untranslated region polymorphism and Plasma VEGF

Comments

Transcription

untranslated region polymorphism and Plasma VEGF
American Journal of Biotechnology and Medical Research
www.scopemed.org
DOI: 10.5455/ajbmr.20160613040736
Original Research
Association of Vascular endothelial growth factor
+405G>C 5’-untranslated region polymorphism and
Plasma VEGF levels in Breast cancer patients
Rani james, Shilpa Chadaga, Lakshmi Krishnamoorthy, Girija Ramaswamy
Dept. of Biochemistry, Kidwai
Memorial Institute of Oncology,
Dr.M.H.Marigowda Road,
Bangalore India
Address for correspondence:
Rani james,
Research Fellow Dept.
of Biochemistry, Kidwai
Memorial Institute of Oncology,
Dr.M.H.Marigowda Road, Bangalore
-560 029. India.
[email protected]
Received: May 13, 2015
Accepted: June 13, 2016
Published: July 01, 2016
ABSTRACT
Objective: Angiogenesis is necessary for tumor growth, invasion, and metastasis. A key mediator in neoangiogenesis is
vascular endothelial growth factor (VEGF). DNA sequence variations in the VEGF gene may lead to altered VEGFexpression
and/or activity, thereby causing interindividual differences in the susceptibility to breast cancer via their actions on the
pathways of tumor angiogenesis. This study was undertaken to study the prevalence of VEGF +405G>C polymorphisms
in Indian population and its association with plasma VEGF levels. Methods: The study comprised 200 patients with
histologically confirmed patients of Breast cancer and 200 normal healthy females as controls. Polymerase chain
reaction and restriction fragment length polymorphism were used for genotyping of VEGF +405G>C polymorphism.
Preoperative plasma VEGF levels were determined by enzyme-linked immunosorbant assay (ELISA) in patients and controls.
Results: Amongst both patients and controls, the genotypic distribution of the VEGF +405G>C polymorphism were in
consistent with Hardy–Weinberg equilibrium. Mean VEGF level was significantly elevated in patients compared to controls
(t=8.248; P<0.001). Plasma VEGF levels correlated significantly with clinical stage of the disease (P=0.035). Significantly
elevated levels of VEGF(P<0.001) were seen in patients with the ‘+405GG&GC’ genotype when compared with the
respective control group. Conclusion: Since all the three genotype +405(GG,GC&CC) were showing an increased plasma
VEGF levels, our study did not prove that mutant CC genotype is associated with higher VEGF expression. But we have
found that plasma VEGF levels were significantly correlated with clinical stage of the disease. This may help to differentiate
the subgroups of patients with poor prognosis who may benefit from validated anti-VEGF treatments.
KEY WORDS: Breast cancer,VEGF Polymorphism, Genotype, ELISA
INTRODUCTION
Breast cancer is the most frequently diagnosed cancer
and the leading cause of cancer death among females,
accounting for 23% of the total cancer patients and 14%
of the cancer deaths[1]. Presently, 75,000 new patients of
breast cancer occur in Indian women every year [2].
Breast cancer can be separated mainly into two types Ductal
carcinoma and Lobular carcinoma.Ductal carcinoma in situ
is the proliferation of malignant epithelial cells confined to
ducts, with no evidence of invasion through the basement
membrane. Invasive ductal carcinoma (IDC) is the most
common type of breast cancer. Invasive ductal carcinoma
starts in a milk passage (duct) of the breast, breaks through
the wall of the duct, and grows into the fatty tissue of the
breast[3,4]. Lobular carcinoma in situ refers to cancer
cells that have formed in the milk glands and are still
confined there. Invasive lobular carcinoma (ILC) starts
in the milk-producing glands (lobules). Like IDC, it can
spread (metastasize) to other parts of the body[5,6]. Most
studies divide breast cancer into four major molecular
subtypes:Luminal A;Luminal B;Triple negative/basallike;HER2 type. . Luminal tumors have cells that look like
those of breast cancers that start in the inner (luminal)
cells lining the mammary ducts.Luminal A tumors tend
to be:ER-positive and/or PR-positive,HER2-negative and
10
Tumor grade 1 or 2, Luminal B tumors tend to be:ERpositive and/or PR-positive; Highly positive for Ki67 and/
or HER2-positive[7].
