View PDF 2.21 M

Acta Oceanol. Sin., 2016, Vol. 35, No. 4, P. 118–123
DOI: 10.1007/s13131-016-0841-x
http://www.hyxb.org.cn
E-mail: [email protected]
Morphological and molecular discrimination of green
macroalgae Chaetomorpha aerea and C. linum
HUANG Bingxin1, 2, 4, TENG Linhong2, 3, DING Lanping1, 2, 4*
1 Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Sciences, Tianjin Normal University, Tianjin
300387, China
2 Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
3 Graduate University of Chinese Academy of Sciences, Beijing 100049, China
4 Marine Biology Institute, Shantou University, Shantou 515063, China
Received 13 January 2015; accepted 7 August 2015
©The Chinese Society of Oceanography and Springer-Verlag Berlin Heidelberg 2016
Abstract
Green macroalgae Chaetomorpha aerea and C. linum are taxonomically confused. In this paper, we tried
morphological and molecular analyses to separate these two species. C. aerea and C. linum can be distinguished
from morphological characteritics, such as frond dimension, cells size and shape, their mean length/width ratios
(LWR), and cell walls constriction. Thalli of C. aerea attenuate basipetally, with diameter 270–500 μm at upper
portion, 160–360 μm at middle portion, 100–160 μm at basal portion. For the upper part, the length of cells is less
than their diameter. Cell walls usually constrict at the dissepiments, which are pellucid or colorless and give the
filament beaded appearance. In contrast, thalli of C. linum often have a constant diameter of 90–300 μm within
the same individual, cell walls usually do not constrict and cells are cylindrical or barrel shaped. The LWR is larger
than that of C. aerea. Results show that the pairwise distance between two species is 3.6%–3.7% for 18S rRNA gene
and 53.5%–54.3% for ITS region. In phylogeny, they distribute at distant clades, which confirms a genetic
divergence at molecular level. In addition, morphological data indicates that filament diameter of C. linum
samples is highly variable, ranging from 90 μm to 300 μm. Then these two species can be considered as separate
species.
Key words: Chaetomorpha aerea, Chaetomorpha linum, molecular identification, morphology comparison, 18S
rRNA, ITS
Citation: Huang Bingxin, Teng Linhong, Ding Lanping. 2016. Morphological and molecular discrimination of green macroalgae
Chaetomorpha aerea and C. linum. Acta Oceanologica Sinica, 35(4): 118–123, doi: 10.1007/s13131-016-0841-x
1 Introduction
The genus Chaetomorpha was established by Kützing (1845),
containing species of uniseriate unbranched filaments with multinucleated cells, and a single reticulate parietal chloroplast with
numerous pyrenoids. The genus has been in a state of taxonomic
confusion due mainly to simple morphological structure and lack
of descriptive knowledge regarding the morphological variability.
Chaetomorpha aerea (Dillwyn) Kützing (1849) and C. linum
(O. F. Müller) Kützing (1845) are two common green macroalgae
along China coast. Because of their simple structure, limited
characters used for species delimitation, the cytological, morphological and cultural methods had been employed to examine
the relationship between the two species (Christensen, 1957;
Kornmann, 1972; Patel, 1971; Price, 1967; Sinha, 1958). There are
different viewpoints about their taxonomic position and nomenclatorial problem. The possible conspecific relationship between
C. linum and C. aerea was first expressed by Rosenvinge (1893),
by stating the belief that C. linum was a detached state of C.
aerea. Collins (1909) formally designated C. linum as a form of C.
aerea (C. aerea f. linum). He later stated that C. linum had priority over C. aerea and classified the taxa C. linum f. linum and C.
linum f. aerea, respectively (Collins, 1918). Christensen (1957)
showed apparent transitional stages between attached (C. aerea)
and detached (C. linum) entities and followed Collins’ nomenclature (Collins, 1918). Lawson et John (1987) followed
Christensen in considering C. aerea and C. linum to be growth
forms of the same taxon, with the latter name having priority.
