Standard PDF - Wiley Online Library

Research Communication
2,3,5,40-Tetrahydroxystilbene-2-O-b-D-glucoside
Protects Human Umbilical Vein Endothelial
Cells Against Lysophosphatidylcholine-Induced
Apoptosis by Upregulating Superoxide
Dismutase and Glutathione Peroxidase
Jing Zhao1
Shouzhu Xu1,2
Fan Song1
Lun Nian1
Xuanxuan Zhou1
Siwang Wang1*
1
Department of Natural Medicine, School of Pharmacy, Fourth Military
Medical University, Xi’an, People’s Republic of China
2
Department of Pharmacology, Xi’an Jiaotong University School
of Medicine, Xi’an, People’s Republic of China
Abstract
2,3,5,40 -Tetrahydroxystilbene-2-O-b-D-glucoside (TSG) has been shown
to protect human umbilical vein endothelial cells (HUVECs) from lysophosphatidylcholine (LPC)-induced injury; however, the underlying
molecular mechanism remains to be determined. The aim of this
study was to investigate the protective mechanism of TSG against
LPC-induced injury in HUVECs. We established a stable LPC-induced
cell model by treating HUVECs with various concentrations of LPC
and found 10.0 mg/mL of LPC to be optimal for inducing HUVECs
injury. The effects of TSG on LPC-induced cell injury were assessed by
cell counting kit-8, apoptosis assay, transmission electron microscope,
and measurement of malondialdehyde (MDA), the antioxidant
enzymes superoxide dismutase (SOD), reactive oxygen species (ROS),
glutathione peroxidase, and mitochondrial membrane potential. The
mRNA and protein levels of caspase-3, Bax, Bcl-2, PARP-1, and cytochrome C were assayed by real-time reverse transcriptasepolymerase chain reaction and immunoblotting, respectively. TSG
pretreatment was able to prevent LPC-induced HUVECs injury and
restore cell viability in a concentration-dependent manner. LPC treated
cells showed typical apoptotic morphological changes including cytoplasmic vacuolation, swollen mitochondria, and characteristic biochemical hallmarks of apoptosis including loss of mitochondrial
membrane potential, activation of caspase-3, decrease of Bcl-2,
increase of PARP-1, upregulation of Bax, and release of cytochrome C,
all of which were apparently inhibited by TSG pretreatment. Treatment
of HUVECs with LPC led to decrease of SOD and glutathione peroxidase in addition to rapid increase of MDA and ROS levels. Pretreatment with TSG restored SOD and glutathione peroxidase levels to
that of normal levels, and significantly decreased ROS and MDA levels. Our data indicate that TSG inhibits apoptosis of HUVECs mediated
by LPC through blocking the mitochondrial apoptotic pathway and
suggest that the mechanisms underlying the protective effects of TSG
are related to the activation of SOD and glutathione peroxidase, the
clearance of intracellular ROS, and reduction of lipid peroxidation.
C 2014 IUBMB Life, 66(10):711–722, 2014
V
Keywords:
2,3,5,40 -tetrahydroxystilbene-2-O-b-D-glucoside;
human
umbilical vein endothelial cells; lysophosphatidylcholine; apoptosis;
superoxide dismutase; reactive oxygen species; glutathione
peroxidase; endothelial injury; mitochondrial membrane potential
Introduction
C 2014 International Union of Biochemistry and Molecular Biology
V
Volume 66, Number 10, October 2014, Pages 711–722
Address correspondence to: Siwang Wang, Department of Natural
Medicine, School of Pharmacy, Fourth Military Medical University, 169
West Changle Road, Xi’an 710032, People’s Republic of China.
E-mail: [email protected]
Received 11 September 2014; Accepted 12 October 2014
DOI 10.1002/iub.1321
Published online 8 November 2014 in Wiley Online Library
(wileyonlinelibrary.com)
IUBMB Life
Atherosclerosis (AS) is the leading cause for cardiovascular
disease and hence one of the most common diseases affecting
human health, but the underlying molecular mechanism
remains to be determined. The response-to-injury hypothesis
states that AS is a chronic inflammatory process followed by
localized injury to the vessel wall, in particular to the endothelial layer lining the lumen of the vessel. Thereafter vascular
endothelial injury is considered to be the initial step during
development and progression of AS (1,2), suggesting that
711
IUBMB LIFE
agents, which could protect against vascular endothelial
injury, may reduce the incidence of cardiovascular disease.
Accordingly, several such agents have been identified and
tested in vitro and in vivo (3–5). Earlier report showed that
2,3,5,40 -tetrahydroxystilbene-2-O-b-D-glucoside (TSG) could
prevent vascular endothelial dysfunction by regulating the
expression of endothelial nitric oxide synthase (eNOS) and
inducible nitric oxide synthase (iNOS) in experimental atherosclerosis in atherogenic-diet rats (6), indicating that TSG is a
potential drug for the prevention and treatment of cardiovascular disease.
TSG is one of the major bioactive constituents extracted
from Polygonum multiflorum Thunb and demonstrates various
pharmacologic
activities
including
antioxidant,
antiinflammatory, and anti-atherosclerotic effects (7–9), improvement of memory and learning ability (10), neuroprotection
(11), anti-aging (12), promotion of hair growth (13), and
attenuation of human platelet aggregation (14). It was recently
reported that TSG could protect human umbilical vein endothelial cells (HUVECs) from lysophosphatidylcholine (LPC)induced injury by attenuating the expression of asymmetric
dimethylarginine (ADMA) and enhancing the production of
nitric oxide (NO) (15); however, the underlying molecular
mechanisms are largely unknown.
HUVECs play an important role in the regulation of vascular physiological functions and the maintenance of vascular
homeostasis (16), while LPC is closely related with AS (17).
LPC is a major lipid constituent of oxidized LDL and plays an
important role in oxidized LDL-induced endothelial dysfunction. LPC increases oxidative stress by generating reactive oxygen species (ROS) and decreasing NO release, thereby causing
endothelial dysfunction (18–20). Previous studies demonstrated
that TSG significantly reduces ROS (21) and protects HUVECs
cells from the injury caused by hydrogen peroxide (H2O2) (22).