Recent epidemiological data have shown a significant
decline in breast cancer mortality over the past 15 years,
as a result of screening programs, better education, and
the introduction of more effective adjuvant treatments
[8]. Unfortunately, about 25%–40% of patients eventually
develop metastatic disease that, in spite of advances in
treatment strategies, is still largely incurable. Results from
experimental studies suggest that tumor progression and
metastasis in breast cancer are angiogenesis dependent[9].
A key mediator in neoangiogenesis is vascular endothelial
growth factor (VEGF) as it stimulates endothelial cell
proliferation and migration, and increases vascular
permeability [10,11]; it is therefore regarded as a marker
of tumour invasion and metastasis [12]. Overexpression
of VEGF has been shown in various cancers [13]. Several
polymorphisms in the VEGF gene have been reported to
affect the expression of the gene [14-17] .SNPs within
the VEGF gene have been identified, some of which have
functional significance. For example, the +405G>C
polymorphisms in the 5’- untranslated region has a
significant effect on VEGF protein expression [18]. G→C
transition at +405 in the 5’-untranslated (5’-UTR) region
Am J Biotech Med Res ● 2016 ● Vol 1 ● Issue 1
James, et al.: VEGF polymorphism and Breast cancer
has been implicated in a number of diseases, especially
those with angiogenic basis [17,19]. VEGF protein
expression was found to be associated with +405 G>C
polymorphism in controls [18]. Association has been
reported in Breast cancer patient–control studies between
VEGF polymorphisms and diseases such as diabetic
retinopathy [17], ovarian cancer [20] and endometriosis
[21].
A few studies [17,22,23] have reported that +405
G>C VEGF polymorphisms are associated with VEGF
expression, but the results are inconsistent. Awata et al
[17] reported that individuals with the +405 CC genotype
had a higher fasting serum VEGF level than those with
other genotypes, and that they carried an increased risk
of diabetic retinopathy. On the other hand, Watson et
al. [18] reported that the +405G allele is associated with
higher lipopolysaccharide-stimulated VEGF expression by
peripheral blood mononuclear cells than the +405C allele.
Among Indians Suganthalakshmi et al. [24] found that the
CG genotype was associated with retinopathy. Similarly
Manjula et al [21] also reported that +405G allele in the
5’-UTR region of VEGF gene may influence the likelihood
of a woman developing endometriosis.
In spite of the importance of angiogenesis in Breast
cancer , there have been no published studies on the
association of VEGF gene polymorphism and Breast cancer
among Indians. In the present study, we investigated the
relationship between +405G>C genetic polymorphism in
the VEGF gene and the development of breast cancer.
MATERIALS AND METHODS
Patient Population
Histologically confirmed patients of Breast cancer samples
were obtained from 200 patients registered (2008to2009)
in the Breast service unit of Kidwai Memorial Institute
of Oncology. Carcinomas included 96% invasive ductal
and 4% invasive lobular types. Patient’s age, stage, grade,
nodal status, estrogen receptor(ER) and progesterone
receptor (PR) status were noted from the case files. Age
matched (+5 years) normal healthy females were selected
as controls (200) . The study protocol was approved by the
Institutional Ethical Committee and Informed consent
was obtained from the patients/relatives of the subjects
under study. All the participants of the study belonged to
the same ethnic group.
The age limit for both populations was set at 21‑81 years.
The mean age for the cases was 48.80 ± 11.37 and for the
control group was 47.29 ± 10.75 years. A preponderance of
the patients was postmenopausal 73 (36.5%) and received
no prior adjuvant therapy. Out of the 200 cases, 113 patients
were node‑positive and 87 cases were node‑negative.
Majority of the patients were in Stage II A followed by
Stage III B. Most of the study subjects are in Grade III. Out
of the 200 breast cancer cases, only 26 cases (13%) were
showing distant metastasis.
Am J Biotech Med Res ● 2016 ● Vol 1 ● Issue 1
Sample
About 5 ml of blood was collected from each subject after
an overnight fast by routine venipuncture. The blood
sample was then distributed into different tubes for the
assays of various biochemical parameters.