Burrows (1991) included C. aerea in C. linum, and then included
C. linum in C. mediterranea. Silva et al. (1996) stated that C.
ligustica was the correct name for a species complex that included C. mediterranea. John et al. (2003) cited C. aerea as a synonym of C. linum. John et al. (2004) cited C. gallica Kützing as a
synonym of C. linum. While there were also other researchers
holding that they were separate species. Patel’s cytological study
showed their different chromosomes numbers (Patel, 1971) and
Kornmann’s culture study reported the independent life histories (Kornmann, 1972).
Molecular data has an important role in identifying samples
that lack clear-cut species-specific morphological characters. For
green algae, sequences of the fast-evolving internal transcribed
spacers (ITS) had been contributed to biogeographical studies
(Bakker et al., 1992, 1995a, b). 18S rRNA gene was also employed
Foundation item: The National Key Technology R&D Program of China under contract No. 2012BAC07B05; the National Natural Science
Foundation of China under contract Nos 31400186, 31270257 and 31093440; the Science and Technology Plan Project of Guangdong Province
under contract No. 2012A020200007; the Science and Technology Plan Project of Shantou City, China under contract No. 2012–171 .
*Corresponding author, E-mail: [email protected]
HUANG Bingxin et al. Acta Oceanol. Sin., 2016, Vol. 35, No. 4, P. 118–123
to study the evolution of the Cladophora complex (Bakker et al.,
1994). In present study, we observed the morphological characters of the two species and compared the ITS region and 18S
rRNA gene sequences from four samples of the genus to determine whether the two most common Chaetomorpha species represent separate evolutionary entity, to evaluate their taxonomic
status, and to determine which, if any, morphological characters
can
be used for species identification.
2
Materials and methods
2.1 Materials collection
Four excursions were arranged to three locations (Yantai,
Rongcheng and Qingdao, China) along the coast of Shandong
Peninsula for collection of the samples at the intertidal zone as
indicated in Table 1. Herbaria were deposited at Marine Biological Museum, Chinese Academy of Sciences. Some fresh samples
were washed with sterile water and preserved at –20°C for DNA
extraction.
2.2 Morphology observation
The morphological characters including thallus color, height,
cells shape and size were observed or measured under light microscope (ZEISS Axioskop2) with more than ten individuals in order to increase the reliability of species identification. Micrographs
were taken with digital camera (ZEISS Axiocam MRc5).
2.3 DNA extraction, PCR amplification and sequencing
Total DNA was extracted from isolated four samples with 500
mg fresh weight using TianGen Plant Genomic DNA Kit. Primers
were designed according to the conserved region in 18S rDNA
and 28S rDNA based upon aligned GenBank sequences from
green algae. The optimum sequences of the Primers were chosen
after they were analyzed by the software Primer 5.0 and synthesized by Nanjing Genscript Corporation as the following sequences:
18S rDNA
ITS
F
R
F
R
5′AATGGCTCGGTAAATCAGTT3′
5′AGTTGATGACTCGCGCTTAC3′
5′GGAAGGAGAAGTCGTAACAAGG3′
5′ATTCCCAAACAACCCGACTC3′
The reaction mixture used for PCR contained 25 μL PCR Mix
Kit (Dongsheng Corp.), 5 μL DNA template, 0.5 μL Taq DNA
polymerase (5 U/μL), 0.5 μL of each primer (50 μm/L), and
ddH2O was added to a final volume of 50 μL. PCR was performed
in PCR instrument (TaKaRa). The cycle was 2 min initial denaturing at 94°C followed by 30 s at 94°C, 1 min at 55°C and 1 min at
72°C for 30 cycles, and a final extension at 72°C for 10 min. To estimate the size of the amplified fragment, the product was run on
a 1% agarose gel, stained with ethidium bromide solution, visualized under UV light, and photographed. The product was puri-
119
fied and sequenced by Shanghai Sunny Biotechnology Corp.
