Get PDF - Wiley Online Library

JOURNAL OF NEUROCHEMISTRY
| 2008 | 107 | 253–264
doi: 10.1111/j.1471-4159.2008.05601.x
, ,
*CHUL Research Centre and Department of Anatomy and Physiology, Laval University, Québec City, Québec, Canada
Ludwig Institute for Cancer Research, University of California San Diego, La Jolla, CA, USA
àInserm, U901, INMED, Marseille, France
§Aix Marseille Université, Faculté des Sciences, Marseille, France
Abstract
Mutations in the gigaxonin gene are responsible for giant
axonal neuropathy (GAN), a progressive neurodegenerative
disorder associated with abnormal accumulations of Intermediate Filaments (IFs). Gigaxonin is the substrate-specific
adaptor for a new Cul3-E3-ubiquitin ligase family that
promotes the proteasome dependent degradation of its partners MAP1B, MAP8 and tubulin cofactor B. Here, we report
the generation of a mouse model with targeted deletion of Gan
exon 1 (GanDexon1;Dexon1). Analyses of the GanDexon1;Dexon1
mice revealed increased levels of various IFs proteins in the
nervous system and the presence of IFs inclusion bodies in
the brain. Despite deficiency of full length gigaxonin, the
GanDexon1;Dexon1 mice do not develop overt neurological phenotypes and giant axons reminiscent of the human GAN disease. Nonetheless, at 6 months of age the GanDexon1;Dexon1
mice exhibit a modest hind limb muscle atrophy, a 10%
decrease of muscle innervation and a 27% axonal loss in the
L5 ventral roots. This new mouse model should provide a
useful tool to test potential therapeutic approaches for GAN
disease.
Keywords: inclusion bodies, intermediate filaments, neuropathy.
J. Neurochem. (2008) 107, 253–264.
Intermediate filaments (IFs), along with microtubules (MTs)
and actin microfilaments, are the basic components of the
cytoskeletal network (Chang and Goldman 2004). The major
function of IFs is to maintain structural integrity of the cell in
response to mechanical and non-mechanical stress (Fuchs
and Cleveland 1998). The three neurofilaments (NF-L, NF-M
and NF-H), a-internexin and peripherin are the components
of the neuronal IFs network. In neurons, IFs are thought to be
involved in development, response to an injury, determination of axonal caliber and conduction velocities (Xiao et al.
2006). The abnormal accumulation of IFs is a pathological
hallmark of many neurodegenerative disorders such as
amyotrophic lateral sclerosis, Charcot Marie Tooth, Parkinson Disease and Giant Axonal Neuropathy (GAN) (Lariviere
and Julien 2004). Neurofilament accumulations may be
caused by neurofilament gene mutations (Tomkins et al.
1998; Georgiou et al. 2002; Kruger et al. 2003), by kinesin
mutations (Xia et al. 2003) or by a disorganization of other
cytoskeletal components.
Giant Axonal Neuropathy (GAN, OMIM #256850) is a
neurodegenerative autosomal recessive disorder that affects
both the central and peripheral nervous system (Asbury et al.
1972; Berg et al. 1972). GAN patients first develop deficits
in the sensori- and motor-tracts which progress with
areflexia, loss of deep/superficial sensitivity and loss of
ambulation. The disorder evolves rapidly with a deterioration
of the central nervous system functions and leads to death
within 10–30 years (Asbury et al. 1972; Berg et al. 1972).
Received July 7, 2008; accepted July 23, 2008.
Address correspondence and reprint requests to Jean-Pierre Julien,
CHUL Research Centre, 2705, Laurier Boulevard, Sainte-Foy, Pavillon
T2-41, Québec City, Quebec, Canada G1V 4G2.
E-mail: [email protected]
Abbreviations used: BSA, bovine serum albumin; DR, dorsal roots;
ES, embryonic stem; GAN, giant axonal neuropathy; IF, intermediate
filament; MTs, microtubules; NF, neurofilament; NFID, neuronal filament inclusion disease; PBS, phosphate-buffered saline; PFA, paraformaldehyde; PMSF, phenylmethylsulfonyl fluoride; VR, ventral roots.
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
253
254 | F. Dequen et al.
GAN is characterized by the presence of giant axons and
systematic accumulation of IFs in a variety of cell types
(Donaghy et al. 1988; Mohri et al. 1998; Bomont and
Koenig 2003).
Since the discovery of the GAN gene (Bomont et al. 2000)
more than 40 mutations have been found in GAN patients,
including deletion, insertion, missense and nonsense mutations (Bomont et al. 2000, 2003; Kuhlenbaumer et al. 2002;
Bruno et al. 2004; Demir et al. 2005; Houlden et al. 2007;
Koop et al. 2007; Leung et al. 2007). These mutations are
localised throughout the GAN gene and are thought to lead to
loss of function of the encoded protein called gigaxonin.
With a N-terminal BTB domain and a C-terminal Kelch
domain (Bomont et al. 2000), gigaxonin has been shown to
be the substrate-adaptor of a Cul3-E3-ubiquitin ligase
complex (Furukawa et al. 2003; Pintard et al. 2003; Xu
et al. 2003). By interacting with the E3 ligase complex
through its BTB domain, GAN promotes the proteasome
dependent degradation of microtubules associated proteins
including MAP1B, MAP8 and tubulin chaperone tubulin
cofactor B, by interaction with its Kelch domain (Allen et al.
2005; Wang et al. 2005; Ding et al. 2006). It is intriguing
that GAN controls degradation of MAP1B which acts as
stabilizer of MTs (Ding et al. 2002) and of tubulin cofactor B
which is involved in MTs depolymerization (Wang et al.
2005).
Ding et al. reported a mouse model deficient for gigaxonin
due to disruption of GAN exons 3 to 5 (GanDexon3)5). The
GanDexon3)5 mice exhibited progressive decline of motor
function with onset between 6 and 10 months and with
occasional spasticity. However, the GanDexon3)5 mice were
maintained in a very heterogenous genetic background and
some of them did not develop overt neurological defects
(Yang et al. 2007).
