Efecto de factores ambientales sobre la regulación del desarrollo de

Transcription

Universidad de Córdoba
Efecto de factores ambientales sobre la
regulación del desarrollo de la hoja
primaria de plantas de girasol
(Helianthus annuus L.)
Tesis doctoral
Lourdes de la Mata Sáez
2015
TÍTULO:Efecto de factores ambientales sobre la regulación del desarrollo de la
hoja primaria de plantas de girasol (Helianthus annuus L.)
AUTOR: Lourdes de la Mata Sáez
© Edita: Servicio de Publicaciones de la Universidad de Córdoba. 2016
Campus de Rabanales
Ctra. Nacional IV, Km. 396 A
14071 Córdoba
www.uco.es/publicaciones
[email protected]
Título: Efecto de factores ambientales sobre la regulación del desarrollo de la hoja
primaria de plantas de girasol (Helianthus annuus L.)
Autora: Lourdes de la Mata Sáez
Departamento de Botánica, Ecología y Fisiología Vegetal
Universidad de Córdoba
Tesis Doctoral
Efecto de factores ambientales sobre la regulación del
desarrollo de la hoja primaria de plantas de girasol
(Helianthus annuus L.)
Autora:
Lourdes de la Mata Sáez
Directoras del trabajo:
Eloísa Agüera Buendía - Purificación de la Haba Hermida
Córdoba, Diciembre de 2015
AGRADECIMIENTOS
Una tesis doctoral es siempre el resultado de años de dedicación, esfuerzo y
paciencia, pero nunca llegaría a término sin la ayuda en diferentes planos de algunas
personas. Por ello me gustaría dar las gracias a mis directoras, Eloísa Agüera y
Purificación de la Haba, por la confianza que depositaron en mí y por su tarea de
supervisión a lo largo de estos años. A Purificación Cabello, por su apoyo constante y su
asesoramiento. Muchas gracias por todo lo que he aprendido de vosotras y por haberme
introducido en mi carrera científica. Mi agradecimiento a Manuel Pineda por su respaldo a
este proyecto y a Josefa Alamillo, que me inició en el conocimiento de la Biología
Molecular con generosidad y paciencia. Muchas gracias también a Guadalupe Alcalá, que
desde la secretaría del departamento siempre estuvo cuando la necesitaba, con una
solución para cada problema. No olvido a mis compañeros de departamento, a Vanessa,
Manuel y Álvaro, gracias también a vosotros por compartir inolvidables momentos en la
Universidad y fuera de ella, en esta importante etapa de mi vida. Y por supuesto, todo mi
cariño a mi familia y a mis amigos, que con su apoyo incondicional me dieron fuerzas y
estuvieron siempre a mi lado.
ÍNDICE
Abreviaturas ................................................................................................. 1 1. RESUMEN .............................................................................................. 3 2. INTRODUCCIÓN .................................................................................. 7 2.1. Aspectos generales ............................................................................. 9 2.2. El CO2 y las plantas ......................................................................... 11 2.3. Importancia del nitrógeno en las plantas ......................................... 12 2.4. Efectos de la irradiancia en las plantas ............................................ 16 2.5. Efectos de la temperatura en las plantas ......................................... 18 2.6. El proceso de senescencia ................................................................. 20 3. OBJETIVOS ......................................................................................... 23 3.1. Capítulo I ......................................................................................... 25 3.2. Capítulo II ........................................................................................ 26 3.3. Capítulo III ...................................................................................... 26 3.4. Capítulo IV ...................................................................................... 27 4. CAPÍTULO I
Growth under elevated atmospheric CO2 concentration accelerates leaf
senescence in sunflower (Helianthus annuus L.) plants ......................... 29
5. CAPÍTULO II
Elevated CO2 concentrations alter nitrogen metabolism and accelerate
senescence in sunflower (Helianthus annuus L.) plants ......................... 41
6. CAPÍTULO III
Study of the senescence process in primary leaves of sunflower
(Helianthus annuus L.) plants under two different light intensities ........ 49
7. CAPÍTULO IV
High temperature promotes early senescence in primary leaves of
sunflower (Helianthus annuus L.) plants ............................................... 61
8. DISCUSIÓN .......................................................................................... 75 9. CONCLUSIONES ................................................................................ 87 9.1. Capítulo I ......................................................................................... 89 9.2. Capítulo II ........................................................................................ 89 9.3. Capítulo III ...................................................................................... 90 9.4. Capítulo IV ...................................................................................... 90 10. BIBLIOGRAFÍA ................................................................................. 91 Abreviaturas
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
−
1 APX: Ascorbato peroxidasa
C/N: Razón carbono/nitrógeno
Citb557: Citocromo b557
FAD: Flavín adenín dinucleótido
GDH: Glutamato deshidrogenasa
GOGAT: Glutamato sintasa
GS: Glutamina sintetasa
HI: Alta irradiancia
HO˙: Radical hidroxilo
IPCC: Panel Intergubernamental de Cambio Climático
LI: Baja irradiancia
MoCo: Cofactor de molibdeno
N2O: Oxido nitroso
NiR: Nitrito reductasa
NO: Oxido nítrico
NO2-: Nitrito
NO3-: Nitrato
NR: Nitrato reductasa
O2-: Radical superóxido
PFD: Densidad de flujo fotónico
PSII: Fotosistema II
ROS: Especies reactivas de oxígeno
Rubisco: Ribulosa-1,5-bisfostato carboxilasa/oxigenasa
SLM: Masa foliar específica
SOD: Superóxido dismutasa
XET: Xiloglucano endotransglicosidasa
1. RESUMEN
Resumen
Resumen
Los procesos bioquímicos, biológicos y morfogenéticos de las plantas de girasol
(Helianthus annuus L.) y en general de todas las plantas, se ven afectados por el cambio
climático en curso, produciendo alteraciones en el desarrollo, crecimiento y productividad de
los cultivos. El cambio climático actual está produciendo modificaciones en los ecosistemas
siendo importante el estudio de plantas con mayor capacidad adaptativa a las modificaciones
medioambientales.
En el presente trabajo se han estudiado los cambios fisiológicos y metabólicos que
ocurren en las plantas de girasol durante su desarrollo, bajo diferentes factores ambientales:
elevada concentración de dióxido de carbono (CO2) atmosférico, elevada temperatura y
variaciones en la intensidad lumínica. Para ello hemos enfocado este estudio abordando, en
diferentes capítulos, estos tres factores ambientales: elevada concentración atmosférica de
CO2 (Capítulo I y II) modificación en la intensidad luminosa (Capítulo III), y elevada
temperatura (Capítulo IV). Se han determinado las variaciones en los parámetros de
crecimiento, así como los cambios en el contenido de pigmentos fotosintéticos, asimilación
fotosintética de CO2, contenido en carbohidratos, actividades y niveles de expresión de
enzimas del metabolismo del nitrógeno y el estado oxidativo del tejido vegetal. En general, se
ha observado que los diferentes factores ambientales provocan en las plantas de girasol
alteraciones que inducen la aceleración del proceso de senescencia en la hoja primaria, cuyo
principal fin es la movilización de nutrientes a los órganos en crecimiento para mantener su
funcionalidad. Estos resultados contribuyen al conocimiento de los efectos que el
calentamiento global va a tener sobre los diferentes cultivos ya que los factores ambientales
estudiados pueden verse afectados por él. Este estudio se ha realizado en plantas de girasol
debido a la gran importancia del cultivo, ya que su uso es fundamental en la alimentación
humana (semilla o aceite) y de animales (forraje), también es importante por su utilización en
procesos de biorremediación y en la producción de biodiesel así como por su valor
ornamental.
5 Resumen
Abstract
Climate change is affecting the biochemical, biological and morphogenetic processes
in sunflower plants (Helianthus annuus L.) and in all plants, producing alterations in growth,
development and productivity of the crops. The current climate change is causing changes in
the ecosystems; therefore, the study of plants with increased ability to adapt to these
environmental changes is important.
In this work, physiological and metabolic changes during the development of
sunflower plants under different atmospheric conditions have been studied. These plants were
subjected to high atmospheric CO2 concentration, high temperature and variations in light
intensity. The responses to the different conditions were addressed in different chapters of
this thesis: high atmospheric CO2 concentration (chapters I and II), changes in the light
intensity (chapter III) and high temperature (chapter IV). During this project, different growth
related parameters were measured such as the content of photosynthetic pigments, CO2
photosynthetic fixation, content of carbohydrates, activity and level of expression of enzymes
related to the nitrogen metabolism and the plant tissue oxidative state. In general, it was
observed that different environmental factors resulted in alterations in sunflower plants;
which induced the acceleration of the process of senescence in primary leaves. The main aim
of this process is to transport nutrients to the young tissues in order to maintain their
functionality. These results add insight into the knowledge of the effects of global warming
on sunflower crops since the studied atmospheric factors might be affected by it. This study
was conducted in sunflower plants because of their importance as a crop. The use of
sunflower is essential in the diet of humans (seeds and oil) and animals (fodder). Its use is
also important in bioremediation, biodiesel production and ornamental use.
6 2. INTRODUCCIÓN
Introducción
2.1. Aspectos generales
El girasol tiene su origen en el continente Americano, más concretamente en México
en el 2600 a.C., en el siglo XVI llegó a Europa y allí se extendió al resto del mundo donde se
cultiva de forma intensiva con fines alimenticios (Putt, 1997). El girasol es una planta anual
de la familia de las asteráceas, durante los estadíos más tempranos del crecimiento, la flor
gira orientándose hacia los rayos del sol, sin embargo, cuando la planta alcanza la madurez se
orienta hacia el este. El girasol es una de las cinco fuentes más importantes de aceite
comestible a nivel mundial, por lo tanto posee un gran valor tanto agronómico como
económico (Cantamutto y Poverene 2007). Esta planta también se usa en procesos de
fitorremediación, en la producción de biodiesel y con fines ornamentales (Mani et al. 2007;
Arzamendi et al. 2008).
Los procesos bioquímicos, biológicos y morfogenéticos de las plantas de girasol y en
general de todas las plantas, se ven afectados por el cambio climático, produciéndose
alteraciones en el desarrollo, en el crecimiento y en la productividad (Bazzaz y Fajer 1992).
El Convenio Marco sobre cambio climático de las Naciones Unidas (1992) define el cambio
climático como una modificación del clima atribuida directa o indirectamente a la actividad
humana que altera la composición de la atmósfera y que se suma a la variabilidad natural del
clima observada durante períodos de tiempo comparables.
Los gases atmosféricos más importantes que producen el efecto invernadero en la
atmósfera son: CO2, N2O, NO y CH4; éstos absorben la radiación infrarroja que emite la
tierra por refracción de la luz que recibe del sol, manteniendo así una temperatura apropiada
para la vida en la tierra. Por tanto, el CO2 es un componente natural y necesario en la
atmósfera terrestre, sin embargo, debido a la actividad humana y a la quema de combustibles
fósiles para la obtención de energía, los niveles de CO2 han aumentado hasta valores muy
elevados, como se puede observar en la curva Keeling (Keeling 1960) (Fig. 1).
9 Introducción
Figura 1. Variaciones de la concentración de CO2 a lo largo de los años. Última medida 9 de enero de
2015. (Scripps institution of oceanography, UC San Diego)
El Panel Intergubernamental de Cambio Climático (IPCC) ha predicho que los niveles
de CO2 entre 2060 y 2090 van a alcanzar unas concentraciones de 660-790 µL L-1 (IPCC
2007). Las emisiones continuadas de este gas es una de las causas del cambio climático, ya
que se produce un aumento de la temperatura debido a la capacidad del CO2 de absorber luz
infrarroja (Schneider 1989; Taylor y MacCracken 1990).
El uso intensivo de fertilizantes químicos altera el ciclo global del nitrógeno
aumentando los niveles de N2O y NO lo que favorece también el calentamiento global
(Templer et al. 2012) (Fig. 2).
10 Introducción
Figura 2. Gases y procesos involucrados en el efecto invernadero. (Tomado de Templer et al. 2012)
El cambio climático ya está produciendo alteraciones importantes en los ecosistemas,
dando lugar a fenómenos extremos relacionados con el clima así como sequías, inundaciones,
olas de calor, ciclones, etc. (IPCC 2014). Gruissem et al. (2012) indican que es importante el
estudio de plantas con mayor flexibilidad y capacidad adaptativa a las modificaciones que
produce el cambio climático, de aumento de CO2, temperatura y variaciones de la intensidad
lumínica.
2.2. El CO2 y las plantas
En general elevados niveles de CO2, tienden a aumentar el crecimiento de las plantas
y a producir grandes cantidades de biomasa especialmente en plantas C3. El tamaño de las
hojas viene determinado por la división y expansión celular, dichos procesos están
coordinados y controlados durante la organogénesis por una serie de factores que incluyen
hormonas vegetales, y que responden a señales ambientales (Nishimura et al. 2004; Tsukaya
2006; Riikonen et al. 2010). La elevada concentración de CO2 en la atmósfera puede influir
11 Introducción
positivamente tanto en la división como en la expansión celular (Kinsman et al. 1997). El
aumento de la expansión celular está asociado con el incremento de la extensibilidad de la
pared celular y de la actividad de enzimas que fluidifican la pared celular, tal es el caso de la
xiloglucano endotransglicosidasa (XET) (Ferris et al. 2001). Se ha descrito que en hojas de
soja y Betula papyrifera creciendo bajo una atmósfera enriquecida en CO2, determinados
genes que participan en el ciclo celular (codificando histonas) o que fluidifican la pared
celular (codificando expansinas y XET), incrementan su expresión (Gupta et al. 2005;
Ainsworth et al. 2006; Druart et al. 2006; Kontunen-Soppela et al. 2010).
La elevada concentración de CO2 incrementa la velocidad de fotosíntesis en plantas
C3 ya que la enzima ribulosa-1,5-bisfostato carboxilasa/oxigenasa (rubisco), involucrada en
los procesos fijación de CO2 y fotorrespiración, no se encuentra saturada a la concentración
de CO2 ambiental (Drake et al. 1997). Por tanto, un incremento en el CO2 atmosférico
aumentará el nivel de CO2 interno de la hoja, así como la razón CO2/O2 afectando a la rubisco
y favoreciendo así, la reacción de carboxilación frente a la de oxigenación. Las elevadas
concentraciones de CO2 pueden reducir el proceso de fotorrespiración en plantas C3 y por
tanto la producción de peróxido de hidrógeno (H2O2) celular derivada del metabolismo del
glicolato (Pritchard et al. 2000).
2.3. Importancia del nitrógeno en las plantas
En la mayoría de los suelos, el nitrógeno se encuentra fundamentalmente en forma de
nitrato, debido a que el amonio, incluso el añadido al suelo como fertilizante, es rápidamente
oxidado a nitrato por las bacterias nitrificantes. En la planta, para convertir el nitrógeno
nítrico en nitrógeno amónico, proceso conocido como reducción asimilatoria del nitrato, se
precisan dos reacciones consecutivas. En la primera de ellas, catalizada por la enzima
citosólica nitrato reductasa (NR), el nitrato es reducido a nitrito (NO2-) con el consumo de dos
electrones procedentes de una molécula de NADH, y en la segunda, catalizada por la enzima
nitrito reductasa (NiR), el nitrito es reducido a amonio en los cloroplastos en una reacción
que precisa de 6 electrones que son aportados por la ferredoxina reducida (Fedred).
12 Introducción
NR -
NO3 + NAD(P)H + H
NO2- + NAD(P)+ + H2O
+
NO2- + 6 Fdred + 8 H+
NiR NH4+ + 6 Fdox + 2 H2O
La NR de eucariotas está constituida por dos subunidades idénticas, cada una de ellas
contiene una molécula de flavín adenín dinucleótido (FAD), citocromo b557 (Citb557) y un
átomo de molibdeno integrado en el denominado cofactor de molibdeno (MoCo), que se
considera el sitio activo de reducción de nitrato. Los tres cofactores participan en serie en la
transferencia de electrones desde el NAD(P)H al nitrato estando unidos entre sí por regiones
bisagra muy sensibles a las proteasas (Maldonado et al. 2000). El poder reductor requerido
para su asimilación procede de las reacciones lumínicas de la fotosíntesis en la hoja o de la
respiración en la raíz. La asimilación de nitrato está regulada por factores endógenos y/o
exógenos tales como el nitrato, compuestos carbonados y la luz. La NR está sujeta a un
mecanismo de regulación post-traduccional en respuesta a los cambios luz/oscuridad como
resultado de una fosforilación reversible de la proteína. En plantas de pepino (Cucumis
sativus L.) se ha visto que la NR puede encontrarse activa (desfosforilada) en la luz o inactiva
(fosforilada) en oscuridad (De la Haba et al. 2001). El amonio procedente de la reducción
asimilatoria del nitrato, junto al generado en otras reacciones metabólicas, es sustrato de
enzimas tales como la glutamina sintetasa (GS) y glutamato deshidrogenasa (GDH).
Actualmente se considera que el par enzimático formado por la GS y la glutamato sintasa
(GOGAT) constituye la principal vía para la asimilación de amonio (Bernard y Habash
2009). El amonio puede proceder no sólo de la reducción del nitrato, sino también de la
fotorrespiración y del catabolismo de proteínas de reserva (Wallsgrove et al. 1987). A través
de la vía GS/GOGAT, el amonio se incorpora inicialmente a una molécula de glutamato
generándose glutamina. En esta reacción catalizada por la GS se requiere ATP y la presencia
de cationes divalentes. A continuación, la GOGAT cataliza la transferencia reductiva del
grupo amido de la glutamina al 2-oxoglutarato, formándose dos moléculas de glutamato. El
donador de electrones en tejidos fotosintéticos es normalmente la ferredoxina reducida (Forde
y Lea 2007) (Fig. 3).
13 Introducción
Figura 3. Asimilación de amonio en el ciclo GS/GOGAT. (Tomado de Taiz y Zeiger 2010)
Una de las dos moléculas de glutamato producidas en la reacción de la GOGAT se
recicla actuando de nuevo como aceptora de amonio, mientras que la otra, en reacciones
catalizadas por aminotransferasas, transfiere su grupo amino a diversos oxoácidos para la
formación de los respectivos aminoácidos (Lea y Miflin 2003).
La enzima GS es una proteína octamérica con una masa molecular de 320-360 kDa y
con una alta afinidad por el amonio, evitando así su toxicidad. En las hojas existen dos
isoenzimas, GS1 y GS2, con distinta composición de subunidades y diferente localización
celular: la GS1 está localizada en el citosol y la GS2 en el cloroplasto (Maldonado et al.
2000). A lo largo del desarrollo de la hoja de girasol se ha comprobado que la actividad de la
isoforma GS2 disminuye mientras que la actividad de la isorforma GS1 aumenta (Cabello et
al. 2006). Estas dos isoenzimas se regulan de forma diferente en distintos tipos celulares y
organismos y en respuesta a diferentes señales del desarrollo, metabólicas y
medioambientales (Zozaya-Hinchliffe et al. 2005). Diferentes estudios mostraron que tanto
las isoforma cloroplástica como la isoforma citosólica de la GS se afectan por estrés abiótico
(Brugière et al. 1999; Martinelli et al. 2007; Bernard y Habash, 2009).
La GDH cataliza el proceso reversible de aminación/desaminación entre el 2oxoglutarato y el glutamato (Fig. 4). La GDH aminante cataliza la incorporación de un grupo
amino al 2-oxoglutarato para formar glutamato. La reacción tiene lugar en la mitochondria y
como resultado de este proceso se producen aminoácidos con el fin de suministrar nitrógeno
orgánico a los órganos en crecimiento (Lehmann y Ratajczak 2008).
14 Introducción
Figura 4. Reacción de aminación y desaminación de la GDH. (Tomado de Taiz y Zeiger 2010)
La GDH desempeña un papel importante en la asimilación de amonio especialmente cuando éste
se encuentra a concentraciones elevadas y en condiciones de estrés (Purnell y Botella 2007).
Numerosos estudios indican un papel predominante de la GDH desaminante en procesos
catabólicos, entre ellos destacan el proceso de senescencia, la germinación de las semillas, en
situaciones limitantes de carbono y durante el periodo de oscuridad (Miflin y Habash 2002).
Se han realizado estudios acerca de la regulación de esta enzima y se ha observado que hay
muchas especies en las que los carbohidratos son reguladores negativos de la expresión y la
actividad de la GDH (Melo-Oliveira et al. 1996). Sin embargo, el amonio y la edad de la hoja
la regulan positivamente, de forma que en plantas de tabaco durante la senescencia,
incrementan los niveles de transcritos de la GDH en hojas fuentes así como los niveles de
amonio (Laurière y Daussant 1983; Masclaux et al. 2000; Masclaux-Dubresse et al. 2005;
Purnell y Botella 2007). La enzima GDH junto con la isoforma GS1 pueden ser considerados
marcadores metabólicos en plantas, los cuales incrementan durante la senescencia de la hoja,
y están implicados en la movilización de nitrógeno (Pageau et al. 2006).
15 Introducción
2.4. Efectos de la irradiancia en las plantas
Otro factor que afecta al crecimiento y desarrollo de la planta es la irradiancia junto
con el tiempo de exposición a la misma. Elevada intensidad lumínica durante largos periodos
de tiempo provoca una disminución del contenido en clorofila y un daño irreversible en el
fotosistema II (PSII), inhibiendo la fotosíntesis, disminuyendo el crecimiento, provocando
peroxidación de lípidos de membrana y acelerando el proceso de senescencia en las plantas
(Prášil et al. 1992; Mishra y Shingal 1992; Melis 1999; Schansker y van Rensen 1999;
Astolfi et al. 2001). Xue et al. (2012), estudiaron el efecto de la elevada irradiancia sobre la
senescencia en Alhagi sparsifolia, llegando a la conclusión de que la disminución de
actividad del PSII se debe tanto a un descenso de actividad en el centro de reacción del PSII,
como a una disminución de la transferencia de electrones entre la plastoquinona y el
citocromo b6/f. Las membranas fotosintéticas pueden ser fácilmente dañadas por la elevada
cantidad de energía absorbida por los pigmentos de forma que, si esta energía no puede ser
almacenada, es requerido un mecanismo de protección. Para evitar el daño fotooxidativo, las
plantas tienen sistemas fotoprotectores de alta eficiencia que operan mediante dos
mecanismos. El primero implica la disipación del exceso de energía de excitación en forma
de calor en los pigmentos antena del PSII, proceso que está relacionado con el ciclo de las
xantofilas. El proceso fotoquímico conlleva el bombeo de protones desde el estroma
cloroplástico al lumen tilacoidal produciendo una bajada de pH en el interior del lumen e
induciendo la activación de la enzima violaxantina de-epoxidasa, localizada en la cara interna
de los sacos tilacoidales. Esta enzima es la encargada de transformar la violaxantina en
zeaxantina a través del intermediario, anterazantina, en cada paso la violaxantina pierde uno
de los dos grupos epoxi que posee en cada uno de sus anillos. La zeaxantina es capaz de
recibir la energía directamente de la clorofila excitada disipándola en forma de calor, sin
emisión de radiación. El proceso se invierte cuando la luz desaparece o se va haciendo
progresivamente menor (Fig. 5).
16 Introducción
Figura 5. Efecto de la intensidad lumínica sobre el ciclo de las xantofilas. (Tomado de Taiz y Zeiger
2010)
En el segundo mecanismo fotoprotector están involucradas enzimas antioxidantes
como la superóxido dismutasa (SOD), la cual convierte aniones superóxido en H2O2, la
catalasa y la ascorbato peroxidasa (APX), las cuales detoxifican el H2O2 (Asada 1999; Logan
et al. 2006). Una alta densidad de flujo fotónico (PFD) es una de las causas del estrés
oxidativo en plantas (Dat et al. 2000). Se han descrito cambios en la actividad y expresión de
enzimas antioxidantes en respuesta a estrés causado por alta intensidad luminosa, aunque en
diferente grado, dependiendo de la planta y de las condiciones del tratamiento (Hernández et
al. 2006; Ariz et al. 2010).
A los sistemas de fotoprotección se añaden los sistemas de reparación, de forma que
la acumulación de energía de excitación provoca la destrucción de una de las subunidades
proteicas de PSII, la denominada proteína D1. Esta proteína D1 es rápidamente sintetizada de
novo y reemplazada en el PSII, sin embargo, cuando la tasa de destrucción de la proteína D1
supera a la de síntesis y reparación, se incrementa la carga energética del sistema la cual no
puede ser transferida y los diferentes componentes moleculares pueden resultar
irreversiblemente dañados. Este proceso se conoce como fotoinhibición (Fig. 6).
17 Introducción
Figura 6. Protección y reparación del daño oxidativo. (Tomado de Taiz y Zeiger 2010)
2.5. Efectos de la temperatura en las plantas
El estudio del efecto de elevadas temperaturas sobre el crecimiento y el metabolismo
de plantas de girasol es de gran importancia, ya que el cambio climático va a determinar que
las temperaturas se eleven entre 2,5 y 6,5 °C durante este siglo (Christensen y Christensen
2007). La elevada temperatura afecta al crecimiento, desarrollo y distribución de las plantas
limitando la productividad de los cultivos al influir en todos los procesos fisiológicos de las
plantas. Estos hechos se deben a que la elevada temperatura condiciona la velocidad de las
reacciones enzimáticas, y modifica la estructura y actividad de macromoléculas. Igualmente
se conoce que la elevada temperatura modifica la composición y estructura de las membranas
celulares incrementando la fluidez de los lípidos de membrana y disminuyendo las
interacciones electrostáticas entre los grupos polares de las proteínas dentro de la fase acuosa
de la membrana y produciendo pérdida de iones (Li et al. 2015). Por ello, la fotosíntesis a
18 Introducción
elevada temperatura se ve alterada ya que se afectan las membranas tilacoidales además de la
forma y disposición tilacoidal (Semenova 2004). Por otro lado, la elevada temperatura
también produce fotoinhibición del PSII a través de su efecto sobre el complejo productor de
oxígeno, el cual se destruye por calor (Aro et al. 1993; Murata et al. 2007; Takahashi y
Murata 2008). La disminución de la tasa fotosintética puede ser también debida a que la
elevada temperatura provoca cierre estomático con el fin de evitar la pérdida de agua, lo que
desencadena un descenso en el intercambio de gases entre la hoja y la atmósfera (Greer y
Weedon 2012). También la tasa fotosintética está determinada por la capacidad de
carboxilación de la rubisco la cual es muy dependiente de la temperatura. A elevada
temperatura disminuye el estado de activación de la rubisco por inactivación de la enzima
rubisco activasa afectando así al proceso de carbamilación de la rubisco (Feller et al. 1998;