As ROS such as H2O2 are potent cellular damaging agents,
these observations led us to hypothesize that TSG might protect HUVECs from apoptosis induced by LPC.
In this study, we investigated the protective mechanism of
TSG in HUVECs against LPC by establishing a stable LPCinduced cell model, followed by treatment with various concentrations of LPC in parallel with Simvastatin, which is being
widely used to treat AS in clinical and scientific research
(23–25). Our results showed that TSG inhibited the apoptosis
of HUVECs induced by LPC through blocking the mitochondrial
apoptotic pathway. Our study may provide an experimental
and theoretical basis for further development of TSG to protect
against cardiovascular diseases such as AS.
Materials and Methods
The experimental protocol was established, according to the
ethical guidelines of the Helsinki Declaration, and was
approved by the Human Ethics Committee of Fourth Military
Medical University, China. Written informed consent was
obtained from individual participants.
712
Reagents
Human umbilical vein endothelial cells (HUVECs) were cell
line established by the Fourth Military Medical University;
DMEM (5.6 mM or 25 mM glucose) was purchased from
Hyclone Thermo Fisher Scientific; TSG (C20H22O9, molecular
weight 406.4, purity 99.0%) was provided by the Fourth Military Medical University; Simvastatin (C25H38O5, molecular
weight 418.6, purity 99.0%) was obtained from the National
Institute for the Control of Pharmaceutical and Biological
Products (Beijing, China); LPC (C24H50NO7P, molecular weight
495.6, purity 99.0%) was purchased from Sigma (MO).
Cell Culture and Treatment
HUVECs were cultured in DMEM supplemented with 10% fetal
bovine serum (FBS), 100 mg/mL penicillin, and 100 mg/mL
streptomycin at 37 C in a 5% CO2 incubator. HUVEC cells
between passages 3 and 10 were used for experiments. When
cells were close to 70–80% confluence, new medium was
added before drug treatment. The groups of experiment: 1)
DMEM: cells were incubated with DMEM for 24 H; 2) LPC:
cells were incubated with 10.0 mg/mL LPC for 24 H; 3) Simvastatin: cells were treated with 5.0 mmol/L Simvastatin for 1 H,
and then exposed to a final concentration of 10.0 mg/mL LPC
for 24 H; 4) TSG (0.1): cells were incubated with TSG 0.1 mmol/
L for 1 H, and then exposed to a final concentration of 10.0 mg/
mL LPC for 24 H; 5) TSG (1.0): cells were incubated with 1.0
mmol/L TSG for 1 H, and then exposed to a final concentration
of 10.0 mg/mL LPC for 24 H; 6) TSG (10.0): cells were incubated with 10.0 mmol/L TSG for 1 H, followed by continued
exposure to a final concentration of LPC 10.0 mg/mL for 24 H.
MTT Assay
Cells were cultured at a density of 2.0 3 104 cells per well in
flat-bottom 96-well plates and incubated for 24 H. Then, cells
were treated with 5.0, 10.0, 20.0, and 40.0 mg/mL LPC for 24 H,
followed by addition of 3-(4,5-dimethylthiazol-2-yl)22,5-diphenyltetrazolium bromide reagent (MTT, Beijing, China). After
incubation for 4 H, the optical density (OD) was measured at
490 nm using a Microplate Reader Model M680-UV Spectrophotometer (Bio-Rad Laboratories, Marnes La Coquette, France).
CCK-8 Assay
The CCK-8 reduction assay kits (Beyotime Institute of Biotechnology, Changsha, China) were used as a qualitative index of
cell viability according to the manufacturer’s instructions. After
24 H incubation with different compounds as described for MTT
assay, 20 mL CCK-8 was added and cells were cultured for additional 4 H. The optical density (OD) was measured at 450 nm
using a Microplate Reader Model M680-UV Spectrophotometer
(Bio-Rad Laboratories, Marnes La Coquette, France).
Annexin V/PI Staining
Apoptotic cells were analyzed with an Annexin V (Fluorescein
isothiocyanate [FITC]-conjugated)/PI apoptosis kit (Keygen Biotech, Nanjing, Jiangsu, China) coupled with flow cytometry.
After treatment with different drugs for 24 H, 0.5–1 3 106 cells
TSG Protects Huvecs By Upregulating SOD and GSH-PX
TABLE 1
The sequences of real-time PCR primers used in this study
Gene
Forward
Reverse
b-Actin
50 TAGTTGCGTTACACCCTTTCTTG 30
50 TCACCTTCACCGTTCCAGTTT 30
Bax
50 CCTTTTGCTTCAGGGTTTCAT 30
50 CTCCATGTTACTGTCCAGTTCGT 30
Bcl-2
50 TTCTTGAAGGTTTCCTCGTCC 30
50 GAATCTGCTGGTCATTTGCC 30
Caspase-3
50 GCACTGGAATGACATCTCGG 30
50 AAACTGCTCCTTTTGCTGTGA 30
PARP-1
50 CATCGAGGTGGCCTACAGTCT 30
50 ATTGTGTGTGGTTGCATGAGTG30
Cyt C
50 TCGTTGTGCCAGCGACTAA 30
50 TGCCTCCCTTTTCAACGG 30
were harvested and resuspended in 500 mL binding buffer. Subsequently, the cells were incubated with 5 mL of Annexin V-FITC
(50 mg/mL) and 5 mL of PI (50 mg/mL) for 15 Min in the dark, followed by flow cytometer analysis (Becton Dickinson, San Jose,
CA). For all the samples, 2 3 105 cells were acquired and analyzed with Cell Quest software (Becton Dickinson). The percentages of early apoptotic cells (the lower right in the scatter plot)
and late apoptotic/necrotic cells (upper right in the scatter plot)
were calculated for comparison.