DNA extraction DNA for PCR-RFLP analysis was extracted
from leukocytes isolated from whole blood by using DNA
extraction kit (Genei)
Genotyping of the VEGF polymorphism
Genotyping of the +405G>C polymorphisms in the 5’
UTR of the VEGF gene was determined by PCR /RFLP
analysis. The method described by Monika et al.[20] was
used for the detection of +405G>C polymorphism. PCR
was carried out in a total volume of 30 µl, containing 200
ng genomic DNA, 1.5µmol of each primer (Sigma,USA),
IX Taq polymerase buffer (1.5mM MgCl2) and 1U of
Taq DNA polymerase (Bangalore Genie, India). For
the +405G>C polymorphism the forward and reverse
primers were 5’-ATTTATTTTTGCTTGCCATT -3’ and
5’ - GTCTGTCTGTCTGTCCGTCA – 3’respectively.PCR
amplification was performed in a programmable thermal
cycler gradient PCR system (Eppendorf AG, Hamburg,
Germany). Genomic DNA was amplified in a final volume
of 30 µl using the following conditions: Initial denaturation
at 950C for 5 min followed by 35 cycles at 940C for 1 min,
570C for 1.5 min and 720C for 1 min. A final extension was
at 720C for 10 min. The PCR product was digested with the
BsmFI restriction endonuclease. (New England Biolabs,
USA) at 65°C overnight for the +405 G>C polymorphism,
separated by 2% agarose gel electrophoresis, and identified
using ethidium bromide staining. For the VEGF +405
polymorphism the uncut fragment was 304 bp (C allele)
and digestion products were 193 and 111 bp (G allele).
Plasma VEGF
Plasma VEGF levels ranged from 11 to 876 pg/ml among
breast cancer patients and a range of less than minimum
detectable level (i.e. <9pg/ml) to 136.0 pg/ml among
controls. The results we have got is similar to the result
published by Rodreiguez et al [28], who used a similar
method for the detection of plasma VEGF.
Plasma is the preferred medium to measure VEGF levels,
because a significant and highly variable platelet-mediated
secretion of VEGF during the clotting process would
invalidate the use of serum as an indicator of circulating
VEGF levels in both controls.[29]
Plasma VEGF levels were determined in 200
patients using commercially available enzyme-linked
immunoassay (ELISA) designed to measure VEGF levels
(Quantikine,R&D Systems Minneapolis, MN).The
assay exhibits no significant cross-reactivity with other
angiogenesis factors and has a sensitivity of 9.0 pg/ml.
Optical density was measured at 450 nm using a microtitre
plate reader (TECAN ELISA READER). A standard curve
11
James, et al.: VEGF polymorphism and Breast cancer
was prepared from 2000pg/ml stock standard VEGF by
serially diluting as 31.2, 62.5,125,250,500,1000 with assay
buffer and sample concentrations were determined.
cut-off value VEGF–ELISA and Diagnostic value.
ELISA
A preponderance of the patients were postmenopausal
and received no prior adjuvant therapy. The median age of
the patients was 48 years (range 25 -75 years). 73 patients
were premenopausal, 127 patients were postmenopausal.
Clinically healthy individuals were used as controls.
RESULTS
Aliquot 0.1ml per well of the 2000pg/ml, 1000pg/ml, 500pg/
ml, 250pg/ml, 125pg/ml, 62.5pg/ml, 31.2pg/ml human
VEGF standard solutions into the precoated 96-well plate.
Add 0.1ml of the sample diluent buffer into the control well
(Zero well). Add 0.1ml of each properly diluted sample of
human sera, plasma, body fluids, tissue lysates or cell culture
supernatants to each empty well. Seal the plate with the cover
and incubate at RT for 2hrs. Remove the cover, discard plate
content and wash the plate three times with wash buffer .
Add 0.1ml of biotinylated anti-human VEGF antibody
working solution into each well and incubate the plate at
RT for 2hrs. Wash the plate three times with wash buffer.
Add 0.2ml of prepared Substrate solution into each well and
incubate the plate at RT for 25min. Wash plate 3 t with
times with wash buffer. Add 0.2ml of prepared stop solution
into each well. The color changes into yellow immediately.
Read the O.D. absorbance at 450nm in a microplate reader
within 30 min after adding the stop solution.