Jiang et al. 1999; Salvucci y Crafts-Brandner 2004; Demirevska-Kepova et al. 2005) (Fig. 7).
Figura 7. Activación de la rubisco a través del proceso de carbamilación. (Tomado de Buchanan et al.
2000)
También se ha observado que la elevada temperatura disminuye los niveles de
actividad de enzimas antioxidantes (Zhang et al. 2012) e induce en las plantas estrés
oxidativo (Foyer et al. 1994) ya que se producen especies reactivas de oxígeno (ROS) tales
como radical superóxido (O2-), H2O2 y radical hidroxilo (HO˙) (Dat et al. 1998). La
acumulación de ROS no sólo tiene consecuencias negativas en las células, sino que también
interviene en las vías de señalización del estrés, activando la síntesis de factores de
transcripción de proteínas de choque térmico (Xu et al. 2006).
19 Introducción
2.6. El proceso de senescencia
El proceso de senescencia se tiende a identificar con el estado final del ciclo de vida
de las plantas. Sin embargo, no es el resultado de un proceso de degeneración, sino un
proceso de desarrollo encaminado a conseguir el desmantelamiento y reciclaje ordenado de
una parte de las estructuras y moléculas que, en un determinado momento, ya no resultan
útiles para la planta (Lim et al. 2007). Es un proceso programado genéticamente y que puede
activarse prematuramente debido a los efectos de la exposición a estrés medioambiental o a la
falta de nutrientes (Quirino et al. 2000; Lim et al. 2003, 2007; Wingler et al. 2009). La acción
combinada de señales externas e internas puede estar involucrada en la inducción del proceso
de senescencia de la hoja a través de una serie de factores entre los que podemos destacar la
acumulación de azúcares en las hojas (Agüera et al. 2010).
La ontogenia de la hoja se puede dividir en tres fases: una primera fase de incremento
de la tasa fotosintética cuando la hoja se está expandiendo activamente, una fase de máxima
velocidad fotosintética de las hojas y finalmente una fase de senescencia prolongada que
comienza con la disminución de la velocidad de fotosíntesis (Gepstein 1988), por tanto la
senescencia es el último estadio en el desarrollo ontogénico de la hoja, después de un periodo
fotosintéticamente productivo. En el proceso de senescencia foliar se produce la
redistribución de nutrientes que determina el transporte de nitrógeno y otros nutrientes a
órganos en crecimiento y muerte celular una vez que la redistribución de nutrientes se ha
completado (Wiedemuth et al. 2005). El proceso de senescencia está asociado a procesos
tales como el descenso de la velocidad de fotosíntesis, la degradación de estructuras celulares
y a la disminución de pigmentos fotosintéticos y proteínas (Ougham et al. 2008), así como a
un incremento de peroxidación lipídica en las membranas celulares (Srivalli y KhannaChopra 2004; Agüera et al. 2010). Durante la senescencia, las células de las hojas sufren
cambios drásticos en el metabolismo celular y una degeneración secuencial de estructuras
celulares (Nam 1997) que ocurren de forma ordenada y comienzan por la degradación del
cloroplasto, permaneciendo la integridad de las membranas, la compartimentación celular, las
mitocondrias y el núcleo intactos hasta la etapa final (Noodén et al. 1997; Gan y Amasino,
1997; Lee y Chen 2002).
El estado redox de las células foliares es también un marcador importante del proceso
de senescencia, el cual puede cambiar al incrementar los niveles de ROS. Las ROS son
moléculas químicamente reactivas que se forman continuamente como subproductos de
diferentes rutas metabólicas en diferentes compartimentos celulares (Foyer y Harbinson
20 Introducción
1994; Apel y Hirt 2004). Hay diferentes fuentes de ROS, por ejemplo el H2O2 y el O2-, que se
producen por la actividad metabólica del cloroplasto y/o peroxisoma en las células
senescentes. Los niveles de ROS se elevan cuando las plantas superiores son sometidas a
distintos tipos de estrés (Zulfugarov et al. 2011). Los componentes de defensa oxidativa se
encargan de eliminar estas ROS cuando las condiciones fisiológicas son estables (Alscher et
al. 1997), sin embargo, el equilibrio entre la presencia de ROS y su eliminación puede ser
alterado por factores medioambientales adversos (Polle 2001; Vanacker et al. 2006). Las
ROS en plantas son eliminadas mediante mecanismos enzimáticos y no enzimáticos, la SOD,
la catalasa, la APX y la glutatión reductasa son las enzimas responsables de los mecanismos
enzimáticos (Mittler 2002). Estas enzimas tienen un papel muy importante en el control de
los niveles de radicales libres (Irigoyen et al. 1992) así como en diferentes procesos
relacionados con la senescencia de la hoja (Procházková y Wilhelmová 2007). Cuando los
metabolitos de defensa y las enzimas responsables fallan en detoxificar las ROS, los procesos
biológicos y estructuras celulares se ven afectados (Asada 1999; Johnson et al. 2003).
La caracterización del proceso de senescencia foliar es importante desde el punto de
vista económico pues la aceleración de este proceso acorta la vida de la planta provocando un
menor rendimiento de las cosechas (Brutnell y Langdale, 1998).
21 3. OBJETIVOS
Objetivos
El objetivo principal de esta tesis doctoral ha sido estudiar el efecto de distintas
condiciones ambientales sobre el proceso de desarrollo de hojas de plantas de girasol
(Helianthus annuus L.) con objeto de determinar la implicación que el cambio climático en
curso va a tener sobre este cultivo. Para ello, hemos enfocado este estudio abordando, en
diferentes capítulos, tres de los factores ambientales más importantes que afectan al
desarrollo de las plantas: elevada concentración atmosférica del CO2 (Capítulo I y II),
variaciones en la intensidad luminosa (Capítulo III), y elevada temperatura (Capítulo IV).
Cada uno de estos factores ha sido estudiado en profundidad, planteándose objetivos más
específicos que se detallan a continuación:
3.1. Capítulo I
Growth under elevated atmospheric CO2 concentration accelerates leaf senescence in
sunflower (Helianthus annuus L.) plants
1. Determinar el posible efecto de la elevada concentración de CO2 atmosférico (800 µL
L−1) sobre el desarrollo de hojas primarias de girasol (16, 22, 32 y 42 días) y su
influencia sobre la inducción del proceso de senescencia. Para ello, se analizaron los
siguientes parámetros:
1.1.-Parámetros de crecimiento: peso seco, superficie foliar, masa foliar
específica (SLM) y proteína soluble.
1.2.-Contenido en pigmentos fotosintéticos: clorofila a, clorofila b, clorofila
total y carotenoides.
1.3.-Velocidad de fijación fotosintética de CO2, velocidad de transpiración y
conductancia estomática.
1.4.-Contenido en azúcares solubles (glucosa, fructosa, sacarosa) y almidón.
1.5.-Contenido de carbono, nitrógeno y razón carbono/nitrógeno (C/N).
1.6.-Estado oxidativo de la hoja: contenido en H2O2 y actividad de enzimas
antioxidantes (catalasa y APX).
25 Objetivos
3.2. Capítulo II
Elevated CO2 concentrations alter nitrogen metabolism and accelerate senescence in
2. Determinar los posibles cambios que una elevada concentración de CO2 atmosférica (800
µL L−1) produce en el metabolismo del nitrógeno durante el desarrollo de hojas primarias de
girasol (16, 22, 32 y 42 días) y su efecto sobre la inducción del proceso de senescencia. Para
ello se realizó:
2.1.-Diseño de cebadores moleculares para la amplificación de los genes
glutamina sintetasa: GS1 y GS2, estudio de la especificidad de los cebadores y
optimización.
2.2.-Análisis de expresión de los transcritos de las isoformas GS1 y GS2.
2.3.-Determinación de la actividad de las enzimas del metabolismo del
nitrógeno: NR, GS y GDH.
3.3. Capítulo III
Study of the senescence process in primary leaves of sunflower (Helianthus annuus L.) plants
under two different light intensities
3. Estudiar el efecto de dos intensidades lumínicas (350 y 125 µmoles de fotones m–2 s–1)
durante el desarrollo de hojas primarias de girasol (16, 22, 32, 42 y 50 días) y su efecto sobre
la inducción del proceso de senescencia. Para ello, se analizaron los siguientes parámetros:
3.1.-Parámetros de crecimiento: peso seco, superficie foliar, SLM y proteína
soluble.
3.2.-Contenido en pigmentos fotosintéticos: clorofila a, clorofila b y
carotenoides.
3.5.-Actividad de las enzimas de la asimilación del nitrógeno: NR, GS y GDH.
26 Objetivos
3.4. Capítulo IV
High temperature promotes an early senescence in primary leaves of sunflower (Helianthus
annuus L.) plants.
4. Estudiar el efecto del incremento de temperatura (régimen día/noche de 23/19 ºC a 33/29
ºC), durante el desarrollo de hojas primarias de girasol (16, 22, 28, 32 y 42 días) y determinar
su implicación sobre el proceso de senescencia. Par ello se analizaron:
4.1.- Parámetros de crecimiento: peso seco, superficie foliar, SLM y proteína
soluble.
4.2-Contenido en pigmentos fotosintéticos: clorofila a, clorofila b, razón clorofila
a/b y carotenoides.
4.6.-Actividad de las enzimas de la asimilación del nitrógeno: NR, GS y GDH.
27 4. CAPÍTULO I
Growth under elevated atmospheric CO2 concentration accelerates
leaf senescence in sunflower (Helianthus annuus L.) plants
Capítulo I
Journal of Plant Physiology 169 (2012) 1392–1400
Contents lists available at SciVerse ScienceDirect
Journal of Plant Physiology
journal homepage: www.elsevier.de/jplph
Growth under elevated atmospheric CO2 concentration accelerates leaf
senescence in sunflower (Helianthus annuus L.) plants
Lourdes de la Mata, Purificación Cabello, Purificación de la Haba, Eloísa Agüera ∗
Departamento de Botánica, Ecología y Fisiología Vegetal, Área de Fisiología Vegetal, Facultad de Ciencias, Universidad de Córdoba, Campus de Rabanales, Edificio Celestino Mutis
(C4), 3a planta, E-14071 Córdoba, Spain
a r t i c l e
i n f o
Article history:
Received 5 February 2012
Received in revised form 24 April 2012
Accepted 21 May 2012
Keywords:
Elevated CO2
Hexoses
Oxidative status
Photosynthetic pigments
Senescence
Sunflower
a b s t r a c t
Some morphogenetic and metabolic processes were sensitive to a high atmospheric CO2 concentration
during sunflower primary leaf ontogeny. Young leaves of sunflower plants growing under elevated CO2
concentration exhibited increased growth, as reflected by the high specific leaf mass referred to as dry
weight in young leaves (16 days). The content of photosynthetic pigments decreased with leaf development, especially in plants grown under elevated CO2 concentrations, suggesting that high CO2 accelerates
chlorophyll degradation, and also possibly leaf senescence. Elevated CO2 concentration increased the
oxidative stress in sunflower plants by increasing H2 O2 levels and decreasing activity of antioxidant
enzymes such as catalase and ascorbate peroxidase. The loss of plant defenses probably increases the
concentration of reactive oxygen species in the chloroplast, decreasing the photosynthetic pigment content as a result. Elevated CO2 concentration was found to boost photosynthetic CO2 fixation, especially in
young leaves. High CO2 also increased the starch and soluble sugar contents (glucose and fructose) and
the C/N ratio during sunflower primary leaf development. At the beginning of senescence, we observed
a strong increase in the hexoses to sucrose ratio that was especially marked at high CO2 concentration.
These results indicate that elevated CO2 concentration could promote leaf senescence in sunflower plants
by affecting the soluble sugar levels, the C/N ratio and the oxidative status during leaf ontogeny. It is likely
that systemic signals produced in plants grown with elevated CO2 , lead to early senescence and a higher
oxidation state of the cells of these plant leaves.
© 2012 Elsevier GmbH. All rights reserved.
Introduction
on living beings, especially on plants, which have been found to
exhibit alterations potentially affecting some steps of their growth
cycle. Studies on various plant species have suggested that climate
changes will affect the development, growth and productivity of
plants through alterations in their biochemical, physiological and
morphogenetic processes (Bazzaz and Fajer, 1992).
Senescence is a stage of the plant growth cycle that involves
strong metabolic and structural changes. Markers associated with
leaf senescence in sunflower plants have shown that senescence
initiates and progresses in primary leaves aged between 28 and
42 days (Cabello et al., 2006). Senescence typically involves cessation of photosynthesis and degeneration of cellular structures,
with strong losses of chlorophyll (Ougham et al., 2008), carotenoids
and proteins and a great increase of lipid peroxidation (Srivalli
and Khanna-Chopra, 2004; Agüera et al., 2010). Senescence is not
only a degenerative process, but also a recycling process by which
nutrients are translocated from senescing cells to young leaves,
developing seeds or storage tissues (Gan and Amasino, 1997).
Leaf senescence is therefore an active, highly regulated and programmed degeneration process, required for plant survival and
controlled by multiple developmental and environmental signals
(Lim et al., 2003). Senescence induction and development are both
Continuous emissions of CO2 from the burning of fossil fuels are
expected to raise global atmospheric CO2 concentrations. Human
activities not only affect CO2 concentrations, but also alter the
global nitrogen cycle by increasing the inputs of fixed forms of
nitrogen, mainly through extensive use of chemical fertilizers. The
Intergovernmental Panel on Climate Change (IPCC) has predicted
that the CO2 concentration may increase by 660–790 !L L−1 from
2060 to 2090 (IPCC, 2007). This is expected to raise global temperatures due to the CO2 capacity to absorb infrared light (Schneider,
1989; Taylor and MacCracken, 1990). Therefore, continuous emissions of this gas at high levels are believed to cause climate change.
One of the most obvious effects of climate change is its effect
Abbreviations: APX, ascorbate peroxidase; DW, dry weight; ROS, reactive oxygen
species; RuBP, ribulose-1,5-bisphosphate; rubisco, ribulose-1,5-bisphophate carboxylase/oxygenase; SLM, specific leaf mass; XET, xyloglucan endotransglycosidase.
∗ Corresponding author. Tel.: +34 957218367; fax: +34 957211069.
E-mail addresses: [email protected] (L. de la Mata), [email protected] (P. Cabello),
[email protected] (P. de la Haba), [email protected] (E. Agüera).
0176-1617/$ – see front matter © 2012 Elsevier GmbH. All rights reserved.
http://dx.doi.org/10.1016/j.jplph.2012.05.024
31 Capítulo I
1393
L. de la Mata et al. / Journal of Plant Physiology 169 (2012) 1392–1400
boost the expression of storage proteins, but also to upregulate
endo-xyloglucan transferase and xyloglucan endotransglycosidase
(XET) (Cosgrove, 1997), both of which are involved in the incorporation of newly secreted xyloglucans into cell walls (Nishitani
and Tominaga, 1992; Fry et al., 1992; Wu and Cosgrove, 2000).
This expression is correlated with the upregulation of genes
coding for various elements of the cytoskeleton associated with
growth, such as the alpha and beta subunits of tubulin, and various
actin-depolymerizing factors. Many physiological studies indicate
that expression of these genes may contribute to increased leaf
size at elevated CO2 concentrations (Ferris et al., 2001).
The aim of this work was to examine the possible role of an
elevated atmospheric CO2 concentration on the induction of sunflower primary leaf senescence and the effects on biochemical and
physiological processes during leaf ontogeny.
seemingly governed by intrinsic and extrinsic factors that act by
accelerating or delaying the process. Some studies have shown that
leaf senescence is regulated not only by changes in hormone levels,
photosynthetic performance, carbohydrate contents and specific
signals, but also by reactive oxygen species (ROS) (Hensel et al.,
1993; Quirino et al., 2000; Orendi et al., 2001; Buchanan-Wollaston
et al., 2003a).
Senescence can start prematurely by the effects of exposure to
environmental stress or nutrient deprivation (Quirino et al., 2000;
Lim et al., 2003, 2007; Wingler et al., 2009; Agüera et al., 2010).
Leaf senescence in sunflower plants is accelerated by nitrogen deficiency (Agüera et al., 2010) and also by increased light exposure
during growth (De la Mata et al., 2012). Nitrogen deficiency and
growth at high irradiance can result in sugar accumulation, which
may induce leaf senescence through hexose-dependent signaling
(Agüera et al., 2010; De la Mata et al., 2012). The combined effect
of sugar accumulation and certain environmental conditions may
increase the sugar sensitivity of plants. However, senescence may
also be regulated by pathways that are independent of sugar signaling (Wingler et al., 2006; Van Doorn, 2008).
Elevated CO2 concentrations may enhance potential net
photosynthesis of C3 plants because ribulose-1,5-bisphophate carboxylase/oxygenase (rubisco), an enzyme involved in both CO2
fixation and photorespiration, is not CO2 saturated at the current
concentration (Drake et al., 1997). Thus, an increase in ambient
CO2 raises the leaf internal CO2 concentration and the CO2 /O2
ratio at the rubisco site, favoring carboxylation over oxygenation
in ribulose-1,5-bisphosphate (RuBP). Therefore, elevated CO2 concentrations can reduce photorespiration and thus cellular H2 O2
production associated with glycolate metabolism (Pritchard et al.,
2000).
The impact of elevated CO2 concentrations on the oxidative
status of leaves has been examined in various plant species
(Cheeseman, 2006; Qiu et al., 2008), in which it seems to cause a
decrease in the activity of some antioxidant enzymes and also in the
concentration of some antioxidants (Wustman et al., 2001), leading to an increase of ROS levels in most plants (Erice et al., 2007).
ROS are continuously formed as by-products of various metabolic
pathways in different cellular compartments (Foyer and Harbinson,
1994; Apel and Hirt, 2004). Under physiological steady-state conditions, these molecules are scavenged by different antioxidant
defense components (Alscher et al., 1997). However, the balance
between ROS production and scavenging may be perturbed by
adverse environmental factors that increase the intracellular levels of ROS (Polle, 2001; Vanacker et al., 2006). In plants, ROS
are detoxified via enzymatic and non-enzymatic mechanisms; the
enzymatic mechanisms involve superoxide dismutase, catalase,
ascorbate peroxidase (APX) and other antioxidant enzymes such
as glutathione reductase (Mittler, 2002). These enzymes play a key
role in controlling the level of oxygen free radicals (Irigoyen et al.,
1992) and also in the regulation of various processes including leaf
senescence (Procházková and Wilhelmová, 2007). The failure of
defense metabolites and enzymes to detoxify ROS affects biological structures and processes, including DNA nicking, amino acid
and protein oxidation, and lipid peroxidation (Asada, 1999; Johnson
et al., 2003), with the consequent generation of breakdown products such as malondialdehyde (Esterbauer, 1982).
The effects of elevated CO2 concentrations on plant productivity
have been extensively studied. Overall, plants tend to increase
growth and to produce greater amounts of biomass in the presence of elevated CO2 concentrations. Also, the C3 photosynthetic
pathway exhibits a greater relative increase than does the C4
pathway under these conditions. Comparatively less research
has been conducted on the effects of CO2 on plant development,
with occasionally dissimilar results (Bazzaz, 1990; Patterson
and Flint, 1990). Elevated CO2 concentrations were found to
Materials and methods
Plant material and growth
Seeds of sunflower (Helianthus annuus L.) from the isogenic
cultivar HA-89 (Semillas Cargill SA, Seville, Spain) were surfacesterilized in 1% (v/v) hypochlorite solution for 15 min. After rinsing
in distilled water, the seeds were imbibed for 3 h and then sown
in plastic trays containing a 1:1 (v/v) mixture of perlite and vermiculite. Seeds were germinated and plants grown in a growth
chamber with a 16 h photoperiod (400 !mol m−2 s−1 of photosynthetically active radiation supplied by “cool white” fluorescent
lamps supplemented by incandescent bulbs) and a day/night
regime of 25/19 ◦ C and 70/80% relative humidity. Plants were
irrigated daily with a nutrient solution containing 10 mM KNO3
(Hewitt, 1966).
Plants were grown under these conditions for 8 days and then
transferred to different controlled-environment cabinets (Sanyo
Gallenkam Fitotron, Leicester, UK) fitted with an ADC 2000 CO2
gas monitor. The plants were kept under ambient CO2 levels
(400 !L L−1 ) or elevated CO2 concentration (800 !L L−1 ) under constant conditions of photonic flux (400 !mol m−2 s−1 ), temperature
(25/19 ◦ C) and relative humidity (70/80%) for another 34 days.
High-purity CO2 was supplied from a compressed gas cylinder (Air
Liquid, Seville, Spain). Samples of primary leaves aged 16, 22, 32 or
42 days were collected 2 h after the start of the photoperiod. Whole
leaves were excised and pooled in two groups: one was used to
measure leaf area and specific leaf mass (SLM)–dry weight (DW),
and the other was immediately frozen in liquid nitrogen and stored
at −80 ◦ C. The frozen plant material was ground in a mortar precooled with liquid N2 and the resulting powder distributed into
small vials that were stored at −80 ◦ C until enzyme activity and
metabolite determinations.
The net CO2 fixation rate, transpiration rate and stomatal conductance were measured on attached leaves, using a CRS068
portable infrared gas analyzer (IRGA) with the software CIRAS-2.
Measurements were made on primary leaf samples from different
plants in each treatment.
Protein, pigment and H2 O2 determinations
Frozen material was homogenized with cold extraction medium
(4 mL g−1 ) consisting of 50 mM Hepes-KOH (pH 7), 5 mM MgCl2 and
1 mM EDTA, and analyzed with the Bio-Rad protein assay according to Bradford (1976). Pigments were determined in plant extracts
according to Cabello et al. (1998). For H2 O2 determination, 1 g
leaf material was ground with 10 mL cool acetone in a cold room
and passed through Whatman filter paper. Hydrogen peroxide was
32 Capítulo I
1394
Fig. 1. Changes in specific leaf mass (SLM) referred to dry weight (DW), leaf area and soluble protein during sunflower primary leaf development. Plants were grown under
different atmospheric CO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1 (open circles). Data are means ± SD of duplicate determinations from three separate
experiments. Asterisks indicate statistically significant differences among the CO2 treatments at the indicated times according to Student’s t-test (P < 0.05).
33 Capítulo I
1395
5
14
*
A
*
4
4
*
*
2
1
2
0
0
16
22
Days
32
16
42
20
22
Days
32
42
5
*
C
*
*
5
(mgg 1)
Carotenoids
*
10
D
*
*
4
*
(mgg 1)
Total chlorophyll
B
*
3
(mgg 1)
*
6
15
*
*
8
(mgg 1)
Chlorophyll a
10
Chlorophyll b
12
*
3
2
0
1
16
22
Days
32
42
16
22
Days
32
42
Fig. 2. Changes in the pigments levels during sunflower primary leaf development. Plants were grown under different atmospheric CO2 concentrations: 400 !L L−1 (closed
circles) and 800 !L L−1 (open circles). Data are means ± SD of duplicate determinations from three separate experiments. Asterisks indicate statistically significant differences
among the CO2 treatments at the indicated times according to Student’s t-test (P < 0.05).
determined by formation of the titanium–hydroperoxide complex
according to Mukherjee and Choudhuri (1983).
and 10 mM H2 O2 . After the enzyme was added, hydrogen peroxide decomposition was monitored via the absorbance at 240 nm
(ε = 43.6 mM−1 cm−1 ).
APX activity was measured with the method of Nakano and
Asada (1981). The reaction mixture contained 50 mM phosphate
buffer (pH 7), 1 mM sodium ascorbate and 25 mM H2 O2 . Following
addition of ascorbate to the mixture, the reaction was monitored
via the absorbance at 290 nm (ε = 2.8 mM−1 cm−1 ).
Carbohydrate determinations
Carbohydrates were extracted from the powdered frozen tissue in successive steps with different ethanol/water solutions
according to Agüera et al. (2006). The supernatants from the centrifugations were collected and combined for the analysis of soluble
sugars, saving the pellets for starch determination. Sucrose, glucose
and fructose were determined according to Outlaw and Tarczynski
(1984), Kunst et al. (1984) and Beutler (1984), respectively. The
pellets were resuspended in water and incubated at 100 ◦ C for 5 h.
Glucose was then released by incubation with "-amylase and amyloglucosidase, and assayed enzymatically as described above.
Statistical analysis
Values are given as the means ± SD of duplicate determinations from three separate experiments. All results were statistically
analyzed using the Student’s t-test and they were conducted at a
significance level of 5% (P < 0.05).
C and N determinations
Results
For C and N determinations, leaves were ground to a homogeneous powder with an Eppendorf grinder (Retsch MM301), using
2 mL Eppendorf containers and 5-mm diameter glass balls. Prior to
analysis, the samples were dried at 70 ◦ C for 24 h. Approximately
3 mg of sample was weighed into tin foil containers (2 mm × 5 mm)
and analyzed for C and N on a CHN elemental analyzer (Interscience
CE instruments, EA 11110 CHNS-O).
Some growth-related parameters, such as specific leaf mass
(SLM) (referred to as dry weight (DW)), leaf area and soluble protein
content, were determined in primary leaves of sunflower plants
grown for 42 days under ambient atmospheric CO2 (400 !L L−1 )
or elevated CO2 (800 !L L−1 ) concentrations (Fig. 1). In both treatments, leaf area increased up to 32 days, especially in the plants
grown under elevated CO2 concentrations. SLM referred to as DW
peaked at 22 days in the plants grown under ambient atmospheric
CO2 concentrations, but at 16 days in the plants grown under
elevated CO2 concentrations, decreasing later during leaf development in both treatments (Fig. 1A and B). A significant decrease in
the soluble protein content was observed during aging of sunflower
primary leaves at both CO2 levels (Fig. 1C).
The plants grown in the presence of elevated CO2 concentrations exhibited lower chlorophyll a and b contents and carotenoids
than those grown under ambient atmospheric CO2 conditions
(Fig. 2). Leaf aging reduced the photosynthetic pigment content
under both treatments of CO2 . Thus, total chlorophyll content
decreased by about 65% between 22 and 42 days in plants grown at
elevated CO2 concentrations, but only by 46% in those grown under
Enzymatic antioxidant activity
For determination of catalase and APX, enzyme extracts were
prepared by freezing the weighed amount of leaf samples in liquid nitrogen to prevent proteolytic activity, which was followed
by grinding in 0.1 M phosphate buffer at pH 7.5 containing 0.5 mM
EDTA and 1 mM ascorbic acid in a 1:10 (w/v) ratio. The homogenate
was passed through four layers of gauze and the filtrate centrifuged
at 15,000 × g for 20 min, and the resulting supernatant was used as
enzyme source.
Catalase activity was estimated according to Aebi (1983). The
reaction mixture contained 50 mM potassium phosphate (pH 7)
34 Capítulo I
1396
9
*
*
8
We also examined the changes in carbohydrate contents during
aging of sunflower primary leaves in order to identify their potential roles as metabolic signals for senescence. The plants grown at
elevated CO2 concentrations exhibited higher contents of starch
and soluble sugars (glucose and fructose) throughout development
than the control plants (Fig. 4A and B). In both CO2 treatments,