Transmission Electron Microscope Analysis
The transmission electron microscope was used to observe the
cell morphology. After 24 H incubation with different compounds as described above, cells were collected by centrifugation (1,000 rpm, 3 Min), washed twice with phosphatebuffered saline (PBS) and fixed in freshly prepared 1% paraformaldehyde with 2% glutaraldehyde for 24 H. Samples were
further treated with 1% osmium tetroxide for 2 H, dehydrated
in graded ethanol, and embedded in araldite. Ultrathin sections were cut and stained with uranyl acetate and lead
citrate, and then observed under transmission electron microscope (JEM-101, Jeol Electron, Japan).
Detection of MDA, Superoxide Dismutase, and
Glutathione Peroxidase
After incubation with different compounds for 24 H as
described above, cells were harvested with 0.25% trypsin, and
washed twice with PBS. Then, the contents of MDA, superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px)
were determined using the corresponding detection kits (Lipid
Peroxidation MDA Assay Kit, Total Superoxide Dismutase
Assay Kit with WST-8, Total Glutathione Peroxidase Assay Kit,
Beyotime Institute of Biotechnology, Changsha, China) according to the manufacturer’s instructions. At the same time, the
concentrations of MDA, SOD, and GSH-Px were determined
using ELISA kits (Elabscience, Wuhan, China).
Detection of ROS Levels
ROS generation of HUVECs induced by LPC was measured by
staining DCFH-DA (Beyotime Institute of Biotechnology, Changsha, China). After incubation in six-well culture plates for 24
Zhao et al.
H, cells were exposed to different compounds as indicated at
37 C for 24 H. Cells were washed twice with PBS. Then, the
cells were resuspended in fresh medium containing 10 mM
DCFH-DA and analyzed by flow cytometry. At the same time,
the concentration of ROS was detailed analysis by ELISA kits
(Elabscience, Wuhan, China).
Determination of the Mitochondrial Membrane
Potential
After treatment, cells were washed twice with PBS and incubated in serum-free medium containing JC-1 dye in the dark at
37 C for 20 Min. After washing with JC-1 dyeing buffer twice,
cells were harvested with 0.25% trypsin and washed twice with
PBS. The cells were analyzed by flow cytometry with excitation
and emission wavelengths of 480 and 530 nm, respectively. At
the same time, parallel fluorescence intensity was detected
using laser confocal microscopy (Olympus FV1000, Japan). The
contents of mitochondrial membrane potential (MMP) were
determined using detection kits (Beyotime Institute of Biotechnology, Changsha, China) according to the manufacturer’s
instructions.
Reverse Transcriptase-Polymerase Chain Reaction
Reverse transcriptase-polymerase chain reaction (RT-PCR) was
used to analyze mRNA expression of genes involved in apoptosis. Total RNA was prepared using Trizol reagent (TaKaRa,
Japan) according to the manufacturer’s instructions. The quantity and purity of the RNA were assessed by measuring the
absorbance at 260 and 280 nm. The cDNA was synthesized
from total RNA (2 mg) with oligo (dT) primers using an M-MLV
reverse transcriptase First Strand Kit (Invitrogen). All PCR conditions were optimized to produce a single product in the exponential range. Quantitative real-time PCR was performed using
SYBR Green master mix and the detection of mRNA was analyzed using an ABI Step One real-time PCR System (Applied Biosystems, Foster City, CA). Primer sequences for the reference
gene b-actin and the genes of interest are listed in Table 1. Typical PCR thermocycler profile was the initial step, 95 C for 10
Min followed by a second step at 95 C for 15 Sec and 60 C for
30 Sec for 40 cycles with a melting curve analysis. The level of
713
IUBMB LIFE
actin (Cat No: AP0060, Bioworld). After incubation with second
antibody, immune complexes were detected using ECL western
blotting reagents (Thermoscientific, Thermo Fisher Scientific).
Immunoreactive bands were quantified using the Gel Doc TM
XR with Lab image 4.0.1 software (Bio-Rad Laboratories,
Marnes La Coquette, France). Measured intensities were corrected with the internal control (b-actin).
Statistical Analysis
The differences were analyzed by ANOVA. All values were
expressed as mean 6 SD from at least three independent
experiments. Statistical significance was defined as P < 0.05.
Results
TSG Prevents the Loss of Cell Viability Following LPC
Treatment
FIG 1
TSG protected HUVECs cells from LPC in a
concentration-dependent manner. (A) HUVECs were
incubated with 5.0, 10.0, 20.0, and 40.0 mg/mL of LPC
for 24 H and cell viability was analyzed using MTT
assay in comparison to DMEM. (B) HUVECs were
treated with LPC alone for 24 H or pretreated with
Simvastatin, 0.1, 1, or 10 mmol/L TSG for 1 H, followed by treatment with LPC for 24 H. Cell viability
was assessed by CCK-8 assay in comparison to
DMEM only control group. Cells without drug addition served as control (DMEM). Data are mean 6 SD
(n 5 8), *P < 0.05, **P < 0.01.
target mRNA was normalized to the level of the b-actin and
compared with the control. Data were analyzed using the DDCT
method.
Western Blot
Total proteins were extracted by lysing cells with Radio Immunoprecipitation Assay (RIPA) Lysis Buffer (Beyotime Institute of
Biotechnology, China). Protein concentrations were determined
using the BCA method (Beyotime Institute of Biotechnology).