Genotype frequencies for the VEGF +405 SNPs are
summarized in Table 1. Amongst both patients and controls,
the genotypic distributions of the individual SNPs as well
as the VEGF allele system were all in Hardy–Weinberg
equilibrium (Table 2). The +405 Genotype frequencies
amongst the 200 patients were GG=44.5%, GC=44% and
CC=11.5%. The +405 Genotype frequencies amongst the
200 controls were GG=42.5%, GC=44.5% and CC=13%.
For the The presence of the ‘C’ allele abolishes the restriction
site for BSMFI. For the VEGF+405 G>C polymorphism the
uncut fragment was 304 bp (C allele) and digestion products
were 193 and 111 bp (G allele). Heterozygous (405 GC ) will
have 3 bands of 304 bp, 193bp and 111bp. Fig.1A
Plasma VEGF levels ranged from 31 to 876 pg/ml among
breast cancer patients and among controls a range of less
than minimum detectable level, ie <9 pg/ml to 136.0 pg/ml
. Statistical cut off was determined using ROC curve.(Fig.
2, Table 3). Mean VEGF level was significantly elevated
in patients compared to control (t=8.248; P<0.001). The
values are showed in Table 4.
Statistical Analysis
The data was analyzed using SPSS 16.0. The frequency of
genotype was determined by direct counting. OR and 95%
CI were estimated as a measure of association between the
genotype and Breast cancer. The genotypic distribution
amongst subjects was tested for Hardy–Weinberg
equilibrium using Fisher’s exact test. Results on continuous
measurements are presented on Mean ± SD (Min-Max)
and results on categorical measurements are presented
in Number (%). Significance is assessed at 5 % level of
significance. ROC curve analysis is performed to find the
Baseline concentrations of plasma VEGF were elevated
(that is, ≥ 123 pg/ml) in 52% (104) of the 200 evaluable
patients and 48% patients were having low levels of
VEGF(VEGF< 123 pg/ml). The Mean and SD values of
VEGF were 126.58 pg/ml and 71.76±5.33 pg/ml for the
patients and control group respectively.
Table 1. Genotype frequencies of 405G>C polymorphism.
405 G>C
Patients
Controls
P value
OR
No
%
No
%
CC
23
11.5
26
13.0
0.647
0.87
GC
88
44.0
89
44.5
0.920
0.97
GG
89
44.5
85
42.5
0.687
1.09
Total
200
100.0
200
100.0
-
-
Table 2. Observed and Expected frequencies +405G>C polymorphisms
405 G/C
Patients
Controls
Observed
Expected
Observed
Expected
GG
89
88.4
85
83.9
GC
88
89.1
89
91.3
CC
23
22.4
26
24.9
Total
200
100.0
200
100.0
G Allele frequency
0.66
C Allele frequency
0.34
Hardy Weinberg equilibrium
Inference
12
χ2=0.031; P=0.860
Consistent with HWE
0.64
0.36
2
=0.126; P=0.721
Consistent with HWE
Am J Biotech Med Res ● 2016 ● Vol 1 ● Issue 1
James, et al.: VEGF polymorphism and Breast cancer
Fig.1A. Restriction digested products of +405G>C Polymorphism
Line1 is molecular marker, Line 2 and 3 are homozygous mutant
(+405CC) and line 4 and 5 are heterozygous(+405GC) Line 6&7
are wild type (+405GG).
Fig. 2. ROC Curve
Table 3. ROC curve analysis of VEGFpg/ml
Cut-off
VEGFpg/ml
>123.66
Sensitivity
Specificity
51.76
89.04
PPV
84.43
NPV
63.64
Accuracy
70.21
P value
<0.001**
Table 4. Comparison VEGFvalues between controls
VEGFpg/ml
Patients
Min-Max
Mean ± SD
95%CI
Inference
Controls
31-876.9
9-136.54
126.58±16.23
71.76±5.33
114.22-139.56
66.23-77.50
Mean VEGFlevel is significantly elevated in patients compared to control with t=8.248;
P<0.001**
Table 5. Correlation of levels of VEGFaccording to Genetic polymorphism in patients
VEGFpg/ml
Patients
Controls
P value
Effect Size
161.18±16.68
77.52±5.11
<0.001**
6.77
98.97±6.35
62.92±11.51
<0.001**
3.85
405 G/C
GG
GC+CC
Next, we studied VEGF plasma levels and VEGF genotypes
in Breast cancer patients and controls to assess possible
functional relevance of the VEGF polymorphisms. The
highest VEGF expression levels were observed within GG
genotype, where as the lowest expression was observed
within CC genotype (Table 5). Plasma VEGF levels
correlated significantly with clinical stage of the disease
(Table 6).