Here, we report a new mouse model with targeted
disruption of the GAN gene based on deletion of exon 1
(GanDexon1;Dexon1). Despite a lack of the full length 68 kDa
Gan protein, the GanDexon1;Dexon1 mice do not develop the
severe neurological phenotypes anticipated from the human
GAN disease. Yet, these GanDexon1;Dexon1 mice do exhibit
pathological changes including accumulations of IF proteins
in the nervous system, loss of peripheral axons, muscle
atrophy and denervation.
Target sequence
Genotyping
neo cassette
exon 1 WT
RT-PCR
exon 1–2
exon 2–7
Materials and methods
Knockout mice
A 10.4 kb fragment of the GAN gene, including exon 1 and part of
the upstream promoter, were subcloned into a pQZ1 cloning vector.
The 0.9 kb AcsI-XmaI fragment containing exon 1 and part of the 3¢
promoter was replaced with a Neo cassette. The vector was then
digested by NotI and PmaCI. The targeting fragment was isolated
and electroporated into embryonic stem (ES) cells. Positive clones
were picked up and amplified. The homologous recombination event
was detected by Southern blot using an external 5¢-EcoRV probe.
The use of animals and all surgical procedures described in this
article were carried out according to The Guide to the Care and Use
of Experimental Animals of the Canadian Council on Animal Care.
Southern blots and PCR
DNA was extracted from mouse tails with phenol-chloroform
procedure. A PCR-amplified fragment of the Gan promoter was
used as a 500 bp probe. Genomic DNA digested with EcoRV and
analyzed according to Southern blotting methods (CouillardDespres et al. 1998). The probe detected a 10-kb wild-type band
and a 5-kb band for the knockout mice. For PCR genotyping, wild
type primers chosen inside the deleted region amplified a sequence
of 190 bp. Standard Neo primers were used for genotyping of the
knockout allele and yielded to an amplification product of 280 bp.
The sequences of primers are shown in Table 1.
RT-PCR
Total RNA from brain and spinal cord was extracted with trizol
reagent according to the manufacturing instructions (Invitrogen,
Burlington, ON, Canada). RNA concentration was determined at
260 nm and aliquots of 5 lg were stored at )80C. Pairs of
primers were chosen to target Gan cDNA and are described in
Table 1. RT-PCR was performed in one step with Superscript-Taq
RT-PCR one step kit (Invitrogen) according to the manufacturer’s
protocol. RT-PCR products were separated by electrophoresis on
agarose gel.
Western blot/dot blot
After dissection, tissues were homogenized in a SUB denaturing
buffer (0.5% sodium dodecyl sulfate/8 M urea in 7.4 phosphate
buffer) with a pool of protease inhibitors [phenylmethylsulfonyl
fluoride (PMSF), protease inhibitor cocktail (Sigma, Saint-Louis,
MI, USA)]. Homogenates were centrifuged at 15 000 g for 20 min
at 20C. The protein concentration of the supernatant was determined by the method of Bradford. Equal amount of proteins were
Foward primer (5¢-3¢)
Reverse primer (5¢-3¢)
CTTGGGTGGAGAGGCTATTC
GTGTCCGACCCTCAGCAC
AGGTGAGATGACAGGAGATC
GCCAGGATGTTCTTCTGCAC
GTGTCCGACCCTCAGCAC
CATCTTCAGTGGGCAGATCA
GTGGATCCGTCATCTTTTGG
CAAAGTTGTGTCTTGCCTCATGC
Table 1 List of the primers used for genotyping and RT-PCR
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
Mouse model with deletion of gigaxonin exon 1
loaded on sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. Membrane was
blocked in PBSMT (PBS1X; tween 0.1%; dry milk 5%) and then
incubated with a dilution of different primary antibodies in PBSMT
overnight at 4C. The different antibodies were gigA/gigB (gigaxonin; Bomont et al., manuscript in preparation), N52 (NF-H),
NN18 (NF-M), NR4 (NF-L), Tau1, a-internexin, Vimentin, glial
fibrillary acidic protein, a-tubulin, b-tubulin, c-tubulin and actin
(Chemicon, Temecula, CA, USA), except for tubulins (Sigma), and
NFL (Novocastra, Newcastle Upon Tyne, UK). Incubation with the
secondary antibody diluted 1 : 5000 (Jackson Immunoresearch,
West Grove, PA, USA) was done at 20C for 30 min. Detection was
done by chemiluminescence (Perkin and Elmer, Waltham, MA,
USA). For dot blot analyses, 10 lg of total protein extract were
loaded directly on to a nitrocellulose membrane (n = 3). Western
blotting was performed as previously described. The optical density
from each resulting spots was measured with the Agfa Arcus II
system and the Image J software. The data were analyzed with a
Mann–Whitney test for statistical significance (n = 3).
| 255
Tissue collection
Mice were perfused with NaCl 0.9% and fixed with 4% paraformaldehyde (PFA) pH 7.4. Selected tissues were dissected, post-fixed
in PFA 4% pH7.4 and then placed in phosphate-buffered saline
(PBS)-sucrose 30%. Brains and spinal cords were cut on microtome
in 25 l sections. Muscles were cut in 10 and 40 l sections and
dorsal root ganglia in 4 l sections with cryostat. Samples were
stored at )20C until use.
Immunohistochemistry
Samples were washed in PBS and treated with 0.6% H2O2 to
attenuate the endogenous peroxidase. Samples were then preincubated in blocking solution (PBS containing 0.25% Triton
X-100, 5% goat serum) and then incubated overnight at RT with the
appropriate dilution of primary antibody in blocking serum [N52
(NF-H), NN18 (NF-M), NR4 (NF-L), a-internexin, peripherin
(Chemicon except Sigma for NR4 and Covance, Berkeley, CA, USA
for Smi31 and Smi32)]. The slices were then washed and incubated
for 90 min at 20C in corresponding secondary biotinylated Ab
Fig. 1 Targeted disruption of the GAN
gene. (a) Schematic representation of the
mouse GAN gene. The targeting vector was
generated by replacing a 1 kb AscI/XmaI
fragment including the first exon by a nlsLacZ/Neo cassette. (b,c) PCR genotyping
and Southern blot of EcoRV-digested tail
DNA probed with a fragment flanking the 5¢
region of the targeting vector. (d) RT-PCR
analyses of total RNA from liver, brain and
spinal cord show that a Gan mRNA species
is still present in the spinal cord but not in
the brain of GanDex1;Dex1 (arrow). (e) Schematic representation of the region chosen to
generate the N-ter GAN antibody used for
the following western blot. (f) Western blots
of total protein extracts from brain and
spinal cord of GanDex1;Dex1 mice and of
GanDex3)5;Dex3)5 mice confirm the absence
of the 68 kDa Gan protein in these knockout mice.