Equal amounts of protein were separated by SDS-PAGE and
transferred to nitrocellulose membranes. After being blocked
with 5% skim milk in Tris-buffered saline (pH 7.6) (TBS) at room
temperature, the membranes were incubated overnight at 4 C
with primary antibodies against Bax (Abcam, ID:ab32503), Bcl2 (Abcam, ID:ab117115), Caspase-3 (Abcam, ID:ab2171), Cyt C
(Abcam, ID:ab13575), PARP-1 (Abcam, ID:ab32378), and b-
714
To establish a suitable experimental model of HUVECs injury
induced by LPC, we treated HUVECs with 5.0, 10.0, 20.0, and
40.0 mg/mL of LPC in DMEM for 24 H and assessed cell viability
using MTT assay. The OD values of cells treated with 5 mg/mL
LPC, 10.0 mg/mL LPC, 20 mg/mL LPC, and 40 mg/mL LPC were
0.76 6 0.18, 0.52 6 0.15, 0.35 6 0.11, and 0.25 6 0.11, respectively (Fig. 1A). The results showed that 10.0 mg/mL of LPC could
decrease HUVECs viability to 50% relative to that of untreated
group. The results suggest that LPC, a main active component of
oxidized-LDL, has the ability to induce HUVECs injury in a
concentration-dependent manner, and 10.0 mg/mL of LPC is the
appropriate concentration to establish a HUVECs injury model.
We next treated HUVECs with LPC alone for 24 H or pretreated with Simvastatin, 0.1, 1, or 10 mmol/L TSG for 1 H followed by treatment with LPC for 24 H. We assessed cell viability
using CCK-8. 10.0 mg/mL of LPC for 24 H decreased the cell viability. In contrast, Simvastatin significantly abolished the loss of
cell viability following treatment with LPC. The cell viability in
the 10.0 mmol/L TSG1LPC group was significantly higher than
that of LPC group; the cell viability in the 0.1 mmol/L TSG1LPC
and 1.0 mmol/L TSG1LPC treated groups was lower than that of
the Simvastatin1LPC treated group but higher than LPC group
(Fig. 1B). These results clearly demonstrated that TSG could protect HUVECs from LPC in a concentration-dependent manner.
TSG Protects HUVECs Against LPC-Induced Apoptosis
To investigate the mechanism of the prevention of LPC-induced
loss of cell viability by TSG, we first analyzed cell apoptosis by
flow cytometry using Annexin-PI double staining of HUVECs
treated with LPC alone for 24 H or pretreated with Simvastatin,
0.1, 1, or 10 mmol/L TSG for 1 H, followed by treatment with LPC
for 24 H. In comparison to the control DMEM, LPC significantly
induced cell apoptosis. As expected, Simvastatin significantly
inhibited LPC-induced apoptosis. Interestingly, increasing the
concentration of TSG significantly reduced the apoptosis rates in
comparison to that of LPC treatment alone (Table 2).
To support the above observation that LPC induced cell
apoptosis is protected by TSG, we checked cell morphology
after treatment of HUVECs with LPC alone or in combination
TSG Protects Huvecs By Upregulating SOD and GSH-PX
TABLE 2
Effects of TSG on cell apoptosis induced by LPC
(x 6 SD, n 5 3)
Group
Apoptosis rate (%)
DMEM
4.7 6 2.6
LPC
28.1 6 2.9c
Simvastatin 1 LPC
11.2 6 2.5b
TSG (0.1 mmol/L) 1 LPC
19.1 6 3.2a
TSG (1.0 mmol/L) 1 LPC
13.4 6 5.8a
TSG (10.0 mmol/L) 1 LPC
a
P < 0.05,
P < 0.01 versus LPC group,
c
P < 0.01 versus DMEM group.
b
FIG 2
Zhao et al.
b
6.3 6 3.9
with Simvastatin, or different concentrations of TSG by transmission electron microscope. As shown in Fig. 2, the HUVECs
in DMEM alone displayed normal chromatin architecture and
abundant mitochondria. In sharp contrast, LPC treatment
caused significant apoptosis and cytoplasmic vacuolation. Simvastatin apparently rescued the apoptotic morphology change
following LPC treatment. TSG obviously attenuated the loss of
mitochondria and cytoplasmic vacuolation that was induced by
LPC. These results indicate that TSG has a protective effect
against LPC-induced apoptosis to HUVECs in vitro.
TSG Inhibits LPC-Induced Upregulation of Caspase-3,
Bax, PARP-1, and Cyt C and Downregulation of Bcl-2
To further investigate cell apoptosis signaling in HUVEC cells
treated with LPC, we examined the effects of LPC on Caspase-3,
Bax, Bcl-2, PARP-1, and Cyt C mRNA expression by RT-PCR and
found that the Caspase-3, Bax, PARP-1, and Cyt C mRNA levels
were significantly increased, while Bcl-2 level was obviously
TSG abolished LPC-induced apoptosis to HUVECs in vitro. Transmission electron microscope micrographs of HUVECs treated
with different compounds as indicated for 24 H. DMEM: Abundant mitochondria were seen in the cytoplasm. LPC: The cells
exposed with LPC 10.0 mg/mL showed an abundance of cytoplasmic vacuolation and swollen mitochondria. Simvastatin1LPC:
Reduced cytoplasmic vacuolation and swollen mitochondria were seen in the cytoplasm. TSG1LPC: With the increase of concentration of TSG, mitochondria condition was improved markedly (original magnification 330,000). In all treatment groups,
swollen mitochondria were detected in comparison to that of DMEM control group. [Color figure can be viewed in the online
issue, which is available at wileyonlinelibrary.com.]
715
IUBMB LIFE
FIG 3
TSG inhibits the upregulation of Caspase-3, Bax, PARP-1, and Cyt C in addition to the downregulation of Bcl-2 by LPC. HUVECs
were treated with LPC alone for 24 H or pretreated with Simvastatin, 0.1, 1, or 10 mmol/L TSG for 1 H, and then treated with
LPC for 24 H. mRNA levels of Bax, Bcl-2, Cyt C (A), Caspase-3, and PARP-1 (B) were determined by real-time PCR with b-actin
as internal control. (C and D) Cells were treated as (A and B), the protein levels of Bax, Bcl-2, Caspase-3, and PARP-1 were
determined by immunoblotting with b-actin as loading control. Data of quantitative analysis are listed below the corresponding
western blots results. Data are the mean 6 SD (n 5 3), *P < 0.05, **P < 0.01 versus LPC group, #P < 0.05, ##P < 0.01 versus LPC
group, &P < 0.05, &&P < 0.01 versus LPC group, $P < 0.05, $$P < 0.01 versus LPC group, qP < 0.05, qqP < 0.01 versus LPC
group, $ $ P < 0.01 versus DMEM group.
decreased following LPC treatment. 5.0 mmol/L of Simvastatin
and TSG significantly reduced these mRNA level alterations.
