TruSeq DNA Methylation Kit (15066014)

Comments

Transcription

TruSeq DNA Methylation Kit (15066014)
TruSeq® DNA Methylation Kit
Reference Guide
For Research Use Only. Not for use in diagnostic procedures.
ILLUMINA PROPRIETARY
Document # 15066014 v01
August 2016
Customize a short end-to-end workflow guide with the Custom Protocol Selector
support.illumina.com/custom-protocol-selector.html
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the
contractual use of its customer in connection with the use of the product(s) described herein and for no other purpose. This
document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed,
or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does not convey any license
under its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this document.
The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order
to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read
and understood prior to using such product(s).
FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN
MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND
DAMAGE TO OTHER PROPERTY.
ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S)
DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE).
© 2016 Illumina, Inc. All rights reserved.
Illumina, TruSeq, the pumpkin orange color, and the streaming bases design are trademarks of Illumina, Inc. and/or its affiliate
(s) in the U.S. and/or other countries. All other names, logos, and other trademarks are the property of their respective owners.
AMPure®, Beckman, and Beckman Coulter are trademarks or registered trademarks of Beckman Coulter, Inc.
ii
Document # 15066014 v01
Revision History
Document
Date
Document # 15066014
v01
August
2016
Document # 15066014
Rev. A
December
2014
TruSeq DNA Methylation Kit Reference Guide
Description of Change
• Updated design of the workflow diagram.
• Renamed and combined some procedures as needed to
improve continuity.
• Revised step-by-step instructions to be more succinct.
• Simplified consumables information at the beginning of each
section.
• Added sections for additional resources, tips and techniques,
acronyms, and how the assay works.
• Added safe stopping points after the Clean Up Tagged DNA,
Amplify Library, and Clean Up Library steps.
• Updated Kit Contents section, including adding kit catalog
numbers, index kit contents, and reagent quantities.
• Specified Coriell Institute gDNA (NA12878) for use as a control.
• Specified a heated lid setting for all thermal cycler programs.
• Clarified that FailSafe PCR Enzyme Mix is a user-supplied
consumable, and specified additional catalog # FSE5101K for
FailSafe PCR Enzyme Mix, 1 KU.
• Added option for a negative control when annealing the
DNA Synthesis Primer.
• Clarified requirement for adding index adapters during library
amplification.
• Updated unit of concentration for the yield of quantified
libraries to nM.
• Corrected the volume of FailSafe PCR Enzyme Mix used during
amplification to 0.5 µl per sample.
• Corrected the volume of TruSeq DNA Synthesis PreMix used
during DNA synthesis to 4 µl per sample.
• Corrected the volume of combined DNA and synthesis primer
to 11 µl per sample.
• Corrected thermal cycler program used for amplification.
• Corrected the insert size to ~160 bp. The 260–380 bp insert size
stated in the previous version is the median library size.
• Corrected the following reagent names: TruSeq
DNA Methylation PreMix, DNA Polymerase, and TruSeq DNA
Methylation Polymerase.
• Removed recommendation to store enzyme solutions in a
benchtop cooler to avoid multiple freeze and thaw cycles. The
enzyme solutions do not freeze at -25°C to -15°C, so freeze and
thaw cycles are not a concern.
Initial release
iii
iv
Document # 15066014 v01
Table of Contents
Revision History
Table of Contents
Chapter 1 Overview
Introduction
DNA Input Recommendations
Additional Resources
Chapter 2 Protocol
Introduction
Tips and Techniques
Library Prep Workflow
Perform Bisulfite Conversion
Anneal Synthesis Primer
Synthesize DNA
Tag DNA
Clean Up Tagged DNA
Amplify Library
Clean Up Library
Check Library
Appendix A Supporting Information
Introduction
Acronyms
How the TruSeq DNA Methylation Assay Works
Kit Contents
Consumables and Equipment
Index Sequences
Sequencing TruSeq DNA Methylation Kit Libraries
Technical Assistance
TruSeq DNA Methylation Kit Reference Guide
iii
v
1
2
3
4
5
6
7
8
9
11
12
14
15
17
19
21
23
24
25
26
27
29
31
32
33
v
vi
Document # 15066014 v01
Chapter 1 Overview
Introduction
DNA Input Recommendations
Additional Resources
TruSeq DNA Methylation Kit Reference Guide
2
3
4
1
Chapter 1
Overview
Overview
Introduction
This protocol explains how to prepare up to 96 libraries using the Illumina® TruSeq®
DNA Methylation Kit. The goal of this protocol is to treat gDNA samples with sodium
bisulfite to denature gDNA into single-stranded DNA (ssDNA). After treatment, the ssDNA
is converted into libraries for subsequent cluster generation and sequencing. An optional
index kit, TruSeq DNA Methylation Index PCR Primers, provides 12 index adapter
sequences for multiplexed sequencing of single-indexed libraries.