2.4 Sequence analysis
Obtained 18S rDNA and ITS sequences of four samples were
aligned and the pairwise distance was calculated using MEGA4
(Tamura et al., 2007) with Kimura’s 2-parameter model (Kimura,
1980). Sequences identity was calculated using Bioedit (Hall,
1999). The related sequences acquired by BLAST were downloaded from GenBank and the complete alignment was conducted using Clustal X (Thompson et al., 1997), maximum parsimony (MP) method was used to construct phylogenetic tree using PAUP4.0b10 (Swofford, 2002). Gaps were treated as data
missing. All sites were treated as unordered and equally
weighted. Heuristic search option with random addition of sequences (10 replicates) and tree-bisection-reconnection (TBR)
were used for tree searching. One thousand bootstrap replications were performed using heuristic searches. Anadyomenaceae species were used as outgroup.
3 Results
3.1 Morphological observation
Chaetomorpha aerea (Dillwyn) Kützing 1849: 379; Tseng and
Li 1935: 201; Tseng 1936: 17; Li 1964: 101, Fig. 11; Noda 1971:
1448.
Conferva aerea Dillwyn 1806: pl. 80.
Chaetomorpha linum sensu Tseng et al. 1983: 262, pl. 130, Fig.
2; Luan 1989: 113, Fig. 147.
Thallus of C. aerea is dark green, 5–10 cm in height, grows attached by a discoid holdfast. The filaments attenuate basipetally,
with diameter 270–500 μm at upper portion, 160–360 μm at
middle portion, 100–160 μm at basal portion. For the upper portion, the length of the joints is usually less than their diameter.
Cells of the upper portion are rounded at each end, which gives
the filament its beaded appearance. Cells of the middle portion
are cylindrical. Cell walls usually constrict at the dissepiments,
which are pellucid or colorless. The ratio of length/width (LWR)
ranges from 0.5–2.5 (Fig. 1).
Chaetomorpha linum (Müller) Kützing 1845: 204; Tseng 1938:
144; Chiang 1960: 62, Fig. 2A; Zhou and Chen 1983: 92; Yoshida
1998: 56; Womersley et Bailey 1970: 263; Womersley 1984: 176,
Figs 54D, 57A, pl. 13, Fig. 2; Silva et al. 1996: 765.
Conferva linum Müller in Oeder 1778:pl.771, Fig.2.
Plants are bright green or light green, free-floating or attached on rocky substrates by a discoid holdfast on basal cell.
Cells are cylindrical to barrel shaped with a diameter of 90–250
μm and a LWR of 0.6–3.4. The basal cell, when present, is 3 to 8
times longer than broad. Cross walls usually do not constrict, and
are not pellucid. Cells diameter is generally consistent within the
same individual (Fig. 2).
The characteristics comparison of the four specimens is listed in Table 2.
Table 1. Collection information of the four Chaetomorpha samples
Taxon
C. linum
C. linum
C. linum
C. aerea
Collection locality
Qingdao, Shandong
Rongcheng, Shandong
Yantai, Shandong
Qingdao, Shandong
Collector
Teng Linhong
Teng Linhong
Teng Linhong
Teng Linhong
Collection date
11 May 2010
21 Jul. 2010
18 Oct. 2010
15 Aug. 2010
Herbarium number
AST2010003
AST2010026
AST2010032
AST2010016
120
HUANG Bingxin et al. Acta Oceanol. Sin., 2016, Vol. 35, No. 4, P. 118–123
Fig. 1. Chaetomorpha aerea (Dillwyn) Kuetzing (AST2010016). a. Upper portion of frond, b. middle portion of frond, and c. lower
portion of frond.
Fig. 2. Chaetomorpha linum (Müller) Kuetzing. a. Middle portion of frond, b. basal portion of frond (AST2010003), c. middle portion of frond (AST2010026), and d. middle portion of frond (AST2010032).
Table 2. Morphological characteristics comparison of Chaetomorpha samples
AST2010016
dark green
5–10
upper part
270–500
middle part
160–360
basal part
100–160
Ratio of length/width
0.5–2.5
Cell shape
beaded orcylindrical
Cell walls
constricted
Growth status
epilithical
Frond color
Height/cm
Cell width/μm
AST2010003
light green
10–15
200–250
150–250
100–200
0.6–2.0
cylindrical orbarrel shaped
smooth, constrictedoccasionally
epilithical
3.2 Sequence analysis
18S rDNA and ITS sequences of the four samples have been
submitted to GenBank (JN540034–JN540041). We compared the
18S rDNA of samples and then aligned them with related sequences from the GenBank (Table 3). A total of 920 traits were included in the analysis, of which 64 were parsimony-informative.
