Lipid Rafts Keep NADPH Oxidase in the Inactive State in Human

Comments

Transcription

Lipid Rafts Keep NADPH Oxidase in the Inactive State in Human
Lipid Rafts Keep NADPH Oxidase in the Inactive State in
Human Renal Proximal Tubule Cells
Weixing Han, Hewang Li, Van Anthony M. Villar, Annabelle M. Pascua, Mustafa I. Dajani,
Xiaoyang Wang, Aruna Natarajan, Mark T. Quinn, Robin A. Felder, Pedro A. Jose, Peiying Yu
Downloaded from http://hyper.ahajournals.org/ by guest on August 3, 2017
Abstract—Recent studies have indicated the importance of cholesterol-rich membrane lipid rafts (LRs) in oxidative
stress-induced signal transduction. Reduced nicotinamide-adenine dinucleotide phosphate (NADPH) oxidases, the
major sources of reactive oxygen species, are implicated in cardiovascular diseases, including hypertension. We tested
the hypothesis that NADPH oxidase subunits and activity are regulated by LRs in human renal proximal tubule cells.
We report that a high proportion of p22phox and the small GTPase Rac1 are expressed in LRs in human renal proximal
tubule cells. The D1-like receptor agonist, fenoldopam (1 ␮mol/L per 20 minutes) dispersed Nox subunits within LRs
and non-LRs and decreased oxidase activity (30.7⫾3.3%). In contrast, cholesterol depletion (2% methyl-␤-cyclodextrin
[␤CD]) translocated NADPH oxidase subunits out of LRs and increased oxidase activity (154.0⫾10.5% versus control,
103.1⫾3.4%), which was reversed by cholesterol repletion (118.9⫾9.9%). Moreover, NADPH oxidase activation by
␤CD (145.5⫾9.0%; control: 98.6⫾1.6%) was also abrogated by the NADPH oxidase inhibitors apocynin (100.4⫾3.2%)
and diphenylene iodonium (9.5⫾3.3%). Furthermore, ␤CD-induced reactive oxygen species production was reversed by
knocking down either Nox2 (81.0⫾5.1% versus ␤CD: 162.0⫾2.0%) or Nox4 (108.0⫾10.8% versus ␤CD:
152.0⫾9.8%). We have demonstrated for the first time that disruption of LRs results in NADPH oxidase activation that
is abolished by antioxidants and silencing of Nox2 or Nox4. Therefore, in human renal proximal tubule cells, LRs
maintain NADPH oxidase in an inactive state. (Hypertension. 2008;51[part 2]:481-487.)
Key Words: NADPH oxidase 䡲 ROS 䡲 dopamine receptors 䡲 lipid rafts
R
educed nicotinamide-adenine dinucleotide phosphate
(NADPH) oxidase, originally identified as a key component of human innate host defense,1 and studied extensively in phagocytes,1–3 has been subsequently studied in
nonphagocytic cells, including gastrointestinal, neural, pulmonary, renal, and vascular smooth muscle cells.4 –17 These
studies provided evidence that this enzyme is the major
source of reactive oxygen species (ROS) in nonphagocytic
cells.5–17 In addition to mediating the intracellular killing of
pathogens in leukocytes and macrophages, ROS may serve as
signal transducers. However, ROS may also be important
mediators of cell injury6 –16; oxidative stress is thought to be
important in the pathogenesis of hypertension.15–17
The primary redox component of all NADPH oxidases is
known as Nox, which has 7 isoforms: Nox1; gp91phox (also
termed Nox2); Nox3; Nox4; Nox5; Duox1; and Duox2. Nox
1 is mainly expressed in the colon,2,4 Nox2 was originally
found in human neutrophils,1– 4,18,19 Nox3 is expressed in fetal
liver and the lung, Nox4 is found in the kidney,4,10,11 Nox5 is
present in spleen and sperm, and Duox1 and Duox2 are
primarily found in the thyroid. However, these Noxs are also
expressed in other tissues.4 –16 In the kidney, renox/Nox4
(which is homologous to Nox2) is highly expressed in the
proximal convoluted tubule,10 whereas Nox4 is highly expressed in distal tubules.11 Activation of Nox2 requires its
assembly with a membrane subunit, p22phox; several cytosolic
regulatory subunits, p67phox, p47phox, and p40phox; and small
GTPase Rac.1–3,18,19
Lipid rafts (LRs) are composed of glycosylphosphatidylinositollinked proteins, glycosphingolipids, and cholesterol that are
associated with signaling molecules, eg, receptors such as G
proteins.20 There are several types of LRs, but the best
described are the caveolae.20 –23 These LRs are characterized
by the presence of caveolins, which bind to cholesterol.
Caveolar and noncaveolar LRs have been implicated in
protein trafficking and signal transduction.17,20 –23 We and
others have reported that there are noncaveolar LRs in human
embryonic kidney and rat renal proximal tubule cells because
these cells are devoid of measurable caveolin-124,25 and,
therefore, could not form caveolae.21,24,25 Nox2 and its
subunits are distributed in and their activity regulated by LRs
in murine microglial, bovine aortic endothelial, and bovine
Received October 14, 2007; first decision November 5, 2007; revision accepted December 14, 2007.
From the Department of Pediatrics (W.H., H.L., V.A.M.V., A.M.P., M.I.D., X.W., A.N., P.A.J., P.Y.), Georgetown University School of Medicine,
Washington, DC; the Department of Veterinary Molecular Biology (M.Q.), Montana State University, Bozeman, Mont; and the Department of Pathology
(R.A.F.), University of Virginia, Charlottesville, Va.
Correspondence to Peiying Yu, MD, Division of Pediatric Nephrology, Department of Pediatrics, Georgetown University Medical Center, 4000
Reservoir Rd, NW, Washington, DC 20057. E-mail [email protected]
© 2008 American Heart Association, Inc.
Hypertension is available at http://hyper.ahajournals.org
DOI: 10.1161/HYPERTENSIONAHA.107.103275
481
482
Hypertension
February 2008 Part II
Downloaded from http://hyper.ahajournals.org/ by guest on August 3, 2017
coronary arterial endothelial cells26 –29; however, there are no
such reports in nonphagocytic human cells.30,31
Dopamine is an important regulator of blood pressure and
renal and adrenal function through an independent peripheral
dopaminergic system.32,33 Abnormalities in renal dopamine
production and receptor function have been described in
human essential hypertension and rodent models of genetic
hypertension.32,33 D1-like dopamine receptor-mediated inhibition of NADPH oxidase activity has been reported by
several groups, including ours.34 –36 Those studies were performed in vascular smooth muscle cells in rats, renal tubules
in mice, and embryonic kidney and peripheral blood mononuclear cells in humans. However, those reports did not
describe the membrane microdomain localization of NADPH
oxidase subunits and did not provide a cellular biological
mechanism for the D1-like receptor-mediated inhibition of
NADPH oxidase activity. We tested the hypothesis that
NADPH oxidase subunits and activity are regulated by
D1-like receptors in LRs of human renal proximal tubule
(hRPT) cells. We now report for the first time that the
majority of p22phox and Rac1 are distributed in LRs, whereas
Nox4 is excluded from LRs. Cholesterol depletion increased
NADPH oxidase activity by redistributing NADPH oxidase
subunits in non-LRs. In contrast, the D1-like receptor agonist
(fenoldopam)-induced inhibition of oxidase activity was accompanied by the dispersal of Nox and subunits in LRs and
non-LRs. These studies suggest that, in human nonphagocytic
cells, LRs keep NADPH oxidase in the inactive state.
Methods
An expanded Methods section is available online at http://hyper.
ahajournals.org.
Measurement of Nox Activity
Cells treated with the indicated drugs and whole cell membranes
were prepared (see the supplemental data). NADPH oxidase activity
was determined by measuring superoxide generation in whole cell
membranes in the presence of lucigenin (10 ␮mol/L) and NADPH
(100 ␮mol/L).35,37 The dynamic tracings of NADPH-dependent
activity were recorded for 180 seconds (AutoLumat Plus luminometer, LB953, EG&G Berthhold). The activities were expressed as
arbitrary light units (ALUs) corrected for the protein concentration
and duration of the experiment (ALU/second per milligram of
protein). To compare the control and drug treatment groups, the
percentage difference of the absolute value of each drug treatment
from the absolute mean of the controls was calculated. All of the
assays were performed in duplicate. All of the protein concentrations
were assayed via Bio-Rad kit.
