Short Communication: Effects of different light conditions

Comments

Transcription

Short Communication: Effects of different light conditions
AsPac J. Mol.
2011
Mol. Biol.
Biol.Biotechnol.
Biotechnol.
Vol. 19 (4), 2011
Vol. 19 (4) : 121 - 130
Flowering time mutants in Arabidopsis
121
Short Communication:
Effects of different light conditions on various CONSTANS-LIKE mutants
and their response to flowering time
Nurhafiza Zainal and Colin Turnbull*
Department of Life Sciences, Sir Alexander Fleming Building, Imperial College London,
South Kensington Campus, London SW7 2AZ, United Kingdom
Received 26 July 2011 / Accepted 15 November 2011
Abstract. CONSTANS (CO) is a central component in the photoperiod pathway that is involved in promotion of flowering.
In Arabidopsis, CO promotes flowering under long day conditions. CONSTANS-LIKE 1 (COL1) is one of the genes in the CO
family with three conserved regions including two domains near the amino terminus known as zinc finger regions and a CCT
(CONSTANS, CO-like, and TOC1) domain near the carboxy terminus. Unexpectedly, in this study, the results show that a col1
T-DNA insertion mutant exhibited early flowering under long day and short day conditions while a COL4 transferred DNA
(T-DNA) line showed early flowering under short day but not under long day conditions. An insertion in the 3’UTR of col1 was
confirmed by PCR. Gene expression analysis showed that the COL1 gene was disrupted. However, through expression analysis
using several primers, at least a partial COL1 mRNA was shown to be present in the col1 line. Nevertheless, whether the mRNA
is functional and able to be translated to COL1 protein is still uncertain. This indicates that col1 is a mutant but not a complete
knockout. Under light-limited condition analysis, wild type, col1 and col12 plants exhibited early flowering under high light intensity compared to low light intensity. Our results suggest that COL1 acts as a negative regulator of flowering time while COL4
only affects flowering time under short day conditions. Additionally, faster growth and flowering time in Arabidopsis under higher
light intensity may be due to an increased photosynthetic rate.
Keywords: Arabidopsis, col1 mutant, CONSTANS-LIKE 1, Flowering, Gene expression, Photoperiod pathway.
INTRODUCTION
In plants, both endogenous and exogenous signals influence the conversion from vegetative to reproductive growth.
There are four types of pathway that regulate flowering time,
which comprise the photoperiod pathway, the autonomous
pathway, the gibberellin pathway and the vernalization
pathway (Koornneef et al., 1998). In Arabidopsis, the photoperiod pathway is the most effective in promoting flowering under long day conditions (LD), deduced partly from
the very late flowering seen in a co-2 ga1-3 double mutant
(Reeves and Coupland, 2001). The photoperiod pathway
perceives light and temporal information through a system
involving three parts: photoreceptors, circadian clock and
output pathway (Simpson 2003). CONSTANS (CO) is the
central component in promotion of flowering by LD and
overexpression of CO causes earlier flowering than in wildtype (WT) under LD. Under short day conditions (SD), in
some families, overexpression of CO causes early flowering
although the level of CO product expression is limited under
this condition (Putterill et al., 1995). Expression of CO is
regulated by the circadian clock and is dependent on GI;
transcription of CO is significantly reduced in gi mutants
(Suarez-Lopez et al., 2001). CO also acts as a transcription
factor that stimulates the expression of one of the main floral integrator genes, FLOWERING LOCUS T (FT) (Kardai-
lsky et al., 1999). High expression of CO occurs during the
evening and continues until dawn under LD while the level
of CO mRNA peaks during the night under SD (SuarezLopez et al. 2001). Promotion of flowering under LD is
achieved by stabilization of CO protein by PHYA and CRY2
at the end of the day (Valverde et al. 2004), whereas protein
accumulation does not occur under SD. This process contributes a basis for regulation of flowering by duration of the
day (Searle and Coupland 2004).
CO is one of the genes in the family of Arabidopsis genes
together with 16 other members. The CO and CONSTANSLIKE (COL) genes have two conserved domains of homology consisting of a zinc-finger region near the amino terminus which acts in protein-protein interactions, and a CCT
region near carboxyl terminal which is involved in localization of protein in the nucleus. The family comprises 3 subgroups of CO; COL1 to COL5 contain two B-boxes similar
to CO; COL6 to COL8 and COL16 contain only one such
B-Box; COL9 to COL15 contain a second B-box which is
less similar to CO (Robson et al., 2001). Rice has 16 genes
(OsA to OsP) that have also been divided into three groups
* Author for correspondence:
Dr. Colin Turnbull, Department of Life Sciences, Sir Alexander Fleming Building, Imperial College London South Kensington Campus, London SW7 2AZ, United Kingdom. Tel.: +442075946437,
Email: [email protected]
122
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
(Griffiths et al., 2003).
