Prisila Dulcy Final Thesis

Effect of Bacopa monniera (Linn.) extract on learning
and memory in Wistar rats: the involvement of the
serotonergic system
Thesis submitted to Bharathidasan University
for the award of Doctor of Philosophy
PRISILA DULCY CHARLES
Department of Animal Science
School of Life Sciences
Bharathidasan University
Tiruchirappalli – 620 024
INDIA
October 2011
Department of Animal Science
School of Life Sciences
BHARATHIDASAN UNIVERSITY
Tiruchirappalli – 620 024. INDIA.
Dr. K. EMMANUVEL RAJAN
Assistant Professor
Email : [email protected] Tel : (+91) 431 – 2407072; 2407040, Extn : 567 Fax : (+91) 431 – 2407045
CERTIFICATE
This is to certify that this thesis entitled “Effect of Bacopa monniera (Linn.)
extract on learning and memory in Wistar rats: the involvement of the serotonergic
system”, submitted by Prisila Dulcy Charles for the degree of Philosophy to
Bharathidasan University is based on the results of studies carried out by her under my
guidance and supervision. This thesis or any part thereof has not been submitted
elsewhere for any other degree.
Place: Tiruchirappalli - 620 024
Date:
K. EMMANUVEL RAJAN
DECLARATION
I hereby declare that the work presented in this thesis has been carried out by
me under the guidance and supervision of Dr. K. Emmanuvel Rajan, Assistant Professor,
Department of Animal Science, School of Life Sciences, Bharathidasan University,
Tiruchirappalli, and this work has not been submitted elsewhere for any other degree.
Place: Tiruchirappalli - 620 024
Date:
PRISILA DULCY CHARLES
Dedicated to my beloved
Parents & Teachers
ACKNOWLEDGEMENTS
First I owe my deep sense of gratitude to the Almighty who showed his blessings in
all situations and mold me completely to finish this degree successfully.
It is an honor for me to thank my beloved guide Dr. K. Emmanuvel Rajan,
Assistant Professor, Department of Animal Science for giving me academic advice,
valuable suggestions and genuine guidance which traverse me in right path to finish my
work in stipulated time and make it fruitful.
I thank my Doctoral committee member Dr. Mrs. P. Geraldine, Professor and
Head, Department of Animal Science for giving encouragement to finish my degree
successfully.
I would like to thank Dr. Hemant K Singh, Laboratories of CNS disorder,
Learning and Memory, Division of Pharmacology, CDRI, Lucknow for his valuable
suggestions and encouragement throughout research work.
I would like to thank other faculties from Department of Animal Science
Dr. G. Archunan, Dr. R. Thirumurugan, Dr. B. Kadalmani and UGC Emeritus
Prof. Dr. Chellam Balasundaram, Prof. Dr. M.A. Akbarsha for their constant support
and encouragement throughout my studies.
It owes my deepest gratitude to my labmates Dr. S. Dharaneedharan,
A. Arul Sundari, A. Ganesh, D. Ragu Varman, J. Preethi, S. Mariappan and
A. Parkavi and for their immense help and provide better environment to complete my
work peacefully.
I would like to show my gratitude to the non-teaching staffs from Department of
Animal Science, Dr. P.R. Baskaran, V. Veeramani, B. Naserkhan, and T. Suresh for
their genuine official support and proper communication of official information in right
time.
I thank my beloved parents, and my lovable brother Antony Edelbert Charles,
and relatives for encouraging me and afford their heart whelming support in making this
compilation a magnificent experience.
Finally, I thank Bharathidasan University for supporting me through URF, and
UGC-SAP program to Dr. KER, gave me financial support to fulfill my research work.
CONTENTS
1
GENERAL INTRODUCTION
1
2
LITERATURE REVIEW
13
3
STUDY MATERIAL
27
4
CHAPTER I
Bacopa monniera extract enhance the learning ability of rats:
up-regulating tryptophan hydroxylase-2 (Tph2) and serotonin
transporter (SERT) expression
30
5
CHAPTER II
Bacopa monniera extract attenuates 1-(m-chlorophenyl)biguanide
induced
hippocampus-dependent
memory
impairment by modulating 5-HT3A receptor
6
CHAPTER III
Bacopa monniera extract attenuates the learning impairment
in aging rat’s brain induced by D-galactose by modulating the
pre- and post-synaptic proteins
87
7
SUMMARY
126
8
REFERENCES
129
ABBREVIATIONS
PUBLICATIONS
66
General Introduction
GENERAL INTRODUCTION
Learning is defined as the process of acquiring new information or skills,
whereas memory refers to the persistence of learning that can be revealed at a later time
(Squire 1987). Neurodegenerative diseases, aging, menopause, hormonal imbalance,
stress, administration of corticosteroids, accumulation of toxic heavy metal like lead
and social isolation, often affect mental performances, particularly memory processing
(Myhrer 2003).
Various strategies in different model system have been used to
understand the mechanisms underlying this unique process. Throughout the world,
behavioural neuroscientists have relied on pharmacological regulating (manipulating
neurotransmitters,
neurotransmitter
receptors
and
other
signaling
molecules)
approaches with different agonists and antagonistic drugs to understand the learning
and memory storage (von Bohlen und Halbach & Dermietzel 2006).
Memory can be divided into two phases: short-term memory (STM) that lasts
minutes to hours and long-term memory (LTM) that lasts several hours to days, weeks,
or even longer (Davis & Squire 1984; Emptage & Carew 1993; Izquierdo et al. 1998;
McGaugh 2000). Neural substrate for both STM and LTM is believed to reside in the
synaptic connections between neurons (Muller 2002). There are three main stages in
the formation and retrieval of memory.
It includes i) encoding or registration
(processing and combining of received information), ii) storage (creation of a
permanent record of the encoded information), iii) retrieval or recall (calling back the
stored information in response to some cue for use in a process or activity).
1
STM is of limited capacity and generally requires covalent modification of
pre-existing proteins by secondary messenger signaling molecules (Davis & Squire
1984; Montarolo et al. 1986; Manseau et al. 1998; Bailey et al. 1992). It includes
working, primary, active memory and resides between sensory memory, which depends
on the attention paid to the elements of sensory memory.
It is that a piece of
information is retained for less than a minute and retrieves it at the appropriate time.
There are three operations within STM that take place namely iconic, acoustic, and
working memory. Iconic is the ability of the brain to hold visual images. Acoustic is
the ability of the brain to hold sound memories. As compared to iconic, acoustic lasts
for a longer period. Working memory is the active memory. It is subject to both decay
and interference. Information can be maintained in STM if the subject of focus is
rehearsed or processed repetitively, then it can be stored for a longer period of time.
Information maintained in STM can be transferred into LTM.
LTM is a permanent record of information and apparently of unlimited capacity
requires alterations in gene expression, new protein synthesis, and the establishment of
new synaptic connections and information may enter sequentially or in parallel (Goelet
et al. 1986; Tully et al. 1994; 1996; Bailey et al. 1996). Information from working
memory is transferred to LTM in a couple of seconds. However, LTM is unlike the
working memory, as there is possibility of decay. Consolidation, a time-dependent
process of stabilization, whereby the experiences achieve a permanent record in
memory.
There are basically two types of LTM, declarative (explicit) and non-declarative
(implicit). Declarative memory is based on pairing a specific stimulus with a fact
2
(Tulving 1983; 1991; Squire et al. 1993). Declarative memory is further distinguished
as either episodic (having specific time and place references) or semantic (for facts in
isolation). The episodic type stands for memories of event and various experiences in a
successive form. Semantic is the one which records facts, concepts and skills that are
acquired throughout our lives (Milner et al. 1998). Non-declarative memories involve
information about performances, it is often acquired unconsciously.
associative or non-associative.
This may be
Non-associative learning is a most basic form of
learning and there are two well-known types: habituation and sensitization.
Habituation is a decrease in response to a benign stimulus when the stimulus is
presented repeatedly. Sensitization is the enhancement of a response to innocuous
stimuli seen after an unpleasant stimulus (Bell et al. 1995; Bear et al. 1996).
Associative learning requires pairing of two events within a short time. This includes
classical conditioning and operant conditioning (Bear et al. 1996).
Classical
conditioning, also termed Pavlovian conditioning proposed by Russian physiologist
Ivan Pavlov (1849-1936) flowed from a realization by studying the behavioural
changes in response to environmental stimuli. In this, the animals learn to associate
between one stimulus (the conditioned stimulus) and the appearance of a second that
may be rewarding or unpleasant (unconditioned stimulus) (Steinmetz et al. 2001).
Operant conditioning, a term proposed by skinner in the early 1930’s. In operant
conditioning, animals learn an association between some action (operant response) they
perform and the arrival of a stimulus which may be either rewarding (positive
reinforcement) or aversive (negative reinforcement) (Staddon & Niv 2008). Procedural
memory includes motor skills and habits. It is the capacity to acquire perceptual-motor
skills (knowledge) through physical practice and is not directly accessible to conscious
recollection as facts or data (Seger 1994; Brooks et al. 1995).
3
In animals learning and memory can only be tested operationally by recall in
which the previously learned behaviour is elicited by the appropriate stimuli.
Behavioural testing of animals allows to obtain the information about the influence of
neurotransmitters in perception, learning and memory, emotional, sexual and social
behaviour. Behaviour can be defined as an animal response to a stimulus; a stimulus
can be an endogenous signal or an environmental signal (light, sound). Behaviour
represents the ultimate output of the brain, and behavioural phenotyping may provide
functional information that may not be detectable using molecular, cellular, or
histological evaluations.
According to the World Health Organization (WHO 2001) report, mood
disorders are the second leading cause of disability in all ages. Most of the drug used to
treat the disorders has a success rate of about 60%, and therapies require several weeks
of treatment to observe signs of improvement (Wong & Licinio 2001). Despite the
advances in drug discovery and therapeutic options phytotherapy may be effective
alternatives in the treatment of various diseases, psychological disorders and has
progressed significantly in the past decade. While pharmaceutical companies continue
to invest enormous resources in identifying different targets and agents that could be
used to develop new drugs. Phytochemicals would appear to have significant benefits
and therefore several plants have been selected and research has identified a number of
natural compounds that could act as nootropic agents (Russo & Borrelli 2005).
Learning and memory is processed in different brain regions like hippocampus,
amygdala, striatum and cortex. Formation of memory requires morphological changes
of synapses. These changes are networked through external stimulus, modulation of
4
neurotransmitters and expression/suppression of associated signaling molecules
(Perez-Garcia & Meneses 2008). Neurons of the brain communicate with one another
at specialized junctions, called synapse, through the process of synaptic transmission.
The communication between neurons is extremely plastic i.e. the strength of synaptic
transmission is not fixed but can be increased or decreased and this property of synaptic
plasticity is one of the crucial processes that enable the brain to encode and retain the
learned informations (Vizi 1980; 1984; Oleskevich et al. 1989; Umbriaco et al. 1995;
Descarries et al. 1997; Vizi & Kiss 1998; Vizi 2000). Synaptic plasticity refers to the
changes in the strength of synaptic function, and this process is currently a major focus
of research on the neurobiology of learning and memory (Malenka & Nicoll 1999;
Kind 2001; Sweatt 2001). Synaptic plasticity includes both short-term changes in the
strength or efficacy of neurotransmission as well as longer-term changes in the
structure and number of synapses (Kandel 2001). Neurotransmitters are the most
common class of chemical messengers which are synthesized in neurons and perform
their action by activating specific receptors and produces different effects at the
synapse (Kalsner & Westfall 1990; Wu & Saggau 1997; von Bohlen und Halbach &
Dermietzel 2006). The release of neurotransmitters depends on the influx of Ca2+ level
in the pre-synaptic neurons, which activates the molecular machinery for exocytosis
and ultimately triggers the release of the neurotransmitters. Neurotransmitters bind at
the post-synaptic receptors and leads to conformational changes or allosteric
mechanisms to the opening of ion channels at the post-synaptic site.
The
neurotransmitters must be metabolically inactivated or cleared from the synaptic cleft
by re-uptake mechanisms after released at synaptic cleft or upon activation of their
receptors (Llinas 1977; West & Fillenz 1980; Milusheva et al. 1992; 1996; Uchihashi
et al. 1998; Nakai et al. 1999). Neurotransmitters are synthesized within the neuron in
5
brain; however, dietary precursors can influence both rate of synthesis and function of
few neurotransmitters (Anderson & Johnston 1983; Young 1996). The amino acids
tryptophan, tyrosine and phenylalanine serve as biosynthetic precursors for the
neurotransmitters serotonin (5-hydroxytryptamine, 5-HT), dopamine (DA), and
norepinephrine (NE) respectively. Single meals can influence the uptake of these
amino acids and modify their conversion to neurotransmitters (Wurtman 1988;
Fernstrom 1994).
Neurotransmitters can be subdivided into two major groups based on their
chemical structure and compositions, biogenic amines [acetylcholine (ACh), 5-HT,
DA, NE, epinephrine (Epi)] and small amino acids [γ-amino butyric acid (GABA),
glutamate (Glu), glycine (Gly)] (Berecek & Brody 1982).
Learning and memory
capacity is regulated by the balanced activity of the different neurotransmitter systems,
including 5-HT, ACh, Glu, GABA, and catecholamines. The role of neurotransmitters
have been investigated in different models, which provide considerable evidence for
variations in extracellular level of neurotransmitters influencing changes in neuronal
activity during memory formation (Gonzalez-Burgos & Feria-Velasco 2008). ACh was
the first neurotransmitter to be discovered in 1921 by Otto Loewi. Its diffusion from
the central nervous system was investigated and whose extracellular levels were
correlated to changes in neuronal activity.
ACh from the cerebral cortex and
hippocampus are always associated with motor activity, novelty and spatial memory
(Ragozzino et al. 1998; Stancampiano et al. 1999).
5-HT was discovered by Maurice M Rapport and his co-workers in 1948. It plays
a critical role in mediating STM and LTM (Byrne & Kandel 1996; Angers et al. 1998;
6
Crow et al. 2001; Barbas et al. 2002; Cohen et al. 2003; Meneses 2003) and involved in
regulation of variety of behaviours (Lucki 1998) such as food intake (Curzon 1995),
sleep (Markov & Goldman 2006), sexual behaviour (Tekes et al. 2006) and emotion
(Aloyo & Dave 2007). Inaddition, it playing a significant role in learning and memory
processing, in particular by interacting with the other neurotransmitter such as ACh,
Glu and DA (Meneses 1999). 5-HT is thought to be involved in the process of memory
consolidation following one-trial avoidance and fear conditioning which often elicits an
increase in anxiety (Inoue et al. 1993; Inoue et al. 1994; Izquierdo et al. 2006; Ji &
Suga 2007; Ogren et al. 2008).
Studies investigating the effect of stress on
long-term potentiation (LTP) have also indicated that a 5-HT has a variety of
modulatory effects on LTP depending on the learning events (e.g. stressed or
non-stressed learning) (Corradetti et al. 1992; Shakesby et al. 2002; Kojima et al. 2003;
Vouimba et al. 2006; Ryan et al. 2008).
Arvid Carlsson discovered DA and is strongly associated with reward
mechanisms in the brain. Both DA and 5-HT plays a key role in modulating synaptic
transmission in the central nervous system (CNS) (Giovanni et al. 1998). Studies in
animal models indicate that DA acting at hippocampal synapses is a necessary
precursor not only for LTP (Frey et al. 1990; Huang & Kandel 1995; Otmakhova &
Lisman 1998), but also for the behavioural persistence of LTM (O’Carroll et al. 2006;
Rossato et al. 2009; Bethus et al. 2010). Notably, in models for episodic memory,
DA-dependent facilitation of neural plasticity is evident after a single event
(Neugebauer et al. 2009). DA release in the hippocampus itself is modulated by
hippocampal activity; outputs from the hippocampus facilitate DA signaling in the
midbrain, which can enhance hippocampal plasticity (Lisman & Grace 2005). DA is
7
involved in reward or reinforcement, cognition, and in diseases such as Parkinson's
disease, mood disorders and schizophrenia.
In 1946, a Swedish biologist Ulf von Euler discovered NE. It is strongly
associated with bringing the nervous systems into "high alert." NE is prevalent in the
sympathetic nervous system, involved in several behavioural functions which includes;
appetite, sexual behaviour, fear, anxiety, pain, sleep arousal, and mood.
It has a
significant role in formation of emotional memories. Adrenal glands releases NE into
the blood stream, along with Epi. Manipulation of NE functions in specific brain
regions shortly after training is able to affect subsequent memory (Liang et al. 1995).
In the 1950s, Eugene Roberts and J. Awapara discovered GABA, is the major
inhibitory neurotransmitter of the brain, occurring in 30-40% of all synapses. The
GABA concentration in the brain is 200-1000 times greater than that of the
monoamines or ACh (Felmlee et al. 2010). GABA regulates the proliferation of neural
progenitor cells migration, differentiation, the elongation of neurites and the formation
of synapses (Ben-Ari 2002). Glu and GABA may be involved in the mechanisms of
memory by modulating the forebrain’s cholinergic pathways (Miranda 2007). Glu is
the major excitatory neurotransmitter of the brain. It is located on the cortical and
hippocampal pyramidal neurons and also throughout different subcortical regions.
Furthermore, Glu and its receptors are involved in LTM formation as well as in LTP, a
process believed to underlie learning and memory (Lynch 2004; Maren 2005).
LTP is a leading candidate for the neurophysiological substrate of learning and
memory (Barnes 1995; Maren & Baudry 1995; Mayford et al. 1995; Brown et al.
8
1988).
LTP can be modified by changes in ACh, DA, NA, and 5-HT systems
(Centonze et al. 2001; Munro et al. 2001; Ohashi et al. 2002). Notably, manipulation of
ACh activity influences learning performances (Blokland 1996), and particularly by
interaction with 5-HT (Steckler & Sahgal 1995). Information processing, storage and
retrieval of information is modulated by neurotransmitters (Myhrer 2003), and
consequent activation of specific G-protein coupled receptors (GPCRs), which mediate
suppression and repression of cellular signaling molecules (Muller 2000).
It has been demonstrated that second messenger cascades plays a critical role in
the modulation of neuronal activity and connectivity between neurons in marine
mollusk Aplysia (Mohamed et al. 2005). The cyclic adenosine monophosphate (cAMP)
coupled pathways have been implicated in mammalian learning and memory models
across the species. Studies have shown that long-term facilitation (LTF) requires both
transcription and translation (Montarolo et al. 1986; Ghirardi et al. 1995). Behavioural
studies in different animal models have demonstrated that LTM requires de novo
protein synthesis around the time of training or during the first few hours of post
training period (Bourtchouladze et al. 1998; Schafe & LeDoux 2000; Igaz et al. 2002;
Scharf et al. 2002). Regulation of the expression of several proteins, protein kinase A
(PKA), mitogen activated protein kinase (MAPK) and cyclic AMP response element
binding protein (CREB) has been associated with the learning process (Emptage &
Carew 1993; Bailey et al. 1996). Experimental evidence indicates that MAPK/extra
cellular regulatory kinase (ERK), once activated, translocates from the cytosol to the
nucleus, and activates/phosphorylates CREB (Kandel 2001). N-Methyl-D-aspartate
(NMDA) receptor activation can also activate the MAPK cascade by stimulating both
the protein kinase C (PKC) and PKA pathway, and can phosphorylate CREB directly
9
through Ca2+/calmodulin-dependent protein kinases II (CaMKII) (Roberson et al.
1999). Several other neurotransmitter receptors, including metabotropic glutamate,
muscarinic cholinergic, 5-HT, DA, and β-adrenergic receptors are coupled to MAPK
activation through PKA or PKC (Roberson et al. 1999).
CREB is involved in
regulation of variety of complex forms of memory and indicating that CREB may be a
universal modulator of processes required for memory formation (Yin et al. 1995). The
levels of induction of CREB may also be a determinant of the amount and schedule of
training required for LTM. CREB’s involvement in memory formation is not restricted
to certain forms of memory, but appears to have a much broader impact on memory
formation. Synaptic restructuring, believed to be crucial for memory formation, seems
to be dependent on CREB transcription (Bito et al. 1996; Deisseroth et al. 1996; Moore
et al. 1996). Phosphorylation of CREB at Ser133 regulates the transcriptional activity of
many immediate early genes (IEGs) (Treisman 1996; Hardingham et al. 2001; Athos
et al. 2002). Expression of IEGs has been used to map specific functions onto neuronal
activity in different areas of the brain including the hippocampus. Induction of IEGs
occurs within minutes in a transient nature, its encoded proteins may serve diverse
functions (Kubik et al. 2007). They belong to different families (Fos, Jun and Krox) of
inducible transcription factors (ITFs), which are encoded by c-fos, fra-1, fra-2, fos-B,
c-jun, jun-B, jun-D, krox-20 and zif 268 (also known as krox-24, egr-1, TIS 8, NGFI-A
or zenk). Once translated in the cytoplasm, these proteins translocate into nucleus
where they can regulate the transcription of target genes. Members of the Fos and Jun
families of ITFs can dimerize with each other to form complexes with activating
protein-1 (AP-1) (Rauscher et al. 1988; Chiu et al. 1988), or with members of other
transcription factor, such as CREB activating transcription factor (ATF) proteins (Hai
& Curran 1991). In the nervous system, the expression of several ITFs is rapidly and
10
transiently induced by a variety of stimuli, including growth factors, neurotransmitters,
peptides, depolarization, seizures, ischemia, brain injury and sensory stimulation
(Hughes & Dragunow 1995, Herrerra & Robertson 1996). Neurons are able to respond
to bursts of activity by modulating the pattern of gene expression that may affect
neuronal plasticity.
Multiple signaling pathways may trigger either rapid
phosphorylation or dephosphorylation events, which modulate the activity of
constitutively expressed transcription factors.
Activated IEGs function as transcription factors binds to regulatory elements to
activate or repress the regulatory transcription factors responsible for inducing
transcription of late response genes (LRGs) or synaptic proteins (Goelet et al. 1986;
Alberni et al. 1994; Taubenfeld et al. 2001a, b). Synaptic proteins play a critical role
during neurotransmission, synaptic structures requires continuous interaction between
the pre-synaptic and post-synaptic neuron (Zoran et al. 1991; Dan & Poo 1994). The
formation and stabilization of heterogeneous pre-synaptic structures at the active zone
requires contact with an appropriate post-synaptic target (Dan & Poo 1994; Daly & Ziff
1997).
At mature synapses, synaptic vesicles (SVs), exocytotic proteins and
voltage-dependent calcium (Ca2+) channels (VDCCs) are localized to active zones of
the pre-synaptic site to ensure effective synaptic transmission (Augustine 2001;
Atwood & Karunanithi 2002). However, VDCCs (Ahmari et al. 2000) and a number of
SV bound proteins including synaptotagmin (SYT) (Littleton et al. 1995; Daly & Ziff
1997), vesicle associated membrane protein (VAMP) synaptobrevin (Ahmari et al.
2000), synapsin (Daly & Ziff 1997) and synaptophysin (SYP) (Fletcher et al. 1991) are
found in premature synapse like terminals independent of target cell contact. CaMKII
is one of the most abundant proteins in neurons comprising 1-2% and it is an
11
oligomeric, multifunctional serine/threonine kinase. CaMKII is required for LTP in the
hippocampus and it has been suggested that it could serve as a molecular switch for
local storage of memory in individual synapses (Lisman et al. 2002). Its expression is
particularly high in the postsynaptic density (PSD), where it is ideally located to
respond to changes in calcium concentration. CaMKII appears likely to be a mediator
of primary importance in linking transient calcium signals to neuronal plasticity.
PSD-95 is one of the most abundant proteins found in the PSD of excitatory synapses
(Beique & Andrade 2003).
PSD-95, which contains multiple protein-protein
interaction domains and plays a decisive role in controlling synaptic strength and
activity dependent synaptic plasticity (Migaud et al. 1998).
Tremendous progress through the years indicates that the activation of patterns
of gene expression is organized in cascades, whereby transcription factors regulate the
expression of IEGs, underlies long-term synaptic plasticity and LTM formation (Goelet
et al. 1986; Bailey et al. 1996; Klann & Sweatt 2008). A large body of experimental
evidence suggests a functional significance of ITFs for processes involved in learning
and consolidation of a long-term memory. Nootropic drugs possibly either interacts
with neurotransmitter system or other neurotrophic factors and activate positively or
negatively the secondary signalling molecules involved in learning and memory
formation.
12
Literature Review
LITERATURE REVIEW
Learning is the process of acquiring knowledge about the world and memory is
the process by which that acquired knowledge is encoded, stored and later retrieved
(Kandel et al. 2000). Learning and memory are based on modifications of synaptic
strength between and among neurons that are simultaneously active. Memory is a
highly complex process that involves several brain structures as well as the role of
several neurotransmitters. McDonald & White (1993) indicated that different aspects
of experience and behaviour are encoded in parallel by many different circuits in the
brain.
Although there are many neurotransmitter systems in the brain, clinical
neuroscience is highly focused on monoamines [DA, NA and 5-HT], ACh and Glu.
These neurotransmitters have been linked to cognitive processes such as attention and
learning (Winkler et al. 1995; Tang et al. 1999). In recent times, several studies
highlighted the importance of plant based drugs, which contribute to modern
therapeutics (Das et al. 2002; Hsieh et al. 2006; Kimani & Nyongesa 2008). Number of
natural compounds has identified from several plants that could act as nootropic agents
(Russo & Borrelli 2005). Substantial work has been carried out to identify the principle
compounds enhancing learning and memory (Satyan et al. 1998). A study by Iyer et al.
(1998) showed that extract of Lawsonia inermis (Mehendi) leaves possess significant
nootropic effect, modulated the level of 5-HT and NA but not DA.
Polyherbal
formulation BR-16A (Mentat) has been shown to augment acquisition and retention of
learning in rats, as well as in states of cognitive deficits (Bhattacharya 1994; Faruqi
1995; Handu & Bhargava 1997). Trasina, a polyherbal formulation, exerts a significant
nootropic effect in models of Alzheimer’s disease induced by intra-cerebroventricular
13
(i.c.v.) injection of colchicine or lesioning by ibotenic acid (Bhattacharya & Kumar
1997).
Bacopa monniera Linn., commonly called as Brahmi, has been traditionally
used by Ayurvedic medical practitioners in India and was classified as a
medhyarasayana, a drug used to improve memory and intellect (medhya) (Russo &
Borrelli 2005). B. monniera leaf extract contains various active alkaloids such as
nicotine, brahmine and herpestine, and triterpenoid saponins such as bacoside A and B
(Chatterji et al. 1963, 1965; Kulshreshtha & Rastogi 1973, 1974; Chandel et al. 1977).
Later, several other saponin compounds such as bacopaside I, II, III, IV and V were
identified (Chakravarty et al. 2001, 2003). B. monniera significantly ameliorated the
rate of acquisition, consolidation and retention in albino rats during foot-shock
motivated brightness discrimination task (Singh & Dhawan 1982). It also attenuated
the retrograde amnesia induced by immobilisation induced stress, electroconvulsive
shock and scopolamine (Singh & Dhawan 1997). B. monniera has a protective effect
against phenytoin-induced cognitive deficit in mice during acquisition and retention
(Vohora et al. 2000). It also reversed the cognitive deficits induced by colchicine and
ibotenic acid as well as reversed the level of ACh (Bhattacharya et al. 2000).
Furthermore, B. monniera treatment enhances the free radical scavenging enzymes in
hippocampus, frontal cortex, and striatum of adult rats suggesting a possible
antioxidant effect (Bhattacharya et al. 2000; Chowdhuri et al. 2002), which protect the
brain under adverse conditions of stress by modulating the activities of heat-shock
protein (HSP70), cytochrome (CYP450) and superoxide dismutase (SOD) (Chowdhuri
et al. 2002).
The extract having the capacity to scavenge superoxide anion and
hydroxyl radical as well as reduced the hydrogen peroxide induced cytotoxicity and
14
DNA damage (Seiss 1993; Tripathi et al. 1996; Rai et al. 2003).
Earlier studies
demonstrated an adaptogenic activity, where it reversed acute and chronic stress
induced changes (Rai et al. 2003), and anti-convulsive activity (Russo & Borrelli
2005). B. monniera induced learning and memory enhancement is attributed to a
combination of cholinergic modulation (Das et al. 2002; Kishore & Singh 2005;
Holcomb et al. 2006; Dhanasekaran et al. 2007) and antioxidant effects (Singh & Singh
1980; Bhattacharya et al. 2000; Vijayan & Helen 2007). In addition, Sheikh et al.
(2007) reported that acute stress induced serotonin level was normalized by
pre-treatment with B. monniera extract. B. monniera reverses the 5-HT2C receptor
mediated motor dysfunction in epileptic rats by reducing 5-HT content, 5-HT2C
receptor binding and gene expression in hippocampus (Paulose et al. 2008). Diazepaminduced anterograde amnesia in mice (Prabhakar et al. 2008) as well as spatial memory
deficit in Alzheimer’s rat model (Uabundit et al. 2010) was also adding support to the
earlier reports.
It also alter the glutamate receptor binding and NMDA R1 gene
expression in epileptic rats (Khan et al. 2008), reducing hypobaric hypoxia induced
spatial memory impairment (Hota et al. 2009) and attenuate the Nω-nitro-L-arginine
(L-NNA) induced amnesia (Saraf et al. 2009). B. monnieri and bacoside A treatment
prevents the occurrence of seizures in pilocarpine-induced epileptic rats there by
reducing the impairment on peripheral nervous system (Mathew et al. 2011).
According to Prisila et al. (2011) B. monniera extract treatment enhanced the learning
ability and retention, by regulating the expression of tryptophan hydroxylase 2 (Tph2),
5-HT synthesis and its transporter. Recently, Emmanuvel Rajan et al. (2011) reported
that B. monniera enhances hippocampus-dependent learning by possibly modulating
the 5-HT3A receptor.
15
Attention and engagement is essential for learning, which is gated by various
neuromodulatory mechanisms in the brain. Modulation of neurotransmitters affects
different signaling pathways, they are implicated in learning and memory. A strong
correlation exists between age-related physiological and psychiatric disorders and brain
neurotransmitters concentrations according to several studies, which have reported that
brain neurotransmitter levels reduced in association with aging (Brizee 1975;
Burchinsky 1985; Santiago et al. 1988; Morgan & May 1990). In the central nervous
system neurotransmitters such as DA, 5-HT and NE are involved in basic physiological
and behavioural functions (Greengard 2001; Marien et al. 2004). LTP is a leading
candidate for the neurophysiological substrate of learning and memory (Brown et al.
1988). LTP can be affected by changes in ACh, DA, NA, and 5-HT systems (Centonze
et al. 2001; Munro et al. 2001; Ohashi et al. 2002). The manipulation of cholinergic
activity influences cognitive performance (Blokland 1996), and ACh is particularly
influential in interaction with 5-HT (Steckler & Sahgal 1995). DA appears to be
involved in spatial learning, whereas NE does not seem to be involved (McNamara &
Skelton 1993). Among them, 5-HT is considered to be involved in regulation of
diverse physiological processes such as sleep-wake cycle, motor activity, feeding,
nociception and thermoregulation (Jacobs & Azmitia 1992; Struder & Weicker 2001)
and variety of brain functions such as control of mood, aggression, anxiety, pain,
learning and memory, and sexual behaviour (Buhot 1997; Mann 1999; Lovinger 1999;
Gainetdinov et al. 1999). Study indicated that 5-HT is connected to pathophysiology of
disorders including major depression, schizophrenia and obsessive-compulsive disorder
(Dutton & Barnes 2008). Memory performance with the systems extracellular 5-HT
level analysis revealed that depletion of tryptophan and manipulation of 5-HT receptors
16
relatively affects memory formation (Schiapparelli et al. 2005, van der Veen et al.