DISCUSSION
Angiogenesis is regulated by many growth factors, among
which VEGF plays a central role and serves as an important
prognostic factor in a variety of tumors, including breast
cancers. The association of VEGF gene polymorphisms
with disease risk attracts a great deal of attention because
VEGF is one of the most potent angiogenic factors and
plays a significant role in the development of solid tumors.
Several studies have evaluated the association of VEGF
Am J Biotech Med Res ● 2016 ● Vol 1 ● Issue 1
polymorphisms with breast cancer risk [30-32]. The results,
however, have been inconsistent.
Studies have shown that several polymorphisms were
associated with the expression of the VEGF protein, and
suggested that the regulation of VEGF expression occurs
primarily at a transcriptional level [33]. The +405G>C
polymorphism is characterized by a point mutation at
position +405 of the VEGF gene that converts Guanine
(G) to Cytosine (C). The +405G>C transition lies in
5’untransalted region of the VEGFgene [34] .Several
transcription factor-binding sites are found in the VEGF5’UTR region and transcriptional regulation of the gene is
complex . Polymorphisms within the 5’-UTR region lead
to differences in VEGF expression between individuals and
could influence the etiology of a variety of pathological
conditions with which VEGF has been associated [35].
In our study we have found that VEGF levels were
significantly increased (P<0.001) in patients compared to
13
James, et al.: VEGF polymorphism and Breast cancer
Table 6. Correlation of levels of VEGFaccording to baseline clinical variables
Clinical variables
VEGFpg/ml
Mean ± SD
95%CI
P value
Age in years
•
21-40 years
121.00±9.36
103.16-140.26
•
41-60 Years
125.17±17.84
108.39-143.16
•
>60 years
142.46±22.68
103.17-188.07
0.579
Menopausal status
•
Pre
115.92±13.16
98.28-135.00
•
Post
132.83±17.88
116.27-150.5
•
Positive
125.63±15.02
109.96-142.34
0.202
Stage
•
I
99.83±10.34
71.26-133.19
•
II
110.75±13.18
93.97-128.90
•
III
146.75±19.41
125.47-169.69
•
IV
126.09±12.17
81.22-180.79
0.035*
ER/PR status
•
ER/PR positive
130.59±16.36
112.24-150.32
•
ER/PR negative
119.27±18.11
100.06-140.15
•
ER positive /PR Negative
134.20±8.34
95.06-180.07
•
PR positive/ER negative
All patients
•
146.22±9.59
94.32-209.44
126.58±16.23
114.22-139.57
0.750
-
A significant association was observed between VEGFand clinical stage by ANOVA(P=0.035).
controls. The highest expression was observed for the GG
genotype, and the lowest for CC genotype.
Watson et al. [18] reported that a G allele at position
+405, which probably lies within the myeloid zinc finger
protein (MZF1) binding site, affects transcriptional
activity and increases VEGF expression in peripheral
blood mononuclear cells in response to lipopolysaccharide.
Furthermore, the +405G haplotype has been associated
with higher promoter activity, and therefore higher VEGF
expression, than the +405C haplotype [36]. We also
observed that the +405C haplotype, which is associated
with lower promoter activity, was more common in controls
than in affected women.
In contrast Awata et al [12] reported that individuals
with the +405 CC genotype had a higher fasting serum
VEGF level than those with other genotypes, and that they
carried an increased risk of diabetic retinopathy. Stevens
et al, [29] also reported that haplotype +405G has a higher
promoter activity than haplotype+405C. In a study of
more than 1,000 women with all stages of breast cancer,
Lu et al [30] found that the +405G>C polymorphism was
significantly associated with survival, with the+405C/C
genotype having the best survival. Multiple factors could
be the reason for the difference between our observations
in this study and results reported by others. Those include
differences in ethnicity, gene-gene interaction and gene
environment interaction.
14
Plasma VEGF levels ranged from 36 to 537 pg/ml among
breast cancer patients and a range of less than minimum
detectable level to <min to 132.0 pg/ml among controls.