COL1 and COL2 encode zinc-finger proteins with 67%
amino acid similarity to CO. Unlike CO, analysis of lines
with up-regulated COL1 and COL2 genes suggest no relationship between flowering time and expression of genes;
no effect on flowering time is observed. However, overexpression of COL1 accelerates the circadian clock in Arabidopsis (Ledger et al., 2001). Additionally, a homologue of
the CONSTANS LIKE 1 gene in Brassica nigra, Bni COL1
is associated with variation in flowering time (Shavorskaya
and Lagercrantz, 2006). col3 plants flowered significantly
earlier than wild-type equivalents under both LD and SD
conditions (Datta et al., 2006). COL9, which is circadianregulated, caused delayed flowering when over-expressed
while a co-suppression line and a knockout line showed
earlier flowering under LD conditions. Moreover, the levels
of mRNA of CO and FT were reduced in the up regulated
COL9 line (Cheng and Wang, 2005). This result indicates
that both COL3 gene and COL9 genes act as suppressors of
CO. Nevertheless, double overexpression of CO and COL9
show early flowering similar to the overexpression of CO
alone, thus CO is epistatic to COL9.
In addition to endogenous pathways, exogenous signals
such as light quality also play a role in determining flowering
time. It is acknowledged, for example, that far-red (FR) light
promotes early flowering. This phenomenon occurs in the
environment as plants growing in the open usually absorb
more red light than far red light. Therefore, plants that grow
under the canopy of larger plants usually experience far red
light enrichment (Kim et al., 2008). A study of Arabidopsis
grown under far-red enriched light (FREL) showed that in
the early hours of the day, plants contain higher levels of
CO mRNA compared to plants growing under white light.
Additionally, FREL, independently from CO transcription,
increased the level of CO protein. Moreover, mutants for
co and gi genes show insensitivity to FREL, supporting the
model that promotion of flowering by FREL acts through
CO (Kim et al., 2008). The influence of other COL genes
on flowering time and the flowering time of COL mutants
under light limited conditions are investigated here to create
new genetic evidence for the effects of COL on flowering
time.
METHODS & MATERIALS
Plant Material.
The seeds of Arabidopsis thaliana
Col used for this study were COL1 (N524856), COL1
(N526182), COL2 (N467454), COL2 (N872660), COL3
(N501005), COL4 (N591739), COL4 (N661206), COL5
(N663414), COL9 (N6137167), COL10 (N662685),
COL10 (N663654), COL11 (N534952) and COL12
(N873127) with control co (N870084) mutants and WT
(Col-0). All of the seeds were ordered from the Arabidopsis Stock Centre (NASC) and were annotated as being mutants produced through knockout by insertion (T-DNA).
Flowering time mutants in Arabidopsis
The insertion of T-DNA took place at the 3’ UTR in
COL1 (N524856), 5’ UTR in COL1 (N526182), the promoter in COL2 (N467454), 5’UTR in COL2 (N872660),
an intron in COL4 (N591739) and in exons of COL3
(N501005), COL4 (N661206), COL5 (N663414), COL9
(N6137167), COL10 (N662685), COL10 (N663654),
COL11 (N534952) and COL12 (N873127). Some of the
lines were still heterozygous because they were self-pollinated populations produced without selection. Homozygous
lines of COL4 (N661206), COL5, and both of the COL10
lines were homozygous due to selection of segregating populations.
Growth conditions and flowering time experiments. Seeds
were sown on compost mixed with sand and vermiculite at
a ratio of 4:1 by volume, then exposed to low temperature
treatment (4°C) for 2 days to break the dormancy of the
seeds (Reeves and Coupland, 2001). The seeds were kept in
a growth room at 22°C with 60% humidity under LD (18h
light, 6h dark) or SD (10h light, 14 h dark) with 120 µmol
m-2s-1 light intensity provided by fluorescent lamps. The
flowering time of each COL line was measured by counting the total number of leaves (rosette leaves) because as the
flowers emerged, leaves cease to form. The counting of leaves
was conducted once the plants start to bolt and the shoots of
the flower were 6 to 10 cm tall, to prevent the leaves on the
axillary shoots being included in the count. The data from
the scoring was then entered into Microsoft Excel for analysis as described by Weigel and Glazebrook (2002). The flowering time phenotype was identified by comparing the total
leaf number of each COL mutant with WT and co mutants.