2006).
Impaired or altered 5-HT neurotransmission appears to be a central dysfunction
leading to affective states such as depression and anxiety (Kahn et al. 1988a, b; Graeff
et al. 1996; Mann 1999), irregular appetite, aggression and pain sensation (Mann 1999)
and impairs memory encoding (Khaliq et al. 2006). 5-HT released into the synapse acts
on pre- and post-synaptic receptors which mediate different signaling pathway. The
cell surface transporters like dopamine transporter (DAT), serotonin transporter
(SERT), and the norepinephrine transporter (NET) plays a key role in the reuptake or
rapid clearance of the released monoamines into the pre-synaptic nerve terminals
(Amara & Kuhar 1993; Torres et al. 2003a, b; Blakely et al. 1994). A study by
Quartermain et al. (1988) suggested that monoamine neurotransmitter systems
substantially influence memory formation.
Monoamine transporters belonging to
Na+/Cl- dependent transporters determine intensity and duration of signal at synapses
(Hersch et al. 1997; Nelson 1998).
Manipulation of monoamine transporters are known to contribute for
imbalancing monoaminergic transmission and thereby triggering the pathologic process
of several neuropsychological disorders such as depression, bipolar disorder, drug
addiction, schizophrenia and stroke (Jayanthi & Ramamoorthy 2005). 5-HT and DA
transmission declined during aging because of decreased 5-HT and DA turnover in the
striatum and other limbic regions (Meek et al. 1977; Carfagna et al. 1985; Machado
et al. 1986; Roubein et al. 1986; Moretti et al. 1987; Venero et al. 1991). Research
indicates a combined effect of inefficient phosphorylation and oxidative damage of
17
TrpH enzyme may be responsible for lower TrpH activity in aging brain.
Such
alterations in TrpH activity may reduce the level of 5-HT in brain, which may be linked
to late-life depression and other brain disorders, such as Alzheimer and Parkinson
diseases (Hussain & Mitra 2000). Reduced level of 5-HT and NE and their metabolites
was observed in cortex, hippocampus and hypothalamus of aged rats (Birthelmer et al.
2003; Tsunemi et al. 2005).
Despite the fact that duration and intensity of the 5-HT neurotransmission at the
synaptic cleft is controlled by the high affinity SERT (Amara & Kuhar 1993) located
presynaptically on 5‐HT neurons (Blakely et al. 1991; Blakely 2001). Notably, most of
the 5-HT neuron cell body was found to be positive for SERT immunoreactivity in the
hind brain region (Fujita et al. 1993). SERT plays a vital role within the 5-HT system,
limiting 5-HT neurotransmission by removing the neurotransmitter through transport
across the presynaptic membrane (Rudnick & Clark 1993; Torres et al. 2003b).
Extended to this, SERT knockout model exhibited depressive or despair-like states
(Zhao et al. 2006).
5-HT has been shown to involve in regulation of different physiological and
mental functions, which act through their diverse receptors located in the CNS (Barnes
& Sharp 1999; Hoyer et al. 2002). So far, 15 subtype receptors (5-HT1A, 5-HT1B/1D,
5-HT1E, 5-HT1F, 5-HT2A/2B/2C, 5-HT3A/3B/3C, 5-HT4A/4B, 5-HT5A/5B, 5-HT6, and 5-HT7)
were identified and their specific role not yet investigated in detail (Raymond et al.
2001; Hoyer et al. 2002). They belong to the G-protein coupled receptor (GPCR), with
the exception of the 5-HT3, which is a ligand-gated ion channel (Macdonald & Olsen
1994; Karlin 2002; Reeves & Lummis 2002; Lester et al. 2004). 5-HT system includes
18
receptors (5-HT1, 5-HT4, 5-HT5, 5-HT6, 5-HT7) that inhibit or stimulate adenylate
cyclase and (5-HT2) receptor stimulates phospholipase C (Hoyer et al. 1994; Barnes &
Sharp 1999; Hoyer et al. 2002). In addition, 5-HT is known to interact with other
neurotransmitter systems, through their receptors particularly with cholinergic (Buhot
et al. 2000; Meneses 2002; 2003) and dopaminergic systems (Buhot et al. 2000).
Age-related decline in post-synaptic 5-HT receptors has been demonstrated in vivo and
assumed to be related to changes in psychological functions in the normal aging
(Yamamoto et al. 2002).
Behavioural study coupled with central or systemic
administration of drugs to activate or inactivate specific 5-HT receptors enable to
understand the relationship of specific receptor to the defined cognitive functions
(Meneses 2003).
The activation of 5-HT1A receptor has been shown to impair performance in a
delayed conditional discrimination task (Herremans et al. 1995). The post-synaptic
5-HT1A receptor has been reported to be involved in the consolidation of memory for
inhibitory avoidance in rats (Mello e Souza et al. 2001) and its blockade resulted in
efficient retention of spatial working memory and non-spatial reference memory by
facilitating the ACh release (Millan et al. 2004). Mice lacking 5-HT1A receptor exhibit
impaired hippocampal-dependent spatial learning and other functional abnormalities
(Sarnyai et al. 2000). 5-HT1A receptor stimulation impaired retention performance in
passive avoidance (PA) learning task (Misane & Ogren 2000; Meneses 2003). The
activation of 5-HT1B receptor through specific agonist CP 93129 preferentially
reference memory (Buhot et al. 1995). These opposite results underline the numerous
functional properties of the two receptors, in particular their specific cellular and
subcellular locations in the hippocampus (Consolo et al. 1996). A study reported the
19
effects of 5-HT2A/2C agonist and antagonist on associative learning or conditioned
avoidance response (Harvey 1996), which can be manipulated further to develop as
therapeutic tools in the treatment of certain memory deficits. The 5-HT2A receptor
plays a significant role in both psychotic and cognitive symptoms of illness indicating
its importance as a therapeutic target for schizophrenia (Roth et al. 2004; Terry et al.
2004). MDL 100907, a selective 5-HT2A antagonist attenuated the cognitive effect
induced by NMDA receptor antagonist (MK-801) (Carlsson et al. 1999), and has shown
to interact with PSD-95, which is involved in anchoring NMDA receptor (Xia et al.
2003).
5-HT3 heteroreceptor modulated the activity of several neurotransmitters,
including cholinergic and glutaminergic system (Ramirez et al. 1996; Aghajanian et al.
1990).
The 5-HT3 receptor antagonists have been shown to induce learning and
memory improvement or to reverse the effect of anticholinergic ligand or age-induced
memory loss in rodents and primates (Barnes et al. 1990).
Compared to
phenylbiguanide/2-methyl-5-HT, 1-(m-chlorophenyl)-biguanide (mCPBG) agonist is
selective and more active (Hoyer et al. 1994). Preclinical studies reported that mCPBG
impaired consolidation of learning, whereas tropisetron and ondansetron improved
performance, and reversed the effect induced by mCPBG (Meneses & Hong 1997;
Meneses 1998). Overexpression of 5-HT3 receptor in mouse forebrain resulted in
enhanced hippocampal-dependent learning and attention (Harrell & Allan 2003).
Expression of 5-HT4 receptor in the limbic system emphasized their role in different
mental function (Lai et al. 2005; Pritchard et al. 2007). Induction of 5-HT4 receptor
may increase the release of ACh in the frontal cortex (Eglen et al. 1995) and the
extracellular level of 5-HT in the hippocampus (Ge et al. 1996). Supporting to that
20
5-HT4 receptor agonist (RS67333) enhanced acquisition and consolidation of spatial
memory (Orsetti et al. 2003) as well as reduced the memory deficits induced by
atropine, scopolamine and 5-HT4 antagonists (Bockaert et al. 2004). Similarly, the
selective
5-HT6
antagonist
(Ro
04-6790)
induced
strengthening
of
ACh
neurotransmission and an improvement of spatial memory (Rogers & Hagan 2001).
The repeated administration of selective 5-HT6 receptor antagonist (SB-399885) fully
reversed the scopolamine-induced deficits in novel object recognition as well as spatial
learning in aged rats (Hirst et al. 2006). Different neurochemical studies indicated that
5-HT6 receptor antagonists enhanced memory consolidation involving DA, Glu and
ACh neurotransmission (Dawson et al. 2001; 2003; Reimer et al. 2003). The 5-HT7
receptor is said to be involved in modulating learning and memory (Cifariello et al.
2008).
5-HT7 receptor knockout mice showed impairment in contextual fear
conditioning (hippocampus-dependent task) and exhibits decreased long-term synaptic
plasticity within the CA1 region of the hippocampus (Roberts et al. 2004). Other
electrophysiological studies indicated that 5-HT7 receptor activation modulated the
excitability and intracellular signaling of pyramidal neurons in the CA1 region of the
hippocampus (Tokarski et al. 2003).
Earlier study indicating that learning evoked changes are accompanied by
alterations in gene expression, this also influenced by neurotransmitters, and their
receptors and growth factors (Roberson et al. 1999). Manipulations with protein and
RNA synthesis inhibitors suggested that experience-dependent alterations in gene
expression within neurons may be required for the formation of LTM (Glassman 1969;
Barondes 1970; Davis & Squire 1984). An early step in such inducible neuronal gene
expression is the activation of constitutively expressed regulatory transcription factors,
21
such as CREB and its phosphorylation mediated by activated kinases (Montminy et al.
1990; Sheng et al. 1990; Armstrong & Montminy 1993; Arias et al. 1994; Vallejo &
Habener 1994; Ghosh & Greenberg 1995; Deisseroth et al. 1996). Subsequent studies
found that CREB acts as a universal modulator in memory formation which involved in
synaptic activity dependent formation of LTM (Dash et al. 1990; Bourtchuladze et al.
1994; Yin et al. 1994; Bartsch et al. 1998; Yin et al. 1995; Balschun et al. 2003).
CREB is an activity-dependent transcription factor that is activated by phosphorylation
at Ser133 by the cAMP/PKA signalling, growth factor signalling, a Ca2+/calmodulindependent, and a MAP kinase regulated pathway (Lonze & Ginty 2002),
phosphorylated CREB promotes the transcription of target genes (Mayr & Montminy
2001; Lonze & Ginty 2002). Much work has focused on the role of CREB in memory
storage and synaptic plasticity (Silva et al. 1998).
Synaptic neurotransmission is regulated by all vesicle trafficking events, such as
function of SVs, exocytotic proteins and VDCCs localized to active zones of the
pre-synaptic (Augustine 2001; Atwood & Karunanithi 2002). Development of mature
synaptic structures requires continuous interaction between the pre-synaptic and
post-synaptic neuron (Zoran et al. 1991; Dan & Poo 1994). Formation and stabilization
of heterogeneous pre-synaptic structures at the active zone requires contact with an
appropriate post-synaptic target (Dan & Poo 1994; Daly & Ziff 1997). Number of
vesicle proteins and membrane proteins, such as VDCCs (Ahmari et al. 2000),
SV bound proteins including SYT (Littleton et al. 1995; Daly & Ziff 1997), VAMP,
synaptobrevin (Ahmari et al. 2000), synapsin (Daly & Ziff 1997) and SYP (Fletcher
et al. 1991), soluble N-ethylmaleimide sensitive fusion attachment receptor (SNARE)
proteins such as syntaxin and synaptosomal associated protein (SNAP) (Littleton et al.
22
1995) are found to actively involved in the process. The release of neurotransmitters
by calcium triggered synaptic vesicle exocytosis is a key event in interneuronal
communication.
During exocytosis synaptic vesicles first docks at pre-synaptic
membrane called active zones and then undergo priming reactions which leave them in
a release-ready state (Sudhof 2004). The release of neurotransmitters is triggered when
an action potential causes opening of calcium channels, and controlled by complex
intracellular membrane protein (Lin & Scheller 2000; Jahn 2003; Sudhof 2004;
Brunger 2005).
Membrane proteins syntaxin 1 and SNAP-25, and the synaptic vesicle protein
synaptobrevin 2 are members of the SNARE family, which are believed to be involved
in membrane fusion. In aged rats, the ability to sustain LTP is impaired, glutamate
release was found to be decreased accompanied with a reduction in the synthesis of
SYP (McGahon et al. 1997). Antonova et al. (2001) have shown that potentiation in
cultured hippocampal neurons is accompanied by a rapid and long-lasting increase in
the number of clusters of pre-synaptic protein SYP.
Potentiation involves rapid
co-ordinated changes in the distribution of proteins in the pre-synaptic neuron as well
as the post-synaptic neuron. SYP immunoreactivity increased in the thalamus of rats
after motor training, which possibly correlated with an increased synaptic plasticity
(Ding et al. 2002).
Similarly, Ishibashi (2002) reported that repeated whisker
stimulation in rats induced expression of SYP mRNA in contralateral barrel cortex,
suggesting that SYP is involved in modulation of synaptic plasticity. SYP is associated
with plasticity related changes in hippocampus (Holahan et al. 2006; Sun et al. 2007),
as well as in age-associated impairment (Smith et al. 2000; King & Arendash 2002).
23
SYT form a large family of C2 domain containing proteins with seven members
in Drosophila and 19 members in mammals (Adolfsen & Littleton 2001; Craxton
2001). SYT1 is the most abundant Ca2+ binding protein present on synaptic vesicles
and accounts for 7% of total vesicle protein (Perin et al. 1990; Chapman & Jahn 1994).
SYT is characterized by a pair of calcium binding motifs the cytosolic C2 domains,
homologous to those originally described in protein kinase C (Nishizuka 1988).
Calcium binds with SYT and phospholipids (Davletov & Sudhof 1993) and interacts
with a variety of other presynaptic molecules. Biochemical studies have demonstrated
that calcium dependent interactions with SYT suggesting that it may couple calcium
influx to vesicle fusion. SYT also binds phospholipids in a calcium dependent manner
through lipid interactions with both C2 domains (Brose et al. 1992; Chapman & Jahn
1994; Davis et al. 1999; Earles et al. 2001; Fernandez et al. 2001). Knockout mice
lacking SYT have greatly reduced synchronous transmitter release following neuronal
stimulation (Geppert et al. 1994). Knock in mice with a mutated SYT that has a 2-fold
reduction in calcium dependent phospholipid binding by the C2A domain and displays
50% reduction in evoked release (Fernandez-Chacon et al. 2001).
According to
Wu et al. (2008) aging is associated with a significant decline in the level of SYT
expression in hippocampus, which impaired their spatial memory task.
CaMKII is one of the most abundant proteins in neurons comprising 1-2% and
it is an oligomeric, multifunctional serine/threonine kinase.
It is expressed
pre-synaptically and post-synaptically, but its expression is particularly high in the
PSD, where it is ideally located to respond to changes in calcium concentration. There
are more than 30 isoforms of CaMKII and numerous substrates, many of which are
located in the PSD (Fink & Meyer 2002). CaMKII appears likely to be a mediator of
24
primary importance in linking transient calcium signals to neuronal plasticity.
Activation of CaMKII occurs as a result of autophosphorylation at Thr286, and it has
recently been shown that if CaMKII is mutated the autophosphorylation is prevented
(Giese et al. 1998). Moreover, the activation of CaMKII results in autophosphorylation
leading to persistent autonomous activity of the enzyme.
Activated CaMKII
translocates to PSD (Shen & Meyer 1999), where it is assumed to exert its action by
driving the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) type of
glutamate receptors to synapse (Hayashi et al. 2000).
Phosphorylation of AMPA
receptor subunits (Barria et al. 1997) causes an increase in current flux through the
receptor channel and this leads to enhancement of synaptic response (Derkach et al.
1999). The requirement of CaMKII in induction phase of LTP was confirmed by
pharmacological inactivation of CaMKII (Malinow et al. 1989) and the transgenic
elimination of its subunit (Silva et al. 1992; Stevens et al. 1994).
Consequently,
induction of LTP increases the level of CaMKII mRNA (Thomas et al. 1994) and
protein (Ouyang et al. 1999). The level of CaMKII autophosphorylation (Fukunaga
et al. 1995; Ouyang et al. 1997) and activity (Fukunaga et al. 1993) is also increased
after LTP induction by phosphorylating many PSD proteins in both the presence and
absence of calcium.
Potential substrates are various glutamate receptors, synaptic
GTPase activating protein (SynGAP), and post-synaptic density protein-95 (PSD-95)
and synapse associated protein-97 (SAP-97). The level of CaMKII in the PSD can
affect LTP and hippocampal dependent learning (Yamauchi 2005). Consequently, an
alteration in αCaMKII activity in hippocampus is correlated with age-related cognitive
deterioration, deficient synaptic plasticity and spatial learning (Giese et al. 1998;
Ahmed & Frey, 2005; Zhang et al. 2009).
25
PSD-95 is one of the most abundant proteins found in the PSD of excitatory
synapses (Beique & Andrade 2003). PSD-95, which contains multiple protein-protein
interaction domains, has been implicated in memory formation (Migaud et al. 1998).
PSD-95, also known as synapse-associated protein-90 (SAP-90), is initially identified
based on its abundance in the isolated PSD (Cho et al. 1992; Kistner et al. 1993).
PSD-95 is composed of five protein interaction domains: three PSD-95/Dlg/ZO-1
(PDZ) domains, a Src homology 3 (SH3) domain and a guanylate kinase (GK) domain
(Sheng & Pak 2000). It directly interacts with NMDA receptor subunits and is reported
to be important in NMDA-receptor clustering (Kornau et al. 1995; Neithammer et al.
1996).
Suppression of PSD-95 expression attenuated excitotoxicity produced via
NMDA receptor activity in brain neurons (Sattler et al. 1999) as well as PSD-95
enhanced NMDAR clustering at synapses (Kim et al. 1996). Aging is accompanied by
a decline in the PSD proteins which leads to impairment in organizing signaling
complexes interactions with ion channels, membrane receptors, cytoskeletal
components at the PSD (Garner et al. 2000; Nicholson et al. 2004). Thus, PSD-95
protein plays a decisive role in controlling synaptic strength and activity dependent
synaptic plasticity.
26
Study Material
STUDY MATERIAL
Kingdom
:
Plantae
Phylum
:
Magnoliophyta
Class
:
Magnoliopsida
Subclass
:
Asteridae
Order
:
Scrophulariales
Family
:
Scrophulariaceae
Genus
:
Bacopa
Species
:
monniera
27
Bacopa monniera (Linn.) (syn: Lysimachia monniera; Monniera cunefolia;
Herpestis monniera) belongs to the Scrophulariaceae family and is commonly known
as “Brahmi” (Chunekar 1960). The genus Bacopa includes over 100 species and is
distributed widely in the tropical regions of the world (Barrett & Strother 1978).
B. monniera is a small creeping herb with numerous branches, stems are prostrate,
succulent and herbaceous with the length of 10 to 30 cm. Leaves are fleshy with
0.5-2.5 cm long and 0.2-1 cm wide, arranged opposite to each other on the stem
(Chunekar 1960; Satyavati et al. 1976). Flowers (0.6-3.2 cm long) are solitary and the
colour ranging from white to pale blue or violet, radially symmetrical, borne in leaf
axils on slender pedicels. Fruits (5mm long) are ovoid, acute, included in the persistant
calyx and seeds are oblong with pale-brown coloured (Mathew 1984). B. monniera
known to grow under different soil and climate conditions but optimal temperature is
30-40 ºC and humidity is 65-80% (Ghosh et al. 2008).
It is commonly found
throughout Indian subcontinents, Nepal, Sri Lanka, China, Taiwan, Vietnam, and also
found in Florida, Hawaii and other southern states of United States of America.
B. monniera has been classified under medhyarasayana, i.e., medicinal plants
rejuvenating intellect and memory (medhya). The ancient classical Ayurvedic treatises,
viz., Charak samhita (6th century A.D.), Susrutu samhita, and Astanga hrdaya, have
prescribed B. monniera to improve memory, intelligence, and general performance (Rai
et al. 2003; Russo & Borrelli 2005). B. monniera contains many active compounds
which are: alkaloids (brahmine and herpestine), saponins (d-mannitol and hersaponin,
acid A, and monnierin), and flavonoids (luteolin and apigenin) (Bose & Bose 1931;
Chopra et al. 1956; Sastri et al. 1959). The principle components responsible for
memory enhancing effect are bacoside A and bacoside B (Chatterji et al. 1963; 1965).
28
In addition, betulic acid, stigmasterol, beta-sitosterol, bacopaside I, II, III, IV, V, X, N1,
N2 and bacopasaponin A, B, C, D, E, F and G were identified (Garay et al. 1996a, b;
Chakravarty et al. 2001; 2003; Hou et al. 2002). Several reports have authenticated the
traditional cognitive-enhancing property of B. monniera in different animal models
(Singh et al. 1988; Singh & Dhawan 1982; 1992; 1997). The lethal dose (LD50) of
alcoholic crude extract of B. monniera given orally was 17 g/kg and aqueous extract at
a dose of 5 g/kg did not showed any toxicity. The LD50 of aqueous and alcoholic crude
extract of B. monniera in rat is 1000 mg/kg and 15 g/kg by intraperitoneal route (Martis
et al. 1992). Pharmacological and toxicological studies demonstrate that B. monniera is
well tolerated without any side effects (Singh & Dhawan 1997; Russo & Borrelli 2005).
In this study, Wistar rat’s (Rattus norvegicus) were used as study animal to gain insight
into the effect of B. monniera leaf extract on learning and memory.
All animal
experiments were performed under the guidelines of Institutional Animal Ethics
Committee (IAEC/BDU/13/2009-10), Bharathidasan University, Tiruchirappalli and
adequate measures were taken to minimize pain or discomfort with animal
experimental procedure.
29
Chapter I
Bacopa monniera extract enhance the learning ability of rats: up-regulating
tryptophan hydroxylase-2 (Tph2) and serotonin transporter (SERT)
expression
INTRODUCTION
Ayurveda, an alternative system of medicine in India, uses a number of plants
for the treatment of a variety of diseases. The ancient classical ayurvedic treatment has
classified many plants under Medhya rasayana, i.e., medicinal plants rejuvenating
intellect and memory (Rai et al. 2003). Several studies tested the in vivo efficacy of
plant extracts to identify biologically active compounds that could act as nootropic
agents (Khalifa 2001; Rai et al. 2001; Das et al. 2002; Achliya et al. 2004; Mohandas
Rao et al. 2005; Russo & Borrelli 2005; Zhao et al. 2006; Kimani & Nyongesa 2008).
Behavioural and biochemical evaluations demonstrated that the plant extracts have the
potential to act on the CNS and mediate neuromodulatory effects.
Bacopa monniera Linn. (Family: Scrophulariaceae), commonly known as
Brahmi, is a creeping herb with bitter taste found in marshy areas in India (Chunekar
1960; Satyavati et al. 1976). It has been used in the Indian system of Ayurvedic
medicine to enhance cognitive function (Russo & Borrelli 2005). B. monniera leaf
extract contain various active alkaloids such as nicotine, brahmine and herpestine, and
triterpenoid saponins such as bacoside A and B (Chatterji et al. 1963; 1965; Schulte
et al. 1972; Kulshreshtha & Rastogi 1973; 1974; Chandel et al. 1977). Subsequently,
several other saponin compounds such as bacopaside I, II, III, IV and V as well as
bacopasaponin C were identified (Chakravarty et al. 2001; 2003). It has been tested for
its neuropharmacological effects like anxiolytic (Singh & Singh 1980), learning and
memory (Singh & Dhawan 1997), and anti-depressant (Sairam et al. 2002). Earlier
study reported that the ethanolic extract of B. monniera enhances the learning and
retention in rats (Singh & Dhawan 1982; 1992; Singh et al. 1988; Vollala et al. 2010).
It has been reported that B. monniera increases the 5-HT level thereby enhancing the
30
learning ability and memory retention in rats (Singh & Dhawan 1997). It also alter the
glutamate receptor binding and NMDA R1 gene expression in epileptic rats (Khan et al.
2008), reducing hypobaric hypoxia induced spatial memory impairment (Hota et al.
2009) and attenuate the Nω-nitro-L-arginine (L-NNA) induced amnesia (Saraf et al.
2009). Furthermore, therapeutic effect of B. monniera treatment has been demonstrated
as neuroprotective effect against the cholinergic degeneration (Uabundit et al. 2010),
reversing diazepam (Saraf et al. 2008; Prabhakar et al. 2008) and scopolamine-induced
memory deficit (Zhou et al. 2009; Saraf et al. 2010).
Neurotransmitters such as DA, 5-HT and NE are involved in basic
physiological, behavioural and endocrine functions (Greengard 2001). Among them,
5-HT is involved in regulation of many physiological processes such as sleep-wake
cycle, motor activity, feeding, nociception and thermoregulation (Jacobs & Azmitia
1992; Struder & Weicker 2001) and a variety of brain functions such as control of
mood, aggression, anxiety, pain, learning and memory, and sexual behaviour (Buhot
1997; Mann 1999; Lovinger 1999; Gainetdinov et al. 1999). Many studies correlated
the memory performance with the systems extracellular 5-HT level, and demonstrated
that depletion of tryptophan and manipulation of 5-HT receptors affect the memory
formation (Schiapparelli et al. 2005; van der Veen et al. 2006).
In the CNS, serotonergic neurons localized as clusters within the raphe nuclei;
the caudal group neurons direct their axons to spinal cord and the rostral group
neuronal axons innervate almost all regions of brain. Biosynthesis of 5-HT is regulated
by the rate-limiting enzyme tryptophan hydroxylase (Tph) (Kim et al. 2002). There are
two forms of Tph; Tph1 is expressed in gut, pineal gland, spleen and thymus, which are
31
responsible for most peripheral 5-HT, whereas Tph2 is neuronal specific which
predominates in brain stem and involved in central 5-HT synthesis (Cote et al. 2003;
Walther & Bader 2003). Chamas and co-workers (1999) indicate that elevation of Tph
expression leads to an enhancement of Tph activity and 5-HT synthesis. 5-HT is
synthesized in 5-HT neuronal cell body, most of which are found to be positive for
SERT immunoreactivity (Fujita et al. 1993). Clearance of synaptic and extra-synaptic
5-HT is the principal function of SERT, and this process involves regulation of SERT
gene transcription-translation (Neumaier et al. 1996; Morikawa et al. 1998; Mossner
et al. 2001).
Altered SERT expression is implicated for multiple forms of
psychopathology, including schizophrenia and drug addiction; therefore, SERT has
become a potential therapeutic target for behavioural disorders (Zhao et al. 2006).
In addition, there is a paucity of data concerning the detailed mechanisms
behind the nootropic action of B. monniera, unraveling the bearings between the
behavioural and molecular events. Although a number of studies have explored the
various pharmacological activities of B. monniera, very little is known about its
interaction with serotonergic system. To gain more insight, the present study designed
to examine the interaction of B. monniera extract (BME) with serotonergic system
during different phases of learning and memory.
32
MATERIALS AND METHODS
1.2.1 Animals
Postnatal day (PND)-14 Wistar rat pups were housed in rectangular
polypropylene cages (43 x 27 x 15 cm). Paddy husk was used as bedding material
which was replaced once in two days. The animals had access to commercial standard
rodent chow and fresh water ad libitum. The animals were maintained under standard
12:12 h light-dark conditions, constant temperature (22 ± 1 ºC), and 60% relative
humidity.
The experiments were conducted between 10:00 h and 17:30 h in a
semi-soundproof laboratory.
1.2.2 Plant material and extraction method
B. monniera plant was collected from the wild, Tiruchirappalli (10º48’10.39”N;
78º41’55.40”E), Tamilnadu, India and was taxonomically identified and authenticated
by Rapinat Herbarium, St Josephs college, Tiruchirappalli, India and the specimen is
preserved in the herbarium (specimen voucher No. RHT 63872). The shade-dried and
powdered leaves of B. monniera were weighed and soaked in water for 24 h. Water
was discarded and the residual plant material was extracted thrice with ethanol (95%)
by maceration (Phrompittayarat et al. 2007) (Figure 1.1). The obtained BME filtrates
was pooled and then evaporated to dryness using a rotary evaporator (Buchi Rotavapor,
Switzerland) under reduced pressure.
33
B. monniera leaves
Dried and powdered
Soaked for 24 h in 300 ml of double distilled water
Water squeezed and plant material soaked in 200 ml of 95% ethanol for 72 h at RT
(MACERATION)
Extract filtered through Whatman No.1 filter paper
Residue obtained was extracted twice using the same procedure
Filtrate combined and evaporated to dryness under reduced pressure with rotary
evaporator
Figure 1.1 Standardized procedure to extract bacosides from B. monniera leaves.
34
1.2.3 Identification of bacoside – Thin Layer Chromatography (TLC)
The presence of bacoside was initially determined using thin layer
chromatography (TLC). First the TLC plate (60F.sub.254, Silica gel, Merck) was
activated by incubating at 100 ºC for 1 h. TLC chamber was saturated for 1 h with
mobile phase containing in the composition of ethyl acetate: methanol: distilled water
(60: 14: 10). Standardized bacoside BESEB CDRI-08 (M/s Lumen Marketing Co.,
Chennai) along with the sample of BME (5.0 mg) was dissolved in 2 ml methanol and
each 2 µl was applied on TLC plates and run in mobile phase. The plate was developed
to a height of 8 cm and the spots were visualized with the help of developing agent
(vanillin: sulphuric acid: ethyl acetate = 1g: 5 ml: 5 ml) followed incubating plates at
110 ºC for 15 min.
1.2.4 HPLC analysis of BME
Sample preparation
BME (500 mg) was dissolved in 50 ml of methanol, sonicated for 10-15
minutes, cooled, made up to 100 ml with methanol, and filtered through a 0.45 µ
membrane filter prior to injection into the chromatographic system.
Instrumentation
The presence of bacoside was determined using Shimadzu HPLC system
equipped with a SPD-M10 AVP photodiode array detector (PDA) Deepak et al. (2005).
The mobile phase consists of A-0.25% orthophosphoric acid in water and
B-acetonitrile.
The analysis took 45 min and the column oven temperature was
maintained at 25 °C. The combination of mobile phase A/B at different times was as
35
follows: at 0.00 min 75/25, at 25.00 min 60/40, at 35.00 min 40/60, at 38.00 min 75/25
and 45 min 75/25. The flow rate was 1.5 ml/min and the injection volume was 25.0 µl.
Separations were monitored at the wavelength of 205 nm and peak identities were
established by comparing the HPLC retention time with the reference compound.
Concentration of the bacosides was calculated using the formula described earlier
(Muthumary & Sashirekha 2007; Tiwari et al. 2010). The analysis repeated three times
to confirm the presence of compound in the extract.
1.2.5 Dose selection
A pilot study was conducted to establish the optimal dose of BME by evaluating
behaviour and toxicity. Rat pups aged PND-14 were randomly divided into four
groups as follows: (1) control (0.5% gum acacia + double distilled water) (n = 8);
(2) BME group I (20 mg/kg + 0.5% gum acacia) (n = 8); (3) BME group II
(30 mg/kg + 0.5% gum acacia) (n = 8); BME group III (40 mg/kg + 0.5% gum acacia)
(n = 8). During the brain growth spurt period (PND-15 to 29) (Mohandas Rao et al.
2005) the freshly prepared aqueous suspension was orally administered to the rats
everyday (10:00 – 11:00 h). Detailed experimental procedure adopted to select the
optimal dose shown in Figure 1.2.