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
256 | F. Dequen et al.
solution 1/1500 in blocking solution (1 : 500; Jackson ImmunoResearch). After washing, the sections were incubated in ABC
complex 1 h at 20C (Vectastain ABC Kit; Vector Laboratories,
Burlingame, CA, USA). Staining was developed by incubating the
samples in 0.5 mg/mL diamino benzidine + 0.003% H2O2 in potassium PBS (substrate kit Vector SG, Vector Laboratories). Tissue
samples were counterstained with hematoxylin (Sigma), dehydrated
in graded concentration of EtOH and xylene, and coverslipped
with DPX (a mixture of distyrene, tricresyl phosphate, and xylene;
Electron Microscopy Sciences, Fort Washington, PA, USA).
Immunofluorescence
As previously described for immunohistochemistry until incubation
with primary Ab (NF-H poly; a-internexin, Chemicon), the tissues
sections were washed in KPBS and then incubated for 90 min in
secondary Ab (Alexa fluor, Invitrogen) diluted 1 : 500 in potassium PBS containing 0.4% Triton X-100 and 1% bovine serum
albumin (BSA). The sections were mounted on superfrost slides
(Fisher, Ottawa, ON, Canada) and finally coverslipped with
fluoromount. For monitoring the neuromuscular junctions, 40 lm
muscle sections were treated incubated 1 h in 0.1 M glycine in
PBS for 2 h at RT and then stained with Alexa Fluor 594conjugated a-bungarotoxin (1 : 2000, Molecular Probes/Invitrogen
detection technologies, Carlsbad, CA, USA) diluted in 3% BSA in
PBS for 3 h at RT. After washing in PBS, the muscles were
blocked in 3% BSA, 10% goat serum and 0.5% Triton X-100 in
PBS overnight at 4C. The next day, muscles were incubated with
mouse anti-neurofilament antibody 160 K (1 : 2000, Temecula,
CA, USA) and mouse synaptic vesicle antibody SV2 (1 : 30,
Developmental Studies Hybridoma Bank, University of Iowa, Iowa
City, IA, USA) in the same blocking solution overnight at 4C.
Fig. 2 Increased levels of IFs in specific regions of the nervous system. (a) Western blots for IF and tubulin proteins reveal variations for
NF-H, NF-M, NF-L, a-internexin, peripherin, vimentin and GFAP. (b)
Western blot of sciatic nerve sections showed that NF proteins are
After washing for 5 h with 1% Triton X-100 in PBS, muscles were
incubated with goat anti-mouse Alexa Fluor 488-conjugated
secondary antibody (Probes/Invitrogen detection technologies,
Carlsbad, CA, USA) diluted 1 : 500 in blocking buffer for 3 h
at RT. Muscles sections were washed in PBS and finally
coverslipped with fluoromount. Total and partial colocalization of
a-bungarotoxin with SV2/NF-M markers characterizes the muscular innervation state whereas a-bungarotoxin staining alone stands
for denervation. 300 neuromuscular junctions were counted per
animal samples discriminating both innerved and denerved
junctions as described above. Innervation and denervation were
then turned into percentage for statistical analyses (n = 4, Mann–
Whitney test).
Axon and neuronal cell count
Dorsal root ganglions from 6 months old mice were dissected after
perfusion with PFA and then post-fixed in glutaraldehyde 3%
(n = 3). Tissue samples were washed three times in 0.1 M NaHPO4
pH 7.4 and then treated with osmium tetroxyde 2% in NaHPO4
0.1 M for 2 h at 20C. The samples were then dehydrated in
increased concentration of EtOH and in Acetone. The final
dehydratation was performed 1 h RT with 50% epoxy resin in
acetone. Ventral (VR) and dorsal roots (DR) were properly separated
and embedded in epoxy resin at least 2 h RT before cooking
overnight at 60C. Resulting blocks were cut in 1 l semi-thin
section and stained with toluidine blue. Axon calibers were
evaluated with stereomicroscopy (Neurolucida Tablet).
Spinal cord sections were Nissl stained with thionin (n = 5).
Motor neurons were identified on the basis of their correct location
(spinal cord ventral horn; laminae 9) and required a distinct
nucleolus to be counted.
more abundant in proximal than in distal sections in GanDex1;Dex1 mice
unlike normal mice. (c) No variation in neurofilament mRNA levels was
detected by RT-PCR.
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
Mouse model with deletion of gigaxonin exon 1
Grip strength test
Hind limb grip strength testing was done by using a Chatillon DFIS2 digital force gauge (model DFIS 2, Ametek, Paoli, PA, USA).
Briefly, mice were allowed to grip wire mesh of the apparatus by
their hind limbs. The animal was moved away from the bar slowly
and apparatus measured if the animal exerted active force against the
movement. Readings were taken in T-peak and measured in grams
of force. Each animal was given three trials per examining period
(Kerr et al. 2003).
Results
Generation of gigaxonin-deficient mice
The Gan gene (46 kb) is composed of 11 exons separated
by 10 introns in mice (Bomont et al. 2000; Gene ID:
209239, NCBI). Exons 1 and 2 are separated by over 20 kb.