In some experiments, ROS were measured in living cells. Cells
(106 cells per well), seeded in 6-well plates and treated with drugs,
were washed twice with the assay buffer and scraped into an assay
tube. The assay was started by the addition of lucigenin and NADPH,
and the dynamic tracing was recorded as described above. Activity is
expressed as ALUs per well in dynamic tracing graph and converted
to the percentage of change from control.
LR Labeling and Confocal Microscopy
LRs were labeled using the Vybrant LR labeling kit. Cells grown on
coverslips were washed once with serum-free medium and incubated
with cholera toxin subunit B conjugated with Alexa Fluor 400
(CTB-488) at 1.0 ␮g/mL for 10 minutes at 4°C. The cells were
washed and incubated with polyclonal anti-CTB antibody (1:200
dilution) for 15 minutes at 4°C. The cells were then stained with
monoclonal anti-Nox2 or anti-p22phox antibodies for 30 minutes.24
Fluorescence images were obtained using laser confocal scanning
microscopy (Olympus Fluoview FV600) at excitation and emission
wavelengths of 488 nm and 505 nm, respectively.24
Statistical Analysis
The data are expressed as means⫾SEMs: Significant differences
between the 2 groups were determined by Student’s t test. Significance among several groups was determined by 1-way factorial
ANOVA followed by the Newman-Keuls test. P⬍0.05 was considered significant.
Results
Analysis of NADPH Oxidase Subunit mRNA in
hRPT Cells
The expression of mRNA for Nox1, Nox2, Nox4, p22phox,
p67phox, p47phox, p40phox, and Rac1 in hRPT cells, shown previously to express D1-like receptors,38 is shown in Figure S1.
Analysis of Nox and Subunit Proteins in
Membranes From Sucrose Gradients
by Immunoblotting
Less than 10% of the membrane proteins were recovered in
LRs (fractions 2 to 6; Figure 1A); the LR marker protein,
caveolin-1, was mainly found in LRs; the other LR marker,
flotillin-1, was found in both LRs and non-LRs (Figure
1A).26 –30 Dopamine D1 and D5 receptors also cofractionated
with the LR markers but were found in non-LR membrane
fractions as well (Figure 1A).
The basal distributions of Nox2, Nox4, and NADPH
oxidase subunits in LR and non-LR fractions are shown in
Figure 1B and 1C and Table S2. The percentage of LR
protein expressions, relative to total LR and non-LR were as
follows: Nox2, 40.3%; p22phox, 65.7%; and Rac1, 57.7% in
LRs; Nox4 was almost exclusively expressed in non-LRs.
p67phox tended to be expressed more in LRs than in non-LRs;
however, significance was not attained. p40phox and p47phox
were mainly localized in non-LRs (Figure S2).
Fenoldopam shifted the Nox2 bands from fractions 4 and 5
to fraction 3; shifted p22phox bands from fractions 4 and 5 to
3 and 4 in LRs and to fractions 10 to 12 in non-LRs;
minimally shifted p67phox band from fractions 5 to 3 and 4;
and decreased Rac1 bands in fractions 5 and 4 and redistributed them to fractions 10 and 11 in non-LR fractions (Figure
1B and 1C). Fenoldopam also decreased the protein expression of p22phox and Rac1 in LRs and Nox2 and Nox4 in
non-LRs (Figure 1D and Table S3). Moreover, fenoldopam
altered the localization of some of the Nox2 and p22phox from
membranes into small intracellular vesicles (Figure 1E).
Fenoldopam did not affect the distribution of p47phox and
minimally altered the distribution of p40phox (Figure S2).
Effect of D1-Like Receptor Agonist on NADPH
Oxidase Activity in hRPT Cells
The fenoldopam-induced alterations in NADPH oxidase subunit localization were associated with a decrease in total cell
membrane oxidase activity. Thus, fenoldopam decreased
NADPH oxidase activity (69.3⫾3.3% versus control:
100⫾2.8%) that was blocked by the D1-like receptor antagonist, Sch23390 (101.1⫾3.0%), which by itself had no effect
(98.2⫾6.8%; Figure 2). These results indicate that the inhib-
Han et al
Regulation of NADPH Oxidase in Lipid Rafts
483
Downloaded from http://hyper.ahajournals.org/ by guest on August 3, 2017
Figure 1. Nox isoforms and NADPH oxidase subunits cofractionate in LRs in hRPT cells. A, Sucrose gradient analysis of LRs. The protein
concentrations (mg/mL) from vehicle-treated cells are shown (top). Fractionated proteins (30 ␮L per lane) were immunoblotted with monoclonal anti– caveolin-1 (Cav-1) and anti–flotillin-1 (Flo-1) antibodies (middle) and polyclonal anti-human D1 (hD1R) and anti-human D5 (hD5R) dopamine receptor antibodies (bottom). Low-density fractions (fractions 2 to 6) contain LRs, whereas the high-density fractions (fractions 7 to 12)
contain non-LRs. The blots are 1 of 3 separate experiments. B through D, Distribution of Nox isoforms and oxidase subunits in LRs and nonLRs. Proteins from sucrose gradients, treated with vehicle (Con), fenoldopam (Fen, 1 ␮mol/L/20 minutes), or ␤CD (2%/1 hour) were probed
with specific antibodies against Nox2, Nox4, p22phox, Rac1, and p67phox. The distributions of Nox2, Nox4, and p22phox are shown in B, and
p67phox and Rac1 in C. The quantities of Nox2, Nox4, p22phox, and Rac1 in LRs are shown in D. Values are means⫾SEMs. n⫽3 to 4, t test;
*P⬍0.01; Fen vs Con. E, Colocalization of LRs with Nox2 and p22phox in hRPT cells using double immunofluorescence labeling. The merged
(yellow) confocal images show colocalization of immunoreactive LRs (green) and Nox2 or p22phox (red) in plasma membranes and in intracellular vesicles. The image is 1 of 3 to 5 separate experiments. Scale bar⫽20 ␮m.
itory effect of fenoldopam on NADPH oxidase activity in
hRPT cells was specifically mediated by D1-like receptors
(D1R or D5R). The inhibition of oxidase activity through the
activation of D1-like receptors at a low concentration of the
agonist is in agreement with previous reports.34 –36
Figure 2. Effect of D1-like receptor agonist and/or antagonist on
NADPH oxidase activity in hRPT cells. NADPH oxidase activity
was measured in hRPT cells treated with vehicle (Con), fenoldopam (Fen, 1 ␮mol/L per 20 minutes), Sch23390 (Sch, 1 ␮mol/L
per 20 minutes), or Fen plus Sch (S⫹F). Dynamic tracings of
oxidase activity are expressed as ALUs/50 ␮g of protein (left),
and the percentage changes in activity from control are
depicted (right). Values are means⫾SEMs. n⫽6, ANOVA
(Newman-Keuls test), *P⬍0.01 Fen vs others.
Effect of Methyl-␤-Cyclodextrin on ROS
Production and Membrane NADPH Oxidase
Activity in hRPT Cells
To investigate the functional role of LRs in the regulation of
NADPH oxidase, methyl-␤-Cyclodextrin (␤CD), a wellestablished cholesterol depleting reagent, was used to disrupt
LRs.21,23,24 The effects of ␤CD on ROS production are shown in
Figure 3 and Table S4. ␤CD dose-dependently increased ROS
production, with the maximum effect noted at 15 mmol/L. This
effect also increased with time, peaking at 60 minutes. A higher
concentration (20 mmol/L) and a longer period of incubation (90
minutes) resulted in a decrease in ROS production relative to the
previous dose or time period (Figure 3). Treatment of hRPT
cells with ␤CD (2% per 1 hour at 37°C) decreased membrane
cholesterol by 54.9⫾4.6%, (Figure S4), in agreement with
previous reports.21,23 ␤CD treatment also resulted in a redistribution of Nox2 and other subunits toward the non-LR fractions
7 to 12 (Figure 1B and 1C).
To determine whether the effect of ␤CD on Nox activity
depended on caveolae or dopamine receptors, HEK-293 cells
transfected with vector or with D1 receptors (HEK-hD1 cells)
were studied in addition to hRPT cells, which express both D1
and D5 receptors. hRPT cells contain caveolae because
484
Hypertension
February 2008 Part II
Downloaded from http://hyper.ahajournals.org/ by guest on August 3, 2017
Figure 3. Dose- and time-dependent effects of ␤CD on ROS
production in hRPT cells. To determine dose-related effects, the
cells were treated with varying concentrations of ␤CD (0, 5, 10,
15, and 20 mmol/L) in serum-free medium for 1 hour at 37°C.