COL mutants that flowered earlier or later than WT were
characterized as having an altered flowering time phenotype.
Further genetic and molecular analysis was done to confirm
the flowering time genotype. For experiments in light limited conditions, homozygous lines of col1, col12 and wild
type were planted on the soil at 22 °C under LD with three
different light intensities: 30, 80 and 200 µmol m-2s-1. Flowering time in the experiment under light limited conditions
was also judged by total number of leaves (rosette leaves).
Homozygosity and T-DNA insertion screening.
For
isolation of DNA, leaves were ground using a tissue lyser
machine (Qiagen) and DNA was extracted using extraction buffer (Qiagen), isopropanol and 70% ethanol. DNA
was then eluted with Tris-EDTA buffer for storage. Mutation by T-DNA insertion caused changes in phenotype by
abolishing or decreasing the function of the gene that was
disrupted. The disrupted function was only expressed in
lines homozygous for the insertion unless the mutation was
dominant, thus plant material for gene expression assays
should be obtained from a homozygous plant (Weigel and
Glazebrook, 2002). In order to determine the genotype of
plants Polymerase Chain Reaction (PCR) was conducted,
using one primer located on either side of the insertion site
(Weigel and Glazebrook, 2002). Homozygous wild type
individuals produced a PCR product from genomic 5’ and
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
Flowering time mutants in Arabidopsis
123
3’ primers, homozygous mutant plants produced a product
Table 1. Primer sequences used in PCR amplification for T-DNA insertion screening.
Primer Pair Name
Forward
Reverse
CO (N870084)
AAGCTGTTGTGACACATGCTG
CCCCTTCTTTCAGATACCAGC
COL1 (N524856)
TCAGCTTAACCGTTGAAGTGG
TCTATGGACCTGGGAGTTGTG
COL1 (N526182)
TTAATTTGGACCCACCATTTG
TGTGCATAGAGATGCAGCATC
COL2 (N467454)
ACCAATTCGGATAGTGGATCC
AGTTGGATCATCTTGTGGCTG
COL2 (N872660)
TTGGCAATATTGTTTCAGTGAAC
TGCAGATAATGGAAGAATCGG
COL3 (N501005)
TGAAAGGGTTCTCCTTCAAGG
TGTTAGGTTTCGACGAGAACG
COL4 (N591739)
ACCAACCACATCATTGCTCTC
CTGCTTCGTGGCTGTTACTTC
COL4 (N661206)
GGCCATTTACTTTATCCTCGC
ATCGTAAAACGGAGTAACGGG
COL5 (N663414)
GACTGGGCATGACAGATCATC
CCAGTCGTCGAGCTAGTGATC
COL9 (N6137167)
ATTGGATCTTTTGATTTGGGG
AGTGCCATGTCAACTTCATCC
COL10 (N662685)
TCCAGAAAATTCATCAATGGC
TCACAGTCAAGTCATGATGCC
COL10 (N663654)
GATATCTCTTCGAGCACGGTG
GTGCAAAAGGATCCTGAAAGG
COL11 (N534952)
AATGGTTCATCAACTTCCGTG
TGAAATGGAAGGTGGAGAGTG
COL12 (N873127)
ATTGGTTCTAAACCAGTGGGG
TAACACATCCAGCTTTACCGG
only from the set of primers that amplify elements that flank
the insertion, and heterozygous plants produced a product
using both sets of primers. The 50 µl PCR mix consisted
of PCR buffer (Qiagen), 50mM MgCl2, 2.5mM dNTPs,
10mM sense and antisense primers, 5 units Taq polymerase,
sterile distilled water and DNA template. Primer sequences,
developed using a primer design tool (NCBI), used for the
PCR assays for each COL product tested are given in Table
1, and the primer used for the leaf border (LB) reaction was
5’-GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC-3’. The PCR program was as follows: initial denaturation at 96°C for 5 minutes, 40 amplification cycles of 94°C
for 30 seconds, 55°C for 1 minute and 72°C for 1 minute
20 seconds, followed by a final extension stage of 72°C for
5 minutes. PCR amplification products were analyzed by
electrophoresis in 1.2% agarose gel with TAE buffer for 50
minutes at 80V. Observation of bands on the gel indicated
whether or not at least one chromosome carried the insert.