Our strategy to disrupt expression of Gan was to remove a
1 kb sequence containing part of the promoter with the
Fig. 3 Dot blot analysis of IF content in the CNS. The levels of NF-H,
NF-M, NF-L, a-internexin and vimentin were quantified by dot blot in
extracts from the brain, cerebellum and spinal cord of GanDex1;Dex1
| 257
translation initiation site in the first exon. A targeting vector
was generated to replace exon 1 and part of the promoter by a
neo cassette (Fig. 1a). The vector was digested with restriction enzymes to yield a 1.5 kb targeting fragment that was
then electroporated in ES cells. Neomycin-resistant colonies
were picked up for Southern blot analysis. ES cell clones
positive for homologous recombination were then microinjected into mouse blastocysts to generate chimeric founder
mice. Male chimeras were then mated with C57BL/6 females
to generate mice heterozygous for Gan exon 1 deletion.
Genotyping of DNA extracted from mouse tails was
determined either by Southern blot analysis using a 500-bp
5¢-EcoRV probe (Fig. 1c) or by PCR using primers
flanking exon 1 (Fig. 1b). Mendelian transmission of the
disrupted Gan gene was obtained by the breeding of
heterozygous F1 mice. Mice homozygous for exon 1 deletion
(GanDexon1;Dexon1) did not exhibit overt neurological phenotypes. The GanDexon1;Dexon1 mice were viable and reproduced
mice and of wild-type littermate at 3, 6, 12 and 24 months of age
(n = 3; t test; **p < 0.001 and *p < 0.01).
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
258 | F. Dequen et al.
normally. Their lifespan did not differ significantly from that
of normal mice (data not shown).
mRNA and protein analyses
RT-PCR analyses were performed with primers to amplify
the region between exons 1 and 2 as well as the region
between exons 2 and 7. Using RT-PCR primers for exons 1
to 2, no band was detected in CNS RNA samples from
GanDex1;Dex1 mice, as expected (Fig. 1d). When RT-PCR was
performed with primers for exons 2 and 7, no Gan mRNA
was detected in the brain of GanDex1;Dex1 mice. However, a
small amount of Gan mRNA was detected in the spinal cord
of GanDex1;Dex1 mice (Fig. 1d, arrow). To further determine
whether Gan protein species were detectable in CNS samples
(a)
(i)
(ii)
(iii)
(iv)
(b)
(i)
(ii)
(iii)
(iv)
(c)
(i)
(ii)
(iii)
(iv)
(d)
(i)
(ii)
(iii)
(iv)
(e)
(i)
(ii)
(iii)
(iv)
(f)
(i)
(ii)
(iii)
(iv)
(g)
(i)
(ii)
(iii)
(iv)
(h)
(i)
(ii)
(iii)
(iv)
Fig. 4 Accumulations of IFs in cerebral cortex and thalamus of
GanDex1;Dex1 mice. All brain sections were stained for the different
neuronal IFs: NF-L (a–b), NF-M (c–d), NF-H (e–f), a-internexin (g–h)
and different regions were analyzed such as cortex (line 1), hippo-
campus (line 2), thalamus (line 3) and cerebellum (line 4). Accumulated protein were detected after immunohistochemistry with
antibodies for NF-H (f) and a-internexin (h) mainly in the cortex [f and
h(i)] but also in the thalamus [f and h(iii)].
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
Mouse model with deletion of gigaxonin exon 1
of GanDex1;Dex1 mice, we carried out immunoblotting experiments using a monoclonal antibody raised against the
N-terminal domain of gigaxonin (Fig. 1e). The immunoblots
in Fig. 1(f) confirmed the absence of the full length 68 kDa
Gan protein in brain and spinal cord samples from
GanDex1;Dex1 mice. We noticed the immunodetection of a
47.5 kDa band in spinal cord samples from GanDex1;Dex1
mice. We have considered the possibility that this band could
have been derived from in frame translation of mRNA
initiated downstream of exon 1. So, immunoblotting was also
carried out with spinal cord samples from the Gan knockout
mice bearing targeted deletion of exon 3 to exon 5 (kindly
provided by Dr. Y. Yang). As shown on the right panel of
immunoblots of Fig. 1(f), the 47.5 kDa band was also
detected in the GanDex3)5;Dex3)5 mice. We conclude that this
band is not derived from the Gan gene. It could be due to
cross-reactivity of the antibody with a protein harbouring a
BTB domain.
(Asbury et al. 1972; Berg et al. 1972; Ouvrier et al. 1974;
Bomont and Koenig 2003). We therefore examined whether
the absence of exon 1 in GanDex1;Dex1 mice resulted in
abnormal levels of IFs and of other cytoskeletal components.
Western blot analyses of total protein extracts at 3 months of
age from the brain, cerebellum and spinal cord revealed
modest increases in protein levels of IF proteins including
NF-L, NF-M, NF-H and a-internexin (Fig. 2a). A two-fold
increase in peripherin and vimentin levels were also observed
in the spinal cord of GanDex1;Dex1 mice when compared to
normal littermates. The analysis of sciatic nerve sections
revealed enhanced NF protein levels along the nerve. The
three subunits seem to be more abundant in the proximal
nerve region (Fig. 2b). The increased levels of neuronal IF
proteins in GanDex1;Dex1 was not due to increased mRNA
expression since RT-PCR analysis for NF-L, NF-M and
NF-H showed no differences of transcript levels in the brain,
cerebellum or spinal cord of GanDex1;Dex1 mice and littermate
controls (Fig. 2c).
