Molecular Marker Screening for Ty

Comments

Transcription

Molecular Marker Screening for Ty
International Journal of Scientific & Technology Research Volume 1, Issue 4, May 2012
ISSN 2277-8616
Molecular Marker Screening for Ty-2 Gene in
Two Tomato Genotypes (Solanum
lycopersicon L.)
Mohamed, S. M., Palchamy, K.
ABSTRACT: Tomato yellow leaf curl virus (TYLCV) is a major tomato virus in tropical and subtropical regions. The resistance to TYLCV disease in the
tomato accession FLA456 and the breeding line CLN2498E was analysed by screening the parents, F1 and BC1F1 population using a sequence tagged
site (STS) marker, linked to Ty-2 gene, T0302, at the Biotechnology and Molecular Breeding Unit of the Asian Vegetable Research and Development
Centre (AVRDC), the World Vegetable Centre at Taiwan. Results showed that CLN2498E carried Ty-2 gene and FLA456 did not carry it. The BC1F1
plants segregated for Ty-2 gene in a ratio of 46:66 which is closed to 1:1 ( χ²=3.33, P< 0.05), which indicated that Ty-2 gene was simply inherited. The
phenotypic screening showed that the breeding line CLN2498E was susceptible to TYLCV-Thailand strain although it carried the Ty-2 locus. The
accession FLA456 was tolerant to TYLCV-Thailand strain. Although the F1 plants carried the Ty-2 locus, with heterozygous alleles, they showed
tolerance to TYLCV-Thailand strain disease. All the plants in the BC1F1 bearing the two bands 900 bp and 800 bp were tolerant to the disease, while
others with only 900 bp were susceptible. The results concluded that CLN 2498E carries Ty-2 gene and does not resistant to TYLCV-Thailand strain
whereas FLA 456 does not carry Ty-2 gene and resistant to TYLCV-Thailand strain.
Key words: Tomato, TYLCV, molecular screening, phenotypic screening, Ty-2 gene, FLA 456, CLN 2498E
————————————————————
1.INTRODUCTION
Begomoviruses are major threat to tomato production in
most tropical and subtropical regions (Anderson and
Morales, 2005). Since 1980s molecular markers are being
widely used as a major tool for breeding of tomato (Barone,
2008). More than 40 genes (including many single genes
and quantitative trait loci, QTL) that confer resistance to all
major classes of pathogens have been mapped on the
tomato molecular map (Grube et al., 2000). Moreover, other
resistance genes were added later to the map (Bai et al.,
2003). Zamir et al. (1994) were the first to report the
mapping of a begomovirus resistance gene using lines
derived from S. chilense accession LA 1969 and they
revealed that a major incompletely dominant gene (Ty-1) on
chromosome 6 accounted mostly for the resistance. A
partially dominant gene, that is now known as Ty-3 (Ji and
Scott, 2006b) was mapped to the marker interval between
cLEG-31-P16 (20cM) and T1079 (27cM) on the long arm of
chromosome 6. The H24 resistance factor, named Ty-2
was reported to be associated with an introgression from
TG36 (84 cM) to TG26 (92 cM) (Hanson et al., 2006). This
polymorphic marker was chosen to screen the segregating
populations that were screened at AVRDC with a biological
assay for resistance to TYLCV (Ji et al., 2007).
_________________
Mohamed, S. M.1 and Palchamy, K. 2
1 Faculty of Agriculture, Nile Valley University, Sudan
2 Asian Vegetable Research and Development Centre
(AVRDC), the World Vegetable Centre, Taiwan.
The mapping analysis showed that the markers TG105A
and T0302 are tightly linked to each other and Ty-2 is
approximately 10 cM away from these markers. The study
aimed at molecular screening for Ty-2 gene in FLA 456 and
CLN 2498E using a sequence tagged site (STS) marker
linked to Ty-2 gene, T0302 (Appendix 1) and analyzing the
genetic of resistance to TYLCV-Thailand in the two
genotypes.
2 MATERIALS AND METHODS
The experiment was conducted at Biotechnology and
Molecular Breeding Unit of the Asian Vegetable Research
and Development Centre (AVRDC), the World Vegetable
Centre at Taiwan. The tomato accession FLA456 was
crossed with the breeding line CLN2498E. The F1 plants
were back crossed to CLN2498E to obtain the BC1F1
population. Then the parents, F1 and BC1F1 plants were
grown on September, 2009 in a greenhouse for exposing to
viruliferous whiteflies carrying the TYLCV-Thailand virus for
one month before transplanting to another greenhouse.