The TruSeq DNA Methylation Kit includes the following features:
} Rapid protocol that can be completed in 5 hours.
} Requires only 50–100 ng gDNA before bisulfite conversion, enabling the study of small
samples.
} High retention of ssDNA fragments for maximum sample usage and library diversity.
} Includes CpG, CHH, and CHG regions for comprehensive, whole-genome results.
2
Document # 15066014 v01
The bisulfite conversion step is optimized for input of 50–100 ng of sample genomic DNA
(dsDNA). After conversion, 50 ng single-stranded DNA (ssDNA) is then used to create
TruSeq DNA Methylation libraries.
} The dsDNA and ssDNA must be free of guanidine salts, organics, and other inhibitors.
} The input DNA must be free of contaminating RNA. Illumina recommends RNase
digestion with DNase-free RNase and subsequent purification.
DNA Quantification
}
}
}
Quantify input dsDNA, including any controls, with a Qubit or NanoDrop method.
After bisulfite conversion, quantify ssDNA with a NanoDrop spectrophotometer using
an RNA setting.
} An RNA setting is necessary for accurate quantification. Because the ssDNA is
single-stranded and contains uracil, it resembles RNA more than DNA.
} Do not use fluorometric quantification methods such as Qubit. The RNA and
DNA standards are not compatible with ssDNA.
} Proceed from bisulfite conversion with 50 ng ssDNA only. Although 51–100 ng
ssDNA provides better depth of coverage, it is not recommended and requires
adjusting PCR (polymerase chain reaction) cycles from 10 to 8–9.
Quantify DNA libraries with qPCR or a fluorometric method such as the Qubit HighSensitivity DNA Kit or PicoGreen.
Control DNA (Optional)
}
}
}
Use 10 ng of Coriell Institute gDNA (NA12878) as a positive control for this protocol.
Alternatively, use 10 ng of gDNA from the same sample you are using for this protocol.
Do not treat any control gDNA with bisulfite.
Shearing or fragmenting the control DNA is not necessary.
TruSeq DNA Methylation Kit Reference Guide
3
DNA Input Recommendations
DNA Input Recommendations
Overview
Additional Resources
Visit the TruSeq DNA Methylation Kit support page on the Illumina website for
documentation, software downloads, training resources, and information about compatible
Illumina products.
4
Document # 15066014 v01
Chapter 2 Protocol
Introduction
Tips and Techniques
Library Prep Workflow
Perform Bisulfite Conversion
Anneal Synthesis Primer
Synthesize DNA
Tag DNA
Clean Up Tagged DNA
Amplify Library
Clean Up Library
Check Library
TruSeq DNA Methylation Kit Reference Guide
6
7
8
9
11
12
14
15
17
19
21
5
Chapter 2
Protocol
Protocol
Introduction
This chapter describes the TruSeq DNA Methylation Kit protocol.
} Before proceeding, confirm kit contents and make sure that you have the required
equipment and consumables, including FailSafe PCR Enzyme Mix. This mix is a
required consumable that is not provided in the TruSeq DNA Methylation Kit. See
Consumables and Equipment on page 29.
} Follow the protocols in the order shown, using the specified volumes and incubation
parameters.
6
Document # 15066014 v01
Unless a safe stopping point is specified in the protocol, proceed immediately to the next
step.
Avoiding Cross-Contamination
}
}
When adding or transferring samples, change tips between each sample.
When adding adapters or primers, change tips between each tube.
Capping the Tubes
}
Always cap the tubes before the following steps in the protocol:
} Shaking steps
} Vortexing steps
} Centrifuge steps
} Thermal cycling steps
Tube Transfers
}
}
When transferring volumes between tube strips, transfer the specified volume from
each tube of a strip to the corresponding tube of the other strip.
If beads are aspirated into the pipette tips, dispense back to the tube on the magnetic
stand and wait until the liquid is clear (~2 minutes).
Centrifugation
}
Centrifuge at any step in the procedure to consolidate liquid or beads in the bottom of
the tube, and to prevent sample loss.
Handling Beads
}
}
}
}
Pipette bead suspension slowly.
When mixing, mix thoroughly.
If beads are aspirated into the pipette tips, dispense back to the tube on the magnetic
stand and wait until the liquid is clear (~2 minutes).
When washing beads:
} Dispense liquid so that beads on the side of the tube are wetted.
} Keep the tubes on the magnet until the instructions specify to remove it.
} Do not agitate the tubes while on the magnetic stand. Do not disturb the bead pellet.
TruSeq DNA Methylation Kit Reference Guide
7
Tips and Techniques
Tips and Techniques
Protocol
Library Prep Workflow
The following diagram illustrates the workflow using a TruSeq DNA Methylation Kit. Safe
stopping points are marked between steps.