To determine whether IF protein levels varied with age,
dot blot immunodetection analyses were performed for NF
subunits, a-internexin and vimentin at 3, 6, 12 and
Changes in IF protein levels in the nervous system
It is well established that gigaxonin-deprived tissues from
GAN patients present characteristic accumulations of IFs
(a)
(b)
(c)
(d)
(e)
(g)
(h)
(i)
(j)
(i)
(i)
(i)
(i)
(i)
(i)
(i)
(i)
(i)
(i)
(ii)
(ii)
(ii)
(ii)
(ii)
(ii)
(ii)
(ii)
(ii)
(ii)
(iii)
(iii)
(iii)
(iii)
(iii)
(iii)
(iii)
(iii)
(iii)
(iii)
(iv)
(iv)
(iv)
(iv)
(iv)
(iv)
(iv)
(iv)
(iv)
(iv)
(v)
(v)
(v)
(v)
(v)
(v)
(v)
(v)
(v)
(v)
(vi)
(vi)
(vi)
(vi)
(vi)
(vi)
(vi)
(vi)
(vi)
(vi)
(k)
(l)
(m)
(n)
(o)
(p)
(q)
Fig. 5 Immunohistochemical analyses of IFs in GanDex1;Dex1 spinal
cord and DRG sections. Spinal cord sections from GanDex1;Dex1 mice
and wild-type littermates were immuno-stained for the different neuronal IFs: NF-L (a–b), NF-M (c–d), NF-H (e–f), a-internexin (g–h) and
peripherin (i–j) as well as DRG (k–t). The immunostaining showed no
difference between GanDex1;Dex1 corticospinal tracks compared to
control in cervical (line 1), thoracic (line 2) and lumbar segments (line
| 259
(f)
(r)
(s)
(t)
3). The cervical (line 4), thoracic (line 5) and lumbar segments (line 6)
of GanDex1;Dex1 spinal cord showed a more intense staining for nerve
fibres (arrows) with occasional accumulations (arrow heads) using
antibodies against NF-L (b,iv–vi), NF-H (f,iv–vi) and a-internexin (h,iv–
vi). Some abnormal accumulations were also detected in GanDex1;Dex1
DRGs with antibodies for NF-L (l) and peripherin (t).
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
260 | F. Dequen et al.
24 months of age in GanDex1;Dex1 brain, cerebellum and
spinal cord samples compared to wild type littermates
(Fig. 3). The results confirmed a dysregulation of all IF
protein levels as early as 3 months of age that was still
present at 24 months of age. In particular, the NF-H and NFL levels were increased up to two folds at all ages in the
brain, cerebellum and spinal cord samples of GanDex1;Dex1mice. The NF-M levels remained unchanged at 6 and
12 months of age in cerebellum and spinal cord samples of
GanDex1;Dex1 mice and were increased in brain at all ages. The
alteration of NF-M levels was less dramatic than for NF-L
and NF-H. The a-internexin levels were increased by up to
3.8-fold in the cerebellum of GanDex1;Dex1 mice at 3 months
of age as compared to controls. The vimentin levels were
significantly increased at 3 months of age in brain and at all
ages tested in cerebellum. The most notable augmentation
appeared at 3 months in the spinal cord. At 6 months of age
the vimentin levels became normal again and then increased
by 20% and 35% at 12 and 24 months of age, respectively.
We examined if the variations in IF levels led to changes in
the CNS by immunohistochemistry. So, we tested antibodies
against each neuronal IF in various sections from the brain
(Fig. 4), spinal cord and DRG (Fig. 5). In the brain, the
immunostaining for NF-L was stronger in the cortex
[Fig. 4a(i)–b(i)] but no changes were detected in hippocampus, thalamus and cerebellum of GanDex1;Dex1 mice compared
to wild-type littermates. NF-M immunostaining did not vary
through all brain sections (Fig. 4c and d).The most notable
changes came from the immunodetection of NF-H and
a-internexin in cerebral cortex and thalamus. In samples
from GanDex1;Dex1 mice, these two IF proteins formed
accumulations reminiscent of intracellular IF inclusion
bodies (Fig. 4E–G, i–iii). Immunohistochemistry was also
carried out for sections of the spinal cord, cervical, thoracic
and lumbar. The different sections immunostained for each
neuronal IF showed no changes of corticospinal tracks
(Fig. 5A–J, i–iii). In the ventral horn, the intensity of NF-L
immunostaining was stronger in fibres around motor neurons
in each section from GanDex1;Dex1 spinal cord as compared to
wild type littermates (Fig. 5a, iv–vi and b, iv–vi). A similar
phenomenon was observed after immunodetection for NF-H
(Fig. 5e, iv–vi and f, iv–vi). Staining using antibodies against
NF-M, a-internexin and peripherin revealed no differences
between GanDex1;Dex1 spinal cord sections compared to wild
type littermates controls (Fig. 5c–d, g–j). In dorsal root
ganglia (Fig. 5k–t), NF-L and peripherin formed abnormal
accumulations in cell bodies (Fig. 5k–l and u–t) but not
NF-M, NF-H and a-internexin (Fig. 5m–r). Over all, our
histological results are consistent with the previous dot blot
analyses.
The histological analyses of the CNS for IFs revealed
inclusions bodies of NF-H and a-internexin mainly in the
cerebral cortex and but also in the thalamus. Immunohistochemistry using Smi 31 and 32 antibodies for detection
of hyperphosphorylated and hypophosphorylated NF-H
revealed that the inclusions were composed only of
non-phosphorylated NF-H (Fig. 6a and b). Double immunofluorescence revealed that the NF-H and a-internexin
Fig. 6 Hypophosphorylated NF-H and a-internexin form inclusions in
brain neurons. Immunohistochemistry performed on GanDex1;Dex1 brain
sections showed that hypophosphorylated NF-H detected with SMI32
antibody (b) rather than hyperphosphorylated NF-H detected with
SMI31 antibody (a) compose the accumulations. Double immunofluorescence revealed the NF-H and a-internexin proteins do not always
colocalize. In fact, the two proteins are predominantly detected in
distinct IF inclusions in GanDex1;Dex1 cerebral cortex sections (wt;wt
(c) vs. Dex1;Dex1 for d). The arrow heads in (d) point to colocalization
whereas the arrows point to distinct inclusions. Double immunofluorescence with NeuN (e) and NF-H (f) antibodies showed a localization
of NF-H in NeuN-positive cells (arrows g–h). Pictures were taken by
confocal microscopy and lateral reconstructions (g–h) showed that
both inclusions detected were neuron-specific and intracytoplasmic.
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
Mouse model with deletion of gigaxonin exon 1
accumulations in neuronal cells did not always colocalize
(Fig. 6d). Confocal microscopy for NF-H and NeuN confirmed the cytoplasmic localisation of the cortical inclusions
described earlier (Fig. 6e–j). Thus, elimination of Gan in
mice leads to formation of intracytoplasmic IF inclusions
bodies especially in cerebral cortex.