A sequence tagged site (STS) marker linked to Ty-2 gene,
T0302 was used to screen the parents, F1 and BC1F1
populations to identify plants with or without Ty-2 gene
which is a factor responsible for resistance to TYLCV
(Hanson, 2006). Two young leaves of each plant at
seedling stage were collected and kept in a separate well of
the 96-well plate. The samples were collected randomly
from five plants on each of the four tested generations (two
parents, F1 and BC1F1). The plates were placed in FreezeDryer, which was pre-cooled until -50˚C, for 24 hours. Then
the plates were placed in a Minibeadbeater and after
grinding for few seconds the samples looked like very fine
powder. Three buffer stock solutions, which were used in
DNA extraction included solution 1, solution 2 and solution
3 were already prepared in the AVRDC biotechnology
laboratory. DNA isolation was done according to the
procedure given by Tanksley (1995). The polymerase chain
reaction (PCR) procedure was carried out following the
45
IJSTR©2012
www.ijstr.org
International Journal of Scientific & Technology Research Volume 1, Issue 4, May 2012
standard protocol described by (Kadirvel, AVRDC, Personal
communication, 2009) to identify the STS markers linked to
Ty-2 locus in the four tested generations. The preparation
of the cocktail mixture was done as follow: 1056 µl ddH2O,
160 µl 10xbuffer, 128 µl dNTP, 80 µl primer and 16 µl hot
start 4 x Taq enzyme were added, respectively in an 0.5 ml
tube. Then 1.0 µl of the DNA template was added to each
well in the two 96-well plates followed by 9.0 µl of the
cocktail mixture and the plates were spin at 2000 rpm for
one minute. After that the plates were placed in the PCR
engine, the PCR reaction (35 cycles) was run. 1.5%
Agrose gels was used to assess Ty-2 gene marker. 2 µl of
1x blue dye was added to each well already loaded with
DNA template in the 96-well plates. Then 2 µl of each
sample was loaded in addition to the marker to the agrose
gel which was run at 160 V for 80 minutes. After that the gel
was removed from the casting tray to a deep tray containing
1 µl of 10 mg/ml Ethidium Bromide solution in 150 ml of 1 x
TBE and stained for 10 minutes and the gel was rinsed
briefly with water. The gel was visualized under UV and a
photograph was saved in the computer. Phenotypic
screening was done after 60 days from germination. The
disease rating scale was scored on a 1-3 scale as
described by Kasrawi (1989) as follows:
ISSN 2277-8616
tolerant to the disease, while others with only 900 bp were
susceptible. When T0302 primer was tested with
germplasm with the Ty-2 locus from the Asian Vegetable
Research and Development Centre (AVRDC), CLN2460E
gave the 900 bp fragment (P. Hanson, pers. com.) which
confirm that CLN2498E carries Ty-2 gene. T0302F/T0302R
primer effectively detected the two genotypes, ty2/ty2 and
Ty2/Ty2 (hanson,2006). This primer pair produced two
bands (800 and 900 bp) for the F1 plants, and this confirm
the previous results by Jensen et al. (2008). The phenotypic
screening results suggested that other genes conferring
tolerance to TYLCV-Thailand are possible, so screening of
FLA456 accession using other markers might identify the
type of this gene.
1 = no observed symptom (resistant).
2 = mild symptoms which are not affecting or slightly
affecting the plant growth habit (tolerant).
3 = severe symptoms include leaf size reduction, leaf
curling, between veins yellowing and plant stunting
(susceptible).
3 RESULTS AND DISCUSSION
PCR product of FLA 456 amplified a 800 bp fragment.
CLN2498E amplified a 900 bp fragment, which is expected
of TYLCV resistant genotype linked to the Ty-2 locus with
the primer T0302 (Fig 1). The F1 plants amplified 900 bp
and 800 bp fragments. This indicated that the F1 plants
carried Ty-2 locus with heterozygous alleles i.e Ty-2/ty-2.