Gene expression analysis. Gene expression analysis was
carried out using reverse transcription PCR (RT-PCR) to
test the expression of the target gene in the knockout line.
Total RNA was extracted using SIGMA-ALDRICHR protocols and eluted in Milli-Q water treated with DEPC. Optical density (OD) measurements were carried out to ensure
the quality of RNA (free from DNA and proteins, 260/280
ratio ≥ 1.7). First strand cDNA synthesis was conducted using 50 µM oligo(dT), 10 mM dNTP, 5x First-strand Buffer,
0.1 M DTT, 200 units/µl SuperScript III RT, sterile distilled
water and 2 µg RNA. RT-PCR was conducted using the
SIGMA-ALDRICHR protocol, using a PCR mix of PCR
Buffer Flexi, 50 mM MgCl2, 10mM dNTP Mix, 10 µM
sense and antisense primers, 5U/µl Taq polymerase, sterile
distilled water and cDNA, and PCR program as follows:
initial denaturation of 95°C for 5 minutes, 35 amplifica-
tion cycles
(a)of 95°C for 30 seconds, 56°C for 1 minute and
(b)
Figure 1. Flowering time of col mutants under long days.
(a) Days to flowering of plants grown under long day. (b) Total
number of rosette leaves formed prior to flowering under long
days. All lines consist of 24 individuals. Error bars are ± s.e.
72°C for 2 minutes, followed by final extension stage of
72°C for 5 minutes. For the expression analysis in Arabidopsis plants, several primers were tested to find the optimal pair of primers that capable to amplify the COL1
sequence. Primer sequences tested for optimum primer
pairs for COL1 amplification are given in Table 2. Oligonucleotides 5’-CACGGCCACTAACCATTCAT-3’ and
124
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
(a)
Flowering time mutants in Arabidopsis
(b)
Figure 2. Phenotype difference between WT and a col1 mutant under long days. (a) Early flowering in individual COL1 (N524856) TDNA line plant compared with WT (Col-0) under long day. (b) Early flowering in segregating population of COL1 (N524856) line under
long days. 6 individuals out of 24 COL1 (N524856) plants show early flowering compared to the rest. The ratio is consistent with 3:1 ratio
where the observed value (18:6) is similar with expected value in phenotype.
Figure 3. Flowering time under short day. Bars represent the total number of leaves formed prior to flowering under short days
(rosette leaves). All 12 lines consist of 24 individuals. Error bars
are ± s.e.
3’-GGACTTCTACCAAGTGGGCA-5’ were used for amplification of COL1, and 5’-ATGAAGATTAAGGTCGTGGCA-3’ and 3’-TCCGAGTTTGAAGAGGCTAC-5’ for
the amplification of ACTIN.
RESULTS
Flowering time experiment. Flowering time in COL TDNA insertion lines was analyzed by observation of samples of Arabidopsis plants growing under LD and SD conditions. In contrast to co, the T-DNA inserted COL1 line
(N524856) demonstrated early flowering compared to WT
under LD (18h light, 6 dark). Total leaf number is consistent with days to flowering of COL mutants (Figure 1). The
COL1 (N524856) line that showed early flowering as measured by total leaf number also showed the earliest flowering time as measured in days. Although no specific analysis
had been completed at this early stage of the study, a major
difference in flowering time was noticed between wild-type
and COL1 (N524856) plants (Figure 2a). Moreover, the ratio of significantly early flowering individuals in the COL1
(N524856) line is 18:6, which is consistent with the 3:1 ex-
pected phenotypic ratio (Figure 2b). However, in contrast
with COL1 (N524856), another COL1 line (N526182) did
not show early flowering under LD (Figure 1b). The difference may be due to T-DNA insertion into a different location causing different expression of the genotype. The location of the T-DNA insertion in COL1 (N524856) is in the
3’UTR region while in COL1 (N526182) the T-DNA is inserted into the 5’UTR region. The remaining T-DNA COL
insertion lines displayed more or less similar flowering time
as WT except for COL12 which showed slightly later flowering than the other COL lines but not co mutants (Figure 1b).
Since this interesting COL1 gene line was heterozygous, homozygous wild-type, heterozygous and homozygous mutants were identified to test whether insertion of T-DNA is
the sole cause of the early flowering of COL1 (N524856).
Under SD, two T-DNA insertion lines show early flowering: COL4 (N591739) and COL1 (N524856) (Figure 3).