The duration of the workflow depends on which Zymo Research kit is used for bisulfite
conversion. After bisulfite conversion, the remaining protocol takes about 2.5 hours to
complete.
Figure 1 TruSeq DNA Methylation Workflow
8
Document # 15066014 v01
This step uses a Zymo Research EZ DNA Methylation kit to perform bisulfite conversion,
which denatures dsDNA into single-strand DNA (ssDNA). Nonmethylated cytosine
nucleotides are converted to uracil, which is read as thymine (T) when sequenced.
Methylated cytosines are protected from conversion, so they are still read as cytosine (C).
NOTE
Do not perform bisulfite conversion on control DNA.
After conversion with a Zymo Research methylation kit, libraries are prepared with the
TruSeq DNA Methylation Kit.
Consumables
}
}
One of the following Zymo Research kits:
} EZ DNA Methylation-Gold
} EZ DNA Methylation-Lightning Kit
0.5 ml or 1.5 ml microcentrifuge tubes
About Reagents
}
The EZ DNA Methylation-Gold Kit is required for plant DNA. For all other sample
types, you can use either kit.
Procedure
1
Follow the manufacturer protocol to treat 50–100 ng gDNA. Adjust the final column
purification elution volume to 9 µl.
2
Quantify the recovered ssDNA with a NanoDrop spectrophotometer using an
RNA setting.
Expect ~80% recovery.
3
Set aside 50 ng of the ssDNA for the TruSeq DNA Methylation protocol.
4
Store any extra ssDNA at -25°C to -15°C. Make aliquots of the sample to avoid repeated
freezing and thawing.
Assess Quality of Denatured DNA
1
Run 1 µl ssDNA on an Agilent 2100 Bioanalyzer using an RNA Pico Chip and the
Eukaryotic Total RNA setting.
2
Evaluate trace profiles for typical converted samples.
The following example shows a 50 ng sample of Coriell Institute gDNA (NA12878)
treated with Zymo Research methylation kits. Assessment was done with an Agilent
2100 Bioanalyzer using an RNA Pico Chip. Differences between the profiles are due to
the duration of each kit protocol. The Gold kit is more thorough, while the Lightning kit
is faster.
TruSeq DNA Methylation Kit Reference Guide
9
Perform Bisulfite Conversion
Perform Bisulfite Conversion
Protocol
Figure 2 Example 2100 Bioanalyzer Profiles of ssDNA
A
B
10
EZ DNA Methylation-Gold Kit
EZ DNA Methylation-Lightning Kit
Document # 15066014 v01
This step anneals the DNA Synthesis Primer required for DNA synthesis to the denatured
DNA (ssDNA), binding tagged random hexamers to the ssDNA.
Consumables
}
}
DNA Synthesis Primer
0.2 ml PCR tubes
Preparation
1
Prepare the following consumables.
Item
DNA Synthesis
Primer
2
Storage
-25°C to -15°C
Instructions
Thaw on ice. Invert several times to mix, and then
centrifuge briefly.
Save the following program on the thermal cycler:
} Choose the preheat lid option
} 95°C for 5 minutes.
Procedure
1
For each sample, combine the following volumes in a PCR tube. Pipette to mix.
} One of the following inputs:
} ssDNA (9 µl)
} [Positive control] Control DNA (9 µl)
} [Negative control] Nuclease-free water (9 µl)
} DNA Synthesis Primer (2 µl)
These volumes result in 11 µl per sample.
2
Place on the preprogrammed thermal cycler and run the program.
3
Remove from the thermal cycler and place in an ice water bath.
TruSeq DNA Methylation Kit Reference Guide
11
Anneal Synthesis Primer
Anneal Synthesis Primer
Protocol
Synthesize DNA
This step synthesizes DNA containing a specific sequence tag from the random hexamers.
Consumables
}
}
}
}
}
TruSeq DNA Methyl PreMix (4 µl per sample)
100 mM DTT (0.5 µl per sample)
TruSeq DNA Methyl Pol (0.5 µl per sample)
Exonuclease I (1 µl per sample)
0.2 ml PCR tubes
Preparation
1
Prepare the following consumables.
Item
TruSeq DNA Methyl
PreMix
100 mM DTT
Storage
-25°C to -15°C
TruSeq DNA Methyl Pol
-25°C to -15°C
Exonuclease I
-25°C to -15°C
-25°C to -15°C
Instructions
Thaw on ice. Invert to mix, and then centrifuge
briefly.
Thaw on ice. Invert to mix, and then centrifuge
briefly.
Thaw on ice. Invert to mix, and then centrifuge
briefly.
Thaw on ice. Invert to mix, and then centrifuge
briefly.