Muscular atrophy, muscle denervation and axonal
degeneration
Giant axonal neuropathy is a neurodegenerative disease
associated with motor deficit. The GanDex1;Dex1 mice did not
exhibit motor dysfunction during aging. Grip strength
analyses were performed during one year and no hind limb
weakness could be detected (Fig. 7a). Nevertheless, staining
of the hind limb muscle fibres showed a small muscular
atrophy (Fig. 7b–c). Indeed, quantification of the transversal
| 261
area of these muscular fibres revealed a 20% decrease in
caliber of muscular fibres from GanDex1;Dex1 mice compared
to controls at 6 and 12 months of age, but not at 3 months of
age (Fig. 7d). Moreover, we detected a 10% increase of
muscle denervation in GanDex1;Dex1 mice as compared to
control mice at 6 and 12 months of age (Fig. 7g).
We have analyzed the dorsal and ventral root axons. As
expected, western blots of both L4/L5 VR and DR revealed a
slight increase of NF content (Fig. 8a and d). To determine
the extent of axonal degeneration, the L5 VR and DR from
6 month-old mice were dissected and cut into 1 l semi thin
sections. The number and caliber of DR and VR axons were
then analyzed by stereomicroscopy. Neither the number of
sensory axons nor the axon caliber were altered in
GanDex1;Dex1 dorsal root compared to wild type (Fig. 8b
and c). However, the number of motor axons was signif-
Fig. 7 Muscular atrophy and denervation in
GanDex1;Dex1 mice. (a) Grip strength test
was carried out at 6 months old mice during
more than 1 year. No weakness of the hind
limbs was detected in GanDex1;Dex1 mice
when compared to heterozygous and wildtype littermate (group from 5–6 mice). Hind
limb muscle cross-sections from 6 monthsold GanDex1;Dex1 mice (c) and littermates (b).
Muscle fibres were significantly thinner at 6
and 12 months of age in GanDex1;Dex1 mice
compared to controls (d). Colocalization of
a-bungarotoxin and SV2/NF-M markers
indicates muscle innervation (e) whether
denervation is characterized by a-bungarotoxin staining alone (f). Based on those
observation, we were able to evaluate the
percentage of innervated and denervated
neuromuscular junctions in GanDex1;Dex1
muscles samples compared to wild type
littermates at 3, 6 and 12 months of age (g).
A significant loss of innervation has been
detected in GanDex1;Dex1 mice at 6 and
12 months of age (g). *p < 0.05; **p < 0.01.
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
262 | F. Dequen et al.
icantly diminished by 27% in GanDex1;Dex1 L5 ventral root
(Fig. 8e). A subset of axons from GanDex1;Dex1 exhibited
larger calibers than control mice but no giant axons were
detected (Fig. 8f).
As there was evidence of axonal degeneration in the L5
ventral root of GanDex1;Dex1 mice, we carried out a motor
neuron count in the lumbar spinal cord. Tissue sections
from normal and GanDex1;Dex1 mice at 1, 2, 3, 6, and
12 months of age were stained with thionin followed by
neuronal count. There was a tendency for decreased number
of motor neuron cell bodies at 6 months in GanDex1;Dex1 as
compared to normal mice but this was not significant
(Fig. 9a and b).
Fig. 8 The number of axons is lower than normal in L5 ventral root but
not in dorsal root of GanDex1;Dex1 mice. The levels of NF proteins in
both dorsal and ventral roots were examined by immunoblotting using
specific antibodies for NF-L, NF-M and NF-H. No alterations in NF
protein levels were detected in L5 dorsal root samples from
GanDex1;Dex1 mice when compared to controls (a). However, there was
an increased NF protein content in the L5 ventral root samples from
GanDex1;Dex1 mice as compared to control littermates (d). (b,e) shows
Discussion
Here we report the characterization of mice with targeted
disruption the Gan gene by insertion of a Neo cassette in
exon 1. This method succeeded in eliminating expression of
the full length form of gigaxonin (Fig. 1f). The GanDex1;Dex1
mice exhibited enhanced levels of several IF proteins, a
histological pathological feature in GAN patients (Figs 3 and
4). Increased levels of IF proteins in nervous tissue were
detected for NF proteins, a-internexin, peripherin as well as
vimentin. Microscopy of peripheral nerve revealed that
subsets of motor axons in GanDex1;Dex1 mice at 6 months of
age were slightly larger than normal and that there was a
the average number of axons of wt;wt, Dex1;wt and Dex1; Dex1 mice
in dorsal and ventral root, respectively. The number of axons was
decreased by 27% in GanDex1;Dex1 mice compared to WT littermates
(n = 3; Mann–Whitney test, *p < 0.05). (c,f) shows the average caliber
of the axons. Some ventral root axons are larger than normal in
GanDex1;Dex1 (n = 3; Mann–Whitney test,wt;wt vs. Dex1; Dex1
***p < 0.001; **p < 0.05). Scale bar 25 lm.
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
Mouse model with deletion of gigaxonin exon 1
Fig. 9 No significant reduction in the number of motor neurons in the
lumbar region of the spinal cord. (a) Motor neurons were stained
(Nissl) and counted at different ages. No change in number of motor
neurons was detected in GanDex1;Dex1 mice when compared to wildtype littermates (n = 5).
significant 27% loss of motor axons (Fig. 8). During aging,
the GanDex1;Dex1 mice also exhibited a 10% loss of hind limb
muscles innervation and a small but significant muscular
atrophy which is another pathological feature of the human
disease (Nafe et al. 2001). However, the GanDex1;Dex1 mice
failed to develop giant axons typical of the human GAN
disease. Muscular atrophy, muscle denervation and loss of
motor axons were not associated with reduced number of
spinal motor neurons and with overt motor dysfunction
(Fig. 9). Interestingly, histological analyses of brain sections
revealed abnormal accumulations of hypophosphorylated
NF-H and of a-internexin specifically in the cortex and
thalamus [Fig. 4e–h(i) and e–h(iii); Fig. 6]. These IF accumulations are highly reminiscent of a-internexin inclusions
found in human neuronal filament inclusion disease (NFID)
(Cairns et al. 2004; Josephs et al. 2005). Like in human
NFID, the inclusions in GanDex1;Dex1 mice are mainly
composed of a-internexin and they occur predominantly in
the cerebral cortex. These inclusions were positive for NF-H
and a-internexin but negative for other NF subunits, tau and
a-synuclein like protein accumulations found in Alzheimer’s
disease or Parkinson’s disease. No genetic mutations have
been linked to NFID so far (Momeni et al. 2006).