Clear differences were observed between WT and both COL
lines (Figure 4). co mutants exhibited late flowering only in
LD but similar late flowering to WT under SD (Koornneef
et al., 1991). The other COL insertion lines showed no significant difference in leaf number at floral initiation or days
to flowering compared to WT or co mutants. Early flowering
in both T-DNA inserted lines may indicate that the COL1
gene affects flowering time under SD conditions, the opposite effect to that of CO. COL4 unexpectedly displayed
early flowering under SD, whereas under LD COL4 shows
no significant difference when compared to WT. COL4 may
therefore possibly influence flowering time under SD but
not LD. Both of these hypotheses require further detailed
analysis for confirmation.
Homozygous T-DNA insertion screening. Through PCR
we distinguished the homozygous mutant individuals from
those which were heterozygous or homozygous WT (Figure
5). COL1 left and right primers are expected to amplify a
1264bp PCR product from a WT chromosome, and a product between 579bp and 879bp using left border (LB) and
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
(a)
Flowering time mutants in Arabidopsis
125
(b)
Figure 4. Phenotype difference between WT and COL1/COL4 under short day conditions. (a) Early flowering in COL4 (N591739)
inserted T-DNA line under short day. (b) Early flowering in COL1 (N524856) inserted T-DNA line under short day.
right
Table 2. Primer sequences tested for compatible primers for COL1 (pairing primers makes 16 possible combinations).
Forward
Reverse
ACAGTTCCACGGCCACTAAC
GGACTTCTACCAAGTGGGCA
CACGGCCACTAACCATTCAT
GGACTTCTACCAAGTGGGCA
AGAGTAACTGGGCACAAGCC
GCATACGCTTTCCTTGAAGC
AGAGTAACTGGGCACAAGCC
CCGTGGTCTTTTCTCTGCAT
primer reactions, respectively, detecting the gene insertion.
From 21 individuals of COL1 assayed, 6 were homozygous
wild-type, 10 were heterozygous and 5 were homozygous
for the insertion (individuals numbered 3, 10, 19, 23 and
24), consistent (X2 = 0.143; P = 0.9309) with the 1:2:1 ratio
expected from Medelian inheritance. The homozygous individual numbered 19 was chosen for repeat growing under
LD to confirm the flowering time phenotype.
WT homozygous plants flowered latest, flowering time
was intermediate in heterozygous and lowest in homozygous
mutants, as measured by total leaf number (Figure 6a).
Plant ages at flowering of homozygous WT, heterozygous
and homozygous mutant show consistency with the total
leaf number (Figure 6b). Although there is no significant
difference in flowering time between the genotypes, heterozygous individuals seem to show intermediate expression.
This might due to co-dominance, with the heterozygous individual expressing both alleles.
Gene expression analysis. All homozygous individuals
selected from the col1 3’UTR mutant population showed
significantly earlier flowering under LD than WT plants
(ANOVA value, P = 1.52 E-30) (Figure 7), and produced
5-6 fewer rosette leaves than WT individuals. We also analyzed col12 mutants under LD because the T-DNA inserted
COL12 line displayed the latest flowering compared to other
COL gene mutants, though flowering was not as late as co
mutants under LD condition. Nevertheless, there is no significant difference between the total leaf number of col12
and WT under LD condition.
In determination of expression levels of the COL1 gene,
using 12 combinations of primers, primer pairs A, D, G, H,
J, and K showed a positive result. These primer pairs show a
clear band in the WT lane and the absence of a band on the
col1 lane that indicates these primers only amplify the inserted gene (Figure 8a). Considering the locations of the 12
primers confirms that only combinations flanking the insertion region produced a positive PCR result (Figure 9). Two
of the combinations (D and J) displayed the most optimal
primers for amplification of COL1; D was chosen for expression analysis. The expected RT-PCR product lengths are
942bp from the COL1 primers and 400bp from the ACTIN
primers. The presence of a band on the gel corresponding
to amplification by the ACTIN primers from col1 and wild
type individuals showed that RNA isolation and cDNA synthesis had been successful. The failure of RT-PCR to amplify
COL1 from the col1 individuals, unlike from WT plants
shows that the COL1 gene was disrupted by the insertion
of T-DNA (Figure 8b). However, this disruption theory is
inconsistent with the fact that primer combinations B, C, E,
F, I and L amplified sequence that does not flank the T-DNA
insertion location (Figure 9) shown by the presence of bands
in both lanes of the gel (Figure 8a).