36
Wistar rats
(Rattus norvegicus)
Postnatal day (PND) - 14
Control
(0.5 % gum acacia)
BME treated
(20, 30 and 40 mg/kg BME)
15 days - Oral
administration
PND – 15 to 29
(Behavioural analysis)
Y-maze
Exploration (PND-30 & 31)
Learning (PND-32 to 37)
Figure 1.2 Schematic representation of experimental method
37
1.2.6 Bioassay of BME uptake
On PND-14 the pups were randomly divided into three groups control (n = 6),
BME (n = 6) and positive control (n = 6). From PND-15 to 29, rats were treated
accordingly. Two hours after the treatment on PND-29, the rats were sacrificed by
decapitation and blood samples were collected, and processed following the Sakuma
et al. (1987) procedure. The supernatant was transferred to a fresh micro centrifuge
tube and a 20 µl volume was injected in to the HPLC column (Torrance, CA, USA).
Standard was prepared with the concentration of 1 mg/ml in methanol and the working
concentration was prepared from the standard with methanol in the ratio of 1:20. The
standard and sample solutions were filtered through 0.45 µm syringe filter.
The
separation was performed using a Shimadzu HPLC (Japan) system under the operating
conditions described earlier (Deepak et al. 2005).
1.2.7 Y-maze test
Y-maze apparatus consists of a start box, a stem (27.5 cm long) and the two
arms forming the arms of “Y” (both 27.5 cm long and diverging at 60º angle from the
stem). The arms are 5 cm width and 40 cm height, and each arm has a goal area
containing a food-well. The apparatus was designed with specifications described in
Van der Borght et al. (2007). The stem and start box of the Y-maze are separated with
a sliding door, which can be operated manually from the experimenter’s position and is
kept in a dimly lit, semi-sound proof room. The floor of the maze was covered with
husk, which was changed after each trial, in order to eliminate the olfactory stimuli.
The rat pups were randomly divided into control (n = 60) and BME (n = 60).
Following the BME administration, both group rats were allowed to explore the
38
Y-maze for five minutes prior to the training period on PND-30 and 31. Subsequently,
the acquisition test was conducted daily from PND-32 to 37, two trials per day. Each
rat was placed in the start box then the sliding door was released slowly after 20 sec.
Rats were allowed to move freely in the maze that leads to the goal area having the
food pellet by blocking the other arm that does not have the food pellet. Eight days
after the acquisition test, on PND-46, rats were subjected to memory test for eight days
(PND-46 to 53). In each trial, individual’s performance was recorded as number of
correct responses and latency to reach the food during the 5 min time.
1.2.8 Treatment schedule
PND-14 rat pups were randomly divided into three groups control (n = 6), BME
(n = 6) and positive control (n = 6). From PND-15 to 29, the control group rats
received 0.5% gum acacia, BME group rats received BME (40 mg/kg + 0.5% gum
acacia) and positive control group received bacoside A (12.52 mg/kg + 0.5% gum
acacia) by oral gavage using a ball ended feeding needle. Freshly prepared aqueous
suspension will be provided every day (10:00 h to 11:00 h) during the growth spurt
period (PND-15 to 29) (Mohandas Rao et al. 2005). Schematic representation of
experimental method is shown in Figure 1.3.
39
Wistar rats
(Rattus norvegicus)
Postnatal day (PND) - 14
Positive Control
BME group
Negative Control
15 days - Oral
administration
of BME
PND – 15 to 29
(Behavioral analysis)
Hindbrain tissue
Sacrificed at different phases
of behavioral test
Y-maze
(PND-29, PND-37, PND-45, PND-53)
Hole-board Passive avoidance
Exploration
PND-30 & 31
PND-30
PND-30
Learning
PND-32 to 37
PND-31
PND-31
Inter-experimental period
PND-38 to 45
24 hours
24 hours
Memory
Neurotransmitter
analysis
Expression pattern
(Tph2 & SERT)
PND-46 to 53
PND-32
5-HT
DA
ACh
Glu
Figure 1.3 Schematic representation of experimental method
40
PND-32
1.2.9 Behavioural test
Control and BME group rats were subjected to behavioural tests (Y-maze,
hole-board and passive avoidance test) to assess their learning ability and retention of
memory. Food restriction maintained as a motivation to animals at 80-85% of their
ad libitum (Toth & Gardiner 2000).
All behavioural tests were conducted by an
investigator who was uninformed about the subject’s treatment.
1.2.10 Hole-board test
Hole-board apparatus was made up of a square wooden box (50 x 50 x 50 cm)
with four holes (3 cm diameter) at each corner. The apparatus was constructed based
on the specifications described by Saitoh et al. (2006). The apparatus was placed on a
turntable so that it could be rotated between trials during acquisition and retention.
Each rat was randomly assigned to a baited hole that remained the same for the rat
throughout testing. Rats allowed to learn the location of a baited hole in a single trial
and a retention test was conducted after 24 h.
Control (n = 12) and BME (n = 12) group rats were subjected to acquisition
session on PND-31; ten trials were given to each individual per session. Each trial
began by placing a rat into an opaque plastic start tube (open at both ends) positioned at
the center of the board. The tube was slowly removed, and the duration of each trial
was 3 min. During the trials, the animal allowed to explore the apparatus poking the
head into the hole to retrieve the food. The floor of the hole-board was cleaned of urine
and feces between trials. Retention test was conducted 24 hours after the acquisition on
PND-32. The protocol used during retention test was the same as that used during
41
acquisition. In each test the latency to reach the baited hole during the three minutes
test time was recorded.
1.2.11 Passive avoidance test
Passive avoidance (PA) task was a modification of Bures et al. (1983). The
training procedure is based on the innate preference of rodents for the dark chamber of
the apparatus.
Exposure to inescapable shock in the dark chamber results in
suppression of this innate preference which serves as a measure of learning.
Rat pups were randomly divided into two groups as follows: control (n = 12)
and BME (n = 12) group. The apparatus consists of two compartments, separated by a
retractable guillotine door (6 × 6 cm); large illuminated safe compartment
(50 × 50 × 35 cm, with 25 W electric bulb) and smaller dark compartment (15 × 15 cm)
with an electrifiable grid.
On PND-30, rat pups representing each group were
individually placed in the safe compartment and allowed to explore chambers for
3 min. On PND-31, rat pups were individually placed in the safe compartment, the
guillotine door was opened after 30 sec and the animal was allowed to enter the dark
compartment. Nine trials were given to each rat with 5 min of inter trial interval,
during the tenth trial, after the rat stepped completely with all its four paws into the
dark compartment, a mild inescapable foot shock (0.5 mA, 2 sec duration) was
delivered from the grid floor. Latency to enter the dark compartment was recorded for
each trial. At the end of the each trial, the rat was returned to its home cage. On
PND-32, rat pups from each group individually placed in the safe compartment with
door closed for 5 sec, and then the guillotine door was opened and allowed to enter the
42
dark compartment. The latency to enter the dark compartment was recorded and used
as a measure of retention.
1.2.12 Neurotransmitter analysis
Rats were decapitated and hindbrain was rapidly removed over dry ice and wet
tissue weighed.
The tissue was homogenized in ice-cold perchloric acid (0.1 M)
containing reduced glutathione (1.6 mM) and Na2-EDTA (4.5 mM). The homogenates
were centrifuged at 12, 000 rpm at 15,777 x g for 20 min at 4 °C; the supernatant was
aspirated, filtered in a 0.22 μm membrane filter (Pall Life Sciences, Ann Arbor, MI,
USA) and stored at −80 °C until analysis. On PND-29, control (n = 6), BME (n = 6)
and positive control (n = 6) group level of different neurotransmitters 5-HT (EIA kit,
BioSource Europe S.A., Belgium), DA, Glu (EIA kit R&D Systems, MN, USA) and
ACh (Biodivision, CA, USA) was estimated from the homogenate respectively
according to the manufacturer’s instructions. In addition, 5-HT level was estimated
from animals representing each group (control and BME) at different phases of Y-maze
test: on PND-14 before BME treatment (n = 6), on PND-29 after BME treatment
(n = 6), after testing the learning ability on PND-37 (n = 6), and after the retention test
on PND-53 (n = 6).
1.2.13 Expression of Tph2 and SERT
Preparation of samples
The level of Tph2 and SERT mRNA expression in hindbrain was determined
from six animals representing each group (control and BME) before BME treatment on
PND-14 and at different phases of Y-maze test after the BME treatment on PND-29,
43
after testing learning ability on PND-37 and after the retention test on PND-53. Each
rat was sacrificed by cervical dislocation, the whole brain was dissected out and
hindbrain was rapidly removed over dry ice. Total RNA was isolated from hindbrain
tissue by using RNeasy Mini Kit (Qiagen, GmbH, Germany), according to the
manufacturer’s instructions. Total RNA was eluted in RNase free water containing
RNase inhibitor (1U/μl; Rnasin, Promega, Madison, USA). The concentration of RNA
was quantified by measuring the absorbance at 260 nm in a spectrophotometer (Optima
Inc, Japan).
Semi-quantitative RT-PCR
Total RNA (2.0 μg/sample) was reverse-transcribed using the AccessQuickTM
RT-PCR system (Promega, Madison, USA). First-strand cDNA was synthesized using
AMV reverse transcriptase in accordance with the manufacturer’s instructions. To
quantify the level of Tph2 and SERT expression, the semi quantitative RT-PCR method
was adopted. The degree of expression of the given genes was established by dividing
the amount of Tph2/SERT mRNA expression by the amount of β-actin mRNA
expression (Beaulieu et al. 2008). Specific primers were designed for Tph2, SERT, and
β-actin to amplify and estimate the level of expression (Table 1.1). Amplification
commenced with initial denaturation at 94 ºC for 2 min, followed by denaturing at
94 ºC for 45 sec, annealing for Tph2 (58 ºC for 45 sec), for SERT (55 ºC for 45 sec),
extension at 72 ºC for 45 sec, then final extension at 72 ºC for 10 min (MJ Mini
Gradient Thermal Cycler, Bio-Rad).
44
Table 1.1 Specific primers were designed and used to examine the expression pattern
of genes using semi-quantitative RT-PCR.
S. No.
Gene
Ta
(ºC)
Size
(bp)
Source
(Genbank
accession number)
1.
Tph2
58 ºC
648
NM_173839.2
For 5' ATGCAGCCCGCAATGATGAT 3'
Rev 5' ACAACACCCCAAGTTTTAGT 3'
2.
SERT
55 ºC
676
NM_013031.1
For 5' ATGGCCCTGAGCGATCTGGT 3'
Rev 5' TCCCCACAAACTCATAGAGCA 3'
3.
β-actin
55 ºC
350
AB004047
For 5' CATCCAGGCTGTGCTGTCCCT 3'
Rev 5' TGCCAATAGTGATGACCTGGC 3'
Ta – primer annealing temperature.
45
Primer Sequences
For semi-quantitative measurements, we amplified the Tph2/SERT with β-actin
and optimized the number of PCR cycles (27, 30, or 33 cycles) to maintain
amplification within a linear range. 20 μl of each PCR product was electrophoresed on
agarose (1.0% w/v) gel containing ethidium bromide (0.5 μg/ml).
Images of the amplified products were acquired with a Molecular Imager
ChemiDoc XRS system (Bio-Rad, USA) and the intensity was quantified using image
analysis software (Quantity one, Bio-Rad, USA). Band intensity was expressed as the
relative peak density; Tph2/β-actin and SERT/β-actin product ratios were calculated as
indices of Tph2 and SERT mRNA expression.
1.2.14 Statistical analysis
Data were expressed as the mean ± standard error of mean (SEM) and plotted
with KyPlot (ver 1.0) for graphical representation.
The results were statistically
evaluated using one way ANOVA in SigmaStat (ver 3.1). Differences were considered
significant if P < 0.05.
46
RESULTS
1.3.1 Thin Layer Chromatography (TLC)
The presence of bacoside in the B. monniera extract was analysed by TLC.
Retention factor (Rf) values indicate the presence of bacosides in the BME and it was
further confirmed by comparing the Rf of the commercially available pure bacoside
(Figure 1.4).
1.3.2 HPLC chromatogram of BME
B. monniera leaf ethanol extraction yield 11.87% of crude extract.
Crude
extract was subjected to HPLC analysis and composition of bacosides present in the
extract was identified by comparing their retention times with those of the standard
bacoside mixture.
The characterized B. monniera leaf extract contained 31.27%
bacosides, i.e. (1) bacopaside I (0.9%), (2) bacoside A3 (9.47%), (3) bacopaside II
(17.15%), (4) jujubogenin of bacopasaponin C (0.38%) and (5) bacopasaponin C
(3.37%) (Figure 1.5).
1.3.3 Uptake of BME
HPLC analysis demonstrated that the major marker compound bacoside A is
present in the serum after BME oral treatment on PND-29. The HPLC analysis revealed
that the serum of BME treated rats contained 75.0 µg/ml of bacoside A and the pure
bacoside A treated rats contained 109.0 µg/ml (Figure 1.6).
47
Rf = 0.95
Rf = 0.82
Rf = 0.66
Rf = 0.57
Rf = 0.18
L1
L2
Figure 1.4 TLC showing the presence of bacosides. Retention factor (Rf) indicates
the presence of bacosides in the (L2) Bacopa monniera extract (BME) and
(L1) standard bacoside (BESEB CDRI-08).
48
Figure 1.5 HPLC overlaid chromatogram of B. monniera extract (BME) along with
bacoside A and bacoside standard mix. Peaks were identified as follows
based on retention time: (1) Bacopaside I (2) Bacoside A3 (3) Bacopaside
II (4) Bacopasaponin C isomer (5) Bacopasaponin C.
49
Figure 1.6 HPLC analysis evidenced the uptake of bacoside A into the system, when
the rat pups were orally treated with BME from PND-15 to 29.
(A) Standard bacoside A (B) Pups treated with pure bacoside A (C) Pups
treated with BME (D) Pups treated with 0.5% gum acacia.
50
1.3.4 Dose selection
The rats treated with BME showed a dose-dependent enhancement in learning
and decreased latency towards reward in Y-maze test (Figure 1.7). BME group I
(20 mg/kg) rats showed 52.4% correct arm visits and BME group II (30 mg/kg) rats
showed 60.4% correct arm visits. When BME group I and II rat’s latency were
compared with control, there was no significant difference [20 mg/kg, F
(1, 94)
= 0.05,
P = 0.82; 30 mg/kg, F
(1, 94)
= 0.243, P = 0.624]. BME group III (40 mg/kg) rats
showed significantly [F
(1, 94)
= 11.46, P < 0.001] less latency with 87.5% correct arm
visits than the control group. Since, the BME (20 and 30 mg/kg) dose did not produce
any significant effect in learning, only 40 mg/kg dose was used for further comparative
analysis.
1.3.5 Y-maze test
Individual performance on Y-maze is shown in Figure 1.8. During learning,
BME treated group rats showed significantly less [F (1, 382) = 137.78, P < 0.001] latency
with high percentage of correct arm visits than the control group. Similarly, when the
retention of memory was tested, BME received rats exhibited significantly less latency
[F
(1, 510)
= 85.24, P < 0.001] and high percentage of correct arm visits than control.
These results suggest that BME significantly improves learning and retention of
memory.
51
(A)
(B)
Figure 1.7 Administration of BME from PND-15 to 29 BME showed a dosedependent enhancement in learning and decreased latency in Y-maze test.
(A) number of correct arm visits (B) latency to retrieve the reward. Values
expressed in mean ± SEM; *** P < 0.001.
52
(A)
(B)
Figure 1.8 Administration of BME from PND-15 to 29 enhances learning and
memory in Y-maze. (A) number of correct arm visits (B) latency to
retrieve reward during learning and retention. Values expressed in
mean ± SEM; ** P < 0.01, *** P < 0.001.
53
1.3.6 Hole-board test
BME treatment significantly reduced [F
(1, 238)
= 22.135, P < 0.001] latency
compared to control on PND-31 during acquisition in hole-board.
Similarly,
significantly [F (1, 238) = 22.82, P < 0.001] less latency was recorded for the BME group
compared to control during the retention test on PND-32 (Figure 1.9).
1.3.7 Passive avoidance test
Results of passive avoidance test in exploration and retention of memory are
shown in Figure 1.10. During exploration, there was no significant difference
[F
(1, 238)
= 1.334, P = 0.249] between animals treated with BME and control group.
Interestingly, during retention test animals treated with BME did not show preference
to enter the dark compartment, and their recorded latency was significantly higher
[F (1, 238) = 223.74, P < 0.001] than control.
1.3.8 Level of neurotransmitters
Level of neurotransmitters was estimated in the hindbrain by ELISA following
treatment with BME. The analysis revealed that continuous treatment of BME from
PND-15 to 29 resulted elevation in levels of 5-HT, ACh and Glu, and reduced the level
of DA.
[F
(1, 10)
Rats received BME showed significant increase in 5-HT level
= 591.12, P < 0.001] when compared to control. Similarly, ACh level was
increased in BME treated rats and positive control rats compared to control rats. The
estimated variation was not significantly different between BME and control
[F (1, 10) = 3.407, P = 0.139].
54
Figure 1.9 Effect of BME on hole-board test performance in acquisition and retention.
Values expressed in mean ± SEM; *** P < 0.001.
55
Figure 1.10 Transfer latency to enter the dark compartment in passive avoidance task.
Values expressed in mean ± SEM; *** P < 0.001.
56
However, significant difference was found between positive control and control
[F (1, 10) = 12.190, P = 0.025].
Likewise, estimated Glu level was higher in BME treated and positive control
rats compared to control.
[control vs BME: F
F
(1, 10)
However, the variations was not significantly different
(1, 10)
= 3.407, P = 0.139; control vs positive control:
= 0.623, P = 0.513] between groups. In contrast, DA level was decreased in
BME received and positive control rats compared to control. The estimated variations
was significantly different [control vs BME: F
positive control: F
(1, 10)
(1, 10)
= 20.31, P < 0.05; control vs
= 117.76, P < 0.05] between groups. The 5-HT levels on
PND-29 did not differ between the BME and the positive control [F
(1, 10)
= 1.729,
P = 0.28] (Figure 1.11). We also analyzed the 5-HT level at different phases of
Y-maze test. On PND-29 and PND-37, 5-HT level was significantly higher
[F
(1, 10)
= 205.05, P < 0.001] in BME group than control. However, the estimated
significant difference in 5-HT levels [F (1, 10) = 1.029, P = 0.334] did not extended up to
PND-53 (Figure 1.12).
1.3.9 Expression of Tph2 and SERT
Effect of BME on serotonergic system was evaluated by estimating the expression
level of Tph2 and SERT mRNA. In BME group, a significant increase [F
(1, 10)
=
1176.073, P < 0.001] in Tph2 mRNA level was estimated on PND-29 (Figure 1.13)
compared to control, the trend continued upto PND-37 [F
(1, 10)
= 129.989, P < 0.001].
On PND-53 the level of Tph2 mRNA did not differ significantly [F
P = 0.106] between the BME and control group.
57
(1, 10)
= 3.157,
Figure 1.11 Effect of Bacoside and BME treatment during PND 14-29 on the level of
5-HT in hindbrain. Values expressed in mean ± SEM; *** P < 0.001.
58
Figure 1.12 Estimated level of 5-HT during different phases of behavioural study.
Values expressed in mean ± SEM; *** P < 0.001.
59
(A)
(B)
Figure 1.13 Semi-quantitative RT-PCR analysis shows expression pattern of (A) Tph2
mRNA during different phases of behavioural study, (B) Estimated level
of Tph2 expression. Values expressed in mean ± SEM; *** P < 0.001.
60
To explore whether the enhancement of 5-HT induce SERT expression; the
level of SERT mRNA was estimated. As shown in Figure 1.14, corresponding to Tph2
expression, similar expression pattern in SERT mRNA level was observed in the BME
group. The level of SERT mRNA expression was higher in BME group than control on
PND-29 [F
(1, 10)
= 284.671, P < 0.001] as well as on PND-37 [F
(1, 10)
= 22.748,
P < 0.001]. However, the estimated level of SERT mRNA expression revealed no clear
significant difference on PND-53 [F
(1, 10)
= 3.213, P = 0.103] between BME and
control group.
Taken together the behavioural, biochemical and expression analyses suggest
that BME treatment enhances the learning ability and memory, possibly through
modulating serotonin synthesis by up-regulating the expression of Tph2 and SERT.
61
(A)
(B)
Figure 1.14 Semi-quantitative RT-PCR analysis shows differential expression of
SERT, (A) expression pattern of SERT during different phases of
behavioural study, (B) Estimated level of SERT expression. Values
expressed in mean ± SEM; *** P < 0.001.
62
DISCUSSION
Effect of BME on neurotransmitter mediated learning and memory was
investigated, BME (40 mg/kg) was orally provided to the postnatal rats for fifteen days
(PND-15 to 29) during brain growth spurt period. The observed behavioural responses
in Y-maze, hole-board and passive avoidance test showed that BME treated rats
performed significantly higher than control group rats during acquisition and retention.
It does clearly indicate that oral administration of BME has enhanced the learning and
memory of rats and it was supported by earlier reports (Singh & Dhawan 1997; Vollala
et al. 2010). HPLC analysis showed the presence of bioactive compound in the serum
of BME treated rats, which demonstrated the uptake of BME into the system. To the
best of our knowledge, this is the first report on the determination of major biologically
active compound bacoside A in the serum after oral administration of BME.
Earlier studies have indicated that monoamine transmitters are essential to
mediate many physiological functions involved in behaviour, cognition, affection, and
emotion as well as neuroendocrine secretion (Mann 1999; Marien et al. 2004), and the
monoamine transporters determine the neurotransmitters intensity and duration of
signal at synapses (Hersch et al. 1997; Nelson 1998). The balanced function of various
neurotransmitters such as ACh, 5-HT (Reis et al. 2009), GABA (Kant et al. 1996) and
Glu (Saraf et al. 2009) were all reported to involve in the regulation of memory
formation. Among monoamine neurotransmitters, 5-HT is considered to be involved in
diverse physiological and behavioural regulations such as mood, sleep, aggression,
cognition, memory, and feeding, as well as depression (Dutton & Barnes 2008).
However, data on the effects of drugs based on 5-HT in learning and memory in
experimental systems from Aplysia to human, explains the role of 5-HT (Barbas et al.
63
2002; Meyer et al. 2009). It has been reported that the BME treatment increased the
level of 5-HT in hippocampus, hypothalamus and cerebral cortex (Sheikh et al. 2007),
and also modified the ACh concentration directly/indirectly through other
neurotransmitter systems. The observed effect of BME on learning and memory could
be directly or indirectly associated with serotonergic system, such as 5-HT metabolism,
release, transportation and action on its receptors. In the present study, the level of
5-HT significantly up-regulated after BME treatment, ACh level was altered and DA
level was reduced. These observations concluded that the bioactive compounds in
BME possibly influence 5-HT synthesis. The elevated 5-HT level possibly activates
their receptor, which may facilitate the release of ACh (Consolo et al. 1994). Notably,
on the other hand the inhibitory effects of cholinesterase activity of B. monniera also
alter the ACh level and enhance memory (Das et al. 2002; Joshi & Parle 2006). The
decreased cholinesterase activity might reduce the DA level and excess ACh turnover
which also possibly enhance the memory (Das et al. 2005). After the administration of
BME for a period of 15 days (PND-15 to 29), 5-HT level increased significantly, and
then attained basal level. However, the observed trend in the 5-HT level had drawn the
attention to examine the effect of BME on 5-HT system. Earlier study reported that
acute stress-induced 5-HT level is normalized by pre-treatment of BME (Sheikh et al.
2007), and that would be regulation of 5-HT level possibly by the negative feedback
mechanism of Tph2 (Fujino et al. 2002; Mo et al. 2008).
Since the Tph2 modulates the synthesis of 5-HT (Zhang et al. 2004), in order to
gain insight into the activation of BME in 5-HT metabolism, the expression pattern of
Tph2 was analysed. The semi-quantitative RT-PCR analysis revealed that the
expression pattern of Tph2 is similar to that of the pattern of 5-HT level.
The
increasing level of Tph mRNA expression elevated Tph2 activity and 5-HT
64
metabolism, which profoundly could influence the synaptic 5-HT activity (Chamas
et al. 1999). In addition, SERT plays a key role in clearance of the released 5-HT
through transport across pre-synaptic membrane (Gainetdinov & Caron 2003). Several
clinically used antidepressant drugs act on the binding site of SERT and modulate the
extracellular level of 5-HT (Tatsumi et al. 1997). These influences paved way to
investigate whether BME treatment up-regulated SERT to increase 5-HT reuptake, it
provide the clue to examine the level of SERT expression. The obtained expression
pattern was similar to Tph2 expression in accordance to the age and treatment. The
up-regulated SERT expression could regulate the reuptake of released 5-HT, and could
control the duration and intensity of signals at the synapse. The enhanced level of
5-HT possibly activated the signaling pathway that could interact with MAPK/ERK,
which leading to the phosphorylation of CREB1 (Michael et al. 1998; Fioravante et al.
2006). Following treatment of B.
monniera enhanced MAPK, PKA and
phosphorylation of CREB has also been reported recently (Saraf et al. 2010). Taken
together the behavioural, biochemical and expression of the present investigations, it is
suggested that BME treatment enhances the learning ability and memory, possibly
through modulating 5-HT synthesis and its transportation.
The present study demonstrates that bioactive compound present in ethanolic
extract of B. monniera enhances learning and retention of memory. The enhancement
of learning and memory possibly due the activation of serotonergic system, the
up-regulated Tph2 expression positively enhance the synthesis of 5-HT while the
up-regulated SERT expression could effectively transport 5-HT and regulate the
signaling pathway.
65
Chapter II
Bacopa monniera extract attenuates 1-(m-chlorophenyl)-biguanide induced
hippocampus-dependent memory impairment by modulating
5-HT3A receptor
INTRODUCTION
Bacopa monniera has been classified as a reputed nootropic plant in the Indian
traditional medical system of Ayurveda (Russo & Borrelli 2005). It has been found to
enhance several aspects of mental functions and learning in animal models (Singh &
Dhawan 1982; 1997; Das et al. 2002; Uabundit et al. 2010; Vollala et al. 2010).
Preliminary study indicated that a neuropharmacological effect of Bacopa was due to
two active saponin glycosides, bacoside A and B (Singh et al. 1988). A subsequent
study has found that Bacopa provides protection from phenytoin-induced cognitive
impairments (Vohora et al. 2000). It has been postulated that its anti-epileptic effect
could be mediated through Glu, NMDAR1 (Khan et al. 2008) and GABA receptor
(Mathew et al. 2011), yet another study suggested that Bacopa extract reduced
hypobaric hypoxia induced spatial memory impairment (Hota et al. 2009).
Furthermore, the efficacy of a Bacopa extract in learning and memory have been
further established by showing the reversal of diazepam (Prabhakar et al. 2008) and
scopolamine-induced amnesia (Zhou et al. 2009; Saraf et al. 2010) and neuroprotective
effect against cholinergic degeneration (Uabundit et al. 2010). Recent studies revealed
the downstream mechanism of a Bacopa extract during reversal of scopolamine and
L-NNA induced amnesia (Saraf et al. 2009; Anand et al. 2010).
The role of 5-HT in learning and memory has been of great interest in
neuroscience; it plays a critical role in mediating STM and LTM (Byrne & Kandel
1996; Angers et al. 1998; Crow et al. 2001; Cohen et al. 2003; Meneses 2003) by
interacting with other neurotransmitter systems through their receptors (Meneses 1999).
5-HT exerts its effects through seven (5-HT1 to 5-HT7) subclasses of receptors (Hoyer
66
et al. 1994; 2002). Among them 5-HT3 is the only ligand-gated ion channel, primarily
present on the pre-synaptic terminals (MacDermott et al. 1999; Khakh & Henderson
2000; van Hooft & Vijverberg 2000) and involved in the pre-synaptic regulation of
other neurotransmitter such as NE, GABA, ACh and DA (Matsumoto et al. 1995;
McMahon & Kauer 1997; Giovannini et al. 1998; Allan et al. 2001). 5-HT3 receptor
mRNA have been found in abundance in the brain stem, fore brain, amygdala and
hippocampus (Morales et al. 1996; Harrell & Allan 2003), which is up-regulated in
hippocampus after PA task (D’Agata & Cavallaro 2003; Cavallaro 2008).
Administration of 5-HT3A receptor selective and active agonist 1-(m-chlorophenyl)biguanide (mCPBG) impaired learning (Kilpatrick et al. 1990; Hong & Meneses 1996;
Meneses 2007), while treatment with antagonist improved learning and memory (Hong
& Meneses 1996). Earlier studies have also demonstrated that 5-HT receptors are
either negatively or positively coupled with activation of adenylate cyclase (AC) and
cAMP (Marinissen & Gutkind 2001; Kroeze et al. 2002). Activation of cAMP initiates
activation of other molecules involved in memory formation by facilitating/hindering
protein synthesis (Kandel 2001; Korzus 2003). Recently, Prisila et al. (2011) reported
that administration of BME extract in postnatal rats elevated the 5-HT level by up
regulating Tph2 and SERT expressions, and also modulated ACh and Glu levels, which
influenced learning and memory. In light of this observation, this experiment was
designed to evaluate how the 5-HT receptors response to hippocampal endogenous
5-HT level and its influence on other neurotransmitters during hippocampus-dependent
learning.
67
MATERIALS AND METHODS
2.2.1 Animal and drugs
Wistar rat pups were housed in a rectangular polypropylene cage
(43 × 27 × 15 cm) with paddy husk as a bedding material. Rat pups were maintained
under a standard 12 h light and dark cycle at a constant temperature (22 ± 2 ºC) with
ad libitum access to food and water. Experiments were conducted between 10:00 h and
17:30 h in a semi-sound proof laboratory under controlled humidity (50-60%) and
temperature (22 ± 2 oC). BME was dissolved in double distilled water with 0.5% gum
acacia.
1-(m-chlorophenyl)-biguanide (mCPBG) (Sigma-Aldrich, Bangalore, India)
was dissolved in saline. Drugs were prepared freshly every day (10:00 h to 11:00 h)
before administration.
2.2.2 Groups and treatment schedule
In order to study the effect of BME on hippocampus-dependent task, BME was
administered from PND-15 to 29, during brain growth spurt period (Mohandas Rao
et al. 2005).
Male and female pups on PND-14 were divided into five groups:
(1) Control untrained group (CUT, n = 6) received vehicle solution [0.5% gum acacia,
oral and 30 min after saline by intraperitoneal (i.p)] and maintained in their home cage
without PA training, (2) Control trained group (CT, n = 18) received vehicle solutions
(0.5% gum acacia, oral and 30 min after saline, i.p) and were trained in PA task,
(3) BME group (n =18) received BME (oral) and saline (i.p.) 30 min after BME
treatment, (4) mCPBG group (n =18) received equal diluents of vehicle solution (0.5%
gum acacia, oral) and mCPBG (10 mg/kg, i.p.), (5) mCPBG and BME group (n = 18)
68
received BME (oral) and mCPBG (10 mg/kg, i.p.) 30 min after BME treatment.
Schematic representation of experimental method is shown in Figure 2.1. The mCPBG
(10 mg/kg) concentration was selected by examining the behaviour after treatment with
different concentrations (1, 5, 10 mg/kg) as reported earlier (Hong & Meneses 1996;
Meneses 2007).
2.2.3 Behavioural analysis
Passive avoidance task
PA task was a modification of Bures et al. (1983); and it is a hippocampusdependent task (Stubley-Weatherly et al. 1996).