the concentrations of soluble sugars increased during leaf aging,
but the starch content strongly declined (Fig. 4D). The hexoses
(glucose + fructose) to sucrose ratio increased at the beginning of
senescence especially at elevated CO2 concentrations. This suggests
that accumulation of hexoses in leaves may play a role in regulating leaf senescence, mainly in the plants grown at elevated CO2
concentration (Fig. 4).
C and N elemental analysis revealed that leaf development has
an adverse effect on their contents, which results in an increase
of the C/N ratio (Fig. 5C). However, under elevated CO2 concentrations, a more marked accumulation of C in the leaves was observed,
resulting in higher C/N ratios during leaf aging than in control plants
(Fig. 5).
We also studied the production of H2 O2 and the activity of
the antioxidant enzymes catalase and APX in sunflower leaves.
As shown in Fig. 6A, H2 O2 production increased with leaf aging,
especially under elevated CO2 concentrations, suggesting that high
levels of CO2 may play a role in regulating leaf senescence in
sunflower plants by increasing ROS production. Catalase and APX
activities increased during early leaf development, reaching their
maximal levels at 22 days and decreasing later in senescent leaves.
Also, these antioxidant enzymatic activities were lower in the
plants grown at elevated CO2 concentrations throughout leaf development (Fig. 6B and C).
A
CO 2 Fixa!on
(µmol CO 2 m 2 s 1)
7
*
6
5
*
4
3
2
1
0
16
22
Days
32
42
4
B
Transpira!on
(mmol H2 O m 2 s 1 )
3,5
3
*
2,5
*
2
*
1,5
1
0,5
0
16
22
Days
32
42
C
Stomatal Conductance
(mmol H2 O m 2s 1)
400
Discussion
300
Leaf surfaces provide the most immediate site of contact
between plants and the atmosphere. Environmental gases enter
leaves primarily through stomata and have the potential to change
plant metabolic processes. Our results indicate that some metabolic
processes are sensitive to high atmospheric CO2 concentration during sunflower primary leaf ontogeny. In fact, the plants grown
under elevated CO2 concentrations exhibited more marked growth
than control plants, as reflected by the greatest increase in SLM,
referred to as DW, in young leaves (Fig. 1A). Hovenden and
Schimanski (2000) also found that SLM was increased by elevated
atmospheric CO2 in southern beech (Nothofagus cunninghamii). Leaf
size is determined by cell division and expansion, which are controlled in a coordinated manner during organogenesis by a complex
network of factors, including plant hormones, in response to environmental cues (Nishimura et al., 2004; Tsukaya, 2006; Riikonen
et al., 2010). The presence of elevated atmospheric CO2 concentrations may influence both cell division (Kinsman et al., 1997) and
expansion (Taylor et al., 2003; Riikonen et al., 2010). Enhanced
cell expansion has been associated with an increase of cell-wall
extensibility and the activity of the cell wall loosening enzyme,
XET (Ferris et al., 2001). It has been described that some cell-cycle
and cell wall-loosening genes (encoding histones, expansin, and
XET) show an increased expression in leaves of soybean and Betula
papyrifera growing under a CO2 -enriched atmosphere (Gupta et al.,
2005; Ainsworth et al., 2006; Druart et al., 2006; Kontunen-Soppela
et al., 2010).
Sunflower plants grown under elevated CO2 concentrations
exhibited lower total chlorophyll (a + b) and carotenoid contents
than plants grown under ambient CO2 . Pigment contents decreased
with leaf development in both treatments, but especially at elevated CO2 concentrations. Thus, the greatest decrease was observed
between 22 and 32 days, with a loss of chlorophyll of 48% in
*
200
100
0
16
22
Days
32
42
Fig. 3. CO2 fixation rate, transpiration rate and stomatal conductance during sunflower primary leaf development. Plants were grown under different atmospheric
CO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1 (open circles). Data
are means ± SD of duplicate determinations from three separate experiments. Asterisks indicate statistically significant differences among the CO2 treatments at the
indicated times according to Student’s t-test (P < 0.05).
ambient atmospheric CO2 conditions. The most marked decrease
was observed between 22 and 32 days, with 48% chlorophyll loss
in plants grown at elevated CO2 concentration compared to 26%
chlorophyll loss in control plants (Fig. 2C). Likewise, carotenoid
content decreased by 25% in plants grown at high CO2 concentrations, but only by 20% in those grown under ambient atmospheric
CO2 conditions (Fig. 2D).
The carbon dioxide fixation rate was negatively affected by
aging, after 22 days, in both treatments (Fig. 3A), being higher in
the plants grown under a CO2 enriched atmosphere throughout
the whole leaf development period. Elevated CO2 concentration increased the transpiration rate and stomatal conductance,
although these parameters decreased during leaf ontogeny (Fig. 3B
and C).
35 Capítulo I
1397
300
*
250
A
*
Fructose
200
150
*
100
50
*
*
150
*
100
*
50
0
0
16
22
32
42
16
22
Days
300
C
140
42
D
*
250
*
Starch
100
80
60
(mgg 1DW)
120
Sucrose
32
Days
160
(mgg 1DW)
B
200
(mgg 1DW)
Glucose
(mgg 1 DW)
250
200
150
100
*
*
32
42
40
50
20
0
0
16
22
32
42
16
22
Days
Days
E
5
4
(mgg 1DW)
(Glucose+Fructose)/Sucrose
6
3
2
1
0
16
22
32
42
Days
Fig. 4. Changes in the contents of glucose, fructose, sucrose, starch and in the hexoses to sucrose ratio during sunflower primary leaf development. Plants were grown under
different atmospheric CO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1 (open circles). Data are means ± SD of duplicate determinations from three separate
experiments. Asterisks indicate statistically significant differences among the CO2 treatments at the indicated times according to Student’s t-test (P < 0.05).
plants grown under elevated CO2 in comparison with a loss of
26% in plants grown under ambient conditions (Fig. 2C). These
results suggest that a high CO2 concentration accelerates chlorophyll degradation, and possibly also leaf senescence. Oxidative
stress was previously found to reduce the chlorophyll content of
Aster tripolium leaves (Geissler et al., 2009). An important fraction
of absorbed light may induce ROS formation when photosynthetic
pigments like chlorophyll start to decline. Plants possess enzymatic and non-enzymatic antioxidant mechanisms to avoid or
reduce the effects of ROS on photosynthetic organs (Mittler, 2002;
Srivalli and Khanna-Chopra, 2009). Our results indicate that an
elevated CO2 concentration reduces the activities of catalase and
APX in sunflower primary leaves (Fig. 6). Leaves of soybean plants
grown at elevated CO2 concentrations produce more H2 O2 than
those grown at ambient CO2 concentrations (Cheeseman, 2006).
Although the specific mechanisms by which CO2 promotes H2 O2
production are unclear, bicarbonate may interact directly with iron
or heme derivates to form complexes with an altered redox potential, thereby facilitating increased production of ROS (Arai et al.,
2005). Whereas exposure of C3 plants to elevated CO2 concentration can be expected to reduce H2 O2 production by hindering
photorespiratory metabolism in leaves (Noctor et al., 2002), our
results suggest that exposure of sunflower plants to elevated CO2
concentration raises oxidative stress through an increase in H2 O2
production and a decrease in antioxidant enzyme activities such as
catalase and APX (Fig. 6). Also, elevated CO2 concentrations have
been found to reduce the formation of antioxidative metabolites
and antioxidant enzyme activities in other plants (Erice et al., 2007;
Gillespie et al., 2011). According to Jing et al. (2008), mutations
in the Arabidopsis CPR5/OLD1 gene may cause early senescence
through deregulation of the cellular redox balance. There are some
evidences suggesting that inadequate oxidant and carbonyl group
production are intrinsically related to plant aging, and also that low
mitochondrial superoxide dismutase and APX activities may contribute to extensive protein carbonylation (Vanacker et al., 2006;
Srivalli and Khanna-Chopra, 2009). On the whole, our results support the notion that exposure to elevated CO2 concentration can
result in oxidative stress, as previously reflected in increased protein carbonylation in Arabidopsis and soybean (Qiu et al., 2008).
Elevated CO2 concentration increased photosynthetic CO2 fixation in sunflower primary leaves in comparison with ambient
CO2 concentrations (Fig. 3A), especially in young leaves (16 and
22 days). Stomatal conductance and transpiration rates in sunflower primary leaves decreased during leaf ontogeny, but these
parameters showed the highest values in the presence of elevated CO2 concentrations, especially after 22 days (Fig. 3B and C).
The stomatal response to atmospheric changes has been extensively studied on a wide variety of species, in which stomatal
conductance is usually reduced by elevated CO2 concentrations
(Long et al., 2004; Ainsworth and Rogers, 2007). Likewise, stomatal density decreases (Lake et al., 2002), thereby leading to a
decreased transpiration rate and an increased leaf temperature
(Long et al., 2004). Although stomata in most species close when
the CO2 concentration rises beyond certain levels, the response
36 Capítulo I
1398
A
A
*
600
*
300
250
*
*
(µmolg 1 DW)
400
H2O2
Carbon (mg g 1 DW)
800
200
200
*
*
150
100
50
0
16
22
32
0
42
Days
16
22
32
42
Days
B
B
60
2,5
40
*
20
(Ug 1DW)
2,0
Catalase ac!vity
Nitrogen (mg g 1 DW)
80
*
*
1,5
*
*
1,0
0,5
0
16
22
32
42
0,0
Days
16
Ascorbate peroxidase ac!vity
Carbon/Nitrogen
ra!o
C
*
20
*
*
15
10
5
0
16
22
32
42
Days
32
42
30
*
25
20
*
15
*
10
5
0
16
Fig. 5. Changes in the contents of carbon and nitrogen and the C/N ratio during sunflower primary leaf development. Plants were grown under different atmospheric
CO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1 (open circles). Data
are means ± SD of duplicate determinations from three separate experiments. Asterisks indicate statistically significant differences among the CO2 treatments at the
indicated times according to Student’s t-test (P < 0.05).
22
32
42
Days
Fig. 6. Hydrogen peroxide accumulation, and catalase and ascorbate peroxidase
activities during sunflower primary leaf development. Plants were grown under
different atmospheric CO2 concentrations: 400 !L L−1 (closed circles) and 800 !L L−1
(open circles). Data are means ± SD of duplicate determinations from three separate
experiments. Asterisks indicate statistically significant differences among the CO2
treatments at the indicated times according to Student’s t-test (P < 0.05).
of plants to high CO2 levels varies widely, and some species are
even unaffected (Drake et al., 1997). The absence of a stomatal
response to atmospheric CO2 may be either genetically determined
or the result of adaptation to an atmosphere with a high relative humidity (Curtis, 1996; Morison, 1998). Elevated atmospheric
CO2 concentrations should boost CO2 photosynthetic fixation for
at least two purposes, namely: (a) to reduce photorespiration and
(b) to enhance substrate binding of rubisco (Long et al., 2004,
2006; Ainsworth and Rogers, 2007). In Populus tremuloide and B.
papyrifera net photosynthesis increases by 49–73% in the presence of elevated CO2 concentrations, and this additionally raises
the hexoses to sucrose ratio (Riikonen et al., 2008). Our results
suggest that elevated CO2 concentrations increase the starch and
soluble sugar contents (glucose and fructose), throughout development in sunflower primary leaves (Fig. 4). A marked increase
in the hexose to sucrose ratio was observed at the beginning of
senescence, especially at elevated CO2 concentrations, suggesting
that carbon mobilization associated with senescence occurs earlier
37 22
Days
C
(Ug 1 DW)
25
and more markedly in plants grown at elevated CO2 concentration. The reason for this increase in soluble sugars may be that
under a surplus of CO2 high amounts of starch are synthesized in
mature, photosynthetically active leaves. Also, this increase could
be the result of senescence promoting a decline in the functional
and structural integrity of cell membranes, thereby accelerating the
membrane lipid catabolism which produces sugars by gluconeogenesis (Buchanan-Wollaston et al., 2003b; Lim et al., 2007). Sugars
regulate many metabolic and development processes, and in some
of them, hexokinase is involved as a sugar sensor. Hexokinase may
be responsible for sugar-dependent senescence regulation, since its
over-expression inhibits plant growth, decreases photosynthetic
activity and induces senescence rapidly (Wingler et al., 2004).
Exposure of cucumber plants to elevated CO2 concentrations was
previously found to result in a concomitant increase in starch and
soluble sugars in leaves, and a decrease in the nitrate content (Larios
Capítulo I
1399
et al., 2001; Agüera et al., 2006). However, the effect of elevated CO2
concentrations on hexose accumulation varies between species.
Thus, hexoses accumulate in soybean plants (Bunce and Sicher,
2001; Rogers et al., 2004; Ainsworth and Long, 2005), whereas
glucose and fructose contents in Arabidopsis plants are essentially
similar irrespective of the CO2 concentration (Bae and Sicher, 2004).
According to Van Doorn (2008), little is known about sugar concentrations and senescence regulation in different tissues and cells.
Sugars may not always be the direct cause of leaf senescence,
although there is, in fact, sufficient evidence that sugar signaling
plays a role in senescence regulation in a complex network with
a variety of other signals, such as those resulting from biotic or
abiotic stress (Wingler and Roitsch, 2008). Leaves of variable age
have been found to differ in their response to changes in atmospheric CO2 concentrations indicating that the effect of sugars on
leaf senescence does not depend on their concentration in a specific cell compartment, but rather on the sugar sensitivity of the
cells (Casanova Katny et al., 2005; Wingler et al., 2006). Thus, old
leaves are generally more sensitive to sugars than young, expanding
leaves (Araya et al., 2005).
It has previously been suggested that changes in leaf metabolism
caused by elevated CO2 concentrations are related to an altered N
status in leaves (Kim et al., 2006; Leakey et al., 2009; Sanz-Sáez et al.,
2010). We found that the C/N ratio in sunflower primary leaves
increases with the leaf age, especially at elevated CO2 concentration
(Fig. 5). Similar results were previously obtained in soybean leaves
growing under elevated atmospheric CO2 concentrations (Rogers
et al., 2004; Ainsworth et al., 2006). Growth in an atmosphere
containing elevated CO2 concentrations usually results in the accumulation of soluble sugars and starch, and in a reduction in nitrogen
and rubisco levels (Ainsworth and Long, 2005). Generally, plants
grown under elevated CO2 concentrations are nitrogen- rather
that carbon-limited. An imbalanced C/N ratio probably accelerates senescence and may increase nitrogen availability by releasing
nitrogen and rubisco from old leaves (Wiedemuth et al., 2005;
Wingler et al., 2006; Zhu et al., 2009).
In conclusion, this work shows that sunflower leaf senescence
could be promoted by an elevated CO2 concentration, revealing that
the level of soluble sugars, the C/N ratio and the oxidative status
interact in a complex manner during leaf ontogeny. It is likely that
systemic signals produced in plants grown with elevated CO2 , lead
to an early senescence and a higher oxidation state of the cells of
these plant leaves.
Alscher RG, Donahue JH, Cramer CL. Reactive oxygen species and antioxidants: relationships in green cells. Physiol Plantarum 1997;100:224–33.
Apel K, Hirt H. Reactive oxygen species: metabolism, oxidative stress and signal
transduction. Annu Rev Plant Biol 2004;55:373–99.
Arai H, Berlett BS, Chock PB, Stadtman ER. Effect of bicarbonate on iron-mediated
oxidation of low-density lipoprotein. Proc Natl Acad Sci USA 2005;102:10472–7.
Araya T, Noguchi K, Terashima I. Differences between sink and source leaves in
carbohydrate repression of photosynthesis. In: van der Est A, Bruce D, editors.
Photosynthesis: fundamental aspects to global perspective. International Society of Photosynthesis; 2005. p. 660–2.
Asada K. The water-water cycle in chloroplasts: scavenging of active oxygens and
dissipation of excess photons. Annu Rev Plant Phys 1999;50:601–39.
Bazzaz FA. The response of natural ecosystems to the rising global CO2 levels. Annu
Rev Ecol Syst 1990;2l:167–96.
Bazzaz FA, Fajer EC. Plant life in a CO2 -rich world. Sci Am 1992;266:68–74.
Beutler HO. d-Fructose. In: Bergmeyer HU, editor. Methods of enzymatic analysis.
Weinheim: Verlag Chemie; 1984. p. 321–7.
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem
1976;72:248–54.
Bae H, Sicher R. Changes of soluble protein expression and leaf metabolite levels in
Arabidopsis thaliana grown in elevated atmospheric carbon dioxide. Field Crop
Res 2004;90:61–73.
Buchanan-Wollaston V, Earl S, Harrison E, Mathas E, Navabpour S, Page T, et al. The
molecular analysis of leaf senescence—a genomics approach. Plant Biotechnol J
2003a;1:3–22.
Buchanan-Wollaston V, Wellesbourne HRI, Warwic UK.Thomas B, Murphy DJ, Murray BG, editors. Encyclopedia of applied plant science; 2003b. p. 808–16.
Bunce JA, Sicher RC. Water stress and day-to-day variation in apparent photosynthetic acclimation of field-grown soybeans to elevated carbon dioxide
concentration. Photosynthetica 2001;39:95–101.
Cabello P, Agüera E, de la Haba P. Metabolic changes during natural ageing in
sunflower (Helianthus annuus L.) leaves: expression and activity of glutamine
synthetase isoforms are regulated differently during senescence. Physiol Plantarum 2006;128:175–85.
Cabello P, de la Haba P, González-Fontes A, Maldonado JM. Induction of nitrate
reductase, nitrite reductase, and glutamine synthetase isoforms in sunflower
cotyledons as affected by nitrate, light, and plastid integrity. Protoplasma
1998;201:1–7.
Casanova Katny MA, Hoffmann-Thoma G, Schrier AA, Fangmeier A, Jäger HJ, van
Bel AJE. Increase of photosynthesis and starch in potato under elevated CO2 is
dependent on leaf age. J Plant Physiol 2005;162:429–38.
Cheeseman JM. Hydrogen peroxide concentrations in leaves under natural conditions. J Exp Bot 2006;57:2435–44.
Cosgrove DJ. Relaxation in a high-stress environment: the molecular bases of extensible cell walls and cell enlargement. Plant Cell 1997;9:1031–41.
Curtis PS. A meta-analysis of leaf gas exchange and nitrogen in trees grown under
elevated carbon dioxide. Plant Cell Environ 1996;19:127–37.
De la Mata L, Cabello P, de la Haba P, Agüera E. Metabolic regulation of leaf senescence in sunflower (Helianthus annuus L.) plants. In: Nagata T, editor. Senescence.
Rijeka: InTech d.o.o; 2012. p. 51–68.
Drake BG, González-Meler MA, Long SP. More efficient plants: a consequence of
rising atmospheric CO2 ? Annu Rev Plant Phys 1997;48:609–39.
Druart N, Rodríguez-Buey M, Barron-Gafford G, Sjödin A, Bhalerao R, Hurry V.
Molecular targets of elevated [CO2 ] in leaves and stems of Populus deltoides:
implications for future tree growth and carbon sequestration. Funct Plant Biol
2006;33:121–31.
Erice G, Aranjuelo I, Irigoyen JJ, Sánchez-Díaz M. Effect of elevated CO2 , temperature
and limited water supply on antioxidant status during regrowth of nodulated
alfalfa. Physiol Plantarum 2007;130:33–45.
Esterbauer H. Aldehyde products of lipid peroxidation. In: McBrien D, Slater T, editors. Free radicals lipid peroxidation and cancer. Boca Raton: Academic Press;
1982. p. 101–28.
Ferris R, Sabatti M, Miglietta F, Mills RF, Taylor G. Leaf area is stimulated in Populus
by free air CO2 enrichment (POPFACE), through increased cell expansion and
production. Plant Cell Environ 2001;24:305–15.
Foyer CH, Harbinson JC. Oxygen metabolism and the regulation of photosynthetic
electron transport. In: Foyer CH, Mullineaux PM, editors. Causes of photooxidative stress and amelioration of defense systems in plant. Boca Raton, FL: CRC
Press; 1994. p. 1–42.
Fry SC, Smith RC, Renwick KF, Martin DJ, Hodge SK, Matthews KJ. Xyloglucan endotransglycosylase, a new wall-loosening enzyme activity from plants. Biochem J
1992;282:821–8.
Gan S, Amasino RM. Making sense of senescence. Plant Physiol 1997;113:313–9.
Geissler N, Hussin S, Koyro HW. Elevated atmospheric CO2 concentration ameliorates effects of NaCl salinity on photosynthesis and leaf structure of Aster
tripolium L. J Exp Bot 2009;60:137–51.
Gillespie KM, Rogers A, Ainsworth EA. Growth at elevated ozone or elevated carbon dioxide concentration alters antioxidant capacity and response to acute
oxidative stress in soybean (Glycine max). J Exp Bot 2011;62:2667–78.
Gupta P, Duplessis S, White H, Karnosky DF, Martin F, Podila GK. Gene expression
patterns of trembling aspen trees following long-term exposure to interacting
elevated CO2 and tropospheric O3 . New Phytol 2005;167:129–42.
Hensel LL, Grbic V, Baumgarten DA, Bleecker AB. Developmental and age-related
processes that influence the longevity and senescence of photosynthetic tissues
in Arabidopsis. Plant Cell 1993;5:553–64.
Acknowledgements
This work was funded by Junta de Andalucía (Grant P07-CVI02627 and PAI Group BIO-0159) and DGICYT (AGL2009-11290).
References
Aebi HE. Catalase. In: Bergmeyer HU, Grassl M, editors. Methods of enzymatic analysis. Weinheim: Verlag Chemie; 1983. p. 273–86.
Agüera E, Cabello P, de la Haba P. Induction of leaf senescence by low nitrogen nutrition in sunflower (Helianthus annuus L.) plants. Physiol Plantarum
2010;138:256–67.
Agüera E, Ruano D, Cabello P, de la Haba P. Impact of atmospheric CO2 on growth,
photosynthesis and nitrogen metabolism in cucumber (Cucumis sativus L.)
plants. J Plant Physiol 2006;16:809–17.
Ainsworth EA, Rogers A, Vodkin LO, Walter A, Schurr U. The effects of elevated CO2
concentration on soybean gene expression. An analysis of growing and mature
leaves. Plant Physiol 2006;142:135–47.
Ainsworth EA, Long SP. What have we learned from 15 years of free-air CO2
enrichment (FACE)? A meta-analytic review of the responses of photosynthesis, canopy properties and plant production to rising CO2 . New Phytol
2005;165:351–72.
Ainsworth EA, Rogers A. The response of photosynthesis and stomatal conductance
to rising [CO2 ]: mechanisms and environmental interactions. Plant Cell Environ
2007;30:258–70.
38 Capítulo I
1400
Hewitt EJ. Sand and water culture methods used in the study of plant nutrition.
Commonwealth Bureau of Horticultural and Plantation Crops, East Malling. Tech
Commun 1966; No. 22.
Hovenden MJ, Schimanski LJ. Genotypic differences in growth and stomatal morphology of Southern Beech, Nothofagus cunninghamii, expoxed to depleted CO2
concentrations. Aust J Plant Physiol 2000;27:281–7.
IPCC. Climate change. In: Solomon SD, Qin M, Manning Z, Chen M, Marquis KB, Averyt
M, Tignor, Miller HL, editors. The physical science basis. Contribution of Working
Group I to the Fourth Assessment. Report of the Intergovernmental Panel on
Climate Change. Cambridge: Cambridge University Press; 2007.
Irigoyen JJ, Emerich DW, Sánchez-Díaz M. Alfalfa leaf senescence induced by drought
stress: photosynthesis, hydrogen peroxide metabolism, lipid peroxidation and
ethylene evolution. Physiol Plantarum 1992;84:67–72.
Jing HC, Hebeler R, Oeljeklaus S, Sitek B, Stühler K, Meyer HE, et al. Early leaf
senescence is associated with an altered cellular redox balance in Arabidopsis
cpr5/old1 mutants. Plant Biol 2008;1:85–98.
Johnson SM, Doherty SJ, Croy RRD. Biphasic superoxide generation in potato tubers.
A self-amplifying response to stress. Plant Physiol 2003;131:1440–9.
Kim SH, Sicher RC, Bae H, Gitz DC, Baker JT, Timlin DJ, et al. Canopy photosynthesis,
evapotranspiration, leaf nitrogen, and transcription profiles of maize in response
to CO2 enrichment. Global Change Biol 2006;12:588–600.
Kinsman EA, Lewis C, Davies MS, Young JE, Francis D, Vilhar B, et al. Elevated CO2
stimulates cells to divide in grass meristems: a differential effect in two natural
populations of Dactylis glomerata. Plant Cell Environ 1997;20:1309–16.
Kontunen-Soppela S, Parviainen J, Ruhanen H, Brosché M, Keinänen M, Thakur
RC, et al. Gene expression responses of paper birch (Betula papyrifera) to
elevated CO2 and O3 during leaf maturation and senescence. Environ Pollut
2010;158:959–68.
Kunst A, Draeger B, Ziegenhorn J. d-Glucose: UV-methods with hexokinase and
glucose-6-phosphate dehydrogenase. In: Bergmeyer HU, editor. Methods of
enzymatic analysis. Weinheim: Verlag Chemie; 1984. p. 163–72.
Lake JA, Woodward FI, Quick WP. Long-distance CO2 signalling in plants. J Exp Bot
2002;53:183–93.
Larios B, Agüera E, de la Haba P, Pérez-Vicente R, Maldonado JM. A short-term
exposure of cucumber plants to rising atmospheric CO2 increases leaf carbohydrate content and enhances nitrate reductase expression and activity. Planta
2001;212:305–12.
Leakey ADB, Ainsworth EA, Bernacchi CJ, Rogers A, Long SP, Ort DR. Elevated CO2
effects on plant carbon, nitrogen and water relations: six important lessons from
FACE. J Exp Bot 2009;60:2859–76.
Lim PO, Kim HJ, Nam HG. Leaf senescence. Annu Rev Plant Biol 2007;58:115–36.
Lim PO, Woo HR, Nam HG. Molecular genetics of leaf senescence in Arabidopsis.
Trends Plant Sci 2003;8:272–8.
Long SP, Ainsworth EA, Rogers A, Ort DR. Rising atmospheric carbon dioxide: plants
FACE the future. Annu Rev Plant Biol 2004;55:591–628.
Long SP, Zhu XG, Naidu SL, Ort DR. Can improvement in photosynthesis increase
crop yields? Plant Cell Environ 2006;29:315–30.
Mittler R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci
2002;7:405–10.
Morison JIL. Stomatal response to increased CO2 concentration. J Exp Bot
1998;49:443–52.
Mukherjee SP, Choudhuri MA. Implications of water stress-induced changes in the
levels of endogenous ascorbic acid and hydrogen peroxide in Vigna seedlings.
Physiol Plantarum 1983;58:166–70.
Nakano Y, Asada K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplast. Plant Cell Physiol 1981;22:860–7.
Nishimura C, Ohashi Y, Sato S, Kato T, Tabata S, Ueguchi C. Histidine kinase homologs
that act as cytokinin receptors possess overlapping functions in the regulation
of shoot and root growth in Arabidopsis. Plant Cell 2004;16:1365–77.
Nishitani K, Tominaga R. Endo-xyloglucan transferase, a novel class of glycosyltransferase that catalyzes transfer of a segment of xyloglucan molecule to another
xyloglucan molecule. J Biol Chem 1992;267:21058–64.
Noctor G, Veljovic-Jovanovic S, Driscoll S, Novitskaya L, Foyer CH. Drought and oxidative load in the leaves of C3 plants: a predominant role for photorespiration? Ann
Bot-Lond 2002;89:841–50.
Orendi G, Zimmermann P, Baar C, Zentgraf U. Loss of stress-induced expression of
catalase3 during leaf senescence in Arabidopsis thaliana is restricted to oxidative
stress. Plant Sci 2001;161:301–14.
Ougham H, Hörtensteiner S, Armstead I, Donnison I, King I, Thomas H, et al. The
control of chlorophyll catabolism and the status of yellowing as a biomarker of
leaf senescence. Plant Biol 2008;10:4–14.
Outlaw Jr WH, Tarczynski MC. Sucrose. In: Bergmeyer HU, editor. Methods of enzymatic analysis. Weinheim: Verlag Chemie; 1984. p. 96–103.
Patterson DT, Flint EP. Implications of increasing carbon dioxide and climate change
for plant communities and competition in natural and managed ecosystems.
39 In: Kimball BA, Rosenberg NJ, Allen Jr LH, editors. Impact of carbon dioxide,
trace gases, and climate change on global agriculture. Madison, WI: Special
Publication American Society of Agronomy Inc.; 1990. p. 83–110.
