Libro de Resúmenes Orales y Pósteres www.seinmunologia2016.org

Transcription

Libro de Resúmenes Orales y Pósteres
www.seinmunologia2016.org
Declarado de interés sanitario por el Ministerio de Sanidad, Servicios Sociales e Igualdad
ISBN: 978-84-608-7808-7
39 Congreso de la Sociedad Española de Inmunología
2
Índice
Comités . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Pág. 3
Comunicaciones Orales . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Págs. 4 - 108
Pósteres. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Págs. 109 - 311
3
Comités
Comité Organizador
Presidente:
Vicepresidente:
Secretario:
Tesorera:
Vocales:
José Miguel Sempere Ortells
Adolfo Campos Ferrer
Pascual Martínez Peinado
Esther Caparrós Cayuela
Dolores Planelles Silvestre
Sandra
García
AmparoPascual
Mir Gisbert
Amparo
Mir Gisbert
Carlos Muñoz
Ruíz
Carlos
Muñoz
Mari Luz
de la Ruíz
Sen Fernández
Mari
Luz de
la SenMarco
Fernández
Francisco
Manuel
de la Calle
Francisco
Manuel
Rafael Sirera
PérezMarco de la Calle
Rafael
Sirera Pérez
Isabel Guillén
Salazar
Isabel
Guillén Ruíz
Salazar
Irene Velasco
Irene
Velasco
RuízAraujo
Begoña
Vázquez
Begoña
VázquezGarcía
Araujo
Sandra Pascual
Comité Científico
Rocío Álvarez López
Belén de Andrés Muguruza
Adolfo Campos Ferrer
Miguel Fernández Arquero
José María García Ruíz de Morales
África González Fernández
Isabel Guillén Salazar
Jules Hoffmann
Dolores Jaraquemada Pérez de Guzmán
Manel Juan Otero
Francisco Manuel Marco de la Calle
Amparo Mir Gisbert
Carlos Muñoz Ruíz
Manuel Muro Amador
Eduard Palou Rivera
Dolores Planelles Silvestre
Ricardo Pujol Borrell
José Ramón Regueiro González-Barros
Carmen Rodríguez Hernández
Margarita Rodríguez Mahou
Francisco Sánchez Madrid
Paloma Sánchez Mateos
Silvia Sánchez Ramón
David Sancho Madrid
José Miguel Sempere Ortells
Mari Luz de la Sen Fernández
Rafael Sirera Pérez
Margarita del Val Latorre
María Luisa Vargas Pérez
Begoña Vázquez Araujo
Luisa María Villar Guimerans
4
Comunicaciones Orales
O-001 DISTRIBUTION OF B CELL SUBSETS IN PERIPHERAL BLOOD (PB) THROUGH LIFE
E. Blanco Álvarez1 , S. de Arriba Méndez2 , T. Contreras Sanfeliciano3 , N. Puig4 , A. Romero5 , A. Remesal2 , O. Pelak6 , A. Serra
Caetano7 , J. Torres Cañizales8 , A. Kienzler9 , J. Philippé10 , M. Van Der Burg11 , M. Vlkova12 , E. López Granados8 , T. Kalina6 ,
A. E. Sousa7 , M. Pérez Andrés1 , J. J. Van Dongen11 , A. Orfao On Behalf Of The Euroflow Pid Group1 1) Departamento de Medicina y Servicio de Citometría (NUCLEUS) 2) Servicio de Pediatría 3) Servicio de Bioquímica clínica 4)
Servicio de Hematología 5) Gerencia de Atención Primaria de Salud de Salamanca 6) Department of Haematology/Oncology 7)
Instituto de Medicina Molecular, Facultad de Medicina 8) Departamento de Inmunología 9) Nuffield Department of Medicine,
Experimental Medicine Division 10) Department of Clinical Chemistry, Microbiology and Immunology 11) Department of
Immunology 12) Department of Clinical Immunology and Allergology
Introduction
Humoral immunocompetence has been mostly evaluated via plasma immunoglobulin (Ig) levels, which only partially reflect
B-cell competence. We developed an approach for quantification of all Ig heavy chain (IgH) isotype-specific human memory
B-cell (MB) and plasma cell (PC) subsets.
Objective
To analyze the age-associated distribution of maturation-associated IgH isotype-specific subsets of human B-cells and PCs in
peripheral blood (PB) and Ig plasma levels.
Material and Methods
PB B-cells from 133 healthy donors (age: 7days to 80y) were classified by 11-color flow cytometry (FC) into immature, naïve
and memory B-cells, plus PC. Based on their IgH isotype, the MB and PC subsets were further divided into IgG1, IgG2, IgG3,
IgG4, IgA1, IgA2, IgM and IgD cells. Plasma Ig levels were studied in parallel by nephelometry.
Results
PB B-cells (832±182cells/uL) from newborns (< 1month) mostly consisted of immature (324±2.9cells/µL) and naïve B-cells
(504±182cells/µL), both subsets reaching their highest levels in PB during the first year(y) of life (515±360 and 1100±709cells/
µL, respectively), decreasing thereafter until adulthood (9.5±7.7 and 116±65cells/µL), when their levels became stable. MB
and PC were already detected in the newborns’ PB at extremely low levels (<0.5cells/µL), including IgG1, IgG2, IgG3, IgA1
and IgA2 MB, and IgM, IgG1 and IgA1 PC. Subsequently, IgM, IgG1, IgG4, IgA1, and IgA2 PC raised first at 6-12 months
(7.1±2.8, 11±6.3, 0.2±0.4, 25±15, and 3.5±2.3cells/µL, respectively), later followed by IgG2 and IgG3 PC at 1-2y (1.4±1.8 and
0.9±1.1cells/µL, respectively) and IgD PC (0.72±0.0.75cells/µL) at 2-5y. In subsequent years , PB IgM, IgG1, IgG3, IgA1 and
IgD PC rapidly decreased during childhood, till stable levels were reached at 18-30y (0.6±0.3, 0.6±0.7, 0.3±1, 2±1.4 and
0.4±0.7cells/µL, respectively). Meanwhile PB IgG2, IgG4 and IgA2 PC numbers slowly decreased, reaching stable numbers at
18-30y (0.3±0.3, 0.1±0.3 and 0.8±0.9cells/µL, respectively). MB were produced and released to PB later than PC. IgMD, IgG1,
IgG3, IgA1, and IgD MB showing their highest levels at 2-5y (95±44, 50±31, 7.9±4.6, 15±6.9 and 2.8±1.9cells/µL, respectively),
decreasing thereafter during childhood, to become stable at 10-18y (33±21, 17±11, 4±2.4, 9.5±5.5 and 0.4±0.5, respectively).
In contrast, PB IgG4, IgG2 and IgA2 MB progressively increased until adulthood, their levels remaining stable thereafter:
0.9±0.7, 9.2±5.5 and 6.7±4.9cells/µL, at 18-30y, 30-40y and 50-60y, respectively. For all different IgH isotypes,Ig plasma levels
reached their maximum at higher ages than their corresponding cell compartments, their levels remaining relatively stable
thereafter.
CONCLUSION
Multiparameter FC can dissect the PB B-cell compartment into >30 different B-cell and PC subsets. For all different IgH isotypes, PC and MB numbers peak in PB at younger ages than their corresponding plasma Ig levels. 1st author is supported by a grant from JCyLy and FSE,EDU/346/2013.
5
O-002 IMBALANCE OF SPLENIC B CELLS ON SENESCENCE-ACCELERATED MOUSE (SAMP8). IMPLICATIONS ON A
DEFFECTIVE HUMORAL RESPONSE
B. de Andrés1 , M. Rodríguez1 , I. Martín1 , M. C. Prado1 , C. Ruíz1 , M. Alía1 , I. Cortegano1 , H. Mira1 , M. Villar1 , E. Cano1 , M. L. Gaspar1 1) Instituto de Salud Carlos III.
Introduction
Aging induces alterations on the immune system that lead both in humans and mice to a predominant pre-inflammatory
status, enhanced susceptibility to pathogens and a decrease in response to vaccination. We have studied previously that the
splenic innate-like B-cell population CD19+CD45Rlo (B1REL), shares features with the so-called Aged-B-Cell compartment,
ABC (CD21loCD23lo, CD5-, CD11b-) and with the B1 lineage (embryo-fetal origin, pre-activation stage, spontaneous IgM
secretion). We wanted to investigate the effects of aging on the B1REL B cell subsets, in comparison to ABC, Marginal Zone B
cells and Follicular B cells, and the humoral response released by the different B cells subsets, by using the senescence-accelerated mouse model (SAMP8) and its control senescence-resistant-mouse strain (SAMR1).
Materials And Methods
Adult (2 month-old) and aged (8-14 months-old) SAMP8 and SAMR1 mice were used. Serum Immunoglobulin (Ig) levels
were measured by ELISA. B cell compartments in bone marrow, spleen and peritoneal cells were determined by flow cytometry, and were isolated on an ARIA I cell sorter. ELISPOT experiments were conducted on sorted B cell populations. Ig
repertoires on these cells were studied by VH sequencing. In vivo proliferation (EdU incorporation), apoptosis (Annexin-V)
and senescence-associated ß-galactosidase (SA-ß-Gal) were performed, as well as in vivo DNP-LPS immunizations.
Results
IgG1 serum levels were heavily diminished on aged SAMP8 mice. ELISPOT assays from sorted B1REL and B2 cells showed a
marked reduction on IgM- and IgG1-secreting cells on aged SAMP8 mice, while these mice had an accumulation of ABC, conventional B2 cells and B1REL cells, and a profound diminution of MZ in comparison with aged SAMR1mice. IgH sequencing
from sorted B1REL and B2 cells denoted a low diversity pattern and distinct V-D-JH rearrangements, with moderated levels of
mutational rates on CDR-H3. Transcripts of genes involved on terminal differentiation and class isotype switching were low
on B1REL and B2 cells from aged SAMP8 mice.
B cells from aged SAMP8 mice had significant in vivo levels of SA-ß-Gal, in comparison with aged SAMR1, were prone to
apoptosis and had limited proliferation rates. After DNP-LPS immunization, sera from aged SAMP8 released minimal levels
of IgG1. Furthermore, a marked increase on the number of ABC accompanied by low levels of MZ and B1REL cells were observed. Altogether our results show that aged SAMP8 had low responsiveness in comparison with SAMR1, or adult wild type
BALB/c mice.
Conclusions
Aging on SAMP8 mice affects heavily to the cellular distribution of splenic B cells, by accumulating ABC and B1REL and a
drastic reduction of MZ cells. Sera from SAMP8 mice had markedly low IgG levels, and IgH repertoires were reduced in terms
of diversity. We have demonstrated that some B cell subsets (ABC and B1REL) were more susceptible to age and display a
“senophenotype” characterized by the accumulation of SA-ß-Gal and the inability to become mature B cells-secreting IgG1.
6
O-003 IN SILICO ANALYSIS OF THE ASSOCIATION BETWEEN HLA-DRB1 AND SENSITIZATION TO AIRBORNE ALLERGENS
IN DIFFERENT ETHNIC GROUPS EXPOSED TO SIMILAR ENVIRONMENTAL CONDITIONS
L. Hernández Cano1 , A. Mora González2 , E. Caparrós Cayuela3 , J. Fernández Sánchez4 , P. Aparicio Alonso1 , G. Rubio Pedraza1 1) Universidad de Murcia 2) Hospital Universitario Morales Meseguer 3) Universidad Miguel Hernández 4) Hospital General
Universitario de Alicante
Introduction
Hypersensitivity to pollens and other inhaled allergens is epidemiologically linked to genes such as HLA class II alleles although molecular basis are poorly demonstrated. Additionally, environmental factors like pollution and levels of allergen
exposition strongly contribute to the development of allergy. Here we evaluate gene contribution by analyzing sensitization
of patients belonging to ethnic groups (EG) differing in their most prevalent HLA-DRB1 alleles but living under similar environmental conditions as a consequence of migration.
Objectives
To determine whether the recent adult-onset respiratory allergy, which involves distinct allergens in different EG, can be
related to the predicted binding of allergen derived peptides by overrepresented HLA-DRB1 alleles.
Patients were selected by allergic respiratory symptoms of recent onset and belonged to three EG: South Amerindians
(n=71), Moroccan (n=24) and Spaniards (n=44). All of them lived for more than 5 years in the same suburban area. Sensitization was determined with a standard skin prick test allergen panel. HLA alleles of each EG, as well as their peptide binding
motifs, were obtained from previously reported data and from the freely accessible sites SYFPETHI and RANKPEP. Allergen
sequences were retrieved from the publicly available databases NCBI and UniProt. Motif searches were performed using
ScanProsite.
Results
The three EG showed similar sensitization to grass and to Olea europaea pollen, which is the most sensitizing allergen. Peptide-binding-motif scanning of the major and minor allergens Ole e1, e2, Phl p1 and p2 showed that the six more frequent
DRB1 alleles in each EG had 0-2 sequences to bind in each allergen with no differences among EG. Contrarily, analysis of Der
p1 and p2 indicated no peptide-motifs for binding to the alleles overrepresented in Amerindians (i.e. DRB1*14:02, 04:07 and
08:02) but a total of 15 binding sites for those overrepresented in Moroccans, which may contribute to explain the frequent
sensitization to mites found in this population. The most noteworthy differences were seen when analyzing Chenopodium,
which resulted to be the main allergenic source for Amerindians in the study region (P=0.003 vs Spaniards and P=0.026 vs
Moroccans). Contrarily to expected, Amerindian alleles show much less capacity to present the major allergen (i.e. Salk k1
one match compared to 12 and 9 matches in Spaniard and Moroccan alleles respectively) as well as the minor allergens (i.e.
Sal k2 and k3 one match compared to 34 and 32 matches in the other two EG).
Conclusions
Although association between EG and airborne allergen sensitization is found among patients living under comparable
allergen exposition, in silico studies suggest that peptide binding specificities of HLA-DRB1 alleles, previously involved by
epidemiology, are not always clear contributors to sensitization. Further studies are needed to evaluate DPB1 and DQB1
alleles.
7
O-004 UNRAVELLING MYC’S PARTNER FUNCTION: ROLE OF MAX IN B LYMPHOCYTE DIFFERENTIATION
M. Pérez Olivares1 , D. Fernández Antorán1 , I. Moreno de Alborán Vierna1
1) Centro Nacional de Biotecnología
Introduction
It is estimated that up to 50% of human cancers have a constitutively enhanced expression of Myc family proto-oncogenes.
The myc proteins are members of a basic region/helix-loop-helix/leucine zipper (bHLHZip) transcription factor family (N-, Land c-Myc) and are implicated in biological functions as important as regulation of cell cycle, differentiation or apoptosis. To
activate or repress target genes, Myc proteins bind to conserved DNA sequences (E-boxes) on gene regulatory regions, for
which Myc must form heterodimers with its partner, Max.
Most of the literature assumes that Myc function relies entirely on its ability to heterodimerize with Max protein, although
some recent reports show that c-Myc can perform some functions without Max.
In bone marrow, B lymphocytes undergo several differentiation stages associated with rearrangements of the B cell receptor gene segments. Previous reported data of our group showed that, in developing B lymphocytes, c-Myc is necessary for
normal B cell differentiation in vivo. Then, in later stages, such as mature B cells, c-Myc is needed for cell proliferation and for
some key events during terminal B cell differentiation, as class switch recombination, normal antibody-secreting cell differentiation and the generation of germinal centers.
Objectives
In this study we characterize the in vivo role of the mandatory Myc partner, Max, and we determine whether Myc action on
developing and mature B lymphocytes relies exclusively on its association with Max.
To address this issue, we generate two conditional mouse models using mb-1-cre and cd19-cre mice to specifically inactivate
max in developing and mature B lymphocytes, respectively. Bone marrow B cells of max-mb-1 mice were isolated as B220+
IgM- GFP+ (pro-pre-B cell progenitors), cultured in the presence of IL-7, and analysed by flow cytometry. Spleen B lymphocytes of max-cd19 mice were purified, activated with LPS and IL-4, and characterize by flow cytometry. Results
Our results show that max-deficient B lymphocytes have a defect in B cell transition to immature and mature stages, and
are dramatically decreased in the bone marrow of these mice, compared with controls. However, these B cells are capable
of differentiating in vitro from pro-pre-B cells progenitors, and generating IgM+ B cells. Finally, we have also observed that
max-deficient B cells begin to proliferate, are able to generate plasma cells and to undergo class switch recombination after
in vitro stimulation.
Conclusions
It is generally assumed that Max is essential for Myc function. Nonetheless, there are no definitive in vivo data to support this
argument. In this study, we characterize the role of Max in our model of B lymphocyte differentiation, and we give evidence
of some c-Myc functions that can be perform in the absence of Max protein.
Funding: Plan Nacional MINECO SAF
8
O-005 17Α-ETHINYLESTRADIOL ALTER IGM+-B LYMPHOCYTE RESPONSES
M. Rodenas1 , N. E. Gómez-González1 , A. García-Alcázar2 , J. Meseguer1 , V. Mulero1 , A. García-Ayala1 1) Universidad de Murcia 2) Centro Oceanográfico de Murcia
Introduction
Freshwater aquatic organisms face the challenge of being exposed to endocrine disruptors chemicals (EDCs) discharged by
the human population. One of the most menacing compounds is 17α-ethinylestradiol, used in most oral contraceptive pills
and in hormone replacement therapy. We have previously demonstrated that this compound alter the immune response of
the gilthead seabream (Sparus aurata L.), a protandrous teleost with a great commercial value.
Objectives
In the present study, we investigate the effect of the dietary intake of EE2 on the immune response of gilthead seabream
focusing our attention in IgM positive B lymphocyte responses.
Materials and Methods
Animals, in vivo treatments
Healthy specimens of gilthead seabream were fed with the pellet diet supplemented with 5 μg EE2/g food or unsupplemented (untreated fish) for 76 days. They were intraperitoneally injected with hemocyanin and imject alum adjuvant (vaccinated
fish) or with PBS (unvaccinated fish) to evaluate the effect of EE2 on an induced adaptive immune response. Sampling was
carried out at 1 and 9 days post-priming (dpp).
The experiments described comply with the guidelines of the European Union Council (2010/63/EU) and the Bioethical Committees of the University of Murcia and IEO for the use of laboratory animals.
Analysis of gene expression
Total RNA was extracted from liver and head kidney. The expression of the genes coding for vtg (liver) and il1b (head kidney)
was analyzed by real-time PCR.
Determination of IgM, Zap70, and IgM and Pax5 positive cells
The percentage of IgM, Zap70 (IgT+ cells), and IgM (IgM+ lymphocyte B) and Pax5 (lymphocyte B-activator protein) double
positive cells was measured in aliquots of 0.5×106 leukocytes from head kidney. After the staining, cells were analyzed by
flow cytometry.
Proliferation assay
To assess the proliferative activity of head kidney IgM+ and Zap70+, 5-ethynyl-2’-deoxyuridine (EdU) was used and detected
by immunofluorescence, and analyzed by flow cytometry.
Statistical analysis
ANOVA and Tukey tests were applied. The critical value for statistical significance was taken as p ≤ 0.05. The asterisks *, ** and
*** refer to p <0.05, p <0.01 and p <0.001, respectively.
Results
Dietary EE2 exerted estrogenic effects on this species, since it increased hepatic vitellogenin gene expression, a biomarker for
endocrine disruption, as we have previously demonstrated.
EE2 also altered the induction of il1b expression in response to vaccination at 1 and 9 dpp.
Furthermore, the percentage of IgM+ B cells increased 1 dpp and decreased at 9 dpp, whereas the number of IgT+ B cells was unaltered.
More interestingly, the EE2-treated group showed a significantly reduced in percentage of IgM+ B cells but increased those of
IgM+/Pax5+/Edu+, which may represent activated B lymphocytes.
Finally, T lymphocyte abundance was unaltered by either vaccination or dietary EE2.
Conclusion
EE2promotes the activation of IgM+ B lymphocytes in teleost fish in response to antigenic stimulation.
MINECO y Fundación Séneca
9
O-006 CTCF IS A REGULATOR OF THE GERMINAL CENTER REACTION
E. Marina Zárate1 , A. Pérez García1 , A. Rodríguez Ramiro1
1) CNIC
Introduction
During the course of an immune response, B cells produce high affinity antibodies in the secondary diversification reactions
that take place in germinal centers (GCs). These diversification events are called somatic hypermutation (SHM) and class
switch recombination (CSR) and are coupled to a high rate proliferation (clonal expansion) or apoptosis (negative selection)
in the context of affinity maturation. Both SHM and CSR are initiated by activation-induced cytidine deaminase, which deaminates cytidines into uracils on the DNA of the immunoglobulin genes. While critical for the immune response, GCs are also
involved in the oncogenic transformation of B cell due to the mechanisms implicated in the affinity maturation of antibodies.
Therefore, understanding the mechanisms regulating these diversification events is relevant both for the humoral response
and for B cell lymphomagenesis.
CTCT, a zinc finger protein involved in long-range chromatin interactions and in transcriptional regulation, has been reported to have an important role during B cell development. Specifically, CTCF controls V(D)J recombination in bone marrow
B cells by favoring the interactions between distal regions of DNA. However, the role of CTCF in CSR or SHM during the GC
reaction has not been addressed.
Objective
Since long-range interactions are required for CSR, we propose that CTCF may be implicated in the diversification reactions
and as a general transcriptional regulator of the GC.
We made use of conditional mice harboring a floxed CTCF allele, where CTCF is eliminated at late bone marrow B cell differentiation after breeding with mice that express Cre recombinase under the control of CD19. Results
We analyzed the involvement of CTCF in the GC reaction in vivo looking at Peyer’s patches and after a T-dependent immunization. We found a dramatic decrease of germinal center B cells indicating that CTCF have an important role controlling
GC. In order to study more in detail the diversification events, we stimulated in vitro CTCF deficient splenic B cells. After 48h
of culture, CTCF deficient B cells show a diminished proliferation rate and, surprisingly, an increased level of switched cells.
Conclusions
1) CTCF is required for the GC reaction. 2) CTCF deficiency impairs B cell survival and proliferation. 3) CTCF negatively regulates CSR. These findings indicate that CTCF can be a regulator of the GC reaction since controls main features such as
proliferation and diversification events.
10
O-008 BRUTON’S TYROSINE KINASE REGULATES INTEGRIN-MEDIATED B CELL MOTILITY AND ANTIGEN-TRIGGERED
IMMUNE SYNAPSE FORMATION
S. Román García 1 , S. Merino Cortés1 , Y. R. Carrasco1 1) Centro Nacional de Biotecnología
Introduction
Bruton’s tyrosine kinase (Btk) has an important role in B cell development and function. It is involved in the signalling through the B cell receptor (BCR), chemokine receptors and Toll-like receptors. Mutations in Btk lead to primary immunodeficiency
in humans (X-linked agammaglobulinemia, XLA) and mouse (X-linked immunodeficient, Xid). Besides, chemical inhibition of
Btk function with Ibrutinib has striking good results in the treatment of B cell lymphoma patients; the mechanisms behind
its effects are not well understood.
Objectives
In this study, we pursued to shed light in the molecular dynamics and functions of Btk during chemokine-mediated migration and antigen-triggered Immune Synapse (IS) formation of B cells.
To analyse cell dynamics, we used a two-dimensional biomimetic model combined with real-time confocal microscopy, the
A20 B cell line transiently transfected with Btk-GFP constructs and primary B cells isolated from the Xid mouse model. The
biomimetic model is based on artificial planar lipid bilayers containing ICAM-1 and chemokine coating in the absence or
presence of tethered antigen.
Results
In A20 B cells expressing Btk-GFP, we observed that Btk located mainly at the lamella and leading-edge of motile cells, while
it distributed homogenously at the IS domains. Btk over-expression impaired neither B cell migration nor IS formation. We
obtained similar results with a Btk mutant that lacked the PH2 domain and mimic the mouse Xid mutation. However, primary
B cells isolated from Xid mice showed important impairment in cell polarization, integrin-mediated adhesion and migration
in response to CXCL13 chemokine. In the presence of antigen, Xid B cells had reduced capacity (~50%) to form the IS; they
also failed to organize the peripheral adhesive domain (peripheral supramolecular activation cluster, pSMAC) but were able
to aggregate similar antigen quantities at the central SMAC when compared with wild type B cells. Immunofluorescence
analysis of fixed synapse-forming B cells showed important defects in the F-actin polimerization, Vinculin and Talin recruitment to the IS as well as in their location at the synapse; these results supported the lack of pSMAC at the Xid B cell synapse.
The defects in IS formation resulted in diminished B cell activation, measured by CD86 and CD69 expression, by tethered
antigen in Xid B cells.
Conclusions
The data so far indicated important functions for Btk in regulating B cell dynamics in response to chemokine and tethered
antigen, and with critical consequences in B cell activation.
11
O-009 ICAM-1 PROVIDES AN HAPTOTACTIC SURFACE FOR RAPID T CELL EXIT VIA LVS UPON INFLAMMATION
A. Teijeira1 , M. Hunter2 , E. Russo2 , I. Melero1 , C. Halin2 1) CIMA, Pamplona 2) ETH Zürich
Introduction
T cells represent the main cell type found in afferent lymph, but the molecular and cellular mechanisms of their migration
through afferent lymphatic vessels (LVs) are only marginally understood. The few studies looking at this particular step of migration have shown that T cells exiting skin via LVs have a particular phenotype (CCR7int/+ CD62Lint CD69- CD103+/- CCR4+/-E-selectin ligands+) (Bromley,2013). CCR7 and S1PR1 have been pointed as molecules responsible of this egress. It has been as
well shown an increased migration of T cells out of inflamed tissue via LVs. However, little is known about the mechanisms
promoting this egress. Our study focuses in imaging for the first time migration of T cells via Lymphatic vessels from skin to
unravel mechanisms and particularities of this process both under steady-state conditions and inflammation.
Objectives
-Visualization and characterization of T cell migration within LVs.
-Identification of differences between T cell migration in steady-state and inflammation.
-Study the role of ICAM-1 in T cell migration via LVs.
Methods
We established a new model with GFP expressing LVs and RFP expressing T cells named Prox-1xhCD2RFP (Choi, 2011, Veiga-Fernandes, 2007) for imaging T cells in the skin. For intravital microscopy of skin LVs time-lapse imaging was performed
with a SP8 Confocal-MP system. Flank lymphatic collectors were observed with a Zeiss Stereomicroscope equipped with a
sCMOS camera. Inflammation in skin was induced by a CHS response to oxazalone and T cell migration to LN was performed
by adoptively transfer of OTII activated T cells in CHS pre-inflamed ear skin.
Results
By intravital microscopy we could observe that T cells crawl within lymphatic capillaries. T cells frequently arrest exhibiting
very low motility and only when arriving close to lymphatic collectors are flushed away by the vessel pumping. In collectors
T cells are transported by the pumping performed by the vessel, being the backflow of T cells prevented by lymphatic valves.
Skin inflammation drives entry of T cells into LVs. Motility gets highly enhanced within the vessels, providing a “highway” that
allows T cells to reach higher speeds than in interstitium. This increased speed is more dependent on the inflammatory state
of the ear than in the activation of T cells. ICAM-1 showed to be important in both the entry and the haptokinesis of T cells
within LVs, where it impedes the fast migration of T cells and impairs directionality of T cell movement. In fact blockade of
ICAM-1 was able to inhibit T cell migration from inflamed skin to the LNs.
Conclusions
Our experiments show that migratory ability of T cells in steady state within LV is very low and inefficient. T cell migration
gets enhanced in inflammation due to the upregulation of ICAM-1 on LECs that facilitates transmigration of T cells and provides a haptokinetic surface for very fast migration.
12
O-010 A ROLE FOR SFRP1 REGULATOR OF WNT SIGNALING IN T-ALL
O. Lancho-Medina1 , S. González-García1 , J. Alcain1 , P. Fuentes1 , M. Carcia-Peydro1 , P. Esteve2 , A. Ambesi-Impiombato3 ,
M. Sánchez-Martin3 , P. Bovolenta2 , A. Ferrando3 , M. L. Toribio1
1) Centro de Biologia Molecular 2) Centro de Biologia Molecular 3) Institute for Cancer Genetics
Introduction
Notch signaling plays a key role in many developmental processes and, particularly, in T-cell lineage commitment and differentiation within the thymus; but deregulation of the Notch pathway results in constitutive Notch activation and generation
of T-cell acute lymphoblastic leukemia (T-ALL). Recent results have shown that Notch signaling is regulated in mouse retinal
neurogenesis by SFRP1, a regulator of the Wnt pathway that binds to ADAM10 metalloprotease and downregulates its activity.
Objectives
Given that ADAM10 is required for Notch activation, the aim of this study was to establish whether SFRP1 also regulates
Notch activity in T lymphopoiesis and, particularly, whether SFRP1 can display an anti-oncogenic role in the pathogenesis of
Notch-dependent T-ALL
To approach this issue, we have overexpressed human SFRP1 by lentiviral transduction in Notch1-dependent T-ALL cell lines;
to analyze the relevance of the anti-proliferation potential of SFRP1 in vivo, leukemia cells transduced with SFRP1 or GFP as
control were transplanted subcutaneously in immunodeficient mice,and in vivo leukemic progression was analyzed at different time post-transplant.
Moreover, to study the status of SFRP1 in the pathogenesis of TALL, we performed sequencing in primary leukemias.
Results
Our in vitro data indicate that SFRP1 overexpression causes a decrease in leukemic cell proliferation and a downregulation
of active Notch1 levels, suggesting a direct functional relationship between SFRP1 and Notch1 in T-ALL cells. Our results in
vivo showed that Sfrp1 expression impaired tumor growth induced a delayed onset of tumor engraftment, supporting an
anti-oncogenic role of SFRP1 also in vivo.
We have addressed the putative anti-oncogenic effect of SFRP1 in primary leukemias from patients diagnosed with T-ALL.
We performed Sanger sequencing to determine which leukemias possessed activating mutations of Notch1 pathway at the
S2 ADAM-dependent cleavage site and have analyzed whether treatment of these primary TALL with supernatants containing human SFRP1 have an effect on Notch1 activation. Importantly, we found that, two SFRP1-treated samples downregulated expression of ICN1, indicating the inhibition of Notch1 activation.
Finally, to determine the incidence of mutations in SFRP1 gene in T-ALL, “next generation sequencing” of coding SFRP1 exons
was performed in DNA samples from a cohort of primary human T-ALLs, which allowed the identification of a mutation
in the SFRP1 gene in one sample. Moreover, we analyzed the epigenetic modifications (methylation) in the SFRP1 gene in
these primary T-ALLs compared with normal T cells. The methylated DNA sequencing allowed us to identify fifteen hypermethylated regions in the SFRP1 gene of the primary T-ALLs, suggesting a tightly epigenetic regulation of SFRP1 in this disease.
Conclusions
These results indicate that SFRP1 can act as anti-oncogenic factor inhibiting Notch1 activation in T-lineage cells and, therefore, deregulation of SFRP1 gene expression can play a critical role in the pathogenesis of T-ALL. 39 Congreso de la Sociedad Española de Inmunología
13
O-011 A NOVEL ROLE FOR A-TYPE LAMINS IN NAÏVE T-CELL DIFFERENTIATION
R. Toribio-Fernández1 , V. Zorita1 , S. Iborra1 , C. Rius1 , G. Martínez del Hoyo1 , V. Rocha-Perugini1 , D. Sancho1 , F. SánchezMadrid2 , V. Andrés1 , J. M. González-Granado1
1) Centro de Investigaciones Cardiovasculares Carlos III (CNIC) 2) Hospital La Princesa
Introduction
Naïve CD4+ T-cells are activated upon the recognition of an antigen and differentiate into T-helper cells (Th) that coordinate
adaptive immunity. Some pathological processes are linked to deregulated Th cell differentiation. Lamin A/C regulates signal
transduction, gene transcription and cell proliferation, differentiation and migration. We have recently published that lamins
A/C are induced in naïve T cells upon TCR-mediated activation to enhance T-cell activation.
Objective
To analyse the role of lamin A/C in the differentiation of naïve CD4+ T-cells towards Th cells.
Material and Methods:
We have studied by flow cytometry and RT-PCR the differentiation process of naive CD4+ T-cells isolated from wild-type and
Lmna-/- mice in vitro. We have also employed a Vaccinia virus and a Leishmania major infection in several mouse models to
analyze the Th-cell differentiation in vivo.
Results
CD4+ T-cells from Lmna-/- mice exhibited significant decreased production of the Th1 signature cytokine IFN-gamma after TCR
stimulation, concomitantly with impaired induction of the Th1-specific transcription factor T-bet during in vitro differentiation experiments. Th1 differentiation was reduced upon Vaccinia virus infection in lethally-irradiated and Lmna-/- bone-marrow transplanted mice when compared to lethally-irradiated and wild-type bone-marrow transplanted mice. Reduced Th1
differentiation was also observed when lamin A/C was absent upon Leishmania major infection after lethal-irradation of
wild-type mice followed by wild-type or Lmna-/- bone-marrow transplantation. Moreover Lmna-/- naïve CD4+ T-cells exhibited
less differentiation toward a Th1 phenotype when compared with wild-type cells after their single or wild-type-combined
adoptive transfer into wild-type mice and upon Vaccinia virus infection.
Conclusion
A-type lamins are critical for naive CD4+ T-cell differentiation toward a Th1 phenotype.
Study supported by ISCIII (CP11/00145, PI14/00526) MINECO (RD12/0042/0028) and Fundación Ramón Areces
14
O-012 EPIGENETIC REGULATION OF THE TRANSCRIPTIONAL PROGRAM IN MEMORY AND TERMINAL DIFFERENTIATED
CD8+ T CELLS
R. M. Rodríguez López1 , B. Álvarez Suarez2 , D. Mosen Ansorena3 , J. L. Lavin Trueba3 , .A. Baragaño Raneros1 , L. Márquez
Kisinousky1 , A. M. Aransay Bañares3 , C. López Larrea1 1) Hospital Universitario Central de Asturias 2) Instituto de Investigacion Sanitaria Fundacion Jimenez Dıaz 3) CIC bioGUNE &
CIBERehd
Introduction
Memory CD8+ T cells generated after infection acquire the ability to sustain antigen-independent homeostasis while preserving effector functions upon antigen re-encounter. Thus, differentiated CD8+ T cells must maintain lineage-specific properties by heritable changes in their gene expression programs. Epigenetic mechanisms have been shown to play a critical role during cell differentiation by contributing to the formation of stable, heritable gene expression patterns.
Objectives
To further study the mechanisms of memory maintenance in CD8+ T cells, we performed genome-wide analysis of DNA
methylation, histone marking (H3K9Ac and H3K9me3) and gene expression profiles in naive, effector memory (EM) and terminally differentiated memory cells (TEMRA).
Material And Methods
CD8+ T cell subsets were isolated by Fluorescence-activated cell sorting (FACS). Whole-genome expression was characterized
using Human HT12 v4 BeadChips (Illumina). DNA methylation was analyzed with Infinium HumanMethylation450 BeadChips (Illumina). Chromatin immunoprecipitation DNA sequencing (ChIP-Seq) was performed with iDeal ChIP-seq (Diagenode) and TruSeq ChIP Library Preparation Kits (Illumina).
Results
Gain and loss of methylation occurred during CD8+ differentiation, but DNA demethylation was more frequent and better
correlated with gene expression. These changes took place in CpG-poor regions and were closely associated with cytotoxicity and cell adhesion functions. Up to 161 genes that encode transcriptional regulators, some of whose functions in CD8+ T
cells are as yet unknown, were differentially expressed in the course of differentiation. Among them, a downstream effector
of the β-catenin pathway, the Lymphoid Enhancer-Binding Factor 1 (LEF1), was the most downregulated transcription factor
in the memory subsets. This result was correlated with loss of H3K9Ac and gain of DNA methylation at the promoter region.
In addition, gene expression profiling after specific knock-down of LEF1 in naive cells revealed a functional link between the
β-catenin pathway a STAT1 expression. In fact, we also observed that pharmacological inhibition of β-catenin reduced STAT1
expression and phosphorilation and prevented naive CD8+ T cell activation after TCR stimulation in vitro. On the other hand,
EM and TEMRA cells showed similar gene expression and DNA methylation patterns. Nonetheless, TEMRA cells upregulated
many genes associated with NK cytotoxicity while accumulating H3K9Ac in their promoter regions. Interestingly, we also
observed gene expression changes in genes related with the TGFβ signaling pathway and several transcription factors not
yet described in this cell subset. Conclusions
Our results provides new insights into the epigenetic remodeling that accompanies the transcriptional program during CD8+
T cell differentiation that will help to understand the regulatory networks involved in memory maintenance.
This work has been financially supported by the Instituto de Salud Carlos III [grant number PI12/02587] and the Fundación
para el Fomento en Asturias de la Investigación Científica Aplicada y la Tecnología (grant number GRUPIN 14-030).
15
O-013 LY9 (CD229) LYMPHOCYTIC IMMUNORECEPTOR
M. Balada1 , M. Cuenca1 , P. Engel1
1) Facultad de Medicina. Univerisdad de Barcelona
Introduction
Signaling lymphocytic activation molecule family (SLAMF) receptors and the specific adapter SLAM-associated protein (SAP)
modulate the development of innate-like lymphocytes. Ly9, a SLAM family member, has been shown to function as a negative regulator of innate-like T lymphocyte cell development in the thymus.
Objectives
Study the regulatory role of Ly9 in the development and homeostasis of NKT cells subsets.
Flow cytometry analysis of NKT cell subsets: NKT1 (CD1d-tetramer+ PLZFneg T-bethi), NKT2 (CD1d-tetramer+ PLZFhi T-betneg)
and NKT17 (CD1d-tetramer+ PLZFlow RORgT+) in the thymus and spleen of wild type and Ly9-deficient mice (Ly9-/-). Changes
in these subsets were also analyzed after in vivo treatment with a monoclonal antibody against Ly9.
Results
In this study, we show an increase in iNKT cell numbers in the thymus of Ly9-/- mice due to an expansion of NKT2 cells, while
thymic NKT1 were not detected. Ly9 absence also lead to an enlargement of the iNKT cell pool in the spleen, and in contrast
to what it was observed in the thymus, NKT1 cells were present in Ly9-/- spleen, indicating that the homeostasis of the different iNKT cell subsets can have distinct requirements in the periphery. Furthermore, in vivo treatment with an agonistic
monoclonal antibody directed against Ly9 significantly decreased iNKT cell numbers in the spleen, and this reduction was
preferentially due to a depletion of NKT2 cells.
Conclusions
These data show that Ly9 regulates NKT cell development and that anti-Ly9 targeting could represent a novel therapeutic
approach to modulate NKT cell expansion.
16
O-014 CHARACTERIZATION OF FUNCTIONAL AND TRANSCRIPTIONAL EFFECTS DERIVED FROM THE NCK-TCR
INTERACTION INHIBITION
D. Reyes Garau1 , A. Borroto Revuelta1 , B. Alarcón Sánchez1 , D. Tormo 2
1) Centro de Biología Molecular Severo Ochoa 2) Artax Biopharma Inc
Introduction
Antigen binding to the T cell receptor (TCR) triggers the recruitment of the cytosolic adaptor protein Nck to a proline-rich
sequence (PRS) in the cytoplasmic tail of the CD3ζ subunit. Nck binds to the PRS with high affinity through its N-terminal SH3
domain (SH3.1); being its recruitment to the TCR important for T cell activation by weak but not by strong agonists. Through
virtual screening and using combinatorial chemistry, we have generated an inhibitor of the TCR-Nck interaction that selectively inhibits TCR-triggered T cell activation.
Materials and methods
The capacity of our compound to disrupt TCR-Nck interaction as well as its biological effects at the level of proliferation, cell
signaling and gene expression have been assessed in human peripheral blood T cells by performing inmunoprecipitation
experiments, expression analysis of T cell activation markers by flow cytometry, proliferation assays and microarray-based
gene expression analysis. The therapeutic efficiency of our compound has been tested on the development of experimental
autoimmune encephalitis (EAE) in mice, a model for multiple sclerosis.
Results
The inhibitor shows high selectivity, it is non-toxic and exerts a powerful therapeutic effect in a mouse model of autoimmune encephalitis. In vitro proliferation assays performed on human peripheral blood T cells, our compound showed intense
anti-proliferative effect on both CD4 and CD8 T-cells. However, the compound enhanced TCR down modulation and promoted CD69 upregulation at concentration of 1nM. Moreover, it impairs early TCR-mediated signaling events such as actin
polymerization and the phosphorylation of Zap-70, an effector protein kinase that is recruited to the TCR and initiates its
downstream signaling cascade.In order to gain insight into the biological pathways affected by the TCR-NCK interaction inhibition, we have analyzed human T-cell gene expression after anti-CD3 stimulation by performing human gene expression
microarrays. The analysis of the obtained data, allowed us to identify 1254 and 2204 genes whose expression was up-regulated in response to the TCR stimulation after 4 and 24 hours respectively, and 137 and 539 genes that were inhibited under
these conditions. The presence of our compound impaired the activation of 511 and 623 genes after 4 and 24 hours of TCR
stimulation respectively, and prevented the inhibition of 29 and 81 genes. In the determination of the canonical pathways
overrepresented among the genes whose expression was inhibited by our compound, we found overrepresentation of the
tRNA charging, the G1/S checkpoint regulation and the interleukin 15, CD28 and the interferon signaling pathways, elucidating possible mechanisms by which our compound could be impairing cellular functions such as cell growth, proliferation
and development.
Conclusions
Taken together these results we suggest that our compound has an anergic effect over T-cell activation and an interesting
therapeutic potential as inmunomodulator against autoimmune T-cell responses.
17
O-015 UNDERSTANDING THE ROLE OF TCR NANOCLUSTERS IN VIVO
E. Rodriguez Bovolenta1 , B. Alarcon Sanchez1 , H. M. Van Santen1
1) Centro Biologia Molecular Severo Ochoa (CSIC/UAM)
Introduction
The T cell receptor (TCR) at the cell surface of the T cell is already organized in clusters of up to 20 TCR complexes before
interaction with its cognate peptide-MHC (pMHC) ligand. Previous work of our groups has established that this clustering
is dynamically regulated during T cell differentiation and that these clusters provide the T cells with enhanced sensitivity to
antigen. We furthermore described that a mutant of the TCR-associated CD3-zeta chain impaired TCR nanocluster formation
and antigen sensitivity upon reconstitution of CD3zeta-deficient T cell lines and ovalbumin-specific TCR-transgenic hematopoietic precursors.
Objectives
We would like to understand the quantitative and qualitative impact of TCR nanoclusters in the development and differentiation of polyclonal T cell subsets and their role in protective immune responses as well as auto-immune and anti-tumor
responses.
We generated transgenic mouse lines expressing mutant or wild type GFP-coupled CD3zeta (CD3zGFP) chains under control
of the CD2 promoter. These transgenic mouse lines have been crossed back onto lines deficient for the endogenous CD3zeta chain. This approach allows us to study in mice homozygous for the endogenous CD3zeta chain deficiency the capacity
of the mutant CD3zGFP chains to support differentiation and function of the various T cell subsets, and hence the role of
TCR nanoclusters in these processes. When analyzed in mice heterozygous for the endogenous CD3zeta deficient allele we
can address the capacity of the mutant CD3zGFP chains to sustain these processes in direct competition with endogenous
CD3zeta chains.
Results
Our initial analysis of mice expressing the mutant CD3zGFP chain in absence of endogenous CD3z indicates that starting
at the late DP phase of thymic differentiation, when TCR-mediated signaling becomes crucial for developmental progress,
the CD4+ T cell subset has an increased level of TCR expression as compared to wild type CD3zGFP expressing mice. This
suggests a compensatory mechanism for inefficient TCR signaling capacity. In mice expressing the mutant CD3zGFP chain in
presence of the endogenous CD3zeta chain we detect mostly CD4+ T cells with a reduced level of expression of the mutant
CD3zGFP chain as compared to mice expressing the wild type CD3zGFP chain, suggesting that CD4+ T cells expressing a
higher level of the mutant chains are less competitive during differentiation. While the expression level of mutant and wild
type CD3zGFP chains is very similar in CD8+ T cells, we have observed defects in proliferative capacity and induction of certain activation markers and cytokines.
Conclusions
Our initial results show defects in differentiation and activation of CD4+ and CD8+ T cell expressing the mutant CD3zeta
chain, and hence indicate an important role of TCR nanoclusters in these processes. We are currently investigating downstream signaling events that are implicated in these defects and will expand analysis of the response capacity of these T cells
in pre-clinical models of auto-immune and anti-tumor responses.
18
O-016 RRAS2 SETS THE THRESHOLD FOR NEGATIVE SELECTION IN THE THYMUS
A. Martínez-Riaño1 , B. Alarcón1
1) Centro de Biología Molecular Severo Ochoa
Introduction
The Ras-MAPK pathway has been linked to positive and negative selection processes during thymocyte development. However, the identity of the Ras GTPases involved in the two processes has not been elucidated. Some years ago, it was described
that RRas2, a small GTPase of the RRas subfamily, was able to interact with the TCR and BCR and was playing an important
role during tonic signalling and survival of mature lymphocytes [1]. Interestingly, we have found that RRas2 is the most highly expressed GTPase of the classical and RRas subfamilies in thymocytes.
Objectives
To study the role of RRas2 during thymocyte development
We analyzed by Flow cytometer thymocyte development of RRas2 deficient animals in a C57BL/6 or AND TCR transgenic background expressing I-Ek or I-Ab MHC class II haplotypes. We have also performed Quantitative PCR analysis on thymocytes
subpopulation in those animals. OT-I TCR transgenic mice were used to analyse thymocyte activation and apoptosis upon
stimulation with MHC-peptide ligands of different affinities. Experimental Autoimmune Encephalomyelitis mouse model
was used to study the development of autoimmune disease in the absence of RRas2.
Results
Thymocytes from RRas2-deficient mice expressing the AND TCR transgene show a dramatic loss of CD4+ SP thymocytes
in H-2k background but not in H-2b background, suggesting that thymocytes are eliminated at the DP-SP transition or at
CD4+ SP when the affinity of the TCR for self-MHCII is relatively high. This is coincident with a massive thymocyte apoptosis
accompanied by an upregulation of the negative selection marker Nur77. Moreover, in the MHC-I restricted OTI TCR model
DP thymocytes are shown to have an increased sensitivity to apoptosis after stimulation with weak agonist derivatives of
the peptide SIINFEKL. Finally, using the Experimental Autoimmune Encephalomyelitis model we detected a resistance in
RRas2-deficient mice to develop neurological symptoms upon MOG immunization, together with a reduction in the avidity
of CD4+ peripheral T cells for MOG tetramers. These data are in concordance with the existence of a more stringent negative
selection in the absence of RRas2.
Conclusions
RRas2 GTPase sets the threshold for negative selection by activating prosurvival signalling pathways.
[1] Delgado, P, et al. Essential function for the GTPase TC21 in homeostatic antigen receptor signaling. Nat Immunol. 10, 880888. (2009)
19
O-017 IDENTIFICATION OF PATIENTS WITH LRBA AND PIK3R1 MUTATIONS PREVIOUSLY DIAGNOSED WITH COMMON
VARIABLE IMMUNODEFICIENCY DISORDERS
L. M. Allende Martínez1 , R. Ruiz García1 , L. Díez Alonso1 , R. Laguna Goya1 , N. Dominguez Pinilla2 , M. J. Castro Panete1 , E. Paz
Artal1 , J. Ruiz Contreras3 , C. Grande4 , L. I. González Granado3
1) Hospital Universitario 12 De Octubre, Madrid 2) Hospital Virgen De La Salud, Toledo 3) Hospital Universitario 12 De Octubre,
Madrid 4) Hospital Universitario 12 De Octubre, Madrid
Introduction
Common variable immunodeficiency (CVID) is characterized by hypogammaglobulinaemia and recurrent infections. In particular when manifesting later in life, CVID must be differentiated from combined immunodeficiency (CID). It is well recognized that a relevant proportion of patients with a clinical diagnosis of CVID (up to 10%) also presents with low numbers of
T-cells and/or impaired T-cell function leading to CID with immune-dysregulation and autoimmunity as the predominant
feature rather than an infectious phenotype. Recently, loss of function in LRBA and gain of function in CTLA and PIK3CD/
PIK3R1 have been described. These syndromes share features with CVID, but really are CID with immune dysregulation, autoimmune cytopenia, and hypogammaglobulinaemia.
Objectives
We have screened a cohort of 30 molecularly undefined primary immunodeficiency patients, previously diagnoses of CVID
or CID, for CTLA4, LRBA, PIK3CD and PIK3R1 deficiencies.
Immunophenotyping was performed from molecular defined patients included in the study. Memory/naïve T and B-cell
subsets, Tregs and Tfh cells analysis were assessed.
Results
We have identified mutations in LRBA and PIK3R1 genes in two patients.
LPS-responsive beige-like anchor protein (LRBA) deficiency is caused by mutations in LRBA gene. LRBA is an important control point for maintaining intracellular stores of CTLA4, which allows the protein to mobilize rapidly to the cell surface where
it can perform its inhibitory function in Tregs and memory T cells. Clinically, the LRBA deficient patient suffered an intracranial granuloma, interstitial lung pneumonia as well as multiple granuloma and acute autoimmune haemolytic anemia. She
maintains decrease naïve CD4 and CD8 T-cells, expansion of effector CD4 and CD8 T-cells, an altered phenotype of Tregs and
Tfh CD4 T-cell, hypogammaglobulinemia and increased serum levels of soluble FasL and vitamin B12.
Heterozygous gain-of-function mutations in PIK3CD or PIK3R1 genes were recently reported to be responsible for a novel
form of CID, causing hyperactivation of PI3K signalling in immune cells. Here, we also report a patient with PIK3R1 deficiency,
clinically, he showed failure to thrive, obstructive sleep apnea syndrome (OSAS), recurrent pneumonia and chronic otitis media. Additionally, he developed huge cervical bilateral lymphadenopathies. Biopsy turned out to be low grade non-Hodgkin
MALT lymphoma. Immunologically, he maintains expansion of senescent CD8+ T cells with relatively increased of transitional B cells, reduced IgG but elevated IgM levels in serum and an altered Tregs and Tfh phenotype.
Conclusions
Molecular diagnosis of both patients are of particular interest since a high rate of patients with LRBA deficiency show early
and sustained improvement in response to abatacept, similar results could be obtained for PIK3CD/PIK3R1 deficiencies with
the development of specific inhibitors of PI3K and may represent a specific therapeutic option.
20
O-018 ALTERED HUMAN DENDRITIC CELL PHENOTYPE AND SUBSET COMPOSITION IN THE BLOOD AND
GASTROINTESTINAL TRACT OF ULCERATIVE COLITIS PATIENTS
D. Bernardo1 , M. Chaparro1 , A. C. Marín1 , P. M. Linares1 , M. Jiménez1 , J. P. Gisbert1
1) Servicio de Aparato Digestivo. Hospital Universitario de La Princesa e Instituto de Investigación Sanitaria Princesa (IIS-IP)
Introduction
Dendritic cells (DC), the most potent antigen presenting cells, determine the outcome (pro-inflammatory/tolerogenic) of antigen-specific adaptive immune responses. In the gastrointestinal tract, DC promote the mechanisms of immune tolerance
towards the nutrients and the commensals while initiate immune responses against invading pathogens. Changes in that immunity/tolerance balance are related with the development of inflammatory bowel diseases, including ulcerative colitis (UC).
Objectives
To characterize human circulating and intestinal DC from healthy controls and active UC patients. Material And Methods
Intestinal biopsies were obtained form the colon and terminal ileum (TI) from non-inflamed healthy controls without autoimmune diseases or malignancies. The inflamed colon and the non-inflamed TI were also sampled from UC patients. Blood
samples were obtained from the same patients/controls. All samples were immediately processed in the laboratory and
characterized by flow cytometry.
Results
Human intestinal DC were identified within singlet viable CD45+ cells as HLA-DR+CD11c+CD14-CD64- and divided into subsets
based on the expression of CD103 and SIRPα. CD103-SIRPα+ DC were the main intestinal subset and together with CD103+SIRPα+ DC were CD1c+ILT3+. CCR2 was expressed in all CD103-SIRPα+ DC with expression being variable on the CD103+SIRPα+ subset, where it was inversely correlated with CD103 expression. CD103+SIRPα- DC constituted a minor subset and
were CD141+ILT3-CCR2-. Circulating DC were identified within the HLA-DR+CD14-CD16-CD19- fraction as plasmacytoid (pDC,
CD123+) and myeloid (mDC, CD11c+), being the later divided into mDC1 (CD1c+) and mDC2 (CD141+). mDC1 and pDC were
SIRPα+ILT3+CCR2+ while mDC2 were SIRPα-ILT3-CCR2-.
In UC patients, the numbers of intestinal CD103+SIRPα+ DC were reduced. CCR2 expression was lower in both CD103+SIRPα+
and CD103-SIRPα+ subsets while HLA-DR intensity was also lower in all intestinal DC subsets. Such differences were indeed
observed in both the inflamed (colon) and non-inflamed (TI) tissue from UC patients compared with the matched tissue from
the healthy controls. Circulating mDC1, mDC2 and pDC from UC patients also had lower HLA-DR expression.
Conclusions
Human intestinal DC subset composition and their phenotype are altered in both inflamed and non-inflamed intestinal
segments (colon and TI) from UC patients as well as in their circulating counterparts compared to healthy controls. Future
studies will determine whether such differences are also resembled into a different functionality and should identify the
mechanisms responsible for such differences. 39 Congreso de la Sociedad Española de Inmunología
21
O-019 FUNCTIONAL AND MOLECULAR CHARACTERIZATION OF A NOVEL NONSENSE MUTATION IN IL2RG GENE IN A
FAMILY WITH ATYPICAL PRESENTATION
M. Martínez Gallo1 , R. Colobran1 , J. Sayós3 , M. García Prat2 , A. Aguiló Cucurull1 , A. Arcas3 , M. Magallón3 , A. Martín Nalda2 ,
R. Pujol Borrell1 , P. Soler Palacín2 1) Hospital Universitari de la Vall d’Hebron 2) Hospital Universitari de la Vall d’Hebron 3) Vall d’Hebron Institut de Recerca (VHIR)
Introduction
X-linked Severe Combined Immunodeficiency (X-SCID) is the most frequent form of SCID, caused by mutations in the gene
encoding the IL-2-receptor γ-chain (IL2RG). This immunodeficiency is characterized by severe lymphopenia and recurring
persistent infections in the first months of life. The common γ-chain works as signal-transducing subunit of the cytokine receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21. In XSCID patients, absence of IL-7 and IL-15-mediated signals causes the most
prominent immunological abnormality in T cells and NK cells, respectively.
Objectives
To understand the molecular mechanisms of the IL2RG mutant in an asymptomatic patient.
A complete immunological evaluation including advanced immunophenotype was done by flow cytometric analysis. Mutation analyses were performed in all the members of the family. TRECs levels and STAT5-phosphorylation were analyzed. Cell
culture, transfection and immunoprecipitation assays were done with mutant and wild-type constructs.
Results
We present a family with two brothers affected by a novel mutation (R328X) in IL2RG gene with a late-onset and atypical
presentation of the disease. The first patient died without any previous episode at the age of 3-years-old after a quick evolution of lymphoma associated with EBV infection. The second boy has remained asymptomatic until the time of the molecular
diagnosis but with progressive lymphopenia affecting T CD4 and CD8 subpopulations since the second year of life. TRECs
levels were decreased indicating dysfunction in the development of T cells. In vitro STAT5-phosphorylation assay showed a
dose-dependent defect.
Conclusions
The molecular characterization of the mutant R328X describes the importance of the last aminoacid residues of the IL2RG
protein in the signal transduction pathways affected. 39 Congreso de la Sociedad Española de Inmunología
22
O-020 CLINICAL APPLICATION OF NEXT-GENERATION SEQUENCING IN THE GENETIC DIAGNOSIS OF PRIMARY
IMMUNODEFICIENCIES
R. Colobran1 , F. Rudilla3 , F. Vidal4 , P. Soler-Palacín2 , A. Martín-Nalda2 , C. Franco-Jarava1 , M. García-Prat2 , N. Borràs4 ,
L. Mongay3 , J. L. Caro3 , R. Pujol-Borrell1 , M. Martínez-Gallo1
1) Hospital Universitari Vall d’Hebron (HUVH / VHIR), Universitat Autònoma de Barcelona (UAB) 2) Hospital Universitari Vall
d’Hebron (HUVH / VHIR), Universitat Autònoma de Barcelona (UAB) 3) Banc de Sang i Teixits (BST) 4) Banc de Sang i Teixits (BST)
Introduction
Primary Immunodeficiencies (PIDs) are a heterogeneous group comprising over 250 diseases caused by congenital defects
of the immune system. Early diagnosis and treatment of PIDs are critical for reducing disease-associated morbidity and improving patient outcomes. Genetic diagnosis of patients is a crucial step to definitively establish a PID classification. However, there are several factors that difficult the selection of candidate genes to screen: mutations in different genes can result
in similar phenotypes, mutations in different parts of the same gene can present with distinct phenotypes, the increasing
number of gene defects associated to PIDs, etc… The emergence of high throughput sequencing technologies (NGS) offers
an ideal platform for molecular diagnostics of PID. Objectives
To use the NGS for genetic diagnosis of PIDs. Our hypothesis is that large targeted gene panels are useful for genetic diagnosis of PIDs. Material and Methods
In this study, we adopted the TruSight One (TSO) Sequencing Panel (Illumina), which targets 4,813 genes associated with
known clinical phenotypes (including most of the genes related with PIDs). The use of this commercially available large panel has pros and cons compared with the use of custom smaller panels. From our point of view the main advantages are: i)
Ready to use (no optimization needed); ii) Flexibility (we can mix samples from different departments); iii) Broader diagnostic
options (beyond the typical PIDs). The usefulness of this assay for molecular diagnosis of PID was investigated by sequencing
DNA from 27 PID patients with no genetic diagnostic after sequencing several genes (Sanger), with no clear candidate genes
after the initial laboratory tests or by explicit demand. Results
First, three samples from patients with known causal mutations were included as a control. The mutations of these samples
were successfully identified after TSO sequencing. Then, the samples from 27 PID patients without genetic diagnosis were
subjected to TSO sequencing panel using the MiSeq system. The initial data analysis was restricted to a subset of about 300
genes related with PIDs. In summary, we achieved a definitive genetic diagnosis in 11 patients (40% success), which is a
remarkable percentage. We identified mutations in “typical” PID genes as IKBKG (NEMO), STAT1, STAT3 and XIAP, in genes recently associated with PID as PIK3R1, but also in genes not typically associated to PIDs as SKIV2L (in a patient with congenital
diarrhoea) or MMACHC (the most common inborn error of vitamin B12 metabolism in a patient that initially presented as a
haemophagocytic lymphohistiocytosis). Conclusions
The TruSight One Sequencing Panel is a good option for the genetic diagnosis of PID. Large targeted gene panels may allow
the identification of other genetic entities with overlapping features with typical PIDs.
Study funded by ISCIII grant PI14/00405 and cofinanced by the European Regional Development Fund.
23
O-021 SECONDARY HEMOPHAGOCYTIC LYMPHOHISTIOCYTOSIS DUE TO MYCOBACTERIUM KANSASSI IN A
PREVIOUSLY HEALTHY PATIENT WITH GATA2 DEFICIENCY
V. Cunill1 , O. Roger Colobran2 , M. T. Martínez-Saavedra3 , M. D. L. R. Jiménez Leon1 , Á. Molina Fuentes1 , J. L. Pérez-Arellano4 ,
M. A. Cardenas5 , M. Martínez-Gallo2 , C. Rodríguez-Gallego1
1) Hospital Universitario Son Espases, Palma de Mallorca, Spain 2) Hospital Vall d´Hebron. Barcelona, Spain 3) Hospital Universitario
Dr. Negrin, Las Palmas de Gran Canaria, Spain 4) Hospital Universitario Insular Gran Canaria, Las Palmas de Gran Canaria, Spain
5) Hospital Universitario Dr. Negrin, Las Palmas de Gran Canaria, Spain
Introducction
Nontuberculous mycobacterial (NTM) infections are extremely rare in immunocompetent patients. Several Classical Primary
immunodeficiency (PIDs) predispose to severe NTM infections. However, patients with these PIDs also suffer other infectious
diseases and experience other clinical manifestations. Mendelian susceptibility to mycobacterial disease (MSMD) is a rare inherited condition characterized by selective predisposition to clinical disease caused by weakly virulent mycobacteria, such
as BCG vaccines and NTM, in otherwise healthy patients with no overt abnormalities in routine hematological and immunological tests. Disease onset ranges from early childhood to adulthood.
Objective
To study a previously healthy patient with secondary hemophagocytic lymphohistiocytosis (HLH) and disseminated Mycobacterium Kansassi infection.
Patient And Methods
Case report: In November 1998, a previously healthy 24-year-old male presented himself, with oral candidiasis and fever. Normocytic anemia, neutropenia, lymphopenia, thrombocytopenia, and monocytopenia (10-20 cells/ul) was observed. Bone
marrow (BM) aspirate showed dyserythropoietic features and many histiocytes with active hemophagocytosis; myelodysplasia vs reactive BM was suspected.
He was diagnosed with secondary HLH and treated with gammaglobulins, oral prednisone, cyclosporine A and antibiotics.
He was sent to referral centers for evaluation of HLH. In January 1999 he was diagnosed with disseminated M. Kansassi infection and he was treated with antimycobacterials with only partial response. A thrombotic event and hearing loss were also
recorded. He died in 2003 due to reactivation of M. Kansassi with severe anemia and BM failure.
Immunological and Genetical studies: We performed the mutation analysis of GATA2. Lymphocyte subpopulations, neutrophil oxidative burst test, analysis of the IL-12/ IFN-γ axis and proliferative responses to mitogens were done.
Results
Immunological studies: By 1999, immunological analysis showed a moderate lymphopenia with absent B cells (CD19 0%,
CD20 0%) and normal percentages of T CD4, T CD8 and NK cells (CD3-CD56+ 10%, CD3-CD16+ 10%). In 2003 the patient
had very low numbers of circulating monocytes and NK cells (3 NK cells/ µl). No lymphocyte proliferation responses to (PHA,
anti-CD3) but normalized with anti-CD28 or PMA. Analysis of the IL-12/IFN-gamma axis was inconclusive because of numerous alterations. Genetical studies: In 2015, molecular analyses revealed a previously unidentified heterozygous c.1035insTCTGGCC (p.Ala345fs exon 5)/wt mutation in GATA-2.
Conclusions
GATA-2 deficiency should be suspected in previously healthy adults individuals with severe mycobacterial infections. A careful study aimed to differentiate between MSMD, GATA-2 and other PID deficiency is mandatory in the differential diagnosis
of previously healthy patients with mycobacterial infection, even in adults.
24
O-022 PRELIMINARY EVIDENCES OF THE ROLE OF GONOSOMAL GENE MOSAICISM IN PRIMARY IMMUNODEFICIENCIES
A. Mensa-Vilaró1 , M. Bravo García-Morato2 , R. Rodríguez-Pena2 , S. Jiménez-Treviño3 , A. Balderrama4 , W. Tarng Cham5 ,
D. Rowczenio6 , M. M. Muriel-Ramos7 , L. Alsina8 , A. Deyà8 , E. González-Roca1 , E. Ruiz-Ortiz1, O. M. Mutchinick4 ,
H. J. Lachmann6 , E. Ramos3 , E. López-Granados 2 , J. Yagüe1 , J. I. Aróstegui1 1) Hospital Clínic-IDIBAPS. Barcelona. Spain 2) Hospital Universitario La Paz. Madrid. Spain 3) Hospital Central de Asturias. Oviedo.
Spain 4) Instituto Nacional de Ciencias Médicas y Nutrición. Mexico 5) Selayang Hospital. Kuala Lumpur. Malaysia 6) University
College of London. United Kingdom 7) Hospital Clínico Universitario de Salamanca. Spain 8) Hospital Sant Joan de Déu. Esplugues.
Spain.
Introduction
A significant proportion of patients with primary immunodeficiencies (PIDs) are sporadic cases due to de novo gene mutations. Traditionally, it has been thought that these de novo mutations appear as errors during gametogenesis and as a result,
the mutation is transmitted to the offspring as a germline mutation. However, these sporadic patients may have actually
inherited the disease from a parent who carries a gene mosaicism, which could be restricted to gonadal tissue (gonadal
mosaicism) or affect both somatic and gonadal tissues (gonosomal mosaicism). So far, studies of gonosomal mosaicism
contributing to the pathogenesis of PIDs are very scarce. We herein show the preliminary evidences of the relevant role of
gonosomal gene mosaicism in patients with X-linked and dominantly-inherited PIDs.
Objectives
To evaluate the presence of gonosomal gene mosaicism in families of patients with PID carrying a germline mutation.
Genomic DNA was extracted from both peripheral blood and different non-hematopoietic cell types. Genetic analysis was
performed by both Sanger sequencing and by amplicon-based deep sequencing (ADS) using an Ion Torrent PGM platform.
Results
A total of 43 families were enrolled. Gonosomal mosaicism was detected in eight (18.6%), with four families suffering from
autoinflammatory diseases (two with cryopyrinopathies, one with Blau syndrome and one with TNF receptor-associated
periodic syndrome (TRAPS)), three families with X-linked PIDs (two with Bruton disease and one with severe combined immunodeficiency) and one family with congenital neutropenia. The mutated allele frequency in peripheral blood ranged from
0.7 to 30.5%.
In families with cryopyrinopathies and with Bruton disease, the parent carrying the gonosomal mosaicism was healthy, probably as a consequence of the low frequency of the mutated allele. By contrast, in families with TRAPS, Blau syndrome and
congenital neutropenia, the individual carrying the gonosomal mosaicism displayed clinical symptoms, though milder than
their offspring carrying the germline mutation.
Interestingly, in the family with Blau syndrome and in one of the two families with Bruton disease, gonosomal mosaicism was
suspected, and subsequently confirmed by ADS, due to the unexpected intrafamilial recurrence of the disease.
Conclusions
The evidences of this preliminary study point to the relevant role that gonosomal gene mosaicism plays in the pathogenesis
of PIDs, which should have critical implications in the genetic counselling. Additional studies in a large number of families
are necessary to add strongly support to our preliminary evidences.
25
O-023 IMPROVING THE CONTROL OF INFECTIONS IN PRIMARY ANTIBODY DEFICIENT PATIENTS BY ADDITION OF
BACTERIAL MUCOSAL IMMUNIZATION
E. Sarmiento Marchese1 , M. Arraya Cabezas1 , J. P. Navarro Valdivieso1 , E. Fernández-Cruz1 , J. Carbone1 1) Hospital General Universitario Gregorio Marañón. Madrid. Spain
Introduction
Despite the use of intravenous immunoglobulin (IVIG) a subset of patients with primary antibody deficiencies remain affected by recurrent bacterial infections. We assume that the immune response is decreased in these patients. However, there is a
lack of information about the potential role of mucosal immunization in this setting. Mucosal vaccination could offer advantages to conventional systemic vaccination including potential protection at the airway surface. Sublingual vaccines against
bacterial respiratory pathogens, such as Streptococcus pneumoniae, Haemophilus influenzae or Pseudomonas aeruginosa,
might have a role in primary antibody deficiency patients, as these microorganisms are frequent and associated with high
morbidity. Previous studies have suggested the efficacy of this therapeutic approach in immunocompetent patients.
Objective
We aimed to evaluate the safety and efficacy of a sublingual polyvalent bacterial preparation in a selected case series of
primary antibody deficiency individuals with refractory bacterial infections.
Prospective, open, non controlled study in a single center. 16 adult patients with primary antibody deficiencies receiving IVIG
were evaluated (Common variable immunodeficiency [CVID] + lung transplantation, n=1; CVID, n=10; x-linked agammaglobulinemia with bronchiectasis, n=1; IgG subclass deficiency, n=1; specific antibody deficiency, n=2; hypogammaglobulinemia, n=1). Mean IgG levels in these patients at the time of indication of mucosal immunization was 1050 mg/dL. Ten of
them (62.5%) required continuous usage of antibiotics to control infections. Preparation of the polyvalent bacterial vaccine
(Bactek, Inmunotek, Spain) was administered daily for 6 months. Clinical outcome: Number of infections that required antimicrobial therapy during the 6 months of mucosal immunization as compared with the prevalence observed during the
6 months before the addition of immunization. Seven patients with primary immune deficiencies not using IVIG and who
received the same protocol of mucosal immunization were also analyzed (CVID, n=4, Hyper-IgE, n=1; IgM deficiency, n=1,
specific antibody deficiency, n=1).
Results
Mucosal vaccination was well tolerated. One patient had to stop mucosal immunization because of increase of upper respiratory tract infections. There were not severe adverse reactions. During the 6 months follow-up since the first administration
of the mucosal vaccine we observed a decrease in the frequency of infectious episodes as compared with a similar period
of time before initiation of therapy (1.6 vs 3.6, p< 0.001). Interestingly enough, the clinical response was similar in the small
group of immune deficient patients with previous infections that were not receiving IVIG therapy (0.43 vs 3.9, p< 0.001).
Conclusions
Bacterial mucosal immunization is a promising therapeutic strategy to improve the control of bacterial infections in primary
antibody deficiency patients. A clinical trial is necessary in the future to evaluate safety and efficacy of this potential therapeutic approach in selected immunodeficiency patients who fail to control bacterial infections despite the use of IVIG and
antimicrobials. 39 Congreso de la Sociedad Española de Inmunología
26
O-024 DETECTION AND MONITORING OF ANTI-PHOSPHOLIPASE A2 RECEPTOR ANTIBODIES IN PATIENTS SUFFERING
IDIOPATHIC MEMBRANOUS NEPHROPATHY TREATED WITH IMMUNOSUPPRESSIVE DRUGS
A. L. Castaño Nuñez1 , I. Olivas Martínez1 , M. Vilches Moreno1 , V. Cabello Chaves1 , M. A. Pérez Valdivia1 , M. López Mendoza1 ,
M. A. Montes Cano1 1) Hospital Universitario Virgen del Rocio
Introduction
Phospholipase A2 receptor (PLA2R) is a type I transmembrane glycoprotein belonging to the mannose receptor family, whose
expression is largely confined to glomerular podocytes in human kidneys. Recently, this protein has been discovered as a
major antigen against which the autoantibodies responsible for idiopathic membranous nephropathy (iMN) are directed.
Although the role of these antibodies, present in approximately 70% of iMN patients, is currently unknown, they’re thought
to disturb podocyte architecture and barrier function. Moreover, several studies have reported a strong correlation among
levels of circulating anti-PLA2R antibodies, clinical disease activity and treatment efficacy. Indirect immunofluorescence is
considered an accurate technique to detect PLA2R autoantibodies, since identifies them with high specificity and sensitivity
in iMN patients.
Objective
To analyze and compare the presence of anti-PLA2R with clinical features and treatment efficacy in a cohort of iMN patients.
Seventy-four patients (49M/25F; 55,9±15,9 average age years) were included in the study. Diagnosis of iMN was confirmed
by renal biopsy in 85% of cases, taking also into account different measures of proteinuria levels (gr/24h) and creatinine (mg/
dL) for each patient. Detection of circulating antibodies against PLA2R was performed using an indirect immunofluorescence
method, based on slides covered with HEK293 cells transfected or not with a PLA2R cDNA.
Results
From the 74 patients, eleven were excluded by a secondary cause of MN, and among the rest, we found a 56% of patients
with anti-PLA2R antibodies that is similar to those observed in other studies. Patients with anti-PLA2R presented higher levels
of proteinuria (9,43±5,79 g/24h) and serum creatinine (1,36±1,3 mg/dL) than those seronegative patients (4,24±2,85 g/24h
and 1,23±1,08 mg/dL, respectively). Moreover, thirteen iNM patients, either anti-PLA2R positive or negative, were followed
over time. We found that patients, who remained always positive or negative during the study, maintained their values of
proteinuria and creatinine. However, those patients that changed to positive or negative after the first anti-PLA2R analysis
showed an increase or decreased respectively of their biochemical parameters compared to the initial situation. Regarding
treatment, although the therapy based on immunosuppressive drugs managed to keep levels of proteinuria and creatinine,
was the administration of tacrolimus the best option to reduce nephropathy in these iMN patients.
Conclusion
The presence of anti-PLA2R antibodies correlates with an increase in botht proteinuria and creatinine levels. Moreover, monitoring of these autoantibodies can contribute to choose different immunosuppressive treatments aimed at reducing the
nephropathy in these patients.
27
O-025 EXPANSION AND ACTIVATION OF HUMAN NK CELLS USING EBV+ LYMPHOBLASTOID CELL LINES AND ACTIVITY
AGAINST LEUKEMIC CELLS FROM B-CLL PATIENTS
T. Calvo Ventura1 , G. Azaceta Reinares2 , M. Gascón Resano1 , J. Marco Brualla1 , I. Izquierdo García2 , D. Sánchez Martínez3 ,
L. Palomera Bernal2 , J. Pardo Jimeno4 , M. Villalba González3 , A. Anel Bernal1 1) Universidad de Zaragoza/Instituto de Investigación Sanitaria de Aragón (IIS-Aragón) 2) Hospital Clínico Universitario “Lozano
Blesa”, Zaragoza 3) Institute for Regenerative Medicine and Biotherapy, Montpellier 4) Centro de Investigación Biomédica de
Aragón (CIBA)/IIS Aragón
Introduction
Cancer immunotherapy using the adoptive transfer of allogeneic NK cells is one possibility that needs to be explored, especially for the treatment of hematological malignancies.
Objectives
Optimization of protocols for the expansion and activation of human NK cells for their use in the treatment of hematological
malignancies.
The expansion and activation of human NK cells from PBMC obtained from healthy donors’ buffy coats was assayed using
different cytokine combinations in the presence or absence of the HLA-I negative EBV+ lymphoblastoid cell line 721.221 in
20-day cultures.
The cytotoxicity of isolated NK cells obtained from these cultures was tested on cells from 28 B-CLL patients at a 5:1 ratio in
4h assays.
The phenotype of the expanded NK cells obtained was determined by flow cytometry and compared with non-activated NK
cells from the same donors.
Results
It was initially observed that maximal expansion and activation status of NK cells was strictly dependent on the presence of
the feeder cells. Afterwards, we compared two protocols of expansion in the presence of the feeder cells, one with IL2 + IL15
and another one with IL2 + IL15 + IFN-a. We did not find significant differences in the expansion rate or cytolytic activity of
NK cells whether IFN-a was present or not during the expansion protocol. Maximum expansion rates were of 200 fold, while
the average rate was around 60 fold. NK cells exerted cytotoxicity against cells from the 85% of tested B-CLL patients, with
an average cytotoxicity of around 50%. At the same time, expanded NK cells were not cytotoxic against PBMC or T cell blasts
obtained from healthy donors. Remarkably, cells from two patients, which were sensitive to NK cell cytotoxicity when they
were tested for the first time, resulted resistant to NK cells obtained from other donors one year later. We are exploring the
possible causes of this resistance, including KIR-HLA match and/or down-modulation of ligands for NK cell activating receptors in the leukemic cells. Finally, we showed that expanded NK cells increased their expression of CD56, maintained that of
CD16, the population of NKG2C+ cells was decreased and the population of NKp44+ cells was remarkably increased.
Conclusions
The expansion rates obtained are sufficient to treat one leukemic patient with cells obtained from one healthy allogeneic
donor. These results reinforce the feasability of using expanded NK cells in the treatment of B-CLL.
28
O-026 CLINICAL APPLICATION OF FROZEN VITAMIN D3-TOLEROGENIC DENDRITIC CELLS
M. J. Mansilla López1 , R. E. Contreras Cardone1 , J. Navarro Barriuso1 , A. Teniente Serra1 , B. Quirant Sanchez1 , J. Punet Ortiz1 ,
J. V. Hervás García2 , S. Presas Rodríguez2 , C. Ramo Tello2 , E. M. Martínez Cáceres1 1) Germans Trias i Pujol University and Research Institute 2) Hospital Universitari Germans Trias i Pujol
Background
Vitamin-D3-induced tolerogenic dendritic cells (tolDC-VitD3) loaded with myelin autoantigens are able to abrogate disease
progression in mouse experimental autoimmune encephalomyelitis (EAE). In vitro studies, tolDC-VitD3 of multiple sclerosis
(MS) patients have demonstrated specific inhibition of lymphocyte proliferation and of IFN-g production, increasing IL-10
levels in co-culture experiments. With the aim to translate this cell-based therapy to the clinic, GMP grade tolDC-VitD3 have
been developed to perform a phase I/IIa clinical trial in MS patients. Frozen human tolDC-VitD3 have shown the same functionality as fresh ones, but so far, no in vivo experiments with frozen tolDC-VitD3 have been performed.
Objective
To demonstrate the in vivo functionality of frozen tolDC-VitD3 in EAE.
tolDC-VitD3 were differentiated and cryopreserved in medium with 50% FBS+10% DMSO. Thawed tolDC-VitD3-MOG cells
(1·10^6 cells) or PBS (sham) were administrated to C57BL/6-EAE induced mice after the onset of clinical signs. Mice were
monitored daily for 74 days.
Results
Treatment with frozen tolDC-VitD3 abrogated clinical progression of the disease (p< 0.001) and reduced MOG-specific proliferative response (p=0.004) compared to control mice, and similarly to fresh tolDCVitD3 cells. Treatment was well tolerated.
Interestingly, the therapeutic effect of the cells after each administration was progressively increased, extending the interval
dosing required. Treated mice had an increase of regulatory T and B cells (p< 0.05) and a reduction of NK cells (p< 0.05).
Conclusion
These results show that frozen tolDC-VitD3 keep their in vivo beneficial clinical effect, increasing their feasibility for its translation to the clinic. This work has been supported by the Spanish Government (FIS PI11/02416 and PI14/01175)
29
O-027 THERAPEUTIC APPROACH FOR DOMINANT-NEGATIVE AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME BY
SPECIFIC SIRNA-INTERFERENCE OF FAS MUTANT ALLELES
E. Mancebo Sierra1 , C. Aquilino Amez1 , R. Ruiz García1 , C. López Álvarez1 , L. Álvarez Carrión1 , L. M. Allende Martínez1 , E. Paz-Artal1 1) Research Institute I+12, Hospital Universitario 12 de Octubre, Madrid, Spain.
Introduction
Autoimmune lymphoproliferative syndrome (ALPS) is a primary immunodeficiency, caused by dysregulation of the immune
system. This congenital disease affects lymphocyte programmed cell death, due to the presence of mutations in different
components of the FAS receptor mediated apoptotic pathway. Most cases of ALPS are caused by dominant-negative mutations in FAS gene (ALPS-Ia). In heterozygous individuals with wild-type and mutant FAS protein, aberrant chains are incorporated into most preassembled FAS homotrimers, which impairs the transduction of an effective death signal in lymphocytes.
Objectives
To date there is no curative or completely satisfactory treatment for this disease, so here we analyze if inactivation of mutated
alleles with small interfering RNAs (siRNAs) could be therapeutically useful for ALPS-Ia patients.
We designed several siRNAs directed against FAS mutations in two patients, P1 and P2 (c.979T> G and c.828dupA respectively). Patients and control fibroblasts were transfected with allele specific siRNAs. After 48 or 72h of transfection FAS mediated apoptosis were stimulated and the effectiveness and specificity of silencing the mutated alleles was evaluated by measuring the percentage of apoptotic cells, activation of caspase-8, loss of mitochondrial membrane potential and functionality
of the effector caspases.
Results
After transfecting fibroblasts of patients with allele specific siRNAs and stimulating FAS apoptosis pathway, we observed a
significant recovery of cell death compared to cells transfected with an irrelevant siRNA or untransfected cells. This recovery
was not dependent on an increased FAS expression on the cell surface, which remained unaltered after transfection, but on
activation of caspases with increased activation of caspase-8 (initiator), caspases 3 and 7 (effector) and involvement of mitochondria in the amplification of cell death, as evidenced by the drop in its membrane potential.
Conclusion
We conclude that allele-specific inhibition of FAS mutations with siRNAs may be useful as personalized therapy for ALPS-Ia
patients. Additionally, it should be explored whether this strategy could be useful in the treatment of tumors in which FAS
mutations prevent cell death and promote growth and invasiveness.
Proyecto PI10/2199 del ISCIII co-financiado por Fondos de la Unión Europea y proyecto FMM-2012/0079
Patente Española 201430504
30
O-028 EVALUATING THE EFFECT OF ANTI-TNF, ANTI-IL6R AND ANTI-CTLA4 ON ACPA ISOTYPES IN PATIENTS WITH
RHEUMATOID ARTHRITIS
D. Hernández Flórez1 , T. del Río 1, J. C. Nieto1 , J. G. Ovalles 1 , C. González1 , I. Monteagudo1 , E. Naredo1 , F. J. López-Longo1 , L. Valor1 1) Hospital General Universitario Gregorio Marañón, Madrid
Introduction
B-cell depletion therapy decreases autoantibodies formation as rheumatoid factor and anti–citrullinated protein antibodies
(ACPA). Other therapeutic targets (TT) such as anti-TNF (tumor necrosis factor), anti-IL-6R (interleukin-6 receptor) and anti-CTL4A (cytotoxic T-lymphocyte antigen-4) modulate the B-cells proliferation/maturation and indirectly the production of
autoantibodies. ACPA titers provide us information about disease activity and may be critical for inducing clinical remission
in rheumatoid arthritis (RA) patients.
Objective
To evaluate the impact of three different TT: anti-TNF; anti-IL6R and anti-CTLA4 on ACPA production in RA patients.
Patients and Methods
In this longitudinal study we selected ACPA positive patients naïve to TT (N=27). All patients were assessed at baseline and
after 4, 8, 12, 24 and 36 months (m) of treatment initiation. Disease activity was assessed by the 28 joint count-disease
activity score (DAS28) according to ‎C-Reactive Protein (CRP). ACPA isotypes (IgG, IgA and IgM) were determined by ELISA
(CCP2,Eurodiagnostica,SE). Anti-human antibodies specific peroxidase-conjugated were used to measure each isotype (Binding Site,UK). The statistical analysis was performed according to TT (anti-TNF,anti-IL6R and anti-CTLA4) and anti-TNF therapies [infliximab(IFX),adalimumab(ADA),etanercept(ETN)].
Results
We found a significant DAS28-CRP decrease in two therapeutic targets: anti-IL6R and anti-TNF at 4, 8, 12, 24 and 36m. Evaluating each anti-TNF treatment, we found a statistically significant decrease on DAS28-CRP in ADL at 4 and ETN groups at
4, 8, 12 and 24m of treatment. Comparing TT, the most outstanding reduction of DAS28-CRP was found in anti-IL6R group
compared to anti-CTLA4 group at 8m, probably due to a greater reduction of CRP in anti-IL6R group. Regarding ACPA isotypes, we only found a significant decrease in IgA-ACPA titers in anti-IL6R group at 4, 8 and 12m of treatment. No changes
were found neither in the other TT nor in the anti-TNF therapies. Comparing TT, the highest IgG-ACPA titers were found in
anti-IL6R group than anti-TNF and anti-CTLA4 groups at 24m. For IgM-ACPA, the lowest titers were found in anti-IL6R than
anti-CTLA4 at 4, 8 and 12m (see p values in Table 1).
Conclusions
Patients treated with anti-IL6R and anti-TNF had the most outstanding reduction of DAS28-CRP at the first 8m of treatment.
Regarding ACPA isotypes, IgM levels were higher in anti-CTLA4 than anti-IL6R probably due to inhibition of B cells class-switching by anti-IL6R therapy. Those patients treated with anti-IL6R presented a progressive decrease in IgA-ACPA and in total
IgA, as well as, a higher IgG-ACPA titer at 24m. These results showed that anti-CTLA4 and anti-IL6R therapies modulate the
immune system by different regulation pathways. Our data suggests that B-cells and ACPA isotypes monitoring may be useful to further understand their role in the RA pathogenesis and its association with clinical response to TT.
31
32
O-029 REGULATORY/ACTIVATED CD4 T CELL PREDICTS THE RESPONSE TO FINGOLIMOD THERAPY IN MULTIPLE
SCLEROSIS PATIENTS
C. Picon 1 , E. Rodriguez-Martin1 , L. Costa-Frossard2 , R. Alenda1 , S. Sainz de La Maza2 , M. Espiño1 , C. de Andrés4 , Y. Aladro3 ,
J. C. Álvarez-Cermeño2 , L. M. Villar1 1) Hospital Universitario Ramón y Cajal 2) Hospital Universitario Ramón y Cajal 3) Hospital Universitario de Getafe 4) Hospital
Universitario Gregorio Marañon
Introduction
Fingolimod is a modulator of sphingosine 1-phospate inhibiting the egress of lymphocytes from the lymph node. Fingolimod has proven to be efficacious in multiple sclerosis (MS) treatment. However, patients show heterogeneous responses to
this therapy.
Objectives
We aimed to investigate if the different leukocyte profiles present in peripheral blood can identify MS patients who can be
optimal responders to fingolimod.
We prospectively studied 62 patients treated with fingolimod during at least 2 years and measured clinical and radiological
activity. No evidence of disease activity (NEDA) was defined as not having new relapses, disability worsening or new lesions
on annual MRI scans during follow-up. Peripheral blood was collected before treatment and 6 months after treatment initiation. Analysis of the different immune cell subsets (T cell, B cells, monocytes and NK cells) was performed by flow cytometry
in a FACSCanto II instrument at the two time points.
Results
48.38% of patients were NEDA while the remaining 51.62% showed ongoing disease activity (ODA) during follow-up Before treatment, NEDA patients showed higher percentage of CD14dim monocytes (p=0.026) and CD14hi,CCR7+ monocytes (p=0.007). However, this variable was not useful to identify patients with high probability of remaining NEDA during
treatment. At six months after initiating fingolimod therapy, NEDA patients had an increase in the proportion of Treg cells
(p=0.0099). Differences were higher when we studied the regulatory/activated CD4+ T cell ratio, which also was higher in
NEDA group (p=0.0002). We established a cut-off of 0.13 for this ratio that allowed us to identify patients with a high probability of remaining NEDA upon fingolimod treatment in the long term (p<0.0001; OR=15.83; CI: 3.820-65.62).
Conclusions
A high regulatory/activated CD4+ T cell ratio during the first months of treatment identifies patients with high probability of
remaining free of disease activity at the long term during fingolimod treatment. 39 Congreso de la Sociedad Española de Inmunología
33
O-030 EARLY DEVELOPMENT OF ANTIBODIES TO INFLIXIMAB IS RELATED TO LOW INFLIXIMAB THROUGH SERUM
LEVELS AND CLINICAL OUTCOMES AT THE INDUCTION PHASE IN PATIENTS WITH RHEUMATOID ARTHRITIS
A. Martínez Feito1 , T. Jurado Camino1 , E. Olariaga Mérida1 , C. Plasencia Rodriguez1 , M. A. Rodriguez Gomez1 , G. Bonilla
Hernan1 , A. Balsa Criado1 , D. Pascual-Salcedo Pascual1 1) Hospital Universitario La Paz, Madrid
Introduction
The anti-TNF monoclonal antibody Infliximab (Ifx) has proven effective in treating rheumatoid arthritis (RA), although in 40%
of cases fails, mainly due to immunogenicity. Formation of immunocomplexes between antibodies to Ifx (ATI) and Ifx can
increase drug clearance, leading to treatment failure. Most of the assays to measure ATI present drug interference. Currently,
different assays to measure total ATI (free and complexed) are in development.
Objetives
To study the association of ATI development at early stages of the treatment with the Ifx through levels (ITL) and with the
clinical outcomes at one year.
A prospective observational study with 64 rheumatoid arthritis patients under Ifx treatment enrolled at the department of
rheumatology was conducted. Serum Ifx levels were measured by a capture ELISA and ATI development by two different assays: an in-house two-site (bridging) bELISA to detect uncomplexed ATI (free ATI) and a commercial kit developed by ImmundiagnostikÒ (Bensheim, Germany)(IDK drug-tolerant assay) to measure “total” (free and complexed) ATI (total ATI). This assay
performs an acid dissociation of the serum, to acquire free ATI. Samples were evaluated at baseline and at week (w) 2, 6, 14, 22
and, only in the case of Ifx levels, at w 54 after Ifx therapy initiation. Clinical activity was evaluated at baseline and w54 by DAS28.
Results
Patients were grouped depending on the presence (ITLpos, n= 41) or absence (ITLneg, n=23) of circulating serum Ifx at w54. ITLneg
patients at w54 had lower ITL at early stages than ITLpos patients and more frequent ATI, measured by both methods (Table 1).
ATI were detected by IDK-drug-tolerant assay at earlier treatment stages (w6) than by bELISA, although not statistically significant until w22 (p=0.011).
The clinical activity at w54 of patients with ATI at w14 was higher than the clinical activity of patients without ATI (5.15 ±
1.02 with vs 3.89 ±1.32 without, p=0.043 by bELISA,) and (4.93 ± 1.30 with vs 3.74 ±1.21 without, p=0.001 by IDK). However,
DAS28 was statistically related to the ATI presence at w22 only when they were detected by bELISA (4.83± 1.17 with vs 3.88
±1.33 without, p =0.01).
Furthermore, ITLneg patients, (with lower ITL at early stages) had a worse clinical activity at w54 than ITLpos patients (4.83
± 1.28 vs 3.72 ±1.53, p=0.003).
Conclusions
Low ITL at early stages are associated with early ATI production and the absence of Ifx together with a worse clinical outcome
at one year. Despite an earlier ATI detection by a drug-tolerant assay (IDK) than by bELISA, it does not represent any advantage over the bELISA to predict the treatment outcome. However, the information of total ATI could help the clinicians to
improve a correct management on the treatment. According to our results, the measurement of Ifx levels at early stages is
the best tool to predict the clinical response.
This work has been supported by a collaboration of Leti laboratorios
34
O-031 IMMUNOLOGICAL MECHANISMS ACTIVATED BY A POLYVALENT BACTERIAL PREPARATION USED FOR THE
TREATMENT OF RECURRENT URINARY TRACT INFECTIONS (RUTIS)
C. Benito Villalvilla1 , C. Cirauqui Armendáriz1 , A. Angelina Querencias1 , J. L. Subiza Garrido-Lestache2 , O. Palomares Gracia1 1) School of Chemistry, Complutense University of Madrid, Madrid, Spain 2) Inmunotek, SL. Alcalá de Henares, Spain 3) Hospital
Clínico San Carlos, Madrid, Spain
Background
MV140 is a defined mixture of entire inactivated bacteria (K. pneumoniae, E. coli, P. vulgaris and S. faecalis, 25% each) used as
a novel sublingual vaccine that has been shown to prevent recurrent urinary tract infections (RUTIs). Although the mucosal
immune system at both induction and effector sites are likely to be involved, the underlying immunological mechanisms
induced by MV140 remain unknown.
Objective
To study the capacity of MV140 and its individual bacterial components to immunomodulate the phenotype and function of
human dendritic cells at the molecular level.
Material and methods
MV140 and the individual bacteria were from Inmunotek S.L. NF-κB activation in THP1 cells and human monocyte-derived
dendritic cells (hmoDCs) induced by MV140 or individual bacteria was quantified by ELISA or immunobloting. The expression of activation surface markers and cytokine signature were determined by flow cytometry or ELISA. Allogeneic co-cultures of MV140-activated hmoDCs and naïve CD4+ T cells, CFSE-dilution assays, flow cytometry, real-time quantitative PCR,
ELISA, blocking and pharmacological inhibition experiments were performed.
Results
MV140 induces NF-κB/AP-1 activation and IL-8 production in THP1 cells. MV140-activated hmoDCs acquire a mature phenotype
as determined by the increased expression of CD86 and CD83 and produce significant levels of pro-inflammatory cytokines
(IL-1β, IL-6, IL-23 or IL-12) as well as high levels of the anti-inflammatory IL-10. The individual contribution of each bacteria was
also determined and significant differences between the Gram negative and positive bacteria demonstrated. MV140-activated
hmoDCs promote the generation of TH1 and TH17 as well as IL-10 producing T cells. Blocking experiments demonstrated that Toll-like receptors via MyD88 and C-type lectin receptors via Syk contribute at different extend to the immunological mechanisms
of action of MV140 in hmoDCs. Initial experiments demonstrate that downstream signaling pathways involving Akt, MAPK and
NF-κB might well be also downstream signalling molecules contributing to the observed effects.
Conclusions
The findings reported in this study provide novel insights into the immunological mechanisms by which MV140 might exert
its clinical efficacy in patients suffering from RUTIs.
35
O-032 TARGETING CD28 COSTIMULATION WITH BI-SPECIFIC APTAMERS TO MELANOMA CANCER STEM CELLS
M. Martínez Soldevilla1 , H. Villanueva Ruíz1 , N. Casares1 , J. J. Lasarte1 , F. Pastor Rodríguez1 1) Centro para la investigación medica aplicada (CIMA)
Introduction
Immunotherapy has made itself a well-established place in cancer therapy. Monoclonal antibodies and especially those with
agonistic activity have shown quite toxicity. Toxicity can be reduced by targeting costimulation to the tumor site thus augmenting the therapeutic index. Besides, cancer stem cells are responsible for drug resistance, metastasis and tumor relapses.
It has been underscored the potential of targeting cancer stem cell in cancer immunotherapy. The use of bi-specific aptamers
to target costimulation to cancer stem cells would induce tumor immunity by hitting the most aggressive subpopulation
among cancer cells. This work shows a strategy capable of inducing tumor immunity by using bi-specific aptamer to target
CD28 costimulation to drug-resistant cancer stem cells within the melanoma tumor.
Combinatorial peptide-cell SELEX strategy was used to identify the MRP1 aptamer. Double filter assays and flow cytometry
were performed to determine its binding and dissociation constant. The PE-labeled aptamer was used to isolate a drug-resistant subpopulation of melanoma cells using sorting. We used qRT-PCR to assess their cancer stem cell phenotype. MTT
assays were performed to demonstrate their resistance to chemotherapy drugs. We carried out proliferation assays by CFSE
dilution and thymidine incorporation to ensure the agonistic capacity of the bi-specific aptamer. In vivo experiments in an
aggresive low-immunogenic melanoma tumor model were performed to assess its antitumor effect.
Results
We have developed an aptamer that binds to MRP1 used to identify a melanoma cancer stem-cell subpopulation that shows
a more aggressive phenotype and higher resistance to chemotherapy drugs. We have engineered a CD28-MRP1 bi-specific
aptamer. The anti-tumor effect with the systemic injection of the MRP1-CD28 bi-specific-aptamer was proved in an aggressive low-immunogenic melanoma tumor in mice. The MRP1-CD28 bi-specific-aptamer was also used to generate a a technically feasible and translational whole-cell vaccine (CD28AptVAX) to provide the proper T cell activation which elicits a strong
tumor- cell immune response against melanoma tumors reducing tumor growth.
Conclusions
In this work we show a clinically feasible strategy to convert in situ the own tumor into an endogenous vaccine by coating
the melanoma cancerous cells with CD28 costimulatory ligands. It is aimed at targeting T-cell costimulation to chemotherapy-resistant tumors which are refractory and been considered as untreatable cancers. We developped the first aptamer that
targets chemotherapy-resistant tumors expressing MRP1 through a novel combinatorial peptide-cell SELEX. We engineered
a MRP1-CD28 bivalent aptamer that is able to deliver the CD28 costimulatory signal to tumor-infiltrating lymphocytes in
chemotherapy-resistant tumors. Melanoma-bearing mice systemically treated with MRP1-CD28 bivalent aptamer show reduced growth, improving mice survival. 39 Congreso de la Sociedad Española de Inmunología
36
O-033 SOMATIC MUTATION IN THE HLA-B GENE OF A PATIENT WITH ACUTE MYELOGENOUS LEUKEMIA
D. Planelles1 , A. Balas2 , C. Gil3 , C. Muñoz4 , M. Rodríguez-Cebriá1 , J. L. Vicario2 1) Centro de Transfusión de la Comunidad Valenciana 2) Centro de Transfusión de la Comunidad de Madrid 3) Hospital General
Universitario de Alicante 4) Hospital General Universitario de Alicante
Introduction
Clonal chromosomal rearrangements and somatic mutations in the genome of tumour cells are very common in haematological malignancies. In HLA genes, several reports have described somatic mutations in patients’ haematological malignant
cells before hematopoietic stem-cell transplantation.
Patient and Methods
The patient was a 58 years old Caucasoid female, diagnosed as AML with normal karyotype. Routine serologic HLA typing
was performed for patient and one sister. The patient’s sample was collected at high leukocytosis (38 x 109/l) and 80% blasts.
For serology typing, a lymphocyte suspension was isolated by using monoclonal antibody-coated magnetic beads. Confirmatory molecular HLA high resolution typing was performed by PCR-SSP, -SSO and sequencing.
Objective
Serologic and molecular typing methods gave discrepant results for HLA-B locus. The objective was to clarify the nature of
this discrepancy.
Results
Serologic HLA typing assignment for the patient was the following: A1,24; B8,62; Cw3,w7; DR17; DR52; DQ2. Confirmatory
molecular HLA high resolution typing by SSP gave an unexpected amplification pattern for the B*15 allele, compatible with
B*15:190N. HLA-B typing by PCR-SSO gave a canonical B*08,*15 assignment. Patient and her sister shared the B*15-bearing
haplotype, and unexpectedly, B*15-specific PCR-SSP amplification pattern found in the healthy sister did not gave the extra
band pattern previously reported for patient’s sample.
In order to clarify these discrepant results, generic HLA-B sequencing was performed. A first set of reactions comprising exons
2 to 4 were analysed. HLA-B typing was not able due to the reading frame shift at exon 3, both in forward and reverse reactions.
Sequencing of both HLA-B alleles in isolation was carried out. When B*15 allele was analysed, one nucleotide insertion at
position 440, codon 123 (TAC>TTA) of the exon 3 was reported. This fact would provoke a premature stop codon at position
152 and a non-functional HLA molecule. Therefore, there is a clear discrepancy between the HLA typing data for HLA-B locus
obtained by serology and sequencing.
One possible explanation for these results could be that the one nucleotide insertion in the B*15 allele occurred as a
somatic mutation in the malignant cell. In order to check this possibility, a new sample was obtained after chemoterapy
treatment. Interestingly, SBT for isolated HLA-B*15 allele showed a canonical B*15:01:01 with the absence of the thymidine insertion at exon 3.
Discussion
This report supports and reminds findings already described regarding the interference of somatic mutations in the HLA
typing accuracy. These possible HLA typing errors may be prevented employing a HLA-typing strategy that avoids the use
of samples with a high proportion of malignant cells, typing the available core family members and employing at least one
sample in remission to carry out the verification of the HLA typing.
37
O-034 DISTRIBUTION OF IMMUNOSUPPRESSIVE CELLS (MDSC AND BREG) AND T FOLLICULAR HELPER (TFH) IN AN
OPERATIONAL TOLERANT RENAL TRANSPLANT RECIPIENT
R. Laguna Goya1 , A. Utrero Rico1 , F. L. Cano Romero1 , E. Gómez Massa1 , D. Arroyo Sánchez1 , A. Andrés Belmonte1 ,
N. Polanco Fernández1 , O. Cabrera Marante1 , M. El Amri1 , E. Paz Artal1 1) Hospital 12 de Octubre, Madrid
Introduction
In isolated cases, some transplanted patients develop specific tolerance towards their graft in the absence of immunosuppressive therapy; this situation is called “operational tolerance” (OT). B transitional and B regulatory cells (Btrans and Breg),
T follicular helper (Tfh) and myeloid derived suppressor cells (MDSC) play an important role as regulators of the immune
response. Their study in OT patients may help to get predictive biomarkers for the identification of subjects that could benefit from reduction or elimination of immunosuppression, reducing also secondary effects and cost. Additionally, new cell
therapies to promote tolerance of the transplanted organs may be developped.
Objective
To analyse Btrans, Breg, Tfh and MDSC in an OT kidney recipient and to compare them with analogous populations in
non-transplanted healthy controls (HC), patients with end-stage kidney disease (ESKD) and stable transplanted patients
(STA) with standard immunosuppression.
PBMC from the OT patient were analysed by FC for three times during one year. Tfh were described as CD4+CXCR5+CCR7loPD1hi T cells; MDSC were described as CD11b+CD33+HLA-DR-, Btrans: D19+CD24hiCD38hi, and Breg: CD19+CD24hiCD38hiIL10+. The same cell subsets were analysed in groups of HC, ESKD and STA subjects.
Results
The OT patient is a 41-year-old male who recieved a renal graft 17 years ago because of ESKD of unknown etiology. He received standard immunosuppression with steroids, cyclosporin and MMF or rapamycin. Eight years after Tx he progressively
weaned off the drugs till the complete cesation 7 years ago. From that moment on he has shown stable renal function. The
three analysis in the OT patient revealed normal numbers of T, B and NK cells. He shows non-donor specific, anti-HLA class II
antibodies. Anti-endothelial cell antibodies are negative. Tfh and MDSC percent or total numbers are similar in the OT recipient and subjects in the studied cohorts. However, Btrans are increased in OT and ESKD patients vs HC and STA subjects (p<
0.05 in all comparisons). Ratio between Btrans and Tfh is higher in OT and ESKD subjects vs HC and STA subjects (p< 0.05).
Conclusions
Btrans increase in our OT patient is consistent with literature. Btrans/Tfh ratio magnifies the difference among OT and STA.
If confirmed in other OT patients, a high Btrans/Tfh ratio might be proposed as a tolerance marker. STA patients with a high
ratio may benefit from reduction of immunosuppression.
Proyecto Integrado de Excelencia, FIS PI13/0045, con-financiado por Fondos de la Unión Europea
38
O-035 BREG PROPORTION BEFORE TRANSPLANTATION PREDICTS ACUTE REJECTION IN RENAL GRAFT RECIPIENTS
F. L. Cano Romero1 , A. Utrero Rico1 , R. Laguna Goya1 , E. Mancebo Sierra1 , P. Talayero de Azcarate1 , A. Andrés Belmonte1 ,
E. Paz Artal1 1) Hospital 12 de Octubre, Madrid
Introduction
B transitional cells (Btrans) (CD19+CD24highCD38high) have been previously related to kidney allograft tolerance. A small proportion of Btrans with the capacity to synthesize the immunosuppressive interleukin 10 (IL-10) is called B regulatory cells
(Breg).
Objectives
To analyze Btrans and Breg in a prospective cohort of kidney graft recipients, at pre-transplant (Tx) and during post-Tx evolution, and to interrogate about changes in these populations potentially related to immune events.
PBMC were obtained from a cohort of 110 kidney transplanted patients. The cells were cultured for 48 hours with CD40L and
CpG and brefeldine was added for the last 5 hours. Btrans were FC-recorded as CD19+CD24highCD38high. Among them, cells positive for intracytoplasmic IL10 were considered Breg. Btrans and Breg were also analysed in a group of healthy controls (HC).
Results
Before Tx, chronic renal patients (CRP) showed significantly higher Btrans than HC (p<0.01), independently from type of
dialysis or base disease. %Breg was similar in HC and CRP. During post-transplant, we observed a decrease of both Btrans
and Breg (p<0.001 pre-transplant vs day +7, for both populations) up to the +3 month, that was independent from the type
of immunosuppressive therapy. Patients with Breg>1.5% at pre-transplant experienced significantly more acute rejection
events. This cutoff showed good AUC, sensitivity and especificity values for predicting rejection.
Conclusion
These preliminary results show that pre-transplant Breg values > 1’5% predict acute rejection of the renal graft. This parameter could be useful to monitor and identify high-risk patients and to personalize immunosuppressive therapy.
39
O-036 ISOLATED DE NOVO ANTI-ENDOTHELIAL ANTIBODIES ARE ASSOCIATED WITH REJECTION IN RENAL
TRANSPLANTATION
E. Sánchez Zapardiel 1 , E. Mancebo Sierra1 , M. J. Castro Panete1 , A. Serrano1 , R. Laguna Goya1 , A. Utrero Rico1 , F. L. Cano
Romero1 , E. Paz Artal1 1) Research Institute I+12, Hospital Universitario 12 de Octubre, Madrid, Spain.
Introduction
There are isolated cases of acute rejection of renal transplantation due to anti-endothelial cells (AECA) antibodies. There is
only one study analyzing the role of AECA in a wide cohort of recipients, which, however, does not exclude that the detected
antibodies recognize allogeneic “classic” targets: HLA, MICA or AT1R.
Objective
To study the meaning and characteristics of AECA in the evolution of kidney transplants patients without anti-HLA, -MICA or
-AT1R antibodies.
Pre- and post-transplant sera were studied in 727 kidney recipients. Anti-HLA and anti-MICA antibodies were analyzed by
Luminex, anti-AT1R by ELISA and AECA were studied by indirect immunofluorescence on slides with HUVEC cells.
Results
From a cohort of 727 recipients, 324 were negative for HLA, MICA and AT1R antibodies. Among these, 66 had AECA (59%
Pre+/Post+, preformed, and 41% Pre-/Post+, de novo AECA). Significantly higher rejection was observed in de novo, vs. preformed or AECA-negative patients (p<0.001). AECA Pre-/Post+ emerged as an independent risk factor for allograft rejection
(OR 5.17, p<0.001). Within de novo AECA patients, only anti-cytoskeleton or anti-nuclear AECA (out of six different patterns
recorded) were detected and appeared in all rejectors (p=0.003). Delayed graft function (DGF) and creatinine at week 1 were
significantly higher in de novo vs. preformed AECA patients (p=0.044 and p=0.034 respectively). Rejection in de novo AECA
group was not predominantly humoral or C4d+.
Conclusion
We found that de novo AECA with targets different from traditional alloantigens relate to rejection. We propose that previous rejections damaged the endothelium and the dying cells exposed nuclear and cytoskeleton antigens, which elicited
the observed rejection-related de novo AECA. These antibodies might serve as biomarkers of endothelium damage in renal
recipients.
40
O-037 CIRCULATING IMMUNE COMPLEXES OF IGA BOUND TO BETA 2 GLYCOPROTEIN I ARE A PREDICTIVE MARKER
FOR RENAL GRAFT LOSS IN PATIENTS POSITIVE FOR IGA AB2GPI
M. Serrano1 , J. A. Martínez-Flores1 , D. Pérez Mendez1 , O. Cabrera Marante1 , M. Sevilla Sánchez1 , S. Mora Diaz1 , I. Ezzahouri El
Khalouki1 , D. Plieguezuelo Garrote1 , F. García Martin1 , E. González Montejo1 , J. M. Morales Cerdan1 , A. Serrano Hermández1 1) Instituto de Investigacion Hospital 12 de Octubre
Introduction
Pretransplant IgA anti-Beta-2-Glycoprotein I antibodies (IgA aB2GPI) is a risk marker of early kidney graft loss, mainly by
thrombosis. About 30% of patients are IgA aB2GPI positive in pretransplant situation. However, only 10% of them lose the
graft, needing new markers to predict graft loss. Recently we described immune complexes of IgA bounded to B2GPI (B2ACIC) in patients positive for IgA aB2GPI and clinical criteria for antiphospholipid syndrome.
Objetive
Our aim is to evaluate B2A-CIC in patients positive for IgA aB2GPI who receive a kidney transplant.
Patients
25 positive IgA aB2GPI patients without early graft loss (Group-1) and 25 positive IgA aB2GPI patients with early graft loss in
the firsts 6 months (Group-2) during 2009 to 2012 were analyzed in the pretransplant sample.
Results
Group-1 IgA aB2GPI mean levels was 68.5± 12.3 UI and 71.4± 10.5 UI for Group 2 (p>0.05). B2A-CIC mean levels was 14.1
± 2.2AU, significantly lower than Group-2 mean levels, 27.1 ± 3.8AU (p = 0.001). Percentage of positive B2A-CIC patients in
Group-1 was 20.0% (5/25) (> 21.0 AU) and Group-2 presented a positivity of 80.0% (20/25) (P <0.001).
Conclusions
B2A-CIC is a predictive marker of graft loss. This makes possible the localization the population actually at risk of graft loss
and improve the management and treatment of patients trying to avoid graft loss.