For time course experiments, the cells were treated with ␤CD
(2%; 13 mmol/L) at varying durations of incubation (0, 15, 30,
60, and 90 minutes) at 37°C. Dynamic tracings of ROS activity
(ALU/106 cells; left) and the activities, expressed as percentage
of change from control (0 time or concentration; right), are
shown. Values are means⫾SEMs. n⫽6 per concentration or
time point, ANOVA (Newman-Keuls test), top, *Pⱕ0.003, 15 vs
0, 5, 10, and 20 mmol/L, **P⬍0.01, 20 vs 0, 5, and 15 mmol/L,
bottom, *P⬍0.001, 60 vs 0, 15, and 30 minutes, #P⬍0.05, 90
minutes vs 0 and 15 minutes.
caveolin-1 is expressed (Figure 1A). In contrast, there are no
caveolae in HEK-293 cells because they lack caveolin-1.24
Nox2 and Nox4 are endogenously expressed in human kidney
and HEK-293 cells.4 D1-like receptors are endogenously
expressed in hRPT cells38 but not in HEK-293 cells.39 Similar
to the studies in hRPT cells, ␤CD increased Nox activity,
which was completely reversed by cholesterol repletion
(Figure 4A and Table S5). Of note was the greater increase in
NADPH oxidase activity caused by ␤CD in HEK-293 cells,
which do not express either the D1 or D5 receptor.39 This
could be taken to indicate that NADPH oxidase activity may
be negatively regulated by D1-like receptors, because HEK293 cells that do not express D1-like receptors have higher
Nox activity than cells that express them (Figure 4A).
To confirm that the stimulatory effect of ␤CD on NADPH
oxidase activity in human kidney cells was also exerted in
other human cells, human coronary artery smooth muscle
cells (hCASMs), which also express caveolin-1,40 were studied. In hCASMs, ␤CD also increased ROS production
(8.5⫾1.0-fold), an effect that was partially reversed by
cholesterol repletion (Figure 4B).
Effect of NADPH Oxidase Inhibitors on
␤CD-Mediated Stimulation of Oxidase Activity in
Human Kidney Cells
To investigate the mechanisms responsible for the effect of
␤CD on NADPH oxidase activity in human kidney cells
(hRPT and HEK-hD1), oxidase inhibitors apocynin and diphenylene iodonium chloride (DPI) were used. The increased
NADPH oxidase activity induced by ␤CD treatment was
completely reversed by the addition of apocynin and DPI
(Figure 5 and Table S6) in both hRPT and HEK-hD1 cells.
Apocynin, by itself, had a modest inhibitory effect, whereas
Figure 4. Effect of ␤CD on membrane
NADPH oxidase activity in hRPT, HEK-293,
and HEK-hD1 cells and ROS production in
hCASMs. A, Cells were treated with vehicle
(Con), ␤CD (2%, 1 hour at 37°C), or ␤CD plus
cholesterol (CCH), and NADPH oxidase activity was measured in cell membranes.
Dynamic tracings of oxidase activity (top) and
the percentage change in activity from control
(bottom) are shown. Values are
means⫾SEMs. n⫽4 to 6, ANOVA (NewmanKeuls), *P⬍0.001, ␤CD vs others within each
group, #HEK-293 ␤CD vs hRPT and HEK-D1
␤CD. B. The effect of ␤CD on ROS production in hCASMs. Dynamic tracings (left) and
the fold change in activity from control (right)
are shown. Values are means⫾SEMs. n⫽4,
ANOVA (Newman-Keuls), *P⬍0.001, ␤CD vs
others and #P⬍0.001, CCH vs Con or ␤CD.
Han et al
Downloaded from http://hyper.ahajournals.org/ by guest on August 3, 2017
Figure 5. Effect of apocynin or DPI on the ␤CD-induced
increase in NADPH oxidase activity in hRPT and HEK-hD1 cells.
The cells were treated with vehicle or the indicated drugs, and
the cell membranes were assayed for NADPH oxidase activity.
Dynamic tracings of oxidase activities (top) and the percentage
changes in activity from control (bottom) are shown. Values are
means⫾SEMs. n⫽4 to 6, ANOVA (Newman-Keuls test),
*P⬍0.001, ␤CD vs others, **P⬍0.001, Apo vs others, †P⬍0.001,
A/␤CD vs others except Con, $ and # P⬍0.001, DPI and D/␤CD
vs others, respectively, for hRPT or HEK-HD1. Vehicle, Con; Apo
indicates apocynin; A/␤CD, Apo⫹␤CD; D/␤CD, DPI⫹␤CD.
DPI, by itself, had a drastic inhibitory effect (Figure 5). These
results indicate that the disruption of LRs facilitates NADPH
oxidase assembly, presumably in non-LRs, and promotes
activation of the oxidase.
Effect of Knockdown of Nox2 and Nox4 on
␤CD-Induced Activation of Nox
To determine the specific Nox isoform that contributed to the
enhanced ROS production induced by ␤CD, small interfering
RNA (siRNA) was used to specifically knock down Nox2 or
Nox4 expression. The Nox-specific siRNAs decreased the expression of Nox2 by 61% and Nox4 by 47% (Figure S5). As
shown in Figure 6 and Table S7, knockdown of Nox2, by itself,
had a slight and nonsignificant effect on basal ROS production.
Knockdown of Nox4 by itself did not affect basal ROS production. However, knockdown of either Nox2 or Nox4 completely
prevented the stimulatory effect of ␤CD on ROS production,
indicating that both Nox2 and Nox4 contributed to the enhanced
ROS production when LRs were disrupted.
Discussion
NADPH oxidases are now recognized to have specific subcellular localizations in caveolae LRs, endosomes, and nuclei.17–21,26 –31 There are only few studies that have reported
the distribution and regulation of Nox proteins and oxidase
subunits in LRs, and most of the studies were performed in
nonhuman cells,26 –29 except those in human neutrophils.30,31
The novel findings are as follows: (1) NADPH oxidase
subunits (p22phox and Rac1) are mainly distributed in LRs
rather than in non-LRs; (2) D1-like receptors (D1R and D5R)
inhibit membrane NADPH oxidase activity that is accompanied by movement of Nox2 and subunits into more buoyant
LR fractions or non-LR fractions and into intracellular
Regulation of NADPH Oxidase in Lipid Rafts
485
Figure 6. Effect of knockdown of Nox2 or Nox4 on the ␤CDinduced increase in ROS production in hRPT cells. The cells
were transfected with siRNA for Nox2 or Nox4 and assayed for
ROS activity. Dynamic tracings of ROS activities (top) and the
percentage changes in activity from control (bottom) are shown.
Values are means⫾SEMs. n⫽4 to 6, ANOVA (Newman-Keuls),
*P⬍0.001, #P⬍0.01, ␤CD vs Con, siRNA alone, or siRNA⫹␤CD.
vesicles; (3) cholesterol depletion with ␤CD increases membrane oxidase activity/ROS production; and (4) the stimulatory effect of cholesterol depletion is prevented by direct
inhibition of NADPH oxidase or by knockdown of either
Nox2 or Nox4 protein expression.
The current studies show that endogenously expressed Nox
isoforms and oxidase subunits are regulated in caveolae-LRs and
non-LRs. Of the NADPH oxidase subunits, p22phox plays a key
role in NADPH oxidase function.4,12 Proper functioning of Nox2
and Nox4 requires association with p22phox.2– 4,12 Activation of
Nox2 also requires assembly of Rac1 and p67phox with Nox2p22phox.12,18,19 Under basal conditions, a high proportion of
p22phox and Rac1 is located in LRs, whereas a large amount of
Nox4, Nox2, p47phox, and p40phox is located in non-LRs. Disruption of LRs with ␤CD allows NAPDH oxidase subunits (p22phox,
Nox2, Rac1, and p67phox) to move from LRs to non-LRs, where
there is an abundance of Nox4, Nox2, p40phox, and p47phox. This
allows for the assembly and subsequent activation of Nox2 and
Nox4. These results suggest that LRs play a pivotal role in
maintaining NADPH oxidase activity in an inactive state in
human kidney cells.
Our studies show for the first time that cholesterol depletion
caused an increase in membrane NADPH oxidase activity/ROS
production in hRPT, HEK-293, and HEK-hD1 cells, in response
to cholesterol depletion, was also observed in hCASMs. However, cholesterol depletion in human neutrophils did not affect
basal superoxide production.30,31 The mechanisms involved in
the cell-specific regulation of NADPH oxidase activity by
cholesterol remain to be determined.