Polle A. Dissecting the superoxide dismutase–ascorbate–glutathione-pathway in
chloroplasts by metabolic modelling. Computer simulations as a step towards
flux analysis. Plant Physiol 2001;126:445–62.
Pritchard SG, Ju Z, van Santen E, Qiu J, Weaver DB, Prior SA, et al. The influence of elevated CO2 on the activities of antioxidative enzymes in two soybean genotypes.
Aust J Plant Physiol 2000;27:1061–8.
Procházková D, Wilhelmová N. Leaf senescence and activities of the antioxidant
enzymes. Biol Plantarum 2007;51:401–6.
Qiu QS, Huber JL, Booker FL, Jain V, Leakey ADB, Fiscus EL, et al. Increased protein
carbonylation in leaves of Arabidopsis and soybean in response to elevated [CO2 ].
Photosynth Res 2008;97:155–66.
Quirino BF, Noh YS, Himelblau E, Amasino RM. Molecular aspects of leaf senescence.
Trends Plant Sci 2000;5:78–282.
Riikonen J, Kets K, Darbah J, Oksanen E, Sober A, Vapaavuori E, et al. Carbon gain
and bud physiology in Populus tremuloides and Betula papyrifera grown under
long-term exposure to elevated concentrations of CO2 and O3 . Tree Physiol
2008;28:243–54.
Riikonen J, Percy KE, Kivimäenpää M, Kubiske ME, Nelson ND, Vapaavuori E, et al.
Leaf size and surface characteristics of Betula papyrifera exposed to elevated CO2
and O3 . Environ Pollut 2010;158:1029–35.
Rogers A, Allen DJ, Davey PA, Morgan PB, Ainsworth EA, Bernacchi CJ, et al. Leaf
photosynthesis and carbohydrate dynamics of soybeans grown throughout
their life-cycle under free-air carbon dioxide enrichment. Plant Cell Environ
2004;27:449–58.
Sanz-Sáez A, Erice G, Aranjuelo I, Nogués S, Irigoyen JJ, Sánchez-Díaz M. Photosynthetic down-regulation under elevated CO2 exposure can be prevented by
nitrogen supply in nodulated alfalfa. J Plant Physiol 2010;167:1558–65.
Schneider SH. The greenhouse effect: science and policy. Science 1989;243:
771–81.
Srivalli B, Khanna-Chopra R. The developing reproductive “sink” induces oxidative
stress to mediate nitrogen mobilization during monocarpic senescence in wheat.
Biochem Biophys Res Commun 2004;325:198–202.
Srivalli B, Khanna-Chopra R. Delayed wheat flag leaf senescence due to removal
of spikelets is associated with increased activities of leaf antioxidant enzymes,
reduced glutathione/oxidized glutathione ratio and oxidative damage to mitochondrial proteins. Plant Physiol Biochem 2009;47:663–70.
Taylor KE, MacCracken MC. Projected effects of increasing concentrations of carbon
dioxide and trace gases on climate. In: Kimball BA, Rosenberg NJ, Allen Jr LH,
editors. Impact of carbon dioxide, trace gases, and climate change on global
agriculture. Madison, WI: Special Publication American Society of Agronomy
Inc.; 1990. p. 1–17.
Taylor G, Tricker PJ, Zhang FZ, Alston VJ, Miglietta F, Kuzminsky E. Spatial and temporal effects of free-air CO2 enrichment (POPFACE) on leaf growth, cell expansion,
and cell production in a closed canopy of poplar. Plant Physiol 2003;131:177–85.
Tsukaya H. Mechanism of leaf-shape determination. Annu Rev Plant Biol
2006;57:477–96.
Van Doorn WG. Is the onset of senescence in leaf cells of intact plants due to low or
high sugars levels? J Exp Bot 2008;59:1963–72.
Vanacker H, Sandalio LM, Jiménez A, Palma JM, Corpas FJ, Meseguer V, et al. Roles
for redox regulation in leaf senescence of pea plants grown on different sources
of nitrogen nutrition. J Exp Bot 2006;57:1735–45.
Wiedemuth K, Muller J, Kahlau A, Amme S, Mock HP, Grzam A, et al. Successive maturation and senescence of individual leaves during barley whole plant ontogeny
reveals temporal and spatial regulation of photosynthetic function in conjunction with C and N metabolism. J Plant Physiol 2005;162:1226–36.
Wingler A, Marès M, Pourtau N. Spatial patterns and metabolic regulation of photosynthetic parameters during leaf senescence. New Phytol 2004;161:781–9.
Wingler A, Masclaux-Daubresse C, Fischer AM. Sugars, senescence and ageing in
plants and heterotrophic organisms. J Exp Bot 2009;60:1063–6.
Wingler A, Purdy S, MacLean JA, Pourtau N. The role of sugars in integrating
environmental signals during the regulation of leaf senescence. J Exp Bot
2006;57:391–9.
Wingler A, Roitsch T. Metabolic regulation of leaf senescence: interactions of sugar
signaling with biotic and abiotic stress responses. Plant Biol 2008;10:50–62.
Wu Y, Cosgrove DJ. Adaptation of roots to low water potentials by changes in cell
wall extensibility and cell wall proteins. J Exp Bot 2000;51:1543–53.
Wustman BA, Oksanen E, Karnosky DF, Noormets A, Isebrands JG, Pregitzer KS, et al.
Effects of elevated CO2 and O3 on aspen clones varying in O3 sensitivity: can CO2
ameliorate the harmful effects of O3 ? Environ Pollut 2001;115:473–81.
Zhu C, Zhu J, Zeng Q, Liu G, Xie Z, Tang H, et al. Elevated CO2 accelerates flag leaf senescence in wheat due to ear photosynthesis which causes greater ear nitrogen sink
capacity and ear carbon sink limitation. Funct Plant Biol 2009;36:291–9.
5. CAPÍTULO II
Elevated CO2 concentrations alter nitrogen metabolism and
accelerate senescence in sunflower (Helianthus annuus L.)
plants
Capítulo II
Plant Soil Environ.
Vol. 59, 2013, No. 7: 303–308
Elevated CO 2 concentrations alter nitrogen metabolism and
accelerate senescence in sunflower (Helianthus annuus L.)
plants
L. De la Mata, P. De la Haba, J.M. Alamillo, M. Pineda, E. Agüera
Department of Botany, Ecology and Plant Physiology, Faculty of Science,
University of Cordoba, Cordoba, Spain
ABSTRACT
Elevated CO2 concentrations were found to cause early senescence during leaf development in sunflower (Helianthus annuus L.) plants, probably by reducing nitrogen availability since key enzymes of nitrogen metabolism,
including nitrate reductase (NR); glutamine synthetase (GS) and glutamate dehydrogenase (GDH), were affected.
Elevated CO2 concentrations significantly decreased the activity of nitrogen assimilation enzymes (NR and GS) and
increased GDH deaminating activities. Moreover, they substantially rose the transcript levels of GS1 while lowering those of GS2. Increased atmospheric CO2 concentrations doubled the CO2 fixation and increased transpiration
rates, although these parameters decreased during leaf ontogeny. It can be concluded that elevated atmospheric
CO2 concentrations alter enzymes involved in nitrogen metabolism at the transcriptional and post-transcriptional
levels, thereby boosting mobilization of nitrogen in leaves and triggering early senescence in sunflower plants.
Keywords: leaf development; GS isoforms; transcript levels
tween carbon and nitrogen metabolism in plants
(Reich et al. 2006). Elevated levels of atmospheric
CO2 inhibit photorespiration in C3 plants increasing
their photosynthetic efficiency, since carboxilation
capacity of ribulose-1-5-biphosphate carboxylase/
oxygenase (Rubisco) enzyme is not saturated by
the current CO2 concentration (Drake et al. 1997).
Moreover, root absorption of NO3– and NH4+ from the
soil and assimilation of NO3– and NH4+ into organic
nitrogen compounds within plant tissues strongly
influence primary productivity in plants. The assimilation of NO3– involves the sequential conversion of NO 3– into NO 2–, then into NH 4+, through
sequential reactions catalyzed by nitrate reductase
(NR) and nitrite reductase (NiR), respectively. NH4+,
the end-product of NO3– reduction, is assimilated
by glutamine synthetase (GS) (Bernard and Habash
2009). Two different isoforms of GS were indentified
Leaf senescence is a key developmental step in
the life of annual plants. During this senescence
process, cells undergo drastic metabolic changes and
sequential degeneration of cellular structures, mainly
chloroplasts. The main function of leaf senescence
is the recycling of nutrients, especially nitrogen remobilization, which affects the nitrogen availability
(Lim et al. 2007). Agüera et al. (2010) showed that
leaf senescence in sunflower plants is accelerated by
nitrogen deficiency. Research in this area focused on
obtaining new cultivars capable of facing the changing climatic conditions on the grounds that elevated
CO 2 concentrations affect nitrogen assimilation
(Bloom et al. 2010). The rise might be mitigated by
crop plants, where photosynthesis converts atmospheric CO2 into carbohydrates and other organic
compounds. The extent of this mitigation remains
uncertain, owing to the complex relationship be-
Supported by the Junta de Andalucía, Grants No. P07-CVI-02627 and PAI Group BIO-0159, and by the DGICYT,
Project No. AGL2009-11290.
303
43 Capítulo II
Vol. 59, 2013, No. 7: 303–308
Plant Soil Environ.
in leaves, namely: cytosolic GS1 and chloroplastic
GS2 (McNally and Hirel 1983). The GS1 and GS2
isoenzymes are differently regulated within specific
cell types and organs, and in response to different
developmental, metabolic and environmental cues
(Zozaya-Hinchliffe et al. 2005). In addition to GS,
other enzymes play key roles in maintaining carbon
and nitrogen balance. Thus, GDH catalyzes the
reversible amination/deamination between 2-oxoglutarate and glutamate. Its physiological role in
nitrogen metabolism, however, is controversial (Forde
and Lea 2007). Although some evidences suggest
that glutamate dehydrogenase (GDH) plays a role
in NH4+ assimilation, many other indicate that GDH
functions primarily as a deaminating enzyme (Lea
and Miflin 2003).
The purpose of this work was to study the effect
of elevated atmospheric CO2 concentration, on sunflower (Helianthus annuus L.) leaf senescence, with
special emphasis on nitrogen metabolism enzymes
(NR, GS and GDH) and the expression of GS1 and
GS2 transcripts during leaf ageing.
in two groups: one was used to measure dry weight
(DW), and the other was immediately frozen in liquid
nitrogen and stored at –80°C. The frozen plant material was ground in a mortar pre-chilled with liquid N2
and the resulting powder distributed into small vials
that were stored at –80°C until enzyme activity and
metabolite determinations. Net CO 2 fixation rate,
transpiration and stomatal conductance were measured 2 h after the start of photoperiod in attached
leaves, using a model CRS068 portable infrared gas
analyzer (IRGA) with CIRAS software (USA). Gas
exchange rates were determined under 400 µL/L
or 800 µL/L CO2 levels. The instrument was adjusted
to maintain 150 cm3/min constant flow, 25°C temperature, 80% relative humidity and 400 µmol/m2/s
lighting inside the leaf chamber. Measurements were
made on primary leaves (16, 22, 32 and 42 days) after
the IRGA stabilization period, using several plants
per treatment. Leaf samples were acclimated in the
leaf chamber for 5–10 min and the measurements
were carried out during the following 3–5 min. For
total organic C and N content determinations, leaves
were ground with an Eppendorf grinder (Retsch
MM301, New York, USA). Prior to analysis, the
samples were dried at 70°C for 24 h. Approximately
3 mg of tissue was weighed into tin foil containers
(2 × 5 mm) and analyzed for C and N on a CHN
elemental analyzer (Interscience CE instruments,
11110 CHNS-O, EURO EA, Saint Nom, France).
Frozen material was homogenized with chilled extraction medium (Agüera et al. 2006). The homogenate was centrifuged at 8 000 × g at 4°C for 2 min,
and enzyme activities were measured immediately
using the cleared extract. NR (EC 1.6.6.1) activity
was assayed in the absence of Mg2+ to determine
total NADH-NR activity, as described by Agüera et
al. (2006). GS (EC 6.3.1.2) activity was measured with
the transferase assay according to De la Haba et al.
(1992). GDH (E.C. 1.4.1.2) deaminating activities
were determined spectrophotometrically according
to Loyola-Vargas and Sánchez de Jiménez (1984).
Total RNA from primary leaves was purified using the
Tri-Reagent (Sigma Aldrich, St. Louis, USA), following
the manufacturer’s instructions. Total RNA (2.5 µg)
was treated with DNAase (RQ1 RNAase-Free
MATERIAL AND METHODS
Sunflower (H. annuus L.) isogenic cultivar HA-89
(Semillas Cargill SA, Seville, Spain) plants cultivated in a growth chamber with a 16 h photoperiod (400 µmol/m 2/s of photosynthetically active
radiation), a day/night regime of 25/19°C and
70/80% relative humidity. Plants were irrigated
daily with a nutrient solution containing 10 mmol
KNO3 (Hewitt 1966). Plants were grown under the
above-described conditions for 8 days and then
transferred to different controlled-environment
cabinets (Sanyo Gallenkam Fitotron, Leicester,
UK) fitted with an ADC 2000 CO 2 gas monitor.
The plants were kept under ambient CO2 levels
(400 µL/L) or elevated CO2 concentration (800 µL/L)
for another 34 days. High-purity CO2 was supplied
from a compressed gas cylinder (Air Liquid, Seville,
Spain). Samples of primary leaves aged 16, 22, 32 or
42 days, were collected 2 h after the start of the light
photoperiod. Whole leaves were collected and pooled
Gene
Accesion number
Organism
Actin
FJ487620
Helianthus
annuus
Helianthus annus
GS1
AF005032
Helianthus
annuus
Helianthus annus
GS2
AF005223
Helianthus annus
Helianthus
annuus
Primers sequences (3'- 5')
agggcggtctttccaagtat
tggtacgaccactggcataa
ccaaagcctattcctggtga
caaacacccgatcacaacag
cttgaccctaagcccattga
ggtttccgcaagtaatcctg
Forward primer
Reverse primer
Forward primer
Reverse primer
Forward primer
Reverse primer
304
44 Capítulo II
Plant Soil Environ.
Vol. 59, 2013, No. 7: 303–308
RESULTS AND DISCUSSION
DNase, Promega) and used to generate first-strand
cDNA by Reverse Transcriptase III (Invitrogen)
using Oligo dT primer, in a total volume of 20 µL.
The cDNA was appropriately diluted and the PCR
reactions were done using the specific primers listed
in the table below. The identity of the amplified
fragments was verified by sequenciation.
Expression analysis was carried out by semiquantitative PCR using GoTaq Flexi DNA polymerase (Promega). Expression levels were normalized
using the expression of the housekeeping gene
actin as internal control. Gene expression levels
were determined by image analysis using Quantity
One, version 4.6.3 (BioRad, California, USA) after gel electrophoresis of the PCR products, and
referred to the level of expression of actin gene
in the same sample.
Values are given as the means ± SD of duplicate
determinations from three separate experiments.
All results were statistically analyzed using the
Student’s t-test and they were conducted at a significance level of 5% (P < 0.05).
activity
GSGS
activity
(mmol
γ-glutamil
hydroxamate/h/g
DW)
(mmol
γ-glutamil
hidroxamate/h/
g
NR
NR activity
activity
(μmol
NO2–/h/g
/h/gDW)
DW)
(μmol
NO-2
(b)
40
20
0
10
20
30
40
30
20
DW)
60
(a)
Available evidence indicates that high atmospheric CO 2 concentrations during leaf ontogeny
alter the activity and expression of some enzymes
that play a key role in the nitrogen metabolism
(NR, GS and GDH) (Figure 1) in sunflower plants.
In fact, plants grown under elevated CO 2 concentration exhibited a significant (P < 0.05) lower
NR (Figure 1a) and GS activities (Figure 1b) than
those grown under ambient atmospheric CO 2
conditions, throughout development. Stitt and
Krapp (1999) initially assumed that some plant
species will require an increased rate of nitrate
assimilation to support an increased plant growth
under elevated CO2 concentrations. However, CO2
enrichment was shown to inhibit NO 3– assimilation in wheat and Arabidopsis plants (Bloom et
al. 2010). NO 3– assimilation is powered by the reduced form of nicotinamide adenine dinucleotide
(NADH). Photorespiration boosts the release of
malic acid from chloroplasts and increases the
10
0
10
20
30
40
Days
200
GDHdeaminating
deaminatingactivity
activity
GDH
(μmol/h/g
(μmol
/h/ gDW)
DW)
(c)
150
Figure 1. Nitrate reductase (NR) (a), glutamine synthetase (GS) (b) and glutamate dehydrogenase GDH (c)
activities during sunflower primary leaf development.
Plants were grown under two atmospheric CO2 concentrations: 400 µL/L (open circles) and 800 µL/L (closed
circles). Data are means ± SD of duplicate determinations from three independent experiments. Asterisks
indicate statistically significant differences among the
CO 2 treatments at the indicated times according to the
Student’s t-test (P < 0.05). DW – dry weight
100
50
0
10
20
30
40
Days
305
45 Capítulo II
Vol. 59, 2013, No. 7: 303–308
(a)
Plant Soil Environ.
(b)
GS2 (relative expression level)
GS1 (relative expression level)
3
2.5
2
1.5
1
0.5
0
16
22
Days
32
1.2
1
0.8
0.6
0.4
0.2
0
16
42
22
Days
32
42
Figure 2. Changes in GS1 (a) and GS2 (b) relative expression level during sunflower primary leaf development.
Plants were grown under two atmospheric CO 2 concentrations: 400 µL/L (white bars) and 800 µL/L (black
bars). Data are means ± SD of duplicate determinations from three independent experiments. Asterisks indicate
statistically significant differences among the CO 2 treatments at the indicated times according to the Student’s
t-test (P < 0.05)
as a regulator of their own degradation during
senescence (Zapata et al. 2005). Increased atmospheric CO 2 levels may boost processes leading
to accelerated senescence in sunflower leaves,
including dismantling of chloroplasts, where GS2
operates (McNally and Hirel 1983). Several studies have shown that GS1 isoforms are involved in
nitrogen remobilization during leaf senescence
in grasses (Swarbreck et al. 2011). In C3 plants
leaves, the largest part of the NH 4+ assimilated
under ambient CO 2 concentration is originated
in the process of photorespiration, rather than
from de novo assimilation of NO 3– or NH 4+ (Stitt
and Krapp 1999) and elevated CO 2 concentration
decreases photorespiration (Foyer et al. 2009).
NH 4+ from photorespiration is assimilated by the
GS2 isoform (Lam et al. 1996), which agrees with
the low levels of GS2 transcripts found in leaves of
the plants grown under elevated CO 2 concentrations relative to the control (Figure 2b). On the
other hand, GDH deaminating activity (Figure 1c)
peaked in senescent leaves (42 days) with both
treatments; activity values after 22 days were significantly higher (P < 0.05) at the elevated CO 2
concentration (Figure 1c). Lea and Miflin (2003)
showed that GDH worked primarily in the deamination reaction leading to the production of NH 4+
in mitochondria. Therefore, increase in GDH
deaminating activity with the increment in CO 2
levels and leaf age was expected. These conditions,
which boost nitrogen remobilization, are typical of
senescence (Lehmann and Ratajcak 2008). Díaz et
al. (2008) found induction of gdh2 expression and
availability of cytoplasmic NADH (Igamberdiev
et al. 2001), which enables the first step of NO 3–
assimilation (Quesada et al. 2000). Elevated CO 2
atmospheric concentrations reduce photorespiration and thereby diminish the amount of NADH
available to power NO 3– reduction, which may
account for the decreased levels of NR activity
observed in sunflower plants grown under elevated CO 2 (Figure 1a). On the other hand, six
transporters of the Nar1 family are involved in
NO2– translocation from the cytosol into the chloroplast in Chlamydomonas, and some of these
transport both NO 2– and HCO 3– (Mariscal et al.
2006). Bloom et al. (2002) showed that HCO 3–
inhibits NO 2– influx into isolated wheat and pea
chloroplasts, indicating that an analogous system is
operating in higher plants. A decreased NO2– influx
into the chloroplast might therefore be the result
of increased CO 2 levels, which may also account
for the reduced (P < 0.05) GS activity observed in
sunflower plants grown under elevated CO 2 concentrations (Figure 1b). Studies have shown that
both the chloroplastic and the cytosolic isoforms
of GS are affected by abiotic stress (Bernad and
Habash 2009). Our results indicate that elevated
CO 2 atmospheric concentrations significantly increase (P < 0.05) GS1 relative expression (Figure 2a),
but decrease (P < 0.05) GS2 transcript levels (Figure 2b),
in sunflower leaves. During this senescence process, cells undergo drastic metabolic changes and
sequential degeneration of cellular structures,
starting with the chloroplasts. These organelles
play a dual role, as a main source for nitrogen and
306
46 Capítulo II
Plant Soil Environ.
Vol. 59, 2013, No. 7: 303–308
Table 1. CO 2 fixation rate, transpiration rate, stomatal conductance and C:N ratio during sunflower primary
leaf development. Plants were grown under different atmospheric CO 2 concentrations: CO 2 ambient (400 µL/L)
and CO 2 elevated (800 µL/L)
Days
CO2 fixation
(µmol CO 2/m2/s)
Transpiration
(mmol H 2O/m2/s)
Stomatal conductance
(mmol H 2O/m2/s)
C:N ratio
ambient
elevated
ambient
elevated
ambient
elevated
ambient
elevated
16
3.0 ± 0.4
6.8 ± 1.0*
3.2 ± 0.3
3.2 ± 0.4
345.3 ± 5.1
305.7 ± 43.0
8.0 ± 0.7
9.0 ± 0.7*
22
3.4 ± 0.2
7.5 ± 1.1*
1.8 ± 0.1
2.3 ± 0.1*
181.0 ± 7.4
208.0 ± 36.9
8.2 ± 0.1
11.6 ± 2.0*
32
2.5 ± 0.5
4.5 ± 0.9*
1.1 ± 0.2
1.9 ± 0.2*
81.8 ± 9.0
160.1 ± 33.7*
11.3 ± 1.1
14.0 ± 1.8*
42
1.2 ± 0.2
3.0 ± 0.4*
1.1 ± 0.1
1.4 ± 0.1*
78.5 ± 2.0
95.1 ± 9.0
12.4 ± 0.9
18.3 ± 1.5*
Data are means ± SD of duplicate determinations from three independent experiments. Asterisks indicate statistically significant differences among the CO2 treatments at the indicated times according to Student’s t-test (P < 0.05)
GDH activity with ageing in Arabidopsis, which
suggests that GDH participates in amino acid
degradation and nitrogen recycling in this plant.
As can be seen from Table 1, the elevated CO 2
concentrations significantly (P < 0.05) increased
photosynthetic and transpiration rates. In contrast, stomatal conductance only showed significant
differences in 32 days-old leaves, although these
parameters decreased during ageing of sunflower
primary leaves. The stomatal response to atmospheric changes was extensively studied on a wide
variety of species. Although stomata in most species
close when the CO 2 concentration rises beyond
certain levels, the response of plants to high CO 2
levels varies widely, and some species are even
unaffected (Drake et al. 1997, Larios et al. 2004).
The absence of a stomatal response to atmospheric
CO2 may be either genetically determined or the
result of adaptation to an atmosphere with a high
relative humidity (Morison 1998). Larios et al.
(2004) found that exposure of sunflower leaves to
increasing CO2 concentrations caused concomitant
increases in photosynthetic CO 2 assimilation and
soluble sugars and reduction in nitrate content.
Elevated levels of atmospheric CO2 were previously
reported to decrease photorespiration rates in C3
plants and to potentially increase their photosynthetic efficiency as a result (Long et al. 2006). In
our plants, the elevated CO 2 concentration led to
an increased (P < 0.05) C:N ratio during ageing of
sunflower primary leaves (Table 1). Consequently, an
increase in atmospheric CO2 concentrations alters
carbon and nitrogen contents, and leads to a gradual
nitrogen limitation by which leaves accumulate
carbohydrates faster than the plants can acquire
nitrogen, thereby causing the nitrogen contents
of leaves to decrease (Reich et al. 2006). Urban et
al. (2012) found that elevated CO2 treatment resulted in decrease of the Rubisco content in Picea
abies, however, higher proportion of Rubisco are
present in its active carbamylated Rubisco forms in
comparison to ambient CO2 plants. In these plants,
the Rubisco content linearly correlates with leaf
nitrogen content, irrespective of CO2 concentration
treatments. Limited nitrogen availability leads to
early senescence and increases the oxidation state
of cells in sunflower leaves (Agüera et al. 2010,
De la Mata et al. 2012). In addition, according to
Schildhauer et al. (2008), the supply of nitrogen
can reverse senescence by altering the expression
of genes coding for plastidic GS.
In conclusion, elevated atmospheric CO 2 concentrations during leaf development in sunflower
(H. annuus L.) lead to early senescence through
a decrease in nitrogen availability resulting from
the effects of key enzymes of nitrogen metabolism on transcriptional (GS1 and GS2) and posttranscriptional levels (NR, GS and GDH).
REFERENCES
Agüera E., Cabello P., De la Haba P. (2010): Induction of leaf
senescence by low nitrogen nutrition in sunflower (Helianthus
annuus L.) plants. Physiologia Plantarum, 138: 256–267.
Agüera E., Ruano D., Cabello P., De la Haba P. (2006): Impact
of atmospheric CO 2 on growth, photosynthesis and nitrogen
metabolism in cucumber (Cucumis sativus L.) plants. Journal
of Plant Physiology, 163: 809–817.
Bernard S.M., Habash D.Z. (2009): The importance of cytosolic
glutamine synthetase in nitrogen assimilation and recycling.
New Phytologist, 182: 608–620.
307
47 Capítulo II
Vol. 59, 2013, No. 7: 303–308
Plant Soil Environ.
Bloom A.J., Burger M., Rubio Asensio J.S., Cousins A.B. (2010):
storage material to asparagine in germinating seeds of yellow
lupine. Journal of Plant Physiology, 165: 149–158.
Lim P.O., Kim H.J., Nam H.G. (2007): Leaf senescence. Annual
Review of Plant Biology, 58: 115–136.
Long S.P., Zhu X.G., Naidu S.L., Ort D.R. (2006): Can improvement in photosynthesis increase crop yields? Plant, Cell and
Environment, 29: 315–330.
Loyola-Vargas V.M., de Jiménez E.S. (1984): Differential role of
glutamate dehydrogenase in nitrogen metabolism of maize
tissues. Plant Physiology, 76: 536–540.
McNally S., Hirel B. (1983): Glutamine synthetase isoforms in
higher plants. Physiologie Vegetale, 21: 761–774.
Mariscal V., Moulin P., Orsel M., Miller A.J., Fernández E., Galván
A. (2006): Differential regulation of the Chlamydomonas Nar1
gene family by carbon and nitrogen. Protist, 157: 421–433.
Morison J.I.L. (1998): Stomatal response to increased CO 2 concentration. Journal of Experimental Botany, 49: 443–452.
Quesada A., Gómez-García I., Fernández E. (2000): Involvement
of chloroplast and mitochondria redox valves in nitrate assimilation. Trends in Plant Science, 5: 463–464.
Reich P.B., Hungate B.A., Luo Y.Q. (2006): Carbon-nitrogen
Carbon dioxide enrichment inhibits nitrate assimilation in
wheat and Arabidopsis. Science, 328: 899–903.
Bloom A.J., Smart D.R., Nguyen D.T., Searles P.S. (2002): Nitrogen assimilation and growth of wheat under elevated carbon
dioxide. Proceeding of the National Academic of Science of
the Unites States of America, 99: 1730–1735.
De la Haba P., Cabello P., Maldonado J.M. (1992): Glutaminesynthetase isoforms appearing in sunflower cotyledons during
germination. Effects of light and nitrate. Planta, 186: 577–581.
De la Mata L., Cabello P., De la Haba P., Agüera E. (2012): Growth
under elevated atmospheric CO2 concentration accelerates leaf
senescence in sunflower (Helianthus annuus L.) plants. Journal
of Plant Physiology, 169: 1392–1400.
Díaz C., Lemaitre T., Christ A., Azzopardi M., Kato Y., Sato F.,
Morot-Gaudry J.F., Dily F.L., Masclaux-Daubresse C. (2008):
Nitrogen recycling and remobilization are differentially controlled by leaf senescence and development stage in Arabidopsis
under low nitrogen nutrition. Plant Physiology, 147: 1437–1449.
Drake B.G., González-Meler M.A., Long S.P. (1997): More efficient plants: A consequence of rising atmospheric CO 2? An-
interactions in terrestrial ecosystems in response to rising
atmospheric carbon dioxide. Annual Review of Ecology, Evolution and Systematics, 37: 611–636.
Schildhauer J., Wiedemuth K., Humbeck K. (2008): Supply of nitrogen
can reverse senescence processes and affect expression of genes
coding for plastidic glutamine synthetase and lysine-ketoglutarate
reductase/saccharopine dehydrogenase. Plant Biology, 10: 76–84.
Stitt M., Krapp A. (1999): The interaction between elevated carbon
dioxide and nitrogen nutrition: The physiological and molecular
background. Plant, Cell and Environment, 22: 583–621.
Swarbreck S.M., Defoin-Platel M., Hindle M., Saqi M., Habash D.Z.