41
O-038 DIFFERENTIAL EXPRESSION OF 5 GENES ALLOWS THE IDENTIFICATION OF INTESTINAL TRANSPLANTS WITH
REJECTION RISK: A STUDY BY RNA-SEQUENCING (RNASEQ)
P. Talayero Giménez de Azcárate1 , L. Alonso Guirado2 , G. Padilla Alonso2 , H. Artaza Álvarez2 , A. Dopazo González3 , F. Sánchez
Cabo4 , E. Mancebo Sierra1 , S. Rodríguez Muñoz5 , J. Calvo Pulido6 , M. Carcía Lacoba2 , E. Paz Artal1 1) Hospital 12 de Octubre 2) Centro de Investigaciones Biológicas 3) Centro Nacional de Investigaciones Cardiovasculares 4) Centro
Nacional de Investigaciones Cardiovasculares 5) Hospital 12 de Octubre 6) Hospital 12 de Octubre
Background
Next Generation Sequencing studies of gene expression (microarrays and RNASeq) help to understand the molecular mechanisms underlying graft injury or transplant tolerance. Because of their high sensitivity, these techniques are also a tool for
discovering new therapeutic targets and biomarkers that reflect the graft evolution.
Objective
The aim of this work is to search gene expression patterns in intestinal graft biopsies with “minimal changes” histology that
could distinguish grafts prone to be rejected versus immunologically stable grafts.
Methods
24 RNA samples obtained from biopsies of intestinal grafts corresponding to 8 patients were included for RNASeq. Biopsies
of patients free of rejection and biopsies taken from 15 days post-rejection without another episode in at least six months
were considered stable (STA). Non-stable group (NSTA) included biopsies obtained between rejection episodes (separated
less than six months) and also biopsies collected within the 15 days before the first rejection episode. Samples were divided
into two subgroups: discovery set (11 STA and 7 NSTA) and test set (6 STA). Differential expression analysis was performed
on the discovery set. Gene selection and classification was performed by the nearest shrunken centroids (NSC) method. The
validation of the classification was performed by support vector machine, bagging and random forest methods in the test
set. Expression of genes selected by NSC method was evaluated by qPCR in a third independent group of 26 biopsies with
the same characteristics (validation set) and a group of biopsies with rejection or undetermined for rejection (rejection set).
Results
816 genes were differentially expressed in STA and NSTA biopsies. In the NSC analysis we obtained a subset of 5 genes (ADH1C, SLC39A4, CYP4F2, OPTN and PDZK1) that classified biopsies of the discovery set in STA and NSTA with an overall error
rate of 11% and classified correctly all the biopsies of the test set. These results were confirmed by other three prediction
models. With the values of the gene expression qPCR assays in the validation set we developed a logistic regression model
that identified STA and NSTA samples with 89% sensitivity and 71% specificity. This model was also validated in the rejection
set, obtaining a good classification.
Conclusions
These 5 genes are possible biomarkers to identify high rejection risk patients even with biopsies with normal histology.
42
O-039 HIGHER LEVELS OF GALECTIN-3 IN HEART RECIPIENTS WITH HISTORY OF ACUTE CELLULAR REJECTION
E. Sarmiento Marchese1 , M. Sarwal2 , L. Li3 , C. Rodríguez4 , L. Calahorra Melero1 , S. García Jiménez1 , Y. Castro5 , I. Sousa6 ,
P. Diez6 , J. Carbone Campoverde1 1) Hospital General Universitario Gregorio Marañón. Madrid. Spain 2) University of California San Francisco, San Francisco, CA, USA
3) Mount Sinai School of Medicine, New York, USA 4) Hospital General Universitario Gregorio Marañón. Madrid. Spain 5) Hospital
General Universitario Gregorio Marañón. Madrid. Spain 6) Hospital General Universitario Gregorio Marañón. Madrid. Spain
Introduction
Acute cellular rejection and cardiac allograft vasculopathy remain as barriers for long term success after heart transplantation. Despite the use of induction and maintenance immunosuppressive therapies, humoral and cellular alloimmune responses may occur during the follow-up after transplantation. However we still lack of reliable biomarkers to identify heart
recipients at risk of humoral and cellular acute and chronic rejection. Development of noninvasive assays to improve rejection diagnosis and patient monitoring is a critical need. Changes of biomarkers measured after heart transplantation can
reflect different processes such as inflammation, cardiomyocyte necrosis, heart function, fibrosis or global cardio renal risk.
Objective
We aimed to assess the relationship between the levels of distinct serum proteins and development of acute cellular rejection or cardiac allograft cardiopathy in a retrospective case control study performed in heart recipients.
63 patients (52 male, 11 women; mean age 53±11 years) were evaluated in a single center study. 32 of these patients developed acute cellular rejection after transplantation according to the revised ISHLT criteria and 31 neither developed acute
cellular rejection in biopsies nor clinical symptoms suggesting humoral rejection (controls). Frozen serum samples were
sended to Stanford University, USA for testing. The following proteins were measured by ELISA tests: Human CD14 (ng/ul),
human CXCL4/PF4, human Fetuin-B (ng/ul), human Galectin-3BP/MAC-2BP (ng/ul), apolipoprotein A1 (ug/ml), human NAP2 (ng/ul), human CXCL9/MIG (ng/ml), human CD44 (ng/ml) and human CD31 (ng/ml). Means of the distinct proteins were
compared by 2-sided Student`s T-test.
Results
Patients who developed acute cellular rejection were found to have significantly higher levels of serum Galectin-3 as compared with controls (13±4.7 vs 9.9±3.8 ng/uL, p=0.016). When we split patients in two groups according to levels of Galectin-3
(cut-off 10 ng/uL), we found a significative association (OR 3.07, 95% CI 1.09-8.61, p=0.033) between higher levels and previous history of acute cellular rejection. Patients who had data of previous cardiac allograft vasculopathy (n=15) disclosed a
profile of higher levels of Galectin-3 (14±5 vs 10±3.9 ng/uL, p=0.031) and also higher CD14 (19±5.6 vs 15±4.8 ng/uL, p=0.012)
and CD44 levels (193±58 vs 150±43 ng/mL, p=0.015).
Conclusions
Galectin-3 is a biomarker that reflects inflammation and fibrosis that might be associated with impairment of cardiac function. Elevated levels of Galectin-3 have been described associated with mortality in acute and chronic heart failure patients.
Higher levels of Galectin-3 could be a consequence of alloimmune responses in heart recipients. Further studies of the potential role of this protein as a biomarker in heart transplantation are warranted.
43
O-040 PRE TRANSPLANT SERUM BAFF AS A POTENTIAL BIOMARKER OF ACUTE REJECTION IN LUNG TRANSPLANTATION
E. Sarmiento Marchese1 , J. M. Cifrian2 , L. Calahorra1 , R. Laporta3 , P. Ussetti3 , C. Bravo4 , S. López4 , A. Sole5 , P. Morales5 ,
A. de Pablos6 , M. Jaramillo1 , S. García1 , I. Ezzahouri1 , J. Carbone1 1) Hospital General Universitario Gregorio Marañón. Madrid 2) Hospital Universitario Marqués de Valdecilla. Santander 3) Hospital
Universitario Puerta de Hierro. Madrid 4) Hospital del Valle de Hebrón. Barcelona 5) Hospital Universitario la Fe. Valencia 6) Hospital
Universitario Doce de Octubre. Madrid.
Introduction
Despite current immunosuppressive protocols, rejection is common after lung transplantation. Most recipients have at least
one episode of acute rejection. The mechanisms leading to this alloimmune complication are complex and not fully understood. BAFF is a critical regulator of B cell development and differentiation. Binding of BAFF to BAFF-R expressed by a subset
of primarily CD4(+) T cells costimulates T cell activation and allo-proliferation.
Objective
In a multicenter study we aimed to identify abnormalities in serum BAFF levels before lung transplantation in lung recipients
with and without acute rejection.
A multicenter prospective study was performed in 5 geographically dispersed transplant centers in Spain. We prospectively
evaluated 88 lung recipients (mean age 53±14 years, 56 male). Maintenance immunosuppressive therapy included corticosteroids, mofetil mycophenolate and either cyclosporine or tacrolimus. Clinical follow-up was performed with daily visits
to the Lung Transplant Units during the first 6 months after transplantation. Serum BAAF levels were determined in frozen
samples sended to a coordinating laboratory center. A commercial ELISA test was used. Study point was before lung transplantation when the patients were included in the waiting list for lung transplantation.
Results
During follow-up, 30 patients (34.09%) developed at least one episode of treated acute rejection. Baseline BAAF concentration was significantly higher in patients who developed rejection as compared with patients who remained free of rejection.
In ROC analysis the best cut-off point associated with acute rejection was 1500 pg/mL. When we stratified patients according
to this cut-off, patients with higher values (>1500 pg/mL) were at higher risk for development of acute rejection (OR 3.57,
95% confidence interval 1.06-12.11, p=0.041). In multivariate regression analysis, after adjustment by clinical risk factors of
acute rejection, higher baseline BAFF levels remained in the final model but did not remained significantly associated with
rejection risk (p=0.08).
Conclusion
This is the first study that report that higher pre-transplant BAAF concentration could be considered a baseline biomarker of
acute rejection in lung transplantation. A higher pre transplant pro-inflammatory status of the recipient might predispose
patients to develop acute rejection. Further studies with a greater number of patients are warranted to confirm these results.
44
O-041 VALIDATION AND IMPLEMENTATION OF NEXT GENERATION SEQUENCING TECHNOLOGY FOR HLA TYPING IN
OUR LABORATORY ROUTINE
E. Enrich Randé1 , N. B. Agusti1 , E. Campos Pérez1 , L. Mongay Berdet1 , I. Corrales Insa1 , C. Hobeich Naya1 , F. Vidal Pérez1 ,
J. L. Caros Oleas1 , F. Rudilla Salvador1 1) Banc de Sang i Teixits de Barcelona
Introduction
Next generation sequencing (NGS) has become a revolutionary and innovative technology with a great impact on molecular
genetics laboratories. We have chosen the NGS technology for HLA typing due to the complexity of HLA system and the
potential of high resolution HLA typing in the success of transplantation.
The aim of the present study was to validate and implement a novel strategy of molecular HLA allele typing by NGS. This
innovative strategy is based on sequencing exons 2, 3 and 4 for HLA class I as well as exons 2 and 3 for HLA class II.
To take advantage of the capacity of this technology, we carry out simultaneous sequencing of 384 samples per run to start
the validation of this method. These samples were previously characterized for HLA-A, -B, -C, -DRB1 and -DQB1 at high resolution using a proprietary NGS methodology based on whole HLA gene sequencing, which was validated and implemented
in our laboratory in early 2015.
The library preparation was performed by nested short-PCR, sequencing was carried out in a MiSeq platform and results
were analyzed using two software programs, Omixon’s target and GenDX’s NGSengine software. Results
The quality of sequencing was consistent since the percentage of reads identified was 92%. Also, we confirmed that more
than 74.8% bases had a Q-score > 30 (Q30). Then, the base call accuracy for these bases was 99.9%. Moreover, the coverage
of reads per sample was homogeneous. The results showed that over 99% of the HLA typing were concordant with previous
NGS sequencing method, for HLA class I was 99.6% (HLA-A: 99.7%, HLA-B: 99.6%, HLA-C: 99.5%) and for HLA class II was
99.4% (HLA-DRB1: 99.9%, HLA-DQB1: 99%). The non-concordant results and the unresolved ambiguities found in the analysis can be explained by the fact that not all exons were sequenced and due to the need to improve the software’s algorithms
for HLA typing by NGS.
Conclusion
The developed strategy for HLA typing by NGS was successfully validated and implemented as a part of the laboratory routine. We obtained high throughput sequencing with a very significant reduction of cost and hands on time. The automation
of the process will improve the throughput of the process and allow taking full advantage of NGS.
45
O-042 EVOLUTION AND CLINICAL CORRELATION OF DE NOVO HLA ANTIBODIES (MEASURED BY LUMINEX SINGLEANTIGEN BEAD ASSAY AND FLOW CYTOMETRY CROSS-MATCH ASSAY) IN RENAL TRANSPLANT
J. J. Mata Molanes1 , L. Moreno Narro1 , P. Arana Berganza1 , S. Chocarro de Miguel1 , A. Flores Ugarriza1 , J. Merino Roncal1 ,
C. Moreno Parado1 1) Clínica Universidad de Navarra
Introduction
Antibody-mediated rejection due to donor-specific anti-HLA antibodies (DSA) is a cause of chronic rejection and poor graft
survival. Recently, most of studies have used the Luminex technology to detect de novo DSA (dnDSA) occurrence in renal
transplant. This platform, however, carries some restrictions in the type of antibodies it detects. For this reason, detection of
dnDSA after transplantation using Luminex can be complemented with traditional technical to detect antibodies.
Objectives
The aim of this study was analyzed the incidence and clinical impact of develop dnDSA by LABScreen single antigen (LSA)
and flow cytometry crossmatch (FCXM) in primary kidney transplants without pretransplant HLA antibodies.
The study includes 122 patients not sensitized before transplantation which were tested for HLA antibodies by LSA at 6, 12,
30 and 48 months posttransplant. Furthermore, DSA monitoring in 40 patients were performed using FCXM at 12 and 30
months after transplantation.
Results
At 4-year follow up the cumulative incidence of dnDSA was 6.1% (n=7), developing 57.1% of these antibodies in the first
posttransplantation years. An early conversion to mTORi-based immunosuppressive regimen was the only independent risk
factor associated with dnDSA formation (HR: 18.37, IC95% 3.67–91.93, p<0.01). Moreover, 6/40 patients (15%) showed DSA by
FCXM with a negative result by Luminex. Patients with DSA (detected by Luminex or FCXM) had significantly higher levels of
serum creatinine than non-DSA and Ab-negative patients (p<0.01). In these patients, DSA preceded the onset of proteinuria
in 71.4% of cases.
Conclusions
We confirmed that dnDSA occurrence is associated with a deterioration of renal function in non-sensitized patient. Moreover, HLA antibodies monitoring by Luminex and complementation with FCXM can provide a better characterization of DSA
after kidney transplant.
46
O-043 IMPACT OF THE POLYMORPHISM RS9264942 NEAR THE HLA-C GENE ON THE CELL-ASSOCIATED HIV-1 DNA
RESERVOIRS IN ASYMPTOMATIC CHRONICALLY INFECTED PATIENTS WITHOUT ANTIRETROVIRAL THERAPY
L. Herraiz-Nicuesa1 , S. García-Consuegra1 , J. P. Navarro-Valdivieso1 , C. Rodríguez-Sainz1 , E. Fernández-Cruz1 1) Hospital General Universitario Gregorio Marañón, Madrid
Background
Several genome wide association studies (GWAS) have identified a polymorphism located 35 kb upstream of the coding
region of the gene HLA-C (-35 C/T; rs9264942) as a host factor significantly associated to the control of the HIV-1 viremia
in untreated patients. The protective allele (-35 C) leads to a lower viral loads. The potential association of this host genetic
polymorphism rs9264942 with the peripheral cell-associated reservoires of the virus has not been investigated.
Objective
To assess the influence of the polymorphism -35 C/T rs9264942 on the outcome of virus burden in 183 antiretroviral (ART)-naïve HIV-1 infected individuals, focusing on the HIV-1 RNA viremia and cellular HIV-1 DNA reservoires associated to peripheral blood mononuclear cells (PBMC).
One hundred eighty three patients with asymptomatic HIV-1 chronic infection who had participated in the clinical trial STIR2102 were retrospectively genotyped for the polymorphism rs9264942 by real-time PCR amplification with the LightSNiP
rs9264942 HLA-C (TIB MOLBIOL GmbH, Berlín, Germany; under license from Roche Diagnostics GmbH) using LightCycler®
FastStart DNA Master HybProbe (Roche Diagnostics) and a LightCycler® 1.5 Instrument. The genotype was verified by sequencing. Plasma levels of HIV-1 RNA were assessed using the Amplicor assay (Hoffman La Roche, Nutley, NJ) with a lower
limit of quantification of 200 copies/mL (2.30 log10 copies/mL). Cell-associated HIV-1 DNA was quantified with a real-time
quantitative PCR method using SYBR Green and primers of the pol gene.
Results
Among the 183 chronically infected study subjects, thirty four (18.6%) displayed the genotype homozygous for the protective allele (-35 CC), whereas ninety five (51.9%) were heterozygous (-35 CT) and fifty four were homozygous for the allele -35
T (29.5%). The allelic frequency of the minor allele (-35 C) was 44.5%. To evaluate the impact of the protective allele -35 C on
the viral control in our cohort of ART-näive patients, we compared viral load levels between carriers and no carriers of the
allele. This revealed decreased setpoints of the plasmatic viremia in -35 C carriers as compared to those with the genotype
-35 TT reaching statistical signifcance (p = 0.035; median comparison for independent samples). Cellular associated HIV-1
DNA levels were also significantly different between patients with and without the allele -35 C (p = 0,000; median comparison for independent samples). This allele was associated with lesser levels of cellular HIV-1 viral DNA associated to PBMCs.
Conclusion
In the untreated HIV-1 chronically infected patients of our study the protective allele -35 C is associated with lower viremias
and also with lower levels of cellular HIV-1 DNA reservoirs.
Financial support: Fondo de Investigación Sanitaria (FIS), Grant: PI09/2558
47
O-044 LARGE SCALE GENETIC ANALYSIS IN BEHÇET DISEASE. IDENTIFICATION OF RESIDUES ASSOCIATED IN THE HLA
CLASS I REGION AND NEW SUSCEPTIBILITY LOCI
L. Ortiz Fernández1 , F. D. Carmona2 , M. A. Montes Cano1 , J. R. García Lozano1 , M. Conde Jaldón1 , Grupo Español de Estudio
Para La Enfermedad de Behçet1 , J. Martín2 , M. F. González Escribano1 1) Instituto de Biomedicina de Sevilla 2) Instituto de Parasitología y Biomedicina “Lopez-Neyra”
Objective
Behçet’s disease (BD) is a complex and immune-mediated vasculitis which aetiology remains unknown. To improve the current knowledge of the BD genetic background, we conducted a large-scale genetic analysis.
Methods
A discovery cohort comprising 278 BD cases and 1,517 unaffected controls were genotyped using the Immunochip platform.
The validation step was performed on an independent replication cohort composed of 130 BD cases and 600 controls. To
extensively analyse the HLA region, single-nucleotide polymorphisms (SNP), classical HLA alleles and polymorphic amino
acid variants were tested and imputed.
Results
The strongest association signals were observed in the HLA class I region, being HLA-B*51 the highest peak (overall
P=6.82E-32, OR=3.82). By using step-wise conditional logistic regression on classical alleles, HLA-B*57 and HLA-A*03 were
identified as additional independent markers. The best-fit model for amino acids in the HLA region included the position 97
in HLA-B and position 66 in HLA-A. The most significant no-HLA loci were IL23R (rs10889664: P=3.81E-12, OR=2.00), the JRKL/
CNTN5 region (rs2848479: P=5.00E-08, OR=1.68) and IL12A (rs1874886: P=6.67E-08, OR=1.72).
Conclusion
Our data support several independent signals within the class I genes, specifically in HLA-A and HLA-B and confirm multiple
markers in HLA-B (HLA-B*51 and B*57). In addition, various non-HLA genes, some of them previously reported, such as, IL23R
and IL12A and others new as the JRKL/CNTN5 region are associated to susceptibility to this disease.
48
O-045 CHARACTERIZATION OF FOUR NEW HLA NULL ALLELES IN THE SPANISH POPULATION: A*11:210N, A*26:107N,
B*15:375N and B*07:44N.
A. Balas1 , F. Sánchez Gordo2 , D. Planelles3 , M. Rodríguez Cebria3 , C. Muñoz4 , F. García Sánchez1 , J. L. Vicario1 1) Centro de Transfusion de Madrid 2) Centro de Transfusion de Malaga 3) Centro de Transfusion de la Comunidad Valenciana
4) Hospital General de Alicante
Introduction
The human leukocyte antigen (HLA) system is the most polymorphic gene cluster in humans. To date, more than 9000 alleles
and 6000 proteins have been described for classical class I genes. Similarly, the number of null and alternatively expressed
HLA alleles has been significantly increased. Up to now, 138 HLA-A, 122 HLA-B and 75 HLA-C null alleles have been characterized. The absence of surface expression can be caused by a wide range of modifications such as insertions, deletions or
substitutions of one or more nucleotides. These events may be responsible for the generation of stop codons or modifications in the promoter or the highly conserved exon–intron splicing regions.
Objectives
Molecular characterization of four novel HLA-null alleles found in Spaniards.
Serologic HLA typing was performed by using commercial typing trays (Inno-train Diagnostik and One Lambda trays). Molecular typing was carried out by PCR-SSO (Luminex technology) and full-length HLA sequencing. Null alleles were further
characterized in isolation by using either cloning or allele-specific full-length amplification methods.
Results
Summary of molecular mechanism explaining the complete expression failure for these four alleles is included in Table 1.
Allele
A*11:210N
A*26:107N
B*15:375N
Mutation
deletion
point mutation
deletion
B*07:44
point mutation
Description of the mutation
exon 4, point deletion nt 643. Stop codon at 201.
exon 3, substitution positon 470 (TGG>TAG), 133 Trp>Stop
exon 3, seven base pairs deletion nts 472-478, Stop codon at 187.
exon 4, substitution nt 852 T>G. Alternative splicing, partial deletion
exon 4. Stop codon at 280.
Conclusions
The failure to identify HLA null alleles in the stem cell transplantation setting may result in a HLA mismatch. Therefore,
screening strategies have been implemented in the clinical Histocompatibility laboratory as a mandatory EFI requirement.
Combination of serology and molecular HLA typing or genomic full-length sequencing analysis are the basic strategies used
for HLA null alleles identification. 39 Congreso de la Sociedad Española de Inmunología
49
O-046 IMPACT OF THE ALLELE CCR5-Δ32 ON THE CELL-ASSOCIATED HIV-1 DNA RESERVOIRS IN ASYMPTOMATIC
CHRONICALLY INFECTED PATIENTS INITIATING ANTI-VIRAL THERAPY
L. Herráiz-Nicuesa1 , D. C. Hernández-Flórez1 , L. Valor1 , J. P. Navarra-Valdivieso1 , E. Fernández-Cruz1 , C. Rodríguez-Sainz1 1) Hospital General Universitario Gregorio Mararón, Madrid
Background
Entry of HIV-1 into target cells depends on the interaction between the viral envelope glycoprotein gp120 and the co-receptor CCR5 or CXCR4. A 32-base pairs deletion in the gene CCR5 (CCR5-Δ32) is a naturally occurring variant that results in
a truncated protein not expressed on the cell surface, leading to effectively restricted HIV-1 cell entry in homozygous individuals and delayed progression in heterozygotes. CCR5-Δ32 allele is associated with lower levels of HIV-1 RNA viral load
and with better virological responses to antiretroviral therapy (ART). The role of the host genetic background CCR5-Δ32 on
the peripheral cell-associated HIV-1 reservoires has not been clearly established. In addition, CCR5 is the major co-receptor
for non-syncytium-inducing (NSI) isolates of HIV-1 (R5 variants) that dominate in early infection and are present throughout
the course of infection. The other co-receptor CXCR4 is preferentially used by syncytium-inducing (SI) isolates (X4 strains),
which appear later during infection at least in 50-60% of patients. Coreceptor usage determines the tropism of the virus and
is critical for HIV-1 pathogenesis.
Objectives
To assess the influence of the CCR5-Δ32 deletion on the outcome of virus burden in 187 antiretroviral-naïve individuals who
initiated antiviral treatment (study STIR-2102), focusing on HIV-1 RNA viremia and cellular HIV-1 DNA reservoires.
CCR5-Δ32 genotyping was retrospectively performed in the 187 individuals by genomic PCR amplification and subsequent
gel electrophoresis. Plasmatic HIV-1 RNA and HIV-1 DNA obtained from peripheral blood mononuclear cells (PBMCs) were
analyzed before ART, one month after ART and at the end of the study (follow-up of 36 months). Coreceptor use was assessed
through V3 amino acid sequences of the env region of the DNA extracted from primary PBMCs in sixteen patients. The combined rule of positive charge at position 11 and/or 25 and V3 net charge was considered to predict viral tropism
Results
Among the 187 chronically infected study subjects, one hundred sixty one (86.1%) displayed the common genotype CCR5wt/wt, whereas twenty five (13.4%) were heterozygous for the deletion allele (CCR5-wt/Δ32). One HIV-1 infected individual
(0.5%) was found to be homozygous for the CCR5-Δ32 allele (CCR5- Δ32/Δ32). HIV-1 RNA viral load before ART was the only
variable significantly different between carriers and non-carriers of the deletion CCR5-Δ32 (p < 0.032). We also describe the
outcome of a patient homozygous for CCR5-Δ32 and analyze the viral tropism from HIV-1 DNA reservoires in the CCR5 genotype background.
Conclusions
CCR5-Δ32 allele was associated in our ART-naïve cohort with a significantly lower HIV-1 RNA level. The trend for diminished
cell-associated HIV-1 DNA levels and slower immunovirological progression in response to ART did not reached statistically
significance in this study.
Financial support: Fondo de Investigación Sanitaria (FIS), Grant:PI09/2558
50
O-047 INTEGRATION OF -OMICS DATASETS FOR COMPREHENSIVE PROTEIN EXPRESSION PROFILING FOR A BURKITT´S LYMPHOMA-DERIVED B-CELL LINE
P. Díez García1 , C. Droste2 , R. M. Dégano4 , N. Ibarrola4 , M. González-Muñoz1 , R. Góngora1 , F.Corrales3 , A. Orfao1 , M. Fuentes1 1) Centro de Investigación del Cáncer 2) Centro de Investigación del Cáncer 3) CIMA 4) Centro de Investigación del Cáncer
Introduction And Objectives
After the Genome era, proteomics has emerged as a powerful tool to simultaneously identify and characterize the compendium of thousands of different proteins active in a cell. The Chromosome-centric Human Proteome Project (C-HPP) is promoting a full characterization of the human proteome combining high-throughput proteomics with the data derived from
genome-wide expression profiling of protein-coding genes. Thus, a comprehensive study of the behaviour of the cells can
be confronted from two different but complementary perspectives: genomics and proteomics. Herein, the combination of
both disciplines has been performed to achieve a deep characterization of a lymphoma cell line.
We focused our research in a Burkitt’s lymphoma-derived B-cell line (Ramos) performing an LTQ-Orbitrap experiment to
profile its proteome. Specifically, proteins obtained by subcellular fractionation were separated by SDS-PAGE and digested
in-gel. The LC-MS/MS analysis was accomplished with a nUPLC-LTQ-Orbitrap Velos and the neXtProt database was used for
the protein search. Concerning the transcriptomic analysis, public datasets from GEO were selected. Finally, the integration
of proteomics and transcriptomics was done using an R-script developed in-house.
Results
The integration of these proteomics datasets and the transcriptomics information revealed a 94% of overlapping in protein
identification between both -omics approaches. Additionally, the functional enrichment analysis showed an enrichment
of functions directly related to the functional and morphological characteristics of B-cells. Moreover, up to 30% of total
protein-coding genes present in the human genome (~5000-6000) were identified in this study (an average of 30% per
chromosome and 85% in the case of the mitochondrial chromosome), improving the protein characterization of the disease.
Finally, the high accuracy in protein identification has allowed the detection of 370 missing proteins (proteins that currently
lack evidence by mass spectrometry up to the moment).
Conclusions
The transcriptomic and proteomic experimental profiling has provided a high coverage report of the expressed proteome
from a human lymphoma B-cell line with a clear insight into the biological processes that characterized these cells. In this
way, it is demonstrated the usefulness of combining -omics for a comprehensive characterization of specific biological systems.
Acknowledgements
We gratefully acknowledge financial support given by the European Social Fund, the Ministry of Education of the Castilla
y León (BIO/SA07/15 and JCYL-EDU/346/2013 Ph.D. scholarship) and the Carlos III Health Institute of Spain and FEDER (FIS
PI14/01538, PT13/0001 PRB2 and Fundación Solórzano FS/23-2015).
51
O-048 GENE EXPRESSION STUDIES IN CELIAC DISEASE AND ULCERATIVE COLITIS
V. Pascual Pascual1 , L. M. Medrano de Dios1 , J. L. Mendoza Hernández2 , N. López Palacios2 , A. Bodas Pinedo3 , M. Fernández
Arquero1 , B. González Pérez4 , I. Salazar Mendoza5 , M. C. Núñez Pardo de Vera1 1) Hospital Clínico San Carlos 2) Hospital Clínico San Carlos 3) Hospital Clínico San Carlos 4) Facultad de Matemáticas, Universidad
Complutense de Madrid 5) Facultad de Veterinaria, Universidad Complutense de Madrid
Introduction
The knowledge of the genetic basis of immune-mediated diseases has dramatically increased in recent years with the advent
of genome-wide association studies (GWAS). These studies described numerous genetic variants across the human genome
showing a different frequency between individuals with the disease and the general population and therefore associated
to disease risk. Additionally, the most recent Immunochip Project and meta-analyses that combine data of previous GWAS
were performed and identified numerous susceptibility loci common to different immune-mediated diseases. Celiac disease
(CD) and ulcerative colitis (UC) are two intestinal disorders with shared disease risk associated regions. However, most of
these regions harbor several genes, which made necessary additional analyses to pinpoint the causal genes in each region.
Objectives
We evaluated the intestinal expression of genes located in CD and UC shared risk regions aimed to investigate whether similar functional consequences were underlying the described association signals.
Methods
Tissue samples were obtained from duodenum from 20 CD patients and 12 controls, and from colon from 7 UC patients and
4 controls. Total RNA was obtained with the RNeasy Mini Kit (Qiagen) and, after RT-PCR reaction, the expression of 17 genes
located in 10 chromosomal regions was measured by quantitative PCR using custom TaqMan array cards. The mRNA expression level of each gene was calculated according to delta-Ct. We used a bayesian decision procedure, which tests multiple
hypotheses simultaneously and allows the use of small sample sizes, to analyse the differential expression between each
group of patients and their controls. This method is based on computing the posterior probability of whether a particular
gene is differentially expressed between groups given the data set for all genes.
Results
We found similar results in CD and UC in six out of the ten studied regions (1q32, 2p16, 2q12, 4q27, 6q23, 14q22 and 18p11),
with active disease characterized by decreased expression of C1orf106, increased C2orf74, IL21 and IL18RAP levels and non-altered expression of PTPN2 and TNFAIP3. The ZFP36L1 gene, located in 14q22, was significantly altered in both diseases, but
with an opposite effect (decreased in CD and increased in UC), however, two different and non-correlated polymorphisms
were associated to these two diseases. The remaining three regions showed discrepant results, with BACH2 increased only in
active CD, ZMIZ1 in UC patients and a different gene altered in 2q11: UBE2L3 in CD and YDJC in UC.
Conclusions
Gene expression studies seem a useful strategy to pinpoint the causal gene in disease risk associated genes, suggesting that
C1orf106, C2orf74, IL21, IL18RAP and ZPF36L1 are involved in these two diseases.
52
O-049 ASSOCIATION OF IMMUNOCHIP POLYMORPHISMS WITH THE PRESENCE OF ANTI-MYENTERIC AUTOANTIBODIES
IN IDIOPATHIC ACHALASIA PATIENTS
A. Murillo Garagorri1 , J. L.Santiago Álvarez1 , A. Ruiz de León1 , J. Pérez de La Serna1 , E. Urcelay García1 1) Instituto de Investigación Sanitaria del Hospital Clínico San Carlos, IdISSC
Introduction
Idiopathic achalasia is a severe motility disorder of the esophagus. The disease involves a failure of the lower esophageal
sphincter to relax, due to a loss of neurons in the myenteric plexus. Moreover, autoantibodies against myenteric neurones
have repeatedly been shown in serum of achalasia patients. The etiology of achalasia remains unknown, but it is likely multifactorial with genetic predisposition and environmental factors probably triggering autoimmune mechanisms. In order to
identify genes contributing to achalasia, we previously participated in the Immunochip project, an association study with
a sample consisting of 1,068 patients and 4,242 controls from Central Europe (630 patients, 2,652 controls), Spain (273 patients, 327 controls), and Italy (165 patients, 1,263 controls).
Objectives
The aim of the present study was to evaluate whether the genetic variability previously analyzed in our achalasia cohort,
would have a role determining the development of antibodies against the myenteric plexus.
A total of 273 achalasia patients were diagnosed according to a standard diagnostic procedure, including esophageal manometry and/or esophagography, and anti-myenteric autoantibodies were discriminated in 199 patients. Genotyping was
performed on the Immunochip, an Illumina Infinium High-Density array developed by the Immunochip Consortium, in these
Spanish patients and 327 controls. This array covers 196,524 common and rare variants at immune-relevant loci throughout
the entire genome. Of all markers, 116,672 SNPs (single nucleotide polymorphisms) passed quality control and were therefore analyzed for their association with Ab-positivity discriminated by indirect immunofluorescence assay (intestinal monkey
tissue, Euroimmun). Genetic comparisons were performed with Helix Tree software (Golden Helix Inc.).
Results
The discovery cohort yielded a list of SNPs associated with circulating Abs by comparison of Ab-positive and Ab-negative (23
vs. 123) achalasia patients. The replication cohort compared the Ab-positive subgroup with healthy controls (327). Only ten
polymorphisms were shared between the discovery and validation comparisons, being three of them located in the human
leucocyte antigen, HLA locus at 6p21.
Conclusion
Immunochip polymorphisms in eight loci within chromosomes 2, 3, 6 and 11 seem to be associated with the presence of
anti-myenteric autoantibodies in idiopathic achalasia patients.
53
O-050 IFITM3 AND SEVERE INFLUENZA VIRUS INFECTION. NO EVIDENCE OF ASSOCIATION
M. López-Rodríguez1,2 , E. Herrera-Ramos1,3 , J. Solé-Violán4 , J. J. Ruíz-Hernández5 , L. Borderías6 , J. P. Horcajada7,8 , G. Nereida1 ,
O. Rajas9 , M. Briones10 , E. López-Granados11 , F. Rodríguez de Castro3,12 , C. Rodríguez-Gallego13 1) Department of Immunology, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain 2)
Department of Clinical Sciences, School of Medicine, Universidad de Las Palmas de Gran Canaria, Las Palmas de Gran Canaria,
Spain 3) Department of Medical and Surgical Sciences, School of Medicine, Universidad de Las Palmas de Gran Canaria, Las Palmas
de Gran Canaria, Spain 4) Intensive Care Unit, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain,
CIBERES 5) Department of Internal Medicine, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas Gran Canaria, Spain 6)
Department of Respiratory Diseases, Hospital San Jorge, Huesca, Spain 7) Department of Infectious Diseases, Hospital Universitari
del Mar, Barcelona, Spain 8) Hospital del Mar de Investigaciones Médicas (IMIM), Barcelona, Spain, CIBERES 9) Department of
Respiratory Diseases, Hospital Universitario de la Princesa, Madrid, Spain 10) Department of Respiratory Diseases, Hospital Clínico y
Universitario de Valencia, Valencia, Spain 11) Department of Immunology, Hospital La Paz. La Paz Institute of Biomedical Research,
IdiPAZ. Madrid, Spain 12) Department of Respiratory Diseases, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas de
Gran Canaria, Spain 13) Department of Immunology, Hospital Universitario Son Espases, Palma de Mallorca, Spain.
Introduction Influenza virus infection (IVI) typically causes a self-limiting upper respiratory disease. Most individuals with IVI by the 2009
pandemic H1N1 (H1N1pdm) virus experienced an uncomplicated flu. It was estimated that 75% of IVI are subclinical. However, in a small subset of patients IVI rapidly progresses to primary viral pneumonia (PVP) with respiratory failure; a minority
of patients require intensive care unit admission. Inherited and acquired variability in host immune responses may influence
susceptibility and outcome of IVI. However, the molecular nature of such human factors has remains largely elusive.
Interferon-induced transmembrane protein-3 (IFITM3) restricts virus entry and replication. It has been proposed, based in
studies with small sample sizes, that homozygosity for IFITM3 rs12252-C, is associated with a population-attributable risk of
5,4% for severe IVI in Northern Europeans (Everitt AR et al. Nature 2012) and 54,3% for severe H1N1pdm infection in Chinese
(Zhang YH et al. Nat Commun 2013).
Objectives
To assess the association of IFITM3 rs12252-C with susceptibility and severity of IVI.
Patients and Methods A total of 148 patients with confirmed IVI were considered for recruitment; 118 Spanish patients (60 of them hospitalized
with PVP) and 246 healthy Spanish individuals were finally included in the statistical analysis. PCR-RFLP with confirmation by
Sanger sequencing was performed.
Results The allele frequency for rs12252-C was found to be 3.5% among the general Spanish population, a frequency similar to that
reported for European populations in the 1,000 Genomes project data source. We found no rs12252-C homozygous individuals in our control group, nor on available data from 503 individuals in the European population from the 1,000 Genomes
project. The only Spanish patient homozygous for rs12252-C was a patient with a neurological disorder (a known risk factor
for severe flu) who suffered from mild flu. Two CC homozygous individuals with severe IVI among the thirty patients who
did not satisfy the criteria of inclusion were found. However, both patients were of Asian ethnicity, where the prevalence of
homozygosity for the variant rs12252-C is much higher (26-44 %).
Conclusions Our data do not suggest a role of this rs12252-C in the development of severe flu in our population. A recent study did not
find any rs12252-C homozygote in a group of 34 patients from UK who required ICU admission due to severe IVI. By contrast,
two rs12252-C homozygous individuals in a group of 259 Caucasian patients with mild influenza, and four in a group of 2,623
Caucasian controls who had never required hospital admission were identified.
Overall, our data do not support a role of rs12252-C in severity of IVI in Europeans. These data may have clinical relevance.
Particularly, to know whether patients homozygous for rs12252-C should be actually considered at risk of severe flu, and if
they would require individualized measures in the case of IVI.
54
55
O-051 T CELL AND NK CELL COMPARTMENT IN PATIENTS WITH IMMUNODEFICIENCY AND SEVERE VIRAL INFECTIONS
R. Ruiz García1 , R. Rodríguez Pena2 , M. J. Díaz Madroñero1 , M. Menchén1 , E. López Granados2 , J. Ruiz Contreras3 , E. Paz Artal1 ,
M. J. Castro3 , L. I. González Granados1 , L. M. Allende1 1) Hospital Universitario 12 de Octubre, Madrid 2) Hospital Universitario La Paz, Madrid 3) Hospital Universitario 12 de Octubre,
Madrid.
Introduction
Primary immunodeficiences (PIDs) are inborn errors of the immune system that predispose affected subjects to an increased
rate of infection, immune dysregulation with autoimmune disease and malignancy. A group of primary immunodeficiences
are caused by a defect in NK and/or CD8 T cells cytotoxic activity, which are the cells in charge to defeat viral infections, intracellular pathogens and tumour cells. In this work we studied the phenotype and function of T and NK cells in patients with
mutations in genes causing immunodeficiency and high susceptibility to severe viral infections.
Objectives
To study phenotype and activity of T and NK cells in patients with DOCK8, GATA2 and MUNC13-4 deficiencies and viral infections. Define biomarkers that help us to identify severe phenotypes of the same disease.
Five patients with PID were enrolled in this study. Two of them had DOCK8 mutations (one had “partial” defect and the other
had a “classic” total defect of the protein), two patients presented mutations in GATA2 gene and the last one had F-HLH
because of UNC13D mutations. The lytic capacity of NK and CD8 T cells was assessed stimulating with K562 and R69 target
cells respectively, measuring CD107a expression on effector cells (degranulation) and propidium iodide positive target cells
(cytotoxicity) by flow cytometry.
NK and T cell phenotype were studied in peripheral blood by FACS using surface and intracellular markers:
-NK cells: CD16, CD2, CD8, CD18, DNAM1, CD11a, CD11b, NKp44, NKp46, NKg2A ,NKg2D, D25, CD69, CD57, CD27, CD28,
CD127, CD95, CD57, Perforin, GZMA and GZMB. -CD8 T-cells: CCR7, CD45RA, CD27, CD28, CD127, CD95, CD57, Perforin,
GZMA and GZMB.
Results
All patients showed markedly decreased NK cytolytic activity to K562 target cells. Patients with DOCK8 mutations exerted
less CD8 cytotoxic activity than controls against R69. Phenotypically DOCK8 patients are very different, the patient with
“classic” defect showed an exhausted T cell phenotype with elevated memory and effector cells expressing CD57 and CD95
contrary to “partial” DOCK8 patient. GATA2 patients had a T an NK cell compartment with immature features (high numbers
of naïve cells, reduce lytic molecules in NK cells with elevated immature markers). Munc13-4 deficient patient presented
normal phenotype in NK and T cells according with age matched donors.
Conclusions
We observed that mutations in the same gene produced very different phenotypes as shown in DOCK8 patients. Immunephenotype could help us to identify between severe and mild forms of the same disease and a better understanding of
the immune defect. GATA2 patients seemed to present defect of peripheral maturation in NK and CD8 cells. UNC13D mutations affected NK and CD8 T-cell function preserving the phenotype.
56
O-052 CLINICAL, GENETIC AND IMMUNOLOGICAL VARIABILITY OF CHRONIC MUCOCUTANEOUS CANDIDIASIS DUE
TO NOVEL MUTATIONS IN STAT1 IN SIX PATIENTS FROM THREE KINDRED
M. T. Martínez de Saavedra Álvarez1 , I. Sologuren Marrero1 , L. Martínez Martínez2 , N. González Quevedo1 , Y. Florido Ortega1 ,
J. M. García Martínez3 , T. Español Borén4 , Ó. de La Calle Martín2 , C. Rodríguez Gallego5 1) Hospital Universitario de G.C. Dr. Negrín 2) Hospital de la Santa Creu i Sant Pau 3) Hospital Universitario de Cruces 4) Hospital
Univerisitari Vall d’Hebron 5) Hospital Son Espases
Introduction
Some patients with chronic mucocutaneous candidiasis (CMC) have no other prominent, overt clinical manifestation. This
condition is often referred as CMC disease (CMCD), which is caused by inborn errors of IL-17 immunity. Gain-of-function
mutations in the STAT1 CCD or DBD are the commonest genetic basis of CMCD.
Objectives
To study the clinical, immunological and genetic variability in with CMCD.
IL-17-, IL-22- and IFN-γ-producing T cells by intracellular FCM. IL-17A, IFN-γ, IL-2, IL-6, IL-4 production by T cells. Proliferative
responses to mitogens and Candida antigens.
Results
Patients
P1: in the first year of life she had growth delay, persistent cutaneous, oral and esophageal candidiasis, P. jirovecii pneumonia,
diarrhea by G. lamblia, and sepsis by S. faecalis. Persistent CMC, and numerous episodes of upper and lower respiratory tract
infections until last follow up (29 year-old). At the age of 17 years she was diagnosed with hypogonadotropic hypogonadism
and aortic calcification. At the age of 23 years generalized osteoporosis and aortic fibroelastoma were diagnosed.
P2: candidiasis affecting gums, tongue and lips since he was 3 years-old. Esophageal candidiasis since the age of 25 years. His
sons (P3, 6 year-old, and P4, 3 year old) presented with recurrent oral thrush since birth, and folliculitis by S. aureus.
P5 (11 year-old): oral, cutaneous and ungueal candidiasis and alopecia since the age of 5 years. Her brother (P6) presented
with isolated oral candidiasis since he was 1 year-old; esophageal candidiasis developed at the age of 21 years. Their father
has oral and esophageal candidiasis since the age of one year; alopecia developed when he was 7 years-old. Their grandfather also suffered from CMC.
Immunology
Low CD4 T cells and low/absent NK cells were observed in P1 since she was 8 year-old. No significant abnormalities of T, B and
NK cell numbers were observed in P2-P6.
Absence of IL-17A- and IL-17F-producing T cells, no IL-17A production and no proliferative responses to Candida were observed in P1 at the age of 25 years. In P2, IL-17A- and IL-17F-producing T cells and proliferation to Candida were slightly
diminished, and IL-17A production was diminished but detectable. In P5 and P6, IL-17A-producing T cells as well as IL-17A
production by T cells and proliferative responses to Candida were normal.
Genetics
P1: WES showed a novel, de novo, STAT1 mutation (p.N658S) in the C-terminal domain. A new STAT1 (pK298N) mutation in STAT1
CCD was observed in P2, P3 and P4. P5 and P6 were heterozygous for a new STAT1 heterozygous mutation in STAT1 CCD.
Conclusions
Patients with CMCD due to STAT1 mutations may present with a highly heterogeneous clinical and immunological phenotype. Unlike previously suspected, STAT1 mutations in domains other than CCD or DBD also cause CMCD. Normal values of
IL-17A-producing T cells and IL-17A production should not exclude the suspicion of CMCD due to STAT1 mutations.
57
O-053 COMPARING 3 PATIENTS INITIALLY CLASSIFIED AS CVID, WHICH, SHARING PHENOTYPIC ELEMENTS, HAVE
DIFFERENT GENETIC BASIS: LRBA, PI3KR1 AND CTLA-4 DEFICIENCIES
A. Llobell3 , M. Piquer1 , G. de Valles2 , A. Esteve-Sole1 , E. González3 , M. A. Martín-Mateos1 , J. I. Aróstegui3 , J. Yagüe3 ,
A. M. Plaza1 , L. Alsina1 , M. Juan3 , F. Casals2 1) Hospital Sant Joan de Déu, Barcelona 2) Universitat Pompeu Fabra, Barcelona 3) Hospital Clínic, Barcelona
Common variable immunodeficiencies (CVID) are the most frequent symptomatic primary immunodeficiencies in humans,
characterized by hypogammaglobulinemia, recurrent sinopulmonar or enteric infections and impaired antibody response.
Some patients develop an immune dysregulation syndrome with autoimmunity, enteropathy and/or malignancy.
New genetic findings have allowed to identify primary immunodeficiencies exhibiting these subsets of symptoms, such as
Lipopolysaccharide Responsive Beige-like Anchor Protein (LRBA) deficiency, Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4)
deficiency and Activated PI3-Kinase Delta Syndrome (APDS), as CVID-separated entities.
Here we describe and compare clinical evolution and immunological studies in three such patients: a deceased female pediatric
patient with an homozygote mutation in exon 4 coding for the BEACH domain of LRBA protein, a 13 years-old patient with a mutation in CTLA-4 gene and a 16 years-old patient with a PI3KR1 (phosphatidylinositol 3-kinase regulator 1) splice site mutation.
All three patients exhibited recurrent infections, including cytomegalovirus (CMV) infection, low or non functional immunoglobulins (requiring immunoglobulin replacement treatment), splenomegaly and/or lymphadenopathies, autoimmune
events consisting of autoimmune hemolytic anemia (AIHA) and inflammatory bowel disease, lymphopenia in 2 of the 3
cases, and two lymphoid malignancies in two cases.
Rituximab was used in the treatment of all three patients, either for the lymphoproliferative events or the AIHA. Rapamycin
was also used in two of the patients with good results.
58
O-054 GAIN OF FUNCTION MUTATION IN PIK3R1 IN A PATIENT WITH A NARROW CLINICAL PHENOTYPE OF
RESPIRATORY INFECTIONS
S. García-Gómez1 , M. T. Martínez-Saavedra2 , A. Domínguez Acosta2 , J. J. Mendoza Quintana2 , J. Poch Páez3 , G. Camps1 ,
E. J. García-Reino1 , J. Álvarez-García1 , R. Martínez-Barricarte4 , Y. Itan4 , B. Boisson4 , E. López-Collazo5 , J. Casanova4 ,
C. Rodriguez Gallego6 , R. Pérez de Diego1 1) Instituto de Investigación Sanitaria IdiPAZ, Hospital Universitario La Paz, Madrid 2) Hospital Universitario de G.C. Dr. Negrín,
Gran Canaria 3) Complejo Hospitalario Universitario Insular-Materno Infantil, Gran Canaria 4) Rockefeller Branch, The Rockefeller
University, Nueva York, EEUU 5) Instituto de Investigación Sanitaria IdiPAZ, Hospital Universitario La Paz, Madrid 6) Hospital
Universitario Son Espases, Palma de Mallorca
Introduction
Predominantly antibody deficiencies may be caused by a variety of defects that interfere with B-cell development, maturation, and/or function.
Objectives
To identify the molecular defect in a 7 year-old girl studied at the age of two years and ten months due to severe pneumonia
and hipogammaglobulinemia. She had suffered from parotitis and upper respiratory infections.
Methods
Lymphocyte subpopulations (flow cytometry). T-cell proliferation to mitogens (tritiated-thymidine incorporation). Sequencing and analysis of human exome (Agilent SureSelect). Validation of the candidate gene by PCR/Sanger sequencing analysis.
Results
The patient had a severe deficiency of IgG and IgA with high IgM levels (359-554 mg/dL). Vaccination responses were poor or
absent. The study of B cell phenotype in peripheral blood revealed low levels of B lymphocytes for age (95-320 B lymphocytes/
ml) with a high percentage of transitional B cells (48% of B cells, CD19+CD24+++CD38+++CD10++CD27-sIgM++). Initial analysis also showed a surprising high percentage (41%) of CD27+IgD- switched B cells. However, a more detailed analysis at the age
of 6 years showed that these cells were actually plasmacytoid IgM+ cells (CD19+CD38++CD24-CD27+++CD10-CD138-cIgM+sIgM-; 45% of B cells). By contrast, no activated B cells (CD19+CD21lowCD38low) and only scarce numbers of naïve B cells
(CD19+CD24+CD38+CD27-CD10-) were detected. Serum immunofixation electrophoresis, rearrangement of the IGH locus
and serum kappa/lambda ratio showed a polyclonal pattern. CD4+ T cells were normal at the age of two years, but they
diminished with age. CD8+ T cells were within normal ranges. However most CD8+ T cells showed a senescent phenotype
(CD57+CD28+CCR7-CD62L-perforin+HLA-DR+). TCRG rearrangement was polyclonal and proliferative responses to T-cell mitogens were normal. Exome sequencing analysis revealed a de novo heterozygous splice site mutation, affecting the first
nucleotide of intron 11 (g. 67589663 G>A) of Phosphatidylinositol 3-kinase regulatory subunit alpha (PIK3R1). The mutated
nucleotide is involved in a donor site for splicing.
Conclusions
Activated PI3Kδ syndrome (APDS1), due to gain-of-function mutations in PIK3CD, is associated with senescent T cells, lymphadenopathy and immunodeficiency (PASLI) disease. Two previous studies have shown that patients with heterozygous
mutations at g.67589663 in PIK3R1 present with a similar clinical and immunological phenotype (APDS2). APDS is also associated to inflammatory diseases, EBV and CMV viremia and to increased lymphoma susceptibility. However, our patient only
experienced respiratory infections. Due to the severity of APDS, early diagnosis is crucial. A careful immunological analysis of
B and T cells followed by genetic analysis may help to distinguish patients with APDS from other, less severe, predominantly
antibody deficiencies.
[PI13/1456; PI14/00616; Ramon Areces Foundation, grant XVII Concurso Nacional].
59
O-055 HIGH PREVALENCE OF COMPLEMENT C5 P.A252T MUTATION IN AFRICAN POPULATIONS: A WORLDWIDE STUDY
C. Franco-Jarava1 , D. Comas2 , M. Hernández-González1 , R. Colobran3 1) Hospital Universitario Vall d’Hebron, Barcelona, Spain 2) Universitat Pompeu Fabra, Barcelona, Spain 3) Vall d’Hebron Institut
de Recerca (VHIR)
Introduction
Complement C5 deficiency (C5D, OMIM #609536) is a rare autosomal recessive disease associated with recurrent infections
episodes, particularly meningitis by Neisseriae species. So far, the molecular basis of hereditary complement C5 deficiency
has been elucidated in 29 families with 17 different mutations described. Most of C5 mutations (13 out of 17) have been
described in only one family. The most prevalent C5 mutation described so far the p.A252T (c.754G>A). It has been recently
reported that this mutation is responsible for C5 deficiency in approximately 7% of Black African meningococcal disease
cases in South Africa. This mutation has also been reported in the SNP database (rs112959008) as part of the 1000 Genomes
Project. Unfortunately, very few samples were tested from Africa. The hypothesis is that this mutation may have arisen many
years ago in Central Africa and spread as tribes migrated. As a result, patients homozygous for the mutated allele could occur
elsewhere in Africa and other communities, playing a role in susceptibility to meningococcal disease.
Objectives
The aim of the study is to investigate whether the prevalence of the mutated c.754G>A allele in C5 gene is higher in African
population than in other communities.
A custom SNP genotyping assay was designed in order to identify the genetic status of C5 p.A252T in 2551 worldwide DNA
samples using qPCR. Controls for all genotypes were used in every plate. All samples identified as carriers of p.A252T have
been sequenced to confirm the presence of the mutation.
Results
The screening of p.A252T mutation has been carried out in the 1048 individuals included in the Human Genome Diversity
Panel, in 796 samples from North African population, and in 352 individuals from Gabon. Moreover, 526 samples from local
population were also studied. To give a more general view of the worldwide distribution of the mutation, all the individuals
studied have been pooled into seven broad continental regions. Only two continental regions contained individuals with
the mutation. South Saharian Africa region was the one with highest incidence; 10 out of 479 individuals carried the genetic
variant (2.09%), followed by Middle East and North Africa region, which contained an individual carrying one allele variation
(n=946; 0.1%). The mutation was absent in the rest of regions studied. Globally; 11 of the 2551 samples studied carried the
mutation in heterozygosis (0.43%).
Conclusions
The results obtained in this study support the previous hypothesis which suggested that the mutation p.A252T may have arisen many years ago in Central Africa and spread by migration. The importance of this fact is remarked in the cases of patients
from these countries presenting with invasive meningococcal disease, who might be strongly recommended to have their
complement function evaluated in order to rule out a now more feasible primary immunodeficiency.
Project financed by PI14/00405
60
O-056 PID: COMPLEX GENETIC DIAGNOSIS AND ITS METHODOLOGIC APROXIMATION
M. Bravo García-Morato1 , E. Vallespín García1 , J. Nevado Blanco1 , M. Á. Mori Álvarez1 , L. Fernández García Moya1 , D. Plaza
López de Sabando1 , A. Méndez Echevarría1 , T. del Rosal Rabes1 , L. del Pino Molina1 , A. Ferreira Cerdán1 , E. López Granados1,
R. Rodríguez Pena1
1) Hospital Universitario La Paz, Madrid
Introduction
Mutations in more than 250 genes have been described as causative of primary immunodeficiencies (PID). The majority of
these mutations are point changes, reason why sequencing assays are the first choice strategies for genetic diagnosis of
PID. But there are situations where these methodologies are insufficient to reach conclusive results, being indispensable to
perform exhaustive genetic studies according to the complexity of the case.
Objectives
We present three cases where infrequent genetic assays were necessary to reach the diagnosis.
NGS was performed using a customized panel of our own design. CGH and SNP arrays were designed and performed in our
hospital. The expression of intracellular BTK was determined by flow cytometry set up in our lab.
Results
Patient 1 is a six years old female who presents recurrent respiratory infections since the age of three. On the last year she has
had pneumonia and giardiasis. The immunological study showed a profound hipogammaglobulinemia with nearly absent B
lymphocytes on peripheral blood. A heterozygous nonsense mutation in the BTK gene was found. Flow cytometry confirmed
the complete absence of BTK protein expression in her monocytes and B lymphocytes. An X chromosome inactivation assay
showed a 100% skewed inactivation of the wild type BTK- X chromosome.
Patient 2 is a fourteen years old male with a medical history of severe autoimmune manifestations, among others, collected
in the following table: Age, years
1
2
7
9
14
Clinical findings
Diabetes Mellitus.
Autoimmune hypothyroidism.
Autoimmune atrophic gastritis.
Autoimmune haemolytic anemia.
Autoimmune haemolytic anemia, neutropenia.
Lymphoproliferative episode.
Other: recurrent respiratory infections, mental and growth retardation.
Sanger sequencing revealed a point mutation in the CASP10 gene and CGH array showed a 4Mb heterozygous deletion
on chromosome 2, which included the CTLA4 gene. These results led to the diagnosis of lymphoproliferative autoimmune
syndrome types IIA and V.
Patient 3 is a nine month old male with bronchiolitis and splenic abscesses where C. parapsilosis has been isolated. After confirming the diagnosis of chronic granulomatous disease, an homozygous missense mutation in the CYBA gene was detected.
Parental study showed that his mother was a carrier of the mutation while his father was wild type. NGS revealed a big 100%
homozygous region on chromosome 16, compatible with partial uniparental disomy. SNP array has just been performed to
confirm this hypothesis. Conclusions
Genetic diagnosis of PID must be adapted for each patient to ensure a conclusive result. Thus, X-linked disorders shouldn’t
be discarded in females with a suggestive phenotype and suitable assays for detecting deletions should be considered, especially in patients who have clinical findings beyond immunological features. Uniparental disomy must also be considered
in cases where parental segregation does not correlate with the patient mutation. 39 Congreso de la Sociedad Española de Inmunología
61
O-057 LENTIVIRAL VECTORS RECONSTITUTE CELLS FROM PATIENTS WITH ATAXIA-TELANGIECTASIA
D. Carranza1 , S. Torres-Rusillo1 , G. Ceballos1 , I. J. Molina1 1) Universidad de Granada
Introduction
Ataxia-Telangiectasia (AT) is a multisystemic disease with severe neurological affectation, immunodeficiency and telangiectasia. Affected patients suffer from progressive cerebellar degeneration but the immunodeficiency tends to
remain steady over time. Another hallmark of the disease is the extreme radiosensitivity. The autosomal recessive disorder is caused by mutations in the large ATM gene, which spans over 150 kB in the genome and comprises 66 exons
that give rise to a cDNA of 9.3 kB. The encoded protein has a molecular weight 370 kDa, and plays critical roles in the
molecular processes leading to DNA repair and genome stability. Because no effective treatments are currently available, gene therapy arises as an attractive possibility but the large size of the transgene has hampered previous attempts.
Objectives
We intended to determine whether or not lentiviral vectors expressing a normal ATM minigene can reconstitute molecular
and functional defects of cells derived from patients with AT.
We constructed a third-generation self-inactivating lentiviral vector containing a full-length ATM cDNA and transduced
ATM-deficient immortalized Human Foreskin Fibroblasts. Vector integration was determined in genomic DNA and mRNA
levels by RT-qPCR. Protein expression was assessed by Western Blotting, flow cytometry and confocal microscopy. ATM functional activity was studied after cellular irradiation.
Results
Transduction of ATM-deficient cells with the ATM-lentiviral vector resulted in a population where integration of 0.6 vector copies per cell allowed expression of native ATM that was readily detected in about 20% of the transduced population. Upon
irradiation, ATM became phosphorylated at residue 1981 Ser as revealed by Western Blot and ATM foci formation by confocal
microscopy, thereby indicating that the expressed protein was functional. Other evidence supporting the restored activity was
obtained from phosphorylation of p53, a downstream ATM direct substrate, and histone ϒ-H2AX as indicator of reconstitution
of the cell repairing capacity of the transduced population upon irradiation. Furthermore, the severe radiosensibility of cells
from A-T patients was reversed upon transduction up to levels that were similar of cells derived from normal individuals.
Conclusions
Our data demonstrate that third-generation lentiviral vectors are able to efficiently pack viral particles that can restore
ATM-related functions in patient cells. Although viral titers and number of vector copies per cell were relatively modest, they
were nevertheless enough to rescue patient’s cells from disease-related defects. Unlike previous attempts to demonstrate
thereby paving the way for a gene therapy clinical trial in humans.
62
O-058 HUMAN DOCK2 MUTATIONS UNDERLIE A NOVEL, PLEIOTROPIC IMMUNODEFICIENCY SYNDROME WITH EARLY
ONSET, INVASIVE INFECTIONS
C. Domínguez Conde1 , K. Dobbs2 , S. Zhang3 , S. Parolini6 , J. Casanova3 , L. D. Notarangelo2 , K. Boztug1 1) CeMM Research Center for Molecular Medicine 2) Boston Children’s Hospital 3) St. Giles Laboratory of Human Genetics of Infectious
Diseases 4) Laboratory of Human Genetics of Infectious Diseases 5) Imagine Institute 6) University of Brescia 7) Medical University
of Vienna
Introduction/Objectives
Congenital defects of immunity can manifest with increased susceptibility to life-threatening infections and/or immune dysregulation. Defining the molecular cause of these diseases is a fundamental step towards understanding their pathogenesis
and rationalizing therapeutic strategies. Methods and Methods/Results
Using homozygosity mapping and exome sequencing, we identified bi-allelic deleterious mutations in DOCK2, encoding
thendedicator of cytokinesis 2, as the molecular etiology of a novel immunodeficiency syndrome in five unrelated patients. DOCK2 is a guanine exchange factor for the small GTPase RAC1 and is involved in the control of actin dynamics.
Analysis of patients’ lymphocytes showed impaired Rac1 activation and decreased levels of F-actin as well as abrogated lymphocyte motility and NK-cell degranulation. Furthermore, antiviral immunity, including type I and III interferon responses,
was defective in patient cells.
Conclusions
These results pinpoint a central role for DOCK2-dependent pathways in human immunity, emphasizing the importance of
actin dynamics and other Rac1-dependent pathways in immune homeostasis. Ongoing investigations employing pull-down
proteomics aim to define the cellular context of DOCK2.
63
O-059 GENETIC DIAGNOSIS AND EXTENDED IMMUNOPHENOTYPE IN PATIENTS WITH ACTIVATED PI3KΔ SYNDROME
(APDS) CAUSED BY MUTATIONS IN THE PIK3R1 GENE
M. Martínez Gallo1 , M. García Prat2 , A. Martin Nalda2 , P. Soler Palacín2 , F. Rudilla3 , R. Pujol Borrell1 , R. Colobran1 1) Hospital Universitari de la Vall d’Hebron 2) Hospital Universitari de la Vall d’Hebron 3) Banc de Sang i Teixits
Introduction
A new primary antibody deficiency caused by hyperactivation of the PI3K signaling pathway was described in 2014, consisting
of two closely related entities: one is caused by gain-of-function mutations in PIK3CD encoding for the p110δ subunit resulting
in “Activated PI3Kδ Syndrome 1” (APDS1) and the other is caused by an activating heterozygous splice site mutation in PIK3R1,
which encodes the p85α, p55α, and p50α regulatory PI3K subunits, resulting in “Activated PI3Kδ syndrome 2” (APDS2).
Objectives
Our aim was to diagnose two patients with ALPS-like phenotype in our center.
Blood count, advanced immunophenotype study in peripheral blood was performed by flow cytometry following FITMaN
protocol. Genetic studies included targeted gene sequencing using the TruSight One Sequencing Panel (Illumina) and confirmation by Sanger sequencing.
Results
Patient 1 (P1) is a male with clinical onset at the age of 18-months. The patient suffered viral infections by EBV, CMV, HPV and
Molluscum contagiosum. He also suffered lymphoproliferation with persistent lymphoadenopathy, hepatomegaly, enteropathy and short stature for age. Patient 2 (P2) is a 15 years old male with clinical onset at the age of 9 years with short stature
for age who suffered respiratory infections including two episodes of pneumonia, acute viral infection (mumps) and chronic
viral infection by EBV, CMV and rubella. Also he suffered lymphoproliferation with persistent submaxilar, axillary and inguinal
lymphoadenopathy and splenomegaly. Initially, FAS and XIAP (P1) and FAS and MAGT1 (P2) were sequenced by Sanger without
any significant result. P1 was subjected to the so-called “clinical exome” sequencing and a heterozygous splice site mutation
(c.1425+1G>A) in PIK3R1 gene was detected. This mutation had been recently described as causative of APDS2 by a partial failure of the regulatory activity of p85α (i.e. causing a dominant activation of PI3K). Then we screened for this mutation several other
patients with ALPS-like phenotype and without positive genetic diagnosis and P2 carried the same c.1425+1G>A mutation in
PIK3R1. Extensive immunophenotyping of both patients showed high numbers of transitional B cells (IgD+CD27-CD38+CD24+)
with low levels of pre-switch memory (IgD+CD27+) and switch memory B cells (IgD-CD27+). In the T cell compartment they
have a skewing of peripheral blood CD8+ T cells toward terminally differentiated effector cells.
Conclusions
While activating mutations of PIK3CD shares clinical features with common variable immunodeficiency (CVID), the gain-offunction mutation in PIK3R1 shares it with autoimmune lymphoproliferative syndrome. The emergence of these new entities
may require to reassess some of the patients now classified as CVID and ALPS without a definitive molecular diagnosis. 39 Congreso de la Sociedad Española de Inmunología
64
O-060 INNOVATIVE TEACHING: THE NEW ACADEMY OF DISTANCE EDUCATION IN CLINICAL IMMUNOLOGY
J. Carbone Campoverde1 , J. Pérez Rojas2 1) Hospital General Universitario Gregorio Marañón. Universidad Complutense de Madrid. Madrid. Spain 2) Hospital Guillermo
Almenara. Universidad Nacional Mayor de San Marcos. Lima. Peru
Introduction
Education is being reshaped by advances in technology including mobile devices, the ability of technology to reach thousands of distance learners, and the widespread use of social media. Universities must confront challenging questions on how
to maintain course completion revenue. In order to remain competitive, institutions of higher education need new tools and
agile staff that can attract and retain students with innovative, online teaching. Objective
To report on an innovative online teaching experience of Clinical Immunology conferences to physicians of a Post-Graduate
training program in Clinical Immunology in Lima-Perú.
Methods
In December 2014, 2 direct conferences were delivered to physicians of the Post-Graduate training Program in Clinical Immunology at the Universidad Nacional Mayor de San Marcos, Medicine Faculty in Lima-Perú. Duration of each conference was
1 hour. Program: Module 1. Immune monitoring to detect risk of infection in patients under immunosuppressive therapy.
Module 2. Pathogenesis of autoimmune diseases. Methodology: Power point slides. Conferences were delivered online by
Skype. Students were present in direct connection with the expert at the Hospital General Universitario Gregorio Marañón
in Madrid and were allowed to ask questions during and after the conference.
Results
The 2 conferences were delivered as scheduled. After 30 minutes of exposition, participants asked questions to the expert
during additional 30 minutes. Evaluation of the activity was performed by the spanish and peruvian coordinators after the
activity. The results of the evaluation were satisfactory. The activity has been included in the Syllabus of the Clinical Immunology Post-Graduate Program.
Conclusions
Live Clinical Immunology Teaching Via Skype is suitable for training specialists in other countries. Students can build on their
present knowledge and improve their skills.
65
O-061 PERCEPTION OF THE UTILITY OF TRAINING ACTIVITIES BY STUDENTS OF SECOND OF MEDICINE
P. Aparicio, G. Rubio
1) Universidad de Murcia
Introduction
Different teaching tools are used in classes without any certainty about the student perception regarding its usefulness
Objectives
Knowing the perception of the usefulness of different training activities along the course by students and the correlation of
the different training activities with the the final exam mark.
A survey was passed to students during a seminar whose attendance was mandatory where they valued the usefulness of
lectures, periodic tests (in which they are allowed to consult books and notes), problem solving seminars, Academically Directed Work (ADW) and laboratory practices. The analysis was done by using correlation coefficient. Results were compared
with surveys runned in the last three years.
Results
One hundred and twenty-two of the 182 students who were presented at the final exam attended all training activities.
Periodic test, ADW and problem solving seminars were considered more useful than theoretical classes. Practical work were
percived as the least useful activity. Scores of every activity were positively correlated with final exam marks. Periodical tests
had the highest correlation while team work marks had the lower. Class attendance correlated weakly with theory final score.
Bibliographical consultation allowance during tests was highly appreciated by students, even when it was limited to the last
thirty minutes.
Conclusions
Participatory assessment tasks are perceived as much more useful than lectures or laboratory practices.
66
O-062 IMMUNOMEDIA PROJECT: CINE-FORUM AS A LEARNING ACTIVITY IN THE IMMUNOLOGY FIELD
A. Corell
1) Inmunología, Universidad de Valladolid
In the ICTs era, the universities have novel roles (using social media, designing multimedia materials among others). In this
context, the Inmunomedia project (with the participation of 5 Universities from Spain, France and Portugal) try to fill some
needs and gaps in the lecturing of Immunology, mainly, in Biomedical degrees.
The project has been structured in 7 axis: first “Developing and disseminating high quality minivideos” on Immunology, under
the name “Inmunepills” (youtube) with a high impact (>800.000 views) among Spanish-speaking universities; second “Collecting, selecting and tagging OAMs and other lecturing materials” (“Content Curation”) onto boards which provide students and
lecturers with useful information, verified and organized by modules. Among the used content curation tools, “Scoop.it” and
Pinterest gave the greatest impacts; third “involving actively the students into their learning process” and collaborating among
universities with the “University Journal of Immunology, Immunopatology and Immunotherapy”: the students tweet relevant
immunology news using #hashtags, which are tracked and generate a journal at “Paper.li”; fourth, “Opening the University to
all the people” by developing multimedia materials in immunology and disseminating them on social media, patients associations and public places (video collection “Defences’Channel” at YouTube); fifth, universalising the materials by subtitling the
Immunepills into Spanish (for deafs), English and French or dubbing them into Portuguese; sixth, developing and designing
a gamification approach to assess learning success at different levels and with an interactive interface between students; and
finally, developing an Immunomedia site to connect all the material, activities, lecturers and students.
One of the activities developed in the project was the use of cine-forums as a new learning method for better understanding
the AIDS, in the subject of secondary immunodeficiencies. The use of a specific film “And the band played on”, and its results
will be presented and discussed.
67
O-063 SUMMARY OF THE DIVULGATIVE ACTIVITIES IN IMMUNOLOGY, DEVELOPED DURING THE YEAR 2015 IN THE
PROVINCE OF MALAGA
F. Fariñas Guerrero
1) Institute of Clinical Immunology and Infectious Diseases; Group Institute of Clinical Immunology and Cell Therapy (IMMUNESTEM)
Throughout the year 2015, we have developed several divulgative activities for differents collectives that included students
of secondary education, patients´ associations (Sjögren Syndrome, Crohn/Ulcerous Colitis, Fibromyalgia /Chronic Fatigue Syndrome), and many conferences for the general public, in places as the “Aula Cultural de El Corte Inglés” and the “Asociación
de amigos del País”. These activities were based on the emission of documentaries, conferences, seminars and “theatrical
activities”, the last with the students making a stage version, showing the functioning of the immune system in a funny way.
Also, these students received a copy of the book “The mysteries of the immune system” edited by the SEI.
The main topics of these activities were:
. How defenses work and its importance in our daily life
. Autoimmune diseases
. Immunodeficiencies in children
. Reproductive Immunology
. Immunologic treatments in cancer: the new hope
. Nutrition, immunity and health (The science of Immunonutrition)
. Stress, depression and the immune system (Psychoneuroimmunology)
. Metabolic Inflammation: the silent killer
. Vaccines in children
. Immunity in old people: the immunosenescence
Some of these activities were done with the collaboration of professionals from other centers like the Unit of Immunodeficiencies and Infectious Diseases of Maternity and Children´s Public Hospital, the Unit of Pediatrics of Xanit Hospital and the
Center for Reproductive Medicine IVI (delegation of Málaga).
The total number of assistants was around 1250 people, with ages between 14 and 75 years. Also, during the past 2015, we
have done a hard work publishing several books. One of these is destined to the general public and titled “In self defense:
adventures and misfortunes of the immunologic system”, which will be published in the next months.
68
O-064 FEASIBILITY OF AN EXTERNAL ROTATION IN THE PHARMACEUTICAL INDUSTRY FROM THE RESIDENCE IN
IMMUNOLOGY PROGRAM
F. Gallego Bustos 1, M. Guzmán Fulgencio 2, L. M. Allende 1, P. Morales1, D. Pleguezuelo1, A. Serrano 1, J. L. Subiza 2 , E. Paz Artal 1
1) Servicio de Inmunología, Hospital Universitario 12 de Octubre, Madrid 2) Inmunotek SL, Madrid
As immunology resident in the hospital (third and fourth year), it is possible to perform an external rotation in an accredited
teaching national or international center. Rotation can have different purposes: expansion of knowledge, research, or to
learn techniques or clinical areas not available in the hospital of origin. Given the large volume of human and veterinarian
disease whose pathophysiological substrate is related to the immune system, there is huge interest in the pharmaceutical,
food, and biotechnology industries to develop drugs, probiotics and other therapeutics based on its modulation. All this
constitutes a wide field for learning during immunology residence and of professional opportunities as future specialists in
immunology. We present here the first experience, as far as we know, of rotation in a pharma/biotech company for a graduate performing the Immunology residency program in a hospital.
After obtaining approval from the Residence Program Board in the hospital and the Health Ministry, the company Inmunotek, a manufacturer of allergy and bacteria vaccines, and other products, accepted the rotation. It is a national medium size
biotechnological company with innovative and research-based products developed during the last 20 years that now are
marketed in more than 30 countries. The rotation was performed through different departments (Medical, R&D, Raw Material, Quality Control, Marketing and Quality Assurance).
It has certainly been an enriching rotation that allows to know and understand what is behind the design and manufacture
of an immunological medicine and to get a real feel of what an immunology laboratory drug maker means, as opposed to a
hospital immunology lab for clinical diagnosis.
This type of rotation in the pharmaceutical industry, according to our information, is unprecedented and represents a valuable opportunity to explore for residents with an interest in the industry.
69
O-065 IMMUNOLOGY COMICS! A FUN AND EFFICIENT SCIENCE COMMUNICATION TOOL
Jesús Sánchez Ruiz
Introduction
The Immunology field is growing in notoriety each day. Every single aspect of our daily life is influenced by our immune
system to some degree, and several of the most promising therapies against many diseases -including cancer- involve modifications of the behaviour of our immune cells. However, the complexity of immunological processes makes it difficult to
fully understand and follow the advances in this field. This issue applies not only to the general population, but also to not
immunology-specialist professionals and, hence, new communication approaches are needed.
Complex and rigid explanations of scientific principles tend to increase distance to the general audience, while too flashy and
scientifically loose communication attempts can confuse and even transmit wrong messages. Here, we propose the use of comics and animations as efficient scientific communication tools for the general population and even life sciences professionals.
In contrast to common perception, comics do not only entertain children and teenagers. In fact, cartoons have long been
used as tool to communicate political and social restlessness, or to develop complicated stories in plot and emotions. Little
by little, comics and cartoons are gaining importance as a means to explain complex scientific facts in an entertaining but
accurate way.
Objectives
We launched a science communication project based on illustrating and explaining immunology via comics and animations.
Our approach includes an online comic platform (www.alymphslife.com) as well as talks and workshops for a broad spectrum of audiences. The focus of this project is to provide an easy access to immunological contents for the general population and life science professionals not specialized in immunology.
Results
In this oral communication we will present the details of the project and its development over the past 3 years since its initiation. Further, we will give selected examples of immunology comics or animations and illustrate our future plans and aims.
70
O-066 IMMUNOLOGY TEACHING IN THE SPANISH UNIVERSITIES
María Martínez-Esparza
1) Universidad de Murcia
Introduction
The entry into the European Space of Top Education, was an excellent opportunity to strengthen the discipline of immunology in the Spanish academic panorama. In this respect, during the Immunology meeting held in February 2008, the SEI
reached a consensus in the proposal of Immunology subject´s distribution in the new university degrees. Monitoring the
implementation of the degrees approved by the ANECA until March 2009, revealed a slow pace and uneven distribution
both in ECTS credits as well as in the courses with Immunology subjects (Muñoz-Ruiz and Regueiro, 2009).
Objectives
This paper aims to make an updated picture of Immunology teaching in graduate studies offered by the Spanish universities.
For this purpose the websites of the different universities were consulted and the following information were registered:
name of the subject, number of ECTS, type of subject, course, teaching guide when available, degree in which it is offer, areas, number and type of contracts of teachers involved, university name and type, and geographic location of the university.
These data were compared with the previously published ones to assess the evolution of the analyzed parameters.
Results
The data obtained showed the growing of the Immunology after the implantation of the different degrees in the Spanish
university. The increase in the Immunology teaching registered, varies depending on the university degrees and geographical location. The staff of Immunology area, which had begun to grow thanks to the implementation of the official accreditation under RD 1312/2007, has continued growing more slowly than expected due to the economic cuts and restrictions
applied to the universities in the last years.
Conclusions
The current situation of teaching in Immunology shows an improvement in recent years, which it is expected to continue in
progress, although there are still pending proposals for concrete improvements.
71
O-067 PROMOTING AUTONOMOUS AND COOPERATIVE LEARNING IN IMMUNOLOGY
E. Martínez-Naves, E. Lafuente
1) Inmunología. Facultad de Medicina. Universidad Complutense.
Introduction
Most common forms of teaching and learning in our Universities still rely heavily on traditional methodologies such as the
master classes in which the students, in a mostly passive way, take notes, accumulate knowledge and finally they transfer
this knowledge into a test. We think that a change is needed in the focus from the teacher to the student in order to develop
more competent, autonomous and motivated learners.
Objective
Our goal was to develop teaching and learning techniques aimed to foster autonomous and cooperative learning skills in
Higher Education in Immunology.
Materials and Methods.
Our department decided to introduce a partial modification of the teaching methodology on the compulsory course “Immunology” (6 ECTS credits) within the degree of Medicine. The course is attended each year by about 400 students and consists
of lectures explained in four groups of 100 students. In addition there are complementary activities, which are made in
smaller groups (25-30 students), which include laboratory and virtual (computer based) practices as well as seminars. In our
previous organization, seminars were taught by teachers trying to promote student’s participation without much successes.
Results
In the academic year 2011/12 we decided to include several changes in the seminars. Each group of seminars was further
divided into working groups of 3-4 students each. The topics would be selected by the students according to their interests,
for example news in the media, advertisements for products that act on the immune system, personal experiences, etc.
The seminars are developed along 3 different sessions (days). In the first session, each working group proposes at least two
topics for discussion during which they have to convince their peers about the interest and relevance of the subject. At the
end of this session the students select from all items proposed those who believe most interesting or relevant to its further
development. In the second session each working group presents one of the issues that were picked in the first session. The
teacher and all the students present in the classroom engage in an open discussion, in order to improve the presentation by
the working group. In the third and final session the students show they definitive presentation and answer questions and
comments that other students or the teacher raise. They should also give the teacher a written summary of their presentation. Professor scores each group based on the quality of the work as a whole. Each student also get a score based on the
quality of his or her performance along all the seminar’s sessions. We will show a summary of some representative presentations made by the students.
Conclusions
The seminars activity as a whole has been very well received by both teachers and students. It improves skills and abilities
such as teamwork, autonomous and cooperative learning as well as critical thinking. It is easy to implement, does not require
further funding and it enhances teacher-student relationships.
72
O-068 COMPARATIVE PROTEOMICS OF EXOSOMES SECRETED BY TUMORAL JURKAT T CELLS AND NORMAL HUMAN T
CELL BLASTS UNRAVELS A TUMORIGENIC ROLE FOR VALOSIN-CONTAINING PROTEIN
A. Bosque Pardos1 , L. Dietz2 , A. Gallego Lleyda1 , M. Sanclemente Cidón1 , M. Iturralde Navarro1 , J. Naval Iraberri1 , M. A. Alava
Martínez de Contrasta1 , L. Martínez Lostao1 , H. J. Thierse2 , A. Anel Bernal1 1) Universidad de Zaragoza/Instituto de Investigación Sanitaria de Aragón (IIS-Aragón) 2) Ruprechts-Karls-University, Heidelberg
Introduction
Exosomes are small vesicles present inside multivesicular bodies (MVB) that differ from intracellular compartments as endosomes and lysosomes. They are characterized by a particular lipid and protein composition, and a size between 40 to 100 nm.
We have previously characterized that FasL and Apo2L/TRAIL are stored in their bioactive form inside human T cell blasts in
exosomes present in MVB. These exosomes are rapidly released to the supernatant upon re-activation of T cells. Proteomic
analysis of exosomes has been done in several cell types and biological fluids, but few systematic studies are available comparing proteomics of exosomes produced by tumoral cells with their healthy cell counterpart.
Objectives
In this study we have compared exosomes produced by normal human T cell blasts with those produced by tumoral Jurkat
cells to identify proteins expressed in tumoral exosomes and characterize their possible tumorigenic role.
Exosomes secreted by normal human T cell blasts or from tumoral Jurkat cells after a PHA pulse were isolated from supernatants by several clearing, centrifugation and ultracentrifugation steps and proteins associated with them characterized by
the following techniques:
- Immunoelectron microscopy
- Immunoblot
- 2D separation and spot identification by mass spectrometry (MALDI-TOF)
- Liquid chromatograpy followed by mass spectrometry (LCMSMS)
The effect of increasing concentrations of the valosin-containing protein (VCP) inhibitor DBeQ on viability of Jurkat cells or
of PBMC or T cell blasts was analyzed by the MTT and Trypan blue methods.
The effect of DBeQ on the secretion of exosomes from Jurkat cells of from T cell blasts was tested using a bioassay against
non-activated Jurkat cells.
Results
We have identified 359 and 418 proteins in exosomes from T cell blasts and Jurkat cells, respectively. Interestingly, only 145
(around a 40%) are common. The major proteins in both cases are actin and tubulin isoforms and the common interaction
nodes correspond to these cytoskeleton and related proteins, as well as to ribosomal and mRNA granule proteins. On one
hand, T cell blast exosomes were enriched in “cluster of differentiation (CD)” immune membrane proteins, and those were
mostly absent from Jurkat exosomes. On the contrary, 14 membrane proteins were present only in exosomes from Jurkat
cells and could have a previously non-described role in malignancy. The most abundant of these proteins was valosin-containing protein (VCP), a membrane ATPase involved in ER homeostasis and ubiquitination. In this work, we also show that
Jurkat tumoral cells are more sensitive to cell death induced by the VCP inhibitor DBeQ than normal T cells. Furthermore, VCP
inhibition prevents functional exosome secretion only in Jurkat cells, but not in T cell blasts.
Conclusions
These results suggest VCP targeting as a new selective pathway to exploit in cancer treatment as a first application of our
proteomic study.
73
O-069 DRUG-INDUCED HYPERPLOIDY STIMULATES AN ANTI-TUMOR NK CELL RESPONSE MEDIATED BY NKG2D AND
DNAM-1 RECEPTORS
A. Acebes-Huerta1 , S. Lorenzo-Herrero1 , A. R. Folgueras2 , L. Huergo-Zapico1 , M. Villa-Álvarez1 , A. López-Soto1 , S. González1 1) Universidad de Oviedo 2) Universidad de Oviedo
Introduction
Formation of polyploid or aneuploid cells is a pathological hallmark of malignant tumors. Cell cycle checkpoint mechanisms
play a crucial role in ensuring genomic integrity during mitosis, avoiding the generation of aneuploid cells. Additionally,
cancer cell DNA ploidy is subjected to extrinsic controls operated by activation of adaptive immune responses mediated by
T cells.
Objectives
Activated NK cells are capable of killing a broad range of cancers and of regulating the innate and adaptive immune responses through the secretion of cytokines, such as IFN-γ. Despite the relevance of NK cells in cancer immunosurveillance, the
mechanisms involved in their activation against cancer cells remain to be fully elucidated. In this study, we try to elucidate if
NK cells are also involved in this novel immunesurveillance mechanism against hyperploid cancer cells.
Cell hyperploidy was induced by treatment tumor cell lines with several anti-mitotic drugs such as cytochalasin D, nocodazole or docetaxel for 48 hours. Then, hyperploid tumor cells were co-cultured with immune cells (isolated from healthy donors)
in order to evaluated the activation of immune responses against cancer.
Results
We report that drug-induced polyploidy in cancer cells activates anti-tumor responses mediated by NK cells. Thus, hyperploidy-inducing chemotherapeutic agents strongly up-regulate the tumor expression of ligands for the NK cell activating
receptors NKG2D and DNAM-1. Drug-induced hyperploidy modulated the repertoire of activating receptors and the cytokine profile of NK cells, rendering tumor cells more susceptible to NK cell-mediated lysis through the activation of NKG2D
and DNAM-1 receptors. In addition, hyperploidization stimulated the production of IL-2 by CD4 T cells, which induced NK
cell proliferation and activity. The stimulation of MICA, a key NKG2D ligand, in hyperploid cells was mainly mediated by ATM
protein kinase. Likewise, pharmacological inhibition of key regulators of endoplasmic reticulum stress in certain cell models
supports a role for this pathway in NKG2D ligand up-regulation.
Conclusions
Our findings indicate that, besides the cytotoxic effect on tumor cells, the therapeutic activity of anti-mitotic drugs may be
mediated by the induction of a coordinated an anti-tumor immune response involving NK and T cells.
74
O-070 REGULATION OF SOLUBLE NKG2D LIGANDS IN ACUTE MYELOID LEUKEMIA
A. Baragaño Raneros1 , B. Suárez Álvarez1 , A. Minguela Puras2 , C. López Larrea1 1) Hospital Universitario Central de Asturias 2) Hospital Virgen de la Arrixacá-IMIB
Introduction
The activating receptor NKG2D expressed on NK, NKT, γδT and αβ CD8+ T cells, recognizes different ligands (MICA/B and
ULBPs1-6) on the cell surface leading the lysis of target cells. High expression levels of NKG2D ligands (NKG2DL) promote
the immunerecognition of target cells. However, tumor cells have developed several mechanisms to evade the immune
response. One of these mechanisms is the release of soluble NKG2DL (sNKG2DL) from the cell surface promoting the NKG2D
downregulation and thus, the tumoral evasion.
Objectives
Here, we analyze the regulatory mechanisms involved in the release of sNKG2DL in acute myeloid leukemia (AML) and its
modulation by demethylating agents in order to increase the immune response against AML cells.
AML cell lines (HL60, KG1a and NB4) and a cohort of 61 AML patients were used in the study. AML cell lines were cultured
with 5-aza-2’-deoxycitidine (DAC) and sNKG2DL were quantified by ELISA. ADAM10, ADAM17 and TIMP3 expression was
analyzed by qRT-PCR. GW280264X and GI254023X treatments were used to inhibit ADAM17 and ADAM10, respectively.
ADAM17 activity was analyzed by a fluorimetric assay and specific siRNA was used to blockage the TIMP3 expression. Pyrosequencing was performed to define the methylation pattern of TIMP3 in AML cells lines and patients. Cytotoxicity ability
was performed by cytotoxicity assays using NKL cell line as effector cells.
Results
Treatment of AML cell lines with DAC reduces drastically the presence of sNKG2DL (sMICA/B, sULBPs1-3) in cell culture supernatants. Consequently, this leads to a higher lysis of AML cells by NK cells in the absence of soluble ligands. After, we
determined the effect of DAC in the expression of ADAM10 and ADAM17 metalloproteases, which had been involved in the
shedding of sNKG2DL. Results show an increase of the ADAM10 and ADAM17 expression after treatment suggesting that
these proteases could be regulated by methylation. However, treatments with specific inhibitors for ADAM10 and ADAM17
show that only ADAM17 is able to regulate the sNKG2DL release in AML. In agreement with this, analysis of ADAM17 activity
reveals that after DAC treatment the activity of this protease is diminished suggesting that the decrease of sNKG2DL after
treatment could be due to a decrease in the ADAM17 activity. In addition, we observe that TIMP3 expression, an inhibitor of
ADAM17, is also upregulated after DAC treatment and silencing of TIMP3 restore the release of sNKG2DL. We demonstrate
that TIMP3 is hypermethylated in AML cell lines and some (33%) AML patients.
Conclusions
Our results suggest that the hypomethylating agents, such as DAC, could regulate the release of sNKG2DL trough modulation of ADAM17 and TIMP3 activity. Controlling the balance between ADAM17 and TIMP3 through methylation could be
useful as a therapeutic strategy to control the release of sNKG2DL in AML avoiding the evasion of the immune response.
This work was supported by the Instituto Carlos III (FIS PI12/02587) and FICYT (GRUPIN14-030). 39 Congreso de la Sociedad Española de Inmunología
75
O-071 NOVEL FUNCTIONS OF EPIGENETIC CHANGES CONTRIBUTING TO THE MIGRATION OF ACUTE LYMPHOBLASTIC
LEUKAEMIA CELLS
X. Zhang1 , P. C. Cook2 , E. Zindy4 , C. C. Williams3 , T. A. Jowitt4 , J. Redondo-Muñoz4 1) University of Manchester 2) University of Manchester 3) University of Manchester 4) University of Manchester
Introduction
T-Acute Lymphoblastic Leukaemia (T-ALL) originates from neoplastic T cell precursors in the thymus. T-ALL cells have to
migrate to the bone marrow and disseminate into different tissues and the nuclear deformability of these cells is necessary
in order to migrate through narrow tissue spaces. Epigenetics is a novel cancer hallmark that leads a new drug generation
to prime cancer cells to death. Epigenetics comprises histone modification, histone variants and DNA modifications, which
regulate chromatin structure without affecting the DNA sequence. Some histone modifications, such as H3K9me3, are connected with more invasive phenotype in several human cancers. However, the mechanisms linking integrins and nuclear
chromatin and how they control nuclear deformability are unknown.
Objectives
Explore how cell-matrix interactions through α4β1 integrin control H3K9me3 levels that regulate, in a transcriptional independent manner, the nuclear plasticity and migration of ALL cells.
We used primary normal CD4+ T lymphocytes and Jurkat (T-ALL cell line) cells. We generated stable Jurkat depleted of SUV39H1 or G9a (two enzymes that catalyse H3K9 methylation) by shRNA letiviral vectors. We analysed the nuclear deformability by a multidisciplinary biophysical approach and determined how G9a activity the cell migration in 2D and 3D environments and on HUVEC (endothelial cells) activated with TNF-a.
Results
We demonstrated that T-ALL adhesion via α4β1 integrin upregulates specific histone H3 methylation (H3K9me2/3). Primary
CD4+ T-cells also showed H3K9me2/3 upregulation upon VCAM1 adhesion, although this change was more moderate than
Jurkat cells. We identified G9a as the methyltransferase responsible for H3K9 methylation. Mechanistically, we determined
that G9a is recruited to the nuclear envelope, which induces its catalytic activity. We demonstrate that H3K9 methylation
correlates with a closed-chromatin conformation and alters the nuclear deformability in a transcriptional independent manner. Finally, we defined that these epigenetic changes were linked to lymphocyte migration, as depleting or inhibiting G9a
blocked cell movement.
Conclusions
Our results reveal novel functions for α4β1 in modulating H3K9me3, which affect nuclear biology and migration of ALL cells.
Together, our findings define how epigenetic changes might contribute to dissemination and progression of this leukaemia.
76
O-072 TGF-Β1 POLYMORPHISMS MAY IDENTIFY GASTRIC ADENOCARCINOMA PATIENTS WITH HIGH RISK OF
METASTASIS AND A LOWER SURVIVAL RATE
I. Juárez Martín-Delgado1 , A. J. Gutiérrez Calvo 2 , A. Blázquez Martín2 , E. Ovejero Merino2 , I. Lasa Unzue2 , A. López García2 ,
R. Gómez Sanz 2 , J. M. Martín Villa1
1) Facultad de Medicina. Universidad Complutense de Madrid 2) Hospital Universitario Príncipe de Asturias
Introduction
Transforming growth factor β1 (TGF-β1) is a cytokine involved in the development and malignancy of tumours. Several
works attribute a dual effect to the cytokine in the cancer evolution depending on its levels in the microenvironment of the
tumour and the stage of the disease.
TGFB1 gene represents several single nucleotide polymorphisms (SNP), which correlate with changes in TGF-β1 levels.
Due to implication of TGF-β1 levels in cancer, we analysed four SNPs (rs1800468, rs1800469, rs1800470, rs1800471) in a
group of patients with gastric adenocarcinoma, to assess a possible association between the TGFB1 polymorphic variants
and progression of the disease.
Objectives
Analyse the relationship between TGFB1 polymorphisms and: 1) development and progression of gastric adenocarcinoma,
2) survival rates of patients, 3) TGF-β1 levels.
Sixty-two patients with gastric adenocarcinoma, classified as type I, II, III or IV, according to the TNM staging system (7th
edition UICC) and fifty-one healthy controls, age- and sex-matched, were used. DNA was obtained and the polymorphisms
analysed by several sequencing methods and frequencies of the SNP were analysed with the SNPStats software. Peripheral
blood mononuclear cells (PBMC) were isolated and stimulated with PMA (20ng/ml) and Ionomicin (1 µM) for 4 hours. Total
protein levels where measured by means of a Lowry assay (Bio-Rad) and concentration of TGF-β1 was measured by an ELISA
assay (Enzo Life Sciences). Survival curves and statistical analysis were performed with the GraphPad Prisms 6.0 software.
Results
We found significant difference in rs1800468-G/A and rs1800469-T/T polymorphisms, with the genotype G/A present in
30.8% of type IV (metastatic) patients compared to 6.4% of type I, II and III (non-metastatic) patients (p=0.019, OR=8.17). Likewise, the T/T genotype of the rs1800469 SNP is absent in the type IV patients, and present in the 19.1% of non-metastatic
patients (p=0.029). Moreover, the ACTG combined haplotype is present in 15.2% of the metastatic patients as compared to
3.2% of non-metastatic (p=0.026, OR=9.21).
We next analysed the effect of the individual polymorphisms in the TGF-β1 levels and found that the rs1800469 T/T polymorphisms results in lower expression of TGF-β1 (142.5 ng of TGF-β1 per µg of total protein, N=8 patients) than the C/T (222.8 ng/
µg, N=3, p=0.0026) or C/C (200.4 ng/ µg, N=3, p=0.0171) polymorphisms. Likewise, the rs1800470 T/T polymorphism, yielded
149.2 ng/µg (N=5) as compared to 220.8 ng per µg of the C/C SNP (N=2, p=0.0147) patients.
Finally, PBMC of ACTG or GCTG bearing patients produce lowers levels of TGF-β1 upon stimulation (163.0 ng/µg, N=5) and
have worse survival rates (28.1%) than the alternative haplotype GTCG (200.4 ng/µg, N=3, p=0.0492) (survival rate=85.5%)
Conclusions
These polymorphisms may us enable to pinpoint metastasis–prone patients, who would need more aggressive therapeutic
approaches upon diagnosis.
77
O-073 INVOLVEMENT OF BMP4 ON THE IMMUNE RESPONSE TO ACUTE LYMPHOBLASTIC LEUKEMIA
A. Entrena 1 , A. Varas 1 , L. M Fernández-Sevilla1 , M. Vazquez1 , R. Sacedon1 , M. Ramirez2 , A. Vicente1 1) Facultad de Medicina, Universidad Complutense 2) Hospital Universitario Niño Jesus
Introduction
Acute lymphoblastic leukemia (ALL) is the most common during childhood with a great incidence between ages 2 and
5 years. Bone morphogenetic proteins (BMP) are growth factors which are related to the homeostasis of many tissues including hematopoietic and immune system. Different alterations in this pathway have been linked to the development of
different tumors. In the present report, we carried out a detailed analysis of the role of BMP4, a ligand of the BMP signaling
pathway, in the proliferation and survival of ALL cells and its implication in the modulation of the immune response during
neoplasia development. Likewise, we analyzed the characteristics of NK cells from the bone marrow of patients with ALL.
Objectives
The objectives of the present work are: 1. To analyze the effect of BMP4 stimulation in survival, proliferation and immune evasion of ALL cells. 2. To study the expression of NK cell receptors and their ligands on NK cells and leukemia cells respectively.
3. To evaluate the effects of the presence of leukemic cells in NK cell functionality.
Primary ALL cells and human leukemic cell lines were used. We have studied the survival, proliferation and NK cell ligand
expression on ALL cell lines after BMP4 stimulation. Flow cytometry analysis and qPCR were used to determine NK cell ligand
expression and phenotype of primary ALL cells and NK cells isolated from patients. Cytotoxic capacity and phenotype of NK
cells after co-culture with leukemic cell lines was evaluated.
Results
Our results show that leukemic cells are able to respond to high concentrations of BMP4 present in the bone marrow of ALL
patients at diagnosis. In this context, BMP4 reduces the proliferation of low-risk leukemic cell line NALM6. Likewise, BMP4
could contribute to improve NK cell cytotoxic capacity through upregulation of NKG2D and NKp30 ligands in low-risk ALL.
In relation with this, leukemic cells from ALL patients show different expression pattern of NKG2D and NKp30 ligands depending on risk of relapse. Moreover, NK cells isolated from the bone marrow of high-risk patients exhibit differences in the
expression of activating and inhibitory receptors. Finally, ALL cells could contribute to these alterations since its presence
reduce NK cell cytotoxic capacity and cytokine production and modulate NK cell receptors expression.
Conclusions
Our results show that BMP4 contributes to improve the immune response to leukemia progression. However, leukemic cells
are able to reduce NK cell functionality, facilitating immune evasion.
This work was supported by grants SAF2012-33180 (Ministerio de Economía y Competitividad), S2010/BMD-2420 (Comunidad de Madrid) and RD12/0019/0007 (Instituto de Salud Carlos III) and by a pre-doctoral fellowship AP2010-0795 (Ministerio
de Educación, Cultura y Deporte).
78
O-074 FUNTIONAL IL7R SIGNALING IN B-CELL ACUTE LYMPHOBLASTIC LEUKEMIA
P. Fuentes1 , S. González-García1 , A. Murcia1 , J. Alcain1 , M. Ramirez Orellana2 , M. L. Toribio1 1) Centro de Biología Molecular ‘‘Severo Ochoa’’, CSIC-UAM. Universidad Autónoma de Madrid, Madrid, Spain 2) Hospital
Universitario del Niño Jesús, Madrid, Spain
Introduction
Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. ALL is caused by the oncogenic transformation
of precursors of T or B lymphocytes (T-ALL or B-ALL) during their development in the thymus or bone marrow, respectively.
ALLs commonly express functional receptors for interleukin-7 (IL-7R), and expression of activating IL7R mutations have been
described in both T-ALL and B-ALL. However, the role of IL7R in B-ALL is poorly understood, mainly owing to the fact that IL7R expression is crucial for B-cell development in mouse but not in man.
Objectives
The main objective of this work was to investigate the role that IL-7R could play in human B-ALL.
The IL7R expression in B-ALL cell lines and human primary B-ALL was analyzed by flow cytometry using an IL7Ra moAb.
Biochemical analysis of distinct intracellular pathways was performed upon IL7R activation with IL-7 at 37ºC for a different
time points. Samples were processed through a SDS-PAGE gel, following by Western blotting experiments. To address the
in vivo impact of IL7R signalling, B-ALL cells lines were transduced with a lentiviral vector encoding GFP as a cell tracer and
either a shRNA specific for human IL7R or a control shRNA. Then, the cells were subcutaneously transplanted in the right flank
of Rag2-/- x gc-/- immunodeficient mice and the tumor growth was measured at different time points. On the other hand, to
assess the in vivo role of inhibiting IL7R expression on maintenance and expansion of human primary B-ALL cells, we developed a xenotransplantation model in which sub-lethally irradiated Rag2-/- x gc-/- immunodeficient mice were transplanted
by intraorbital injection with human primary BM cells from two B-ALL patients transduced with the same lentiviral vectors
(shRNA and shRNA IL7R).
Results
Our data show that IL-7R that are constitutively expressed on B-ALL cell lines, including REH and NALM-6, are functional
in response to IL-7, as assessed by activation of STAT5-JAK, AKT-PI3K, ERK and mTOR pathways. Importantly, IL7R silencing
impaired in vivo survival and expansion of B-ALL cell lines injected subcutaneously into NSG immunodeficient mice, and
prevented the generation of solid tumors. The pathological relevance of these findings is stressed by the observation that
low IL7R expression levels displayed by primary bone marrow samples from B-ALL patients become increased in vivo in serial
xenotransplantation assays, thereby suggesting a selective role for IL7R in supporting B-ALL leukemia initiating cell (LIC) activity. More important in pathological terms, IL7R silencing impairs in vivo establishment and progression of primary human
B-ALL in host mice.
Conclusions
IL-7R signaling is crucial for maintenance and progression of B-ALL. These results provide proof of principle for the future
design of IL-7R-targetted therapies against LIC activity of human B-ALL.
79
O-075 IMMUNE-CHECKPOINT EXPRESSION SCORE IS AN INDEPENDENT PROGNOSTIC BIOMARKER IN RESECTABLE
NON-SMALL CELL LUNG CANCER
M. Usó1 , E. Jantus-Lewintre1 , R. Sirera3 , A. Herreros1 , R. Guijarro2 , S. Calabuig1 , A. Blasco5 , J. Forteza4 , C. Camps5 1) Fundación Investigación Hospital General Universitario de Valencia 2) Hospital General Universitario de Valencia 3) Universitat
Politècnica de València 4) CIPF-UCV 5) Hospital General Universitario de Valencia
Introduction
Immune checkpoints blockade, which activate antitumor immunity, has demonstrated promising clinical results in NSCLC.
Objective
In this study we have investigated the prognostic role of immune-checkpoint expression markers and its correlation with
immune-cells infiltration and clinico-pathological characteristics in a cohort of resectable NSCLC patients.
RNA was isolated from fresh-frozen lung specimens (tumor and normal lung) (n=178). RTqPCR was performed to analyze the
expression of CTLA-4, PD-1 and PD-L1 by the use of hydrolysis probes. Relative gene expression was assessed by Pfaffl formula and normalized by the use of CDKN1B, GUS and ACTB as endogenous genes (selected by GeNorm algorithm). These data
was used to develop a gene expression score. Furthermore, the presence of CD4+, CD8+ and FOXP3+ lymphocytes was also
assessed in FFPE samples from 63 of these patients by immunohistochemistry (IHC). All statistical analysis were considered
significant at p< 0.05.
Results
Patient’s median age was 65 years [26-85], 86.5% were male and 52.0% were adenocarcinomas (ADC). Since CTLA-4 and
PD-1 were moderately associated with prognosis based on COX regression analysis (Z-score> 1.5), a multivariate model
including these two genes was created. Absolute regression coefficients from this analysis were used in order to calculate
the immune-checkpoint score: (PD1 x 0.116) + (CTLA4 x 0.0589) for each case. We found a significant association between
the high immune-checkpoint score and the presence of cytotoxic (CD8+) infiltrating lymphocytes in the tumor microenvironment (p=0.030). Kaplan-Meier survival analysis showed that patients with high immune-checkpoint score have longer
overall survival (OS) [NR vs 40.4 months, p=0.008] and longer progression free survival (PFS) [82.6 vs 23 months, p=0.009]. A
stratified analysis by histology was performed, showing a strong association between the high immune-checkpoint score
and better outcomes [OS p=0.002; PFS p< 0.001] in the group of ADCs (N= 78). Multivariate analysis in the entire cohort indicated that the immune-checkpoint score was an independent biomarker of prognosis for OS [HR: 0.308; 95%CI, 0.156-0.609;
p=0.001] and PFS [HR: 0.527; 95%CI, 0.298-0.933; p=0.028] in early-stage NSCLC patients.
Conclusions
The immune-checkpoint score based on the expression levels of CTLA-4 and PD-1 correlates with the presence of CD8+ infiltrating lymphocytes in the tumor microenvironment. This score provides relevant prognostic information for a better characterization of early-stage NSCLS patients with strikingly different outcomes who may be candidates for immune-based therapies.
Supported by grants PS09-01147, PS09-01149 and RD12/0036/0025 from ISCIII.
80
O-076 SELECTIVE INHIBITORS OF DEATH-ASSOCIATED PROTEIN KINASE 1 (DAPK1) INDUCE TUMOR CELL DEATH BY
REVERSING DAPK1 CONSTITUTIVE PHOSPHORYLATION
S. Torres-Rusillo1 , M. J. Pineda de las Infantas2 , A. Lorente2 , D. Carranza1 , A. Unciti-Broceta3 , J. J. Diaz Mochon2 , I. J. Molina1 1) Universidad de Granada 2) Universiad de Granada 3) University of Edinburgh
Introduction
DAPK1 is a serin-threonin kinase that participates in several signaling pathways involved in the development of tumors
and other diseases. DAPK1 plays an important role in the control of apoptosis, but it has not been formally established as
a therapeutic target due to the lack of selective inhibitors. We synthesized, through a novel synthetic pathway, a library of
poly-substituted purine derivatives. These compounds are the first small-molecules known as selective inhibitors of the
DAPK1 activity, triggercell death on tumor cells.
Objectives
We aimed to determine the mechanisms underlying the pro-apoptotic activity of our newly-synthesized compounds
Induction of apoptosis was studied by cell cycle analysis with Propidium Iodide and Annexin-V staining. Expression of DAPK1
and phosphor-DAPK1 was assessed by Western Blotting, and production of Reactive-Oxygen species (ROS) by flow cytometry after probing with DIOC6. Reversal of hypermethilation was achieved by treatment of cells with 5-Azacitine.
Results
We determined that treatment of tumor cells with our compounds triggers caspases activation that leads to apoptosis and
production of ROS. The intensity of apoptosis correlates, in transfected clones, with constitutive expression levels of the
anti-apoptotic genes Bcl-2 and Bcl-x. Compound-mediated induction of apoptosis requires expression of DAPK1, as the
resistant cell line Raji (which does not express DAPK1) is turned into a sensitive target in a time-dependent fashion by re-expressing DAPK1 after its treatment with the demethylating agent 5-Azacitidine. Finally, we determined that our compounds
selectively interact with DAPK1 and provoke a reversal of its constitutive phosphorylated stated, rather than inhibiting protein expression.
Conclusions
We demonstrated that our compounds, the first selective inhibitors of DAPK1, trigger apoptosis in tumor cells. The current
model of DAPK1 activity contemplates that inactive DAPK1 is folded against its catalytic domain by phosphorylation of the
protein, whereas enzyme activation would dephosphorylate regulatory residues leading to the opening of the loop, exposure of the catalytic domain and DAPK1 activation leading to cell death. Our results are consistent with, and validate, this
theoretical model and pave the way for further examination of DAPK1 as a new target in anti-tumor therapies.
81
O-077 POTENTIAL OF ANTI-HUMAN CCR9 ANTIBODIES FOR THE TREATMENT OF HEMATOLOGICAL NEOPLASIAS
C. Álvarez1 , M. Vela2 , J. A. García-Sanz3 , M. Lozano2 , C. Muñoz2 , L. Kremer2 1) Hospital Universitario La Princesa 2) Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas (CNBCSIC) 3) Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas (CIB-CSIC)
Introduction
The use of therapeutic antibodies for cancer treatment has grown exponentially in recent years, as they combine high specificity and low toxicity. Many of these antibodies recognize antigens expressed selectively on the surface of tumor cells; this
is the case of the chemokine receptor CCR9. This receptor is involved in the retention of developing T cells in the thymus and
leukocyte recruitment to the small intestine, where its ligand, the chemokine CCL25, is expressed. In adulthood, after thymus
involution, CCR9 expression is very limited; it is restricted to infiltrating T cells in the intestinal mucosa and 3-4% of circulating memory T lymphocytes. Expression of this receptor is reported in various types of neoplasias, including T cell acute
lymphoblastic leukemias, metastatic melanomas, breast cancer and colon adenocarcinomas. These reasons make CCR9 an
attractive target for the design of new anti-tumor therapeutic drugs.
Our group previously developed and characterized two human CCR9-specific monoclonal antibodies (mAb) termed 91R and
92R, obtained by gene immunization. These mAb recognize the receptor in its native conformation and bind to a common
epitope in the CCR9 N-terminal extracellular domain.
Objective
We characterized CCR9 expression in several acute and chronic lymphoproliferative disorders to identify potential therapeutic targets of the anti-CCR9 mAb.
Cells from 29 patients with acute and chronic T cell and B cell lymphoproliferative disorders were studied by flow cytometry.
We characterized the phenotype of the hematological neoplasm and quantified the percentage of CCR9 expression specifically in the pathological cells.
Results
We detected CCR9 expression in two B cell neoplasias that could not be classified as defined entities such as B cell chronic
lymphocytic leukemia or multiple myeloma. CCR9-expressing B cell neoplasias thus belong to the so-called unclassifiable
B cell lymphoproliferative disorders. In addition, blast cells from a T-cell/myeloid mixed lineage acute leukemia strongly
expressed this receptor.