There may also be species-specific membrane microdomain regulation of NADPH oxidase by cholesterol. Cholesterol depletion with ␤CD decreased ROS production in
bovine28,29 and rodent cells.26,27 We have also found that
cholesterol depletion of rat renal proximal tubule cells de-
486
Hypertension
February 2008 Part II
Downloaded from http://hyper.ahajournals.org/ by guest on August 3, 2017
creased superoxide production (unpublished data). Transfection of rat p22phox in HEK-293 cells heterologously expressing
rat Nox4 caused a 3-fold increase in ROS production.41 In
contrast, transfection of human p22phox in HEK-293 cells
heterologously expressing human NADPH oxidase isoforms,
Nox1 to 4, did not further increase ROS production.12 These
studies suggest inherent differences between human and
rodent NADPH oxidase subunit activity, but the cause of such
inherent differences remains to be discovered.
There are caveolae in rodent and bovine vascular smooth
muscle and endothelial cells,22,23 similar to human RPT cells
(current study) and human coronary arterial smooth muscle
cells.40 In contrast, there are no caveolae in human neutrophils,
rat renal proximal tubules, and mouse microglial cells.24,25,26,30,31
The effect of cholesterol-depleting drugs, eg, ␤CD, is because of
cholesterol depletion and is not caused by nonspecific drug
effects, because the drug-induced changes were reversed by
cholesterol repletion. These studies support the notion that
cholesterol, an important component of LRs, rather than caveolae mediates the effect of cholesterol depletion on basal oxidase
activity and ROS production, be it stimulatory or inhibitory. The
notion that the activation of NADPH oxidase with cholesterol
depletion is secondary to translocation of NADPH oxidase
subunits, resulting in its assembly and activation, is supported by
the apocynin and DPI experiments. Apocynin and DPI, 2
structurally unrelated NADPH oxidase inhibitors, have been
widely used in functional studies of NADPH oxidase.5,9,11,42 In
the current report, both apocynin, which, by itself had a modest
inhibitory effect on basal oxidase activity, and DPI, which by
itself had a marked inhibitory effect, reversed the ␤CD-mediated
increase in ROS production in hRPT and HEK-D1 cells, indicating that NADPH oxidase is a major source of ROS production in these cells. In the basal state, cells produce low levels of
ROS for self-defense, which requires only a minimal activation
of Nox. Apocynin exerts its inhibitory effect by reacting with
thiol groups and by inhibiting the translocation of cytosolic
factors and their assembly with Nox2-p22phox in the cell membrane.9 DPI inhibits flavoprotein activity by direct binding and
inhibition of mitochondrial electron transfer and NO synthase
activity.42
The pharmacological studies using apocynin and DPI do
not directly prove the importance of redistribution of NADPH
oxidase subunits in non-LRs in the stimulatory effect of
cholesterol depletion on NADPH oxidase activity, and, thus,
other mechanisms may be involved. However, the Nox2 and
Nox4 knockdown studies minimize the need for such alternative explanations. Nox 24,8,13 and Nox4 are expressed in
renal tubules, with Nox4 as the major isoform in the kidney.4,7,8,11 Inhibition of Nox2 or Nox4 protein expression in
hRPT cells by Nox2 or Nox4 siRNA completely reversed the
stimulatory effect of ␤CD on ROS production, suggesting
that both Nox2 and Nox4 are critical in this phenomenon.
Kawahara et al12 have reported that p22phox serves to stabilize
the catalytic oxidase subunits and that Nox1 protein was
decreased by silencing of p22phox. It is possible that knockdown of either Nox2 or Nox4 could have also reduced the
expression of other Nox subunits, such as p22phox. Therefore,
knocking down 1 oxidase subunit could influence the expression and function of the other subunits.
D1-like receptors decrease NADPH oxidase activity and
ROS production, mediated via protein kinase A– dependent
and –independent mechanisms and the direct inhibition of
phospholipase D and NADPH oxidase activities.34 –36 Our
studies provide the first direct evidence for D1-like dopamine
receptor– dependent signaling in membrane microdomains of
hRPT cells. We have also reported previously that D1
receptors are regulated in LRs in HEK-hD1 cells.24 Several
studies have shown that caveolar and noncaveolar LRs serve
as platforms to store signaling proteins17,20,21 and as vehicles
for endocytosis and trafficking during signaling,17,21–23 keeping some proteins in the active or in the inactive state. The
current studies provide a cell biological mechanism by which
D1-like receptors inhibit NADPH oxidase activity. Thus,
NADPH activity can be inhibited by D1-like receptors via 2
mechanisms: redistribution of Nox2 and p22phox to more
buoyant LR fractions and Rac1 and p22phox to non-LR
fractions and decreasing the expression of Rac1 and p22phox in
LRs and Nox2 and Nox4 in non-LRs. The D1-like receptormediated decrease in LR expression of NADPH oxidase
subunits, such as p22phox and Rac1, could be because of
translocation to non-LRs. The D1-like receptor–mediated
decrease in the expression of Nox2 and Nox4 in non-LRs
may have been the result of degradation; fenoldopam induced
the movement of Nox2 into small intracellular vesicles (early
or late endosomes), possibly en route to their degradation.
This segregated compartmentalization of Nox and subunits
would impair their assembly, similar to those described for
apocynin,9 resulting in decreased NADPH oxidase activity
and ROS production. However, it remains to be determined
how D1-like receptors regulate Nox2 and NADPH oxidase
subunit degradation and trafficking along with the other
receptors in LRs in hRPT cells.
In summary, we show for the first time that D1-like receptors
regulate NADPH oxidase activity through the redistribution of
Nox2 and subunits (p22phox and Rac1) in membrane microdomains and intracellular vesicles. Disruption of LRs enhances
NADPH oxidase activity and ROS production, which are abolished by antioxidant reagents and inhibition of Nox2 and Nox4
expression. Therefore, the integrity of LRs plays an important
role in maintaining NADPH oxidase in the inactive state in
human nonphagocytic cells.
Clinical Perspectives
The integrity of LRs plays an important role in keeping
NADPH oxidase inactive in hRPT cells. Marked reductions
in total cholesterol have beneficial effects on cardiovascular
function.43 A 50% decrease in cell membrane cholesterol is
associated with oxidative stress, and oxidative stress is
associated with disease, including hypertension. Thus, it
is possible that the marked reduction in serum cholesterol
obtained through pharmacological treatment could result in a
decrease in cell membrane cholesterol and a potentially
deleterious increase in oxidative stress.
Sources of Funding
These studies were supported in part by grants from the National
Institutes of Health (HL23081, HL074940, DK39308, and HL68686).
Han et al
Disclosures
None.
References
Downloaded from http://hyper.ahajournals.org/ by guest on August 3, 2017
1. Babior BM. NADPH oxidase: an update. Blood. 1999;93:1464 –1476.
2. Quinn MT, Gauss KA. Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases. J Leukoc
Biol. 2004;76:760 –781.
3. Bokoch GM, Diebold BA. Current molecular models for NADPH oxidase
regulation by Rac GTPase. Blood. 2002;100:2692–2696.
4. Cheng G, Cao Z, Xu X, van Meir EG, Lambeth JD. Homologs of
gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5.
Gene. 2001;269:131–140.
5. Bhunia AK, Han H, Snowden A, Chatterjee S. Redox-regulated signaling
by lactosylceramide in the proliferation of human aortic smooth muscle
cells. J Biol Chem. 1997;272:15642–15649.
6. Azumi H, Inoue N, Takeshita S, Rikitake Y, Kawashima S, Hayashi Y,
Itoh H, Yokoyama M. Expression of NADH/NADPH oxidase p22phox in
human coronary arteries. Circulation. 1999;100:1494 –1498.
7. Sorescu D, Weiss D, Lassegue B, Clempus RE, Szocs K, Sorescu GP,
Valppu L, Quinn MT, Lambeth JD, Vega JD, Taylor WR, Griendling KK.
Superoxide production and expression of nox family proteins in human
atherosclerosis. Circulation. 2002;105:1429 –1435.
8. Van Buul JD, Fernandez-Borja M, Anthony EC, Hordijk PL. Expression
and localization of NOX2 and NOX4 in primary human endothelial cells.
Antioxid Redox Signal. 2005;7:308 –317.
9. Meyer JW, Holland JA, Ziegler LM, Chang MM, Beebe G, Schmitt ME.
Identification of a functional leukocyte-type NADPH oxidase in human
endothelial cells: a potential atherogenic source of reactive oxygen
species. Endothelium. 1999;7:11–22.
10. Guzik TJ, Geiszt M, Kopp JB, Varnai P, Leto TL. Identification of reNox, an
NAD(P)H oxidase in kidney. Proc Natl Acad Sci. 2000;97:8010–8014.
11. Shiose A, Kuroda J, Tsuruya K, Hirai M, Hirakata H, Naito S, Hattori M,
Sakaki Y, Sumimoto H. A novel superoxide-producing NAD(P)H
oxidase in kidney. J Biol Chem. 2001;276:1417–1423.