Moreover, increased concentration of TSG further inhibited the
716
effects of LPC. In addition, the effect of 10.0 mmol/L of TSG was
superior to that of the 5.0 mmol/L of Simvastatin (Figs. 3A and
3B). Consistent with the results from RT-PCR, similar changes of
TSG Protects Huvecs By Upregulating SOD and GSH-PX
FIG 4
Zhao et al.
TSG inhibits the decrease of the mitochondrial transmembrane potential (MMP) by LPC. HUVECs were treated with LPC
alone or pretreated with Simvastatin, 0.1, 1, or 10 mmol/L TSG for 1 H, and then treated with LPC for 24 H. Images were
captured under an inverted laser scanning confocal microscope after JC-1 staining. The first column picture was merged
the second, and presented in the third column. In unhealthy mitochondria, JC-1 produced green fluorescence in the form
of monomer. In normal mitochondria, JC-1 formed polymer in the mitochondrial matrix and produced red fluorescence.
Compared with DMEM group, the red fluorescence in LPC group decreased significantly, thus red and green fluorescence
ratio decreased. With the increase of concentration of TSG, red and green fluorescence ratio increased significantly (original magnification 3600). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
717
IUBMB LIFE
TABLE 3
TSG prevents the decrease the mitochondrial
membrane potential by LPC (x 6 SD, n 5 3)
Group
Mitochondrial membrane potential
(MFI)
DMEM
12.0 6 1.7
LPC
1.3 6 0.6c
b
Simvastatin 1 LPC
5.1 6 0.9
TSG (0.1 mmol/L) 1 LPC
2.2 6 0.7a
TSG (1.0 mmol/L) 1 LPC
3.7 6 1.2a
TSG (10.0 mmol/L) 1 LPC
7.8 6 1.9b
a
P < 0.05,
P < 0.05 versus LPC group,
c
P < 0.01 versus DMEM group.
b
the protein levels of Caspase-3, Bax, Bcl-2, and PARP-1 were
found by Western blot analysis (Figs. 3C and 3D). These results
indicated that the apoptosis induced by LPC might involve caspase regulation and mitochondrial apoptotic pathway.
TSG Inhibits the Decrease of the MMP and the
Increase Cyt C Release into the Cytoplasm from
Mitochondria in HUVECs by LPC
decrease of SOD and GSH-Px by LPC. Moreover, TSG inhibited
the LPC-induced changes of these molecules in a concentrationdependent manner (Fig. 6). These results suggest that TSG might
protect HUVECs against injury induced by LPC by increasing the
expression of the antioxidant enzymes SOD and GSH-Px, scavenging ROS, and reducing lipid peroxidation.
Discussion
In this study, we established an LPC-induced cell model to
investigate the protective mechanism of TSG in HUVECs by
LPC. Our results showed that the treatment of HUVECs with
LPC resulted in significant cell apoptosis, which could be
restored by TSG pretreatment. Most importantly, we found
that TSG inhibited the production of MDA and ROS and reduction of SOD and GSH-Px by LPC. Our results suggest that TSG
might protect HUVECs against LPC-mediated injury by antagonizing LPC-induced apoptosis via upregulating the expression
of the antioxidant enzymes SOD and GSH-Px, scavenging ROS,
and reducing lipid peroxidation.
Cell apoptosis is a self-regulating programmed cell death,
which balances cell survival and death and maintains normal
tissue homeostasis (27). Although apoptosis can be triggered
by different kinds of stimuli, the downstream signaling pathways of cell apoptosis are common (28,29). Endothelial apoptosis can damage the physiological barrier of blood vessels
and endothelial dysfunction, promote clotting, and reduce
To verify the result of Cyt C as detected by RT-PCR, we further
assayed the protein expression of Cyt C and MMP. As shown in
Fig. 4 and Table 3, treatment with 10.0 mg/mL LPC significantly
decreased the red florescence intensity in HUVECs. However,
pretreatment of HUVECs with TSG was able to rescue the
median fluorescence intensity (MFI) in a concentrationdependent manner. In addition, 10.0 mmol/L of TSG could
recover the MMP of cells treated with LPC to a normal level. The
change in the MMP is associated with the permeability of the
mitochondrial membrane and the release of cytochrome C into
the cytoplasm from the mitochondria (26). Indeed, treatment of
HUVEC cells with LPC resulted in apparent increase of Cyt C,
which was significantly inhibited by either Simvastatin or TSG
(Fig. 5). These results demonstrated that TSG inhibited the LPCinduced decrease of MMP and the concomitant increase of Cyt C
release into the cytoplasm from mitochondria in HUVECs.
TSG Inhibits the Production of MDA and ROS and
Decrease of SOD and GSH-Px by LPC
To investigate the mechanism by which TSC inhibited the LPCinduced apoptosis in HUVECs, we determined the status of SOD,
GSH-Px, MDA, and ROS of HUVECs treated with LPC alone or in
combination with Simvastatin, or different concentrations of
TSG for 24 H. Relative to normal DMEM group, the levels of MDA
and ROS were significantly increased in HUVECs treated with
10.0 mg/mL of LPC, while the levels of SOD and GSP-Px were significantly decreased. In contrast, both Simvastatin and 10.0
mmol/L TSG inhibited the production of MDA and ROS and
718
FIG 5
TSG inhibits the increase Cyt C release into the cytoplasm from mitochondria in HUVECs by LPC.
HUVECs were treated with LPC alone or pretreated
with Simvastatin, 0.1, 1, or 10 mmol/L TSG for 1 H,
and then treated with LPC for 24 H. The protein level
of Cyt C was determined by western blots. Data are
the mean 6 SD (n 5 3), *P < 0.05, **P < 0.01 versus
LPC group, &&P < 0.01 versus DMEM group.