The authors found that increased plasma VEGF levels
were significantly associated with, clinical stage of disease.
So detection of plasma VEGF may be helpful for selecting
the patients who may benefit from validated anti-VEGF
treatments. This finding agrees with that of Salven et al
[31] who showed a correlation between circulating levels of
VEGF and the stage of disease or tumor burden.
SUMMARY
Since all the three VEGF genotypes (GG, GC&CC) were
showing an increased plasma VEGF levels, our study did
not prove that mutant CC genotype is associated with
higher VEGF expression. The authors found that increased
plasma VEGF levels were significantly associated with,
clinical stage of disease. So detection of plasma VEGF may
be helpful for selecting the patients who may benefit from
validated anti-VEGF treatments. Further studies on larger
populations may be necessary to confirm these observations.
+405G>C variant may contribute to a modest increase in
risk. Other genetic variants and non genetic factors such
as age, ER/PR status, stage, and plasma VEGF levels can
modify the risk contributed by the variants.
Am J Biotech Med Res ● 2016 ● Vol 1 ● Issue 1
James, et al.: VEGF polymorphism and Breast cancer
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
Jemal A, Bray F, Center M. Global cancer statistics. caac.2011;61:69-90.
Murthy NS, Mathew A. Cancer epidemiology, prevention and control.
CURRENT SCIENCE.2004;86:518-527.
Li C, Malone K, Porter P, Weiss NS, Tang MC,Haugen KC et
al. Relationship between long durations and different regimens
of hormone therapy and risk of breast cancer. JAMA. 2003;
289:3254–3263.
Abeloff MD, Wolff AC, Weber BL. Cancer of the Breast. Clin Oncol.
2008;4: 1875–1943.
Richie R, Swanson JO. Breast Cancer: A Review of the Literature. J
Insur Med. 2003; 35: 85–101.
Arpino G, Bardou V J, Clark GM, Elledge RM. Infiltrating lobular
carcinoma of the breast: tumor characteristics and clinical outcome.
Breast Cancer Research . 2004;6:R149-156.
Xiaofeng Dai , Ting Li , Zhonghu Bai , Yankun Yang , Xiuxia Liu , Jinling
Zhan , Bozhi Shi. Breast cancer intrinsic subtype classification, clinical
use and future trends. Am J Cancer Res. 2015;5(10):2929-2943.
Guarneri V, Conte P. Metastatic Breast Cancer: Therapeutic Options
According to
Molecular Subtypes and Prior Adjuvant Therapy. The Oncologist.
2009;14:645–656.
Gasparini G, Toi M, Gion M. Prognostic significance of vascular
endothelial growth factor protein in node-negative breast carcinoma.
J Natl Cancer Inst. 1997;89:139-147.
Risau W. Mechanisms of angiogenesis. Nature .1997;386:671-674.
Ferrara N, Henzel WJ. Pituitary follicular cells secrete a novel heparinbinding growth factor specific for vascular endothelial cells. Biochem
Biophys Res Commun.1989;161:851-858.
Carmeliet P , Jain RK .Angiogenesis in cancer and other diseases.
Nature.2000; 407:249–257.
Nakamura M, AbeY, TokunagaT. Pathological significance of vascular
endothelial growth factorA isoform expression in human cancer.
Pathol Int. 2002;52: 331-339.
Yang B, Cross DF, Ollerenshaw M. Polymorphisms of the vascular
endothelial growth factor and susceptibility to diabetic microvascular
complications in patients with type1 diabetes mellitus. J Diabetes
Complicat. 2003;17:1–6.
Mohammadi M, Ollier W, Hutchinson I. A functional association study
of VEGFgene polymorphisms with VEGFexpression by stimulated
PBM cells. Hum Immunol.2003;64:S125.
Shahbazi M, Fryer AA, Pravica V. Vascular endothelial growth factor
gene polymorphisms are associated with acute renal allograft
rejection. J Am Soc Nephrol .2002;13:260–264.
Awata T, Inoue K, Kurihara S . A Common Polymorphism in the 5’-UTR
Region of the VEGFGene Is Associated With Diabetic Retinopathy in
Type 2 Diabetes. DIABETES.2002; 51:1635-1639.