PA task has several advantages
compared with multisession tasks, and has a clearly defined compartment of the test
box. The training procedure is based on the innate preference of rodents for the dark
chamber of the apparatus. Exposure to inescapable shock in the dark chamber results
in suppression of this innate preference which serves as a measure of learning. The
area in which the rat receives shock provides the cues for the contextual reference
memory via classical fear-conditioning (Misane & Ogren 2000).
The apparatus
consists of two compartments, separated by a retractable guillotine door (6 × 6 cm);
large illuminated safe compartment (50 × 50 × 35 cm, with 25 W electric bulb) and
smaller dark compartment (15 × 15 cm) with an electrifiable grid. On PND-30, rat
pups representing each group (except untrained control group) were individually placed
in the safe compartment and allowed to explore chambers for 3 min. On PND-31, rat
pups were individually placed in the safe compartment, the guillotine door was opened
after 30 sec and the animal was allowed to enter the dark compartment.
69
Wistar rats
(Rattus norvegicus)
Postnatal day (PND) - 14
Control
Untrained
Control
Trained
BME
mCPBG + BME
mCPBG
PND – 15 to 29
15 days Oral
administration
(Behavioral analysis)
Passive avoidance task
Exploration
(PND-30)
Hippocampus
Sacrificed after 24 hours
Learning
(PND-31)
Inter-experimental
period
24 hours
Memory
(PND-32)
Neurotransmitter analysis
(5-HT, DA, ACh, Glu &
GABA)
Expression pattern
(5-HT1A, 5-HT2A, 5-HT3A,
5-HT4, 5-HT5A, 5-HT6 & 5-HT7)
Figure 2.1 Schematic representation of experimental method.
70
Nine trials were given to each rat with 5 min of inter trial interval, during the tenth trial,
after the rat stepped completely with all its four paws into the dark compartment, a mild
inescapable foot shock (0.5 mA, 2 sec duration) was delivered from the grid floor.
Latency to enter the dark compartment was recorded for each trial. At the end of the
each trial, the rat was returned to its home cage. On PND-32, rat pups from each group
individually placed in the safe compartment with door closed for 5 sec, and then the
guillotine door was opened and allowed to enter the dark compartment. The latency to
enter the dark compartment was recorded and used as a measure of retention.
2.2.4 Gene expression analysis
Sample preparation
Total RNA was isolated from tissue samples obtained from different group (CUT,
CT, BME, mCPBG, and mCPBG + BME treated) using TRIzol (Invitrogen Inc, USA)
according to manufacturer’s instructions. The concentration of RNA was quantified by
measuring the optic absorbance at 260 nm with a spectrophotometer (Optima Inc,
Japan).
Northern hybridization
Northern hybridization was used to identify the expression of 5-HT3A receptor
associated with hippocampus task and BME treatment. Total RNA (20 µg/sample)
with
sampling
buffer
[50%
formamide,
2.2
M
formaldehyde
and
1X
4-morpholinopropane sulfonic acid (MOPS) buffer, pH 7.0] was loaded onto a 1%
agarose gel containing 0.44 M formaldehyde and run in 1X MOPS buffer at constant
voltage (50 V; 2 h) and then transferred on to a nitrocellulose membrane (SigmaAldrich, USA). The membrane was hybridized with a biotin-labeled 5-HT3A specific
71
probe (DecaLabel DNA Labeling Kit, Fermentas International Inc, Canada) at 42 °C
for 10 h. Non-specific hybridization was removed by washing with 2X SSC and 0.1%
SDS at room temperature (RT) for 10 min (twice), followed by washing at 65 °C in
0.1X SSC and 0.1% SDS for 20 min (twice). Specific hybridization of the 5-HT3A
DNA probe with 5-HT3A mRNA was visualized using a biotin chromogenic detection
kit (Fermentas International Inc, Canada).
Semi-quantitative RT-PCR
Total RNA (2.0 μg/sample) was reverse transcribed into cDNA using oligo-dT
primer (Access QuickTM RT-PCR kit, Fermentas International Inc, Canada). 5-HT
receptors were amplified from synthesized cDNA using specific primers (Table 2.1)
5-HT1A, 5-HT2A, 5-HT3A, 5-HT4, 5-HT5A, 5-HT6, and 5-HT7. Conditions for the PCR
reactions were as follows: initial denaturation at 94 ºC for 2 min followed by
denaturation at 94 °C for 1 min, annealing at 55 – 61 ºC (specific for each receptor) for
1 min, and extension at 72 °C for 1 min, then final extension at 72 ºC for 10 min
(MJ Mini gradient thermal cycler, Bio-Rad, CA, USA). 20 μl of each PCR product was
electrophoresed on agarose gel (1.0% w/v) containing ethidium bromide (0.5 μg/ml).
Images of the amplified products were acquired with a Molecular Imager ChemiDoc
XRS system; the intensity was quantified using the image analysis software (Quantity
one, Bio-Rad, USA). The band intensity was expressed as the relative peak density; the
degree of expression of 5-HT receptor was established by dividing the amount of 5-HT
receptor mRNA expression by the amount of β-actin mRNA expression respectively
(McCaffrey et al. 2000; Chamizo et al. 2001).
72
Table 2.1
Primers used for the present study were designed from specific gene
sequences.
S. No.
Gene
Ta
(ºC)
Size
(bp)
Source
(Genbank
accession number)
Primer Sequences
1.
5-HT1A
55 ºC
652
NM_022225.1
For 5′ TCATTTTCTGCGCGGTGCT 3′
Rev 5′ TCCAGTCCCCACTACCTGGCT 3′
2.
5-HT2A
58 ºC
658
NM_017254.1
For 5′ AGGGTACCTCCCACCGACAT 3′
Rev 5′ TTTGGCTCGAGTGCTGAGGT 3′
3.
5-HT3A
57 ºC
618
NM_024394.2
For 5′ TGCTGTTGGCCTTGTTCCTT 3′
Rev 5′ ACTCGCCCTGATTTATGAAGA 3′
4.
5-HT4
57 ºC
701
NM_012853.1
For 5′ TTCCAACGAGGGTTTCGGGT 3′
Rev 5′ TGTCTGGGGCCTGCTTTCA 3′
5.
5-HT5A
57 ºC
557
NM_013148.1
For 5′ ACCTAACCGCAGCTTGGACA 3′
Rev 5′ GTGGAGAACACGGTGTAGGA 3′
6.
5-HT6
61 ºC
611
NM_024365.1
For 5′ ATGGTTCCAGAGCCAGGCCCT 3′
Rev 5′ TGAAGCAGATGGCACCCGAA 3′
7.
5-HT7
57 ºC
635
NM_022938.2
For 5′ ATGATGGACGTTAACAGCAG 3′
Rev 5′ AGCAGCCAGACCGACAGAAT 3′
8.
β-actin
55 ºC
350
AB004047
For 5′ CATCCAGGCTGTGCTGTCCCT 3′
Rev 5′ TGCCAATAGTGATGACCTGGC 3′
Ta – primer annealing temperature
73
2.2.5 Neurotransmitter analysis
On PND-32, six rat pups representing each group (CT, BME, mCPBG, and
mCPBG + BME treated) were sacrificed 24 h after PA training by decapitation, and the
hippocampus region was dissected as described elsewhere Glowinski & Iversen (1966).
A part of tissue was frozen separately on dry ice, weighed, and homogenized with the
buffer (0.1 M perchloric acid, 4.5 mM Na2-EDTA, 1.6 mM reduced glutathione),
remaining tissue sample was used for isolation of total RNA. The homogenate was
centrifuged at 4 ºC at 14,000 rpm for 20 min and the supernatants were filtered using
0.22 µm filters (Millipore India Pvt Ltd, India). The filtrates were stored at -80 ºC.
The level of 5-HT, DA, GABA (ALPCO Diagnostics, Salem, USA), Glu (R & D
Systems, MN, USA) and ACh (Biovision, CA, USA) from the homogenate was
determined using ELISA kit. The concentration of 5-HT, DA, ACh, GABA, Glu in
each tissue sample was calculated by comparing the optical density (OD) of the
samples to that of the standard curve.
2.2.6 Statistical analysis
Data were expressed as mean ± standard error of mean (SEM) and plotted with
KyPlot (Ver. 1.0) for graphical representation. One way ANOVA was performed with
Sigma Stat software (Ver. 3.1) to examine the differences between group and the
differences were considered significant if P < 0.05.
74
RESULTS
2.3.1 BME attenuate mCPBG induced learning and memory impairment
The PA task latency to enter the dark compartment during successive
acquisition trials on PND-31 BME treated group was not significantly different
[F = 5.543, P = 0.030] from control group (Figure 2.2). However the PND-32, BME
treated group showed significantly higher latency to enter the dark compartment as
compared with control group [F = 24.610, P < 0.001]. The 5-HT3A receptor agonist
mCPBG was used to examine the role 5-HT3A receptor in hippocampus-dependent PA
task. On the other hand along with mCPBG, BME was also given to examine whether
the BME would attenuate the mCPBG mediated effect on “encoding” PA experience.
Administration of 5-HT3A receptor agonist mCPBG did not alter the latency during
acquisition [F = 3.737, P = 0.069], but during retention the latency was significantly
shorter [F = 74.560, P < 0.001] compared to control group (Figure 2.3). Recorded preshock latencies suggest that BME treatment along with mCPBG did not enhance their
acquisition. Their latency was significantly low compared to control [F = 22.170,
P < 0.001] and BME alone treated group [F = 6.501, P < 0.05]. Whereas their latency
during retention was significantly high compared to control group [F = 21.883,
P < 0.001] and comparable to BME treated group [F = 1.721, P = 0.206]. Interestingly,
the latency displayed by mCPBG with BME treated group was significantly higher
[F = 428.16, P < 0.001] during retention, compared with the mCPBG treated group,
suggesting that BME attenuate the mCPBG induced acquisition impairment and
provides additional evidence to its memory enhancing effect.
75
Figure 2.2 Recorded latency during acquisition in PA task for all groups. No
difference was recorded between groups. Values expressed in
mean ± SEM.
76
Figure 2.3 Recorded latency during retention in PA task. During retention, BME
received group shows higher latency. 5-HT3A receptor agonist mCPBG
treated individuals exhibited significantly less latency. Pre-treatment of
BME attenuates mCPBG effect on 5-HT3A receptor. Values expressed in
mean ± SEM.
77
2.3.2 BME extract induced 5-HT receptors expression
In order to examine the expression of 5-HT receptors in hippocampus of BME
pre-treated rats during hippocampus-dependent task, the level of 5-HT receptor mRNA
was quantified by semi-quantitative RT-PCR (Figure 2.4). Level of 5-HT1A receptor
expression in untrained control did not vary significantly from the trained control group
[F
(1, 11)
= 3.147, P = 0.106]. However, expression was significantly low in BME
[F
(1, 11)
= 8.716, P < 0.05] compared to trained control group. The level of 5-HT2A
mRNA expression was significantly higher in BME treated [F (1, 11) = 10.299, P < 0.01]
than untrained control but it didn’t differ significantly [F (1, 11) = 0.229, P = 0.643] from
trained control group. 5-HT3A receptor expression was notably increased in BME
treated group when compared with trained [F
control group [F
(1, 11)
(1, 11)
= 13.847, P < 0.01] and untrained
= 43.854, P < 0.001]. This result suggests that BME treatment
possibly up-regulates the expression of 5-HT3A receptor during PA task.
receptor expression did not significantly vary either in BME treated [F
P = 0.900] or in trained control [F
= 0.016,
= 0.054, P = 0.820] from untrained control
Expression of 5-HT5A receptor in BME treated animals did not vary
group.
significantly from trained [F
[F
(1, 11)
(1, 11)
5-HT4A
(1, 11)
(1, 11)
= 0.166, P = 0.692].
= 0.001, P = 0.966] and untrained control
Similar pattern of 5-HT6 receptor expression was
observed, i.e. 5-HT6 receptor expression in BME treated group did not significantly
vary from either trained [F
[F
(1, 11)
(1, 11)
= 0. 821, P = 0.386] or untrained controls
= 0.206, P < 0.660]. Expression of 5-HT7 receptor was significantly lower in
BME treated group as compared to trained [F
control groups [F (1, 11) = 21.066, P < 0.001].
78
(1, 11)
= 7.599, P < 0.05] and untrained
(A)
(B)
Figure 2.4 Expression pattern of 5-HT receptors in hippocampus after treated with BME
and trained/untrained conditioned in PA task. (A) Representative semiquantitative
RT-PCR analysis showing the expression pattern of 5-HT1A-7
receptors. (B) Histogram showing the relative mRNA expression of 5-HT1A-7
receptors. Values expressed in mean ± SEM; * P < 0.05, ** P < 0.01,
*** P < 0.001.
79
2.3.3 BME extract attenuate the mCPBG effect on 5-HT3A receptor
Northern hybridization analysis showed that PA training and BME treatment
enhanced the 5-HT3A receptor expression in hippocampus. While the 5-HT3A receptor
agonist mCPBG partially reduced the level of expression, BME attenuated the mCPBG
effect on 5-HT3A receptor expression (Figure 2.5). Semi-quantitative RT-PCR analysis
exhibited quantitative variations in 5-HT3A receptor expression in different groups. The
analysis revealed that 5-HT3A agonist mCPBG treatment significantly reduced
[F (1, 11) = 22.333, P < 0.001] the expression of 5-HT3A receptor compared to any other
groups. Interestingly, BME treatment up-regulated the 5-HT3A receptor expression, the
estimated level of expression was significantly higher in both BME treated
[F
(1, 11)
= 97.01, P < 0.001] and mCPBG treated with BME [F
(1, 11)
= 42.714,
P < 0.001] than the mCPBG treated group. It demonstrated that BME attenuate the
mCPBG induced suppression of 5-HT3A receptor expression. Overall, significantly low
expression was found in the mCPBG treated group compared to both behaviourally
trained [F
(1, 11)
= 114.83, P < 0.001] and untrained control group [F
(1, 11)
= 19.363,
P < 0.001].
2.3.4 Modulation of neurotransmitters
To find out the per se effect of BME and mCPBG treatment, the level of
neurotransmitter in hippocampus was estimated by ELISA on PND-32 i.e. 24 h after
training at PA task. Figure 2.6 shows the differences in the levels of neurotransmitters
(5-HT, DA, ACh, GABA and Glu). The analysis shows that BME treatment effectively
increased the levels of 5-HT, ACh, GABA and reduced the level of DA in hippocampus
compared to control.
80
(A)
(B)
(C)
Figure 2.5 Expression pattern of 5-HT3A receptor in hippocampus of different group.
(A) Northern hybridization analysis showing the level of 5-HT3A receptor
mRNA
in
different
groups
(CUT,
CT,
BME,
mCPBG,
and
mCPBG + BME). (B) Representative semi-quantitative RT-PCR analysis
showing the effect of BME treatment on 5-HT3A receptor expression.
(C) Bar diagram depicts the level of relative mRNA expression of 5-HT3A
receptor. Values expressed in mean ± SEM; *** P < 0.001.
81
Figure 2.6 Estimated level of neurotransmitters in hippocampus of different groups.
Values expressed in mean ± SEM; * P < 0.05, ** P < 0.01, *** P < 0.001.
82
The 5-HT3 receptor agonist mCPBG treatment reduced the 5-HT and ACh
levels and also elevated the DA as well as GABA levels compared to both control and
BME treated group. Glu level was modulated by BME treatment. However, there was
no significant variation between groups. Taken together, BME treatment effectively
attenuate
the
mCPBG
induced
5-HT3A
neurotransmitter system.
83
receptor
mediated
modulation
in
DISCUSSION
B. monniera has been commonly used to enhance the cognitive function in the
Indian traditional medical system.
In the present study, the effect of BME
pre-treatment on 5-HT receptors during hippocampus-dependent learning and the
subsequent changes in other neurotransmitters was investigated. The PA task was used
to measure the hippocampus-dependent learning and examine the expression pattern of
5-HT receptors in hippocampus (D’Agata & Cavallaro 2003). When the retention of
memory was tested, the BME treatment significantly increased the latency. Subsequent
semi-quantitative RT-PCR analysis revealed that the 5-HT3A receptor expression was
notably increased compared to all other receptors (5-HT1A, 5-HT2A, 5-HT4, 5-HT5A,
5-HT6 and 5-HT7) in both BME treated and trained animals not receiving any treatment.
Studies reported that 5-HT3A expression could be stimulated either by endogenous
5-HT or by its selective agonist, which may involve hippocampus-dependent task like
fear conditioning (Harrell & Allan 2003; Fink & Göthert 2007).
It has been
demonstrated that mCPBG treatment effectively impaired the retention of the
conditioned response (Hong & Meneses 1996) and both STM and LTM (Meneses
2007). The 5-HT3A agonist mCPBG function has facilitated us to gain insight into the
specific role of 5-HT3A receptor in hippocampus-dependent learning and its interactions
with other neurotransmitters. As already reported, administration of mCPBG decreased
the latency in each trial compared to any other group in the PA task. Interestingly, rats
treated with mCPBG and BME displayed higher latency in retention which
demonstrates that BME treatment attenuate the mCPBG induced memory impairment.
The observation suggests that mCPBG induced blockade of 5-HT3A receptor expression
was suppressed by BME in the rats treated with a combination of mCPBG and BME.
84
Recorded improvement in PA task in BME, mCPBG with BME treated group could be
due to the up-regulation of 5-HT3A receptor.
The up-regulated 5-HT3A receptor may interact with serotonergic system or with
other neurotransmitters that involved in learning and memory (Meneses 1999; van
Hooft & Vijverberg 2000; Turner et al. 2004). After BME treatment, significantly
higher levels of 5-HT, ACh, GABA, Glu and reduction in the level of DA was
observed. The up-regulated 5-HT3A receptor may facilitate the release of ACh in
hippocampus (Consolo et al. 1994). On the other hand, the anticholinesterase activity
of BME (Das et al. 2002) also appears to be involved in the regulation of ACh level and
memory enhancement (Siddiqui & Levey 1999; Joshi & Parle 2006). The 5-HT3A
receptor present in the GABAergic neuron (Morales et al. 1996), may activate the
GABAergic neurons (Turner et al. 2004; Dorostkar & Boehm 2007), which also
enhanced the release of GABA. In fact, increased GABA level in hippocampus could
activate the inhibitory GABA receptors on cholinergic system that leads to inhibition of
ACh release (Ramirez et al. 1996; Diez-Ariza et al. 1998). The present study suggests
that 5-HT3A receptor may directly interact with cholinergic system and enhances the
level of ACh, which may be beyond the influence of inhibitory GABAergic system in
hippocampus to inhibit the release of ACh.
In contrast, administration of mCPBG significantly induced the level of 5-HT,
ACh and elevated the level of GABA.
It should also be noted that 5-HT3A is a
heteroreceptor, its stimulation by means of mCPBG has been reported to enhance
GABA and DA levels and inhibit the release of ACh (Fink & Gothert 2007), and it may
also be involved in the regulation of 5-HT release. In addition, activation of 5-HT3A in
85
dopaminergic neuron could facilitate the release of DA (Blandina et al. 1989; Alex &
Pehek 2007), and its agonist mCPBG inhibit DA uptake by binding with DAT
(Campbell et al. 1995), thereby increasing the synaptic DA level. A noteworthy point
is that it did not alter the level of Glu.
This suggests that Glu neurons in the
hippocampus may not co-localize with 5-HT3A receptor (Dorostar & Boehm 2007).
Earlier biochemical investigations showed that BME enhanced the protein kinase
activity, 5-HT and lowered the Epi levels (Singh & Dhawan 1997). The observed
changes are indicative of the facilitatory effect of BME on long-term and intermediate
forms of memory (Crow et al. 2001). Bacosides present in the BME are non-polar
glycosides; lipid-mediated transport may facilitate the bacosides to cross the
blood-brain barrier (BBB) by free (passive) diffusion (Pardridge 1999), which possibly
act on the neurotransmitter system.
Considering the interaction of multiple
neurotransmitters involved in learning and memory network (Decker & McGaugh
1991; Matsukawa et al. 1997; Stancampiano et al. 1999; Nail-Boucherie et al. 2000),
BME act on the serotonergic system, elevated the level of 5-HT and up-regulates the
expression of 5-HT3A receptor and improves the hippocampus-dependent task.
86
Chapter III
Bacopa monniera extract attenuates the D-galactose induced learning
impairment in aging rat’s brain by modulating the pre- and post-synaptic
proteins
INTRODUCTION
Bacopa monniera Linn (syn. Brahmi) has been extensively used as a memory
enhancing agent in the Indian traditional Ayurvedic system of medicine (Russo &
Borrelli 2005). It has been found that B. monniera exerting antioxidant effects against
oxidative stress, by enhancing endogenous antioxidative defense enzymes activity
(Bhattacharya et al. 2000; Jyoti & Sharma 2006). The reported pharmacological effect
was due to two principle components bacoside A (Chatterji et al. 1965; Singh et al.
1988) and bacoside-B (Basu et al. 1967; Singh et al. 1988). It has been postulated that
B. monniera attenuates memory deficits induced by scopolamine (Zhou et al. 2009;
Saraf et al. 2011) and diazepam (Prabhakar et al. 2008). In addition, studies reported
the downstream mechanism of Bacopa extract during reversal of scopolamine and
L-NNA induced amnesia (Anand et al. 2010; Saraf et al. 2010). Recently, Prisila et al.
(2011) reported that B. monniera enhanced the learning and memory by regulating the
expression of Tph2, 5-HT biosynthesis and its transporter, which possibly acting
through 5-HT3A receptor (Emmanuvel Rajan et al. 2011).
Information processing in the hippocampus is limited in aged individuals due to
declining neural substrates, modulators and synaptic strength (Jernigan et al. 1991;
Golomb et al. 1993; Geinisman et al. 1995). These changes directly affect induction
and maintenance of LTP (Rosenzweig & Barnes 2003).
Any disruption in the
hippocampus leads to impairment of spatial memory (Barnes 1994), odor memory
(Rapp et al. 1996), novelty-preference and paired-associative learning (Rajji et al.
2006). Learning impairment in rodent model is generated by prolonged administration
of D-galactose (D-gal), which induces oxidative stress (Cui et al. 1998; Wei et al.
87
2005). D-gal administration accelerate the aging process generate advanced glycation
end product (AGE), reduces anti-oxidant enzymes (Cui et al. 2006) and induces
neurodegeneration (Cui et al. 2000). Furthermore, a study revealed the D-gal effect on
synaptic morphology suggesting a decline in the density of synapses on the
catecholaminergic region as well as with a forebrain cholinergic neuronal loss (Hua
et al. 2007). In order to counteract the disruption of the redox homeostasis leading to
neuronal cell death, pathogenesis of aging-related diseases and neurodegenerative
disorders, higher animals have evolved with multi-faceted elaborate defence
mechanisms including the antioxidant enzymes (Simonian & Coyle 1996; Klaunig &
Kamendulis 2004; de Vries et al. 2008). The major factor responsible for maintenance
of intracellular redox homeostasis in the central nervous system is endowed with
endogenous antioxidant enzymes.
The endogenous antioxidant enzymes functions
were regulated by the antioxidant response element (ARE), it is under control of the
nuclear transcription factor NF-E2-related factor 2 (Nrf2) (Wasserman & Fahl 1997;
Jaiswal et al. 2004; de Vries et al. 2008). When the oxidative stress elevated, Nrf2
dissociate from a cytosolic inhibitor (INrf2), (also known as Keap1, Kelch-like
ECH-associating protein1) then translocates into nucleus and bind with ARE to drive
the induction of defensive antioxidant enzymes (Itoh et al. 2003).
On the other hand, memory formation and recovery of information depend on
synaptic transmission i.e. such as release of neurotransmitters, and modulation of
expression level of synaptic proteins (Wu et al. 2008). Synaptic proteins are involved
in a majority of pre-synaptic functions like recycling of synaptic vesicles and
exocytosis of neurotransmitters and signal transduction (Ferreira & Rapoport 2002;
Lisman et al. 2002) and a decline in the above is associated with impairment of
88
memory and synaptic function. According to Remondes & Schuman (2003) decline in
the synaptic plasticity is extensively involved in the development of nervous system,
restoration of brain functions after injury as well as learning and memory. The key
pre-synaptic protein SYT, critical for mediating synaptic vesicle docking and SYP, a
synaptic vesicle membrane protein involved in the formation of fusion pore (Koh &
Bellen 2003), and post-synaptic proteins PSD-95 and CaMKII (Gardoni et al. 2001;
Cammarota et al. 2008) critical for synaptic plasticity. SYT a major Ca2+ sensor
required for normal synaptic transmission and also involved in facilitating exocytosis
and endocytosis (Sudhof 2004). A study by Geppert et al. (1994) indicates that SYT
knockout mice exhibits declension in synchronous transmitter release after stimulation.
SYP was first discovered in rat brain and predominantly exists in the synapse of central
and peripheral nervous system, involved in the process of the calcium dependent
neurotransmitter release (Valtorta et al. 2004). Tarsa and Goda (2002) states that SYN
act as a specific marker of synaptic function at the pre-synaptic terminal, associated
with cognitive function.
CaMKIIα found primarily in cerebral cortex and hippocampus (Sakagami et al.
2000) forms the substrates for learning and memory, plays a vital role in
neurotransmission, synaptic plasticity, LTP and gene expression (Wang et al. 2005;
Ahmed & Frey 2005; Vaynman et al. 2007). The structural rearrangements occur at the
PSD which presumably anchors proteins regulating synaptic transmission (Inoue &
Okabe 2003).
PSD-95, a member of scaffolding proteins known as MAGUKS
regulates activity dependent structural plasticity. PSD-95 is found at the excitatory
glutamatergic synapses which play a critical role in the organization of synapses as well
as gating structural and functional changes. A study by El-Husseini et al. (2000) states
89
that over expression of PSD-95 leads to enhanced synaptic transmission indicating a
possible role of PSD-95 in synaptic plasticity. In this chapter, the neuroprotective
effect of B. monniera was examined in D-gal induced aging model by antioxidant
enzymes activity, modulation of neurotransmitters as well as key pre-synaptic (SYP,
SYT1) and post-synaptic (CaMKIIα, PSD-95) proteins involved in synaptic plasticity.
90
MATERIALS AND METHODS
3.2.1 Animal and drugs
Three months old Wistar rats were housed in a standard laboratory cage
(43 cm × 27 cm × 15 cm) with paddy husk as a bedding material.
Rats were
maintained under a standard 12:12 h light-dark conditions at a constant temperature
(22 ºC ± 2 ºC) and 60% relative humidity with ad libitum access to food and water.
The experiments were conducted between 10:00 h and 17:30 h in a semi-soundproof
laboratory.
3.2.2 Groups and treatment schedule
The effect of BME on learning impairment in aging rat’s brain induced by
D-galactose was examined. Rats were divided into four groups; i.e. (1) control group:
[0.9% saline (subcutaneous) + 0.5% gum acacia (oral)] (n = 11), (2) D-gal group:
[100 mg/kg D-gal (subcutaneous)] (n = 10), (3) BME group: [BME (oral)] (n = 10),
saline/D-gal/BME
administered for eight
weeks according to
their group,
(4) D-gal + BME group: [100 mg/kg D-gal (subcutaneous) + BME, (oral)] (n = 11),
BME administered only for six weeks from 3rd week. Each rat’s pre and post treatment
body weight were monitored every three days throughout the period of experiment.
Figure 3.1 shows schematic representation of experimental method.
91
Wistar rats
(Rattus norvegicus)
3 months old
D-Galactose + BME after
2 weeks
BME
D-Galactose
Control
Treatment for 8
weeks
(Behavioral analysis)
Contextual associative learning
Shaping phase
(5 days)
Sacrificed after training
Training period
(8 days)
Inter-experimental
period
24 hours
Memory test
Biochemical analysis
Advanced glycation
end products (AGE)
Molecular analysis
Expression pattern
(8 days)
Nrf2
SYT1
SYP
CaMKII
PSD-95
Antioxidant enzymes
(SOD & GPx)
Neurotransmitter analysis
(5-HT & NE)
Figure 3.1 Schematic representation of experimental method
92
3.2.3 Behavioural assessment
Rats were subjected to contextual-associative learning task, which depends on
the hippocampus (Mumby et al. 2002; Rajji et al. 2006). A context refers to the
surrounding visual cues in the environment including the floor texture, specific
combination of colour on the walls of the apparatus. Experimental apparatus was
constructed with specifications of Rajji et al. (2006). Two plastic cups were placed
adjacently with a 25 cm space between one another and 10 cm away from the walls.
Depending on the context, two different odor (mixed with the sand in a 1.0%
concentration by volume); odor A (Citral, Sigma-Aldrich, GmbH, Germany) and odor
B (Cineole, Sigma-Aldrich, GmbH, Germany) was presented to rats simultaneously.
Cups were filled with sterilized playground sand with odor A/B and only one cup had
small piece of chocolate (Hershey’s hugs, Hershey, PA) at the bottom of the cup as a
reward. During acquisition rats were exposed individually to two different contexts;
Context 1 (CT1) the floor was black, walls with black and white stripes, left cup with
odor A and rewarded with the chocolate chips; right cup with odor B without the
reward. In Context 2 (CT2), the floor was black but different geometrical shapes on the
walls. Left cup was with odor A without reward, whereas the right cup with odor B
and rewarded with chocolate chips. The position of each scented cup was placed
randomly assigned to right or left in counterbalanced design.
Experiment was conducted between 10:00 h and 17:30 h in a semi-sound proof
laboratory.
Rats were allowed to explore the apparatus for five days before the
training; two non-scented sand-filled cups were placed on the apparatus, and one of the
cup was baited with chocolate chips. On day one, chocolate pieces were dispersed on
the sand and on the baited cup. Each rat was given maximum time of 1 h to dig and
93
retrieve all the hidden retreats in the cup. This procedure was repeated for three times
on day one. On day two, the same procedure was repeated for three times, only hidden
multiple treats were provided (i.e. none on the surface). On day three, rats were
subjected to the same procedure as above but only one hidden treat kept in the cup. On
day four and five the procedure was the same as that of day 3, but the time was limited
to 8 min to retrieve the treat. On day five, if the rat was not digging in all three trials
within the time limit of 8 min, they were eliminated from the study.
3.2.4 Shaping phase
Training to a contextual-associative learning task
Rats were trained for eight days, 5 trials were provided for each rat in each
context (CT1/CT2). Trial started by placing the rat in CT1 or CT2 and ended when the
time elapsed (8 min) or the rat retrieved the hidden treat. The inter-trial interval was
15 min. The number of correct/incorrect responses were classified depends on each rat
attempt to dig the cup with reward or without reward. Time taken to retrieve the
hidden reward from the cup was recorded.
Retention of contextual-associative task
Five days after the acquisition period, each rat was subjected to behavioural test
for eight days in the similar context on which they were previously trained. Each rat
was given 5 min to retrieve the hidden reward. In each context, the trial was terminated
if the rat failed to retrieve the reward within 5 min. Behavioural responses were
recorded following the same procedure as in training period. Behavioural observations
were scored by an individual blind to the subject’s treatment.
94
3.2.5 Advanced glycation end products
Rats (n = 6, in each group) were sacrificed after treatment and blood samples
were collected, and brain tissues were stored for other analysis. Serum was separated
and processed for quantitative measurement of AGE by ELISA as described earlier
(Song et al. 1999). Briefly, 96-well plates were coated with AGE-BSA at 4 ºC for 16 h
and washed with washing buffer (PBS, 0.05% Tween-20, 1 mM NaN3) for three times,
then blocked with 1% normal goat serum for 2 h at 37ºC. The serum samples were
diluted (1:10) in a buffer (PBS, 0.02% Tween-20, 1 mM NaN3, 1% normal goat serum)
and incubated with anti-AGE polyclonal anti-serum (1:3000) at RT for 2 h. The plate
was washed with washing buffer and incubated with alkaline phosphate conjugated
secondary antibody (1:2000) at 37 °C for 1 h.