Conclusion
The pathologies described above are among those that could benefit from treatment with agents directed to CCR9. Mixed
lineage acute leukemia is a rare disease with a poor prognosis and a clear need for alternative treatments. The unanticipated
expression of CCR9 by otherwise unclassifiable B cell lymphoproliferative disorders adds new information that will aid in
their diagnosis, classification and treatment. Our findings raise the question whether there is a normal CCR9+ B cell counterpart to these lymphoid tumors or if CCR9 expression on B cells can be considered aberrant.
82
O-078 FUNCTIONAL INTERACTION OF THE ANKYLOSING SPONDYLITIS ASSOCIATED ENDOPLASMIC RETICULUM
AMINOPEPTIDASE 2 (ERAP2) WITH THE HLA-B*27 PEPTIDOME IN HUMAN CELLS
A. Martín-Esteban1 , P. Guasp1 , E. Barnea2 , A. Admon2 , J. A. López de Castro1 1) CBMSO 2) Faculty of Biology, Technion
Introduction
The final steps of the antigen processing pathway of Major Histocompatibility Complex Class I (MHC-I) molecules take place
in the endoplasmic reticulum (ER). The peptides reaching this compartment are often longer than those optimal for MHC-I
binding. In humans, the final cut of MHC-I ligands is carried out by two related aminopeptidases, ERAP1 and ERAP2, which
differ in trimming specificity and substrate handling. ERAP1 cleaves virtually all N-terminal residues, except Pro, showing
preference for hydrophobic ones. ERAP2 almost exclusively cleaves basic residues. Moreover, ERAP1 activity is strongly influenced by substrate length, being almost unable to digest peptides shorter than nonamers. In contrast, ERAP2 optimally
cleaves peptides of 7-8 residues, quickly becoming less efficient with longer substrates. Yet, the precise role of ERAP2 in
shaping MHC-I peptidomes is unknown. ERAP2 has been reacently shown to be a risk factor for ankylosing spondylitis both
among HLA-B*27 positive and negative individuals. Objectives
To determine the effect of ERAP2 expression on the HLA-B*27 peptidome in live cells.
HLA-B*27:05-bound peptides were isolated from two ERAP2-negative and one ERAP2-positive lymphoblastoid cell lines
expressing functionally undistinguishable ERAP1 variants, by immunoaffinity chromatography and acid extraction. Functional equivalence of ERAP1 variants was established by in vitro peptide digestions. Over 2000-4000 B*27:05 ligands were
identified from each cell line and their relative abundance was established by quantitative tandem mass spectrometry and
MaxQuant-based analyses. Pairwise comparisons were performed to determine the structural features of peptides whose
relative abundance was influenced by ERAP2. Peptide affinity was estimated with standard predictive algorthims.
Results
The B*27:05 peptidome from the ERAP2-positive cell line showed 3-4% less peptides with N-terminal basic residues than
those from ERAP2-negative cells. The predominant peptides in the presence of ERAP2 consisted of more nonamers, less
decamers, and less peptides with N-terminal basic residues than those predominant in ERAP2-negative cells. The ERAP2-dependent changes did not alter the global affinity of the B*27:05 peptidome.
Conclusions
ERAP2 significantly influences the B*27:05-bound peptidome, through destroying at least 3-4%, and decreasing the abundance of many more, ligands with N-terminal basic residues, and increasing the abundance of nonamers. The former effects
are best explained by direct ERAP2 trimming. Those on peptide length presumably result from ERAP2-induced activation
of ERAP1 trimming. The influence of ERAP2 on B*27:05 is consistent with its relevance in ankylosing spondylitis among
HLA-B*27-positive individuals and strongly supports a peptide mediated pathogenetic mechanism of this disease. Analogous effects on other MHC-I-bound peptidomes might explain its involvement in HLA-B27-negative spondyloarthitis. This is,
to our knowledge, the first description of the effect of ERAP2 on a MHC-I peptidome in living cells.
83
O-079 ERAP1 DIFFERENTIALLY SHAPES TWO SUBPEPTIDOMES IN HLA-B*51:01. IMPLICATIONS FOR THE PATHOGENESIS OF BEÇHET’S DISEASE
P. Guasp1 , A. Carlos1 , G. Patricia1 , M. Adrián1 , M. Miguel2 , E. Barnea3 , A. Admon3 , J. A. López de Castro1 1) Centro de Biología Molecular Severo Ochoa (CSIC-UAM) 2) Centro Nacional de Biotecnología (CSIC) 3) Technion-Israel Institute
of Technology
Introduction
HLA-B*51:01 is the main risk factor for Beçhet’s disease, a multisystemic vasculitis characterized by uveitis, skin lesions, oral
aphthae and genital ulcerations. The endoplasmic reticulum aminopeptidase 1 (ERAP1) trims peptides to be loaded onto the
MHC-I molecules. ERAP1 is also associated with Beçhet’s disease in epistasis with HLA-B*51:01. This association suggests that
antigen processing and presentation is important in the pathogenesis of the disease.
Objectives
To analyze the peptidome presented by HLA-B*51:01, to define its binding motif and its implications for the functional and
pathogenic interaction of ERAP1 with B*51:01.
721.221 cells do not express MHC-I molecules. The B*51:01 peptidome expressed in 721.221 transfectant cells was isolated by affinity chromatography using the W6/32 antibody. B*51:01-bound peptides were pulled out by acid extraction and
identified by tandem mass spectrometry using a Q-Exactive-Plus instrument and MaxQuant analysis. Recombinant ERAP1
variants with different polymorphisms and enzymatic activities were purified and used to digest five synthetic peptides.
Theoretical MHC-I and TAP binding affinities were calculated using predictive algorithms.
Results
B*51:01 preferentially binds peptides with Pro or Ala at peptide position 2 (P2), and with Ile, Val, and less frequently, Leu, at
the C-terminal position. The dual preference at P2 generates two subpeptidomes with distinct features. The P1 position is
determined by the nature of the P2 residue in an ERAP1 related way. Ligands with Pro2 showed a preference for residues
susceptible to ERAP1, such as Tyr and Leu, while ligands with Ala2 showed a strong preference for Asp at P1, a residue that
is very resistant to ERAP1. Pro2 containing ligands cannot enter the Endoplasmic Reticulum (ER) through TAP, and do so as
N-extended peptides, which need to be processed by ERAP1. In contrast, Ala2 ligands showed equal or higher affinity for
TAP than their N-terminal extensions, meaning that ERAP1 processing may not be absolutely required for the presentation
of these ligands. The Pro2 subpeptidome showed higher affinity for B*51:01 than the Ala2 subpeptidome.
Conclusions
ERAP1 does not trim peptidic bonds involving Proline. This feature is crucial, since ligands with Pro2 are generated in the
ER by ERAP1 but cannot be destroyed by it, while ligands with Ala2 do not necessarily need to be generated by ERAP1, and
an excessive activity of the enzyme can degrade them. We propose a mechanism in which ERAP1 activity directly influences B*51:01 by differentially processing the Ala2 and Pro2 peptides, leading to global alterations in the nature and affinity
of the peptidome. The correct balance between both subpeptidomes may be crucial for Behçet’s Disease susceptibility.
84
O-080 MONOCYTE-DERIVED IL-15 ACTS AS A CRUCIAL FACTOR AGAINST FUNGAL INFECTION
J. Domínguez Andrés1 , L. González Cintado1 , L. Hernández Villarrubia1 , L. Feo Lucas1 , M. López-Bravo1 , C. Ardavín1 1) Centro Nacional de Biotecnología
Introduction
Invasive candidiasis occurs when the fungal pathogen Candida albicans enters the bloodstream and spreads to different
organs throughout the body. In immunocompromised patients, Candida infections reach a mortality rate up to 40%, fact
that keeps invasive candidiasis as a major issue of concern in clinic environments. The innate immune response driven by
dendritic cells, NK cells, macrophages and neutrophils within the first hours of infection has been proved to be crucial for the
final outcome of the infection but the mechanisms of interplay among these different leukocytic subsets are still a matter of
controversy.
Objectives
We seek to elucidate the mechanisms that drive the host-pathogen interactions in the first days after systemic infection
focusing on the interplay between monocytes, NK cells and neutrophils, approaching the role of monocytes as a possible
source of IL-15 for the priming of NK cells as a source of GM-CSF after Candida albicans infection. We also aim to investigate
the intracellular pathways driving these processes.
We used a mouse model of systemic candidiasis in C57BL/6 mice. Ccr2-/- mice were used to evaluate the specific role of
monocytes and IL-15-/- mice were employed to assess the role of IL-15 in the NK cell priming after infection. Fungal burden
and neutrophil killing experiments were carried out to test the ability of the different mouse lines to fight against the fungal
infection. In vitro dendritic cell-NK cell cocultures were employed to check the specific interactions between these cell types.
The kinetics of leukocytic populations were analyzed by flow cytometry. Gene expression analysis of monocytes and NK cells
was defined by qPCR.
Results
Our data suggest that inflammatory monocytes and dendritic cells act as a source of IL-15 that licenses NK cells to produce
GM-CSF after Candida albicans infection enhancing the candidacidal activity of neutrophils leading to a better outcome of
the infection and an improved survival rate. Gene expression analysis confirmed that the IL-15 upregulation seen after Candida albicans recognition relies on a Dectin-1-IRF5-dependent mechanism. Flow cytometry data obtained from Ccr2-/- and
IL-15-/- confirmed the lack of activation of candidacidal mechanisms and an altered leukocytic infiltration in the kidneys of
these mice after Candida infection, causing a fatal outcome in these animals.
Conclusions
This study describes a new role for IL-15 in fungal diseases suggesting that after systemic Candida albicans infection, monocyte-derived cells act as a fundamental source of IL-15 activating the interplay between monocytes, NK cells and neutrophils
through a Dectin-1-IRF5-IL-15 axis contributing to an enhanced fungicidal capacity of mouse kidney neutrophils leading to
a lower fungal burden and an improved survival after the infection.
85
O-081 BATF3-DEPENDENT DENDRITIC CELLS CONTROL HOUSE DUST MITE-DRIVEN TH2 AND TH17 RESPONSE
THROUGH IL-12 PRODUCTION
L. Conejero Hall1 , S. Chayeb Khouili1 , S. Martínez Cano1 , H. Izquierdo Fernández1 , P. Brandi1 , D. Sancho Madrid1 1) CNIC (Centro Nacional de Investigaciones Cardiovasculares)
Introduction
Asthma is a chronic inflammatory disease associated to eosinophilia, airway obstruction and airway hyperreactivity. Following inhalation of allergens, conventional lung dendritic cells (DCs), which consist of CD11b+ DCs and CD103+ DCs in mice,
migrate to the local lymph nodes (LN). Upon exposure to the clinically relevant allergen HDM, CD11b+ DCs interact with
naïve T cells providing the first instruction for T helper cell 2 (Th2) differentiation characteristic in asthma; however, the role
of CD103+ DCs in airway inflammation remains controversial.
Objectives
Investigate the role of lung CD103+ DCs in HDM-induced asthma.
WT and Batf3-/- mice, used as a model of CD103+ DC impairment, were chronically exposed to HDM, and the development of
characteristic features of asthma such as increase in BAL infiltrates, Th2 and Th17 cytokine production, mucus secretion by
goblet cells and IgE levels in sera was analysed.
Results
Batf3-deficient mice show a significant increase in total BAL infiltrates, including mainly an influx of eosinophils and neutrophils. In addition, mice deficient for CD103+ DCs develop more perivascular and peribronchial infiltration than WT mice,
which correlates with an increase in Th2 and Th17 cytokine production by lung-draining LN and splenocytes. To further
investigate the mechanism, the production of IL-12 by both subsets of lung migratory DCs (CD103+ and CD11b+) was evaluated in the lung-draining LN following exposure to HDM. Only CD103+ DCs were able to increase the production of IL-12,
which in turn enhances Th1 differentiation, attenuating Th2 and Th17 response and main features of asthma.
Conclusion
Batf3-dependent DCs are essential providers of IL-12 that controls induction of Th1 immunity in response to HDM, thus dampening allergic airway inflammation.
86
O-082 SUBLINGUAL IMMUNIZATION OF MICE WITH POLYBACTERIAL IMMUNOSTIMULATION: EFFECTS ON THE
PROLIFERATIVE CAPACITY AND CYTOKINE PRODUCTION OF SPLENOCYTES
C. M. Diez Rivero1 , M. Tejera Alhambra1 , M. Guzmán Fulgencio1 , R. Caballero1 , I. Soria Castro1 , J. López Relaño2 , E. Fernández
Caldas1 , J. L. Subiza1 , M. Casanovas1 1) INMUNOTEK, S.L. 2) Hospital Clínico San Carlos
Introduction
Sublingual polybacterial immunostimulation is currently used with success in the clinical practice for the prophylaxis of
recurrent urinary tract infections (RUTIs). MV140 is a preparation that contains a mixture of equal amounts of inactivated
selected strains of Escherichia coli, Klebsiella pneumoniae, Proteus vulgaris and Enterococcus faecalis. These bacteria are pathogens frequently responsible for RUTIs.
Objectives
The aim of this study was to evaluate the systemic response elicited by the sublingual immunostimulation with MV140 in
mice; evaluating the proliferative capacity of their splenocytes and the production of cytokines in response to specific and
unspecific stimuli.
A total of 32 BALB/c mice, divided in 4 groups of 8 animals each (4 females and 4 males per group), were immunized sublingually with different concentrations of MV140 (group 1: 1010 bacteria/mL, group 2: 109 bacteria/mL and group 3: 108 bacteria/
mL) or with the excipients contained in MV140 (sham). Anesthetized mice received 10 µL of each dose of MV140 or sham
weekly for 1 month and afterwards were sacrificed. Isolated splenocytes were cultured with phytohemagglutinin (PHA), 2
concentrations of MV140 (107 bacteria/mL and 106 bacteria/mL), sham and culture medium. The proliferation of the splenocytes was measured with Carboxy Fluorescein Succinimidyl Ester (CFSE) after 6 days. Cytokine levels (IFN-γ, TNF-α, IL-10 and
IL-2) were determined after 48 hours in cell culture supernatants with the Cytometric Bead Array.
Results
The proliferative response was dose dependent, being higher in mice immunized with the highest concentration of MV140
(dose group 1: 1010 bacteria/mL). This proliferation was significantly higher than in the sham group in response to specific
(MV140 107 bacteria/mL and 106 bacteria/mL) (p=0.01) and to unspecific (PHA) stimuli (p<0.001). The production of IFN-γ,
TNF-α and IL-2 was also dose dependent. Levels of IFN-γ and TNF-α were significantly higher in the supernatants from group
1 splenocytes in response to MV140 (106 b/mL) (p<0.05) with respect to sham. In response to PHA, IFN-γ levels were highest in splenocytes from mice in group 1 (p<0.05) and were similar for IL-2 and TNF-α in splenocytes from groups 1 and 2
(p<0.05). IL-10 production was only specific to MV140 stimulation. IL-10 levels were higher in splenocytes from groups 1 and
2 (p<0.05), in response to MV140 (106 bacteria/mL), being highest in group 2, whose immunization concentration dose is the
same as that used in the normal clinical practice in humans (109 bacteria/mL).
Conclusions
In vivo sublingual immunization of mice with MV140 elicits a systemic and strong proliferation of splenocytes in response to
specific and non-specific stimuli with a Th1 lymphocytes polarization and high levels of IL-10.
87
O-083 MODULATION AND CONDITIONING OF THE T CELL RESPONSES BY EPITHELIAL CELLS
M. Molero Abraham1 , E. Lafuente1 , J. L. Subiza2 , P. Reche1 1) Facultad de Medicina, Universidad Complutense de Madrid 2) Hospital Clínico San Carlos
Introduction
The oral mucosa is a major site of interaction with microorganisms and food antigens where important defense and tolerance mechanisms are articulated. The oral epithelium accumulates many immune cells including a large number of intraepithelial T cells. Epithelial cells (ECs) can determinate T cell responses by conditioning dendritic cells (DCs) maturation.
However, the ability of ECs to directly condition T cell responses is largely unknown.
Objective
We aimed to investigate the role of oral epithelial cells treated with various stimulus conditioning T cell responses.
In this study, we employed oral epithelium cell lines, H413 and TR146, and primary human keratinocytes isolated from the
oral mucosa according to Michalczyk et al, 2004, BioTechniques, 37:262. As stimulus we used IFNg and Bactek®, a bacteria
polyvalent preparation used to reduce the frequency of recurrent infections of the respiratory tract. We used flow cytometry
to study DC activation makers in ECs (CD80, CD86, HLA-DR, CD40, MHC-I). We stimulated CD4 T cells (total, Th1 and naïve)
with anti-CD3 and anti-CD28 and cultured them with supernatants of ECs treated with or without Bactek® and with ECs stimulated with or without Bactek®. We used ELISA to analyze the presence of cytokines in the supernatants of ECs (IL1b, TGFb,
IL6, IL10, TNFa and IL8) and conditioned CD4 T cells (IFNg, TNFa, TGFb or IL2).
Results
H413 and TR146 cells stimulated with Bactek® and IFNg expressed HLA-DR and CD40, while we only observed MHC-I expression in the cells treated with IFNg, expression of CD80 and CD86 was marginal in both cell lines. Keratinocytes exhibited low
expression levels of CD86, CD80, and CD40 when treated with both Bactek® and IFNg. Untreated ECs released TGFb, TNFa,
IL6 and IL8 and treated with Bactek® increased the liberation of IL6 and IL8. Untreated Keratinocytes released lower levels
of cytokines than the cell lines and treatment with Bactek® decreased the TGFb expression. Bactek® increased the release of
TNFa and IFNg by stimulated CD4 T cells and such release decreased in the presence of ECs-supernatants and when co-cultured with ECs.
Conclusions
Our results show that epithelial cells are capable of quenching Th1 responses elicited.
Funding
This work has been supported by GRANT IPT-2012-0639-090000 to INMUNOTEK S.L.
88
O-084 VACCINATION IN THE ABSENCE OF TAP, THE TRANSPORTER ASSOCIATED WITH ANTIGEN PROCESSING
D. Gamarra Carrasco1 , S. Lázaro García1 , S. Iborra Martín2 , M. Ramos Álvarez-Buylla2 , M. del Val Latorre1 1) Centro de Biología Molecular Severo Ochoa 2) Centro Nacional de Microbiología, Instituto de Salud Carlos III
Introduction
The development of safe and effective vaccines against viruses is commonly based on the induction of secondary responses
of CD8+ T lymphocytes by the priming of these cells with one or more antigens. Further action of CD8+ T lymphocytes depends on a correct antigen presentation by infected cells. In our lab, we have described and characterized the existence and
unexpected prevalence of viral antigen presentation pathways in the absence of the Transporter Associated with antigen
Processing (TAP).
Previous results in our lab show that TAP1-/- mice can trigger an efficient secondary response against several viral antigens
and that they can establish CD8+ T lymphocytes with a memory phenotype.
Objectives
We aim to assess the capacity of TAP1-/- mice to efficiently clear a VACV infection as well as the potential of TAP-independent
viral antigens as vaccinating tools in TAP-deficient and WT mice using VACV as an in vivo infection model.
We infect TAP1-/- and WT mice with VACV and measure the viral load in spleen and ovaries at different days post infection to
track the clearance of the virus in these organs.
To assess and compare the vaccinating capacity of three TAP-independent viral epitopes and one TAP-dependent viral epitope, we inoculate the mice with TAP1-/- bone marrow-derived dendritic cells (BMDCs) matured with LPS and loaded with
synthetic antigenic viral peptides. Fourteen days later, the vaccinated mice are challenged with a VACV infection. After the
challenge, we track the viral clearance.
Results
Our results show that TAP1-/- mice can clear a VACV infection in spleen and ovaries as efficiently as WT mice. Also, the three
TAP-independent viral antigens used for vaccination can induce a proper and efficient CD8+ T-lymphocyte response capable
of clearing a VACV challenge infection from the spleen in TAP1-/- mice as efficiently as in WT mice.
However, the track of viral load in ovaries of vaccinated mice shows a much poorer vaccinating capacity of the same three
TAP-independent viral antigens in TAP1-/- mice than in WT mice.
Conclusions
In conclusion, our work adds more evidence to the existence of TAP-independent viral antigen processing pathways in vivo,
and shows their physiological relevance in the elimination of a viral infection. We demonstrate that TAP-/- mice possess sufficient mechanisms to fight a viral infection and we also show evidence of the vaccinating capacity against a viral infection of
three TAP-independent epitopes in a TAP-deficient in vivo model.
89
O-085 INNATE AND ADAPTIVE IMMUNE RESPONSE IN SUSCEPTIBILITY AND OUTCOME OF INFLUENZA VIRUS INFECTION
M. López-Rodríguez1,2 , J. Solé-Violán3 , E. Herrera-Ramos1,4 , J. J. Ruíz-Hernández5 , L. Borderías6 , J. P. Horcajada7,8 , T. Rodríguez9 ,
M. C. Pérez-González 10 , Y. Florido-Ortega1 , A. Domínguez1 , O. Rajas11 , M. Briones12 , E. López-Granados13 , F. Rodríguez de
Castro4,14, C. Rodríguez-Gallego15 1) Department of Immunology, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain 2) Department of
Clinical Sciences, School of Medicine, Universidad de Las Palmas de Gran Canaria, Las Palmas de Gran Canaria, Spain 3) Intensive Care
Unit, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain, CIBERES 4) Department of Medical and
Surgical Sciences, School of Medicine, Universidad de Las Palmas de Gran Canaria, Las Palmas de Gran Canaria, Spain 5) Department
of Internal Medicine, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas Gran Canaria, Spain 6) Department of Respiratory
Diseases, Hospital San Jorge, Huesca, Spain 7) Department of Infectious Diseases, Hospital Universitari del Mar, Barcelona, Spain
8) Hospital del Mar de Investigaciones Médicas (IMIM), Barcelona, Spain, CIBERES 9) Department of Biochemistry, Hospital Universitario
de Gran Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain 10) Department of Microbiology, Hospital Universitario de Gran
Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain 11) Department of Respiratory Diseases, Hospital Universitario de la Princesa,
Madrid, Spain 12) Department of Respiratory Diseases, Hospital Clínico y Universitario de Valencia, Valencia, Spain 13) Department of
Immunology, Hospital La Paz. La Paz Institute of Biomedical Research, IdiPAZ. Madrid, Spain 14) Department of Respiratory Diseases,
Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain 15) Department of Immunology, Hospital
Universitario Son Espases, Palma de Mallorca, 07120, Spain.
Introduction
The majority of influenza virus infections (IVI) were estimated to be subclinical, and those patients with symptomatic infection usually present a mild flu. However, in a small subset of patients, the infection may rapidly evolve to severe forms.
The role of genetic variability in the susceptibility and outcome of influenza virus infection (IVI) remains largely unknown.
We have recently reported that variants at SFTPA2 influence severity of H1N1pdm09 infection. Some SNPs in several genes,
among them TLR3, FCGR2A, TNF, LTA and CCR5 genes, have been suggested to be associated with severity of H1N1pdm09
virus infection. Mice models suggest that TLR2, TLR3, TLR4 and TIRAP are key players in the development of severe IVI. A role
of IgG2 deficiency as a predisposing factor for severe influenza has also been proposed.
We studied 137 Spanish patients with IVI (80.3% by H1N1pdm09). Sixty-four patients required hospitalization due to primary
viral pneumonia; 49 out of them required ICU admission. Control group consisted of 1,466 unrelated volunteers.
Nineteen genetic variants, most of them with functional relevance, at 14 genes (FCGR2A, FCGR3A, FCGR3B, IL1RN, IL6, LTA,
TNFA, TIRAP, TLR1, TLR2, TLR3, TLR4, CCR5, IGHG2-G2m) were studied, in order to analyze their role in the susceptibility and
outcome of influenza infection. Immunoglobulin (Ig) G, IgA, IgM and IgG subclasses in acute and convalescent phase were
measured in patients with mild and severe flu.
Results No differences in serum levels of Immunoglobulins were observed in the different subgroups of patients in acute phase and
in convalescent phase according to severity (Table 1). When severity was evaluated in the small number of patients with
IgG2 below the normal range, no predisposition to severity was either observed. Even a patient diagnosed with a primary
immunodeficiency (also present in his brother) with severely reduced peripheral B cells, IgG2 and IgM deficiency and poor
antibody production to polysaccharide antigens had a mild flu. Another patient with mild flu had an IRAK-4 deficiency. No
significant differences in genotype or allele frequencies between patients and controls, or between the different groups of
patients stratified according to their severity were found.
Conclusions Our results do not support that IgG2 or other immunoglobulin deficiencies may be a significant risk factor for severe influenza. In fact, patients with primary antibody deficiencies are not particularly prone to influenza. Our results do not support
that variants at TLR3, FCGR2A, TNF, LTA and CCR5 are associated with susceptibility or severity of IVI. Our data neither suggest
any role of the studied functional variants at FCGR3A, FCGR3B, IL1RN, IL6, TIRAP, TLR1, TLR2, TLR3, TLR4 and the IGHG2 (IgG2)
G2m(n) allotype in determining susceptibility to or severity of IVI. The role of immunoglobulins and TLRs in the severity of
influenza infection in humans will be discussed.
90
91
O-086 ANTI-ENA AND ANTI-DSDNA AUTOAB SECRETING CELLS CIRCULATE IN SLE PATIENTS AND A MIX OF B-LINEAGE
RELATED CYTOKINES PROMOTES AUTOAB PRODUCTION
R. de La Varga Martínez1 , B. Rodríguez Bayona2 , G. A. Añez Sturchio3 , J. J. Pérez Venegas4 , F. Medina Varo3 , C. Rodríguez
Hernández5 1) Hospital Universitario Puerta del Mar, Cádiz 2) Complejo Hospitalario Universitario de Huelva. Hospital Juan Ramón Jiménez,
Huelva 3) Hospital Universitario Puerta del Mar, Cádiz 4) Hospital de Jerez de la Frontera, Cádiz 5) Hospital Universitario Puerta del
Mar, Cádiz.
Introduction
Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterised by hyperactivation of B Lymphocytes
and autoantibody (autoAb) production. It is not completely known if the same mechanisms that regulate humoral immune
responses operate in autoreactive responses in human SLE.
Objective
Our objective was to examine the presence of circulating autoreactive plasmablasts/plasma cells (PB/PC) and to analyse their
requirements for autoAb (dsDNA and ENA) production.
Blood samples from 53 SLE patients with serum anti-dsDNA (n=25) and/or ENA (n=44) autoAb were studied. Clinical and
laboratory data were collected. Enriched B cell fractions and PB/PC isolated by cell sorting (FACS Aria, BD) were cultured in
the absence and in the presence of IL-6, IL-21, BAFF, APRIL, VEGF and CXCL12 (MIX), the STAT-3 and JAK1 inhibitors stattic
and ruxolitinib, respectively, and cycloheximide. ENA and dsDNA Ab production in sera and cell cultures were determined
by chemiluminescence (CLIA) (Inova, Werfen). Total IgG production in cultures was determined by an in-house ELISA. PB/PC
proliferation, apoptosis and expression of cytokine receptors was determined on PB/PC by flow cytometry.
Results
Circulating PB/PC capable of producing ENA and dsDNA autoAb spontaneously in cultures were found in 55% and 32% of
the patients, respectively. Patients with circulating dsDNA-specific PB/PC displayed lower levels of C3 and C4, more proteinuria and bigger SLICC scores than patients without circulating specific PB/PC.
Circulating PB/PC in SLE patients expressed receptors for IL-6, CXC12, APRIL and particularly IL-21 and BAFF. Cultured sorted
PB/PC augmented anti-ENA and IgG production when cultured with MIX. STAT-3 and JAK1 blockade inhibited MIX-induced
IgG and anti-ENA Ab production by circulating PB/PC in SLE patients.
PB/PC in SLE patients had a high percentage of proliferating BrdU+-cells and the addition of MIX to the cultures significantly
augmented this figure.
Conclusions
CLIA (Inova, Werfen) is a sensitive and specific methodology for detecting anti-ENA and anti-dsDNA autoAb in supernatants
from cell cultures.
MIX promotes IgG and anti-ENA Ab production by circulating PB/PC in SLE patients.
STAT-3 and JAK1 blockade inhibit MIX-induced IgG and anti-ENA production by circulating PB/PC in SLE patients.
MIX augments the proliferation of circulating in vivo-generated PB/PC in SLE patients.
A circulating phase of ENA and dsDNA- specific PB/PC was detected in 55% and 32% of SLE. The presence of circulating DNAds-specific PB/PC is associated with a more severe outcome: more chronic organ damage and activation of complement pathway.
Financiación: PI-0366-2013. Consejería de Igualdad, Salud y Políticas Sociales. Andalucía
92
O-087 DECIDUALIZATION MODULATES THE IMMUNE RESPONSE AT THE HUMAN MATERNAL–FETAL INTERFACE
M. J. Ruiz Magaña1 , R. Muñoz Fernández1 , R. Martínez Aguilar1 , E. Toro Carretero2 , J. L. Sánchez Fernández2 , A. C. Abadía
Molina1 , S. Romero Pinedo2 , M. C. Ruiz Ruiz1 , E. García Olivares3 1) Universidad de Granada 2) Universidad de Granada 3) Servicio Andaluz de Salud
Introduction
The human decidua or gestational endometrium is in close contact with the trophoblast (fetal tissue), forming the maternal–
fetal interface. Decidual stromal cells (DSCs) are the main cellular component of the decidua. DSCs originate from fibroblastic
precursors (preDSCs) located around the vessel. During the luteal phase of the menstrual cycle, under the effect of ovarian
hormones (estradiol and progesterone, P4), preDSCs leave the vessels and differentiate (decidualize) into cells (decidualized
DSC, dDSC) of a rounder shape that secrete prolactin (PRL). The cell lineage and functions of DSCs have remained elusive
until recently. The isolation and maintenance of highly purified human DSC lines in culture allowed us to study the antigen
phenotype and functional characteristics of these cells. The many immune activities of DSCs suggest that these cells are
involved in the mechanisms of maternal–fetal immune tolerance, preventing fetal tissue rejection by the mother’s immune
system. Because decidualization is a physiological phenomenon during normal pregnancy, we hypothesize that this process
of differentiation plays a key role in the development of immune tolerance.
Objectives
The aim of this work was to study the changes in the immune phenotype and functions of human DSCs during decidualization.
We established human DSC lines from first-trimester human decidua. We also established stromal cell lines from nongestational endometrium (endometrial stromal cells, EnSC). These lines consisted of predecidual and preendometrial stromal cells
(preEnSC), as confirmed by their differentiation under the effects of cAMP and P4. The antigen phenotype was analyzed by
flow cytometry, RT-PCR and confocal microscopy. Cytokine secretion was measured with an enzyme immune assay.
Results
Under the effects of P4 and cAMP, preDSC lines differentiated (decidualized) in vitro. dDSC became rounder and secreted
PRL. The expression of CD140b, CD146 (markers of undifferentiation) and alpha-smooth muscle actin (αSMA) decreased
in dDSC. These results were confirmed by confocal microscopy: preDSCs, located in vivo around the vessels, co-expressed
αSMA and CD140b or CD146, whereas dDSCs, which are not located around the vessels, did not express αSMA or CD146. In
vitro, dDSC secreted IL-10 and IL-15. EnSC lines showed a similar behavior: decidualization induced a reduction in the expression of CD140b, CD146 and αSMA; however, the secretion of PRL, IL-10 and IL-15 was significantly lower.
Conclusions
Our results suggest that decidualization induced changes in DSC and EnSC that favor maternal–fetal immune tolerance. IL10 is a Th2 cytokine associated with normal pregnancy, and IL-15 induces the differentiation of uterine NK cells, which are
involved in the formation of spiral arteries and in chemotaxis of the fetal trophoblast. These changes are, however, more
intense during pregnancy (DSCs) than in the nongestational endometrium (EnSCs).
93
O-088 TOLERANT LIVER TRANSPLANT RECIPIENTS HAVE A DIFFERENTIAL PROFILE OF ACTIVATED REGULATORY T
CELL SUBSETS WHICH CORRELATE WITH A SPECIFIC MICRORNA EXPRESSION PATTERN
A. Baroja Mazo1 , B. Revilla Nuin1 , Á. de Béjar Almira2 , L. Martínez Alarcón1 , J. I. Herrero Santos3 , C. M. Martínez Cáceres1 ,
J. A. Pons Miñano1 1) Murcia’s BioHealth Research Institute - Hospital Virgen de la Arrixaca (IMIB-Arrixaca). Centro de Investigación en RedEnfermedades Hepáticas y Digestivas (CIBERehd), Murcia 2) Hospital General Universitario Santa Lucía, Cartagena 3) Clínica
Universidad de Navarra. Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd). Instituto
de Investigación Sanitaria de Navarra (IdiSNA), Pamplona.
Introduction
Regulatory T cells (Tregs) play a potential role in operational tolerance in liver transplant patients and microRNAs (miRNAs)
are known to be involved in the immunological responses and tolerance. Objectives
Thus, we analyzed the implication of different peripheral blood Treg subsets and miRNAs in liver transplantation tolerance in
24 tolerant (Tol) and 23 non-tolerant (non-Tol) liver transplant recipients and 16 healthy individuals.
Material and Methods 47 liver transplant patients and 16 healthy volunteers were analyzed and different types of samples were obtained, including
PBMCs, DNA and total RNA.
The study was performed by employing cellular (flow cytometry), genetic (RT-qPCR) and epigenetic (FOXP3 Treg-specific
demethylated region (TSDR) demethylation rate) approximation.
Results
Non-Tol patients had a lower demethylation rate of FOXP3 TSDR than Tol patients that correlated with frequency of circulating Tregs. Tol patients presented a different signature in Treg subset markers as compared with non-Tol patients with increased expression of HELIOS and FOXP3 and a higher proportion of LAP+ Tregs and CD45RA-HLA-DR+ activated effector-memory
Tregs. The expression of 5 miRNAs (miR95, miR24, miR31, miR146a and miR155) was higher in Tol than in non-Tol patients.
They had a positive correlation with activated Treg markers. Conclusions
These data suggest that activated effector-memory Tregs and a TSRD-demethylation state of Tregs may play a role in the complex system of regulation of LT tolerance. For the first time, a set of miRNAs differentially expressed in human liver transplant tolerant patients providing strong evidence that miRNAs are indispensable for preservation of self-tolerance as mediated by Tregs.
94
O-089 ANTI-GSTT1 ANTIBODIES AND GRAFT REJECTION IN LIVER AND KIDNEY TRANSPLANTATION
M. Español-Rego1 , M. García-Ormaechea2 , L. Rubio1 , J. Martorell1 , E. Palou1 , G. Ercilla1 , O. Viñas2 1) Hospital Clínic de Barcelona 2) Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS) 3) Hospital Clínic de Barcelona
Introduction
Approximately 20% of Caucasian population lacks Glutathione S-transferase Theta 1 (GSTT1), an enzyme involved in cellular
detoxification that can induce the production of anti-GSTT1 antibodies in transplanted patients with GSTT1 mismatch between
a positive donor and a null receptor. These antibodies may influence graft dysfunction in liver and kidney transplantation.
Objectives
The aim of our study was to identify, retrospectively, whether the presence of anti-GSTT1 antibodies was associated to a
higher risk of developing greater graft dysfunction and or rejection, compared to controls; and validate the ELISA test with
the human GSTT1-recombinant protein, using indirect immunofluorescene (IIF) as gold standard method. Material and Methods
We included 26 (10 kidney and 16 liver) transplanted patients from Hospital Clínic, Barcelona, from 2010 until 2015, with no
donor anti-HLA specific antibodies. Ten patients had a positive IIF characteristic pattern of anti-GSTT1 antibodies.
Results
Preliminary results showed that 1/4(25%) of anti-GSTT1 positive kidney transplant and 4/6(66.7%) of GSTT1 positive liver
transplanted patients experimented graft rejection vs 2/6(33.3%) of kidney and 1/10(10.0%) liver control patients (p=0.5320
and p=0.0216 respectively). After adjust the cutoff, IIF positive samples were also positive through the ELISA. Conclusions
Although the study group is small, a 100% correlation was obtained between IFI and ELISA detection of anti-GSTT1 antibodies, and the results confirm previous studies showing a higher risk of graft rejection in liver transplant patients with
anti-GSTT1 antibodies and suggest that monitoring the presence of anti-GSTT1 antibodies in recipients of GSTT1 mismatch
liver transplant could help to predict liver graft rejection.
95
O-090 A PROTECTIVE ROLE FOR PSGL-1/P-SELECTIN INTERACTION IN AUTOIMMUNITY
R. González Tajuelo1 , J. Silván Montoya1 , M. de La Fuente Fernández1 , E. Vicente Rabaneda1 , S. Castañeda Sanz1 , C. Gamallo
Amat1 , A. Urzainqui Mayayo1 1) Hospital Universitario de la Princesa
Introduction
PSGL-1/P-Selectin interaction regulates the initial steps of leukocyte extravasation, and it has been demonstrated that this
interaction is necessary for the dendritic cell-induced regulatory T cell differentiation from naïve T cells. More important, Psgl1-/- mice have altered tolerance/immunity balance in the colonic lamina propria and spontaneously develop an autoimmune
syndrome similar to human scleroderma.
Systemic lupus erythematosus (SLE) is an autoimmune syndrome characterized by the production of anti-nuclear antibodies, inflammation of the skin and internal organs, immune complex deposition and polyclonal expansion of autorreactive
lymphocytes.
Objectives
1) Characterization of the autoimmune syndrome developed by P-Selectin deficient (P-sel-/-) mice.
2) Analysis of the expression of P-Selectin in skin biopsies of SLE patients.
Skin and internal organs from P-Sel-/- and wild type (WT) mice were extracted, embedded in paraffin and analyzed histologically. Immune complex deposition in skin and kidney was determined by immunohistochemistry (IHC). Levels of blood
serum autoantibodies were quantified by ELISA. Peripheral blood leukocytes and splenocytes were isolated and immunostained for FACS analysis. For the photosensitivity assay, 3 month-old WT and P-Sel-/- mice were radiated with 0.306 J/cm2 with
a UVB lamp every other day for a week and an additional dose of 0.12 J/cm2 three days later before sacrifice. Skin biopsies
from healthy controls and SLE patients were analyzed for the expression of P-Selectin by IHC and immunofluorescence (IF).
Results
P-Sel-/- mice showed skin alterations characteristic of lupus prone mice, including panniculitis, lypoatrophy, and photosensitivity. In addition, we found circulating anti-dsDNA and anti-Sm antibodies and immunocomplex deposition in the skin
and glomeruli of P-Sel-/- mice. Histological analysis revealed immune infiltration of the skin, kidney and lung. Additionally,
we found a reduction in the IL-10 producing PBLs, and splenic T lymphocytes showed a more activated/effector phenotype
(CD62LnegCD44neg) in P-Sel-/- mice. Finally, we have found a reduction in the percentage of blood vessel expressing P-Selectin
in the biopsies of SLE patients compared with age-mated healthy controls.
Conclusions
P-Selectin deficiency leads to a lupus-like syndrome sharing characteristics with the established lupus mouse models.
Additionally, we found an imbalanced regulatory/proinflammatory immune cell ratio in peripheral blood and spleen.
More important, the lower expression of P-Selectin in the skin of SLE patients suggests a protective role for P-Selectin in
skin homeostasis, and that could be implicated in the pathogenesis of SLE dermatitis. These results reaffirm the notion
that the PSGL-1/P-Selectin axis is crucial for maintaining immune system homeostasis and preventing autoimmunity.
96
O-091 OLIGOCLONAL IGM BANDS PREDICT EARLY CONVERSION TO MULTIPLE SCLEROSIS AFTER AN OPTIC NEURITIS
A. Tejeda Velarde1 , S. Sainz de la Maza Cantero1 , M. Espiño Martínez1 , I. Toboso del Amo1 , J. C. Álvarez Cermeño1 , L. M. Villar
Guimerans1 1) Hospital Universitario Ramón y Cajal
Introduction
Multiple sclerosis (MS) is a chronic disease of the central nervous system and is the main cause of disability in young adults
from Occidental countries. In most cases multiple sclerosis initiates as a clinical isolated syndrome (CIS), although not all CIS
result in MS. It has been described that CIS topography may influence patient outcome, being optic neuritis (ON) a good
prognostic marker. Previous studies showed that oligoclonal IgG bands (OCBG) predict conversion of ON to MS. However,
the influence of lipid specific IgM bands (OCBM), considered as a marker of highly inflammatory MS, in NO outcome remains
to be explored
Objectives
Our objective was to determine if OCMB detection may predict patient outcome after an NO.
We followed prospectively 30 patients suffering an ON. All were subjected to a lumbar puncture in less than a month after
ON episode. OCGB and OCMB were studied by isoelectric focusing and western blot in paired CSF and serum samples and
patients were followed by a variable time ranging from 1 to 10 years. Conversion to MS measured as the appearance of a
second relapse affecting a different system was monitored
Results
15 patients converted to MS during follow-up. No significant differences in age sex or time of follow-up were observed between converters and non converters.
14 of 15 patients who converted (93.3%) had OCBG, while only 1 of 15 patients who didn’t convert (6.7%) had OCBG. 5 of 30
patients (16.7%) showed lipid specific OCBM.
OCMB associated with earlier conversion to MS in the whole cohort (median survival: 7 months in OCMB+ patients vs 87
months in those lacking these antibodies. Hazard ratio: 389.1 p< 0.0001). It also predicted earlier conversion in patients with
OCGB, that show a high probability of developing MS (Patients who showed OCGB and OCBM had a median survival time
of 7 months while those showing a OCGB and lacking OCMB had a median survival time of 56 months (Hazard ratio 14.05
p=0.008).
Conclusions
Our data show that OCMB predict an earlier conversion to MS after an ON, despite the benign prognosis associated with this
particular CIS topography.
97
O-092 IDENTIFICATION OF KEY GENES AND PATHWAYS INVOLVED IN ENDOPLASMIC RETICULUM STRESS LINKED TO
INTESTINAL INFLAMMATION
B. Martín Adrados1 , J. C. Hernández Walias1 , M. Gómez del Moral1 , A. M. Corraliza2 , A. Salas2 , E. Martínez Naves1 1) Facultad de Medicina. Universidad Complutense 2) Hospital Clinic de Barcelona. IDIBAPS.
Introduction
Different pathological situations can induce Endoplasmic Reticulum (ER) stress, a condition characterized by the accumulation of unfolded proteins within the ER lumen. To respond to these stressful situations cells activate the unfolded protein
response (UPR). ER stress is associated to different inflammatory and autoimmune disorders, including Inflammatory Bowel
Disease (IBD).
Objective
The goal of the present work was to identify key genes and pathways involved in Intestinal Inflammation linked to ER stress.
We analyzed RNA microarrays data obtained from UC patients and healthy controls colonic biopsies. Samples from UC patients with active disease were from: 1) areas with inflammation (UC active involved) and 2) uninvolved proximal segments
(UC active uninvolved). In addition, we analyzed samples from involved mucosa segments of UC patients with quiescent
disease (UC remission).Furthermore, we analyzed the whole-genome transcriptional profile from Caco-2 cells treated with:
1) thapsigargin, a chemical inducer of ER stress, 2) flagellin, which stimulates an inflammatory response trough TLR5 and 3) a
combination of thapsigargin plus flagellin, mimicking an inflammatory response in the presence of ER stress. Expression of
selected genes were further validated by Real Time Q-PCR.
Results
There were no differences in the ER-stress transcriptional profile when we compared samples from healthy controls to UC
active uninvolved samples. In contrast, a clear pattern of up-regulation in UPR transcriptome was observed when we compared UC active involved with control samples or UC remission samples. Interestingly, UC inactive samples showed up-regulation of the of UPR genes when compared to control healthy samples, indicating a clear state of ER stress in the intestinal
mucosa of UC patients with quiescent disease.
Caco-2 cells exposed to flagellin respond up-regulating genes involved in inflammation, mainly chemokines. Top up-regulated genes in Caco-2 by treatment with thapsigargin were those related to UPR, repair of the barrier epithelia and NKG2D
ligands. Exposure to flagellin after thapsigargin treatment of Caco-2 cells resulted in a powerful synergistic effect between
the UPR and TLR signaling showing dramatic quantitative and qualitative transcriptome changes. We identified a large number of genes that could be indicators of inflammation linked to ER stress. Gene set analysis revealed different signaling pathways such as cytokines, NF-KB, UPR, colorrectal cancer metastasis, HMGB1 as well coagulation.
Conclusions
Colonic samples from UC patients with quiescent disease show a transcriptional UPR profile indicating that mucosal tissue
is under ER stress conditions.
TLR signaling and chemically induced UPR synergistically potentiate the inflammatory response in Caco-2 cells. We identified key genes and pathways whose role might be important in the pathology of IBD.
This work supported by a grant from ISCIII, Ref. PI13/00218
98
O-093 CELIAC DISEASE (CD) IN SELECTIVE IgA DEFICIENCY (sIgAd), THE IMPORTANCE OF A DIFFERENTIAL APPROACH
M. J. Martínez Becerra1 , S. Farrais Villalba1 , J. Blas Espada1 , E. Sancho Cadenas1 1) Hospital Universitario Fundación Jiménez Díaz
Introduction
Total selective IgA deficiency (sIgAd) poses a risk for Celiac Disease (CD) 10 times higher than general population. Few studies
focus in sIgAd-CD which, due to peculiarities in immune regulation, might differentiate from IgA-CD.
Objectives
Describe the incidence of sIgAd-CD and its clinical phenotype. Identify the diagnostic antibody profile. Study antibody clearance once gluten free diet (GFD) has been established and compare it vs. an IgA-CD cohort. Test two alternative methods
for IgG tTG and DGP. Check correlation between high levels of IgG tTG and villous atrophy.
All total sIgAd who had been tested for CD (IgG tTG, IgG DGP and IgG Endomisyum -EMA INOVA-) from Dec. 2012 to Jan. 2016 were
retrospectively reviewed. sIgAd patients with either one or plus IgG positive antibody were included. When available, two different
assays for each antibody (IgG tTG and IgG DGP): 1 INOVA -Positive>20 U-; 2 BioPlex CD -Positive>15 U- were evaluated. An IgA-CD
cohort with matched age and follow-up period was randomly selected. Clinical data were collected from medical records.
Results
27 patients were identified. In 7, clinical data were not available. 20 patients were included (100 sera). 19/20 were CD (13/20
belonged to group A: CD newly-diagnosed. 6/20 into group B: CD follow-up). 1/20 had isolated IgG DGP and finally was not
diagnosed of CD, tagged as false positive.
In group A, at diagnosis -age 36 years, 4:1 Female/Male- 70% had double positivity for IgG tTG and DGP, whereas 30% had isolated
IgG tTG. EMA IgG was positive in all patients. Mean pre-GFD antibody levels (xUNL times the Upper Normal Limit) were higher by
Biorad and persisted positive at follow-up (Table1). When performed: 90% (9/10) biopsies were Marsh-Oberhuber 3; 1/10 grade 1.
IgG tTG antibody levels at diagnosis were higher in sIgAd (>17x Biorad) than in control group (13x Biorad).
In group A GFD-adherents, at short-term GFD (6 months) mean reduction in IgG tTG INOVA was 32%, by BioRad 0%. In contrast, mean IgA tTG BioRad clearance at 6 months in a IgA-CD cohort was 66%.
Globally, when tested simultaneously, Biorad showed values on average 10xULN higher compared to INOVA, with high dispersion (range: 0-15xULN).
Conclusion
The lack of IgG DGP in as much as 30% of new diagnosis suggests the importance of a screening strategy based on IgG tTG
in total sIgAd. This study demonstrates the lower rate of antibody clearance compared to IgA-CD, with long-term persistent
antibodies despite a strict adherence to GFD. Our results highlight striking differences in antibody levels showed by two alternative methods which might lead to misinterpretations on follow-up. In line with EPSGHAN recommendations, our results
highlight the need for adjusting the levels associated to villous atrophy to the assay employed.
99
O-094 NLRP3 AND CASPASE-8 ARE INVOLVED IN IL-1Β RELEASE INDUCED BY THE BEE VENOM MELITTIN
F. Martín-Sánchez1 , J. J. Martínez-García1 , L. Rivas2 , P. Pelegrín1 1) Instituto Murciano de Investigación Biosanitaria-Virgen de la Arrixaca (IMIB-Arrixaca) 2) Centro de Investigaciones Biológicas
(CSIC)
Introduction
Melittin, the main component of the bee venom, is a cytolytic molecule reported to be able to induce NLRP3 inflammasome
activation in macrophages. In addition, previous studies have shown that bee venom induces apoptosis through caspase-8/
caspase-3 pathway activation. However, the molecular mechanisms for this inflammasome activation remain poorly understood. Recently, caspase-8 has been suggested to participate in processing and release or IL-1β, meanwhile caspase-3 has
been involved in IL-18 degradation.
Objective
The aim of this study was to understand the molecular cascades by which melittin induce pro-inflammatory cytokine release.
In vitro cultures of human THP1 cells and bone marrow derived macrophages (BMDM) from wild type or different knock-out
mice stimulated in vitro with melittin. Inflammasome activation was evaluated by secretion of IL-1β and IL-18, activation of
caspase-1, cell death and formation of aggregates of the apoptosis speck-like protein with a caspase activating domain (ASC). Results
We found that melittin induces classical NLRP3 inflammasome activation by potassium depletion, leading to the formation
of ASC aggregates, caspase-1 activation and IL-1β maturation and secretion, but interestingly not IL-18. However, the use of
NLRP3, ASC or caspase-1 knock-out BMDMs reduced, but not completely abolished IL-1β release by melittin, being approximately 30% of IL-1β released independent of NLRP3 inflammasome and caspase-1. In addition, as expected, caspase-8/
caspase-3 pathway was induced by melittin in macrophages, this activation was independent on caspase-1. Inhibition of
caspase-8 was able to reduce approximately 30% of the IL-1β secretion induced by melittin. In addition, caspase-8 inhibition
blocked caspase-3 activity leading to an increase in IL-18 secretion.
Conclusions
These results suggest that melittin induces IL-1β processing and secretion mainly via the classical NLRP3/caspase-1 inflammasome pathway, but also by a caspase-8-dependent but NLRP3-independent pathway. In addition, caspase-8 activating
caspase-3 appears implicated in degradation of IL-18 and could explain the lack of IL-18 release induced by melittin.
This work was supported by Sara Borrell postdoctoral grant and research grants from Instituto Salud Carlos III–Fondo Europeo de Desarrollo Regional, and European Research Council.
100
O-095 TLR2, TLR4 AND DECTIN-1 SIGNALLING IN HEMATOPOIETIC STEM AND PROGENITOR CELLS DETERMINES THE
ANTIFUNGAL PHENOTYPE OF THE MACROPHAGES THEY PRODUCE
A. Martínez Albiñana1 , J. Megías Vericat2 , A. Yáñez Boyer3 , H. S. Goodridge3 , D. Gozalbo Flor1 , M. L. Gil Herrero1 1) Universitat de València, Valencia, Spain 2) Universitat de Valencia, Valencia, Spain 3) Cedars Sinai Medical Center, LA, USA
Introduction
TLRs represent an attractive target for the stimulation of myeloid cell production by HSPCs. We have previously demonstrated that (i) HSPCs use TLR2 to sense Candida albicans in vivo and induce the production of macrophages, and (ii) macrophages produced by HSPCs exposed to the TLR2 agonist Pam3CSK4 either prior to or during differentiation exhibit reduced
inflammatory cytokine and reactive oxygen responses [1-4]. In this work, we used an in vitro model of HSPCs differentiation
to investigate the functional consequences for macrophages of exposure of HSPCs to various PAMPs and C. albicans cells.
Mouse HSPCs (Lin− cells) were cultured with M-CSF to induce macrophage differentiation, in the presence or absence of the
following PRR agonists: Pam3CSK4 (TLR2 ligand), LPS (TLR4 ligand), depleted zymosan (which only activates Dectin-1), or C.
albicans yeasts (which activate several PRRs, but principally TLR2 and Dectin-1). Differentiated cell populations were characterized by flow cytometry. The ability of differentiated macrophages to (i) produce cytokines following stimulation by PAMPs
was determined by ELISA, (ii) to phagoytose labeled-yeast cells was determined by flow cytometry, and (iii) to kill viable yeast
was determined by quantification of CFU after coculture, as previously described [1-3].
Results
Our data show that those PAMPs differentially impact the anti-microbial function of the macrophages produced by the exposed HSPCs. Pure TLR2 and TLR4 ligands generate macrophages with a diminished ability to produce inflammatory cytokines.
In contrast, HSPCs activation in response to C. albicans leads to the generation of macrophages that are better prepared to
deal with the infection, as they produce higher amounts of inflammatory cytokines and have higher fungicidal capacity than
control macrophages.
Conclusions
Our data show that detection of PAMPs by HSPCs impacts the antimicrobial function of the macrophages they produce. Therefore, the tailored manipulation of the differentiation process may help to boost the innate immune response to infection.
References
Megías et al. (2012). Stem Cels, 30 (7): 1486–1495.
Megías et al. (2013). Cell Microbiol 15 (7): 1143–1153
Yáñez et al. (2013). Eur J Immunol, 43 (8): 2114–2125
Yáñez et al. (2013). Eur J Immunol, 43 (10): 2526–2533
This work was supported by grant SAF2014-53823-P (Ministerio de Economía y Competitividad, Spain). 39 Congreso de la Sociedad Española de Inmunología
101
O-096 SHIP-1 COUPLES TO THE DECTIN-1 HEMITAM AND SELECTIVELY MODULATES REACTIVE OXYGEN SPECIES PRODUCTION IN DENDRITIC CELLS IN RESPONSE TO CANDIDA ALBICANS
C. del Fresno Sánchez1 , N. Blanco-Menéndez1 , S. Fernandes2 , E. Calvo1 , R. Conde-Garrosa1 , W. Kerr2 , D. Sancho1 1) Centro Nacional de Investigaciones Cardiovasculares Carlos III 2) SUNY Upstate Medical University, Syracuse
Introduction
Dectin-1 (Clec7a) is a C-type lectin receptor that binds Syk through a intracellular hemITAM motif and couples sensing of
pathogens such as fungi to induction of innate responses. Dectin-1 engagement triggers a plethora of activating events, but
little is known about the modulation of such pathways.
Objectives
Define a precise and unbias picture of early Dectin-1 signaling and analyze the functional consequences of these signaling
pathways.
We explored the interactome of the intracellular tail of Dectin-1 in mouse dendritic cells. Interacting proteins were confirmed by western blot and in particular the phosphatidil inositol phosphatase SHIP-1, visualized by confocal microscopy.
Putative functions of SHIP-1 downstream Dectin-1 were studied after generating SHIP-1 deficient CD11c+ GM-CSF-derived
bone marrow cells (GM-BM). In response to Dectin-1 ligands, we measured phagocytosis, cytokine production, activation
of biochemical signaling pathways, reactive oxygen species (ROS) production and killing activity against Candida albicans.
Results
We found binding of SHIP-1 phosphatase to the phosphorylated hemITAM of Dectin-1. SHIP-1 colocalized with Dectin-1 during phagocytosis of zymosan in a hemITAM-dependent fashion. Moreover, endogenous SHIP-1 relocated to live or heat-killed C. albicans-containing phagosomes in a Dectin-1-dependent manner in GM-BM. However, SHIP-1 absence in GM-BM did
not affect activation of MAPK or production of cytokines and readouts dependent on NF-κB and NFAT. Notably, ROS production was enhanced in SHIP-1-deficient GM-BM treated with heat-killed C. albicans, live C. albicans, or the specific Dectin-1
agonists curdlan or whole glucan particles. This increased oxidative burst was dependent on Dectin-1, Syk, PI3K, phosphoinositide-dependent protein kinase 1, and NADPH oxidase. GM-BM from CD11c∆SHIP-1 mice also showed increased killing
activity against live C. albicans that was dependent on Dectin-1, Syk, and NADPH oxidase.
Conclusions
These results illustrate the complexity of myeloid C-type lectin receptor signaling, and how a classically considered activating
hemITAM present in Dectin-1, can also couple to intracellular inositol phosphatases. This particular interaction modulates
selected functional responses and tightly regulates processes such as ROS production that could be deleterious to the host.
102
O-097 VITAMIN B6 REDUCES SKIN INFLAMMATION IN A ZEBRAFISH MODEL OF PSORIASIS
F. J. Martínez Navarro1 , F. J. Martínez Morcillo1 , R. Corbalán-Vélez2 , M. T. Martínez Menchón2 , J. Meseguer Peñalver1 , D. García
Moreno1 , V. Mulero Méndez1 1) Faculty of Biology, University of Murcia/IMIB 2) University Hospital Virgen de la Arrixaca
Introduction
Psoriasis is a skin inflammatory disorder that affects 1-3 % of the human populations. Although several therapies based in
the neutralization of proinflammatory cytokines have been used with relative success, they have important side effects. Therefore, additional treatments are required. We have developed a zebrafish model of skin inflammation based in the transient
genetic inactivation of the Tnfa/Tnfr2 axis. Using a metabolomic approach in this model, we have found reduced levels of
vitamin B6 and increased ones of cystathionine, a marker of vitamin B6 deficiency.
Objectives
The main objective of this study was determining if vitamin B6 was able to inhibit skin inflammation in Tnfr2-deficient zebrafish larvae.
Tnfr2-deficient zebrafish larvae were treated by bath immersion with 0-10 µM Vitamin B6 at 24hours post-fertilization (hpf ) in
the presence of 1% DMSO to facilitate adsorption. Skin inflammation was then evaluated at 72 hpf by checking neutrophil
dispersion and the expression of genes encoding pro-inflammatory mediators by RT-qPCR.
Results
We observed that vitamin B6 was able to reduce neutrophil dispersion of Tnfr2-deficient larvae in a dose-dependent manner.
Studies are in progress to evaluate the mechanism involved in the regulation of skin homeostasis by vitamin B6.
Conclusions
The results of our study point out to vitamin B6 and cystathionine as prognosis markers for psoriasis and suggest that dietary
intake of vitamin B6 may have a profound impact on this disease.
103
O-098 ATF4 REGULATES THE EXPRESSION OF ULBP-1 IN KIDNEY CELLS UPON ENDOPLASMIC RETICULUM STRESS
ACTIVATION
P. Díaz Bulnes1 , A. Baragaño Raneros1 , B. Suarez Álvarez 1 , A. B. Sanz2 , C. López Larrea1 1) Hospital Universitario Central de Asturias (HUCA) 2) Instituto de investigación sanitaria. Fundación Jiménez Díaz
Introduction
Kidney injury is characterized by processes such as hypoxia, inflammation and proteinuria that lead to development and
progression to the kidney disease. These issues induce the Endoplasmic Reticulum (ER) activation, promoting an altered
unfolded protein response (UPR) signalling and promoting a higher apoptosis and inflammation. ER stress is mediated by
three ER transmembrane transducer proteins (ATF6, PERK and IRE1), being the PERK–eIF-2α axis involves in the ATF4 activation. Moreover, it is known that different oxidative stress conditions increase the expression of the NKG2D ligands proteins
(MICA-B and ULBPs1-3 in humans and HL-60, MULT-1, and Rae-1 in mouse) in the kidney. Engagement of these ligands with
their NKG2D activating receptor favours the recognition and lysis by NKG2D-expressing cytotoxic cells.
Objectives
The aim of this study was to analyse the influence of ER stress, activated by different external insults such as hypoxia, inflammation or proteinuria, on the NKG2DL expression during the kidney damage.
Methods
The human (HK2) and mouse (MTC) kidney tubular epithelial cells were used. ER stress was induced in these cells by treatment with tunicamycin or amino acid starvation. Quantitative RT-PCR was used to analyse the expression of NKG2DL and
ER stress genes. NKG2DL cell surface expression was analyzed by flow-cytometry. To analyze the direct role of ATF-4 in
NKG2DL-expressing HK2 cells, a specific siRNA was used. An in-vivo mice model of acute kidney injury (AKI) was induced by
intraperitoneal injection of 250 mg/kg acid folic.
Results
Firstly, we observed that ER stress activation by tunicamycin (0.5 μg/ml, 24h) and amino acid starvation (cultures in serumfree RPMI medium) in HK2 cells induce the expression of ATF4, as well as another genes related to UPR signalling (GRP78,
XBP1, and CHOP). Moreover, the gene expression of ULBP1 was highly upregulated (more than 60 times) while the rest of
ligands (MICA, MICB, ULBP-2 and ULBP-3) remain unchanged. Further, we examine the involvement of ATF4 in the regulation
of ULBP1 using a specific siRNA for ATF-4 gene. Blockage of the ATF-4 expression (80% inhibition), significantly downregulates the ULBP-1 expression levels in HK2 cells. Similar results were observed in the murine MCTs cells; where upregulation
of ATF-4 by tunicamycin correlates with an increased expression of the murine NKG2DL homologous to ULBP1, MULT-1.
Additional studies in a mouse model mediated by acid folic reveal that the expression of MULT-1 was also increased during
the kidney damage.
Conclusions
ER stress activation in kidney cells induces the expression of the transcription factor ATF-4, which binds to the promoter regions of the human ULBP-1 and murine MULT-1 NKG2DL regulating their expression. Our data suggest that ATF-4 could have
an essential role in the regulation of ULBP-1 and MULT-1 during the kidney damage.
Funding: This work was supported by Instituto Carlos III (PI12/02587) and FICYT (GRUPIN14-030).
104
O-099 INTRACELLULAR VS EXTRACELLULAR C3 DIFFERENTIALLY REGULATE T- AND B-CELL IMMUNOBIOLOGY IN
PRIMARY (DUE TO C3 MUTATIONS) VS SECONDARY (DUE TO FACTOR I MUTATIONS) C3-DEFICIENCY
A. Jiménez-Reinoso1 , A. V. Marin1 , A. López-Lera2 , S. Rodríguez de Córdoba3 , E. Román-Ortiz4 , M. López-Trascasa2 ,
J. R. Regueiro1 1) Complutense University and Hospital 12 de Octubre Health Research Institute 2) Hospital Universitario La Paz, Centro de
Investigación Biomédica en Red de Enfermedades Raras (CIBERER), IdiPAZ 3) Centro de Investigaciones Biológicas (CSIC) and
Centro de Investigación Biomédica en Red de Enfermedades Raras (CIBERER) 4) Hospital La Fe
Introduction
Liver-derived plasma or extracellular C3 (eC3) can influence adaptive immunity through eC3-specific leukocyte surface receptors, as shown in B lymphocytes. Leukocyte-derived C3 may contribute locally to the eC3 pool, but it has been reported
to be involved also in the delivery of critical intracellular C3 (iC3) cues required, for instance, for T cell differentiation and
function.
To distinguish between eC3 and iC3 signals, we studied T cell and B cell differentiation and function in primary eC3-deficient
individuals due to homozygous mutations, which might impair both types of signals, and compared them with secondary
eC3-deficient individuals due to homozygous Factor I deficiency, which would impair only eC3 signals. As controls with
normal eC3 and iC3 signals, healthy donors and C2 deficient individuals were included. PBMC and iC3 phenotyping were
performed by FACS and/or fluorescence microscopy. T and B cell function were studied using CFSE dilution to monitor proliferation against different mitogenic and antigenic stimuli. Cytokine induction was measured by BD™ Cytometric Bead Array
and by intracellular flow cytometry.
Results
In vivo naïve B cell differentiation to both switched and non-switched memory B cells was selectively impaired in both primary and secondary eC3 deficiency, supporting that eC3 cues were required. These results correlated with eC3 levels when
heterozygous eC3-deficient individuals were studied. In contrast, B cell function measured ex vivo as the proliferative response to PWM or in vivo as specific antibody titers were essentially normal and thus eC3-independent. T cell differentiation
and function was mostly normal in PBMC from secondary eC3 deficiency but unexpectedly also in primary eC3 deficiency,
which prompted us to study their iC3 content. The results showed that T cells from primary (and secondary) eC3-deficient
individuals contained iC3 fragments despite their severe C3 mutations, which may explain their normal ex vivo T cell features.
However, transformed T cells from primary eC3-deficient individuals showed impaired cytokine induction in vitro.
Conclusions
Signals from eC3 rather than iC3 are required for normal B cell differentiation in a plasma C3 level-dependent fashion, whereas certain B cell functions are eC3-independent. In contrast, mutations underlying severe eC3 deficiency do not cause an
equivalent iC3 deficiency in T cells, which thus receive sufficient iC3 signals for some (PBMC phenotype and proliferation in
response to mitogens), but not all (cytokine induction), differentiation and functional features.
Grants
CAM S2010/BMD-2316; MINECO SAF2011-24235/BES-2012-055054, SAF2012-38636, SAF2014-54708-R; LAIR 2012/0070.
105
O-100 EXTRACELLULAR VESICLES FROM ADIPOSE TISSUE-DERIVED MESENCHYMAL STEM CELLS REDUCE THE
INFLAMMATORY MEDIATORS PRODUCTION BY PERITONEAL MACROPHAGES
M. D. C. Carceller Zazo1 , M. I. Guillén Salazar1,2 , M. J. Alcaraz Tormo1 1) Universitat de València 2) Universidad CEU Cardenal Herrera
Introduction
Studies of adipose-derived mesenchymal stem cells (ASC) secretome have demonstrated their anti-inflammatory properties
in inflammatory diseases. Little is known about the extracellular vesicles (EV), microvesicles (MV) and exosomes (Ex), from
the secretome of ASC and their effects on cells from the innate immune system.
Objectives
The aim of this study was to evaluate the effect of EV from ASC secretome on different macrophage inflammatory markers
in the early immune response.
ASC were isolated from perigonadal adipose tissue from male CD1 mice and seeded with medium with 15% exosome-depleted fetal bovine serum. MV and Ex were isolated from the secretome of ASC at passage (P)0, P1 and P2 by differential (ultra)
centrifugation. Size and concentration of MV and Ex were determined with tunable resistive pulse sensing (IZON).
Resident macrophages were isolated from the peritoneal cavity of male CD1 mice. Phenotypic characterisation was performed with positive markers CD11b-APC and F4/80-Alexa Fluor 488® by flow cytometry. Cells were seeded into 24-well plates.
Macrophages were stimulated during 20h with LPS (1 µg/ml) and treated with Ex and MV in a concentration range of 72x106/
ml-9x105/ml and 18x106/ml-9x104/ml, respectively, and a combination of both MV and Ex. Inflammatory mediators were
determined in the macrophage supernatant. Interleukin (IL)-1β, Tumor Necrosis Factor (TNF)-α and Keratinocyte Chemoattractant (KC) levels were quantified by ELISA. Prostaglandin E2 (PGE2) and Nitric oxide (NO) production were measured by
radioimmunoassay and fluorometric determination, respectively.
Results
Resident peritoneal macrophages were positive for CD11b and F4/80 markers. Stimulation of macrophages with LPS (LPS
group) significantly raised the production of all inflammatory parameters. Secretomes at P0, P1 and P2 reduced the production of these inflammatory mediators.
MV and Ex from secretome at P0, P1 and P2 significantly decreased the production of KC by macrophages treated with all
concentration assayed in comparison with LPS group. However, only the MV and Ex from P1 were able to significantly decrease the other inflammatory mediators evaluated.
Ex significantly decreased the levels of IL-1β, TNF-α and NO at a concentration of 18x106/ml in comparison with LPS group.
MV significantly reduced the levels of NO at the 9x104/ml concentration and TNF-α at all concentrations assayed, in comparison with LPS group.
When added both MV and Ex, only the levels of KC, NO and PGE2 diminished significantly but this inhibitory effect was not
higher than that of MV or Ex alone.
Conclusions
These results suggest that Ex and MV play an important role in the regulation of inflammatory processes in the innate immune system. Ex and MV could be a potential treatment in the early state of inflammatory diseases.
M.C. Carceller was supported by a fellowship (FPU) from MECD.
106
O-101 SLAMF8 MODULATES MOLECULAR PATHWAYS, ENDOCYTIC TRAFFICKING AND MICROBICIDAL MECHANISMS
IN MICE INFECTED WITH SALMONELLA ENTERICA SEROVAR TYPHIMURIUM
S. Romero Pinedo1 , R. Martínez Aguilar1 , R. Muñoz Fernández1 , A. C. Abadía Molina1 1) CIBM, Universidad de Granada
Introduction
SLAMf8, a member of the SLAM receptor family expressed in macrophages upon IFN-g or bacteria stimulation, is a negative
regulator of NADPH oxidase activity through PKC activation. In addition, SLAMf8 is able to modulate RAC1/2 membrane
mobilization and actin polymerization through p38MAPK pathway. Moreover, in vivo assays with Salmonella enterica serovar
Typhimurium (S. typhimurium) have shown an enhanced bactericidal activity in SLAMf8-ko compared with the wild type
mice. Furthermore, in vitro assays shown that SLAMf8 modulates the induction of nitric oxide synthase in macrophages,
microbicidal mechanism modulated by ERK and p38MAPK pathways.
Objectives
The aim of this study was to determine whether SLAMf8 might modulate pathways and protein involved in the clearance and
trafficking of Salmonella-containing vacuoles (SCVs) in vitro, and microbicidal mechanisms using in vivo assays.
Thioglycollate-elicited macrophages were isolated from the peritoneum of SLAMf8-ko and wild type mice. Macrophages
were treated with IFNγ and infected with S. typhimurium, and the protein extract was obtained or immunofluorescences were
performed in order to study the trafficking of SCVs by confocal microscopy. SLAMf8-ko and wild type mice were infected
intraperitoneally with S. typhimurium, sacrificed and peritoneal cells and spleens were lysed in the appropriated lysis buffer
to obtain total extract. The proteins extract were resolved in SDS-PAGE, blotted and probed with the respective antibodies.
Results
We observed that upon Salmonella stimulation in vitro, SLAMF8-ko macrophages had higher c-Src Tyr416 phosphorylation,
active form of this kinase, and lower SHIP-1 Tyr1020 and SHP-1 Tyr564 phosphorylation, active form of these phosphatases,
than wild type macrophages. When we study the trafficking of S. typhimurium through endosomal comparments, SLAMF8ko macrophages had higher Rab5A colocalization in SCVs, than wild type macrophages. Furthermore, in concordance with
previous in vitro studies, SLAMf8-ko mice had higher nitric oxide synthase induction than their wild type counterparts, when
they were intraperitoneally infected with S. typhimurium.
Conclusions
SLAMf8 modulates the phosphorylation of active form of c-Src kinase, probably through SHIP-1 and SHP1 phosphatases
activity. A higher phosphorylation of active form of c-Src kinase, would promote a higher NADPH oxidase activation through
PKC, pathway involved in the S. typhimurium clearance. In addition, SLAMF8 modulates the trafficking of SCVs through Rab5A. Finally, SLAMf8 regulates the nitric oxide synthase induction as microbicidal mechanisms in vivo experiments.
This work was supported by grants from the Ministry of Education and Science (SAF2007-62562) & Ministry of Science and Innovation (PI10/01096) of Spain.
107
O-102 ROLE OF IL-7R ACTIVATING MUTATIONS IN THE PATHOGENESIS AND PROGRESSION OF T-ALL
A. Murcia Ceballos1 , S. González García1 , M. García Peydró1 , J. Alcain Sánchez1 , A. Álvarez Ferrando2 , M. L. Toribio García1 ,
P. Fuentes Villarejo1 1) Centro de Biología Molecular “Severo Ochoa”, CSIC-UAM, Madrid (Spain) 2) Institute for Cancer Genetics, Columbia University,
New York (USA)
Introduction
T-cell acute lymphoblastic leukemia (T-ALL), one of the most common pediatric cancers, is caused by the oncogenic transformation of T-cell precursors during their development in the thymus. Several studies, including ours, have shown that human
T-ALLs commonly express functional receptors for interleukin-7 (IL-7R), a cytokine which plays a crucial role in human T-cell
development and which contributes as well to T-ALL proliferation. Recently, gain-of-function IL7R mutations have been described in about 10% of T-ALL and B-ALL patients, indicating that IL7R can be an oncogene. However, the mechanisms through which these IL7R mutations promote leukemia are poorly understood; and the molecular bases underlying the frequent
failure of chemotherapy resulting in relapse in these patients remain to be identified.
Objectives
We aimed at investigating the oncogenic impact of a novel gain-of-function mutation identified in IL7R exon 6 of a T-ALL
patient, as a model to identify molecular effectors implicated in the leukemogenic process.
We ectopically overexpressed a mutated gain-of-function IL7R identified in a T-ALL patient by lentiviral transduction of growth factor-dependent cell lines. The functional impact of the mutation was first assessed in vitro by proliferation, apoptosis
and biochemical assays aimed to dissect the signaling pathways involved in cell proliferation. Moreover, the oncogenic effect
of the mutation was next assessed in vivo, by transplanting mutant cells into immunodeficient mice.
Results
We found that expression of the IL7R exon 6 mutant promoted cytokine-independent cell proliferation and apoptosis prevention in vitro, likely due to expression of a homodimeric IL-7Ra receptor resulting from disulfide bond formation. Regarding the mechanism involved, we observed that cells expressing the mutated receptor displayed constitutive activation of
JAK-STAT, MAPK and mTORC1 pathways, independently of PI3K-Akt activation. More importantly, in vivo studies showed that
expression of the IL7R mutant resulted in a growth advantage of transduced cells, which induced an oncogenic expansion
in a xenotransplantation model.
Further analyses of signaling pathways responsible for the oncogenic progression of cells expressing the IL7R exon 6 mutation revealed that constitutive mTORC1 activation and cell proliferation in mutant cells was dependent on amino acid
availability. Moreover, we found that expression of amino acid transporters, together with the c-Myc oncogene, is induced
downstream of IL-7R-mediated signaling. Therefore, expression of constitutively active IL-7R exon 6 allowed us to identify a
new metabolic pathway downstream IL-7R with important implications in tumor progression.
Conclusions
The identification of an alternative mTORC1 activation pathway, independent of Akt but dependent of amino acid sensors,
points to these molecules as promising therapeutic targets for treatment of T-ALL and B-ALL that express either a mutant or
a wild type IL-7R.
108
O-103 CYTOMEGALOVIRUS INDUCES EXPANSION OF HIGHLY POLYFUNCTIONAL CD4+ T CELL SUBSET COEXPRESSING
CD57 AND CD154
A. Pera1 , A. Vasudev 2 , C. Tan 2 , H. Kared 2 , A. Larbi 2 , R. Solana 1 1) IMIBIC - Hospital Univ. Reina Sofía - Universidad de Córdoba 2) Singapore Immunology Network (SIgN), A*STAR, Singapore
Introduction
CD4+ T cells are essential for HCMV (human cytomegalovirus) infection control. CMV-specific CD4+ T cells display antiviral functions and are crucial for B cell and CD8+ T cell activation. In the elderly, CMV infection impairs immunity to other viruses and has been traditionally described as an important contributor to T cell senescence.
Objectives. Recent results suggest that in the early stages of life, CMV confers immune protection against other pathogens
(heterologous immunity). To clarify these controversial results, we analysed the effects of latent CMV infection on the quality
of the immune response in young individuals.
The presence of polyfunctional T cells, through an extensive phenotypic and functional characterization of the CD4+
T cell subset. CD154 expression, degranulation (CD107a), and cytokine production (IFN-gamma, TNF-alpha, and IL-2), as
well as T cell phenotype markers (CD57, CD28, CD27), was analysed in young healthy donors stratified by CMV serostatus.
Results
We show that CD4+ T cells co-expressing CD57 and CD154, which are exclusively present in CMV-positive individuals, are
the most polyfunctional CD4+ T cell subset, whereas CD4+CD27+CD28− T cells are associated with lower polyfunctionality.
On the other hand, the CD4+CD28+ T cell frequency correlates with higher polyfunctionality in CD4+CD57− T cells from
CMV-seronegative individuals and CD4+CD57+CD154+ T cells from CMV-seropositive individuals. Thus, polyfunctionality is
a property of central memory CD4+ T cells in CMV-seronegative individuals, while after CMV infection, polyfunctional T cells
become highly differentiated allowing efficient eradication of infections.
Conclusions
Our resuts extend previous observations of the impact of CMV on CD8+ T cell functionality to the CD4+ T cell compartment,
revealing CD57 as a polyfunctionality marker of T cells, which is expanded following CMV infection. CD57+ T cells have been
implicated in inflammatory conditions, but its potential role in the response against infectious disease and vaccination has
to be investigated.
109
Pósteres
P-001 DESENSITIZATION FOR THE TREATMENT OF HYPERSENSITIVITY REACTIONS TO ETANERCEPT IN 2 PATIENTS
WITH POSITIVE BASOPHIL ACTIVATION TEST
R. de La Varga Martínez1 , D. Gutiérrez Fernández2 , G. A. Añez Sturchio3 , A. M. Fernández Rodríguez3 , J. A. Andrés García4 ,
F. Medina Varo3 1) Hospital Universitario Puerta del Mar, Cádiz 2) Hospital Universitario Puerta del Mar, Cádiz 3) Hospital Universitario Puerta del
Mar, Cádiz 4) Hospital Universitario Puerta del Mar, Cádiz.
Introduction
Etanercept (ETN) is a human fusion dimeric protein that acts as a competitive inhibitor of the TNFα and TNFβ cell surface
receptor. ETN is considered a first line treatment for psoriatic arthritis as well as other rheumatic diseases.
Immune-mediated adverse reactions to ETN reported in the literature include injection site reactions (ISRs) and immediate
systemic hypersensitivity reactions that impede the use of the drug in sensitized patients whose treatment consists of desensitization in order to create tolerance to the drug.
Objective
We present two patients diagnosed with psoriatic arthritis (PsA) that developed a hypersensitivity reaction to ETN and also
present a positive basophil activation test (BAT) for the drug in which a desensitization protocol was successful.
Patient 1: 52 year old woman diagnosed with PsA that after the fifth weekly dose of ETN presented erythema, pruritus and
intense edema in the injection site that persisted for 12 hours.
Patient 2: 37 year old woman diagnosed with PsA. Two hours after the administration of the second dose of ETN developed
pruritus, erythema and local edema in the injection site followed by generalized urticaria without angioedema that persisted
during four days and required treatment with antihistamines and methylprednisolone.
BAT is a potent tool for the detection of IgE-dependent allergies in vitro. The activation of basophils by the BAT can be monitored by the determination of the upregulation of CD63 surface expression using flow cytometry.
Results
Skin prick and intradermal tests with etanercept were negative in both patients. The BAT to ETN in both patients was positive.
The percentage of activated (CD63+) basophils (SSClow/CD203chigh) stimulated with ETN was of 75% in patient 1 and of 58%
in patient 2.
The desensitization protocol consisted in the subcutaneous administration of 8 dosages until a therapeutic accumulative
dose of 50 mg was reached. At 15 days of desensitization each patient received a full dose of ETN in both arms (to avoid
mayor drug deposits) and at the end of the month the full dose in one arm. During the following 8 months the patients have
been tolerating the administration of 50 mg a week without adverse effects.
Conclusions
BAT offers the opportunity of detecting IgE-dependent drug allergies in vitro avoiding complications from drug provocation
tests.
Our protocol allows etanercept desensitization in one day while other described protocols up to date last 3 days.
Rapid desensitization offers new perspectives for the continuation of biologic therapy after a hypersensitivity reaction that
can benefit patients without an adequate alternative.
110
P-002 MOLECULAR ANALYSIS OF BICLONAL FOLLICULAR LYMPHOMA SUGGESTS THE PARTICIPATION OF THE
RECEPTOR EDITING MECHANISM
P. Jiménez Gámiz1 , M. E. Alonso Sarasquete2 , P. Montes Ramos1 , P. Garrido Collado1 , F. Ruiz-Cabello Osuna1 , M. González Diaz2 1) Complejo Hospitalario Universitario de Granada 2) Hospital Universitario de Salamanca
Introduction
Follicular lymphoma (FL) results from the malignant transformation of mature B cells and involves the aberrant proliferation
of germinal center (GC) B cells. The hallmark and most recurrent feature of FL is the t(14;18) (q32;q21) chromosomal translocation. But the translocation alone is insufficient for malignant transformation of B cells and multistep process is required for
FL development. These mechanisms are still unknown.
Here we describe a FL case in a 56 year old woman in which flow cytometry analysis showed different pattern of immunoglobulin light (IgL) chain expression: monoclonal Igκ+ in cervical lymph node (LN) tumor cells and biclonal Igκ+λ+ in peripheral
blood (PB) tumor cells.
Objectives
Elucidate the molecular basis for the striking phenotype detected by flow cytometry.
Case report:
A 56 year old woman was referred because of systemic lymphadenopathy. A cervical LN biopsy was consistent with a FL
grade 2. FISH analysis of LN and PB cells revealed the t (14;18) translocation in 85-90% of cells analyzed.
Flow cytometry:
Cells obtained from LN and PB were analyzed with a flow cytometer (FACS Canto II) using monoclonal antibodies specific for
CD45, CD19, CD20, CD10, CD22, CD23, CD200, FMC7, Igκ and Igλ chains (Becton Dickinson).
P.C.R:
DNA extracted from biopsied LN cells and PB cells was amplified for the IGH and IGκ and IGλ loci in accordance with the
protocol of the BIOMED-2 (2003).
Genescan analysis:
Fluorescence labelled PCR products were tested by capillary electrophoresis and GeneScan analysis (ABI 3130 Genetic
Analyzer; Applied Biosystems).
Sequence analysis of PCR products:
PCR products from amplification of the IGH and IGL genes rearrangements were sequenced by an ABI 3130.
Results
Flow cytometry analysis revealed similar expression of following antigens in LN and PB tumor cells: CD19+lo, CD10++,
CD20+, CD22+. These features were consistent with a diagnosis of FL. Surprisingly, the surface IgL chain expression was different in both samples: in LN we detected a monoclonal pattern (Igκ=97%, Igλ=3%), while in PB the expression was biclonal
(Igκ=65%, Igλ=35%). Molecular analysis of IGH locus presented an identical monoclonal pattern in both samples. Monoclonal rearrangements were also detected at IGκ and IGλ loci. Furthermore the IgH and IgL rearrangements in both samples
shared the same CDR3.
Conclusions
Tumor cells from LN and PB showed an identical IGH rearrangemet. This indicated that Igκ+ and Igλ+ clones shared the same
IgH chain with different IgL chain. These results suggest that the two clones derived from the common progenitor cells. It
is possible that Igλ expressing cells would have arisen subsequent to a receptor editing process executed in order to avoid
self-reactivity of Igκ clone. The t(14;18) translocation could promote the survival of the auto-reactive Igκ clone.
111
P-003 KOUNIS SYNDROME: A RARE IGE- MEDIATED HYPERSENSITIVITY SYNDROME
M. Jiménez Leon1, O. Verdeguer2, V. Cunill1 , Á. Molina1 , J. Milá1 , J. Pons1 1) Hospital Son Espases 2) Hospital Clínico
Introduction
Kounis syndrome (KS) is defined as the co-incidental occurrence of an acute coronary syndrome (ACS) with hypersensitivity
reactions following an allergenic event. Mast cells and their products are crucial for the pathogenesis of KS. Their activation
leads to degranulation of preformed inflammatory mediators, increased production of arachidonic acid-derived mediators,
and increased gene expression to produce cytokines and chemokines. These mediators are responsible for plasma extravasation and tissue edema, inflammation and leukocyte recruitment, bronchoconstriction and mucus secretion. In heart
tissues mast cells are abundant; they might contribute to coronary artery thrombosis.
Case Report
We report the case of a 50-year-old woman, without antecedents of cardiovascular diseases, who developed dyspnoea, tonic
seizures, apnea and bradycardia during an odontological procedure to place a natural latex rubber dam over the tooth. She
was receiving an intravenous infusion of amoxicillin/clavulanic acid, dexketoprofen, ranitidine and methylprednisolone. At
the time of emergency medical services evaluation, the patient was unconscious, with respiratory arrest, palpable carotid
pulse, but systolic blood pressure was undetectable. She also developed right conjugated gaze deviation, central cyanosis
and diffused erythema. An ECG showed a ventricular rate of 113 beats per minute, with ST-segment depression (2 mm) in
leads II, III, aVF, V3-V6. The patient was admitted to the ICU where mechanical ventilation and vasoactive drugs were required.
Blood tests revealed elevated elevated levels of troponine I and CKMB.
Skin test with amoxicillin, penicilloyl polylysine (PPL), minor determinant mixture (MDM), cefuroxime and latex were performed. Serum specific IgE-antibodies against amoxicillin and latex were determined by a fluorescence enzyme immunoassay
(ImmunoCAP®). Basophile activation test (Allergenicity®) also was performed.
Results
Skin prick testing was positive for amoxicillin and negative for PPL, MDM, cefuroxime and latex. Serum-specific IgE against
amoxicillin as well as the basophile activation/degranulation test were positive (CRTH2posCD203cbrightCD3neg). Cefuroxime, NSAIDs, ranitidine, corticosteroids and contact with latex are well tolerated at the moment.
Conclusions
We present a case of immediate type of allergic reaction to amoxicillin with clinical manifestation of anaphylaxis and acute
coronary syndrome. Cardiac involvement in allergic reactions to drugs is rare, and represents an important clinical finding
during an anaphylactic reaction. KS is caused by the effect of pro-inflammatory mediators massively released by mast cells
in heart tissue and in coronary arteries and plaques. Because a number of stimuli can trigger mast cell degranulation, primarily IgE-mediated allergic reactions, it is conceivable that any allergic reaction might potentially facilitate coronary spasm or
plaque disruption.
112
P-004 SERUM LIGHT CHAIN IMMUNOFIXATION IS A GOOD SCREENING METHOD FOR MONOCLONAL GAMMOPATHIES
COMPARED WITH SERUM PROTEIN ELECTROPHORESIS
M. El Amri1 , S. Mora1 , M. D. Pérez Méndez1 , E. Paz-Artal1 , D. E. Pleguezuelo.1 1) Hospital Universitario 12 de Octubre, Madrid
Introduction
Monoclonal gammopathies are characterised by the production of monoclonal immunoglobulins or free light chains by an
abnormal plasma cell or B-cell clone and may indicate malignancy. Although there is currently no consensus on the initial
test or combination of tests to be perfomed when monoclonal gammopathies are suspected, Serum Protein Electrophoresis
(SPEP) and Urine Protein Electrophoresis are commonly requested as screening investigations. If any of these tests result
abnormal, immunofixation of serum (IF) or urine are performed to confirm the presence of a paraprotein and determine the
involved heavy and light chains. Due to the low sensitivity of SPEP we evaluated an alternative screening tool to detect true
positive samples missed by SPEP.
Objective
To compare SPEP and Kappa and Lambda Light Chain Immunofixation (KLIF) for their ability to detect true monoclonal
gammopathies.
We studied 86 serum samples from our cohort of patients diagnosed with serum paraproteins and 4 healthy controls. The
diagnosis had been previously made using IF, which we used as our gold-standard method. We performed SPEP and KLIF
of our total 90 samples and evaluated the number of true positives samples missed using each technique. SPEP was made
using Sebia Hydragel 15 Protein(E) kit following manufacturer’s instructions in a Hydrasis2. KLIF was reasessed using previously made IF, analyzing only the lines of IF gels corresponding to Kappa and Lambda light chains. IF was made using Sebia
Hydragel 4IF kit following manufacturer’s instructions in a Hydrasis2. Both SPEP and IF gels were evaluated directly and also
scanned and treated with Sebia Phoresis software by an immunochemistry experienced independent observer who was
blind for IF results.
Results
Among 86 positive samples measured by IF, 16 were not detected by SPEP and 2 were not detected by KLIF, rendering a sensitivity of 81% for SPEP and 97% for KLIF. Among 16 samples missed by SPEP 12 had weak monoclonal paraproteins, 2 had
weak light-chains-only monoclonal bands and 2 samples were typed as IgA migrating in beta region of the proteinogram.
Among the 2 samples missed by KLIF, one of them was a heavy-chain-only monoclonal band and the other one was a weak
IgG-Kappa paraprotein.
Conclusions
KLIF led to the detection of all monoclonal bands missed by SPEP and could be considered as a valid screening tool for serum
paraproteins.
Limitations
This is a retrospective study performed with 86 known abnormal samples. The evaluation of a larger number of normal samples is ongoing, so will be able to evaluate the specificity of SPEP and KLIF method in our cohort.
113
P-005 IN VIVO LONG TRACING OF CD19+ DERIVED CELLS
M. D. C. Prado Zamora1 , M. Rodríguez García1 , C. Ruiz Sánchez1 , M. Alía Moral1 , I. Cortegano Jimeno1 , B. de Andrés Muguruza1 ,
M. L. Gaspar Alonso-Vega1 1) Instituto de Salud Carlos III
Introduction
Adult mouse spleen harbors cells with a CD19+CD45R-/lo phenotype. These cells persist through the life span of the mouse
and, although showing functional differences with CD19+CD45R+ and B1 cells, share characteristics with B1 cells being
B1-related (B1-rel). In the mouse embryo, the first committed B lymphocytes share this phenotype and appear in fetal liver
at E11, earlier than “conventional” CD19+CD45R+ B lineage, which are detected at E13-E14.
Objectives
To trace the embryonic origin of adult B1-rel cells in vivo. To analyze the mean life of different CD19+ cell derived populations
in relation to the B1-rel cells.
Tg(CD19-cre/ERT2)1Sjv (CD19-cre) transgenic mice expressing the OH-tamoxifen (OH-T)-inducible Cre recombinase under
the control of human CD19 promoter and the reporter line B6.129X1-Gt(ROSA)26Sortm1(EYFP)Cos/J (ROSA26-EYFP), were maintained in a SPF facility. The CD19-cre mice were selected to obtain a homozygous line. CD19-cre x ROSA26-EYFP were intercrossed to get a hybrid F1 progeny. The presence of CD19-cre/ERT2 gene was determined by PCR.
OH-T was administered i.p. for 2-4 consecutive days. Different protocols were tested to get the optimum conditions for injections to pregnant females, lactating mothers and adult mice. At the indicated gestational ages, single-cell suspensions
were obtained from previously isolated fetal livers (FL). Spleen (SPL), bone marrow (BM), peyer patches (PP), peritoneal wash
cells (PWC), peripheral blood leucocytes (PBL), inguinal ganglion (IG), thymus (T) and peyer patches (PP) were dissected from
postnatal or adult animals. Cell suspensions were stained with monoclonal antibodies and analyzed by flow cytometry.
Results
The OH-T administration in pregnant females (at E11-E14) induces a nonproductive delivery, but CD19+EYFP+ cells are detected in E19 fetuses. Further experiments performing caesareans at E20 to get viable fetuses with foster mothers are being
performed. OH-T administration in lactating females induces the presence of CD19+EYFP+ cells in the progeny mice up to
2 months later. The EYFP signal induced by the OH-T administration in 2-months old mice persist up to 20 months after the
treatment. This signal is restricted to CD19+ B Lymphocytes and to CD19-CD138+ plasma cells. EYFP+ signals are preferentially maintained on B1-rel cells.
Conclusions
These results are consistent with the long life and the embryonic origin of the B1-rel cells presented in adult spleen previously reported by our laboratory.
114
P-006 DIFFERENCES IN THE IMMUNOLOGICAL PROFILE OF PATIENTS ALLERGIC TO FRUITS IN THE EAST OF SPAIN
M. V. Moreno Cantó1 , E. Caparrós Cayuela1 , E. Flores Pardo2 , L. I. Velásquez Castrillón1 , F. Gómez Pérez4 , F. J. Fernández Sánchez3 1) Universidad Miguel Hernández de Elche 2) Hospital Universitario de San Juan de Alicante 3) Hospital General Universitario de
Alicante 4) Hospital Regional Universitario de Málaga
Introduction
The prevalence of food allergies has increased in several regions of the world, affecting 2.5% of the general population. The
prevalence of food allergy in Spain is 7.4% with an implication of fruit in 33% of cases. Peach belongs to the family Rosaceae
and is the fruit that most often cause allergies. Other fruits inducing allergic reactions: kiwi, mango, pineapple, melon, watermelon, avocados and grapes. The molecular components associated with plant food allergies are profilins, seed storage
proteins, and pathogenesis related proteins such as non-specific lipid transfer proteins(LTPs).
Objectives
The aim of this study was to undertake a representative study of the immunological profile of fruit allergy in East of Spain and
to compare this profile with the observed in other regions of Spain.
We studied a sample of 308 patients who attended the allergy office due to fruit allergy, 175 from East region and 133 from
other regions of Spain. Skin Prick Tests were performed at the first and also in monitoring visits with foods extracts of different species of fruits. Serum specific IgE to fruits were measured by the ImmunoCAP. In order to study molecular components, technical ISAC platform was used. The individual allergens included in the diagnostic related with allergy fruit were:
Pru p1 and Pru p3(peach), Mal d1(apple) and Act d1, Act d2(kiwi).
Results
The final population sample therefore comprised 213 adult patients, 110 from the East region. Statistically significant differences exist for Pru p3 between the Eastern part of Spain and the other regions studied. The Pru p3 was responsible for most
of the allergic symptoms to peach, respiratory symptoms, anaphylaxis and digestive symptoms while the Pru p1 presented
increased risk of anaphylaxis. The molecular allergen of kiwi, Act d2 was the main cause of allergic symptoms of this fruit, oral
and skin symptoms, while the Act d1 digestive disorders. For apple, molecular component thereof, Mal d1, cause of 0.5% of
anaphylaxis.
Seventy six percent the patients present an allergy to pollen, being the most common causing allergic symptoms in patients
olive and oriental plantain. We detected differences between Eastern Spain and the rest of areas analyzed, but for pollens of
Parietaria spp. and Salsola spp.
Conclusions
The immunological profile of patients allergic to fruit from East of Spain differs from other regions studied in their sensitization to fruits, pollens and allergen components. The East of Spain has a high frequency of Pru p3 and Act d2, accounting for
87% of sensitization, and therefore these allergens should always be included in the diagnostic panel. The study of molecular
components provides is very important for patients allergic to fruits.
115
P-007 TOLEROGENIC AND TH2 PROMOTER FACTORS IN ORAL ALLERGY SYNDROME
A. Mora González1 , L. Velasquez Castrillón2 , E. Caparrós Cayuela2 , J. Fernández Sánchez3 , P. Aparicio Alonso4 , G. Rubio Pedraza4 1) Hospital Universitario Morales Meseguer 2) Universidad Miguel Hernández 3) Hospital General Universitario de Alicante 4)
Universidad de Murcia
Introduction
Oral allergy syndrome (OAS) or pollen-food allergy syndrome is caused by cross-reactive proteins found in both pollen grains
and vegetable food. For unknown reasons OAS is developed over time by approximately 20% of pollinic subjects. Soluble
HLA-G isoforms (sHLA-G) and thymic stromal lymphopoietin (TSLP) can be detected in oral secretions and their levels may
provide clues to the possible involvement of imbalanced signals at oral mucosa on sensitization of these patients.
Objectives
To evaluate sHLA-G and TSLP levels in oral fluid from patients suffering from pollinosis and their relationship to different
severity grades of hypersensitivity to plant food allergens.
A total of 77 adults (18 with OAS, 30 with pollen allergy and plant food allergy with systemic affectation and 29 normal
controls) were enrolled. Skin pricks and specific IgE tests were performed to measure allergic sensitization. Patients and controls were given a 0.5 g cotton swab that was chewed for 1-2 min, placed in a tube with 10µL of protease inhibitor cocktail
containing AEBSF and aprotinin among others, and centrifuged 1000xg. The clear liquid was collected and frozen. sHLA-G1
and -G5 isoforms were measured using home-made ELISA with MEM-G/9 as capture layer, biotinylated W6/32 as reporter
and streptavidin-HRP conjugate as an amplification step. The supernatant of the choriocarcinoma cell line JEG-3 was used to
generate calibration curves. TSLP was measured by commercial ELISA.
Results
sHLA-G levels in saliva showed bimodality in all groups. Food allergic patients, independently of their clinical manifestations,
showed less sHLA-G (range 0-178.9, median 12.9 U/mL) than healthy subjects (range 0-294, median 20.0 U/mL). Differences emphasized when patients receiving allergen-specific immunotherapy were excluded (resulting range 0-119, median
7.1 U/mL). Interestingly, when results were segregated by OAS (range 0-76.6, median 0.0) or systemic affectation (0-178.9,
median 15.8), P< 0.05 Kruskal-Wallis test, and 44% of undetectable samples in the first group, data distributions suggested
two completely separated populations. TSLP levels in saliva (0-160.4 pg/mL) were not apparently related to OAS or systemic
affectation. Total protein content of samples (range 15.8-270.9 mg/dL) were similar in all groups and independent of either
HLA-G or TSLP concentrations which excludes dilution effect of avoidance diets.
Conclusions
These results point toward a possible poor tolerogenic environment, due in part to low or null secretion of HLA-G soluble
isoforms by immune oral mucosal cells in OAS, than might inefficiently counterbalance TH2 promoter signals released by
epithelial cells (i.e. TSLP) and whose effects on local DC require further assessment.
116
P-008 EPIGENETICS MARKS ON PRDM1 GENE PROMOTERS IN HUMAN MALIGNANT PLASMA CELLS
R. Romero García1 , L. Gómez Jaramillo1 , F. Mora López1 , A. Campos Caro1 1) Hospital Universitario Puerta del Mar
Introduction
Multiple Myeloma (MM) is a human cancer of malignant plasma cells (PCs) that presents a complex pathogenesis and is associated with a collection of disease manifestations, including osteolytic lesions, anemia, immunosupression and renal failure.
Is suggested that myeloma PCs arise from post-germinal center differentiated B-cells. The human positive regulatory domain
I (PRDM1) transcription factor, is considered the main regulator of terminal differentiation process from B-cells towards PCs.
It is considered, in general, as a transcriptional repressor that silences several genes like MYC, CIITA, SPI-B, PAX-5, related to
B-cell phenotype. In malignant PCs PRDM1 gene has been described to originate two isoforms, PRDM1α and PRDM1β, by
alternative transcriptional promoters. PRDM1β, which lacks the amino-terminal 101 amino acids compare to the normal
PRDM1α, shows a loss of repressive function on multiple targeted genes, acting as a competitive dominant negative
Objectives
PRDM1β, is being expressed in MM-PCs and MM cell lines. However its mechanism of transcriptional regulation remains to
be elucidated. Here we assessed if the methylation status as well as the histone modifications of the PRDM1 gene promoters
in myeloma PCs are related to the expression of the PRDM1α and PRDM1β isoforms
B-cells, normal-PCs and malignants MM-PCs were isolated from bone marrow samples obtained from Andalusian Public
Health System Biobank. Human cell lines Daudi, Raji, U266, NCI-H929, RPMI-8226 were also used. To evaluate the methylation
status of the PRDM1α and PRDM1β promoters, genomic DNA was purified, modified with bisulfite, specific PCR amplified
and sequenced. Cell cultures were also treated with the DNA methyltransferase inhibitor 5-Aza-2´-deoxycytidine (5-aza) in
order to investigate changes in transcriptional activity of PRDM1 gene. Moreover, ChIP assays have been performed to analyse the histone modification status in the PRDM1 promoters
Results
The expression of the PRDM1α and PRDM1β isoforms seems to be correlated to the different methylation patterns observed in the two alternative PRDM1 promoters. A lost in the methylation status after analysing 35 and 12 CpG positions into
the CpG-island of the PRDM1α and PRDM1β promoters respectively, while an increased expression was observed. Specific
CpGs positions into the promoters probably determine the turn-on/off transcriptional activity of PRDM1 gene. On this way,
5Áza treatment augmented the expression level of PRDM1 transcripts. On the other hand, ChIPs assays showed different
histone marks for H3K4me, H3K4me3, H3K9ac, but not for H3K27, H3K9me2, when we compare the PRDM1 promoter region
between RPMI and U266 cells. H3K4me3, H3K9ac seems to be related to the PRDM1β expression
Conclusions
The loss/gain of epigenetic marks in the PRDM1 promoters contributes to modify the expression level ratio between PRDM1α and PRDM1β and this, consequently, might contribute to myeloma progression
117
P-009 COMPARATIVE ANALYSIS OF THE CDR-H3 REGION OF ANTIBODIES IN DIFFERENT HUMAN B CELLS AND PLASMA
CELLS SUBSETS
G.Jiménez-Gómez1 , J. L. Gómez-Perales1 , A. B. Ramos-Amaya1 , J. Brieva1 , A. Campos-Caro1 1) Hospital Universitario Puerta del Mar
Introduction
The diversity of Ig molecules is initially generated by recombination of different germline gene segments (V, D, J segments)
during B cells development. The antigen-binding sites of Ig molecules are mainly formed by six hypervariable loops termed
complementary determining regions (CDR): three from the light (L) chain and three from the heavy (H) chain. CDR1 and
CDR2 are the regions where somatic hypermutations (SHM) mainly occurs. CDR-H3 is directly formed by the juxtaposition of
V-D-J regions and is located at the center of the antigen-binding site having then a key role in antigen recognition and binding. At first, antigen-induced PCs generated in inductive lymphoid tissues are selected to travel through the circulation and
finally, are selected to home onto terminal deposit organs. Previously our group has explored the mutational modifications
occurring during the systemic PC maturation, by comparing the SHM of IGHV genes (specially, in CDR1 and in CDR2 regions)
in human PCs isolated from tonsil, blood, and bone marrow (BM). The SHM analysis revealed the existence of a maturational
gradient in these genes, as demonstrated by a progressive increase in the frequency of total and R mutations and total and
non-conserved amino-acids changes following the direction: tonsil→blood→BM.
Objectives
The aim of this work is to study the CDR-H3 composition differences in the previously studied human PC subsets (tonsil→
blood→BM) and compare between them as well as with other subsets, ie naïve B cells, memory B cells and intestinal lamina
propria (LP-PCs).
All sequences were obtained from our previous works and other from published data bases. Sequences were analyzed submitting them to the ImMunoGeneTics (IMGT/V QUEST) web-based analysis tool. Data analysis were then imported into a
Microsoft® Excel® based software, named Immunoglobulin Analysis Tool (IgAT) for further analysis. We analyzed a total of
1844 productive rearrangements: B cells (n=167); Memory B cells, (n=293) and CPs, (n=1384).
Results
As expected, the total number of mutations (R+S) and R/S ratio, was getting higher in the direction from B cells, memory B
cells, tonsil-PC, blood-PCs, BM-PCs and LP-PCs the largest. Regarding to the CDR3 region, the number of mutations was similar
between B cells and memory B cells, but was higher in the population of PCs. No exceptional differences between the uses of
D-segments were observed between all subset compared. However, its length was lower in all the PCs populations compared
to B cells and memory B cells, probably by use of shorter D-, J-regions and a reduced number of “N”-insertions. Moreover, the
frequency of the amino acids and hydrophobicity index found in CDR-H3 regions varies from B-cell to PCs subsets.
Conclusions
These findings suggest that, as was described about somatic hypermutation in IGVH region, exist a maturational gradient
from B cell to PCs which could be reflected in terms of CDR-H3 length and amino acid composition.
118
P-010 DYACYLGLICEROL KINASE Ζ PARTICIPATES IN B CELL DYNAMICS REGULATION BY AFFECTING LFA-1 ACTIVATION
AND ACTIN REARRANGEMENTS
S. V. Merino Cortés1 , S. Román García1 , Y. R. Carrasco1 1) Centro Nacional de Biotecnología
Introduction
B lymphocytes move over the follicular stromal cell network searching for specific antigens; chemokines and integrins support this cell behaviour. BCR recognition of antigen presented at the surface of antigen presenting cells (APC) leads to stop
migration and Immune Synapse (IS) formation; this B cell-APC long-lasting interaction has an important role in B cell activation. The z isoform of Dyacylglicerol Kinase (DGKz) has been recently implicated in controlling B cell activation by increasing
the antigen threshold required for BCR signalling. It is unknown how DGKz shapes B cell dynamics (motility versus IS) to
regulate cell activation.
Objective
We evaluated the DGKz participation in the molecular mechanisms that underlie the IS versus motility behaviours in B cells.
Methodology
To study cell dynamics, we used a biomimetic model based on artificial planar lipid bilayers containing GPI-linked ICAM-1
and CXCL13 coating in absence or presence of tethered antigen, in combination with real time confocal microscopy. We
utilized primary B cells isolated from the spleen of wild type (WT) and DGKz-/- mice, and the murine B cell line A20 transiently
transfected with a DGKz-GFP construct.
Results
DGKz-/- B cells showed higher IS frequency than WT B cells. The synapse was properly formed, although the adhesive ring
(peripheral SMAC, pSMAC) was smaller than in control cells. DGKz-GFP overexpression in A20 B cells promoted a decrease in
IS and adhesion frequencies. It also led to increased synapse areas and the migration of half of the synapse-forming A20 B
cells, carrying the antigen cluster at the back of the cell. In the absence of antigen, CXCL13-triggered DGKz-/- B cell migration
was comparable to WT B cells; DGKz-GFP A20 B cells did show however higher cell protrusion activity and contact area with
the artificial membrane than non-transfected cells. DGKz localizes at the cytosol and upon cell stimulation translocates to the
plasma membrane. DGKz-GFP appeared at the plasma membrane of synapse-forming A20 B cells, but did not accumulate
at the synapse plane; in motile A20 B cells, DGKz-GFP accumulated at the lamelipodium. It is known that the Phosphatidic
Acid (PA) produced by DGKz activates PAK-1/Rac GTPases axis and thus actin reorganization. We detected higher levels of
phospho-PAK-1 in DGKz-GFP A20 B cells than in non-transfected cells.
Conclusion
DGKz regulates the B cell ability to form the IS in response to antigen; this mechanism might be implicated in the DGKz-mediated control of B cell activation. DGKz affects LFA-1 activation triggered by antigen or chemokines. Finally, PA production
facilitates B cell migration by increasing cell protrusion activity through the activation of the PAK1/Rac GTPases axis. 39 Congreso de la Sociedad Española de Inmunología
119
P-011 T FOLLICULAR HELPER IN PRIMARY IMMUNODEFICINECY AS MARKER OF DEFICIENT HUMORAL RESPONSES
R. Ruiz García1 , L. Díaz Alonso1 , R. Laguna Goya1 , M. El Amri1 , M. Menchén1 , M. J. Díaz Madroñero1 , M. J. Remondo1 , J. Ruiz
Contreras1 , E. Paz Artal1 , J. Guerra Vales1 , L. I. González Granado1 , L. M. Allende1 1) Hospital Universitario 12 de Octubre, Madrid
Introduction
Naïve CD4+ T cells differentiate into distinct populations of effector cells with specialized functions. One of this effector
populations are T follicular helper CD4 (Tfh) cells which are responsible for mediating the differentiation of naïve B cells into
memory and plasma cells, thereby providing effective humoral immunity against T-dependent antigens. Tfh cells express
increased levels of CXCR5, PD-1, BCL6 and localize to follicles of secondary lymphoid tissues. There is a small proportion
of circulating CD4+CXCR5+ T cells in peripheral blood correlated with tissue Tfh cells. Recent studies show that analysis of
blood circulating Tfh cells can provide clues to understand the mode of action of vaccines, the pathogenesis of autoimmune
diseases and primary immunodefienciencies (PIDs).
Objectives
In this work we have studied patients with monogenic mutations and undefined molecular diagnosis causing PIDs with
associated humoral immune defects in order to identify distinct quantitative or qualitative defects in human Tfh cells. We
aimed to provide an explanation for humoral immune defects in some PIDs as well as the mechanisms that regulates Tfh
differentiation and function.
Peripheral blood samples from 30 PID patients were analyzed by flow cytometry. Blood memory Tfh cells were defined as
CXCR5+CD45RA-CD4+. Tfh are composed of heterogeneous subpopulations and to differentiate them we used CXCR3, CCR6
and PD1 surface markers. We also assessed their cytokine release capacity after 16 hours of stimulation with PMA+ION measuring intracytoplasmatic expression of IL-21, IL-13 and INFγ, IL-17 and IL-10. We quantified levels of class switched memory
B cells from patients and correlated them with Tfh cells. Data of immunoglobulin levels were also collected.