(2011): New perspectives on glutamine synthetase in grasses.
Journal of Experimental Botany, 62: 1511–1522.
Urban O., Hrstka M., Zitová M., Holišová P., Sprtová M., Klem
K., Calfapietra C., De Angelis P., Marek M.V. (2012): Effect of
season, needle age and elevated CO 2 concentration on photo-
nual Review of Plant Physiology and Plant Molecular Biology,
48: 609–639.
Forde B.G., Lea P.J. (2007): Glutamate in plants: Metabolism,
regulation and signalling. Journal of Experimental Botany,
58: 2339–2358.
Foyer C.H., Bloom A.J., Queval G., Noctor G. (2009): Photorespiratory metabolism: Genes, mutants, energetics, and redox
signaling. Annual Review of Plant Biology, 60: 455–484.
Igamberdiev A.U., Bykovaa N.V., Leab P.J., Gardeströma P. (2001):
The role of photorespiration in redox and energy balance of
photosynthetic plant cells: A study with a barley mutant deficient
in glycine decarboxylase. Physiologia Plantarum, 111: 427–438.
Lam H.M., Coschigano K.T., Oliveira I.C., Melo-Oliveira R.,
Coruzzi G.M. (1996): The molecular-genetics of nitrogen assimilation into amino acids in higher plants. Annual Review
of Plant Physiology and Plant Molecular Biology, 47: 569–593.
Larios B., Agüera E., Cabello P., Maldonado J.M., De la Haba P.
(2004): The rate of CO 2 assimilation controls the expression
and activity of glutamine synthetase through sugar formation
in sunflower (Helianthus annuus L) leaves. Journal of Experimental Botany, 55: 69–75.
Lea P.J., Miflin B.J. (2003): Glutamate synthase and the synthesis
of glutamate in plants. Plant Physiology and Biochemistry,
41: 555–564.
Lehmann T., Ratajczak L. (2008): The pivotal role of glutamate
dehydrogenase (GDH) in the mobilization of N and C from
synthesis and Rubisco acclimation in Picea abies. Plant Physiology and Biochemistry, 58: 135–141.
Zapata J.M., Guéra A., Esteban-Carrasco A., Martín M., Sabater
B. (2005): Chloroplasts regulate leaf senescence: Delayed senescence in transgenic ndhF-defective tobacco. Cell Death and
Differentiation, 12: 1277–1284.
Zozaya-Hinchliffe M., Potenza C., Ortega J.L., Sengupta-Gopalan
C. (2005): Nitrogen and metabolic regulation of the expression
of plastidic glutamine synthetase in alfafa (Medicago sativa).
Plant Science, 168: 1041–1052.
Received on January 27, 2013
Accepted on May 17, 2013
Corresponding author:
Dr. Eloísa Agüera Buendía, University of Cordoba, Faculty of Science, Department of Botany, Ecology and Plant
Physiology, Área de Fisiología Vegetal, Campus de Rabanales, edificio Celestino Mutis (C4), E-14071 Cordoba, Spain
phone: + 34 957 218 367, fax + 34 957 211 069, e-mail: [email protected]
308
48 6. CAPÍTULO III
(Helianthus annuus L.) plants under two different light intensities
Capítulo III
DOI: 10.1007/s11099-013-0001-x
PHOTOSYNTHETICA 51 (1): 85-94, 2013
(Helianthus annuus L.) plants under two different light intensities
L. DE LA MATA, P. CABELLO, P. DE LA HABA, and E. AGÜERA+
Departamento de Botánica, Ecología y Fisiología Vegetal, Área de Fisiología Vegetal, Facultad de Ciencias,
Universidad de Córdoba, Campus de Rabanales. Edificio Celestino Mutis (C4), E-14071 Córdoba, Spain*
Abstract
Different parameters that vary during leaf development may be affected by light intensity. To study the influence of
different light intensities on primary leaf senescence, sunflower (Helianthus annuus L.) plants were grown for 50 days
under two photon flux density (PFD) conditions, namely high irradiance (HI) at 350 mol(photon) m–2 s–1 and low
irradiance (LI) at 125 mol(photon) m–2 s–1. Plants grown under HI exhibited greater specific leaf mass referred to dry
mass, leaf area and soluble protein at the beginning of the leaf development. This might have resulted from the increased
CO2 fixation rate observed in HI plants, during early development of primary leaves. Chlorophyll a and b contents in HI
plants were lower than in LI plants in young leaves. By contrast, the carotenoid content was significantly higher in HI
plants. Glucose concentration increased with the leaf age in both treatments (HI and LI), while the starch content
decreased sharply in HI plants, but only slightly in LI plants. Glucose contents were higher in HI plants than in LI plants;
the differences were statistically significant (p<0.05) mainly at the beginning of the leaf senescence. On the other hand,
starch contents were higher in HI plants than in LI plants, throughout the whole leaf development period. Nitrate
reductase (NR) activity decreased with leaf ageing in both treatments. However, the NR activation state was higher
during early leaf development and decreased more markedly in senescent leaves in plants grown under HI. GS activity
also decreased during sunflower leaf ageing under both PFD conditions, but HI plants showed higher GS activities than
LI plants. Aminating and deaminating activities of glutamate dehydrogenase (GDH) peaked at 50 days (senescent
leaves). GDH deaminating activity increased 5-fold during the leaf development in HI plants, but only 2-fold in LI
plants. The plants grown under HI exhibited considerable oxidative stress in vivo during the leaf senescence, as revealed
by the substantial H2O2 accumulation and the sharply decrease in the antioxidant enzymes, catalase and ascorbate
peroxidase, in comparison with LI plants. Probably, systemic signals triggered by a high PFD caused early senescence
and diminished oxidative protection in primary leaves of sunflower plants as a result.
Additional key words: antioxidant enzymes; ascorbate peroxidase; catalase; glutamate dehydrogenase; glutamine synthetase; hexose;
nitrite reductase; irradiance; nitrate reductase; plant; reactive oxygen species; senescence; sunflower; superoxide dismutase.
Introduction
Leaf senescence is a highly regulated and programmed
degeneration process that is controlled by multiple developmental and environmental signals (Lim et al. 2003).
Senescence is not only a degenerative process, but also a
recycling process whereby nutrients are translocated from
senescing cells to young leaves, developing seeds or
storage tissues (Gan and Amasino 1997). Senescence is
characterized mainly by cessation of photosynthesis,
degeneration of cellular structures, intensive losses of
chlorophylls (Chls), carotenoids (Car) and proteins, and
———
Received 24 January 2012, accepted 24 October 2012.
+
Corresponding author; tel.: +34957218367, fax +34957211069, e-mail: [email protected]
Abbreviations: APX – ascorbate peroxidase; Car – carotenoids; CAT – catalase; Chl – chlorophyll; DTT – dithiothreitol; DM – dry
mass; EDTA – ethylenediaminotetraacetic acid; FAD – flavin adenine dinucleotide; GDH – glutamate dehydrogenase; GOGAT –
glutamate synthetase; gs – stomatal conductance; GS – glutamine synthetase; GS1 – cytosolic glutamine synthetase; GS2 –
chloroplastic glutamine synthetase; HI – high irradiance; LI – low irradiance; NiR – nitrite reductase; NR – nitrate reductase; PFD –
photon flux density; PN – net photosynthetic rate; ROS – reactive oxygen species; SLM – specific leaf mass; SOD – superoxide
dismutase.
Acknowledgements. This work was funded by Junta de Andalucía (Grant P07-CVI-02627 and PAI group BIO-0159) and DGICYT
(AGL2009-11290). The authors are grateful to Mr. A. Velasco Blanco for his valuable technical assistance and to Prof. Dr. J. Diz
Pérez for the helpful advice on the statistical analysis.
85
51 Capítulo III
L. DE LA MATA et al.
dramatically increased lipid peroxidation (Srivalli and
Khanna-Chopra 2004, Agüera et al. 2010). This process
can start prematurely by effect of plant exposure to
environmental stress or nutrient deprivation (Quirino et
al. 2000, Lim et al. 2003, Lim et al. 2007, Wingler et al.
2009, Agüera et al. 2010).
Irradiance and duration of exposure to light are major
factors influencing plant growth and development. A very
high intensity (about 500–5,000 mol m–2 s–1) applied for
an extended period leads to irreversible damage of PSII.
This phenomenon inhibits photosynthesis and diminishes
plant growth (Prasil et al. 1992, Melis 1999, Schansker
and van Rensen 1999). To avoid photooxidative damage,
plants possess highly efficient photoprotective systems
that operate via two primary mechanisms. The first one
involves dissipation of excess excitation energy as heat in
the antenna pigment complexes of PSII. This process is
related to the xanthophyll cycle, by which violaxanthin is
de-epoxidized to antheraxanthin and zeaxanthin in the socalled “violaxanthin cycle” or “xanthophyll cycle”. The
second photoprotective mechanism involves antioxidant
enzymes such as superoxide dismutase (SOD), which
converts superoxide anions into H2O2, and catalase and
APX, which detoxify the resulting peroxide (Asada 1999,
Logan et al. 2006). Plant ageing increases oxidative stress
and ROS levels, but this may also reduce antioxidant
protection (Buchanan-Wollaston et al. 2003a, Zimmermann and Zentgraf 2005, Vanacker et al. 2006). High
PFD exposure has been deemed one major cause of
oxidative stress in plants (Dat et al. 2000). Some reports
describe changes in activity and expression of antioxidant
enzymes in response to high PFD stress, albeit to a
varying extent depending on the particular plant material
and treatment conditions (Hernández et al. 2006, Ariz et
al. 2010). The equilibrium between ROS production and
scavenging may be altered under different stress
conditions (Srivalli and Khanna-Chopra 2009).
Almost all plant stress situations studied to date have
similar effects to natural senescence, and reduce NR,
NiR, GOGAT, total GS, and GS2, but increase GDH and
GS1 transcripts, proteins, and activity levels (Masclaux et
al. 2000, Masclaux-Daubresse et al. 2005, Pageau et al.
2006). NR activity in leaves is rapidly modulated by
reversible phosphorylation of NR protein in response to
light/dark transitions (Agüera et al. 1999, de la Haba et
al. 2001). NR activity decreases under low irradiance in
coffee plants (Carelli et al. 2006). According to Cabello
et al. (2006), ageing induces oxidative stress in sunflower
leaves, having an adverse impact on chloroplastic GS2
and photosynthetic pigments. Ever since GOGAT was
discovered, the GS/GOGAT pathway has proved to be
the most important process for ammonia assimilation into
amino acids (Miflin and Lea 1980). Because of its low
affinity for ammonia, GDH is assumed to act as a
catabolic enzyme in the deamination of glutamate
(Pahlich 1996, Lehmann and Ratajczak 2008). MasclauxDaubresse et al. (2002) ascribed age-related induction of
GDH in a range of plant tissues to either an increase in
ammonia content or depletion of carbohydrates, both of
which are usually observed during senescence.
The purpose of this work was to study the effect of
two PFDs [125 and 350 mol(photon) m–2 s–1], with
special emphasis on growth, sugar levels, regulation of
nitrogen metabolism, enzyme activities, and photoprotection mechanisms during development in primary
sunflower (H. annuus L.) leaves. Sunflower has a great
agronomical and economical value since it is one of the
five most important sources of edible oil in the world
(Cantamutto and Poverene 2007). Sunflower oil is also a
source of biodiesel (Arzamendi et al. 2008), sunflower
plants have an ornamental value and are used for
phytoremediation (Mani et al. 2007).
Materials and methods
Plant material and growth: Seeds of sunflower (H. annuus L.) from the isogenic cultivar HA-89 (Semillas
Cargill SA, Sevilla, Spain) were surface-sterilized in 1%
(v/v) hypochlorite solution for 15 min. After rinsing in
distilled water, the seeds were imbibed for 3 h and then
sown in plastic trays containing a mixture of perlite and
vermiculite (1:1, v/v). All seeds were germinated and
plants were incubated in a chamber under a 16/8 h
light/dark cycle and a day/night regime of 25/19ºC
temperature and 70/80% relative humidity. Plants were
irrigated daily with a nutrient solution containing 10 mM
KNO3 (Hewitt 1966).
Two different PFDs (provided by Sylvania F72T12/
CW/VHO, 160 W fluorescent lamps supplemented with
Mazda 60 W incandescent bulbs and measured using a
model CRS068 portable infrared gas analyser governed
via the software CIRAS), HI and LI, were applied over a
period of 50 d. At different times (16, 22, 32, 42, and
50 d), primary leaf samples were collected 2 h after the
photoperiod start. Entire leaves were excised and pooled
in two groups: one was used to measure leaf area and
specific leaf mass (SLM) referred to DM, and the other
was frozen immediately in liquid nitrogen and stored at –
80 C. The frozen plant material was ground in a mortar
precooled with liquid N2 and the powder distributed into
small vials that were stored at –80 C until enzyme
activity and metabolite determinations.
Net CO2 fixation and stomatal conductance were
measured on attached leaves, 2 h after the photoperiod
start, using a model CRS068 portable infrared gas analyser (MA, USA), governed via the software CIRAS. The
instrument was adjusted to have inside the leaf chamber
constant conditions of CO2 concentration (360 μl l–1),
flow (150 cm3 min–1), leaf temperature (25ºC), relative
humidity (80%) and the light intensities used in each
treatment (HI and LI). Measurements were made on
86
52 Capítulo III
SENESCENCE IN SUNFLOWER UNDER DIFFERENT IRRADIANCES
tion, H2O2 decomposition was monitored spectrophotometrically at 240 nm (ε = 43.6 mM–1 cm–1).
APX activity was measured according to Nakano and
Asada (1981). The reaction mixture contained 50 mM
phosphate buffer (pH 7), 1 mM sodium ascorbate and
25 mM H2O2. After adding of ascorbate to the mixture,
the reaction was monitored at 290 nm (ε = 2.8 mM–1 cm–1).
primary leaf samples after the stabilization period, using
several plants per treatment. Leaf samples were
acclimated in the leaf chamber for 5–10 min and
measurements were carried out during 3–5 min.
Extraction and activity measurement of NR, GS, and
GDH: Frozen material was homogenized with cold
extraction medium (4 ml g–1) consisting of 100 mM
Hepes-KOH (pH 7.5), 10% (v/v) glycerol, 1% (w/v)
polyvinylpolypyrrolidone (PVPP), 0.1% (v/v) Triton,
6 mM DTT, 1 mM EDTA, 0.5 mM phenylmethylsulphonyl fluoride (PMSF), 25 µM leupeptin, 20 µM flavin
adenine dinucleotide (FAD) and 5 µM Na2MoO4. The
homogenate was centrifuged at 8,000 × g at 4ºC for
2 min, and enzyme activity measured immediately in the
clear extract.
NR (EC 1.6.6.1) activity was determined in the
presence and absence of Mg2+. The activation state of NR
was calculated as the ratio of its activity in the presence
and absence of Mg2+, and expressed as a percentage, as
described by Agüera et al. (2006). GS (EC 6.3.1.2)
activity was measured with the transferase assay of de la
Haba et al. (1992). Finally, GDH (EC 1.4.1.2) aminating
and deaminating activities were determined spectrophotometrically at 340 nm according to Loyola-Vargas and
Sánchez de Jiménez (1984).
Carbohydrates were extracted from the powdered frozen
tissue in successive steps with ethanol/water mixtures in
different proportions according to Agüera et al. (2006).
The supernatants from each centrifugation were collected
and combined to determine soluble sugars, whereas the
pellets were used to quantify starch. Sucrose, glucose,
and fructose were determined according to Outlaw and
Tarczynski (1984), Kunst et al. (1984) and Beutler (1984),
respectively. The pellets were resuspended in water and
incubated at 100ºC for 5 h. Glucose was then released by
incubation with -amylase and amyloglucosidase, and
assayed enzymatically as described above.
Protein, pigment, and H2O2: Soluble protein was extracted in 50 mM Hepes-KOH (pH 7), 5 mM MgCl2 and
1 mM EDTA, and determined with the Bio-Rad protein
assay according to Bradford (1976). Pigments were
determined by HPLC in the plant extracts according to
Cabello et al. (1998). For H2O2 determination, 1 g of leaf
material was ground with 10 ml of cooled acetone in
a cold room, and filtered through Whatman filter paper.
H2O2 was determined by formation of a titaniumhydroperoxide complex according to Mukherjee and
Choudhuri (1983).
Enzyme antioxidant activity: Enzyme extracts for determination of catalase (CAT, EC 1.11.1.6) and APX (EC
1.11.1.11) were prepared by freezing a weighed amount
of leaf samples (g) in liquid nitrogen to prevent
proteolytic activity, followed by grinding in 10 ml
extraction buffer (0.1 M phosphate buffer, pH 7.5,
containing 0.5 mM EDTA and 1 mM ascorbic acid). The
resulting homogenate was passed through 4 layers of
gauze and the filtrate centrifuged at 15,000 × g for
20 min, the supernatant being used as enzyme source.
CAT activity was estimated according to Aebi (1983).
The reaction mixture contained 50 mM potassium
phosphate (pH 7) and 10 mM H2O2. After enzyme addi-
Statistical analysis: Values are given as the means SD
of three separate experiments with duplicate determinations. All results were statistically analyzed in a
bifactorial model, which considers the effect of the PFD
and the cultivation time on the variables using the
ANOVA and Tukey’s test and they were conducted at a
significance level of 5% (p<0.05).
Results
Some growth parameters such as SLM referred to DM,
leaf area and soluble protein were determined in primary
leaves of sunflower plants grown for 50 d under two PFD
regimes, LI and HI (Fig. 1). SLM referred to DM peaked
at 22 d in plants grown under both regimes and then
decreased by effect of ageing. HI plants exhibited higher
SLM referred to DM values than LI plants at the
beginning of the growth period (16 and 22 d, Fig. 1A).
With both treatments (HI and LI), leaf area increased
until day 32, but the values were 24% higher at the
beginning of the growth period (16 d) in HI plants
(Fig. 1B). In general, HI plants showed greater development than LI plants (data not shown). The soluble
protein content exhibited a similar variation pattern in
both HI and LI plants, decreasing about 50% during
sunflower primary leaf ageing, but the protein levels were
about 11% higher in HI plants than in LI plants at 22 and
32 d (Fig. 1C).
Leaf development had a negative effect on photosynthetic pigment content in both treatments. The chlorophylls (Chls) a and b contents were lower in HI plants
than in LI plants throughout leaf development, with up to
30% decrease in young leaves (Fig. 2A,B). On the
contrary, the carotenoid content in HI plants was
statistically significantly higher than in LI plants during
leaf development period (Fig. 2C).
87
53 Capítulo III
Fig. 1. Changes in specific leaf mass (SLM) referred to dry
mass (DM), leaf area and soluble protein during sunflower
primary leaf development under LI (■) and HI (□). Data are
means SD of 3 separate experiments with duplicate determinations. * – statistically significant differences among the
PFD treatments and the cultivation time according to the
ANOVA and Tukey’s test (p<0.05).
Fig. 2. Changes in the pigment contents during sunflower
means SD of 3 separate experiments with duplicate determinations. * – statistically significant differences among the
PFD treatments and the cultivation time according to the
ANOVA and Tukey’s test (p<0.05). DM – dry mass; Chl –
chlorophyll; Car – carotenoids.
The CO2 fixation rate was negatively affected by leaf
ageing in both treatments, but the loss of photosynthetic
activity was more marked and occurred earlier in HI
plants than in LI plants. Thus, under HI the CO2 fixation
rate decreased by about 90% between 22 and 50 d,
whereas in LI plants it decreased only about 64% in the
same period. Stomatal conductance decreased considerably after 22 d, but no statistically significantly differences were observed between both treatments (Table 1).
We also examined the changes in carbohydrate
contents in sunflower primary leaves during ageing in
order to identify a potential role as metabolic signals for
senescence (Fig. 3). With both treatments (HI and LI), the
concentrations of soluble sugars (glucose, fructose and
sucrose) increased with the leaf age up to 42 d. By
contrast, the starch content decreased very sharply in HI
plants during leaf development, but only slightly in LI
plants (Fig. 3). Glucose contents were higher in HI plants
than in LI plants, these differences were statistically
significant (p<0.05), mainly at the beginning of the leaf
senescence (32 d) (Fig. 3A). On the other hand, starch
contents were higher in HI plants than in LI plants,
throughout the whole leaf development period (Fig. 3D).
NR activity was determined in the presence and absence
of Mg2+ in sunflower primary leaves, and the NR
activation state was also estimated. As shown in Table 2,
NR activity decreased during leaf development, both in
the presence and absence of Mg2+. The decrease was
more evident under LI, while under HI it was noted only
from 22 day. The NR activation state diminished in
senescent leaves with both treatments. However, in the
HI plants the NR activation state was higher, and it also
decreased more sharply during leaf ageing, than in LI
plants (Table 2).
GS activity also declined during leaf ageing, and it
showed higher values in HI plants (Fig. 4). On the
contrary, GDH aminating and deaminating activities
(Table 3) peaked in senescent leaves (50 d) and higher
values were noted in LI compared with HI. However, the
GDH deaminating activity increased 5-fold during leaf
88
54 Capítulo III
Table 1. Net photosynthetic rate (PN) and stomatal conductance (gs) during sunflower primary leaf development under LI and HI.
Data are means SD of 3 separate experiments with duplicate determinations.!* – statistically significant differences among the PFD
treatments and the cultivation time according to the ANOVA and Tukey’s test (p<0.05).
Time [d]
PN [µmol(CO2) m–2 s–1]
LI
HI
16
22
32
42
50
2.63 ± 0.25
3.40 ± 0.37
3.37 ± 0.30
1.43 ± 0.12
1.23 ± 0.12
5.06 ± 0.76*
5.76 ± 0.80*
2.00 ± 0.02*
0.66 ± 0.06
0.60 ± 0.36
gs [mmol(H2O) m–2 s–1]
LI
HI
570.25 ± 24.24
620.67 ± 2.42
351.67 ± 2.21
30.67 ± 2.03
16.56 ± 0.54
550.46 ± 28.87
615.50 ± 5.10
355.30 ± 0.25
10.94 ± 0.20
6.67 ± 0.77
tically significant (p<0.05). CAT and APX activities rose
during early leaf development and decreased in senescent
leaves (42 and 50 d). This decline in the activity of the
antioxidant enzymes was more marked, about 40%, in HI
plants (Fig. 5B,C).
development in HI plants, but only 2-fold in LI plants.
We also studied H2O2 production and the activity of
CAT and APX in sunflower leaves. As shown in Fig. 5A,
the production of H2O2 increased considerably with leaf
ageing. After 22 d, the H2O2 levels in HI plants were
higher than in LI plants, these differences were statis-
Discussion
photosynthetic rate (PN) observed in young leaves (16
and 22 d) in HI plants (Table 1), could be explained by a
greater Rubisco content (Ariz et al. 2010) and also as a
consequence of more efficient penetration of incident
radiation into the leaves with lower Chls content
(Radochová and Tichá 2008). The Car content of primary
leaves in sunflower plants grown under both PFD used in
this work revealed that HI plants contained more Car than
LI plants (Fig. 2C). This suggests that plants can
synthesize large amounts of Car as an adaptative strategy
to protect their photosynthetic machinery when subjected
to high PFD (Behera and Choudhury 2001, 2003;
Lichtenthaler 2007).
The concentration of soluble sugars increased up to
42 d in both treatments, with a slight decrease in glucose
and sucrose contents in more senescent leaves (50 d). On
the other hand, the starch content decreased, especially in
HI plants (Fig. 3). Interestingly, our results show a
significant accumulation of glucose and starch in HI
plants in comparison with LI plants. Glucose contents
were statistically significant mainly at the beginning of
the leaf senescence (Fig. 3A). The accumulation of
glucose could not be directly related to photosynthetic
activity because pigment contents and CO2 fixation rates
decreased during leaf ageing (Figs. 2, 3; Table 1). It could
be rather due to starch hydrolysis, especially in HI plants
(Fig. 3D). The increase in soluble sugars, especially
glucose, might also be the result of senescence promoting
a decline in the functional and structural integrity of cell
membranes, thereby accelerating the membrane lipid
catabolism which produces sugars by gluconeogenesis
(Buchanan-Wollaston et al. 2003b, Lim et al. 2007).
Accumulation of soluble sugars at the beginning of
senescence has been described in various plants, but
changes are not clearly associated with leaf development
Our results showed that in primary leaves of sunflower
(H. annuus L.) plants some metabolic processes, like
carbon and nitrogen metabolism and susceptibility to
oxidative stress, were sensitive to irradiance. In fact, we
found HI to increase significantly leaf area, SLM referred
to DM, and soluble protein content at the beginning of
the leaf development (Fig. 1). This might be a result of
the increased photosynthetic capacity observed in HI
plants during early development of primary leaves. At
later stages, the photosynthetic rate decreased faster in HI
plants than in LI plants (Table 1). We have also found a
decrease in soluble protein content during leaf development (Fig. 1C) that could be caused by strong degradation of chloroplast proteins during senescence, as
reported by Martínez et al. (2008). On the other hand,
changes in the protein content can reflect alterations in
the distribution of N and C compounds as a consequence
of more efficient N mobilization during senescence (Díaz
et al. 2008).
Leaf development had a negative effect on photosynthetic pigment content of sunflower plants, in both
treatments. The content of Chls a and b was lower in HI
plants than in LI plants throughout leaf development,
with up to 30% decrease in young leaves (Fig. 2A,B).
Plants can avoid excessive light absorption by, e.g.,
reducing Chl production, adopting a steep inclination or
reflecting incident light (Adams et al. 2004, Baig et al.
2005, Demmig-Adams and Adams 2006). The loss of
Chls is typical of leaf senescence and may be used as an
indicator of this phenomenon (Yoo et al. 2003, Guo and
Gan 2005, Ougham et al. 2008). Astolfi et al. (2001) also
observed a decrease in Chls content and suggested that
high PFD induces premature senescence and increases the
senescence rate. The CO2 fixation rate in HI plants might
have no correlation with Chl content. The higher net
89
55 Capítulo III
and may vary depending on the plants lines (Díaz et al.
2005, Wingler et al. 2006, Agüera et al. 2010). In fact,
leaf senescence is a plastic process that can be triggered
by a variety of external and internal factors (BuchananWollaston et al. 2003a, Wingler et al. 2006, MasclauxDaubresse et al. 2007,Wingler et al. 2009). Ono et al.
(2001) have shown that shading leaves of sunflower or
bean reduces their sugar contents and delays senescence,
which suggests that the carbohydrate accumulation
induces leaf senescence. It has been suggested a role of
hexose accumulation in ageing leaves as a signal for
either senescence initiation or acceleration in annual
plants (Masclaux et al. 2000, Moore et al. 2003, Díaz et
al. 2005, Masclaux-Daubresse et al. 2005, Parrot et al.
2005, Pourtau et al. 2006, van Doorn 2008, Wingler and
Roitsch 2008, Agüera et al. 2010).
Nitrogen metabolism in old source leaves is characterized by progressive hydrolysis of stromal proteins and
degradation of chloroplasts (Masclaux et al. 2000,
Hörtensteiner and Feller 2002). We found that NR
activity in the presence or absence of Mg2+, as well as the
activation state of NR, decreased during leaf ageing for
both HI and LI plants. However, in HI plants, activation
