UNIVERSIT`A DEGLI STUDI DI TRIESTE Role of

Transcription

UNIVERSITÀ DEGLI STUDI DI TRIESTE
DIPARTIMENTO DI BIOCHIMICA, BIOFISICA e CHIMICA DELLE
MACROMOLECOLE
DOTTORATO DI RICERCA IN MEDICINA MOLECOLARE
XX CICLO
Settore Scientifico-disciplinare: Biologia Molecolare (Bio/11)
Role of Unconjugated Bilirubin
in the Endothelial Dysfunction
Dottoranda:
Graciela Luján Mazzone
Coordinatore del Collegio Docenti:
Prof. Giannino Del Sal
Università degli Studi di Trieste
Relatore:
Prof. Claudio Tiribelli
Correlatore:
Dott. Igino Rigato
Supervisor:
Prof. Claudio Tiribelli
Tutor:
Dr. Igino Rigato
External Supervisor:
Dr. Helena Schteingart
Centro de Investigaciones Endocrinológicas - CONICET - Argentina
Thesis Committee:
Prof. Francesco Tedesco
Prof. Stefano Gustincich
Scuola Internazionale Superiore di Studi Avanzati di Trieste
Prof. Massimo Levrero
Università degli Studi di Roma - La Sapienza
Prof. Franco Vittur
Prof. Silvia Giordano
Università degli Studi di Torino
Dr. Claudio Brocolini
Università degli Studi di Udine
Prof. Giannino Del Sal
Prof. Renato Gennaro
palabra
This study was supported by a fellowship from the Italian Ministry of Foreign
Affairs (MAE) in Rome, Italy. In particular, I wish to thank Dr. Paola Ranocchia.
Contents
Abstract
xiii
Publications
xvii
Abbreviations
xix
1
Introduction
1
1.1
Bilirubin metabolism . . . . . . . . . . . . . . . . . . . . . . . .
1
1.2
Bilirubin and pathophysiology . . . . . . . . . . . . . . . . . . .
3
1.3
Vascular atherosclerosis . . . . . . . . . . . . . . . . . . . . . . .
7
1.3.1
Morphology of atherosclerotic lesions . . . . . . . . . . .
7
1.3.2
Atherogenesis - Response to the injury theory . . . . . . .
10
1.3.3
Endothelium . . . . . . . . . . . . . . . . . . . . . . . .
11
1.4
Pro-inflammatory cytokines . . . . . . . . . . . . . . . . . . . . .
14
1.5
Nitric oxide . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
16
1.5.1
Biosynthesis of nitric oxide . . . . . . . . . . . . . . . .
17
1.5.2
Endothelial Nitric Oxide Synthase (eNOS) . . . . . . . .
20
1.5.3
Inducible Nitric Oxide Synthase (iNOS) . . . . . . . . . .
22
1.5.4
Nitric oxide and pathophysiology . . . . . . . . . . . . .
24
Adhesion molecules . . . . . . . . . . . . . . . . . . . . . . . . .
27
1.6.1
The Selectins . . . . . . . . . . . . . . . . . . . . . . . .
29
1.6.2
Immunoglobulin superfamily adhesion molecules . . . . .
33
Signal transduction pathways . . . . . . . . . . . . . . . . . . . .
39
1.7.1
cAMP-response element(CRE)-binding protein (CREB) .
40
1.7.2
NF-κB . . . . . . . . . . . . . . . . . . . . . . . . . . .
41
1.6
1.7
v
CONTENTS
2
Aim of the Study
51
3
Materials and Methods
53
3.1
Endothelial Cells . . . . . . . . . . . . . . . . . . . . . . . . . .
53
3.2
Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
54
3.3
UCB solutions . . . . . . . . . . . . . . . . . . . . . . . . . . . .
55
3.4
Culture conditions . . . . . . . . . . . . . . . . . . . . . . . . . .
57
3.4.1
Cytokines treatment . . . . . . . . . . . . . . . . . . . .
58
Endothelial cell susceptibility . . . . . . . . . . . . . . . . . . . .
58
3.5.1
LDH release test . . . . . . . . . . . . . . . . . . . . . .
58
3.5.2
Mitochondrial toxicity by MTT test . . . . . . . . . . . .
59
Endothelial dysfunction analysis . . . . . . . . . . . . . . . . . .
60
3.6.1
Nitric oxide . . . . . . . . . . . . . . . . . . . . . . . . .
60
3.6.2
Gene expression analysis . . . . . . . . . . . . . . . . . .
62
3.6.3
Western blot . . . . . . . . . . . . . . . . . . . . . . . .
63
Signal transduction pathways . . . . . . . . . . . . . . . . . . . .
66
3.7.1
cAMP-response element(CRE)-binding protein (CREB) .
66
3.7.2
Preparation of total nuclear extracts . . . . . . . . . . . .
67
Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . .
68
3.5
3.6
3.7
3.8
4
Results
69
4.1
Effects of UCB on cell viability . . . . . . . . . . . . . . . . . .
69
4.1.1
UCB did not affect the LDH release induced by TNF-α
.
69
4.1.2
UCB reduced endothelial cell viability
. . . . . . . . . .
69
Nitric oxide analysis . . . . . . . . . . . . . . . . . . . . . . . .
71
4.2.1
Effect of UCB on NO levels in H5 V cells . . . . . . . . .
73
4.2.2
Effect of UCB on NOS mRNA expression . . . . . . . . .
73
4.2.3
NO levels in HUVEC cells . . . . . . . . . . . . . . . . .
75
4.2.4
UCB, the redox status and NO levels . . . . . . . . . . .
75
UCB reduced AM expression induced by TNF-α . . . . . . . . .
80
4.3.1
H5 V cells - mRNA relative expression . . . . . . . . . . .
80
4.3.2
HUVEC cells - mRNA relative expression . . . . . . . . .
84
AM protein expression . . . . . . . . . . . . . . . . . . . . . . .
88
4.2
4.3
4.4
vi
CONTENTS
4.5
UCB effects via NF-κB pathway . . . . . . . . . . . . . . . . . .
4.5.1
5
6
96
UCB and PDTC inhibit gene over-expression in an addictive pattern . . . . . . . . . . . . . . . . . . . . . . . . .
96
4.5.2
CREB phosphorylation is not influenced by UCB . . . . .
96
4.5.3
NF-κB nuclear translocation is inhibited by UCB . . . . .
99
Discussion
103
5.1
Viability and UCB . . . . . . . . . . . . . . . . . . . . . . . . . 104
5.2
Nitric oxide and UCB . . . . . . . . . . . . . . . . . . . . . . . . 108
5.3
Adhesion molecules and UCB . . . . . . . . . . . . . . . . . . . 113
5.4
Signalling pathways and UCB . . . . . . . . . . . . . . . . . . . 114
Conclusions
119
Acknowledgements
121
References
122
Reprints
161
vii
List of Figures
1.1
Bilirubin metabolism . . . . . . . . . . . . . . . . . . . . . . . .
2
1.2
Hepatic heme metabolism of bilirubin . . . . . . . . . . . . . . .
4
1.3
Stages of atherosclerotic lesions . . . . . . . . . . . . . . . . . .
9
1.4
Leucocytes attachment, rolling and migration through endothelial
cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
12
1.5
Stepwise NO synthesis by NOS . . . . . . . . . . . . . . . . . .
17
1.6
Schematic Presentation of Nitric Oxide isoforms structure . . . .
19
1.7
Steps in the inflammatory process . . . . . . . . . . . . . . . . .
29
1.8
Structure of the Selectin domains . . . . . . . . . . . . . . . . . .
31
1.9
Structure of ICAM-1 domains . . . . . . . . . . . . . . . . . . .
35
1.10 Structure of VCAM-1 different isoforms domanins . . . . . . . .
38
1.11 Activation of the cAMP-CREB signalling pathway . . . . . . . .
42
1.12 Schematic Presentation of NF-κB and IκB Structure . . . . . . . .
44
3.1
Morphology of H5 V cells in vitro . . . . . . . . . . . . . . . . . .
54
3.2
Morphology of HUVEC cells in vitro . . . . . . . . . . . . . . .
55
3.3
Relationship of Bf-UCB with different albumin preparations . . .
56
3.4
Chemistry of the Griess Reagent . . . . . . . . . . . . . . . . . .
61
4.1
Effect of UCB on cell viability - MTT assay . . . . . . . . . . . .
72
4.2
Effect of different doses UCB on NO production . . . . . . . . .
74
4.3
TNF-α induces iNOS gene expression in H5 V cells . . . . . . . .
76
4.4
Effect of UBC on TNF-α-induced iNOS gene - H5 V cells . . . . .
77
4.5
NAC reverted TNF-α effects iNOS gene . . . . . . . . . . . . . .
79
4.6
Effect of NAC on NO production
. . . . . . . . . . . . . . . . .
81
4.7
UBC and NAC reverted TNF-α induction of iNOS gene . . . . . .
82
ix
LIST OF FIGURES
4.8
TNF-α induces AM gene expression in H5 V cells . . . . . . . . .
83
4.9
Effect of UBC on TNF-α-induced E-selectin gene - H5 V cells . .
85
4.10 Effect of UBC on TNF-α-induced Vcam-1 gene - H5 V cells . . .
86
4.11 Effect of UBC on TNF-α-induced Icam-1 gene - H5 V cells . . . .
87
4.12 Effect of UBC on TNF-α-induced E-selectin gene - HUVEC cells
89
4.13 Effect of UBC on TNF-α-induced VCAM-1 gene - HUVEC cells
90
4.14 Effect of UBC on TNF-α-induced ICAM-1 gene - HUVEC cells .
91
4.15 TNF-α induces E-selectin protein expression in H5 V cells . . . .
92
4.16 TNF-α induces Vcam-1 protein expression in H5 V cells . . . . . .
93
4.17 TNF-α induces Icam-1 protein expression in H5 V cells . . . . . .
94
4.18 Effect of UBC on TNF-α-induced AM protein expression - H5 V
cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
95
4.19 PDTC inhibits AM and iNOS mRNA over-expression by TNF-α .
97
4.20 UCB and PDTC inhibit additively the gene over-expression . . . .
98
4.21 Induction of CREB phosphorylation by TNF-α in H5 V cells . . .
99
4.22 UBC does not affect CREB phosphorylation in H5 V cells . . . . . 100
4.23 UCB inhibits TNF-α-induced nuclear translocation of NF-κB . . . 101
x
List of Tables
1.1
NF-κB inhibitors that demonstrate anti inflammatory activity in
experimental models . . . . . . . . . . . . . . . . . . . . . . . .
48
3.1
H5 V - Primer sequence designed for the mRNA quantification . .
63
3.2
HUVEC - Primer sequence designed for the mRNA quantification
64
3.3
Primary antibodies tested . . . . . . . . . . . . . . . . . . . . . .
65
4.1
Effect of UCB on cell viability - LDH release . . . . . . . . . . .
70
4.2
Effect of different doses of TNF-α on NO production . . . . . . .
71
4.3
Time dependent effect of TNF-α on NO production . . . . . . . .
73
4.4
Threshold cycle values of eNOS in HUVEC cells . . . . . . . . .
78
4.5
Threshold cycle values of genes studied in H5 V control cells . . .
80
xi
ABSTRACT
Atherosclerosis, a progressive cardiovascular disease, is characterized by the accumulation of cholesterol in macrophage deposits (foam cells) and the formation
of atherosclerotic plaques in the walls large- and medium- sized arteries. The
earliest events in the development of atherosclerosis involve progressive modifications in the endothelial micro-environment. This endothelial dysfunction is
a complex of multi-step mechanisms, for which reduced NO levels have been
reported as a marker, is characterized by increasing expression of adhesion molecules (AMs), which mediate the diapedesis (migration) of inflammatory and immunocompetent cells through the endothelial layer into the arterial wall.
NO is synthesized intracellularly by nitric oxide enzymes (eNOS and iNOS)
and is regulated by a variety of stimuli. NO acts as an autocrine or paracrine
hormone, as well as intracellular messenger, with a critical role in vascular endothelial growth factor-induced angiogenesis and vascular hyper-permeability in
vitro.
The over-expression of AMs is orchestrated by pro-inflammatory cytokines,
particularly TNF-α. The two major subsets of AMs participating in these processes are the selectins, in particular E-selectin, and the immunoglobulin gene
superfamily, in particular vascular cell adhesion molecule 1 (VCAM-1) and intercellular adhesion molecule 1 (ICAM-1).
Transcriptional regulation of these inflammatory genes requires the participation of several proteins, inducible activators, as: NF-κB and (CRE)-binding
protein (CREB). The most abundant form of NF-κB is an heterodimer of p50 and
xiii
Abstract
p65; which is sequestered in the cytoplasm in an inactive form through interaction with the IκB inhibitor proteins. Signals that induce NF-κB release dimers
to enter to the nucleus and induce gene expression. Pyrridoline dithiocarbamate
(PDTC) a metal-chelating compound inhibits NF-κB by blocking ubiquitine ligase activity towards phosphorylated IκB, in turn downregulating the expression
of E-selectin, VCAM-1 and ICAM-1. CREB is a widely expressed DNA-binding
protein, downstream target of cAMP, activated by phosphorylation on serine 133.
A regulatory site, on the gene promoters of both E-selectin and VCAM-1, binds
both NF-κB and CREB transcription factors.
Unconjugated bilirubin (UCB), long considered to be simply a waste end product of heme metabolism and a marker for hepatobiliary disorders, is now thought
to function as an endogenous tissue protector by attenuating free radical-mediated
damage to both lipids and proteins. There is increasing epidemiological evidence
supporting an inverse association between cardiovascular disease and plasma levels of bilirubin. Recent studies indicated that bilirubin may be protective in the
development of atherosclerotic diseases by inhibiting the proliferation of vascular
smooth muscle cells by mechanisms yet to be established. It has been proposed
that UCB can interfere with the atherosclerotic disease development by inhibiting
the trans-endothelial vascular cell adhesion molecule (VCAM-1)-dependent migration of monocytes into the intima. The aim of this study is to investigate the
effect of the UCB in the endothelial dysfunction. Specifically UCB effects on NO
production, AMs expression and the regulatory transcription factors involve in the
inflammatory response.
Variable doses of free bilirubin (Bf) (the active form of UCB in plasma), simulating upper normal (15 nM) and modestly elevated levels (30 nM) for plasma,
were evaluated in two models of endothelial cells. A) H5 V, murine microvascular
endothelial cell line, and B) HUVEC (Human Umbilical Vein Endothelial Cells),
isolated from the vein of human umbilical cord. TNF-α (20 ng/mL) was added in
order to reproduce, in vitro, the endothelial dysfunction and describe UCB contribution on its effects.
xiv
UCB alone reduced the viability in H5 V cells by MTT assay in a dose dependent manner after 24 hours while no effect was observed in the LDH released.
In the first set of experiments NO production in H5 V cells was evaluated, a
time-depended increase on NO basal and a dose-dependent decrease on NO concentration after TNF-α (20 ng/mL) were observed. NO reduction related TNF-α
was seen at all times studied. The effect of UCB was studied in co-treatments
with TNF-α for 24 and 48 hours. UCB (Bf 15 and 30 nM) significantly reversed
the reduction of nitrite content induced by TNF-α at 48 hours.
The gene expression analysis was performed by Real Time PCR technology
with specific primers for eNOS, iNOS, E-selectin, VCAM-1 and ICAM-1. In H5 V
cells, TNF-α increased the expression of all the genes studied (except eNOS) at
2, 6 and 24 hours. The co-treatment with UCB , at a Bf that did not themselves
affect the expression of the three adhesion molecules, blunts the over-expression
of E-selectin, Vcam-1 and iNOS induced by a pro-inflammatory cytokine such as
TNF-α. The inhibitory effect of UCB was usually modest (20-30%) and detected
at 2 and/or 6 hours, but had disappeared 24 hours. Furthermore, a synergistic effect between TNF-α and UCB was seen on the expression of iNOS at 24 hours,
indicating a biphasic regulation. Moreover, no effects were seen on eNOS. Similar results were observed in the regulation of the gene expression of the AMs and
viability in HUVEC cells, indicating the lack of species specific effect. However,
no effect of TNF-α or UCB was seen in the expression of iNOS, eNOS or NO
content.
Western blot analysis in H5 V cells confirmed that TNF-α induced the expression of E-selectin, VCAM-1 and ICAM-1 in a time-dependent manner. This effect
was blunted after 24 hours by the presence of UCB (Bf 15 and 30 nM).
The contribution of NF-κB pathway in UCB effects was investigated by addition of a specific inhibitor, PDTC. The co-treatment with PDTC and UCB for
2 hours produced an additive reduction of TNF-α effect on E-selectin, VCAM-1,
and iNOS in H5 V cells. In addition, UCB prevented the nuclear translocation of
xv
Abstract
NF-κB induced by TNF-α. Failure of UCB to alter TNF-α-induced phosphorylation of CREB (at Ser 133) suggested that the CREB pathway was not involved in
the UCB inhibition.
The results obtained in the present study shows that unconjugated bilirubin,
even at upper-normal physiological (15 nM) and mildly elevated (30 nM) Bf can
modulate gene expression and endothelial cell function. Furthermore, UCB may
regulate NO levels by a bi-phasic regulation of iNOS, and in addition influences
the expression of the endothelial adhesion molecules. In summary, these data indicates that bilirubin limits the over-expression of the adhesion molecules and regulates the NO metabolism in the pro-inflammatory state induced by the cytokine
TNF-α. Even though UCB alone does not alter these markers. UCB effects are
mediated in part by a modulation of the NF-κB transcription factor. These results
support the concept that modestly elevated concentrations of bilirubin may help
prevent atherosclerotic disease as suggested by epidemiological studies.
xvi
PUBLICATIONS
List of Publications relevant to the Thesis
• Multidrug resistance associated protein 1 protects against
bilirubin-induced cytotoxicity. Calligaris S, Cekic D, Roca-Burgos L,
Gerin F, Mazzone G, Ostrow JD, Tiribelli C.FEBS Lett. 2006 Feb 20;
580(5): 1355-9. Epub 2006 Jan 26.
• Unconjugated bilirubin prevents the TNF-α related induction of three
endothelial adhesion molecules via the NF-κB pathway. Mazzone G,
Rigato I, Ostrow DJ, Bortoluzzi A and Tiribelli C. Submitted.
List of other Publications
• FSH and bFGF stimulate the production of glutathione in cultured rat
Sertoli cells. Gualtieri AF, Mazzone GL, Rey RA, Schteingart HF.Int J
Androl. 2007 Nov 26; [Epub ahead of print.]
xvii
ABBREVIATIONS
List of abbreviations
AM
Adhesion Molecules
VCAM-1
Human Vascular Cell Adhesion Molecule-1
Vcam-1
Mouse Vascular Cell Adhesion Molecule-1
ICAM-1
Human Intercellular Adhesion Molecule-1
Icam-1
Mouse Intercellular Adhesion Molecule-1
E-selectin
Human or Mouse Endothelial Selectin
TNF-α
Tumor Necrosis Factor alpha
IL
Interleukin
IFN
Interferons
TNF-R55/RI
TNF-α Receptor I
TNF-R75/RII
TNF-α Receptor II
UCB
Unconjugated Bilirubin
Bf
Free Unbound Plasma Bilirubin
HO1
Heme Oxygenase-1
HO2
Heme Oxygenase-2
HO3
Heme Oxygenase-3
UGT/UGT1A1
Diphosphoglucuronate Glucoronosyltransferase
UDPGA
UDP-glucuronic Acid
BVR
Biliverdin Reductase
cMOATP
Canalicular Multispecific Anion Transporter
xix
Abbreviations
ATP
Adenosine Triphosphate
NO
Nitric Oxide
NOS
Nitric Oxide Synthase
eNOS
Endothelial Nitric Oxide Synthase
iNOS
Inducible Nitric Oxide Synthase
CREB
cAMP-response Element(CRE)-binding Protein
NF-κB
Nuclear Factor κB
STAT
Signal Transducers and Activators of Transcription
CBP
cAMP-responsive Element(CREB)-binding Protein
IκB
Inhibitory Protein of NF-κB
ATF
Activating Transcription Factor (ATF)-binding Element
AP-1
Activator Protein-1
C/EBP
CCAAT/enhancer Binding Protein
MAPK
Mitogen-activated Protein Kinase
GATA
Globin Transcription Factor
NF-1
Nuclear Factor I/C (CCAAT-binding transcription factor)
GAS
IFN-gamma-activating sites
ISRE
Interferon-stimulated Response Element
IRF-E
Interferon Regulatory Factor Binding site
NAC
N-acetylcysteine
PDTC
Pyrrolidine Dithiocarbamate
ROS
Reactive Oxygen Species
LPS
Lipopolysaccharide
GSH
Glutathione
ECM
Extracellular Matrix
HUVEC
Human Umbilical Vein Endothelial Cells
H5 V
Murine Microvascular Endothelial Cells
LDH
Lactate Dehydrogenase
NO2–
NO3–
Nitrite
Nitrate
xx
Chapter 1
INTRODUCTION
1.1
Bilirubin metabolism
Bilirubin is produced as the end product of the degradation of hemoglobin from
senescent or hemolyzed red blood cells. The breakdown of hemoglobin, other
hemoproteins, and free heme generates 250 to 400 mg of bilirubin daily in humans (London et al., 1950). A number of studies indicate that hemoglobin is the
principal source of bile pigment in mammals, accounting normally for approximately 80% of daily bilirubin production (London et al., 1950; Ostrow et al.,
1962).
The heme degradation is enzymatic, mediated by the microsomal enzyme
heme oxygenase 1 (HO-1), which directs stereospecific cleavage of the heme
ring. This reaction requires a reducing agent, such as nicotinamide-adenine dinucleotide phosphate (NADPH) and three molecules of oxygen, and results in the
formation of the linear tetrapyrrole, biliverdin, carbon monoxide, and iron (Tenhunen et al., 1968). Three isoforms of HO have been described: two constitutively
expressed isoforms, HO-2 and HO-3 (Rublevskaya & Maines, 1994; McCoubrey
et al., 1997), and a inducible isoform, HO-1 (Elbirt & Bonkovsky, 1999). HO-1,
the rate-limiting enzyme in the catabolism of the heme, is ubiquitous and is transcriptionally inducible by a variety of agents, such as heme, oxidants, hypoxia,
endotoxin, and cytokines (Maines, 1997; Ishizawa et al., 1983). Following its
synthesis by HO1 or HO2, biliverdin is converted to bilirubin by the phosphoprotein biliverdin reductase (BVR), in the presence of NADPH (Figure 1.1).
1
Introduction
Figure 1.1: Bilirubin metabolism. Bilirubin derives from heme metabolism by heme oxygenase and biliverdin reductase.
Bilirubin is tightly, but reversibly, bound to plasma albumin. Albumin binding
keeps bilirubin in solution and transports the pigment to different organs and to
the liver in particular. Albumin binding protects against toxic effects of bilirubin.
A small unbound fraction of bilirubin is thought to be responsible for its biological effects (Weisiger et al., 2001; Ahlfors, 2001; Wennberg et al., 1979).
At the sinusoidal surface of the hepatocyte, bilirubin dissociates from albumin
and is uptaken by hepatocyte, through mechanism not fully elucidated (Zucker
2
1.2 Bilirubin and pathophysiology
et al., 1999; Cui et al., 2001). Within the hepatocyte, bilirubin binds to a group
of cytosolic proteins, mainly to glutathione-S-transferases (GSTs) (Zucker et al.,
1995). GST binding inhibits the efflux of bilirubin from the cell (Figure 1.2).
A specific form of uridine diphosphoglucuronate glucoronosyltransferase (UGT,
also termed UGT1A1), located in the reticulum, catalyzes the transfer of the glucuronic acid moiety from UDP-glucuronic acid (UDPGA) to bilirubin. In these
step bilirubin diglucuronide and monoglucuronide is formed (Bosma et al., 1994;
Hauser et al., 1984). This conversion is critical for efficient excretion of bilirubin to the bile canaliculus. Conjugated bilirubin is excreted against concentration
gradient by a canalicular multispecific anion transporter (cMOAT) also known
as multidrug resistance-related protein (MRP2) (Kamisako et al., 1999). The
energy for the transport is provided by the hydrolysis of an adenosine triphosphate (ATP). Any abnormality causing slowing or blockage of this rather complicated metabolic pathway will lead to disturbances of bilirubin metabolism (Ostrow et al., 2003a).
1.2
Bilirubin and pathophysiology
Bilirubin has been implicated in the development of different diseases (Greenberg, 2002). Is well known that it is responsible for the yellow skin coloration in
physiological jaundice of the newborn (Gourley, 1997). In this case, jaundice is
the result of a combination of factors, such as the increased bilirubin production
and immaturity of the bilirubin disposal mechanism of the liver. In the great majority of the cases, neonatal hyperbilirubinemia is innocuous. But severe neonatal
hyperbilirubinaemia, in few cases, may cause kernicterus and ultimately death.
Kernicterus is a devastating, chronic, disabling neurological disorder (Shapiro,
2003). Furthermore, unconjugated hyperbilirubinemia is observed also as a consequence of mutations on UGT1A1 gene, leading the description of Crigle-Najjar
and Gilbert syndromes and in the hemolytic disorders (Bosma, 2003; Ostrow &
Tiribelli, 2001a).
Particularly, the kernicterus is an example that suggests the cytotoxic effect
3
Introduction
Figure 1.2: Summary of hepatic metabolism of bilirubin. Bilirubin is strongly bound to albumin in the circulation. At the sinusoidal surface of the hepatocyte, this complex dissociates,
and the bilirubin enters hepatocytes. Within the hepatocyte, bilirubin binds to glutathione-Stransferases (GSTs). UGT1A1 (or UGT) catalyzes the transfer of the glucuronic acid forming
the diglucuronide and monoglucuronide forms. Canalicular excretion of bilirubin is mediated by
multidrug resistance related protein (MRP2).
4
1.2 Bilirubin and pathophysiology
of bilirubin. Several studies have shown such toxicity (Hansen, 2001; Ostrow &
Tiribelli, 2001b), which typically occurs at micromolar concentrations of bilirubin. In vitro studies demonstrated that bilirubin causes death of cultured neurons
(Rodrigues et al., 2002a) and cerebral microvascular endothelial cells (Akin et al.,
2002) by apoptotic pathways. N-methyl-D-aspartate receptor antagonists can protect cultured neurons from bilirubin toxicity (Grojean et al., 2000), suggests the
implications of this class of glutamate receptors in pathogenesis of bilirubin damage.
However, accumulating evidence points to a protective role of bilirubin at
physiologic levels (Dor et al., 1999; Tomaro & Batlle, 2002). Stocker et al.
(Stocker et al., 1987; Stocker & Peterhans, 1989) showed that bilirubin is an antioxidant that can scavenge peroxyl radicals. Furthermore, bilirubin has been reported to protect against a variety of pathological processes, including complementmediated anaphylaxis (Nakagami et al., 1993), myocardial ischemia (Clark et al.,
2000), pulmonary fibrosis (Wang et al., 2002), and cyclosporine nephrotoxicity
(Polte et al., 2002).
This raises a seeming paradox: how can such low concentrations of UCB
protect against the much higher levels of reactive oxygen species? (Ostrow &
Tiribelli, 2003). One possible explanation involves the mechanism of redox cycling. Biliverdin is reduced to bilirubin through the action of BVR. Bilirubin then
interacts with reactive oxygen species (ROS), which neutralize their toxicity and
oxidize bilirubin, thereby regenerating biliverdin. As this cycle is repeated, the
antioxidant effect of bilirubin is multiplied. In this manner, low concentrations
of bilirubin can be recycled to neutralize large amounts of ROS (Baranano et al.,
2002).
There is increasing epidemiological evidence supporting an inverse association between cardiovascular disease and plasma bilirubin levels (Rigato et al.,
2005). In a study involving 4156 individuals aged 5-30 years from a biracial
(black-white) community, bilirubin levels showed significant differences related
to races and sex. In males of both races the bilirubin level was higher than their
5
Introduction
counterparts, except in the pre-adolescents age group of 5-10 years. However,
males in general have higher risk for cardiovascular diseases than females. This
apparent paradox may be due to the multifactorial nature of cardiovascular disease
(Madhavan et al., 1997).
Similarly, a cross-sectional prevalence study conducted on men aged 21 to 61
years found that the decrease in total serum bilirubin was associated with more
severe cardiovascular events (Schwertner et al., 1994).
Interestingly, the prospective Farmingham offspring study found that a higher
total serum bilirubin level was associated with a lower risk for myocardial infraction, coronary artery disease and any adverse cardiovascular events, particulary
in men (Djouss et al., 2001). It is not clear whether higher serum bilirubin concentrations in physiological ranges work in favor of the cardiovascular system in
younger persons with no cardiovascular risk factors (Breimer et al., 1994). Furthermore, another study demonstrated that patients with Gilbert syndrome (who
have mildly elevated bilirubin levels) have less ischemic heart disease than the
general population (Vitek et al., 2002).
On the contrary, in another study conducted on 7735 men, ages 40-59, in England, Wales and Scotland, it was demonstrated that low bilirubin concentration
is also strongly associated with several cardiovascular risk factors. Men with increased concentrations of serum bilirubin and liver enzymes appeared to be at
much increased risk of ischemic heart disease. Interestingly, after adjustment
for lifestyle factors, biological factors, and preexisting disease, the relationship
remained U-shaped. This analysis demonstrate that both low and high concentrations of serum bilirubin are associated with an increased risk of ischemic heart
disease (Breimer et al., 1995). However, Hopkins et al. (Hopkins et al., 1996)
demonstrated that significant lower levels of bilirubin were found in patients with
coronary artery disease.
The relevance of serum bilirubin as a risk factor inversely related to the coronary artery disease was suggested also in other studies (Gullu et al., 2005). How6
1.3 Vascular atherosclerosis
ever bilirubin correlation as a useful marker compared with others (such as apolipoprotein B) seems to be controversial (Levinson, 1997).
More recent studies indicated that bilirubin may be protective in the development of atherosclerotic diseases by inhibiting the proliferation of vascular smooth
muscle cells by mechanisms not well established yet (Stocker & Keaney, 2004).
Collectively, these data indicate that the relationship between UCB and coronary
heart disease is still to be elucidated.
1.3
Vascular atherosclerosis
Atherosclerosis is the major source of morbidity and mortality in the developed
world (Murray & Lopez, 1997). The magnitude of this problem is profound, as
atherosclerosis claims more lives than all types of cancer combined and the economic costs are considerable. Although currently a problem of the developed
world, the World Health Organization predicts that global economic prosperity
could lead to an epidemic of atherosclerosis as developing countries acquire Western habits.
The vascular atherosclerosis, a progressive cardiovascular disease, is characterized by the accumulation of cholesterol in macrophage deposits (foam cell) in
large- and medium- sized arteries and the formation of the so called atherosclerotic plaques in the arteries walls (Stocker & Keaney, 2004). Several clinical
studies provide important evidence between traditional risk factors (dyslipidemia,
hypertension, diabetes, obesity, among others) associated with atheromatous disease (Stocker & Keaney, 2004; Libby et al., 2002).
1.3.1
Morphology of atherosclerotic lesions
The arterial wall normally consists of three well-defined concentric layers that
surround the arterial lumen, each of which has a distinctive composition of cells
7
Introduction
and extracellular matrix. The layer immediately adjacent to the lumen is called the
intima, the middle layer is known as the media, and the outermost layer comprises
the arterial adventitia. These three layers are demarcated by concentric layers of
elastin, known as the internal elastic lamina that separates the intima from the media, and the external elastic lamina that separates the media from the adventitia.
A single contiguous layer of endothelial cells lines the luminal surface of arteries.
These cells sit on a basement membrane of extracellular matrix and proteoglycans
that is bordered by the internal elastic lamina. Although smooth muscle cells are
occasionally found in the intima, endothelial cells are the principal cellular component of this anatomic layer and form a physical and functional barrier between
flowing blood and the stroma of the arterial wall.
Atherosclerosis manifests itself histological as arterial lesions known as plaques
that have been extensively characterized into six major types of lesions that reflect
the early, developing, and mature stages of the disease (Stary et al., 1995; Stary
et al., 1994). The lesions stages were described as:
• Type I lesions, represent the very initial changes and are recognized as
an increase in the number of intimal macrophages and the appearance of
macrophages filled with lipid droplets (foam cells);
• Type II lesions, include the fatty streak lesion, the first grossly visible lesion,
and are characterized by layers of macrophage foam cells and lipid droplets
within intimal smooth muscle cells and minimal coarse-grained particles
and heterogeneous droplets of extracellular lipid;
• Type III (intermediate) lesions, are the morphological and chemical bridge
between type II and advanced lesions. Type III lesions appear in some adaptive intimal thickening (progression-prone locations) in young adults and
are characterized by pools of extracellular lipid in addition to all the components of type II lesions;
• Type IV lesions, are defined by a relatively thin tissue separation of the lipid
core from the arterial lumen. Type V lesions exhibit fibrous thickening of
8
Figure 1.3: Stages of atherosclerotic lesion. Varying stages of atherosclerotic lesion as outline
by Stary et al. From (Stocker & Keaney, 2004)
this structure, also known as the lesion cap. These type IV and V lesions
can be found initially in areas of the coronary arteries, abdominal aorta, and
some aspects of the carotid arteries in the third to fourth decade of life;
• Mature type VI lesions exhibit architecture that is more complicated and
characterized by calcified fibrous areas with visible ulceration. These types
of lesions are often associated with symptoms or arterial embolization.
In summary, the cohort studies by Stary show that progression beyond the fatty
streak stage is associated with a sequence of changes starting with the appearance
of extracellular lipid which begins to form a core to a lesion that is becoming more
9
Introduction
elevated (Figure 1.3). Smooth muscle cells migrate into and proliferate within the
plaque, forming a layer over the luminal side of the lipid core. More and more
collagen is produced and plaque size increases. The process culminates in what is
known as a raised fibrolipid or advanced plaque. In the aorta such plaques may be
a centimeter or more in length.
1.3.2
Atherogenesis - Response to the injury theory
Over the past 150 years, numerous efforts have been made to explain the complex events associated with the development of atherosclerosis. In this endeavor,
different hypothesis have emerged that emphasize different concepts as the necessary and sufficient events to support the development of the atherosclerosis lesions
(Stocker & Keaney, 2004).
These paradigms have been devoted to understand the molecular mechanisms
of atherosclerosis and the factors that predispose individuals to clinical events.
Ross et al. (Ross, 1999) proposed “the response to the injury” theory of atherosclerosis. In this hypothesis, the initial step in the atherogenesis is the endothelial
denudation leading to a number of compensatory responses that alter the normal