Light limited condition analysis.
Total leaf number of
126
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
Flowering time mutants in Arabidopsis
Figure 5. Homozygous and T-DNA insertion screening. PCR products for COL1 (N524856). The expected product length from COL1
left and right primers is 1264bp for wild-type and 579bp – 879bp for the left border (LB) and right primer reaction. For each of the individuals, the presence of a band in both or either lane shows whether the individual is mutant or not. The presence of a band in the first
lane only indicates that the individual is homozygous wild type, in both lanes indicates a heterozygote and in the second lane indicates a
homozygote mutant. The amplified LB/R band amplified from COL0 individuals corresponds to an unknown product that does not represent the T-DNA insertion and is 500bp, smaller than the true product that is amplified from mutants which at 579bp-879bp.
plants growing under 80 µmol m-2s-1 and 200 µmol m-2s-1
light intensity indicate that wild type, col1 and col12 plants
grown under the lower light intensity exhibited later flowering than plants grown under higher light intensity (ANOVA
value; COL0, P = 1.95372E-05; col1, P = 1.97986 E-07; col12,
P = 4.32506 E-08) (Figure 10). This finding is completely at
odds with other studies of Arabidopsis grown under low light
quantity. However, flowering of col1 is significantly earlier
than WT and col12 in each light quantity, signifying that
COL1 affects flowering under both high and moderate light
intensity. Arabidopsis plants grown under 30 µmol m-2s-1
failed to grow or flower normally. This problem may be due
to insufficient light intensity.
DISCUSSION
Analysis of a col1 mutant with a T-DNA insertion in the
3’UTR grown under LD and SD shows early flowering is
produced under both conditions. This is the opposite of co
which causes late flowering but only under LD (Onouchi
etal., 2000; Putterill et al., 1995). Correlation between plant
age to flowering and total leaf number of each COL gene
mutant showed that there is a relationship between actual
flowering time and total leaf count. The early flowering observed in T-DNA insertion lines is not consistent with the
finding that transgenic overexpression of COL1 has little effect on flowering time under LD conditions (Ledger et al.,
2001). However, the early flowering reported here is similar to findings related to COL3 and COL9 genes. Analysis
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
(a)
(b)
Figure 6. (a) Mean total leaf number of homozygous WT, heterozygous and homozygous mutants in COL1 (N524856) inserted
line. (b) Mean of plant ages of homozygous WT, heterozygous and
homozygous mutants in COL1 (N524856) inserted line.
Figure 7. Total leaf number in WT, col1 and col12 under long
day conditions. ANOVA value, P = 1.52 E-30.
of col3 mutants shows early flowering in both LD
and SD while a mutant of col9 produced by insertion of T-DNA shows early flowering only under
LD (Cheng and Wang, 2005; Datta et al., 2006).
Early flowering of col1 mutants suggests that COL1
does not function as a promoter of flowering but may act
as a negative regulator or suppressor of CO. CO acts as a
major promoter of FT, the main floral integrator in flowering only when grown under LD. This is because a longer
light period results in a higher abundance of CO mRNA and
more protein being expressed. Although PHYB degrades
CO protein in the early part of the day, the level of CO
mRNA and protein expression caused by the longer activation of CO through the photoperiod pathway is sufficient to
promote flowering. In addition, PHYA and CRY2 help to
stabilize CO protein at the end of the day.
Under SD, insufficient expression of CO mRNA and
degradation of CO protein in the dark leads to late flowering in Arabidopsis (Valverde et al., 2004). This is in contrast
to COL1 and COL4 as both of these insertion lines display early flowering in SD, signifying that COL1 and COL4
affects flowering time by enhancing negative regulation of
CO. Further molecular and genetic analysis under SD is re-
Flowering time mutants in Arabidopsis
127
quired to confirm this hypothesis.
In analysing gene expression of several insertion lines,
primers that flanked the T-DNA insertion region did not
amplify from col1 mutant plants, indicating that COL1 was
disrupted. However, amplification of cDNA sequence that
did not include the region of T-DNA insertion from both
wild type and mutant plants suggests that col1 is a mutant
line but is not a complete knockout, as mRNA was made.
Whether the col1 mRNA is functional and able to be translated into COL1 protein is still unknown, but the early
flowering phenotype of this col1 mutant indicates that it
is not completely functional. Mutations that cause disruption in the function of the CCT domain delays flowering in
Arabidopsis (Robson et al., 2001). The insertion of T-DNA
in col1 is located in the 3’UTR and causes early flowering
in Arabidopsis while insertion in the 5’UTR in the COL1
(N526182) insertion line does not cause early flowering.