TSG Protects Huvecs By Upregulating SOD and GSH-PX
FIG 6
TSG inhibited the changes of MDA, ROS, SOD, and GSH-Px by LPC in a concentration-dependent manner. After incubation for
24 H with different compounds as indicated, cells were harvested, and the contents of MDA (A1 and A2), SOD (B1 and B2),
ROS (C1 and C2), and GSH-Px (D1 and D2) were determined, respectively, by detection kits and ELISA kits. (E) One experiment
representative of three is shown. The results were determined by flow cytometry analysis. Data are the mean 6 SD (n 5 3),
*P < 0.05, **P < 0.01 versus LPC group, &P < 0.05, &&P < 0.01 versus DMEM group. [Color figure can be viewed in the online
issue, which is available at wileyonlinelibrary.com.]
active material of vascular endothelial cells such as NO generation, causing AS in the early stage (30,31). Furthermore,
endothelial apoptosis is closely associated with hyperlipidemia
(32), hypertension (33), and diabetes (34). Therefore, to prevent cardiovascular disease especially AS, it is important to
protect endothelial cells from apoptosis resulted from oxidative
stress.
Oxide-LDL, a stimulus of AS, is currently being widely
used to induce oxidative stress in experimental models. Similar
to oxide-LDL, LPC is also able to induce injury of vascularendothelium-dependent diastolic function. LPC is derived from
polar surface phosphatidylcholine (PC) of lipoproteins or from
Zhao et al.
cell membrane-derived PC as a result of phospholipase A2
(PLA2). In this study, we used LPC to induce oxidative stress
injury in HUVECs. Our results showed that LPC was able to
induce HUVECs injury in a concentration-dependent manner
and 10.0 mg/mL of LPC was the optimal concentration to
induce HUVECs injury. Next, we investigated the protective
effects of TSG against LPC-induced oxidative stress injury in
HUVECs. The results demonstrated that TSG could inhibit the
LPC-mediated HUVECs injury and could restore cell vitality in
a concentration-dependent manner. Moreover, the protective
effects of TSG (10.0 mmol/L) were stronger than those of Simvastatin (5.0 mmol/L) in HUVECs.
719
IUBMB LIFE
FIG 6
720
(Continued)
TSG Protects Huvecs By Upregulating SOD and GSH-PX
Oxidative stress results from the imbalance between ROS
and antioxidants and contributes to the pathogenesis of cardiovascular diseases and other diseases. In this study, treatment of HUVECs with 10.0 mg/mL LPC resulted in 6-fold
increase of the ROS level and 1.92-fold upregulation of the
concentration of the oxidative product MDA, indicating oxidative stress injury in HUVECs. These data suggest that
accumulation of ROS causes lipid peroxidation. Indeed, treatment of HUVECs with LPC led to decrease of SOD and GSHPx in addition to rapid increase of MDA. Interestingly, pretreatment with 10.0 mmol/L TSG restored the SOD and GSHPx levels to that of the DMEM only group, and significantly
decreased ROS and MDA levels. Moreover, the ability of TSG
(10.0 mmol/L) to activate the antioxidant enzymes SOD and
GSH-Px in HUVECs was significantly stronger than that of
Simvastatin (5.0 mmol/L). These results suggest that the
mechanism underlying TSG protection against LPC-induced
HUVECs oxidative stress injury involves the elevation of the
expression of the antioxidant enzymes SOD and GSH-Px and
the clearance of ROS.
One of the mechanisms of cellular injury by oxidative
stress is the induction of cell apoptosis. Our results suggest
that TSG may protect HUVECs against LPC-induced apoptosis
by promoting the expression of the antioxidant enzymes SOD
and GSH-Px and the clearance of ROS. There are three apoptotic pathways: cell surface death receptors-Caspase-8Caspase-3 (29); mitochondria/MMP-Cyt C-Caspase-9-Caspase-3
(35,36); endoplasmic reticulum/Ca21-Caspase-12-Caspase-3
(37). The three apoptotic cascades converge on the activation
of caspase-3, which results in the cleavage of intracellular
poly (ADP ribose) polymerase (PARP-1) and the activation of
DNase, leading to DNA fragmentation (38–40). Bcl-2 family
members play important roles in mitochondria-dependent activation of caspase cascades (41). Previous studies have demonstrated that ROS increases the membrane permeability of
mitochondria, causing the depolarization of the MMP and the
release of Cyt C from mitochondria into the cytosol, triggering
the caspase cascade, and leading to cell apoptosis (42–44). Our
data showed that LPC (10.0 mg/mL) significantly induced apoptosis in HUVECs, accompanied with the loss of the MMP, the
release of Cyt C, increase of caspase-3, Bax, and PARP-1, and
decrease of Bcl-2. Whereas, TSG apparently abolished these
effects induced by LPC, such as inhibition of the expression of
Caspase-3 by LPC. Taken together, we conclude that the
underlying mechanism of the protection of TSG against LPCinduced injury in HUVECs involves eliminating ROS by upregulating SOD and GSH-Px, and inhibiting the mitochondriadependent apoptotic pathway through stabilizing MMP, preventing Cyt C release, increasing Bcl-2 expression, and
decreasing Caspases-3 activation.
In summary, we discovered a novel mechanism by which
TSG protects endothelial cells from oxidative stress involved in
LPC-induced injury in HUVECs. Our findings will be helpful to
develop TSG as a candidate for the prevention and treatment
of cardiovascular diseases including AS.
Zhao et al.
Acknowledgements
This research was supported by the Major Science and Technology Projects in Shanxi province, China (2012KTCQ03-02).
The funders had no role in study design, data collection and
analysis, decision to publish, or preparation of the manuscript.
References
[1] Zhang, M., Zhou, S. H., Li, X. P., Shen, X. Q., and Fang, Z. F. (2008) A novel
hypothesis of atherosclerosis: EPCs-mediated repair-to-injury. Med. Hypotheses 70, 838 – 841.