2
Save the following Program A on the thermal cycler:
} Choose the preheat lid option
} 25°C for 5 minutes
} 42°C for 30 minutes
} 37°C for 2 minutes
} Hold at 4°C
3
Save the following Program B on the thermal cycler:
} Choose the preheat lid option
} 37°C for 10 minutes
} 95°C for 3 minutes
} 25°C for 2 minutes and hold
4
For each sample, combine the following volumes on ice to prepare 5 µl Master Mix.
Pipette to mix.
} TruSeq DNA Methyl PreMix (4 µl)
} 100 mM DTT (0.5 µl)
} TruSeq DNA Methyl Pol (0.5 µl)
Procedure
12
1
Add 5 µl Master Mix to each sample tube on ice. Pipette to mix.
The total volume per sample is 16 µl.
2
Place on the preprogrammed thermal cycler and run Program A.
3
Add Exonuclease to each sample, 1 sample at a time, as follows.
Document # 15066014 v01
Synthesize DNA
a
b
c
Remove 1 tube from the thermal cycler.
Add 1 µl Exonuclease I. Pipette to mix.
Return the tube to the thermal cycler.
The total volume per sample is 17 µl.
4
When all tubes are returned to the thermal cycler, run Program B.
TruSeq DNA Methylation Kit Reference Guide
13
Protocol
Tag DNA
This step extends the 3′ end of the synthesized DNA and adds a complementary sequence.
The result is di-tagged DNA with known sequence tags at the 3′ and 5′ ends.
Consumables
}
}
}
TruSeq DNA Methyl Term Tag PreMix (7.5 µl per sample)
DNA Polymerase (0.5 µl per sample)
0.2 ml PCR tubes
About Reagents
}
The TruSeq DNA Methyl Term Tag PreMix is highly viscous. Before each use, mix by
pipetting using wide-bore tip or flicking the tube and then centrifuging briefly.
Preparation
1
Prepare the following consumables.
Item
TruSeq DNA Methyl Term Tag
PreMix
DNA Polymerase
Storage
-25°C to -15°C
-25°C to -15°C
Instructions
Thaw on ice. Invert to mix, and then
centrifuge briefly.
Thaw on ice. Invert to mix, and then
centrifuge briefly.
2
Save the following program on the thermal cycler.
} Choose the preheated lid option
} 25°C for 30 minutes
} 95°C for 3 minutes
} Hold at 4°C
3
For each sample, combine the following volumes on ice to prepare 8 µl TT Master Mix.
} TruSeq DNA Methyl Term Tag PreMix (7.5 µl)
} DNA Polymerase (0.5 µl)
4
Pipette using a wide-bore tip to mix, and then centrifuge briefly.
Procedure
1
Add TT Master Mix to each sample, 1 sample at a time, as follows.
a
b
c
Remove 1 tube from the thermal cycler.
Add 8 µl TT Master Mix. Pipette to mix.
Return the tube to the thermal cycler.
The total volume per sample is 25 µl.
14
Document # 15066014 v01
This step uses a 1.6x concentration of AMPure XP beads to purify the sample tagged DNA,
which prepares it for subsequent amplification.
Consumables
}
}
}
}
AMPure XP beads
Freshly prepared 80% ethanol
Nuclease-free water
1.5 ml microcentrifuge tubes
About Reagents
}
}
}
}
Vortex AMPure XP beads before each use.
Vortex AMPure XP beads frequently to make sure that beads are evenly distributed.
Avoid disturbing the beads.
Always prepare fresh 80% for wash steps. Ethanol can absorb water from the air,
impacting results.
Preparation
1
Prepare the following consumables.
Item
AMPure
XP beads
2
Storage
2°C to 8°C
Instructions
Let stand for at least 30 minutes to bring to room
temperature.
Prepare fresh 80% ethanol from absolute ethanol. Prepare 400 µl per sample.
Clean Up Tagged DNA
1
Add 40 µl AMPure XP beads to each sample tube. Pipette to mix.
2
Transfer the entire volume of each tube to a new 1.5 ml microcentrifuge tube.
3
Incubate at room temperature for 5 minutes.
4
Place on a magnetic stand and wait until the liquid is clear (~5 minutes).
5
Remove and discard supernatant from each tube.
Some liquid can remain.
6
Wash 2 times as follows.
a
b
c
Add 150–200 µl fresh 80% ethanol to each tube. Make sure that the beads are
covered.
Incubate on the magnetic stand for ≥ 30 seconds.
Remove and discard all supernatant from each tube.
7
Remove residual 80% ethanol from each tube.
8
Remove from the magnetic stand and centrifuge briefly.
9
Return the tubes to magnetic stand for 1 minute.