The conserved 18S rDNA showed relatively low divergence. Pairwise distance between C. linum and C. aerea ranged from
3.6%–3.7%, obviously higher than that among the C. linum population (0.0%–0.1%). In addition, similarity of the two species
ranged from 95.7%–96.1%, lower than that of C. linum
(99.4%–99.8%) (Table 4). 18S rDNA comparison demonstrated
that the two confused species, C. linum and C. aerea, are genetically separate entities.
The complete ITS1-5.8S rDNA-ITS2 sequences were defined
in the homology with other sequences identified in a BLAST
search of the GenBank database (Table 5). The length of ITS1 was
AST2010026
bright green
10–15
170–200
150–200
110–150
1.1–3.4
cylindrical
smooth, notconstricted
eree-floating
AST2010032
light green
10–15
100–110
90–110
90–100
1.1–2.4
cylindrical orbarrel shaped
smooth, notconstricted
epilithical
406 bp for C. linum and 508 bp for C. aerea. The length of ITS2
was 272 bp for C. linum and 296 bp for C. aerea. The length of
5.8S rDNA was 157 bp for both species. The alignment indicates
that the sequences and length of 5.8S rDNA were quite conservative and that of ITS were highly divergent. Sequences divergence values in the ITS data set were higher than those observed
in the 18S rDNA dataset. They ranged from 0.5% among conspecifics to 54.3% between C. linum and C. aerea (Table 6). This variation level strongly suggests that C. linum and C. aerea are distinct species.
3.3 Phylogenetic tree analysis
Phylogenetic trees constructed with MP methods were shown
in Figs 3 and 4. In the phylogram of 18S rDNA, C. linum samples
formed sister group with other genera species, and then the large
clade clustered with C. aerea and C. moniligera group. For the
ITS tree, C. aerea clustered with two other species of Chaeto-
HUANG Bingxin et al. Acta Oceanol. Sin., 2016, Vol. 35, No. 4, P. 118–123
121
Table 3. 18S rDNA sequences of related species in GenBank and accession number
Taxon
Chaetomorpha antennina
Chaetomorpha crassa
Rhizoclonium sp.
Rhizoclonium hieroglyphicum
Rhizoclonium riparium
Cladophora rupestris
Cladophora albida
Cladophora glomerata
Rhizoclonium grande
Rhizoclonium hieroglyphicum
Rhizoclonium riparium
Cladophora sericea
Chaetomorpha moniligera
Chaetomorpha linum
Cladophora vagabunda
Microdictyon japonicum
Anadyomene stellata
Valoniopsis pachynema
Sampling area and country
Shizuoka, Shimoda, Japan
Ishikawa, Shika, Japan
USA
UK
Kanagawa, Japan
Roscoff, France
Hokkaido, Japan
LakeAkan, Hokkaido, Japan
Kagoshima, Oshima, Japan
Chiba, Yachimata, Japan
Tokyo, Japan
Roscoff, France
Hokkaido, Otaru, Japan
Kochi, Japan
Brazil
Shimoda, Japan
Colon, Panama
Queensland, Australia
Accession No.
AB062700
AB062701
AB259958
AB256042
AB202077
Z35319
Z35421
AB062706
AB062714
AB062715
AB202076
Z35320
AB062703
AB062702
FJ715643
AM498760
AF510147
AM498765
Table 4. Pairwise distance (below) and sequence identity value (above) of 18S rRNA gene
Sample
AST2010003
AST2010026
AST2010032
AST2010016
AST2010003
0.001
0.000
0.036
AST2010026
0.994
AST2010032
0.998
0.995
0.001
0.037
AST2010016
0.960
0.957
0.961
0.036
Table 5. ITS sequences of related species in GenBank and accession number
Taxon
Chaetomorpha sp.