Then the plate was washed and
p-nitrophenyl phosphate substrate (100 µl) was added. Sixty minutes after incubation,
optical density was determined at 405 nm using microplate reader (Bio-Rad, USA).
The level of AGE in each sample was calculated using the standard curve.
3.2.6 Biochemical analysis
Hippocampus region of rats representing each group was dissected as described
elsewhere (Glowinski & Iversen 1996). A part of tissue was frozen separately on dry
ice, weighed and homogenized with 50 mM phosphate buffer (pH 7.2; 1 ml/100 mg
tissue). The homogenate was centrifuged at 12,000 x g for 30 min at 4 °C and the clear
supernatant was collected for biochemical analysis. The concentration of each protein
sample was estimated using Bradford's standard method (Bradford 1976). The activity
of superoxide dismutase (SOD) (Marklund & Marklund 1974) and glutathione
peroxidase (GPx) (Rotruck et al. 1973) assayed following respective method.
95
3.2.7 Neurotransmitter analysis
After the training period, rats from each group [Control (n = 6); D-gal (n = 6);
BME (n = 6); D-Gal + BME (n = 6)] were decapitated and the hippocampus region was
dissected out and frozen on dry ice. The wet tissue weighed and then homogenized in
ice-cold perchloric acid (0.1 M) containing reduced glutathione (1.6 mM) and
Na2-EDTA (4.5 mM). The homogenates were centrifuged at 12,000 rpm for 20 min at
4 ºC; the supernatant was aspirated, filtered in a 0.22 µm membrane filter (Pall Life
Sciences, MI, USA), and stored at -80 ºC until analysis. The level of 5-HT (BioSource
ELISA kit, Europe S.A, Belgium) and NE (Immuno Biological Laboratories Inc., MN,
USA) was estimated according to the manufacturer’s instructions. The concentration of
5-HT and NE in each sample was calculated using standard curve.
3.2.8 Semi-quantitative RT-PCR
After the training period, rats from each group [Control (n = 6); D-gal (n = 6);
BME (n = 6); D-Gal + BME (n = 6)] was sacrificed, and the hippocampus region was
dissected out as described earlier (Glowinski & Iversen 1996). A part of tissue was
used to isolate total RNA using TRIzol (MERCK, Bangalore, India), according to the
manufacturer’s instructions and stored with RNase inhibitor (1U/μl; Rnasin, Promega,
Madison, USA) at -70 ºC and the remaining tissue was used to isolate protein. The
concentration of RNA was quantified by measuring the absorbance at 260 nm in a
Biophotometer (Eppendorf Inc., Germany). Total RNA (2.0 μg/sample) was reversetranscribed using the iScriptTM cDNA synthesis kit (Bio-Rad, USA) using
random/oligo dT primers. Specific primers for Nrf2, SYT1, SYP, CaMKIIa, PSD-95,
and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed to amplify
96
and estimate the level of expression (Table 3.1). Semi-quantitative RT-PCR was used
to quantify the level of Nrf2/SYT1/SYP/CaMKIIa/PSD-95 expression, together with
GAPDH as an internal control. PCR reaction started with initial denaturation at 94 ºC
for 3 min, followed by denaturation at 94 ºC for 1 min, annealing at 58 ºC for 1 min
(Nrf2), 55 ºC for 1 min (SYT1), 56 ºC for 1 min (SYP), 57 ºC for 1 min (CaMKIIα),
56 ºC for 1 min (PSD-95), 58 ºC for 1 min (GAPDH) and extension at 72 ºC for 2 min,
then final extension at 72 ºC for 10 min (MJ Mini Gradient Thermal Cycler, Bio-Rad,
CA, USA). The number of PCR cycles (25, 30, and 35 cycles) were optimized to
maintain amplification process within a linear range. Twenty microliters of each PCR
product was electrophoresed on agarose gel (1.0% w/v) containing ethidium bromide
(0.3 μg/ml). Images of the amplified products were acquired with a Molecular Imager
ChemiDoc XRS system (Bio-Rad, USA) and the intensity was quantified using the
image analysis software (Quantity one, Bio-Rad, USA).
The band intensity was
expressed as the relative peak density; the degree of Nrf2/SYT1/SYP/CaMKIIa/PSD-95
expression was established by dividing the level of Nrf2/SYT1/SYP/CaMKIIa/PSD-95
mRNA expression by the level of GAPDH mRNA expression (Barber et al. 2005).
97
Table 3.1
Specific primers were designed and used to examine the expression
pattern of genes using semi-quantitative RT-PCR.
S. No.
Gene
Ta
(ºC)
Size
(bp)
Source
(Genbank
accession number)
1.
Nrf2
58 ºC
658
NM_031789.1
For 5' ACAAGCAGCAGGCTGAGACT 3'
Rev 5' GATTCGTGCACAGCAGCACT 3'
2.
SYT1
55 ºC
711
NM_001033680.2
For 5' TGCCACCGTGGGCCTTAATA 3'
Rev 5' CAACAGTCAGTTTGCCGGCA 3'
3.
SYP
56 ºC
622
NM_012664.2
For 5' TGCTACGTGTGGCAGCTACA 3'
Rev 5' GCCAGGTGCTGGTTGCTTTT 3'
4.
CaMKIIα
57 ºC
757
NM_177407.4
For 5' ATGGCTACCATCACCTGCAC 3'
Rev 5' TCAGCATCTTATTGATCAGATC 3'
5.
PSD-95
56 ºC
708
NM_007864.3
For 5' ATGGACTGTCTCTGTATAGTGA 3'
Rev 5' ATATGTGTTCTTCAGGGCTG 3'
6.
GAPDH
58 ºC
377
NG_028301.1
For 5' ATGGTGAAGGTCGGTGTGAACGGA 3'
Rev 5' GAAGGGGCGGAGATGATGACCCT 3'
Ta – primer annealing temperature.
98
Primer Sequences
3.2.9 Western blotting
The hippocampus tissue obtained from each group was lysed in 500 µl ice-cold
lysis buffer (150 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM EDTA, 0.1% v/v NP-40,
1 mM DTT, 0.2 mM sodium orthovanadate, 0.23 mM PMSF) and 10 μl/ml protease
inhibitor cocktail (Sigma-Aldrich, USA).
The homogenates were kept on ice for
30 min and then centrifuged at 10,000 x g for 30 min at 4 °C. The clear supernatants
were collected in a fresh tube and centrifuged again at 12,000 x g for 15 min at 4 °C.
The final supernatants were collected and stored as aliquots, in order to avoid repeated
freeze–thaw of the samples and were stored at -80 °C. The concentration of each
protein sample was determined using Bradford's method (Bradford 1976). Protein
lysate (40 μg each) were mixed with loading buffer (100% glycerol, 125 mM Tris-HCl
[pH 6.8], 4% SDS, 0.006% bromophenol blue, 2% mercaptoethanol) and boiled for
5 min then resolved on 10% polyacrylamide gel (PAGE). The separated proteins were
transferred electrophoretically onto polyvinylidene difluoride (PVDF) membrane
(Millipore India Pvt Ltd., India).
The membranes were then pre-blocked with Tris-buffered saline (TBS-T)
containing (5% non-fat dry milk and 0.1% Tween 20) for 3 h at RT. Membranes were
incubated with one of the specific primary antibodies; rabbit monoclonal anti-SYP
(M-04-1019; 1:10,000; Millipore, USA), mouse anti-SYT1 (BD-610433; 1:4000; BD
Biosciences, USA), mouse polyclonal anti-CaMKIIα antibody (SC-32288; 1:200
dilution), rabbit polyclonal anti-phospho-CaMKIIα (Thr286) antibody (SC-12886-R;
1:200 dilution), rabbit polyclonal anti-PSD-95 antibody (SC-28941; 1:200) at 4 ºC for
16 h. Rabbit polyclonal anti-β-actin antibody (SC-130656; 1:200) was used as control
for each sample. The membranes were washed with TBS-T for three times (each
99
5 min) and the membrane bound antibodies were detected by either mouse anti-rabbit
alkaline phosphatase conjugated antibody (SC-2358; 1:2000), or goat anti-mouse
alkaline phosphatase conjugated (SC-2058; 1:2000) secondary antibody. Following the
post-secondary washes three times with TBS-T, alkaline phosphatase activity was
detected
with
5-bromo-4-chloro-3-indolyl
phosphate
di-sodium
salt/nitroblue
tetrazolium chloride (HIMEDIA, Mumbai, India) according to the manufacturer's
instructions. Intensity of each band was measured using Quantity One image analysis
software (Bio-Rad, USA).
3.2.10 Statistical analysis
Data’s were expressed as mean ± standard error of mean (SEM), and plotted
with KyPlot (version 1.0) for graphical representation.
Data’s were statistically
evaluated by one way ANOVA in SigmaStat (version 3.1).
considered significant if P < 0.05.
100
Differences were
RESULTS
3.3.1 Effect of BME on contextual-associative learning
Behavioural performances of the different groups revealed that individuals
treated with BME showed significantly more correct responses during contextual
associative learning [F
(3,60)
= 36.003, P < 0.001] and retention [F
(3,60)
= 56.571,
P < 0.001] compared to any other group (Figure 3.2). Among groups, D-gal treated
group showed significantly less correct responses during acquisition [F
P < 0.001] as well as in retention [F
group.
(1,30)
(1,30)
= 15.961,
= 43.452, P < 0.001] compared with control
Interestingly, D-gal + BME group’s correct responses during learning
[F (1,30) = 58.03, P < 0.001] and retention [F (1,30) = 72.56, P < 0.001] was significantly
higher than D-gal group. However, there was no significant difference in correct
responses during learning [F
(1,30)
= 3.461, P = 0.073] and retention [F
(1,30)
= 1.54,
P = 0.224] between control and D-gal + BME group.
As shown in Figure 3.3, recorded latency for BME group was significantly less
during learning [F (3,60) = 38.332, P < 0.001] and retention [F (3,60) = 31.787, P < 0.001]
than any other group. In contrast, D-gal group displayed significantly higher latency
during learning [F (2,45) = 17.094, P < 0.001] and retention [F (2,45) = 15.404, P < 0.001]
compared with other groups.
Interestingly, latency of D-gal + BME group was
significantly less during learning [F
(1,30)
= 30.891, P < 0.001] and retention
[F (1,30) = 35.735, P < 0.001] than D-gal. However, there was no significant difference
in latency between control and D-gal + BME group during learning [F
P = 0.122] but significant difference was found during retention [F
(1,30)
(1,30)
= 2.529,
= 7.325,
P = 0.011]. The observed behavioural data suggest that BME attenuate the D-gal
induced learning impairment in contextual-associative task.
101
(A)
(B)
Figure 3.2
Behavioural responses of different groups during contextual-associative
learning task. Individuals correct responses during (A) learning task and
(B) during retention test. Values expressed in mean ± SEM;
*** P < 0.001.
102
(A)
(B)
Figure 3.3
Different groups latency to retrieve the reward during contextualassociative learning. Individual’s latency during (A) learning and
(B) during retention. Values expressed in mean ± SEM; ** P < 0.01,
*** P < 0.001.
103
3.3.2 Analysis of advanced glycation end products
Figure 3.4 shows that BME treatment did not alter [F
the level of serum AGE.
[F
(3,8)
(1,4)
= 4.609, P = 0.121]
In contrast, D-gal treatment significantly increased
= 84.294, P < 0.001] the level of serum AGE compared with all other groups.
Interestingly, significant decline [F
(1,4)
= 30.907, P < 0.01] in the level of AGE was
observed after continuous treatment of BME in D-gal + BME group when compared
with D-gal group. However, there was a significant difference [F
(1,4)
= 23.715,
P < 0.01] in the estimated level of AGE products between control and D-gal + BME
group.
3.3.3 Effect of BME on the SOD and GPx activity
Antioxidant enzymes SOD and GPx levels were varied among different groups
(Figure 3.5).
The estimated level of antioxidant enzymes SOD [F
(3,8)
= 8.305,
P < 0.01] and GPx [F (3,8) = 191.070, P < 0.01] in BME treated group was significantly
higher compared to all other groups.
decreased the level of SOD [F
(1,4)
In contrast, D-gal treatment significantly
= 29.434, P < 0.01] and GPx [F
(1,4)
= 30.717,
P < 0.01] compared to control. Estimated level of SOD in D-gal + BME was not
significantly different [F
(1,4)
= 0.588, P = 0.486] from control group but the level of
GPx activity was significantly different [F
(1,4)
= 62.563, P < 0.01]. Interestingly,
administration of BME restored the level of antioxidant enzymes in D-gal treated
group. When compared to D-gal group the level of SOD [F (1,4) = 7.897, P < 0.05] and
GPx [F (1,4) = 427.743, P < 0.001] was significantly increased in D-gal + BME group.
104
Figure 3.4 Level of AGE in serum of individuals from different groups. Values
expressed in mean ± SEM; *** P < 0.001.
105
(A)
(B)
Figure 3.5 Estimated level of antioxidant enzymes in different groups.
(A) Superoxide dismutase (SOD) and (B) Glutathione peroxidase
(GPx) activity in hippocampus in different groups. Values expressed
in mean ± SEM; ** P < 0.01, *** P < 0.001.
106
3.3.4 Neurotransmitter analysis
Estimated extracellular level of 5-HT and NE in hippocampus (Figure 3.6)
shows that level of 5-HT was elevated 46% in BME treated group, which was
significantly higher [F
(1,11)
= 1267.190, P < 0.001] compared to control group. In
contrast, D-gal treatment significantly reduced [F
5-HT compared to control.
(1,11)
= 471.073, P < 0.001] 30% of
Infact, BME treatment restored the 5-HT level in
D-gal + BME group, which is 35% higher than D-gal group and showed significant
difference [F (1,11) = 430.95, P < 0.001]. Subsequent analysis suggest that estimated
5-HT level was significantly higher [F (1,11) = 14.038, P < 0.01] 8% than control group.
The estimated level of NE showed no significant change among groups except
in the D-gal group.
The estimated level was 6.7% low in D-gal group with the
significant difference compared to control group
[F
(1,11)
= 8.682, P = 0.015]. The
estimated NE level was quiet similar and did not showed significant difference [control
vs BME (F
(1,11)
= 3.483, P = 0.092); control vs D-gal + BME (F
(1,11)
= 3.160,
P = 0.106); and D-gal vs D-gal + BME (F (1,11) = 3.923, P = 0.076)].
3.3.5 Effect of BME on the expression of Nrf2
We observed that expression of Nrf2 (Figure 3.7) was enhanced by BME
treatment. A significant difference [F (1,11) = 49.349, P < 0.001] was found in the level
of Nrf2 expression between BME and control group. In contrast, expression of Nrf2
was significantly low in D-gal group [F (1,11) = 20.040, P < 0.001] compared to control.
Notably, the level of Nrf2 expression was significantly up-regulated [F
(1,11)
= 32.373,
P < 0.001] in D-gal + BME group compared to D-gal group and the estimated level was
comparable to [F (1,11) = 2.040, P = 0.184] control.
107
(A)
(B)
Figure 3.6 Level of neurotransmitters in hippocampus of individuals from different
groups (A) 5-HT and (B) NE.
** P < 0.01, *** P < 0.001.
108
Values expressed in mean ± SEM;
Figure 3.7 Expression of Nrf2 in hippocampus of individuals from different groups.
(A) Semi-quantitative RT-PCR shows the differential expression of Nrf2.
(B) Estimated level of Nrf2 mRNA expression in different groups. Values
expressed in mean ± SEM; *** P < 0.001.
109
3.3.6 Effect of BME on the expression of SYT1 and SYP
BME treatment increased the level of SYT1 (Figure 3.8) and SYP (Figure 3.9)
expression in hippocampus. A significant difference was found in the level of SYT1
[F (1,11) = 17.750, P < 0.002] and SYP [F (1,11) = 36.474, P < 0.001] expression between
BME and control group.
P < 0.023] and SYP [F
(1,11)
In contrast, the expression of SYT1 [F
(1,11)
= 7.152,
= 14.668, P < 0.003] was significantly low in D-gal group
compared to control. Notably, the level of SYT1 [F (1,11) = 20.849, P < 0.001] and SYP
expression [F
(1,11)
= 69.996, P < 0.001] was significantly up-regulated in
D-gal + BME group compared to D-gal group.
3.3.7 Effect of BME on the expression of CaMKII and PSD-95
BME treatment increased the level of CaMKII (Figure 3.10) and PSD-95
(Figure 3.11) expression in hippocampus. A significant difference was found in the
level of CaMKII [F
(1,11)
= 15.495, P < 0.003] and PSD-95 [F
(1,11)
= 117.506,
P < 0.001] expression between BME and control group. In contrast, the expression of
CaMKII [F
(1,11)
= 10.671, P < 0.008] and PSD-95 [F
(1,11)
= 5.224, P < 0.045] was
significantly low in D-gal group compared to control. Notably, the level of CaMKII
[F (1,11) = 74.151, P < 0.001] and PSD-95 expression [F (1,11) = 27.582, P < 0.001] was
significantly up-regulated in D-gal + BME group compared to D-gal.
110
Figure 3.8 Expression of SYT1 in hippocampus of individuals from different groups.
(A) Semi-quantitative RT-PCR shows the differential expression of SYT1.
(B) Estimated level of SYT1 mRNA expression in different groups. Values
expressed in mean ± SEM; *** P < 0.001.
111
Figure 3.9 Expression of SYP in hippocampus of individuals from different groups.
(A) Semi-quantitative RT-PCR shows the differential expression of SYP.
(B) Estimated level of SYP mRNA expression in different groups.
Values expressed in mean ± SEM; *** P < 0.001.
112
Figure 3.10 Expression of CaMKII in hippocampus of individuals from different
groups. (A) Semi-quantitative RT-PCR shows the differential expression
of CaMKII. (B) Estimated level of CaMKII mRNA expression in
different groups. Values expressed in mean ± SEM; *** P < 0.001.
113
Figure 3.11 Expression of PSD-95 in hippocampus of individuals from different
groups. (A) Semi-quantitative RT-PCR shows the differential expression
of PSD-95. (B) Estimated level of PSD-95 mRNA expression in
different groups. Values expressed in mean ± SEM; *** P < 0.001.
114
3.3.8 Effect of BME on synaptic proteins
Western blot analysis shows the differences in the level of SYT expression
when the trace value was measured (Figure 3.12). The results showed a significantly
up-regulated [F
(1,11)
= 15.276, P < 0.01] expression of SYT in BME treated group
compared to control group. There was no significant variation in the level of SYT in
control compared to D-gal group [F
(1,11)
= 1.500, P = 0.249] and D-gal + BME group
[F (1,11) = 3.809, P = 0.080]. Notably, the estimated variation was statistically different
[F (1,11) = 5.913, P <0.01] between D-gal and D-gal + BME group. On the other hand,
when the level of SYP expression (Figure 3.13) was estimated, BME treatment
significantly [F
control.
(1,11)
= 18.048, P < 0.01] up-regulated the expression compared to
In contrast, D-gal treatment significantly decreased [F
(1,11)
= 17.453,
P < 0.01] the level of SYP. Subsequent analysis revealed that along with D-gal
treatment, BME treatment prevents the SYP suppression. The estimated level was
significantly different in D-gal + BME group compared to D-gal [F
(1,11)
= 61.064,
P < 0.001] and control [F (1,11) = 10.170, P < 0.01].
CaMKII and PSD-95 are the key synaptic protein at the post-synaptic density
necessary for synaptic plasticity. Then investigated the effect of BME treatment on
post-synaptic protein CaMKII by western blot analysis (Figure 3.14). The level of
CaMKII expression was found significantly increased in BME group [F (1,11) = 51.444,
P < 0.001] and decreased in D-gal group [F
control.
115
(1,11)
= 18.757, P < 0.001] compared to
Figure 3.12 Level of SYT1 protein in hippocampus of individuals from different
groups. (A) Western blot analysis shows the level of SYT1 protein in
hippocampus of individuals after contextual-associative learning,
(B) estimated level of SYT1 expression. Values expressed in
mean ± SEM; ** P < 0.01.
116
Figure 3.13 Level of SYP protein in hippocampus of individuals from different
groups. (A) Western blot analysis shows the level of SYP protein in
hippocampus of individuals after contextual-associative learning,
(B) estimated level of SYP expression. Values expressed in
mean ± SEM; ** P < 0.01; *** P < 0.001.
117
Figure 3.14 Level of CaMKII protein in hippocampus of individuals from different
groups. Western blot analysis shows the level of (A) t-CaMKII and
p-CaMKII protein in hippocampus of individuals after contextualassociative learning, (B) estimated level of t-CaMKII and (C) p-CaMKII
expression. Values expressed in mean ± SEM; ** P < 0.01;
*** P < 0.001.
118
Subsequently,
the
obtained
results
showed
a
significant
difference
[F (1,11) = 18.074, P < 0.01] in the expression level in D-gal + BME group as compared
to D-gal group. Although, the results showed a variation in the expression of CaMKII
between D-gal + BME group and D-gal group, the variation was not significantly
different from control group [F
(1,11)
= 0.050, P = 0.828]. In addition, the level of
phosphorylated CaMKII was significantly increased in BME group [F
(1,11)
= 65.456,
P < 0.001] and decreased in D-gal group [F (1,11) = 14.027, P < 0.01] when compared to
control.
Interestingly, the level of p-CaMKII was significantly up-regulated in
D-gal + BME group compared to D-gal group [F (1,11) = 19.141, P < 0.001] and control
[F (1,11) = 18.324, P < 0.001].
Furthermore, the level of PSD-95 in all groups (Figure 3.15) was estimated.
Similar to CaMKII, BME treatment significantly up-regulated the expression of
PSD-95 in BME group [F
(1,11)
= 32.672, P < 0.001] and the expression was
significantly declined in D-gal group [F
(1,11)
= 6.697, P < 0.05] compared to control.
Estimated level of PSD-95 expression was significantly high in D-gal + BME group
[F
(1,11)
= 26.195,
P < 0.001]
compared to D-gal group and control group
[F (1,11) = 20.770, P < 0.001].
119
Figure 3.15 Level of PSD-95 protein in hippocampus of individuals from different
groups. (A) Western blot analysis shows the level of PSD-95 protein in
hippocampus of individuals after contextual-associative learning,
(B) estimated level of PSD-95 expression. Values expressed in
mean ± SEM; * P < 0.05; *** P < 0.001.
120
DISCUSSION
Neuroprotective effect of BME was examined on D-gal induced aging model.
Several studies reported that BME enhances several aspects of mental functions in
animal models (Singh & Dhawan 1982; 1997; Das et al. 2002; Russo & Borelli 2005;
Uabundit et al. 2010). Recent studies reported that BME enhances the learning and
memory possibly by acting on the serotonergic system through 5-HT3A receptor (Prisila
et al. 2011; Emmanuvel Rajan et al. 2011).
In the present study, a contextual-
associative learning paradigm was used to measure the efficacy of BME against D-gal
induced brain aging. Age related changes in hippocampus were well documented in
rodents, which exhibits deficit in contextual learning (Luu et al. 2008). The results
demonstrate that BME treatment enhances the contextual-associative learning in rats
and showed more correct responses to retrieve reward with less latency. On the other
hand, the rats exhibited remarkable impairment in contextual-associative learning
i.e. specific odor and their respective context after daily subcutaneous injection of
D-gal for eight weeks.
The observed impairment possibly due to D-gal induced
formation of AGE, increase of AGE is a sign of pathogenesis of age and age-associated
disorders (Lu et al. 2006; Wu et al. 2008; Shan et al. 2009), which leads to reduction in
antioxidant enzymes activity (Cui et al. 2006). The observed results revealed that BME
treatment significantly improved the performance of D-gal treated rats in contextual
learning task. Rats exhibit more correct responses in retrieval of reward with less
latency. In order to understand the observed behavioural changes are associated with
D-gal induced aging, the level of AGE was examined. The analysis revealed that level
of AGE is elevated in D-gal administered rats.
However, the level of AGE was
decreased after BME administration in D-gal treated rats. Notably, level of AGE is
121
below the basal level in BME treated rats. Further D-gal induced oxidative damage
was investigated by analysing the level of antioxidant enzymes in hippocampus.
Earlier studies demonstrate that administration of D-gal enhances the formation of
reactive oxygen species (ROS), neuronal damage and reduction in learning and
memory (Zhang et al. 2005; Lu et al. 2006; Wu et al. 2008). D-gal could remarkably
cause decrease of SOD and GPx and the accumulation of ROS, whereas BME could
restore the activity of SOD and GPx and significantly enhanced the antioxidant activity.
It can be inferred that the neuroprotective effect of BME due to its up-regulation of
antioxidant enzymes. Supporting to the earlier report (Bhattacharya et al. 2000), the
obtained results showed a significant increase in the level of SOD and GPx after BME
treatment. The level of antioxidant enzymes were elevated after BME treatment in the
D-gal treated individuals, which suggest that BME attenuate the D-gal induced
oxidative damage possibly by eliminating free radicals.
Responding to oxidative stress, Nrf2 binds to the ARE and regulates ARE
mediated induction and expression of antioxidant genes (Johnson et al. 2008; de Vries
et al. 2008). Over expression of Nrf2 was shown to up-regulate the expression of
antioxidant genes and neuroprotection against neurodegenerative disease (Johnson et al.
2008; de Vries et al. 2008; Chen et al. 2009). These precedents drive to examine the
level of Nrf2 expression, estimated level of Nrf2 expression was elevated in BME
treated as well as D-gal and BME treated groups. The level of Nrf2 expression was
significantly low in D-gal treated individuals.
The analysis suggests that BME
attenuated the oxidative damage and thus enhancing cellular defense through the
activation of Nrf2.
122
Aging had been connected to decline in level of 5-HT and NE and their
metabolites in cortex, hippocampus and hypothalamus (Migues et al. 1999; Birthelmer
et al. 2003; Tsunemi et al. 2005). In line with the above reports the level of 5-HT and
NE in hippocampus might influence brain functions. In an effort to understand the
modulation of neurotransmitters, the level of 5-HT and NE was estimated in
hippocampus.
The present data are in line with previous reports in which aging
reduced the level of 5-HT and NE in hippocampus (Yau et al. 1999; Birthelmer et al.
2003). The observed values indicated that level of 5-HT and NE was declined in D-gal
group, whereas BME treatment found to normalise the D-gal induced reduction in
5-HT and NE level. The present study again showed that BME effectively act against
the neuronal damage and restore the level of neurotransmitters in hippocampus, and
improve the performance in contextual learning. Oxidation of synaptic proteins can
lead to reduction in synaptic functions, and ultimately cause neuronal damage
(Markesbery 1997). The obtained data hypothesized that the reduction in contextual
learning in D-gal treated rats possibly due to loss of synaptic proteins, and BME may
reverse the loss and leading to improved performance of D-gal treated rats in contextual
learning.
A panel of synaptic proteins known to be involved in synaptic plasticity-related
events in hippocampus were chosen (Zhao et al. 2009).
SYT acts as a calcium
dependent synaptic vesicle protein exclusively involved in synaptic vesicle docking and
neurotransmitter release (Schwarz 2004). A study by Wu et al. (2008) reported that
D-gal treatment showed a significant decline in the level of SYT expression in
hippocampus, which impaired their spatial memory task. SYP is a vesicle-associated
regulatory protein, involved in plasticity related changes in hippocampus (Holahan
123
et al. 2006; Sun et al. 2007), and in age-associated impairment (Smith et al. 2000; King
& Arendash 2002). Similar to the earlier reports, the level of SYT and SYP was
declined after D-gal administration. These findings suggest that decreasing the level of
these proteins possibly reduced synaptic communication and synaptic plasticity.
However, when BME was treated along with D-gal, the level of SYT and SYP
expression
was
communication
increased
and
and
synaptic
restored
function,
protein
level,
established
which
positively
synaptic
correlated
with
neurotransmitter release and behavioural performance of D-gal induced impaired rats in
contextual associative learning (Frick & Fernandez 2003; Evans & Cousin 2005).
Level of signalling components are essential for neurotransmission involved in synaptic
plasticity. PSD proteins CaMKII and PSD-95 are critical for LTP, and information
storage (Barria & Malinow 2005; Vaynman et al. 2007). Activation of CaMKII and
PSD-95 mediates neurotransmission, gene expression and synaptic plasticity
(El-Husseini et al. 2000; Wang et al. 2005; Nyffeler et al. 2007). Consequently, an
alteration in αCaMKII activity in hippocampus is correlated with age-related cognitive
deterioration, deficient synaptic plasticity and spatial learning (Giese et al. 1998;
Ahmed & Frey 2005; Zhang et al. 2009). PSD-95 which belongs to the family of
scaffolding proteins, and these are involved in organising signaling complexes and
interacts with ion channels, membrane receptors, cytoskeletal components and
signaling molecules at the post synaptic density (Garner et al. 2000). Western blot
analysis showed that rats with learning/memory impairment induced by D-gal showed a
decreased level of CaMKII and PSD-95 in hippocampus. Further, revealed that BME
increased the level of CaMKII and PSD-95 in the hippocampus of D-gal treated rats.
Declining the PSD proteins affect the interaction between the PSD proteins and which
leads to impairment in aged rats (Nicholson et al. 2004). These results suggested that
124
the increased level of CaMKII and its phosphorylation, and PSD-95 expression may
help to repair the learning and memory deficit caused by D-gal. The present study
demonstrate that BME treatment increase the SOD and GPX activity possibly by
up-regulating Nrf2 expression and then enhancing cellular defence mechanism. On the
other hand, it could increase release of neurotransmitters, level of synaptic proteins and
reverse D-gal induced contextual-associative learning impairment.
125
Summary
SUMMARY
The effect of B. monniera extract on the serotonergic system was investigated,
oral administration of BME enhanced the learning and retention of previously acquired
information significantly in all behavioural tasks. HPLC analysis showed the presence
of bioactive compound in the serum of BME treated rats, which demonstrated the
uptake of bacoside into the system. The bioactive compounds in the BME could
directly or indirectly interact with neurotransmitter systems to enhance learning and
memory. The balanced function of various neurotransmitters such as ACh, 5-HT,
GABA and Glu were all reported to involved in the regulation of memory formation.
Following BME treatment, the level of 5-HT increased while DA decreased
significantly, and the level of ACh was altered. However, the estimated variation was
not significant in the level of ACh and Glu. The level of 5-HT was significantly
elevated up to PND-37 and was then restored to normal level on PND-53.
Interestingly, concomitant up-regulation was recorded in the mRNA expression of
serotonin synthesizing enzyme Tph2 and SERT on PND-29 and PND-37, which was
normalised on PND-53. The results suggest that BME treatment significantly enhances
the learning and memory in postnatal rats possibly through up-regulating the expression
of Tph2, 5-HT biosynthesis and its transporter.
Subsequent activation of 5-HT receptors responding to elevated endogenous
5-HT level was examined.
Semi-quantitative RT-PCR was used to identify the
expression pattern of different 5-HT receptors.
The screening profile indicated a
notable increase in the 5-HT3A receptor expression after treatment with BME compared
to all other receptors (5-HT1A, 5-HT2A, 5-HT4, 5-HT5A, 5-HT6 and 5-HT7).
126
The
up-regulated 5-HT3A receptor may interact with serotonergic system or with other
neurotransmitters that is involved in learning and memory.
The 5-HT3A agonist
mCPBG function has facilitated to gain insight into the specific role of 5-HT3A receptor
in hippocampal-dependent learning and its interactions with other neurotransmitters.