vascular homeostatic properties (Ross, 1999).
The earliest event that occurs in the development of atherosclerosis is characterized by a progressive modification in the physiological microenvironment
identified as endothelial dysfunction (Endemann & Schiffrin, 2004).
The endothelial dysfunction is a complex multi-step mechanisms that has been
implicated in the pathophysiology of different forms of cardiovascular disease
(Gimbrone et al., 1995). The endothelial injury or dysfunction is characterized by
enhanced endothelial permeability and low-density lipoprotein (LDL) retention
in the subendothelial space (Schwenke & Carew, 1989; Schwenke & Zilversmit,
1989). This event is followed by leukocyte adhesion and transmigration across
the endothelium (Petri & Bixel, 2006)(Figure 1.4).
10
In intermediate stages, atherosclerosis is characterized by foam cell formation
(macrophages filled with lipid droplets) and an inflammatory response including
T-cell activation, the adherence and aggregation of platelets and further entry of
leukocytes into the arterial wall along with migration of smooth muscle cells into
the intima (Bobryshev, 2006; Zernecke & Weber, 2005; Raines & Ross, 1993).
The oxidized lipids deposition leads to a cell proliferation within the arterial wall
that gradually impinges on the vessel lumen and impedes blood flow (Libby &
Aikawa, 2001).
Continued inflammation allows for cellular necrosis, with a concomitant release of cytokines, growth factors that set the stage for autocatalytic expansion of
the lesion (Raines & Ross, 1995). Finally, advanced atherosclerosis is characterized by continued macrophage accumulation, fibrous cap formation, and necrosis in the core of the lesion (Davies & Woolf, 1993; Bobryshev, 2006; Libby
& Aikawa, 2001). This process may be quite insidious lasting for decades until
an atherosclerotic lesion (plaque) becomes disrupted and deep arterial wall components are exposed to flowing blood, leading to thrombosis and compromised
oxygen supply to target organs such as the heart and brain (Libby, 2002; Davies
& Woolf, 1993).
Because of the silent and slow progression of atherosclerosis in humans, many
of the current concepts on the cellular and molecular mechanisms involved in the
formation and alteration of advanced lesions of atherosclerosis have come from
animal models.
1.3.3
Endothelium
The endothelium is strategically located between the wall of blood vessels and
the blood stream. Endothelial cells regulate a wide array of processes including
thrombosis, vascular tone, and leukocyte trafficking (Cook-Mills & Deem, 2005;
Zeiher, 1996). It senses mechanical stimuli such as pressure and shear stress, and
11
Introduction
Figure 1.4: Attachment, rolling and migration of leucocytes through the arterial endothelial monolayer into the intima. In the human arterial intima, the majority of monocytes differentiate into macrophages but some differentiate into dendritic cells (A). The majority of macrophages
transform into foam cells (B), while others do not accumulate lipids in their cytoplasm (C). Nonfoam macrophages frequently contact other immuno-inflammatory cells (C). In (C), a non-foam
macrophage is marked by a black star, while white stars indicate lymphocytes. Transmission electron microscopy. Scale bars: 4 mm (B, C). From (Bobryshev, 2006)
12
hormonal stimuli, such as vasoactive substances (Galley & Webster, 2004; Cines
et al., 1998).
One of the most important vasodilating substances released by the endothelium is nitric oxide (NO)(Mann et al., 2003), which inhibits cell growth and
inflammation and has anti-aggregant effects on platelets (Bruch-Gerharz et al.,
1998). Reduced NO levels have often been reported in presence of impaired endothelial function (Endemann & Schiffrin, 2004). Different mechanisms may be
involved in the onset of this dysfunction:
1. reduced expression and/or functionality of nitric oxide synthase (Cai & Harrison, 2000);
2. shortage of co-substrates (Mann et al., 2003);
3. NO consumption by increased ROS production (Cai & Harrison, 2000; Fischer et al., 2003).
NO plays a pivotal role in anti-atherogenesis; in addition to being a vasodilator, it inhibits platelet adherence and aggregation, smooth muscle cells proliferation, and endothelial cell leukocyte interaction, all of which are key events in
atherogenesis (Cooke et al., 1992; Davignon & Ganz, 2004). Pathophysiological
states associated with a decrease in NO bio-availability and endothelial adhesion
molecules for monocytes are up-regulated (Caterina et al., 1995). This could enhance local inflammation of the vessel wall, which may play a critical role in
plaque rupture (van der Wal et al., 1994).
The endothelial dysfunction is an early event, characterize by markers of inflammation and endothelial activation. These markers become useful, by providing additional information about a patient’s risk of developing cardiovascular disease, as well as providing new targets for treatment (Endemann & Schiffrin, 2004;
Tardif et al., 2006). Moreover, the endothelial dysfunction may also precede the
development of other diseases not strictly associated cardiovascular disease (Engler et al., 2003; Raitakari et al., 2004; Virdis et al., 2001).
13
Introduction
Clearly, understanding the mechanisms and mediators of endothelial dysregulation and inflammation may yield new targets to predict, prevent, and treat cardiovascular disease. Markers of endothelial dysfunction include soluble forms
of adhesion molecules, which can be assessed in plasma (Szmitko et al., 2003b).
However, several other markers such us oxidized low-density lipoprotein receptor1 (LOX-1), CD40 ligand, asymmetric dimethylarginine (ADMA), to name a few,
have been proposed (Castelli et al., 1986; Szmitko et al., 2003a).
In summary, the endothelium is a crucial vascular structure not only because
it serves as a barrier between flowing blood and vascular wall but also because
it produces mediators regulating vascular growth, platelet function, and coagulation. Thus, the endothelium is not only target but also mediator of inflammatory
diseases.
1.4
Pro-inflammatory cytokines
Cytokines and growth factors constitute a potent set of multi-functional peptide
signalling molecules capable of regulating several cellular functions, including
chemotaxis or directed migration, proliferation, accumulation of lipid, and synthesis of matrix components all of which take place during atherogenesis.
Cytokine is the term that has been used to describe the family of peptides that
regulate immune function and the term growth factor has most often been applied
to stimulators and inhibitors of cell proliferation. These growth regulatory molecules are multi-functional and a single peptide can promote cellular changes at
several different levels (Nathan & Sporn, 1991).
In vivo, growth factors, cytokines and their specific cell-surface receptors are
expressed at low or undetectable levels, may be sequestered in inactive forms and
may be regulated differentially after activation. By binding to specific cell-surface
receptors on responsive cells, cytokines and growth factors may induce signals
that evoke a large number of biological responses (Nathan & Sporn, 1991).
14
1.4 Pro-inflammatory cytokines
Cytokines appear to orchestrate the chronic development of atherosclerosis by
mediating infiltration and accumulation of immunocompetent cells, or enhancing
foam cell formation and thrombogenicity of the lipid core. Several studies have
examined the expression of the various cytokines and growth factors that may be
involved in the cellular changes that accompany developing lesions. Increased
concentrations of IL-1, TNF-α, IFN-γ, and platelet-derived growth factor (PDGF)
have been observed in the lesions of atherosclerosis (Raines & Ross, 1993).
Pro-inflammatory cytokines, as TNF-α, increase leukocyte adhesion to culture
endothelium via the expression of adhesion molecules (AM) and the release of
chemokines, facilitating the attraction and diapedesis of immunocompetent cells
in vitro (Young et al., 2002).
In 1975, Lloyd et al. could demonstrated unambiguously that treatment of
mice or rabbit with bacille Calmette-Gurin (BCG) for 10-14 days, followed by
injection of lipopolysaccharide (LPS), led to the released into the circulation of
a protein, which they called Tumor Necrosis Factor or TNF-α (Carswell et al.,
1975).
On the basis of amino acid sequences data derived from purified human or rabbit TNF-α, different groups cloned the human TNF-α (hTNF) cDNA gene (Shirai
et al., 1985; Pennica et al., 1984). Subsequently, the cDNA from pig, cow, rabbit,
cat, rat and mouse have been reported (McGraw et al., 1990; Drews et al., 1990).
Both human and the murine cDNA could be expressed at very high efficiency in
Escherichia coli and became available for physico-chemical, biological, biochemical and preclinical research, as well as for clinical application.
The human genomic TNF-α gene is located on the short chromosome 6 and
the gene is interrupted by three introns. The TNF-α cDNA gene codes for a mature polypeptide of 157 amino acids in human and 156 amino acids in mouse
(Fiers, 1991). Interestingly, the polypeptide is preceded by a 76 amino acid long
pre-sequence that is much longer than a classical signal sequence. Furthermore, is
15
Introduction
strongly conserved between different mammalian species as the mature sequence,
which suggest a specific and essential function. The native structure of TNF-α is a
trimmer with a total molecular mass of 52 kDa (Van et al., 1991). Unlike human,
mouse TNF-α (mTNF) is a glycoprotein.
TNF-α was originally thought to be produced exclusively by macrophages.
However, by immunohistochemistry and in situ hybridization was also detected in
mesenchymal, endothelial and smooth muscle cells of the atherosclerotic human
arteries (Barath et al., 1990).
Receptors for TNF-α are expressed in the majority of mouse and human cell
lines. The number of receptors vary from about 200 up to 10000, and the binding
constant is around 2X10−10 M. Although the presence of the TNF-α receptor is a
prerequisite for the biological effect, there is not correlation between the number
of receptors and the magnitude of the response, or even the direction of response.
Two distinct TNF-α receptor subtypes (type I and type II) have been identified.
The first TNF-α receptor has a molecular weight of about 55 kDa, and can be referred to as TNF-R55 or TNF-RI. The second receptor has a molecular weight of
about 75 kDa, and can be referred to as TNF-R75 or TNF-RII. Although both receptors bind TNF-α, different cellular responses can be activated (Fiers, 1991).
TNF-α has numerous biological functions, including hemorrhagic necrosis of
transplanted tumors, cytotoxicity, and an important role in endotoxic shock and
in inflammatory, immunoregulatory, proliferative, and antiviral responses (Clermont et al., 2003; Fiers, 1991).
1.5
Nitric oxide
The Nitric Oxide (NO), a diatomic radical, was originally recognized in connection with contraction and relaxation of blood vessels. In the meantime, it has
become clear that NO is an universal messenger substance that takes part in diverse forms of intercellular and intracellular communication. For example, NO is
formed with the help of specific enzymes systems activated by extracellular and
16
1.5 Nitric oxide
Figure 1.5: Stepwise NO synthesis by NOS. The two reactions of NO synthesis as catalyzed
by NOS. The NADPH and oxygen requirements of each reaction are shown.
intracellular signals (Lowenstein & Snyder, 1992). Indeed, NO is synthesized
intracellularly and reaches its effector molecules, which may be localized in the
same cell or in neighboring cells, by diffusion. Finally, NO is notable among
signals for its rapid diffusion, ability to permeate cell membranes, and intrinsic
instability, properties that eliminate the need for extracellular NO receptors or
targeted NO degradation (Nathan, 2003). Thus, NO has the character of an autocrine or paracrine hormone, as well as intracellular messenger (Bruch-Gerharz
et al., 1998). One way or another, practically every cell in mammals is subject to
regulation by NO.
1.5.1
Biosynthesis of nitric oxide
The NO is generated by the oxidation of L-arginine to citrulline exclusively by
the enzyme Nitric Oxide Synthase (NOS). NO is synthesized from L-arginine
through a five-electron oxidation step via the formation of the intermediate NG hydroxy-L-arginine (Hibbs et al., 1988; Palmer et al., 1988). Others substrates
for NOS-mediated NO production are the molecular oxygen and NADPH (Leone
et al., 1991)(Figure 1.5).
The NOS are enzymes of complex composition that are active as dimers but
17
Introduction
can also exist as inactive monomers. Furthermore, three isoforms of NOS have
been identified (Moncada et al., 1991; Forstermann et al., 1998; Stuehr & Griffith,
1992). Two isoforms are constitutively expressed and are activated by Ca+2 intracellular levels (Nathan, 1992).
Among them, nNOS (NOS1) was found to have a widespread distribution in
specific neurons of the central and peripheral nervous system (Bredt et al., 1991;
Vincent & Kimura, 1992; Vincent & Hope, 1992). However, nNOS expression
is not confined to neuronal cells (Forstermann et al., 1998). eNOS (NOS3) was
first identified in endothelial cells (Frstermann et al., 1991), but the expression
has also been demonstrated in several nonendothelial cell types, including neurons and other rat brain regions (Abe et al., 1997; Dinerman et al., 1994), cardiac
myocyte (Balligand et al., 1995), blood platelets (Sase & Michel, 1995), hepatocyte (Zimmermann et al., 1996), smooth muscle cells (Teng et al., 1998) and
others (Forstermann et al., 1998). The third isoform is a calcium independent,
iNOS (NOS2) and is not constitutive expressed (Nathan, 1992) but is induced
in macropahges, as well as in others cells such as melanocytes (Fecker et al.,
2002), cardiac myocytes (Kacimi et al., 1997), hepatocytes (Moreau, 2002), rabbit
corneal epithelial, stroma and endothelial cells (O’Brien et al., 2001) in response
to cytokines and bacterial endotoxin .
NOS isoforms are highly homologous in their primary structure (Figure 1.6).
They differ in size (130 to 160 kDa), amino acid sequence (50 to 60% identity between any two isoforms) (Lamas et al., 1992), tissue distribution, transcriptional
regulation, and activation by intracellular calcium. Moreover, they share an overall three-component construction (Crane et al., 1997; Stuehr et al., 2001; Moncada
& Higgs, 1993):
• an NH2 -terminal catalytic oxygenase domain (residues 1 to 498 for iNOS)
that binds heme (iron protoporphyrin IX), BH4 , and the substrate L-Arginine;
• a COOH-terminal reductase domain (residues 531 to 1144 for iNOS) that
binds FMN, FAD, and NADPH;
18
1.5 Nitric oxide
Figure 1.6: Schematic Presentation of Nitric Oxide isoforms structure. eNOS and iNOS diffentes domains and homology regions. For eNOS, regions involved in acylation, binding of substrates and cofactors are indicated as well as the oxygenase and reductase domain. Arg, arginine;
BH4 , tetrahydrobiopterin; CaM, calmodulin; FMN, flavin mononucleotide; FAD, flavin adenine
dinucleotide.
• an intervening calmodulin-binding region (residues 499 to 530 for iNOS)
that regulates electronic communication between oxygenase and reductase
domains.
Although NO synthesis reaction by NOS is well understood, some aspects
have been question and still been controversial (Alderton et al., 2001). It is
well accepted that the biosynthesis of NO requires a number of essential cofactors such as tetrahydrobiopterin (BH4 ), flavin adenine dinucleotide (FAD), and
flavin mononucleotide (FMN). BH4 seems to be important in maintaining NOS
in its active dimeric form (Griffith & Stuehr, 1995). Furthermore, NOS contains
binding sites for heme and calmodulin, both being essential for the enzyme activity. Indeed, functionally and structurally NOS enzymes catalase, as expected,
19
Introduction
a multi-electron transfer in order to generate NO. The FAD and FMN in the reductase domain accept electrons from NADPH and pass them on to the haem
domain. The essential role of the flavin cofactors is to allow a two-electron donor
(NADPH) to donate electrons to a one-electron acceptor (haem), by forming a
stable semiquinone radical intermediate (NG -hydroxy-L-arginine). These electron flow may result in the formation of the enzyme products citrulline and NO
(Abu-Soud & Stuehr, 1993).
Intriguingly the pathway of electron flow appears to cross over between different subunits of the dimer, i.e. the flavin domain of one polypeptide chain donates
its electron to the haem domain of the other. The physiological reason for this is
unclear, but it is clearly a major reason why the NOS monomer is inactive.
1.5.2
Endothelial Nitric Oxide Synthase (eNOS)
Regulation of eNOS expression
The eNOS promoter has been cloned from human (Marsden et al., 1993), bovine
(Venema et al., 1994), murine (Gnanapandithen et al., 1996), porcine (Zhang et al.,
1997) endothelial cells, and there is a high degree of homology in the promoter
sequence among the different species (Venema et al., 1994). This high sequence
homology suggests significant evolutionary conservation of transcriptional regulation. Like many so-called constitutively expressed proteins, the eNOS promoter
lacks a typical TATA box (Forstermann et al., 1998). In addition, eNOS promoter
possesses multiple potential cis-regulatory DNA sequences, including a CCAT
box, Sp1 sites, GATA motifs, CACCC boxes, AP-1 and AP-2 sites, a p53 binding region, NF-1 elements, NF-κB site, acute phase reactant regulatory elements,
sterol regulatory elements, and shear stress response elements (Marsden et al.,
1993; Cieslik et al., 1998; Karantzoulis-Fegaras et al., 1999; Laumonnier et al.,
2000; Tang et al., 1995; Grumbach et al., 2005). Deletion experiments revealed
that some binding sites are essential for eNOS promoter activity, in particular Sp1
and GATA (German et al., 2000).
Given the list of transcription factors that bind to the eNOS promoter it is
20
1.5 Nitric oxide
hardly surprising that eNOS mRNA levels in cultured and native endothelial cells
can be modulated by numerous stimuli (Searles, 2006). Although the term inducible has been restricted to iNOS (NOS 2), eNOS is also regulated by a variety of stimuli (Bruch-Gerharz et al., 1998; Govers & Rabelink, 2001). For instance, TNF-α is known to lower eNOS expression by decreasing the half-life of
its mRNA (Lai et al., 2003). In addition, TNF-α induced destabilization of eNOS
message has been observed by others. Yoshizumi et al. (Yoshizumi et al., 1993)
demonstrated that there was a dramatic decrease in steady-state levels of eNOS
mRNA and protein in human umbilical vein endothelial cells (HUVECs) treated
with the cytokine TNF-α. This finding was consistent with earlier work showing
impaired endothelium dependent vasorelaxation in isolated arteries treated with
TNF-α (Aoki et al., 1989). In nuclear run-on analysis of cells treated with TNF-α,
there was no difference in the rate of eNOS transcription compared with untreated
cells . However, TNF-α treatment resulted in a reduction of eNOS mRNA halflife from 48 h at baseline to 3 h (Yoshizumi et al., 1993).
Co-translational modification and post-translational regulation of eNOS
It was also demonstrated that there is a marked discrepancy among the amounts
of eNOS mRNA, protein expression and activity, strongly suggesting a regulatory
mechanisms at post-transcriptional (Yoshizumi et al., 1993; Forstermann et al.,
1998) and post-translational level (Govers & Rabelink, 2001).
In contrast to the other NOS isoforms, eNOS contains a myristoyl group that is
covalently attached to the glycine residue at its NH2 terminus. The turnover of the
myristoyl group is as slow as that of eNOS itself, demonstrating the irreversibility of myristoylation (Liu et al., 1995). Myristoylation renders eNOS membrane
bound, whereas iNOS and nNOS are predominantly, if not exclusively, cytoplasmic. Indeed, the myristoyl moiety is and absolute requirement for the membrane
localization and activity of eNOS (Sakoda et al., 1995).
The monomers that compose the active eNOS dimer are also palmitoylated
21
Introduction
(Sessa et al., 1995). This post-translational modification does not modify eNOS
activity, is reversible, requires myristoylation and stabilizes the association with
intracellular membranes. The membrane association is required for the phosphorylation and activation of eNOS (Patterson, 2002). Functional eNOS can be detected in at least three membrane compartments: the Golgi apparatus (O’Brien
et al., 1995; Sessa et al., 1995), the plasma membrane (Hecker et al., 1994) and
the plasmalemmal caveolae, a specialized plasma membrane domain principally
composed by caveolins proteins (Feron et al., 1996; Garca-Cardea et al., 1996;
Liu et al., 1996; Govers et al., 2002).
The co-localization of the signal transduction molecules and proteins that
comprise the eNOS signaling complex within the different membrane compartments facilitates enzyme activation, NO production, and the activation of downstream effector pathways (Govers & Rabelink, 2001).
Another determinant of eNOS expression is NO itself. NO has been shown
to be involved in a negative-feedback regulatory mechanism and decreases eNOS
expression via a cGMP-mediated process (Vaziri & Wang, 1999). In agreement,
the decrease in glomerular filtration rate after administration of LPS could be attributable to inhibition of eNOS function, most likely by NO auto-inhibition via
activation of iNOS (Schwartz et al., 1997).
1.5.3
Inducible Nitric Oxide Synthase (iNOS)
In contrast to eNOS and nNOS, iNOS, once expressed, is present in much greater
amounts and is continuously active due to the tight binding of calmodulin even at
basal levels of cytosolic Ca2+ . These properties result in the production of much
greater amounts of NO by iNOS, typically within the micromolar range, as compared with eNOS and nNOS (Cho et al., 1992; Stuehr et al., 2001).
Thus, the relatively large amounts of NO and its reaction products produced
by iNOS are capable of killing bacteria, viruses, and other infectious organisms
22
1.5 Nitric oxide
and are also capable of causing tissue damage (Hobbs et al., 1999). Indeed, NO is
extremely reactive and short-lived. A variety of reactive products of NO formed
in tissues, including peroxynitrite, NOX , and N2 O3 , are likely the molecules responsible for tissue damage (Bruch-Gerharz et al., 1998; Stuehr et al., 2001).
Regulation of iNOS
The iNOS gene is quiescent in most tissues until it is transcriptionally activated
by diverse stimuli to produce large amounts of NO (Kone & Baylis, 1997). Accordingly, both positive and negative modulators have evolved to control tightly
iNOS expression and to prevent untoward effects of excessive NO production.
The 5’ flanking region of iNOS gene was cloned and sequenced for mouse
(Xie & Nathan, 1993; Lowenstein et al., 1993), rat (Zhang et al., 1998) and human (Nunokawa et al., 1994). The large size of these region suggested a complex
regulation of induction. iNOS transcription is regulated in a complex manner by
several constitutive and inducible transcription factors, including CREB (Eberhardt et al., 1998), C/EBPbeta (Eberhardt et al., 1998), NF-κB (Beck & Sterzel,
1996; Neufeld & Liu, 2003) and many others cytokines responsive elements such
as: AP-1, γ-IRE, NF-IL6, GAS, IRF-E, ISRE, TNF-RE, and X box (Chu et al.,
1998). Indeed, the promoter region of human iNOS contains multiple binding
sites for NF-κB (Taylor et al., 1998; Xie & Nathan, 1994). Various stimuli in a
wide variety of cells induce iNOS (Taylor & Geller, 2000; Rao, 2000; Frstermann
& Kleinert, 1995). It was demonstrated that iNOS can be regulated by stimuli
including cytokines, e.g., IFN-γ, IL-1β, and TNF-α that, have been shown to activate NF-κB (Chu et al., 1998; Neufeld & Liu, 2003). In contrast, transforming
growth factor-β (Pfeilschifter & Vosbeck, 1991), interleukin (IL)-13 (Saura et al.,
1996), and STAT3 (Yu et al., 2002b) suppress iNOS transcription.
Epigenetic controls on iNOS transcription are also operative, and it was shown
that hyperacetylation (Yu et al., 2002b) and DNA methylation (Yu et al., 2002a)
limit iNOS activation. Although much is known about the cis and trans regula23
Introduction
tory factors controlling activation of iNOS transcription by cytokines and bacterial
LPS, relatively little is known about how iNOS transcription might be constrained
and how local changes in chromatin structure might participate in this process.
On the other hand, iNOS is also regulated post-transcriptionally. Different and
multiple levels may affected iNOS activity (Nathan & Xie, 1994). Among them:
• mRNA and protein stability (Vodovotz et al., 1993);
• binding of calmoduling (Cho et al., 1992);
• activity of kinase and phosphatase regulating the protein phosphorylation
(Dawson et al., 1993; Michel et al., 1993);
• availability of subtracts and cofactors (Vodovotz et al., 1994; Albina et al.,
1988; Gross & Levi, 1992);
• NO itself (Assreuy et al., 1993; Griscavage et al., 1993);
• subcellular localization (Vodovotz et al., 1993).
Complex regulation of iNOS at multiple levels may reflect the dual role of
iNOS in host defense and autotoxicity (Bogdan, 2001a).
1.5.4
Nitric oxide and pathophysiology
Excessive NO production has been associated to several pathologies. The concentration of NO produced within a cell has also significant implications for the
ultimate signals produced. Under certain pathological conditions such as inflammation, up-regulation of inducible NOS affords production of NO at low micromolar concentrations (Xie & Nathan, 1994). In this concentration range, NO
competes effectively with the enzyme superoxide dismutase (SOD) for O2– , facilitating formation of ONOO− and other reactive nitrogen species (RNS) (Koppenol
et al., 1992). This increase in tissue RNS, a condition termed “nitrosative stress”
(Hausladen et al., 1996), leads to the modification of cellular targets such as thiols, proteins, and lipids, many of which have implications for cellular signaling
24
1.5 Nitric oxide
(Davis et al., 2001).
Excessive NO production was linked to pathologies including: immune-type
diabetes, inflammatory bowel disease, rheumatoid arthritis, carcinogenesis, septic
shock, multiple sclerosis, transplant rejection and stroke. On the other hand, several pathologies were linked to insufficient NO production, including: hypertension, impotence, arteriosclerosis and susceptibility to infection (Bogdan, 2001a;
Bruch-Gerharz et al., 1998; Nathan, 1992).
In the immune system, the use of NO donors and NOS inhibitors and the analysis of NOS knock out mice have provided evidence that NO governs a broad
spectrum of processes (Bogdan, 2001a). These include the differentiation, proliferation and apoptosis of immune cells, the expression adhesion molecules, the
production of cytokines and other soluble mediators, and the synthesis and deposition of extracellular matrix components (Marshall et al., 2000; Bogdan, 2001b;
Pfeilschifter et al., 2001). Many molecular targets for NO have been identified
whose contribution to a specific phenotype.
High-input NO release may strongly affect endothelial cell functions. Increased NO production likely plays an important role in different steps of angiogenesis, modulating migration, proliferation, and endothelial cell organization
into a network structure (Papapetropoulos et al., 1997; Shizukuda et al., 1999;
Fukumura & Jain, 1998).
NO is a principal factor involved in the anti-atherosclerotic properties of the
endothelium (Endemann & Schiffrin, 2004). It has been documented that NO
plays a critical role in vascular endothelial growth factor-induced angiogenesis
(Hood et al., 1998), vascular hyper-permeability mediated by eNOS and iNOS expression in vitro (Papapetropoulos et al., 1997) and down-regulation of cytokineinduced endothelial cell adhesion molecule expression (Jiang et al., 2005). In
agreement with these findings, inhibition of the NO-producing enzyme eNOS
caused accelerated atherosclerosis in experimental models (Davignon & Ganz,
2004).
25
Introduction
NO interferes in vitro with key events in the development of atherosclerosis,
such as monocyte and leukocyte adhesion to the endothelium (Landmesser et al.,
2006). Also, high concentrations of NO have been implicated in the modulation
of leukocyte recruitment by the regulation of adhesion molecule expression on endothelial cells (Zadeh et al., 2000) and in the microbicidal activity of endothelial
cells (Jiang et al., 2005; Bogdan, 2001a). NO also decreases endothelial permeability and reduces vessel tone, thus decreasing flux of lipoproteins into the vessel
wall (Rubbo et al., 2002). Finally, NO has been shown to inhibit vascular smooth
muscle cell proliferation, migration (Endres & Laufs, 1998) and platelet aggregation (Radomski et al., 1987). It has been proposed that eNOS has a dual role
in the pathogenesis of atherosclerosis: under normal conditions, it generates low
concentrations of NO and probably peroxynitrite (Koppenol et al., 1992), which
favor an anti-atherosclerotic environment (Endemann & Schiffrin, 2004; Wever
et al., 1998). However, during hyperlipidemia and atherosclerosis, it may contribute to the formation of oxidative stress by a reduction in BH4 -dependent NO
formation and unopposed superoxide formation by the enzyme (Schillinger et al.,
2002). Particularly, in the setting of local induction, iNOS could favor the development of local toxic concentrations of peroxynitrite in atherosclerotic plaques
(Lee et al., 2004). This concept further emphasizes the role of redox state as a
determinant of vascular integrity in atherosclerosis (Stocker & Keaney, 2004; Endemann & Schiffrin, 2004; Davignon & Ganz, 2004).
In summary, NO production plays a role in the physiology or pathophysiology
of almost every organ system. Thus, it should come as little additional surprise
to learn that the production of NO is regulated by means as diverse and complex
as NOS functions. The diversity of ways in which NO production can be timed,
confined, augmented, or suppressed, combined with the wide spectrum of NO’s
molecular targets, helps explain how one molecule can serve many functions.
26
1.6 Adhesion molecules
1.6
Adhesion molecules
Most eukaryotic cells have the ability to recognise and react functionally to extracellular matrices. This is true not only for actively migrating cells that use
adhesive contact for traction and guidance, but also for stationary cells that require a platform for support and orientation.
Cells in vivo must form contacts with their neighbours or with the extracellular matrix (ECM) in order to form tissues or organs. The macromolecular components of ECM, which are secreted by resident cells, include proteglycans, glycoproteins and collagens that are secreted and assembled locally into an organised
network to which cells adhere (Hay, 1981). Other members of the ECM, including adhesive molecules such as laminin, vitronectin and fibronectin, facilitate the
adherence of cells to their substratum (Hay, 1981; Humphries, 1990).
ECM not only fills intercellular spaces, shaping and strengthening many tissues. The ECM offers structural support for cells, and can also act as a physical
barrier or selective filter to soluble molecules. On the other hand, ECM can influences cellular functions such as state of differentiation and proliferation (Wylie
et al., 1979; Adams & Watt, 1993; Springer, 1990). ECM components regulate
differentiation and development by mechanisms involved intracellular events that
may transduce signals between ECM receptors and the nucleus (Adams & Watt,
1993; Aplin et al., 2002).
Cell adhesion receptors identified to date mediate both homophilic adhesion,
which involves binding of an adhesion molecule on one cell to the same adhesion molecule on a second cell and heterophilic adhesion, in which an adhesion
molecule on one cell type binds to a different type of cell adhesion molecule on a
second cell. The T-cell interaction with antigen-presenting target cells in the immune system is the best known example of heterophilic adhesion (Springer, 1990).
Diversity in the composition of ECM in different tissues and at different stages of
development arises not only through expression of different matrix molecules, but
also from the existence of multiple forms of individual molecules.
27
Introduction
Many different molecules have been identified by using specific monoclonal
antibodies and the subsequent identification of genes responsible for encoding
these molecules has shown that they are structurally different from each other
(Wylie et al., 1979).
The cell adhesion molecules can be divided into 4 major families: A) the
cadherin superfamily (Takeichi, 1988), B) the selectins (Bevilacqua & Nelson,
1993), C) the immunoglobulin superfamily (Hogg et al., 1991) and D) the integrins (Hynes, 1987) (Figure 1.7). The interactions of the adhesion molecules
with the ECM has a homeostatic function in promoting tissue regeneration during
wound healing (Eliceiri, 2001), while aberrant adhesion contributes to the etiology and pathogenesis of a number of major human diseases including asthma,
allergy, cardiovascular disease and cancer (Kelly et al., 2007; Blankenberg et al.,
2003; Juntavee et al., 2005).
Adhesion molecules mediate many other different functions, acting as receptors for growth factors and mediating cell-cell adhesion rather than cell extracellular matrix interactions (Lster & Horstkorte, 2000). Adhesion molecules are
important on early phase of atherosclerosis involving the recruitment of inflammatory cells from the circulation and their transendothelial migration (Kelly et al.,