10 Using a P10 pipette tip, remove all residual 80% ethanol from each tube.
11 Air dry on the magnetic stand for 3 minutes.
TruSeq DNA Methylation Kit Reference Guide
15
Clean Up Tagged DNA
Clean Up Tagged DNA
Protocol
12 Add 24.5 µl nuclease-free water to each tube.
13 Remove from the magnetic stand.
14 Pipette to resuspend the beads.
15 Incubate at room temperature for 2 minutes.
16 Place on the magnetic stand and wait until the liquid is clear (~5 minutes).
17 Transfer 22.5 µl supernatant from each microcentrifuge tube to a new PCR tube.
The supernatant contains the di-tagged DNA.
18 Set aside on ice.
SAFE STOPPING POINT
If you are stopping, cap the tube and store at -25°C to -15°C for up to 7 days.
16
Document # 15066014 v01
This step uses a 10-cycle PCR program to amplify the library, generate a second strand of
DNA, add sequencing adapters to both ends of the original DNA strand, and optionally
add Index 1 (i7) adapters.
The TruSeq DNA Methyl Reverse provided in the TruSeq DNA Methylation Kit generates a
non-indexed library. To generate a single-index library, replace the TruSeq DNA Methyl
Reverse with the Index PCR Primers provided in the TruSeq DNA Methylation Index PCR
Primers kit. For information about the Index PCR Primers, including which ones to use, see
Index Sequences on page 31.
Consumables
}
}
}
}
FailSafe PCR Enzyme Mix (0.5 µl per sample)
FailSafe PCR PreMix E (25 µl per sample)
TruSeq DNA Methyl Forward (1 µl per sample)
One of the following primers:
} [Non-indexed libraries] TruSeq DNA Methyl Reverse (1 µl per sample)
} [Single-indexed libraries] Index PCR Primers (1 µl per sample)
About Reagents
}
FailSafe PCR Enzyme Mix is a user-supplied consumable.
Preparation
1
Prepare the following consumables.
Item
FailSafe PCR Enzyme Mix
Storage
-25°C to -15°C
FailSafe PCR PreMix E
-25°C to -15°C
TruSeq DNA Methyl
Forward
TruSeq DNA Methyl
Reverse*
Index PCR Primers*
-25°C to -15°C
-25°C to -15°C
-25°C to -15°C
Instructions
Thaw on ice. Invert to mix, and then centrifuge
briefly.
Thaw on ice. Invert to mix, and then centrifuge
briefly.
Thaw on ice. Invert to mix, and then centrifuge
briefly.
Thaw on ice. Invert to mix, and then centrifuge
briefly.
Thaw on ice. Invert to mix, and then centrifuge
briefly.
* Prepare TruSeq DNA Methyl Reverse or Index PCR Primers.
2
Save the following program on the thermal cycler:
} Choose the preheated lid option
} 95°C for 1 minute
} 10 cycles of:
} 95°C for 30 seconds
} 55°C for 30 seconds
} 68°C for 3 minutes
} 68°C for 7 minutes
} Hold at 4°C
TruSeq DNA Methylation Kit Reference Guide
17
Amplify Library
Amplify Library
Protocol
NOTE
The TruSeq DNA Methylation protocol is optimized for 10 PCR cycles. If the protocol
started with more than the recommended input of 50 ng DNA or 10 ng control DNA,
reduce PCR cycles to 8 or 9.
Procedure
1
Add the following volumes to each PCR tube containing 22.5 µl di-tagged DNA:
} FailSafe PCR PreMix E (25 µl)
} TruSeq DNA Methyl Forward (1 µl)
} One of the following primers:
} [Non-indexed libraries] TruSeq DNA Methyl Reverse (1 µl)
} [Single-indexed libraries] Index PCR Primer (1 µl)
} FailSafe PCR Enzyme Mix, 1.25 U (0.5 µl)
The total volume per sample is 50 µl.
2
Place on the preprogrammed thermal cycler and run the program.
SAFE STOPPING POINT
If you are stopping, leave the tubes on the thermal cycler overnight.
18
Document # 15066014 v01
This step uses a 1.0x concentration of AMPure XP beads to purify the library DNA and
remove primer dimer that PCR amplification can cause.
Consumables
}
}
}
}
AMPure XP beads
Freshly prepared 80% ethanol
Nuclease-free water
1.5 ml microcentrifuge tubes
About Reagents
}
}
}
}
Vortex AMPure XP beads before each use.
Vortex AMPure XP beads frequently to make sure that beads are evenly distributed.
Avoid disturbing the beads.
Always prepare fresh 80% for wash steps. Ethanol can absorb water from the air,
impacting results.
Preparation
1
Prepare the following consumables.
Item
AMPure
XP beads
2
Storage
2°C to
8°C
Instructions
Let stand for at least 30 minutes to bring to room temperature.
Prepare fresh 80% ethanol from absolute ethanol. Prepare 400 µl per sample.