Furthermore, 5-HT3A receptor agonist mCPBG impaired learning in the passive
avoidance task followed by reduction of 5-HT3A receptor expression, 5-HT and ACh
levels.
Administration of BME along with mCPBG attenuated mCPBG induced
behavioural, molecular and neurochemical alterations. Obtained results suggest that
BME possibly act on serotonergic system through 5-HT3A receptor to improve the
hippocampal-dependent task.
Further, to know the molecular mechanism of activated 5-HT3A receptor on
synaptic proteins, loss-of-function was developed by treating with D-gal in adult rats.
BME alone treated rats showed significantly improved behavioural performances in
contextual-associative learning, increased antioxidant markers and synaptic protein
levels as compared to control. Whereas, chronic administration of D-gal for 8 weeks
significantly impaired the behavioural performance accompanied by a significant
elevation in the level of AGE product than all other groups. Interestingly, upon BME
treatment, the D-gal treated rats exhibits improved behavioural performance and
significant up-regulation in the activity of anti-oxidant enzymes SOD, GPx and Nrf2
expression accompanied with an elevated level of 5-HT.
Better performance in
contextual associative learning was associated with concomitant increase in the levels
of mRNA and proteins of SYP, SYTI, CaMKII and PSD-95 proteins in the
hippocampus. Obtained data suggests that BME attenuates the D-gal induced cognitive
deficits by up-regulating the cellular antioxidant defense system regulating ARE via
127
activation of Nrf2. In addition, BME possibly increases the level of neurotransmitters,
and synaptic proteins thereby improving the contextual-associative learning. Thus,
these findings support the therapeutic efficacy of B. monniera to enhance the learning
efficiency in general and also to improve the age associated learning impairments.
128
References
REFERENCES
Achliya GS, Barabde U, Wadodkar S, Dorle A (2004) Effect of Bramhi Ghrita, an
polyherbal formulation on learning and memory paradigms in experimental animals.
Indian J Pharmacol 36:159-162.
Adolfsen B, Littleton JT (2001) Genetic and molecular analysis of the synaptotagmin
family. Cell Mol Life Sci 58:393-402.
Aghajanian GK, Sprouse JS, Sheldon P, Rasmussen K (1990) Electrophysiology of
the central serotonin system: receptor subtypes and transducer mechanisms. Ann N Y
Acad Sci 600:93-103.
Ahmari SE, Buchanan J, Smith SJ (2000) Assembly of presynaptic active zones from
cytoplasmic transport packets. Nat Neurosci 5:445-451.
Ahmed T, Frey JU (2005) Plasticity-specific phosphorylation of CaMKII,
MAP-kinases and CREB during late-LTP in rat hippocampal slices in vitro.
Neuropharmacology 49:477-492.
Alberini CM, Ghirardi M, Metz R, Kandel ER (1994) C/EBP is an immediate-early
gene required for the consolidation of long-term facilitation in Aplysia.
Cell 76:1099-1114.
Alex KD, Pehek EA (2007) Pharmacologic mechanisms of serotonergic regulation of
dopamine neurotransmission. Pharmacol Ther 113:296-320.
Allan AM, Galindo R, Chynoweth J, Engel SR, Savage DD (2001) Conditioned
place preference for cocaine is attenuated in mice overexpressing the 5-HT3 receptor.
Psychopharmacology 158:18-27.
Aloyo VJ, Dave KD (2007) Behavioral response to emotional stress in rabbits: role of
serotonin and serotonin2A receptors. Behav Pharmacol 18:651-659.
Amara SG, Kuhar MJ (1993) Neurotransmitter transporters: recent progress.
Annu Rev Neurosci 16:73-93.
Anand A, Saraf MK, Prabhakar S (2010) Antiamnesic effect of B. monniera on
L-NNA induced amnesia involves calmodulin. Neurochem Res 35:1172-1181.
Anderson GH, Johnston JL (1983) Nutrient control of brain neurotransmitter
synthesis and function. Can J Physiol Pharmacol 61:271-281.
Angers A, Storozhuk MV, Duchaine T, Castellucci VF, DesGroseillers L (1998)
Cloning and functional expression of an Aplysia 5-HT receptor negatively coupled to
adenylate cyclase. J Neurosci 18:5586-5593.
Antonova I, Arancio O, Trillat AC, Wang HG, Zablow L, Udo H, Kandel ER,
Hawkins RD (2001) Rapid increase in clusters of presynaptic proteins at onset of
long-lasting potentiation. Science 294:1547-1550.
129
Arias J, Alberts AS, Brindle P, Claret FX, Smeal T, Karin M, Feramisco J,
Montminy M (1994) Activation of cAMP and mitogen responsive genes relies on a
common nuclear factor. Nature 370:226-229.
Armstrong RC, Montminy MR (1993) Transsynaptic control of gene expression.
Annu Rev Neurosci 16:17-29.
Athos J, Impey S, Pineda VV, Chen X, Storm DR (2002) Hippocampal
CRE-mediated gene expression is required for contextual memory formation. Nature
Neurosci 5:1119-1120.
Atwood HL, Karunanithi S (2002) Diversification of synaptic strength: presynaptic
elements. Nat Rev Neurosci 3:497-516.
Augustine GJ (2001) How does calcium trigger neurotransmitter release? Curr Opin
Neurobiol 11:320-326.
Bailey CH, Chen M, Keller F, Kandel ER (1992) Serotonin-mediated endocytosis of
apCAM: an early step of learning-related synaptic growth in Aplysia. Science
256:645-649.
Bailey CH, Bartsch D, Kandel E (1996) Toward a molecular definition of long-term
memory storage. Proc Natl Acad Sci U S A 93:13445-13452.
Balschun D, Wolfer DP, Gass P, Mantamadiotis T, Welzl H, Schutz G, Frey JU,
Lipp HP (2003) Does cAMP response element-binding protein have a pivotal role in
hippocampal synaptic plasticity and hippocampus-dependent memory? J Neurosci
23:6304-6314.
Barbas D, Zappulla JP, Angers S, Bouvier M, Castellucci VF, DesGroseillers L
(2002) Functional characterization of a novel serotonin receptor (5-HTap2) expressed in
the CNS of Aplysia californica. J Neurochem 80:335-345.
Barber RD, Harmer DW, Coleman RA, Clark BJ (2005) GAPDH as a
housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human
tissues. Physiol Genomics 21:389-395.
Barnes CA (1994) Normal aging: regionally specific changes in hippocampal synaptic
transmission. Trends Neurosci 17:13-18.
Barnes CA (1995) Involvement of LTP in memory: are we "searching under the street
light"? Neuron 15:751-754.
Barnes JM, Costall B, Coughlan J, Domeney AM, Gerrard PA, Kelly ME, Navlor
RJ, Onaivi ES, Tomkins DM, Tvers MB (1990) The effects of ondansetron, a 5-HT3
receptor antagonist, on cognition in rodents and primates. Pharmacol Biochem Behav
35:955-962.
Barnes NM, Sharp T (1999) A review of central 5-HT receptors and their function.
Neuropharmacology 38:1083-1152.
130
Barondes SH (1970) Cerebral protein synthesis inhibitors block long-term memory.
Int Rev Neurobiol 12:177-205.
Barrett SCH, Strother JL (1978) Taxonomy and natural history of Bacopa
(Scrophulariaceae) in California. Syst Bot 5:408-419.
Barria A, Muller D, Derkach V, Griffith LC, Soderling TR (1997) Regulatory
phosphorylation of AMPA-type glutamate receptors by CaM-KII during long-term
potentiation. Science 276:2042-2045.
Barria A, Malinow R (2005) NMDA receptor subunit composition controls synaptic
plasticity by regulating binding to CaMKII. Neuron 48:289-301.
Bartsch D, Casadio A, Karl KA, Serodio P, Kandel ER (1998) CREB1 encodes a
nuclear activator, a repressor, and a cytoplasmic modulator that form a regulatory unit
critical for long-term facilitation. Cell 95:211-223.
Basu N, Rastogi RP, Dhar ML (1967) Chemical examination of Bacopa monnieri
Wettst: part III - Bacoside B. Indian J Chem 5:84-86.
Bear MF, Connors BW, Paradiso MA (1996) Neuroscience: exploring the brain.
Lippincott Williams & Wilkins press, Baltimore.
Beaulieu JM, Zhang X, Rodriguiz RM, Sotnikova TD, Cools MJ, Wetsel WC,
Gainetdinov RR, Caron MG (2008) Role of GSK3β in behavioural abnormalities
induced by serotonin deficiency. Proc Natl Acad Sci U S A 105:1333-1338.
Beique JC, Andrade R (2003) PSD-95 regulates synaptic transmission and plasticity
in rat cerebral cortex. J Physiol 546:859-867.
Bell IR, Hardin EE, Baldwin CM, Schwartz GE (1995) Increased limbic system
symptomatology and sensitizability of young adults with chemical and noise
sensitivities. Environ Res 70:84-97.
Ben-Ari Y (2002) Excitatory actions of gaba during development: the nature of the
nurture. Nat Rev Neurosci 3:728-739.
Berecek KH, Brody MJ (1982) Evidence for a neurotransmitter role for epinephrine
derived from the adrenal medulla. Am J Physiol 242:H593-601.
Bethus I, Tse D, Morris RG (2010) Dopamine and memory: modulation of the
persistence of memory for novel hippocampal NMDA receptor-dependent paired
associates. J Neurosci 30:1610-1618.
Bhattacharya SK (1994) Nootropic effect of BR-16A (Mentat), a psychotropic herbal
formulation, on cognitive deficits induced by prenatal undernutrition, postnatal
environmental impoverishment and hypoxia in rats. Indian J Exp Biol 32:31-36.
131
Bhattacharya SK, Kumar A (1997) Effect of Trasina, an ayurvedic herbal
formulation, on experimental models of Alzheimer's disease and central cholinergic
markers in rats. J Altern Complement Med 3:327-336.
Bhattacharya SK, Bhattacharya A, Kumar A, Ghosal S (2000) Antioxidant activity
of Bacopa monniera in rat frontal cortex, striatum and hippocampus. Phytother Res
14:174-179.
Birthelmer A, Stemmelin J, Jackisch R, Cassel JC (2003) Presynaptic modulation of
acetylcholine, noradrenaline, and serotonin release in the hippocampus of aged rats
with various levels of memory impairments. Brain Res Bull 60:283-296.
Bito H, Deisseroth K, Tsien RW (1996) CREB phosphorylation and
dephosphorylation: a Ca2+ and stimulus duration-dependent switch for hippocampal
gene expression. Cell 87:1203-1214.
Blakely RD, Berson HE, Fremeau RT, Caron MG, Peek MM, Prince HK, Bradley
CC (1991) Cloning and expression of a functional serotonin transporter from rat brain.
Nature 354:66-70.
Blakely RD, De Felice LJ, Hartzell HC (1994) Molecular physiology of
norepinephrine and serotonin transporters. J Exp Biol 196:263-281.
Blakely RD (2001) Physiological genomics of antidepressant targets: keeping the
periphery in mind. J Neurosci 21:8319-8323.
Blandina P, Goldfarb J, Craddock-Royal B, Green JP (1989) Release of
endogenous dopamine by stimulation of 5-hydroxytryptamine3 receptors in rat striatum.
J Pharmacol Exp Ther 251:803-809
Blokland A (1996) Acetylcholine: a neurotransmitter for learning and memory? Brain
Res Rev 21:285-300.
Bockaert J, Claeysen S, Compan V, Dumuis A (2004) 5-HT4 receptors. Curr Drug
Targets CNS Neurol Disord 3:39-51.
Bose KC, Bose NK (1931) Observations on the actions and uses of Herpestis
monniera. J Indian Med Assoc 1:60.
Bourtchuladze R, Frenguelli B, Blendy J, Cioffi D, Schutz G, Silva AJ (1994)
Deficient long-term memory in mice with a targeted mutation of the cAMP-responsive
element-binding protein. Cell 79:59-68.
Bourtchouladze R, Abel T, Berman N, Gordon R, Lapidus K, Kandel ER (1998)
Different training procedures recruit either one or two critical periods for contextual
memory consolidation, each which requires protein synthesis and PKA. Learn Mem
5:365-374.
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem
72:248-254.
132
Brizee K (1975) Neurobiology and aging in non-human primates. Plenum press, New
York.
Brooks V, Hilperath F, Brooks M, Ross HG, Freund HJ (1995) Learning "what"
and "how" in a human motor task. Learn Mem 2:225-243.
Brose N, Petrenko AG, Sudhof TC, Jahn R (1992) Synaptotagmin: a calcium sensor
on the synaptic vesicle surface. Science 256:1021-1025.
Brown TH, Chapman PF, Kairis EW, Keenan CL (1988) Long-term synaptic
potentiation. Science 242:724-728.
Brunger AT (2005) Structure and function of SNARE and SNARE-interacting
proteins. Q Rev Biophys 38:1-47
Buhot MC, Patra SK, Naili S (1995) Spatial memory deficits following stimulation of
hippocampal 5-HT1B receptors in the rat. Eur J Pharmacol 285:221-228.
Buhot MC (1997) Serotonin receptors in cognitive behaviors. Curr Opin Neurobiol
7:243-254.
Buhot MC, Martin S, Segu L (2000) Role of serotonin in memory impairment.
Ann Med 32:210-221.
Burchinsky SG (1985) Changes in the functional interactions of neurotransmitter
systems during aging: neurochemical and clinical aspects. J Clin Exp Gerontol 7:1-30.
Bures J, Buresova O, Huston JP (1983) Techniques and basic experiments for study
of brain and behaviour. Elsevier Science Publishers, Amsterdam-New York,
pp. 148-160.
Byrne JH, Kandel ER (1996) Presynaptic facilitation revisited: state and time
dependence. J Neurosci 16:425-435.
Cammarota M, Bevilaqua LR, Medina JH, Izquierdo I (2008) ERK1/2 and
CaMKII-mediated events in memory formation: is 5HT regulation involved? Behav
Brain Res 195:120-128.
Campbell AD, Womer DE, Simon JR (1995) The 5-HT3 receptor agonist
1-(m-chlorophenyl)-biguanide interacts with the dopamine transporter in rat brain
synaptosomes. Eur J Pharmacol 290:157-162.
Carfagna N, Trunzo F, Moretti A (1985) Brain catecholamine content and turnover
in aging rats. Exp Gerontol 20:265-269.
Carlsson A, Waters N, Carlsson ML (1999) Neurotransmitter interactions in
schizophrenia-therapeutic implications. Biol Psychiatry 46:1388-1395.
Cavallaro S (2008) Genomic analysis of serotonin receptors in learning and memory.
Behav Brain Res 195:2-6.
133
Centonze D, Picconi B, Gubellini P, Bernardi G, Calabresi P (2001) Dopaminergic
control of synaptic plasticity in the dorsal striatum. Eur J Neurosci 13:1071-1077.
Chakravarty AK, Sarkar T, Masuda K, Shiojima K, Nakane T, Kawahara N
(2001) Bacopasides I and II: two psedojujubojenin glycosides from Bacopa monniera.
Phytochemistry 58:553-556.
Chakravarty AK, Garai S, Masuda K, Nakane T, Kawahara N (2003) Bacopasides
III-V: three new triterpenoid glycosides from Bacopa monniera. Chem Pharm Bull
51:215-217.
Chamas F, Serova L, Sabban EL (1999) Tryptophan hydroxylase mRNA levels are
elevated by repeated immobilization stress in rat raphe nuclei but not in pineal gland.
Neurosci Lett 267:157-160.
Chamizo C, Rubio JM, Moreno J, Alvar J (2001) Semi-quantitative analysis of
multiple cytokines in canine peripheral blood mononuclear cells by a single tube
RT-PCR. Vet Immunol Immunopathol 83:191-202.
Chandel RS, Kulshreshtha DK, Rastogi RP (1977) Bacogenin A3: a new sapogenin
from Bacopa monniera. Phytochemistry 16:141-143.
Chapman ER, Jahn R (1994) Calcium-dependent interaction of the cytoplasmic
region of synaptotagmin with membranes. Autonomous function of a single
C2-homologous domain. J Biol Chem 269:5735-5741.
Chatterji N, Rastogi RP, Dhar ML (1963) Chemical examination of Bacopa
monniera Wettst: isolation of chemical constituents. Indian J Chem 1:212-215.
Chatterji N, Rastogi RP, Dhar ML (1965) Chemical examination of Bacopa
monniera Wettst: the constitution of bacoside A. Indian J Chem 3:24-29.
Chen PC, Vargas MR, Pank AK, Smeyne RJ, Johnson DA, Kan YW, Johnson JA
(2009) Nrf2-mediated neuroprotection in the MPTP mouse model of Parkinson’s
disease: critical role for the astrocyte. Proc Natl Acad Sci U S A 106:2933-2938.
Chiu R, Boyle WJ, Meek J, Smeal T, Hunter T, Karin M (1988) The c-Fos protein
interacts with c-Jun/AP-1 to stimulate transcription of AP-1 responsive genes.
Cell 54:541-552.
Cho KO, Hunt CA, Kennedy MB (1992) The rat brain postsynaptic density fraction
contains a homolog of the Drosophila disc-large tumor suppressor protein.
Neuron 9:929-942.
Chopra RN, Nayar L, Chopra IC (1956) Glossary of Indian Medicinal Plants.
Council of Scientific and Industrial Research, New Delhi. vol 32.
Chowdhuri DK, Parmar D, Kakkar P, Shukla R, Seth P, Srimal RC (2002)
Antistress effects of bacosides of Bacopa monnieri: modulation of Hsp70 expression,
superoxide dismutase and cytochrome P450 activity in rat brain. Phytother Res
16:639-645.
134
Chunekar KC (1960) Bhav prakasa nighantu. Varanasi: Hindi translation, 372.
Cifariello A, Pompili A, Gasbarri A (2008) 5-HT7 receptors in the modulation of
cognitive processes. Behav Brain Res 195:171-179.
Cohen JE, Onyike CU, McElroy VL, Lin AH, Abrams TW (2003) Pharmacological
characterization of an adenylyl cyclase-coupled 5-HT receptor in Aplysia: comparison
with mammalian 5-HT receptors. J Neurophysiol 89:1440-1455.
Consolo S, Bertorelli R, Russi G, Zambelli M, Ladinsky H (1994) Serotonergic
facilitation of acetylcholine release in vivo from rat dorsal hippocampus via serotonin
5-HT3 receptors. J Neurochem 62:2254-2261.
Consolo S, Ramponi S, Ladinsky H, Baldi G (1996) A critical role for D1 receptors
in the 5-HT1A-mediated facilitation of in vivo acetylcholine release in rat frontal cortex.
Brain Res 707:320-323.
Corradetti R, Ballerini L, Pugliese AM, Pepeu G (1992) Serotonin blocks the
long-term potentiation induced by primed burst stimulation in the CA1 region of rat
hippocampal slices. Neuroscience 46:511-518.
Cote F, Thevenot E, Fligny C, Fromes Y, Darmon M, Ripoche MA, Bayard E,
Hanoun N, Saurini F, Lechat P, Dandolo L, Hamon M, Mallet J, Vodjdani G
(2003) Disruption of the nonneuronal tph1 gene demonstrates the importance of
peripheral serotonin in cardiac function. Proc Natl Acad Sci U S A 100:13525-13530.
Craxton M (2001) Genomic analysis of synaptotagmin genes. Genomics 77:43-49.
Crow T, Xue Bian JJ, Siddiqui V, Neary JT (2001) Serotonin activation of the ERK
pathway in Hermissenda: contribution of calcium-dependent protein kinase C.
J Neurochem 78:358-364.
Cui X, Li W, Zhang B, Zhang J (1998) Mechanism of lipid peroxidation in
D-galactose induced brain aging model. Chin J Gerontol 18:38-40.
Cui X, Zhang B, Li W, Cai Y, Sun J (2000) Studies on the relationship between cell
senescence induced by D-galactose and injurious effects of free radical. Basic Med Sci
Clinics 20:24-26.
Cui X, Zuo P, Zhang Q, Li X, Hu Y, Long J, Packer L, Liu J (2006) Chronic
systemic D-galactose exposure induces memory loss, neurodegeneration, and oxidative
damage in mice: protective effects of R-alpha-lipoic acid. J Neurosci Res
83:1584-1590.
Curzon G (1995) Serotonergic aspects of feeding. In: Takada A, Curzon G (eds.),
Serotonin in the central nervous system and periphery. Elsevier, Amsterdam, pp. 42-51.
D’Agata V, Cavallaro S (2003) Hippocampal gene expression profiles in passive
avoidance conditioning. Eur J Neurosci 18:2835-2841.
135
Daly C, Ziff EB (1997) Post-transcriptional regulation of synaptic vesicle protein
expression and the developmental control of synaptic vesicle formation. J Neurosci
17:2365-2375.
Dan Y, Poo MM (1994) Retrograde interactions during formation and elimination of
neuromuscular synapses. Curr Opin Neurobiol 4:95-100.
Das A, Shanker G, Nath C, Pal R, Singh S, Singh HK (2002) A comparative study in
rodents of standardized extracts of Bacopa monniera and Ginkgo biloba:
anticholinesterase and cognitive enhancing activities. Pharmacol Biochem Behav
73:893-900.
Das A, Rai D, Dikshit M, Palit G, Nath C (2005) Nature of stress: differential effects
on brain acetylcholinesterase activity and memory in rats. Life Science 77:2299-2311.
Dash PK, Hochner B, Kandel ER (1990) Injection of the cAMP-responsive element
into the nucleus of Aplysia sensory neurons blocks long-term facilitation. Nature
345:718-721.
Davis HP, Squire LR (1984) Protein synthesis and memory: a review. Psychol Bull
96:518-559.
Davis AF, Bai J, Fasshauer D, Wolowick MJ, Lewis JL, Chapman ER (1999)
Kinetics of synaptotagmin responses to Ca2+ and assembly with the core SNARE
complex onto membranes. Neuron 24:363-376.
Davletov BA, Sudhof TC (1993) A single C2 domain from synaptotagmin I is
sufficient for high affinity Ca2+/phospholipid binding. J Biol Chem 268:26386-26390.
Dawson LA, Nguyen HQ, Li P (2001) The 5-HT6 receptor antagonist SB-271046
selectively enhances excitatory neurotransmission in the rat frontal cortex and
hippocampus. Neuropsychopharmacology 25:662-668.
Dawson LA, Nguyen HQ, Li P (2003) Potentiation of amphetamine induced changes
in dopamine and 5-HT by a 5-HT6 receptor antagonist. Brain Res Bull 59:513-521.
de Vries HE, Witte M, Hondius D, Rozemuller AJM, Drukarch B, Hoozemans J,
van Horssen J (2008) Nrf2-induced antioxidant protection: a promising target to
counteract ROS-mediated damage in neurodegenerative disease? Free Radic Biol Med
45:1375-1383.
Decker MW, McGaugh JL (1991) The role of interactions between the cholinergic
system and other neuromodulatory systems in learning and memory. Synapse
7:151-168.
Deepak M, Sangli GK, Arun PC, Amit A (2005) Quantitative determination of the
major saponin mixture bacoside A in Bacopa monnieri by HPLC. Phytochem Anal
16:24-29.
Deisseroth K, Bito H, Tsien RW (1996) Signaling from synapse to nucleus:
postsynaptic CREB phosphorylation during multiple forms of hippocampal synaptic
plasticity. Neuron 16:89-101.
136
Derkach V, Barria A, Soderling TR (1999) Ca2+/calmodulin-KII enhances channel
conductance of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate type glutamate
receptors. Proc Natl Acad Sci U S A 96:3269-3274.
Descarries L, Gisiger V, Steriade M (1997) Diffuse transmission by acetylcholine in
the CNS. Prog Neurobiol 53:603-625.
Dhanasekaran M, Tharakan B, Holcomb LA, Hitt AR, Young KA, Manyam BV
(2007) Neuroprotective mechanisms of ayurvedic antidementia botanical Bacopa
monniera. Phytother Res 21:965-969.
Diez-Ariza M, Ramirez MJ, Lasheras B, Del Rio J (1998) Differential interaction
between 5-HT3 receptors and GABAergic neurons inhibiting acetylcholine release in
rat entorhinal cortex slices. Brain Res 801:228-232.
Ding Y, Li J, Lai Q, Azam S, Rafols JA, Diaz FG (2002) Functional improvement
after motor training is correlated with synaptic plasticity in rat thalamus. Neurol Res
24:829-836.
Dorostkar MM, Boehm S (2007) Opposite effects of presynaptic 5-HT3 receptor
activation on spontaneous and action potential-evoked GABA release at hippocampal
synapses. J Neurochem 100:395-405.
Dutton AC, Barnes NM (2008) 5-Hydroxytryptamine in the central nervous system.
In: Lajtha A, Vizi ES (eds.), Handbook of neurochemistry and molecular neurobiology:
neurotransmitter systems. Springer, United States, pp. 171-212.
Earles CA, Bai J, Wang P, Chapman ER (2001) The tandem C2 domains of
synaptotagmin contain redundant Ca2+ binding sites that cooperate to engage
t-SNAREs and trigger exocytosis. J Cell Biol 154:1117-1123.
Eglen RM, Wong EHF, Dumuis A, Bockaert J (1995) Central 5-HT4 receptors.
Trends Pharmacol Sci 16:391-397.
El-Husseini AE, Schnell E, Chetkovich DM, Nicoll RA, Bredt DS (2000) PSD-95
involvement in maturation of excitatory synapses. Science 290:1364-1368.
Emmanuvel Rajan K, Singh HK, Parkavi A, Charles PD (2011) Attenuation of
1-(m-chlorophenyl)-biguanide induced hippocampus-dependent memory impairment
by a standardised extract of Bacopa monniera (BESEB CDRI-08). Neurochem Res
36:2136-2144.
Emptage NJ, Carew TJ (1993) Long-term synaptic facilitation in the absence of
short-term facilitation in Aplysia neurons. Science 262:253-256.
Evans GJ, Cousin MA (2005) Tyrosine phosphorylation of synaptophysin in synaptic
vesicle recycling. Biochem Soc Trans 33:1350-1353.
Faruqi S, Andrade C, Rarnteke S, Joseph J, Venkataraman BV, Naga Rani MA
(1995) Herbal pharmacotherapy for the attenuation of electroconvulsive shock-induced
anterograde and retrograde amnestic deficits. Convuls Ther 11:241-247
137
Fernandez I, Arac D, Ubach J, Gerber SH, Shin O, Gao Y, Anderson RG, Sudhof
TC, Rizo J (2001) Three-dimensional structure of the synaptotagmin 1 C2B-domain:
synaptotagmin 1 as a phospholipid binding machine. Neuron 32:1057-1069.
Fernandez-Chacon R, Shin OH, Konigstorfer A, Matos MF, Meyer AC, Garcia J,
Gerber SH, Rizo J, Sudhof TC, Rosenmund C (2002) Structure/function analysis of
Ca2+ binding to the C2A domain of synaptotagmin 1. J Neurosci 22:8438-8446.
Fernstrom JD (1994) Dietary amino acids and brain function. J Am Diet Assoc
94:71-77.
Ferreira A, Rapoport M (2002) The synapsins: beyond
neurotransmitter release. Cell Mol Life Sci 59:589-595.
the
regulation
of
Fink CC, Meyer T (2002) Molecular mechanisms of CaMKII activation in neuronal
plasticity. Curr Opin Neurobiol 12:293-299.
Fink KB, Gothert M (2007) 5-HT receptor regulation of neurotransmitter release.
Pharmacol Rev 59:360-417.
Fioravante D, Smolen PD, Byrne JH (2006) The 5-HT-and FMRFa-activated
signaling pathways interact at the level of the Erk MAPK cascade: potential inhibitory
constraints on memory formation. Neurosci Lett 396:235-240.
Felmlee MA, Roiko SA, Morse BL, Morris ME (2010) Concentration-effect
relationships for the drug of abuse gamma-hydroxybutyric acid. J Pharmacol Exp Ther
333:764-771.
Fletcher TL, Cameron P, De Camilli P, Banker G (1991) The distribution of
synapsin I and synaptophysin in hippocampal neurons developing in culture. J Neurosci
11:1617-1626.
Frey U, Schroeder H, Matthies H (1990) Dopaminergic antagonists prevent
long-term maintenance of posttetanic LTP in the CA1 region of rat hippocampal slices.
Brain Res 522:69-75.
Frick KM, Fernandez SM (2003) Enrichment enhances spatial memory and increases
synaptophysin levels in aged female mice. Neurobiol Aging 24:615-626.
Fujino K, Yoshitake T, Inoue O, Ibii N, Kehr J, Ishida J, Nohta H, Yamaguch M
(2002) Increased serotonin release in mice frontal cortex and hippocampus induced by
acute physiological stressors. Neurosci Lett 320:91-95.
Fujita M, Shimada S, Maeno H, Nishimura T, Tohyama M (1993) Cellular
localization of serotonin transporter mRNA in the rat brain. Neurosci Lett 162:59-62.
Fukunaga K, Stoppini L, Miyamoto E, Muller D (1993) Long-term potentiation is
associated with an increased activity of Ca2+/calmodulin protein kinase II. J Biol Chem
268:7863-7867.
138
Fukunaga K, Muller D, Miyamoto E (1995) Increased phosphorylation of
Ca2+/calmodulin-dependent protein kinase II and its endogenous substrates in the
induction of long-term potentiation. J Biol Chem 270:6119-6124.
Gainetdinov RR, Wetsel WC, Jones SR, Levin ED, Jaber M, Caron MG (1999)
Role of serotonin in the paradoxical effect of calming psychostimulants on
hyperactivity. Science 283:397-401.
Gainetdinov RR, Caron MG (2003) Monoamine transporters: from genes to behavior.
Ann Rev Pharmacol Toxicol 43:261-284.
Garay S, Mahato SB, Ohtani K, Yamasaki K (1996a) Dammarane-type triterpenoid
saponins from Bacopa monniera. Phytochemistry 42:815-820.
Garay S, Mahato SB, Ohtani K, Yamasaki K (1996b) Bacosaponin
D-a pseudojujubogenin glycoside from Bacopa monniera. Phytochemistry 43:447-449.
Gardoni F, Schrama LH, Kamal A, Gispen WH, Cattabeni F, Di Luca M (2001)
Hippocampal synaptic plasticity involves competition between Ca2+/calmodulindependent protein kinase II and postsynaptic density 95 for binding to the NR2A
subunit of the NMDA receptor. J Neurosci 21:1501-1509.
Garner CC, Nash J, Huganir RL (2000) PDZ domains in synapse assembly and
signaling. Trends Cell Biol 10:274-280.
Ge J, Barnes NM (1996) 5-HT4 receptor-mediated modulation of 5-HT release in the
rat hippocampus in vivo. Br J Pharmacol 117:1475-1480.
Geinisman Y, de Toledo-Morrell L, Morrell F, Heller TF (1995) Hippocampal
markers of age-related memory dysfunction: behavioral electrophysiological and
morphological perspectives. Prog Neurobiol 45:223-252.
Geppert M, Goda Y, Hammer RE, Li C, Rosahl TW, Stevens CF, Sudhof TC
(1994) Synaptotagmin I: a major Ca2+sensor for transmitter release at a central synapse.
Cell 79:717-727.
Ghirardi M, Montarolo PG, Kandel ER (1995) A novel intermediate stage in the
transition between short- and long-term facilitation in the sensory to motor neuron
synapse of Aplysia. Neuron 14:413-420.
Ghosh A, Greenberg ME (1995) Calcium signaling in neurons: molecular
mechanisms and cellular consequences. Science 268:239-247.