12. Kawahara T, Ritsick D, Cheng G, Lambeth JD. Point mutations in the
proline-rich region of p22phox are dominant inhibitors of Nox1- and
Nox2-dependent reactive oxygen generation. J Biol Chem. 2005;280:
31859 –31869.
13. Irani K. Oxidant signaling in vascular cell growth, death, and survival: a
review of the roles of reactive oxygen species in smooth muscle and endothelial cell mitogenic and apoptotic signaling. Circ Res. 2000;87:179–183.
14. Zhan CD, Sindhu RK, Vaziri ND. Up-regulation of kidney NAD(P)H
oxidase and calcineurin in SHR: reversal by lifelong antioxidant supplementation. Kidney Int. 2004;65(1):219 –227.
15. Zhao W, Swanson SA, Ye J, Li X, Shelton JM, Zhang W, Thomas GD.
Reactive oxygen species impair sympathetic vasoregulation in skeletal
muscle in angiotensin II-dependent hypertension. Hypertension. 2006;48:
637–643.
16. Wilcox CS. Oxidative stress and nitric oxide deficiency in the kidney: a
critical link to hypertension? Am J Physiol Regul Integr Comp Physiol.
2005;289:R913–R935.
17. Ushio-Fukai M, Zuo L, Ikeda S, Tojo T, Patrushev NA, Alexander RW.
cAbl tyrosine kinase mediates reactive oxygen species- and caveolindependent AT1 receptor signaling in vascular smooth muscle: role in
vascular hypertrophy. Circ Res. 2005;97:829 – 836.
18. De Leo FR, Ulman KV, Davis AR, Jutila KL, Quinn MT. Assembly of
the human neutrophil NADPH oxidase involves binding of p67phox and
flavocytochrome b to a common functional domain in p47phox. J Biol
Chem. 1996;271:17013–17020.
19. Dang PM, Cross AR, Babior BM. Assembly of the neutrophil respiratory
burst oxidase: a direct interaction between p67PHOX and cytochrome
b558. Proc Natl Acad Sci U S A. 2001;98:3001–3005.
20. Simons K, Ehehalt R. Cholesterol, lipid rafts, and disease. J Clin Invest.
2002;110:597– 603.
21. Allen JA, Halverson-Tamboli RA, Rasenick MM. Lipid raft microdomains
and neurotransmitter signalling. Nat Rev Neurosci. 2007;8:128–140.
22. Insel PA, Head BP, Ostrom RS, Patel HH, Swaney JS, Tang CM, Roth DM.
Caveolae and lipid rafts: G protein-coupled receptor signaling microdomains
in cardiac myocytes. Ann N Y Acad Sci. 2005;1047:166–172.
23. Smart EJ, Anderson RG. Alterations in membrane cholesterol that affect
structure and function of caveolae. Methods Enzymol. 2002;353:131–139.
Regulation of NADPH Oxidase in Lipid Rafts
487
24. Yu P, Yang Z, Jones JE, Wang Z, Owens SA, Mueller SC, Felder RA,
Jose PA. D1 Dopamine receptor signaling involves caveolin-2 in
HEK-293 cells. Kidney Int. 2004;66:2167–2180.
25. Breton S, Lisanti MP, Tyszkowski R, McLaughlin M, Brown D. Basolateral distribution of caveolin-1 in the kidney. Absence from
H⫹-ATPase-coated endocytic vesicles in intercalated cells. J Histochem
Cytochem. 1998;46:205–214.
26. Vilhardt F, van Deurs B. The phagocyte NADPH oxidase depends on
cholesterol-enriched membrane microdomains for assembly. EMBO J.
2004;23:739 –748.
27. Zuo L, Ushio-Fukai M, Hilenski LL, Alexander RW. Microtubules
regulate angiotensin II type 1 receptor and Rac1 localization in caveolae/lipid rafts: role in redox signaling. Arterioscler Thromb Vasc Biol.
2004;24:1223–1228.
28. Yang B, Oo TN, Rizzo V. Lipid rafts mediate H2O2 prosurvival effects
in cultured endothelial cells. FASEB J. 2006;20:1501–1503.
29. Zhang AY, Yi F, Zhang G, Gulbins E, Li PL. Lipid raft clustering and
redox signaling platform formation in coronary arterial endothelial cells.
Hypertension. 2006;7:74 – 80.
30. Shao D, Segal AW, Dekker LV. Lipid rafts determine efficiency of NADPH
oxidase activation in neutrophils. FEBS Lett. 2003;550:101–106.
31. Guichard C, Pedruzzi E, Dewas C, Fay M, Pouzet C, Bens M,
Vandewalle A, Ogier-Denis E, Gougerot-Pocidalo MA, Elbim C.
Interleukin-8-induced priming of neutrophil oxidative burst requires
sequential recruitment of NADPH oxidase components into lipid rafts.
J Biol Chem. 2005;280:37021–37032.
32. Jose PA, Eisner GM, Felder RA. Role of dopamine receptors in the
kidney in the regulation of blood pressure. Curr Opin Nephrol Hypertens.
2002;11:87–92.
33. Hussain T, Lokhandwala MF. Renal dopamine receptors and hypertension. Exp Biol Med (Maywood). 2003;228:134 –142.
34. Yasunari K, Kohno M, Kano H, Minami M, Yoshikawa J. Dopamine as
a novel antioxidative agent for rat vascular smooth muscle cells through
dopamine D1-like receptors. Circulation. 2000;101:2302–2308.
35. Yang Z, Asico LD, Yu P, Wang Z, Jones JE, Escano CS, Wang X, Quinn
MT, Sibley DR, Romero GG, Felder RA, Jose PA. D5 dopamine receptor
regulation of reactive oxygen species production, NADPH oxidase, and
blood pressure. Am J Physiol Regul Integr Comp Physiol. 2006;290:
R96 –R104.
36. Colombo C, Cosentino M, Marino F, Rasini E, Ossola M, Blandini F,
Mangiagalli A, Samuele A, Ferrari M, Bombelli R, Lecchini S, Nappi G,
Frigo G. Dopaminergic modulation of apoptosis in human peripheral
blood mononuclear cells: possible relevance for Parkinson’s disease. Ann
N Y Acad Sci. 2003;1010:679 – 682.
37. Li Y, Zhu H, Kuppusamy P, Roubaud V, Zweier JL, Trush MA. Validation of lucigenin (bis-N-methylacridinium) as a chemilumigenic probe
for detecting superoxide anion radical production by enzymatic and
cellular systems. J Biol Chem. 1998;273:2015–2023.
38. Felder RA, Sanada H, Xu J, Yu PY, Wang Z, Watanabe H, Asico LD,
Wang W, Zheng S, Yamaguchi I, Williams SM, Gainer J, Brown NJ,
Hazen-Martin D, Wong LJ, Robillard JE, Carey RM, Eisner GM, Jose
PA. G protein-coupled receptor kinase 4 gene variants in human essential
hypertension. Proc Natl Acad Sc U S A. 2002;99:3872–3877.
39. Wang Q, Jolly JP, Surmeier JD, Mullah BM, Lidow MS, Bergson CM,
Robishaw JD. Differential dependence of the D1 and D5 dopamine
receptors on the G protein gamma 7 subunit for activation of adenylylcyclase. J Biol Chem. 2001;276:39386 –39393.
40. Peterson TE, Guicciardi ME, Gulati R, Kleppe LS, Mueske CS,
Mookadam M, Sowa G, Gores GJ, Sessa WC, Simari RD. Caveolin-1 can
regulate vascular smooth muscle cell fate by switching platelet-derived
growth factor signaling from a proliferative to an apoptotic pathway.
Arterioscler Thromb Vasc Biol. 2003;23:1521–1527.
41. Ambasta RK, Kumar P, Griendling KK, Schmidt HHW, Busse R,
Brandes RP. Direct interaction of the novel Nox proteins with p22phox is
required for the formation of a functionally active NADPH oxidase. J Biol
Chem. 2004;279:45935– 45941.
42. Dodd-o JM, Pearse DB. Effect of the NADPH oxidase inhibitor apocynin
on ischemia-reperfusion lung injury. Am J Physiol Heart Circ Physiol.
2000;279:H303–H312.
43. Gould AL, Davies GM, Alemao E, Yin DD, Cook JR. Cholesterol
reduction yields clinical benefits: meta-analysis including recent trials.
Clin Ther. 2007;29:778 –794.