state of NR increased during early leaf development, and
then decreased drastically during senescence (Table 2).
De la Haba et al. (2001) previously found that both
activity and activation state of NR in cucumber plants
raise with high light intensity and diminish with darkness,
and they ascribed this NR regulation effect to a potential
phosphorylation/dephosphorylation mechanism. Since the
main metabolic process in leaf senescence involves
nutrient remobilization, ammonium should! be rapidly
assimilated into amino acids via GS/GOGAT to avoid
deleterious effects and to supply nitrogenous forms
suitable for source–sink transport (Masclaux-Daubresse
et al. 2006). Our results revealed that GS activity
decreased during sunflower leaf ageing under both irradiance regimes, and that HI plants showed the highest GS
activities (Fig. 4). The effects of light on the expression
of genes coding for chloroplastic isoform GS2 have been
tested by Oliveira and Coruzzi (1999). They found that
chloroplastic isoform GS2 is induced by light or by
carbon metabolites such as sucrose. GS activity is known
Fig. 3. Changes in the contents of glucose, fructose, sucrose and
starch during sunflower primary leaf development under LI (■)
and HI (□). Data are means SD of 3 separate experiments with
duplicate determinations. * – statistically significant differences
among the PFD treatments and the cultivation time according to
the ANOVA and Tukey’s test (p<0.05). DM – dry mass.
Table 2. NR activity (assayed without and with Mg2+) and activation state of NR during sunflower primary leaf development under LI
and HI. Data are means SD of 3 separate experiments with duplicate determinations. * – statistically significant differences among
the PFD treatments and the cultivation time according to the ANOVA and Tukey’s test (p<0.05).
Time [d]
LI
NR activity [μmol(NO2–) h–1 g–1(DM)]
Assay - Mg2+
Assay + Mg2+
NR activation
state [%]
HI
NR activity [μmol(NO2–) h–1 g–1(DM)]
Assay - Mg2+
Assay + Mg2+
NR activation
state [%]
16
22
32
42
50
64.98 ± 0.21
54.94 ± 1.04
47.29 ± 0.36
14.17 ± 0.1
11.18 ± 0.57
38.0
32.9
27.5
32.8
18.5
52.57 ± 2.82*
58.59 ± 0.67
23.88 ± 0.15*
21.45 ± 0.15*
4.02 ± 0.36*
66.5
66.2
27.7
24.9
13.7
24.88 ± 0.21
18.05 ± 0.26
13.03 ± 0.36
4.65 ± 0.05
2.06 ± 0.11
34.95 ± 0.88*
38.76 ± 0.83*
6.60 ± 0.26*
5.53 ± 0.15*
0.55 ± 0.05*
90
56 Capítulo III
Table 3. Glutamate dehydrogenase (GDH) aminating and deaminating activities during sunflower primary leaf development under LI
and HI. Data are means SD of 3 separate experiments with duplicate determinations. * – statistically significant differences among
the PFD treatments and the cultivation time according to the ANOVA and Tukey’s test (p<0.05).
Time [d]
16
22
32
42
50
GDH activity [μmol h–1 g–1(DM)]
Aminating
LI
HI
85.0 ± 4.6
233.0 ± 15.5
250.0 ± 37.8
276.7 ± 14.3
327.7 ± 44.6
*
48.5 ± 3.4
80.1 ± 7.1*
135.9 ± 14.2*
240.2 ± 14.0
235.4 ± 15.2*
Deaminating
LI
HI
99.5 ± 3.4
128.6 ± 14.0
182.0 ± 10.3
196.6 ± 3.4
216.0 ± 10.3
38.8 ± 3.7*
67.9 ± 3.7*
89.8 ± 3.8*
169.9 ± 10.0*
194.1 ± 7.4
resulting degradation products to other plant parts
(Vanacker et al. 2006). Oxidative stress during
senescence may be caused or increased by the loss of
antioxidant enzyme activities (Zimmermann and Zentgraf
2005, Zimmermann et al. 2006, Procházková and
Wilhelmová 2007, Pompelli et al. 2010). Senescence is
also accompanied by an increased ROS production,
Fig. 4. Changes in the glutamine synthetase (GS) activity during
sunflower primary leaf development under LI (■) and HI (□).
Data are means SD of 3 separate experiments with duplicate
determinations.! * – statistically significant differences among
the PFD treatments and the cultivation time according to the
ANOVA and Tukey’s test (p<0.05). DM – dry mass.
to decrease during leaf senescence (Masclaux et al. 2000,
Cabello et al. 2006). The loss of GS activity during leaf
development must be mainly due to a progressive decline
in activity and expression of the GS2 isoform since the
cytosolic isoform GS1 increases during sunflower leaf
ageing (Cabello et al. 2006). The greatest increase in
GDH deaminating activity observed in HI plants during
leaf development (5-fold in HI compared with only 2-fold
in LI, Table 3) might be explained assuming that GDH
does not play a role in ammonium assimilation, but rather
it participates in glutamate catabolism (Miflin and
Habash 2002, Masclaux-Daubresse et al. 2006). GDH
activity is also induced in old leaves when nitrogen remobilization is maximal (Masclaux-Daubresse et al. 2006).
Plants grown under HI exhibited considerable oxidative stress in vivo at final stages of leaf development, as
revealed by a significant increase in H2O2 accumulation
and a more marked decrease in antioxidant enzyme
(catalase and APX) activities, in comparison with LI
plants (Fig. 5). Leaf senescence is an oxidative process
that involves degradation of cellular and subcellular
structures and macromolecules, and mobilization of the
Fig. 5. H2O2 accumulation and enzymatic activities of catalase
(CAT) and ascorbate peroxidase (APX) during sunflower
means
SD of 3 separate experiments with duplicate
determinations. * – statistically significant differences among
the PFD treatments and the cultivation time according to the
ANOVA and Tukey’s test (p<0.05).
91
57 Capítulo III
and one of the reasons for this phenomenon is the
imbalance between generation and consumption of
electrons in the photosynthetic electron transport chain
caused by preferential inhibition of stromal reactions
relative to photosystem II photochemistry (Špundová et
al. 2003). Inhibition of stromal reactions increases the
electron flow to molecular oxygen, thereby causing ROS
to accumulate and chloroplast components to be damaged
as a result (Špundová et al. 2005, Couée et al. 2006).
Susceptibility to oxidative stress depends on the overall
balance between production of oxidants and the antioxidant capability of cells. High PFD regime was
previously found to cause reversible photoinhibition of
photosynthesis in pea chloroplasts and to increase ROS
potentially regulating the accumulation of mRNA
encoding antioxidant enzymes (Hernández et al. 2006.).
Changes in an activity and expression of antioxidant
enzymes in response to high PFD stress have been
reported (Yoshimura et al. 2000, Hernández et al. 2004).
High PFD causes early symptoms of senescence during
leaf expansion in tobacco plants (Radochová and Tichá
2008). Our results suggest that HI accelerated senescence
in the primary leaf of sunflower plants, probably in order
to preserve the functionality of young leaves, and also
that one of the reasons for accelerated senescence in HI
plants might be the strong cellular oxidation and oxidative damage caused by an increased H2O2 accumulation,
which might be partially due to an earlier decline of
antioxidant enzyme activities in these plants.
In conclusion, our results showed that high PFD
caused early senescence in sunflower (H. annuus L.)
primary leaves by altering the CO2 fixation rate and the
Chl and sugar levels, the activity of key enzymes of
nitrogen metabolism (NR, GS, and GDH), and the
oxidation status of the plant (accumulation of H2O2 and
loss of APX and CAT activities). Systemic signals
triggered by a high PFD probably caused early senescence and diminished oxidative protection in primary
leaves of sunflower plants as a result.
References
Adams, W.W., III, Zarter, C.R., Ebbert, V., Demmig-Adams,
B.: Photoprotective strategies of overwintering evergreens. –
BioScience 54: 41-49, 2004.
Aebi, H.E.: Catalase. – In: Bergmeyer, H.U., Grassl, M. (ed.):
Methods of Enzymatic Analysis. Pp. 273-286. Verlag
Chemie, Weinheim 1983.
Agüera, E., Poblete, L., de la Haba, P., Maldonado, J. M.: Light
modulation and in vitro effects of adenine nucleotides on leaf
nitrate reductase activity in cucumber (Cucumis sativus). –
Physiol. Plant. 105: 218-223, 1999.
Agüera, E., Ruano, D., Cabello, P., de la Haba, P.: Impact of
atmospheric CO2 on growth, photosynthesis and nitrogen
metabolism in cucumber (Cucumis sativus L.) plants. – J.
Plant Physiol. 163: 809-817, 2006.
Agüera, E., Cabello, P., de la Haba, P.: Induction of leaf
senescence by low nitrogen nutrition in sunflower (Helianthus
annuus) plants. – Physiol. Plant. 138: 256-267, 2010.
Ariz, I., Esteban, R., García-Plazaola, J.I., Becerril, J.M. et al.:
High irradiance induces photoprotective mechanisms and a
positive effect on NH4+ stress in Pisum sativum L. – J. Plant
Physiol. 167: 1038-1045, 2010.
Arzamendi, G., Campo, I., Arguiñarena, E., Sánchez, M.,
Montes, M., Gandía, L.M.: Synthesis of biodiesel from
sunflower oil with silica-supported NaOH catalysts. – J.
Chem. Technol. Biotechnol. 83: 862-870, 2008.
Asada, K.: The water-water cycle in chloroplasts: scavenging of
active oxygens and dissipation of excess photons. – Annu.
Rev. Plant Physiol. Plant Mol. Biol. 50: 601-639, 1999.
Astolfi, S., De Biasi, M.G., Passera, C.: Effects of irradiancesulphur interactions on enzymes of carbon, nitrogen and
sulphur metabolism in maize plants. – Photosynthetica 39:
177-181, 2001.
Baig, M.J., Anand, A., Mandal, P.K., Bhatt, R.K.: Irradiance
influences contents of photosynthetic pigments and proteins in
tropical grasses and legumes. – Photosynthetica 43: 47-53,
2005.
Behera, R.K., Choudhury, N.K.: Photosynthetic characteristics
of chloroplasts of primary wheat leaves grown under different
irradiance. – Photosynthetica 39: 11-15, 2001.
Behera, R.K., Choudhury, N.K.: High irradiance-induced
changes in carotenoid composition and increase in nonphotochemical quenching of Chl a fluorescence in primary
wheat leaves. – J. Plant Physiol. 160: 1141-1146, 2003.
Beutler, H.O.: D-Fructose. – In: Bergmeyer, H.U. (ed.):
Methods of Enzymatic Analysis. Pp. 321-327. Verlag
Chemie, Weinheim 1984.
Bradford, M.M.: A rapid and sensitive method for quantitation
of microgram quantities of protein utilizing the principle of
protein-dye-binding. – Anal. Biochem. 72: 248-254, 1976.
Buchanan-Wollaston, V., Earl, E., Harrison, E., Mathas, E.,
Navabpour, S., Page. T, Pink, D.: The molecular analysis of
leaf senescence – a genomics approach. – Plant Biotechnol. J.
1: 3-22, 2003a.
Buchanan-Wollaston, V., Wellesbourne, H.R.I., Warwick, U.K.:
Senescence, leaves. – In: Encyclopedia of Applied Plant
Sciences, Elsevier Academic Press. Pp. 808-816, 2003b.
Cabello, P., de la Haba, P., González-Fontes, A., Maldonado,
J.M.: Induction of nitrate reductase, nitrite reductase, and
glutamine synthetase isoforms in sunflower cotyledons as
affected by nitrate, light, and plastid integrity. – Protoplasma
201: 1-7, 1998.
Cabello, P., Agüera, E., de la Haba, P.: Metabolic changes
during natural ageing in sunflower (Helianthus annuus)
leaves: expression and activity of glutamine synthetase
isoforms are regulated differently during senescence. –
Physiol. Plant. 128: 175-185, 2006.
Cantamutto, M., Poverene, M.: Genetically modified sunflower
release: opportunities and risks. Field Crop. Res. 101: 133144, 2007.
Carelli, M.L.C., Fahl, J.I., Cochicho J.D.: Aspects of nitrogen
metabolism in coffee plants. – Braz. J. Plant Physiol. 18: 9-21,
2006.
Couée, I., Sulmon, C., Gouesbet, G., El Amrani, A.: Involvement of soluble sugars in reactive oxygen species balance and
92
58 Capítulo III
responses to oxidative stress in plants. – J. Exp. Bot. 3: 449459, 2006.
Dat, J., Vandenabeele, S., Vranová, E., Van Montagu, M., Inzè,
D., Van Breusegem, F.: Dual action of the active oxygen
species during plant stress responses. – Cell. Mol. Life Sci.
57: 779-795, 2000.
de la Haba, P., Cabello, P., Maldonado, J.M.: Glutaminesynthetase isoforms appearing in sunflower cotyledons during
germination. Effects of light and nitrate. – Planta 186: 577581, 1992.
de la Haba, P., Agüera, E., Benítez, L., Maldonado, J.M.:
Modulation of nitrate reductase activity in cucumber
(Cucumis sativus) roots. – Plant Sci. 161: 231-237, 2001.
Demmig-Adams, B., Adams, W.W., III: Photoprotection in an
ecological context: the remarkable complexity of thermal
energy dissipation. – New Phytol. 172: 11-21, 2006.
Díaz, C., Purdy, S., Christ, A., Morot-Gaudry, J.F., Wingler, A.,
Masclaux-Daubresse, C.: Characterization of markers to
determine the extent and variability of leaf senescence in
Arabidopsis. A metabolic profiling approach. – Plant Physiol.
138: 898-908, 2005.
Díaz, C., Lemaître, T., Christ, A., et al.: Nitrogen recycling and
remobilization are differentially controlled by leaf senescence
and development stage in Arabidopsis under low nitrogen
nutrition. – Plant Physiol. 147: 1437-1449, 2008.
Gan, S., Amasino, R.M.: Making sense of senescence.
Molecular genetic regulation and manipulation of leaf
senescence. – Plant Physiol. 113: 313-319, 1997.
Guo, Y., Gan, S.: Leaf senescence: signals, execution, and
regulation. – Curr. Top. Develop. Biol. 71: 83-112, 2005.
Hernández, J.A., Escobar, C., Creissen, G., Mullineaux, P.M.:
Role of hydrogen peroxide and the redox state of ascorbate in
the induction of antioxidant enzymes in pea leaves under
excess light stress. – Funct. Plant Biol. 31: 359-368, 2004.
Hernández, J.A., Escobar, C., Creissen, G., Mullineaux, P.M.:
Antioxidant enzyme in pea plants under high irradiance. –
Biol. Plant. 50: 395-399, 2006.
Hewitt, E.J.: Sand and water culture methods used in the study
of plant nutrition. – Commonwealth Bureau of Horticultural
and Plantation Crops, East Malling. Tech. Commun. No 22,
1966.
Hörtensteiner, S., Feller, U.: Nitrogen metabolism and remobilization during senescence. – J. Exp. Bot. 53: 927-937, 2002.
Kunst, A., Draeger, B., Ziegenhorn, J.: D-Glucose: UV-methods
with hexokinase and glucose-6-phosphate dehydrogenase. –
In: Bergmeyer, H.U. (ed.): Methods of Enzymatic Analysis.
Pp. 163-172. Verlag Chemie, Weinheim 1984.
Lehmann, T., Ratajczak, L.: The pivotal role of glutamate
dehydrogenase (GDH) in the mobilization of N and C from
storage material to asparagine in germinating seeds of yellow
lupine. – J. Plant Physiol. 165: 149-158, 2008.
Lichtenthaler, H.K.: Biosynthesis, accumulation and emission
of carotenoids, -tocopherol, plastoquinone, and isoprene in
leaves under high photosynthetic irradiance. – Photosynth.
Res. 92: 163-179, 2007.
Lim, P.O., Woo, H.R., Nam, H.G: Molecular genetics of leaf
senescence in Arabidopsis. – Trends Plant Sci. 8: 272-278,
2003.
Lim, P.O., Kim, H.J., Nam, H.G.: Leaf senescence. – Annu.
Rev. Plant Biol. 58: 115-136, 2007.
Logan, B.A. Kornyeyev, D., Hardison, J., Holaday, A.S.: The
role of antioxidant enzymes in photoprotection. – Photosynth.
Res. 88: 119-132, 2006.
Loyola-Vargas, V.M., Sánchez de Jiménez, E.: Differential role
of glutamate dehydrogenase in nitrogen metabolism of maize
tissues. – Plant Physiol. 76: 536-540, 1984.
Mani, D., Sharma, B., Kumar, C.: Phytoaccumulation, interaction, toxicity and remediation of cadmium from Helianthus
annuus L. (sunflower). - Bull. Environ. Contam. Toxicol. 79:
71-79, 2007.
Martínez, D.E., Costa, M.L., Guiamet, J.J.: Senescenceassociated degradation of chloroplast proteins inside and
outside the organelle. – Plant Biol. 10: 15-22, 2008.
Masclaux, C., Valadier, M.H., Brugière, N., Morot-Gaudry,
J.F., Hirel, B.: Characterization of the sink/source transition in
tobacco (Nicotiana tabacum L.) shoots in relation to nitrogen
management and leaf senescence. – Planta 211: 510-518,
2000.
Masclaux-Daubresse, C., Valadier, M.H., Carrayol, E.,
Reisdorf-Cren, M., Hirel, B.: Diurnal changes in the expression of glutamate dehydrogenase and nitrate reductase are
involved in the C/N balance of tobacco source leaves. – Plant
Cell Environ. 25: 1451-1462, 2002.
Masclaux-Daubresse, C., Carrayol, E., Valadier, M.H.: The two
nitrogen mobilisation- and senescence-associated GS1 and
GDH genes are controlled by C and N metabolites. – Planta
221: 580-588, 2005.
Masclaux-Daubresse, C., Reisdorf-Cren, M., Pageau, K. et al.:
Glutamine synthetase-glutamate synthase pathway and
glutamate dehydrogenase play distinct roles in the sink-source
nitrogen cycle in tobacco. – Plant Physiol. 140: 444-456,
2006.
Masclaux-Daubresse, C., Purdy, S., Lemaître, T., Pourtau, N.,
Taconnat, L., Renou, J. P., Wingler, A.: Genetic variation
suggests interaction between cold acclimation and metabolic
regulation of leaf senescence. – Plant. Physiol. 143: 434-446,
2007.
Melis, A.: Photosystem-II damage and repair cycle in
chloroplasts: what modulates the rate of photodamage in vivo?
– Trends Plant Sci. 4: 130-135, 1999.
Miflin, B.J., Lea, P.J.: Ammonium assimilation. – In: Miflin,
B.J. (ed.): The Biochemistry of Plants Amino Acids and
Derivatives. Pp. 169-202. Academic Press. New YorkLondon – Toronto – Sydney – San Francisco 1980.
Miflin, B.J., Habash, D.: The role of glutamine synthetase and
glutamate dehydrogenase in nitrogen assimilation and
possibilities for improvement in the nitrogen utilization of
crops. – J. Exp. Bot. 53: 979-987, 2002.
Moore, B., Zhou, L., Rolland, F., et al.: Role of the Arabidopsis
glucose sensor HXK1 in nutrient, light and hormonal
signaling. – Science 300: 332-336, 2003.
Mukherjee, S.P., Choudhuri, M.A.: Implications of water stressinduced changes in the levels of endogenous ascorbic acid and
hydrogen peroxide in Vigna seedlings. – Physiol. Plant. 58:
166-170, 1983.
Nakano, Y., Asada, K.: Hydrogen peroxide is scavenged by
ascorbate-specific peroxidase in spinach chloroplasts. – Plant
Cell Physiol. 22: 867-880, 1981.
Oliveira, I.C., Coruzzi, G.M.: Carbon and amino acids reciprocally modulate the expression of glutamine syntethase in
Arabidopsis. – Plant Physiol. 121: 301-310, 1999.
Ono, K., Nishi, Y., Watanabe, A., Terashima, I.: Possible
mechanisms of adaptive leaf senescence. – Plant Biol. 3: 234243, 2001.
Ougham, H., Hörtensteiner, S., Armstead, I., Donnison, I.,
King, I., Thomas, H., Mur, L.: The control of chlorophyll
93
59 Capítulo III
catabolism and the status of yellowing as a biomarker of leaf
senescence. – Plant Biol. 10: 4-14, 2008.
Outlaw, W.H., Jr., Tarczynski, M.C.: Sucrose. – In: Bergmeyer,
H.U. (ed.): Methods of Enzymatic Analysis. Pp. 96-103.
Verlag Chemie, Weinheim 1984.
Pageau, K., Reisdorf-Cren, M., Morot-Gaudry, J.F., MasclauxDaubresse, C.: The two senescence-related markers, GS1
(cytosolic glutamine synthetase) and GDH (glutamate dehydrogenase), involved in nitrogen mobilization, are differentially
regulated during pathogen attack and by stress hormones and
reactive oxygen species in Nicotiana tabacum L. leaves. – J.
Exp. Bot. 57: 547-557, 2006.
Pahlich, E.: Remarks concerning the dispute related to the
function of plant glutamate dehydrogenase: commentary. –
Can. J. Bot. 74: 512-515, 1996.
Parrott, D., Yang, L., Shama, L., Fischer, A.M.: Senecence is
accelerated, and several proteases are induced by carbon
“feast” conditions in barley (Hordeum vulgare L.) leaves. –
Planta 222: 989-1000, 2005.
Pompelli, M.F., Martins, S.C.V., Antunes, W.C., Chaves,
A.R.M., DaMatta, F.M.: Photosynthesis and photoprotection
in coffee leaves is affected by nitrogen and light availabilities
in winter conditions. – J. Plant Physiol. 167: 1052-1060,
2010.
Pourtau, N., Jennings, R., Pelzer E. et al..: Effect of sugarinduced senescence on gene expression and implications for
the regulation of senescence in Arabidopsis. – Planta 224:
556-568, 2006.
Prášil, O., Adir, N., Ohad, I.: Dynamic of PSII: Mechanism of
photoinhibition and recovery process. – In: Baber, J. (ed.):
The Photosystems: Structures, Function and Molecular
Biology. Pp 295-348. Elsevier, Amsterdam – London – New
York – Tokyo 1992.
Procházková, D., Wilhelmová, N.: Leaf senescence and activities of the antioxidant enzymes. – Biol. Plant. 51: 401-406,
2007.
Quirino, B.F., Noh, Y.S., Himelblau, E., Amasino, R.M.:
Molecular aspects of leaf senescence. – Trends Plant Sci. 5:
278-282, 2000.
Radochová, B., Tichá, I.: Excess irradiance causes early symptoms of senescence during leaf expansion in photoautotrophically in vitro grown tobacco plants. – Photosynthetica
46: 471-475, 2008.
Schansker, G., van Rensen, J.J.S.: Performance of active
Photosystem II centers in photoinhibited pea leaves. –
Photosynth. Res. 62:175-184, 1999.
Špundová, M., Popelková, H., Ilík, P., et al.: Ultra-structural
and functional changes in the chloroplasts of detached barley
leaves senescing under dark and light conditions. – J. Plant
Physiol. 160: 1051-1058, 2003.
Špundová, M., Slouková, K., Hunková, M., Nauš, J.: Plant
shading increases lipid peroxidation and intensifies
senescence-induced changes in photosynthesis and activities
of ascorbate peroxidase and glutathione reductase in wheat. –
Photosynthetica 43: 403-409, 2005.
Srivalli, B., Khanna-Chopra, R.: The developing reproductive
‘sink’ induces oxidative stress to mediate nitrogen mobilization during monocarpic senescence in wheat. – Biochem.
Biophys. Res. Commun. 325: 198-202, 2004.
Srivalli, B., Khanna-Chopra, R.: Delayed wheat flag leaf
senescence due to removal of spikelets is associated with
increased activities of leaf antioxidant enzymes, reduced
glutathione/oxidized glutathione ratio and oxidative damage
to mitochondrial proteins. – Plant Physiol. Biochem. 47: 663670, 2009.
Vanacker, H., Sandalio, L.M., Jiménez, A., et al.: Roles for
redox regulation in leaf senescence of pea plants grown on
different sources of nitrogen nutrition. – J. Exp. Bot. 57:
1735-1745, 2006.
van Doorn, W.G.: Is the onset of senescence in leaf cells of
intact plants due to low or high sugar level? – J. Exp. Bot. 59:
1963-1972, 2008.
Wingler, A., Masclaux-Daubresse, C., Fischer, A.M.: Sugars,
senescence and ageing in plants and heterotrophic organisms.
– J. Exp. Bot. 60: 1063-1066, 2009.
Wingler, A., Purdy, S., MacLean, J.A., Pourtau, N.: The role of
sugars in integrating environmental signals during the regulation of leaf senescence. – J. Exp. Bot. 57: 391-399, 2006.
Wingler, A., Roitsch, T.: Metabolic regulation of leaf senescence: interactions of sugar signalling with biotic and abiotic
stress responses. – Plant Biol. 10: 50-62, 2008.
Yoo, S.D., Greer, D.H., Laing, W.A., McManus, M.T.: Changes
in photosynthetic efficiency and carotenoid composition in
leaves of white clover at different developmental stages. –
Plant Physiol. Biochem. 41: 887-893, 2003.
Yoshimura, K., Yabuta, Y., Ishikawa, T., Shigeoka, S.: Expression of spinach ascorbate peroxidase isoenzymes in response
to oxidative stresses. – Plant Physiol. 123: 223-234, 2000.
Zimmermann, P., Zentgraf, U.: The correlation between oxidative stress and leaf senescence during plant development. –
Cell. Mol. Biol. Lett. 10: 515-534, 2005.
Zimmermann, P., Heinlein, C., Orendi, G., Zentgraf, U.: Senescence-specific regulation of catalases in Arabidopsis thaliana
(L.) Heynh. – Plant Cell Environ. 29: 1049-1060, 2006.
94
60 7. CAPÍTULO IV
High temperature promotes early senescence in primary leaves of
Capítulo IV
63 Capítulo IV
64 Capítulo IV
65 Capítulo IV
66 Capítulo IV
67 Capítulo IV
68 Capítulo IV
69 Capítulo IV
70 Capítulo IV
71 Capítulo IV
72 Capítulo IV
73 8. DISCUSIÓN
Discusión
En el presente trabajo se han estudiado los cambios fisiológicos y metabólicos que
ocurren en las plantas de girasol durante su desarrollo, bajo diferentes factores ambientales:
elevada concentración de CO2 atmosférico, elevada intensidad lumínica y elevada
temperatura. Para ello, se determinaron los cambios en el contenido en pigmentos
fotosintéticos, asimilación fotosintética de CO2, contenido en carbohidratos, actividades y
niveles de expresión de enzimas del metabolismo del nitrógeno y el estado oxidativo del
tejido vegetal. En general, se ha observado que durante el proceso de desarrollo de la hoja
primaria de girasol se produce un adelanto del proceso de senescencia cuando las plantas se
sometieron, de forma independiente, a elevadas concentraciones de CO2 atmosférico, elevada
irradiancia y elevada temperatura. Los factores ambientales estudiados pueden verse
afectados por el cambio climático en curso y de ahí la importancia del estudio de sus efectos
sobre el desarrollo de la planta.
Este estudio se ha realizado en plantas de girasol debido a la gran importancia del
cultivo, ya que su uso es fundamental en la alimentación humana (semilla o aceite), de
animales (forraje), y también por su valor agronómico y ambiental (Putt 1997; Cantamutto y
Poverene 2007; Mani et al. 2007; Arzamendi et al. 2008).
En el capítulo I, se observó que algunos procesos fisiológicos y metabólicos son
sensibles a la elevada concentración de CO2 (800 µL L-1) durante el desarrollo de la hoja
primaria de girasol. En general, las plantas cultivadas con elevada concentración de CO2
atmosférico presentaron un mayor crecimiento como se refleja en la elevada SLM encontrada
en hojas jóvenes (16 días). Hovenden y Schimanski (2000) también comprobaron en hojas de
Nothofagus cunningahamii, que la SLM incrementaba en respuesta al elevado CO2
atmosférico. El crecimiento de la hoja depende de dos procesos fisiológicos: expansión y
división celular, ambos están controlados de forma coordinada, durante la organogénesis, por
diversos factores endógenos entre los que se encuentran las hormonas vegetales las cuales
responden a señales ambientales (Nishimura et al. 2004; Tsukaya 2006; Riikonen et al.
2010). El incremento de la expansión celular se debe a un aumento de la actividad de la
enzima XET y como consecuencia se produce un incremento de la extensibilidad de la pared
celular (Ferris et al. 2001). Además, se ha descrito en hojas de soja y Betula papyrifera que a
elevados niveles de CO2, se produce un incremento de la expresión de genes que intervienen
en el ciclo celular y en el proceso de fluidificación de la pared celular (Gupta et al. 2005;
Ainsworth et al. 2006; Druart et al. 2006; Kontunen-Soppela et al. 2010).
77 Discusión
Las plantas de girasol cultivadas a elevada concentración de CO2 atmosférico
mostraron menor contenido de clorofila (a y b) y de carotenoides durante la ontogenia de la
hoja primaria. El contenido en pigmentos fotosintéticos disminuyó con el desarrollo de la
-1
-1
hoja tanto a elevado CO2 (800 µL L ) como a CO2 ambiental (400 µL L ) siendo esta
respuesta más acentuada a elevada concentración de CO2. Estos resultados sugieren que el
elevado CO2 atmosférico acelera la degradación de clorofilas y posiblemente también la
senescencia de la hoja. Así mismo, los niveles de actividad de algunas enzimas antioxidantes
como la catalasa o la APX se redujeron durante el desarrollo de hojas primarias de plantas de
girasol cultivadas a elevado CO2 al igual que se observó en otras especies (Erice et al. 2007;
Gillespie et al. 2011). Por el contrario, los niveles de H2O2 incrementaron. Estos cambios,
posiblemente determinan un estrés oxidativo en la hoja lo que provoca la degradación de los
pigmentos fotosintéticos. (Geissler et al. 2009). Diferentes estudios han sugerido que la
producción, de forma no adecuada, de grupos oxidantes y carbonilos está relacionada con la
edad de la planta y también que la disminución de las actividades APX y SOD
mitocondriales, pudiendo contribuir a un aumento del proceso de carbonilación de proteínas
(Vanacker et al. 2006; Srivalli y Khanna-Chopra, 2009). En plantas de Arabidopsis y de soja
se observó que el elevado CO2 incrementó el contenido en grupos carbonilos, lo que causó la
perdida de clorofila en la hoja (Qiu et al. 2008). Nuestros resultados sugieren que la
exposición a elevada concentración de CO2 puede provocar un estrés oxidativo en la planta,
lo que podría aumentar la carbonilación de proteínas.
La elevada concentración de CO2 incrementó la velocidad de fijación fotosintética de
CO2, la conductancia estomática y la transpiración. La respuesta estomática de las plantas al