Procedure
1
Add 50 µl AMPure XP beads to each PCR tube. Pipette to mix.
2
Transfer the entire volume of each tube to a new 1.5 ml microcentrifuge tube.
3
Incubate at room temperature for 5 minutes.
4
Place on a magnetic stand and wait until the liquid is clear (~5 minutes).
5
Remove and discard supernatant from each tube.
Some liquid can remain.
6
Wash 2 times as follows.
a
b
c
Add 150–200 µl fresh 80% ethanol to each tube. Make sure that the beads are
covered.
Incubate on the magnetic stand for ≥ 30 seconds.
Remove and discard all supernatant from each tube.
7
Remove residual 80% ethanol from each tube.
8
Remove from the magnetic stand and centrifuge briefly.
9
Return the tubes to magnetic stand for 1 minute.
10 Using a P10 pipette tip, remove all residual 80% ethanol from each tube.
11 Air dry on the magnetic stand for 3 minutes.
TruSeq DNA Methylation Kit Reference Guide
19
Clean Up Library
Clean Up Library
Protocol
12 Add 20 µl nuclease-free water to each tube.
13 Remove from the magnetic stand.
14 Pipette to resuspend the beads.
15 Incubate at room temperature for 2 minutes.
16 Place on a magnetic stand and wait until the liquid is clear (~5 minutes).
17 Transfer the supernatant from each microcentrifuge tube to any fresh tube that can hold
20 µl.
The supernatant contains the TruSeq DNA Methylation library.
SAFE STOPPING POINT
If you are stopping, cap the tube and store at -25°C to -15°C for up to 1 year. Avoid freezing
and thawing more than 1 time during this period. Make sure that each tube contains ≤ 2
libraries.
20
Document # 15066014 v01
Quantify Library
1
Quantify the converted and unconverted dsDNA libraries with qPCR or a fluorometric
method such as the Qubit High-Sensitivity DNA Kit or PicoGreen.
Typical yield is 10–15 nM.
Assess Quality
1
Run 1 µl undiluted library on an Agilent 2100 Bioanalyzer using a High Sensitivity
DNA Chip.
Libraries typically show a broad size distribution from ~150–1000 bp, with median
library sizes of 260–380 bp. After subtracting adapter sequences, the insert DNA is ~160
bp. The recommended run is paired-end with a read length of 75 bp per read.
In the following example, bisulfite conversion of the DNA was performed with the EZ
DNA Methylation-Lightning Kit. TruSeq DNA Methylation libraries were prepared
from bisulfite-treated and control DNA using 10 PCR cycles, and assessed with an
Agilent 2100 Bioanalyzer using a High Sensitivity DNA Chip. TruSeq DNA
Methylation libraries prepared using the EZ DNA Methylation-Gold Kit for bisulfite
treatment produced identical results.
Figure 3 Example 2100 Bioanalyzer Profiles of TruSeq DNA Methylation Libraries
A
B
TruSeq DNA Methylation library from 50 ng of Coriell DNA treated with bisulfite.
TruSeq DNA Methylation library from 10 ng of untreated control Coriell DNA.
TruSeq DNA Methylation Kit Reference Guide
21
Check Library
Check Library
22
Document # 15066014 v01
Appendix A Supporting Information
Introduction
Acronyms
How the TruSeq DNA Methylation Assay Works
Kit Contents
Consumables and Equipment
Index Sequences
Sequencing TruSeq DNA Methylation Kit Libraries
TruSeq DNA Methylation Kit Reference Guide
24
25
26
27
29
31
32
23
Appendix A
Supporting Information
Supporting Information
Introduction
The protocols described in this guide assume that you have reviewed the contents of this
appendix, confirmed your kit contents, and obtained all the required consumables and
equipment.
24
Document # 15066014 v01
Acronyms
Acronyms
Acronym
C
dsDNA
Definition
Cytosine
Sample Genomic DNA
DTT
Dithiothreitol
gDNA
Genomic DNA
HPLC
High Performance Liquid Chromatography
PCR
ssDNA
Polymerase Chain Reaction
Single-Strand DNA
T
Thymine
TT
Terminal Tagging
TruSeq DNA Methylation Kit Reference Guide
25
Supporting Information
How the TruSeq DNA Methylation Assay Works
A bisulfite treatment denatures gDNA into ssDNA. The TruSeq DNA Methylation Kit uses
a polymerase that can read uracil nucleotides to synthesize DNA strands that contain a
specific sequence tag. The 3′ ends of the strands are then selectively tagged with a second
specific sequence tag to generate di-tagged DNA with known sequence tags at both ends.
PCR enriches the di-tagged DNA, adding primers and optional indexes. The
dsDNA generated by the PCR step contains the necessary sequences for Illumina
sequencing systems.