Rhizoclonium sp.
Chaetomorpha norvegica
Cladophora sp.
Cladophora pygmaea
Cladophora rhodolithicola
Willeella mexicana
Sampling area and country
Philippines
USA
Norway
Pontevedra, Baliza de
Pembrokeshire, Milford
Pembrokeshire, Milford Haven, UK
Perlas Island, Panama
Accession No.
FR694876
AB259959
FR694877
FM205056
FM205054
FM205055
AM778978
Table 6. Pairwise distance (below) and sequence identity value (above) of ITS
Sample
AST2010003
AST2010026
AST2010032
AST2010016
AST2010003
0.025
0.027
0.535
AST2010026
0.957
0.005
0.541
morpha, then formed a clade with C. linum samples. As shown in
both the phylogenetic trees, C. aerea and C. linum represent separate evolutionary entities.
4 Discussion
As stated previously, the genus Chaetomorpha Kützing (1845)
have posed numerous taxonomic problems for phycologists. Although many authors proposed the conspecific possibility, previous studies on the life history and cytology of the two species
supported the recognition of the two as separate species (Kornmann, 1972; Patel, 1971; Sinha, 1958). Blair described the electrophoretic and morphological patterns and concluded that C. aerea
and C. linum are distinct species that exhibit only modest morphological and electrophoretic differences (Blair et al., 1982;
Blair, 1983). In this study, we provided strong evidence for the in-
AST2010032
0.956
0.994
AST2010016
0.564
0.563
0.562
0.543
terspecies divergence at molecular level. For the conserved 18S
rDNA, the interspecies similarity (95.7%–96.1%) is lower than
that of intraspecies (99.4%–99.8%). Moreover, the ITS similarity
of the two species is 56.2%–56.4%, much lower than that of intraspecies (95.6%–99.4%). The results reveal that genetic distance of the two species is markedly larger than intraspecies divergence and they should be separate entities. Moreover, it can
be drawn from the phylogenetic trees of 18S rDNA that C. linum
is more closely related to species belonging to Cladophora and
Rhizoclonium than to C. aerea. This result prompts us to doubt
whether present taxonomic status of the three genera Cladophora, Rhizoclonium and Chaetomorpha reflects their genetic relationships. Due to the limited Cladophorales sequence information in the GenBank, more comprehensive analysis needs to be
conducted in the future.
122
HUANG Bingxin et al. Acta Oceanol. Sin., 2016, Vol. 35, No. 4, P. 118–123
Fig. 3. MP tree based on 18S rRNA gene sequences (Tree length=172, CI=0.732 6, RI=0.849 7).
Fig. 4. MP tree based on ITS and 5.8S rRNA gene sequences (Tree length=1 717, CI=0.851 5, RI=0.849 6).
For seaweed classification, many traits such as thallus height,
color, cell size, cell wall thickness and stratification, pyrenoid
number, and attachment state are dependent on plant maturity
and environmental conditions (Mathieson et al., 1981); therefore,
it is essential to determine the stability of as many characters as
possible. Morphologically, the two species can be distinguished
from each other by the following characters.
4.1 Filament dimension
Generally, thalli of C. aerea have larger cell diameter than that
of C. linum. Additionally, for C. aerea, filament dimension within
one individual is variable and the diameter in upper portion is
larger than the lower portion. While for C. linum, the average diameter of the same plant is constant.
4.2 Cell shape
For the thalli of C. aerea, cells of the upper portion are roun-
ded at each end, which gives the filament its beaded appearance.
Cell walls usually constrict at the dissepiments, which make it
pellucid or colorless between cells. Yet cell walls of C. linum do
not constrict and cells are cylindrical or barrel shaped, without
obvious pellucid space.