2007; Jang et al., 1994; Petri & Bixel, 2006).
The two major subsets of adhesion molecules participating in the inflammatory disease are: the selectins, in particular E and P selectins and the immunoglobulin gene superfamily, in particular vascular cell adhesion molecule 1 (VCAM-1)
and intercellular adhesion molecule 1 (ICAM-1) (Blankenberg et al., 2003; Jang
et al., 1994). Selectins, belong to a family of Ca+2 dependent carbohydrate binding
proteins, mediate the earlier adhesion of leukocytes to the endothelium during the
rolling step of leukocyte extravasations in inflammation. VCAM-1 is a glycoprotein expressed on the surface of activated endothelium and on a variety of cell
types. ICAM-1 is a counter receptor for the leukocyte β2 integrin, LFA-1. ICAM1 is expressed on leukocytes, fibroblast, epithelial cells and endothelial cells. The
28
Figure 1.7: Steps in the inflammatory process. The five distinct steps leading to leukocyte
accumulation and tissue damage during inflammatory processes. Selectins, VCAM and ICAM
interaction with leukocyte integrins. From (Jackson, 2002).
expression of this adhesion molecules is also regulated by several cytokines, such
as IL-1β, IL-4, TNF-α and IFN-γ (Dustin et al., 1986; Shimizu et al., 1992a).
1.6.1
The Selectins
The selectins, a family of Ca+2 dependent carbohydrate binding proteins, mediate
the initial attachment of leukocytes to the endothelium on the blood vessel wall
during the rolling step of leukocyte extravasation in inflammation (Abbassi et al.,
1993; Petri & Bixel, 2006).
Selectins recognise fucosylated carbohydrate ligands, especially structures containing Sialyl-LewisX (sLeX ) and Sialyl-Lewisa (sLea ), which are heavily ex29
Introduction
pressed on neutrophils and monocytes and also found on natural killer cells. These
selectin/carbohydrate interactions permit leukocytes to roll along the vascular endothelium in the direction of blood flow as a prelude to integrin-mediated adhesion
(Munro et al., 1992).
All selectins have a unique and characteristic extracellular region composed of
an amino-terminal calcium dependent lectin-like binding domain which is formed
by a 120-amino acid. This region determines the ability of each selectin to bind
to specific carbohydrate ligands (Drickamer, 1988). This domain is followed by a
sequence of 35-40 amino acids similar to a repeat structure, which was first found
in epidermal growth factor (EGF). The lectin and EGF-like domains are shown
to have 60% to 70% homology at the nucleotide and protein level. There is also
a region composed by two to nine short consensus repeat sequences (SCR), similar to those found in complement regulatory proteins. The size variation of the
selectins is due to the different numbers of SCR domains, each ∼60 amino acids
long. This is followed by a single transmembrane region and a short cytoplasmic
tail (Vestweber & Blanks, 1999) (Figure 1.8).
The selectins family consists of three closely related cell-surface molecules:
L-selectin (MEL-14, LAM-1, CD62L), E-selectin (ELAM-1, CD62E), and Pselectin (PADGEM, GMP-140, CD62P). P-, L-, E-selectin are most closely related in amino acid sequence within lectin and EGF like domains. Moreover,
these domains mediate specific interactions with similar, if not identical, carbohydrate determinants displayed on diverse ligands (Tedder et al., 1995).
All selectins participate in different, though overlapping, ways to the early
steps of leukocyte recruitment at the endothelial surface under shear forces: leukocyte rolling and tethering. By interactions with their ligands, selectins create weak
bonds between activated endothelial cells (E- and P-selectin) and leukocytes (Lselectin). P-selectin/PSGL-1 binding triggers leukocyte activation, integrin mobilization and induces inflammation and thrombosis (Blankenberg et al., 2003;
Vestweber & Blanks, 1999).
30
Figure 1.8: Structural organization of selectins. Selectins are composed of an amino-terminal
lectin domain, a single epidermal growth factor (EGF)-type repeat and various numbers of consensus repeats or so called complement binding domains, which share sequence homology with
a domain structure often found in proteins with complement binding activity. Proteins have a
single transmembrane region and a short cytoplasmic tail. E-selectins have different numbers of
complement binding domains in different species.
31
Introduction
Unlike E- and P-selectins, L-selectin is found only on leukocytes and is expressed continuously throughout myeloid differentiation and on early erythroid
progenitor cells but not on mature erythrocytes (Tedder et al., 1995). L-selectin
was originally reported to mediate lymphocyte binding to high endothelial venules
of peripheral lymph nodes during lymphocyte homing. Subsequently, it was
shown to be expressed on most of other peripheral blood leukocytes and is thought
to be involved in regulating leukocyte traffic in the systemic microcirculation
(Warnock et al., 1998).
P-selectin is another type of selectin adhesion protein that was initially found
in platelets and also is constitutively expressed in endothelial cells (Johnston et al.,
1989). In both cell types, P-selectin is synthesised and stored in cytoplasmic
granules. In platelets P-selectin is contained in the α-granules (Wagner, 2005),
whereas in endothelial cells it is found in Wiebel-Palade bodies (McEver et al.,
1989). P-selectin is mobilized rapidly to the external plasma membrane of endothelial cells and platelets in response to activation with cytokines such as thrombin (Tedder et al., 1995). Expression of P-selectin on the cell surface generally
is short-lived. This supports the idea that P-selectin mediates early leukocyteendothelial interactions and also mediates the binding of activated B-cells and a
subset of T-cells, to stimulated endothelium in vitro (Wagner, 2005). Since Pselectin an E-selectin can bind to the tetrasaccharide sLeX and both mediate the
binding of PMNs and monocytes, the function of the endothelial selectins appears
to be redundant (Larsen et al., 1992). The rapid transport of P-selectin to the cell
surface (McEver et al., 1989) and the more slowly acting up regulation by de novo
synthesis of E-selectin (Bevilacqua et al., 1987) had served as an explanation for
this redundancy, arguing for similar functions of both selectins at different time
points. At the same time, the parallel expression of both selectins after induction
with TNF-α might argue for redundancy. However, indirect evidence has emerged
recently, suggesting that the physiological ligands for both endothelial selectins on
the same leukocytes might be different (Hahne et al., 1993; Larsen et al., 1992).
E (endothelial)-selectin is specific from endothelial cells. This adhesion molecule is almost absent from non activated endothelial cells and become induced
32
upon the exposure of the endothelium to various pro-inflammatory stimuli. Eselectin synthesis is increased rapidly after cell stimulation by cytokines such as
TNF-α or IL-1β (Invernici et al., 2005) and lipopolisaccharide (LPS). Induction
occurred on the transcriptional level, and within 34 h after stimulation, maximal
levels of E-selectin protein are expressed at the cell surface. Basal levels are
reached again after 16-24 h, in contrast to other cytokine-inducible adhesion molecules such as ICAM-1 and VCAM-1. A similar mechanism and similar kinetics
of the regulation of mouse E-selectin were found on mouse endothelioma cells
(Hahne et al., 1993).
The 5’-flanking regions of human E-selectin were cloned and sequenced, and
the regulatory elements of the gene were studied intensively. Four regulatory elements were found in the human E-selectin promoter, three of them are NF-κB
binding sites and one is an activating transcription factor (ATF)-binding element
(Kaszubska et al., 1993). NF-κB elements are not sufficient, but necessary, for the
cytokine-stimulated induction of E-selectin transcription (Whelan et al., 1991).
Furthermore, proteosome inhibitors block the degradation of IκB, consequently
block NF-κB activation and inhibit transcriptional activation of E-selectin (Read
et al., 1997). In addition to the NF-κB elements, the ATF element is involved
in cytokine-stimulated expression of E-selectin as well. These two pathways are
rapidly activated and converge on the E-selectin promoter to result in full cytokine
responsiveness of this gene (Read et al., 1997).
1.6.2
Immunoglobulin superfamily adhesion molecules
The immunoglobulin superfamily is the most abundant family of cell surface adhesion molecules, accounting for 50% of leukocyte surface glycoprotein. The
structure of this family is characterized by repeated domains, similar to those
found in immunoglobulins. These 70-100 aminoacid domains are composed of
two β sheets and give rise to immunoglobulin folds that participate to adhesion
sites (Blankenberg et al., 2003; Petri & Bixel, 2006).
33
Introduction
Alternative splicing is frequent in the genes of this family and allows the
production of multiple isoforms. By mutation and deletion analysis these immunoglobulin domains have been shown to mediate many different functions, including acting as receptors for growth factors and mediating cell-cell adhesion
rather than cell- extracellular matrix interactions (Holness & Simmons, 1994;
Shimizu et al., 1992b). Though not all immunoglobulin-superfamily adhesion
molecules mediate cell-cell interactions. Many glycoprotein which belong to
this family do function as adhesion receptors, including: intercellular adhesion
molecule-1 (ICAM-1; CD54), intercellular adhesion molecule-2 (ICAM-2), vascular cell adhesion molecule-1 (VCAM-1; CD106), platelet-endothelial cell adhesion molecule-1 (PECAM-1; CD31) and the mucosal addressin cell adhesion
molecule-1 (MAdCAM-1). ICAM-1, ICAM-2 and VCAM-1 are involved in the
adhesion of T-cells to endothelial cells by serving as surface ligands for the integrins LFA-1 (leukocyte-function antigen-1), αLβ2 and α4 β1 (Shimizu et al.,
1992b).
Intercellular Adhesion Molecule-1 (ICAM-1)
The adhesion molecules ICAM-1 (CD54) and ICAM-2 (CD102) are counterreceptors for the leukocyte β2 integrin, LFA-1 (CD11α/CD18) (Diamond et al.,
1991; van de Stolpe & van der Saag, 1996). ICAM-1 molecule mediate adhesion of leukocytes to activated endothelium by establishing strong bonds with
integrins and inducing firm arrest of inflammatory cells at the vascular surface,
and participate to leukocyte extravasation (Petri & Bixel, 2006; Katagiri et al.,
1996). Linkage with the cytoskeleton, ICAM-1 may localize within regions of the
endothelial cell membrane in order to facilitate leukocyte adherence and transmigration (van der Wal et al., 1994). Conversely, blocking ICAM-1 function with
antibodies prevents leukocytes to firmly adhere to the endothelium, resulting in a
significant reduction in leukocyte trans-endothelial migration in various animals’
models. In line with these experimental findings, ICAM-1 knock-out mice show
an impaired inflammatory response exemplified by reduce tissue infiltration of
neutrophils (Sligh et al., 1993).
34
Figure 1.9: Structure of ICAM-1 domains. Intercellular adhesion molecule-1 (ICAM-1) has
five immunoglobulin like domains followed by a transmembrane region and a short cytoplasmic
tail.
ICAM molecules are able to bind more than one ligand by using different
binding domains. The dimerisation or formation of larger protein multimers is
commonly observed for such molecules and may increase binding affinities with
ligands. Amino acid substitutions in the extracellular domains have indicated that
the primary binding site for LFA-1 is located in the NH2 -terminal first domain of
ICAM-1 (Stanley & Hogg, 1998; Staunton et al., 1990). A second ligand-binding
site for another β2 integrin on leukocytes (CD11b/CD18, Mac-1) is localized to
the third immunoglobulin-like domain. However, it is clear that the NH2 -terminal
two domains in both cases do not contribute equally to the binding site (Figure
1.9).
ICAM-2 has only two extracellular immunoglobulin-like domains and the
binding site for Mac-1 is localized to the third immunoglobulin-like domain of
ICAM-1. The second domain has a less critical role (Holness & Simmons, 1994),
it appears that ICAM-2 contribution as an endothelial ligand for this leukocyte
integrin is rather limited (Staunton et al., 1989; Casasnovas et al., 1999).
35
Introduction
ICAM-1 is expressed on leukocytes, fibroblasts, epithelial cells and endothelial cells (Dustin et al., 1986). ICAM-2 also has a similar tissue distribution
(Blankenberg et al., 2003). ICAM-1 displays molecular weight heterogeneity in
different cell types with a mature form of of 97 kDa on fibroblasts, 114 kDa on
the myelomonocyte cell line U937, and 90 kDa on the B lymphoblastoid cell JY.
ICAM-1 biosynthesis involves a 73 kDa intracellular precursor which is converted
to the mature form in 20 to 30 min. The maturation, in the Golgi complex, is followed by transport to the cell surface within a few minutes (Dustin et al., 1986).
In vitro, ICAM-1 expression can be up regulated in responses to proinflammatory cytokines such as IFN-γ, TNF-α and IL-1β (Invernici et al., 2005; Sawa
et al., 2007). The induction is dependent on protein and mRNA synthesis and is
reversible. The up-regulation of ICAM- 1 by IL-1β involved a rapid mRNA and
protein synthesis-dependent, which is apparent within 1 hr (Dustin et al., 1986).
On the contrary, ICAM-2 apparently is expressed constitutively and is not regulated by cytokines (van Buul et al., 2007).
It is therefore interesting the characterization to the genomic structure of the
5’-flanking region for the human ICAM-1 gene. It was identified to be a functional potent promoter region. Structural analysis revealed that contained potential
interferon responsive elements, glucocorticoid receptor-binding sites, an NF-κB
consensus element, and AP1 and AP2 sites, regions which may be involved in the
regulation of this gene expression (Voraberger et al., 1991; Muller et al., 1995; Degitz et al., 1991). The exact biologic roles played by these potential elements, as
well as other regions involved in the constitutive and tissue-specific regulation of
ICAM-1 gene expression, are currently under investigation (Degitz et al., 1991).
Vascular Cell Adhesion Molecule-1 (VCAM-1)
Another member of the immunoglobulin gene superfamily, VCAM-1, is a 90–110
kDa glycoprotein which supported the adhesion of mononuclear leukocytes (Petri
36
& Bixel, 2006) and certain tumor cells (Osborn et al., 1989; Rice & Bevilacqua,
1989; Rice et al., 1990). In vitro studies demonstrated that VCAM-1 is expressed
on the surface of isolated human fetal endothelial cells deriving from different organs such as: brain, heart, lung, liver and kidney. In this way, it was supported the
notion that VCAM-1 expression can be up-regulated by interferon-γ (IFN-β) and
several cytokines, such as IL-4, IL-1β and TNF-α (Li et al., 1993; Invernici et al.,
2005; Sawa et al., 2007).
VCAM-1 interacts with the leukocyte integrin α4β1 on many different cells
including eosinophils, monocytes and with α4β7 on activated peripheral T-cells.
Thus α4β1/VCAM-1 interactions, like LFA-1/ICAM-1 interactions, may regulate
the movement of lymphocytes out of blood vessels to cross the endothelium in the
inflammatory sites (Petri & Bixel, 2006). Furthermore, α4β1/VCAM-1 interaction has been shown to be crucial for the binding of hematopoietic precursor cells
to a bone marrow derived adherent cell population (Ryan et al., 1991).
Osborn et al. (Osborn et al., 1989) demonstrated on HUVEC cells treated
with IL-1, that VCAM-1 contains six immunoglobulin domains . On the other
hand, Cybusky et al. (Cybulsky et al., 1991), reported that VCAM-1 contained
an additional 276 base-pair domain, located between domains 3 and 4. Together,
these data indicate that the two forms of mRNA arise by alternative splicing, although the seven-domain form appeared predominant. On the surface of HUVEC
cells only a 110 kDa polypeptide was detectable by immunoprecipitation. This is
consistent with the seven-immunoglobulin like domain form of VCAM-1 (Cybulsky et al., 1991). Alternative splicing of the VCAM-1 gene, in cytokine activated
endothelium, may generate functionally distinct cell-surface adhesion molecules
(Figure 1.10). In this way, it was demonstrated by functional analysis that the
major form of VCAM-1 has seven extracellular immunoglobulin like domains
(VCAM-7D). Moreover, the three NH2 -terminal domains (domains 1-3) are similar in amino acid sequence to domains 4-6. However, on the minor form of
VCAM-1 (VCAM-6D), the domain 4 is deleted by an alternative splicing (Osborn et al., 1992).
37
Introduction
Figure 1.10: Structure of VCAM-1 different isoforms domains. Vascular adhesion molecule1 (VCAM-1) has either six or seven immunoglobulin domains followed by a transmembrane region and a short cytoplasmic tail.
It was determined that either the first of the homologous fourth domain of
VCAM-1 are required for VLA-4-dependent adhesion (Jackson, 2002). These
binding sites can function in the absence of the other. When all are present, cell
binding activity is increased relative to monovalent forms of the molecule. Thus,
VCAM-1 exemplifies evolution of a functionally bivalent cell-cell adhesion molecule by intergenic duplication (Osborn et al., 1992).
The characterization to the genomic structure of the 5’-flanking sequences
of the human VCAM-1 promoter was also performed. It was identified a functional potent promoter cis-acting sequences that direct the cytokine-induced transcription. Within the cytokine-responsive region of the core promoter were functional NF-κB and GATA elements. Upstream of the core promoter, the VCAM-1
5’flanking sequence contained a negative regulatory activity. NF-κB mediate in
this way activation of VCAM-1 gene expression (Neish et al., 1992).
Cell adhesion and adhesion molecules have been shown to contribute to the
pathogenesis of a large number of common human disorders and tumor cell metastasis in cancer. Several studies have demonstrated that cell adhesion molecules are
38
1.7 Signal transduction pathways
involved in signal transduction pathways (Adams & Watt, 1993). These molecules
transmit signals from the extracellular matrix on the cell interior (outside-in) and
from the inside of the cell to the outside of the cell (inside-out) similar to those
transduced by growth factors, hormones and cytokines. These results might be
extremely significant in metastatic spread and the treatment of a large number of
human disorders.
1.7
Signal transduction pathways
It has become clear over the last few years that, in addition to enabling leukocytes
to adhere to endothelium, adhesion molecules are also involved in intracellular
signal transduction. Leukocyte responses to integrin engagement have been extensively studied, while responses of endothelial cells have received much less attention. Nevertheless, leukocyte adhesion is known to be associated with alterations
in the functional state of endothelium, affecting surface protein expression, secretory function, permeability to macromolecules, and leukocyte transmigration.
These responses are associated with intracellular signals, including cytoskeletal
modification, protein phosphorylation, and calcium influx.
Transcriptional regulation, a critical basal mechanism in fundamental biologic
processes, requires the participation of several classes of proteins: those that binds
specific DNA sequences, those associate with transcriptional regulators through
protein-protein interactions (coactivators or corepressors) and those that perform
an architectural function. Collectively, these proteins interact with the components of the basal transcription apparatus to affect gene transcription. In addition,
it has been widely shown that most cytokines action involves the activation of
transcription factors (e.g. NF-κB, AP-1) and protein kinases (e.g. PKA and PKC)
that in turn, regulate the expression of many target genes, indispensable to the
maintenance of the inflammatory state and are involved in the pathophysiology of
inflammatory diseases (Kleinert et al., 1998; Hanada & Yoshimura, 2002).
39
Introduction
1.7.1
cAMP-response element(CRE)-binding protein (CREB)
Another important transcription factor is the cAMP-response element (CRE) binding protein (CREB). CREB is a 43 kDa nuclear transcription factor member of a
family of cAMP-responsive activators. In mammalian systems this family includes also the activating transcription factor 1 (ATF1) and the cAMP response
element modulator (CREM)(Mayr & Montminy, 2001).
As indicates by its name, CREB is activated by phosphorylation in response
to, among other signals, cAMP. The accumulation of cAMP in response to activation of guanine-nucleotide-binding (G)-protein-coupled receptors induces most
cellular responses through the cAMP-dependent protein kinase (PKA).
The primary structure of the CREB family reveals a centrally located 60 amino
acid kinase inducible domain (KID). This domain contains the a PKA phosphorylation site (RRPSY) as well as several potential phosphorylation sites for casein
kinase I and II (Brindle et al., 1993; de Groot et al., 1993). There is also a basic
region of leucine zipper (bZIP) dimerization domain located at the carboxy terminally site in all members of the family.
Phosphorylation of the serine residue at 133 (Ser 133), promotes recruitment
of the transcriptional co-activator CBP and its paralogue p300 (Kwok et al., 1994;
Arias et al., 1994). It was demonstrated that Ser 133 phosphorylation is response
to cAMP stimulation is sufficient to induce target gene expression through promoters containing only CRE site. At the same time additional promoter bound
factors seems to be required for gene activation by CREB in response to mitogen
and stress signals. This cooperative interaction permits the efficient recruitment
of CBP (Mayr et al., 2001).
At the basal state, PKA resides in the cytoplasm as an inactive heterotetramer
of paired regulatory (R) and catalytic (C) subunits. Induction of cAMP liberates
the C subunits, which passively diffuse into the nucleus and induce cellular gene
expression by phosphorylating CREB at serine residue 133 (Figure 1.11).
40
The mechanism by which the cAMP-signaling pathway can achieves specificity include:
• compartmentalization of PKA via binding to scaffolding proteins;
• regulated expression of the distinct regulatory and catalytic subunit according cell and tissue;
• differential combinations of the regulatory and catalytic subunit isoforms.
It has been reported that specific localization and association of PKA type I is
activated on the cytoplasm and by a downstream pathway activated CREB phosphorylation that induced gene transcription (Constantinescu et al., 2002).
Furthermore, it has been demonstrated this transcription factor is necessary
for the activation and induction of several targets genes. Among them, VCAM-1
(Ono et al., 2006), E-selectin were reported to be regulated by this transcription
factor on endothelial cells (Gerritsen et al., 1997).
Recent results in HUVEC cells demonstrated that after TNF-α stimulation the
E-selectin gene activation is dependent of CBP and the closely related factor p300
that can interact with p65. The induction is dependent of chromatin remodeling by
selective histone modification involving hyper-acetylation, phosphorylation and
methylation (Edelstein et al., 2005).
1.7.2
NF-κB
NF-κB is an important transcription factor that plays a central and evolutionary
conserved role in many cellular responses to environmental changes. Several
pro-inflammatory genes involved in controlling, for example, cell adhesion, immune stimulation, apoptosis, chemoattraction, differentiation, extracellular matrix
degradation, redox metabolism, and production of mediators have been shown to
41
Introduction
Figure 1.11: Activation of the cAMP-CREB signalling pathway. Induction of adenylyl cyclase (AC) by ligand (L)-bound receptor (R) proceeds through activation of the heterotrimeric G
protein (G). Increases in the levels of cellular cAMP promote dissociation of the protein kinase A
(PKA) heterotetramer, which consists of paired regulatory (R) and catalytic (C) subunits. Liberated C subunits migrate into the nuclear compartment by passive diffusion and phosphorylate the
cyclic AMP response element (CRE)-binding protein (CREB) at a single phospho-acceptor site,
Ser133. The phosphorylation promotes transcription by recruitment of the co-activator CREBbinding protein (CBP). CBP mediates transcriptional activation through its association with RNA
polymerase II (Pol II) complexes and through intrinsic histone acetyltransferase activity. Target
gene activation is terminated by the serine/threonine phosphatase PP-1-mediated dephosphorylation of CREB. From (Mayr et al., 2001)
42
be regulated by NF-κB (Kempe et al., 2005).
NF-κB exists in the cytoplasm of the majority of cell types as homo (Fujita
et al., 1992) or heterodimers (Inoue et al., 1991; Urban et al., 1991) of a family
of structurally related proteins. Five proteins belonging to the NF-κB family have
been identified in mammalian cells: p65 (RelA), c-Rel, RelB, p50/p105 (NF-κB1)
and p52/p100 (NF-κB2). The first three are produced as transcriptionally active
proteins; the latter are synthesized as longer precursor molecules of 105 and 100
kDa respectively, which are further process to the smaller, transcriptional active
forms by processed that are not fully understood (Ghosh et al., 1998).
Each member of this family contains a conserved N-terminal region called
the Rel-homology domain (RHD) and the nuclear localization signal (NLS). The
RHD domain is responsible for DNA binding (Schreck et al., 1990), dimerization
and association with the inhibitory proteins (Verma et al., 1995)(Figure 1.12).
NF-κB dimers are sequestered in the cytosol of unstimulated cells via noncovalent interactions with a class of inhibitory proteins called IκB. These proteins
also comprise a structurally and functionally related family of molecules (Verma
et al., 1995).
Seven IκB molecules have been identified: IκBα, IκBβ, IκBγ, IκBε, Bcl-3,
p100 and p105 (Baeuerle, 1998b; Link et al., 1992). All known IκB proteins contain multiple copies of a 30–33 amino acid sequence called ankyrin repeats; and
the specific interaction between the ankyrin repeats and the RHD is the defining
feature of the association between NF-κB and IκB. Through these associations,
IκB molecules mask the NLS of NF-κB. Thus, IκB degradation would simply
lead to unmasking of the NLS, allowing free NF-κB dimers enter the classical
nuclear import pathway (Verma et al., 1995).
The nuclear translocation of this protein complex may be due to cellular stimulation with inflammatory cytokines, phorbol esters, UV radiation. The phosphorilation, ubiquitination, and proteosomal degradation of IκB causes the nuclear
43
Introduction
Figure 1.12: Schematic Presentation of NF-κB and IκB Structure. The numbers refer to the
ankyrin repeats. Right circles represent p50 and left circles p65 with their two Ig-like domains.
Dashed lines indicate sequences missing from the structures. RHD, rel homology domain; P,
phosphate groups on serines 32 and 36; C and N, C and N termini of the three proteins. Shown 1
to 6 IκBα domains. From (Baeuerle, 1998b)
44
translocation and is involved into the inflammatory response by induction of different genes (Ghosh & Karin, 2002).
TNF-α and IL-β act as a primary endogenous inducers of NF-κB. When cells
are exposed to those pro-inflammatory cytokines, a cascade of events leads to the
phosphorylation and subsequent degradation of IκB. As the result, NF-κB is liberated and can enter to the nucleus for gene expression activation. The stimulation
and activation of NF-κB do not require protein synthesis, there is a rapid and efficient induction of target genes (May & Ghosh, 1998).
Activation of NF-κB through IκB phosphorylation and degradation depends
on IκB kinases (IKKs) activity (May & Ghosh, 1998). The IKK complex is composed of three subunits, the catalytic subunits IKKα (IKK1) and IKKβ (IKK2)
and the regulatory subunit IKKγ (IKKAP or NEMO, NF-κB essential modulator),
and was originally identified as a high-molecular-weight kinase complex able to
phosphorylate serines 32 and 36 of IκBα (Verma et al., 1995).
There is evidence that IkBα, which is very rapidly resinthesized after degradation, can enter to the nucleus and remove IκBα from DNA. The discovery of
the leucin rich nuclear export sequences (NES) supported this idea (ArenzanaSeisdedos et al., 1997). The inactive complex is then transported back into the
cytoplasm or degraded in the nucleus thereby completing a cycle of activation and
inactivation of NF-κB. However, NES sequence was not found in IκBβ (Malek
et al., 2001), protein that was shown to be functional equivalent to IκBα (Cheng
et al., 1998). Futhermore, the mechanism responsible for the nuclear uptake remained controversial. Moreover, the biological significance of this process its yet
to be establish.
On the other hand, it was demonstrated a basal phosphorylation of IκBα in
un-stimulated cells. This basal phosphorylation occurs at the carboxy-terminal
casein kinase II sites. The presence of free IκBα in un-stimulated cells would
prevent rapid induction and reduce the sensitivity of the NF-κB system (Barroga
et al., 1995). It is important to note that IκBα in its un-stimulated state is con45
Introduction
tinuously turning over (Rice & Ernst, 1993; Henkel et al., 1993; Miyamoto et al.,
1994). The half-life of IκBα is ∼2.5 hr in the 70Z/3 murine pre-B cell line, making it a very unstable protein (Miyamoto et al., 1994). Moreover, the half-life of
Rel/NF-κB is much longer in the same cells (Miyamoto et al., 1994). This is in
agreement with an earlier observation that NF-κB is regulated by a labile inhibitor
(Sen & Baltimore, 1986). Additionally, it explains why inhibition of protein synthesis results in NF-κB activation (Sen & Baltimore, 1986). If IκBα turning over
faster than NF-κB, the lack of IκBα synthesis will eventually lead to the presence
of free NF-κB.
Recently, it was shown that IκBα was able to regulate other pathways such
as p53, a tumor suppressor protein, by preventing the p53 nuclear translocation.
The C terminal of IκBα enhanced cell dead, which suggests that may be a proapoptotic protein. Interestingly, the relationship of NF-κB, p53 and IκBα and the
mechanism remains to be determined (Li et al., 2006).
An aspect of the NF-κB system that has not been extensively studied is the
kinetics of nuclear translocation of NF-κB proteins following activation. Although complete IκBα degradation and maximum DNA-binding activity appears
in <10 min following stimulation in some cells, the amount of NF-κB proteins
that translocate into the nucleus within the same period is <l0%-20% of total NFκB proteins (Miyamoto et al., 1994). A possible explanation for this effect is that
some NF-κB proteins may be associated with other IκB proteins, such as IκBβ,
Bcl-3, p105, and p100. Also, the nuclear translocation machinery may reach a
saturation point. Additionally, there may be others unexplored regulatory steps
important for the nuclear translocation.
Anti-inflammatory inhibition of NF-κB
Inhibitors of NF-κB activation are useful tools for elucidating molecular mechanism involved in gene expression. The regulatory role of NF-κB in inflammatory
pathways can be further characterized when several mechanistically distinct in46
hibitors are studied in the same model of gene expression.
Several steps of the NF-κB signal transduction pathway can be targeted by
various inhibitors:
• IKK activation;
• IκB phosphorylation and degradation;
• NF-κB nuclear translocation and transcriptional activity.
Several studies demonstrated that different molecules were able to inhibit NFκB pathway. This molecules were classified according the structure and activity include: aspirin, salicylates, nonsteroidal anti-inflammatory drugs, glucocorticoids, antioxidants, proteasome inhibitors, antisense oligodeoxynucleotides, natural compounds and cell penetrating peptides (Delhalle et al., 2004). All of them
were reported to function through distinct mechanisms in vivo and in vitro as are
summarized in Table 1.1.
The generation of reactive oxygen species (ROS) by phagocytic leukocytes
(neutrophils, monocytes, macrophages, and eosinophils) is one of the most important hallmarks of the inflammatory process. By oxidizing essential cellular
components of invading pathogens, reactive radicals and oxidants also represent
the first line of defense against microorganisms (Hensley et al., 2000). In addition, to promoting general cytotoxicity, ROS may also act to up-regulate proinflammatory gene expression by activating NF-κB, a process that is itself sensitive to the cellular redox state (Schoonbroodt & Piette, 2000). Diverse agents that
cause oxidative stress can activate NF-κB (Schreck et al., 1991; Zhang & Chen,
2004) and numerous stimuli that activate NF-κB, including cytokines, phorbol esters, LPS, and CD3 engagement, increase the levels of intracellular ROS (Bowie
& O’Neill, 2000a). Although evidence for the role of ROS in pro-inflammatory
NF-κB activation remains circumstantial, more convincing studies demonstrated
that a variety of antioxidant molecules, such as N-acetylcysteine (NAC), dithiocarbamates, vitamin E derivatives, and glutathione peroxidase, can inhibit NF-κB
47
Introduction
Table 1.1: NF-κB inhibitors that demonstrate anti inflammatory activity in experimental
models
Class
Salicylates
aspirin, sulfasalazine, triflusal
NSAIDs