Lipid Rafts Keep NADPH Oxidase in the Inactive State in Human Renal Proximal Tubule
Cells
Weixing Han, Hewang Li, Van Anthony M. Villar, Annabelle M. Pascua, Mustafa I. Dajani,
Xiaoyang Wang, Aruna Natarajan, Mark T. Quinn, Robin A. Felder, Pedro A. Jose and Peiying
Yu
Downloaded from http://hyper.ahajournals.org/ by guest on August 3, 2017
Hypertension. 2008;51:481-487; originally published online January 14, 2008;
doi: 10.1161/HYPERTENSIONAHA.107.103275
Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2008 American Heart Association, Inc. All rights reserved.
Print ISSN: 0194-911X. Online ISSN: 1524-4563
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://hyper.ahajournals.org/content/51/2/481
Data Supplement (unedited) at:
http://hyper.ahajournals.org/content/suppl/2008/01/24/HYPERTENSIONAHA.107.103275.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Hypertension is online at:
http://hyper.ahajournals.org//subscriptions/
ONLINE SUPPLEMENT
Lipid Rafts Keep NADPH Oxidase in the Inactive State in Human Renal Proximal Tubule Cells
1
Weixing Han, 1Hewang Li, 1Van Anthony M. Villar, Annabelle M. Pascua, 1Mustafa I. Dajani,
1
Xiaoyang Wang, 1Aruna Natarajan, 2Mark T. Quinn, 3Robin A. Felder,
1
Pedro A. Jose and 1Peiying Yu
1
Department of Pediatrics, Georgetown University School of Medicine, Washington, DC
2
Department of Veterinary Molecular Biology, Montana State University, Bozeman, MT
3Department of Pathology, University of Virginia, VA
Address correspondence to
Peiying Yu, MD
Research Assistant Professor
Division of Pediatric Nephrology
Department of Pediatrics
Georgetown University Medical Center
4000 Reservoir Road, NW
Washington, DC 20057
Tel: 202-687-4951
Fax: 202-687-1503
E-mail: [email protected]
1
Materials and Methods
Materials
Previously well-characterized human renal proximal tubule (hRPT) cells were used (1-3).
The sources of reagents were: monoclonal antibodies to human NADPH oxidase subunits (Nox2,
p22phox, p67phox) (4); anti-Rac1, siRNA for Nox2 and Nox4 and control siRNA (Santa Cruz
Biotechnology, Inc., CA); an affinity purified polyclonal anti-Nox4 antibody (5), polyclonal
anti-D5R and anti-D1R antibodies generated from our laboratory, specificities of which have
been reported (6-8); anti-caveolin-1 and anti-flotillin-1 (BD Biosciences-Transduction Labs.,
Lexington, KY); secondary antibodies for blotting and immunostaining (Jackson
ImmunoReseach Labs. West Grove, PA); ECL western blotting detection reagents (Millipore
Corporation, Billerca, MA); BCA protein assay reagent (PIERCE, Rockford, IL); protease
inhibitor Cocktail set III, fenoldopam, SCH23390, 2-N-morpholino ethanesulfonic acid (Mes),
methyl-β-cyclodextrin (βCD), triethanolamine, lucigenin, NADPH, and cholesterol (SIGMAAldrich, St. Louis, MO); cell culture reagents (Life Technologies -GIBCO/BRL, Rockville, MD);
Amplex Red cholesterol assay kit and Vybrant LR labeling kit (Molecular Probes Inc., Eugene,
OR 97402).
Cell Culture
The hRPT cells from normotensive subjects were maintained in DMEM/F12
supplemented with 10% fetal bovine serum (FBS), epidermal growth factor (10 ng/ml), insulin,
transferrin, selenium (5 µg/ml each), hydrocortisone (36 ng/ml) and triiodothyronine (4 pg/ml) at
37oC in humidified 5% CO2/95% air (1-3). Non-transfected human embryonic kidney (HEK-
2
293) cells and those heterologously expressing the human D1 receptor (HEK-hD1 cells) (6-20
passages) were cultured in MEM with 10% FBS, as previously reported (9).
Cell Treatments
Our laboratory has reported that the fenoldopam-mediated inhibition of O2- production in
HEK-293 cells heterologously expressing the human D5R is dose-dependent (10). The inhibitory
effect of fenoldopam on ROS production in hRPT cells is also dose-dependent (Figure S3).
Based on these data, a fenoldopam concentration of 1 :mol/L was chosen for all experiments in
current report. Higher concentrations of D1-like receptor agonists may increase superoxide
production (11). The hRPT cells were grown in 100 cm dishes. At 90% confluence, cells prestarved in serum-free DMEM/F12 medium (SFM) for 1 hour were treated with vehicle; the D1like receptor agonist, fenoldopam (1.0 µmol/L/20 min); the D1-like receptor antagonist, SCH
23390 (Sch, 1.0 :mol/l) for 20 min; or Sch (2 min) plus fenoldopam for an additional 20 min at
the same concentrations. To disrupt lipid rafts (LRs), the cholesterol depleting reagent,
methyl−β-cyclodextrin (βCD) was used (12-14). In all cholesterol depletion and cholesterol
repletion experiments, the βCD concentration was 2% and incubated at 37oC for 1hour, except
for the dose- and time-dependent experiments. The cells were washed once with SFM and then
incubated with vehicle or βCD in SFM. Cholesterol repletion was performed by incubating the
cells in a pre-mixed solution containing cholesterol (stock solution in 100% ethanol at 50 mg/ml)
at100 µg/ml along with βCD. In some cases, the cells were pretreated with apocynin (10 µmol/L)
or diphenylene iodonium (DPI, 5.0 µmol/L), alone or in combination with βCD (2%/37oC) for 1
hour. The cells were washed in cold PBS after incubated with the drugs and subjected to
experiment.
3
Cell transfections
Cells were seeded in 6-well plates at density of 2x105/well at day 1 and then transfected
with siRNA for Nox2 or Nox4 or control siRNA at day 2, following the manufacturer’s
directions. ROS, assayed at day 4, as described in ‘Methods’, were expressed as ALU/well (106
cells/well). The results were compared with controls that were given a value of 100%.
Reverse transcription-polymerase chain reaction (RT-PCR) analysis
RNA was extracted from hRPT cells, using the RNeasay RNA Extraction Kit (Qiagen)
following the manufacturer’s directions. Total RNA was quantified by Smartspec TM Plus (BioRad) and 1 µg of RNA was used to semi-quantify the mRNA expression of Nox2 and Nox4.
The sets of the primers are listed in Supplement Table S1.
RT-PCR was carried out using Superscript III One-step RT-PCR Kit (Invitrogen) at the
following conditions: 55o C for 30 min, 35 cycles at 95o C for 30 sec, 55o C for 30 sec, 68o C for 1
min, and one cycle at 68o C for 3 min. β-actin was used as the housekeeping gene to normalize
the data. The products were resolved in 2% agarose gel and visualized using a digital gel
documentation system (Alpha Innotech Corporation), as shown in Supplement Figure S1.
Whole cell membrane preparation
Cell membranes were prepared, as described previously (10) with slight modifications.
Briefly, hRPT cells were treated with the indicated drugs. The cell pellets were collected after
centrifugation (1000g/2min/4oC), washed with cold PBS, and re-suspended in 500 µl of ice-cold
hypotonic lysis buffer containing (concentration in mmol/L, shown in square brackets) Tris-HCl
4
[25], EDTA [1], and EGTA [1], and protease inhibitors, pH 7.4. The cell suspensions were
sonicated and centrifuged at 1000 g for 10 min. The supernatants were collected, the pellets
were re-suspended in lysis buffer, and the sonication and centrifugation steps were repeated. The
supernatants were combined and centrifuged at 425,000 g for 60 min. The pellets containing
whole cell membranes were resuspended in assay buffer containing (mmol/L) sodium phosphate
[10], potassium phosphate [2], potassium chloride [10], triethanolamine [50], NaCl [150], MgCl2
[2], EDTA [1.0] and protease inhibitors.
Subcellular fractionation
To prepare LRs and non-LRs, hRPT cells were subjected to sucrose density gradient
centrifugation using a detergent-free protocol according to Song (15), with slight modifications
(9). Briefly, the cell pellets were lysed in 1.5 ml of 500 mmol/L sodium carbonate, pH 11, and
homogenized in clear ultracentrifuge tubes. Equal amounts of homogenates (for each group of
samples) were diluted 1:2 with 80% sucrose and overlaid with 5-35% sucrose as a discontinuous
sucrose gradient and subjected to centrifugation at 160,000 g (Beckman SW40 rotor) at 4oC for
16 hours. After centrifugation, twelve 1-ml fractions were collected, and a light-scattering band
confined to the 5-35% sucrose interface were in fractions 2-6 and represent lipid rafts (LRs)
while fractions 7-12 represent non-LRs (9, 15, 16). Caveolin-1 and flotillin-1, which are
strongly associated with LRs, and considered as LRs marker proteins (12), co-fractionated with
these LRs fractions (9, 12-15). All sucrose solutions were prepared in MBS (mmol/L) Mes [25],
pH 6.7, NaCl [150]. The fractionated proteins were mixed with Laemmli buffer, boiled, and
subjected to immunoblotting (9).