A
B
C
26
Bisulfite conversion with a Zymo Research methylation kit
Synthesis and tagging to generate di-tagged DNA
PCR enrichment to add primers and indexes
Document # 15066014 v01
Make sure that you have all reagents identified in this section before starting the protocol.
The TruSeq DNA Methylation Kit is available in 3 configurations, as shown in the
following table. An optional index kit pairs with any of the configurations.
Table 1 TruSeq DNA Methylation Kits
TruSeq DNA Methylation Kit 12 reactions
TruSeq DNA Methylation Kit 24 reactions
TruSeq DNA Methylation Kit 96 reactions
TruSeq DNA Methylation Index PCR Primers 10 reactions, 12 indexes
Catalog #
EGMK81312
EGMK91324
EGMK91396
EGIDX81312
TruSeq DNA Methylation Kit (12 Reactions) (EGMK81312)
Store at -25°C to -15°C
Quantity
1
1
1
1
1
1
1
1
1
1
1
Description
DNA Synthesis Primer
TruSeq DNA Methyl PreMix
100 mM DTT
TruSeq DNA Methyl Pol
Exonuclease I
TruSeq DNA Methyl Term Tag PreMix
DNA Polymerase
FailSafe PCR PreMix E
TruSeq DNA Methyl Forward
TruSeq DNA Methyl Reverse
Nuclease-Free Water
TruSeq DNA Methylation Kit (24 Reactions) (EGMK91324)
Store at -25°C to -15°C
Quantity
1
1
1
1
1
1
1
1
1
1
1
Description
DNA Synthesis Primer
TruSeq DNA Methyl PreMix
100 mM DTT
TruSeq DNA Methyl Pol
Exonuclease I
TruSeq DNA Methyl Term Tag PreMix
DNA Polymerase
FailSafe PCR PreMix E
TruSeq DNA Methyl Forward PCR Primer
TruSeq DNA Methyl Reverse PCR Primer
Nuclease-Free Water
TruSeq DNA Methylation Kit Reference Guide
27
Kit Contents
Kit Contents
Supporting Information
TruSeq DNA Methylation Kit (96 Reactions) (EGMK91396)
Store at -25°C to -15°C
Quantity
1
1
1
1
1
1
1
3
1
1
3
Description
DNA Synthesis Primer
TruSeq DNA Methyl PreMix
100 mM DTT
TruSeq DNA Methyl Pol
Exonuclease I
TruSeq DNA Methyl Term Tag PreMix
DNA Polymerase
FailSafe PCR PreMix E
TruSeq DNA Methyl Forward PCR Primer
TruSeq DNA Methyl Reverse PCR Primer
RNase-Free Water (Nuclease-Free Water)
TruSeq DNA Methylation Index PCR Primers (EGIDX81312)
Store at -25°C to -15°C
Quantity
12
28
Description
Index PCR Primers, 1 to 12
Document # 15066014 v01
Make sure that you have the required user-supplied consumables and equipment before
starting the protocol.
The protocol has been optimized and validated using the items listed. Comparable
performance is not guaranteed when using alternate consumables and equipment.
Consumables
Consumable
Supplier
0.2 ml PCR tubes
General lab supplier
0.2 ml or 0.5 ml microcentrifuge tubes
General lab supplier
1.5 ml microcentrifuge tubes
General lab supplier
Absolute (100%) ethanol
General lab supplier
Agencourt AMPure XP system
Beckman-Coulter Genomics, catalog # A63880
An EZ DNA methylation kit:
• EZ DNA Methylation-Gold Kit
• EZ DNA Methylation-Lightning Kit
Zymo Research:
• Gold Kit—catalog # D5005 or D5006
• Lightning Kit—catalog # D5030 or D5031
FailSafe PCR Enzyme Mix, 100 U or 1 KU
Illumina, catalog # FSE51100 or FSE5101K
P10 pipette tips
General lab supplier
Pure 200G pipette tips*
Molecular BioProducts, catalog # 3531
* Or equivalent wide-bore pipette tip. Alternatively, trim the end of a 1 ml pipette tip.
Equipment
Equipment
Supplier
1.5 ml microcentrifuge
General lab supplier
Magnetic rack or stand for 1.5 ml
tubes
Bangs Laboratories, Inc., catalog # LS001, MS002, or
MS003
Life Technologies, catalog # 12321D
NanoDrop UV-Vis
Spectrophotometer
Thermo Fisher Scientific
Qubit Fluorometer
Thermo Fisher Scientific
Thermal cycler or heat block*
General lab supplier
Vortexer
General lab supplier
* Or other temperature-controlled device.
TruSeq DNA Methylation Kit Reference Guide
29
Consumables and Equipment
Consumables and Equipment
Supporting Information
Thermal Cyclers
Use the following recommended settings for selected thermal cycler models. Before
performing library prep, validate any thermal cyclers not listed.