Ghosh T, Maity TK, Sengupta P, Dash DK, Bose A (2008) Antidiabetic and in vivo
antioxidant activity of ethanolic extract of Bacopa monnieri Linn.
Aerial part: a possible mechanism of action. Iranian J Pharm Res 7:61-68.
Giese KP, Fedorov NB, Filipkowski RK, Silva AJ (1998) Autophosphorylation at
Thr286 of the alpha calcium-calmodulin kinase II in LTP and learning. Science
279:870-873.
139
Giovannini MG, Ceccarelli I, Molinari B, Cecchi M, Goldfarb J, Blandina P
(1998) Serotonergic modulation of acetylcholine release from cortex of freely moving
rats. J Pharmacol Exp Ther 285:1219-1225.
Glassman E (1969) The biochemistry of learning: an evaluation of the role of RNA
and protein. Annu Rev Biochem 38:605-646.
Glowinski J, Iversen LL (1966) Regional studies of catecholamines in the rat brain.
I. The disposition of [3H] norepinephrine, [3H] dopamine and [3H] dopa in various
regions of the brain. J Neurochem 13:655-669.
Goelet P, Castellucci VF, Schacher S, Kandel E (1986) The long and short of
long-term memory: a molecular framework. Nature 322:4419-4422.
Golomb J, Deleon MJ, Kluger A, George AE, Tarshish C, Ferris SH (1993)
Hippocampal atrophy in normal aging. An association with recent memory impairment.
Arch Neurol 50:967-973.
González-Burgos I, Feria-Velasco A (2008) Serotonin/dopamine interaction in
memory formation. Prog Brain Res 172:603-623.
Graeff FG, Guimaraes FS, De Andrade TG, Deakin JF (1996) Role of 5-HT in
stress, anxiety, and depression. Pharmacol Biochem Behav 54:129-141.
Greengard P (2001) The neurobiology of slow synaptic transmission. Science
294:1024-1030.
Hai T, Curran T (1991) Cross-family dimerization of transcription factors Fos/Jun and
ATF/CREB alters DNA binding specificity. Proc Natl Acad Sci U S A 88:3720-3724.
Handu SS, Bhargava VK (1997) Effect of BR-16A (Mentat) on cognitive deficits in
aluminium-treated and aged rats. Indian J Pharmacol 29:258-261.
Hardingham GE, Arnold FJL, Bading H (2001) Nuclear calcium signaling controls
CREB-mediated gene expression triggered by synaptic activity. Nat Neurosci
4:261-267.
Harrell AV, Allan AM (2003) Improvements in hippocampal-dependent learning and
detrimental attention in 5-HT3 receptor over expressing mice. Learn Mem 10:410-419.
Harvey JA (1996) Serotonergic regulation of associative learning. Behav Brain Res
73:47-50.
Hayashi Y, Shi S, Esteban J, Piccini A, Poncer J, Malinow R (2000) Driving AMPA
receptors into synapses by LTP and CaMKII: requirement for GluR1 and PDZ domain
interaction. Science 287:2262-2267.
Herremans AHJ (1995) Serotonergic drug effects on a delayed conditional
discrimination task in the rat; involvement of the 5-HT1A receptor in working memory.
J Psychopharmacol 9:242-250.
140
Herrera DG, Robertson HA (1996) Activation of c-fos in the brain. Prog Neurobiol
50: 83-107.
Hersch SM, Yi H, Heilman CJ, Edwards RH, Levey AI (1997) Subcellular
localization and molecular topology of dopamine transporter in the striatum and
substantia nigra. J Comp Neurol 388:211-227.
Hirst WD, Stean TO, Rogers DC, Sunter D, Pugh P, Moss SF, Bromidge SM,
Riley G, Smith DR, Bartlett S, Heidbreder CA, Atkins AR, Lacroix LP, Dawson
LA, Foley AG, Regan CM, Upton N (2006) SB-399885 is a potent, selective 5-HT6
receptor antagonist with cognitive enhancing properties in aged rat water maze and
novel object recognition models. Eur J Pharmacol 553:109-119.
Holahan MR, Rekart JL, Sandoval J, Routtenberg A (2006) Spatial learning
induces presynaptic structural remodeling in the hippocampal mossy fiber system of
two rat strains. Hippocampus 16:560-570.
Holcomb LA, Dhanasekaran M, Hitt AR, Young KA, Riggs M, Manyam BV
(2006) Bacopa monniera extract reduces amyloid levels in PSAPP mice. J Alzheimers
Dis 9:243-251.
Hong E, Meneses A (1996) Systemic injection of p-chloroamphetamine eliminates the
effect of the 5-HT3 compounds on learning. Pharmacol Biochem Behav 53:765-769.
Hota SK, Barhwal K, Baitharu I, Prasad D, Singh SB, Ilavazhagan G (2009)
Bacopa monniera leaf extract ameliorates hypobaric hypoxia induced spatial memory
impairment. Neurobiol Dis 34:23-39.
Hou CC, Lin SJ, Cheng JT, Hsu FL (2002) Bacopaside III, bacopasaponin G, and
bacopasides A, B, and C from Bacopa monniera. J Nat Prod 65:1759-1763.
Hoyer D, Clarke DE, Fozard JR, Hartig PR, Martin GR, Mylecharane EJ, Saxena
PR, Humphrey PP (1994) International Union of Pharmacology classification of
receptors for 5-hydroxytryptamine (Serotonin). Pharmacol Rev 46:157-203.
Hoyer D, Hannon JP, Martin GR (2002) Molecular, pharmacological and functional
diversity of 5-HT receptors. Pharmacol Biochem Behav 71:533-554.
Hsieh CL, Cheng CY, Tsai TH, Lin IH, Liu CH, Chiang SY, Lin JG, Lao CJ,
Tang NY (2006) Paeonol reduced cerebral infarction involving the superoxide anion
and microglia activation in ischemia-reperfusion injured rats. J Ethnopharmacol
106:208-215.
Hua X, Lei M, Zhang Y, Ding J, Han Q, Hu G, Xiao M (2007) Long-term
D-galactose injection combined with ovariectomy serves as a new rodent model for
Alzheimer's disease. Life Sci 80:1897-1905.
Huang YY, Kandel ER (1995) D1/D5 receptor agonists induce a protein synthesisdependent late potentiation in the CA1 region of the hippocampus. Proc Natl Acad
Sci U S A 92:2446-2450.
141
Hughes P, Dragunow M (1995) Induction of immediate-early genes and the control of
neurotransmitter-regulated gene expression within the nervous system. Pharmacol Rev
47:133-178.
Hussain AM, Mitra AK (2000) Effect of aging on tryptophan hydroxylase in rat brain:
implications on serotonin level. Drug Metab Dispos 28:1038-1042.
Igaz LM, Vianna MR, Medina JH, Izquierdo I (2002) Two time periods of
hippocampal mRNA synthesis are required for memory consolidation of fear-motivated
learning. J Neurosci 22:6781-6789.
Inoue A, Okabe S (2003) The dynamic organization of postsynaptic proteins:
translocating molecules regulate synaptic function. Curr Opin Neurobiol 13:332-340.
Inoue T, Koyama T, Tsuchiya K, Yamashita I (1993) The potentiation of
serotonergic activity reduces conditioned fear-induced freezing behavior.
Jpn J Psychiatry Neurol 47:420-421.
Inoue T, Tsuchiya K, Koyama T (1994) Regional changes in dopamine
and serotonin activation with various intensity of physical and psychological stress in
the rat brain. Pharmacol Biochem Behav 49:911-920.
Ishibashi H (2002) Increased synaptophysin expression through whisker stimulation in
rat. Cell Mol Neurobiol 22:191-195.
Itoh K, Wakabayashi N, Katoh Y, Ishii T, O Connor T, Yamamoto M (2003)
Keap1 regulates both cytoplasmic-nuclear shuttling and degradation of Nrf2 in
response to electrophiles. Genes Cells 8:379-391.
Iyer MR, Pal SC, Kasture VS, Kasture SB (1998) Effect of Lawsonia inermis on
memory and behaviour mediated via monoamine neurotransmitters. Indian
J pharmacol 30:181-185.
Izquierdo I, Barros DM, Mello e Souza T, de Souza MM, Izquierdo LA, Medina
JH (1998) Mechanisms for memory types differ. Nature 393:635-636.
Izquierdo I, Bevilaqua LR, Rossato JI, Bonini JS, Medina JH, Cammarota M
(2006) Different molecular cascades in different sites of the brain control memory
consolidation. Trends Neurosci 29:496-505.
Jacobs BL, Azmitia EC (1992) Structure and function of the brain serotonin system.
Physiol Rev 72:165-229.
Jahn R, Lang T, Sudhof TC (2003) Membrane Fusion. Cell 112:519-533.
Jaiswal AK (2004) Nrf2 signaling in coordinated activation of antioxidant gene
expression. Free Radic Biol Med 36:1199-1207.
Jayanthi LD, Ramamoorthy S (2005) Regulation of monoamine transporters:
influence of psychostimulants and therapeutic antidepressants. AAPS J 7:E728-738.
142
Jernigan TL, Archibald SL, Berhow MT, Sowell ER, Foster DS, Hesselink JR
(1991) Cerebral structure on MRI, part I: localization of age-related changes. Biol
Psychiatry 29:55-67.
Ji W, Suga N (2007) Serotonergic modulation of plasticity of the auditory cortex
elicited by fear conditioning. J Neurosci 27:4910-4918.
Johnson JA, Johnson DA, Kraft AD, Calkins MJ, Jakel RJ, Vargas MR, Chen PC
(2008) The Nrf2-ARE pathway: an indicator and modulator of oxidative stress in
neurodegeneration. Ann N Y Acad Sci 1147:61-69.
Joshi H, Parle M (2006) Brahmi rasayana improves learning and memory in mice.
Evid Based Complement Alternat Med 3:79-85.
Jyoti A, Sharma D (2006) Neuroprotective role of Bacopa monnieri extract against
aluminium-induced oxidative stress in the hippocampus of rat brain. Neurotoxicology
27:451-457.
Kahn R, Wetzler S, van Praag HM, Asnis GM, Strauman T (1988a) Behavioral
indications for serotonin receptor hypersensitivity in panic disorder. Psychiatry Res
25:101-104.
Kahn RS, Asnis GM, Wetzler S, van Praag HM (1988b) Neuroendocrine evidence
for serotonin receptor hypersensitivity in panic disorder. Psychopharmacology
96:360-364.
Kalsner S, Westfall TC (1990) Presynaptic receptors and the question of
autoregulation of neurotransmitter release. Ann N Y Acad Sci 604:1-652.
Kandel ER (2001) The molecular biology of memory storage: a dialogue between
genes and synapses. Science 294:1030-1038.
Kandel, ER, JH Schwartz, TM Jessell (2000) Principles of neural science. McGrawHill press, New York.
Kant GJ, Wylie RM, Vasilakis AA, Ghosh S (1996) Effects of triazolam and
diazepam on learning and memory as assessed using a water maze. Pharmacol
Biochem Behav 53:317-322.
Karlin A (2002) Emerging structure of the nicotinic acetylcholine receptors. Nat Rev
Neurosci 3:102-114.
Khakh BS, Henderson G (2000) Modulation of fast synaptic transmission by
presynaptic ligand-gated cation channels. J Auton Nerv Syst 81:110-121.
Khalifa AE (2001) Hypericum perforatum as a nootropic drug: enhancement of
retrieval memory of a passive avoidance conditioning paradigm in mice.
J Ethnopharmacol 76:49-57.
Khaliq S, Haider S, Ahmed SP, Perveen T, Haleem DJ (2006) Relationship of brain
tryptophan and serotonin in improving cognitive performance in rats. Pak J Pharm Sci
19:11-15.
143
Khan R, Krishnakumar A, Paulose CS (2008) Decreased glutamate receptor binding
and NMDA R1 gene expression in hippocampus of pilocarpine-induced epileptic rats:
neuroprotective role of Bacopa monnieri extract. Epilepsy Behav 12:54-60.
Kilpatrick GJ, Butler A, Burridge J, Oxford AW (1990) 1-(m-Chlorophenyl)biguanide, a potent high affinity 5-HT3 receptor agonist. Eur J Pharmacol
182:193-197.
Kim E, Cho KO, Rothschild A, Sheng M (1996) Heteromultimerization and NMDA
receptor-clustering activity of Chapsyn-110, a member of the PSD-95 family of
proteins. Neuron 17:103-113.
Kim SW, Park SY, Hwang O (2002) Up-regulation of tryptophan hydroxylase
expression and serotonin synthesis by sertraline. Mol Pharmacol 61:778-785.
Kimani ST, Nyongesa AW (2008) Effects of single daily khat (Catha edulis) extract
on spatial learning and memory in CBA mice. Behav Brain Res 195:192-197.
Kind PC, Neumann PE (2001) Plasticity: downstream of glutamate. Trends Neurosci
24:553-555.
King DL, Arendash GW (2002) Maintained synaptophysin immunoreactivity in
Tg2576 transgenic mice during aging: correlations with cognitive impairment. Brain
Res 926:58-68.
Kishore K, Singh M (2005) Effect of bacosides, alcoholic extract of Bacopa monniera
Linn. (Brahmi), on experimental amnesia in mice. Indian J Exp Biol 43:640-645.
Kistner U, Wenzel BM, Veh RW, Cases-Langhoff C, Garner AM, Appeltauer U,
Voss B, Gundelfinger ED, Garner CC (1993) SAP90, a rat presynaptic protein
related to the product of the Drosophila tumor suppressor gene dlg-A. J Biol Chem
268:4580-4583.
Klann E, Sweatt JD (2008) Altered protein synthesis is a trigger for long-term
memory formation. Neurobiol Learn Mem 89:247-259.
Klaunig JE, Kamendulis LM (2004) The role of oxidative stress in carcinogenesis.
Annu Rev Pharmacol Toxicol 44:239-267.
Koh TW, Bellen HJ (2003) Synaptotagmin I, a Ca2+ sensor for neurotransmitter
release. Trends Neurosci 26:413-422.
Kojima T, Matsumoto M, Togashi H, Tachibana K, Kemmotsu O, Yoshioka M
(2003) Fluvoxamine suppresses the long-term potentiation in the hippocampal CA1
field of anesthetized rats: an effect mediated via 5-HT1A receptors. Brain Res
959:165-168.
Kornau HC, Schenker LT, Kennedy MB, Seeburg PH (1995) Domain interaction
between NMDA receptor subunits and the postsynaptic density protein PSD-95.
Science 269:1737-1740.
144
Korzus E (2003) The relation of transcription to memory formation. Acta Biochim Pol
50:775-782.
Kroeze WK, Kristiansen K, Roth BL (2002) Molecular biology of serotonin
receptors structure and function at the molecular level. Curr Top Med Chem 2:507-528.
Kubik S, Miyashita T, Guzowski JF (2007) Using immediate-early genes to map
hippocampal subregional functions. Learn Mem 14:758-70.
Kulshreshtha DK, Rastogi RP (1973) Bacogenin A1: a novel dammerane triterpene
sapogenin from Bacopa monniera. Phytochemistry 12:887-892.
Kulshreshtha DK, Rastogi RP (1974) Bacogenin A2: a new sapogenin from
bacosides. Phytochemistry 13:1205-1206.
Lai MK, Tsang SW, Alder JT, Keene J, Hope T, Esiri MM, Francis PT, Chen CP
(2005) Loss of serotonin 5-HT2A receptors in the postmortem temporal cortex
correlates with rate of cognitive decline in Alzheimer's disease. Psychopharmacology
179:673-677.
Lester HA, Dibas MI, Dahan DS, Leite JF, Dougherty DA (2004) Cys-loop
receptors: new twists and turns. Trends Neurosci 27:329-336.
Liang KC, Chen LL, Huang TE (1995) The role of amygdala norepinephrine in
memory formation: involvement in the memory enhancing effect of peripheral
epinephrine. Chin J Physiol 38:81-91.
Lin RC, Scheller RH (2000) Mechanisms of synaptic vesicle exocytosis. Annu Rev
Cell Dev Biol 16:19-49.
Lisman J, Schulman H, Cline H (2002) The molecular basis of CaMKII function in
synaptic and behavioural memory. Nat Rev Neurosci 3:175-190.
Lisman JE, Grace AA (2005) The hippocampal-VTA loop: controlling the entry of
information into long-term memory. Neuron 46:703-713.
Littleton JT, Upton L, Kania A (1995) Immunocytochemical analysis of axonal
outgrowth in synaptotagmin mutations. J Neurochem 65:32-40.
Llinas RR (1977) Depolarization-release coupling systems in neurons. Neurosci Res
Prog Bull 15:555-687.
Lonze BE, Ginty DD (2002) Function and regulation of CREB family transcription
factors in the nervous system. Neuron 35:605-623.
Lovinger DM (1999) The role of serotonin in alcohol’s effects on the brain. Curr Sep
Arch 18:23-28.
Lu J, Zheng YL, Luo L, Wu DM, Sun DX, Feng YJ (2006) Quercetin reverses
D-galactose induced neurotoxicity in mouse brain. Behav Brain Res 171:251-260.
145
Luu TT, Pirogovsky E, Gilbert PE (2008) Age-related changes in contextual
associative learning. Neurobiol Learn Mem 89:81-85.
Lucki I (1998) The spectrum of behaviors influenced by serotonin. Biol Psychiatry
44:151-162.
Lynch MA (2004) Long-term potentiation and memory. Physiol Rev 84:87-136.
MacDermott AB, Role LW, Siegelbaum SA (1999) Presynaptic ionotropic receptors
and the control of transmitter release. Annu Rev Neurosci 22:443-485.
MacDonald RL, Olsen RW (1994) GABAa receptor channels. Annu Rev Neurosci
17:569-602.
Machado A, Cano J, Santiago M (1986) The change with age in biogenic amines and
their metabolites in the striatum of the rat. Arch Gerontol Geriatr 5:333-342.
Malenka RC, Nicoll RA (1999) Long-term potentiation-a decade of progress. Science
285:1870-1874.
Malinow R, Schulman H, Tsien RW (1989) Inhibition of postsynaptic PKC or
CaMKII blocks induction but not expression of LTP. Science 245:862-866.
Mann JJ (1999) Role of serotonergic system in the pathogenesis of major depression
and suicidal behavior. Neuropsychopharmacology 21:S99-S105.
Manseau F, Sossin WS, Castellucci VF (1998) Long-term changes in excitability
induced by protein kinase C activation in Aplysia sensory neurons. J Neurophysiol
79:1210-1218.
Maren S (2005) Synaptic mechanisms of associative memory in the amygdala.
Neuron 47:783-786.
Maren S, Baudry M (1995) Properties and mechanisms of long-term synaptic
plasticity in the mammalian brain: relationships to learning and memory. Neurobiol
Learn Mem 63:1-18.
Marien MR, Colpaert FC, Rosenquist AC (2004) Noradrenergic mechanisms in
neurodegenerative diseases: a theory. Brain Res Rev 45:38-78.
Marinissen MJ, Gutkind JS (2001) G-protein-coupled receptors and signaling
networks: emerging paradigms. Trends Pharmacol Sci 22:368-376.
Markesbery WR (1997) Oxidative stress hypothesis in Alzheimer’s disease. Free
Radic Biol Med 23:134-147.
Marklund S, Marklund G (1974) Involvement of the superoxide anion radical in the
autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J
Biochem 47:469-474.
Markov D, Goldman M (2006) Normal sleep and circadian rhythms: neurobiologic
mechanisms underlying sleep and wakefulness. Psychiatr Clin North Am 29:841-853.
146
Martis G, Rao A, Karanth KS (1992) Neuropharmaological activity of Herpestis
monniera. Fitoterapia 63:399-404.
Mathew J, Gangadharan G, Kuruvilla KP, Paulose CS (2011) Behavioral deficit
and decreased GABA receptor functional regulation in the hippocampus of epileptic
rats: effect of Bacopa monnieri. Neurochem Res 36:7-16.
Mathew KM (1984) The flora of Tamil Nadu and Carna. Rapinat Herbarium St.
Joseph’s College, Tiruchirapalli, India.
Matsukawa M, Ogawa M, Nakadate K, Maeshima T, Ichitani Y, Kawai N, Okado
N (1997) Serotonin and acetylcholine are crucial to maintain hippocampal synapses and
memory acquisition in rats. Neurosci Lett 230:13-16.
Matsumoto M, Yoshioka M, Togashi H, Tochihara M, Ikeda T, Saito H (1995)
Modulation of norepinephrine release by serotonergic receptors in the rat hippocampus
as measured by in vivo microdialysis. J Pharmacol Exp Ther 272:1044-1051.
Mayford M, Wang J, Kandel ER, O'Dell TJ (1995) CaMKII regulates the frequencyresponse function of hippocampal synapses for the production of both LTD and LTP.
Cell 81:891-904.
Mayr B, Montminy M (2001) Transcriptional regulation by the phosphorylationdependent factor CREB. Nat Rev Mol Cell Biol 2:599-609.
McCaffrey TA, Fu C, Du B, Eksinar S, Kent KC, Bush H Jr, Kreiger K,
Rosengart T, Cybulsky MI, Silverman ES, Collins T (2000) High-level expression
of Egr-1 and Egr-1- inducible genes in mouse and human atherosclerosis. J Clin Invest
105:653-662.
McDonald RJ, White NM (1993) A triple dissociation of memory systems:
hippocampus, amygdala, and dorsal striatum. Behav Neurosci 107:3-22.
McGahon B, Clements MP, Lynch MA (1997) The ability of aged rats to sustain
long-term potentiation is restored when the age-related decrease in membrane
arachidonic acid concentration is reversed. Neuroscience 81:9-16.
McGaugh JL (2000) Memory: a century of consolidation. Science 87:248-251.
McMahon LL, Kauer JA (1997) Hippocampal interneurons are excited via serotoningated ion channels. J Neurophys 78:2493-2502.
McNamara RK, Skelton RW (1993) The neuropharmacological and neurochemical
basis of place learning in the Morris water maze. Brain Res Rev 18:33-49.
Meek JL, Bertilsson L, Cheney DL, Zsilla G, Costa E (1977) Aging induced changes
in acetylcholine and serotonin content of discrete brain nuclei. J Gerontol 32:129-131.
Mello e Souza T, Rodrigues C, Souza MM, Vinade E, Coitinho A, Choi H,
Izquierdo I (2001) Involvement of the serotonergic type 1A (5-HT1A) receptor in the
agranular insular cortex in the consolidation of memory for inhibitory avoidance in rats.
Behav Pharmacol 12:349-353.
147
Meneses A (1998) Physiological, pathophysiological and therapeutic roles of 5-HT
systems in learning and memory. Rev Neurosci 9:275-290.
Meneses A (1999) 5-HT system and cognition. Neurosci Biobehav Rev 23:1111-1125.
Meneses A (2002) Involvement of 5-HT2A/2B/2C receptors on memory formation: simple
agonism, antagonism, or inverse agonism? Cell Mol Neurobiol 22:675-688.
Meneses A (2003) A pharmacological analysis of an associative learning task: 5-HT1 to
5-HT7 receptor subtypes function on a Pavlovian/instrumental auto shaped memory.
Learn Mem 10:363-372.
Meneses A (2007) Stimulation of 5-HT1A, 5-HT1B, 5-HT2A/2C, 5-HT3 and 5-HT4
receptors or 5-HT uptake inhibition: short- and long-term memory. Behav Brain Res
184:81-90.
Meneses A, Hong E (1997) A pharmacological analysis of serotonergic receptors:
effects of their activation of blockade in learning. Prog Neuropsychopharmacol Biol
Psychiatry 21:273-296.
Meyer JM, Loebel AD, Schweizer E (2009) Lurasidone: a new drug in development
for schizophrenia. Expert Opin Investig Drugs 18:1715-1726.
Michael D, Martin KC, Seger R, Ning MM, Baston R, Kandel ER (1998) Repeated
pulses of serotonin required for long-term facilitation activate mitogen activated protein
kinase in sensory neurons of Aplysia. Proc Natl Acad Sci U S A 95:1864-1869.
Migaud M, Charlesworth P, Dempster M, Webster LC, Watabe AM, Makhinson
M, He Y, Ramsay MF, Morris RG, Morrison JH, O’Dell TJ, Grant SG (1998)
Enhanced long-term potentiation and impaired learning in mice with mutant
postsynaptic density-95 protein. Nature 396:433-439.
Migues JM, Aldegunde M, Paz-Valinas L, Recio J, Sanchez-Barcelo E (1999)
Selective changes in the contents of noradrenaline, dopamine and serotonin in rat brain
areas during aging. J Neural Transm 106:1089-1098.
Millan MJ, Gobert A, Roux S, Porsolt R, Meneses A, Carli M, Di Cara B, Jaffard
R, Rivet JM, Lestage P, Mocaer E, Peglion JL, Dekeyne A (2004) The serotonin1A
receptor partial agonist S15535 [4-(benzodioxan-5-yl) 1-(indan-2-yl) piperazine]
enhances cholinergic transmission and cognitive function in rodents: a combined
neurochemical and behavioral analysis. J Pharmacol Exp Ther 311:190-203.
Milner B, Squire LR, Kandel ER (1998) Cognitive neuroscience review and the study
of memory. Neuron 20:445-468.
Milusheva EA, Doda M, Pasztor E, Lajtha A, Sershen H, Vizi ES (1992)
Regulatory interactions among axon terminals affecting the release of different
transmitters from rat striatal slices under hypoxic and hypoglycemic conditions.
J Neurochem 59:946-952.
148
Milusheva EA, Doda M, Baranyi M, Vizi ES (1996) Effect of hypoxia and glucose
deprivation on ATP level, adenylate energy charge and [Ca2+]o-dependent and
independent release of [3H]dopamine in rat striatal slices. Neurochem Int 28:501-507.
Miranda MI (2007) Changes in neurotransmitter extracellular levels during memory
formation. In: Bermúdez-Rattoni F (ed.), Neural plasticity and memory: from genes to
brain imaging, CRC press, Florida, pp. 129-156.
Misane I, Ogren SO (2000) Multiple 5-HT receptors in passive avoidance:
comparative
studies
of
p-chloroamphetamine
and
8-OH-DPAT.
Neuropsychopharmacology 22:168-190.
Mo B, Feng N, Renner K, Forster G (2008) Restraint stress increases serotonin
release in the central nucleus of the amygdala via activation of corticotropin-releasing
factor receptors. Brain Res Bull 76:493-498.
Mohamed HA, Yao W, Fioravante D, Smolen P, Byrne JH (2005) cAMP response
elements in Aplysia creb1, creb2, and Ap-uch promoters: implications for feedback
loops modulating long term memory. J Biol Chem 280:27035-27043.
Mohandas Rao KG, Muddanna Rao S, Gurumadhva Rao S (2005) Centella
asiatica (linn) induced behavioural changes during growth spurt period in neonatal rats.
Neuroanatomy 4:18-23.
Montarolo PG, Goelet P, Castellucci VF, Morgan J, Kandel ER, Schacher S (1986)
A critical period for macromolecular synthesis in long-term heterosynaptic facilitation
in Aplysia. Science 234:1249-1254.
Montminy MR, Gonzalez GA, Yamamoto KK (1990) Regulation of cAMP-inducible
genes by CREB. Trends Neurosci 13:184-188.
Moore AN, Waxham MN, Dash PK (1996) Neuronal activity increases the
phosphorylation of the transcription factor cAMP response element-binding protein
(CREB) in rat hippocampus and cortex. J Biol Chem 271:14214-14220.
Morales M, Battenberg E, de Lecea L, Bloom FE (1996) The type 3 serotonin
receptor is expressed in a subpopulation of GABAergic neurons in the rat neocortex
and hippocampus. Brain Res 731:199-202.
Moretti A, Carfagna N, Trunzo F (1987) Effect of aging on monoamines and their
metabolites in the rat brain. Neurochem Res 12:1035-1039.
Morgan DG, May PC (1990) Age-related changes in synaptic neurochemistry.
In: Schneider EL & Rowe JW (eds.), Handbook of the biology of aging. Academic
Press, New York, pp. 219-254.
Morikawa O, Sakai N, Obara H, Saito N (1998) Effects of interferon-alpha,
interferon-gamma and cAMP on the transcriptional regulation of the serotonin
transporter. Eur J Pharmacol 349:317-324.
Mossner R, Daniel S, Schmitt A, Albert D, Lesch KP (2001) Modulation of
serotonin transporter function by interleukin-4. Life Sci 68:873-880.
149
Muller G (2000) Towards 3D structures of G protein-coupled receptors: a
multidisciplinary approach. Curr Med Chem 7:861-888.
Muller U (2002) Learning in honeybees: from molecules to behaviour. Zoology
105:313-320.
Mumby DG, Gaskin S, Glenn MJ, Schramek TE, Lehmann H (2002) Hippocampal
damage and exploratory preferences in rats: memory for objects, places, and contexts.
Learn Mem 9:49-57.
Munro CAM, Walling SG, Evans JH, Harley CW (2001) Beta-adrenergic blockade
in the dentate gyrus in vivo prevents high frequency-induced long-term potentiation of
EPSP slope, but not long-term potentiation of population spike amplitude.
Hippocampus 11:322-328.
Muthumary J, Sashirekha S (2007) Detection of taxol, as anticancer drug, from
selected coelomycetous fungi. Indian J Sci Technol 1:1-10.
Myhrer T (2003) Neurotransmitter systems involved in learning and memory in the
rat: a meta-analysis based on studies of four behavioral tasks. Brain Res Brain Res Rev
41:268-287.
Nail-Boucherie K, Dourmap N, Jaffard R, Costentin J (2000) Contextual fear
conditioning is associated with an increase of acetylcholine release in the hippocampus
of rat. Cogn Brain Res 9:193-197.
Nakai T, Milusheva EA, Baranyi M, Uchihashi Y, Satoh T, Vizi ES (1999)
Excessive release of [3H] noradrenaline and glutamate in response to simulation of
ischemic conditions in rat spinal cord slice preparation: effect of NMDA and AMPA
receptor antagonists. Eur J Pharmacol 366:143-150.
Nelson N (1998) The family of Na+/Cl- neurotransmitter transporters. J Neurochem
71:1785-1803.
Neugebauer F, Korz V, Frey JU (2009) Modulation of extracellular monoamine
transmitter concentrations in the hippocampus after weak and strong tetanization of the
perforant path in freely moving rats. Brain Res 1273:29-38.
Neumaier JF, Root DC, Hamblin MW (1996) Chronic fluoxetine reduces serotonin
transporter mRNA and 5-HT1B mRNA in a sequential manner in the rat dorsal raphe
nucleus. Neuropsychopharmacology 15:512-522.
Nicholson DA, Yoshida R, Berry RW, Gallagher M, Geinisman Y (2004) Reduction
in size of perforated postsynaptic densities in hippocampal axospinous synapses and
age-related spatial learning impairments. J Neurosci 24:7648-7653.
Niethammer M, Kim E, Sheng M (1996) Interaction between the C-terminus of
NMDA receptor subunits and multiple members of the PSD-95 family of
membrane-associated guanylate kinases. J Neurosci 16:2157-2163.
Nishizuka Y (1988) The molecular heterogeneity of protein kinase C and its
implications for cellular regulation. Nature 334:661-665.
150
Nyffeler M, Zhang WN, Feldon J, Knuesel I (2007) Differential expression of PSD
proteins in age-related spatial learning impairments. Neurobiol Aging 28:143-155.
O’Carroll CM, Martin SJ, Sandin J, Frenquelli B, Morris RG (2006)
Dopaminergic modulation of the persistence of one-trial hippocampus-dependent
memory. Learn Mem 13:760-769.