ibuprofen, sulindac, tepoxalin
Glucocorticoids
dexamethasone, hydrocortisone
Anti-sense oligodeoxynucleotides
anti-p50, anti-p65
Transcription factor
decoy-oligodeoxynucleotides
Natural compounds
flavanoids, polyphenols, sesquiterpene lactones, curcumin, sesterterpene
Antioxidants
PDTC, N-acetylcysteine, Vitamin
E, Vitamin C
Proteasome inhibitors
lactacystin, MG132, TLCK, TPCK,
PSI, PS-519, PS341
Peptides
SN50, NLS, NBD, TIRAP
In vitro
In vivo
Synovial fibroblast, lung epithelial
cells, dendritic cells, monocytes,
macrophages, T-cells, endothelial
cells, vascular smooth muscle cells.
Contact hypersensitivity, zymosan-induced
paw inflammatio
Macrophages, endothelial cells, Tcells
Zymosan-induced inflammation in the paw
and spinal cord
Macrophages, endothelial cells,
pulmonary epithelial cells, T-cells
Carrageenin-induced air pouch, peritoneal
sepsis, myocardial contractile depression
Fibroblast, B-cells, T-cells
Graft rejection, septic shock
Endothelial cells, vascular smooth
muscle cells, macrophages
Rheumatoid arthritis, ischemia-reperfusion
injury, nephritis, carrageenin-induced paw
inflammation, Arthus reaction
T-cells, macrophages, fibrosarcoma
and epithelial cells
Septic
shock,
inflammation
Macrophages, monocytes, T-cells
Septic shock, neutrophilic alveolitis, multiple organ injury, experimental allergic
encephalomyelitis
Macrophages, monocytes, T-cells,
B-cells
Asthma, septic shock, neutrophilic alveolitis, cerebral and myocardial ischemiareperfusion injury
Macrophages, T-cells, endothelial
cells, vascular smooth cells
Septic shock, zymosan-induced peritonitis, PMA-induced ear edema, carrageenininduced paw inflammation, Arthus reaction,
inflammatory bowel disease
48
TPA-induced
skin
activation (Szotowski et al., 2007; Bowie & O’Neill, 2000b).
Indeed, dithiocarbamates are widely used in basic and clinical resarch and
seams to be more potent and effective than others antioxidants as NAC and glutathione (GSH) (Zhu et al., 2002). In agree with different studies, the antioxidant
molecular mechanism of NAC and dithiocarbamates is different. In a study conducted in human pulmonary vascular endothelial cells that had been pre-incubated
with NAC and stimulated with TNF-α. NAC attenuated TNF-α induced activation of the mitogen-activated protein (MAP) kinase cascades and in these way
intracellular GSH levels were increased (Hashimoto et al., 2001). However NAC
effects as antioxidants on endothelial cells through NF-κB pathway seams to be
controversial an not fully understood (Schubert et al., 2002).
Pyrrolidine dithiocarbamate (PDTC) is a NF-κB inhibitor (Schreck et al., 1992).
It was demonstrated that PDTC treatment prevents IκBα degradation, thereby
blocking NF-κB activation (Tamada et al., 2006). Indeed, PDTC does not lead
to the appearance of a newly phosphorylated IκBα variant, suggesting that the
drug blocked phosphorylation. In addition to IκBα degradation, phosphorylation
is necessary for NF-κB activation but not for the direct release of IκBα. The
modification seems to dramatically enhance the rate of proteolytic breakdown by
proteosome (Traenckner et al., 1994). Additionally, PDTC can inhibits NF-κB
induction by lipopolisaccharide. In this way regulates the expression of endogenous tissue factor, a glycoprotein receptor for coagulation factors VII and VIIa on
HUVEC cells (Orthner et al., 1995). Moreover, PDTC is able to inhibit specifically the production of IL-6, IL-8 and granulocyte macrophage colony stimulating
facto in response to inflammatory mediators on HUVEC cells (Muoz et al., 1996).
As described previously, E-selectin, ICAM-1 and VCAM-1 expression are
under the control of NF-κB signalling (Hanada & Yoshimura, 2002; Lin et al.,
2007) . The combined treatment of cytokines such as TNF-α and IL-1β induced
the expression of these genes on HUVEC cells. The NF-κB role was confirm by
over-expression of dominant negative inhibitor IκB protein and also by combinatory treatment with several inhibitors (PDTC, dexametasone and others)(Kuldo
49
Introduction
et al., 2005). However, NF-κB contribution for VCAM-1 and ICAM-1 expression
is still controversial (Zerfaoui et al., 2008). Others inflammatory markers such as
NO levels and the inducibel nitric oxide synthase are under the control of NF-κB
signalling (Beck & Sterzel, 1996).
Thus, different antioxidants inhibit NF-κB activation via multiple mechanisms,
which may depend on the properties of the antioxidant, its specific target in the
treated cell, or the origin of the treated cells. Development of novel NF-κB inhibitory drugs bares an important significance in the prevention and treatment of
cardiovascular diseases. Natural antioxidants originated have a huge advantage
over existing drugs being non-toxic and inexpensive. Their potency as NF-κB
inhibitors on endothelial cells, and the novel mechanism of activation, provide a
strong rational for further studies both in vitro and in vivo.
50
Chapter 2
AIM OF THE STUDY
Several clinical observations pointed out the critical role of bilirubin on the risk
of cardiovascular atherosclerotic disease. It remains unclear whether modestly
elevated or high normal levels of serum bilirubin (as in Gilbert’s syndrome) are
protective or harmful in non-hepatic diseases.
It has been proposed that the antioxidant properties of bilirubin against atheromatous disease might be exerted at multiple steps preventing: the peroxidation of
lipoproteins in the intima, the oxidation of membrane phospholipids in the endothelial cells and macrophages or even the activation of metalloproteinases in
the intima (Rigato et al., 2005).
Indeed, bilirubin might also act as a second messenger and not merely as a
pharmacological compound. It was shown that bilirubin might have a direct regulatory effect by binding the aryl hydrocarbon receptor (Seubert et al., 2002) or
indirectly by activation of constitutive androstane receptor (Huang et al., 2004).
Bilirubin, that so far was regarded as a waste product of heme metabolism,
must be consider as an active molecule with many unexplored functions and therapeutic potential.
The aim of this study is to investigate the effect of the unconjugated bilirubin
(UCB) in the endothelial dysfunction, as the earliest event in the development of
the atherosclerotic disease. Specifically, UCB effects on the nitric oxide metab51
Aim of the Study
olism, the vascular adhesion molecules expression and the main signaling pathways involved in the inflammatory response. The main goal of the present work
is to elucidate the bilirubin molecular mechanism involved in the atheromatous
diseases that correlates with the previous epidemiological evidence.
52
Chapter 3
MATERIALS AND METHODS
3.1
Endothelial Cells
The vascular endothelium is a single layer of cells lining the inside face of all
blood vessels and constitute an important metabolic organ which is critically involved in the generation and the regulation of multiple physiological and pathological process such as inflammation, atherosclerosis and angiogenesis (Pratico,
2005).
Endothelial cells are dynamic and have both metabolic and synthetic functions. They exert significant autocrine, paracrine and endocrine actions and influence smooth muscle cells, platelets and peripheral leucocytes (Cines et al., 1998).
The endothelium is sensitive to growth factors and exchanges messengers with
blood and sub-endothelium, the extracellular matrix and the smooth muscle cell
of the media in large vessels (Nathan & Sporn, 1991).
Even cells from the same part of the vasculature can have varied responses.
It is also important to note that responses of cultured endothelial cells may not
reflect responses seen in the same cells in vivo, and the immortalized endothelial
cell lines used in many laboratory studies may, in particular, have altered expression patterns of key markers compared with cells studied in vivo.
In the present study a murine microvascular endothelial cells (H5 V) was used.
This cell line is a transformed endothelial cell line from heart mice with a retro53
Figure 3.1: Morphology of H5 V cells in vitro. H5 V 10X Normal Light
viral construct encoding polyoma middle-sized T antigen (Garlanda et al., 1994)
(Figure 3.1). To further confirm our data, a human umbilical vein endothelial cells
(HUVEC), isolated from the vein of the umbilical cord (Booyse et al., 1981; Jaffe
et al., 1973) (Figure 3.2) was also considered.
3.2
Materials
Unconjugated bilirubin (UCB)(Sigma Chemical Co, St. Louis MO), was purifeied as described by McDonagh and Assisi (McDonagh & Assisi, 1972). Dulbecco’s Phosphate saline, Dulbecco’s modified Eagles’s medium high glucose
(DMEM/High glucose), penicillin and streptomycin were purchased from Euroclone U.K. and Fetal calf serum was obtained from Invitrogen Carlsbad, California.
Chloroform (99%) was obtained from Carlo Erba Milan, Italy. Fatty acid free
bovine serum albumin (BSA), tetrazolium salt (MTT), DMSO, TNF-α, and all
other reagents and chemicals were purchased from Sigma-Aldrich Italy Milan,
Italy.
54
3.3 UCB solutions
Figure 3.2: Morphology of HUVEC cells in vitro. HUVEC 40X Normal Light
3.3
UCB solutions
The free (unbound) plasma bilirubin concentration (Bf), a little fraction of total
bilirubin concentration, is the principal determinant of tissue uptake and toxicity.
However, methods to estimate the Bf from medium has rarely been performed
(Nelson et al., 1974; Jacobsen & Wennberg, 1974). Indeed, in most of the in vitro
studies of cellular toxicity the UCB levels were higher than those seen in physiological and pathophysiological conditions (Ostrow et al., 2003b).
Recently, in our group the Bf bilirubin levels in tissue culture media were evaluated by a standardization of peroxidase method (Roca et al., 2006). The methods
involves minimal dilution of the sample, minimizing the effect of dilution of the
albumin concentration on the binding affinity (Ahlfors, 1981). The effects of albumin concentration on bilirubin-albumin binding measured were evaluated by the
peroxidase method in order to reproduce different physiologic Bf levels. The molar ratio of UCB and bovine serum albumin (BSA 30 µM) was tested in DMEM
high glucose in order to obtain variable doses of Bf (Figure 3.3). Similar results
were obtained with M199 medium used in HUVEC culture.
55
Figure 3.3: Relationship of Bf to UCB with three different albumin preparations.(N) FCS
10%, (2) BSA 30 µM, () HSA 30 µM. Data represent the mean ±SD of three independent
experiments in triplicate. From (Calligaris et al., 2007)
56
3.4 Culture conditions
Purified UCB was dissolved in chloroform at a concentration of 0.85 mM
and aliquots were dried under nitrogen. Immediately before each incubation, an
aliquot was dissolved in DMSO (0.3 µL of DMSO per µg of UCB, and diluted
with serum free medium containing 30 µM bovine serum albumin (BSA).
Experiments were performed with two final UCB concentrations of 2.5 and
5 µM, yielding unbound UCB concentrations (Bf) calculated to be respectively
15 and 30 nM. In order to standardize DMSO-related effects, a further volume
of DMSO was added to the final solution to reach an equal total amount in all
treatment groups. To minimize photo-degradation, all the experiments with UCB
were performed under light protection (dim lighting and vials wrapped in tin foil).
3.4
Culture conditions
H5 V cells were grown up to ∼80% of confluence in Dulbecco’s Modified Eagle’s Medium High Glucose (DMEM) containing fetal calf serum (10% vol/vol),
penicillin (100 U/mL) and streptomycin (100 g/mL). After confluence cells were
washed three times with PBS and then incubate in six different combinations of
adducts:
• Control group: serum free medium containing BSA (30 µM) and DMSO
(0.29% v/v).
• TNF alone group: add TNFα 20 ng/mL, serum free medium, BSA, DMSO.
• UCB 15 alone: add UCB at Bf 15 nM, serum free medium, BSA, DMSO.
• UCB 30 alone: add Bf 30 nM, serum free medium, BSA, DMSO.
• Co-treatment UCB 15-TNF: add Bf 15 nM, TNFα 20 ng/mL, serum free
medium, BSA and DMSO.
• Co-treatment UCB 30-TNF: add Bf 30 nM, TNFα 20 ng/mL, serum free
medium, BSA and DMSO.
57
Human Umbilical Vein Endothelial Cells (HUVEC) were kindly gifted by
Prof. F. Tedesco from Dept. of Physiology an Pathology University of Trieste.
Cells were cultured in medium M199 with Hanks’ salt and NaHCO3 (SIGMA
M7653) enriched with fetal calf serum (20%), bovine cerebral extraction (50
µg/mL, gifted by Prof. F. Tedesco) (Maciag et al., 1979), Na-heparin (50 µg/mL,
EPSOCLAR, Biologici Italia Laboratory Srl, Milan, Italy), penicillin (100 U/mL)
and streptomycin (100 µg/mL). Cells were grown up on 25 cm 2 plastic flasks covered with gelatine (1%, SIGMA G-9391) in sterile bidistilled water (v/v). Cells
were used for experiments between the 4th and 6th cell passage. Cells were treated
in the same conditions as described previously for H5 V cells.
3.4.1
Cytokines treatment
Cytokines represent a group of multi-functional substances that could be involved
in the initiation and amplification of the inflammatory process regulating the expression of many target genes. Human TNF-α, one of the pro-inflammatory cytokine, was added to the culture in order to describe UCB contribution on its
effects. TNF-α time and dose response were determined as indicated in Table 4.2
and Table 4.3.
3.5
Endothelial cell susceptibility
In this part of the study, different endothelial susceptibility to UCB and TNF-α in
the two cell lines (HUVEC and H5 V) was analyzed. The approaches used for this
point to test cytotoxicity were:
• assess of Lactate Dehydrogenase (LDH) release, to evaluate the presence
and degree of membrane damage;
• analysis of Mitochondrial Toxicity by MTT test (Liu et al., 1997).
3.5.1
LDH release test
Lactate dehydrogenase (LDH) is a stable cytoplasmic enzyme rapidly released
into the cell culture supernatant upon the damage of the plasma membrane (Hu &
58
3.5 Endothelial cell susceptibility
E., 1970).
The Cytotoxicity Detection Kit (LDH, ROCHE Applied Science, Penzberg,
Germany) was used to detect the cell damage. This kit allows to measure the LDH
activity by a colorimetric reaction. In the first step NAD+ is reduced to NADH/H+
by the LDH-catalyzed conversion of lactate to pyruvate. In the second step the
catalyst (diaphorase) transfers H/H+ from NADH/H+ to the tetrazolium salt INT
(2-[4-iodophenyl]-3- [4-nitrophenyl]-5-phenyltetrazolium chloride) which is reduced to formazan. The formazan formed during the reaction is proportional to
the number of lysed cells and shows a maximum absorption at about 500 nm light
length.
The H5 V monolayers cells were cultured on 24-well plates and treated for 24
hours, as indicated in the Table legend 4.1, with different UCB concentrations
with or without TNF-α (20 ng/mL).
The culture media was kept for this assay and cells were lysated with 1% Triton X-100. 50 µl of the supernatant and equal amount of the lysate cells were
incubated with the reaction mix for 20 minutes protected from light at room temperature. The absorbance of the samples at 490 nm was determined in a LD 400C
Luminescence Detector (Beckman Coulter S.p.A, Milan, Italy). Results were expressed as percentage of the maximum amount of releasable LDH, obtained by
lysing cells.
3.5.2
Mitochondrial toxicity by MTT test
One of the most frequently used methods for measuring cell proliferation and cytotoxicity is the reduction of 3(4,5-dimethyltiazolyl-2)-2,5 diphenyl tetrazolium
(MTT), a monotetrazohum salt (Mosmann, 1983).
H5 V and HUVEC cells were cultured on 24-well plates and treated for variable periods of time, as indicated in the Figure legend 4.1, with different UCB
concentrations with or without TNF-α (20 ng/mL).
59
A stock solution of MTT was dissolved in PBS pH 7.4 at 5 mg/mL. MTT solution was further diluted to 0.5 mg/mL in DMEM/High Glucose without phenol
red to avoid interference with the plate reading. Cells were incubated with DMEM
containing MTT for 2 hours at 37 ◦ C. At the end of incubation period, the medium
was replaced with the addition of 1 ml isopropanol/HCL 0.04 M, to dissolve MTT
formazan crystals. Samples were then gently shacked in an orbital shaker for 2
hours at 37 ◦ C. After centrifugation at 10,000 RPM for 3 min, absorbance values,
at a length light of 570 nm, were determined in a LD 400C Luminescence Detector (Beckman Coulter S.p.A, Milan, Italy). Results were expressed as percentage
of control cells, not exposed to UCB, which was considered as 100% viability.
3.6
Endothelial dysfunction analysis
The different markers for endothelial dysfunction were evaluated by:
• measurement of Nitric Oxide levels;
• gene expression analysis of the adhesion molecules and Nitric oxide Synthase enzymes;
• protein expression analysis of the adhesion molecules.
3.6.1
Nitric oxide
Nitric oxide (NO) is unstable in an aerobic environment. The most commonly
employed methods for analysis of NO in aqueous solutions are the colorimetric
assays by Griess reagent. Through the years, modifications to the original reaction
described by Griess in 1879 have been reported (Nims et al., 1996; Cook et al.,
1996).
This methodology is based on the fact that free NO, reacts with oxygen to
yield reactive nitrogen oxide intermediates that can subsequently oxidize or nitrosate various substrates. In aerobic aqueous solution several stable and nonvolatile breakdown products can be detected, among them nitrate NO3– and sub60
3.6 Endothelial dysfunction analysis
Figure 3.4: Chemistry of the Griess Reagent. Chemical reactions involved in the measurement
of NO2– using the Griess Reagent system
sequently nitrite NO2– (Green et al., 1982).
The colorimetric assay for evaluating NO concentration depends on the nitrosative properties of the NO intermediates NO2– . The nitrosation of sulfamide by
acidic nitrite solutions in the presence of naphthylethylenediamine dihydrochloride (NEDD) results in an azo dye with absorption maximum at 540 nm light
length (Figure 3.4).
H5 V and HUVEC cells were cultured on 6-well plates and treated for variable
periods of time, with different UCB concentrations with or without TNF-α (20
ng/mL) as indicate in Table 4.3 and Figure 4.2.
Culture media was kept for the assay, the absorbance was determined at 540
nm in a spectrophotometer Beckman DU 640 (Beckman Coulter S.p.A, Milan,
Italy). Values were compared against a standard curve with increasing concentrations of nitrite (1.56 to 100 µM). Cell lysates were stored for protein determination by Bicinchoninic Acid Protein Assay (BCA)(Smith et al., 1985) following
the procedure’s instructions (B-9643, SIGMA). Results were expressed as nmol
NO2– mg/mL protein.
61
3.6.2
Gene expression analysis
RNA extraction
H5 V and HUVEC cells were cultured on 6-well plates and treated for 2, 6 and
24 hours, with different UCB concentrations with or without TNF-α (20 ng/mL).
Total RNA was isolated by Tri Reagent solution according to the manufacture’s
suggestions (SIGMA, Missouri, USA. T9424). The total RNA concentration and
the purity were quantified by spectrophotometric analysis in a Beckman DU640.
For each sample the A260 /A280 ratio comprised between 1.8 and 2.0 was considered as good RNA quality criteria. The integrity was determined by agarose
gel electrophoresis and staining with ethidium bromide, indicating that the RNA
preparations were of high integrity. Isolated RNA was dissolved in RNAse free
water and store at −80 ◦ C until analysis.
mRNA Quantification by Real-Time RT-PCR
Expression analysis of target gene were performed by Real Time RT-PCR technology, using specific primers for detection of the following markers of endothelial
dysfunction: eNOS, iNOS, ICAM-1, VCAM-1, E-selectin.
Retrotranscription using 1µg of total RNA was performed with an iScriptT M
cDNA Synthesis Kit (BIO-RAD Laboratories, Hercules, CA, USA Catalog # 1708891) according to the manufacture’s suggestions. The reaction was run in a Thermal Cycler (Gene Amp PCR System 2400, Perkin -Elmer, Boston, MA, USA) at
25 ◦ C per 5 min, 42 ◦ C for 45 min, 85 ◦ C for 5 min. The final cDNA was conserved
at −20 ◦ C until used.
Real-time RT-PCR was performed according to the iQ SYBR Green Supermix
protocol (Bio-Rad Laboratories). The selected genes and their primer sequences
for mouse and human are reported in Table 3.1, and Table 3.2, respectively. The
primers were designed using Beacon Designer 4.02 software (PREMIER Biosoft
International, Palo Alto, CA, USA). All primer pairs were synthesized by Sigma
Genosys (Cambridgeshire, UK).
62
Table 3.1: H5 V - Primer sequence designed for the mRNA quantification
Mouse - Gene
Accession number
Primer Forward
Primer Reverse
eNOS
NM 08713.2
GTGGAACAACTGGAGAAAGG
AAGGAGGCGAGGACTAGG
iNOS
NM 010927.1
TTGTGCGAAGTGTCAGTGG
TCCTTTGAGCCCTTTGTGC
Icam-1
NM 010493.2
TCCGCTGTGCTTTGAGAAC
GGTCCTTGCCTACTTGCTG
GGAGTCACAGCCAATAGC
Vcam-1
NM 011693.2
GGGAGAGACAAAGCAGAAG
E-selectin
NM 011345.1
GGTTCCTTCCTGCCAAGTG
GCCATTGAGCGTCCATCC
βACTIN
NM 007393.0
CCTTCTTGGGTATGGAATCCTGTG
CAGCACTGTGTTGGCATAGAGG
PCR amplification was carried out in 25 µL reaction volume containing 25 ng
of cDNA, 1 x iQ SYBR Green Supermix (100 mM KCL; 40 mM Tris-HCl; pH:
8.4; 0.4 mM each dNTP; 50U/mL iTaq DNA polymerase; 6 mM MgCl2 ; SYBR
Green I; 20 mM fluorescein; and stabilizers)(BIO-RAD Laboratories) and 250 nM
gene specific sense and anti-sense primers and 100 nM primers for 18S. Reactions
were run and analyzed on a Bio-Rad iCycler iQ Real-Time PCR detection system
(iCycler IQ software, version 3.1; Bio-Rad).
Cycling parameters were determined, and resulting data were analyzed by using the comparative Ct method as means of relative quantification. The relative
quantification was made using the Plaffl modification of the ∆∆Ct equation (Pfaffl,
2001; Tichopad et al., 2004). The relative gene expression levels of each transcript
were determined by comparison with a standard curve. The genes were normalized by dividing the expression value of a housekeeping gene βactin for H5 V cells,
hypoxanthine guanine phosphoribosyltransferase (HPRT) and βactin for HUVEC
cells. Melting curve analysis and gel electrophoresis were performed to check
product specificity. Results reported as indicated in the Figure legends represent
the mean of 3 different experiments.
3.6.3
Western blot
H5 V cells were treated as previosly described for 24 hours with different UCB
concentrations with or without TNF-α (20 ng/mL). Cells were then washed once
with PBS at room temperature and dissolved in cell lysis buffer, PBS containing
63
Table 3.2: HUVEC - Primer sequence designed for the mRNA quantification
Human - Gene
Accession number
Primer Forward
Primer Reverse
eNOS
NM 000603
CGGCGGAAGAGGAAGGAGTC
CCACGGCACGAGCAAAGG
iNOS
NM 000625.3
ATGACTCCCAGCACAAGG
GCCATCTCCAGCATCTCC
ICAM-1
NM 000201
GCTTCGTGTCCTGTATGG
CTGGCACATTGGAGTCTG
GCAACTGAACACTTGACTG
VCAM-1
NM 001078
GACCACATCTACGCTGAC
E-selectin
NM 000450
GGTTCCTTCCTGCCAAGTG
GCCATTGAGCGTCCATCC
βACTIN
NM 001101
CGCCGCCAGCTCACCATG
CACGATGGAGGGGAAGACGG
HPRT
NM 000194
CTGGAAAGAATGTCTTGATTGTGG
TTTGGATTATACTGCCTGACCAAG
1% v/v of a protease inhibitor cocktail from Sigma (P-8340) and 2 mM PMSF
(phenylmethylsulfonylfluoride). Cells were placed on ice and disrupted by ultrasonic sonication (Bandelin Sonoplus, HD2070, Berlin, Germany; 3 times at 5 s at
30% of power).
Protein concentration in the lysate was determined by the Bicinchoninic Acid
Protein Assay (BCA)(Smith et al., 1985) following the instructions reported by
the supplier (B-9643, SIGMA).
Equal amounts of protein (60 µg) were subjected to sodium dodecyl sulphatepolacrilamide gel electorphoresis (SDS-PAGE). Molecular weight standards (Precision Plus Protein dual color standards, Bio-Rad) were used as marker proteins.
Samples were immersed in a boiling water bath for 5 min and then immediately
settled on ice. Proteins were loaded on 10% polyacrylamide gel by electrophoresis in a Mini Protein III Cell (Bio-Rad, Hercules, CA, USA). After SDS-PAGE,
gels were electrotransferred with a semi-dry blotting system at 100 V for 120
min onto immune-blot PVDF membranes (Bio-Rad) using a Mini Trans-Blot Cell
(Bio-Rad).
Membranes were incubated overnight at 4 ◦ C with commercial antibodies (Table 3.3) that allow the specific recognition of Vcam-1 (Santa Cruz Biotechnology,
Inc., Santa Cruz, CA), Icam-1 (Santa Cruz Biotechnology), E-selectin (Santa Cruz
Biotechnology).
64
Table 3.3: Primary antibodies tested
Protein
Primary Antibody
Dilution
(Catalog #)
Vcam-1
sc-1504
1:500
Icam-1
sc-1511
1:500
E-selectin
sc-14011
1:250
Actin
A2066
1:2000
Antibodies were dissolved in a solution containing skim milk (5%) and TTBS buffer (Tris/HCL 20 mM, Tween 20, 0.2%, NaCl 500 nM, pH 7.5) at the
dilution reported in Table 3.3. After three washes with T-TBS, membranes were
incubated for 1 hour at room temperature with a secondary antibody (SigmaAldrich Italy Milan, Italy). The following antibodies were used: IgG-anti-goat
(dilution 1:4000) for Vcam-1 or Icam-1 and IgG-anti-rabbit (dilution 1:1000) for
E-selectin, all conjugated with peroxidase.
Proteins bands were detected by peroxidase reaction and visualized by exposure of membrane in the ECL-Plus Western Blot detection system solutions (ECL
Plus Western Blotting Detection Reagents, GE-Healthcare Bio-Sciences, Italy).
Membranes were incubated with a stripping buffer (0.5 mM Tris/HCl pH 6.8,
0.2 %v/v SDS, 0.68%v/v β-Mercaptoethanol) for 30 min at 55 ◦ C followed by
overnight incubation with a commercial antibody specific for Actin recognition
(Table 3.3, SIGMA) according to the procedure previously described. After repeated washes, the membranes were incubated with secondary antibody IgG-antirabbit peroxidase conjugated (dilution 1:5000), for 1 hour at room temperature.
The immunoreactivity was visualized as previously described, by ECL-Plus detection kit.
The intensities of the autoradiographic bands were estimated by densitometric
scanning using NIH Image software (Scion Corporation Frederick, MD, USA).
65
3.7
Signal transduction pathways
The transcription factors involved in the expression of markers for endothelial
dysfunction were evaluated by:
• use of Inflammatory inhibitors (PDTC - NAC);
• evaluation of of CREB phosphorylation;
• assessment of NF-κB (p65 subunit) nuclear translocation.
To study the role of UCB on NF-κB pathway, cells were treated with PDTC
(Pyrrolidine dithiocarbamate) a specific inhibitor NF-κB. H5 V cells were treated
for 2 hours with PDTC (10 µM) alone or with UCB, as described above, in the
presence or absence of TNF-α. Cells were pre-treated with PDTC 1 hour before
incubation with TNF-α. PDTC was dissolved in serum free medium on the day
of treatment. Cells were then collected and the mRNAs were extracted. The expression of AMs was evaluated by Real Time RT-PCR.
UCB effects on NO levels were also evaluated after 24 hours treatment with
NAC in the same culture conditions described previously. NAC solution was
freshly prepared on the day of treatment and adjusted to pH 7.4 by the addition of
8 M NaOH. NAC dose response were determined as indicate in Figure legends 4.5.
3.7.1
cAMP-response element(CRE)-binding protein (CREB)
The H5 V monolayers cells were cultured on 6-well plates and pre-treated for variable periods of time, as indicated in the Figure legends 4.21, with different UCB
concentrations with or without TNF-α (20 ng/mL). Proteins were collected and
a gel electrophoresis (SDS-PAGE) was performed as described in Western Blot
section.
The phosphorylated CREB at Ser 133 was detected by the PhosphoPlus CREB
antibody Kit (Catalog # 9190, Cell Signaling). The kit allowed the specific recog66
nition of the phosphorylation status of CREB at serine 133. Phospho-CREB specific antibody was used (dilution 1:500). The membranes were reprobed with an
antibody against total CREB (recognized phosphorylated and non phosphorylated
form) (dilution of 1:500). Secondary antibody IgG-anti-rabbit (dilution 1:1000)
conjugated with peroxidase was used. All antibodies were analyzed by the same
procedure previously described.
3.7.2
Preparation of total nuclear extracts
The total cytoplasmic and nuclear extracts were obtained by using minor modification of the Dignam’s method (Dignam et al., 1983). H5 V cells were seeded at
a density of 5x107 on 75 − cm 2 flasks and were treated with different UCB concentrations with or without TNF-α (20 ng/ml) for 30 minutes.
After treatment, the cells were collected by centrifugation at 800Xg for 10
min. The cells were resuspended in 400 µL cells ice-cooled solution A (10 mM
Hepes, pH 7.9, 0.1 mM MgCl2 , 10 mM KCl, 0.1 mM EDTA, pH 8, 0.1 mM
dithiotreitol, 0.5 mM phenylmethylsulphonyl fluoride, 1 mM Na orthovanadate
and 1 mM Na Fluoride). After 10 min ice incubation the cells were centrifuged at
800Xg for 5 min at 4 ◦ C. The supernatant containing the cytoplasm was collected
and stored at −80 ◦ C. The pellet containing nuclei was resuspended with solution
A and was centrifugated at 800Xg for 5 min at 4 ◦ C. The nuclear fraction was
resuspended in ice-cooled solution B (20 mM Hepes, pH 7.9, 420 mM NaCl, 1.5
mM MgCl2 , 0.2 mM EDTA, 5% glycerol, 0.1 mM dithiotreitol, 0.5 mM phenylmethylsulphonyl fluoride, 1 mM Na orthovanadate and 1 mM Na Fluoride). After
30 min ice incubation with constant stirring, the suspension was vortexed for 10
s, then centrifuged at 15,000Xg for 20 min at 4 ◦ C. The supernatant containing
nuclear extract was recovered and stored at −80 ◦ C.
The protein content of the extracts was determined by BCA method as described before. The nuclear and cytoplasmic extract fractions were analyzed by
SDS-page Western Blot.
67
Commercial antibody that allow the specific recognition of NF-κB p65 subunit(Catalog # SC-109, dilution 1:1000, Santa Cruz Biotechnology, Santa Cruz,
CA, USA) was used. To test nuclear enrichments, the presence of a nuclear matrix
protein p84 (Catalog # ab487, dilution 1:1000, Abcam, Abcam Inc., Cambridge,
MA, USA) was evaluated as marker (Portal et al., 2006). Secondary antibodies
conjugated with peroxidase (both from Sigma-Aldrich) IgG-anti-rabbit (dilution
1:2000), for NF-κB, and IgG-anti-mouse (dilution 1:2000), for p84, were used.
Both antibodies were analyzed by the same procedure previously described on
Western blot section.
3.8
Statistical analysis
All experiments were run in triplicate and repeated three times. Results are expressed as mean±SD. Oneway ANOVA with Tukey-Kramer post test was performed using GraphPad InStat version 3.00 for Windows 95 (GraphPad Software,
San Diego, CA, USA). Probabilities, ≤ 0.05 were considered statistically significant.
68
Chapter 4
RESULTS
4.1
Effects of UCB on cell viability
Bilirubin has been found to be toxic to many cell examined in vitro, including fibroblasts (Nelson et al., 1974), hepatocytes, erytrocytes, leukcocytes, liver (Czernobilsky & Dubin, 1965), HeLa (Shimabuku & Nakamura, 1983) and platelets(Amit
et al., 1992).
The effect of UCB and TNF-α on endothelial cell viability was evaluated.
Two different methods to analyzes cell viability were used, Lactate Dehydrogenase (LDH) release and Mitochondrial Toxicity (MTT) assay.
4.1.1
UCB did not affect the LDH release induced by TNF-α
The plasma membrane integrity was unchanged in presence of different doses of
UCB (Bf, 15, 30 and 100 nM). As expected, the addition of TNF-α (20 ng/mL)
significantly increased the extracellular LDH activity. However, no further effects
were observed when co-treatment TNF-α plus UCB were performed. Table 4.1
summaries the results obtained in H5 V cells.
4.1.2
UCB reduced endothelial cell viability
Based on the negative results of LDH and since MTT assay was demonstrated
to be a method more suitable for studying bilirubin cytotoxicity in a human liver
69
Results
LDH release (%)
UCB (Bf nM)
- TNF-α
+ TNF-α
Control
14.9±1.60
26.8±1.3∗
15
15.2±1.3
23.1±1.9∗
30
14.6±1.8
23.4±1.7∗
100
15.5±0.2
22.13±0.8∗
Table 4.1: Effect of UCB on cell viability - LDH release. H5 V cells were incubated with different doses of UCB (Bf 15, 30 and 100 nM), with or without treatment with TNF-α. Control cells
(UCB, Bf 0 nM) were treated as described in Materials and Methods. Cells were collected after 24
h of treatment, LDH released (%) into the cell medium was calculated. Results are expressed as
mean percentage values (%) of three independent experiment performed in triplicate. *: p< 0.05
versus control.
cell line (Ngai et al., 1998), H5 V cells were exposed to different doses of UCB
(Bf 15, 30 and 100 nM) with or without TNF-α (20 ng/mL) for 24 hours. Control cells were treated as described in Materials and Methods. UCB significantly
decreased H5 V vitality in a dose-dependent manner (Figure 4.1, D). However,
the co-treatment with TNF-α(20 ng/ml) did not modify UCB effects. Same results were obtained when cells were exposed to UCB with or without TNF-α (20
ng/ml) for 48 hours (data not shown).
In order to verify UCB effects on endothelial cell viability, HUVEC cells were
treated with different doses of UCB (Bf 15, 30 and 100 nM) with or without TNFα (20 ng/mL) for 2, 6 and 24 hours. Similarly to H5 V cells, UCB was able to
reduce endothelial cell viability in a dose dependent manner at 2 and 6 hours (Figure 4.1, A and B). Treatment for 24 hours greatly decreased the cell viability even
in control cells (Figure 4.1, C). Indeed, HUVEC cells have an initial reduction on
cell viability, even at 2 and 6 hours, due to the absence of fetal calf serum and
bovine cerebral extraction, conditions of control group (UCB, Bf 0 nM). This initial reduction of cell viability was significantly increased by treatment with TNF-α
alone. However, once UCB was add to the cell medium culture, co-treatment with
TNF-α(20 ng/mL) did not cause further effects.
70
4.2 Nitric oxide analysis
TNF-α
(ng/mL)
NO
(NO2– nmol/mg
protein)
0
5.0±0.80
2.5
4.4±0.16
5
4.4±0.30
10
4.2±0.60
20
3.5±0.35∗