Giant axonal neuropathy is a progressive and fatal sensory
motor neuropathy that affects both the CNS and PNS
(Asbury et al. 1972; Berg et al. 1972; Ouvrier et al. 1974;
Igisu et al. 1975). Mutations in GAN gene cause a very
severe human disease. Due to the recessive mode of
inheritance of GAN mutations supporting a loss of function
| 263
of gigaxonin, we generated a mouse model deficient for
gigaxonin. Despite a disorganization of IF network, formation of neuronal filament inclusions in cerebral cortex and
peripheral nerve abnormalities, the GanDex1;Dex1 mice exhibited only mild phenotypes when compared to human
GAN disease. In contrast, Ding et al. (2006) reported
GanDex3)5;Dex3)5 mice with a progressive deterioration of
motor function. However, it is difficult to compare the two
Gan knockout mouse models. The report by Ding et al.
(2006) did not include a quantification of motor dysfunction
with standard behavioural tests and analyses of muscle fibers,
neuromuscular junctions and peripheral axons. Moreover the
onset and progression of the neurological phenotype were
not constant and varied greatly between the Gan Dex3)5;Dex3)5
mice. This was probably reflecting mouse genetic background heterogeneity (Yang et al. 2007).
Our analyses of GanDex1;Dex1 mice confirm the importance
of gigaxonin in modulating the levels and organization of IF
proteins. As neuronal IF proteins have very long half live
(Millecamps et al. 2007), IFs might be prone to form
abnormal accumulations as a result of microtubule-based
transport defects such as those caused by GAN gene
mutations. Of particular interest are the findings that the
GanDex1;Dex1 mice develop early onset formation of IF
inclusions in brain neurons. The occurrence of brain IF
inclusions bodies and of other pathological features including
muscle atrophy, muscle denervation and axonal loss suggest
that the GanDex1;Dex1 mice might provide a useful tool for
testing potential therapeutic approaches for GAN disease.
Acknowledgements
We thank Roxanne Larivière, Renée Paradis, Mélanie LalancetteHébert, Geneviève Soucy and Makoto Urushitani for their advices
and technical assistance. We thank Dr. Qinzhang Zhu for advices in
the design of the targeting vector. We thank Dr. Yanmin Yang for
providing the tissues from their mouse model. Jean-Pierre Julien
holds a Canada Research Chair in Neurodegeneration. Florence
Dequen is a recipient of a FRSQ Studentship. Pascale Bomont was
supported in part by a Fellowship from the Fondation pour la
Recherche Médicale (FRM) and by a grant from the Association
Française contre les Myopathies (AFM). Geneviève Gowing is
recipient of a CIHR Doctoral Research Award. This work was
supported by grants from the Canadian Institutes of Health and
Research to J.-P.J and from National Institutes of Health (USA) to
DWC.
References
Allen E., Ding J., Wang W., Pramanik S., Chou J., Yau V. and Yang Y.
(2005) Gigaxonin-controlled degradation of MAP1B light chain is
critical to neuronal survival. Nature 438, 224–228.
Asbury A. K., Gale M. K., Cox S. C., Baringer J. R. and Berg B. O.
(1972) Giant axonal neuropathy–a unique case with segmental neurofilamentous masses. Acta Neuropathol. (Berl) 20,
237–247.
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264
264 | F. Dequen et al.
Berg B. O., Rosenberg S. H. and Asbury A. K. (1972) Giant axonal
neuropathy. Pediatrics 49, 894–899.
Bomont P. and Koenig M. (2003) Intermediate filament aggregation in
fibroblasts of giant axonal neuropathy patients is aggravated in non
dividing cells and by microtubule destabilization. Hum. Mol.
Genet. 12, 813–822.
Bomont P., Cavalier L., Blondeau F. et al. (2000) The gene encoding
gigaxonin, a new member of the cytoskeletal BTB/kelch repeat
family, is mutated in giant axonal neuropathy. Nat. Genet. 26, 370–
374.
Bomont P., Ioos C., Yalcinkaya C. et al. (2003) Identification of seven
novel mutations in the GAN gene. Hum. Mutat. 21, 446.
Bruno C., Bertini E., Federico A. et al. (2004) Clinical and molecular
findings in patients with giant axonal neuropathy (GAN). Neurology 62, 13–16.
Cairns N. J., Zhukareva V., Uryu K. et al. (2004) Alpha-internexin is
present in the pathological inclusions of neuronal intermediate
filament inclusion disease. Am. J. Pathol. 164, 2153–2161.
Chang L. and Goldman R. D. (2004) Intermediate filaments mediate
cytoskeletal crosstalk. Nat. Rev. Mol. Cell Biol. 5, 601–613.
Couillard-Despres S., Zhu Q., Wong P. C., Price D. L., Cleveland D. W.
and Julien J. P. (1998) Protective effect of neurofilament heavy
gene overexpression in motor neuron disease induced by mutant
superoxide dismutase. Proc. Natl Acad. Sci. USA 95, 9626–9630.
Demir E., Bomont P., Erdem S. et al. (2005) Giant axonal neuropathy:
clinical and genetic study in six cases. J. Neurol. Neurosurg.
Psychiatry 76, 825–832.
Ding J., Liu J. J., Kowal A. S., Nardine T., Bhattacharya P., Lee A. and
Yang Y. (2002) Microtubule-associated protein 1B: a neuronal
binding partner for gigaxonin. J. Cell Biol. 158, 427–433.
Ding J., Allen E., Wang W. et al. (2006) Gene targeting of GAN in
mouse causes a toxic accumulation of microtubule-associated
protein 8 and impaired retrograde axonal transport. Hum. Mol.