Extensive phenotypic plasticity usually interferes with identification. The average cell dimensions of C. linum range from
150–300 μm. In present study, there are three populations,
among which sample AST2010032 exhibits obviously distinct cell
size. Its cell diameter is only 90–110 μm. We cannot identify it by
the slender habitat. Yet through molecular analysis, the ITS similarity between this sample and sample AST2010026 reach to
99.4%, with only five different characters. This data is obviously
higher than 56.2% between AST2010032 and AST2010016, indicating that this slim filament belongs to C. linum. It also can be
drown that the thickness of thallus may be variable greatly
among intraspecific individuals and should be evaluated when
HUANG Bingxin et al. Acta Oceanol. Sin., 2016, Vol. 35, No. 4, P. 118–123
used for taxonomic characters. Besides, some researchers considered C. linum as a detached state of C. aerea (Christensen,
1957; Rosenvinge, 1893; Lawson and John, 1987). Our results
showed that C. linum existed both attached and detached forms.
The detached population AST2010026 was sampled at high tide
beach and exposed to strong wave, making it entangled together
and free-floating with seawater. While the other two samples
AST2010003 and AST2010026 grow epilithically on hard substrata. Hence, attached or detached form can be influenced by
environment factors and should not be used as taxonomic criterion.
Acknowledgements
Special thanks are given to Saren Gaowa, Zhang Wei, Wang
Tao, Bao Chunmei for their kind laboratory technical assistance.
We also would like to appreciate the members of marine biological museum of Institute of Oceanology, Chinese Academy of
Sciences for their help.
References
Bakker F T, Olsen J L, Stam W T, et al. 1992. Nuclear ribosomal DNA
internal transcribed spacer regions (ITS1 and ITS2) define discrete biogeographic groups in Cladophora-albida (Chlorophyta). Journal of Phycology, 28(6): 839–845
Bakker F T, Olsen J L, Stam W T, et al. 1994. The Cladophora complex
(Chlorophyta): New views based on 18S rRNA gene sequences.
Molecular Phylogenetics and Evolution, 3(4): 365–382
Bakker F T, Olsen J L, Stam W T. 1995a. Evolution of nuclear rDNA its
sequences in the Cladophora albida/sericea clade (Chlorophyta). Journal of Molecular Evolution, 40(6): 640–651
Bakker F T, Olsen J L, Stam W T. 1995b. Global phylogeography in the
cosmopolitan species Cladophora vagabunda (Chlorophyta)
based on nuclear rDNA internal transcribed spacer sequences.
European Journal of Phycology, 30(3): 197–208
Blair S M. 1983. Taxonomic treatment of the Chaetomorpha and
Rhizoclonium species (Cladophorales, Chlorophyta) in newEngland. Rhodora, 85(842): 175–211
Blair S M, Mathieson A C, Cheney D P. 1982. Morphological and Electrophoretic investigations of selected species of Chaetomorpha
(Chlorophyta; Cladophorales). Phycologia, 21(2): 164–172
Burrows E M. 1991. Seaweeds of the British Isles. Volume 2 Chlorophyta. London: Natural History Museum Publications
Chiang Y M. 1960. Marine algae of northern Taiwan (Cyanophyta,
Chlorophyta, Phaeophyta). Taiwania, 7(1): 51–75
Christensen T. 1957. Chaetomorpha linum in the attached state. Botanisk Tidsskrift, 53: 311–316
Collins F S. 1909. The green algae of North America. Tufts College
Studies, Scientific Series, 2(3): 79–480
Collins F S. 1918. The green algae of North America. Second supplementary paper. Tufts College Studies, Scientific Series, 4(7):
1–106
Dillwyn L W. 1806. British Confervæ; or, Colored Figures and Descriptions of the British Plants Referred by Botanists to the
Genus Conferva. London: W. Phillips
Hall T A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41: 95–98