40
3.6±0.34∗
Table 4.2: Effect of different doses of TNF-α on NO production. H5 V cells were incubated
with different doses of TNF-α (0, 2.5, 5, 10, 20, 40 ng/mL). Cells were collected after 24 h of
treatment. Results are expressed as NO2– nmol/mg protein and represent means±SD, n=3. *: p<
0.05 versus control group (TNF-α 0 ng/mL).
Based on these results, in the following experiments we decided to removed
the treatment with high doses of UCB (Bf 100 nM), in order to avoid excessive
loss of cell survival. To summarize, UCB reduced in a dose dependent manner
the cell viability in both cell lines. UCB toxicity was manifested by impaired
mitochondrial function (MTT activity). However, UCB did not cause change in
the cellular permeability or necrosis, base on LDH release assay.
4.2
Nitric oxide analysis
The effect of increasing concentrations of TNF-α on NO production in H5 V cells
was evaluated. While TNF-α up to a concentration of 10 ng/mL did not influence
the NO production at 24 hours, when the concentration was over 20 a significant
decreased on the NO concentration in the cell medium was observed. Table 4.2
summaries the results obtained in H5 V cells.
On the other hand, the secretion profile of NO to cell medium, in cells treated
with or without TNF-α (20 ng/mL) was also evaluated. A time depended NO
basal increased was reveled. The NO reduction with TNF-α was seen at all times
studied (12h 86%, 24h 76% and 48h 78%, p< 0.05). Table 4.3 summaries the
results obtained in H5 V cells.
71
Results
Figure 4.1: Effect of UCB on cell viability - MTT assay. HUVEC (A, B and C) and H5 V cells
(D) were incubated with different doses of UCB (Bf 15, 30 and 100 nM), with or without TNF-α.
Control cells (UCB, Bf 0 nM) were treated as described in Materials and Methods. Results are
expressed as mean percentage values (%) of three independent experiment performed in triplicate.
*: p< 0.05 versus control. #: p< 0.05 versus complete medium.
72
NO (NO2– nmol/mg protein)
Hours
- TNF-α
+ TNF-α
12
9.53±0.80
8.20±0.6∗
24
7.93±0.1
6.10±0.9∗
48
14.72±0.8
11.54±0.13∗
Table 4.3: Time dependent effect of TNF-α on NO production. H5 V cells were incubated
with TNF-α (20 ng/mL) for 12, 24 and 48 hours. Cell medium was collected after treatment. Results are expressed as NO2– nmol/mg protein and represent means±SD, n=3. *: p< 0.05 compared
to respective cells without TNF-α.
4.2.1
Effect of UCB on NO levels in H5 V cells
To study the putative role of UCB in NO concentration, nitrite (NO2– ) production
in culture supernatant was measured. Treatments with UCB at two different undersaturation concentrations of free bilirubin (Bf 15 and 30 nM) with or without
TNF-α (20 ng/mL), for 24 and 48 hours were performed. The time periods (24
and 48 hours) were considering eNOS half life, which is about 20 hours (Govers &
Rabelink, 2001). As demonstrated before, TNF-α at a concentration of 20 ng/mL,
significantly reduces nitrite levels. The significant reductions of nitrite content,
by treatments with TNF-α (20 ng/mL), was not reversed by the presence of any
doses of UCB after treatments for 24 hours (Figure 4.2, A). Interestingly, the
significant reductions of nitrite content in culture supernatant induced by TNF-α
was reversed after 48 hours by the presence of UCB, either a Bf of 15 or 30 nM
(Figure 4.2, B).
4.2.2
Effect of UCB on NOS mRNA expression
We investigated, by Real Time RT-PCR, whether or not UCB modifies the gene
expression of the two Nitric Oxide Synthases (NOS), constitutive (eNOS) and inducible form (iNOS) in endothelial cells.
The expression of eNOS was not influenced by the treatment with TNF-α (20
ng/mL) at 2, 6 and 24 hours (Figure 4.3, A). On the other hand, the addition of
TNF-α (20 ng/mL) increased the expression of iNOS at 2, 6 and 24 hours (Figure
73
Results
Figure 4.2: Effect of different doses UCB on NO production. H5 V cells were incubated
with different doses of UCB (Bf 15 and 30 nM), with or without TNF-α. Control cells (UCB,
Bf 0 nM) were treated as described in Materials and Methods. Cell medium was collected after
24 h (A) or 48 h (B) of treatment for NO2– levels determination. Results are expressed as mean
percentage values (%)±SD of control cell group, from three independent experiment performed
in triplicate.*: p< 0.05 versus control. #: p< 0.05 versus TNF-α alone group (UCB, Bf 0 nM plus
TNF-α).
74
4.3, B).
Co-treatments with TNF-α and UCB (Bf 15 nM) determined a slightly but significant reduction of mRNA expression at 2 hours (74%, p< 0.05). However, no
effect was seen in treatments with UCB alone. Interestingly, at 24 hours, the cotreatment with both UCB (Bf 15 and 30 nM) and TNF-α was able to increase the
levels of iNOS expression (160% and 126%, respectively) if compared to TNF-α
alone (considered as 100%) treatments (Figure 4.4).
According to this data we can postulate that UCB is able to modulate the
TNF-α effect on the induction of iNOS expression while as well as TNF-α, UCB
has been shown not be involved in the regulation of eNOS. These results suggest
that iNOS expression is affected by UCB treatments in biphasic regulation, which
could modify NO concentration at 48 hours. Such mechanism would constitute
a self-regulating pathway by which NO production from this NOS could be finetuned (Schwartz et al., 1997; Bogdan, 2001a).
4.2.3
NO levels in HUVEC cells
The same experiments were conducted in HUVEC cells. The NO levels were
undetectable by Griess’ assay. This result was also confirmed by an ion chromatography with suppressed conductivity detection (data not shown). Indeed, no
effects of either TNF-α (Table 4.4) or UCB (data not shown) were seen on eNOS
expression. Moreover, the mRNA expression of iNOS evaluated by Real Time
RT-PCR was undetectable in all the experimental conditions described in Materials and Methods.
4.2.4
UCB, the redox status and NO levels
ROS levels can be considered as molecular second messengers that could activate
or inhibit cell functioning depending on the intensity and duration of the oxidative
stress produced in the cell. As described previously, NO levels result from an imbalance between the synthesis and consumption. The quenching of NO by ROS
lead to the formation of reactive nitrogen species (Endemann & Schiffrin, 2004;
75
Results
Figure 4.3: TNF-α induces iNOS gene expression in H5 V cells. Effect of TNF-α (20 ng/mL)
on eNOS (A) and iNOS (B) mRNA gene expression on H5 V cells at 2, 6 and 24 hours. Bars represent fold of expression, obtained by real time RT-PCR, compared to control cells and normalized
to β-actin used as housekeeping gene. Results are representative of three independent experiments.
Values are mean ±SD. *: p< 0.05 versus control group.
76
Figure 4.4: Effect of UBC on TNF-α-induced iNOS gene expression in H5 V cells. Effect of
different doses of UCB (15 and 30 nM) with or without TNF-α (20 ng/mL) on H5 V cells. Cells
were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed by Real Time
RT-PCR. Results are expressed as mean percentage of folds of expression (%), related to TNF-α
(20 ng/mL) alone treatment, ±SD, n=3. *: p< 0.05 versus TNF-α alone treatment group.
77
Results
eNOS expression
Hours
- TNF-α
+ TNF-α
2
25.30±0.14
24.80±0.10
6
24.00±0.20
24.25±0.10
24
25.85±0.20
26.90±0.10
Table 4.4: Threshold cycle values of eNOS in HUVEC cells. Effect of TNF-α (20 ng/mL) on
eNOS mRNA gene expression in HUVEC cells at 2, 6 and 24 hours. Values are a representative set
of mean±SD threshold cycle values (Ct) obtained by Real Time RT-PCR reaction from samples
in triplicate. Data represent control group cells at 2, 6 and 24 hours.
Madamanchi et al., 2005).
In order to verify if the UCB effects on NO production were influences by
ROS, a set of experiments using NAC, a well known antioxidant, were done as
described in Materials and Methods. Nitrite (NO2– ) production in culture supernatant was measured as described before. iNOS and eNOS expression, were evaluated by Real Time RT-PCR.
H5 V cells were incubated for 2 hours with TNF-α (20 ng/mL) with or without NAC (10 mM). As expected, the expression of eNOS was not influenced by
TNF-α or NAC treatment (Figure 4.5, A). However, TNF-α induction on iNOS
mRNA expression was reverted in a dose-dependent manner by NAC. Moreover,
treatment with NAC 5 mM completely abolished TNF-α effects (Figure 4.5, B).
As previously established, TNF-α (20 ng/mL), significantly reduces nitrite
levels. In addition, significant reductions of nitrite content, was also observed after treatment with NAC (10 mM) alone. Interestingly, an additive inhibitor effect
was observed by co-treatments with TNF-α and NAC (Figure 4.6, A). These results can partially be explained by the regulation of iNOS expression. Treatments
with TNF-α (20 ng/mL) induced iNOS mRNA, as demonstrated before. However
when NAC, alone or in co-treatment with TNF-α, was added to the cell medium
a significant reduction of the iNOS expression was observed (Figure 4.6, B).
78
Figure 4.5: NAC reverted TNF-α effects on iNOS gene expression. H5 V cells were incubated
with different doses of NAC (50, 20, 10 and 5 mM) with or without TNF-α (20 ng/mL). eNOS (A)
and iNOS (B) mRNAs gene expression were evaluated after 2 hours of treatment. Bars represent
fold of expression, obtained by Real Time RT-PCR, compared to control cells and normalized to
β-actin used as housekeeping gene. Results are representative of two independent experiments.
Values are mean±SD.
79
Results
Genes
2h
6h
24h
E-selectin
23.03±0.05
23.23±0.23
23.07±0.15
Vcam-1
27.97±0.11
28.63±0.05
28.47±0.11
Icam-1
27.87±0.15
28.80±0.17
28.97±0.05
Table 4.5: Threshold cycle values of genes studied in H5 V control cells. Values are a representative set of mean±SD threshold cycle values (Ct) obtained by Real Time RT-PCR reaction
from samples in triplicate. Data represent control group cells at 2, 6 and 24 hours.
Interestingly, the significant reduction of iNOS expression, induced by TNFα, was additively reversed by the presence of UCB (at Bf of 15 nM) and NAC,
after 2 hours (Figure 4.7).
4.3
UCB reduced AM expression induced by TNF-α
4.3.1
H5 V cells - mRNA relative expression
In order to characterize unconjugated bilirubin (UCB) effects on adhesion molecules (AM) gene expression, mRNAs levels were quantified by Real Time RTPCR. H5 V cells were incubated for 2, 6 and 24 hours with TNF-α (20 ng/mL), as
described.
As expected, TNF-α alone engendered a significant increase of all three AM
genes at 2, 6 and 24 hours, with lower, but still elevated mRNA levels at 24 hours
(Figure 4.8). In addition, no changes were observed in control cells group at different time points. Table 4.5 summaries the threshold cycle (Ct) values of AM
genes studied in the control cell group.
Therefore, later experiments were designed to evaluate the direct role of physiological doses of UCB in co-treatment with TNF-α, as previously described.
Co-treatment with UCB (Bf 15 and 30 nM), significantly blunted the TNF-αinduced expression of E-selectin at 2h by 31% and 43% (respect to TNF-α alone
group, considered as 100%; p<0.05). However, no statistically significant differ80
4.3 UCB reduced AM expression induced by TNF-α
Figure 4.6: Effect of NAC on NO production. H5 V cells were incubated with NAC (10 mM),
with or without TNF-α. Control cells were treated as described in Materials and Methods. Cell
medium was collected after 24 h of treatment for NO2– levels determination. Results are expressed
as NO2– nmol/mg protein and represent means±SD, n=3. (A) *: p< 0.05 compared to respective
group. (B) *: p< 0.05 versus control group. #: p< 0.05 versus TNF-α alone treatment group. &:
p< 0.05 versus NAC alone treatment group.
81
Results
Figure 4.7: TNF-α induction of iNOS gene expression was reverted by UBC and NAC.
Effect of different doses of UCB (Bf 15 and 30 nM) with NAC (10 mM) on H5 V cells. Cells were
incubated with TNF-α (20 ng/mL) and collected after 2 h of treatment. The mRNAs were analyzed
by Real Time RT-PCR. Results are expressed as mean percentage of folds of expression (%),
related to TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus TNF-α alone treatment
group. &: p< 0.05 versus NAC alone treatment group.
82
Figure 4.8: TNF-α induces AM gene expression in H5 V cells. Effect of TNF-α (20 ng/mL) on
AM mRNAs gene expression in H5 V cells at 2, 6 and 24 hours. Bars represent fold of expression,
obtained by Real Time RT-PCR, compared to control cells and normalized to β-actin used as
housekeeping gene. Results are representative of three independent experiments. Values are mean
±SD. *: p< 0.05 versus control group.
83
Results
ences were recorded at 6 and 24 hours (Figure 4.9).
TNF-α-induced Vcam-1 gene expression was significantly blunted by 28%,
by co-treatment with UCB 15 nM at 2 hours (p<0.05) and by 28% & 35% with
UCB 15 nM and 30 nM at 6 hours (p<0.05); no differences were observed at 24
hours (Figure 4.10).
Interestingly, the induction of Icam-1 gene expression by TNF-α was not affected by co-treatment with UCB over any time period (Figure 4.11). It should be
noted that the gene expressions of all genes studied were not modified when cells
were treated with UCB alone at both concentrations.
4.3.2
HUVEC cells - mRNA relative expression
Further experiments were done in order to assess whether UCB also regulated the
adhesion molecules mRNA expression on HUVEC cells.
Adhesion molecules mRNA levels gene expression were analyzed by Real
time RT-PCR. HUVEC cell were incubated for 2, 6 and 24 hours with different
doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL), as previously described.
The results were similar to those observed in H5 V cells. TNF-α alone determined a significant increase of E-selectin, VCAM-1 and ICAM-1 at all times
studied, respect to the control group (Figure 4.12, 4.13, 4.14). Moreover, mRNA
gene expression was unchanged in control cells at all time points (data not shown).
Indeed, no significant changes in AM gene expression were seen in UCB treatment alone (data not shown).
TNF-α induced over-expression (considered as the 100%) of E-selectin. This
was blunted 25–30% by co-treatment with either dose of UCB (Bf 15 and 30 nM)
at 2 and 6 h (p< 0.05) but the 20% reduction at 24 hours was not significant (Figure 4.12).
84
Figure 4.9: Effect of UBC on TNF-α-induced E-selectin gene expression in H5 V cells. Effect
of different doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) on H5 V cells.
Cells were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed by Real
Time RT-PCR. Results are expressed as mean percentage of folds of expression (%), related to
TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group. #: p< 0.05 versus
TNF-α alone treatment group.
85
Results
Figure 4.10: Effect of UBC on TNF-α-induced Vcam-1 gene expression in H5 V cells. Effect
TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group. #: p< 0.05 versus
86
Figure 4.11: Effect of UBC on TNF-α-induced Icam-1 gene expression in H5 V cells. Effect
TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group.
87
Results
By contrast, TNF-α induced over-expression of VCAM-1 was decreased 20–
25% by co-treatment with UCB (Bf 15 and 30 nM) only at 6 hours (p< 0.05,
Figure 4.13).
Interestingly, unlike H5 V cells, the ICAM-1 gene over expression caused by
TNF-α treatment (D) was blunted by UCB co-treatment (40% for Bf 15 nM and
48% for Bf 30 nM) at 6 h (p< 0.05), but not at 2 or 24 hours (Figure 4.14).
4.4
AM protein expression
H5 V cells were harvested after 24 hours treatment under the different conditions
as described in Materials and Methods. AM protein expression was determined
by SDS-PAGE Western Blot analysis.
TNF-α was able to induce protein expression of E-selectin (Figure 4.15),
Vcam-1 (Figure 4.16) and Icam-1(Figure 4.17), in a time-dependent manner, confirming data previously obtained from other endothelial cells (Cook-Mills & Deem,
2005).
When cells were treated with TNF-α and UCB for 24 hours, the protein expression was reduced if compared with TNF-α treatment alone (Figure 4.18).
Similar results were obtained at 6 hours of treatment, whereas not significant differences were observed (data not shown). Moreover, UCB alone, at Bf of 15 and
30 nM did not affect protein expression (data not shown).
Due to the low antibodies cross-reactivity observed, protein profiles in HUVEC
cells were unable to be obtained.
88
4.4 AM protein expression
Figure 4.12: Effect of UBC on TNF-α-induced E-selectin gene expression in HUVEC cells.
Effect of different doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) on HUVEC
cells. Cells were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed by
real time RT-PCR. Results are expressed as mean percentage of folds of expression (%), related
to TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group. #: p< 0.05 versus
89
Results
Figure 4.13: Effect of UBC on TNF-α-induced VCAM-1 gene expression in HUVEC cells.
Real Time RT-PCR. Results are expressed as mean percentage of folds of expression (%), related
90
Figure 4.14: Effect of UBC on TNF-α-induced ICAM-1 gene expression in HUVEC cells.
Real Time RT-PCR. Results are expressed as mean percentage of folds of expression (%), related
91
Results
Figure 4.15: TNF-α induces E-selectin protein expression in H5 V cells. Cells were treated
with TNF-α (20 ng/mL) for the indicated time periods. Total cell lysates were analyzed by Western
blot with specify antibody as described in Materials and Methods. Western blot analysis shown
are normalized by Actin. The density of the specific band was scanned and quantified with an
imaging analyzer. Results indicate the fold of increase of one representative of three reproducible
experiments per treatment group.
92
Figure 4.16: TNF-α induces Vcam-1 protein expression in H5 V cells. Cells were treated with
TNF-α (20 ng/mL) for the indicated time periods. Total cell lysates were analyzed by Western
93
Results
Figure 4.17: TNF-α induces Icam-1 protein expression in H5 V cells. Cells were treated with
TNF-α (20 ng/mL) for the indicated time periods. Total cell lysates were analyzed by Western
94
Figure 4.18: Effect of UBC on protein expression of three AM in H5 V cells treated with
TNF-α. Bilirubin reduces the TNF-α protein induction of E-selectin (A), Vcam-1 (B) and Icam-1
(C) at 24 hours. Western blot analysis shown are normalized by Actin. The density of the specific
band was scanned and quantified with an imaging analyzer. Results indicate the fold of increase
of one representative of three reproducible experiments per treatment group.
95
Results
4.5
UCB effects via NF-κB pathway
4.5.1
UCB and PDTC inhibit gene over-expression in an addictive pattern
H5 V cells from all experimental groups were pre-treated with PDTC to specifically inhibit the NF-κB pathway. The AM and iNOS mRNAs were measured
by Real Time RT-PCR after 2 hours of treatment, as described in Materials and
Methods.
PDTC effects seams not to be dose related mediated (Figure 4.19). The addition of PDTC (10 µM) caused a significant reduction in gene over-expression
induced by TNF-α for iNOS (46%), E-selectin (73%), Vcam-1 (80%) and Icam-1
(24%) mRNA (respect TNF-α alone considered as 100%, p< 0.05 Figure 4.20).
An additive inhibition of the expression of E-selectin gene, was seen upon
addition of UCB at either 15 or 30 nM Bf (55%, 46%, p< 0.05). The additive
inhibition by UCB of Vcam-1 gene expression was significant only at a Bf of 30
nM (56%, p< 0.05). Indeed, the additive inhibition on iNOS gene expression was
significant only at a Bf of 15 nM (40%, p< 0.05) (Figure 4.20).
The definition of an “additive effect” was concluded only when the sum of
the individual inhibitions by UCB and PDTC did not differ statistically from the
experimentally-measured inhibition obtained by combined treatment with UCB
and PDTC (Kuldo et al., 2005). The combinatory addictive theorically expected
effect was equal to the observed addictive effect on iNOS, E-selectin and Vcam-1
gene expression at Bf 30 nM and for also at Bf 15 nM for E-selectin. Icam-1
gene induction by TNF-α was not further inhibited by the addition of UCB to the
treatment PDTC.
4.5.2
CREB phosphorylation is not influenced by UCB
To investigate whether CREB is inactivated by UCB, western blot analysis was
performed by using an antibody that recognizes the phosphorylated form of CREB
96
4.5 UCB effects via NF-κB pathway
Figure 4.19: PDTC inhibits the TNF-α AM and iNOS mRNA gene over-expression. H5 V
cells were incubated with different doses of PDTC (250, 100, 50, 10 and 5 µM) with or without
TNF-α (20 ng/mL). E-selectin, Vcam-1, Icam-1 and iNOS specific mRNAs were evaluated after 2
hours of treatment. Bars represent fold of expression, obtained by Real Time RT-PCR, compared
to control cells and normalized to β-actin as housekeeping gene. Results are representative of two
independent experiments. Values are mean±SD.
97
Results
Figure 4.20: UCB and PDTC inhibit, in an addictive pattern, the gene over-expression of
AM and iNOS induced by TNF-α. Effect of different doses of UCB (Bf 15 and 30 nM) with or
without TNF-α (20 ng/mL) and PDTC (10 µM) on H5 V cells. Cells were collected after 2 hours
of treatment and the relevant, specific mRNAs were analyzed by Real Time RT-PCR. Results are
expressed as mean of folds of expression, related to TNF-α (20 ng/ml) alone treatment, ±SD. *:
p< 0.05 versus TNF-α alone treatment group. #: p<0.05 versus TNF-α and PDTC treatment
group.
98
Figure 4.21: Time dependent induction of CREB phosphorylation by TNF-α in H5 V cells.
CREB was detected by Western blot analysis using a phospho-specific and total CREB antibody.
Cells were incubated with TNF-α(20 ng/mL) for 0, 5, 15, 30, 60, 120 and 240 minutes. The
density of the specific band was scanned and quantified with an imaging analyzer. The ratio
of phosphorylated CREB to total CREB in TNF-α stimulated cells is shown as the relative fold
increase compared with that in un-stimulated cells. Results indicate the fold of increase of one
representative of two reproducible experiments per treatment group.
at Ser 133 and an antibody that recognizes both forms of CREB. Phosphorylation of CREB was significantly increased in a time dependent manner by TNF-α
alone, with a maximum increase reached after 15 min (Figure 4.21). UCB did not
affected CREB phosphorylation whether cells were treated with UCB alone or in
co-treatment with TNF-α (Figure 4.22).
4.5.3
NF-κB nuclear translocation is inhibited by UCB
It was also investigated whether the NF-κB translocation to the nucleus was inhibited by UCB (Bf 15 and 30 nM). Cytoplasmic and nuclear localization of the p65
NF-κB subunit were evaluated by Western blot. As reported, TNF-α stimulated
p65 NF-κB nuclear translocation (Baeuerle, 1998a; May & Ghosh, 1998). UCB
alone did not affected p65 translocation (data not shown). On the contrary, when
cells were co-treated with UCB and TNF-α, the p65 nuclear translocation induced
by TNF-α was prevented by UCB in a dose dependent manner. Furthermore, the
co-treatment with UCB and TNF-α caused an increase of the cytoplasmic fraction
of p65 compared to control and to treatment with TNF-α alone (Figure 4.23).
99
Results
Figure 4.22: UBC does not affect CREB phosphorylation in H5 V cells. CREB was detected
by Western blot analysis using a phospho-specific and total CREB antibody. Cells were incubated
with UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) for 15 minutes. The density of the
specific band was scanned and quantified with an imaging analyzer. The ratio of phosphorylated
CREB to total CREB in TNF-α stimulated cells is shown as the relative fold increase compared
with that in un-stimulated cells. Results indicate the fold of increase of one representative of two
reproducible experiments per treatment group.
100
Figure 4.23: UCB inhibits TNF-α-induced nuclear translocation of NF-κB in H5 V cells.
Panel A) TNF-α stimulates translocation of NF-κB from cytoplasm to nucleus, which is inhibited
by UCB. NF-κB was detected by Western blot analysis using a p65 NF-κB antibody after 30
minutes of incubation with TNF-α and/or UCB. Western blot analysis shown are normalized by
Actin. The purity of the cytoplasmic fraction was confirmed by αP84 antibody. Panel B) The
density of the specific band was scanned and quantified with an imaging analyzer. Results indicate
the fold of increase compared with unstimulated cells in cytoplasmic and nuclear fraction of one
representative of three reproducible experiments.
101
Chapter 5
DISCUSSION
For a long time bilirubin was considered to be simply a waste end product of heme
metabolism. More recently strong evidence has emerged pointing to bilirubin as
an independent factor in the prevention of atherosclerotic disease (Djouss et al.,
2001). In particular, mildly elevated serum bilirubin levels were associated with a
lower incidence of ischemic cardiovascular effects (Vitek et al., 2002) raising the
idea that bilirubin can interfere with the mechanisms involved in the development
of atherosclerosis. Based on the antioxidant properties of bilirubin, the hypothesis
was formulated that bilirubin can act as a ROS scavenger was formulated (Stocker
& Keaney, 2004; Baranano et al., 2002).
More recently bilirubin was demonstrated to inhibit the proliferation of vascular smooth muscle cells (Ollinger et al., 2005) and the endothelial migration of
monocytes (Keshavan et al., 2005). Furthermore, heme oxigenase-1, the widely
distributed enzyme that converts hemes into bilirubin, CO and Fe+2 formation, was
demonstrated to inhibit the over-expression of vascular adhesion molecules induced by TNF-α (Blankenberg et al., 2003).
Based on previous data, we postulated that bilirubin, by itself, and in particularly its active free form (unbound unconjugated bilirubin) can interfere with the
expression of adhesion molecules on endothelial cells. We created an in vitro
model of endothelial dysfunction, the earliest step in atherosclerotic disease, in
which over-expression of ICAM-1, VCAM-1 and E-selectin was induced by treatment of endothelial cells with TNF-α.
103
Discussion
Two endothelial cell lines were studied: immortalized H5 V cells from mice
and HUVEC cells, derived from the human umbilical cord. These cells were used
to study the nitric oxide metabolism, and the gene and protein expression of three
adhesion molecules after induction by TNF-α and/or treatment with low doses of
UCB. Our experiments utilized two concentrations of unbound bilirubin (Bf) of
15 and 30 nM, in order to mimic as closely as possible the plasma Bf levels found
in humans with mild unconjugated hyperbilirubinemia (Jacobsen & Wennberg,
1974; Nelson et al., 1974). In this in vitro system, the Bf in the medium is the
equivalent of plasma Bf, since the endothelial cells are directly bathed by the fluid
in both cases. It thus differs from others studies of central nervous system cells,
since the blood brain barrier and choroid plexus intervene between the plasma and
the neurons and astrocytes.
5.1
Viability and UCB
It is well recognized that infants who died from sever hyperbilirubinemia not only
demonstrate yellow staining of the brains but also yellow coloration of tissue
and organs. Although the occurrence of central nervous system sequelae is the
most constant clinical feature, other functional abnormalities such as diarrhoea
and urine concentration defect have also been described (Ostrow, 1986).
There have been a handful on in vitro studies demonstrating cytotoxic effects
of UCB depending on the cell type. Although this difference in most of the in vitro
cells models UCB has been found to be toxic, including fibroblast (Nelson et al.,
1974; Chuniaud et al., 1996; Ngai et al., 2000), astrocytes (Chuniaud et al., 1996),
oligodendrocytes (Genc et al., 2003), hepatocytes, erythrocytes, leukocytes, liver
(Czernobilsky & Dubin, 1965), HeLa cells (Shimabuku & Nakamura, 1983; Ngai
et al., 2000), platelets (Amit et al., 1992), neuroblastoma (Schiff et al., 1985), hepatoma (Thaler, 1971; Seubert et al., 2002), glioblastoma, Chang Liver (Ngai et al.,
2000) and fibrosarcoma (Cowger, 1971). Even thought there is scant information
regarding the molecular mechanism underlying these effects; it has been recently
104
5.1 Viability and UCB
demonstrated that Bf and not the total UCB elicits the toxic effect (Calligaris et al.,
2007).
The results obtained in H5 V cells clearly demonstrated a reduction on the cell
viability. Interestingly, HUVEC cells seams to be more sensitive to UCB than
H5 V, at same levels of Bf and at shorter incubation times (Figure 4.1). On the
other hand, as it was shown UCB did not cause membrane permeability, leading
to the release of LDH (Table 4.1), this effect may reflect the absence of necrosis at
the Bf studied. Cellular release of LDH is generally considered to be a hallmark
of necrotic cell death (O’Brien et al., 2000).
The fact that mitochondrial activity was impaired when no lysis was detectable
is in line with the hypothesis proposed by Mustapha et al. (Mustafa et al., 1969)
where mitochondrial may be the primary target for Bf. In line with this observation was the demonstration that, in astrocytes and fibroblast, the Bf level is responsible of toxic effects, mainly correlated with alteration on mitochondrial activity
instead of cell lysis. Indeed, it was proposed that the aggregation of higher levels
of Bf molecules inside the cell may result in the breaking of the membrane architecture and cytolisis (Chuniaud et al., 1996).
Indeed, toxicity of higher doses of UCB (86 µM, at a UCB/albumin ratio of
3:1) in immature cells neurons is typically characterized by a perturbation of the
mitochondrial membrane, with alteration of polarity, fluidity and increasing the
permeability, leading to the release of cytochrome c (Rodrigues et al., 2002b; Rodrigues et al., 2002a), critical events associated with the initiation of the cell death
by apoptotic pathways.
Another study of the mitochondrial functionality clearly demonstrated that
bilirubin at high non physiological doses (25–50 µM) stimulates apoptosis of
colon adenocarcinoma cells in vitro through activation of the mitochondrial pathway, by directly dissipating mitochondrial membrane potential. As this effect is
triggered at concentrations normally present in the intestinal lumen, it was postulated a physiologic role for bilirubin in modulating colon tumorigenesis (Keshavan
105
Discussion
et al., 2004).
Furthermore, it was demonstrated that bovine brain microvascular endothelial
cells may undergo apoptosis after exposure to higher doses of bilirubin (10-100
µM). These effect appeared to be time-dependent but not clearly concentrationdependent. Indeed, biochemical markers for apoptosis such as DNA fragmentation and PARP cleavage were induced by bilirubin (Akin et al., 2002).
It was recently reported that a given Bf concentration may or may not cause
cell lysis, depending on the ratio UCB/albumin (Calligaris et al., 2007). Furthermore, different results have been obtained depending on the cell type and the assays used but as mentioned previously the level of Bf used. Amplification of UCB
cytotoxicity by TNF-α and LPS was observed in fibroblast cells at a UCB/HSA
molar ratio of 1.0 (Ngai & Yeung, 1999).
It is well known that TNF-α exhibits its cytotoxic effect through binding to the
cell receptor (Fiers, 1991). The present results confirm that TNF-α was able to induce cytotoxicity (Figure 4.1). Interestingly, cytotoxicity effect was more evident
on HUVEC cells. I agreement with previously studies this HUVEC seems to be
more sensitive to the absence of serum and the treatments with TNF-α or others
growth factors (Emmanuel et al., 2002). However, no further combinatory effects
were seen in co-treatment with different physiological doses of UCB in both cell
model studied. Moreover, the lack of further cytotoxic effects in co-treatments
UCB and TNF-α seems to reenforce the hypothesis of antioxidant properties of
UCB.
On the other hand, Harlan et al. (Harlan et al., 1983) reported that LPS in
concentration up to 10 µg/mL did not induce detectable cytotoxicity in human endothelial cells derived from umbilical vein, pulmonary artery, or pulmonary vein.
In contrast, significant cytotoxicity was observed in bovine aortic endothelial cells
exposed to LPS as low as 0.01 µg/mL. Indeed, these data demonstrated an important direct LPS-mediated cytotoxic effect, and that this toxic effect depends on the
species from which the endothelial cells are derived.
106
5.1 Viability and UCB
Barañano et al. (Baranano et al., 2002) introduced the hypothesis of UCB
actin as antioxidant compound like others known antioxidants such as glutathione
and α-tocopherol. It was demonstrated that the potent physiologic antioxidant actions of bilirubin reflects an amplification cycle whereby bilirubin, acting as an
antioxidant, is itself oxidized to biliverdin and then recycled by biliverdin reductase back to bilirubin. This redox cycle may constitute the principal physiologic
function of bilirubin. However, most of the previous studies that evaluated antioxidant actions of bilirubin, were restricted to in vitro experiments measuring
the antioxidant potential of bilirubin, or examined protection conferred by exogenous bilirubin. In line with this idea, the cytoprotective UCB effects have been
then confirmed in vivo and in vitro by inhibiting ROS. UCB and α-tocopherol protected oligondendrocytes from H2 O2 (100 µM). Interestingly, bilirubin seems to
be more effective than α-tocopherol at the same concentration (50 nM). However,
the cytoprotection of bilirubin diminished at higher concentration (100 µM) presumably because higher levels of UCB are themselves cytotoxic (Liu et al., 2003).