This suggests that elements in or near the 3’UTR of COL1
may be involved in regulation of expression, and this in turn
affects the flowering time.
Light-limited condition analysis was carried out by
growing plants at low, intermediate and high light intensities. Plants grown under dense canopies perceive a low ratio
of red to far-red incoming light (Cerdan and Chory, 2003).
Analysis of photoperiod pathway mutants and autonomous
pathway mutants show that FREL (i.e. a R to FR ratio of 0.4)
promotes early flowering through the photoperiod pathway
(Kim et al., 2008). It is also known that levels of CO mRNA
and CO protein increase in plants grown under FREL compared to plants grown under white light only (Kim et al.,
2008). This higher level of CO activity is believed to result
from stabilization of CO protein by PHYA and CRY2 in farred light and suppression of the degradation of CO protein
under red-light by PHYB. Analysis of COL gene expression
under light-limited conditions was done by growing col1 homozygous plants under three levels of light intensity: 30, 80
and 200 µmol m-2s-1. Wild type, col1 and col12 plants grown
under the moderate light intensity exhibited later flowering
than plants grown under higher light intensity. This may be
due to a higher photosynthetic rate allowing faster growth
and flowering. This is in contrast with early flowering in
co mutants grown under far-red light or FREL (far-red enriched light) in the laboratory (Kim et al., 2008). Nevertheless, col1 flowered significantly earlier than wild type and
col12 in both light conditions whereas plants grown under
the lowest light intensity showed retarded development and
failed to flower. The earlier flowering seen in col1 mutants
compared to wild type and col12 plants under both light intensities suggests that COL1 affects the flower-ing time under any light intensity. Nevertheless, conditions of low light
intensity in this experiment were different from actual FREL
conditions (R to FR ratio of 0.4). Repeat experiments should
be done with accurate light intensity provision achieved by
measuring and modifying the spectrum so that it will be similar to shade conditions found in the natural environment.
128
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
Flowering time mutants in Arabidopsis
(a)
(b)
Figure 8. (a) Gel of RT-PCR products from 12 primer combinations for COL1, each determined for WT (COL0) and col1 mutant.
(b) Determination of expression of COL1 (expected product = 942bp) in WT and col1 (using D primer combination) using ACTIN
primers as reference.
Figure 10. Light-limited condition experiment. The blue bars
represent total leaf number of WT (COL0), col1 and col12 grown
under 80 µmol m-2 s-1 light intensity. The red bars represent total
leaf number of WT, col1 and col12 grown under 200 µmol m-2 s -1
light intensity. Plant grown under 200 µmol m-2 s-1 shows significantly early flowering compared to plant grown under 80 µmol m-2
s-1 (ANOVA value, P = 0.008144).
CONCLUSION
Figure 9. Location of 12 combinations of primers.
COL1 appears not to act as a floral promoter but instead
functions as a negative regulator of flowering. From RT-
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
PCR and PCR analysis, it is confirmed that a homozygous
line carrying a T-DNA insertion in the COL1 gene displays
early flowering and disrupted expression of COL1. Additionally, col1 affects flowering time in SD, in contrast to co;
co mutants have the same flowering time as wild type plants
when grown under SD (Valverde et al., 2004). In the future,
further detailed genetic and biochemical analysis is required
to clarify these responses. For example, further analysis of
col1 gene expression should be done, especially to determine
the expression level of CO and FT in col1 mutants. High
expression of CO and/or FT in col1 mutants would support the hypothesis that COL1 acts as negative regulator of
flowering. In addition, analysis of COL1 and COL4 mutants
under SD should be carried out by PCR-based genotype selection followed by gene expression analysis of COLs, CO
and FT to further determine the influence of SD on COL1
and COL4.
ACKNOWLEDGEMENTS
The author would like to thank Ms. Zaidah Rahmat and
Ms. Maija Sierla for great cooperation in the laboratory.
REFERENCES
Cerdan, P.D. and Chory, J. 2003. Regulation of flowering
time by light quality. Nature 423 (6942): 881-885
Cheng, X.F. and Wang, Z.Y. 2005. Overexpression of COL9,
a CONSTANS-LIKE gene, delays flowering by reducing
expression of CO and FT in Arabidopsis thaliana. Plant
Journal 43 (5): 758-768
Datta, S., Hettiarachchi, G.H., Deng, X.W. and Holm,
M. 2006. Arabidopsis CONSTANS-LIKE3 is a positive
regulator of red light signaling and root growth. Plant
Cell 18 (1): 70-84
Griffiths, S., Dunford, R.P., Coupland, G. and Laurie, D.A.