30
Thermal Cycler
Temp Mode
Lid Temp
Vessel Type
Bio-Rad DNA Engine
Tetrad 2
Calculated
Heated, Constant
at 100°C
Polypropylene plates
and tubes
MJ Research DNA
Engine Tetrad
Calculated
Heated
Plate
Eppendorf
Mastercycler Pro S
Gradient S,
Simulated Tube
Heated
Plate
Document # 15066014 v01
The sequence of each Index PCR Primer provided in the TruSeq DNA Methylation Index
PCR Primers is as follows, where NNNNNN is the reverse complement of the index sequence
generated during sequencing.
5′ CAAGCAGAAGACGGCATACGAGAT[NNNNNN]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3’
The following table provides the bases for TruSeq DNA Methylation libraries.
Table 2 Index Adapter Sequences
Index 1 (i7) Adapters
Index 1 PCR Primer
Index 2 PCR Primer
Index 3 PCR Primer
Index 4 PCR Primer
Index 5 PCR Primer
Index 6 PCR Primer
Index 7 PCR Primer
Index 8 PCR Primer
Index 9 PCR Primer
Index 10 PCR Primer
Index 11 PCR Primer
Index 12 PCR Primer
Sequence
ATCACG
CGATGT
TTAGGC
TGACCA
ACAGTG
GCCAAT
CAGATC
ACTTGA
GATCAG
TAGCTT
GGCTAC
CTTGTA
Pooling Guidelines
Balance the representation of A/C and G/T nucleotides in pooled libraries to ensure proper
registration when sequencing. The following example primer combinations provide the
balanced representation necessary for multiplexed sequencing:
} Index PCR Primers 6 and 12
} Index PCR Primers 1, 4, and 8
} Index PCR Primers 5, 10, and 11
Custom Index Adapters
Illumina does not support custom primer and index adapters. Adding untested sequences
to adapters can cause unexpected consequences during library preparation, clustering, and
sequencing. The following information is intended as general guidance only and success is
not guaranteed. Use the index adapters provided in the TruSeq DNA Methylation Index
PCR Primers whenever possible, and perform pilot experiments with all new designs.
} The Reverse PCR Primer adds indexes during library amplification. Before using a
custom Reverse PCR Primer, the oligonucleotide must be synthesized, purified with a
high performance liquid chromatography (HPLC), and desalted.
} Dissolve primers to a final concentration of 10 µM in nuclease-free water.
} Custom Reverse PCR Primers must have the following sequence, where X is the reverse
complement of the intended index:
5’-CAAGCAGAAGACGGCATACGAGAT[X]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3’
} The sequence of the custom Reverse PCR Primer after synthesis must be a reverse
complement sequence.
For example, the custom index adapter sequence when using the Illumina Multiplexing
Index Read Sequencing Primer is 5’ …ACGTAC…, which is read as …GTACGT… 3’.
TruSeq DNA Methylation Kit Reference Guide
31
Index Sequences
Index Sequences
Supporting Information
Sequencing TruSeq DNA Methylation Kit Libraries
TruSeq DNA Methylation Kit libraries are compatible with Illumina cluster and SBS kits
and can be sequenced on any Illumina system. However, the coverage recommendation of
30x is high. If you are sequencing a large genome, a run on the MiSeq or MiniSeq does not
provide sufficient data.
32
Document # 15066014 v01
For technical assistance, contact Illumina Technical Support.
Table 3 Illumina General Contact Information
Website
Email
www.illumina.com
[email protected]
Table 4 Illumina Customer Support Telephone Numbers
Region
Contact Number
Region
North America
1.800.809.4566
Japan
Australia
1.800.775.688
Netherlands
Austria
0800.296575
New Zealand
Belgium
0800.81102
Norway
China
400.635.9898
Singapore
Denmark
80882346
Spain
Finland
0800.918363
Sweden
France
0800.911850
Switzerland
Germany
0800.180.8994
Taiwan
Hong Kong
800960230
United Kingdom
Ireland
1.800.812949
Other countries
Italy
800.874909
Contact Number
0800.111.5011
0800.0223859
0800.451.650
800.16836
1.800.579.2745
900.812168
020790181
0800.563118
00806651752
0800.917.0041
+44.1799.534000
Safety data sheets (SDSs)—Available on the Illumina website at
support.illumina.com/sds.html.
Product documentation—Available for download in PDF from the Illumina website. Go
to support.illumina.com, select a product, then select Documentation & Literature.
TruSeq DNA Methylation Kit Reference Guide
33
Technical Assistance
Technical Assistance
Illumina
5200 Illumina Way
San Diego, California 92122 U.S.A.
+1.800.809.ILMN (4566)
+1.858.202.4566 (outside North America)
[email protected]
www.illumina.com

Similar documents