Ogren SO, Eriksson TM, Elvander-Tottie E, D'Addario C, Ekstrom JC,
Svenningsson P, Meister B, Kehr J, Stiedl O (2008) The role of 5-HT1A receptors in
learning and memory. Behav Brain Res 195:54-77.
Ohashi S, Matsumoto M, Otani H, Mori K, Togashi H, Ueno K, Kaku A, Yoshioka
M (2002) Changes in synaptic plasticity in the rat hippocampomedial prefrontal cortex
pathway induced by repeated treatments with fluvoxamine. Brain Res 949:131-138.
Oleskevich S, Descarries L, Lacaille JC (1989) Quantified distribution of the
noradrenaline innervation in the hippocampus of adult rat. J Neurosci 9:3803-3015.
Orsetti M, Dellarole A, Ferri S, Ghi P (2003) Acquisition, retention, and recall of
memory after injection of RS67333, a 5-HT4 receptor agonist, into the nucleus basalis
magnocellularis of the rat. Learn Mem 10:420-426.
Otmakhova NA, Lisman JE (1998) D1/D5 dopamine receptors inhibit depotentiation
at CA1 synapses via cAMP-dependent mechanism. J Neurosci 18:1270-1279.
Ouyang Y, Kantor D, Harris KM, Schuman EM, Kennedy MB (1997)
Visualization of the distribution of autophosphorylated calcium/calmodulin-dependent
protein kinase II after tetanic stimulation in the CA1 area of the hippocampus.
Neuroscience 17:5416-5427.
Ouyang Y, Rosenstein A, Kreiman G, Schuman EM, Kennedy MB (1999) Tetanic
stimulation leads to increased accumulation of Ca2+/calmodulin-dependent protein
kinase II via dendritic protein synthesis in hippocampal neurons. Neuroscience
19:7823-7833.
Pardridge WM (1999) Blood-brain barrier biology and methodology. J Neurovirol
5:556-569.
Paulose CS, Chathu F, Khan SR, Krishnakumar A (2008) Neuroprotective role of
Bacopa monnieri extract in epilepsy and effect of glucose supplementation during
hypoxia: glutamate receptor gene expression. Neurochem Res 33:1663-1671.
Perez-Garcia G, Meneses A (2008) Memory formation, amnesia, improved memory
and reversed amnesia: 5-HT role. Behav Brain Res 195:17-29.
Perin MS, Fried VA, Mignery GA, Jahn R, Sudhof TC (1990) Phospholipid binding
by a synaptic vesicle protein homologous to the regulatory region of protein kinase C.
Nature 345:260-263.
Phrompittayarat W, Putalun W, Tanaka H, Jetiyanon K, Wittaya-areekul S,
Ingkaninan K (2007) Comparison of various extraction methods of Bacopa monnieri.
Naresuan University Journal 15:29-34.
151
Prabhakar S, Saraf MK, Pandhi P, Anand A (2008) Bacopa monniera exerts
antiamnesic effect on diazepam-induced anterograde amnesia in mice.
Psychopharmacology 200:27-37.
Prisila DC, Ganesh A, Geraldine P, Akbarsha MA, Emmanuvel Rajan K (2011)
Bacopa monniera leaf extract up-regulates tryptophan hydroxylase (TPH2) and
serotonin transporter (SERT) expression: implications in memory formation.
J Ethnopharmacol 134:55-61.
Pritchard AL, Pritchard CW, Bentham P, Lendon CL (2007) Role of serotonin
transporter polymorphisms in the behavioural and psychological symptoms in probable
Alzheimer disease patients. Dement Geriatr Cogn Disord 24:201-206.
Quartermain D, Judge ME, Jung H (1988) Amphetamine enhances retrieval
following diverse sources of forgetting. Physiol Behav 43:239-241
Ragozzino D, Giovannelli A, Mileo AM, Limatola C, Santoni A, Eusebi F (1998)
Modulation of the neurotransmitter release in rat cerebellar neurons by GRO beta.
Neuroreport 9:3601-3606.
Rai KS, Murthy KD, Karanth KS, Rao MS (2001) Clitoria ternatea root extract
treatment during growth spurt period enhances learning and memory in rats. Indian
J Physiol Pharmacol 45:305-313.
Rai D, Bhatia G, Palit G, Pal R, Singh S, Singh H (2003) Adaptogenic effect of
Bacopa monniera (Brahmi). Pharmacol Biochem Behav 75:823-830.
Rajji T, Chapman D, Eichenbaum H, Greene R (2006) The role of CA3
hippocampal NMDA receptors in paired associate learning. J Neurosci 26:908-915.
Ramirez MJ, Cenarruzabeitia E, Lasheras B, Del Rio J (1996) Involvement of
GABA systems in acetylcholine release induced by 5-HT3 receptor blockade in slices
from rat entorhinal cortex. Brain Res 712:274-280.
Rapp PR, Kansky MT, Eichenbaum H (1996) Learning and memory for hierarchical
relationships in the monkey: effects of aging. Behav Neurosci 110:887-897.
Rauscher FJD, Sambucetti LC, Curran T, Distel RJ, Spiegelman BM (1988)
Common DNA binding site for Fos protein complexes and transcription factor AP-1.
Cell 52:471-480.
Raymond JR, Mukhin YV, Gelasco A, Turner J, Collinsworth G, Gettys TW,
Grewal JS, Garnovskaya MN (2001) Multiplicity of mechanisms of serotonin
receptor signal transduction. Pharmacol Ther 92:179-212.
Reeves DC, Lummis SC (2002) The molecular basis of the structure and function of
the 5-HT3 receptor: a model ligand-gated ion channel. Mol Membr Biol 19:11-26.
Reis HJ, Guatimosim C, Paquest M, Santos M, Ribeiro FM, Kummer A,
Schenatto G, Vsalgado JV, Vieira LB, Teixeira AL, Palotas A (2009)
Neurotransmitters in the central nervous system and their implication in learning and
memory processes. Curr Med Chem 16:796-840.
152
Remondes M, Schuman EM (2003) Molecular mechanisms contributing to
long-lasting synaptic plasticity at the temporoammonic-CA1 synapse. Learn Mem
10:247-252.
Riemer C, Borroni E, Levet-Trafit B, Martin JR, Poli S, Porter RH, Bos M (2003)
Influence of the 5-HT6 receptor on acetylcholine release in the cortex: pharmacological
characterization of 4-(2-bromo-6-pyrrolidin-1-ylpyridine-4-sulfonyl) phenylamine, a
potent and selective 5-HT6 receptor antagonist. J Med Chem 46:1273-1276.
Roberson ED, English JD, Adams JP, Selcher JC, Kondratick C, Sweatt JD (1999)
The mitogen-activated protein kinase cascade couples PKA and PKC to cAMP
response element binding protein phosphorylation in area CA1 of hippocampus.
J Neurosci 19:4337-4348.
Roberts AJ, Krucker T, Levy CL, Slanina KA, Sutcliffe JG, Hedlund PB (2004)
Mice lacking 5-HT receptors show specific impairments in contextual learning. Eur
J Neurosci 19:1913-1922.
Rogers D, Hagan J (2001) 5-HT6 receptor antagonists enhance retention of a water
maze task in the rat. Psychopharmacology 158:114-119.
Rosenzweig ES, Barnes CA (2003) Impact of aging on hippocampal function:
plasticity, network dynamics, and cognition. Prog Neurobiol 69:143-179.
Rossato JI, Bevilaqua LR, Izquierdo I, Medina JH, Cammarota M (2009)
Dopamine controls persistence of long-term memory storage. Science 325:1017-1020.
Roth BL, Sheffler DJ, Kroeze WK (2004) Magic shotguns versus magic bullets:
selectively non-selective drugs for mood disorders and schizophrenia. Nat Rev Drugs
Discov 3:353-359.
Rotruck JT, Pope AL, Ganther HE, Swanson AB, Hafeman DG, Hoekstra WG
(1973) Selenium: biochemical role as a component of glutathione peroxidase. Science
179:588-590.
Roubein IF, Embree LJ, Jackson DW (1986) Changes in catecholamine levels in
discrete regions of rat brain during aging. Exp Aging Res 12:193-196.
Rudnick G, Clark J (1993) From synapse to vesicle: the reuptake and storage of
biogenic amine neurotransmitters. Biochim Biophys Acta 1144:249-263.
Russo A, Borrelli F (2005) Bacopa monniera, a reputed nootropic plant: an overview.
Phytomedicine 12:305-317.
Ryan BK, Anwyl R, Rowan MJ (2008) 5-HT2 receptor-mediated reversal of the
inhibition of hippocampal long-term potentiation by acute inescapable stress.
Neuropharmacology 55:175-182.
Sairam K, Dorababu M, Goel RK, Bhattacharya SK (2002) Antidepressant activity
of standardized extract of Bacopa monniera in experimental models of depression in
rats. Phytomedicine 9:207-211.
153
Saitoh A, Hirose N, Yamada M, Yamada M, Nozaki C, Oka T, Kamei J (2006)
Changes in emotional behavior of mice in the hole-board test after olfactory
bulbectomy. J Pharmacol Sci 102:377-386.
Sakagami H, Umemiya M, Saito S, Kondo H (2000) Distinct immunohistochemical
localization of two isoforms of Ca2+/calmodulin-dependent protein kinase kinases in the
adult rat brain. Eur J Neurosci 12:89-99.
Sakuma R, Nishina T, Kitamura M (1987) Deproteinizing methods evaluated for
determination of uric acid in serum by reversed-phase liquid chromatography with
ultraviolet detection. Clin Chem 33:1427-1430.
Santiago M, Machado A, Reinoso-Suárez F, Cano J (1988) Changes in biogenic
amines in rat hippocampus during development and aging. Life Sci 42:2503-2508.
Saraf MK, Prabhakar S, Pandhi P, Anand A (2008) Bacopa monniera ameliorates
amnesic effects of diazepam qualifying behavioural-molecular partitioning.
Neuroscience 155:476-484.
Saraf MK, Prabhakar S, Anand A (2009) Bacopa monnieri alleviates N (omega)nitro-l-arginine arginine-induced but not MK-801-induced amnesia: a mouse Morris
water maze study. Neurosci 160:149-155.
Saraf MK, Anand A, Prabhakar S (2010) Scopolamine induced amnesia is reversed
by Bacopa monniera through participation of kinase-CREB pathway. Neurochem Res
35:279-287.
Saraf MK, Prabhakar S, Khanduja KL, Anand A (2011) Bacopa monniera
attenuates scopolamine-induced impairment of spatial memory in mice. Evid Based
Complement Alternat Med 236186.
Sarnyai Z, Sibille EL, Pavlides C, Fenster RJ, McEwen BS, Toth, M (2000)
Impaired hippocampal-dependent learning and functional abnormalities in the
hippocampus in mice lacking serotonin (1A) receptors. Proc Natl Acad Sci U S A
97:14731-14736.
Sastri MS, Dhalla NS, Malhotra CL (1959) Chemical investigation of Herpestis
monniera Linn (Brahmi). Indian J Pharmacol 21:303-304.
Sattler R, Xiong Z, Lu WY, Hafner M, MacDonald JF, Tymianski M (1999)
Specific coupling of NMDA receptor activation to nitric oxide neurotoxicity by
PSD-95 protein, Science 284:1845-1848.
Satyan KS, Jaiswal AK, Ghosal S, Bhattacharya SK (1998) Anxiolytic activity of
ginkgolic acid conjugates from Indian Ginkgo biloba. Psychopharmacology
136:148-152.
Satyavati GV, Raina MK, Sharma M (1976) Indian medicinal plants, Indian council
of medical research, New Delhi, pp. 20-35.
154
Schafe GE, LeDoux JE (2000) Memory consolidation of auditory Pavlovian fear
conditioning requires protein synthesis and protein kinase A in the amygdala.
J Neurosci 20:RC96.
Scharf MT, Woo NH, Lattal KM, Young JZ, Nguyen PV, Abel T (2002) Protein
synthesis is required for the enhancement of long-term potentiation and long-term
memory by spaced training. J Neurophysiol 87:2770-2777.
Schiapparelli L, Del Rio J, Frechilla D (2005) Serotonin 5-HT receptor blockade
enhances Ca2+/calmodulin-dependent protein kinase II function and membrane
expression of AMPA receptor subunits in the rat hippocampus: implications for
memory formation. J Neurochem 94:884-895.
Schulte KE, Ruecker G, EI-Kersch M (1972) Components of medicinal plants,
Phytochemistry 11:2649-2651.
Schwarz TL (2004) Synaptotagmin promotes both vesicle fusion and recycling. Proc
Natl Acad Sci U S A 101:16401-16402.
Seger CA (1994) Implicit learning. Psychiatr Bull 115:163-196.
Seiss H (1993) Strategies of antioxidant defense. Eur J Biochem 215:213-219.
Shakesby AC, Anwyl R, Rowan MJ (2002) Overcoming the effects of stress on
synaptic plasticity in the intact hippocampus: rapid actions of serotonergic and
antidepressant agents. J Neurosci 22:3638-3644.
Shan Q, Lu J, Zheng Y, Li J, Zhou Z, Hu B, Zhang Z, Fan S, Mao Z, Wang YJ,
Ma D (2009) Purple sweet potato color ameliorates cognition deficits and attenuates
oxidative damage and inflammation in aging mouse brain induced by D-galactose.
J Biomed Biotechnol 1-9.
Sheikh N, Ahmad A, Siripurapu KB, Kuchibhotla VK, Singh S, Palit G (2007)
Effect of Bacopa monniera on stress induced changes in plasma corticosterone and
brain monoamines in rats. J Ethnopharmacol 111:671-676.
Shen K, Meyer T (1999) Dynamic control of CaMKII translocation and localization in
hippocampal neurons by NMDA receptor simulation. Science 284:162-166.
Sheng M, McFadden G, Greenberg ME (1990) Membrane depolarization and
calcium induce c-fos transcription via phosphorylation of transcription factor CREB.
Neuron 4:255-268
Sheng M, Pak DT (2000) Ligand-gated ion channel interactions with cytoskeletal and
signaling proteins. Annu Rev Physiol 62:755-778.
Siddiqui MF, Levey AI (1999) Cholinergic therapies in Alzhemer’s disease. Drugs
Fut 24:417-444.
Silva AJ, Stevens CF, Tonegawa S, Wang Y (1992) Deficient hippocampal long-term
potentiation in alpha-calcium-calmodulin kinase II mutant mice. Science 257:201-206.
155
Silva AJ, Kogan JH, Frankland PW, Kida S (1998) CREB and memory. Annu Rev
Neurosci 21:127-148.
Simonian NA, Coyle JT (1996) Oxidative stress in neurodegenerative diseases. Annu
Rev Pharmacol Toxicol 36:83-106.
Singh HK, Dhawan BN (1982) Effect of Bacopa monniera Linn. (Brahmi) extract on
avoidance responses in rats. J Ethnopharmacol 5:205-214.
Singh HK, Dhawan BN (1992) Drugs affecting learning and memory. In: Tandon PN,
Bijlani V, Wadhwa S (eds.), Lectures in neurobiology. Wiley, New Delhi, pp. 189-207.
Singh HK, Dhawan BN (1997) Neuropsychopharmacological effects of the ayurvedic
nootropic Bacopa monniera Linn. (Brahmi). Indian J Pharmacol 29:S359-S365.
Singh HK, Rastogi RP, Srimal RC, Dhawan BN (1988) Effect of bacosides A and B
on avoidance responses in rats. Phytother Res 2:70-75.
Singh RH, Singh L (1980) Studies on the anti-anxiety effect of the medyha rasayana
drug Brahmi (Bacopa monniera Wettst). J Res Ayur Siddha 1:133-148.
Smith TD, Adams MM, Gallagher M, Morrison JH, Rapp PR (2000) Circuitspecific alterations in hippocampal synaptophysin immunoreactivity predict spatial
learning impairment in aged rats. J Neurosci 20:6587-6593.
Song X, Bao MM, Li DD, Li YM (1999) Advanced glycation in D-galactose induced
mouse aging model. Mech Ageing Dev 108:239-251.
Squire LR (1987) Memory and Brain. Oxford university press, New York.
Squire LR, Knowlton B, Musen G (1993) The structure and organization of memory.
Annu Rev Psychol 44:453-495.
Staddon JER, Niv Y (2008) Operant conditioning. Scholarpedia, 3:2318.
Stancampiano R, Cocco S, Cugusi C, Sarais L, Fadda F (1999) Serotonin and
acetylcholine release response in the rat hippocampus during a spatial memory task.
Neuroscience 89:1135-1143.
Steckler T, Sahgal A (1995) The role of serotonergic-cholinergic interactions in the
mediation of cognitive behaviour. Behav Brain Res 67:165-199.
Steinmetz JE, Tracy J, Green JT (2001) Classical eyeblink conditioning: clinical
models and applications. Integr Physiol Behav Sci 36:220-238.
Stevens CF, Tonegawa S, Wang Y (1994) The role of calcium-calmodulin kinase II in
three forms of synaptic plasticity. Curr Biol 4:687-693.
Struder HK, Weicker H (2001) Physiology and pathophysiology of the serotonergic
system and its implications on mental and physical performance. Int J Sports Med
22:482-497.
156
Stubley-Weatherly L, Harding JW, Wright JW (1996) Effects of discrete kainic
acid-induced hippocampal lesions on spatial and contextual learning and memory in
rats. Brain Res 716:29-38.
Sudhof TC (2004) The synaptic vesicle cycle. Annu Rev Neurosci 27: 509-547
Sun D, McGinn MJ, Zhou Z, Harvey HB, Bullock MR, Colello RJ (2007)
Anatomical integration of newly generated dentate granule neurons following traumatic
brain injury in adult rats and its association to cognitive recovery. Exp Neurol
204:264-272.
Sweatt JD (2001) The neuronal MAP kinase cascade: a biochemical signal integration
system subserving synaptic plasticity and memory. J Neurochem 76:1-10.
Tang YP, Shimizu E, Dube GR, Rampon C, Kerchner GA, Zhuo M, Liu G, Tsien
JZ (1999) Genetic enhancement of learning and memory in mice. Nature 401:63-69.
Tarsa L, Goda Y (2002) Synaptophysin regulates activity-dependent synapse
formation in cultured hippocampal neurons. Proc Natl Acad Sci U S A 99:1012-1016.
Tatsumi M, Groshan K, Blakely RD, Richelson E (1997) Pharmacological profile of
antidepressants and related compounds at human monoamine transporters. Eur
J Pharmacol 340:249-258.
Taubenfeld SM, Milekic MH, Monti B, Alberini CM (2001a) The consolidation of
new but not reactivated memory requires hippocampal C/EBPβ. Nat Neurosci
4:813-818.
Taubenfeld SM, Wiig KA, Monti B, Dolan B, Pollonini G, Alberini CM (2001b)
Fornix-dependent induction of hippocampal CCAAT enhancer-binding protein β and δ
co-localizes with phosphorylated cAMP response element-binding protein and
accompanies long-term memory consolidation. J Neurosci 21:84-91.
Tekes K, Hantos M, Gyenge M, Karabelyos C, Csaba G (2006) Prolonged effect of
stress at weaning on the brain serotonin metabolism and sexuality of female rats.
Horm Metab Res 38:799-802
Terry Jr AV (2004) Drugs that target serotonergic receptors. In: Buccafusco JJ (ed.),
Cognitive enhancing drugs. Birkhauser Verlag, Basel, Switzerland pp. 79-88.
Thomas KL, Laroche S, Errington ML, Bliss TV, Hunt SP (1994) Spatial and
temporal changes in signal transduction pathways during LTP. Neuron 13:737-745.
Tiwari RK, Chanda S, Deepak M, Murli B, Agarwal A (2010) HPLC method
validation for simultaneous estimation of madecassoside, asiaticoside and Asiatic acid
in Centella asiatica. J Chem Pharm Res 2:223-229.
Tokarski K, Zahorodna A, Bobula B, Hess G (2003) 5-HT7 receptors increase the
excitability of rat hippocampal CA1 pyramidal neurons. Brain Res 993:230-234.
Torres GE, Gainetdinov RR, Caron MG (2003a) Plasma membrane monoamine
transporters: structure, regulation and function. Nat Rev Neurosci 4:13-25.
157
Torres GE, Carneiro A, Seamans K, Fiorentini C, Sweeney A, Yao WD, Caron
MG (2003b) Oligomerization and trafficking of the human dopamine transporter.
Mutational analysis identifies critical domains important for the functional expression
of the transporter. J Biol Chem 278:2731-2739.
Toth LA, Gardiner TW (2000) Food and water restriction protocols: physiological
and behavioural considerations. Contemp Top Lab Anim Sci 39:9-17.
Treisman R (1996) Regulation of transcription by MAP kinase cascades. Curr Opin
Cell Biol 8:205-215.
Tripathi YB, Chaurasia S, Tripathi E, Upadhyay A, Dubey GP (1996) Bacopa
monniera Linn. as an antioxidant: mechanism of action. Indian J Exp Biol 34:523-526.
Tsunemi, Utsuyama M, Seidler BKH, Kobayashi S, Hirokawa K (2005)
Age-related decline of brain monoamines in mice is reversed to young level by
Japanese herbal medicine. Neurochem Res 30:75-81.
Tully T, Preat T, Boynton SC, Del Vecchio M (1994) Genetic dissection of
consolidated memory in Drosophila. Cell 79:35-47.
Tully T, Bolwig G, Christensen J, Connolly J, DelVecchio M, DeZazzo J, Dubnau
J, Jones C, Pinto S, Regulski M, Svedberg B, Velinzon K (1996) A return to genetic
dissection of memory in Drosophila. Cold Spring Harb Symp Quant Biol 61:207-218.
Tulving E (1983) Elements of episodic memory, Clarendon Press, Oxford.
Tulving E (1991) Concepts in human memory. In: Squire LR, Weinberger NM, Lynch
G, McGaugh J (eds.), Memory: organization and locus of change. Oxford University
Press, New York, pp. 3-32.
Turner TJ, Mokler DJ, Luebke JI (2004) Calcium influx through presynaptic 5-HT3
receptors facilitates GABA release in the hippocampus, in vitro slice and synaptosome
studies. Neuroscience 129:703-718.
Uabundit N, Wattanathorn J, Mucimapura S, Ingkaninan K (2010) Cognitive
enhancement and neuroprotective effects of Bacopa monnieri in Alzheimer’s disease
model. J Ethnopharmacol 127:26-31.
Uchihashi Y, Bencsics A, Umeda E, Nakai T, Sato T, Vizi ES (1998) Na+ channel
block prevents the ischemia-induced release of norepinephrine from spinal cord slices.
Eur J Pharmacol 346:145-150.
Umbriaco, D, Garcia S, Beaulieu C, Descarries L (1995) Relational features of
acetylcholine, noradrenaline, serotonin and GABA axon terminals in the stratum
radiatum of adult rat hippocampus (CA1). Hippocampus 5:605-620.
Vallejo M, Habener JF (1994) Mechanisms of transcriptional regulation by cAMP.
In: Conaway R, Conaway J (eds.), Transcription: mechanisms and regulation. Raven
Press, New York, pp. 353-368.
158
Valtorta F, Pennuto M, Bonanomi D, Benfenati F (2004) Synaptophysin: leading
actor or walk-on role in synaptic vesicle exocytosis? Bioessays 26:445-453.
Van der Borght K, Havakes R, Bos T, Eggen BJL, Van der Zee EA (2007) Exercise
improves memory acquisition and retrieval in the Y-maze task: relationship with
hippocampal neurogenesis. Behav Neurosci 121:324-334.
van der Veen FM, Evers EA, van Deursen JA, Deutz NE, Backes WH, Schmitt JA
(2006) Acute tryptophan depletion reduces activation in the right hippocampus during
encoding in an episodic memory task. Neuroimage 31:1188-1196.
Van Hooft JA, Vijverberg HP (2000) 5-HT3 receptors and neurotransmitter release in
the CNS: a nerve ending story? Trends Neurosci 23:605-610.
Vaynman S, Ying Z, Gomez-Pinilla F (2007) The select action of hippocampal
calcium calmodulin protein kinase II in mediating exercise-enhanced cognitive
function. Neuroscience 144:825-833.
Venero JL, Machado A, Cano J (1991) Turnover of dopamine and serotonin and their
metabolites in the striatum of aged rats. J Neurochem 56:1940-1948.
Vijayan V, Helen A (2007) Protective activity of Bacopa monniera Linn. on
nicotine-induced toxicity in mice. Phytother Res 21:378-381.
Vizi ES (1980) Nonsynaptic modulation of transmitter release: Pharmacological
implication. Trends Pharmacol Sci 1:172-175.
Vizi ES (1984) Nonsynaptic interactions between neurons: modulation of
neurochemical transmission. John Wiley and Sons, New York.
Vizi ES, Kiss JP (1998) Neurochemistry and pharmacology of the major hippocampal
transmitter systems: synaptic and nonsynaptic interactions. Hippocampus 8:566-607.
Vizi ES (2000) Role of high-affinity receptors and membrane transporters in
nonsynaptic communication and drug action in the central nervous system. Pharmacol
Rev 52:63-89.
Vohora D, Pal SN, Pillai KK (2000) Protection from phenytoin-induced cognitive
deficit by Bacopa monniera, a reputed Indian nootropic plant. J Ethnopharmacol
71:383-390.
Vollala VR, Upadhya S, Nayak S (2010) Effect of Bacopa monniera Linn. (brahmi)
extract on learning and memory in rats: a behavioral study. J Vet Behav 5:69-74.
von Bohlen und Halbach O, Dermietzel R (2006) Neurotransmitters and
neuromodulators: handbook of receptors and biological effects, Wiley-VCH Verlag
GmbH & Co, Weinheim.
Vouimba RM, Muñoz C, Diamond DM (2006) Differential effects of predator stress
and the antidepressant tianeptine on physiological plasticity in the hippocampus and
basolateral amygdala. Stress 9:29-40.
159
Walther DJ, Bader M (2003) A unique central tryptophan hydroxylase isoform.
Biochem Pharmacol 66:1673-1680.
Wang YJ, Chen GH, Hu XY, Lu YP, Zhou JN, Liu RY (2005) The expression of
calcium/calmodulin-dependent protein kinase II-alpha in the hippocampus of patients
with Alzheimer’s disease and its links with AD-related pathology. Brain Res
1031:101-108.
Wasserman WW, Fahl WE (1997) Functional antioxidant responsive elements.
Proc Natl Acad Sci U S A 94:5361-5366.
Wei HF, Li L, Song QJ, Ai HX, Chu J, Li W (2005) Behavioural study of the
D-galactose induced aging model in C57BL/6J mice. Behav Brain Res 157:245-251.
West DP, Fillenz M (1980) Storage and release of noradrenaline in hypothalamic
synaptosomes. J Neurochem 35:1323-1328.
Winkler J, Suhr ST, Gage FH, Thal LJ, Fisher LJ (1995) Essential role of
neocortical acetylcholine in spatial memory. Nature 375:484-487.
Wong ML, Licinio J (2001) Research and treatment approaches to depression. Nat Rev
Neurosci 2:343-351.
Wu DM, Lu J, Zheng YL, Zhou Z, Shan Q, Ma DF (2008) Purple sweet potato color
repairs D-galactose-induced spatial learning and memory impairment by regulating the
expression of synaptic proteins. Neurobiol Learn Mem 90:19-27.
Wu LG, Saggau P (1997) Presynaptic inhibition of elicited neurotransmitter release.
Trends Neurol Sci 20:204-212.
Wurtman RJ (1988) Neurotransmitters,
Curr Concepts Nutr 16:27-34.
control
of
appetite,
and
obesity.
Xia Z, Gray JA, Compton-Toth BA, Roth BL (2003) A direct interaction of PSD-95
with 5-HT2A serotonin receptors regulates receptor trafficking and signal transduction.
J Biol Chem 278:21901-21908.
Yamamoto M, Suhara T, Okubo Y, Ichimiya T, Sudo Y, Inoue M, Takano A,
Yasuno F, Yoshikawa K, Tanada S (2002) Age-related decline of serotonin
transporters in living human brain of healthy males. Life Sci 71:751-757.
Yamauchi T (2005) Neuronal Ca2+/calmodulin-dependent protein kinase II-discovery,
progress in a quarter of a century, and perspective: implication for learning and
memory. Biol Pharm Bull 28:1342-1354.
Yau JL, Olsson T, Noble J, Seckl JR (1999) Serotonin receptor subtype gene
expression in the hippocampus of aged rats following chronic amitriptyline treatment.
Brain Res Mol Brain Res 70:282-287.
Yin JCP, Wallach JS, Del Vecchio M, Wilder EL, Zhou H, Quinn WG, Tully T
(1994) Induction of a dominant negative CREB transgene specifically blocks long-term
memory in Drosophila. Cell 79:49-58.
160
Yin JC, Del Vecchio M, Zhou H, Tully T (1995) CREB as a memory modulator:
induced expression of a dCREB2 activator isoform enhances long-term memory in
Drosophila. Cell 81:107-115.
Young SN (1996) Behavioral effects of dietary neurotransmitter precursors: basic and
clinical aspects. Neurosci Biobehav Rev 20:313-323.
Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG (2004)
Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science 305:217.
Zhang Q, Li XK, Cui X, Zuo PP (2005) D-Galactose injured neurogenesis in the
hippocampus of adult mice. Neurol Res 27:552-556.
Zhang GR, Cheng XR, Zhou WX, Zhang YX (2009) Age-related expression of
calcium/calmodulin-dependent protein kinase II A in the hippocampus and cerebral
cortex of senescence accelerated mouse prone/8 mice is modulated by anti-Alzheimer's
disease drugs. Neuroscience 159:308-315.
Zhao H, Li Q, Zhang Z, Pei X, Wang J, Li Y (2009) Long-term ginsenoside
consumption prevents memory loss in aged SAMP8 mice by decreasing oxidative
stress and up-regulating the plasticity related proteins in hippocampus. Brain Res
1256:111-122.
Zhao S, Edwards J, Carroll J, Wiedholz L, Millstein RA, Jaing C, Murphy DL,
Lanthorn TH, Holmes A (2006) Insertion mutation at the C-terminus of the serotonin
transporter disrupts brain serotonin function and emotion-related behaviors in mice.
Neuroscience 140:321-334.
Zhou Y, Peng L, Zhang WD, Kong DY (2009) Effect of triterpenoid saponins from
Bacopa monniera on scopolamine-induced memory impairment in mice. Planta Med
75:568-574.
Zoran MJ, Doyle RT, Haydon PG (1991) Target contact regulates the calcium
responsiveness of the secretory machinery during synaptogenesis. Neuron 6:145-151.
161
Abbreviations
ABBREVIATIONS
bp
Base pair
ºC
Centigrade
dNTP
Deoxynucleotide triphosphate
DTT
Dithiothreitol
Na2-EDTA
Ethylenediaminetetraacetic acid-disodium salt
g
Grams
h
Hours
kg
Kilogram
cm
Centimeter
min
Minutes
μg
Microgram
μl
Microlitre
μM
Micromolar
mM
Millimolar
M
Molar
mA
Milliampere
NaCl
Sodium chloride
NaOH
Sodium hydroxide
NP-40
Tergitol NP-40
ng
Nanogram
PMSF
Phenylmethylsulfonyl fluoride
rpm
Revolutions per minute
SDS
Sodium dodecyl sulfate
Sec
Second(s)
SSC
Sodium chloride-sodium citrate
TAE
Tris acetic acid EDTA buffer
V
Volts
v/v
volume/volume
w/v
weight/volume
Publications