elevado CO2 varía ampliamente entre especies y algunas de ellas pueden no verse afectadas
por este factor (Drake et al. 1997). Esta falta de respuesta estomática al elevado CO2 puede
estar genéticamente determinada o bien ser el resultado de la adaptación a una atmósfera con
elevada humedad relativa (Curtis 1996; Morison 1998). La elevada concentración de CO2
puede incrementar los niveles de fijación fotosintética de CO2 en las plantas, principalmente
de dos formas: a) reduciendo el proceso de fotorrespiración; b) aumentando el sustrato de la
rubisco (Long et al. 2004, 2006; Ainsworth y Rogers 2007). En Populus tremuloide y Betula
papirifera la fotosíntesis neta incrementó entre el 49 y 73% en presencia de elevado CO2 y
esto causó un aumento de la razón hexosas/sacarosa (Riikonen et al. 2008). Nuestros
resultados muestran, al inicio de la senescencia de la hoja, un marcado incremento de la razón
hexosas/sacarosa, especialmente a elevado CO2, sugiriendo que el proceso de movilización
78 Discusión
de carbono asociado con la senescencia, ocurre de forma más temprana y más marcada en
plantas cultivadas a elevada concentración de CO2. La razón de este incremento en azúcares
solubles puede ser debido a que bajo elevado de CO2 se sintetiza mayor cantidad de almidón
en hojas maduras fotosintéticamente activas. También, este incremento en azúcares solubles
puede ser el resultado de que el proceso de senescencia promueve un descenso en la
integridad estructural y funcional de membranas celulares, acelerando de este modo el
catabolismo de lípidos de membrana produciéndose azúcares por gluconeogénesis
(Buchanan-Wollaston et al. 2003; Lim et al. 2007). Los azúcares regulan muchos procesos
metabólicos y del desarrollo y en muchos de ellos está involucrada la enzima hexoquinasa
como sensor de azúcares. La hexoquinasa puede ser responsable de la regulación del proceso
de senescencia dependiente de azúcares, de forma que su sobreexpresión inhibe el
crecimiento de la planta, disminuye la actividad fotosintética e induce rápidamente la
senescencia (Wingler et al. 2004). Cuando las plantas de pepino se expusieron a elevado CO2
se observó en las hojas un aumento en almidón y azúcares solubles y un descenso en el
contenido de nitrato (Larios et al. 2001; Agüera et al. 2006). Hay evidencias que sugieren
que la vía de señalización de los azúcares juega un papel importante en la regulación de la
senescencia, sin embargo, existen otras vías de señalización inducidas por diferentes tipos de
estrés tanto bióticos como abióticos (Wingler y Roitsch 2008; Schippers et al. 2015).
Por otro lado, se ha sugerido que los cambios en el metabolismo de la hoja causados
por el elevado CO2 están relacionados con sus niveles de nitrógeno (Kim et al. 2006; Leakey
et al. 2009; Sanz-Sáez et al. 2010). Nuestros resultados muestran que la razón C/N
incrementa con la edad en la hoja, especialmente a elevado CO2, resultados similares fueron
previamente observados en plantas de soja (Rogers et al. 2004; Ainsworth et al. 2006). El
crecimiento en atmósfera a elevado CO2, normalmente produce una acumulación de azúcares
solubles y almidón, reduciendo los niveles de nitrógeno (Ainsworth y Long 2005).
Generalmente las plantas creciendo a elevado CO2 están más limitadas en nitrógeno que en
carbono. El desequilibrio en la razón C/N puede acelerar el proceso de senescencia, con el fin
de incrementar la disponibilidad de nitrógeno por movilización de éste desde las hojas viejas
hasta los órganos en crecimiento (Wiedemuth et al. 2005; Wingler et al. 2006; Zhu et al.
2009).
En el capítulo II se estudió cómo la elevada concentración de CO2 atmosférico (800
−1
µL L ) afecta a la actividad y expresión de algunas enzimas que tienen un papel clave en el
metabolismo del nitrógeno (NR, GS y GDH) durante el desarrollo de la hoja. Plantas
79 Discusión
cultivadas a elevada concentración de CO2, mostraron durante su desarrollo, una menor
actividad NR y GS que aquellas cultivadas en CO2 ambiental. Stitt y Krapp (1999) indicaron
que diferentes especies vegetales cultivadas a elevado CO2 presentaron un mayor crecimiento
e incremento en la velocidad de asimilación de nitrógeno. Sin embargo, en plantas de trigo y
Arabidopsis se comprobó que el elevado CO2 atmosférico disminuyó la asimilación de
nitrógeno (Bloom et al. 2010), lo cual podría ser la causa del menor contenido en proteínas
observado en estas plantas (Kimball et al. 2001; Högy et al. 2009). El elevado CO2
atmosférico disminuye el proceso de fotorrespiración y la disponibilidad de NADH en el
citosol (Bloom et al. 2010). También se ha observado que el proceso de fotorrespiración,
estimula el transporte de malato desde el cloroplasto al citosol a través del translocador de
ácidos dicarboxílicos (Backhausen et al. 1998), aumentando así la disponibilidad de NADH
citosolico (Igamberdiev et al. 2001), y favoreciendo el proceso de reducción de nitrato
(Quesada et al. 2000). Por otro lado, se ha comprobado que seis transportadores de la familia
Nar1 están implicados en el transporte de nitrito desde el citosol al cloroplasto en
Chlamydomonas, algunos de ellos transportan tanto nitrito como bicarbonato (HCO3-)
(Mariscal et al. 2006). Un sistema análogo al descrito en Chlamydomonas opera también en
plantas superiores (Bloom et al. 2010) ya que se ha observado en cloroplastos aislados de
trigo y de guisante que la presencia de HCO3- inhibe el trasporte de nitrito al interior del
cloroplasto. La menor entrada de nitrito en el cloroplasto bajo condiciones de elevado CO2
podría ser la causa de la reducción de la actividad GS observada en plantas de girasol
creciendo a elevada concentración de CO2.
También se estudió la expresión relativa de las isoformas GS citosólica (GS1) y
cloroplástica (GS2) durante el desarrollo de hojas de girasol observándose que el elevado
CO2 atmosférico incrementó la expresión relativa de la isoforma GS1 y disminuyó los niveles
de transcritos de la isoforma GS2. Durante el proceso de senescencia, las células sufren
cambios metabólicos muy drásticos y una degeneración secuencial de las estructuras
celulares comenzando por la degradación de los cloroplastos. Estos orgánulos juegan un
doble papel durante el proceso de senescencia, ya que actúan como fuente de nitrógeno y
como reguladores de su propia degradación (Zapata et al. 2005, Girondé et al. 2015). El
incremento de CO2 atmosférico podría aumentar los procesos que conducen a la aceleración
de la senescencia en hojas de girasol, incluyendo la degradación de los cloroplastos donde se
localiza la GS2 (McNally y Hirel 1983). Diversos estudios han mostrado que la isoforma
GS1 está implicada en la movilización de nitrógeno durante el proceso de senescencia de la
80 Discusión
hoja (Swarbreck et al. 2011). En plantas C3 la mayor parte del amonio asimilado bajo
condiciones de CO2 ambiental procede del proceso de fotorrespiración, y es asimilado por la
isoforma GS2 (Sttit y Krapp 1999). La elevada concentración de CO2 disminuye la
fotorrespiración (Foyer et al. 2009), este hecho explicaría los menores niveles de transcritos
de GS2 encontrados en hojas de girasol creciendo a elevado CO2.
Por otro lado, la actividad GDH desaminante aumentó en hojas senescentes de girasol
en ambos tratamientos; sin embargo, los niveles de actividad fueron significativamente más
altos en las plantas tratadas con elevada concentración de CO2. Lea y Miflin (2003)
mostraron que la GDH actúa principalmente catalizando la reacción de desaminación y por
tanto produciendo amonio en la mitochondria. Por lo que es lógico el aumento de los niveles
de GDH desaminante con el incremento de CO2 en la atmósfera y con la edad de la hoja
observado en plantas de girasol. En Arabidopsis la edad de la planta induce la expresión del
gen gdh2 y la actividad GDH, sugiriendo que la GDH participa en la degradación y el
reciclaje de nitrógeno en esta planta (Díaz et al. 2008).
Los cambios observados en las enzimas del metabolismo del nitrógeno junto con el
incremento en la razón C/N, durante el desarrollo de hojas primarias de girasol, indican que
el elevado CO2 atmosférico determina una limitación gradual del nitrógeno en las hojas de
girasol, ya que la acumulación de carbohidratos en las hojas ocurre de forma más rápida que
el proceso de absorción de nitrógeno (Reich et al. 2006). La disponibilidad limitada de
nitrógeno conduce a una senescencia temprana e incrementa el estado oxidativo de las células
de hojas de girasol (Agüera et al. 2010).
En el capítulo III se estudió la influencia de diferentes intensidades de luz sobre el
desarrollo de hojas primarias de girasol, en plantas cultivadas durante 50 días bajo dos
tratamientos de irradiancia: elevada irradiancia (350 µmol de fotones m–2 s–1, HI) y baja
irradiancia (125 µmol de fotones m–2 s–1, LI). Nuestros resultados muestran que al inicio del
desarrollo de la hoja, la HI incrementó el área foliar, la SLM y el contenido en proteína
soluble. Esto podría ser el resultado del incremento de la capacidad fotosintética observado
durante las primeras etapas de desarrollo de la hoja primaria, en plantas cultivadas a HI. En
estadios más tardíos del desarrollo de la hoja, la velocidad de fotosíntesis disminuye de forma
más rápida en plantas a HI que en plantas a LI. También se observó un descenso en el
contenido de proteína soluble durante el desarrollo de la hoja que podría ser causado por la
degradación de las proteínas del cloroplasto como observaron Martínez et al. (2008). Por otro
lado, los cambios en el contenido de proteínas pueden reflejar alteraciones en la distribución
81 Discusión
de compuestos de carbono y nitrógeno como consecuencia de una mayor eficiencia en la
movilización de nitrógeno durante la senescencia (Díaz et al. 2008).
El desarrollo de la hoja tuvo un efecto negativo sobre el contenido en pigmentos
fotosintéticos de plantas de girasol en ambos tratamientos. El contenido en clorofila a y b fue
menor en plantas a HI que en plantas a LI a lo largo del desarrollo de la hoja. Las plantas
pueden evitar el exceso de absorción de luz reduciendo la síntesis de clorofilas, variando la
orientación de las hojas o reflejando la luz incidente (Adams et al. 2004; Baig et al. 2005;
Demmig-Adams y Adams 2006). La pérdida de clorofila es típica de hojas senescentes y
podría ser usada como marcador del proceso de senescencia (Ougham et al. 2008). Astolfi et
al. (2001) también observaron, a elevada irradiancia, un descenso en el contenido de clorofila
lo que induce senescencia prematura en las hojas. La mayor velocidad de fotosíntesis
observada en plantas jóvenes de girasol podría deberse a un incremento en el contenido en
rubisco (Ariz et al. 2010) y/o también a una mayor eficiencia en la penetración de la
radiación incidente (Radochová y Tichá 2008). El contenido en carotenoides de hojas
primarias de girasol fue más elevado en plantas HI, lo que sugiere que estas plantas sintetizan
mayor cantidad de carotenoides como una estrategia adaptativa para proteger su maquinaria
fotosintética frente a elevadas intensidades (Behera y Choudhury 2001, 2003; Lichtenthaler
2007).
La concentración de azúcares solubles incrementó durante el desarrollo de la hoja
primaria de girasol hasta los 42 días en ambos tratamientos, disminuyendo ligeramente el
contenido en glucosa y sacarosa en hojas más senescentes (50 días). Sin embargo, el
contenido en almidón disminuyó con el desarrollo de la hoja y especialmente en plantas a HI.
Nuestros resultados muestran acumulación significativa de glucosa al inicio de la
senescencia. Ono et al. (2001) han mostrado que hojas de girasol y judía, sometidas a baja
irradiancia reducen su contenido en azúcares y retrasan el proceso de senescencia, lo cual
sugiere que la acumulación de carbohidratos induce la senescencia de la hoja.
Se ha estudiado el metabolismo del nitrógeno a lo largo del desarrollo de las hojas
primarias de girasol. Se encontró que la actividad NR, tanto en presencia como en ausencia
de Mg2+, así como el estado de activación de la enzima NR, disminuyeron durante el
desarrollo de la hoja en ambos tratamientos. Sin embargo, en plantas a HI el estado de
activación de la enzima NR incrementó durante las primeras etapas de desarrollo de la hoja y
disminuyó drásticamente durante la senescencia. De la Haba et al. (2001), observaron en
plantas de pepino, un aumento de actividad y del estado de activación de la NR con la
82 Discusión
elevada irradiancia y un descenso en oscuridad, atribuyendo este efecto a un mecanismo de
regulación por fosforilación/ defosforilación de la NR en respuesta a luz/oscuridad.
Nuestros resultados muestran que la actividad GS disminuyó a lo largo del desarrollo
en ambos tratamientos, observándose mayores niveles de GS a HI. El efecto de la luz sobre la
expresión de los genes que codifican la isoforma GS2 ha sido estudiada por Oliveira y
Coruzzi (1999). Ellos observaron que la isoforma cloroplástica se induce por luz o por
metabolitos del carbono tales como la sacarosa; también se conoce que la actividad GS
disminuye durante la senescencia de la hoja (Masclaux et al. 2000; Cabello et al. 2006). La
pérdida de actividad GS a lo largo del desarrollo de la hoja es debida principalmente a una
disminución progresiva de la actividad y de la expresión de la isoforma GS2 ya que la
isoforma GS1 incrementa durante el desarrollo de la hoja (Cabello et al. 2006).
Las plantas de girasol cultivadas a HI presentaron mayor estrés oxidativo al final del
desarrollo de la hoja, como se reveló por el incremento en el contenido de H2O2, así como por
el descenso de actividad de enzimas antioxidantes (catalasa y APX). La elevada intensidad
luminosa causa una fotoinhibición reversible de la fotosíntesis en cloroplastos de guisante y
un incremento de ROS (Hernández et al. 2006). Nuestros resultados sugieren que a HI se
acelera el proceso de senescencia en hojas primarias de plantas de girasol, y este proceso se
lleva a cabo con el fin de asegurar la funcionalidad de las hojas jóvenes.
En el capítulo IV se estudió el efecto del incremento de la temperatura desde un
régimen de día/noche de 23/19 ºC (control) a 33/29 ºC (elevada temperatura), sobre diferentes
procesos bioquímicos y fisiológicos a lo largo del desarrollo de la hoja primaria de girasol. La
elevada temperatura es una causa importante de estrés medioambiental que limita la
producción agrícola en el mundo (Hasanuzzaman et al. 2013). Nuestros resultados muestran
que hojas primarias de girasol sometidas a elevada temperatura presentan un menor
crecimiento como se refleja en la menor área foliar, SLM y en el contenido de proteína
soluble con respecto al control. La elevada temperatura afecta al crecimiento de la planta ya
que es una de las situaciones de estrés que actúa estimulando la degradación de proteínas, lo
que conlleva a la senescencia y muerte de los tejidos vegetales (Ferguson et al. 1990;
Scheurwater et al. 2000; Martínez et al. 2008).
La fotosíntesis es uno de los procesos fisiológicos más sensible a la elevada
temperatura (Crafts-Brandner y Salvucci 2002). Nuestros resultados mostraron que la elevada
temperatura disminuyó la fotosíntesis neta en hojas primarias de girasol, el efecto adverso de
la elevada temperatura sobre la fotosíntesis puede ser debido al menor contenido en
83 Discusión
pigmentos fotosintéticos y al cierre parcial de los estomas observado en las hojas. Greer y
Weston (2010) obsevaron en hojas de Vitis vinifera, que la velocidad de fotosíntesis
disminuyó hasta un 60% al incrementar la temperatura de 25 a 45 ºC, esta reducción en la
fotosíntesis se atribuyó al cierre parcial de estomas. También se ha descrito que el
metabolismo del carbono (en el estroma del cloroplasto) y las reacciones fotoquímicas (en las
membranas tilacoidales) son los procesos afectados en primer lugar por la elevada
temperatura (Wang et al. 2009). La elevada temperatura causa la reducción del estado de
activación de la rubisco por inactivación de la rubisco activasa y disminución del proceso de
carbamilación de la rubisco (Crafts-Brandner y Law 2000; Han et al. 2009). Las plantas de
girasol cultivadas a elevada temperatura mostraron bajos niveles de clorofilas a y b, la
pérdida de clorofila es característica del proceso de senescencia, y puede ser utilizada como
marcador de este proceso (Ougham et al. 2008). En plantas de sorgo sometidas a elevada
temperatura se observó que la pérdida de clorofila ocurre también como resultado de la
peroxidación de lípidos de las membranas tilacoidales (Mohammed y Tarpley 2010). El
contenido en carotenoides en hojas primarias de girasol fue menor en plantas sometidas a
elevada temperatura. Este menor contenido en carotenoides podría afectar negativamente a la
planta ya que estos pigmentos tienen una función antioxidante importante impidiendo la
peroxidación lipídica en la planta (Havaux 1998; Havaux et al. 2007). También se ha puesto
de manifiesto que la elevada temperatura puede tener un efecto negativo sobre las membranas
de los tilacoides ya que disminuye la proporción de ácidos grasos saturados/insaturados en
los lípidos de membrana, incrementando su fluidez (Schrader et al. 2004).
El incremento en los niveles de azúcares (glucosa, fructosa y sacarosa) observados
durante el desarrollo de la hoja, especialmente a elevada temperatura, sugieren que la elevada
temperatura acelera el proceso de senescencia en hojas primarias de plantas de girasol.
También los contenidos en azúcares solubles en hojas de Lonicera japonica y de pepino
aumentaron cuando las plantas se sometieron a estrés por calor (Li et al. 2011; Zhang et al.
2012). Nuestros resultados indican que la acumulación de azúcares en las hojas de girasol
puede ser debido a la hidrólisis de almidón más que al proceso de fijación de CO2 ya que se
observó un descenso en la velocidad de fotosíntesis durante la senescencia y sobre todo, en
plantas sometidas a elevada temperatura. Hakata et al. (2012) observaron una inducción de la
expresión de la enzima α-amilasa en plantas de arroz sometidas a altas temperaturas. El
incremento en azúcares solubles (glucosa principalmente) durante el proceso de senescencia
84 Discusión
también puede deberse al catabolismo lipídico de las membranas celulares a través del cual se
forman azúcares por gluconeogénesis (Buchanan-Wollaston et al. 2003; Lim et al. 2007).
Durante el desarrollo de la hoja, el incremento de la temperatura produjo alteraciones
en algunas enzimas claves del metabolismo del nitrógeno (NR, GS y GDH). Las plantas
cultivadas a elevada temperatura mostraron niveles más bajos de actividad NR y GS que las
plantas control a lo largo del desarrollo de la hoja. La actividad NR y GS están directamente
relacionadas con la fotosíntesis, debido a que estas enzimas requieren poder reductor y ATP
respectivamente, y además la GS relaciona el metabolismo del carbono y del nitrógeno a
través de la incorporación de amonio a esqueletos carbonados (Lam et al. 1996). Debido a
que la asimilación del nitrógeno y del carbono están acopladas en el metabolismo de las
plantas, la disminución de la velocidad de fotosíntesis que ocurre a elevada temperatura
afecta negativamente al metabolismo del nitrógeno (Wollenweber et al. 2003; Xu et al.
2006). Las hojas senescentes de girasol mostraron una mayor actividad GDH desaminante en
plantas cultivadas a elevada temperaturas. La GDH tiene especial importancia en el
catabolismo de los aminoácidos, especialmente en la liberación de amonio para su posterior
incorporación en aminoácidos durante el proceso de senescencia (Masclaux-Daubresse et al.
2005). La elevada temperatura y la edad de la hoja induce la movilización de nitrógeno, que
es característica del proceso de senescencia (Díaz et al. 2008).
El estrés por elevadas temperaturas, al igual que ocurre con otros tipos de estrés
abióticos, puede producir un desequilibrio enzimático causante de la acumulación de ROS y
responsables del estrés oxidativo (Asada 2006). Las plantas de girasol cultivadas a elevada
temperatura mostraron estrés oxidativo, como se refleja en el incremento del contenido de
H2O2 y en el descenso de las enzimas antioxidantes catalasa y APX. En hojas de caña de
azúcar, tolerantes al calor, se observó un incremento en la expresión de las enzimas catalasa y
APX al aumentar la temperatura, siendo esto un mecanismo de protección frente a las ROS
que se producen en estas plantas a elevada temperatura (Procházková y Wilhelmová 2007;
Pompelli et al. 2010; Srivastava et al. 2012). Nuestros resultados sugieren que la elevada
temperatura acelera el proceso de senescencia en hojas primarias de plantas de girasol, debido
en parte a la oxidación celular causada por la acumulación de H2O2, y a la disminución de la
actividad de enzimas antioxidantes.
85 9. CONCLUSIONES
Conclusiones
9.1. Capítulo I
Growth under elevated atmospheric CO2 concentration accelerates leaf senescence in
sunflower (Helianthus annuus L.) plants.
1. Hojas jóvenes de plantas de girasol cultivadas a elevado CO2, mostraron una mayor
velocidad de crecimiento como se refleja por la elevada SLM referida a peso seco.
2. El contenido en pigmentos fotosintéticos disminuyó con el desarrollo de la hoja,
especialmente en plantas que crecieron en condiciones de alto CO2 lo que indica que
el elevado CO2 acelera la degradación de clorofila y también probablemente la
senescencia de la hoja.
3. El elevado CO2 provocó un incremento en la velocidad de fotosíntesis, contenido en
azúcares solubles y almidón y en la tasas C/N a lo largo del desarrollo de la hoja.
Probablemente un desequilibrio en la relación C/N sería uno de los factores que
contribuyen a acelerar la senescencia de la hoja de plantas de girasol.
4. El elevado CO2 incrementa el estado oxidativo de la célula en plantas de girasol ya
que se observó un incremento en el contenido de H2O2 y una disminución en la
actividad de enzimas antioxidantes, lo que podría conducir a una senescencia
temprana en hojas de plantas de girasol.
9.2. Capítulo II
Elevated CO2 concentrations alter nitrogen metabolism and accelerate senescence in
5. El elevado CO2 disminuyó significativamente la actividad de enzimas del
metabolismo del nitrógeno NR y GS y los niveles de transcritos de la isoforma GS2.
Por otro lado, incrementó la actividad GDH desaminante así como los niveles de
transcritos de la isoforma G1 durante la ontogenia de hojas primarias de plantas de
girasol.
6. El elevado CO2 condujo a una senescencia temprana en hojas primarias de girasol
debido a una disminución en la asimilación de nitrógeno como consecuencia de los
efectos sobre enzimas claves del metabolismo del nitrógeno a nivel transcripcional
(GS1 y GS2) y post-transcripcional (NR, GS y GDH).
89 Conclusiones
9.3. Capítulo III
Study of the senescence process in primary leaves of sunflower (Helianthus annuus L.) plants
under two different light intensities
7. El contenido en pigmentos fotosintéticos disminuyó con el desarrollo de la hoja,
especialmente en plantas que crecieron a elevada irradiancia, lo que indica que la
elevada irradiancia acelera la degradación de clorofila y también probablemente la
senescencia de la hoja.
8. A elevada irradiancia el contenido en carotenoides fue mayor durante el desarrollo de
la hoja como estrategia adaptativa de las plantas para la protección de la maquinaria
fotosintética.
9. La acumulación de glucosa observada a elevada irradiancia en hojas maduras de
girasol puede actuar como señal de inducción en el proceso de senescencia.
10. La elevada irradiancia incrementó significativamente el contenido de H2O2 en hojas
de plantas de girasol y produjo una menor protección oxidativa lo que es una de las
causas de la senescencia temprana de la hoja.
9.4. Capítulo IV
High temperature promotes an early senescence in primary leaves of sunflower (Helianthus
annuus L.) plants.
11. En hojas primarias de girasol la elevada temperatura induce el proceso de senescencia
ya que disminuye el crecimiento, altera el metabolismo del carbono y del nitrógeno y
disminuye el estado oxidativo de la planta.
90 10. BIBLIOGRAFÍA
Bibliografía
Adams WW III, Zarter CR, Ebbert V, Demmig-Adams B. (2004) Photoprotective strategies of
overwintering evergreens. Bioscience 54: 41-49.
Adams WW III, Zarter CR, Mueh KE, Demmig-Adams B. (2006) Energy dissipation and
photoinhibition: a continuum of photoprotection. In: Demming-Adams B, Adams WIII,
Mattoo AK, eds. Photoprotection, photoinhibition, gene regulation, and environment.
Advances in photoshynthesis and respitation. Drodrecht, Springer, pp. 49-64.
Agüera E, Ruano D, Cabello P, de la Haba P. (2006) Impact of atmospheric CO2 on growth,
photosynthesis and nitrogen metabolism in cucumber (Cucumis sativus L.) plants. J Plant
Physiol 163: 809-817.
Agüera E, Cabello P, De La Haba P. (2010) Induction of leaf senescence by low nitrogen
nutrition in sunflower (Helianthus annuus) plants. Physiol Plant 138: 256-267.
Ainsworth EA, Long SP. (2005) What have we learned from 15 years of free-‐‑air CO2 enrichment
(FACE)? A meta-‐‑analytic review of the responses of photosynthesis, canopy properties
and plant production to rising CO2. New Phytol 165: 351-372.
Ainsworth EA, Rogers A, Vodkin LO, Walter A, Schurr U. (2006) The effects of elevated CO2
concentration on soybean gene expression. An analysis of growing and mature leaves.
Plant Physiol 142: 135-147.
Ainsworth EA, Rogers A. (2007) The response of photosynthesis and stomatal conductance to
rising [CO2]: mechanisms and environmental interactions. Plant Cell Environ 30: 258270.
Alscher RG, Donahue JL, Cramer CL. (1997) Reactive oxygen species and antioxidants:
relationships in green cells. Physiol Plant 100: 224-233.
Apel K, Hirt H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal
transduction. Annu Rev Plant Biol 55: 373-399.
Ariz I, Esteban R, García-Plazaola JI, Becerril JM, Aparicio-Tejo PM, Moran JF. (2010) High
irradiance induces photoprotective mechanisms and a positive effect on NH4 stress in
Pisum sativum L. J Plant Physiol 167: 1038-1045.
Aro E, Virgin I, Andersson B. (1993) Photoinhibition of photosystem II. Inactivation, protein
damage and turnover. Biochim Biophys Acta 1143: 113-134.
93 Bibliografía
Arzamendi G, Campo I, Arguiñarena E, Sánchez M, Montes M, Gandía LM. (2008) Synthesis of
biodiesel from sunflower oil with silica-‐‑supported NaOH catalysts. J Chem Technol
Biotechnol 83: 862-870.
Asada K. (1999) The water-water cycle in chloroplasts: scavenging of active oxygens and
dissipation of excess photons. Annu Rev Plant Physiol Plant Biol 50: 601-639.
Asada K. (2006) Production and scavenging of reactive oxygen species in chloroplasts and their
functions. Plant Physiol 141: 391-396.
Astolfi S, De Biasi M, Passera C. (2001) Effects of irradiance-sulphur interactions on enzymes of
carbon, nitrogen, and sulphur metabolism in maize plants. Photosynthetica 39: 177-181.
Backhausen JE, Emmerlich A, Holtgrefe S, Horton P, Nast G, Rogers JJ, Müller-Röber B,
Scheibe R. (1998) Transgenic potato plants with altered expression levels of chloroplast
NADP-malate dehydrogenase: interactions between photosynthetic electron transport and
malate metabolism in leaves and in isolated intact chloroplasts. Planta 207: 105-114.
Baig M, Anand A, Mandal P, Bhatt R. (2005) Irradiance influences contents of photosynthetic
pigments and proteins in tropical grasses and legumes. Photosynthetica 43: 47-53.
Bazzaz FA, Fajer ED. (1992) Plant life in a CO2-rich world. Sci Am 266: 68-74.
Behera RK, Choudhury NK. (2001) Photosynthetic characteristics of chloroplasts of primary
wheat leaves grown under different irradiance. Photosynthetica 39: 11-15.