Watson CJ, Webb NJ, Bottomley MJ. Identification of polymorphisms
within the vascular endothelial growth factor (VEGF) gene: correlation
with variation in VEGFprotein expression. Cytokine. 2000;12:
1232–1235.
Summers A, Coupes BM, Brennan MF. VEGF-460 genotype plays
an important role in progression to chronic kidney disease stage 5.
Nephrol Dial Transplant. 2005; 20: 2427–2432.
Hefler LA, Mustea A, Konsgen D. Vascular endothelial growth factor
gene polymorphisms are associated with prognosis in ovarian cancer.
Clin Cancer Res. 2007;13:898-901.
Bhanoori M, Babu KA, Reddy P. The vascular endothelial growth
factor (VEGF) +405G>C 5’-UTR region polymorphism and increased
risk of endometriosis in South Indian women: a case control study
.humrep. 2005;20:1844-1849.
Heist RS, Zhai R, Liu G. VEGFpolymorphisms and survival in earlystage non-small-cell lung cancer. J Clin Oncol. 2008;26(6):856-862.
Churchill A, Carter JG, Lovell HC. VEGFpolymorphisms are
associated with neovascular age-related macular degeneration.
Hmg.2006;15:2955-2961.
Suganthalakshmi, B, Anand R, Kim R . Association of VEGFand eNOS
gene polymorphisms in type 2 diabetic retinopathy. Mol. Vis.2006,
12:336–341.
Buraczynska M, Ksiazek P, Baranowicz-Gaszczyk I. Association of the
VEGFgene polymorphism with diabetic retinopathy in type 2 diabetes
patients .Nephrol Dial, Transplant . 2007;22: 827–832.
Rodriguez CR, Fei DT, Keyt B, Baly DL. A sensitive fluorometric
enzyme-linked immunosorbent assay that measures vascular
endothelial growth factor . Angiogenesis. 2003;6:283-287.
Am J Biotech Med Res ● 2016 ● Vol 1 ● Issue 1
28. Krippl P, Langsenlehner U, Renner W. A common 936 C/T gene
polymorphism of vascular endothelial growth factor is associated
with decreased breast cancer risk. Int J Cancer.2003;106: 468- 471.
29. Jin Q, Hemminki K, Enquist K. Vascular Endothelial Growth Factor
Polymorphisms in Relation to Breast Cancer Development and
Prognosis Clinical Cancer Research. 2005;11:3647-3653.
30. Smith KC, Bateman AC, Fussell HM. Cytokine gene polymorphisms
and breast cancer susceptibility and prognosis. Eur J Immunogenet.
2004;31:167 – 173.
31. Liu Q, Li Y, Zhao J. Association of polymorphisms -1154G/A and
-2578C/A in the vascular endothelial growth factor gene with
decreased risk of endometriosis in Chinese women. Human
Reexpression. 2009;24: 2660–2666.
32. Jain L, Vargo CA, Danesi R. The role of vascular endothelial growth
factor SNPs as predictive and prognostic markers for major solid
tumors. Mol Cancer Ther. 2009; 8:2496-2508.
33. Akiri G, Nahari D, Finkelstein Y .Regulation of vascular endothelial
growth factor (VEGF) expression is mediated by internal initiation of
translation and alternative initiation of transcription. Oncogene.1998;
17:227–236.
34. Stevens A, Soden J, Brenchley PE. Haplotype Analysis of the
Polymorphic Human Vascular Endothelial Growth Factor Gene
Promoter. Cancer Res. 2003;63:812-816.
35. Lu H , Shu X, Cui Y. Association of Genetic Polymorphisms in
the VEGFGene with Breast Cancer Survival. Cancer Res. 2005;
65(12):5015-5019.
36. Salven P, Perhoniemi V, Tykka H. Serum VEGFlevels in women with
a benign breast tumor or breast cancer. Breast Cancer Res Treat.
1999;53: 161-166.
© DD. This is an open access article licensed under the terms
of the Creative Commons Attribution Non-Commercial License
(http://creativecommons.org/licenses/by-nc/3.0/) which permits
unrestricted, noncommercial use, distribution and reproduction in any
medium, provided the work is properly cited.
Source of Support: Nil, Conflict of Interest: None declared
15

Similar documents