Results
Patients with CVID had increased percentage of CXCR5+CD45RA-CD4+ Tfh cells whereas patients with STAT3 mutations,
BTK, Di George and GATA2 mutations had lower levels of Tfh. CCR6+CXCR3- (Th17-like) and CCR6-CXCR3- (Th2-like) Tfh cells
are the subtypes able to induce naïve B cells to produce immunoglobulins which are reduced in patients with CID, CVID,
STAT3 and GATA2. These patients also showed reduced level of class switched memory B cells and increased percentage of
CCR6-CXCR3+ (Th1-like) Tfh cells.
Conclusions
Here, we studied Tfh cells in a wide spectrum of primary immunodeficiencies in order to understand the effects of monogenic mutations in the quality and quantity of humoral immune responses. Tfh cells are a good biomarker able to monitor
humoral immunity in patients with PIDs. Patients with lower number of Tfh cells or patients with normal numbers but with
effector phenotype are unable to produce correct humoral responses.
120
P-012 THE ROLE OF C-FLIP IN REGULATORY T CELL HOMEOSTASIS
C. Plaza Sirvent1 , M. Schuster1 , Y. Neumann1 , J. Niemz2 , U. Heise3 , M. Pils3 , J. Hühn2 , K. Schulze-Osthoff 4 , I. Schmitz1 1) Helmholtz Centre for Infection Research/OvG Universität Magdeburg 2) Helmholtz Centre for Infection Research 3) Helmholtz
Centre for Infection Research 4) University of Tübingen/German Cancer Consortium (DKTK) and German Research Cancer Center
(DKFZ)
Introduction
Regulatory T (Treg) cells have an essential role in maintaining peripheral tolerance, preventing autoimmune diseases and
limiting chronic inflammation. The equilibrium between effector T cells and regulatory T cells is crucial to maintain immune
homeostasis. Our work focuses on the study of the T cell apoptosis, key regulator of this balance. Apoptosis can be mediated
by the extrinsic pathway (receptor-mediated apoptosis) and the intrinsic pathway (regulated by the Bcl-2 protein family).
Death receptor-mediated apoptosis is a key mechanism to clear the lymphocyte expansion during the effector phase of the
immune response. Recently, a pro-apoptotic role of Foxp3 and the protective effect of the Bcl-2 protein Mcl-1 have been
demonstrated. However, nothing is known about the contribution of the extrinsic pathway of apoptosis in the regulation of
the Treg homeostasis.
Objectives
The aim of this work is to study the importance of the extrinsic pathway of apoptosis for the homeostasis of the Treg cells and
to determine the role of the anti-apoptotic protein c-FLIP in the maintenance of this process.
Apoptosis-related gene expression analysis by quantitative PCR and death receptor expression examination by flow cytometry were performed in regulatory T cell and conventional T cell populations. Moreover, the impact of the different death
ligands on cell viability of conventional and regulatory T cells was investigated by different apoptosis assays. Furthermore, a mouse line lacking Cflar, the gene encoding c-FLIP, specifically in Treg cells was generated. The mouse line was monitored and several organs were analyzed by histology. In addition, the cells of the lymphoid organs of these mice were
analyzed by flow cytometry in order to study alterations in the Treg compartment and the status of the T cell activation.
Results
Treg cells show higher susceptibility to cell death upon CD95L stimulation compared to conventional T cells. Both cell types
have identical death receptor expression patterns, suggesting differences in intra-cellular signaling. In line, the expression of
the long isoform of c-FLIP is significantly reduced in regulatory T cells compare to conventional T cells. Conditional knockout
mice lacking c-FLIP in Foxp3+ cells lack Treg cells in the periphery and, consequently, die at about three weeks of age exhibiting a scurfy-like phenotype.
Conclusions
c-FLIP is involved in death receptor-mediated apoptosis susceptibility and is essential for Treg cell homeostasis preventing
autoimmunity. Consequently, since Treg cells are able to control autoimmunity and to repress anti-cancer immunity, the
CD95-c-FLIP axis represents a therapeutic target for immunomodulation in pathologic scenarios.
121
P-013 FETAL CALF SERUM INDUCED MISSESTIMATION OF DEAD AND APOPTOTIC CELLS
J. C. Zarzuela1 , Á. Cartón1 , A. Corell1 , M. C. Martín1 1) Universidad de Valladolid
Introduction
Fetal Calf Serum (FCS) is commonly used as a supplement to RPMI for peripheral lymphocyte cultures aimed at both expansion/proliferation and response assays. Some authors have reported T cell activation and even a NK-like cytotoxicity due to
FCS-supplemented media.
When working with blood concentrates such as buffy coats or cord blood units, culture media are routinely used to bring
them to peripheral blood-like leukocyte concentrations. Culture media are also used to resuspend mucosae-brushed cells in
order to perform flow cytometry assays.
Objective
Our aim was to analyze the effect of FCS in apoptosis and viability both in peripheral blood buffy coats and isolated lymphocytes.
Five buffy coats from the regional Blood Bank (CHEMCYL, Valladolid) were tested for this preliminary assay. Lymphocytes (mononuclear cells) were isolated with a Ficoll density gradient. Tested media were FCS RPMI supplemented medium (RPMI-1640,
10% FCS, 1% L-Glutamine, 1% Penicillin/Streptomycin) and FCS free RPMI medium (RPMI-1640, 1% L-Glutamine, 1% Penicillin/
Streptomycin). 1:3 diluted buffy coats were incubated with 7-Amino-Actinomycin D and CD45-PC7’ and lymphocyte isolates
were incubated with Annexin V and Propidium Iodide, PI). Buffy coats were kept at room temperature while mononuclear isolates were kept at 4ºC to resemble real analysis conditions as much as possible. Both samples were stored at those temperatures
for 2, 24 and 48 hours after RPMI addition, then stained as stated before, and finally analyzed by flow cytometry.
Results
Fetal Calf Serum addition to RPMI for buffy coat dilution does not affect mononuclear cell viability. After 24h total dead and
late apoptotic granulocytes (%) in buffy coats diluted with RPMI FCS-supplemented medium were significantly higher than
RPMI FCS-free medium. These differences were not so evident after 48h, probably due to an increase in cell death in both
situations (these are not cell-expansion-aimed cultures but a way to preserve samples before analysis). On the other hand,
in isolated lymphocytes with RPMI FCS-supplemented medium significant increases both in dead cells and early stages of
apoptotic cells were found at all incubation times.
Conclusions
Viability of granulocyte percent may be artefactually augmented by FCS addition to RPMI for buffy coat dilution as well as
lymphocyte dead is incremented by FCS supplemented media. On the other hand, apoptosis or cell death may be overestimated whenever we use FBS-supplemented media. These facts are specially relevant in viability analysis of blood cord units
analysis and in mucosae-brushed cells.
122
P-014 INCREASED ɣδ T CELLS IN THE CONJUNCTIVA AND DECREASED NKT, Th AND B1 CELLS IN THE ELDERLY:
MAIN FINDINGS WHEN COMPARING LYMPHOCYTE SUBSETS IN PERIPHERAL BLOOD AND CONJUNCTIVAL IELs
J. C. Zarzuela1 , M. C. Martín1 , S. Rubio2 , J. M. Herreras2 , A. Vallelado2 , A. Armentia3 , R. Reinoso4 , M. Marcos5 , A. Corell1 1) Universidad de Valladolid 2) Hospital Clínico de Valladolid 3) Hospital Universitario Pio del Rio Hortega 4) IOBA 5) Hospital
Clínico de Valladolid
Introduction
Ocular conjunctiva holds an associated lymphoid tissue (CALT) with specific cellular features. It is well known that CALT has
morphological and functional variations across tissues. Therefore, analysis of lymphoid populations might render useful information on ocular surface conditions, but would probably be modified by factors such as age, sex or treatments.
Objectives
The aim of this study is to improve the knowledge of the immunological component in human conjunctiva, to further find
out diagnostic, prognostic or follow-up biomarkers that allow improve clinical and therapeutic management in any ocular
surface condition.
Major subsets of peripheral blood lymphocytes as well as of intraepithelial lymphocytes (IELs) from conjunctival mucosa
were characterized by flow cytometry samples from both healthy volunteers and allergic individuals (n=10, 53+/-2 years,
56% woman). Conjunctival samples were obtained by brush cytology. A screening was performed in both tissues for any
potential diagnostic or follow up biomarker. Influence of age, gender or ocular allergy symptoms was also analysed.
Surface molecules CD45, CD45RA, CD45R0, CD3, CD4, CD8, CD16, CD56, CD19, CD127, CD25, CD5, CD194, CD183, CD196,
CCR10 and TCRɣδ were analysed to identify lymphocyte subsets and their frequencies: total, memory, naïve, ɣδ T cells, CD8+
(Tc, NKT subtypes), CD4+(Th0, Th1, Th2, Th17, Th22 and Tregs subsets), B cells (B1 and B2) and NK cells (regulatory and
cytotoxic) in conjunctiva and peripheral blood.
Results
Age and sex seem to determine differences in some lymphocyte subsets: NKT, Th and B1 cells might be age-influenced whereas Th2 and Th22 might be sex-influenced. No correlation between peripheral and conjunctival lymphocytes was found.
Conjunctival lymphocytes seem to be mainly ɣδ T cells while they are only a minor population in peripheral blood.
Conclusions
CALT lymphoid subsets are independent from those in peripheral blood. Both innate and acquired immunity cellular profiles
would change with age, whereas Th2-related responses might depend on sex. Anyway a larger cohort must be analyzed to
ascertain those differences.
123
P-016 MODULATION OF THE EXPRESSION OF ADHESION AND CHEMOTACTIC MOLECULES IN TWO POPULATIONS OF
EFFECTOR CD4+ T LYMPHOCYTES IN RHEUMATOID ARTHRITIS PATIENTS
M. Iglesias Escudero1 , M. A. Moro García1 , R. Marcos Fernández1 , R. Alonso Arias1 1) Hospital Universitario Central de Asturias
Introduction
Several studies have reported the appearance of a CD4+CD28null effector T cell subset in rheumatoid arthritis (RA) patients.
Since the CD4+CD28null subset presents potent inflammatory activity and a capability to induce tissue destruction has been
suggested to predispose RA patients to develop more aggressive disease. IL-15 has also demonstrated clinical importance,
since serum levels correlate with the severity of the disease and elevated concentrations of this cytokine have been detected
in synovial fluid of patients. Furthermore, recent studies have shown that cytokine IL-15 has a strong effect on CD4+CD28null
T cell subset.
Objectives
We evaluated the expression of chemotactic and adhesion molecules (CD11a, CD49d, CX3CR1, CCR5 and CD44) in two effector subsets of CD4+ T cells with different degrees of differentiation in response to IL-15 treatment. We analyzed the least
differentiated effector subset CD4+CD28+CD45RA- and the more differentiated CD4+CD28null subset (CD45RA+ or -). We
have also studied the IL-15 effect on CD4+CD28null cell migration. Material and Methods
PMBCs were obtained from 7 RA patients who fulfilled the American College of Rheumatology classification criteria for RA.
All these patients received methotrexate and anti-inflammatory treatment. Patients selected for this study had a CD4+CD28null T cell population >5%. Expression of chemotactic and adhesion molecules was assessed by flow cytometry. To evaluate the effect of IL-15 on patients cells, PBMCs were stimulated with anti-CD3, IL-15 and anti-CD3+IL-15 and incubated for 18
h. The migratory capacity of CD4+CD28null T cells was studied using Transwell plates.
Results
Less differentiated subset (CD4+CD28+CD45-) had a lower basal expression of the studied molecules than CD28null cells, except CD44 molecule expressed equally in both subsets (CD11a, p>0.001; CD49d, p=0.028; CX3CR1=0.024; CCR5, p=0.01). We
found no differences in the expression of these molecules when we divided the most differentiated subset (CD4+CD28null)
according to the expression of the CD45RA molecule into CD4+CD28nullCD45RA- (EM3 cells) and CD4+CD28nullCD45RA+
(E cells). We found an increased expression of CD11a and CD44 molecules in both subsets after treatment with IL-15 in medium alone or in response to anti-CD3 (p=0.016, p=0.015 and p=0.035, p=0.026, respectively). This effect was not observed
in the expression of CD49d, CX3CR1 and CCR5 molecules. We have also demonstrated that the T cell subset CD4+CD28null
have an enhanced migratory capacity both at baseline and when cultured with IL-15.
Conclusions
More differentiated memory effector cells have increased expression of the studied molecules; however only the expression of
CD11a and CD44 was affected by IL-15. The migratory capacity of these cells is greatly increased in presence of IL-15. The study
of the ability of adhesion and migration of these subsets could be very beneficial to try to halt the spread of the AR disease. 39 Congreso de la Sociedad Española de Inmunología
124
P-017 IL-7R AND PRE-TCR AS POTENTIAL NOVEL THERAPEUTIC TARGETS FOR T-ALL TREATMENT
M. Mosquera Sáiz1 , P. Fuentes 1 , S. González 1 , M. García-Peydró1 , J. Alcain 1 , B. de Andrés2 , M. L. Gaspar 2 , A. Corcoran3 ,
B. Alarcón1 , M. L. Toribio1 1) Centro de Biología Molecular Severo Ochoa 2) Centro Nacional de Microbiología (Instituto de Salud Carlos III) 3) Babraham
Institute
Introduction
Notch1 signalling plays a crucial role during intrathymic T cell development, inducing T-cell specification from multipotent
progenitors seeding the thymus and as a regulator of cellular expansion at two critical checkpoints sequentially controlled by the IL-7R and the pre-TCR complex. However, Notch1 is also a central oncogenic player in most human T-cell acute
lymphoblastic leukemias (T-ALL), as NOTCH1 gain-of function mutations are present in over 60% of T-ALLs. Given that the
main targets of oncogenic Notch1 activation are Notch associated signalling pathways that control survival and proliferation
during normal T-cell development, we hypothesized that IL-7R and pre-TCR are essential mediators of Notch1 dependent
leukemogenesis.
Objetive
Determine the contribution of IL-7R and pre-TCR pathways to the pathophysiology of Notch1-associated T-ALL.
In order to recapitulate the human disease, we took advantage of a murine model of T-ALL generation, consisting in the
transplantation of murine bone marrow (BM) progenitors overexpressing mutant NOTCH1 (ICN1) into immunodeficient
mice; in combination with mice genetically engineered either to lack IL7-R or to display a specific CD3E mutation that impairs
pre-TCR signalling but not expression.
Results
We demonstrated that IL-7R expression is essential for Notch1-induced leukemia generation, as ICN1-transduced BM progenitors from IL-7Rα knock-out mice failed to induce T-ALL in transplanted hosts. Moreover, we showed that IL-7R expression
is necessary to support tumour progression and that it may play a crucial role in leukemia initiating cell (LIC) activity. Next,
we addressed the contribution of pre-TCR complex to T-ALL oncogenesis, showing that impaired pre-TCR signalling in mice
harbouring a CD3e mutation impairs T-cell transformation driven by active Notch1.
Conclusions
Our work highlights the absolute requirement of both IL-7R and pre-TCR for Notch1 dependent transformation of developing thymocytes, and point toward IL-7R and pre-TCR as novel therapeutic targets for treatment of T-ALL.
125
P-018 T-LYMPHOCYTE DIFFERENTIATION AND ANTI-OXLDL ANTIBODIES CORRELATE TO LIPID PROFILE IN PATIENTS
WITH ACUTE CORONARY SYNDROME
R. Marcos Fernández1 , M. A. Moro García1 , M. Iglesias Escudero1 , F. López Iglesias1 , R. Alonso Arias1 1) Hospital Universitario Central de Asturias
Introduction
Immunosenescence is characterized by the presence of high numbers of differentiated T lymphocytes and a lower number
of poorly differentiated or naïve T lymphocytes. Moreover, this profile has been linked to chronic inflammatory diseases,
and according to our previous research, it is manifested in patients with acute coronary syndrome (ACS). On the other hand,
elevated blood cholesterol level is a main risk factor of atherosclerosis process, which underlies the development of coronary
heart disease, including ACS.
Objectives
Our main objective in this study was to demonstrate the correlation between the differentiation lymphocyte status and the
lipid profile in ACS patients.
We prospectively included 52 ACS patients and 50 healthy controls, between January 2012 and January 2014. We quantified
the levels of total cholesterol (TC), cholesterol coupled with low-density lipoproteins (LDLc), cholesterol bound to high-density lipoproteins (HDLc) and triglycerides. We also characterize lymphocyte subpopulations by flow cytometry. We performed an approach to calculate the immune system differentiation degree of patients by dividing the percentage of the less
differentiated subset (naïve cells) and the most differentiated memory cells subsets (EM3+E). We studied the relationship
between the levels of TC, LDLc and HDLc, and the ratio NAÏVE/EM3+E in both CD4+ and CD8+ T lymphocytes. We also quantified levels of antibodies against oxidized LDL (anti-oxLDL) in these patients by ELISA.
Results
We observed a negative correlation between the ratio NAÏVE/EM3+E and concentrations of CT (Spearman Rho test; Rho:
-0.327; p=0.01 in CD4+ and Rho: -0.330; p=0.008 in CD8+) and LDLc (Spearman Rho test; Rho: -0.349; p=0.005 in CD4+ and
Rho: -0.307; p=0.014 in CD8+). On the other hand, we found a positive correlation with the levels of HDLc (Spearman Rho
test; Rho: 0.548; p<0.001 in CD4+ and Rho: 0.291; p=0.019 in CD8+). We also found much higher levels of auto-antibodies
against oxidized LDL in patients with ACS than in controls (Student t test, p <0.001). Furthermore, the title of anti-oxLDL
antibodies is positively correlated with the levels of TC and LDLc (Spearman Rho test; Rho: 0.430 and 0.611 and p=0.018 and
p<0.001, respectively) and inversely with HDLc (Spearman Rho test; Rho: -0.356, p=0.05) in ACS patients. We did not find any
correlation with serum concentration of triglycerides.
Conclusions
In summary, we have found that among ACS patients included in our study, those with a higher risk lipid profile (high levels
of CT and LDLc and low levels of HDLc) had a more aged immunophenotype. The relationship between lipid profile and
immunesenescence may suggest that lipoproteins play a role as antigens in the development of the adaptive immune response of patients with atherosclerosis. Indeed, ACS patients have high levels of anti-oxLDL antibodies and they correlated
with the lipid levels. 39 Congreso de la Sociedad Española de Inmunología
126
P-019 CD4 RESPONSE OF AN AQUEOUS EXTRACT BURSERA SP
C. H. Parga Lozano1 , Y. R. T. Ortega García2 1) Universidad Libre de Barranquilla 2) Grupo de Farmacoterapia e Inmunología
Introduction
This study evaluated the cellular response of CD4 T lymphocytes in the blood of individuals from the aqueous extract of
the medicinal plant Bursera sp. Today there is a growing use of medicinal plants as therapeutic alternatives to national and
international level. In Colombia phytochemical studies are done and analyzed the immunomodulatory response but not
very deep.
So, here it is to test the behavior of CD4 T lymphocytes in individuals who continued treatment plant that signed informed
consent. This treatment were given in sockets infusion with 5 grams of bark in 100 mL of water heated 5 minutes. CD4 were
measured by flow cytometry.
Results
In general the immunomodulatory effect on CD4 cells Bursera sp extract in these individuals consisted of increased response in the early weeks and decreased in recent weeks. All results showed a significant difference (p <0.05, t student) when
compared each sampling.
Conclusion
In conclusion a possible anti-inflammatory activity of this plant appeared.
127
P-020 THE B ISOFORM OF NON-MUSCLE MYOSIN II IS INDUCED DURING PROLIFERATION OF CD4 + T CELLS AND
CONTROLS THE ARCHITECTURE OF THE IMMUNE SYNAPSE
A. Ortega Carrion1 , L. Alba Montero1 , I. Rios Guillen1 , R. Aguilar Cuenca1 , V. Centeno Talayero1 , C. Delgado Arevalo1 ,
M. Vicente Manzanares1 1) Hospital Universitario de la Princesa
Introduction
Non muscle Myosin II is an actin-binding protein expressed in all eukaryotic cells. It is a molecular motor of crucial for cellular
phenomena such as migration and division. In mammals, three isoforms have been characterized (II-A, -B and -C), and they
all have unique and overlapping functions.
Results
In this work, we characterize the expression and function of the main isoforms, II-A and II-B, in different leukocyte lineages.
T cells express NMII-A and NMII-B, unlike other leukocytes, e.g. neutrophils, which express only NMII-A. NMII-B is specifically
induced by mitotic stimuli, e.g. phytohemagglutinin + IL-2, but not by antigen-dependent signals via TCR.
We speculate that NMII-B is an important factor in the maintenance of immunological memory, because its expression is
comparatively high in CD4 + CD45RO + memory T lymphocytes compared with CD4 + CD45RA+ naïve T cells. These data are
confirmed by observations in rheumatoid arthritis patients, which exhibit elevated NMII-B expression compared to healthy
controls. In conclusion, the evidence indicates that the expression of NMII-B isoform in T lineage increases in conditions of
activation and proliferation of immune system.
Functionally, we have determined that NMII-B is a regulator of actin cortex in lymphoid cells. The specific knockdown of
NMII-B, but not the NMII-A, regulates the morphology of the contact between the T cell and the APC cell in the immune synapse. This effect is specific of the T cell, not of the APC cell. The inhibition of the NMII-B generates a marked over-extension
of the area of contact between the T cell and the APC, leading to frequent engulfment of the APC by the T cell.
Conclusions
We conclude that NMII-B is a multi-step regulator of T cell activation, shaping the contact with antigen-presenting cells and
mediating long-term T cell activation and possibly the acquisition of memory phenotypes in humans.
128
P-021 T-CELL SPECIFIC DEPLETION OF CLASS IA PI-3 KINASE P110 CATALYTIC SUBUNITS FAVORS TH1 DIFFERENTIATION. EFFECT ON ANTIGEN- AND MELANOMA-SPECIFIC RESPONSES
M. Montes-Casado1 , L. Aragoneses-Fenoll1 , G. de Ojeda1 , Y. Acosta2 , U. Dianzani3 , J. M. Rojo2 , P. Portolés1 1) Centro Nacional de Microbiología, Instituto de Salud Carlos III (ISCIII), Majadahonda, Madrid, Spain 2) Centro de Investigaciones
Biológicas, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain 3) Amedeo Avogadro” University of Eastern
Piedmont, Interdisciplinary Research Center of Autoimmune Diseases (IRCAD), Novara, Italy
Introduction
Signaling through Class I PI3-kinases is essential to many cellular processes including normal and tumor cell growth, survival, and motility. Because of their specific expression in hematopoietic cells, studies on PI3-kinase function in lymphocytes
have focused on Class IA p110d and the class IB p110g catalytic subunits. However, lymphocytes also have high levels of the
p110a catalytic subunit and efficiently binds the PI3-kinase regulatory subunits that is recruited to costimulatory molecules
like CD28 and ICOS (CD274).
Objectives
To analyze the role of p110a class IA PI3-kinases in T lymphocyte functions in vitro and in vivo using mice with T-cell conditional deletion of p110a, or p110a-specific siRNA.
p110aflox/flox CD4Cre- (WT) or p110aflox/flox CD4Cre+ mice with a T cell specific deletion of p110a (T-p110a-/-) were studied. Thymic or spleen cell populations were analyzed. Activation in vitro of naive (CD4+CD62L+ or CD8+CD62L+) T lymphocytes, or the
response in vivo to protein antigen (KLH) or the B16F10 melanoma were compared.
Results.
T-cell specific deletion of PI3K p110a catalytic subunits results in a minor decrease in total number of cells and the percentage of CD4+ T cells. In vitro activation of CD4+CD62L+ naive cells shows that cells from T-p110a-/- mice have a Th1-biased
response and significantly enhanced Th1, Th17, and Tfh differentiation. Increased Th1 responses in T-p110a-/- mice correlates
with enhanced Erk and P38 activation and T-bet expression. Enhanced Erk activity was also induced in CD4+ Th cell lines by
silencing p110a, but not p110d expression. Comparison of WT and p110a-/- Tfh cells and the effect of isoform-specific inhibitors shows that PI3K p110a and p110d contribute to ICOS-induced elongation. Activated CD8+ naive cells from T- p110a-/mice showed enhanced secretion of the effector cytokines IFN-g and TNF-a. Furthermore, IL-2 expanded, activated T CD8+
cells from T-p110a-/- mice have enhanced effector function as shown by levels of CD62L, Granzyme B and LAMP-1 (CD107a).
In vivo, T-p110a-/- mice immunized with KLH had enhanced KLH-specific IFN-g and IgG1 and IgG2b responses. T-p110a-/- mice
showed delayed development of B16F10 melanoma, with lower percentage of Treg cells in the spleen of tumor-bearing mice
and enhanced secretion of melanoma-specific IFN-g.
Conclusions
The p110a PI3K isoform expressed by mature CD4 and CD8 T lymphocytes contributes to the control of effector cell differentiation and particularly enhances Th1 responses, antigen responses to protein antigen, or melanoma-specific immune
responses.
Supported by Grants PI13/01809 (to JMR) and PI13/02153 (to PP) from “Acción Estratégica en Salud, Plan Estatal I+D+i”, Ministerio de Economía y Competitividad (MINECO), Spain
129
P-022 INVOLVEMENT OF MINOR T CELL SUBPOPULATIONS IN MOLLUSCUM CONTAGIOSUM INFECTION
A. Teniente Serra1 , C. Rodríguez1 , B. Quirant Sánchez1 , I. Bielsa1 , E. M. Martínez-Cáceres1 1) Hospital Universitari Germans Trias i Pujol, Barcelona
Introduction
Molluscum contagiosum (MC) is one of the most common viral skin disease caused by molluscum contagiosum virus. Alterations in minor T cell subpopulations in peripheral blood of MC patients could explain predisposition to infection.
Objectives
To perform an exhaustive analysis of the T cell compartment in MC patients in order to identify those subpopulations that
might be involved in susceptibility to MC infection.
CD4+ and CD8+ T cells (including naïve, central memory, effector memory and terminally differentiated effector (TEMRA),
Th1, Th2, Th17) and activation markers (CD38 and HLA-DR) were analyzed in peripheral blood of MC patients and sex- and
age-matched healthy donors using multiparametric flow cytometry. No patients were HIV positive or received immunosuppressive therapy.
Results
Eight patients were analyzed; 5 (62.5%) men and 3 (37.5%) women. Mean age at onset of the lesions was 30.25 years (range
20–59). All the patients presented with classic molluscum lesions (small dome-shaped papules with an umbillicated centre).
The number of lesions per patient averaged 10 to 15 and main duration of the disease was 91.25 days. The most prevalent
locations were pubis and inner thighs.
A decrease in absolute counts of naïve [40 (17-133) vs 139 (77-214) cells/µl; p=0.0379] and TEMRA [30 (18-67) vs 153 (55-185)
cells/µl; p=0.0207] CD8+ T cells was found in MC patients compared with healthy donors.
In contrast, an increase in percentages of CD8+CD38+HLA-DR- [32.65 (22.65-46.53) vs 7.05 (2.85-10.23) %; p=0.0002] and
CD8+CD38+HLA-DR+ [6.25 (3.03-11.50) vs 1.74 (1.45-2.85) %; p=0.0207].
Conclusions
Although it has to be confirmed with a higher number of patients, the results of this preliminary study point to a role of minor
CD8 T cell subpopulations in the susceptibility to MC infection.
130
P-023 INCREASED CD3+/CD19+ AND CD4+/CD8+ CONJUNCTIVAL IELS RATIOS IN GLAUCOMA
M. S. Rubio Martínez1 , A. Corell Almuzara3 , S. Villarón Álvarez4 , R. Martín Sanz5 , J. M. Herreras Cantalapiedra1 , R. Reinoso
Tapia2 , M. C. Martín Alonso3 1) Hospital Clínico Universitario de Valladolid 2) Instituto de oftalmobiología aplicada (IOBA) 3) Facultad de Medicina. Universidad
de Valladolid 4) Hospital Nuestra Señora de Sonsoles, Ávila 5) Complejo Hospitalario de Salamanca
Introduction
Glaucoma is a neurodegenerative disease of the optic nerve. In the last ten years increasing evidence for an autoimmune
component in glaucoma has been found. Ocular surface changes are well known as side effects of anti glaucoma drugs but
to date, intraepithelial lymphocytes (IELs) within the conjunctival-associated lymphoid tissue (CALT) have not been characterized in untreated glaucoma.
Our group described the distribution of these IELs in healthy adults, as well as in ‘evaporative-type dry-eye’ cases, (there are
ongoing studies also on allergies and infectious diseases). The present study will help decipher the mucosal immune system
(IELs and epithelial cells) in glaucoma pathogenesis
Objectives
In this study the first step was to characterize the IELs subsets proportions; second to study cell viability, apoptosis and cell
cycle stage in both, IELs and epithelial cells. The aim was to test the variations between obtained data in untreated glaucoma
CALT patients, with those from healthy subjects. Finally, the usability as diagnostic biomarkers of significative different values
was evaluated.
This is a case-control study analyzing 17 glaucoma patients and 17 control volunteers. Inferior fornical conjunctival cells
were collected by brush cytology (BC). The percentage and phenotype, cell viability, apoptosis and cell cycle stage of the
BC-recovered cells were analyzed by flow cytometry. In addition to surface CD antigens, forward scatter (FS) vs side scatter
(SS) were analyzed to gate either IELs subsets (CD45+ and low SS), complex epithelial cells (high FS and SS) or a simple mixed
population (low FS and SS) that included more basal epithelial and lymphoid cells.
Results
As expected, conjunctival IELs subsets were characterized in both cohorts. There was a significative reduction in IELs infiltration in analyzed glaucoma patients as compared with controls. T cells’ proportion was significantly higher in glaucoma
whereas B cells’ percentage was significantly lower. Subsequently, CD3+/CD19+ ratio was significantly higher suggesting a
cellular-mediated immune response. Glaucoma cases had significantly more Th lymphocytes than controls and therefore
CD4+/CD8+ ratio was significantly higher. NK lymphocytes were augmented as a trend in glaucoma. Dead simple cells percentage was significantly higher whereas dead complex epithelial cells percentage was significantly lower in glaucoma cases
as compared to controls.
These results (higher T/B and CD4/CD8 ratios together with a trend to heightened NK cells percentage) may support the
hypothesis of an autoimmune component in the pathogenesis of glaucoma.
Conclusions
This is the first study that characterizes IELs in conjunctiva of untreated glaucoma cases. Glaucoma induces changes in T/B as
well as CD4/CD8 conjunctival IELs ratios. These findings might help a better diagnosis and and therapeutical management
of glaucoma.
131
P-024 NON-IGE MEDIATED ALLERGY TO FRUIT: 2 CASES REPORT OF FPIES AND IN VITRO DENDRITIC CELL STUDY
M. V. Moreno Cantó1 , E. Caparrós Cayuela1 , P. González Delgado3 , E. Flores Pardo2 , L. I. Velásquez Castrillón1 , F. J. Fernández Sánchez3 1) Universidad Miguel Hernández 2) Hospital Universitario de San Juan de Alicante 3) Hospital General Universitario de Alicante
Introduction
Food allergies comprise different disorders that result from an aberrant immune response to dietary antigens. The non-IgE
mediated disorders likely result from direct T cell antigen-response mediated by pro-inflammatory cytokines that lead to a
variety of clinical manifestations, one of these is food protein-induced enterocolitis syndrome (FPIES). There are little evidences on what are the exact mechanisms controlling the development of FPIES and participation of dendritic cells is still under
study for this food allergy. HLA-G molecules are characterized by low allelic polymorphism, and the presence of HLA-G has
been associated with tolerogenic functions in innate and adaptive cellular response. Moreover, the allelic polymorphism of
the HLA-G gene has been associated with the generation of lower production of HLA-G protein. Differences in HLA-G gene
pattern and dendritic cell maturation could have a role in the final outcome of the illness.
Objectives
To evaluate the maturational capacity of dendritic cells in response to fruit extracts in two fruit-induced FPIES patients and
to characterize HLA-G gene profile in these patients.
Two patients were diagnosed of FPIES after having gastrointestinal symptoms following fruit ingestion. Skin prick tests were
performed with extracts of different fruits. Patch tests were performed and specific IgE was measured by ImmunoCAP. Monocytes were separated by CD14 immunomagnetic labeling. GM-CSF and IL-4-induced immature dendritic cells were treated
with different fruits extracts, or LPS as positive control for maturation state. After 48h, cells were subjected to flow cytometry
with antibodies against DC-SIGN, HLA-DR and CD86, and supernatants processed for cytokine quantification. DNA from both
patients was extracted and HLA-G polymorphism of deletion/insertion in exon 8, and null allele 01:05N, were analysed in
both patients.
Results
We report two cases of fruit-induced FPIES both after apple and banana ingestion. Characterization of dendritic cell maturation parameters indicated that maturation was induced after in vitro dendritic cell treatment with fruit extracts. Expression
of the pathogen receptor DC-SIGN was reduced and expression of the costimulatory molecule CD86 or expression of HLA-DR
molecule was increased. We also observed an elevated production of IL-6 and IL-8 in dendritic cells in patients versus control
donors. Regarding HLA-G expression, we detected the allelic polymorphism of 14pb Inser/Del in patients diagnosed of FPIES
patients which was different from tolerant controls.
Conclusions
This study reveals a pro-inflammatory profile upon exposure of dendritic cells to fruit extracts, characterized by their phenotypic profile and measured by in vitro cytokine production. The polymorphism in HLA-G exon 8 suggests a possible difference in protein production therefore a plausible different ability to counteract the inflammation observed in FPIES.
132
P-027 AUTOANTIBODIES AGAINST HIGH DENSITY LIPOPROTEINS AND RS662 POLYMORPHISM REGULATE PON1
ACTIVITY IN RHEUMATOID ARTHRITIS PATIENTS
J. Rodríguez-Carrio1 , P. López1 , R. López-Mejías2 , M. Alperi-López3 , F. J. Ballina-García3 , M. Á. González-Gay4 , A. Suárez1 1) University of Oviedo 2) Hospital Universitario Marqués de Valdecilla, IDIVAL 3) Hospital Universitario Central de Asturias 4)
Hospital Clínico Universitario de Santiago de Compostela
Introduction
High Density Lipoproteins (HDL) cardioprotective functions not only rely on their classical role in reverse cholesterol transport but also on their anti-antioxidant and anti-inflammatory activities. Paraoxonase 1 (PON1) is a HDL-associated antioxidant enzyme with an important role in avoiding lipid oxidization. Although genetic polymorphisms are known to modulate
PON1 activity, its involvement in cardiovascular disease (CVD) in Rheumatoid Arthritis (RA) and other conditions is controversial, suggesting that additional factors may modulate its function. Interestingly, a role for autoantibodies in CVD development is emerging.
Objectives
Since anti-HDL antibodies have been related to an impaired lipid profile and CVD in RA, we aimed to evaluate (i) whether an
antioxidant functional impairment of HDL is found in relation to anti-HDL antibodies and PON1 rs662 genetic variants and
(ii) whether these factors may influence CVD in RA patients.
Serum PON1 activity, using paraoxon as substrate, and IgG anti-HDL antibodies were quantified in 212 RA patients and 110
healthy controls (HC). The PON1 rs662 genotype (Q>R) was determined with TaqMan probes. An additional group of 13 biologic-naïve RA patients was prospectively followed for three months.
Results
PON1 activity was decreased in RA compared to HC (p=0.005). PON1 rs662 variants influenced serum PON1 activity in both
groups, QQ homozygotes exhibiting the lowest activity. However, distribution of genotypes did not differ between groups
(p=0.215) and Hardy-Weinberg equilibrium was observed in both populations. Interestingly, PON1 activity was not associated with disease activity, ESR or CRP, thereby suggesting that other factors may explain the reduced PON1 activity in RA
patients. A multivariate ANOVA analysis confirmed an independent role of both rs662 (p<0.0001) and anti-HDL antibodies
(p=0.026) on PON1 activity, but differences were noted among rs662 genetic variants. Anti-HDL antibodies were associated
with a greater impairment of PON1 activity (p=0.010), decreasing HDL levels (r=-0.680, p<0.001) and higher prevalence of CV
events in univariate and multivariate models in patients carrying the QQ genotype, but not in their QR or RR counterparts.
Finally, change in anti-HDL antibodies upon TNFα-blockade independently predicted improved PON1 activity (b[95% CI], p:
-0.369 [-0.669, -0.069], p=0.024) after adjusting by clinical response, change in ESR and change in HDL levels. Conclusions
PON1 activity is impaired in RA in association with rs662 status and anti-HDL antibodies. The presence of anti-HDL autoantibodies in patients with the low activity genotype was correlated with a decreased PON1 function and associated with a
higher prevalence of CV events in these patients. Therefore, anti-HDL autoantibodies are crucial mediators which represent
the missing link between rs662 polymorphism and CVD.
133
P-028 THE EXPRESSION AND FUNCTION OF HUMAN CD300 RECEPTORS ON CIRCULATING MONONUCLEAR CELLS ARE
DISTINCT IN NEWBORNS AND ADULTS
O. Zenarruzabeitia Belaustegi1 , J. Vitallé Andrade1 , S. García Obregón2 , I. Astigarraga Aguirre2 , C. Eguizabal Argaiz3 , S. Santos
Cabrera4 , V. R. Simhadri5 , F. Borrego Rabasco1 1) BioCruces Health Research Institute 2) BioCruces Health Research Institute 3) Basque Center for Transfusion and Human Tissues
4) Basque Center for Transfusion and Human Tissues 5) U.S. Food and Drug Administration
Introduction
It is well known that neonates are more susceptible to infections than adults. This is in part due to immaturity and naiveté of
their immune system, affecting both the innate and adaptive immune responses. In spite of the numerous findings already
described, still we have an incomplete picture of the differences of neonatal vs. adult immune systems.
The immune system is regulated by several mechanisms, including the signaling from cell surface activating and inhibitory
receptors. Differential expression of receptors may result in altered activation thresholds of immune cells. The human CD300
molecules are expressed in both myeloid and lymphoid cells. Their clinical significance have been well documented, and it
has been described their role in the pathogenesis of many diseases. However, nothing is known about the expression and
signaling-mediated abilities of the CD300 molecules in newborn immune cells.
Objectives
The objective of this study was to carry out a comprehensive analysis of CD300 receptors expression in neonatal and adult
immune cells, along with their regulation and function in monocytes that could help to explain the immaturity of the newborn immune system.
CD300 receptors expression was measured by flow cytometry on T, B, natural killer (NK) cells, conventional dendritic cells
(cDCs), plasmacytoid DC (pDCs) and monocytes from adult peripheral blood mononuclear cells vs. neonatal cord blood mononuclear cells. We also studied the regulation of CD300 expression on newborn and adult monocytes and their ability to
induce intracellular calcium mobilization and cytokine production.
Results
Our results show that the expression of CD300 molecules is developmentally regulated. Cells from the neonatal adaptive immune system expressed lower levels of the CD300a inhibitory receptor compared with cells from the adult immune system.
Other CD300 receptors expression on monocytes and DCs from cord blood also exhibited significant differences when compared with adult monocytes. Furthermore, we also show that LPS differentially regulated CD300 expression on monocytes in
adults and neonates, and that CD300c and CD300e mediated monocyte activation and cytokine production is significantly
reduced in newborn monocytes.
Conclusions
We conclude that neonatal innate and adaptive immune cells exhibit a pattern of CD300 receptor family expression that is
distinct from adults. We also demonstrate that CD300c and CD300e-mediated signals are quantitatively different. Therefore,
this study adds to our understanding of the immaturity of the neonatal immune system.
Funding
ISCIII-Subdirección de Evaluación y Fomento de la Investigación-Fondo Europeo de Desarrollo Regional (FEDER) (PI13/00889);
SAIOTEK, Departamento de Desarrollo Económico y Competitividad, Gobierno Vasco (SAIO13-PE13BF005).
134
P-029 EVALUATION OF TWO SPECIFIC BIOMARKERS FOR THE DIAGNOSIS OF PRIMARY BILIARY CHOLANGITIS IN A
SPANISH COHORT
M. Garcia Ormaechea1 , G. L. Norman2 , Z. Shums2 , J. Milo2 , S. Encabo2 , C. Bentow2 , M. Mahler2 , M. A. Romera Forné1 , O. Viñas
Gomis1 , A. Parés Darnaculleta3 1) Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), Hospital Clínic de Barcelona 2) Inova Diagnostics, San Diego,
CA, USA 3) Hospital Clínic de Barcelona, University of Barcelona
Introduction
Primary biliary cholangitis (PBC) is an autoimmune chronic cholestatic liver disease characterized by the presence of anti-mitochondrial antibodies (AMAs). While >90% of patients have AMA-M2, 5-10% of patients with clinically-proven PBC are
consistently serologically negative for AMA-M2. Objectives
The aim of the study was to evaluate the presence of two novel markers of PBC, antibodies to PBCx peptide and hexokinase
1 (HK-1) by ELISA in a Spanish cohort of PBC patients and disease/healthy controls.
Methods
The study included 229 samples from patients with PBC (n=59), autoimmune hepatitis (AIH, n=38), AIH/PBC overlap (n=4),
healthy individuals (n=30) and relevant disease controls (n=98), including patients with hepatitis C virus (n=30), inflammatory bowel disease (n=20), connective tissue disorders (n=20), alcohol related liver disease (n=15), primary sclerosing
cholangitis (n=8) and other liver disorders (n=5), which were tested for antibodies to anti-PBCx peptide and anti-HK-1 using
prototype ELISAs (research use only, Inova Diagnostics, San Diego, USA). PBC patients and some disease controls were tested
for AMA by IIF (NOVA Lite Rat Liver, Kidney, Stomach, Inova Diagnostics). Overlap AIH/PBC patients (n=4) were excluded from
performance analysis.
Results
Clinical performance of the two markers is shown in the table below. Anti-PBCx and anti-HK-1 antibodies were detected
in 20.3% (12/59) and in 37.3% (19/59) of the PBC patients, respectively. There was minimal overlap between anti-PBCx and
anti-HK-1 antibody reactivity [only 3 (5%) dual positive]. Of 5 AMA-M2 negative specimens by IIF, one was anti-PBCx positive.
Sensitivity in PBC (95% CI)
Specificity (95% CI)
Likelihood Ratio (+)
Likelihood Ratio (-)
Odds Ratio (OR)
Area Under the Curve (AUC)
PBCx
20.3%
(12.0-32.3%)
98.2%
(94.8-99.4%)
11.3
0.81
13.9
0.50
HK-1
37.3%
(26.1-50.0%)
97.0%
(93.1-98.7%)
12.4
0.65
19.1
0.72
PBCx + HK-1 combined
(either/or positive)
52.5%
(40.0-64.7%)
95.2%
(90.8-97.5%)
10.9
0.50
21.9
0.74
Conclusion
The two novel markers demonstrate potential diagnostic utility for PBC in this cohort. Future studies are needed using additional AMA-M2 negative PBC patients to investigate the added clinical sensitivity of the two markers for PBC and to assess
potential clinical associations in PBC patients. 39 Congreso de la Sociedad Española de Inmunología
135
P-030 QUANTA FLASH LKM-1 CHEMILUMINESCENT IMMUNOASSAY DEMONSTRATES RELIABLE CLINICAL
PERFORMANCE IN AUTOIMMUNE HEPATITIS
M. Garcia Ormaechea1 , G. Lakos2 , R. Albesa2 , C. Bentow2 , M. A. Aure2 , M. Mahler2 , L. Rubio Egea1 , O. Viñas Gomis1 , A. Parés
Darnaculleta3 1) Institut d’Investigacions Biomèdiques August Pi i Sunyer(IDIBAPS), Hospital Clínic de Barcelona 2) Inova Diagnostics, San Diego,
Introduction
Autoimmune hepatitis type 2 (AIH-2) is a chronic liver disease of unknown etiology characterized by the presence of liver/
kidney microsomal type 1 (LKM-1) and/or liver cytosol type 1 (LC-1) antibodies detected on rodent kidney-liver tissue sections by indirect immunofluorescence (IIF) complemented with solid phase assays such as enzyme immunoassays, immunoblot and fluorescence bead-based assays.
Objectives
The aim of this study was to analyze the clinical performance of a novel chemiluminescent immunoassay (CIA), QUANTA
Flash LKM-1, in a cohort of AIH patients and relevant disease controls.
The study included 229 samples from patients with AIH (n=12 AIH-2, n=26 AIH-1), primary biliary cholangitis (PBC, n=59),
AIH/PBC overlap (n=4), healthy individuals (n=30) and relevant disease controls (n=98), including patients with hepatitis C
virus (n=30), inflammatory bowel disease (n=20), connective tissue disorders (n=20), alcohol related liver disease (n=15),
primary sclerosing cholangitis (n=8) and other liver disorders (n=5). All samples were tested with QUANTA Flash LKM-1 (research use only, Inova Diagnostics, San Diego, USA). For method comparison, the AIH patients and some of the disease
controls were tested by IIF (NOVA Lite Rat Liver, Kidney, Stomach, Inova Diagnostics) and dot blot (EUROLINE, Euroimmun,
Lübeck, Germany). Overlap AIH/PBC patients (n=4) were excluded from performance analysis.
Results
In the AIH-2 patients, QUANTA Flash LKM-1 CIA demonstrated a sensitivity of 50.0% (95% confidence interval, CI 25.4-74.6%)
with a specificity of 93.0% (95% CI 88.8-95.7%) including the HCV patients and specificity of 100.0% (95% CI 98.0-100.0%) when
HCV patients were excluded. Receiver operating characteristic (ROC) curve analysis showed an area under the curve value of
0.82 for discriminating between AIH-2 and controls (excluding HCV patients). Where patients samples were tested by three
methods (n=131, including HCV patients), excellent qualitative agreement was found between the CIA, IIF, and dot blot: 95.4%
(95% CI 90.4-97.9), kappa=0.84 (95% CI 0.71-0.96) between CIA and IIF; 98.5% (95% CI 94.6-99.6), kappa=0.95 (95% CI 0.87-1.00)
between CIA and dot blot; 96.9% (95% CI 92.4-98.8), kappa=0.89 (95% CI 0.79-1.00) between IIF and dot blot.
Conclusion
QUANTA Flash LKM-1 CIA demonstrated excellent clinical performance in this cohort of AIH patients and controls and also
showed a high level of agreement to the traditional IIF and dot blot methods. 39 Congreso de la Sociedad Española de Inmunología
136
P-031 QUANTA FLASH M2 (MIT3) CHEMILUMINESCENT IMMUNOASSAY DEMONSTRATES RELIABLE CLINICAL
PERFORMANCE IN PRIMARY BILIARY CHOLANGITIS
M. Garcia Ormaechea1 , G. Lakos2 , P. Martis2 , C. Bentow2 , M. A. Aure2 , M. Mahler2 , R. Ruiz Aragón1 , O. Viñas Gomis1 , A. Parés
Darnaculleta3 1) Institut d’Investigacions Biomèdiques August Pi i Sunyer(IDIBAPS), Hospital Clínic de Barcelona 2) Inova Diagnostics, San Diego,
Introduction
Anti-mitochondrial antibodies (AMA) are significant serological markers for primary biliary cholangitis (PBC). Although the
classical detection method for AMA-M2 is indirect immunofluorescence (IIF), the major mitochondrial antigenic targets are
the E2 subunits of the pyruvate dehydrogenase complex (PDC-E2), the branched chain oxoacid dehydrogenase complex
(BCOADC-E2), and the 2-oxoacid glutarate dehydrogenase complex (OGDC-E2), developed on solid phase assays (enzyme
immunoassay, immunoblot, fluorescence bead-based assay). Objectives
The goal of this study was to analyze the clinical performance of a novel chemiluminescent immunoassay (CIA), QUANTA
Flash M2 (MIT3), in a cohort of PBC patients and relevant disease controls.
The study included 229 samples from patients with PBC (n=59), AIH (n=38), AIH/PBC overlap (n=4), healthy individuals (n=30)
and relevant disease controls (n=98), including patients with hepatitis C virus (n=30), inflammatory bowel disease (n=20), connective tissue disorders (n=20), alcohol related liver disease (n=15), primary sclerosing cholangitis (n=8) and other liver disorders (n=5). All samples were tested with QUANTA Flash M2/MIT3 (research use only, Inova Diagnostics, San Diego, USA). For
method comparison, the PBC patients and some of the disease controls were tested for AMA by IIF (NOVA Lite Rat Liver, Kidney,
Stomach Slides, Inova Diagnostics). Overlap AIH/PBC patients (n=4) were excluded from clinical performance analysis.
Results
In the PBC patient population, QUANTA Flash M2 (MIT3) CIA demonstrated a sensitivity of 94.9% (95% CI 86.1-98.3%) with
a specificity in the disease controls of 98.8% (95% CI 95.7-99.7%, odds ratio=1530). Receiver operating characteristic (ROC)
curve analysis showed an area under the curve (AUC) value of 1.0 (95% CI 0.998-1.001). Excellent agreement was found between the CIA and IIF with a total qualitative agreement of 95.2% (95% CI 91.2-97.5) and a kappa value = 0.89 (95% CI 0.820.96). By comparing IIF titer vs. chemiluminescent units (CU) of the CIA, good quantitative agreement was also found using
Spearman’s analysis (Spearman’s rho = 0.87, 95% CI 0.83-0.91, p<0.0001).
Conclusion
QUANTA Flash M2 (MIT3) CIA demonstrated excellent clinical performance in this cohort of PBC patients and controls and
also showed a high level of agreement to the traditional IIF method. 39 Congreso de la Sociedad Española de Inmunología
137
P-032 EVALUATION OF A CHEMILUMINISCENCE ASSAY FOR ANTIPHOSPHOLIPID ANTIBODIES
V. Cunill 1 , E. Villegas1 , M. Montes1 , V. Ávila1 , M. Fuster1 , Á. Molina-Fuentes1 , A. Urruticoechea2 , C. Moll3 , M. Ibañez4 ,
E. González5 , L. Pallarés6 , M. Julià1 1) Hospital Universitari Son Espases, Palma de Mallorca, Spain 2) Hospital Can Misses, Eivissa, Spain 3) Hospital Mateu Orfila,
Menorca, Spain 4) Hospital Son LLatzer, Palma de Mallorca, Spain 5) Hospital Son LLatzer, Palma de Mallorca, Spain 6) Hospital
Universitari Son Espases, Palma de Mallorca, Spain
Introduction
The antiphospholipid syndrome (APS) is defined by the persistent presence of antiphospholipid antibodies (aPL): lupus
anticoagulant, anticardiolipin (aCL) or anti-b2-glycoprotein I (ab2GPI). Large interassay variation persists among ELISA techniques for aPL detection. This is a limitation that may be overcome by new methodologies such as chemiluminiscence
immunoassay (CIA).
Objectives
The aim of this work was to evaluate the diagnostic performance for APS of an automated CIA (Zenit RA) compared to ELISA.
Material and Methdos
We studied healthy controls (HC) (n=50) and patients with clinical suspicion of SAP (n=71). We compared both techniques
and correlated each one against the clinical background of the patients. 99th percentiles of HC values were not applicable as
a cut-off and we used those reported with the highest diagnostic performance.
Results
The sensitivity/specificity of CIA vs ELISA was: 50%/95%, 24%/95%, 75%/93% and 77%/75% for aCL IgG, aCL IgM, ab2GPI IgG
and ab2GPI IgM, respectively. The Spearman correlation coefficients were lower than 0.6 in all cases.
Regarding the clinical background, the specificity of aCL IgG/IgM and ab2GPI IgG/IgM measured by CIA was higher compared to ELISA: 100% vs 97%, 89% vs 25%, 100% vs 85% and 82% vs 76%, respectively. The same applied for sensitivity, except
for aCL IgM: 17% vs 4%, 30% vs 56%, 22% vs 7% and 47% vs 23%, respectively.
Conclusions
There were differences in aPL detection by ELISA and CIA, probably due to distinct epitopes exposed for autoantibodies
recognition. Clinical performance of CIA was better. This method can improve reproducibility and robustness of aPL determinations for APS diagnosis.
138
P-033 USEFULNESS OF AUTOANTIBODIES ANTI-E2 SUBUNITS OF MITOCHONDRIAL DEHYDROGENASES IN PRIMARY
BILIARY CIRROSIS
J. Climent 1 , F. Morandeira1 , V. Mas1 , E. Dueñas1 , A. Amador1 , J. Castellote1 , J. Bas1 1) Hospital Universitario de Bellvitge, Barcelona
Introduction
Primary biliary cirrhosis (PBC) is an autoimmune liver disease characterized by the presence of anti-mitochondrial antibodies
(AMA) in 90-98% of patients. The major autoantigens correspond to E2 subunits of 2-oxo acid dehydrogenase complex: pyruvate dehydrogenase (PDC), branched-chain 2-oxoacid dehydrogenase (BCOADC) and 2-oxoglutarate dehydrogenase (OGDC).
PBC patients show a high degree of clinical variability. However, a reliable immunologic indicator still remains elusive.
Objectives
1) To evaluate the usefulness of the autoantibodies against the different E2 specificities in the diagnosis of PBC.
2) To delineate the clinical correlates of the anti-E2 dehydrogenase profile.
Methods
164 patients (80% women) with positive AMA by immunoblot test were retrospectively studied. AMA were assessed by
standard indirect immunofluorescence (IIF) on composite tissue blocs followed by the detection of autoantibodies against
native PDC (nPDC) and the E2 subunits of PDC, BCOAD and OGDC employing a commercially available dot blot technique
(Palex, St. Cugat). IFI AMA titers were classified as Negative (<1:40), Low (≤1:80), Medium (1:80<X≤1:320) and High (>1:320).
The relationship of AMA titer and specificity with clinical, immunological and biochemical variables was studied.
Results
138 patients (84%) presented autoantibodies to native PDC (nPDC), 113 to PDC-E2 (69%), 66 to BCOAD-E2 (40%) and 24 to
OGDC-E2 (15%).
68 of these patients had a confirmed diagnosis of PBC: 6 out of 45 presenting one dehydrogenase specificity (13%), 29 out of
69 with 2 specificities (42%), 25 out of 41 with 3 specificities (61%) and 8 out of 9 with 4 specificities (89%) (The ninth patient
was diagnosed as “probable PBC”). Thus, PBC diagnosis is strongly related to increasing number of specificities (χ2, P<0.0001).
In addition, AMA were detected by IIF in 131/151 cases. Patients with definite PBC were distributed according to titer: 0/20
with negative IIF, 6/23 with low titers, 13/38 with medium titers and 47/70 with high titers. Here again, the likelihood of a
PBC diagnosis is associated to an elevated IIF titer (χ2, P<0.0001). There is also an association between number of specificities
and antibody titer.
A preliminary analysis failed to find any association between response to a particular dehydrogenase and biochemical liver
function. However, concomitant autoimmune thyroid disorders were only found in 13 patients with anti-nPDC, 11 of them
also with anti-PDC-E2 and 2 with anti-BCOADC.
Conclusions
The results support the usefulness of testing separate specificities. The more AMA specificities with high antibody titers, the
higher is the probability of PBC diagnosis. Thus, the presence of a “full positive” result is likely to be diagnostic of PBC whereas
positivity to a single subunit makes it unlikely. In addition, the results support the association between anti-PDC autoantibodies and autoimmune thyroid disease.
139
P-034 PRESENCE OF ANTI-DFS70 ANTIBODIES IN A COHORT OF PATIENTS FROM A TERTIARY HOSPITAL
M. Español-Rego1 , S. de La Cruz Rodríguez1 , L. Rubio1 , O. Viñas2 , M. García-Ormaechea 2 1) Hospital Clínic de Barcelona 2) Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS)
Introduction
The clinical significance of DFS70 autoantibodies remains controversial. They have been reported to be more prevalent in
patients without ANA-associated systemic autoimmune disease (SAD) and also in healthy individuals, endorsing the idea of
a potential protective role.
Objectives
The aim of our study was to assess the presence of anti-DFS70 antibodies in patients with positive ANA by indirect immunofluorescence (IIF-ANA) with a potentially compatible dense fine speckled (DFS) pattern and negative dsDNA and ENA
antibodies.
We included 41 sera with an intense (≥ 1:320) IIF-ANA selected from 279 sequential samples submitted for ANA testing during a six month period. Patients were studied for a variety of diseases: 20(48.8%) systemic autoimmune diseases, 15(36.6%)
interstitial lung disease and 6(14.6%) other conditions.
Our laboratory does not inform DFS pattern. We considered the homogeneous-speckled as compatible and an intense homogeneous potentially concealing DFS pattern.
Samples were tested by IIF-Hep2 cells and QUANTA Flash DFS70 Chemiluminescense immunoassay (CIA), both from Inova
Diagnostics.
Results
DFS70 autoantibodies were positive in 2 patients (5%), both diagnosed with autoimmune thyroid disease (Hashimoto’s
Thyroiditis and Graves-Basedow disease).
Conclusion
Our findings are in keeping with those described in the literature, despite the small number of samples tested, showing low
prevalence of anti-DFS70 antibodies in patients with SAD. 39 Congreso de la Sociedad Española de Inmunología
140
P-035 RESULTS OF A CENTRALIZED UNIT FOR THE ASSESSMENT OF OLIGOCLONAL BANDS IN PATIENTS WITH
NEUROLOGICAL DISEASES
I. Toboso de Lamo1 , L. Brieva2 , A. B. Caminero3 , E. Fernández Díaz4 , I. García Castañón5 , J. L. Sánchez Menoyo6 , M. Muñoz
Pasadas7 , F. Pérez Parra8 , E. Durán9 , V. Meca Lallana10 , I. Gómez Moreno11 , C. García Arnal12 , A. Muñoz Málaga13 , M. del Real14 ,
L. M. Villar Guimerans1 1) Hospital Ramón y Cajal. Madrid 2) Hospital Universitari Arnau de Vilanova de Lleida 3) Complejo Asistencial de Ávila 4) Complejo
Hospitalario Universitario de Albacete 5) Hospital Universitario de Fuenlabrada 6) Hospital Galdakao-Usansolo 7) Hospital General
Universitario de Ciudad Real 8) Hospital Universitario del Henares 9) Hospital Infanta Elena. Huelva 10) Hospital Universitario de
la Princesa. Madrid 11) Hospital General Virgen de la Luz.Cuenca 12) Hospitalario Virgen de las Nieves. Granada 13) Hospital de
Especialidades de Jerez de la Frontera 14) Hospital General Universitario de Ciudad Real
Introduction
We have implemented a centralized unit for high sensitivity detection of oligoclonal IgG (OCGB) and IgM (OCMB) bands in
patients with suspect of multiple sclerosis (MS). After 24 months in operation, we aim to assess the value of our techniques
in daily clinical practise.
In two years of operation we received 1244 samples from 72 different centres. To assess the clinical utility of our results, we
designed a survey to get the definite diagnosis and clinical data of the patients. We received data of 172 patients with a definite diagnosis from 17 centres. We explore the accuracy of our techniques in this group of patients, 147 of them with EMRR.
Results
OCGB showed a specificity of 100% and a sensitivity of 93% for MS diagnosis. Lipid-specific OCMB were present in 50 % of
MS patients. They identified patients with a rapid disability progression in terms of MSSS score (5.18±2.196 vs 1.32±2.28
[mean±standard error], p=0.019).
Conclusions
These results demonstrate the utility of highly specialised Cerebrospinal fluid (CSF) laboratories in the clinical assessment of
patients with suspected MS. 39 Congreso de la Sociedad Española de Inmunología
141
P-036 MODERATE LAD-1 DEFICIENCY IN A PATIENT WITH MULTIPLE DIAGNOSIS OF NEUTROPHILIC DERMATOSIS
V. Cunill1 , I. Garcia-Laorden2 , M. R. Jiménez León1 , M. T. Martínez-Saavedra2 , Á. Molina Fuentes1 , L. López-Borrego3 ,
L. Allende4 , C. Rodríguez-Gallego1 1) Hospital Universitario Son Espases, Palma de Mallorca, Spain 2) Hospital Universitario Dr. Negrin, Las Palmas de Gran Canaria,
Spain 3) Hospital Universitario Insular Gran Canaria, Las Palmas de Gran Canaria, Spain 4) Hospital Universitario 12 de Octubre,
Madrid, Spain
Introduction
Neutrophilic dermatoses (ND) are a group of autoinflammatory disorders characterised by inflammatory skin lesions with
an intense neutophilic infiltrate. ND includes Sweet syndrome (SS) and pyoderma gangrenosum (PG) among other entities.
Leukocyte adhesion deficiency type I (LAD-I) is a primary immunodeficiency caused by mutations in ITGB2 (CD18, b2 integrin). Patients have recurrent infections of the skin, perirectal area, and airways. Cutaneous lesions tend to be necrotizing
and ulcerate, without pus and an almost complete absence of neutrophils on histopathology. In absence of bone marrow
transplantation, patients with the severe form (no CD18 expression) usually die before the age of two. The moderate phenotype (1%-30% of normal expression of CD18) is milder and tends to be diagnosed later in life.
Patient and Methods Female with a history of recurrent cutaneous ulcerations and sinopulmonary infections since childhood. Histology of pustular lesion revealed necrotizing folliculitis and perifollicular abscess formation. Ulcerative lesions showed a dense neutrophilic
infiltrate. At the age of 21 years she was diagnosed with PG in four different hospitals and treatment with corticosteroids and
cyclosporine was started.
Analysis of peripheral leukocytes. Mutation analysis of the ITGB2.
Results
Patient’s lymphocytes expressed 2% of CD18, whereas 10-14% of normal expression was observed on monocytes and granulocytes. The expression of the alpha-integrins chains ranged from a 3% of normal expression of CD11b on monocytes and
granulocytes to a 65% of normal expression of CD11c on patient’s granulocytes. A marked expression of CD18 and CD11a
was observed on PHA/IL-2-activated T-cells, albeit lower (20% of normal) than in cells from healthy donors. IFN-g increased
the expression of CD18 on leucocytes from healthy individuals but it did not result in increased membrane expression of
CD18 on patient’s leukocytes. Mutation analysis of ITBG2 revealed a (p.R593C) mutation in homozygosis. After LAD-1 diagnosis, immunosuppressant therapy was withdrawn and cotrimoxazol prophylaxis was started, with a clinical improvement,
although respiratory infections persisted. Between the ages of 30 and 41 years numerous episodes of cutaneous ulcers with
positive cultures for P. aeruginosa, methicillin-resistant S. aureus and S. maltophilia were recorded. In the same period, several
episodes of SS and PG were also documented. At the age of 41 years corticosteroid, azathioprine and Infliximab treatment
was started. The patient died of Septic Shock with multiorgan failure at the age of 41.
Conclusions
We report a patient diagnosed with moderate LAD-1 deficiency at the age of 27, with atypical clinical and histologic features:
(neither delayed cord separation, nor gingivitis, periodontitis or persistent peripheral neutrofilia). LAD-1 should be suspected in patients diagnosed with a childhood onset of PG, and immunosuppressive therapies for ND should be avoided.
142
P-037 OBSTETRIC ANTIPHOSPHOLIPID SYNDROME AND ANTIPHOSPHOLIPID AUTOANTIBODIES PROFILE
A. Tejeda Velarde1 , P. B. González Urra1 , I. Gañán Nieto1 , M. Á. Moreno Hidalgo1 , Á. Carrasco Sayalero1 1) Hospital Universitario Ramón y Cajal, Madrid
Introduction
Antiphospholipid syndrome (APS) is defined by recurrent thrombosis and/or pregnancy loss in the presence of antiphospholipid autoantibodies (aPL). However, previous studies have shown differences in the pathogenic pathway between thrombotic manifestations and obstetric APS. Moreover, there is no general agreement on which aPL profile confers the greatest
obstetric risk in APS patients.
Objectives
Our objective was to determine if a specific aPL profile may predict obstetric risk in women who suffer APS.
We studied retrospectively 50 women who suffered APS. We measured in serum samples by Enzyme-Linked ImmunoSorbent Assay (ELISA) the following aPL: Immunoglobulin G (IgG) and Immunoglobulin M (IgM) anticardiolipin autoantibodies,
and IgG and IgM anti-β2 glycoprotein I autoantibodies.
Results
19 out of 50 women suffered obstetric manifestations. In the univariate analysis IgG anticardiolipin autoantibodies (Odd
Ratio 0.96, p=0.028) were associated with obstetric APS. The number of positive aPL was associated with obstetric APS, Odd
Ratio of 0.33 (p=0.011).
The multivariate analysis identified two variables as obstetric APS predictor. IgG anticardiolipin autoantibodies (Odd Ratio
0.94, p=0.015) and IgG anti-β2 glycoprotein I autoantibodies (Odd Ratio 1.04; p=0.041). Discrimination ability of this model
was evaluated by ROC curve, the area under the curve was 0.8. The ability to model calibration was also evaluated using
Hosmer-Lemeshow test (p=0.52).
Conclusions
Specific aPL profile predicts obstetric risk in APS women.
The titers of IgG anticardiolipin autoantibodies and IgG anti-β2 glycoprotein I autoantibodies are associated with adverse
pregnancy outcome.
143
P-038 CHARACTERIZATION OF ANTI-RETINAL ANTIBODIES BY IMMUNOBLOT IN PATIENTS WITH SARCOIDOSIS AND
OCULAR INVOLVEMENT
C. L. Avendaño Monje1 , E. Martín de Valmaseda1 , A. M. Núñez Garnés1 , J. M. García Ruiz de Morales1 , S. Calleja Antolín1 1) Complejo Asistencial Universitario de León
Introduction
Sarcoidosis is a systemic granulomatous disease of unknown etiology. The spectrum of clinical manifestations is wide. Ocular
involvement is described in 20-70% of patients. When the disease involves the posterior pole, is severe and often disabling,
causing visual impairment.
TH1 lymphocytes have a central role in the immunopathology of sarcoidosis. The role of B cells and autoantibodies in the
disease is not well known. Polyclonal hypergammaglobulinemia and the presence of autoantibodies against different antigens is often observed. In patients with sarcoidosis and posterior uveitis antibodies against retinal antigens have been
descrited, but its clinical significance is unknown. There is no consensus on the methodology for detection, which explains
the reported differences in prevalence of anti-retinal antibodies in sarcoidosis.
Objectives
To characterize the pattern of anti-retinal antibodies in patients with sarcoidosis and ocular involvement.
Prospective study in patients with histologically confirmed sarcoidosis. Four groups of patients were included: a) 25 healthy
controls, b) 25 well-characterized patients with autoimmune diseases, c) 25 patients with sarcoidosis without ocular involvement and d) 25 patients sarcoidosis and ocular involvement.
Anti-retina antibodies were studied by Western blot, using human retina as antigen. The positive results were confirmed by
ELISA and localized by confocal microscopy.
Results
In healthy subjects and patients with autoimmune diseases reactivity of 27% and 32% with some retinal protein was respectively observed. In patients with sarcoidosis, prevalence reached 60%. In patients with sarcoidosis and ocular involvement,
30% recognized carbonic anhydrase type II, which was not observed in healthy controls and in patients with autoimmune
diseases or sarcoidosis without ocular involvement.
Conclusions
Sarcoidosis patients have a higher prevalence of anti-retinal antibodies. Only those with ocular involvement had antibodies
recognizing carbonic anhydrase type II. Although this antigen is not unique to retina and antibodies against carbonic anhydrase have been described in patiens with autoimmune pancreatitis, they are absent in healthy individuals and patients with
sarcoidosis without ocular involvement. These results suggest a pathogenic role of anti-carbonic anhydrase II antibodies in
some cases of sarcoidosis ocular.
144
P-039 ANTI-MITOCHONDRIAL M2 IIF STAINING PATTERN FOR ANTIBODIES AGAINST E2 SUBUNIT OF BRANCHED
CHAIN 2-OXO-ACID-DEHYDROGENASE COMPLEX (BCOADC-E2)
M. Martínez González1 , M. Fonolleda Ramboux1 , À. Soriano Martínez1 , A. Rus Merchán1 , A. Teniente Serra1 , B. Quirant
Sánchez1 , E. M. Martínez Cáceres1 1) Immunology Division Hospital Universitari Germans Trias i Pujol. Universitat Autònoma de Barcelona (UAB), FOCIS-CE UAB-ICS
Introduction
Serum anti-mitochondrial antibodies (AMA) are the diagnostic hallmark of primary biliary cirrhosis (PBC), being detected in
90-95% of affected individuals. They react selectively against subunits of the 2-oxoacid-dehydrogenase complexes family,
being the E2 subunit of the pyruvate dehydrogenase complex (PDC-E2) the most common autoantigen (>95%), followed
by the E2 subunit of branched chain 2-oxo-acid-dehydrogenase complex (BCOADC-E2) (52-55%). These antibodies are detected by indirect inmunofluorescence (IIF) using rat liver/kidney/stomach (LKS) composite blocks and have been described
as mitochondrial M2 pattern having a cytoplasmic granular fluorescence in the liver hepatocytes, the proximal and distal
tubules of the kidney and the parietal cells of the stomach. Nevertheless, differences in IIF staining pattern between mitochondrial M2 positive samples positive for PDC-E2 or BCOADC-E2 have not been reported so far.
Objective
To determinate if antibodies against PDC-E2 and BCOADC-E2 have a different staining pattern on LKS composite blocks that
would allow differentiating them by IIF.
Samples received in our hospital during the past 2 years with positive AMA detected by IIF (NOVA Lite Rat Liver/Kidney/Stomach®) and a negative immunoblot test for PDC-E2 specificity (D-Tek Blue Dot Liver 7 IgG®) had been reanalysed. IIF images
of these samples were compared to those AMA PDC-E2 positive. In those cases in which a differential anti-mitochondrial IIF
pattern was found in the kidney, the analysis by immunoblot was extended to the E2 subunit of BCOADC, PDC and oxoglutarate dehydrogenase complexes (D-Tek Blue Dot Liver 10 IgG®).
Results
Samples of 10 female patients (60±14 years) were identified. IIF staining showed a cytoplasmic granular fluorescence in hepatocytes, kidney tubules and parietal cells, similar to the one described for anti-mitochondrial M2 pattern, but with higher
fluorescence intensity on distal tubules of the kidney. All of these samples were confirmed as being positive for BCOADC-E2
antibodies and negative for PDC-E2 specificity by immunoblot. From the 10 patients, 4 have been diagnosed of PBC, 4 are
currently under study and 2 are asymptomatic with no symptoms of PBC.
Conclusions
This study shows that anti-mitochondrial antibodies directed against PDC or BCOADC-E2 subunits can be differentiated
by the staining intensity of the distal tubes of the rat kidney. Therefore, in front of a mitochondrial pattern with increased
staining fluorescence of the distal tubules, BCOADC-E2 specificity should be confirmed. The clinical implication of these two
anti-mitochondrial specificities should be evaluated.
145
P-040 PD-L1 EXPRESSION BY THYROID FOLLICULAR CELLS IN GRAVES’ DISEASE, A CLUE FOR THE UNDERSTANDING
OF GD IMMUNOPATHOLOGY?
D. Alvarez de La Sierra1 , C. de Jesus Gil2 , R. Ramezani2 , A. Lucas Martin3 , G. Obiols Alfonso4 , I. Caragol Urgelles1 , O. González
López5 , J. Doblas Fernéndez5 1) Hospital Universitario Valle de Hebron (HUVH) 2) Vall d’Hebron Institut de Recerca (VHIR) 3) Hospital Universitario Germans Trias
i Pujol 4) Hospital Universitario Valle de Hebron (HUVH) 5) Hospital Universitario Valle de Hebron (HUVH)
Introduction
Graves\’ disease (GD) is a relatively frequent thyroid autoimmune disease that is unusual because of the production of stimulating auto-antibodies to the thyrotropin receptor (TSHR). One outstanding feature of GD is that thyroid tissue is hyperplastic
and healthy in spite of progressive lymphocytic infiltration that may contain abundant CD8+ T cells. It is well established that
in GD thyroid follicular cells (TFC) overexpress HLA class I and expresses inappropriately HLA class II. TFCs also show high levels of adhesion molecule ICAM-1. HLA and ICAM-1 that are inducible by IFN-gamma that is present in thyroid autoimmune
glands. Parenchymatous cells like TFC may inhibit the effect of cytotoxic T cells by the expression of PD-L1 the ligand of PD1,
whose expression is also inducible by IFN-gamma.
Hypothesis
Expression of PD-L1 byTFCs may nfluence the outcome of the interaction betweenTFCs hyperexpressing HLA andT lymphocytes
and explain being spared by CTLs.
Objective
The purpose of this work is to determine the level of PD-L1 expression by TFC in normal thyroid and whether its expression
is increased in GD.
Substrates: Thyroid glands from patients affected by GD (n=10) or Multinodular Goitre (n=3), palatine tonsil (n=1), thymus
(n=1) and spleen (n=1) were obtained from the Hospital Germans Tries i Pujol or Hospital Vall d’Hebron biobanks. Cryostat sections were stained by the indirect immunofluorescence technique using antibodies to: PD-1, PD-L1, lymphocytes
markers as well as anti-Cytokeratin 18 (as a TFC marker). In some instances, double IFL staining was applied to confirm the
identity of the cells.
Results
Both Moabs and Rabbit polyclonal anti-PD-L1 were capable of detecting PD-L1 on lymphoid tissues with the expected patterns. PD-L1 was found to be expressed by TFC of GD thyroid glands at a higher level and with a different pattern that in MNG
thyroid. PD-L1 staining was clearly detected in approximately half of GD glands. In MNG only weak or traces of staining was
visible in the three glands examined.
Conclusion
PD-L1 is expressed by TFCs at higher level in GD glands than in non-autoimmune MNG glands and this may influence their
interaction with T lymphocytes. Further work is in progress to confirm and expand these results.
146
P-041 CD4+CD25+FOXP3+ EXPRESSION AND SUPERNATANT CYTOKINES IN CLONOGENIC hASCS/PBMCS
CO-CULTURES. EFFECT OF HASCS CONDITIONED MEDIA ON PBMCS PROLIFERATION
P. Martínez Peinado1 , S. Pascual García1 , M. L. Sen Fernández1 , M. I. Arribas García de León2 , E. Roche Collado2 , J. M. Sempere Ortells1 1) Universidad de Alicante 2) Universidad Miguel Hernández
Introduction
We have demonstrated in previous studies that different one-cell derived populations of human adipose-derived mesenchymal stem cells (hASCs) shown significant differences in 1) the inhibition of proliferation of co-cultured peripheral blood
mononuclear cells (PBMCs) and different isolated populations of lymphocytes and 2) in their cytokine profile.
Objectives
The objectives of this study were: 1) To analyse the effect of conditioned media from different clonogenic hASCs in the proliferation of PBMCs. 2) To assess the cytokine environment of clonogenic hASCs/PBMCs co-cultures. 3) To establish differences
in the expression of CD4+CD25+FoxP3+ lymphocytes in clonogenic hASCs/PBMCs co-cultures.
hASCs clones were obtained from different donors. Cell proliferation was measured by CFSE (Sigma) technique. Cytokines
were analysed by FlowCytomix (eBioscience). FoxP3 expression and membrane phenotype were detemined by the most
appropiate monoclonal antibodies (eBioscience). Co-cultures were performed with RPMI. Different DMEM (Gibco) conditioned media were obtained from clonogenic hASC cultures (20.000 cells, 72h). Conditioned media culture were performed by
using 50% RPMI (Gibco) and 50% of the aforementioned conditioned media. Phytohemagglutinin (PHA) 10 µg/mL (Sigma)
was used for stimulation. Flow cytometry was used for analysis (EPICS-XL, Coulter; FacsCantoII; BD).
Results
All the conditioned media (CM) from different clones of hASCs (hASCs) inhibited the proliferation of PHA-stimulated PBMCs.
Some differences between CM from different hASCs were observed. Regarding cytokines in supernatants of hASC-PMBCs
co-cultures, some differences were also found between PBMCs alone vs. the same cells co-cultured with hASCs. IL-5, IL-6, IL-9,
IL-10, IL-13, IFN-γ and TNF-α showed a decrease in concentration when hASCs were present, with a dissimilar degree according to the clone. IL-1 and IL-17 showed the opposite results, revealing statistically significant differences between hASCs
clones. Finally, the expression of FoxP3 in PBMCs in co-cultures with hASCs were distinct depending on the presence of the
different clonogenic hASCs.
Conclusions
Once more, we have demonstrated that differences in the degree of immunomodulation by clonogenic hASCs on PBMCs
happen at different levels, such as inhibition of proliferation, released cytokines and FoxP3 expression. Different clonogenic
hASCs cause different interactions with PBMCs, showing a wide range of in the final suppressive effect of hASCs.
147
P-042 DETERMINATION OF HLA-G AND ITS RELATIONSHIP WITH FOOD ALLERGIES
L. Velásquez Castrillon1 , M. V. Moreno Cantó1 , M. Vander Hofstadt Rovira1 , P. González Delgado2 , E. Flores Pardo2 , G. Rubio
Pedraza3 , E. Caparros Cayuela1 , J. Fernández Sánchez2 1) Universidad Miguel Hernández 2) Hospital de Alicante 3) Universidad de Murcia
Introduction
Allergic food hypersensitivity is defined as an adverse reaction caused by immunological mechanisms, mediated or not by
IgE. Non-IgE mediated reactions are cell-mediated hypersensitivity processes still not clearly understood. HLA-G antigens
are non-classical HLA molecules, characterized by low allelic polymorphism, and limited tissue distribution. The presence
of HLA-G has been associated with tolerogenic functions in innate and adaptive cellular response, since HLA-G antigens are
able to affect the cytotoxicity of NK cells and T cells CD8+, CD4+ and dendritic cell maturation. Moreover, the allelic polymorphism of the HLA-G gene, deletion/insertion polymorphism of a sequence of 14 bp in exon 8 in the 3\’ UTR, has been associated with the generation of an unstable mRNA and lower production of sHLA-G protein. This gene alteration may confer
different ability to control inflammatory processes in these food-allergic patients.
Objecive
To evaluate the presence of genetic polymorphism in HLA-G and its association with HLA-G protein in food-induced non-IgE
hypersensitivity patients compared to healthy controls.
Detection of the deletion/insertion polymorphism of HLA-G. DNA from saliva samples was extracted and PCR was performed, using GAPDH as positive control. PCR products were subjected to 1% agarose gel, and both 226 bp and 240 bp bands,
or none were observed depending on polymorphism presence or null allele 01:05N deletion detection, respectively.
Measurement of HLA-G protein. HLA-G was determined by ELISA and detection antibody was MEM-G/1.
Results
Determining the deletion/insertion polymorphism in exon 8 and null allele 01:05N of HLA-G gene expression in food-allergic patients. Determination was performed in 25 samples of patients with food allergy to fish; 16 samples were positive for
the allelic polymorphism and 9 samples were positive for the null allele 01:05N. For fruit-allergic patients, 2 samples were
positive for the allelic polymorphism. In the case of vegetable protein-allergic patients, for 5 samples were positive for the
allelic polymorphism and 3 samples positive for the null allele 01:05N. We analysed 36 healthy controls, and 7 of them were
positive for the allelic polymorphism. ELISA Detection of soluble protein sHLA-G saliva samples. HLA-G protein was detected in 19 samples out of 25. In the presence of the polymorphism, levels of the protein are varied, but lower compared with non-carriers of the polymorphism healthy
controls. In the case of null allele, HLA-G was not detectable in either case.
Conclusions
HLA-G protein and genetic profile is related to food-allergy diagnose in non-IgE mediated allergic patients. It may have a
role in tolerance establishment to food, so a deeper understanding of these processes will result in the acquisition of new
knowledge that can be useful against these increasingly prevalent diseases in our society. 39 Congreso de la Sociedad Española de Inmunología
148
P-043 LATE ONSET CRYOPYRIN-ASSOCIATED PERIODIC SYNDROME DUE TO MYELOID-RESTRICTED SOMATIC NLRP3
MOSAICISM
A. Mensa-Vilaró1 , M. T. Bosque Peralta2 , G. Magri3 , H. Martínez-Banaclocha4 , J. J. Martínez-García4 , A. Baroja-Mazo4 ,
E. González-Roca1 , M. Casorran-Berges2 , J. Sintes3 , S. Plaza1 , M. C. Antón1 , E. Ruiz-Ortiz1 , A. Cerutti3 , P. Pelegrín4 , J. Yagüe1 ,
C. Delgado-Beltran2 , J. I. Aróstegui1 1) Hospital Clínic-IDIBAPS. Barcelona. Spain 2) Hospital Clínico Universitario Lozano Blesa. Zaragoza. Spain 3) Hospital del Mar.
Barcelona. Spain 4) Hospital Clínico Universitario Virgen Arrixaca. Murcia. Spain.
Introduction
Cryopyrin-associated periodic syndromes (CAPS) are monogenic autoinflammatory diseases caused by dominantly inherited or de novo gain-of-function NLRP3 mutations. These mutations lead to an uncontrolled hyperactivity of the NLRP3-inflammasome and an overproduction of IL-1β. Recently, next-generation sequencing-based methods have expanded the genetic
bases of CAPS to include NLRP3 mosaicism as a pathophysiological mechanism playing an important role.
Objectives
To identify the genetic cause of the disease in a patient with late onset but otherwise typical CAPS.
DNA was extracted from unfractionated peripheral blood and from different isolated hematopoietic and non-hematopoietic
cells. Molecular analysis was performed by both Sanger sequencing and by amplicon-based deep sequencing (ADS). The
pathogenic effect of the NLRP3 variant was investigated using different functional assays.
Results
The patient is a 64 year-old Spanish male who started at the age of 56 years with a generalized urticarial rash, oligoarthritis, bilateral deafness, and marked leucocytosis, neutrophilia and increased inflammatory markers. ADS detected the novel
p.Gln636Glu NLRP3 mutation, with an allele frequency of 25.0% in unfractionated blood, suggesting for the presence of a
somatic mosaicism. The analyses of different tissues showed variable frequencies for the mutated allele (range 0-31.8%)
depending on the cell’s origin. The novel NLRP3 mutation was restricted to myeloid cells (31.8% in monocytes, 24.6% in neutrophils, and 11.2% in circulating CD34+ common myeloid progenitor cells) and was completely absent in cells of lymphoid
lineage. The novel NLRP3 variant was located on a highly evolutionary conserved amino acid residue and was predicted to
be possibly damaging by different bioinformatics algorithms. Functional assays showed that the novel variant induces both
ASC-dependent NF-kB activation and necrosis-like programmed cell death as well as constitutively increased activation of
NLRP3-inflammasome. Treatment with the anti-interleukin-1 drug anakinra showed a rapid remission of all clinical symptoms, with the exception of deafness, and normalization of inflammatory markers.
Conclusions
We herein describe a novel somatic NLRP3 mutation as the cause of the disease in a patient with late onset, but otherwise
typical CAPS, which was restricted to cells of myeloid lineage. Our findings expand the clinical diversity of CAPS towards mild
phenotypes, which may not start necessarily during childhood.
149
P-044 A PROPOSAL FOR NEW CLINICAL CRITERIA OF OBSTETRICAL ANTIPHOSPHOLIPID SYNDROME
A. Comins Boo1 , M. Nuñez Beltrán1 , J. L. Ochoa Grullón1 , Á. García Segovia3 , M. Fernández Arquero1 , P. Coronado Martín2 ,
M. Á. Herraiz Martínez2 , S. Sánchez Ramón1 1) Hospital Clinico San Carlos 2) Hospital Clinico San Carlos 3) Clinica Millenium
Introduction
The antiphospholipid syndrome (APS) is the most common cause of recurrent reproductive failure (RRF). Besides the thrombotic component in the APS pathophysiology, an inflammatory component may compromise the embryo survival and mother health status. The role of natural killer (NK) cell expansion in the setting of APS remains to be clearly defined.
Objetives:
Our main goal was to study the association of APS with peripheral NK expansion in RRF (recurrent miscarriages, RM, and
recurrent implantation failure, RIF, after six good-quality embryos).
We retrospectively evaluated the incidence of antiphospholipid antibodies (aPL) and blood NK expansion (defined as total
NK proportions above 13% of total lymphocytes) in RRF patients. aPL were studied by ELISA and NK cells by multiparametric
flow-cytometry (BD).
Results
In this preliminary study 588 patients were evaluated: 282 RM (mean age 36.38 ± 3.57; mean of miscarriages, 3.7) and 306 RIF
(mean age 37.67 ± 3.73; mean of IVF treatments, 3.2).
Fifty-five out of 282 RM patients (19.5%) had positive aPL antibodies, whereas sixty-four out of 306 RIF patients (20%) had
positive aPL (p=0.67). Expanded circulating NK cells were found in twenty out of fifty-five RM patients (36.36%) and twenty-eight out of sixty-four RIF patients (43.75%; p=0,41).
Conclusions
RIF and RM patients showed similar incidence of aPL antibodies, although RIF is still not considered a clinical criteria of APS.
NK expansion was observed in a significant number of APS patients and may point to a more inflammatory aspect of this
pathology that should be carefully monitored. Ongoing prospective studies are being carried out to thoroughly study the
implications of this association.
150
P-045 AUTOIMMUNE EVALUATION IN PATIENTS WITH IDIOPATHIC PORTAL HYPERTENSION (IPH). POTENTIAL
PATHOPHYSIOLOGICAL ROLE AND BIOMARKERS
E. A. González-Navarro1 , E. Cerda Reyes2 , G. Silva-Junior2 , S. Seijo3 , A. Baiges3 , V. Hernández-Gea3 , M. Juan1 , J. C. García-Pagán3 1) Hospital Clinic Barcelona 2) Idibaps 3) Liver Unit Hospital Clinic 4) Universidad de Barcelona
Background and Aims
IPH is a rare clinical disorder consisting of intrahepatic portal hypertension in the absence of cirrhosis and other causes of
liver disease. The pathophysiological mechanisms causing IPH remain largely unknown, although IPH is occasionally associated with autoimmune diseases (AD).
This study evaluates the potential involvement of autoimmunity in the pathophysiology of IPH.
Methods
In serum samples prospectively collected from 39 patients with IPH and of 39 patients with liver cirrhosis (LC) matched by
gender, signs of portal hypertension and liver function included as controls the 25 autoantibodies were determined. Antiendothelial cell antibodies (AECA) by CytoELISA (cell basedELISA using EA.Hy926 cells), immunohistochemistry (IH) and
Western-blot on normal liver.
Results
Anti-TPO (Anti-Tiroperoxidase) and AECA were significantly more frequent in IPH patients than in patients with LC
(41%vs10.3%;p=0.002 and 25.6%vs2.6%;p=0.003 respectively). These autoantibodies were represented in all IPH subgroups.
Selectivity of AECA positivity was confirmed by IH showing reactivity against endothelial cells of normal livers.
EA.Hy926 lysates were tested by Western blotting with serum samples, identifying a protein with a molecular weight of 68-72
kDa. Presence of anti-TPO and/or AECA had no prognostic value; patients had a similar clinical outcome during follow-up. In
the current cohort of patients with portal hypertension (IPH+LC), presence of anti-TPO and/or AECA had a specificity/sensitivity of 87.2%/64.1%; and a positive/negative likelihood ratio of 5/0.41 respectively for the diagnosis of IPH.
Conclusions
Our findings suggest a potential contribution of AECA and anti-TPO to IPH pathogenesis and may be helpful for the diagnosis of IPH.
151
P-046 UTILITY OF ANTI-PLA2R ANTIBODIES BY INDIRECT IMMUNOFLUORESCENCE IN IDIOPATHIC MEMBRANOUS
NEPHROPATHY DIAGNOSIS
E. Vergara Prieto1 , M. I. Alcalá Peña1 , M. L. Vargas Pérez1 , S. Barroso Hernández1 , L. Oliveira Azevedo1 , R. Hernández Gallego1 ,
N. R. Robles Pérez-Monteoliva 1 1) Complejo Hospitalario Universitario de Badajoz
Introduction
Phospholipase-A2-receptor antibodies (anti-PLA2R) could play an important role in the development of idiopathic Membranous nephropathy (iMN), and could be used as a marker to help at diagnosis, classification and monitorization of disease.
Objectives
To evaluate the diagnostic utility of anti-PLA2R in iMN diagnosis in our Health Area.
We retrospectively evaluated the values of anti-PLA2R in 108 patients at the time of diagnosis: 30 patients with iMN, and 78
patients with other nephropathies. The diagnosis of iMN was confirmed by renal biopsy.
Also, anti-PLA2R were studied in 29 patients with a previous diagnosis (more than four years of evolution) of iMN who had
received some treatment and with different clinical status (measure by proteinuria evolution).
The detection of circulating anti-PLA2R was performed using an IIF (indirect immunofluorescence) Mosaic (EUROIMMUN AG,
Lübeck, Germany). The slide contains a mosaic of two different biochips in one incubation field, the first biochip is coated
with human embryonic kidney (HEK) 293 cells expressing the PLA2R-protein, the second biochip contains non-transfected
HEK293 cells as substrates. We calculated the sensitivity and specificity of the IIF technique for the identification of patients
with iMN at diagnosis.
Results
A total of 20 of the 30 patients with iMN at the time of diagnosis had anti-PLA2R. Out of the 78 patients with other nephropathies, only one had anti-PLA2R, whose diagnosis was myeloma. The sensitivity of this trial in this group is 66,7% with a
specificity of 98,7%, negative predictive value 88,5% and positive predictive value 95,2%.
Within the group of patients previously diagnosed of iMN (n=29) anti-PLA2R were not detected. Nevertheless 8 of them had
markers of disease activity (proteinuria increase from baseline).
Conclusions
The diagnostic utility of anti-PLA2R is very high. The elevated specificity would allow avoiding doing biopsies in individuals
with a positive result for these antibodies. Also, they could be an useful biomarker in order to monitor the disease and predict
relapse. It supports the idea of being serological markers of disease activity.
152
P-047 ABSCOPAL EFFECTS OF RADIOTHERAPY ARE ENHANCED BY COMBINED IMMUNOSTIMULATORY MABS AND
ARE DEPENDENT ON CD8 T-CELL CROSSPRIMING
I. Rodríguez López1 , M. E. Rodríguez Ruiz1 , S. Garasa Larraza2 , B. Barbés Fernández1 , J. L. Solorzano Rendon1 , J. L. Pérez
Gracia1 , S. Labiano Almiñana2 , M. Fernández de Sanmamed Gutiérrez1 , A. Azpilikueta Lusarreta2 , E. Bolaños Mateo2 ,
A. Rodríguez Sánchez-Paulete2 , M. A. Aznar Gómez2 , A. Rouzaut Subirá2 , M. Jure Kunkel3 , I. Melero Bermejo1 1) Clinica Universidad de Navarra 2) Centro de Investigación Médica Aplicada 3) Bristol Myers Squibb
Introduction
Preclinical and clinical evidence indicate that the proimmune effects of radiotherapy can be synergistically augmented with
immunostimulatory monoclonal antibodies (mAb) to act both on irradiated tumor lesions and on distant, non-irradiated
tumor sites.
Objectives
Evaluation the effect of the combination of radiotherapy with immunostimulatory anti-PD1 and anti-CD137 mAbs and the
abscopal effect.
Radiotherapy was delivered to a field including the tumor with 2 mm margins using a Clinac 2300 C/D Linear Accelerator fitted with a 10 mm RadioSurgery conical collimator, which is designed to deliver very sharp and limited radiation dosed
fields. Mice received 3 fractions of 8 Gy on alternate days. Mice were injected s.c. with 5×105 cells in the right flank (primary
tumor) and 3×105 cells in the left flank (secondary tumor). On Day 12, animals were randomly assigned to groups receiving
or not radiotherapy, to only one of the two tumors, in combination or not with intraperitoneal immunostimulatory monoclonal antibodies (anti-PD1, anti-CD137 or both). Tumors were measured to evaluate de survival or were analized by flow
citomtetry and immunohistochemistry.
Results
The combination of radiotherapy with immunostimulatory anti-PD1 and anti-CD137 mAbs was conducive to favorable
effects on distant non-irradiated tumor lesions as observed in transplanted MC38 (colorectal cancer), B16OVA (melanoma)
and 4T1 (breast cancer) models. The therapeutic activity was crucially performed by CD8 T cells, as found in selective depletion experiments. Moreover, the presence of BATF-3-dependent dendritic cells specialized in crosspresentation/crosspriming of antigens to CD8+ T cells was an absolute requirementere absolutely required for the antitumor effects to occur. The
irradiation regimen induced immune infiltrate changes in the irradiated and non-irradiated lesions featured by reductions
in the total content of effector T cells, Tregs, and myeloid-derived suppressor cells (MDSC), while effector T cells expressed
more intracellular IFNγ in both the irradiated and contralateral tumors. Importantly, 48h following irradiation CD8+ TILs
showed brighter expression of CD137 and PD-1, thereby displaying more target molecules for the corresponding mAbs.
Likewise, PD-1 and CD137 were induced on tumor-infiltrating lymphocytes from surgically excised human carcinomas that
were irradiated ex-vivo.
Conclusions
These mechanisms involving crosspriming and CD8 T cells advocate clinical development of immunotherapy combinations
with anti-PD1 plus anti-CD137 mAbs that can be synergistically accompanied by radiotherapy strategies, even if disease is
left outside the field of irradiation.
153
P-048 SUCCESSFUL IMMUNOTHERAPY AGAINST A TRANSPLANTABLE MOUSE SQUAMOUS LUNG CARCINOMA WITH
ANTI-PD-1 AND ANTI-CD137 MONOCLONAL ANTIBODIES
A. Azpilikueta Lusarreta1 , J. Agorreta Arrazubi2 , S. Labiano Almiñana1 , J. L. Pérez Gracia 3 , A. Rodríguez Sánchez-Paulete1 ,
M. Aznar Gómez1 , D. Ajona Martínez-Polo2 , I. Gil Bazo3 , M. Larráyoz Ilundáin2 , Á. Teijeira Sánchez1 , M. E. Rodríguez Ruiz1 ,
R. Pío Osés2 , L. Montuenga Badía2 , I. Melero Bermejo1 1) CIMA 2) CIMA 3) CUN
Introduction
Anti-PD-1 and anti-PD-L1 antagonist monoclonal antibodies are being developed in the clinic against metastatic non-small
cell lung cancer (NSCLC) with special efficacy against the squamous histology. However, there is a lack of reliable experimental models for this histology to test immunotherapeutic combinations.
Objectives
Generate a squamous cell lung cancer mouse model to study the efficacy and mechanisms of actions of the combination of
anti-PD-1 and anti-CD137 mAbs.
We generated a transplantable squamous cell carcinoma (UN-SCC680AJ ) cell line from a lung tumor induced by chronic
NTCU mutagenesis in AJ mice. Tumor cells expressed cytokeratin-14, overexpressed p40 and lacked TTF1, indicating squamous lineage as confirmed by histology. Over two hundred mutations in its exome suggested potential for antigenicity.
Immunocompetent mice subcutaneously implanted with this syngeneic cell line were treated with anti-CD137 and/or anti-PD-1 mAb and monitored for tumor growth/progression or assessed for intratumoral leukocyte infiltration using immunohistochemistry and flow cytometry.
Results
In syngeneic mice, large 12-day-established tumors derived from the transplantable cell line variant UN-SCC680AJ were
amenable to curative treatment with anti-PD-1, anti-PD-L1 or anti-CD137 immunostimulatory monoclonal antibodies. Single agent therapies lost curative efficacy when treatment started beyond day +17, whereas a combination of anti-PD-1 + anti-CD137 achieved complete rejections. Tumor cells expressed weak baseline PD-L1 on the plasma membrane but this could
be readily induced by interferon-g. Combined treatment efficacy required CD8 T-cells and induced a leukocyte infiltrate in
which T lymphocytes co-expressing CD137 and PD-1 were prominent.
Conclusion
These promising results advocate the use of anti-PD-1/PD-L1 + anti-CD137 mAb combined immunotherapy for the treatment of squamous NSCLC in the clinical setting.
154
P-049 INFLIXIMAB SERUM CONCENTRATIONS, TREATMENT RESPONSE AND TREATMENT COSTS IN PSORIASIC PATIENTS
J. Bas Minguet1 , M. Colls González2 , J. Notario Rosa3 , F. Morandeira Rego1 , N. Padullés Zamora2 , J. Climent Martí1 , A. Padullés
Zamora2 , V. Mas Bosch1 , H. Colom Codina4 1) Hospital Universitari de Bellvitge 2) Hospital Universitari de Bellvitge 3) Hospital Universitari de Bellvitge 4) Universitat de
Barcelona
Introduction
Infliximab (IFX) is widely used in psoriasis treatment. The current IFX approach is based on an initial dose of 5 mg/kg given
intravenously at weeks 0, 2, 6, and every 8 weeks (8w). Due to large inter-individual variability in IFX pharmacokinetics, exposure guided dose could be a cost-effective strategy for regimen optimization.
Objectives
Primary endpoint was to assess the relationship between IFX serum pre-dose concentrations (Cmin) and treatment efficacy
assessed by PASI (Psoriasis Area and Severity Index score). Secondary endpoint was to analyze the economic impact of IFX
treatment optimization based on IFX Cmin, presence of anti-IFX antibodies (ATI) and clinical response (PASI).
Prospective study of patients with moderate to severe psoriasis treated with IFX between January 2013 and November 2015.
Cmin (mg/L) and ATI were determined at steady state conditions by ELISA (Promonitor®). Patients achieving PASI100, Cmin>1.5
mg/L and undetectable ATI were scheduled to decrease dose to 3-4 mg/kg/8w or 5 mg/kg/8w if they were previously receiving intensified IFX. When steady state was achieved with the new regimen, Cmin, ATI and PASI were determined. IFX was
discontinued if patients tested ATI positive in 3 consecutive measurements.
Results
23 patients were included (7 with psoriatic arthritis). Median weight (kg): 86,9 (Q1-Q3:70.9 -94.0), median age (years): 53
(Q1-Q3: 40-60), median BSA (m2): 1.99 (Q1-Q3: 1.79-2.17). 58 samples were available for analysis. Median IFX dose: 5 mg/
kg/8 weeks (range, 3.5 mg/kg/8w-5 mg/kg/6w). Median IFX Cmin (mg/L):2.14 (Q1-Q3: 0.35- 2.64). ATI were positive in 6 cases.
Median dose (mg/ kg/ month) and dose adjusted Cmin (Cmin/D) (mgL-1/mg kg-1month-1) were 2.57 and 0.73 respectively. In
patients with a BSA >1.7 m2, median Cmin/D was 0.87. Mean PASI was 2.07 (Q1-Q3:0-3). Median Cmin in patients achieving PASI
75 was 2.11 mg/L vs 1.5 mg/L in those not achieving PASI 75.
IFX initial regimen was maintained in 11 patients. Dose was reduced in 5 patients (n=3: 4mg/kg 8w, n=1: 3.5mg/kg 8w and
n=1: 7w to 8w). Two patients presented lack of response and 3 developed secondary failures due to ATI; treatment was changed to another anti-TNF or Ustekinumab in all these patients. Treatment was stopped in 2 patients (one of these patients
tested positive for ATI). Annual IFX cost was 314.731€ and annual cost/patient was 13,684€ (7,183 – 25,226€). Treatment cost
for the entire study period was 748,099€. Annual savings compared to initial IFX treatment (in maintenance regime) were
42,889€ and 67,155€ for the entire study period.
Conclusions
Determination of IFX Cmin and ATI is a useful tool for treatment optimization in clinical practice. Both Higher Cmin and
BSA<1.7 m2 are associated with a better clinical response. Moreover, monitoring psoriasis treatment with Cmin, ATI and PASI
produces significant cost savings.
155
P-050 TARGETED DELIVERY OF DEXAMETHASONE PALMITATE IN RHEUMATOID ARTHRITIS USING POLYMERIC
NANOPARTICLES
R. Simón Vázquez1 , M. Lorscheider2 , P. Calleja2 , L. Mousnier2 , N. Tsapis2 , E. Fattal2 , Á. González Fernández1 1) Centro de Investigaciones Biomédicas y Universidad de Vigo 2) Univ. Paris-Sud, Université Université Paris-Saclay
Introduction Glucocorticoids (GC) are potent anti-inflammatory and immunosupresant drugs that are useful in the treatment of many inflammatory and autoimmune diseases, such as rheumatoid arthritis (RA). However, their unfavorable pharmacokinetics (PK), the high
doses needed to reach a therapeutic effect, and the associated side effects have limited their prescription. Hence, the therapeutic
use of GC could benefit from a targeted delivery into the inflamed tissues by using polymeric nanoparticles (NPs). This strategy could
improve their PK by means of the enhanced permeation and retention effect (EPR), reducing at the same time the dose needed.
Objectives
Dexamethasone (DXM) is a suitable GC for the treatment of RA that has been already encapsulated into polymeric NPs. In
the present work, the prodrug dexamethasone palmitate (DXP) was encapsulated into PLGA-PEG NPs with a high efficiency.
The PK of this formulation was studied in vivo, in healthy mice, and compared with the commercial DXM.
Nanoparticle preparation
The unloaded and DXP-loaded NPs were prepared by the solvent emulsion evaporation technique. Particle size, polydispersity index and Z-potential were determined using a Malvern Zetasizer NanoZS. The DXP loading was characterized by HPLC.
Pharmacokinetics
The PK studies were done in 9 weeks old mice. Seven animals per group were used, and the equivalent of 12 mg/Kg of dexamethasone was injected as DXP-PLGA-PEG NPs. The animals were sacrificed at different time points, and the plasma and organs collected for DXP and DXM quantification by HPLC. A group receiving commercial dexamethasone was used as control.
Results
Nanoparticle characterization
The PLGA-PEG NPs, unloaded and DXP-loaded, were characterized for size and Z-potential (Table 1). All the formulations
were stable up to 30 days.
After removal of the free DXP, the drug loading was measured using four different DXP amounts (5, 10, 15 and 20 mg) by
HPLC. The drug loading followed a linear behavior and the encapsulation efficiency was about 75%. The drug loading obtained in 100 mg PLGA-PEG by using an initial amount of 10 mg of DXP was 7% approximately.
Pharmacokinetics
The pharmacokinetics of the DXP encapsulated in PLGA-PEG NPs was characterized by HPLC at different time points. The
elease of DXP and the DXM concentration in plasma were high for almost 18 hours, much longer than the commercial injectable form of dexamethasone sodium phosphate, with low plasma levels after two hours.
Conclusions
The encapsulation of DXP in PLGA-PEG NPs was achieved with good encapsulation efficiency. The PK of the DXP-PLGA-PEG
formulation was much favorable than the commercial dexamethasone. The efficacy on a RA model will be tested in the future.
156
P-051 BENEFITS OF IMMUNOMODULATION THROUGH MUCOSA IN PREVENTING OF RECURRENT VULVOVAGINAL
CANDIDIASIS (RVVC)
M. Guzmán Fulgencio1 , M. G. Pérez Ortiz2 , M. Tejera Alhambra 1 , J. C. Ruiz de La Roja 2 , J. Valero Bernabé2 , J. L. Subiza1 ,
E. Fernández Caldas1 , M. Casanovas1 1) Inmunotek SL 2) Hospital Santa Cristina, Madrid
Introduction
Recurrent vulvovaginal Candidiasis (RVVC) is a functional disorder that is defined as 4 or more episodes of vulvovaginal
infection in a perid of 12 months caused by Candida. albicans but occasionally caused by other Candida sp. or yeasts. An
estimated 75% of women will have at least one episode of VVC, 40%–45% will have two or more episodes and 5-8% of adult
women will develop RVVC.
The main strategies of action for the treatment of RVVC are aimed at getting the rebalancing of the vaginal flora. The preventive strategy is necessary but it is limited to the prophylactic treatment for the removal of the causative agent. However, there
are other emerging alternatives to avoid reinfection or relapse but still no scientific evidence of its efficacy.
Objetives
The aim of this study was to evaluate the benefits of specific mucosal immunomodulation (sublingual) through a pilot study
as an alternative in the prevention of this disease.
Patients: 33 patients (median age 42.5 years, range 18-72) of which 23 had RVVC and 10 RVVC and recurrent UTI (Urinary
Tract Infection) were included. Median RVVC episodes in the 12 months prior to treatment was 6 (range 4-8).
Treatment: 23 patients received an individualized vaccine RVVC Uromune® (INMUNOTEK, SL, Q-Pharma) with a selected
strain (V132) of Candida albicans cultured and inactivated under optimized conditions and 10 with RVVC and recurrent UTI
received a mixture of V132 with selected strains (MV140) of inactivated bacteria. The concentration was 300 FTU/mL (109
organisms/mL). Sublingual dose administered was 200 microliters per day for 3 months and follow up was 12 months. Wilcoxon test was used to compare the number of episodes of infections before and after of treatment.
Results
Median after treatment episodes was 0, range 0-5 (P < 0.0001). Twenty patients (60.6%) did not develop a new infection, 5
(15.2%) developed 1 (mild) and 6 (18.2%) had 2 or more infections. Two patients (6%) discontinued treatment. No adverse
reactions were recorded.
Conclusions
Immunomodulatory treatment with individualized vaccine with Candida albicans is very safe with an efficacy of 80% (0-1
new infections). Sublingually immunomodulation with selected strains could be an effective strategy to reduce the frequency and duration of these recurrent infections.
157
P-052 MUCOSAL BACTERIAL IMMUNOSTIMULATION HIGHLY REDUCES THE NEED OF SURGERY IN PATIENTS WITH
RECURRENT TONSILLITIS
L. García1 , M. Tejera Alhambra2 , M. Guzmán Fulgencio2 , R. Caballero2 , E. Fernández Caldas2 , J. L. Subiza2 , M. Casanovas2 1) Hospital Carmen y Severo Ochoa 2) INMUNOTEK, S.L.
Introduction
Recurrent tonsillitis in adults is a common otorhinolaryngological disease. It is a very frequent condition with a major, clinical
and occupational impact, affecting the daily quality of life of the patient. Currently, the standard treatment is tonsillectomy.
As prophylaxis for surgery, continuous prophylaxis with antibiotics is indicated. BACTEK® is a bacterial immunostimulant
successfully used for the prevention of recurrent respiratory tract infections. Bacterial preparations administered through
the sublingual route have demonstrated to be safe and effective, boosting innate immunity and increasing antigen-specific
cell-mediated and humoral responses.
Objective
The objective of this study was to evaluate if the use of a bacterial immunostimulant together with prophylactic antibiotic
therapy could reduce the frequency and severity of tonsillitis and avoid tonsillectomy.
In this study, the medical records of 88 patients (24 men and 64 women, median 25 years, range 20-31 years) with recurrent
tonsillitis were reviewed. All patients had recurrent tonsillitis with chronic inflammation, suffering a minimum of 3 acute episodes in the last 12 months. All patients included in the study were candidate for surgery. Sixty-six were treated with a course
of antibiotics (penicillin im or azithromycin). Twenty-two patients received, in addition to the antibiotics, the polybacterial
immunostimulant (BACTEK®) during the same period of time. The mean time of treatment was 4.4 (± 2.2) months per patient.
BACTEK® is suspension of six inactivated non-lysated bacterial concentrates: Staphylococcus aureus 15%; Staphylococcus epidermidis 15%; Streptococcus pneumoniae 60%; Klebsiella pneumoniae 4%; Moraxella catarrhalis 3%; Haemophilus influenzae
3%. The administration was daily applying two sprays through the oral mucosal route (perlingual/sublingual route). Failure
of treatment was considered if there were 2 new episodes of tonsillitis after the initiation of the corresponding treatment.
Results
Globally, 53 (60%) patients had clinical improvement and 35 (40%) were tonsillectomized. In the group that only received
antibiotics as prophylactic treatment 35 (53%) avoided tonsillectomy and 31 (47%) has at least 2 new episodes of tonsillitis
and required surgery. In the group receiving antibiotics plus BACTEK® 18 (82%) patients experienced clinical improvement
avoiding tonsillectomy. The difference between both study groups was statistically significant (P=0.0230). There were no side
effects regarding BACTEK® reported and all patients completed the prophylactic treatment.