[2] Chapman, M. J. (2007) From pathophysiology to targeted therapy for atherothrombosis: a role for the combination of statin and aspirin in secondary prevention. Pharmacol. Ther. 113, 184 – 196.
[3] Chen, W., Tang, F., Xie, B., Chen, S., Huang, H., et al. (2012) Amelioration of
atherosclerosis by tanshinone IIA in hyperlipidemic rabbits through attenuation of oxidative stress. Eur. J. Pharmacol. 674, 359 – 364.
[4] Li, L., Yao, Y., Wang, H., Ren, Y., Ma, L. et al. (2010) Pravastatin attenuates
cardiac dysfunction induced by lysophosphatidylcholine in isolated rat
hearts. Eur. J. Pharmacol. 640, 139 – 142.
[5] Mattison, J. A., Wang, M., Bernier, M., Zhang, J., Park, S. S. et al. (2014)
Resveratrol prevents high fat/sucrose diet-induced central arterial wall
inflammation and stiffening in nonhuman primates. Cell Metab. 20, 183 – 90.
[6] Zhang, W., Xu, X. L., Wang, Y. Q., Wang, C. H., and Zhu, W. Z. (2009) Effects
of 2,3,4’,5-tetrahydroxystilbene 2-O-beta-D-glucoside on vascular endothelial
dysfunction in atherogenic-diet rats. Planta Med. 75, 1209 – 1214.
[7] Zeng, C., Xiao, J. H., Chang, M. J., and Wang, J. L. (2011) Beneficial effects
of THSG on acetic acid-induced experimental colitis: involvement of upregulation of PPAR-gamma and inhibition of the Nf-Kappab inflammatory pathway. Molecules 16, 8552 – 8568.
[8] Zhang, J. K., Yang, L., Meng, G. L., Fan, J., Chen, J. Z. et al. (2012) Protective
effect of tetrahydroxystilbene glucoside against hydrogen peroxide-induced
dysfunction and oxidative stress in osteoblastic MC3T3-E1 cells. Eur. J. Pharmacol. 689, 31 – 37.
[9] Yao, W., Fan, W., Huang, C., Zhong, H., Chen, X., et al. (2013) Proteomic analysis for anti-atherosclerotic effect of tetrahydroxystilbene glucoside in rats.
Biomed. Pharmacother. 67, 140 – 145.
[10] Zhang, L., Xing, Y., Ye, C. F., Ai, H. X., Wei, H. F., et al. (2006) Learningmemory deficit with aging in APP transgenic mice of Alzheimer’s disease
and intervention by using tetrahydroxystilbene glucoside. Behav. Brain Res.
173, 246 – 254.
[11] Zhang, L., Huang, L., Chen, L., Hao, D., and Chen, J. (2013) Neuroprotection
by tetrahydroxystilbene glucoside in the MPTP mouse model of Parkinson’s
disease. Toxicol. Lett. 222, 155 – 163.
[12] Zhou, X. X., Yang, Q., Xie, Y. H., Sun, J. Y., Qiu, P. C., et al. (2013) Protective
effect of tetrahydroxystilbeneglucoside against D-galactose induced aging
process in mice. Phytochem. Lett. 6, 372 – 378.
[13] Sun, Y. N., Cui, L., Li, W., Yan, X. T., Yang, S. Y., et al. (2013) Promotion
effect of constituents from the root of Polygonum multiflorum on hair
growth. Bioorg. Med. Chem. Lett. 23, 4801 – 4805.
[14] Xiang, K., Liu, G., Zhou, Y. J., Hao, H. Z., Yin, Z., et al. (2014) 2,3,5,4’-tetrahydroxystilbene-2-O-beta-D-glucoside (THSG) attenuates human platelet
aggregation, secretion and spreading in vitro. Thromb. Res. 133, 211 – 217.
[15] Zhang, C., Yang, Y., Tian, Y., Qiao, X., Long, S., et al. (2012) Effect of TSG
on expression of adhesion molecule induced by H2O2 on vascular endothelial cell. Pharmacol. Bull. 28, 1088 – 1092.
[16] Shi, Y. and Tokunaga, O. (2004) Chlamydia pneumoniae (C. pneumoniae)
infection upregulates atherosclerosis-related gene expression in human
umbilical vein endothelial cells (HUVECs). Atherosclerosis 177, 245 – 253.
[17] Schmitz, G. and Ruebsaamen, K. (2010) Metabolism and atherogenic disease association of lysophosphatidylcholine. Atherosclerosis 208,
10 – 18.
[18] Matsubara, M., Yao, K., and Hasegawa, K. (2006) Benidipine, a
dihydropyridine-calcium channel blocker, inhibits lysophosphatidylcholine-
721
IUBMB LIFE
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
induced endothelial injury via stimulation of nitric oxide release. Pharmacol.
Res. 53, 35 – 43.
Matsubara, M. and Hasegawa, K. (2005) Benidipine, a dihydropyridinecalcium channel blocker, prevents lysophosphatidylcholine-induced injury
and reactive oxygen species production in human aortic endothelial cells.
Atherosclerosis 178, 57 – 66.
Zmijewski, J. W., Landar, A., Watanabe, N., Dickinson, D. A., Noguchi, N.,
et al. (2005) Cell signalling by oxidized lipids and the role of reactive oxygen
species in the endothelium. Biochem. Soc. Trans. 33, 1385 – 1389.
Li, X., Li, Y., Chen, J., Sun, J., Li, X., et al. (2010) Tetrahydroxystilbene glucoside attenuates MPP1-induced apoptosis in PC12 cells by inhibiting ROS
generation and modulating JNK activation. Neurosci. Lett. 483, 1 – 5.
Long, S., Zhang, C., Qiao, X., Huang, L., Tian, Y., et al. (2011) Effects of TSG
on apoptosis of HUVECs and the expression of caspase-3 and PARP
Induced by H202. Biochem. Biophys. 1052 – 1059.