5
Immunoblotting
To assess the quantity of proteins in the sucrose gradient fractions, 30 µl from each of
the twelve fractions were subjected to SDS-polyacrylamide gradient (8-16%) gel electrophoresis
and transferred onto nitrocellulose membranes. The membranes were probed with the indicated
antibodies, and the immunoreactive bands were quantified as reported (9, 16, 17). Proteins of
interest were normalized to control groups, with the control given a value of 100%. All protein
preparations were carried out at 4oC in the presence of protease inhibitors (Cocktail set III), as
described above. All protein concentrations were assayed with a Bio-Rad kit.
Measurement of cholesterol content
Cholesterol content was measured using the Amplex Red cholesterol assay kit following
the manufacturer’s directions (18). hRPT cells were grown in 6-well plates to 90% confluence.
Cells were washed with PBS buffer and incubated with vehicle (control) or βCD (15
mmol/L.2%) in SFM at the indicated time points at 37oC. The cells were washed 3 times with
PBS, and the cell pellets lysed in lysis buffer containing (mmol/L) 20 potassium phosphate, pH
7.4, 100 NaCl, 25 cholic acid, and 0.5% Triton X-100. The reactions were initiated by adding
50:l of Amplex Red reagent to each microplate well containing 50 :l of the diluted sample (1/5
dilution) and incubated for 30 min at 37oC, protected from light. Serially diluted cholesterol
samples (0-10 :g) served as standard. The fluorescence was read at excitation and emission
wave lengths of 530-560 and 590 nm, respectively, using Vector (Bio-Rad) reader. The
cholesterol content was calculated and expressed as % change from control.
6
References:
1.
Watanabe H, Xu J, Bengra C, Jose PA, Felder RA. Desensitization of human
renal D1
dopamine receptors by G protein-coupled receptor kinase 4. Kidney Int. 2002; 62:790-798.
2. Felder RA, Sanada H, Xu J, Yu PY, Wang Z, Watanabe H, Asico LD, Wang W,
Zheng S,
Yamaguchi I, Williams SM, Gainer J, Brown NJ, Hazen-Martin D, Wong LJ, Robillard JE,
Carey RM, Eisner GM, Jose PA. G protein-coupled receptor kinase 4 gene variants in
human essential hypertension. Proc Natl Acad Sci U S A. 2002; 99:3872-3877.
3.
Sanada H, Jose PA, Hazen-Martin D, Yu PY, Xu J, Bruns DE, Phipps J, Carey RM, Felder
RA. Dopamine-1 receptor coupling defect in renal proximal tubule cells in hypertension.
Hypertension. 1999; 33:1036-1042.
4.
Burritt JB, Quinn MT, Jutila MA, Bond CW, Jesaitis AJ. Topological mapping of
neutrophil cytochrome b epitopes with phage-display libraries. J Biol Chem. 1995; 270:
16974-16980.
5. Wang Z, Armando I, Asico LD, Escano C, Wang X, Lu Q, Felder RA, Schnackenberg CG,
Sibley DR, Eisner GM, Jose PA. The elevated blood pressure of human GRK4( A142V
transgenic mice is not associated with increased ROS production. Am J Physiol Heart Circ
Physiol. 2007; 292:H2083-92.
6. Zheng S, Yu P, Zeng C, Wang Z, Yang Z, Andrews PM, Felder RA, Jose PA. Gα12- and
Gα13-protein subunit linkage of D5 dopamine receptors in the nephron. Hypertension. 2003;
41:604-610.
7.
Yu P, Asico LD, Luo Y, Andrews P, Eisner GM, Hopfer U, Felder RA, Jose PA. D1
dopamine receptor hyperphosphorylation in renal proximal tubules in hypertension. Kidney
Int. 2006; 70:1072-1079.
7
8.
Xu J, Li XX, Albrecht FE, et al: Dopamine1 receptor, GSα, and Na+-H+ exchanger
interactions in the kidney in hypertension. Hypertension. 2000; 36:395-399.
9.
Yu P, Yang Z, Jones JE, Wang Z, Owens SA, Mueller SC, Felder RA, Jose PA. D1
Dopamine receptor signaling involves caveolin-2 in HEK-293 cells. Kidney Int. 2004; 66:
2167-2180.
10. Yang Z, Asico LD, Yu P, Wang Z, Jones JE, Escano CS, Wang X, Quinn MT, Sibley DR,
Romero GG, Felder RA, Jose PA. D5 dopamine receptor regulation of reactive oxygen
species production, NADPH oxidase, and blood pressure. Am J Physiol Regul Integr Comp
Physiol. 2006, 290:R96-R104.
11. Colombo C, Cosentino M, Marino F, Rasini E, Ossola M, Blandini F, Mangiagalli A,
Samuele A, Ferrari M, Bombelli R, Lecchini S, Nappi G, Frigo G. Dopaminergic
modulation of apoptosis in human peripheral blood mononuclear cells: possible relevance
for Parkinson's disease. Ann N Y Acad Sci. 2003; 1010:679-682.
12. Foster LJ, De Hoog CL, Mann M. Unbiased quantitative proteomics of lipid rafts reveals high
specificity for signaling factors. Proc Natl Acad Sci. 2003; 100:5813-5818.
13. Allen JA, Halverson-Tamboli RA, Rasenick MM. Lipid raft microdomains and
neurotransmitter signalling. Nat Rev Neurosci. 2007; 8:128-140.
14. Smart EJ, Anderson RG. Alterations in membrane cholesterol that affect structure and
function of caveolae. Methods Enzymol. 2002; 353,131-139.
15. Song K, Li S, Li Shengwen, Okamoto T, Quilliam LA, Sargiacomo M, Lisanti MP: Copurification and direct interaction of Ras with caveolin, an integral membrane protein of
caveolae microdomains. Detergent-free purification of caveolae microdomains. J Biol Chem.
1996; 271: 9690-9697.
8
16. Vilhardt F, van Deurs B. The phagocyte NADPH oxidase depends on cholesterol-enriched
membrane microdomains for assembly. EMBO J. 2004; 23(4):739-748.
17. Yu PY, Asico LD, Eisner GM, Jose PA. Differential regulation of renal phospholipase C
isoforms by catecholamines. J Clin Invest. 1995; 95:304-308.
18. Yu P-Y, Asico LD, Eisner GM, Hopfer U, Felder RA, Jose PA. Renal protein phosphatase
2A activity and spontaneous hypertension in rats. Hypertension. 2000, 36:1053-1058.
9
Figure legends:
Figure S1. Expression of mRNA for Nox2 and Nox4 and cytosolic subunits in hRPTs
The expressions of Nox2, Nox4, and cytosolic subunit mRNA were evaluated in non-stimulated
hRPT cells by RT-PCR using β-actin as control.
Figure S2. Sucrose gradient analysis of p47phox and p40phox in hRPT cells
Fractions from sucrose gradients were probed with monoclonal anti-p47phox and anti-p40phox.
Low density fractions (fractions 2-6) contain LRs, while the high density fractions (fractions 712) contain non-LRs. The blots are one of three separate experiments.
Figure S3 Dose-dependent effect of the D1-like receptor agonist, fenoldopam, on ROS
production in hRPT cells
The cells were treated with vehicle (Con) or varying concentrations of fenoldopam (10-8,
10-7, 10-6 and 10-5 :mol/L) in serum-free medium for 20 min at 37oC. The cell membranes were
subjected to ROS assay, as described in ‘Methods”. The ROS activities are expressed as
percentage change from control (left panel). The numerical values of the percentage changes
are listed in the right panel. Values are mean ± SEM., n=4, ANOVA (Newman-Keuls test),
*P<0.01, Con vs. all doses, 10-8 vs. 10-6 and 10-5 :mol/L, †10-8 vs. Con, 10-6 and 10-5 µmol/L,
#P<0.05, 10-7 vs. 10-5 and 10-6 :mol/L.
Figure S4. Effect of βCD on cholesterol content in hRPT cells
Cholesterol content was measured using the Amplex Red cholesterol assay kit, as
described in ‘Methods’. The reactions were initiated by adding 50 µl of Amplex Red reagent to
each microplate well containing 50 µl of the diluted sample (1:5 dilution) and incubated for
10
1hour at 37oC. The assay was performed in triplicate. Values are mean±SEM from 4
independent experiments, t-test, *P<0.001, control vs $CD.