Conclusion
These results obtained from real life conditions in adult patients with recurrent tonsillitis support the administration of sublingual polybacterial immunostimulation as an effective strategy to reduce the need of tonsillectomy. 39 Congreso de la Sociedad Española de Inmunología
158
P-053 OPTIMAL INFLIXIMAB SERUM TROUGH LEVELS RANGES IN PATIENTS WITH RHEUMATOID ARTHRITIS WITH A
GOOD CLINICAL RESPONSE
E. M. Olariaga Mérida1 , A. Martínez Feito1 , T. Jurado Camino1 , C. Plasencia Rodriguez1 , A. Balsa Criado1 , M. Á. Gonzalez Gómez1 ,
A. Villalba Yllan1 , D. Peiteado López1 , G. Bonilla Hernan1 , D. Pascual-Salcedo Pascual1 1) Hospital Universitario La Paz
Introduction
The biologic treatments have supposed a therapeutic revolution in the last years. Several publications have shown that patients
in treatment with anti-TNF drugs with a good response have higher circulating drug levels than no-responder patients. These
levels could be affected by different parameters like pharmacokinetic, age, body weight index, standard dose, among others.
Numerous endeavours are being focused to find optimal circulating drug ranges but nowadays, there are few publications
only in Adalimumab and Etanercept.
Objetive
To establish optimal Infliximab (Ifx) trough levels (ITL) range in rheumatoid arthritis (RA) patients associated to a good clinical
response.
Methods
Out of the 112 RA patients from the biologic cohort treated with Ifx enrolled at the department of rheumatology, 61 received
a standard dose of Ifx: 3 mg/kg every 8 (±1) weeks. The retrospective study period covered from 6 months to 5 years. The
clinical response was evaluated according EULAR criteria and the clinical improvement by ΔDAS28. ITL were measured by
ELISA [correlation with Promonitor (Derio, Vizcaya) k=1, r=0,88; with Sanquin (Amsterdam, Holanda) k=1, r=0,97] in a total of
161 serum samples. All of the statistical analyses were performed using GraphPadPrism 5.0 software.
Results
A total of 61 patients with RA were enrolled in the study, of whom fifty four (88.8%) were women, with a mean (± SD) age of
57.2± 14.9 years. Mean time of disease was 10.5±8.7 years. Forty seven (77%) and fifty three patients (87%) were positive to
Rheumatoid Factor (RF) and ACPA, respectively. The median ITL, excluding samples with antibodies to Ifx (n=22), were 2624
ng/ml (IQR 1088-4096), being the most frequent values of our distribution 1000 and 4000 ng/ml (35% and 28%, respectively).
Patients with a good EULAR response had higher ITL than patients with a moderated EULAR response [3392 ng/ml (IQR 13444800) vs 1824 ng/ml (IQR 322-3529), p=0.02] or not EULAR response [3392 ng/ml (RIQ 1344-4800) vs 118 ng/ml (RIQ 9-3472),
p<0,01]. Of all Ifx measurements (n=161), clinical improvement absence (ΔDAS28<1,2) was associated with lower levels of
quartil25 (p<0.01) and upper levels of quartile75 did not show a greater clinical improvement (p=0.24) than ITL around the
median (1088 ng/ml a 4096 ng/ml).
Conclusion
ITL are correlated with the EULAR response and the clinical improvement. ITL between 1088 ng/ml and 4096 ng/ml showed
to be the optimal range associated with a good clinical response and higher circulating levels do not associate with a clinical
improvement increase. The economic impact of applying the knowledge of optimal ranges is a relevant tool to improve the
management in RA patients in clinical practice.
Funding by restricted grants from Pfizer (PI-1155) and from Progenika (PI-1557).
159
P-054 GENETIC IMMUNOTHERAPIES FOR THE TREATMENT OF MELANOMA THAT INHIBIT MDSC DIFFERENTIATION
AND FUNCTION
M. Gato Cañas1 , I. Blanco Luquin1 , H. Arasanz Esteban1 , D. Escors Murugarren1 , V. Arteta Sanchez1 , G. Kochan1 , X. Pérez de
Morentin1 , J. Fernandez Irigoyen1 , E. Santamaria Martínez1 1) Navarra Biomed
Introduction
Although there are a number of strategies to strengthen antigen presentation by dendritic cells to drive anti-tumour responses, these strategies hardly overcome the immunosuppressive tumour microenvironment that inhibits effector T cells.
This immunosuppressive environment is in part reinforced by the activities of myeloid derived suppressor cells (MDSCs). Intra-tumour MDSC differentiation and functions are still largely unknown as they are very hard to isolate them from tumours.
We have recently devised a highly efficient and rapid method to produce very large numbers of tumor-infiltrating MDSCs ex
vivo without inducing tumors in mice. MDSCs and DCs will be used to evaluate lentivector-based genetic treatments to (1)
boost DC activities while (2) inhibit MDSC suppressive activities.
Objectives
The objective of this study was to differentiate MDSCs modeling intra-tumour MDSCs, non-tumour MDSCs and immunogenic DCs and compare them by quantitative proteomics to identify pathways that specifically regulate intra-tumour MDSC
activities but not DCs or non-tumour MDSCs.
Once specific pathways are identified, we will design lentivector constructs expressing proteins or shRNAs interfering with
these pathways, and co-expressing a microRNA silencing the immune checkpoint inhibitor PD-L1. These lentivectors will
be then used to modify MDSCs and study their effects, and test their potential anti-cancer activities together with known
molecular activators of the immune system.
Cells and mice
B16F10 cells, 293T cells, bone marrow-derived dendritic cells (BM-DCs) and MDSCs were grown as published (Gato et al.
Oncotarget 2015). Dual lentivectors co-expressing 2 genes and a PDL1-specific microRNA were used to clone cell signalling
modulators (Liechtenstein et al. 2014). iTRAQ quantitative proteomics were performed to compare DCs, non-tumour MDSCs
and tumour-MDSCs. Pathway reconstructions were performed with Ingenuity and regulatory kinases (nodes) were identified. B16 melanoma cells were modified with lentivectors expressing cell signalling modulators, and injected into C57BL/6
mice to monitor cancer cell growth.
Results
The functions of intra-tumour MDSCs were regulated by ERK. Lentivector silencing of ERK in myeloid precursors inhibited
their differentiation into MDSCs, while favour DC differentiation. Inhibition of the ERK pathway by lentivector expression of
a dominant negative MEK1 mutant and simultaneous PDL1 silencing in B16 melanoma cells impaired their growth in vivo.
Conclusions
Quantitative proteomics highlighted the ERK pathway as a main regulator of intra-tumour MDSC functions. We have shown
that ERK inhibition inhibits MDSC differentiation in vitro and also inhibits B16 melanoma growth in vivo. These results indicate that a lentivector co-expressing ERK inhibitors with PDL1-specific microRNAs may result in an effective genetic treatment
of tumours. We are currently evaluating the capacity of this lentivector in triggering anti-B16 T cell responses.
We acknowledge funding from the Gobierno de Navarra grant (BMED 033-2014). Maria Gato is funded by a Gobierno de
Navarra predoctoral fellowship.
160
P-055 EVALUATING THE EFFECT OF BELIMUMAB ON CLINICAL DISEASE ACTIVITY AND B-CELL IN PATIENTS WITH
SYSTEMIC LUPUS ERYTHEMATOSUS
D. Hernández Flórez1 , T. del Río1 , J. C. Nietp1 , J. G. Ovalles 1 , C. González 1 , I. Monteagudo1 , E. Naredo1 , F. J. López-Longo1 , L. Valor1 1) Hospital General Universitario Gregorio Marañón, Madrid
Introduction
Systemic lupus erythematosus (SLE) is an autoimmune inflammatory disease with wide ranging multi-systemic effects and
clinical manifestations of fluctuating intensity and severity (1). This is characterized by dysfunction of T-cells and B-cell (BC)
activation and an abnormal production of autoantibodies (2). Anomalous patterns in the expression of pro-inflammatory
and anti-inflammatory cytokines and soluble proteins concentration such as sBAFF (B- soluble cell activating factor) has
been described. Belimumab is a fully humanised monoclonal antibody against BAFF for use in combination with standard
immunosuppressants in autoantibody-positive SLE (3).
Objetive
To evaluate the impact of belimumab on disease activity, serological and phenotypical B-cell markers in SLE patients.
Eight patients diagnosed with SLE and treated with belimumab were assessed clinical, serological and phenotypically at
baseline, 4 and 8 months. Disease activity was evaluated using the SLEDAI score (Systemic Lupus Erythematosus Disease
Activity Index). Remission was defined as SLEDAI< 3, moderate disease activity as SLEDAI=3-12 and severe disease activity
as SLEDAI>12. sBAFF, TNF-alpha and IL-17A serum levels were determined by ELISA. BC phenotyping was performed using
multiparameter flow cytometry. A control group was evaluated to compare serological and phenotypical variables (2).
Results
We found a progressively decreased disease activity measured by SLEDAI, absolute BC-CD19+ count and anti-DNA antibodies, whereas the platelet count increased progressively. Regarding sBAFF, TNF-alpha and IL-17A serum levels, these were
persistently elevated in the SLE group compared to the control group. Furthermore, sBAFF serum levels increased while IL17A and TNF-alpha decreased during follow up in the SLE group. We observed changes on BC phenotype in the SLE group
when comparing with controls. In the SLE group, we observed a decrease in percentages (%) of BC-naïve (CD19+/CD27-) and
an increase in % of BC-memory (CD19+/CD27+). Respect to BC subsets, we observed a decrease in the % of BC-naïve-mature (CD19+IgD+CD38+) and plasmablasts (CD19+IgD-CD38++), and an increase in BC-post-germinal-center (CD19+IgDCD38+) and BC-memory-resting (CD19+/IgD+/CD38-). We found an inverse correlation of SLEDAI with both haemoglobin
and C3 (p = 0.046, p = 0.01, respectively).
Conclusions
Our results suggest that the response to belimumab in SLE patients might be associated with both a decrease in the percentages of BC-naïve and a progressive increase of sBAFF serum levels. These observations may be a potential indicator of
therapeutic response, and these findings should be corroborated in larger cohorts and longer follow-ups.
1.Kamal A, Khamashta M.Autoimmun Rev. 2014 Nov;13(11):1094-101.
2.Liossis SN, Melissaropoulos K. Expert Opin Pharmacother. 2014 Apr;15(6):833-40.
3.Lutalo PM, D\’Cruz DP. Expert Opin Biol Ther. 2014 Nov;14(11):1701-8.
161
P-056 MONOCLONAL ANTIBODIES USED FOR MULTIPLE MYELOMA TREATMENT CAN INTERFERE IN SERUM
IMMUNOFIXATION RESULTS
M. Fonolleda Ramboux1 , C. Motlló Borrella2 , J. Carrascal Sánchez1 , M. García Caro2 , E. M. Martínez Cáceres1 , A. Oriol
Rocafiguera2 , A. Teniente Serra1 1) Hospital Universitari Germans Trias i Pujol. Universitat Autònoma de Barcelona (UAB), FOCIS-CE UAB-ICS 2) Hospital Universitari
Germans Trias i Pujol
Introduction
Immunotherapy with monoclonal antibodies (moAbs) is a new therapeutic tool for Multiple Myeloma (MM). Daratumumab
is a novel human IgG1 kappa subclass moAb against CD38, a transmembrane protein highly expressed on malignant plasma
cells. Due to its antibody structure, we hypothesize that Daratumumab could interfere the follow up by immunofixation of
MM patients, especially in those with an IgG kappa monoclonal component.
Objectives
To analyse by immunofixation, serum samples from MM patients under treatment with Daratumumab which are in suspected clinical complete remission and assess if an IgG monoclonal component attributable to the moAb is present. Compare
these results with the immunofixations done at the time of diagnosis.
Serum samples from 6 MM patients under treatment with Daratumumab and in suspected clinical complete remission were
analysed by immunofixation using Easy Mask Immunofixation Kit and G26 analyzer from Interlab. These results were compared with the immunofixation done at the moment of diagnosis.
Results
2 patients with an original IgG kappa monoclonal component (same structure as Daratumumab) showed 2 different monoclonal band migration patterns when evaluated at the time of suspected clinical complete remission. The bands corresponded to the initial monoclonal component and probably to Daratumumab.
4 patients with an original monoclonal component different from IgG kappa presented a small IgG kappa monoclonal component in the immunofixation done during treatment with Daratumumab. One of those who had to stop moAb therapy due
to MM progression, showed a disappearance of the IgG kappa monoclonal component at the following control immunofixation (which also showed the reappearance of the original monoclonal component).
Conclusions
Due to its structure, patients under Daratumumab monoclonal antibody treatment may have small IgG kappa monoclonal
bands by immunofixation which can interfere in patient’s assessment of residual monoclonal paraprotein. For this reason,
the patient’s treatment should be taken into account to make a correct interpretation of the results, especially in those who
originally had an IgG kappa monoclonal component. The pattern of migration of the MC should be compared with the pattern of migration of the MC at the moment of diagnosis to avoid a wrong interpretation of the results.
162
P-057 REPROGRAMMING REGULATORY/EFECTOR RESPONSES IS CRUCIAL FOR OPTIMAL RESPONSE TO IFN-BETA IN
MULTIPLE SCLEROSIS
R. Alenda1 , L. Costa-Frossard1 , E. Rodríguez-Martín1 , C. Picón1 , S. Saiz de La Maza1 , E. Roldán1 , J. C. Álvarez-Cermeño1 , L. M.
Villar-Guimerans1 1) Hospital Universitario Ramón y Cajal, Madrid
Introduction
Multiple sclerosis (MS) is a chronic inflammatory disease of the CNS characterized by inflammation, demyelination and axonal damage. Interferon beta (IFNB) was the first immunomodulatory agent used for the treatment of relapsing-remitting
MS (RRMS). It has proven to be a safe treatment that inhibits relapse activity and the onset of new lesions in MRI and delays
disease progression in MS patients. However, its mechanism of action remains unclear.
Objective
The aim of our study was to contribute to elucidate the mechanism of action of this drug in MS.
A total of 119 RRMS patients treated with interferon beta. Patients were followed for 2 years. We monitored disability changes by measuring the EDSS score, the number of new relapses, and the onset of new lesions on annual MRI scans.
Blood samples were collected before treatment initiation and after 6 and of IFNB therapy. Serum and peripheral blood mononuclear cell were obtained and stored frozen until their use. The presence of neutralizing antibodies against IFNB was
monitored by effect cytophatic assay. We explored different T, B and NK subsets by flow cytometry in a FACSanto II instrument. To explore different functional subsets we performed intracellular labelling with FoxP3 and IL-10 (regulatory cells), TNF
alpha, IFN gamma and IL-17 (Inflammatory responses) and perforin (cytotoxic responses).
Results
20 patients abandoned the study for different reasons. Other 9 developed neutralising anti-IFNB antibodies. No one of them
showed a complete response to IFNB and were excluded of the biomarkers study. We classified the remaining 90 in two
groups depending if they were free of disease activity (n=24, 37.8%) or showed active disease during treatment (n=56,
62,2%). Significant differences were found in the responders group in three regulatory subsets after 6 months of treatment.
They showed an increase in the percentage of regulatory T cells (p= 0.013), B cells producing IL-10 (p=0.002) y CD56bright
cells (p=0.0008). We observed an inverse correlation between CD56bright cells and B cells (r= -0.4493, p= 0.008) and CD5 B
cells (r= -0.4044). In the same way an inverse correlation between T regulatory cells and CD8 T cells (r=-0.3536, p=0.02), CD8
T cells producing IFN-gamma (r=-0.4921, p=0.01), CD8 T cells producing TNF-alfa (r=-0.5201, p= 0.01) and CD56 bright cells
(r= -0.3804, p= 0.02) was obtained. Not correlation of B regulatory cells and any effector subset was found. Conclusions
Optimal response to IFN-beta associates with an increase in regulatory cell subsets (T CD4+CD25hFoxP3+ cells, CD19+IL-10+
cells and CD56bright cells). This seems to contribute to break the inflammatory response characteristic of MS by acting on
B cells, cytotoxic T cells and NK cells. These results suggest that restoring regulatory cells subsets could be a mechanism of
action of IFNB and confirms the misbalance of regulatory and effector cells is involved in the pathophysiology of MS.
163
P-058 2-FLUORO-RNA OLIGONUCLEOTIDE CD40 TARGETED APTAMERS FOR THE TREATMENT OF B LYMPHOMA AND
BONE-MARROW APLASIA RECOVERY
M. Martínez Soldevilla1 , H. Villanueva Ruiz1 , F. Pastor Rodríguez1 1) Centro para la investigación médica aplicada (CIMA)
Introduction
Recent studies have underscored the importance of immunomodulatory antibodies in the treatment of solid and hematological tumors. ODN-Aptamers are rising as a novel class of drugs that can rival therapeutic antibodies. The success of some of
the current cancer immunotherapy approaches in oncological patients depends on the intrinsic antigenicity of each tumor
as has recently been disclosed, and it is hampered in those patients that are treated with myeloablative chemotherapy or
radiotherapy, which induce profound immunosuppression. CD40 agonist and antagonist molecules offer a new therapeutic
alternative which has the potential to generate anticancer effects by different mechanisms.
Objectives
The specif aims of this work are; I) Isolation and characterization of murine CD40 aptamers.II) Generation of agonistic and
antagonistic aptamers against murine CD40 and their characterization either in vitro and in vivo. III) Generation and caracterization of a CD40 agonist aptamer-shRNA chimera to target the inhibition of the Nonsense mRNA Mediated Decay (NMD)
to tumor cells.
We have used High-throughput (HT)-SELEX to identify murine CD40 aptamers. Nitrocellulose filter-binding assays were carried out to determine the dissociation constant of each aptamer. Flow citometry was used to evaluate the binding capacity
of the engineered constructs. PRoliferation assays by CFSE dilution were performed to assess the agonistic capacity of the
specific constructs. Murine B-cell Lymphoma tumor models were used to evaluate their anti-tumor effect. Immunohistochemistry and qRT-PCR were used to evaluate the anti-tumor immune response.
Results
HS-SELEX was performed to identify high-affinity aptamers against CD40, and three therapeutic CD40 constructs were engineered as: CD40 agonist aptamer, CD40 antagonist aptamer and CD40 agonistic aptamer-shRNA chimera. It is shown that
CD40 agonist aptamers can be used to promote bone-marrow aplasia recovery. CD40 antagonist aptamers are revealed to
have a direct antitumor effect on CD40-expressing B cell lymphoma in vitro and in vivo. Further, in order to identify a therapeutic reagent that will generate the optimal conditions for cancer immunotherapy (antigen-presenting cell activation,
tumor antigenicity enhancement and bone-marrow aplasia recovery), CD40 agonist aptamer-shRNA chimera was generated
to target the inhibition of the NMD to tumor cells.
Conclusions
We have isolated high-affinity aptamers against murine CD40 by using HT-SELEX. We have engineered three different therapeutic constructs used to treat B-cell malignancies by three different mechanisms. We have generated a CD40 agonist
aptamer-shRNA chimera was generated to target the inhibition of the NMD to tumor cells. This chimera provides he optimal
conditions for cancer immunotherapy; antigen-presenting cell activation, tumor antigenicity enhancement and bone-marrow aplasia recovery.
164
P-059 IMMUNOGENICITY OF CYTOTOXIC T CELL-MEDIATED CELL DEATH DURING CANCER IMMUNOTHERAPY AND ITS
REGULATION BY MUTATIONS ASSOCIATED WITH APOPTOSIS RESISTANCE
P. Jaime Sánchez1 , E. Catalán Muñoz2 , J. Pardo Jimeno1 1) Centro de Investigaciones Biomedicas de Aragón (CIBA) 2) Facultad de Ciencias
Introduction
Cancer immunotherapy has emerged as a promising alternative to treat cancers with high aggressiveness. Immunogenic cell
death (ICD) is a distinctive instance of regulated cell death induced by specific stimuli (i.e. radiotherapy and some chemotherapeutics) that induces immune activation and memory against dying tumour cells.
Objectives
At present it is not known if immunotherapy (i.e. cytotoxic T –Tc- cell)-mediated cell death also induces anti-cancer immune
memory and the effect of anti-apoptotic mutations. Here we have employed the LCM virus-gp33 as model tumor antigen
and EL4 mouse lymphoma cells to analyse in vivo the immunogenicity of cell death induced by Tc cells.
We have employed C57BL/6 female mice and the murine Lymphocytic choriomeningitis virus (LCMV) to generate a immune
response against EL4 murine lymphoma cells.
Results
In vivo elimination of EL4.gp33 cells (expressing gp33) in LCMV-immunised mice protected against challenge with parental
EL4 cells. The same result was obtained when mice where primed with dendritic cells or with dying EL4.gp33 cells killed in vitro by LCMV-Tc cells. This protection correlated with exposition of the ICD signal calreticulin on the surface of dying EL4gp33
cells. EL4 tumors in mice immunised with dying EL4.gp33 cells were significantly smaller and presented more lymphocyte
infiltration than those in non-primed control mice. Depletion of CD8+ T cells or perforin deficiency abrogated the protective
effect indicating generation of an efficient in vivo anti-tumoural immune response against endogenous EL4 cell antigens.
Caspase inhibition by Z-VAD-fmk reduced the amount of calreticulin exposition without affecting the level of cell death. EL4.
gp33 mutants overexpressing Bcl-XL, or a dominant negative form of caspase-3 were also eliminated efficiently in vivo and
ex vivo by LCMV-Tc cells. Conclusions
Our results suggest that cancer immunotherapy is an efficient alternative to eliminate cancer cells and avoid cancer recurrence. Importantly tumors cells dying by non-apoptotic mechanisms may have higher recurrence rates due to the absence
of long-term immune memory.
165
P-060 IMMUNOLIPOSOMES WITH TRAIL AND ANTI-CEA SCFV ANCHORED ON THEIR SURFACE SPECIFICALLY TARGET
CANCER CELLS AND EXHIBIT ENHANCED CYTOTOXICITY
D. de Miguel Samaniego1 , A. Gallego Lleyda2 , A. Blanco Toribio3 , L. Sanz Alcober3 , A. Anel Bernal1 , L. Martínez Lostao4 1) Universidad de Zaragoza / Instituto de Investigación Sanitaria de Aragón (IIS Aragón) 2) Universidad de Zaragoza 3) Hospital
Universitario Puerta de Hierro 4) Hospital Clínico Universitario Lozano Blesa / Instituto de Investigación Sanitaria de Aragón (IIS
Aragón) / Instituto de Nanociencia de Aragón / Universidad de Zaragoza
Introduction
Apo2 Ligand/TNF Related Apoptosis Inducing Ligand (Apo2L/TRAIL) is a TNF super-family member specifically expressed
in immune cells such as NK cells and effector T cells. TRAIL is able to induce apoptosis in a wide variety of tumor cells but
not in normal cells making this molecule a promising anti-tumor agent. However, phase I/II clinical trials using TRAIL-based
therapies have shown that although TRAIL is a safe molecule, its anti-tumor activity is limited. Novel TRAIL formulations with
improved bioactivity are necessary to overcome this handicap. Since association with exosomes is the physiological manner
of TRAIL secretion, our group has generated artificial liposomes with a lipid composition resembling that of natural exosomes displaying anchored bioactive recombinant TRAIL on their surface (LUV-TRAIL). LUV-TRAIL have demonstrated greatly
increased cytotoxicity in different human cancer types with respect to soluble recombinant TRAIL.
Targeted delivery of TRAIL specifically to the tumor would increase the local concentration and minimize the dilution of the
drug in circulation. An experimental approach of targeting is the use of antibody fragments or peptides that specifically
target cancer cells to generate novel TRAIL constructs which drive this death ligand to specific tumor antigens. Principally,
single-chain variable antibody fragments (scFv) have been used. These scFv bear the advantage of maintaining the specificity of full antibodies, whilst presenting a much smaller size, which makes them more versatile molecules.. In this line, we have
generated LUV-TRAIL with anti carcinoembryonic antigen (CEA) scFV tethered to their surface in order to endow them with
tumor-targeting properties
LUV-TRAIL-aCEA (immuno-LUV-TRAIL) were generated anchoring the his-tagged MFE-23 scFv to their surface using a novel
Ni2+-(N-5-amino-1-carboxylpentyl)-iminodiacetic acid, NTA)-containing liposomal system. Specificity of immuno-LUV-TRAIL
was analyzed by flow cytometry and fluorescence microscopy. Finally, cytotoxic ability of immuno-LUV-TRAIL was tested in
human colorectal cancer (CRC) cells using flow cytometry.
Results
- Immuno-LUV-TRAIL bind to HT-29 cells, a CEA-positive CRC cell line.
- Binding of immuno-LUV-TRAIL to CEA positive cells is specific since immuno-LUV-TRAIL do not bind to SKBR3 cells, a breast
tumor cell line lacking CEA expression.
- Immuno-LUV-TRAIL induced cell death in HT-29 cells more efficiently than non-targeted LUV-TRAIL.
Conclusions
Our results demonstrated that anchoring scFV-aCEA MFE-23 to the liposome surface greatly increased the specific killing
of CEA positive CRC cells. LUV-TRAIL functionalization with tumor-specific scFvs could allow targeted delivery in different
settings, increasing their clinical applicability.
This work was supported by Grant PI13/00416 from Instituto de Salud Carlos III and Grant FII2015-217 from Fundación Inocente Inocente. Diego de Miguel and Ana Gallego-Lleyda are supported by respective pre-doctoral fellowships from Gobierno de Aragón.
166
P-061 ACUTE ADMINISTRATION OF ADIPOSE-DERIVED MESENCHYMAL STEM CELLS EXTRACELLULAR VESICLES REDUCES
METALLOPROTEINASE ACTIVITY IN OSTEOARTHRITIC CELL PRIMARY CULTURES STIMULATED BY INTERLEUKIN-1β
M. Tofiño Vian1 , M. I. Guillén Salazar2 , M. D. Pérez del Caz3 , V. Mirabet4 , M. J. Alcaraz Tormo1 1) Universitat de València 2) Universidad CEU Cardenal Herrera 3) Hospital Universitario Politécnico La Fe 4) Generalitat Valenciana
Introduction
Extracellular vesicles (EV) are lipid bilayer particles excreted to the extracellular medium. Certain EV-like exosomes (EX) and
microvesicles (MV) participate in cell-to-cell communication by transfer of bioactive molecules. Adipose-tissue-derived mesenchymal stem cells (AD-MSC) release EV under both physiological and pathological conditions. The immunomodulatory
properties of AD-MSC have proven to be beneficial in several diseases, such as osteoarthritis (OA). We have investigated the
effects of AD-MSC derived EX and MV on metalloproteinase (MMP) activity in OA chondrocytes and osteoblasts stimulated
with interleukin-1β (IL-1β).
Cells were cultured with appropriate media supplemented with EV-free serum. EV were isolated from AD-MSC conditioned
medium by differential centrifugation with size filtration. To characterize EV, resistive pulse sensing was used. Chondrocytes
and osteoblasts were stimulated with IL-1β (10ng/mL) and treated with MV or EX for 24h. Then, MMP activity and levels of
inflammatory markers interleukin 6 (IL-6), tumour necrosis factor α (TNFα) and prostaglandin E2 (PGE2) were measured by
enzyme specific activity assay, ELISA and RIA. Results
MV and EX had a mean diameter of 316 nm and 115 nm, and a concentration of 8*109 and 3.8*1010 particles/mL, respectively. In chondrocytes, treatment with MV (3.6*107 particles/mL) and EX (7.2*107 particles/mL) resulted in a significant reduction of IL-6 but not TNFα nor PGE2 levels. In osteoblasts, the same treatment resulted in a significant reduction of PGE2 and
IL6, but not TNFα. EV treatment resulted in a significant reduction of MMP levels only in chondrocytes.
Conclusion
Administration of EV may have potential pharmacological applications to lessen pathological inflammatory conditions. Differences in response between OA cell types, and/or modulation of MMP degradation pathways may lead to new and more
specific therapeutic targets based on the interaction between AD-MSC derived EV and cells.
167
P-062 SAFETY OF LOW-DOSE PREDNISONE FOR THE TREATMENT OF WOMEN WITH NK ASSOCIATED SPONTANEOUS
RECURRENT PREGNANCY LOSS
E. Pombrol1 , L. Herraiz2 , M. Arraya2 , J. P. Navarro2 , J. Gil2 , E. Fernandez-Cruz2 , J. Carbone2 1) Universidad Complutense de Madrid 2) Hospital General Universitario Gregorio Marañón. Madrid
Introduction
Peripheral blood natural killer (NK) cell level >12% is a risk factor for spontaneous recurrent pregnancy loss. Distinct immune
based therapies have the potential to modulate the activity of these cells.
Objectives
A. To evaluate the safety of low-dose prednisone usage during pregnancy in women with spontaneous recurrent pregnancy
loss who were found to have peripheral blood NK cell (CD3-CD16/CD56+) percentages >12%.
B. To assess the outcome in terms of live-birth rate in the following pregnancy.
Design: Retrospective case control study. Patients: Twenty-nine women with a history of at least 2 consecutive pregnancy losses.
Intervention: Immunomodulation with prednisone (10 mg/day [n=25], 5 mg [n=4]) starting at the time of biochemical confirmation
of pregnancy by rising hCG titers, and continuing in the first trimester. Main Outcome: Live-birth rate in the following pregnancy.
Data were matched with 27 women with NK cell count >12% that were not treated during the following pregnancy at the
same center.
Results
There were no significant differences in baseline and immunological parameters between the patients and controls (Mean
age 36±8 vs 37±4 years, p=0.99; NK cell count 18±5 vs 17±4%, respectively, p=0.54). No congenital abnormalities were observed. Gestational diabetes was observed in 7.1 and 4.2% of prednisone treated women and controls, respectively (Chi-square,
p=0.65). Arterial hypertension and preeclampsia was observed in 2 prednisone treated women. Mean gestational age at
delivery was similar in both groups (38±2.7 vs 38±1.5 weeks, p=0.53). 89.3% of prednisone treated women achieved a live
birth after immunomodulation while 64% controls achieved a successful pregnancy and delivery (p=0.028). Prednisone use
was associated with decreased risk of pregnancy loss in the following pregnancy (OR 0.21, 95%CI 0.05-0.91, p=0.037). As
compared with pre-pregnancy baseline values, NK cell percentages at 4 months (13.9±5%, p=0.009) and 6 months (12.2±5%,
p< 0.001) were significantly lower in prednisone group. Limitations of the study: Retrospective design and small sample.
Conclusions
Prednisone is a commonly prescribed steroid for lupus and distinct immune based diseases during pregnancy. Prednisone
belongs to the category C of pregnancy risk (risk cannot be ruled out) and therefore we used low doses of prednisone to
minimize adverse events. A decrease of NK cell percentages during pregnancy can be obtained with low-dose prednisone.
The data suggest that prednisone use during the first trimester might be associated with a decreased risk of pregnancy loss.
A randomized placebo-controlled clinical trial is necessary to further evaluate the safety and efficacy of this intervention.
168
P-063 IMMUNOTHERAPY WITH MESENCHYMAL STEM CELLS IN THE PROLIFERATIVE EOSINOPHILIC KERATITIS IN CAT:
AN EXPERIMENTAL MODEL FOR HUMAN OPHTHALMOLOGY.
A. J. Villatoro Jiménez1 , F. Fariñas Guerrero1 , V. Fernández Gensini1 , S. Claros Gil2 , J. A. Andrades Gómez2 , J. Becerra Ratia2 1) INSTITUTO DE INMUNOLOGÍA CLINICA Y TERAPIA CELULAR (IMMUNESTEM) 2) Laboratory of Bioengineering and Tissue Regeneration
(LABRET) 3) Networking Biomedical Research Center in Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN)
Introduction
Feline proliferative keratitis (FPK) is a chronic keratopathy, of difficult healing, caused by immunopathological response mediated by a Th2 type response which triggers a mixed hypersensitivity reaction, involving a component of type I hypersensitivity (allergy) and type IV (subtype IVb) or eosinophilic delayed hypersensitivity. In this type of inflammatory response
predominates the production of cytokines such as IL4 and IL5, among others. Such hypersensitivity response mediated by
Th2, is reflected at histopathological level by the existence of an eosinophilic inflammatory infiltrate with the concomitant
presence of mast cells and plasma cells at corneal level.
Mesenchymal stem cells from the adipose tissue (Ad-MSC) have demonstrated significant anti-inflammatory and immunomodulatory capacity on both innate and adaptive immune response, and have been used successfully as a therapeutic
element in different autoimmune eye diseases in humans and animals.
The main aim of our study was to investigate the safety and therapeutic effects of feline allogeneic Ad-MSC, previously characterized in our laboratory.
Five client-owned cats (5 eyes) of European breeds, 3 males and 2 females, aged between 3 and 6 years were selected. All
individuals were affected by FPK, at least during 6 months and refractory to the current treatment, with duration of the clinical signs from 6 to 12 months (mean 9 months). All eyes were implanted aseptically, with two injections in a time interval
of 2 months, of 2×106 allogeneic feline Ad-MSCs, subconjunctivally near the lesion, with preliminary vitality test with trypan
blue staining.
Results
The clinical observation of the process showed a significant improvement during the 4 first weeks after cell transplantation
with progressive disappearance of ocular signs beginning with a decrease of corneal plaque and a subsequent decrease in
the corneal vascularization. In 2 of the 5 cases showed decrease of ocular signs before the second implantation. All animals
showed a complete remission of clinical signs at six months. This recovery remains stable until the last follow-up where the
cornea is completely transparent with complete regression of blood vessels and did not show signs of regression or worsening without topic treatment.
Conclusions
Cell therapy with allogeneic fAd-MSCs treatment is a novel, safe, simple and effective for FPK refractory to conventional
treatment, demonstrating its immunomodulatory capacity against a Th2 response. From the standpoint of translational medicine, these findings open the gate to the treatment of other diseases of immunological origin in humans and other animal
species. To our knowledge, this is the first time in literature that local implantation of allogeneic fAd-MSCs has been found as
an effective therapeutic alternative to treat cats with FPK.
169
P-064 IMMUNOTHERAPY WITH ADIPOSE-DERIVED MESENCHYMAL STEM CELLS IN KERATOCONJUNCTIVITIS SICCA IN
DOGS: A MODEL FOR SJÖGREN’S SYNDROME IN HUMANS
A. J. Villatoro Jiménez1 , F. Fariñas Guerrero1 , V. Fernández Gensini1 , S. Claros Gil2 , G. Rico Llanos2 , J. A. Andrades Gómez2 ,
J. Becerra Ratia2 1) INSTITUTO DE INMUNOLOGÍA CLINICA Y TERAPIA CELULAR (IMMUNESTEM) 2) Department of Cell Biology, Genetics and
Physiology, Faculty of Sciences, Biomedical Research Institute of Málaga (IBIMA) 3) Networking Biomedical Research Center in
Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN) 4) Centro Andaluz de Nanomedicina y Biotecnología (BIONAND)
Introduction
Keratoconjunctivitis sicca (KCS) or dry eye disease (DED) is an immune-mediated disease, with high level of prevalence in
humans and dogs. KCS is a multifactorial disease with dysfunction in a component of the lacrimal functional unit, leading to
changes in the volume, composition, or clearance of the tear film, which results in symptoms of discomfort, visual disturbances, and tear film instability with potential damage to the ocular surface. Although their mechanisms are not yet completely
understood, there is enough evidence suggesting a cytokine and receptor-mediated inflammatory process affecting both
the lacrimal gland and the ocular surface, with progressive immune-mediated destruction of lacrimal tissue in humans and
dogs. The current treatment protocols in KCS are difficult, last lifetime with variability in efficacy and safety.
Adipose-derived mesenchymal stromal cells (Ad-MSCs) are multipotent stem cells with with important secretory faculties
of different bioactive molecules with trophic, paracrine, and immunomodulatory functions. Their low immunogenicity and
their immunoregulatory effect allow their allogeneic use, which makes them an alternative to be a promising new treatment
for severe refractory autoimmune diseases.
Our aim in this study was to investigate the therapeutic effects and security of allogeneic adipose-derived mesenchymal
stromal cells (Ad-MSCs) implanted around the lacrimal glands in dogs with KCS refractory to current available treatments.
Forty dogs client-owned of different breeds, sex, weight and ages were selected. All individuals were affected by bilateral
KCS at least for 6 months. All animals underwent a periodical full ophthalmic examination. To assess the clinical course we
measured the tears production and evaluated ocular surface health of each eye. Eighty eyes of 40 selected animals with KCS
were implanted aseptically with one injection of 5 × 106 allogeneic Ad-MSCs
Results
The clinical observation of the process showed a significant improvement during the first three months after transplantation.
This recovery remains stable until the last follow-up and did not show signs of regression or worsening. The scores obtained
from the follow-up of the ocular discharge, hyperaemia and corneal changes, showed a sustained decrease over all the time
period. These reductions were statistically significant between baseline and 6th and 9th month after treatment for all parameters (P <0.001).
Conclusion
Our results indicate that allogeneic Ad-MSCs implantation around the lacrimal glands is a safe, effective, and relatively simple therapy of KCS in dogs, with a significant improvement of tears production and in all ocular clinical signs associated with the disease.
170
P-065 REVERSIBLE ALTERATION OF ENDOTHELIAL VASCULAR INTEGRITY BY DASATINIB
B. Colom Fernández1 , A. Marcos Jiménez1 , A. Kreutzman2 , M. Ilander2 , M. Vicente4 , A. Ortega4 , C. Delgado4 , C. Cuesta
Mateos1 , S. Mustjoki2 , J. L. Steegmann3 , C. Muñoz Calleja1 1) Hospital Universitario la Princesa 2) University of Helsinki and Helsinki University Central Hospital 3) Hospital Universitario la
Princesa 4) Universidad Autónoma de Madrid
Introduction
Dasatinib is a short-acting dual ABL/SRC family tyrosine kinase inhibitor (TKI), which is frequently used in the treatment of
chronic myeloid leukemia (CML) and Ph+ acute lymphoblastic leukemia. Although very effective, dasatinib relatively often
causes adverse effects including diarrhea, and pleural and pericardial effusions, which actual causes are currently undetermined. Endothelial cells line the inner walls of blood vessels, controlling the access of blood proteins and circulating cells to
the underlying tissues.
Objective
We aim to study whether dasatinib affects the integrity of endothelial cell monolayers as a possible mechanism causing
those adverse effects.
Human umbilical vein endothelial cells (HUVECs) were treated with either dasatinib in different concentrations or vehicle
solution. Imatinib, the first line TKI for the treatment of CML, was also included as control.
To evaluate the effects of dasatinib and imatinib on the integrity and the permeability of the endothelial cell monolayer, real-time cell impedance measurements and immunofluorescence analysis of cell-cell (VEcadherin) and cell-matrix adhesions
(actin and vinculin) were performed. Dasatinib toxicity on the ECs was excluded with 7AAD.
For the in vivo permeability assay, mice were treated intraperitoneally with dasatinib and then administered with Evans Blue
intravenously. Spleen, lungs, brains, and small intestine were collected and the intensity of Evans Blue in the organs was
determined by detecting absorbance.
Results
In this study, we demonstrated that dasatinib (with doses similar to those found in the plasma of patients treated with the
drug), but not imatinib, disrupts the integrity of endothelial monolayer, through a dramatic decrease of the number and size
of the cell-matrix contacts and disassembly of cell-cell contacts. These effects are accompanied by decreased impedance
of the cell monolayer consistent with impaired integrity and increased permeability. Importantly, these effects were dasatinib-specific, dose-dependent and reversible, since dasatinib washout restored cell-matrix adhesions, cell-cell contacts
and impedance. Interestingly, mice treated intraperitoneally with dasatinib and administered with Evans Blue intravenously
displayed vascular leakage, especially to the gut.
Conclusion
Our data are consistent with a model of transient vascular leakage caused by dasatinib that probably contributes to side
effects such as thrombopenia, diarrhea and pleural effusion, contributing to the knowledge of the pathogenesis of the characteristic adverse effects of dasatinib. 39 Congreso de la Sociedad Española de Inmunología
171
P-066 LYMPHOCYTOSIS INDUCED BY DASATINIB INTAKE IS ASSOCIATED WITH INHIBITION OF LYMPHOCYTE
MIGRATION AND MODIFIED CHEMOKINE RECEPTOR EXPRESSION
B. Colom Fernández1 , A. Marcos Jiménez1 , A. Kreuztman3 , I. Portero1 , C. Cuesta Mateos1 , V. García Gutiérrez4 , J. L. Steegmann2 ,
C. Muñoz Calleja1 1) Hospital Universitario la Princesa 2) Hospital Universitario la Princesa 3) University of Helsinki and Helsinki University Central
Hospital 4) Hospital Universitario Ramón y Cajal
Introduction
Dasatinib, a second-generation tyrosine kinase inhibitor, is used for the treatment of chronic myeloid leukemia (CML) and is
known to have unique immunomodulatory effects. Dasatinib causes a rapid lymphocytosis after its intake, which has been
related to better clinical response. As the underlying mechanisms are not known, we hypothesize that the motility and migration of lymphocytes is being modulated by dasatinib.
Objective
Our aim was to study whether dasatinib intake affects the migratory capacity of lymphocytes and its impact on therapy
outcome.
Eighteen CML patients treated with dasatinib after not having MMR at 18 months with imatinib. We collected peripheral
blood samples before (“pre-sample”) and after (“post-sample”) the first intake of dasatinib (t0), and follow-up samples from
the same patients at 3 months (t3). The phenotype of their lymphocytes, their migratory capacity and blood differential
counts were analyzed before and after drug intake at each time-point. Results
Dasatinib intake induced a significant increase of NK-cells. Further, it increased CD8+ T cells, while reducing the proportion of
CD4+ T-cells among the total T-cells. With the first dose of dasatinib (t0), the percentage of the homing molecule CCR7 was
lower in both CD4+ and CD8+ T-cells in the post-samples. The effect of dasatinib on lymphocyte migration was studied with
transwell assays. At t0, post-samples showed a reduced migratory capacity towards the chemokines ligands of CCR7, CCL19
and CCL21, in both CD4+ and CD8+ T-cell subsets. In order to investigate whether these findings are related to the lymphocytosis induced by dasatinib, patients were classified as mobilizers (n=14) or non-mobilizers (n=3), depending on whether
they experienced an increase in the absolute lymphocyte counts after the first intake of dasatinib or not. We found that the
reduction of either the expression of CCR7 or the migration of lymphocytes towards its ligands were seen in mobilizers but
not in no mobilizers.
We are currently studying whether the effects on the migratory behavior of the lymphocytes are associated to the clinical
response defined as the achievement of major molecular response.
Conclusion
We report for the first time that dasatinib modified the expression of the homing molecule CCR7 and the migratory capacity
of the lymphocytes in response to its ligands. Moreover, these findings are exclusive of those patients who experienced a
lymphocytosis after the first intake of this TKI.
172
P-067 IMPROVING THE MANAGEMENT PROTOCOL OF SECONDARY IMMUNODEFICIENCY TO HAEMATOLOGICAL
MALIGNANCY: PROSPECTS FOR IgG REPLACEMENT THERAPY
S. Sánchez-Ramón1 , J. Ochoa-Grullón1 , C. Benavente1 , R. Martínez1
1) Hospital Clínico San Carlos
Introduction
The indication for IgG replacement therapy includes chronic lymphocytic leukemia (CLL) and multiple myeloma (MM) with
hypogammaglobulinemia and recurrent infections. Infection is a major cause of morbidity and mortality in these patients.
However, indications for IVIg in Europe are no longer aligned with the clinical scenario due to newer chemotherapeutic
protocols and changes in the spectrum of infections. Besides, patients affected with other B cell malignancies present with
similar immunodeficiency and manifestations while are not covered by the current IVIg indication.
Objective
The aim of this study is to develop a strategy for a retrospective analysis to re-evaluate the role of IVIg in haematological
malignancy and to provide clinical-based evidence to propose a better management protocol for the current clinical context
in this indication.
We will undertake two different approaches:
1) We will conduct a scientific literature review with the purpose of re-assess the role of IVIg in patients with hematological
malignancy. The following steps will be performed: Preliminary work: In the first step we have performed a search in the
scientific literature focusing on the object of study. As bibliographic Databases sources we used Medline through the portals
PubMed (http://www.ncbi.nlm.nih.gov/pubmed/) searching the available publications in the last 25 years. To conduct our
search the following keywords in English and Spanish will be used: “hypogammaglobulinemia and CLL/MM”, “replacement
immunoglobulins and haematological malignancy”, “antibody production deficit and B cell neoplasms”. Study selection: We
have chosen clinical trials, metaanalysis, case reports, case series and letters to the editor that focuses in human models.
2) We will review a series of characteristic case reports of patients with B cell neoplasms and hypogammaglobulinemia treated with IVIg (Flebogamma DIF; Grifols) to highlight the most relevant medical and immunological aspects of IVIg indications
nowadays.
Results
The studies that met the criteria of the Cochrane library will be identified and only those articles that met the purpose of the
study will be reviewed. The results drawn will set new standards of the management protocol of patients with haematological malignancy. The case report series will be published in the form of training course to disseminate the information to
improve current management of these patients.
Conclusions
There is an urgent need to re-evaluate the role of IVIg therapy in haematological malignancy. Multidisciplinary collaboration
might help to develop new strategies that include screening, monitoring and treatment protocols for which early IVIg intervention may be beneficial. 39 Congreso de la Sociedad Española de Inmunología
173
P-068 DASATINIB AND IMATINIB DECREASE THE EXPRESSION OF VCAM-1 AND CD34 AND INHIBIT ADHESION OF
LEUKOCYTES TO ENDOTHELIUM
A. Marcos Jiménez1 , B. Colom Fernández1 , A. Kreutzman1 , Á. Ortega Carrión1 , M. Vicente Manzanares1 , C. Muñoz Calleja1 1) Hospital Universitario La Princesa
Introduction
Imatinib and dasatinib are tyrosine kinase inhibitors (TKIs) commonly used for the treatment of chronic myeloid leukemia
(CML). There are increasing data on the impact of TKIs on the immune system which may condition the clinical response of
the patients, but the effects of TKI on the vascular endothelium is still unknown although it might play a role.
Objectives
Our aim was to study the effects of dasatinib and imatinib on endothelial cells, focusing on the adhesion events and the
molecules involved in such processes.
Human umbilical vein endothelial cells (HUVECs) were isolated and cultured up to the 4th passage. For the adhesion experiments, confluent HUVEC were pretreated with imatinib or dasatinib for 1h, and then stimulated over night with TNF-a when
inflammatory conditions were required. Next, freshly isolated peripheral blood mononuclear cells (PBMCs) labeled with CellTrace were added to the wells. The plates were then incubated in constant rotation (64rpm), 1h at 37ºC, to mimic rolling
and adhesion events. After a washing step, HUVEC and attached cells were detached with trypsin and collected into tubes
for flow cytometry.
To study the potential of TKIs to detach previously adhered PBMCs from the monolayer, the HUVEC were treated over night
with TNF-a. The PBMCs were then allowed to attach to the monolayer. After one hour, TKIs were added and the rotation was
continued for 30min. Thereafter the supernatants were collected and a washing step was performed before the HUVEC with
the attached PBMCs were collected by trypsin. To assess the effect of both TKIs on PBMCs adhesion to human recombinant
VCAM-1 and ICAM-1 we slightly modified the protocol.
For the phenotyping analysis, HUVEC were treated with TNF-a (20ng/ml over night), dasatinib (50nM or 100nM for 1h) or
imatinib (2uM or 10uM for 1h). Finally, cells were stained with fluorochrome-conjugated antibodies against CD34, VCAM-1
or ICAM-1.
Results
Dasatinib and imatinib inhibited the adhesion of leukocytes to endothelial cells (both under basal and under inflammatory
conditions) and were able to detach leukocytes that have already been attached. We confirmed that PBMCs adhesion to
human recombinant VCAM-1 and ICAM-1 was not affected by these TKI. Furthermore, dasatinib and imatinib can induce
phenotypic changes in HUVEC, since they downregulated the basal expression of ICAM-1 and CD34. After stimulation with
TNF-a, some adhesion molecules (VCAM-1 and CD34) on endothelial cells were also downregulated by both dasatinib and
imatinib in vitro.
Conclusion
We describe novel effects of dasatinib and imatinib on the endothelial cells which provide new insights on the interaction
between immune cells and the endothelium in dasatinib and imatinib-treated CML patients. The impact of these findings in
the therapeutic response needs further research.
174
P-069 MUCOSAL VACCINES IN ACTIVELY IMMUNOSUPRESSED PATIENTS WITH RECURRENT INFECTIONS: A NEW
THERAPEUTIC APPROACH
J. L. Ochoa-Grullón1 , A. Rodríguez de La Peña1 , P. Macarrón2 , C. Morado2 , E. Toledano2 , I. Díaz2 , M. Núñez-Beltrán 1 ,
A. Comins-Boo 1 , K. Llano Hernández 1 , E. Rodríguez1 , G. Candelas2 , S. Sánchez-Ramón1 1) Hospital Clínico San Carlos 2) Hospital Clínico San Carlos
Introduction
The use of biologic therapies as an adjuvant for the treatment of systemic autoimmune diseases is rapidly expanding, due
the efficacy and safety profiles of these drugs, and the better understanding of the targets of altered immune regulation.
However, infections complications after biologicals are major concerns in their use. Objectives
The aim of this study is to evaluate the clinical benefit of new personalized polybacterial sublingual vaccines (Bactek®) in
patients with systemic autoimmune disease and recurrent infections.
An observational study in a cohort of patients with systemic autoimmune disease and recurrent respiratory tract infections
(RRTI) (three or more episodes of upper respiratory tract infection or at least one pneumonia episode per year) and recurrent urinary tract infections (RUTI) (3 or more UTIs in per year) was carried out. All patients underwent immunization with
sublingual polyvalent preparation (Bactek®, ImmunoteK S.L. Madrid, Spain) for RRTI (Staphylococcus spp., S. pneumoniae, K.
pneumoniae, B. catarrhalis, H. influenzae) and RUTI (K. pneumonia, E. coli, E. faecalis, P. vulgaris). Immunological evaluation was
performed at baseline and at 6 and 12 mo., including those parameters: serum immunoglobulins, IgG subclasses, specific
antibodies production, and B and T cell subsets counts.
Results
Twenty-three patients (mean age, 55.52±15.69, 21 women and 2 men) were studied: (n=11, 47%) with rheumatoid arthritis,
(n=5, 21.7%) with SLE, (n = 3, 13%) with MCTD, (n=1, 4.34%) with psoriatic arthritis, (n=1, 4.34%) with SLE/ rheumatoid arthritis, (n=1, 4.34%) with DLE/Sjögren, (n=1, 4.34%) with cryoglobulinemia II and (n=1, 4.34%) with Sjögren syndrome. All patients presented a decrease in RRTI and RUTI frequency at six months of vaccine. All evaluated patients improved in terms of
RRTI (4.81±2.04 vs 0.75 ±1.29) and RUTI (4.56±1.59 vs 0.22±0.44) at 6 months. An episode of pneumonia in two patients. Nine
out of twenty three patients (39%) showed alterations of the humoral immune response, (n=6, 26%) showed hypogammaglobulinemia and (n=3, 13%) IgG2 subclass deficiencies. Eleven of twenty-three (47%) disclosed defect on specific antibody
production to polysaccharide and protein stimulus, seven (30%) with normal Ig serum levels and five (21%) with hypogammaglobulinemia. Twenty-one were with DMARDs and eleven of twenty-three received biological therapies. The most used
DMARDs was metotrexate (n=12, 52%) followed by anti- TNF α (n=9, 39%) and anti-CD20 (n=8, 34%) as biological therapies.
Conclusions
Vaccination in immunosuppressed patients due to systemic autoimmune disease is a commonly missed opportunity. There is
an urgent need to develop alternative strategies to prevent the overuse of antibiotics in what is called the post-antibiotic era.
Our preliminary results seem to be promising in these patients, reducing the infections rates avoiding chronic use of antibiotics and subsequent resistance.
175
P-070 SOLUBLE HUMAN CD5 IMPROVES THE ANTI-TUMORAL RESPONSE IN A HETEROTOPIC MELANOMA MOUSE MODEL
I. Simoes1 , F. Aranda1 , E. Carreras1 , V. Martínez1 , F. Lozano2 , F. Lozano3 1) Institut d’Investigacions Biomèdiques August Pi i Sunyer 2) Hospital Clínic de Barcelona 3) Universitat de Barcelona, Barcelona
Introduction
CD5 is a transmembrane glycoprotein expressed on all T cells and the B1a cell subset. CD5 is signal transducing receptor physically associated to the clonotypic receptor of T (TCR) and B1a (BCR) cells, playing a relevant role in T-cell development and
activation by negatively modulating the intracellular signals generated during the antigen recognition. To date, the nature of
the CD5 ligand/s is a controversial matter, and no human CD5-deficiencies have been reported. In an attempt to further investigate the in vivo consequences of blocking CD5 function under physiological and pathological conditions, our group has
developed a transgenic mouse line (shCD5EμTg) which express a soluble form of human CD5 (shCD5) at pg/mL range. This
shCD5 would likely act as a “decoy receptor” blocking the ligand-receptor interactions mediated by membrane-bound CD5
in vivo and resulting in a “functional” knock-down. Indeed shCD5EμTg mice showed a decreased frequency of spleen and
lymph node Treg cells and peritoneal IL-10+CD5+ Breg cells, together with an increased frequency of spleen NKT cells. Accordingly, shCD5Eμ.Tg mice showed enhanced immune responses to auto-antigens (collagen, myelin) and cancer cells (B16F0
melanoma), a fact that was reproduced in wild-type mice treated with repeated infusions of recombinant shCD5 protein.
Objectives
In this work we further study the mechanism underlying such an enhanced anti-tumoral response in the B16F0 melanoma
model.
B16F0 melanoma cells (5x104) were s.c. injected in back of shCD5EμTg mice and non-transgenic littermates. In some instances wild-type C57BL/6 mice were infused with recombinant shCD5 either i.p. or peritumorally each other day starting when
tumors had a diameter of approximately 3mm. Tumor growth along time and the characteristics of the lymphocyte infiltrates
in the tumor draining lymph node (TdLN) were analyzed.
Results
Significant decreased melanoma size/weight in shCD5EμTg mice associated to increased numbers of tumor-infiltrating lymphocytes and of total and activated CD8+ and CD4+ cells in TdLN. The decrease in tumor size/weight induced by therapeutic
administration of exogenous shCD5 protein to already established melanomas was also accompanied by increased numbers
of total and activated T-cells in TdLN.
Conclusions
The results suggest that sustained transgenic expression of shCD5 or peritumoral infusion of shCD5 favors an enhanced
anti-tumoral response to melanoma.
(*) Work supported by grants from Worldwide Cancer Research (14-1275), Fundació La Marató TV3 (201319-30), and Ministerio de Economía y Competitividad (Plan Nacional I+D+i, SAF2013-46151-R) co-financed by European Development Regional Fund “A way to achieve Europe” ERDF. IS holds a fellowships from Fundação para a Ciência e a Tecnologia (SFRH/
BD/75738/2011).
176
P-071 T CD4+ HELPER (TH1, 2, 9, 17, 22, TFH) AND TREG CELLS CYTOKINE EXPRESSION PROFILES BY MICROBEADS
ARRAY DURING MONITORING AFTER KIDNEY TRANSPLANTATION
J. Eguía Núñez1 , S. Llorente Viñas1 , F. J. Boix Giner1 , G. González Martínez1 , M. V. Bernardo Pisa1 , J. M. Bolarín Guillén1 ,
J. A. Galián Megías1 , R. López Hernández1 , M. R. Moya Quiles1 , J. A. Campillo Marquina1 , A. Minguela Puras1 , A. M. García
Alonso1 , L. Jimeno García1 , M. Muro Amador1 1) Clinical University Hospital Virgen de la Arrixaca, Murcia, Spain
Introduction
In kidney transplantation (Tx), anti-HLA antibodies not only produce hyper-acute rejection, but that these are also responsible for acute and chronic rejection. The development of donor specific antibodies (DSA) can predict graft failure at least
one year before it occurs, for this reason it is very important to monitor its apparition. However, in some cases, it is possible a
normal allograft function with DSA presence (àccommodation´). The complicated regulation of immune networks permits
the modification of different levels of immunosuppressive therapies respect to clinical events. These may be related with
the role of different kinds of T cells, such as, Th1, Th2, Th9, Th17, Th22, Tfh and Treg and their differential cytokine production
which could regulate gene expression of anti-apoptotic proteins.
Objectives
Our aim was to study the Th1, Th2, Th9, Th17, Th22, Tfh and Treg cytokine expression profiles to evaluate their relationship
with allosensitization in kidney transplant.
We included in our study 49 patients (33 males and 16 females; mean age, 56 years) who received kidney Tx from 2013 to
2015. In each patient we recollected the following serum samples: pre-Tx, 1st month, 3rd month, 6th month and 1 year postTx. We measured the level of cytokine profile of Th1, Th2, Th9, Th17, Th22, Tfh and Treg in each sample (GM-CSF, IFN-γ, IL-1, IL2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12p70, IL-13, IL-17A, IL-18, IL-21, IL-22, IL-23, IL-27 and TNF-α/) by ProcartaPlexTM Immunoassay
Workflow using Luminex technology (Affymetrix, eBioscience, CA).
Results
Our analysis showed that, except IL-23, all other cytokines (GM-CSF, IFN-γ, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12p70, IL-13,
IL-17A, IL-18, IL-21, IL-22, IL-27 and TNF-α/) had different implication in kidney transplant as their levels during one-year of
follow-up had important quantification variations. However, the levels of IL-23 were invariant, therefore, this cytokine have
not a clear role in kidney transplant. The next step that we would have to establish a relationship between cytokine profiles
with kidney transplant outcome studying allograft function with respect to define parameters to evaluate a protective or
rejection role of each cytokine through expression of anti-apoptotic or pro-apoptotic proteins, respectively.
Conclusions
Accommodation is a hypothetical process which would allow for avoid kidney rejection. This is achieved with some molecules, such as DSA or cytokines, and several kinds of T cells, which could regulate differential gene expression of anti-apoptotic
proteins. Th1, Th2, Th9, Th17, Th22, Tfh and Treg cytokine expression profiles seem to have a role in kidney transplantation,
except IL-23. However, more studies are needed to evaluate if these cytokines or their differential imbalance have a protective or rejection role.
177
P-072 STUDY OF GENE EXPRESSION OF THE MTOR PATHWAY (MTORC1 AND MTORC2) IN RENAL BIOPSIES RENALES
AND ITS RELATIONSHIP WITH HUMORAL REJECTION DEVELOPMENT IN KIDNEY POST-TRANSPLANTATION
M. V. Bernardo Pisa1 , J. de La Peña Moral1 , J. Eguia Nuñez1 , F. Boix Giner1 , G. Gonzalez Martínez1 , J. A. Galian Mejias1 ,
A. Mrowiec1 , L. Gimeno Arias1 , I. Legaz1 , J. A. Campillo Marquina1 , M. R. Moya Quiles1 , A. Minguela1 , A. M. Garcia Alonso1 ,
S. Llorente Viñas1 , M. Muro1 1) University Clinic Hospital Virgen de la Arrixaca
Introduction
Antibody-mediated rejection (AMR) is the major cause of kidney transplant failure. While some patients presenting with
DSAs develop either chronic or acute AMR and ultimately reject their allograft, others maintain stable functioning allografts
and continue to demonstrate normal biopsy histopathologies. In addition, mTOR, a serine/threonine protein kinase, integrates responses from a wide variety of signals to regulate cell growth, metabolism, and survival. This important kinase forms
2 distinct protein complexes, mTORC1 and mTORC2. The rapamycin-sensitive mTORC1 complex regulates multiple biosynthetic cellular processes. In contrast, mTORC2 (with AKT activation) is important for cell proliferation, migration, and survival
(apoptosis and autophagy inhibition). mTOR complex has also been implicated in accommodation or rejection phenomena.
Objectives
Our aim was to determine if any differences in mTORC1 and mTORC2 gene expression between DSA+/AMR+, DSA+/AMR−
and DSA− patients might explain these phenomena transplant complications.
The study population consisted of 269 patients who were transplanted and anti-HLA antibody monitored (OL) during 5
years. An assay of human mTOR signaling (RT2 Profiler PCR Array, Quiagen) that profiles the expression of 84 key genes involved in mTOR pathway was used to assess the gene expression profiles of kidney recipients who presented DSAs and showed
anomalous biopsy histopathology and developed AMR (n=14). RNA was extracted from biopsies and cDNA obtained (RTFirst-Strand). Biopsy profiles for these DSA+/AMR+ patients were compared to biopsies as DSA+/AMR- and DSA- controls.
Fold-Change [2^(-Delta Delta Ct)] was the normalized gene expression [2^(-Delta Ct)] in the Test Sample divided the normalized gene expression [2^(-Delta Ct)] in the Control Sample.
Results
In biopsies, PIK3CG, PRKCB, PRKCG, PRKAG3, DDIT4, IGF1, INS, AKT, AKT1S1, EIF4F, GTPaseHRas, IRS1, VEGFC, ULK1, TELO2,
RPTOR, and RPS6KA2 transcripts were found to be significantly over-expressed (≥5-fold) in both DSA+/AMR+ and DSA+/
AMR- relative to DSA− samples, while AKT1S1 transcripts were more expressed in DSA+/AMR- biopsies versus DSA+/AMR+.
The following genes were under-expressed (≥5-fold) in both DSA+/AMR+ samples relative to DSA− controls: RPS6 (>10-fold),
VEGFA (>15-fold), RHOA, EIF4EBP2, INSR, PRKAA2, STRADB, YWHAQ and B2M. The imbalance of gene expression could inhibit mTORC2 activation promoting mTORC1 of fibrosis, proliferation and rejection in DSA+/AMR+ patients. Finally, a higher
number of over-expressed genes with mTORC1+ regulation and a number of under-expressed genes with mTORC2+ regulation in biopsies from DSA+/AMR+ patients were found.
Conclusion
Given these findings, future trials are warranted to determine if determined gene expression profiles can prevent graft failure, highlighting the need to develop a more complete understanding of the mechanisms of allograft protection or injury.
178
P-073 DIFFERENT LEVELS OF INTRACELLUIAR TH1, TH2 AND TH17 CITOKINES COULD CONDICIONATE OPPORTUNISTIC
INFECTION APPARITION IN KIDNEY AND LIVER POST-TRANSPLANTATION
F. Boix Giner1 , J. Eguia Nuñez1 , G. Gonzalez Martínez1 , J. A. Galian Mejias1 , G. Salgao Cecilia1 , A. Mrowiec1 , L. Gimeno Arias1 ,
I. Legaz1 , J. A. Campillo Marquina1 , M. R. Moya Quiles1 , A. Minguela Puras1 , A. M. Garcia Alonso1 , M. Miras1 , S. Llorente1 ,
M. Muro Amador1 1) Hospital Clinico Universitario Virgen de la Arrixaca
Introduction
Opportunistic infection (OI) remains a leading cause of morbidity and mortality among liver (LR) and kidney recipients (KR)
after transplantation (Tx). Current immunosuppressive therapies are focused on preventing allograft rejection (AR). The risk of
inadequate immunosuppression must be balanced in order to prevent AR as well as OI. Thus, monitoring of cell-mediated immunity (CMI) may help to better understand the role of different T-cell subsets in recipients who suffer OI establishing potential
therapeutic targets providing personalized immunosuppressive regimen combined with better prophylaxis therapies.
Objectives
The aim of this study was to monitor intracellular cytokine production for several peripheral T-cell subsets within the first
year after liver and kidney-organ Tx by flow cytometry.
Renal and Hepatic recipients were monitored post-transplantation (pre-Tx, 1st month, 3rd month, 6th month and 1 year postTx) by flow cytometry by cellular markers and several intracellular cytokines.
Results
The number of CD8+CD69+IFN-γ+, CD4+CD69+IL-17+ and CD4+CD69+IL-10+ cells was significantly increased in patients with
End-Stage Liver Failure (ESLF) compared to the healthy controls (HC). Similarly, the number of CD8+CD69+IL-10+ cells but
not CD4+CD69+IL-10+ and CD4+CD69+IFN-γ+ were increased in patients with End-Stage Renal Failure (ESRF) compared to the
HC. The number of CD8+CD69+IFN-γ+ cells in LR as well as CD4+CD69+IFN-γ+ in KR was significantly lower at several points
within the first year post-Tx in patients with OI compared to levels at baseline. Contrarily, the number of CD4+CD69+IL-17+
and CD4+CD69+IL-10+ cells in LR as well as CD4+CD69+IL-10+ and CD8+CD69+IL-10+ in KR was significantly higher during the
post-Tx monitoring compared to baseline levels. Moreover, the number of Th17 cells was negatively correlated with the
number of Th1 cells in LR. Stratification analysis indicated that infected (INF) recipient group displayed greater number of
CD4+CD69+IL-17+ and CD4+CD69+IL-10+ in LR as well as high level of CD4+CD69+IL-10+, CD8+CD69+IL-10+ in KR compared to
non-infected (NoINF) recipients. By contrast, INF group displayed decreased numbers of CD8+CD69+IFN-γ+ in LR as well as
low levels of CD4+CD69+IFN-γ+ cells compared to NoINF group.
Conclusion
The imbalance among different types of CD4+ and CD8+ T cells may contribute towards the establishment of new biomarkers
to identify recipients at high risk of OI, adding an opportunity for individualizing post-Tx prophylaxis practices.
179
P-074 CD28 PRE-TRANSPLANT (EXPRESSION LEVELS AND QUANTIFICATION OF MOLECULES PER CELL) IN T CD4+
CELLS PREDICTS ACUTE REJECTION DEVELOPMENT IN RENAL AND HEPATIC RECIPIENTS
F. Boix Giner1 , J. M. Bolarin1 , J. Eguia Nuñez1 , G. González Martínez1 , J. de La Peña Moral1 , G. Salgado Cecilia1 , A. Mrowiec1 ,
L. Gimeno Arias1 , I. Legaz1 , J. A. Campìllo Marquina1 , M. R. Moya Quiles1 , A. M. Garcia Alonso1 , S. Llorente Viñas1 , A. Minguela
Puras1 , M. Muro Amador1 1) Clinical University Hospital Virgen de la Arrixaca
Introduction
Acute rejection (AR) remains a significant cause of graft loss. Better approaches capable to predict AR are nowadays being investigated. Surface CD28 protein is essential for T-cell proliferation and survival as well as cytokine production. Previous own
studies reported that heart and liver transplant recipients up-regulate CD28 in CD4+ lymphocytes in periods of AR activity.
Furthermore, pre-transplant levels of CD28 in rejectors were lower than non-rejectors.
Objectives
The aim of this study was to validate the expression of CD28 in CD4+ T-cells as biomarker of AR in liver (LR) and kidney (KR)
recipients.
Pre-transplant CD4+CD28+ peripheral T-cells were examined in 30 LR and 31 KR from Clinical University Hospital ´Virgen de la
Arrixaca´ in Murcia, Spain by flow cytometry.
Results
Pre-transplant CD4+CD28+ T-cells in LR were significantly lower in rejectors than non-rejectors (P=0.002); furthermore the total number of CD28 molecules per cell in LR (P=0.02) as well as KR (P=0.047) was significantly lower in rejectors than non-rejectors. Healthy group didn´t display differences when compared against LR and KR, however higher level of CD4+CD28+ was
observed when compared against rejected-LR (P=0.04) but not KR. CD28 levels < 41.94% were able to discriminate LR at high
risk of AR (P=0.003). Similarly, a total number of CD28 molecules ≤8359 (P=0.031) in LR and ≤7669 (P=0.046) in KR correlated
with high risk of AR.
Conclusion
The preliminary results presented herein exhibit a fast and non-invasive method which provides assistance to clinicians in
order to prevent AR by monitoring CD4+CD28+ peripheral T-cells.
180
P-075 EVOLUTION OF T FOLLICULAR HELPER (TFH) CELLS IN KIDNEY TRANSPLANT RECIPIENTS
R. Laguna Goya1 , A. Utrero Rico1 , F. L. Cano Romero1 , L. Allende Martínez1 , R. Ruiz García1 , P. Talayero de Azcarate1 , D. Pérez
Mendez1 , A. Serrano 1 , A. Andrés Belmonte1 , E. Paz Artal1 1) Hospital 12 de Octubre, Madrid
Introduction
Antibody-mediated rejection is responsible for 30-50% of renal graft failures. T follicular helper lymphocytes (Tfh) are necessary for the differentiation of B lymphocytes to plasma cells and efficient production of antibodies. Currently it is possible to
identify Tfh in peripheral blood and to interrogate about their meaning in renal transplantation (Tx) and potential usefulness
as a biomarker.
Objectives
(1) To study Tfh in patients with end-stage renal disease (ESRD) before transplantation, (2) post-transplant follow-up, and (3)
analyze its relationship with evolution of the graft.
PBMC were isolated pre-transplant and at different post-transplant time points in a prospective cohort of 84 kidney recipients. Tfh were FC-analyzed as CD4+CXCR5+CCR7loPD1hi cells. Clinical data and immunological events were recorded.
Results
Before Tx, lower Tfh were observed in patients with ESRD vs healthy controls, independently of disease or type of dialysis
received. Patients with pre-Tx anti-HLA antibodies showed higher Tfh. However these differences did not reach significance.
Patients receiving their 2nd or sucesive Tx showed higher numbers of Tfh vs those receiving a first Tx (p< 0.0001). After Tx,
Tfh significantly decreased, and this was mostly due to patients receiving timoglobulin as induction, whereas Tfh remained
unchanged in patients receiving basiliximab or without induction. At month +3 and +6, Tfh were significantly higher than
pre-transplant (p< 0.0001). We observed higher Tfh at day +7, +14 and at month +1 in patients that suffered rejection events
in comparison to non-rejectors.
Conclusions
Our preliminar data show differences in Tfh frequency among different groups of renal Tx recipients. Studies analyzing relationships between Tfh and pre-, post-Tx allogeneic antibodies and rejection are ongoing and will be presented.
181
P-076 A STUDY OF ANTI-HLA IMMUNIZATION AFTER PREGNANCY
M. Vilches Moreno1 , A. Sampalo Laínz2 , A. Nieto Díaz2 1) Hospital Universitario Virgen del Rocío 2) Hospital Universitario Puerta del Mar
Introduction
HLA antibodies can be detected in individuals who have been immunized as a result of blood transfusion, pregnancies, or
transplants. The impact of pregnancy on the incidence of anti-HLA immunization has been poorly explored, and most of the
data were obtained by standard complement-dependent lymphocytotoxicity (CDC) assay, with a reported incidence of 18%
to 30%. This approach has several limitations. In many cases, antibodies can not be detected by CDC as their level fades in
time; the presence of class II antibodies is not addressed, and in addition, CDC cannot detect non-complement-fixing antibodies. Techniques more sensitive for HLA antibody detection may help to asses better HLA immunization in this setting.
Objectives
The aim of this work was to evaluate pregnancy-induced HLA sensitization using single antigen microbead assay.
Pregnancy-induced HLA sensitization was analyzed in 69 mothers without a history of transfusions or transplants. The mothers and their offspring were typed for HLA-A, -B and -DR. Sera from the mothers were studied using Luminex screening test
to detect anti-HLA class I and class II antibodies. Positive and borderline sera were further analyzed using single antigen kits.
Specificities with mean fluorescence intensity (MFI) equal than 1500 or higher were considered positive. Statistical analysis
was performed with SPSS 18.0 software.
Results
Thirty-four out of 69 sera tested (49.3%) were positive with the screening test; 52.9% of them were positive for class I and
61.7% for class II antibodies. Twenty-eight sera (40.5%) were scored as borderline; 60.7% for class I and 39.2% for class II. Seven samples (10.1%) resulted negative for both classes of antibodies. Antibodies with MFI>1500 against at least one of the
paternal alloantigens were detected in all sera with positive screening. Interestingly, antibodies against at least one paternal
alloantigen with MFI > 1500 were detected in 52.9% sera with borderline screening for class I and 36.3% for class II. The possible existence of latent sensitization was further explored. In the sera studied by single antigen, those antigens showing
positive MFI values (>1500) were excluded from the analysis and the rest of specificities (i.e. “negative” antigens) (n=1859)
were grouped in three categories: a) maternal self-antigens, (n=181); b) paternal alloantigens, (n=103); c) neutral alloantigens, (n=1575). Mean MFI values for each group were obtained and compared. The Kruskal-Wallis test for the three groups
showed highly significant differences (p<0.0001). Comparisons between paternal alloantigens and neutral and maternal
self-antigens were also highly significant (288 vs 153, p<0.0001; 288 vs 102, p<0.0001; respectively)
Conclusions
The high sensitivity of the Luminex technology allows revealing a higher frequency of pregnancy-induced immunization.
These results may have implications in pre-transplant risk assesment in parous women.
182
P-077 ANALYSIS OF ANTI-HLA SPECIFIC RESPONSE BASED ON DIFFERENCES AT MOLECULAR LEVEL BETWEEN
ALLOANTIGENS
M. Vilches Moreno1 , A. Moreno Salazar3 , A. Sampalo Laínz2 , T. M. García Álvarez3 , M. A. Mazuecos Blanca3 , A. Nieto Díaz2 1) Hospital universitario Virgen del Rocío 2) Hospital Universitario Puerta del Mar 3) Hospital Universitario Puerta del Mar
Introduction
HLA antibodies can be detected in individuals who have been immunized as a result of blood transfusion, pregnancies, or
transplants. Identify risk factors for the development of antibodies against HLA alloantigens is of great interest in the context of transplantation. Duquesnoy created a computer algorithm (HLAMatchmaker) to determine HLA matching between
donor-receptor based on number of mismatched eplets. This algorithm takes into account only differences accessible to antibodies. However the role of differences in non-exposed residues between alloantigens in relation to humoral sensitization
has been poorly explored
Objectives
The aim of this work was to analyze the incidence of HLA alloantibodies as a function of the number of eplets as well as of the
number of different non-self 15-mer peptides that can be generated from the immunizing antigens.
The study was performed in two contexts: pregnancy-induced immunization and kidney transplantation. 69 mothers with
at least one pregnancy without a history of transfusions or transplants and 44 kidney transplant pairs without prior history
of HLA immunizating events were analyzed. Mothers, siblings, donors and recipients were typed for HLA-A, -B and -DRB1 at
high resolution level. HLA antibodies in serum from the mothers and recipients were detected by Luminex (screening and
single antigen kits). For each allogeneic HLA the number of eplets was determined using HLAMatchmaker algorithm. In addition, the number of differences between allogeneic and self antigens at molecular level was determined by decomposing
HLA molecules to all possible 15-mer peptides and counting non-self peptides (i.e. those present only in alloantigens). This
was performed using an internet resource (www.IEDB org) coupled with an in-house algorithm. Mismatched HLA antigens
were classified as immunogenic or non-immunogenic alleles. Statistical analysis was performed with SPSS 18.0 software.
Results
Immunization by pregnancies.
HLA antibodies were detected in 38 out of 69 (55.1%) sera tested. 276 alloantigens were identified: 73 (26.4%) immunogenic
and 203 (73.6%) non-immunogenic. Number of peptides and eplets for each group were obtained and compared. Comparisons between immunogenic and non-immunogenic alloantigens showed highly significant differences for both the number
of peptides and the number of eplets (243.4 vs. 682.9, p <0.0001; 8.2 vs. 6.6, p = 0.001, respectively).
Immunization by transplantation
A total of 180 alloantigens were identified in this group: 34 (18.9%) were immunogenic and 146 non-Immunogenic (81.1%).
Comparisons between groups showed significant differences for the number of non-self peptides (230.4 in the immunogenic
group vs.194.2 in no-inmmunogenic, p = 0.016) but not significant for the number of eplets; (5.9 vs. 5.7, p=0.796; respectively).
Conclusions
A greater difference at the molecular level in HLA alloantigens, considering not only exposed residues (eplets) but the whole
molecule, increases significantly the likelihood of developing antibodies against them.
183
P-078 MIXTEC MEXICAN AMERINDIANS: AN HLA ALLELES STUDY FOR AMERICA PEOPLING, PHARMACOGENOMICS
AND TRANSPLANTATION
G. Vargas-Alarcón1 , D. Cruz-Robles1 , F. López-Pacheco1 , E. Muñiz2 , J. Palacio-Grüber2 , C. Campos2 , D. Rey2 , J. Martín-Villa2 ,
A. Arnaiz-Villena2 1) Instituto Nacional de Cardiologıa Ignacio Chavez, Mexico City, Mexico 2) University Complutense, Madrid Regional Blood Center,
Madrid, Spain
Introduction
It is believed that First Amerindian Natives have come from Asia through the Bering land bridge between 30,000–12,000
years before present (BP). Both genetic and archaeological evidence suggests that a two-way Trans-Atlantic traffic occurred
before Columbus discovered America. Greenberg first postulated the triple migration theory for explaining the peopling of
the Americas. A Trans-Pacific route of American peopling from Asia or Polynesia has also been suggested because HTLV-1
virus strains shared identical sequences in Japan and in the northern coast of South America.
Objectives
Our study aims to study HLA alleles in a Mixtecan population from Jamiltepec (in Oaxaca’s western coast). This Central America/Pacific population HLA study would clarify the still unclear peopling of the Americas and the origins of Amerindians, and
would allow to establish the Mixtec profile that will be useful for preventive HLA genetic epidemiology (HLA linked diseases),
HLA pharmacogenomics and future transplant waiting lists.
HLA-A, -B and -DRB1 alleles have been studied in this Amerindian population by indirect DNA sequencing. HLA relatedness
has been tested by comparing results with other Amerindians and worldwide populations. Genetic distances between populations, Neighbor Joining dendrograms and correspondence analyses have been carried out.
Results
The gene frequency values for HLA-A, -B, and -DRB1 loci do not differ significantly and the population is found in Hardy–
Weinberg equilibrium. A NJ relatedness dendrogram based on HLA-DRB1 allele frequencies separates all populations in
three clusters, one of them groups Amerindians together with North American Na-Dene (West Canada Indians, Navajo and
Apache), Eskimo and eastern Siberians; Amerindians are separated from other Americans and Asians populations. The second cluster grouped the rest of World wide populations.
Conclusions
1) Our Mixtec sample from Oaxaca Coastal (Pacific) Mexican area shows an HLA profile different to that of Oaxaca Central
Mountains area showing that genes and languages do not correlate which is inferred both by plane genetic distances and
NJ dendrograms and correspondence analyses.
2) Genetic distances and NJ dendrograms join together Mazatecan Mexican Amerindians with our studied Coastal Mixtec
group; it fits with the historical relationship between Mixtec and Mazatecans.
3) A*24:02-B*35:14-DRB1*04:11, A*02:01-B*15:15-DRB1*04:11 and A*68:03-B*39:08-DRB1*08:02 extended HLA haplotypes
have been ‘‘de novo’’ found in our Mixtec Coastal sample.
4) Shared HLA alleles are found between our Pacific Coast Mixtec Amerindians and Pacific Islanders.
5) These results are useful for establishing a future area transplantation waiting list, for the study of HLA linked diseases epidemiology and for pharmacogenomics in certain drug therapy.
184
P-079 SHORT AND LONG-TERM ALLOGRAFT SURVIVAL IN SINGLE-KIDNEY TRANSPLANTED PATIENTS ACCORDING TO
THEIR DONOR-SPECIFIC ANTI-HLA ANTIBODY STATUS BEFORE TRANSPLANTATION
A. M. Navas Romo1 , J. E. Molina Alcaide3 , M. L. Agüera Morales2 , A. Rodríguez Benot2 , P. Aljama García2 , R. Solana Lara1 1) Hospital Universitario Reina Sofia 2) Hospital Universitario Reina Sofia 3) Instituto Maimónides de Investigación Biomédica de
Córdoba (IMIBIC)/Hospital Universitario Reina Sofía/Universidad de Córdoba
Introduction
The presence of circulating preformed anti-HLA antibodies against donor HLA molecules avoids any transplantation possibility of patients with chronic kidney disease nowadays. Thanks to lasts scientific and technological advances, new and
more sensitive anti-HLA antibody screening tests have been developed. Among them, the single antigen beads-C1q assay
detects only the sub-set of antibodies capable of binding the C1q human complement component. Excluding only this subset of C1q-binding antibodies could increase the limited transplantation possibilities of patients waiting for a kidney donor.
However, the impact of preformed C1q-binding anti-HLA antibodies on kidney allograft outcome is still under consideration.
Objective
The aim of this study was to analyze the impact of preformed donor-specific anti-HLA antibodies (DSA) on kidney outcome
examining allograft survival at short (1 year after transplantation) and long-term (8 years after transplantation).
In this study we retrospectively analyzed kidney allograft survival of 345 single-kidney transplanted patients according to their
DSA status before transplantation screened by single antigen beads and single antigen beads-C1q tests. Kidney graft failure
was considered as the event of interest and defined as return to dialysis. Data on graft survival were censored at the time of
death. Short and long-term allograft survival was plotted on Kaplan-Meier curves and compared using the log-rank test.
Results
The 75 patients with preformed DSA had significantly worse long-term allograft survival rate than patients without
preformed DSA (p=0.005). Moreover, the 26 patients with preformed C1q-binding DSA had worse allograft survival than patients with non-C1q binding DSA (p<0.005) and without DSA (p<0.001). We did not find significant differences regarding long-term allograft survival between patients with non-C1q binding DSA and without DSA (p=0.340).
Furthermore, the 75 patients with preformed C1q-binding DSA had significantly the worst short-term allograft survival
compared with the remaining study population (p<0.005). Interestingly, when we plotted long-term allograft survival since
the first year after transplantation, we did not find significant differences according to the preformed DSA status and the
C1q-binding DSA status (DSA- vs. DSA+/C1q- vs. DSA+/C1q+; p=0.429).
Conclusions
The presence of C1q-binding DSA significantly decrease allograft survival rate in single-kidney transplanted patients. The
effect caused by DSA takes place mainly at short term, particularly during the first year after transplantation. Those patients
who maintain the allograft function during the first year after transplantation did not have significant differences in longterm allograft survival rate regardless of their DSA antibody status at time of transplantation. An accommodation phenomenon could be the hypothetical cause of these results. Further studies are needed to ensure this hypothesis.
185
P-080 THE PRESENCE OF NON-C1Q BINDING DONOR-SPECIFIC ANTI-HLA ANTIBODIES DOES NOT PREDICT KIDNEY
ALLOGRAFT FAILURE INDEPENDENTLY OF THEIR STRENGTH IN SINGLE ANTIGEN BEADS ASSAY
J. E. Molina Alcaide3 , A. M. Navas Romo1 , M. L. Agüera Morales2 , A. Rodríguez Benot2 , P. Aljama García2 , R. Solana Lara1 1) Hospital Universitario Reina Sofía 2) Hospital Universitario Reina Sofía 3) Instituto Maimónides de Investigación Biomédica de
Córdoba (IMIBIC)/Hospital Universitario Reina Sofía/Universidad de Córdoba
Introduction
The single antigen beads (SAB) assay has been modified to detect only the sub-set of anti-HLA antibodies capable of binding
the first component of the human complement cascade. Several studies have reported that the presence of C1q-binding donor-specific anti-HLA antibodies (DSA) after transplantation is a predictive factor of allograft failure, since histopathological
lesions found are associated with higher incidence of antibody mediated rejection. It also have been reported a correlation
between the antibody strength detected in SAB assay and the C1q-binding ability. However, the impact of preformed DSA
on allograft outcome, according to the C1q-binding ability is still under discussion.
Objective
The aim of this study was to analyze the impact of preformed DSA according to their C1q-binding ability on kidney allograft
outcome regardless of their strength in SAB assay.
In this study, pre-transplantation sera sample of 345 single-kidney transplanted patients were analyzed using SAB assay and
SAB-C1q assay. A multivariate Cox regression test was performed to quantify hazard ratios (HR) and 95% confidence intervals
(CI) for kidney allograft loss after the adjustment for other clinical and immunological predictive factors. Collinearity tests
were performed to ensure the independence of predictive variables. When entering the DSA strength in the model, a cut-off
value of 6,000 MFI was established since it was the lowest MFI value of C1q-binding DSA detected in SAB assay. Kidney failure
was considered as return to dialysis. The follow-up time was 8 years.
Results
Patients with preformed DSA had a 1.889 times increased adjusted-risk of allograft failure compared to patients without DSA.
Moreover, patients with C1q-binding DSA had a 2.897 times increased adjusted risk of allograft failure. Interestingly, we did
not find a significant higher risk of allograft failure in patients with non-C1q binding DSA compared to patients without DSA
(HR=1.412; p=0.245). Furthermore, when we entered the DSA strength in the multivariate model, we neither found significant differences in the adjusted-risk of allograft failure between patients with non-C1q-binding DSA and patients without
DSA, regardless of the strength in SAB assay (pDSA+/C1q-<6,000MFI=0.445; pDSA+/C1q->6,000MFI=0.321).
Conclusions
Only preformed C1q-binding DSA significantly increase the risk of allograft failure and should be totally avoided before
transplantation. The presence of preformed non-C1q-binding DSA does not increase the risk of premature allograft failure,
regardless of their strength. Then, these non-C1q-binding antibodies could be considered as minor risk without the need to
establish a particular MFI cut-off. The identification of unacceptable mismatches according to SAB assay would improve the
risk stratification for allograft loss and increase the limited allograft allocation in highly sensitized patients, which is the main
purpose of these studies.
186
P-081 INTRAVENOUS IMMUNOGLOBULIN THERAPY IN HEART, LUNG, KIDNEY AND LIVER RECIPIENTS WITH POSTTRANSPLANT SEVERE INFECTION AND IgG HYPOGAMMAGLOBULINEMIA LONG TERM AFTER TRANSPLANTATION
E. Sarmiento Marchese1 , I. Sousa Casasnovas2 , E. Zatarain2 , S. García Jiménez1 , M. Rodríguez Ferrero3 , F. Anaya3 , M. Salcedo4 ,
D. Rincon4 , R. Laporta5 , P. Ussetti Gil5 , J. Navarro Caspistegui1 , E. Fernandez-Cruz1 , J. Carbone Campoverde1 1) Hospital General Universitario Gregorio Marañón. Madrid 2) Hospital General Universitario Gregorio Marañón. Madrid 3)
Hospital General Universitario Gregorio Marañón. Madrid 4) Hospital General Universitario Gregorio Marañón. Madrid 5) Hospital
Universitario Puerta de Hierro. Madrid
Introduction
Infection is a leading cause of death after transplantation. IgG hypogammaglobulinemia (HGG) can be associated with development of severe infections after the first year of solid organ transplantation (SOT). We have previously observed that
HGG occurring after the first year of heart transplantation is a risk factor of death. We have also described that inespecific
intravenous immunoglobulin (IVIG) replacement therapy is useful to restorate IgG levels in heart recipients during the first
year after transplantation.
Objectives
In the present study we assessed the safety and the rate of IgG immune reconstitution after IVIG for HGG and severe infections occurring more than one year after transplantation in SOT.
Methods
Retrospective multicenter study. An event was defined as a severe infection requiring hospitalization and antimicrobial therapy. HGG was detected at the time of infection and defined as serum IgG < 600 mg/dl by nephelometry. IVIG-protocol
(compassionate use): non specific IVIG (Flebogamma 5%, n=10; Intratect 5%; n=8; Privigen 10%, n=3; Plangamma 5%, n=2;
Gammagard 5%, n=1; Flebogamma DIF 5%, n=1). Goal: to reach normal IgG levels (>750 mg/dl). IVIG at a dose of 300-400
mg/kg/month was added to conventional antimicrobial therapy.
Results
25 SOT recipients received IVIG therapy [heart (n=16), kidney (n= 5), liver (n=2), lung (n=2)]. Mean time after transplantation
was 5.1 (1-22 years). Distribution of infections: Bacterial infections, n=16; clostridium difficile associated diarrhea (CDAD),
n=2; CMV infection, n=6; aspergillosis, n=2; recurrent herpes zoster, n=1; H1N1 influenza pneumonia, n=1; pyoderma gangrenosum, n=1. Some patients had more than one severe infection at the time of indication of IVIG. Mean IgG levels at the
time of infection and after IVIG therapy were (462 ± 109 vs 854 ±185 mg/dl, 2-tailed paired Student´s T-test, p<0.001, respectively). Normalization of IgG levels was obtained in 16 patients (64%). One heart recipient reported moderate chest pain
during one IVIG infusion. IVIG infusions were continued with another IVIG product without any further adverse reactions in
this patient. No other moderate or severe adverse reactions were observed during or after IVIG usage.
Conclusion
IVIG was safe, well tolerated and associated with humoral immunity restoration in SOT recipients with HGG and severe infections more than one year after transplantation. A randomized clinical trial is necessary to further evaluate this potential new
indication of IVIG. 39 Congreso de la Sociedad Española de Inmunología
187
P-082 ROLE OF THE ANTI-DP ANTIBODIES IN RENAL TRANSPLANTATION
C. Abad Molina1 , E. Aguado Domínguez1 , F. M. González Roncero2 , M. Á. Gentil Govantes2 , I. Aguilera Aguilera1 , A. Núñez
Roldán1 , M. F. González Escribano1 1) Hospital Universitario Virgen del Rocío 2) Hospital Universitario Virgen del Rocío
Introduction
Humoral immune response to class I and II HLA molecules affects the outcome of renal transplantation. Preexistent anti-donor class II antibodies increase the risk of transplant failure and de novo anti-class II antibodies are associated with a higher
incidence of acute and chronic rejection. Regarding the different class II molecules, some authors have described that disparities in DPB or DPA may be responsible of antibody-mediated rejection (AMR) in renal repeatedly transplanted patients.
Besides, these studies suggest that the eplets 84DEAV and 56DE/56EE of DPB could be relevant in the antibody response.
However, there a relatively low number of cases in which the only incompatibility is DP, therefore, every informative case is
important in order to define the role of DP in the outcome of the renal transplantation.
Objetive
Contribute to clarify the role of the donor-specific anti HLA-DP antibodies in renal transplantation.
The propositus was a 33 years old patient receiving his third graft. The donor of this third graft was the patient´s mother, a 54
years old woman, who completely matched with the patient at HLA-A, B, C, DR and DQ. The only incompatibility received for
the patient was DPB (Donor DPB1*04:01, *04:02; receipt DPB1*04:02). This incompatibility implies receiving 2 eplets mismatches, 55AA and 56AE, which are not considered immunogenics. Previously to the 3rd transplant, the patient was immunized
(PRAc=99%) but crossmatch (XM) using the microlinfocititoxicity test againts T and B was negative as well as the virtual XM
performed with a single antigen Luminex assay.
Results
The patient had an impaired renal function in the 12 firts days post-transplant. The single antigen assay did not reveal DSA
and the biopsy study was reported as absence of acute cellular rejection and C4d negative. However, after one year with impaired renal function, DSA de novo antibodies against DPB1*04:01 were detected in the patient serum and biopsy revealed
absence of acute celular rejection and mild signs of acute humoral rejection with C4d negative. The patient was dignosed
of humoral rejection and received treatment for it (Rituximab, plasmapheresis, IVIG) but the DSA remained and it was not
successful and one year later returned to hemodialysis.
Conclusions
Our results support that there is immunization againts HLA-DP eplets considered non-immunogenic and they suggest that
anti-DP antibodies could be relevant in the outcome of renal transplantation.
188
P-083 HLA MISTYPING DUE TO LOSS OF HETEROZYGOSITY AS DETERMINED BY PCR-SSO AND PCR-SBT USING LOCUSSPECIFIC PRIMERS IN A PATIENT WITH SÉZARY SYNDROME
D. Planelles1 , M. F. Palmero2 , M. Rodríguez-Cebriá1 , C. Muñoz3 , R. Granell1 , M. Luis1 , E. Laguarda1 , F. Martínez1 , D. Jarque1 ,
C. Marín1 , M. Álvarez1 , N. Puig1 1) Centro de Transfusión de la Comunidad Valenciana 2) Hospital General Universitario de Alicante 3) Hospital General Universitario
de Alicante
Introduction
HLA loss of heterozygosity has been demonstrated in a variety of solid tumors and in a few haematological malignancies.
HLA-typing errors due to genetic alterations in tumour cells, as the loss of the whole or partial HLA haplotype, can have serious consequences in the selection of suitable donor for hematopoietic stem-cell transplantation (HSCT). Sézary syndrome
is a variant of cutaneous T-cell lymphoma characterized by a clonal proliferation of aberrant T-helper cell populations and
there is currently a growing interest in considering HSCT to treat this syndrome.
Patient and Methods
The patient was a 56-year-old Caucasian female, diagnosed as Sézary syndrome with “significant” blood involvement: Sézary
cell counts in the collected patient’s peripheral blood sample were 27.000. Routine serologic HLA typing was performed by
means of monoclonal typing trays (One Lambda) on a lymphocyte suspension isolated by using monoclonal antibody-coated magnetic beads. Confirmatory HLA high-resolution typing was performed by SBT using locus-specific amplification primers (SBTexcellerator®, GenDx). HLA homozygosity was confirmed by PCR-SSO (One Lambda) and by PCR-SSP (Olerup SSP®).
Objective
HLA-homozygosity obtained by biallelic SBT and PCR-SSO was not confirmed by PCR-SSP nor serology. The objective of this
study was to analyse these discordant results in order to ensure accuracy in HLA typing of this patient.
Results
Serologic HLA analysis for the patient identified the following typing: A2,32; B39,58; Cw7,-; DR7,16; DR51,53; DQ2,5. Confirmatory high-resolution typing by biallelic PCR-SBT revealed a complete HLA- Class I homozygosity (HLA-A, -C and B):
A*32:01:01,-; B*39:01:01:01,-; C*12:03,-. In order to discard a potential allele drop-out due to the SBT-technology, PCR-SSO
technology was performed. Homozygosity in HLA-A, B and C was confirmed, and the typing obtained was: HLA-A*32:AGUPU,-; B*39:AGJVX,-; C*12:AGRNW,-.
Based on serological typing of patient, high resolution PCR-SSP was performed on the second allele undetected by biallelic
SBT/SSO. PCR with specific primers for A*02, B*58 and C*07 could readly detect alleles A*02:01, B*58:01 and C*07:01, respectively. HLA-A*32:01, B*39:01 and C*12:03 were detected as well using specific primers for these allele-groups.
Additional sequencing using group-specific sequencing primers detected specific polimorphisms for A*02:01:01 and
B*58:01:01.
HLA-Class II molecular typing by monoallelic PCR-SBT and PCR-SSO, in the case of DRB1, and by PCR-SSO and SSP, in
the case of DQB1, rendered heterozygous results according to the serological typing: HLA-DRB1*07:01:01G,*16:01:01;
DQB1*02:02,*05:02.
Conclusions
HLA-homozygosity in patients with indication of unrelated HSCT and without the possibility of performing a family segregation analysis, should be carefully confirmed by different HLA-typing methods, or with a second typing sample obtained from
a buccal swab or after a long period of complete remission.
189
P-084 DIFFERENT ROLE OF HLA ALLELES AND KIR HAPLOTYPES ACCORD THE TYPE OF RECURRENT REPRODUCTIVE
FAILURE
V. Pascual1 , J. L. Vicario2 , M. Núñez Beltran1 , M. Fernández Arquero1 , S. Sánchez Ramón1 1) Hospital Clínico San Carlos 2) Centro de transfusión Comunidad de Madrid
Introduction
Recurrent miscarriages (RM) and repeated implantation failures (RIF) after in vitro fertilization (IVF) are the two principal
forms of recurrent reproductive failure (RRF). Both have heterogeneous known causes but still the cause of a proportion of
RRF remain unknown Increasing body of evidence shows both alloimmune and autoimmune mechanisms involved in RRF.
The KIR multigene family exhibits an extensive degree of diversity, due to a combination of presence or absence of particular
genes combined with allelic polymorphism of individual KIR genes. The order of the KIR genes along the chromosome has
been determined for two distinct haplotypes. The A haplotype has seven KIR loci, any of them an activating receptor. The B
haplotypes are mainly characterized by the presence of extra loci, encoding activating receptors.
HLA- C can be separated in two different groups by the amino acid in two positions (HLA-C1/ HLA-C2). B haplotype confers
protection from pregnancy disorders, and its absence (A haplotype) increases the risk of pregnancy complications. Mothers
who are homozygous for KIR haplotype A (KIR AA) when the fetus has more HLA-C2 genes than the mother and the additional fetal HLA-C2 alleles are of paternal origin was described as increased risk of pre-eclampsia. Objectives
To perform a comparative study of the HLA and KIR genes involved in allogeneic RRF in both groups of patients. Materials and Methods
A total of 61 women with history of RM or RIF and her partners were studied. All samples were obtained from Spanish individuals of Caucasian origin.
Maternal genomic DNA was isolated from 5 ml of blood using the QIAamp DNA Maxi Blood Kit (QIAGEN). KIR typing was
performed by PCR-SSO on Luminex derives (Lifecodes, Immuncor, USA.
We obtained the data of Spanish control population from Allele Frequency Net Database (http://www.allelefrequencies.net).
Results
The mean age of our patients was 36±3.2 years.
Compatible with data in the literature, our results suggest that B allele confers protection, for both BA/ BB genotypes groups.
No significant differences were found between the groups.
Woman with RIF show higher incidence of the risk haplotype (34.5%) compared to control population (22.6%). Of note, woman with RM, the A haplotype is shown diminished respect to the normal population.
On the other hand, the alleles of HLA-C1 group seem to be more often in women who develop RIF (71%), compared to recurrent mistake group (55%) and control population (54%).
Conclusion
Our result suggest a different role this immune process in the form of two main recurrent reproductive failures (RRF). The
protective effect of B alleles of the KIR genes seems to happen in the earlier stages of pregnancy, so the presence of the risk
alleles it seems to cause an unsatisfactory implantation of the embryo.
Further studies are needed to corroborate our results but could be interesting to study the correlation of these risk loci and
the survival fetus time.
190
P-085 STUDY OF HLA ASSOCIATION FOR PEOPLE WITH SENSITIVITY TO DRUGS
C. H. Parga Lozano1 , Y. R. T. Ortega García2 1) Universidad del Atlántico 2) Grupo de Farmacoterapia e Inmunología
Introduction
Colombia is a Latin American country located in northwestern South America and was an important link between the North
and South in the hemisphere. In Colombia there are not studies about Amerindian aspirin susceptibility. Because this, this
study is based in to look for the asociation between the HLA genes from Korean population (en these have been determined
HLA aspirin susceptibility) and them presence in Amerindian Colombian.
In the present study we have analised the HLA allelic frequencies of 1324 chromosomes from 12 Amerindian Colombian and
one Korean population. We have used the availables HLA data from these native populations and we compared them using
genetic distances and constructing dendrograms Neighbour-Joining (NJ) and correspondence analysis.
Results
Based on these analyzes it was found that there is a close relationship between the indigenous people from Colombia,
mainly with the indigenous from Sierra Nevada de Santa Marta and the HLA genes related with aspirin susceptibility Korean
population.
Conclusions
As was observed in this study, Amerindian Colombia could have a susceptibility to aspirin intolerance.
191
P-086 PTPN22 IS NOT ASSOCIATED WITH BEHCET’S DISEASE. STUDY SPANNING THE COMPLETE GENE REGION IN THE
SPANISH POPULATION AND META-ANALYSIS OF THE FUNCTIONAL VARIANT R620W
L. Ortiz Fernández1 , M. A. Montes Cano1 , J. R. García Lozano1 , M. Conde Jaldón1 , Grupo Español para Estudio de la Enfermedad
de Behçet 1 , J. Martín2 , M. F. González Escribano1 1) Instituto de Biomedicina de Sevilla (IBiS) 2) Instituto de Parasitología y Biomedicina
Introduction
The functional variant R620W of the protein tyrosine phosphatase non receptor-22 (PTPN22) gene plays an important role in
susceptibility to several immuno- mediated pathologies. Behcet\’s disease (BD) is a complex disease related to the immune
system with a demonstrated genetic base. The HLA class I genes are the most important genetic factors in BD although other
genes are also involved in the susceptibility to this disease. The PTPN22 has been proposed as a candidate gene in BD but
this association has not been clearly demonstrated yet.
Objective
The aim of this study was asses the association of PTPN22 with BD.
A cohort composed of 404 Spanish BD patients and 1517 unrelated healthy individuals ethnically matched was genotyped
in rs2476601 (R620W). Five tag SNPs: rs1217412, rs2476599, rs3789607, rs3765598 and rs1217419 (spanning a 57 Kb region
between 3’UTR and 5’UTR) and rs2488457 (located at the promoter region) were also studied in order to perform a screening
of the complete gene. Genotyping was performed using TaqMan® assays. The rs2476601 data were included in a metaanalysis together with those published till the date. The rest of SNPs were used in a case-control study.
Results
No evidence of the association of rs2476601 with BD in the meta-analysis (P =0.504 in the model of alleles) were found. In
the case-control study, no statistically significant differences were observed when comparing the distribution of variants in
patients and controls.
Conclusions
Our results discard a major role of the PTPN22 gene in BD.
192
P-087 ASSOCIATION OF CCR5Δ32 AND BEHÇET’S DISEASE: NEW DATA FROM A CASE-CONTROL STUDY IN THE SPANISH
POPULATION AND META-ANALYSIS
L. Ortiz Fernández1 , J. R. Garcia Lozano1 , M. A. Montes Cano1 , M. Conde Jaldón1 , Grupo Español para el Estudio de la
Enfermedad de Behçet 1 , J. Martín2 , M. F. González Escribano1 1) Instituto de Biomedicina de Sevilla 2) Instituto de Parasitología y Biomedicina
Introduction
Behçet’s disease (BD) is an immune-mediated and complex disease associated with HLA class I and other genes.
Objective
The aim of this study was to contribute to a better understanding of the relationship of the 32-bp deletion in the CCR5 gene
(CCR5Δ32) and this disease by conducting a case-control study in the Spanish population and also a meta-analysis including
all the studies available to date.
A cohort composed of 348 BD Spanish patients and 477 unrelated healthy and ethnically matched individuals were genotyped in CCR5Δ32 using polymerase chain reaction (PCR) and capillary electrophoresis with fluorescent detection. In the
meta-analysis, data from a total of seven populations extracted from four previous studies along with data of the present
study were included.
Results
Regarding the case-control study, no statistically significant differences were observed when the patient and control groups
were compared (allelic model: 0.07 in patients vs. 0.06 in controls, p=0.303). In the meta-analysis, no evidence of association
of the CCR5Δ32 polymorphism with BD was observed (pMH= 0.091; OR=1.22; 95%CI 0.98 to 1.52 in the allelic model)
Conclusion
The results of this meta-analysis discard a major role of the CCR5Δ32 polymorphism in BD.
193
P-088 GENE POLYMORPHISM OF HUMAN GLUTATHIONE S-TRANSFERASE THETA (GSTT1) IN THE SOUTHEAST OF SPAIN
G. González Martínez1 , S. Llorente2 , J. Eguía1 , J. A. Galian1 , E. Novoa1 , F. Boix1 , A. Mrowiec1 , L. Gimeno2 , M. R. Moya Quiles1 ,
J. A. Campilllo1 , A. Minguela1 , A. Nuñez Roldan3 , A. Garcia Alonso1 , I. Aguilera3 , M. Muro1 1) Hospital Clínico Universitario Virgen de la Arrixaca-IMIB (Murcia) 2) Hospital Clínico Universitario Virgen de la Arrixaca-IMIB
(Murcia) 3) Hospital Clínico Virgen del Rocio (Sevilla)
Introduccion
Several drug-metabolizing enzymes belonging to the glutathione S-transferase family have the potential to behave as minor histocompatibility antigens (miHA) in bone marrow transplantation (BMT). Among them, glutathione S-transferase T1
(GSTT1) present the null allele, meaning the absence of protein due to gene deletions. GSTT1 is predominantly expressed in
liver, kidney, and erythrocytes, and is absent in a homozygous manner in 20% of the Caucasian population. Immune recognition of the GSTT1 alloantigen, with production of donor specific antibodies (Abs), has already been described in GSTT1-null
recipients receiving liver and kidney transplants from GSTT1-positive donors. These Abs constitute a risk factor to develop
de novo immune hepatitis or chronic antibody-mediated rejection. In addition, it has previously described that the presence
of these Abs may induce hepatic GVHD in GSTT1+ patients who receive allo-HSCT from GSTT1-null donors. In patients receiving BMT for treatment of congenital hemoglobinopathies, the frequency of rejection in these patients bearing GSTT1-null
genotype was significantly higher than in those GSTT1+ patients, suggesting that a effect of GSTT1 matching could not be
cause for the observed facts.
Objetives
The aim of this study was to define the frequency of GSTT1 alloantigen in our region.
Peripheral blood was obtained from 173 unrelated randomly selected, all of them Caucasoid, recruited in the Southeast of
Spain. All subjects gave their informed consent prior to their inclusion in this study to the collection and storage of blood,
isolation of DNA, and determination of the gene polymorphisms. Indeed, the study was approved by the local medical
committee. Genomic DNA was extracted from peripheral blood lymphocytes with the Maxwell16 extractor (Promega, WI)
and was employed for the GSTT1 genotyping. This was performed by real time-PCR [Genvinset GSTT1 (Blackhills Diagnostic
Resources)] according to the manufacturer´s instructions.
Results
This study was designed to investigate genetic diversity in GSTT1 gene in a population where no previous GSTT1 data existed. The frequency of GSTT1 (expression/deletion homozygous polymorphism of protein GSST1) null genotype was 17.9%
(n=31/173) in our population (table 1). These data are in accordance with previous data of neigh boring populations, although the frequency of our population is slightly inferior to that reported in other Caucasian populations (≈20%) and their
genetic relationships will be discussed.
Conclusions
The presence of antibodies against GSTT1 protein in these GSTT1-null recipients receiving an allotransplant from a GSTT1+
donor has widely been described. For this reason, the study and determination of the frequency of GSTT1-null genotype in
our community is very important to know the true involvement that these antibodies could have in kidney, liver or bone
marrow transplant outcome.
194
P-089 INHIBITORY KIR2D GENES AS A TOOL IN FORENSIC ANTHROPOLOGICAL STUDIES
I. Legaz Pérez1 , J. M. Bolarin2 , B. Las Heras2 , J. A. Campillo2 , L. Gimeno2 , A. Mrowiec2 , F. Boix2 , R. Moya Quiles2 , A. M. Garcia
Alonso2 , A. Luna1 , M. Muro2 , A. Minguela2 1) Universidad de Murcia 2) Hospital Clinico Universitario Virgen de la Arrixaca
Introduction
KIR are encoded by a family of genes on chromosome 19q13.4, exhibiting extensive haplotypic variation in gene number
and content, as well as allelic polymorphism for individual genes. Depending on the intracellular domains two types of KIR
have been distinguished, inhibitory KIR (iKIR) and activating KIR (aKIR). The inhibitory KIR2D receptors are characterized by
two extracellular domain with with a long cytoplasmic tail and the presence of al least one immunoreceptor tyrosine-based
inhibitory motif (ITIM).
Objetive
The aim of this study was to analyze the frequency of five iKIR2D genes in the Spanish population and compare with the
frequency in 16 different populations in order to find new genetic markers that can be used to differentiate populations in
the forensic practice.
A total of 609 Spanish unrelated individuals of different geographic regions were analyzed. Genomic DNA was extracted
from peripheral blood and KIR genotyping was performed by PCR-SSO. Five inhibitory KIRs (KIR2DL1-5) were analyzed. Statistical analysis was performed using the SPSS 15.0 Comparisons were made by the two-sided Fisher´s exact test. A level of
P<0.05 was accepted as statistically significant.
Results
iKIR genes analyzed were present in the Spanish population studied. The Spain frequency of KIR2DL1 (97.7%) was similar
to other populations analyzed, excepted to Australian and Borneo (72% and 83%, respectively; P <0.001).With regard to
the frequency of KIR2DL2 (60.1%) in our population was similar to the analyzed populations of Europe, except the British
population whose frequency was significantly lower (52.9%; P=0.014). Significantly lower frequencies were also observed
in populations of Borneo, China, Russian (33%, 25% and 50% respectively, P <0.001) and Venezuela (49.3%; P=0.007). In
contrast, the frequency in Australian population was a significant higher respect to our population (79%; P =0.002). KIR2DL3
(87.2%) in our population presented similar percentages to the rest of Europe, except in Turkish population whose frequency
was significantly lower (80%; P=0.015). Interestingly, the other world populations analyzed present frequencies significantly
higher than the Spanish, except to Australian population whose frequency is lower (68%; P < 0.001). In addition, KIR2DL5
Spanish frequency (51.9%) is higher than the population of Macedonia and Borneo (41.6% and 31%; P = 0.011; P = 0.007,
respectively), and lower than the population of India and Iran (71% and 61.5%; P<0.001; P=0.022, respectively).