Pernice, F., Floccari, F., Caccamo, C., Belghity, N., Mantuano, S., et al. (2006)
Chromosomal damage and atherosclerosis. A protective effect from simvastatin. Eur. J. Pharmacol. 532, 223 – 229.
Sobal, G. and Sinzinger, H. (2005) Effect of simvastatin on the oxidation of
native and modified lipoproteins. Biochem. Pharmacol. 70, 1185 – 1191.
Zhang, Z., Zhang, M., Li, Y., Liu, S., Ping, S., et al. (2013) Simvastatin inhibits the additive activation of ERK1/2 and proliferation of rat vascular smooth
muscle cells induced by combined mechanical stress and oxLDL through
LOX-1 pathway. Cell Signal. 25, 332 – 340.
Emami, S., Ghourchian, H., and Divsalar, A. (2011) Release of Cyt c from
the model membrane due to conformational change induced by anticancer
palladium complex. Int. J. Biol. Macromol. 48, 243 – 248.
Hanahan, D. and Weinberg, R. A. (2000) The hallmarks of cancer. Cell 100,
57 – 70.
Qin, C. and Liu, Z. (2007) In atherogenesis, the apoptosis of endothelial cell
itself could directly induce over-proliferation of smooth muscle cells. Med.
Hypotheses 68, 275 – 277.
Ashkenazi, A. and Dixit, V. M. (1998) Death receptors: signaling and modulation. Science 281, 1305 – 1308.
Erdbruegger, U., Woywodt, A., Kirsch, T., Haller, H., and Haubitz, M. (2006)
Circulating endothelial cells as a prognostic marker in thrombotic microangiopathy. Am. J. Kidney Dis. 48, 564 – 570.
Wassmann, S., Werner, N., Czech, T., and Nickenig, G. (2006) Improvement
of endothelial function by systemic transfusion of vascular progenitor cells.
Circ. Res. 99, e74 – e83.
Chen, C. H., Jiang, T., Yang, J. H., Jiang, W., Lu, J., et al. (2003) Low-density
lipoprotein in hypercholesterolemic human plasma induces vascular endothelial cell apoptosis by inhibiting fibroblast growth factor 2 transcription.
Circulation 107, 2102 – 2108.
722
[33] Xi, H., Akishita, M., Nagai, K., Yu, W., Hasegawa, H., et al. (2007) Potent free
radical scavenger, edaravone, suppresses oxidative stress-induced endothelial damage and early atherosclerosis. Atherosclerosis 191, 281 – 289.
[34] Kobayashi, N., DeLano, F. A., and Schmid-Schonbein, G. W. (2005) Oxidative stress promotes endothelial cell apoptosis and loss of microvessels in
the spontaneously hypertensive rats. Arterioscler. Thromb. Vasc. Biol. 25,
2114 – 2121.
[35] Eskes, R., Desagher, S., Antonsson, B., and Martinou, J. C. (2000) Bid induces the oligomerization and insertion of Bax into the outer mitochondrial
membrane. Mol. Cell Biol. 20, 929 – 935.
[36] Cain, K., Bratton, S. B., Langlais, C., Walker, G., Brown, D. G., et al. (2000)
Apaf-1 oligomerizes into biologically active approximately 700-kDa and
inactive approximately 1.4-MDa apoptosome complexes. J. Biol. Chem.
275, 6067 – 6070.
[37] Nakagawa, T., Zhu, H., Morishima, N., Li, E., Xu, J., et al. (2000) Caspase-12
mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature 403, 98 – 103.
[38] Won, S. J., Ki, Y. S., Chung, K. S., Choi, J. H., Bae, K. H., et al. (2010)
3alpha,23-isopropylidenedioxyolean-12-en-27-oic acid, a triterpene isolated
from Aceriphyllum rossii, induces apoptosis in human cervical cancer HeLa
cells through mitochondrial dysfunction and endoplasmic reticulum stress.
Biol. Pharm. Bull. 33, 1620 – 1626.
[39] Yang, X. H., Zheng, X., Cao, J. G., Xiang, H. L., Liu, F., et al. (2010) 8-Bromo7-methoxychrysin-induced apoptosis of hepatocellular carcinoma cells
involves ROS and JNK. World J. Gastroenterol. 16, 3385 – 3393.
[40] Woo, J. H., Kim, Y. H., Choi, Y. J., Kim, D. G., Lee, K. S., et al. (2003) Molecular mechanisms of curcumin-induced cytotoxicity: induction of apoptosis
through generation of reactive oxygen species, down-regulation of Bcl-XL
and IAP, the release of cytochrome c and inhibition of Akt. Carcinogenesis
24, 1199 – 1208.
[41] Woo, H. J., Jun, D. Y., Lee, J. Y., Woo, M. H., Yang, C. H., et al. (2011) Apoptogenic activity of 2alpha,3alpha-dihydroxyurs-12-ene-28-oic acid from Prunella vulgaris var. lilacina is mediated via mitochondria-dependent
activation of caspase cascade regulated by Bcl-2 in human acute leukemia
Jurkat T cells. J. Ethnopharmacol. 135, 626 – 635.
[42] Li, S., Dong, P., Wang, J., Zhang, J., Gu, J., et al. (2010) Icariin, a natural flavonol glycoside, induces apoptosis in human hepatoma SMMC-7721 cells via a
ROS/JNK-dependent mitochondrial pathway. Cancer Lett. 298, 222 – 230.
[43] Kakkar, P. and Singh, B. K. (2007) Mitochondria: a hub of redox activities
and cellular distress control. Mol. Cell Biochem. 305, 235 – 253.
[44] Zanotto-Filho, A., Delgado-Canedo, A., Schroder, R., Becker, M., Klamt, F.,
et al. (2010) The pharmacological NFkappaB inhibitors BAY117082 and
MG132 induce cell arrest and apoptosis in leukemia cells through ROSmitochondria pathway activation. Cancer Lett. 288, 192 – 203.
TSG Protects Huvecs By Upregulating SOD and GSH-PX