Genet. 15, 1451–1463.
Donaghy M., King R. H., Thomas P. K. and Workman J. M. (1988)
Abnormalities of the axonal cytoskeleton in giant axonal neuropathy. J. Neurocytol. 17, 197–208.
Fuchs E. and Cleveland D. W. (1998) A structural scaffolding of intermediate filaments in health and disease. Science 279, 514–519.
Furukawa M., He Y. J., Borchers C. and Xiong Y. (2003) Targeting of
protein ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases.
Nat. Cell Biol. 5, 1001–1007.
Georgiou D. M., Zidar J., Korosec M., Middleton L. T., Kyriakides T.
and Christodoulou K. (2002) A novel NF-L mutation Pro22Ser is
associated with CMT2 in a large Slovenian family. Neurogenetics
4, 93–96.
Houlden H., Groves M., Miedzybrodzka Z., Roper H., Willis T., Winer
J., Cole G. and Reilly M. M. (2007) New mutations, genotype
phenotype studies and manifesting carriers in giant axonal neuropathy. J. Neurol. Neurosurg. Psychiatry 78, 1267–1270.
Igisu H., Ohta M., Tabira T., Hosokawa S. and Goto I. (1975) Giant
axonal neuropathy. A clinical entity affecting the central as well as
the peripheral nervous system. Neurology 25, 717–721.
Josephs K. A., Uchikado H., McComb R. D., Bashir R., Wszolek Z.,
Swanson J., Matsumoto J., Shaw G. and Dickson D. W. (2005)
Extending the clinicopathological spectrum of neurofilament
inclusion disease. Acta Neuropathol. 109, 427–432.
Kerr D. A., Llado J., Shamblott M. J., Maragakis N. J., Irani D. N.,
Crawford T. O., Krishnan C., Dike S., Gearhart J. D. and Rothstein
J. D. (2003) Human embryonic germ cell derivatives facilitate
motor recovery of rats with diffuse motor neuron injury. J. Neurosci. 23, 5131–5140.
Koop O., Schirmacher A., Nelis E. et al. (2007) Genotype-phenotype
analysis in patients with giant axonal neuropathy (GAN).
Neuromuscul. Disord. 17, 624–630.
Kruger R., Fischer C., Schulte T. et al. (2003) Mutation analysis of the
neurofilament M gene in Parkinson’s disease. Neurosci. Lett. 351,
125–129.
Kuhlenbaumer G., Young P., Oberwittler C., Hunermund G., Schirmacher A., Domschke K., Ringelstein B. and Stogbauer F. (2002)
Giant axonal neuropathy (GAN): case report and two novel
mutations in the gigaxonin gene. Neurology 58, 1273–1276.
Lariviere R. C. and Julien J. P. (2004) Functions of intermediate filaments
in neuronal development and disease. J. Neurobiol. 58, 131–148.
Leung C. L., Pang Y., Shu C., Goryunov D. and Liem R. K. (2007)
Alterations in lipid metabolism gene expression and abnormal lipid
accumulation in fibroblast explants from giant axonal neuropathy
patients. BMC Genet. 8, 6.
Millecamps S., Gowing G., Corti O., Mallet J. and Julien J. P. (2007)
Conditional NF-L transgene expression in mice for in vivo analysis
of turnover and transport rate of neurofilaments. J. Neurosci. 27,
4947–4956.
Mohri I., Taniike M., Yoshikawa H., Higashiyama M., Itami S. and
Okada S. (1998) A case of giant axonal neuropathy showing focal
aggregation and hypophosphorylation of intermediate filaments.
Brain Dev. 20, 594–597.
Momeni P., Cairns N. J., Perry R. H., Bigio E. H., Gearing M., Singleton
A. B. and Hardy J. (2006) Mutation analysis of patients with
neuronal intermediate filament inclusion disease (NIFID). Neurobiol. Aging 27, 778 e771–778 e776.
Nafe R., Trollmann R. and Schlote W. (2001) The giant axonal neuropathy–clinical and hisotological aspects, differential diagnosis
and a new case. Clin. Neuropathol. 20, 200–211.
Ouvrier R. A., Prineas J., Walsh J. C., Reye R. D. and McLeod J. G.
(1974) Giant axonal neuropathy–a third case. Proc. Aust. Assoc.
Neurol. 11, 137–144.
Pintard L., Willis J. H., Willems A. et al. (2003) The BTB protein MEL26 is a substrate-specific adaptor of the CUL-3 ubiquitin-ligase.
Nature 425, 311–316.
Tomkins J., Usher P., Slade J. Y., Ince P. G., Curtis A., Bushby K. and
Shaw P. J. (1998) Novel insertion in the KSP region of the neurofilament heavy gene in amyotrophic lateral sclerosis (ALS).
Neuroreport 9, 3967–3970.
Wang W., Ding J., Allen E., Zhu P., Zhang L., Vogel H. and Yang Y.
(2005) Gigaxonin interacts with tubulin folding cofactor B and
controls its degradation through the ubiquitin-proteasome pathway.
Curr. Biol. 15, 2050–2055.
Xia C. H., Roberts E. A., Her L. S., Liu X., Williams D. S., Cleveland
D. W. and Goldstein L. S. (2003) Abnormal neurofilament transport caused by targeted disruption of neuronal kinesin heavy chain
KIF5A. J. Cell Biol. 161, 55–66.
Xiao S., McLean J. and Robertson J. (2006) Neuronal intermediate
filaments and ALS: a new look at an old question. Biochim. Biophys. Acta 1762, 1001–1012.
Xu L., Wei Y., Reboul J., Vaglio P., Shin T. H., Vidal M., Elledge S. J.
and Harper J. W. (2003) BTB proteins are substrate-specific
adaptors in an SCF-like modular ubiquitin ligase containing
CUL-3. Nature 425, 316–321.
Yang Y., Allen E., Ding J. and Wang W. (2007) Giant axonal neuropathy.
Cell. Mol. Life Sci. 64, 601–609.
2008 The Authors
Journal Compilation 2008 International Society for Neurochemistry, J. Neurochem. (2008) 107, 253–264