John D M, Lawson G W, Ameka G K. 2003. The Marine Macroalgae of
the Tropical West Africa Sub-region: Beihefte zur Nova Hedwigia. Berlin: J. Cramer, 125: 1–217
John D M, van Reine W F P, Lawson G W, et al. 2004. A Taxonomic
and Geographical Catalogue of the Seaweeds of the Western
Coast of Africa and Adjacent Islands: Beihefte zur Nova Hedwigia. Berlin: J. Cramer, 127: 1–339
Kimura M. 1980. A simple method for estimating evolutionary rates
123
of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16(2): 111–120
Kornmann P. 1972. Ein Beitrag zur Taxonomie der Gattung Chaetomorpha (Cladophorales, Chlorophyta). Helgoländer wissenschaftliche Meeresuntersuchungen, 23(1): 1–31
Kützing F T. 1845. Phycologia Germanica, d.i. Deutschlands Algen in
bündigen Beschreibungen. Nebst einer Anleitung zum Untersuchen und Bestimmen dieser Gewächse für Anfänger.. Nordhausen: W. Köhne, 1–340
Kützing F T. 1849. Species Algarum. pp. [i]-vi, [1]-922. Lipsiae
[Leipzig], Germany: F. A. Brockhaus
Lawson G W, John D W. 1987. The marine algae and coastal environment of tropical West Africa (Second Edition). Beihefte zur
Nova Hedwigia, 93: vi + 1–415
Li R G. 1964. Marine Green algae of Lüda, Liaoning Province. Jilin
Normal University Journal (in Chinese), (1): 91–106
Luan R X. 1989. Field Guide of Marine Algae Along Dalian Coast (in
Chinese). Dalian: Dalian Maritime University Press, 1–129
Mathieson A C, Norton T A, Neushul M. 1981. The taxonomic implications of genetic and environmentally induced variations in
seaweed morphology. The Botanical Review, 47(3): 313–347
Noda M. 1971. Flora of Chinese northeastern region (Manchuria): I.
Algae of the North Eastern China and Korea. Kazama study Co.,
Ltd., 1383–1601
Patel R J. 1971. Cytotaxonomical studies on Chaetomorpha linum
(OF. Müll.) Kütz. and C. aerea (Dillwyn) Kütz.. Phykos, 11:
17–22
Price W M. 1967. Some aspects of the biology and taxonomy of the
unbranched Cladophorales in the British Islands [dissertation].
England: University of Liverpool
Rosenvinge L K. 1893. Grønlands Havalger. Meddelser om Grønland,
3: 763–981
Silva P C, Basson P W, Moe R L. 1996. Catalogue of the Benthic Marine Algae of the Indian Ocean. Botany: University of California
Publications, 79: 1–1259
Sinha J P. 1958. Chromosome numbers and life cycles in members of
Cladophorales. British Phycological Journal, 1: 24–27
Swofford D L. 2002. PAUP*. Phylogenetic analysis using parsimony (*
and other methods). Sunderland, Massachusetts: Sinauer Associates
Tamura K, Dudley J, Nei M, et al. 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) Software Version 4. 0. Molecular
Biology and Evolution, 24(8): 1596–1599
Thompson J D, Gibson T J, Plewniak F, et al. 1997. The CLUSTAL_X
windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Research, 25(24): 4876–4882
Tseng C K. 1936. Studies on the marine Chlorophyceae from Hainan.
Chinese Marine Biological Bulletin, 1: 129–200
Tseng C K. 1938. Studies on the marine Chlorophyceae from Hainan,
II. Lingn Sci J, 17(2): 141–149
Tseng C K. 1983. Common Seaweeds of China. Beijing: Science Press
Tseng C K, Li L C. 1935. Some marine algae from Tsingtao and Chefoo, Shantung. Bulletin of the Fan Memorial Institute of Biology (Botany), 6(4): 183–235
Womersley H B S. 1984. The Marine Benthic Flora of Southern Australia. Part I. Adelaide: Government Printer, South Australia,
1–329
Womersley H B S, Bailey A. 1970. Marine algae of the Solomon Islands. Philosophical Transactions of the Royal Society of B: Biological Sciences, 259(830): 257–352
Yoshida T. 1998. Marine Algae of Japan. Tokyo: Uchida Rokakuho
Publishing Co., Ltd., 1–1222
Zhou Z Y, Chen Z H. 1983. A list of marine algae from Fujian coast.
Journal of Oceanography in Taiwan Strait (in Chinese), 2(2):
91–102