The BC1F1 plants segregated for Ty-2 locus. Out of 112
plants, 46 plants amplified 900 bp fragments and 66 plants
amplified 900 bp and 800 bp fragments (segregated in a
ratio of 46:66 which is closed to 1:1 ( χ²=3.33, P< 0.05),
while no plants amplified 800 bp fragment (Fig. 1). These
results indicated that the bands of 900 bp were simply
inherited. In the phenotypic screening for TYLCV-Thailand
resistance all the CLN2498E plants showed very severe
symptoms whereas all FLA456 plants showed very mild
symptoms. The F1 plants showed very mild symptoms. The
BC1F1 plants segregated for their reaction to TYLCVThailand, 64 out of 120 plants showed very severe
symptoms whereas 56 plants showed very mild symptoms
i.e. they segregated in a ratio of 64:56(χ²=0.5). Results
showed that the breeding line CLN2498E was susceptible
to TYLCV-Thailand strain although it carried Ty-2 locus
responsible for tolerance to some other TYLCV strains. The
accession FLA456 was tolerant to TYLCV-Thailand strain
and it did not carry the Ty-2 gene. Although the F1 plants
carried the Ty-2 locus, with heterozygous alleles, they
showed tolerance to TYLCV disease. All the plants in the
BC1F1 bearing the two bands 900 bp and 800 bp were
FIG.1 : PCR fragments with Ty-2 locus primers for the
T0302 marker (agarose patterns lanes are for the parents
lines CLN2498E and FLA456, F1 and 128 BC1F1 plants)
46
IJSTR©2012
www.ijstr.org
International Journal of Scientific & Technology Research Volume 1, Issue 4, May 2012
ISSN 2277-8616
TABLE 1 : Reaction of resistance to tomato yellow leaf curl virus (TYLCV–Thailand) disease in
CLN2498E, FLA456, F1 and BC1F1 populations
4 APPENDICES
APPENDIX 1:The primer sequences for T0302
F: 5′ TGGCTCATCCTGAAGCTGATAGCGC
R: 5′ AGTGTACATCCTTGCCATTGACT
5 REFERENCES
[1] P.K. Anderson and F.J. Morales, ‘’Whitefly and whiteflyborne viruses in the tropics: Building a knowledge base for
global action,’’ CIAT publication no.341, 351 p,2005.
[2] Y.Bai, C.C. Huang, R. Hults, F. Meijer-Dekens, G.
Bonnema and P. Lindhout,’’ QTLs for tomato powdery
mildew resistance (Oidium lycopersici) in Lycopersicon
parviflorum Gl.1601 co-localized with two qualitative
powdery mildew resistance genes,’’ Mol Plant Microbe
Interact 16: 196-176, 2003.
[3] A. Barone, ‘'Molecular markers-assisted selection for
resistance to pathogens in tomato. Marker Assisted
Selection: A fast tract to increase genetic gain in plant and
animal breeding,’’ Session1: MAS in plants, 2008.
[4] M.R. Foolad and S. Sharma, ‘’ Solanum genomic
network,’’ htt://www.sgn.cornell.edu, 2005.
[5] R.C. Grube,
E.R. Radwanski and M. Jahn,
‘’Comparative genetics of disease resistancwithin the
Solanaceae.’’ Genetics 155: 873-887, 2000.
[6] P. Hanson, S.K. Green and G. Kuo, ‘’Ty2, a gene on
chromosome 11conditioning geminivirus resistance in
tomato,’’ Tomato Genetic Cooperative Report 56:17-18,
2006.
[7] Y. Ji, P. Hanson, E. Graham and D.P. Maxwell,
‘’Sources of resistance, inheritance, and location of genetic
loci conferring resistance to members of the tomato
infection begomoviruses,’’ In: Czosnek H (ed) Tomato
yellow leaf curl virus disease: Management, molecular
biology, Breeding for resistance. Kluwer, Dordrecht, 2007.
[8] Y. Ji and J.W. Scott, ‘’Ty-3, a begomovirus resistance locus
linked to Ty-1 on chromosome 6’’ Report of Tomato
Genetic Coop. 56, 2006b.
[9] S.J. Katie, P. Hanson, and M. Luis, ‘’Co-dominant SCAR
marker for detection of the begomovirusresistanceTy2 locus
derived from Solanum habrochaites in tomato germplasm,’’
(Graham and Hanson, pers. com.)
[10] S.D. Tanksley, M.W. Ganal, J.P. Prince, M.C. Vicente,
M.W. Bonierbale, P. Broun, T.M. Fulton, J.J. Giovannoni,
S. Grandillo, G.B. Martin, R. Messeguer, J.C. Miller, L.A.H.
Miller, O. Paterson, M.S. Pineda, R.A. Roeder, W.Wu.
Wing and N.D. Young,’’High density molecular linkage
maps of the tomato and potato genomes,’’ Genetics
132:1141-1160, 1992.
[11] D. Zamir, I. Ekstein-Michelson, Y. Zakay, N. Navot, M.
Zeidan, M. Sarfatti, Y. Eshed, E. Harel, T. Pleban, H. Van
Oss, N. Keder, H.D. Rabinowitch and H. Czosnek,
‘’Mapping and introgression of tomato yellow leaf curl virus
tolerance gene, Ty-1,’’ Theor. Appl. Genet. 88:141-146,
1994.
47
IJSTR©2012
www.ijstr.org

Similar documents