Figure S5. Effect of siRNA for Nox2 and Nox4 on Nox protein expression in hRPT cells
Cells were transfected with siRNA for Nox2 or Nox4 or their respective control-siRNAs,
as described in the ‘Methods’. The cell lysates were probed with polyclonal anti-Nox4 and
monoclonal anti-Nox2 and anti-βactin antibodies. The immunoreactive bands (75 kDa) were
quantified, as described previously (6-9, 10, 16, 17). Values are mean± SEM., n=4, ANOVA
(Newman-Keuls), *P<0.01, siRNA vs control (vehicle) and control-siRNA.
11
Table S1. List of Primers for RT-PCR.
Gene
Nox1
Sequence (5’-3’)
TTAACAGCACGCTGATCCTG (sense)
CTGGATGGGATTTAGCCAAG (anti-sense)
Nox2
GAATTGTACGTGGGCAGACC (sense)
CACTCCAGCTTGGACACCTT (anti-sense)
Nox4
CGGCTGCATCAGTCTTAACC (sense)
TTGACCATTCGGATTTCCAT (anti-sense)
p22phox
CGCTTCACCCAGTGGTACTT (sense)
GTAGATGCCGCTCGCAAT (antisense)
p67phox
CTTCAACATTGGCTGCATGT (sense)
GCTCAGACTTCATGCTCGTG (antisense)
p47phox
ACCAAGATCTCCCGCTGTC (sense)
CGCTCTCGCTCTTCTCTACG (antisense)
p40phox
TCCTCCTCAGTCGGATCAAC (sense)
ATGAGCGCTACGTCCTCATC (antisense)
Rac1
CCCTATCCTATCCGCAAACA (sense)
TCGCTTCGTCAAACACTGTC (antisense)
β-actin
AGAAAATCTGGCACCACACC (sense)
CTCCTTAATGTCACGCACGA (anti-sense)
12
Table S2. Distribution of Nox2 and oxidase subunits in lipid rafts
Subunits
Nox2
Nox4
LRs
40.3±3.7*
0*
Non-LRs
59.7 ±3.7
99.0 ± 4.4
p22phox
65.7 ±3.3*
34.3 ±3.3
Rac1
57.7 ±3.1*
42.3 ±3.1
p67phox
56.5 ±6.9
43.5 ±6.9
Proteins from the 12 fractions were probed with the antibodies, as indicated, and the
immunoreactive bands were quantified, as described in ‘Methods’. Fractions 2-6 represent lipid
rafts (LRs), and fractions 7-12 represent non-lipid rafts (non-LRs). Results are expressed as %
change (LRs + non-LRs = 100%). The values are mean ± SEM from 3-4 experiments, t-test,
*P<0.01, LRs vs. non-LRs.
13
Table S3. Quantification of Nox subunits
% Change
LRs
non-LRs
Control
Fenoldopam
Control
Fenoldopam
Nox2
100.0±6.0
90.0±8.0
100.5±5.5
68.9±5.8*
Nox4
0
0
99.0±4.4
73.7±3.3*
p22phox
100.8±2.6
71.1±3.1*
100.5±7.9
84.7±5.7
Rac1
100.0±5.8
58.0±3.7*
100.0±5.1
88.8±3.7
The values are mean ± SEM from 3-4 experiments, paired t-test,*P<0.01, Control vs.
Fenoldopam, n=3-4, LRs = lipid rafts, non-LRs = non-lipid rafts.
14
Table S4. Dose- and time-dependent effect of βCD on ROS production in hRPT cells
Dose
(mmol/L)
0
5
10
15
20
ROS
(fold increase)
1.1±0.1*
5.3±0.2
8.4±0.6
13.2±0.8 †
10.3±0.7*
Time (min)
0
15
30
60
90
ROS
(fold increase)
1.0±0.1*
4.8±0.73
6.9±0.75
9.5±1.0*
7.8±1.1 ‡
Cells were treated with βCD at the indicated doses for 1h or with βCD (2%.13 mmol/L) for the
indicated time points at 37oC. Cells were assayed for ROS production, as described in
‘Methods’. Values are mean ± SEM from six separate experiments, ANOVA (Newman-Keuls
test), *P<0.001, 0 vs. all doses, †P≤0.003, 15 vs 0, 5, 10 and 20 mmol/L, *P<0.001, 20 vs. 0, 5,
15 mmol/L; *P<0.001, 0 vs. all time points, *P<0.001, 60 min vs. 0 and 15 min, ‡P<0.05, 90 min
vs. 0 and 15 min
15
Table S5. Effect of βCD on NADPH oxidase activity in human kidney cell lines
Cell lines
Control
$CD
CCH
hRPT
100.0±8.7
154.0±4.0*
104.5±6.8
HEK-293
118.6±12
196.6±9.3* †
121.0±11.6
HEK-hD1
103.1±3.4
164.6±10.5*
118.9±10
Cells were treated with βCD (2%/1h/37oC), or cholesterol plus βCD (CCH), and the membranes
were prepared and assayed, as described in ‘Methods’. The data are expressed as activities in %,
with control hRPT cells set at 100%. Values are mean ± SEM from 4-6 experiments, ANOVA
(Newman-Keuls test), *P<0.001, βCD vs. control and CCH, †P<0.05, $CD in HEK-293 vs. βCD
in hRPT and HEK-hD1 cells.
16
Table S6. Effect of βCD, apocynin, and/or DPI on NADPH oxidase activity in human
kidney cell lines
Cell lines
Vehicle
$CD
hPRT
100 ±1.0
146±9.0*
100±4.5
153±3.6*
HEK-hD1
Apo
A/$CD
DPI
D/$CD
74.7±6.2 † 100±3.2 ‡
11±2.4*
9.5±3.3*
77.2±3.0 † 117±3.1 ‡
10±4.6*
7.9±2.2*
Cells were treated with vehicle, βCD (2%/1h/37oC), apocynin (Apo, 10 µmol/L), βCD plus Apo
(A/βCD), DPI (5 µmol/L), or DPI plus βCD (D/βCD). Cell membranes were prepared and
assayed, as described in ‘Methods’. Values represent the mean ± SEM from 4-6 experiments,
ANOVA (Newman-Keuls test), *P<0.001, βCD vs. others, †Apo vs. others, ‡A/βCD vs. βCD,
Apo, DPI and D/βCD, and *DPI and D/βCD vs. others respectively.
17
Table S7. Effect of Nox2 and Nox4 siRNA on βCD-induced increase in ROS production in
hRPT cells
Isoform
Control
βCD
siRNA
siRNA+βCD
Nox2
100±1.0
162.3±2.0*
83.0±7.1
81.3±5.1
Nox4
100±1.0
151.7±9.8*
112.8±12.1
108.0±10.8
Cells were transfected with siRNA for Nox2 or Nox4 for 48 h. Cells were then treated with
vehicle or βCD and assayed for ROS production, as described in ‘Methods’. The activity in
vehicle-treated (Control) cells was set at 100%. Values are the mean ± SEM from 3-6
experiments, ANOVA (Newman-Keuls test), *P<0.001,,βCD vs. control, siRNA and
siRNA+βCD.
18
Figure S1
Nox2
Nox 4
p22phox
p67phox
p47phox
p40phox
Rac 1
$-actin
Figure S2
Fraction No. 1 2 3 4 5 6 7 8 9 10 11 12
Con
Fen
Con
Fen
p47phox
p40phox
Figure S3
Dose-dependent fenoldopammediated inhibition of ROS
production in hRPT cells
% change) of control
120
*
†
#
80
40
0
Con
-8
-7
-6
Log (fenoldopam) (M)
-5
Con
100±5.7%*
10-8
85.8±4.2%†
10-7
79.6±5.0%#
10-6
64.6±6.3%
10-5
53.9±7.0%
Figure S4
Fluorescence
(% changes)
120
80
*
40
0
Con βCD
Figure S5
The effect of siRNA for Nox2 and Nox4 on protein expression
% change
Control
siRNA
ControlsiRNA
Nox2
100.2±6.2
39.1±6.1*
121.2 ±6.2
Nox4
104.5 ±5.4
53.1 ±4.8*
105.6 ±8.1
Values are mean ±SEM., n=4. ANOVA (Student-Newman-Keuls),
*P<0.01, siRNA vs. control and control-siRNA.
Nox2
Nox4
Control
siRNA
siRNA
Control
Control
siRNA
siRNA
Control
$-actin

Similar documents