Another study conducted in erythrocytes derived from cord blood demonstrated antioxidant properties of bilirubin. It was concluded that bilirubin, at physiologic concentrations, protects neonatal red blood cells against oxidative stress.
However, bilirubin at concentrations equal or exceeding 30 mg/dL and a bilirubin/BSA ratio of greater than one, was associated with significant cytotoxicity.
Additionally, cytotoxicity was evaluated by increased protein oxidation, decreased
erythrocyte glucose-6 phosphate dehydrogenase and adenosine triphosphatase activity, and altered cell membrane integrity (Mireles et al., 1999).
Moreover, bilirubin physiologic role relates to cytoprotection generated endogenous by Heme oxygenase-1, the rate limiting enzyme of heme degradation,
was confirmed in several studies directly related to inflammatory stress and endothelial dysfunction that will discuss latter (Kawamura et al., 2005; Taille et al.,
2003).
Although it is believed that the action of UCB is basically related to its toxic
107
Discussion
and antioxidant effects in respect of its concentration (Ostrow & Tiribelli, 2003),
the aim of the present data is to demonstrate that UCB may have some other cellular functions. Moreover, the previous findings outline the idea that may be difficult
to formulate a unifying concept of UCB effects. This conclusion is supported by
several reports in neural cells that demonstrated different sensitivities to bilirubin
cytotoxicity (Schiff et al., 1985; Notter & Kendig, 1986; Calligaris et al., 2007).
The contradictory observations in the cellular response in several studies may be
the result of non-physiologic concentration of bilirubin used or in alternative, the
presence of different mechanism of action in different cell lines (Calligaris et al.,
2007).
5.2
Nitric oxide and UCB
Accumulating evidence suggested that increased vascular oxidant stress represent
a major cause of reduced endothelial NO bio-availability in experimental and clinical cardiovascular disease. Different mechanism may explain why changes of the
endothelial redox state have a profound impact on endothelial NO availability
(Boulden et al., 2006):
• a direct inactivation of NO by superoxide O2– ;
• a reduced NOS activity, by increasing endogenous inhibitors;
• an increased oxidation of critical cofactors, such as BH4 by changes of the
endothelial redox state .
All these mechanisms may contribute to explain the NO levels in endothelial
cells which are important for endothelium dependent vasodilation, suppression of
thrombosis, vascular inflammation and thrombosis. This concept has been supported by several clinical studies, where endothelium dependent vasomotion is
therefore to represent a surrogate marker for cardiovascular events (Landmesser
et al., 2006).
The current study provides several evidence about NO regulation in two models of endothelial cells (H5 V and HUVEC). The regulation of NO metabolism and
108
5.2 Nitric oxide and UCB
the enzymes involved the synthesis (eNOS and iNOS) during the pro-inflammatory
state seems to be controversial (Wever et al., 1998). Cytokines are believed to induce the production of substantial amounts of NO by increasing iNOS expression
and activity during the pro-inflammatory state (Nathan, 1992). However, eNOS
down-regulation by TNF-α, and the decreased bio-availability of NO on the development of the endothelial dysfunction was also reported (Lai et al., 2003; Govers
& Rabelink, 2001).
Our data demonstrated a redaction of NO levels by treatments with the proinflammatory cytokine TNF-α in time (Table 4.3) and in dose-dependent manner
(Table 4.2). Moreover, the increase of the NO content in control conditions seems
to be time dependent (Table 4.3). Even though these results were further confirmed by using an ion chromatography with suppressed conductivity detection,
the interferences of the Griess’ method can not be exclude (Nithipatikom et al.,
1996). However, it was demonstrated in rabbit corneal cells that a mixture of
cytokines, TNF-α, IL-1β and INF-γ are required to induce significant nitrite accumulation and iNOS expression. Indeed in absence of INF-γ, little or no nitrite
accumulation by TNF-α was reported (O’Brien et al., 2001).
It is well known that the activity of NO is not restricted to the site of production. As un-charged gas, NO radicals are highly diffusible. Indeed, the generation
of s-nitrosothiols, s-nitrosylated proteins, and s-nitrosyl-metal complex can mediate its functions for instances to long distances. Moreover, the imbalance of proand anti-apoptotic effects can thus be best understood in terms of the specific cyscontaining proteins that are targets of NO in the context of cell type and stimulus
(Gaston et al., 2006).
On the other hand, during the endothelial dysfunction state a reduction of
NO levels were reported and explained by different mechanism, increasing of
ROS production, among others. ECs have been shown to generate significant
amounts of ROS (Stroes et al., 1998) and to express enzymes (e.g. eNOS, NADPH
oxidase, CYP, COX) that can produce ROS in response to receptor activation
or other cellular events that elevate intracellular calcium. NO is the principal
109
Discussion
endothelium-derived dilator operating in the vasculature and its activity can be
governed by the amount of ROS in the vascular milieu, whereby superoxide anions
can rapidly scavenge NO at a diffusion-controlled rate (Endemann & Schiffrin,
2004; Madamanchi et al., 2005). NO displays high affinity for heme groups and
many enzymes, including those noted above (NOS, COX, CYP etc) have heme
groups. Thus NO itself may inhibit the enzymatic production of superoxide and
H2 O2 (Griscavage et al., 1994). The relative contributions of NO and ROS to
vascular tone are inversely proportional to each other and the appearance of one
could likely compensate for the absence of the other.
Pathophysiological conditions such as diabetes and atherosclerosis display
signs of oxidative stress and dysfunctions in the NO pathway, thus it may be valid
to argue that endothelial ROS production could be compensating for impairments
to normal relaxant mechanisms (Wever et al., 1998). If this hypothesis is correct then there should be an increased contribution of H2 O2 in pathophysiological
states where the normal production of NO is compromised.
Boulden et al. (Boulden et al., 2006) demonstrated that endothelial dysfunction can be induced by H2 O2 and may be mediated by the NADPH oxidase and
its product, O2– . The activation of the NADPH oxidase results in increased O2–
with effects on NO production. This implies that ROS may be a downstream effector of NADPH oxidase activation in order to decreased NO levels and mediate
endothelial dysfunction.
Furthermore, increased NADPH oxidase activity is associated with hypertension and progression of atherosclerosis, suggesting that this enzyme may be part
of the pathogenic cascade leading to uncompensated oxidative stress (Cai et al.,
2003).
In agreement with these findings, several reviews indicated the role of TNF-α
in ROS production. TNF-α induces oxidative stress by activating the NADPH
oxidase complex, the major source of endothelial reactive oxygen species production (Li et al., 2002).
110
5.2 Nitric oxide and UCB
Jiang et al. (Jiang et al., 2006) demonstrated in human microvascular endothelial cells that NO donors strongly induce expression of heme oxygenase-1.
This was associated with a reduction of the superoxide-generating capacity of
NADPH oxidase, an effect that depends on de novo gene transcription and heme
oxygenase-1 activity. Activation of NADPH oxidase by TNF-α increased generation of reactive oxygen species, specially when heme oxygenase-1 expression was
blocked with specific small-interfering RNA. Interestingly, these results demonstrated that bilirubin (1-100 nM) suppressed TNF-α induced ROS formation by
inhibiting NADPH oxidase activity.
Moreover, it was reported in fibroblast that high UCB levels inhibit protein
kinase C phosphorylation. Then UCB may regulate the activation of NADPH oxidase by changing the phosphorylation state, crucial for NADPH oxidase activity,
of the p47 phox subunit (Amit & Boneh, 1993).
In the present study, TNF-α was able to induce iNOS expression in a time
dependent manner without modifying eNOS mRNA (Figure 4.3), in line with previews reports (Bruch-Gerharz et al., 1998). However, a discrepancy between the
induction of iNOS expression and the NO levels was observed. Probably, a reduction of NO levels or a generation of other forms of nitrosative reactive species
generated by ROS can occurred. The ROS hypothesis was then verified by using NAC, a well known antioxidant. The present data demonstrate that NO basal
levels were reduced by treatment with NAC alone (Figure 4.6). These data may
partially demonstrate the hypothesis of ROS generation in H5 V cell model. Moreover when NAC and TNF-α where added together, a further reduction on NO
levels was observed. This reduction may be the result of the reduction of ROS
generated by NAC as antioxidant but also by a reduction on iNOS expression, as
shown in Figure 4.5 and Figure 4.6. Interestingly, co-treatment with TNF-α and
NAC was able to inhibit NO production. Furthermore, as shown in Figure 4.6,
iNOS expression induced by TNF-α was blunted by treatment with NAC. These
results clearly demonstrated a complex and multi-step regulatory mechanism in
the synthesis of NO, iNOS expression, and consumption, ROS.
111
Discussion
The present data also clearly demonstrate a role of UCB on the modulation of
NO metabolism. However, the molecular events on NO levels by UCB may be
difficult to explain for several reasons. First, NO levels are the result of a very
complex regulation and UCB may be involved in different steps. At 48 hours NO
levels were reversed by UCB even at upper-normal physiological (15 nM) and
mildly elevated (30 nM) Bf (Figure 4.2). These results may be explained by an
up-regulation of iNOS induced by UCB at 24 hours (Figure 4.4). However, after 2 hours of treatment UCB significantly inhibits iNOS expression (Figure 4.4).
Interestingly, at 2 hours NO levels were not detectable. This complex biphasic
regulation of UCB on iNOS expression may be explained by a modulation the
NO levels. It was reported that NO levels are responsible of iNOS regulation itself (Schwartz et al., 1997). In this case as NO levels were not detectable, UCB
may prevent NO induction. On the other hand, when NO levels were dismissed
(at 48 hours), UCB may compensate these effects by a synergistic effect on iNOS
TNF-α induction (24 hours). However, further results need to be obtained in order
to prove these hypothesis. The additive effect observed between UCB and NAC
reinforced the hypothesis of the redox state (Figure 4.7).
It was demonstrated both in vivo and in vitro, that UCB limits the increase
hepatic levels of TNF-α, nitric oxide (NO) and iNOS caused by treatment with
endotoxin (Wang et al., 2004). These results, in agreement with our data, suggests
a role for bilirubin in the prevention of the tissue injury in response to inflammatory stimuli.
NO levels in freshly isolatedHUVEC cells were undetectable, in line with several in vitro studies. However, HUVEC cells freshly isolated and treated with
TNF-α seems to increase NO production together with an increase in the iNOS
expression (Orpana et al., 1997). Conversely, iNOS induction could not be further
detected in HUVEC subcultures passed once from cells presenting maximal levels
of iNOS expression in the primary culture (de Assis et al., 2002). No changes in
eNOS expression were seen in the present study by treatment with TNF-α at all
times studied (Table 4.4). Moreover, iNOS mRNA expression was undetectable.
112
5.3 Adhesion molecules and UCB
While accumulating evidence on different sources of endothelial cells demonstrated ROS effects, the TNF-α effects on NO metabolism are still not fully
elucidated (Govers & Rabelink, 2001; Yang & Rizzo, 2007). However our data,
accordingly with recent studies on heme oxygenase-1 (Jiang et al., 2006), pointed
out UCB as a potential modulator of of the oxidant stress and the cardiovascular
protective actions.
5.3
Adhesion molecules and UCB
Our results demonstrated, for the first time, that in both the mouse and human
endothelial cell lines UCB, at Bf that did not affect the expression of the three adhesion molecules, blunts the over-expression of E-selectin and VCAM-1 induced
by a pro-inflammatory cytokine such as TNF-α, indicating the lack of species
specific effect (Figure 4.9, 4.12, 4.10, 4.13). By contrast, the enhanced gene expression of ICAM-1 induced by TNF-α was blunted by UCB only in the human
(HUVEC) cell line (Figure 4.11, 4.14). In both cell lines the inhibitory effect of
UCB was usually modest (20-30%), detected and 2 and/or 6 hours, but vanished
by 24 hours.
E-selectin, ICAM-1 and VCAM-1 are known to share many common regulatory mechanisms but only partially shared in the NF-κB pathway (Marui et al.,
1993; Zerfaoui et al., 2008). Thus, in endothelial cells the treatment with hemeoxygenase, a precursor of bilirubin formation, inhibited only the TNF-α induced
over-expression of VCAM-1 and E-selectin but not ICAM-1, indicating that different regulatory mechanism are involved (Soares et al., 2004).
Interestingly, in both cell models E-selectin was the adhesion molecule whose
gene expression was the earliest to be influenced by UCB. The variations were
observed just 2 hours after exposure to the pigment. This data is consistent with
the well established observation that E-selectin is the first adhesion molecule to
be involved, in a time dependent manner, in the leukocyte recruitment by rolling
113
Discussion
and tethering (Blankenberg et al., 2003).
On the other hand, in H5 V cells, UCB blunted the protein over-expression of
all three adhesion molecules induced by TNF-α (Figure 4.18). These findings
suggests a post-transcriptional influence of bilirubin, yet to be demonstrated.
A recent study, in murine endothelial cells, demonstrated a different pattern of
expression of the three adhesion molecules studied in acute and chronic treatment
with TNF-α. E-selectin was strongly up regulated in acute but not in chronic inflammation. More over VCAM-1 reveled a similar patter in contrast with ICAM-1
(Rajashekhar et al., 2007). The authors proposed that the discrepancies found in
several studies can be explained as: 1) tissue culture conditions and immortalization procedures further contributing to the differences in response to TNF-α; 2)
mouse endothelial cells used respond differently from human endothelial cells. In
agrement with this hypothesis the presents results demonstrated that UCB effects,
at leat for the adhesion molecules expression, appears to be lack of species specific effect. Previous studies pointed out the potential role of UCB in modulating
the trans-endothelial migration Vcam-1 mediated in vivo (Keshavan et al., 2005).
Even though the culture conditions differ among the studies, specially for UCB
concentrations, these findings support a potential role for bilirubin as an endogenous immunomodulatory agent. However the molecular mechanisms underlying
this activation, or blunt in terms of UCB effect, are not fully understood, nor is it
known whether these genes are activated by common, or gene-specific, regulatory
factors.
5.4
Signalling pathways and UCB
The present data may rise the hypothesis that bilirubin can influence the inflammatory markers (NO and adhesion molecules) by interfering with the pathways
involved in the regulation endothelial dysfunction. However, the exact mechanism(s) responsible for bilirubin-mediated antioxidant o toxicity remains largely
114
5.4 Signalling pathways and UCB
unknown. An interesting question is: how bilirubin could mediate its effects?.
Several data demonstrated the UCB effects are limited to binding to nuclear receptors. It was shown that bilirubin might have a direct regulatory effect by binding
the aryl hydrocarbon receptor (Seubert et al., 2002) or indirectly by activation of
constitutive androstane receptor (Huang et al., 2004). Both receptors are associated with multiple cellular functions, cell cycle (Elizondo et al., 2000), apoptotic
response (Reiners & Clift, 1999), xenobiotics hepatic clearance (Wei et al., 2000),
indicating its interactions with signalling pathways.
Several signalling pathways are described to be involved in regulating the gene
expression of iNOS and adhesion molecules specially NF-κB (Baeuerle, 1998a;
Ghosh et al., 1998; Hanada & Yoshimura, 2002; Lin et al., 2007) and CREB (Gerritsen et al., 1997; Ono et al., 2006; Ciani et al., 2002).
In the present study it was demonstrated that PDTC, an IκB inhibitor that prevents the release of p65 (Schoonbroodt & Piette, 2000), has an additive inhibitory
effect on TNF-α induction of iNOS and the adhesion molecules indicating that
bilirubin may also act through an other signalling cascade (Figure 4.20).
When the extent of NF-κB nuclear translocation was evaluated after TNF-α
and UCB co-treatment in our H5 V cells, the TNF-α-stimulated nuclear translocation was inhibited by UCB (Figure 4.23). This result confirmed that UCB can
affect the NF-κB regulatory pathway, probably through an interaction with the
IKK proteins (Malek et al., 2001).
CREB is also involved in the up-regulation of Vcam-1 and E-selectin gene
expression induced by TNF-α (Gerritsen et al., 1997; Ono et al., 2006). It was
investigated the CREB cascade to look for a possible involvement of UCB on
this signalling cascade. However, no influence of UCB on the phosphorylation of
CREB (Figure 4.22) induced by TNF-α was observed (Figure 4.21). Thus CREB
does not mediate the influences of UCB on the expression of the adhesion molecules in H5 V cells.
115
Discussion
Bilirubin is already known to be a modulator of the NF-κB signal transduction pathway in astrocytes. Furthermore it was demonstrated that high doses of
UCB (50 µM) induces p65 NF-κB subunit nuclear translocation after 4 hours of
treatment (Fernandes et al., 2006). On the other hand, it was recently reported that
biliverdin inhibits the transcriptional activity of NF-κB in HEK293A cells, by inhibiting TNF-α-induced DNA binding (Gibbs & Maines, 2007). The coimmunoprecipitation data showed that biliverdin reductase binds, under TNF-α stimulus,
to the p65 subunit of NF-κB. Indeed, an over-expression of biliverdin reductase
enhanced both the basal and TNF-α-mediated activation of NF-κB and the concomitant iNOS gene activation (Gibbs & Maines, 2007). These results do not fit
with the findings of the present study. These differences may be a further demonstration of the dual bilirubin effect, toxic at high concentration and protective at
low levels, modulating at least in part by NF-κB signalling pathway.
It is becoming clear that NO itself plays a pivotal role in the regulation of the
gene expression, specially by this regulatory activity may control iNOS gene induction.(Schwartz et al., 1997). Such mechanism would constitute a self-regulating
pathway by which NO production from this NOS could be fine-tuned (Schwartz
et al., 1997; Bogdan, 2001a). This biphasic activity of NO appears to play a central role in the time course of activation of these immune cells and, by inference,
in facilitating the initiation of a defense response against pathogenic stimuli and
in its termination to limit tissue damage. This mechanism, mainly due to the NFκB pathway, can also explain at least in part the reported ability of NO to act in
both a pro- and anti-inflammatory manner (Connelly et al., 2001). Interestingly,
the results described in the present data demonstrated that UCB may also have a
biphasic effects on iNOS regulation (Figure 4.4). Low concentrations of NO (such
as occur after 2 hours of treatment with TNF-α) activate NF-κB and up-regulated
iNOS while high concentrations of NO have the opposite effect. UCB may help
to regulate NO production preventing its overproduction and avoiding its reduction. As it was demonstrated previously UCB effects on iNOS expression may be
mediated, at least in part, by preventing the NF-κB nuclear translocation induced
by TNF-α (Figures 4.20 and 4.23). However, on the modulation of NO levels
by UCB the contribution of others pathways or post-transcriptional mechanisms
116
5.4 Signalling pathways and UCB
affecting NOS activity can not be excluded.
Other studies suggested that UCB would be able to modulate others signal
transduction pathways. In HeLa and mouse embryonic fibroblast, UCB at high
toxic concentrations (80 nM) induced oxidative stress, activated APE1/Ref-1, a
master redox signalling pathway regulator in eukaryotic cells and induced the activation of Egr-1 transcription factor by up regulation of PTEN tumor suppressor
(Cesaratto et al., 2007). In this way UCB may induce cell toxicity not only by
modulating NF-κB (Fernandes et al., 2006).
Adhesion molecules such as VCAM-1, E-selectin and ICAM-1 are highly regulates at transcriptional level by a large number of mediators. As it was mentioned
previously, NF-κB is believed to play a critical role in mediating inflammatory response in endothelium (Martin et al., 2000). However, the used of different doses
of PDTC, the specific inhibitor, could not complectly revert TNF-α stimulation
of iNOS and the three genes studied (Figure 4.19). These results suggest that an
overlapping distinct signalling pathways may serve to modulate pro-inflammatory
genes expression (Quinlan et al., 1999; Marui et al., 1993; Zerfaoui et al., 2008).
Several others pathways seams to be important by the modulation of the adhesion molecules. Among them, the NFAT family of transcription factors regulated
by calcium and calcineurin. NFAT proteins are phosphorylated and reside in the
cytoplasm in resting cells; upon stimulation, they are dephosphorylated by calcineurin, translocated to the nucleus to activate the transcription of a large number
of genes (Hogan et al., 2003). Moreover, the activation of endothelial cells by
thrombin involves an interplay between NFAT and NF-κB signaling pathways to
modulate cooperatively the VCAM-1 gene expression (Minami et al., 2006). It
was demonstrated that bilirubin is a modulator of calcium reservoirs increasing
intracellular calcium levels (Brito et al., 2004). These results according to the
present data may formulate the hypothesis that some other pathways are important to determine UCB effects, specially those relative to its protective functions.
Altogether, our data suggest that bilirubin may blunt the pro-inflammatory
117
Discussion
state determined by the cytokine TNF-α by interacting, at least in part, with the
NF-κB transcription factor. However the contribution of other signalling pathways can not be excluded.
118
Chapter 6
CONCLUSIONS
The results obtained in the present study show that unconjugated bilirubin, even
at upper-normal physiological (15 nM) and mildly elevated (30 nM) Bf can modulate gene expression and endothelial cell function.
In this in vitro system UCB reduces the viability of endothelial cells in a dose
dependent manner. The cytotoxic is primary observed by a impaired mitochondrial function. This effect is more evident at high levels of bilirubin (100 nM).
Moreover, the accumulation inside the cell at higher Bf may induced a disruption on the cell membrane leading to necrosis and cell death. However, the lack
of combinatory further effects between UCB and the pro-inflammatory cytokine
TNF-α may reinforce the hypothesis of antioxidant properties od UCB.
This observation pointed out the important role of the Bf in order to compare
different results. Indeed, non-physiologic concentration of bilirubin used may reflect in different cellular responses.
The results described demonstrated in mouse endothelial cell line that UCB
(at normal and mildly elevated physiological levels) may have a biphasic effects
on iNOS regulation. This effect was described by NO itself, low concentrations
of NO (such as occur after 2 hours of treatment with TNF-α) may activate NF-κB
and up-regulated iNOS. High concentrations of NO could have the opposite effect. UCB may help to regulate NO production preventing its overproduction and
avoiding its reduction. As it was demonstrated previously, UCB effects on iNOS
119
Conclusions
expression may be mediated, at least in part, by preventing the NF-κB nuclear
translocation induced by TNF-α.
The results demonstrate also, for the first time, that in mouse and human endothelial cell lines UCB, at Bf that did not themselves affect the expression of
the three adhesion molecules, blunts the over-expression of E-selectin and Vcam1
induced by a pro-inflammatory cytokine such as TNF-α, indicating the lack of
species specific effect. By contrast, the enhanced gene expression of Icam-1 induced by TNF-α was blunted by UCB only in the human (HUVEC) cells line.
In both cell lines, the inhibitory effect of UCB was usually modest (20-30%) and
detected at 2 and/or 6 hours, but had worn off by 24 hours.
In summary, these data indicate that bilirubin may blunt the development of
endothelial dysfunction by modulating the adhesion molecules over-expression
and the NO metabolism in the pro-inflammatory state induced by the cytokine
TNF-α. Even though UCB alone does not alter these markers. UCB effects are
mediated in part by a modulation of the NF-κB transcription factor. These results
support the concept that modestly elevated concentrations of bilirubin may help
prevent atherosclerotic disease as suggested by epidemiological studies.
120
ACKNOWLEDGEMENTS
121
REFERENCES
Abbassi, O., Kishimoto, T., McIntire, L., Anderson, D. & Smith, C. (1993). E-selectin
supports neutrophil rolling in vitro under conditions of flow. J.Clin.Invest 92, 2719–
2730.
Abe, K., Pan, L. H., Watanabe, M., Konno, H., Kato, T. & Itoyama, Y. (1997). Upregulation of protein-tyrosine nitration in the anterior horn cells of amyotrophic lateral
sclerosis. Neurol Res 19, 124–128.
Abu-Soud, H. M. & Stuehr, D. J. (1993). Nitric oxide synthases reveal a role for calmodulin in controlling electron transfer. Proc Natl Acad Sci U S A 90, 10769–10772.
Adams, J. C. & Watt, F. M. (1993). Regulation of development and differentiation by the
extracellular matrix. Development 117, 1183–1198.
Ahlfors, C. E. (1981). Effect of serum dilution on apparent unbound bilirubin concentration as measured by the peroxidase method. Clin Chem 27, 692–696.
Ahlfors, C. E. (2001). Bilirubin-albumin binding and free bilirubin. J Perinatol 21 Suppl
1, S40–2; discussion S59–62.
Akin, E., Clower, B., Tibbs, R., Tang, J. & Zhang, J. (2002). Bilirubin produces apoptosis
in cultured bovine brain endothelial cells. Brain Res 931, 168–175.
Albina, J. E., Mills, C. D., Barbul, A., Thirkill, C. E., Henry, W. L., Mastrofrancesco, B.
& Caldwell, M. D. (1988). Arginine metabolism in wounds. Am J Physiol 254,
E459–E467.
Alderton, W., Cooper, C. & Knowles, R. (2001). Nitric oxide synthases: structure, function and inhibition. Biochem.J. 357, 593–615.
123
REFERENCES
Amit, Y. & Boneh, A. (1993). Bilirubin inhibits protein kinase C activity and protein
kinase C-mediated phosphorylation of endogenous substrates in human skin fibroblasts. Clin.Chim.Acta 223, 103–111.
Amit, Y., Cashore, W. & Schiff, D. (1992). Studies of bilirubin toxicity at the synaptosome
and cellular levels. Semin Perinatol 16, 186–190.
Aoki, N., Siegfried, M. & Lefer, A. M. (1989). Anti-EDRF effect of tumor necrosis factor
in isolated, perfused cat carotid arteries. Am J Physiol 256, H1509–H1512.
Aplin, A., Hogan, B., Tomeu, J. & Juliano, R. (2002). Cell adhesion differentially regulates the nucleocytoplasmic distribution of active MAP kinases. J.Cell Sci. 115,
2781–2790.
Arenzana-Seisdedos, F., Turpin, P., Rodriguez, M., Thomas, D., Hay, R. T., Virelizier,
J. L. & Dargemont, C. (1997). Nuclear localization of I kappa B alpha promotes
active transport of NF- kappa B from the nucleus to the cytoplasm. J Cell Sci 110 (
Pt 3), 369–378.
Arias, J., Alberts, A. S., Brindle, P., Claret, F. X., Smeal, T., Karin, M., Feramisco, J. &
Montminy, M. (1994). Activation of cAMP and mitogen responsive genes relies on
a common nuclear factor. Nature 370, 226–229.
Assreuy, J., Cunha, F. Q., Liew, F. Y. & Moncada, S. (1993). Feedback inhibition of nitric
oxide synthase activity by nitric oxide. Br J Pharmacol 108, 833–837.
Baeuerle, P. (1998a). Pro-inflammatory signaling: last pieces in the NF- kappa B puzzle?
Curr.Biol. 8, R19–R22.
Baeuerle, P. (1998b). I kappa B-NF- kappa B structures: at the interface of inflammation
control. Cell 95, 729–731.
Balligand, J. L., Kobzik, L., Han, X., Kaye, D. M., Belhassen, L., O’Hara, D. S., Kelly,
R. A., Smith, T. W. & Michel, T. (1995). Nitric oxide-dependent parasympathetic
signaling is due to activation of constitutive endothelial (type III) nitric oxide synthase in cardiac myocytes. J Biol Chem 270, 14582–14586.
Baranano, D., Rao, M., Ferris, C. & Snyder, S. (2002). Biliverdin reductase: a major
physiologic cytoprotectant. Proc.Natl.Acad.Sci.U.S.A 99, 16093–16098.
124
REFERENCES
Barath, P., Fishbein, M., Cao, J., Berenson, J., Helfant, R. & Forrester, J. (1990). Tumor necrosis factor gene expression in human vascular intimal smooth muscle cells
detected by in situ hybridization. Am.J.Pathol. 137, 503–509.
Barroga, C. F., Stevenson, J. K., Schwarz, E. M. & Verma, I. M. (1995). Constitutive
phosphorylation of IkappaBalpha by casein kinase II. Proc Natl Acad Sci U S A 92,
7637–7641.
Beck, K. F. & Sterzel, R. B. (1996). Cloning and sequencing of the proximal promoter of
the rat iNOS gene: activation of NF kappa B is not sufficient for transcription of the
iNOS gene in rat mesangial cells. FEBS Lett 394, 263–267.
Bevilacqua, M., Pober, J., Mendrick, D., Cotran, R. & Gimbrone, M.A., J.
(1987). Identification of an inducible endothelial-leukocyte adhesion molecule.
Proc.Natl.Acad.Sci.U.S.A 84, 9238–9242.
Bevilacqua, M. P. & Nelson, R. M. (1993). Selectins. J Clin Invest 91, 379–387.
Blankenberg, S., Barbaux, S. & Tiret, L. (2003). Adhesion molecules and atherosclerosis.
Atherosclerosis 170, 191–203.
Bobryshev, Y. (2006). Monocyte recruitment and foam cell formation in atherosclerosis.
Micron. 37, 208–222.
Bogdan, C. (2001a). Nitric oxide and the immune response. Nat.Immunol. 2, 907–916.
Bogdan, C. (2001b). Nitric oxide and the regulation of gene expression. Trends Cell Biol
11, 66–75.
Booyse, F., Quarfoot, A., Chediak, J., Stemerman, M. & Maciag, T. (1981). Characterization and properties of cultured human von Willebrand umbilical vein endothelial
cells. Blood 58, 788–796.
Bosma, P. J. (2003). Inherited disorders of bilirubin metabolism. J Hepatol 38, 107–117.
Bosma, P. J., Seppen, J., Goldhoorn, B., Bakker, C., Elferink, R. P. O., Chowdhury, J. R.,
Chowdhury, N. R. & Jansen, P. L. (1994). Bilirubin UDP-glucuronosyltransferase
1 is the only relevant bilirubin glucuronidating isoform in man. J Biol Chem 269,
17960–17964.
125
REFERENCES
Boulden, B. M., Widder, J. D., Allen, J. C., Smith, D. A., Al-Baldawi, R. N., Harrison,
D. G., Dikalov, S. I., Jo, H. & Dudley, S. C. (2006). Early determinants of H2O2induced endothelial dysfunction. Free Radic Biol Med 41, 810–817.
Bowie, A. & O’Neill, L. A. (2000a). Oxidative stress and nuclear factorkappa B activation: a reassessment of the evidence in the light of recent discoveries. Biochem
Pharmacol 59, 13–23.
Bowie, A. G. & O’Neill, L. A. (2000b). Vitamin C inhibits NF- kappa B activation by
TNF via the activation of p38 mitogen-activated protein kinase. J Immunol 165,
7180–7188.
Bredt, D. S., Glatt, C. E., Hwang, P. M., Fotuhi, M., Dawson, T. M. & Snyder, S. H.
(1991). Nitric oxide synthase protein and mRNA are discretely localized in neuronal
populations of the mammalian CNS together with NADPH diaphorase. Neuron 7,
615–624.
Breimer, L., Wannamethee, G., Ebrahim, S. & Shaper, A. (1995). Serum bilirubin and risk
of ischemic heart disease in middle-aged British men. Clin.Chem. 41, 1504–1508.
Breimer, L. H., Spyropolous, K. A., Winder, A. F., Mikhailidis, D. P. & Hamilton, G.
(1994). Is bilirubin protective against coronary artery disease?
Clin Chem 40,
1987–1988.
Brindle, P., Linke, S. & Montminy, M. (1993). Protein-kinase-A-dependent activator in
transcription factor CREB reveals new role for CREM repressors. Nature 364, 821–
824.
Brito, M. A., Brites, D. & Butterfield, D. A. (2004). A link between hyperbilirubinemia,
oxidative stress and injury to neocortical synaptosomes. Brain Res 1026, 33–43.
Bruch-Gerharz, D., Ruzicka, T. & Kolb-Bachofen, V. (1998). Nitric oxide in human skin:
current status and future prospects. J.Invest Dermatol. 110, 1–7.
Cai, H. & Harrison, D. (2000). Endothelial dysfunction in cardiovascular diseases: the
role of oxidant stress. Circ.Res. 87, 840–844.
Cai, H., Li, Z., Davis, M. E., Kanner, W., Harrison, D. G. & Dudley, S. C. (2003). Aktdependent phosphorylation of serine 1179 and mitogen-activated protein kinase kinase/extracellular signal-regulated kinase 1/2 cooperatively mediate activation of the
126
REFERENCES
endothelial nitric-oxide synthase by hydrogen peroxide. Mol Pharmacol 63, 325–
331.
Calligaris, S. D., Bellarosa, C., Giraudi, P., Wennberg, R. P., Ostrow, J. D. & Tiribelli, C.
(2007). Cytotoxicity is predicted by unbound and not total bilirubin concentration.
Pediatr Res 62, 576–580.
Carswell, E., Old, L., Kassel, R., Green, S., Fiore, N. & Williamson, B.
(1975).
An endotoxin-induced serum factor that causes necrosis of tumors.
Casasnovas, J., Pieroni, C. & Springer, T. (1999).
Lymphocyte function-associated
antigen-1 binding residues in intercellular adhesion molecule-2 (ICAM-2) and the
integrin binding surface in the ICAM subfamily. Proc.Natl.Acad.Sci.U.S.A 96,
3017–3022.
Castelli, W. P., Garrison, R. J., Wilson, P. W., Abbott, R. D., Kalousdian, S. & Kannel,