Conclusions
Inhibitory KIR2D gene frequencies of Spanish population were quite similar in Europe populations like Denmark, Finland,
Ireland and Italian, Czech Republic and Turkey but very different to others worldwide populations (Australia, Borneo, China,
India, Venezuela and Russia) these findings enriching the Caucasian gene information resources and represent essential and
complementary tools for anthropological studies.
195
P-090 IMMUNOGENETIC FACTORS AFFECTING THE COURSE OF ACUTE PANCREATITIS
A. Rodríguez Nicolás1 , A. Martínez Chamorro1 , F. D. Carmona López3 , M. P. Jiménez Gámiz1 , A. M. Matas Cobos2 , J. Martín
Ibáñez3 , E. Redondo Cerezo2 , F. Ruiz-Cabello Osuna1 1) Complejo Hospitalario Universitario de Granada 2) Complejo Hospitalario Universitario de Granada 3) Instituto de Parasitología
y Biomedicina “López - Neyra”
Introduction
The acute pancreatitis is an inflammatory clinical condition associated with high mortality and morbidity. Toll-like receptors
(TLRs) are essential in the activation of the inflammasome cascade, required for the initiation of inflammation. When the
inflammatory response becomes uncontrolled, a Systemic Inflammatory Response Syndrome (SIRS) ensues. This systemic
inflammatory response is the result of the secretion of pro inflammatory mediators including interleukins (IL-1, IL-6, IL-15,
IL-8, IL-33, and IL-18), TGF-β, and TNF-α.
Objectives
We hypothesized that changes in the function of these components of the inflammatory response, caused by genetic polymorphisms in their encoding genes, could determine acute pancreatitis (AP) incidence or severity.
269 patients and 1517 controls were included. Acute pancreatitis diagnosis criteria were abdominal pain, increased serum
amylase levels, and positive findings on abdominal imaging. The patients were observed until discharge. Blood samples
were obtained, determining the following genetic polymorphisms TLR1 rs5743611, TLR2 rs5743704, TLR3rs3775291,
TLR3 rs5743305, TLR4 rs4986790, TLR4 rs4986791, TLR5rs5744174, TLR6 rs5743795, TLR7 rs2302267, TLR9 rs352140, TLR10
rs4129009, RANTES rs2107538 , TNF-α rs1800629, MCP1 rs1024611, RIPK2 rs42490, NOD2 rs9302752.
Results
We found that IL23R rs11209026 polymorphism was related to AP incidence. The odds ratio (OR) for carriers was 1.523
(P=7.261E-3). The other polimorphisms were not related to AP incidence.
Regarding severity, the carriers of G allele in RIPK2 rs42490 had an increased risk for severe pancreatitis (OR= 2.736; P =
0.01583). The OR was 1.609 (P=0.042) when comparing severe or moderately severe pancreatitis versus mild acute pacreatitis.
The patients carrying CC genotype in TLR3 rs3775291 had an increased risk for severe pancreatitis (CC [OR], 2.426; P = 0.015).
In addition, the patients carrying TLR6 rs5743795 GG genotype had a lower risk for severe AP (GG OR, 0.909; P < 0.05). Intensive care unit admission was related to TLR5 rs5744174 homozygote TT carriers (TT OR, 3.367; P = 0.036).
Conclusions
Our work points to genetic polymorphisms in TLR3, TLR5, TLR6 , IL23R and RIPK2 as having a plausible role in the occurrence
or severity of AP.
196
P-091 ZEBRAFISH LIPOCALIN-TYPE PROSTAGLANDIN D SYNTHASE HOMOLOGUES: MOLECULAR CHARACTERIZATION
AND EXPRESSION ANALYSIS
V. Gómez-Abellán1 , F. Hermi2 , V. Mulero1 , M. P. Sepulcre1 1) University of Murcia 2) Unit IMEC
Introduction
Mammalian lipocalin-type Prostaglandin D synthase (L-PGDS) is a bifunctional protein with the ability of carrying lipophilic
molecules and synthesizing PGD2. However studies about the activity of non mammalian L-PGDS revealed few or no activity
for this molecule.
Objectives
The aim of this study is the identification of the different zebrafish L-PGDS isoforms and the analysis of their expression in
larvae and adult zebrafish under control and infected conditions and to determine their enzymatic activity.
Sequence homology analysis was performed using BLAST of the NCBI nucleotide sequence database using the structure of
human L-PGDS.
Gene expression was analyzed with RT-PCR in zebrafish embryos during the first stages of development (0, 2, 7, 9, 24, 48 and
72 hpf ).
Zebrafish larvae were infected or not with Salmonella at 2 dpf, and the expression of the different L-PGDS isoforms was
analyzed with RT-qPCR at 3, 6, 24 and 48 hpi.
Adult zebrafish were infected or not with Vibrio anguillarum and 24 and 48 hpi the expression of the different L-PGDS isoforms were analyzed by RT-qPCR in head kidney.
Results
In this study we have characterized three L-PGDS isoforms in the zebrafish gene database, (L-PGDSa, L-PGDSb, L-PGDSlip15)
and have identified a new one in the chromosome 5 termed as L-PGDSnew5. All isoforms contain a lipocalin domain and the
conserved folding patterns and three structurally conserved regions (SCRs) but lacked the essential cysteine residue required for PGDS activity found in mammalian L-PGDS.
The expression analysis in zebrafish embryos during the first stages of development showed that the transcripts of the four
L-PGDS isoforms are maternally transferred since they were detected from the fertilization time. Furthermore, larvae infection with Salmonella result in increased mRNA levels of L-PGDSlip15 at all time tested. Similarly, adult zebrafish infection
with Vibrio anguillarum was able to induce the transcript levels of L-PGDSlip15 in head kidney. In contrast bacterial infection
decreased the mRNA levels of L-PGDSa, L-PGDSb, and L-PGDSnew5.
Conclusions
Our data suggests a key role for L-PGDSlip15 in the immune response in zebrafish bacterial challenged. Further studies related with the determination of its enzymatic activity will through light into to the role of this protein in zebrafish immunity.
197
P-092 ASSOCIATION OF HLA-A, -B AND -DRB1 AND FIBROMYALGIA SYNDROME
L. Gimeno1 , G. Salgado1 , E. Novoa1 , J. M. Bolarin1 , I. Legaz5 , P. Martínez1 , A. Bermudez2 , A. Martínez-León4 , M. Muro1 ,
M. Moya-Quiles1 , J. A. Campillo1 , A. Minguela1 , M. R. Álvarez-López1 , I. Lozano3 , A. M. García-Alonso1 1) Hospital Clínico Universitario Virgen de la Arrixaca 2) Hospital Clínico Universitario Virgen de la Arrixaca 3) Hospital Clínico
Universitario Virgen de la Arrixaca 4) Centro de Salud Murcia-San Andrés 5) Univerisdad de Murcia
Introduction
Fibromyalgia (FM) is an idiopathic disorder characterized by widespread nonarticular musculoskeletal pain accompanied
by fatigue, sleep and memory disorders and mainly affecting women. Recent evidence suggests environmental factors and
related conditions in genetically predisposed individuals. Human leukocyte antigen (HLA) region remains the most powerful
susceptibility genes. These genes play an important role in disease susceptibility since HLA control a variety of functions in
immune system.
Objective
Our aim was to study HLA class-I and class-II polymorphism and their association with FM. Influence on widespread and
severity of the illness was also evaluated.
Methods
150 clinically defined FM patients and 150 healthy controls were included in the study. HLA-A, -B and -DR typing was performed by microbeads array luminex technology (PCR-SSO). Statistical analysis of HLA diversity association was performed by
SPSS programme.
Results
Analysis of HLA polymorphism revealed that HLA-DRB1*04 allele were significantly associated with patients suffering FM
(P=0.004, Pc=0.05). Furthermore, FM widespread and severity assessed by Fibromyalgia Survey Questionnaire (FSQ) showed
also significant association. In a first analysis we found significant associations between HLA-A*23 (p=0.035), A*33 (p=0.019),
A*25 (p=0.004) and A*30 (p=0.013) and HLA-B*15 (p=0.031), B*18 (p=0.024), B*38 (p=0.029) and B*44 (p=0.026) with a more
severe grade of illness, but these associations lost statistical significance after correction for multiple testing due to the limited number of patients.
Conclusion
Our data suggest that HLA could be related with FM syndrome outcome and also evidence the genetic and immunological
basis, although further and broader studies will be necessary in the future.
Acknowledgements
This work was supported by Fondo de Investigación Sanitaria (FIS; PI11/01926) and Seneca Foundation (GERM/06/2008).
198
P-093 CYTOKINES POLYMORPHISM IN FIBROMYALGIA SYNDROME.
L. Gimeno1 , A. Mrowiec1 , G. Salgado1 , E. Novoa1 , J. M. Bolarin1 , P. Martínez1 , A. Bermúdez2 , A. Martínez-León3 , M. Muro1 ,
M. R. Moya-Quiles1 , J. A. Campillo1 , A. Minguela1 , M. R. Álvarez-López1 , I. Lozano4 , A. M. García-Alonso1 1) Hospital Clínico Universitario Virgen de la Arrixaca 2) Hospital Clínico Universitario Virgen de la Arrixaca 3) Centro de Salud
Murcia-San Andrés 4) Hospital Clínico Universitario Virgen de la Arrixaca
Introduction
Fibromyalgia (FM) is a common chronic pain disorder affecting 2% of the general population where 85% of the affected
are females. Defined by the American College of Rheumatology (ACR) as widespread pain, pathophysiologic mechanisms
underlying are not completely understood. Diverse studies support the possible role of both genetics and environment
contributions and although is a non-inflammatory process, a lot of studies demonstrate that cytokines have a place among
proposed FM paradigm.
Objective
Our aim is to study the influence of cytokines gene polymorphisms on FM. Influence on disease stage and progression measure by different standardized psychiatry test was also evaluated.
Methods
150 clinically defined fibromyalgia patients and 150 healthy controls were included in the study. Diverse cytokine polymorphisms were analysed, anti-inflammatory IL10, TGFb and IL4 and pro-inflammatory IL6, IFNg, IL1b, TNFa, IL8, IL17. Statistics
analysis was performed by SPSS programme.
Results
No significant differences between controls and patients were found. However, some genotypes showed association with severity of the disease. GG IL1b rs16944 genotype was associated with more severity cases of FM (p=0.006, Pc<0.05) meanwhile
pro-inflamatory IL6 rs1800795 GG (p=0.011, Pc<0.05) and IFNg rs2430561 AA (p=0.018, Pc<0.05) genotypes showed increased prevalence on moderated forms. Among anti-inflammatory cytokines only GG genotype of TGFb rs1800469 (p=0.011,
Pc<0.05) and IL4 VNTR 3R (p=0.005, Pc<0.05) showed association with the gravity of FM.
Conclusions
Our data suggest an association between cytokine polymorphisms and susceptibility to FM. Further studies are necessary to
determinate its relation with cytokine levels and the outcome of de FM.
Acknowledgements
This work was supported by Fondo de Investigación Sanitaria (FIS; PI11/01926) and Seneca Foundation (GERM/06/2008).
199
P-094 DESCRIPTION OF THE NOVEL HLA-DQB1*02:02:01:02 ALLELE IN A SPANISH INDIVIDUAL
G. Montero Martín1 , E. Rivas García4 , I. Cervera1 , A. Teniente Serra6 , M. Fonolleda6 , M. C. Trejo Benítez4 , M. I. González
Henríquez4 , J. Martínez Laso5 1) Centro Nacional de Microbiología-ISCIII 2) German Trias i Pujol University IGTP-Campus Can Ruti 3) Universitat Autònoma de
Barcelona 4) Complejo Hospitalario Universitario Insular Materno-Infantil 5) Centro Nacional de Microbiologia- ISCIII, Complejo
Hospitalario Universitario Insular Materno-Infantil 6) German Trias i Pujol University IGTP-Campus Can Ruti, Universitat Autònoma
de Barcelona
Introduction
HLA typing of a Spanish Caucasian individual was performed to complete diagnosis of diabetes mellitus type I (DM1). While
common linkage disequilibrium in our population for DRB1*07 is DQB1*02:02, the patient showed a different pattern consisting of DRB1*07-DQB1*02:01 genes.
Objectives
The main objective was to determine the exact sequence of the HLA-DQB1*02 in this sample in order to characterize the
uncommon pattern of linkage disequilibrium found.
Total DNA was extracted using standard methods and initial test for DM1 was carried out using real time PCR technology.
Then, low resolution typing was determined by Luminex technology and SBT techniques were used in order to assess high
resolution typing of HLA-DQB. Specific HLA-DQB1*02 pair primers were designed to specifically amplify the locus and sequencing standard protocols using a Big Dye terminator cycle sequencing kit and an ABI3730xl automated sequencer were
carried out.
Results
The sequence obtained had identical exon sequence as DQB1*02:02:01:01. Regarding the non-coding regions, it shared with
DQB1*02:01:01 the same sequence from 5ÚTR to intron 2, while intron 5 corresponded to DQB1*02:02:01:01 sequence. The rest
of the non-coding region didn´t follow a specific sequence pattern although some were present in DQB1*05, 06 or 03 alleles.
Conclusions
A new allele of HLA-DQB1*02 has been described. Although exon sequence is identical to DQB1*02:02:01.01, intron sequences seem to come from a combination of the latest and DQB1*02:01:01.
200
P-095 SEQUENCING AND CHARACTERIZATION OF A NOVEL HLA ALLELE, DQA1*01:13
D. Planelles1 , A. Balas2 , N. Puig1 , M. Luis1 , M. Rodríguez-Cebriá1 , R. Granell1 , E. Laguarda1 , F. Martínez1 , D. Jarque1 , C. Marín1 ,
M. Álvarez1 , J. L. Vicario2 1) Centro de Transfusión de la Comunidad Valenciana 2) Centro de Transfusión de la Comunidad De Madrid
Introduction
Polymorphism is a defining feature of HLA system. HLA Class I and DRB1 genes are the most polymorphic loci, whereas other
genes as those of DQA1 locus, are less diverse, with only 55 alleles identified to date.
Objectives
Molecular characterization of a novel HLA-DQA1 allele.
HLA-DQA1 typing of a Spanish Caucasian patient with suspected celiac disease pathology by polymerase chain reaction
sequence specific oligoprobes (PCR-SSO) method (LABType® SSO test, One Lambda Inc., Canoga Park, CA) and Luminex®
technology (Luminex Corporation, Austin, TX) rendered results inconsistent with any known HLA-DQA1 allele combination.
Hybridization pattern was suggestive of a possible DQA1*05:01,*01:07 typing. HLA-Class II serological analysis was also performed by means of commercial monoclonal typing trays (MDR160, One Lambda). Subsequent characterization was carried
out by sequencing-based typing. DQA1*01 and DQA1*05-specific amplifications were performed by using a consensus oligonucleotide placed at intron 1; 5’ggaggaarcaggggytggaaatgtc3’, position 3707-3731; and group-specific oligonucleotides
in intron 3; DQA1*01 5’gaaaacaatgaagtggcaggccca3’, positions 4986-5009 and DQA1*04,*05,*06; 5’tcttgagcccctatgctcaggccc3’, positions 4992-5003.
Results
The DQA1*01 sequence rendered a novel DQA1 allele officially named as DQA1*01:13 (HWS10025560, KT807797).
DQA1*01:13 shows one nucleotide change from DQA1*01:07Q at position 169 GAG>CAG, codon 34, E34>Q34. The extended HLA typing of this patient was A*01,*03; B*07,*08; DRB1*03,*15; DQA1*05:01:01,*01:13; DQB1*02:01:01G,*06:02:01G.
Cell surface expression of DQA1*01:07Q has been defined as questionable and serologically undetectable, possibly due to
the presence of a Cysteine at position 79. To check this possibility for DQA1*01:13 allele, serological class II characterization
of this sample was carried out. In contrast, to that define for DQA1*01:07Q, positive recognition for HLA-DQ2 and –DQ6
molecules was obtained. HLA-DQα/β trans-complementation of DQA1*05:01 and DQB1*06:02 molecules has proven to be a
nonfunctional molecule due to inefficient assembly and structural instability. Therefore, the positive detection of both DQ2
and DQ6 molecules on the cell surface of this patient would suggest that DQA1*01:13 would be able to form part of a heterodimer molecule together with DQB1*06:02.
The name DQA1*01:13 has been officially assigned by the WHO Nomenclature Committee in March 2015. This follows the
agreed policy that, subject to the conditions stated in the most recent Nomenclature Report, names will be assigned to new
sequences as they are identified. List of such new names will be published in the following WHO Nomenclature Report.
Conclusions
HLA-DQA1 typing of this sample was only possible by sequencing. Due to the extreme polymorphism of the HLA system,
sequencing-based typing is the suitable procedure for a complete and reliable HLA typing.
201
P-096 EASTER ISLAND AND ALEUTS RELATEDNESS TO AMERINDIANS AND PACIFIC ISLANDERS ACCORDING TO HLA
GENES
E. Muñiz1 , J. Palacio-Grüber1 , C. Campos1 , D. Rey1 , S. Tomasi1 , J. Martin-Villa1 , A. Arnaiz-Villena1 1) University Complutense, Madrid Regional Blood Center, Madrid, Spain,
Introduction
The peopling of America has been explained almost exclusively on genetic bases. However, Genetics is not able by itself
to uncover it in space and time. While Eskimo, Aleuts, Na-Dene speakers and Amerindians there exist, there is no genetic,
cultural or anthropological homogeneity within these groups. In addition, an Easter Islanders/Amerindian (Titikaka Lake,
Tiwanaku, Bolivia) relationship has been postulated.
Objectives
In this work, we have particularly addressed the relatedness of the First America Inhabitants with Pacific Islanders and specifically with Aleuts and Easter Islanders by using HLA alleles from many other worldwide populations, also including Pacific
Islanders, Amerindians, Aleuts and Easter Islanders ethnic groups.
A genealogic study and also a frequency comparison study taking into account anthropological traits and HLA alleles and
haplotypes by standard techniques (Arlequin, Dispan and Vista programs) were carried out.
Results
We have previously observed that Amerindian HLA frequencies profile does not correlate with either their linguistic branch or their geographical present placements. Also Mesoamerican Amerindians (related to Maya and Olmec cultures) seem less related with Pacific Islanders than some South American Amerindians. DA genetic distances show a
general view: Mesoamericans seem to be less related to Pacific Islanders than South American Amerindians by using two dimension HLA gene frequencies analyses.
Conclusions
1- Aleuts seem to be a genetic and linguistic separate group which may be related to northern European Lapps, both of them
originated in southern Siberia Baikal Lake area.
2- First America Inhabitants, including all analyzed Amerindians, Na-Dene speakers and Eskimo have had genetic flow with
Pacific Islanders: the latter share autosomal HLA alleles and haplotypes with First America Inhabitants. This could have been
bidirectional.
3- Particularly, Easter Islanders show a probable cultural and genetic exchange with Titikaka Lake Aymaras (Tiwanaku culture). This civilization also shares significant traits with European Iberian megalithic builders (5000 years BC).
4- Mesoamericans (Mazatecans, Mixe, Zapotecans, Mayans) may be grouped together because they bear more ancient Olmec culture traits and present paper HLA results.
5- Genes and languages do not correlate unless results are chosen.
6- Genetics by itself do not explain origin and populations relatedness: archaeology, linguistics and other cultural traits must
be taken into account.
202
P-097 MHC VARIABILITY IN WILD SONGBIRDS: NORMAL INTRON SIZE AND MOLECULE EVOLUTION SUGGEST THAT A
MINIMAL ESSENCIAL MHC DOES NOT EXIST IN BIRDS
A. Arnaiz-Villena1 , E. Muñiz1 , J. Palacio-Grüber1 , C. Campos1 , J. Martin-Villa1 , E. Gómez-Casado2 1) University Complutense, Madrid Regional Blood Center, Madrid, Spain 2) Instituto Nacional de Investigación y Tecnología
Agraria y Alimentaria (INIA), Autopista A6, Hipódromo, Madrid
Introduction
Birds are considered dinosaurs that passed the 65 million years ago bottleneck. Songbirds (Passeriformes) include about
half extant bird species (about 5000) and are generally the most air-thriving bird species, concordantly with their small size.
Mayor Histocompatibility complex (MHC) molecules stimulate immune responses against microbes and its class I molecules
have seven conserved residues in all vertebrates from jawed-fishes, 300 million years ago, to humans, including chickens.
Intron changes are not supposed to fit a regular genetic clock model. This makes them unuseful for establishing phylogenies.
However, study of intron changes on groups of already phylogenetically defined models, like certain songbirds (order Passeriformes, namely, Canaries and Goldfinches species) do not follow the postulated model of minimal essential MHC for birds.
Objectives
Our aim was to study MHC evolution of wild Finches, intron size, indels, genetic distances between species and average
molecule variability.
DNA from these birds were isolated and Class I molecules were sequenced. Linearized Maximum Likelihood phylogram trees were constructed with PAUP* software. Linearized Bayesian Inference phylograms were constructed with MrBayes software.
Results
A putative expected conservation of intron 2 in closely related species is not found in these wild birds, instead a large variability is recorded. In addition, exon and intron size shows existence of a MHC similar in size and conserved sites to mammals,
including humans and all other vertebrates. However, 2 out of seven evolutive conserved molecular MHC sites from fishes to
man are specific for these birds. Entropy does not show variation in birds in comparison with other species.
Conclusions
This is concordant with the hypothesis that most allelic MHC variability is achieved by gene conversion (involving introns)
rather than by point mutations. Intron 2 size of histocompatibility molecule in wild small birds (Passerines) is similar to that
size of other vertebrates. In addition, Intron 2 size is significantly larger in Passerines than in human and chicken.
203
P-098 KURDS HLA GENES: ITS IMPLICATIONS IN TRANSPLANTATION AND PHARMACOGENOMICS
J. Palacio-Gruber1 , A. Amirzargar2 , D. Rey1 , E. Muñiz1 , C. Campos1 , J. Martin-Villa1 , A. Arnaiz-Villena1 1) University Complutense, Madrid Regional Blood Center, Madrid, Spain 2) Medical School, Tehran University of Medical Sciences,
Tehran, Iran
Introduction
HLA genes (class I and II) have been studied in a Kurd population from Iran (North West towns of Saqqez and Baneh, close to
Irak border). They are defined by language speaking, an Iranian language. Kurds live nowadays in Turkey, Syria, Iraq, Armenia,
Turkmenistan, Kazakhstan and Iran. Present day Kurd gene pool may be due to admixture of ancient North Mesopotamian
and Central Asia populations, who share common culture origins.
Objectives
In this work, we have addressed the relatedness of the Kurds with the Turks and other Middle Eastern populations by using
HLA alleles from many other World wide populations, also including North and South Mediterranean, Siberians and Orientals. This will be interesting for establishing the Kurd HLA profile that will also be useful for HLA epidemiology and pharmacogenomics and a virtual regional future transplant waiting list.
HLA Kurd profile has been compared with those of Central Asians, Siberians, Mediterraneans and other World wide populations; a total of 7746 chromosomes were used for computer comparisons by standard techniques by using Arlequin, Dispan
and Vista software.
Results
Both Neighbor-joining and correspondence genetic analyses place Kurds in the Mediterranean population cluster, close
to Iranians, Europeans and Caucasus populations (Svan and Georgian). New extended HLA haplotypes are described, being A*02:01-B*35:01-DRB1*01:01-DQB1*05:01 and A*24:02-B*18:09-DRB1*11:01-DQB1*03:01 the most frequent ones; other
Kurd extended haplotypes are also found in Azeris and Palestinians.
Conclusions
1) Kurds are placed in the Mediterranean population cluster supporting our present and previous HLA data showing that
Mediterranean populations include Turkey, Middle East and North Indian countries.
2) These data may be useful for future Iranian Kurds transplantation regional programs.
3) HLA pharmacogenomics in order to practice a preventive Medicine and drug side effects, and 4) Epidemiology of HLA-associated diseases in Kurds.
204
P-099 NARCOLEPSY AND IMMUNOPATHOLOGICAL DISEASES
E. Fernández-Fernández1 , F. J. Martínez1 , S. Sánchez-Ramón1 , J. Matías-Guiu1 , M. Fernandez-Arquero1 1) Hospital Clínico San Carlos
Introduction
Narcolepsy (NC) is a chronic sleep disorder caused by the selective loss of hypocretin-producing neurons. In the past few
years the autoimmune hypothesis of narcolepsy has become strongly accepted although no direct evidence is still available.
The strong association of narcolepsy with the human leucocyte antigen (HLA) system is clearly known. Specifically with the
HLA-DQB1*06:02 allele, marker for the disease.The role of environmental factors is strongly suspected to act as a trigger in
genetically predisposed patients. Upper airway infections, such as those caused by Streptococcus pyogenes, seasonal H1N1
influenza infection, and H1N1 vaccination have been reported to be associated with the disease. The strongest hypothesis
to explain autoimmunity involves molecular mimicry. Autoimmune diseases present many shared risk loci and others with
variable specificities to different diseases. A GWAS in Caucasian individuals, all of them HLA-DQB1*06:02 positive, identified
an association with the T-cell receptor α (TCA) locus on chromosome 14, supporting the autoimmune hypothesis.
Objectives
The aim of this study was the evaluation of the comorbidity of NC and immunopathological diseases (IDs). IDs comprised
all autoimmune and other immune-mediated disorders for this study. To accomplish it, we focus to find out the frequency
of the association and the influence of that association on the outcome of the disease and on the severity of the symptoms.
Patients and methods
Sixty Caucasian patients with NC diagnosed were included. The diagnostic criteria included the presence of excessive daytime sleepiness (EDS ≥3 months) and typical cataplexy.For the assessment of IDs, patients were asked about the age at onset
of the ID: previous to the onset of the first symptom of NC (EDS), simultaneously or subsequent to the onset of EDS.
Results
Four patients out of 60 (6.6%) had one or more IDs in addition to narcolepsy. The IDs found to coexist with narcolepsy in this
cohort were: multiple sclerosis, systemic lupus erythematosus, psoriasis and Crohn’s disease. In 3 cases the ID preceded the
EDS (first symptom of narcolepsy), and in 1 cases both EDS and ID appeared simultaneously. No significant differences were
found between narcoleptic patients with or without ID regarding the age at onset of narcolepsy symptoms, except for cataplexy. Cataplexy was shown to be significantly more severe on patients with ID rather than without it.
Conclusions
No studies so far have reported an association between NC and other non-neurological IDs. In this series of HLA- DQB1*06:02
positive patients with NC, the prevalence of IDs was high (6.6%). This suggests that the disease might arise on a background
of generalized susceptibility to immunopathology. The significantly more severe cataplexy in the groups with IDs supports
the hypothesis that a higher genetic load could modulate the symptoms expression.
205
P-100 NARCOLEPSY AND GENETIC MARKERS
E. Fernández-Fernández1 , F. J. Martínez1 , S. Sánchez-Ramón1 , J. Matias-Guiu1 , M. Fernandez-Arquero1 1) Hospital Clínico San Carlos
Introduction
Narcolepsy is a rare chronic sleep disorder a characterized by excessive daytime sleepiness and cataplexy. These symptoms are
due to a selective destruction of hypocretin-producing neurons. It is considered an autoimmune mediated disease, as it is associated with HLA-DQB1*06:02 (83-98%).Several studies suggests an important contribuition of environmental factors. Upper
airway infections have been discussed to be the autoimmune origin and to be triggered by S.pyogenes and Influenza A H1N1
infection, and H1N1 vaccination. A possible mechanism involves cross-reactivity of H1N1-T cell and hypocretin-producing cells
presented via HLA-DQB1*06:02. A specfic epitope (pHA1275-287) of H1N1 hematoglutinin 1 protein has been reported as a
possible trigger for this cross-reactivty since two hypocretin antigenic epitopes are similar to the 2009 H1N1 strain.
Objectives
In this study, we aimed to study the innate immunity, focusing in two goals: define the whole HLA haplotype, newly focusing
in HLA class I; and the analysis of NK cells KIR receptor genes as a possible new target in Narcolepsy. This approach could help
to understand the molecular mechanism and a possible impplication of cell-mediated cytotoxicity.
A total of 82 Caucasian individuals were included in the study. The diagnosis criteria included the presence of EDS≥ 3 months, cataplexy and DQB1*0602 gentics.All samples were genotyped for HLA class I (A, B, C). The KIR genotype analysis informs the presence or absence of the different KIR genes. Two KIR haplotypes have been established depending on the gene
content. The A haplotype known as inhibitory and the B haplotype the activator.The statistical analysis compares allelic and
genotypic frequencies using SPSS software v. 15.0 (Chicago, IL, USA). No statistically significant deviations from Hardy–Weinberg equilibrium were observed. Distributions were performed using χ2 test or Fisher’s exact test. Odds ratios (ORs) were
calculated and their 95% confidence intervals (CIs) were estimated using the Cornfield method.
Results
The most relevant HLA class I alleles found to be statistically significant for HLA class I loci were: A*1101 and A*2402; B*0801,
B*1302 and B*4001; and C*040101 and C*070101. The most prevalent haplotypes with the characteristic class II alleles of the
disease together with class I is: B*0801-C*0701/C*0702-DRB1*1501-DQA1*0102-DQB1*0602; B*1302-C*0602-DRB1*1501DQA1*0102-DQB1*0602.The individuals were classified as inhibitors (or activators, depending on the KIR gene content.
The activator haplotype (85% vs 68.9%) was statistically significantly associated in narcoleptic individuals versus controls,
showing an OR of 2.5.
Conclusions
In this study HLA class I alleles A*1101, A*2402, B*0801, B*1302, B*4001 and C*040101 are found to have a association with
narcolepsy. Second, there is a clear significative association to narcolepsy when the individual carries an activator haplotype
of KIR receptors.
206
P-101 KIR 3DL1/3DS1 IN BEHÇET’S DISEASE
A. L. Castaño Nuñez1 , M. A. Montes Cano1 , L. Ortiz Fernández2 , M. Conde Jaldon2 , Grupo Clínico Español para la Enfermedad
de Behçet3 , M. F. González Escribano1 1) Hospital Universitario Virgen del Rocio 2) Instituto de Biomedicina de Sevilla. Universidad de Sevilla 3) Hospitales: Virgen del
Rocio, San Cecilio, Clinic, Chu A Coruña, Valme, Marques de Valdecilla, Torrecardenas, Vall d’Hebron, Virgen del Camino, Universitari
Mutua Terrassa, Carlos Haya, La Princesa, IPB López Neyra
Introduction
Behcet\’s disease (BD) is a multifactorial disease associated with several HLA class I molecules with the Bw4 epitope. In addition to the antigen presenting function, some of these molecules act as ligands of the specific receptors of Natural Killer
(NK) cells, Killer cell immunoglobulin (Ig)-like receptors (KIRs). The KIR gene family currently consists of 15 gene loci and two
pseudogenes and each individual has a particular set of KIR genes. The KIR molecules can have long (KIR2DL/3DL) or short
(KIR2DS/3DS) cytoplasmic tails generating inhibitory or activator signals respectively. Different surface expression levels
(from none to high) have been described for the KIR3DL1 alleles. KIR3DL1/3DS1 recognizes Bw4. KIRs regulate the response
of NK cells through recognition of HLA class I molecules, therefore the relationship ligand/receptor could be involved in the
ethiopatogenesis of BD trough the NK control.
Objective
Analyse whether the relationship ligand/receptor of the pair Bw4 KIR3DL1/3DS1 is associated with BD.
The KIR gene sets were determined in 241 patients and 134 controls by PCR-SSOP (Luminex). KIR3DL1/3DL1 and KIR3DL1/3DS1 individuals were genotyped in the rs149123986 (A/G) by real-time PCR (Taqman probes). Individuals bearing G
have a “null expression-surface allele”. Patients and controls were stratified in “I” (individuals KIR3DL1/3DL1 and KIR3DL1/3DS1 rs149123986AA and KIR3DL1/3DL1 rs149123986AG) and NoI (individuals 3DL1/3DL1 rs149123986GG, 3DL1/3DS1
rs149123986AG and 3DS1/3DS1). The group has been previously genotyping in HLA class I, and patients and controls were
stratified also according to the presence of Bw4. Distributions were compared using the chi-square test. The p-values ≤0.05
were considered statistically significant.
Results
The frequency I was slightly higher in the patient group than in controls (83.8 % vs.78.3 %). In addition, when analysed according to the presence of the ligand, the results were similar in the group Bw4+ (83.6% vs. 79.6%), as in group Bw4- (85.7% vs.
74.2%). Although the results do not reach statistical significance probably because of the small size of the cohort analyzed
Conclusions
Our results do not rule out association between the surface expression of KIR3DL1 and Behcet\’s disease
207
P-102 ROLE OF HLA-B ANTIGENS IN CONFERRING PROTECTION AGAINST PROGRESSION FROM LATENT INFECTION TO
ACTIVE PULMONARY TUBERCULOSIS
F. N. Jurado Uribe1 , F. Ausín Ortega1 , J. L. Arroyo2 , R. Agüero Balbín1 , M. C. Fariñas Álvarez1 , J. G. Ocejo-Vinyals1 1) Hospital Universitario Marqués de Valdecilla 2) Banco Regional de Sangre y Tejidos
Introduction
Tuberculosis (TB) is one of the world’s most important infectious causes of death worldwide. Approximately 90%–95% of
individuals infected with Mycobacterium tuberculosis (Mtb) are able to mount an immune response that halts the progression from latent TB infection (LTBI) to active TB disease. HLA seems to be one of the factors involved in this susceptibility or
resistance to the progression to an active disease.
There are several studies about the distribution of HLA-B antigens in patients with pulmonary tuberculosis (PTB) in different populations with controversial results. However, practically no study has previously considered latent tuberculosis infected individuals (LTBI).
Objectives
Our aim was to study the HLA-B antigen distribution in a well conserved population from Northern Spain (healthy controls, patients
with PTB and subjects with LTBI) to find out if one or more HLA-B antigens could be involved in the progression to an active disease.
We evaluated the distribution of the HLA-B antigens in 160 patients with PTB, 109 LTBI subjects and in 268 healthy individuals.
The HLA-B typing was performed by PCR-SSO (xMAP technology-Luminex) using the LIFECODES HLA-B SSO TYPING KIT.
Results
We found significant differences in the distribution of several HLA-B antigens among the three groups (table 1).
HLA-B*
Allele
07
CONTROLS
n = 524
n (%)
57 (10.88)
PTB
n = 318
n (%)
14 (4.40)
P
0,0016
OR
0,38
CI 95%
0,21-0,69
08
14
40
44
CONTROLS
n = 524
30 (5,73)
31 (5,92)
18 (3,44)
104 (19,85)
LTBI
n = 218
22 (10,09)
31 (14,22)
16 (7,34)
59 (27,06)
LTBI vs CONTROLS
0,049
0,0003
0,03
0,037
1,85
2,64
2,23
1,5
1,04-3,28
1,56-4,46
1,12-4,42
1,04-2,17
07
08
14
15
18
27
35
40
44
LTBI
n = 218
32 (14.68)
22 (10,09)
31 (14,22)
23 (10,55)
14 (6,42)
15 (6,88)
28 (12,84)
16 (7,34)
59 (27,06)
PTB
n = 318
14 (4.40)
9 (2,83)
14 (4,40)
16 (5,03)
8 (2,52)
9 (2,83)
22 (6,92)
8 (2,52)
49 (15,41)
PTB vs LTBI
0,0001
0,0008
0,0001
0,025
0,043
0,044
0,03
0,015
0,0014
0,27
0,26
0,28
0,45
0,38
0,39
0,50
0,33
0,49
0,14-0,51
0,12-0,58
0,14-0,54
0,23-0,87
0,15-0,91
0,17-0,92
0,28-0,91
0,14-0,78
0,32-0,75
PTB vs CONTROLS
Table 1. Distribution of HLA-B antigens in healthy controls, individuals with LTBI and patients with PTB and comparisons
among the three groups.
208
Conclusions
There are significant differences in the distribution of HLA-B antigens among the three groups.
B*07 is significant more frequent in controls and LTBI individuals compared to PTB. Moreover, when we compared healthy
controls with LTBI individuals, we found that HLA-B*08, *14, *40 and *44 were significant more frequent in the LTBI group.
Furthermore, when we compared individuals with LTBI and patients with PTB we found that not only B*07 but B*08, *14, *44
and others were more frequent in the LTBI group.
All this findings would support a role of these antigens in conferring protection against progression to an active disease.
209
P-103 SUBLINGUAL POLYVALENT BACTERIAL VACCINE IN THE PREVENTION OF INFECTIOUS COMPLICATIONS IN
COMUN VARIABLE IMMUNODEFICIENCY
M. Núñez-Beltrán1 , J. Ochoa Grullón 1 , K. Llano Hernandez1 , E. Rodríguez de Frias1 , M. A. Rodríguez Peña1 , M. FernándezArquero1 , S. Sánchez-Ramón1 1) Hospital Clínico San Carlos, Madrid
Introduction
Common variable immunodeficiency (CVID) is the most common symptomatic primary immunodeficiency with an estimated incidence ranging between 1:10,000 and 1:50,000. Clinical onset is characterized by recurrent bacterial infections,
inflammatory and autoimmune diseases, and an increased incidence of cancer and lymphoma. Recurrent upper and lower
respiratory tract infections (RRTI) (sinusitis and otitis, pharyngoamygdalitis, bronchitis, pneumonia) and less frequently recurrent urine tract infections (RUTI) are mainly controlled by substitutive therapy with polyclonal gammaglobuline. Still, a
group of patients present with recurrent RRTIs and RUTI despite adequate trough IgG levels. Antibiotic prophylaxis is sometimes not enough and has other medical concerns.
Objectives
Our main goal was to determine, in a cohort of CVID patients with RRTI and RUTI despite normal trough serum IgG levels, the
effects of mucosal polybacterial vaccines on infectious clinical manifestations.
A retrospective observational study in a cohort of CVID patients with RRTI or RUTI who underwent mucosal polybacterial
vaccine was evaluated. We administrated sublingual immunization with polyvalent bacterial vaccine (15% Staphylococcus
Aureus, 15% Staphylococcus epidermidis, 60% Streptococcus pneumoniae, 4% Klebsiella pneumoniae, 3% Haemophilus
influenza, 3% Moraxella catarrhalis in RRTI patients and 25% Enterococcus faecalis; 25% Escherichia Coli; 25% Klebsiella
pneumonia; 25% Proteus vulgaris in RUTI patients; Bactek, Inmunotek S.L., Madrid).
Results
Eight CVID patients (mean age 45 ± 17; 8 women) with mean serum IgG of 813 ± 325 mg/dl were treated with 3-months
sublingual vaccine. 4 out of 8 CVID patients had bronchiectasis. After 6-months of starting the vaccine, a decrease in the
frequency of RRTI and RUTI was observed (from 3 to 6 episodes at baseline towards 0 to 2 episodes at 6 months) (Table 1).
Patients described a decrease in the severity and duration of infection. Besides, a concomitant improvement of quality of life
(SF-36) was shown.
Conclusions
There is an urgent need to develop alternative strategies to prevent the overuse of antibiotics in what is called the post-antibiotic era. Sublingual polyvalent bacterial vaccine helped CVID patients to control recurrent infections with concomitant
improvement in their quality of life.
210
P-104 FULMINANT FATAL PYOGENIC BACTERIAL INFECTIONS IN ROMANI PATIENTS DUE TO A FOUNDER EFFECT
LEADING TO MYD88 DEFICIENCY
Á. Molina Fuentes1 , J. L. Santos2 , M. D. L. R. Jiménez1 , V. Cunill1 , M. López Rodríguez3 , M. T. Martínez Saavedra3 , J. Aróstegui4 ,
N. Martínez Pomar1 , C. Rodríguez Gallego1 1) Hospital Universitari Son Espases, Palma de Mallorca 2) Hospital Virgen de las Nieves, Granada 3) Hospital Universitario de Gran
Canaria Dr. Negrín. Las Palmas de Gran Canaria 4) Hospital Clinic, Barcelona
Introduction
MYD88 and IRAK-4 are key components for Toll-like receptors (TLRs), except TLR3, and interleukin-1 receptors (IL-1Rs) mediated immune responses. MyD88- and IRAK-4-deficient patients suffer from invasive and non-invasive infections by a narrow
range of bacteria, particularly by S. pneumoniae and, to a lesser extent, S. aureus and P-aeruginosa. Infections are life-threatening and may be difficult to diagnose due to the low or delayed clinical and biological inflammatory signs. Twenty-five
MyD88-deficient patients have been reported so far.
Objectives
We investigated five children (P1-P5) of Romani ethnicity from Granada who died due to invasive infections by capsulated
bacteria.
Coding exons and adjacent intronic region of MYD88 were amplified by PCR followed by bi-directional Sanger Sequencing
using specific primers.
Results
The index patient (P1) was a 7 months-old male who died from a fulminant meningitis by S. pneumoniae. DNA was sent
for analysis and homozygousity for a mutation in MYD88 (160del3, p.E52del) was observed. We had previously described
MYD88 deficiency due to E52del homozygosity in five patients from two Spanish Kindred of Romani ancestry. A second
Romani patient (P2) who had suffered from acute perforated appendicitis by P. aeruginosa at the age of 5 months and who
had died from fulminant pneumococcal meningitis at the age of 10 months was then sent for analysis. He was also shown
to be homozygous for MYD88 p.E52del. Shorthly thereafter, three other Romani patients from Granada were studied. P3 and
P4 (brothers) had died from meningitis by P. aeruginosa and Septic Shock with multiorganic failure due to S. dysgalactiae
equisimilis infection at the ages of 1 year and 6 months respectively. P5 died after necrotizing fasciitis surgery due to septic
shock by P. aeruginosa at the age of 3 years and 10 months. P3, P4 and P5 also presented with low-grade fever and low or
delayed clinical and biological inflammatory responses in the course of infectious episodes. The parents of P1, P2, P3 and P4
were heterozygous for p.E52del. DNAs from biopsies from P3, P4 and P5 are being currently analyzed for p.E52del in MYD88. Conclusions
In the absence of diagnosis, MYD88 deficiency is frequently fatal in childhood. Due to the high mortality rates, prompt diagnosis is decisive to initiate prophylactic gammaglobulin, antibiotic and vaccination. Homozygousity for E52del in MYD88 is by far
the commonest cause of MYD88 deficiency, and all the patients homozygous for this mutation are of Romani ancestry. Taken
together, data suggest a founder effect leading to MYD88 deficiency in Romani people. Analysis of DNA from E52del homozygous individuals from France, Portugal, Kosovo, Italy, Barcelona and Granada is in progress in order to estimate the most recent
common ancestor of these patients. Clinical suspicion as well as diagnostic procedures and treatment will be discussed.
FIS 013/01456
211
P-105 MOLECULAR DIAGNOSIS OF ATAXIA-TELANGIECTASIA IN A PATIENT
F. Mora López1 , R. de la Varga Martínez1 , R. Marín Iglesias1 , C. Rodríguez Hernández1 1) Hospital Universitario Puerta del Mar, Cádiz.
Introduction
Ataxia-telangiectasia (A-T) is an autosomal recessive disorder (MIM#208900) with a frequency of 3 per 106 live births. It is a
pleiotropic disease characterized by progressive ataxia due to cortical cerebellar degeneration, variable degree of immunodeficiency that predisposes to sinopulmonary infections, and increased risk of developing cancer. Patients with A-T also show
oculocutaneous telangiectasia, oculomotor apraxia, difficulty swallowing, hypersensitivity to ionizing radiation, chromosomal
instability and high serum α-fetoprotein (AFP) concentrations.
The clinical diagnosis of A-T is relatively easy when the characteristic neurodegenaration and telangiectasia are both present.
But the diagnosis is often difficult to make in young children before the development of telangiectasia and in those children
with mild or atypical phenotypes. Serum levels of AFP are useful but difficult to interpret in patients younger than age 2 years.
Molecular testing can be used to confirm suspected cases of A-T and also allows genetic counseling and prenatal diagnosis.
Objectives
To confirm the diagnosis of Ataxia-Telangiectasia in a two years old patient with ataxia.
SNP-based array (HD Cytoscan, Affimetrix).
Sequencing of the coding region of the ATM gene in cDNA.
Sequencing in genomic DNA of the affected exon.
Multiplex ligation-dependent probe amplification (MLPA).
Determination of serum AFP concentration and antibodies levels.
Flow cytometric characterization of lymphocyte subpopulations.
Results
SNP-based array detected a run of homozygosity of 10 Kbp in 11q22, informed as a Variant of Unknown Significance. The run
of homozygosity affects more than 40 genes including the ATM gene, this raised the suspicion of A-T.
Serum AFP elevated: 57.7 ng/mL (normal range 0 - 13.6 ng/mL)Ig levels: selective deficit of IgA.
Immunophenotyping: alterations in lymphocyte subpopulations.
Sequencing of the coding region of ATM in cDNA detected a frameshift indel mutation (c.3435_3436delGTinsA, p.Asp1145Glufs*10). This mutation has not been previously described. MLPA and sequencing of genomic DNA of the patient´s
parents confirmed homozygosity (and discarded a deletion in 11q22). Homozygosity for the detected mutation confirmed
the diagnosis of A-T in the patient.
Conclusions
Molecular testing of A-T is problematic due to the very large coding sequence of the ATM gene, with 9168 nucleotides and
more than 60 exons. Sequencing of genomic DNA of all exons of the gene is the more sensitive and reliable method but it
is labor intensive and time consuming. Direct sequencing of the coding region of the ATM gene in cDNA is a more efficient
approach for detecting most mutations. MLPA is often required, as some 10% of reported ATM mutations are large genomic
deletions or duplications. Other molecular tests, as SNP-based arrays or CGH arrays can be useful. AFP and immunoglobulin
levels and characterization of lymphocyte subsets by flow cytometry are recommended.
212
P-106 T AND B LYMPHOCYTES IMMUNOPHENOTIC ANALYSIS IN PATIENTS WITH IMMUNODEFICIENCY COMMON VARIABLE AND ISOLATED IGG SUBCLASS DEFICIENCY
J. M. Lucena Soto1 , S. Cano Gómez1 , J. Palomina Nicas1 , B. Sánchez Sánchez1 1) Hospital Universitario Virgen del Rocío
Introduction
Common variable immunodeficiency disorders (CVID) are a group of heterogeneous conditions that have in common primary
failure of B cell function; however, T cell abnormalities have been described, including a decreased T cell count to expense of
T CD4+ lymphocytes, with activated immunophenotype, and decreased naïve T cells, due to a low amount of recent thymic
emigrants (TRECs) and a high rate of apoptosis. Isolated IgG subclass deficiency (iIgGD) is another humoral primary immunodeficiency, usually asymptomatic, although sometimes with an aggressive clinical course or course, ending with a CVID. In these
cases it is necessary to look for markers that may help predict the future development of the disease. In this sense, few studies
have analyzed the immunophenotypic characteristics of B lymphocyte subpopulations and, above all, T cells.
Objective
To verify if in our cohort with CVID, iIgGD patients and healthy controls there are differences in B and T lymphocyte subpopulations.
25 CVID patients, 39 iIgGD patients and 33 healthy controls were recruited. T lymphocyte subpopulations analyzed were:
Naïve, memory, activated phenotype in both Th and Tc, Tregs, TRECs and double negative. B lymphocyte subpopulations
analyzed were: naïve, memory, transitional, CD21low and B1.
Results
CVID patients show B1 cells, naïve T (both Th and Tc) and TRECs percentages decreased and central and activated memory
T cells (both Th and Tc) percentages elevated. However, these differences are only observed in the CVID subgroup with profound hipogammaglobulinemia and a very low number of switched memory B lymphocytes, while in other CVID and iIgGD
patients, T and B subpopulation are normal.
Conclusions
Alterations in T lymphocytes subpopulations were observed only in patients with CVID and decreased levels of all immunoglobulin isotypes, suggesting that genetic defects affect both pathways, humoral and cellular. In contrast, patients with
iIgGD and CVID with slightly decreased immunoglobin levels, suggest specific humoral pathway defects.
213
P-107 WOMEN WITH HLH CARRY GENETIC VARIANTS AFFECTING PROTEIN EXPRESSION IN X-LINKED BIRC4 AND
SH2D1A GENES
L. Martín-Martín1 , M. Alonso-Martínez 1 , I. Toribio-Pascual 1 , S. García-Obregón 2 , I. Astigarraga 2 , E. Fernández-Cruz 1 ,
J. Gil-Herrera1 1) Hospital General Universitario Gregorio Marañón, Madrid 2) Hospital Universitario de Cruces
Introduction/Objectives
Defective X-linked inhibitor of apoptosis (XIAP) and SLAM-associated protein (SAP) can cause hemophagocytic lymphohistiocytosis (HLH) in male patients. Recent reports show female patients diagnosed of HLH as well as with incomplete forms of
the disease carrying heterozygous mutated BIRC4 (XIAP) or SH2D1A (SAP) genotypes. We aimed to analyse this two X-linked
genes in women with late-onset HLH.
8 women from 13 to 56 years-old fulfilling HLH diagnosis were studied. Coding exons and exon-intron boundaries of XIAP/
BIRC4 and SH2D1A genes were amplified and directly sequenced. Single nucleotide variation (SNP) identification, position
in the coding sequence and allele/genotype frequencies data were obtained from dbSNP database and Ensembl project. In
silico tools SIFT and POLYPHEN-2 were used.
Results
We found the SNP rs5956583 (c.1268A>C; Q423P) is 5/8 patients; 2 homozygous and 3 heterozygous for this nonsynonymous polymorphism located in XIAP/BIRC4 gene. Allele frequency for C nucleotide is 0,325 and female frequencies for A/A,
A/C and C/C genotypes are 0,24, 0,21 and 0,07, respectively. Q423P is located close to the UBA domain of XIAP and predicted
to be a tolerated change. Genetic analysis of SH2D1A revealed the SNP rs12164382 (c-346C>T) in 6/7 the female patients
tested; 2 homozygous and 4 heterozygous for this polymorphism. Allele frequency for T nucleotide is 0,51 and female frequencies for C/C, C/T and T/T are 0,125, 0,26 and 0,13 respectively. This position is a methylation site located in the 5’ UTR
region of SH2D1A.
Conclusion
Higher frequencies of Q423P in XIAP and c-346C>T in SH2D1A are found in adult female HLH patients when compared to
healthy populations. P423 variant is associated with decreased XIAP protein and mRNA expression and higher caspase-9 activation. c-346T polymorphism in SH2D1A causes a loss of this methylation site and increases SAP protein expression. Further
studies are needed to clarify the contribution of such genetic variants to the background predisposing to HLH development.
Finantial Support: FIS PI12/02761
214
P-108 A PATIENT WITH COMMON VARIABLE IMMUNODEFICIENCY AND EVANS SYNDROME
V. Cunill 1 , C. Barceló1 , V. Andreu1 , M. D. L. R. Jiménez1 , Á. Molina-Fuentes1 , A. Gutiérrez1 , M. García1 , N. Martínez-Pomar1 ,
J. Iglesias1 , J. M. Ferrer Balaguer1 , J. Milà1 , J. Pons de Ves1 1) Hospital Universitario Son Espases, Palma de Mallorca, España
Introduction
Common Variable Immunodeficiency (CVID) is the most common symptomatic primary immune deficiency characterized
by hypogammaglobulinemia and defective response to vaccination. CVID patients suffer from recurrent respiratory and gastrointestinal infections. Autoimmune and inflammatory or lymphoproliferative disorders may also be present.
Hematological disorders like autoimmune hemolytic anemia (AIHA), idiopathic thrombocytopenic purpura (ITP) or autoimmune neutropenia are the most common autoimmune disorders, present in up to 30% of patients. A high percentage of
them develop an autoimmune cytopenia before the diagnosis of CVID. Evans syndrome (ES) is the simultaneous development of AIHA and ITP and is associated with autoimmune and lymphoproliferative diseases or primary immunodeficiencies.
Objective
We aimed to describe the clinical and immunological features of a patient with common variable immunodeficiency and ES.
Patient and Methods
A 65-years-old male was diagnosed with CVID and treated with intravenous immunoglobulin. He suffered from a mild thrombocytopenia (78200 cells/µl) and neutropenia (1.15*103 cells/µl) and was admitted to our hospital with severe autoimmune
hemolytic anemia (RBC count 1.9 x 106/µL and hemoglobin 7.12g/dl).
Physical examination and computer tomography studies showed polyadenopathies and splenomegaly, which suggested an
underlying condition responsible for the cytopenias. The patient responded to corticosteroids, was hemodynamically stable,
had no bleeding and remained afebrile.
T cell subpopulations, regulatory T cells (Treg), CD21, CD38 and the European consensus classification for CVID (EUROclass: (i) CVID
patients with ≤2% of IgD–CD27+ (switched memory phenotype) B-cells or smB-; and (ii) patients with >2% of IgD–CD27+ B-cells
or smB+) were determined by flow cytometry. The mutation analysis of TNFRSF13B was performed by Sanger sequencing.
Results
The total amount of CD19+ B cells was within the normal range (6%). The patient had less than 1% of IgD–CD27+ (switched
memory phenotype) B cells, 7% IgD+CD27+ (non-switched memory phenotype) B cells, 91% of IgD+ CD27- (naïve) B cells
and was classified as Smb- CVID. A 20% of CD21 low B cells and a 5% of CD38- CD21 low B cells was also observed.
Percentages of CD3 (74%), CD4 (51%) and CD8 (23%) T cells were normal but a mild CD4 T lymphopenia was observed (449
cels/µl). The evaluation of CD4+CD25+CD127- cells revealed a low percentage of Treg lymphocytes (less than 1% of CD4+ cells).
No TACI mutations or variants were found.
Conclusions
We report a patient with CVID and ES treated with monthly infusions of gammaglobulin and corticosteroids. Corticosteroids
are the mainstay treatment of ITP and AIHA although splenectomy and/or rituximab are effective options for more severe
autoimmune cytpenias. Since the presence of lymphoma could underlie cytopenias and CVID patients have a high risk of
lymphoma, this diagnosis should be discarded in our patient.
215
P-109 A COMPLEX COMBINED IMMUNODEFICIENCY WITH CMC AND AUTOIMMUNITY IN A GOF-STAT1 PATIENT
M. Lozano Rabella1 , N. Benítez1 , M. Rubiales1 , I. Badell1 , L. Martínez-Martínez1 , O. de La Calle-Martin1 1) Hospital de la Santa Creu i Sant Pau
Introduction
Chronic mucocutaneous candidiadis (CMC) is characterized by recurrent or persistent infections of the nails, skin and mucous
membranes with Candida sp. This disease is related to impaired IL-17 immunity. Several genetic defects have been associated
to CMC, STAT1 mutations being the most frequent. These mutations resulted in a gain of function (GOF) due to an increased
phosphorylation that induces higher responses to IFNg which causes a Th17 impairment, preventing fungi clearance.
Objectives
The aim of the study was to identify the molecular and genetic defects responsible for a complex combined immunodeficiency with CMC and autoimmunity in a long-term patient.
We present a 31 year-old man who has suffered from recurrent candidiasis since early childhood with several complications
like esophageal stenosis. During his late childhood he also suffered from recurrent respiratory infections that finally conducted to a lung lobe resection. Later on, he developed a severe haemolytic anaemia and diabetes mellitus type I. Due to the
refractority and the autoimmune origin of the anemia, Rituximab was administered. However, several complications were
accompanied by such as: pulmonary tuberculosis, cryptococcal meningitis and an aggressive inflammatory bowel disease. He also developed a progressive lymphopenia and hypogammaglobulinemia, so a hematopoetical transplantation was
performed. Although the early results were encouraging, the implant was lost, and the patient has progressively developed
a profound T and B lymphopenia with no Ig production. Th17 were determined by flow cytometry. AIRE, IL17F, RORgT and
STAT1 were sequenced. STAT1 and P-STAT1 were analysed by western blot. Dynamic of dephosphorylation of STAT1 was studied by flow cytometry using IFNg stimuli combined with the tyrosine-kinase inhibitor staurosporine.
Results
Th17 cells were absent in the patient. Genetic analysis showed a de novo heterozygous mutation in the exon 14 of STAT1 (c.
1154C>T) corresponding to the DNA binding domain, that led to the replacement of tyrosine 385 for a methionine (p.T385M).
This mutation had been previously reported. WB analysis showed not only an increased STAT1 phosphorylation in response
to IFNg stimuli, but also a higher amount of total STAT1. Dynamic analysis showed a prolonged P-STAT1 expression over time,
indicating an impaired STAT1 dephosphorylation.
Conclusions
Our patient presented a de novo mutation in STAT1 (p.T385M). The analysis corroborated that p.T385M is a GOF mutation. It
had been previously associated with CMC, and the analysis of the literature suggested that this mutation has a high penetrance and severity. Most of the reported patients presented with a severe symptomatology, profound immunodeficiency,
and in some cases autoimmunity was present.
216
P-110 IMMUNOLOGICAL ASSESMENT IN KABUKI SYNDROME
L. Y. Bravo Gallego1 , A. Ferreira Cerdán1 , F. Santos Simarro1 , S. García Miñaur de La Rica1 , T. del Rosal Rabes 1 , A. Méndez
Echevarría1 , E. López Granado1 , R. Rodríguez Pena1 1) Hospital Universitario La Paz, Madrid
Introduction
Kabuki syndrome (KS) is a complex multisystem developmental disorder associated with mutation of genes encoding histone-modifying proteins (autosomal dominant KMT2D mutations and X-linked KDM6A mutations). In addition to craniofacial, intellectual, and cardiac defects, KS is also characterized by immune dysfunction (humoral deficiency and autoimmune disease).
Objective
Our aim was to characterize humoral and cellular defects found in patients with KS.
Patients with a clinical diagnosis of KS by a board-certified clinical geneticist were included in a retrospective study. We
reviewed the medical records and did immunological laboratory evaluations (immunoglobulin levels, postvaccination serology, lymphocyte subpopulation data, and mitogen-induced lymphocyte proliferation studies).
Results
Five cases were identified. Children at immune evaluation were aged from two to fourteen years. All had Kabuki faces,
mild-to-moderate intellectual disability and skeletal anomalies. Other structural defects were present: congenital heart disease (3/5), short stature (3/5), urogenital anomalies (3/5) and anorectal malformations (2/5). Recurrent otitis media (4/5) and
hearing impairment (2/5) were also common features.
All but one patient had KMT2D mutations.
Immunologic analysis revealed that all patients had lower naïve emigrant lymphocytes (CD4+CD31+CD45Ra), and lower
memory CD8+ T-cell percentages and counts (3/5).
One patient had low serum IgG and IgA levels. Another patient had panhypoglobulinema, undetectable anti-Tetanus toxoid
and anti-Diphtheria toxin antibodies with lower class-switched memory B cells (CD19+CD27+IgM-IgD-), but he had been
received anti-CD20 (rituximab) antibody therapy one month before analysis and had a normal serum immunoglobulin levels
before therapy. He is currently treating with intravenous immunoglobulin every three weeks.
Two of our patients had a history of autoimmune disease (immune thrombocytopenic purpura and autoimmune hepatitis).
Lymphocyte proliferation function was all normal.
Conclusions
Antibody deficiency, disturbed memory cell development and anomalies in the naïve emigrant lymphocytes could increase
susceptibility to infections in KS patients. All patients with Kabuki syndrome should undergo serial clinical immune evaluations. 39 Congreso de la Sociedad Española de Inmunología
217
P-111 NEXT GENERATION SEQUENCING OF PID: BOTH SIDES OF NEW GENETIC DIAGNOSIS APPROACHES
M. Bravo García-Morato1 , E. Vallespín García2 , Á. del Pozo Maté2 , K. Ibáñez Garikano2 , J. C. Silla Castro2 , J. Molina Garicano3 ,
L. Y. Bravo Gallego1 , A. Ferreira Cerdán1 , E. López Granados1 , R. Rodríguez Pena1 1) Hospital Universitario La Paz 2) Hospital Universitario La Paz 3) Complejo Hospitalario de Navarra
Introduction
Next generation sequencing (NGS) has marked a before and an after in the way genetic diseases are diagnosed. This methodology allows to sequence from a restricted group of genes or panel to the whole genome of an individual. In our experience, panels of genes can be a very useful tool for Primary immunodeficiencies (PID) genetic diagnosis, although they don’t
always lead to a direct conclusive result. In many cases, large amounts of work are generated to determine whether DNA
changes are pathogenic or not and, in some of them, despite the effort, a final diagnosis can’t just be made.
Objectives
To show four cases which exemplify the reality of working with a panel of PID genes.
NGS was performed using a 422 genes-customized panel of our own design (Roche Nimblegen technology, MiSeq system.
More information detailed in a poster).
Results
Panel 1 belongs to a male with a deep T lymphopenia, undetectable serum immunoglobulin levels and low in vitro proliferative responses to mitogens. Two described mutations in IL7R gene were found, leading immediately to the diagnosis of
severe combined immunodeficiency.
Panel 2 belongs to a consanguineous male with a selective T lymphopenia, hypogammaglobulinemia and absent in vitro
proliferative responses to mitogens, except to PHA. An homozygous splicing non-described mutation in ZAP70 gene was
detected. According to the clinical and immunological features, this change has the category of “likely pathogenic” but as it
has not been described before, RT-PCR should be performed to confirm the diagnosis.
Panel 3 belongs to a female with low IgG and IgM levels, recurrent respiratory infections, dermatitis and autoimmune features as hypothyroidism, atrophic gastritis, diabetes mellitus and alopecia areata. Non-described changes were found in LRBA,
STAT-2 or NFKB1 genes, all considered “variations of uncertain significance” according to the clinical data of the patient. Flow
cytometry and RT-PCR should be perfomed to check whether any of these variations are disease-causing.
Panel 4 belongs to a male with B and T CD4+ lymphopenia, agammaglobulinemia, low in vitro proliferative response to
mitogens, recurrent respiratory and gastrointestinal infections and a poor control of viral infections as herpes virus and Molluscum contagiosum ones. Of the amount of variations detected by the NGS panel, none of them can explain the phenotype.
Conclusions
NGS is an useful tool for genetic diagnosis of PID, allowing the identification of mutations in PID-related uncommon genes
that wouldn’t probably be located otherwise. Results require careful validation when non-described variations are found.
There are cases in which pathogenic mutations can be supported by other assays but there are others in which none of the
variations seems to be associated with the clinical and immunological phenotype. For a proper use and interpretation, NGS
of PID should be performed and analysed by immunologists who have received specific formation to manage this complex
methodology, in centres with experience in the clinical, immunological and genetic bases of PID.
218
P-112 PROMOTING THE AWARENESS OF PID AMONG THE MEDICAL PROFEISIONAL IN A TERTIARY HOSPITAL
A. M. Bielsa Masdeu1 , A. Cánovas Fernández1 , J. J. Alonso Alonso1 , M. V. Egurbide Arberas1 , V. Cabriada Nuño1 , S. Castro
Quintas1 , O. Merino Ochoa1 , G. Barreiro Garcia1 , M. Argueta Valdez1 , M. J. Blanco Vidal1 , N. Diez Herrán1 , L. Guío Carrión1 1) Hospital Universitario de Cruces, Bilbao
Introduction
Several primary immunodeficiencies may have their initial presentation in adulthood. The use of six clinical “warning signs”
has been suggested as a screening tool to identify patients that may have primary immunodeficiency (PID) conditions in
adulthood. Primary immunodeficiencies (PI) are defects of the immune system that cause severe, sometimes life-threatening, infections if not diagnosed and treated appropriately. Many patients with PID are undiagnosed, under-diagnosed, or
misdiagnosed. To raise awareness and assure earliest diagnosis, appropriate treatment, and proper care management, we
implemented a awareness program beginning in 2014.
Objetives
Identify patients with PID in patients with “warning signs” or with antibody deficiencies between the admitted in the services of risk at the University Hospital of Cruces and increase the awareness of PIDs among doctors working in the hospital.
The study was conducted between April 2014 and April 2015, with the participation of the Service of Pneumology, Infectious
Diseases, Neurology, Internal Medicine, Gastroenterology and Intensive Care, including patients with “warging signs” and
without secondary immunodeficiency or with antibody deficiency. Previously a talk was given to each service. It has led to
patients through consultation sheet to Internal Medicine - study PID. After determining with the medical record if the suspicion is confirmed, there have been relevant analytical studies based on the type of infection.
Results
We evaluated 43 patients (24 women and 19 men) between 15 and 84 years, 15 inpatients and 28 outpatients, from 6 services listed plus Dermatology, with the participation of 24 physicians. Most came of Gastroenterology and Pneumology. The
main reason has been the recurrent infections. Relevant diagnostic were2 CVID (common variable immunodeficiency), 1
CVID with deficit C2 associated, 1 antibody deficiency associated to CD4 lymphopenia and 14 other antibody deficiencies,
having started in 7 of them IVIG therapy. Prior to starting the program there were in Internal Medicine 18 PID patients on
replacement therapy, in one year performance there were indicated immunoglobulins in 7 more patients, representing an
increase of 28%.
Conclusions
The action here aims to increase the awareness of PIDs among doctors working in different fields. Prompt identification of
PID is important for prognosis. The simple act done in our hospital increased considerably the number of patients diagnosed
with requirement of immunoglobulin replacement therapy.
219
P-113 NEXT GENERATION SEQUENCING OF PID: A CUSTOMIZED PANEL CONTAINING 422 GENES RELATED WITH THE
FUNCTION OF THE IMMUNE SYSTEM
M. Bravo García-Morato1 , E. Vallespín García1 , Á. del Pozo Maté1 , P. Lapunzina Badía1 , R. Rodríguez Pena1 , E. López Granados1 1) Hospital Universitario La Paz, Madrid
Introduction
Next generation sequencing (NGS) is a revolutionary methodology that allows from the simultaneous sequencing of a
pre-defined group of genes (panel of genes), to the combination of the coding sequences contained in the genome (Whole
Exome Sequencing, WES), or even the complete genome (Whole Genome Sequencing, WGS) of an individual. NGS has widely shown its utility for the diagnosis of primary immunodeficiencies (PID), and has boosted our capacity to discover new
disease-related genes. Gene panels can be a valuable and cost-effective tool in centres responsible for the diagnosis of a
large number of patients, with a wide spectrum of potential entities, including several in which prompt diagnosis is needed
for an assisted therapeutic decision for bone marrow trasplantation.
Objectives
To describe a customized NGS panel of a combined set of both, known and candidate genes designed, set up and validated
in our Molecular Immunology Laboratory and routinely used for PID diagnosis since August 2015.
NGS panel was performed using the SeqCap EZ technology (Roche Nimblegen). DNA libraries were made using the KAPA
Library Prep SECAP EZ Library SR v4.2. Samples were run on the MiSeq system (Illumina). Bioinformatics analyses were performed by the Bioinformatics Unit of the INGEMM (La Paz University Hospital), using the following tools: Bowtie2 v2.0.0;
picard-tools 1.27; samtools version.0.1.19-44428cd; GenomeAnalysisTK version 2.6-5; SnpEff 3.5e; dbNSFP version 2.7; bedtools v2.18.1; Human reference genome: hg19. Database: dbNSFP v.2.7; dbSNP v.137; ClinVar date 2010703.
Results
Up to date, our PID panel has been validated with 21 previously known mutations, including missense, nosense and splicing
mutations, small insertions and deletions and big deletions. All of them were technically detected, although two of the big
deletions did not pass the bioinformatics filtrates being considered as background noise. Among the patients studied using
this technology, mutations were found in different genes, as: IL7R, ZAP70, STAT-1, STAT-3, CTLA-4, ACP5, BTK, CASP10, NRAS,
TACI or NCF1. These DNA changes included missense, nonsense and splicing mutations and one big deletion. NGS results
have been confirmed by Sanger sequencing, with no false-positives.
The mean depth of targeted sequences varies between 100x and 600x. The untargeted sequences are almost the same in all
cases, mainly due to pseudogenes or other highly homologous regions in the genome, which difficult the capture. Conclusions
Our PID customized panel shows high levels of sensitivity and specificity and constitutes or initial approach to the genetic
diagnosis of the majority of patients in our hospital, with an elevated diagnosis rate. However, deletions comprising several
exons or whole genes may not be detected, so alternative assays should always be considered if suspicion persists despite
a negative result.
220
P-114 PATENTS COMPARISON BETWEEN SPAIN AND THE REST OF THE WORLD
E. Campos Jiménez1 , I. Espadas Garcia1 , A. Campos Ferrer1 1) Universidad Miguel Hernández
Introduction
The Patent Cooperation Treaty assists applicants in seeking patent protection internationally for their inventions and facilitates public access to a wealth of technical information. By filing one patent application under the Patent Cooperation Treaty,
Applicants can seek protection in 148 countries throughout the world. In recent years, a major concern of science and technology policies is to give commercial value to innovations.
Objectives
The study aims to see the differences between Spain and the rest of the world in patent applications and analyse the main
applicant companies.
Methods
The Patent documents applied via the Patent Cooperation Treaty in the area of Immunology from 2004 to 2015 were obtained through SCOPUS. The main quality indicators used were: countries, number of patents, researchers, applicants, sections
and classes of the International Patent Classification, economic sectors and the principal entities.
Results
Ninety five countries requested patents through the Patent Cooperation Treaty during the whole period. The total number
of patents was 24,396, 23,450 of which were requested by The Organisation for Economic Co-operation and Development,
7,279 by European Union, 273 by Spain. The United States of America submitted a total of 14,827 applications. A change
of pattern is happening since 2007, when applications reached a peak of 2,828, 31 of which were Spanish. The countries
that in recent years have maintained or increased patent applications despite the crisis are: China, Norway, Poland and
Taiwan. On the contrary, United Kingdom, Germany, Switzerland, Canada, Australia, Netherlands have reduced the number
of applications. We have observed differences between the kind of classes applied to patents in those 95 countries (mostly
A61, C07, C12, G01, A01, G06, A23, C40, B01, C08) and the ones in Spain (A61, C07, C12, G01, A01, A23, G06, C08). The classes
Elaborated Organic Products and Pharmaceutical Products are the ones that appear more often in the 96 countries studied,
while in Spain are Analysis of Biological Materials and Biotechnology. The number of patents applied by universities in these
96 countries was almost twice the number of the Spanish ones. The number of hospitals three times the number in Spain.
The number of patents generated by Spanish Public Research Organizations is more than twice the ones produced in the
Public Research Organizations in the other 95 countries. In the last three years, the entities that generate the largest number
of patents in the world were the Hoffmann la Roche, Genentech and the University of California. In Spain were the Almirall,
Consejo Superior de Investigaciones Científicas and Institució Catalana de Recerca i Estudis Avançats.
Conclusions
Spain takes the 16th position in the world patent applications. Spanish universities and hospitals apply less than the rest of
the world; however the Spanish Public Research Organizations applied more.
221
P-115 IMMUNOLOGY PATENT APPLICATIONS DURING THE CRISIS AND ITS SUBSEQUENT EVOLUTION
Introduction
The Patent Cooperation Treaty is an international patent law treaty that provides a unified procedure for filing patent applications to protect inventions in each of its contracting states. Nowadays, this treaty includes 148 countries, the majority of
them are industrialized
Objectives
The aim of this study is to analyse the collaborations between countries seeking patents and comparing them based population size, Gross national income, and Gross expenditure on Research, Development and Innovation.
Methods
The Patent documents applied via the Patent Cooperation Treaty in the area of Immunology from 2004 to 2015 were obtained through SCOPUS. The main quality indicators used were: The main collaborations between countries and the relationship between patents and Gross national income per capita and Research, Development and Innovation.
Results
Ninety-six countries requested patents through the Patent Cooperation Treaty during the whole period. The main collaborations between countries during 2012-15 were: United States-Switzerland (289 applications), United States-Germany (156),
United States-United Kingdom (111), Switzerland-Germany (110), United States-China (91), United States-Canada (81) and
United States-France (80), but during 2004-11 they were Switzerland-Germany (316), United States-United Kingdom (306),
United States-Switzerland (287), United States-Canada (224), United States-France (164), Switzerland-Germany (163) and Switzerland-France (155).
The main collaborations between Spain and the other countries during 2004-15 were with United States (10), France (6), United Kingdom (3), Austria (3), but during 2004-11 were: United States (44), United Kingdom (23), Switzerland (17), France (13),
and Germany (6).
United States requests the 20’06% of its patents with other countries (19’29 in 201), and Spain the 40’65% (45’07 in 2011).
The main patent applicants during 2004-15 based on their population were: Monaco (505/106 inhabitants and year), Liechtenstein (268), Switzerland (163), Iceland (156), Israel (108), Denmark (76), Belgium (47) and United States (46). Spain (6).
The main patent applicants during 2012-15 based on their Gross national income per capita were: United States (265), United
Kingdom (48), India (41), Germany (38), China (32), France (31), Israel (27) and Switzerland (23). Spain (8).
The main patent applicants during 2004-15 based on the average expenditure on Research, Development and Innovation
in % of Gross national product were: United States (5277), United Kingdom (1144), Germany (628), France (557), Canada (529),
Monaco (475) and Switzerland (451). Spain (220).
Conclusions
Spain has reduced its cooperation with other countries in the last four years, and it has passed position 30 to 24 in function
of the population, of 17 to 28 on their Gross national income per capita and of 15 to 13 on the expenditure on Research, Development and Innovation in % of Gross national product.
222
P-116 EVOLUTION OF PATENTS IN IMMUNOLOGY, IN LATIN AMERICA
Introduction
Scientiometric analyses are particularly important for the community Scientific and companies. These analyses can help to
stimulate scientific research in certain regions of the world.
Objectives
The aim of this study is to analyse the technological situation of Immunology in Latin America since 2004.
Methods
The Patent documents applied via the Patent Cooperation Treaty in the area of Immunology from 2004 to 2015 were obtained through SCOPUS and evaluated having in count: the number of patents, countries, researchers, applicants, sections and
classes of the International Patent Classification, economic sectors and entities.
Results and Conclusions
Ninety five countries requested patents through the Patent Cooperation Treaty during the whole period. The total number of
patents was 24,396, 213 of which were applied by Latin America, of which, 65 corresponding to Brazil, Cuba (39), Mexico (34),
Argentina (33), Chile (17), Uruguay (10), Colombia (5), Bermuda (3), Bahamas, Barbados, Costa Rica, Peru (2), and 1 to Belize,
Ecuador, Honduras, and Trinidad and Tobago.
Private companies have passed to apply 40% of patents to 12%. On the contrary universities have passed from 16 to 18%, the
Public Research Organizations have passed from 15 to 28%, and Private Persons from 5 to 32%.
We have observed differences between the kind of classes applied to patents in those 95 countries (mostly A61, C07, C12,
G01, A01, G06, A23, C40, B01, C08) and the ones in Latin America (A61, C12, C07, A23).
The main collaborations of Latin America countries were: United States (57), Israel (11), Spain (8), France (9), United Kingdom
(6), Germany (6) and Canada (5).
The main patent applicants during 2012-15 were: Centro Inmunología Molecular from Cuba (6), Consejo Nacional de Investigaciones Científicas y Técnicas from Argentina, Fundação à Amparo Pesquisa from Brazil, Universidade Federal de Minas Gerais from Brazil (3), but during 2004-11 were: Centro de Ingeniería Genética y Biotecnología from Cuba (21), Instituto Carlos
Finlay from Cuba (12), Fundação de Amparo à Pesquisa from Brasil (8), Universidade Federal de Minas Gerais from Brasil and
Universidade de São Paulo from Brasil (6)
The main patent applicants during 2004-15 based on their population were: Bermuda (46/106 inhabitants and year), Cayman
Islands (34), Barbados (7), Bahama (5) and Cuba (3).
The main patent applicants during 2004-15 based on their Gross national income per capita were: Cuba (6,6), Brazil (4,2), Argentina (2,5), Mexico (2) and Chile (0,8).
The main patent applicants during 2004-15 based on the average expenditure on Research, Development and Innovation in
% of Gross national product were: México (7), Argentina (4), but during 2004-11 were: Mexico (1,8) and Honduras (1,6).
Conclusions
Research, Development and Innovation in % of Gross national product in Latin America are below the world average; however, the level of patents in immunology is higher than expected.
223
P-117 FROM AMPHIBIAN TO AMNIOTES THROUGH THE IMMUNOGLOBULINS
O. Estevez Martínez1 , M. E. Garet Fernández1 , D. Olivieri2 , F. Gambon Deza3 1) Universidad de Vigo 2) Universidad de Vigo 3) Servicio Gallego de Salud (SERGAS)
Introduction
Amphibians were the first vertebrates changing their environment from water to earth, suffering modifications in their genomes. In particular, Immunoglobulin (Ig) X/A and Y genes emerged and forms of IgD differentiated from Igs found in fish. In
this work, we describe the Igs of extant amphibians obtained from the High Himalaya Frog (Nanorana parkeri) genome and
the Chinese Giant Salamander (Andrias davidianus), the Japanese Fire-bellied Newt (Cynops pyrrhogaster) and the Eastern
Newt (Notopthalmus viridescens) transcriptomes.
Objectives
Identification of the Igs that correspond to relics of the first vertebrate species living on land.
Materials & Methods
Antibody genes of N. parkeri were located by homology searches with Xenopus laevis Ig gene sequences. Exons were found
performing a TBLASTN query with Ig amino acid (AA) sequences of Xenopus, together with gene finder software programs.
For the transcriptome analysis the RNA sequences were reconstructed using Trinityrnaseq to obtain the sequence of the
entire constant region and the most probable AA sequences. With these sequences, we did a homology search and a phylogenetic study using known Igs.
Results
Amongst all the immunoglobulins identified, the most interesting results were find in the IgD and IgA genes, present in all
species studied.
The IgD was present either in a long form or a short form. The long IgD has only been found in the Caudata order. The long
IgD is orthologous to the reptile eleven-domain IgD. Different isoforms of this IgD were found due to differential splicing
in all caudata. The two Igs found in N. parkeri showed close similarity to X. laevis IgD but distant relation to reptile IgD. This
corresponds to the short form of IgD, also present in the caudate transcriptomes.
A phylogenetic analysis grouped the amphibian IgA into two clades showing two different isotypes. This isotypes arose prior
to the diversification of the Anura and Caudata orders. The two clades correspond to two IgA lineages: Lineage A1, is associated to birds and reptile IgA, and Lineage A2 to mammalian IgA. Lineage A1 gene is located between IgM and IgY genes and
gene from Lineage A2 is located at 3’ position of the locus.
Conclusions:
We have discovered the presence of two IgA isotypes in amphibians not previously described. One of these isotypes is suggested to be a precursor of the mammalian IgA (Lineage A2), while the other is a precursor of the IgA of birds and crocodiles
(Lineage A1). Regarding IgD, we have described a long IgD in amphibians related in evolution to that of reptiles and mammals. Some amphibians also possess more than one gene for the IgD, specifically, a short form of the IgD similar to that of X.
laevis. These results suggest that amphibian have immunoglobulin genes that could be a reminder of genes existing prior to
the divergence of reptiles and mammals more than 300 million years ago. 39 Congreso de la Sociedad Española de Inmunología
224
P-118 THYROID ANTIBODIES DETERMINATION: FLUOROENZYMEIMMUNOASSAY vs CHEMILUMINESCENCE
A. Ú. Muñoz Colmenero1 , E. Ocaña Pérez1 1) Complejo Hospitalario de Jaén
INTRODUCTION
Thyroid antibodies detection is indicated in cases of Graves\’ disease, Hashimoto\’s thyroiditis and postpartum thyroiditis
due to suspected autoimmune thyroid disease. In general, prevalence of these antibodies increases with age and other autoimmune diseases such as diabetes mellitus type 1 and pernicious anemia.
Anti-thyroid peroxidase antibodies (A-TPO) determination is the most sensitive test among the different thyroid autoantibodies for diagnosis of patients with autoimmune thyroid disease. These antibodies are detectable in approximately 95% of
patients with Hashimoto´s thyroiditis and 85% with Grave´s disease.
On the other hand, anti-thyroglobulin antibodies (A-TG) are positive in about 60% and 30% of patients with Hashimoto´s
thyroiditis and Grave´s disease, respectively. Thus, A-TG are used primarily as an adjunct assay in the follow-up of patients
with differentiated thyroid cancer.
During the early phases, A-TG are markedly elevated and A-TPO only slightly elevated. Later, A-TG may disappear, but A-TPO
persists for many years. Although both may become negative if the disease is prolonged or if it remits
OBJETIVE
The aim of our study was to evaluate the correlation between A-TPO and A-TG levels by fluoroenzymeimmunoassay (Unicap
250, Thermo-Fisher) and chemiluminescence (Architect i2000, Abbot and Cobas 6000, Roche Diagnostic).
MATERIAL AND METHODS
In parallel, 50 and 72 serum samples for A-TPO and A-TG detection, respectively, were processed by fluoroenzymeimmunoassay (Unicap 250, Thermo-Fisher) and chemiluminescence (Architect i2000, Abbot). On the other hand, 53 and 56 serum samples for A-TPO and A-TG detection, respectively, were processed by fluoroenzymeimmunoassay (Unicap 250, Thermo-Fisher)
and chemiluminescence (Cobas 6000, Roche Diagnostic).
Passing-Bablok regression analysis and kappa statistics were used to compare methods.
RESULTS
Regression equations were:
A-TPO: Unicap = -0.09 (-0.75 to –0.04; 95% CI) + 0.72 (0.66 to 0.86; 95% CI) Architect
A-TG: Unicap = 2.07 (-2.1 to 6.7; 95% CI) + 2.98 (2.09 to 3.49; 95% CI) Architect
A-TPO: Unicap = -11.67 (-19 to –9,54; 95% CI) + 1,13 (0,99 to 1,51; 95% CI) Cobas
A-TG: Unicap = -24,68 (-95,81 to -10,05; 95% CI) + 1,94 (1,36 to 3,76; 95% CI) Cobas
Cohen\’s kappa coefficients for qualitative data were:
A-TPO: κ = 0.80 (Unicap vs Architect)
A-TG: κ = 0.85 (Unicap vs Architect)
A-TPO: κ = 0,81 (Unicap vs Cobas)
A-TG: κ = 0,60 (Unicap vs Cobas)
CONCLUSIONS
In this study, we found that the results of both chemiluminescence methods weren’t transferable to those of fluoroenzymeimmunoassay based on Passing Bablok regression analysis.
However, we detected strong agreement between both methods using kappa analysis, except A-TG detection for Unicap vs
Cobas that we found a moderate agreement. Therefore, we conclude that methodological change, although with new cutoffs, will not affect clinical information.
225
P-119 ACUTE MEGAKARYOBLASTIC LEUKEMIA IN CHILDREN. TWO CASE REPORT
L. Aragon Irusquieta1 , P. Echaniz Aizpuru1 , C. Cipitria Arnaiz1 , P. García Martínez1 , M. Rey Rey1 1) Hospital Donostia
Introduction
Acute megakaryoblastic leukemia (AMKL) is a rare form of acute myeloid leukemia, with morphologic and immunophenotypic evidence of megakaryocytic differentiation in more than 50% of the neoplastic myeloblasts. AMKL can occur in three
major demographic subgroups, showing different genetic abnormalities and clinical outcomes: children with Down syndrome (DS-AMKL), children without Down syndrome (non-DS-AMKL) and adults (adult-AMKL). The biological differences in the
AMKL subtypes are usually reflected in distinct immunophenotypes. Regarding children with Down syndrome (DS), AMKL is
the most common subtype of AML. In this communication we present two cases of children with AMKL, characterized in our
laboratory by flow cytometry.
Objectives
characterization by flow cytometry of two cases of AMKL in children (DS-AMKL and non-DS-AMKL, respectively), highlighting the different phenotypic features between them, often useful for disease following after treatment.
bone marrow aspirates and peripheral blood samples from two pediatric patients with suspicion of acute leukemia were processed for flow cytometry analysis. Briefly, the samples were stained with the appropriate monoclonal antibodies to identify
the leukemic blasts, notably CD34, CD117, CD41a cyt and CD61cyt. Data were acquired in a FACSCalibur flow cytometer, and
analyzed with Paint-a-Gate Software. It´s important to notice that the bone marrow samples from these patients are often
insufficient due to the frequent fibrosis, hence the use of peripheral blood samples to complete the diagnosis.
Results
In the patient without DS, we observed that the leukemic blasts CD34+/CD117+, besides the main antigens associated with
the megakaryocytic lineage (CD41a cyt, CD61cyt), showed a clear expression of the CD56 antigen, more frequently described
in children with non-DS-AMKL, compared to adult-AMKL. This marker is useful for disease following after chemotherapy. Regarding the patient with DS, the leukemic blasts expressed also CD34, CD117, CD41a cyt and CD61cyt, showing in addition a
bright CD7 expression, characteristic of DS-AMKL. However, we observed no expression of CD11b, a marker frequently found
in this pathology. In this case, CD7 expression was useful for minimal residual disease monitoring after therapy.
Conclusions
the phenotypic differences observed between the cases of children with AMKL are valuable for a precise assignation of the
patients to the different subgroups, allowing also the appropriate following of the disease after treatment by flow cytometry.
226
P-120 APPLICATION OF THE NOVEL MARKERS CD200, CD123 AND CD10 TO HELP IN THE IDENTIFICATION OF THE
DIFFERENT SUBTYPES OF HAIRY CELL LEUKEMIA BY FLOW CYTOMETRY
L. Aragon Irusquieta1 , M. Rey Rey1 , P. García Martínez1 , C. Cipitria Arnaiz1 , P. Echaniz Aizpuru1 1) Hospital Donostia
Introduction
Hairy cell leukemia (HCL) is an uncommon chronic B-cell lymphoprolipherative disorders, representing about 2% of lymphoid leukemias. Some of the hallmarks of this disease are splenomegaly, pancytopenia and monocytopenia, mainly involving the bone marrow and spleen, with scarce leukemic cells in the peripheral blood. HCL diagnosis relies mainly on
morphological findings and the immunophenotype of the leukemic cells by flow cytometry. HCL cells usually show a distinct
immunophenotypic profile, usually with coexpression of CD103, CD11c and CD25, although atypical immunophenotypes
have been reported.
Objectives
To present several cases of HCL diagnosed by flow cytometry in our laboratory, highlighting the utility of novel markers
(CD200, CD123 and CD10), for HCL subclassification, to avoid false exclusion of HCL diagnosis, particularly when one of more
of the typical antigens are absent.
Bone marrow aspirates and peripheral blood samples from the patients with suspicion of HCL were processed for flow cytometry. Briefly, samples were stained with the monoclonal antibodies included in the routine panel used in our laboratory for
the diagnosis of chronic B-cell proliferative disorders, notably CD19, CD20, CD103, CD11c, CD25 and CD10, with the addition
of CD200 and CD123. Data were acquired in a FACSCanto II flow cytometer and analyzed with Infinicyt software.
Results
We identified three out of the four HCL subclasses described so far, based on the classical antigen combination for HCL
diagnosis (CD103, CD11c and CD25): classical, variant and atypical, respectively. Conversely, we did not find any cases of the
Japanese variant. Regarding the cases that we classified as classical HCL, we always observed the combination of markers
traditionally associated with HCL diagnosis by flow cytometry (CD103+/CD25+/CD11c+hi), in addition to a variable expression of the recent markers proposed by the literature (CD10, CD200 and CD123). In the cases that we considered as HCL
variant, CD25 expression was absent (being one of the criteria that define this HCL subtype), along with variable expression
of CD103 and no expression of CD200, CD123 or CD10. Finally, in the patients diagnosed as atypical HCL, no expression of
CD103 was observed. Moreover, expression of CD25 and CD10 was found, along with high expression levels of CD11c, CD200
and CD123.
Conclusions
Taking into account the scarceness of the disease, and thus the difficulty to obtain samples of the different HCL subtypes, we
believe that the use of novel markers such as CD200, CD123 and CD10, although not specific for this pathology, can be useful
for an accurate subclassification of the cases.
227
P-121 INFREQUENT COEXISTENCE OF TWO HEMATOLOGICAL PROCESSES IN THE SAME PATIENT. SEVERAL CASE
REPORTS
L. Aragon Irusquieta1 , M. Rey Rey1 , C. Cipitria Arnaiz1 , P. García Martínez1 , P. Echaniz Aizpuru1 1) Hospital Donostia
Introduction
The coexistence of hematological processes in the same patient is infrequent, being around 5% of the total lymphoma cases.
However, the literature is solely centered in the co-occurrence of two or more chronic disorders. To our knowledge, there is
no information regarding the coexistence of an acute leukemia and a chronic B-cell lymphoprolipherative disorder.
Objectives
We present two different scenarios characterized by flow cytometry: the coexistence of an acute lymphoblastic B leukemia
and a chronic B cell disorder, and the concurrence of two chronic B-cell lymphoproliferative processes.
Peripheral blood (PB) samples were processed for flow cytometry (in the case of the acute leukemia, the diagnosis was made
in PB due to the advanced age of the patient). Briefly, samples were stained with the routine panels used in our laboratory
for acute leukemia or chronic B-cell disorders. Data were acquired in FACSCalibur and FACSCanto II flow cytometers and
analyzed with Paint-A-Gate and Infinicyt software.
Results
Case 1: coexistence between acute lymphoblastic early pro-B leukemia and chronic B-cell disorder. In the case of the leukemia, the lymphoid leukemic blasts presented the following phenotype: CD45+low/CD34+/CD19+low/CD13-/HLA-DR-/
CD33-/CD7-/CD71+low/CD14-/CD138-/CD10-/CD38+/CD117-/CD2-/CD15-/CD11b-/CD64-/CD41a-/CD11c-/CD36-/CD4-/
IREM-/CD123+/CD56-/CD3 cyt-/CD79a cyt+/CD22 cyt+/TdT+low. Regarding the chronic B-cell proliferative disorder, the
CD19+ B cells expressed the following antigens: CD20+/CD79b+/CD22+/FMC7+/CD5-/CD23-/CD43-/CD38-/CD10-, with
clonal expression of kappa light chains at low intensity, compatible with a marginal lymphoma. The clonality was further
confirmed by a positive immunoglobulin rearrangement.
Case 2: co-occurrence between two chronic B-cell lymphoproliferative disorders. In this scenario, two distinct B cell populations were found. One of them (60% of the total B cells) presented the following phenotype: CD19+/CD20+low/CD79b+low/
CD22+low/FMC7+low/CD5+/CD23+/CD43+/CD38+/CD10-/CD200+, with clonal expression of kappa light chains at low intensity, the archetypal phenotype of chronic lymphocytic leukemia (LLC). Regarding the other B cell population (the remaining 35% of the B cells), the cells expressed the following antigens: CD19+/CD20+/CD79b+/CD22+/FMC7+/CD5-/CD23-/
CD43-/CD38-/CD200-, with clonal expression of lambda light chains at high intensity, being compatible with a marginal
lymphoma. In this case, clonality was further demonstrated by positive immunoglobulin rearrangement.
Conclusions
In the daily routine of a flow cytometry laboratory it is possible to detect several hematological disorders coexisting in the
same patient. Although scarce, it is important to accurately define these cases, in order to establish the most aggressive disease to receive the appropriate treatment.
228
P-122 SOMATIC CALRETICULIN MUTATIONS IN MYELOPROLIFERATIVE NEOPLASMS WITH NONMUTATED JAK2
R. de La Varga Martínez1 , F. Mora López2 , B. Rodríguez Bayona3 , A. Paz Coll4 1) Hospital Universitario Puerta del Mar, Cádiz 2) Hospital Universitario Puerta del Mar, Cádiz 3) Complejo Hospitalario Universitario
de Huelva. Hospital Juan Ramón Jiménez, Huelva 4) Hospital Universitario Puerto Real, Cádiz
Introduction
Philadelphia-chromosome-negative myeloproliferative neoplasms include polycythemia vera, essential thrombocythemia
(ET) and primary myelofibrosis. ET involves primarily the megakaryocytic lineage and is mainly characterized by excessive
platelet production. ET is considered a chronic nonreactive thrombocythemia that is not accounted for by other chronic
myeloproliferative disorders. JAK2 (V617F) and MPL mutations are found in 50-60% and 1-5% of patients with ET, respectively. Recently, different somatic frameshift mutations in exon 9 of the calreticulin (CALR) gene have been reported in 15-30%
of patients with nonmutated JAK2/MPL. Clonal marker is not detected in the remaining 15-20% of patients and it would be
necessary to discard a secondary or reactive thrombocytosis.
Objective
To analyse indel mutations in exon 9 of CALR gene in ET patients with nonmutated JAK2.
A total of 77 samples from Ph-/nonmutated-JAK2 patients who fulfilled the WHO criteria for ET were enrolled in the study.
Briefly, genomic DNA was extracted from peripheral blood granulocytic subset (QIAamp DNA mini kit, Qiagen); DNA was
amplified by PCR (multiplex PCR kit, Qiagen) using a FAM-labeled-forward primer to allow subsequent fragment analysis
(CALR-Forward-FAM: 5´-GGCAAGGCCCTGAGGTGT-3´ and CALR-Reverse: 5´-GGCCTCAGTCCAGCCCTG-3´); PCR products
were separated by capillary electrophoresis on an ABI3100 analyzer followed by fragment analysis on GeneMapper software (Applied BioSystems). Additional peaks to the normal (265bp) were further characterized by sequencing analysis on an
ABI3100 analyzer.
Results
Mutations in exon 9 of the CALR gene were detected in 27,3% of ET patients with nonmutated JAK2. Deletions of 52pb, n= 13
(c.1092_1143del and c.1099_1150del), insertion of 5pb, n=5 (c.1154_1155insTTGTC), deletion of 31pb, n=1 (c.1115_1145del),
deletion of 1pb, n=1 (c.1140delG,) and 11pb indel+, n=1 (c.1120_1125delAAGAAA insTCTTGTCTTCTCCTCTT) were found.
The 11pb indel+ mutation, to our knowledge, has not been previously described. As the other reported mutations, this new
mutation is associated with the loss of the endoplasmic reticulum retention KDEL motif and leads to transformation of the
negatively charged glutamic-acid-rich C-terminus of calreticulin to a positively charged arginine-rich region.
The comparative study of the peaks height corresponding to mutant versus normal allele provides allelic load semiquantitative information and might be useful in monitoring patients evolution.
Conclusions
Screening of CALR mutations by fluorescently labeled PCR and fragment analysis is a cost-effective and efficient clinical test
and should be included in the routine investigation of ET patients.
229
P-123 THE CANNABINOID RECEPTORS AGONIST WIN55,212-2 PROMOTES ANTIINFLAMATORY RESPONSES IN HUMAN
DENDRITIC CELLS: IMPLICATIONS IN THE CONTEXT OF ALLERGIC DISEASES
A. Angelina Querencias1 , I. Nombela Díaz1 , C. Cirauqui Armendáriz1 , C. Benito Villalvilla1 , O. Palomares Gracia1 1) Complutense University of Madrid
Background
Cannabinoids are compounds involved in allergic diseases. In humans, the mRNA expression levels of the cannanbinoid
receptor 1 (CB1) have been shown to be upregulated in allergic patients, but the functional significance of such observation
remains elusive. Human dendritic cells (DCs) express CB1 and CB2 but their implication in allergy and the underlying immunological mechanisms are still unknown.
Objective
To study the role played by cannabinoids receptors in human DCs as potential therapeutic targets for immunotherapy of
allergic diseases.
Inhibition of TLR2-L-mediated NF-κB/AP-1 activation and IL-8 production by the CB1/CB2 agonist WIN55,212-2 was studied
in the reporter THP1-XBlue cell line and human monocyte-derived dendritic cells (hmoDCs). The expression of surface markers HLA-DR, CD-86 and CD-83 and cytokine production in LPS-activated hmoDCs in the absence or presence of WIN55,2122 was analyzed by flow cytometry and ELISA, respectively. Allogeneic co-cultures of hmoDCs and naïve CD4+ T cells, CFSE-dilution assays, real-time quantitative PCR and ELISA were also performed.
Results
We showed that THP1 cells and hmoDCs express CB1 and CB2. The agonist WIN55,212-2 inhibits the TLR2-L-induced NF-κB/
AP-1 activation and the production of the pro-inflammatory cytokine IL-8 in a dose-dependent manner. Pharmacological
inhibition experiments with specific antagonist for CB1 or CB2 demonstrated that both CB1 and CB2 contributed to this inhibition. WIN55,212-2 down-regulates the expression of HLA-DR, CD-86 and CD-83 as well as the production of IL-6, IL-8, and
TNF-α in hmoDCs stimulated with LPS without altering cell viability. In the same way, WIN55,212-2 inhibits cAMP levels and
NF-κB activation induced by LPS in hmoDCs. Human DCs activated in the presence of WIN55,212-2 promoted the generation
of IL-10-producing T cells.
Conclusion
The cannabinoid receptor agonist WIN55,212-2 imprint a tolerogenic phenotype in human DCs, suggesting that cannabinoids promotes antiinflamatory responses in these cells. Our data might well have important implications for the designing
of future therapeutic strategies for the treatment of allergic diseases.
230
P-124 MICAFUGIN INCREASES THE HUMAN MACROPHAGE RESPONSE AGAINST C. ALBICANS
J. P. Guirao-Abad Jp1 , R. Sánchez-Fresneda1 , J. C. Argüelles1 , M. Martínez-Esparza2 1) Facultad de Biología. Universidad de Murcia 2) Facultad de Medicina. Universidad de Murcia
Introduction
Echinocandins are antifungal compounds which inhibits the activity of βglucan synthase thus disrupting cell wall formation
and function. Caspofungin and micafungin are members of this family. Several studies have shown that caspofungin is an
antifungal drug with an important immunomodulatory role in the response against C. albicans. Sub-lethal doses of this
echinocandin are able to unmask cell wall β-glucans, which are detected by macrophages through Dectin-1, increasing the
production of pro-inflammatory cytokines as TNF-α, Il-12, Il-17 and INF-γ. However, this behavior has not been studied yet
for micafungin.
Objectives
To analyze the effect of micafungin treatment on C. albicans cells in the immune response of human macrophages.
Peritoneal human macrophages were isolated and purified from healthy donors. The clinical isolated SC5314 C. albicans
strain were treated with different concentrations of micafungin and the CMI50 were calculated. The effect of micafungin on
the expression of β-glucans in the C. albicans cell wall was studied by flow cytometry. Macrophages were co-cultured in vitro
for 4h at ratio 1:5 macrophage:yeast, with SC5314 yeast strain untreated or pre-treated for 1h with micafungin (0.005 µg/ml;
0.01 µg/ml; 0.05 µg/ml). Unstimulated macrophages were also studied in parallel. The supernatants was then recovered and
the cytokine content was analyzed by ELISA.
Results
Micafungin treatment induces the exposition of β-glucans on the C. albicans cell wall surface. SC5314 cells pretreated with
lethal doses of micafungin (0.05 µg/ml) compared with untreated yeast cells, induced a statistically significant increase in the
secretion of the pro-inflammatory and anti-inflammatory cytokines TNF-α and Il-10, respectively in human peritoneal macrophages. This increase was not observed when the yeast cells were pretreated with sub-lethal doses of micafungin (0.005
µg/ml; 0.01 µg/ml). On the other hand, the results found for low IL-17A followed the same tendency observed for TNF-α and
IL-10, although were not statistically significant.
Conclusions
Treatment of C. albicans with lethal doses of micafungin increases the recognition and activation of human macrophages
which increase the production of cytokines, which facilitates the removal of the fungal infection.
231
P-125 EOSIN 5 MALEIMIDE (EMA) STAINING FOR SPHEROCYTES DETECTION IN HEREDITARY SPHEROCITOSIS
N. Olivares Beobide1 , N. Maruri Machado1 , A. Pacho de Lucas1 , M. Riñón Mtnez Gallo1 , B. Arrizazabalaga Amuchastegui2 ,
R. del Orbe Barreto2 , A. Arrieta Gutiérrez1
1) Hospital universitario de Cruces 2) Hospital universitario de Cruces
Introduction
Eritrocyte membrane has two principal layers, an external lipid bilayer and spectrine based internal cytoeskeleton which
interact dynamically and allow the elasticity and deformability of normal eritrocytes. The deficiency or disfunction of one
or more of the proteins of the cytoeskeleton produces a disruption in the vertical interaction with the lipidic bilayer with
the consecuent formation of spherocytes. Hereditary spherocytosis (HS) is the most common inherited hemolytic anemia
in the north of Europe. Spherocytes show decreased deformability inside the microcirculation, premature retention in the
spleen, extravascular hemolysis and a reduced lifespan. The laboratory diagnosis of HS has been based on peripheral smear
examination and osmotic fragility test (TPR= 50-60%, SPC= 74%), despite these technic do not distinguish between autoimmune (hemolityc anemia) and membrane congenital defect. During the last year we have implemented in our laboratory
EMA staining test, a colorant which binds stoychiometrically to the surface protein band 3 of the erytrocyte and exclusively
identificates HS spherocytes regardless of the molecular defect or clinical phenotype (TPR=93%,SPC= 98%).
Objectives
Our aim is to analize the results of the flow cytometry assay for EMA staining of thirty five patients presented with an hemolytic disorder since its implementartion in our laboratory one year ago, and compare the results with clinical data and
morphological findings.
Materials
Eosin-5-maleimide (C24H9Br4NO7) Sigma-Aldrich for direct immunofluorescence quantification (0.5 mg/mL). Phosphate buffered saline (PBS, pH 7.4). Thirthy five whole blood samples including samples from patients that are confirmed to have HS.
Six whole blood samples with EDTA (negative controls) for each patient blood sample. FACS Canto II instrument.
Methods
To wash whole human blood (3x), label with EMA during an hour in the dark; wash labeled RBC (3x) and resuspend in 1.5 mL
volume and adquire 20000 events per sample at a median flow rate. The results are shown as the mean fluorescence intensity
for patient and controls. The relative fluorescence index (RFI) for the patient is calculated respect the controls.
Results
Samples of patients previously diagnosed of HS, with spherocytes present in the smear, showed a wide peak with a decreased in the mean fluorencence intensity of EMA in FL1 compared to the normal RBC samples used as controls, with a relative
fluorescence index(RFI) <0.8.
Conclusions
No one of the tets available identifies all the cases of HS. Implementing EMA assay as a part of a clinical work up for patients
that present with hemolityc disorders has helped identifying those with HS. EMA staining test is reproducible and technically
simple to perform and does not require special technical training.
232
P-126 EXPRESSION OF FOXP3 AND CD25 IN PBMCS CULTURED WITH ISOTONIC QUINTON® SOLUTION
S. Pascual García1 , P. Martínez Peinado1 , Y. Segovia Huertas1 , M. García Irles1 , M. L. de La Sen Fernández1 , J. M. Sempere Ortells1 1) Universidad de Alicante
Introduction
Isotonic Quinton® solution is a signed product by Laboratoires Quinton®, consisting in diluted cold-ultrafiltered seawater
with 9g/l of NaCl, obtained at very specific deepness and locations, which is used for medical purposes. It is well-known that
seawater contains many essential mineral elements for the proper functioning of body cells, including the immune system
cells. Regulatory T (T reg) lymphocytes are a CD4+ lymphocyte subset involved in regulation of the immune system that
simultaneously express CD25 and FoxP3.
Objectives
The first objective is to analyse the effect of Isotonic Quinton® solutions on the expression of CD25 and FoxP3 in Peripheral
Blood Mononuclear Cells (PBMCs) stimulated with phytohemagglutinin (PHA) (Sigma). The second objective is to compare
the effect of this Isotonic Solution with a saline solution of a similar concentration (PBS).
PBMCs were obtained from nine healthy volunteers, seeded onto 96 well flat-bottom plates and cultured with 100% RPMI
(HyClone), 100% PBS or 100% Isotonic solution. Moreover, different rates of RPMI/PBS and RPMI/Isotonic solution were used.
Finally, lymphocytes were analysed through flow cytometry (Epics XL, Coulter) by using the appropriate anti-CD25 and anti-FoxP3 (eBioscience) monoclonal antibodies.
Results
Cells cultured with Isotonic Quinton® solution expressed a higher percentage of the CD4+CD25+FoxP3+ subpopulation than
the ones cultured with PBS. Similar results were obtained when the CD4+CD25highFoxP3+ subset was analysed. Interestingly,
these differences were statistically significant when 100% isotonic solution and 100% PBS were compared, being always these
values higher for the former condition. Furthermore, for the Isotonic solution rates of 12,5% and 25%, even higher values of
these subsets were found than when cells were cultured with 100% RPMI (optimal conditions). On the other hand, Median Fluorescence Intensity (MFI) was also studied, showing statistically significant differences on CD25 and FoxP3 expression at starving
conditions (100% Isotonic solution vs. cells cultured with 100% PBS), being always these values lower for the PBS condition.
Conclusions
Isotonic Quinton® solutions seem to be able of maintaining and/or increasing the percentage of regulatory T cells under the
different stimulating conditions studied.
This work has been supported by Conselleria D’Educació, Cultura i Esport (APOTI/2014/005).
233
P-127 DETERMINATION OF HLA-G IN PATIENTS WITH ENDOMETRIOSIS
L. Montesinos Llorca1 , I. Velasco Ruiz3 , M. I. Acién Sánchez1 , L. I. Velásquez Castrillón2 , E. Caparrós Cayuela2 , P. Acién Álvarez4 1) Hospital Universitario San Juan 2) Universidad Miguel Hernández 3) Hospital Universitario San Juan 4) Universidad Miguel
Hernández
Introduction
Endometriosis, estrogen-dependent chronic inflammatory disease develops after implantation and development of ectopic
endometrial cells, suggesting a poor immune response and molecular alterations of endometrial cells themselves conferred
inmunosupervivencia. Secretion of HLA-G molecule could be involved in the clinical process, although its detection in these
patients is controversial.
Objectives
- Determine the HLA-G levels in serum, peritoneal fluid (PF) and liquid endometrioma (LE) or liquid cyst (LC) of patients with
and without endometriosis.
- To determine the expression of HLA-G in endometriotic tissue and eutopic endometrium.
Serum samples, LP, LQ and LE or tissues from patients with endometriosis (n = 120) and patients with benign ovarian cysts
other non endometriotic (n = 30) were obtained. The concentration of soluble HLA-G was determined by ELISA and its detection in serum PF, LE / LC and endometriotic / endometrial tissue by Western Blot.
Results
There were no differences in the levels of HLA-G in serum and LP between groups, but the levels of LE vs LC, still higher than
in the first (p <0.05). However, HLA-G is not detected in all samples tested. Although not related to the symptomatology of
the disease was observed, the HLA-G values were higher in the cases with PF infiltrating endometriosis (p <0.05), especially
in secretory phase. Respect to detection by Western blotting, in the group of patients with endometriosis were obtained
11 of 15 positive sera, 14 of 19 positive LP and 2 of 3 positive LE. In addition, samples were processed endometriotic and
endometrial tissue of 3 of these patients, HLA-G was detected in all of them. In the group without endometriosis, the results
obtained were 4 out of 5 positive serum, 4 of 5 positive PF and 2 of 2 positive LC.
Conclusions
• The HLA-G molecule is present in serum, PF and LC/LE both in patients with endometriosis and women with no endometriosis cysts. However, a certain percentage of patients in both groups where not detected.
• The HLA-G molecule is expressed in eutopic and ectopic endometrium of patients with endometriosis, confirming the high
values found in the LE.
234
P-128 ROLE OF SNARE PROTEINS IN BST2 TRAFFICKING AND EXOSOMES RELEASE FROM HUMAN MULTIPLE MYELOMA
PLASMA CELLS
L. Gómez Jaramillo1 , R. Romero García1 , A. Campos Caro1 1) Hospital Universitario Puerta del Mar
Introduction
Exosomes are 60–100-nm membrane vesicles that are secreted into the extracellular milieu by practically all cell types. Increasing evidence suggests that exosomes from hematopoietic cells may serve as intercellular communication vehicles that
assist immune responses. BST2 was originally described as a cell surface protein that is preferentially expressed on terminally
differentiated B cells. Actually, BST2 appears to be a molecule with multiple activities as to regulate the release of several
viruses from infected cells, inhibiting TLR-7/9 induced cytokine responses or activating NFκB pathway. In addition, it is reported that BST2 is present at the membrane of exosomes derived from the multiple myeloma cell line U266. The trafficking and
subcellular localization of BST-2 and it secretion as a part of exosomes remain to be elucidated.
