-1116. 2002.