2003. The evolution of CONSTANS-like gene families
in barley, rice, and Arabidopsis. Plant Physiology 131 (4):
1855-1867
Isaure, M.P., Fraysse, A., Deves, G., Le, L.P., Fayard, B.,
Susini, J., Bourguignon, J. and Ortega, R. 2006. Microchemical imaging of cesium distribution in Arabidopsis
thaliana plant and its interaction with potassium and
essential trace elements. Biochimie 88 (11): 1583-1590
Kardailsky, I., Shukla, V.K., Ahn, J.H., Dagenais, N., Christensen, S.K., Nguyen, J.T., Chory, J., Harrison, M.J.
and Weigel, D. 1999. Activation tagging of the floral
inducer FT. Science 286 (5446): 1962-1965
Flowering time mutants in Arabidopsis
129
Kim, S.K., Yun, C.H., Lee, J.H., Jang, Y.H., Park, H.Y. and
Kim, J.K. 2008. OsCO3, a CONSTANS-LIKE gene,
controls flowering by negatively regulating the expression of FT-like genes under SD conditions in rice. Planta 228 (2): 355-365
Kim, S.Y., Yu, X. and Michaels, S.D. 2008. Regulation of
CONSTANS and FLOWERING LOCUS T expression
in response to changing light quality. Plant Physiology
148 (1): 269-279
Koornneef, M., Alonso-Blanco, C., Peeters, A.J. and Soppe,
W. 1998. Genetic control of flowering time in Arabidopsis. Annual Review Plant Physiology and Plant Molecular Biology 49: 345-370
Koornneef, M., Hanhart, C.J. and van der Veen, J.H. 1991.
A genetic and physiological analysis of late flowering
mutants in Arabidopsis thaliana. Molecular and General
Genetics 229 (1): 57-66
Ledger, S., Strayer, C., Ashton, F., Kay, S.A. and Putterill,
J. 2001. Analysis of the function of two circadian-regulated CONSTANS-LIKE genes. Plant Journal 26 (1):
15-22
Onouchi, H., Igeno, M.I., Perilleux, C., Graves, K. and
Coupland, G. 2000. Mutagenesis of plants overexpressing CONSTANS demonstrates novel interactions
among Arabidopsis flowering-time genes. Plant Cell 12
(6): 885-900
Putterill, J., Robson, F., Lee, K., Simon, R. and Coupland,
G. 1995. The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell 80 (6):
847-857
Reeves, P.H. and Coupland, G. 2001. Analysis of flowering
time control in Arabidopsis by comparison of double
and triple mutants. Plant Physiology 126 (3): 10851091
Robson, F., Costa, M.M., Hepworth, S.R., Vizir, I., Pineiro,
M., Reeves, P.H., Putterill, J. and Coupland, G. 2001.
Functional importance of conserved domains in the
flowering-time gene CONSTANS demonstrated by
analysis of mutant alleles and transgenic plants. Plant
Journal 28 (6): 619-631
Searle, I. and Coupland, G. 2004. Induction of flowering
by seasonal changes in photoperiod. EMBO Journal 23
(6): 1217-1222
Shavorskaya, O. and Lagercrantz, U. 2006. Sequence divergence at the putative flowering time locus COL1 in
Brassicaceae. Molecular Phylogenetics and Evolution 39
130
AsPac J. Mol. Biol. Biotechnol. Vol. 19 (4), 2011
(3): 846-854
Simpson, G.G. 2003. Evolution of flowering in response to
day length: flipping the CONSTANS switch. Bioessays
25 (9): 829-832
Suarez-Lopez, P., Wheatley, K., Robson, F., Onouchi, H.,
Valverde, F. and Coupland, G. 2001. CONSTANS
mediates between the circadian clock and the control
of flowering in Arabidopsis. Nature 410 (6832): 11161120
Valverde, F., Mouradov, A., Soppe, W., Ravenscroft, D., Samach, A. and Coupland, G. 2004. Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 303 (5660): 1003-1006
Weigel, D. and Glazebrook, J. 2002. Arabidopsis; a laboratory manual.
Flowering time mutants in Arabidopsis

Similar documents