SNARE complexes are required for the fusion of cellular membranes and are made up of three proteins, one member from
each one SNARE subfamily (VAMPs, Syntaxins and SNAP25). SNARE members forming the SNARE complex seems to be specified for determined cellular trafficking pathways. Knowledge about the SNARE complexes composition could allow us to
regulate the trafficking and/or the secretion processes from cells.
Objectives
The study of the exosomes release mechanisms is important because it is known that exosomes facilitates the intercellular
communication between cells. Several studies have focused on the role of circulating extracellular vesicles in cancer biology.
The aim of this study is characterize SNARE proteins implicated in the secretion process of BST-2 as well as to identify SNARE
proteins present in the human myeloma U266 cells derived exosomes.
U266 cells were harvested in free-serum culture medium and the isolation of exosomes was performed by ultracentrifugation.
BST-2 expression and constitutive SNARE proteins on exosomes was examined by Western-blot. Experiments of loss of function
were performed by nucleofection of U266 with specific siRNA against several SNARE proteins. The amount of BST-2 at the cell
surface was measured by flow cytometry and protein localization was analyzed using immunofluorenscence (IF) microscopy.
Results
Several SNAREs proteins, as well as BST2 were detected in U266 cell derived exosomes. Knockdown experiments using specific siRNA for Sytaxin-4 (STX4) significantly reduced the expression of BST2 on the U266 cell surface, as was observed by flow
cytometry. Simultaneously, depletion of SXT4 caused a vesicular cytoplasmic accumulation of BST-2. It is noteworthy that
STX4 was also detected in exosomes pellets, as was done with BST2.
Conclusions
The present study indicates that STX4 and BST2 could be in the same vesicles and that STX4 might regulates the trafficking
of BST2 to the membrane and/or the secretion of exosomes containing BST2.
235
P-129 BASILIXIMAB (ANTI-CD25) DEPLETES GRANULOCYTIC-MYELOID DERIVED SUPPRESSOR CELLS (G-MDSC):
AN OBSERVATION IN THE CLINICAL SETTING
A. Utrero Rico1 , R. Laguna Goya1 , F. L. Cano Romero1 , E. Gómez Massa1 , D. Arroyo Sánchez1 , M. J. Castro Panete1 , E. Mancebo
Sierra1 , E. Paz Artal1 1) Hospital 12 de Octubre, Madrid
Introduction
MDCS are a heterogeneous population with capacity to suppress immune responses mostly mediated by T cells. Two subsets
exist: monocytic (M-MDSC) and granulocytic (G-MDSC). In human cancer, MDSC increase in peripheral blood and also in the
tumor, favouring a suppressive environment. In animal models for transplantation (Tx), tolerance is improved after inoculation of MDSC, but data from the clinical transplantation are scarce. On the other hand, incidence of cancer in transplanted
patients is 3-fold vs normal population.
Objective
Understanding human MDSC in patients receiving solid organ grafts and its relationship with development of cancer.
We obtained PBMC from 14 healthy donors (HD) and from a cohort of 110 renal transplanted patients, pre-Tx and at days
+7, +14, and months +1, +3 and +6. By FC analysis, CD11b+CD33+HLA-DR- cells were considered total MDSC; CD11b+CD33+HLA-DR-CD14+CD15- and CD11b+CD33+HLA-DR-CD14-CD15- were considered M-MDSC and G-MDSC respectively.
Results
MDSC are 1% of total PBMC in HD as well as ESKD patients (0.8% G-MDSC and 0.2% M-MDSC). We did not observe any
difference in MDSC, G-MDSC or M-MDSC counts in pre-Tx samples of recipients vs HD or in relationship with base disease.
Recipients of 2nd or sucesive transplants showed less M-MDSC than 1st transplant recipients (p=ns). After Tx, MDSC augmented significantly (% MDSC pre- vs post-Tx, p≤0.0001), and then progressively decreased to become similar to pre-Tx at
month +6. We observed that this profile was mostly due to evolution of M-MDSC but not G-MDSC, which did not experience
significant changes. M-MDSC increased in immediate post-Tx in all patients, regardless absence of induction treatment or
induced by thymoglobulin or basiliximab. On the contrary, G-MDSC showed a significant decrease in basiliximab-treated patients (0.70% pre-Tx vs 0,43% at day +7, p=0.037). Flow Cytometry confirmed that G-MDSC, but not M-MDSC, express CD25,
the IL2R α chain and target of basiliximab. However, an important variability in CD25 expression in G-MDSC was observed
among individuals.
Conclusions
M-MDSC subset increases during first 15 days post-Tx, so they might be actively participating in graft tolerance. Induction
with basiliximab depletes G-MDSC, because they express CD25. Studies are ongoing to analyse whether these cells express
the whole IL2R in their membrane and if so, its functional meaning.
236
P-130 INCREASING TUMOR CELL IMMUNOGENICITY BY RESTORATION OF TUMOR HLA CLASS I EXPRESSION USING
ADENO- AND ADENO-ASSOCIATED VIRAL VECTORS CODING FOR HLA-A2 AND BETA2-MICROGLOBULIN GENES
F. J. Carretero Coca2 , A. B. del Campo Alonso1 , S. Zinchenko1 , F. Garrido1 , N. Aptsiauri1 1) Hospital Virgen de las Nieves de Granada, Complejo Hospitalario Universitario de Granada, Instituto de Investigación Biosanitaria
ibs Granada 2) Universidad de Granada
Introduction
Immune rejection of cancer depends on proper presentation of tumor-associated peptides displayed by HLA to T-cells. Tumors frequently escape immune destruction via total or partial loss of HLA class I molecules, including heavy chain variants
and/or beta2-microglobulin (b2m). HLA-A2 is the most common allele in Caucasian population with widest tumor-associated peptide repertoire and its loss has been associated with cancer progression and resistance to immunotherapy. Hence, a
recovery of missing HLA class I specificity on tumor cells could restore tumor immunogenicity and cytotoxic T-cell immunity.
Here we report a recuperation of tumor HLA class I expression by introduction of HLA-A2 and/or b2m genes using different
viral vectors.
Objectives
Development and optimization of HLA class I gene transfer by viral vectors aimed at recovering tumor cell immunogenicity
and susceptibility to T-cell mediated lysis.
We produced recombinant viral vectors, including two adenoviral vectors (Ad5) carrying HLA-A2 gene (AdCMV-HLAA2) and
b2m gene (AdCMV-B2m), as well as an adeno-associated vector AAV2 coding for HLA-A2 (AAV2-HLAA2). AAV2 serotype
was selected as one with the highest transfection capacity among many other AAV serotypes. We infected several different
human tumor cell lines of distinct histotype with total or selective HLA-A2 loss, as well as cells positive for HLA-A2, and
compared the capability of the studied viral particles to modulate HLA class I cell surface expression using FACS and immunocytochemistry.
Results
Infection of tumor cell lines with viral vectors demonstrated a complete recovery or increase of HLA-A2 cell surface expression. Ad5 and, to a lesser degree, AAV2 proved to be efficient in: 1) recovery of lost endogenous HLA-A2 allele; 2) HLA-A2
upregulation in low-HLA-A2 expressing cells; and 3) expression of an additional HLA-A2 allele in tumor cells naturally lacking
HLA-A2 allele. Ad5-mediated co-transfection of HLA-A2 with b2m demonstrated that the de novo expressed proteins are
capable of forming a HLA-I/b2m complex on the cell surface.
Conclusion
The obtained results suggest that viral vectors coding for HLA molecules are useful in recovering lost tumor HLA class I expression. This gene therapy approach can be used in a combination with immunotherapy to increase the efficacy of tumor rejection.
237
P-131 CA10 A NEW TUMOR MARKER FOR TUMOR DETECTION AND FOLLOW-UP IN SERUM OF GLANDULAR AND
HEMATOLOGICAL NEOPLASMS. ITS RELATIONSHIP WITH BIOLOGICAL BEHAVIOR
L. Molto Delgado1 , M. Fuentes Ferrer2 , J. I. Tudela Garcia3 , J. M. Esteban4 , R. Martínez Martínez5 , J. Moreno6 , M. V. Arroyo
Fernandez7 , J. L. Subiza Garrido-Lestache8 1) Hospital Clinico San Carlos, Madrid 2) Hospital Clinico San Carlos, Madrid 3) Inmunotek, Alcala de Henares, Madrid 4) Hospital
Clinico San Carlos, Madrid 5) Hospital Clinico San Carlos, Madrid 6) Hospital Clinico San Carlos, Madrid 7) Hospital Clinico San
Carlos, Madrid 8) Hospital Clinico San Carlos, Madrid
Introduction
MUC-1 mucin is a transmembrane glycoprotein heavily glycosylated and normally expressed in the glandular cells as well as
in immune cells. MUC-1 provides cell-signaling pathways and protection to gland tissue, limiting accessibility and preventing pathogenic colonization. Aberrantly glycosylated MUC-1 is overexpressed in most human epithelial cancers. Here we
shown that CA10, a new tumor-associated marker defined by a mAb A10, recognizing a a core-type carbohydrate epitope
associated with MUC1, can be used for the detection of glandular and immune neoplastic cells as well as to monitor tumor
progression. CA10 is also expressed as a stage-dependent manner in tumor tissue and correlates with other carbohydrate
tumor antigens such as PSA, CA15.3, CA19.9 and CEA.
Serum samples of cancer patients as well as control subjects were collected at department of Clinical Analysis under protocols approved by Scientific Ethics Committee of Hospital. CA10 in serum was measured by a sandwich ELISA assay developed
with A10 mAb. Levels of CA10 were expressed as AU and a cut-off value of 0.3 AU/mL was used following measurement of
serum from a range of related age and gender healthy individuals (n=71). Relationships among expression of serum markers
were determined on the same time-lapse sample. Correlations between CA10 and carcinoma types were performed using
the Kruskal-Wallis and Mann-Whitney U test. Correlations within tumor-serum markers were determined by Rho Spearman
test. Estimation of events in the follow-up of patients was done using Kaplan-Meier Cox-regression curves.
Results
Analysis of CA10 expression from individual serum samples of patients with glandular solid and hematological neoplasms
showed a significant increase in CA10 levels of patients with regard to, gender-watched healthy individuals (p<0.001 to
p=0.005). CA10 expression levels were more significant for adenocarcinomas of prostate, breast cervix gastric and endometrium cancers than those from thyroid, colon, liver, gallbladder or esophagus cancers. Rho Spearman´s correlation test,
between CA10 and other tumor markers such as PSA, CA15.3, CA19.9 and CEA showed an increase in CA10 levels for corresponding tumor-marker adenocarcinomas and even in the follow-up of patients. Kruskal-Wallis test showed CA10 levels correlated directly with tissue lesion either for prostate (Gleason scoring) breast (Elston scoring) colorectal (TNM classification,)
or Thyroid neoplasms. On the other hand, there was also a significant increase in CA10 levels of patients with Multiple Mieloma, Non-Hodgkin´s Lymphoma, Myelodisplastic Syndromes, CLL, CML and ALL. with regard to healthy individuals (p<0.001
to 0.019). Mann-Whitney U test also showed significant correlation between CA10 levels and active clinical presentation of
hematological disease.
Conclusion
CA10 can be used as a biomarker for cancer diagnosis, staging and monitoring relapse of disease.
238
P-132 CA10 A NEW TUMOR MARKER OF MUCINS IN PROSTATE TUMORS. CORRELATION BETWEEN LOST OF TUMOR
TISSUE EXPRESSION AND INCREASED SERUM LEVELS WITH HISTOLOGIC GLEASON SCORE AND SURVIVAL TIME
L. Molto Delgado1 , M. Fuentes Ferrer2 , J. I. Tudela Garcia3 , J. A. García-López Asenjo4 , S. Hernandez5 , J. Moreno6 , M. Arroyo
Fernández7 , J. L. Subiza Garrido-Lestache8 1) Hospital Clinico San Carlos, Madrid 2) Hospital Clinico San Carlos, Madrid 3) Inmunotek, Alcala de Henares 4) Hospital Clinico
San Carlos, Madrid 5) Hospital de Madrid, Sanchinarro, Madrid 6) Hospital Clinico San Carlos, Madrid 7) Hospital Clinico San
Carlos, Madrid 8) Hospital Clinico San Carlos, Madrid
Introduction
PCa is most commonly diagnosed by Gleason classification, PSA concentration and clinical diagnosis. Prostate cancer is a
disease with distinct clinical behavior. There is no method to identify tumors which will progress from those with an indolent course. PSA levels at diagnosis and response to treatment may exclude patients in early stage and for early recurrence.
Other PCa-related markers can be expressed as progression markers such as MUC-1 mucin. MUC-1 behaves as an adhesion
molecule maintaining the differential status of epithelia. Searching for mucin patterns of expression in malignant prostate
may help to understand common pathways of expression and signaling in the evolution of neoplasms and better tools for
diagnosis. CA10 is a new tumor-associated carbohydrate defined by the mAb A10 that can be found in serum of different
cancer patients.
A10 mAb recognizes a MUC-1-associated carbohydrate epitope on mucin glycans of adenocarcinomas. An immunohistochemistry study was made by evaluating 180 biopsies from 138 patients with PCa, by a single pathologist using semiquantitative Gleason grade. Disease progression was evaluated by serum PSA, and survival time. Serum samples were collected at
Clinical Analysis Service of Hospital under protocols approved by Scientific Ethics Committee. CA10 in serum was measured
by indirect ELISA assays by a sandwich assay developed with A10 mAb. A CA10 cut-off of 0.3 AU/mL was used following
analysis of related healthy individual samples (n=71). Relationships among markers were determined on the same time-lapse sample. Correlations between CA10 and PSA with tumor types were performed using Kruskal-Wallis and Mann-Whitney
U test. Correlations within serum markers were determined by Rho Spearman test. Variance in the follow-up of patients was
done using the Kaplan-Meier Cox regression curves.
Results
Immunohistochemistry analysis of CA10 on prostate tumors, showed significant correlation between CA10 expression and
histologic types of PCa (p=.000). Immunohistochemical staining of tissue showed CA10 loss of expression on PCA tissues
with increased Gleason score (p=.000). Loss of CA10 on tumor tissue inversely correlated with increased serum PSA levels,
development of bone metastases and survival time. On Benign Prostate Hyperplasia, BPH, there was an overexpression
which is followed by a progressive loss of CA10 staining on tissue lesions of low and high PIN (p=.000). Another group of
patient´s serum samples with PCA (n=86), showed increased levels CA10 with regard to healthy individuals (p<.001). Serum
CA10 also correlate with PSA (r=.414, p<.001) and PhA levels (p<.001), histologic Gleason score lesion and survival time after
development of bone metastases (p=0,012
Conclusion
Expression of CA10 antigen in cancer prostate tissue and serum correlates inversely with clinical outcome of prostate tumors
and may be used as a suitable criteria for diagnosis and follow-up and serum correlates inversely with clinical outcome of
prostate tumors and may be used as a suitable criteria for diagnosis and follow-up.
239
P-133 INFLUENCE OF GENETIC NKG2D POLYMORPHISM IN MALIGNANT CUTANEOUS MELANOMA
L. Gimeno1 , H. Martínez 1 , M. V. Bernardo-Pisa 1 , J. M. Bolarín1 , M. Muro1 , R. López-Hernández 1 , L. Marin2 , B. Las HerasFerre 1 , M. R. Moya-Quiles 1 , A. Minguela1 , I. Legaz4 , A. M. García-Alonso1 , M. R. Álvarez-López 1 , J. Martínez-Escribano3 ,
J. A. Campillo1 1) Hospital Clínico Universitario Virgen de la Arrixaca 2) Hospital Universitario de Salamanca 3) Hospital Clínico Universitario
Virgen de la Arrixaca 4) Universidad de Murcia
Introduction
Natural killer (NK) cells are believed to be involved in the immune response against melanoma. NKG2D (activating) and NKG2A (inhibitory) are C-type lectin NK cell receptors located in the natural killer complex (NKC) region 12p13.2-p12.3, that play
a critical role in regulating NK activity. Previously, it has been described, in a Japanese population, an association between
polymorphisms in NKC region, including NKG2D gene and NKG2A promoter, and susceptibility to cancer development.
Objective
To analyze the NKC region 12p13.2-p12.3 polymorphism in melanoma disease in a Spanish Caucasian population.
233 melanoma patients and 200 healthy controls were included in the study. Seven single nucleotide polymorphisms (SNPs)
covering NKG2D gene (NKC3, 4, 7, 9, 10, 11, 12), and one SNP of NKG2A promoter (NKC17), were genotyped by a TaqMan
5Ńuclease Assay.
Results
An association between the eight SNPs analyzed and the risk of developing cutaneous melanoma was not found.
Data of NKC region genotyping were also used to identify haplotype blocks (Hb-1 and Hb-2) by linkage disequilibrium analysis. In contrast to the Japanese population, NKC-17, in our population, was not in linkage disequilibrium with SNPs NKC3, 7,
11 and 12 (Hb1 block).
No association was observed with melanoma disease when the most frequent haplotypes, both from Hb1 or Hb2 blocks,
were considered. However, a significantly increased frequency of the third most frequent haplotype from block Hb2 was
found in melanoma patients compared with controls (P=9.4x10-5; Pc<0.05).
Conclusions
Our results suggest that NKG2D polymorphism may have an effect on cutaneous melanoma susceptibility.
Acknowledgements
This work was supported by Fondo de Investigación Sanitaria (FIS; PI11/02644, PI11/02686 and FISPI13/02297), Seneca Foundation (GERM/06/2008), CajaMurcia Foundation and CIBEREHD.
240
P-134 COLORECTAL CANCER MICROSATELLITE INSTABILITY IS ASSOCIATED WITH A HIGHER HLA CLASS II EXPRESSION
FREQUENCY AND A DIFFERENT LEUKOCYTE INFILTRATION PATTERN
C. Torres Durán1 , M. Otero2 , E. García1 , M. Bernal1 , M. López1 , F. Perea1 , T. Cabrera1 , F. Ruiz-Cabello1 , F. Garrido1 , A. Concha2 1) Complejo Hospitalario Universitario de Granada 2) Complejo Hospitalario Universitario de A Coruña
Introduction:
A 15% of colorectal carcinomas (CRC) have been reported to be microsatellite unstable (MSI), whereas the other 85% are
classified as CIN, which do not present microsatellite instability (MSS). While data exists concerning CRC HLA-class I antigens
expression, little is known about HLA-class II antigen expression, and it seems to be contradictory.
Objectives:
The aim of this study is to compare HLA-II expression frequency between two CRC groups (MSI+ and MSS) and establish a
correlation between HLA-class II and the pattern of lymphocyte infiltration.
Materials and Methods:
Immunohistochemistry was performed in 196 CRC samples to study the HLA-class II expression (GRB1) and the leukocyte
infiltration (CD3, CD8, CD68, CD64). Bat26 was analyzed to classify these samples in our two groups (MSS and MSI). A molecular study of CIITA, RFX and NLRP5 genes has been performed in the MSI group (37 samples) in order to verify if the lack of
expression of HLA-class II is associated with mutations in the studied genes.
Results:
HLA-class II expression was found to be increased in the MSI group (p<0,05, 51% DR+ samples) compared to the control
group (MSS) (13,8% DR+ samples). With regard to the infiltrate, a statistically significant association between HLA-class II
expression and higher number of intratumoral infiltrating CD8 has been found in MSS CRC, while only a tendency to such
correlation was observed in the MSI group. Additionally, in some specimens, focal areas without detectable expression of
HLA class II were surrounded by tumour tissue showing strong expression of HLA class II antigens. In these cases, different
macrophage infiltration patterns were observed. All tumours from the MSI group do not have mutation in the studied RFX5
and CIITA microsatellites.
Conclusions:
MSI CRCs tumors have a higher HLA-class II expression frequency and a greater CD8 infiltration. This could suggest a higher
tumour immunogenicity and, thus, association with better prognosis of these tumours. We also revealed that the lack of
HLA-class II molecules in the MSI group is not explained by C7 repeated motif mutations in RFX5 and CIITA genes.
241
P-135 PODOCALYXIN-LIKE PROTEIN 1 PROMOTES CELL PROLIFERATION, DRUG RESISTANCE AND METABOLIC
CHANGES IN BURKITT´S LYMPHOMA CELLS
E. Tamayo Orbegozo1 , M. Riñón Martínez-Gallo2 , N. Nieto Rementería3 , L. Amo Herrero1 , E. Amutio Díez4 , N. Maruri Machado2 ,
M. S. Solaun Aguirre5 , A. García de Vicuña Meléndez6 , A. Arrieta Gutierrez2 1) Instituto de Investigación Sanitaria Biocruces 2) Hospital Universitario Cruces 3) Instituto de Investigación Sanitaria Biocruces
4) Hospital Universitario Cruces 5) Instituto de Investigación Sanitaria Biocruces 6) Hospital Universitario Cruces
Introduction
Podocalyxin-like protein 1 (PCLP1), a CD34-related sialomucin involved in the regulation of cellular morphology and adhesion, is expressed by different types of cancer, including leukemia. PCLP1 up-regulation has been associated with a more aggressive phenotype and unfavourable prognostic factor in breast, colorectal, prostate, ovarian cancer and renal carcinoma.
In breast cancer cells and glioblastoma, PCLP1 promotes tumor growth and invasion, whereas the role of PCPL1 in leukemia
and lymphoma cells still remains undetermined. Burkitt´s lymphoma is a highly aggresive B-cell non-Hodgkin lymphoma
and the fastest growing human tumor, occurring most frequently in children in regions with endemic malaria and with a
lesser extent in the developed world. Understanding the role of PCPL1 in Burkitt´s lymphoma progression could help to
improve the treatment of the disease.
Objetives
To elucidate the biological function of PCLP1 in Burkitt´s lymphoma cells.
Burkitt´s lymphoma Raji cell line stably overexpressing PCLP1 and control cells were exposed to different concentrations of
dexamethasone, hydrogen peroxide and a type II anti-CD20 monoclonal antibody (GA101). Then, cell death was measured
by flow cytometry using Annexin-V and 7-aminoactinomycin staining. Cell proliferation was assessed by counting live cells
on a hemocytometer using trypan blue exclusion dye. Cell adhesion was analyzed by light microscopy. To determine the
metabolic requirements of cell proliferation and viability, Raji cells were culture in glucose- or glutamine-free medium or in
the presence of specific metabolic inhibitors. Lipid droplet formation was detected by fluorescence microscopy after Nile
Red staining.
Results
Overexpression of PCLP1 induces an increase in proliferation and adhesion of Raji cells. Furthermore, PCLP1 promotes
cell resistance to dexamethasone-, hydrogen peroxide- and GA101-induced cell death. The augmented susceptibility of
PCLP1-overexpressing cells to glutamine starvation and to a 6-phosphogluconate dehydrogenase inhibitor indicate that
PCLP1 enhances Raji cell dependence on glutamine and pentose phosphate pathway, respectively. Interestingly, PCLP1
upregulation markedly increase cytosolic lipid droplet production, which has been involved in tumorigenesis.
Conclusion
The results show that PCLP1 provides Burkitt´s lymphoma cells with an increased ability to proliferate and contributes to
drug resistance. These data also unveil a role of PCLP1 in cellular metabolic reprogramming. Thereby, targeting PCLP1 might
improve clinical outcome in patients with Burkitt´s lymphoma.
242
P-136 DYNAMICS OF IMMUNOLOGICAL PARAMETERS IN PERITONEAL FLUID AND PERIPHERAL BLOOD FROM PATIENTS
WITH PERITONEAL CARCINOMATOSIS TREATED WITH CYTOREDUCTIVE SURGERY AND HIPEC. THE INFLAMMATORY
RESPONSE AND CLINICAL IMPLICATIONS
M. R. Jiménez1 , Á. Molina1 , V. Cunill1 , E. Villegas1 , J. Pons1 , C. Martínez1 , N. Esteve2 , R. Morales3 , J. Milá1 1) Institut d’Investigació Sanitària de Palma (IdISPa), Palma de Mallorca, Spain, Hospital Universitari Son Espases. Palma de
Mallorca. Illes Balears 2) Institut d’Investigació Sanitària de Palma (IdISPa), Palma de Mallorca, Spain, Hospital Universitari Son
Espases. Palma de Mallorca. Illes Balears 3) Institut d’Investigació Sanitària de Palma (IdISPa), Palma de Mallorca, Spain, Hospital
Universitari Son Espases. Palma de Mallorca. Illes Balears
Introduction
Intraperitoneal dissemination is a common progression of ovarian and colorectal cancers for which it signifies poor prognosis. Cells need only to exfoliate from primary tumors and secondary sites into the peritoneal fluid, which provides efficient
transport to additional sites within the abdominal cavity. Cytoreductive surgery (CRS) with Hyperthermic Intraperitoneal
Chemotherapy(HIPEC) becomes an option for selected patients with peritoneal carcinomatosis(PC). Surgical aggression involves peritonectomy with multivisceral resection, hyperthermia and local and systemic action of the cytostatic added in
the procedure.
CRS-HIPEC is associated with a high morbidity and mortality rates, but with greater median survival than systemic chemotherapy and palliative surgery. PC remains a challenging disease for which improved treatments are urgently needed.
The molecular mechanisms involved in beneficial effects of CRS-HIPEC remain unexplored.
Objetives
The aim of our study is to characterize the local and systemic early cellular and humoral responses induced by CRS-HIPEC,
in order to find valuable parameters that can influence morbidity and mortality in patients with peritoneal carcinomatosis
from a single institution.
46 patients (55% ovarian, 45% of colorectal origin) treated for PC receiving CRS-HIPEC were included in our prospective and
descriptive study from March 2014 to February 2016. Preoperative and postoperative systemic blood, serum and peritoneal
fluid were analysed for immunological parameters (serum immunoglobulins, complement factors and neutrophils (PMN),
monocytes, lymphocytes subpopulations) and inflammatory markers. Associated morbidity, staging of cancer by the Peritoneal Carcinomatosis Index (PCI), organs removed and specific chemotherapy used in HIPEC were also recorded.
Results
No significant correlation was observed among morbidities and ratios (blood PMN/Lymphocyte, blood Platelet/Lymphocyte) previously reported as useful markers. Patients who suffered from anastomotic leakage post HIPEC showed significantly increased lymphocytes in peritoneal fluid after 72h. Serum IgE levels showed a pattern related to acute phase reactant and
IgG/IgE ratios at 24h post HIPEC were significantly reduced. PC from an ovarian origin, showed significantly reduced NK cells
in peripheral blood (pre HIPEC) and significantly reduced serum IgA levels post 24h. CRS-HIPEC patients who suffered from
postoperative infections (pneumonia, clinical sepsis, surgical site infections) after more than 2 weeks post HIPEC showed
significantly increased B cells (CD19+) in peritoneal fluid after 72h of HIPEC. Increased PMN numbers in peritoneal fluid pre
HIPEC correlated with lower ICP.
Conclusion
Even though the peritoneal fluid plays a crucial role in the spread of ovarian and colorectal cancer, the contribution of
its host-derived cellular constituents is poorly understood. The accessibility of peritoneal fluid and its cellular component
makes an excellent source of tumour and their environment for the investigation of prognostic and predictive biomarkers,
and for molecular profiling analysis.
243
P-137 CD14+ HLA-DRLOW/- EXPRESSION IS ASSOCIATED WITH INCREASED BLAST CELLS IN PERIPHERAL BLOOD AND
RISK OF MYELODYSPLASTIC SYNDROME
P. Montes Ramos1 , S. Maroto Gallego1 , P. Jiménez Gámiz1 , F. Hernández Mohedo2 , F. J. Perea García1 , F. Ruiz-Cabello Osuna1 1) COMPLEJO HOSPITALARIO UNIVERSITARIO DE GRANADA 2) COMPLEJO HOSPITALARIO UNIVERSITARIO DE GRANADA
Introduction
Myelodysplastic syndrome (MDS) is a group of progressive, clonal, neoplastic bone marrow disorders characterized by hematopoietic stem cell dysfunction and dysregulation of the immune response. The mechanisms involved in the transformation to acute myeloid leukemia (AML) are not entirely clarified although a role of the immune response has been suggested.
In this sense, alterations in the bone marrow microenvironment including the presence of immunosuppressive cells (MDSCs,
Tregs) could contribute to inhibition of cytotoxic response and promote tumour escape.
Objectives
Our aim was to investigate a possible role of the monocytic myeloid-derived suppressor cells (Mo-MDSCs, CD14+ HLA-DRlow/-)
and Tregs in this disease. Material and Methods
A group of 53 independent MDS patients (25 peripheral blood and 28 bone marrow samples) and a group of 55 healthy subjects was used for this study. The presence of CD14+ HLA-DRlow/- cells and CD34+ blasts in peripheral blood and bone marrow
in both MDS patients and control cases was analyzed by multiparametric flow cytometry. The following fluorescent-labeled
monoclonal antibodies (mAbs) were used: anti-CD45-V500, anti-CD3-V450, anti-CD4-PerCP, anti-CD8-APH7, anti-CD19-PE-Cy7,
anti-CD56-PE-Cy7, anti-CD127-APC, anti-CD34-APC, anti-CD64-FICT, anti-CD25-PE-Cy7, anti-CD14-PE, anti-CD20-V450, anti-CD11b-PerCP and anti-DR-V450.
Results
In this study, we observed a positive correlation between the frequency of CD14+ HLA-DRlow/- MDSC cells and CD34+ blasts in
peripheral blood. In addition, the frequency of CD14+ HLA-DRlow/- cells was significantly elevated in MDS patients as compared to the control cases (up to five times higher). In peripheral blood we did not observe any significant differences in other
lymphocyte subpopulation. No significant results were found in bone marrow. We also found that increased frequency of
CD34+ blasts in peripheral blood of the patient fit the existing International Prognostic Scoring System (IPSS), but are different from the revised one (IPSS-R).
Conclusions
The increase of cells with MDSCs phenotype of monocytic origin can suggest a higher risk of myelodysplastic transformation
favouring the immune escape, which may be important for understanding the pathogenesis of high-risk MDS.
244
P-138 TUMOR HLA CLASS I LOSS FORMS DIFFERENT STROMAL PATTERNS IN LUNG CANCER
F. J. Perea García1 , M. Bernal Sánchez1 , A. Sánchez-Palencia Ramos2 , M. D. M. Valenzuela Membrives1 , F. Ruiz-Cabello Osuna1 ,
F. Garrido Torres-Puchol1
1) Hospital Universitario Virgen de las Nieves 2) Hospital Universitario Virgen de las Nieves
Introduction
HLA class I molecules (HLA-I) play a primordial role in the antigen recognition and this allows cytotoxic T lymphocyte (CD8+)
to kill tumor cells. HLA-I loss has been observed in different types of human tumors and it represents one of the main immune escape mechanisms.
However, it has not been related with lymphocyte infiltration.
Objectives
The objective of this study was to analyze HLA-I expression in lung tumors and the pattern of stromal development and leukocyte infiltration, to analyze the relationship between these characteristics and establish the role in the tumor progression.
In this study we analyzed 35 primary human lung tumors. Tumor HLA-I expression and lymphocyte infiltration were
studied by immunohistochemical analysis using the following monoclonal antibodies: W6/32 which recognize the
HLA-ABC/B2m complex, GRH1 which recognize B2m molecule, HC10 which recognize heavy chain HLA-BC, 108-2C5
against a subset of HLA-A locus-encoded gene products and 42IB5 against HLA-B locus-encoded gene products.
Lymphocyte infiltrate were analyzed using the following monoclonal antibodies: anti-CD3, anti-CD8, anti-CD45RO, GRT2
which recognizes overall leukocyte subsets and anti-CD64 which recognizes macrophages.
Results
We found 18 cases with total loss of HLA-I and 16 with positive expression. In the HLA-I negative group 67% of cases showed
a stromal pattern, where the lymphocytes are trapped in the peritumoral stromal tissue formed by a dense network CAF
(cancer associated fibroblasts) and macrophages, and the T cells do not have a direct contact with tumor cells. In contrast, in
the HLA-I positive group 81% of cases showed tumor infiltrating pattern with lymphocytes diffusely infiltrate the tumor nest
with a direct contact with cancer cells. The statistical analysis showed a significant association (p<0.008) between pattern of
immune infiltration and HLA-I expression.
Conclusion
Pattern of infiltration and tumor/stroma structure appeared to be closely associated with HLAI expression. In this study we
found that tumors with HLA-I loss form a non-permissive stromal structure which keeps lymphocytes away from tumor in
the area surrounding it, without a direct contact, promoting tumor cell survival. In contrast, tumors with positive HLA-I expression show a permissive structure, in which lymphocytes contact with tumor cells and potentially can eliminate them.
245
P-139 ANALYSIS OF MALIGNANT LESIONS AND PERIPHERAL BLOOD NATURAL KILLER CELLS IN LUNG CANCER PATIENTS
F. J. Perea García1 , M. D. M. Valenzuela Membrives1 , A. Sánchez-Palencia Ramos2 , M. Bernal Sánchez1 , M. E. Farez Vidal1 ,
F. Ruiz-Cabello Osuna1 1) Hospital Universitario Virgen de las Nieves 2) Hospital Universitario Virgen de las Nieves
Introduction
Natural killer cells (NK) have a main role in the defense against intracellular pathogens and in the tumor development. NK
cells are able to recognize tumor cells and kill them through a huge receptor repertoire presented on their cell surface. There are several subsets with different functional characteristics and this can influence in the anti-tumor immune response.
Objectives
The objective of this study was to analyze the natural killer cell subsets and their role in tumor progression.
In this study we studied a group of 56 lung cancer patients and 40 healthy donors. We analyzed different NK subsets (CD56+
CD16+, CD56bright CD16+, CD56- CD16-) in peripheral blood and different parts of lung tissue from cancer patients: core
tumor tissue, adjacent tissue and healthy tissue by multiparametric flow cytometry techniques. The following monoclonal
antibodies were used to identify the different subsets: anti CD45-V450, anti CD3-APCH7, anti CD56-PE, anti CD16-FITC, anti
NKG2D-percp, anti CD161-APC, anti NKp46-Pecy7.
Results
We found a significant increase of NK cells in peripheral blood of the patients, both in proportion and absolute counts (cell/
ul) in comparison to control group. However, we found a progressive decreased of the proportion of these cells in healthy,
adjacent to tumor and core tumor tissue (19.1, 14.8 and 7.8, respectively). Furthermore, we found a higher proportion of
cells with altered phenotype (CD56low/-, CD16-) (likely immature and not cytotoxic). The presence of CD56bright CD16- non
cytotoxic phenotype cells was significantly higher in tumor tissues (9.6) in comparison with other tissues (adjacent tumor
tissue 5.4, p< 0.04 and healthy tissue 2.1, p< 0.004).
Conclusions
The results obtained in peripheral blood show a NK lymphocytosis in lung cancer patients.
However, these cells do not seem to infiltrate well the tumor tissue. This data suggest that the tumor microenvironment
probably inhibits the infiltration of NK cells (higher proportion in healthy tissue) and it changes the cell phenotype to a
non-cytotoxic one. These alterations can contribute to the immune escape and hence to the tumor progression.
246
P-140 INCREASED NUMBERS OF CD14+/ DR- CELLS IN PERIPHERAL BLOOD OF LUNG CANCER PATIENTS
F. J. Perea García1 , M. D. M. Valenzuela Membrives1 , A. Sanchez-Palencia Ramos2 , M. Bernal Sanchez1 , M. E. Farez Vidal1 ,
F. Ruiz-Cabello Osuna1 1) Hospital Universitario Virgen de las Nieves 2) Hospital Universitario Virgen de las Nieves
Introduction
CD14+ DR- cells are associated with myeloid suppressor cells of monocyte lineage. HLA-DR molecules are expressed on
antigen presenting cells (APC) and they play a primordial role in the antigen processing and presentation. The presence of
myeloid suppressor cells (both of monocyte and granulocytic lineage origin) has been associated with tumor progression
due to its role in reducing T-cells adaptive immune responses.
Objectives
Our objective was to analyze the presence of myeloid suppressor cells (MSC, monocyte lineage) in lung cancer patients and to
correlate it with clinico-pathological characteristics of the patients.
In this study we analyzed HLA-DR expression on peripheral blood monocytes of 53 lung cáncer patients in comparison with
42 healthy patients using multiparametric flow cytometry with the following monoclonal antibodies: anti-CD14-FITC, antiCD64-PE, anti CD45-V500, HLA-DR-APC.
We used T-student test for statistical data analysis.
Results
We found a significant increase in the proportion of HLA-DR negative monocytes in lung cáncer patients in comparison with healthy controls (9.2% and 6.6%, respectively; p<0.012). We also found a decrease in HLA-DR expression (measured as mean florescence intensity) in the monocyte subset of peripheral blood of lung cancer patients in comparison with controls (3805 and 5795,
respectively; p<0.000). Our results suggest that tumor or tumor stroma probably release some factors which induce a decrease
in the expression of HLA-DR and reduce the antigen presenting capability. We did not observe any correlation between the level
of CD14+/DR- cells and the reduction of the HLA-DR expression on monocytes with clinicopathological parameters of patients.
Conclusions
HLA-DR downregulation and the presence of a higher proportion of MSC of monocytic origin may contribute to tumor evasion through to defect in antigen presentation to cytotoxic T lymphocytes.
247
P-141 “PHANTOM” IgE MYELOMA
V. Mas Bosch1 , F. Morandeira Rego1 , J. Climent Martí1 , C. Fuertes Purificacion1 , S. Barrachina Moles1 , J. Bas Minguet1 1) Hospital de Bellvitge
Introduction
Multiple myeloma (MM) is a neoplastic condition characterized by proliferation of malignant plasma cells in the bone marrow. It accounts for 1% of all cancers and around 10% of all haematological malignancies.
IgE MM is a rare condition, accounting for only 0.01% of MM, as fewer than 50 cases have been described to date. It’s worth
mentioning that the only IgE MM found in Catalonia has been detected in our lab and is pending publication.
Recently, we observed a weak band corresponding to IgEL while we were routinely screening the serum of a 97 year-old
woman for MM study.
Objectives
To verify the IgEL isotype of the band, as it is extremly unlikely to be observed.
Capillary electrophoresis and Immunotyping (IT) were carried out with a Capillarys 2 system, Sebia (Lisses, France). Immunofixation (IFX) with specific IgD and IgE antisera was performed with the Hydrasys system, Sebia, as the IT showed a decrease of lambda. Total IgE quantification was performed by two different methods employing two devices: ImmunoCAP®
(Thermo Fisher Scientific) and Immulite2000® (Siemens)
Results
At first, the routine IFX showed a weak IgGL band and a weak but well defined band corresponding to IgE. Since the migration of this band was identical to that of L chains, this was classified as IgEL. The subsequent quantification of total IgE
levels revealed a very low serum concentration so that several dilutions were performed to exclude a prozone phenomenon.
However, a very low concentration value was finally obtained (7 IU/mL).
We repeated IFX twice and the presence of the IgE band was confirmed in both assays.
Due to this discrepancy, the sample was sent to another laboratory to quantify IgE by a different method (Immulite2000
quimioluminiscence assay). They confirmed our low total IgE level for this sample. After that, they also performed IFX with an
Hydrasys system confirming the weak IgGL band but they were not able to detect any band corresponding to IgEL.
Since contamination of the IgE anti-serum was ruled out by using a normal serum as a negative control, we decided to check
our Hydrasys system, realizing that the staining reagent hadn’t been changed for 3 months.
Surprisingly, after doing this change, the IgE band no longer was observed.
Conclusions
In the first place, we conclude that the band corresponding to IgE was an artefact, as it wasn’t reproduced in a different lab
and we obtained a negative final result. Moreover, both total IgE levels measured were normal.
The technical problem observed was somewhat related to the staining reagent, although a more intense pattern was expected with fresh reagent, fact that doesn`t explain why we first detected the IgE band and why it later disappeared. Probably,
we´ll never find out the reason.
The take- home message from this expierence is that we should always be critical when we observe an IgE band, as very few
IgE myelomas have been described so far.
248
P-142 HLA CLASS I AND PDL-1 EXPRESSION IN LUNG AND BLADDER TUMORS AND IN CANCER CELL LINES TREATED
WITH ANTI-“IMMUNE CHECKPOINT” ANTIBODIES OR HLA-CORRECTING GENE THERAPY
M. Méndez Garcia4 , F. J. Carretero Coca4 , F. J. Perea García4 , J. F. Flores-Martin3 , J. M. Cozar3 , A. Sanchez-Palencia Ramos2 ,
F. Ruiz-Cabello Osuna1 , F. Garrido1 , N. Aptsiauri1 1) Complejo Hospitalario Universitario de Granada, Instituto de Investigación Biosanitaria ibs.Granada 2) Complejo Hospitalario
Universitario de Granada, Instituto de Investigación Biosanitaria ibs.Granada 3) Complejo Hospitalario Universitario de Granada,
Instituto de Investigación Biosanitaria ibs.Granada 4) Universidad de Granada
Introduction
Reduced expression of HLA class I is an important immune escape mechanism from cytotoxic T cells (CTL) described in
various types of cancer. It is frequently associated with poor prognosis and resistance to therapy. PDL-1 is a molecule also
expressed by tumor cells, which induces inhibition of CTL activation by binding to its receptor, PD1. The new strategy of cancer immunotherapy based on “immune checkpoint” blocking antibodies targeting PD-1/PDL-1 axis is aimed at activation of
anti-tumor T-cell immunity, which requires tumor antigen presentation of T-cells via HLA-I/beta2m complex. Therefore, the
efficacy of the novel immunomodulatory treatment is also reliant on proper co-presentation of HLA-I molecules. Objectives
1) To analyze a correlation between the expressions of HLA-I and PDL-1 in lung and bladder primary tumors, as well as in
human tumor cells lines.
2) To evaluate how an in vitro treatment of cancer cells with anti-PDL-1 antibodies or transfection with HLA-coding genes
affects tumor cells expression of HLA, CD80, PDL-1 and some other related molecules, both on protein and/or mRNA levels.
Using immunohistochemistry we analyzed 35 lung and 30 bladder primary tumors for the expression of HLA class I and PDL1. Using FACS and qRT-PCR we analyzed 14 human cancer cell lines (including melanoma, and bladder, prostate and breast
carcinoma) for the expression of HLA, PDL-1 and other related molecules in baseline conditions and after incubation with
anti-PDL-1 antibodies or infection with HLA-coding viral vector.
Results
Analysis of primary tumors and tumor cell lines demonstrated negative/heterogeneous HLA-I expression in about 65% of
lung tumors and in 40% of bladder tumors. PDL-I expression was positive only in about 20% of tumors without clear association with HLA-I expression, but with a tendency toward inverse correlation. Incubation with anti-PDL-1 antibodies resulted
in an increase at the transcriptional level of HLA-I, CD80, antigen processing machinery genes, as well as of other related
genes, such as NLRC5 and IRF-1. Infection of tumor cells with viral vectors coding for HLA genes led to increased expression
of CD80, but only in PDL-1negative cells.
Conclusions
The obtained results indicate that bladder and lung tumors demonstrate a high incidence of HLA-I loss, while tumor PDL-1
expression is a less frequent event, with a tendency toward an inverse correlation with HLA-I expression. We also can conclude that PDL-1 blocking could potentially increase the expression of tumor HLA-I and T-cell activating ligands. Strategies
which upregulate tumor HLA-I may have a beneficial effect on tumor immunogenicity and T-cell mediated rejection.
249
P-143 ROLE OF BMP4 IN BRAIN PARENCHYMA INVASION BY ACUTE LYMPHOBLASTIC LEUKEMIA CELLS
L. M. Fernández-Sevilla1 , A. Varas1 , A. Entrena1 , J. Valencia1 , E. Jiménez1 , C. Martínez-Macho1 , Á. González-Murillo2 ,
M. Ramírez2 , Á. Vicente1 1) Facultad de Medicina, Universidad Complutense de Madrid 2) Hospital Universitario Niño Jesús
Introduction
Survival rates of childhood B-cell acute lymphoblastic leukemia (B-ALL) have improved near to 80% due to contemporary
treatments, however there is a group of children who later relapse mainly in central nervous system (CNS). Previous results
from our laboratory have shown a correlation between this group of patients and high levels of bone morphogenetic protein
4 (BMP4) in cerebrospinal fluid.
Objectives
We aim to evaluate the role of BMP4 on the tumor cells entry into brain parenchyma across capillary endothelium.
In order to identify the impact of BMP4 on endothelial cells, quantitative PCR as well as proliferation and viability assays were
performed. Furthermore, we used an in vitro model for blood brain barrier based on human cultured cell lines. An ALL cell
line (NALM6) was in addition used for the transmigration and adhesion assays. Finally, brain damage produced by leukemia
cells was also evaluated in a human-mouse chimeric ALL model.
Results
We found induction on BMP4 expression and other BMP signaling pathway components on endothelial cells provoked by
tumor cells. Functional assays showed that BMP4 not only promotes adhesion and transmigration of NALM6 cells but also
induces changes on the expression profile of metalloproteinases and intercellular adhesion molecules in brain barrier cells.
Furthermore, presence of leukemic cells crossing the endothelium and disturbances of brain structures has been identified
on brain sections.
Conclusion
BMP4 promotes tumor cell adhesion and later entry into the brain favoring metastasis establishment. The mechanisms of
invasion might include the variations of the expression of molecules involved on the blood brain barrier´s integrity maintenance such as metalloproteinases and intercellular adhesion molecules.
This work was supported by grants SAF2012-33180 (Ministerio de Economía y Completitividad) and by Uno Entre Cien Mil
Foundation.
250
P-144 RELAPSED B-CELL BLASTS WITH INTERMEDIATE TO VERY HIGH SIDE SCATTER IN AN ADULT PATIENT WITH
PRO-B ACUTE LYMPHOBLASTIC LEUKEMIA AT DIAGNOSIS: A CASE REPORT
I. Gañán Nieto1 , E. Rodríguez Martín1 , J. Villarrubia Espinosa2 , C. Martín Martín1 , M. Piris Villaespesa2 , M. Talavera Yaguez3 ,
C. García-Hoz Jiménez1 , E. Roldán Santiago1 1) Hospital Universitario Ramón y Cajal 2) Hospital Universitario Ramón y Cajal 3) Hospital Universitario Ramón y Cajal
Introduction
B acute lymphoblastic leukemia (B-ALL) is a neoplasm of lymphoblasts committed to the B-cell lineage when this population
is upper 25% of total cells. B-ALL cells are typically small to medium size agranular blasts with scant cytoplasm, condensed
nuclear chromatin and indistinct nucleoli.
Objectives
To report an uncommon case of an adult patient with typical pro-B-ALL blasts at diagnosis who relapsed with an unusual
blast variant characterized by high Side Scatter (SSC) values.
A 64-year-old man with no biochemical alterations and pancytopenia was diagnosed of B-ALL. Complete remission was obtained after chemotherapy. One year later, relapse of ALL was detected, with massive infiltration in bone marrow (BM). A new
chemotherapy cycle was started, receiving a haploidentical hematopoietic stem cell transplantation after reaching complete
remission. Finally, the patient died from infection and sepsis.
Cells contained in fresh BM aspirates were stained with fluorescence-labelled antibodies and analyzed by flow cytometry
(FCM). Blasts were manually gated in a SSC/CD45 or CD34/SSC biparametric plots. The study was completed with images of
bone marrow extensions and analysis of karyotype and FISH.
Results
At diagnosis, all BM blasts cells were positive for CD34, CD45 (low to intermediate medium fluorescence intensity -MFI-),
CD19 (lower MFI than normal precursors), CD22, cytoplasmic CD79 alpha, DR and Tdt; partially positive for CD24 and negative for CD10, CD20, CD21, CD37, CD79 beta, mu cytoplasmic chain and surface immunoglobulin. Myeloid antigen expression
was as follows: CD117-, CD33-/+ (25% of blasts; low MFI), CD13-/+ (40%; low MFI), CD11b-, CD66c-, CD14-, CD65+, CD16- and
CD64-. Moreover, the majority of blasts displayed a low FSC (small to intermediate) and low SSC (25.400 arbitrary units -a.u.-),
with a distribution that overlapped with residual T lymphocytes (20.000 a.u.). This finding correlated to a large degree with
their morphology, since blasts were defined as cells with medium size and basophilic and clear or finely vacuolated cytoplasm. Not myc gene rearrangement or bcr/abl translocation was detected, although in 13% of analyzed cells, loss of a red
signal corresponding to the abl gene was seen. One year later, however, relapsed blasts showed intermediate to very high
SSC signal in FCM analysis (blasts: 186.000 a.u.; myeloid cells: 131.000 a.u.) that correlated with dramatic changes observed in
cytological extensions: large cells with numerous and prominent vacuoles. In contrast, there were no significant alterations
in the phenotypic profile of tumor cells, ruling out a transformation into biphenotypic ALL or AML.
Conclusions
We described here for the first time a B-ALL that relapsed with a variant B-ALL characterized by high SSC values, an aberrant
shift in SSC profile which has not been previously reported.
High SSC among B cells blasts could serve as a useful biomarker to identify ALL with poor prognosis.
251
P-145 IMMUNOEDITION AND IMMUNOESCAPE OF MELANOMA CELLS UPON INTERACTION WITH NATURAL KILLER
CELLS
F. Sierra1 , F. M. Soto 1 , S. Morgado1 , B. Sánchez-Correa1 , J. J. Gordillo1 , E. Durán2 , J. G. Casado1 , R. Solana3 , R. Tarazona1 1) Faculty of Veterinary, University of Extremadura 2) Faculty of Veterinary, University of Extremadura 3) IMIBIC - Hospital
Universitario Reina Sofía - Universidad de Córdoba
Introduction
Natural killer (NK) cells constitute the first line of defense against transformed cells as tumors or virus-infected cells. NK cell
activation depends on a tune balance between activating and inhibitory signaling through surface receptors. It has been
demonstrated in vitro that NK cells can recognize and destroy melanoma cells. However, melanoma cells develop strategies
to avoid NK cell lysis such as the shedding of soluble ligands that engage activating receptors on NK cells. At the same time,
tumor-mediated down-regulation of activating receptors on NK cells further contribute to melanoma escape.
HYPOTHESIS: The bidirectional interactions of NK cells with melanoma cells induce changes in both effector and target cells
diminishing melanoma susceptibility to NK cell-mediated lysis.
AIM: To investigate in vitro the interactions between melanoma cells and NK cells and their contribution to melanoma escape.
Methods
Melanoma cell lines obtained from OISTER project (QLRT-2001-00668) were grown on 24 well plates until reaching semi-confluence. In vitro co-cultures were performed by the addition of resting PBLs or IL-2 stimulated PBLs (lymphokine activated
killers, LAK) at 1:1 ratio. Cells were incubated for 24h and analyzed by flow cytometry. The expression of activating NK cell
receptors, NKp30, NKp46, DNAM-1 and NKG2D was studied on NK cells after co-culture and the expression of HLA class I
molecules, CD155, CD112 and MICA/B on melanoma cells.
Results
The expression of DNAM-1 and NKp30 was reduced on NK cells after co-culture with MaMel56 and WM793. DNAM-1 and
NKp46 decreased after co-culture with MaMel45 cells. IRNE cells induced a decrease of NKp30 and NKp46. Although NKG2D
expression was reduced after incubation with several melanoma cell lines, the differences were not statistically significant. In
relation with melanoma cell lines, HLA class I expression was increased after co-culture with PBLs or LAK cells. An increased
expression of CD155 (ligand of DNAM-1) was found on WM793, WM1205LU and MaMel56 cell lines. A decreased expression
of ULBP3 and ULBP2 (ligands for NKG2D) was observed on MaMel56 and MaMel60 respectively.
Conclusions
Melanoma cells express a large panel of ligands for NK cell activating receptors. NK cell co-culture with melanoma cells
down-regulates the expression of activating receptors on NK cells reducing their cytotoxic capacity. Melanoma immunoediting by NK cells is also observed. Thus, melanoma cells up-regulate the expression of HLA class I which subsequently might
favor escape from NK cells. In addition several changes in the expression of ligands on melanoma are also observed after
co-culture with LAK cells such as a decreased expression of NKG2D ligands and an increased expression of CD155, a ligand
for DNAM-1. The relevance of these changes in the final balance that leads to NK cell activation requires further analysis.
252
P-146 CYTOKINE INDUCED UP-REGULATION OF ACTIVATING RECEPTORS ON NK CELLS FROM ACUTE MYELOID
LEUKEMIA PATIENTS PARTIALLY OVERCOMES BOTH AGE- AND LEUKEMIA-ASSOCIATED IMMUNOSENESCENCE
B. Sánchez‑Correa1 , J. M. Bergua2 , I. Casas2 , C. Campos3 , M. J. Arcos2 , H. Bañas2 , E. Duran4 , R. Solana3 , R. Tarazona1 1) Faculty of Veterinary, University of Extremadura 2) Hospital San Pedro de Alcantara 3) IMIBIC-Reina Sofia University HospitalUniversity of Cordoba 4) Faculty of Veterinary, University of Extremadura
Introduction
Natural Killer (NK) cells in acute myeloid leukemia (AML) patients show diminished expression of several activating receptors
that may impair NK cell immunosurveillance of leukemia. Most AML patients are elderly and in poor condition for intensive
chemotherapy protocols. Besides, several age-associated changes in NK cell phenotype have been reported that contribute
to the defective NK cell responses observed in the elderly. Because of that, a better understanding of age-associated alterations on NK cells is required for the development of NK cell-based immunotherapy in elderly AML patients. Several strategies
to enhance the expression of activating receptors or to counteract inhibitory receptor signaling have been proposed with
the purpose of improving NK cell cytotoxicity against tumor cells.
Objectives
To analyze the phenotype and function of NK cells from AML patients and to develop cytokine-based strategies to increase
or recover the expression of NK cell activating receptors.
Peripheral mononuclear cells were obtained from AML patients and healthy volunteers. NK cell (CD3−CD56+) analysis was
carried out by flow cytometry. Degranulation assays were performed by examining CD107a/b expression on NK cells after
activation with the K562 cell line.
Results
The analysis of receptor expression on AML-NK cells has shown a significant decline of the activating receptors NKp30, NKp46
and DNAM-1 in AML patients. As expected, the changes described in the phenotype of NK cells in elderly individuals also
lead to altered NK cell function with a significantly reduced cytotoxicity and CD107a degranulation against K562 erythroleukemia cell line. We observed that IL-15 increased the expression of NK activating receptors in vitro and, more important,
enhanced NK cell degranulation against K562 cells. These results indicate that, even in elderly patients, NK cell function can
be enhanced by cytokines. These data suggest that the decreased NK cell function observed in AML patients is partially due
to a decrease in the expression of activating receptors, an effect that is more pronounced in elderly patients.
Conclusions
NK cells from AML patients display several phenotypic and functional alterations that, to a certain extent, resemble those
observed associated to ageing. In vitro culture with IL-15 has demonstrated an up-regulation of several activating receptors
and an increased NK cell degranulation against leukemia cells. Both, young and elderly patients can benefit of IL-15 effect. An
improved knowledge of the contribution of age- and leukemia-associated NK cell senescence to tumor immunosurveillance
in AML patients is required. During the last decade, the significant advances in our understanding of NK cells biology have
opened promising perspectives for the use of NK cell-based immunotherapy for AML patients. 39 Congreso de la Sociedad Española de Inmunología
253
P-147 THE IMMUNE CONTEXTURE OF THE TUMOR MICROENVIRONMENT IN RESECTED NON-SMALL CELL LUNG CANCER
M. Usó1 , E. Jantus-Lewintre1 , R. Sirera3 , A. Herreros1 , R. Guijarro2 , S. Calabuig1 , S. Gallach1 , E. Muniera1 , A. Blasco5 , J. Forteza4 ,
C. Camps5 1) Fundación Investigación Hospital General Universitario de Valencia 2) Hospital General Universitario de Valencia 3) Universitat
Introduction
The analysis of the immune contexture of tumor microenvironment is leading to the development of new immunotherapies
and the identification of biomarkers. Therefore, it would be interesting to better understand the key elements involved in
shaping this microenvironment in solid tumors.
Objectives
In this study, we have investigated immunologic markers, especially those related to immunoregulation in resected NSCLC.
In this retrospective study, FFPE samples from 122 early-stage NSCLC patients of primary tumor tissue were used. Laser
capture microdissection was carried out in order to separately obtain tumor and stroma areas. Thirty-eight genes relevant
to tumor immune response and immunoregulation were assessed by relative gene expression analysis by RTqPCR using
hydrolysis probes. Furthermore, the presence of CD8+ lymphocytes was also assessed in 84 of these FFPE samples by immunohistochemistry. All statistical analyses were considered significant at p< 0.05.
Results
Survival analysis carried out with cluster groups obtained from unsupervised hierarchical clustering analysis based on gene
expression data showed that patients in stromal Cluster I had a worse PFS than patients in Cluster II (17.4 vs. 44.3 months, p
= 0.006). With regard to the tumoral clustering, patients in Cluster II had a worse OS than patients in Cluster I (34.4 vs. 70.4
months, p = 0.005) as well as a shorter PFS (19.1 vs. 32.5 months, p = 0.010). Those clusters associated with better survival
presented higher levels of gene expression levels in general. Furthermore, the presence of CD8+ cells in the tumor compartment was significantly associated with better OS (73.9 vs. 40.4 months, p=0.021) and PFS (56.8 vs. 23 months, p=0.026). We
also investigated whether there were significant differences in gene expression patterns according to CD8+ cell infiltration.
Interestingly, tumors with higher levels of CD8+ cell infiltration expressed significantly higher levels of genes related to immunosuppressive factors (p = 0.008), chemokines and their receptors (p = 0.017), MDSCs (p = 0.008) and APCs (p = 0.006).
Moreover, significant positive correlations were observed between higher levels of CD8+ cell infiltration and the expression
of certain individual genes such as IDO1 (p < 0.001), CCL5 (p = 0.005), CD209 (p = 0.031), CD86 (p < 0.001), and IL23A (p =
0.008), whereas IL8 expression was inversely correlated (p = 0.015).
Conclusions
Our results indicate the existence of different immune-status in NSCLCs. One major subset of tumors presents a
phenotype consisting of infiltrating T cells, which reflects immune cell activation, and in which immunoregulation processes are activated in order to avoid immune attack. In this case patients had better outcomes. The other major phenotype, related to a worse outcome, is characterized by the absence of immune infiltrates on tumor samples, reflecting ignorance or exclusion of immune system by tumor cells. These results provide new insight into the
tumor immunity field in NSCLC, and could be useful in the future development of prognostic and therapeutic tools.
254
P-148 IMMUNE CHECKPOINTS SCORE AND CD8+ T CELLS INFILTRATION ARE INDEPENDENT PROGNOSTIC BIOMARKERS
IN RESECTED NSCLC
M. Usó1 , E. Jantus-Lewintre1 , R. Sirera3 , A. Herreros1 , R. Guijarro2 , S. Calabuig1 , A. Blasco5 , S. Gallach1 , E. Muniera1 , J. Forteza4 ,
C. Camps5 1) Fundación Investigación Hospital General Universitario de Valencia 2) Hospital General Universitario de Valencia 3) Universitat
Objective
Due to the promising clinical results of immune checkpoints blockade, we have investigated the prognostic role of immune
checkpoint expression markers and CD8+ T cells infiltration in resected NSCLC.
RNA was isolated from freshfrozen lung specimens (tumor and normal) (n=178). RTqPCR was performed to analyze the expression of CTLA4, PD1 and PDL1, and gene expression was normalized against CDKN1B, GUS and ACTB as endogenous control. These data were used to develop a gene expression score. The presence of CD8+cells was assessed in tumor and stroma
compartments in 63 FFPE samples by immunohistochemistry. All statistical analysis were considered significant at p< 0.05.
Results
A multivariate model including CTLA4 and PD1 was created and absolute regression coefficients were used
to calculate the immune checkpoints score (ICS): (PD1 x 0.116) + (CTLA4 x 0.0589). We found a significant association between high ICS and CD8+ infiltrating cells in the tumor compartment (p=0.012). KaplanMeier
survival analysis showed that patients with high ICS had longer overall survival (OS) [NR vs 40.4 months, p=0.008] and longer
progression free survival (PFS) [82.6 vs 23 months, p=0.009]. Moreover, the presence of CD8+cells in the tumor compartment
was significantly associated with better OS [73.9 vs 40.4 months, p=0.021] and PFS [56.8 vs 23 months, p=0.026].
Multivariate analysis indicated that ICS and CD8+ cells infiltration were independent biomarkers of prognosis (Table 1).
Conclusions
The immune checkpoints score, based on the expression levels of CTLA4 and PD1, and the presence of CD8+ cells in the tumor compartment provide relevant prognostic information for a better characterization of early stage NSCLC patients with
strikingly different outcomes who may be candidates for immunebased therapies.
255
P-149 RELEVANCE OF CCR7 WITH VLA4 EXPRESSION IN THE PATHOGENESIS AND PROGNOSIS OF CHRONIC LYMPHOCYTIC
LEUKEMIA
B. Somovilla-Crespo1 , C. Cuesta Mateos1 , M. J. Alfonso Pérez1 , A. Redruello1 , A. M. Ramírez-Menjíbar1 , V. López-Huete1 ,
A. Marcos Jiménez1 , S. Sánchez Alonso1 , A. Kreutzmann1 , C. Muñoz-Calleja1 1) Hospital Universitario de La Princesa
Introduction
The chemokine receptor CCR7 is variably expressed on chronic lymphocytic leukemia (CLL) cells, causes dissemination of
lymphomas and could, therefore, be related to the progression of the disease. VLA4, CD38 and ZAP70 expressions are used to
predict the outcome of CLL patients by flow cytometry. The main prognostic factor in this context is the adhesion molecule
VLA4 which expression is variable and discriminates two subgroups of patients, VLA4 positive and negative, with different
prognosis: VLA4 expression associates to accelerated tumor progression and shorter survival.
Objectives
We investigated whether CCR7 expression correlates with clinically relevant parameters and accepted prognostic factors in
CLL, in particular VLA4, as well as their role in the pathogenesis of CLL.
82 CLL patients were included. VLA4, CD38, ZAP70 and CCR7 levels were studied by flow cytometry. CCR7 expression was
correlated with prognosis factors and clinical parameters of CLL.
The migratory ability of CLL cells was analyzed in transwell chambers with samples from both VLA4 positive and VLA4 negative patients. Spontaneous migration and chemotaxis induced by the ligands of CCR7, CCL19 and CCL21, were studied.
The adhesive ability of CLL cells was studied through in vitro adhesion assays in plates coated with human umbilical vein
endothelial cells (HUVECs).
Results
Contrarily to our hypothesis, a low CCR7 expression was associated with poor prognosis factors such as Rai and Binet disease
high stages, short lymphocyte doubling time, need of treatment, and CD38 and VLA4 positivity. CCR7 expression also correlated with the percentage of CLL lymphocytes on the lymphoid population (R. 0.305, p=0.039), leucocytes per mm3 (R: 0.328,
p=0.026) and number of lines of treatment per year (R: -0.501, p<0.001).
The inverse correlation between CCR7 and VLA4 could be explained by an in vivo endocytosis of CCR7 when VLA4 is positive
and allows the interaction between the CLL cells and the endothelial cells where ligands of CCR7 are produced. To test this
hypothesis we incubated CLL cells from VLA4+ patients in starving for 24 hours but levels of CCR7 did not increase.
The worse prognosis of VLA4+ patients is probably related to a higher adhesive or migratory potential of their cells. In vitro
adhesion experiments revealed that the adhesion of CCL cells to HUVEC was significantly higher in VLA4+ patients. However
chemotaxis assays in transwell without endothelial cells demonstrated that the migratory capacity of CCL cells from both
VLA4+ and VLA4- patients are similar.
Conclusions
CCR7 expression is inversely associated to adverse prognosis factors, mainly VLA-4 positivity, which in turn guarantees a
more efficient adhesion to the endothelium, and probably provides a higher potential of entering the secondary lymphoid
organs where CLL cells receive survival signals. The cause of the inverse relationship between CCR7 and VLA4 is being currently investigated.
256
P-150 CD9 TETRASPANIN IS EXPRESSED IN AN ACTIVATED FORM IN BONE MARROW PLASMA CELLS FROM PATIENTS
WITH MONOCLONAL GAMMOPATHIES.
C. Martín Martín1 , E. Rodríguez Martín1 , M. J. Blanchard Rodríguez 2 , L. M. Villar Guimerans 1 , E. Roldán Santiago1 1) Hospital Universitario Ramón y Cajal (Madrid) 2) Hospital Universitario Ramón y Cajal (Madrid)
Introduction
Multiple myeloma (MM) is a plasma cell (PC) neoplasia and represents a 10% of all hematological neoplasms. In many cases,
resistence mechanisms to current treatments are due to PC interactions with the microenvironment in the bone marrow
(BM) niche. It is therefore necessary to know in depth the molecules involved in these interactions. It is well-known that beta
1 (CD29) integrins family are implicated in this process, particularly VLA-4, whose altered expression implies lower binding to
the components of niche. Although in the last decade it has been described in many tissues and cell lines a close relationship
between the activation states of CD29 and CD9, a protein belonging to the tetraspanin superfamily, in MM plasma cells the
expression of both proteins have not been previosly described.
Objectives
We want to check if the degree of activation of CD29 and/or CD9 depends on the presence of both in PC of patients with
monoclonal gammopathies.
We have analyzed fresh BM aspirates obtained from 44 patients with monoclonal gammopathy (8 MGUS, 15 MM at diagnosis, 12 relapsed MM and 8 treated MM) and 12 control patients without malignancy. All samples were tested by flow cytometry to determine the degree of expression of CD9 and CD29 both in their consitutive (ML13 and MAR4 clones, respectively)
and activated (HUTS21 and PAINS13 clones) forms. Moreover, since HUTS21 and PAINS13 epitopes are regulated by divalent
cations, we studied the effect of MnCl2 in aspirates washed with PBS to remove the plasma. So we can see if the activation of
the epitopes is affected when one of the two molecules are not expressed on the tumor cell.
Results
Unlike what has been described in other cell types, in malignant PC the expression of PAINS13 epitope (activated CD9) was
detected despite the disminished expression of CD29. However, median fluorescence intensity (MFI) of CD9 positive cells
was higher in those cells expressing CD29 at adequate levels. Moreover, in activation assays with divalent cations, we observed that MnCl2 increased the expression level of HUTS21 activation epitope in both CD9+ as well as CD9- PC. Interestingly,
the expression of activation induced epitope PAINS13 was increased significantly greater degree in samples with normal
levels of CD29.
Conclusions
PC from patients with monoclonal gammopathies expresed the tetraspanin CD9 in an activated form whose expression
depended at least in part, on changes in the activated form and/or constitutive level of integrin CD29
257
P-151 FUNCTIONAL INTERACTION OF ERAP1 WITH HLA-B27 PEPTIDOMES AND ITS RELATIONSHIP TO ANKYLOSING
SPONDYLITIS
A. Sanz-Bravo1 , N. García-Medel1 , C. Álvarez-Navarro1 , E. Barnea2 , A. Martín-Esteban1 , M. Marcilla3 , P. Gómez-Molina1 , D. Van
Nguyen1 , J. Campos4 , M. Mazariegos5 , A. Admon2 , J. A. López de Castro1 1) Centro de Biología Molecular Severo Ochoa 2) Technion-Israel Institute of Technology, Haifa 32000, Israel 3) Centro Nacional de
Biotecnología (Consejo Superior de Investigaciones Científicas) 4) Hospital Universitario Puerta de Hierro Majadahonda, Madrid
5) Hospital 12 de Octubre, Madrid
Introduction
Ankylosing spondylitis (AS) is a rheumatic disease strongly associated with HLA-B27. Genome wide association studies revealed that the Endoplasmic Reticulum Aminopeptidase (ERAP) 1 is a significant risk factor for this disease in HLA-B27+
individuals. The function of the enzyme is to trim peptides to an optimal size to be loaded onto HLA class I molecules. Thus,
ERAP1 polymorphism may affect AS susceptibility by altering peptide-dependent features of HLA-B27.
Objectives
1) To characterize the alterations, and their mechanism, induced in the HLA–B27–bound peptidome expressed in live cells by
the natural ERAP1 polymorphisms predisposing to AS on HLA-B*27:04 and B*27:05.
2) To analyze the relationship between the HLA-B27 peptides from subtypes differentially associated with AS and their ERAP1
dependency.
HLA–B27–bound peptides were isolated from human lymphoid cell lines expressing distinct or the same ERAP1 variant and
characterized by mass spectrometry. The relative amount of each shared peptide, in any given cell line pair, was estimated
from the respective ion peak intensities. ERAP1 susceptibility scores, ranging from 0 to 100, were assigned to N-terminal
flanking and P1 residues based on their susceptibility to ERAP1 trimming.
Results
1) The AS-associated ERAP1 polymorphisms, generated in HLA-B*27:04 an optimized peptidome with more ERAP1-resistant
N-flanking and P1 residues, shorter length and higher thermostability, compared to a less active and AS-protective ERAP1 context.
2) The AS-associated ERAP1 polymorphisms generated in HLA-B*27:05 a peptidome with higher molecular weight, more
ERAP1-resistant P1 residues and differential use of internal residues.
3) The identification of a large amount of peptides from several subtypes allowed us to define the relationship between the
features of peptidomes from subtypes differentially associated with AS and their ERAP1-dependency. AS-associated subtypes presented a higher ratio between resistant to sensitive residues in P1 compared to non AS-associated subtypes which
presented a ratio close to one.
Conclusions
1) The mechanism of ERAP1/HLA-B27 interaction is the altered balance between epitope generation and destruction, which
is determined by the susceptibility of N-terminal flanking and P1 residues to trimming, by distinct ERAP1 variants.
2) There is a differential influence of ERAP1 on AS- and non-AS-associated subtypes: The lower discrimination of non-AS-associated subtypes for peptides differing in the susceptibility of their P1 residues to ERAP1 is similar to the effect of low-activity variants on the HLA-B*27:05 and B*27:04 peptidome and suggests that non-AS-associated subtypes are less influenced
by ERAP1 polymorphism than AS-associated ones.
258
P-152 ENHANCEMENT OF VACCINATION IMMUNE RESPONSE IN ATHLETES UNDERGOING STRENGTH TRAINING
VERSUS ENDURANCE TRAINING
M. A. Moro García1 , M. Iglesias Escudero1 , R. Marcos Fernández1 , B. Fernández García2 , M. Rodríguez Alonso3 , R. Alonso Arias1 1) Hospital Universitario Central de Asturias 2) Universidad de Oviedo 3) Balneario de las Caldas
Introduction
Exercise has a clear influence on the state of the immune system. It is generally accepted that moderate exercise increases
life expectancy and are numerous observational studies that have shown the health benefits of physical activity in patients
with different pathologies, and even on comorbidity and survival of older individuals. On the other hand, physical exercise
induces a series of changes in the immune system depending, among other factors, on the type of exercise performed.
Objectives
To compare the effect of endurance training (ET) versus strength training (ST) in vivo immunization, we used influenza virus
vaccination as model.
Fourteen athletes were selected and randomly assigned to one of the training groups. A control sedentary group of 8 individuals was also studied. We performed an extraction of peripheral blood at baseline and after 12 weeks from vaccination.
We quantified by ELISA the serum antibody titer against influenza virus in both times studied. We also evaluated the ability
of activation of CD4+ T lymphocytes in response to anti-CD3 and against an extract of influenza vaccine by surface staining
with anti-CD69 antibody.
Results
Levels of antibodies against influenza virus in ET athletes were not significantly higher from baseline. In the group of ST levels
were significantly elevated compared to both, baseline (p=0.003) and ET group (p=0.008). Differences between groups were
also found when we quantified the specific CD4+ T lymphocytes against influenza virus, with higher levels in the ST group
(p=0.024). No differences between the control group and the ET or ST group were found in specific CD4+ T lymphocytes.
However, the antibody titers generated by the ST group was three times higher than in the control group (p=0.021).
Conclusions
In summary, ST appears to have a better effect on the response to vaccination than the ET. It seems that realization of ST
would be recommended in the period immediately following the vaccination in athletes, in order to favor the response to
vaccination, avoid infections, and improve their athletic performance.
259
P-153 ADDITIVE BENEFICIAL EFFECTS OF SOLUBLE CD6 FORMS AND BACTERICIDAL ANTIBIOTICS IN EXPERIMENTAL
POLYMICROBIAL SEPSIS
M. Martínez Florensa1 , M. Consuegra Fernández1 , F. Aranda Vega1 , N. Armiger-Borrás1 , M. Di Scala2 , J. Pachón3 , G. González
Aseguinolaza2 , F. Lozano Soto4 1) Centro Esther Koplowitz CEK- Institut dÍnvestigacions Biomédiques August Pi i Sunyer IDIBAPS 2) Centro de Investigación
Médica Aplicada-CIMA 3) University Hospital Virgen del Rocío/CSIC/University of Sevilla 4) Hospital Clínic de Barcelona
Introduction
The soluble form of the scavenger-like human CD6 lymphocyte surface receptor (shCD6) has been shown to bind
to pathogen-associated molecular patterns present in Gram-positive or -negative bacteria, and to be time- and dose-dependent effective when infused in mouse models of monobacterial-induced sepsis of intraabdominal origin.
Objetives
The aim of the present work was to demonstrate the efficacy of shCD6 in the prevention and treatment of polymicrobial
sepsis caused by cecal ligation and puncture (CLP).
-Sepsis was induced in pathogen free male C57BL/6 mice 8-10 weeks old (20-25g). Mice were anesthetized with ketamine
and xylazine cocktail. Afterwards the cecum was movilizzed, ligated below the ileocecal valve, and puncture twice with a 21
gauge needle to induce polymicrobial peritonitis with a 90-100% of letality on the first 48h. The abdominal wall was closed
in two layers. After surgery, mice were administrated with 1 mL physiologic saline solution.
-Chemokine serum levels were analyzed following the manufacturers indications by ELISA method.
-Infection with hepatotropic recombinant adeno-associated virus (AAV) expressing a recombinant soluble murine CD6 form
or Luciferase.
Results
-The intraperitoneal prophylactic or therapeutic of 1,25 mg/kg rshCD6 administration improves survival rate on 40% and
25% respectively and it acts in a dose and time dependent way on CLP septic shock model. Likewise either prophylactic or
therapeutic treatments decreases significantly the proinlflamatory-chemokine serum levels on the first 24h, and dicreases
also the bacteremia levels.
-The intraperitoneal antibiotic administration has similar effects like single treatment than the rshCD6 administration. On the
other hand, there is and additive effect when they are administered like combinated compounds.
-The intravenous therapeutic of 1,25 mg/kg rshCD6 treatment improves survival rate delaying its administration improving
its therapeutical potential.
-Mice transduced with AAV expressing soluble murine CD6 (smCD6) two weeks before CLP-induction showed significant
higher survival rates than those transduced with control empty AAV.
Conclusions
Soluble CD6 has been shown to display in vitro and in vivo beneficial effects on survival rate, decrease of pro-inflammatory
cytokine release and bacteremia levels. The administration of rshCD6 and broad spectrum antibiotic (Imipenem) like combined compounds has additive effects on survival rate in a polimicrobial septic shock model. Mice transduced with AAV
expressing smCD6 two weeks before CLP-induction showed significant higher survival rates than those transduced with
control empty AAV
260
P-154 THE ROLE OF DENDRITIC CELLS IN THE IMMUNOLOGICAL MECHANISMS OF ACTION OF POLYVALENT BACTERIAL
PREPARATIONS TO PREVENT RECURRENT RESPIRATORY TRACT INFECTIONS
C. Cirauqui Armendáriz1 , C. Benito Villalvilla1 , L. Cillero2 , C. M. Díez Rivero3 , A. Angelina Querencias1 , B.Pérez-Villamil2 ,
S. Sánchez Ramón2 , J. L. Subiza Garrido-Lestache3 , O. Palomares Gracia1 1) Universidad Complutense de Madrid 2) Hospital Clínico San Carlos 3) Inmunotek S.L.
Introduction
Recurrent respiratory tract infections (RRTIs) represent a major health-care problem with significant morbidity and mortality.
RTIs are also associated with the spread of resistance to antibiotics in patients with deficient humoral and cellular immune
functions. Recently, a novel polyvalent killed entire bacterial preparation (MV130) was demonstrated to reduce the rate of
recurrent respiratory infections in susceptible patients. However, the detailed underlying immune mechanisms involved in
the beneficial clinical effects of MV130 and the actual contribution of the dendritic cells (DCs) are still largely unknown.
Objective
To evaluate the molecular immunological mechanisms induced by MV130 in DCs from healthy donors (controls) and patients suffering from RRTIs.
MV130 (a selected mixture of inactivated Gram +ve and –ve bacteria strains frequently infecting the respiratory tract) and
the corresponding control (excipients without bacteria) were from Inmunotek S.L. Human monocyte-derived DCs (hmoDCs)
were obtained from monocytes of controls and patients. The phenotypic and function of hmoDCs treated with control excipients or MV130 were assessed by flow cytometry, real-time quantitative PCR and ELISA. Global comparative transcriptome
gene array analyses (Agilent technology) were performed with hmoDCs from healthy controls stimulated with control excipients or MV130.
Results
MV130-activated hmoDCs from healthy subjects and patients displayed significantly higher levels of co-stimulatory molecules CD86 and CD83 than humoDCs stimulated with control excipients. MV130- but not control excipients-treated hmoDCs
from both healthy and patients produced significant levels of IL-12, TNF-α, IL-1β, IL-6, IL-23 and IL-10. Global comparative
transcriptome analysis showed that 132 genes were differentially expressed (FC>2 and p<0.05) in humoDCs activated with
MV130 compare to control excipients. Most of these genes were related to immune responses initiated by human DCs after
activation: cytokines, chemokines, clusters of differentiation and Toll like receptors. Functional analyses using KEGG pathway
database allowed the identification of 6 main pathways differentially activated by MV130 involved in immune responses
such as cytokine-cytokine receptor interaction, chemokine signaling pathway, JAK -STAT pathway, cell adhesion molecules
(CAMs), NOD-like receptor signaling and TOLL-like receptor signaling.
Conclusion
MV130 activates human DCs from healthy subjects and patients suffering from RRTIs in a similar manner. MV130 induces
pro-inflammatory innate immune responses as well as high levels of IL-10, which might well confer protection against pathogens while keeping homeostasis. Our data suggest that several genes and pathways might be involved in the mechanisms
contributing to the reduction of RRTIs in patients treated with MV130. 39 Congreso de la Sociedad Española de Inmunología
261
P-155 MOUSE STRAIN IMPACTS THE INNATE IMMUNE RESPONSE TO ZYMOSAN INDUCED GENERALIZED
INFLAMMATION (ZIGI)
E. Carreras 1 , M. Orta1 , I. Simões1 , M. Velasco1 , F. Lozano1 1) Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS) 2) Universitat de Barcelona 3) Hospital Clínic de Barcelona
Introduction
Zymosan, a yeast cell wall extract mainly composed of ß-glucans and mannans, activates complement and binds to different immune cell receptors (TLR2, Dectin-1, and CD5) resulting in a generalized inflammation post-intraperitoneal injection.
This model of Zymosan-induced generalized inflammation (ZIGI) was first developed in rats and then different laboratories
used in several mice strains to investigate possible prophylactic and/or therapeutic treatments for fungal sepsis, or to study
ß-glucan receptor signalling pathways.
Objective
Compare the response of C57BL/6 inbred and CD1 outbred mice to ZIGI model with the aim to dissect immune factors related to genetics and detect putative targets for fungal infection treatment.
Increasing doses of Zymosan (0-1000 mg/Kg) were injected i.p. to C57BL/6 and CD1 mice and clinical parameters, survival,
and levels of pro- and anti-inflammatory cytokines in serum and peritoneum monitored. Splenocytes from C57BL/6 and
CD1 mice were stimulated ex-vivo with Zymosan (with or without a blocking anti-IL-12 antibody), LPS, or LTA and cytokines
measured in the supernatants. C57BL76 mice were injected with Zymosan alone (700 mg/Kg) or supplemented with IFN-γ (5
ng) or shCD5 (25 μg) plus IFN-γ (5 ng) and clinical score and survival monitored.
Results
We found that C57BL/6 mice were more susceptible than CD1 mice to Zymosan insult. Accordingly, infusion of a soluble
form of the human T cell receptor CD5 (sCD5; 25 μg) significantly increased CD1 but not C57BL/6 mice survival post-ZIGI. The
resistance of CD1 mice to ZIGI was linked to higher secretion of the Th1 cytokine interferon (IFN- γ) among other cytokines.
Splenocytes from CD1 mice also secreted significantly higher amounts of IFN-γ than splenocytes from C57BL/6 mice when ex
vivo exposed to Zymosan. IFN-γ secretion was IL-12-dependent as blocking anti-IL-12 antibody reduced IFN-γ production ex
vivo. The enhanced ability of CD1 splenocytes to produce IFN-γ was not limited to stimulation by zymosan but also to other
PAMPS of bacterial origin such as LPS and LTA. In agreement with these in vitro data, in vivo studies showed that IFN-γ (5ng)
infusion significantly increased the survival of C57BL76 mice to ZIGI. Interestingly, simultaneous administration of sCD5 (25
μg) plus IFN-γ (5ng) induced further significant increment on ZIGI-induced C57BL76 mice survival compared to either treatment alone.
Conclusion
This report highlights the link between response to a fungal like inflammatory stimulus and genetic background.
This work is supported by the Spanish Ministerio de Economía y Competitividad (Plan Nacional I+D+I, SAF2013-46151-R) and
Instituto de Salud Carlos III (Spanish Network for Research in Infectious Diseases, RD12/0015/0018).
262
P-156 ANTI-CITRULLINATED PROTEIN ANTIBODIES (ACPA) PRODUCED IN CELL CULTURES OF PLASMABLASTS/
PLASMA CELLS FROM PATIENTS WITH RHEUMATOID ARTHRITIS CAN BE DETECTED BY CHEMILUMINISCENCE
R. de La Varga Martínez1 , B. Rodríguez Bayona2 , G. A. Añez Sturchio3 , I. Macías Fernández3 , F. Medina Varo3 , C. Rodríguez
Hernández4 1) Hospital Universitario Puerta del Mar, Cádiz 2) Complejo Hospitalario Universitario de Huelva. Hospital Juan Ramón Jiménez,
Huelva 3) Hospital Universitario Puerta del Mar, Cádiz 4) Hospital Universitario Puerta del Mar, Cádiz.
Introduction
Rheumatoid arthritis (RA) is a systemic autoimmune disease that causes joint damage. ACPA are highly specific for RA and
can have a pathological role in RA. The mechanisms that regulate APCA production are not completely known. Among the
reasons is the difficulty for obtaining auto-reactive cells and for detecting low quantities of APCA in “in vitro” studies.
Objective
Our aim was to find a methodology sensitive and specific for detecting ACPA in supernatants (SN) of cell cultures from RA
patients and to examine the presence of circulating autoreactive plasmablasts/plasma cells (PB/PC) in these patients.
Blood samples from 25 RA patients with serum ACPA were studied. Clinical and laboratory data were collected. Enriched B
cell fraction was obtained by T-cell depletion of mononuclear cells and cell cultures were performed in the presence and in
the absence of cycloheximide. Circulating ACPA-specific PB/PC were functionally identified as cells capable of spontaneous
and active autoAntibodies (autoAb) production. ACPA production in sera and undiluted SN of cell cultures were determined
by chemiluminescence (CLIA) (Inova, Werfen) and were expressed as relative luminiscent units (RLU). Total IgG production in
cultures was determined by an in-house ELISA.
Results
To determine the level of sensitivity of CLIA for detecting APCA in cell cultures, analyses were done in serial diluted samples
of sera positive for ACPA (ELISA values higher than the 90th percentile). CLIA was able to detect APCA up to a 1/10000 dilution of the positive sera.
A cut-off level for positive SN was established by using the mean RLU ± 3 SD of APCA value in SN from cultures of healthy
controls (n=10).
Specificity was established by testing APCA in the culture SN from SLE patients with high titres of anti-ENA or anti-dsDNA
Ab but without APCA (n=10). APCA values in these cultures did not exceed the cut-off. Moreover, enriched B cell cultures
from three healthy individuals immunised with tetanic toxoid produced IgG anti-Tetanus toxoid Ab in cultures, but not ACPA.
By using CLIA, active ACPA production by circulating in vivo-generated autoreactive PB/PC was detected in 40% RA patients.
ACPA production in those cell cultures correlate with serum responses (r=0.613, p< 0.005). The kinetics studies indicated that
APCA and IgG productions continued for 14 days.
Conclusions
CLIA (Inova, Werfen) is a sensitive and specific methodology for detecting APCA in supernatants of cell cultures from patients
diagnosed with RA.
A circulating phase of auto-reactive PB/PC producing ACPA is present in 40% of RA patients.
IgG and ACPA-specific PB/PC showed similar kinetics of Ab production.
Financiación: PI-0366-2013. Consejería de Igualdad, Salud y Políticas Sociales. Andalucía
263
P-157 TH17 RESPONSES AND NATURAL IGM ANTIBODIES ARE RELATED TO GUT MICROBIOTA COMPOSITION IN SYSTEMIC LUPUS ERYTHEMATOSUS PATIENTS
P. López Suárez1 , B. de Paz Cazón1 , J. Rodríguez Carrio1 , A. Hevia González2 , B. Sánchez García 2 , A. Margolles Barros2 ,
A. Suárez Díaz1 1) Faculty of Medicine, University of Oviedo 2) Instituto de Productos Lácteos de Asturias (IPLA), Consejo Superior de Investigaciones
Científicas (CSIC)
Introduction
Intestinal dysbiosis, characterized by a reduced Firmicutes/Bacteroidetes ratio, has been reported in systemic lupus erythematosus (SLE) patients.
Objective
This study aimed to evaluate the possible involvement of the SLE intestinal dysbiosis in the imbalance between inflammatory and regulatory immune responses. Then, we analyzed the possible relationship between the SLE-associated gut
dysbiosis and the presence of immune parameters characteristic of these patients, such as the Treg/Th populations, cytokine
levels, disease activity and the production of both pathogenic anti-dsDNA and protective natural IgM anti-phosphoryl choline antibodies.
Human leukocytes were cultured with SLE fecal microbiota (SLE-M), total or enriched with Treg-inducing bacteria (Clostridia
or bifidobacteria), and the observed immune responses were compared with the alterations detected in SLE patients. Flow
cytometry was used to determine the Th1/Th17/Treg subsets in both patients and after coculture of microbiota-conditioned
dendritic cells with CD4+ naïve lymphocytes, whereas cytokines and autoantibodies were quantified by immunoassays.
Results
In vitro cultures revealed that SLE-M promoted lymphocyte activation and Th17 differentiation from naïve CD4+ lymphocytes
to a greater extent than healthy control-microbiota. Enrichment of SLE-M with Treg-inducing bacteria showed that a mixture
of two Clostridia strains significantly reduced the Th17/Th1 balance, whereas Bifidobacterium bifidum supplementation prevented CD4+ lymphocyte over-activation. In fact, ex vivo analyses of patient samples showed enlarged Th17 and Foxp3+IL-17+
populations in patients, suggesting a possible Treg-Th17 trans-differentiation. Moreover, analyses of fecal microbiota revealed a negative correlation between IL-17+ populations and Firmicutes in healthy controls, whereas in SLE this phylum
correlated directly with IFNγ serum levels, a Th1 cytokine slightly reduced in patients. Finally, the frequency of Synergistetes,
positively correlated with the Firmicutes/Bacteroidetes ratio in healthy controls, showed a strong negative correlation with IL6, tended to be reduced in patients with elevated anti-dsDNA titers, and correlated positively with protective IgM antibodies
against phosphorylcholine.
Conclusions
In vitro cultures with SLE-M suggested that immune responses against intestinal bacteria could be involved in lymphocyte
over-activation and Treg-Th17 trans-differentiation observed in SLE patients. The altered immune responses associated with
the intestinal dysbiosis could be reestablished, at least in part, by the supplementation with beneficial bacterial strains able
to induce suppressor responses, thus supporting a possible therapeutic benefit of probiotics in the reestablishment of the
Treg/Th imbalance present in SLE. In addition, our results revealed a possible role of intestinal Synergistetes in the development of natural protective anti-PC IgM antibodies.
264
P-158 PRESENCE OF SYSTEMIC-RELATED DISEASE AUTOANTIBODIES IN PRIMARY BILIARY CIRRHOSIS PATIENTS WITH
POSITIVE ANTI-MITOCHONDRIAL ANTIBODIES
M. Vilches Moreno1 , I. Olivas Martínez1 , M. J. Ferreira Fernández1 , Á. L. Castaño Nuñez1 , M. T. García González1 , M. A. Montes
Cano1 1) Hospital Universitario Virgen del Rocío
Introduction
Primary biliary cirrhosis (PBC) is a chronic progressive cholestatic organ-specific autoimmune disease of unknown etiology
that leads to the destruction of intrahepatic bile ducts. Without adequate treatment, PBC can ultimately produce fibrosis
and cirrhosis being necessary the liver transplantation. Although numerous autoantibodies are normally found in sera from
patients with PBC, the presence of anti-mitochondrial antibodies (AMA) in approximately 90-95% of these patients seems to
be pathognomonic and highly sensitive for the disease. One third of patients have antinuclear antibodies (ANA), including
anti-gp210 and anti-Sp100, that are highly specific for the progression and severity of this disease and of particular interest
in cases with negative AMA antibodies. Moreover, autoantibodies non specific for PBC closely related to other autoimmune
diseases can also be detected in the serum of these patients, existing often an association with Sjögren’s syndrome, lupus,
celiac disease or rheumatoid arthritis.
Objectives
To investigate the frequency of non-specific systemic-related disease autoantibodies in PBC AMA positive patients.
A total of twenty two sera from PBC patients, positive for antimitochondrial antibodies by indirect immunofluorescence
were confirmed by specific ELISA and then collected. In each serum an immuobloting test was performed for the qualitative
detection of IgG class antibodies against 14 different antigens:AMA-M2, M2-3E, Sp100, gp-210, SS-A, Ro-52, CENP-A, CENP-B,
PML, LKM-1, LC-1, SLA, Scl-70 y PGDH.
Results
The mean age of the patients at study was 61.7 years (±14.55 SD), with 82% women and 18% men. This study confirmed
the presence of antibodies against M2 in 100% of the sera. We didn´t detect antibodies against the following antigens: PML,
LKM-1, LC-1, SLA, Scl-70 and PGDH. We found autoantibodies specific of PBC against gp-210 in 6 sera (27,3%) and against
Sp-100 in other 6 sera (27,3%). Thirteen out of 22 sera tested (59.1%) were positive for autoantibodies non specific of primary
biliary cirrhosis directed against Ro-52 (36,4%), CENP-A (22,7%), CENP-B (13,6%) and SS-A (4,5%). These patients also presented other autoimmune diseases: psoriasis, SAF primary, Sjögren\’s syndrome and celiac disease which have not been found
in patients with antibodies only against M2, gp-210 and/or Sp100.
Conclusions
This study shows a high incidence of systemic-related disease autoantibodies in patients AMA positive, which suggest that
the development of PBC is a multi-factorial process often associated with other autoimmune disorders.
265
P-159 THE MAJORITY OF PATIENTS NEGATIVE FOR ANA-IIFA AND POSITIVE FOR ANA-MULTIPLEX BECOME IIFA
POSITIVE IN THREE YEARS
D. Pérez1 , J. A. Martínez-Flores1 , M. Serrano1 , O. Cabrera1 , D. Lora1 , M. Sevilla1 , E. Paz-Artal1 , A. Serrano1 1) Hospital Universitario 12 de Octubre
Introduction
Antinuclear antibodies (ANA) are a heterogeneous group of autoantibodies that can be detected in serum of patients with
autoimmune diseases and are fundamental for its diagnosis. From more than 50 years, ANA have been determined by indirect immunofluorescence assay (IIFA) using Hep-2 cells and is considered as a gold standard technique, however requires a
laborious process.
In the last years Multiplex technology was introduced for ANA evaluation, nevertheless the concordance and kappa value
between both techniques is very low, main by the high number of false positives in the Multiplex technology.
Objetives
The aim is based on analyzing the higher number of false positives.
Patients sera was analized both by Multiplex technology using Bioplex 2200 (BioRad) and IIFA on Hep-2 cells (Inova). IIFA was
considered positive for dilution >=1/160.
411 patients positive for ANA by Multiplex and negative by IIFA were followed-up 3 years. Results
312 patients (76%) become clearly positive by ANA-IIFA (more than three consecutive positive determinations) over a period
of three years. The 16%(65 patients) were in the gray area (alternative IIFA positive 1/160 or negative). The 8% (34 patients)
remained completely negative by IIFA throughout follow-up. Kappa index at three years was k=0,8.
Conclusion
Multiplex positive patients who were negative for IIFA become positive ANA-IIFA in the next three years. This enhances diagnostic accuracy up to 3 years, being able to treat faster the disease and improving life quality. It could be considered that
the presence of anti Ro and anti Centromere B in IIFA negative patients may be predictive for the positivization of the IIFA.
266
P-160 EVALUATION OF FULLY AUTOMATED IMMUNOASSAY SYSTEMS FOR DETECTION IgA ANTI B2 GLYCOPROTEIN I
D. Pérez1 , J. A. Martínez-Flores1 , M. Serrano1 , O. Cabrera1 , D. Lora1 , M. Sevilla1 , E. Paz-Artal1 , A. Serrano1 1) Hospital Universitario 12 de Octubre
Introduction
In recent years, we have been witnessing increased clinical interest in the determination of IgA anti Beta-2-Glycoprotein
I antibodies (IgA aB2GPI) as well as increased demand for this test. For this reason, we have proposed incorporating this
determination into fully automated systems. Some ELISA-based diagnostic systems for IgA aB2GPI antibodies detection are
suboptimal to detect IgA aB2GPI.
Objetives
The aim of our study was to determine whether the diagnostic yield of modern detection systems based on automatic platforms to measure IgA aB2GPI is equivalent to that of the well-optimized ELISA-based assays
130 patients were analyzed for IgA aB2GPI by three fully automated immunoassys: fluoroenzymoimmunoassay (System
1, black), chemioluminescence (System 2, grey) and multiplex technology (System 3, white) using an ELISA based-assay as
reference. The three systems were also analyzed for IgG aB2GPI with 58 patients.
Results
System-1 was able to detect IgA aB2GPI with good sensitivity and kappa index (99% and 0.72 respectively). The other two
systems were not able to differentiate sera among low and high positive values (figure 1). They had also poor sensitivity (20%
and 15%) and kappa index (0.10 and 0.07) respectively (Figure 2). On the other hand kappa index for IgG aB2GPI was >0.89
in the three systems.
Conclusion
Some analytical methods to detect IgA aB2GPI are suboptimal as well as some ELISA-based diagnostic systems. This variability may account for the discrepancy in their clinical significance. It is important that the scientific community work to
standardize analytic methods to determine IgA aB2GPI antibodies.
267
P-161 ROLE OF ANTI CITRULLINATED PROTEIN ANTIBODIES AS MARKER OF RADIOGRAPHIC DAMAGE IN A GROUP OF
PATIENTS WITH EARLY RHEUMATOID ARTHRITIS
E. Vergara Prieto1 , M. I. Alcalá Peña1 , C. Carrasco Cubero2 , J. L. Álvarez Vega2 , J. M. Salazar Vallinas2 , C. Rodríguez Godoy3 ,
D. Sánchez Paré 3 , M. L. Vargas Pérez1 1) Complejo Hospitalario Universitario de Badajoz 2) Complejo Hospitalario Universitario de Badajoz 3) Complejo Hospitalario
Universitario de Badajoz
Introduction
Autoantibodies in early rheumatoid arthritis (RA) have important diagnostic value. Anti citrullinated protein antibodies
(ACPA) and rheumatoid factor (RF) are believed to be associated with more severe clinical outcomes, in part based on a higher likelihood for structural damage.
It has recently been described that bone damage in early and even recent-onset RA is attributed to ACPAs, which form years
before clinical symptoms start to emerge.
Objectives
To assess if the baseline values of ACPA are associated with the severity of initial radiographic involvement.
The study population was 52 patients diagnosed with early RA according to ACR-EULAR 2010 classification criteria, with
ACPA positive.Serum samples at time of diagnosis were analyzed, and levels of ACPA, RF, C reactive protein (CRP) and erythrocyte sedimentation rate (ESR) were determined. Values of DAS 28, SDAI and HAQ were employed as clinical activity markers.
Radiographic damage was assessed by two independent readers, using Sharp scores modified by Van der Heijde. Comparisons between this score and ACPA levels and other serological and clinical markers were evaluated by Spearman correlation
coefficient.
Results
We show no significant radiological damage in our patients, despite all being ACPA positive. The Sharp score modified by Van
der Heijde was measured in 47 patients, with values between 0 and 101 (mean: 24.76+24.54).
We find no correlation between Sharp score and ACPA, RF, ESR and clinical activity markers, and a weak correlation between
Sharp Score and CRP (Spearman Rho: 0.459; p=0.005)
Conclusions
In our group of patients with early RA, we find no correlation between radiographic damage and ACPA titre at diagnosis. So, although ACPA could be associated with bone wound, as describedin previous studies, this is independent of the levels of antibodies.
268
P-162 STUDY COMPARING TWO ANALYTICAL METHODS FOR SEMIQUANTITATIVE DETERMINATION OF SERUM
AUTOANTIBODY IGG ANTI-CYCLIC CITRULLINATED PEPTIDE (CCP) IN RHEUMATOID ARTHRITIS: ELISA-CCPLUS®
IMMUNOSCAN AND CLIA- ZENIT RA CCP®
J. A. Hiraldo Patiño1 , M. B. Aparicio Hernández1 , F. Marqués García1 , J. M. González Buitrago Arriero1 1) Complejo Asistencial Clínico Universitario de Salamanca
INTRODUCTION
Rheumatoid arthritis (RA) is a progressive autoimmune and chronic inflammatory polyarthritis of multifactorial etiology. Clinical course of RA is a progressive deterioration of joint function. Rheumatoid factor has high sensitivity and low specificity for RA. In recent years there has developed an analysis of autoantibody IgG anti-CCP (=CCP). CCP has high specificity in
diagnosis and prognosis of RA.
Citrullination is catalyzed by peptidyl arginine deaminase and involves deamination of arginine residues filaggrin and other
proteins of the joint cavity. Transformation Arg to citrulline induce IgG anti-CCP autoantibodies in individuals with genetic
predisposition to develop RA (HLA DRB1 type).
Introduction of a new methods in the laboratory requires comparison and analytical concordance study with other standardized reference methods. Immunoassays are semiquantitative in CCP analysis (results in arbitrary units: AU/ml). Results
are not reproducible by other methods/reagents, and should be referred to their own reference ranges. Show whether the
analyte is present or not. Reference ranges and the values of
cutt-of of the CCP-marker, associated with a method/reagent
provide insight into the likelihood of a result + is associated with a pathological case. Regardless of the analytical method
and its ranks and results, clinical case should be correlated with the positivity or negativity associated with the result.
OBJECTIVES
-Study Correlation (collinearity) of semi-quantitative analytical results between the two analitycal methods.
-Check If there is qualitative analytical concordance (+/-) between the two methods and therefore its use is clinically equivalent.
MATERIAL AND METHODS
Determination of CCP in n = 44 serum samples with 2 methods:
-Method ELISA enzyme-linked immunoassay (reference): Zenit sp + analyzer (Menarini diagnostics ®), reagent CCPlus® Immunoscan. Sensitivity 1.6 UA/mL. Linearity range 1.6 to 400. Ref. range. < 25 negative for CCP
-Method CLIA chemiluminescence (new method): Zenit RA analyzer (M. diagnostics®), reagent ZENIT RA CCP®. Sensitivity 2.1
AU/ml. Linearity range 2.1 to 320. Ref. range. < 5 negative statistical methods:
- Least squares regression. Pearson´s correlation coefficient (r) - Cohen\’s kappa index
RESULTS
- X = ELISA and Y= CLIA. Regression line Y = 0.6787 X - 4.8603. Pearson´s correlation coefficient r= 0.93.
- Cohen\’s kappa index = 0.953 (95% IC: 0.863 to 1.044). Kappa is clearly in IC and show strength very good agreement.
CONCLUSIONS
Pearson r = 0.93 indicates high collinearity. Analytical relationship between the two methods is given by the equation of the line. It
can deduce that CLIA results are obtained by measuring in a range of rlinearity relatively lower ELISA due to the trial design.
Kappa index = 0.953, agreement study between qualitative variables (+/-) reveals very good agreement. The use of any of
the two methods is highly equivalent.
269
P-163 ASSOCIATION OF ANTI-YO, ANTI-HU AND ANTI-SOX1 ANTIBODIES IN CSF IN PATIENT WITH LIMBIC AND
PARALIMBIC ENCEPHALITIS IN THE SETTING OF SMALL CELL LUNG CARCINOMA
I. Gañán Nieto1 , P. B. González Urra1 , A. Tejeda Velarde1 , J. Adriano2 , Á. Carrasco Salayero1 1) Hospital Universitario Ramón y Cajal 2) Hospital Universitario Ramón y Cajal
Introduction
Onconeuronal antibodies represent a special group of AAb which are associated with paraneoplastic neurological syndromes (PNS) that usually accompany malignant tumours.
Anti-Hu and Anti-SOX1 autoantibodies are associated with small-cell lung carcinoma.
Anti-Yo autoantibodies are founded in the serum and cerebrospinal fluid of women with paraneoplastic cerebellar degeneration, associated with cancer of the ovary, uterus, adnexa or breast, being very infrequent in men. Besides, Anti-Yo antibodies are usually related with other antibodies against peripheral antigens (calcium channel, acetylcholine receptor,…),
but there aren’t known cases where it is associated with other onconeuronal antibodies. Anti-Yo antibody response is rarely
associated with other tumors, included small-cell lung cancer (SCLC), and very infrequent in men. Objectives
We present a male pacient with Paraneoplastic Multifocal Syndrome associated to small-cell lung cancer (SCLC) and positive
for anti-Yo, anti Hu and anti-SOX1 antineuronal antibodies.
Antineuronal antibodies were studied in serum and CSF by immunofluorescence assays against both mouse cerebellar and
hippocampus preparations (IIFT: Neurology Mosaic 1 of Euroimmun) and corroborated by immunoblot analysis (EUROLINE
Paraneoplastic Neurologic Syndromes 12 Ag (IgG) of Euroimmun).
We also carried out other immunological tests such as the study of oligoclonal bands (OCB) in serum and cerebrospinal fluid
(CSF) with an isoelectric focusing technique and the study of antinuclear antibodies (ANAs) through IFI.
Information about brain magnetic resonance imaging (MRI) and thoracic and abdominal CT (computed tomography) was
supplied for the Neurology Department.
Results
We present a 69 year-old male patient who developed a limbic encephalitis, who had anti-Yo, anti-Hu and anti SOX1 antibody positivity in CSF. The OCB study had a mirror pattern as result, indicating systemic inflammation. A tumor screening
in this patient disclosed a small cell lung carcinoma by CT scan and confirmed in the broncoscopy biopsy. Although he was
treated with corticosteroids, iv gamma globulin and chemotherapy, he died finally.
Conclusions
Detection of onconeural antibodies implies the search of an underlying tumor.
Presence of onconeural antibodies is associated with bad clinical prognosis.
Although the anti-Hu antibodies could have been the cause of all the symptoms, a role of the coexisting anti-Yo has to be
considered in the progression of the cerebellar syndrome. Therefore it is necessary to consider an association of antibodies
in a patient with a multifocal syndrome to search and treat each tumor adequately.
270
P-164 PERFORMANCE OF THE AUTOMATED DIGITAL IFA MICROSCOPE (NOVA View®) IN THE DIAGNOSIS OF ANCA
ASSOCIATED VASCULITIS
A. Pichel Beleiro1 , L. Mozo Avellaned1 1) Hospital Universitario Central de Asturias
Introduction
Determination of anti-neutrophil cytoplasm antibodies (ANCA) by indirect fluorescence analysis (IFA) is an essential procedure
in the serological diagnosis of ANCA associated vasculitis (AAV). However, ANCA determination is influenced by several factors
including reader’s interpretation, slide fixation and presence of other autoantibodies such as anti-nuclear antibodies (ANA).
Objective
To assess the performance of the NOVA View® automated digital IFA microscope in the routine diagnosis of AAV.
Sera from 38 AAV patients (28 anti-mieloperoxidase [MPO] positive and 10 anti-proteinase 3 [PR3] positive) at diagnosis were
analysed by IFA on ethanol and formalin-fixed neutrophil slides and on HEp-2 slides (Inova Diagnostics). Presence of ANCA
and ANA was determined both by laboratory physician microscope observation (Axioskop 2 plus, Zeiss) and automated
microscope interpretation (NOVA View®, Inova Diagnostics). Results
On ethanol-fixed slides, 37 out of the 38 AAV patients were p-ANCA or c-ANCA positive by physician evaluation. An agreement with NOVA View digital interpretation was observed in 36 cases (94,7%). By screen computer interpretation, the two
patients who were only found to be positive by physician observation (1 p-ANCA/MPO positive and 1 c-ANCA/PR3 positive)
also showed ANCA pattern correlation (100%). On formalin-fixed slides, all AAV patients displayed a c-ANCA pattern by physician observation, 25 out of them (65,8%) showing pattern agreement by NOVA View interpretation. This low correlation
was mainly due to 7 positive results without an associated ANCA pattern obtained in the digital analysis. Interestingly, 3
out of these patients were anti-PR3 positive and showed a mixed p-ANCA/c-ANCA pattern by physician observation, two
of them being also ANA positive. Thus, a positive result in formalin-fixed slides was obtained by NOVA View in 32 AAV sera
(84,2%). Nevertheless, the agreement between physician and NOVA View interpretation in formalin-fixed slides increased up
to 97,4% (37/38) by screen computer observation.
Conclusion
Automated ANCA interpretation by NOVA View shows a high agreement with physician microscope observation on ethanol-fixed slides. This correlation was lower in formalin-fixed slides mainly due to the presence of ANCA mixed patterns. 39 Congreso de la Sociedad Española de Inmunología
271
P-165 CIRCULATING IMMUNE COMPLEXES OF IGA BOUND TO BETA 2 GLYCOPROTEIN ARE STRONGLY ASSOCIATED
WITH ACUTE THROMBOTIC EVENTS
J. A. Martínez-Flores1 , M. Serrano Blanco1 , D. Pérez Mendez1 , O. Cabrera Marante1 , M. Sevilla Sánchez1 , S. Mora Diaz1 ,
I. Ezzahouri El Khalouki1 , D. Plieguezuelo Garrote1 , J. M. Morales Cerdán1 , A. Serrano Hermández1 1) Instituto de Investigacion Hospital 12 de Octubre
Introduction
IgA anti- beta2-glycoprotein I (B2GP1) antibodies (IgA aB2GP1) testing is appropriate, since Galveston 2010, when patients
present antiphospholipid syndrome (APS) symptoms and are persistently negative for consensus antiphospholipid autoantibodies (aPL). Nevertheless not everyone who has positive aPL develops thrombosis.
We recently described the presence of immune complexes of IgA bounded to B2GP1 (B2A-CIC), here we describe its clinical
consequences.
Matherial and methods
A total of 157 individuals isolate positive for IgA aB2GP1 were studied: 50 controls without any APS antecedent, 25 patients
with recent thrombotic events (TEV) (Group-1) and 82 patients with antecedents of old TEV (Group-2). Results
B2A-CIC prevalence (cut-off >21.0 AU) in Group-1 was 80.0% (20/25), significantly higher than in the Group-2, 18.2% (15/82)
and controls 16% (8/50) (p<0.001). In a multivariable analysis, positivity of B2A-CIC was an independent variable for acute
thrombosis with a 50.1 Odd ratio (CI 8.2-306.1, 95%, p<0.0001). Levels of B2A-CIC in group-1 dropped significantly two months after the TEV becoming negative the vast majority. IgA aB2GPI levels did not differ between the time of thrombosis and
monitoring (p=0.17).