W. B. (1986). Incidence of coronary heart disease and lipoprotein cholesterol levels.
The Framingham Study. JAMA 256, 2835–2838.
Caterina, R. D., Libby, P., Peng, H. B., Thannickal, V. J., Rajavashisth, T. B., Gimbrone,
M. A., Shin, W. S. & Liao, J. K. (1995). Nitric oxide decreases cytokine-induced
endothelial activation. Nitric oxide selectively reduces endothelial expression of adhesion molecules and proinflammatory cytokines. J Clin Invest 96, 60–68.
Cesaratto, L., Calligaris, S. D., Vascotto, C., Deganuto, M., Bellarosa, C., Quadrifoglio,
F., Ostrow, J. D., Tiribelli, C. & Tell, G. (2007). Bilirubin-induced cell toxicity
involves PTEN activation through an APE1/Ref-1-dependent pathway. J Mol Med
85, 1099–1112.
Cheng, J. D., Ryseck, R. P., Attar, R. M., Dambach, D. & Bravo, R. (1998). Functional
redundancy of the nuclear factor kappa B inhibitors I kappa B alpha and I kappa B
beta . J Exp Med 188, 1055–1062.
Cho, H. J., Xie, Q. W., Calaycay, J., Mumford, R. A., Swiderek, K. M., Lee, T. D.
& Nathan, C. (1992).
Calmodulin is a subunit of nitric oxide synthase from
macrophages. J Exp Med 176, 599–604.
127
REFERENCES
Chu, S. C., Marks-Konczalik, J., Wu, H. P., Banks, T. C. & Moss, J. (1998). Analysis of
the cytokine-stimulated human inducible nitric oxide synthase (iNOS) gene: characterization of differences between human and mouse iNOS promoters. Biochem
Biophys Res Commun 248, 871–878.
Chuniaud, L., Dessante, M., Chantoux, F., Blondeau, J., Francon, J. & Trivin, F. (1996).
Cytotoxicity of bilirubin for human fibroblasts and rat astrocytes in culture. Effect
of the ratio of bilirubin to serum albumin. Clin.Chim.Acta 256, 103–114.
Ciani, E., Guidi, S., Della, V. G., Perini, G., Bartesaghi, R. & Contestabile, A. (2002). Nitric oxide protects neuroblastoma cells from apoptosis induced by serum deprivation
through cAMP-response element-binding protein (CREB) activation. J.Biol.Chem.
277, 49896–49902.
Cieslik, K., Zembowicz, A., Tang, J. L. & Wu, K. K. (1998). Transcriptional regulation
of endothelial nitric-oxide synthase by lysophosphatidylcholine. J Biol Chem 273,
14885–14890.
Cines, D. B., Pollak, E. S., Buck, C. A., Loscalzo, J., Zimmerman, G. A., McEver, R. P.,
Pober, J. S., Wick, T. M., Konkle, B. A., Schwartz, B. S., Barnathan, E. S., McCrae,
K. R., Hug, B. A., Schmidt, A. M. & Stern, D. M. (1998). Endothelial cells in
physiology and in the pathophysiology of vascular disorders. Blood 91, 3527–3561.
Clark, J. E., Foresti, R., Sarathchandra, P., Kaur, H., Green, C. J. & Motterlini, R. (2000).
Heme oxygenase-1-derived bilirubin ameliorates postischemic myocardial dysfunction. Am J Physiol Heart Circ Physiol 278, H643–H651.
Clermont, F., Adam, E., Dumont, J. & Robaye, B. (2003). Survival pathways regulating
the apoptosis induced by tumour necrosis factoralpha in primary cultured bovine
endothelial cells. Cell Signal. 15, 539–546.
Connelly, L., Palacios-Callender, M., Ameixa, C., Moncada, S. & Hobbs, A. (2001).
Biphasic regulation of NF- kappa B activity underlies the pro- and anti-inflammatory
actions of nitric oxide. J.Immunol. 166, 3873–3881.
Constantinescu, A., Gordon, A. & Diamond, I. (2002). cAMP-dependent protein kinase
types I and II differentially regulate cAMP response element-mediated gene expression: implications for neuronal responses to ethanol. J.Biol.Chem. 277, 18810–
18816.
128
REFERENCES
Cook, J., Kim, S., Teague, D., Krishna, M., Pacelli, R., Mitchell, J., Vodovotz, Y., Nims,
R., Christodoulou, D., Miles, A., Grisham, M. & Wink, D. (1996). Convenient
colorimetric and fluorometric assays for S-nitrosothiols. Anal.Biochem. 238, 150–
158.
Cook-Mills, J. & Deem, T. (2005). Active participation of endothelial cells in inflammation. J.Leukoc.Biol. 77, 487–495.
Cooke, J. P., Singer, A. H., Tsao, P., Zera, P., Rowan, R. A. & Billingham, M. E. (1992).
Antiatherogenic effects of L-arginine in the hypercholesterolemic rabbit. J Clin Invest 90, 1168–1172.
Cowger, M. L. (1971). Mechanism of bilirubin toxicity on tissue culture cells: factors
that affect toxicity, reversibility by albumin, and comparison with other respiratory
poisons and surfactants. Biochem Med 5, 1–16.
Crane, B. R., Arvai, A. S., Gachhui, R., Wu, C., Ghosh, D. K., Getzoff, E. D., Stuehr, D. J.
& Tainer, J. A. (1997). The structure of nitric oxide synthase oxygenase domain and
inhibitor complexes. Science 278, 425–431.
Cui, Y., Knig, J., Leier, I., Buchholz, U. & Keppler, D. (2001). Hepatic uptake of bilirubin
and its conjugates by the human organic anion transporter SLC21A6. J Biol Chem
276, 9626–9630.
Cybulsky, M., Fries, J., Williams, A., Sultan, P., Eddy, R., Byers, M., Shows, T.,
Gimbrone, M.A., J. & Collins, T. (1991).
Gene structure, chromosomal lo-
cation, and basis for alternative mRNA splicing of the human VCAM1 gene.
Czernobilsky, B. & Dubin, I. N. (1965). Effect of fibroblasts, Chang and rat liver cells on
bilirubin in tissue culture. Proc Soc Exp Biol Med 119, 964–966.
Davies, M. J. & Woolf, N. (1993). Atherosclerosis: what is it and why does it occur? Br
Heart J 69, S3–11.
Davignon, J. & Ganz, P. (2004). Role of endothelial dysfunction in atherosclerosis. Circulation 109, III27–III32.
Davis, K. L., Martin, E., Turko, I. V. & Murad, F. (2001). Novel effects of nitric oxide.
Annu Rev Pharmacol Toxicol 41, 203–236.
129
REFERENCES
Dawson, T. M., Steiner, J. P., Dawson, V. L., Dinerman, J. L., Uhl, G. R. & Snyder,
S. H. (1993). Immunosuppressant FK506 enhances phosphorylation of nitric oxide
synthase and protects against glutamate neurotoxicity. Proc Natl Acad Sci U S A
90, 9808–9812.
de Assis, M. C., Plotkowski, M. C., Fierro, I. M., Barja-Fidalgo, C. & de Freitas, M. S.
(2002). Expression of inducible nitric oxide synthase in human umbilical vein endothelial cells during primary culture. Nitric Oxide 7, 254–261.
de Groot, R. P., den Hertog, J., Vandenheede, J. R., Goris, J. & Sassone-Corsi, P. (1993).
Multiple and cooperative phosphorylation events regulate the CREM activator function. EMBO J 12, 3903–3911.
Degitz, K., Li, L. & Caughman, S. (1991). Cloning and characterization of the 5’transcriptional regulatory region of the human intercellular adhesion molecule 1
gene. J.Biol.Chem. 266, 14024–14030.
Delhalle, S., Blasius, R., Dicato, M. & Diederich, M. (2004). A beginner’s guide to NFkappa B signaling pathways. Ann.N.Y.Acad.Sci. 1030, 1–13.
Diamond, M., Staunton, D., Marlin, S. & Springer, T. (1991). Binding of the integrin Mac1 (CD11b/CD18) to the third immunoglobulin-like domain of ICAM-1 (CD54) and
its regulation by glycosylation. Cell 65, 961–971.
Dignam, J., Lebovitz, R. & Roeder, R. (1983). Accurate transcription initiation by RNA
polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids
Res. 11, 1475–1489.
Dinerman, J. L., Dawson, T. M., Schell, M. J., Snowman, A. & Snyder, S. H. (1994).
Endothelial nitric oxide synthase localized to hippocampal pyramidal cells: implications for synaptic plasticity. Proc Natl Acad Sci U S A 91, 4214–4218.
Djouss, L., Levy, D., Cupples, L. A., Evans, J. C., D’Agostino, R. B. & Ellison, R. C.
(2001). Total serum bilirubin and risk of cardiovascular disease in the Framingham
offspring study. Am J Cardiol 87, 1196–200; A4, 7.
Dor, S., Takahashi, M., Ferris, C. D., Zakhary, R., Hester, L. D., Guastella, D. & Snyder,
S. H. (1999). Bilirubin, formed by activation of heme oxygenase-2, protects neurons
against oxidative stress injury. Proc Natl Acad Sci U S A 96, 2445–2450.
130
REFERENCES
Drews, R., Coffee, B., Prestwood, A. & McGraw, R. (1990). Gene sequence of porcine
tumor necrosis factor alpha . Nucleic Acids Res. 18, 5564–.
Drickamer, K. (1988). Two distinct classes of carbohydrate-recognition domains in animal
lectins. J.Biol.Chem. 263, 9557–9560.
Dustin, M., Rothlein, R., Bhan, A., Dinarello, C. & Springer, T. (1986). Induction by IL 1
and interferon- gamma : tissue distribution, biochemistry, and function of a natural
adherence molecule (ICAM-1). J.Immunol. 137, 245–254.
Eberhardt, W., Plss, C., Hummel, R. & Pfeilschifter, J. (1998). Molecular mechanisms
of inducible nitric oxide synthase gene expression by IL-1 beta and cAMP in rat
mesangial cells. J Immunol 160, 4961–4969.
Edelstein, L., Pan, A. & Collins, T. (2005). Chromatin modification and the endothelialspecific activation of the E-selectin gene. J.Biol.Chem. 280, 11192–11202.
Elbirt, K. K. & Bonkovsky, H. L. (1999). Heme oxygenase: recent advances in understanding its regulation and role. Proc Assoc Am Physicians 111, 438–447.
Eliceiri, B. (2001). Integrin and growth factor receptor crosstalk. Circ.Res. 89, 1104–
1110.
Elizondo, G., Fernandez-Salguero, P., Sheikh, M. S., Kim, G. Y., Fornace, A. J., Lee,
K. S. & Gonzalez, F. J. (2000). Altered cell cycle control at the G(2)/M phases in
aryl hydrocarbon receptor-null embryo fibroblast. Mol Pharmacol 57, 1056–1063.
Emmanuel, C., Foo, E., Medbury, H., Matthews, J., Comis, A. & Zoellner, H. (2002).
Synergistic induction of apoptosis in human endothelial cells by tumour necrosis
factoralpha and transforming growth factor- beta . Cytokine 18, 237–241.
Endemann, D. & Schiffrin, E. (2004). Endothelial dysfunction. J.Am.Soc.Nephrol. 15,
1983–1992.
Endres, M. & Laufs, U. (1998). [HMG-CoA reductase inhibitor and risk of stroke]. Nervenarzt 69, 717–721.
Engler, M. M., Engler, M. B., Malloy, M. J., Chiu, E. Y., Schloetter, M. C., Paul, S. M.,
Stuehlinger, M., Lin, K. Y., Cooke, J. P., Morrow, J. D., Ridker, P. M., Rifai, N.,
Miller, E., Witztum, J. L. & Mietus-Snyder, M. (2003). Antioxidant vitamins C
131
REFERENCES
and E improve endothelial function in children with hyperlipidemia: Endothelial
Assessment of Risk from Lipids in Youth (EARLY) Trial. Circulation 108, 1059–
1063.
Fecker, L., Eberle, J., Orfanos, C. & Geilen, C. (2002). Inducible nitric oxide synthase
is expressed in normal human melanocytes but not in melanoma cells in response to
tumor necrosis factoralpha , interferon- gamma , and lipopolysaccharide. J.Invest
Dermatol. 118, 1019–1025.
Fernandes, A., Falcao, A., Silva, R., Gordo, A., Gama, M., Brito, M. & Brites, D. (2006).
Inflammatory signalling pathways involved in astroglial activation by unconjugated
bilirubin. J.Neurochem. 96, 1667–1679.
Feron, O., Belhassen, L., Kobzik, L., Smith, T. W., Kelly, R. A. & Michel, T. (1996).
Endothelial nitric oxide synthase targeting to caveolae. Specific interactions with
caveolin isoforms in cardiac myocytes and endothelial cells. J Biol Chem 271,
22810–22814.
Fiers, W. (1991). Tumor necrosis factor. Characterization at the molecular, cellular and in
vivo level. FEBS Lett. 285, 199–212.
Fischer, P., Dominguez, G., Cuniberti, L., Martinez, V., Werba, J., Ramirez, A. & Masnatta, L. (2003). Hyperhomocysteinemia induces renal hemodynamic dysfunction:
is nitric oxide involved? J.Am.Soc.Nephrol. 14, 653–660.
Forstermann, U., Boissel, J. & Kleinert, H. (1998). Expressional control of the ’constitutive’ isoforms of nitric oxide synthase (NOS I and NOS III). FASEB J. 12, 773–790.
Frstermann, U. & Kleinert, H. (1995). Nitric oxide synthase: expression and expressional
control of the three isoforms. Naunyn Schmiedebergs Arch Pharmacol 352, 351–
364.
Frstermann, U., Pollock, J. S., Schmidt, H. H., Heller, M. & Murad, F. (1991).
Calmodulin-dependent endothelium-derived relaxing factor/nitric oxide synthase
activity is present in the particulate and cytosolic fractions of bovine aortic endothelial cells. Proc Natl Acad Sci U S A 88, 1788–1792.
Fujita, T., Nolan, G. P., Ghosh, S. & Baltimore, D. (1992). Independent modes of transcriptional activation by the p50 and p65 subunits of NF-kappa B. Genes Dev 6,
775–787.
132
REFERENCES
Fukumura, D. & Jain, R. K. (1998). Role of nitric oxide in angiogenesis and microcirculation in tumors. Cancer Metastasis Rev 17, 77–89.
Galley, H. & Webster, N. (2004). Physiology of the endothelium. Br.J.Anaesth. 93, 105–
113.
Garca-Cardea, G., Oh, P., Liu, J., Schnitzer, J. E. & Sessa, W. C. (1996). Targeting of
nitric oxide synthase to endothelial cell caveolae via palmitoylation: implications
for nitric oxide signaling. Proc Natl Acad Sci U S A 93, 6448–6453.
Garlanda, C., Parravicini, C., Sironi, M., De Rossi, M., Wainstok, d. C., Carozzi, F., Bussolino, F., Colotta, F., Mantovani, A. & Vecchi, A. (1994). Progressive growth in
immunodeficient mice and host cell recruitment by mouse endothelial cells transformed by polyoma middle-sized T antigen: implications for the pathogenesis of
opportunistic vascular tumors. Proc.Natl.Acad.Sci.U.S.A 91, 7291–7295.
Gaston, B., Singel, D., Doctor, A. & Stamler, J. S. (2006). S-nitrosothiol signaling in
respiratory biology. Am J Respir Crit Care Med 173, 1186–1193.
Genc, S., Genc, K., Kumral, A., Baskin, H. & Ozkan, H. (2003). Bilirubin is cytotoxic to
rat oligodendrocytes in vitro. Brain Res. 985, 135–141.
German, Z., Chambliss, K. L., Pace, M. C., Arnet, U. A., Lowenstein, C. J. & Shaul, P. W.
(2000). Molecular basis of cell-specific endothelial nitric-oxide synthase expression
in airway epithelium. J Biol Chem 275, 8183–8189.
Gerritsen, M., Williams, A., Neish, A., Moore, S., Shi, Y. & Collins, T.
(1997).
CREB-binding protein/p300 are transcriptional coactivators of p65.
Ghosh, S. & Karin, M. (2002). Missing pieces in the NF- kappa B puzzle. Cell 109
Suppl, S81–S96.
Ghosh, S., May, M. J. & Kopp, E. B. (1998). NF- kappa B and Rel proteins: evolutionarily
conserved mediators of immune responses. Annu Rev Immunol 16, 225–260.
Gibbs, P. E. M. & Maines, M. D. (2007). Biliverdin inhibits activation of NF- kappa B:
reversal of inhibition by human biliverdin reductase. Int J Cancer 121, 2567–2574.
133
REFERENCES
Gimbrone, M. A., Cybulsky, M. I., Kume, N., Collins, T. & Resnick, N. (1995). Vascular
endothelium. An integrator of pathophysiological stimuli in atherogenesis. Ann N
Y Acad Sci 748, 122–31; discussion 131–2.
Gnanapandithen, K., Chen, Z., Kau, C. L., Gorczynski, R. M. & Marsden, P. A. (1996).
Cloning and characterization of murine endothelial constitutive nitric oxide synthase. Biochim Biophys Acta 1308, 103–106.
Gourley, G. R. (1997). Bilirubin metabolism and kernicterus. Adv Pediatr 44, 173–229.
Govers, R. & Rabelink, T. (2001). Cellular regulation of endothelial nitric oxide synthase.
Am.J.Physiol Renal Physiol 280, F193–F206.
Govers, R., van der, S. P., van Donselaar, E., Slot, J. & Rabelink, T. (2002). Endothelial nitric oxide synthase and its negative regulator caveolin-1 localize to distinct
perinuclear organelles. J.Histochem.Cytochem. 50, 779–788.
Green, L., Wagner, D., Glogowski, J., Skipper, P., Wishnok, J. & Tannenbaum, S. (1982).
Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal.Biochem. 126,
131–138.
Greenberg, D. (2002). The jaundice of the cell. Proc.Natl.Acad.Sci.U.S.A 99, 15837–
15839.
Griffith, O. W. & Stuehr, D. J. (1995). Nitric oxide synthases: properties and catalytic
mechanism. Annu Rev Physiol 57, 707–736.
Griscavage, J. M., Fukuto, J. M., Komori, Y. & Ignarro, L. J. (1994). Nitric oxide inhibits
neuronal nitric oxide synthase by interacting with the heme prosthetic group. Role of
tetrahydrobiopterin in modulating the inhibitory action of nitric oxide. J Biol Chem
269, 21644–21649.
Griscavage, J. M., Rogers, N. E., Sherman, M. P. & Ignarro, L. J. (1993). Inducible nitric
oxide synthase from a rat alveolar macrophage cell line is inhibited by nitric oxide.
J Immunol 151, 6329–6337.
Grojean, S., Koziel, V., Vert, P. & Daval, J. L. (2000). Bilirubin induces apoptosis via
activation of NMDA receptors in developing rat brain neurons. Exp Neurol 166,
334–341.
134
REFERENCES
Gross, S. S. & Levi, R. (1992). Tetrahydrobiopterin synthesis. An absolute requirement
for cytokine-induced nitric oxide generation by vascular smooth muscle. J Biol
Chem 267, 25722–25729.
Grumbach, I., Chen, W., Mertens, S. & Harrison, D. (2005). A negative feedback mechanism involving nitric oxide and nuclear factor kappa -B modulates endothelial nitric
oxide synthase transcription. J.Mol.Cell Cardiol. 39, 595–603.
Gullu, H., Erdogan, D., Tok, D., Topcu, S., Caliskan, M., Ulus, T. & Muderrisoglu, H.
(2005). High serum bilirubin concentrations preserve coronary flow reserve and
coronary microvascular functions. Arterioscler Thromb Vasc Biol 25, 2289–2294.
Hahne, M., Jager, U., Isenmann, S., Hallmann, R. & Vestweber, D. (1993). Five tumor necrosis factor-inducible cell adhesion mechanisms on the surface of mouse
endothelioma cells mediate the binding of leukocytes. J.Cell Biol. 121, 655–664.
Hanada, T. & Yoshimura, A. (2002). Regulation of cytokine signaling and inflammation.
Cytokine Growth Factor Rev 13, 413–421.
Hansen, T. W. (2001). Bilirubin brain toxicity. J Perinatol 21 Suppl 1, S48–51; discussion
S59–62.
Harlan, J. M., Harker, L. A., Reidy, M. A., Gajdusek, C. M., Schwartz, S. M. & Striker,
G. E. (1983). Lipopolysaccharide-mediated bovine endothelial cell injury in vitro.
Lab Invest 48, 269–274.
Hashimoto, S., Gon, Y., Matsumoto, K., Takeshita, I. & Horie, T. (2001).
N-
acetylcysteine attenuates TNF- alpha -induced p38 MAP kinase activation and p38
MAP kinase-mediated IL-8 production by human pulmonary vascular endothelial
cells. Br.J.Pharmacol. 132, 270–276.
Hauser, S., Ziurys, J. & Gollan, J. (1984). Subcellular distribution and regulation of
hepatic bilirubin UDP-glucuronyltransferase. J.Biol.Chem. 259, 4527–4533.
Hausladen, A., Privalle, C. T., Keng, T., DeAngelo, J. & Stamler, J. S. (1996). Nitrosative
stress: activation of the transcription factor OxyR. Cell 86, 719–729.
Hay, E. D. (1981). Extracellular matrix. J Cell Biol 91, 205s–223s.
135
REFERENCES
Hecker, M., Mlsch, A., Bassenge, E., Frstermann, U. & Busse, R. (1994). Subcellular localization and characterization of nitric oxide synthase(s) in endothelial cells:
physiological implications. Biochem J 299 ( Pt 1), 247–252.
Henkel, T., Machleidt, T., Alkalay, I., Krnke, M., Ben-Neriah, Y. & Baeuerle, P. A. (1993).
Rapid proteolysis of I kappa B- alpha is necessary for activation of transcription
factor NF- kappa B. Nature 365, 182–185.
Hensley, K., Robinson, K. A., Gabbita, S. P., Salsman, S. & Floyd, R. A. (2000). Reactive
oxygen species, cell signaling, and cell injury. Free Radic Biol Med 28, 1456–1462.
Hibbs, J. B., Taintor, R. R., Vavrin, Z. & Rachlin, E. M. (1988). Nitric oxide: a cytotoxic
activated macrophage effector molecule. Biochem Biophys Res Commun 157, 87–
94.
Hobbs, A. J., Higgs, A. & Moncada, S. (1999). Inhibition of nitric oxide synthase as a
potential therapeutic target. Annu Rev Pharmacol Toxicol 39, 191–220.
Hogan, P., Chen, L., Nardone, J. & Rao, A. (2003). Transcriptional regulation by calcium,
calcineurin, and NFAT. Genes Dev. 17, 2205–2232.
Hogg, N., Bates, P. A. & Harvey, J. (1991). Structure and function of intercellular adhesion molecule-1. Chem Immunol 50, 98–115.
Holness, C. & Simmons, D. (1994). Structural motifs for recognition and adhesion in
members of the immunoglobulin superfamily. J.Cell Sci. 107 ( Pt 8), 2065–2070.
Hood, J. D., Meininger, C. J., Ziche, M. & Granger, H. J. (1998). VEGF upregulates
ecNOS message, protein, and NO production in human endothelial cells. Am J
Physiol 274, H1054–H1058.
Hopkins, P. N., Wu, L. L., Hunt, S. C., James, B. C., Vincent, G. M. & Williams, R. R.
(1996). Higher serum bilirubin is associated with decreased risk for early familial
coronary artery disease. Arterioscler Thromb Vasc Biol 16, 250–255.
Hu, B. & E., B. (1970). Methods in Enzymatic Analyse, vol. 2,. Second edition,
Weinheim-Bergsts.
Huang, W., Zhang, J. & Moore, D. (2004). A traditional herbal medicine enhances bilirubin clearance by activating the nuclear receptor CAR. J.Clin.Invest 113, 137–143.
136
REFERENCES
Humphries, M. (1990). The molecular basis and specificity of integrin-ligand interactions.
J.Cell Sci. 97 ( Pt 4), 585–592.
Hynes, R. O. (1987). Integrins: a family of cell surface receptors. Cell 48, 549–554.
Inoue, J., Kerr, L. D., Ransone, L. J., Bengal, E., Hunter, T. & Verma, I. M. (1991). c-rel
activates but v-rel suppresses transcription from kappa B sites. Proc Natl Acad Sci
U S A 88, 3715–3719.
Invernici, G., Ponti, D., Corsini, E., Cristini, S., Frigerio, S., Colombo, A., Parati, E. &
Alessandri, G. (2005). Human microvascular endothelial cells from different fetal
organs demonstrate organ-specific CAM expression. Exp.Cell Res. 308, 273–282.
Ishizawa, S., Yoshida, T. & Kikuchi, G. (1983). Induction of heme oxygenase in rat liver.
Increase of the specific mRNA by treatment with various chemicals and immunological identity of the enzymes in various tissues as well as the induced enzymes. J
Biol Chem 258, 4220–4225.
Jackson, D. (2002). alpha 4 integrin antagonists. Curr.Pharm.Des 8, 1229–1253.
Jacobsen, J. & Wennberg, R. P. (1974). Determination of unbound bilirubin in the serum
of newborns. Clin Chem 20, 783.
Jaffe, E., Nachman, R., Becker, C. & Minick, C. (1973). Culture of human endothelial
cells derived from umbilical veins. Identification by morphologic and immunologic
criteria. J.Clin.Invest 52, 2745–2756.
Jang, Y., Lincoff, A. M., Plow, E. F. & Topol, E. J. (1994). Cell adhesion molecules in
coronary artery disease. J Am Coll Cardiol 24, 1591–1601.
Jiang, F., Roberts, S. J., raju Datla, S. & Dusting, G. J. (2006). NO modulates NADPH
oxidase function via heme oxygenase-1 in human endothelial cells. Hypertension
48, 950–957.
Jiang, M., Tsukahara, H., Hayakawa, K., Todoroki, Y., Tamura, S., Ohshima, Y., Hiraoka,
M. & Mayumi, M. (2005). Effects of antioxidants and NO on TNF- alpha -induced
adhesion molecule expression in human pulmonary microvascular endothelial cells.
Respir.Med. 99, 580–591.
137
REFERENCES
Johnston, G. I., Cook, R. G. & McEver, R. P. (1989). Cloning of GMP-140, a granule membrane protein of platelets and endothelium: sequence similarity to proteins
involved in cell adhesion and inflammation. Cell 56, 1033–1044.
Juntavee, A., Sripa, B., Pugkhem, A., Khuntikeo, N. & Wongkham, S. (2005). Expression of sialyl Lewis(a) relates to poor prognosis in cholangiocarcinoma. World J
Gastroenterol 11, 249–254.
Kacimi, R., Long, C. & Karliner, J. (1997). Chronic hypoxia modulates the interleukin-1
beta -stimulated inducible nitric oxide synthase pathway in cardiac myocytes. Circulation 96, 1937–1943.
Kamisako, T., Leier, I., Cui, Y., Knig, J., Buchholz, U., Hummel-Eisenbeiss, J. & Keppler,
D. (1999). Transport of monoglucuronosyl and bisglucuronosyl bilirubin by recombinant human and rat multidrug resistance protein 2. Hepatology 30, 485–490.
Karantzoulis-Fegaras, F., Antoniou, H., Lai, S. L., Kulkarni, G., D’Abreo, C., Wong,
G. K., Miller, T. L., Chan, Y., Atkins, J., Wang, Y. & Marsden, P. A. (1999). Characterization of the human endothelial nitric-oxide synthase promoter. J Biol Chem
274, 3076–3093.
Kaszubska, W., Hooft, v. H., Ghersa, P., DeRaemy-Schenk, A., Chen, B., Hai, T., DeLamarter, J. & Whelan, J. (1993). Cyclic AMP-independent ATF family members
interact with NF- kappa B and function in the activation of the E-selectin promoter
in response to cytokines. Mol.Cell Biol. 13, 7180–7190.
Katagiri, K., Kinashi, T., Irie, S. & Katagiri, T. (1996). Differential regulation of leukocyte
function-associated antigen-1/ intercellular adhesion molecules-1-dependent adhesion and aggregation in HL-60 cells. Blood 87, 4276–4285.
Kawamura, K., Ishikawa, K., Wada, Y., Kimura, S., Matsumoto, H., Kohro, T., Itabe, H.,
Kodama, T. & Maruyama, Y. (2005). Bilirubin from heme oxygenase-1 attenuates
vascular endothelial activation and dysfunction. Arterioscler.Thromb.Vasc.Biol. 25,
155–160.
Kelly, M., Hwang, J. & Kubes, P. (2007). Modulating leukocyte recruitment in inflammation. J.Allergy Clin.Immunol. 120, 3–10.
138
REFERENCES
Kempe, S., Kestler, H., Lasar, A. & Wirth, T. (2005). NF- kappa B controls the global
pro-inflammatory response in endothelial cells: evidence for the regulation of a proatherogenic program. Nucleic Acids Res. 33, 5308–5319.
Keshavan, P., Deem, T., Schwemberger, S., Babcock, G., Cook-Mills, J. & Zucker, S.
(2005). Unconjugated bilirubin inhibits VCAM-1-mediated transendothelial leukocyte migration. J.Immunol. 174, 3709–3718.
Keshavan, P., Schwemberger, S. J., Smith, D. L. H., Babcock, G. F. & Zucker, S. D.
(2004). Unconjugated bilirubin induces apoptosis in colon cancer cells by triggering
mitochondrial depolarization. Int J Cancer 112, 433–445.
Kleinert, H., Wallerath, T., Fritz, G., Ihrig-Biedert, I., Rodriguez-Pascual, F., Geller,
D. & Forstermann, U. (1998). Cytokine induction of NO synthase II in human
DLD-1 cells: roles of the JAK-STAT, AP-1 and NF- kappa B-signaling pathways.
Br.J.Pharmacol. 125, 193–201.
Kone, B. C. & Baylis, C. (1997). Biosynthesis and homeostatic roles of nitric oxide in the
normal kidney. Am J Physiol 272, F561–F578.
Koppenol, W. H., Moreno, J. J., Pryor, W. A., Ischiropoulos, H. & Beckman, J. S. (1992).
Peroxynitrite, a cloaked oxidant formed by nitric oxide and superoxide. Chem Res
Toxicol 5, 834–842.
Kuldo, J., Westra, J., Asgeirsdottir, S., Kok, R., Oosterhuis, K., Rots, M., Schouten, J.,
Limburg, P. & Molema, G. (2005). Differential effects of NF- kappa B and p38
MAPK inhibitors and combinations thereof on TNF- alpha - and IL-1 beta -induced
proinflammatory status of endothelial cells in vitro. Am.J.Physiol Cell Physiol 289,
C1229–C1239.
Kwok, R. P., Lundblad, J. R., Chrivia, J. C., Richards, J. P., Bchinger, H. P., Brennan,
R. G., Roberts, S. G., Green, M. R. & Goodman, R. H. (1994). Nuclear protein CBP
is a coactivator for the transcription factor CREB. Nature 370, 223–226.
Lai, P., Mohamed, F., Monge, J. & Stewart, D. (2003). Downregulation of eNOS mRNA
expression by TNF alpha : identification and functional characterization of RNAprotein interactions in the 3’UTR. Cardiovasc.Res. 59, 160–168.
139
REFERENCES
Lamas, S., Marsden, P. A., Li, G. K., Tempst, P. & Michel, T. (1992). Endothelial nitric oxide synthase: molecular cloning and characterization of a distinct constitutive
enzyme isoform. Proc Natl Acad Sci U S A 89, 6348–6352.
Landmesser, U., Harrison, D. & Drexler, H. (2006).
Oxidant stress-a major
cause of reduced endothelial nitric oxide availability in cardiovascular disease.
Eur.J.Clin.Pharmacol. 62 Suppl 13, 13–19.
Larsen, G., Sako, D., Ahern, T., Shaffer, M., Erban, J., Sajer, S., Gibson, R., Wagner,
D., Furie, B. & Furie, B. (1992). P-selectin and E-selectin. Distinct but overlapping
leukocyte ligand specificities. J.Biol.Chem. 267, 11104–11110.
Laumonnier, Y., Nadaud, S., Agrapart, M. & Soubrier, F. (2000). Characterization of
an upstream enhancer region in the promoter of the human endothelial nitric-oxide
synthase gene. J Biol Chem 275, 40732–40741.
Lee, J. Y., Je, J. H., Jung, K. J., Yu, B. P. & Chung, H. Y. (2004). Induction of endothelial
iNOS by 4-hydroxyhexenal through NF- kappa B activation. Free Radic Biol Med
37, 539–548.
Leone, A. M., Palmer, R. M., Knowles, R. G., Francis, P. L., Ashton, D. S. & Moncada,
S. (1991). Constitutive and inducible nitric oxide synthases incorporate molecular
oxygen into both nitric oxide and citrulline. J Biol Chem 266, 23790–23795.
Levinson, S. S. (1997). Relationship between bilirubin, apolipoprotein B, and coronary
artery disease. Ann Clin Lab Sci 27, 185–192.
Li, H., Cybulsky, M., Gimbrone, M.A., J. & Libby, P. (1993). Inducible expression of vascular cell adhesion molecule-1 by vascular smooth muscle cells in vitro and within
rabbit atheroma. Am.J.Pathol. 143, 1551–1559.
Li, J.-M., Mullen, A. M., Yun, S., Wientjes, F., Brouns, G. Y., Thrasher, A. J. & Shah,
A. M. (2002). Essential role of the NADPH oxidase subunit p47(phox) in endothelial
cell superoxide production in response to phorbol ester and tumor necrosis factoralpha. Circ Res 90, 143–150.
Li, X., Xing, D., Wang, J., Zhu, D.-B., Zhang, L., Chen, X.-J., Sun, F.-Y. & Hong, A.
(2006). Effects of I kappa B alpha and its mutants on NF- kappa B and p53 signaling
pathways. World J Gastroenterol 12, 6658–6664.
140
REFERENCES
Libby, P. (2002). Inflammation in atherosclerosis. Nature 420, 868–874.
Libby, P. & Aikawa, M. (2001). Evolution and stabilization of vulnerable atherosclerotic
plaques. Jpn.Circ.J. 65, 473–479.
Libby, P., Ridker, P. & Maseri, A. (2002). Inflammation and atherosclerosis. Circulation
105, 1135–1143.
Lin, C., Chen, L., Lee, P., Lee, C., Lin, J. & Chiu, J. (2007). The inhibition of TNFalpha -induced E-selectin expression in endothelial cells via the JNK/NF- kappa B
pathways by highly N-acetylated chitooligosaccharides. Biomaterials 28, 1355–
1366.
Link, E., Kerr, L. D., Schreck, R., Zabel, U., Verma, I. & Baeuerle, P. A. (1992). Purified
I kappa B- beta is inactivated upon dephosphorylation. J Biol Chem 267, 239–246.
Liu, J., Garca-Cardea, G. & Sessa, W. C. (1995). Biosynthesis and palmitoylation of
endothelial nitric oxide synthase: mutagenesis of palmitoylation sites, cysteines-15
and/or -26, argues against depalmitoylation-induced translocation of the enzyme.
Biochemistry 34, 12333–12340.
Liu, J., Garca-Cardea, G. & Sessa, W. C. (1996). Palmitoylation of endothelial nitric oxide
synthase is necessary for optimal stimulated release of nitric oxide: implications for
caveolae localization. Biochemistry 35, 13277–13281.
Liu, Y., Peterson, D. A., Kimura, H. & Schubert, D. (1997). Mechanism of cellular
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction. J
Neurochem 69, 581–593.
Liu, Y., Zhu, B., Wang, X., Luo, L., Li, P., Paty, D. & Cynader, M. (2003). Bilirubin as
a potent antioxidant suppresses experimental autoimmune encephalomyelitis: implications for the role of oxidative stress in the development of multiple sclerosis.
J.Neuroimmunol. 139, 27–35.
London, I., West, R., Shemin, D. & Rittenberg, D. (1950). On the origin of bile pigment
in normal man. J.Biol.Chem. 184, 351–358.
Lowenstein, C. J., Alley, E. W., Raval, P., Snowman, A. M., Snyder, S. H., Russell, S. W.
& Murphy, W. J. (1993). Macrophage nitric oxide synthase gene: two upstream
141
REFERENCES
regions mediate induction by interferon gamma and lipopolysaccharide. Proc Natl
Acad Sci U S A 90, 9730–9734.
Lowenstein, C. J. & Snyder, S. H. (1992). Nitric oxide, a novel biologic messenger. Cell
70, 705–707.
Lster, K. & Horstkorte, R. (2000). Enzymatic quantification of cell-matrix and cell-cell
adhesion. Micron 31, 41–53.
Maciag, T., Cerundolo, J., Ilsley, S., Kelley, P. & Forand, R. (1979). An endothelial cell
growth factor from bovine hypothalamus: identification and partial characterization.
Madamanchi, N., Vendrov, A. & Runge, M. (2005). Oxidative stress and vascular disease.
Arterioscler.Thromb.Vasc.Biol. 25, 29–38.
Madhavan, M., Wattigney, W. A., Srinivasan, S. R. & Berenson, G. S. (1997). Serum
bilirubin distribution and its relation to cardiovascular risk in children and young
adults. Atherosclerosis 131, 107–113.
Maines, M. D. (1997). The heme oxygenase system: a regulator of second messenger
gases. Annu Rev Pharmacol Toxicol 37, 517–554.
Malek, S., Chen, Y., Huxford, T. & Ghosh, G. (2001). I kappa B beta , but not I kappa
B alpha , functions as a classical cytoplasmic inhibitor of NF- kappa B dimers by
masking both NF- kappa B nuclear localization sequences in resting cells. J Biol
Chem 276, 45225–45235.
Mann, G. E., Yudilevich, D. L. & Sobrevia, L. (2003). Regulation of amino acid and
glucose transporters in endothelial and smooth muscle cells. Physiol Rev 83, 183–
252.
Marsden, P. A., Heng, H. H., Scherer, S. W., Stewart, R. J., Hall, A. V., Shi, X. M.,
Tsui, L. C. & Schappert, K. T. (1993). Structure and chromosomal localization of
the human constitutive endothelial nitric oxide synthase gene. J Biol Chem 268,
17478–17488.
Marshall, H. E., Merchant, K. & Stamler, J. S. (2000). Nitrosation and oxidation in the
regulation of gene expression. FASEB J 14, 1889–1900.
142
REFERENCES
Martin, R. D., Hoeth, M., Hofer-Warbinek, R. & Schmid, J. A. (2000). The transcription
factor NF- kappa B and the regulation of vascular cell function. Arterioscler Thromb
Vasc Biol 20, E83–E88.
Marui, N., Offermann, M., Swerlick, R., Kunsch, C., Rosen, C., Ahmad, M., Alexander,
R. & Medford, R. (1993). Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism
in human vascular endothelial cells. J.Clin.Invest 92, 1866–1874.
May, M. & Ghosh, S. (1998). Signal transduction through NF- kappa B. Immunol.Today
19, 80–88.
Mayr, B., Canettieri, G. & Montminy, M. (2001). Distinct effects of cAMP and mitogenic signals on CREB-binding protein recruitment impart specificity to target gene
activation via CREB. Proc.Natl.Acad.Sci.U.S.A 98, 10936–10941.
Mayr, B. & Montminy, M. (2001). Transcriptional regulation by the phosphorylationdependent factor CREB. Nat Rev Mol Cell Biol 2, 599–609.
McCoubrey, W. K., Huang, T. J. & Maines, M. D. (1997). Isolation and characterization
of a cDNA from the rat brain that encodes hemoprotein heme oxygenase-3. Eur J
Biochem 247, 725–732.
McDonagh, A. & Assisi, F. (1972). The ready isomerization of bilirubin IX- in aqueous
solution. Biochem.J. 129, 797–800.
McEver, R. P., Beckstead, J. H., Moore, K. L., Marshall-Carlson, L. & Bainton, D. F.
(1989). GMP-140, a platelet alpha -granule membrane protein, is also synthesized
by vascular endothelial cells and is localized in Weibel-Palade bodies. J Clin Invest
84, 92–99.
McGraw, R., Coffee, B., Otto, C., Drews, R. & Rawlings, C. (1990). Gene sequence of
feline tumor necrosis factor alpha . Nucleic Acids Res. 18, 5563–.
Michel, T., Li, G. K. & Busconi, L. (1993). Phosphorylation and subcellular translocation
of endothelial nitric oxide synthase. Proc Natl Acad Sci U S A 90, 6252–6256.
Minami, T., Miura, M., Aird, W. & Kodama, T. (2006). Thrombin-induced auto-inhibitory
factor, down syndrome critical region-1, attenuates NFAT-dependent vascular cell
143
REFERENCES
adhesion molecule-1 expression and inflammation in endothelium. J.Biol.Chem.
281, 20503–20520.
Mireles, L. C., Lum, M. A. & Dennery, P. A. (1999). Antioxidant and cytotoxic effects of