Behera RK, Choudhury NK. (2003) High irradiance-induced changes in carotenoid composition
and increase in non-photochemical quenching of Chl a fluorescence in primary wheat
leaves. J Plant Physiol 160: 1141-1146.
Bernard SM, Habash DZ. (2009) The importance of cytosolic glutamine synthetase in nitrogen
assimilation and recycling. New Phytol 182: 608-620.
Bloom AJ, Burger M, Rubio Asensio JS, Cousins AB. (2010) Carbon dioxide enrichment inhibits
nitrate assimilation in wheat and Arabidopsis. Science 328: 899-903.
Brugière N, Dubois F, Limami AM, Lelandais M, Roux Y, Sangwan RS, Hirel B. (1999)
Glutamine synthetase in the phloem plays a major role in controlling proline production.
Plant Cell 11: 1995-2012.
Brutnell TP, Langdale JA. (1998) Signals in leaf development. In: Callow JA, ed. Advances in
Botanical Research. Birmingham, Academic Press, pp. 162-196.
94 Bibliografía
Buchanan BB, Gruissem W, Jones RL. (2000) Biochemistry and Molecular Biology of plants.
Rockville, American Society of Plant Physiologists Vol. 40.
Buchanan-Wollaston V, Wellesbourne HRI. (2003) Senescence, leaves. In: Thomas B, Murphy
DJ, Murray BG, eds. Encyclopedia of applied plant sciences, Amsterdam, Elsevier
Academic Press, pp. 808-816.
Cabello P, Agüera E, De La Haba P. (2006) Metabolic changes during natural ageing in
sunflower (Helianthus annuus) leaves: expression and activity of glutamine synthetase
isoforms are regulated differently during senescence. Physiol Plant 128: 175-185.
Cantamutto M, Poverene M. (2007) Genetically modified sunflower release: opportunities and
risks. Field Crops Res 101: 133-144.
Christensen JH, Christensen OB. (2007) A summary of the PRUDENCE model projections of
changes in European climate by the end of this century. Clim Change 81: 7-30.
Crafts-Brandner S, Law R. (2000) Effect of heat stress on the inhibition and recovery of the
ribulose-1, 5-bisphosphate carboxylase/oxygenase activation state. Planta 212: 67-74.
Crafts-Brandner SJ, Salvucci ME. (2002) Sensitivity of photosynthesis in a C4 plant, maize, to
heat stress. Plant Physiol 129: 1773-1780.
Curtis P. (1996) A meta-analysis of leaf gas exchange and nitrogen in trees grown under elevated
carbon dioxide. Plant Cell Environ 19: 127-137.
Dat JF, Lopez-Delgado H, Foyer CH, Scott IM. (1998) Parallel changes in H2O2 and catalase
during thermotolerance induced by salicylic acid or heat acclimation in mustard
seedlings. Plant Physiol 116: 1351-1357.
Dat JF, Vandenabeele S, Vranová E, Van Montagu M, Inzé D, Van Breusegem F. (2000) Dual
action of the active oxygen species during plant stress responses. Cell Mol Life Sci 57:
779-795.
De la Haba P, Agüera E, Benı́tez L, Maldonado JM. (2001) Modulation of nitrate reductase
activity in cucumber (Cucumis sativus) roots. Plant Sci 161: 231-237.
Demirevska-Kepova K, Holzer R, Simova-Stoilova L, Feller U. (2005) Heat stress effects on
ribulose-1, 5-bisphosphate carboxylase/oxygenase, rubisco binding protein and rubisco
activase in wheat leaves. Biol Plant 49: 521-525.
95 Bibliografía
Demmig-‐‑Adams B, Adams WW. (2006) Photoprotection in an ecological context: the
remarkable complexity of thermal energy dissipation. New Phytol 172: 11-21.
Díaz C, Lemaitre T, Christ A, Azzopardi M, Kato Y, Sato F, Morot-Gaudry JF, Le Dily F,
Masclaux-Daubresse C. (2008) Nitrogen recycling and remobilization are differentially
controlled by leaf senescence and development stage in Arabidopsis under low nitrogen
nutrition. Plant Physiol 147: 1437-1449.
Drake BG, Gonzàlez-Meler MA, Long SP. (1997) More efficient plants: a consequence of rising
atmospheric CO2? Annu Rev Plant Physiol Plant Mol Biol 48: 609-639.
Druart N, Rodríguez-Buey M, Barron-Gafford G, Sjödin A, Bhalerao R, Hurry V. (2006)
Molecular targets of elevated [CO2] in leaves and stems of Populus deltoides:
implications for future tree growth and carbon sequestration. Func Plant Biol 33: 121131.
Erice G, Aranjuelo I, Irigoyen JJ, Sánchez-‐‑Díaz M. (2007) Effect of elevated CO2, temperature
and limited water supply on antioxidant status during regrowth of nodulated alfalfa.
Physiol Plant 130: 33-45.
Feller U, Crafts-Brandner SJ, Salvucci ME. (1998) Moderately high temperatures inhibit
ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) activase-mediated activation
of rubisco. Plant Physiol 116: 539-546.
Ferguson DL, Guikema JA, Paulsen GM. (1990) Ubiquitin pool modulation and protein
degradation in wheat roots during high temperature stress. Plant Physiol 92: 740-746.
Ferris R, Sabatti M, Miglietta F, Mills R, Taylor G. (2001) Leaf area is stimulated in Populus by
free air CO2 enrichment (POPFACE), through increased cell expansion and production.
Plant Cell Environ 24: 305-315.
Forde BG, Lea PJ. (2007) Glutamate in plants: metabolism, regulation, and signalling. J Exp Bot
58: 2339-2358.
Foyer CH, Harbinson J, Mullineaux P. (1994) Oxygen metabolism and the regulation of
photosynthetic electron transport. In: Foyer CH, Mullineaux PM, eds. Causes of
photooxidative stress and amelioration of defense systems in plants. Boca Raton, CRC
Press pp. 1-42.
96 Bibliografía
Foyer CH, Bloom AJ, Queval G, Noctor G. (2009) Photorespiratory metabolism: genes, mutants,
energetics, and redox signaling. Ann Rev Plant Biol 60: 455-484.
Gan S, Amasino RM. (1997) Making sense of senescence (Molecular Genetic regulation and
manipulation of leaf senescence). Plant Physiol 113: 313-319.
Geissler N, Hussin S, Koyro HW. (2009) Elevated atmospheric CO2 concentration ameliorates
effects of NaCl salinity on photosynthesis and leaf structure of Aster tripolium L. J Exp
Bot 60: 137-151.
Gepstein S. (1998) Photosynthesis. In: L Nooden, AC Leopold, ed. Senescence and aging in
plants. San Diego, Academic Press, pp 85-109.
Gillespie KM, Rogers A, Ainsworth EA. (2011) Growth at elevated ozone or elevated carbon
dioxide concentration alters antioxidant capacity and response to acute oxidative stress in
soybean (Glycine max). J Exp Bot 62: 2667-2678.
Girondé A, Etienne P, Trouverie J, Bouchereau A, Le Cahérec F, Leport L, Orsel M, Niogret M,
Nesi N, Carole D. (2015) The contrasting N management of two oilseed rape genotypes
reveals the mechanisms of proteolysis associated with leaf N remobilization and the
respective contributions of leaves and stems to N storage and remobilization during seed
filling. BMC Plant Biol 15: 59.
Greer DH, Weedon MM. (2012) Modelling photosynthetic responses to temperature of grapevine
(Vitis vinifera cv. Semillon) leaves on vines grown in a hot climate. Plant, Cell Environ
35: 1050-1064.
Greer DH, Weston C. (2010) Heat stress affects flowering, berry growth, sugar accumulation and
photosynthesis of Vitis vinifera cv. Semillon grapevines grown in a controlled
environment. Func Plant Biol 37: 206-214.
Gruissem W, Lee C, Oliver M, Pogson B. (2012) The global plant council: Increasing the impact
of plant research to meet global challenges. J Plant Biol 55: 343-345.
Gupta P, Duplessis S, White H, Karnosky D, Martin F, Podila G. (2005) Gene expression
patterns of trembling aspen trees following long-‐‑term exposure to interacting elevated
CO2 and tropospheric O3. New Phytol 167: 129-142.
97 Bibliografía
Hakata M, Kuroda M, Miyashita T, Yamaguchi T, Kojima M, Sakakibara H, Mitsui T,
Yamakawa H. (2012) Suppression of α -‐‑amylase genes improves quality of rice grain
ripened under high temperature. Plant Biotechnol J 10: 1110-1117.
Han F, Chen H, Li X, Yang M, Liu G, Shen S. (2009) A comparative proteomic analysis of rice
seedlings under various high-temperature stresses. Biochim Biophys Acta 4: 1625-1634.
Hasanuzzaman M, Nahar K, Alam MM, Roychowdhury R, Fujita M. (2013) Physiological,
biochemical, and molecular mechanisms of heat stress tolerance in plants. Int J Mol Sci
14: 9643-9684.
Havaux M. (1998) Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci 3: 147151.
Havaux M, Dall'osto L, Bassi R. (2007) Zeaxanthin has enhanced antioxidant capacity with
respect to all other xanthophylls in Arabidopsis leaves and functions independent of
binding to PSII antennae. Plant Physiol 145: 1506-1520.
Hernández JA, Escobar C, Creissen G, Mullineaux P. (2006) Antioxidant enzyme induction in
pea plants under high irradiance. Biol Plant 50: 395-399.
Högy P, Wieser H, Köhler P, Schwadorf K, Breuer J, Franzaring J, Muntifering R, Fangmeier A.
(2009) Effects of elevated CO2 on grain yield and quality of wheat: results from a 3-‐‑year
free-‐‑air CO2 enrichment experiment. Plant Biol 11: 60-69.
Hovenden MJ, Schimanski LJ. (2000) Genotypic differences in growth and stomatal morphology
of southern beech, Nothofagus cunninghamii, exposed to depleted CO2 concentrations.
Funct Plant Biol 27: 281-287.
Igamberdiev AU, Bykova NV, Lea PJ, Gardeström P. (2001) The role of photorespiration in
redox and energy balance of photosynthetic plant cells: a study with a barley mutant
deficient in glycine decarboxylase. Physiol Plant 111: 427-438.
IPCC (2007) Climate change 2007: The physical science basis. In: Solomon SD, Qin M,
Manning Z, Chen M, Marquis M, Averyt KB, Tignor MM, Miller HL, eds. Contribution
of working group I to the fourth assessment. Report of the intergovernmental panel on
climate change. Cambridge, Cambridge University Press.
IPCC (2014) Climate change 2014: Impacts, adaptations and vulnerability. In: Field CB, Barros
VR, Dokken DJ, Mach KJ et al. eds. Contribution of working group II to the fifth
98 Bibliografía
assessment. Report of the intergovernmental panel on climate change, Ginebra,
Cambridge University Press.
Irigoyen JJ, Emerich D, Sánchez-‐‑Diaz M. (1992) Alfalfa leaf senescence induced by drought
stress: photosynthesis, hydrogen peroxide metabolism, lipid peroxidation and ethylene
evolution. Physiol Plant 84: 67-72.
Jiang D, Lu Q, Weng X, Zheng B, Xi H. (1999) Regulation of rubisco carboxylation activity and
photosynthetic rate by rubisco activase during leaf senescence in rice. J Zhejiang Univ
(Agricult Life Sci) 26: 119-124.
Johnson SM, Doherty SJ, Croy RR. (2003) Biphasic superoxide generation in potato tubers. A
self-amplifying response to stress. Plant Physiol 131: 1440-1449.
Keeling CD. (1960) The concentration and isotopic abundances of carbon dioxide in the
atmosphere. Tellus 12: 200-203.
Kim J, Lee K, Shin K, Kang J, Lee H, Kim M, Jang P, Jang M. (2006) The effect of seawater
CO2 concentration on growth of a natural phytoplankton assemblage in a controlled
mesocosm experiment. Limnol Oceanogr 51: 1629-1636.
Kimball B, Morris C, Pinter P, Wall G, Hunsaker D, Adamsen F, LaMorte R, Leavitt S,
Thompson T, Matthias A. (2001) Elevated CO2, drought and soil nitrogen effects on
wheat grain quality. New Phytol 150: 295-303.
Kinsman E, Lewis C, Davies M, Young J, Francis D, Vilhar B, Ougham H. (1997) Elevated CO2
stimulates cells to divide in grass meristems: a differential effect in two natural
populations of Dactylis glomerata. Plant Cell Environ 20: 1309-1316.
Kontunen-Soppela S, Parviainen J, Ruhanen H, Brosche M, Keinänen M, Thakur RC,
Kolehmainen M, Kangasjärvi J, Oksanen E, Karnosky DF. (2010) Gene expression
responses of paper birch (Betula papyrifera) to elevated CO2 and O3 during leaf
maturation and senescence. Environ Pollut 158: 959-968.
Lam H, Coschigano K, Oliveira I, Melo-Oliveira R, Coruzzi G. (1996) The molecular-genetics of
nitrogen assimilation into amino acids in higher plants. Annu Rev Plant Physiol Plant
Mol Biol 47: 569-593.
99 Bibliografía
Larios B, Agüera E, de la Haba P, Pérez-Vicente R, Maldonado JM. (2001) A short-term
exposure of cucumber plants to rising atmospheric CO2 increases leaf carbohydrate
content and enhances nitrate reductase expression and activity. Planta 212: 305-312.
Laurière C, Daussant J. (1983) Identification of the ammonium-‐‑dependent isoenzyme of
glutamate dehydrogenase as the form induced by senescence or darkness stress in the first
leaf of wheat. Physiol Plant 58: 89-92.
Lea PJ, Miflin BJ. (2003) Glutamate synthase and the synthesis of glutamate in plants. Plant
Physiol Biochem 41: 555-564.
Leakey AD, Ainsworth EA, Bernacchi CJ, Rogers A, Long SP, Ort DR. (2009) Elevated CO2
effects on plant carbon, nitrogen, and water relations: six important lessons from FACE. J
Exp Bot 60: 2859-2876.
Lee R, Chen SG. (2002) Programmed cell death during rice leaf senescence is nonapoptotic. New
Phytol 155: 25-32.
Lehmann T, Ratajczak L. (2008) The pivotal role of glutamate dehydrogenase (GDH) in the
mobilization of N and C from storage material to asparagine in germinating seeds of
yellow lupine. J Plant Physiol 165: 149-158.
Li Q, Zheng Q, Shen W, Cram D, Fowler DB, Wei Y, Zou J. (2015) Understanding the
biochemical basis of temperature-induced lipid pathway adjustments in plants. Plant Cell
27: 86-103.
Li WD, Hu X, Liu JK, Jiang GM, Li O, Xing D. (2011) Chromosome doubling can increase heat
tolerance in Lonicera japonica as indicated by chlorophyll fluorescence imaging. Biol
Plant 55: 279-284.
Lichtenthaler HK. (2007) Biosynthesis, accumulation and emission of carotenoids, α-tocopherol,
plastoquinone, and isoprene in leaves under high photosynthetic irradiance. Photosynth
Res 92: 163-179.
Lim PO, Woo HR, Nam HG. (2003) Molecular genetics of leaf senescence in Arabidopsis.
Trends Plant Sci 8: 272-278.
Lim PO, Kim HJ, Gil Nam H. (2007) Leaf senescence. Annu Rev Plant Biol 58: 115-136.
Logan BA, Kornyeyev D, Hardison J, Holaday AS. (2006) The role of antioxidant enzymes in
photoprotection. Photosynth Res 88: 119-132.
100 Bibliografía
Long SP, Ainsworth EA, Rogers A, Ort DR. (2004) Rising atmospheric carbon dioxide: plants
FACE the future. Annu Rev Plant Biol 55: 591-628.
Long SP, Zhu XG, Naidu SL, Ort DR. (2006) Can improvement in photosynthesis increase crop
yields? Plant Cell Environ 29: 315-330.
Maldonado JM, Agüera E, Pérez R. (2000) Asimilación del nitrógeno y del azufre. In: AzcónBieto J, Talón M, eds. Fundamentos de Fisiología Vegetal S.A. Madrid Mcgraw-hill /
Interamericana de España, pp. 235-246.
Mani D, Sharma B, Kumar C. (2007) Phytoaccumulation, interaction, toxicity and remediation of
cadmium from Helianthus annuus L. (sunflower). Bull Environ Contam Toxicol 79: 7179.
Mariscal V, Moulin P, Orsel M, Miller AJ, Fernández E, Galván A. (2006) Differential
regulation of the Chlamydomonas Nar1 gene family by carbon and nitrogen. Protist 157:
421-433.
Martinelli T, Whittaker A, Bochicchio A, Vazzana C, Suzuki A, Masclaux-Daubresse C. (2007)
Amino acid pattern and glutamate metabolism during dehydration stress in the
'resurrection' plant Sporobolus stapfianus: a comparison between desiccation-sensitive
and desiccation-tolerant leaves. J Exp Bot 58: 3037-3046.
Martínez DE, Costa ML, Guiamet JJ. (2008) Senescence-‐‑associated degradation of chloroplast
proteins inside and outside the organelle. Plant Biology 10: 15-22.
Masclaux C, Valadier MH, Brugière N, Morot-Gaudry JF, Hirel B. (2000) Characterization of
the sink/source transition in tobacco (Nicotiana tabacum L.) shoots in relation to nitrogen
management and leaf senescence. Planta 211: 510-518.
Masclaux-Daubresse C, Carrayol E, Valadier MH. (2005) The two nitrogen mobilisation-and
senescence-associated GS1 and GDH genes are controlled by C and N metabolites. Planta
221: 580-588.
McNally S, Hirel B. (1983) Glutamine synthetase isoforms in higher plants. Physiologie
Végétale 21: 761-774.
Melis A. (1999) Photosystem-II damage and repair cycle in chloroplasts: what modulates the rate
of photodamage in vivo? Trends Plant Sci 4: 130-135.
101 Bibliografía
Melo-Oliveira R, Oliveira IC, Coruzzi GM. (1996) Arabidopsis mutant analysis and gene
regulation define a nonredundant role for glutamate dehydrogenase in nitrogen
assimilation. Proc Natl Acad Sci 93: 4718-4723.
Miflin BJ, Habash DZ. (2002) The role of glutamine synthetase and glutamate dehydrogenase in
nitrogen assimilation and possibilities for improvement in the nitrogen utilization of
crops. J Exp Bot 53: 979-987.
Mishra RK, Singhal GS. (1992) Function of photosynthetic apparatus of intact wheat leaves
under high light and heat stress and its relationship with peroxidation of thylakoid lipids.
Plant Physiol 98: 1-6.
Mittler R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405-410.
Mohammed AR, Tarpley L. (2010) Effects of high night temperature and spikelet position on
yield-related parameters of rice (Oryza sativa L.) plants. Eur J Agron 33: 117-123.
Morison JIL. (1998) Stomatal response to increased CO2 concentration. J Exp Bot 49: 443-452.
Murata N, Takahashi S, Nishiyama Y, Allakhverdiev SI. (2007) Photoinhibition of photosystem
II under environmental stress. Biochim Biophys Acta 1767: 414-421.
Nam HG. (1997) The molecular genetic analysis of leaf senescence. Curr Opin Biotechnol 8:
200-207.
Nishimura C, Ohashi Y, Sato S, Kato T, Tabata S, Ueguchi C. (2004) Histidine kinase homologs
that act as cytokinin receptors possess overlapping functions in the regulation of shoot
and root growth in Arabidopsis. Plant Cell 16: 1365-1377.
Noodén LD, Guiamét JJ, John I. (1997) Senescence mechanisms. Physiol Plant 101: 746-753.
Oliveira IC, Coruzzi GM. (1999) Carbon and amino acids reciprocally modulate the expression
of glutamine synthetase in Arabidopsis. Plant Physiol 121: 301-310.
Ono K, Nishi Y, Watanabe A, Terashima I. (2001) Possible mechanisms of adaptive leaf
senescence. Plant Biol 3: 234-243.
Ougham H, Hörtensteiner S, Armstead I, Donnison I, King I, Thomas H, Mur L. (2008) The
control of chlorophyll catabolism and the status of yellowing as a biomarker of leaf
senescence. Plant Biol 10: 4-14.
Pageau K, Reisdorf-Cren M, Morot-Gaudry JF, Masclaux-Daubresse C. (2006) The two
senescence-related markers, GS1 (cytosolic glutamine synthetase) and GDH (glutamate
102 Bibliografía
dehydrogenase), involved in nitrogen mobilization, are differentially regulated during
pathogen attack and by stress hormones and reactive oxygen species in Nicotiana
tabacum L. leaves. J Exp Bot 57: 547-557.
Polle A. (2001) Dissecting the superoxide dismutase-ascorbate-glutathione-pathway in
chloroplasts by metabolic modeling. Computer simulations as a step towards flux
analysis. Plant Physiol 126: 445-462.
Pompelli MF, Martins SCV, Antunes WC, Chaves ARM, DaMatta FM. (2010) Photosynthesis
and photoprotection in coffee leaves is affected by nitrogen and light availabilities in
winter conditions. J Plant Physiol 167: 1052-1060.
Prášil O, Adir N, Ohad I. (1992) Dynamic of PSII: Mechanism of photoinhibition and recovery
process. In: Baber J, ed. The photosystems: structures, function and molecular biology.
Amsterdam, Elsevier, pp. 295-348.
Pritchard SG, Ju Z, van Santen E, Qiu J, Weaver DB, Prior SA, Rogers HH. (2000) The influence
of elevated CO2 on the activities of antioxidative enzymes in two soybean genotypes.
Aust J Plant Physiol 27: 1061-1068.
Procházková D, Wilhelmova N. (2007) Leaf senescence and activities of the antioxidant
enzymes. Biol Plant 51: 401-406.
Purnell MP, Botella JR. (2007) Tobacco isoenzyme 1 of NAD(H)-dependent glutamate
dehydrogenase catabolizes glutamate in vivo. Plant Physiol 143: 530-539.
Putt ED. (1997) Early history of sunflower. In: Schneiter AA, ed. Agronomy series 35. Madison,
American Society of Agronomy, pp. 1-19.
Qiu QS, Huber JL, Booker FL, Jain V, Leakey ADB, Fiscus EL, Yau PM, Ort DR, Huber SC.
(2008) Increased protein carbonylation in leaves of Arabidopsis and soybean in response
to elevated [CO2]. Photosynthesis Res 97: 155-166.
Quesada A, Gómez-García I, Fernández E. (2000) Involvement of chloroplast and mitochondria
redox valves in nitrate assimilation. Trends Plant Sci 5: 463-464.
Quirino BF, Noh YS, Himelblau E, Amasino RM. (2000) Molecular aspects of leaf senescence.
103 Bibliografía
Radochová B, Tichá I. (2008) Excess irradiance causes early symptoms of senescence during leaf
expansion in photoautotrophically in vitro grown tobacco plants. Photosynthetica 46:
471-475.
Reich PB, Hungate BA, Luo YQ. (2006) Carbon-nitrogen interactions in terrestrial ecosystems in
response to rising atmospheric carbon dioxide. Annu Rev Ecol, Evol Syst 37: 611-636.
Riikonen J, Kets K, Darbah J, Oksanen E, Sober A, Vapaavuori E, Kubiske ME, Nelson N,
Karnosky DF. (2008) Carbon gain and bud physiology in Populus tremuloides and Betula
papyrifera grown under long-term exposure to elevated concentrations of CO2 and O3.
Tree Physiol 28: 243-254.
Riikonen J, Percy KE, Kivimäenpää M, Kubiske ME, Nelson ND, Vapaavuori E, Karnosky DF.
(2010) Leaf size and surface characteristics of Betula papyrifera exposed to elevated CO2
and O3. Environ Pollut 158: 1029-1035.
Rogers A, Allen D, Davey P, Morgan P, Ainsworth E, Bernacchi C, Cornic G, Dermody O,
Dohleman F, Heaton E. (2004) Leaf photosynthesis and carbohydrate dynamics of
soybeans grown throughout their life-‐‑cycle under free-‐‑air carbon dioxide enrichment.
Plant Cell Environ 27: 449-458.
Salvucci ME, Crafts-‐‑Brandner SJ. (2004) Inhibition of photosynthesis by heat stress: the
activation state of rubisco as a limiting factor in photosynthesis. Physiol Plant 120: 179186.
Sanz-Sáez Á, Erice G, Aranjuelo I, Nogués S, Irigoyen JJ, Sánchez-Díaz M. (2010)
Photosynthetic down-regulation under elevated CO2 exposure can be prevented by
nitrogen supply in nodulated alfalfa. J Plant Physiol 167: 1558-1565.
Schansker G, van Rensen JJ. (1999) Performance of active photosystem II centers in
photoinhibited pea leaves. Photosynth Res 62: 175-184.
Scheurwater I, Dunnebacke M, Eising R, Lambers H. (2000) Respiratory costs and rate of protein
turnover in the roots of a fast-growing (Dactylis glomerata L.) and a slow-growing
(Festuca ovina L.) grass species. J Exp Bot 51: 1089-1097.
Schippers JH, Schmidt R, Wagstaff C, Jing HC. (2015) Living to die and dying to live: the
survival strategy behind leaf senescence. Plant Physiol 169: 914-930.
104 Bibliografía
Schrader SM, Wise RR, Wacholtz WF, Ort DR, Sharkey TD. (2004) Thylakoid membrane
responses to moderately high leaf temperature in Pima cotton. Plant Cell Environ 27:
725-735.
Schneider SH. (1989) The greenhouse effect: science and policy. Science 243: 771-781.
Semenova G. (2004) Structural reorganization of thylakoid systems in response to heat treatment.
Photosynthetica 42: 521-527.
Srivalli B, Khanna-Chopra R. (2004) The developing reproductive ‘sink’ induces oxidative stress
to mediate nitrogen mobilization during monocarpic senescence in wheat. Biochem
Biophys Res Commun 325: 198-202.
Srivalli B, Khanna-Chopra R. (2009) Delayed wheat flag leaf senescence due to removal of
spikelets is associated with increased activities of leaf antioxidant enzymes, reduced
glutathione/oxidized glutathione ratio and oxidative damage to mitochondrial proteins.
Plant Physiol Biochem 47: 663-670.
Srivastava S, Pathak AD, Gupta PS, Shrivastava AK, Srivastava AK. (2012) Hydrogen peroxidescavenging enzymes impart tolerance to high temperature induced oxidative stress in
sugarcane. Biol J Environ 33: 656-661.
Stitt M, Krapp A. (1999) The interaction between elevated carbon dioxide and nitrogen nutrition:
the physiological and molecular background. Plant Cell Environ 22: 583-621.
Swarbreck SM, Defoin-Platel M, Hindle M, Saqi M, Habash DZ. (2011) New perspectives on
glutamine synthetase in grasses. J Exp Bot 62: 1511-1522.
Taiz L, Zeiger E. (2010) Plant physiology fith edition. Sunderland, Massachusetts. VSA. Sinauer
Associates, Inc., Publisher.
Takahashi S, Murata N. (2008) How do environmental stresses accelerate photoinhibition?
Taylor KE, MacCracken MC. (1990) Projected effects of increasing concentrations of carbon
dioxide and trace gases on climate. In: Kimball BA, ed. Impact of carbon dioxide, trace
gases, and climate change on global agriculture. Madison, American Society of
Agronomy, Crop Science Society of America, and Soil Science Society of America, pp.
1-17.
105 Bibliografía
Templer PH, Pinder RW, Goodale CL. (2012) Effects of nitrogen deposition on greenhouse-gas
fluxes for forests and grasslands of North America. Front Ecol Environ 10: 547-553.
Tsukaya H. (2006) Mechanism of leaf-shape determination. Annu Rev Plant Biol 57: 477-496.
Vanacker H, Sandalio LM, Jimenez A, Palma JM, Corpas FJ, Meseguer V, Gomez M, Sevilla F,
Leterrier M, Foyer CH, del Rio LA. (2006) Roles for redox regulation in leaf senescence
of pea plants grown on different sources of nitrogen nutrition. J Exp Bot 57: 1735-1745.
Wallsgrove RM, Turner JC, Hall NP, Kendall AC, Bright SW. (1987) Barley mutants lacking
chloroplast glutamine synthetase-biochemical and genetic analysis. Plant Physiol 83: 155158
Wang J, Cui L, Wang Y, Li J. (2009) Growth, lipid peroxidation and photosynthesis in two tall
fescue cultivars differing in heat tolerance. Biol Plant 53: 237-242.
Wiedemuth K, Müller J, Kahlau A, Amme S, Mock H, Grzam A, Hell R, Egle K, Beschow H,
Humbeck K. (2005) Successive maturation and senescence of individual leaves during
barley whole plant ontogeny reveals temporal and spatial regulation of photosynthetic
function in conjunction with C and N metabolism. J Plant Physiol 162: 1226-1236.
Wingler A, Marès M, Pourtau N. (2004) Spatial patterns and metabolic regulation of
photosynthetic parameters during leaf senescence. New Phytol 161: 781-789.
Wingler A, Purdy S, MacLean JA, Pourtau N. (2006) The role of sugars in integrating
environmental signals during the regulation of leaf senescence. J Exp Bot 57: 391-399.
Wingler A, Roitsch T. (2008) Metabolic regulation of leaf senescence: interactions of sugar
signalling with biotic and abiotic stress responses. Plant Biol 10: 50-62.
Wingler A, Masclaux-Daubresse C, Fischer AM. (2009) Sugars, senescence, and ageing in plants
and heterotrophic organisms. J Exp Bot 60: 1063-1066.
Wollenweber B, Porter J, Schellberg J. (2003) Lack of Interaction between extreme high-‐‑
temperature events at vegetative and reproductive growth stages in wheat. J Agr Crop Sci
189: 142-150.
Xu S, Li J, Zhang X, Wei H, Cui L. (2006) Effects of heat acclimation pretreatment on changes
of membrane lipid peroxidation, antioxidant metabolites, and ultrastructure of
chloroplasts in two cool-season turfgrass species under heat stress. Environ Exp Bot 56:
274-285.
106 Bibliografía
Xue W, Li XY, Zhu JT, Lin LS. (2012) Effects of temperature and irradiance on photosystem
activity during Alhagi sparsifolia leaf senescence. Biol Plant 56: 785-788.
Zapata JM, Guera A, Esteban-Carrasco A, Martin M, Sabater B. (2005) Chloroplasts regulate
leaf senescence: delayed senescence in transgenic ndhF-defective tobacco. Cell Death
Differ 12: 1277-1284.
Zhang J, Li DM, Gao Y, Yu B, Xia C, Bai J. (2012) Pretreatment with 5-aminolevulinic acid
mitigates heat stress of cucumber leaves. Biol Plant 56: 780-784.
Zhu C, Zhu J, Zeng Q, Liu G, Xie Z, Tang H, Cao J, Zhao X. (2009) Elevated CO2 accelerates
flag leaf senescence in wheat due to ear photosynthesis which causes greater ear nitrogen
sink capacity and ear carbon sink limitation. Funct Plant Biol 36: 291-299.
Zozaya-Hinchliffe M, Potenza C, Ortega JL, Sengupta-Gopalan C. (2005) Nitrogen and
metabolic regulation of the expression of plastidic glutamine synthetase in alfalfa
(Medicago sativa). Plant Sci 168: 1041-1052.
Zulfugarov IS, Tovuu A, Kim J, Lee C. (2011) Detection of reactive oxygen species in higher
plants. J Plant Biol 54: 351-357.
107

Efecto de factores ambientales sobre la regulación del desarrollo de

Transcription

Similar documents

Meeting Agenda - Kubiak Research Group

metal leaf - Campbell`s Art Class

Pedro Fernández began his international career when he was

Cassia fistula (Golden

Headings Vocabulry Important Info

green highway for economic and environmental

VIEW HOW IT`S MADE

FLAAR Reports - Wide-Format

Science Day CO2 Dragster Introduction

Rose leaf rag