B2A-CIC positive patients from all groups had lower platelet levels than B2A-CIC negative patients (187.5±9.1 vs. 235.7±7.1
platelets x 103/mm3, p<0.001) and more prevalence of thrombocytopenia (p<0.017). Group-1 patients had 123.7 ±7.1 mg/
dl and 26.0 ±2.5 mg/ dl C3 and C4 mean levels respectively, Group-2 patients had 121.1 ±4.6 mg/dl and 23.7 ±1.3 mg/ dl
C3 and C4 mean levels respectively, and Control group had 113.4 ±3.9 mg/ dl and 22.8 ±1.0 mg/ dl C3 and C4 mean levels
respectively and there were not significant differences.
Conclusions
The positivity for B2A-CIC is strongly associated with acute thrombotic event. Patients who did not develop thrombosis
and were B2A-CIC positive had lower platelet levels, which suggest a hypercoagulable state. This mechanism seems to be
unrelated to complement-fixing aPL. B2A-CIC could potentially select IgA aB2GP1 positive patients at risk of developing a
thrombotic event and may help the management of APS patients.
272
P-166 CXCL7 AND TRAIL MRNA ARE OVERPRESSED IN BLOOD OF MULTIUPLE SCLEROSIS PATIENTS IGM(+) VERSUS IGM(-)
L. Aragon Iruskieta1 , M. Saenz Cuesta1 , A. Bermejo Becerro1 , H. Irizar2 , M. C. Maider2 , O. Q. Iñaki2 , C. T. Tamara3 , O. B. David2 ,
O. U. Javier3 , P. I. Alvaro1 1) Laboratorio de Inmunología 2) Unidad de Esclerosis Múltiple 3) S. Neurologia
Introduction
Presence of Oligoclonal bands (OCBs) IgM+ in Multiple Sclerosis (MS) patients has been associated with worse prognosis,
faster conversion to progressive forms, increased number of relapses and higher disability compared with patients with
OCBs IgMObjetives
Search a blood mRNA biomarker of IGM+ status.
mRNA expression of a panel of cytokines and interleukins in PBMC and CSF samples from 18 patients with OCBs IgM+ and 18
patients with OCBs IgM-. Neurofilament Light (NFL) have been also quantified in the 36 CSF samples by ELISA.
Results
1. mRNA expression of PBMC: IgM + vs IgM - Overexpression of TRAIL (FC:3.7) and CXCL7 (FC:2.11) has been detected in IgM+ group vs IgM – (p < 0.05), moreover, although in low expression levels, IL13 (FC:5) and BMP2 (FC:3.2) present also overexpression in the IgM+ group
2.mRNA expression in CSF: IgM+ vs IgM- Although IL22 is expressed at low levels, it can be detected in 35/36 patients. No differences have been found between
IgM+ vs IgM-.
- Despite that data has to be interpreted with caution due to the low expression levels (Ct values around 35 ), differences at
the expression levels of CCL7, CXCL, CXCL9, IL-18, MSTN and ACTB has been detected.
- NFL present no differences between the groups.
Conclusions
CXCL7 and TRAIL mRNA overexpression must be validated but our data point to a potential utility of these genes as surrogated IG-CSF status biomarker.
273
P-167 ACTIVATED CIRCULATING IMMUNE SYSTEM AND A HIGHER EXPRESSION OF PSGL-1 IN PATIENTS WITH
SYSTEMIC SCLEROSIS
J. Silván Montoya1 , A. Pérez Frías1 , R. González Tajuelo1 , S. Castañeda Sanz1 , E. Vicente Rabaneda1 , A. Urzainqui Mayayo1 1) Hospital Universitario de La Princesa
Introduction
PSGL-1 is a higly glycosilated protein expressed in the membrane of all leukocyte subsets. PSGL-1 has two main functions,
one during the first steps of extravassation, regulating the capability of leukocytes to migrate into the tissues and the other
one in mantaining the immune system homeostasis by sending tolerogenic signals when interacting with P-selectin.
Systemic Sclerosis (SSc) is an autoimmune disease characterized by activation of the immune system, generation of autoantibodies, vascular activation, skin fibrosis and involvement of internal organs, such as kidney and lungs. The more severe
form of the disease presents pulmonary arterial hypertension, which is the main cause of death.
Mice lacking PSGL-1 reproduce a syndrome similar to human SSc, suggesting the implication of this molecule in the development of this connective tissue disease.
Objectives
1. To study the circulating populations of leukocytes in SSc patients
2. To analyze the expression of PSGL-1 in the circulating leukocytes of patients with SSc
Blood samples from patients with SSc and healthy donors were collected and the circulating cells were immunostained for
FACS analysis. Comparisons between patients and healthy donors were assessed using Student´s t-test. A p<0.05 level of
statistical significance was used for all analyses. Statistical procedures were performed using IBM SPSS Statistics 22.
Results
We have found altered circulating leukocyte populations in SSc patients, which showed higher percentage of neutrophils
and decreased percentage of lymphocytes. In addition, SSc patients presented higher percentage of CD16+ CD14+ cells
among total monocytes (CD14+). This population is described as proinflamatory and has been reported to be implicated in
other autoimmune diseases as Rheumatoid Arthritis.
Monocytes and dendritic cells of SSc patients presented higher expression of MHC-II (HLA-DR) indicating increased activation and a higher capability of antigen presentation. Importantly, SSc patients showed higher expression of PSGL-1 compared with healthy donors.
Conclusions
Pathogenesis of SSc is yet unknown, although the involvement of the immune system is clear. It has been described that
PSGL-1 expression increases in human DC after activation with LPS or TNF and that the signaling of PSGL-1 reduces the expression of MHC-II in these cells, suggesting a role for PSGL-1 in the control of DC activation and hence in the control of the
immune response. In this study we show a higher expression of both, PSGL-1 and MHC-II in the membrane of leukocytes
isolated from SSc patients, suggesting that PSGL-1 signaling is altered in SSc patients and that this alteration could be implicated in the overactivation of the immune system and SSc pathogenesis.
274
P-168 FREQUENCY AND CLINICAL RELEVANCE OF ANTI-U1 RNP A AUTO-ANTIBODIES BY MULTIPLEX ASSAY
A. Rubio de La Rosa1 , B. Padilla Merlano1 , M. C. Salcedo Moreno1 , M. A. Julián Viñals1 , F. Yáñez Pereira1 , E. Marco Castro1 ,
M. J. Marcos Gutiérrez1 , R. Álvarez Doforno1 1) Hospital Universitario La Paz
Introduction
Anti-RNP antibodies show a high incidence in different autoimmune diseases, like mixed connective tissue disease, appearing in approximately 40% of patients with systemic lupus erythematosus (SLE). The target protein of this autoantibody is a
small ribonucleoprotein (U1 RNP) that contains three autoantigens (A, C and 68 kDa), localized in the nucleoplasm of cells,
with the exclusion of the nucleoli. No clear association has been found between anti-U1 RNP A Ab and diseases, neither autoimmune nor of any other kind. Previous studies indicate that these autoantibodies may be used as predictive markers of
SLE, as they could be detected three years before the diagnosis.
Objectives
To stablish the frequency and clinical utility of anti-RNP A Ab using BioPlex® 2200 Multiplex Assay in day-to-day autoimmunity laboratory work.
6954 sera from patients were analyzed using the Luminex assay (BioPlex 2200 ANA Screen, Bio-Rad), that is able to measure
13 autoantibodies simultaneously. Anti-cellular antibodies (ANA) were detected using indirect immunofluorescence (IFI) on
HEp-2 cell slides (EUROIMMUN AG Lübeck). A commercial dot-blot (INNO-LIA ANA Update, FUJIREBIO) was used as a confirmatory multiparametric test. Patients’ clinical data was collected.
Results
Of the total of sera analyzed, 82 (1,2%) were positive for anti-RNP A Ab with a titer higher than 3 AU/ml. 40% of these sera (33/82)
were ANA positive by IFI and different ANA patterns were observed. From these positives, only 4 were confirmed as isolated anti-U1 RNP A Ab by the INNOLIA test, while 17 were associated with another autoantibody (anti-U1 RNP C, anti-U1 RNP 68 kDa,
anti-Sm, anti-Ro). Most of these patients had an autoimmune disease diagnosis (82%, 27/33), with a high incidence of SLE (33%).
60% of the sera (49/82) showed a negative IFI, 16 of them with a titer higher than 7 AU/ml tested by BioPlex. Only 5 were confirmed as isolated anti-U1 RNP A Ab by INNOLIA, and one was associated with anti-Ro Ab. This group of patients had different
diagnosis of non-autoimmune diseases (81%, 39/48).
Conclusions
Anti-U1RNP Ab detected by Bioplex:
Have low frequency and not all of them are confirmed by other tests.
Show a high percentage of negatives by IFI and positives show multiple patterns.
That show positive IFI appear alongside other autoantibodies and are associated with different autoimmune diseases. In the
cases where anti-U1 RNP A Ab is found isolated, there should be a specific follow-up, to evaluate it as a predictive marker of
the earliest stages of SLE.
That show negative IFI are found in non-autoimmune diseases and those with a low titer, in the absence of an associated Ab,
don’t seem to have any clinical relevance. More studies are neccesary to confirm this data.
275
P-169 AUTOANTIBODIES TO 3-HIDROXY-3-METHYLGLUTARYL-COENZYME A REDUCTASE (HMGCR) IN PATIENTS WITH
INFLAMMATORY MYOPATHIES. EXPERIENCE IN “GRUPO AUTOINMUNIDAD DE MADRID”
B. Padilla Merlano1 , A. Rubio de La Rosa1 , P. Martínez Hernández1 , G. Roy Ariño2 , M. D. C. Vegas Sánchez3 , M. J. Martínez
Becerra3 , A. Plaza López4 , R. Álvarez Doforno1 1) Hospital Universitario La Paz 2) Hospital Ramón Y Cajal 3) Hospital Universitario Fundación Jiménez Díaz 4) Hospital Puerta De
Hierro
Introduction
Statins are drugs for the treatment of dyslipidemia and reduction of cardiovascular risk. Its mechanism of action consists in a
competitive inhibition of enzyme HMGCR. One of the side effects observed for this type of drugs is myotoxicity and the development of a necrotizing myopathy, where it is described the presence of anti-HMGCR antibodies. Autoimmune necrotizing
myopathy is characterized by a sudden or subacute onset, a progressive course ending up in severe muscular weakness and
elevated serum creatine kinase (CK) levels. Antibodies against signal recognition particle (SRP) have also been associated to
this myopathy. Autoimmune myopathy secondary to statin treatment persists after drug discontinuation.
Objectives
To determine the clinical and immunological characteristics of our patients with suspected inflammatory myopathy positive
anti HMGCR antibodies.
Patients and methods:
This study included sera from 129 patients, 53 men and 76 women, with an average age of 60 years (7-90), from hospitals
members of the Grupo Autoinmunidad de Madrid (GAIM). Patients were divided in: treated with statins with muscle symptomatology (45); inflammatory myopathy (78), and myopathy with anti SRP positive (6). For the detection of anti-HMGCR
antibodies a commercial Kit (QUANTA Lite ® HMGCR ELISA.Inova Diagnostics, Werfen) was used. Results higher than 20 UI/
mL were considered positive. For the detection of anticellular antibodies (ANA) was used indirect immunofluorescence on
slides of HEp-2 cells. For the study of myositis specific antibodies the “Euroline autoimmune inflammatory myopathies 16 Ag
(IgG)” (EUROIMMUN) was used. Clinical data were collected from patients records.
Results
Anti HMGCR antibodies were detected in 11 patients: 7 belong to the group treated with statins with muscle symptomatology and 4 to the inflammatory myopathy group (one of which was treated with statin). All of them had progressive muscle
weakness. The levels of CK were elevated in all the patients.
In the study of muscular biopsies 4 autoimmune necrotizing myopathies (1 without consumption of statin) and 7 inflammatory myopathies (2 in pediatric age without consumption statin) were found.
The electromyogram was compatible with inflammatory myopathy in 9 patients. No other myositis specific autoantibodies
were detected in any of these patients.
During the follow up of these patients a decrease of the levels of anti-HMGCR antibodies was observed, as well as of CK levels, associated to a medical improvement.
Conclusions
(I) Anti-HMGCR antibodies
Can be present in patients treated or not with statins.
Are detected in adults and children.
Not all patients with these antibodies have an autoimmune necrotizing myopathy.
Are not associated with other specific antibodies of myositis
(II) Anti-HMGCR antibodies are helpful for clinical monitoring. The titer correlates with elevated CK levels and its decline with
clinical improvement of the patient.
276
P-170 OXIDATIVE STRESS IS ELEVATED IN MONOCYTES FROM MULTIPLE SCLEROSIS PATIENTS
S. Medina1 , N. Villarrubia1 , S. Sainz de La Maza2 , L. Costa-Frossard2 , J. C. Álvarez-Cermeño2 , L. M. Villar1 1) Hospital Ramón y Cajal 2) Hospital Ramón y Cajal
Introduction
Multiple sclerosis (MS) is a chronic autoimmune disease of central nervous system (CNS) causing inflammation myelin loss,
axonal damage, and progressive neurologic dysfunction.
The understanding the pathogenesis of MS is challenging. Many studies involved T and B cells as key mediators of neurologic
manifestations taking place in MS. However, recent studies suggest that innate immune cells could have an important role
in driving the pathologic immune response in MS.
Objectives
To study the oxidative stress levels in different monocyte subsets (classical, intermediates and non classical) from MS patients
and controls and explore its correlations with different lymphocyte and NK cell subsets.
Peripheral blood lymphocytes from 20 untreated MS patients and 15 age and sex matched controls was analyzed by flow
cytometry. We analysed activated and regulatory T CD4+ T cells, memory, activated and regulatory B cells and effector and
regulatory NK cells. We also explored classical, intermediate and non classical monocyte subsets. The oxidative stress was
analyzed in monocytes with mitosox red mitochondrial superoxide indicator.
Results
Peripheral blood monocytes from MS patients had higher levels of oxidative stress that that of healthy controls when assaying total monocytes (p=0.02), the classical subset (CD14hiCD16-, p=0.01), the intermediate (CD14hi CD16+, p=0.01) and
the non classical (CD14lowCD16+, p=0.02) one. No differences in the percentages of other leukocyte subpopulations were
observed between patients and controls.
We explored in MS patients if the percentages of monocytes showing oxidative stress correlated with other lymphocyte
subsets and found a linear correlation with CD4+activated lymphocytes (r=0.45, p=0.001). This association was closer when
classical monocytes were studied (CD14++CD16-, Red Mitosox+) (r=0.50, p=0.0005)
Conclusions
MS patients show higher levels of oxidative stress in monocytes than healthy individuals. The levels of oxidative stress correlate closely with CD4+ T cell activation, thus suggesting that oxidative stress may play a role in maintaining the abnormal T
cell response characteristic of the disease.
277
P-171 CD6 EXPRESSION ENSURES PROPER REGULATION OF IMMUNE RESPONSES INVOLVING CELL-CONTACTDEPENDENT ANTIGENIC CHALLENGE
M. Consuegra-Fernández1 , M. Martínez-Florensa1 , F. Aranda1 , D. S. José2 , N. Armiger-Borràs1 , M. Orta-Mascaró1 , E. Carreras1 ,
V. G. Martínez1 , P. Engel2 , F. Lozano3 1) Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS) 2) Facultat de Medicina, Universitat de Barcelona 3) Hospital
Clínic de Barcelona
Introduction
CD6 is a lymphocyte surface receptor modulating intracellular signals mediated by the T-cell receptor complex (TCR) to
which it is physically associated. The interaction of CD6 with its main reported ligand, CD166/ALCAM (Activated Leukocyte
Cell Adhesion Molecule), is critical for the stabilization and maturation of the immunological synapse (IS) between Antigen
Presenting Cells (APC) and T-cells as well as for transmigration of T cells to inflamed tissues. However, most of the available
information on this subject comes from in vitro systems, making its in vivo function a yet unresolved question.
Objectives
To investigate the in vivo and in vitro consequences of CD6-deficiency in a mouse model of autoimmunity involving cell contact-dependent antigenic challenge.
Phenotypical and functional characterization of lymphocyte subsets from CD6-deficient (CD6-/-) and wild-type (CD6+/+)
C57BL/6 mice was performed following chronic graft-versus-host (cGvHD)-induced lupus-like disease upon transfer of MHC
class II (Ia)-incompatible allogeneic B6.C-H-2bm12/KhEg (bm12) splenocytes. Similar studies were performed following in vitro
stimulation of CD6-/- and CD6+/+ splenocytes with either allogeneic (bm12) cells or monoclonal antibody (mAb)-induced
crosslinking of CD3 and CD28 in the presence of different cytokine agonists and antagonists.
Results
Compared to CD6+/+ littermates, CD6-/- mice presented higher serum autoantibody titers but lower splenomegaly, associated
with decreased in vivo splenocyte proliferation and relative higher frequency of B2 and Treg cells. Functional in vitro analyses
following allogeneic stimulation revealed significantly decreased T-cell proliferative responses together with increased induction of regulatory T cells (Treg) of low suppressive activity by CD6-/- mouse cells. However no significant differences were
observed between CD6-/- and CD6+/+ mouse splenocytes regarding T-cell proliferative responses and Treg cell induction upon
in vitro stimulation with anti-CD3 plus anti-CD28 mAb in the presence or absence of cytokines (IL-2 and TGF-β)
Conclusions
These data indicate that the dysregulated autoimmune response observed in CD6-/- mice likely results from abrogation of
CD6-CD166/ALCAM interactions rather than cell intrinsic signalling defects.
This work is supported by grants from Worldwide Cancer Research (14-1275), Fundació La Marató TV3 (201319-30), and
Spanish Ministerio de Economía y Competitividad (Plan Nacional I+D+i, SAF2013-46151-R, SAF2012-39536) - co-financed by
European Development Regional Fund “A way to achieve Europe” ERDF.
278
P-172 DC-SIGN+ MACROPHAGES INDUCE TRANSPLANTATION TOLERANCE
P. Conde-San Román1 , J. Cano-Ochando1 1) Instituto de Salud Carlos III
Introduction
Macrophage accumulation in the transplanted organ has long been recognized as a feature of allograft rejection. It was
described that immunogenic Ly6Chi monocytes infiltrate the allografts and contribute to the signature of organ rejection.
However, the plasticity of macrophage activation allows for a regulatory phenotype depending on the tissue environment,
so inflammatory Ly6Chi monocytes can develop into regulatory Ly6Clo macrophages once the inciting inflammatory stimulus has been resolved.
Objectives
Identify the origin and developmental factors that characterize the conversion of immune stimulatory Ly6Chi monocytes into
regulatory Ly6Clo macrophages.
BALB/c hearts were transplanted as fully vascularized heterotopic grafts into C57BL/6 mice as previously described (Corry
et al., 1973). Recipient mice were treated with 250 mg anti-CD40L mAb (iv). For Suppression Assays, spleens of C57BL/6 or
C57BL/6-Foxp3tm1Flv/J mice were gently dissociated into single-cell suspensions. Splenocytes were either stained with
anti-CD4 mAb, or labeled with CFSE followed by staining with anti-CD8 mAb. Responder FoxP3+CD4+ and CFSE+CD8+ T cells
were sorted using FACS Aria II. Stimulated FoxP3+CD4+ or CFSE+CD8+T cells were cultures with graft infiltrating Ly6Chi, Ly6Clo, and Ly6G+ myeloid cells for 4 days. T cell proliferation was measured by flow cytometric analysis of CFSE dilution on CD8+
T cells. Treg expansion was measured by flow cytometric analysis of Foxp3 RFP on CD4+ T cells.
Results
We demonstrate that suppressive macrophages expressing Ly6CloCD169+ are responsible for transplantation tolerance. Blockade of the CD40L-CD40 costimulatory pathway promotes the conversion of immunogenic Ly6ChiCD169- into regulatory
Ly6CloCD169+ macrophages. Costimulatory blockade requires CSF1 cytokine upregulation and partial prevention of interferon-gamma (IFN-g) in the transplanted allograft. We also, demonstrate that the dendritic cell-specific ICAM-grabbing non-integrin (DC-SIGN, CD209a) is upregulated in suppressive macrophages. Additionally we confirm that DC-SIGN engagement
by fucosylated ligands together with TLR4 triggering is necessary for production of immunoregulatory interleukin-10 (IL-10)
associated with immune regulation and prolonged allograft survival.
Conclusions
We demonstrate that graft-infiltrating DC-SIGN-expressing macrophages are required for the induction of transplantation
tolerance revealing a previously unknown function of mouse DC-SIGN. Phenotypic characterization of graft-protective regulatory macrophages as well as the mechanisms required to control their differentiation in vivo, have important implications
for understanding and potentially manipulating pathogenic immune responses.
279
P-173 ANTI -RNP DETECTION BY BIOPLEX® : FALSE POSITIVE OR TRUE DISEASE?
R. Téllez Pérez1 , M. D. C. Vegas Sánchez1 , F. J. de La Hera Fernández2 , E. Sancho Cadenas1 , P. Tramón Gutierrez1 , C. Serrano
del Castillo1 , M. J. Martínez-Becerra1 1) Fundación Jiménez Díaz 2) Fundación Jiménez Díaz
Introduction
Multiplex tecniques are replacing traditional assays for ANA determination.
In our lab, Bioplex® 2200 ANA Screen, based on dsDNA, Sm, RNP-70, RNP-A, SSA, SSB, Scl-70, Jo-1, CENP-B, Ribosomal-P, Chromatin and U1RNP has been in use for 1,5 years long.
The rates of positive results for anti-RNP antibodies (Abs) proven relatively high from the start, despite many of them being
negative for the entire complex U1RNP (isolated anti-RNP).
Objectives
The aim of this work is to identify the prevalence of isolated anti-RNP on ANA Bioplex®. Study these sera behavior by Indirect
Immunofluorescence (IIF). Find out clinical phenotype associated to isolated anti-RNP.
We retrospectively evaluated patients displaying isolated anti-RNP -RNP 70 and/or A without anti-Sm or anti-Sm/RNP(=U1RNP)- from February 1st to March 31 st 2015 (Bioplex® 2200 ANA Screen -Positive >1 Index, Bio-Rad®)
Serum samples were obtained from patients referred to our laboratory. Samples were evaluated by IIF (Hep-2, Inova Werfen®). Clinical data and other analytical parameters were collected by systematic review of patient´s records.
Results
Positive ANA screen was detected in 643 out of 3997 patients analyzed; 125 (19,45%) had an isolated anti -RNP (70 or A).
Mean age was 60 ± 16 years, 72% were female.
For reference, the prevalence of other Abs were: anti-SSA, 130 (20,21%) and anti CENP-B, 50 (7,77%).
54% presented anti-RNP values between 1-2 Index (Cut off> 1 Index). 9,6% had high titers, above upper detection limit (8
Index). Anti-U1RNP titer was below the limit of detection (<0.2) in 92% of these samples.
108 out 125 patientes were tested by IIF. 60% were negative. Positive IIF was observed mainly in female, 79%, mean age 58 ±
17 years. The most common pattern was homogeneous (46,5%) at low titer -1/80-, 60%. 21% of these were also positive for
other ENA (anti-dsDNA, SSA and SSB). Nuclear coarse granular staining was not present in any of the patients.
Clinical data were obtained for 108 out of 125 patients. (Table 1)
280
Conclusions
We found greater prevalence of isolated positive anti-RNP than expected, it being as high as other antibodies typically more
frequent such as anti-SSA.
With many samples displaying levels slightly above the cut-off value proposed by the manufacturer, ROC-adjusted cut-off
could help partly to overcome this problem. Nevertheless, yet there is a remarkable proportion of samples at very high levels.
As of now, there is no significant clinical relationship between these isolated RNP and key phenotypic features of Mixture
Tissue Connective Disease (MTCD). These facts, together with the high proportion of patients with negative IIF, lead us to
hypothesize we are facing false positivity, thus these results should be interpreted cautiously during clinical practice.
Nevertheless, follow-up and additional techniques could help to confirm that this isolated anti-RNP does not correspond to
preclinical stages of the disease.
281
P-174 CHARACTERIZATIONOFDENDRITICCELLSGENERATEDFROMTHEMYELOIDCELLLINEMUTZ-3:USEINAUTOIMUNITY
C. Calviño Sampedro1 , Ó. J. Cordero Santamaría2 , J. Viñuela Roldán3 , A. Castro Lareo4 , R. Varela Calviño1 1) Facultad de Farmacia (Universidad de Santiago de Compostela) 2) CIBUS (Universidad de Santiago de Compostela) 3) Centro
Hospitalario Universitario de Santiago de Compostela 4) Agencia Gallega de sangre, órganos y tejidos
Introduction
Dendritic cells (DCs) represent the most important antigen presenting cell (APC) and are capable of generating either an
antigen-specific inflammatory or a tolerant immune response according to their phenotype. However, one of the major
problems studying those cells is the number that can be obtained from the differentiation of peripheral blood monocytes,
so another cellular sources are needed to study factors that determine their tolerance phenotype.
Objectives
The main objective of this work was to study the phenotype and tolerance capacity of DCs generated from the myeloid cell
line MUTZ-3 and their response to vitamin D3, to evaluate the possibility of using those in tolerance studies in autoimmunity.
DCs were generated from the myeloid cell line MUTZ-3 using GM-CSF and IL-4 and mature using LPS and IFN-g, either in
the absence or presence of vitamin D3. To compare DCs obtained from peripheral monocytes were also generated. Several
markers of activation and tolerance were quantified by both flow cytometry and RT-PCR.
Results
The cultivation of the MUTZ-3 cell line in the presence of GM-CSF and IL-4 allows the generation of DC-like cells, expressing
DC markers such as CD1a or DC11c. After activation, those DC-like cells up-regulate the expression of several activation markers such as CD83. However, important differences regarding several markers linked to tolerance phenotype can be detected
when compared to DCs generated from peripheral monocytes; moreover, this cells seems to respond differently to vitamin
D3, an agent known to induce a tolerance phenotype in DCs.
Conclusions
The myeloid MUTZ-3 cell line has been typically used as a surrogate cell to generate high numbers of DC-like cells to substitute the scarce DCs generated from peripheral monocytes. Although several studies indicates that those cells could be used
in studies where a pro-inflammatory response is needed, their use in studies where a tolerazing immune response is required
seems more limited because the expression of markers associated with this phenotype are expressed at significantly different levels and their unresponsiveness to agents known to induce a tolerance phenotype in DCs.
282
P-175 IGG VERSUS IGA ANTI-DEAMINATED GLIADINES IN THE DIAGNOSIS AND MONITORING OF CD. A RETROSPECTIVE
STUDY
J. Blas Espada1 , C. Vegas Sánchez1 , R. Téllez Pérez1 , S. Farrais Villalba1 , M. J. Martínez Becerra1 1) Hospital Universitario Fundación Jiménez Díaz
Introduction
The role of serological tests such as IgA anti-transglutaminase autoantibodies (tTG) has become increasingly important in
coeliac disease (CD) diagnosis. However, the efficiency of IgG and IgA anti-deaminated gliadines (DGP) is more controversial.
Objectives
To study the added value of measuring IgG and IgA DGP in CD suspicion with positive tTG.
We retrospectively evaluated 146 random patients with clinical suspicion of CD and IgA tTG positive from Feb. 2014 to Aug.
2015. Normal IgA and gluten-containing diet at analysis were confirmed.
IgA tTG, IgG and IgA DGP were measured by QuantaLyser (Feb.14-Jul. 14; Positive >20 Inova Werfen®) or BioPlex (Aug. 14Aug. 15; Positive >15; BioRad®) in all samples.
Patients were stratified according to serological profile: Group 1 (Positive IgA tTG+IgG and IgA DGP), Group 2 (tTG+IgG DGP),
Group 3 (tTG+IgA DGP) and Group 4 (isolated tTG).
EmA, HLA typing and duodenal biopsies were performed when required for diagnostic purposes.
T test was used to compare IgA TG levels. P values <0.05 were considered significant.
Results
Mean age was 19 years (1-70), 71% female. 90 had HLA typing, non-DQ2/DQ8 were not described in our cohort. The most
frequent profile was Group1, with the highest anti-tTG and IgG DGP levels (Table 1) (tTG vs Groups2 and 4 p<0.05; IgG-DGP
vs Group2 p<0.05).
Globally, 92%(135) patients were diagnosed with CD -age 19 years (1-70)- mean tTG levels were 10 xULN (multiplicity factor
of cut-off ). 92% had IgG DGP, 87% had IgA DGP. When tested: 115/116 (99%) had positive EMA and 72/83 (87%) showed
duodenal histology Marsh3. 81% belonged to Group1.
11 (8%) patients were non-CD (age 18 (2-61)). On average, TG levels were 4 xULN. When tested: 7/7 (100%) had low positive
EMA and 7/7 (100%) showed Marsh0. 55% belonged to Group2.
25/146 were monitored after GFD instauration (follow-up 6 months, 4-8). 100% had tTG tested at follow-up, showing a mean
reduction of 71% vs. pre-GFD. Regarding IgG-DGP, 7/25 had it tested, with a mean reduction of 81%. Follow-up IgA-DGP was
available in 23/25 patients, with a mean decrease of 79%.
Conclusions
When tTG associates to DGP it frequently goes along with both IgA and IgG. Triple positivity is extensively described in CD,
even in adults. This profile is linked to the highest prevalence of Marsh 3 and tTG highest levels. An exception is tTG+IgA DGP
profile, which displays similar tTG and IgA DGP levels, together with a high rate of CD. These results may point out to a higher
specificity of tTG+IgA DGP compared to isolated tTG or tTG+IgG DGP.
Antibody clearance under GFD follows a similar rate in tTG, IgG and IgA DGP thus allowing CD-monitoring. 39 Congreso de la Sociedad Española de Inmunología
283
284
P-176 CLINICAL IMPLICATIONS AND ANALYTICAL PROFILE OF ISOLATED ANTI-Β2 GLYCOPROTEIN ANTIBODIES
M. D. C. Vegas Sánchez1 , L. Dejanire Santacruz Orué1 , J. Blas Espada1 , R. Tellez Pérez1 , O. Sánchez Pernaute1 , M. J. Martínez
Becerra1 1) Hospital Universitario Fundación Jiménez Díaz
Introduction
Anti-β2 glycoprotein antibodies (β2GPI) represent a highly specific serologic test for Anti-Phospholipid Syndrome (APS)
diagnosis, less sensitive than anti-cardiolipin (aCL). Some reports demonstrate that anti-β2GPI-domain I specific antibodies,
are associated with increased risk of thrombosis or pregnancy complications. On the other hand, isolated β2GPI has been
described on non-APS diagnosis such as atopic dermatitis.
Objective
Identify the analytical profile and clinical implications of isolated anti-β2GPI positivity, non-aCL-dependant.
Samples meeting the inclusion criteria (anti-β2GPI APS-criteria ->40GPL and/or MPL- persistent for at least 12 weeks, aCL-independent -<40 GPL/MPL- were randomly selected. Antiphospolipid antibodies (aPLs) were analyzed by ELISA (Quantalyser,
INOVA Werfen®). Positivity was classified as weak (20-40 GPL/MPL), moderate (40-80 GPL/MPL) or strong (>80 GPL/MPL). APS
clinical manifestations (APS), APS-related (APSr) features and Lupus Anticoagulant (LA) were recorded for all patients. Control
group (31 sex and age-matched individuals tested routinely for aPLs and LA with negative results) was included.
Results
141 samples (29 patients, 79% females, mean age 61) were included (4.8 samples/patient). 86% were IgM isotype. After 21
months of follow-up 21% developed other aPL.
Long-term persistency was confirmed in 79% (follow-up 22 months). Of these, at basal: 38% displayed moderate levels and
70% strong positivity. 34% were LA positive.
When anti-β2GPI was persistent, APS clinical features appeared in 44% -mostly thrombosis (70%)-. 35% had APSr -mainly
thrombocytopenia (75%)-.
APS was diagnosed in 17% of persistent anti-β2GPI, a further 22% was tagged as probable APS.
6 patients were transiently positive (follow-up 29 months), mean time to negative 14 months). At baseline, 3 had moderate
and 3 strong levels, with no positive LA. APS clinical features showed up in 5; 1 was diagnosed with APS (17%).
Moreover, in control group (77% female, age 59) 29% had APS clinical criteria, mainly thrombosis (25%); in 16% APSr were
described.
Globally, at last follow-up, levels were stable in 62% patients. All patients who developed other aPL along the study had
persistent anti-β2GPI.
Conclusions
Isolated anti-β2GPI generally appear at high levels, stable at long-term.
The higher rate of APS/APSr manifestations in the study population, as opposed to control group, might signal a role for
anti-β2GPI in these clinical settings.
A higher prevalence of APS/probable APS diagnosis seems to be related to long-term persistency of anti-β2GPI, where indeed positive LA and extra-aPL development are gathered. A differential epitope recognition in persistent vs transient antibodies could explain this bimodal behaviour.
285
P-177 GRANZYME A CONTRIBUTESTO INFLAMMATORY ARTHRITISTHROUGH STIMULATION OF OSTEOCLASTOGENESIS
L. Santiago García1 , C. Menaa2 , M. Arias Cabrero1 , P. Martin3 , P. Jaime Sánchez1 , S. Metkar4 , N. Erill5 , V. González5 , E. Esser2 ,
S. Raja2 , M. Simon6 , S. M. Sprague2 , C. Gabay3 , L. Martínez-Lostao1 , J. Pardo Jimeno1 , C. J. Froelich2 1) Instituto de Investigación Sanitaria Aragón (IIS Aragón), Biomedical Research Centre of 10 Aragon (CIBA), 50009, Zaragoza,
Spain 2) NorthShore University Healthcare System, Evanston, IL, USA 3) University of Geneva, School of Medicine, Geneva, 13
Switzerland and Division of Rheumatology, University Hospital Geneva, Switzerland 4) TheraTest Laboratories Inc, Lombard, IL,
USA 5) Althia Laboratories, Barcelona, Spain 6) Max-Planck-Institute for Immunology and Epigenetics, Freiburg, 17 Germany
Objective
Granzyme A (GzmA) is elevated in the plasma and synovium in RA patients suggesting the involvement of the protease in
its pathogenesis. GzmA contributes to sepsis by regulating proinflammatory cytokine production. We evaluated the contribution of GzmA to the pathogenesis of RA in vivo and the possibility that GzmA via TNF-α stimulates osteoclastogenesis.
Methodology
Inflammatory arthritis induced by type II collagen was evaluated in wild type, GzmA deficient and perforin deficient mice.
Osteoclastogenic potential of GzmA was evaluated in vitro on bone marrow and CFU-GM cells and in vivo using GzmA deficient mice.
Results
Gene deletion of GzmA attenuates CIA, including pro-inflammatory cytokines in serum and join damage and bone erosion
in affected mice, suggesting that osteoclast activity is reduced in the absence of GzmA. Accordingly, GzmA-treated bone
marrow cells produce multinucleated cells that fulfill criteria for mature osteoclasts: tartrate-resistant acid phosphatase activity, β-integrin and calcitonin receptor expression plus resorptive activity on dentine slices. GzmA appears to act without
accessory cells and its activity is not affected by osteoprotegerin suggesting a minor contribution of RANKL. It also induces
expression and secretion of TNF-α and neutralization of TNF-α or stimulation of CFU-GM cells from TNF-α-/- mice prevents
GzmA-induced osteoclastogenesis. Finally, GzmA deficient mice presented reduced osteoclastogenesis in vivo (less calcitonin receptor positive mutinucleated cells and less transcripts for cathepsin K, MMP-9 and TRAP in joints) and reduced levels
of CTX-I in serum.
Conclusion
GzmA contributes, in part by promoting osteoclast differentiation, to the joint destruction in RA.
286
P-178 EXTRACELLULAR ATP AS AN EARLY DANGER SIGNAL DURING ALLOGRAFT REJECTION
J. Amores-Iniesta1 , C. M. Martínez1 , M. Barberà-Cremades1 , A. Baroja-Mazo1 , P. Pelegrín1 1) Instituto Murciano de Investigación Biosanitaria-Virgen de la Arrixaca (IMIB-Arrixaca)
Introduction
The immune system is activated in response to foreign non-self components that represent a danger to the host, such as pathogenic microorganisms. However, harmful agents for the host could also be of endogenous origin and activate immunity,
leading to ‘sterile’ inflammation. A challenging unexplored scenario for this model is the activation of the immune system in
allogeneic transplantation, where a strong Th1 destructive immune response is developed against ‘sterile’ foreign non-self
but ‘not-dangerous’ tissue grafts.
Objectives
Determine the role for extracellular ATP and the Nucleotide oligomerization domain-, Leucine-rich repeat-, and Pyrin domain-containing 3 (NLRP3) inflammasome as a danger signalling during allotransplantation.
An in vivo skin transplantation model was performed using male C57 BL/6 mice as recipients and either C57 BL/6 mice donors (for syngeneic transplantation) or Balb/c mice donors (for allogeneic transplantation). Recipients from different knockout strains were used to compare with allotransplants on wild type mice. After 3 and 7 days the concentration of extracellular
ATP was determined by bioluminescence using pmeLuc reporter cells, cytokines were determined in the graft and serum,
and histology was used to analyse rejection score.
Results
We found that in allotransplants extracellular ATP concentration increase, suggesting that this nucleotide acts as an early endogenous danger signal released after innate sensing of allogeneic tissues. Antigen-presenting cells recognizing non-self antigens are responsible for the early elevation of extracellular ATP. In this process, P2X7 receptor plays a key role and activates
the NLRP3 inflammasome. Furthermore, NLRP3 inflammasome induces the release of interleukin (IL)-18 that establish a Th1
response against the allotransplant via interferon-γ (IFN-γ) production. P2X7 receptor pharmacological inhibition, or genetic
deficiency of P2X7 receptor or NLRP3 inflammasome resulted in a delayed graft rejection without complete immune paralysis.
Conclusions
These data clarify the function of danger signals during non-self and ‘non-dangerous’ immune activation and have important implications for transplantation medicine, as pharmacological targeting of P2X7 receptor could improve the development of graft tolerance.
This work was supported by Sara Borrell postdoctoral grant and research grants from Instituto Salud Carlos III–Fondo Europeo de Desarrollo Regional, and European Research Council.
287
P-179 IMMUNOSUPPRESSION AND INVASIVE INFECTION FROM ENDOGENOUS GUT MICROBIOTA CAUSES ACTIVATION
OF RETINAL MICROGLIA IN MOUSE MODELS
M. L. Gil Herrero1 , V. Maneu Flores2 , A. Noailles Gil3 , V. Gómez Vicente2 , M. Boix Castejón2 , N. Cuenca Navarro3 , D. Gozalbo Flor1 1) Universitat de València , Spain 2) Universidad de Alicante, Spain 3) Universidad de Alicante, Spain
Introduction
Systemic infection, immunosuppression, and peripheral inflammation can increase microglia activation in the brain, and
there is evidence suggesting an association between neurodegenerative disorders and persistent immune activation. It has
been demonstrated that systemic infections can activate the retinal microglia. In a similar way, immunosuppression and
peripheral inflammation might also be considered as risk factors for those patients.
Objectives
The aim of this work was to determine whether immunosuppression, gastrointestinal (GI) inflammation and/or GI colonization could cause activation of retinal microglia, and its relationship with systemic infection from endogenous origin.
Two different experimental approaches using mouse models were performed: (i) immunosuppression by cyclophosphamide (CPA) treatment and chemically-induced sublethal colitis by oral administration of DSS (sodium dextran sulphate), and (ii)
fungal colonization of the GI tract following oral administration of Candida albicans viable yeast cells and immunosuppression in wild type and TLR2-/- mice orally treated with antibacterial antibiotics. Microglia activation was determined by flow
cytometry (increased forward scatter heterogeneity of the CD11b positive population and increased expression levels of
CD11b) and confirmed by confocal immunofluorescence analysis (cell morphology and immunoreactivity against anti-IBA1
and anti-MHCIIRT1B antibodies).
Results
Immunosuppression by CPA treatment caused activation of murine retinal microglia, which was increased with concomitant
peripheral inflammation (chemically-induced sublethal colitis). Under these conditions (simultaneous immunosuppression
and colitis) translocation of bacteria from gut to internal organs was observed. Similarly, immunosuppression by CPA treatment of wild type and TLR2-/- mice, colonized by C. albicans, also caused activation of microglia cells, and this activation was
higher in TLR2-/- mice, which are more susceptible to fungal invasion from GI tract to internal organs (liver and kidney). Conclusions
Activation of retinal microglia by CPA treatment appears to be enhanced by microbial invasion from gut microbiota, which
is favored by concomitant GI inflammation or fungal colonization; consequently these conditions (peripheral inflammation
and immunosuppression) could represent risk factors for patients with ocular neurodegenerative diseases, such as diabetic
retinopathy or glaucoma.
288
P-180 TLR2 MODULATES GUT COLONIZATION AND DISSEMINATION OF CANDIDA ALBICANS IN A MURINE MODEL
M. L. Gil Herrero1 , D. Prieto Prieto2 , V. Maneu Flores3 , J. Pla Alonso2 , D. Gozalbo Flor1 1) Universitat de València, Spain 2) Universidad Complutense de Madrid, Spain 3) Ubniversidad de Alicante, Spain
Introduction
Invasive candidiasis often arises from translocation of endogenous yeasts from the gastrointestinal (GI) tract to the bloodstream; in fact, high fungal GI levels represent an important predisposing factor towards acquired invasive Candida infections.
Toll-like receptors (TLRs) play a key role in maintenance of intestinal epithelial homeostasis and protecting gut mucosa
against injury, as well as in host protection against candidiasis (notably TLR2) [1,2].
Objectives
The aim of this work was to study the involvement of TLR2 in GI-tract colonization by C. albicans and fungal translocation to
internal organs in a murine model of long-term high-level sustained colonization using wild type and TLR2-/- mice.
High level of fungal colonization was obtained following oral administration of C. albicans yeasts in antibiotic-treated
(C57BL/6 wild type and TLR2 KO) mice, while disseminated infection was favored upon cyclophosphamide administration to
colonized mice, as previously described [3,4]. Fungal burden in internal organs (liver and kidney) was quantified by colony
forming units (CFUs) determination on Saboureaud-dextrose agar plates added with chloramphenicol and gentamicin, following standard procedures [2].
Results
Both wild type and TLR2-/- mice strains, orally administered with one dose of C. albicans viable yeasts, display similar sustained high level of gut colonization by the fungus when oral antibacterial treatment is present, while removal of antibiotic
treatment causes a progressive clearance of yeasts in control mice, but not in TLR2 -/- mice. Interestingly, previous C. albicans
colonization levels were recovered once the antibiotic treatment was again applied. These results suggest that signaling
through TLR2 impairs somehow the capacity of C. albicans to compete with bacteria for gut colonization. Translocation and
invasion of fungal cells to internal organs (liver and kidney), following immunosuppression of colonized mice by cyclophosphamide treatment, was increased in TLR2-/- mice, as compared to wild type mice.
Conclusions
These results point out to a role of TLR2 in gut protection against colonization and endogenous invasion of internal organs
by C. albicans.
References
[1] Gil et al. (2016). Front Biosci (Landmark Ed) 2016; 21(2), 278-302.
[2] Villamón et al. (2004). Microbes Infect 2004; 6(1): 1-7.
[3] Prieto et al. (2014). PLoS One 2014; 9(1): e87128.
[4] Prieto and Pla (2015). Front Microbiol 2015; 6: 792, doi: 10.3389/fmicb.2015.00792.
289
P-181 17Α-ETHINYLESTRADIOL MODULATES THE PERITONEAL INNATE IMMUNE RESPONSE OF THE GILTHEAD
SEABREAM, SPARUS AURATA L
N. E. Gómez-González1 , M. C. Rodenas1 , M. Arizcun2 , M. P. Sepulcre1 , V. Mulero1 , A. García-Ayala1 1) University of Murcia 2) Instituto Español de Oceanografía
Introduction
The gilthead seabream, Sparus aurata L., is a hermaphrodite and marine teleost fish of seasonal breeding which have a great
economic value in the Mediterranean aquaculture. 17α-ethinylestradiol (EE2) is a synthetic estrogen used in most oral contraceptives pills and hormone replacement therapy that has been found widespread in the aquatic environment. In previous
studies, we described the effects of EE2 in immune system of gilthead seabream. Moreover, we observed that immune cells
of adult gilthead seabream express estrogens receptors (ERs) and that the dietary intake of EE2 promoted a differential increase in the hepatic vitellogenin gene expression and alter the capacity of gilthead seabream to appropriately respond to
infection. However, those studies are mainly focus on head-kidney (HK) leukocytes and no information exists on the effects
of EE2 on the gilthead seabream peritoneal exudate (PE). Objectives
The aim of this research is to study the effect of EE2 in the innate immune system of gilthead seabream focusing on the possible alterations produced in PE.
Juvenile gilthead seabream specimens with a body weight of 20 g were fed three times at day at a feeding rate of 1.5% of
fish biomass with pellet diet supplemented with EE2 (5 μg/g food, treated fish) or unsupplemented (untreated fish) for 3
months. Moreover, they were intraperitoneally injected with hemocyanin (45 μg/fish) and imject alum adjuvant (3.6 μg/fish)
(vaccinated fish) or phosphate buffered saline (control fish) the last day of the EE2 treatment.
Specimens were anesthetized and PE, HK and livers were removed. Cell number was counted using an automatic cell counter. Acidophilic granulocytes (AG) and mast cells (MC) percentages were analyzed by flow cytometry. Reactive oxygen species activity (ROS) was measured by luminescence. Gene expression was measure by RT-qPCR.
Results
As previously described, we found that EE2 increased the expression of the gene encoding hepatic vitellogenin.
EE2 and vaccination decreased the percentage of KH AG while not changes were found in PE AG in those groups. Interestingly, vaccinated treated fishes showed a higher PE AG percentage.
Treated and control groups increased the number of cells of the peritoneal cavity as well as the respiratory burst but only the
control group reduced the PE MC percentage. Surprisingly, the vaccinated treated fishes showed a lower percentage of PE
MC and a higher number of PE total cells.
Conclusions
EE2 alters the vitellogenin expression levels.
EE2 modifies the abundance of the leukocyte populations in head-kidney and peritoneal exudate and the recruitment of
leukocytes in peritoneal exudate.
EE2 increases the ROS peritoneal production.
Financial Support: Fundación Séneca Agencial de Ciencia y Tecnología Región de Murcia and MINECO.
290
P-182 MOLECULAR CHARACTERIZATION AND EXPRESSION ANALYSIS OF PGE2 RECEPTOR SUBTYPES IN GILTHEAD
SEABREAM (SPARUS AURATA L.)
F. Hermi2 , V. Gómez-Abellán 1 , J. Montero1 , E. Sarropoulou4 , R. Oueslati3 , V. Mulero1 , M. P. Sepulcre1 1) Faculty of Biology of Murcia 2) Faculty of Sciences of Bizerte and Faculty of Biology of Murcia 3) Faculty of Sciences of Bizerte 4)
Institute for Marine Biology
Introduction
Prostaglandin E2 (PGE2) is a lipid mediators involved in several physiological and pathological processes. In mammals, PGE2
signal through four subtypes receptors belonging to the G protein-coupled receptor superfamily designed as EP1, EP2, EP3,
and EP4. Although these receptors have been well characterized in mammals, their evolutionary aspects are largely unknown.
Objectives
The aim of this study is the identification and phylogenetic and molecular characterization of PGE2 receptors in the teleost
fish gilthead seabream (Sparus aurata L.).
The full coding sequences of ep1, ep2, ep3 and ep4 from gilthead seabream were identified and the deduced amino acid
sequences used to generate multiple alignments and phylogenetic trees with EP receptors from related fish species, reptile,
bird and mammals. Gene expression was analyzed with RT-qPCR in head kidney derived macrophages and acidophilic granulocytes, the two professional phagocytes of this species, stimulated in vitro with 50 mg/ml bacterial DNA (TLR9 agonist)
alone or in combination with 10 mM PGE2.
Results
The phylogenetic analysis revealed long conserved regions in all vertebrates, especially the ligand-binding domains that
are fully conserved. The expression analysis revealed that although the four genes were constitutively expressed in macrophages and acidophilic granulocytes, ep2 and ep3 were expressed at much higher levels in macrophages. Notably, PGE2
stimulation was able to induce the transcript levels of ep1, ep2 and ep4 in acidophilic granulocytes, whereas bacterial DNA
stimulation failed to do so. In sharp contrast, either bacterial DNA or PGE2 stimulation declined the mRNA levels of the four
receptors in macrophages.
Conclusions
Our data suggests cell specificity of PGE2 signalling in fish and pave way for future functional studies aimed at clarifying the
role and signalling pathways of prostaglandins in fish immunity.
291
P-183 EXPRESSION PROFILE OF NOVEL CELL SURFACE MOLECULES ON DIFFERENT SUBSETS OF MONOCYTES AND
DENDRITIC CELLS FROM HUMAN PERIPHERAL BLOOD
D. Pinto Damasceno1 , M. Pérez Andrés 1 , W. B. Van Den Bossche2 , J. Flores-Montero1 , S. de Bruin3 , C. Teodosio 3 , J. Van
Dongen 3 , A. Orfao1 , J. Almeida 1 1) Cancer Research Center 2) Erasmus University Medical Center, Rotterdam, The Netherlands.3) Leiden University Medical Center,
Leiden, The Netherlands
Introduction
Circulating antigen presenting cells (APCs) are a heterogeneous group of cells, consisting of different functionally specialized subsets, i.e. plasmacytoid dendritic cells (pDCs), myeloid DCs (mDCs), classical monocytes and a population of APCs
differentiating from monocytes (CD16+ APCs, also termed non-classical monocytes -ncMo-). Although major steps forward
have beenmade in the last years in our understanding of the role of the distinct APC subsets, further studies -including more
detailed phenotypic analyses- are required to better understand their precise functional interactions.
Objectives
To investigate the reactivity for new monoclonal antibodies (mAb) -including those against the new CD365 to CD371 molecules- on different subsets of APCs in normal human peripheral blood (PB).
Methods
Seventy-two new mAb submitted and provided by the 10th International Workshop on Human Leukocyte Differentiation
Antigens were tested on freshly obtained PB samples from 5 healthy adult donors.
Antigen expression was analyzedat the cell surface-membrane level by 8-color flow cytometry on whole PB samples, with
the following backbone panel of mAb, to identify the different APC subsets: CD14, CD16, CD33, CD45, CD123, anti-HLADR
and anti-SLAN.
Results
Plasmacytoid DCs (pDCs) was the only population that expressed CD85g and CD195, whereas they lacked all other molecules investigated; in contrast, myeloid DCs (mDCs) mostly expressed inhibitory C-type lectin receptors (CLRs) and other inhibitory-associated molecules, while monocytes expressed both inhibitory and activating CLRs, together with other phagocytosis-associated receptors. Within monocytes, progressively lower levels of expression were generally observed from classical
monocytes to SLAN- and SLAN+ non-classical monocytes (ncMo) for most expressed molecules, except for the CD368 endocytic receptor -found to be positive only in classical monocytes-, and the CD369 and CD371 modulating/signaling receptors
plus the CD101 inhibitory molecule, found to be expressed at higher levels in SLAN+ vs. SLAN- ncMo.
Conclusions
In summary, the pattern of expression of the different signaling molecules and receptors here analyzed varies among the distinct subsets of PB APCs, althogh similar profiles for molecules within each functional group was found, suggesting unique
pattern-recognition and signaling capabilities for distinct subpopulations of APCs and therefore, also diverse functional roles.
ApplicableFundingSource
Ministerio de Economía y Competitividad (Ministry of Economy and Competitiveness) - PI13/01412-FEDER; RTICC
D12/0036/0048-FEDER, PI13/01412-FEDER 39 Congreso de la Sociedad Española de Inmunología
292
P-184 MODIFICACIONES EN EL EQUILIBRIO DE LIGAMIENTO DEL LOCUS 19Q13.4 EN PACIENTES CON CIRROSIS ALCOHÓLICA
I. Legaz Pérez1 , E. Navarro-Noguera 3 , J. M. Bolarin2 , B. Las Heras2 , A. M. Garcia Alonso2 , J. A. Campillo2 , F. Boix2 , L. Gimeno2 ,
A. Mrowiec2 , R. Moya-Quiles2 , A. Luna Maldonado1 , M. Muro2 , A. Minguela1 1) Universidad de Murcia 2) Hospital Clínico Universitario Virgen de la Arrixaca 3) Hospital Clínico Universitario Virgen de la Arrixaca
Introduction
KIR genes are a large family of highly polymorphic genes located on chromosome 19q13.4. This family is characterized by
exhibiting high haplotype variation in number of genes and content, as well as presenting a high allelic polymorphism. Depending on its location on chromosome 19, KIR genes are classified as centromeric and telomeric, which largely determines
its presence or absence in certain haplotypes thus configuring the repository KIR receptors on NK cells and ultimately its
activity. Depending on the structure of the intracellular domains of these membrane receptors are distinguished two types
of KIR with inhibitory function (iKIR) and activating (aKIR).
Objetive
The aim of this study was to determine the pattern of linkage disequilibrium (LD) of 16 KIR genes in a Spanish population of
patients with end-stage alcoholic cirrhosis (AC) and compare it with a healthy Spanish population in order to find differences
in KIR gene association.
A total of 281 male AC end-stage patients were analyzed and compared with 319 healthy individuals taken as a control.
Genomic DNA was obtained from peripheral blood and KIR genotyping was performed by PCR-SSO. A total of 16 KIR genes
were analyzed. Statistical analysis was performed using SPSS 15.0 and comparisons were made by Fisher \’s exact test. A level
of P<0.05 was accepted as statistically significant. LD values for two locus were calculated using 2x2 tables and normalized
as described previously.
Results
The analysis of linkage disequilibrium patterns KIR gene in patients with alcoholic cirrhosis shows a statistically significant
decrease in the association between KIR2DL2/S2 and the rest of KIR genes analyzed, except for the association of KIR2DL2/
S2 with KIR2DS5 that it is statistically significantly increased (P=0.002 and P=0.000, respectively) . Another increase in genetic
association observed in the diseased population was related between KIR2DS5 and KIR2DL1 (P=0.035). Rather, a statistically
significant decrease in the joint presence of KIR2DL2 and KIR2DL3 genes in patients with alcoholic cirrhosis (P=0.027) compared to controls was observed.
Conclusion
LD patterns of KIR genes in AC patients were quite similar to healthy population with exception of KIR2DS5 whose presence
was increased with most centromeric genes and KIR3DL2 telomeric gene.
293
P-185 IMPACT OF OXIDATIVE STRESS IN PSORIASIS: A ROLE FOR XDH AND NRF2
F. J. Martínez Morcillo1 , F. J. Martínez Navarro1 , R. Corbalán Vélez2 , M. T. Martínez Menchón2 , J. Meseguer Peñalver1 ,
D. García Moreno1 , V. Mulero Méndez1 1) Faculty of Biology, University of Murcia/IMIB 2) University Hospital Vírgen de la Arrixaca
Introduction
Psoriasis is a not contagious skin chronic inflammation disease that affects nearly 2% world population. The etiology is still
undetermined, but it is known that allergic, genetic, immunological and environmental causes are all involved. Several studies have demonstrated a strong correlation between oxidative stress and skin inflammation in psoriasis patients. In order to
elucidate this relationship, we have investigated xanthine dehydrogenase (Xdh), as the main reactive oxygen species (ROS)
source in the cell, and the nuclear factor-erythroid 2 related factor 2 (Nrf2), which is a redox sensitivity transcriptional factor
involved in the induction of numerous genes encoding ROS-scavenging enzymes through binding the common DNA regulatory element, called antioxidant response element (ARE).
Objectives
Study whether XDH and NRF2 can be used as diagnosis and prognosis markers in psoriasis and evaluate whether pharmacological inhibition of Xdh or activation of Nrf2 are able to diminish skin inflammation and oxidative stress in a zebrafish model
of skin inflammation.
We have analyzed transcriptomic data from human psoriasis samples available at the GEO database. Using the unique advantages of the zebrafish embryo for in vivo imaging and cell tracking, we have tested by bath immersion the capability of
Xdh inhibitors and Nrf2-activating compounds to reduce neutrophils dispersion in Tnfr2-deficient larvae, as an indicator of
skin inflammation severity.
Results
The analysis of a human transcriptomic data at GEO database showed that XDH and GDA, which is upstream XDH, were both
induced in psoriatic lesional skin. In addition, their expression was directly correlated to the expression of some inflammation-related genes in psoriatic skin lesions. Furthermore, there is a concomitant reduced expression of NRF2 in psoriatic
skin lesions, which negatively correlated with inflammation markers. Preliminary functional analysis in a zebrafish model of
skin inflammation showed that pharmacological activation of the Nrf2 pathway resulted in reduced skin inflammation.
Conclusions
The results of this study reveal new prognosis markers and therapeutic targets for psoriasis. Pharmacological activation of
NRF2 pathway could result in an improved protection against oxidative stress in psoriasis, leading to reduced inflammation
and disease progression.
294
P-186 ESTRADIOL AND PROGESTERONE BALANCE NEUTROPHILS RESPONSE TO SPERM AND CANDIDA ALBICANS IN
THE FEMALE REPRODUCTIVE TRACT
L. Salinas Muñoz1 , E. Mercader Cidoncha1 , R. Campos Fernández1 , M. Fernández García1 , A. Hidalgo Alonso2 , R. Samaniego
García1 , M. Relloso Cereceda1 1) Hospital General Universitario Gregorio Marañón 2) Centro Nacional de Investigaciones Cardiovasculares
Introduction
Female reproductive mucosa recognizes pathogens and sperm as foreign material, and induces an influx of neutrophils to
eliminate them; although, neutrophil response against sperm must be regulated to allow fertilization. Likewise, neutrophil
numbers disappear during the ovulatory phase (high estradiol) of the ovarian cycle in the vaginal lumen, and increase during
the luteal phase (high progesterone): therefore, sex hormones control the neutrophil influx.
Vaginal secretions contain chemokines that drive neutrophil migration into the vaginal lumen; however, chemokines expression during the ovarian cycle or in response to hormonal treatments is controversial and their role in vaginal defense
remains unknown.
Objective
The aim of this study is to investigate the chemokines mechanism by which female sex hormones -estradiol and progesterone- regulate neutrophils in the female reproductive tract after infection or insemination.
We used C. albicans vaginal infection or insemination in the presence of female sex hormones. To investigate the hormonal
role on the neutrophil transepithelial migration we used adoptive transfer of CXCR2-/- neutrophils and chemokine immunofluorescence quantitative analysis.
Results
Our data show that the CXCL1/CXCR2 axis drives neutrophil transepithelial migration into the vaginal lumen. Estradiol disrupts the CXCL1 gradient and favors neutrophil arrest, mainly in the ectocervix and fornix; however, progesterone allows the
CXCL1 gradient to induce a rapid neutrophil migration towards the vaginal lumen.
Conclusions
CXCL1 expression by vaginal and cervical epithelial cells drives neutrophil transepithelial infiltration through tightly established gradient. Estradiol-treatment arrests neutrophil migration by disrupting the CXCL1 gradient; as a result, the vagina
becomes more vulnerable. In contrast, progesterone promotes CXCL1 gradient, allowing neutrophil influx in the vaginal
lumen and restoring vaginal immunity.
295
P-187 A LINK BETWEEN NAD+ BIOSYNTHESIS AND PSORIASIS
D. García Moreno1 , F. J. Martínez Morcillo1 , F. J. Martínez Navarro1 , M. T. Martínez Menchón2 , R. Corbalán-Vélez2 , J. Meseguer
Peñalver1 , V. Mulero Méndez1 1) Faculty of Biology, University of Murcia/IMIB 2) University Hospital Virgen de la Arrixaca
Introduction
Psoriasis is a chronic inflammatory dermatosis that affects millions of people worldwide. Tumor necrosis factor α (TNFα) is
a multifunctional cytokine that mediates key roles in acute and chronic inflammation, including psoriasis. In previous studies, we have taken advantage of the strengths of the zebrafish embryo for in vivo imaging to develop a skin inflammation
model based in the genetic depletion of Tnfa or its receptor Tnfr2 where inflammation can be easily quantified by assessing
neutrophil mobilization to the skin.
Objectives
Study whether NAD+ and its precursors can be used as prognosis markers and therapeutical targets for psoriasis.
Methods
The expression of genes encoding key enzymes in NAD+ biosynthesis were obtained from transcriptomic data of human
psoriasis samples available at the GEO database. RT-qPCR was used to determine the expression of these genes in zebrafish
larvae deficient in Tnfr2. The ability of NAD+ and its precursors applied by bath immersion to reduce neutrophil dispersion
was evaluated in Tnfr2-deficient larvae, as an indicator of skin inflammation severity.
Results
Gene expression analysis showed that the genes encoding the enzymes involved in the biosynthesis of NAD+ are altered in
both human psoriatic lesional skin and Tnfr2-deficient zebrafish. In addition, NAD+ was able to reduce neutrophil dispersion
of Tnfr2-deficient larvae while, conversely, its precursors nicotinamide, nicotinamide mononucleotide and nicotinic acid promoted neutrophil dispersion in wild type larvae.
Conclusions
The results of this study reveal new prognosis markers and therapeutic targets for psoriasis. NAD+ could reduce skin inflammation and psoriasis progression. Studies are in progress to validate nicotinic acid, nicotinamide, nicotinamide mononucleotide and NAD+ serum levels as prognosis markers of psoriasis and to elucidate the molecular mechanisms involved in the
regulation of skin inflammation by these metabolites.
296
P-188 CIRCULATING CYTOKINES PREDICTS DEVELOPMENT OF ACUTE PANCREATITIS
A. Rodríguez Nicolás1 , A. Martínez Chamorro1 , M. P. Jiménez Gámiz1 , A. M. Matas Cobos2 , F. Ruiz-Cabello Osuna1 , E. Redondo
Cerezo2 1) Complejo Hospitalario Universitario de Granada 2) Complejo Hospitalario Universitario de Granada
Introduction
During acute pancreatitis (PA), a generalized inflammatory response is induced, which is largely responsible for the associated high mortality and morbidity. If the inflammatory response becomes uncontrolled, a Systemic Inflammatory Response
Syndrome (SIRS) ensues. This systemic inflammatory response is the result of the secretion of pro inflammatory mediators
including interleukins (IL-1, IL-6, IL-15, IL-8, IL-33, and IL-18), TGF-β, and TNF-α, among others.
Objectives
Quantification of levels of serum pro-inflammatory cytokines determined upon admission to the hospital, could provide
objective evidence for the assessment of the severity of AP and the prediction of its course.
In this study we analyzed 18 different cytokines in a total of 120 patients with acute pancreatitis, upon admission to the
hospital, in order to address their relation with the severity of the disease. The criteria for diagnosis were abdominal pain,
increased serum amylase and positive findings on abdominal ultrasonography and/or computed tomographic scan. The
patients were classified according to the criteria of Atlanta 2012 by gravity. We obtained blood samples, to determine the
following cytokines in serum: IL-9, IL-10, IL-17A, IL-21, IL-22, IL-23, IL-27, GM-CSF, IFN-γ, IL-1, IL-2, IL-4, IL-5, IL-6, IL-12 p70, IL-13,
IL-18, TNF-α.
Results
The levels of 7 of 21 analyzed cytokines (IFN-γ, IL13, IL1b, IL6, TNF-α, GM-CSF, IL4) were significantly higher in the group of patients with severe acute pancreatitis in relation to groups of patients with mild
or moderately severe PA. The levels of the other cytokines were not significantly different among groups
We found that the levels of some cytokines were significantly higher in the group of patients who died: IFN-γ, IL6 , TNF-α,
IL18, IL10. IFN-gamma. Some cytokines related with inflammation were significantly elevated in the group of patients who
required to be transferred to a intensive care unit: IFN-γ, IL6 , TNF-α, IL18, IL10.
Conclusions
Our work demonstrates that the levels of pro-inflammatory cytokines are in relation with the severity of the disease. The
levels of cytokines involved in SIRS such as TNFα, IL-1b and IL-6, are remarkably high in the groups of patients with severe
AP, and in the patients who died.
297
P-189 HETEROGENEITY BUT INDIVIDUAL CONSTANCY OF EPITOPES, ISOTYPES AND AVIDITY OF FACTOR H
AUTOANTIBODIES IN ATYPICAL HEMOLYTIC UREMIC SYNDROME
P. Nozal 1 , M. E. Bernabéu-Herrero2 , B. Uzonyi3 , Á. Szilágyi4 , S. Hyvärinen5 , Z. Prohászka4 , T. S. Jokiranta5 , P. Sánchez-Corral2 ,
M. López-Trascasa1 , M. Józsi6 1) Hospital Universitario La Paz-IdiPAZ. Unidad de Inmunología 2) Hospital Universitario La Paz-IdiPAZ. Grupo 21 3) Eötvös Loránd
University, Budapest 4) Semmelweis University, Budapest 5) University of Helsinki and Helsinki University Hospital 6) Eötvös Loránd
University, Budapest
Introduction
Factor H (FH) autoantibodies are present in 6-10% of atypical hemolytic uremic syndrome (aHUS) patients, most of whom
have homozygous deficiency of the FH-related protein FHR-1. These autoantibodies cause a functional deficiency of FH, interfering with FH binding to the alternative pathway convertase and with FH-dependent cell protection, but little is known
about their changes over time and their molecular characteristics.
Objectives
The objectives were to study the specificity and other immunological features of anti-FH autoantibodies in the Spanish and
Hungarian aHUS cohorts, and their evolution over time.
Material & Methods
A total of 19 patients were included and serial samples of 14 of them were available, follow-up time ranging from 2 months
to 8 years. The specificity of the autoantibodies was determined by ELISA with immobilized FH, recombinant FH fragments,
FHR-1 and recombinant SCR19-20 fragments carrying 13 single amino acid mutations, and in some cases by competition
ELISA with various monoclonal anti-FH antibodies. IgG subclasses and light chains, and avidity at different time points were
also analyzed by ELISA.
Results:
FH autoantibodies from FHR-1 deficient patients (n=13) mainly recognized FH, its SCR19-20 fragment and FHR-1, but autoantibody specificity in patients who are homo- or heterozygous for the CFHR1 gene (n=6) was heterogeneous. No significant changes apart from total antibody titer were observed during follow-up in each patient. Fine epitope mapping with
recombinant FH SCR19-20 containing single amino acid mutations showed significantly reduced binding in 7 out of 14
patients, in most cases, comprising residues 1183-1189 and 1210-1215, revealing a major common autoantibody epitope
and highlighting the functional importance of these residues, as they also accumulate mutations described in aHUS patients.
Avidities showed variations between patients, but in most cases the avidity index did not change significantly upon time.
Most autoantibodies were IgG3, and all but three presented only with kappa or with lambda light chains.
Conclusions
Although the pathogenic role of anti-FH autoantibodies in aHUS is well established, this study shows autoantibody heterogeneity among patients, but no significant variation in their characteristics over time in each patient. The presence of a
single light chain most patients and the limited epitopes recognized by autoantibodies, suggest a restricted response in
most patients.
Funding
Ministerio de Economía y Competitividad (MINECO), PI12-00597, SAF2012-38636., Sociedad Española de Nefrología (SENEFRO) and CIBERER (ACCI-2014), the Lendület Program of the Hungarian Academy of Sciences (LP2012-43), and the Hungarian
Scientific Research Fund (OTKA)
298
P-190 SERUM PROPERDIN CONSUMPTION AS A BIOMARKER OF C5 CONVERTASE DYSREGULATION IN C3 GLOMERULOPATHY
F. Corvillo Rodríguez1 , M. Bravo García Morato1 , P. Nozal Aranda1 , A. Tortajada2 , S. Rodríguez de Córdoba2 , M. López Trascasa1 1) Hospital Univesitario La Paz. IdiPAZ 2) Centro de Investigaciones Biológicas (CIB). Consejo Superior de Investigaciones Científicas
(CSIC)
Introduction
Properdin (P) stabilizes the alternative pathway (AP) convertases, being the only known positive regulator of complement
system. In addition, P is a pattern recognition molecule able to initiate directly the AP on non-self surfaces. Although P deficiencies are long time known to be associated with Neisseria infections and P is often found deposited at sites of AP activation and tissue injury, the potential role of P in the pathogenesis of complement dysregulation associated disorders has not
been extensively studied.
Objectives
Measure serum properdin levels in 49 patients with histological and clinical evidence of C3 glomerulopathy (C3G) and correlate with the complement profile and parameters of renal function.
Serum C3 and C4 levels were measured using nephelometry. Factor B, properdin, C5 and sC5b-9 levels were measured using
Enzyme-Linked ImmunoSorbent Assay (ELISA).
Results
Patients were divided in two groups according to the presence or absence of C3 nephritic factor (C3NeF), an autoantibody
that stabilizes the AP C3 convertase. The presence of this autoantibody results in a significant reduction in circulating C3
(p<0.001) and C5 levels (p<0.05), but does not alter factor B, P and sC5b-9 levels. Interestingly, in our cohort, serum P levels were low in 17 of the 32 C3NeF-negative patients. This group exhibited significant reduction of C3 (p<0.001) and C5
(p<0.001), and increase of sC5b-9 (p<0.001) plasma levels, compared to the control group. Besides, P consumption was
significantly correlated with C3 (r= 0.798, p 0.0001), C5 (r= 0.806, p<0.0001), sC5b-9 (r = -0.683, p 0.043) and a higher degree
of proteinuria (r= -0.862, p 0.013).
Conclusions
These results further illustrate the heterogeneity among C3G patients and suggest that P serum levels could be a reliable
clinical biomarker to identify patients with underlying surface AP C5 convertase dysregulation.
Funding. This work was performed with the support of grants from the Spanish Ministerio de Economía y Competitividad
(SAF2012-38636), Comunidad de Madrid (S2010/BMD-2316) and CIBERER (ACCI-2014).
299
P-191 A NOVEL PROTOCOL FOR M1/M2 MACROPHAGES CHARACTERIZATION FROM RAT KIDNEY BY FLOW CYTOMETRY
I. Cortegano Jimeno1 , A. Rubio Navarro2 , B. Martín Fernández3 , M. Guerrero Hue2 , V. Lahera Julia3 , M. Alía Moral1 ,
B. de Andrés Muguruza1 , M. L. Gaspar Alonso-Vega1 , J. Egido de Los Ríos2 , J. A. Moreno Gutierrez2 1) Centro Nacional de Microbiología 2) IIS-Fundación Jiménez Díaz, Autonoma University 3) Faculty of Medicine, Complutense
University
Introduction
Renal disease is a global health problem, with increased prevalence, and associated with elevated morbidity and mortality.
There are increasing evidences suggesting the important role of inflammation and, subsequently, macrophages in the development and progression of renal disease. Macrophages are heterogeneous cells that have been implicated in kidney injury
produced by aldosterone administration. M1 macrophages are activated by pro-inflammatory cytokines and have microbicide function contributing to tissue inflammation. By contrast, macrophages called M2 are involved in tissue remodelling.
Objective
To obtain a protocol to perform phenotypic and quantitative analysis of macrophages from rat kidneys treated with aldosterone plus salt administration by flow cytometry.
Material and Method
Male Wistar rats were used in the study. Animal were divided in four groups: aldosterone group, spironolactone group, aldosterone+spironolactone group and control group. After 3 weeks, animals were sacrificed and macrophages phenotype was
analyzed in kidneys cell populations by flow cytometry. Kidneys were decapsulated, minced and incubated with collagenase. Cells were incubated with CD45-PE-Cy7, CD86-PE and CD163-APC, washed, fixed and permeabilized using BD Cytofix/
Cytoperm and then incubated with CD68-FITC. Samples were analyzed by flow cytometry in a FACSAria I (BD) and with Flow
Jo (Tree Star) software packages. Rat peritoneal macrophages were used as positive controls for macrophage markers detection. CD68 was detected by inmunochemistry in kidneys from different animals. mRNA levels were measured by RT-PCR for
M1 markers (iNOS and INFγ) and M2 markers (Arg1and Il-10) in control and aldosterone treated rats.
Results
We discriminated macrophages populations in kidneys according the dual presence of CD45 and CD68. Then we analyzed
the expression of CD86 (M1 marker) and CD163 (M2 marker). Our results showed an increase in CD45+CD68+ macrophages
in aldosterone treated rats. Expression of CD86 was only increased in CD45+CD68+ macrophages from aldosterone treated rats; by contrast no CD163 expression was detected in CD45+CD68+ macrophages from any group. Increased mRNA
expression of iNOS and IFN-γ (M1 markers) was observed after aldosterone + salt treatment, whereas Arg1 or IL-10 mRNA
expression (M2 macrophage markers) did not change after aldosterone administration. All together, these results suggest
that aldosterone + salt administration promotes inflammatory M1 macrophage phenotype in vivo.
Conclusions
We have described a new method for phenotypic characterization of renal macrophages in a quantitative manner using flow
cytometry. This technique, with a low cellular mortality, can be further completed with several assays, including cell sorting,
mRNA or protein expression studies to allow in-depth characterization of macrophage role in renal disease.
300
P-192 EXPRESSION OF TOLL-LIKE RECEPTORS DURING EMBRYONIC DEVELOPMENT
C. Ruiz Sánchez1 , B. de Andrés Muguruza1 , M. Alía Moral1 , M. Rodriguez García1 , M. D. C. Prado Zamora1 , I. Cortegano Jimeno1 , M. L. Gaspar Alonso-Vega1 1) Centro Nacional de Microbiología - Instituto de Salud Carlos III
Introduction
Toll-like Receptors (TLR), which recognize pathogen associated molecular patterns (PAMPs), are highly conserved throughout evolution and are expressed on different types of cells, including that of the innate immune system. Little is known
about the expression of these receptors and the acquisition of TLR´s functionality in early moments of life during the first
encounters with pathogens, nor during the early hematopoietic events that take place in the fetal liver and bone marrow.
Objectives
To study the TLR´s expression on lympho-myeloid cells in embryo and newborn mouse.
BALB/c mice were mated overnight to obtain embryos of controlled gestational age (E). Pregnant females were sacrificed,
the yolk sacs (YS) were removed and the embryos were exsanguinated. Blood cells were recovered (PBMC), and the embryos were dissected to obtain fetal livers (FL). Cell suspensions from PBMC, FL and YS were obtained and blocked with anti-Fcγ (2.4G2) monoclonal antibody (MonAb) before being stained with fluorochrome-labelled MonAbs. The samples were
analyzed by flow cytometry and purified by FACS. For Immunofluorescence, whole embryos were fixed and frozen in OCT,
and 10 µm slices were prepared. Slides were incubated with MonAbs and observed on a confocal microscope. Quantitative
real-time polymerase chain reaction (RT-PCR) amplifications were performed with TLR2, TLR4 and TLR9-specific primers.
Results
We have studied the expression of TLR2, TLR4 and TLR9 on cells of FL, YS and PBMC during embryonic life, between 11.5 to
18.5 gestation days, and after birth in the BALB/c experimental model. We have found that there is a distinctive expression
of these receptors among CD45+ cell populations (that are mostly myeloid cells at these embryo stages). This expression
changes along gestation, e.g.TLR2 expression is detected in FL from 11.5 day, its expression increases until 14.5 day, and
practically disappears at 18.5 day, while the expression of TLR4 increases along gestation from E14.5 until 18.5 day.
Conclusion
There is an expression of TLRs in cells from embryo hematopoietic tissues in the E12.5-E18.5 mouse embryo. We propose
that these receptors may play a role in the in the developmental process of the embryo itself, clearing damaged structures,
promoting tissue remodeling or the differentiation to different stages of progenitor cells.
301
P-193 CMV SEROPOSITIVITY AND AGEING AFFECT THE EXPRESSION OF ACTIVATING RECEPTORS ON NK CELL SUBSETS
N. López Sejas1 , C. Campos Fernandez1 , F. Hassouneh1 , A. Pera Rojas1 , R. Tarazona Lafarga2 , R. Solana Lara1 1) IMIBIC-Hospital Universitario Reina Sofia. Universidad de Córdoba, España 2) Universidad de Extremadura. Cáceres, España.
Introduction
NK cells represent an important component of the innate immune response against infection and tumors. Age-associated
changes in NK cell phenotype have been previously reported and they have been associated with CMV infection.
Objectives
The aim of this work was to analyze the effect of CMV- seropositivity and ageing on the surface receptors expression in the
NK cells.
67 healthy donors were included, stratified by age and CMV-seropositivity. All volunteers agreed and signed informed consent to participate. The study was approved by the Ethics Committee of the Reina Sofia University Hospital.
Peripheral blood samples were obtained in heparinized tubes and peripheral blood mononuclear cells (PBMCs) were isolated. Plasma from all donors was tested for CMV-specific IgG and IgM by ELISA. The percentage of cells expressing NKp30,
NKp46, DNAM-1, CD57, CD300 y CD161 in NK cell subsets (defined by CD56 and CD16 expression) were analyzed by multiparametric flow cytometry. Data were analyzed using FlowJo software.
Results
Our results showed an increase in NKp46 expression on CD56brightNK cells from young CMV-seropositive donors compared
with CMV-seronegative. NKp30 was decreased in total, CD56dim and CD56negNK cells from young and elderly CMV-seropositive individuals, when compared with young CMV-seronegative. DNAM-1 was also decreased on total and CD56dimNK
cells from elderly subjects when compared to young (CMV-seronegative and CMV-seropositive).
Furthermore, we also observed an increase in CD57 expression on total and CD56dimNK cells from CMV-seropositive donors
(young and elderly) compared to young CMV-seronegative. CD300 expression was also increased in total, CD56dim and
CD56brightNK cells from elderly CMV-seropositive donors compared to young (CMV-seropositive and CMV-negative) and
middle-age CMV-seropositive. CD161 expression was decreased in total, CD56dim and CD56brightNK cells from elderly,
middle-age and young donors (all CMV-seropositive) compared to young CMV-negative.
We further analyzed the expression of certain receptors according to CD57 expression. CD57+NK cells had a lower NKp30
expression in young and old CMV-seropositive donors compared with young CMV-seronegative, and a decreased DNAM-1
expression in old individuals when compared with young donors, independently of CMV serostatus.
Conclusion
These results indicate that aging and CMV infection are associated to changes in NK cell phenotype and function. Thus,
whereas aging is associated to the increased CD300 expression and decreased DNAM-1 expression, CMV-seropositivity of
healthy young donors is associated to differences on CD56bright (increased NKp46) and CD56dim (decreased NKp30), to the
increased CD57 expression and to the decreased CD161 expression on the major CD56dim cell subsets.
The results presented emphasize the relevance of including the determination of CMV serostatus in those studies addressed
to analyze the immune response in the elderly. 39 Congreso de la Sociedad Española de Inmunología
302
P-194 INHIBITION OF C5A-DEPENDENT HUMAN NEUTROPHIL MIGRATION USING THREE NEW ANTI-C5A MONOCLONAL
ANTIBODIES
A. V. Marin1 , F. J. Fernández2 , M. Subias3 , J. Querol2 , A. Jiménez-Reinoso1 , M. Domínguez4 , M. C. Vega2 , S. Rodríguez de
Córdoba3 , J. R. Regueiro1 1) Complutense University School of Medicine and Hospital 12 de Octubre Health Research Institute, Madrid, Spain 2) Centro de
Investigaciones Biológicas (CSIC) and Centro de Investigación Biomédica en Red de Enfermedades Raras, Madrid, Spain 3) Centro
de Investigaciones Biológicas (CSIC) and Centro de Investigación Biomédica en Red de Enfermedades Raras, Madrid, Spain 4)
Centro Nacional de Microbiología, Instituto de Investigación Carlos III, Madrid, Spain
Introduction
C5a has two known receptors with similar cellular distribution including neutrophils: the extracellular C5a-receptor 1 (C5aR1
or CD88) and the mostly intracellular and less characterized C5a-receptor-like 2. Signaling through C5aR1 induces widespread hemodynamic and inflammatory responses. Because excessive C5a signaling can be detrimental in settings such as
immune complex disease, ischemia/reperfusion injury or sepsis, modulation of extracellular C5a signaling is key to develop
new therapies for such disorders. Neutrophils are the first immune mediators that travel to the inflammatory focus following
C5a gradients. Thus, the modulation of neutrophil migration could prevent exacerbated inflammatory reactions. We generated three new mouse antibodies that recognize human C5a (unpublished). Their inhibitory capacity of neutrophil migration
in vitro was required to validate their therapeutic potential.
Objective
To evaluate the in vitro inhibitory capacity of C5a-dependent human neutrophil migration by three new antibodies (αC5a1,
αC5a2 and αC5a3), in comparison with the C5aR1 antagonist A8 (a mutant C5a construct, Heller et al, 1999) in transwell assays.
Human granulocytes were isolated from EDTA venous blood samples by centrifugation and cleaned of residual erythrocytes
by lysis before chemotactic migration in 24-well transwell plates at 0.2x106 cells/upper chamber, while lower chambers contained increasing C5a concentrations diluted from zymosan-activated human serum. Plates were incubated for 30 min at 37
°C with 5% CO2 and, using forward and side scatter gating, the number of granulocytes from lower chambers was quantified
by flow cytometry for 1.5 min at constant flux acquisition. The inhibitory capacity of increasing concentrations of antibodies
or A8 was tested against a fixed concentration of C5a previously defined (1 nM), which attracted 5.200±1.600 cells against a
background of 600±300 cells to lower chambers filled with EDTA-containing human serum with undetectable C5a by ELISA,
diluted as above. Migration in the presence of antagonists was normalized and fitted to a sigmoidal function by GraphPad
Prism software, which calculated the half-maximal effective concentration (EC50).
Results
As reported by Heller, our C5a titration results also showed a biphasic migration pattern which peaked around 1.2 nM and
dropped at 2.5 mM to 0 nM C5a migration levels. Our antagonist titration results showed that the three antibodies completely inhibited neutrophil migration towards 1 nM C5a, but at different concentrations relative to A8. Their EC50 were 13, 21,
25 and 89 nM for αC5a2, αC5a3, A8 and αC5a1, respectively.
Conclusions
Three new mouse anti-human C5a antibodies inhibited C5a-dependent human neutrophil migration in vitro with different
EC50, two of them better than A8, and are thus potentially useful for human therapy.
Grants: CAMS2010/BMD-2316, ISCII FIS PI-121667, MINECO SAF2011-24235 y SAF2014-54708-R
303
P-195 THE PRESENCE OF A NOVEL SUBSET OF PERITONEAL MACROPHAGES FROM CIRRHOTIC PATIENTS IS ASSOCIATED
TO AN INCREASED RESPONSE TO LPS
A. J. Ruiz-Alcaraz 1 , A. Tapia-Abellán1 , M. D. Fernández-Fernández1 , M. Tristán-Manzano1 , T. Hernández-Caselles1 , M. MirasLópez2 , P. García-Peñarrubia1 , M. Martínez-Esparza1 1) Facultad de Medicina. Universidad de Murcia. IMIB, Murcia, Spain 2) Hospital Universitario Virgen de la Arrixaca, IMIB, Murcia,
Spain.
Introduction
A better knowledge of the phenotype, the activation status and the capacity of response of resident macrophages present in
the ascites fluid (AF) of cirrhotic patients would be useful to identify novel targets for pharmaceutical intervention to prevent
hepatic damage.
Objective
The aim of this study was to characterize monocyte-derived macrophages (M-DM) from blood and ascites of cirrhotic patients comparatively with those obtained from blood of healthy controls.
M-DM were isolated from the uninfected blood and AF of decompensated cirrhotic patients and from the blood healthy subjects (controls). The phenotypic profile of the cells was analyzed by flow cytometry by studying the differential expression of
several pro-inflammatory M1-related activation markers and anti-inflammatory M2 alternative markers. M-DM were isolated
and stimulated in vitro with LPS and heat killed Candida albicans. Phosphorylation levels of key signaling molecules, such as
ERK, c-Jun, p38 MAPK, and PKB/Akt, were analyzed by Western blotting. The secretion of cytokines was quantified by ELISA.
Results
We found a new phenotypic pattern of M-DM present in AF, which includes a novel cell subset, that is different from that
found both in the blood of the same cirrhotic patients and healthy controls and displays a mixed M1-M2 phenotypic and
functional profile. Concomitantly, basal hyperactivation of ERK and JNK/c-Jun pathways observed in ascites M-DM correlated
with the novel subset of peritoneal macrophages. In vitro LPS treatment highly increases ERK1/2, PKB/Akt and c-Jun phosphorylation, while that of p38 MAPK is decreased in M-DM from ascites compared to control blood M-DM. Stimulation of
healthy blood M-DM with LPS and C. albicans induced higher phosphorylation levels of p38 than those from ascites. Regarding cytokines secretion, in vitro activated M-DM from ascites of cirrhotic patients produced significantly higher amounts of
IL-6, IL-10 and TNF-α, and lower levels of IL-1β and IL-12 than control blood M-DM.
Conclusion
A new subpopulation of peritoneal M-DM has been identified in ascites of cirrhotic patients, which is very sensitive to LPS
stimulation.
304
P-196 ANALYSIS OF THE NEUTROPHIL FUNCTION IN THE ASCITIC FLUIDS FROM PATIENTS WITH CIRRHOSIS
L. Perea1 , J. C. Nieto1 , E. Sánchez2 , E. Román2 , M. Poca2 , C. Guarner2 , C. Juárez1 , G. Soriano2 , S. Vidal1 1) Institut de Recerca IIB-Sant Pau, Barcelona 2) Hospital de la Santa Creu i Sant Pau, Barcelona
Background
Patients with decompensated cirrhosis have complications such as spontaneous bacterial peritonitis (SBP) that lead to a
defective immune response. One of these defects could be the described impaired functionality of ascitic neutrophils from
patients with SBP. This defect could be induced by the content of the ascitic fluid.
Aims
(a) To compare the effect of sterile ascitic fluids (SA) and SBP ascitic fluids (culture-negative, CN-SBP or culture-positive, CPSBP) on the function of neutrophils (oxidative burst activity and NETosis).
(b) To compare the effect of SBP ascitic fluid at the day of diagnosis and after the antibiotic treatment on neutrophil function.
Methods
We isolated neutrophils from peripheral blood of healthy donors and obtained cell-free ascitic fluid samples
from patients with decompensated cirrhosis. We then cultured neutrophils in cell-free medium with 10% of fetal calf serum (FCS) as positive control, SA, CN-SBP or CP-SBP to determine the levels of oxidative burst and NETosis.
Results
We firstly showed a positive correlation between the oxidative burst induced by ascitic fluids in neutrophils and the oxidative burst produced by ascitic neutrophils from cirrhotic patients. SA induced the highest oxidative burst on neutrophils, whereas CP-SBP, CN-SPB and FCS showed similar oxidative burst. Antibiotic treatment did not increase the oxidative burst of CP-SBP. Quantification assays of extracellular DNA showed higher
levels of NETosis induced by 0.22μm-filtered SA samples than by unfiltered samples. No significant differences were observed between NETosis induced by SA, CP-SBP and CN-SBP. However, we observed microscopically a different pattern of extracellular DNA in CN-SBP and CP-SBP induced NETosis. Antibiotic treatment did not correct this pattern. Finally, levels of oxidative burst of ascitic neutrophils correlated with NETosis levels induced by fluids in healthy neutrophils.
Conclusion
Cell-free ascitic fluids from patients with decompensated cirrhosis alter the oxidative burst and NETosis of healthy neutrophils. Characteristic immune response in the ascitic neutrophils from these patients could be the consequence of the ascitic
fluid composition.
305
P-197 POSSIBLE ROLE OF SLAMF8 IN M1 AND M2-TYPE MACROPHAGES
S. Romero Pinedo1 , V. Morón Calvente2 , M. J. Ruiz Magaña1 , F. Abadía Molina2 , A. C. Abadía Molina1 1) CIBM, Universidad de Granada 2) CIBM, Universidad de Granada
Introduction
SLAMf8 is a member of the SLAM receptor family that acts as a negative regulator of NADPH oxidase activity in mouse macrophages through PKC. SLAMf8 is expressed in macrophages activated with IFN-g or bacteria, therefore SLAMf8 negatively
regulates inflammatory responses upon inflammation-associated stimuli. It is widely known that under different cytokine
profiles, macrophages can differentiate at two types of macrophages with different activation states: M1 or classically activated and M2 or alternatively activated macrophages. M1 macrophages are generated by an environment with LPS and IFNγ,
characterized by the expression of pro-inflammatory cytokines, whereas M2 macrophages are generated by an environment
with: IL-4, IL-13 and IL-10, and are a subset of anti-inflammatory and regulatory macrophages.
Objectives
Due to SLAMf8 is a negative regulator of inflammatory response, the aim of this work was to determine the expression of
SLAMf8 in M1 and M2-polarized human macrophages.
Human monocytic cell line, THP-1, were treated with PMA to induce the macrophage differentiation (M0, M1 and M2). Then
the cells differentiated to M1 were treated with pure LPS and IFNγ, while M2-differentiated cells were treated with IL-4. As
monocytic state or resting cells (R), were used THP-1 no treated. Finalized the differentiation, M1 and M2 polarization was
evaluated under light microscopy, western blot and RT-PCR analysis. SLAMf8 expression was evaluated through RT-PCR and
flow cytometry.
Results
The morphological analysis under light microscopy and the study of M1 and M2-specific marker through RT-PCR or western
blot, confirmed that macrophage polarization to M0, M1 and M2 in THP-1 cells was performed successfully. Resting cells
(monocytic state) were round and did not attach to the surface of culture dish. M0, M1 and M2-polaryzed macrophages
were adhered to the plate substrate and had higher expression of CD14 (macrophage activation marker) than resting cells.
M1-polaryzed macrophages showed a round shape and had a higher expression of CXCL10 while M2-polaryzed macrophages showed an elongated spindle-like morphology shape and had a higher expression of CCL18, MRC1 by RT-PCR, and
E-cadherin by western blot analysis. When we analyzed the mRNA or protein expression of SLAMf8, we found that M0, M1
and M2-polaryzed macrophages expressed SLAMf8 significantly in comparison with the monocytic state.
Conclusions
Our results shown that SLAMf8 is expressed in M1 and M2-type macrophages, therefore could modulate the pro or anti-inflammatory responses in the different subsets, but in order to elicit the key role of SLAMf8 in M1 and M2-polarized human
macrophages, further studies are necessary.
This work was supported by grants from the Ministry of Education and Science (SAF2007-62562) & Ministry of Science and Innovation (PI10/01096) of Spain.
306
P-198 CSF-1 REGULATES THE MIGRATORY PATTERN AND RESPONSE OF MONOCYTES FROM INACTIVE CRONH´S
DISEASE PATIENTS
J. C. Nieto Sáchica1 , C. Zamora1 , E. Cantó1 , E. Garcia-Planella2 , J. Gordillo2 , M. A. Ortiz1 , C. Juárez3 , S. Vidal1 1) Institut d’Investigació Biomèdica Sant Pau 2) Hospital S. Creu i S. Pau, Barcelona , Spain 3) Hospital S. Creu i S. Pau, Barcelona ,
Spain
Introduction
Crohn’s disease (CD) is a relapsing systemic inflammatory disease, mainly affecting the gastrointestinal tract with extra-intestinal manifestations and associated immune disorders. Cell migration to the inflammation sites is directed by inflammatory
chemokines. Circulating cells can respond to gradients of these chemokines through chemokine receptors. Little is known
about the migratory pattern of peripheral blood monocytes and its regulatory mediators in CD patients during remission.
Results
Flow cytometry analysis showed a higher expression of CCR5 on monocytes from CD patients than on monocytes from
healthy donors, after 24h in culture with medium. This CCR5 up-regulation was associated with the production of high CSF-1
and IL-10 levels. The higher expression of CCR5 on CD monocytes increased their migratory pattern in response to RANTES.
During differentiation of monocytes, signaling through CCR5/RANTES increased CD163 and HLA-DR expression and diminished TLR4-induced TNF-a and IL-6 secretion. When we analyzed clinical parameters, those patients with penetrating CD and
those treated with azathioprine had the highest CSF-1 levels and CCR5 expression. CRP levels inversely correlated with CSF-1
levels and CCR5 expression.
Conclusion
Our results suggest that monocytes from CD patients in remission produced high levels of CSF-1 that upregulate CCR5
expression on cell surface. As a consequence, monocytes differentiated in these conditions had lower production of inflammatory cytokines. The treatment of these patients with azathioprine could be the responsible of the anti-inflammatory
profile of these monocytes.
307
P-199 A NEW ROLE FOR HUMAN BRAIN PERICYTES IN NOD1 MEDIATED VASCULAR INFLAMMATION: COMPARISON TO
TLR4 RESPONSES
R. Navarro Ortiz1 , P. Delgado Wicke1 , N. Nuñez Prado1 , M. Compte Grau1 , A. Blanco Toribio1 , G. Nuñez2 , L. Álvarez Vallina3 ,
L. Sanz Alcober1 1) Hospital Universitario Puerta de Hierro Majadahonda 2) University of Michigan 3) Aarhus University
Introduction and objectives
We have previously described the response of human brain pericytes (HBP) to lipopolysaccharide (LPS) through toll-like
receptor 4 (TLR4). However, gram-negative pathogen-associated molecular patterns include not only LPS but also peptidoglycan (PGN). Given that we could not rule out the presence of co-purified PGN in the LPS preparation, we decided to analyze
the expression of the intracellular PGN receptors NOD1 and NOD2 in HBP and compare the responses to their cognate agonists and ultrapure LPS.
Methods
NOD1 and NOD2 gene expression in HBP was analyzed by qRT-PCR, and protein expression was assessed by FACS and immunocytofluorescence. To address whether NOD1 signaling pathway was functional in HBP, the effect of the C12-iE-DAP agonist on the
expression of the proinflammatory mediators IL6 and IL8 was studied by qRT-PCR and ELISA, alone or in combination with LPS.
To further assess the role of NOD1 in C12-iE-DAP-mediated gene induction, we used shRNA to knock down NOD1 expression. Finally, we used PP2, a potent inhibitor of RIPK2, to discriminate NOD1 and TLR4 responses in HBP. Pharmacological
inhibitors of p38 MAPK and NF-κB were used to evaluate which downstream signaling components of the NOD1 pathway
were relevant in this model.
Results
We demonstrated that NOD1 is expressed in HBP, whereas NOD2 expression is barely detectable. Next, we compared IL6 and IL8
gene modulation by C12-iE-DAP with that of ultrapure LPS. Both C12-iE-DAP and ultrapure LPS induced significant increases in
IL6 and IL8 gene expression. The upregulation with both agonists was more evident for IL8 than for IL6. Consistent with the RNA
results, both C12-iE-DAP and ultrapure LPS induced a statistically significant increase in IL8 release into culture supernatants.
As emerging evidence suggests cooperative effects of pattern recognition receptors, we also addressed the outcome of
combined triggering of NOD1 and TLR4, demonstrating their synergistic effect on the induction of IL8.
Using NOD1 silencing in HBP, we showed a requirement for C12-iE-DAP-dependent signaling. Finally, we could discriminate
NOD1 and TLR4 pathways in pericytes by pharmacological targeting of RIPK2, a kinase involved in NOD1 but not in TLR4
signaling cascade. Both p38 MAPK and NF-κB appear to be downstream mediators in the NOD1 pathway.
Conclusion
To our knowledge, this is the first report demonstrating that the intracellular receptor NOD1 is functionally expressed in HBP.
We show that HBP can sense gram-negative bacterial products by both NOD1 and TLR4 receptors, acting through distinct
pathways. These results provide new insight about how HBP participate in the response to pathogens in the brain and may
have implications for disease management. Modulating the activity of pericytes may provide a novel means of treating inflammatory conditions of the brain, where they are especially abundant.
308
P-200 PHAGOCYTOSIS-ACTIVATION-CELL DEATH (PAD) IN ONE-STEP ASSAY
P. Díez García1 , C. Teodosio Gonçalves1 , W. Parak2 , A. Orfao1 , M. Fuentes1 1) Centro de Investigación del Cáncer 2) University of Marburg 3) Centro de Investigación del Cáncer 4) Centro de Investigación del
Cáncer
Introduction
The development of nanotechnology at biomedical levels has led to the usage of nanoparticles (NPs) as vehicles for drugs
and others biomolecules thanks to their suitability to enter the cells. Thus, the cellular uptake and the consequent interaction
with cellular mechanisms as well as the biocompatibility, cytotoxicity and immune system activation must be evaluated.
Currently, there are several options for these studies, but a one-step multi-parametric strategy could be more efficient.
Five different kinds of NPs have been incubated (4 charged dextran-based NPs and 1 FITC-labelled latex NPs) in three cell
cultures (Jurkat, THP1, and mononuclear cells purified from peripheral blood from healthy donors). The one-step multi-parametric assay was performed by using a flow cytometry panel termed PAD tube (Annexin V-PB, CD4-PE, CD45-PeCy5.5,
CD14-PeCy7, TNFalpha-APC, CD3-APCH7) acquired in a FACSCanto II flow cytometer. May Grünwald-Giemsa (MGG) stain and
MTT assays were used for pre-evaluation and/or validation of results obtained by PAD assay.
Results
The phagocytic capacity of different cell lines (FITC channel and FSC/SSC parameters) at different concentrations (5-10 NPs/
cell) and incubation times (4, 6, 12 h) has reported a minimal cell death (Annexin-V) and a low immune response (TNFalpha-APC) assessed by cytokine production in monocytes and T CD4 lymphocytes (CD4, CD45, CD14, CD3). Additionally,
the combination of size and granularity parameters has allowed the analysis of phagocytosis in those non-labelled NPs by
comparison to FITC-labelled ones.
Conclusions
The characterization of NPs with different physicochemical properties has been performed with a one-step multi-parametric
assay for the qualitative and quantitative evaluation of phagocytosis, immune system activation and cell death. Furthermore, these analyses can be simultaneously evaluated in different cell populations (involved in immune response) within
the same sample. Our results have shown the applicability and suitability of the PAD tube for evaluating the interaction of
nanomaterials with the immune system in an efficient, cheap and very fast manner.
Acknowledgments
We gratefully acknowledge financial support from the Carlos III Health Institute of Spain (ISCIII, FIS PI14/01538, and
FIS PI12/00624, Fundación Solórzano FS/23-2015), Fondos FEDER (EU) and Junta Castilla-León (BIO/SA07/15 and JCYLEDU/346/2013 Ph.D. scholarship).
309
P-201 METHOD SENSITIVITY IN NK LYMPHOCYTE PHENOTYPING BY MULTICOLOUR FLOW CYTOMETRY
M. C. Martín Alonso1 , M. A. García Hontoria1 , A. Corell Almuzara1 1) Universidad de Valladolid
Introduction
It is controversial whether methodological issues can affect lymphocyte phenotyping results and thus, laboratories’ proficiency. GECLID program (external proficiency testing program for diagnostic immunology) runs interlaboratory comparisons for flow cytometry since 2010.
Objective
To determine the influence of flow cytometry platforms and monoclonal antibodies (MoAbs) in T, B and NK lymphocyte
phenotyping.
Data from a single interlaboratory comparison round were analyzed (valid data from 44 labs, 5 peripheral blood samples).
Paired samples’ median comparisons (Friedeman/Wilcoxon) were performed. A total of 245 non parametrical contrasts of
hypothesis tests were carried out. Anti-CD45 MoAbs were used by participants to gate T, B and NK lymphocytes. Anti-CD3
MoAbs, to select T cells (CD3+) and NK cells (CD3-). Anti-CD4 and anti-CD8 MoAbs allow characterizing T lymphocyte subsets. Anti-CD19 MoAbs were used for B cell detection. Either anti-CD16 together with anti-CD56 MoAbs or anti-CD56 alone
were used to select NK lymphocytes.
Results
No differences were found either in single vs. double platform for absolute lymphocyte count, anti-CD19 MoAb manufacturers or fluorochromes. When analyzing variations due to flow cytometers, only 5 parameters were significantly different
in 60 comparisons made. NK lymphocyte percentages significantly varied among flow cytometers in two of the 5 samples,
both following the same profile (cytometer#1> cytometer#4> cytometer#2> cytometer#3). Anti-CD45 MoAb manufacturer
determined 6 significant differences in 50 parameters analyzed. NK cell proportion was significantly different between CD45
MoAb manufacturers in 2 samples, both in the same sign (manufacturer#1>manufacturer#2). Only 1 in 50 comparisons
was significantly different due to CD45 fluorochrome: a CD8 percentage that was also significantly different as comparing
anti-CD45 MoAb manufacturers. Anti-CD3 MoAb manufacturer was also a factor for 4/20 significant differences. Again NK
cell proportion was significantly different by anti-CD3 MoAb manufacturers in 2 samples, both in the same sign (manufacturer#1>manufacturer#2). Anti CD3 fluorochrome was found to determine significant differences for 5/20 parameters. Percentage of NK lymphocytes was significantly different as comparing anti-CD3 fluorochromes in 2 samples, both in the same sign
(PC5>FITC). NK detection MoAb cocktails (anti-CD16+CD56 vs. Anti-CD56 alone) were significantly different in 4 out of the 5
samples, both in the same sign (CD16+CD56 > CD56 alone).
Conclusions
Lymphocyte phenotyping by flow cytometry yields robust results regarding cytometer and monoclonal antibodies. Anyway,
some subsets such as NK cells are affected by methodological issues and can be over/under estimated depending on the
flow cytometer, the anti-CD45 anti-CD3manufacturer or fluorochrome; the manufacturer (as long as they are defined by
CD3-) or the MoAbs used to phenotype this population.
310
P-202 THE IL23-IL23R AXIS IN DENDRITIC CELLS AND MACROPHAGES IN ATHEROSCLEROSIS
J. Gil Pulido1 , C. Cochain1 , A. Zernecke1 1) Universitätsklinikum Würzburg
Introduction
Atherosclerosis is a chronic inflammatory disease of the vessel wall responsible for heart attacks and stroke. It is now well
accepted that circulating low density lipoprotein (LDL) can cross the endothelial barrier of the vessels and become oxidized
(oxLDL). Resident macrophages and dendritic cells (DCs) have the ability to engulf those molecules and initiate an immune
response, resulting in the recruitment of new cells and the formation of atherosclerotic plaques. These antigen presenting
cells (APCs) can also secrete a variety of cytokines, such as for example IL23. IL23 is secreted by activated dendritic cells and
macrophages and is composed of two subunits, p40 and p19, its unique subunit, which can bind to the newly characterized
IL23 receptor (IL23R). Until now there are no data about the role of IL23/IL23r in the development and progression of atherosclerosis. There are also no data on how IL23 might be influenced under such inflammatory conditions, as well as how IL23r
expression is regulated by dendritic cells and macrophages.
Objectives
The aim of our project is to investigate how IL23 production is influenced under inflammatory conditions and in response
to atherogenic stimuli (eg. oxLDL), and to dissect the expression of IL23r on immune cells during the development of atherosclerosis.
Bone marrow-derived DCs (BMDCs) and -macrophages (BMDMs) were generated using GM-CSF and M-CSF, respectively, and
exposed to different atherorelevant compounds to study the expression of IL23 by RT-PCR and ELISA. BMDCs and BMDM
were also used for characterization of IL23r expression in vitro. Transgenic mice carrying GFP under the IL23r promoter were
used as a “partial knock out” (IL23r+/GFP) and “full knock out” (IL23rGFP/GFP) to track GFP production as an indicator of IL-23r
expression in FACS analyses.
Results
We could demonstrate that IL23 is rapidly induced by BMDCs after treatment with LPS, but could not detect the expression
of IL-23 in response to oxLDL. In contrast to BMDCs, we could not detect IL23 production in BMDMs in response to any of
these stimuli. Although it has been suggested that IL23r might be expressed by BMDCs, we have failed to detect the expression of GFP by unstimulated IL23r+/GFP or IL23rGFP/GFP BMDCs or BMDMs, or after stimulation with LPS, TNF-α or oxLDL,
suggesting that these cells do not express IL23r under these conditions in vitro.
Conclusions
Our data show that IL-23 is not induced by atherogenic stimuli in vitro, suggesting that the expression of IL23 may not be
altered during the course of atherosclerosis. IL23r is present on several CD11b+IL23r+ immune cells in vivo. In vitro, however,
we could not detect IL-23r expression, suggesting that it may be futile to study Il-23-induced signalling pathways in cultured
cells in vitro. Taken together, the Il23/Il23r signalling axis seems to be highly in a complex manner, requiring further studies
in the future.
311
P-203 SOD3 ATTENUATES NF-kB ACTIVITY IN ENDOTHELIAL CELLS AND ENHANCES T CELL INFILTRATION OF TUMOURS
L. Carmona-Rodríguez1, E. Mira1, M. Franch2, T. D. Oury3 , S. Mañes1
1) Department of Immunology and Oncology 2) Departamento de Bioinformática, Centro Nacional de Biotecnología/CSIC,
Madrid, Spain 3) Department of Pathology, University of Pittsburgh, 200 Lothrop St., Pittsburgh, PA USA
The effectiveness of cancer immunotherapy depends on the recruitment of effector cytotoxic T lymphocytes into tumours.
The tumour-associated endothelium is a major regulator of leukocyte diapedesis, through its expression of adhesion receptors and chemokines. The specific adhesion molecules and chemokines expressed by endothelial cells are supervised by
pro-inflammatory transcription factors such as those of the nuclear transcription factor kappa B (NF-kB) family, which are
usually hyperactivated in the tumour endothelium. Here we show that extracellular superoxide dismutase (SOD3) attenuates NF-kB activity; this in turn modifies the chemokines expressed in the tumour-associated endothelium and alters lymphocyte trafficking into the tumour parenchyma. Expression of SOD3, the major anti-oxidant enzyme in the extracellular space,
is greatly reduced in several tumours (breast, lung, melanoma) compared to the surrounding healthy tissue. In a mouse
mammary tumour model, we verified SOD3 downregulation as a result of the oncogenic process. Administration of lovastatin restored SOD3 expression in these tumours, which increased the number of intratumoral T cells. Using syngeneic tumour
models, we showed that lovastatin augmented T cell infiltration into tumours in wild type but not in SOD3-/- mice. Specific
SOD3 expression in tumour-associated stroma (including endothelial cells) increased the infiltration of adoptively transferred T cells as well as their effectiveness in eradicating the tumours. In vitro chemotaxis assays using mock- and SOD3-transfected endothelial cells (1g11-SOD3) also showed increased chemokine CCL19-induced T cell transmigration when SOD3
was overexpressed. Expression profiles of mock- and 1G11-SOD3 cells stimulated with tumour-conditioned medium (as a
pro-inflammatory stimulus) showed that SOD3 changed the expression of 1168 genes (874 up- and 294 downregulated),
including some chemokines. SOD3 significantly reduced CCL2, CCL7, CXCL10 and CXCL16 expression and enhanced that
of CXCL12, CXCL14 and CXCL15. Gene Set Enrichment Analyses (GSEA) using the entire set of differentially regulated genes
showed that SOD3 inhibited the canonical and non-canonical NF-kB pathways. Using a variety of biochemical methods,
we confirmed that SOD3 overexpression reduces NF‑kB activation in pro-inflammatory conditions. Based on these data, we
propose that SOD3 reduces the inflammatory state of the tumour-associated endothelium by attenuating NF-kB activation,
which in turn promotes T cell infiltration into the tumour.

Libro de Resúmenes Orales y Pósteres www.seinmunologia2016.org

Transcription

Similar documents

dr. blum invitation

The Immune System - Life Sciences Outreach Program

Feel Your Best with the BOOM!

FAITH News Legacy - Sociedad Guadalupana

2014 - Sociedad Guadalupana

The Immunity Boosters - Roswell Park Cancer Institute

Untitled - Caja Rural Granada

Newsletter - Espanola Valley Humane Society

Ambrotose®-The Missing Link in Human Nutrition