bilirubin on neonatal erythrocytes. Pediatr Res 45, 355–362.
Miyamoto, S., Maki, M., Schmitt, M. J., Hatanaka, M. & Verma, I. M. (1994). Tumor
necrosis factor alpha -induced phosphorylation of I kappa B alpha is a signal for its
degradation but not dissociation from NF- kappa B. Proc Natl Acad Sci U S A 91,
12740–12744.
Moncada, S. & Higgs, A. (1993). The L-arginine-nitric oxide pathway. N Engl J Med
329, 2002–2012.
Moncada, S., Palmer, R. M. & Higgs, E. A. (1991). Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol Rev 43, 109–142.
Moreau, R. (2002). Are nitric oxide synthases new players in the pathophysiology of
fulminant hepatic failure? J.Hepatol. 37, 678–680.
Mosmann, T. (1983). Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65, 55–63.
Muller, S., Kammerbauer, C., Simons, U., Shibagaki, N., Li, L., Caughman, S. & Degitz,
K. (1995). Transcriptional regulation of intercellular adhesion molecule-1: PMAinduction is mediated by NF kappa B. J.Invest Dermatol. 104, 970–975.
Munro, J., Lo, S., Corless, C., Robertson, M., Lee, N., Barnhill, R., Weinberg, D. &
Bevilacqua, M. (1992). Expression of sialyl-Lewis X, an E-selectin ligand, in inflammation, immune processes, and lymphoid tissues. Am.J.Pathol. 141, 1397–1408.
Muoz, C., Pascual-Salcedo, D., Castellanos, M. C., Alfranca, A., Aragons, J., Vara, A.,
Redondo, J. M. & de Landzuri, M. O. (1996). Pyrrolidine dithiocarbamate inhibits
the production of interleukin-6, interleukin-8, and granulocyte-macrophage colonystimulating factor by human endothelial cells in response to inflammatory mediators:
modulation of NF- kappa B and AP-1 transcription factors activity. Blood 88, 3482–
3490.
Murray, C. J. & Lopez, A. D. (1997). Global mortality, disability, and the contribution of
risk factors: Global Burden of Disease Study. Lancet 349, 1436–1442.
144
REFERENCES
Mustafa, M. G., Cowger, M. L. & King, T. E. (1969). Effects of bilirubin on mitochondrial
reactions. J Biol Chem 244, 6403–6414.
Nakagami, T., Toyomura, K., Kinoshita, T. & Morisawa, S. (1993). A beneficial role
of bile pigments as an endogenous tissue protector: anti-complement effects of
biliverdin and conjugated bilirubin. Biochim Biophys Acta 1158, 189–193.
Nathan, C. (1992). Nitric oxide as a secretory product of mammalian cells. FASEB J 6,
3051–3064.
Nathan, C. (2003). Specificity of a third kind: reactive oxygen and nitrogen intermediates
in cell signaling. J Clin Invest 111, 769–778.
Nathan, C. & Sporn, M. (1991). Cytokines in context. J Cell Biol 113, 981–986.
Nathan, C. & Xie, Q. W. (1994). Regulation of biosynthesis of nitric oxide. J Biol Chem
269, 13725–13728.
Neish, A., Williams, A., Palmer, H., Whitley, M. & Collins, T. (1992). Functional analysis
of the human vascular cell adhesion molecule 1 promoter. J.Exp.Med. 176, 1583–
1593.
Nelson, T., Jacobsen, J. & Wennberg, R. P. (1974). Effect of pH on the interaction of
bilirubin with albumin and tissue culture cells. Pediatr Res 8, 963–967.
Neufeld, A. & Liu, B. (2003). Comparison of the signal transduction pathways for the
induction of gene expression of nitric oxide synthase-2 in response to two different
stimuli. Nitric.Oxide. 8, 95–102.
Ngai, K. C. & Yeung, C. Y. (1999). Additive effect of tumor necrosis factoralpha and
endotoxin on bilirubin cytotoxicity. Pediatr Res 45, 526–530.
Ngai, K. C., Yeung, C. Y. & Karlberg, J. (1998). Modification of the MTT method for the
study of bilirubin cytotoxicity. Acta Paediatr Jpn 40, 313–317.
Ngai, K. C., Yeung, C. Y. & Leung, C. S. (2000). Difference in susceptibilities of different
cell lines to bilirubin damage. J Paediatr Child Health 36, 51–55.
Nims, R., Cook, J., Krishna, M., Christodoulou, D., Poore, C., Miles, A., Grisham, M.
& Wink, D. (1996). Colorimetric assays for nitric oxide and nitrogen oxide species
145
REFERENCES
formed from nitric oxide stock solutions and donor compounds. Methods Enzymol.
268, 93–105.
Nithipatikom, K., Pratt, P. F. & Campbell, W. B. (1996). Nitro-L-arginine inteferes with
the cadmium reduction of nitrate/griess reaction method of measuring nitric oxide
production. Eur J Clin Chem Clin Biochem 34, 133–137.
Notter, M. F. & Kendig, J. W. (1986). Differential sensitivity of neural cells to bilirubin
toxicity. Exp Neurol 94, 670–682.
Nunokawa, Y., Ishida, N. & Tanaka, S. (1994). Promoter analysis of human inducible
nitric oxide synthase gene associated with cardiovascular homeostasis. Biochem
Biophys Res Commun 200, 802–807.
O’Brien, A. J., Young, H. M., Povey, J. M. & Furness, J. B. (1995). Nitric oxide synthase is localized predominantly in the Golgi apparatus and cytoplasmic vesicles of
vascular endothelial cells. Histochem Cell Biol 103, 221–225.
O’Brien, T., Babcock, G., Cornelius, J., Dingeldein, M., Talaska, G., Warshawsky, D. &
Mitchell, K. (2000). A comparison of apoptosis and necrosis induced by hepatotoxins in HepG2 cells. Toxicol Appl Pharmacol 164, 280–290.
O’Brien, W., Heimann, T., Tsao, L., Seet, B., McFadden, G. & Taylor, J. (2001). Regulation of nitric oxide synthase 2 in rabbit corneal cells. Invest Ophthalmol.Vis.Sci. 42,
713–719.
Ollinger, R., Bilban, M., Erat, A., Froio, A., McDaid, J., Tyagi, S., Csizmadia, E., GraaSouza, A. V., Liloia, A., Soares, M. P., Otterbein, L. E., Usheva, A., Yamashita, K.
& Bach, F. H. (2005). Bilirubin: a natural inhibitor of vascular smooth muscle cell
proliferation. Circulation 112, 1030–1039.
Ono, H., Ichiki, T., Ohtsubo, H., Fukuyama, K., Imayama, I., Iino, N., Masuda, S.,
Hashiguchi, Y., Takeshita, A. & Sunagawa, K. (2006). cAMP-response elementbinding protein mediates tumor necrosis factoralpha -induced vascular cell adhesion molecule-1 expression in endothelial cells. Hypertens.Res. 29, 39–47.
Orpana, A., Ranta, V., Mikkola, T., Viinikka, L. & Ylikorkala, O. (1997). Inducible nitric
oxide and prostacyclin productions are differently controlled by extracellular matrix
and cell density in human vascular endothelial cells. J.Cell Biochem. 64, 538–546.
146
REFERENCES
Orthner, C. L., Rodgers, G. M. & Fitzgerald, L. A. (1995). Pyrrolidine dithiocarbamate
abrogates tissue factor (TF) expression by endothelial cells: evidence implicating
nuclear factorkappa B in TF induction by diverse agonists. Blood 86, 436–443.
Osborn, L., Hession, C., Tizard, R., Vassallo, C., Luhowskyj, S., Chi-Rosso, G. &
Lobb, R. (1989). Direct expression cloning of vascular cell adhesion molecule 1,
a cytokine-induced endothelial protein that binds to lymphocytes. Cell 59, 1203–
1211.
Osborn, L., Vassallo, C. & Benjamin, C. (1992). Activated endothelium binds lymphocytes through a novel binding site in the alternately spliced domain of vascular cell
adhesion molecule-1. J.Exp.Med. 176, 99–107.
Ostrow, J., Pascolo, L., Shapiro, S. & Tiribelli, C. (2003a). New concepts in bilirubin
encephalopathy. Eur.J.Clin.Invest 33, 988–997.
Ostrow, J., Pascolo, L. & Tiribelli, C. (2003b). Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro. Pediatr.Res. 54,
98–104.
Ostrow, J. D. (1986). Bile Pigments and Jaundice, vol. 4,. Marcel Dekker INC., 270
Madison Avenue, New York, New York.
Ostrow, J. D., Jandl, J. H. & Schmid, R. (1962). The formation of bilirubin from
hemoglobin in vivo. J Clin Invest 41, 1628–1637.
Ostrow, J. D. & Tiribelli, C. (2001a). Variation in UGT1A1 activity in Gilbert’s syndrome.
J Hepatol 34, 636–639.
Ostrow, J. D. & Tiribelli, C. (2001b). New concepts in bilirubin neurotoxicity and the need
for studies at clinically relevant bilirubin concentrations. J Hepatol 34, 467–470.
Ostrow, J. D. & Tiribelli, C. (2003). Bilirubin, a curse and a boon. Gut 52, 1668–1670.
Palmer, R. M., Ashton, D. S. & Moncada, S. (1988). Vascular endothelial cells synthesize
nitric oxide from L-arginine. Nature 333, 664–666.
Papapetropoulos, A., Garca-Cardea, G., Madri, J. A. & Sessa, W. C. (1997). Nitric oxide
production contributes to the angiogenic properties of vascular endothelial growth
factor in human endothelial cells. J Clin Invest 100, 3131–3139.
147
REFERENCES
Patterson, S. (2002). Posttranslational protein S-palmitoylation and the compartmentalization of signaling molecules in neurons. Biol.Res. 35, 139–150.
Pennica, D., Nedwin, G., Hayflick, J., Seeburg, P., Derynck, R., Palladino, M., Kohr,
W., Aggarwal, B. & Goeddel, D. (1984). Human tumour necrosis factor: precursor
structure, expression and homology to lymphotoxin. Nature 312, 724–729.
Petri, B. & Bixel, M. (2006). Molecular events during leukocyte diapedesis. FEBS J. 273,
4399–4407.
Pfaffl, M. (2001). A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29, e45–.
Pfeilschifter, J., Eberhardt, W. & Beck, K. F. (2001). Regulation of gene expression by
nitric oxide. Pflugers Arch 442, 479–486.
Pfeilschifter, J. & Vosbeck, K. (1991). Transforming growth factor beta 2 inhibits interleukin 1 beta - and tumour necrosis factor alpha -induction of nitric oxide synthase
in rat renal mesangial cells. Biochem Biophys Res Commun 175, 372–379.
Polte, T., Hemmerle, A., Berndt, G., Grosser, N., Abate, A. & Schrder, H. (2002). Atrial
natriuretic peptide reduces cyclosporin toxicity in renal cells: role of cGMP and
heme oxygenase-1. Free Radic Biol Med 32, 56–63.
Portal, D., Rosendorff, A. & Kieff, E. (2006). Epstein-Barr nuclear antigen leader protein
coactivates transcription through interaction with histone deacetylase 4. Proc Natl
Acad Sci U S A 103, 19278–19283.
Pratico, D. (2005). Antioxidants and endothelium protection. Atherosclerosis 181, 215–
224.
Quinlan, K., Naik, S., Cannon, G., Armstrong, C., Bunnett, N., Ansel, J. & Caughman,
S. (1999). Substance P activates coincident NF-AT- and NF- kappa B-dependent
adhesion molecule gene expression in microvascular endothelial cells through intracellular calcium mobilization. J.Immunol. 163, 5656–5665.
Radomski, M. W., Palmer, R. M. & Moncada, S. (1987). The role of nitric oxide and
cGMP in platelet adhesion to vascular endothelium. Biochem Biophys Res Commun
148, 1482–1489.
148
REFERENCES
Raines, E. W. & Ross, R. (1993). Smooth muscle cells and the pathogenesis of the lesions
of atherosclerosis. Br Heart J 69, S30–S37.
Raines, E. W. & Ross, R. (1995). Biology of atherosclerotic plaque formation: possible
role of growth factors in lesion development and the potential impact of soy. J Nutr
125, 624S–630S.
Raitakari, M., Ilvonen, T., Ahotupa, M., Lehtimki, T., Harmoinen, A., Suominen, P., Elo,
J., Hartiala, J. & Raitakari, O. T. (2004). Weight reduction with very-low-caloric diet
and endothelial function in overweight adults: role of plasma glucose. Arterioscler
Thromb Vasc Biol 24, 124–128.
Rajashekhar, G., Grow, M., Willuweit, A., Patterson, C. E. & Clauss, M. (2007). Divergent and convergent effects on gene expression and function in acute versus chronic
endothelial activation. Physiol Genomics 31, 104–113.
Rao, K. M. (2000). Molecular mechanisms regulating iNOS expression in various cell
types. J Toxicol Environ Health B Crit Rev 3, 27–58.
Read, M., Whitley, M., Gupta, S., Pierce, J., Best, J., Davis, R. & Collins, T. (1997). Tumor necrosis factor alpha -induced E-selectin expression is activated by the nuclear
factorkappa B and c-JUN N-terminal kinase/p38 mitogen-activated protein kinase
pathways. J.Biol.Chem. 272, 2753–2761.
Reiners, J. J. & Clift, R. E. (1999). Aryl hydrocarbon receptor regulation of ceramideinduced apoptosis in murine hepatoma 1c1c7 cells. A function independent of aryl
hydrocarbon receptor nuclear translocator. J Biol Chem 274, 2502–2510.
Rice, G. & Bevilacqua, M. (1989). An inducible endothelial cell surface glycoprotein
mediates melanoma adhesion. Science 246, 1303–1306.
Rice, G., Munro, J. & Bevilacqua, M. (1990).
Inducible cell adhesion molecule
110 (INCAM-110) is an endothelial receptor for lymphocytes. A CD11/CD18independent adhesion mechanism. J.Exp.Med. 171, 1369–1374.
Rice, N. R. & Ernst, M. K. (1993). In vivo control of NF- kappa B activation by I kappa
B alpha . EMBO J 12, 4685–4695.
Rigato, I., Ostrow, J. & Tiribelli, C. (2005). Bilirubin and the risk of common non-hepatic
diseases. Trends Mol.Med. 11, 277–283.
149
REFERENCES
Roca, L., Calligaris, S., Wennberg, R., Ahlfors, C., Malik, S., Ostrow, J. & Tiribelli, C.
(2006). Factors affecting the binding of bilirubin to serum albumins: validation and
application of the peroxidase method. Pediatr.Res. 60, 724–728.
Rodrigues, C., Sola, S., Brito, M., Brites, D. & Moura, J. (2002a). Bilirubin directly
disrupts membrane lipid polarity and fluidity, protein order, and redox status in rat
mitochondria. J.Hepatol. 36, 335–341.
Rodrigues, C., Sola, S., Silva, R. & Brites, D. (2002b). Aging confers different sensitivity
to the neurotoxic properties of unconjugated bilirubin. Pediatr.Res. 51, 112–118.
Ross, R. (1999). Atherosclerosis–an inflammatory disease. N Engl J Med 340, 115–126.
Rubbo, H., Trostchansky, A., Botti, H. & Batthyny, C. (2002). Interactions of nitric oxide
and peroxynitrite with low-density lipoprotein. Biol Chem 383, 547–552.
Rublevskaya, I. & Maines, M. D. (1994). Interaction of Fe-protoporphyrin IX and heme
analogues with purified recombinant heme oxygenase-2, the constitutive isozyme of
the brain and testes. J Biol Chem 269, 26390–26395.
Ryan, D., Nuccie, B., Abboud, C. & Winslow, J. (1991). Vascular cell adhesion molecule1 and the integrin VLA-4 mediate adhesion of human B cell precursors to cultured
bone marrow adherent cells. J.Clin.Invest 88, 995–1004.
Sakoda, T., Hirata, K., Kuroda, R., Miki, N., Suematsu, M., Kawashima, S. & Yokoyama,
M. (1995). Myristoylation of endothelial cell nitric oxide synthase is important for
extracellular release of nitric oxide. Mol Cell Biochem 152, 143–148.
Sase, K. & Michel, T. (1995). Expression of constitutive endothelial nitric oxide synthase
in human blood platelets. Life Sci 57, 2049–2055.
Saura, M., Martnez-Dalmau, R., Minty, A., Prez-Sala, D. & Lamas, S. (1996).
Interleukin-13 inhibits inducible nitric oxide synthase expression in human mesangial cells. Biochem J 313 ( Pt 2), 641–646.
Sawa, Y., Sugimoto, Y., Ueki, T., Ishikawa, H., Sato, A., Nagato, T. & Yoshida, S. (2007).
Effects of TNF- alpha on Leukocyte Adhesion Molecule Expressions in Cultured
Human Lymphatic Endothelium. J.Histochem.Cytochem. 55, 721–733.
Schiff, D., Chan, G. & Poznansky, M. J. (1985). Bilirubin toxicity in neural cell lines
N115 and NBR10A. Pediatr Res 19, 908–911.
150
REFERENCES
Schillinger, M., Mlekusch, W., Haumer, M., Sabeti, S., Maca, T. & Minar, E. (2002). Relation of small artery compliance and lipoprotein (a) in patients with atherosclerosis.
Am J Hypertens 15, 980–985.
Schoonbroodt, S. & Piette, J. (2000). Oxidative stress interference with the nuclear factorkappa B activation pathways. Biochem Pharmacol 60, 1075–1083.
Schreck, R., Meier, B., Mnnel, D. N., Drge, W. & Baeuerle, P. A. (1992). Dithiocarbamates as potent inhibitors of nuclear factor kappa B activation in intact cells. J Exp
Med 175, 1181–1194.
Schreck, R., Rieber, P. & Baeuerle, P. A. (1991). Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF- kappa B transcription
factor and HIV-1. EMBO J 10, 2247–2258.
Schreck, R., Zorbas, H., Winnacker, E. L. & Baeuerle, P. A. (1990). The NF- kappa B
transcription factor induces DNA bending which is modulated by its 65-kD subunit.
Nucleic Acids Res 18, 6497–6502.
Schubert, S., Neeman, I. & Resnick, N. (2002). A novel mechanism for the inhibition of
NF- kappa B activation in vascular endothelial cells by natural antioxidants. FASEB
J. 16, 1931–1933.
Schwartz, D., Mendonca, M., Schwartz, I., Xia, Y., Satriano, J., Wilson, C. & Blantz,
R. (1997). Inhibition of constitutive nitric oxide synthase (NOS) by nitric oxide
generated by inducible NOS after lipopolysaccharide administration provokes renal
dysfunction in rats. J.Clin.Invest 100, 439–448.
Schwenke, D. C. & Carew, T. E. (1989). Initiation of atherosclerotic lesions in cholesterolfed rabbits. II. Selective retention of LDL vs. selective increases in LDL permeability
in susceptible sites of arteries. Arteriosclerosis 9, 908–918.
Schwenke, D. C. & Zilversmit, D. B. (1989). The arterial barrier to lipoprotein influx in
the hypercholesterolemic rabbit. 1. Studies during the first two days after mild aortic
injury. Atherosclerosis 77, 91–103.
Schwertner, H., Jackson, W. & Tolan, G. (1994). Association of low serum concentration
of bilirubin with increased risk of coronary artery disease. Clin.Chem. 40, 18–23.
151
REFERENCES
Searles, C. D. (2006). Transcriptional and posttranscriptional regulation of endothelial
nitric oxide synthase expression. Am J Physiol Cell Physiol 291, C803–C816.
Sen, R. & Baltimore, D. (1986). Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46, 705–716.
Sessa, W. C., Garca-Cardea, G., Liu, J., Keh, A., Pollock, J. S., Bradley, J., Thiru, S.,
Braverman, I. M. & Desai, K. M. (1995). The Golgi association of endothelial nitric
oxide synthase is necessary for the efficient synthesis of nitric oxide. J Biol Chem
270, 17641–17644.
Seubert, J., Darmon, A., El Kadi, A., D’Souza, S. & Bend, J. (2002). Apoptosis in
murine hepatoma hepa 1c1c7 wild-type, C12, and C4 cells mediated by bilirubin.
Mol.Pharmacol. 62, 257–264.
Shapiro, S. (2003). Bilirubin toxicity in the developing nervous system. Pediatr.Neurol.
29, 410–421.
Shimabuku, R. & Nakamura, H. (1983). Drug-mediated displacement of bilirubin from
albumin in cultured cells. Jpn J Exp Med 53, 215–217.
Shimizu, Y., Newman, W., Tanaka, Y. & Shaw, S. (1992a). Lymphocyte interactions with
endothelial cells. Immunol.Today 13, 106–112.
Shimizu, Y., van Seventer, G. A., Ennis, E., Newman, W., Horgan, K. J. & Shaw, S.
(1992b). Crosslinking of the T cell-specific accessory molecules CD7 and CD28
modulates T cell adhesion. J Exp Med 175, 577–582.
Shirai, T., Yamaguchi, H., Ito, H., Todd, C. & Wallace, R. (1985). Cloning and expression
in Escherichia coli of the gene for human tumour necrosis factor. Nature 313, 803–
806.
Shizukuda, Y., Tang, S., Yokota, R. & Ware, J. A. (1999). Vascular endothelial growth
factor-induced endothelial cell migration and proliferation depend on a nitric oxidemediated decrease in protein kinase C delta activity. Circ Res 85, 247–256.
Sligh, J.E., J., Ballantyne, C., Rich, S., Hawkins, H., Smith, C., Bradley, A. & Beaudet,
A. (1993). Inflammatory and immune responses are impaired in mice deficient in
intercellular adhesion molecule 1. Proc.Natl.Acad.Sci.U.S.A 90, 8529–8533.
152
REFERENCES
Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano,
M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J. & Klenk, D. C. (1985). Measurement of protein using bicinchoninic acid. Anal Biochem 150, 76–85.
Soares, M. P., Seldon, M. P., Gregoire, I. P., Vassilevskaia, T., Berberat, P. O., Yu, J.,
Tsui, T.-Y. & Bach, F. H. (2004). Heme oxygenase-1 modulates the expression of
adhesion molecules associated with endothelial cell activation. J Immunol 172,
3553–3563.
Springer, T. A. (1990). Adhesion receptors of the immune system. Nature 346, 425–434.
Stanley, P. & Hogg, N. (1998). The I domain of integrin LFA-1 interacts with ICAM-1
domain 1 at residue Glu-34 but not Gln-73. J.Biol.Chem. 273, 3358–3362.
Stary, H. C., Chandler, A. B., Dinsmore, R. E., Fuster, V., Glagov, S., Insull, W., Rosenfeld, M. E., Schwartz, C. J., Wagner, W. D. & Wissler, R. W. (1995). A definition
of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on
Arteriosclerosis, American Heart Association. Arterioscler Thromb Vasc Biol 15,
1512–1531.
Stary, H. C., Chandler, A. B., Glagov, S., Guyton, J. R., Insull, W., Rosenfeld, M. E.,
Schaffer, S. A., Schwartz, C. J., Wagner, W. D. & Wissler, R. W. (1994). A definition
of initial, fatty streak, and intermediate lesions of atherosclerosis. A report from the
Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart
Association. Arterioscler Thromb 14, 840–856.
Staunton, D., Dustin, M., Erickson, H. & Springer, T. (1990). The arrangement of the
immunoglobulin-like domains of ICAM-1 and the binding sites for LFA-1 and rhinovirus. Cell 61, 243–254.
Staunton, D., Dustin, M. & Springer, T. (1989). Functional cloning of ICAM-2, a cell
adhesion ligand for LFA-1 homologous to ICAM-1. Nature 339, 61–64.
Stocker, R. & Keaney, J.F., J. (2004). Role of oxidative modifications in atherosclerosis.
Physiol Rev 84, 1381–1478.
Stocker, R. & Peterhans, E. (1989).
Antioxidant properties of conjugated biliru-
bin and biliverdin: biologically relevant scavenging of hypochlorous acid. Free
Radic.Res.Commun. 6, 57–66.
153
REFERENCES
Stocker, R., Yamamoto, Y., McDonagh, A., Glazer, A. & Ames, B. (1987). Bilirubin is
an antioxidant of possible physiological importance. Science 235, 1043–1046.
Stroes, E. S., van Faassen, E. E., van Londen, G. J. & Rabelink, T. J. (1998). Oxygen
radical stress in vascular disease: the role of endothelial nitric oxide synthase. J
Cardiovasc Pharmacol 32 Suppl 3, S14–S21.
Stuehr, D., Pou, S. & Rosen, G. M. (2001). Oxygen reduction by nitric-oxide synthases.
J Biol Chem 276, 14533–14536.
Stuehr, D. J. & Griffith, O. W. (1992). Mammalian nitric oxide synthases. Adv Enzymol
Relat Areas Mol Biol 65, 287–346.
Szmitko, P. E., Wang, C.-H., Weisel, R. D., de Almeida, J. R., Anderson, T. J. & Verma,
S. (2003a). New markers of inflammation and endothelial cell activation: Part I.
Circulation 108, 1917–1923.
Szmitko, P. E., Wang, C.-H., Weisel, R. D., Jeffries, G. A., Anderson, T. J. & Verma, S.
(2003b). Biomarkers of vascular disease linking inflammation to endothelial activation: Part II. Circulation 108, 2041–2048.
Szotowski, B., Antoniak, S., Goldin-Lang, P., Tran, Q., Pels, K., Rosenthal, P., Bogdanov, V., Borchert, H., Schultheiss, H. & Rauch, U. (2007). Antioxidative treatment
inhibits the release of thrombogenic tissue factor from irradiation- and cytokineinduced endothelial cells. Cardiovasc.Res. 73, 806–812.
Taille, C., Almolki, A., Benhamed, M., Zedda, C., Megret, J., Berger, P., Leseche,
G., Fadel, E., Yamaguchi, T., Marthan, R., Aubier, M. & Boczkowski, J. (2003).
Heme oxygenase inhibits human airway smooth muscle proliferation via a bilirubindependent modulation of ERK1/2 phosphorylation. J.Biol.Chem 278, 27160–
27168.
Takeichi, M. (1988). The cadherins: cell-cell adhesion molecules controlling animal morphogenesis. Development 102, 639–655.
Tamada, S., Asai, T., Kuwabara, N., Iwai, T., Uchida, J., Teramoto, K., Kaneda, N.,
Yukimura, T., Komiya, T., Nakatani, T. & Miura, K. (2006). Molecular mechanisms
and therapeutic strategies of chronic renal injury: the role of nuclear factor kappa B
activation in the development of renal fibrosis. J Pharmacol Sci 100, 17–21.
154
REFERENCES
Tang, J. L., Zembowicz, A., Xu, X. M. & Wu, K. K. (1995). Role of Sp1 in transcriptional activation of human nitric oxide synthase type III gene. Biochem Biophys Res
Commun 213, 673–680.
Tardif, J., Heinonen, T., Orloff, D. & Libby, P. (2006). Vascular biomarkers and surrogates
in cardiovascular disease. Circulation 113, 2936–2942.
Taylor, B. S., de Vera, M. E., Ganster, R. W., Wang, Q., Shapiro, R. A., Morris, S. M.,
Billiar, T. R. & Geller, D. A. (1998). Multiple NF- kappa B enhancer elements
regulate cytokine induction of the human inducible nitric oxide synthase gene. J
Biol Chem 273, 15148–15156.
Taylor, B. S. & Geller, D. A. (2000). Molecular regulation of the human inducible nitric
oxide synthase (iNOS) gene. Shock 13, 413–424.
Tedder, T., Steeber, D., Chen, A. & Engel, P. (1995). The selectins: vascular adhesion
molecules. FASEB J. 9, 866–873.
Teng, B., Murthy, K. S., Kuemmerle, J. F., Grider, J. R., Sase, K., Michel, T. & Makhlouf,
G. M. (1998). Expression of endothelial nitric oxide synthase in human and rabbit
gastrointestinal smooth muscle cells. Am J Physiol 275, G342–G351.
Tenhunen, R., Marver, H. & Schmid, R. (1968). The enzymatic conversion of heme to
bilirubin by microsomal heme oxygenase. Proc.Natl.Acad.Sci.U.S.A 61, 748–755.
Thaler, M. M. (1971). Bilirubin toxicity in hepatoma cells. Nat New Biol 230, 218–219.
Tichopad, A., Didier, A. & Pfaffl, M. W. (2004). Inhibition of real-time RT-PCR quantification due to tissue-specific contaminants. Mol Cell Probes 18, 45–50.
Tomaro, M. & Batlle, A. (2002). Bilirubin: its role in cytoprotection against oxidative
stress. Int.J.Biochem.Cell Biol. 34, 216–220.
Traenckner, E. B., Wilk, S. & Baeuerle, P. A. (1994). A proteasome inhibitor prevents
activation of NF- kappa B and stabilizes a newly phosphorylated form of I kappa Balpha that is still bound to NF- kappa B. EMBO J 13, 5433–5441.
Urban, M. B., Schreck, R. & Baeuerle, P. A. (1991). NF- kappa B contacts DNA by a
heterodimer of the p50 and p65 subunit. EMBO J 10, 1817–1825.
155
REFERENCES
Van, Ostade, X., Tavernier, J., Prange, T. & Fiers, W. (1991). Localization of the active
site of human tumour necrosis factor (hTNF) by mutational analysis. EMBO J. 10,
827–836.
van Buul, J., Kanters, E. & Hordijk, P. (2007). Endothelial signaling by Ig-like cell
adhesion molecules. Arterioscler.Thromb.Vasc.Biol. 27, 1870–1876.
van de Stolpe, A. & van der Saag, P. T. (1996). Intercellular adhesion molecule-1. J Mol
Med 74, 13–33.
van der Wal, A., Becker, A., van der Loos, C. & Das, P. (1994). Site of intimal rupture
or erosion of thrombosed coronary atherosclerotic plaques is characterized by an
inflammatory process irrespective of the dominant plaque morphology. Circulation
89, 36–44.
Vaziri, N. D. & Wang, X. Q. (1999). cGMP-mediated negative-feedback regulation of
endothelial nitric oxide synthase expression by nitric oxide. Hypertension 34, 1237–
1241.
Venema, R. C., Nishida, K., Alexander, R. W., Harrison, D. G. & Murphy, T. J. (1994).
Organization of the bovine gene encoding the endothelial nitric oxide synthase.
Biochim Biophys Acta 1218, 413–420.
Verma, I., Stevenson, J., Schwarz, E., Van Antwerp, D. & Miyamoto, S. (1995). Rel/NFkappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev.
9, 2723–2735.
Vestweber, D. & Blanks, J. (1999). Mechanisms that regulate the function of the selectins
and their ligands. Physiol Rev. 79, 181–213.
Vincent, S. R. & Hope, B. T. (1992). Neurons that say NO. Trends Neurosci 15, 108–113.
Vincent, S. R. & Kimura, H. (1992). Histochemical mapping of nitric oxide synthase in
the rat brain. Neuroscience 46, 755–784.
Virdis, A., Ghiadoni, L., Cardinal, H., Favilla, S., Duranti, P., Birindelli, R., Magagna,
A., Bernini, G., Salvetti, G., Taddei, S. & Salvetti, A. (2001). Mechanisms responsible for endothelial dysfunction induced by fasting hyperhomocystinemia in
normotensive subjects and patients with essential hypertension. J Am Coll Cardiol
38, 1106–1115.
156
REFERENCES
Vitek, L., Jirsa, M., Brodanova, M., Kalab, M., Marecek, Z., Danzig, V., Novotny, L. &
Kotal, P. (2002). Gilbert syndrome and ischemic heart disease: a protective effect of
elevated bilirubin levels. Atherosclerosis 160, 449–456.
Vodovotz, Y., Bogdan, C., Paik, J., Xie, Q. W. & Nathan, C. (1993). Mechanisms of
suppression of macrophage nitric oxide release by transforming growth factor beta .
J Exp Med 178, 605–613.
Vodovotz, Y., Kwon, N. S., Pospischil, M., Manning, J., Paik, J. & Nathan, C. (1994). Inactivation of nitric oxide synthase after prolonged incubation of mouse macrophages
with IFN- gamma and bacterial lipopolysaccharide. J Immunol 152, 4110–4118.
Voraberger, G., Schafer, R. & Stratowa, C. (1991). Cloning of the human gene for intercellular adhesion molecule 1 and analysis of its 5’-regulatory region. Induction by
cytokines and phorbol ester. J.Immunol. 147, 2777–2786.
Wagner, D. (2005).
New links between inflammation and thrombosis.
Arte-
rioscler.Thromb.Vasc.Biol. 25, 1321–1324.
Wang, H.-D., Yamaya, M., Okinaga, S., Jia, Y.-X., Kamanaka, M., Takahashi, H., Guo,
L.-Y., Ohrui, T. & Sasaki, H. (2002). Bilirubin ameliorates bleomycin-induced pulmonary fibrosis in rats. Am J Respir Crit Care Med 165, 406–411.
Wang, W., Smith, D. & Zucker, S. (2004). Bilirubin inhibits iNOS expression and NO
production in response to endotoxin in rats. Hepatology 40, 424–433.
Warnock, R., Askari, S., Butcher, E. & von Andrian, U. (1998). Molecular mechanisms
of lymphocyte homing to peripheral lymph nodes. J.Exp.Med. 187, 205–216.
Wei, P., Zhang, J., Egan-Hafley, M., Liang, S. & Moore, D. D. (2000). The nuclear
receptor CAR mediates specific xenobiotic induction of drug metabolism. Nature
407, 920–923.
Weisiger, R., Ostrow, J., Koehler, R., Webster, C., Mukerjee, P., Pascolo, L. & Tiribelli, C.
(2001). Affinity of human serum albumin for bilirubin varies with albumin concentration and buffer composition: results of a novel ultrafiltration method. J.Biol.Chem
276, 29953–29960.
Wennberg, R. P., Ahlfors, C. E. & Rasmussen, L. F. (1979). The pathochemistry of
kernicterus. Early Hum Dev 3, 353–372.
157
REFERENCES
Wever, R., Luscher, T., Cosentino, F. & Rabelink, T. (1998). Atherosclerosis and the two
faces of endothelial nitric oxide synthase. Circulation 97, 108–112.
Whelan, J., Ghersa, P., Hooft, v. H., Gray, J., Chandra, G., Talabot, F. & DeLamarter, J.
(1991). An NF kappa B-like factor is essential but not sufficient for cytokine induction of endothelial leukocyte adhesion molecule 1 (ELAM-1) gene transcription.
Nucleic Acids Res. 19, 2645–2653.
Wylie, D. E., Damsky, C. H. & Buck, C. A. (1979). Studies on the function of cell
surface glycoproteins. I. Use of antisera to surface membranes in the identification
of membrane components relevant to cell-substrate adhesion. J Cell Biol 80, 385–
402.
Xie, Q. & Nathan, C. (1994). The high-output nitric oxide pathway: role and regulation.
J Leukoc Biol 56, 576–582.
Xie, Q. W. & Nathan, C. (1993).
Promoter of the mouse gene encoding calcium-
independent nitric oxide synthase confers inducibility by interferon- gamma and
bacterial lipopolysaccharide. Trans Assoc Am Physicians 106, 1–12.
Yang, B. & Rizzo, V. (2007). TNF- alpha potentiates protein-tyrosine nitration through
activation of NADPH oxidase and eNOS localized in membrane rafts and caveolae
of bovine aortic endothelial cells. Am J Physiol Heart Circ Physiol 292, H954–
H962.
Yoshizumi, M., Perrella, M. A., Burnett, J. C. & Lee, M. E. (1993). Tumor necrosis factor
downregulates an endothelial nitric oxide synthase mRNA by shortening its half-life.
Circ Res 73, 205–209.
Young, J., Libby, P. & Schonbeck, U. (2002). Cytokines in the pathogenesis of atherosclerosis. Thromb.Haemost. 88, 554–567.
Yu, Z., Zhang, W. & Kone, B. C. (2002a). Histone deacetylases augment cytokine induction of the iNOS gene. J Am Soc Nephrol 13, 2009–2017.
Yu, Z., Zhang, W. & Kone, B. C. (2002b). Signal transducers and activators of transcription 3 (STAT3) inhibits transcription of the inducible nitric oxide synthase gene by
interacting with nuclear factor kappa B. Biochem J 367, 97–105.
158
REFERENCES
Zadeh, M. S., Kolb, J. P., Geromin, D., D’Anna, R., Boulmerka, A., Marconi, A., Dugas,
B., Marsac, C. & D’Alessio, P. (2000). Regulation of ICAM-1/CD54 expression on
human endothelial cells by hydrogen peroxide involves inducible NO synthase. J
Leukoc Biol 67, 327–334.
Zeiher, A. (1996). Endothelial vasodilator dysfunction: pathogenetic link to myocardial
ischaemia or epiphenomenon? Lancet 348 Suppl 1, s10–s12.
Zerfaoui, M., Suzuki, Y., Naura, A. S., Hans, C. P., Nichols, C. & Boulares, A. H. (2008).
Nuclear translocation of p65 NF- kappa B is sufficient for VCAM-1, but not ICAM1, expression in TNF-stimulated smooth muscle cells: Differential requirement for
PARP-1 expression and interaction. Cell Signal 20, 186–194.
Zernecke, A. & Weber, C. (2005). Inflammatory mediators in atherosclerotic vascular
disease. Basic Res Cardiol 100, 93–101.
Zhang, H., Chen, X., Teng, X., Snead, C. & Catravas, J. D. (1998). Molecular cloning
and analysis of the rat inducible nitric oxide synthase gene promoter in aortic smooth
muscle cells. Biochem Pharmacol 55, 1873–1880.
Zhang, J., Patel, J. M. & Block, E. R. (1997). Molecular cloning, characterization and expression of a nitric oxide synthase from porcine pulmonary artery endothelial cells.
Comp Biochem Physiol B Biochem Mol Biol 116, 485–491.
Zhang, Y. & Chen, F. (2004). Reactive oxygen species (ROS), troublemakers between
nuclear factorkappa B (NF- kappa B) and c-Jun NH(2)-terminal kinase (JNK).
Cancer Res 64, 1902–1905.
Zhu, B., Carr, A. & Frei, B. (2002). Pyrrolidine dithiocarbamate is a potent antioxidant
against hypochlorous acid-induced protein damage. FEBS Lett. 532, 80–84.
Zimmermann, H., Kurzen, P., Klossner, W., Renner, E. L. & Marti, U. (1996). Decreased
constitutive hepatic nitric oxide synthase expression in secondary biliary fibrosis
and its changes after Roux-en-Y choledocho-jejunostomy in the rat. J Hepatol 25,
567–573.
Zucker, S., Goessling, W., Ransil, B. & Gollan, J. (1995). Influence of glutathione Stransferase B (ligandin) on the intermembrane transfer of bilirubin. Implications for
the intracellular transport of nonsubstrate ligands in hepatocytes. J.Clin.Invest 96,
1927–1935.
159
REFERENCES
Zucker, S. D., Goessling, W. & Hoppin, A. G. (1999). Unconjugated bilirubin exhibits
spontaneous diffusion through model lipid bilayers and native hepatocyte membranes. J Biol Chem 274, 10852–10862.
160
REPRINTS
161
Multidrug resistance associated protein 1 protects against bilirubin-induced
cytotoxicity
163
Reprints
164
165
Reprints
166
167
Unconjugated bilirubin prevents the TNF-α related induction of three endothelial adhesion molecules via the NF-κB pathway
169

UNIVERSIT`A DEGLI STUDI DI TRIESTE Role of

Transcription

Similar documents

Pericytes promote selective vessel regression to regulate vascular

Endo-PAT2000 - Arterial Health

Jaundice in the Healthy Term Infant

Are Incomplete Denitrification Pathways a Common Trait in Thermus

NUSRAT ADUSEI HAMENOO - Kwame Nkrumah University of

diseases - Journal of Medical Genetics

fulltext01

HTM 2022 Medical gas pipeline systems: Design

The Chemistry of Powder and Explosives

The IZKF Aachen in 2011 - RWTH Aachen University